Inventors list |
Assignees list |
Classification tree browser |
Top 100 Inventors |
Top 100 Assignees |
Patent application title: POLYNUCLEOTIDES ENCODING ANTIGENIC HIV TYPE C POLYPEPTIDES, POLYPEPTIDES AND USES THEREOF
Inventors:
Jan Zur Megede (San Francisco, CA, US)
Susan Barnett (San Francisco, CA, US)
Ying Lian (Vallejo, CA, US)
Susan Engelbrecht (Tygerberg, ZA)
Estrelita Janse Van Rensburg (Tygerberg, ZA)
Assignees:
NOVARTIS VACCINES AND DIAGNOSTICS, INC.
University of Stellenbosch
IPC8 Class: AA61K9127FI
USPC Class:
424450
Class name: Drug, bio-affecting and body treating compositions preparations characterized by special physical form liposomes
Publication date: 2010-12-16
Patent application number: 20100316698
Sign up to receive free email alerts when patent applications with chosen keywords are published SIGN UP
Abstract:
The present invention relates to polynucleotides encoding immunogenic HIV
type C polypeptides. Uses of the polynucleotides in applications
including DNA immunization, generation of packaging cell lines, and
production of HIV Type C proteins are also described.Claims:
1. An expression cassette comprising a polynucleotide sequence encoding a
polypeptide comprising:(a) an HIV Pol polypeptide, wherein the
polynucleotide sequence encoding said Pol polypeptide comprises a
sequence having at least 90% sequence identity to the sequence presented
of FIG. 8 (SEQ ID NO:30); FIG. 9 (SEQ ID NO:31) or FIG. 10 (SEQ ID
NO:32);(b) X contiguous nucleotides, wherein (i) the X contiguous
nucleotides have at least 90% percent identity to Y contiguous
nucleotides of SEQ ID NO:46, (ii) X equals Y, and (iii) Y is at least
97:(c) X contiguous nucleotides, wherein (i) the X contiguous nucleotides
have at least 90% percent identity to Y contiguous nucleotides of SEQ ID
NO:51 (ii) X equals Y, and (iii) Y is 1494:(d) X contiguous nucleotides,
wherein (i) the X contiguous nucleotides have at least 90% percent
identity to Y contiguous nucleotides of SEQ ID NO:99, (ii) X equals Y,
and (iii) Y is 1491:(e) X contiguous nucleotides, wherein (i) the X
contiguous nucleotides have at least 90% percent identity to Y contiguous
nucleotides of SEQ ID NO:55; SEQ ID NO:57; SEQ ID NO:101; SEQ ID NO:96;
SEQ ID NO:134 or SEQ ID NO:135, (ii) X equals Y, and (iii) Y is at least
60:(f) X contiguous nucleotides, wherein (i) the X contiguous nucleotides
have at least 90% percent identity to Y contiguous nucleotides of SEQ ID
NO:58; (ii) X equals Y, and (iii) Y is 354:(g) X contiguous nucleotides,
wherein (i) the X contiguous nucleotides have at least 90% percent
identity to Y contiguous nucleotides of SEQ ID NO:60; (ii) X equals Y,
and (iii) Y is 876.(h) X contiguous nucleotides, wherein (i) the X
contiguous nucleotides have at least 90% percent identity to Y contiguous
nucleotides of SEQ ID NO:62; (ii) X equals Y, and (iii) Y is 3015:(i) X
contiguous nucleotides, wherein (i) the X contiguous nucleotides have at
least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:103;
(ii) X equals Y, and (iii) Y is 3009:(j) X contiguous nucleotides,
wherein (i) the X contiguous nucleotides have at least 90% percent
identity to Y contiguous nucleotides of SEQ ID NO:64 or SEQ ID NO:66;
(ii) X equals Y, and (iii) Y is 297;(k) X contiguous nucleotides, wherein
(i) the X contiguous nucleotides have at least 90% percent identity to Y
contiguous nucleotides of SEQ ID NO:68, (ii) X equals Y, and (iii) Y is
1965:(l) An expression cassette comprising a polynucleotide comprising X
contiguous nucleotides, wherein (i) the X contiguous nucleotides have at
least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:70;
(ii) X equals Y, and (iii) Y is 1977;(m) X contiguous nucleotides,
wherein (i) the X contiguous nucleotides have at least 90% percent
identity to Y contiguous nucleotides of SEQ ID NO:72 or SEQ ID NO:105,
(ii) X equals Y, and (iii) Y is at least 30;(n) X contiguous nucleotides,
wherein (i) the X contiguous nucleotides have at least 90% percent
identity to Y contiguous nucleotides of SEQ ID NO:74 or SEQ ID NO:107,
(ii) X equals Y, and (iii) Y is at least 30;(o) X contiguous nucleotides,
wherein (i) the X contiguous nucleotides have at least 90% percent
identity to Y contiguous nucleotides of SEQ ID NO:76; (ii) X equals Y,
and (iii) Y is 1680:(p) X contiguous nucleotides, wherein (i) the X
contiguous nucleotides have at least 90% percent identity to Y contiguous
nucleotides of SEQ ID NO:78; (ii) X equals Y, and (iii) Y is 1668:(q) X
contiguous nucleotides, wherein (i) the X contiguous nucleotides have at
least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:80,
SEQ ID NO:81 or SEQ ID NO:109; (ii) X equals Y, and (iii) Y is 216;(r) X
contiguous nucleotides, wherein (i) the X contiguous nucleotides have at
least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:83;
(ii) X equals Y, and (iii) Y is 93;(s) X contiguous nucleotides, wherein
(i) the X contiguous nucleotides have at least 90% percent identity to Y
contiguous nucleotides of SEQ ID NO:111; (ii) X equals Y, and (iii) Y is
90;(t) X contiguous nucleotides, wherein (i) the X contiguous nucleotides
have at least 90% percent identity to Y contiguous nucleotides of SEQ ID
NO:85, or SEQ ID NO:113; (ii) X equals Y, and (iii) Y is 579.(u) X
contiguous nucleotides, wherein (i) the X contiguous nucleotides have at
least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:87;
(ii) X equals Y, and (iii) Y is 288.(v) X contiguous nucleotides, wherein
(i) the X contiguous nucleotides have at least 90% percent identity to Y
contiguous nucleotides of SEQ ID NO:115; (ii) X equals Y, and (iii) Y is
287:(w) X contiguous nucleotides, wherein (i) the X contiguous
nucleotides have at least 90% percent identity to Y contiguous
nucleotides of SEQ ID NO:89 or SEQ ID NO:117; (ii) X equals Y, and (iii)
Y is at least 30;(x) X contiguous nucleotides, wherein (i) the X
contiguous nucleotides have at least 90% percent identity to Y contiguous
nucleotides of SEQ ID NO:91; (ii) X equals Y, and (iii) Y is at least
30:(y) X contiguous nucleotides, wherein (i) the X contiguous nucleotides
have at least 90% percent identity to Y contiguous nucleotides of SEQ ID
NO:93 or SEQ ID NO:94; (ii) X equals Y, and (iii) Y is 309;(z) X
contiguous nucleotides, wherein (i) the X contiguous nucleotides have at
least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:96;
(ii) X equals Y, and (iii) Y is at least 60; or(aa) X contiguous
nucleotides, wherein (i) the X contiguous nucleotides have at least 90%
percent identity to Y contiguous nucleotides of SEQ ID NO:119, SEQ ID
NO:120; SEQ ID NO:121; SEQ ID NO:122; SEQ ID NO:123; SEQ ID NO:124; SEQ
ID NO:125; SEQ ID NO:126; SEQ ID NO:127; SEQ ID NO:131; SEQ ID NO:132 or
SEQ ID NO:133, (ii) X equals Y, and (iii) Y is at least 60.
2. (canceled)
3. The expression cassette of claim 1, wherein the polynucleotide comprises (b) and wherein (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:47, (ii) X equals Y, and (iii) Y is at least 144.
4. The expression cassette of claim 3, comprising a polynucleotide comprising X contiguous nucleotides, wherein (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:49 or SEQ ID NO:97, (ii) X equals Y, and (iii) Y is at least 300.
5. The expression cassette of claim 4, comprising a polynucleotide comprising X contiguous nucleotides, wherein (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:49, (ii) X equals Y, and (iii) Y is 2610.
6. The expression cassette of claim 4, comprising a polynucleotide comprising X contiguous nucleotides, wherein (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:97, (ii) X equals Y, and (iii) Y is 2565.
7-9. (canceled)
10. The expression cassette of claim 1, wherein the polynucleotide, comprises (e) and wherein (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:55; SEQ ID NO:57; SEQ ID NO:101; SEQ ID NO:96; SEQ ID NO:134 or SEQ ID NO:135, (ii) X equals Y, and (iii) Y is 624.
11-18. (canceled)
19. The expression cassette of claim 1, wherein the polynucleotide comprises (m) and wherein (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:72 or SEQ ID NO:105; (ii) X equals Y, and (iii) Y is 75.
20. (canceled)
21. The expression cassette of claim 1, comprising a wherein the polynucleotide comprising X contiguous nucleotides, comprises (n) and wherein (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:74 or SEQ ID NO:107; (ii) X equals Y, and (iii) Y is 246.
22-30. (canceled)
31. The expression cassette of claim 1 wherein the polynucleotide comprises (w) and wherein (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:89; (ii) X equals Y, and (iii) Y is 267.
32. The expression cassette of claim 1 wherein the polynucleotide comprises (w) and wherein (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:117; (ii) X equals Y, and (iii) Y is 261.
33. (canceled)
34. The expression cassette of claim 1 wherein the polynucleotide comprises (x) and wherein (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:91; (ii) X equals Y, and (iii) Y is 321.
35-36. (canceled)
37. The expression cassette of claim 1 wherein the polynucleotide comprises (z) and wherein (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:96; (ii) X equals Y, and (iii) Y is 624.
38. (canceled)
39. The expression cassette of claim 1, wherein the polynucleotide comprises (aa) and wherein (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:119, SEQ ID NO:120; SEQ ID NO:121; SEQ ID NO:122; SEQ ID NO:123; SEQ ID NO:124; SEQ ID NO:125; SEQ ID NO:126; SEQ ID NO:127; SEQ ID NO:131; SEQ ID NO:132 or SEQ ID NO:133, (ii) X equals Y, and (iii) Y is at least 300.
40. The expression cassette of claim 39, wherein:(a) (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:123 or SEQ ID NO:124, (ii) X equals Y, and (iii) Y is 2433;(b) (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:122, (ii) X equals Y, and (iii) Y is 2301;(c) (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:125; (ii) X equals Y, and (iii) Y is 2517;(d) (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:126 or SEQ ID NO:127, (ii) X equals Y, and (iii) Y is 2520;(e) (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:119, (ii) X equals Y, and (iii) Y is 1377;(f) (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:120 or SEQ ID NO:121, (ii) X equals Y, and (iii) Y is 1839; or(g) (i) the X contiguous nucleotides have at least 90% percent identity to Y contiguous nucleotides of SEQ ID NO:132 or SEQ ID NO:133, (ii) X equals Y, and (iii) Y is 1890.
41-46. (canceled)
47. A polynucleotide comprising the sequence depicted in SEQ ID NO:33, SEQ ID NO:45, SEQ ID NO:128, or fragments derived therefrom.
48. The polynucleotide of claim 47, wherein said fragments comprise coding sequence for the gene products selected from the group consisting of Gag, Pol, Vif, Vpr, Tat, Rev, Vpu, Env and Nef.
49. The polynucleotide of claim 48, wherein the fragment comprises a Gag gene product.
50. The polynucleotide of claim 48, wherein the fragment comprises an Env gene product.
51. The polynucleotide of claim 50, wherein the Env gene product is gp160, gp140 or gp120.
52-58. (canceled)
59. The expression cassette of claim 1, further comprising one or more nucleic acids encoding one or more viral polypeptides or antigens.
60. The expression cassette of claim 59, wherein the viral polypeptide or antigen is selected from the group consisting of Gag, Env, vif, vpr, tat, rev, vpu, nef and combinations thereof.
61. The expression cassette of claim 1, further comprising one or more nucleic acids encoding one or more cytokines.
62. A recombinant expression system for use in a selected host cell, comprising, an expression cassette of claim 1, and wherein said polynucleotide sequence further comprises control elements capable of driving expression in the selected host cell.
63. The recombinant expression system of claim 62, wherein said control elements are selected from the group consisting of a transcription promoter, a transcription enhancer element, a transcription termination signal, polyadenylation sequences, sequences for optimization of initiation of translation, and translation termination sequences.
64. The recombinant expression system of claim 62 wherein said transcription promoter is selected from the group consisting of CMV, CMV+intron A, SV40, RSV, HIV-Ltr, MMLV-ltr, and metallothionein.
65. A cell comprising an expression cassette of claim 1, and wherein said polynucleotide sequence further comprises control elements compatible with expression in the selected cell.
66. The cell of claim 65, wherein the cell is selected from the group consisting of a mammalian cell, an insect cell, a bacterial cell, a yeast cell, a plant, an antigen presenting cell, a primary cell, an immortalized cell, and a tumor derived cell.
67. The cell of claim 66, wherein the cell is selected from the group consisting of BHK, VERO, HT1080, 293, RD, COS-7, and CHO cells.
68. The cell of claim 67, wherein said cell is a CHO cell.
69. The cell of claim 66, wherein the cell is either Trichoplusia ni (Tn5) or Sf9 insect cells.
70. The cell of claim 66, wherein the antigen presenting cell is a lymphoid cell selected from the group consisting of macrophage, monocytes, dendritic cells, B-cells, T-cells, stem cells, and progenitor cells thereof.
71. A composition for generating an immunological response, comprising an expression cassette of claim 1.
72. The composition of claim 71, further comprising one or more Pol polypeptides.
73. The composition of claim 72, further comprising an adjuvant.
74. A composition for generating an immunological response, comprising an expression cassette of claim 52.
75. The composition of claim 74, further comprising a Pol polypeptide.
76. The composition of claim 74, further comprising one or more polypeptides encoded by the nucleic acid molecules encoding a viral polypeptide or antigen selected from the group consisting of Gag, Env, vif, vpr, tat, rev, vpu, nef and combinations thereof.
77. The composition of claim 76, further comprising an adjuvant.
78. A method of immunization of a subject, comprising, introducing a composition of claim 71 into said subject under conditions that are compatible with expression of said expression cassette in said subject.
79. The method of claim 78, wherein said expression cassette is introduced using a gene delivery vector.
80. The method of claim 79, wherein the gene delivery vector is a non-viral vector.
81. The method of claim 79, wherein said gene delivery vector is a viral vector.
82. The method of claim 79, wherein said gene delivery vector is selected from the group consisting of an adenoviral vector, a vaccinia viral vector, an AAV vector, a retroviral vector, a lentiviral vector and an alphaviral vector.
83. The method of claim 82, wherein said gene delivery vector is a Sindbis-virus derived vector.
84. The method of claim 82, wherein said gene delivery vector is a cDNA vector.
85. The method of claim 82, wherein said gene delivery vector is a eukaryotic layered viral initiation system (ELVIS).
86. The method of claim 79, wherein said composition delivered using a particulate carrier.
87. The method of claim 79, wherein said composition is coated on a gold or tungsten particle and said coated particle is delivered to said subject using a gene gun.
88. The method of claim 79, wherein said composition is encapsulated in a liposome preparation.
89. The method of claim 79, wherein said subject is a mammal.
90. The method of claim 89, wherein said mammal is a human.
91. A method of generating an immune response in a subject, comprising: providing an expression cassette of claim 1, expressing said polypeptide in a suitable host cell, isolating said polypeptide, and administering said polypeptide to the subject in an amount sufficient to elicit an immune response.
92. A method of generating an immune response in a subject, comprising introducing into cells of said subject an expression cassette of claim 1, under conditions that permit the expression of said polynucleotide and production of said polypeptide, thereby eliciting an immunological response to said polypeptide.
93. The method of claim 92, where the method further comprises co-administration of an HIV polypeptide.
94. The method of claim 93, wherein co-administration of the polypeptide to the subject is carried out before introducing said expression cassette.
95. The method of claim 93, wherein co-administration of the polypeptide to the subject is carried out concurrently with introducing said expression cassette.
96. The method of claim 93, wherein co-administration of the polypeptide to the subject is carried out after introducing said expression cassette.
97. The expression cassette of claim 59, wherein the viral polypeptide or antigen is selected from the group consisting of polypeptides derived from hepatitis B, hepatitis C and combinations thereof.
Description:
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001]This application is a continuation-in-part of U.S. Ser. No. 09/610,313, filed Jul. 5, 2000.
TECHNICAL FIELD
[0002]Polynucleotides encoding antigenic Type C HIV polypeptides (e.g., Gag, pol, vif, vpr, tat, rev, vpu, env, and nef) are described, as are uses of these polynucleotides and polypeptide products in immunogenic compositions. Also described are polynucleotide sequences from South African variants of HIV Type C.
BACKGROUND OF THE INVENTION
[0003]Acquired immune deficiency syndrome (AIDS) is recognized as one of the greatest health threats facing modern medicine. There is, as yet, no cure for this disease. In 1983-1984, three groups independently identified the suspected etiological agent of AIDS. See, e.g., Barre-Sinoussi et al. (1983) Science 220:868-871; Montagnier et al., in Human T-Cell Leukemia Viruses (Gallo, Essex & Gross, eds., 1984); Vilmer et al. (1984) The Lancet 1:753; Popovic et al. (1984) Science 224:497-500; Levy et al. (1984) Science 225:840-842. These isolates were variously called lymphadenopathy-associated virus (LAV), human T-cell lymphotrophic virus type III (HTLV-III), or AIDS-associated retrovirus (ARV). All of these isolates are strains of the same virus, and were later collectively named Human Immunodeficiency Virus (HIV). With the isolation of a related AIDS-causing virus, the strains originally called HIV are now termed HIV-1 and the related virus is called HIV-2 See, e.g., Guyader et al. (1987) Nature 326:662-669; Brun-Vezinet et al. (1986) Science 233:343-346; Clavel et al. (1986) Nature 324:691-695.
[0004]A great deal of information has been gathered about the HIV virus, however, to date an effective vaccine has not been identified. Several targets for vaccine development have been examined including the env and Gag gene products encoded by HIV. Gag gene products include, but are not limited to, Gag-polymerase and Gag-protease. Env gene products include, but are not limited to, monomeric gp120 polypeptides, oligomeric gp140 polypeptides and gp160 polypeptides.
[0005]Haas, et al., (Current Biology 6(3):315-324, 1996) suggested that selective codon usage by HIV-1 appeared to account for a substantial fraction of the inefficiency of viral protein synthesis. Andre, et al., (J. Virol. 72(2):1497-1503, 1998) described an increased immune response elicited by DNA vaccination employing a synthetic gp120 sequence with modified codon usage. Schneider, et al., (J Virol. 71(7):4892-4903, 1997) discuss inactivation of inhibitory (or instability) elements (INS) located within the coding sequences of the Gag and Gag-protease coding sequences.
[0006]The Gag proteins of HIV-1 are necessary for the assembly of virus-like particles. HIV-1 Gag proteins are involved in many stages of the life cycle of the virus including, assembly, virion maturation after particle release, and early post-entry steps in virus replication. The roles of HIV-1 Gag proteins are numerous and complex (Freed, E. O., Virology 251:1-15, 1998).
[0007]Wolf, et al., (PCT International Application, WO 96/30523, published 3 Oct. 1996; European Patent Application, Publication No. 0 449 116 A1, published 2 Oct. 1991) have described the use of altered pr55 Gag of HIV-1 to act as a non-infectious retroviral-like particulate carrier, in particular, for the presentation of immunologically important epitopes. Wang, et al., (Virology 200:524-534, 1994) describe a system to study assembly of HIV Gag-β-3-galactosidase fusion proteins into virions. They describe the construction of sequences encoding HIV Gag-β-galactosidase fusion proteins, the expression of such sequences in the presence of HIV Gag proteins, and assembly of these proteins into virus particles.
[0008]Shiver, et al., (PCT International Application, WO 98/34640, published 13 Aug. 1998) described altering HIV-1 (CAM1) Gag coding sequences to produce synthetic DNA molecules encoding HIV Gag and modifications of HIV Gag. The codons of the synthetic molecules were codons preferred by a projected host cell.
[0009]Recently, use of HIV Env polypeptides in immunogenic compositions has been described. (see, U.S. Pat. No. 5,846,546 to Hurwitz et al., issued Dec. 8, 1998, describing immunogenic compositions comprising a mixture of at least four different recombinant virus that each express a different HIV env variant; and U.S. Pat. No. 5,840,313 to Vahlne et al., issued Nov. 24, 1998, describing peptides which correspond to epitopes of the HIV-1 gp120 protein). In addition, U.S. Pat. No. 5,876,731 to Sia et al, issued Mar. 2, 1999 describes candidate vaccines against HIV comprising an amino acid sequence of a T-cell epitope of Gag linked directly to an amino acid sequence of a B-cell epitope of the V3 loop protein of an HIV-1 isolate containing the sequence GPGR. There remains a need for antigenic HIV polypeptides, particularly Type C isolates.
SUMMARY OF THE INVENTION
[0010]Described herein are novel Type C HIV sequences, for example, 8--5_TV1_C.ZA, 8--2_TV1_C.ZA and 12-5--1_TV2_C.ZA, polypeptides encoded by these novel sequences, and synthetic expression cassettes generated from these and other Type C HIV sequences.
[0011]In certain embodiments, the present invention relates synthetic expression cassettes encoding HIV Type C polypeptides, including Env, Gag, Pol, Prot, Vpr, Vpu, Vif, Nef, Tat, Rev and/or fragments thereof. In addition, the present invention also relates to improved expression of HIV Type C polypeptides and production of virus-like particles. Synthetic expression cassettes encoding the HIV polypeptides (e.g., Gag-, pol-, protease (prot)-, reverse transcriptase, integrase, RNAseH, Tat, Rev, Nef, Vpr, Vpu, Vif and/or Env-containing polypeptides) are described, as are uses of the expression cassettes.
[0012]Thus, one aspect of the present invention relates to expression cassettes and polynucleotides contained therein. The expression cassettes typically include an HIV-polypeptide encoding sequence inserted into an expression vector backbone. In one embodiment, an expression cassette comprises a polynucleotide sequence encoding one or more Pol-containing polypeptides, wherein the polynucleotide sequence comprises a sequence having at least about 85%, preferably about 90%, more preferably about 95%, and more preferably about 98% sequence (and any integers between these values) identity to the sequences taught in the present specification. The polynucleotide sequences encoding Pol-containing polypeptides include, but are not limited to, those shown in SEQ ID NO:30, SEQ ID NO:31; SEQ ID NO:32; SEQ ID NO:62; SEQ ID NO:103; SEQ ID NO:58; SEQ ID NO:60; SEQ ID NO:64; SEQ ID NO:66; SEQ ID NO:68; SEQ ID NO:70; SEQ ID NO:76; and SEQ ID NO:78.
[0013]The polynucleotides encoding the HIV polypeptides of the present invention may also include sequences encoding additional polypeptides. Such additional polynucleotides encoding polypeptides may include, for example, coding sequences for other viral proteins (e.g., hepatitis B or C or other HIV proteins, such as, polynucleotide sequences encoding an HIV Gag polypeptide, polynucleotide sequences encoding an HIV Env polypeptide and/or polynucleotides encoding one or more of vif, vpr, tat, rev, vpu and nef); cytokines or other transgenes. In one embodiment, the sequence encoding the HIV Pol polypeptide(s) can be modified by deletions of coding regions corresponding to reverse transcriptase and integrase. Such deletions in the polymerase polypeptide can also be made such that the polynucleotide sequence preserves T-helper cell and CTL epitopes. Other antigens of interest may be inserted into the polymerase as well.
[0014]In another embodiment, an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HIV Gag-containing polypeptide, wherein the polynucleotide sequence encoding the Gag polypeptide comprises a sequence having at least about 85%, preferably about 90%, more preferably about 95%, and most preferably about 98% sequence identity to the sequences taught in the present specification. The polynucleotide sequences encoding Gag-containing polypeptides include, but are not limited to, the following polynucleotides: nucleotides 844-903 of FIG. 1 (a Gag major homology region) (SEQ ID NO:1); nucleotides 841-900 of FIG. 2 (a Gag major homology region) (SEQ ID NO:2); FIG. 24 (SEQ ID NO:53, a Gag major homology region); the sequence presented as FIG. 1 (SEQ ID NO:3); the sequence presented as FIG. 22 (SEQ ID NO:51); the sequence presented as FIG. 70 (SEQ ID NO:99); and the sequence presented as FIG. 2 (SEQ ID NO:4). As noted above, the polynucleotides encoding the Gag-containing polypeptides of the present invention may also include sequences encoding additional polypeptides.
[0015]In another embodiment, an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HIV Env-containing polypeptide, wherein the polynucleotide sequence encoding the Env polypeptide comprises a sequence having at least about 85%, preferably about 90%, more preferably about 95%, and most preferably about 98% sequence identity to the sequences taught in the present specification. The polynucleotide sequences encoding Env-containing polypeptides include, but are not limited to, the following polynucleotides: nucleotides 1213-1353 of FIG. 3 (SEQ ID NO:5) (encoding an Env common region); the sequence presented as FIG. 17 (SEQ ID NO:46) (encoding a 97 nucleotide long Env common region); SEQ ID NO:47 (encoding a 144 nucleotide long Env common region); nucleotides 82-1512 of FIG. 3 (SEQ ID NO:6) (encoding a gp120 polypeptide); nucleotides 82-2025 of FIG. 3 (SEQ ID NO:7) (encoding a gp140 polypeptide); nucleotides 82-2547 of FIG. 3 (SEQ ID NO:8) (encoding a gp160 polypeptide); SEQ ID NO:49 (encoding a gp160 polypeptide); nucleotides 1-2547 of FIG. 3 (SEQ ID NO:9) (encoding a gp160 polypeptide with signal sequence); nucleotides 1513-2547 of FIG. 3 (SEQ ID NO:10) (encoding a gp41 polypeptide); nucleotides 1210-1353 of FIG. 4 (SEQ ID NO:11) (encoding an Env common region); nucleotides 73-1509 of FIG. 4 (SEQ ID NO:12) (encoding a gp120 polypeptide); nucleotides 73-2022 of FIG. 4 (SEQ ID NO:13) (encoding a gp140 polypeptide); nucleotides 73-2565 of FIG. 4 (SEQ ID NO:14) (encoding a gp160 polypeptide); nucleotides 1-2565 of FIG. 4 (SEQ ID NO:15) (encoding a gp160 polypeptide with signal sequence); the sequence presented as FIG. 20 (SEQ ID NO:49) (encoding a gp160 polypeptide); the sequence presented as FIG. 68 (SEQ ID NO:97) (encoding a gp160 polypeptide); nucleotides 1510-2565 of FIG. 4 (SEQ ID NO:16) (encoding a gp41 polypeptide); nucleotides 7 to 1464 of FIG. 90 (SEQ ID NO:119) (encoding a gp120 polypeptide with modified wild type signal sequence); nucleotides 7 to 1977 of FIG. 91 (SEQ ID NO:120) (encoding a gp140 polypeptide including signal sequence modified from wild-type 8--2_TV1_C.ZA (e.g., "modified wild type leader sequence")); nucleotides 7 to 1977 of FIG. 92 (SEQ ID NO:121) (encoding a gp140 polypeptide with modified wild type 8--2_TV1_C.ZA signal sequence); nucleotides 7 to 2388 of FIG. 93 (SEQ ID NO:122) (encoding a gp160 polypeptide with modified wild type signal sequence); nucleotides 7 to 2520 of FIG. 94 (SEQ ID NO:123) (encoding a gp160 polypeptide with modified wild type 8--2_TV1_C.ZA signal sequence); nucleotides 7 to 2520 of FIG. 95 (SEQ ID NO:124) (encoding a gp160 polypeptide with modified wild type 8--2_TV1_C.ZA signal sequence); nucleotides 13 to 2604 of FIG. 96 (SEQ ID NO:125) (encoding a gp160 polypeptide with TPA1 signal sequence); nucleotides 7 to 2607 of FIG. 97 (SEQ ID NO:126) (encoding a gp160 polypeptide with modified wild type 8--2_TV1_C.ZA signal sequence); nucleotides 1 to 2049 of FIG. 100 (SEQ ID NO:131) (encoding a gp140 polypeptide with TPA1 signal sequence); nucleotides 7 to 1607 of FIG. 98 (SEQ ID NO:126) (encoding a gp160 polypeptide with wild type 8--2_TV1_C.ZA signal sequence); nucleotides 7 to 2064 of SEQ ID NO:132 (encoding a gp140 polypeptide with modified wild-type 8--2_TV1_C.ZA leader sequence); and nucleotides 7 to 2064 of SEQ ID NO:133 (encoding a gp140 polypeptide with wild-type 8--2_TV1_C.ZA leader sequence).
[0016]In certain embodiments, the Env-encoding sequences will contain further modifications, for instance mutation of the cleavage site to prevent the cleavage of a gp140 polypeptide into a gp120 polypeptide and a gp41 polypeptide (SEQ ID NO:121 and SEQ ID NO:124) or deletion of variable regions V1 and/or V2 (SEQ ID NO:119; SEQ ID NO:120; SEQ ID NO:121; SEQ ID NO:122; SEQ ID NO:123; and SEQ ID NO:124).
[0017]In another embodiment, an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HIV Nef-containing polypeptide, wherein the polynucleotide sequence encoding the Nef polypeptide comprises a sequence having at least about 85%, preferably about 90%, more preferably about 95%, and most preferably about 98% sequence identity to the sequences taught in the present specification. The polynucleotide sequences encoding Nef-containing polypeptides include, but are not limited to, the following polynucleotides: the sequence presented in FIG. 26 (SEQ ID NO:55); the sequence presented in FIG. 72 (SEQ ID NO:101); the sequence presented in FIG. 28 (SEQ ID NO:57); the sequence presented in FIG. 67 (SEQ ID NO:96); the sequence presented in FIG. 103 (SEQ ID NO:134); and the sequence presented in FIG. 104 (SEQ ID NO:135).
[0018]In another embodiment, an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HIV Rev-containing polypeptide, wherein the polynucleotide sequence encoding the Rev polypeptide comprises a sequence having at least about 85%, preferably about 90%, more preferably about 95%, and most preferably about 98% sequence identity to the sequences taught in the present specification. The polynucleotide sequences encoding Rev-containing polypeptides include, but are not limited to, the following polynucleotides: the sequence presented in FIG. 43 (SEQ ID NO:72); the sequence presented in FIG. 76 (SEQ ID NO:105); the sequence presented in FIG. 45 (SEQ ID NO:74); the sequence presented in FIG. 78 (SEQ ID NO:107); and the sequence presented in FIG. 62 (SEQ ID NO:91).
[0019]In another embodiment, an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HIV Tat-containing polypeptide, wherein the polynucleotide sequence encoding the Tat polypeptide comprises a sequence having at least about 85%, preferably about 90%, more preferably about 95%, and most preferably about 98% sequence identity to the sequences taught in the present specification. The polynucleotide sequences encoding Tat-containing polypeptides include, but are not limited to, the following polynucleotides: the sequence presented in FIG. 51 (SEQ ID NO:80); the sequence presented in FIG. 80 (SEQ ID NO:109); the sequence presented in FIG. 52 (SEQ ID NO:81); the sequence presented in FIG. 54 (SEQ ID NO:83); and the sequence presented in FIG. 82 (SEQ ID NO:111).
[0020]In another embodiment, an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HIV Vif-containing polypeptide, wherein the polynucleotide sequence encoding the Vif polypeptide comprises a sequence having at least about 85%, preferably about 90%, more preferably about 95%, and most preferably about 98% sequence identity to the sequences taught in the present specification. The polynucleotide sequences encoding Vif-containing polypeptides include, but are not limited to, the following polynucleotides: the sequence presented in FIG. 56 (SEQ ID NO:85); and the sequence presented in FIG. 84 (SEQ ID NO:113).
[0021]In another embodiment, an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HIV Vpr-containing polypeptide, wherein the polynucleotide sequence encoding the Vpr polypeptide comprises a sequence having at least about 85%, preferably about 90%, more preferably about 95%, and most preferably about 98% sequence identity to the sequences taught in the present specification. The polynucleotide sequences encoding Vpr-containing polypeptides include, but are not limited to, the following polynucleotides: the sequence presented in FIG. 58 (SEQ ID NO:87); and the sequence presented in FIG. 86 (SEQ ID NO:115).
[0022]In another embodiment, an expression cassette comprises a polynucleotide sequence encoding a polypeptide including an HIV Vpu-containing polypeptide, wherein the polynucleotide sequence encoding the Vpu polypeptide comprises a sequence having at least about 85%, preferably about 90%, more preferably about 95%, and most preferably about 98% sequence identity to the sequences taught in the present specification. The polynucleotide sequences encoding Vpu-containing polypeptides include, but are not limited to, the following polynucleotides: the sequence presented in FIG. 60 (SEQ ID NO:89); and the sequence presented in FIG. 88 (SEQ ID NO:117).
[0023]Further embodiments of the present invention include purified polynucleotides of any of the sequences described herein. Exemplary polynucleotide sequences encoding Gag-containing polypeptides include, but are not limited to, the following polynucleotides: nucleotides 844-903 of FIG. 1 (SEQ ID NO:1) (a Gag major homology region); nucleotides 841-900 of FIG. 2 (SEQ ID NO:2) (a Gag major homology region); the sequence presented as FIG. 1 (SEQ ID NO:3); the sequence presented as FIG. 2 (SEQ ID NO:4); the sequence presented as FIG. 22 (SEQ ID NO:51); the sequence presented as FIG. 70 (SEQ ID NO:99); and the sequence presented as FIG. 24 (SEQ ID NO:53) (a Gag major homology region).
[0024]Exemplary polynucleotide sequences encoding Env-containing polypeptides include, but are not limited to, the following polynucleotides: nucleotides 1213-1353 of FIG. 3 (SEQ ID NO:5) (encoding an Env common region); the sequence presented as FIG. 17 (SEQ ID NO:46) (encoding a 97 nucleotide long Env common region); SEQ ID NO:47 (encoding a 144 nucleotide long Env common region); nucleotides 82-1512 of FIG. 3 (SEQ ID NO:6) (encoding a gp120 polypeptide); nucleotides 82-2025 of FIG. 3 (SEQ ID NO:7) (encoding a gp140 polypeptide); nucleotides 82-2547 of FIG. 3 (SEQ ID NO:8) (encoding a gp160 polypeptide); SEQ ID NO:49 (encoding a gp160 polypeptide); nucleotides 1-2547 of FIG. 3 (SEQ ID NO:9) (encoding a gp160 polypeptide with signal sequence); nucleotides 1513-2547 of FIG. 3 (SEQ ID NO:10) (encoding a gp41 polypeptide); nucleotides 1210-1353 of FIG. 4 (SEQ ID NO:11) (encoding an Env common region); nucleotides 73-1509 of FIG. 4 (SEQ ID NO:12) (encoding a gp120 polypeptide); nucleotides 73-2022 of FIG. 4 (SEQ ID NO:13) (encoding a gp140 polypeptide); nucleotides 73-2565 of FIG. 4 (SEQ ID NO:14) (encoding a gp160 polypeptide); nucleotides 1-2565 of FIG. 4 (SEQ ID NO:15) (encoding a gp160 polypeptide with signal sequence); the sequence presented as FIG. 20 (SEQ ID NO:49) (encoding a gp160 polypeptide); the sequence presented as FIG. 68 (SEQ ID NO:97) (encoding a gp160 polypeptide); nucleotides 1510-2565 of FIG. 4 (SEQ ID NO:16) (encoding a gp41 polypeptide); nucleotides 7 to 1464 of FIG. 90 (SEQ ID NO:119) (encoding a gp120 polypeptide with modified wild type signal sequence); nucleotides 7 to 1977 of FIG. 91 (SEQ ID NO:120) (encoding a gp140 polypeptide including signal sequence modified from wild-type 8--2_TV1_C.ZA (e.g., "modified wild type leader sequence")); nucleotides 7 to 1977 of FIG. 92 (SEQ ID NO:121) (encoding a gp140 polypeptide with modified wild type 8--2_TV1_C.ZA signal sequence); nucleotides 7 to 2388 of FIG. 93 (SEQ ID NO:122) (encoding a gp160 polypeptide with modified wild type signal sequence); nucleotides 7 to 2520 of FIG. 94 (SEQ ID NO:123) (encoding a gp160 polypeptide with modified wild type 8--2_TV1_C.ZA signal sequence); nucleotides 7 to 2520 of FIG. 95 (SEQ ID NO:124) (encoding a gp160 polypeptide with modified wild type 8--2_TV1_C.ZA signal sequence); nucleotides 13 to 2604 of FIG. 96 (SEQ ID NO:125) (encoding a gp160 polypeptide with TPA1 signal sequence); nucleotides 7 to 2607 of FIG. 97 (SEQ ID NO:126) (encoding a gp160 polypeptide with modified wild type 8--2_TV1_C.ZA signal sequence); nucleotides 1 to 2049 of FIG. 100 (SEQ ID NO:131) (encoding a gp140 polypeptide with TPA1 signal sequence); nucleotides 7 to 1607 of FIG. 98 (SEQ ID NO:126) (encoding a gp160 polypeptide with wild type 8--2_TV1_C.ZA signal sequence); nucleotides 7 to 2064 of SEQ ID NO:132 (encoding a gp140 polypeptide with modified wild-type 8--2_TV1_C.ZA leader sequence); and nucleotides 7 to 2064 of SEQ ID NO:133 (encoding a gp140 polypeptide with wild-type 8--2_TV1_C.ZA leader sequence).
[0025]Exemplary purified polynucleotides encoding additional HIV polynucleotides include: Pol-encoding polynucleotides (e.g., SEQ ID NO:30, SEQ ID NO:31; SEQ ID NO:32; SEQ ID NO:62; SEQ ID NO:103; SEQ ID NO:58; SEQ ID NO:60; SEQ ID NO:64; SEQ ID NO:66; SEQ ID NO:68; SEQ ID NO:70; SEQ ID NO:76; and SEQ ID NO:78); Nef-encoding polynucleotides (e.g., SEQ ID NO:55; SEQ ID NO:101; SEQ ID NO:57; SEQ ID NO:96); Rev-encoding polynucleotides (e.g., SEQ ID NO:72; SEQ ID NO:105; SEQ ID NO:74); SEQ ID NO:107; SEQ ID NO:91); Tat-encoding polynucleotides (e.g., SEQ ID NO:80; SEQ ID NO:109; SEQ ID NO:81; SEQ ID NO:83; SEQ ID NO:111); Vif-encoding polynucleotides (e.g., SEQ ID NO:85; SEQ ID NO:113); and Vpr-encoding polynucleotides (e.g., SEQ ID NO:87; SEQ ID NO:115); Vpu-encoding polynucleotides (e.g., SEQ ID NO:89; SEQ ID NO:117).
[0026]In other embodiments, the present invention relates to native HIV polypeptide-encoding sequences obtained from novel Type C strains; fragments of these native sequences; expression cassettes containing these wild-type sequences; and uses of these sequences, fragments and expression cassettes. Exemplary full length sequences are shown in SEQ ID NO:33 and SEQ ID NO:45. Exemplary fragments coding for various HIV gene products include: the sequence presented in FIG. 19 (SEQ ID NO:48) (an Env-encoding sequence); the sequence presented in FIG. 69 (SEQ ID NO:98) (an Env-encoding sequence); the sequence presented in FIG. 21 (SEQ ID NO:50) (a gp160 polypeptide); the sequence presented in FIG. 23 (SEQ ID NO:52) (a Gag polypeptide); the sequence presented in FIG. 71 (SEQ ID NO:100) (a Gag polypeptide); the sequence presented in FIG. 25 (SEQ ID NO:54) (a Gag polypeptide); the sequence presented in FIG. 27 (SEQ ID NO:56) (a Nef polypeptide); the sequence presented in FIG. 73 (SEQ ID NO:102) (a Nef polypeptide); the sequence presented in FIG. 30 (SEQ ID NO:59) (a p15RNAseH polypeptide); the sequence presented in FIG. 32 (SEQ ID NO:61) (a p31Integrase polypeptide); the sequence presented in FIG. 34 (SEQ ID NO:63) (a Pol polypeptide); the sequence presented in FIG. 75 (SEQ ID NO:104) (a Pol polypeptide); the sequence presented in FIG. 36 (SEQ ID NO:65) (a Prot polypeptide); the sequence presented in FIG. 38 (SEQ ID NO:67) (a inactivated Prot polypeptide); the sequence presented in FIG. 40 (SEQ ID NO:69) (an inactivated Prot and RT polypeptide); the sequence presented in FIG. 42 (SEQ ID NO:71) (a Prot and RT polypeptide); the sequence presented in FIG. 44 (SEQ ID NO:73) (a Rev polypeptide); the sequence presented in FIG. 77 (SEQ ID NO:106) (a Rev polypeptide); the sequence presented in FIG. 46 (SEQ ID NO:75) (a Rev polypeptide); the sequence presented in FIG. 79 (SEQ ID NO:108) (a Rev polypeptide); the sequence presented in FIG. 48 (SEQ ID NO:77) (an RT polypeptide); the sequence presented in FIG. 50 (SEQ ID NO:79) (a mutated RT polypeptide); the sequence presented in FIG. 53 (SEQ ID NO:82) (a Tat polypeptide); the sequence presented in FIG. 81 (SEQ ID NO:110) (a Tat polypeptide); the sequence presented in FIG. 55 (SEQ ID NO:84) (a Tat polypeptide); the sequence presented in FIG. 83 (SEQ ID NO:112) (a Tat polypeptide); the sequence presented in FIG. 57 (SEQ ID NO:86) (a Vif polypeptide); the sequence presented in FIG. 85 (SEQ ID NO:114) (a Vif polypeptide); the sequence presented in FIG. 59 (SEQ ID NO:88) (a Vpr polypeptide); the sequence presented in FIG. 82 (SEQ ID NO:116) (a Vpr polypeptide); the sequence presented in FIG. 61 (SEQ ID NO:90) (a Vpu polypeptide); the sequence presented in FIG. 89 (SEQ ID NO:118) (a Vpu polypeptide); the sequence presented in FIG. 63 (SEQ ID NO:92) (a Rev polypeptide); and the sequence presented in FIG. 66 (SEQ ID NO:95) (a Tat polypeptide).
[0027]The native and synthetic polynucleotide sequences encoding the HIV polypeptides of the present invention typically have at least about 85%, preferably about 90%, more preferably about 95%, and most preferably about 98% sequence identity to the sequences taught herein. Further, in certain embodiments, the polynucleotide sequences encoding the HIV polypeptides of the invention will exhibit 100% sequence identity to the sequences taught herein.
[0028]The polynucleotides of the present invention can be produced by recombinant techniques, synthetic techniques, or combinations thereof.
[0029]The present invention further includes recombinant expression systems for use in selected host cells, wherein the recombinant expression systems employ one or more of the polynucleotides and expression cassettes of the present invention. In such systems, the polynucleotide sequences are operably linked to control elements compatible with expression in the selected host cell. Numerous expression control elements are known to those in the art, including, but not limited to, the following: transcription promoters, transcription enhancer elements, transcription termination signals, polyadenylation sequences, sequences for optimization of initiation of translation, and translation termination sequences. Exemplary transcription promoters include, but are not limited to those derived from CMV, CMV+intron A, SV40, RSV, HIV-Ltr, MMLV-ltr, and metallothionein.
[0030]In another aspect the invention includes cells comprising one or more of the expression cassettes of the present invention where the polynucleotide sequences are operably linked to control elements compatible with expression in the selected cell. In one embodiment such cells are mammalian cells. Exemplary mammalian cells include, but are not limited to, BHK, VERO, HT1080, 293, RD, COS-7, and CHO cells. Other cells, cell types, tissue types, etc., that may be useful in the practice of the present invention include, but are not limited to, those obtained from the following: insects (e.g., Trichoplusia ni (Tn5) and Sf9), bacteria, yeast, plants, antigen presenting cells (e.g., macrophage, monocytes, dendritic cells, B-cells, T-cells, stem cells, and progenitor cells thereof), primary cells, immortalized cells, tumor-derived cells.
[0031]In a further aspect, the present invention includes compositions for generating an immunological response, where the composition typically comprises at least one of the expression cassettes of the present invention and may, for example, contain combinations of expression cassettes (such as one or more expression cassettes carrying a Pol-polypeptide-encoding polynucleotide, one or more expression cassettes carrying a Gag-polypeptide-encoding polynucleotide, one or more expression cassettes carrying accessory polypeptide-encoding polynucleotides (e.g., native or synthetic vpu, vpr, nef, vif, tat, rev), and/or one or more expression cassettes carrying an Env-polypeptide-encoding polynucleotide). Such compositions may further contain an adjuvant or adjuvants. The compositions may also contain one or more Type C HIV polypeptides. The Type C HIV polypeptides may correspond to the polypeptides encoded by the expression cassette(s) in the composition, or may be different from those encoded by the expression cassettes. An example of the polynucleotide in the expression cassette encoding the same polypeptide as is being provided in the composition is as follows: the polynucleotide in the expression cassette encodes the Gag-polypeptide of FIG. 1 (SEQ ID NO:3), and the polypeptide (SEQ ID NO:17) is the polypeptide encoded by the sequence shown in FIG. 1. An example of the polynucleotide in the expression cassette encoding a different polypeptide as is being provided in the composition is as follows: an expression cassette having a polynucleotide encoding a Gag-polymerase polypeptide, and the polypeptide provided in the composition may be a Gag and/or Gag-protease polypeptide. In compositions containing both expression cassettes (or polynucleotides of the present invention) and polypeptides, various expression cassettes of the present invention can be mixed and/or matched with various Type C HIV polypeptides described herein.
[0032]In another aspect the present invention includes methods of immunization of a subject. In the method any of the above described compositions are into the subject under conditions that are compatible with expression of the expression cassette(s) in the subject. In one embodiment, the expression cassettes (or polynucleotides of the present invention) can be introduced using a gene delivery vector. The gene delivery vector can, for example, be a non-viral vector or a viral vector. Exemplary viral vectors include, but are not limited to Sindbis-virus derived vectors, retroviral vectors, and lentiviral vectors. Compositions useful for generating an immunological response can also be delivered using a particulate carrier. Further, such compositions can be coated on, for example, gold or tungsten particles and the coated particles delivered to the subject using, for example, a gene gun. The compositions can also be formulated as liposomes. In one embodiment of this method, the subject is a mammal and can, for example, be a human.
[0033]In a further aspect, the invention includes methods of generating an immune response in a subject. Any of the expression cassettes described herein can be expressed in a suitable cell to provide for the expression of the Type C HIV polypeptides encoded by the polynucleotides of the present invention. The polypeptide(s) are then isolated (e.g., substantially purified) and administered to the subject in an amount sufficient to elicit an immune response. In certain embodiments, the methods comprise administration of one or more of the expression cassettes or polynucleotides of the present invention, using any of the gene delivery techniques described herein. In other embodiments, the methods comprise co-administration of one or more of the expression cassettes or polynucleotides of the present invention and one or more polypeptides, wherein the polypeptides can be expressed from these polynucleotides or can be other subtype C HIV polypeptides. In other embodiments, the methods comprise co-administration of multiple expression cassettes or polynucleotides of the present invention. In still further embodiments, the methods comprise co-administration of multiple polypeptides, for example polypeptides expressed from the polynucleotides of the present invention and/or other subtype C HIV polypeptides.
[0034]The invention further includes methods of generating an immune response in a subject, where cells of a subject are transfected with any of the above-described expression cassettes or polynucleotides of the present invention, under conditions that permit the expression of a selected polynucleotide and production of a polypeptide of interest (e.g., encoded by any expression cassette of the present invention). By this method an immunological response to the polypeptide is elicited in the subject. Transfection of the cells may be performed ex vivo and the transfected cells are reintroduced into the subject. Alternately, or in addition, the cells may be transfected in vivo in the subject. The immune response may be humoral and/or cell-mediated (cellular). In a further embodiment, this method may also include administration of an Type C HIV polypeptides before, concurrently with, and/or after introduction of the expression cassette into the subject.
[0035]These and other embodiments of the present invention will readily occur to those of ordinary skill in the art in view of the disclosure herein.
BRIEF DESCRIPTION OF THE FIGURES
[0036]FIG. 1 (SEQ ID NO:3) shows the nucleotide sequence of a polynucleotide encoding a synthetic Gag polypeptide. The nucleotide sequence shown was obtained by modifying type C strain AF110965 and include further modifications of INS.
[0037]FIG. 2 (SEQ ID NO: 4) shows the nucleotide sequence of a polynucleotide encoding a synthetic Gag polypeptide. The nucleotide sequence shown was obtained by modifying type C strain AF110967 and include further modifications of INS.
[0038]FIG. 3 (SEQ ID NO:9) shows the nucleotide sequence of a polynucleotide encoding a synthetic Env polypeptide. The nucleotide sequence depicts gp160 (including a signal peptide) and was obtained by modifying type C strain AF110968. The arrows indicate the positions of various regions of the polynucleotide, including the sequence encoding a signal peptide (nucleotides 1-81) (SEQ ID NO:18), a gp120 polypeptide (nucleotides 82-1512) (SEQ ID NO:6), a gp41 polypeptide (nucleotides 1513-2547) (SEQ ID NO:10), a gp140 polypeptide (nucleotides 82-2025) (SEQ ID NO:7) and a gp160 polypeptide (nucleotides 82-2547) (SEQ ID NO:8). The codons encoding the signal peptide are modified (as described herein) from the native HIV-1 signal sequence.
[0039]FIG. 4 (SEQ ID NO:15) shows the nucleotide sequence of a polynucleotide encoding a synthetic Env polypeptide. The nucleotide sequence depicts gp160 (including a signal peptide) and was obtained by modifying type C strain AF110975. The arrows indicate the positions of various regions of the polynucleotide, including the sequence encoding a signal peptide (nucleotides 1-72) (SEQ ID NO:19), a gp120 polypeptide (nucleotides 73-1509) (SEQ ID NO:12), a gp41 polypeptide (nucleotides 1510-2565) (SEQ ID NO:16), a gp140 polypeptide (nucleotides 73-2022) (SEQ ID NO:13), and a gp160 polypeptide (nucleotides 73-2565) (SEQ ID NO:14). The codons encoding the signal peptide are modified (as described herein) from the native HIV-1 signal sequence.
[0040]FIG. 5 shows the location of some remaining INS in synthetic Gag sequences derived from AF110965. The changes made to these sequences are boxed in the Figures. The top line depicts a codon modified sequence of Gag polypeptides from the indicated strains (SEQ ID NO:20). The nucleotide(s) appearing below the line in the boxed region(s) depicts changes made to remove further INS and correspond to the sequence depicted in FIG. 1 (SEQ ID NO:3).
[0041]FIG. 6 shows the location of some remaining INS in synthetic Gag sequences derived from AF110967. The changes made to these sequences are boxed in the Figures. The top line depicts a modified sequence of Gag polypeptides from the indicated strains (SEQ ID NO:21). The nucleotide(s) appearing below the line in the boxed region(s) depicts changes made to remove further INS and correspond to the sequence depicted in FIG. 2 (SEQ ID NO:4).
[0042]FIG. 7 is a schematic depicting the selected domains in the Pol region of HIV.
[0043]FIG. 8 (SEQ ID NO:30) depicts the nucleotide sequence of the synthetic construct designated PR975(+). "(+)" indicates that the reverse transcriptase is functional. This construct includes sequence from p2 (nucleotides 16 to 54 of SEQ ID NO:30); p7 (nucleotides 55 to 219 of SEQ ID NO:30); p1/p6 (nucleotides 220-375 of SEQ ID NO:30); prot (nucleotides 376 to 672 of SEQ ID NO:30), reverse transcriptase (nucleotides 673 to 2352 of SEQ ID NO:30); and 6 amino acids of integrase shown in FIG. 7 (nucleotides 2353 to 2370 of SEQ ID NO:30). In addition, the construct contains a multiple cloning site (MCS, nucleotides 2425 to 2463 of SEQ ID NO:30) for insertion of a transgene and a YMDD epitope cassette (nucleotides 2371 to 2424 of SEQ ID NO:30).
[0044]FIG. 9 (SEQ ID NO:31) depicts the nucleotide sequence of the synthetic construct designated PR975YM. As illustrated in FIG. 7, the RT region includes a mutation in the catalytic center (mut. cat. center). "YM" refers to constructs in which the nucleotides encode the amino acids AP instead of YMDD in this region. Reverse transcriptase is not functional in this construct. This construct includes sequence from the p2 (nucleotides 16 to 54 of SEQ ID NO:31); p7 (nucleotides 55 to 219 of SEQ ID NO:31); p1/p6 (nucleotides 220 to 375 of SEQ ID NO:31); prot (nucleotides 376 to 672 of SEQ ID NO:31); and reverse transcriptase (nucleotides 673 to 2346 of SEQ ID NO:31) shown in FIG. 7, although the reverse transcriptase protein is not functional. In addition, the construct contains a multiple cloning site (MCS, nucleotides 2419 to 2457 of SEQ ID NO:31) for insertion of a transgene and a YMDD epitope cassette (nucleotides 2365 to 2418 of SEQ ID NO:31).
[0045]FIG. 10 (SEQ ID NO:32) depicts the nucleotide sequence of the synthetic construct designated PR975YMWM. "YM" refers to constructs in which the nucleotides encode the amino acids AP instead of YMDD in this region. "WM" refers to constructs in which the nucleotides encode amino acids PI instead of WMGY in this region. This construct includes sequence from the p2 (nucleotides 16 to 54 of SEQ ID NO:32); p7 (nucleotides 55 to 219 of SEQ ID NO:32); p1/p6 (nucleotides 220 to 375 of SEQ ID NO:32); prot (nucleotides 376 to 672 of SEQ ID NO:32); and reverse transcriptase (nucleotides 673 to 2340 of SEQ ID NO:32) shown in FIG. 7, although the reverse transcriptase protein is not functional. In addition, the construct contains a multiple cloning site (MCS, nucleotides 2413 to 2451 of SEQ ID NO:32) for insertion of a transgene and a YMDD epitope cassette (nucleotides 2359 to 2412 of SEQ ID NO:32).
[0046]FIG. 11 (SEQ ID NO:33) depicts the nucleotide sequence of 8--5_TV1_C.ZA. Various regions are shown in Table A.
[0047]FIG. 12 (SEQ ID NO:34) depicts the wild type nucleotide sequence of AF110975 Pol from p2gag until p7gag.
[0048]FIG. 13 (SEQ ID NO:35) depicts the wild type nucleotide sequence of AF110975 Pol from p1 through the first 6 amino acids of the integrase protein.
[0049]FIG. 14 (SEQ ID NO:36) depicts the nucleotide sequence of a cassette encoding Ile178 through Serine 191 of reverse transcriptase.
[0050]FIG. 15 (SEQ ID NO:37) shows amino acid sequence which includes an epitope in the region of the catalytic center of the reverse transcriptase protein.
[0051]FIG. 16 (SEQ ID NO:45) depicts the nucleotide sequence of 12-5--1_TV2_C.ZA.
[0052]FIG. 17 (SEQ ID NO:46) depicts the nucleotide sequence of a synthetic Env-encoding polynucleotide derived from 8--5_TV1_C.ZA. The sequence corresponds to a short (97 base pair) common region.
[0053]FIG. 18 (SEQ ID NO:47) depicts the nucleotide sequence of a synthetic Env-encoding polynucleotide derived from 8--5_TV1_C.ZA. The sequence corresponds to a common region in Env.
[0054]FIG. 19 (SEQ ID NO:48) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA Env.
[0055]FIG. 20 (SEQ ID NO:49) depicts the nucleotide sequence of a synthetic Env gp160-encoding polynucleotide derived from 8--5_TV1_C.ZA.
[0056]FIG. 21 (SEQ ID NO:50) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA Env gp160.
[0057]FIG. 22 (SEQ ID NO:51) depicts the nucleotide sequence of a synthetic Gag-encoding polynucleotide derived from 8--5_TV1_C.ZA.
[0058]FIG. 23 (SEQ ID NO:52) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA Gag.
[0059]FIG. 24 (SEQ ID NO:53) depicts the nucleotide sequence of a synthetic Gag-encoding polynucleotide (major homology region) derived from 8--5_TV1_C.ZA.
[0060]FIG. 25 (SEQ ID NO:54) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA Gag major homology region.
[0061]FIG. 26 (SEQ ID NO:55) depicts the nucleotide sequence of a synthetic Nef-encoding polynucleotide derived from 8--5_TV1_C.ZA.
[0062]FIG. 27 (SEQ ID NO:56) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA Nef.
[0063]FIG. 28 (SEQ ID NO:57) depicts the nucleotide sequence of a synthetic Nef-encoding polynucleotide derived from 8--5_TV1_C.ZA. The sequence includes a mutation at position 125 which results in a non-functional gene product.
[0064]FIG. 29 (SEQ ID NO:58) depicts the nucleotide sequence of a synthetic RNAseH-encoding polynucleotide derived from 8--5_TV1_C.ZA. RnaseH is a functional domain of the Pol gene, corresponding to p15 (Table A).
[0065]FIG. 30 (SEQ ID NO:59) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA RNAseH.
[0066]FIG. 31 (SEQ ID NO:60) depicts the nucleotide sequence of a synthetic integrase (Int)-encoding polynucleotide derived from 8--5_TV1_C.ZA. Int is a functional domain of the Pol gene, corresponding to p31 (Table A).
[0067]FIG. 32 (SEQ ID NO:61) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA Int.
[0068]FIG. 33 (SEQ ID NO:62) depicts the nucleotide sequence of a synthetic Pol-encoding polynucleotide derived from 8--5_TV1_C.ZA.
[0069]FIG. 34 (SEQ ID NO:63) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA Pol.
[0070]FIG. 35 (SEQ ID NO:64) depicts the nucleotide sequence of a synthetic protease (prot)-encoding polynucleotide derived from 8--5_TV1_C.ZA.
[0071]FIG. 36 (SEQ ID NO:65) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA Prot.
[0072]FIG. 37 (SEQ ID NO:66) depicts the nucleotide sequence of a synthetic protease (prot)-encoding polynucleotide derived from 8--5_TV1_C.ZA containing a mutation in which results in inactivation of the protease.
[0073]FIG. 38 (SEQ ID NO:67) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA inactivated Prot.
[0074]FIG. 39 (SEQ ID NO:68) depicts the nucleotide sequence of a synthetic protease (prot)-encoding polynucleotide and a synthetic reverse transcriptase (RT)-encoding polynucleotide, both derived from 8--5_TV1_C.ZA. The Prot and RT sequences both contain a mutation which results in inactivation of the gene product.
[0075]FIG. 40 (SEQ ID NO:69) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA inactivated Prot/mutated RT.
[0076]FIG. 41 (SEQ ID NO:70) depicts the nucleotide sequence of a synthetic protease (prot)-encoding polynucleotide and a synthetic reverse transcriptase (RT)-encoding polynucleotide, both derived from 8--5_TV1_C.ZA.
[0077]FIG. 42 (SEQ ID NO:71) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA Prot and RT.
[0078]FIG. 43 (SEQ ID NO:72) depicts the nucleotide sequence of a synthetic rev-encoding polynucleotide derived from 8--5_TV1_C.ZA. The synthetic sequence depicted corresponds to exon 1 of rev. Wild-type rev has two exons.
[0079]FIG. 44 (SEQ ID NO:73) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA exon 1 of Rev.
[0080]FIG. 45 (SEQ ID NO:74) depicts the nucleotide sequence of a synthetic rev-encoding polynucleotide derived from 8--5_TV1_C.ZA. The synthetic sequence depicted corresponds to exon 2 of rev.
[0081]FIG. 46 (SEQ ID NO:75) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA exon 2 of Rev.
[0082]FIG. 47 (SEQ ID NO:76) depicts the nucleotide sequence of a synthetic RT-encoding polynucleotide derived from 8--5_TV1_C.ZA.
[0083]FIG. 48 (SEQ ID NO:77) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA RT.
[0084]FIG. 49 (SEQ ID NO:78) depicts the nucleotide sequence of a synthetic RT-encoding polynucleotide derived from 8--5_TV1_C.ZA. The synthetic polynucleotide includes a mutation in the RT coding sequence which renders the gene product inactive.
[0085]FIG. 50 (SEQ ID NO:79) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA RT including a mutation which inactivates the RT gene product.
[0086]FIG. 51 (SEQ ID NO:80) depicts the nucleotide sequence of a synthetic Tat-encoding polynucleotide derived from 8--5_TV1_C.ZA. The synthetic sequence depicted corresponds to exon 1 of Tat and further includes a mutation that renders the Tat gene product non-functional. Wild-type Tat has two exons.
[0087]FIG. 52 (SEQ ID NO:81) depicts the nucleotide sequence of a synthetic Tat-encoding polynucleotide derived from 8--5_TV1_C.ZA. The synthetic sequence depicted corresponds to exon 1 of Tat.
[0088]FIG. 53 (SEQ ID NO:82) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA exon 1 of Tat.
[0089]FIG. 54 (SEQ ID NO:83) depicts the nucleotide sequence of a synthetic Tat-encoding polynucleotide derived from 8--5_TV1_C.ZA. The synthetic sequence depicted corresponds to exon 2 of Tat.
[0090]FIG. 55 (SEQ ID NO:84) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA exon 2 of Tat.
[0091]FIG. 56 (SEQ ID NO:85) depicts the nucleotide sequence of a synthetic Vif-encoding polynucleotide derived from 8--5_TV1_C.ZA.
[0092]FIG. 57 (SEQ ID NO:86) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA Vif.
[0093]FIG. 58 (SEQ ID NO:87) depicts the nucleotide sequence of a synthetic Vpr-encoding polynucleotide derived from 8--5_TV1_C.ZA.
[0094]FIG. 59 (SEQ ID NO:88) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA Vpr.
[0095]FIG. 60 (SEQ ID NO:89) depicts the nucleotide sequence of a synthetic Vpu-encoding polynucleotide derived from 8--5_TV1_C.ZA.
[0096]FIG. 61 (SEQ ID NO:90) depicts the wild-type nucleotide sequence of 8--5_TV1_C.ZA Vpu.
[0097]FIG. 62 (SEQ ID NO:91) depicts the nucleotide sequence of a synthetic rev-encoding polynucleotide derived from 8--5_TV1_C.ZA. The synthetic sequence depicted corresponds to exons 1 and 2 of rev.
[0098]FIG. 63 (SEQ ID NO:92) depicts the wild-type nucleotide sequence of exons 1 and 2 of rev derived from 8--5_TV1_C.ZA.
[0099]FIG. 64 (SEQ ID NO:93) depicts the nucleotide sequence of a synthetic Tat-encoding polynucleotide derived from 8--5_TV1_C.ZA. The synthetic polynucleotide includes both exons 1 and 2 of Tat and further includes a mutation in exon 1 which renders the gene product non-functional.
[0100]FIG. 65 (SEQ ID NO:94) depicts the nucleotide sequence of a synthetic Tat-encoding polynucleotide derived from 8--5_TV1_C.ZA. The synthetic polynucleotide includes both exons 1 and 2 of Tat.
[0101]FIG. 66 (SEQ ID NO:95) depicts the wild-type nucleotide sequence of exons 1 and 2 of Tat derived from 8--5_TV1_C.ZA.
[0102]FIG. 67 (SEQ ID NO:96) depicts the nucleotide sequence of a synthetic Nef-encoding polynucleotide derived from 8--5_TV1_C.ZA. The sequence includes a mutation at position 125 which results in a non-functional gene product and a mutation that eliminates the myristoylation site of the Nef gene product.
[0103]FIG. 68 (SEQ ID NO:97) depicts the nucleotide sequence of a synthetic Env gp160-encoding polynucleotide derived from 12-5--1_TV2_C.ZA.
[0104]FIG. 69 (SEQ ID NO:98) depicts the wild-type nucleotide sequence of Env gp160 derived from 12-5--1_TV2_C.ZA.
[0105]FIG. 70 (SEQ ID NO:99) depicts the nucleotide sequence of a synthetic Gag-encoding polynucleotide derived from 12-5--1_TV2_C.ZA.
[0106]FIG. 71 (SEQ ID NO:100) depicts the wild-type nucleotide sequence of Gag derived from 12-5--1_TV2_C.ZA.
[0107]FIG. 72 (SEQ ID NO:101) depicts the nucleotide sequence of a synthetic Nef-encoding polynucleotide derived from 12-5--1_TV2_C.ZA.
[0108]FIG. 73 (SEQ ID NO:102) depicts the wild-type nucleotide sequence of Nef derived from 12-5--1_TV2_C.ZA.
[0109]FIG. 74 (SEQ ID NO:103) depicts the nucleotide sequence of a synthetic Pol-encoding polynucleotide derived from 12-5--1_TV2_C.ZA.
[0110]FIG. 75 (SEQ ID NO:104) depicts the wild-type nucleotide sequence of Pol derived from 12-5--1_TV2_C.ZA.
[0111]FIG. 76 (SEQ ID NO:105) depicts the nucleotide sequence of a synthetic Rev-encoding polynucleotide derived from exon 1 of Rev from 12-5--1_TV2_C.ZA.
[0112]FIG. 77 (SEQ ID NO:106) depicts the wild-type nucleotide sequence of exon 1 of Rev derived from 12-5--1_TV2_C.ZA.
[0113]FIG. 78 (SEQ ID NO:107) depicts the nucleotide sequence of a synthetic Rev-encoding polynucleotide derived from exon 2 of Rev from 12-5--1_TV2_C.ZA.
[0114]FIG. 79 (SEQ ID NO:108) depicts the wild-type nucleotide sequence of exon 2 of Rev derived from 12-5--1_TV2_C.ZA.
[0115]FIG. 80 (SEQ ID NO:109) depicts the nucleotide sequence of a synthetic Tat-encoding polynucleotide derived from exon 1 of Tat from 12-5--1_TV2_C.ZA.
[0116]FIG. 81 (SEQ ID NO:110) depicts the wild-type nucleotide sequence of exon 1 of Tat derived from 12-5--1_TV2_C.ZA.
[0117]FIG. 82 (SEQ ID NO:111) depicts the nucleotide sequence of a synthetic Tat-encoding polynucleotide derived from exon 2 of Tat from 12-5--1_TV2_C.ZA.
[0118]FIG. 83 (SEQ ID NO:112) depicts the wild-type nucleotide sequence of exon 2 of Tat derived from 12-5--1_TV2_C.ZA.
[0119]FIG. 84 (SEQ ID NO:113) depicts the nucleotide sequence of a synthetic Vif-encoding polynucleotide derived from 12-5--1_TV2_C.ZA.
[0120]FIG. 85 (SEQ ID NO:114) depicts the wild-type nucleotide sequence of Vif derived from 12-5--1_TV2_C.ZA.
[0121]FIG. 86 (SEQ ID NO:115) depicts the nucleotide sequence of a synthetic Vpr-encoding polynucleotide derived from 12-5--1_TV2_C.ZA.
[0122]FIG. 87 (SEQ ID NO:116) depicts the wild-type nucleotide sequence of Vpr derived from 12-5--1_TV2_C.ZA.
[0123]FIG. 88 (SEQ ID NO:117) depicts the nucleotide sequence of a synthetic Vpu-encoding polynucleotide derived from 12-5--1_TV2_C.ZA.
[0124]FIG. 89 (SEQ ID NO:118) depicts the wild-type nucleotide sequence of Vpu derived from 12-5--1_TV2 C.ZA.
[0125]FIG. 90 (SEQ ID NO:119) depicts the nucleotide sequence of a synthetic Env gp120-encoding polynucleotide derived from 8--2_TV1_C.ZA. The V2 region is deleted. The sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a codon modified signal peptide leader sequence (nucleotides 7 to 87); a gp120 coding sequence (nucleotides 88 to 1464); a stop codon (nucleotides 1465 to 1467); an XhoI restriction site (nucleotides 1468 to 1473).
[0126]FIG. 91 (SEQ ID NO:120) depicts the nucleotide sequence of a synthetic Env gp140-encoding polynucleotide derived from 8--2_TV1_C.ZA. The V2 region is deleted. The sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a modified signal peptide leader sequence (nucleotides 7 to 87); a gp140 coding sequence (nucleotides 88 to 1977); a stop codon (nucleotides 1978 to 1980); an XhoI restriction site (nucleotides 1981 to 1986).
[0127]FIG. 92 (SEQ ID NO:121) depicts the nucleotide sequence of a synthetic Env gp140-encoding polynucleotide derived from 8--2_TV1_C.ZA. The V2 region is deleted and the sequence includes mutations in the cleavage site that prevent the cleavage of a gp140 polypeptide into a gp120 polypeptide and a gp41 polypeptide. The sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a modified signal peptide leader sequence (nucleotides 7 to 87); gp140 coding sequence (nucleotides 88 to 1977); a stop codon (nucleotides 1978 to 1980); an XhoI restriction site (nucleotides 1981 to 1986).
[0128]FIG. 93 (SEQ ID NO:122) depicts the nucleotide sequence of a synthetic Env gp160-encoding polynucleotide derived from 8--2_TV1_C.ZA. The V1/V2 regions are deleted. The sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a modified signal peptide leader sequence (nucleotides 7 to 87); gp160 coding sequence (nucleotides 88 to 2388); a stop codon (nucleotides 2389 to 2391); an XhoI restriction site (nucleotides 2392 to 2397).
[0129]FIG. 94 (SEQ ID NO:123) depicts the nucleotide sequence of a synthetic Env gp160-encoding polynucleotide derived from 8--2_TV1_C.ZA. The V2 region is deleted. The sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a modified signal peptide leader sequence (nucleotides 7 to 87); a gp160 coding sequence (nucleotides 88 to 2520); a stop codon (nucleotides 2521 to 2523); an XhoI restriction site (nucleotides 2524 to 2529).
[0130]FIG. 95 (SEQ ID NO:124) depicts the nucleotide sequence of a synthetic Env gp160-encoding polynucleotide derived from 8--2_TV1_C.ZA. The V2 region is deleted and the cleavage site is mutated. The sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a modified signal peptide leader sequence (nucleotides 7 to 87); a gp160 coding sequence (nucleotides 88 to 2520); a stop codon (nucleotides 2521 to 2523); an XhoI restriction site (nucleotides 2524 to 2529).
[0131]FIG. 96 (SEQ ID NO:125) depicts the nucleotide sequence of a synthetic Env gp160-encoding polynucleotide derived from 8--2_TV1_C.ZA. The nucleotide sequence includes a TPA1 leader sequence. The sequence includes: a SalI restriction site (nucleotides 1 to 6); a Kozak sequence (nucleotides 7 to 12); a TPA1 signal peptide leader sequence (nucleotides 13 to 87); a gp160 coding sequence (nucleotides 88 to 2604); a stop codon (nucleotides 2605 to 2607); an XhoI restriction site (nucleotides 2608 to 2613).
[0132]FIG. 97 (SEQ ID NO:126) depicts the nucleotide sequence of a synthetic Env gp160-encoding polynucleotide derived from 8--2_TV1_C.ZA. The sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a modified signal peptide leader sequence (nucleotides 7 to 87); a gp160 coding sequence (nucleotides 8 to 2607); a stop codon (nucleotides 2608 to 2610); an XhoI restriction site (nucleotides 2611 to 2616).
[0133]FIG. 98 (SEQ ID NO:127) depicts the nucleotide sequence of a synthetic Env gp160-encoding polynucleotide derived from 8--2_TV1_C.ZA. The nucleotide sequence includes a wild type leader sequence. The sequence includes: an EcoRI restriction site (nucleotides 1 to 6); a native (unmodified) signal peptide leader sequence (nucleotides 7 to 87); a gp160 coding sequence (nucleotides 88 to 2607); a stop codon (nucleotides 2608 to 2610); an XhoI restriction site (nucleotides 2611 to 2616).
[0134]FIG. 99 (SEQ ID NO:128) depicts the nucleotide sequence of wild type gp160 derived from 8--2_TV1_C.ZA.
[0135]FIG. 100 (SEQ ID NO:131) depicts the nucleotide sequence of a synthetic Env gp140-encoding polynucleotide derived from 8--2_TV1_C.ZA. The nucleotide sequence includes a TPA1 leader sequence (nucleotides 1-75); a gp140 coding sequence (nucleotides 76 to 2049); a stop codon (nucleotides 2050 to 2052)
[0136]FIG. 101 (SEQ ID NO:132) depicts the nucleotide sequence of a synthetic gp140-encoding polynucleotide derived from 8--2_TV1_C.ZA. The nucleotide sequence includes an EcoRI restriction site (nucleotides 1 to 6); a leader sequence modified from the TV1_C.ZA wild-type leader sequence (nucleotides 7 to 87); a gp140 coding sequence (nucleotides 88 to 2064); a stop codon (nucleotides 2065 to 2067); a XhoI restriction site (nucleotides 2068 to 2073).
[0137]FIG. 102 (SEQ ID NO:133) depicts the nucleotide sequence of a synthetic gp140-encoding polynucleotide derived from 8--2_TV1_C.ZA. The nucleotide sequence includes wild-type TV1_C.ZA unmodified leader sequence. The nucleotide sequence includes a restriction site (nucleotides 1 to 6); a wild type leader sequence (nucleotides 7 to 87); a gp140 coding sequence (nucleotides 88 to 2064); a stop codon (nucleotides 2065 to 2067); a XhoI restriction site (nucleotides 2068-2073).
[0138]FIG. 103 (SEQ ID NO:134) depicts the nucleotide sequence of a synthetic Nef-encoding polynucleotide derived from 12-5--1_TV2_C.ZA. The sequence includes a mutation at position 125 which results in a non-functional gene product.
[0139]FIG. 104 (SEQ ID NO:135) depicts the nucleotide sequence of a synthetic Nef-encoding polynucleotide derived from 12-5--1_TV2_C.ZA. The synthetic polynucleotide includes a mutation that eliminates the myristoylation site of the Nef gene product.
[0140]FIG. 105 depicts an alignment of Env polypeptides from various HIV isolates. The regions between the arrows indicate regions (of TV1 and TV2 clones) in the beta and/or bridging sheet region(s) that can be deleted and/or truncated. The "*" denotes N-linked glycosylation sites (of TV1 and TV2 clones), one or more of which can be modified (e.g., deleted and/or mutated).
DETAILED DESCRIPTION OF THE INVENTION
[0141]The practice of the present invention will employ, unless otherwise indicated, conventional methods of chemistry, biochemistry, molecular biology, immunology and pharmacology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pa.: Mack Publishing Company, 1990); Methods In Enzymology (S. Colowick and N. Kaplan, eds., Academic Press, Inc.); and Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell, eds., 1986, Blackwell Scientific Publications); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Short Protocols in Molecular Biology, 4th ed. (Ausubel et al. eds., 1999, John Wiley & Sons); Molecular Biology Techniques: An Intensive Laboratory Course, (Ream et al., eds., 1998, Academic Press); PCR (Introduction to Biotechniques Series), 2nd ed. (Newton & Graham eds., 1997, Springer Verlag).
[0142]All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.
[0143]As used in this specification and the appended claims, the singular forms "a," "an" and "the" include plural references unless the content clearly dictates otherwise. Thus, for example, reference to "an antigen" includes a mixture of two or more such agents.
1. DEFINITIONS
[0144]In describing the present invention, the following terms will be employed, and are intended to be defined as indicated below.
[0145]"Synthetic" sequences, as used herein, refers to Type C HIV polypeptide-encoding polynucleotides whose expression has been modified as described herein, for example, by codon substitution and inactivation of inhibitory sequences. "Wild-type" or "native" sequences, as used herein, refers to polypeptide encoding sequences that are essentially as they are found in nature, e.g., Gag, Pol, Vif, Vpr, Tat, Rev, Vpu, Env and/or Nef encoding sequences as found in Type C isolates, e.g., AF110965, AF110967, AF110968, AF110975, 8--5_TV1_C.ZA, 8--2_TV1_C.ZA or 12-5--1_TV2_C.ZA. The various regions of the HIV genome are shown in Table A, with numbering relative to 8--5_TV1_C.ZA (SEQ ID NO:33). Thus, the term "Pol" refers to one or more of the following polypeptides: polymerase (p6Pol); protease (prot); reverse transcriptase (p66RT or RT); RNAseH (p15RNAseH); and/or integrase (p31Int or Int).
[0146]As used herein, the term "virus-like particle" or "VLP" refers to a nonreplicating, viral shell, derived from any of several viruses discussed further below. VLPs are generally composed of one or more viral proteins, such as, but not limited to those proteins referred to as capsid, coat, shell, surface and/or envelope proteins, or particle-forming polypeptides derived from these proteins. VLPs can form spontaneously upon recombinant expression of the protein in an appropriate expression system. Methods for producing particular VLPs are known in the art and discussed more fully below. The presence of VLPs following recombinant expression of viral proteins can be detected using conventional techniques known in the art, such as by electron microscopy, X-ray crystallography, and the like. See, e.g., Baker et al., Biophys. J. (1991) 60:1445-1456; Hagensee et al., J. Virol. (1994) 68:4503-4505. For example, VLPs can be isolated by density gradient centrifugation and/or identified by characteristic density banding. Alternatively, cryoelectron microscopy can be performed on vitrified aqueous samples of the VLP preparation in question, and images recorded under appropriate exposure conditions.
[0147]By "particle-forming polypeptide" derived from a particular viral protein is meant a full-length or near full-length viral protein, as well as a fragment thereof, or a viral protein with internal deletions, which has the ability to form VLPs under conditions that favor VLP formation. Accordingly, the polypeptide may comprise the full-length sequence, fragments, truncated and partial sequences, as well as analogs and precursor forms of the reference molecule. The term therefore intends deletions, additions and substitutions to the sequence, so long as the polypeptide retains the ability to form a VLP. Thus, the term includes natural variations of the specified polypeptide since variations in coat proteins often occur between viral isolates. The term also includes deletions, additions and substitutions that do not naturally occur in the reference protein, so long as the protein retains the ability to form a VLP. Preferred substitutions are those which are conservative in nature, i.e., those substitutions that take place within a family of amino acids that are related in their side chains. Specifically, amino acids are generally divided into four families: (1) acidic--aspartate and glutamate; (2) basic--lysine, arginine, histidine; (3) non-polar--alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar--glycine, asparagine, glutamine, cystine, serine threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids.
[0148]An "antigen" refers to a molecule containing one or more epitopes (either linear, conformational or both) that will stimulate a host's immune system to make a humoral and/or cellular antigen-specific response. The term is used interchangeably with the term "immunogen." Normally, a B-cell epitope will include at least about 5 amino acids but can be as small as 3-4 amino acids. A T-cell epitope, such as a CTL epitope, will include at least about 7-9 amino acids, and a helper T-cell epitope at least about 12-20 amino acids. Normally, an epitope will include between about 7 and 15 amino acids, such as, 9, 10, 12 or 15 amino acids. The term "antigen" denotes both subunit antigens, (i.e., antigens which are separate and discrete from a whole organism with which the antigen is associated in nature), as well as, killed, attenuated or inactivated bacteria, viruses, fungi, parasites or other microbes. Antibodies such as anti-idiotype antibodies, or fragments thereof, and synthetic peptide mimotopes, which can mimic an antigen or antigenic determinant, are also captured under the definition of antigen as used herein. Similarly, an oligonucleotide or polynucleotide which expresses an antigen or antigenic determinant in vivo, such as in gene therapy and DNA immunization applications, is also included in the definition of antigen herein.
[0149]For purposes of the present invention, antigens can be derived from any of several known viruses, bacteria, parasites and fungi, as described more fully below. The term also intends any of the various tumor antigens. Furthermore, for purposes of the present invention, an "antigen" refers to a protein which includes modifications, such as deletions, additions and substitutions (generally conservative in nature), to the native sequence, so long as the protein maintains the ability to elicit an immunological response, as defined herein. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the antigens.
[0150]An "immunological response" to an antigen or composition is the development in a subject of a humoral and/or a cellular immune response to an antigen present in the composition of interest. For purposes of the present invention, a "humoral immune response" refers to an immune response mediated by antibody molecules, while a "cellular immune response" is one mediated by T-lymphocytes and/or other white blood cells. One important aspect of cellular immunity involves an antigen-specific response by cytolytic T-cells ("CTL"s). CTLs have specificity for peptide antigens that are presented in association with proteins encoded by the major histocompatibility complex (MHC) and expressed on the surfaces of cells. CTLs help induce and promote the destruction of intracellular microbes, or the lysis of cells infected with such microbes. Another aspect of cellular immunity involves an antigen-specific response by helper T-cells. Helper T-cells act to help stimulate the function, and focus the activity of, nonspecific effector cells against cells displaying peptide antigens in association with MHC molecules on their surface. A "cellular immune response" also refers to the production of cytokines, chemokines and other such molecules produced by activated T-cells and/or other white blood cells, including those derived from CD4+ and CD8+ T-cells.
[0151]A composition or vaccine that elicits a cellular immune response may serve to sensitize a vertebrate subject by the presentation of antigen in association with MHC molecules at the cell surface. The cell-mediated immune response is directed at, or near, cells presenting antigen at their surface. In addition, antigen-specific T-lymphocytes can be generated to allow for the future protection of an immunized host.
[0152]The ability of a particular antigen to stimulate a cell-mediated immunological response may be determined by a number of assays, such as by lymphoproliferation (lymphocyte activation) assays, CTL cytotoxic cell assays, or by assaying for T-lymphocytes specific for the antigen in a sensitized subject. Such assays are well known in the art. See, e.g., Erickson et al., J. Immunol. (1993) 151:4189-4199; Doe et al., Eur. J. Immunol. (1994) 24:2369-2376. Recent methods of measuring cell-mediated immune response include measurement of intracellular cytokines or cytokine secretion by T-cell populations, or by measurement of epitope specific T-cells (e.g., by the tetramer technique) (reviewed by McMichael, A. J., and O'Callaghan, C. A., J. Exp. Med. 187(9)1367-1371, 1998; Mcheyzer-Williams, M. G., et al, Immunol. Rev. 150:5-21, 1996; Lalvani, A., et al, J. Exp. Med. 186:859-865, 1997).
[0153]Thus, an immunological response as used herein may be one which stimulates the production of CTLs, and/or the production or activation of helper T-cells. The antigen of interest may also elicit an antibody-mediated immune response. Hence, an immunological response may include one or more of the following effects: the production of antibodies by B-cells; and/or the activation of suppressor T-cells and/or γ6 T-cells directed specifically to an antigen or antigens present in the composition or vaccine of interest. These responses may serve to neutralize infectivity, and/or mediate antibody-complement, or antibody dependent cell cytotoxicity (ADCC) to provide protection to an immunized host. Such responses can be determined using standard immunoassays and neutralization assays, well known in the art.
[0154]An "immunogenic composition" is a composition that comprises an antigenic molecule where administration of the composition to a subject results in the development in the subject of a humoral and/or a cellular immune response to the antigenic molecule of interest. The immunogenic composition can be introduced directly into a recipient subject, such as by injection, inhalation, oral, intranasal and mucosal (e.g., intra-rectally or intra-vaginally) administration.
[0155]By "subunit vaccine" is meant a vaccine composition which includes one or more selected antigens but not all antigens, derived from or homologous to, an antigen from a pathogen of interest such as from a virus, bacterium, parasite or fungus. Such a composition is substantially free of intact pathogen cells or pathogenic particles, or the lysate of such cells or particles. Thus, a "subunit vaccine" can be prepared from at least partially purified (preferably substantially purified) immunogenic polypeptides from the pathogen, or analogs thereof. The method of obtaining an antigen included in the subunit vaccine can thus include standard purification techniques, recombinant production, or synthetic production.
[0156]"Substantially purified" general refers to isolation of a substance (compound, polynucleotide, protein, polypeptide, polypeptide composition) such that the substance comprises the majority percent of the sample in which it resides. Typically in a sample a substantially purified component comprises 50%, preferably 80%-85%, more preferably 90-95% of the sample. Techniques for purifying polynucleotides and polypeptides of interest are well-known in the art and include, for example, ion-exchange chromatography, affinity chromatography and sedimentation according to density.
[0157]A "coding sequence" or a sequence which "encodes" a selected polypeptide, is a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences (or "control elements"). The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, cDNA from viral, procaryotic or eucaryotic mRNA, genomic DNA sequences from viral or procaryotic DNA, and even synthetic DNA sequences. A transcription termination sequence such as a stop codon may be located 3' to the coding sequence.
[0158]Typical "control elements", include, but are not limited to, transcription promoters, transcription enhancer elements, transcription termination signals, polyadenylation sequences (located 3' to the translation stop codon), sequences for optimization of initiation of translation (located 5' to the coding sequence), and translation termination sequences.
[0159]A "polynucleotide coding sequence" or a sequence which "encodes" a selected polypeptide, is a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences (or "control elements"). The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. Exemplary coding sequences are the modified viral polypeptide-coding sequences of the present invention. A transcription termination sequence may be located 3' to the coding sequence. Typical "control elements", include, but are not limited to, transcription regulators, such as promoters, transcription enhancer elements, transcription termination signals, and polyadenylation sequences; and translation regulators, such as sequences for optimization of initiation of translation, e.g., Shine-Dalgarno (ribosome binding site) sequences, Kozak sequences (i.e., sequences for the optimization of translation, located, for example, 5' to the coding sequence), leader sequences, translation initiation codon (e.g., ATG), and translation termination sequences. In certain embodiments, one or more translation regulation or initiation sequences (e.g., the leader sequence) are derived from wild-type translation initiation sequences, i.e., sequences that regulate translation of the coding region in their native state. Wild-type leader sequences that have been modified, using the methods described herein, also find use in the present invention. Promoters can include inducible promoters (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), repressible promoters (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), and constitutive promoters.
[0160]A "nucleic acid" molecule can include, but is not limited to, procaryotic sequences, eucaryotic mRNA, cDNA from eucaryotic mRNA, genomic DNA sequences from eucaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. The term also captures sequences that include any of the known base analogs of DNA and RNA.
[0161]"Operably linked" refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, a given promoter operably linked to a coding sequence is capable of effecting the expression of the coding sequence when the proper enzymes are present. The promoter need not be contiguous with the coding sequence, so long as it functions to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding sequence and the promoter sequence can still be considered "operably linked" to the coding sequence.
[0162]"Recombinant" as used herein to describe a nucleic acid molecule means a polynucleotide of genomic, cDNA, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation: (1) is not associated with all or a portion of the polynucleotide with which it is associated in nature; and/or (2) is linked to a polynucleotide other than that to which it is linked in nature. The term "recombinant" as used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide. "Recombinant host cells," "host cells," "cells," "cell lines," "cell cultures," and other such terms denoting procaryotic microorganisms or eucaryotic cell lines cultured as unicellular entities, are used interchangeably, and refer to cells which can be, or have been, used as recipients for recombinant vectors or other transfer DNA, and include the progeny of the original cell which has been transfected. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement to the original parent, due to accidental or deliberate mutation. Progeny of the parental cell which are sufficiently similar to the parent to be characterized by the relevant property, such as the presence of a nucleotide sequence encoding a desired peptide, are included in the progeny intended by this definition, and are covered by the above terms.
[0163]Techniques for determining amino acid sequence "similarity" are well known in the art. In general, "similarity" means the exact amino acid to amino acid comparison of two or more polypeptides at the appropriate place, where amino acids are identical or possess similar chemical and/or physical properties such as charge or hydrophobicity. A so-termed "percent similarity" then can be determined between the compared polypeptide sequences. Techniques for determining nucleic acid and amino acid sequence identity also are well known in the art and include determining the nucleotide sequence of the mRNA for that gene (usually via a cDNA intermediate) and determining the amino acid sequence encoded thereby, and comparing this to a second amino acid sequence. In general, "identity" refers to an exact nucleotide to nucleotide or amino acid to amino acid correspondence of two polynucleotides or polypeptide sequences, respectively.
[0164]Two or more polynucleotide sequences can be compared by determining their "percent identity." Two or more amino acid sequences likewise can be compared by determining their "percent identity." The percent identity of two sequences, whether nucleic acid or peptide sequences, is generally described as the number of exact matches between two aligned sequences divided by the length of the shorter sequence and multiplied by 100. An approximate alignment for nucleic acid sequences is provided by the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981). This algorithm can be extended to use with peptide sequences using the scoring matrix developed by Dayhoff, Atlas of Protein Sequences and Structure, M. O. Dayhoff ed., 5 suppl. 3:353-358, National Biomedical Research Foundation, Washington, D.C., USA, and normalized by Gribskov, Nucl. Acids Res. 14(6):6745-6763 (1986). An implementation of this algorithm for nucleic acid and peptide sequences is provided by the Genetics Computer Group (Madison, Wis.) in their BestFit utility application. The default parameters for this method are described in the Wisconsin Sequence Analysis Package Program Manual, Version 8 (1995) (available from Genetics Computer Group, Madison, Wis.). Other equally suitable programs for calculating the percent identity or similarity between sequences are generally known in the art.
[0165]For example, percent identity of a particular nucleotide sequence to a reference sequence can be determined using the homology algorithm of Smith and Waterman with a default scoring table and a gap penalty of six nucleotide positions. Another method of establishing percent identity in the context of the present invention is to use the MPSRCH package of programs copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by IntelliGenetics, Inc. (Mountain View, Calif.). From this suite of packages, the Smith-Waterman algorithm can be employed where default parameters are used for the scoring table (for example, gap open penalty of 12, gap extension penalty of one, and a gap of six). From the data generated, the "Match" value reflects "sequence identity." Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art, such as the alignment program BLAST, which can also be used with default parameters. For example, BLASTN and BLASTP can be used with the following default parameters: genetic code=standard; filter=none; strand=both; cutoff=60; expect=10; Matrix=BLOSUM62; Descriptions=50 sequences; sort by=HIGH SCORE; Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+Swiss protein+Spupdate+PIR. Details of these programs can be found at the following internet address: http://www.ncbi.nlm.gov/cgi-bin/BLAST.
[0166]One of skill in the art can readily determine the proper search parameters to use for a given sequence, exemplary preferred Smith Waterman based parameters are presented above. For example, the search parameters may vary based on the size of the sequence in question. Thus, for the polynucleotide sequences of the present invention the length of the polynucleotide sequence disclosed herein is searched against a selected database and compared to sequences of essentially the same length to determine percent identity. For example, a representative embodiment of the present invention would include an isolated polynucleotide having X contiguous nucleotides, wherein (i) the X contiguous nucleotides have at least about a selected level of percent identity relative to Y contiguous nucleotides of the sequences described herein, and (ii) for search purposes X equals Y, wherein Y is a selected reference polynucleotide of defined length.
[0167]The sequences of the present invention can include fragments of the sequences, for example, from about 15 nucleotides up to the number of nucleotides present in the full-length sequences described herein (e.g., see the Sequence Listing, Figures, and claims), including all integer values falling within the above-described range. For example, fragments of the polynucleotide sequences of the present invention may be 30-60 nucleotides, 60-120 nucleotides, 120-240 nucleotides, 240-480 nucleotides, 480-1000 nucleotides, and all integer values therebetween.
[0168]The synthetic expression cassettes (and purified polynucleotides) of the present invention include related polynucleotide sequences having about 80% to 100%, greater than 80-85%, preferably greater than 90-92%, more preferably greater than 95%, and most preferably greater than 98% up to 100% (including all integer values falling within these described ranges) sequence identity to the synthetic expression cassette (and purified polynucleotide) sequences disclosed herein (for example, to the claimed sequences or other sequences of the present invention) when the sequences of the present invention are used as the query sequence against, for example, a database of sequences.
[0169]Two nucleic acid fragments are considered to "selectively hybridize" as described herein. The degree of sequence identity between two nucleic acid molecules affects the efficiency and strength of hybridization events between such molecules. A partially identical nucleic acid sequence will at least partially inhibit a completely identical sequence from hybridizing to a target molecule. Inhibition of hybridization of the completely identical sequence can be assessed using hybridization assays that are well known in the art (e.g., Southern blot, Northern blot, solution hybridization, or the like, see Sambrook, et al., supra or Ausubel et al., supra). Such assays can be conducted using varying degrees of selectivity, for example, using conditions varying from low to high stringency. If conditions of low stringency are employed, the absence of non-specific binding can be assessed using a secondary probe that lacks even a partial degree of sequence identity (for example, a probe having less than about 30% sequence identity with the target molecule), such that, in the absence of non-specific binding events, the secondary probe will not hybridize to the target.
[0170]When utilizing a hybridization-based detection system, a nucleic acid probe is chosen that is complementary to a target nucleic acid sequence, and then by selection of appropriate conditions the probe and the target sequence "selectively hybridize," or bind, to each other to form a hybrid molecule. A nucleic acid molecule that is capable of hybridizing selectively to a target sequence under "moderately stringent" typically hybridizes under conditions that allow detection of a target nucleic acid sequence of at least about 10-14 nucleotides in length having at least approximately 70% sequence identity with the sequence of the selected nucleic acid probe. Stringent hybridization conditions typically allow detection of target nucleic acid sequences of at least about 10-14 nucleotides in length having a sequence identity of greater than about 90-95% with the sequence of the selected nucleic acid probe. Hybridization conditions useful for probe/target hybridization where the probe and target have a specific degree of sequence identity, can be determined as is known in the art (see, for example, Nucleic Acid Hybridization: A Practical Approach, editors B. D. Hames and S. J. Higgins, (1985) Oxford; Washington, D.C.; IRL Press).
[0171]With respect to stringency conditions for hybridization, it is well known in the art that numerous equivalent conditions can be employed to establish a particular stringency by varying, for example, the following factors: the length and nature of probe and target sequences, base composition of the various sequences, concentrations of salts and other hybridization solution components, the presence or absence of blocking agents in the hybridization solutions (e.g., formamide, dextran sulfate, and polyethylene glycol), hybridization reaction temperature and time parameters, as well as, varying wash conditions. The selection of a particular set of hybridization conditions is selected following standard methods in the art (see, for example, Sambrook, et al., supra or Ausubel et al., supra).
[0172]A first polynucleotide is "derived from" second polynucleotide if it has the same or substantially the same basepair sequence as a region of the second polynucleotide, its cDNA, complements thereof, or if it displays sequence identity as described above.
[0173]A first polypeptide is "derived from" a second polypeptide if it is (i) encoded by a first polynucleotide derived from a second polynucleotide, or (ii) displays sequence identity to the second polypeptides as described above.
[0174]Generally, a viral polypeptide is "derived from" a particular polypeptide of a virus (viral polypeptide) if it is (i) encoded by an open reading frame of a polynucleotide of that virus (viral polynucleotide), or (ii) displays sequence identity to polypeptides of that virus as described above.
[0175]"Encoded by" refers to a nucleic acid sequence which codes for a polypeptide sequence, wherein the polypeptide sequence or a portion thereof contains an amino acid sequence of at least 3 to 5 amino acids, more preferably at least 8 to 10 amino acids, and even more preferably at least 15 to 20 amino acids from a polypeptide encoded by the nucleic acid sequence. Also encompassed are polypeptide sequences which are immunologically identifiable with a polypeptide encoded by the sequence. Further, polyproteins can be constructed by fusing in-frame two or more polynucleotide sequences encoding polypeptide or peptide products. Further, polycistronic coding sequences may be produced by placing two or more polynucleotide sequences encoding polypeptide products adjacent each other, typically under the control of one promoter, wherein each polypeptide coding sequence may be modified to include sequences for internal ribosome binding sites.
[0176]"Purified polynucleotide" refers to a polynucleotide of interest or fragment thereof which is essentially free, e.g., contains less than about 50%, preferably less than about 70%, and more preferably less than about 90%, of the protein with which the polynucleotide is naturally associated. Techniques for purifying polynucleotides of interest are well-known in the art and include, for example, disruption of the cell containing the polynucleotide with a chaotropic agent and separation of the polynucleotide(s) and proteins by ion-exchange chromatography, affinity chromatography and sedimentation according to density.
[0177]By "nucleic acid immunization" is meant the introduction of a nucleic acid molecule encoding one or more selected antigens into a host cell, for the in vivo expression of an antigen, antigens, an epitope, or epitopes. The nucleic acid molecule can be introduced directly into a recipient subject, such as by injection, inhalation, oral, intranasal and mucosal administration, or the like, or can be introduced ex vivo, into cells which have been removed from the host. In the latter case, the transformed cells are reintroduced into the subject where an immune response can be mounted against the antigen encoded by the nucleic acid molecule.
[0178]"Gene transfer" or "gene delivery" refers to methods or systems for reliably inserting DNA of interest into a host cell. Such methods can result in transient expression of non-integrated transferred DNA, extrachromosomal replication and expression of transferred replicons (e.g., episomes), or integration of transferred genetic material into the genomic DNA of host cells. Gene delivery expression vectors include, but are not limited to, vectors derived from alphaviruses, pox viruses and vaccinia viruses. When used for immunization, such gene delivery expression vectors may be referred to as vaccines or vaccine vectors.
[0179]"T lymphocytes" or "T cells" are non-antibody producing lymphocytes that constitute a part of the cell-mediated arm of the immune system. T cells arise from immature lymphocytes that migrate from the bone marrow to the thymus, where they undergo a maturation process under the direction of thymic hormones. Here, the mature lymphocytes rapidly divide increasing to very large numbers. The maturing T cells become immunocompetent based on their ability to recognize and bind a specific antigen. Activation of immunocompetent T cells is triggered when an antigen binds to the lymphocyte's surface receptors.
[0180]The term "transfection" is used to refer to the uptake of foreign DNA by a cell. A cell has been "transfected" when exogenous DNA has been introduced inside the cell membrane. A number of transfection techniques are generally known in the art. See, e.g., Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13:197. Such techniques can be used to introduce one or more exogenous DNA moieties into suitable host cells. The term refers to both stable and transient uptake of the genetic material, and includes uptake of peptide- or antibody-linked DNAs.
[0181]A "vector" is capable of transferring gene sequences to target cells (e.g., viral vectors, non-viral vectors, particulate carriers, and liposomes). Typically, "vector construct," "expression vector," and "gene transfer vector," mean any nucleic acid construct capable of directing the expression of a gene of interest and which can transfer gene sequences to target cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors.
[0182]Transfer of a "suicide gene" (e.g., a drug-susceptibility gene) to a target cell renders the cell sensitive to compounds or compositions that are relatively nontoxic to normal cells. Moolten, F. L. (1994) Cancer Gene Ther. 1:279-287. Examples of suicide genes are thymidine kinase of herpes simplex virus (HSV-tk), cytochrome P450 (Manome et al. (1996) Gene Therapy 3:513-520), human deoxycytidine kinase (Manome et al. (1996) Nature Medicine 2(5):567-573) and the bacterial enzyme cytosine deaminase (Dong et al. (1996) Human Gene Therapy 7:713-720). Cells which express these genes are rendered sensitive to the effects of the relatively nontoxic prodrugs ganciclovir (HSV-tk), cyclophosphamide (cytochrome P450 2B1), cytosine arabinoside (human deoxycytidine kinase) or 5-fluorocytosine (bacterial cytosine deaminase). Culver et al. (1992) Science 256:1550-1552, Huber et al. (1994) Proc. Natl. Acad. Sci. USA 91:8302-8306.
[0183]A "selectable marker" or "reporter marker" refers to a nucleotide sequence included in a gene transfer vector that has no therapeutic activity, but rather is included to allow for simpler preparation, manufacturing, characterization or testing of the gene transfer vector.
[0184]A "specific binding agent" refers to a member of a specific binding pair of molecules wherein one of the molecules specifically binds to the second molecule through chemical and/or physical means. One example of a specific binding agent is an antibody directed against a selected antigen.
[0185]By "subject" is meant any member of the subphylum chordata, including, without limitation, humans and other primates, including non-human primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs; birds, including domestic, wild and game birds such as chickens, turkeys and other gallinaceous birds, ducks, geese, and the like. The term does not denote a particular age. Thus, both adult and newborn individuals are intended to be covered. The system described above is intended for use in any of the above vertebrate species, since the immune systems of all of these vertebrates operate similarly.
[0186]By "pharmaceutically acceptable" or "pharmacologically acceptable" is meant a material which is not biologically or otherwise undesirable, i.e., the material may be administered to an individual in a formulation or composition without causing any undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.
[0187]By "physiological pH" or a "pH in the physiological range" is meant a pH in the range of approximately 7.2 to 8.0 inclusive, more typically in the range of approximately 7.2 to 7.6 inclusive.
[0188]As used herein, "treatment" refers to any of (I) the prevention of infection or reinfection, as in a traditional vaccine, (ii) the reduction or elimination of symptoms, and (iii) the substantial or complete elimination of the pathogen in question. Treatment may be effected prophylactically (prior to infection) or therapeutically (following infection).
[0189]By "co-administration" is meant administration of more than one composition or molecule. Thus, co-administration includes concurrent administration or sequentially administration (in any order), via the same or different routes of administration. Non-limiting examples of co-administration regimes include, co-administration of nucleic acid and polypeptide; co-administration of different nucleic acids (e.g., different expression cassettes as described herein and/or different gene delivery vectors); and co-administration of different polypeptides (e.g., different HIV polypeptides and/or different adjuvants). The term also encompasses multiple administrations of one of the co-administered molecules or compositions (e.g., multiple administrations of one or more of the expression cassettes described herein followed by one or more administrations of a polypeptide-containing composition). In cases where the molecules or compositions are delivered sequentially, the time between each administration can be readily determined by one of skill in the art in view of the teachings herein.
[0190]"Lentiviral vector", and "recombinant lentiviral vector" refer to a nucleic acid construct which carries, and within certain embodiments, is capable of directing the expression of a nucleic acid molecule of interest. The lentiviral vector include at least one transcriptional promoter/enhancer or locus defining element(s), or other elements which control gene expression by other means such as alternate splicing, nuclear RNA export, post-translational modification of messenger, or post-transcriptional modification of protein. Such vector constructs must also include a packaging signal, long terminal repeats (LTRS) or portion thereof, and positive and negative strand primer binding sites appropriate to the retrovirus used (if these are not already present in the retroviral vector). Optionally, the recombinant lentiviral vector may also include a signal which directs polyadenylation, selectable markers such as Neo, TK, hygromycin, phleomycin, histidinol, or DHFR, as well as one or more restriction sites and a translation termination sequence. By way of example, such vectors typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second strand DNA synthesis, and a 3'LTR or a portion thereof.
[0191]"Lentiviral vector particle" as utilized within the present invention refers to a lentivirus which carries at least one gene of interest. The retrovirus may also contain a selectable marker. The recombinant lentivirus is capable of reverse transcribing its genetic material (RNA) into DNA and incorporating this genetic material into a host cell's DNA upon infection. Lentiviral vector particles may have a lentiviral envelope, a non-lentiviral envelope (e.g., an ampho or VSV-G envelope), or a chimeric envelope.
[0192]"Nucleic acid expression vector" or "Expression cassette" refers to an assembly which is capable of directing the expression of a sequence or gene of interest. The nucleic acid expression vector includes a promoter which is operably linked to the sequences or gene(s) of interest. Other control elements may be present as well. Expression cassettes described herein may be contained within a plasmid construct. In addition to the components of the expression cassette, the plasmid construct may also include a bacterial origin of replication, one or more selectable markers, a signal which allows the plasmid construct to exist as single-stranded DNA (e.g., a M13 origin of replication), a multiple cloning site, and a "mammalian" origin of replication (e.g., a SV40 or adenovirus origin of replication).
[0193]"Packaging cell" refers to a cell which contains those elements necessary for production of infectious recombinant retrovirus which are lacking in a recombinant retroviral vector. Typically, such packaging cells contain one or more expression cassettes which are capable of expressing proteins which encode Gag, pol and env proteins.
[0194]"Producer cell" or "vector producing cell" refers to a cell which contains all elements necessary for production of recombinant retroviral vector particles.
2. MODES OF CARRYING OUT THE INVENTION
[0195]Before describing the present invention in detail, it is to be understood that this invention is not limited to particular formulations or process parameters as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting.
[0196]Although a number of methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, the preferred materials and methods are described herein.
[0197]2.1. The HIV Genome
[0198]The HIV genome and various polypeptide-encoding regions are shown in Table A. The nucleotide positions are given relative to 8--5_TV1_C.ZA (SEQ ID NO:33, FIG. 11). However, it will be readily apparent to one of ordinary skill in the art in view of the teachings of the present disclosure how to determine corresponding regions in other HIV strains or variants (e.g., isolates HIVIIIb, HIVSF2, HIV-1.sub.SF162, HIV-1.sub.SF170, VLAV, HIVLAI, HIVMN, HIV-1.sub.CM235, HIV-1US4, other HIV-1 strains from diverse subtypes (e.g., subtypes, A through G, and O), HIV-2 strains and diverse subtypes (e.g., HIV-2UC1 and HIV-2UC2), and simian immunodeficiency virus (SIV). (See, e.g., Virology, 3rd Edition (W. K. Joklik ed. 1988); Fundamental Virology, 2nd Edition (B. N. Fields and D. M. Knipe, eds. 1991); Virology, 3rd Edition (Fields, B N, D M Knipe, P M Howley, Editors, 1996, Lippincott-Raven, Philadelphia, Pa.; for a description of these and other related viruses), using for example, sequence comparison programs (e.g., BLAST and others described herein) or identification and alignment of structural features (e.g., a program such as the "ALB" program described herein that can identify the various regions).
TABLE-US-00001 TABLE A Regions of the HIV Genome relative to 8_5_TV1_C.ZA Region Position in nucleotide sequence 5'LTR 1-636 U3 1-457 R 458-553 U5 554-636 NFkB II 340-348 NFkB I 354-362 Sp1 III 379-388 Sp1 II 390-398 Sp1 I 400-410 TATA Box 429-433 TAR 474-499 Poly A signal 529-534 PBS 638-655 p7 binding region, packaging signal 685-791 Gag: 792-2285 p17 792-1178 p24 1179-1871 Cyclophilin A bdg. 1395-1505 MHR 1632-1694 p2 1872-1907 P7 1908-2072 Frameshift slip 2072-2078 p1 2073-2120 p6Gag 2121-2285 Zn-motif I 1950-1991 Zn-motif II 2013-2054 Pol: 2072-5086 p6Pol 2072-2245 Prot 2246-2542 p66RT 2543-4210 p15RNaseH 3857-4210 p31Int 4211-5086 Vif: 5034-5612 Hydrophilic region 5292-5315 Vpr: 5552-5839 Oligomerization 5552-5677 Amphipathic α-helix 5597-5653 Tat: 5823-6038 and 8417-8509 Tat-1 exon 5823-6038 Tat-2 exon 8417-8509 N-terminal domain 5823-5885 Trans-activation domain 5886-5933 Transduction domain 5961-5993 Rev: 5962-6037 and 8416-8663 Rev-1 exon 5962-6037 Rev-2 exon 8416-8663 High-affinity bdg. site 8439-8486 Leu-rich effector domain 8562-8588 Vpu: 6060-6326 Transmembrane domain 6060-6161 Cytoplasmic domain 6162-6326 Env (gp160): 6244-8853 Signal peptide 6244-6324 gp120 6325-7794 V1 6628-6729 V2 6727-6852 V3 7150-7254 V4 7411-7506 V5 7663-7674 C1 6325-6627 C2 6853-7149 C3 7255-7410 C4 7507-7662 C5 7675-7794 CD4 binding 7540-7566 gp41 7795-8853 Fusion peptide 7789-7842 Oligomerization domain 7924-7959 N-terminal heptad repeat 7921-8028 C-terminal heptad repeat 8173-8280 Immunodominant region 8023-8076 Nef: 8855-9478 Myristoylation 8858-8875 SH3 binding 9062-9091 Polypurine tract 9128-9154 SH3 binding 9296-9307
[0199]It will be readily apparent that one of skill in the art can readily align any sequence to that shown in Table A to determine relative locations of any particular HIV gene. For example, using one of the alignment programs described herein (e.g., BLAST), other HIV Type C sequences can be aligned with 8--5_TV1_C.ZA (Table A) and locations of genes determined.
[0200]Polypeptide sequences can be similarly aligned. For example, FIG. 103 shows the alignment of Env polypeptide sequences from various strains, relative to SF-162. As described in detail in co-owned WO/39303, Env polypeptides (e.g., gp120, gp140 and gp160) include a "bridging sheet" comprised of 4 anti-parallel β-strands (β-2, β-3, β-20 and β-21) that form a β-sheet. Extruding from one pair of the β-strands (β-2 and β-3) are two loops, V1 and V2. The β-2 sheet occurs at approximately amino acid residue 113 (Cys) to amino acid residue 117 (Thr) while β-3 occurs at approximately amino acid residue 192 (Ser) to amino acid residue 194 (Ile), relative to SF-162 (see, FIG. 103). The "V1/V2 region" occurs at approximately amino acid positions 120 (Cys) to residue 189 (Cys), relative to SF-162. Extruding from the second pair of β-strands (β-20 and β-21) is a "small-loop" structure, also referred to herein as "the bridging sheet small loop." The locations of both the small loop and bridging sheet small loop can be determined relative to HXB-2 following the teachings herein and in WO/39303. Also shown by arrows in FIG. 103A-C are approximate sites for deletions sequence from the beta sheet region. The "*" denotes N-glycosylation sites that can be mutated following the teachings of the present specification.
[0201]2.2 Synthetic Expression Cassettes
[0202]2.2.1 Modification of HIV-1-Type C Pol-, Prot-, Rt-, Int-, Gag, Env, Tat, Rev, Nef, RnaseH, Vif, Vpr, and Vpu Nucleic Acid Coding Sequences
[0203]One aspect of the present invention is the generation of HIV-1 type C coding sequences, and related sequences, having improved expression relative to the corresponding wild-type sequences.
[0204]2.2.1.1. Modification of Gag Nucleic Acid Coding Sequences
[0205]An exemplary embodiment of the present invention is illustrated herein by modifying the Gag protein wild-type sequences obtained from the AF110965 and AF110967 strains of HIV-1, subtype C. (see, for example, Korber et al. (1998) Human Retroviruses and Aids, Los Alamos, N. Mex.: Los Alamos National Laboratory; Novitsky et al. (1999) J. Virol. 73(5):4427-4432, for molecular cloning of various subtype C clones from Botswana). Also illustrated herein is the modification of wild-type sequences from novel isolates 8--5_TV1_C.ZA (also called TV001 or TV1) and 12-5--1_TV2_C.ZA (also called TV002 or TV2). SEQ ID NO:52 shows the wild-type sequence of Gag from 8--5_TV1_C.ZA and SEQ ID NO:54 shows the wild-type sequence of the major homology region of Gag (nucleotides 1632-1694 of Table A) of the same strain. SEQ ID NO:100 shows the wild-type sequence of Gag of 12-5--1_TV2_C.ZA.
[0206]Gag sequence obtained from other Type C HIV-1 variants may be manipulated in similar fashion following the teachings of the present specification. Such other variants include, but are not limited to, Gag protein encoding sequences obtained from the isolates of HIV-1 Type C, for example as described in Novitsky et al., (1999), supra; Myers et al., infra; Virology, 3rd Edition (W. K. Joklik ed. 1988); Fundamental Virology, 2nd Edition (B. N. Fields and D. M. Knipe, eds. 1991); Virology, 3rd Edition (Fields, B N, D M Knipe, P M Howley, Editors, 1996, Lippincott-Raven, Philadelphia, Pa. and on the World Wide Web (Internet), for example at http://hiv-web.lan1.gov/cgi-bin/hivDB3/public/wdb/ssampublic and http://hiv-weblan1.gov.
[0207]First, the HIV-1 codon usage pattern was modified so that the resulting nucleic acid coding sequence was comparable to codon usage found in highly expressed human genes (Example 1). The HIV codon usage reflects a high content of the nucleotides A or T of the codon-triplet. The effect of the HIV-1 codon usage is a high AT content in the DNA sequence that results in a decreased translation ability and instability of the mRNA. In comparison, highly expressed human codons prefer the nucleotides G or C. The Gag coding sequences were modified to be comparable to codon usage found in highly expressed human genes.
[0208]Second, there are inhibitory (or instability) elements (INS) located within the coding sequences of the Gag coding sequences. The RRE is a secondary RNA structure that interacts with the HIV encoded Rev-protein to overcome the expression down-regulating effects of the INS. To overcome the post-transcriptional activating mechanisms of RRE and Rev, the instability elements can be inactivated by introducing multiple point mutations that do not alter the reading frame of the encoded proteins. Subtype C Gag-encoding sequences having inactivated RRE sites are shown, for example, in FIGS. 1 (SEQ ID NO:3), 2 (SEQ ID NO:4), 5 (SEQ ID NO:20) and 6 (SEQ ID NO:26). Similarly, other synthetic polynucleotides derived from other Subtype C strains can be modified to inactivate the RRE sites.
[0209]Modification of the Gag polypeptide coding sequences results in improved expression relative to the wild-type coding sequences in a number of mammalian cell lines (as well as other types of cell lines, including, but not limited to, insect cells). Further, expression of the sequences results in production of virus-like particles (VLPs) by these cell lines (see below).
[0210]2.2.1.2 Modification of Env Nucleic Acid Coding Sequences
[0211]Similarly, the present invention also includes synthetic Env-encoding polynucleotides and modified Env proteins. Wild-type Env sequences are obtained from the AF110968 and AF110975 strains as well as novel strains 8--5_TV1_C.ZA (SEQ ID NO:33) and 12-5--1_TV2_C.ZA (SEQ ID NO:45) of HIV-1, type C. (see, for example, Novitsky et al. (1999) J. Virol. 73(5):4427-4432, for molecular cloning of various subtype C clones from Botswana). Wild-type Env sequences of 8--5_TV1_C.ZA are shown, for example, in SEQ ID NO:48 (wild-type Env common region, nucleotides 7486-7629 as shown in Table A); and SEQ ID NO:50 (wild type gp160, nucleotides 6244-8853 as shown in Table A). Wild-type Env gp160 of 12-5--1_TV2_C.ZA is shown in SEQ ID NO:98. It will be readily apparent from the disclosure herein that polynucleotides encoding fragments of Env gp160 (e.g., gp120, gp41, gp140) can be readily obtained from the larger, full-length sequences disclosed herein. It will also be readily apparent that other modifications can be made, for example deletion of regions such as the V1 and/or V2 region; mutation of the cleavage site and the like (see, Example 1). Exemplary sequences of such modification as shown in SEQ ID NO:119 through 127.
[0212]Further, Env sequences obtained from other Type C HIV-1 variants may be manipulated in similar fashion following the teachings of the present specification. Such other variants include, but are not limited to, Env protein encoding sequences obtained from the isolates of HIV-1 Type C, described above.
[0213]The codon usage pattern for Env was modified as described above for Gag so that the resulting nucleic acid coding sequence was comparable to codon usage found in highly expressed human genes. Experiments performed in support of the present invention show that the synthetic Env sequences were capable of higher level of protein production relative to the native Env sequences.
[0214]Modification of the Env polypeptide coding sequences results in improved expression relative to the wild-type coding sequences in a number of mammalian cell lines (as well as other types of cell lines, including, but not limited to, insect cells). Similar Env polypeptide coding sequences can be obtained, modified and tested for improved expression from a variety of isolates, including those described above for Gag.
[0215]Further modifications of Env include, but are not limited to, generating polynucleotides that encode Env polypeptides having mutations and/or deletions therein. For instance, the hypervariable regions, V1 and/or V2, can be deleted as described herein. Additionally, other modifications, for example to the bridging sheet region and/or to N-glycosylation sites within Env can also be performed following the teachings of the present specification. (see, FIG. 103A-C and WO/39303). Various combinations of these modifications can be employed to generate synthetic expression cassettes as described herein.
[0216]2.2.1.3 Modification of Sequences Including HIV-1 Pol Nucleic Acid Coding Sequences
[0217]The present invention also includes expression cassettes which include synthetic Pol sequences. As noted above, "Pol" includes, but is not limited to, the protein-encoding regions shown in FIG. 7, for example polymerase, protease, reverse transcriptase and/or integrase-containing sequences. The regions shown in FIG. 7 are described, for example, in Wan et al (1996) Biochem. J. 316:569-573; Kohl et al. (1988) PNAS USA 85:4686-4690; Krausslich et al. (1988) J. Virol. 62:4393-4397; Coffin, "Retroviridae and their Replication" in Virology, pp 1437-1500 (Raven, N.Y., 1990); Patel et. al. (1995) Biochemistry 34:5351-5363. Thus, the synthetic expression cassettes exemplified herein include one or more of these regions and one or more changes to the resulting amino acid sequences.
[0218]Wild type Pol sequences were obtained from the AF110975, 8--5_TV1_C.ZA and 12-5--1_TV2_C.ZA strains of HIV-1, type C. (see, for example, Novitsky et al. (1999) J. Virol. 73(5):4427-4432, for molecular cloning of various subtype C clones from Botswana). SEQ ID NO:34 shows the wild type sequence of AF110975 from the p2 through p7 region of Pol (see, FIG. 7 and Table A). SEQ ID NO:35 shows the wild type sequence of AF110975 from p1 through the first 6 amino acids of integrase (see, FIG. 7 and Table A). SEQ ID NO:63 and SEQ ID NO:104 show wild-type sequences of Pol from 8--5_TV1_C.ZA and 12-5--1_TV2_C.ZA, respectively (see, also, Table A).
[0219]Sequence obtained from other Type C HIV-1 variants may be manipulated in similar fashion following the teachings of the present specification. Such other variants include, but are not limited to, Pol protein encoding sequences obtained from the isolates of HIV-1 Type C described herein.
[0220]The codon usage pattern for Pol was modified as described above for Gag and Env so that the resulting nucleic acid coding sequence was comparable to codon usage found in highly expressed human genes.
[0221]Table B shows the nucleotide positions of various regions found in the Pol constructs exemplified herein (e.g., SEQ ID NOs: 30-32).
TABLE-US-00002 TABLE B Position in nucleotide sequence in construct PR975(+) PR975YM PR975(+) Seq Id Seq Id YMWM Region No: 30 No: 31 Seq Id No: 32 Sal 1 restriction site 1-6 1-6 1-6 Kozak start codon 7-16 7-16 7-16 p2 16-54 16-54 16-54 P7 55-219 55-219 55-219 p1/p6 pol 220-375 220-375 220-375 Insertion mutation for in frame 225 225 225 p10Protease 376-672 376-672 376-672 p66RT 673-2352 673-2346 673-2340 p51RT 673-1992 673-1986 673-1980 p15RNaseH 1993-2352 1993-2346 1993-2340 catalytic center region 1219-1230 1219-1224 1219-1224 (YMDD) primer grip region (WMGY) 1357-1368 1351-1362 1351-1356 6aa Integrase 2353-2370 2347-2364 2341-2358 YMDD epitope cassette 2371-2424 2365-2418 2359-2412 (incl. 5' + 3'Gly) MCS (multiple cloning site) 2425-2463 2419-2457 2413-2451 EcoR 1 restriction site 2464-2469 2458-2463 2452-2457
[0222]As shown in Table B, exemplary constructs were modified in various ways. For example, the expression constructs exemplified herein include sequence that encodes the first 6 amino acids of the integrase polypeptide. This 6 amino acid region is believed to provide a cleavage recognition site recognized by HIV protease (see, e.g., McCornack et al. (1997) FEBS Letts 414:84-88). As noted above, certain constructs exemplified herein include a multiple cloning site (MCS) for insertion of one or more transgenes, typically at the 3' end of the construct. In addition, a cassette encoding a catalytic center epitope derived from the catalytic center in RT is typically included 3' of the sequence encoding 6 amino acids of integrase. This cassette (SEQ ID NO:36) encodes Ile178 through Serine 191 of RT (amino acids 3 through 16 of SEQ ID NO:37) and was added to keep this well conserved region as a possible CTL epitope. Further, the constructs contain an insertion mutations (position 225 of SEQ ID NOs:30 to 32) to preserve the reading frame. (see, e.g., Park et al. (1991) J. Virol. 65:5111).
[0223]In certain embodiments, the catalytic center and/or primer grip region of RT are modified. The catalytic center and primer grip regions of RT are described, for example, in Patel et al. (1995) Biochem. 34:5351 and Palaniappan et al. (1997) J. Biol. Chem. 272(17):11157. For example, in the construct designated PR975YM (SEQ ID NO:31), wild type sequence encoding the amino acids YMDD at positions 183-185 of p66 RT, numbered relative to AF110975, are replaced with sequence encoding the amino acids "AP". In the construct designated PR975YMWM (SEQ ID NO:32), the same mutation in YMDD is made and, in addition, the primer grip region (amino acids WMGY, residues 229-232 of p66RT, numbered relative to AF110975) are replaced with sequence encoding the amino acids "PI."
[0224]For the Pol sequence, the changes in codon usage are typically restricted to the regions up to the -1 frameshift and starting again at the end of the Gag reading frame; however, regions within the frameshift translation region can be modified as well. Finally, inhibitory (or instability) elements (INS) located within the coding sequences of the protease polypeptide coding sequence can be altered as well.
[0225]Experiments can be performed in support of the present invention to show that the synthetic Pol sequences were capable of higher level of protein production relative to the native Pol sequences. Modification of the Pol polypeptide coding sequences results in improved expression relative to the wild-type coding sequences in a number of mammalian cell lines (as well as other types of cell lines, including, but not limited to, insect cells). Similar Pol polypeptide coding sequences can be obtained, modified and tested for improved expression from a variety of isolates, including those described above for Gag and Env.
[0226]2.2.1.4 Modification of Other HIV Sequences
[0227]The present invention also includes expression cassettes which include synthetic HIV Type C sequences derived HIV genes other than Gag, Env and Pol, including but not limited to, regions within Gag, Env, Pol, as well as, vif, vpr, tat, rev, vpu, and nef, for example from 8--5_TV1_C.ZA (SEQ ID NO:33) or 12-5--1_TV2_C.ZA (SEQ ID NO:45). Sequences obtained from other strains can be manipulated in similar fashion following the teachings of the present specification.
[0228]As noted above, the codon usage pattern is modified as described above for Gag, Env and Pol so that the resulting nucleic acid coding sequence is comparable to codon usage found in highly expressed human genes. Experiments can be performed in support of the present invention to show that these synthetic sequences were capable of higher level of protein production relative to the native sequences and that modification of the wild-type polypeptide coding sequences results in improved expression relative to the wild-type coding sequences in a number of mammalian cell lines (as well as other types of cell lines, including, but not limited to, insect cells). Furthermore, the nucleic acid sequence can also be modified to introduce mutations into one or more regions of the gene, for instance to render the gene product non-functional and/or to eliminate the myristoylation site in Nef.
[0229]Synthetic expression cassettes exemplified herein include SEQ ID NO:49 and SEQ ID NO:97 (Env gp160-encoding sequences, modified based on 8--5_TV1_C.ZA wild type and 12-5--1_TV2_C.ZA wild-type, respectively); SEQ ID NO:51 and SEQ ID NO:99 (Gag-encoding sequences modified based on 8--5_TV1_C.ZA wild type and 12-5--1 TV2_C.ZA wild-type, respectively); SEQ ID NO:53 (Gag major homology region, modified based on 8--5_TV1_C.ZA wild type); SEQ ID NO:55 and SEQ ID NO:101 (Nef-encoding sequences, modified based on 8--5_TV1_C.ZA wild type and 12-5--1_TV2_C.ZA wild-type, respectively); SEQ ID NO:57 and SEQ ID NO:134 (Nef-encoding sequences with a mutation at position 125 resulting in a non-functional gene product, modified based on 8--5_TV1_C.ZA wild type and 12-5--1_TV2_C.ZA, respectively); SEQ ID NO:58 (RNAseH-encoding sequences, modified based on 8--5_TV1_C.ZA wild type); SEQ ID NO:60 (Integrase-encoding sequences, modified based on 8--5_TV1_C.ZA wild type); SEQ ID NO:62 and SEQ ID NO:103 (Pol-encoding sequences, modified based on 8--5_TV1_C.ZA wild type and 12-5--1_TV2_C.ZA wild-type, respectively); SEQ ID NO:64 (Protease-encoding sequences, modified based on 8--5_TV1_C.ZA wild type); SEQ ID NO:66 (inactivated protease-encoding sequences, modified based on 8--5_TV1_C.ZA wild type); SEQ ID NO:68 (inactivated protease and RT mutated sequences, modified based on 8--5_TV1_C.ZA wild type); SEQ ID NO:70 (protease and reverse-transcriptase-encoding sequences, modified based on 8--5_TV1_C.ZA wild type); SEQ ID NO:72 and SEQ NO:105 (exon 1 of Rev, modified based on 8--5_TV1_C.ZA wild type and 12-5--1_TV2_C.ZA wild-type, respectively); SEQ ID NO:74 and SEQ ID NO:107 (exon 2 of Rev, modified based on 8--5_TV1_C.ZA wild type and 12-5--1_TV2_C.ZA wild-type, respectively); SEQ ID NO:76 (reverse transcriptase-encoding sequences, modified based on 8--5_TV1_C.ZA wild type); SEQ ID NO:78 (mutated reverse-transcriptase, modified based on 8--5_TV1_C.ZA wild type); SEQ ID NO:80 (exon 1 of Tat including a mutation that results in non-functional Tat, modified based on 8--5_TV1_C.ZA wild type); SEQ ID NO:81 and SEQ ID NO:109 (exon 1 of Tat, modified based on 8--5_TV1_C.ZA wild type and 12-5--1_TV2_C.ZA wild-type, respectively); SEQ ID NO:83 and SEQ ID NO:111 (exon 2 of Tat, modified based on 8--5_TV1_C.ZA wild type and 12-5--1_TV2_C.ZA wild-type, respectively); SEQ ID NO:85 and SEQ ID NO:113) (Vif-encoding sequences, modified based on 8--5_TV1_C.ZA wild type and 12-5--1_TV2_C.ZA wild-type, respectively); SEQ ID NO:87 and SEQ ID NO:115 (Vpr-encoding sequences, modified based on 8--5_TV1_C.ZA wild type and 12-5--1_TV2_C.ZA wild-type, respectively); SEQ ID NO:89 and SEQ ID NO:117 (Vpu-encoding sequences, modified based on 8--5_TV1_C.ZA wild type and 12-5--1_TV2_C.ZA wild-type, respectively); SEQ ID NO:91 (sequences of exons 1 and 2 of Rev, modified based on 8--5_TV1_C.ZA wild type); SEQ ID NO:93 (sequences of mutated exon 1 of Tat and exon 2 of Tat, where mutation of exon 1 results in non-functional Tat, modified based on 8--5_TV1_C.ZA wild type); SEQ ID NO:94 (sequences of exons 1 and 2 of Tat, modified based on 8--5_TV1_C.ZA wild type); SEQ ID NO:96 and SEQ ID NO:135 (Nef-encoding sequences including a mutation to eliminate myristoylation site, modified based on 8--5_TV1_C.ZA wild type and 12-5--1_TV2_C.ZA, respectively).
[0230]2.2.1.5 Further Modification of Sequences Including HIV-1 Nucleic Acid Coding Sequences
[0231]The Type C HIV polypeptide-encoding expression cassettes described herein may also contain one or more further sequences encoding, for example, one or more transgenes. Further sequences (e.g., transgenes) useful in the practice of the present invention include, but are not limited to, further sequences are those encoding further viral epitopes/antigens {including but not limited to, HCV antigens (e.g., E1, E2; Houghton, M., et al., U.S. Pat. No. 5,714,596, issued Feb. 3, 1998; Houghton, M., et al., U.S. Pat. No. 5,712,088, issued Jan. 27, 1998; Houghton, M., et al., U.S. Pat. No. 5,683,864, issued Nov. 4, 1997; Weiner, A. J., et al., U.S. Pat. No. 5,728,520, issued Mar. 17, 1998; Weiner, A. J., et al., U.S. Pat. No. 5,766,845, issued Jun. 16, 1998; Weiner, A. J., et al., U.S. Pat. No. 5,670,152, issued Sep. 23, 1997; all herein incorporated by reference), HIV antigens (e.g., derived from tat, rev, nef and/or env); and sequences encoding tumor antigens/epitopes. Further sequences may also be derived from non-viral sources, for instance, sequences encoding cytokines such interleukin-2 (IL-2), stem cell factor (SCF), interleukin 3 (IL-3), interleukin 6 (IL-6), interleukin 12 (IL-12), G-CSF, granulocyte macrophage-colony stimulating factor (GM-CSF), interleukin-1 alpha (IL-1I), interleukin-11 (IL-11), MIP-1I, tumor necrosis factor (TNF), leukemia inhibitory factor (LIF), c-kit ligand, thrombopoietin (TPO) and flt3 ligand, commercially available from several vendors such as, for example, Genzyme (Framingham, Mass.), Genentech (South San Francisco, Calif.), Amgen (Thousand Oaks, Calif.), R&D Systems and Immunex (Seattle, Wash.). Additional sequences are described below, for example in Section 2.3. Also, variations on the orientation of the Gag and other coding sequences, relative to each other, are described below.
[0232]HIV polypeptide coding sequences can be obtained from other Type C HIV isolates, see, e.g., Myers et al. Los Alamos Database, Los Alamos National Laboratory, Los Alamos, N. Mex. (1992); Myers et al., Human Retroviruses and Aids, 1997, Los Alamos, N. Mex.: Los Alamos National Laboratory. Synthetic expression cassettes can be generated using such coding sequences as starting material by following the teachings of the present specification (e.g., see Example 1).
[0233]Further, the synthetic expression cassettes of the present invention include related polypeptide sequences having greater than 85%, preferably greater than 90%, more preferably greater than 95%, and most preferably greater than 98% sequence identity to the synthetic expression cassette sequences disclosed herein (for example, (SEQ ID NOs:30-32; SEQ ID NOs: 3, 4, 20, and 21 and SEQ ID NOs:5-17). Various coding regions are indicated in FIGS. 3 and 4, for example in FIG. 3 (AF110968), nucleotides 1-81 (SEQ ID NO:18); nucleotides 82-1512 (SEQ ID NO:6) encode a gp120 polypeptide, nucleotides 1513 to 2547 (SEQ ID NO:10) encode a gp41 polypeptide, nucleotides 82-2025 (SEQ ID NO:7) encode a gp140 polypeptide and nucleotides 82-2547 (SEQ ID NO:8) encode a gp160 polypeptide. Similarly, in FIG. 98 (SEQ ID NO:127, strain 8--2_TV1_C.ZA), nucleotides 1-6 are an EcoR1 restriction site; nucleotides 7-87 a encode a wild-type (from 8--2_TV1_C.ZA) leader signal peptide; nucleotides 88 to 1563 encode a gp120 polypeptide; nucleotides 88 to 2064 encode a gp140 polypeptide; nucleotides 88 to 2607 encode a gp160 polypeptide.
[0234]2.2.3 Expression of Synthetic Sequences Encoding HIV-1 Subtype C and Related Polypeptides
[0235]Synthetic HIV-encoding sequences (expression cassettes) of the present invention can be cloned into a number of different expression vectors to evaluate levels of expression and, in the case of Gag, production of VLPs. The synthetic DNA fragments for HIV polypeptides can be cloned into eucaryotic expression vectors, including, a transient expression vector, CMV-promoter-based mammalian vectors, and a shuttle vector for use in baculovirus expression systems. Corresponding wild-type sequences can also be cloned into the same vectors.
[0236]These vectors can then be transfected into a several different cell types, including a variety of mammalian cell lines (293, RD, COS-7, and CHO, cell lines available, for example, from the A.T.C.C.). The cell lines are then cultured under appropriate conditions and the levels of any appropriate polypeptide product can be evaluated in supernatants. (see, Table A and Example 2). For example, p24 can be used to evaluate Gag expression; gp160, gp140 or gp120 can be used to evaluate Env expression; p6pol can be used to evaluate Pol expression; prot can be used to evaluate protease; p15 for RNAseH; p31 for Integrase; and other appropriate polypeptides for Vif, Vpr, Tat, Rev, Vpu and Nef. Further, modified polypeptides can also be used, for example, other Env polypeptides include, but are not limited to, for example, native gp160, oligomeric gp140, monomeric gp120 as well as modified and/or synthetic sequences of these polypeptides. The results of these assays demonstrate that expression of synthetic HIV polypeptide-encoding sequences are significantly higher than corresponding wild-type sequences.
[0237]Further, Western Blot analysis can be used to show that cells containing the synthetic expression cassette produce the expected protein at higher per-cell concentrations than cells containing the native expression cassette. The HIV proteins can be seen in both cell lysates and supernatants. The levels of production are significantly higher in cell supernatants for cells transfected with the synthetic expression cassettes of the present invention.
[0238]Fractionation of the supernatants from mammalian cells transfected with the synthetic expression cassette can be used to show that the cassettes provide superior production of HIV proteins and, in the case of Gag, VLPs, relative to the wild-type sequences.
[0239]Efficient expression of these HIV-containing polypeptides in mammalian cell lines provides the following benefits: the polypeptides are free of baculovirus contaminants; production by established methods approved by the FDA; increased purity; greater yields (relative to native coding sequences); and a novel method of producing the Subtype C HIV-containing polypeptides in CHO cells which is not feasible in the absence of the increased expression obtained using the constructs of the present invention. Exemplary Mammalian cell lines include, but are not limited to, BHK, VERO, HT1080, 293, 293T, RD, COS-7, CHO, Jurkat, HUT, SUPT, C8166, MOLT4/clone8, MT-2, MT-4, H9, PM1, CEM, and CEMX174, such cell lines are available, for example, from the A.T.C.C.).
[0240]A synthetic Gag expression cassette of the present invention will also exhibit high levels of expression and VLP production when transfected into insect cells. Synthetic expression cassettes described herein also demonstrate high levels of expression in insect cells. Further, in addition to a higher total protein yield, the final product from the synthetic polypeptides consistently contains lower amounts of contaminating baculovirus proteins than the final product from the native Type C sequences.
[0241]Further, synthetic expression cassettes of the present invention can also be introduced into yeast vectors which, in turn, can be transformed into and efficiently expressed by yeast cells (Saccharomyces cerevisea; using vectors as described in Rosenberg, S. and Tekamp-Olson, P., U.S. Pat. No. RE35,749, issued, Mar. 17, 1998, herein incorporated by reference).
[0242]In addition to the mammalian and insect vectors, the synthetic expression cassettes of the present invention can be incorporated into a variety of expression vectors using selected expression control elements. Appropriate vectors and control elements for any given cell type can be selected by one having ordinary skill in the art in view of the teachings of the present specification and information known in the art about expression vectors.
[0243]For example, a synthetic expression cassette can be inserted into a vector which includes control elements operably linked to the desired coding sequence, which allow for the expression of the gene in a selected cell-type. For example, typical promoters for mammalian cell expression include the SV40 early promoter, a CMV promoter such as the CMV immediate early promoter (a CMV promoter can include intron A), RSV, HIV-Ltr, the mouse mammary tumor virus LTR promoter (MMLV-ltr), the adenovirus major late promoter (Ad MLP), and the herpes simplex virus promoter, among others. Other nonviral promoters, such as a promoter derived from the murine metallothionein gene, will also find use for mammalian expression. Typically, transcription termination and polyadenylation sequences will also be present, located 3' to the translation stop codon. Preferably, a sequence for optimization of initiation of translation, located 5' to the coding sequence, is also present. Examples of transcription terminator/polyadenylation signals include those derived from SV40, as described in Sambrook, et al., supra, as well as a bovine growth hormone terminator sequence. Introns, containing splice donor and acceptor sites, may also be designed into the constructs for use with the present invention (Chapman et al., Nuc. Acids Res. (1991) 19:3979-3986).
[0244]Enhancer elements may also be used herein to increase expression levels of the mammalian constructs. Examples include the SV40 early gene enhancer, as described in Dijkema et al., EMBO J. (1985) 4:761, the enhancer/promoter derived from the long terminal repeat (LTR) of the Rous Sarcoma Virus, as described in Gorman et al., Proc. Natl. Acad. Sci. USA (1982b) 79:6777 and elements derived from human CMV, as described in Boshart et al., Cell (1985) 41:521, such as elements included in the CMV intron A sequence (Chapman et al., Nuc. Acids Res. (1991) 19:3979-3986).
[0245]The desired synthetic polypeptide encoding sequences can be cloned into any number of commercially available vectors to generate expression of the polypeptide in an appropriate host system. These systems include, but are not limited to, the following: baculovirus expression {Reilly, P. R., et al., BACULOVIRUS EXPRESSION VECTORS: A LABORATORY MANUAL (1992); Beames, et al., Biotechniques 11:378 (1991); Pharmingen; Clontech, Palo Alto, Calif.)}, vaccinia expression {Earl, P. L., et al., "Expression of proteins in mammalian cells using vaccinia" In Current Protocols in Molecular Biology (F. M. Ausubel, et al. Eds.), Greene Publishing Associates & Wiley Interscience, New York (1991); Moss, B., et al., U.S. Pat. No. 5,135,855, issued 4 Aug. 1992}, expression in bacteria {Ausubel, F. M., et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley and Sons, Inc., Media Pa.; Clontech}, expression in yeast {Rosenberg, S, and Tekamp-Olson, P., U.S. Pat. No. RE35,749, issued, Mar. 17, 1998, herein incorporated by reference; Shuster, J. R., U.S. Pat. No. 5,629,203, issued May 13, 1997, herein incorporated by reference; Gellissen, G., et al., Antonie Van Leeuwenhoek, 62(1-2):79-93 (1992); Romanos, M. A., et al., Yeast 8(6):423-488 (1992); Goeddel, D. V., Methods in Enzymology 185 (1990); Guthrie, C., and G. R. Fink, Methods in Enzymology 194 (1991)}, expression in mammalian cells {Clontech; Gibco-BRL, Ground Island, N.Y.; e.g., Chinese hamster ovary (CHO) cell lines (Haynes, J., et al., Nuc. Acid. Res. 11:687-706 (1983); 1983, Lau, Y. F., et al., Mol. Cell. Biol. 4:1469-1475 (1984); Kaufman, R. J., "Selection and coamplification of heterologous genes in mammalian cells," in Methods in Enzymology, vol. 185, pp 537-566. Academic Press, Inc., San Diego Calif. (1991)}, and expression in plant cells {plant cloning vectors, Clontech Laboratories, Inc., Palo Alto, Calif., and Pharmacia LKB Biotechnology, Inc., Pistcataway, N.J.; Hood, E., et al., J. Bacterial. 168:1291-1301 (1986); Nagel, R., et al., FEMS Microbiol. Lett. 67:325 (1990); An, et al., "Binary Vectors", and others in Plant Molecular Biology Manual A3:1-19 (1988); Miki, B. L. A., et al., pp. 249-265, and others in Plant DNA Infectious Agents (Hohn, T., et al., eds.) Springer-Verlag, Wien, Austria, (1987); Plant Molecular Biology: Essential Techniques, P. G. Jones and J. M. Sutton, New York, J. Wiley, 1997; Miglani, Gurbachan Dictionary of Plant Genetics and Molecular Biology, New York, Food Products Press, 1998; Henry, R. J., Practical Applications of Plant Molecular Biology, New York, Chapman & Hall, 1997).
[0246]Also included in the invention is an expression vector, containing coding sequences and expression control elements which allow expression of the coding regions in a suitable host. The control elements generally include a promoter, translation initiation codon, and translation and transcription termination sequences, and an insertion site for introducing the insert into the vector. Translational control elements have been reviewed by M. Kozak (e.g., Kozak, M., Mamm. Genome 7(8):563-574, 1996; Kozak, M., Biochimie 76(9):815-821, 1994; Kozak, M., J Cell Biol 108(2):229-241, 1989; Kozak, M., and Shatkin, A. J., Methods Enzymol 60:360-375, 1979).
[0247]Expression in yeast systems has the advantage of commercial production. Recombinant protein production by vaccinia and CHO cell line have the advantage of being mammalian expression systems. Further, vaccinia virus expression has several advantages including the following: (i) its wide host range; (ii) faithful post-transcriptional modification, processing, folding, transport, secretion, and assembly of recombinant proteins; (iii) high level expression of relatively soluble recombinant proteins; and (iv) a large capacity to accommodate foreign DNA.
[0248]The recombinantly expressed polypeptides from synthetic HIV polypeptide-encoding expression cassettes are typically isolated from lysed cells or culture media. Purification can be carried out by methods known in the art including salt fractionation, ion exchange chromatography, gel filtration, size-exclusion chromatography, size-fractionation, and affinity chromatography. Immunoaffinity chromatography can be employed using antibodies generated based on, for example, HIV antigens.
[0249]Advantages of expressing the proteins of the present invention using mammalian cells include, but are not limited to, the following: well-established protocols for scale-up production; the ability to produce VLPs; cell lines are suitable to meet good manufacturing process (GMP) standards; culture conditions for mammalian cells are known in the art.
[0250]Various forms of the different embodiments of the invention, described herein, may be combined.
[0251]2.3 Production of Virus-Like Particles and Use of the Constructs of the Present Invention to Create Packaging Cell Lines.
[0252]The group-specific antigens (Gag) of human immunodeficiency virus type-1 (HIV-1) self-assemble into noninfectious virus-like particles (VLP) that are released from various eucaryotic cells by budding (reviewed by Freed, E. O., Virology 251:1-15, 1998). The synthetic expression cassettes of the present invention provide efficient means for the production of HIV-Gag virus-like particles (VLPs) using a variety of different cell types, including, but not limited to, mammalian cells.
[0253]Viral particles can be used as a matrix for the proper presentation of an antigen entrapped or associated therewith to the immune system of the host.
[0254]2.3.1 VLP Production Using the Synthetic Expression Cassettes of the Present Invention
[0255]Experiments can be performed in support of the present invention to demonstrate that the synthetic expression cassettes of the present invention provide superior production of both Gag proteins and VLPs, relative to native Gag coding sequences. Further, electron microscopic evaluation of VLP production can show that free and budding immature virus particles of the expected size are produced by cells containing the synthetic expression cassettes.
[0256]Using the synthetic expression cassettes of the present invention, rather than native Gag coding sequences, for the production of virus-like particles provide several advantages. First, VLPs can be produced in enhanced quantity making isolation and purification of the VLPs easier. Second, VLPs can be produced in a variety of cell types using the synthetic expression cassettes, in particular, mammalian cell lines can be used for VLP production, for example, CHO cells. Production using CHO cells provides (i) VLP formation; (ii) correct myristoylation and budding; (iii) absence of non-mammalian cell contaminants (e.g., insect viruses and/or cells); and (iv) ease of purification. The synthetic expression cassettes of the present invention are also useful for enhanced expression in cell-types other than mammalian cell lines. For example, infection of insect cells with baculovirus vectors encoding the synthetic expression cassettes results in higher levels of total Gag protein yield and higher levels of VLP production (relative to wild-type coding sequences). Further, the final product from insect cells infected with the baculovirus-Gag synthetic expression cassettes consistently contains lower amounts of contaminating insect proteins than the final product when wild-type coding sequences are used.
[0257]VLPs can spontaneously form when the particle-forming polypeptide of interest is recombinantly expressed in an appropriate host cell. Thus, the VLPs produced using the synthetic expression cassettes of the present invention are conveniently prepared using recombinant techniques. As discussed below, the Gag polypeptide encoding synthetic expression cassettes of the present invention can include other polypeptide coding sequences of interest (for example, HIV protease, HIV polymerase, HCV core; Env; synthetic Env; see, Example 1). Expression of such synthetic expression cassettes yields VLPs comprising the Gag polypeptide, as well as, the polypeptide of interest.
[0258]Once coding sequences for the desired particle-forming polypeptides have been isolated or synthesized, they can be cloned into any suitable vector or replicon for expression. Numerous cloning vectors are known to those of skill in the art, and the selection of an appropriate cloning vector is a matter of choice. See, generally, Sambrook et al, supra. The vector is then used to transform an appropriate host cell. Suitable recombinant expression systems include, but are not limited to, bacterial, mammalian, baculovirus/insect, vaccinia, Semliki Forest virus (SFV), Alphaviruses (such as, Sindbis, Venezuelan Equine Encephalitis (VEE)), mammalian, yeast and Xenopus expression systems, well known in the art. Particularly preferred expression systems are mammalian cell lines, vaccinia, Sindbis, insect and yeast systems.
[0259]For example, a number of mammalian cell lines are known in the art and include immortalized cell lines available from the American Type Culture Collection (A.T.C.C.), such as, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), as well as others. Similarly, bacterial hosts such as E. coli, Bacillus subtilis, and Streptococcus spp., will find use with the present expression constructs. Yeast hosts useful in the present invention include inter alia, Saccharomyces cerevisiae, Candida albicans, Candida maltosa, Hansenula polymorpha, Kluyveromyces fragilis, Kluyveromyces lactis, Pichia guillerimondii, Pichia pastoris, Schizosaccharomyces pombe and Yarrowia lipolytica. Insect cells for use with baculovirus expression vectors include, inter alia, Aedes aegypti, Autographa californica, Bombyx mori, Drosophila melanogaster, Spodoptera frugiperda, and Trichoplusia ni. See, e.g., Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987).
[0260]Viral vectors can be used for the production of particles in eucaryotic cells, such as those derived from the pox family of viruses, including vaccinia virus and avian poxvirus. Additionally, a vaccinia based infection/transfection system, as described in Tomei et al., J. Virol. (1993) 67:4017-4026 and Selby et al., J. Gen. Virol. (1993) 74:1103-1113, will also find use with the present invention. In this system, cells are first infected in vitro with a vaccinia virus recombinant that encodes the bacteriophage T7 RNA polymerase. This polymerase displays exquisite specificity in that it only transcribes templates bearing T7 promoters. Following infection, cells are transfected with the DNA of interest, driven by a T7 promoter. The polymerase expressed in the cytoplasm from the vaccinia virus recombinant transcribes the transfected DNA into RNA which is then translated into protein by the host translational machinery. Alternately, T7 can be added as a purified protein or enzyme as in the "Progenitor" system (Studier and Moffatt, J. Mol. Biol. (1986) 189:113-130). The method provides for high level, transient, cytoplasmic production of large quantities of RNA and its translation product(s).
[0261]Depending on the expression system and host selected, the VLPS are produced by growing host cells transformed by an expression vector under conditions whereby the particle-forming polypeptide is expressed and VLPs can be formed. The selection of the appropriate growth conditions is within the skill of the art. If the VLPs are formed intracellularly, the cells are then disrupted, using chemical, physical or mechanical means, which lyse the cells yet keep the VLPs substantially intact. Such methods are known to those of skill in the art and are described in, e.g., Protein Purification Applications: A Practical Approach, (E. L. V. Harris and S. Angal, Eds., 1990).
[0262]The particles are then isolated (or substantially purified) using methods that preserve the integrity thereof, such as, by gradient centrifugation, e.g., cesium chloride (CsCl) sucrose gradients, pelleting and the like (see, e.g., Kirnbauer et al. J. Virol. (1993) 67:6929-6936), as well as standard purification techniques including, e.g., ion exchange and gel filtration chromatography.
[0263]VLPs produced by cells containing the synthetic expression cassettes of the present invention can be used to elicit an immune response when administered to a subject. One advantage of the present invention is that VLPs can be produced by mammalian cells carrying the synthetic expression cassettes at levels previously not possible. As discussed above, the VLPs can comprise a variety of antigens in addition to the Gag polypeptide (e.g., Gag-protease, Gag-polymerase, Env, synthetic Env, etc.). Purified VLPs, produced using the synthetic expression cassettes of the present invention, can be administered to a vertebrate subject, usually in the form of vaccine compositions. Combination vaccines may also be used, where such vaccines contain, for example, an adjuvant subunit protein (e.g., Env). Administration can take place using the VLPs formulated alone or formulated with other antigens. Further, the VLPs can be administered prior to, concurrent with, or subsequent to, delivery of the synthetic expression cassettes for DNA immunization (see below) and/or delivery of other vaccines. Also, the site of VLP administration may be the same or different as other vaccine compositions that are being administered. Gene delivery can be accomplished by a number of methods including, but are not limited to, immunization with DNA, alphavirus vectors, pox virus vectors, and vaccinia virus vectors.
[0264]VLP immune-stimulating (or vaccine) compositions can include various excipients, adjuvants, carriers, auxiliary substances, modulating agents, and the like. The immune stimulating compositions will include an amount of the VLP/antigen sufficient to mount an immunological response. An appropriate effective amount can be determined by one of skill in the art. Such an amount will fall in a relatively broad range that can be determined through routine trials and will generally be an amount on the order of about 0.1 μg to about 1000 μg, more preferably about 1 μg to about 300 μg, of VLP/antigen.
[0265]A carrier is optionally present which is a molecule that does not itself induce the production of antibodies harmful to the individual receiving the composition. Suitable carriers are typically large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, lipid aggregates (such as oil droplets or liposomes), and inactive virus particles. Examples of particulate carriers include those derived from polymethyl methacrylate polymers, as well as microparticles derived from poly(lactides) and poly(lactide-co-glycolides), known as PLG. See, e.g., Jeffery et al., Pharm. Res. (1993) 10:362-368; McGee J P, et al., J. Microencapsul. 14(2):197-210, 1997; O'Hagan D T, et al., Vaccine 11(2):149-54, 1993. Such carriers are well known to those of ordinary skill in the art. Additionally, these carriers may function as immunostimulating agents ("adjuvants"). Furthermore, the antigen may be conjugated to a bacterial toxoid, such as toxoid from diphtheria, tetanus, cholera, etc., as well as toxins derived from E. coli.
[0266]Adjuvants may also be used to enhance the effectiveness of the compositions. Such adjuvants include, but are not limited to: (1) aluminum salts (alum), such as aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc.; (2) oil-in-water emulsion formulations (with or without other specific immunostimulating agents such as muramyl peptides (see below) or bacterial cell wall components), such as for example (a) MF59 (International Publication No. WO 90/14837), containing 5% Squalene, 0.5% Tween 80, and 0.5% Span 85 (optionally containing various amounts of MTP-PE (see below), although not required) formulated into submicron particles using a microfluidizer such as Model 110Y microfluidizer (Microfluidics, Newton, Mass.), (b) SAF, containing 10% Squalane, 0.4% Tween 80, 5% pluronic-blocked polymer L121, and thr-MDP (see below) either microfluidized into a submicron emulsion or vortexed to generate a larger particle size emulsion, and (c) Ribi® adjuvant system (RAS), (Ribi Immunochem, Hamilton, Mont.) containing 2% Squalene, 0.2% Tween 80, and one or more bacterial cell wall components from the group consisting of monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL+CWS (Detox®); (3) saponin adjuvants, such as Stimulon® (Cambridge Bioscience, Worcester, Mass.) may be used or particle generated therefrom such as ISCOMs (immunostimulating complexes); (4) Complete Freunds Adjuvant (CFA) and Incomplete Freunds Adjuvant (IFA); (5) cytokines, such as interleukins (IL-1, IL-2, etc.), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (TNF), etc.; (6) oligonucleotides or polymeric molecules encoding immunostimulatory CpG mofifs (Davis, H. L., et al., J. Immunology 160:870-876, 1998; Sato, Y. et al., Science 273:352-354, 1996) or complexes of antigens/oligonucleotides {Polymeric molecules include double and single stranded RNA and DNA, and backbone modifications thereof, for example, methylphosphonate linkages; or (7) detoxified mutants of a bacterial ADP-ribosylating toxin such as a cholera toxin (CT), a pertussis toxin (PT), or an E. coli heat-labile toxin (LT), particularly LT-K63 (where lysine is substituted for the wild-type amino acid at position 63) LT-R72 (where arginine is substituted for the wild-type amino acid at position 72), CT-S109 (where serine is substituted for the wild-type amino acid at position 109), and PT-K9/G129 (where lysine is substituted for the wild-type amino acid at position 9 and glycine substituted at position 129) (see, e.g., International Publication Nos. WO93/13202 and WO92/19265); and (8) other substances that act as immunostimulating agents to enhance the effectiveness of the composition. Further, such polymeric molecules include alternative polymer backbone structures such as, but not limited to, polyvinyl backbones (Pitha, Biochem Biophys Acta, 204:39, 1970a; Pitha, Biopolymers, 9: 965, 1970b), and morpholino backbones (Summerton, J., et al., U.S. Pat. No. 5,142,047, issued Aug. 25, 1992; Summerton, J., et al., U.S. Pat. No. 5,185,444 issued Feb. 9, 1993). A variety of other charged and uncharged polynucleotide analogs have been reported. Numerous backbone modifications are known in the art, including, but not limited to, uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, and carbamates) and charged linkages (e.g., phosphorothioates and phosphorodithioates).}; and (7) other substances that act as immunostimulating agents to enhance the effectiveness of the VLP immune-stimulating (or vaccine) composition. Alum, CpG oligonucleotides, and MF59 are preferred.
[0267]Muramyl peptides include, but are not limited to, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-normuramyl-L-alanyl-D-isoglutame (nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(P-2'-dipalmitoyl-sn- -glycero-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE), etc.
[0268]Dosage treatment with the VLP composition may be a single dose schedule or a multiple dose schedule. A multiple dose schedule is one in which a primary course of vaccination may be with 1-10 separate doses, followed by other doses given at subsequent time intervals, chosen to maintain and/or reinforce the immune response, for example at 1-4 months for a second dose, and if needed, a subsequent dose(s) after several months. The dosage regimen will also, at least in part, be determined by the need of the subject and be dependent on the judgment of the practitioner.
[0269]If prevention of disease is desired, the antigen carrying VLPs are generally administered prior to primary infection with the pathogen of interest. If treatment is desired, e.g., the reduction of symptoms or recurrences, the VLP compositions are generally administered subsequent to primary infection.
[0270]2.3.2 Using the Synthetic Expression Cassettes of the Present Invention to Create Packaging Cell Lines
[0271]A number of viral based systems have been developed for use as gene transfer vectors for mammalian host cells. For example, retroviruses (in particular, lentiviral vectors) provide a convenient platform for gene delivery systems. A coding sequence of interest (for example, a sequence useful for gene therapy applications) can be inserted into a gene delivery vector and packaged in retroviral particles using techniques known in the art. Recombinant virus can then be isolated and delivered to cells of the subject either in vivo or ex vivo. A number of retroviral systems have been described, including, for example, the following: (U.S. Pat. No. 5,219,740; Miller et al. (1989) BioTechniques 7:980; Miller, A. D. (1990) Human Gene Therapy 1:5; Scarpa et al. (1991) Virology 180:849; Burns et al. (1993) Proc. Natl. Acad. Sci. USA 90:8033; Boris-Lawrie et al. (1993) Cur. Opin. Genet. Develop. 3:102; GB 2200651; EP 0415731; EP 0345242; WO 89/02468; WO 89/05349; WO 89/09271; WO 90/02806; WO 90/07936; WO 90/07936; WO 94/03622; WO 93/25698; WO 93/25234; WO 93/11230; WO 93/10218; WO 91/02805; in U.S. Pat. No. 5,219,740; U.S. Pat. No. 4,405,712; U.S. Pat. No. 4,861,719; U.S. Pat. No. 4,980,289 and U.S. Pat. No. 4,777,127; in U.S. Ser. No. 07/800,921; and in Vile (1993) Cancer Res 53:3860-3864; Vile (1993) Cancer Res 53:962-967; Ram (1993) Cancer Res 53:83-88; Takamiya (1992) J Neurosci Res 33:493-503; Baba (1993) J Neurosurg 79:729-735; Mann (1983) Cell 33:153; Cane (1984) Proc Natl Acad Sci USA 81; 6349; and Miller (1990) Human Gene Therapy 1.
[0272]In other embodiments, gene transfer vectors can be constructed to encode a cytokine or other immunomodulatory molecule. For example, nucleic acid sequences encoding native IL-2 and gamma-interferon can be obtained as described in U.S. Pat. Nos. 4,738,927 and 5,326,859, respectively, while useful muteins of these proteins can be obtained as described in U.S. Pat. No. 4,853,332. Nucleic acid sequences encoding the short and long forms of mCSF can be obtained as described in U.S. Pat. Nos. 4,847,201 and 4,879,227, respectively. In particular aspects of the invention, retroviral vectors expressing cytokine or immunomodulatory genes can be produced as described herein (for example, employing the packaging cell lines of the present invention) and in International Application No. PCT US 94/02951, entitled "Compositions and Methods for Cancer Immunotherapy."
[0273]Examples of suitable immunomodulatory molecules for use herein include the following: IL-1 and IL-2 (Karupiah et al. (1990) J. Immunology 144:290-298, Weber et al. (1987) J. Exp. Med. 166:1716-1733, Gansbacher et al. (1990) J. Exp. Med. 172:1217-1224, and U.S. Pat. No. 4,738,927); IL-3 and IL-4 (Tepper et al. (1989) Cell 57:503-512, Golumbek et al. (1991) Science 254:713-716, and U.S. Pat. No. 5,017,691); IL-5 and IL-6 (Brakenhof et al. (1987) J. Immunol. 139:4116-4121, and International Publication No. WO 90/06370); IL-7 (U.S. Pat. No. 4,965,195); IL-8, IL-9, IL-10, IL-11, IL-12, and IL-13 (Cytokine Bulletin, Summer 1994); IL-14 and IL-15; alpha interferon (Finter et al. (1991) Drugs 42:749-765, U.S. Pat. Nos. 4,892,743 and 4,966,843, International Publication No. WO 85/02862, Nagata et al. (1980) Nature 284:316-320, Familletti et al. (1981) Methods in Enz. 78:387-394, Twu et al. (1989) Proc. Natl. Acad. Sci. USA 86:2046-2050, and Faktor et al. (1990) Oncogene 5:867-872); beta-interferon (Seif et al. (1991) J. Virol. 65:664-671); gamma-interferons (Radford et al. (1991) The American Society of Hepatology 20082015, Watanabe et al. (1989) Proc. Natl. Acad. Sci. USA 86:9456-9460, Gansbacher et al. (1990) Cancer Research 50:7820-7825, Maio et al. (1989) Can. Immunol. Immunother. 30:34-42, and U.S. Pat. Nos. 4,762,791 and 4,727,138); G-CSF (U.S. Pat. Nos. 4,999,291 and 4,810,643); GM-CSF (International Publication No. WO 85/04188).
[0274]Immunomodulatory factors may also be agonists, antagonists, or ligands for these molecules. For example, soluble forms of receptors can often behave as antagonists for these types of factors, as can mutated forms of the factors themselves.
[0275]Nucleic acid molecules that encode the above-described substances, as well as other nucleic acid molecules that are advantageous for use within the present invention, may be readily obtained from a variety of sources, including, for example, depositories such as the American Type Culture Collection, or from commercial sources such as British Bio-Technology Limited (Cowley, Oxford England). Representative examples include BBG 12 (containing the GM-CSF gene coding for the mature protein of 127 amino acids), BBG 6 (which contains sequences encoding gamma interferon), A.T.C.C. Deposit No. 39656 (which contains sequences encoding TNF), A.T.C.C. Deposit No. 20663 (which contains sequences encoding alpha-interferon), A.T.C.C. Deposit Nos. 31902, 31902 and 39517 (which contain sequences encoding beta-interferon), A.T.C.C. Deposit No. 67024 (which contains a sequence which encodes Interleukin-1b), A.T.C.C. Deposit Nos. 39405, 39452, 39516, 39626 and 39673 (which contain sequences encoding Interleukin-2), A.T.C.C. Deposit Nos. 59399, 59398, and 67326 (which contain sequences encoding Interleukin-3), A.T.C.C. Deposit No. 57592 (which contains sequences encoding Interleukin-4), A.T.C.C. Deposit Nos. 59394 and 59395 (which contain sequences encoding Interleukin-5), and A.T.C.C. Deposit No. 67153 (which contains sequences encoding Interleukin-6).
[0276]Plasmids containing cytokine genes or immunomodulatory genes (International Publication Nos. WO 94/02951 and WO 96/21015, both of which are incorporated by reference in their entirety) can be digested with appropriate restriction enzymes, and DNA fragments containing the particular gene of interest can be inserted into a gene transfer vector using standard molecular biology techniques. (See, e.g., Sambrook et al., supra., or Ausbel et al. (eds) Current Protocols in Molecular Biology, Greene Publishing and Wiley-Interscience).
[0277]Polynucleotide sequences coding for the above-described molecules can be obtained using recombinant methods, such as by screening cDNA and genomic libraries from cells expressing the gene, or by deriving the gene from a vector known to include the same. For example, plasmids which contain sequences that encode altered cellular products may be obtained from a depository such as the A.T.C.C., or from commercial sources. Plasmids containing the nucleotide sequences of interest can be digested with appropriate restriction enzymes, and DNA fragments containing the nucleotide sequences can be inserted into a gene transfer vector using standard molecular biology techniques.
[0278]Alternatively, cDNA sequences for use with the present invention may be obtained from cells which express or contain the sequences, using standard techniques, such as phenol extraction and PCR of cDNA or genomic DNA. See, e.g., Sambrook et al., supra, for a description of techniques used to obtain and isolate DNA. Briefly, mRNA from a cell which expresses the gene of interest can be reverse transcribed with reverse transcriptase using oligo-dT or random primers. The single stranded cDNA may then be amplified by PCR (see U.S. Pat. Nos. 4,683,202, 4,683,195 and 4,800,159, see also PCR Technology: Principles and Applications for DNA Amplification, Erlich (ed.), Stockton Press, 1989)) using oligonucleotide primers complementary to sequences on either side of desired sequences.
[0279]The nucleotide sequence of interest can also be produced synthetically, rather than cloned, using a DNA synthesizer (e.g., an Applied Biosystems Model 392 DNA Synthesizer, available from ABI, Foster City, Calif.). The nucleotide sequence can be designed with the appropriate codons for the expression product desired. The complete sequence is assembled from overlapping oligonucleotides prepared by standard methods and assembled into a complete coding sequence. See, e.g., Edge (1981) Nature 292:756; Nambair et al. (1984) Science 223:1299; Jay et al. (1984) J. Biol. Chem. 259:6311.
[0280]The synthetic expression cassettes of the present invention can be employed in the construction of packaging cell lines for use with retroviral vectors.
[0281]One type of retrovirus, the murine leukemia virus, or "MLV", has been widely utilized for gene therapy applications (see generally Mann et al. (Cell 33:153, 1993), Cane and Mulligan (Prot, Nat'l. Acad. Sci. USA 81:6349, 1984), and Miller et al., Human Gene Therapy 1:5-14; 1990.
[0282]Lentiviral vectors typically, comprise a 5' lentiviral LTR, a tRNA binding site, a packaging signal, a promoter operably linked to one or more genes of interest, an origin of second strand DNA synthesis and a 3' lentiviral LTR, wherein the lentiviral vector contains a nuclear transport element. The nuclear transport element may be located either upstream (5') or downstream (3') of a coding sequence of interest (for example, a synthetic Gag or Env expression cassette of the present invention). Within certain embodiments, the nuclear transport element is not RRE. Within one embodiment the packaging signal is an extended packaging signal. Within other embodiments the promoter is a tissue specific promoter, or, alternatively, a promoter such as CMV. Within other embodiments, the lentiviral vector further comprises an internal ribosome entry site.
[0283]A wide variety of lentiviruses may be utilized within the context of the present invention, including for example, lentiviruses selected from the group consisting of HIV, HIV-1, HIV-2, FIV and SIV.
[0284]In one embodiment of the present invention synthetic Gag-polymerase expression cassettes are provided comprising a promoter and a sequence encoding synthetic Gag-polymerase and at least one of vpr, vpu, nef or vif, wherein the promoter is operably linked to Gag-polymerase and vpr, vpu, nef or vif.
[0285]Within yet another aspect of the invention, host cells (e.g., packaging cell lines) are provided which contain any of the expression cassettes described herein. For example, within one aspect packaging cell line are provided comprising an expression cassette that comprises a sequence encoding synthetic Gag-polymerase, and a nuclear transport element, wherein the promoter is operably linked to the sequence encoding Gag-polymerase. Packaging cell lines may further comprise a promoter and a sequence encoding tat, rev, or an envelope, wherein the promoter is operably linked to the sequence encoding tat, rev, Env or sequences encoding modified versions of these proteins. The packaging cell line may further comprise a sequence encoding any one or more of nef, vif, vpu or vpr (wild-type or synthetic).
[0286]In one embodiment, the expression cassette (carrying, for example, the synthetic Gag-polymerase) is stably integrated. The packaging cell line, upon introduction of a lentiviral vector, typically produces particles. The promoter regulating expression of the synthetic expression cassette may be inducible. Typically, the packaging cell line, upon introduction of a lentiviral vector, produces particles that are essentially free of replication competent virus.
[0287]Packaging cell lines are provided comprising an expression cassette which directs the expression of a synthetic Gag-polymerase gene or comprising an expression cassette which directs the expression of a synthetic Env genes described herein. (See, also, Andre, S., et al., Journal of Virology 72(2):1497-1503, 1998; Haas, J., et al., Current Biology 6(3):315-324, 1996) for a description of other modified Env sequences). A lentiviral vector is introduced into the packaging cell line to produce a vector producing cell line.
[0288]As noted above, lentiviral vectors can be designed to carry or express a selected gene(s) or sequences of interest. Lentiviral vectors may be readily constructed from a wide variety of lentiviruses (see RNA Tumor Viruses, Second Edition, Cold Spring Harbor Laboratory, 1985). Representative examples of lentiviruses included HIV, HIV-1, HIV-2, FIV and SIV. Such lentiviruses may either be obtained from patient isolates, or, more preferably, from depositories or collections such as the American Type Culture Collection, or isolated from known sources using available techniques.
[0289]Portions of the lentiviral gene delivery vectors (or vehicles) may be derived from different viruses. For example, in a given recombinant lentiviral vector, LTRs may be derived from an HIV, a packaging signal from SW, and an origin of second strand synthesis from HrV-2. Lentiviral vector constructs may comprise a 5' lentiviral LTR, a tRNA binding site, a packaging signal, one or more heterologous sequences, an origin of second strand DNA synthesis and a 3' LTR, wherein said lentiviral vector contains a nuclear transport element that is not RRE.
[0290]Briefly, Long Terminal Repeats ("LTRs") are subdivided into three elements, designated U5, R and U3. These elements contain a variety of signals which are responsible for the biological activity of a retrovirus, including for example, promoter and enhancer elements which are located within U3. LTRs may be readily identified in the provirus (integrated DNA form) due to their precise duplication at either end of the genome. As utilized herein, a 5' LTR should be understood to include a 5' promoter element and sufficient LTR sequence to allow reverse transcription and integration of the DNA form of the vector. The 3' LTR should be understood to include a polyadenylation signal, and sufficient LTR sequence to allow reverse transcription and integration of the DNA form of the vector.
[0291]The tRNA binding site and origin of second strand DNA synthesis are also important for a retrovirus to be biologically active, and may be readily identified by one of skill in the art. For example, retroviral tRNA binds to a tRNA binding site by Watson-Crick base pairing, and is carried with the retrovirus genome into a viral particle. The tRNA is then utilized as a primer for DNA synthesis by reverse transcriptase. The tRNA binding site may be readily identified based upon its location just downstream from the 5'LTR. Similarly, the origin of second strand DNA synthesis is, as its name implies, important for the second strand DNA synthesis of a retrovirus. This region, which is also referred to as the poly-purine tract, is located just upstream of the 3'LTR.
[0292]In addition to a 5' and 3' LTR, tRNA binding site, and origin of second strand DNA synthesis, recombinant retroviral vector constructs may also comprise a packaging signal, as well as one or more genes or coding sequences of interest. In addition, the lentiviral vectors have a nuclear transport element which, in preferred embodiments is not RRE. Representative examples of suitable nuclear transport elements include the element in Rous sarcoma virus (Ogert, et al., J. Virol. 70, 3834-3843, 1996), the element in Rous sarcoma virus (Liu & Mertz, Genes & Dev., 9, 1766-1789, 1995) and the element in the genome of simian retrovirus type I (Zolotukhin, et al., J. Virol. 68, 7944-7952, 1994). Other potential elements include the elements in the histone gene (Kedes, Annu. Rev. Biochem. 48, 837-870, 1970), the α-interferon gene (Nagata et al., Nature 287, 401-408, 1980), the β-adrenergic receptor gene (Koilka, et al., Nature 329, 75-79, 1987), and the c-Jun gene (Hattorie, et al., Proc. Natl. Acad. Sci. USA 85, 9148-9152, 1988).
[0293]Recombinant lentiviral vector constructs typically lack both Gag-polymerase and Env coding sequences. Recombinant lentiviral vector typically contain less than 20, preferably 15, more preferably 10, and most preferably 8 consecutive nucleotides found in Gag polymerase and Env genes. One advantage of the present invention is that the synthetic Gag-polymerase expression cassettes, which can be used to construct packaging cell lines for the recombinant retroviral vector constructs, have little homology to wild-type Gag-polymerase sequences and thus considerably reduce or eliminate the possibility of homologous recombination between the synthetic and wild-type sequences.
[0294]Lentiviral vectors may also include tissue-specific promoters to drive expression of one or more genes or sequences of interest.
[0295]Lentiviral vector constructs may be generated such that more than one gene of interest is expressed. This may be accomplished through the use of di- or oligo-cistronic cassettes (e.g., where the coding regions are separated by 80 nucleotides or less, see generally Levin et al., Gene 108:167-174, 1991), or through the use of Internal Ribosome Entry Sites ("IRES").
[0296]Packaging cell lines suitable for use with the above described recombinant retroviral vector constructs may be readily prepared given the disclosure provided herein. Briefly, the parent cell line from which the packaging cell line is derived can be selected from a variety of mammalian cell lines, including for example, 293, RD, COS-7, CHO, BHK, VERO, HT1080, and myeloma cells.
[0297]After selection of a suitable host cell for the generation of a packaging cell line, one or more expression cassettes are introduced into the cell line in order to complement or supply in trans components of the vector which have been deleted.
[0298]Representative examples of suitable expression cassettes have been described herein and include synthetic Env, synthetic Gag, synthetic Gag-protease, and synthetic Gag-polymerase expression cassettes, which comprise a promoter and a sequence encoding, e.g., Gag-polymerase and at least one of vpr, vpu, nef or vif, wherein the promoter is operably linked to Gag-polymerase and vpr, vpu, nef or vif. As described above, the native and/or synthetic coding sequences may also be utilized in these expression cassettes.
[0299]Utilizing the above-described expression cassettes, a wide variety of packaging cell lines can be generated. For example, within one aspect packaging cell line are provided comprising an expression cassette that comprises a sequence encoding synthetic Gag-polymerase, and a nuclear transport element, wherein the promoter is operably linked to the sequence encoding Gag-polymerase. Within other aspects, packaging cell lines are provided comprising a promoter and a sequence encoding tat, rev, Env, or other HIV antigens or epitopes derived therefrom, wherein the promoter is operably linked to the sequence encoding tat, rev, Env, or the HIV antigen or epitope. Within further embodiments, the packaging cell line may comprise a sequence encoding any one or more of nef, vif, vpu or vpr. For example, the packaging cell line may contain only nef, vif, vpu, or vpr alone, nef and vif, nef and vpu, nef and vpr, vif and vpu, vif and vpr, vpu and vpr, nef vif and vpu, nef vif and vpr, nef vpu and vpr, vvir vpu and vpr, or, all four of nef, vif, vpu, and vpr.
[0300]In one embodiment, the expression cassette is stably integrated. Within another embodiment, the packaging cell line, upon introduction of a lentiviral vector, produces particles. Within further embodiments the promoter is inducible. Within certain preferred embodiments of the invention, the packaging cell line, upon introduction of a lentiviral vector, produces particles that are free of replication competent virus.
[0301]The synthetic cassettes containing modified coding sequences are transfected into a selected cell line. Transfected cells are selected that (i) carry, typically, integrated, stable copies of the HIV coding sequences, and (ii) are expressing acceptable levels of these polypeptides (expression can be evaluated by methods known in the prior art, e.g., see Examples 1-4). The ability of the cell line to produce VLPs may also be verified.
[0302]A sequence of interest is constructed into a suitable viral vector as discussed above. This defective virus is then transfected into the packaging cell line. The packaging cell line provides the viral functions necessary for producing virus-like particles into which the defective viral genome, containing the sequence of interest, are packaged. These VLPs are then isolated and can be used, for example, in gene delivery or gene therapy.
[0303]Further, such packaging cell lines can also be used to produce VLPs alone, which can, for example, be used as adjuvants for administration with other antigens or in vaccine compositions. Also, co-expression of a selected sequence of interest encoding a polypeptide (for example, an antigen) in the packaging cell line can also result in the entrapment and/or association of the selected polypeptide in/with the VLPs.
[0304]Various forms of the different embodiments of the present invention (e.g., constructs) may be combined.
[0305]2.4 DNA Immunization and Gene Delivery
[0306]A variety of HIV polypeptide antigens, particularly Type C HIV antigens, can be used in the practice of the present invention. HIV antigens can be included in DNA immunization constructs containing, for example, a synthetic Gag expression cassette fused in-frame to a coding sequence for the polypeptide antigen (synthetic or wild-type), where expression of the construct results in VLPs presenting the antigen of interest.
[0307]HIV antigens of particular interest to be used in the practice of the present invention include tat, rev, nef, vif, vpu, vpr, and other HIV antigens or epitopes derived therefrom. These antigens may be synthetic (as described herein) or wild-type. Further, the packaging cell line may contain only nef, and HIV-1 (also known as HTLV-III, LAV, ARV, etc.), including, but not limited to, antigens such as gp120, gp41, gp160 (both native and modified); Gag; and pol from a variety of isolates including, but not limited to, HIVIIIb, HIVSF2, HIV-1.sub.SF162, HIV-1.sub.SF170, HIVLAV, HIVLAI, HIVMN, HIV-1.sub.CM235, HIV-1US4, other HIV-1 strains from diverse subtypes (e.g., subtypes, A through G, and O), HIV-2 strains and diverse subtypes (e.g., HIV-2UC1 and HIV-2UC2). See, e.g., Myers, et al., Los Alamos Database, Los Alamos National Laboratory, Los Alamos, N. Mex.; Myers, et al., Human Retroviruses and Aids, 1990, Los Alamos, N. Mex.: Los Alamos National Laboratory.
[0308]To evaluate efficacy, DNA immunization using synthetic expression cassettes of the present invention can be performed, for instance as described in Example 4. Mice are immunized with both the Gag (and/or Env) synthetic expression cassette and the Gag (and/or Env) wild type expression cassette. Mouse immunizations with plasmid-DNAs will show that the synthetic expression cassettes provide a clear improvement of immunogenicity relative to the native expression cassettes. Also, the second boost immunization will induce a secondary immune response, for example, after approximately two weeks. Further, the results of CTL assays will show increased potency of synthetic Gag (and/or Env) expression cassettes for induction of cytotoxic T-lymphocyte (CTL) responses by DNA immunization.
[0309]It is readily apparent that the subject invention can be used to mount an immune response to a wide variety of antigens and hence to treat or prevent a HIV infection, particularly Type C HIV infection.
[0310]2.4.1 Delivery of the Synthetic Expression Cassettes of the Present Invention
[0311]Polynucleotide sequences coding for the above-described molecules can be obtained using recombinant methods, such as by screening cDNA and genomic libraries from cells expressing the gene, or by deriving the gene from a vector known to include the same. Furthermore, the desired gene can be isolated directly from cells and tissues containing the same, using standard techniques, such as phenol extraction and PCR of cDNA or genomic DNA. See, e.g., Sambrook et al., supra, for a description of techniques used to obtain and isolate DNA. The gene of interest can also be produced synthetically, rather than cloned. The nucleotide sequence can be designed with the appropriate codons for the particular amino acid sequence desired. In general, one will select preferred codons for the intended host in which the sequence will be expressed. The complete sequence is assembled from overlapping oligonucleotides prepared by standard methods and assembled into a complete coding sequence. See, e.g., Edge, Nature (1981) 292:756; Nambair et al., Science (1984) 223:1299; Jay et al., J. Biol. Chem. (1984) 259:6311; Stemmer, W. P. C., (1995) Gene 164:49-53.
[0312]Next, the gene sequence encoding the desired antigen can be inserted into a vector containing a synthetic expression cassette of the present invention. In certain embodiments, the antigen is inserted into the synthetic Gag coding sequence such that when the combined sequence is expressed it results in the production of VLPs comprising the Gag polypeptide and the antigen of interest, e.g., Env (native or modified) or other antigen(s) (native or modified) derived from HIV. Insertions can be made within the coding sequence or at either end of the coding sequence (5', amino terminus of the expressed Gag polypeptide; or 3', carboxy terminus of the expressed Gag polypeptide) (Wagner, R., et al., Arch Virol. 127:117-137, 1992; Wagner, R., et al., Virology 200:162-175, 1994; Wu, X., et al., J. Virol. 69(6):3389-3398, 1995; Wang, C-T., et al., Virology 200:524-534, 1994; Chazal, N., et al., Virology 68(1):111-122, 1994; Griffiths, J. C., et al., J. Virol. 67(6):3191-3198, 1993; Reicin, A. S., et al., J. Virol. 69(2):642-650, 1995).
[0313]Up to 50% of the coding sequences of p55Gag can be deleted without affecting the assembly to virus-like particles and expression efficiency (Borsetti, A., et al, J. Virol. 72(11):9313-9317, 1998; Garnier, L., et al., J Virol 72(6):4667-4677, 1998; Zhang, Y., et al., J Virol 72(3):1782-1789, 1998; Wang, C., et al., J Virol 72(10): 7950-7959, 1998). In one embodiment of the present invention, immunogenicity of the high level expressing synthetic Gag expression cassettes can be increased by the insertion of different structural or non-structural HIV antigens, multiepitope cassettes, or cytokine sequences into deleted regions of Gag sequence. Such deletions may be generated following the teachings of the present invention and information available to one of ordinary skill in the art. One possible advantage of this approach, relative to using full-length sequences fused to heterologous polypeptides, can be higher expression/secretion efficiency of the expression product.
[0314]When sequences are added to the amino terminal end of Gag, the polynucleotide can contain coding sequences at the 5' end that encode a signal for addition of a myristic moiety to the Gag-containing polypeptide (e.g., sequences that encode Met-Gly).
[0315]The ability of Gag-containing polypeptide constructs to form VLPs can be empirically determined following the teachings of the present specification.
[0316]The synthetic expression cassettes can also include control elements operably linked to the coding sequence, which allow for the expression of the gene in vivo in the subject species. For example, typical promoters for mammalian cell expression include the SV40 early promoter, a CMV promoter such as the CMV immediate early promoter, the mouse mammary tumor virus LTR promoter, the adenovirus major late promoter (Ad MLP), and the herpes simplex virus promoter, among others. Other nonviral promoters, such as a promoter derived from the murine metallothionein gene, will also find use for mammalian expression. Typically, transcription termination and polyadenylation sequences will also be present, located 3' to the translation stop codon. Preferably, a sequence for optimization of initiation of translation, located 5' to the coding sequence, is also present. Examples of transcription terminator/polyadenylation signals include those derived from SV40, as described in Sambrook et al., supra, as well as a bovine growth hormone terminator sequence.
[0317]Enhancer elements may also be used herein to increase expression levels of the mammalian constructs. Examples include the SV40 early gene enhancer, as described in Dijkema et al., EMBO J. (1985) 4:761, the enhancer/promoter derived from the long terminal repeat (LTR) of the Rous Sarcoma Virus, as described in Gorman et al., Proc. Natl. Acad. Sci. USA (1982b) 79:6777 and elements derived from human CMV, as described in Boshart et al., Cell (1985) 41:521, such as elements included in the CMV intron A sequence.
[0318]Furthermore, plasmids can be constructed which include a chimeric antigen-coding gene sequences, encoding, e.g., multiple antigens/epitopes of interest, for example derived from more than one viral isolate.
[0319]Typically the antigen coding sequences precede or follow the synthetic coding sequence and the chimeric transcription unit will have a single open reading frame encoding both the antigen of interest and the synthetic coding sequences. Alternatively, multi-cistronic cassettes (e.g., bi-cistronic cassettes) can be constructed allowing expression of multiple antigens from a single mRNA using the EMCV IRES, or the like.
[0320]Once complete, the constructs are used for nucleic acid immunization using standard gene delivery protocols. Methods for gene delivery are known in the art. See, e.g., U.S. Pat. Nos. 5,399,346, 5,580,859, 5,589,466. Genes can be delivered either directly to the vertebrate subject or, alternatively, delivered ex vivo, to cells derived from the subject and the cells reimplanted in the subject.
[0321]A number of viral based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. Selected sequences can be inserted into a vector and packaged in retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to cells of the subject either in vivo or ex vivo. A number of retroviral systems have been described (U.S. Pat. No. 5,219,740; Miller and Rosman, BioTechniques (1989) 7:980-990; Miller, A. D., Human Gene Therapy (1990) 1:5-14; Scarpa et al., Virology (1991) 180:849-852; Burns et al., Proc. Natl. Acad. Sci. USA (1993) 90:8033-8037; and Boris-Lawrie and Temin, Cur. Opin. Genet. Develop. (1993) 3:102-109.
[0322]A number of adenovirus vectors have also been described. Unlike retroviruses which integrate into the host genome, adenoviruses persist extrachromosomally thus minimizing the risks associated with insertional mutagenesis (Haj-Ahmad and Graham, J. Virol. (1986) 57:267-274; Bett et al., J. Virol. (1993) 67:5911-5921; Mittereder et al., Human Gene Therapy (1994) 5:717-729; Seth et al., J. Virol. (1994) 68:933-940; Barr et al., Gene Therapy (1994) 1:51-58; Berkner, K. L. BioTechniques (1988) 6:616-629; and Rich et al., Human Gene Therapy (1993) 4:461-476).
[0323]Additionally, various adeno-associated virus (AAV) vector systems have been developed for gene delivery. AAV vectors can be readily constructed using techniques well known in the art. See, e.g., U.S. Pat. Nos. 5,173,414 and 5,139,941; International Publication Nos. WO 92/01070 (published 23 Jan. 1992) and WO 93/03769 (published 4 Mar. 1993); Lebkowski et al., Molec. Cell. Biol. (1988) 8:3988-3996; Vincent et al., Vaccines 90 (1990) (Cold Spring Harbor Laboratory Press); Carter, B. J. Current Opinion in Biotechnology (1992) 3:533-539; Muzyczka, N. Current Topics in Microbial. and Immunol. (1992) 158:97-129; Kotin, R. M. Human Gene Therapy (1994) 5:793-801; Shelling and Smith, Gene Therapy (1994) 1:165-169; and Zhou et al., J. Exp. Med. (1994) 179:1867-1875.
[0324]Another vector system useful for delivering the polynucleotides of the present invention is the enterically administered recombinant poxvirus vaccines described by Small, Jr., P. A., et al. (U.S. Pat. No. 5,676,950, issued Oct. 14, 1997, herein incorporated by reference).
[0325]Additional viral vectors which will find use for delivering the nucleic acid molecules encoding the antigens of interest include those derived from the pox family of viruses, including vaccinia virus and avian poxvirus. By way of example, vaccinia virus recombinants expressing the genes can be constructed as follows. The DNA encoding the particular synthetic HIV subtype C polypeptide coding sequence is first inserted into an appropriate vector so that it is adjacent to a vaccinia promoter and flanking vaccinia DNA sequences, such as the sequence encoding thymidine kinase (TK). This vector is then used to transfect cells which are simultaneously infected with vaccinia. Homologous recombination serves to insert the vaccinia promoter plus the gene encoding the coding sequences of interest into the viral genome. The resulting TK recombinant can be selected by culturing the cells in the presence of 5-bromodeoxyuridine and picking viral plaques resistant thereto.
[0326]Alternatively, avipoxviruses, such as the fowlpox and canarypox viruses, can also be used to deliver the genes. Recombinant avipox viruses, expressing immunogens from mammalian pathogens, are known to confer protective immunity when administered to non-avian species. The use of an avipox vector is particularly desirable in human and other mammalian species since members of the avipox genus can only productively replicate in susceptible avian species and therefore are not infective in mammalian cells. Methods for producing recombinant avipoxviruses are known in the art and employ genetic recombination, as described above with respect to the production of vaccinia viruses. See, e.g., WO 91/12882; WO 89/03429; and WO 92/03545.
[0327]Molecular conjugate vectors, such as the adenovirus chimeric vectors described in Michael et al., J. Biol. Chem. (1993) 268:6866-6869 and Wagner et al., Proc. Natl. Acad. Sci. USA (1992) 89:6099-6103, can also be used for gene delivery.
[0328]Members of the Alphavirus genus, such as, but not limited to, vectors derived from the Sindbis, Semliki Forest, and Venezuelan Equine Encephalitis viruses, will also find use as viral vectors for delivering the polynucleotides of the present invention (for example, a synthetic Gag-polypeptide encoding expression cassette). For a description of Sindbis-virus derived vectors useful for the practice of the instant methods, see, Dubensky et al., J. Virol. (1996) 70:508-519; and International Publication Nos. WO 95/07995 and WO 96/17072; as well as, Dubensky, Jr., T. W., et al., U.S. Pat. No. 5,843,723, issued Dec. 1, 1998, and Dubensky, Jr., T. W., U.S. Pat. No. 5,789,245, issued Aug. 4, 1998, both herein incorporated by reference.
[0329]A vaccinia based infection/transfection system can be conveniently used to provide for inducible, transient expression of the coding sequences of interest in a host cell. In this system, cells are first infected in vitro with a vaccinia virus recombinant that encodes the bacteriophage T7 RNA polymerase. This polymerase displays exquisite specificity in that it only transcribes templates bearing T7 promoters. Following infection, cells are transfected with the polynucleotide of interest, driven by a T7 promoter. The polymerase expressed in the cytoplasm from the vaccinia virus recombinant transcribes the transfected DNA into RNA which is then translated into protein by the host translational machinery. The method provides for high level, transient, cytoplasmic production of large quantities of RNA and its translation products. See, e.g., Elroy-Stein and Moss, Proc. Natl. Acad. Sci. USA (1990) 87:6743-6747; Fuerst et al., Proc. Natl. Acad. Sci. USA (1986) 83:8122-8126.
[0330]As an alternative approach to infection with vaccinia or avipox virus recombinants, or to the delivery of genes using other viral vectors, an amplification system can be used that will lead to high level expression following introduction into host cells. Specifically, a T7 RNA polymerase promoter preceding the coding region for T7 RNA polymerase can be engineered. Translation of RNA derived from this template will generate T7 RNA polymerase which in turn will transcribe more template. Concomitantly, there will be a cDNA whose expression is under the control of the T7 promoter. Thus, some of the T7 RNA polymerase generated from translation of the amplification template RNA will lead to transcription of the desired gene. Because some T7 RNA polymerase is required to initiate the amplification, T7 RNA polymerase can be introduced into cells along with the template(s) to prime the transcription reaction. The polymerase can be introduced as a protein or on a plasmid encoding the RNA polymerase. For a further discussion of T7 systems and their use for transforming cells, see, e.g., International Publication No. WO 94/26911; Studier and Moffatt, J. Mol. Biol. (1986) 189:113-130; Deng and Wolff, Gene (1994) 143:245-249; Gao et al., Biochem. Biophys. Res. Commun. (1994)200:1201-1206; Gao and Huang, Nuc. Acids Res. (1993) 21:2867-2872; Chen et al., Nuc. Acids Res. (1994) 22:2114-2120; and U.S. Pat. No. 5,135,855.
[0331]Synthetic expression cassettes of interest can also be delivered without a viral vector. For example, the synthetic expression cassette can be packaged in liposomes prior to delivery to the subject or to cells derived therefrom. Lipid encapsulation is generally accomplished using liposomes which are able to stably bind or entrap and retain nucleic acid. The ratio of condensed DNA to lipid preparation can vary but will generally be around 1:1 (mg DNA:micromoles lipid), or more of lipid. For a review of the use of liposomes as carriers for delivery of nucleic acids, see, Hug and Sleight, Biochim. Biophys. Acta. (1991) 1097:1-17; Straubinger et al., in Methods of Enzymology (1983), Vol. 101, pp. 512-527.
[0332]Liposomal preparations for use in the present invention include cationic (positively charged), anionic (negatively charged) and neutral preparations, with cationic liposomes particularly preferred. Cationic liposomes have been shown to mediate intracellular delivery of plasmid DNA (Feigner et al., Proc. Natl. Acad. Sci. USA (1987) 84:7413-7416); mRNA (Malone et al., Proc. Natl. Acad. Sci. USA (1989) 86:6077-6081); and purified transcription factors (Debs et al., J. Biol. Chem. (1990) 265:10189-10192), in functional form.
[0333]Cationic liposomes are readily available. For example, N[1-2,3-dioleyloxy)propyl]-N,N,N-triethylammonium (DOTMA) liposomes are available under the trademark Lipofectin, from GIBCO BRL, Grand Island, N.Y. (See, also, Feigner et al., Proc. Natl. Acad. Sci. USA (1987) 84:7413-7416). Other commercially available lipids include (DDAB/DOPE) and DOTAP/DOPE (Boerhinger). Other cationic liposomes can be prepared from readily available materials using techniques well known in the art. See, e.g., Szoka et al., Proc. Natl. Acad. Sci. USA (1978) 75:4194-4198; PCT Publication No. WO 90/11092 for a description of the synthesis of DOTAP (1,2-bis(oleoyloxy)-3-(trimethylammonio)propane) liposomes.
[0334]Similarly, anionic and neutral liposomes are readily available, such as, from Avanti Polar Lipids (Birmingham, Ala.), or can be easily prepared using readily available materials. Such materials include phosphatidyl choline, cholesterol, phosphatidyl ethanolamine, dioleoylphosphatidyl choline (DOPC), dioleoylphosphatidyl glycerol (DOPG), dioleoylphosphatidyl ethanolamine (DOPE), among others. These materials can also be mixed with the DOTMA and DOTAP starting materials in appropriate ratios. Methods for making liposomes using these materials are well known in the art.
[0335]The liposomes can comprise multilammelar vesicles (MLVs), small unilamellar vesicles (SUVs), or large unilamellar vesicles (LUVs). The various liposome-nucleic acid complexes are prepared using methods known in the art. See, e.g., Straubinger et al., in METHODS OF IMMUNOLOGY (1983), Vol. 101, pp. 512-527; Szoka et al., Proc. Natl. Acad. Sci. USA (1978) 75:4194-4198; Papahadjopoulos et al., Biochim. Biophys. Acta (1975) 394:483; Wilson et al., Cell (1979) 17:77); Deamer and Bangham, Biochim. Biophys. Acta (1976) 443:629; Ostro et al., Biochem. Biophys. Res. Commun. (1977) 76:836; Fraley et al., Proc. Natl. Acad. Sci. USA (1979) 76:3348); Enoch and Strittmatter, Proc. Natl. Acad. Sci. USA (1979) 76:145); Fraley et al., J. Biol. Chem. (1980) 255:10431; Szoka and Papahadjopoulos, Proc. Natl. Acad. Sci. USA (1978) 75:145; and Schaefer-Ridder et al., Science (1982) 215:166.
[0336]The DNA and/or protein antigen(s) can also be delivered in cochleate lipid compositions similar to those described by Papahadjopoulos et al., Biochem. Biophys. Acta. (1975) 394:483-491. See, also, U.S. Pat. Nos. 4,663,161 and 4,871,488.
[0337]The synthetic expression cassette of interest may also be encapsulated, adsorbed to, or associated with, particulate carriers. Such carriers present multiple copies of a selected antigen to the immune system and promote trapping and retention of antigens in local lymph nodes. The particles can be phagocytosed by macrophages and can enhance antigen presentation through cytokine release. Examples of particulate carriers include those derived from polymethyl methacrylate polymers, as well as microparticles derived from poly(lactides) and poly(lactide-co-glycolides), known as PLG. See, e.g., Jeffery et al., Pharm. Res. (1993) 10:362-368; McGee J P, et al., J Microencapsul. 14(2):197-210, 1997; O'Hagan D T, et al., Vaccine 11(2):149-54, 1993. Suitable microparticles may also be manufactured in the presence of charged detergents, such as anionic or cationic detergents, to yield microparticles with a surface having a net negative or a net positive charge. For example, microparticles manufactured with anionic detergents, such as hexadecyltrimethylammonium bromide (CTAB), i.e. CTAB-PLG microparticles, adsorb negatively charged macromolecules, such as DNA. (see, e.g., Int'l Application Number PCT/US99/17308).
[0338]Furthermore, other particulate systems and polymers can be used for the in vivo or ex vivo delivery of the gene of interest. For example, polymers such as polylysine, polyarginine, polyornithine, spermine, spermidine, as well as conjugates of these molecules, are useful for transferring a nucleic acid of interest. Similarly, DEAF dextran-mediated transfection, calcium phosphate precipitation or precipitation using other insoluble inorganic salts, such as strontium phosphate, aluminum silicates including bentonite and kaolin, chromic oxide, magnesium silicate, talc, and the like, will find use with the present methods. See, e.g., Feigner, P. L., Advanced Drug Delivery Reviews (1990) 5:163-187, for a review of delivery systems useful for gene transfer. Peptoids (Zuckerman, R. N., et al., U.S. Pat. No. 5,831,005, issued Nov. 3, 1998, herein incorporated by reference) may also be used for delivery of a construct of the present invention.
[0339]Additionally, biolistic delivery systems employing particulate carriers such as gold and tungsten, are especially useful for delivering synthetic expression cassettes of the present invention. The particles are coated with the synthetic expression cassette(s) to be delivered and accelerated to high velocity, generally under a reduced atmosphere, using a gun powder discharge from a "gene gun." For a description of such techniques, and apparatuses useful therefore, see, e.g., U.S. Pat. Nos. 4,945,050; 5,036,006; 5,100,792; 5,179,022; 5,371,015; and 5,478,744. Also, needle-less injection systems can be used (Davis, H. L., et al, Vaccine 12:1503-1509, 1994; Bioject, Inc., Portland, Oreg.).
[0340]Recombinant vectors carrying a synthetic expression cassette of the present invention are formulated into compositions for delivery to the vertebrate subject. These compositions may either be prophylactic (to prevent infection) or therapeutic (to treat disease after infection). The compositions will comprise a "therapeutically effective amount" of the gene of interest such that an amount of the antigen can be produced in vivo so that an immune response is generated in the individual to which it is administered. The exact amount necessary will vary depending on the subject being treated; the age and general condition of the subject to be treated; the capacity of the subject's immune system to synthesize antibodies; the degree of protection desired; the severity of the condition being treated; the particular antigen selected and its mode of administration, among other factors. An appropriate effective amount can be readily determined by one of skill in the art. Thus, a "therapeutically effective amount" will fall in a relatively broad range that can be determined through routine trials.
[0341]The compositions will generally include one or more "pharmaceutically acceptable excipients or vehicles" such as water, saline, glycerol, polyethyleneglycol, hyaluronic acid, ethanol, etc. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles. Certain facilitators of nucleic acid uptake and/or expression can also be included in the compositions or coadministered, such as, but not limited to, bupivacaine, cardiotoxin and sucrose.
[0342]Once formulated, the compositions of the invention can be administered directly to the subject (e.g., as described above) or, alternatively, delivered ex vivo, to cells derived from the subject, using methods such as those described above. For example, methods for the ex vivo delivery and reimplantation of transformed cells into a subject are known in the art and can include, e.g., dextran-mediated transfection, calcium phosphate precipitation, polybrene mediated transfection, lipofectamine and LT-1 mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide(s) (with or without the corresponding antigen) in liposomes, and direct microinjection of the DNA into nuclei.
[0343]Direct delivery of synthetic expression cassette compositions in vivo will generally be accomplished with or without viral vectors, as described above, by injection using either a conventional syringe or a gene gun, such as the Accell® gene delivery system (PowderJect Technologies, Inc., Oxford, England). The constructs can be injected either subcutaneously, epidermally, intradermally, intramucosally such as nasally, rectally and vaginally, intraperitoneally, intravenously, orally or intramuscularly. Delivery of DNA into cells of the epidermis is particularly preferred as this mode of administration provides access to skin-associated lymphoid cells and provides for a transient presence of DNA in the recipient. Other modes of administration include oral and pulmonary administration, suppositories, needle-less injection, transcutaneous and transdermal applications. Dosage treatment may be a single dose schedule or a multiple dose schedule. Administration of nucleic acids may also be combined with administration of peptides or other substances.
[0344]2.4.2 Ex Vivo Delivery of the Synthetic Expression Cassettes of the Present Invention
[0345]In one embodiment, T cells, and related cell types (including but not limited to antigen presenting cells, such as, macrophage, monocytes, lymphoid cells, dendritic cells, B-cells, T-cells, stem cells, and progenitor cells thereof), can be used for ex vivo delivery of the synthetic expression cassettes of the present invention. T cells can be isolated from peripheral blood lymphocytes (PBLs) by a variety of procedures known to those skilled in the art. For example, T cell populations can be "enriched" from a population of PBLs through the removal of accessory and B cells. In particular, T cell enrichment can be accomplished by the elimination of non-T cells using anti-MHC class II monoclonal antibodies. Similarly, other antibodies can be used to deplete specific populations of non-T cells. For example, anti-Ig antibody molecules can be used to deplete B cells and anti-MacI antibody molecules can be used to deplete macrophages.
[0346]T cells can be further fractionated into a number of different subpopulations by techniques known to those skilled in the art. Two major subpopulations can be isolated based on their differential expression of the cell surface markers CD4 and CD8. For example, following the enrichment of T cells as described above, CD4+ cells can be enriched using antibodies specific for CD4 (see Coligan et al., supra). The antibodies may be coupled to a solid support such as magnetic beads. Conversely, CD8+ cells can be enriched through the use of antibodies specific for CD4 (to remove CD4.sup.+ cells), or can be isolated by the use of CD8 antibodies coupled to a solid support. CD4 lymphocytes from HIV-1 infected patients can be expanded ex vivo, before or after transduction as described by Wilson et. al. (1995) J. Infect. Dis. 172:88.
[0347]Following purification of T cells, a variety of methods of genetic modification known to those skilled in the art can be performed using non-viral or viral-based gene transfer vectors constructed as described herein. For example, one such approach involves transduction of the purified T cell population with vector-containing supernatant of cultures derived from vector producing cells. A second approach involves co-cultivation of an irradiated monolayer of vector-producing cells with the purified T cells. A third approach involves a similar co-cultivation approach; however, the purified T cells are pre-stimulated with various cytokines and cultured 48 hours prior to the co-cultivation with the irradiated vector producing cells. Pre-stimulation prior to such transduction increases effective gene transfer (Nolta et al. (1992) Exp. Hematol. 20:1065). Stimulation of these cultures to proliferate also provides increased cell populations for re-infusion into the patient. Subsequent to co-cultivation, T cells are collected from the vector producing cell monolayer, expanded, and frozen in liquid nitrogen.
[0348]Gene transfer vectors, containing one or more synthetic expression cassette of the present invention (associated with appropriate control elements for delivery to the isolated T cells) can be assembled using known methods.
[0349]Selectable markers can also be used in the construction of gene transfer vectors. For example, a marker can be used which imparts to a mammalian cell transduced with the gene transfer vector resistance to a cytotoxic agent. The cytotoxic agent can be, but is not limited to, neomycin, aminoglycoside, tetracycline, chloramphenicol, sulfonamide, actinomycin, netropsin, distamycin A, anthracycline, or pyrazinamide. For example, neomycin phosphotransferase II imparts resistance to the neomycin analogue geneticin (G418).
[0350]The T cells can also be maintained in a medium containing at least one type of growth factor prior to being selected. A variety of growth factors are known in the art which sustain the growth of a particular cell type. Examples of such growth factors are cytokine mitogens such as rIL-2, IL-10, IL-12, and IL-15, which promote growth and activation of lymphocytes. Certain types of cells are stimulated by other growth factors such as hormones, including human chorionic gonadotropin (hCG) and human growth hormone. The selection of an appropriate growth factor for a particular cell population is readily accomplished by one of skill in the art.
[0351]For example, white blood cells such as differentiated progenitor and stem cells are stimulated by a variety of growth factors. More particularly, IL-3, IL-4, IL-5, IL-6, IL-9, GM-CSF, M-CSF, and G-CSF, produced by activated TH and activated macrophages, stimulate myeloid stem cells, which then differentiate into pluripotent stem cells, granulocyte-monocyte progenitors, eosinophil progenitors, basophil progenitors, megakaryocytes, and erythroid progenitors. Differentiation is modulated by growth factors such as GM-CSF, IL-3, IL-6, IL-11, and EPO.
[0352]Pluripotent stem cells then differentiate into lymphoid stem cells, bone marrow stromal cells, T cell progenitors, B cell progenitors, thymocytes, TH Cells, Tc cells, and B cells. This differentiation is modulated by growth factors such as IL-3, IL-4, IL-6, IL-7, GM-CSF, M-CSF, G-CSF, IL-2, and IL-5.
[0353]Granulocyte-monocyte progenitors differentiate to monocytes, macrophages, and neutrophils. Such differentiation is modulated by the growth factors GM-CSF, M-CSF, and IL-8. Eosinophil progenitors differentiate into eosinophils. This process is modulated by GM-CSF and IL-5.
[0354]The differentiation of basophil progenitors into mast cells and basophils is modulated by GM-CSF, IL-4, and IL-9. Megakaryocytes produce platelets in response to GM-CSF, EPO, and IL-6. Erythroid progenitor cells differentiate into red blood cells in response to EPO.
[0355]Thus, during activation by the CD3-binding agent, T cells can also be contacted with a mitogen, for example a cytokine such as IL-2. In particularly preferred embodiments, the IL-2 is added to the population of T cells at a concentration of about 50 to 100 μg/ml. Activation with the CD3-binding agent can be carried out for 2 to 4 days.
[0356]Once suitably activated, the T cells are genetically modified by contacting the same with a suitable gene transfer vector under conditions that allow for transfection of the vectors into the T cells. Genetic modification is carried out when the cell density of the T cell population is between about 0.1×106 and 5×106, preferably between about 0.5×106 and 2×106. A number of suitable viral and nonviral-based gene transfer vectors have been described for use herein.
[0357]After transduction, transduced cells are selected away from non-transduced cells using known techniques. For example, if the gene transfer vector used in the transduction includes a selectable marker which confers resistance to a cytotoxic agent, the cells can be contacted with the appropriate cytotoxic agent, whereby non-transduced cells can be negatively selected away from the transduced cells. If the selectable marker is a cell surface marker, the cells can be contacted with a binding agent specific for the particular cell surface marker, whereby the transduced cells can be positively selected away from the population. The selection step can also entail fluorescence-activated cell sorting (FACS) techniques, such as where FACS is used to select cells from the population containing a particular surface marker, or the selection step can entail the use of magnetically responsive particles as retrievable supports for target cell capture and/or background removal.
[0358]More particularly, positive selection of the transduced cells can be performed using a FACS cell sorter (e.g. a FACSVantage® Cell Sorter, Becton Dickinson Immunocytometry Systems, San Jose, Calif.) to sort and collect transduced cells expressing a selectable cell surface marker. Following transduction, the cells are stained with fluorescent-labeled antibody molecules directed against the particular cell surface marker. The amount of bound antibody on each cell can be measured by passing droplets containing the cells through the cell sorter. By imparting an electromagnetic charge to droplets containing the stained cells, the transduced cells can be separated from other cells. The positively selected cells are then harvested in sterile collection vessels. These cell sorting procedures are described in detail, for example, in the FACSVantage® Training Manual, with particular reference to sections 3-11 to 3-28 and 10-1 to 10-17.
[0359]Positive selection of the transduced cells can also be performed using magnetic separation of cells based on expression or a particular cell surface marker. In such separation techniques, cells to be positively selected are first contacted with specific binding agent (e.g., an antibody or reagent the interacts specifically with the cell surface marker). The cells are then contacted with retrievable particles (e.g., magnetically responsive particles) which are coupled with a reagent that binds the specific binding agent (that has bound to the positive cells). The cell-binding agent-particle complex can then be physically separated from non-labeled cells, for example using a magnetic field. When using magnetically responsive particles, the labeled cells can be retained in a container using a magnetic filed while the negative cells are removed. These and similar separation procedures are known to those of ordinary skill in the art.
[0360]Expression of the vector in the selected transduced cells can be assessed by a number of assays known to those skilled in the art. For example, Western blot or Northern analysis can be employed depending on the nature of the inserted nucleotide sequence of interest. Once expression has been established and the transformed T cells have been tested for the presence of the selected synthetic expression cassette, they are ready for infusion into a patient via the peripheral blood stream.
[0361]The invention includes a kit for genetic modification of an ex vivo population of primary mammalian cells. The kit typically contains a gene transfer vector coding for at least one selectable marker and at least one synthetic expression cassette contained in one or more containers, ancillary reagents or hardware, and instructions for use of the kit.
[0362]2.4.3 Further Delivery Regimes
[0363]Any of the polynucleotides (e.g., expression cassettes) or polypeptides described herein (delivered by any of the methods described above) can also be used in combination with other DNA delivery systems and/or protein delivery systems. Non-limiting examples include co-administration of these molecules, for example, in prime-boost methods where one or more molecules are delivered in a "priming" step and, subsequently, one or more molecules are delivered in a "boosting" step. In certain embodiments, the delivery of one or more nucleic acid-containing compositions and is followed by delivery of one or more nucleic acid-containing compositions and/or one or more polypeptide-containing compositions (e.g., polypeptides comprising HIV antigens). In other embodiments, multiple nucleic acid "primes" (of the same or different nucleic acid molecules) can be followed by multiple polypeptide "boosts" (of the same or different polypeptides). Other examples include multiple nucleic acid administrations and multiple polypeptide administrations.
[0364]In any method involving co-administration, the various compositions can be delivered in any order. Thus, in embodiments including delivery of multiple different compositions or molecules, the nucleic acids need not be all delivered before the polypeptides. For example, the priming step may include delivery of one or more polypeptides and the boosting comprises delivery of one or more nucleic acids and/or one more polypeptides. Multiple polypeptide administrations can be followed by multiple nucleic acid administrations or polypeptide and nucleic acid administrations can be performed in any order. In any of the embodiments described herein, the nucleic acid molecules can encode all, some or none of the polypeptides. Thus, one or more or the nucleic acid molecules (e.g., expression cassettes) described herein and/or one or more of the polypeptides described herein can be co-administered in any order and via any administration routes. Therefore, any combination of polynucleotides and/or polypeptides described herein can be used to generate elicit an immune reaction.
EXPERIMENTAL
[0365]Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.
[0366]Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.
Example 1
Generation of Synthetic Expression Cassettes
A. Modification of HIV-1 Env, Gag, Pol Nucleic Acid Coding Sequences
[0367]The Pol coding sequences were selected from Type C strain AF110975. The Gag coding sequences were selected from the Type C strains AF110965 and AF110967. The Env coding sequences were selected from Type C strains AF110968 and AF110975. These sequences were manipulated to maximize expression of their gene products.
[0368]First, the HIV-1 codon usage pattern was modified so that the resulting nucleic acid coding sequence was comparable to codon usage found in highly expressed human genes. The HIV codon usage reflects a high content of the nucleotides A or T of the codon-triplet. The effect of the HIV-1 codon usage is a high AT content in the DNA sequence that results in a decreased translation ability and instability of the mRNA. In comparison, highly expressed human codons prefer the nucleotides G or C. The coding sequences were modified to be comparable to codon usage found in highly expressed human genes.
[0369]Second, there are inhibitory (or instability) elements (INS) located within the coding sequences of the Gag and Gag-protease coding sequences (Schneider R, et al., J Virol. 71(7):4892-4903, 1997). RRE is a secondary RNA structure that interacts with the HIV encoded Rev-protein to overcome the expression down-regulating effects of the INS. To overcome the post-transcriptional activating mechanisms of RRE and Rev, the instability elements are inactivated by introducing multiple point mutations that do not alter the reading frame of the encoded proteins. FIGS. 5 and 6 (SEQ ID Nos: 3, 4, 20 and 21) show the location of some remaining INS in synthetic sequences derived from strains AF110965 and AF110967. The changes made to these sequences are boxed in the Figures. In FIGS. 5 and 6, the top line depicts a modified sequence of Gag polypeptides from the indicated strains. The nucleotide(s) appearing below the line in the boxed region(s) depicts changes made to further remove INS. Thus, when the changes indicated in the boxed regions are made, the resulting sequences correspond to the sequences depicted in FIGS. 1 and 2, respectively.
[0370]The synthetic coding sequences are assembled by methods known in the art, for example by companies such as the Midland Certified Reagent Company (Midland, Tex.).
[0371]In one embodiment of the invention, sequences encoding Pol-polypeptides are included with the synthetic Gag or Env sequences in order to increase the number of epitopes for virus-like particles expressed by the synthetic, modified Gag/Env expression cassette. Because synthetic HIV-1 Poi expresses the functional enzymes reverse transcriptase (RT) and integrase (TNT) (in addition to the structural proteins and protease), it may be helpful in some instances to inactivate RT and INT functions. Several deletions or mutations in the RT and INT coding regions can be made to achieve catalytic nonfunctional enzymes with respect to their RT and INT activity. {Jay. A. Levy (Editor) (1995) The Retroviridae, Plenum Press, New York. ISBN 0-306-45033X. Pages 215-20; Grimison, B. and Laurence, J. (1995), Journal Of Acquired Immune Deficiency Syndromes and Human Retrovirology 9(1):58-68; Wakefield, J. K., et al., (1992) Journal Of Virology 66(11):6806-6812; Esnouf, R., et al., (1995) Nature Structural Biology 2(4):303-308; Maignan, S., et al., (1998) Journal Of Molecular Biology 282(2):359-368; Katz, R. A. and Skalka, A. M. (1994) Annual Review Of Biochemistry 73 (1994); Jacobo-Molina, A., et al., (1993) Proceedings Of the National Academy Of Sciences Of the United States Of America 90(13):6320-6324; Hickman, A. B., et al., (1994) Journal Of Biological Chemistry 269(46):29279-29287; Goldgur, Y., et al., (1998) Proceedings Of the National Academy Of Sciences Of the United States Of America 95(16):9150-9154; Goette, M., et al., (1998) Journal Of Biological Chemistry 273(17):10139-10146; Gorton, J. L., et al., (1998) Journal of Virology 72(6):5046-5055; Engelman, A., et al., (1997) Journal Of Virology 71(5):3507-3514; Dyda, F., et al., Science 266(5193):1981-1986; Davies, J. F., et al., (1991) Science 252(5002):88-95; Bujacz, G., et al., (1996) Febs Letters 398(2-3):175-178; Beard, W. A., et al., (1996) Journal Of Biological Chemistry 271(21):12213-12220; Kohlstaedt, L. A., et al., (1992) Science 256(5065):1783-1790; Krug, M. S, and Berger, S. L. (1991) Biochemistry 30(44):10614-10623; Mazumder, A., et al., (1996) Molecular Pharmacology 49(4):621-628; Palaniappan, C., et al., (1997) Journal Of Biological Chemistry 272(17):11157-11164; Rodgers, D. W., et al., (1995) Proceedings Of the National Academy Of Sciences Of the United States Of America 92(4):1222-1226; Sheng, N. and Dennis, D. (1993) Biochemistry 32(18):4938-4942; Spence, R. A., et al., (1995) Science 267(5200):988-993.)
[0372]Furthermore selected B- and/or T-cell epitopes can be added to the Pol constructs (e.g., 3' of the truncated INT or within the deletions of the RT- and INT-coding sequence) to replace and augment any epitopes deleted by the functional modifications of RT and INT. Alternately, selected B- and T-cell epitopes (including CU epitopes) from RT and NT can be included in a minimal VLP formed by expression of the synthetic Gag or synthetic Pol cassette, described above. (For descriptions of known HIV B- and T-cell epitopes see, HIV Molecular Immunology Database CTL Search Interface; Los Alamos Sequence Compendia, 1987-1997; Internet address: http://hiv-web.lan1.gov/immunology/index.html.)
[0373]The resulting modified coding sequences are presented as a synthetic Env expression cassette; a synthetic Gag expression cassette; a synthetic Pol expression cassette. A common Gag region (Gag-common) extends from nucleotide position 844 to position 903 (SEQ ID NO:1), relative to AF110965 (or from approximately amino acid residues 282 to 301 of SEQ ID NO:17) and from nucleotide position 841 to position 900 (SEQ ID NO:2), relative to AF110967 (or from approximately amino acid residues 281 to 300 of SEQ ID NO:22). A common Env region (Env-common) extends from nucleotide position 1213 to position 1353 (SEQ ID NO:5) and amino acid positions 405 to 451 of SEQ ID NO:23, relative to AF110968 and from nucleotide position 1210 to position 1353 (SEQ ID NO:11) and amino acid positions 404-451 (SEQ ID NO:24), relative to AF110975.
[0374]The synthetic DNA fragments for Pol, Gag and Env are cloned into the following eucaryotic expression vectors: pCMVKm2, for transient expression assays and DNA immunization studies, the pCMVKm2 vector is derived from pCMV6a (Chapman et al., Nuc. Acids Res. (1991) 19:3979-3986) and comprises a kanamycin selectable marker, a ColE1 origin of replication, a CMV promoter enhancer and Intron A, followed by an insertion site for the synthetic sequences described below followed by a polyadenylation signal derived from bovine growth hormone--the pCMVKm2 vector differs from the pCMV-link vector only in that a polylinker site is inserted into pCMVKm2 to generate pCMV-link; pESN2dhfr and pCMVPLEdhfr, for expression in Chinese Hamster Ovary (CHO) cells; and, pAcC13, a shuttle vector for use in the Baculovirus expression system (pAcC13, is derived from pAcC12 which is described by Munemitsu S., et al., Mol Cell Biol. 10(11):5977-5982, 1990).
[0375]Briefly, construction of pCMVPLEdhfr was as follows.
[0376]To construct a DHFR cassette, the EMCV IRES (internal ribosome entry site) leader was PCR-amplified from pCite-4-a+ (Novagen, Inc., Milwaukee, Wis.) and inserted into pET-23d (Novagen, Inc., Milwaukee, Wis.) as an Xba-Nco fragment to give pET-EMCV. The dhfr gene was PCR-amplified from pESN2dhfr to give a product with a Gly-Gly-Gly-Ser spacer in place of the translation stop codon and inserted as an Nco-BamHI fragment to give pET-E-DHFR. Next, the attenuated neo gene was PCR amplified from a pSV2Neo (Clontech, Palo Alto, Calif.) derivative and inserted into the unique BamHI site of pET-E-DHFR to give pET-E-DHFR/Neo.sub.(m2). Finally the bovine growth hormone terminator from pcDNA3 (Invitrogen, Inc., Carlsbad, Calif.) was inserted downstream of the neo gene to give pET-E-DHFR/Neo.sub.(m2)BGHt. The EMCV-dhfr/neo selectable marker cassette fragment was prepared by cleavage of pET-E-DHFR/Neo.sub.(m2)BGHt.
[0377]The CMV enhancer/promoter plus Intron A was transferred from pCMV6a (Chapman et al., Nuc. Acids Res. (1991) 19:3979-3986) as a HindIII-SalI fragment into pUC19 (New England Biolabs, Inc., Beverly, Mass.). The vector backbone of pUC19 was deleted from the Nde1 to the Sap1 sites. The above described DHFR cassette was added to the construct such that the EMCV IRES followed the CMV promoter. The vector also contained an ampT gene and an SV40 origin of replication.
B. Defining of the Major Homology Region (MHR) of HIV-1 p55Gag
[0378]The Major Homology Region (MHR) of HIV-1 p55 (Gag) is located in the p24-CA sequence of Gag. It is a conserved stretch of approximately 20 amino acids. The position in the wild type AF110965 Gag protein is from 282-301 (SEQ ID NO:25) and spans a region from 844-903 (SEQ ID NO:26) for the Gag DNA-sequence. The position in the synthetic Gag protein is also from 282-301 (SEQ ID NO:25) and spans a region from 844-903 (SEQ ID NO:1) for the synthetic Gag DNA-sequence. The position in the wild type and synthetic AF110967 Gag protein is from 281-300 (SEQ ID NO:27) and spans a region from 841-900 (SEQ ID NO:2) for the modified Gag DNA-sequence. Mutations or deletions in the MHR can severely impair particle production (Borsetti, A., et al., J. Virol. 72(11):9313-9317, 1998; Mammano, F., et al., J Virol 68(8):4927-4936, 1994).
[0379]Percent identity to this sequence can be determined, for example, using the Smith-Waterman search algorithm (Time Logic, Incline Village, Nev.), with the following exemplary parameters: weight matrix=nuc4×4hb; gap opening penalty=20, gap extension penalty=5.
C. Defining of the Common Sequence Region of HIV-1 Env
[0380]The common sequence region (CSR) of HIV-1 Env is located in the C4 sequence of Env. It is a conserved stretch of approximately 47 amino acids. The position in the wild type and synthetic AF110968 Env protein is from approximately amino acid residue 405 to 451 (SEQ ID NO:28) and spans a region from 1213 to 1353 (SEQ ID NO:5) for the Env DNA-sequence. The position in the wild type and synthetic AF110975 Env protein is from approximately amino acid residue 404 to 451 (SEQ ID NO:29) and spans a region from 1210 to 1353 (SEQ ID NO:11) for the Env DNA-sequence.
[0381]Percent identity to this sequence can be determined, for example, using the Smith-Waterman search algorithm (Time Logic, Incline Village, Nev.), with the following exemplary parameters: weight matrix=nuc4×4hb; gap opening penalty=20, gap extension penalty=5.
[0382]Various forms of the different embodiments of the invention, described herein, may be combined.
D. Exemplary HIV Sequences Derived from South African HIV Type C Strains
[0383]HIV coding sequences of novel Type C isolates were obtained. Polypeptide-coding sequences were manipulated to maximize expression of their gene products.
[0384]As described above, the HIV-1 codon usage pattern was modified so that the resulting nucleic acid coding sequence was comparable to codon usage found in highly expressed human genes. The HIV codon usage reflects a high content of the nucleotides A or T of the codon-triplet. The effect of the HIV-1 codon usage is a high AT content in the DNA sequence that results in a decreased translation ability and instability of the mRNA. In comparison, highly expressed human codons prefer the nucleotides G or C. The coding sequences were modified to be comparable to codon usage found in highly expressed human genes.
[0385]Shown below in Table C are exemplary wild-type and synthetic sequences derived from a novel South African HIV Type C isolate, clone 8--5_TV1_C.ZA. Table D shows exemplary synthetic Env sequences derived from a novel South African HIV Type C isolate, clone 8--2_TV1_C.ZA. Table E shows wild-type and synthetic sequences derived from South African HIV Type C strain 12-5--1_TV2_C.ZA.
TABLE-US-00003 TABLE C SEQ Name ID Description C4_Env_TV1_C_ZA_opt 46 synthetic sequence of short Env "common short region" C4_Env_TV1_C_ZA_opt 47 synthetic sequence of Env "common region" C4_Env_TV1_C_ZA_wt 48 wild type 8_5_TV1_C.ZA Env sequence Envgp160_TV1_C_ZAopt 49 synthetic Env gp160 Envgp160_TV1_C_ZAwt 50 wild type 8_5_TV1_C.ZA Env gp160 sequence Gag_TV1_C_ZAopt 51 synthetic sequence of Gag Gag_TV1_C_ZAwt 52 wild type 8_5_TV1_C.ZA Gag sequence Gag_TV1_ZA_MHRopt 53 synthetic sequence of Gag major homology region Gag_TV1_ZA_MHRwt 54 wild type 8_5_TV1_C.ZA Gag major homology region sequence Nef_TV1_C_ZAopt 55 synthetic sequence of Nef Nef_TV1_C_ZAwt 56 wild type 8_5_TV1_C.ZA Nef sequence NefD125G_TV1_C_ZAopt 57 synthetic sequence of Nef, including mutation at position 125 resulting in non-functional gene product p15RNaseH_TV1_C_ZAopt 58 synthetic sequence of RNAseH (p15 of Pol) p15RNaseH_TV1_C_ZAwt 59 wild type 8_5_TV1_C.ZA RNAseH sequence p31Int_TV1_C_ZAopt 60 synthetic sequence of Integrase (p31 of Pol) p31Int_TV1_C_ZAwt 61 wild type 8_5_TV1_C.ZA Integrase sequence Pol_TV1_C_ZAopt 62 synthetic sequence of Pol Pol_TV1_C_ZAwt 63 wild type 8_5_TV1_C.ZA Pol sequence Prot_TV1_C_ZAopt 64 synthetic sequence of Prot Prot_TV1_C_ZAwt 65 wild type 8_5_TV1_C.ZA Prot sequence Protina_TV1_C_ZAopt 66 synthetic sequence of Prot including mutation resulting in inactivation of protease Protina_TV1_C_ZAwt 67 wild type 8_5_TV1_C.ZA Prot sequence, including mutation resulting in inactivation of protease. ProtinaRTmut_TV1_C_ZAopt 68 synthetic sequence of Prot and reverse transcriptase (RT), including mutation resulting in inactivation of protease and mutation resulting in inactivation of RT. ProtinaRTmut_TV1_C_ZAwt 69 wild type 8_5_TV1_C.ZA Prot and RT, mutation resulting in inactivation of protease and mutation resulting in inactivation of RT. ProtwtRTwt_TV1_C_ZAopt 70 synthetic sequences of Prot and RT ProtwtRTwt_TV1_C_ZAwt 71 wild type 8_5_TV1_C.ZA Prot and RT RevExon1_TV1_C_ZAopt 72 synthetic sequence of exon 1 of Rev RevExon1_TV1_C_ZAwt 73 wild type 8_5_TV1_C.ZA of exon 1 of Rev RevExon2_TV1_C_ZAopt-2 74 synthetic sequence of exon 2 of Rev RevExon2_TV1_C_ZAwt 75 wild type 8_5_TV1_C.ZA of exon 2 of Rev RT_TV1_C_ZAopt 76 synthetic sequence of RT RT_TV1_C_ZAwt 77 wild type 8_5_TV1_C.ZA RT RTmut_TV1_C_ZAopt 78 synthetic sequence of RT, including mutation resulting in inactivation of RT RTmut_TV1_C_ZAwt 79 wild type 8_5_TV1_C.ZA RT, including mutation resulting in inactivation of RT TatC22Exon1_TV1_C_ZAopt 80 synthetic sequence of exon 1 of Tat, including mutation resulting in non-functional Tat gene product TatExon1_TV1_C_ZAopt 81 synthetic sequence of exon 1 of Tat TatExon1_TV1_C_ZAwt 82 wild type 8_5_TV1_C.ZA exon 1 of Tat TatExon2_TV1_C_ZAopt 83 synthetic sequence of exon 2 of Tat TatExon2_TV1_C_ZAwt 84 wild type 8_5_TV1_C.ZA exon 2 of Tat Vif_TV1_C_ZAopt 85 synthetic sequence of Vif Vif_TV1_C_ZAwt 86 wild type 8_5_TV1_C.ZA Vif Vpr_TV1_C_ZAopt 87 synthetic sequence of Vpr Vpr_TV1_C_ZAwt 88 wild type 8_5_TV1_C.ZA Vpr Vpu_TV1_C_ZAopt 89 synthetic sequence of Vpu Vpu_TV1_C_ZAwt 90 wild type 8_5_TV1_C.ZA Vpu revexon1_2 TV1 C ZAopt 91 synthetic sequence of exons 1 and 2 of Rev RevExon1_2_TV1_C_ZAwt 92 wild type 8_5_TV1_C.ZA Rev (exons 1 and 2) TatC22Exon1_2_TV1_C_ZAopt 93 synthetic sequence of exons 1 and 2 of Tat, including mutation in exon 1 resulting in non- functional Tat gene product TatExon1_2_TV1_C_ZAopt 94 synthetic sequence of exons 1 and 2 of Tat TatExon1_2_TV1_C_ZAwt 95 wild type 8_5_TV1_C.ZA Tat (exons 1 and 2) NefD125G- 96 synthetic sequence of Nef, including mutation Myr_TV1_C_ZAopt eliminating myristoylation site.
TABLE-US-00004 TABLE D Name Seq Id Description gp120mod.TV1.delV2 119 synthetic sequence of Env gp120, including V2 deletion and modified leader sequences derived from wild-type 8_2_TV1_C.ZA sequences gp140mod.TV1.delV2 120 synthetic sequence of Env gp140, including V2 deletion and modified leader sequences derived from wild-type 8_2_TV1_C.ZA sequences gp140mod.TV1.mut7.delV2 121 synthetic sequence of Env gp140, including V2 deletion and mutation in cleavage site and modified leader sequences derived from wild- type 8_2_TV1_C.ZA sequences gp160mod.TV1.delV1V2 122 synthetic sequence of Env gp160, including V1/V2 deletion and modified leader derived from wild-type 8_2_TV1_C.ZA sequences gp160mod.TV1.delV2 123 synthetic sequence of Env gp160, including V2 deletion and modified leader sequences derived from wild-type 8_2_TV1_C.ZA sequences gp160mod.TV1.mut7.delV2 124 synthetic sequence of Env gp160, including V2 deletion; a mutation in cleavage site; and modified leader sequences derived from wild- type 8_2_TV1_C.ZA sequences gp160mod.TV1.tpa1 125 synthetic sequence of Env gp160, TPA1 leader gp160mod.TV1 126 synthetic sequence of Env gp160, including modified leader sequences derived from wild- type (8_2_TV1_C.ZA) sequences gp160mod.TV1.wtLnative 127 synthetic sequence of Env gp160, including wild type 8_2_TV1_C.ZA (unmodified) leader gp140.mod.TV1.tpa1 131 synthetic sequence of Env gp140, TPA1 leader gp140mod.TV1 132 synthetic sequence of Env gp140, including modified leader sequences derived from wild- type 8_2_TV1_C.ZA sequences gp140mod.TV1.wtLnative 133 synthetic sequence of Env gp120, including wild type 8_2_TV1_C.ZA (unmodified) leader sequence.
[0386]As noted above, Env-encoding constructs can be prepared using any of the full-length of gp160 constructs. For example, a gp140 form (SEQ ID NO:132) was made by truncating gp160 (SEQ ID NO:126) at nucleotide 2064; gp120 was made by truncating gp160 (SEQ ID NO:126) at nucleotide 1551 (SEQ ID NO:126). Additional gp140 and gp120 forms can be made using the methods described herein. One or more stop codons are typically added (e.g., nucleotides 2608 to 2610 of SEQ ID NO:126). Further, the wild-type leader sequence can be modified and/or replaced with other leader sequences (e.g., TPA1 leader sequences).
[0387]Thus, the polypeptide gp160 includes the coding sequences for gp120 and gp41. The polypeptide gp41 is comprised of several domains including an oligomerization domain (OD) and a transmembrane spanning domain (TM). In the native envelope, the oligomerization domain is required for the non-covalent association of three gp41 polypeptides to form a trimeric structure: through non-covalent interactions with the gp41 trimer (and itself), the gp120 polypeptides are also organized in a trimeric structure. A cleavage site (or cleavage sites) exists approximately between the polypeptide sequences for gp120 and the polypeptide sequences corresponding to gp41. This cleavage site(s) can be mutated to prevent cleavage at the site. The resulting gp140 polypeptide corresponds to a truncated form of gp160 where the transmembrane spanning domain of gp41 has been deleted. This gp140 polypeptide can exist in both monomeric and oligomeric (i.e. trimeric) forms by virtue of the presence of the oligomerization domain in the gp41 moiety. In the situation where the cleavage site has been mutated to prevent cleavage and the transmembrane portion of gp41 has been deleted the resulting polypeptide product is designated "mutated" gp140 (e.g., gp140.mut). As will be apparent to those in the field, the cleavage site can be mutated in a variety of ways. In the exemplary constructs described herein (e.g., SEQ ID NO:121 and SEQ ID NO:124), the mutation in the gp120/gp41 cleavage site changes the wild-type amino acid sequence KRRVVQREKR (SEQ ID NO:129) to ISSVVQSEKS (SEQ ID NO:130).
[0388]In yet other embodiments, hypervariable region(s) were deleted, N-glycosylation sites were removed and/or cleavage sites mutated. Exemplary constructs having variable region deletions (V1 and/or V2), V2 deletes were constructed by deleting nucleotides from approximately 499 to approximately 593 (relative to SEQ ID NO:128) and V1/V2 deletes were constructed by deleting nucleotides from approximately 375 to approximately 602 (relative to SEQ ID NO:128). The relative locations of V1 and/or V2 regions can also be readily determined by alignment to the regions shown in Table A. Table E shows wild-type and synthetic sequences derived from South African HIV Type C strain 12-5--1_TV2_C.ZA.
TABLE-US-00005 TABLE E Name SEQ ID Description Envgp160_TV2_C_ZAopt 97 synthetic sequence of Env gp160 Envgp160_TV2_C_ZAwt 98 wild type 12-5_1_TV2_C.ZA Env gp160. Gag_TV2_C_ZAopt 99 synthetic sequence of Gag Gag_TV2_C_ZAwt 100 wild type 12-5_1_TV2_C.ZA Gag Nef_TV2_C_ZAopt 101 synthetic sequence of Nef Nef_TV2_C_ZAwt 102 wild type 12-5_1_TV2_C.ZA Nef Pol_TV2_C_ZAopt 103 synthetic sequence of Pol Pol_TV2_C_ZAwt 104 wild type 12-5_1_TV2_C.ZA of Pol RevExon1_TV2_C_ZAopt 105 synthetic sequence of exon 1 of Rev RevExon1_TV2_C_ZAwt 106 wild type 12-5_1_TV2_C.ZA of exon 1 of Rev RevExon2_TV2_C_ZAopt 107 synthetic sequence of exon 2 of Rev RevExon2_TV2_C_ZAwt 108 wild type 12-5_1_TV2_C.ZA of exon 2 of Rev TatExon1_TV2_C_ZAopt 109 synthetic sequence of exon 1 of Tat TatExon1_TV2_C_ZAwt 110 wild type 12-5_1_TV2_C.ZA of exon 1 of Tat TatExon2_TV2_C_ZAopt 111 synthetic sequence of exon 2 of Tat TatExon2_TV2_C_ZAwt 112 wild type 12-5_1_TV2_C.ZA of exon 2 of Tat Vif_TV2_C_ZAopt 113 synthetic sequence of Vif Vif_TV2_C_ZAwt 114 wild type 12-5_1_TV2_C.ZA of Vif Vpr_TV2_C_ZAopt 115 synthetic sequence of Vpr Vpr_TV2_C_ZAwt 116 wild type 12-5_1_TV2_C.ZA of Vpr Vpu_TV2_C_ZAopt 117 synthetic sequence of Vpu Vpu_TV2_C_ZAwt 118 wild type 12-5_1_TV2_C.ZA of Vpu
[0389]It will be readily apparent that sequences derived from any HIV type C stain or clone can modified as described herein in order to achieve desirable modifications in that strain. Additionally, polyproteins can be constructed by fusing in-frame two or more polynucleotide sequences encoding polypeptide or peptide products. Further, polycistronic coding sequences may be produced by placing two or more polynucleotide sequences encoding polypeptide products adjacent each other, typically under the control of one promoter, wherein each polypeptide coding sequence may be modified to include sequences for internal ribosome binding sites.
[0390]The sequences of the present invention, for example, the modified (synthetic) polynucleotide sequences encoding HIV polypeptides, may be modified by deletions, point mutations, substitutions, frame-shifts, and/or further genetic modifications (for example, mutations leading to inactivation of an activity associated with a polypeptide, e.g., mutations that inactivate protease, tat, or reverse transcriptase activity). Such modifications are taught generally in the art and may be applied in the context of the teachings of the present invention. For example, sites corresponding to the "Regions of the HIV Genome" listed in Table A may be modified in the corresponding regions of the novel sequences disclosed herein in order to achieve desirable modifications. Further, the modified (synthetic) polynucleotide sequences of the present invention can be combined for use, e.g., in an composition for generating an immune response in a subject, in a variety of ways, including but not limited to the following ways: multiple individual expression cassettes each comprising one polynucleotide sequence of the present invention (e.g., a gag-expression cassette, an env expression cassette, and a rev expression cassette, or a pol-expression cassette, a vif expression cassette, and a vpr expression cassette, etc.); polyproteins produced by in-frame fusions of multiple polynucleotides of the present invention, and polycistronic polynucleotides produced using multiple polynucleotides of the present invention.
Example 2
Expression Assays for the Synthetic Coding Sequences
A. Type C HIV Coding Sequences
[0391]The wild-type Subtype C HIV coding (for example from AF110965, AF110967, AF110968, AF110975, as well as novel South African strains 8--5_TV1_,C.ZA, 8--2_TV1_C.ZA and 12-5--1_TV2_C.ZA) sequences are cloned into expression vectors having the same features as the vectors into which the synthetic sequences are cloned.
[0392]Expression efficiencies for various vectors carrying the wild-type and synthetic sequences are evaluated as follows. Cells from several mammalian cell lines (293, RD, COS-7, and CHO; all obtained from the American Type Culture Collection, 10801 University Boulevard, Manassas, Va. 20110-2209) are transfected with 2 μg of DNA in transfection reagent LT1 (PanVera Corporation, 545 Science Dr., Madison, Wis.). The cells are incubated for 5 hours in reduced serum medium (Opti-MEM, Gibco-BRL, Gaithersburg, Md.). The medium is then replaced with normal medium as follows: 293 cells, IMDM, 10% fetal calf serum, 2% glutamine (BioWhittaker, Walkersville, Md.); RD and COS-7 cells, D-MEM, 10% fetal calf serum, 2% glutamine (Opti-MEM, Gibco-BRL, Gaithersburg, Md.); and CHO cells, Ham's F-12, 10% fetal calf serum, 2% glutamine (Opti-MEM, Gibco-BRL, Gaithersburg, Md.). The cells are incubated for either 48 or 60 hours. Cell lysates are collected as described below in Example 3. Supernatants are harvested and filtered through 0.45 μm syringe filters. Supernatants are evaluated using the using 96-well plates coated with a murine monoclonal antibody directed against HIV antigen, for example a Coulter p24-assay (Coulter Corporation, Hialeah, Fla., US). The HIV-1 antigen binds to the coated wells. Biotinylated antibodies against HIV recognize the bound antigen. Conjugated strepavidin-horseradish peroxidase reacts with the biotin. Color develops from the reaction of peroxidase with TMB substrate. The reaction is terminated by addition of 4NH2SO4. The intensity of the color is directly proportional to the amount of HIV antigen in a sample.
[0393]Synthetic HIV Type C expression cassettes provides dramatic increases in production of their protein products, relative to the native (wild-type Subtype C) sequences, when expressed in a variety of cell lines.
B. Signal Peptide Leader Sequences
[0394]The ability of various leader sequences to drive expression was tested by transfecting cells with wild type or synthetic Env-encoding expression cassettes operably linked to different leader sequences and evaluating expression of Env polypeptide by ELISA or Western Blot. The amino acid and nucleotide sequence of various signal peptide leader sequences are shown in Table 4.
TABLE-US-00006 TABLE 4 Amino acid Leader sequence DNA sequence WTnative MRVMGTQKNCQQWWIW ATGAGAGTGATGGGGACACAGA (8_2_TV GILGFWMLMIC AGAATTGTCAACAATGGTGGAT 1_C.ZA) ATGGGGCATCTTAGGCTTCTGG ATGCTAATGATTTGT WTmod MRVMGTQKNCQQWWIW ATGCGCGTGATGGGCACCCAGA (8_2_TV GILGFWMLMIC AGAACTGCCAGCAGTGGTGGAT 1_C.ZA) CTGGGGCATCCTGGGCTTCTGG ATGCTGATGATCTGC Tpa1 MDAMKRGLCCVLLLCG ATGGATGCAATGAAGAGAGGGC AVFVSPSAS TCTGCTGTGTGCTGCTGCTGTG TGGAGCAGTCTTCGTTTCGCCC AGCGCCAGC Tpa2 MDAMKRGLCCVLLLCG ATGGATGCAATGAAGAGAGGGC AVFVSPS TCTGCTGTGTGCTGCTGCTGTG TGGAGCAGTCTTCGTTTCGCCC AGC
[0395]293 cells were transiently transfected using standard methods with native and sequence-modified constructs encoding the gp120 and gp140 forms of the 8--2_TV1_C.ZA (TV1c8.2) envelope. Env protein was measure in cell lysates and supernatants using an in-house Env capture ELISA. Results are shown in Table 5 below and indicate that the wild-type signal peptide leader sequence of the TV1c8.2 can be used to efficiently express the encoded envelope protein to levels that are better or comparable to those observed using the heterologous tpa leader sequences. Furthermore, the TV1c8.2 leader works in its native or sequence-modified forms and can be used with native or sequence-modified env genes. All constructs were tested after cloning of the gene cassettes into the EcoR1 and Xho1 sites of the pCMVlink expression vector.
TABLE-US-00007 TABLE 5 TV1c8.2 construct Supernatant (ng) Lysate (ng) Total (ng) gp140nat.wtL 532 149 681 gp140nat.tpa1 250 20 270 gp140nat.tpa2 192 34 226 gp120mod.wtLmod 6186 4576 10762 gp120mod.tpa1 6932 3808 10740 gp120mod.wtLnat 6680 4174 10854 gp140mod.wtLmod 1844 8507 10351 gp140mod.tpa1 1854 2925 4779 gp140mod.wtLnat 1532 3015 4547
[0396]The sequence-modified TV1c8.2 envelope variant gene cassettes were subcloned into a Chiron pCMV expression vector for the derivation of stable mammalian cell lines. Stable CHO cell lines expressing the TV1c8.2 envelope proteins were derived using standard methods of transfection, methotrexate amplification, and screening. These cell lines were found to secrete levels of envelope protein that were comparable to those observed for proteins expressed using the tpa leader sequences. Representative results are shown in Table 6 for two cell line clone expressing the TV1c8.2 gp120; they are compared to two reference clones expressing SF162 subtype B gp120 derived in a similar fashion but using the tpa leader. Protein concentrations were determined following densitometry of scanned gels of semi-purified proteins. Standard curves were generated using a highly purified and well-characterized preparation of SF2 gp120 protein and the concentrations of the test proteins were determined.
TABLE-US-00008 TABLE 6 Expression CHO cell line Clone # (ng/ml) gp120 SF162 Clone 65 921 Clone 71 972 gp120TV1.C8.2 Clone 159 1977 Clone 210 1920
[0397]The results were also confirmed by Western Blot Analysis, essentially as described in Example 3.
Example 3
Western Blot Analysis of Expression
A. HIV Type C Coding Sequences
[0398]Human 293 cells are transfected as described in Example 2 with pCMV-based vectors containing native or synthetic HIV Type C expression cassettes. Cells are cultivated for 60 hours post-transfection. Supernatants are prepared as described. Cell lysates are prepared as follows. The cells are washed once with phosphate-buffered saline, lysed with detergent [1% NP40 (Sigma Chemical Co., St. Louis, Mo.) in 0.1 M Tris-HCl, pH 7.5], and the lysate transferred into fresh tubes. SDS-polyacrylamide gels (pre-cast 8-16%; Novex, San Diego, Calif.) are loaded with 20 μl of supernatant or 12.5 μl of cell lysate. A protein standard is also loaded (5 broad size range standard; BioRad Laboratories, Hercules, Calif.). Electrophoresis is carried out and the proteins are transferred using a BioRad Transfer Chamber (BioRad Laboratories, Hercules, Calif.) to Immobilon P membranes (Millipore Corp., Bedford, Mass.) using the transfer buffer recommended by the manufacturer (Millipore), where the transfer is performed at 100 volts for 90 minutes. The membranes are exposed to HIV-1-positive human patient serum and immunostained using o-phenylenediamine dihydrochloride (OPD; Sigma).
[0399]Immunoblotting analysis shows that cells containing the synthetic expression cassette produce the expected protein at higher per-cell concentrations than cells containing the native expression cassette. The proteins are seen in both cell lysates and supernatants. The levels of production are significantly higher in cell supernatants for cells transfected with the synthetic expression cassettes of the present invention.
[0400]In addition, supernatants from the transfected 293 cells are fractionated on sucrose gradients. Aliquots of the supernatant are transferred to Polyclear® ultra-centrifuge tubes (Beckman Instruments, Columbia, Md.), under-laid with a solution of 20% (wt/wt) sucrose, and subjected to 2 hours centrifugation at 28,000 rpm in a Beckman SW28 rotor. The resulting pellet is suspended in PBS and layered onto a 20-60% (wt/wt) sucrose gradient and subjected to 2 hours centrifugation at 40,000 rpm in a Beckman SW41ti rotor.
[0401]The gradient is then fractionated into approximately 10×1 ml aliquots (starting at the top, 20%-end, of the gradient). Samples are taken from fractions 1-9 and are electrophoresed on 8-16% SDS polyacrylamide gels. The supernatants from 293/synthetic cells give much stronger bands than supernatants from 293/native cells.
Example 4
In Vivo Immunogenicity of Synthetic HIV Type C Expression Cassettes
A. Immunization
[0402]To evaluate the possibly improved immunogenicity of the synthetic HIV Type C expression cassettes, a mouse study is performed. The plasmid DNA, pCMVKM2 carrying the synthetic Gag expression cassette, is diluted to the following final concentrations in a total injection volume of 100 μl: 20 μg, 2 μg, 0.2 μg, 0.02 and 0.002 μg. To overcome possible negative dilution effects of the diluted DNA, the total DNA concentration in each sample is brought up to 20 μg using the vector (pCMVKM2) alone. As a control, plasmid DNA of the native Gag expression cassette is handled in the same manner. Twelve groups of four to ten Balb/c mice (Charles River, Boston, Mass.) are intramuscularly immunized (50 μA per leg, intramuscular injection into the tibialis anterior) according to the schedule in Table 1.
TABLE-US-00009 TABLE 1 Gag or Env Expression Concentration of Gag or Immunized at time Group Cassette Env plasmid DNA (μg) (weeks): 1 Synthetic 20 01, 4.sup. 2 Synthetic 2 0, 4 3 Synthetic 0.2 0, 4 4 Synthetic 0.02 0, 4 5 Synthetic 0.002 0, 4 6 Synthetic 20 0 7 Synthetic 2 0 8 Synthetic 0.2 0 9 Synthetic 0.02 0 10 Synthetic 0.002 0 11 Native 20 0, 4 12 Native 2 0, 4 13 Native 0.2 0, 4 14 Native 0.02 0, 4 15 Native 0.002 0, 4 16 Native 20 0 17 Native 2 0 18 Native 0.2 0 19 Native 0.02 0 20 Native 0.002 0 1= initial immunization at "week 0"
[0403]Groups 1-5 and 11-15 are bled at week 0 (before immunization), week 4, week 6, week 8, and week 12. Groups 6-20 and 16-20 are bled at week 0 (before immunization) and at week 4.
B. Humoral Immune Response
[0404]The humoral immune response is checked with an anti-HIV antibody ELISAs (enzyme-linked immunosorbent assays) of the mice sera 0 and 4 weeks post immunization (groups 5-12) and, in addition, 6 and 8 weeks post immunization, respectively, 2 and 4 weeks post second immunization (groups 1-4).
[0405]The antibody titers of the sera are determined by using the appropriate anti-HIV polypeptide (e.g., anti-Pol, anti-Gag, anti-Env, anti-Vif, anti-Vpu, etc.) antibody ELISA. Briefly, sera from immunized mice are screened for antibodies directed against the HIV proteins (e.g., p55 Gag protein, an Env protein, e.g., gp160 or gp120 or a Pol protein, e.g., p6, prot or RT, etc). ELISA microtiter plates are coated with 0.2 μg of HIV protein per well overnight and washed four times; subsequently, blocking is done with PBS-0.2% Tween (Sigma) for 2 hours. After removal of the blocking solution, 100 μl of diluted mouse serum is added. Sera are tested at 1/25 dilutions and by serial 3-fold dilutions, thereafter. Microtiter plates are washed four times and incubated with a secondary, peroxidase-coupled anti-mouse IgG antibody (Pierce, Rockford, Ill.). ELISA plates are washed and 100 μl of 3,3',5,5'-tetramethyl benzidine (TMB; Pierce) is added per well. The optical density of each well is measured after 15 minutes. The titers reported are the reciprocal of the dilution of serum that gave a half-maximum optical density (O.D.).
[0406]Synthetic expression cassettes will provide a clear improvement of immunogenicity relative to the native expression cassettes,
C. Cellular Immune Response
[0407]The frequency of specific cytotoxic T-lymphocytes (CTL) is evaluated by a standard chromium release assay of peptide pulsed mouse (Balb/c, CB6F1 and/or C3H) CD4 cells. HIV polypeptide (e.g., Pol, Gag or Env) expressing vaccinia virus infected CD-8 cells are used as a positive control. Briefly, spleen cells (Effector cells, E) are obtained from the mice immunized as described above are cultured, restimulated, and assayed for CTL activity against Gag peptide-pulsed target cells as described (Doe, B., and Walker, C. M., AIDS 10(7):793-794, 1996). Cytotoxic activity is measured in a standard 51Cr release assay. Target (T) cells are cultured with effector (E) cells at various E:T ratios for 4 hours and the average cpm from duplicate wells are used to calculate percent specific 51Cr release.
[0408]Cytotoxic T-cell (CTL) activity is measured in splenocytes recovered from the mice immunized with HIV Gag or Env DNA. Effector cells from the Gag or Env DNA-immunized animals exhibit specific lysis of HIV polypeptide-pulsed SV-BALB (MHC matched) targets cells, indicative of a CTL response. Target cells that are peptide-pulsed and derived from an MHC-unmatched mouse strain (MC57) are not lysed.
[0409]Thus, synthetic expression cassettes exhibit increased potency for induction of cytotoxic T-lymphocyte (CTL) responses by DNA immunization.
Example 5
DNA-Immunization of Non-Human Primates Using a Synthetic HIV Type C Expression Cassette
[0410]Non-human primates are immunized multiple times (e.g., weeks 0, 4, 8 and 24) intradermally, mucosally or bilaterally, intramuscular, into the quadriceps using various doses (e.g., 1-5 mg) and various combinations of synthetic HIV Type C plasmids. The animals are bled two weeks after each immunization and ELISA is performed with isolated plasma. The ELISA is performed essentially as described in Example 4 except the second antibody-conjugate is an anti-human IgG, g-chain specific, peroxidase conjugate (Sigma Chemical Co., St. Louis, Md. 63178) used at a dilution of 1:500. Fifty μg/ml yeast extract is added to the dilutions of plasma samples and antibody conjugate to reduce non-specific background due to preexisting yeast antibodies in the non-human primates.
[0411]Further, lymphoproliferative responses to antigen can also be evaluated post-immunization, indicative of induction of T-helper cell functions.
[0412]Synthetic plasmid DNA are expected to be immunogenic in non-human primates.
Example 6
In Vitro Expression of Recombinant Sindbis RNA and DNA Containing the Synthetic HIV Type C Expression Cassette
[0413]To evaluate the expression efficiency of the synthetic Pol, Env and Gag expression cassette in Alphavirus vectors, the selected synthetic expression cassette is subcloned into both plasmid DNA-based and recombinant vector particle-based Sindbis virus vectors. Specifically, a cDNA vector construct for in vitro transcription of Sindbis virus RNA vector replicons (pRSIN-luc; Dubensky, et al., J Virol. 70:508-519, 1996) is modified to contain a PmeI site for plasmid linearization and a polylinker for insertion of heterologous genes. A polylinker is generated using two oligonucleotides that contain the sites XhoI, PmlI, ApaI, NarI, XbaI, and Nod (XPANXNF, and XPANXNR).
[0414]The plasmid pRSIN-luc (Dubensky et al., supra) is digested with XhoI and NotI to remove the luciferase gene insert, blunt-ended using Klenow and dNTPs, and purified from an agarose get using GeneCleanII (Bio101, Vista, Calif.). The oligonucleotides are annealed to each other and ligated into the plasmid. The resulting construct is digested with NotI and SacI to remove the minimal Sindbis 3'-end sequence and A40 tract, and ligated with an approximately 0.4 kbp fragment from PKSSIN1-BV (WO 97/38087). This 0.4 kbp fragment is obtained by digestion of pKSSIN1-BV with NotI and SacI, and purification after size fractionation from an agarose gel. The fragment contains the complete Sindbis virus 3'-end, an A40 tract and a PmeI site for linearization. This new vector construct is designated SINBVE.
[0415]The synthetic HIV coding sequences are obtained from the parental plasmid by digestion with EcoRI, blunt-ending with Klenow and dNTPs, purification with GeneCleanII, digestion with SalI, size fractionation on an agarose gel, and purification from the agarose gel using GeneCleanII. The synthetic HIV polypeptide-coding fragment is ligated into the SINBVE vector that is digested with XhoI and PmtI. The resulting vector is purified using GeneCleanII and is designated SINBVGag. Vector RNA replicons may be transcribed in vitro (Dubensky et al., supra) from SINBVGag and used directly for transfection of cells. Alternatively, the replicons may be packaged into recombinant vector particles by co-transfection with defective helper RNAs or using an alphavirus packaging cell line.
[0416]The DNA-based Sindbis virus vector pDCMVSIN-beta-gal (Dubensky, et al., J Virol. 70:508-519, 1996) is digested with SalI and XbaI, to remove the beta-galactosidase gene insert, and purified using GeneCleanII after agarose gel size fractionation. The HIV Gag or Env gene is inserted into the pDCMVSIN-beta-gal by digestion of SINBVGag with SalI and XhoI, purification using GeneCleanII of the Gag-containing fragment after agarose gel size fractionation, and ligation. The resulting construct is designated pDSIN-Gag, and may be used directly for in vivo administration or formulated using any of the methods described herein.
[0417]BHK and 293 cells are transfected with recombinant Sindbis RNA and DNA, respectively. The supernatants and cell lysates are tested with the Coulter capture ELISA (Example 2).
[0418]BHK cells are transfected by electroporation with recombinant Sindbis RNA.
[0419]293 cells are transfected using LT-1 (Example 2) with recombinant Sindbis DNA. Synthetic Gag- and/or Env-containing plasmids are used as positive controls. Supernatants and lysates are collected 48 h post transfection.
[0420]Type C HIV proteins can be efficiently expressed from both DNA and RNA-based Sindbis vector systems using the synthetic expression cassettes.
Example 7
In Vivo Immunogenicity of Recombinant Sindbis Replicon Vectors Containing Synthetic Pol, Gag and/or Env Expression Cassettes
A. Immunization
[0421]To evaluate the immunogenicity of recombinant synthetic HIV Type C expression cassettes in Sindbis replicons, a mouse study is performed. The Sindbis virus DNA vector carrying synthetic expression cassettes (Example 6), is diluted to the following final concentrations in a total injection volume of 100 μl: 20 μg, 2 μg, 0.2 μg, 0.02 and 0.002 μg. To overcome possible negative dilution effects of the diluted DNA, the total DNA concentration in each sample is brought up to 20 μg using the Sindbis replicon vector DNA alone. Twelve groups of four to ten Balb/c mice (Charles River, Boston, Mass.) are intramuscularly immunized (50 μl per leg, intramuscular injection into the tibialis anterior) according to the schedule in Table 2. Alternatively, Sindbis viral particles are prepared at the following doses: 103 pfu, 105 pfu and 107 pfu in 100 μl, as shown in Table 3. Sindbis HIV polypeptide particle preparations are administered to mice using intramuscular and subcutaneous routes (50 μl per site).
TABLE-US-00010 TABLE 2 Gag or Env Expression Concentration of Gag Immunized at time Group Cassette or Env DNA (μg) (weeks): 1 Synthetic 20 01, 4.sup. 2 Synthetic 2 0, 4 3 Synthetic 0.2 0, 4 4 Synthetic 0.02 0, 4 5 Synthetic 0.002 0, 4 6 Synthetic 20 0 7 Synthetic 2 0 8 Synthetic 0.2 0 9 Synthetic 0.02 0 10 Synthetic 0.002 0 1= initial immunization at "week 0"
TABLE-US-00011 TABLE 3 Gag or Env Concentration of viral Immunized at time Group sequence particle (pfu) (weeks): 1 Synthetic 103 01, 4.sup. 2 Synthetic 105 0, 4 3 Synthetic 107 0, 4 8 Synthetic 103 0 9 Synthetic 105 0 10 Synthetic 107 0 1= initial immunization at "week 0"
[0422]Groups are bled and assessment of both humoral and cellular (e.g., frequency of specific CTLs) is performed, essentially as described in Example 4.
Example 8
Identification and Sequencing of a Novel HIV Type C Variants
[0423]A full-length clone, called 8--5_TV1_C.ZA, encoding an HIV Type C was isolated and sequenced. Briefly, genomic DNA from HIV-1 subtype C infected South African patients was isolated from PBMC (peripheral blood mononuclear cells) by alkaline lysis and anion-exchange columns (Quiagen). To get the genome of full-length clones two halves were amplified, that could later be joined together in frame within the Pol region using an unique Sal 1 site in both fragments. For the amplification, 200-800 ng of genomic DNA were added to the buffer and enzyme mix of the Expand Long Template PCR System after the protocol of the manufacturer (Boehringer Mannheim). The primer were designed after alignments of known full length sequences. For the 5' half a primer mix of 2 forward primers containing either thymidine (S1FCSacTA 5'-GTTTCTTGAGCTCTGGAAGGGTTAATTTAC TCCAAGAA-3', SEQ ID NO:38) or cytosine on position 20 (S1FTSacTA 5'-GTTTCTTGAGCTCTGGAAGGGTTAATTTACTCTAAGAA, SEQ ID NO:39) plus Sal 1 site, were used. The reverse primer were also a mix of two primers with either thymidine or cytosine on position 13 (S145RTSalTA 5'-GTTTCTTGTCGACTTGTCCATGTATGGCTTCCCC T-3', SEQ ID NO:40 and S145RCSalTA 5'-GTTTCTTGTCGACTTGTCCATGCATGGCTTCCCT-3' SEQ ID NO:41) and contained a Sal 1 site. The forward primer for the 3' half was also a mixture of two primers (S245FASalTA 5'-GTTTCTTGTCGACTGTAGTCCAGGaATATGGCAAT TAG-3' SEQ ID NO:42 and S245FGSalTA 5'-GTTTCTTGTCGACTGTAGTCCAGGgATATG GCAA TTAG-3' SEQ ID NO:43) with Sal 1 site and adenine or guanine on position 12. The reverse primer had a Not 1 site (S2_FullNotTA 5'-GTTTCTTGCGGCCGCTGCTAGA GATTTTCCACACTACCA-3' SEQ ID NO:44). After amplification the PCR products were purified using a 1% agarose gel and cloned into the pCR-XL-TOPO vector via TA cloning (Invitrogen). Colonies were checked by restriction analysis and sequence verified. For the full length sequence the sequences of the 5'- and 3' half were combined. The sequence is shown in SEQ ID NO:33. Furthermore, important domains are shown in Table A.
[0424]Another clone, designated 12-5--1_TV2_C.ZA was also sequenced and is shown in SEQ ID NO:45. The domains can be readily determined in view of the teachings of the specification, for example by aligning the sequence to those shown in Table A to find the corresponding regions in clone 12-5--1_TV2_C.ZA.
[0425]As described above (Example 1, Table C), synthetic expression cassettes were generated using one or more polynucleotide sequences obtained from 8--5_TV 1_C.ZA or 12-5--1_TV2_C.ZA.
[0426]The polynucleotides described herein have all been deposited at Chiron Corporation, Emeryville, Calif.
[0427]Although preferred embodiments of the subject invention have been described in some detail, it is understood that obvious variations can be made without departing from the spirit and the scope of the invention as defined by the appended claims.
Sequence CWU
1
SEQUENCE LISTING
<160> NUMBER OF SEQ ID NOS: 150
<210> SEQ ID NO 1
<211> LENGTH: 60
<212> TYPE: DNA
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 1
gacatcaagc agggccccaa ggagcccttc cgcgactacg tggaccgctt cttcaagacc 60
<210> SEQ ID NO 2
<211> LENGTH: 60
<212> TYPE: DNA
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 2
gacatccgcc agggccccaa ggagcccttc cgcgactacg tggaccgctt cttcaagacc 60
<210> SEQ ID NO 3
<211> LENGTH: 1479
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic Gag of HIV strain AF110965
<400> SEQUENCE: 3
atgggcgccc gcgccagcat cctgcgcggc ggcaagctgg acgcctggga gcgcatccgc 60
ctgcgccccg gcggcaagaa gtgctacatg atgaagcacc tggtgtgggc cagccgcgag 120
ctggagaagt tcgccctgaa ccccggcctg ctggagacca gcgagggctg caagcagatc 180
atccgccagc tgcaccccgc cctgcagacc ggcagcgagg agctgaagag cctgttcaac 240
accgtggcca ccctgtactg cgtgcacgag aagatcgagg tccgcgacac caaggaggcc 300
ctggacaaga tcgaggagga gcagaacaag tgccagcaga agatccagca ggccgaggcc 360
gccgacaagg gcaaggtgag ccagaactac cccatcgtgc agaacctgca gggccagatg 420
gtgcaccagg ccatcagccc ccgcaccctg aacgcctggg tgaaggtgat cgaggagaag 480
gccttcagcc ccgaggtgat ccccatgttc accgccctga gcgagggcgc caccccccag 540
gacctgaaca cgatgttgaa caccgtgggc ggccaccagg ccgccatgca gatgctgaag 600
gacaccatca acgaggaggc cgccgagtgg gaccgcgtgc accccgtgca cgccggcccc 660
atcgcccccg gccagatgcg cgagccccgc ggcagcgaca tcgccggcac caccagcacc 720
ctgcaggagc agatcgcctg gatgaccagc aaccccccca tccccgtggg cgacatctac 780
aagcggtgga tcatcctggg cctgaacaag atcgtgcgga tgtacagccc cgtgagcatc 840
ctggacatca agcagggccc caaggagccc ttccgcgact acgtggaccg cttcttcaag 900
accctgcgcg ccgagcagag cacccaggag gtgaagaact ggatgaccga caccctgctg 960
gtgcagaacg ccaaccccga ctgcaagacc atcctgcgcg ctctcggccc cggcgccagc 1020
ctggaggaga tgatgaccgc ctgccagggc gtgggcggcc ccagccacaa ggcccgcgtg 1080
ctggccgagg cgatgagcca ggccaacacc agcgtgatga tgcagaagag caacttcaag 1140
ggcccccggc gcatcgtcaa gtgcttcaac tgcggcaagg agggccacat cgcccgcaac 1200
tgccgcgccc cccgcaagaa gggctgctgg aagtgcggca aggagggcca ccagatgaag 1260
gactgcaccg agcgccaggc caacttcctg ggcaagatct ggcccagcca caagggccgc 1320
cccggcaact tcctgcagag ccgccccgag cccaccgccc cccccgccga gagcttccgc 1380
ttcgaggaga ccacccccgg ccagaagcag gagagcaagg accgcgagac cctgaccagc 1440
ctgaagagcc tgttcggcaa cgaccccctg agccagtaa 1479
<210> SEQ ID NO 4
<211> LENGTH: 1509
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic Gag of HIV strain AF110967
<400> SEQUENCE: 4
atgggcgccc gcgccagcat cctgcgcggc gagaagctgg acaagtggga gaagatccgc 60
ctgcgccccg gcggcaagaa gcactacatg ctgaagcacc tggtgtgggc cagccgcgag 120
ctggagggct tcgccctgaa ccccggcctg ctggagaccg ccgagggctg caagcagatc 180
atgaagcagc tgcagcccgc cctgcagacc ggcaccgagg agctgcgcag cctgtacaac 240
accgtggcca ccctgtactg cgtgcacgcc ggcatcgagg tccgcgacac caaggaggcc 300
ctggacaaga tcgaggagga gcagaacaag tcccagcaga agacccagca ggccaaggag 360
gccgacggca aggtgagcca gaactacccc atcgtgcaga acctgcaggg ccagatggtg 420
caccaggcca tcagcccccg caccctgaac gcctgggtga aggtgatcga ggagaaggcc 480
ttcagccccg aggtgatccc catgttcacc gccctgagcg agggcgccac cccccaggac 540
ctgaacacga tgttgaacac cgtgggcggc caccaggccg ccatgcagat gctgaaggac 600
accatcaacg aggaggccgc cgagtgggac cgcctgcacc ccgtgcaggc cggccccgtg 660
gcccccggcc agatgcgcga cccccgcggc agcgacatcg ccggcgccac cagcaccctg 720
caggagcaga tcgcctggat gaccagcaac ccccccgtgc ccgtgggcga catctacaag 780
cggtggatca tcctgggcct gaacaagatc gtgcggatgt acagccccgt gagcatcctg 840
gacatccgcc agggccccaa ggagcccttc cgcgactacg tggaccgctt cttcaagacc 900
ctgcgcgccg agcaggccac ccaggacgtg aagaactgga tgaccgagac cctgctggtg 960
cagaacgcca accccgactg caagaccatc ctgcgcgctc tcggccccgg cgccaccctg 1020
gaggagatga tgaccgcctg ccagggcgtg ggcggccccg gccacaaggc ccgcgtgctg 1080
gccgaggcga tgagccaggc caacagcgtg aacatcatga tgcagaagag caacttcaag 1140
ggcccccggc gcaacgtcaa gtgcttcaac tgcggcaagg agggccacat cgccaagaac 1200
tgccgcgccc cccgcaagaa gggctgctgg aagtgcggca aggagggcca ccagatgaag 1260
gactgcaccg agcgccaggc caacttcctg ggcaagatct ggcccagcca caagggccgc 1320
cccggcaact tcctgcagaa ccgcagcgag cccgccgccc ccaccgtgcc caccgccccc 1380
cccgccgaga gcttccgctt cgaggagacc acccccgccc ccaagcagga gcccaaggac 1440
cgcgagccct accgcgagcc cctgaccgcc ctgcgcagcc tgttcggcag cggccccctg 1500
agccagtaa 1509
<210> SEQ ID NO 5
<211> LENGTH: 141
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Env common region of HIV strain AF110968
<400> SEQUENCE: 5
accatcacca tcacctgccg catcaagcag atcatcaaca tgtggcagaa ggtgggccgc 60
gccatgtacg ccccccccat cgccggcaac ctgacctgcg agagcaacat caccggcctg 120
ctgctgaccc gcgacggcgg c 141
<210> SEQ ID NO 6
<211> LENGTH: 1431
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic gp120 coding region of HIV strain
AF110968
<400> SEQUENCE: 6
agcgtggtgg gcaacctgtg ggtgaccgtg tactacggcg tgcccgtgtg gaaggaggcc 60
aagaccaccc tgttctgcac cagcgacgcc aaggcctacg agaccgaggt gcacaacgtg 120
tgggccaccc acgcctgcgt gcccaccgac cccaaccccc aggagatcgt gctggagaac 180
gtgaccgaga acttcaacat gtggaagaac gacatggtgg accagatgca cgaggacatc 240
atcagcctgt gggaccagag cctgaagccc tgcgtgaagc tgacccccct gtgcgtgacc 300
ctgaagtgcc gcaacgtgaa cgccaccaac aacatcaaca gcatgatcga caacagcaac 360
aagggcgaga tgaagaactg cagcttcaac gtgaccaccg agctgcgcga ccgcaagcag 420
gaggtgcacg ccctgttcta ccgcctggac gtggtgcccc tgcagggcaa caacagcaac 480
gagtaccgcc tgatcaactg caacaccagc gccatcaccc aggcctgccc caaggtgagc 540
ttcgacccca tccccatcca ctactgcacc cccgccggct acgccatcct gaagtgcaac 600
aaccagacct tcaacggcac cggcccctgc aacaacgtga gcagcgtgca gtgcgcccac 660
ggcatcaagc ccgtggtgag cacccagctg ctgctgaacg gcagcctggc caagggcgag 720
atcatcatcc gcagcgagaa cctggccaac aacgccaaga tcatcatcgt gcagctgaac 780
aagcccgtga agatcgtgtg cgtgcgcccc aacaacaaca cccgcaagag cgtgcgcatc 840
ggccccggcc agaccttcta cgccaccggc gagatcatcg gcgacatccg ccaggcctac 900
tgcatcatca acaagaccga gtggaacagc accctgcagg gcgtgagcaa gaagctggag 960
gagcacttca gcaagaaggc catcaagttc gagcccagca gcggcggcga cctggagatc 1020
accacccaca gcttcaactg ccgcggcgag ttcttctact gcgacaccag ccagctgttc 1080
aacagcacct acagccccag cttcaacggc accgagaaca agctgaacgg caccatcacc 1140
atcacctgcc gcatcaagca gatcatcaac atgtggcaga aggtgggccg cgccatgtac 1200
gcccccccca tcgccggcaa cctgacctgc gagagcaaca tcaccggcct gctgctgacc 1260
cgcgacggcg gcaagaccgg ccccaacgac accgagatct tccgccccgg cggcggcgac 1320
atgcgcgaca actggcgcaa cgagctgtac aagtacaagg tggtggagat caagcccctg 1380
ggcgtggccc ccaccgaggc caagcgccgc gtggtggagc gcgagaagcg c 1431
<210> SEQ ID NO 7
<211> LENGTH: 1944
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic gp140 coding region of HIV strain
AF110968
<400> SEQUENCE: 7
agcgtggtgg gcaacctgtg ggtgaccgtg tactacggcg tgcccgtgtg gaaggaggcc 60
aagaccaccc tgttctgcac cagcgacgcc aaggcctacg agaccgaggt gcacaacgtg 120
tgggccaccc acgcctgcgt gcccaccgac cccaaccccc aggagatcgt gctggagaac 180
gtgaccgaga acttcaacat gtggaagaac gacatggtgg accagatgca cgaggacatc 240
atcagcctgt gggaccagag cctgaagccc tgcgtgaagc tgacccccct gtgcgtgacc 300
ctgaagtgcc gcaacgtgaa cgccaccaac aacatcaaca gcatgatcga caacagcaac 360
aagggcgaga tgaagaactg cagcttcaac gtgaccaccg agctgcgcga ccgcaagcag 420
gaggtgcacg ccctgttcta ccgcctggac gtggtgcccc tgcagggcaa caacagcaac 480
gagtaccgcc tgatcaactg caacaccagc gccatcaccc aggcctgccc caaggtgagc 540
ttcgacccca tccccatcca ctactgcacc cccgccggct acgccatcct gaagtgcaac 600
aaccagacct tcaacggcac cggcccctgc aacaacgtga gcagcgtgca gtgcgcccac 660
ggcatcaagc ccgtggtgag cacccagctg ctgctgaacg gcagcctggc caagggcgag 720
atcatcatcc gcagcgagaa cctggccaac aacgccaaga tcatcatcgt gcagctgaac 780
aagcccgtga agatcgtgtg cgtgcgcccc aacaacaaca cccgcaagag cgtgcgcatc 840
ggccccggcc agaccttcta cgccaccggc gagatcatcg gcgacatccg ccaggcctac 900
tgcatcatca acaagaccga gtggaacagc accctgcagg gcgtgagcaa gaagctggag 960
gagcacttca gcaagaaggc catcaagttc gagcccagca gcggcggcga cctggagatc 1020
accacccaca gcttcaactg ccgcggcgag ttcttctact gcgacaccag ccagctgttc 1080
aacagcacct acagccccag cttcaacggc accgagaaca agctgaacgg caccatcacc 1140
atcacctgcc gcatcaagca gatcatcaac atgtggcaga aggtgggccg cgccatgtac 1200
gcccccccca tcgccggcaa cctgacctgc gagagcaaca tcaccggcct gctgctgacc 1260
cgcgacggcg gcaagaccgg ccccaacgac accgagatct tccgccccgg cggcggcgac 1320
atgcgcgaca actggcgcaa cgagctgtac aagtacaagg tggtggagat caagcccctg 1380
ggcgtggccc ccaccgaggc caagcgccgc gtggtggagc gcgagaagcg cgccgtgggc 1440
atcggcgccg tgttcctggg cttcctgggc gccgccggca gcaccatggg cgccgccagc 1500
atcaccctga ccgtgcaggc ccgcctgctg ctgagcggca tcgtgcagca gcagaacaac 1560
ctgctgcgcg ccatcgaggc ccagcagcac ctgctgcagc tgaccgtgtg gggcatcaag 1620
cagctgcaga cccgcatcct ggccgtggag cgctacctga aggaccagca gctgctgggc 1680
atctggggct gcagcggcaa gctgatctgc accaccgccg tgccctggaa cagcagctgg 1740
agcaaccgca gccacgacga gatctgggac aacatgacct ggatgcagtg ggaccgcgag 1800
atcaacaact acaccgacac catctaccgc ctgctggagg agagccagaa ccagcaggag 1860
aagaacgaga aggacctgct ggccctggac agctggcaga acctgtggaa ctggttcagc 1920
atcaccaact ggctgtggta catc 1944
<210> SEQ ID NO 8
<211> LENGTH: 2466
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic gp160 coding region of HIV strain
AF110968
<400> SEQUENCE: 8
agcgtggtgg gcaacctgtg ggtgaccgtg tactacggcg tgcccgtgtg gaaggaggcc 60
aagaccaccc tgttctgcac cagcgacgcc aaggcctacg agaccgaggt gcacaacgtg 120
tgggccaccc acgcctgcgt gcccaccgac cccaaccccc aggagatcgt gctggagaac 180
gtgaccgaga acttcaacat gtggaagaac gacatggtgg accagatgca cgaggacatc 240
atcagcctgt gggaccagag cctgaagccc tgcgtgaagc tgacccccct gtgcgtgacc 300
ctgaagtgcc gcaacgtgaa cgccaccaac aacatcaaca gcatgatcga caacagcaac 360
aagggcgaga tgaagaactg cagcttcaac gtgaccaccg agctgcgcga ccgcaagcag 420
gaggtgcacg ccctgttcta ccgcctggac gtggtgcccc tgcagggcaa caacagcaac 480
gagtaccgcc tgatcaactg caacaccagc gccatcaccc aggcctgccc caaggtgagc 540
ttcgacccca tccccatcca ctactgcacc cccgccggct acgccatcct gaagtgcaac 600
aaccagacct tcaacggcac cggcccctgc aacaacgtga gcagcgtgca gtgcgcccac 660
ggcatcaagc ccgtggtgag cacccagctg ctgctgaacg gcagcctggc caagggcgag 720
atcatcatcc gcagcgagaa cctggccaac aacgccaaga tcatcatcgt gcagctgaac 780
aagcccgtga agatcgtgtg cgtgcgcccc aacaacaaca cccgcaagag cgtgcgcatc 840
ggccccggcc agaccttcta cgccaccggc gagatcatcg gcgacatccg ccaggcctac 900
tgcatcatca acaagaccga gtggaacagc accctgcagg gcgtgagcaa gaagctggag 960
gagcacttca gcaagaaggc catcaagttc gagcccagca gcggcggcga cctggagatc 1020
accacccaca gcttcaactg ccgcggcgag ttcttctact gcgacaccag ccagctgttc 1080
aacagcacct acagccccag cttcaacggc accgagaaca agctgaacgg caccatcacc 1140
atcacctgcc gcatcaagca gatcatcaac atgtggcaga aggtgggccg cgccatgtac 1200
gcccccccca tcgccggcaa cctgacctgc gagagcaaca tcaccggcct gctgctgacc 1260
cgcgacggcg gcaagaccgg ccccaacgac accgagatct tccgccccgg cggcggcgac 1320
atgcgcgaca actggcgcaa cgagctgtac aagtacaagg tggtggagat caagcccctg 1380
ggcgtggccc ccaccgaggc caagcgccgc gtggtggagc gcgagaagcg cgccgtgggc 1440
atcggcgccg tgttcctggg cttcctgggc gccgccggca gcaccatggg cgccgccagc 1500
atcaccctga ccgtgcaggc ccgcctgctg ctgagcggca tcgtgcagca gcagaacaac 1560
ctgctgcgcg ccatcgaggc ccagcagcac ctgctgcagc tgaccgtgtg gggcatcaag 1620
cagctgcaga cccgcatcct ggccgtggag cgctacctga aggaccagca gctgctgggc 1680
atctggggct gcagcggcaa gctgatctgc accaccgccg tgccctggaa cagcagctgg 1740
agcaaccgca gccacgacga gatctgggac aacatgacct ggatgcagtg ggaccgcgag 1800
atcaacaact acaccgacac catctaccgc ctgctggagg agagccagaa ccagcaggag 1860
aagaacgaga aggacctgct ggccctggac agctggcaga acctgtggaa ctggttcagc 1920
atcaccaact ggctgtggta catcaagatc ttcatcatga tcgtgggcgg cctgatcggc 1980
ctgcgcatca tcttcgccgt gctgagcatc gtgaaccgcg tgcgccaggg ctacagcccc 2040
ctgcccttcc agaccctgac ccccaacccc cgcgagcccg accgcctggg ccgcatcgag 2100
gaggagggcg gcgagcagga ccgcggccgc agcatccgcc tggtgagcgg cttcctggcc 2160
ctggcctggg acgacctgcg cagcctgtgc ctgttcagct accaccgcct gcgcgacttc 2220
atcctgatcg ccgcccgcgt gctggagctg ctgggccagc gcggctggga ggccctgaag 2280
tacctgggca gcctggtgca gtactggggc ctggagctga agaagagcgc catcagcctg 2340
ctggacacca tcgccatcgc cgtggccgag ggcaccgacc gcatcatcga gttcatccag 2400
cgcatctgcc gcgccatccg caacatcccc cgccgcatcc gccagggctt cgaggccgcc 2460
ctgcag 2466
<210> SEQ ID NO 9
<211> LENGTH: 2547
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic signal sequence and gp160 coding
region of HIV strain AF110968
<400> SEQUENCE: 9
atgcgcgtga tgggcatcct gaagaactac cagcagtggt ggatgtgggg catcctgggc 60
ttctggatgc tgatcatcag cagcgtggtg ggcaacctgt gggtgaccgt gtactacggc 120
gtgcccgtgt ggaaggaggc caagaccacc ctgttctgca ccagcgacgc caaggcctac 180
gagaccgagg tgcacaacgt gtgggccacc cacgcctgcg tgcccaccga ccccaacccc 240
caggagatcg tgctggagaa cgtgaccgag aacttcaaca tgtggaagaa cgacatggtg 300
gaccagatgc acgaggacat catcagcctg tgggaccaga gcctgaagcc ctgcgtgaag 360
ctgacccccc tgtgcgtgac cctgaagtgc cgcaacgtga acgccaccaa caacatcaac 420
agcatgatcg acaacagcaa caagggcgag atgaagaact gcagcttcaa cgtgaccacc 480
gagctgcgcg accgcaagca ggaggtgcac gccctgttct accgcctgga cgtggtgccc 540
ctgcagggca acaacagcaa cgagtaccgc ctgatcaact gcaacaccag cgccatcacc 600
caggcctgcc ccaaggtgag cttcgacccc atccccatcc actactgcac ccccgccggc 660
tacgccatcc tgaagtgcaa caaccagacc ttcaacggca ccggcccctg caacaacgtg 720
agcagcgtgc agtgcgccca cggcatcaag cccgtggtga gcacccagct gctgctgaac 780
ggcagcctgg ccaagggcga gatcatcatc cgcagcgaga acctggccaa caacgccaag 840
atcatcatcg tgcagctgaa caagcccgtg aagatcgtgt gcgtgcgccc caacaacaac 900
acccgcaaga gcgtgcgcat cggccccggc cagaccttct acgccaccgg cgagatcatc 960
ggcgacatcc gccaggccta ctgcatcatc aacaagaccg agtggaacag caccctgcag 1020
ggcgtgagca agaagctgga ggagcacttc agcaagaagg ccatcaagtt cgagcccagc 1080
agcggcggcg acctggagat caccacccac agcttcaact gccgcggcga gttcttctac 1140
tgcgacacca gccagctgtt caacagcacc tacagcccca gcttcaacgg caccgagaac 1200
aagctgaacg gcaccatcac catcacctgc cgcatcaagc agatcatcaa catgtggcag 1260
aaggtgggcc gcgccatgta cgcccccccc atcgccggca acctgacctg cgagagcaac 1320
atcaccggcc tgctgctgac ccgcgacggc ggcaagaccg gccccaacga caccgagatc 1380
ttccgccccg gcggcggcga catgcgcgac aactggcgca acgagctgta caagtacaag 1440
gtggtggaga tcaagcccct gggcgtggcc cccaccgagg ccaagcgccg cgtggtggag 1500
cgcgagaagc gcgccgtggg catcggcgcc gtgttcctgg gcttcctggg cgccgccggc 1560
agcaccatgg gcgccgccag catcaccctg accgtgcagg cccgcctgct gctgagcggc 1620
atcgtgcagc agcagaacaa cctgctgcgc gccatcgagg cccagcagca cctgctgcag 1680
ctgaccgtgt ggggcatcaa gcagctgcag acccgcatcc tggccgtgga gcgctacctg 1740
aaggaccagc agctgctggg catctggggc tgcagcggca agctgatctg caccaccgcc 1800
gtgccctgga acagcagctg gagcaaccgc agccacgacg agatctggga caacatgacc 1860
tggatgcagt gggaccgcga gatcaacaac tacaccgaca ccatctaccg cctgctggag 1920
gagagccaga accagcagga gaagaacgag aaggacctgc tggccctgga cagctggcag 1980
aacctgtgga actggttcag catcaccaac tggctgtggt acatcaagat cttcatcatg 2040
atcgtgggcg gcctgatcgg cctgcgcatc atcttcgccg tgctgagcat cgtgaaccgc 2100
gtgcgccagg gctacagccc cctgcccttc cagaccctga cccccaaccc ccgcgagccc 2160
gaccgcctgg gccgcatcga ggaggagggc ggcgagcagg accgcggccg cagcatccgc 2220
ctggtgagcg gcttcctggc cctggcctgg gacgacctgc gcagcctgtg cctgttcagc 2280
taccaccgcc tgcgcgactt catcctgatc gccgcccgcg tgctggagct gctgggccag 2340
cgcggctggg aggccctgaa gtacctgggc agcctggtgc agtactgggg cctggagctg 2400
aagaagagcg ccatcagcct gctggacacc atcgccatcg ccgtggccga gggcaccgac 2460
cgcatcatcg agttcatcca gcgcatctgc cgcgccatcc gcaacatccc ccgccgcatc 2520
cgccagggct tcgaggccgc cctgcag 2547
<210> SEQ ID NO 10
<211> LENGTH: 1035
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic a gp41 coding region of HIV
strain
AF110968
<400> SEQUENCE: 10
gccgtgggca tcggcgccgt gttcctgggc ttcctgggcg ccgccggcag caccatgggc 60
gccgccagca tcaccctgac cgtgcaggcc cgcctgctgc tgagcggcat cgtgcagcag 120
cagaacaacc tgctgcgcgc catcgaggcc cagcagcacc tgctgcagct gaccgtgtgg 180
ggcatcaagc agctgcagac ccgcatcctg gccgtggagc gctacctgaa ggaccagcag 240
ctgctgggca tctggggctg cagcggcaag ctgatctgca ccaccgccgt gccctggaac 300
agcagctgga gcaaccgcag ccacgacgag atctgggaca acatgacctg gatgcagtgg 360
gaccgcgaga tcaacaacta caccgacacc atctaccgcc tgctggagga gagccagaac 420
cagcaggaga agaacgagaa ggacctgctg gccctggaca gctggcagaa cctgtggaac 480
tggttcagca tcaccaactg gctgtggtac atcaagatct tcatcatgat cgtgggcggc 540
ctgatcggcc tgcgcatcat cttcgccgtg ctgagcatcg tgaaccgcgt gcgccagggc 600
tacagccccc tgcccttcca gaccctgacc cccaaccccc gcgagcccga ccgcctgggc 660
cgcatcgagg aggagggcgg cgagcaggac cgcggccgca gcatccgcct ggtgagcggc 720
ttcctggccc tggcctggga cgacctgcgc agcctgtgcc tgttcagcta ccaccgcctg 780
cgcgacttca tcctgatcgc cgcccgcgtg ctggagctgc tgggccagcg cggctgggag 840
gccctgaagt acctgggcag cctggtgcag tactggggcc tggagctgaa gaagagcgcc 900
atcagcctgc tggacaccat cgccatcgcc gtggccgagg gcaccgaccg catcatcgag 960
ttcatccagc gcatctgccg cgccatccgc aacatccccc gccgcatccg ccagggcttc 1020
gaggccgccc tgcag 1035
<210> SEQ ID NO 11
<211> LENGTH: 144
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic Env common region of HIV strain
AF110975
<400> SEQUENCE: 11
agcatcatca ccctgccctg ccgcatcaag cagatcatcg acatgtggca gaaggtgggc 60
cgcgccatct acgccccccc catcgagggc aacatcacct gcagcagcag catcaccggc 120
ctgctgctgg cccgcgacgg cggc 144
<210> SEQ ID NO 12
<211> LENGTH: 1437
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic gp120 coding region of HIV strain
AF110975
<400> SEQUENCE: 12
agcggcctgg gcaacctgtg ggtgaccgtg tacgacggcg tgcccgtgtg gcgcgaggcc 60
agcaccaccc tgttctgcgc cagcgacgcc aaggcctacg agaaggaggt gcacaacgtg 120
tgggccaccc acgcctgcgt gcccaccgac cccaaccccc aggagatcga gctggacaac 180
gtgaccgaga acttcaacat gtggaagaac gacatggtgg accagatgca cgaggacatc 240
atcagcctgt gggaccagag cctgaagccc cgcgtgaagc tgacccccct gtgcgtgacc 300
ctgaagtgca ccaactacag caccaactac agcaacacca tgaacgccac cagctacaac 360
aacaacacca ccgaggagat caagaactgc accttcaaca tgaccaccga gctgcgcgac 420
aagaagcagc aggtgtacgc cctgttctac aagctggaca tcgtgcccct gaacagcaac 480
agcagcgagt accgcctgat caactgcaac accagcgcca tcacccaggc ctgccccaag 540
gtgagcttcg accccatccc catccactac tgcgcccccg ccggctacgc catcctgaag 600
tgcaagaaca acaccagcaa cggcaccggc ccctgccaga acgtgagcac cgtgcagtgc 660
acccacggca tcaagcccgt ggtgagcacc cccctgctgc tgaacggcag cctggccgag 720
ggcggcgaga tcatcatccg cagcaagaac ctgagcaaca acgcctacac catcatcgtg 780
cacctgaacg acagcgtgga gatcgtgtgc acccgcccca acaacaacac ccgcaagggc 840
atccgcatcg gccccggcca gaccttctac gccaccgaga acatcatcgg cgacatccgc 900
caggcccact gcaacatcag cgccggcgag tggaacaagg ccgtgcagcg cgtgagcgcc 960
aagctgcgcg agcacttccc caacaagacc atcgagttcc agcccagcag cggcggcgac 1020
ctggagatca ccacccacag cttcaactgc cgcggcgagt tcttctactg caacaccagc 1080
aagctgttca acagcagcta caacggcacc agctaccgcg gcaccgagag caacagcagc 1140
atcatcaccc tgccctgccg catcaagcag atcatcgaca tgtggcagaa ggtgggccgc 1200
gccatctacg ccccccccat cgagggcaac atcacctgca gcagcagcat caccggcctg 1260
ctgctggccc gcgacggcgg cctggacaac atcaccaccg agatcttccg cccccagggc 1320
ggcgacatga aggacaactg gcgcaacgag ctgtacaagt acaaggtggt ggagatcaag 1380
cccctgggcg tggcccccac cgaggccaag cgccgcgtgg tggagcgcga gaagcgc 1437
<210> SEQ ID NO 13
<211> LENGTH: 1950
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic gp140 coding region of HIV strain
AF110975
<400> SEQUENCE: 13
agcggcctgg gcaacctgtg ggtgaccgtg tacgacggcg tgcccgtgtg gcgcgaggcc 60
agcaccaccc tgttctgcgc cagcgacgcc aaggcctacg agaaggaggt gcacaacgtg 120
tgggccaccc acgcctgcgt gcccaccgac cccaaccccc aggagatcga gctggacaac 180
gtgaccgaga acttcaacat gtggaagaac gacatggtgg accagatgca cgaggacatc 240
atcagcctgt gggaccagag cctgaagccc cgcgtgaagc tgacccccct gtgcgtgacc 300
ctgaagtgca ccaactacag caccaactac agcaacacca tgaacgccac cagctacaac 360
aacaacacca ccgaggagat caagaactgc accttcaaca tgaccaccga gctgcgcgac 420
aagaagcagc aggtgtacgc cctgttctac aagctggaca tcgtgcccct gaacagcaac 480
agcagcgagt accgcctgat caactgcaac accagcgcca tcacccaggc ctgccccaag 540
gtgagcttcg accccatccc catccactac tgcgcccccg ccggctacgc catcctgaag 600
tgcaagaaca acaccagcaa cggcaccggc ccctgccaga acgtgagcac cgtgcagtgc 660
acccacggca tcaagcccgt ggtgagcacc cccctgctgc tgaacggcag cctggccgag 720
ggcggcgaga tcatcatccg cagcaagaac ctgagcaaca acgcctacac catcatcgtg 780
cacctgaacg acagcgtgga gatcgtgtgc acccgcccca acaacaacac ccgcaagggc 840
atccgcatcg gccccggcca gaccttctac gccaccgaga acatcatcgg cgacatccgc 900
caggcccact gcaacatcag cgccggcgag tggaacaagg ccgtgcagcg cgtgagcgcc 960
aagctgcgcg agcacttccc caacaagacc atcgagttcc agcccagcag cggcggcgac 1020
ctggagatca ccacccacag cttcaactgc cgcggcgagt tcttctactg caacaccagc 1080
aagctgttca acagcagcta caacggcacc agctaccgcg gcaccgagag caacagcagc 1140
atcatcaccc tgccctgccg catcaagcag atcatcgaca tgtggcagaa ggtgggccgc 1200
gccatctacg ccccccccat cgagggcaac atcacctgca gcagcagcat caccggcctg 1260
ctgctggccc gcgacggcgg cctggacaac atcaccaccg agatcttccg cccccagggc 1320
ggcgacatga aggacaactg gcgcaacgag ctgtacaagt acaaggtggt ggagatcaag 1380
cccctgggcg tggcccccac cgaggccaag cgccgcgtgg tggagcgcga gaagcgcgcc 1440
gtgggcatcg gcgccgtgat cttcggcttc ctgggcgccg ccggcagcaa catgggcgcc 1500
gccagcatca ccctgaccgc ccaggcccgc cagctgctga gcggcatcgt gcagcagcag 1560
agcaacctgc tgcgcgccat cgaggcccag cagcacatgc tgcagctgac cgtgtggggc 1620
atcaagcagc tgcaggcccg cgtgctggcc atcgagcgct acctgaagga ccagcagctg 1680
ctgggcatct ggggctgcag cggcaagctg atctgcacca ccaccgtgcc ctggaacagc 1740
agctggagca acaagaccca gggcgagatc tgggagaaca tgacctggat gcagtgggac 1800
aaggagatca gcaactacac cggcatcatc taccgcctgc tggaggagag ccagaaccag 1860
caggagcaga acgagaagga cctgctggcc ctggacagcc gcaacaacct gtggagctgg 1920
ttcaacatca gcaactggct gtggtacatc 1950
<210> SEQ ID NO 14
<211> LENGTH: 2493
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic gp160 coding region of HIV strain
AF110975
<400> SEQUENCE: 14
agcggcctgg gcaacctgtg ggtgaccgtg tacgacggcg tgcccgtgtg gcgcgaggcc 60
agcaccaccc tgttctgcgc cagcgacgcc aaggcctacg agaaggaggt gcacaacgtg 120
tgggccaccc acgcctgcgt gcccaccgac cccaaccccc aggagatcga gctggacaac 180
gtgaccgaga acttcaacat gtggaagaac gacatggtgg accagatgca cgaggacatc 240
atcagcctgt gggaccagag cctgaagccc cgcgtgaagc tgacccccct gtgcgtgacc 300
ctgaagtgca ccaactacag caccaactac agcaacacca tgaacgccac cagctacaac 360
aacaacacca ccgaggagat caagaactgc accttcaaca tgaccaccga gctgcgcgac 420
aagaagcagc aggtgtacgc cctgttctac aagctggaca tcgtgcccct gaacagcaac 480
agcagcgagt accgcctgat caactgcaac accagcgcca tcacccaggc ctgccccaag 540
gtgagcttcg accccatccc catccactac tgcgcccccg ccggctacgc catcctgaag 600
tgcaagaaca acaccagcaa cggcaccggc ccctgccaga acgtgagcac cgtgcagtgc 660
acccacggca tcaagcccgt ggtgagcacc cccctgctgc tgaacggcag cctggccgag 720
ggcggcgaga tcatcatccg cagcaagaac ctgagcaaca acgcctacac catcatcgtg 780
cacctgaacg acagcgtgga gatcgtgtgc acccgcccca acaacaacac ccgcaagggc 840
atccgcatcg gccccggcca gaccttctac gccaccgaga acatcatcgg cgacatccgc 900
caggcccact gcaacatcag cgccggcgag tggaacaagg ccgtgcagcg cgtgagcgcc 960
aagctgcgcg agcacttccc caacaagacc atcgagttcc agcccagcag cggcggcgac 1020
ctggagatca ccacccacag cttcaactgc cgcggcgagt tcttctactg caacaccagc 1080
aagctgttca acagcagcta caacggcacc agctaccgcg gcaccgagag caacagcagc 1140
atcatcaccc tgccctgccg catcaagcag atcatcgaca tgtggcagaa ggtgggccgc 1200
gccatctacg ccccccccat cgagggcaac atcacctgca gcagcagcat caccggcctg 1260
ctgctggccc gcgacggcgg cctggacaac atcaccaccg agatcttccg cccccagggc 1320
ggcgacatga aggacaactg gcgcaacgag ctgtacaagt acaaggtggt ggagatcaag 1380
cccctgggcg tggcccccac cgaggccaag cgccgcgtgg tggagcgcga gaagcgcgcc 1440
gtgggcatcg gcgccgtgat cttcggcttc ctgggcgccg ccggcagcaa catgggcgcc 1500
gccagcatca ccctgaccgc ccaggcccgc cagctgctga gcggcatcgt gcagcagcag 1560
agcaacctgc tgcgcgccat cgaggcccag cagcacatgc tgcagctgac cgtgtggggc 1620
atcaagcagc tgcaggcccg cgtgctggcc atcgagcgct acctgaagga ccagcagctg 1680
ctgggcatct ggggctgcag cggcaagctg atctgcacca ccaccgtgcc ctggaacagc 1740
agctggagca acaagaccca gggcgagatc tgggagaaca tgacctggat gcagtgggac 1800
aaggagatca gcaactacac cggcatcatc taccgcctgc tggaggagag ccagaaccag 1860
caggagcaga acgagaagga cctgctggcc ctggacagcc gcaacaacct gtggagctgg 1920
ttcaacatca gcaactggct gtggtacatc aagatcttca tcatgatcgt gggcggcctg 1980
atcggcctgc gcatcatctt cgccgtgctg agcatcgtga accgcgtgcg ccagggctac 2040
agccccctga gcttccagac cctgaccccc aacccccgcg gcctggaccg cctgggccgc 2100
atcgaggagg agggcggcga gcaggaccgc gaccgcagca tccgcctggt gcagggcttc 2160
ctggccctgg cctgggacga cctgcgcagc ctgtgcctgt tcagctacca ccgcctgcgc 2220
gacctgatcc tggtgaccgc ccgcgtggtg gagctgctgg gccgcagcag cccccgcggc 2280
ctgcagcgcg gctgggaggc cctgaagtac ctgggcagcc tggtgcagta ctggggcctg 2340
gagctgaaga agagcgccac cagcctgctg gacagcatcg ccatcgccgt ggccgagggc 2400
accgaccgca tcatcgaggt gatccagcgc atctaccgcg ccttctgcaa catcccccgc 2460
cgcgtgcgcc agggcttcga ggccgccctg cag 2493
<210> SEQ ID NO 15
<211> LENGTH: 2565
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic signal sequence and gp160 coding
region of HIV strain AF110975
<400> SEQUENCE: 15
atgcgcgtgc gcggcatcct gcgcagctgg cagcagtggt ggatctgggg catcctgggc 60
ttctggatct gcagcggcct gggcaacctg tgggtgaccg tgtacgacgg cgtgcccgtg 120
tggcgcgagg ccagcaccac cctgttctgc gccagcgacg ccaaggccta cgagaaggag 180
gtgcacaacg tgtgggccac ccacgcctgc gtgcccaccg accccaaccc ccaggagatc 240
gagctggaca acgtgaccga gaacttcaac atgtggaaga acgacatggt ggaccagatg 300
cacgaggaca tcatcagcct gtgggaccag agcctgaagc cccgcgtgaa gctgaccccc 360
ctgtgcgtga ccctgaagtg caccaactac agcaccaact acagcaacac catgaacgcc 420
accagctaca acaacaacac caccgaggag atcaagaact gcaccttcaa catgaccacc 480
gagctgcgcg acaagaagca gcaggtgtac gccctgttct acaagctgga catcgtgccc 540
ctgaacagca acagcagcga gtaccgcctg atcaactgca acaccagcgc catcacccag 600
gcctgcccca aggtgagctt cgaccccatc cccatccact actgcgcccc cgccggctac 660
gccatcctga agtgcaagaa caacaccagc aacggcaccg gcccctgcca gaacgtgagc 720
accgtgcagt gcacccacgg catcaagccc gtggtgagca cccccctgct gctgaacggc 780
agcctggccg agggcggcga gatcatcatc cgcagcaaga acctgagcaa caacgcctac 840
accatcatcg tgcacctgaa cgacagcgtg gagatcgtgt gcacccgccc caacaacaac 900
acccgcaagg gcatccgcat cggccccggc cagaccttct acgccaccga gaacatcatc 960
ggcgacatcc gccaggccca ctgcaacatc agcgccggcg agtggaacaa ggccgtgcag 1020
cgcgtgagcg ccaagctgcg cgagcacttc cccaacaaga ccatcgagtt ccagcccagc 1080
agcggcggcg acctggagat caccacccac agcttcaact gccgcggcga gttcttctac 1140
tgcaacacca gcaagctgtt caacagcagc tacaacggca ccagctaccg cggcaccgag 1200
agcaacagca gcatcatcac cctgccctgc cgcatcaagc agatcatcga catgtggcag 1260
aaggtgggcc gcgccatcta cgcccccccc atcgagggca acatcacctg cagcagcagc 1320
atcaccggcc tgctgctggc ccgcgacggc ggcctggaca acatcaccac cgagatcttc 1380
cgcccccagg gcggcgacat gaaggacaac tggcgcaacg agctgtacaa gtacaaggtg 1440
gtggagatca agcccctggg cgtggccccc accgaggcca agcgccgcgt ggtggagcgc 1500
gagaagcgcg ccgtgggcat cggcgccgtg atcttcggct tcctgggcgc cgccggcagc 1560
aacatgggcg ccgccagcat caccctgacc gcccaggccc gccagctgct gagcggcatc 1620
gtgcagcagc agagcaacct gctgcgcgcc atcgaggccc agcagcacat gctgcagctg 1680
accgtgtggg gcatcaagca gctgcaggcc cgcgtgctgg ccatcgagcg ctacctgaag 1740
gaccagcagc tgctgggcat ctggggctgc agcggcaagc tgatctgcac caccaccgtg 1800
ccctggaaca gcagctggag caacaagacc cagggcgaga tctgggagaa catgacctgg 1860
atgcagtggg acaaggagat cagcaactac accggcatca tctaccgcct gctggaggag 1920
agccagaacc agcaggagca gaacgagaag gacctgctgg ccctggacag ccgcaacaac 1980
ctgtggagct ggttcaacat cagcaactgg ctgtggtaca tcaagatctt catcatgatc 2040
gtgggcggcc tgatcggcct gcgcatcatc ttcgccgtgc tgagcatcgt gaaccgcgtg 2100
cgccagggct acagccccct gagcttccag accctgaccc ccaacccccg cggcctggac 2160
cgcctgggcc gcatcgagga ggagggcggc gagcaggacc gcgaccgcag catccgcctg 2220
gtgcagggct tcctggccct ggcctgggac gacctgcgca gcctgtgcct gttcagctac 2280
caccgcctgc gcgacctgat cctggtgacc gcccgcgtgg tggagctgct gggccgcagc 2340
agcccccgcg gcctgcagcg cggctgggag gccctgaagt acctgggcag cctggtgcag 2400
tactggggcc tggagctgaa gaagagcgcc accagcctgc tggacagcat cgccatcgcc 2460
gtggccgagg gcaccgaccg catcatcgag gtgatccagc gcatctaccg cgccttctgc 2520
aacatccccc gccgcgtgcg ccagggcttc gaggccgccc tgcag 2565
<210> SEQ ID NO 16
<211> LENGTH: 1056
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic a gp41 coding region of HIV
strain
AF110975
<400> SEQUENCE: 16
gccgtgggca tcggcgccgt gatcttcggc ttcctgggcg ccgccggcag caacatgggc 60
gccgccagca tcaccctgac cgcccaggcc cgccagctgc tgagcggcat cgtgcagcag 120
cagagcaacc tgctgcgcgc catcgaggcc cagcagcaca tgctgcagct gaccgtgtgg 180
ggcatcaagc agctgcaggc ccgcgtgctg gccatcgagc gctacctgaa ggaccagcag 240
ctgctgggca tctggggctg cagcggcaag ctgatctgca ccaccaccgt gccctggaac 300
agcagctgga gcaacaagac ccagggcgag atctgggaga acatgacctg gatgcagtgg 360
gacaaggaga tcagcaacta caccggcatc atctaccgcc tgctggagga gagccagaac 420
cagcaggagc agaacgagaa ggacctgctg gccctggaca gccgcaacaa cctgtggagc 480
tggttcaaca tcagcaactg gctgtggtac atcaagatct tcatcatgat cgtgggcggc 540
ctgatcggcc tgcgcatcat cttcgccgtg ctgagcatcg tgaaccgcgt gcgccagggc 600
tacagccccc tgagcttcca gaccctgacc cccaaccccc gcggcctgga ccgcctgggc 660
cgcatcgagg aggagggcgg cgagcaggac cgcgaccgca gcatccgcct ggtgcagggc 720
ttcctggccc tggcctggga cgacctgcgc agcctgtgcc tgttcagcta ccaccgcctg 780
cgcgacctga tcctggtgac cgcccgcgtg gtggagctgc tgggccgcag cagcccccgc 840
ggcctgcagc gcggctggga ggccctgaag tacctgggca gcctggtgca gtactggggc 900
ctggagctga agaagagcgc caccagcctg ctggacagca tcgccatcgc cgtggccgag 960
ggcaccgacc gcatcatcga ggtgatccag cgcatctacc gcgccttctg caacatcccc 1020
cgccgcgtgc gccagggctt cgaggccgcc ctgcag 1056
<210> SEQ ID NO 17
<211> LENGTH: 492
<212> TYPE: PRT
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 17
Met Gly Ala Arg Ala Ser Ile Leu Arg Gly Gly Lys Leu Asp Ala Trp
1 5 10 15
Glu Arg Ile Arg Leu Arg Pro Gly Gly Lys Lys Cys Tyr Met Met Lys
20 25 30
His Leu Val Trp Ala Ser Arg Glu Leu Glu Lys Phe Ala Leu Asn Pro
35 40 45
Gly Leu Leu Glu Thr Ser Glu Gly Cys Lys Gln Ile Ile Arg Gln Leu
50 55 60
His Pro Ala Leu Gln Thr Gly Ser Glu Glu Leu Lys Ser Leu Phe Asn
65 70 75 80
Thr Val Ala Thr Leu Tyr Cys Val His Glu Lys Ile Glu Val Arg Asp
85 90 95
Thr Lys Glu Ala Leu Asp Lys Ile Glu Glu Glu Gln Asn Lys Cys Gln
100 105 110
Gln Lys Ile Gln Gln Ala Glu Ala Ala Asp Lys Gly Lys Val Ser Gln
115 120 125
Asn Tyr Pro Ile Val Gln Asn Leu Gln Gly Gln Met Val His Gln Ala
130 135 140
Ile Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Val Ile Glu Glu Lys
145 150 155 160
Ala Phe Ser Pro Glu Val Ile Pro Met Phe Thr Ala Leu Ser Glu Gly
165 170 175
Ala Thr Pro Gln Asp Leu Asn Thr Met Leu Asn Thr Val Gly Gly His
180 185 190
Gln Ala Ala Met Gln Met Leu Lys Asp Thr Ile Asn Glu Glu Ala Ala
195 200 205
Glu Trp Asp Arg Val His Pro Val His Ala Gly Pro Ile Ala Pro Gly
210 215 220
Gln Met Arg Glu Pro Arg Gly Ser Asp Ile Ala Gly Thr Thr Ser Thr
225 230 235 240
Leu Gln Glu Gln Ile Ala Trp Met Thr Ser Asn Pro Pro Ile Pro Val
245 250 255
Gly Asp Ile Tyr Lys Arg Trp Ile Ile Leu Gly Leu Asn Lys Ile Val
260 265 270
Arg Met Tyr Ser Pro Val Ser Ile Leu Asp Ile Lys Gln Gly Pro Lys
275 280 285
Glu Pro Phe Arg Asp Tyr Val Asp Arg Phe Phe Lys Thr Leu Arg Ala
290 295 300
Glu Gln Ser Thr Gln Glu Val Lys Asn Trp Met Thr Asp Thr Leu Leu
305 310 315 320
Val Gln Asn Ala Asn Pro Asp Cys Lys Thr Ile Leu Arg Ala Leu Gly
325 330 335
Pro Gly Ala Ser Leu Glu Glu Met Met Thr Ala Cys Gln Gly Val Gly
340 345 350
Gly Pro Ser His Lys Ala Arg Val Leu Ala Glu Ala Met Ser Gln Ala
355 360 365
Asn Thr Ser Val Met Met Gln Lys Ser Asn Phe Lys Gly Pro Arg Arg
370 375 380
Ile Val Lys Cys Phe Asn Cys Gly Lys Glu Gly His Ile Ala Arg Asn
385 390 395 400
Cys Arg Ala Pro Arg Lys Lys Gly Cys Trp Lys Cys Gly Lys Glu Gly
405 410 415
His Gln Met Lys Asp Cys Thr Glu Arg Gln Ala Asn Phe Leu Gly Lys
420 425 430
Ile Trp Pro Ser His Lys Gly Arg Pro Gly Asn Phe Leu Gln Ser Arg
435 440 445
Pro Glu Pro Thr Ala Pro Pro Ala Glu Ser Phe Arg Phe Glu Glu Thr
450 455 460
Thr Pro Gly Gln Lys Gln Glu Ser Lys Asp Arg Glu Thr Leu Thr Ser
465 470 475 480
Leu Lys Ser Leu Phe Gly Asn Asp Pro Leu Ser Gln
485 490
<210> SEQ ID NO 18
<211> LENGTH: 81
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic signal sequence of HIV strain
AF110968
<400> SEQUENCE: 18
atgcgcgtga tgggcatcct gaagaactac cagcagtggt ggatgtgggg catcctgggc 60
ttctggatgc tgatcatcag c 81
<210> SEQ ID NO 19
<211> LENGTH: 72
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic signal sequence of HIV strain
AF110975
<400> SEQUENCE: 19
atgcgcgtgc gcggcatcct gcgcagctgg cagcagtggt ggatctgggg catcctgggc 60
ttctggatct gc 72
<210> SEQ ID NO 20
<211> LENGTH: 1479
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic Gag coding sequence of HIV strain
AF110965
<400> SEQUENCE: 20
atgggcgccc gcgccagcat cctgcgcggc ggcaagctgg acgcctggga gcgcatccgc 60
ctgcgccccg gcggcaagaa gtgctacatg atgaagcacc tggtgtgggc cagccgcgag 120
ctggagaagt tcgccctgaa ccccggcctg ctggagacca gcgagggctg caagcagatc 180
atccgccagc tgcaccccgc cctgcagacc ggcagcgagg agctgaagag cctgttcaac 240
accgtggcca ccctgtactg cgtgcacgag aagatcgagg tgcgcgacac caaggaggcc 300
ctggacaaga tcgaggagga gcagaacaag tgccagcaga agatccagca ggccgaggcc 360
gccgacaagg gcaaggtgag ccagaactac cccatcgtgc agaacctgca gggccagatg 420
gtgcaccagg ccatcagccc ccgcaccctg aacgcctggg tgaaggtgat cgaggagaag 480
gccttcagcc ccgaggtgat ccccatgttc accgccctga gcgagggcgc caccccccag 540
gacctgaaca ccatgctgaa caccgtgggc ggccaccagg ccgccatgca gatgctgaag 600
gacaccatca acgaggaggc cgccgagtgg gaccgcgtgc accccgtgca cgccggcccc 660
atcgcccccg gccagatgcg cgagccccgc ggcagcgaca tcgccggcac caccagcacc 720
ctgcaggagc agatcgcctg gatgaccagc aaccccccca tccccgtggg cgacatctac 780
aagcgctgga tcatcctggg cctgaacaag atcgtgcgca tgtacagccc cgtgagcatc 840
ctggacatca agcagggccc caaggagccc ttccgcgact acgtggaccg cttcttcaag 900
accctgcgcg ccgagcagag cacccaggag gtgaagaact ggatgaccga caccctgctg 960
gtgcagaacg ccaaccccga ctgcaagacc atcctgcgcg ccctgggccc cggcgccagc 1020
ctggaggaga tgatgaccgc ctgccagggc gtgggcggcc ccagccacaa ggcccgcgtg 1080
ctggccgagg ccatgagcca ggccaacacc agcgtgatga tgcagaagag caacttcaag 1140
ggcccccgcc gcatcgtgaa gtgcttcaac tgcggcaagg agggccacat cgcccgcaac 1200
tgccgcgccc cccgcaagaa gggctgctgg aagtgcggca aggagggcca ccagatgaag 1260
gactgcaccg agcgccaggc caacttcctg ggcaagatct ggcccagcca caagggccgc 1320
cccggcaact tcctgcagag ccgccccgag cccaccgccc cccccgccga gagcttccgc 1380
ttcgaggaga ccacccccgg ccagaagcag gagagcaagg accgcgagac cctgaccagc 1440
ctgaagagcc tgttcggcaa cgaccccctg agccagtaa 1479
<210> SEQ ID NO 21
<211> LENGTH: 1509
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: synthetic Gag coding sequence of HIV strain
AF110967
<400> SEQUENCE: 21
atgggcgccc gcgccagcat cctgcgcggc gagaagctgg acaagtggga gaagatccgc 60
ctgcgccccg gcggcaagaa gcactacatg ctgaagcacc tggtgtgggc cagccgcgag 120
ctggagggct tcgccctgaa ccccggcctg ctggagaccg ccgagggctg caagcagatc 180
atgaagcagc tgcagcccgc cctgcagacc ggcaccgagg agctgcgcag cctgtacaac 240
accgtggcca ccctgtactg cgtgcacgcc ggcatcgagg tgcgcgacac caaggaggcc 300
ctggacaaga tcgaggagga gcagaacaag agccagcaga agacccagca ggccaaggag 360
gccgacggca aggtgagcca gaactacccc atcgtgcaga acctgcaggg ccagatggtg 420
caccaggcca tcagcccccg caccctgaac gcctgggtga aggtgatcga ggagaaggcc 480
ttcagccccg aggtgatccc catgttcacc gccctgagcg agggcgccac cccccaggac 540
ctgaacacca tgctgaacac cgtgggcggc caccaggccg ccatgcagat gctgaaggac 600
accatcaacg aggaggccgc cgagtgggac cgcctgcacc ccgtgcaggc cggccccgtg 660
gcccccggcc agatgcgcga cccccgcggc agcgacatcg ccggcgccac cagcaccctg 720
caggagcaga tcgcctggat gaccagcaac ccccccgtgc ccgtgggcga catctacaag 780
cgctggatca tcctgggcct gaacaagatc gtgcgcatgt acagccccgt gagcatcctg 840
gacatccgcc agggccccaa ggagcccttc cgcgactacg tggaccgctt cttcaagacc 900
ctgcgcgccg agcaggccac ccaggacgtg aagaactgga tgaccgagac cctgctggtg 960
cagaacgcca accccgactg caagaccatc ctgcgcgccc tgggccccgg cgccaccctg 1020
gaggagatga tgaccgcctg ccagggcgtg ggcggccccg gccacaaggc ccgcgtgctg 1080
gccgaggcca tgagccaggc caacagcgtg aacatcatga tgcagaagag caacttcaag 1140
ggcccccgcc gcaacgtgaa gtgcttcaac tgcggcaagg agggccacat cgccaagaac 1200
tgccgcgccc cccgcaagaa gggctgctgg aagtgcggca aggagggcca ccagatgaag 1260
gactgcaccg agcgccaggc caacttcctg ggcaagatct ggcccagcca caagggccgc 1320
cccggcaact tcctgcagaa ccgcagcgag cccgccgccc ccaccgtgcc caccgccccc 1380
cccgccgaga gcttccgctt cgaggagacc acccccgccc ccaagcagga gcccaaggac 1440
cgcgagccct accgcgagcc cctgaccgcc ctgcgcagcc tgttcggcag cggccccctg 1500
agccagtaa 1509
<210> SEQ ID NO 22
<211> LENGTH: 502
<212> TYPE: PRT
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 22
Met Gly Ala Arg Ala Ser Ile Leu Arg Gly Glu Lys Leu Asp Lys Trp
1 5 10 15
Glu Lys Ile Arg Leu Arg Pro Gly Gly Lys Lys His Tyr Met Leu Lys
20 25 30
His Leu Val Trp Ala Ser Arg Glu Leu Glu Gly Phe Ala Leu Asn Pro
35 40 45
Gly Leu Leu Glu Thr Ala Glu Gly Cys Lys Gln Ile Met Lys Gln Leu
50 55 60
Gln Pro Ala Leu Gln Thr Gly Thr Glu Glu Leu Arg Ser Leu Tyr Asn
65 70 75 80
Thr Val Ala Thr Leu Tyr Cys Val His Ala Gly Ile Glu Val Arg Asp
85 90 95
Thr Lys Glu Ala Leu Asp Lys Ile Glu Glu Glu Gln Asn Lys Ser Gln
100 105 110
Gln Lys Thr Gln Gln Ala Lys Glu Ala Asp Gly Lys Val Ser Gln Asn
115 120 125
Tyr Pro Ile Val Gln Asn Leu Gln Gly Gln Met Val His Gln Ala Ile
130 135 140
Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Val Ile Glu Glu Lys Ala
145 150 155 160
Phe Ser Pro Glu Val Ile Pro Met Phe Thr Ala Leu Ser Glu Gly Ala
165 170 175
Thr Pro Gln Asp Leu Asn Thr Met Leu Asn Thr Val Gly Gly His Gln
180 185 190
Ala Ala Met Gln Met Leu Lys Asp Thr Ile Asn Glu Glu Ala Ala Glu
195 200 205
Trp Asp Arg Leu His Pro Val Gln Ala Gly Pro Val Ala Pro Gly Gln
210 215 220
Met Arg Asp Pro Arg Gly Ser Asp Ile Ala Gly Ala Thr Ser Thr Leu
225 230 235 240
Gln Glu Gln Ile Ala Trp Met Thr Ser Asn Pro Pro Val Pro Val Gly
245 250 255
Asp Ile Tyr Lys Arg Trp Ile Ile Leu Gly Leu Asn Lys Ile Val Arg
260 265 270
Met Tyr Ser Pro Val Ser Ile Leu Asp Ile Arg Gln Gly Pro Lys Glu
275 280 285
Pro Phe Arg Asp Tyr Val Asp Arg Phe Phe Lys Thr Leu Arg Ala Glu
290 295 300
Gln Ala Thr Gln Asp Val Lys Asn Trp Met Thr Glu Thr Leu Leu Val
305 310 315 320
Gln Asn Ala Asn Pro Asp Cys Lys Thr Ile Leu Arg Ala Leu Gly Pro
325 330 335
Gly Ala Thr Leu Glu Glu Met Met Thr Ala Cys Gln Gly Val Gly Gly
340 345 350
Pro Gly His Lys Ala Arg Val Leu Ala Glu Ala Met Ser Gln Ala Asn
355 360 365
Ser Val Asn Ile Met Met Gln Lys Ser Asn Phe Lys Gly Pro Arg Arg
370 375 380
Asn Val Lys Cys Phe Asn Cys Gly Lys Glu Gly His Ile Ala Lys Asn
385 390 395 400
Cys Arg Ala Pro Arg Lys Lys Gly Cys Trp Lys Cys Gly Lys Glu Gly
405 410 415
His Gln Met Lys Asp Cys Thr Glu Arg Gln Ala Asn Phe Leu Gly Lys
420 425 430
Ile Trp Pro Ser His Lys Gly Arg Pro Gly Asn Phe Leu Gln Asn Arg
435 440 445
Ser Glu Pro Ala Ala Pro Thr Val Pro Thr Ala Pro Pro Ala Glu Ser
450 455 460
Phe Arg Phe Glu Glu Thr Thr Pro Ala Pro Lys Gln Glu Pro Lys Asp
465 470 475 480
Arg Glu Pro Tyr Arg Glu Pro Leu Thr Ala Leu Arg Ser Leu Phe Gly
485 490 495
Ser Gly Pro Leu Ser Gln
500
<210> SEQ ID NO 23
<211> LENGTH: 849
<212> TYPE: PRT
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 23
Met Arg Val Met Gly Ile Leu Lys Asn Tyr Gln Gln Trp Trp Met Trp
1 5 10 15
Gly Ile Leu Gly Phe Trp Met Leu Ile Ile Ser Ser Val Val Gly Asn
20 25 30
Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Lys Glu Ala Lys
35 40 45
Thr Thr Leu Phe Cys Thr Ser Asp Ala Lys Ala Tyr Glu Thr Glu Val
50 55 60
His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn Pro
65 70 75 80
Gln Glu Ile Val Leu Glu Asn Val Thr Glu Asn Phe Asn Met Trp Lys
85 90 95
Asn Asp Met Val Asp Gln Met His Glu Asp Ile Ile Ser Leu Trp Asp
100 105 110
Gln Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Thr Leu
115 120 125
Lys Cys Arg Asn Val Asn Ala Thr Asn Asn Ile Asn Ser Met Ile Asp
130 135 140
Asn Ser Asn Lys Gly Glu Met Lys Asn Cys Ser Phe Asn Val Thr Thr
145 150 155 160
Glu Leu Arg Asp Arg Lys Gln Glu Val His Ala Leu Phe Tyr Arg Leu
165 170 175
Asp Val Val Pro Leu Gln Gly Asn Asn Ser Asn Glu Tyr Arg Leu Ile
180 185 190
Asn Cys Asn Thr Ser Ala Ile Thr Gln Ala Cys Pro Lys Val Ser Phe
195 200 205
Asp Pro Ile Pro Ile His Tyr Cys Thr Pro Ala Gly Tyr Ala Ile Leu
210 215 220
Lys Cys Asn Asn Gln Thr Phe Asn Gly Thr Gly Pro Cys Asn Asn Val
225 230 235 240
Ser Ser Val Gln Cys Ala His Gly Ile Lys Pro Val Val Ser Thr Gln
245 250 255
Leu Leu Leu Asn Gly Ser Leu Ala Lys Gly Glu Ile Ile Ile Arg Ser
260 265 270
Glu Asn Leu Ala Asn Asn Ala Lys Ile Ile Ile Val Gln Leu Asn Lys
275 280 285
Pro Val Lys Ile Val Cys Val Arg Pro Asn Asn Asn Thr Arg Lys Ser
290 295 300
Val Arg Ile Gly Pro Gly Gln Thr Phe Tyr Ala Thr Gly Glu Ile Ile
305 310 315 320
Gly Asp Ile Arg Gln Ala Tyr Cys Ile Ile Asn Lys Thr Glu Trp Asn
325 330 335
Ser Thr Leu Gln Gly Val Ser Lys Lys Leu Glu Glu His Phe Ser Lys
340 345 350
Lys Ala Ile Lys Phe Glu Pro Ser Ser Gly Gly Asp Leu Glu Ile Thr
355 360 365
Thr His Ser Phe Asn Cys Arg Gly Glu Phe Phe Tyr Cys Asp Thr Ser
370 375 380
Gln Leu Phe Asn Ser Thr Tyr Ser Pro Ser Phe Asn Gly Thr Glu Asn
385 390 395 400
Lys Leu Asn Gly Thr Ile Thr Ile Thr Cys Arg Ile Lys Gln Ile Ile
405 410 415
Asn Met Trp Gln Lys Val Gly Arg Ala Met Tyr Ala Pro Pro Ile Ala
420 425 430
Gly Asn Leu Thr Cys Glu Ser Asn Ile Thr Gly Leu Leu Leu Thr Arg
435 440 445
Asp Gly Gly Lys Thr Gly Pro Asn Asp Thr Glu Ile Phe Arg Pro Gly
450 455 460
Gly Gly Asp Met Arg Asp Asn Trp Arg Asn Glu Leu Tyr Lys Tyr Lys
465 470 475 480
Val Val Glu Ile Lys Pro Leu Gly Val Ala Pro Thr Glu Ala Lys Arg
485 490 495
Arg Val Val Glu Arg Glu Lys Arg Ala Val Gly Ile Gly Ala Val Phe
500 505 510
Leu Gly Phe Leu Gly Ala Ala Gly Ser Thr Met Gly Ala Ala Ser Ile
515 520 525
Thr Leu Thr Val Gln Ala Arg Leu Leu Leu Ser Gly Ile Val Gln Gln
530 535 540
Gln Asn Asn Leu Leu Arg Ala Ile Glu Ala Gln Gln His Leu Leu Gln
545 550 555 560
Leu Thr Val Trp Gly Ile Lys Gln Leu Gln Thr Arg Ile Leu Ala Val
565 570 575
Glu Arg Tyr Leu Lys Asp Gln Gln Leu Leu Gly Ile Trp Gly Cys Ser
580 585 590
Gly Lys Leu Ile Cys Thr Thr Ala Val Pro Trp Asn Ser Ser Trp Ser
595 600 605
Asn Arg Ser His Asp Glu Ile Trp Asp Asn Met Thr Trp Met Gln Trp
610 615 620
Asp Arg Glu Ile Asn Asn Tyr Thr Asp Thr Ile Tyr Arg Leu Leu Glu
625 630 635 640
Glu Ser Gln Asn Gln Gln Glu Lys Asn Glu Lys Asp Leu Leu Ala Leu
645 650 655
Asp Ser Trp Gln Asn Leu Trp Asn Trp Phe Ser Ile Thr Asn Trp Leu
660 665 670
Trp Tyr Ile Lys Ile Phe Ile Met Ile Val Gly Gly Leu Ile Gly Leu
675 680 685
Arg Ile Ile Phe Ala Val Leu Ser Ile Val Asn Arg Val Arg Gln Gly
690 695 700
Tyr Ser Pro Leu Pro Phe Gln Thr Leu Thr Pro Asn Pro Arg Glu Pro
705 710 715 720
Asp Arg Leu Gly Arg Ile Glu Glu Glu Gly Gly Glu Gln Asp Arg Gly
725 730 735
Arg Ser Ile Arg Leu Val Ser Gly Phe Leu Ala Leu Ala Trp Asp Asp
740 745 750
Leu Arg Ser Leu Cys Leu Phe Ser Tyr His Arg Leu Arg Asp Phe Ile
755 760 765
Leu Ile Ala Ala Arg Val Leu Glu Leu Leu Gly Gln Arg Gly Trp Glu
770 775 780
Ala Leu Lys Tyr Leu Gly Ser Leu Val Gln Tyr Trp Gly Leu Glu Leu
785 790 795 800
Lys Lys Ser Ala Ile Ser Leu Leu Asp Thr Ile Ala Ile Ala Val Ala
805 810 815
Glu Gly Thr Asp Arg Ile Ile Glu Phe Ile Gln Arg Ile Cys Arg Ala
820 825 830
Ile Arg Asn Ile Pro Arg Arg Ile Arg Gln Gly Phe Glu Ala Ala Leu
835 840 845
Gln
<210> SEQ ID NO 24
<211> LENGTH: 855
<212> TYPE: PRT
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 24
Met Arg Val Arg Gly Ile Leu Arg Ser Trp Gln Gln Trp Trp Ile Trp
1 5 10 15
Gly Ile Leu Gly Phe Trp Ile Cys Ser Gly Leu Gly Asn Leu Trp Val
20 25 30
Thr Val Tyr Asp Gly Val Pro Val Trp Arg Glu Ala Ser Thr Thr Leu
35 40 45
Phe Cys Ala Ser Asp Ala Lys Ala Tyr Glu Lys Glu Val His Asn Val
50 55 60
Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn Pro Gln Glu Ile
65 70 75 80
Glu Leu Asp Asn Val Thr Glu Asn Phe Asn Met Trp Lys Asn Asp Met
85 90 95
Val Asp Gln Met His Glu Asp Ile Ile Ser Leu Trp Asp Gln Ser Leu
100 105 110
Lys Pro Arg Val Lys Leu Thr Pro Leu Cys Val Thr Leu Lys Cys Thr
115 120 125
Asn Tyr Ser Thr Asn Tyr Ser Asn Thr Met Asn Ala Thr Ser Tyr Asn
130 135 140
Asn Asn Thr Thr Glu Glu Ile Lys Asn Cys Thr Phe Asn Met Thr Thr
145 150 155 160
Glu Leu Arg Asp Lys Lys Gln Gln Val Tyr Ala Leu Phe Tyr Lys Leu
165 170 175
Asp Ile Val Pro Leu Asn Ser Asn Ser Ser Glu Tyr Arg Leu Ile Asn
180 185 190
Cys Asn Thr Ser Ala Ile Thr Gln Ala Cys Pro Lys Val Ser Phe Asp
195 200 205
Pro Ile Pro Ile His Tyr Cys Ala Pro Ala Gly Tyr Ala Ile Leu Lys
210 215 220
Cys Lys Asn Asn Thr Ser Asn Gly Thr Gly Pro Cys Gln Asn Val Ser
225 230 235 240
Thr Val Gln Cys Thr His Gly Ile Lys Pro Val Val Ser Thr Pro Leu
245 250 255
Leu Leu Asn Gly Ser Leu Ala Glu Gly Gly Glu Ile Ile Ile Arg Ser
260 265 270
Lys Asn Leu Ser Asn Asn Ala Tyr Thr Ile Ile Val His Leu Asn Asp
275 280 285
Ser Val Glu Ile Val Cys Thr Arg Pro Asn Asn Asn Thr Arg Lys Gly
290 295 300
Ile Arg Ile Gly Pro Gly Gln Thr Phe Tyr Ala Thr Glu Asn Ile Ile
305 310 315 320
Gly Asp Ile Arg Gln Ala His Cys Asn Ile Ser Ala Gly Glu Trp Asn
325 330 335
Lys Ala Val Gln Arg Val Ser Ala Lys Leu Arg Glu His Phe Pro Asn
340 345 350
Lys Thr Ile Glu Phe Gln Pro Ser Ser Gly Gly Asp Leu Glu Ile Thr
355 360 365
Thr His Ser Phe Asn Cys Arg Gly Glu Phe Phe Tyr Cys Asn Thr Ser
370 375 380
Lys Leu Phe Asn Ser Ser Tyr Asn Gly Thr Ser Tyr Arg Gly Thr Glu
385 390 395 400
Ser Asn Ser Ser Ile Ile Thr Leu Pro Cys Arg Ile Lys Gln Ile Ile
405 410 415
Asp Met Trp Gln Lys Val Gly Arg Ala Ile Tyr Ala Pro Pro Ile Glu
420 425 430
Gly Asn Ile Thr Cys Ser Ser Ser Ile Thr Gly Leu Leu Leu Ala Arg
435 440 445
Asp Gly Gly Leu Asp Asn Ile Thr Thr Glu Ile Phe Arg Pro Gln Gly
450 455 460
Gly Asp Met Lys Asp Asn Trp Arg Asn Glu Leu Tyr Lys Tyr Lys Val
465 470 475 480
Val Glu Ile Lys Pro Leu Gly Val Ala Pro Thr Glu Ala Lys Arg Arg
485 490 495
Val Val Glu Arg Glu Lys Arg Ala Val Gly Ile Gly Ala Val Ile Phe
500 505 510
Gly Phe Leu Gly Ala Ala Gly Ser Asn Met Gly Ala Ala Ser Ile Thr
515 520 525
Leu Thr Ala Gln Ala Arg Gln Leu Leu Ser Gly Ile Val Gln Gln Gln
530 535 540
Ser Asn Leu Leu Arg Ala Ile Glu Ala Gln Gln His Met Leu Gln Leu
545 550 555 560
Thr Val Trp Gly Ile Lys Gln Leu Gln Ala Arg Val Leu Ala Ile Glu
565 570 575
Arg Tyr Leu Lys Asp Gln Gln Leu Leu Gly Ile Trp Gly Cys Ser Gly
580 585 590
Lys Leu Ile Cys Thr Thr Thr Val Pro Trp Asn Ser Ser Trp Ser Asn
595 600 605
Lys Thr Gln Gly Glu Ile Trp Glu Asn Met Thr Trp Met Gln Trp Asp
610 615 620
Lys Glu Ile Ser Asn Tyr Thr Gly Ile Ile Tyr Arg Leu Leu Glu Glu
625 630 635 640
Ser Gln Asn Gln Gln Glu Gln Asn Glu Lys Asp Leu Leu Ala Leu Asp
645 650 655
Ser Arg Asn Asn Leu Trp Ser Trp Phe Asn Ile Ser Asn Trp Leu Trp
660 665 670
Tyr Ile Lys Ile Phe Ile Met Ile Val Gly Gly Leu Ile Gly Leu Arg
675 680 685
Ile Ile Phe Ala Val Leu Ser Ile Val Asn Arg Val Arg Gln Gly Tyr
690 695 700
Ser Pro Leu Ser Phe Gln Thr Leu Thr Pro Asn Pro Arg Gly Leu Asp
705 710 715 720
Arg Leu Gly Arg Ile Glu Glu Glu Gly Gly Glu Gln Asp Arg Asp Arg
725 730 735
Ser Ile Arg Leu Val Gln Gly Phe Leu Ala Leu Ala Trp Asp Asp Leu
740 745 750
Arg Ser Leu Cys Leu Phe Ser Tyr His Arg Leu Arg Asp Leu Ile Leu
755 760 765
Val Thr Ala Arg Val Val Glu Leu Leu Gly Arg Ser Ser Pro Arg Gly
770 775 780
Leu Gln Arg Gly Trp Glu Ala Leu Lys Tyr Leu Gly Ser Leu Val Gln
785 790 795 800
Tyr Trp Gly Leu Glu Leu Lys Lys Ser Ala Thr Ser Leu Leu Asp Ser
805 810 815
Ile Ala Ile Ala Val Ala Glu Gly Thr Asp Arg Ile Ile Glu Val Ile
820 825 830
Gln Arg Ile Tyr Arg Ala Phe Cys Asn Ile Pro Arg Arg Val Arg Gln
835 840 845
Gly Phe Glu Ala Ala Leu Gln
850 855
<210> SEQ ID NO 25
<211> LENGTH: 20
<212> TYPE: PRT
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 25
Asp Ile Lys Gln Gly Pro Lys Glu Pro Phe Arg Asp Tyr Val Asp Arg
1 5 10 15
Phe Phe Lys Thr
20
<210> SEQ ID NO 26
<211> LENGTH: 60
<212> TYPE: DNA
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 26
gacataaaac aaggaccaaa agagcccttt agagactatg tagaccggtt ctttaaaacc 60
<210> SEQ ID NO 27
<211> LENGTH: 20
<212> TYPE: PRT
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 27
Asp Ile Arg Gln Gly Pro Lys Glu Pro Phe Arg Asp Tyr Val Asp Arg
1 5 10 15
Phe Phe Lys Thr
20
<210> SEQ ID NO 28
<211> LENGTH: 47
<212> TYPE: PRT
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 28
Thr Ile Thr Ile Thr Cys Arg Ile Lys Gln Ile Ile Asn Met Trp Gln
1 5 10 15
Lys Val Gly Arg Ala Met Tyr Ala Pro Pro Ile Ala Gly Asn Leu Thr
20 25 30
Cys Glu Ser Asn Ile Thr Gly Leu Leu Leu Thr Arg Asp Gly Gly
35 40 45
<210> SEQ ID NO 29
<211> LENGTH: 48
<212> TYPE: PRT
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 29
Ser Ile Ile Thr Leu Pro Cys Arg Ile Lys Gln Ile Ile Asp Met Trp
1 5 10 15
Gln Lys Val Gly Arg Ala Ile Tyr Ala Pro Pro Ile Glu Gly Asn Ile
20 25 30
Thr Cys Ser Ser Ser Ile Thr Gly Leu Leu Leu Ala Arg Asp Gly Gly
35 40 45
<210> SEQ ID NO 30
<211> LENGTH: 2469
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PR975(+)
<400> SEQUENCE: 30
gtcgacgcca ccatggccga ggccatgagc caggccacca gcgccaacat cctgatgcag 60
cgcagcaact tcaagggccc caagcgcatc atcaagtgct tcaactgcgg caaggagggc 120
cacatcgccc gcaactgccg cgccccccgc aagaagggct gctggaagtg cggcaaggag 180
ggccaccaga tgaaggactg caccgagcgc caggccaact tcttccgcga ggacctggcc 240
ttcccccagg gcaaggcccg cgagttcccc agcgagcaga accgcgccaa cagccccacc 300
agccgcgagc tgcaggtgcg cggcgacaac ccccgcagcg aggccggcgc cgagcgccag 360
ggcaccctga acttccccca gatcaccctg tggcagcgcc ccctggtgag catcaaggtg 420
ggcggccaga tcaaggaggc cctgctggac accggcgccg acgacaccgt gctggaggag 480
atgagcctgc ccggcaagtg gaagcccaag atgatcggcg gcatcggcgg cttcatcaag 540
gtgcgccagt acgaccagat cctgatcgag atctgcggca agaaggccat cggcaccgtg 600
ctgatcggcc ccacccccgt gaacatcatc ggccgcaaca tgctgaccca gctgggctgc 660
accctgaact tccccatcag ccccatcgag accgtgcccg tgaagctgaa gcccggcatg 720
gacggcccca aggtgaagca gtggcccctg accgaggaga agatcaaggc cctgaccgcc 780
atctgcgagg agatggagaa ggagggcaag atcaccaaga tcggccccga gaacccctac 840
aacacccccg tgttcgccat caagaagaag gacagcacca agtggcgcaa gctggtggac 900
ttccgcgagc tgaacaagcg cacccaggac ttctgggagg tgcagctggg catcccccac 960
cccgccggcc tgaagaagaa gaagagcgtg accgtgctgg acgtgggcga cgcctacttc 1020
agcgtgcccc tggacgagga cttccgcaag tacaccgcct tcaccatccc cagcatcaac 1080
aacgagaccc ccggcatccg ctaccagtac aacgtgctgc cccagggctg gaagggcagc 1140
cccagcatct tccagagcag catgaccaag atcctggagc ccttccgcgc ccgcaacccc 1200
gagatcgtga tctaccagta catggacgac ctgtacgtgg gcagcgacct ggagatcggc 1260
cagcaccgcg ccaagatcga ggagctgcgc aagcacctgc tgcgctgggg cttcaccacc 1320
cccgacaaga agcaccagaa ggagcccccc ttcctgtgga tgggctacga gctgcacccc 1380
gacaagtgga ccgtgcagcc catcgagctg cccgagaagg agagctggac cgtgaacgac 1440
atccagaagc tggtgggcaa gctgaactgg gccagccaga tctaccccgg catcaaggtg 1500
cgccagctgt gcaagctgct gcgcggcgcc aaggccctga ccgacatcgt gcccctgacc 1560
gaggaggccg agctggagct ggccgagaac cgcgagatcc tgcgcgagcc cgtgcacggc 1620
gtgtactacg accccagcaa ggacctggtg gccgagatcc agaagcaggg ccacgaccag 1680
tggacctacc agatctacca ggagcccttc aagaacctga agaccggcaa gtacgccaag 1740
atgcgcaccg cccacaccaa cgacgtgaag cagctgaccg aggccgtgca gaagatcgcc 1800
atggagagca tcgtgatctg gggcaagacc cccaagttcc gcctgcccat ccagaaggag 1860
acctgggaga cctggtggac cgactactgg caggccacct ggatccccga gtgggagttc 1920
gtgaacaccc cccccctggt gaagctgtgg taccagctgg agaaggagcc catcatcggc 1980
gccgagacct tctacgtgga cggcgccgcc aaccgcgaga ccaagatcgg caaggccggc 2040
tacgtgaccg accggggccg gcagaagatc gtgagcctga ccgagaccac caaccagaag 2100
accgagctgc aggccatcca gctggccctg caggacagcg gcagcgaggt gaacatcgtg 2160
accgacagcc agtacgccct gggcatcatc caggcccagc ccgacaagag cgagagcgag 2220
ctggtgaacc agatcatcga gcagctgatc aagaaggaga aggtgtacct gagctgggtg 2280
cccgcccaca agggcatcgg cggcaacgag cagatcgaca agctggtgag caagggcatc 2340
cgcaaggtgc tgttcctgga cggcatcgat ggcggcatcg tgatctacca gtacatggac 2400
gacctgtacg tgggcagcgg cggccctagg atcgattaaa agcttcccgg ggctagcacc 2460
ggtgaattc 2469
<210> SEQ ID NO 31
<211> LENGTH: 2463
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PR975YM
<400> SEQUENCE: 31
gtcgacgcca ccatggccga ggccatgagc caggccacca gcgccaacat cctgatgcag 60
cgcagcaact tcaagggccc caagcgcatc atcaagtgct tcaactgcgg caaggagggc 120
cacatcgccc gcaactgccg cgccccccgc aagaagggct gctggaagtg cggcaaggag 180
ggccaccaga tgaaggactg caccgagcgc caggccaact tcttccgcga ggacctggcc 240
ttcccccagg gcaaggcccg cgagttcccc agcgagcaga accgcgccaa cagccccacc 300
agccgcgagc tgcaggtgcg cggcgacaac ccccgcagcg aggccggcgc cgagcgccag 360
ggcaccctga acttccccca gatcaccctg tggcagcgcc ccctggtgag catcaaggtg 420
ggcggccaga tcaaggaggc cctgctggac accggcgccg acgacaccgt gctggaggag 480
atgagcctgc ccggcaagtg gaagcccaag atgatcggcg gcatcggcgg cttcatcaag 540
gtgcgccagt acgaccagat cctgatcgag atctgcggca agaaggccat cggcaccgtg 600
ctgatcggcc ccacccccgt gaacatcatc ggccgcaaca tgctgaccca gctgggctgc 660
accctgaact tccccatcag ccccatcgag accgtgcccg tgaagctgaa gcccggcatg 720
gacggcccca aggtgaagca gtggcccctg accgaggaga agatcaaggc cctgaccgcc 780
atctgcgagg agatggagaa ggagggcaag atcaccaaga tcggccccga gaacccctac 840
aacacccccg tgttcgccat caagaagaag gacagcacca agtggcgcaa gctggtggac 900
ttccgcgagc tgaacaagcg cacccaggac ttctgggagg tgcagctggg catcccccac 960
cccgccggcc tgaagaagaa gaagagcgtg accgtgctgg acgtgggcga cgcctacttc 1020
agcgtgcccc tggacgagga cttccgcaag tacaccgcct tcaccatccc cagcatcaac 1080
aacgagaccc ccggcatccg ctaccagtac aacgtgctgc cccagggctg gaagggcagc 1140
cccagcatct tccagagcag catgaccaag atcctggagc ccttccgcgc ccgcaacccc 1200
gagatcgtga tctaccaggc ccccctgtac gtgggcagcg acctggagat cggccagcac 1260
cgcgccaaga tcgaggagct gcgcaagcac ctgctgcgct ggggcttcac cacccccgac 1320
aagaagcacc agaaggagcc ccccttcctg tggatgggct acgagctgca ccccgacaag 1380
tggaccgtgc agcccatcga gctgcccgag aaggagagct ggaccgtgaa cgacatccag 1440
aagctggtgg gcaagctgaa ctgggccagc cagatctacc ccggcatcaa ggtgcgccag 1500
ctgtgcaagc tgctgcgcgg cgccaaggcc ctgaccgaca tcgtgcccct gaccgaggag 1560
gccgagctgg agctggccga gaaccgcgag atcctgcgcg agcccgtgca cggcgtgtac 1620
tacgacccca gcaaggacct ggtggccgag atccagaagc agggccacga ccagtggacc 1680
taccagatct accaggagcc cttcaagaac ctgaagaccg gcaagtacgc caagatgcgc 1740
accgcccaca ccaacgacgt gaagcagctg accgaggccg tgcagaagat cgccatggag 1800
agcatcgtga tctggggcaa gacccccaag ttccgcctgc ccatccagaa ggagacctgg 1860
gagacctggt ggaccgacta ctggcaggcc acctggatcc ccgagtggga gttcgtgaac 1920
accccccccc tggtgaagct gtggtaccag ctggagaagg agcccatcat cggcgccgag 1980
accttctacg tggacggcgc cgccaaccgc gagaccaaga tcggcaaggc cggctacgtg 2040
accgaccggg gccggcagaa gatcgtgagc ctgaccgaga ccaccaacca gaagaccgag 2100
ctgcaggcca tccagctggc cctgcaggac agcggcagcg aggtgaacat cgtgaccgac 2160
agccagtacg ccctgggcat catccaggcc cagcccgaca agagcgagag cgagctggtg 2220
aaccagatca tcgagcagct gatcaagaag gagaaggtgt acctgagctg ggtgcccgcc 2280
cacaagggca tcggcggcaa cgagcagatc gacaagctgg tgagcaaggg catccgcaag 2340
gtgctgttcc tggacggcat cgatggcggc atcgtgatct accagtacat ggacgacctg 2400
tacgtgggca gcggcggccc taggatcgat taaaagcttc ccggggctag caccggtgaa 2460
ttc 2463
<210> SEQ ID NO 32
<211> LENGTH: 2457
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PR975YMWM
<400> SEQUENCE: 32
gtcgacgcca ccatggccga ggccatgagc caggccacca gcgccaacat cctgatgcag 60
cgcagcaact tcaagggccc caagcgcatc atcaagtgct tcaactgcgg caaggagggc 120
cacatcgccc gcaactgccg cgccccccgc aagaagggct gctggaagtg cggcaaggag 180
ggccaccaga tgaaggactg caccgagcgc caggccaact tcttccgcga ggacctggcc 240
ttcccccagg gcaaggcccg cgagttcccc agcgagcaga accgcgccaa cagccccacc 300
agccgcgagc tgcaggtgcg cggcgacaac ccccgcagcg aggccggcgc cgagcgccag 360
ggcaccctga acttccccca gatcaccctg tggcagcgcc ccctggtgag catcaaggtg 420
ggcggccaga tcaaggaggc cctgctggac accggcgccg acgacaccgt gctggaggag 480
atgagcctgc ccggcaagtg gaagcccaag atgatcggcg gcatcggcgg cttcatcaag 540
gtgcgccagt acgaccagat cctgatcgag atctgcggca agaaggccat cggcaccgtg 600
ctgatcggcc ccacccccgt gaacatcatc ggccgcaaca tgctgaccca gctgggctgc 660
accctgaact tccccatcag ccccatcgag accgtgcccg tgaagctgaa gcccggcatg 720
gacggcccca aggtgaagca gtggcccctg accgaggaga agatcaaggc cctgaccgcc 780
atctgcgagg agatggagaa ggagggcaag atcaccaaga tcggccccga gaacccctac 840
aacacccccg tgttcgccat caagaagaag gacagcacca agtggcgcaa gctggtggac 900
ttccgcgagc tgaacaagcg cacccaggac ttctgggagg tgcagctggg catcccccac 960
cccgccggcc tgaagaagaa gaagagcgtg accgtgctgg acgtgggcga cgcctacttc 1020
agcgtgcccc tggacgagga cttccgcaag tacaccgcct tcaccatccc cagcatcaac 1080
aacgagaccc ccggcatccg ctaccagtac aacgtgctgc cccagggctg gaagggcagc 1140
cccagcatct tccagagcag catgaccaag atcctggagc ccttccgcgc ccgcaacccc 1200
gagatcgtga tctaccaggc ccccctgtac gtgggcagcg acctggagat cggccagcac 1260
cgcgccaaga tcgaggagct gcgcaagcac ctgctgcgct ggggcttcac cacccccgac 1320
aagaagcacc agaaggagcc ccccttcctg cccatcgagc tgcaccccga caagtggacc 1380
gtgcagccca tcgagctgcc cgagaaggag agctggaccg tgaacgacat ccagaagctg 1440
gtgggcaagc tgaactgggc cagccagatc taccccggca tcaaggtgcg ccagctgtgc 1500
aagctgctgc gcggcgccaa ggccctgacc gacatcgtgc ccctgaccga ggaggccgag 1560
ctggagctgg ccgagaaccg cgagatcctg cgcgagcccg tgcacggcgt gtactacgac 1620
cccagcaagg acctggtggc cgagatccag aagcagggcc acgaccagtg gacctaccag 1680
atctaccagg agcccttcaa gaacctgaag accggcaagt acgccaagat gcgcaccgcc 1740
cacaccaacg acgtgaagca gctgaccgag gccgtgcaga agatcgccat ggagagcatc 1800
gtgatctggg gcaagacccc caagttccgc ctgcccatcc agaaggagac ctgggagacc 1860
tggtggaccg actactggca ggccacctgg atccccgagt gggagttcgt gaacaccccc 1920
cccctggtga agctgtggta ccagctggag aaggagccca tcatcggcgc cgagaccttc 1980
tacgtggacg gcgccgccaa ccgcgagacc aagatcggca aggccggcta cgtgaccgac 2040
cggggccggc agaagatcgt gagcctgacc gagaccacca accagaagac cgagctgcag 2100
gccatccagc tggccctgca ggacagcggc agcgaggtga acatcgtgac cgacagccag 2160
tacgccctgg gcatcatcca ggcccagccc gacaagagcg agagcgagct ggtgaaccag 2220
atcatcgagc agctgatcaa gaaggagaag gtgtacctga gctgggtgcc cgcccacaag 2280
ggcatcggcg gcaacgagca gatcgacaag ctggtgagca agggcatccg caaggtgctg 2340
ttcctggacg gcatcgatgg cggcatcgtg atctaccagt acatggacga cctgtacgtg 2400
ggcagcggcg gccctaggat cgattaaaag cttcccgggg ctagcaccgg tgaattc 2457
<210> SEQ ID NO 33
<211> LENGTH: 9781
<212> TYPE: DNA
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 33
tggaagggtt aatttactcc aagaaaaggc aagaaatcct tgatttgtgg gtctatcaca 60
cacaaggctt cttccctgat tggcaaaact acacaccggg gccaggggtc agatatccac 120
tgacctttgg atggtgctac aagctagtgc cagttgaccc aggggaggtg gaagaggcca 180
acggaggaga agacaactgt ttgctacacc ctatgagcca acatggagca gaggatgaag 240
atagagaagt attaaagtgg aagtttgaca gcctcctagc acgcagacac atggcccgcg 300
agctacatcc ggagtattac aaagactgct gacacagaag ggactttccg cctgggactt 360
tccactgggg cgttccggga ggtgtggtct gggcgggact tgggagtggt caaccctcag 420
atgctgcata taagcagctg cttttcgcct gtactgggtc tctctcggta gaccagatct 480
gagcctggga gccctctggc tatctaggga acccactgct taagcctcaa taaagcttgc 540
cttgagtgct ttaagtagtg tgtgcccatc tgttgtgtga ctctggtaac tagagatccc 600
tcagaccctt tgtggtagtg tggaaaatct ctagcagtgg cgcccgaaca gggaccagaa 660
agtgaaagtg agaccagagg agatctctcg acgcaggact cggcttgctg aagtgcacac 720
ggcaagaggc gagaggggcg gctggtgagt acgccaattt tacttgacta gcggaggcta 780
gaaggagaga gatgggtgcg agagcgtcaa tattaagcgg cggaaaatta gataaatggg 840
aaagaattag gttaaggcca gggggaaaga aacattatat gttaaaacat ctagtatggg 900
caagcaggga gctggaaaga tttgcactta accctggcct gttagaaaca tcagaaggct 960
gtaaacaaat aataaaacag ctacaaccag ctcttcagac aggaacagag gaacttagat 1020
cattattcaa cacagtagca actctctatt gtgtacataa agggatagag gtacgagaca 1080
ccaaggaagc cttagacaag atagaggaag aacaaaacaa atgtcagcaa aaagcacaac 1140
aggcaaaagc agctgacgaa aaggtcagtc aaaattatcc tatagtacag aatgcccaag 1200
ggcaaatggt acaccaagct atatcaccta gaacattgaa tgcatggata aaagtaatag 1260
aggaaaaggc tttcaatcca gaggaaatac ccatgtttac agcattatca gaaggagcca 1320
ccccacaaga tttaaacaca atgttaaata cagtgggggg acatcaagca gccatgcaaa 1380
tgttaaaaga taccatcaat gaggaggctg cagaatggga taggacacat ccagtacatg 1440
cagggcctgt tgcaccaggc cagatgagag aaccaagggg aagtgacata gcaggaacta 1500
ctagtaccct tcaggaacaa atagcatgga tgacaagtaa tccacctatt ccagtagaag 1560
acatctataa aagatggata attctggggt taaataaaat agtaagaatg tatagccctg 1620
ttagcatttt ggacataaaa caagggccaa aagaaccctt tagagactat gtagaccggt 1680
tctttaaaac cttaagagct gaacaagcta cacaagatgt aaagaattgg atgacagaca 1740
ccttgttggt ccaaaatgcg aacccagatt gtaagaccat tttaagagca ttaggaccag 1800
gggcctcatt agaagaaatg atgacagcat gtcagggagt gggaggacct agccataaag 1860
caagagtgtt ggctgaggca atgagccaag caaacagtaa catactagtg cagagaagca 1920
attttaaagg ctctaacaga attattaaat gtttcaactg tggcaaagta gggcacatag 1980
ccagaaattg cagggcccct aggaaaaagg gctgttggaa atgtggacag gaaggacacc 2040
aaatgaaaga ctgtactgag aggcaggcta attttttagg gaaaatttgg ccttcccaca 2100
aggggaggcc agggaatttc ctccagaaca gaccagagcc aacagcccca ccagcagaac 2160
caacagcccc accagcagag agcttcaggt tcgaggagac aacccccgtg ccgaggaagg 2220
agaaagagag ggaaccttta acttccctca aatcactctt tggcagcgac cccttgtctc 2280
aataaaagta gagggccaga taaaggaggc tctcttagac acaggagcag atgatacagt 2340
attagaagaa atagatttgc cagggaaatg gaaaccaaaa atgatagggg gaattggagg 2400
ttttatcaaa gtaagacagt atgatcaaat acttatagaa atttgtggaa aaaaggctat 2460
aggtacagta ttagtagggc ctacaccagt caacataatt ggaagaaatc tgttaactca 2520
gcttggatgc acactaaatt ttccaattag tcctattgaa actgtaccag taaaattaaa 2580
accaggaatg gatggcccaa aggtcaaaca atggccattg acagaagaaa aaataaaagc 2640
attaacagca atttgtgagg aaatggagaa ggaaggaaaa attacaaaaa ttgggcctga 2700
taatccatat aacactccag tatttgccat aaaaaagaag gacagtacta agtggagaaa 2760
attagtagat ttcagggaac tcaataaaag aactcaagac ttttgggaag ttcaattagg 2820
aataccacac ccagcaggat taaaaaagaa aaaatcagtg acagtgctag atgtggggga 2880
tgcatatttt tcagttcctt tagatgaaag cttcaggaaa tatactgcat tcaccatacc 2940
tagtataaac aatgaaacac cagggattag atatcaatat aatgtgctgc cacagggatg 3000
gaaaggatca ccagcaatat tccagagtag catgacaaaa atcttagagc ccttcagagc 3060
aaaaaatcca gacatagtta tctatcaata tatggatgac ttgtatgtag gatctgactt 3120
agaaataggg caacatagag caaaaataga agagttaagg gaacatttat tgaaatgggg 3180
atttacaaca ccagacaaga aacatcaaaa agaaccccca tttctttgga tggggtatga 3240
actccatcct gacaaatgga cagtacaacc tatactgctg ccagaaaagg atagttggac 3300
tgtcaatgat atacagaagt tagtgggaaa attaaactgg gcaagtcaga tttacccagg 3360
gattaaagta aggcaactct gtaaactcct caggggggcc aaagcactaa cagacatagt 3420
accactaact gaagaagcag aattagaatt ggcagagaac agggaaattt taagagaacc 3480
agtacatgga gtatattatg atccatcaaa agacttgata gctgaaatac agaaacaggg 3540
gcatgaacaa tggacatatc aaatttatca agaaccattt aaaaatctga aaacagggaa 3600
gtatgcaaaa atgaggacta cccacactaa tgatgtaaaa cagttaacag aggcagtgca 3660
aaaaatagcc atggaaagca tagtaatatg gggaaagact cctaaattta gactacccat 3720
ccaaaaagaa acatgggaga catggtggac agactattgg caagccacct ggatccctga 3780
gtgggagttt gttaataccc ctcccctagt aaaattatgg taccaactag aaaaagatcc 3840
catagcagga gtagaaactt tctatgtaga tggagcaact aatagggaag ctaaaatagg 3900
aaaagcaggg tatgttactg acagaggaag gcagaaaatt gttactctaa ctaacacaac 3960
aaatcagaag actgagttac aagcaattca gctagctctg caggattcag gatcagaagt 4020
aaacatagta acagactcac agtatgcatt aggaatcatt caagcacaac cagataagag 4080
tgactcagag atatttaacc aaataataga acagttaata aacaaggaaa gaatctacct 4140
gtcatgggta ccagcacata aaggaattgg gggaaatgaa caagtagata aattagtaag 4200
taagggaatt aggaaagtgt tgtttctaga tggaatagat aaagctcaag aagagcatga 4260
aaggtaccac agcaattgga gagcaatggc taatgagttt aatctgccac ccatagtagc 4320
aaaagaaata gtagctagct gtgataaatg tcagctaaaa ggggaagcca tacatggaca 4380
agtcgactgt agtccaggga tatggcaatt agattgtacc catttagagg gaaaaatcat 4440
cctggtagca gtccatgtag ctagtggcta catggaagca gaggttatcc cagcagaaac 4500
aggacaagaa acagcatatt ttatattaaa attagcagga agatggccag tcaaagtaat 4560
acatacagac aatggcagta attttaccag tactgcagtt aaggcagcct gttggtgggc 4620
aggtatccaa caggaatttg gaattcccta caatccccaa agtcagggag tggtagaatc 4680
catgaataaa gaattaaaga aaataatagg acaagtaaga gatcaagctg agcaccttaa 4740
gacagcagta caaatggcag tattcattca caattttaaa agaaaagggg gaattggggg 4800
gtacagtgca ggggaaagaa taatagacat aatagcaaca gacatacaaa ctaaagaatt 4860
acaaaaacaa attataagaa ttcaaaattt tcgggtttat tacagagaca gcagagaccc 4920
tatttggaaa ggaccagccg aactactctg gaaaggtgaa ggggtagtag taatagaaga 4980
taaaggtgac ataaaggtag taccaaggag gaaagcaaaa atcattagag attatggaaa 5040
acagatggca ggtgctgatt gtgtggcagg tggacaggat gaagattaga gcatggaata 5100
gtttagtaaa gcaccatatg tatatatcaa ggagagctag tggatgggtc tacagacatc 5160
attttgaaag cagacatcca aaagtaagtt cagaagtaca tatcccatta ggggatgcta 5220
gattagtaat aaaaacatat tggggtttgc agacaggaga aagagattgg catttgggtc 5280
atggagtctc catagaatgg agactgagag aatacagcac acaagtagac cctgacctgg 5340
cagaccagct aattcacatg cattattttg attgttttac agaatctgcc ataagacaag 5400
ccatattagg acacatagtt tttcctaggt gtgactatca agcaggacat aagaaggtag 5460
gatctctgca atacttggca ctgacagcat tgataaaacc aaaaaagaga aagccacctc 5520
tgcctagtgt tagaaaatta gtagaggata gatggaacga cccccagaag accaggggcc 5580
gcagagggaa ccatacaatg aatggacact agagattcta gaagaactca agcaggaagc 5640
tgtcagacac tttcctagac catggctcca tagcttagga caatatatct atgaaaccta 5700
tggggatact tggacgggag ttgaagctat aataagagta ctgcaacaac tactgttcat 5760
tcatttcaga attggatgcc aacatagcag aataggcatc ttgcgacaga gaagagcaag 5820
aaatggagcc agtagatcct aaactaaagc cctggaacca tccaggaagc caacctaaaa 5880
cagcttgtaa taattgcttt tgcaaacact gtagctatca ttgtctagtt tgctttcaga 5940
caaaaggttt aggcatttcc tatggcagga agaagcggag acagcgacga agcgctcctc 6000
caagtggtga agatcatcaa aatcctctat caaagcagta agtacacata gtagatgtaa 6060
tggtaagttt aagtttattt aaaggagtag attatagatt aggagtagga gcattgatag 6120
tagcactaat catagcaata atagtgtgga ccatagcata tatagaatat aggaaattgg 6180
taagacaaaa gaaaatagac tggttaatta aaagaattag ggaaagagca gaagacagtg 6240
gcaatgagag tgatggggac acagaagaat tgtcaacaat ggtggatatg gggcatctta 6300
ggcttctgga tgctaatgat ttgtaacacg gaggacttgt gggtcacagt ctactatggg 6360
gtacctgtgt ggagagaagc aaaaactact ctattctgtg catcagatgc taaagcatat 6420
gagacagaag tgcataatgt ctgggctaca catgcttgtg tacccacaga ccccaaccca 6480
caagaaatag ttttgggaaa tgtaacagaa aattttaata tgtggaaaaa taacatggca 6540
gatcagatgc atgaggatat aatcagttta tgggatcaaa gcctaaagcc atgtgtaaag 6600
ttgaccccac tctgtgtcac tttaaactgt acagatacaa atgttacagg taatagaact 6660
gttacaggta atacaaatga taccaatatt gcaaatgcta catataagta tgaagaaatg 6720
aaaaattgct ctttcaatgc aaccacagaa ttaagagata agaaacataa agagtatgca 6780
ctcttttata aacttgatat agtaccactt aatgaaaata gtaacaactt tacatataga 6840
ttaataaatt gcaatacctc aaccataaca caagcctgtc caaaggtctc ttttgacccg 6900
attcctatac attactgtgc tccagctgat tatgcgattc taaagtgtaa taataagaca 6960
ttcaatggga caggaccatg ttataatgtc agcacagtac aatgtacaca tggaattaag 7020
ccagtggtat caactcaact actgttaaat ggtagtctag cagaagaagg gataataatt 7080
agatctgaaa atttgacaga gaataccaaa acaataatag tacatcttaa tgaatctgta 7140
gagattaatt gtacaaggcc caacaataat acaaggaaaa gtgtaaggat aggaccagga 7200
caagcattct atgcaacaaa tgacgtaata ggaaacataa gacaagcaca ttgtaacatt 7260
agtacagata gatggaataa aactttacaa caggtaatga aaaaattagg agagcatttc 7320
cctaataaaa caataaaatt tgaaccacat gcaggagggg atctagaaat tacaatgcat 7380
agctttaatt gtagaggaga atttttctat tgcaatacat caaacctgtt taatagtaca 7440
tactacccta agaatggtac atacaaatac aatggtaatt caagcttacc catcacactc 7500
caatgcaaaa taaaacaaat tgtacgcatg tggcaagggg taggacaagc aatgtatgcc 7560
cctcccattg caggaaacat aacatgtaga tcaaacatca caggaatact attgacacgt 7620
gatgggggat ttaacaacac aaacaacgac acagaggaga cattcagacc tggaggagga 7680
gatatgaggg ataactggag aagtgaatta tataaatata aagtggtaga aattaagcca 7740
ttgggaatag cacccactaa ggcaaaaaga agagtggtgc agagaaaaaa aagagcagtg 7800
ggaataggag ctgtgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcg 7860
tcaataacgc tgacggtaca ggccagacaa ctgttgtctg gtatagtgca acagcaaagc 7920
aatttgctga aggctataga ggcgcaacag catatgttgc aactcacagt ctggggcatt 7980
aagcagctcc aggcgagagt cctggctata gaaagatacc taaaggatca acagctccta 8040
gggatttggg gctgctctgg aagactcatc tgcaccactg ctgtgccttg gaactccagt 8100
tggagtaata aatctgaagc agatatttgg gataacatga cttggatgca gtgggataga 8160
gaaattaata attacacaga aacaatattc aggttgcttg aagactcgca aaaccagcag 8220
gaaaagaatg aaaaagattt attagaattg gacaagtgga ataatctgtg gaattggttt 8280
gacatatcaa actggctgtg gtatataaaa atattcataa tgatagtagg aggcttgata 8340
ggtttaagaa taatttttgc tgtgctctct atagtgaata gagttaggca gggatactca 8400
cctttgtcat ttcagaccct taccccaagc ccgaggggac tcgacaggct cggaggaatc 8460
gaagaagaag gtggagagca agacagagac agatccatac gattggtgag cggattcttg 8520
tcgcttgcct gggacgatct gcggagcctg tgcctcttca gctaccaccg cttgagagac 8580
ttcatattaa ttgcagtgag ggcagtggaa cttctgggac acagcagtct caggggacta 8640
cagagggggt gggagatcct taagtatctg ggaagtcttg tgcagtattg gggtctagag 8700
ctaaaaaaga gtgctattag tccgcttgat accatagcaa tagcagtagc tgaaggaaca 8760
gataggatta tagaattggt acaaagaatt tgtagagcta tcctcaacat acctaggaga 8820
ataagacagg gctttgaagc agctttgcta taaaatggga ggcaagtggt caaaacgcag 8880
catagttgga tggcctgcag taagagaaag aatgagaaga actgagccag cagcagaggg 8940
agtaggagca gcgtctcaag acttagatag acatggggca cttacaagca gcaacacacc 9000
tgctactaat gaagcttgtg cctggctgca agcacaagag gaggacggag atgtaggctt 9060
tccagtcaga cctcaggtac ctttaagacc aatgacttat aagagtgcag tagatctcag 9120
cttcttttta aaagaaaagg ggggactgga agggttaatt tactctagga aaaggcaaga 9180
aatccttgat ttgtgggtct ataacacaca aggcttcttc cctgattggc aaaactacac 9240
atcggggcca ggggtccgat tcccactgac ctttggatgg tgcttcaagc tagtaccagt 9300
tgacccaagg gaggtgaaag aggccaatga aggagaagac aactgtttgc tacaccctat 9360
gagccaacat ggagcagagg atgaagatag agaagtatta aagtggaagt ttgacagcct 9420
tctagcacac agacacatgg cccgcgagct acatccggag tattacaaag actgctgaca 9480
cagaagggac tttccgcctg ggactttcca ctggggcgtt ccgggaggtg tggtctgggc 9540
gggacttggg agtggtcacc ctcagatgct gcatataagc agctgctttt cgcttgtact 9600
gggtctctct cggtagacca gatctgagcc tgggagctct ctggctatct agggaaccca 9660
ctgcttaggc ctcaataaag cttgccttga gtgctctaag tagtgtgtgc ccatctgttg 9720
tgtgactctg gtaactagag atccctcaga ccctttgtgg tagtgtggaa aatctctagc 9780
a 9781
<210> SEQ ID NO 34
<211> LENGTH: 203
<212> TYPE: DNA
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 34
gctgaggcaa tgagccaagc aaccagcgca aacatactga tgcagagaag caatttcaaa 60
ggccctaaaa gaattattaa atgtttcaac tgtggcaagg aagggcacat agctagaaat 120
tgtagggccc ctaggaaaaa aggctgttgg aaatgtggaa aggaaggaca ccaaatgaaa 180
gactgtactg agaggcaggc taa 203
<210> SEQ ID NO 35
<211> LENGTH: 2151
<212> TYPE: DNA
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 35
ttttttaggg aagatttggc cttcccacaa gggaaggcca gggaatttcc ttcagaacag 60
aacagagcca acagccccac cagcagagag cttcaagttc gaggagacaa cccccgctcc 120
gaagcaggag ccgaaagaca gggaaccctt aatttccctc aaatcactct ttggcagcga 180
ccccttgtct caataaaagt agggggtcaa ataaaggagg ctctcttaga cacaggagct 240
gatgatacag tattagaaga aatgagtttg ccaggaaaat ggaaaccaaa aatgatagga 300
ggaattggag gttttatcaa agtaagacag tatgatcaaa tacttataga aatttgtgga 360
aaaaaggcta taggtacagt attaatagga cctacacctg tcaacataat tggaaggaat 420
atgttgactc agcttggatg cacactaaat tttccaatta gtcccattga aactgtgcca 480
gtaaaattaa agccaggaat ggatggccca aaggttaaac aatggccatt gacagaagag 540
aaaataaaag cattaacagc aatttgtgaa gaaatggaga aagaaggaaa aattacaaaa 600
attgggcctg aaaatccata taacactcca gtatttgcca taaaaaagaa ggacagtact 660
aagtggagaa agttagtaga tttcagggaa cttaataaaa gaactcaaga cttttgggaa 720
gttcaattag gaataccaca cccagcaggg ttaaaaaaga aaaaatcagt gacagtactg 780
gatgtggggg atgcatattt ttcagttcct ttagatgagg acttcaggaa atatactgca 840
ttcaccatac ctagtataaa caatgaaaca ccagggatta gatatcaata taatgtgctt 900
ccacagggat ggaaaggatc accatcaata ttccagagta gcatgacaaa aatcttagag 960
ccctttagag caagaaatcc agaaatagtc atctatcaat atatggatga cttgtatgta 1020
ggatctgact tagaaatagg gcaacataga gcaaaaatag aggagttaag aaaacatctg 1080
ttaaggtggg gatttaccac accggacaag aaacatcaga aagaaccccc atttctttgg 1140
atggggtatg aactccatcc tgacaaatgg acagtacagc ctatagagtt gccagaaaag 1200
gaaagctgga ctgtcaatga tatacagaag ttagtgggaa aattaaattg ggccagtcag 1260
atttacccag gaattaaagt aaggcaactt tgtaaactcc ttaggggggc caaagcacta 1320
acagatatag taccactaac tgaagaagca gaattagaat tggcagagaa cagggaaatt 1380
ctaagagaac cagtacatgg agtatattat gacccatcaa aagacttggt agctgaaata 1440
cagaaacagg ggcatgacca atggacatat caaatttacc aagaaccatt caaaaacctg 1500
aaaacaggga agtatgcaaa aatgaggact gcccacacta atgatgtaaa acagttaaca 1560
gaggcagtgc aaaaaatagc tatggaaagc atagtaatat ggggaaagac tcctaaattt 1620
agactaccca tccaaaaaga aacatgggag acatggtgga cagactattg gcaagccacc 1680
tggattcctg agtgggagtt tgttaatacc cctcccttag taaaattatg gtaccagcta 1740
gagaaagaac ccataatagg agcagaaact ttctatgtag atggagcagc taatagggaa 1800
actaaaatag gaaaagcagg gtatgttact gacagaggaa ggcagaaaat tgtttctcta 1860
acagaaacaa caaatcagaa gactgaatta caagcaattc agctagcttt gcaagattca 1920
ggatcagaag taaacatagt aacagactca cagtatgcat taggaatcat tcaagcacaa 1980
ccagataaga gtgaatcaga gttagtcaac caaataatag aacaattaat aaaaaaggaa 2040
aaggtctacc tgtcatgggt accagcacat aaaggaattg gaggaaatga acaaatagat 2100
aaattagtaa gtaagggaat caggaaagtg ctgtttctag atggaataga t 2151
<210> SEQ ID NO 36
<211> LENGTH: 54
<212> TYPE: DNA
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 36
ggcggcatcg tgatctacca gtacatggac gacctgtacg tgggcagcgg cggc 54
<210> SEQ ID NO 37
<211> LENGTH: 18
<212> TYPE: PRT
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 37
Gly Gly Ile Val Ile Tyr Gln Tyr Met Asp Asp Leu Tyr Val Gly Ser
1 5 10 15
Gly Gly
<210> SEQ ID NO 38
<211> LENGTH: 38
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: primer S1FCSacTA
<400> SEQUENCE: 38
gtttcttgag ctctggaagg gttaatttac tccaagaa 38
<210> SEQ ID NO 39
<211> LENGTH: 38
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: primer S1FTSacTA
<400> SEQUENCE: 39
gtttcttgag ctctggaagg gttaatttac tctaagaa 38
<210> SEQ ID NO 40
<211> LENGTH: 35
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: primer S145RTSalTA
<400> SEQUENCE: 40
gtttcttgtc gacttgtcca tgtatggctt cccct 35
<210> SEQ ID NO 41
<211> LENGTH: 34
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: primer S145RCSalTA
<400> SEQUENCE: 41
gtttcttgtc gacttgtcca tgcatggctt ccct 34
<210> SEQ ID NO 42
<211> LENGTH: 38
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: primer S245FASalTA
<400> SEQUENCE: 42
gtttcttgtc gactgtagtc caggaatatg gcaattag 38
<210> SEQ ID NO 43
<211> LENGTH: 38
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: primer S245FGSalTA
<400> SEQUENCE: 43
gtttcttgtc gactgtagtc cagggatatg gcaattag 38
<210> SEQ ID NO 44
<211> LENGTH: 39
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: primer S2FullNotTA
<400> SEQUENCE: 44
gtttcttgcg gccgctgcta gagattttcc acactacca 39
<210> SEQ ID NO 45
<211> LENGTH: 9738
<212> TYPE: DNA
<213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 45
tggaagggtt aatttactcc aggaaaaggc aagagatcct tgatttatgg gtctatcaca 60
cacaaggcta cttccctgat tggcaaaact acacaccggg accaggggtc agatatccac 120
tgacctttgg atggtgcttc aagctagtgc cagttgaccc aagggaagta gaagaggcca 180
acggaggaga agacaactgt ttgctacacc ctatgagcca gtatggaatg gatgatgaac 240
acaaagaagt gttacagtgg aagtttgaca gcagcctagc acgcagacac ctggcccgcg 300
agctacatcc ggattattac aaagactgct gacacagaag ggactttccg cctgggactt 360
tccactgggg cgttccaggg ggagtggtct gggcgggact gggagtggcc agccctcaga 420
tgctgcatat aagcagcggc ttttcgcctg tactgggtct ctctaggtag accagatccg 480
agcctgggag ctctctgtct atctggggaa cccactgctt aggcctcaat aaagcttgcc 540
ttgagtgctc taagtagtgt gtgcccatct gttgtgtgac tctggtaact ctggtaacta 600
gagatccctc agaccctttg tggtagtgtg gaaaatctct agcagtggcg cccgaacagg 660
gacttgaaag cgaaagtgag accagagaag atctctcgac gcaggactcg gcttgctgaa 720
gtgcactcgg caagaggcga ggggggcgac tggtgagtac gccaaaattt tttttgacta 780
gcggaggcta gaaggagaga gatgggtgcg agagcgtcaa tattaagagg gggaaaatta 840
gacaaatggg aaaaaattag gttacggcca ggggggagaa aacactatat gctaaaacac 900
ctagtatggg caagcagaga gctggaaaga tttgcagtta accctggcct tttagagaca 960
tcagacggat gtagacaaat aataaaacag ctacaaccag ctcttcagac aggaacagag 1020
gaaattagat cattatttaa cacagtagca actctctatt gtgtacataa agggatagat 1080
gtacgagaca ccaaggaagc cttagacaag atagaggagg aacaaaacaa atgtcagcaa 1140
aaaacacagc aggcggaagc ggctgacaaa aaggtcagtc aaaattatcc tatagtgcag 1200
aacctccaag ggcaaatggt acaccaggcc atatcaccta gaaccttgaa tgcatgggta 1260
aaagtaatag aggagaaggc ttttagccca gaggtaatac ccatgtttac agcattatca 1320
gaaggagcca ccccacaaga tttaaacacc atgttaaata cagtgggggg acatcaagca 1380
gccatgcaaa tgttaaaaga taccatcaat gaggaggctg cagaatggga taggttacat 1440
ccagtacatg cagggcctgt tgcaccaggc cagatgagag aaccaagggg aagtgacata 1500
gcaggaacta ctagtaccct tcaagaacaa atagcatgga tgacaagtaa cccacctatc 1560
ccagtagggg acatctataa aaggtggata attctggggt taaataaaat agtaagaatg 1620
tacagccctg tcagcatttt agacataaaa caaggaccaa aggaaccctt tagagactat 1680
gtagaccggt tcttcaaaac tttaagagct gaacaatcta cacaagaggt aaaaaattgg 1740
atgacagaca ccttgttagt ccaaaatgcg aacccagatt gtaagaccat tttaagagca 1800
ttaggaccag gggcttcatt agaagaaatg atgacagcat gtcagggagt gggaggacct 1860
agccacaaag caagagtttt ggctgaggca atgagccaag caaacaatac aagtgtaatg 1920
atacagaaaa gcaattttaa aggccctaga agagctgtta aatgtttcaa ctgtggcagg 1980
gaagggcaca tagccaggaa ttgcagggcc cctaggaaaa ggggctgttg gaaatgtgga 2040
aaggaaggac accaaatgaa agactgtact gagaggcagg ctaatttttt agggaaaatt 2100
tggccttccc acaaggggag gccagggaat ttccttcaga gcagaccaga gccaacagcc 2160
ccaccactag aaccaacagc cccaccagca gagagcttca agttcaagga gactccgaag 2220
caggagccga aagacaggga acctttaact tccctcaaat cactctttgg cagcgacccc 2280
ttgtctcaat aaaagtagcg ggccaaacaa aggaggctct tttagataca ggagcagatg 2340
atacagtact agaagaaata aacttgccag gaaaatggaa accaaaaatg ataggaggaa 2400
ttggaggttt tatcaaagta agacagtatg atcaaatact tatagaaatt tgtggaaaaa 2460
gggctatagg tacagtatta gtaggaccta cacctgtcaa cataattgga agaaatctgt 2520
tgactcagct tggatgcaca ctaaattttc caattagccc cattgaaact gtaccagtaa 2580
aattaaagcc aggaatggat ggcccaaagg ttaaacaatg gccattgaca gaagaaaaaa 2640
taaaagcatt aacagaaatt tgtgaggaaa tggagaagga aggaaaaatt acaaaaattg 2700
ggcctgaaaa tccatataac actccagtat ttgccataaa gaagaaggac agtacaaagt 2760
ggagaaaatt agtagatttc agggaactca ataaaagaac tcaagacttt tgggaagtcc 2820
aattaggaat accacaccca gcagggttaa aaaagaaaaa atcagtgaca gtactggatg 2880
tgggagatgc atatttttca gtccctttag atgagagctt cagaaaatat actgcattca 2940
ccatacctag tataaacaat gaaacaccag ggattagata tcaatataat gttcttccac 3000
agggatggaa aggatcacca gcaatattcc agagtagcat gacaagaatc ttagagccct 3060
ttagaacaca aaacccagaa gtagttatct atcaatatat ggatgactta tatgtaggat 3120
ctgacttaga aatagggcaa catagagcaa aaatagagga gttaagagga cacctattga 3180
aatggggatt taccacacca gacaagaaac atcagaaaga acccccattt ctttggatgg 3240
ggtatgaact ccatcctgac aaatggacag tacagcctat acagctgcca gaaaaggaga 3300
gctggactgt caatgatata cagaagttag tgggaaagtt aaactgggca agtcagattt 3360
acccagggat taaagtaagg caactgtgta aactccttag gggagccaaa gcactaacag 3420
acatagtgcc actgactgaa gaagcagaat tagaattggc tgagaacagg gaaattctaa 3480
aagaaccagt acatggagta tattatgacc catcaaaaga tttaatagct gaaatacaga 3540
aacaggggaa tgaccaatgg acatatcaaa tttaccaaga accatttaaa aatctgagaa 3600
caggaaagta tgcaaaaatg aggactgccc acactaatga tgtgaaacag ttagcagagg 3660
cagtgcaaaa gataacccag gaaagcatag taatatgggg aaaaactcct aaatttagac 3720
tacccatccc aaaagaaaca tgggagacat ggtggtcaga ctattggcaa gccacctgga 3780
ttcctgagtg ggagtttgtc aatacccctc ccctagtaaa attgtggtac cagctggaaa 3840
aagaacccat agtaggggca gaaactttct atgtagatgg agcagccaat agggaaacta 3900
aaataggaaa agcagggtat gtcactgaca aaggaaggca gaaagttgtt tccttcactg 3960
aaacaacaaa tcagaagact gaattacaag caattcagct agctttgcag gattcagggc 4020
cagaagtaaa catagtaaca gactcacagt atgcattagg aatcattcaa gcacaaccag 4080
ataagagtga atcagaatta gtcagtcaaa taatagaaca gttgataaaa aaggaaaaag 4140
tctacctatc atgggtacca gcacataaag gaattggagg aaatgaacaa gtagacaaat 4200
tagtaagtag tggaatcaga aaagtactgt ttctagatgg aatagataaa gctcaagaag 4260
agcatgaaaa atatcacagc aattggagag caatggctag tgagtttaat ctgccaccca 4320
tagtagcaaa ggaaatagta gccagctgtg ataaatgtca gctaaaaggg gaagccatgc 4380
atggacaagt cgactgtagt ccaggaatat ggcaattaga ctgtacacat ttagaaggaa 4440
aaatcatcct agtagcagtc catgtagcca gtggctacat ggaagcagag gttatcccag 4500
cagaaacagg acaagaaaca gcatacttta tactaaaatt agcaggaaga tggccagtca 4560
aagtaataca tacagataat ggcagtaatt tcaccagtac cgcagttaag gcagcctgtt 4620
ggtgggcaga tatccaacgg gaatttggaa ttccctacaa tccccaaagt caaggagtag 4680
tagaatccat gaataaagaa ttaaagaaaa tcatagggca agtaagagat caagctgagc 4740
accttaagac agcagtacaa atggcagtat tcattcacaa ttttaaaaga aaagggggga 4800
ttggggggta cagtgcaggg gagagaataa tagacataat agcatcagac atacaaacta 4860
aagaattaca aaaacaaatt ataaaaattc aaaattttcg ggtttattac agagacagca 4920
gagaccctat ttggaaagga ccagccaaac tactctggaa aggtgaaggg gcagtagtaa 4980
tacaagataa tagtgatata aaggtagtac caagaaggaa agcaaaaatc attaaggact 5040
atggaaaaca gatggcaggt gctgattgtg tggcaggtag acaggatgaa gattagaaca 5100
tggcacagtt tagtaaagca ccatatgtat gtttcgagga gagctgatgg atggttctac 5160
agacatcatt atgaaagcag acacccaaaa gtaagttcag aagtacacat cccattagga 5220
gatgccaggt tagtaataaa aacatattgg ggtctgcaga caggagaaag agcttggcat 5280
ttgggtcacg gagtctccat agaatggaga ttgagaagat atagcacaca agtagaccct 5340
gacctgacag accaactaat tcatatgcat tattttgatt gttttgcaga atctgccata 5400
aggaaagcca tactaggaca gatagttagc cctaagtgtg actatcaagc aggacataac 5460
aaggtaggat ctctacaata cttggcactg acagcattga taaaaccaaa aaagataaag 5520
ccacctctgc ctagtgttag gaaattagta gaggatagat ggaacaagcc ccagaagacc 5580
aggggccgca gagggaacca tacaatgaat ggacactaga gcttttagaa gaactcaagc 5640
aggaagctgt cagacacttt cctagaccat ggctccataa cttaggacaa catatctatg 5700
aaacctatgg agatacttgg acaggagttg aagcaataat aagaatcctg caacaattac 5760
tgtttattca tttcaggatt gggtgccatc atagcagaat aggcattttg cgacagagaa 5820
gagcaagaaa tggagccaat agatcctaac ctagaaccct ggaaccatcc aggaagtcag 5880
cctaaaactg cttgtaatgg gtgttactgt aaacgttgca gctatcattg tctagtttgc 5940
tttcagaaaa aaggcttagg catttactat ggcaggaaga agcggagaca gcgacgaagc 6000
gctcctccaa gcaataaaga tcatcaagat cctctaccaa agcagtaagt accgaatagt 6060
atatgtaatg ttagatttaa ctgcaagaat agattctaga ttaggaatag gagcattgat 6120
agtagcacta atcatagcaa taatagtgtg gaccatagta tatatagaat ataggaaatt 6180
ggtaaggcaa aggaaaatag actggttagt taaaaggatt agggaaagag cagaagacag 6240
tggcaatgag agcgaggggg atactgaaga attatcgaca ctggtggata tggggcatct 6300
taggcttttg gatgctaatg atgtgtaatg tgaagggctt gtgggtcaca gtctactacg 6360
gggtacctgt ggggagagaa gcaaaaacta ctctattttg tgcatcagat gctaaagcat 6420
atgagaaaga agtgcataat gtctgggcta cacatgcctg tgtacccaca gaccccaacc 6480
cacaagaagt gattttgggc aatgtaacag aaaattttaa catgtggaaa aatgacatgg 6540
tggatcagat gcaggaagat ataatcagtt tatgggatca aagccttaag ccatgtgtaa 6600
aattgacccc actctgtgtc actttaaact gtacaaatgc aactgttaac tacaataata 6660
cctctaaaga catgaaaaat tgctctttct atgtaaccac agaattaaga gataagaaaa 6720
agaaagaaaa tgcacttttt tatagacttg atatagtacc acttaataat aggaagaatg 6780
ggaatattaa caactataga ttaataaatt gtaatacctc agccataaca caagcctgtc 6840
caaaagtctc gtttgaccca attcctatac attattgtgc tccagctggt tatgcgcctc 6900
taaaatgtaa taataagaaa ttcaatggaa taggaccatg cgataatgtc agcacagtac 6960
aatgtacaca tggaattaag ccagtggtat caactcaatt actgttaaat ggtagcctag 7020
cagaagaaga gataataatt agatctgaaa atctgacaaa caatgtcaaa acaataatag 7080
tacatcttaa tgaatctata gagattaaat gtacaagacc tggcaataat acaagaaaga 7140
gtgtgagaat aggaccagga caagcattct atgcaacagg agacataata ggagatataa 7200
gacaagcaca ttgtaacatt agtaaaaatg aatggaatac aactttacaa agggtaagtc 7260
aaaaattaca agaactcttc cctaatagta cagggataaa atttgcacca cactcaggag 7320
gggacctaga aattactaca catagcttta attgtggagg agaatttttc tattgcaata 7380
caacagacct gtttaatagt acatacagta atggtacatg cactaatggt acatgcatgt 7440
ctaataatac agagcgcatc acactccaat gcagaataaa acaaattata aacatgtggc 7500
aggaggtagg acgagcaatg tatgcccctc ccattgcagg aaacataaca tgtagatcaa 7560
atattacagg actactatta acacgtgatg gaggagataa taatactgaa acagagacat 7620
tcagacctgg aggaggagac atgagggaca attggagaag tgaattatat aaatacaagg 7680
tggtagaaat taaaccatta ggagtagcac ccactgctgc aaaaaggaga gtggtggaga 7740
gagaaaaaag agcagtagga ataggagctg tgttccttgg gttcttggga gcagcaggaa 7800
gcactatggg cgcagcatca ataacgctga cggtacaggc cagacaatta ttgtctggta 7860
tagtgcaaca gcaaagtaat ttgctgaggg ctatagaggc gcaacagcat atgttgcaac 7920
tcacggtctg gggcattaag cagctccagg caagagtcct ggctatagag agatacctac 7980
aggatcaaca gctcctagga ctgtggggct gctctggaaa actcatctgc accactaatg 8040
tgctttggaa ctctagttgg agtaataaaa ctcaaagtga tatttgggat aacatgacct 8100
ggatgcagtg ggatagggaa attagtaatt acacaaacac aatatacagg ttgcttgaag 8160
actcgcaaag ccagcaggaa agaaatgaaa aagatttact agcattggac aggtggaaca 8220
atctgtggaa ttggtttagc ataacaaatt ggctgtggta tataaaaata ttcataatga 8280
tagtaggagg cttgataggt ttaagaataa tttttgctgt gctctctcta gtaaatagag 8340
ttaggcaggg atactcaccc ttgtcattgc agacccttat cccaaacccg aggggacccg 8400
acaggctcgg aggaatcgaa gaagaaggtg gagagcaaga cagcagcaga tccattcgat 8460
tagtgagcgg attcttgaca cttgcctggg acgacctacg aagcctgtgc ctcttctgct 8520
accaccgatt gagagacttc atattaattg tagtgagagc agtggaactt ctgggacaca 8580
gtagtctcag gggactgcag agggggtggg gaacccttaa gtatttgggg agtcttgtgc 8640
aatattgggg tctagagtta aaaaagagtg ctattaatct gcttgatact atagcaatag 8700
cagtagctga aggaacagat aggattctag aattcataca aaacctttgt agaggtatcc 8760
gcaacgtacc tagaagaata agacagggct tcgaagcagc tttgcaataa aatggggggc 8820
aagtggtcaa aaagcagtat aattggatgg cctgaagtaa gagaaagaat cagacgaact 8880
aggtcagcag cagagggagt aggatcagcg tctcaagact tagagaaaca tggggcactt 8940
acaaccagca acacagccca caacaatgct gcttgcgcct ggctggaagc gcaagaggag 9000
gaaggagaag taggctttcc agtcagacct caggtacctt taagaccaat gacttataaa 9060
gcagcaatag atctcagctt ctttttaaaa gaaaaggggg gactggaagg gttaatttac 9120
tccaagaaaa ggcaagagat ccttgatttg tgggtttata acacacaagg cttcttccct 9180
gattggcaaa actacacacc gggaccaggg gtcagatttc cactgacctt tggatggtac 9240
ttcaagctag agccagtcga tccaagggaa gtagaagagg ccaatgaagg agaaaacaac 9300
tgtttactac accctatgag ccagcatgga atggaggatg aagacagaga agtattaaga 9360
tggaagtttg acagtacgct agcacgcaga cacatggccc gcgagctaca tccggagtat 9420
tacaaagact gctgacacag aagggacttt ccgctgggac tttccactgg ggcgttccag 9480
gaggtgtggt ctgggcggga caggggagtg gtcagccctg agatgctgca tataagcagc 9540
tgcttttcgc ctgtactggg tctctctagg tagaccagat ctgagcccgg gagctctctg 9600
gctatctagg gaacccactg cttaagcctc aataaagctt gccttgagtg ccttgagtag 9660
tgtgtgcccg tctgttgtgt gactctggta actagagatc cctcagacca cttgtggtag 9720
tgtggaaaat ctctagca 9738
<210> SEQ ID NO 46
<211> LENGTH: 97
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Env Optimized common region
short
<400> SEQUENCE: 46
catcaccctg cagtgcaaga tcaagcagat cgtgcgcatg tggcagggcg tgggccaggc 60
catgtacgcc ccccccatcg ccggcaacat cacctgc 97
<210> SEQ ID NO 47
<211> LENGTH: 144
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Env Optimized common region
<400> SEQUENCE: 47
ctgcccatca ccctgcagtg caagatcaag cagatcgtgc gcatgtggca gggcgtgggc 60
caggccatgt acgccccccc catcgccggc aacatcacct gccgcagcaa catcaccggc 120
atcctgctga cccgcgacgg cggc 144
<210> SEQ ID NO 48
<211> LENGTH: 144
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Env wild type common region
<400> SEQUENCE: 48
ttacccatca cactccaatg caaaataaaa caaattgtac gcatgtggca aggggtagga 60
caagcaatgt atgcccctcc cattgcagga aacataacat gtagatcaaa catcacagga 120
atactattga cacgtgatgg ggga 144
<210> SEQ ID NO 49
<211> LENGTH: 2610
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Envgp160 optimized
<400> SEQUENCE: 49
atgcgcgtga tgggcaccca gaagaactgc cagcagtggt ggatctgggg catcctgggc 60
ttctggatgc tgatgatctg caacaccgag gacctgtggg tgaccgtgta ctacggcgtg 120
cccgtgtggc gcgaggccaa gaccaccctg ttctgcgcca gcgacgccaa ggcctacgag 180
accgaggtgc acaacgtgtg ggccacccac gcctgcgtgc ccaccgaccc caacccccag 240
gagatcgtgc tgggcaacgt gaccgagaac ttcaacatgt ggaagaacaa catggccgac 300
cagatgcacg aggacatcat cagcctgtgg gaccagagcc tgaagccctg cgtgaagctg 360
acccccctgt gcgtgaccct gaactgcacc gacaccaacg tgaccggcaa ccgcaccgtg 420
accggcaaca ccaacgacac caacatcgcc aacgccacct acaagtacga ggagatgaag 480
aactgcagct tcaacgccac caccgagctg cgcgacaaga agcacaagga gtacgccctg 540
ttctacaagc tggacatcgt gcccctgaac gagaacagca acaacttcac ctaccgcctg 600
atcaactgca acaccagcac catcacccag gcctgcccca aggtgagctt cgaccccatc 660
cccatccact actgcgcccc cgccgactac gccatcctga agtgcaacaa caagaccttc 720
aacggcaccg gcccctgcta caacgtgagc accgtgcagt gcacccacgg catcaagccc 780
gtggtgagca cccagctgct gctgaacggc agcctggccg aggagggcat catcatccgc 840
agcgagaacc tgaccgagaa caccaagacc atcatcgtgc acctgaacga gagcgtggag 900
atcaactgca cccgccccaa caacaacacc cgcaagagcg tgcgcatcgg ccccggccag 960
gccttctacg ccaccaacga cgtgatcggc aacatccgcc aggcccactg caacatcagc 1020
accgaccgct ggaacaagac cctgcagcag gtgatgaaga agctgggcga gcacttcccc 1080
aacaagacca tcaagttcga gccccacgcc ggcggcgacc tggagatcac catgcacagc 1140
ttcaactgcc gcggcgagtt cttctactgc aacaccagca acctgttcaa cagcacctac 1200
taccccaaga acggcaccta caagtacaac ggcaacagca gcctgcccat caccctgcag 1260
tgcaagatca agcagatcgt gcgcatgtgg cagggcgtgg gccaggccat gtacgccccc 1320
cccatcgccg gcaacatcac ctgccgcagc aacatcaccg gcatcctgct gacccgcgac 1380
ggcggcttca acaacaccaa caacgacacc gaggagacct tccgccccgg cggcggcgac 1440
atgcgcgaca actggcgcag cgagctgtac aagtacaagg tggtggagat caagcccctg 1500
ggcatcgccc ccaccaaggc caagcgccgc gtggtgcagc gcaagaagcg cgccgtgggc 1560
atcggcgccg tgttcctggg cttcctgggc gccgccggca gcaccatggg cgccgccagc 1620
atcaccctga ccgtgcaggc ccgccagctg ctgagcggca tcgtgcagca gcagagcaac 1680
ctgctgaagg ccatcgaggc ccagcagcac atgctgcagc tgaccgtgtg gggcatcaag 1740
cagctgcagg cccgcgtgct ggccatcgag cgctacctga aggaccagca gctgctgggc 1800
atctggggct gcagcggccg cctgatctgc accaccgccg tgccctggaa cagcagctgg 1860
agcaacaaga gcgaggccga catctgggac aacatgacct ggatgcagtg ggaccgcgag 1920
atcaacaact acaccgagac catcttccgc ctgctggagg acagccagaa ccagcaggag 1980
aagaacgaga aggacctgct ggagctggac aagtggaaca acctgtggaa ctggttcgac 2040
atcagcaact ggctgtggta catcaagatc ttcatcatga tcgtgggcgg cctgatcggc 2100
ctgcgcatca tcttcgccgt gctgagcatc gtgaaccgcg tgcgccaggg ctacagcccc 2160
ctgagcttcc agaccctgac ccccagcccc cgcggcctgg accgcctggg cggcatcgag 2220
gaggagggcg gcgagcagga ccgcgaccgc agcatccgcc tggtgagcgg cttcctgagc 2280
ctggcctggg acgacctgcg cagcctgtgc ctgttcagct accaccgcct gcgcgacttc 2340
atcctgatcg ccgtgcgcgc cgtggagctg ctgggccaca gcagcctgcg cggcctgcag 2400
cgcggctggg agatcctgaa gtacctgggc agcctggtgc agtactgggg cctggagctg 2460
aagaagagcg ccatcagccc cctggacacc atcgccatcg ccgtggccga gggcaccgac 2520
cgcatcatcg agctggtgca gcgcatctgc cgcgccatcc tgaacatccc ccgccgcatc 2580
cgccagggct tcgaggccgc cctgctgtaa 2610
<210> SEQ ID NO 50
<211> LENGTH: 2610
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Type C Envgp160 wild type
<400> SEQUENCE: 50
atgagagtga tggggacaca gaagaattgt caacaatggt ggatatgggg catcttaggc 60
ttctggatgc taatgatttg taacacggag gacttgtggg tcacagtcta ctatggggta 120
cctgtgtgga gagaagcaaa aactactcta ttctgtgcat cagatgctaa agcatatgag 180
acagaagtgc ataatgtctg ggctacacat gcttgtgtac ccacagaccc caacccacaa 240
gaaatagttt tgggaaatgt aacagaaaat tttaatatgt ggaaaaataa catggcagat 300
cagatgcatg aggatataat cagtttatgg gatcaaagcc taaagccatg tgtaaagttg 360
accccactct gtgtcacttt aaactgtaca gatacaaatg ttacaggtaa tagaactgtt 420
acaggtaata caaatgatac caatattgca aatgctacat ataagtatga agaaatgaaa 480
aattgctctt tcaatgcaac cacagaatta agagataaga aacataaaga gtatgcactc 540
ttttataaac ttgatatagt accacttaat gaaaatagta acaactttac atatagatta 600
ataaattgca atacctcaac cataacacaa gcctgtccaa aggtctcttt tgacccgatt 660
cctatacatt actgtgctcc agctgattat gcgattctaa agtgtaataa taagacattc 720
aatgggacag gaccatgtta taatgtcagc acagtacaat gtacacatgg aattaagcca 780
gtggtatcaa ctcaactact gttaaatggt agtctagcag aagaagggat aataattaga 840
tctgaaaatt tgacagagaa taccaaaaca ataatagtac atcttaatga atctgtagag 900
attaattgta caaggcccaa caataataca aggaaaagtg taaggatagg accaggacaa 960
gcattctatg caacaaatga cgtaatagga aacataagac aagcacattg taacattagt 1020
acagatagat ggaataaaac tttacaacag gtaatgaaaa aattaggaga gcatttccct 1080
aataaaacaa taaaatttga accacatgca ggaggggatc tagaaattac aatgcatagc 1140
tttaattgta gaggagaatt tttctattgc aatacatcaa acctgtttaa tagtacatac 1200
taccctaaga atggtacata caaatacaat ggtaattcaa gcttacccat cacactccaa 1260
tgcaaaataa aacaaattgt acgcatgtgg caaggggtag gacaagcaat gtatgcccct 1320
cccattgcag gaaacataac atgtagatca aacatcacag gaatactatt gacacgtgat 1380
gggggattta acaacacaaa caacgacaca gaggagacat tcagacctgg aggaggagat 1440
atgagggata actggagaag tgaattatat aaatataaag tggtagaaat taagccattg 1500
ggaatagcac ccactaaggc aaaaagaaga gtggtgcaga gaaaaaaaag agcagtggga 1560
ataggagctg tgttccttgg gttcttggga gcagcaggaa gcactatggg cgcagcgtca 1620
ataacgctga cggtacaggc cagacaactg ttgtctggta tagtgcaaca gcaaagcaat 1680
ttgctgaagg ctatagaggc gcaacagcat atgttgcaac tcacagtctg gggcattaag 1740
cagctccagg cgagagtcct ggctatagaa agatacctaa aggatcaaca gctcctaggg 1800
atttggggct gctctggaag actcatctgc accactgctg tgccttggaa ctccagttgg 1860
agtaataaat ctgaagcaga tatttgggat aacatgactt ggatgcagtg ggatagagaa 1920
attaataatt acacagaaac aatattcagg ttgcttgaag actcgcaaaa ccagcaggaa 1980
aagaatgaaa aagatttatt agaattggac aagtggaata atctgtggaa ttggtttgac 2040
atatcaaact ggctgtggta tataaaaata ttcataatga tagtaggagg cttgataggt 2100
ttaagaataa tttttgctgt gctctctata gtgaatagag ttaggcaggg atactcacct 2160
ttgtcatttc agacccttac cccaagcccg aggggactcg acaggctcgg aggaatcgaa 2220
gaagaaggtg gagagcaaga cagagacaga tccatacgat tggtgagcgg attcttgtcg 2280
cttgcctggg acgatctgcg gagcctgtgc ctcttcagct accaccgctt gagagacttc 2340
atattaattg cagtgagggc agtggaactt ctgggacaca gcagtctcag gggactacag 2400
agggggtggg agatccttaa gtatctggga agtcttgtgc agtattgggg tctagagcta 2460
aaaaagagtg ctattagtcc gcttgatacc atagcaatag cagtagctga aggaacagat 2520
aggattatag aattggtaca aagaatttgt agagctatcc tcaacatacc taggagaata 2580
agacagggct ttgaagcagc tttgctataa 2610
<210> SEQ ID NO 51
<211> LENGTH: 1494
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Gag optimized
<400> SEQUENCE: 51
atgggcgccc gcgccagcat cctgagcggc ggcaagctgg acaagtggga gcgcatccgc 60
ctgcgccccg gcggcaagaa gcactacatg ctgaagcacc tggtgtgggc cagccgcgag 120
ctggagcgct tcgccctgaa ccccggcctg ctggagacca gcgagggctg caagcagatc 180
atcaagcagc tgcagcccgc cctgcagacc ggcaccgagg agctgcgcag cctgttcaac 240
accgtggcca ccctgtactg cgtgcacaag ggcatcgagg tgcgcgacac caaggaggcc 300
ctggacaaga tcgaggagga gcagaacaag tgccagcaga aggcccagca ggccaaggcc 360
gccgacgaga aggtgagcca gaactacccc atcgtgcaga acgcccaggg ccagatggtg 420
caccaggcca tcagcccccg caccctgaac gcctggatca aggtgatcga ggagaaggcc 480
ttcaaccccg aggagatccc catgttcacc gccctgagcg agggcgccac cccccaggac 540
ctgaacacca tgctgaacac cgtgggcggc caccaggccg ccatgcagat gctgaaggac 600
accatcaacg aggaggccgc cgagtgggac cgcacccacc ccgtgcacgc cggccccgtg 660
gcccccggcc agatgcgcga gccccgcggc agcgacatcg ccggcaccac cagcaccctg 720
caggagcaga tcgcctggat gaccagcaac ccccccatcc ccgtggagga catctacaag 780
cgctggatca tcctgggcct gaacaagatc gtgcgcatgt acagccccgt gagcatcctg 840
gacatcaagc agggccccaa ggagcccttc cgcgactacg tggaccgctt cttcaagacc 900
ctgcgcgccg agcaggccac ccaggacgtg aagaactgga tgaccgacac cctgctggtg 960
cagaacgcca accccgactg caagaccatc ctgcgcgccc tgggccccgg cgccagcctg 1020
gaggagatga tgaccgcctg ccagggcgtg ggcggcccca gccacaaggc ccgcgtgctg 1080
gccgaggcca tgagccaggc caacagcaac atcctggtgc agcgcagcaa cttcaagggc 1140
agcaaccgca tcatcaagtg cttcaactgc ggcaaggtgg gccacatcgc ccgcaactgc 1200
cgcgcccccc gcaagaaggg ctgctggaag tgcggccagg agggccacca gatgaaggac 1260
tgcaccgagc gccaggccaa cttcctgggc aagatctggc ccagccacaa gggccgcccc 1320
ggcaacttcc tgcagaaccg ccccgagccc accgcccccc ccgccgagcc caccgccccc 1380
cccgccgaga gcttccgctt cgaggagacc acccccgtgc cccgcaagga gaaggagcgc 1440
gagcccctga ccagcctgaa gagcctgttc ggcagcgacc ccctgagcca gtaa 1494
<210> SEQ ID NO 52
<211> LENGTH: 1494
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Gag Wild Type
<400> SEQUENCE: 52
atgggtgcga gagcgtcaat attaagcggc ggaaaattag ataaatggga aagaattagg 60
ttaaggccag ggggaaagaa acattatatg ttaaaacatc tagtatgggc aagcagggag 120
ctggaaagat ttgcacttaa ccctggcctg ttagaaacat cagaaggctg taaacaaata 180
ataaaacagc tacaaccagc tcttcagaca ggaacagagg aacttagatc attattcaac 240
acagtagcaa ctctctattg tgtacataaa gggatagagg tacgagacac caaggaagcc 300
ttagacaaga tagaggaaga acaaaacaaa tgtcagcaaa aagcacaaca ggcaaaagca 360
gctgacgaaa aggtcagtca aaattatcct atagtacaga atgcccaagg gcaaatggta 420
caccaagcta tatcacctag aacattgaat gcatggataa aagtaataga ggaaaaggct 480
ttcaatccag aggaaatacc catgtttaca gcattatcag aaggagccac cccacaagat 540
ttaaacacaa tgttaaatac agtgggggga catcaagcag ccatgcaaat gttaaaagat 600
accatcaatg aggaggctgc agaatgggat aggacacatc cagtacatgc agggcctgtt 660
gcaccaggcc agatgagaga accaagggga agtgacatag caggaactac tagtaccctt 720
caggaacaaa tagcatggat gacaagtaat ccacctattc cagtagaaga catctataaa 780
agatggataa ttctggggtt aaataaaata gtaagaatgt atagccctgt tagcattttg 840
gacataaaac aagggccaaa agaacccttt agagactatg tagaccggtt ctttaaaacc 900
ttaagagctg aacaagctac acaagatgta aagaattgga tgacagacac cttgttggtc 960
caaaatgcga acccagattg taagaccatt ttaagagcat taggaccagg ggcctcatta 1020
gaagaaatga tgacagcatg tcagggagtg ggaggaccta gccataaagc aagagtgttg 1080
gctgaggcaa tgagccaagc aaacagtaac atactagtgc agagaagcaa ttttaaaggc 1140
tctaacagaa ttattaaatg tttcaactgt ggcaaagtag ggcacatagc cagaaattgc 1200
agggccccta ggaaaaaggg ctgttggaaa tgtggacagg aaggacacca aatgaaagac 1260
tgtactgaga ggcaggctaa ttttttaggg aaaatttggc cttcccacaa ggggaggcca 1320
gggaatttcc tccagaacag accagagcca acagccccac cagcagaacc aacagcccca 1380
ccagcagaga gcttcaggtt cgaggagaca acccccgtgc cgaggaagga gaaagagagg 1440
gaacctttaa cttccctcaa atcactcttt ggcagcgacc ccttgtctca ataa 1494
<210> SEQ ID NO 53
<211> LENGTH: 60
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Gag Major Homology Region
Optimized
<400> SEQUENCE: 53
gacatcaagc agggccccaa ggagcccttc cgcgactacg tggaccgctt cttcaagacc 60
<210> SEQ ID NO 54
<211> LENGTH: 60
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Gag Major Homology Region Wild
Type
<400> SEQUENCE: 54
gacataaaac aagggccaaa agaacccttt agagactatg tagaccggtt ctttaaaacc 60
<210> SEQ ID NO 55
<211> LENGTH: 624
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Nef Optimized
<400> SEQUENCE: 55
atgggcggca agtggagcaa gcgcagcatc gtgggctggc ccgccgtgcg cgagcgcatg 60
cgccgcaccg agcccgccgc cgagggcgtg ggcgccgcca gccaggacct ggaccgccac 120
ggcgccctga ccagcagcaa cacccccgcc accaacgagg cctgcgcctg gctgcaggcc 180
caggaggagg acggcgacgt gggcttcccc gtgcgccccc aggtgcccct gcgccccatg 240
acctacaaga gcgccgtgga cctgagcttc ttcctgaagg agaagggcgg cctggagggc 300
ctgatctaca gccgcaagcg ccaggagatc ctggacctgt gggtgtacaa cacccagggc 360
ttcttccccg actggcagaa ctacaccagc ggccccggcg tgcgcttccc cctgaccttc 420
ggctggtgct tcaagctggt gcccgtggac ccccgcgagg tgaaggaggc caacgagggc 480
gaggacaact gcctgctgca ccccatgagc cagcacggcg ccgaggacga ggaccgcgag 540
gtgctgaagt ggaagttcga cagcctgctg gcccaccgcc acatggcccg cgagctgcac 600
cccgagtact acaaggactg ctga 624
<210> SEQ ID NO 56
<211> LENGTH: 624
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Nef Wild Type
<400> SEQUENCE: 56
atgggaggca agtggtcaaa acgcagcata gttggatggc ctgcagtaag agaaagaatg 60
agaagaactg agccagcagc agagggagta ggagcagcgt ctcaagactt agatagacat 120
ggggcactta caagcagcaa cacacctgct actaatgaag cttgtgcctg gctgcaagca 180
caagaggagg acggagatgt aggctttcca gtcagacctc aggtaccttt aagaccaatg 240
acttataaga gtgcagtaga tctcagcttc tttttaaaag aaaagggggg actggaaggg 300
ttaatttact ctaggaaaag gcaagaaatc cttgatttgt gggtctataa cacacaaggc 360
ttcttccctg attggcaaaa ctacacatcg gggccagggg tccgattccc actgaccttt 420
ggatggtgct tcaagctagt accagttgac ccaagggagg tgaaagaggc caatgaagga 480
gaagacaact gtttgctaca ccctatgagc caacatggag cagaggatga agatagagaa 540
gtattaaagt ggaagtttga cagccttcta gcacacagac acatggcccg cgagctacat 600
ccggagtatt acaaagactg ctga 624
<210> SEQ ID NO 57
<211> LENGTH: 624
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C NefD125G Optimized
<400> SEQUENCE: 57
atgggcggca agtggagcaa gcgcagcatc gtgggctggc ccgccgtgcg cgagcgcatg 60
cgccgcaccg agcccgccgc cgagggcgtg ggcgccgcca gccaggacct ggaccgccac 120
ggcgccctga ccagcagcaa cacccccgcc accaacgagg cctgcgcctg gctgcaggcc 180
caggaggagg acggcgacgt gggcttcccc gtgcgccccc aggtgcccct gcgccccatg 240
acctacaaga gcgccgtgga cctgagcttc ttcctgaagg agaagggcgg cctggagggc 300
ctgatctaca gccgcaagcg ccaggagatc ctggacctgt gggtgtacaa cacccagggc 360
ttcttccccg gctggcagaa ctacaccagc ggccccggcg tgcgcttccc cctgaccttc 420
ggctggtgct tcaagctggt gcccgtggac ccccgcgagg tgaaggaggc caacgagggc 480
gaggacaact gcctgctgca ccccatgagc cagcacggcg ccgaggacga ggaccgcgag 540
gtgctgaagt ggaagttcga cagcctgctg gcccaccgcc acatggcccg cgagctgcac 600
cccgagtact acaaggactg ctga 624
<210> SEQ ID NO 58
<211> LENGTH: 354
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C p15RNaseH Optimized
<400> SEQUENCE: 58
accttctacg tggacggcgc caccaaccgc gaggccaaga tcggcaaggc cggctacgtg 60
accgaccgcg gccgccagaa gatcgtgacc ctgaccaaca ccaccaacca gaagaccgag 120
ctgcaggcca tccagctggc cctgcaggac agcggcagcg aggtgaacat cgtgaccgac 180
agccagtacg ccctgggcat catccaggcc cagcccgaca agagcgacag cgagatcttc 240
aaccagatca tcgagcagct gatcaacaag gagcgcatct acctgagctg ggtgcccgcc 300
cacaagggca tcggcggcaa cgagcaggtg gacaagctgg tgagcaaggg catc 354
<210> SEQ ID NO 59
<211> LENGTH: 354
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C p15RNaseH Wild Type
<400> SEQUENCE: 59
actttctatg tagatggagc aactaatagg gaagctaaaa taggaaaagc agggtatgtt 60
actgacagag gaaggcagaa aattgttact ctaactaaca caacaaatca gaagactgag 120
ttacaagcaa ttcagctagc tctgcaggat tcaggatcag aagtaaacat agtaacagac 180
tcacagtatg cattaggaat cattcaagca caaccagata agagtgactc agagatattt 240
aaccaaataa tagaacagtt aataaacaag gaaagaatct acctgtcatg ggtaccagca 300
cataaaggaa ttgggggaaa tgaacaagta gataaattag taagtaaggg aatt 354
<210> SEQ ID NO 60
<211> LENGTH: 876
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C p31Int Optimized
<400> SEQUENCE: 60
cgcaaggtgc tgttcctgga cggcatcgac aaggcccagg aggagcacga gcgctaccac 60
agcaactggc gcgccatggc caacgagttc aacctgcccc ccatcgtggc caaggagatc 120
gtggccagct gcgacaagtg ccagctgaag ggcgaggcca tccacggcca ggtggactgc 180
agccccggca tctggcagct ggactgcacc cacctggagg gcaagatcat cctggtggcc 240
gtgcacgtgg ccagcggcta catggaggcc gaggtgatcc ccgccgagac cggccaggag 300
accgcctact tcatcctgaa gctggccggc cgctggcccg tgaaggtgat ccacaccgac 360
aacggcagca acttcaccag caccgccgtg aaggccgcct gctggtgggc cggcatccag 420
caggagttcg gcatccccta caacccccag agccagggcg tggtggagag catgaacaag 480
gagctgaaga agatcatcgg ccaggtgcgc gaccaggccg agcacctgaa gaccgccgtg 540
cagatggccg tgttcatcca caacttcaag cgcaagggcg gcatcggcgg ctacagcgcc 600
ggcgagcgca tcatcgacat catcgccacc gacatccaga ccaaggagct gcagaagcag 660
atcatccgca tccagaactt ccgcgtgtac taccgcgaca gccgcgaccc catctggaag 720
ggccccgccg agctgctgtg gaagggcgag ggcgtggtgg tgatcgagga caagggcgac 780
atcaaggtgg tgccccgccg caaggccaag atcatccgcg actacggcaa gcagatggcc 840
ggcgccgact gcgtggccgg cggccaggac gaggac 876
<210> SEQ ID NO 61
<211> LENGTH: 876
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C p31Int Wild Type
<400> SEQUENCE: 61
aggaaagtgt tgtttctaga tggaatagat aaagctcaag aagagcatga aaggtaccac 60
agcaattgga gagcaatggc taatgagttt aatctgccac ccatagtagc aaaagaaata 120
gtagctagct gtgataaatg tcagctaaaa ggggaagcca tacatggaca agtcgactgt 180
agtccaggga tatggcaatt agattgtacc catttagagg gaaaaatcat cctggtagca 240
gtccatgtag ctagtggcta catggaagca gaggttatcc cagcagaaac aggacaagaa 300
acagcatatt ttatattaaa attagcagga agatggccag tcaaagtaat acatacagac 360
aatggcagta attttaccag tactgcagtt aaggcagcct gttggtgggc aggtatccaa 420
caggaatttg gaattcccta caatccccaa agtcagggag tggtagaatc catgaataaa 480
gaattaaaga aaataatagg acaagtaaga gatcaagctg agcaccttaa gacagcagta 540
caaatggcag tattcattca caattttaaa agaaaagggg gaattggggg gtacagtgca 600
ggggaaagaa taatagacat aatagcaaca gacatacaaa ctaaagaatt acaaaaacaa 660
attataagaa ttcaaaattt tcgggtttat tacagagaca gcagagaccc tatttggaaa 720
ggaccagccg aactactctg gaaaggtgaa ggggtagtag taatagaaga taaaggtgac 780
ataaaggtag taccaaggag gaaagcaaaa atcattagag attatggaaa acagatggca 840
ggtgctgatt gtgtggcagg tggacaggat gaagat 876
<210> SEQ ID NO 62
<211> LENGTH: 3015
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Pol Optimized
<400> SEQUENCE: 62
ttcttccgcg agaacctggc cttcccccag ggcgaggccc gcgagttccc ccccgagcag 60
acccgcgcca acagccccac cagccgcacc aacagcccca ccagccgcga gctgcaggtg 120
cgcggcgaca acccccgcgc cgaggagggc gagcgcgagg gcaccttcaa cttcccccag 180
atcaccctgt ggcagcgccc cctggtgagc atcaaggtgg agggccagat caaggaggcc 240
ctgctggaca ccggcgccga cgacaccgtg ctggaggaga tcgacctgcc cggcaagtgg 300
aagcccaaga tgatcggcgg catcggcggc ttcatcaagg tgcgccagta cgaccagatc 360
ctgatcgaga tctgcggcaa gaaggccatc ggcaccgtgc tggtgggccc cacccccgtg 420
aacatcatcg gccgcaacct gctgacccag ctgggctgca ccctgaactt ccccatcagc 480
cccatcgaga ccgtgcccgt gaagctgaag cccggcatgg acggccccaa ggtgaagcag 540
tggcccctga ccgaggagaa gatcaaggcc ctgaccgcca tctgcgagga gatggagaag 600
gagggcaaga tcaccaagat cggccccgac aacccctaca acacccccgt gttcgccatc 660
aagaagaagg acagcaccaa gtggcgcaag ctggtggact tccgcgagct gaacaagcgc 720
acccaggact tctgggaggt gcagctgggc atcccccacc ccgccggcct gaagaagaag 780
aagagcgtga ccgtgctgga cgtgggcgac gcctacttca gcgtgcccct ggacgagagc 840
ttccgcaagt acaccgcctt caccatcccc agcatcaaca acgagacccc cggcatccgc 900
taccagtaca acgtgctgcc ccagggctgg aagggcagcc ccgccatctt ccagagcagc 960
atgaccaaga tcctggagcc cttccgcgcc aagaaccccg acatcgtgat ctaccagtac 1020
atggacgacc tgtacgtggg cagcgacctg gagatcggcc agcaccgcgc caagatcgag 1080
gagctgcgcg agcacctgct gaagtggggc ttcaccaccc ccgacaagaa gcaccagaag 1140
gagcccccct tcctgtggat gggctacgag ctgcaccccg acaagtggac cgtgcagccc 1200
atcctgctgc ccgagaagga cagctggacc gtgaacgaca tccagaagct ggtgggcaag 1260
ctgaactggg ccagccagat ctaccccggc atcaaggtgc gccagctgtg caagctgctg 1320
cgcggcgcca aggccctgac cgacatcgtg cccctgaccg aggaggccga gctggagctg 1380
gccgagaacc gcgagatcct gcgcgagccc gtgcacggcg tgtactacga ccccagcaag 1440
gacctgatcg ccgagatcca gaagcagggc cacgagcagt ggacctacca gatctaccag 1500
gagcccttca agaacctgaa gaccggcaag tacgccaaga tgcgcaccac ccacaccaac 1560
gacgtgaagc agctgaccga ggccgtgcag aagatcgcca tggagagcat cgtgatctgg 1620
ggcaagaccc ccaagttccg cctgcccatc cagaaggaga cctgggagac ctggtggacc 1680
gactactggc aggccacctg gatccccgag tgggagttcg tgaacacccc ccccctggtg 1740
aagctgtggt accagctgga gaaggacccc atcgccggcg tggagacctt ctacgtggac 1800
ggcgccacca accgcgaggc caagatcggc aaggccggct acgtgaccga ccgcggccgc 1860
cagaagatcg tgaccctgac caacaccacc aaccagaaga ccgagctgca ggccatccag 1920
ctggccctgc aggacagcgg cagcgaggtg aacatcgtga ccgacagcca gtacgccctg 1980
ggcatcatcc aggcccagcc cgacaagagc gacagcgaga tcttcaacca gatcatcgag 2040
cagctgatca acaaggagcg catctacctg agctgggtgc ccgcccacaa gggcatcggc 2100
ggcaacgagc aggtggacaa gctggtgagc aagggcatcc gcaaggtgct gttcctggac 2160
ggcatcgaca aggcccagga ggagcacgag cgctaccaca gcaactggcg cgccatggcc 2220
aacgagttca acctgccccc catcgtggcc aaggagatcg tggccagctg cgacaagtgc 2280
cagctgaagg gcgaggccat ccacggccag gtggactgca gccccggcat ctggcagctg 2340
gactgcaccc acctggaggg caagatcatc ctggtggccg tgcacgtggc cagcggctac 2400
atggaggccg aggtgatccc cgccgagacc ggccaggaga ccgcctactt catcctgaag 2460
ctggccggcc gctggcccgt gaaggtgatc cacaccgaca acggcagcaa cttcaccagc 2520
accgccgtga aggccgcctg ctggtgggcc ggcatccagc aggagttcgg catcccctac 2580
aacccccaga gccagggcgt ggtggagagc atgaacaagg agctgaagaa gatcatcggc 2640
caggtgcgcg accaggccga gcacctgaag accgccgtgc agatggccgt gttcatccac 2700
aacttcaagc gcaagggcgg catcggcggc tacagcgccg gcgagcgcat catcgacatc 2760
atcgccaccg acatccagac caaggagctg cagaagcaga tcatccgcat ccagaacttc 2820
cgcgtgtact accgcgacag ccgcgacccc atctggaagg gccccgccga gctgctgtgg 2880
aagggcgagg gcgtggtggt gatcgaggac aagggcgaca tcaaggtggt gccccgccgc 2940
aaggccaaga tcatccgcga ctacggcaag cagatggccg gcgccgactg cgtggccggc 3000
ggccaggacg aggac 3015
<210> SEQ ID NO 63
<211> LENGTH: 3015
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Pol Wild Type
<400> SEQUENCE: 63
ttttttaggg aaaatttggc cttcccacaa ggggaggcca gggaatttcc tccagaacag 60
accagagcca acagccccac cagcagaacc aacagcccca ccagcagaga gcttcaggtt 120
cgaggagaca acccccgtgc cgaggaagga gaaagagagg gaacctttaa cttccctcaa 180
atcactcttt ggcagcgacc ccttgtctca ataaaagtag agggccagat aaaggaggct 240
ctcttagaca caggagcaga tgatacagta ttagaagaaa tagatttgcc agggaaatgg 300
aaaccaaaaa tgataggggg aattggaggt tttatcaaag taagacagta tgatcaaata 360
cttatagaaa tttgtggaaa aaaggctata ggtacagtat tagtagggcc tacaccagtc 420
aacataattg gaagaaatct gttaactcag cttggatgca cactaaattt tccaattagt 480
cctattgaaa ctgtaccagt aaaattaaaa ccaggaatgg atggcccaaa ggtcaaacaa 540
tggccattga cagaagaaaa aataaaagca ttaacagcaa tttgtgagga aatggagaag 600
gaaggaaaaa ttacaaaaat tgggcctgat aatccatata acactccagt atttgccata 660
aaaaagaagg acagtactaa gtggagaaaa ttagtagatt tcagggaact caataaaaga 720
actcaagact tttgggaagt tcaattagga ataccacacc cagcaggatt aaaaaagaaa 780
aaatcagtga cagtgctaga tgtgggggat gcatattttt cagttccttt agatgaaagc 840
ttcaggaaat atactgcatt caccatacct agtataaaca atgaaacacc agggattaga 900
tatcaatata atgtgctgcc acagggatgg aaaggatcac cagcaatatt ccagagtagc 960
atgacaaaaa tcttagagcc cttcagagca aaaaatccag acatagttat ctatcaatat 1020
atggatgact tgtatgtagg atctgactta gaaatagggc aacatagagc aaaaatagaa 1080
gagttaaggg aacatttatt gaaatgggga tttacaacac cagacaagaa acatcaaaaa 1140
gaacccccat ttctttggat ggggtatgaa ctccatcctg acaaatggac agtacaacct 1200
atactgctgc cagaaaagga tagttggact gtcaatgata tacagaagtt agtgggaaaa 1260
ttaaactggg caagtcagat ttacccaggg attaaagtaa ggcaactctg taaactcctc 1320
aggggggcca aagcactaac agacatagta ccactaactg aagaagcaga attagaattg 1380
gcagagaaca gggaaatttt aagagaacca gtacatggag tatattatga tccatcaaaa 1440
gacttgatag ctgaaataca gaaacagggg catgaacaat ggacatatca aatttatcaa 1500
gaaccattta aaaatctgaa aacagggaag tatgcaaaaa tgaggactac ccacactaat 1560
gatgtaaaac agttaacaga ggcagtgcaa aaaatagcca tggaaagcat agtaatatgg 1620
ggaaagactc ctaaatttag actacccatc caaaaagaaa catgggagac atggtggaca 1680
gactattggc aagccacctg gatccctgag tgggagtttg ttaatacccc tcccctagta 1740
aaattatggt accaactaga aaaagatccc atagcaggag tagaaacttt ctatgtagat 1800
ggagcaacta atagggaagc taaaatagga aaagcagggt atgttactga cagaggaagg 1860
cagaaaattg ttactctaac taacacaaca aatcagaaga ctgagttaca agcaattcag 1920
ctagctctgc aggattcagg atcagaagta aacatagtaa cagactcaca gtatgcatta 1980
ggaatcattc aagcacaacc agataagagt gactcagaga tatttaacca aataatagaa 2040
cagttaataa acaaggaaag aatctacctg tcatgggtac cagcacataa aggaattggg 2100
ggaaatgaac aagtagataa attagtaagt aagggaatta ggaaagtgtt gtttctagat 2160
ggaatagata aagctcaaga agagcatgaa aggtaccaca gcaattggag agcaatggct 2220
aatgagttta atctgccacc catagtagca aaagaaatag tagctagctg tgataaatgt 2280
cagctaaaag gggaagccat acatggacaa gtcgactgta gtccagggat atggcaatta 2340
gattgtaccc atttagaggg aaaaatcatc ctggtagcag tccatgtagc tagtggctac 2400
atggaagcag aggttatccc agcagaaaca ggacaagaaa cagcatattt tatattaaaa 2460
ttagcaggaa gatggccagt caaagtaata catacagaca atggcagtaa ttttaccagt 2520
actgcagtta aggcagcctg ttggtgggca ggtatccaac aggaatttgg aattccctac 2580
aatccccaaa gtcagggagt ggtagaatcc atgaataaag aattaaagaa aataatagga 2640
caagtaagag atcaagctga gcaccttaag acagcagtac aaatggcagt attcattcac 2700
aattttaaaa gaaaaggggg aattgggggg tacagtgcag gggaaagaat aatagacata 2760
atagcaacag acatacaaac taaagaatta caaaaacaaa ttataagaat tcaaaatttt 2820
cgggtttatt acagagacag cagagaccct atttggaaag gaccagccga actactctgg 2880
aaaggtgaag gggtagtagt aatagaagat aaaggtgaca taaaggtagt accaaggagg 2940
aaagcaaaaa tcattagaga ttatggaaaa cagatggcag gtgctgattg tgtggcaggt 3000
ggacaggatg aagat 3015
<210> SEQ ID NO 64
<211> LENGTH: 297
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Protease Optimized
<400> SEQUENCE: 64
ccccagatca ccctgtggca gcgccccctg gtgagcatca aggtggaggg ccagatcaag 60
gaggccctgc tggacaccgg cgccgacgac accgtgctgg aggagatcga cctgcccggc 120
aagtggaagc ccaagatgat cggcggcatc ggcggcttca tcaaggtgcg ccagtacgac 180
cagatcctga tcgagatctg cggcaagaag gccatcggca ccgtgctggt gggccccacc 240
cccgtgaaca tcatcggccg caacctgctg acccagctgg gctgcaccct gaacttc 297
<210> SEQ ID NO 65
<211> LENGTH: 297
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Protease Wild Type
<400> SEQUENCE: 65
cctcaaatca ctctttggca gcgacccctt gtctcaataa aagtagaggg ccagataaag 60
gaggctctct tagacacagg agcagatgat acagtattag aagaaataga tttgccaggg 120
aaatggaaac caaaaatgat agggggaatt ggaggtttta tcaaagtaag acagtatgat 180
caaatactta tagaaatttg tggaaaaaag gctataggta cagtattagt agggcctaca 240
ccagtcaaca taattggaag aaatctgtta actcagcttg gatgcacact aaatttt 297
<210> SEQ ID NO 66
<211> LENGTH: 297
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Inactivated Protease Optimized
<400> SEQUENCE: 66
ccccagatca ccctgtggca gcgccccctg gtgagcatca aggtggaggg ccagatcaag 60
gaggccctgc tggccaccgg cgccgacgac accgtgctgg aggagatcga cctgcccggc 120
aagtggaagc ccaagatgat cggcggcatc ggcggcttca tcaaggtgcg ccagtacgac 180
cagatcctga tcgagatctg cggcaagaag gccatcggca ccgtgctggt gggccccacc 240
cccgtgaaca tcatcggccg caacctgctg acccagctgg gctgcaccct gaacttc 297
<210> SEQ ID NO 67
<211> LENGTH: 297
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Inactivated Protease Wild Type
<400> SEQUENCE: 67
cctcaaatca ctctttggca gcgacccctt gtctcaataa aagtagaggg ccagataaag 60
gaggctctct tagccacagg agcagatgat acagtattag aagaaataga tttgccaggg 120
aaatggaaac caaaaatgat agggggaatt ggaggtttta tcaaagtaag acagtatgat 180
caaatactta tagaaatttg tggaaaaaag gctataggta cagtattagt agggcctaca 240
ccagtcaaca taattggaag aaatctgtta actcagcttg gatgcacact aaatttt 297
<210> SEQ ID NO 68
<211> LENGTH: 1965
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Inactivated Protease Mutated
Reverse Transcriptase Optimized
<400> SEQUENCE: 68
ccccagatca ccctgtggca gcgccccctg gtgagcatca aggtggaggg ccagatcaag 60
gaggccctgc tggccaccgg cgccgacgac accgtgctgg aggagatcga cctgcccggc 120
aagtggaagc ccaagatgat cggcggcatc ggcggcttca tcaaggtgcg ccagtacgac 180
cagatcctga tcgagatctg cggcaagaag gccatcggca ccgtgctggt gggccccacc 240
cccgtgaaca tcatcggccg caacctgctg acccagctgg gctgcaccct gaacttcccc 300
atcagcccca tcgagaccgt gcccgtgaag ctgaagcccg gcatggacgg ccccaaggtg 360
aagcagtggc ccctgaccga ggagaagatc aaggccctga ccgccatctg cgaggagatg 420
gagaaggagg gcaagatcac caagatcggc cccgacaacc cctacaacac ccccgtgttc 480
gccatcaaga agaaggacag caccaagtgg cgcaagctgg tggacttccg cgagctgaac 540
aagcgcaccc aggacttctg ggaggtgcag ctgggcatcc cccaccccgc cggcctgaag 600
aagaagaaga gcgtgaccgt gctggacgtg ggcgacgcct acttcagcgt gcccctggac 660
gagagcttcc gcaagtacac cgccttcacc atccccagca tcaacaacga gacccccggc 720
atccgctacc agtacaacgt gctgccccag ggctggaagg gcagccccgc catcttccag 780
agcagcatga ccaagatcct ggagcccttc cgcgccaaga accccgacat cgtgatctac 840
caggcccccc tgtacgtggg cagcgacctg gagatcggcc agcaccgcgc caagatcgag 900
gagctgcgcg agcacctgct gaagtggggc ttcaccaccc ccgacaagaa gcaccagaag 960
gagcccccct tcctgcccat cgagctgcac cccgacaagt ggaccgtgca gcccatcctg 1020
ctgcccgaga aggacagctg gaccgtgaac gacatccaga agctggtggg caagctgaac 1080
tgggccagcc agatctaccc cggcatcaag gtgcgccagc tgtgcaagct gctgcgcggc 1140
gccaaggccc tgaccgacat cgtgcccctg accgaggagg ccgagctgga gctggccgag 1200
aaccgcgaga tcctgcgcga gcccgtgcac ggcgtgtact acgaccccag caaggacctg 1260
atcgccgaga tccagaagca gggccacgag cagtggacct accagatcta ccaggagccc 1320
ttcaagaacc tgaagaccgg caagtacgcc aagatgcgca ccacccacac caacgacgtg 1380
aagcagctga ccgaggccgt gcagaagatc gccatggaga gcatcgtgat ctggggcaag 1440
acccccaagt tccgcctgcc catccagaag gagacctggg agacctggtg gaccgactac 1500
tggcaggcca cctggatccc cgagtgggag ttcgtgaaca ccccccccct ggtgaagctg 1560
tggtaccagc tggagaagga ccccatcgcc ggcgtggaga ccttctacgt ggacggcgcc 1620
accaaccgcg aggccaagat cggcaaggcc ggctacgtga ccgaccgcgg ccgccagaag 1680
atcgtgaccc tgaccaacac caccaaccag aagaccgagc tgcaggccat ccagctggcc 1740
ctgcaggaca gcggcagcga ggtgaacatc gtgaccgaca gccagtacgc cctgggcatc 1800
atccaggccc agcccgacaa gagcgacagc gagatcttca accagatcat cgagcagctg 1860
atcaacaagg agcgcatcta cctgagctgg gtgcccgccc acaagggcat cggcggcaac 1920
gagcaggtgg acaagctggt gagcaagggc atccgcaagg tgctg 1965
<210> SEQ ID NO 69
<211> LENGTH: 1965
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Inactivated Protease Mutated
Reverse Transcriptase Wild Type
<400> SEQUENCE: 69
cctcaaatca ctctttggca gcgacccctt gtctcaataa aagtagaggg ccagataaag 60
gaggctctct tagccacagg agcagatgat acagtattag aagaaataga tttgccaggg 120
aaatggaaac caaaaatgat agggggaatt ggaggtttta tcaaagtaag acagtatgat 180
caaatactta tagaaatttg tggaaaaaag gctataggta cagtattagt agggcctaca 240
ccagtcaaca taattggaag aaatctgtta actcagcttg gatgcacact aaattttcca 300
attagtccta ttgaaactgt accagtaaaa ttaaaaccag gaatggatgg cccaaaggtc 360
aaacaatggc cattgacaga agaaaaaata aaagcattaa cagcaatttg tgaggaaatg 420
gagaaggaag gaaaaattac aaaaattggg cctgataatc catataacac tccagtattt 480
gccataaaaa agaaggacag tactaagtgg agaaaattag tagatttcag ggaactcaat 540
aaaagaactc aagacttttg ggaagttcaa ttaggaatac cacacccagc aggattaaaa 600
aagaaaaaat cagtgacagt gctagatgtg ggggatgcat atttttcagt tcctttagat 660
gaaagcttca ggaaatatac tgcattcacc atacctagta taaacaatga aacaccaggg 720
attagatatc aatataatgt gctgccacag ggatggaaag gatcaccagc aatattccag 780
agtagcatga caaaaatctt agagcccttc agagcaaaaa atccagacat agttatctat 840
caagccccgt tgtatgtagg atctgactta gaaatagggc aacatagagc aaaaatagaa 900
gagttaaggg aacatttatt gaaatgggga tttacaacac cagacaagaa acatcaaaaa 960
gaacccccat ttcttcccat cgaactccat cctgacaaat ggacagtaca acctatactg 1020
ctgccagaaa aggatagttg gactgtcaat gatatacaga agttagtggg aaaattaaac 1080
tgggcaagtc agatttaccc agggattaaa gtaaggcaac tctgtaaact cctcaggggg 1140
gccaaagcac taacagacat agtaccacta actgaagaag cagaattaga attggcagag 1200
aacagggaaa ttttaagaga accagtacat ggagtatatt atgatccatc aaaagacttg 1260
atagctgaaa tacagaaaca ggggcatgaa caatggacat atcaaattta tcaagaacca 1320
tttaaaaatc tgaaaacagg gaagtatgca aaaatgagga ctacccacac taatgatgta 1380
aaacagttaa cagaggcagt gcaaaaaata gccatggaaa gcatagtaat atggggaaag 1440
actcctaaat ttagactacc catccaaaaa gaaacatggg agacatggtg gacagactat 1500
tggcaagcca cctggatccc tgagtgggag tttgttaata cccctcccct agtaaaatta 1560
tggtaccaac tagaaaaaga tcccatagca ggagtagaaa ctttctatgt agatggagca 1620
actaataggg aagctaaaat aggaaaagca gggtatgtta ctgacagagg aaggcagaaa 1680
attgttactc taactaacac aacaaatcag aagactgagt tacaagcaat tcagctagct 1740
ctgcaggatt caggatcaga agtaaacata gtaacagact cacagtatgc attaggaatc 1800
attcaagcac aaccagataa gagtgactca gagatattta accaaataat agaacagtta 1860
ataaacaagg aaagaatcta cctgtcatgg gtaccagcac ataaaggaat tgggggaaat 1920
gaacaagtag ataaattagt aagtaaggga attaggaaag tgttg 1965
<210> SEQ ID NO 70
<211> LENGTH: 1977
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Protease and Reverse
Transcriptase Optimized
<400> SEQUENCE: 70
ccccagatca ccctgtggca gcgccccctg gtgagcatca aggtggaggg ccagatcaag 60
gaggccctgc tggacaccgg cgccgacgac accgtgctgg aggagatcga cctgcccggc 120
aagtggaagc ccaagatgat cggcggcatc ggcggcttca tcaaggtgcg ccagtacgac 180
cagatcctga tcgagatctg cggcaagaag gccatcggca ccgtgctggt gggccccacc 240
cccgtgaaca tcatcggccg caacctgctg acccagctgg gctgcaccct gaacttcccc 300
atcagcccca tcgagaccgt gcccgtgaag ctgaagcccg gcatggacgg ccccaaggtg 360
aagcagtggc ccctgaccga ggagaagatc aaggccctga ccgccatctg cgaggagatg 420
gagaaggagg gcaagatcac caagatcggc cccgacaacc cctacaacac ccccgtgttc 480
gccatcaaga agaaggacag caccaagtgg cgcaagctgg tggacttccg cgagctgaac 540
aagcgcaccc aggacttctg ggaggtgcag ctgggcatcc cccaccccgc cggcctgaag 600
aagaagaaga gcgtgaccgt gctggacgtg ggcgacgcct acttcagcgt gcccctggac 660
gagagcttcc gcaagtacac cgccttcacc atccccagca tcaacaacga gacccccggc 720
atccgctacc agtacaacgt gctgccccag ggctggaagg gcagccccgc catcttccag 780
agcagcatga ccaagatcct ggagcccttc cgcgccaaga accccgacat cgtgatctac 840
cagtacatgg acgacctgta cgtgggcagc gacctggaga tcggccagca ccgcgccaag 900
atcgaggagc tgcgcgagca cctgctgaag tggggcttca ccacccccga caagaagcac 960
cagaaggagc cccccttcct gtggatgggc tacgagctgc accccgacaa gtggaccgtg 1020
cagcccatcc tgctgcccga gaaggacagc tggaccgtga acgacatcca gaagctggtg 1080
ggcaagctga actgggccag ccagatctac cccggcatca aggtgcgcca gctgtgcaag 1140
ctgctgcgcg gcgccaaggc cctgaccgac atcgtgcccc tgaccgagga ggccgagctg 1200
gagctggccg agaaccgcga gatcctgcgc gagcccgtgc acggcgtgta ctacgacccc 1260
agcaaggacc tgatcgccga gatccagaag cagggccacg agcagtggac ctaccagatc 1320
taccaggagc ccttcaagaa cctgaagacc ggcaagtacg ccaagatgcg caccacccac 1380
accaacgacg tgaagcagct gaccgaggcc gtgcagaaga tcgccatgga gagcatcgtg 1440
atctggggca agacccccaa gttccgcctg cccatccaga aggagacctg ggagacctgg 1500
tggaccgact actggcaggc cacctggatc cccgagtggg agttcgtgaa cacccccccc 1560
ctggtgaagc tgtggtacca gctggagaag gaccccatcg ccggcgtgga gaccttctac 1620
gtggacggcg ccaccaaccg cgaggccaag atcggcaagg ccggctacgt gaccgaccgc 1680
ggccgccaga agatcgtgac cctgaccaac accaccaacc agaagaccga gctgcaggcc 1740
atccagctgg ccctgcagga cagcggcagc gaggtgaaca tcgtgaccga cagccagtac 1800
gccctgggca tcatccaggc ccagcccgac aagagcgaca gcgagatctt caaccagatc 1860
atcgagcagc tgatcaacaa ggagcgcatc tacctgagct gggtgcccgc ccacaagggc 1920
atcggcggca acgagcaggt ggacaagctg gtgagcaagg gcatccgcaa ggtgctg 1977
<210> SEQ ID NO 71
<211> LENGTH: 1977
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Protease and Reverse
Transcriptase
Wild Type
<400> SEQUENCE: 71
cctcaaatca ctctttggca gcgacccctt gtctcaataa aagtagaggg ccagataaag 60
gaggctctct tagacacagg agcagatgat acagtattag aagaaataga tttgccaggg 120
aaatggaaac caaaaatgat agggggaatt ggaggtttta tcaaagtaag acagtatgat 180
caaatactta tagaaatttg tggaaaaaag gctataggta cagtattagt agggcctaca 240
ccagtcaaca taattggaag aaatctgtta actcagcttg gatgcacact aaattttcca 300
attagtccta ttgaaactgt accagtaaaa ttaaaaccag gaatggatgg cccaaaggtc 360
aaacaatggc cattgacaga agaaaaaata aaagcattaa cagcaatttg tgaggaaatg 420
gagaaggaag gaaaaattac aaaaattggg cctgataatc catataacac tccagtattt 480
gccataaaaa agaaggacag tactaagtgg agaaaattag tagatttcag ggaactcaat 540
aaaagaactc aagacttttg ggaagttcaa ttaggaatac cacacccagc aggattaaaa 600
aagaaaaaat cagtgacagt gctagatgtg ggggatgcat atttttcagt tcctttagat 660
gaaagcttca ggaaatatac tgcattcacc atacctagta taaacaatga aacaccaggg 720
attagatatc aatataatgt gctgccacag ggatggaaag gatcaccagc aatattccag 780
agtagcatga caaaaatctt agagcccttc agagcaaaaa atccagacat agttatctat 840
caatatatgg atgacttgta tgtaggatct gacttagaaa tagggcaaca tagagcaaaa 900
atagaagagt taagggaaca tttattgaaa tggggattta caacaccaga caagaaacat 960
caaaaagaac ccccatttct ttggatgggg tatgaactcc atcctgacaa atggacagta 1020
caacctatac tgctgccaga aaaggatagt tggactgtca atgatataca gaagttagtg 1080
ggaaaattaa actgggcaag tcagatttac ccagggatta aagtaaggca actctgtaaa 1140
ctcctcaggg gggccaaagc actaacagac atagtaccac taactgaaga agcagaatta 1200
gaattggcag agaacaggga aattttaaga gaaccagtac atggagtata ttatgatcca 1260
tcaaaagact tgatagctga aatacagaaa caggggcatg aacaatggac atatcaaatt 1320
tatcaagaac catttaaaaa tctgaaaaca gggaagtatg caaaaatgag gactacccac 1380
actaatgatg taaaacagtt aacagaggca gtgcaaaaaa tagccatgga aagcatagta 1440
atatggggaa agactcctaa atttagacta cccatccaaa aagaaacatg ggagacatgg 1500
tggacagact attggcaagc cacctggatc cctgagtggg agtttgttaa tacccctccc 1560
ctagtaaaat tatggtacca actagaaaaa gatcccatag caggagtaga aactttctat 1620
gtagatggag caactaatag ggaagctaaa ataggaaaag cagggtatgt tactgacaga 1680
ggaaggcaga aaattgttac tctaactaac acaacaaatc agaagactga gttacaagca 1740
attcagctag ctctgcagga ttcaggatca gaagtaaaca tagtaacaga ctcacagtat 1800
gcattaggaa tcattcaagc acaaccagat aagagtgact cagagatatt taaccaaata 1860
atagaacagt taataaacaa ggaaagaatc tacctgtcat gggtaccagc acataaagga 1920
attgggggaa atgaacaagt agataaatta gtaagtaagg gaattaggaa agtgttg 1977
<210> SEQ ID NO 72
<211> LENGTH: 75
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C RevExon1 Optimized
<400> SEQUENCE: 72
atggccggcc gcagcggcga cagcgacgag gccctgctgc aggtggtgaa gatcatcaag 60
atcctgtacc agagc 75
<210> SEQ ID NO 73
<211> LENGTH: 76
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C RevExon1 Wild Type
<400> SEQUENCE: 73
atggcaggaa gaagcggaga cagcgacgaa gcgctcctcc aagtggtgaa gatcatcaaa 60
atcctctatc aaagca 76
<210> SEQ ID NO 74
<211> LENGTH: 246
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C RevExon2 Optimized
<400> SEQUENCE: 74
ccctacccca agcccgaggg cacccgccag gcccgccgca accgccgccg ccgctggcgc 60
gcccgccagc gccagatcca caccatcggc gagcgcatcc tggtggcctg cctgggccgc 120
agcgccgagc ccgtgcccct gcagctgccc cccctggagc gcctgcacat caactgcagc 180
gagggcagcg gcaccagcgg cacccagcag agccagggca ccaccgaggg cgtgggcgac 240
ccctaa 246
<210> SEQ ID NO 75
<211> LENGTH: 248
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C RevExon2 Wild Type
<400> SEQUENCE: 75
acccttaccc caagcccgag gggactcgac aggctcggag gaatcgaaga agaaggtgga 60
gagcaagaca gagacagatc catacgattg gtgagcggat tcttgtcgct tgcctgggac 120
gatctgcgga gcctgtgcct cttcagctac caccgcttga gagacttcat attaattgca 180
gtgagggcag tggaacttct gggacacagc agtctcaggg gactacagag ggggtgggag 240
atccttaa 248
<210> SEQ ID NO 76
<211> LENGTH: 1680
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Reverse Transcriptase Optimized
<400> SEQUENCE: 76
cccatcagcc ccatcgagac cgtgcccgtg aagctgaagc ccggcatgga cggccccaag 60
gtgaagcagt ggcccctgac cgaggagaag atcaaggccc tgaccgccat ctgcgaggag 120
atggagaagg agggcaagat caccaagatc ggccccgaca acccctacaa cacccccgtg 180
ttcgccatca agaagaagga cagcaccaag tggcgcaagc tggtggactt ccgcgagctg 240
aacaagcgca cccaggactt ctgggaggtg cagctgggca tcccccaccc cgccggcctg 300
aagaagaaga agagcgtgac cgtgctggac gtgggcgacg cctacttcag cgtgcccctg 360
gacgagagct tccgcaagta caccgccttc accatcccca gcatcaacaa cgagaccccc 420
ggcatccgct accagtacaa cgtgctgccc cagggctgga agggcagccc cgccatcttc 480
cagagcagca tgaccaagat cctggagccc ttccgcgcca agaaccccga catcgtgatc 540
taccagtaca tggacgacct gtacgtgggc agcgacctgg agatcggcca gcaccgcgcc 600
aagatcgagg agctgcgcga gcacctgctg aagtggggct tcaccacccc cgacaagaag 660
caccagaagg agcccccctt cctgtggatg ggctacgagc tgcaccccga caagtggacc 720
gtgcagccca tcctgctgcc cgagaaggac agctggaccg tgaacgacat ccagaagctg 780
gtgggcaagc tgaactgggc cagccagatc taccccggca tcaaggtgcg ccagctgtgc 840
aagctgctgc gcggcgccaa ggccctgacc gacatcgtgc ccctgaccga ggaggccgag 900
ctggagctgg ccgagaaccg cgagatcctg cgcgagcccg tgcacggcgt gtactacgac 960
cccagcaagg acctgatcgc cgagatccag aagcagggcc acgagcagtg gacctaccag 1020
atctaccagg agcccttcaa gaacctgaag accggcaagt acgccaagat gcgcaccacc 1080
cacaccaacg acgtgaagca gctgaccgag gccgtgcaga agatcgccat ggagagcatc 1140
gtgatctggg gcaagacccc caagttccgc ctgcccatcc agaaggagac ctgggagacc 1200
tggtggaccg actactggca ggccacctgg atccccgagt gggagttcgt gaacaccccc 1260
cccctggtga agctgtggta ccagctggag aaggacccca tcgccggcgt ggagaccttc 1320
tacgtggacg gcgccaccaa ccgcgaggcc aagatcggca aggccggcta cgtgaccgac 1380
cgcggccgcc agaagatcgt gaccctgacc aacaccacca accagaagac cgagctgcag 1440
gccatccagc tggccctgca ggacagcggc agcgaggtga acatcgtgac cgacagccag 1500
tacgccctgg gcatcatcca ggcccagccc gacaagagcg acagcgagat cttcaaccag 1560
atcatcgagc agctgatcaa caaggagcgc atctacctga gctgggtgcc cgcccacaag 1620
ggcatcggcg gcaacgagca ggtggacaag ctggtgagca agggcatccg caaggtgctg 1680
<210> SEQ ID NO 77
<211> LENGTH: 1680
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Reverse Transcriptase Wild Type
<400> SEQUENCE: 77
ccaattagtc ctattgaaac tgtaccagta aaattaaaac caggaatgga tggcccaaag 60
gtcaaacaat ggccattgac agaagaaaaa ataaaagcat taacagcaat ttgtgaggaa 120
atggagaagg aaggaaaaat tacaaaaatt gggcctgata atccatataa cactccagta 180
tttgccataa aaaagaagga cagtactaag tggagaaaat tagtagattt cagggaactc 240
aataaaagaa ctcaagactt ttgggaagtt caattaggaa taccacaccc agcaggatta 300
aaaaagaaaa aatcagtgac agtgctagat gtgggggatg catatttttc agttccttta 360
gatgaaagct tcaggaaata tactgcattc accataccta gtataaacaa tgaaacacca 420
gggattagat atcaatataa tgtgctgcca cagggatgga aaggatcacc agcaatattc 480
cagagtagca tgacaaaaat cttagagccc ttcagagcaa aaaatccaga catagttatc 540
tatcaatata tggatgactt gtatgtagga tctgacttag aaatagggca acatagagca 600
aaaatagaag agttaaggga acatttattg aaatggggat ttacaacacc agacaagaaa 660
catcaaaaag aacccccatt tctttggatg gggtatgaac tccatcctga caaatggaca 720
gtacaaccta tactgctgcc agaaaaggat agttggactg tcaatgatat acagaagtta 780
gtgggaaaat taaactgggc aagtcagatt tacccaggga ttaaagtaag gcaactctgt 840
aaactcctca ggggggccaa agcactaaca gacatagtac cactaactga agaagcagaa 900
ttagaattgg cagagaacag ggaaatttta agagaaccag tacatggagt atattatgat 960
ccatcaaaag acttgatagc tgaaatacag aaacaggggc atgaacaatg gacatatcaa 1020
atttatcaag aaccatttaa aaatctgaaa acagggaagt atgcaaaaat gaggactacc 1080
cacactaatg atgtaaaaca gttaacagag gcagtgcaaa aaatagccat ggaaagcata 1140
gtaatatggg gaaagactcc taaatttaga ctacccatcc aaaaagaaac atgggagaca 1200
tggtggacag actattggca agccacctgg atccctgagt gggagtttgt taatacccct 1260
cccctagtaa aattatggta ccaactagaa aaagatccca tagcaggagt agaaactttc 1320
tatgtagatg gagcaactaa tagggaagct aaaataggaa aagcagggta tgttactgac 1380
agaggaaggc agaaaattgt tactctaact aacacaacaa atcagaagac tgagttacaa 1440
gcaattcagc tagctctgca ggattcagga tcagaagtaa acatagtaac agactcacag 1500
tatgcattag gaatcattca agcacaacca gataagagtg actcagagat atttaaccaa 1560
ataatagaac agttaataaa caaggaaaga atctacctgt catgggtacc agcacataaa 1620
ggaattgggg gaaatgaaca agtagataaa ttagtaagta agggaattag gaaagtgttg 1680
<210> SEQ ID NO 78
<211> LENGTH: 1668
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Mutated Reverse Transcriptase
Optimized
<400> SEQUENCE: 78
cccatcagcc ccatcgagac cgtgcccgtg aagctgaagc ccggcatgga cggccccaag 60
gtgaagcagt ggcccctgac cgaggagaag atcaaggccc tgaccgccat ctgcgaggag 120
atggagaagg agggcaagat caccaagatc ggccccgaca acccctacaa cacccccgtg 180
ttcgccatca agaagaagga cagcaccaag tggcgcaagc tggtggactt ccgcgagctg 240
aacaagcgca cccaggactt ctgggaggtg cagctgggca tcccccaccc cgccggcctg 300
aagaagaaga agagcgtgac cgtgctggac gtgggcgacg cctacttcag cgtgcccctg 360
gacgagagct tccgcaagta caccgccttc accatcccca gcatcaacaa cgagaccccc 420
ggcatccgct accagtacaa cgtgctgccc cagggctgga agggcagccc cgccatcttc 480
cagagcagca tgaccaagat cctggagccc ttccgcgcca agaaccccga catcgtgatc 540
taccaggccc ccctgtacgt gggcagcgac ctggagatcg gccagcaccg cgccaagatc 600
gaggagctgc gcgagcacct gctgaagtgg ggcttcacca cccccgacaa gaagcaccag 660
aaggagcccc ccttcctgcc catcgagctg caccccgaca agtggaccgt gcagcccatc 720
ctgctgcccg agaaggacag ctggaccgtg aacgacatcc agaagctggt gggcaagctg 780
aactgggcca gccagatcta ccccggcatc aaggtgcgcc agctgtgcaa gctgctgcgc 840
ggcgccaagg ccctgaccga catcgtgccc ctgaccgagg aggccgagct ggagctggcc 900
gagaaccgcg agatcctgcg cgagcccgtg cacggcgtgt actacgaccc cagcaaggac 960
ctgatcgccg agatccagaa gcagggccac gagcagtgga cctaccagat ctaccaggag 1020
cccttcaaga acctgaagac cggcaagtac gccaagatgc gcaccaccca caccaacgac 1080
gtgaagcagc tgaccgaggc cgtgcagaag atcgccatgg agagcatcgt gatctggggc 1140
aagaccccca agttccgcct gcccatccag aaggagacct gggagacctg gtggaccgac 1200
tactggcagg ccacctggat ccccgagtgg gagttcgtga acaccccccc cctggtgaag 1260
ctgtggtacc agctggagaa ggaccccatc gccggcgtgg agaccttcta cgtggacggc 1320
gccaccaacc gcgaggccaa gatcggcaag gccggctacg tgaccgaccg cggccgccag 1380
aagatcgtga ccctgaccaa caccaccaac cagaagaccg agctgcaggc catccagctg 1440
gccctgcagg acagcggcag cgaggtgaac atcgtgaccg acagccagta cgccctgggc 1500
atcatccagg cccagcccga caagagcgac agcgagatct tcaaccagat catcgagcag 1560
ctgatcaaca aggagcgcat ctacctgagc tgggtgcccg cccacaaggg catcggcggc 1620
aacgagcagg tggacaagct ggtgagcaag ggcatccgca aggtgctg 1668
<210> SEQ ID NO 79
<211> LENGTH: 1668
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Mutated Reverse Transcriptase
Wild Type
<400> SEQUENCE: 79
ccaattagtc ctattgaaac tgtaccagta aaattaaaac caggaatgga tggcccaaag 60
gtcaaacaat ggccattgac agaagaaaaa ataaaagcat taacagcaat ttgtgaggaa 120
atggagaagg aaggaaaaat tacaaaaatt gggcctgata atccatataa cactccagta 180
tttgccataa aaaagaagga cagtactaag tggagaaaat tagtagattt cagggaactc 240
aataaaagaa ctcaagactt ttgggaagtt caattaggaa taccacaccc agcaggatta 300
aaaaagaaaa aatcagtgac agtgctagat gtgggggatg catatttttc agttccttta 360
gatgaaagct tcaggaaata tactgcattc accataccta gtataaacaa tgaaacacca 420
gggattagat atcaatataa tgtgctgcca cagggatgga aaggatcacc agcaatattc 480
cagagtagca tgacaaaaat cttagagccc ttcagagcaa aaaatccaga catagttatc 540
tatcaagccc cgttgtatgt aggatctgac ttagaaatag ggcaacatag agcaaaaata 600
gaagagttaa gggaacattt attgaaatgg ggatttacaa caccagacaa gaaacatcaa 660
aaagaacccc catttcttcc catcgaactc catcctgaca aatggacagt acaacctata 720
ctgctgccag aaaaggatag ttggactgtc aatgatatac agaagttagt gggaaaatta 780
aactgggcaa gtcagattta cccagggatt aaagtaaggc aactctgtaa actcctcagg 840
ggggccaaag cactaacaga catagtacca ctaactgaag aagcagaatt agaattggca 900
gagaacaggg aaattttaag agaaccagta catggagtat attatgatcc atcaaaagac 960
ttgatagctg aaatacagaa acaggggcat gaacaatgga catatcaaat ttatcaagaa 1020
ccatttaaaa atctgaaaac agggaagtat gcaaaaatga ggactaccca cactaatgat 1080
gtaaaacagt taacagaggc agtgcaaaaa atagccatgg aaagcatagt aatatgggga 1140
aagactccta aatttagact acccatccaa aaagaaacat gggagacatg gtggacagac 1200
tattggcaag ccacctggat ccctgagtgg gagtttgtta atacccctcc cctagtaaaa 1260
ttatggtacc aactagaaaa agatcccata gcaggagtag aaactttcta tgtagatgga 1320
gcaactaata gggaagctaa aataggaaaa gcagggtatg ttactgacag aggaaggcag 1380
aaaattgtta ctctaactaa cacaacaaat cagaagactg agttacaagc aattcagcta 1440
gctctgcagg attcaggatc agaagtaaac atagtaacag actcacagta tgcattagga 1500
atcattcaag cacaaccaga taagagtgac tcagagatat ttaaccaaat aatagaacag 1560
ttaataaaca aggaaagaat ctacctgtca tgggtaccag cacataaagg aattggggga 1620
aatgaacaag tagataaatt agtaagtaag ggaattagga aagtgttg 1668
<210> SEQ ID NO 80
<211> LENGTH: 216
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C TatC22Exon1 Optimized
<400> SEQUENCE: 80
atggagcccg tggaccccaa gctgaagccc tggaaccacc ccggcagcca gcccaagacc 60
gccggcaaca actgcttctg caagcactgc agctaccact gcctggtgtg cttccagacc 120
aagggcctgg gcatcagcta cggccgcaag aagcgccgcc agcgccgcag cgcccccccc 180
agcggcgagg accaccagaa ccccctgagc aagcag 216
<210> SEQ ID NO 81
<211> LENGTH: 216
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C TatExon1 Optimized
<400> SEQUENCE: 81
atggagcccg tggaccccaa gctgaagccc tggaaccacc ccggcagcca gcccaagacc 60
gcctgcaaca actgcttctg caagcactgc agctaccact gcctggtgtg cttccagacc 120
aagggcctgg gcatcagcta cggccgcaag aagcgccgcc agcgccgcag cgcccccccc 180
agcggcgagg accaccagaa ccccctgagc aagcag 216
<210> SEQ ID NO 82
<211> LENGTH: 216
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C TatExon1 Wild Type
<400> SEQUENCE: 82
atggagccag tagatcctaa actaaagccc tggaaccatc caggaagcca acctaaaaca 60
gcttgtaata attgcttttg caaacactgt agctatcatt gtctagtttg ctttcagaca 120
aaaggtttag gcatttccta tggcaggaag aagcggagac agcgacgaag cgctcctcca 180
agtggtgaag atcatcaaaa tcctctatca aagcag 216
<210> SEQ ID NO 83
<211> LENGTH: 93
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C TatExon2 Optimized
<400> SEQUENCE: 83
cccctgcccc aggcccgcgg cgacagcacc ggcagcgagg agagcaagaa gaaggtggag 60
agcaagaccg agaccgaccc ctacgactgg tga 93
<210> SEQ ID NO 84
<211> LENGTH: 93
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C TatExon2 Wild Type
<400> SEQUENCE: 84
cccttacccc aagcccgagg ggactcgaca ggctcggagg aatcgaagaa gaaggtggag 60
agcaagacag agacagatcc atacgattgg tga 93
<210> SEQ ID NO 85
<211> LENGTH: 579
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Vif Optimized
<400> SEQUENCE: 85
atggagaacc gctggcaggt gctgatcgtg tggcaggtgg accgcatgaa gatccgcgcc 60
tggaacagcc tggtgaagca ccacatgtac atcagccgcc gcgccagcgg ctgggtgtac 120
cgccaccact tcgagagccg ccaccccaag gtgagcagcg aggtgcacat ccccctgggc 180
gacgcccgcc tggtgatcaa gacctactgg ggcctgcaga ccggcgagcg cgactggcac 240
ctgggccacg gcgtgagcat cgagtggcgc ctgcgcgagt acagcaccca ggtggacccc 300
gacctggccg accagctgat ccacatgcac tacttcgact gcttcaccga gagcgccatc 360
cgccaggcca tcctgggcca catcgtgttc ccccgctgcg actaccaggc cggccacaag 420
aaggtgggca gcctgcagta cctggccctg accgccctga tcaagcccaa gaagcgcaag 480
ccccccctgc ccagcgtgcg caagctggtg gaggaccgct ggaacgaccc ccagaagacc 540
cgcggccgcc gcggcaacca caccatgaac ggccactag 579
<210> SEQ ID NO 86
<211> LENGTH: 579
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Vif Wild Type
<400> SEQUENCE: 86
atggaaaaca gatggcaggt gctgattgtg tggcaggtgg acaggatgaa gattagagca 60
tggaatagtt tagtaaagca ccatatgtat atatcaagga gagctagtgg atgggtctac 120
agacatcatt ttgaaagcag acatccaaaa gtaagttcag aagtacatat cccattaggg 180
gatgctagat tagtaataaa aacatattgg ggtttgcaga caggagaaag agattggcat 240
ttgggtcatg gagtctccat agaatggaga ctgagagaat acagcacaca agtagaccct 300
gacctggcag accagctaat tcacatgcat tattttgatt gttttacaga atctgccata 360
agacaagcca tattaggaca catagttttt cctaggtgtg actatcaagc aggacataag 420
aaggtaggat ctctgcaata cttggcactg acagcattga taaaaccaaa aaagagaaag 480
ccacctctgc ctagtgttag aaaattagta gaggatagat ggaacgaccc ccagaagacc 540
aggggccgca gagggaacca tacaatgaat ggacactag 579
<210> SEQ ID NO 87
<211> LENGTH: 288
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Vpr Optimized
<400> SEQUENCE: 87
atggagcgcc cccccgagga ccagggcccc cagcgcgagc cctacaacga gtggaccctg 60
gagatcctgg aggagctgaa gcaggaggcc gtgcgccact tcccccgccc ctggctgcac 120
agcctgggcc agtacatcta cgagacctac ggcgacacct ggaccggcgt ggaggccatc 180
atccgcgtgc tgcagcagct gctgttcatc cacttccgca tcggctgcca gcacagccgc 240
atcggcatcc tgcgccagcg ccgcgcccgc aacggcgcca gccgcagc 288
<210> SEQ ID NO 88
<211> LENGTH: 288
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Vpr Wild Type
<400> SEQUENCE: 88
atggaacgac ccccagaaga ccaggggccg cagagggaac catacaatga atggacacta 60
gagattctag aagaactcaa gcaggaagct gtcagacact ttcctagacc atggctccat 120
agcttaggac aatatatcta tgaaacctat ggggatactt ggacgggagt tgaagctata 180
ataagagtac tgcaacaact actgttcatt catttcagaa ttggatgcca acatagcaga 240
ataggcatct tgcgacagag aagagcaaga aatggagcca gtagatcc 288
<210> SEQ ID NO 89
<211> LENGTH: 267
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Vpu Optimized
<400> SEQUENCE: 89
atggtgagcc tgagcctgtt caagggcgtg gactaccgcc tgggcgtggg cgccctgatc 60
gtggccctga tcatcgccat catcgtgtgg accatcgcct acatcgagta ccgcaagctg 120
gtgcgccaga agaagatcga ctggctgatc aagcgcatcc gcgagcgcgc cgaggacagc 180
ggcaacgaga gcgacggcga caccgaggag ctgagcacca tggtggacat gggccacctg 240
cgcctgctgg acgccaacga cctgtaa 267
<210> SEQ ID NO 90
<211> LENGTH: 267
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Vpu Wild Type
<400> SEQUENCE: 90
atggtaagtt taagtttatt taaaggagta gattatagat taggagtagg agcattgata 60
gtagcactaa tcatagcaat aatagtgtgg accatagcat atatagaata taggaaattg 120
gtaagacaaa agaaaataga ctggttaatt aaaagaatta gggaaagagc agaagacagt 180
ggcaatgaga gtgatgggga cacagaagaa ttgtcaacaa tggtggatat ggggcatctt 240
aggcttctgg atgctaatga tttgtaa 267
<210> SEQ ID NO 91
<211> LENGTH: 321
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C RevExon 1 and 2 Optimized
<400> SEQUENCE: 91
atggccggcc gcagcggcga cagcgacgag gccctgctgc aggtggtgaa gatcatcaag 60
atcctgtacc agagccccta ccccaagccc gagggcaccc gccaggcccg ccgcaaccgc 120
cgccgccgct ggcgcgcccg ccagcgccag atccacacca tcggcgagcg catcctggtg 180
gcctgcctgg gccgcagcgc cgagcccgtg cccctgcagc tgccccccct ggagcgcctg 240
cacatcaact gcagcgaggg cagcggcacc agcggcaccc agcagagcca gggcaccacc 300
gagggcgtgg gcgaccccta a 321
<210> SEQ ID NO 92
<211> LENGTH: 324
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C RevExon 1 and 2 Wild Type
<400> SEQUENCE: 92
atggcaggaa gaagcggaga cagcgacgaa gcgctcctcc aagtggtgaa gatcatcaaa 60
atcctctatc aaagcaaccc ttaccccaag cccgagggga ctcgacaggc tcggaggaat 120
cgaagaagaa ggtggagagc aagacagaga cagatccata cgattggtga gcggattctt 180
gtcgcttgcc tgggacgatc tgcggagcct gtgcctcttc agctaccacc gcttgagaga 240
cttcatatta attgcagtga gggcagtgga acttctggga cacagcagtc tcaggggact 300
acagaggggg tgggagatcc ttaa 324
<210> SEQ ID NO 93
<211> LENGTH: 309
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C TatC22 Exon 1 and 2 Optimized
<400> SEQUENCE: 93
atggagcccg tggaccccaa gctgaagccc tggaaccacc ccggcagcca gcccaagacc 60
gccggcaaca actgcttctg caagcactgc agctaccact gcctggtgtg cttccagacc 120
aagggcctgg gcatcagcta cggccgcaag aagcgccgcc agcgccgcag cgcccccccc 180
agcggcgagg accaccagaa ccccctgagc aagcagcccc tgccccaggc ccgcggcgac 240
agcaccggca gcgaggagag caagaagaag gtggagagca agaccgagac cgacccctac 300
gactggtga 309
<210> SEQ ID NO 94
<211> LENGTH: 309
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Tat Exon 1 and 2 Optimized
<400> SEQUENCE: 94
atggagcccg tggaccccaa gctgaagccc tggaaccacc ccggcagcca gcccaagacc 60
gcctgcaaca actgcttctg caagcactgc agctaccact gcctggtgtg cttccagacc 120
aagggcctgg gcatcagcta cggccgcaag aagcgccgcc agcgccgcag cgcccccccc 180
agcggcgagg accaccagaa ccccctgagc aagcagcccc tgccccaggc ccgcggcgac 240
agcaccggca gcgaggagag caagaagaag gtggagagca agaccgagac cgacccctac 300
gactggtga 309
<210> SEQ ID NO 95
<211> LENGTH: 309
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C Tat Exon 1 and 2 Wild Type
<400> SEQUENCE: 95
atggagccag tagatcctaa actaaagccc tggaaccatc caggaagcca acctaaaaca 60
gcttgtaata attgcttttg caaacactgt agctatcatt gtctagtttg ctttcagaca 120
aaaggtttag gcatttccta tggcaggaag aagcggagac agcgacgaag cgctcctcca 180
agtggtgaag atcatcaaaa tcctctatca aagcagccct taccccaagc ccgaggggac 240
tcgacaggct cggaggaatc gaagaagaag gtggagagca agacagagac agatccatac 300
gattggtga 309
<210> SEQ ID NO 96
<211> LENGTH: 624
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Type C NefD125g Optimized
Myristalization
Modification
<400> SEQUENCE: 96
atggccggca agtggagcaa gcgcagcatc gtgggctggc ccgccgtgcg cgagcgcatg 60
cgccgcaccg agcccgccgc cgagggcgtg ggcgccgcca gccaggacct ggaccgccac 120
ggcgccctga ccagcagcaa cacccccgcc accaacgagg cctgcgcctg gctgcaggcc 180
caggaggagg acggcgacgt gggcttcccc gtgcgccccc aggtgcccct gcgccccatg 240
acctacaaga gcgccgtgga cctgagcttc ttcctgaagg agaagggcgg cctggagggc 300
ctgatctaca gccgcaagcg ccaggagatc ctggacctgt gggtgtacaa cacccagggc 360
ttcttccccg gctggcagaa ctacaccagc ggccccggcg tgcgcttccc cctgaccttc 420
ggctggtgct tcaagctggt gcccgtggac ccccgcgagg tgaaggaggc caacgagggc 480
gaggacaact gcctgctgca ccccatgagc cagcacggcg ccgaggacga ggaccgcgag 540
gtgctgaagt ggaagttcga cagcctgctg gcccaccgcc acatggcccg cgagctgcac 600
cccgagtact acaaggactg ctga 624
<210> SEQ ID NO 97
<211> LENGTH: 2565
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Envgp160_TV2_C_ZAopt
<400> SEQUENCE: 97
atgcgcgccc gcggcatcct gaagaactac cgccactggt ggatctgggg catcctgggc 60
ttctggatgc tgatgatgtg caacgtgaag ggcctgtggg tgaccgtgta ctacggcgtg 120
cccgtgggcc gcgaggccaa gaccaccctg ttctgcgcca gcgacgccaa ggcctacgag 180
aaggaggtgc acaacgtgtg ggccacccac gcctgcgtgc ccaccgaccc caacccccag 240
gaggtgatcc tgggcaacgt gaccgagaac ttcaacatgt ggaagaacga catggtggac 300
cagatgcagg aggacatcat cagcctgtgg gaccagagcc tgaagccctg cgtgaagctg 360
acccccctgt gcgtgaccct gaactgcacc aacgccaccg tgaactacaa caacaccagc 420
aaggacatga agaactgcag cttctacgtg accaccgagc tgcgcgacaa gaagaagaag 480
gagaacgccc tgttctaccg cctggacatc gtgcccctga acaaccgcaa gaacggcaac 540
atcaacaact accgcctgat caactgcaac accagcgcca tcacccaggc ctgccccaag 600
gtgagcttcg accccatccc catccactac tgcgcccccg ccggctacgc ccccctgaag 660
tgcaacaaca agaagttcaa cggcatcggc ccctgcgaca acgtgagcac cgtgcagtgc 720
acccacggca tcaagcccgt ggtgagcacc cagctgctgc tgaacggcag cctggccgag 780
gaggagatca tcatccgcag cgagaacctg accaacaacg tgaagaccat catcgtgcac 840
ctgaacgaga gcatcgagat caagtgcacc cgccccggca acaacacccg caagagcgtg 900
cgcatcggcc ccggccaggc cttctacgcc accggcgaca tcatcggcga catccgccag 960
gcccactgca acatcagcaa gaacgagtgg aacaccaccc tgcagcgcgt gagccagaag 1020
ctgcaggagc tgttccccaa cagcaccggc atcaagttcg ccccccacag cggcggcgac 1080
ctggagatca ccacccacag cttcaactgc ggcggcgagt tcttctactg caacaccacc 1140
gacctgttca acagcaccta cagcaacggc acctgcacca acggcacctg catgagcaac 1200
aacaccgagc gcatcaccct gcagtgccgc atcaagcaga tcatcaacat gtggcaggag 1260
gtgggccgcg ccatgtacgc cccccccatc gccggcaaca tcacctgccg cagcaacatc 1320
accggcctgc tgctgacccg cgacggcggc gacaacaaca ccgagaccga gaccttccgc 1380
cccggcggcg gcgacatgcg cgacaactgg cgcagcgagc tgtacaagta caaggtggtg 1440
gagatcaagc ccctgggcgt ggcccccacc gccgccaagc gccgcgtggt ggagcgcgag 1500
aagcgcgccg tgggcatcgg cgccgtgttc ctgggcttcc tgggcgccgc cggcagcacc 1560
atgggcgccg ccagcatcac cctgaccgtg caggcccgcc agctgctgag cggcatcgtg 1620
cagcagcaga gcaacctgct gcgcgccatc gaggcccagc agcacatgct gcagctgacc 1680
gtgtggggca tcaagcagct gcaggcccgc gtgctggcca tcgagcgcta cctgcaggac 1740
cagcagctgc tgggcctgtg gggctgcagc ggcaagctga tctgcaccac caacgtgctg 1800
tggaacagca gctggagcaa caagacccag agcgacatct gggacaacat gacctggatg 1860
cagtgggacc gcgagatcag caactacacc aacaccatct accgcctgct ggaggacagc 1920
cagagccagc aggagcgcaa cgagaaggac ctgctggccc tggaccgctg gaacaacctg 1980
tggaactggt tcagcatcac caactggctg tggtacatca agatcttcat catgatcgtg 2040
ggcggcctga tcggcctgcg catcatcttc gccgtgctga gcctggtgaa ccgcgtgcgc 2100
cagggctaca gccccctgag cctgcagacc ctgatcccca acccccgcgg ccccgaccgc 2160
ctgggcggca tcgaggagga gggcggcgag caggacagca gccgcagcat ccgcctggtg 2220
agcggcttcc tgaccctggc ctgggacgac ctgcgcagcc tgtgcctgtt ctgctaccac 2280
cgcctgcgcg acttcatcct gatcgtggtg cgcgccgtgg agctgctggg ccacagcagc 2340
ctgcgcggcc tgcagcgcgg ctggggcacc ctgaagtacc tgggcagcct ggtgcagtac 2400
tggggcctgg agctgaagaa gagcgccatc aacctgctgg acaccatcgc catcgccgtg 2460
gccgagggca ccgaccgcat cctggagttc atccagaacc tgtgccgcgg catccgcaac 2520
gtgccccgcc gcatccgcca gggcttcgag gccgccctgc agtaa 2565
<210> SEQ ID NO 98
<211> LENGTH: 2565
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Envgp160_TV2_C_ZAwt
<400> SEQUENCE: 98
atgagagcga gggggatact gaagaattat cgacactggt ggatatgggg catcttaggc 60
ttttggatgc taatgatgtg taatgtgaag ggcttgtggg tcacagtcta ctacggggta 120
cctgtgggga gagaagcaaa aactactcta ttttgtgcat cagatgctaa agcatatgag 180
aaagaagtgc ataatgtctg ggctacacat gcctgtgtac ccacagaccc caacccacaa 240
gaagtgattt tgggcaatgt aacagaaaat tttaacatgt ggaaaaatga catggtggat 300
cagatgcagg aagatataat cagtttatgg gatcaaagcc ttaagccatg tgtaaaattg 360
accccactct gtgtcacttt aaactgtaca aatgcaactg ttaactacaa taatacctct 420
aaagacatga aaaattgctc tttctatgta accacagaat taagagataa gaaaaagaaa 480
gaaaatgcac ttttttatag acttgatata gtaccactta ataataggaa gaatgggaat 540
attaacaact atagattaat aaattgtaat acctcagcca taacacaagc ctgtccaaaa 600
gtctcgtttg acccaattcc tatacattat tgtgctccag ctggttatgc gcctctaaaa 660
tgtaataata agaaattcaa tggaatagga ccatgcgata atgtcagcac agtacaatgt 720
acacatggaa ttaagccagt ggtatcaact caattactgt taaatggtag cctagcagaa 780
gaagagataa taattagatc tgaaaatctg acaaacaatg tcaaaacaat aatagtacat 840
cttaatgaat ctatagagat taaatgtaca agacctggca ataatacaag aaagagtgtg 900
agaataggac caggacaagc attctatgca acaggagaca taataggaga tataagacaa 960
gcacattgta acattagtaa aaatgaatgg aatacaactt tacaaagggt aagtcaaaaa 1020
ttacaagaac tcttccctaa tagtacaggg ataaaatttg caccacactc aggaggggac 1080
ctagaaatta ctacacatag ctttaattgt ggaggagaat ttttctattg caatacaaca 1140
gacctgttta atagtacata cagtaatggt acatgcacta atggtacatg catgtctaat 1200
aatacagagc gcatcacact ccaatgcaga ataaaacaaa ttataaacat gtggcaggag 1260
gtaggacgag caatgtatgc ccctcccatt gcaggaaaca taacatgtag atcaaatatt 1320
acaggactac tattaacacg tgatggagga gataataata ctgaaacaga gacattcaga 1380
cctggaggag gagacatgag ggacaattgg agaagtgaat tatataaata caaggtggta 1440
gaaattaaac cattaggagt agcacccact gctgcaaaaa ggagagtggt ggagagagaa 1500
aaaagagcag taggaatagg agctgtgttc cttgggttct tgggagcagc aggaagcact 1560
atgggcgcag catcaataac gctgacggta caggccagac aattattgtc tggtatagtg 1620
caacagcaaa gtaatttgct gagggctata gaggcgcaac agcatatgtt gcaactcacg 1680
gtctggggca ttaagcagct ccaggcaaga gtcctggcta tagagagata cctacaggat 1740
caacagctcc taggactgtg gggctgctct ggaaaactca tctgcaccac taatgtgctt 1800
tggaactcta gttggagtaa taaaactcaa agtgatattt gggataacat gacctggatg 1860
cagtgggata gggaaattag taattacaca aacacaatat acaggttgct tgaagactcg 1920
caaagccagc aggaaagaaa tgaaaaagat ttactagcat tggacaggtg gaacaatctg 1980
tggaattggt ttagcataac aaattggctg tggtatataa aaatattcat aatgatagta 2040
ggaggcttga taggtttaag aataattttt gctgtgctct ctctagtaaa tagagttagg 2100
cagggatact cacccttgtc attgcagacc cttatcccaa acccgagggg acccgacagg 2160
ctcggaggaa tcgaagaaga aggtggagag caagacagca gcagatccat tcgattagtg 2220
agcggattct tgacacttgc ctgggacgac ctacgaagcc tgtgcctctt ctgctaccac 2280
cgattgagag acttcatatt aattgtagtg agagcagtgg aacttctggg acacagtagt 2340
ctcaggggac tgcagagggg gtggggaacc cttaagtatt tggggagtct tgtgcaatat 2400
tggggtctag agttaaaaaa gagtgctatt aatctgcttg atactatagc aatagcagta 2460
gctgaaggaa cagataggat tctagaattc atacaaaacc tttgtagagg tatccgcaac 2520
gtacctagaa gaataagaca gggcttcgaa gcagctttgc aataa 2565
<210> SEQ ID NO 99
<211> LENGTH: 1491
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Gag_TV2_C_ZAopt
<400> SEQUENCE: 99
atgggcgccc gcgccagcat cctgcgcggc ggcaagctgg acaagtggga gaagatccgc 60
ctgcgccccg gcggccgcaa gcactacatg ctgaagcacc tggtgtgggc cagccgcgag 120
ctggagcgct tcgccgtgaa ccccggcctg ctggagacca gcgacggctg ccgccagatc 180
atcaagcagc tgcagcccgc cctgcagacc ggcaccgagg agatccgcag cctgttcaac 240
accgtggcca ccctgtactg cgtgcacaag ggcatcgacg tgcgcgacac caaggaggcc 300
ctggacaaga tcgaggagga gcagaacaag tgccagcaga agacccagca ggccgaggcc 360
gccgacaaga aggtgagcca gaactacccc atcgtgcaga acctgcaggg ccagatggtg 420
caccaggcca tcagcccccg caccctgaac gcctgggtga aggtgatcga ggagaaggcc 480
ttcagccccg aggtgatccc catgttcacc gccctgagcg agggcgccac cccccaggac 540
ctgaacacca tgctgaacac cgtgggcggc caccaggccg ccatgcagat gctgaaggac 600
accatcaacg aggaggccgc cgagtgggac cgcctgcacc ccgtgcacgc cggccccgtg 660
gcccccggcc agatgcgcga gccccgcggc agcgacatcg ccggcaccac cagcaccctg 720
caggagcaga tcgcctggat gaccagcaac ccccccatcc ccgtgggcga catctacaag 780
cgctggatca tcctgggcct gaacaagatc gtgcgcatgt acagccccgt gagcatcctg 840
gacatcaagc agggccccaa ggagcccttc cgcgactacg tggaccgctt cttcaagacc 900
ctgcgcgccg agcagagcac ccaggaggtg aagaactgga tgaccgacac cctgctggtg 960
cagaacgcca accccgactg caagaccatc ctgcgcgccc tgggccccgg cgccagcctg 1020
gaggagatga tgaccgcctg ccagggcgtg ggcggcccca gccacaaggc ccgcgtgctg 1080
gccgaggcca tgagccaggc caacaacacc agcgtgatga tccagaagag caacttcaag 1140
ggcccccgcc gcgccgtgaa gtgcttcaac tgcggccgcg agggccacat cgcccgcaac 1200
tgccgcgccc cccgcaagcg cggctgctgg aagtgcggca aggagggcca ccagatgaag 1260
gactgcaccg agcgccaggc caacttcctg ggcaagatct ggcccagcca caagggccgc 1320
cccggcaact tcctgcagag ccgccccgag cccaccgccc cccccctgga gcccaccgcc 1380
ccccccgccg agagcttcaa gttcaaggag acccccaagc aggagcccaa ggaccgcgag 1440
cccctgacca gcctgaagag cctgttcggc agcgaccccc tgagccagta a 1491
<210> SEQ ID NO 100
<211> LENGTH: 1491
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Gag_TV2_C_ZAwt
<400> SEQUENCE: 100
atgggtgcga gagcgtcaat attaagaggg ggaaaattag acaaatggga aaaaattagg 60
ttacggccag gggggagaaa acactatatg ctaaaacacc tagtatgggc aagcagagag 120
ctggaaagat ttgcagttaa ccctggcctt ttagagacat cagacggatg tagacaaata 180
ataaaacagc tacaaccagc tcttcagaca ggaacagagg aaattagatc attatttaac 240
acagtagcaa ctctctattg tgtacataaa gggatagatg tacgagacac caaggaagcc 300
ttagacaaga tagaggagga acaaaacaaa tgtcagcaaa aaacacagca ggcggaagcg 360
gctgacaaaa aggtcagtca aaattatcct atagtgcaga acctccaagg gcaaatggta 420
caccaggcca tatcacctag aaccttgaat gcatgggtaa aagtaataga ggagaaggct 480
tttagcccag aggtaatacc catgtttaca gcattatcag aaggagccac cccacaagat 540
ttaaacacca tgttaaatac agtgggggga catcaagcag ccatgcaaat gttaaaagat 600
accatcaatg aggaggctgc agaatgggat aggttacatc cagtacatgc agggcctgtt 660
gcaccaggcc agatgagaga accaagggga agtgacatag caggaactac tagtaccctt 720
caagaacaaa tagcatggat gacaagtaac ccacctatcc cagtagggga catctataaa 780
aggtggataa ttctggggtt aaataaaata gtaagaatgt acagccctgt cagcatttta 840
gacataaaac aaggaccaaa ggaacccttt agagactatg tagaccggtt cttcaaaact 900
ttaagagctg aacaatctac acaagaggta aaaaattgga tgacagacac cttgttagtc 960
caaaatgcga acccagattg taagaccatt ttaagagcat taggaccagg ggcttcatta 1020
gaagaaatga tgacagcatg tcagggagtg ggaggaccta gccacaaagc aagagttttg 1080
gctgaggcaa tgagccaagc aaacaataca agtgtaatga tacagaaaag caattttaaa 1140
ggccctagaa gagctgttaa atgtttcaac tgtggcaggg aagggcacat agccaggaat 1200
tgcagggccc ctaggaaaag gggctgttgg aaatgtggaa aggaaggaca ccaaatgaaa 1260
gactgtactg agaggcaggc taatttttta gggaaaattt ggccttccca caaggggagg 1320
ccagggaatt tccttcagag cagaccagag ccaacagccc caccactaga accaacagcc 1380
ccaccagcag agagcttcaa gttcaaggag actccgaagc aggagccgaa agacagggaa 1440
cctttaactt ccctcaaatc actctttggc agcgacccct tgtctcaata a 1491
<210> SEQ ID NO 101
<211> LENGTH: 624
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Nef_TV2_C_ZAopt
<400> SEQUENCE: 101
atgggcggca agtggagcaa gagcagcatc atcggctggc ccgaggtgcg cgagcgcatc 60
cgccgcaccc gcagcgccgc cgagggcgtg ggcagcgcca gccaggacct ggagaagcac 120
ggcgccctga ccaccagcaa caccgcccac aacaacgccg cctgcgcctg gctggaggcc 180
caggaggagg agggcgaggt gggcttcccc gtgcgccccc aggtgcccct gcgccccatg 240
acctacaagg ccgccatcga cctgagcttc ttcctgaagg agaagggcgg cctggagggc 300
ctgatctaca gcaagaagcg ccaggagatc ctggacctgt gggtgtacaa cacccagggc 360
ttcttccccg actggcagaa ctacaccccc ggccccggcg tgcgcttccc cctgaccttc 420
ggctggtact tcaagctgga gcccgtggac ccccgcgagg tggaggaggc caacgagggc 480
gagaacaact gcctgctgca ccccatgagc cagcacggca tggaggacga ggaccgcgag 540
gtgctgcgct ggaagttcga cagcaccctg gcccgccgcc acatggcccg cgagctgcac 600
cccgagtact acaaggactg ctga 624
<210> SEQ ID NO 102
<211> LENGTH: 624
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Nef_TV2_C_ZA_wt
<400> SEQUENCE: 102
atggggggca agtggtcaaa aagcagtata attggatggc ctgaagtaag agaaagaatc 60
agacgaacta ggtcagcagc agagggagta ggatcagcgt ctcaagactt agagaaacat 120
ggggcactta caaccagcaa cacagcccac aacaatgctg cttgcgcctg gctggaagcg 180
caagaggagg aaggagaagt aggctttcca gtcagacctc aggtaccttt aagaccaatg 240
acttataaag cagcaataga tctcagcttc tttttaaaag aaaagggggg actggaaggg 300
ttaatttact ccaagaaaag gcaagagatc cttgatttgt gggtttataa cacacaaggc 360
ttcttccctg attggcaaaa ctacacaccg ggaccagggg tcagatttcc actgaccttt 420
ggatggtact tcaagctaga gccagtcgat ccaagggaag tagaagaggc caatgaagga 480
gaaaacaact gtttactaca ccctatgagc cagcatggaa tggaggatga agacagagaa 540
gtattaagat ggaagtttga cagtacgcta gcacgcagac acatggcccg cgagctacat 600
ccggagtatt acaaagactg ctga 624
<210> SEQ ID NO 103
<211> LENGTH: 3009
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Pol_TV2_C_ZAopt
<400> SEQUENCE: 103
ttcttccgcg agaacctggc cttcccccag ggcgaggccc gcgagttccc cagcgagcag 60
acccgcgcca acagccccac cacccgcacc aacagcccca ccagccgcga gctgcaggtg 120
cagggcgaca gcgaggccgg cgccgagcgc cagggcacct tcaacttccc ccagatcacc 180
ctgtggcagc gccccctggt gagcatcaag gtggccggcc agaccaagga ggccctgctg 240
gacaccggcg ccgacgacac cgtgctggag gagatcaacc tgcccggcaa gtggaagccc 300
aagatgatcg gcggcatcgg cggcttcatc aaggtgcgcc agtacgacca gatcctgatc 360
gagatctgcg gcaagcgcgc catcggcacc gtgctggtgg gccccacccc cgtgaacatc 420
atcggccgca acctgctgac ccagctgggc tgcaccctga acttccccat cagccccatc 480
gagaccgtgc ccgtgaagct gaagcccggc atggacggcc ccaaggtgaa gcagtggccc 540
ctgaccgagg agaagatcaa ggccctgacc gagatctgcg aggagatgga gaaggagggc 600
aagatcacca agatcggccc cgagaacccc tacaacaccc ccgtgttcgc catcaagaag 660
aaggacagca ccaagtggcg caagctggtg gacttccgcg agctgaacaa gcgcacccag 720
gacttctggg aggtgcagct gggcatcccc caccccgccg gcctgaagaa gaagaagagc 780
gtgaccgtgc tggacgtggg cgacgcctac ttcagcgtgc ccctggacga gagcttccgc 840
aagtacaccg ccttcaccat ccccagcatc aacaacgaga cccccggcat ccgctaccag 900
tacaacgtgc tgccccaggg ctggaagggc agccccgcca tcttccagag cagcatgacc 960
cgcatcctgg agcccttccg cacccagaac cccgaggtgg tgatctacca gtacatggac 1020
gacctgtacg tgggcagcga cctggagatc ggccagcacc gcgccaagat cgaggagctg 1080
cgcggccacc tgctgaagtg gggcttcacc acccccgaca agaagcacca gaaggagccc 1140
cccttcctgt ggatgggcta cgagctgcac cccgacaagt ggaccgtgca gcccatccag 1200
ctgcccgaga aggagagctg gaccgtgaac gacatccaga agctggtggg caagctgaac 1260
tgggccagcc agatctaccc cggcatcaag gtgcgccagc tgtgcaagct gctgcgcggc 1320
gccaaggccc tgaccgacat cgtgcccctg accgaggagg ccgagctgga gctggccgag 1380
aaccgcgaga tcctgaagga gcccgtgcac ggcgtgtact acgaccccag caaggacctg 1440
atcgccgaga tccagaagca gggcaacgac cagtggacct accagatcta ccaggagccc 1500
ttcaagaacc tgcgcaccgg caagtacgcc aagatgcgca ccgcccacac caacgacgtg 1560
aagcagctgg ccgaggccgt gcagaagatc acccaggaga gcatcgtgat ctggggcaag 1620
acccccaagt tccgcctgcc catccccaag gagacctggg agacctggtg gagcgactac 1680
tggcaggcca cctggatccc cgagtgggag ttcgtgaaca ccccccccct ggtgaagctg 1740
tggtaccagc tggagaagga gcccatcgtg ggcgccgaga ccttctacgt ggacggcgcc 1800
gccaaccgcg agaccaagat cggcaaggcc ggctacgtga ccgacaaggg ccgccagaag 1860
gtggtgagct tcaccgagac caccaaccag aagaccgagc tgcaggccat ccagctggcc 1920
ctgcaggaca gcggccccga ggtgaacatc gtgaccgaca gccagtacgc cctgggcatc 1980
atccaggccc agcccgacaa gagcgagagc gagctggtga gccagatcat cgagcagctg 2040
atcaagaagg agaaggtgta cctgagctgg gtgcccgccc acaagggcat cggcggcaac 2100
gagcaggtgg acaagctggt gagcagcggc atccgcaagg tgctgttcct ggacggcatc 2160
gacaaggccc aggaggagca cgagaagtac cacagcaact ggcgcgccat ggccagcgag 2220
ttcaacctgc cccccatcgt ggccaaggag atcgtggcca gctgcgacaa gtgccagctg 2280
aagggcgagg ccatgcacgg ccaggtggac tgcagccccg gcatctggca gctggactgc 2340
acccacctgg agggcaagat catcctggtg gccgtgcacg tggccagcgg ctacatggag 2400
gccgaggtga tccccgccga gaccggccag gagaccgcct acttcatcct gaagctggcc 2460
ggccgctggc ccgtgaaggt gatccacacc gacaacggca gcaacttcac cagcaccgcc 2520
gtgaaggccg cctgctggtg ggccgacatc cagcgcgagt tcggcatccc ctacaacccc 2580
cagagccagg gcgtggtgga gagcatgaac aaggagctga agaagatcat cggccaggtg 2640
cgcgaccagg ccgagcacct gaagaccgcc gtgcagatgg ccgtgttcat ccacaacttc 2700
aagcgcaagg gcggcatcgg cggctacagc gccggcgagc gcatcatcga catcatcgcc 2760
agcgacatcc agaccaagga gctgcagaag cagatcatca agatccagaa cttccgcgtg 2820
tactaccgcg acagccgcga ccccatctgg aagggccccg ccaagctgct gtggaagggc 2880
gagggcgccg tggtgatcca ggacaacagc gacatcaagg tggtgccccg ccgcaaggcc 2940
aagatcatca aggactacgg caagcagatg gccggcgccg actgcgtggc cggccgccag 3000
gacgaggac 3009
<210> SEQ ID NO 104
<211> LENGTH: 3009
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Pol_TV2_C_ZAwt
<400> SEQUENCE: 104
ttttttaggg aaaatttggc cttcccacaa ggggaggcca gggaatttcc ttcagagcag 60
accagagcca acagccccac cactagaacc aacagcccca ccagcagaga gcttcaagtt 120
caaggagact ccgaagcagg agccgaaaga cagggaacct ttaacttccc tcaaatcact 180
ctttggcagc gaccccttgt ctcaataaaa gtagcgggcc aaacaaagga ggctctttta 240
gatacaggag cagatgatac agtactagaa gaaataaact tgccaggaaa atggaaacca 300
aaaatgatag gaggaattgg aggttttatc aaagtaagac agtatgatca aatacttata 360
gaaatttgtg gaaaaagggc tataggtaca gtattagtag gacctacacc tgtcaacata 420
attggaagaa atctgttgac tcagcttgga tgcacactaa attttccaat tagccccatt 480
gaaactgtac cagtaaaatt aaagccagga atggatggcc caaaggttaa acaatggcca 540
ttgacagaag aaaaaataaa agcattaaca gaaatttgtg aggaaatgga gaaggaagga 600
aaaattacaa aaattgggcc tgaaaatcca tataacactc cagtatttgc cataaagaag 660
aaggacagta caaagtggag aaaattagta gatttcaggg aactcaataa aagaactcaa 720
gacttttggg aagtccaatt aggaatacca cacccagcag ggttaaaaaa gaaaaaatca 780
gtgacagtac tggatgtggg agatgcatat ttttcagtcc ctttagatga gagcttcaga 840
aaatatactg cattcaccat acctagtata aacaatgaaa caccagggat tagatatcaa 900
tataatgttc ttccacaggg atggaaagga tcaccagcaa tattccagag tagcatgaca 960
agaatcttag agccctttag aacacaaaac ccagaagtag ttatctatca atatatggat 1020
gacttatatg taggatctga cttagaaata gggcaacata gagcaaaaat agaggagtta 1080
agaggacacc tattgaaatg gggatttacc acaccagaca agaaacatca gaaagaaccc 1140
ccatttcttt ggatggggta tgaactccat cctgacaaat ggacagtaca gcctatacag 1200
ctgccagaaa aggagagctg gactgtcaat gatatacaga agttagtggg aaagttaaac 1260
tgggcaagtc agatttaccc agggattaaa gtaaggcaac tgtgtaaact ccttagggga 1320
gccaaagcac taacagacat agtgccactg actgaagaag cagaattaga attggctgag 1380
aacagggaaa ttctaaaaga accagtacat ggagtatatt atgacccatc aaaagattta 1440
atagctgaaa tacagaaaca ggggaatgac caatggacat atcaaattta ccaagaacca 1500
tttaaaaatc tgagaacagg aaagtatgca aaaatgagga ctgcccacac taatgatgtg 1560
aaacagttag cagaggcagt gcaaaagata acccaggaaa gcatagtaat atggggaaaa 1620
actcctaaat ttagactacc catcccaaaa gaaacatggg agacatggtg gtcagactat 1680
tggcaagcca cctggattcc tgagtgggag tttgtcaata cccctcccct agtaaaattg 1740
tggtaccagc tggaaaaaga acccatagta ggggcagaaa ctttctatgt agatggagca 1800
gccaataggg aaactaaaat aggaaaagca gggtatgtca ctgacaaagg aaggcagaaa 1860
gttgtttcct tcactgaaac aacaaatcag aagactgaat tacaagcaat tcagctagct 1920
ttgcaggatt cagggccaga agtaaacata gtaacagact cacagtatgc attaggaatc 1980
attcaagcac aaccagataa gagtgaatca gaattagtca gtcaaataat agaacagttg 2040
ataaaaaagg aaaaagtcta cctatcatgg gtaccagcac ataaaggaat tggaggaaat 2100
gaacaagtag acaaattagt aagtagtgga atcagaaaag tactgtttct agatggaata 2160
gataaagctc aagaagagca tgaaaaatat cacagcaatt ggagagcaat ggctagtgag 2220
tttaatctgc cacccatagt agcaaaggaa atagtagcca gctgtgataa atgtcagcta 2280
aaaggggaag ccatgcatgg acaagtcgac tgtagtccag gaatatggca attagactgt 2340
acacatttag aaggaaaaat catcctagta gcagtccatg tagccagtgg ctacatggaa 2400
gcagaggtta tcccagcaga aacaggacaa gaaacagcat actttatact aaaattagca 2460
ggaagatggc cagtcaaagt aatacataca gataatggca gtaatttcac cagtaccgca 2520
gttaaggcag cctgttggtg ggcagatatc caacgggaat ttggaattcc ctacaatccc 2580
caaagtcaag gagtagtaga atccatgaat aaagaattaa agaaaatcat agggcaagta 2640
agagatcaag ctgagcacct taagacagca gtacaaatgg cagtattcat tcacaatttt 2700
aaaagaaaag gggggattgg ggggtacagt gcaggggaga gaataataga cataatagca 2760
tcagacatac aaactaaaga attacaaaaa caaattataa aaattcaaaa ttttcgggtt 2820
tattacagag acagcagaga ccctatttgg aaaggaccag ccaaactact ctggaaaggt 2880
gaaggggcag tagtaataca agataatagt gatataaagg tagtaccaag aaggaaagca 2940
aaaatcatta aggactatgg aaaacagatg gcaggtgctg attgtgtggc aggtagacag 3000
gatgaagat 3009
<210> SEQ ID NO 105
<211> LENGTH: 75
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: RevExon1_TV2_C_ZAopt
<400> SEQUENCE: 105
atggccggcc gcagcggcga cagcgacgag gccctgctgc aggccatcaa gatcatcaag 60
atcctgtacc agagc 75
<210> SEQ ID NO 106
<211> LENGTH: 76
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: RevExon1_TV2_C_ZAwt
<400> SEQUENCE: 106
atggcaggaa gaagcggaga cagcgacgaa gcgctcctcc aagcaataaa gatcatcaag 60
atcctctacc aaagca 76
<210> SEQ ID NO 107
<211> LENGTH: 246
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: RevExon2_TV2_C_ZAopt
<400> SEQUENCE: 107
ccctacccca agcccgaggg cacccgccag gcccgccgca accgccgccg ccgctggcgc 60
gcccgccagc agcagatcca cagcatcagc gagcgcatcc tggacacctg cctgggccgc 120
cccaccaagc ccgtgcccct gctgctgccc cccatcgagc gcctgcacat caactgcagc 180
gagagcagcg gcaccagcgg cacccagtag agccagggca ccgccgaggg cgtgggcaac 240
ccctaa 246
<210> SEQ ID NO 108
<211> LENGTH: 248
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: RevExon2_TV2_C_ZAwt
<400> SEQUENCE: 108
acccttatcc caaacccgag gggacccgac aggctcggag gaatcgaaga agaaggtgga 60
gagcaagaca gcagcagatc cattcgatta gtgagcggat tcttgacact tgcctgggac 120
gacctacgaa gcctgtgcct cttctgctac caccgattga gagacttcat attaattgta 180
gtgagagcag tggaacttct gggacacagt agtctcaggg gactgcagag ggggtgggga 240
acccttaa 248
<210> SEQ ID NO 109
<211> LENGTH: 216
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: TatExon1_TV2_C_ZAopt
<400> SEQUENCE: 109
atggagccca tcgaccccaa cctggagccc tggaaccacc ccggcagcca gcccaagacc 60
gcctgcaacg gctgctactg caagcgctgc agctaccact gcctggtgtg cttccagaag 120
aagggcctgg gcatctacta cggccgcaag aagcgccgcc agcgccgcag cgcccccccc 180
agcaacaagg accaccagga ccccctgccc aagcag 216
<210> SEQ ID NO 110
<211> LENGTH: 216
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: TatExon1_TV2_C_ZAwt
<400> SEQUENCE: 110
atggagccaa tagatcctaa cctagaaccc tggaaccatc caggaagtca gcctaaaact 60
gcttgtaatg ggtgttactg taaacgttgc agctatcatt gtctagtttg ctttcagaaa 120
aaaggcttag gcatttacta tggcaggaag aagcggagac agcgacgaag cgctcctcca 180
agcaataaag atcatcaaga tcctctacca aagcag 216
<210> SEQ ID NO 111
<211> LENGTH: 90
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: TatExon2_TV2_C_ZAopt
<400> SEQUENCE: 111
cccctgagcc agacccgcgg cgaccccacc ggcagcgagg agagcaagaa gaaggtggag 60
agcaagaccg ccgccgaccc cttcgactag 90
<210> SEQ ID NO 112
<211> LENGTH: 90
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: TatExon2_TV2_C_ZAwt
<400> SEQUENCE: 112
cccttatccc aaacccgagg ggacccgaca ggctcggagg aatcgaagaa gaaggtggag 60
agcaagacag cagcagatcc attcgattag 90
<210> SEQ ID NO 113
<211> LENGTH: 579
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Vif_TV2_C_ZAopt
<400> SEQUENCE: 113
atggagaacc gctggcaggt gctgatcgtg tggcaggtgg accgcatgaa gatccgcacc 60
tggcacagcc tggtgaagca ccacatgtac gtgagccgcc gcgccgacgg ctggttctac 120
cgccaccact acgagagccg ccaccccaag gtgagcagcg aggtgcacat ccccctgggc 180
gacgcccgcc tggtgatcaa gacctactgg ggcctgcaga ccggcgagcg cgcctggcac 240
ctgggccacg gcgtgagcat cgagtggcgc ctgcgccgct acagcaccca ggtggacccc 300
gacctgaccg accagctgat ccacatgcac tacttcgact gcttcgccga gagcgccatc 360
cgcaaggcca tcctgggcca gatcgtgagc cccaagtgcg actaccaggc cggccacaac 420
aaggtgggca gcctgcagta cctggccctg accgccctga tcaagcccaa gaagatcaag 480
ccccccctgc ccagcgtgcg caagctggtg gaggaccgct ggaacaagcc ccagaagacc 540
cgcggccgcc gcggcaacca caccatgaac ggccactag 579
<210> SEQ ID NO 114
<211> LENGTH: 579
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Vif_TV2_C_ZAwt
<400> SEQUENCE: 114
atggaaaaca gatggcaggt gctgattgtg tggcaggtag acaggatgaa gattagaaca 60
tggcacagtt tagtaaagca ccatatgtat gtttcgagga gagctgatgg atggttctac 120
agacatcatt atgaaagcag acacccaaaa gtaagttcag aagtacacat cccattagga 180
gatgccaggt tagtaataaa aacatattgg ggtctgcaga caggagaaag agcttggcat 240
ttgggtcacg gagtctccat agaatggaga ttgagaagat atagcacaca agtagaccct 300
gacctgacag accaactaat tcatatgcat tattttgatt gttttgcaga atctgccata 360
aggaaagcca tactaggaca gatagttagc cctaagtgtg actatcaagc aggacataac 420
aaggtaggat ctctacaata cttggcactg acagcattga taaaaccaaa aaagataaag 480
ccacctctgc ctagtgttag gaaattagta gaggatagat ggaacaagcc ccagaagacc 540
aggggccgca gagggaacca tacaatgaat ggacactag 579
<210> SEQ ID NO 115
<211> LENGTH: 288
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Vpr_TV2_C_ZAopt
<400> SEQUENCE: 115
atggagcagg cccccgagga ccagggcccc cagcgcgagc cctacaacga gtggaccctg 60
gagctgctgg aggagctgaa gcaggaggcc gtgcgccact tcccccgccc ctggctgcac 120
aacctgggcc agcacatcta cgagacctac ggcgacacct ggaccggcgt ggaggccatc 180
atccgcatcc tgcagcagct gctgttcatc cacttccgca tcggctgcca ccacagccgc 240
atcggcatcc tgcgccagcg ccgcgcccgc aacggcgcca accgcagc 288
<210> SEQ ID NO 116
<211> LENGTH: 288
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Vpr_TV2_C_ZAwt
<400> SEQUENCE: 116
atggaacaag ccccagaaga ccaggggccg cagagggaac catacaatga atggacacta 60
gagcttttag aagaactcaa gcaggaagct gtcagacact ttcctagacc atggctccat 120
aacttaggac aacatatcta tgaaacctat ggagatactt ggacaggagt tgaagcaata 180
ataagaatcc tgcaacaatt actgtttatt catttcagga ttgggtgcca tcatagcaga 240
ataggcattt tgcgacagag aagagcaaga aatggagcca atagatcc 288
<210> SEQ ID NO 117
<211> LENGTH: 261
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Vpu_TV2_C_ZAopt
<400> SEQUENCE: 117
atgctggacc tgaccgcccg catcgacagc cgcctgggca tcggcgccct gatcgtggcc 60
ctgatcatcg ccatcatcgt gtggaccatc gtgtacatcg agtaccgcaa gctggtgcgc 120
cagcgcaaga tcgactggct ggtgaagcgc atccgcgagc gcgccgagga cagcggcaac 180
gagagcgagg gcgacaccga ggagctgagc accctggtgg acatgggcca cctgcgcctg 240
ctggacgcca acgacgtgta a 261
<210> SEQ ID NO 118
<211> LENGTH: 261
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Vpu_TV2_C_ZAwt
<400> SEQUENCE: 118
atgttagatt taactgcaag aatagattct agattaggaa taggagcatt gatagtagca 60
ctaatcatag caataatagt gtggaccata gtatatatag aatataggaa attggtaagg 120
caaaggaaaa tagactggtt agttaaaagg attagggaaa gagcagaaga cagtggcaat 180
gagagcgagg gggatactga agaattatcg acactggtgg atatggggca tcttaggctt 240
ttggatgcta atgatgtgta a 261
<210> SEQ ID NO 119
<211> LENGTH: 1473
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: gp120mod.TV1.delV2
<400> SEQUENCE: 119
gaattcatgc gcgtgatggg cacccagaag aactgccagc agtggtggat ctggggcatc 60
ctgggcttct ggatgctgat gatctgcaac accgaggacc tgtgggtgac cgtgtactac 120
ggcgtgcccg tgtggcgcga cgccaagacc accctgttct gcgccagcga cgccaaggcc 180
tacgagaccg aggtgcacaa cgtgtgggcc acccacgcct gcgtgcccac cgaccccaac 240
ccccaggaga tcgtgctggg caacgtgacc gagaacttca acatgtggaa gaacgacatg 300
gccgaccaga tgcacgagga cgtgatcagc ctgtgggacc agagcctgaa gccctgcgtg 360
aagctgaccc ccctgtgcgt gaccctgaac tgcaccgaca ccaacgtgac cggcaaccgc 420
accgtgaccg gcaacagcac caacaacacc aacggcaccg gcatctacaa catcgaggag 480
atgaagaact gcagcttcaa cgccggcgcc ggccgcctga tcaactgcaa caccagcacc 540
atcacccagg cctgccccaa ggtgagcttc gaccccatcc ccatccacta ctgcgccccc 600
gccggctacg ccatcctgaa gtgcaacaac aagaccttca acggcaccgg cccctgctac 660
aacgtgagca ccgtgcagtg cacccacggc atcaagcccg tggtgagcac ccagctgctg 720
ctgaacggca gcctggccga ggagggcatc atcatccgca gcgagaacct gaccgagaac 780
accaagacca tcatcgtgca cctgaacgag agcgtggaga tcaactgcac ccgccccaac 840
aacaacaccc gcaagagcgt gcgcatcggc cccggccagg ccttctacgc caccaacgac 900
gtgatcggca acatccgcca ggcccactgc aacatcagca ccgaccgctg gaacaagacc 960
ctgcagcagg tgatgaagaa gctgggcgag cacttcccca acaagaccat ccagttcaag 1020
ccccacgccg gcggcgacct ggagatcacc atgcacagct tcaactgccg cggcgagttc 1080
ttctactgca acaccagcaa cctgttcaac agcacctacc acagcaacaa cggcacctac 1140
aagtacaacg gcaacagcag cagccccatc accctgcagt gcaagatcaa gcagatcgtg 1200
cgcatgtggc agggcgtggg ccaggccacc tacgcccccc ccatcgccgg caacatcacc 1260
tgccgcagca acatcaccgg catcctgctg acccgcgacg gcggcttcaa caccaccaac 1320
aacaccgaga ccttccgccc cggcggcggc gacatgcgcg acaactggcg cagcgagctg 1380
tacaagtaca aggtggtgga gatcaagccc ctgggcatcg cccccaccaa ggccaagcgc 1440
cgcgtggtgc agcgcgagaa gcgctaactc gag 1473
<210> SEQ ID NO 120
<211> LENGTH: 1986
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: gp140mod.TV1.delV2
<400> SEQUENCE: 120
gaattcatgc gcgtgatggg cacccagaag aactgccagc agtggtggat ctggggcatc 60
ctgggcttct ggatgctgat gatctgcaac accgaggacc tgtgggtgac cgtgtactac 120
ggcgtgcccg tgtggcgcga cgccaagacc accctgttct gcgccagcga cgccaaggcc 180
tacgagaccg aggtgcacaa cgtgtgggcc acccacgcct gcgtgcccac cgaccccaac 240
ccccaggaga tcgtgctggg caacgtgacc gagaacttca acatgtggaa gaacgacatg 300
gccgaccaga tgcacgagga cgtgatcagc ctgtgggacc agagcctgaa gccctgcgtg 360
aagctgaccc ccctgtgcgt gaccctgaac tgcaccgaca ccaacgtgac cggcaaccgc 420
accgtgaccg gcaacagcac caacaacacc aacggcaccg gcatctacaa catcgaggag 480
atgaagaact gcagcttcaa cgccggcgcc ggccgcctga tcaactgcaa caccagcacc 540
atcacccagg cctgccccaa ggtgagcttc gaccccatcc ccatccacta ctgcgccccc 600
gccggctacg ccatcctgaa gtgcaacaac aagaccttca acggcaccgg cccctgctac 660
aacgtgagca ccgtgcagtg cacccacggc atcaagcccg tggtgagcac ccagctgctg 720
ctgaacggca gcctggccga ggagggcatc atcatccgca gcgagaacct gaccgagaac 780
accaagacca tcatcgtgca cctgaacgag agcgtggaga tcaactgcac ccgccccaac 840
aacaacaccc gcaagagcgt gcgcatcggc cccggccagg ccttctacgc caccaacgac 900
gtgatcggca acatccgcca ggcccactgc aacatcagca ccgaccgctg gaacaagacc 960
ctgcagcagg tgatgaagaa gctgggcgag cacttcccca acaagaccat ccagttcaag 1020
ccccacgccg gcggcgacct ggagatcacc atgcacagct tcaactgccg cggcgagttc 1080
ttctactgca acaccagcaa cctgttcaac agcacctacc acagcaacaa cggcacctac 1140
aagtacaacg gcaacagcag cagccccatc accctgcagt gcaagatcaa gcagatcgtg 1200
cgcatgtggc agggcgtggg ccaggccacc tacgcccccc ccatcgccgg caacatcacc 1260
tgccgcagca acatcaccgg catcctgctg acccgcgacg gcggcttcaa caccaccaac 1320
aacaccgaga ccttccgccc cggcggcggc gacatgcgcg acaactggcg cagcgagctg 1380
tacaagtaca aggtggtgga gatcaagccc ctgggcatcg cccccaccaa ggccaagcgc 1440
cgcgtggtgc agcgcgagaa gcgcgccgtg ggcatcggcg ccgtgttcct gggcttcctg 1500
ggcgccgccg gcagcaccat gggcgccgcc agcatcaccc tgaccgtgca ggcccgccag 1560
ctgctgagcg gcatcgtgca gcagcagagc aacctgctga aggccatcga ggcccagcag 1620
cacatgctgc agctgaccgt gtggggcatc aagcagctgc aggcccgcgt gctggccatc 1680
gagcgctacc tgaaggacca gcagctgctg ggcatctggg gctgcagcgg ccgcctgatc 1740
tgcaccaccg ccgtgccctg gaacagcagc tggagcaaca agagcgagaa ggacatctgg 1800
gacaacatga cctggatgca gtgggaccgc gagatcagca actacaccgg cctgatctac 1860
aacctgctgg aggacagcca gaaccagcag gagaagaacg agaaggacct gctggagctg 1920
gacaagtgga acaacctgtg gaactggttc gacatcagca actggccctg gtacatctaa 1980
ctcgag 1986
<210> SEQ ID NO 121
<211> LENGTH: 1986
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: gp140mod.TV1.mut7.delV2
<400> SEQUENCE: 121
gaattcatgc gcgtgatggg cacccagaag aactgccagc agtggtggat ctggggcatc 60
ctgggcttct ggatgctgat gatctgcaac accgaggacc tgtgggtgac cgtgtactac 120
ggcgtgcccg tgtggcgcga cgccaagacc accctgttct gcgccagcga cgccaaggcc 180
tacgagaccg aggtgcacaa cgtgtgggcc acccacgcct gcgtgcccac cgaccccaac 240
ccccaggaga tcgtgctggg caacgtgacc gagaacttca acatgtggaa gaacgacatg 300
gccgaccaga tgcacgagga cgtgatcagc ctgtgggacc agagcctgaa gccctgcgtg 360
aagctgaccc ccctgtgcgt gaccctgaac tgcaccgaca ccaacgtgac cggcaaccgc 420
accgtgaccg gcaacagcac caacaacacc aacggcaccg gcatctacaa catcgaggag 480
atgaagaact gcagcttcaa cgccggcgcc ggccgcctga tcaactgcaa caccagcacc 540
atcacccagg cctgccccaa ggtgagcttc gaccccatcc ccatccacta ctgcgccccc 600
gccggctacg ccatcctgaa gtgcaacaac aagaccttca acggcaccgg cccctgctac 660
aacgtgagca ccgtgcagtg cacccacggc atcaagcccg tggtgagcac ccagctgctg 720
ctgaacggca gcctggccga ggagggcatc atcatccgca gcgagaacct gaccgagaac 780
accaagacca tcatcgtgca cctgaacgag agcgtggaga tcaactgcac ccgccccaac 840
aacaacaccc gcaagagcgt gcgcatcggc cccggccagg ccttctacgc caccaacgac 900
gtgatcggca acatccgcca ggcccactgc aacatcagca ccgaccgctg gaacaagacc 960
ctgcagcagg tgatgaagaa gctgggcgag cacttcccca acaagaccat ccagttcaag 1020
ccccacgccg gcggcgacct ggagatcacc atgcacagct tcaactgccg cggcgagttc 1080
ttctactgca acaccagcaa cctgttcaac agcacctacc acagcaacaa cggcacctac 1140
aagtacaacg gcaacagcag cagccccatc accctgcagt gcaagatcaa gcagatcgtg 1200
cgcatgtggc agggcgtggg ccaggccacc tacgcccccc ccatcgccgg caacatcacc 1260
tgccgcagca acatcaccgg catcctgctg acccgcgacg gcggcttcaa caccaccaac 1320
aacaccgaga ccttccgccc cggcggcggc gacatgcgcg acaactggcg cagcgagctg 1380
tacaagtaca aggtggtgga gatcaagccc ctgggcatcg cccccaccaa ggccatcagc 1440
agcgtggtgc agagcgagaa gagcgccgtg ggcatcggcg ccgtgttcct gggcttcctg 1500
ggcgccgccg gcagcaccat gggcgccgcc agcatcaccc tgaccgtgca ggcccgccag 1560
ctgctgagcg gcatcgtgca gcagcagagc aacctgctga aggccatcga ggcccagcag 1620
cacatgctgc agctgaccgt gtggggcatc aagcagctgc aggcccgcgt gctggccatc 1680
gagcgctacc tgaaggacca gcagctgctg ggcatctggg gctgcagcgg ccgcctgatc 1740
tgcaccaccg ccgtgccctg gaacagcagc tggagcaaca agagcgagaa ggacatctgg 1800
gacaacatga cctggatgca gtgggaccgc gagatcagca actacaccgg cctgatctac 1860
aacctgctgg aggacagcca gaaccagcag gagaagaacg agaaggacct gctggagctg 1920
gacaagtgga acaacctgtg gaactggttc gacatcagca actggccctg gtacatctaa 1980
ctcgag 1986
<210> SEQ ID NO 122
<211> LENGTH: 2397
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: gp160mod.TV1.delV1V2
<400> SEQUENCE: 122
gaattcatgc gcgtgatggg cacccagaag aactgccagc agtggtggat ctggggcatc 60
ctgggcttct ggatgctgat gatctgcaac accgaggacc tgtgggtgac cgtgtactac 120
ggcgtgcccg tgtggcgcga cgccaagacc accctgttct gcgccagcga cgccaaggcc 180
tacgagaccg aggtgcacaa cgtgtgggcc acccacgcct gcgtgcccac cgaccccaac 240
ccccaggaga tcgtgctggg caacgtgacc gagaacttca acatgtggaa gaacgacatg 300
gccgaccaga tgcacgagga cgtgatcagc ctgtgggacc agagcctgaa gccctgcgtg 360
aagctgaccc ccctgtgcgt gggcgccggc aactgcaaca ccagcaccat cacccaggcc 420
tgccccaagg tgagcttcga ccccatcccc atccactact gcgcccccgc cggctacgcc 480
atcctgaagt gcaacaacaa gaccttcaac ggcaccggcc cctgctacaa cgtgagcacc 540
gtgcagtgca cccacggcat caagcccgtg gtgagcaccc agctgctgct gaacggcagc 600
ctggccgagg agggcatcat catccgcagc gagaacctga ccgagaacac caagaccatc 660
atcgtgcacc tgaacgagag cgtggagatc aactgcaccc gccccaacaa caacacccgc 720
aagagcgtgc gcatcggccc cggccaggcc ttctacgcca ccaacgacgt gatcggcaac 780
atccgccagg cccactgcaa catcagcacc gaccgctgga acaagaccct gcagcaggtg 840
atgaagaagc tgggcgagca cttccccaac aagaccatcc agttcaagcc ccacgccggc 900
ggcgacctgg agatcaccat gcacagcttc aactgccgcg gcgagttctt ctactgcaac 960
accagcaacc tgttcaacag cacctaccac agcaacaacg gcacctacaa gtacaacggc 1020
aacagcagca gccccatcac cctgcagtgc aagatcaagc agatcgtgcg catgtggcag 1080
ggcgtgggcc aggccaccta cgcccccccc atcgccggca acatcacctg ccgcagcaac 1140
atcaccggca tcctgctgac ccgcgacggc ggcttcaaca ccaccaacaa caccgagacc 1200
ttccgccccg gcggcggcga catgcgcgac aactggcgca gcgagctgta caagtacaag 1260
gtggtggaga tcaagcccct gggcatcgcc cccaccaagg ccaagcgccg cgtggtgcag 1320
cgcgagaagc gcgccgtggg catcggcgcc gtgttcctgg gcttcctggg cgccgccggc 1380
agcaccatgg gcgccgccag catcaccctg accgtgcagg cccgccagct gctgagcggc 1440
atcgtgcagc agcagagcaa cctgctgaag gccatcgagg cccagcagca catgctgcag 1500
ctgaccgtgt ggggcatcaa gcagctgcag gcccgcgtgc tggccatcga gcgctacctg 1560
aaggaccagc agctgctggg catctggggc tgcagcggcc gcctgatctg caccaccgcc 1620
gtgccctgga acagcagctg gagcaacaag agcgagaagg acatctggga caacatgacc 1680
tggatgcagt gggaccgcga gatcagcaac tacaccggcc tgatctacaa cctgctggag 1740
gacagccaga accagcagga gaagaacgag aaggacctgc tggagctgga caagtggaac 1800
aacctgtgga actggttcga catcagcaac tggccctggt acatcaagat cttcatcatg 1860
atcgtgggcg gcctgatcgg cctgcgcatc atcttcgccg tgctgagcat cgtgaaccgc 1920
gtgcgccagg gctacagccc cctgagcttc cagaccctga cccccagccc ccgcggcctg 1980
gaccgcctgg gcggcatcga ggaggagggc ggcgagcagg accgcgaccg cagcatccgc 2040
ctggtgagcg gcttcctgag cctggcctgg gacgacctgc gcaacctgtg cctgttcagc 2100
taccaccgcc tgcgcgactt catcctgatc gccgtgcgcg ccgtggagct gctgggccac 2160
agcagcctgc gcggcctgca gcgcggctgg gagatcctga agtacctggg cagcctggtg 2220
cagtactggg gcctggagct gaagaagagc gccatcagcc tgctggacac catcgccatc 2280
accgtggccg agggcaccga ccgcatcatc gagctggtgc agcgcatctg ccgcgccatc 2340
ctgaacatcc cccgccgcat ccgccagggc ttcgaggccg ccctgctgta actcgag 2397
<210> SEQ ID NO 123
<211> LENGTH: 2529
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: gp160mod.TV1.delV2
<400> SEQUENCE: 123
gaattcatgc gcgtgatggg cacccagaag aactgccagc agtggtggat ctggggcatc 60
ctgggcttct ggatgctgat gatctgcaac accgaggacc tgtgggtgac cgtgtactac 120
ggcgtgcccg tgtggcgcga cgccaagacc accctgttct gcgccagcga cgccaaggcc 180
tacgagaccg aggtgcacaa cgtgtgggcc acccacgcct gcgtgcccac cgaccccaac 240
ccccaggaga tcgtgctggg caacgtgacc gagaacttca acatgtggaa gaacgacatg 300
gccgaccaga tgcacgagga cgtgatcagc ctgtgggacc agagcctgaa gccctgcgtg 360
aagctgaccc ccctgtgcgt gaccctgaac tgcaccgaca ccaacgtgac cggcaaccgc 420
accgtgaccg gcaacagcac caacaacacc aacggcaccg gcatctacaa catcgaggag 480
atgaagaact gcagcttcaa cgccggcgcc ggccgcctga tcaactgcaa caccagcacc 540
atcacccagg cctgccccaa ggtgagcttc gaccccatcc ccatccacta ctgcgccccc 600
gccggctacg ccatcctgaa gtgcaacaac aagaccttca acggcaccgg cccctgctac 660
aacgtgagca ccgtgcagtg cacccacggc atcaagcccg tggtgagcac ccagctgctg 720
ctgaacggca gcctggccga ggagggcatc atcatccgca gcgagaacct gaccgagaac 780
accaagacca tcatcgtgca cctgaacgag agcgtggaga tcaactgcac ccgccccaac 840
aacaacaccc gcaagagcgt gcgcatcggc cccggccagg ccttctacgc caccaacgac 900
gtgatcggca acatccgcca ggcccactgc aacatcagca ccgaccgctg gaacaagacc 960
ctgcagcagg tgatgaagaa gctgggcgag cacttcccca acaagaccat ccagttcaag 1020
ccccacgccg gcggcgacct ggagatcacc atgcacagct tcaactgccg cggcgagttc 1080
ttctactgca acaccagcaa cctgttcaac agcacctacc acagcaacaa cggcacctac 1140
aagtacaacg gcaacagcag cagccccatc accctgcagt gcaagatcaa gcagatcgtg 1200
cgcatgtggc agggcgtggg ccaggccacc tacgcccccc ccatcgccgg caacatcacc 1260
tgccgcagca acatcaccgg catcctgctg acccgcgacg gcggcttcaa caccaccaac 1320
aacaccgaga ccttccgccc cggcggcggc gacatgcgcg acaactggcg cagcgagctg 1380
tacaagtaca aggtggtgga gatcaagccc ctgggcatcg cccccaccaa ggccaagcgc 1440
cgcgtggtgc agcgcgagaa gcgcgccgtg ggcatcggcg ccgtgttcct gggcttcctg 1500
ggcgccgccg gcagcaccat gggcgccgcc agcatcaccc tgaccgtgca ggcccgccag 1560
ctgctgagcg gcatcgtgca gcagcagagc aacctgctga aggccatcga ggcccagcag 1620
cacatgctgc agctgaccgt gtggggcatc aagcagctgc aggcccgcgt gctggccatc 1680
gagcgctacc tgaaggacca gcagctgctg ggcatctggg gctgcagcgg ccgcctgatc 1740
tgcaccaccg ccgtgccctg gaacagcagc tggagcaaca agagcgagaa ggacatctgg 1800
gacaacatga cctggatgca gtgggaccgc gagatcagca actacaccgg cctgatctac 1860
aacctgctgg aggacagcca gaaccagcag gagaagaacg agaaggacct gctggagctg 1920
gacaagtgga acaacctgtg gaactggttc gacatcagca actggccctg gtacatcaag 1980
atcttcatca tgatcgtggg cggcctgatc ggcctgcgca tcatcttcgc cgtgctgagc 2040
atcgtgaacc gcgtgcgcca gggctacagc cccctgagct tccagaccct gacccccagc 2100
ccccgcggcc tggaccgcct gggcggcatc gaggaggagg gcggcgagca ggaccgcgac 2160
cgcagcatcc gcctggtgag cggcttcctg agcctggcct gggacgacct gcgcaacctg 2220
tgcctgttca gctaccaccg cctgcgcgac ttcatcctga tcgccgtgcg cgccgtggag 2280
ctgctgggcc acagcagcct gcgcggcctg cagcgcggct gggagatcct gaagtacctg 2340
ggcagcctgg tgcagtactg gggcctggag ctgaagaaga gcgccatcag cctgctggac 2400
accatcgcca tcaccgtggc cgagggcacc gaccgcatca tcgagctggt gcagcgcatc 2460
tgccgcgcca tcctgaacat cccccgccgc atccgccagg gcttcgaggc cgccctgctg 2520
taactcgag 2529
<210> SEQ ID NO 124
<211> LENGTH: 2529
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: gp160mod.TV1.mut7.delV2
<400> SEQUENCE: 124
gaattcatgc gcgtgatggg cacccagaag aactgccagc agtggtggat ctggggcatc 60
ctgggcttct ggatgctgat gatctgcaac accgaggacc tgtgggtgac cgtgtactac 120
ggcgtgcccg tgtggcgcga cgccaagacc accctgttct gcgccagcga cgccaaggcc 180
tacgagaccg aggtgcacaa cgtgtgggcc acccacgcct gcgtgcccac cgaccccaac 240
ccccaggaga tcgtgctggg caacgtgacc gagaacttca acatgtggaa gaacgacatg 300
gccgaccaga tgcacgagga cgtgatcagc ctgtgggacc agagcctgaa gccctgcgtg 360
aagctgaccc ccctgtgcgt gaccctgaac tgcaccgaca ccaacgtgac cggcaaccgc 420
accgtgaccg gcaacagcac caacaacacc aacggcaccg gcatctacaa catcgaggag 480
atgaagaact gcagcttcaa cgccggcgcc ggccgcctga tcaactgcaa caccagcacc 540
atcacccagg cctgccccaa ggtgagcttc gaccccatcc ccatccacta ctgcgccccc 600
gccggctacg ccatcctgaa gtgcaacaac aagaccttca acggcaccgg cccctgctac 660
aacgtgagca ccgtgcagtg cacccacggc atcaagcccg tggtgagcac ccagctgctg 720
ctgaacggca gcctggccga ggagggcatc atcatccgca gcgagaacct gaccgagaac 780
accaagacca tcatcgtgca cctgaacgag agcgtggaga tcaactgcac ccgccccaac 840
aacaacaccc gcaagagcgt gcgcatcggc cccggccagg ccttctacgc caccaacgac 900
gtgatcggca acatccgcca ggcccactgc aacatcagca ccgaccgctg gaacaagacc 960
ctgcagcagg tgatgaagaa gctgggcgag cacttcccca acaagaccat ccagttcaag 1020
ccccacgccg gcggcgacct ggagatcacc atgcacagct tcaactgccg cggcgagttc 1080
ttctactgca acaccagcaa cctgttcaac agcacctacc acagcaacaa cggcacctac 1140
aagtacaacg gcaacagcag cagccccatc accctgcagt gcaagatcaa gcagatcgtg 1200
cgcatgtggc agggcgtggg ccaggccacc tacgcccccc ccatcgccgg caacatcacc 1260
tgccgcagca acatcaccgg catcctgctg acccgcgacg gcggcttcaa caccaccaac 1320
aacaccgaga ccttccgccc cggcggcggc gacatgcgcg acaactggcg cagcgagctg 1380
tacaagtaca aggtggtgga gatcaagccc ctgggcatcg cccccaccaa ggccatcagc 1440
agcgtggtgc agagcgagaa gagcgccgtg ggcatcggcg ccgtgttcct gggcttcctg 1500
ggcgccgccg gcagcaccat gggcgccgcc agcatcaccc tgaccgtgca ggcccgccag 1560
ctgctgagcg gcatcgtgca gcagcagagc aacctgctga aggccatcga ggcccagcag 1620
cacatgctgc agctgaccgt gtggggcatc aagcagctgc aggcccgcgt gctggccatc 1680
gagcgctacc tgaaggacca gcagctgctg ggcatctggg gctgcagcgg ccgcctgatc 1740
tgcaccaccg ccgtgccctg gaacagcagc tggagcaaca agagcgagaa ggacatctgg 1800
gacaacatga cctggatgca gtgggaccgc gagatcagca actacaccgg cctgatctac 1860
aacctgctgg aggacagcca gaaccagcag gagaagaacg agaaggacct gctggagctg 1920
gacaagtgga acaacctgtg gaactggttc gacatcagca actggccctg gtacatcaag 1980
atcttcatca tgatcgtggg cggcctgatc ggcctgcgca tcatcttcgc cgtgctgagc 2040
atcgtgaacc gcgtgcgcca gggctacagc cccctgagct tccagaccct gacccccagc 2100
ccccgcggcc tggaccgcct gggcggcatc gaggaggagg gcggcgagca ggaccgcgac 2160
cgcagcatcc gcctggtgag cggcttcctg agcctggcct gggacgacct gcgcaacctg 2220
tgcctgttca gctaccaccg cctgcgcgac ttcatcctga tcgccgtgcg cgccgtggag 2280
ctgctgggcc acagcagcct gcgcggcctg cagcgcggct gggagatcct gaagtacctg 2340
ggcagcctgg tgcagtactg gggcctggag ctgaagaaga gcgccatcag cctgctggac 2400
accatcgcca tcaccgtggc cgagggcacc gaccgcatca tcgagctggt gcagcgcatc 2460
tgccgcgcca tcctgaacat cccccgccgc atccgccagg gcttcgaggc cgccctgctg 2520
taactcgag 2529
<210> SEQ ID NO 125
<211> LENGTH: 2613
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: gp160mod.TV1.tpa1
<400> SEQUENCE: 125
gtcgacgcca ccatggatgc aatgaagaga gggctctgct gtgtgctgct gctgtgtgga 60
gcagtcttcg tttcgcccag cgccagcacc gaggacctgt gggtgaccgt gtactacggc 120
gtgcccgtgt ggcgcgacgc caagaccacc ctgttctgcg ccagcgacgc caaggcctac 180
gagaccgagg tgcacaacgt gtgggccacc cacgcctgcg tgcccaccga ccccaacccc 240
caggagatcg tgctgggcaa cgtgaccgag aacttcaaca tgtggaagaa cgacatggcc 300
gaccagatgc acgaggacgt gatcagcctg tgggaccaga gcctgaagcc ctgcgtgaag 360
ctgacccccc tgtgcgtgac cctgaactgc accgacacca acgtgaccgg caaccgcacc 420
gtgaccggca acagcaccaa caacaccaac ggcaccggca tctacaacat cgaggagatg 480
aagaactgca gcttcaacgc caccaccgag ctgcgcgaca agaagcacaa ggagtacgcc 540
ctgttctacc gcctggacat cgtgcccctg aacgagaaca gcgacaactt cacctaccgc 600
ctgatcaact gcaacaccag caccatcacc caggcctgcc ccaaggtgag cttcgacccc 660
atccccatcc actactgcgc ccccgccggc tacgccatcc tgaagtgcaa caacaagacc 720
ttcaacggca ccggcccctg ctacaacgtg agcaccgtgc agtgcaccca cggcatcaag 780
cccgtggtga gcacccagct gctgctgaac ggcagcctgg ccgaggaggg catcatcatc 840
cgcagcgaga acctgaccga gaacaccaag accatcatcg tgcacctgaa cgagagcgtg 900
gagatcaact gcacccgccc caacaacaac acccgcaaga gcgtgcgcat cggccccggc 960
caggccttct acgccaccaa cgacgtgatc ggcaacatcc gccaggccca ctgcaacatc 1020
agcaccgacc gctggaacaa gaccctgcag caggtgatga agaagctggg cgagcacttc 1080
cccaacaaga ccatccagtt caagccccac gccggcggcg acctggagat caccatgcac 1140
agcttcaact gccgcggcga gttcttctac tgcaacacca gcaacctgtt caacagcacc 1200
taccacagca acaacggcac ctacaagtac aacggcaaca gcagcagccc catcaccctg 1260
cagtgcaaga tcaagcagat cgtgcgcatg tggcagggcg tgggccaggc cacctacgcc 1320
ccccccatcg ccggcaacat cacctgccgc agcaacatca ccggcatcct gctgacccgc 1380
gacggcggct tcaacaccac caacaacacc gagaccttcc gccccggcgg cggcgacatg 1440
cgcgacaact ggcgcagcga gctgtacaag tacaaggtgg tggagatcaa gcccctgggc 1500
atcgccccca ccaaggccaa gcgccgcgtg gtgcagcgcg agaagcgcgc cgtgggcatc 1560
ggcgccgtgt tcctgggctt cctgggcgcc gccggcagca ccatgggcgc cgccagcatc 1620
accctgaccg tgcaggcccg ccagctgctg agcggcatcg tgcagcagca gagcaacctg 1680
ctgaaggcca tcgaggccca gcagcacatg ctgcagctga ccgtgtgggg catcaagcag 1740
ctgcaggccc gcgtgctggc catcgagcgc tacctgaagg accagcagct gctgggcatc 1800
tggggctgca gcggccgcct gatctgcacc accgccgtgc cctggaacag cagctggagc 1860
aacaagagcg agaaggacat ctgggacaac atgacctgga tgcagtggga ccgcgagatc 1920
agcaactaca ccggcctgat ctacaacctg ctggaggaca gccagaacca gcaggagaag 1980
aacgagaagg acctgctgga gctggacaag tggaacaacc tgtggaactg gttcgacatc 2040
agcaactggc cctggtacat caagatcttc atcatgatcg tgggcggcct gatcggcctg 2100
cgcatcatct tcgccgtgct gagcatcgtg aaccgcgtgc gccagggcta cagccccctg 2160
agcttccaga ccctgacccc cagcccccgc ggcctggacc gcctgggcgg catcgaggag 2220
gagggcggcg agcaggaccg cgaccgcagc atccgcctgg tgagcggctt cctgagcctg 2280
gcctgggacg acctgcgcaa cctgtgcctg ttcagctacc accgcctgcg cgacttcatc 2340
ctgatcgccg tgcgcgccgt ggagctgctg ggccacagca gcctgcgcgg cctgcagcgc 2400
ggctgggaga tcctgaagta cctgggcagc ctggtgcagt actggggcct ggagctgaag 2460
aagagcgcca tcagcctgct ggacaccatc gccatcaccg tggccgaggg caccgaccgc 2520
atcatcgagc tggtgcagcg catctgccgc gccatcctga acatcccccg ccgcatccgc 2580
cagggcttcg aggccgccct gctgtaactc gag 2613
<210> SEQ ID NO 126
<211> LENGTH: 2616
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: gp160mod.TV1
<400> SEQUENCE: 126
gaattcatgc gcgtgatggg cacccagaag aactgccagc agtggtggat ctggggcatc 60
ctgggcttct ggatgctgat gatctgcaac accgaggacc tgtgggtgac cgtgtactac 120
ggcgtgcccg tgtggcgcga cgccaagacc accctgttct gcgccagcga cgccaaggcc 180
tacgagaccg aggtgcacaa cgtgtgggcc acccacgcct gcgtgcccac cgaccccaac 240
ccccaggaga tcgtgctggg caacgtgacc gagaacttca acatgtggaa gaacgacatg 300
gccgaccaga tgcacgagga cgtgatcagc ctgtgggacc agagcctgaa gccctgcgtg 360
aagctgaccc ccctgtgcgt gaccctgaac tgcaccgaca ccaacgtgac cggcaaccgc 420
accgtgaccg gcaacagcac caacaacacc aacggcaccg gcatctacaa catcgaggag 480
atgaagaact gcagcttcaa cgccaccacc gagctgcgcg acaagaagca caaggagtac 540
gccctgttct accgcctgga catcgtgccc ctgaacgaga acagcgacaa cttcacctac 600
cgcctgatca actgcaacac cagcaccatc acccaggcct gccccaaggt gagcttcgac 660
cccatcccca tccactactg cgcccccgcc ggctacgcca tcctgaagtg caacaacaag 720
accttcaacg gcaccggccc ctgctacaac gtgagcaccg tgcagtgcac ccacggcatc 780
aagcccgtgg tgagcaccca gctgctgctg aacggcagcc tggccgagga gggcatcatc 840
atccgcagcg agaacctgac cgagaacacc aagaccatca tcgtgcacct gaacgagagc 900
gtggagatca actgcacccg ccccaacaac aacacccgca agagcgtgcg catcggcccc 960
ggccaggcct tctacgccac caacgacgtg atcggcaaca tccgccaggc ccactgcaac 1020
atcagcaccg accgctggaa caagaccctg cagcaggtga tgaagaagct gggcgagcac 1080
ttccccaaca agaccatcca gttcaagccc cacgccggcg gcgacctgga gatcaccatg 1140
cacagcttca actgccgcgg cgagttcttc tactgcaaca ccagcaacct gttcaacagc 1200
acctaccaca gcaacaacgg cacctacaag tacaacggca acagcagcag ccccatcacc 1260
ctgcagtgca agatcaagca gatcgtgcgc atgtggcagg gcgtgggcca ggccacctac 1320
gcccccccca tcgccggcaa catcacctgc cgcagcaaca tcaccggcat cctgctgacc 1380
cgcgacggcg gcttcaacac caccaacaac accgagacct tccgccccgg cggcggcgac 1440
atgcgcgaca actggcgcag cgagctgtac aagtacaagg tggtggagat caagcccctg 1500
ggcatcgccc ccaccaaggc caagcgccgc gtggtgcagc gcgagaagcg cgccgtgggc 1560
atcggcgccg tgttcctggg cttcctgggc gccgccggca gcaccatggg cgccgccagc 1620
atcaccctga ccgtgcaggc ccgccagctg ctgagcggca tcgtgcagca gcagagcaac 1680
ctgctgaagg ccatcgaggc ccagcagcac atgctgcagc tgaccgtgtg gggcatcaag 1740
cagctgcagg cccgcgtgct ggccatcgag cgctacctga aggaccagca gctgctgggc 1800
atctggggct gcagcggccg cctgatctgc accaccgccg tgccctggaa cagcagctgg 1860
agcaacaaga gcgagaagga catctgggac aacatgacct ggatgcagtg ggaccgcgag 1920
atcagcaact acaccggcct gatctacaac ctgctggagg acagccagaa ccagcaggag 1980
aagaacgaga aggacctgct ggagctggac aagtggaaca acctgtggaa ctggttcgac 2040
atcagcaact ggccctggta catcaagatc ttcatcatga tcgtgggcgg cctgatcggc 2100
ctgcgcatca tcttcgccgt gctgagcatc gtgaaccgcg tgcgccaggg ctacagcccc 2160
ctgagcttcc agaccctgac ccccagcccc cgcggcctgg accgcctggg cggcatcgag 2220
gaggagggcg gcgagcagga ccgcgaccgc agcatccgcc tggtgagcgg cttcctgagc 2280
ctggcctggg acgacctgcg caacctgtgc ctgttcagct accaccgcct gcgcgacttc 2340
atcctgatcg ccgtgcgcgc cgtggagctg ctgggccaca gcagcctgcg cggcctgcag 2400
cgcggctggg agatcctgaa gtacctgggc agcctggtgc agtactgggg cctggagctg 2460
aagaagagcg ccatcagcct gctggacacc atcgccatca ccgtggccga gggcaccgac 2520
cgcatcatcg agctggtgca gcgcatctgc cgcgccatcc tgaacatccc ccgccgcatc 2580
cgccagggct tcgaggccgc cctgctgtaa ctcgag 2616
<210> SEQ ID NO 127
<211> LENGTH: 2616
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: gp160mod.TV1.wtLnative
<400> SEQUENCE: 127
gaattcatga gagtgatggg gacacagaag aattgtcaac aatggtggat atggggcatc 60
ttaggcttct ggatgctaat gatttgtaac accgaggacc tgtgggtgac cgtgtactac 120
ggcgtgcccg tgtggcgcga cgccaagacc accctgttct gcgccagcga cgccaaggcc 180
tacgagaccg aggtgcacaa cgtgtgggcc acccacgcct gcgtgcccac cgaccccaac 240
ccccaggaga tcgtgctggg caacgtgacc gagaacttca acatgtggaa gaacgacatg 300
gccgaccaga tgcacgagga cgtgatcagc ctgtgggacc agagcctgaa gccctgcgtg 360
aagctgaccc ccctgtgcgt gaccctgaac tgcaccgaca ccaacgtgac cggcaaccgc 420
accgtgaccg gcaacagcac caacaacacc aacggcaccg gcatctacaa catcgaggag 480
atgaagaact gcagcttcaa cgccaccacc gagctgcgcg acaagaagca caaggagtac 540
gccctgttct accgcctgga catcgtgccc ctgaacgaga acagcgacaa cttcacctac 600
cgcctgatca actgcaacac cagcaccatc acccaggcct gccccaaggt gagcttcgac 660
cccatcccca tccactactg cgcccccgcc ggctacgcca tcctgaagtg caacaacaag 720
accttcaacg gcaccggccc ctgctacaac gtgagcaccg tgcagtgcac ccacggcatc 780
aagcccgtgg tgagcaccca gctgctgctg aacggcagcc tggccgagga gggcatcatc 840
atccgcagcg agaacctgac cgagaacacc aagaccatca tcgtgcacct gaacgagagc 900
gtggagatca actgcacccg ccccaacaac aacacccgca agagcgtgcg catcggcccc 960
ggccaggcct tctacgccac caacgacgtg atcggcaaca tccgccaggc ccactgcaac 1020
atcagcaccg accgctggaa caagaccctg cagcaggtga tgaagaagct gggcgagcac 1080
ttccccaaca agaccatcca gttcaagccc cacgccggcg gcgacctgga gatcaccatg 1140
cacagcttca actgccgcgg cgagttcttc tactgcaaca ccagcaacct gttcaacagc 1200
acctaccaca gcaacaacgg cacctacaag tacaacggca acagcagcag ccccatcacc 1260
ctgcagtgca agatcaagca gatcgtgcgc atgtggcagg gcgtgggcca ggccacctac 1320
gcccccccca tcgccggcaa catcacctgc cgcagcaaca tcaccggcat cctgctgacc 1380
cgcgacggcg gcttcaacac caccaacaac accgagacct tccgccccgg cggcggcgac 1440
atgcgcgaca actggcgcag cgagctgtac aagtacaagg tggtggagat caagcccctg 1500
ggcatcgccc ccaccaaggc caagcgccgc gtggtgcagc gcgagaagcg cgccgtgggc 1560
atcggcgccg tgttcctggg cttcctgggc gccgccggca gcaccatggg cgccgccagc 1620
atcaccctga ccgtgcaggc ccgccagctg ctgagcggca tcgtgcagca gcagagcaac 1680
ctgctgaagg ccatcgaggc ccagcagcac atgctgcagc tgaccgtgtg gggcatcaag 1740
cagctgcagg cccgcgtgct ggccatcgag cgctacctga aggaccagca gctgctgggc 1800
atctggggct gcagcggccg cctgatctgc accaccgccg tgccctggaa cagcagctgg 1860
agcaacaaga gcgagaagga catctgggac aacatgacct ggatgcagtg ggaccgcgag 1920
atcagcaact acaccggcct gatctacaac ctgctggagg acagccagaa ccagcaggag 1980
aagaacgaga aggacctgct ggagctggac aagtggaaca acctgtggaa ctggttcgac 2040
atcagcaact ggccctggta catcaagatc ttcatcatga tcgtgggcgg cctgatcggc 2100
ctgcgcatca tcttcgccgt gctgagcatc gtgaaccgcg tgcgccaggg ctacagcccc 2160
ctgagcttcc agaccctgac ccccagcccc cgcggcctgg accgcctggg cggcatcgag 2220
gaggagggcg gcgagcagga ccgcgaccgc agcatccgcc tggtgagcgg cttcctgagc 2280
ctggcctggg acgacctgcg caacctgtgc ctgttcagct accaccgcct gcgcgacttc 2340
atcctgatcg ccgtgcgcgc cgtggagctg ctgggccaca gcagcctgcg cggcctgcag 2400
cgcggctggg agatcctgaa gtacctgggc agcctggtgc agtactgggg cctggagctg 2460
aagaagagcg ccatcagcct gctggacacc atcgccatca ccgtggccga gggcaccgac 2520
cgcatcatcg agctggtgca gcgcatctgc cgcgccatcc tgaacatccc ccgccgcatc 2580
cgccagggct tcgaggccgc cctgctgtaa ctcgag 2616
<210> SEQ ID NO 128
<211> LENGTH: 2604
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Wild-type Env gp160 (8_2_ZA)
<400> SEQUENCE: 128
atgagagtga tggggacaca gaagaattgt caacaatggt ggatatgggg catcttaggc 60
ttctggatgc taatgatttg taacacggag gacttgtggg tcacagtcta ctatggggta 120
cctgtgtgga gagacgcaaa aactactcta ttctgtgcat cagatgctaa agcatatgag 180
acagaagtgc ataatgtctg ggctacacat gcctgtgtac ccacagaccc caacccacaa 240
gaaatagttt tgggaaatgt aacagaaaat tttaatatgt ggaaaaatga catggcagat 300
cagatgcatg aggatgtaat cagtttatgg gatcaaagcc taaagccatg tgtaaagttg 360
accccactct gtgtcacttt aaactgtaca gatacaaatg ttacaggtaa tagaactgtt 420
acaggtaata gtaccaataa tacaaatggt acaggtattt ataacattga agaaatgaaa 480
aattgctctt tcaatgcaac cacagaatta agagataaga aacataaaga gtatgcactc 540
ttttatagac ttgatatagt accacttaat gagaatagtg acaactttac atatagatta 600
ataaattgca atacctcaac cataacacaa gcctgtccaa aggtctcttt tgacccgatt 660
cctatacatt actgtgctcc agctggttat gcgattctaa agtgtaataa taagacattc 720
aatgggacag gaccatgtta taatgtcagc acagtacaat gtacacatgg aattaagcca 780
gtggtatcaa ctcaattact gttaaatggt agtctagcag aagaagggat aataattaga 840
tctgaaaatt tgacagagaa taccaaaaca ataatagtac accttaatga atctgtagag 900
attaattgta caagacccaa caataataca agaaaaagtg taaggatagg accaggacaa 960
gcattctatg caacaaatga tgtaatagga aacataagac aagcacattg taacattagt 1020
acagatagat ggaacaaaac tttacaacag gtaatgaaaa aattaggaga gcatttccct 1080
aataaaacaa tacaatttaa accacatgca ggaggggatc tagaaattac aatgcatagc 1140
tttaattgta gaggagaatt tttctattgt aatacatcaa acctgtttaa tagcacatac 1200
cactctaata atggtacata caaatacaat ggtaattcaa gctcacccat cacactccaa 1260
tgtaaaataa aacaaattgt acgcatgtgg caaggggtag gacaagcaac gtatgcccct 1320
cccattgcag gaaacataac atgtagatca aacatcacag gaatactatt gacacgtgat 1380
ggaggattta acaccacaaa caacacagag acattcagac ctggaggagg agatatgagg 1440
gataactgga gaagtgaatt atataaatat aaagtagtag aaattaagcc attgggaata 1500
gcacccacta aggcaaaaag aagagtggtg cagagagaaa aaagagcagt gggaatagga 1560
gctgtgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaataacg 1620
ctgacggtac aggccagaca actgttgtct ggtatagtgc aacagcaaag caatttgctg 1680
aaggctatag aggcgcaaca gcatatgttg caactcacag tctggggcat taagcagctc 1740
caggcgagag tcctggctat agaaagatac ctaaaggatc aacagctcct agggatttgg 1800
ggctgctctg gaagactcat ctgcaccact gctgtgcctt ggaactccag ttggagtaat 1860
aaatctgaaa aagatatttg ggataacatg acttggatgc agtgggatag agaaattagt 1920
aattacacag gcttaatata caatttgctt gaagactcgc aaaaccagca ggaaaagaat 1980
gaaaaagatt tattagaatt ggacaagtgg aacaatctgt ggaattggtt tgacatatca 2040
aactggccgt ggtatataaa aatattcata atgatagtag gaggcttgat aggtttaaga 2100
ataatttttg ctgtgctttc tatagtgaat agagttaggc agggatactc acctttgtca 2160
tttcagaccc ttaccccaag cccgagggga ctcgacaggc tcggaggaat cgaagaagaa 2220
ggtggagagc aagacagaga cagatccata cgattggtga gcggattctt gtcgcttgcc 2280
tgggacgatc tgcggaacct gtgcctcttc agctaccacc gcttgagaga cttcatatta 2340
attgcagtga gggcagtgga acttctggga cacagcagtc tcaggggact acagaggggg 2400
tgggaaatcc ttaagtatct gggaagtctt gtgcaatatt ggggtctaga gctaaaaaag 2460
agtgctatta gtctgcttga taccatagca ataacagtag ctgaaggaac agataggatt 2520
atagaattag tacaaagaat ttgtagagct atcctcaaca tacctagaag aataagacag 2580
ggctttgaag cagctttgct ataa 2604
<210> SEQ ID NO 129
<211> LENGTH: 10
<212> TYPE: PRT
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: wild-type amino acid sequence changed by
mutation in gp120/gp41cleavage site
<400> SEQUENCE: 129
Lys Arg Arg Val Val Gln Arg Glu Lys Arg
1 5 10
<210> SEQ ID NO 130
<211> LENGTH: 10
<212> TYPE: PRT
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: wild-type amino acid sequence changed by
mutation in gp120/gp41 cleavage site
<400> SEQUENCE: 130
Ile Ser Ser Val Val Gln Ser Glu Lys Ser
1 5 10
<210> SEQ ID NO 131
<211> LENGTH: 2052
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: gp140mod.TV1.tpa1
<400> SEQUENCE: 131
atggatgcaa tgaagagagg gctctgctgt gtgctgctgc tgtgtggagc agtcttcgtt 60
tcgcccagcg ccagcaccga ggacctgtgg gtgaccgtgt actacggcgt gcccgtgtgg 120
cgcgacgcca agaccaccct gttctgcgcc agcgacgcca aggcctacga gaccgaggtg 180
cacaacgtgt gggccaccca cgcctgcgtg cccaccgacc ccaaccccca ggagatcgtg 240
ctgggcaacg tgaccgagaa cttcaacatg tggaagaacg acatggccga ccagatgcac 300
gaggacgtga tcagcctgtg ggaccagagc ctgaagccct gcgtgaagct gacccccctg 360
tgcgtgaccc tgaactgcac cgacaccaac gtgaccggca accgcaccgt gaccggcaac 420
agcaccaaca acaccaacgg caccggcatc tacaacatcg aggagatgaa gaactgcagc 480
ttcaacgcca ccaccgagct gcgcgacaag aagcacaagg agtacgccct gttctaccgc 540
ctggacatcg tgcccctgaa cgagaacagc gacaacttca cctaccgcct gatcaactgc 600
aacaccagca ccatcaccca ggcctgcccc aaggtgagct tcgaccccat ccccatccac 660
tactgcgccc ccgccggcta cgccatcctg aagtgcaaca acaagacctt caacggcacc 720
ggcccctgct acaacgtgag caccgtgcag tgcacccacg gcatcaagcc cgtggtgagc 780
acccagctgc tgctgaacgg cagcctggcc gaggagggca tcatcatccg cagcgagaac 840
ctgaccgaga acaccaagac catcatcgtg cacctgaacg agagcgtgga gatcaactgc 900
acccgcccca acaacaacac ccgcaagagc gtgcgcatcg gccccggcca ggccttctac 960
gccaccaacg acgtgatcgg caacatccgc caggcccact gcaacatcag caccgaccgc 1020
tggaacaaga ccctgcagca ggtgatgaag aagctgggcg agcacttccc caacaagacc 1080
atccagttca agccccacgc cggcggcgac ctggagatca ccatgcacag cttcaactgc 1140
cgcggcgagt tcttctactg caacaccagc aacctgttca acagcaccta ccacagcaac 1200
aacggcacct acaagtacaa cggcaacagc agcagcccca tcaccctgca gtgcaagatc 1260
aagcagatcg tgcgcatgtg gcagggcgtg ggccaggcca cctacgcccc ccccatcgcc 1320
ggcaacatca cctgccgcag caacatcacc ggcatcctgc tgacccgcga cggcggcttc 1380
aacaccacca acaacaccga gaccttccgc cccggcggcg gcgacatgcg cgacaactgg 1440
cgcagcgagc tgtacaagta caaggtggtg gagatcaagc ccctgggcat cgcccccacc 1500
aaggccaagc gccgcgtggt gcagcgcgag aagcgcgccg tgggcatcgg cgccgtgttc 1560
ctgggcttcc tgggcgccgc cggcagcacc atgggcgccg ccagcatcac cctgaccgtg 1620
caggcccgcc agctgctgag cggcatcgtg cagcagcaga gcaacctgct gaaggccatc 1680
gaggcccagc agcacatgct gcagctgacc gtgtggggca tcaagcagct gcaggcccgc 1740
gtgctggcca tcgagcgcta cctgaaggac cagcagctgc tgggcatctg gggctgcagc 1800
ggccgcctga tctgcaccac cgccgtgccc tggaacagca gctggagcaa caagagcgag 1860
aaggacatct gggacaacat gacctggatg cagtgggacc gcgagatcag caactacacc 1920
ggcctgatct acaacctgct ggaggacagc cagaaccagc aggagaagaa cgagaaggac 1980
ctgctggagc tggacaagtg gaacaacctg tggaactggt tcgacatcag caactggccc 2040
tggtacatct aa 2052
<210> SEQ ID NO 132
<211> LENGTH: 2073
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: gp140mod.TV1
<400> SEQUENCE: 132
gaattcatgc gcgtgatggg cacccagaag aactgccagc agtggtggat ctggggcatc 60
ctgggcttct ggatgctgat gatctgcaac accgaggacc tgtgggtgac cgtgtactac 120
ggcgtgcccg tgtggcgcga cgccaagacc accctgttct gcgccagcga cgccaaggcc 180
tacgagaccg aggtgcacaa cgtgtgggcc acccacgcct gcgtgcccac cgaccccaac 240
ccccaggaga tcgtgctggg caacgtgacc gagaacttca acatgtggaa gaacgacatg 300
gccgaccaga tgcacgagga cgtgatcagc ctgtgggacc agagcctgaa gccctgcgtg 360
aagctgaccc ccctgtgcgt gaccctgaac tgcaccgaca ccaacgtgac cggcaaccgc 420
accgtgaccg gcaacagcac caacaacacc aacggcaccg gcatctacaa catcgaggag 480
atgaagaact gcagcttcaa cgccaccacc gagctgcgcg acaagaagca caaggagtac 540
gccctgttct accgcctgga catcgtgccc ctgaacgaga acagcgacaa cttcacctac 600
cgcctgatca actgcaacac cagcaccatc acccaggcct gccccaaggt gagcttcgac 660
cccatcccca tccactactg cgcccccgcc ggctacgcca tcctgaagtg caacaacaag 720
accttcaacg gcaccggccc ctgctacaac gtgagcaccg tgcagtgcac ccacggcatc 780
aagcccgtgg tgagcaccca gctgctgctg aacggcagcc tggccgagga gggcatcatc 840
atccgcagcg agaacctgac cgagaacacc aagaccatca tcgtgcacct gaacgagagc 900
gtggagatca actgcacccg ccccaacaac aacacccgca agagcgtgcg catcggcccc 960
ggccaggcct tctacgccac caacgacgtg atcggcaaca tccgccaggc ccactgcaac 1020
atcagcaccg accgctggaa caagaccctg cagcaggtga tgaagaagct gggcgagcac 1080
ttccccaaca agaccatcca gttcaagccc cacgccggcg gcgacctgga gatcaccatg 1140
cacagcttca actgccgcgg cgagttcttc tactgcaaca ccagcaacct gttcaacagc 1200
acctaccaca gcaacaacgg cacctacaag tacaacggca acagcagcag ccccatcacc 1260
ctgcagtgca agatcaagca gatcgtgcgc atgtggcagg gcgtgggcca ggccacctac 1320
gcccccccca tcgccggcaa catcacctgc cgcagcaaca tcaccggcat cctgctgacc 1380
cgcgacggcg gcttcaacac caccaacaac accgagacct tccgccccgg cggcggcgac 1440
atgcgcgaca actggcgcag cgagctgtac aagtacaagg tggtggagat caagcccctg 1500
ggcatcgccc ccaccaaggc caagcgccgc gtggtgcagc gcgagaagcg cgccgtgggc 1560
atcggcgccg tgttcctggg cttcctgggc gccgccggca gcaccatggg cgccgccagc 1620
atcaccctga ccgtgcaggc ccgccagctg ctgagcggca tcgtgcagca gcagagcaac 1680
ctgctgaagg ccatcgaggc ccagcagcac atgctgcagc tgaccgtgtg gggcatcaag 1740
cagctgcagg cccgcgtgct ggccatcgag cgctacctga aggaccagca gctgctgggc 1800
atctggggct gcagcggccg cctgatctgc accaccgccg tgccctggaa cagcagctgg 1860
agcaacaaga gcgagaagga catctgggac aacatgacct ggatgcagtg ggaccgcgag 1920
atcagcaact acaccggcct gatctacaac ctgctggagg acagccagaa ccagcaggag 1980
aagaacgaga aggacctgct ggagctggac aagtggaaca acctgtggaa ctggttcgac 2040
atcagcaact ggccctggta catctaactc gag 2073
<210> SEQ ID NO 133
<211> LENGTH: 2073
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: gp140mod.TV1.wtLnative
<400> SEQUENCE: 133
gaattcatga gagtgatggg gacacagaag aattgtcaac aatggtggat atggggcatc 60
ttaggcttct ggatgctaat gatttgtaac accgaggacc tgtgggtgac cgtgtactac 120
ggcgtgcccg tgtggcgcga cgccaagacc accctgttct gcgccagcga cgccaaggcc 180
tacgagaccg aggtgcacaa cgtgtgggcc acccacgcct gcgtgcccac cgaccccaac 240
ccccaggaga tcgtgctggg caacgtgacc gagaacttca acatgtggaa gaacgacatg 300
gccgaccaga tgcacgagga cgtgatcagc ctgtgggacc agagcctgaa gccctgcgtg 360
aagctgaccc ccctgtgcgt gaccctgaac tgcaccgaca ccaacgtgac cggcaaccgc 420
accgtgaccg gcaacagcac caacaacacc aacggcaccg gcatctacaa catcgaggag 480
atgaagaact gcagcttcaa cgccaccacc gagctgcgcg acaagaagca caaggagtac 540
gccctgttct accgcctgga catcgtgccc ctgaacgaga acagcgacaa cttcacctac 600
cgcctgatca actgcaacac cagcaccatc acccaggcct gccccaaggt gagcttcgac 660
cccatcccca tccactactg cgcccccgcc ggctacgcca tcctgaagtg caacaacaag 720
accttcaacg gcaccggccc ctgctacaac gtgagcaccg tgcagtgcac ccacggcatc 780
aagcccgtgg tgagcaccca gctgctgctg aacggcagcc tggccgagga gggcatcatc 840
atccgcagcg agaacctgac cgagaacacc aagaccatca tcgtgcacct gaacgagagc 900
gtggagatca actgcacccg ccccaacaac aacacccgca agagcgtgcg catcggcccc 960
ggccaggcct tctacgccac caacgacgtg atcggcaaca tccgccaggc ccactgcaac 1020
atcagcaccg accgctggaa caagaccctg cagcaggtga tgaagaagct gggcgagcac 1080
ttccccaaca agaccatcca gttcaagccc cacgccggcg gcgacctgga gatcaccatg 1140
cacagcttca actgccgcgg cgagttcttc tactgcaaca ccagcaacct gttcaacagc 1200
acctaccaca gcaacaacgg cacctacaag tacaacggca acagcagcag ccccatcacc 1260
ctgcagtgca agatcaagca gatcgtgcgc atgtggcagg gcgtgggcca ggccacctac 1320
gcccccccca tcgccggcaa catcacctgc cgcagcaaca tcaccggcat cctgctgacc 1380
cgcgacggcg gcttcaacac caccaacaac accgagacct tccgccccgg cggcggcgac 1440
atgcgcgaca actggcgcag cgagctgtac aagtacaagg tggtggagat caagcccctg 1500
ggcatcgccc ccaccaaggc caagcgccgc gtggtgcagc gcgagaagcg cgccgtgggc 1560
atcggcgccg tgttcctggg cttcctgggc gccgccggca gcaccatggg cgccgccagc 1620
atcaccctga ccgtgcaggc ccgccagctg ctgagcggca tcgtgcagca gcagagcaac 1680
ctgctgaagg ccatcgaggc ccagcagcac atgctgcagc tgaccgtgtg gggcatcaag 1740
cagctgcagg cccgcgtgct ggccatcgag cgctacctga aggaccagca gctgctgggc 1800
atctggggct gcagcggccg cctgatctgc accaccgccg tgccctggaa cagcagctgg 1860
agcaacaaga gcgagaagga catctgggac aacatgacct ggatgcagtg ggaccgcgag 1920
atcagcaact acaccggcct gatctacaac ctgctggagg acagccagaa ccagcaggag 1980
aagaacgaga aggacctgct ggagctggac aagtggaaca acctgtggaa ctggttcgac 2040
atcagcaact ggccctggta catctaactc gag 2073
<210> SEQ ID NO 134
<211> LENGTH: 624
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: NefD125G_TV2_C_ZAopt
<400> SEQUENCE: 134
atgggcggca agtggagcaa gagcagcatc atcggctggc ccgaggtgcg cgagcgcatc 60
cgccgcaccc gcagcgccgc cgagggcgtg ggcagcgcca gccaggacct ggagaagcac 120
ggcgccctga ccaccagcaa caccgcccac aacaacgccg cctgcgcctg gctggaggcc 180
caggaggagg agggcgaggt gggcttcccc gtgcgccccc aggtgcccct gcgccccatg 240
acctacaagg ccgccatcga cctgagcttc ttcctgaagg agaagggcgg cctggagggc 300
ctgatctaca gcaagaagcg ccaggagatc ctggacctgt gggtgtacaa cacccagggc 360
ttcttccccg gctggcagaa ctacaccccc ggccccggcg tgcgcttccc cctgaccttc 420
ggctggtact tcaagctgga gcccgtggac ccccgcgagg tggaggaggc caacgagggc 480
gagaacaact gcctgctgca ccccatgagc cagcacggca tggaggacga ggaccgcgag 540
gtgctgcgct ggaagttcga cagcaccctg gcccgccgcc acatggcccg cgagctgcac 600
cccgagtact acaaggactg ctga 624
<210> SEQ ID NO 135
<211> LENGTH: 624
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: NefD125G-Myr_TV2_C_ZAopt
<400> SEQUENCE: 135
atggccggca agtggagcaa gagcagcatc atcggctggc ccgaggtgcg cgagcgcatc 60
cgccgcaccc gcagcgccgc cgagggcgtg ggcagcgcca gccaggacct ggagaagcac 120
ggcgccctga ccaccagcaa ccaccgccac aacaacgccg cctgcgcctg gctggaggcc 180
caggaggagg agggcgaggt gggcttcccc gtgcgccccc aggtgcccct gcgccccatg 240
acctacaagg ccgccatcga cctgagcttc ttcctgaagg agaagggcgg cctggagggc 300
ctgatctaca gcaagaagcg ccaggagatc ctggacctgt gggtgtacaa cacccagggc 360
ttcttccccg gctggcagaa ctacaccccc ggccccggcg tgcgcttccc cctgaccttc 420
ggctggtact tcaagctgga gcccgtggac ccccgcgagg tggaggaggc caacgagggc 480
gagaacaact gcctgctgca ccccatgagc cagcacggca tggaggacga ggaccgcgag 540
gtgctgcgct ggaagttcga cagcaccctg gcccgccgcc acatggcccg cgagctgcac 600
cccgagtact acaaggactg ctga 624
<210> SEQ ID NO 136
<211> LENGTH: 27
<212> TYPE: PRT
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: TV1c8.2 signal peptide leader sequence
<400> SEQUENCE: 136
Met Arg Val Met Gly Thr Gln Lys Asn Cys Gln Gln Trp Trp Ile Trp
1 5 10 15
Gly Ile Leu Gly Phe Trp met Leu Met Ile Cys
20 25
<210> SEQ ID NO 137
<211> LENGTH: 81
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: WTnative (8-2_TV1_C.ZA) signal peptide
leader sequence
<400> SEQUENCE: 137
atgagagtga tggggacaca gaagaattgt caacaatggt ggatatgggg catcttaggc 60
ttctggatgc taatgatttg t 81
<210> SEQ ID NO 138
<211> LENGTH: 81
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: WTmod (8-2_TV1_C.ZA) signal peptide
leader sequence
<400> SEQUENCE: 138
atgcgcgtga tgggcaccca gaagaactgc cagcagtggt ggatctgggg catcctgggc 60
ttctggatgc tgatgatctg c 81
<210> SEQ ID NO 139
<211> LENGTH: 25
<212> TYPE: PRT
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Tpa1 signal peptide leader sequence
<400> SEQUENCE: 139
Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly
1 5 10 15
Ala Val Phe Val Ser Pro Ser Ala Ser
20 25
<210> SEQ ID NO 140
<211> LENGTH: 75
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Tpa1 signal peptide leader sequence
<400> SEQUENCE: 140
atggatgcaa tgaagagagg gctctgctgt gtgctgctgc tgtgtggagc agtcttcgtt 60
tcgcccagcg ccagc 75
<210> SEQ ID NO 141
<211> LENGTH: 23
<212> TYPE: PRT
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Tpa2 signal peptide leader sequence
<400> SEQUENCE: 141
Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly
1 5 10 15
Ala Val Phe Val Ser Pro Ser
20
<210> SEQ ID NO 142
<211> LENGTH: 69
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Tpa2 signal peptide leader sequence
<400> SEQUENCE: 142
atggatgcaa tgaagagagg gctctgctgt gtgctgctgc tgtgtggagc agtcttcgtt 60
tcgcccagc 69
<210> SEQ ID NO 143
<211> LENGTH: 842
<212> TYPE: PRT
<213> ORGANISM: Human immunodeficiency virus SF162
<400> SEQUENCE: 143
Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly
1 5 10 15
Ala Val Phe Val Ser Pro Ser Ala Val Glu Lys Leu Trp Val Thr Val
20 25 30
Tyr Tyr Gly Val Pro Val Trp Lys Glu Ala Thr Thr Thr Leu Phe Cys
35 40 45
Ala Ser Asp Ala Lys Ala Tyr Asp Thr Glu Val His Asn Val Trp Ala
50 55 60
Thr His Ala Cys Val Pro Thr Asp Pro Asn Pro Gln Glu Ile Val Leu
65 70 75 80
Glu Asn Val Thr Glu Asn Phe Asn Met Trp Lys Asn Asn Met Val Glu
85 90 95
Gln Met His Glu Asp Ile Ile Ser Leu Trp Asp Gln Ser Leu Lys Pro
100 105 110
Cys Val Lys Leu Thr Pro Leu Cys Val Thr Leu His Cys Thr Asn Leu
115 120 125
Lys Asn Ala Thr Asn Thr Lys Ser Ser Asn Trp Lys Glu Met Asp Arg
130 135 140
Gly Glu Ile Lys Asn Cys Ser Phe Lys Val Thr Thr Ser Ile Arg Asn
145 150 155 160
Lys Met Gln Lys Glu Tyr Ala Leu Phe Tyr Lys Leu Asp Val Val Pro
165 170 175
Ile Asp Asn Asp Asn Thr Ser Tyr Lys Leu Ile Asn Cys Asn Thr Ser
180 185 190
Val Ile Thr Gln Ala Cys Pro Lys Val Ser Phe Glu Pro Ile Pro Ile
195 200 205
His Tyr Cys Ala Pro Ala Gly Phe Ala Ile Leu Lys Cys Asn Asp Lys
210 215 220
Lys Phe Asn Gly Ser Gly Pro Cys Thr Asn Val Ser Thr Val Gln Cys
225 230 235 240
Thr His Gly Ile Arg Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly
245 250 255
Ser Leu Ala Glu Glu Gly Val Val Ile Arg Ser Glu Asn Phe Thr Asp
260 265 270
Asn Ala Lys Thr Ile Ile Val Gln Leu Lys Glu Ser Val Glu Ile Asn
275 280 285
Cys Thr Arg Pro Asn Asn Asn Thr Arg Lys Ser Ile Thr Ile Gly Pro
290 295 300
Gly Arg Ala Phe Tyr Ala Thr Gly Asp Ile Ile Gly Asp Ile Arg Gln
305 310 315 320
Ala His Cys Asn Ile Ser Gly Glu Lys Trp Asn Asn Thr Leu Lys Gln
325 330 335
Ile Val Thr Lys Leu Gln Ala Gln Phe Gly Asn Lys Thr Ile Val Phe
340 345 350
Lys Gln Ser Ser Gly Gly Asp Pro Glu Ile Val Met His Ser Phe Asn
355 360 365
Cys Gly Gly Glu Phe Phe Tyr Cys Asn Ser Thr Gln Leu Phe Asn Ser
370 375 380
Thr Trp Asn Asn Thr Ile Gly Pro Asn Asn Thr Asn Gly Thr Ile Thr
385 390 395 400
Leu Pro Cys Arg Ile Lys Gln Ile Ile Asn Arg Trp Gln Glu Val Gly
405 410 415
Lys Ala Met Tyr Ala Pro Pro Ile Arg Gly Gln Ile Arg Cys Ser Ser
420 425 430
Asn Ile Thr Gly Leu Leu Leu Thr Arg Asp Gly Gly Lys Glu Ile Ser
435 440 445
Asn Thr Thr Glu Ile Phe Arg Pro Gly Gly Gly Asp Met Arg Asp Asn
450 455 460
Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val Lys Ile Glu Pro Leu
465 470 475 480
Gly Val Ala Pro Thr Lys Ala Lys Arg Arg Val Val Gln Arg Glu Lys
485 490 495
Arg Ala Val Thr Leu Gly Ala Met Phe Leu Gly Phe Leu Gly Ala Ala
500 505 510
Gly Ser Thr Met Gly Ala Arg Ser Leu Thr Leu Thr Val Gln Ala Arg
515 520 525
Gln Leu Leu Ser Gly Ile Val Gln Gln Gln Asn Asn Leu Leu Arg Ala
530 535 540
Ile Glu Ala Gln Gln His Leu Leu Gln Leu Thr Val Trp Gly Ile Lys
545 550 555 560
Gln Leu Gln Ala Arg Val Leu Ala Val Glu Arg Tyr Leu Lys Asp Gln
565 570 575
Gln Leu Leu Gly Ile Trp Gly Cys Ser Gly Lys Leu Ile Cys Thr Thr
580 585 590
Ala Val Pro Trp Asn Ala Ser Trp Ser Asn Lys Ser Leu Asp Gln Ile
595 600 605
Trp Asn Asn Met Thr Trp Met Glu Trp Glu Arg Glu Ile Asp Asn Tyr
610 615 620
Thr Asn Leu Ile Tyr Thr Leu Ile Glu Glu Ser Gln Asn Gln Gln Glu
625 630 635 640
Lys Asn Glu Gln Glu Leu Leu Glu Leu Asp Lys Trp Ala Ser Leu Trp
645 650 655
Asn Trp Phe Asp Ile Ser Lys Trp Leu Trp Tyr Ile Lys Ile Phe Ile
660 665 670
Met Ile Val Gly Gly Leu Val Gly Leu Arg Ile Val Phe Thr Val Leu
675 680 685
Ser Ile Val Asn Arg Val Arg Gln Gly Tyr Ser Pro Leu Ser Phe Gln
690 695 700
Thr Arg Phe Pro Ala Pro Arg Gly Pro Asp Arg Pro Glu Gly Ile Glu
705 710 715 720
Glu Glu Gly Gly Glu Arg Asp Arg Asp Arg Ser Ser Pro Leu Val His
725 730 735
Gly Leu Leu Ala Leu Ile Trp Asp Asp Leu Arg Ser Leu Cys Leu Phe
740 745 750
Ser Tyr His Arg Leu Arg Asp Leu Ile Leu Ile Ala Ala Arg Ile Val
755 760 765
Glu Leu Leu Gly Arg Arg Gly Trp Glu Ala Leu Lys Tyr Trp Gly Asn
770 775 780
Leu Leu Gln Tyr Trp Ile Gln Glu Leu Lys Asn Ser Ala Val Ser Leu
785 790 795 800
Phe Asp Ala Ile Ala Ile Ala Val Ala Glu Gly Thr Asp Arg Ile Ile
805 810 815
Glu Val Ala Gln Arg Ile Gly Arg Ala Phe Leu His Ile Pro Arg Arg
820 825 830
Ile Arg Gln Gly Phe Glu Arg Ala Leu Leu
835 840
<210> SEQ ID NO 144
<211> LENGTH: 867
<212> TYPE: PRT
<213> ORGANISM: Human immunodeficiency virus TV1.8_2
<400> SEQUENCE: 144
Met Arg Val Met Gly Thr Gln Lys Asn Cys Gln Gln Trp Trp Ile Trp
1 5 10 15
Gly Ile Leu Gly Phe Trp Met Leu Met Ile Cys Asn Thr Glu Asp Leu
20 25 30
Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Arg Asp Ala Lys Thr
35 40 45
Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala Tyr Glu Thr Glu Val His
50 55 60
Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn Pro Gln
65 70 75 80
Glu Ile Val Leu Gly Asn Val Thr Glu Asn Phe Asn Met Trp Lys Asn
85 90 95
Asp Met Ala Asp Gln Met His Glu Asp Val Ile Ser Leu Trp Asp Gln
100 105 110
Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Thr Leu Asn
115 120 125
Cys Thr Asp Thr Asn Val Thr Gly Asn Arg Thr Val Thr Gly Asn Ser
130 135 140
Thr Asn Asn Thr Asn Gly Thr Gly Ile Tyr Asn Ile Glu Glu Met Lys
145 150 155 160
Asn Cys Ser Phe Asn Ala Thr Thr Glu Leu Arg Asp Lys Lys His Lys
165 170 175
Glu Tyr Ala Leu Phe Tyr Arg Leu Asp Ile Val Pro Leu Asn Glu Asn
180 185 190
Ser Asp Asn Phe Thr Tyr Arg Leu Ile Asn Cys Asn Thr Ser Thr Ile
195 200 205
Thr Gln Ala Cys Pro Lys Val Ser Phe Asp Pro Ile Pro Ile His Tyr
210 215 220
Cys Ala Pro Ala Gly Tyr Ala Ile Leu Lys Cys Asn Asn Lys Thr Phe
225 230 235 240
Asn Gly Thr Gly Pro Cys Tyr Asn Val Ser Thr Val Gln Cys Thr His
245 250 255
Gly Ile Lys Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly Ser Leu
260 265 270
Ala Glu Glu Gly Ile Ile Ile Arg Ser Glu Asn Leu Thr Glu Asn Thr
275 280 285
Lys Thr Ile Ile Val His Leu Asn Glu Ser Val Glu Ile Asn Cys Thr
290 295 300
Arg Pro Asn Asn Asn Thr Arg Lys Ser Val Arg Ile Gly Pro Gly Gln
305 310 315 320
Ala Phe Tyr Ala Thr Asn Asp Val Ile Gly Asn Ile Arg Gln Ala His
325 330 335
Cys Asn Ile Ser Thr Asp Arg Trp Asn Lys Thr Leu Gln Gln Val Met
340 345 350
Lys Lys Leu Gly Glu His Phe Pro Asn Lys Thr Ile Gln Phe Lys Pro
355 360 365
His Ala Gly Gly Asp Leu Glu Ile Thr Met His Ser Phe Asn Cys Arg
370 375 380
Gly Glu Phe Phe Tyr Cys Asn Thr Ser Asn Leu Phe Asn Ser Thr Tyr
385 390 395 400
His Ser Asn Asn Gly Thr Tyr Lys Tyr Asn Gly Asn Ser Ser Ser Pro
405 410 415
Ile Thr Leu Gln Cys Lys Ile Lys Gln Ile Val Arg Met Trp Gln Gly
420 425 430
Val Gly Gln Ala Thr Tyr Ala Pro Pro Ile Ala Gly Asn Ile Thr Cys
435 440 445
Arg Ser Asn Ile Thr Gly Ile Leu Leu Thr Arg Asp Gly Gly Phe Asn
450 455 460
Thr Thr Asn Asn Thr Glu Thr Phe Arg Pro Gly Gly Gly Asp Met Arg
465 470 475 480
Asp Asn Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val Glu Ile Lys
485 490 495
Pro Leu Gly Ile Ala Pro Thr Lys Ala Lys Arg Arg Val Val Gln Arg
500 505 510
Glu Lys Arg Ala Val Gly Ile Gly Ala Val Phe Leu Gly Phe Leu Gly
515 520 525
Ala Ala Gly Ser Thr Met Gly Ala Ala Ser Ile Thr Leu Thr Val Gln
530 535 540
Ala Arg Gln Leu Leu Ser Gly Ile Val Gln Gln Gln Ser Asn Leu Leu
545 550 555 560
Lys Ala Ile Glu Ala Gln Gln His Met Leu Gln Leu Thr Val Trp Gly
565 570 575
Ile Lys Gln Leu Gln Ala Arg Val Leu Ala Ile Glu Arg Tyr Leu Lys
580 585 590
Asp Gln Gln Leu Leu Gly Ile Trp Gly Cys Ser Gly Arg Leu Ile Cys
595 600 605
Thr Thr Ala Val Pro Trp Asn Ser Ser Trp Ser Asn Lys Ser Glu Lys
610 615 620
Asp Ile Trp Asp Asn Met Thr Trp Met Gln Trp Asp Arg Glu Ile Ser
625 630 635 640
Asn Tyr Thr Gly Leu Ile Tyr Asn Leu Leu Glu Asp Ser Gln Asn Gln
645 650 655
Gln Glu Lys Asn Glu Lys Asp Leu Leu Glu Leu Asp Lys Trp Asn Asn
660 665 670
Leu Trp Asn Trp Phe Asp Ile Ser Asn Trp Pro Trp Tyr Ile Lys Ile
675 680 685
Phe Ile Met Ile Val Gly Gly Leu Ile Gly Leu Arg Ile Ile Phe Ala
690 695 700
Val Leu Ser Ile Val Asn Arg Val Arg Gln Gly Tyr Ser Pro Leu Ser
705 710 715 720
Phe Gln Thr Leu Thr Pro Ser Pro Arg Gly Leu Asp Arg Leu Gly Gly
725 730 735
Ile Glu Glu Glu Gly Gly Glu Gln Asp Arg Asp Arg Ser Ile Arg Leu
740 745 750
Val Ser Gly Phe Leu Ser Leu Ala Trp Asp Asp Leu Arg Asn Leu Cys
755 760 765
Leu Phe Ser Tyr His Arg Leu Arg Asp Phe Ile Leu Ile Ala Val Arg
770 775 780
Ala Val Glu Leu Leu Gly His Ser Ser Leu Arg Gly Leu Gln Arg Gly
785 790 795 800
Trp Glu Ile Leu Lys Tyr Leu Gly Ser Leu Val Gln Tyr Trp Gly Leu
805 810 815
Glu Leu Lys Lys Ser Ala Ile Ser Leu Leu Asp Thr Ile Ala Ile Thr
820 825 830
Val Ala Glu Gly Thr Asp Arg Ile Ile Glu Leu Val Gln Arg Ile Cys
835 840 845
Arg Ala Ile Leu Asn Ile Pro Arg Arg Ile Arg Gln Gly Phe Glu Ala
850 855 860
Ala Leu Leu
865
<210> SEQ ID NO 145
<211> LENGTH: 869
<212> TYPE: PRT
<213> ORGANISM: Human immunodeficiency virus TV1.8_5
<400> SEQUENCE: 145
Met Arg Val Met Gly Thr Gln Lys Asn Cys Gln Gln Trp Trp Ile Trp
1 5 10 15
Gly Ile Leu Gly Phe Trp Met Leu Met Ile Cys Asn Thr Glu Asp Leu
20 25 30
Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Arg Glu Ala Lys Thr
35 40 45
Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala Tyr Glu Thr Glu Val His
50 55 60
Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn Pro Gln
65 70 75 80
Glu Ile Val Leu Gly Asn Val Thr Glu Asn Phe Asn Met Trp Lys Asn
85 90 95
Asn Met Ala Asp Gln Met His Glu Asp Ile Ile Ser Leu Trp Asp Gln
100 105 110
Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Thr Leu Asn
115 120 125
Cys Thr Asp Thr Asn Val Thr Gly Asn Arg Thr Val Thr Gly Asn Thr
130 135 140
Asn Asp Thr Asn Ile Ala Asn Ala Thr Tyr Lys Tyr Glu Glu Met Lys
145 150 155 160
Asn Cys Ser Phe Asn Ala Thr Thr Glu Leu Arg Asp Lys Lys His Lys
165 170 175
Glu Tyr Ala Leu Phe Tyr Lys Leu Asp Ile Val Pro Leu Asn Glu Asn
180 185 190
Ser Asn Asn Phe Thr Tyr Arg Leu Ile Asn Cys Asn Thr Ser Thr Ile
195 200 205
Thr Gln Ala Cys Pro Lys Val Ser Phe Asp Pro Ile Pro Ile His Tyr
210 215 220
Cys Ala Pro Ala Asp Tyr Ala Ile Leu Lys Cys Asn Asn Lys Thr Phe
225 230 235 240
Asn Gly Thr Gly Pro Cys Tyr Asn Val Ser Thr Val Gln Cys Thr His
245 250 255
Gly Ile Lys Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly Ser Leu
260 265 270
Ala Glu Glu Gly Ile Ile Ile Arg Ser Glu Asn Leu Thr Glu Asn Thr
275 280 285
Lys Thr Ile Ile Val His Leu Asn Glu Ser Val Glu Ile Asn Cys Thr
290 295 300
Arg Pro Asn Asn Asn Thr Arg Lys Ser Val Arg Ile Gly Pro Gly Gln
305 310 315 320
Ala Phe Tyr Ala Thr Asn Asp Val Ile Gly Asn Ile Arg Gln Ala His
325 330 335
Cys Asn Ile Ser Thr Asp Arg Trp Asn Lys Thr Leu Gln Gln Val Met
340 345 350
Lys Lys Leu Gly Glu His Phe Pro Asn Lys Thr Ile Lys Phe Glu Pro
355 360 365
His Ala Gly Gly Asp Leu Glu Ile Thr Met His Ser Phe Asn Cys Arg
370 375 380
Gly Glu Phe Phe Tyr Cys Asn Thr Ser Asn Leu Phe Asn Ser Thr Tyr
385 390 395 400
Tyr Pro Lys Asn Gly Thr Tyr Lys Tyr Asn Gly Asn Ser Ser Leu Pro
405 410 415
Ile Thr Leu Gln Cys Lys Ile Lys Gln Ile Val Arg Met Trp Gln Gly
420 425 430
Val Gly Gln Ala Met Tyr Ala Pro Pro Ile Ala Gly Asn Ile Thr Cys
435 440 445
Arg Ser Asn Ile Thr Gly Ile Leu Leu Thr Arg Asp Gly Gly Phe Asn
450 455 460
Asn Thr Asn Asn Asp Thr Glu Glu Thr Phe Arg Pro Gly Gly Gly Asp
465 470 475 480
Met Arg Asp Asn Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val Glu
485 490 495
Ile Lys Pro Leu Gly Ile Ala Pro Thr Lys Ala Lys Arg Arg Val Val
500 505 510
Gln Arg Lys Lys Arg Ala Val Gly Ile Gly Ala Val Phe Leu Gly Phe
515 520 525
Leu Gly Ala Ala Gly Ser Thr Met Gly Ala Ala Ser Ile Thr Leu Thr
530 535 540
Val Gln Ala Arg Gln Leu Leu Ser Gly Ile Val Gln Gln Gln Ser Asn
545 550 555 560
Leu Leu Lys Ala Ile Glu Ala Gln Gln His Met Leu Gln Leu Thr Val
565 570 575
Trp Gly Ile Lys Gln Leu Gln Ala Arg Val Leu Ala Ile Glu Arg Tyr
580 585 590
Leu Lys Asp Gln Gln Leu Leu Gly Ile Trp Gly Cys Ser Gly Arg Leu
595 600 605
Ile Cys Thr Thr Ala Val Pro Trp Asn Ser Ser Trp Ser Asn Lys Ser
610 615 620
Glu Ala Asp Ile Trp Asp Asn Met Thr Trp Met Gln Trp Asp Arg Glu
625 630 635 640
Ile Asn Asn Tyr Thr Glu Thr Ile Phe Arg Leu Leu Glu Asp Ser Gln
645 650 655
Asn Gln Gln Glu Lys Asn Glu Lys Asp Leu Leu Glu Leu Asp Lys Trp
660 665 670
Asn Asn Leu Trp Asn Trp Phe Asp Ile Ser Asn Trp Leu Trp Tyr Ile
675 680 685
Lys Ile Phe Ile Met Ile Val Gly Gly Leu Ile Gly Leu Arg Ile Ile
690 695 700
Phe Ala Val Leu Ser Ile Val Asn Arg Val Arg Gln Gly Tyr Ser Pro
705 710 715 720
Leu Ser Phe Gln Thr Leu Thr Pro Ser Pro Arg Gly Leu Asp Arg Leu
725 730 735
Gly Gly Ile Glu Glu Glu Gly Gly Glu Gln Asp Arg Asp Arg Ser Ile
740 745 750
Arg Leu Val Ser Gly Phe Leu Ser Leu Ala Trp Asp Asp Leu Arg Ser
755 760 765
Leu Cys Leu Phe Ser Tyr His Arg Leu Arg Asp Phe Ile Leu Ile Ala
770 775 780
Val Arg Ala Val Glu Leu Leu Gly His Ser Ser Leu Arg Gly Leu Gln
785 790 795 800
Arg Gly Trp Glu Ile Leu Lys Tyr Leu Gly Ser Leu Val Gln Tyr Trp
805 810 815
Gly Leu Glu Leu Lys Lys Ser Ala Ile Ser Pro Leu Asp Thr Ile Ala
820 825 830
Ile Ala Val Ala Glu Gly Thr Asp Arg Ile Ile Glu Leu Val Gln Arg
835 840 845
Ile Cys Arg Ala Ile Leu Asn Ile Pro Arg Arg Ile Arg Gln Gly Phe
850 855 860
Glu Ala Ala Leu Leu
865
<210> SEQ ID NO 146
<211> LENGTH: 854
<212> TYPE: PRT
<213> ORGANISM: Human immunodeficiency virus TV2.12-5/1
<400> SEQUENCE: 146
Met Arg Ala Arg Gly Ile Leu Lys Asn Tyr Arg His Trp Trp Ile Trp
1 5 10 15
Gly Ile Leu Gly Phe Trp Met Leu Met Met Cys Asn Val Lys Gly Leu
20 25 30
Trp Val Thr Val Tyr Tyr Gly Val Pro Val Gly Arg Glu Ala Lys Thr
35 40 45
Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala Tyr Glu Lys Glu Val His
50 55 60
Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn Pro Gln
65 70 75 80
Glu Val Ile Leu Gly Asn Val Thr Glu Asn Phe Asn Met Trp Lys Asn
85 90 95
Asp Met Val Asp Gln Met Gln Glu Asp Ile Ile Ser Leu Trp Asp Gln
100 105 110
Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Thr Leu Asn
115 120 125
Cys Thr Asn Ala Thr Val Asn Tyr Asn Asn Thr Ser Lys Asp Met Lys
130 135 140
Asn Cys Ser Phe Tyr Val Thr Thr Glu Leu Arg Asp Lys Lys Lys Lys
145 150 155 160
Glu Asn Ala Leu Phe Tyr Arg Leu Asp Ile Val Pro Leu Asn Asn Arg
165 170 175
Lys Asn Gly Asn Ile Asn Asn Tyr Arg Leu Ile Asn Cys Asn Thr Ser
180 185 190
Ala Ile Thr Gln Ala Cys Pro Lys Val Ser Phe Asp Pro Ile Pro Ile
195 200 205
His Tyr Cys Ala Pro Ala Gly Tyr Ala Pro Leu Lys Cys Asn Asn Lys
210 215 220
Lys Phe Asn Gly Ile Gly Pro Cys Asp Asn Val Ser Thr Val Gln Cys
225 230 235 240
Thr His Gly Ile Lys Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly
245 250 255
Ser Leu Ala Glu Glu Glu Ile Ile Ile Arg Ser Glu Asn Leu Thr Asn
260 265 270
Asn Val Lys Thr Ile Ile Val His Leu Asn Glu Ser Ile Glu Ile Lys
275 280 285
Cys Thr Arg Pro Gly Asn Asn Thr Arg Lys Ser Val Arg Ile Gly Pro
290 295 300
Gly Gln Ala Phe Tyr Ala Thr Gly Asp Ile Ile Gly Asp Ile Arg Gln
305 310 315 320
Ala His Cys Asn Ile Ser Lys Asn Glu Trp Asn Thr Thr Leu Gln Arg
325 330 335
Val Ser Gln Lys Leu Gln Glu Leu Phe Pro Asn Ser Thr Gly Ile Lys
340 345 350
Phe Ala Pro His Ser Gly Gly Asp Leu Glu Ile Thr Thr His Ser Phe
355 360 365
Asn Cys Gly Gly Glu Phe Phe Tyr Cys Asn Thr Thr Asp Leu Phe Asn
370 375 380
Ser Thr Tyr Ser Asn Gly Thr Cys Thr Asn Gly Thr Cys Met Ser Asn
385 390 395 400
Asn Thr Glu Arg Ile Thr Leu Gln Cys Arg Ile Lys Gln Ile Ile Asn
405 410 415
Met Trp Gln Glu Val Gly Arg Ala Met Tyr Ala Pro Pro Ile Ala Gly
420 425 430
Asn Ile Thr Cys Arg Ser Asn Ile Thr Gly Leu Leu Leu Thr Arg Asp
435 440 445
Gly Gly Asp Asn Asn Thr Glu Thr Glu Thr Phe Arg Pro Gly Gly Gly
450 455 460
Asp Met Arg Asp Asn Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val
465 470 475 480
Glu Ile Lys Pro Leu Gly Val Ala Pro Thr Ala Ala Lys Arg Arg Val
485 490 495
Val Glu Arg Glu Lys Arg Ala Val Gly Ile Gly Ala Val Phe Leu Gly
500 505 510
Phe Leu Gly Ala Ala Gly Ser Thr Met Gly Ala Ala Ser Ile Thr Leu
515 520 525
Thr Val Gln Ala Arg Gln Leu Leu Ser Gly Ile Val Gln Gln Gln Ser
530 535 540
Asn Leu Leu Arg Ala Ile Glu Ala Gln Gln His Met Leu Gln Leu Thr
545 550 555 560
Val Trp Gly Ile Lys Gln Leu Gln Ala Arg Val Leu Ala Ile Glu Arg
565 570 575
Tyr Leu Gln Asp Gln Gln Leu Leu Gly Leu Trp Gly Cys Ser Gly Lys
580 585 590
Leu Ile Cys Thr Thr Asn Val Leu Trp Asn Ser Ser Trp Ser Asn Lys
595 600 605
Thr Gln Ser Asp Ile Trp Asp Asn Met Thr Trp Met Gln Trp Asp Arg
610 615 620
Glu Ile Ser Asn Tyr Thr Asn Thr Ile Tyr Arg Leu Leu Glu Asp Ser
625 630 635 640
Gln Ser Gln Gln Glu Arg Asn Glu Lys Asp Leu Leu Ala Leu Asp Arg
645 650 655
Trp Asn Asn Leu Trp Asn Trp Phe Ser Ile Thr Asn Trp Leu Trp Tyr
660 665 670
Ile Lys Ile Phe Ile Met Ile Val Gly Gly Leu Ile Gly Leu Arg Ile
675 680 685
Ile Phe Ala Val Leu Ser Leu Val Asn Arg Val Arg Gln Gly Tyr Ser
690 695 700
Pro Leu Ser Leu Gln Thr Leu Ile Pro Asn Pro Arg Gly Pro Asp Arg
705 710 715 720
Leu Gly Gly Ile Glu Glu Glu Gly Gly Glu Gln Asp Ser Ser Arg Ser
725 730 735
Ile Arg Leu Val Ser Gly Phe Leu Thr Leu Ala Trp Asp Asp Leu Arg
740 745 750
Ser Leu Cys Leu Phe Cys Tyr His Arg Leu Arg Asp Phe Ile Leu Ile
755 760 765
Val Val Arg Ala Val Glu Leu Leu Gly His Ser Ser Leu Arg Gly Leu
770 775 780
Gln Arg Gly Trp Gly Thr Leu Lys Tyr Leu Gly Ser Leu Val Gln Tyr
785 790 795 800
Trp Gly Leu Glu Leu Lys Lys Ser Ala Ile Asn Leu Leu Asp Thr Ile
805 810 815
Ala Ile Ala Val Ala Glu Gly Thr Asp Arg Ile Leu Glu Phe Ile Gln
820 825 830
Asn Leu Cys Arg Gly Ile Arg Asn Val Pro Arg Arg Ile Arg Gln Gly
835 840 845
Phe Glu Ala Ala Leu Gln
850
<210> SEQ ID NO 147
<211> LENGTH: 875
<212> TYPE: PRT
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: HIV Env consensus sequence
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: (148)..(149)
<223> OTHER INFORMATION: Xaa can be any naturally occurring amino
acid
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: (151)..(151)
<223> OTHER INFORMATION: Xaa can be any naturally occurring amino
acid
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: (153)..(153)
<223> OTHER INFORMATION: Xaa can be any naturally occurring amino
acid
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: (155)..(156)
<223> OTHER INFORMATION: Xaa can be any naturally occurring amino
acid
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: (192)..(192)
<223> OTHER INFORMATION: Xaa can be any naturally occurring amino
acid
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: (366)..(366)
<223> OTHER INFORMATION: Xaa can be any naturally occurring amino
acid
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: (406)..(409)
<223> OTHER INFORMATION: Xaa can be any naturally occurring amino
acid
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: (421)..(421)
<223> OTHER INFORMATION: Xaa can be any naturally occurring amino
acid
<220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: (475)..(476)
<223> OTHER INFORMATION: Xaa can be any naturally occurring amino
acid
<400> SEQUENCE: 147
Met Arg Val Met Gly Thr Gln Lys Asn Cys Gln Gln Trp Trp Ile Trp
1 5 10 15
Gly Ile Leu Gly Phe Trp Met Leu Met Ile Cys Asn Val Glu Asp Leu
20 25 30
Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Arg Glu Ala Lys Thr
35 40 45
Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala Tyr Glu Thr Glu Val His
50 55 60
Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn Pro Gln
65 70 75 80
Glu Ile Val Leu Gly Asn Val Thr Glu Asn Phe Asn Met Trp Lys Asn
85 90 95
Asn Met Val Asp Gln Met His Glu Asp Ile Ile Ser Leu Trp Asp Gln
100 105 110
Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Thr Leu Asn
115 120 125
Cys Thr Asn Thr Asn Val Thr Gly Asn Arg Thr Val Thr Gly Asn Ser
130 135 140
Asn Ser Asn Xaa Xaa Ala Xaa Ala Xaa Tyr Xaa Xaa Glu Glu Met Lys
145 150 155 160
Asn Cys Ser Phe Asn Val Thr Thr Glu Leu Arg Asp Lys Lys His Lys
165 170 175
Glu Tyr Ala Leu Phe Tyr Lys Leu Asp Ile Val Pro Leu Asn Asn Xaa
180 185 190
Glu Asn Ser Asn Asn Phe Thr Tyr Arg Leu Ile Asn Cys Asn Thr Ser
195 200 205
Thr Ile Thr Gln Ala Cys Pro Lys Val Ser Phe Asp Pro Ile Pro Ile
210 215 220
His Tyr Cys Ala Pro Ala Gly Tyr Ala Ile Leu Lys Cys Asn Asn Lys
225 230 235 240
Thr Phe Asn Gly Thr Gly Pro Cys Tyr Asn Val Ser Thr Val Gln Cys
245 250 255
Thr His Gly Ile Lys Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly
260 265 270
Ser Leu Ala Glu Glu Gly Ile Ile Ile Arg Ser Glu Asn Leu Thr Glu
275 280 285
Asn Thr Lys Thr Ile Ile Val His Leu Asn Glu Ser Val Glu Ile Asn
290 295 300
Cys Thr Arg Pro Asn Asn Asn Thr Arg Lys Ser Val Arg Ile Gly Pro
305 310 315 320
Gly Gln Ala Phe Tyr Ala Thr Asn Asp Ile Ile Gly Asn Ile Arg Gln
325 330 335
Ala His Cys Asn Ile Ser Thr Asp Arg Trp Asn Lys Thr Leu Gln Gln
340 345 350
Val Met Lys Lys Leu Gln Glu His Phe Pro Asn Lys Thr Xaa Ile Lys
355 360 365
Phe Lys Pro His Ala Gly Gly Asp Leu Glu Ile Thr Met His Ser Phe
370 375 380
Asn Cys Arg Gly Glu Phe Phe Tyr Cys Asn Thr Ser Asn Leu Phe Asn
385 390 395 400
Ser Thr Tyr His Asn Xaa Xaa Xaa Xaa Asn Gly Thr Tyr Lys Tyr Asn
405 410 415
Gly Asn Ser Ser Xaa Pro Ile Thr Leu Gln Cys Lys Ile Lys Gln Ile
420 425 430
Ile Arg Met Trp Gln Gly Val Gly Gln Ala Met Tyr Ala Pro Pro Ile
435 440 445
Ala Gly Asn Ile Thr Cys Arg Ser Asn Ile Thr Gly Ile Leu Leu Thr
450 455 460
Arg Asp Gly Gly Phe Asn Asn Thr Asn Thr Xaa Xaa Thr Glu Thr Phe
465 470 475 480
Arg Pro Gly Gly Gly Asp Met Arg Asp Asn Trp Arg Ser Glu Leu Tyr
485 490 495
Lys Tyr Lys Val Val Glu Ile Lys Pro Leu Gly Ile Ala Pro Thr Lys
500 505 510
Ala Lys Arg Arg Val Val Gln Arg Glu Lys Arg Ala Val Gly Ile Gly
515 520 525
Ala Val Phe Leu Gly Phe Leu Gly Ala Ala Gly Ser Thr Met Gly Ala
530 535 540
Ala Ser Ile Thr Leu Thr Val Gln Ala Arg Gln Leu Leu Ser Gly Ile
545 550 555 560
Val Gln Gln Gln Ser Asn Leu Leu Lys Ala Ile Glu Ala Gln Gln His
565 570 575
Met Leu Gln Leu Thr Val Trp Gly Ile Lys Gln Leu Gln Ala Arg Val
580 585 590
Leu Ala Ile Glu Arg Tyr Leu Lys Asp Gln Gln Leu Leu Gly Ile Trp
595 600 605
Gly Cys Ser Gly Lys Leu Ile Cys Thr Thr Ala Val Pro Trp Asn Ser
610 615 620
Ser Trp Ser Asn Lys Ser Glu Ala Asp Ile Trp Asp Asn Met Thr Trp
625 630 635 640
Met Gln Trp Asp Arg Glu Ile Ser Asn Tyr Thr Asn Thr Ile Tyr Arg
645 650 655
Leu Leu Glu Asp Ser Gln Asn Gln Gln Glu Lys Asn Glu Lys Asp Leu
660 665 670
Leu Glu Leu Asp Lys Trp Asn Asn Leu Trp Asn Trp Phe Asp Ile Ser
675 680 685
Asn Trp Leu Trp Tyr Ile Lys Ile Phe Ile Met Ile Val Gly Gly Leu
690 695 700
Ile Gly Leu Arg Ile Ile Phe Ala Val Leu Ser Ile Val Asn Arg Val
705 710 715 720
Arg Gln Gly Tyr Ser Pro Leu Ser Phe Gln Thr Leu Thr Pro Ser Pro
725 730 735
Arg Gly Pro Asp Arg Leu Gly Gly Ile Glu Glu Glu Gly Gly Glu Gln
740 745 750
Asp Arg Asp Arg Ser Ile Arg Leu Val Ser Gly Phe Leu Ser Leu Ala
755 760 765
Trp Asp Asp Leu Arg Ser Leu Cys Leu Phe Ser Tyr His Arg Leu Arg
770 775 780
Asp Phe Ile Leu Ile Ala Val Arg Ala Val Glu Leu Leu Gly His Ser
785 790 795 800
Ser Leu Arg Gly Leu Gln Arg Gly Trp Glu Ile Leu Lys Tyr Leu Gly
805 810 815
Ser Leu Val Gln Tyr Trp Gly Leu Glu Leu Lys Lys Ser Ala Ile Ser
820 825 830
Leu Leu Asp Thr Ile Ala Ile Ala Val Ala Glu Gly Thr Asp Arg Ile
835 840 845
Ile Glu Leu Val Gln Arg Ile Cys Arg Ala Ile Leu Asn Ile Pro Arg
850 855 860
Arg Ile Arg Gln Gly Phe Glu Ala Ala Leu Leu
865 870 875
<210> SEQ ID NO 148
<211> LENGTH: 4
<212> TYPE: PRT
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Epitope Tag
<400> SEQUENCE: 148
Tyr Met Asp Asp
1
<210> SEQ ID NO 149
<211> LENGTH: 4
<212> TYPE: PRT
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Epitope Tag
<400> SEQUENCE: 149
Trp Met Gly Tyr
1
<210> SEQ ID NO 150
<211> LENGTH: 4
<212> TYPE: PRT
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Epitope Tag
<400> SEQUENCE: 150
Gly Pro Gly Arg
1
User Contributions:
Comment about this patent or add new information about this topic:














































































































































































































