Patent application title: Families of Non-Cross-Hybridizing Polynucleotides for Use as Tags and Tag Complements, Manufacture and Use Thereof
Inventors:
Daniel Kobler (Ontario, CA)
Daniel Fieldhouse (Bolton, CA)
IPC8 Class: AC07H2100FI
USPC Class:
536 231
Class name: Nitrogen containing n-glycosides, polymers thereof, metal derivatives (e.g., nucleic acids, oligonucleotides, etc.) dna or rna fragments or modified forms thereof (e.g., genes, etc.)
Publication date: 2010-12-09
Patent application number: 20100311957
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: Families of Non-Cross-Hybridizing Polynucleotides for Use as Tags and Tag Complements, Manufacture and Use Thereof
Inventors:
Daniel Kobler
Daniel Fieldhouse
Agents:
GOODWIN PROCTER LLP;PATENT ADMINISTRATOR
Assignees:
Origin: BOSTON, MA US
IPC8 Class: AC07H2100FI
USPC Class:
Publication date: 12/09/2010
Patent application number: 20100311957
Abstract:
A family of minimally cross-hybridizing nucleotide sequences, methods of
use, etc. A specific family of 1168 24mers is described.Claims:
1.-95. (canceled)
96. A composition comprising a set of minimally cross-hybridizing oligonucleotide tags or tag complements, each tag or tag complement in the composition either being free of cytosine residues and comprising guanosine residues or being free of guanosine residues and comprising cytosine residues,wherein for each tag or tag complement that comprises cytosine residues, the cytosine residues are separated by between one and six non-cytosine residues, and for each tag or tag complement that comprises guanosine residues, the guanosine residues are separated by between one and six non-guanosine residues,wherein the number of cytosine and guanosine residues present in each tag or tag complement in the composition does not exceed L/4 where L is the number of bases in the oligonucleotide,wherein the length of each tag or tag complement in the composition differs by no more than five bases from the average length of all tags or tag complements in the composition,wherein each tag or tag complement in the composition contains no more than 4 contiguous identical nucleotides,wherein the number of guanosine and cytosine residues present in each tag or tag complement in the composition does not vary from the average number of guanosine and cytosine residues present in all other tags or tag complements of the composition by more than one, andwhen each tag or tag complement of the composition is exposed to hybridization conditions comprising 0.2M NaCl, 0.1M Tris, 0.08% Triton X-100, pH 8.0 at 37.degree. C., the degree of cross-hybridization between the tag or tag complement and an oligonucleotide of the set that is not fully complementary to the tag or tag complement does not exceed 30% of the degree of hybridization between the tag or tag complement and a fully complementary oligonucleotide to said tag or tag complement.
97. The composition of claim 96, further characterized in that, each tag or tag complement in the composition contains either a cytosine or guanosine residue located within seven residues of an end of the tag or tag complement.
98. The composition of claim 96, wherein the length of each tag or tag complement in the composition is identical.
99. The composition of claim 98, wherein the number of guanosine and cytosine residues present in each tag or tag complement is the same.
100. The composition of claim 96, wherein the tags or tag complements are attached to a solid phase support.
101. The composition of claim 100, wherein the support is a planar substrate comprising a plurality of spatially addressable regions.
102. The composition of claim 96, wherein the tags or tag complements are covalently linked to microparticles.
103. The composition of claim 102, wherein the microparticles are spectrophotometrically unique and each unique microparticle has a different tag or tag complement attached thereto.
104. The composition of claim 96, wherein the degree of cross-hybridization between a said oligonucleotide and any complement of a different oligonucleotide of the composition does not exceed 10% of the degree of hybridization between said oligonucleotide and a complement to said oligonucleotide.
105. The composition of claim 96, wherein each oligonucleotide of the set is at least ten nucleotides in length.
106. A composition comprising minimally cross-hybridizing molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide comprising a sequence of ten to fifty nucleotide bases in length and for which, under a single set of hybridization conditions, the degree of cross-hybridization between a said oligonucleotide and any complement of a different oligonucleotide does not exceed about 20% of the degree of hybridization between said oligonucleotide and a complement to said oligonucleotide, and wherein each sequence is free of cytosine residues and comprises guanosine residues and, for each sequence, the number of guanosine residues does not exceed L/4 where L is the number of bases in said sequence.
107. The composition of claim 106, wherein each said sequence is of the same length as every other said sequence.
108. The composition of claim 107, wherein each said sequence is twenty-four bases in length.
109. The composition of claim 106, wherein the number of guanosine residues in each said sequence does not vary from the average number of guanosine residues in all of the sequences of the set by more than one.
110. The composition of claim 109, wherein each said sequence is twenty-four bases in length and each said sequence contains six guanosine residues.
111. The composition of claim 106, wherein at the 5'-end of each said sequence at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence is a guanosine residue.
112. The composition of claim 106, wherein at the 3'-end of each said sequence at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence is a guanosine residue.
113. The composition of claim 111, wherein at the 3'-end of each said sequence at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence is a guanosine residue.
114. A composition of claim 106, wherein each said molecule is linked to a solid phase support so as to be distinguishable from a mixture of other said molecules by hybridization to its complement.
115. The composition of claim 114, wherein each molecule is linked to a location on a said solid phase support that is different than the location for each other different said molecule.
116. The composition of claim 115, wherein each said solid phase support is a microparticle and each said molecule is covalently linked to a different microparticle than each other different said molecule.
117. A composition comprising minimally cross-hybridizing molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide comprising a sequence of ten to fifty nucleotide bases in length and for which, under a single set of hybridization conditions, the degree of cross-hybridization between a said oligonucleotide and any complement of a different oligonucleotide does not exceed about 20% of the degree of hybridization between said oligonucleotide and a complement to said oligonucleotide, and wherein each sequence is free of guanosine residues and comprises cytosine residues and, for each sequence, the number of cytosine residues does not exceed L/4 where L is the number of bases in said sequence.
118. The composition of claim 117, wherein each said sequence is of the same length as every other said sequence.
119. The composition of claim 118, wherein each said sequence is twenty-four bases in length.
120. The composition of claim 117, wherein the number of cytosine residues in each said sequence does not vary from the average number of cytosine residues in all of the sequences of the set by more than one.
121. The composition of claim 120, wherein each said sequence is twenty-four bases in length and each said sequence contains six cytosine residues.
122. The composition of claim 117, wherein at the 5'-end of each said sequence at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence is a cytosine residue.
123. The composition of claim 117, wherein at the 3'-end of each said sequence at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence is a cytosine residue.
124. The composition of claim 122, wherein at the 3'-end of each said sequence at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence is a cytosine residue.
125. A composition of claim 117, wherein each said molecule is linked to a solid phase support so as to be distinguishable from a mixture of other said molecules by hybridization to its complement.
126. The composition of claim 125, wherein each molecule is linked to a location on a said solid phase support that is different than the location for each other different said molecule.
127. The composition of claim 126, wherein each said solid phase support is a microparticle and each said molecule is covalently linked to a different microparticle than each other different said molecule.
Description:
FIELD OF THE INVENTION
[0001]This invention relates to families of oligonucleotide tags for use, for example, in sorting molecules. Members of a given family of tags can be distinguished one from the other by specific hybridization to their tag complements.
BACKGROUND OF THE INVENTION
[0002]Specific hybridization of oligonucleotides and their analogs is a fundamental process that is employed in a wide variety of research, medical, and industrial applications, including the identification of disease-related polynucleotides in diagnostic assays, screening for clones of novel target polynucleotides, identification of specific polynucleotides in blots of mixtures of polynucleotides, therapeutic blocking of inappropriately expressed genes and DNA sequencing. Sequence specific hybridization is critical in the development of high throughput multiplexed nucleic acid assays. As formats for these assays expand to encompass larger amounts of sequence information acquired through projects such as the Human Genome project, the challenge of sequence specific hybridization with high fidelity is becoming increasingly difficult to achieve.
[0003]In large part, the success of hybridization using oligonucleotides depends on minimizing the number of false positives and false negatives. Such problems have made the simultaneous use of multiple hybridization probes in a single experiment i.e. multiplexing, particularly in the analysis of multiple gene sequences on a gene microarray, very difficult. For example, in certain binding assays, a number of nucleic acid molecules are bound to a chip with the desire that a given "target" sequence will bind selectively to its complement attached to the chip. Approaches have been developed that involve the use of oligonucleotide tags attached to a solid support that can be used to specifically hybridize to the tag complements that are coupled to probe sequences. Chetverin et al. (WO 93/17126) uses sectioned, binary oligonucleotide arrays to sort and survey nucleic acids. These arrays have a constant nucleotide sequence attached to an adjacent variable nucleotide sequence, both bound to a solid support by a covalent linking moiety. These binary arrays have advantages compared with ordinary arrays in that they can be used to sort strands according to their terminal sequences so that each strand binds to a fixed location on an array. The design of the terminal sequences in this approach comprises the use of constant and variable sequences. U.S. Pat. Nos. 6,103,463 and 6,322,971 issued to Chetverin et al. on Aug. 15, 2000 and Nov. 27, 2001, respectively.
[0004]This concept of using molecular tags to sort a mixture of molecules is analogous to molecular tags developed for bacterial and yeast genetics (Hensel et al., Science; 269, 400-403: 1995 and Schoemaker et al., Nature Genetics; 14, 450-456: 1996). Here, a method termed "signature tagged" mutagenesis in which each mutant is tagged with a different DNA sequence is used to recover mutant genes from a complex mixture of approximately 10,000 bacterial colonies. In the tagging approach of Barany et al. (WO 9731256), known as the "zip chip", a family of nucleic acid molecules, the "zip-code addresses", each different from each other, are set out on a grid. Target molecules are attached to oligonucleotide sequences complementary to the "zipcode addresses," referred to as "zipcodes," which are used to specifically hybridize to the address locations on the grid. While the selection of these families of polynucleotide sequences used as addresses is critical for correct performance of the assay, the performance has not been described.
[0005]Working in a highly parallel hybridization environment requiring specific hybridization imposes very rigorous selection criteria for the design of families of oligonucleotides that are to be used. The success of these approaches is dependent on the specific hybridization of a probe and its complement. Problems arise as the family of nucleic acid molecules cross-hybridize or hybridize incorrectly to the target sequences. While it is common to obtain incorrect hybridization resulting in false positives or an inability to form hybrids resulting in false negatives, the frequency of such results must be minimized. In order to achieve this goal certain thermodynamic properties of forming nucleic acid hybrids must be considered. The temperature at which oligonucleotides form duplexes with their complementary sequences known as the Tm (the temperature at which 50% of the nucleic acid duplex is dissociated) varies according to a number of sequence dependent properties including the hydrogen bonding energies of the canonical pairs A-T and G-C (reflected in GC or base composition), stacking free energy and, to a lesser extent, nearest neighbour interactions. These energies vary widely among oligonucleotides that are typically used in hybridization assays. For example, hybridization of two probe sequences composed of 24 nucleotides, one with a 40% GC content and the other with a 60% GC content, with its complementary target under standard conditions theoretically may have a 10° C. difference in melting temperature (Mueller et al., Current Protocols in Mol. Biol.; 15, 5:1993). Problems in hybridization occur when the hybrids are allowed to form under hybridization conditions that include a single hybridization temperature that is not optimal for correct hybridization of all oligonucleotide sequences of a set. Mismatch hybridization of non-complementary probes can occur forming duplexes with measurable mismatch stability (Santalucia et al., Biochemistry; 38: 3468-77, 1999). Mismatching of duplexes in a particular set of oligonucleotides can occur under hybridization conditions where the mismatch results in a decrease in duplex stability that results in a higher Tm than the least stable correct duplex of that particular set. For example, if hybridization is carried out under conditions that favor the AT-rich perfect match duplex sequence, the possibility exists for hybridizing a GC-rich duplex sequence that contains a mismatched base having a melting temperature that is still above the correctly formed AT-rich duplex. Therefore, design of families of oligonucleotide sequences that can be used in multiplexed hybridization reactions must include consideration for the thermodynamic properties of oligonucleotides and duplex formation that will reduce or eliminate cross hybridization behavior within the designed oligonucleotide set.
[0006]The development of such families of tags has been attempted over the years with varying degrees of success. There are a number of different approaches for selecting sequences for use in multiplexed hybridization assays. The selection of sequences that can be used as zipcodes or tags in an addressable array has been described in the patent literature in an approach taken by Brenner and co-workers. U.S. Pat. No. 5,654,413 describes a population of oligonucleotide tags (and corresponding tag complements) in which each oligonucleotide tag includes a plurality of subunits, each subunit consisting of an oligonucleotide having a length of from three to six nucleotides and each subunit being selected from a minimally cross hybridizing set, wherein a subunit of the set would have at least two mismatches with any other sequence of the set. Table II of the Brenner patent specification describes exemplary groups of 4mer subunits that are minimally cross hybridizing according to the aforementioned criteria. In the approach taken by Brenner, constructing non cross-hybridizing oligonucleotides, relies on the use of subunits that form a duplex having at least two mismatches with the complement of any other subunit of the same set. The ordering of subunits in the construction of oligonucleotide tags is not specifically defined.
[0007]Parameters used in the design of tags based on subunits are discussed in Barany et al. (WO 9731256). For example, in the design of polynucleotide sequences that are for example 24 nucleotides in length (24mer) derived from a set of four possible tetramers in which each 24mer "address" differs from its nearest 24mer neighbour by 3 tetramers. They discuss further that, if each tetramer differs from each other by at least two nucleotides, then each 24mer will differ from the next by at least six nucleotides. This is determined without consideration for insertions or deletions when forming the alignment between any two sequences of the set. In this way a unique "zip code" sequence is generated. The zip code is ligated to a label in a target dependent manner, resulting in a unique "zip code" which is then allowed to hybridize to its address on the chip. To minimize cross-hybridization of a "zip code" to other "addresses", the hybridization reaction is carried out at temperatures of 75-80° C. Due to the high temperature conditions for hybridization, 24mers that have partial homology hybridize to a lesser extent than sequences with perfect complementarity and represent `dead zones`. This approach of implementing stringent hybridization conditions for example, involving high temperature hybridization, is also practiced by Brenner et. al.
[0008]The current state of technology for designing non-cross hybridizing tags based on subunits does not provide sufficient guidance to construct a family of relatively large numbers of sequences with practical value in assays that require stringent non-cross hybridizing behavior.
[0009]A multiplex sequencing method has been described in U.S. Pat. No. 4,942,124, which issued to Church on Jul. 17, 1990. The method requires at least two vectors which differ from each other at a tag sequence. It is stated that a tag sequence in one vector will not hybridize under stringent hybridization conditions to a tag sequence (i.e., complementary probes do not cross-hybridize) in another vector. Exemplary stringent hybridization conditions are given as 42° C. in 500-1000 mM sodium phosphate buffer. A set of 42 20-mer tag sequences, all of which lack G residues, is given in FIG. 3 of the specification. Details of how the sequences were obtained are not provided, although Church states that initially 92 were chosen on the basis of their having sufficient sequence diversity to insure uniqueness.
[0010]So while it is possible for a person knowledgeable in the field to design a small number of non-cross hybridizing tags, it is difficult to design a larger number such tags. A co-pending application of the owner of this patent application describes such a set of 210 non-cross hybridizing tags that have a practical value. A method described in international patent application No. PCT/CA 01/00141 published under WO 01/59151 on Aug. 16, 2001. Little guidance is provided, however, for the provision of a larger set, say 1000 or so, of non-cross hybridizing tags. Since having sets of approximately 1000 non-cross hybridizing tags, or more, would be of considerable practical value, it would be useful to develop such a set.
[0011]Thus, while it is desirable with such arrays to have, at once, a large number of address molecules, the address molecules should each be highly selective for its own complement sequence: While such an array provides the advantage that the family of molecules making up the grid is entirely of design, and does not rely on sequences as they occur in nature, the provision of a family of molecules, which is sufficiently large and where each individual member is sufficiently selective for its complement over all the other zipcode molecules (i.e., where there is sufficiently low cross-hybridization, or cross-talk) continues to elude researchers.
SUMMARY OF INVENTION
[0012]A family of 1168 sequences was obtained using a computer algorithm to have desirable hybridization properties for use in nucleic acid detection assays. The sequence set of 1168 oligonucleotides was partially characterized in hybridization assays, demonstrating the ability of family members to correctly hybridize to their complementary sequences with minimal cross hybridization. These are the sequences having SEQ ID NOs:1 to 1168 of Table I.
[0013]Variant families of sequences (seen as tags or tag complements) of a family of sequences taken from Table I are also part of the invention. For the purposes of discussion, a family or set of oligonucleotides will often be described as a family of tag complements, but it will be understood that such a set could just easily be a family of tags.
[0014]A family of complements is obtained from a set of oligonucleotides based on a family of oligonucleotides such as those of Table I. To simplify discussion, providing a family of complements based on the oligonucleotides of Table I will be described.
[0015]Firstly, the groups of sequences based on the oligonucleotides of Table I can be represented as shown in Table IA.
TABLE-US-00001 TABLE IA Numeric sequences corresponding to nucleotide base patterns of a set of oligonucleotides Sequence Numeric Pattern Identifier 1 1 1 2 2 3 2 3 1 1 1 3 1 2 2 3 2 2 2 3 2 3 2 1 1 3 2 2 1 3 1 3 2 2 1 1 2 2 3 2 1 2 2 2 3 1 2 3 1 2 1 2 3 2 2 1 1 1 3 2 1 1 3 2 3 2 2 3 1 1 1 2 3 2 3 2 3 1 2 3 2 2 1 3 1 1 3 2 1 2 1 2 2 3 2 3 1 1 2 4 2 2 2 3 2 3 2 1 3 1 1 2 1 2 3 2 3 2 2 3 2 2 1 1 5 1 2 1 1 3 2 3 2 1 1 3 2 3 1 1 1 2 1 1 3 1 1 3 1 6 1 1 3 1 3 2 1 2 2 2 3 2 2 3 2 3 1 3 2 2 1 1 1 2 7 3 2 3 2 2 2 1 2 3 2 2 1 2 1 2 3 2 3 1 1 3 2 2 2 8 1 1 1 3 1 3 1 1 2 1 3 1 1 2 1 2 3 2 3 2 1 1 3 2 9 2 1 2 3 1 1 1 3 1 3 2 3 1 3 1 2 1 1 2 3 2 2 2 1 10 1 2 3 1 3 1 1 1 2 1 2 3 2 2 1 3 1 1 2 3 2 3 1 2 11 2 2 1 3 2 2 3 2 2 3 1 2 3 2 2 2 1 3 2 1 3 2 2 2 12 3 2 1 1 1 3 1 3 2 1 2 1 1 3 2 2 2 3 1 2 3 1 2 1 13 1 1 1 3 2 1 1 3 1 1 2 3 1 2 3 2 1 1 2 1 1 3 2 3 14 3 2 1 3 1 1 1 2 1 3 2 2 2 1 2 2 3 1 2 3 1 2 2 3 15 2 3 2 1 1 3 2 3 1 1 1 2 1 3 2 3 1 3 2 2 1 2 2 2 16 1 1 1 2 1 3 1 2 3 1 2 1 2 1 1 3 2 3 1 3 1 1 2 3 17 1 2 1 1 3 2 2 1 2 1 1 3 2 3 2 2 1 2 3 2 3 1 3 2 18 2 1 2 1 3 1 2 1 1 1 3 1 3 1 2 3 1 2 2 2 3 2 2 3 19 1 3 1 3 2 2 3 1 3 1 1 2 3 2 1 2 1 3 2 1 2 2 1 2 20 1 1 3 2 1 3 2 2 2 3 2 1 1 3 1 1 2 3 1 2 2 3 2 1 21 2 2 1 2 3 1 1 1 2 2 3 1 3 2 3 1 1 3 1 2 2 3 1 2 22 3 2 1 2 1 2 3 2 1 1 1 2 2 3 2 2 1 2 3 2 2 3 1 3 23 3 1 1 2 2 3 2 1 2 1 1 1 3 2 1 2 2 1 3 1 2 3 2 3 24 2 1 3 1 2 3 1 3 1 2 2 1 1 3 2 3 2 2 1 2 2 2 3 1 25 3 2 2 1 1 3 2 2 2 3 2 2 2 1 2 3 2 1 2 1 3 1 1 3 26 3 1 3 2 1 2 2 1 3 2 1 1 1 3 2 3 1 2 1 2 3 1 2 1 27 3 2 3 1 1 2 3 1 2 2 2 1 3 2 1 1 1 2 3 1 2 2 3 1 28 3 1 2 2 3 1 1 3 2 2 1 2 1 3 1 1 1 2 3 1 2 2 1 3 29 1 3 2 3 1 2 1 1 1 2 3 2 2 1 3 2 2 3 1 1 2 2 3 2 30 2 1 2 1 2 1 3 2 1 1 1 2 3 2 2 2 3 2 3 2 3 2 2 3 31 2 2 1 1 3 2 3 2 2 1 3 2 2 1 2 2 2 3 2 2 3 2 1 3 32 3 2 1 3 2 1 1 2 1 2 3 1 1 3 2 3 1 3 1 1 2 1 2 1 33 2 1 3 2 3 2 1 2 1 3 1 1 2 3 2 1 3 1 2 2 2 1 3 2 34 2 2 3 2 1 3 1 2 2 1 3 1 2 3 2 3 2 2 2 3 2 1 1 1 35 2 1 3 2 1 2 1 3 1 3 2 1 3 1 3 1 2 3 1 2 1 2 2 2 36 1 2 2 3 2 3 1 1 1 3 1 1 1 3 1 3 1 1 3 1 1 1 2 2 37 2 3 2 3 1 3 1 1 2 2 1 1 3 1 2 2 1 1 3 1 1 2 3 2 38 1 2 1 2 2 1 3 2 2 1 1 3 1 1 1 3 1 1 3 1 3 2 2 3 39 2 2 3 2 1 3 2 2 3 1 3 1 1 1 2 1 2 3 2 1 3 2 2 2 40 2 1 3 1 3 2 2 3 2 2 1 1 1 3 1 3 2 3 2 1 1 1 2 1 41 3 2 2 1 2 3 1 2 3 2 3 2 1 2 1 1 3 2 1 1 2 1 2 3 42 2 2 2 3 2 2 1 3 1 1 2 3 1 3 1 1 3 1 2 2 2 1 2 3 43 1 3 2 1 2 1 3 2 2 2 1 1 1 3 1 1 3 2 1 3 2 1 3 1 44 3 2 3 1 3 1 2 1 2 1 3 1 2 2 2 1 3 1 1 1 3 2 1 1 45 2 2 3 2 2 2 1 2 1 3 2 3 1 1 3 2 3 1 1 2 1 3 2 1 46 1 1 3 2 1 1 3 2 1 3 2 1 1 2 1 3 2 3 2 3 2 2 1 1 47 1 2 2 2 3 2 3 1 3 2 2 1 2 3 1 1 1 3 1 2 1 1 3 1 48 3 1 1 1 3 2 1 3 1 3 1 1 2 1 1 1 3 1 2 1 1 3 1 1 49 1 2 2 2 1 1 3 1 2 2 3 2 2 1 1 3 1 3 2 1 3 1 1 3 50 3 2 2 2 1 1 1 3 1 2 2 3 2 1 1 3 1 1 2 3 2 3 2 1 51 2 2 2 3 2 3 1 1 3 1 2 3 1 1 3 2 1 2 2 2 3 2 1 2 52 2 3 2 3 2 2 2 1 3 1 1 2 2 2 1 3 2 1 2 3 2 3 2 1 53 3 1 2 1 1 2 3 1 2 2 1 2 1 3 1 1 1 3 2 3 2 2 2 3 54 3 2 2 1 2 2 2 3 2 1 1 3 2 2 1 1 3 1 2 1 3 2 1 3 55 1 3 2 2 2 1 2 2 3 1 1 1 3 1 3 2 2 2 3 1 1 2 1 3 56 2 2 3 2 3 2 2 2 1 2 2 3 2 3 2 1 3 2 2 2 1 1 1 3 57 1 2 2 3 2 3 1 3 1 1 3 1 2 1 2 3 1 1 1 3 2 2 1 2 58 2 3 1 3 1 1 2 3 2 1 1 1 3 1 1 2 3 2 2 2 1 2 2 3 59 1 2 3 2 3 1 1 1 3 2 2 1 2 3 1 2 3 2 2 1 1 2 2 3 60 3 2 2 2 1 3 2 1 2 2 1 3 2 2 3 2 2 1 1 3 1 2 2 3 61 3 1 2 2 3 1 2 1 2 2 2 3 1 1 2 3 2 2 2 3 2 2 2 3 62 2 3 1 1 2 2 3 1 1 1 3 2 3 2 1 1 2 3 2 2 3 2 1 2 63 3 1 2 2 3 2 1 2 2 3 2 2 3 1 3 1 1 2 1 3 1 1 2 1 64 1 1 1 2 2 2 3 1 3 1 2 2 2 3 2 3 1 2 1 3 1 3 2 1 65 3 2 1 1 2 2 1 3 1 2 2 2 3 2 2 2 3 2 2 3 2 2 3 2 66 3 2 2 2 3 2 1 2 2 3 2 2 1 3 2 3 1 1 2 1 2 1 3 2 67 1 2 3 2 1 3 2 1 3 2 1 3 1 2 3 2 2 2 1 2 3 1 1 2 68 2 3 2 2 2 1 1 1 3 1 2 3 1 2 2 3 1 1 3 1 1 1 2 3 69 2 3 2 3 1 2 1 1 2 3 1 2 3 2 2 1 2 2 2 3 2 3 2 1 70 1 2 1 3 2 2 3 2 3 1 3 1 1 2 2 2 3 2 1 1 2 2 1 3 71 1 2 1 3 1 2 3 2 1 1 3 1 3 1 1 1 2 2 3 2 3 1 1 1 72 1 3 1 2 2 1 1 3 1 3 1 1 3 2 2 1 1 2 1 3 1 3 2 1 73 3 1 1 3 2 1 1 1 2 2 3 2 3 1 1 2 3 1 1 1 3 1 1 1 74 1 1 2 3 2 1 1 3 1 1 1 3 1 1 3 1 2 2 3 2 2 3 2 1 75 2 2 2 3 1 2 2 2 1 2 3 2 3 2 2 1 2 3 2 2 3 1 3 2 76 3 2 1 2 2 3 1 3 1 1 1 2 2 2 3 1 1 3 1 1 2 3 1 1 77 3 1 1 2 2 3 2 1 2 3 1 1 1 2 3 1 1 2 2 3 2 1 1 3 78 2 1 2 2 3 2 1 3 1 1 3 2 1 1 1 3 2 2 1 3 1 1 3 2 79 2 2 2 1 2 3 2 1 1 2 3 1 2 1 1 3 2 3 2 1 3 2 2 3 80 1 2 1 2 1 3 2 2 3 1 1 1 2 2 3 2 3 1 2 1 3 2 3 2 81 1 2 1 1 3 1 1 1 2 2 1 3 1 3 1 3 2 2 3 2 1 1 1 3 82 3 1 1 2 2 3 2 3 1 1 1 2 3 2 3 1 2 2 3 1 2 1 2 1 83 1 1 1 2 1 1 3 2 1 3 2 2 2 1 1 2 3 1 3 1 3 1 1 3 84 3 1 2 2 1 1 1 3 1 1 3 2 1 1 3 2 3 1 1 2 3 2 2 2 85 2 1 2 3 2 3 2 3 2 2 3 2 2 2 1 3 2 3 2 2 1 2 2 1 86 3 1 3 2 2 1 2 1 2 3 2 1 3 2 2 1 3 1 3 2 2 1 2 1 87 3 1 1 1 3 1 1 1 3 1 1 3 2 3 2 2 1 1 3 2 2 1 1 1 88 2 1 3 2 1 2 2 1 3 2 1 1 3 2 1 2 3 2 3 1 2 2 3 2 89 2 2 3 2 3 2 3 1 2 2 3 1 1 2 1 2 2 3 2 3 1 1 1 2 90 1 2 3 2 3 1 1 1 3 1 3 2 2 1 1 3 2 3 1 2 2 1 1 1 91 3 1 2 2 3 1 1 2 3 1 2 2 3 1 3 1 2 1 2 3 2 1 1 1 92 1 1 3 1 2 3 1 2 1 3 2 2 1 1 3 2 3 2 1 1 3 2 2 1 93 2 1 3 2 2 3 2 2 1 2 2 3 1 3 1 1 2 2 2 1 3 1 1 3 94 2 2 2 1 2 1 3 2 3 1 1 2 2 1 2 3 1 3 2 3 1 1 1 3 95 3 1 2 1 3 1 2 2 2 1 3 1 1 2 3 1 1 2 2 1 1 3 2 3 96 2 2 2 3 1 1 3 1 1 3 1 3 1 2 2 2 3 1 1 1 2 2 3 1 97 1 2 3 1 1 2 1 1 3 1 3 2 2 3 1 2 1 1 1 2 3 2 3 1 98 2 3 2 2 2 1 2 3 2 1 3 2 3 2 1 3 1 2 2 3 1 1 2 2 99 2 2 2 1 1 3 2 3 1 3 2 2 1 2 1 3 1 1 3 2 1 3 2 1 100 3 1 2 2 2 1 2 3 2 3 2 2 2 3 1 1 3 2 2 1 1 3 1 2 101 2 1 3 2 2 1 3 1 3 1 1 1 3 2 3 1 2 1 1 1 3 2 2 1 102 3 2 1 1 2 3 1 2 1 1 2 3 1 1 3 2 3 2 1 2 1 2 1 3 103 1 1 2 3 1 1 3 2 3 2 2 1 3 2 1 2 1 3 1 2 1 3 2 1 104 2 1 1 1 2 2 3 1 3 2 2 2 3 2 2 2 3 1 2 2 3 2 1 3 105 2 1 1 2 3 1 1 3 1 1 2 1 1 3 2 1 2 3 1 3 2 3 2 2 106 1 1 1 2 3 2 1 1 2 1 3 2 3 2 2 3 2 2 1 3 2 2 1 3 107 1 3 1 3 2 2 1 3 2 3 1 1 1 2 3 2 2 3 2 2 1 1 1 2 108 3 1 1 1 2 1 3 1 1 1 2 3 2 1 2 2 3 2 2 2 3 2 3 1 109 1 3 2 2 1 2 1 1 3 2 2 2 3 2 3 1 3 1 1 2 2 1 1 3 110 3 1 3 2 2 2 1 2 1 3 2 2 1 3 1 1 2 1 2 3 2 2 3 2 111 1 3 1 3 2 2 1 2 2 1 3 1 1 3 1 1 3 1 2 2 2 1 1 3 112 3 1 3 2 2 1 1 2 3 1 1 1 2 1 1 3 2 1 2 2 2 3 2 3 113 1 2 3 1 2 3 1 1 2 1 3 2 2 3 1 1 3 2 1 2 1 2 1 3 114 1 2 1 3 1 2 1 2 3 1 3 1 2 3 1 1 1 3 2 2 1 3 2 1 115 2 1 2 3 2 1 1 1 3 1 1 1 3 2 3 1 1 1 3 1 1 3 1 1 116 2 3 1 1 2 3 2 1 3 1 1 1 2 3 1 1 2 3 2 2 3 1 1 1 117 1 1 2 2 3 1 1 2 1 3 2 3 2 3 2 3 1 3 2 2 2 1 1 2 118 1 3 1 2 1 2 2 3 2 2 2 3 1 2 2 1 1 2 3 1 1 3 1 3 119 1 1 1 3 2 2 3 2 1 1 1 3 2 2 3 1 1 3 1 2 1 1 1 3 120 3 2 2 1 1 3 1 3 1 2 2 1 2 3 1 3 1 2 3 2 1 2 2 1 121 1 3 1 1 3 1 2 1 2 1 1 3 1 1 3 1 2 2 3 1 1 2 2 3 122 3 2 1 3 1 1 1 2 2 2 3 1 1 2 2 3 1 2 3 2 3 1 1 1 123 1 1 3 1 3 2 1 3 1 2 2 3 1 2 1 1 3 2 1 2 1 2 3 1 124 2 3 1 2 1 2 1 3 2 1 3 2 3 1 1 3 1 1 1 2 1 1 3 2 125 1 3 1 2 1 1 2 3 1 2 3 1 3 1 1 1 2 3 1 1 3 1 2 1 126 1 2 3 2 3 1 1 1 3 2 1 2 2 2 3 2 3 1 2 1 2 1 3 2 127 1 1 2 1 1 3 1 3 1 1 2 2 3 1 2 1 2 3 1 1 3 1 2 3 128 2 1 1 3 2 3 2 1 2 2 2 1 3 2 1 3 1 1 2 3 1 1 3 2 129 2 1 2 3 2 2 1 3 1 2 2 2 3 2 2 3 1 3 1 2 2 3 1 2 130 1 3 2 2 2 3 2 1 2 3 1 1 3 1 3 1 2 1 3 2 1 2 2 2 131 3 1 3 1 1 1 2 3 2 2 1 2 3 2 1 2 2 2 1 3 2 1 3 2 132 2 1 2 3 2 3 1 3 1 1 2 3 2 3 2 2 2 3 1 2 2 2 1 1 133 3 2 1 2 3 2 2 2 3 2 2 2 1 2 1 3 1 1 2 3 2 1 2 3 134 3 1 3 2 1 2 1 2 1 3 1 1 3 1 1 1 3 1 1 1 2 2 2 3 135 1 2 3 1 3 2 3 1 1 3 2 1 1 1 2 3 2 1 3 2 2 1 2 2 136 2 2 1 1 3 1 1 3 2 3 1 3 2 2 1 2 2 3 2 3 1 2 1 2 137 1 2 3 1 1 1 2 3 1 3 1 1 2 1 2 2 3 2 2 3 2 2 2 3 138 3 1 2 2 1 1 2 3 1 2 2 1 2 3 2 3 1 1 2 2 3 1 2 3 139 3 1 1 1 2 3 2 2 1 1 1 3 1 2 1 2 3 1 1 1 3 2 1 3 140 2 1 2 2 3 2 2 3 1 2 2 2 3 1 2 1 2 2 1 3 2 3 2 3 141 2 2 2 1 2 3 2 2 2 3 2 3 2 1 2 3 2 1 1 3 2 1 3 2 142 1 1 2 2 3 1 1 1 3 1 1 2 2 3 2 3 2 3 1 1 2 2 3 1 143 2 3 1 3 2 2 2 3 1 1 2 2 2 3 2 2 2 3 1 3 2 1 1 2 144 3 1 2 3 2 1 2 1 1 2 3 1 2 3 2 3 2 3 2 1 1 1 2 2 145 1 2 3 2 3 1 3 1 3 1 1 3 1 1 2 2 2 3 2 2 2 1 2 2 146 3 2 3 1 2 1 1 1 3 2 1 2 2 3 2 2 3 1 2 1 3 1 1 1 147 3 1 1 3 2 1 3 1 1 2 1 3 1 1 1 3 2 2 1 1 2 1 3 1 148 2 2 3 2 3 2 1 3 2 2 1 1 3 1 3 2 2 3 2 2 2 1 1 2 149 2 1 3 2 1 3 2 1 1 3 2 2 3 2 2 1 3 1 1 2 1 3 2 2 150 1 1 2 2 2 3 1 1 3 2 1 2 1 1 2 3 1 1 2 3 2 3 2 3 151 2 1 3 1 1 1 2 2 3 2 1 3 2 1 2 2 2 3 1 3 1 3 1 1 152 2 3 2 1 2 1 2 3 2 2 1 1 2 3 1 3 1 2 3 2 2 3 2 1 153 2 1 2 2 2 3 1 2 1 1 3 1 3 1 1 2 3 1 1 3 1 1 3 2 154 2 2 3 1 1 2 1 3 2 3 2 1 1 2 3 1 1 2 1 2 3 1 2 3 155 3 2 1 3 2 2 2 3 2 3 1 1 2 1 3 1 1 2 2 1 3 2 2 2 156 1 1 1 3 1 2 3 1 2 2 3 2 1 1 2 2 2 3 2 3 2 3 1 1 157 3 1 1 3 1 2 2 3 2 2 3 1 3 2 2 1 1 2 1 3 1 2 1 1 158 1 3 1 2 2 1 2 3 2 1 3 2 3 1 2 3 2 1 1 1 2 3 2 2 159 3 1 1 2 2 2 1 3 1 2 3 2 1 3 1 2 1 2 3 1 1 2 3 2 160 3 1 2 1 3 1 1 3 2 3 2 1 2 2 1 1 3 2 1 1 3 2 2 1 161 2 1 2 3 1 1 2 2 1 2 3 1 3 1 1 3 1 1 2 1 3 1 3 2 162 2 2 2 3 2 2 1 2 3 1 1 3 2 3 1 2 2 2 3 2 2 2 3 2 163 3 2 1 1 1 3 1 2 2 3 2 3 2 2 1 2 1 2 3 1 1 1 2 3 164 2 2 3 2 3 1 2 1 3 2 1 3 2 2 1 3 1 2 1 2 2 2 3 2 165 3 1 1 2 2 1 1 3 1 2 1 1 1 3 1 1 3 1 3 1 1 3 2 1 166 3 1 2 2 3 2 1 3 1 1 2 3 1 1 2 2 2 3 2 1 3 2 1 2 167 1 1 1 2 1 1 3 1 3 1 3 1 3 1 1 2 3 1 2 2 2 1 3 2 168 1 1 2 2 1 2 3 2 3 1 1 2 1 3 1 2 2 3 2 2 3 1 1 3 169 2 2 1 1 3 1 2 2 2 1 2 3 2 3 1 2 1 3 2 1 3 1 3 2 170 2 2 1 1 1 3 1 2 1 3 2 3 2 2 2 3 2 2 3 2 3 2 2 1 171 2 1 2 2 3 1 2 2 2 1 2 3 1 1 3 1 3 2 1 2 1 3 2 3 172 1 1 1 2 2 2 3 1 2 3 1 3 2 1 3 2 2 2 1 1 3 1 3 1 173 1 2 1 1 1 3 2 2 3 2 2 2 3 1 2 3 2 2 2 3 1 1 2 3 174 3 1 2 2 3 2 3 1 2 3 1 1 2 1 1 2 3 2 2 1 2 2 3 1 175 3 1 2 3 1 1 3 1 1 1 2 1 2 3 1 2 1 2 3 1 1 2 1 3 176 2 2 1 1 1 3 2 2 1 2 2 3 1 1 3 2 3 1 1 3 2 2 3 1 177 2 2 3 2 1 1 3 1 1 1 2 1 3 1 3 1 2 2 2 3 2 3 2 2 178 3 1 3 1 2 2 3 1 3 2 2 2 1 1 3 2 1 2 2 1 3 1 2 2 179 1 3 2 3 1 2 1 1 2 1 3 1 1 2 3 1 2 1 1 1 2 3 2 3 180 3 1 2 1 1 2 1 3 2 3 1 1 2 2 2 3 1 3 2 2 3 2 1 2 181 1 3 1 2 1 2 2 2 3 2 1 3 2 1 3 1 1 1 3 2 1 2 3 2 182 3 2 2 1 2 3 1 1 2 3 2 2 3 1 1 2 2 2 3 1 1 2 3 2 183 1 2 3 1 1 1 3 1 2 2 2 1 3 2 2 3 2 3 1 3 1 2 1 2 184 1 1 1 2 1 3 1 3 1 1 3 2 2 1 2 3 1 2 3 2 3 1 2 1 185 2 2 1 3 2 3 1 3 1 1 1 2 3 2 2 2 1 1 2 3 2 3 1 2 186 2 3 1 1 3 1 1 2 1 2 3 2 3 1 1 1 2 2 1 3 2 2 2 3 187 3 2 2 2 3 1 2 1 3 2 2 2 1 1 2 3 1 3 2 1 2 2 3 1 188 3 2 2 3 2 1 1 3 2 1 1 2 3 1 2 1 1 1 3 2 1 2 3 1 189 2 1 1 3 1 3 2 1 3 2 1 1 2 2 3 2 2 3 2 2 2 1 3 1 190 2 2 2 3 1 3 1 3 1 3 2 1 2 3 2 1 2 3 1 2 2 1 2 2 191 1 2 2 3 1 2 2 3 2 3 1 1 2 2 1 3 1 2 1 3 1 1 3 1 192 3 1 2 2 1 3 2 1 2 2 2 1 3 2 1 3 2 1 1 2 1 3 1 3 193 2 1 2 3 2 1 2 2 1 3 1 3 1 2 1 2 2 3 1 1 1 3 2 3 194 2 1 2 3 2 3 1 1 1 3 2 1 1 2 3 1 2 1 1 1 2 3 1 3 195 3 2 1 1 2 2 1 3 2 1 1 2 3 1 2 2 2 3 1 1 2 3 1 3 196 3 2 2 2 1 2 2 3 2 1 1 1 3 1 2 3 2 1 1 3 2 3 1 1 197 2 1 3 2 1 3 1 1 2 2 3 2 2 3 2 2 1 1 1 3 1 1 2 3 198 2 1 2 2 3 2 2 1 3 2 2 1 2 3 2 1 3 2 3 2 3 2 1 1 199 3 1 3 2 3 1 1 1 3 2 2 1 2 1 2 3 1 1 1 3 2 1 2 1 200 1 2 1 2 1 3 1 1 3 2 2 3 1 2 3 1 3 2 2 2 1 2 3 1 201 2 2 2 1 3 1 1 3 2 1 1 3 1 1 2 1 1 3 2 3 1 3 2 1 202 2 3 2 3 2 1 2 1 1 3 1 2 1 2 2 2 3 2 1 1 3 1 1 3 203 2 1 3 1 1 3 1 3 2 2 3 2 1 2 2 3 2 2 1 2 1 1 3 2 204 3 2 3 2 2 1 2 2 1 3 2 2 2 1 1 3 2 2 1 3 1 3 2 1 205 1 1 2 1 2 1 3 2 3 1 2 3 2 3 1 1 1 2 2 3 1 1 2 3 206 2 2 1 3 1 3 1 1 2 1 3 1 3 2 3 1 2 2 1 2 1 3 2 2 207 3 1 1 3 2 3 1 3 2 2 1 1 2 3 1 2 2 2 3 2 1 1 1 2 208 1 1 2 3 2 1 1 1 3 2 1 1 1 3 1 1 1 3 2 3 1 2 3 1 209 3 2 2 1 3 2 2 1 2 3 1 2 3 1 1 2 1 2 2 3 2 3 2 1 210 1 1 1 2 3 1 3 2 2 1 3 1 3 2 1 3 1 1 2 2 1 2 3 2 211 3 1 2 1 2 1 3 1 1 3 1 2 2 1 3 2 2 1 3 2 3 1 2 1 212 1 2 1 3 2 2 2 3 2 2 3 1 3 1 2 2 2 1 2 3 1 3 2 1 213 2 1 3 1 1 2 1 3 2 2 1 3 2 1 3 2 1 1 3 1 3 2 1 2 214 3 1 1 2 2 2 3 2 1 2 2 3 2 3 1 1 3 2 2 2 1 3 2 1 215 3 2 1 3 2 1 1 3 1 1 3 1 3 1 1 2 2 1 3 1 2 2 1 1 216 1 1 2 3 2 3 2 2 1 2 3 2 1 2 3 2 1 1 1 2 1 3 2 3 217 3 1 1 2 2 1 3 2 2 1 3 1 3 2 1 1 1 2 2 3 2 2 2 3 218 3 1 1 1 2 2 3 1 1 3 1 2 1 3 2 1 1 3 1 1 1 2 3 1 219 3 2 3 2 1 2 2 1 2 3 2 3 1 2 2 2 1 2 3 1 2 1 3 1 220 2 1 2 2 1 2 3 1 3 1 1 1 3 2 2 3 1 1 2 1 3 2 1 3 221 2 1 2 3 2 1 2 2 3 2 1 2 2 3 1 3 2 1 3 1 2 3 1 1 222 3 2 3 1 2 2 3 1 1 2 1 3 2 1 3 1 2 2 3 2 2 2 1 1 223 1 3 2 1 1 3 2 2 3 2 2 2 3 1 2 2 3 1 1 1 2 2 2 3 224 3 1 1 3 2 2 2 3 1 2 2 2 1 1 3 2 2 2 1 1 3 1 1 3 225 3 1 3 1 1 3 1 2 1 1 1 2 3 1 2 1 2 2 3 2 2 1 2 3 226 1 2 3 1 2 3 1 3 2 2 3 2 2 1 1 2 1 3 2 2 1 3 2 2 227 2 1 2 3 1 2 1 2 2 2 3 1 1 3 1 3 2 3 2 2 1 1 3 1 228 3 1 3 1 2 3 1 2 2 1 1 1 3 2 3 1 2 2 2 1 2 3 1 1 229 1 2 1 3 2 2 1 1 3 1 3 2 3 1 2 3 1 3 1 1 2 1 1 1 230 2 2 2 1 2 2 3 2 2 1 3 1 2 1 1 1 3 1 3 2 2 3 1 3 231 1 3 1 1 2 1 2 2 3 1 2 1 3 2 2 3 1 1 3 2 2 3 1 1 232 2 1 3 2 3 2 1 1 1 3 2 3 2 1 3 1 2 2 3 2 1 1 1 2 233 1 3 2 1 3 2 3 1 2 1 2 3 1 2 2 2 3 1 1 2 1 2 2 3 234 2 3 2 1 2 2 3 1 1 2 2 1 3 1 1 2 1 3 2 3 1 3 1 1 235 2 3 1 2 1 2 3 1 3 1 2 1 3 1 1 3 2 2 2 1 1 2 3 2 236 3 1 1 3 1 1 3 2 1 1 3 2 1 2 1 1 1 3 2 1 1 1 2 3 237 2 2 2 1 1 3 2 3 2 3 1 2 1 1 3 1 1 1 3 1 2 1 3 1 238 2 1 2 2 3 2 2 3 1 1 2 3 2 3 2 2 2 1 1 1 3 1 3 1 239 3 1 1 2 1 1 2 3 1 2 3 1 3 1 2 3 1 2 2 1 2 2 3 1 240 2 1 3 1 3 1 1 1 3 1 3 1 3 1 1 2 2 3 2 1 2 2 1 1 241 1 2 3 2 1 2 1 1 2 3 1 3 1 2 1 2 3 2 2 2 3 2 3 1 242 1 1 2 1 3 1 2 1 1 3 1 2 2 3 1 2 2 3 2 3 2 2 2 3 243
2 2 2 3 1 2 3 1 2 1 1 2 1 3 1 1 3 1 3 1 1 2 3 1 244 1 3 1 2 3 1 1 2 1 1 3 2 2 3 2 3 1 1 2 3 2 2 2 1 245 1 3 1 2 3 1 1 1 3 1 1 1 3 2 3 2 1 3 1 1 2 1 2 2 246 2 3 2 2 1 1 1 2 3 2 1 2 3 2 1 3 2 1 1 2 2 3 1 3 247 2 1 3 2 1 3 2 3 2 3 1 1 3 2 2 1 2 2 2 3 2 2 1 2 248 1 3 2 3 1 1 2 3 2 2 2 3 2 1 1 1 3 1 3 2 2 2 1 1 249 3 1 2 1 1 1 2 3 1 3 1 1 2 2 3 1 3 2 1 1 2 2 3 2 250 2 3 1 2 3 1 3 1 1 1 2 2 3 2 2 2 1 1 3 2 3 2 2 2 251 1 1 1 2 1 1 3 2 1 3 2 3 2 3 1 3 2 1 1 2 1 3 2 1 252 2 1 2 3 1 1 1 2 1 2 3 2 3 1 2 1 3 2 1 1 3 1 3 1 253 1 2 2 3 2 1 1 3 1 3 2 3 1 2 2 1 2 1 3 1 2 3 1 2 254 1 3 1 3 2 1 1 3 1 1 2 3 1 1 1 3 1 3 1 2 1 1 2 1 255 2 1 1 3 2 1 1 3 2 1 3 1 2 3 2 2 1 1 1 3 1 3 1 2 256 1 1 1 2 1 3 1 1 1 3 1 1 2 2 3 2 1 3 1 3 2 1 3 2 257 1 2 1 3 1 2 2 2 1 1 3 2 3 1 1 3 1 3 1 3 2 2 1 2 258 3 1 1 2 3 2 2 2 3 2 1 1 1 2 3 2 1 2 1 3 1 2 1 3 259 1 1 1 2 1 3 1 1 2 3 1 3 2 1 3 2 3 1 1 1 2 1 2 3 260 2 2 3 1 1 2 2 1 2 3 2 1 3 1 3 1 1 1 3 2 1 1 1 3 261 2 1 3 2 1 1 1 2 2 3 1 3 1 3 2 1 3 2 2 3 1 1 2 2 262 2 3 2 1 1 1 3 2 3 2 2 2 1 2 1 3 2 3 2 3 2 1 1 2 263 1 2 1 2 3 1 2 2 2 3 1 3 1 2 3 1 3 1 1 2 3 2 1 1 264 1 1 2 1 2 2 3 1 2 1 2 3 2 3 2 2 3 2 3 1 1 3 2 1 265 1 3 2 3 1 3 1 2 2 1 2 3 1 3 2 1 2 2 3 1 2 2 2 1 266 2 2 3 2 1 2 2 2 1 3 1 2 1 3 2 3 1 3 1 2 2 1 2 3 267 1 2 1 3 1 1 1 2 3 1 1 1 3 1 2 1 3 1 2 1 3 1 1 3 268 3 1 2 2 3 2 1 2 1 2 3 2 1 1 1 3 2 1 3 2 2 2 1 3 269 2 1 2 3 1 1 2 3 2 2 1 2 2 3 2 3 2 3 2 2 3 1 2 2 270 3 1 2 1 2 2 1 3 2 1 3 1 3 2 1 1 3 2 1 2 1 2 2 3 271 2 3 1 4 1 2 3 1 1 2 2 2 3 2 3 2 2 1 2 3 1 2 1 2 272 2 1 2 3 1 1 2 3 1 1 3 2 1 1 1 3 1 3 1 2 3 2 1 1 273 3 1 3 2 3 1 1 2 2 2 3 2 2 3 2 1 1 2 2 2 3 2 2 2 274 1 3 1 1 1 2 2 3 2 1 3 1 3 2 2 1 1 2 2 3 2 3 2 1 275 3 2 3 2 2 1 1 2 3 1 1 1 3 2 2 3 2 3 1 1 2 1 1 2 276 2 3 2 3 1 2 2 2 3 2 2 1 1 3 1 1 3 1 2 2 1 1 2 3 277 1 3 2 1 3 2 1 2 2 3 2 1 1 1 3 2 1 2 1 1 1 3 1 3 278 2 3 1 2 2 3 2 2 3 2 1 2 1 3 2 2 1 2 2 3 2 3 2 1 279 3 1 2 2 3 2 1 3 2 2 2 1 1 2 3 2 2 1 1 3 1 1 2 3 280 1 2 3 1 1 1 2 1 1 3 1 1 1 2 2 3 1 3 2 1 3 1 3 1 281 2 1 2 3 1 2 3 1 2 1 2 2 2 3 2 2 3 2 1 2 3 2 3 2 282 2 2 2 1 3 1 3 2 2 2 3 1 2 2 1 3 2 1 2 3 2 2 2 3 283 1 1 2 1 1 3 1 3 1 2 2 3 2 3 1 2 3 1 3 1 1 1 2 1 284 1 1 2 3 1 1 2 1 3 1 1 2 1 3 1 3 1 1 2 3 2 1 3 1 285 3 2 1 3 2 1 3 2 1 1 2 2 2 3 1 1 2 3 2 2 2 3 1 1 286 1 3 2 3 1 3 2 1 1 2 2 3 1 2 2 3 1 2 2 3 2 2 1 1 287 3 1 1 2 1 1 2 3 2 2 2 1 3 2 3 2 3 2 2 2 3 1 1 1 288 1 2 1 2 3 1 1 1 3 2 1 3 1 3 1 1 1 3 2 3 2 2 1 2 289 2 3 1 3 2 2 1 2 2 3 2 1 2 2 2 1 3 2 2 2 3 1 1 3 290 2 1 3 2 2 3 1 3 2 2 2 1 1 1 3 2 2 3 1 1 1 3 1 1 291 2 1 1 1 3 1 3 2 3 1 2 3 2 1 1 1 2 1 3 1 1 3 2 2 292 2 3 2 1 3 2 3 2 2 2 1 3 1 3 2 1 1 3 2 2 1 2 2 1 293 1 3 1 3 1 2 2 1 1 2 3 2 3 2 2 3 1 1 1 3 1 2 2 1 294 3 2 1 1 2 1 1 3 2 2 3 2 3 1 1 1 3 1 1 3 1 2 2 1 295 3 1 3 1 2 3 2 2 1 2 1 3 1 2 1 1 2 3 1 1 1 3 1 1 296 2 2 2 1 3 2 2 3 1 2 2 3 2 2 3 1 1 2 1 3 1 3 2 1 297 1 2 2 1 2 2 3 1 1 1 3 2 1 3 1 2 3 2 2 1 3 1 2 3 298 2 2 2 1 2 3 2 3 2 3 1 2 2 3 1 3 2 3 2 2 2 1 1 2 299 2 1 2 2 2 1 3 2 2 1 3 1 2 1 3 1 2 1 3 1 3 1 3 2 300 1 2 3 2 3 2 2 2 1 2 3 2 3 1 1 1 3 1 2 2 2 3 2 1 301 1 2 1 3 2 1 1 2 2 1 3 1 1 3 1 3 1 1 3 1 1 2 3 2 302 2 1 2 3 1 3 2 3 1 2 2 1 3 1 1 2 2 3 2 1 2 2 2 3 303 2 2 1 1 2 3 2 1 2 2 3 2 2 2 1 1 1 3 1 3 2 3 2 3 304 1 2 1 3 1 3 1 1 2 2 1 1 3 1 1 2 2 3 2 2 2 3 1 3 305 3 2 2 1 2 1 1 3 2 1 3 1 1 1 2 3 2 1 2 1 3 1 1 3 306 1 3 2 1 1 2 2 1 3 2 2 2 3 1 1 1 2 3 2 3 2 1 3 2 307 3 1 1 1 3 1 2 2 1 2 3 1 2 2 3 2 1 1 1 3 2 3 1 2 308 3 2 1 1 3 1 2 2 1 3 1 1 3 2 2 1 1 2 3 1 1 3 1 1 309 3 1 3 1 1 2 3 2 2 3 1 1 2 1 1 3 1 1 3 2 1 1 2 2 310 2 2 1 1 3 1 3 2 3 2 2 2 3 1 1 2 1 3 2 3 2 2 2 1 311 1 2 1 1 1 3 1 1 1 3 1 3 2 1 2 3 1 3 1 2 2 1 2 3 312 1 3 2 2 1 2 2 3 1 2 2 3 1 1 3 1 2 3 1 3 1 1 1 2 313 3 2 2 2 3 2 3 2 2 2 3 2 1 2 1 1 3 2 2 3 2 2 1 1 314 2 2 3 2 1 2 3 2 3 1 3 2 2 2 1 3 1 2 2 1 1 2 3 1 315 2 1 3 2 2 1 1 1 3 2 1 2 1 3 2 2 3 2 2 2 3 1 3 2 316 1 1 1 2 2 2 3 2 3 2 2 3 1 3 1 2 2 2 3 2 1 2 1 3 317 2 1 2 2 1 3 2 3 2 2 1 2 3 1 2 1 1 1 3 1 3 1 1 3 318 2 1 2 1 1 3 1 1 3 2 1 1 2 2 2 3 1 3 1 1 3 1 3 2 319 2 1 1 3 2 2 3 1 3 1 2 3 2 2 2 3 2 2 2 3 1 2 1 1 320 3 2 3 2 1 3 1 2 2 2 1 2 3 1 1 2 2 3 1 3 2 1 1 2 321 2 1 2 1 3 1 3 1 1 3 2 3 2 2 2 1 3 2 2 3 2 1 2 1 322 1 2 1 1 1 3 1 1 3 1 1 2 1 3 2 2 3 2 2 3 2 3 2 1 323 1 3 1 2 2 3 1 1 1 2 1 3 1 2 2 1 3 1 1 1 3 2 2 3 324 3 2 2 3 2 2 1 2 1 1 3 1 1 1 2 1 3 2 2 2 3 2 2 3 325 1 3 1 1 1 2 1 3 1 3 2 1 1 3 1 3 2 3 2 2 2 1 1 1 326 1 3 1 3 1 2 1 3 2 1 3 2 1 1 1 2 1 3 2 2 1 2 2 3 327 1 1 1 2 3 1 2 2 3 2 3 2 1 1 3 2 2 1 2 3 2 1 2 3 328 1 1 3 1 1 3 2 1 1 3 1 3 1 3 1 1 1 2 2 2 3 1 1 2 329 3 2 3 2 3 2 1 2 2 2 1 3 2 2 3 1 2 1 1 2 2 3 1 2 330 1 2 2 3 2 2 3 2 2 3 2 2 3 1 3 1 1 1 2 3 2 1 2 2 331 1 3 1 2 1 1 3 2 2 1 1 1 3 2 1 1 1 3 1 3 1 1 2 3 332 2 1 3 2 2 3 1 1 3 2 2 1 3 2 2 2 1 1 3 2 3 2 2 1 333 1 3 2 1 1 3 1 1 2 3 2 1 1 2 1 2 3 1 2 3 1 2 1 3 334 1 2 3 1 3 1 2 2 3 1 1 1 3 1 2 2 2 1 2 3 1 1 2 3 335 2 3 1 2 2 3 1 1 2 2 1 3 1 3 1 3 1 1 2 3 2 1 2 1 336 1 3 2 2 1 3 2 1 1 3 1 3 1 1 2 1 2 1 3 2 3 1 1 2 337 1 2 2 1 1 3 1 2 2 3 2 1 2 1 3 2 2 1 3 2 3 1 2 3 338 3 1 3 1 2 1 1 1 3 1 1 2 2 3 1 1 1 2 1 3 1 1 3 1 339 1 3 1 3 2 1 1 1 2 3 2 2 1 1 3 1 1 1 3 1 1 3 2 2 340 1 1 1 3 2 2 2 3 2 2 1 2 3 2 3 2 3 1 1 3 1 1 2 2 341 1 2 2 3 2 3 2 2 2 1 1 3 1 1 1 2 1 2 3 1 2 3 1 3 342 2 1 2 2 3 1 1 1 2 3 1 3 1 2 3 2 1 2 3 2 1 3 2 2 343 1 2 2 2 3 2 3 2 3 1 2 3 2 2 2 3 1 1 1 2 1 2 3 1 344 2 1 1 3 1 2 1 1 2 1 3 2 3 1 3 1 3 1 1 1 2 2 3 1 345 1 2 2 2 1 2 3 1 2 2 1 3 2 3 2 1 1 3 2 3 2 2 3 2 346 3 1 2 2 1 1 3 1 1 2 1 1 1 3 2 3 2 3 1 1 3 1 1 2 347 3 2 1 1 2 2 3 1 2 3 1 1 3 1 3 2 2 1 3 2 2 2 1 2 348 2 3 2 3 2 2 1 2 3 2 2 1 2 1 1 3 1 1 3 2 3 1 2 1 349 1 3 1 3 1 1 1 2 2 3 1 1 2 2 2 1 3 1 1 1 2 3 2 3 350 2 2 1 2 2 3 1 1 2 3 2 3 1 3 1 1 1 3 2 1 2 2 2 3 351 2 3 2 2 1 1 2 3 1 3 1 1 3 1 2 1 1 2 3 1 2 1 3 2 352 3 1 1 1 3 2 1 2 2 2 3 2 2 3 1 2 2 1 2 2 3 2 2 3 353 2 1 3 2 2 2 1 2 3 2 1 3 2 2 1 1 2 2 3 2 2 3 1 3 354 3 2 2 3 1 1 1 3 1 2 1 3 2 2 2 3 1 2 1 2 3 2 1 2 355 2 2 1 3 1 1 3 1 2 1 3 1 2 2 1 2 2 3 1 3 1 1 1 3 356 1 1 2 1 1 2 3 2 2 3 2 3 1 1 1 2 1 3 1 2 3 2 3 1 357 1 3 2 1 1 3 1 1 1 3 2 2 2 1 3 2 2 2 1 3 2 2 1 3 358 2 1 3 2 2 2 1 1 2 3 1 3 1 2 3 2 2 2 3 1 2 1 2 3 359 2 2 1 1 1 3 1 2 3 2 2 1 1 1 3 1 1 2 3 1 3 2 3 1 360 1 1 1 3 2 3 2 3 2 1 2 1 2 3 2 2 1 3 1 1 1 3 2 1 361 1 2 2 1 1 3 2 2 1 2 3 2 3 2 2 2 1 2 3 2 3 2 2 3 362 2 2 2 3 1 1 3 1 1 3 2 3 2 2 2 3 2 1 2 2 1 2 3 2 363 2 3 2 2 1 1 3 1 1 3 2 2 2 1 3 2 2 1 1 1 3 2 2 3 364 2 2 2 1 1 3 2 1 2 1 1 3 1 2 2 3 2 3 2 3 1 3 1 2 365 1 3 1 2 1 2 2 2 3 1 2 1 3 1 2 1 3 1 1 3 1 1 1 3 366 1 2 2 2 1 3 1 3 2 2 3 2 1 1 3 1 1 3 1 2 1 2 2 3 367 3 1 3 1 1 1 2 2 3 2 1 1 2 2 3 2 2 1 3 1 3 2 1 2 368 3 1 1 3 2 1 2 1 2 3 2 2 1 1 3 1 2 3 2 1 1 2 1 3 369 1 1 2 1 2 2 3 1 1 3 1 2 3 2 1 3 2 3 1 3 2 2 1 2 370 3 1 3 2 2 2 1 3 1 1 1 2 3 1 2 1 1 1 3 1 1 2 2 3 371 2 1 1 3 1 1 1 2 3 1 3 2 2 1 2 1 2 3 2 2 3 1 3 1 372 2 2 3 1 2 1 2 1 1 3 1 1 3 2 2 3 2 3 1 2 1 1 3 2 373 1 1 3 2 3 2 2 2 1 1 2 3 2 1 1 3 1 3 1 1 2 3 1 1 374 3 2 2 3 2 3 1 3 1 1 2 2 1 3 1 1 1 2 1 3 2 1 2 1 375 2 2 2 1 3 2 2 2 3 1 2 3 2 3 2 2 2 1 2 3 1 3 1 2 376 3 2 1 1 2 2 3 1 1 1 3 2 1 2 3 1 3 2 1 3 2 1 1 2 377 2 1 3 2 2 3 1 1 2 1 1 3 1 2 2 3 1 3 1 3 1 1 1 2 378 2 2 1 1 3 2 3 1 1 3 2 3 2 2 3 2 2 2 1 2 2 3 1 1 379 1 2 2 3 1 2 2 2 3 2 2 3 1 1 1 2 1 1 3 2 3 2 2 3 380 2 3 1 1 2 2 3 2 2 3 1 2 1 1 3 2 2 1 2 3 1 1 3 1 381 3 2 2 2 3 2 2 1 2 2 3 1 3 2 1 1 3 2 2 3 1 1 2 2 382 2 3 1 2 2 2 1 3 2 1 2 3 2 1 2 2 1 3 1 3 2 2 3 1 383 2 1 1 1 2 1 3 1 3 1 2 3 1 3 1 1 2 1 1 3 1 1 1 3 384 1 3 1 1 2 3 2 2 1 2 1 2 3 2 1 3 1 3 1 1 1 2 2 3 385 1 2 2 2 1 2 3 2 1 3 2 2 3 1 3 1 3 2 3 1 2 1 1 1 386 3 2 1 1 1 3 1 2 1 3 2 2 2 3 1 3 2 1 1 2 2 2 3 1 387 3 1 1 1 2 1 3 2 1 2 1 1 2 3 2 2 1 1 3 2 3 1 3 1 388 1 2 2 3 2 1 2 1 2 2 3 2 3 2 2 3 1 1 3 1 1 1 3 2 389 3 1 3 2 2 1 1 3 2 3 2 1 1 1 2 3 1 1 1 2 3 2 1 1 390 1 2 1 3 1 2 2 3 2 3 2 3 1 1 1 3 1 1 1 3 1 1 2 2 391 2 2 1 1 2 1 3 1 1 3 2 2 2 3 2 1 3 2 1 2 3 1 2 3 392 2 2 3 2 1 2 3 2 3 1 3 1 1 2 1 1 1 3 2 2 2 1 3 2 393 3 2 3 1 2 2 1 3 1 2 1 2 3 1 2 3 1 2 1 2 3 1 1 2 394 2 3 1 1 3 1 1 3 1 1 2 2 2 1 3 1 2 2 2 3 2 1 1 3 395 2 3 2 1 2 3 1 2 2 1 2 2 3 1 2 2 1 3 2 3 2 3 2 2 396 2 3 2 3 1 1 1 3 1 3 1 1 2 3 1 2 1 3 1 2 1 2 2 2 397 1 1 2 2 3 1 1 1 2 3 1 3 2 3 2 3 2 2 2 1 1 3 1 1 398 1 2 2 1 2 1 3 1 3 2 2 1 3 2 2 2 1 3 1 1 2 3 1 3 399 1 1 1 3 1 2 1 3 1 1 1 2 2 3 1 3 2 3 2 1 2 3 1 2 400 3 2 1 3 2 2 2 3 2 2 1 1 2 3 2 2 3 2 1 2 1 1 2 3 401 1 3 1 3 1 2 1 2 2 1 3 1 1 2 3 2 1 1 3 1 1 2 1 3 402 1 3 1 1 3 2 2 2 3 1 1 1 2 1 2 3 1 2 1 3 1 1 2 3 403 2 1 3 1 1 2 3 2 1 1 1 3 2 2 2 1 3 2 1 2 1 3 1 3 404 1 3 2 1 3 1 2 3 2 1 2 3 2 2 1 1 2 3 2 3 1 1 2 1 405 2 3 1 1 1 3 2 3 1 1 1 2 1 2 3 1 1 1 2 3 2 2 3 2 406 1 2 1 3 2 1 2 1 2 2 3 1 3 2 2 2 3 2 1 2 3 1 1 3 407 3 1 1 3 1 1 1 2 3 2 2 2 3 2 1 3 1 1 2 1 1 3 2 1 408 1 1 2 3 1 3 2 1 2 2 3 1 1 3 1 1 1 2 3 2 1 2 1 3 409 3 2 3 1 2 1 3 1 1 2 2 2 3 2 3 2 2 2 1 1 2 3 1 1 410 2 3 2 1 3 2 1 2 3 1 1 3 1 1 2 1 1 2 3 1 1 1 2 3 411 1 2 1 3 1 1 3 2 2 1 1 2 3 1 2 1 1 2 2 3 2 3 2 3 412 3 2 3 1 2 2 3 2 1 1 3 2 1 1 3 2 1 1 1 3 1 2 1 1 413 2 1 2 3 2 1 3 2 2 2 3 2 3 2 2 1 2 2 2 3 1 1 3 1 414 2 3 1 3 2 1 1 3 2 2 2 3 2 1 2 3 2 2 2 1 1 3 2 1 415 2 1 1 1 2 3 2 1 2 3 1 3 2 3 2 3 2 1 1 1 3 1 1 1 416 3 2 1 1 3 1 3 2 1 2 2 3 1 1 1 2 2 1 3 2 1 1 3 1 417 3 2 2 3 1 3 2 3 2 1 1 1 3 1 2 2 1 2 2 3 1 2 1 1 418 1 3 2 1 2 3 1 3 2 2 1 2 2 1 3 1 2 1 1 1 3 2 3 1 419 1 2 2 2 3 2 2 1 2 1 3 1 3 2 2 3 2 3 2 2 3 2 1 2 420 2 1 1 2 2 1 3 2 1 3 2 3 2 3 2 2 3 1 1 1 2 2 2 3 421 2 3 2 1 2 2 3 1 3 1 2 2 3 2 2 1 2 2 3 2 1 2 2 3 422 3 2 2 1 2 2 1 3 1 1 3 1 3 1 2 1 1 2 2 3 1 3 2 2 423 2 2 3 1 3 2 2 3 2 3 1 2 2 1 1 3 2 1 3 2 1 2 1 2 424 3 1 2 1 3 2 1 2 1 1 2 3 1 2 2 3 1 1 3 2 1 1 2 3 425 3 2 3 1 1 1 3 1 2 1 2 2 2 3 1 3 1 3 1 2 1 1 1 2 426 1 3 2 2 1 2 3 1 2 2 2 3 1 1 3 1 1 1 2 2 3 2 2 3 427 3 2 1 1 3 2 1 2 2 2 3 1 1 2 2 2 3 1 2 3 1 3 2 2 428 2 1 1 2 1 3 2 3 2 2 1 2 1 1 3 2 3 1 1 1 3 1 3 2 429 1 1 1 2 3 1 1 2 2 3 1 2 3 2 3 2 1 2 1 2 3 1 1 3 430 1 3 1 1 1 3 2 3 1 3 2 2 3 2 2 1 1 3 2 1 2 2 2 1 431 2 2 2 1 2 3 2 3 2 3 1 1 2 2 3 2 3 2 1 2 1 2 1 3 432 3 2 1 1 2 1 2 3 1 2 1 3 1 1 1 2 3 2 1 1 1 3 1 3 433 3 1 3 1 1 2 2 3 2 2 2 1 1 1 3 1 2 1 3 2 2 3 2 1 434 3 1 1 2 2 2 3 2 2 1 1 3 1 1 2 3 1 3 2 2 2 3 1 2 435 1 2 1 3 2 3 1 2 3 1 2 2 1 1 1 3 1 3 1 1 2 2 2 3 436 1 2 1 3 1 2 3 2 2 2 1 3 2 2 3 1 3 1 2 2 1 2 2 3 437 1 1 3 1 3 2 3 2 1 1 1 2 1 3 1 1 1 3 2 3 1 2 1 2 438 2 3 2 3 2 1 2 2 3 1 2 2 3 2 2 3 1 3 1 2 1 1 1 2 439 2 1 3 2 1 2 1 3 2 3 1 3 1 1 1 3 1 3 2 2 1 1 1 2 440 1 1 1 3 1 2 1 1 3 1 1 1 3 1 3 1 2 3 1 2 3 2 2 2 441 3 1 1 3 2 2 1 2 2 3 1 1 1 2 1 3 1 3 1 1 3 2 1 2 442 1 2 3 2 1 2 3 2 1 2 1 3 1 1 1 3 1 3 2 1 1 1 2 3 443 3 1 2 3 2 2 2 3 2 1 1 1 3 1 2 2 3 1 1 1 2 2 3 1 444 1 1 2 2 2 1 3 1 3 1 3 2 1 2 2 2 3 2 3 2 2 3 2 1 445 1 1 2 2 2 3 2 2 2 3 1 1 1 3 1 1 1 3 2 1 1 3 2 3 446 1 1 1 3 1 3 2 1 3 2 3 2 2 1 2 2 3 2 2 1 3 1 2 1 447 3 2 1 2 3 2 2 3 2 1 2 1 2 3 2 2 3 2 2 3 1 2 1 2 448 3 2 1 3 1 1 2 2 2 3 2 2 3 1 3 2 1 2 2 2 3 2 1 1 449 1 2 3 1 1 2 2 2 1 3 2 2 1 3 2 3 2 1 1 3 1 1 1 3 450 1 2 3 1 2 1 1 3 1 1 1 2 3 2 2 3 1 2 3 1 1 3 2 1 451 2 2 3 1 2 3 1 2 3 1 1 3 1 2 1 1 2 3 2 1 3 1 2 1 452 1 3 1 2 3 1 2 1 2 3 1 2 1 2 1 3 1 2 2 1 3 1 2 3 453 2 2 3 1 1 1 3 2 2 1 3 1 1 1 3 1 2 1 3 1 2 3 2 2 454 3 2 2 2 1 1 2 3 2 2 1 3 2 2 1 3 1 1 1 3 2 1 1 3 455 3 1 3 1 2 2 2 1 1 3 2 2 2 3 1 1 3 2 3 1 1 1 2 1 456 2 2 2 3 2 2 1 3 2 1 3 2 2 3 2 2 1 2 1 1 3 1 3 1 457 2 1 2 3 1 3 1 1 2 1 3 2 2 2 3 2 2 1 3 2 3 1 1 2 458 2 2 3 1 1 1 3 2 2 2 1 1 1 3 1 1 3 1 3 1 2 1 1 3 459 1 1 3 2 3 1 3 2 2 3 1 1 1 2 3 1 1 1 2 1 2 3 2 2 460 3 2 2 1 3 1 1 1 2 3 1 1 1 2 3 1 3 2 1 3 2 2 1 2 461 2 1 1 3 2 1 2 2 3 2 1 2 2 2 3 2 3 2 3 2 3 2 1 2 462 2 3 2 1 2 2 1 3 2 1 1 1 3 1 1 3 1 3 1 3 1 1 2 1 463 3 1 3 1 1 3 1 3 1 1 1 2 1 1 3 2 2 3 1 1 1 2 1 1 464 3 2 1 1 1 3 2 1 3 1 1 1 2 1 3 1 1 2 2 3 1 3 2 2 465 3 2 3 2 3 2 2 1 2 2 2 3 2 2 2 3 2 1 1 1 3 2 1 2 466 2 2 2 3 1 2 3 2 1 2 3 1 1 2 1 2 1 3 2 1 2 3 1 3 467 1 1 3 1 2 2 3 2 3 2 3 1 1 2 1 3 2 2 3 1 1 1 2 2 468 2 1 2 1 1 1 3 2 2 2 3 1 1 3 1 2 3 1 3 2 3 1 2 1 469 1 3 1 2 1 1 1 3 1 3 1 2 2 2 1 1 3 1 2 3 2 1 2 3 470 3 1 1 3 1 1 2 2 1 1 3 2 2 3 1 3 1 1 2 2 1 1 3 1 471 2 1 3 1 3 1 1 1 2 2 2 3 1 2 1 1 1 3 1 1 1 3 1 3 472 1 1 1 3 2 2 2 1 2 3 1 1 3 2 2 1 2 2 3 1 3 2 1 3 473 1 1 1 2 1 3 2 3 2 1 1 3 2 1 1 1 3 1 3 1 2 3 1 2 474 2 1 2 3 1 2 3 1 2 2 2 1 3 2 2 1 2 1 1 3 1 3 2 3 475 2 1 3 1 2 1 1 1 2 3 2 2 1 2 3 1 2 3 1 3 2 1 1 3 476 1 3 1 2 2 3 1 2 2 3 2 3 1 2 3 1 2 2 2 3 2 1 2 1 477 2 2 1 1 3 1 1 3 1 1 2 2 3 2 1 2 1 2 3 1 3 1 3 2 478 3 2 1 3 1 1 2 3 2 2 2 1 3 1 3 2 2 3 1 1 2 1 2 1 479 3 1 3 1 1 1 2 1 3 2 1 1 3 1 1 3 2 1 1 1 2 1 3 1 480 1 2 2 3 1 1 3 2 2 3 2 2 1 2 3 2 3 1 1 3 1 2 2 2 481 2 1 1 1 2 3 2 2 3 2 3 2 1 3 1 3 2 1 1 2 2 1 3 1 482 1 1 1 2 1 1 3 1 3 2 2 2 3 1 3 1 1 3 2 2 3 2 2 2 483 1 3 2 2 3 2 1 1 2 1 1 3 1 1 3 2 3 1 2 2 2 1 1 3 484 3 2 2 1 3 1 1 2 3 2 1 2 1 2 1 3 1 3 2 2 1 3 1 2 485 2 2 3 1 2 1 2 2 3 1 1 1 3 1 3 1 1 1 3 2 2 1 2 3 486 2 2 1 1 1 3 1 3 1 3 1 1 1 2 3 2 2 2 3 1 2 2 1 3 487 2 3 2 3 1 1 2 2 2 3 1 3 2 1 2 2 1 3 2 1 1 3 1 1 488 2 1 1 2 2 2 3 1 1 2 3 2 3 1 1 1 3 2 2 3 2 2 1 3 489 1 2 3 2 3 2 2 2 3 1 1 1 3 1 2 3 1 2 3 1 2 2 2 1 490 1 1 3 2 2 1 2 3 2 2 3 1 2 1 2 2 3 1 3 2 3 1 1 1 491 2 1 3 1 2 1 1 1 3 1 1 3 1 2 1 3 1 3 1 2 2 2 1 3 492 3 1 2 3 1 1 2 3 2 1 3 1 2 1 2 1 2 3 2 1 1 2 3 1 493 3 1 1 3 1 1 2 1 3 2 2 2 1 2 3 2 1 1 1 2 3 1 2 3 494
3 2 1 3 2 1 2 1 2 1 3 2 2 1 1 1 3 1 2 3 1 3 2 2 495 3 2 2 1 2 2 2 3 2 3 2 1 2 3 1 2 2 1 2 3 1 2 2 3 496 1 3 1 3 1 2 2 1 3 1 1 1 2 2 3 1 3 1 3 1 1 2 2 1 497 3 2 1 2 3 1 2 1 3 1 3 2 2 2 1 2 1 3 2 3 1 2 1 1 498 3 2 2 1 3 1 1 1 3 1 1 2 3 1 1 1 2 2 3 1 1 3 2 1 499 1 1 3 1 1 2 3 1 3 1 1 2 1 2 1 3 1 3 1 2 3 1 1 2 500 1 1 1 3 1 3 1 1 2 1 3 2 3 2 2 2 1 1 3 1 1 3 1 2 501 3 1 2 3 2 3 2 2 1 2 2 3 1 2 1 3 1 1 1 2 2 1 3 1 502 2 1 3 1 3 2 2 1 2 1 3 1 3 1 2 1 2 2 3 2 1 2 3 1 503 3 1 3 1 3 2 2 3 1 1 2 1 1 3 2 2 1 1 1 3 1 2 1 2 504 1 3 1 2 1 2 3 1 1 1 2 1 3 1 2 2 3 2 2 1 3 1 3 1 505 3 1 3 2 3 1 1 2 1 3 1 1 1 3 1 2 1 2 3 2 2 1 1 2 506 1 1 1 3 1 3 1 2 1 2 2 3 1 1 3 1 3 1 1 2 1 1 1 3 507 3 2 2 1 2 1 3 1 1 2 1 1 3 2 2 3 2 1 1 1 3 2 3 2 508 2 3 1 2 1 3 2 1 2 3 1 2 1 1 2 3 2 3 2 2 2 1 2 3 509 2 2 2 3 2 2 3 2 2 1 1 3 2 1 2 3 2 3 1 2 2 2 1 3 510 2 1 1 1 3 2 3 2 2 3 2 3 2 2 1 1 1 3 1 2 2 1 1 3 511 2 3 2 3 2 2 2 3 1 2 2 3 1 2 2 1 1 2 3 2 2 1 2 3 512 1 2 2 1 1 2 3 1 1 2 3 1 3 2 3 2 2 3 2 1 1 2 3 2 513 2 1 3 1 2 3 2 2 2 3 2 3 1 3 2 2 2 3 1 2 1 2 2 1 514 3 1 1 2 3 1 1 2 1 3 2 1 1 2 1 3 1 2 3 1 2 2 2 3 515 1 1 2 1 3 2 3 2 3 2 2 3 2 2 1 2 1 2 3 1 2 2 1 3 516 2 1 3 1 2 2 1 3 1 1 3 1 2 3 2 2 3 2 3 2 1 2 2 1 517 1 1 2 3 2 3 2 3 2 3 2 2 1 1 1 2 3 1 1 2 2 2 3 2 518 3 1 1 2 2 1 1 3 2 1 2 1 2 3 1 3 2 3 2 1 3 1 1 1 519 2 2 1 2 2 3 2 3 2 3 2 1 1 3 2 1 3 2 3 2 1 1 1 2 520 3 2 1 3 2 1 1 1 3 1 3 1 1 2 2 3 2 2 2 1 3 2 1 2 521 1 1 3 2 2 2 3 2 1 1 3 1 1 3 2 1 3 2 2 3 1 1 2 1 522 1 3 2 2 1 2 1 3 2 1 2 1 3 2 1 3 2 1 2 1 3 1 3 1 523 3 1 1 1 3 1 1 1 2 3 2 3 2 1 2 1 3 2 2 2 1 1 2 3 524 2 2 3 2 3 1 3 2 1 1 2 3 1 1 2 3 1 2 3 2 1 2 2 1 525 3 2 1 3 1 3 2 2 3 2 1 1 1 2 1 3 1 3 1 1 2 1 1 1 526 1 2 2 1 1 2 3 2 1 3 1 2 2 3 2 1 1 3 1 3 1 2 1 3 527 2 2 1 3 2 3 2 3 2 2 2 3 2 1 3 1 2 1 3 1 1 2 2 1 528 1 3 1 3 1 3 2 2 2 3 2 3 2 1 2 1 2 3 2 1 2 1 1 1 529 2 2 1 1 3 2 2 2 1 3 2 3 1 3 1 2 2 2 3 2 2 1 1 3 530 1 2 3 1 1 3 2 2 2 1 2 2 3 1 1 2 1 3 2 1 3 2 3 1 531 1 2 1 2 2 2 3 2 3 2 2 3 2 1 2 3 2 2 2 3 2 3 1 1 532 1 1 1 3 2 3 2 2 2 1 2 1 3 1 1 3 1 2 2 2 3 1 2 3 533 1 1 3 1 3 1 2 1 2 3 1 2 2 2 3 2 2 1 3 2 2 3 2 1 534 1 1 3 1 1 3 1 1 1 2 3 1 3 2 3 1 2 1 1 2 3 2 1 1 535 2 1 3 2 3 2 2 2 3 1 2 1 2 3 2 2 1 1 3 1 1 3 2 2 536 3 2 1 3 1 1 1 3 2 3 1 2 1 3 1 2 2 1 3 2 1 1 2 1 537 3 1 2 1 1 1 2 3 2 2 1 1 3 2 2 1 3 2 1 2 3 1 2 3 538 1 3 1 2 2 1 3 1 1 3 1 1 2 2 3 2 2 2 1 3 1 1 2 3 539 1 2 1 2 2 2 3 1 3 1 1 3 2 3 2 3 1 1 1 2 3 1 1 2 540 2 3 1 3 2 1 1 1 2 1 3 2 2 2 1 2 3 1 3 2 1 3 2 1 541 2 2 1 3 1 3 1 3 2 1 3 1 2 1 1 1 3 1 2 2 2 3 1 2 542 1 2 2 3 2 2 2 1 1 3 2 2 3 2 2 3 1 2 1 1 3 1 2 3 543 3 2 2 3 2 1 1 1 3 2 2 1 1 1 3 2 3 2 3 1 1 2 2 2 544 1 2 1 3 1 2 2 3 2 3 2 3 2 2 2 3 2 2 1 2 1 3 2 1 545 3 2 1 1 3 2 2 1 2 2 3 1 3 1 1 2 3 1 2 1 1 2 1 3 546 2 1 3 1 2 2 1 3 2 2 3 1 2 1 1 3 2 3 2 3 2 1 1 2 547 1 1 1 2 3 2 1 1 1 2 3 1 1 3 1 3 2 3 2 2 2 3 2 2 548 3 1 2 1 3 1 1 3 1 1 1 2 3 2 1 2 1 2 1 3 2 3 1 2 549 2 1 2 1 3 1 3 2 3 2 1 2 3 2 2 1 2 3 1 2 1 1 1 3 550 2 1 2 3 1 1 3 2 3 1 2 1 1 3 1 2 3 1 1 3 1 1 2 2 551 2 3 2 2 3 1 3 1 1 2 1 3 2 1 1 3 1 3 1 1 2 2 2 1 552 2 1 3 1 2 1 1 2 3 2 3 1 1 3 2 1 1 2 1 1 3 2 3 1 553 3 2 1 2 2 1 2 3 1 2 3 1 2 1 3 2 1 3 2 1 1 3 2 1 554 1 3 1 2 1 2 3 1 2 2 2 1 3 2 1 2 2 3 1 1 2 3 2 3 555 1 1 2 2 1 1 3 2 2 2 3 2 1 3 1 3 2 3 1 2 2 2 3 1 556 1 1 3 1 1 1 2 1 3 1 2 3 2 1 3 2 1 1 3 1 2 3 2 2 557 2 2 3 1 3 1 1 3 2 2 3 2 2 3 2 1 1 2 1 1 3 1 1 2 558 1 3 2 3 2 3 1 1 1 2 1 3 2 3 1 1 1 3 2 2 2 1 1 1 559 2 2 2 1 2 3 2 1 3 2 1 3 1 2 2 2 1 2 3 2 3 1 1 3 560 1 2 2 1 1 2 3 1 3 1 1 1 2 2 1 3 2 3 2 3 2 2 1 3 561 1 2 3 2 2 1 1 2 1 3 2 3 1 2 1 3 2 1 1 1 3 2 3 1 562 2 1 2 3 2 2 3 1 2 1 1 1 2 3 1 2 2 1 2 3 1 3 2 3 563 2 2 1 2 2 1 3 1 3 2 2 3 2 3 2 3 2 3 1 2 1 2 1 2 564 2 3 2 2 3 2 2 1 2 3 1 2 2 3 1 3 2 2 1 3 1 1 2 1 565 1 1 2 2 2 3 1 3 2 2 1 1 3 1 1 3 1 1 3 2 3 2 1 1 566 1 1 1 3 1 2 1 1 1 3 2 2 1 1 3 2 3 2 2 2 3 2 1 3 567 2 3 2 2 3 1 3 1 2 3 1 2 1 2 2 3 2 1 2 1 1 3 2 2 568 2 1 1 1 2 1 3 2 3 1 1 2 3 1 3 2 2 1 2 1 3 1 3 2 569 1 2 1 3 1 2 3 2 2 1 2 3 1 2 1 3 2 2 1 3 2 2 1 3 570 3 2 2 1 1 3 2 3 1 1 3 1 2 1 2 3 2 1 2 2 3 2 2 1 571 2 1 1 3 1 1 1 3 2 1 1 1 3 2 2 2 3 2 1 3 1 2 3 2 572 1 1 3 1 3 1 1 1 3 2 2 2 3 1 2 2 3 1 1 2 1 1 1 3 573 1 2 1 2 2 1 3 1 2 3 2 3 1 3 2 2 1 2 1 2 3 2 3 2 574 1 3 2 2 2 3 1 3 2 2 2 1 3 2 1 2 2 3 2 3 1 1 2 1 575 1 2 3 2 2 1 1 1 2 3 1 3 1 3 1 2 2 3 2 3 2 1 2 1 576 2 1 1 1 2 3 2 2 3 2 3 1 2 2 1 2 2 3 2 3 1 3 1 2 577 2 1 1 3 1 1 2 2 3 1 1 3 2 1 1 3 1 3 2 2 1 2 2 3 578 1 3 1 3 1 2 1 3 1 1 2 2 1 1 3 2 2 2 3 2 2 3 1 2 579 3 1 1 3 1 1 2 3 2 2 1 1 3 1 1 1 2 1 2 3 2 1 1 3 580 2 1 2 2 2 3 2 3 1 2 2 1 1 3 1 1 3 2 2 3 1 3 1 1 581 1 3 2 2 1 3 1 1 2 2 2 3 2 3 2 1 3 2 1 3 1 1 2 2 582 1 1 3 2 2 2 1 2 2 3 2 2 3 1 2 3 2 2 3 2 1 2 2 3 583 3 1 1 2 3 1 3 2 2 2 1 1 3 1 3 2 2 2 1 2 1 3 2 1 584 1 3 2 3 1 1 3 1 2 2 3 2 1 2 3 2 1 3 2 1 2 1 1 1 585 1 3 2 2 3 1 1 1 2 3 1 3 2 1 2 2 1 1 3 2 1 1 2 3 586 1 2 3 2 3 2 2 1 2 2 2 3 1 3 1 2 3 1 3 2 1 1 2 2 587 1 1 1 2 1 3 2 3 2 2 3 2 2 3 1 1 3 2 2 3 2 2 1 2 588 3 2 1 3 1 3 1 1 1 3 1 2 1 2 1 2 3 2 1 3 2 2 2 1 589 3 1 3 1 3 2 1 2 2 2 3 1 2 3 1 1 2 3 1 2 2 1 2 1 590 3 1 3 2 1 2 1 1 3 2 2 2 1 3 2 3 2 1 2 1 2 2 3 1 591 1 2 1 1 2 3 2 3 1 2 2 1 2 2 3 1 2 2 3 1 3 1 3 1 592 2 2 1 3 2 2 3 2 2 1 2 3 2 3 1 3 1 3 2 1 1 2 1 1 593 1 1 1 2 3 1 3 2 1 2 1 2 2 3 1 1 2 2 3 2 3 1 2 3 594 1 1 2 2 1 3 1 1 3 2 1 1 3 2 1 3 1 3 2 2 2 1 1 3 595 2 3 2 1 1 3 2 2 2 1 1 1 3 2 1 1 3 1 1 1 2 3 2 3 596 3 1 1 1 2 3 1 2 1 1 3 2 2 3 1 2 1 2 1 1 3 1 1 3 597 1 1 2 3 1 3 2 1 3 2 2 2 3 2 1 2 2 2 3 1 3 2 2 2 598 1 3 2 3 1 1 2 3 2 1 1 3 1 2 2 1 2 3 2 1 2 2 2 3 599 3 2 1 1 2 2 3 1 1 2 2 3 1 1 1 3 1 2 1 1 3 2 3 2 600 2 1 2 3 2 2 2 1 1 3 2 1 3 2 3 1 1 1 2 1 3 1 3 2 601 3 2 1 2 2 3 1 1 1 2 2 3 1 1 2 2 1 3 1 1 3 2 1 3 602 1 1 2 1 2 3 2 1 1 2 3 2 1 3 2 2 3 1 1 1 3 2 3 1 603 2 3 1 1 2 1 2 2 3 1 3 1 1 2 2 1 2 3 1 3 1 3 2 2 604 2 1 3 2 3 2 1 1 1 2 3 1 2 3 1 1 3 1 1 1 3 2 1 2 605 3 2 1 2 3 2 3 2 1 1 1 3 1 1 1 2 2 2 3 1 2 3 2 1 606 1 1 2 2 3 2 2 2 3 1 1 1 3 2 2 2 3 2 2 3 1 3 1 1 607 1 1 2 2 3 2 2 2 3 1 3 2 1 3 2 1 2 2 1 3 2 1 3 2 608 2 1 1 2 2 3 1 3 2 2 2 3 1 1 2 1 1 3 1 3 1 3 2 2 609 2 3 2 2 3 1 2 2 3 2 1 1 3 2 3 2 2 2 1 2 2 3 2 2 610 3 1 1 1 2 2 2 3 2 3 1 3 2 1 2 3 2 1 2 2 2 3 1 1 611 2 1 1 3 1 1 2 3 1 1 2 3 2 3 1 1 3 2 3 1 1 2 1 2 612 2 1 1 2 3 2 3 1 1 3 2 2 2 3 2 3 1 1 1 3 1 2 1 2 613 2 2 3 2 1 2 1 2 3 1 1 1 3 2 1 1 3 1 1 3 1 1 3 2 614 2 1 3 1 3 1 3 1 1 3 1 1 3 1 1 1 2 1 1 3 1 1 2 1 615 1 2 2 2 3 1 1 1 2 3 2 2 1 1 2 3 1 3 1 3 1 3 1 2 616 2 2 3 2 3 2 3 2 1 2 1 2 1 3 2 1 2 2 1 3 1 1 2 3 617 1 2 2 3 2 2 1 3 2 1 2 2 3 1 2 3 2 3 1 1 3 2 2 1 618 2 3 2 2 2 3 2 1 2 2 2 3 1 1 2 3 1 1 1 2 3 1 1 3 619 2 3 2 2 1 3 1 2 2 3 2 3 2 2 1 1 1 2 3 2 1 3 2 2 620 2 1 2 1 3 1 3 2 1 2 2 3 2 1 2 1 3 1 3 1 3 1 1 1 621 1 1 1 2 1 3 2 1 1 3 1 1 2 3 2 1 3 2 2 3 2 2 3 1 622 2 3 1 3 2 3 2 3 1 2 2 2 1 2 3 1 2 2 1 1 3 2 2 1 623 1 3 1 1 2 2 2 3 2 2 3 2 1 3 2 3 2 2 1 2 3 1 2 2 624 3 1 2 2 3 1 1 3 1 1 1 3 1 1 1 2 1 3 2 2 2 3 1 1 625 3 1 2 1 1 2 1 3 1 3 1 1 2 1 3 2 1 3 1 3 2 2 1 1 626 3 1 2 2 3 1 1 1 2 2 2 3 2 1 3 2 2 1 2 1 3 2 3 1 627 3 1 2 2 2 1 1 3 1 1 3 1 2 3 1 1 2 1 1 2 3 2 1 3 628 2 2 2 3 1 3 1 3 1 1 1 3 2 1 3 1 1 2 1 1 3 1 2 1 629 3 1 2 2 1 1 3 1 3 2 1 1 1 2 3 1 3 2 1 2 1 1 3 1 630 2 2 2 3 1 2 1 3 1 1 2 2 3 1 1 1 2 2 2 3 1 3 1 3 631 2 3 1 1 3 1 1 3 1 3 2 3 2 2 1 2 1 1 3 1 2 2 2 1 632 3 2 3 1 1 1 2 3 1 2 2 2 1 3 1 3 2 1 1 2 1 1 3 2 633 1 1 1 2 1 1 3 1 1 2 1 3 1 3 1 3 1 3 1 1 1 3 2 2 634 3 2 2 3 2 1 1 1 3 2 1 1 2 1 3 1 3 1 1 1 2 2 1 3 635 1 3 2 3 1 2 2 2 1 3 1 2 2 1 2 3 2 3 1 2 3 1 2 2 636 1 3 1 3 2 1 2 1 3 2 2 2 1 3 1 2 2 2 1 2 3 2 1 3 637 1 2 3 1 2 2 1 3 1 2 1 3 2 3 1 1 1 2 2 3 2 2 1 3 638 1 2 3 1 1 1 2 3 2 1 2 2 1 3 2 2 2 1 3 1 3 2 2 3 639 1 2 1 2 2 3 1 3 2 3 1 3 1 3 2 2 1 2 2 3 2 2 1 1 640 1 3 1 2 3 2 3 2 1 2 2 3 1 1 2 2 1 1 3 1 1 3 2 2 641 2 1 1 2 3 2 3 2 2 3 1 2 1 3 1 1 2 1 3 1 3 1 2 1 642 1 1 1 2 2 1 3 2 2 3 1 1 1 3 2 1 2 3 1 3 1 1 1 3 643 2 2 2 1 3 1 3 2 2 3 1 1 3 1 1 1 2 3 2 2 1 1 2 3 644 3 1 2 2 3 2 2 3 1 2 2 1 2 2 3 1 2 3 1 1 2 2 2 3 645 2 3 2 2 3 2 2 3 2 2 3 1 1 2 2 3 1 1 3 1 1 2 2 1 646 1 2 2 1 1 3 2 1 1 3 1 1 2 2 3 1 3 1 3 2 2 2 3 1 647 3 2 1 2 3 2 2 3 2 1 1 2 3 2 1 2 2 1 1 3 1 1 1 3 648 2 1 3 2 2 3 2 3 1 2 2 2 1 2 3 2 1 1 2 3 1 2 2 3 649 2 3 1 2 1 1 2 3 1 1 1 3 2 2 2 1 2 1 3 1 3 1 3 1 650 3 2 1 1 3 1 2 2 3 2 2 2 3 2 1 2 3 1 2 1 1 3 1 2 651 2 2 3 1 1 2 2 1 1 3 1 3 2 1 1 3 1 2 3 2 2 2 1 3 652 1 1 3 2 3 2 2 2 3 2 2 2 1 3 1 3 2 1 1 1 3 1 2 1 653 1 3 1 3 1 3 1 2 1 1 1 3 2 1 2 1 3 1 1 3 2 2 1 1 654 1 2 2 1 2 3 1 1 2 1 3 2 2 1 3 1 1 1 3 1 3 1 3 2 655 2 2 3 2 2 3 1 2 1 2 2 1 3 1 3 1 1 2 3 2 3 2 2 2 656 2 2 2 1 2 2 3 1 3 1 3 2 2 2 3 2 2 1 2 2 2 3 2 3 657 1 3 2 3 2 2 1 1 3 1 1 3 2 2 3 1 2 2 1 2 2 3 1 2 658 3 1 3 1 1 1 2 3 1 2 2 3 1 1 2 3 2 2 3 1 2 1 1 2 659 3 1 2 1 1 3 2 1 2 2 1 3 2 1 2 3 1 3 2 3 2 1 1 2 660 2 2 2 3 1 2 2 2 1 1 3 1 3 2 3 2 2 3 1 1 2 3 2 1 661 1 1 3 2 2 1 3 2 1 1 1 2 1 3 1 3 2 1 3 1 1 1 3 1 662 3 2 1 1 1 3 2 1 2 3 1 1 2 1 2 3 2 3 1 1 1 2 3 2 663 2 1 1 2 1 1 3 2 3 2 3 2 2 3 2 3 1 1 2 3 2 1 1 2 664 1 1 1 3 1 2 2 2 1 3 1 3 2 1 3 1 1 1 3 1 3 1 1 2 665 2 2 1 3 2 2 2 3 1 3 2 2 3 1 1 1 2 1 3 2 1 1 1 3 666 2 1 1 2 1 3 2 1 2 3 1 3 2 1 1 3 1 2 2 3 1 1 1 3 667 3 1 1 3 1 2 2 1 3 1 2 2 3 1 2 3 2 2 1 3 2 2 1 1 668 2 1 1 1 3 1 3 1 3 1 1 3 2 2 1 3 2 1 1 2 1 3 1 1 669 2 1 1 3 2 1 2 3 1 3 1 1 1 2 3 1 2 3 2 3 2 2 1 2 670 3 1 3 2 2 2 3 2 2 2 3 2 2 1 3 2 2 1 2 2 3 1 2 1 671 1 1 3 2 1 1 1 3 1 1 1 2 3 2 2 1 1 3 1 3 2 1 3 2 672 1 2 3 1 3 1 1 2 2 3 2 2 3 2 2 3 1 1 1 2 3 2 1 1 673 2 2 1 3 1 2 2 1 3 1 3 2 1 3 2 1 3 1 1 3 1 1 2 1 674 2 1 3 2 3 1 2 3 1 1 3 1 1 3 2 2 1 3 1 1 1 2 2 1 675 2 1 1 2 3 2 1 3 2 1 1 2 3 2 3 1 2 3 1 2 1 1 3 2 676 2 2 3 1 3 1 1 1 3 1 1 2 1 1 3 2 1 3 2 3 2 1 1 1 677 2 1 1 2 3 1 3 2 3 1 3 1 2 2 1 2 1 3 1 2 2 3 2 2 678 3 2 1 2 1 1 3 1 1 1 2 3 2 3 2 3 2 2 2 3 1 2 2 1 679 3 2 3 1 1 2 3 2 3 2 2 1 1 2 3 1 1 3 1 2 1 2 1 2 680 3 1 1 1 3 2 2 1 2 2 1 3 2 1 3 2 2 1 1 1 3 1 2 3 681 2 1 3 1 1 2 2 3 2 3 2 2 2 3 1 2 1 1 3 2 3 1 2 1 682 2 3 1 2 2 2 1 3 1 2 2 3 1 3 1 3 2 2 1 1 1 2 3 1 683 1 2 2 1 2 2 3 1 3 2 2 2 3 1 1 2 3 2 2 3 1 2 1 3 684 1 2 1 3 2 1 3 2 2 1 2 3 2 2 2 3 1 2 2 2 1 3 2 3 685 1 2 1 3 1 1 3 1 1 3 1 1 2 1 1 1 3 2 2 1 3 1 3 1 686 3 1 2 3 2 2 3 1 1 1 3 2 1 1 2 3 1 1 2 2 2 3 2 1 687 3 1 3 1 2 2 3 1 2 1 3 2 1 3 1 1 1 2 3 1 2 1 1 1 688 2 3 1 3 1 3 1 1 2 1 1 1 3 2 1 2 3 1 1 2 2 2 3 1 689 2 1 2 1 1 1 3 1 2 3 1 2 3 2 3 1 1 2 2 1 3 2 1 3 690 2 2 1 2 3 2 1 1 3 1 1 2 3 2 2 2 3 1 3 1 3 1 1 1 691 1 3 2 1 1 1 2 3 1 2 3 1 1 2 3 1 2 1 2 3 1 2 3 1 692 3 1 1 1 2 2 2 3 2 3 2 2 1 1 1 3 2 2 3 1 1 2 3 1 693 3 1 2 3 1 1 2 3 1 2 2 3 2 3 2 2 2 1 1 3 2 1 2 1 694 3 1 1 1 2 1 1 3 2 3 1 3 1 3 2 2 1 1 2 3 1 1 1 2 695 2 3 2 2 3 1 1 1 2 1 3 2 2 1 2 2 1 3 2 2 2 3 2 3 696 2 2 2 3 1 3 1 3 2 1 2 1 2 2 3 1 2 1 2 3 1 3 1 1 697 1 2 2 3 2 3 2 3 2 1 1 1 3 2 1 1 3 1 2 2 2 1 1 3 698 2 1 2 1 3 2 2 2 3 1 1 3 2 3 2 3 1 2 3 2 1 2 2 2 699 3 2 3 1 1 3 2 2 1 2 1 3 2 3 2 1 2 1 1 1 3 1 1 2 700 3 2 1 2 3 2 2 3 1 1 2 1 3 2 1 1 1 2 1 3 1 2 2 3 701 2 2 1 3 1 1 1 3 2 3 2 3 1 2 2 2 3 2 3 2 1 2 2 2 702 2 2 2 1 3 2 1 1 2 1 2 3 2 1 1 3 1 3 1 2 3 2 3 1 703 1 3 2 1 2 3 2 1 2 1 3 1 2 3 1 2 3 2 2 2 3 2 2 2 704 1 2 2 2 1 1 3 2 1 1 1 3 2 3 2 1 3 1 3 1 2 1 1 3 705 1 2 2 2 3 2 3 2 2 3 1 1 2 2 3 2 1 1 1 3 2 3 1 1 706 1 2 3 2 2 1 2 2 1 3 1 2 2 3 2 3 1 2 3 1 1 2 3 1 707 2 1 3 2 1 3 2 1 3 1 1 2 1 2 3 1 1 1 2 2 1 3 1 3 708 2 2 2 1 1 2 3 1 3 1 1 3 1 3 2 2 1 3 1 3 2 1 2 1 709 1 1 1 3 2 2 2 1 3 2 1 3 1 3 2 3 2 1 2 3 2 1 1 1 710 1 2 1 2 1 2 3 1 2 1 3 2 1 3 1 3 2 1 3 1 2 2 1 3 711 2 3 1 3 1 1 3 2 2 1 1 2 2 3 2 1 2 1 3 1 2 2 3 1 712 2 1 2 1 3 1 3 1 2 3 2 2 1 2 1 2 3 1 1 3 2 2 3 2 713 1 1 1 2 2 2 3 2 2 1 1 3 2 2 3 2 2 3 2 2 3 2 2 3 714 2 2 3 2 2 3 1 1 3 1 2 3 1 1 1 3 2 1 3 1 1 2 2 1 715 1 1 3 1 3 1 2 1 1 3 2 1 3 2 3 2 2 2 1 2 3 2 2 2 716 1 1 2 1 1 3 1 1 3 1 1 3 2 3 1 1 1 3 1 2 2 3 1 2 717 2 1 1 3 2 2 1 1 1 3 2 2 3 1 2 3 1 2 2 3 1 2 1 3 718 1 2 1 2 1 1 3 1 2 1 1 3 1 3 2 3 2 1 1 3 2 3 1 2 719 3 2 2 1 1 1 2 3 2 2 3 2 2 3 2 2 2 1 1 3 2 3 1 2 720 3 1 3 2 2 1 1 3 2 2 1 2 2 1 3 2 2 1 1 3 1 1 3 2 721 2 1 2 2 1 3 1 3 2 2 2 3 1 3 1 1 2 1 1 3 2 1 3 2 722 2 1 1 2 3 2 2 3 2 2 1 2 3 2 3 2 2 1 3 1 2 3 2 2 723 3 1 1 1 3 2 2 3 1 2 1 3 1 1 2 3 2 1 1 2 3 2 2 2 724 2 3 1 2 1 3 1 2 3 1 1 2 2 3 1 2 2 3 1 2 2 1 3 2 725 1 2 3 1 2 1 3 1 3 2 1 1 1 3 1 1 2 1 1 3 2 2 3 2 726 1 3 2 1 1 3 2 3 2 2 1 3 1 2 1 3 2 1 2 2 3 1 1 2 727 1 2 3 2 1 3 1 2 2 1 1 1 3 2 1 3 2 3 2 1 2 3 2 2 728 2 2 1 2 2 3 1 2 1 1 2 3 1 3 1 3 1 3 2 2 1 1 1 3 729 1 2 2 2 3 2 2 1 2 3 1 2 1 1 1 2 3 2 3 2 1 3 2 3 730 2 2 3 1 1 3 1 1 1 2 1 1 3 1 3 2 1 1 2 1 1 3 1 3 731 2 3 2 3 2 1 1 2 1 1 3 2 1 3 2 1 1 3 1 2 2 1 3 1 732 1 2 3 1 1 1 3 2 2 1 3 1 3 2 2 2 1 2 3 1 2 1 1 3 733 1 2 2 1 3 2 2 1 1 3 1 3 1 3 2 2 2 3 2 1 3 1 2 2 734 2 3 2 1 3 2 1 2 2 3 2 1 2 3 1 2 2 1 1 1 3 2 3 2 735 1 3 2 2 3 1 2 1 1 1 3 1 1 3 1 1 3 1 3 2 1 2 1 2 736 3 2 1 1 2 3 1 3 1 2 1 1 1 3 1 3 1 3 1 2 1 1 2 2 737 2 3 2 3 2 2 3 1 1 3 1 2 1 1 1 3 2 2 2 1 2 3 1 2 738 1 1 3 1 1 3 1 3 2 1 3 2 2 1 3 1 1 2 2 3 1 2 2 1 739 3 1 1 2 3 1 1 3 1 2 3 1 1 3 2 2 2 3 2 2 1 1 2 1 740 1 1 1 2 2 3 2 2 3 1 3 1 2 1 1 3 1 2 1 3 2 3 1 2 741 2 3 1 2 2 3 2 2 2 1 1 2 3 1 2 3 2 3 2 3 1 2 2 1 742 1 2 3 1 1 3 2 1 2 2 3 2 2 3 1 3 2 3 1 2 2 2 1 1 743 3 2 3 2 1 1 1 2 3 2 2 2 3 1 3 1 2 3 2 1 2 1 2 2 744 1 1 2 2 3 1 2 3 1 3 2 2 2 1 1 1 3 1 3 2 2 3 1 2 745
2 2 2 3 2 3 2 1 1 2 1 2 3 1 2 2 3 1 3 1 3 2 2 2 746 3 2 1 3 2 1 3 1 2 3 1 2 2 1 1 3 1 1 3 1 2 1 1 1 747 2 2 2 1 1 2 3 2 3 1 1 1 2 2 2 3 2 2 3 2 3 1 3 2 748 3 2 1 1 1 3 1 1 2 2 1 3 1 2 1 1 1 3 1 3 2 3 1 2 749 1 1 2 1 3 2 2 1 1 3 2 2 2 1 1 3 1 3 2 2 3 2 3 2 750 3 2 3 2 3 1 2 3 2 2 2 1 2 1 3 1 2 2 2 3 2 2 1 2 751 3 2 1 2 1 3 2 3 2 3 1 2 2 1 3 1 2 2 2 3 2 1 1 1 752 3 2 2 3 2 1 1 3 1 1 1 3 1 2 1 2 3 2 1 1 3 1 1 1 753 1 2 1 2 2 1 3 1 2 2 3 2 1 1 1 3 1 3 1 3 2 3 1 1 754 3 1 3 2 3 1 2 1 2 2 3 1 1 1 2 2 1 3 1 2 2 3 2 1 755 2 1 1 3 1 1 3 2 2 1 1 1 3 1 1 3 1 3 1 3 2 2 2 1 756 3 1 2 3 2 2 1 3 1 2 1 1 1 3 2 2 2 1 1 3 2 1 3 2 757 3 2 3 1 2 2 3 2 1 2 3 1 3 1 1 1 2 3 2 2 1 1 1 2 758 2 3 1 2 2 1 2 2 3 2 1 1 3 1 1 1 3 1 2 2 3 1 3 1 759 1 1 3 1 1 2 2 3 2 3 2 1 1 3 2 2 2 1 2 3 1 3 2 1 760 2 2 3 2 1 2 2 2 1 3 1 1 3 1 2 2 2 3 2 1 3 1 2 3 761 2 1 2 1 2 3 2 2 2 3 2 3 2 1 1 3 1 1 3 1 1 1 2 3 762 3 1 2 1 1 2 3 2 3 2 3 1 1 2 2 2 3 2 3 1 1 2 1 1 763 2 2 1 3 1 1 1 2 3 2 3 1 3 1 2 2 2 1 1 3 1 3 2 2 764 1 3 2 3 2 1 3 1 1 2 2 2 3 2 1 2 2 2 1 3 2 2 3 2 765 2 1 3 2 2 1 1 3 1 2 1 3 1 3 2 1 1 1 2 3 1 2 1 3 766 3 1 1 3 2 3 1 2 1 2 2 3 2 1 1 1 2 2 3 1 2 1 1 3 767 3 2 1 1 2 2 3 2 3 2 2 1 3 1 2 2 2 1 1 3 1 1 3 2 768 2 3 1 2 1 2 2 2 3 2 3 1 1 2 2 3 1 2 1 3 2 1 2 3 769 1 1 3 2 1 1 1 3 1 3 1 2 1 2 1 3 2 2 1 1 3 2 2 3 770 1 2 2 1 3 2 2 1 1 3 2 2 1 2 2 2 3 2 3 1 3 2 3 1 771 1 3 1 2 3 1 1 3 2 1 3 2 2 2 1 2 3 1 1 2 2 1 3 1 772 2 3 1 3 2 2 1 3 2 2 1 1 3 2 3 1 2 1 3 2 2 1 1 1 773 2 2 1 2 2 3 2 1 3 1 2 2 2 1 3 1 3 1 1 3 1 2 3 1 774 2 1 2 2 2 3 2 3 2 2 2 3 2 2 3 1 2 2 1 3 1 2 1 3 775 3 2 1 2 1 1 2 3 2 3 2 3 2 3 1 1 1 3 2 2 1 2 1 1 776 2 1 2 1 2 3 2 2 3 1 3 2 1 2 1 1 1 3 1 3 1 3 1 1 777 2 2 1 3 2 2 1 3 2 2 2 1 1 1 3 1 2 2 3 2 3 1 3 2 778 2 2 2 1 3 1 1 2 1 1 3 2 3 1 2 3 2 3 1 2 3 1 1 1 779 1 3 1 3 2 1 1 2 3 2 3 2 1 1 1 2 1 3 2 2 1 3 1 2 780 2 3 2 3 1 2 1 1 1 3 1 3 1 1 1 2 2 1 3 2 2 3 2 2 781 3 1 1 2 2 2 1 3 2 3 1 1 2 3 2 2 2 3 1 3 1 2 2 1 782 2 3 2 3 1 2 3 2 3 2 1 1 3 2 1 2 1 2 3 1 1 1 2 2 783 2 2 3 2 3 1 1 2 3 1 2 2 1 1 2 3 1 1 2 1 3 1 1 3 784 1 1 2 3 2 2 3 2 2 2 1 3 1 2 2 3 1 3 1 1 1 3 2 2 785 1 3 1 2 2 3 2 3 2 2 1 3 2 1 2 2 1 3 2 1 2 1 1 3 786 2 2 3 1 2 3 2 1 2 2 1 3 1 1 1 3 2 2 2 1 2 3 2 3 787 2 1 2 3 1 2 2 3 2 3 2 3 2 2 1 3 1 3 1 1 2 2 2 1 788 2 1 3 2 3 2 1 3 1 2 1 2 2 2 3 1 2 1 3 2 2 1 2 3 789 1 3 2 2 2 1 1 2 3 2 3 2 2 2 1 3 2 2 3 2 2 1 2 3 790 2 3 2 3 2 1 1 1 3 2 1 3 1 1 1 3 2 1 1 1 3 1 2 2 791 3 2 2 1 2 3 1 2 1 2 1 3 2 3 1 3 2 2 3 2 2 1 2 2 792 2 2 2 3 1 2 2 3 1 1 2 3 2 2 1 1 2 1 3 2 3 2 3 2 793 1 3 1 3 2 1 2 2 1 3 2 1 3 2 2 1 2 2 3 2 1 1 3 2 794 2 1 1 3 2 1 3 1 1 1 3 1 1 3 1 1 3 1 2 1 2 2 2 3 795 1 3 1 1 1 3 1 3 1 1 2 2 1 2 3 2 1 1 2 3 1 1 1 3 796 2 2 1 3 1 2 2 2 3 2 2 1 3 2 3 2 3 1 2 2 2 1 1 3 797 3 1 2 3 1 2 2 1 1 3 1 2 1 2 1 3 1 3 1 2 1 3 2 2 798 1 2 1 2 2 2 3 1 3 2 3 1 2 2 1 1 3 1 3 2 1 1 2 3 799 2 3 2 1 2 2 3 2 3 1 3 2 2 1 1 3 2 1 2 1 1 3 2 2 800 1 1 2 2 2 1 3 2 1 3 1 1 1 3 2 3 2 2 3 2 3 2 2 2 801 3 2 2 1 3 1 1 3 1 2 2 1 1 3 2 2 3 1 1 2 1 1 2 3 802 2 1 1 1 3 2 1 2 3 2 3 1 3 1 2 3 1 2 2 2 1 2 3 2 803 2 3 1 1 1 2 3 1 2 2 1 1 1 3 1 2 3 1 1 3 1 2 3 1 804 2 2 1 2 2 1 3 1 2 3 2 2 3 1 3 2 3 2 2 2 3 2 2 2 805 2 1 3 2 3 2 2 2 1 1 1 3 1 3 2 1 3 2 1 2 1 2 3 1 806 1 3 2 2 1 2 1 1 3 2 1 1 1 2 3 1 2 3 2 2 3 1 2 3 807 2 2 1 1 3 1 3 1 3 1 1 1 2 1 1 3 2 3 2 1 2 2 3 2 808 3 1 2 1 2 2 3 1 1 1 2 3 2 3 2 1 1 1 2 3 1 2 3 1 809 1 2 3 1 2 3 1 1 2 2 1 1 3 1 1 1 3 1 1 1 3 1 3 1 810 3 1 1 2 1 3 2 2 2 3 1 2 2 2 3 2 3 2 2 2 3 2 2 1 811 1 3 2 2 3 2 2 2 1 3 1 2 2 2 3 1 2 2 2 3 2 1 1 3 812 3 2 1 2 3 1 3 1 2 2 2 3 1 2 1 2 1 1 3 1 2 2 1 3 813 2 2 2 1 2 1 3 2 3 1 3 2 1 2 1 3 2 3 1 2 3 1 2 2 814 2 1 2 1 2 3 2 3 1 1 3 1 2 1 2 1 1 3 2 3 2 2 2 3 815 1 2 2 3 1 2 1 3 1 2 3 1 2 1 3 2 1 1 2 2 3 1 3 2 816 2 3 1 2 1 3 1 2 3 2 3 1 1 3 1 1 2 2 2 3 1 2 2 2 817 3 1 1 3 1 2 1 2 2 3 1 1 1 3 1 1 2 2 2 3 1 2 3 2 818 3 1 2 3 2 2 2 1 3 2 3 2 1 3 1 2 1 2 1 3 1 2 2 2 819 3 1 1 2 1 2 2 3 1 3 2 2 1 2 1 1 3 2 1 3 2 1 3 2 820 1 3 2 3 1 3 2 1 1 3 2 1 1 2 1 3 1 1 1 3 1 2 2 2 821 3 2 1 3 1 1 2 1 1 3 2 1 1 2 2 2 3 2 3 1 3 1 2 1 822 3 1 3 2 2 1 2 2 2 3 1 3 1 2 2 2 1 3 1 2 3 2 2 2 823 3 1 1 1 2 3 1 2 3 1 2 2 3 1 1 2 2 2 1 3 1 3 1 2 824 1 1 1 2 1 3 2 3 2 3 1 3 1 1 2 1 3 2 2 1 1 3 2 1 825 1 2 3 2 3 2 2 1 1 3 2 2 3 2 1 3 1 1 3 1 1 2 1 1 826 1 2 1 1 2 3 1 3 2 2 1 1 2 1 3 2 3 2 1 1 3 1 1 3 827 1 2 1 1 3 1 3 1 2 3 2 2 2 1 1 3 2 2 1 3 1 1 1 3 828 2 3 2 2 1 3 2 3 2 2 1 3 1 1 1 2 1 2 3 1 1 1 3 1 829 2 2 2 1 3 1 1 3 1 2 2 3 2 2 1 3 1 2 1 1 3 2 2 3 830 3 2 3 2 1 1 2 3 2 1 2 1 1 3 1 2 1 3 2 2 1 1 3 2 831 2 1 2 2 1 3 1 3 1 3 1 1 1 2 2 3 2 1 3 1 3 1 2 2 832 2 1 3 2 3 1 3 1 2 1 1 1 3 2 1 1 1 3 2 2 2 1 2 3 833 2 2 3 2 3 1 1 1 3 2 2 1 1 3 2 1 1 3 2 2 1 3 2 2 834 1 1 1 3 2 3 2 1 1 3 2 2 3 1 1 3 1 1 2 1 2 2 3 1 835 3 1 1 2 1 3 1 3 2 3 2 2 1 2 2 2 3 1 1 1 2 1 3 1 836 2 1 2 1 1 3 1 3 1 3 1 3 1 2 1 1 3 2 1 1 2 1 1 3 837 2 3 1 3 2 3 1 1 1 2 2 3 1 2 1 3 1 3 2 1 1 1 2 2 838 3 1 2 3 1 1 2 1 1 3 2 2 2 1 1 3 2 3 1 3 1 1 1 2 839 3 2 3 2 3 1 2 1 2 3 2 2 2 1 2 2 3 1 2 2 1 1 3 2 840 2 1 1 1 3 2 3 1 3 2 3 2 1 1 1 2 3 1 2 1 1 2 3 1 841 3 2 1 3 1 3 2 2 2 3 1 2 2 2 3 1 1 1 3 1 1 2 1 2 842 3 1 1 2 1 2 2 3 2 2 1 2 3 2 2 2 3 2 2 1 2 3 1 3 843 3 2 3 2 1 1 2 1 1 3 1 2 3 2 1 2 2 3 2 2 3 2 2 2 844 2 1 1 1 2 2 3 1 2 2 3 2 3 1 3 2 2 3 1 1 3 1 1 2 845 2 3 1 3 1 2 1 3 2 2 1 2 1 3 2 2 1 1 3 2 2 2 1 3 846 1 3 2 2 2 3 2 2 1 1 3 1 2 2 1 2 3 2 1 3 1 1 1 3 847 3 1 1 2 3 2 3 2 1 3 1 1 2 1 1 3 1 3 1 2 2 1 1 1 848 3 2 1 2 2 1 2 3 1 1 1 3 1 1 3 2 2 3 2 2 3 2 2 2 849 3 2 3 2 2 1 2 1 3 1 1 3 2 2 1 1 1 2 3 2 2 1 1 3 850 2 2 1 1 3 1 3 2 1 3 2 3 1 1 2 1 2 3 1 2 1 3 2 1 851 1 1 2 3 2 2 1 2 1 1 3 1 2 3 1 3 1 3 2 2 2 1 3 2 852 1 2 1 2 1 1 3 1 2 2 2 3 1 2 3 2 1 3 2 3 2 1 3 2 853 2 1 2 3 2 2 2 3 2 2 3 2 2 3 2 2 1 1 3 2 2 2 3 1 854 3 1 2 1 3 2 2 2 1 3 2 1 2 1 3 1 1 3 1 2 1 1 1 3 855 3 2 2 3 1 1 2 1 2 1 3 1 3 1 2 1 3 2 1 1 1 2 1 3 856 1 3 1 3 1 1 3 1 2 2 2 1 3 2 1 1 3 1 1 2 3 1 2 1 857 2 3 1 1 2 3 1 3 1 1 1 3 1 2 1 2 2 3 1 3 2 1 2 2 858 2 3 1 1 3 1 2 2 1 2 1 3 2 1 3 2 2 3 2 1 2 1 3 1 859 3 1 2 2 1 3 2 1 3 2 1 2 2 3 1 1 3 1 2 2 1 2 3 2 860 2 3 1 1 1 2 3 2 3 2 1 2 2 2 3 2 1 2 3 2 2 2 1 3 861 1 2 2 1 1 1 3 2 2 3 1 2 1 2 3 1 1 1 3 1 1 3 2 3 862 1 1 2 3 2 1 3 1 3 1 2 2 3 2 1 3 2 3 1 1 2 1 2 2 863 2 2 1 2 2 2 3 2 2 3 1 3 2 3 2 1 1 1 2 3 2 3 1 2 864 1 2 3 2 1 1 2 2 3 2 3 1 1 2 1 1 2 3 2 1 2 3 2 3 865 3 1 2 2 2 3 2 1 2 1 3 1 3 1 2 2 1 3 2 1 1 3 2 1 866 1 1 2 1 2 2 3 2 2 3 2 2 2 1 3 1 3 1 1 1 3 1 1 3 867 1 2 3 1 2 3 1 2 3 2 1 2 2 2 3 2 1 1 1 3 1 3 2 1 868 1 1 2 3 2 1 2 2 2 3 2 3 2 3 1 2 2 3 2 3 2 1 1 1 869 1 3 2 3 2 2 1 2 3 1 1 3 1 1 2 1 3 2 1 1 3 1 1 2 870 3 2 2 1 2 3 2 1 3 1 3 1 2 3 1 1 1 3 1 1 1 2 2 1 871 3 2 2 2 3 2 1 2 2 1 3 1 2 1 1 1 2 3 1 3 2 2 3 2 872 2 3 1 2 2 2 1 2 3 1 3 1 2 2 1 1 3 1 3 1 1 1 3 1 873 2 2 2 3 2 3 2 3 2 2 1 2 2 3 2 1 1 2 2 3 1 3 1 2 874 3 1 2 3 2 3 2 3 1 2 1 2 3 1 2 2 1 1 1 3 1 1 1 2 875 1 3 1 2 2 1 2 1 3 1 2 2 2 3 2 1 3 1 3 1 1 1 3 2 876 3 1 1 3 1 3 2 1 2 3 2 1 1 2 1 3 2 1 2 2 3 2 1 2 877 2 2 2 3 2 1 1 2 3 2 2 3 2 2 3 1 3 2 2 2 1 1 3 1 878 1 3 2 1 1 1 2 1 3 2 1 3 2 1 2 3 1 1 2 1 1 3 1 3 879 3 1 1 2 3 2 2 3 1 1 2 2 3 1 1 1 2 1 2 3 1 3 2 2 880 1 3 2 1 3 2 2 1 1 2 2 3 1 2 1 3 2 1 1 3 2 2 2 3 881 1 3 2 3 2 1 1 1 3 1 1 1 2 3 1 1 2 3 1 1 2 1 1 3 882 2 3 2 2 1 3 1 2 1 2 2 2 3 2 3 1 1 1 2 3 2 3 1 1 883 2 3 2 1 2 3 2 2 3 1 3 2 2 2 3 1 1 2 2 3 2 2 1 2 884 2 3 1 3 2 3 1 1 2 2 1 3 2 2 1 2 3 2 2 3 2 2 1 2 885 3 1 1 3 1 1 1 3 1 1 1 2 3 1 3 1 1 1 3 1 2 2 1 2 886 2 2 1 1 3 2 1 1 3 2 2 3 2 3 2 2 3 1 2 1 2 2 1 3 887 1 2 3 1 2 3 2 3 2 2 2 3 1 2 2 2 3 1 1 2 2 3 1 1 888 1 1 3 2 1 1 3 2 3 1 1 1 2 2 3 2 2 3 2 2 2 3 1 1 889 1 2 3 1 1 3 2 3 2 1 1 1 3 2 2 2 3 1 1 1 3 1 1 1 890 1 3 1 3 1 3 2 1 1 3 1 2 1 1 2 2 3 2 1 2 1 3 2 1 891 2 2 2 1 2 3 1 3 1 2 1 3 1 2 3 1 1 1 2 1 1 3 2 3 892 1 3 1 1 1 2 2 1 3 2 1 3 2 1 1 2 3 1 2 2 2 3 2 3 893 3 1 2 2 2 3 1 3 1 2 2 3 1 1 2 3 1 3 1 1 2 1 2 1 894 3 1 2 2 1 3 1 1 1 3 1 2 3 1 1 2 1 1 1 3 1 2 3 1 895 2 1 3 1 2 1 3 1 1 1 3 2 1 2 1 2 3 2 2 3 2 1 3 2 896 3 1 1 3 1 2 1 3 2 1 1 1 3 2 1 1 1 3 2 1 1 3 2 2 897 1 1 1 2 3 2 3 2 3 2 2 2 1 3 2 1 3 2 2 3 2 1 1 1 898 2 2 3 2 2 3 1 1 3 2 1 1 3 1 3 1 2 3 1 1 2 1 1 1 899 2 1 2 2 2 3 1 3 1 3 1 1 1 3 1 1 1 3 1 3 2 2 2 1 900 2 1 2 2 2 1 3 2 3 1 2 3 1 1 2 2 2 3 2 3 1 2 3 2 901 2 2 1 2 1 3 2 3 1 2 3 1 2 3 1 2 1 1 3 2 2 3 1 2 902 2 1 1 1 3 1 2 1 1 2 2 3 2 1 3 1 1 1 3 2 1 3 2 3 903 3 2 2 2 1 3 2 1 2 2 3 1 2 1 2 2 3 2 3 2 3 2 1 1 904 3 2 3 2 2 3 2 3 1 1 2 1 1 3 1 2 2 3 1 1 1 2 1 2 905 1 1 1 3 1 1 1 3 2 1 2 1 1 1 3 2 3 1 3 1 2 1 3 1 906 2 1 2 2 2 3 2 1 1 3 1 1 3 2 3 2 1 3 1 2 1 2 2 3 907 2 1 3 1 1 3 1 2 3 1 1 1 2 2 3 2 3 1 2 2 2 3 2 2 908 1 2 1 1 2 1 3 2 1 1 3 2 3 1 1 2 3 1 2 3 1 3 1 2 909 1 1 2 3 2 3 1 1 2 1 1 3 1 2 1 1 1 3 2 3 2 3 2 1 910 1 2 2 3 1 1 3 1 2 1 1 1 3 1 2 3 2 2 3 2 2 2 1 3 911 2 3 1 1 1 2 1 3 1 1 3 2 3 1 3 1 2 2 1 2 1 3 2 1 912 1 3 2 2 1 2 2 3 2 3 1 1 1 3 1 3 2 2 2 1 2 3 1 2 913 1 1 1 2 1 3 2 1 3 2 3 1 2 1 3 1 3 1 1 3 1 2 2 2 914 1 3 2 3 2 1 2 3 1 1 3 2 3 2 1 1 2 1 1 3 1 2 2 1 915 2 3 1 2 2 1 1 3 1 2 2 3 2 3 2 1 3 2 3 2 2 1 2 1 916 1 3 2 2 2 1 2 3 1 2 1 2 2 2 3 2 1 3 1 2 3 1 3 2 917 2 1 2 3 2 3 2 1 2 3 1 1 3 1 2 2 1 2 1 3 2 2 1 3 918 3 1 1 1 2 2 3 2 2 3 2 1 2 1 3 1 3 2 3 1 2 1 2 1 919 2 1 3 1 1 1 2 1 3 2 2 2 1 1 3 2 1 2 1 3 2 3 2 3 920 2 3 1 2 2 2 1 3 1 2 3 2 2 2 1 2 2 3 2 3 1 3 1 1 921 1 1 3 2 2 3 1 2 1 2 2 2 3 2 2 3 2 2 1 3 1 2 3 1 922 2 3 1 2 3 2 3 1 2 1 1 2 3 1 3 1 1 2 1 1 1 3 1 1 923 1 1 1 3 2 2 2 1 3 2 2 2 3 2 1 2 2 1 3 2 1 3 1 3 924 1 3 2 2 2 3 1 2 3 2 3 1 2 1 3 2 1 1 1 2 1 3 1 1 925 1 1 3 2 3 2 2 1 2 2 3 1 1 2 3 2 3 1 2 3 2 2 1 2 926 1 1 1 2 2 3 1 1 3 2 3 2 3 1 2 1 1 2 3 2 2 2 3 2 927 3 2 2 2 1 3 2 3 1 2 2 1 1 1 3 1 2 1 3 1 2 2 1 3 928 1 2 1 1 3 2 3 2 1 2 1 1 3 1 3 1 1 3 2 3 2 2 1 1 929 1 2 3 1 1 2 2 2 3 2 2 2 3 2 3 1 2 3 1 1 3 2 2 1 930 1 1 1 3 1 1 2 2 3 1 3 1 1 1 2 3 1 1 1 3 2 2 1 3 931 1 3 2 3 2 1 1 3 1 3 2 1 2 1 1 1 3 2 1 2 2 2 3 1 932 3 1 1 2 2 1 1 3 1 2 2 3 2 2 1 2 1 2 3 2 3 1 3 2 933 2 1 2 3 1 1 1 3 2 3 2 2 3 2 2 2 1 1 3 2 1 1 3 1 934 2 1 1 1 3 2 1 1 1 2 3 2 2 1 2 3 2 3 1 3 1 3 1 1 935 1 1 1 3 1 2 1 2 2 3 1 2 2 3 1 3 1 2 1 3 1 3 2 2 936 1 1 3 2 3 1 2 1 2 3 1 1 2 1 2 3 2 3 1 3 1 1 1 2 937 1 1 1 2 1 3 1 3 2 2 2 3 2 2 1 1 2 3 2 1 1 3 2 3 938 3 1 2 2 2 1 3 1 2 3 1 3 2 2 1 1 3 1 1 2 2 2 1 3 939 2 2 3 2 1 1 1 2 3 1 3 2 3 2 3 1 1 2 1 2 2 3 2 1 940 1 3 2 1 3 2 3 2 1 2 2 2 3 1 3 1 2 1 1 2 1 3 1 1 941 2 3 1 3 2 2 1 1 1 3 1 3 2 2 3 2 2 3 1 2 1 2 2 2 942 1 1 1 3 1 3 2 3 2 1 2 2 1 3 1 1 1 2 1 3 2 2 2 3 943 3 2 2 2 1 3 2 2 1 2 2 2 3 1 2 3 1 3 1 2 1 1 2 3 944 1 1 3 2 3 2 1 1 1 2 3 1 1 2 1 1 1 3 1 3 2 2 3 2 945 1 1 2 1 1 1 3 2 3 1 3 2 1 3 1 1 3 2 3 2 1 1 2 2 946 2 1 2 2 3 1 3 2 2 2 3 2 3 2 1 1 1 3 1 1 3 1 2 1 947 2 2 2 1 2 1 3 2 2 3 2 2 3 2 3 2 2 3 1 1 1 3 2 2 948 1 2 3 1 1 1 2 1 2 3 1 2 2 3 2 3 2 2 2 3 2 2 3 2 949 1 1 1 3 1 3 1 2 3 2 1 1 1 3 2 3 1 3 2 2 1 2 2 1 950 2 2 3 1 1 3 1 1 1 3 2 2 1 3 1 2 3 1 2 3 1 1 2 2 951 1 2 3 2 2 1 2 2 2 3 2 2 2 1 3 2 2 2 3 2 3 2 3 1 952 1 1 1 2 1 2 3 1 1 2 2 2 3 1 1 3 1 3 1 1 3 2 3 1 953 3 1 2 2 1 3 1 2 1 2 1 3 1 1 2 1 2 2 3 1 1 3 1 3 954 2 2 1 3 1 1 2 1 1 3 1 3 1 1 1 2 3 2 1 2 3 2 3 2 955 2 2 2 1 2 3 1 1 1 3 1 3 1 1 3 2 3 2 1 2 2 1 2 3 956 3 2 1 1 3 2 1 2 2 1 1 3 2 3 2 3 1 2 2 2 1 3 2 1 957 1 2 1 1 1 3 1 3 1 1 3 2 1 1 1 3 1 3 2 1 1 1 3 2 958 1 2 2 3 2 2 1 1 2 2 3 1 1 3 2 3 2 1 2 3 1 1 1 3 959 2 1 2 1 2 1 3 2 2 3 1 3 2 2 3 1 3 2 1 1 3 1 2 2 960 2 1 3 1 2 3 1 3 1 2 1 2 1 2 3 1 1 1 3 1 2 1 3 2 961 1 2 1 1 3 1 1 3 1 2 3 1 2 2 2 3 2 3 2 1 1 1 2 3 962 2 2 1 3 2 1 1 2 1 1 3 1 1 1 3 1 2 3 1 1 3 1 3 1 963 3 1 2 2 2 3 2 3 1 3 2 1 1 1 3 2 1 1 1 2 1 3 1 1 964 1 1 1 2 1 3 1 2 3 2 1 3 1 1 2 2 2 3 2 3 2 3 2 2 965 3 1 1 1 2 2 1 3 2 3 2 2 2 3 2 3 2 3 2 1 2 2 1 2 966 1 2 2 2 3 1 3 2 1 2 3 1 2 1 3 1 1 3 1 2 2 3 2 2 967 1 2 1 3 1 3 2 2 3 1 1 3 2 1 2 3 2 1 1 1 3 2 2 2 968 2 1 1 2 2 2 3 2 3 1 1 2 3 2 2 3 2 2 1 2 2 3 2 3 969 2 2 1 3 2 2 2 1 2 3 1 3 1 3 2 3 1 3 1 2 2 2 1 1 970 3 2 2 3 2 2 1 3 1 3 2 3 2 2 2 1 2 3 1 1 1 2 2 2 971 2 2 2 1 2 2 3 2 3 1 2 3 2 3 1 1 1 2 1 1 3 1 3 1 972 3 2 1 1 3 2 1 1 2 1 2 3 1 2 1 3 2 3 1 2 2 1 1 3 973 2 3 1 3 1 2 3 1 2 3 2 1 2 1 2 3 2 1 3 2 1 1 2 1 974 1 1 2 2 3 1 3 1 1 1 3 1 3 1 2 1 1 1 2 3 1 2 1 3 975 2 2 2 3 1 1 3 2 3 1 2 3 2 2 1 3 1 1 2 3 2 2 2 1 976 1 3 2 2 3 2 2 3 2 3 2 1 1 2 2 3 2 2 1 3 2 1 1 1 977 1 2 1 3 2 3 1 3 1 1 3 2 3 1 2 1 1 3 1 2 1 2 2 2 978 3 2 3 2 3 1 2 1 1 3 2 1 1 2 2 3 1 3 2 2 1 1 1 2 979 2 1 3 2 2 1 2 2 3 2 2 2 3 2 3 1 1 2 2 2 3 1 3 1 980 1 2 1 3 2 2 3 1 1 2 1 3 2 1 1 2 2 2 3 1 1 3 1 3 981 1 2 3 2 2 2 3 2 3 2 2 2 3 1 1 2 1 3 1 3 1 1 2 1 982 2 3 1 2 1 1 1 3 1 2 1 2 3 1 3 1 3 1 2 2 3 2 1 1 983 2 1 1 1 3 1 2 3 1 3 1 2 3 2 2 3 2 2 1 1 1 3 2 2 984 1 1 3 2 3 1 1 1 2 2 2 3 2 1 1 3 1 1 2 2 1 3 2 3 985 3 1 1 1 2 3 1 3 1 3 2 2 1 2 2 3 1 2 1 3 2 2 2 1 986 2 2 2 3 2 1 1 1 2 3 1 3 1 2 1 2 1 3 2 3 2 2 1 3 987 3 2 2 1 1 2 2 3 2 3 1 2 1 2 2 2 3 1 2 2 1 3 2 3 988 1 3 1 3 2 3 2 2 3 1 2 1 1 1 3 1 2 3 2 2 2 1 2 1 989 1 1 2 2 3 2 3 1 3 1 1 1 2 2 3 1 2 1 1 3 1 1 3 1 990 2 2 1 1 1 3 1 3 1 1 2 2 3 1 3 1 1 3 1 3 1 1 1 2 991 2 2 3 2 2 1 3 1 1 3 1 1 2 2 3 1 1 2 3 2 1 2 3 2 992 1 3 2 2 1 1 3 1 2 1 2 3 2 3 2 3 1 2 3 2 2 2 1 1 993 2 3 1 3 2 2 1 2 3 2 2 3 2 1 1 2 1 3 1 1 1 2 2 3 994 2 2 1 3 1 2 1 1 3 2 2 2 1 3 1 3 1 2 2 3 1 3 1 1 995 1 2 3 1 3 2 1 1 2 1 1 3 1 3 2 1 2 2 2 3 1 1 3 2 996
2 3 2 2 2 1 1 3 2 3 2 1 1 2 3 1 2 2 2 3 2 2 1 3 997 2 2 3 1 1 3 1 1 3 1 2 2 3 2 2 1 2 2 3 2 2 3 1 1 998 2 1 2 1 3 1 1 1 3 1 2 2 1 1 1 3 1 3 2 3 1 1 2 3 999 2 1 1 1 2 2 3 2 2 1 3 1 1 1 2 2 2 3 1 3 2 3 2 3 1000 1 2 2 3 2 2 1 3 2 3 2 3 2 2 1 2 2 3 1 2 2 1 2 3 1001 3 1 3 1 1 2 2 1 2 3 2 3 2 3 1 1 2 1 2 1 3 1 1 1 1002 2 2 3 1 2 2 3 1 2 1 1 1 3 2 1 1 1 3 1 3 2 3 2 1 1003 3 2 3 2 3 2 1 1 1 2 2 3 1 1 2 1 2 3 2 2 1 1 2 3 1004 1 1 1 3 2 1 1 1 3 1 1 1 3 1 1 3 2 2 2 3 1 1 1 3 1005 2 2 2 1 3 2 2 3 1 1 3 1 1 2 1 3 1 1 1 3 1 1 1 3 1006 3 2 3 2 1 1 2 1 1 3 1 3 2 3 1 1 2 1 3 2 1 1 2 2 1007 2 1 2 2 3 1 1 1 2 1 1 3 1 3 1 3 1 2 2 2 3 2 3 1 1008 1 2 3 1 3 1 1 1 3 1 1 3 1 1 3 2 2 1 1 3 1 2 2 2 1009 1 1 3 1 3 2 3 1 3 2 1 2 1 2 2 3 2 2 1 1 1 3 1 1 1010 2 2 2 3 2 1 1 1 3 2 3 1 2 3 1 2 3 2 1 1 3 1 2 1 1011 3 1 2 3 2 2 1 2 3 2 3 1 2 3 1 1 1 2 1 2 3 2 1 2 1012 3 2 1 3 1 1 2 1 1 1 3 2 3 2 2 1 1 1 3 2 3 2 2 1 1013 1 1 1 3 1 3 2 1 2 3 2 3 2 3 2 1 2 3 1 2 1 2 2 2 1014 1 1 1 3 1 2 1 1 3 1 3 2 2 1 3 2 1 1 1 2 2 3 2 3 1015 1 1 3 1 1 2 2 1 3 1 3 1 1 2 1 1 3 2 3 2 3 1 2 1 1016 3 1 2 1 1 3 1 1 1 3 2 3 1 1 1 2 3 2 1 1 1 2 2 3 1017 3 1 2 3 1 1 1 3 1 2 3 2 2 2 1 1 1 3 2 2 2 3 2 2 1018 1 3 2 3 2 1 1 3 2 1 1 2 1 1 3 2 2 2 3 1 3 1 1 1 1019 3 2 2 3 1 3 1 1 2 2 1 3 1 1 2 2 2 3 1 2 1 1 1 3 1020 2 2 1 1 3 1 1 1 2 2 2 3 2 1 2 3 2 3 2 2 3 2 2 3 1021 1 3 1 1 3 1 2 2 2 1 3 1 2 3 1 1 1 2 3 1 3 2 2 2 1022 2 1 1 3 2 2 2 3 1 3 1 2 1 1 1 3 1 2 3 1 2 1 2 3 1023 2 3 1 3 1 2 1 3 2 2 2 3 2 1 1 2 1 2 3 2 2 2 3 2 1024 1 3 2 2 2 3 1 1 1 2 2 3 2 1 1 3 2 2 2 3 1 2 3 1 1025 2 1 3 1 1 2 2 3 1 2 2 1 1 2 3 1 2 3 1 3 2 1 3 2 1026 1 3 1 3 1 2 2 2 3 2 1 1 2 1 1 3 2 1 2 2 3 1 1 3 1027 1 2 1 1 2 3 1 2 3 2 1 1 2 3 2 1 1 3 2 1 3 2 3 2 1028 2 3 1 1 1 2 2 2 3 1 2 3 1 3 1 3 1 2 1 2 3 2 2 1 1029 2 3 2 3 2 1 1 1 3 2 1 2 1 3 2 2 2 1 2 3 2 2 1 3 1030 2 3 1 1 2 1 1 3 2 3 1 1 1 2 1 3 1 1 2 3 1 1 2 3 1031 1 1 1 3 1 1 1 3 1 2 2 3 2 1 1 2 1 1 3 2 1 3 1 3 1032 1 1 2 3 1 1 1 2 1 3 2 3 2 2 1 1 1 2 3 1 3 2 3 2 1033 3 2 1 3 1 2 1 1 1 3 1 2 3 2 3 1 1 2 2 1 2 3 1 2 1034 3 1 2 1 3 2 1 2 1 2 3 2 3 2 3 2 1 2 2 2 3 2 2 2 1035 1 2 3 2 2 2 3 2 1 3 1 1 1 2 3 2 2 2 3 1 1 3 1 2 1036 1 1 1 2 2 2 3 2 1 3 1 3 1 3 1 1 1 2 2 2 3 2 2 3 1037 2 1 3 1 1 2 1 1 3 1 2 2 1 3 2 1 1 3 2 3 2 1 3 1 1038 2 3 1 2 2 2 1 3 1 3 1 1 1 2 1 2 3 1 3 2 1 3 1 1 1039 1 1 2 1 3 1 3 2 1 2 3 2 2 3 2 2 2 1 2 3 1 3 1 1 1040 3 1 2 3 1 2 3 1 1 3 1 3 2 2 2 1 2 2 3 2 1 1 1 2 1041 1 1 3 2 1 1 1 3 1 1 3 1 1 3 1 1 1 2 3 2 3 2 2 1 1042 2 2 3 1 1 3 1 1 2 2 1 1 3 2 3 2 2 2 1 3 2 3 2 1 1043 1 3 1 1 1 3 1 1 2 3 2 2 3 1 2 2 2 1 2 3 1 2 3 2 1044 3 1 2 2 1 1 1 3 1 3 1 2 3 2 2 3 1 2 2 3 1 1 1 2 1045 1 1 2 3 1 2 1 1 2 2 3 2 2 3 1 3 1 3 1 3 2 1 1 2 1046 3 2 2 2 3 2 2 3 1 1 1 3 2 3 2 1 1 1 3 2 1 2 1 2 1047 2 3 1 3 2 2 1 2 1 2 3 1 3 1 1 1 3 2 3 2 1 1 2 2 1048 2 2 3 2 3 1 3 1 1 1 3 1 1 3 2 1 2 1 2 1 3 1 1 2 1049 3 2 1 1 3 2 2 2 1 3 1 3 2 2 1 2 1 3 1 3 2 2 2 1 1050 3 1 2 1 3 1 2 1 3 1 2 1 1 3 2 2 1 1 2 2 3 1 1 3 1051 1 3 1 3 1 2 3 1 2 2 3 2 2 2 1 2 3 2 1 2 2 1 2 3 1052 1 1 1 3 2 2 1 1 3 1 1 1 2 2 3 2 1 3 2 3 1 2 1 3 1053 2 2 2 3 1 2 1 2 2 3 2 2 2 3 2 3 1 3 2 3 2 1 2 1 1054 1 2 2 2 3 2 1 3 1 1 1 3 2 2 3 2 2 1 2 3 1 3 2 2 1055 3 1 2 2 2 3 1 3 2 1 1 3 2 2 2 1 2 1 3 1 2 3 1 1 1056 1 1 3 1 2 1 1 1 3 2 3 1 3 2 2 3 1 2 2 2 1 3 1 2 1057 3 1 2 1 2 2 3 2 1 1 3 1 2 1 2 3 2 2 3 2 1 1 1 3 1058 3 2 1 1 3 1 3 2 3 2 1 2 2 3 2 1 1 3 2 2 1 1 2 2 1059 3 2 3 2 3 1 2 2 1 3 2 1 1 2 3 1 1 3 2 1 2 2 2 1 1060 3 2 1 1 3 1 1 1 3 1 2 2 1 1 3 2 3 2 2 1 3 2 1 1 1061 1 3 2 1 3 1 1 1 3 2 2 3 1 1 1 2 2 3 1 2 2 1 2 3 1062 2 1 1 3 1 3 1 1 3 2 2 3 1 3 2 1 1 2 3 2 1 2 2 2 1063 3 2 2 1 1 3 1 1 1 2 1 3 2 1 3 1 2 1 1 3 2 3 1 1 1064 2 1 1 3 2 1 1 1 2 2 3 1 1 1 3 2 3 2 1 2 1 3 2 3 1065 1 1 3 1 2 3 2 1 2 3 2 2 2 1 2 2 3 2 2 3 2 3 2 1 1066 1 2 2 2 1 3 1 1 2 1 2 1 3 2 3 1 1 3 1 3 1 2 1 3 1067 3 2 2 1 2 3 1 1 1 3 1 3 2 1 2 3 2 3 2 2 1 1 1 2 1068 2 1 2 2 1 2 3 2 3 1 1 3 1 1 3 1 1 2 3 1 2 2 1 3 1069 2 1 1 2 1 1 3 2 2 3 1 1 3 1 3 1 1 2 2 3 2 2 3 2 1070 2 3 1 2 3 2 2 2 3 1 2 3 2 1 1 2 2 3 2 2 1 1 1 3 1071 3 2 3 1 1 1 3 1 2 2 2 3 1 3 2 2 2 3 2 1 2 1 1 2 1072 1 3 1 3 1 1 2 1 2 1 3 1 2 2 3 1 3 1 2 2 2 3 2 2 1073 2 2 2 3 1 3 1 2 3 2 3 1 2 3 1 2 1 1 1 3 2 2 1 1 1074 3 2 2 3 2 1 1 1 2 2 3 2 1 3 2 1 1 1 3 1 1 3 2 1 1075 3 2 3 2 2 1 2 3 1 2 3 2 2 3 2 2 2 3 2 1 2 2 1 2 1076 1 2 2 1 2 2 3 2 3 2 1 3 1 2 3 2 1 2 2 1 1 3 1 3 1077 3 2 2 1 3 1 1 1 3 1 2 2 2 1 3 1 1 3 2 2 1 3 2 2 1078 2 2 3 2 3 2 1 2 2 1 1 3 1 3 1 3 2 3 1 1 1 2 1 2 1079 3 2 2 2 1 1 3 1 2 1 3 1 1 1 3 1 3 2 3 1 2 2 2 1 1080 1 1 2 3 1 3 1 1 1 2 1 3 1 2 1 3 2 2 1 2 2 3 2 3 1081 2 3 1 1 2 2 3 1 1 2 1 1 3 1 1 2 2 2 3 2 2 3 2 3 1082 1 1 2 1 1 3 1 2 2 3 1 1 2 2 1 3 2 3 1 3 2 1 1 3 1083 1 1 2 3 2 2 2 3 1 3 1 3 1 2 2 2 1 3 2 1 1 1 3 1 1084 1 3 2 2 2 1 3 1 1 2 1 3 1 1 1 2 3 2 3 2 2 2 3 1 1085 2 1 2 1 1 3 2 1 1 3 2 3 2 2 1 1 3 1 2 2 2 3 1 3 1086 3 2 1 3 2 3 1 1 2 1 1 3 2 2 1 3 2 3 2 2 1 1 2 1 1087 1 1 3 2 3 2 3 2 2 1 1 1 3 2 1 1 1 2 3 2 1 3 1 2 1088 1 3 1 3 1 2 3 2 2 2 1 2 3 2 2 3 2 3 1 1 2 2 1 1 1089 1 3 2 2 3 1 1 2 1 2 2 3 1 2 3 1 2 1 1 3 1 1 3 1 1090 2 3 1 1 2 3 2 3 1 3 1 2 3 2 2 2 1 3 1 1 2 1 1 2 1091 1 1 2 1 1 2 3 1 2 3 2 1 1 3 2 2 2 3 1 3 2 2 2 3 1092 1 1 1 3 1 3 2 3 1 1 2 1 3 1 1 1 2 1 1 3 1 3 1 1 1093 1 1 2 1 1 1 3 2 2 1 2 2 3 1 3 1 3 1 3 2 2 2 1 3 1094 1 3 2 1 3 2 3 2 2 3 2 1 3 2 2 2 1 3 2 1 2 1 2 1 1095 3 2 1 1 3 1 1 2 3 2 1 2 2 1 3 1 2 1 2 2 2 3 2 3 1096 3 1 2 1 1 1 2 3 2 2 2 3 1 2 1 1 1 3 2 1 3 2 2 3 1097 1 2 1 3 2 1 2 3 2 1 2 3 2 3 2 3 1 1 3 1 2 2 2 1 1098 1 2 3 1 1 2 3 2 1 3 1 3 2 3 1 2 2 1 3 2 2 2 1 1 1099 3 2 1 3 2 1 2 2 2 1 3 2 3 1 2 3 2 1 1 3 1 1 2 1 1100 1 3 1 1 2 2 3 2 1 2 2 3 1 1 3 1 1 3 1 1 2 1 2 3 1101 2 2 2 1 2 1 3 1 1 2 2 3 1 3 1 3 1 1 3 2 2 1 1 3 1102 1 1 1 3 2 1 3 2 1 3 1 3 1 2 2 2 3 1 3 1 1 2 2 1 1103 2 2 2 1 1 1 3 1 1 1 3 2 1 2 2 3 2 1 1 3 1 3 2 3 1104 1 1 1 2 2 3 1 3 1 1 1 3 2 3 1 1 2 3 1 1 3 2 2 2 1105 1 1 3 1 1 1 2 1 1 3 2 1 2 3 1 2 1 3 2 1 3 2 1 3 1106 1 2 2 2 3 1 1 2 2 3 2 1 2 2 3 2 1 3 2 2 2 3 2 3 1107 1 1 3 1 3 1 1 2 1 1 2 3 2 1 3 1 3 1 2 1 2 1 1 3 1108 2 3 2 3 2 1 1 2 1 3 2 2 3 2 2 1 1 2 3 1 3 2 1 1 1109 2 1 2 1 3 2 2 3 2 1 3 2 2 2 1 3 1 2 3 1 1 2 3 2 1110 1 2 2 3 2 3 2 2 1 3 1 1 2 3 1 2 3 2 2 1 1 2 1 3 1111 3 2 2 2 3 2 1 2 1 3 2 1 2 2 2 3 1 2 2 3 1 2 3 2 1112 1 3 1 3 2 1 1 1 3 2 1 2 3 1 3 2 2 1 2 3 1 1 2 1 1113 3 1 1 1 3 2 2 2 1 1 3 2 3 1 2 3 2 1 2 1 2 2 3 2 1114 2 2 1 1 1 2 3 1 2 1 1 1 3 1 3 2 1 3 2 3 1 1 3 2 1115 2 2 1 1 1 2 3 2 3 2 3 1 3 1 1 3 1 2 3 1 1 2 1 1 1116 1 2 2 2 3 2 1 2 1 1 1 3 2 3 1 1 3 1 1 3 1 3 1 1 1117 2 3 1 2 2 1 3 2 1 2 2 2 3 2 3 1 1 3 1 3 1 2 2 2 1118 2 2 2 3 1 1 2 3 1 1 1 2 2 3 1 2 3 1 2 1 3 1 2 3 1119 1 3 1 3 2 1 1 3 1 2 2 1 1 3 1 1 2 1 1 3 1 1 1 3 1120 1 2 2 3 1 1 2 2 3 1 3 1 1 3 2 3 1 1 3 2 1 1 1 2 1121 2 2 2 1 3 1 3 1 1 3 2 1 2 2 3 2 2 2 3 1 1 1 3 1 1122 2 1 1 1 3 2 3 1 1 1 3 1 2 2 2 3 1 1 1 2 3 1 2 3 1123 3 1 1 1 3 2 2 1 3 1 3 1 1 1 2 3 2 1 3 1 1 1 2 2 1124 3 2 3 1 1 2 1 1 2 3 1 1 3 1 1 3 2 2 1 2 3 2 2 1 1125 2 2 3 2 3 1 1 2 1 1 1 3 2 1 3 1 2 3 2 3 2 2 1 2 1126 2 2 1 2 1 2 3 1 2 1 2 3 1 3 2 2 2 3 2 3 2 2 3 1 1127 2 2 3 1 2 2 2 3 2 3 2 3 1 3 2 1 2 2 1 3 2 2 1 2 1128 1 1 1 3 2 3 1 2 2 1 1 3 2 2 1 3 2 2 2 3 1 3 1 2 1129 2 2 3 2 1 2 2 2 3 2 1 2 1 1 2 3 2 2 3 1 1 3 1 3 1130 3 2 2 2 3 1 1 1 2 2 1 3 2 3 2 3 1 3 1 1 1 2 1 2 1131 1 1 2 3 2 2 3 1 3 1 2 2 3 1 2 1 1 2 3 2 2 3 1 1 1132 2 1 3 2 1 3 2 1 3 2 1 2 2 3 2 2 3 2 1 1 2 1 1 3 1133 3 2 2 3 2 1 1 2 2 2 3 1 3 2 3 2 2 1 3 2 2 1 2 2 1134 2 3 1 1 2 1 2 3 1 2 1 3 2 2 1 3 2 1 1 2 2 3 2 3 1135 2 3 1 2 1 3 2 1 2 3 2 2 2 3 2 3 1 2 2 1 1 1 3 1 1136 3 1 2 3 2 1 2 1 1 1 3 1 3 2 1 2 3 2 2 1 2 1 1 3 1137 1 3 2 3 1 3 1 2 2 2 1 3 1 1 3 1 2 3 2 2 1 2 2 1 1138 1 2 3 1 3 1 1 2 2 2 3 2 2 1 1 1 3 1 3 1 1 1 3 2 1139 1 1 1 3 1 1 2 2 1 3 2 1 2 3 1 2 1 3 1 2 3 1 3 1 1140 2 1 3 1 3 2 2 3 2 1 2 1 3 2 2 2 1 2 1 3 2 2 3 1 1141 3 2 1 3 1 1 2 3 1 2 2 3 2 2 2 1 3 1 1 3 1 2 2 2 1142 3 2 2 2 1 2 3 2 2 2 3 1 3 1 1 3 1 3 2 2 1 2 2 2 1143 2 1 3 1 1 3 2 2 2 3 1 1 1 3 2 2 1 2 2 3 1 2 2 3 1144 3 1 2 3 1 1 3 1 3 2 1 2 2 2 3 2 2 1 2 1 2 3 2 1 1145 3 1 2 3 1 1 2 1 2 1 3 2 1 1 3 2 1 2 2 3 1 3 2 1 1146 2 1 3 2 3 1 2 3 1 1 1 2 2 2 3 1 3 1 2 1 3 1 2 1 1147 3 1 1 1 3 1 1 1 2 2 3 1 1 3 1 3 2 2 2 3 1 2 1 2 1148 1 2 2 2 3 1 3 2 1 2 2 2 3 2 3 2 1 2 2 3 1 1 2 3 1149 1 2 3 1 3 2 2 3 1 1 1 2 2 2 3 1 1 3 2 1 2 2 3 2 1150 2 2 1 1 2 1 3 2 3 1 3 1 3 1 3 2 1 2 1 2 3 2 1 1 1151 1 2 2 1 1 3 1 3 1 3 2 3 1 3 2 1 1 1 2 3 2 1 1 1 1152 1 1 3 1 1 2 1 3 1 2 3 1 3 1 2 2 1 3 1 1 1 2 1 3 1153 1 3 2 2 2 1 1 1 3 1 3 2 2 1 3 1 1 2 2 3 1 1 1 3 1154 3 2 1 1 3 1 2 2 2 3 2 2 3 1 1 2 1 1 1 3 1 1 3 1 1155 1 3 1 3 1 1 1 3 1 1 3 2 2 1 1 1 3 2 3 1 2 1 2 2 1156 2 1 1 2 1 3 1 3 1 1 3 1 3 1 2 3 2 1 2 3 1 1 2 1 1157 2 2 1 2 2 1 3 2 3 1 2 1 1 3 2 3 1 1 3 2 2 2 1 3 1158 1 2 1 1 2 3 2 1 1 1 3 1 2 3 1 3 2 2 2 1 2 3 1 3 1159 2 2 3 1 2 2 2 3 1 3 1 3 2 2 3 1 2 1 1 3 1 2 2 2 1160 1 2 3 1 2 2 1 2 2 3 2 3 2 3 2 1 3 1 1 2 2 1 3 1 1161 2 1 2 1 1 1 3 1 2 1 2 1 3 2 1 3 1 2 3 1 2 3 2 3 1162 2 2 2 1 3 2 2 3 1 3 1 2 3 1 1 3 2 2 1 2 2 1 3 1 1163 1 2 2 3 1 1 2 2 3 1 2 1 2 1 3 2 3 2 1 1 1 3 2 3 1164 3 1 1 3 1 1 1 3 1 2 2 1 2 2 3 2 1 2 2 3 1 3 2 2 1165 1 2 2 3 1 3 2 3 2 1 3 2 3 1 2 2 2 1 3 1 1 1 2 1 1166 1 1 2 1 1 1 3 2 3 2 2 2 1 1 3 1 3 2 1 3 1 3 2 1 1167 3 2 1 3 1 3 1 2 1 1 2 2 3 1 2 3 2 3 2 1 1 2 2 2 1168
[0016]In Table IA, each of the numerals 1 to 3 (numeric identifiers) represents a nucleotide base and the pattern of numerals 1 to 3 of the sequences in the above list corresponds to the pattern of nucleotide bases present in the oligonucleotides of Table I, which oligonucleotides have been found to be non-cross-hybridizing, as described further in the detailed examples. Each nucleotide base is selected from the group of nucleotide bases consisting of A, C, G, and T/U. A particularly preferred embodiment of the invention, in which a specific base is assigned to each numeric identifier is shown in Table I, below.
[0017]In one broad aspect, the invention is a composition comprising molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a group of sequences as specified by numeric identifiers set out in Table IA. In the sequences, each of 1 to 3 is a nucleotide base selected to be different from the others of 1 to 3 with the proviso that up to three nucleotide bases of each sequence can be substituted with any nucleotide base provided that: [0018]for any pair of sequences of the set: [0019]M1≦15, M2≦12, M3≦19, M4≦15, and M5≦18, where: [0020]M1 is the maximum number of matches for any alignment in which there are no internal indels; [0021]M2 is the maximum length of a block of matches for any alignment; [0022]M3 is the maximum number of matches for any alignment having a maximum score; [0023]M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of maximum score; and [0024]M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of maximum score; [0025]wherein: [0026]the score of an alignment is determined according to the equation (A×m)-(B×mm)-(C×(og+eg))-(D×eg)), wherein: [0027]for each of (i) to (iv): (i) m=6, mm=6, og=0 and eg6, (ii) m=6, mm=6, og=5 and eg=1, (iii) m=6, mm=2, og=5 and eg=1, and (iv) m=6, mm=6, og=6 and eg=0, [0028]A is the total number of matched pairs of bases in the alignment; [0029]B is the total number of internal mismatched pairs in the alignment; [0030]C is the total number of internal gaps in the alignment; and [0031]D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; and [0032]wherein the maximum score is determined separately for each of (i), (ii), (iii) and (iv).
[0033]An explanation of the meaning of the parameters set out above is given in the section describing detailed embodiments.
[0034]In another broad aspect, the invention is a composition containing molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a group of sequences as set out in Table IA wherein each of 1 to 3 is a nucleotide base selected to be different from the others of 1 to 3 with the proviso that up to three nucleotide bases of each sequence can be substituted with any nucleotide base provided that: [0035]for any pair of sequences of the set: [0036]M1≦18, M2≦16, M3≦20, M4≦17, and M5≦19, where: [0037]M1 is the maximum number of matches for any alignment in which there are no internal indels; [0038]M2 is the maximum length of a block of matches for any alignment; [0039]M3 is the maximum number of matches for any alignment having a maximum score; [0040]M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of maximum score; and [0041]M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of maximum score; [0042]wherein [0043]the score of an alignment is determined according to the equation (A×m)-(B×mm)-(C×(og+eg))-(D×eg)), wherein: [0044]for each of (i) to (iv): (i) m=6, mm=6, og=0 and eg=6, (ii) m=6, mm=6, og=5 and eg=1, (iii) m=6, mm=2, og=5 and eg=1, and (iv) m=6, mm=6, og=6 and eg=0, [0045]A is the total number of matched pairs of bases in the alignment; [0046]B is the total number of internal mismatched pairs in the alignment; [0047]C is the total number of internal gaps in the alignment; and [0048]D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; and [0049]wherein the maximum score is determined separately for each of (i), (ii), (iii) and (iv).
[0050]In another broad aspect, the invention is a composition comprising molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a group of sequences set out in Table IA wherein each of 1 to 3 is a nucleotide base selected to be different from the others of 1 to 3 with the proviso that up to three nucleotide bases of each sequence can be substituted with any nucleotide base provided that: [0051]for any pair of sequences of the set: [0052]M1≦18, M2≦16, M3≦20, M4≦17, and M5≦19, where: [0053]M1 is the maximum number of matches for any alignment in which there are no internal indels; [0054]M2 is the maximum length of a block of matches for any alignment; [0055]M3 is the maximum number of matches for any alignment having a maximum score; [0056]M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of maximum score; and [0057]M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of maximum score, wherein: [0058]the score of an alignment is determined according to the equation 3A-B-3C-D, wherein: [0059]A is the total number of matched pairs of bases in the alignment; [0060]B is the total number of internal mismatched pairs in the alignment; [0061]C is the total number of internal gaps in the alignment; and [0062]D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; and
[0063]In preferred aspects, the invention provides a composition in which, for the group of 24mer sequences in which 1=A, 2=T and 3=G, under a defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 30% of the degree of hybridization between said sequence and its complement, for all said oligonucleotides of the composition, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the composition does not exceed 50% of the degree of hybridization of the oligonucleotide and its complement.
[0064]More preferably, the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 30% of the degree of hybridization between said sequence and its complement, the degree of hybridization between each sequence and its complement varies by a factor of between 1 and up to 10, more preferably between 1 and up to 9, more preferably between 1 and up to 8, more preferably between 1 and up to 7, more preferably between 1 and up to 6, and more preferably between 1 and up to 5.
[0065]It is also preferred that the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 25%, more preferably does not exceed 20%, more preferably does not exceed 15%, more preferably does not exceed 10%, more preferably does not exceed 5%.
[0066]Even more preferably, the above-referenced defined set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C.
[0067]In the composition, the defined set of conditions can include the group of 24mer sequences being covalently linked to beads.
[0068]In a particular preferred aspect, for the group of 24mers the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 15% of the degree of hybridization between said sequence and its complement and the degree of hybridization between each sequence and its complement varies by a factor of between 1 and up to 9, and for all oligonucleotides of the set, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the set does not exceed 20% of the degree of hybridization of the oligonucleotide and its complement.
[0069]It is possible that each 1 is one of A, T/U, G and C; each 2 is one of A, T/U, G and C; and each 3 is one of A, T/U, G and C; and each of 1, 2 and 3 is selected so as to be different from all of the others of 1, 2 and 3. More preferably, 1 is A or T/U, 2 is A or T/U and 3 is G or C. Even more preferably, 1 is A, 2 is T/U, and 3 is G.
[0070]In certain preferred composition, each of the oligonucleotides is from twenty-two to twenty-six bases in length, or from twenty-three to twenty-five, and preferably, each oligonucleotide is of the same length as every other said oligonucleotide.
[0071]In a particularly preferred embodiment, each oligonucleotide is twenty-four bases in length.
[0072]It is preferred that no oligonucleotide contains more than four contiguous bases that are identical to each other.
[0073]It is also preferred that the number of G's in each oligonucleotide does not exceed L/4 where L is the number of bases in said sequence.
[0074]For reasons described below, the number of G's in each said oligonucleotide is preferred not to vary from the average number of G's in all of the oligonucleotides by more than one. Even more preferably, the number of G's in each said oligonucleotide is the same as every other said oligonucleotide. In the embodiment disclosed below in which oligonucleotides were tested, the sequence of each was twenty-four bases in length and each oligonucleotide contained 6 G's.
[0075]It is also preferred that, for each nucleotide, there is at most six bases other than G between every pair of neighboring pairs of G's.
[0076]Also, it is preferred that, at the 5'-end of each oligonucleotide at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence of the oligonculeotide is a G. Similarly, it is preferred, at the 3'-end of each oligonucleotide that at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence of the oligonucleotide is a G.
[0077]It is possible to have sequence compositions that include one hundred and sixty said molecules, or that include one hundred and seventy said molecules, or that include one hundred and eighty said molecules, or that include one hundred and ninety said molecules, or that include two hundred said molecules, or that include two hundred and twenty said molecules, or that include two hundred and forty said molecules, or that include two hundred and sixty said molecules, or that include two hundred and eighty said molecules, or that include three hundred said molecules, or that include four hundred said molecules, or that include five hundred said molecules, or that include six hundred said molecules, or that include seven hundred said molecules, or that include eight hundred said molecules, or that include nine hundred said molecules, or that include one thousand said molecules.
[0078]It is possible, in certain applications, for each molecule to be linked to a solid phase support so as to be distinguishable from a mixture containing other of the molecules by hybridization to its complement. Such a molecule can be linked to a defined location on a solid phase support such that the defined location for each molecule is different than the defined location for different others of the molecules.
[0079]In certain embodiments, each solid phase support is a microparticle and each said molecule is covalently linked to a different microparticle than each other different said molecule.
[0080]In another broad aspect, the invention is a composition comprising a set of 150 molecules for use as tags or tag complements wherein each molecule includes an oligonucleotide having a sequence of at least sixteen nucleotide bases wherein for any pair of sequences of the set: [0081]M1>19/24×L1, M2>17/24×L1, M3>21/24×L1, M4>18/24×L1, M5>20/24×L1, where L1 is the length of the shortest sequence of the pair, [0082]where: [0083]M1 is the maximum number of matches for any alignment of the pair of sequences in which there are no internal indels; [0084]M2 is the maximum length of a block of matches for any alignment of the pair of sequences; [0085]M3 is the maximum number of matches for any alignment of the pair of sequences having a maximum score; [0086]M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of the pair of sequences of maximum score; [0087]and [0088]M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of the pair of sequences of maximum score, wherein: [0089]the score of an alignment is determined according to the equation (A×m)-(B×mm)-(C×(og+eg))-(D×eg)), wherein: [0090]for each of (i) to (iv): [0091](i) m=6, mm=6, og=0 and pg=6, [0092](ii) m=6, mm=6, og=5 and eg=1, [0093](iii) m=6, mm=2, og=5 and eg=1, and [0094](iv) m=6, mm=6, og=6 and eg=0, [0095]A is the total number of matched pairs of bases in the alignment; [0096]B is the total number of internal mismatched pairs in the alignment; [0097]C is the total number of internal gaps in the alignment; and [0098]D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; and [0099]wherein the maximum score is determined separately for each of (i), (ii), (iii) and (iv).
[0100]In yet another broad aspect, the invention is a composition that includes a set of 150 molecules for use as tags or tag complements wherein each molecule has an oligonucleotide having a sequence of at least sixteen nucleotide bases wherein for any pair of sequences of the set: [0101]M1≦18, M2≦16, M3≦20, M4≦17, and M5≦19, where: [0102]M1 is the maximum number of matches for any alignment of the pair of sequences in which there are no internal indels; [0103]M2 is the maximum length of a block of matches for any alignment of the pair of sequences; [0104]M3 is the maximum number of matches for any alignment of the pair of sequences having a maximum score; [0105]M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of the pair of sequences of maximum score; [0106]and [0107]M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of the pair of sequences of maximum score, wherein: [0108]the score of a said alignment is determined according to the equation 3A-B-3C-D, wherein: [0109]A is the total number of matched pairs of bases in the alignment; [0110]B is the total number of internal mismatched pairs in the alignment; [0111]C is the total number of internal gaps in the alignment; and [0112]D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment.
[0113]In certain embodiments of the invention, each sequence of a composition has up to fifty bases. More preferably, however, each sequence is between sixteen and forty bases in length, or between sixteen and thirty-five bases in length, or between eighteen and thirty bases in length, or between twenty and twenty-eight bases in length, or between twenty-one and twenty-seven bases in length, or between twenty-two and twenty-six bases in length.
[0114]Often, each sequence is of the same length as every other said sequence. In particular embodiments disclosed herein, each sequence is twenty-four bases in length.
[0115]Again, it can be preferred that no sequence contains more than four contiguous bases that are identical to each other, etc., as described above.
[0116]In certain preferred embodiments, the composition is such that, under a defined set of conditions, the maximum degree of hybridization between an oligonucleotide and any complement of a different oligonucleotide of the composition does not exceed about 30% of the degree of hybridization between said oligonucleotide and its complement, more preferably 20%, more preferably 15%, more preferably 10%, more preferably 6%.
[0117]Preferably, the set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C., and the oligonucleotides are covalently linked to microparticles. Of course it is possible that these specific conditions be used for determining the level of hybridization.
[0118]It is also preferred that under such a defined set of conditions, the degree of hybridization between each oligonucleotide and its complement varies by a factor of between 1 and up to 8, more preferably up to 7, more preferably up to 6, more preferably up to 5. In a particular disclosed embodiment, the observed variance in the degree of hybridization was a factor of only 5.3, i.e., the degree of hybridization between each oligonucleotide and its complement varied by a factor of between 1 and 5.6.
[0119]In certain preferred embodiments, under the defined set of conditions, the maximum degree of hybridization between a said oligonucleotide and any complement of a different oligonucleotide of the composition does not exceed about 15%, more preferably 10%, more preferably 6%.
[0120]In one preferred embodiment, the set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C., and the oligonucleotides are covalently linked to microparticles.
[0121]Also, under the defined set of conditions, it is preferred that the degree of hybridization between each oligonucleotide and its complement varies by a factor of between 1 and up to 8, more preferably up to 7, more preferably up to 6, more preferably up to 5.
[0122]Any composition of the invention can include one hundred and sixty of the oligonucleotide molecules, or one hundred and seventy of the oligonucleotide molecules, or one hundred and eighty of the oligonucleotide molecules, or one hundred and ninety of the oligonucleotide molecules, or two hundred of the oligonucleotide molecules, or two hundred and twenty of the oligonucleotide molecules, or two hundred and forty of the oligonucleotide molecules, or two hundred and sixty of the oligonucleotide molecules, or two hundred and eighty of the oligonucleotide molecules, or three hundred of the oligonucleotide molecules, or four hundred of the oligonucleotide molecules, or five hundred of the oligonucleotide molecules, or six hundred of the oligonucleotide molecules, or seven hundred of the oligonucleotide molecules, or eight hundred of the oligonucleotide molecules, or nine hundred of the oligonucleotide molecules, or one thousand or more of the oligonucleotide molecules.
[0123]A composition of the invention can be a family of tags, or it can be a family of tag complements.
[0124]An oligonucleotide molecule belonging to a family of molecules of the invention can have incorporated thereinto one more analogues of nucleotide bases, preference being given those that undergo normal Watson-Crick base pairing.
[0125]The invention includes kits for sorting and identifying polynucleotides. Such a kit can include one or more solid phase supports each having one or more spatially discrete regions, each such region having a uniform population of substantially identical tag complements covalently attached. The tag complements are made up of a set of oligonucleotides of the invention.
[0126]The one or more solid phase supports can be a planar substrate in which the one or more spatially discrete regions is a plurality of spatially addressable regions.
[0127]The tag complements can also be coupled to microparticles. Microparticles preferably each have a diameter in the range of from 5 to 40 μm.
[0128]Such a kit preferably includes microparticles that are spectrophotometrically unique, and therefore distinguisable from each other according to conventional laboratory techniques. Of course for such kits to work, each type of microparticle would generally have only one tag complement associated with it, and usually there would be a different oligonucleotide tag complement associated with (attached to) each type of microparticle.
[0129]The invention includes methods of using families of oligonucleotides of the invention.
[0130]One such method is of analyzing a biological sample containing a biological sequence for the presence of a mutation or polymorphism at a locus of the nucleic acid. The method includes: [0131](A) amplifying the nucleic acid molecule in the presence of a first primer having a 5'-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention to form an amplified molecule with a 5'-end with a sequence complementary to the sequence of the tag; [0132](B) extending the amplified molecule in the presence of a polymerase and a second primer having 5'-end complementary the 3'-end of the amplified sequence, with the 3'-end of the second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3'-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus of the amplified sequence; [0133](C) specifically hybridizing the second primer to a tag complement having the tag complement sequence of (A); and [0134](B) detecting the nucleotide derivative incorporated into the second primer in (B) so as to identify the base located at the locus of the nucleic acid.
[0135]In another method of the invention, a biological sample containing a plurality of nucleic acid molecules is analyzed for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule. This method includes steps of: [0136](A) amplifying the nucleic acid molecule in the presence of a first primer having a 5'-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention to form an amplified molecule with a 5'-end with a sequence complementary to the sequence of the tag; [0137](B) extending the amplified molecule in the presence of a polymerase and a second primer having 5'-end complementary the 3'-end of the amplified sequence, the 3'-end of the second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3'-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus of the amplified molecule; [0138](C) specifically hybridizing the second primer to a tag complement having the tag complement sequence of (A); and [0139](D) detecting the nucleotide derivative incorporated into the second primer in (B) so as to identify the base located at the locus of the nucleic acid;wherein each tag of (A) is unique for each nucleic acid molecule and steps (A) and (B) are carried out with said nucleic molecules in the presence of each other.
[0140]Another method includes analyzing a biological sample that contains a plurality of double stranded complementary nucleic acid molecules for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule. The method includes steps of: [0141](A) amplifying the double stranded molecule in the presence of a pair of first primers, each primer having an identical 5'-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention to form amplified molecules with 5'-ends with a sequence complementary to the sequence of the tag; [0142](B) extending the amplified molecules in the presence of a polymerase and a pair of second primers each second primer having a 5'-end complementary a 3'-end of the amplified sequence, the 3'-end of each said second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3'-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other; [0143](C) specifically hybridizing each of the second primers to a tag complement having the tag complement sequence of (A); and [0144](D) detecting the nucleotide derivative incorporated into the second primers in (B) so as to identify the base located at said locus;wherein the sequence of each tag of (A) is unique for each nucleic acid molecule and steps (A) and (B) are carried out with said nucleic molecules in the presence of each other.
[0145]In yet another aspect, the invention is a method of analyzing a biological sample containing a plurality of nucleic acid molecules for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule, the method including steps of: [0146](a) hybridizing the molecule and a primer, the primer having a 5'-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention and a 3'-end extending to immediately adjacent the locus; [0147](b) enzymatically extending the 3'-end of the primer in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of enzymatic incorporation onto the 3'-end of a growing nucleotide strand; (ii) causes termination of said extension; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus; [0148](c) specifically hybridizing the extended primer formed in step (b) to a tag complement having the tag complement sequence of (a); and [0149](d) detecting the nucleotide derivative incorporated into the primer in step (b) so as to identify the base located at the locus of the nucleic acid molecule;wherein each tag of (a) is unique for each nucleic acid molecule and steps (a) and (b) are carried out with said nucleic molecules in the presence of each other.
[0150]The derivative can be a dideoxy nucleoside triphosphate.
[0151]Each respective complement can be attached as a uniform population of substantially identical complements in specially discrete regions on one or more solid phase support(s).
[0152]Each tag complement can include a label, each such label being different for respective complements, and step (d) can include detecting the presence of the different labels for respective hybridization complexes of bound tags and tag complements.
[0153]Another aspect of the invention includes a method of determining the presence of a target suspected of being contained in a mixture. The method includes the steps of: [0154](i) labelling the target with a first label; [0155](ii) providing a first detection moiety capable of specific binding to the target and including a first tag; [0156](iii) exposing a sample of the mixture to the detection moiety under conditions suitable to permit (or cause) said specific binding of the molecule and target; [0157](iv) providing a family of suitable tag complements of the invention wherein the family contains a first tag complement having a sequence complementary to that of the first tag; [0158](v) exposing the sample to the family of tag complements under conditions suitable to permit (or cause) specific hybridization of the first tag and its tag complement; [0159](vi) determining whether a said first detection moiety hybridized to a first said tag complement is bound to a said labelled target in order to determine the presence or absence of said target in the mixture.
[0160]Preferably, the first tag complement is linked to a solid support at a specific location of the support and step (vi) includes detecting the presence of the first label at said specified location.
[0161]Also, the first tag complement can include a second label and step (vi) includes detecting the presence of the first and second labels in a hybridized complex of the moiety and the first tag complement.
[0162]Further, the target can be selected from the group consisting of organic molecules, antigens, proteins, polypeptides, antibodies and nucleic acids. The target can be an antigen and the first molecule can be an antibody specific for that antigen.
[0163]The antigen is usually a polypeptide or protein and the labelling step can include conjugation of fluorescent molecules, digoxigenin, biotinylation and the like.
[0164]The target can be a nucleic acid and the labelling step can include incorporation of fluorescent molecules, radiolabelled nucleotide, digoxigenin, biotinylation and the like.
DETAILED DESCRIPTION OF THE INVENTION
FIGURES
[0165]Reference is made to the attached figures in which,
[0166]FIG. 1 illustrates generally the steps followed to obtain a family of sequences of the present invention;
[0167]FIG. 2 shows the intensity of the signal (MFI) for each perfectly matched sequence (probe sequences indicated in Table I) and its complement (target, at 50 fmol) obtained as described in Example 1;
[0168]FIG. 3 is a three dimensional representation showing cross-hybridization observed for the sequences of FIG. 2 as described in Example 1. The results shown in FIG. 2 are reproduced along the diagonal of the drawing; and
[0169]FIG. 4 is illustrative of results obtained for an individual target (SEQ ID NO:90, target No. 90) when exposed to the 100 probes of Example 1. The MFI for each bead is plotted.
DETAILED EMBODIMENTS
[0170]The invention provides a method for sorting complex mixtures of molecules by the use of families of oligonucleotide sequence tags. The families of oligonucleotide sequence tags are designed so as to provide minimal cross hybridization during the sorting process. Thus any sequence within a family of sequences will not significantly cross-hybridize with any other sequence derived from that family under appropriate hybridization conditions known by those skilled in the art. The invention is particularly useful in highly parallel processing of analytes.
Families of Oligonucleotide Sequence Tags
[0171]The present invention includes a family of 24mer polynucleotides that have been demonstrated to be minimally cross-hybridizing with each other. This family of polynucleotides is thus useful as a family of tags, and their complements as tag complements.
[0172]In order to be considered for inclusion into the family, a sequence had to satisfy a certain number of rules regarding its composition. For example, repetitive regions that present potential hybridization problems such as four or more of a similar base (e.g., AAAA or TTTT) or pairs of Gs were forbidden. Another rule is that each sequence contains exactly six Gs and no Cs, in order to have sequences that are more or less isothermal. Also required for a 24mer to be included is that there must be at most six bases between every neighboring pair of Gs. Another way of putting this is that there are at most six non-Gs between any two consecutive Gs. Also, each G nearest the 5'-end (resp. 3'-end) of its oligonucleotide (the left-hand (resp. right-hand) side as written in Table I) was required to occupy one of the first to seventh positions (counting the 5'-terminal (resp. 3'-terminal) position as the first position.)
[0173]The process used to design families of sequences that do not exhibit cross-hybridization behavior is illustrated generally in FIG. 1). Depending on the application for which these families of sequences will be used, various rules are designed. A certain number of rules can specify constraints for sequence composition (such as the ones described in the previous paragraph). The other rules are used to judge whether two sequences are too similar. Based on these rules, a computer program can derive families of sequences that exhibit minimal or no cross-hybridization behavior. The exact method used by the computer program is not crucial since various computer programs can derive similar families based on these rules. Such a program is for example described in international patent application No. PCT/CA 01/00141 published under WO 01/59151 on Aug. 16, 2001. Other programs can use different methods, such as the ones summarized below.
[0174]A first method of generating a maximum number of minimally cross-hybridizing polynucleotide sequences starts with any number of non-cross-hybridizing sequences, for example just one sequence, and increases the family as follows. A certain number of sequences is generated and compared to the sequences already in the family. The generated sequences that exhibit too much similarity with sequences already in the family are dropped. Among the "candidate sequences" that remain, one sequence is selected and added to the family. The other candidate sequences are then compared to the selected sequence, and the ones that show too much similarity are dropped. A new sequence is selected from the remaining candidate sequences, if any, and added to the family, and so on until there are no candidate sequences left. At this stage, the process can be repeated (generating a certain number of sequences and comparing them to the sequences in the family, etc.) as often as desired. The family obtained at the end of this method contains only minimally cross-hybridizing sequences.
[0175]A second method of generating a maximum number of minimally cross-hybridizing polynucleotide sequences starts with a fixed-size family of polynucleotide sequences. The sequences of this family can be generated randomly or designed by some other method. Many sequences in this family may not be compatible with each other, because they show too much similarity and are not minimally cross-hybridizing. Therefore, some sequences need to be replaced by new ones, with less similarity. One way to achieve this consists of repeatedly replacing a sequence of the family by the best (that is, lowest similarity) sequence among a certain number of (for example, randomly generated) sequences that are not part of the family. This process can be repeated until the family of sequences shows minimal similarity, hence minimal cross-hybridizing, or until a set number of replacements has occurred. If, at the end of the process, some sequences do not obey the similarity rules that have been set, they can be taken out of the family, thus providing a somewhat smaller family that only contains minimally cross-hybridizing sequences. Some additional rules can be added to this method in order to make it more efficient, such as rules to determine which sequence will be replaced.
[0176]Such methods have been used to obtain the 1168 non-cross-hybridizing tags of Table I that are the subject of this patent application.
[0177]One embodiment of the invention is a composition comprising molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on the group of sequences set out in Table IA, wherein each of the numeric identifiers 1 to 3 (see the Table) is a nucleotide base selected to be different from the others of 1 to 3. According to this embodiment, several different families of specific sets of oligonucleotide sequences are described, depending upon the assignment of bases made to the numeric identifiers 1 to 3.
[0178]The sequences contained in Table I have a mathematical relationship to each other, described as follows.
[0179]Let S and T be two DNA sequences of lengths s and t respectively. While the term "alignment" of nucleotide sequences is widely used in the field of biotechnology, in the context of this invention the term has a specific meaning illustrated here. An alignment of S and T is a 2xp matrix A (with p≧s and p≧t) such that the first (or second) row of A contains the characters of S (or T respectively) in order, interspersed with p-s (or p-t respectively) spaces. It assumed that no column of the alignment matrix contains two spaces, i.e., that any alignment in which a column contains two spaces is ignored and not considered here. The columns containing the same base in both rows are called matches, while the columns containing different bases are called mismatches. Each column of an alignment containing a space in its first row is called an insertion and each colmun containing a space in its second row is called a deletion while a column of the alignment containing a space in either row is called an indel. Insertions and deletions within a sequence are represented by the character `--`. A gap is a continuous sequence of spaces in one of the rows (that is neither immediately preceded nor immediately followed by another space in the same row), and the length of a gap is the number of spaces in that gap. An internal gap is one in which its first space is preceded by a base and its last space is followed by a base and an internal indel is an indel belonging to an internal gap. Finally, a block is a continuous sequence of matches (that is neither immediately preceded nor immediately followed by another match), and the length of a block is the number of matches in that block. In order to illustrate these definitions, two sequences S=TGATCGTAGCTACGCCGCG (of length s=19; SEQ ID NO:1169) and T=CGTACGATTGCAACGT (of length t=16; SEQ ID NO:1170) are considered. Exemplary alignment R1 of S and T (with p=23) is:
TABLE-US-00002 Alignment R1: -- -- -- -- T G A T C G T A G C T A C G C C G C G C G T A C G A T -- -- T -- G C A A C G T -- -- -- -- 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
[0180]Columns 1 to 4, 9, 10, 12 and 20 to 23 are indels, columns 6, 7, 8, 11, 13, 14, 16, 17 and 18 are matches, and columns 5, 15 and 19 are mismatches. Columns 9 and 10 form a gap of length 2, while columns 16 to 18 form a block of length 3. Columns 9, 10 and 12 are internal indels.
[0181]A score is assigned to the alignment A of two sequences by assigning weights to each of matches, mismatches and gaps as follows: [0182]the reward for a match m, [0183]the penalty for a mismatch mm, [0184]the penalty for opening a gap og, [0185]the penalty for extending a gap eg.Once these values are set, a score to each column of the alignment is assigned according to the following rules: [0186]1. assign 0 to each column preceding the first match and to each column following the last match. [0187]2. for each of the remaining columns, assign in if it is a match, -mm if it is a mismatch, -og-eg if it is the first indel of a gap, -eg if it is an indel but not the first indel of a gap.The score of the alignment A is the sum of the scores of its columns. An alignment is said to be of maximum score if no other alignment of the same two sequences has a higher score (with the same values of m, mm, og and eg). A person knowledgeable in the field will recognize this method of scoring an alignment as scoring a local (as opposed to global) alignment with affine gap penalties (that is, gap penalties that can distinguish between the first indel of a gap and the other indels). It will be appreciated that the total number of indels that open a gap is the same as the total number of gaps and that an internal indel is not one of those assigned a 0 in rule (1) above. It will also be noted that foregoing rule (1) assigns a 0 for non-internal mismatches. An internal mismatch is a mismatch that is preceded and followed (not necessarily immediately) by a match.
[0188]As an illustration, if the values of m, mm, og and eg are set to 3, 1, 2 and 1 respectively, alignment R1 has a score of 19, determined as shown below:
TABLE-US-00003 Scoring of Alignment R1 -- -- -- -- T G A T C G T A G C T A C G C C G C G C G T A C G A T -- -- T -- G C A A C G T -- -- -- -- 0 0 0 0 0 3 3 3 -3 -1 3 -3 3 3 -1 3 3 3 0 0 0 0 0
Note that for two given sequences S and T, there are numerous alignments. There are often several alignments of maximum score.
[0189]Based on these alignments, five sequence similarity measures are defined as follows. For two sequences S and T, and weights {m, mm, og, eg}: [0190]M1 is the maximum number of matches over all alignments free of internal indels; [0191]M2 is the maximum length of a block over all alignments; [0192]M3 is the maximum number of matches over all alignments of maximum score; [0193]M4 is the maximum sum of the lengths of the longest two blocks over all alignments of maximum score; [0194]M5 is the maximum sum of the lengths of all the blocks of length at least 3, over all alignments of maximum score.Notice that, by definition, the following inequalities between these similarity measures are obtained: M4≦M3 and M5≦M3. Also, in order to determine M2 it is sufficient to determine the maximum length of a block over all alignments free of internal indels. For two given sequences, the values of M3 to M5 can vary depending on the values of the weights {m, mm, og, eg}, but not M1 and M2.
[0195]For weights {3, 1, 2, 1}, the illustrated alignment is not a maximum score alignment of the two example sequences. But for weights {6, 6, 0, 6} it is; hence this alignment shows that for these two example sequences, and weights {6, 6, 0, 6}, M2≧3, M3≧9, M4≧6 and M5≧6. In order to determine the exact values of M1 to M5, all the necessary alignments need to be considered. M1 and M2 can be found by looking at the s+t-1 alignments free of internal indels, where s and t are the lengths of the two sequences considered. Mathematical tools known as dynamic programming can be implemented on a computer and used to determine M3 to M5 in a very quick way. Using a computer program to do these calculations, it was determined that: [0196]with the weights {6, 6, 0, 6}, M1=8, M2=4, M3=10, M4=6 and M5=6; [0197]with the weights {3, 1, 2, 1}, M1=8, M2=4, M3=10, M4=6 and M5=4.According to the preferred embodiment of this invention, two sequences S and T each of length 24 are too similar if at least one of the following happens: [0198]M1>6 or [0199]M2>13 or [0200]M3>20 or [0201]M4>16 or [0202]M5>19when using either weights {6, 6, 0, 6}, or {6, 6, 5, 1}, or {6, 2, 5, 1}, or {6, 6, 6, 0}. In other words, the five similarity measures between S and T are determined for each of the above four sets of weights, and checked against these thresholds (for a total of 20 tests).
[0203]The above thresholds of 16, 13, 20, 16 and 19, and the above sets of weights, were used to obtain the sequences listed in Table I. Additional sequences can thus be added to those of Table I as long as the above alignment rules are obeyed for all sequences.
[0204]It is also possible to alter thresholds M1, M2, etc., while remaining within the scope of this invention. It is thus possible to substitute or add sequences to those of Table I, or more generally to those of Table IA to obtain other sets of sequences that would also exhibit reasonably low cross-hybridization. More specifically, a set of 24mer sequences in which there are no two sequences that are too similar, where too similar is defined as: [0205]M1>19 or [0206]M2>17 or [0207]M3>21 or [0208]M4>18 or [0209]M5>20when using either weights {6, 6, 0, 6}, or {6, 6, 5, 1}, or {6, 2, 5, 1}, or {6, 6, 6, 0}, would also exhibit low cross-hybridization. Reducing any of the threshold values provides sets of sequences with even lower cross-hybridization. Alternatively, `too similar` can also be defined as: [0210]M1>19 or [0211]M2>17 or [0212]M3>21 or [0213]M4>18 or [0214]M5>20when using either weights {3, 1, 2, 1}. Alternatively, other combinations of weights will lead to sets of sequences with low cross-hybridization.
[0215]Notice that using weights {6, 6, 0, 6} is equivalent to using weights {1, 1, 0, 1}, or weights {2, 2, 0, 2}, . . . (that is, for any two sequences, the values of M1 to M5 are exactly the same whether weights {6, 6, 0, 6} or {1, 1, 0, 1} or {2, 2, 0, 2} or any other multiple of {1, 1, 0, 1} is used).
[0216]When dealing with sequences of length other than 24, or sequences of various lengths, the definition of similarity can be adjusted. Such adjustments are obvious to the persons skilled in the art. For example, when comparing a sequence of length L1 with a sequence of length L2 (with L1<L2), they can be considered as too similar when
M1>19/24×L1
M2>17/24×L1
M3>21/24×L1
M4>18/24×L1
M5>20/24×L1
when using either weights {6, 6, 0, 6}, or {6, 6, 5, 1}, or {6, 2, 5, 1} or {6, 6, 6, 0}.
[0217]Polynucleotide sequences can be composed of a subset of natural bases most preferably A, T and G. Sequences that are deficient in one base possess useful characteristics, for example, in reducing potential secondary structure formation or reduced potential for cross hybridization with nucleic acids in nature. Also, it is preferable to have tag sequences that behave isothermally. This can be achieved for example by maintaining a constant base composition for all sequences such as six Gs and eighteen As or Ts for each sequence. Additional sets of sequences can be designed by extrapolating on the original family of non-cross-hybridizing sequences by simple methods known to those skilled in the art.
[0218]In order to validate the sequence set, a subset of sequences from the family of 1168 sequence tags was selected and characterized, in terms of the ability of these sequences to form specific duplex structures with their complementary sequences, and the potential for cross-hybridization within the sequence set. See Example 1, below. The subset of 100 sequences was randomly selected, and analyzed using the Luminex100 LabMAP® platform. The 100 sequences were chemically immobilized onto the set of 100 different Luminex microsphere populations, such that each specific sequence was coupled to one spectrally distinct microsphere population. The pool of 100 microsphere-immobilized probes was then hybridized with each of the 100 corresponding complementary sequences. Each sequence was examined individually for its specific hybridization with its complementary sequence, as well as for its non-specific hybridization with the other 99 sequences present in the reaction. This analysis demonstrated the propensity of each sequence to hybridize only to its complement (perfect match), and not to cross-hybridize appreciably with any of the other oligonucleotides present in the hybridization reaction.
[0219]It is within the capability of a person skilled in the art, given the family of sequences of Table I, to modify the sequences, or add other sequences while largely retaining the property of minimal cross-hybridization which the polynucleotides of Table I have been demonstrated to have.
[0220]There are 1168 polynucleotide sequences given in Table I. Since all 1168 of this family of polynucleotides can work with each other as a minimally cross-hybridizing set, then any plurality of polynucleotides that is a subset of the 1168 can also act as a minimally cross-hybridizing set of polynucleotides. An application in which, for example, 30 molecules are to be sorted using a family of polynucleotide tags and tag complements could thus use any group of 30 sequences shown in Table I. This is not to say that some subsets may be found in a practical sense to be more preferred than others. For example, it may be found that a particular subset is more tolerant of a wider variety of conditions under which hybridization is conducted before the degree of cross-hybridization becomes unacceptable.
[0221]It may be desirable to use polynucleotides that are shorter in length than the 24 bases of those in Table I. A family of subsequences (i.e., subframes of the sequences illustrated) based on those contained in Table I having as few as 10 bases per sequence could be chosen, so long as the subsequences are chosen to retain homological properties between any two of the sequences of the family important to their non cross-hybridization.
[0222]The selection of sequences using this approach would be amenable to a computerized process. Thus for example, a string of 10 contiguous bases of the first 24mer of Table I could be selected: AAATTGTGAAAGATTGTTTGTGTA (SEQ ID NO:1).
[0223]The same string of contiguous bases from the second 24mer could then be selected and compared for similarity against the first chosen sequence: GTTAGAGTTAATTGTATTTGATGA (SEQ ID NO:2). A systematic pairwise comparison could then be carried out to determine if the similarity requirements are violated. If the pair of sequences does not violate any set property, a 10mer subsequence can be selected from the third 24mer sequence of Table I, and compared to each of the first two 10mer sequences (in a pairwise fashion to determine its compatibility therewith, etc. In this way a family of 10mer sequences may be developed.
[0224]It is within the scope of this invention, to obtain families of sequences containing 11mer, 12mer, 13mer, 14mer, 15mer, 16mer, 17mer, 18mer, 19mer, 20mer, 21mer, 22mer and 23mer sequences by analogy to that shown for 10mer sequences.
[0225]It may be desirable to have a family of sequences in which there are sequences greater in length than the 24mer sequences shown in Table I. It is within the capability of a person skilled in the art, given the family of sequences shown in Table I, to obtain such a family of sequences. One possible approach would be to insert into each sequence at one or more locations a nucleotide, non-natural base or analogue such that the longer sequence should not have greater similarity than any two of the original non-cross-hybridizing sequences of Table I and the addition of extra bases to the tag sequences should not result in a major change in the thermodynamic properties of the tag sequences of that set for example the GC content must be maintained between 10%-40% with a variance from the average of 20%. This method of inserting bases could be used to obtain, for example, a family of sequences up to 40 bases long.
[0226]Given a particular family of sequences that can be used as a family of tags (or tag complements), e.g., those of Table I, a skilled person will readily recognize variant families that work equally as well.
[0227]Again taking the sequences of Table I for example, every T could be converted to an A and vice versa and no significant change in the cross-hybridization properties would be expected to be observed. This would also be true if every G were converted to a C.
[0228]Also, all of the sequences of a family could be taken to be constructed in the 5'-3' direction, as is the convention, or all of the constructions of sequences could be in the opposition direction (3'-5').
[0229]There are additional modifications that can be carried out. For example, C has not been used in the family of sequences. Substitution of C in place of one or more G's of a particular sequence would yield a sequence that is at least as low in homology with every other sequence of the family as was the particular sequence chosen for modification. It is thus possible to substitute C in place of one or more G's in any of the sequences shown in Table I. Analogously, substituting of C in place of one or more A's is possible, or substituting C in place of one or T's is possible.
[0230]It is preferred that the sequences of a given family are of the same, or roughly the same length. Preferably, all the sequences of a family of sequences of this invention have a length that is within five bases of the base-length of the average of the family. More preferably, all sequences are within four bases of the average base-length. Even more preferably, all or almost all sequences are within three bases of the average base-length of the family. Better still, all or almost all sequences have a length that is within two of the base-length of the average of the family, and even better still, within one of the base-length of the average of the family.
[0231]It is also possible for a person skilled in the art to derive sets of sequences from the family of sequences described in this specification and remove sequences that would be expected to have undesirable hybridization properties.
Methods for Synthesis of Oligonucleotide Families
[0232]Preferably oligonucleotide sequences of the invention are synthesized directly by standard phosphoramidite synthesis approaches and the like (Caruthers et al, Methods in Enzymology; 154, 287-313: 1987; Lipshutz et al, Nature Genet.; 21, 20-24: 1999; Fodor et al, Science; 251, 763-773: 1991). Alternative chemistries involving non natural bases such as peptide nucleic acids or modified nucleosides that offer advantages in duplex stability may also be used (Hacia et al; Nucleic Acids Res; 27: 4034-4039, 1999; Nguyen et al, Nucleic Acids Res.; 27, 1492-1498: 1999; Weiler et al, Nucleic Acids Res.; 25, 2792-2799:1997). It is also possible to synthesize the oligonucleotide sequences of this invention with alternate nucleotide backbones such as phosphorothioate or phosphoroamidate nucleotides. Methods involving synthesis through the addition of blocks of sequence in a stepwise manner may also be employed (Lyttle et al, Biotechniques, 19: 274-280 (1995). Synthesis may be carried out directly on the substrate to be used as a solid phase support for the application or the oligonucleotide can be cleaved from the support for use in solution or coupling to a second support.
Solid Phase Supports
[0233]There are several different solid phase supports that can be used with the invention. They include but are not limited to slides, plates, chips, membranes, beads, microparticles and the like. The solid phase supports can also vary in the materials that they are composed of including plastic, glass, silicon, nylon, polystyrene, silica gel, latex and the like. The surface of the support is coated with the complementary tag sequences by any conventional means of attachment.
[0234]In preferred embodiments, the family of tag complement sequences is derivatized to allow binding to a solid support. Many methods of derivatizing a nucleic acid for binding to a solid support are known in the art (Hermanson G., Bioconjugate Techniques; Acad. Press: 1996). The sequence tag may be bound to a solid support through covalent or non-covalent bonds (Iannone et al, Cytometry; 39: 131-140, 2000; Matson et al, Anal. Biochem.; 224: 110-106, 1995; Proudnikov et al, Anal Biochem; 259: 34-41, 1998; Zammatteo et al, Analytical Biochemistry; 280:143-150, 2000). The sequence tag can be conveniently derivatized for binding to a solid support by incorporating modified nucleic acids in the terminal 5' or 3' locations.
[0235]A variety of moieties useful for binding to a solid support (e.g., biotin, antibodies, and the like), and methods for attaching them to nucleic acids, are known in the art. For example, an amine-modified nucleic acid base (available from, eg., Glen Research) may be attached to a solid support (for example, Covalink-NH, a polystyrene surface grafted with secondary amino groups, available from Nunc) through a bifunctional crosslinker (e.g., bis(sulfosuccinimidyl suberate), available from Pierce). Additional spacing moieties can be added to reduce steric hindrance between the capture moiety and the surface of the solid support.
Attaching Tags to Analytes for Sorting
[0236]A family of oligonucleotide tag sequences can be conjugated to a population of analytes most preferably polynucleotide sequences in several different ways including but not limited to direct chemical synthesis, chemical coupling, ligation, amplification, and the like. Sequence tags that have been synthesized with primer sequences can be used for enzymatic extension of the primer on the target for example in PCR amplification.
Detection of Single Nucleotide Polymorphisms Using Primer Extension
[0237]There are a number of areas of genetic analysis where families of non-cross-hybridizing sequences can be applied including disease diagnosis, single nucleotide polymorphism analysis, genotyping, expression analysis and the like. One such approach for genetic analysis, referred to as the primer extension method (also known as Genetic Bit Analysis (Nikiforov et al, Nucleic Acids Res.; 22, 4167-4175: 1994; Head et al Nucleic Acids Res.; 25, 5065-5071: 1997)), is an extremely accurate method for identification of the nucleotide located at a specific polymorphic site within genomic DNA. In standard primer extension reactions, a portion of genomic DNA containing a defined polymorphic site is amplified by PCR using primers that flank the polymorphic site. In order to identify which nucleotide is present at the polymorphic site, a third primer is synthesized such that the polymorphic position is located immediately 3' to the primer. A primer extension reaction is set up containing the amplified DNA, the primer for extension, up to 4 dideoxynucleoside triphosphates (each labeled with a different fluorescent dye) and a DNA polymerase such as the Klenow subunit of DNA Polymerase 1. The use of dideoxy nucleotides ensures that a single base is added to the 3' end of the primer, a site corresponding to the polymorphic site. In this way the identity of the nucleotide present at a specific polymorphic site can be determined by the identity of the fluorescent dye-labeled nucleotide that is incorporated in each reaction. One major drawback to this approach is its low throughput. Each primer extension reaction is carried out independently in a separate tube.
[0238]Universal sequences can be used to enhance the throughput of primer extension assay as follows. A region of genomic DNA containing multiple polymorphic sites is amplified by PCR. Alternatively, several genomic regions containing one or more polymorphic sites each are amplified together in a multiplexed PCR reaction. The primer extension reaction is carried out as described above except that the primers used are chimeric, each containing a unique universal tag at the 5' end and the sequence for extension at the 3' end. In this way, each gene-specific sequence would be associated with a specific universal sequence. The chimeric primers would be hybridized to the amplified DNA and primer extension is carried out as described above. This would result in a mixed pool of extended primers, each with a specific fluorescent dye characteristic of the incorporated nucleotide. Following the primer extension reaction, the mixed extension reactions are hybridized to an array containing probes that are reverse complements of the universal sequences on the primers. This would segregate the products of a number of primer extension reactions into discrete spots. The fluorescent dye present at each spot would then identify the nucleotide incorporated at each specific location. A number of additional methods for the detection of single nucleotide polymorphisms, including but not limited to, allele specific polymerase chain reaction (ASPCR), allele specific primer extension (ASP) and oligonucleotide ligation assay (OLA) can be performed by someone skilled in the art in combination with the tag sequences described herein.
Kits Using Families of Tag Sequences
[0239]The families of non cross-hybridizing sequences may be provided in kits for use in for example genetic analysis. Such kits include at least one set of non-cross-hybridizing sequences in solution or on a solid support. Preferably the sequences are attached to microparticles and are provided with buffers and reagents that are appropriate for the application. Reagents may include enzymes, nucleotides, fluorescent labels and the like that would be required for specific applications. Instructions for correct use of the kit for a given application will be provided.
Examples
Example 1
Cross Talk Behavior of Sequence on Beads
[0240]A group of 100 sequences, randomly selected from Table I, was tested for feasibility for use as a family of minimally cross-hybridizing oligonucleotides. The 100 sequences selected are separately indicated in Table I along with the numbers assigned to the sequences in the tests.
[0241]The tests were conducted using the Luminex LabMAP® platform available from Luminex Corporation, Austin, Tex., U.S.A. The one hundred sequences, used as probes, were synthesized as oligonucleotides by Integrated DNA Technologies (IDT, Coralville, Iowa, U.S.A.). Each probe included a C6 aminolink group coupled to the 5'-end of the oligonucleotide through a C12 ethylene glycol spacer. The C6 aminolink molecule is a six carbon spacer containing an amine group that can be used for attaching the oligonucleotide to a solid support. One hundred oligonucleotide targets (probe complements), the sequence of each being the reverse complement of the 100 probe sequences, were also synthesized by IDT. Each target was labelled at its 5'-end with biotin. All oligonucleotides were purified using standard desalting procedures, and were reconstituted to a concentration of approximately 200 μM in sterile, distilled water for use. Oligonucleotide concentrations were determined spectrophotometrically using extinction coefficients provided by the supplier.
[0242]Each probe was coupled by its amino linking group to a carboxylated fluorescent microsphere of the LapMAP system according to the Luminex100 protocol. The microsphere, or bead, for each probe sequence has unique, or spectrally distinct, light absorption characteristics which permits each probe to be distinguished from the other probes. Stock bead pellets were dispersed by sonication and then vortexing. For each bead population, five million microspheres (400 μL) were removed from the stock tube using barrier tips and added to a 1.5 mL Eppendorf tube (USA Scientific). The microspheres were then centrifuged, the supernatant was removed, and beads were resuspended in 25 μL of 0.2 M MES (2-(N-morpholino)ethane sulfonic acid) (Sigma), pH 4.5, followed by vortexing and sonication. One nmol of each probe (in a 25 μL volume) was added to its corresponding bead population. A volume of 2.5 μL of EDC cross-linker (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (Pierce), prepared immediately before use by adding 1.0 mL of sterile ddH2O to 10 mg of EDC powder, was added to each microsphere population. Bead mixes were then incubated for 30 minutes at room temperature in the dark with periodic vortexing. A second 2.5 μL aliquot of freshly prepared EDC solution was then added followed by an additional 30 minute incubation in the dark. Following the second EDC incubation, 1.0 mL of 0.02% Tween-20 (BioShop) was added to each bead mix and vortexed. The microspheres were centrifuged, the supernatant was removed, and the beads were resuspended in 1.0 mL of 0.1% sodium dodecyl sulfate (Sigma). The beads were centrifuged again and the supernatant removed. The coupled beads were resuspended in 100 μL of 0.1 M MES pH 4.5. Bead concentrations were then determined by diluting each preparation 100-fold in ddH2O and enumerating using a Neubauer BrightLine Hemacytometer. Coupled beads were stored as individual populations at 8° C. protected from light.
[0243]The relative oligonucleotide probe density on each bead population was assessed by Terminal Deoxynucleotidyl Transferase (TdT) end-labelling with biotin-ddUTPs. TdT was used to label the 3'-ends of single-stranded DNA with a labeled ddNTP. Briefly, 180 μL of the pool of 100 bead populations (equivalent to about 4000 of each bead type) to be used for hybridizations was pipetted into an Eppendorf tube and centrifuged. The supernatant was removed, and the beads were washed in 1× TdT buffer. The beads were then incubated with a labelling reaction mixture, which consisted of 5× TdT buffer, 25 mM CoCl2, and 1000 pmol of biotin-16-ddUTP (all reagents were purchased from Roche). The total reaction volume was brought up to 85.5 μL with sterile, distilled H2O, and the samples were incubated in the dark for 1 hour at 37° C. A second aliquot of enzyme was added, followed by a second 1 hour incubation. Samples were run in duplicate, as was the negative control, which contained all components except the TdT. In order to remove unincorporated biotin-ddUTP, the beads were washed 3 times with 200 μL of hybridization buffer, and the beads were resuspended in 50 μL of hybridization buffer following the final wash. The biotin label was detected spectrophotometrically using SA-PE (streptavidin-phycoerythrin conjugate). The streptavidin binds to biotin and the phycoerythrin is spectrally distinct from the probe beads. The 10 mg/mL stock of SA-PE was diluted 100-fold in hybridization buffer, and 15 μL of the diluted SA-PE was added directly to each reaction and incubated for 15 minutes at 37° Celsius. The reactions were analyzed on the Luminex100 LabMAP. Acquisition parameters were set to measure 100 events per bead using a sample volume of 50 μL.
[0244]The results obtained are shown in FIG. 2. As can be seen the Mean Fluorescent Intensity (MFI) of the beads varies from 840.3 to 3834.9, a range of 4.56-fold. Assuming that the labelling reactions are complete for all of the oligonucleotides, this illustrates the signal intensity that would be obtained for each type of bead at this concentration if the target (i.e., labelled complement) was bound to the probe sequence to the full extent possible.
[0245]The cross-hybridization of targets to probes was evaluated as follows. 100 oligonucleotide probes linked to 100 different bead populations, as described above, were combined to generate a master bead mix, enabling multiplexed reactions to be carried out. The pool of microsphere-immobilized probes was then hybridized individually with each biotinylated target. Thus, each target was examined individually for its specific hybridization with its complementary bead-immobilized sequence, as well as for its non-specific hybridization with the other 99 bead-immobilized universal sequences present in the reaction. For each hybridization reaction, 25 μL bead mix (containing about 2500 of each bead population in hybridization buffer) was added to each well of a 96-well Thermowell PCR plate and equilibrated at 37° C. Each target was diluted to a final concentration of 0.002 fmol/μL in hybridization buffer, and 25 μL (50 fmol) was added to each well, giving a final reaction volume of 50 μL. Hybridization buffer consisted of 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 and hybridizations were performed at 37° C. for 30 minutes. Each target was analyzed in triplicate and six background samples (i.e. no target) were included in each plate. A SA-PE conjugate was used as a reporter, as described above. The 10 mg/mL stock of SA-PE was diluted 100-fold in hybridization buffer, and 15 μL of the diluted SA-PE was added directly to each reaction, without removal of unbound target, and incubated for 15 minutes at 37° C. Finally, an additional 35 μL of hybridization buffer was added to each well, resulting in a final volume of 100 μL per well prior to analysis on the Luminex100 LabMAP. Acquisition parameters were set to measure 100 events per bead using a sample volume of 80 μL.
[0246]The percent hybridization was calculated for any event in which the NET MFI was at least 3 times the zero target background. In other words, a calculation was made for any sample where (MFI.sub.sample-MFIzero target background)/MFIzero target background≧3.
[0247]The net median fluorescent intensity (MFI.sub.sample-MFIzero target background) generated for all of the 10,000 possible target/probe combinations was calculated. As there are 100 probes and 100 targets, there are 100×100=10,0000 possible different interactions possible of which 100 are the result of perfect hybridizations. The remaining 9900 result from hybridization of a target with a mismatched probe. A cross-hybridization event is then defined as a non-specific event whose net median fluorescent intensity exceeds 3 times the zero target background. In other words, a cross-talk calculation is only be made for any sample where (MFI.sub.sample-MFIzero target background)/MFIzero target background≧3. Cross-hybridization events were quantified by expressing the value of the cross-hybridization signal as a percentage of the perfect match hybridization signal with the same-probe.
[0248]The results obtained are illustrated in FIG. 3. The ability of each target to be specifically recognized by its matching probe is shown. Of the possible 9900 non-specific hybridization events that could have occurred when the 100 targets were each exposed to the pool of 100 probes, 6 events were observed. Of these 6 events, the highest non-specific event generated a signal equivalent to 5.3% of the signal observed for the perfectly matched pair (i.e. specific hybridization event).
[0249]Each of the 100 targets was thus examined individually for specific hybridization with its complement sequence as incorporated onto a microsphere, as well as for non-specific hybridization with the complements of the other 99 target sequences. Representative hybridization results for target (complement of probe 90, Table I) are shown in FIG. 4. Probe 90 was found to hybridize only to its perfectly-matched target. No cross-hybridization with any of the other 99 targets was observed.
[0250]The foregoing results demonstrate the possibility of incorporating the 1168 sequences of Table I, or any subset thereof, into a multiplexed system with the expectation that most if not all sequences can be distinguished from the others by hybridization. That is, it is possible to distinguish each target from the other targets by hybridization of the target with its precise complement and minimal hybridization with complements of the other targets.
Example 2
Tag Sequences Used in Sorting Polynucleotides
[0251]The family of non cross hybridizing sequence tags or a subset thereof can be attached to oligonucleotide probe sequences during synthesis and used to generate amplified probe sequences. In order to test the feasibility of PCR amplification with non cross hybridizing sequence tags and subsequently addressing each respective sequence to its appropriate location on two-dimensional or bead arrays, the following experiment was devised. A 24mer tag sequence can be connected in a 5'-3' specific manner to a p53 exon specific sequence (20mer reverse primer). The connecting p53 sequence represents the inverse complement of the nucleotide gene sequence. To facilitate the subsequent generation of single stranded DNA post-amplification the tag-Reverse primer can be synthesized with a phosphate modification (PO4) on the 5'-end. A second PCR primer can also be generated for each desired exon, represented by the Forward (5'-3') amplification primer. In this instance the Forward primer can be-labeled with a 5'-biotin modification to allow detection with Cy3-avidin or equivalent.
[0252]A practical example of the aforementioned description is as follows: For exon 1 of the human p53 tumor suppressor gene sequence the following tag-Reverse primer (SEQ ID NO:1171) can be generated:
TABLE-US-00004 222087 222063 5'-PO4-ATGTTAAAGTAAGTGTTGAAATGT-TCCAGGGAAGCGTGTCACCGTCGT-3' Tag Sequence # 3 Exon 1 Reverse
The numbering above the Exon-1 reverse primer represents the genomic nucleotide positions of the indicated bases.The corresponding Exon-1 Forward primer sequence (SEQ ID NO:1172) is as follows:
TABLE-US-00005 221873 221896 5'-Biotin-TCATGGCGACTGTCCAGCTTTGTG-3'
In combination these primers will amplify a product of 214 by plus a 24 by tag extension yielding a total size of 238 bp.Once amplified, the PCR product can be purified using a QIAquick PCR purification kit and the resulting DNA can be quantified. To generate single stranded DNA, the DNA is subjected to λ-exonuclease digestion thereby resulting in the exposure of a single stranded sequence (anti-tag) complementary to the tag-sequence covalently attached to the solid phase array. The resulting product is heated to 95° C. for 5 minutes and then directly applied to the array at a concentration of 10-50 nM. Following hybridization and concurrent sorting, the tag-Exon 1 sequences are visualized using Cy3-streptavidin. In addition to direct visualization of the biotinylated product, the product itself can now act as a substrate for further analysis of the amplified region, such as SNP detection and haplotype determination.
DEFINITIONS
[0253]Non-cross-hybridization: Describes the absence of hybridization between two sequences that are not perfect complements of each other.
[0254]Cross-hybridization: The hydrogen bonding of a single-stranded DNA sequence that is partially but not entirely complementary to a single-stranded substrate.
[0255]Homology or Similarity: How closely related two or more separate strands of DNA are to each other, based on their base sequences.
[0256]Analogue: The symbols A, G, T/U, C take on their usual meaning in the art here. In the case of T and U, a person skilled in the art would understand that these are equivalent to each other with respect to the inter-strand hydrogen-bond (Watson-Crick) binding properties at work in the context of this invention. The two bases are thus interchangeable and hence the designation of T/U. A chemical, which resembles a nucleotide base is an analogue thereof. A base that does not normally appear in DNA but can substitute for the ones, which do, despite minor differences in structure. Analogues particularly useful in this invention are of the naturally occurring bases can be inserted in their respective places where desired. Such an analogue is any non-natural base, such as peptide nucleic acids and the like that undergoes normal Watson-Crick pairing in the same way as the naturally occurring nucleotide base to which it corresponds.
[0257]Complement: The opposite or "mirror" image of a DNA sequence. A complementary DNA sequence has an "A" for every "T" and a "C" for every "G". Two complementary strands of single stranded DNA, for example a tag sequence and its complement, will join to form a double-stranded molecule.
[0258]Complementary DNA (cDNA): DNA that is synthesized from a messenger RNA template; the single-stranded form is often used as a probe in physical mapping.
[0259]Oligonucleotidex Refers to a short nucleotide polymer whereby the nucleotides may be natural nucleotide bases or analogues thereof.
[0260]Tag: Refers to an oligonucleotide that can be used for specifically sorting analytes with at least one other oligonucleotide that when used together do not cross hybridize.
TABLE-US-00006 TABLE I No. in Sequence SEQ ID NO: Ex 1 A A A T T G T G A A A G A T T G T T T G T G T A 1 1 G T T A G A G T T A A T T G T A T T T G A T G A 2 -- A T G T T A A A G T A A G T G T T G A A A T G T 3 -- T G A T G T T A G A A G T A T A T T G T G A A T 4 -- T T T G T G T A G A A T A T G T G T T G T T A A 5 -- A T A A G T G T A A G T G A A A T A A G A A G A 6 -- A A G A G T A T T T G T T G T G A G T T A A A T 7 -- G T G T T T A T G T T A T A T G T G A A G T T T 8 -- A A A G A G A A T A G A A T A T G T G T A A G T 9 -- T A T G A A A G A G T G A G A T A A T G T T T A 10 -- A T G A G A A A T A T G T T A G A A T G T G A T 11 -- T T A G T T G T T G A T G T T T A G T A G T T T 12 -- G T A A A G A G T A T A A G T T T G A T G A T A 13 -- A A A G T A A G A A T G A T G T A A T A A G T G 14 -- G T A G A A A T A G T T T A T T G A T G A T T G 15 -- T G T A A G T G A A A T A G T G A G T T A T T T 16 2 A A A T A G A T G A T A T A A G T G A G A A T G 17 -- A T A A G T T A T A A G T G T T A T G T G A G T 18 -- T A T A G A T A A A G A G A T G A T T T G T T G 19 -- A G A G T T G A G A A T G T A T A G T A T T A T 20 -- A A G T A G T T T G T A A G A A T G A T T G T A 21 -- T T A T G A A A T T G A G T G A A G A T T G A T 22 -- G T A T A T G T A A A T T G T T A T G T T G A G 23 -- G A A T T G T A T A A A G T A T T A G A T G T G 24 4 T A G A T G A G A T T A A G T G T T A T T T G A 25 -- G T T A A G T T T G T T T A T G T A T A G A A G 26 -- G A G T A T T A G T A A A G T G A T A T G A T A 27 -- G T G A A T G A T T T A G T A A A T G A T T G A 28 -- G A T T G A A G T T A T A G A A A T G A T T A G 29 -- A G T G A T A A A T G T T A G T T G A A T T G T 30 -- T A T A T A G T A A A T G T T T G T G T G T T G 31 -- T T A A G T G T T A G T T A T T T G T T G T A G 32 -- G T A G T A A T A T G A A G T G A G A A T A T A 33 -- T A G T G T A T A G A A T G T A G A T T T A G T 34 -- T T G T A G A T T A G A T G T G T T T G T A A A 35 -- T A G T A T A G A G T A G A G A T G A T A T T T 36 -- A T T G T G A A A G A A A G A G A A G A A A T T 37 7 T G T G A G A A T T A A G A T T A A G A A T G T 38 -- A T A T T A G T T A A G A A A G A A G A G T T G 39 -- T T G T A G T T G A G A A A T A T G T A G T T T 40 -- T A G A G T T G T T A A A G A G T G T A A A T A 41 -- G T T A T G A T G T G T A T A A G T A A T A T G 42 -- T T T G T T A G A A T G A G A A G A T T T A T G 43 10 A G T A T A G T T T A A A G A A G T A G T A G A 44 -- G T G A G A T A T A G A T T T A G A A A G T A A 45 -- T T G T T T A T A G T G A A G T G A A T A G T A 46 -- A A G T A A G T A G T A A T A G T G T G T T A A 47 -- A T T T G T G A G T T A T G A A A G A T A A G A 48 -- G A A A G T A G A G A A T A A A G A T A A G A A 49 -- A T T T A A G A T T G T T A A G A G T A G A A G 50 -- G T T T A A A G A T T G T A A G A A T G T G T A 51 -- T T T G T G A A G A T G A A G T A T T T G T A T 52 -- T G T G T T T A G A A T T T A G T A T G T G T A 53 -- G A T A A T G A T T A T A G A A A G T G T T T G 54 -- G T T A T T T G T A A G T T A A G A T A G T A G 55 -- A G T T T A T T G A A A G A G T T T G A A T A G 56 -- T T G T G T T T A T T G T G T A G T T T A A A G 57 -- A T T G T G A G A A G A T A T G A A A G T T A T 58 -- T G A G A A T G T A A A G A A T G T T T A T T G 59 13 A T G T G A A A G T T A T G A T G T T A A T T G 60 -- G T T T A G T A T T A G T T G T T A A G A T T G 61 -- G A T T G A T A T T T G A A T G T T T G T T T G 62 14 T G A A T T G A A A G T G T A A T G T T G T A T 63 -- G A T T G T A T T G T T G A G A A T A G A A T A 64 -- A A A T T T G A G A T T T G T G A T A G A G T A 65 -- G T A A T T A G A T T T G T T T G T T G T T G T 66 -- G T T T G T A T T G T T A G T G A A T A T A G T 67 -- A T G T A G T A G T A G A T G T T T A T G A A T 68 -- T G T T T A A A G A T G A T T G A A G A A A T G 69 -- T G T G A T A A T G A T G T T A T T T G T G T A 70 -- A T A G T T G T G A G A A T T T G T A A T T A G 71 -- A T A G A T G T A A G A G A A A T T G T G A A A 72 -- A G A T T A A G A G A A G T T A A T A G A G T A 73 -- G A A G T A A A T T G T G A A T G A A A G A A A 74 -- A A T G T A A G A A A G A A G A T T G T T G T A 75 -- T T T G A T T T A T G T G T T A T G T T G A G T 76 -- G T A T T G A G A A A T T T G A A G A A T G A A 77 -- G A A T T G T A T G A A A T G A A T T G T A A G 78 -- T A T T G T A G A A G T A A A G T T A G A A G T 79 -- T T T A T G T A A T G A T A A G T G T A G T T G 80 -- A T A T A G T T G A A A T T G T G A T A G T G T 81 -- A T A A G A A A T T A G A G A G T T G T A A A G 82 -- G A A T T G T G A A A T G T G A T T G A T A T A 83 -- A A A T A A G T A G T T T A A T G A G A G A A G 84 -- G A T T A A A G A A G T A A G T G A A T G T T T 85 -- T A T G T G T G T T G T T T A G T G T T A T T A 86 -- G A G T T A T A T G T A G T T A G A G T T A T A 87 -- G A A A G A A A G A A G T G T T A A G T T A A A 88 -- T A G T A T T A G T A A G T A T G T G A T T G T 89 -- T T G T G T G A T T G A A T A T T G T G A A A T 90 -- A T G T G A A A G A G T T A A G T G A T T A A A 91 -- G A T T G A A T G A T T G A G A T A T G T A A A 92 -- A A G A T G A T A G T T A A G T G T A A G T T A 93 17 T A G T T G T T A T T G A G A A T T T A G A A G 94 -- T T T A T A G T G A A T T A T G A G T G A A A G 95 -- G A T A G A T T T A G A A T G A A T T A A G T G 96 18 T T T G A A G A A G A G A T T T G A A A T T G A 97 -- A T G A A T A A G A G T T G A T A A A T G T G A 98 -- T G T T T A T G T A G T G T A G A T T G A A T T 99 -- T T T A A G T G A G T T A T A G A A G T A G T A 100 19 G A T T T A T G T G T T T G A A G T T A A G A T 101 -- T A G T T A G A G A A A G T G A T A A A G T T A 102 -- G T A A T G A T A A T G A A G T G T A T A T A G 103 -- A A T G A A G T G T T A G T A T A G A T A G T A 104 -- T A A A T T G A G T T T G T T T G A T T G T A G 105 -- T A A T G A A G A A T A A G T A T G A G T G T T 106 -- A A A T G T A A T A G T G T T G T T A G T T A G 107 -- A G A G T T A G T G A A A T G T T G T T A A A T 108 -- G A A A T A G A A A T G T A T T G T T T G T G A 109 -- A G T T A T A A G T T T G T G A G A A T T A A G 110 -- G A G T T T A T A G T T A G A A T A T G T T G T 111 -- A G A G T T A T T A G A A G A A G A T T T A A G 112 -- G A G T T A A T G A A A T A A G T A T T T G T G 113 -- A T G A T G A A T A G T T G A A G T A T A T A G 114 -- A T A G A T A T G A G A T G A A A G T T A G T A 115 -- T A T G T A A A G A A A G T G A A A G A A G A A 116 -- T G A A T G T A G A A A T G A A T G T T G A A A 117 -- A A T T G A A T A G T G T G T G A G T T T A A T 118 -- A G A T A T T G T T T G A T T A A T G A A G A G 119 -- A A A G T T G T A A A G T T G A A G A T A A A G 120 -- G T T A A G A G A T T A T G A G A T G T A T T A 121 -- A G A A G A T A T A A G A A G A T T G A A T T G 122 --
G T A G A A A T T T G A A T T G A T G T G A A A 123 -- A A G A G T A G A T T G A T A A G T A T A T G A 124 -- T G A T A T A G T A G T G A A G A A A T A A G T 125 22 A G A T A A T G A T G A G A A A T G A A G A T A 126 -- A T G T G A A A G T A T T T G T G A T A T A G T 127 -- A A T A A G A G A A T T G A T A T G A A G A T G 128 23 T A A G T G T A T T T A G T A G A A T G A A G T 129 -- T A T G T T A G A T T T G T T G A G A T T G A T 130 -- A G T T T G T A T G A A G A G A T A G T A T T T 131 -- G A G A A A T G T T A T G T A T T T A G T A G T 132 -- T A T G T G A G A A T G T G T T T G A T T T A A 133 -- G T A T G T T T G T T T A T A G A A T G T A T G 134 -- G A G T A T A T A G A A G A A A G A A A T T T G 135 -- A T G A G T G A A G T A A A T G T A G T T A T T 136 -- T T A A G A A G T G A G T T A T T G T G A T A T 137 -- A T G A A A T G A G A A T A T T G T T G T T T G 138 -- G A T T A A T G A T T A T G T G A A T T G A T G 139 -- G A A A T G T T A A A G A T A T G A A A G T A G 140 -- T A T T G T T G A T T T G A T A T T A G T G T G 141 -- T T T A T G T T T G T G T A T G T A A G T A G T 142 -- A A T T G A A A G A A T T G T G T G A A T T G A 143 -- T G A G T T T G A A T T T G T T T G A G T A A T 144 -- G A T G T A T A A T G A T G T G T G T A A A T T 145 -- A T G T G A G A G A A G A A T T T G T T T A T T 146 -- G T G A T A A A G T A T T G T T G A T A G A A A 147 -- G A A G T A G A A T A G A A A G T T A A T A G A 148 -- T T G T G T A G T T A A G A G T T G T T T A A T 149 24 T A G T A G T A A G T T G T T A G A A T A G T T 150 -- A A T T T G A A G T A T A A T G A A T G T G T G 151 -- T A G A A A T T G T A G T A T T T G A G A G A A 152 -- T G T A T A T G T T A A T G A G A T G T T G T A 153 25 T A T T T G A T A A G A G A A T G A A G A A G T 154 26 T T G A A T A G T G T A A T G A A T A T G A T G 155 -- G T A G T T T G T G A A T A G A A T T A G T T T 156 -- A A A G A T G A T T G T A A T T T G T G T G A A 157 -- G A A G A T T G T T G A G T T A A T A G A T A A 158 -- A G A T T A T G T A G T G A T G T A A A T G T T 159 -- G A A T T T A G A T G T A G A T A T G A A T G T 160 -- G A T A G A A G T G T A T T A A G T A A G T T A 161 -- T A T G A A T T A T G A G A A G A A T A G A G T 162 -- T T T G T T A T G A A G T G A T T T G T T T G T 163 -- G T A A A G A T T G T G T T A T A T G A A A T G 164 -- T T G T G A T A G T A G T T A G A T A T T T G T 165 28 G A A T T A A G A T A A A G A A G A G A A G T A 166 -- G A T T G T A G A A T G A A T T T G T A G T A T 167 -- A A A T A A G A G A G A G A A T G A T T T A G T 168 -- A A T T A T G T G A A T A G A T T G T T G A A G 169 -- T T A A G A T T T A T G T G A T A G T A G A G T 170 -- T T A A A G A T A G T G T T T G T T G T G T T A 171 -- T A T T G A T T T A T G A A G A G T A T A G T G 172 -- A A A T T T G A T G A G T A G T T T A A G A G A 173 -- A T A A A G T T G T T T G A T G T T T G A A T G 174 -- G A T T G T G A T G A A T A A T G T T A T T G A 175 -- G A T G A A G A A A T A T G A T A T G A A T A G 176 -- T T A A A G T T A T T G A A G T G A A G T T G A 177 -- T T G T A A G A A A T A G A G A T T T G T G T T 178 -- G A G A T T G A G T T T A A G T A T T A G A T T 179 -- A G T G A T A A T A G A A T G A T A A A T G T G 180 -- G A T A A T A G T G A A T T T G A G T T G T A T 181 -- A G A T A T T T G T A G T A G A A A G T A T G T 182 -- G T T A T G A A T G T T G A A T T T G A A T G T 183 -- A T G A A A G A T T T A G T T G T G A G A T A T 184 30 A A A T A G A G A A G T T A T G A T G T G A T A 185 -- T T A G T G A G A A A T G T T T A A T G T G A T 186 -- T G A A G A A T A T G T G A A A T T A G T T T G 187 -- G T T T G A T A G T T T A A T G A G T A T T G A 188 -- G T T G T A A G T A A T G A T A A A G T A T G A 189 -- T A A G A G T A G T A A T T G T T G T T T A G A 190 -- T T T G A G A G A G T A T G T A T G A T T A T T 191 -- A T T G A T T G T G A A T T A G A T A G A A G A 192 -- G A T T A G T A T T T A G T A G T A A T A G A G 193 31 T A T G T A T T A G A G A T A T T G A A A G T G 194 -- T A T G T G A A A G T A A T G A T A A A T G A G 195 -- G T A A T T A G T A A T G A T T T G A A T G A G 196 -- G T T T A T T G T A A A G A T G T A A G T G A A 197 -- T A G T A G A A T T G T T G T T A A A G A A T G 198 32 T A T T G T T A G T T A T G T A G T G T G T A A 199 -- G A G T G A A A G T T A T A T G A A A G T A T A 200 -- A T A T A G A A G T T G A T G A G T T T A T G A 201 -- T T T A G A A G T A A G A A T A A G T G A G T A 202 -- T G T G T A T A A G A T A T T T G T A A G A A G 203 -- T A G A A G A G T T G T A T T G T T A T A A G T 204 -- G T G T T A T T A G T T T A A G T T A G A G T A 205 -- A A T A T A G T G A T G T G A A A T T G A A T G 206 -- T T A G A G A A T A G A G T G A T T A T A G T T 207 -- G A A G T G A G T T A A T G A T T T G T A A A T 208 -- A A T G T A A A G T A A A G A A A G T G A T G A 209 33 G T T A G T T A T G A T G A A T A T T G T G T A 210 34 A A A T G A G T T A G A G T A G A A T T A T G T 211 -- G A T A T A G A A G A T T A G T T A G T G A T A 212 -- A T A G T T T G T T G A G A T T T A T G A G T A 213 -- T A G A A T A G T T A G T A G T A A G A G T A T 214 -- G A A T T T G T A T T G T G A A G T T T A G T A 215 -- G T A G T A A G A A G A G A A T T A G A T T A A 216 -- A A T G T G T T A T G T A T G T A A A T A G T G 217 -- G A A T T A G T T A G A G T A A A T T G T T T G 218 -- G A A A T T G A A G A T A G T A A G A A A T G A 219 -- G T G T A T T A T G T G A T T T A T G A T A G A 220 -- T A T T A T G A G A A A G T T G A A T A G T A G 221 35 T A T G T A T T G T A T T G A G T A G A T G A A 222 -- G T G A T T G A A T A G T A G A T T G T T T A A 223 36 A G T A A G T T G T T T G A T T G A A A T T T G 224 -- G A A G T T T G A T T T A A G T T T A A G A A G 225 -- G A G A A G A T A A A T G A T A T T G T T A T G 226 -- A T G A T G A G T T G T T A A T A G T T A G T T 227 -- T A T G A T A T T T G A A G A G T G T T A A G A 228 -- G A G A T G A T T A A A G T G A T T T A T G A A 229 -- A T A G T T A A G A G T G A T G A G A A T A A A 230 -- T T T A T T G T T A G A T A A A G A G T T G A G 231 -- A G A A T A T T G A T A G T T G A A G T T G A A 232 -- T A G T G T A A A G T G T A G A T T G T A A A T 233 -- A G T A G T G A T A T G A T T T G A A T A T T G 234 -- T G T A T T G A A T T A G A A T A G T G A G A A 235 -- T G A T A T G A G A T A G A A G T T T A A T G T 236 -- G A A G A A G T A A G T A T A A A G T A A A T G 237 -- T T T A A G T G T G A T A A G A A A G A T A G A 238 -- T A T T G T T G A A T G T G T T T A A A G A G A 239 38 G A A T A A T G A T G A G A T G A T T A T T G A 240 -- T A G A G A A A G A G A G A A T T G T A T T A A 241 39 A T G T A T A A T G A G A T A T G T T T G T G A 242 -- A A T A G A T A A G A T T G A T T G T G T T T G 243 40 T T T G A T G A T A A T A G A A G A G A A T G A 244 -- A G A T G A A T A A G T T G T G A A T G T T T A 245 -- A G A T G A A A G A A A G T G T A G A A T A T T 246 -- T G T T A A A T G T A T G T A G T A A T T G A G 247 41 T A G T A G T G T G A A G T T A T T T G T T A T 248 --
A G T G A A T G T T T G T A A A G A G T T T A A 249 -- G A T A A A T G A G A A T T G A G T A A T T G T 250 -- T G A T G A G A A A T T G T T T A A G T G T T T 251 -- A A A T A A G T A G T G T G A G T A A T A G T A 252 -- T A T G A A A T A T G T G A T A G T A A G A G A 253 -- A T T G T A A G A G T G A T T A T A G A T G A T 254 -- A G A G T A A G A A T G A A A G A G A T A A T A 255 -- T A A G T A A G T A G A T G T T A A A G A G A T 256 -- A A A T A G A A A G A A T T G T A G A G T A G T 257 -- A T A G A T T T A A G T G A A G A G A G T T A T 258 42 G A A T G T T T G T A A A T G T A T A G A T A G 259 43 A A A T A G A A T G A G T A G T G A A A T A T G 260 -- T T G A A T T A T G T A G A G A A A G T A A A G 261 -- T A G T A A A T T G A G A G T A G T T G A A T T 262 -- T G T A A A G T G T T T A T A G T G T G T A A T 263 -- A T A T G A T T T G A G A T G A G A A T G T A A 264 -- A A T A T T G A T A T G T G T T G T G A A G T A 265 -- A G T G A G A T T A T G A G T A T T G A T T T A 266 44 T T G T A T T T A G A T A G T G A G A T T A T G 267 -- A T A G A A A T G A A A G A T A G A T A G A A G 268 -- G A T T G T A T A T G T A A A G T A G T T T A G 269 -- T A T G A A T G T T A T T G T G T G T T G A T T 270 45 G A T A T T A G T A G A G T A A G T A T A T T G 271 -- T G A G A T G A A T T T G T G T T A T G A T A T 272 -- T A T G A A T G A A G T A A A G A G A T G T A A 273 -- G A G T G A A T T T G T T G T A A T T T G T T T 274 -- A G A A A T T G T A G A G T T A A T T G T G T A 275 -- G T G T T A A T G A A A G T T G T G A A T A A T 276 -- T G T G A T T T G T T A A G A A G A T T A A T G 277 -- A G T A G T A T T G T A A A G T A T A A A G A G 278 -- T G A T T G T T G T A T A G T T A T T G T G T A 279 -- G A T T G T A G T T T A A T G T T A A G A A T G 280 -- A T G A A A T A A G A A A T T G A G T A G A G A 281 -- T A T G A T G A T A T T T G T T G T A T G T G T 282 -- T T T A G A G T T T G A T T A G T A T G T T T G 283 -- A A T A A G A G A T T G T G A T G A G A A A T A 284 -- A A T G A A T A G A A T A G A G A A T G T A G A 285 -- G T A G T A G T A A T T T G A A T G T T T G A A 286 47 A G T G A G T A A T T G A T T G A T T G T T A A 287 -- G A A T A A T G T T T A G T G T G T T T G A A A 288 -- A T A T G A A A G T A G A G A A A G T G T T A T 289 -- T G A G T T A T T G T A T T T A G T T T G A A G 290 -- T A G T T G A G T T T A A A G T T G A A A G A A 291 -- T A A A G A G T G A T G T A A A T A G A A G T T 292 -- T G T A G T G T T T A G A G T A A G T T A T T A 293 -- A G A G A T T A A T G T G T T G A A A G A T T A 294 -- G T A A T A A G T T G T G A A A G A A G A T T A 295 -- G A G A T G T T A T A G A T A A T G A A A G A A 296 -- T T T A G T T G A T T G T T G A A T A G A G T A 297 -- A T T A T T G A A A G T A G A T G T T A G A T G 298 -- T T T A T G T G T G A T T G A G T G T T T A A T 299 -- T A T T T A G T T A G A T A G A T A G A G A G T 300 -- A T G T G T T T A T G T G A A A G A T T T G T A 301 -- A T A G T A A T T A G A A G A G A A G A A T G T 302 -- T A T G A G T G A T T A G A A T T G T A T T T G 303 -- T T A A T G T A T T G T T T A A A G A G T G T G 304 -- A T A G A G A A T T A A G A A T T G T T T G A G 305 -- G T T A T A A G T A G A A A T G T A T A G A A G 306 -- A G T A A T T A G T T T G A A A T G T G T A G T 307 -- G A A A G A T T A T G A T T G T A A A G T G A T 308 -- G T A A G A T T A G A A G T T A A T G A A G A A 309 48 G A G A A T G T T G A A T A A G A A G T A A T T 310 -- T T A A G A G T G T T T G A A T A G T G T T T A 311 -- A T A A A G A A A G A G T A T G A G A T T A T G 312 -- A G T T A T T G A T T G A A G A T G A G A A A T 313 -- G T T T G T G T T T G T A T A A G T T G T T A A 314 50 T T G T A T G T G A G T T T A G A T T A A T G A 315 -- T A G T T A A A G T A T A G T T G T T T G A G T 316 -- A A A T T T G T G T T G A G A T T T G T A T A G 317 -- T A T T A G T G T T A T G A T A A A G A G A A G 318 -- T A T A A G A A G T A A T T T G A G A A G A G T 319 -- T A A G T T G A G A T G T T T G T T T G A T A A 320 -- G T G T A G A T T T A T G A A T T G A G T A A T 321 -- T A T A G A G A A G T G T T T A G T T G T A T A 322 -- A T A A A G A A G A A T A G T T G T T G T G T A 323 -- A G A T T G A A A T A G A T T A G A A A G T T G 324 -- G T T G T T A T A A G A A A T A G T T T G T T G 325 -- A G A A A T A G A G T A A G A G T G T T T A A A 326 -- A G A G A T A G T A G T A A A T A G T T A T T G 327 -- A A A T G A T T G T G T A A G T T A T G T A T G 328 -- A A G A A G T A A G A G A G A A A T T T G A A T 329 -- G T G T G T A T T T A G T T G A T A A T T G A T 330 -- A T T G T T G T T G T T G A G A A A T G T A T T 331 -- A G A T A A G T T A A A G T A A A G A G A A T G 332 -- T A G T T G A A G T T A G T T T A A G T G T T A 333 -- A G T A A G A A T G T A A T A T G A T G A T A G 334 -- A T G A G A T T G A A A G A T T T A T G A A T G 335 -- T G A T T G A A T T A G A G A G A A T G T A T A 336 -- A G T T A G T A A G A G A A T A T A G T G A A T 337 -- A T T A A G A T T G T A T A G T T A G T G A T G 338 -- G A G A T A A A G A A T T G A A A T A G A A G A 339 -- A G A G T A A A T G T T A A G A A A G A A G T T 340 -- A A A G T T T G T T A T G T G T G A A G A A T T 341 -- A T T G T G T T T A A G A A A T A T G A T G A G 342 -- T A T T G A A A T G A G A T G T A T G T A G T T 343 -- A T T T G T G T G A T G T T T G A A A T A T G A 344 -- T A A G A T A A T A G T G A G A G A A A T T G A 345 -- A T T T A T G A T T A G T G T A A G T G T T G T 346 -- G A T T A A G A A T A A A G T G T G A A G A A T 347 -- G T A A T T G A T G A A G A G T T A G T T T A T 348 -- T G T G T T A T G T T A T A A G A A G T G A T A 349 -- A G A G A A A T T G A A T T T A G A A A T G T G 350 -- T T A T T G A A T G T G A G A A A G T A T T T G 351 -- T G T T A A T G A G A A G A T A A T G A T A G T 352 -- G A A A G T A T T T G T T G A T T A T T G T T G 353 -- T A G T T T A T G T A G T T A A T T G T T G A G 354 -- G T T G A A A G A T A G T T T G A T A T G T A T 355 -- T T A G A A G A T A G A T T A T T G A G A A A G 356 -- A A T A A T G T T G T G A A A T A G A T G T G A 357 56 A G T A A G A A A G T T T A G T T T A G T T A G 358 -- T A G T T T A A T G A G A T G T T T G A T A T G 359 -- T T A A A G A T G T T A A A G A A T G A G T G A 360 -- A A A G T G T G T A T A T G T T A G A A A G T A 361 -- A T T A A G T T A T G T G T T T A T G T G T T G 362 -- T T T G A A G A A G T G T T T G T A T T A T G T 363 -- T G T T A A G A A G T T T A G T T A A A G T T G 364 -- T T T A A G T A T A A G A T T G T G T G A G A T 365 -- A G A T A T T T G A T A G A T A G A A G A A A G 366 -- A T T T A G A G T T G T A A G A A G A T A T T G 367 -- G A G A A A T T G T A A T T G T T A G A G T A T 368 -- G A A G T A T A T G T T A A G A T G T A A T A G 369 -- A A T A T T G A A G A T G T A G T G A G T T A T 370 -- G A G T T T A G A A A T G A T A A A G A A T T G 371 -- T A A G A A A T G A G T T A T A T G T T G A G A 372 60 T T G A T A T A A G A A G T T G T G A T A A G T 373 --
A A G T G T T T A A T G T A A G A G A A T G A A 374 61 G T T G T G A G A A T T A G A A A T A G T A T A 375 -- T T T A G T T T G A T G T G T T T A T G A G A T 376 -- G T A A T T G A A A G T A T G A G T A G T A A T 377 -- T A G T T G A A T A A G A T T G A G A G A A A T 378 -- T T A A G T G A A G T G T T G T T T A T T G A A 379 -- A T T G A T T T G T T G A A A T A A G T G T T G 380 -- T G A A T T G T T G A T A A G T T A T G A A G A 381 -- G T T T G T T A T T G A G T A A G T T G A A T T 382 -- T G A T T T A G T A T G T A T T A G A G T T G A 383 -- T A A A T A G A G A T G A G A A T A A G A A A G 384 -- A G A A T G T T A T A T G T A G A G A A A T T G 385 -- A T T T A T G T A G T T G A G A G T G A T A A A 386 -- G T A A A G A T A G T T T G A G T A A T T T G A 387 -- G A A A T A G T A T A A T G T T A A G T G A G A 388 -- A T T G T A T A T T G T G T T G A A G A A A G T 389 -- G A G T T A A G T G T A A A T G A A A T G T A A 390 -- A T A G A T T G T G T G A A A G A A A G A A T T 391 -- T T A A T A G A A G T T T G T A G T A T G A T G 392 -- T T G T A T G T G A G A A T A A A G T T T A G T 393 -- G T G A T T A G A T A T G A T G A T A T G A A T 394 -- T G A A G A A G A A T T T A G A T T T G T A A G 395 -- T G T A T G A T T A T T G A T T A G T G T G T T 396 -- T G T G A A A G A G A A T G A T A G A T A T T T 397 -- A A T T G A A A T G A G T G T G T T T A A G A A 398 -- A T T A T A G A G T T A G T T T A G A A T G A G 399 -- A A A G A T A G A A A T T G A G T G T A T G A T 400 -- G T A G T T T G T T A A T G T T G T A T A A T G 401 -- A G A G A T A T T A G A A T G T A A G A A T A G 402 64 A G A A G T T T G A A A T A T G A T A G A A T G 403 -- T A G A A T G T A A A G T T T A G T A T A G A G 404 -- A G T A G A T G T A T G T T A A T G T G A A T A 405 -- T G A A A G T G A A A T A T G A A A T G T T G T 406 -- A T A G T A T A T T G A G T T T G T A T G A A G 407 -- G A A G A A A T G T T T G T A G A A T A A G T A 408 -- A A T G A G T A T T G A A G A A A T G T A T A G 409 -- G T G A T A G A A T T T G T G T T T A A T G A A 410 66 T G T A G T A T G A A G A A T A A T G A A A T G 411 -- A T A G A A G T T A A T G A T A A T T G T G T G 412 -- G T G A T T G T A A G T A A G T A A A G A T A A 413 -- T A T G T A G T T T G T G T T A T T T G A A G A 414 -- T G A G T A A G T T T G T A T G T T T A A G T A 415 67 T A A A T G T A T G A G T G T G T A A A G A A A 416 -- G T A A G A G T A T T G A A A T T A G T A A G A 417 68 G T T G A G T G T A A A G A T T A T T G A T A A 418 -- A G T A T G A G T T A T T A G A T A A A G T G A 419 -- A T T T G T T A T A G A G T T G T G T T G T A T 420 -- T A A T T A G T A G T G T G T T G A A A T T T G 421 -- T G T A T T G A G A T T G T T A T T G T A T T G 422 -- G T T A T T A G A A G A G A T A A T T G A G T T 423 -- T T G A G T T G T G A T T A A G T A G T A T A T 424 -- G A T A G T A T A A T G A T T G A A G T A A T G 425 -- G T G A A A G A T A T T T G A G A G A T A A A T 426 -- A G T T A T G A T T T G A A G A A A T T G T T G 427 -- G T A A G T A T T T G A A T T T G A T G A G T T 428 -- T A A T A G T G T T A T A A G T G A A A G A G T 429 -- A A A T G A A T T G A T G T G T A T A T G A A G 430 -- A G A A A G T G A G T T G T T A A G T A T T T A 431 -- T T T A T G T G T G A A T T G T G T A T A T A G 432 -- G T A A T A T G A T A G A A A T G T A A A G A G 433 -- G A G A A T T G T T T A A A G A T A G T T G T A 434 -- G A A T T T G T T A A G A A T G A G T T T G A T 435 -- A T A G T G A T G A T T A A A G A G A A T T T G 436 -- A T A G A T G T T T A G T T G A G A T T A T T G 437 -- A A G A G T G T A A A T A G A A A G T G A T A T 438 -- T G T G T A T T G A T T G T T G A G A T A A A T 439 -- T A G T A T A G T G A G A A A G A G T T A A A T 440 -- A A A G A T A A G A A A G A G A T G A T G T T T 441 -- G A A G T T A T T G A A A T A G A G A A G T A T 442 -- A T G T A T G T A T A G A A A G A G T A A A T G 443 -- G A T G T T T G T A A A G A T T G A A A T T G A 444 -- A A T T T A G A G A G T A T T T G T G T T G T A 445 -- A A T T T G T T T G A A A G A A A G T A A G T G 446 -- A A A G A G T A G T G T T A T T G T T A G A T A 447 -- G T A T G T T G T A T A T G T T G T T G A T A T 448 -- G T A G A A T T T G T T G A G T A T T T G T A A 449 -- A T G A A T T T A G T T A G T G T A A G A A A G 450 -- A T G A T A A G A A A T G T T G A T G A A G T A 451 -- T T G A T G A T G A A G A T A A T G T A G A T A 452 -- A G A T G A T A T G A T A T A G A T T A G A T G 453 -- T T G A A A G T T A G A A A G A T A G A T G T T 454 -- G T T T A A T G T T A G T T A G A A A G T A A G 455 -- G A G A T T T A A G T T T G A A G T G A A A T A 456 -- T T T G T T A G T A G T T G T T A T A A G A G A 457 -- T A T G A G A A T A G T T T G T T A G T G A A T 458 -- T T G A A A G T T T A A A G A A G A G A T A A G 459 -- A A G T G A G T T G A A A T G A A A T A T G T T 460 -- G T T A G A A A T G A A A T G A G T A G T T A T 461 -- T A A G T A T T G T A T T T G T G T G T G T A T 462 -- T G T A T T A G T A A A G A A G A G A G A A T A 463 -- G A G A A G A G A A A T A A G T T G A A A T A A 464 -- G T A A A G T A G A A A T A G A A T T G A G T T 465 -- G T G T G T T A T T T G T T T G T A A A G T A T 466 69 T T T G A T G T A T G A A T A T A G T A T G A G 467 -- A A G A T T G T G T G A A T A G T T G A A A T T 468 -- T A T A A A G T T T G A A G A T G A G T G A T A 469 -- A G A T A A A G A G A T T T A A G A T G T A T G 470 71 G A A G A A T T A A G T T G A G A A T T A A G A 471 -- T A G A G A A A T T T G A T A A A G A A A G A G 472 -- A A A G T T T A T G A A G T T A T T G A G T A G 473 -- A A A T A G T G T A A G T A A A G A G A T G A T 474 -- T A T G A T G A T T T A G T T A T A A G A G T G 475 -- T A G A T A A A T G T T A T G A T G A G T A A G 476 -- A G A T T G A T T G T G A T G A T T T G T A T A 477 -- T T A A G A A G A A T T G T A T A T G A G A G T 478 73 G T A G A A T G T T T A G A G T T G A A T A T A 479 -- G A G A A A T A G T A A G A A G T A A A T A G A 480 -- A T T G A A G T T G T T A T G T G A A G A T T T 481 -- T A A A T G T T G T G T A G A G T A A T T A G A 482 -- A A A T A A G A G T T T G A G A A G T T G T T T 483 -- A G T T G T A A T A A G A A G T G A T T T A A G 484 -- G T T A G A A T G T A T A T A G A G T T A G A T 485 74 T T G A T A T T G A A A G A G A A A G T T A T G 486 -- T T A A A G A G A G A A A T G T T T G A T T A G 487 -- T G T G A A T T T G A G T A T T A G T A A G A A 488 -- T A A T T T G A A T G T G A A A G T T G T T A G 489 -- A T G T G T T T G A A A G A T G A T G A T T T A 490 -- A A G T T A T G T T G A T A T T G A G T G A A A 491 -- T A G A T A A A G A A G A T A G A G A T T T A G 492 -- G A T G A A T G T A G A T A T A T G T A A T G A 493 -- G A A G A A T A G T T T A T G T A A A T G A T G 494 -- G T A G T A T A T A G T T A A A G A T G A G T T 495 -- G T T A T T T G T G T A T G A T T A T G A T T G 496 -- A G A G A T T A G A A A T T G A G A G A A T T A 497 -- G T A T G A T A G A G T T T A T A G T G A T A A 498 -- G T T A G A A A G A A T G A A A T T G A A G T A 499 --
A A G A A T G A G A A T A T A G A G A T G A A T 500 -- A A A G A G A A T A G T G T T T A A G A A G A T 501 -- G A T G T G T T A T T G A T A G A A A T T A G A 502 -- T A G A G T T A T A G A G A T A T T G T A T G A 503 -- G A G A G T T G A A T A A G T T A A A G A T A T 504 -- A G A T A T G A A A T A G A T T G T T A G A G A 505 -- G A G T G A A T A G A A A G A T A T G T T A A T 506 -- A A A G A G A T A T T G A A G A G A A T A A A G 507 -- G T T A T A G A A T A A G T T G T A A A G T G T 508 -- T G A T A G T A T G A T A A T G T G T T T A T G 509 -- T T T G T T G T T A A G T A T G T G A T T T A G 510 77 T A A A G T G T T G T G T T A A A G A T T A A G 511 -- T G T G T T T G A T T G A T T A A T G T T A T G 512 -- A T T A A T G A A T G A G T G T T G T A A T G T 513 -- T A G A T G T T T G T G A G T T T G A T A T T A 514 -- G A A T G A A T A G T A A T A G A T G A T T T G 515 -- A A T A G T G T G T T G T T A T A T G A T T A G 516 -- T A G A T T A G A A G A T G T T G T G T A T T A 517 -- A A T G T G T G T G T T A A A T G A A T T T G T 518 -- G A A T T A A G T A T A T G A G T G T A G A A A 519 -- T T A T T G T G T G T A A G T A G T G T A A A T 520 -- G T A G T A A A G A G A A T T G T T T A G T A T 521 80 A A G T T T G T A A G A A G T A G T T G A A T A 522 -- A G T T A T A G T A T A G T A G T A T A G A G A 523 -- G A A A G A A A T G T G T A T A G T T T A A T G 524 -- T T G T G A G T A A T G A A T G A T G T A T T A 525 -- G T A G A G T T G T A A A T A G A G A A T A A A 526 -- A T T A A T G T A G A T T G T A A G A G A T A G 527 -- T T A G T G T G T T T G T A G A T A G A A T T A 528 -- A G A G A G T T T G T G T A T A T G T A T A A A 529 81 T T A A G T T T A G T G A G A T T T G T T A A G 530 -- A T G A A G T T T A T T G A A T A G T A G T G A 531 -- A T A T T T G T G T T G T A T G T T T G T G A A 532 -- A A A G T G T T T A T A G A A G A T T T G A T G 533 -- A A G A G A T A T G A T T T G T T A G T T G T A 534 -- A A G A A G A A A T G A G T G A T A A T G T A A 535 -- T A G T G T T T G A T A T G T T A A G A A G T T 536 -- G T A G A A A G T G A T A G A T T A G T A A T A 537 -- G A T A A A T G T T A A G T T A G T A T G A T G 538 -- A G A T T A G A A G A A T T G T T T A G A A T G 539 -- A T A T T T G A G A A G T G T G A A A T G A A T 540 -- T G A G T A A A T A G T T T A T G A G T A G T A 541 -- T T A G A G A G T A G A T A A A G A T T T G A T 542 -- A T T G T T T A A G T T G T T G A T A A G A T G 543 -- G T T G T A A A G T T A A A G T G T G A A T T T 544 -- A T A G A T T G T G T G T T T G T T A T A G T A 545 -- G T A A G T T A T T G A G A A T G A T A A T A G 546 -- T A G A T T A G T T G A T A A G T G T G T A A T 547 83 A A A T G T A A A T G A A G A G T G T T T G T T 548 -- G A T A G A A G A A A T G T A T A T A G T G A T 549 -- T A T A G A G T G T A T G T T A T G A T A A A G 550 -- T A T G A A G T G A T A A G A T G A A G A A T T 551 -- T G T T G A G A A T A G T A A G A G A A T T T A 552 -- T A G A T A A T G T G A A G T A A T A A G T G A 553 84 G T A T T A T G A T G A T A G T A G T A A G T A 554 -- A G A T A T G A T T T A G T A T T G A A T G T G 555 -- A A T T A A G T T T G T A G A G T G A T T T G A 556 -- A A G A A A T A G A T G T A G T A A G A T G T T 557 -- T T G A G A A G T T G T T G T A A T A A G A A T 558 -- A G T G T G A A A T A G T G A A A G T T T A A A 559 -- T T T A T G T A G T A G A T T T A T G T G A A G 560 -- A T T A A T G A G A A A T T A G T G T G T T A G 561 -- A T G T T A A T A G T G A T A G T A A A G T G A 562 -- T A T G T T G A T A A A T G A T T A T G A G T G 563 -- T T A T T A G A G T T G T G T G T G A T A T A T 564 -- T G T T G T T A T G A T T G A G T T A G A A T A 565 -- A A T T T G A G T T A A G A A G A A G T G T A A 566 -- A A A G A T A A A G T T A A G T G T T T G T A G 567 88 T G T T G A G A T G A T A T T G T A T A A G T T 568 -- T A A A T A G T G A A T G A G T T A T A G A G T 569 -- A T A G A T G T T A T G A T A G T T A G T T A G 570 -- G T T A A G T G A A G A T A T G T A T T G T T A 571 -- T A A G A A A G T A A A G T T T G T A G A T G T 572 -- A A G A G A A A G T T T G A T T G A A T A A A G 573 -- A T A T T A G A T G T G A G T T A T A T G T G T 574 -- A G T T T G A G T T T A G T A T T G T G A A T A 575 -- A T G T T A A A T G A G A G A T T G T G T A T A 576 -- T A A A T G T T G T G A T T A T T G T G A G A T 577 -- T A A G A A T T G A A G T A A G A G T T A T T G 578 -- A G A G A T A G A A T T A A G T T T G T T G A T 579 -- G A A G A A T G T T A A G A A A T A T G T A A G 580 -- T A T T T G T G A T T A A G A A G T T G A G A A 581 -- A G T T A G A A T T T G T G T A G T A G A A T T 582 -- A A G T T T A T T G T T G A T G T T G T A T T G 583 -- G A A T G A G T T T A A G A G T T T A T A G T A 584 -- A G T G A A G A T T G T A T G T A G T A T A A A 585 -- A G T T G A A A T G A G T A T T A A G T A A T G 586 -- A T G T G T T A T T T G A G A T G A G T A A T T 587 -- A A A T A G T G T T G T T G A A G T T G T T A T 588 -- G T A G A G A A A G A T A T A T G T A G T T T A 589 -- G A G A G T A T T T G A T G A A T G A T T A T A 590 -- G A G T A T A A G T T T A G T G T A T A T T G A 591 -- A T A A T G T G A T T A T T G A T T G A G A G A 592 -- T T A G T T G T T A T G T G A G A G T A A T A A 593 -- A A A T G A G T A T A T T G A A T T G T G A T G 594 -- A A T T A G A A G T A A G T A G A G T T T A A G 595 3 T G T A A G T T T A A A G T A A G A A A T G T G 596 5 G A A A T G A T A A G T T G A T A T A A G A A G 597 -- A A T G A G T A G T T T G T A T T T G A G T T T 598 -- A G T G A A T G T A A G A T T A T G T A T T T G 599 6 G T A A T T G A A T T G A A A G A T A A G T G T 600 8 T A T G T T T A A G T A G T G A A A T A G A G T 601 -- G T A T T G A A A T T G A A T T A G A A G T A G 602 -- A A T A T G T A A T G T A G T T G A A A G T G A 603 -- T G A A T A T T G A G A A T T A T G A G A G T T 604 -- T A G T G T A A A T G A T G A A G A A A G T A T 605 -- G T A T G T G T A A A G A A A T T T G A T G T A 606 -- A A T T G T T T G A A A G T T T G T T G A G A A 607 -- A A T T G T T T G A G T A G T A T T A G T A G T 608 -- T A A T T G A G T T T G A A T A A G A G A G T T 609 -- T G T T G A T T G T A A G T G T T T A T T G T T 610 -- G A A A T T T G T G A G T A T G T A T T T G A A 611 -- T A A G A A T G A A T G T G A A G T G A A T A T 612 -- T A A T G T G A A G T T T G T G A A A G A T A T 613 -- T T G T A T A T G A A A G T A A G A A G A A G T 614 -- T A G A G A G A A G A A G A A A T A A G A A T A 615 -- A T T T G A A A T G T T A A T G A G A G A G A T 616 -- T T G T G T G T A T A T A G T A T T A G A A T G 617 -- A T T G T T A G T A T T G A T G T G A A G T T A 618 -- T G T T T G T A T T T G A A T G A A A T G A A G 619 -- T G T T A G A T T G T G T T A A A T G T A G T T 620 -- T A T A G A G T A T T G T A T A G A G A G A A A 621 -- A A A T A G T A A G A A T G T A G T T G T T G A 622 -- T G A G T G T G A T T T A T G A T T A A G T T A 623 -- A G A A T T T G T T G T A G T G T T A T G A T T 624 --
G A T T G A A G A A A G A A A T A G T T T G A A 625 -- G A T A A T A G A G A A T A G T A G A G T T A A 626 -- G A T T G A A A T T T G T A G T T A T A G T G A 627 -- G A T T T A A G A A G A T G A A T A A T G T A G 628 -- T T T G A G A G A A A G T A G A A T A A G A T A 629 -- G A T T A A G A G T A A A T G A G T A T A A G A 630 -- T T T G A T A G A A T T G A A A T T T G A G A G 631 -- T G A A G A A G A G T G T T A T A A G A T T T A 632 -- G T G A A A T G A T T T A G A G T A A T A A G T 633 -- A A A T A A G A A T A G A G A G A G A A A G T T 634 9 G T T G T A A A G T A A T A G A G A A A T T A G 635 -- A G T G A T T T A G A T T A T G T G A T G A T T 636 -- A G A G T A T A G T T T A G A T T T A T G T A G 637 -- A T G A T T A G A T A G T G A A A T T G T T A G 638 -- A T G A A A T G T A T T A G T T T A G A G T T G 639 -- A T A T T G A G T G A G A G T T A T T G T T A A 640 -- A G A T G T G T A T T G A A T T A A G A A G T T 641 -- T A A T G T G T T G A T A G A A T A G A G A T A 642 -- A A A T T A G T T G A A A G T A T G A G A A A G 643 11 T T T A G A G T T G A A G A A A T G T T A A T G 644 -- G A T T G T T G A T T A T T G A T G A A T T T G 645 -- T G T T G T T G T T G A A T T G A A G A A T T A 646 -- A T T A A G T A A G A A T T G A G A G T T T G A 647 12 G T A T G T T G T A A T G T A T T A A G A A A G 648 15 T A G T T G T G A T T T A T G T A A T G A T T G 649 -- T G A T A A T G A A A G T T T A T A G A G A G A 650 -- G T A A G A T T G T T T G T A T G A T A A G A T 651 -- T T G A A T T A A G A G T A A G A T G T T T A G 652 -- A A G T G T T T G T T T A G A G T A A A G A T A 653 -- A G A G A G A T A A A G T A T A G A A G T T A A 654 -- A T T A T G A A T A G T T A G A A A G A G A G T 655 -- T T G T T G A T A T T A G A G A A T G T G T T T 656 -- T T T A T T G A G A G T T T G T T A T T T G T G 657 -- A G T G T T A A G A A G T T G A T T A T T G A T 658 -- G A G A A A T G A T T G A A T G T T G A T A A T 659 -- G A T A A G T A T T A G T A T G A G T G T A A T 660 -- T T T G A T T T A A G A G T G T T G A A T G T A 661 16 A A G T T A G T A A A T A G A G T A G A A A G A 662 -- G T A A A G T A T G A A T A T G T G A A A T G T 663 -- T A A T A A G T G T G T T G T G A A T G T A A T 664 -- A A A G A T T T A G A G T A G A A A G A G A A T 665 -- T T A G T T T G A G T T G A A A T A G T A A A G 666 -- T A A T A G T A T G A G T A A G A T T G A A A G 667 -- G A A G A T T A G A T T G A T G T T A G T T A A 668 -- T A A A G A G A G A A G T T A G T A A T A G A A 669 -- T A A G T A T G A G A A A T G A T G T G T T A T 670 -- G A G T T T G T T T G T T A G T T A T T G A T A 671 -- A A G T A A A G A A A T G T T A A G A G T A G T 672 -- A T G A G A A T T G T T G T T G A A A T G T A A 673 -- T T A G A T T A G A G T A G T A G A A G A A T A 674 -- T A G T G A T G A A G A A G T T A G A A A T T A 675 -- T A A T G T A G T A A T G T G A T G A T A A G T 676 -- T T G A G A A A G A A T A A G T A G T G T A A A 677 -- T A A T G A G T G A G A T T A T A G A T T G T T 678 -- G T A T A A G A A A T G T G T G T T T G A T T A 679 -- G T G A A T G T G T T A A T G A A G A T A T A T 680 -- G A A A G T T A T T A G T A G T T A A A G A T G 681 -- T A G A A T T G T G T T T G A T A A G T G A T A 682 -- T G A T T T A G A T T G A G A G T T A A A T G A 683 -- A T T A T T G A G T T T G A A T G T T G A T A G 684 -- A T A G T A G T T A T G T T T G A T T T A G T G 685 -- A T A G A A G A A G A A T A A A G T T A G A G A 686 -- G A T G T T G A A A G T A A T G A A T T T G T A 687 -- G A G A T T G A T A G T A G A A A T G A T A A A 688 -- T G A G A G A A T A A A G T A T G A A T T T G A 689 -- T A T A A A G A T G A T G T G A A T T A G T A G 690 -- T T A T G T A A G A A T G T T T G A G A G A A A 691 -- A G T A A A T G A T G A A T G A T A T G A T G A 692 -- G A A A T T T G T G T T A A A G T T G A A T G A 693 -- G A T G A A T G A T T G T G T T T A A G T A T A 694 -- G A A A T A A G T G A G A G T T A A T G A A A T 695 -- T G T T G A A A T A G T T A T T A G T T T G T G 696 -- T T T G A G A G T A T A T T G A T A T G A G A A 697 -- A T T G T G T G T A A A G T A A G A T T T A A G 698 -- T A T A G T T T G A A G T G T G A T G T A T T T 699 -- G T G A A G T T A T A G T G T A T A A A G A A T 700 -- G T A T G T T G A A T A G T A A A T A G A T T G 701 -- T T A G A A A G T G T G A T T T G T G T A T T T 702 -- T T T A G T A A T A T G T A A G A G A T G T G A 703 -- A G T A T G T A T A G A T G A T G T T T G T T T 704 -- A T T T A A G T A A A G T G T A G A G A T A A G 705 20 A T T T G T G T T G A A T T G T A A A G T G A A 706 -- A T G T T A T T A G A T T G T G A T G A A T G A 707 -- T A G T A G T A G A A T A T G A A A T T A G A G 708 -- T T T A A T G A G A A G A G T T A G A G T A T A 709 -- A A A G T T T A G T A G A G T G T A T G T A A A 710 -- A T A T A T G A T A G T A G A G T A G A T T A G 711 -- T G A G A A G T T A A T T G T A T A G A T T G A 712 -- T A T A G A G A T G T T A T A T G A A G T T G T 713 -- A A A T T T G T T A A G T T G T T G T T G T T G 714 -- T T G T T G A A G A T G A A A G T A G A A T T A 715 -- A A G A G A T A A G T A G T G T T T A T G T T T 716 -- A A T A A G A A G A A G T G A A A G A T T G A T 717 -- T A A G T T A A A G T T G A T G A T T G A T A G 718 -- A T A T A A G A T A A G A G T G T A A G T G A T 719 -- G T T A A A T G T T G T T G T T T A A G T G A T 720 -- G A G T T A A G T T A T T A G T T A A G A A G T 721 -- T A T T A G A G T T T G A G A A T A A G T A G T 722 21 T A A T G T T G T T A T G T G T T A G A T G T T 723 -- G A A A G T T G A T A G A A T G T A A T G T T T 724 -- T G A T A G A T G A A T T G A T T G A T T A G T 725 -- A T G A T A G A G T A A A G A A T A A G T T G T 726 -- A G T A A G T G T T A G A T A G T A T T G A A T 727 27 A T G T A G A T T A A A G T A G T G T A T G T T 728 -- T T A T T G A T A A T G A G A G A G T T A A A G 729 -- A T T T G T T A T G A T A A A T G T G T A G T G 730 29 T T G A A G A A A T A A G A G T A A T A A G A G 731 -- T G T G T A A T A A G T A G T A A G A T T A G A 732 -- A T G A A A G T T A G A G T T T A T G A T A A G 733 37 A T T A G T T A A G A G A G T T T G T A G A T T 734 -- T G T A G T A T T G T A T G A T T A A A G T G T 735 -- A G T T G A T A A A G A A G A A G A G T A T A T 736 -- G T A A T G A G A T A A A G A G A G A T A A T T 737 -- T G T G T T G A A G A T A A A G T T T A T G A T 738 -- A A G A A G A G T A G T T A G A A T T G A T T A 739 -- G A A T G A A G A T G A A G T T T G T T A A T A 740 -- A A A T T G T T G A G A T A A G A T A G T G A T 741 -- T G A T T G T T T A A T G A T G T G T G A T T A 742 -- A T G A A G T A T T G T T G A G T G A T T T A A 743 -- G T G T A A A T G T T T G A G A T G T A T A T T 744 46 A A T T G A T G A G T T T A A A G A G T T G A T 745 -- T T T G T G T A A T A T G A T T G A G A G T T T 746 -- G T A G T A G A T G A T T A A G A A G A T A A A 747 -- T T T A A T G T G A A A T T T G T T G T G A G T 748 -- G T A A A G A A T T A G A T A A A G A G T G A T 749 -- A A T A G T T A A G T T T A A G A G T T G T G T 750 --
G T G T G A T G T T T A T A G A T T T G T T A T 751 -- G T A T A G T G T G A T T A G A T T T G T A A A 752 49 G T T G T A A G A A A G A T A T G T A A G A A A 753 -- A T A T T A G A T T G T A A A G A G A G T G A A 754 -- G A G T G A T A T T G A A A T T A G A T T G T A 755 -- T A A G A A G T T A A A G A A G A G A G T T T A 756 -- G A T G T T A G A T A A A G T T T A A G T A G T 757 -- G T G A T T G T A T G A G A A A T G T T A A A T 758 -- T G A T T A T T G T A A G A A A G A T T G A G A 759 -- A A G A A T T G T G T A A G T T T A T G A G T A 760 -- T T G T A T T T A G A A G A T T T G T A G A T G 761 -- T A T A T G T T T G T G T A A G A A G A A A T G 762 -- G A T A A T G T G T G A A T T T G T G A A T A A 763 -- T T A G A A A T G T G A G A T T T A A G A G T T 764 -- A G T G T A G A A T T T G T A T T T A G T T G T 765 -- T A G T T A A G A T A G A G T A A A T G A T A G 766 -- G A A G T G A T A T T G T A A A T T G A T A A G 767 -- G T A A T T G T G T T A G A T T T A A G A A G T 768 -- T G A T A T T T G T G A A T T G A T A G T A T G 769 -- A A G T A A A G A G A T A T A G T T A A G T T G 770 -- A T T A G T T A A G T T A T T T G T G A G T G A 771 -- A G A T G A A G T A G T T T A T G A A T T A G A 772 -- T G A G T T A G T T A A G T G A T A G T T A A A 773 -- T T A T T G T A G A T T T A G A G A A G A T G A 774 -- T A T T T G T G T T T G T T G A T T A G A T A G 775 -- G T A T A A T G T G T G T G A A A G T T A T A A 776 -- T A T A T G T T G A G T A T A A A G A G A G A A 777 -- T T A G T T A G T T T A A A G A T T G T G A G T 778 -- T T T A G A A T A A G T G A T G T G A T G A A A 779 -- A G A G T A A T G T G T A A A T A G T T A G A T 780 -- T G T G A T A A A G A G A A A T T A G T T G T T 781 -- G A A T T T A G T G A A T G T T T G A G A T T A 782 -- T G T G A T G T G T A A G T A T A T G A A A T T 783 -- T T G T G A A T G A T T A A T G A A T A G A A G 784 51 A A T G T T G T T T A G A T T G A G A A A G T T 785 -- A G A T T G T G T T A G T A T T A G T A T A A G 786 -- T T G A T G T A T T A G A A A G T T T A T G T G 787 -- T A T G A T T G T G T G T T A G A G A A T T T A 788 -- T A G T G T A G A T A T T T G A T A G T T A T G 789 52 A G T T T A A T G T G T T T A G T T G T T A T G 790 -- T G T G T A A A G T A G A A A G T A A A G A T T 791 -- G T T A T G A T A T A G T G A G T T G T T A T T 792 53 T T T G A T T G A A T G T T A A T A G T G T G T 793 -- A G A G T A T T A G T A G T T A T T G T A A G T 794 54 T A A G T A G A A A G A A G A A G A T A T T T G 795 -- A G A A A G A G A A T T A T G T A A T G A A A G 796 -- T T A G A T T T G T T A G T G T G A T T T A A G 797 -- G A T G A T T A A G A T A T A G A G A T A G T T 798 -- A T A T T T G A G T G A T T A A G A G T A A T G 799 -- T G T A T T G T G A G T T A A G T A T A A G T T 800 -- A A T T T A G T A G A A A G T G T T G T G T T T 801 -- G T T A G A A G A T T A A G T T G A A T A A T G 802 -- T A A A G T A T G T G A G A T G A T T T A T G T 803 -- T G A A A T G A T T A A A G A T G A A G A T G A 804 -- T T A T T A G A T G T T G A G T G T T T G T T T 805 -- T A G T G T T T A A A G A G T A G T A T A T G A 806 -- A G T T A T A A G T A A A T G A T G T T G A T G 807 -- T T A A G A G A G A A A T A A G T G T A T T G T 808 -- G A T A T T G A A A T G T G T A A A T G A T G A 809 -- A T G A T G A A T T A A G A A A G A A A G A G A 810 -- G A A T A G T T T G A T T T G T G T T T G T T A 811 -- A G T T G T T T A G A T T T G A T T T G T A A G 812 -- G T A T G A G A T T T G A T A T A A G A T T A G 813 -- T T T A T A G T G A G T A T A G T G A T G A T T 814 -- T A T A T G T G A A G A T A T A A G T G T T T G 815 -- A T T G A T A G A T G A T A G T A A T T G A G T 816 -- T G A T A G A T G T G A A G A A T T T G A T T T 817 -- G A A G A T A T T G A A A G A A T T T G A T G T 818 55 G A T G T T T A G T G T A G A T A T A G A T T T 819 -- G A A T A T T G A G T T A T A A G T A G T A G T 820 -- A G T G A G T A A G T A A T A G A A A G A T T T 821 -- G T A G A A T A A G T A A T T T G T G A G A T A 822 -- G A G T T A T T T G A G A T T T A G A T G T T T 823 -- G A A A T G A T G A T T G A A T T T A G A G A T 824 -- A A A T A G T G T G A G A A T A G T T A A G T A 825 -- A T G T G T T A A G T T G T A G A A G A A T A A 826 -- A T A A T G A G T T A A T A G T G T A A G A A G 827 -- A T A A G A G A T G T T T A A G T T A G A A A G 828 -- T G T T A G T G T T A G A A A T A T G A A A G A 829 -- T T T A G A A G A T T G T T A G A T A A G T T G 830 -- G T G T A A T G T A T A A G A T A G T T A A G T 831 -- T A T T A G A G A G A A A T T G T A G A G A T T 832 57 T A G T G A G A T A A A G T A A A G T T T A T G 833 -- T T G T G A A A G T T A A G T A A G T T A G T T 834 -- A A A G T G T A A G T T G A A G A A T A T T G A 835 -- G A A T A G A G T G T T A T T T G A A A T A G A 836 -- T A T A A G A G A G A G A T A A G T A A T A A G 837 -- T G A G T G A A A T T G A T A G A G T A A A T T 838 -- G A T G A A T A A G T T T A A G T G A G A A A T 839 -- G T G T G A T A T G T T T A T T G A T T A A G T 840 -- T A A A G T G A G T G T A A A T G A T A A T G A 841 -- G T A G A G T T T G A T T T G A A A G A A T A T 842 -- G A A T A T T G T T A T G T T T G T T A T G A G 843 -- G T G T A A T A A G A T G T A T T G T T G T T T 844 -- T A A A T T G A T T G T G A G T T G A A G A A T 845 -- T G A G A T A G T T A T A G T T A A G T T T A G 846 -- A G T T T G T T A A G A T T A T G T A G A A A G 847 -- G A A T G T G T A G A A T A A G A G A T T A A A 848 -- G T A T T A T G A A A G A A G T T G T T G T T T 849 -- G T G T T A T A G A A G T T A A A T G T T A A G 850 58 T T A A G A G T A G T G A A T A T G A T A G T A 851 -- A A T G T T A T A A G A T G A G A G T T T A G T 852 -- A T A T A A G A T T T G A T G T A G T G T A G T 853 -- T A T G T T T G T T G T T G T T A A G T T T G A 854 -- G A T A G T T T A G T A T A G A A G A T A A A G 855 -- G T T G A A T A T A G A G A T A G T A A A T A G 856 -- A G A G A A G A T T T A G T A A G A A T G A T A 857 -- T G A A T G A G A A A G A T A T T G A G T A T T 858 -- T G A A G A T T A T A G T A G T T G T A T A G A 859 -- G A T T A G T A G T A T T G A A G A T T A T G T 860 -- T G A A A T G T G T A T T T G T A T G T T T A G 861 59 A T T A A A G T T G A T A T G A A A G A A G T G 862 -- A A T G T A G A G A T T G T A G T G A A T A T T 863 62 T T A T T T G T T G A G T G T A A A T G T G A T 864 -- A T G T A A T T G T G A A T A A T G T A T G T G 865 63 G A T T T G T A T A G A G A T T A G T A A G T A 866 -- A A T A T T G T T G T T T A G A G A A A G A A G 867 -- A T G A T G A T G T A T T T G T A A A G A G T A 868 -- A A T G T A T T T G T G T G A T T G T G T A A A 869 -- A G T G T T A T G A A G A A T A G T A A G A A T 870 -- G T T A T G T A G A G A T G A A A G A A A T T A 871 65 G T T T G T A T T A G A T A A A T G A G T T G T 872 -- T G A T T T A T G A G A T T A A G A G A A A G A 873 -- T T T G T G T G T T A T T G T A A T T G A G A T 874 70 G A T G T G T G A T A T G A T T A A A G A A A T 875 --
A G A T T A T A G A T T T G T A G A G A A A G T 876 -- G A A G A G T A T G T A A T A G T A T T G T A T 877 -- T T T G T A A T G T T G T T G A G T T T A A G A 878 -- A G T A A A T A G T A G T A T G A A T A A G A G 879 -- G A A T G T T G A A T T G A A A T A T G A G T T 880 -- A G T A G T T A A T T G A T A G T A A G T T T G 881 -- A G T G T A A A G A A A T G A A T G A A T A A G 882 -- T G T T A G A T A T T T G T G A A A T G T G A A 883 -- T G T A T G T T G A G T T T G A A T T G T T A T 884 -- T G A G T G A A T T A G T T A T G T T G T T A T 885 -- G A A G A A A G A A A T G A G A A A G A T T A T 886 -- T T A A G T A A G T T G T G T T G A T A T T A G 887 -- A T G A T G T G T T T G A T T T G A A T T G A A 888 72 A A G T A A G T G A A A T T G T T G T T T G A A 889 -- A T G A A G T G T A A A G T T T G A A A G A A A 890 -- A G A G A G T A A G A T A A T T G T A T A G T A 891 -- T T T A T G A G A T A G A T G A A A T A A G T G 892 -- A G A A A T T A G T A G T A A T G A T T T G T G 893 -- G A T T T G A G A T T G A A T G A G A A T A T A 894 -- G A T T A G A A A G A T G A A T A A A G A T G A 895 -- T A G A T A G A A A G T A T A T G T T G T A G T 896 -- G A A G A T A G T A A A G T A A A G T A A G T T 897 -- A A A T G T G T G T T T A G T A G T T G T A A A 898 75 T T G T T G A A G T A A G A G A T G A A T A A A 899 -- T A T T T G A G A G A A A G A A A G A G T T T A 900 -- T A T T T A G T G A T G A A T T T G T G A T G T 901 -- T T A T A G T G A T G A T G A T A A G T T G A T 902 -- T A A A G A T A A T T G T A G A A A G T A G T G 903 -- G T T T A G T A T T G A T A T T G T G T G T A A 904 -- G T G T T G T G A A T A A G A T T G A A A T A T 905 -- A A A G A A A G T A T A A A G T G A G A T A G A 906 -- T A T T T G T A A G A A G T G T A G A T A T T G 907 -- T A G A A G A T G A A A T T G T G A T T T G T T 908 -- A T A A T A G T A A G T G A A T G A T G A G A T 909 -- A A T G T G A A T A A G A T A A A G T G T G T A 910 -- A T T G A A G A T A A A G A T G T T G T T T A G 911 -- T G A A A T A G A A G T G A G A T T A T A G T A 912 76 A G T T A T T G T G A A A G A G T T T A T G A T 913 -- A A A T A G T A G T G A T A G A G A A G A T T T 914 -- A G T G T A T G A A G T G T A A T A A G A T T A 915 -- T G A T T A A G A T T G T G T A G T G T T A T A 916 -- A G T T T A T G A T A T T T G T A G A T G A G T 917 -- T A T G T G T A T G A A G A T T A T A G T T A G 918 78 G A A A T T G T T G T A T A G A G T G A T A T A 919 -- T A G A A A T A G T T T A A G T A T A G T G T G 920 -- T G A T T T A G A T G T T T A T T G T G A G A A 921 -- A A G T T G A T A T T T G T T G T T A G A T G A 922 -- T G A T G T G A T A A T G A G A A T A A A G A A 923 79 A A A G T T T A G T T T G T A T T A G T A G A G 924 -- A G T T T G A T G T G A T A G T A A A T A G A A 925 -- A A G T G T T A T T G A A T G T G A T G T T A T 926 -- A A A T T G A A G T G T G A T A A T G T T T G T 927 -- G T T T A G T G A T T A A A G A T A G A T T A G 928 82 A T A A G T G T A T A A G A G A A G T G T T A A 929 -- A T G A A T T T G T T T G T G A T G A A G T T A 930 -- A A A G A A T T G A G A A A T G A A A G T T A G 931 -- A G T G T A A G A G T A T A A A G T A T T T G A 932 -- G A A T T A A G A T T G T T A T A T G T G A G T 933 -- T A T G A A A G T G T T G T T T A A G T A A G A 934 -- T A A A G T A A A T G T T A T G T G A G A G A A 935 -- A A A G A T A T T G A T T G A G A T A G A G T T 936 -- A A G T G A T A T G A A T A T G T G A G A A A T 937 -- A A A T A G A G T T T G T T A A T G T A A G T G 938 -- G A T T T A G A T G A G T T A A G A A T T T A G 939 -- T T G T A A A T G A G T G T G A A T A T T G T A 940 -- A G T A G T G T A T T T G A G A T A A T A G A A 941 -- T G A G T T A A A G A G T T G T T G A T A T T T 942 -- A A A G A G T G T A T T A G A A A T A G T T T G 943 -- G T T T A G T T A T T T G A T G A G A T A A T G 944 -- A A G T G T A A A T G A A T A A A G A G T T G T 945 -- A A T A A A G T G A G T A G A A G T G T A A T T 946 -- T A T T G A G T T T G T G T A A A G A A G A T A 947 -- T T T A T A G T T G T T G T G T T G A A A G T T 948 -- A T G A A A T A T G A T T G T G T T T G T T G T 949 -- A A A G A G A T G T A A A G T G A G T T A T T A 950 -- T T G A A G A A A G T T A G A T G A T G A A T T 951 -- A T G T T A T T T G T T T A G T T T G T G T G A 952 -- A A A T A T G A A T T T G A A G A G A A G T G A 953 -- G A T T A G A T A T A G A A T A T T G A A G A G 954 -- T T A G A A T A A G A G A A A T G T A T G T G T 955 -- T T T A T G A A A G A G A A G T G T A T T A T G 956 -- G T A A G T A T T A A G T G T G A T T T A G T A 957 -- A T A A A G A G A A G T A A A G A G T A A A G T 958 -- A T T G T T A A T T G A A G T G T A T G A A A G 959 -- T A T A T A G T T G A G T T G A G T A A G A T T 960 -- T A G A T G A G A T A T A T G A A A G A T A G T 961 -- A T A A G A A G A T G A T T T G T G T A A A T G 962 -- T T A G T A A T A A G A A A G A T G A A G A G A 963 -- G A T T T G T G A G T A A A G T A A A T A G A A 964 -- A A A T A G A T G T A G A A T T T G T G T G T T 965 -- G A A A T T A G T G T T T G T G T G T A T T A T 966 -- A T T T G A G T A T G A T A G A A G A T T G T T 967 -- A T A G A G T T G A A G T A T G T A A A G T T T 968 -- T A A T T T G T G A A T G T T G T T A T T G T G 969 -- T T A G T T T A T G A G A G T G A G A T T T A A 970 -- G T T G T T A G A G T G T T T A T G A A A T T T 971 -- T T T A T T G T G A T G T G A A A T A A G A G A 972 -- G T A A G T A A T A T G A T A G T G A T T A A G 973 -- T G A G A T G A T G T A T A T G T A G T A A T A 974 -- A A T T G A G A A A G A G A T A A A T G A T A G 975 85 T T T G A A G T G A T G T T A G A A T G T T T A 976 -- A G T T G T T G T G T A A T T G T T A G T A A A 977 -- A T A G T G A G A A G T G A T A A G A T A T T T 978 -- G T G T G A T A A G T A A T T G A G T T A A A T 979 -- T A G T T A T T G T T T G T G A A T T T G A G A 980 -- A T A G T T G A A T A G T A A T T T G A A G A G 981 -- A T G T T T G T G T T T G A A T A G A G A A T A 982 -- T G A T A A A G A T A T G A G A G A T T G T A A 983 -- T A A A G A T G A G A T G T T G T T A A A G T T 984 -- A A G T G A A A T T T G T A A G A A T T A G T G 985 -- G A A A T G A G A G T T A T T G A T A G T T T A 986 -- T T T G T A A A T G A G A T A T A G T G T T A G 987 -- G T T A A T T G T G A T A T T T G A T T A G T G 988 -- A G A G T G T T G A T A A A G A T G T T T A T A 989 -- A A T T G T G A G A A A T T G A T A A G A A G A 990 -- T T A A A G A G A A T T G A G A A G A G A A A T 991 -- T T G T T A G A A G A A T T G A A T G T A T G T 992 -- A G T T A A G A T A T G T G T G A T G T T T A A 993 -- T G A G T T A T G T T G T A A T A G A A A T T G 994 -- T T A G A T A A G T T T A G A G A T T G A G A A 995 -- A T G A G T A A T A A G A G T A T T T G A A G T 996 -- T G T T T A A G T G T A A T G A T T T G T T A G 997 -- T T G A A G A A G A T T G T T A T T G T T G A A 998 -- T A T A G A A A G A T T A A A G A G T G A A T G 999 -- T A A A T T G T T A G A A A T T T G A G T G T G 1000 -- A T T G T T A G T G T G T T A T T G A T T A T G 1001 --
G A G A A T T A T G T G T G A A T A T A G A A A 1002 -- T T G A T T G A T A A A G T A A A G A G T G T A 1003 -- G T G T G T A A A T T G A A T A T G T T A A T G 1004 -- A A A G T A A A G A A A G A A G T T T G A A A G 1005 -- T T T A G T T G A A G A A T A G A A A G A A A G 1006 -- G T G T A A T A A G A G T G A A T A G T A A T T 1007 -- T A T T G A A A T A A G A G A G A T T T G T G A 1008 -- A T G A G A A A G A A G A A G T T A A G A T T T 1009 -- A A G A G T G A G T A T A T T G T T A A A G A A 1010 -- T T T G T A A A G T G A T G A T G T A A G A T A 1011 -- G A T G T T A T G T G A T G A A A T A T G T A T 1012 -- G T A G A A T A A A G T G T T A A A G T G T T A 1013 -- A A A G A G T A T G T G T G T A T G A T A T T T 1014 -- A A A G A T A A G A G T T A G T A A A T T G T G 1015 -- A A G A A T T A G A G A A T A A G T G T G A T A 1016 -- G A T A A G A A A G T G A A A T G T A A A T T G 1017 86 G A T G A A A G A T G T T T A A A G T T T G T T 1018 -- A G T G T A A G T A A T A A G T T T G A G A A A 1019 -- G T T G A G A A T T A G A A T T T G A T A A A G 1020 87 T T A A G A A A T T T G T A T G T G T T G T T G 1021 -- A G A A G A T T T A G A T G A A A T G A G T T T 1022 -- T A A G T T T G A G A T A A A G A T G A T A T G 1023 -- T G A G A T A G T T T G T A A T A T G T T T G T 1024 -- A G T T T G A A A T T G T A A G T T T G A T G A 1025 -- T A G A A T T G A T T A A T G A T G A G T A G T 1026 -- A G A G A T T T G T A A T A A G T A T T G A A G 1027 -- A T A A T G A T G T A A T G T A A G T A G T G T 1028 -- T G A A A T T T G A T G A G A G A T A T G T T A 1029 -- T G T G T A A A G T A T A G T T T A T G T T A G 1030 -- T G A A T A A G T G A A A T A G A A T G A A T G 1031 -- A A A G A A A G A T T G T A A T A A G T A G A G 1032 -- A A T G A A A T A G T G T T A A A T G A G T G T 1033 89 G T A G A T A A A G A T G T G A A T T A T G A T 1034 -- G A T A G T A T A T G T G T G T A T T T G T T T 1035 -- A T G T T T G T A G A A A T G T T T G A A G A T 1036 -- A A A T T T G T A G A G A G A A A T T T G T T G 1037 -- T A G A A T A A G A T T A G T A A G T G T A G A 1038 -- T G A T T T A G A G A A A T A T G A G T A G A A 1039 -- A A T A G A G T A T G T T G T T T A T G A G A A 1040 -- G A T G A T G A A G A G T T T A T T G T A A A T 1041 -- A A G T A A A G A A G A A G A A A T G T G T T A 1042 -- T T G A A G A A T T A A G T G T T T A G T G T A 1043 -- A G A A A G A A T G T T G A T T T A T G A T G T 1044 -- G A T T A A A G A G A T G T T G A T T G A A A T 1045 -- A A T G A T A A T T G T T G A G A G A G T A A T 1046 -- G T T T G T T G A A A G T G T A A A G T A T A T 1047 90 T G A G T T A T A T G A G A A A G T G T A A T T 1048 -- T T G T G A G A A A G A A G T A T A T A G A A T 1049 -- G T A A G T T T A G A G T T A T A G A G T T T A 1050 -- G A T A G A T A G A T A A G T T A A T T G A A G 1051 -- A G A G A T G A T T G T T T A T G T A T T A T G 1052 -- A A A G T T A A G A A A T T G T A G T G A T A G 1053 -- T T T G A T A T T G T T T G T G A G T G T A T A 1054 -- A T T T G T A G A A A G T T G T T A T G A G T T 1055 -- G A T T T G A G T A A G T T T A T A G A T G A A 1056 -- A A G A T A A A G T G A G T T G A T T T A G A T 1057 -- G A T A T T G T A A G A T A T G T T G T A A A G 1058 -- G T A A G A G T G T A T T G T A A G T T A A T T 1059 -- G T G T G A T T A G T A A T G A A G T A T T T A 1060 91 G T A A G A A A G A T T A A G T G T T A G T A A 1061 -- A G T A G A A A G T T G A A A T T G A T T A T G 1062 92 T A A G A G A A G T T G A G T A A T G T A T T T 1063 -- G T T A A G A A A T A G T A G A T A A G T G A A 1064 -- T A A G T A A A T T G A A A G T G T A T A G T G 1065 -- A A G A T G T A T G T T T A T T G T T G T G T A 1066 -- A T T T A G A A T A T A G T G A A G A G A T A G 1067 -- G T T A T G A A A G A G T A T G T G T T A A A T 1068 93 T A T T A T G T G A A G A A G A A T G A T T A G 1069 -- T A A T A A G T T G A A G A G A A T T G T T G T 1070 -- T G A T G T T T G A T G T A A T T G T T A A A G 1071 -- G T G A A A G A T T T G A G T T T G T A T A A T 1072 -- A G A G A A T A T A G A T T G A G A T T T G T T 1073 -- T T T G A G A T G T G A T G A T A A A G T T A A 1074 -- G T T G T A A A T T G T A G T A A A G A A G T A 1075 94 G T G T T A T G A T G T T G T T T G T A T T A T 1076 -- A T T A T T G T G T A G A T G T A T T A A G A G 1077 -- G T T A G A A A G A T T T A G A A G T T A G T T 1078 -- T T G T G T A T T A A G A G A G T G A A A T A T 1079 -- G T T T A A G A T A G A A A G A G T G A T T T A 1080 -- A A T G A G A A A T A G A T A G T T A T T G T G 1081 -- T G A A T T G A A T A A G A A T T T G T T G T G 1082 95 A A T A A G A T T G A A T T A G T G A G T A A G 1083 -- A A T G T T T G A G A G A T T T A G T A A A G A 1084 -- A G T T T A G A A T A G A A A T G T G T T T G A 1085 -- T A T A A G T A A G T G T T A A G A T T T G A G 1086 -- G T A G T G A A T A A G T T A G T G T T A A T A 1087 -- A A G T G T G T T A A A G T A A A T G T A G A T 1088 -- A G A G A T G T T T A T G T T G T G A A T T A A 1089 -- A G T T G A A T A T T G A T G A T A A G A A G A 1090 -- T G A A T G T G A G A T G T T T A G A A T A A T 1091 -- A A T A A T G A T G T A A G T T T G A G T T T G 1092 -- A A A G A G T G A A T A G A A A T A A G A G A A 1093 -- A A T A A A G T T A T T G A G A G A G T T T A G 1094 -- A G T A G T G T T G T A G T T T A G T A T A T A 1095 -- G T A A G A A T G T A T T A G A T A T T T G T G 1096 -- G A T A A A T G T T T G A T A A A G T A G T T G 1097 -- A T A G T A T G T A T G T G T G A A G A T T T A 1098 -- A T G A A T G T A G A G T G A T T A G T T T A A 1099 -- G T A G T A T T T A G T G A T G T A A G A A T A 1100 -- A G A A T T G T A T T G A A G A A G A A T A T G 1101 -- T T T A T A G A A T T G A G A G A A G T T A A G 1102 -- A A A G T A G T A G A G A T T T G A G A A T T A 1103 -- T T T A A A G A A A G T A T T G T A A G A G T G 1104 -- A A A T T G A G A A A G T G A A T G A A G T T T 1105 -- A A G A A A T A A G T A T G A T A G T A G T A G 1106 -- A T T T G A A T T G T A T T G T A G T T T G T G 1107 -- A A G A G A A T A A T G T A G A G A T A T A A G 1108 -- T G T G T A A T A G T T G T T A A T G A G T A A 1109 -- T A T A G T T G T A G T T T A G A T G A A T G T 1110 -- A T T G T G T T A G A A T G A T G T T A A T A G 1111 -- G T T T G T A T A G T A T T T G A T T G A T G T 1112 -- A G A G T A A A G T A T G A G T T A T G A A T A 1113 -- G A A A G T T T A A G T G A T G T A T A T T G T 1114 96 T T A A A T G A T A A A G A G T A G T G A A G T 1115 -- T T A A A T G T G T G A G A A G A T G A A T A A 1116 -- A T T T G T A T A A A G T G A A G A A G A G A A 1117 97 T G A T T A G T A T T T G T G A A G A G A T T T 1118 -- T T T G A A T G A A A T T G A T G A T A G A T G 1119 -- A G A G T A A G A T T A A G A A T A A G A A A G 1120 -- A T T G A A T T G A G A A G T G A A G T A A A T 1121 -- T T T A G A G A A G T A T T G T T T G A A A G A 1122 -- T A A A G T G A A A G A T T T G A A A T G A T G 1123 -- G A A A G T T A G A G A A A T G T A G A A A T T 1124 -- G T G A A T A A T G A A G A A G T T A T G T T A 1125 98 T T G T G A A T A A A G T A G A T G T G T T A T 1126 --
T T A T A T G A T A T G A G T T T G T G T T G A 1127 -- T T G A T T T G T G T G A G T A T T A G T T A T 1128 -- A A A G T G A T T A A G T T A G T T T G A G A T 1129 -- T T G T A T T T G T A T A A T G T T G A A G A G 1130 -- G T T T G A A A T T A G T G T G A G A A A T A T 1131 -- A A T G T T G A G A T T G A T A A T G T T G A A 1132 -- T A G T A G T A G T A T T G T T G T A A T A A G 1133 -- G T T G T A A T T T G A G T G T T A G T T A T T 1134 -- T G A A T A T G A T A G T T A G T A A T T G T G 1135 -- T G A T A G T A T G T T T G T G A T T A A A G A 1136 -- G A T G T A T A A A G A G T A T G T T A T A A G 1137 -- A G T G A G A T T T A G A A G A T G T T A T T A 1138 -- A T G A G A A T T T G T T A A A G A G A A A G T 1139 -- A A A G A A T T A G T A T G A T A G A T G A G A 1140 99 T A G A G T T G T A T A G T T T A T A G T T G A 1141 -- G T A G A A T G A T T G T T T A G A A G A T T T 1142 -- G T T T A T G T T T G A G A A G A G T T A T T T 1143 -- T A G A A G T T T G A A A G T T A T T G A T T G 1144 -- G A T G A A G A G T A T T T G T T A T A T G T A 1145 -- G A T G A A T A T A G T A A G T A T T G A G T A 1146 100 T A G T G A T G A A A T T T G A G A T A G A T A 1147 -- G A A A G A A A T T G A A G A G T T T G A T A T 1148 -- A T T T G A G T A T T T G T G T A T T G A A T G 1149 -- A T G A G T T G A A A T T T G A A G T A T T G T 1150 -- T T A A T A G T G A G A G A G T A T A T G T A A 1151 -- A T T A A G A G A G T G A G T A A A T G T A A A 1152 -- A A G A A T A G A T G A G A T T A G A A A T A G 1153 -- A G T T T A A A G A G T T A G A A T T G A A A G 1154 -- G T A A G A T T T G T T G A A T A A A G A A G A 1155 -- A G A G A A A G A A G T T A A A G T G A T A T T 1156 -- T A A T A G A G A A G A G A T G T A T G A A T A 1157 -- T T A T T A G T G A T A A G T G A A G T T T A G 1158 -- A T A A T G T A A A G A T G A G T T T A T G A G 1159 -- T T G A T T T G A G A G T T G A T A A G A T T T 1160 -- A T G A T T A T T G T G T G T A G A A T T A G A 1161 -- T A T A A A G A T A T A G T A G A T G A T G T G 1162 -- T T T A G T T G A G A T G A A G T T A T T A G A 1163 -- A T T G A A T T G A T A T A G T G T A A A G T G 1164 -- G A A G A A A G A T T A T T G T A T T G A G T T 1165 -- A T T G A G T G T A G T G A T T T A G A A A T A 1166 -- A A T A A A G T G T T T A A G A G T A G A G T A 1167 -- G T A G A G A T A A T T G A T G T G T A A T T T 1168 --
[0261]All references referred to in this specification are incorporated herein by reference.
[0262]The scope of protection sought for the invention described herein is defined by the appended claims. It will also be understood that any elements recited above or in the claims, can be combined with the elements of any claim. In particular, elements of a dependent claim can be combined with any element of a claim from which it depends, or with any other compatible element of the invention.
[0263]This application claims priority from United States Provisional Patent Application Nos. 60/263,710 and 60/303,799, filed Jan. 25, 2001 and Jul. 10, 2001. Both of these documents are incorporated herein by reference.
Sequence CWU
1
1172124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1aaattgtgaa agattgtttg
tgta 24224DNAArtificial
SequenceDescription of Artificial SequenceArtificially Synthesized
DNA Sequence 2gttagagtta attgtatttg atga
24324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 3atgttaaagt aagtgttgaa
atgt 24424DNAArtificial
SequenceDescription of Artificial SequenceArtificially Synthesized
DNA Sequence 4tgatgttaga agtatattgt gaat
24524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 5tttgtgtaga atatgtgttg
ttaa 24624DNAArtificial
SequenceDescription of Artificial SequenceArtificially Synthesized
DNA Sequence 6ataagtgtaa gtgaaataag aaga
24724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 7aagagtattt gttgtgagtt
aaat 24824DNAArtificial
SequenceDescription of Artificial SequenceArtificially Synthesized
DNA Sequence 8gtgtttatgt tatatgtgaa gttt
24924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 9aaagagaata gaatatgtgt
aagt 241024DNAArtificial
SequenceDescription of Artificial SequenceArtificially Synthesized
DNA Sequence 10tatgaaagag tgagataatg ttta
241124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 11atgagaaata
tgttagaatg tgat
241224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 12ttagttgttg
atgtttagta gttt
241324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 13gtaaagagta
taagtttgat gata
241424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 14aaagtaagaa
tgatgtaata agtg
241524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 15gtagaaatag
tttattgatg attg
241624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 16tgtaagtgaa
atagtgagtt attt
241724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 17aaatagatga
tataagtgag aatg
241824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 18ataagttata
agtgttatgt gagt
241924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 19tatagataaa
gagatgattt gttg
242024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 20agagttgaga
atgtatagta ttat
242124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 21aagtagtttg
taagaatgat tgta
242224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 22ttatgaaatt
gagtgaagat tgat
242324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 23gtatatgtaa
attgttatgt tgag
242424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 24gaattgtata
aagtattaga tgtg
242524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 25tagatgagat
taagtgttat ttga
242624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 26gttaagtttg
tttatgtata gaag
242724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 27gagtattagt
aaagtgatat gata
242824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 28gtgaatgatt
tagtaaatga ttga
242924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 29gattgaagtt
atagaaatga ttag
243024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 30agtgataaat
gttagttgaa ttgt
243124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 31tatatagtaa
atgtttgtgt gttg
243224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 32ttaagtgtta
gttatttgtt gtag
243324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 33gtagtaatat
gaagtgagaa tata
243424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 34tagtgtatag
aatgtagatt tagt
243524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 35ttgtagatta
gatgtgtttg taaa
243624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 36tagtatagag
tagagatgat attt
243724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 37attgtgaaag
aaagagaaga aatt
243824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 38tgtgagaatt
aagattaaga atgt
243924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 39atattagtta
agaaagaaga gttg
244024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 40ttgtagttga
gaaatatgta gttt
244124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 41tagagttgtt
aaagagtgta aata
244224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 42gttatgatgt
gtataagtaa tatg
244324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 43tttgttagaa
tgagaagatt tatg
244424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 44agtatagttt
aaagaagtag taga
244524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 45gtgagatata
gatttagaaa gtaa
244624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 46ttgtttatag
tgaagtgaat agta
244724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 47aagtaagtag
taatagtgtg ttaa
244824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 48atttgtgagt
tatgaaagat aaga
244924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 49gaaagtagag
aataaagata agaa
245024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 50atttaagatt
gttaagagta gaag
245124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 51gtttaaagat
tgtaagaatg tgta
245224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 52tttgtgaaga
tgaagtattt gtat
245324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 53tgtgtttaga
atttagtatg tgta
245424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 54gataatgatt
atagaaagtg tttg
245524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 55gttatttgta
agttaagata gtag
245624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 56agtttattga
aagagtttga atag
245724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 57ttgtgtttat
tgtgtagttt aaag
245824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 58attgtgagaa
gatatgaaag ttat
245924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 59tgagaatgta
aagaatgttt attg
246024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 60atgtgaaagt
tatgatgtta attg
246124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 61gtttagtatt
agttgttaag attg
246224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 62gattgatatt
tgaatgtttg tttg
246324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 63tgaattgaaa
gtgtaatgtt gtat
246424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 64gattgtattg
ttgagaatag aata
246524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 65aaatttgaga
tttgtgatag agta
246624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 66gtaattagat
ttgtttgttg ttgt
246724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 67gtttgtattg
ttagtgaata tagt
246824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 68atgtagtagt
agatgtttat gaat
246924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 69tgtttaaaga
tgattgaaga aatg
247024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 70tgtgataatg
atgttatttg tgta
247124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 71atagttgtga
gaatttgtaa ttag
247224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 72atagatgtaa
gagaaattgt gaaa
247324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 73agattaagag
aagttaatag agta
247424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 74gaagtaaatt
gtgaatgaaa gaaa
247524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 75aatgtaagaa
agaagattgt tgta
247624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 76tttgatttat
gtgttatgtt gagt
247724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 77gtattgagaa
atttgaagaa tgaa
247824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 78gaattgtatg
aaatgaattg taag
247924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 79tattgtagaa
gtaaagttag aagt
248024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 80tttatgtaat
gataagtgta gttg
248124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 81atatagttga
aattgtgata gtgt
248224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 82ataagaaatt
agagagttgt aaag
248324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 83gaattgtgaa
atgtgattga tata
248424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 84aaataagtag
tttaatgaga gaag
248524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 85gattaaagaa
gtaagtgaat gttt
248624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 86tatgtgtgtt
gtttagtgtt atta
248724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 87gagttatatg
tagttagagt tata
248824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 88gaaagaaaga
agtgttaagt taaa
248924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 89tagtattagt
aagtatgtga ttgt
249024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 90ttgtgtgatt
gaatattgtg aaat
249124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 91atgtgaaaga
gttaagtgat taaa
249224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 92gattgaatga
ttgagatatg taaa
249324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 93aagatgatag
ttaagtgtaa gtta
249424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 94tagttgttat
tgagaattta gaag
249524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 95tttatagtga
attatgagtg aaag
249624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 96gatagattta
gaatgaatta agtg
249724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 97tttgaagaag
agatttgaaa ttga
249824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 98atgaataaga
gttgataaat gtga
249924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 99tgtttatgta
gtgtagattg aatt
2410024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 100tttaagtgag
ttatagaagt agta
2410124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 101gatttatgtg
tttgaagtta agat
2410224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 102tagttagaga
aagtgataaa gtta
2410324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 103gtaatgataa
tgaagtgtat atag
2410424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 104aatgaagtgt
tagtatagat agta
2410524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 105taaattgagt
ttgtttgatt gtag
2410624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 106taatgaagaa
taagtatgag tgtt
2410724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 107aaatgtaata
gtgttgttag ttag
2410824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 108agagttagtg
aaatgttgtt aaat
2410924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 109gaaatagaaa
tgtattgttt gtga
2411024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 110agttataagt
ttgtgagaat taag
2411124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 111gagtttatag
ttagaatatg ttgt
2411224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 112agagttatta
gaagaagatt taag
2411324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 113gagttaatga
aataagtatt tgtg
2411424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 114atgatgaata
gttgaagtat atag
2411524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 115atagatatga
gatgaaagtt agta
2411624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 116tatgtaaaga
aagtgaaaga agaa
2411724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 117tgaatgtaga
aatgaatgtt gaaa
2411824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 118aattgaatag
tgtgtgagtt taat
2411924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 119agatattgtt
tgattaatga agag
2412024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 120aaagttgtaa
agttgaagat aaag
2412124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 121gttaagagat
tatgagatgt atta
2412224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 122agaagatata
agaagattga attg
2412324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 123gtagaaattt
gaattgatgt gaaa
2412424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 124aagagtagat
tgataagtat atga
2412524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 125tgatatagta
gtgaagaaat aagt
2412624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 126agataatgat
gagaaatgaa gata
2412724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 127atgtgaaagt
atttgtgata tagt
2412824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 128aataagagaa
ttgatatgaa gatg
2412924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 129taagtgtatt
tagtagaatg aagt
2413024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 130tatgttagat
ttgttgagat tgat
2413124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 131agtttgtatg
aagagatagt attt
2413224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 132gagaaatgtt
atgtatttag tagt
2413324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 133tatgtgagaa
tgtgtttgat ttaa
2413424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 134gtatgtttgt
ttatagaatg tatg
2413524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 135gagtatatag
aagaaagaaa tttg
2413624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 136atgagtgaag
taaatgtagt tatt
2413724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 137ttaagaagtg
agttattgtg atat
2413824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 138atgaaatgag
aatattgttg tttg
2413924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 139gattaatgat
tatgtgaatt gatg
2414024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 140gaaatgttaa
agatatgaaa gtag
2414124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 141tattgttgat
ttgatattag tgtg
2414224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 142tttatgtttg
tgtatgtaag tagt
2414324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 143aattgaaaga
attgtgtgaa ttga
2414424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 144tgagtttgaa
tttgtttgag taat
2414524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 145gatgtataat
gatgtgtgta aatt
2414624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 146atgtgagaga
agaatttgtt tatt
2414724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 147gtgataaagt
attgttgata gaaa
2414824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 148gaagtagaat
agaaagttaa taga
2414924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 149ttgtgtagtt
aagagttgtt taat
2415024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 150tagtagtaag
ttgttagaat agtt
2415124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 151aatttgaagt
ataatgaatg tgtg
2415224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 152tagaaattgt
agtatttgag agaa
2415324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 153tgtatatgtt
aatgagatgt tgta
2415424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 154tatttgataa
gagaatgaag aagt
2415524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 155ttgaatagtg
taatgaatat gatg
2415624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 156gtagtttgtg
aatagaatta gttt
2415724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 157aaagatgatt
gtaatttgtg tgaa
2415824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 158gaagattgtt
gagttaatag ataa
2415924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 159agattatgta
gtgatgtaaa tgtt
2416024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 160gaatttagat
gtagatatga atgt
2416124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 161gatagaagtg
tattaagtaa gtta
2416224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 162tatgaattat
gagaagaata gagt
2416324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 163tttgttatga
agtgatttgt ttgt
2416424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 164gtaaagattg
tgttatatga aatg
2416524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 165ttgtgatagt
agttagatat ttgt
2416624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 166gaattaagat
aaagaagaga agta
2416724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 167gattgtagaa
tgaatttgta gtat
2416824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 168aaataagaga
gagaatgatt tagt
2416924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 169aattatgtga
atagattgtt gaag
2417024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 170ttaagattta
tgtgatagta gagt
2417124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 171ttaaagatag
tgtttgttgt gtta
2417224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 172tattgattta
tgaagagtat agtg
2417324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 173aaatttgatg
agtagtttaa gaga
2417424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 174ataaagttgt
ttgatgtttg aatg
2417524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 175gattgtgatg
aataatgtta ttga
2417624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 176gatgaagaaa
tatgatatga atag
2417724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 177ttaaagttat
tgaagtgaag ttga
2417824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 178ttgtaagaaa
tagagatttg tgtt
2417924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 179gagattgagt
ttaagtatta gatt
2418024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 180agtgataata
gaatgataaa tgtg
2418124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 181gataatagtg
aatttgagtt gtat
2418224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 182agatatttgt
agtagaaagt atgt
2418324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 183gttatgaatg
ttgaatttga atgt
2418424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 184atgaaagatt
tagttgtgag atat
2418524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 185aaatagagaa
gttatgatgt gata
2418624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 186ttagtgagaa
atgtttaatg tgat
2418724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 187tgaagaatat
gtgaaattag tttg
2418824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 188gtttgatagt
ttaatgagta ttga
2418924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 189gttgtaagta
atgataaagt atga
2419024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 190taagagtagt
aattgttgtt taga
2419124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 191tttgagagag
tatgtatgat tatt
2419224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 192attgattgtg
aattagatag aaga
2419324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 193gattagtatt
tagtagtaat agag
2419424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 194tatgtattag
agatattgaa agtg
2419524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 195tatgtgaaag
taatgataaa tgag
2419624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 196gtaattagta
atgatttgaa tgag
2419724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 197gtttattgta
aagatgtaag tgaa
2419824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 198tagtagaatt
gttgttaaag aatg
2419924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 199tattgttagt
tatgtagtgt gtaa
2420024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 200gagtgaaagt
tatatgaaag tata
2420124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 201atatagaagt
tgatgagttt atga
2420224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 202tttagaagta
agaataagtg agta
2420324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 203tgtgtataag
atatttgtaa gaag
2420424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 204tagaagagtt
gtattgttat aagt
2420524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 205gtgttattag
tttaagttag agta
2420624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 206aatatagtga
tgtgaaattg aatg
2420724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 207ttagagaata
gagtgattat agtt
2420824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 208gaagtgagtt
aatgatttgt aaat
2420924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 209aatgtaaagt
aaagaaagtg atga
2421024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 210gttagttatg
atgaatattg tgta
2421124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 211aaatgagtta
gagtagaatt atgt
2421224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 212gatatagaag
attagttagt gata
2421324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 213atagtttgtt
gagatttatg agta
2421424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 214tagaatagtt
agtagtaaga gtat
2421524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 215gaatttgtat
tgtgaagttt agta
2421624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 216gtagtaagaa
gagaattaga ttaa
2421724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 217aatgtgttat
gtatgtaaat agtg
2421824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 218gaattagtta
gagtaaattg tttg
2421924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 219gaaattgaag
atagtaagaa atga
2422024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 220gtgtattatg
tgatttatga taga
2422124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 221tattatgaga
aagttgaata gtag
2422224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 222tatgtattgt
attgagtaga tgaa
2422324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 223gtgattgaat
agtagattgt ttaa
2422424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 224agtaagttgt
ttgattgaaa tttg
2422524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 225gaagtttgat
ttaagtttaa gaag
2422624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 226gagaagataa
atgatattgt tatg
2422724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 227atgatgagtt
gttaatagtt agtt
2422824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 228tatgatattt
gaagagtgtt aaga
2422924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 229gagatgatta
aagtgattta tgaa
2423024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 230atagttaaga
gtgatgagaa taaa
2423124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 231tttattgtta
gataaagagt tgag
2423224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 232agaatattga
tagttgaagt tgaa
2423324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 233tagtgtaaag
tgtagattgt aaat
2423424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 234agtagtgata
tgatttgaat attg
2423524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 235tgtattgaat
tagaatagtg agaa
2423624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 236tgatatgaga
tagaagttta atgt
2423724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 237gaagaagtaa
gtataaagta aatg
2423824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 238tttaagtgtg
ataagaaaga taga
2423924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 239tattgttgaa
tgtgtttaaa gaga
2424024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 240gaataatgat
gagatgatta ttga
2424124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 241tagagaaaga
gagaattgta ttaa
2424224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 242atgtataatg
agatatgttt gtga
2424324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 243aatagataag
attgattgtg tttg
2424424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 244tttgatgata
atagaagaga atga
2424524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 245agatgaataa
gttgtgaatg ttta
2424624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 246agatgaaaga
aagtgtagaa tatt
2424724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 247tgttaaatgt
atgtagtaat tgag
2424824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 248tagtagtgtg
aagttatttg ttat
2424924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 249agtgaatgtt
tgtaaagagt ttaa
2425024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 250gataaatgag
aattgagtaa ttgt
2425124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 251tgatgagaaa
ttgtttaagt gttt
2425224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 252aaataagtag
tgtgagtaat agta
2425324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 253tatgaaatat
gtgatagtaa gaga
2425424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 254attgtaagag
tgattataga tgat
2425524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 255agagtaagaa
tgaaagagat aata
2425624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 256taagtaagta
gatgttaaag agat
2425724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 257aaatagaaag
aattgtagag tagt
2425824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 258atagatttaa
gtgaagagag ttat
2425924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 259gaatgtttgt
aaatgtatag atag
2426024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 260aaatagaatg
agtagtgaaa tatg
2426124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 261ttgaattatg
tagagaaagt aaag
2426224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 262tagtaaattg
agagtagttg aatt
2426324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 263tgtaaagtgt
ttatagtgtg taat
2426424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 264atatgatttg
agatgagaat gtaa
2426524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 265aatattgata
tgtgttgtga agta
2426624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 266agtgagatta
tgagtattga ttta
2426724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 267ttgtatttag
atagtgagat tatg
2426824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 268atagaaatga
aagatagata gaag
2426924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 269gattgtatat
gtaaagtagt ttag
2427024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 270tatgaatgtt
attgtgtgtt gatt
2427124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 271gatattagta
gagtaagtat attg
2427224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 272tgagatgaat
ttgtgttatg atat
2427324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 273tatgaatgaa
gtaaagagat gtaa
2427424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 274gagtgaattt
gttgtaattt gttt
2427524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 275agaaattgta
gagttaattg tgta
2427624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 276gtgttaatga
aagttgtgaa taat
2427724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 277tgtgatttgt
taagaagatt aatg
2427824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 278agtagtattg
taaagtataa agag
2427924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 279tgattgttgt
atagttattg tgta
2428024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 280gattgtagtt
taatgttaag aatg
2428124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 281atgaaataag
aaattgagta gaga
2428224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 282tatgatgata
tttgttgtat gtgt
2428324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 283tttagagttt
gattagtatg tttg
2428424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 284aataagagat
tgtgatgaga aata
2428524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 285aatgaataga
atagagaatg taga
2428624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 286gtagtagtaa
tttgaatgtt tgaa
2428724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 287agtgagtaat
tgattgattg ttaa
2428824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 288gaataatgtt
tagtgtgttt gaaa
2428924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 289atatgaaagt
agagaaagtg ttat
2429024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 290tgagttattg
tatttagttt gaag
2429124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 291tagttgagtt
taaagttgaa agaa
2429224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 292taaagagtga
tgtaaataga agtt
2429324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 293tgtagtgttt
agagtaagtt atta
2429424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 294agagattaat
gtgttgaaag atta
2429524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 295gtaataagtt
gtgaaagaag atta
2429624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 296gagatgttat
agataatgaa agaa
2429724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 297tttagttgat
tgttgaatag agta
2429824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 298attattgaaa
gtagatgtta gatg
2429924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 299tttatgtgtg
attgagtgtt taat
2430024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 300tatttagtta
gatagataga gagt
2430124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 301atgtgtttat
gtgaaagatt tgta
2430224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 302atagtaatta
gaagagaaga atgt
2430324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 303tatgagtgat
tagaattgta tttg
2430424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 304ttaatgtatt
gtttaaagag tgtg
2430524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 305atagagaatt
aagaattgtt tgag
2430624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 306gttataagta
gaaatgtata gaag
2430724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 307agtaattagt
ttgaaatgtg tagt
2430824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 308gaaagattat
gattgtaaag tgat
2430924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 309gtaagattag
aagttaatga agaa
2431024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 310gagaatgttg
aataagaagt aatt
2431124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 311ttaagagtgt
ttgaatagtg ttta
2431224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 312ataaagaaag
agtatgagat tatg
2431324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 313agttattgat
tgaagatgag aaat
2431424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 314gtttgtgttt
gtataagttg ttaa
2431524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 315ttgtatgtga
gtttagatta atga
2431624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 316tagttaaagt
atagttgttt gagt
2431724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 317aaatttgtgt
tgagatttgt atag
2431824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 318tattagtgtt
atgataaaga gaag
2431924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 319tataagaagt
aatttgagaa gagt
2432024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 320taagttgaga
tgtttgtttg ataa
2432124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 321gtgtagattt
atgaattgag taat
2432224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 322tatagagaag
tgtttagttg tata
2432324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 323ataaagaaga
atagttgttg tgta
2432424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 324agattgaaat
agattagaaa gttg
2432524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 325gttgttataa
gaaatagttt gttg
2432624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 326agaaatagag
taagagtgtt taaa
2432724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 327agagatagta
gtaaatagtt attg
2432824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 328aaatgattgt
gtaagttatg tatg
2432924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 329aagaagtaag
agagaaattt gaat
2433024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 330gtgtgtattt
agttgataat tgat
2433124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 331attgttgttg
ttgagaaatg tatt
2433224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 332agataagtta
aagtaaagag aatg
2433324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 333tagttgaagt
tagtttaagt gtta
2433424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 334agtaagaatg
taatatgatg atag
2433524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 335atgagattga
aagatttatg aatg
2433624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 336tgattgaatt
agagagaatg tata
2433724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 337agttagtaag
agaatatagt gaat
2433824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 338attaagattg
tatagttagt gatg
2433924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 339gagataaaga
attgaaatag aaga
2434024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 340agagtaaatg
ttaagaaaga agtt
2434124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 341aaagtttgtt
atgtgtgaag aatt
2434224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 342attgtgttta
agaaatatga tgag
2434324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 343tattgaaatg
agatgtatgt agtt
2434424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 344atttgtgtga
tgtttgaaat atga
2434524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 345taagataata
gtgagagaaa ttga
2434624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 346atttatgatt
agtgtaagtg ttgt
2434724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 347gattaagaat
aaagtgtgaa gaat
2434824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 348gtaattgatg
aagagttagt ttat
2434924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 349tgtgttatgt
tataagaagt gata
2435024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 350agagaaattg
aatttagaaa tgtg
2435124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 351ttattgaatg
tgagaaagta tttg
2435224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 352tgttaatgag
aagataatga tagt
2435324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 353gaaagtattt
gttgattatt gttg
2435424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 354tagtttatgt
agttaattgt tgag
2435524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 355gttgaaagat
agtttgatat gtat
2435624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 356ttagaagata
gattattgag aaag
2435724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 357aataatgttg
tgaaatagat gtga
2435824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 358agtaagaaag
tttagtttag ttag
2435924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 359tagtttaatg
agatgtttga tatg
2436024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 360ttaaagatgt
taaagaatga gtga
2436124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 361aaagtgtgta
tatgttagaa agta
2436224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 362attaagttat
gtgtttatgt gttg
2436324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 363tttgaagaag
tgtttgtatt atgt
2436424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 364tgttaagaag
tttagttaaa gttg
2436524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 365tttaagtata
agattgtgtg agat
2436624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 366agatatttga
tagatagaag aaag
2436724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 367atttagagtt
gtaagaagat attg
2436824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 368gagaaattgt
aattgttaga gtat
2436924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 369gaagtatatg
ttaagatgta atag
2437024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 370aatattgaag
atgtagtgag ttat
2437124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 371gagtttagaa
atgataaaga attg
2437224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 372taagaaatga
gttatatgtt gaga
2437324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 373ttgatataag
aagttgtgat aagt
2437424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 374aagtgtttaa
tgtaagagaa tgaa
2437524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 375gttgtgagaa
ttagaaatag tata
2437624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 376tttagtttga
tgtgtttatg agat
2437724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 377gtaattgaaa
gtatgagtag taat
2437824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 378tagttgaata
agattgagag aaat
2437924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 379ttaagtgaag
tgttgtttat tgaa
2438024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 380attgatttgt
tgaaataagt gttg
2438124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 381tgaattgttg
ataagttatg aaga
2438224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 382gtttgttatt
gagtaagttg aatt
2438324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 383tgatttagta
tgtattagag ttga
2438424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 384taaatagaga
tgagaataag aaag
2438524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 385agaatgttat
atgtagagaa attg
2438624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 386atttatgtag
ttgagagtga taaa
2438724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 387gtaaagatag
tttgagtaat ttga
2438824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 388gaaatagtat
aatgttaagt gaga
2438924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 389attgtatatt
gtgttgaaga aagt
2439024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 390gagttaagtg
taaatgaaat gtaa
2439124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 391atagattgtg
tgaaagaaag aatt
2439224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 392ttaatagaag
tttgtagtat gatg
2439324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 393ttgtatgtga
gaataaagtt tagt
2439424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 394gtgattagat
atgatgatat gaat
2439524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 395tgaagaagaa
tttagatttg taag
2439624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 396tgtatgatta
ttgattagtg tgtt
2439724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 397tgtgaaagag
aatgatagat attt
2439824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 398aattgaaatg
agtgtgttta agaa
2439924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 399attatagagt
tagtttagaa tgag
2440024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 400aaagatagaa
attgagtgta tgat
2440124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 401gtagtttgtt
aatgttgtat aatg
2440224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 402agagatatta
gaatgtaaga atag
2440324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 403agaagtttga
aatatgatag aatg
2440424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 404tagaatgtaa
agtttagtat agag
2440524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 405agtagatgta
tgttaatgtg aata
2440624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 406tgaaagtgaa
atatgaaatg ttgt
2440724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 407atagtatatt
gagtttgtat gaag
2440824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 408gaagaaatgt
ttgtagaata agta
2440924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 409aatgagtatt
gaagaaatgt atag
2441024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 410gtgatagaat
ttgtgtttaa tgaa
2441124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 411tgtagtatga
agaataatga aatg
2441224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 412atagaagtta
atgataattg tgtg
2441324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 413gtgattgtaa
gtaagtaaag ataa
2441424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 414tatgtagttt
gtgttatttg aaga
2441524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 415tgagtaagtt
tgtatgttta agta
2441624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 416taaatgtatg
agtgtgtaaa gaaa
2441724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 417gtaagagtat
tgaaattagt aaga
2441824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 418gttgagtgta
aagattattg ataa
2441924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 419agtatgagtt
attagataaa gtga
2442024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 420atttgttata
gagttgtgtt gtat
2442124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 421taattagtag
tgtgttgaaa tttg
2442224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 422tgtattgaga
ttgttattgt attg
2442324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 423gttattagaa
gagataattg agtt
2442424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 424ttgagttgtg
attaagtagt atat
2442524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 425gatagtataa
tgattgaagt aatg
2442624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 426gtgaaagata
tttgagagat aaat
2442724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 427agttatgatt
tgaagaaatt gttg
2442824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 428gtaagtattt
gaatttgatg agtt
2442924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 429taatagtgtt
ataagtgaaa gagt
2443024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 430aaatgaattg
atgtgtatat gaag
2443124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 431agaaagtgag
ttgttaagta ttta
2443224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 432tttatgtgtg
aattgtgtat atag
2443324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 433gtaatatgat
agaaatgtaa agag
2443424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 434gagaattgtt
taaagatagt tgta
2443524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 435gaatttgtta
agaatgagtt tgat
2443624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 436atagtgatga
ttaaagagaa tttg
2443724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 437atagatgttt
agttgagatt attg
2443824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 438aagagtgtaa
atagaaagtg atat
2443924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 439tgtgtattga
ttgttgagat aaat
2444024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 440tagtatagtg
agaaagagtt aaat
2444124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 441aaagataaga
aagagatgat gttt
2444224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 442gaagttattg
aaatagagaa gtat
2444324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 443atgtatgtat
agaaagagta aatg
2444424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 444gatgtttgta
aagattgaaa ttga
2444524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 445aatttagaga
gtatttgtgt tgta
2444624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 446aatttgtttg
aaagaaagta agtg
2444724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 447aaagagtagt
gttattgtta gata
2444824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 448gtatgttgta
tatgttgttg atat
2444924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 449gtagaatttg
ttgagtattt gtaa
2445024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 450atgaatttag
ttagtgtaag aaag
2445124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 451atgataagaa
atgttgatga agta
2445224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 452ttgatgatga
agataatgta gata
2445324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 453agatgatatg
atatagatta gatg
2445424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 454ttgaaagtta
gaaagataga tgtt
2445524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 455gtttaatgtt
agttagaaag taag
2445624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 456gagatttaag
tttgaagtga aata
2445724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 457tttgttagta
gttgttataa gaga
2445824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 458tatgagaata
gtttgttagt gaat
2445924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 459ttgaaagttt
aaagaagaga taag
2446024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 460aagtgagttg
aaatgaaata tgtt
2446124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 461gttagaaatg
aaatgagtag ttat
2446224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 462taagtattgt
atttgtgtgt gtat
2446324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 463tgtattagta
aagaagagag aata
2446424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 464gagaagagaa
ataagttgaa ataa
2446524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 465gtaaagtaga
aatagaattg agtt
2446624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 466gtgtgttatt
tgtttgtaaa gtat
2446724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 467tttgatgtat
gaatatagta tgag
2446824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 468aagattgtgt
gaatagttga aatt
2446924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 469tataaagttt
gaagatgagt gata
2447024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 470agataaagag
atttaagatg tatg
2447124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 471gaagaattaa
gttgagaatt aaga
2447224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 472tagagaaatt
tgataaagaa agag
2447324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 473aaagtttatg
aagttattga gtag
2447424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 474aaatagtgta
agtaaagaga tgat
2447524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 475tatgatgatt
tagttataag agtg
2447624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 476tagataaatg
ttatgatgag taag
2447724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 477agattgattg
tgatgatttg tata
2447824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 478ttaagaagaa
ttgtatatga gagt
2447924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 479gtagaatgtt
tagagttgaa tata
2448024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 480gagaaatagt
aagaagtaaa taga
2448124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 481attgaagttg
ttatgtgaag attt
2448224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 482taaatgttgt
gtagagtaat taga
2448324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 483aaataagagt
ttgagaagtt gttt
2448424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 484agttgtaata
agaagtgatt taag
2448524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 485gttagaatgt
atatagagtt agat
2448624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 486ttgatattga
aagagaaagt tatg
2448724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 487ttaaagagag
aaatgtttga ttag
2448824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 488tgtgaatttg
agtattagta agaa
2448924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 489taatttgaat
gtgaaagttg ttag
2449024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 490atgtgtttga
aagatgatga ttta
2449124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 491aagttatgtt
gatattgagt gaaa
2449224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 492tagataaaga
agatagagat ttag
2449324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 493gatgaatgta
gatatatgta atga
2449424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 494gaagaatagt
ttatgtaaat gatg
2449524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 495gtagtatata
gttaaagatg agtt
2449624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 496gttatttgtg
tatgattatg attg
2449724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 497agagattaga
aattgagaga atta
2449824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 498gtatgataga
gtttatagtg ataa
2449924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 499gttagaaaga
atgaaattga agta
2450024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 500aagaatgaga
atatagagat gaat
2450124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 501aaagagaata
gtgtttaaga agat
2450224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 502gatgtgttat
tgatagaaat taga
2450324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 503tagagttata
gagatattgt atga
2450424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 504gagagttgaa
taagttaaag atat
2450524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 505agatatgaaa
tagattgtta gaga
2450624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 506gagtgaatag
aaagatatgt taat
2450724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 507aaagagatat
tgaagagaat aaag
2450824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 508gttatagaat
aagttgtaaa gtgt
2450924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 509tgatagtatg
ataatgtgtt tatg
2451024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 510tttgttgtta
agtatgtgat ttag
2451124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 511taaagtgttg
tgttaaagat taag
2451224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 512tgtgtttgat
tgattaatgt tatg
2451324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 513attaatgaat
gagtgttgta atgt
2451424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 514tagatgtttg
tgagtttgat atta
2451524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 515gaatgaatag
taatagatga tttg
2451624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 516aatagtgtgt
tgttatatga ttag
2451724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 517tagattagaa
gatgttgtgt atta
2451824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 518aatgtgtgtg
ttaaatgaat ttgt
2451924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 519gaattaagta
tatgagtgta gaaa
2452024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 520ttattgtgtg
taagtagtgt aaat
2452124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 521gtagtaaaga
gaattgttta gtat
2452224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 522aagtttgtaa
gaagtagttg aata
2452324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 523agttatagta
tagtagtata gaga
2452424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 524gaaagaaatg
tgtatagttt aatg
2452524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 525ttgtgagtaa
tgaatgatgt atta
2452624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 526gtagagttgt
aaatagagaa taaa
2452724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 527attaatgtag
attgtaagag atag
2452824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 528ttagtgtgtt
tgtagataga atta
2452924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 529agagagtttg
tgtatatgta taaa
2453024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 530ttaagtttag
tgagatttgt taag
2453124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 531atgaagttta
ttgaatagta gtga
2453224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 532atatttgtgt
tgtatgtttg tgaa
2453324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 533aaagtgttta
tagaagattt gatg
2453424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 534aagagatatg
atttgttagt tgta
2453524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 535aagaagaaat
gagtgataat gtaa
2453624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 536tagtgtttga
tatgttaaga agtt
2453724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 537gtagaaagtg
atagattagt aata
2453824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 538gataaatgtt
aagttagtat gatg
2453924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 539agattagaag
aattgtttag aatg
2454024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 540atatttgaga
agtgtgaaat gaat
2454124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 541tgagtaaata
gtttatgagt agta
2454224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 542ttagagagta
gataaagatt tgat
2454324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 543attgtttaag
ttgttgataa gatg
2454424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 544gttgtaaagt
taaagtgtga attt
2454524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 545atagattgtg
tgtttgttat agta
2454624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 546gtaagttatt
gagaatgata atag
2454724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 547tagattagtt
gataagtgtg taat
2454824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 548aaatgtaaat
gaagagtgtt tgtt
2454924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 549gatagaagaa
atgtatatag tgat
2455024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 550tatagagtgt
atgttatgat aaag
2455124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 551tatgaagtga
taagatgaag aatt
2455224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 552tgttgagaat
agtaagagaa ttta
2455324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 553tagataatgt
gaagtaataa gtga
2455424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 554gtattatgat
gatagtagta agta
2455524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 555agatatgatt
tagtattgaa tgtg
2455624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 556aattaagttt
gtagagtgat ttga
2455724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 557aagaaataga
tgtagtaaga tgtt
2455824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 558ttgagaagtt
gttgtaataa gaat
2455924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 559agtgtgaaat
agtgaaagtt taaa
2456024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 560tttatgtagt
agatttatgt gaag
2456124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 561attaatgaga
aattagtgtg ttag
2456224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 562atgttaatag
tgatagtaaa gtga
2456324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 563tatgttgata
aatgattatg agtg
2456424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 564ttattagagt
tgtgtgtgat atat
2456524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 565tgttgttatg
attgagttag aata
2456624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 566aatttgagtt
aagaagaagt gtaa
2456724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 567aaagataaag
ttaagtgttt gtag
2456824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 568tgttgagatg
atattgtata agtt
2456924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 569taaatagtga
atgagttata gagt
2457024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 570atagatgtta
tgatagttag ttag
2457124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 571gttaagtgaa
gatatgtatt gtta
2457224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 572taagaaagta
aagtttgtag atgt
2457324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 573aagagaaagt
ttgattgaat aaag
2457424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 574atattagatg
tgagttatat gtgt
2457524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 575agtttgagtt
tagtattgtg aata
2457624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 576atgttaaatg
agagattgtg tata
2457724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 577taaatgttgt
gattattgtg agat
2457824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 578taagaattga
agtaagagtt attg
2457924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 579agagatagaa
ttaagtttgt tgat
2458024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 580gaagaatgtt
aagaaatatg taag
2458124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 581tatttgtgat
taagaagttg agaa
2458224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 582agttagaatt
tgtgtagtag aatt
2458324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 583aagtttattg
ttgatgttgt attg
2458424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 584gaatgagttt
aagagtttat agta
2458524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 585agtgaagatt
gtatgtagta taaa
2458624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 586agttgaaatg
agtattaagt aatg
2458724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 587atgtgttatt
tgagatgagt aatt
2458824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 588aaatagtgtt
gttgaagttg ttat
2458924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 589gtagagaaag
atatatgtag ttta
2459024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 590gagagtattt
gatgaatgat tata
2459124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 591gagtataagt
ttagtgtata ttga
2459224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 592ataatgtgat
tattgattga gaga
2459324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 593ttagttgtta
tgtgagagta ataa
2459424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 594aaatgagtat
attgaattgt gatg
2459524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 595aattagaagt
aagtagagtt taag
2459624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 596tgtaagttta
aagtaagaaa tgtg
2459724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 597gaaatgataa
gttgatataa gaag
2459824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 598aatgagtagt
ttgtatttga gttt
2459924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 599agtgaatgta
agattatgta tttg
2460024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 600gtaattgaat
tgaaagataa gtgt
2460124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 601tatgtttaag
tagtgaaata gagt
2460224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 602gtattgaaat
tgaattagaa gtag
2460324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 603aatatgtaat
gtagttgaaa gtga
2460424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 604tgaatattga
gaattatgag agtt
2460524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 605tagtgtaaat
gatgaagaaa gtat
2460624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 606gtatgtgtaa
agaaatttga tgta
2460724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 607aattgtttga
aagtttgttg agaa
2460824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 608aattgtttga
gtagtattag tagt
2460924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 609taattgagtt
tgaataagag agtt
2461024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 610tgttgattgt
aagtgtttat tgtt
2461124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 611gaaatttgtg
agtatgtatt tgaa
2461224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 612taagaatgaa
tgtgaagtga atat
2461324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 613taatgtgaag
tttgtgaaag atat
2461424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 614ttgtatatga
aagtaagaag aagt
2461524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 615tagagagaag
aagaaataag aata
2461624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 616atttgaaatg
ttaatgagag agat
2461724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 617ttgtgtgtat
atagtattag aatg
2461824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 618attgttagta
ttgatgtgaa gtta
2461924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 619tgtttgtatt
tgaatgaaat gaag
2462024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 620tgttagattg
tgttaaatgt agtt
2462124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 621tatagagtat
tgtatagaga gaaa
2462224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 622aaatagtaag
aatgtagttg ttga
2462324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 623tgagtgtgat
ttatgattaa gtta
2462424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 624agaatttgtt
gtagtgttat gatt
2462524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 625gattgaagaa
agaaatagtt tgaa
2462624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 626gataatagag
aatagtagag ttaa
2462724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 627gattgaaatt
tgtagttata gtga
2462824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 628gatttaagaa
gatgaataat gtag
2462924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 629tttgagagaa
agtagaataa gata
2463024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 630gattaagagt
aaatgagtat aaga
2463124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 631tttgatagaa
ttgaaatttg agag
2463224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 632tgaagaagag
tgttataaga ttta
2463324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 633gtgaaatgat
ttagagtaat aagt
2463424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 634aaataagaat
agagagagaa agtt
2463524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 635gttgtaaagt
aatagagaaa ttag
2463624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 636agtgatttag
attatgtgat gatt
2463724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 637agagtatagt
ttagatttat gtag
2463824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 638atgattagat
agtgaaattg ttag
2463924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 639atgaaatgta
ttagtttaga gttg
2464024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 640atattgagtg
agagttattg ttaa
2464124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 641agatgtgtat
tgaattaaga agtt
2464224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 642taatgtgttg
atagaataga gata
2464324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 643aaattagttg
aaagtatgag aaag
2464424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 644tttagagttg
aagaaatgtt aatg
2464524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 645gattgttgat
tattgatgaa tttg
2464624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 646tgttgttgtt
gaattgaaga atta
2464724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 647attaagtaag
aattgagagt ttga
2464824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 648gtatgttgta
atgtattaag aaag
2464924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 649tagttgtgat
ttatgtaatg attg
2465024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 650tgataatgaa
agtttataga gaga
2465124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 651gtaagattgt
ttgtatgata agat
2465224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 652ttgaattaag
agtaagatgt ttag
2465324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 653aagtgtttgt
ttagagtaaa gata
2465424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 654agagagataa
agtatagaag ttaa
2465524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 655attatgaata
gttagaaaga gagt
2465624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 656ttgttgatat
tagagaatgt gttt
2465724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 657tttattgaga
gtttgttatt tgtg
2465824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 658agtgttaaga
agttgattat tgat
2465924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 659gagaaatgat
tgaatgttga taat
2466024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 660gataagtatt
agtatgagtg taat
2466124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 661tttgatttaa
gagtgttgaa tgta
2466224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 662aagttagtaa
atagagtaga aaga
2466324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 663gtaaagtatg
aatatgtgaa atgt
2466424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 664taataagtgt
gttgtgaatg taat
2466524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 665aaagatttag
agtagaaaga gaat
2466624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 666ttagtttgag
ttgaaatagt aaag
2466724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 667taatagtatg
agtaagattg aaag
2466824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 668gaagattaga
ttgatgttag ttaa
2466924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 669taaagagaga
agttagtaat agaa
2467024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 670taagtatgag
aaatgatgtg ttat
2467124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 671gagtttgttt
gttagttatt gata
2467224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 672aagtaaagaa
atgttaagag tagt
2467324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 673atgagaattg
ttgttgaaat gtaa
2467424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 674ttagattaga
gtagtagaag aata
2467524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 675tagtgatgaa
gaagttagaa atta
2467624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 676taatgtagta
atgtgatgat aagt
2467724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 677ttgagaaaga
ataagtagtg taaa
2467824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 678taatgagtga
gattatagat tgtt
2467924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 679gtataagaaa
tgtgtgtttg atta
2468024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 680gtgaatgtgt
taatgaagat atat
2468124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 681gaaagttatt
agtagttaaa gatg
2468224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 682tagaattgtg
tttgataagt gata
2468324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 683tgatttagat
tgagagttaa atga
2468424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 684attattgagt
ttgaatgttg atag
2468524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 685atagtagtta
tgtttgattt agtg
2468624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 686atagaagaag
aataaagtta gaga
2468724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 687gatgttgaaa
gtaatgaatt tgta
2468824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 688gagattgata
gtagaaatga taaa
2468924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 689tgagagaata
aagtatgaat ttga
2469024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 690tataaagatg
atgtgaatta gtag
2469124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 691ttatgtaaga
atgtttgaga gaaa
2469224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 692agtaaatgat
gaatgatatg atga
2469324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 693gaaatttgtg
ttaaagttga atga
2469424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 694gatgaatgat
tgtgtttaag tata
2469524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 695gaaataagtg
agagttaatg aaat
2469624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 696tgttgaaata
gttattagtt tgtg
2469724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 697tttgagagta
tattgatatg agaa
2469824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 698attgtgtgta
aagtaagatt taag
2469924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 699tatagtttga
agtgtgatgt attt
2470024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 700gtgaagttat
agtgtataaa gaat
2470124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 701gtatgttgaa
tagtaaatag attg
2470224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 702ttagaaagtg
tgatttgtgt attt
2470324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 703tttagtaata
tgtaagagat gtga
2470424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 704agtatgtata
gatgatgttt gttt
2470524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 705atttaagtaa
agtgtagaga taag
2470624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 706atttgtgttg
aattgtaaag tgaa
2470724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 707atgttattag
attgtgatga atga
2470824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 708tagtagtaga
atatgaaatt agag
2470924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 709tttaatgaga
agagttagag tata
2471024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 710aaagtttagt
agagtgtatg taaa
2471124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 711atatatgata
gtagagtaga ttag
2471224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 712tgagaagtta
attgtataga ttga
2471324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 713tatagagatg
ttatatgaag ttgt
2471424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 714aaatttgtta
agttgttgtt gttg
2471524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 715ttgttgaaga
tgaaagtaga atta
2471624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 716aagagataag
tagtgtttat gttt
2471724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 717aataagaaga
agtgaaagat tgat
2471824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 718taagttaaag
ttgatgattg atag
2471924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 719atataagata
agagtgtaag tgat
2472024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 720gttaaatgtt
gttgtttaag tgat
2472124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 721gagttaagtt
attagttaag aagt
2472224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 722tattagagtt
tgagaataag tagt
2472324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 723taatgttgtt
atgtgttaga tgtt
2472424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 724gaaagttgat
agaatgtaat gttt
2472524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 725tgatagatga
attgattgat tagt
2472624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 726atgatagagt
aaagaataag ttgt
2472724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 727agtaagtgtt
agatagtatt gaat
2472824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 728atgtagatta
aagtagtgta tgtt
2472924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 729ttattgataa
tgagagagtt aaag
2473024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 730atttgttatg
ataaatgtgt agtg
2473124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 731ttgaagaaat
aagagtaata agag
2473224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 732tgtgtaataa
gtagtaagat taga
2473324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 733atgaaagtta
gagtttatga taag
2473424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 734attagttaag
agagtttgta gatt
2473524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 735tgtagtattg
tatgattaaa gtgt
2473624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 736agttgataaa
gaagaagagt atat
2473724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 737gtaatgagat
aaagagagat aatt
2473824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 738tgtgttgaag
ataaagttta tgat
2473924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 739aagaagagta
gttagaattg atta
2474024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 740gaatgaagat
gaagtttgtt aata
2474124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 741aaattgttga
gataagatag tgat
2474224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 742tgattgttta
atgatgtgtg atta
2474324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 743atgaagtatt
gttgagtgat ttaa
2474424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 744gtgtaaatgt
ttgagatgta tatt
2474524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 745aattgatgag
tttaaagagt tgat
2474624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 746tttgtgtaat
atgattgaga gttt
2474724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 747gtagtagatg
attaagaaga taaa
2474824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 748tttaatgtga
aatttgttgt gagt
2474924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 749gtaaagaatt
agataaagag tgat
2475024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 750aatagttaag
tttaagagtt gtgt
2475124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 751gtgtgatgtt
tatagatttg ttat
2475224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 752gtatagtgtg
attagatttg taaa
2475324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 753gttgtaagaa
agatatgtaa gaaa
2475424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 754atattagatt
gtaaagagag tgaa
2475524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 755gagtgatatt
gaaattagat tgta
2475624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 756taagaagtta
aagaagagag ttta
2475724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 757gatgttagat
aaagtttaag tagt
2475824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 758gtgattgtat
gagaaatgtt aaat
2475924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 759tgattattgt
aagaaagatt gaga
2476024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 760aagaattgtg
taagtttatg agta
2476124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 761ttgtatttag
aagatttgta gatg
2476224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 762tatatgtttg
tgtaagaaga aatg
2476324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 763gataatgtgt
gaatttgtga ataa
2476424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 764ttagaaatgt
gagatttaag agtt
2476524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 765agtgtagaat
ttgtatttag ttgt
2476624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 766tagttaagat
agagtaaatg atag
2476724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 767gaagtgatat
tgtaaattga taag
2476824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 768gtaattgtgt
tagatttaag aagt
2476924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 769tgatatttgt
gaattgatag tatg
2477024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 770aagtaaagag
atatagttaa gttg
2477124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 771attagttaag
ttatttgtga gtga
2477224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 772agatgaagta
gtttatgaat taga
2477324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 773tgagttagtt
aagtgatagt taaa
2477424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 774ttattgtaga
tttagagaag atga
2477524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 775tatttgtgtt
tgttgattag atag
2477624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 776gtataatgtg
tgtgaaagtt ataa
2477724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 777tatatgttga
gtataaagag agaa
2477824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 778ttagttagtt
taaagattgt gagt
2477924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 779tttagaataa
gtgatgtgat gaaa
2478024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 780agagtaatgt
gtaaatagtt agat
2478124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 781tgtgataaag
agaaattagt tgtt
2478224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 782gaatttagtg
aatgtttgag atta
2478324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 783tgtgatgtgt
aagtatatga aatt
2478424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 784ttgtgaatga
ttaatgaata gaag
2478524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 785aatgttgttt
agattgagaa agtt
2478624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 786agattgtgtt
agtattagta taag
2478724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 787ttgatgtatt
agaaagttta tgtg
2478824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 788tatgattgtg
tgttagagaa ttta
2478924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 789tagtgtagat
atttgatagt tatg
2479024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 790agtttaatgt
gtttagttgt tatg
2479124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 791tgtgtaaagt
agaaagtaaa gatt
2479224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 792gttatgatat
agtgagttgt tatt
2479324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 793tttgattgaa
tgttaatagt gtgt
2479424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 794agagtattag
tagttattgt aagt
2479524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 795taagtagaaa
gaagaagata tttg
2479624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 796agaaagagaa
ttatgtaatg aaag
2479724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 797ttagatttgt
tagtgtgatt taag
2479824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 798gatgattaag
atatagagat agtt
2479924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 799atatttgagt
gattaagagt aatg
2480024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 800tgtattgtga
gttaagtata agtt
2480124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 801aatttagtag
aaagtgttgt gttt
2480224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 802gttagaagat
taagttgaat aatg
2480324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 803taaagtatgt
gagatgattt atgt
2480424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 804tgaaatgatt
aaagatgaag atga
2480524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 805ttattagatg
ttgagtgttt gttt
2480624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 806tagtgtttaa
agagtagtat atga
2480724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 807agttataagt
aaatgatgtt gatg
2480824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 808ttaagagaga
aataagtgta ttgt
2480924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 809gatattgaaa
tgtgtaaatg atga
2481024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 810atgatgaatt
aagaaagaaa gaga
2481124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 811gaatagtttg
atttgtgttt gtta
2481224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 812agttgtttag
atttgatttg taag
2481324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 813gtatgagatt
tgatataaga ttag
2481424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 814tttatagtga
gtatagtgat gatt
2481524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 815tatatgtgaa
gatataagtg tttg
2481624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 816attgatagat
gatagtaatt gagt
2481724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 817tgatagatgt
gaagaatttg attt
2481824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 818gaagatattg
aaagaatttg atgt
2481924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 819gatgtttagt
gtagatatag attt
2482024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 820gaatattgag
ttataagtag tagt
2482124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 821agtgagtaag
taatagaaag attt
2482224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 822gtagaataag
taatttgtga gata
2482324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 823gagttatttg
agatttagat gttt
2482424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 824gaaatgatga
ttgaatttag agat
2482524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 825aaatagtgtg
agaatagtta agta
2482624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 826atgtgttaag
ttgtagaaga ataa
2482724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 827ataatgagtt
aatagtgtaa gaag
2482824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 828ataagagatg
tttaagttag aaag
2482924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 829tgttagtgtt
agaaatatga aaga
2483024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 830tttagaagat
tgttagataa gttg
2483124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 831gtgtaatgta
taagatagtt aagt
2483224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 832tattagagag
aaattgtaga gatt
2483324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 833tagtgagata
aagtaaagtt tatg
2483424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 834ttgtgaaagt
taagtaagtt agtt
2483524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 835aaagtgtaag
ttgaagaata ttga
2483624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 836gaatagagtg
ttatttgaaa taga
2483724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 837tataagagag
agataagtaa taag
2483824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 838tgagtgaaat
tgatagagta aatt
2483924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 839gatgaataag
tttaagtgag aaat
2484024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 840gtgtgatatg
tttattgatt aagt
2484124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 841taaagtgagt
gtaaatgata atga
2484224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 842gtagagtttg
atttgaaaga atat
2484324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 843gaatattgtt
atgtttgtta tgag
2484424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 844gtgtaataag
atgtattgtt gttt
2484524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 845taaattgatt
gtgagttgaa gaat
2484624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 846tgagatagtt
atagttaagt ttag
2484724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 847agtttgttaa
gattatgtag aaag
2484824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 848gaatgtgtag
aataagagat taaa
2484924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 849gtattatgaa
agaagttgtt gttt
2485024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 850gtgttataga
agttaaatgt taag
2485124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 851ttaagagtag
tgaatatgat agta
2485224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 852aatgttataa
gatgagagtt tagt
2485324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 853atataagatt
tgatgtagtg tagt
2485424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 854tatgtttgtt
gttgttaagt ttga
2485524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 855gatagtttag
tatagaagat aaag
2485624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 856gttgaatata
gagatagtaa atag
2485724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 857agagaagatt
tagtaagaat gata
2485824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 858tgaatgagaa
agatattgag tatt
2485924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 859tgaagattat
agtagttgta taga
2486024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 860gattagtagt
attgaagatt atgt
2486124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 861tgaaatgtgt
atttgtatgt ttag
2486224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 862attaaagttg
atatgaaaga agtg
2486324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 863aatgtagaga
ttgtagtgaa tatt
2486424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 864ttatttgttg
agtgtaaatg tgat
2486524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 865atgtaattgt
gaataatgta tgtg
2486624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 866gatttgtata
gagattagta agta
2486724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 867aatattgttg
tttagagaaa gaag
2486824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 868atgatgatgt
atttgtaaag agta
2486924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 869aatgtatttg
tgtgattgtg taaa
2487024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 870agtgttatga
agaatagtaa gaat
2487124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 871gttatgtaga
gatgaaagaa atta
2487224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 872gtttgtatta
gataaatgag ttgt
2487324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 873tgatttatga
gattaagaga aaga
2487424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 874tttgtgtgtt
attgtaattg agat
2487524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 875gatgtgtgat
atgattaaag aaat
2487624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 876agattataga
tttgtagaga aagt
2487724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 877gaagagtatg
taatagtatt gtat
2487824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 878tttgtaatgt
tgttgagttt aaga
2487924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 879agtaaatagt
agtatgaata agag
2488024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 880gaatgttgaa
ttgaaatatg agtt
2488124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 881agtagttaat
tgatagtaag tttg
2488224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 882agtgtaaaga
aatgaatgaa taag
2488324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 883tgttagatat
ttgtgaaatg tgaa
2488424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 884tgtatgttga
gtttgaattg ttat
2488524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 885tgagtgaatt
agttatgttg ttat
2488624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 886gaagaaagaa
atgagaaaga ttat
2488724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 887ttaagtaagt
tgtgttgata ttag
2488824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 888atgatgtgtt
tgatttgaat tgaa
2488924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 889aagtaagtga
aattgttgtt tgaa
2489024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 890atgaagtgta
aagtttgaaa gaaa
2489124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 891agagagtaag
ataattgtat agta
2489224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 892tttatgagat
agatgaaata agtg
2489324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 893agaaattagt
agtaatgatt tgtg
2489424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 894gatttgagat
tgaatgagaa tata
2489524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 895gattagaaag
atgaataaag atga
2489624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 896tagatagaaa
gtatatgttg tagt
2489724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 897gaagatagta
aagtaaagta agtt
2489824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 898aaatgtgtgt
ttagtagttg taaa
2489924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 899ttgttgaagt
aagagatgaa taaa
2490024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 900tatttgagag
aaagaaagag ttta
2490124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 901tatttagtga
tgaatttgtg atgt
2490224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 902ttatagtgat
gatgataagt tgat
2490324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 903taaagataat
tgtagaaagt agtg
2490424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 904gtttagtatt
gatattgtgt gtaa
2490524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 905gtgttgtgaa
taagattgaa atat
2490624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 906aaagaaagta
taaagtgaga taga
2490724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 907tatttgtaag
aagtgtagat attg
2490824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 908tagaagatga
aattgtgatt tgtt
2490924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 909ataatagtaa
gtgaatgatg agat
2491024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 910aatgtgaata
agataaagtg tgta
2491124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 911attgaagata
aagatgttgt ttag
2491224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 912tgaaatagaa
gtgagattat agta
2491324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 913agttattgtg
aaagagttta tgat
2491424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 914aaatagtagt
gatagagaag attt
2491524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 915agtgtatgaa
gtgtaataag atta
2491624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 916tgattaagat
tgtgtagtgt tata
2491724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 917agtttatgat
atttgtagat gagt
2491824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 918tatgtgtatg
aagattatag ttag
2491924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 919gaaattgttg
tatagagtga tata
2492024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 920tagaaatagt
ttaagtatag tgtg
2492124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 921tgatttagat
gtttattgtg agaa
2492224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 922aagttgatat
ttgttgttag atga
2492324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 923tgatgtgata
atgagaataa agaa
2492424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 924aaagtttagt
ttgtattagt agag
2492524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 925agtttgatgt
gatagtaaat agaa
2492624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 926aagtgttatt
gaatgtgatg ttat
2492724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 927aaattgaagt
gtgataatgt ttgt
2492824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 928gtttagtgat
taaagataga ttag
2492924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 929ataagtgtat
aagagaagtg ttaa
2493024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 930atgaatttgt
ttgtgatgaa gtta
2493124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 931aaagaattga
gaaatgaaag ttag
2493224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 932agtgtaagag
tataaagtat ttga
2493324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 933gaattaagat
tgttatatgt gagt
2493424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 934tatgaaagtg
ttgtttaagt aaga
2493524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 935taaagtaaat
gttatgtgag agaa
2493624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 936aaagatattg
attgagatag agtt
2493724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 937aagtgatatg
aatatgtgag aaat
2493824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 938aaatagagtt
tgttaatgta agtg
2493924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 939gatttagatg
agttaagaat ttag
2494024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 940ttgtaaatga
gtgtgaatat tgta
2494124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 941agtagtgtat
ttgagataat agaa
2494224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 942tgagttaaag
agttgttgat attt
2494324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 943aaagagtgta
ttagaaatag tttg
2494424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 944gtttagttat
ttgatgagat aatg
2494524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 945aagtgtaaat
gaataaagag ttgt
2494624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 946aataaagtga
gtagaagtgt aatt
2494724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 947tattgagttt
gtgtaaagaa gata
2494824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 948tttatagttg
ttgtgttgaa agtt
2494924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 949atgaaatatg
attgtgtttg ttgt
2495024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 950aaagagatgt
aaagtgagtt atta
2495124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 951ttgaagaaag
ttagatgatg aatt
2495224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 952atgttatttg
tttagtttgt gtga
2495324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 953aaatatgaat
ttgaagagaa gtga
2495424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 954gattagatat
agaatattga agag
2495524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 955ttagaataag
agaaatgtat gtgt
2495624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 956tttatgaaag
agaagtgtat tatg
2495724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 957gtaagtatta
agtgtgattt agta
2495824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 958ataaagagaa
gtaaagagta aagt
2495924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 959attgttaatt
gaagtgtatg aaag
2496024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 960tatatagttg
agttgagtaa gatt
2496124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 961tagatgagat
atatgaaaga tagt
2496224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 962ataagaagat
gatttgtgta aatg
2496324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 963ttagtaataa
gaaagatgaa gaga
2496424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 964gatttgtgag
taaagtaaat agaa
2496524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 965aaatagatgt
agaatttgtg tgtt
2496624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 966gaaattagtg
tttgtgtgta ttat
2496724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 967atttgagtat
gatagaagat tgtt
2496824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 968atagagttga
agtatgtaaa gttt
2496924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 969taatttgtga
atgttgttat tgtg
2497024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 970ttagtttatg
agagtgagat ttaa
2497124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 971gttgttagag
tgtttatgaa attt
2497224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 972tttattgtga
tgtgaaataa gaga
2497324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 973gtaagtaata
tgatagtgat taag
2497424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 974tgagatgatg
tatatgtagt aata
2497524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 975aattgagaaa
gagataaatg atag
2497624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 976tttgaagtga
tgttagaatg ttta
2497724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 977agttgttgtg
taattgttag taaa
2497824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 978atagtgagaa
gtgataagat attt
2497924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 979gtgtgataag
taattgagtt aaat
2498024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 980tagttattgt
ttgtgaattt gaga
2498124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 981atagttgaat
agtaatttga agag
2498224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 982atgtttgtgt
ttgaatagag aata
2498324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 983tgataaagat
atgagagatt gtaa
2498424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 984taaagatgag
atgttgttaa agtt
2498524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 985aagtgaaatt
tgtaagaatt agtg
2498624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 986gaaatgagag
ttattgatag ttta
2498724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 987tttgtaaatg
agatatagtg ttag
2498824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 988gttaattgtg
atatttgatt agtg
2498924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 989agagtgttga
taaagatgtt tata
2499024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 990aattgtgaga
aattgataag aaga
2499124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 991ttaaagagaa
ttgagaagag aaat
2499224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 992ttgttagaag
aattgaatgt atgt
2499324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 993agttaagata
tgtgtgatgt ttaa
2499424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 994tgagttatgt
tgtaatagaa attg
2499524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 995ttagataagt
ttagagattg agaa
2499624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 996atgagtaata
agagtatttg aagt
2499724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 997tgtttaagtg
taatgatttg ttag
2499824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 998ttgaagaaga
ttgttattgt tgaa
2499924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 999tatagaaaga
ttaaagagtg aatg
24100024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1000taaattgtta
gaaatttgag tgtg
24100124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1001attgttagtg
tgttattgat tatg
24100224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1002gagaattatg
tgtgaatata gaaa
24100324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1003ttgattgata
aagtaaagag tgta
24100424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1004gtgtgtaaat
tgaatatgtt aatg
24100524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1005aaagtaaaga
aagaagtttg aaag
24100624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1006tttagttgaa
gaatagaaag aaag
24100724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1007gtgtaataag
agtgaatagt aatt
24100824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1008tattgaaata
agagagattt gtga
24100924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1009atgagaaaga
agaagttaag attt
24101024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1010aagagtgagt
atattgttaa agaa
24101124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1011tttgtaaagt
gatgatgtaa gata
24101224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1012gatgttatgt
gatgaaatat gtat
24101324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1013gtagaataaa
gtgttaaagt gtta
24101424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1014aaagagtatg
tgtgtatgat attt
24101524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1015aaagataaga
gttagtaaat tgtg
24101624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1016aagaattaga
gaataagtgt gata
24101724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1017gataagaaag
tgaaatgtaa attg
24101824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1018gatgaaagat
gtttaaagtt tgtt
24101924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1019agtgtaagta
ataagtttga gaaa
24102024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1020gttgagaatt
agaatttgat aaag
24102124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1021ttaagaaatt
tgtatgtgtt gttg
24102224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1022agaagattta
gatgaaatga gttt
24102324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1023taagtttgag
ataaagatga tatg
24102424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1024tgagatagtt
tgtaatatgt ttgt
24102524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1025agtttgaaat
tgtaagtttg atga
24102624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1026tagaattgat
taatgatgag tagt
24102724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1027agagatttgt
aataagtatt gaag
24102824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1028ataatgatgt
aatgtaagta gtgt
24102924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1029tgaaatttga
tgagagatat gtta
24103024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1030tgtgtaaagt
atagtttatg ttag
24103124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1031tgaataagtg
aaatagaatg aatg
24103224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1032aaagaaagat
tgtaataagt agag
24103324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1033aatgaaatag
tgttaaatga gtgt
24103424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1034gtagataaag
atgtgaatta tgat
24103524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1035gatagtatat
gtgtgtattt gttt
24103624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1036atgtttgtag
aaatgtttga agat
24103724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1037aaatttgtag
agagaaattt gttg
24103824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1038tagaataaga
ttagtaagtg taga
24103924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1039tgatttagag
aaatatgagt agaa
24104024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1040aatagagtat
gttgtttatg agaa
24104124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1041gatgatgaag
agtttattgt aaat
24104224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1042aagtaaagaa
gaagaaatgt gtta
24104324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1043ttgaagaatt
aagtgtttag tgta
24104424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1044agaaagaatg
ttgatttatg atgt
24104524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1045gattaaagag
atgttgattg aaat
24104624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1046aatgataatt
gttgagagag taat
24104724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1047gtttgttgaa
agtgtaaagt atat
24104824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1048tgagttatat
gagaaagtgt aatt
24104924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1049ttgtgagaaa
gaagtatata gaat
24105024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1050gtaagtttag
agttatagag ttta
24105124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1051gatagataga
taagttaatt gaag
24105224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1052agagatgatt
gtttatgtat tatg
24105324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1053aaagttaaga
aattgtagtg atag
24105424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1054tttgatattg
tttgtgagtg tata
24105524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1055atttgtagaa
agttgttatg agtt
24105624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1056gatttgagta
agtttataga tgaa
24105724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1057aagataaagt
gagttgattt agat
24105824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1058gatattgtaa
gatatgttgt aaag
24105924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1059gtaagagtgt
attgtaagtt aatt
24106024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1060gtgtgattag
taatgaagta ttta
24106124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1061gtaagaaaga
ttaagtgtta gtaa
24106224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1062agtagaaagt
tgaaattgat tatg
24106324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1063taagagaagt
tgagtaatgt attt
24106424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1064gttaagaaat
agtagataag tgaa
24106524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1065taagtaaatt
gaaagtgtat agtg
24106624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1066aagatgtatg
tttattgttg tgta
24106724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1067atttagaata
tagtgaagag atag
24106824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1068gttatgaaag
agtatgtgtt aaat
24106924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1069tattatgtga
agaagaatga ttag
24107024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1070taataagttg
aagagaattg ttgt
24107124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1071tgatgtttga
tgtaattgtt aaag
24107224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1072gtgaaagatt
tgagtttgta taat
24107324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1073agagaatata
gattgagatt tgtt
24107424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1074tttgagatgt
gatgataaag ttaa
24107524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1075gttgtaaatt
gtagtaaaga agta
24107624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1076gtgttatgat
gttgtttgta ttat
24107724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1077attattgtgt
agatgtatta agag
24107824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1078gttagaaaga
tttagaagtt agtt
24107924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1079ttgtgtatta
agagagtgaa atat
24108024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1080gtttaagata
gaaagagtga ttta
24108124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1081aatgagaaat
agatagttat tgtg
24108224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1082tgaattgaat
aagaatttgt tgtg
24108324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1083aataagattg
aattagtgag taag
24108424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1084aatgtttgag
agatttagta aaga
24108524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1085agtttagaat
agaaatgtgt ttga
24108624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1086tataagtaag
tgttaagatt tgag
24108724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1087gtagtgaata
agttagtgtt aata
24108824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1088aagtgtgtta
aagtaaatgt agat
24108924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1089agagatgttt
atgttgtgaa ttaa
24109024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1090agttgaatat
tgatgataag aaga
24109124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1091tgaatgtgag
atgtttagaa taat
24109224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1092aataatgatg
taagtttgag tttg
24109324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1093aaagagtgaa
tagaaataag agaa
24109424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1094aataaagtta
ttgagagagt ttag
24109524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1095agtagtgttg
tagtttagta tata
24109624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1096gtaagaatgt
attagatatt tgtg
24109724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1097gataaatgtt
tgataaagta gttg
24109824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1098atagtatgta
tgtgtgaaga ttta
24109924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1099atgaatgtag
agtgattagt ttaa
24110024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1100gtagtattta
gtgatgtaag aata
24110124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1101agaattgtat
tgaagaagaa tatg
24110224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1102tttatagaat
tgagagaagt taag
24110324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1103aaagtagtag
agatttgaga atta
24110424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1104tttaaagaaa
gtattgtaag agtg
24110524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1105aaattgagaa
agtgaatgaa gttt
24110624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1106aagaaataag
tatgatagta gtag
24110724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1107atttgaattg
tattgtagtt tgtg
24110824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1108aagagaataa
tgtagagata taag
24110924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1109tgtgtaatag
ttgttaatga gtaa
24111024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1110tatagttgta
gtttagatga atgt
24111124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1111attgtgttag
aatgatgtta atag
24111224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1112gtttgtatag
tatttgattg atgt
24111324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1113agagtaaagt
atgagttatg aata
24111424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1114gaaagtttaa
gtgatgtata ttgt
24111524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1115ttaaatgata
aagagtagtg aagt
24111624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1116ttaaatgtgt
gagaagatga ataa
24111724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1117atttgtataa
agtgaagaag agaa
24111824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1118tgattagtat
ttgtgaagag attt
24111924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1119tttgaatgaa
attgatgata gatg
24112024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1120agagtaagat
taagaataag aaag
24112124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1121attgaattga
gaagtgaagt aaat
24112224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1122tttagagaag
tattgtttga aaga
24112324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1123taaagtgaaa
gatttgaaat gatg
24112424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1124gaaagttaga
gaaatgtaga aatt
24112524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1125gtgaataatg
aagaagttat gtta
24112624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1126ttgtgaataa
agtagatgtg ttat
24112724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1127ttatatgata
tgagtttgtg ttga
24112824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1128ttgatttgtg
tgagtattag ttat
24112924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1129aaagtgatta
agttagtttg agat
24113024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1130ttgtatttgt
ataatgttga agag
24113124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1131gtttgaaatt
agtgtgagaa atat
24113224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1132aatgttgaga
ttgataatgt tgaa
24113324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1133tagtagtagt
attgttgtaa taag
24113424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1134gttgtaattt
gagtgttagt tatt
24113524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1135tgaatatgat
agttagtaat tgtg
24113624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1136tgatagtatg
tttgtgatta aaga
24113724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1137gatgtataaa
gagtatgtta taag
24113824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1138agtgagattt
agaagatgtt atta
24113924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1139atgagaattt
gttaaagaga aagt
24114024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1140aaagaattag
tatgatagat gaga
24114124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1141tagagttgta
tagtttatag ttga
24114224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1142gtagaatgat
tgtttagaag attt
24114324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1143gtttatgttt
gagaagagtt attt
24114424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1144tagaagtttg
aaagttattg attg
24114524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1145gatgaagagt
atttgttata tgta
24114624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1146gatgaatata
gtaagtattg agta
24114724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1147tagtgatgaa
atttgagata gata
24114824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1148gaaagaaatt
gaagagtttg atat
24114924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1149atttgagtat
ttgtgtattg aatg
24115024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1150atgagttgaa
atttgaagta ttgt
24115124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1151ttaatagtga
gagagtatat gtaa
24115224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1152attaagagag
tgagtaaatg taaa
24115324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1153aagaatagat
gagattagaa atag
24115424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1154agtttaaaga
gttagaattg aaag
24115524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1155gtaagatttg
ttgaataaag aaga
24115624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1156agagaaagaa
gttaaagtga tatt
24115724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1157taatagagaa
gagatgtatg aata
24115824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1158ttattagtga
taagtgaagt ttag
24115924DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1159ataatgtaaa
gatgagttta tgag
24116024DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1160ttgatttgag
agttgataag attt
24116124DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1161atgattattg
tgtgtagaat taga
24116224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1162tataaagata
tagtagatga tgtg
24116324DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1163tttagttgag
atgaagttat taga
24116424DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1164attgaattga
tatagtgtaa agtg
24116524DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1165gaagaaagat
tattgtattg agtt
24116624DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1166attgagtgta
gtgatttaga aata
24116724DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1167aataaagtgt
ttaagagtag agta
24116824DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1168gtagagataa
ttgatgtgta attt
24116919DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1169tgatcgtagc
tacgccgcg
19117016DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1170cgtacgattg caacgt
16117148DNAArtificial
SequenceDescription of Artificial SequenceArtificially Synthesized
DNA Sequence 1171atgttaaagt aagtgttgaa atgttccagg gaagcgtgtc accgtcgt
48117224DNAArtificial SequenceDescription of Artificial
SequenceArtificially Synthesized DNA Sequence 1172tcatggcgac
tgtccagctt tgtg 24
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20110001057 | COMPONENT FOR MANIPULATING A STREAM OF CHARGED PARTICLES |
20110001056 | COMPONENT FOR MANIPULATING A STREAM OF CHARGED PARTICLES |
20110001055 | RADIATION DETECTION SYSTEM |
20110001054 | RADIATION DETECTOR DEVICE HAVING AN ELECTRICALLY CONDUCTIVE OPTICAL INTERFACE |
20110001053 | LOW-POWER TDC-ADC AND ANGER LOGIC IN RADIATION DETECTION APPLICATIONS |