Patent application title: PFU REPLICATION ACCESSORY FACTORS AND METHODS OF USE
Inventors:
Holly Hurlbut Hogrefe (San Diego, CA, US)
Janice Marie Cline (San Marcos, CA, US)
Connie Jo Hansen (San Diego, CA, US)
Assignees:
STRATAGENE CALIFORNIA
IPC8 Class: AC12P2106FI
USPC Class:
435 691
Class name: Chemistry: molecular biology and microbiology micro-organism, tissue cell culture or enzyme using process to synthesize a desired chemical compound or composition recombinant dna technique included in method of making a protein or polypeptide
Publication date: 2009-09-03
Patent application number: 20090221029
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: PFU REPLICATION ACCESSORY FACTORS AND METHODS OF USE
Inventors:
Connie Jo Hansen
Holly Hurlbut Hogrefe
Janice Marie Cline
Agents:
AGILENT TECHOLOGIES INC
Assignees:
STRATAGENE CALIFORNIA
Origin: LOVELAND, CO US
IPC8 Class: AC12P2106FI
USPC Class:
435 691
Abstract:
This invention provides isolated polynucleotides that encode replication
accessory factors. The invention also provides novel DNA replication
accessory factors, which have been isolated and purified from the
hyperthermophilic archaea Pyrococcus furiosus. The invention also
provides various methods of enhancing a nucleic acid polymerase reaction
comprising the addition of the replication accessory factors to the
reaction. This invention further provides methods of synthesizing,
amplifying, and mutagenizing nucleic acids of interest employing the
replication accessory factors. This invention also provides kits
comprising, at least one of the replication accessory factors. This
invention also provides kits useful for various methods that comprise at
least one replication accessory factor.Claims:
1-3. (canceled)
4. An isolated polynucleotide encoding a helicase, wherein the polynucleotide comprises a nucleic acid sequence that encodes an amino acid sequence at least 70% identical to SEQ ID NO:74.
5. The polynucleotide of claim 4, wherein the polynucleotide is a cDNA.
6. The polynucleotide of claim 4, wherein the polynucleotide is an mRNA.
7-14. (canceled)
15. A vector comprising the polynucleotide of claim 4.
16. The vector of claim 15, wherein the vector is a plasmid.
17. The vector of claim 15, wherein the vector is a bacteriophage.
18. The vector of claim 15, wherein the vector is a retrovirus.
19. The vector of claim 15, wherein the vector is an adenovirus.
20. A host cell comprising the vector of claim 15.
21. The host cell of claim 20, wherein the host cell is a prokaryotic cell.
22. The host cell of claim 20, wherein the host cell is a eukaryotic cell.
23-26. (canceled)
27. A method for producing a polypeptide, comprising: expressing the polynucleotide of the vector of claim 15 in a host cell; and purifying the expressed product.
28. The method of claim 27, wherein the host cell is a prokaryotic cell.
29. The method of claim 27, wherein the host cell is a eukaryotic cell.
30-74. (canceled)
75. The polynucleotide of claim 4, wherein the amino acid sequence is at least 80% identical to SEQ ID NO:74.
76. The polynucleotide of claim 4, wherein the amino acid sequence is at least 90% identical to SEQ ID NO:74.
77. The polynucleotide of claim 4, wherein the amino acid sequence is at least 95% identical to SEQ ID NO:74.
78. The polynucleotide of claim 4, wherein the nucleic acid sequence comprises SEQ ID NO:67.
Description:
RELATED APPLICATION INFORMATION
[0001]This application is a divisional application of U.S. application Ser. No. 10/828,924, filed Apr. 20, 2004 (now U.S. Pat. No. 7,442,766), which is a continuation of U.S. application Ser. No. 09/626,813, filed Jul. 27, 2000 (abandoned), which claims the benefit of U.S. Provisional Application Ser. No. 60/146,580, filed Jul. 30, 1999. Each of these prior application is herein incorporated by reference in its entirety.
BACKGROUND AND SUMMARY OF THE INVENTION
[0002]The invention relates to the field of replicating, amplifying, and sequencing nucleic acids. Further, this invention relates to novel proteins that enhance the activity of the polymerases.
[0003]In vitro polymerization techniques have enormously benefited the fields of biotechnology and medicine. The ability to manipulate nucleic acids with polymerization reactions greatly facilitates techniques ranging from gene characterization and molecular cloning (including, but not limited to sequencing, mutagenesis, synthesis and amplification of DNA), determining allelic variations, and detecting and screening of various diseases and conditions (e.g., hepatitis B).
[0004]An in vitro polymerization technique of great interest is the polymerase chain reaction (PCR). This method rapidly and exponentially replicates and amplifies nucleic acids of interest. PCR is performed by repeated cycles of denaturing a DNA template, usually by high temperatures, then annealing opposing primers to the complementary DNA strands, and then extending the annealed primers with a DNA polymerase. Multiple cycles of PCR result in an exponential amplification of the DNA template.
[0005]Unfortunately, PCR has limitations. These limitations range from 1) the rate of nucleotide incorporation, 2) the fidelity of nucleotide incorporation, 3) the length of the molecule to be amplified, and 4) the specificity of the polymerase.
[0006]Various methods to improve PCR exist. One approach is to optimize the reaction conditions, e.g., such as the pH, dNTP concentrations, or reaction temperatures. Another approach is to add various chemical compounds, e.g., formamide (Sarkar, G., et al. Nucl. Acids Res. 18: 7465 (1990)), tetramethyammonium chloride, and dimethyl sulfoxide (Chevet et al., Nucl. Acids Res. 23:3343-3344 (1995); Hung et al., Nucl. Acids Res. 18:4953 (1990)) to either increase the specificity of the PCR reaction and/or increase yield. Other attempts include adding various proteins, such as replication accessory factors. Replication accessory factors known to be involved in DNA replication have also increased yields and the specificity of PCR products. For example, E. coli single-stranded DNA binding protein, such as RFA, has been used to increase the yield and specificity of primer extension reactions and PCR reactions (U.S. Pat. Nos. 5,449,603, and 5,534,407). Another protein, the gene 32 protein of phage 14, appears to improve the ability to amplify larger DNA fragments (Schwartz et al., Nucl. Acids Res. 18: 1079 (1990).
[0007]An important modification that has enhanced the ease and specificity of PCR is the use of Thermus aquaticus (Taq) DNA polymerase in place of the Klenow fragment of E. coli DNA pol I (Saiki et al., Science 230:1350-1354 (1988)). The use of this thermostable DNA polymerase obviates the need for repeated enzyme additions, permits elevated annealing and primer extension temperatures, and enhances specificity. Further, this modification has enhanced the specificity of binding between the primer and its template. But, Taq polymerase has a fundamental drawback because it does not have 3' to 5' exonuclease activity and, therefore, cannot excise incorrect nucleotides added to the ends of the amplified products. Due to this limitation, the fidelity of Taq-PCR reactions typically have suffered. Therefore, those in the field have searched for another thermostable polymerase that has 3' to 5' exonuclease activity.
[0008]Polymerases having 3' to 5' exonuclease activity have been found in archaebacteria (archaea). Archaebacteria is a third kingdom, different from eukaryotes and bacteria (eubacteria). Many archaebacteria are thermophilic bacteria-like organisms that can grow in extremely high temperatures, i.e., 100° C. One such archaebacteria is Pyrococcus furiosus (Pfu). A monomeric polymerase from Pfu has been identified that has the desired 3' to 5' exonuclease activity and synthesizes nucleic acids of interest at high temperatures (Lundberg et al., Gene 108: 1-6 (1991); Cline et al., Nucl. Acids Res. 24: 3546-3551 (1996) (This polymerase is referred to as Pfu polymerase.)) A second DNA polymerase has been identified in P. furiosus which has two subunits (DP1/DP2) and is referred to as pol II. See References 1 and 15. This polymerase may also be enhanced by the accessory factors.
[0009]Certain natural proteins exist in archaebacteria, i.e., PEF (polymerase enhancing factors) that exhibit deoxyuracil triphosphatase (dUTPase) activity and that enhance the activity of Pfu polymerase (International Patent Application Publication No. WO 98/42860, published on Oct. 1, 1998). The presence of deoxyuracil-containing DNA in a DNA polymerization reaction inhibits polymerase activity (Lasken et al. (J. Biol. Chem. 271: 17692-17696)). Specifically, during the course of a normal PCR reaction, a dCTP may be deaminated into dUTP, thereby introducing a deoxyuridine into the newly synthesized DNA. But, when this newly synthesized DNA is thereafter amplified, the presence of the deoxyuridine inhibits the Pfu polymerase. The archaeal dUTPase (PEF) prevents dUTP incorporation and, thus, avoids the inhibition of the Pfu polymerase. Accordingly, the archaeal dUTPase optimizes the activity of Pfu polymerase.
[0010]According to certain embodiments, the invention provides methods of, and materials for, enhancing the polymerase activity of Pfu polymerase. Certain embodiments involve major components of the replication machinery in eukaryotes, e.g.: a helicase enzyme that unwinds the DNA helix and, thereby, provides a single-stranded DNA template; single-stranded DNA binding proteins (RFA) that bind and stabilize the resulting single-stranded DNA template; a "sliding clamp" protein (PCNA) that stabilizes the interaction between the polymerase and the primed single-stranded DNA template and that enhances synthesis of long DNA strands (also known as "processivity"); and a "clamp-loading" protein complex (RFC) that assembles the PCNA protein.
[0011]According to certain embodiments, the invention provides novel DNA replication accessory factors which have been isolated and purified from the hyperthermophilic archaeal bacteria Pyrococcus furiosus. In certain embodiments, the isolated proteins are thermostable homologues of eukaryotic DNA replication proteins PCNA, RF-C subunits, RFA, and helicases. Recent computer analysis of sequence data do not describe the proteins disclosed herein, although sequences that may be homologous to eukaryotic and/or eubacterial replication factors exist (Chedin et al., TIBS 23:273-277 (1998); Egdell and Doolittle, Cell 89: 995-998 (1997); Bull et al., Science 273:1058-1-73 (1996)).
[0012]According to certain embodiments, this invention also involves isolated polynucleotides that encode the replication accessory factors.
[0013]In certain embodiments, the polynucleotide may be cDNA, genomic DNA, mRNA, or plasmid DNA.
[0014]According to certain embodiments, the invention includes vectors comprising a polynucleotide that encodes a replication accessory factor and host cells comprising such vectors. According to certain embodiments, the invention includes polypeptides expressed in those host cells. Further, this invention provides not only the host cells and their products, but also, the methods of using such host cells to produce the polypeptides of interest.
[0015]According to certain embodiments, the invention includes methods of enhancing a nucleic acid polymerase reaction comprising the addition of one or more of the replication accessory factors to the reaction.
[0016]In certain embodiments, only one archaeal replication accessory factor will be added into the nucleic acid polymerase reaction. In other embodiments, a combination of factors may be added.
[0017]In certain embodiments, an archaeal dUTPase may be combined with one or more of those replication accessory factors to further enhance the polymerase reaction.
[0018]In certain embodiments, this invention also provides methods of synthesizing nucleic acids comprising employing an archaeal polymerase and an archaeal replication accessory factor(s).
[0019]According to certain embodiments, the invention includes methods of amplifying nucleic acids of interest comprising employing an archaeal polymerase and an archaeal replication accessory factor(s).
[0020]In certain embodiments of the inventive methods, the archaeal polymerase is Pfu polymerase. In certain embodiments of these methods, the archaeal polymerase is combined with another polymerase, such as Taq. In other embodiments of these methods, an archaeal dUTPase may also be included to enhance polymerase activity.
[0021]In certain embodiments of the inventive methods, the archaeal polymerase is P. furiosus pol II polymerase.
[0022]In certain embodiments, this invention also provides a kit used in the practice of the above-described methods.
[0023]In certain embodiments, this invention also provides a kit comprising an archaeal polymerase and at least one archaeal replication accessory factor.
[0024]In certain embodiments, those kits would also comprise an archaeal dUTPase and possibly, another polymerase, such as Taq.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025]The abbreviations used herein for amino acids in the translated protein sequences, which are single letter, and the nucleic acids are those conventionally used, as in Stryer et al., Biochemistry. 3rd ed., W.H, Freeman, N.Y. (1988) at the back cover.
[0026]FIG. 1 illustrates the identification of native PCNA in heparin sepharose fractions. Nucleotide incorporation was measured in the absence of salt to detect polymerase activity ("Pol") or in the presence of NaCl+Pfu DNA polymerase to detect PCNA.
[0027]FIG. 2 illustrates the identification of native PCNA activity in SDS-PAGE gel slices. An active heparin sepharose fraction was electrophoresed on an SDS-PAGE gel, and slices of the gel were excised and the proteins eluted. The presence of PCNA or polymerase activity was determined as described above in FIG. 1 and in the Detailed Description of Embodiments of the Invention.
[0028]FIG. 3 illustrates the DNA sequence of PCNA. (SEQ ID NO:59)
[0029]FIG. 4 illustrates the translated protein sequence of PCNA. (SEQ ID NO:60)
[0030]FIG. 5 illustrates that PCNA enhances the processivity of Pfu DNA polymerase. A 5'-radiolabelled 38 bp oligonucleotide was annealed to single-stranded M13. The template was incubated at 72° C. in the presence of cloned Pfu PCR buffer, dNTPs, and either cloned Pfu DNA polymerase or exo-Pfu DNA polymerase. To certain reactions, ˜0.1 or 10 fmoles of PCNA was added. Reactions were allowed to proceed for 1, 5, 10, or 30 minutes, and then stopped in loading buffer. The extension products were electrophoresed on CastAway® prepoured 6% (7M urea) gels, and the gels were dried and visualized by autoradiography. The length of the fully extended product is approximately 7 kb.
[0031]FIG. 6 illustrates the stimulation of TaqPlus® Long DNA polymerase blend (Stratagene) with PCNA. A 23 kb fragment was amplified from genomic DNA using 5U TaqPlus® Long polymerase blend, in the presence of native PEF, a no KCl buffer, and varying amounts of PCNA.
[0032]FIG. 7 illustrates the stimulation of TaqPlus® Long DNA polymerase blend with PCNA. A 30 kb fragment was amplified from genomic DNA using 5U TaqPlus® Long, in the presence of native PEF, a no KCl buffer, and varying amounts of PCNA.
[0033]FIG. 8 illustrates the DNA sequence of genomic RFC clones. (SEQ ID NO:61) Genomic sequences encoding the P38 and P55 subunits are located in tandem, respectively. The sequence encoding P38 contains an intein. As used herein, the term "intein" includes, but is not limited to protein splicing elements. These elements are involved in the post-translational processing of pre-proteins. The coding regions of the P38 and P55 subunits are bracketed [ ]. The intein sequence is enclosed in parentheses ( ).
[0034]FIG. 9 illustrates the translated protein sequence of the genomic RFC clone. (SEQ ID NO:62) The sequence encoding P38 and P55% respectively, are enclosed in parentheses ( ), while the sequence of the intein is bracketed [ ]. The * indicates a stop codon.
[0035]FIG. 10 illustrates the translated protein sequence of recombinant P55 clone. (SEQ ID NO:63)
[0036]FIG. 11 illustrates the translated protein sequence of recombinant P38 clone. (SEQ ID NO:64)
[0037]FIG. 12 illustrates a Western blot of immunoaffinity purified native RFC complex using anti-P38 IgG (panel A) or anti-P55 IgG (panel B). Immunoaffinity purification was carried out using rabbit anti P55 IgG as the capture reagent. Fractions are labeled as follows: +, positive control; 0, wash. F20-F34 refer to fractions eluted at pH 2.8 from the column.
[0038]FIG. 13 illustrates a protein gel of immunoaffinity purified native RFC complex. Immunoaffinity purification was carried out using rabbit anti P55 IgG as the capture reagent. Fractions are labeled as follows: +, positive P38 control; α-P38 (unrelated expt.) or α-P55 column washes (present expt.). F18-F23 refer to fractions eluted at pH 2.8 from the column.
[0039]FIG. 14 illustrates the ATPase activity of native and recombinant RFC. Positions on the TLC plate containing the released radioactive phosphate were excised and counted in a scintillation counter.
[0040]FIG. 15 illustrates that native clamp loader further stimulates primer extension by Pfu in the presence of PCNA. Primer extension reactions were carried out as described in the Detailed Description of Embodiments of the Invention.
[0041]FIG. 16 illustrates a CDNA sequence of a clone expressing RFA. (SEQ ID NO:65)
[0042]FIG. 17 illustrates the translated protein sequence of RFA. The theoretical molecular weight is 41.3 kDa. The native protein may start at the third methionine. (SEQ ID NO:66)
[0043]FIG. 18 illustrates a gel shift assay that demonstrates single-stranded DNA binding activity of P. furiosus RFA. 50 ng of a 38-mer oligo was incubated with E. coli SSB (lane 1), water (lane 2), or P. furiosus RFA (lanes 3-7) in TE buffer (lanes 1-3), 1× cloned Pfu buffer (lane 4), 50 mM Tris pH 8.5, 25 mM KCl, 2 mM MgCl2 (lane 5), 50 mM Tris pH 8.5, 25 mM KCl, 5 mM MgCl2 (lane 6), or 50 mM Tris pH 8.5, 25 mM KCl, 2 mM ZnCl2 (lane 7). Samples were incubated at 95° C. for 10 minutes, followed by 72° C. for 2 minutes prior to loading on a 4-20% acrylamide gradient gel in 1×TBE buffer. Bands were visualized by SYBR green staining and UV illumination.
[0044]FIG. 19 illustrates an increase in amplification specificity with RFA using cloned Pfu+PEF (Pfu Turbo® DNA polymerase (Stratagene)) (5.2 kb system).
[0045]FIG. 20 illustrates an increase in product yield using RFA in combination with cloned Pfu Turbo® DNA polymerase (2.1 kb system).
[0046]FIG. 21 illustrates an increase in yield and amplification specificity with RFA and E. coli SSB using Taq and Pfu DNA polymerases (0.5 kb system).
[0047]FIG. 22 illustrates the DNA sequence of recombinant helicase 2. This helicase has demonstrated PCR enhancing activity. (SEQ ID NO:67)
[0048]FIG. 23 illustrates the DNA sequence of recombinant helicase 3. (SEQ ID NO:68)
[0049]FIG. 24 illustrates the DNA sequence of recombinant helicase 4. (SEQ ID NO:69)
[0050]FIG. 25 illustrates the DNA sequence of recombinant helicase 5. (SEQ ID NO:70)
[0051]FIG. 26 illustrates the DNA sequence of recombinant helicase 6. (SEQ ID NO:71)
[0052]FIG. 27 illustrates the DNA sequence of recombinant helicase 7. (SEQ ID NO:72)
[0053]FIG. 28 illustrates the DNA sequence of recombinant helicase dna2. (SEQ ID NO:73) This helicase has demonstrated PCR enhancing activity.
[0054]FIG. 29 illustrates the translated protein sequence for helicase 2. (SEQ ID NO:74) The theoretical molecular weight is 87.9 kDa+4.0 kDa (CBP affinity tag).
[0055]FIG. 30 illustrates the translated protein sequence for helicase 3. (SEQ ID NO:75) The theoretical molecular weight is 100.0 kDa+4.0 kDa.
[0056]FIG. 31 illustrates the translated protein sequence for helicase 4. (SEQ ID NO:76) The theoretical molecular weight is 105.0 kDa+4.0 kDa.
[0057]FIG. 32 illustrates the translated protein sequence for helicase 5. (SEQ ID NO:77) The theoretical molecular weight is 86.8 kDa+4.0 kDa.
[0058]FIG. 33 illustrates the translated protein sequence for helicase 6+4.0 kDa (CBP affinity tag). (SEQ ID NO:78)
[0059]FIG. 34 illustrates the translated protein sequence for helicase 7. (SEQ ID NO:79) The theoretical molecular weight is 126.0 kDa+4.0 kDa.
[0060]FIG. 35 illustrates the translated protein sequence for helicase dna2+4.0 kDa (CBP affinity tag). (SEQ ID NO:80)
[0061]FIG. 36 illustrates the ATPase activity of helicases produced by phage induction. 1 microliter of Pfu helicases 3, 4, 5, 6, 7, and 8 (lanes 1-6 respectively), 0.8 units of porcine ATPase (9) or water (10) were incubated with 1 μl of 4.5 micromolar ATP and 1 microCurie of gamma labeled 33P ATP in 1× Optiprime buffer #3 (10 mM Tris-HCl (pH 8.3), 3.5 mM MgCl2, 75 mM KCl). The samples were incubated at 72° C. for 20 minutes before being spotted on PEI cellulose F. The samples were allowed to dry before the PEI cellulose was placed in a shallow reservoir of 0.4 M NaH2PO4. The liquid front was allowed to migrate 5 cm before being removed from the liquid and dried. The samples were exposed to x-ray film for one hour.
[0062]FIG. 37 illustrates the ATPase activity of helicases produced by IPTG induction of bacterial cultures. 1 microliter of an old lot or new lot of Pfu dna2-like helicase (lanes 1 and 2, respectively), Pfu helicase 2, 3, 4, 5 and 7 (lanes 3-7), water (8), or 0.8 units of porcine ATPase (9) were incubated with 1 μl of 4.5 micromolar ATP and 1 microCurie of gamma labeled 33P ATP in 1× Optiprime buffer #3 (10 mM Tris-HCl (pH 8.3), 3.5 mM MgCl2, 75 mM KCl). The samples were incubated at 72° C. for 20 minutes before being spotted on PEI cellulose F. After drying, the PEI cellulose was placed in a shallow reservoir of 0.4 M NaH2PO4. The liquid front was allowed to migrate 4 cm before being removed from the liquid and dried. The samples were exposed to x-ray film for one hour.
[0063]FIG. 38 illustrates the helicase displacement of bound oligos. Radioactively labeled oligonucleotides with a 3' overhang (A) or a 5' overhang (B) were annealed to M13 mp18. The reactions were incubated with 0.5 μl of putative Pfu helicases 3-7 and Pfu helicase dna2 in 50 mM Tris pH 8.5, 25 mM KCl, 5 mM MgCl2 and 5 mM ATP for 30 minutes at 55° C. 1 μl of Pfu helicase 2 was used in an identical reaction. The positive control was generated by thermally melting the annealed oligo prior to loading. The negative control was incubated with water. The samples were run on 4-20% gradient acrylamide gels in 1×TBE. The gels were dried and exposed to x-ray film.
[0064]FIG. 39 illustrates the enhancement of Pfu processivity with Pfu PCNA and RF-C.
[0065]FIG. 40 illustrates the DNA sequence of recombinant helicase 8. (SEQ ID NO:81) Molecular weight is 82.6 kDa+4 kDa CBP tag.
[0066]FIG. 41 illustrates the translated protein sequence of recombinant helicase 8. (SEQ ID NO:82)
[0067]FIG. 42 illustrates the stimulation of nucleotide incorporation by Pfu and P. furiosus pol II DNA polymerases using PCNA. Primer extension reactions were performed at 66-99° C. using primed single-stranded M13 DNA. Optimal activity was observed at or above 80° C. in the presence of PCNA (no measurements carried out between 80 and 95° C.), while reduced activity was observed above 72° C. in the absence of PCNA.
DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION
[0068]The invention provides for isolated and purified polynucleotides that encode novel DNA replication accessory factors from hyperthermophilic archaebacteria. In certain embodiments, the replication accessory factors are from Pyrococcus furiosus. These replication accessory factors may be thermostable homologues of the eukaryotic DNA replication proteins PCNA, RFC subunits, RFA, and helicases.
[0069]As used herein "isolated and purified polynucleotide" is a nucleic acid, which is substantially separate from at least one other DNA sequence that naturally accompanies the native polynucleotide. Such other DNA sequences may be, e.g., a ribosome, a polymerase, and any other human genomic sequence.
[0070]These polynucleotides include RNA, cDNA, genomic DNA, synthetic forms, e.g., oligonucleotides, antisense and sense strands, and may also include chemically or biochemically modified nucleotides, e.g., mutated nucleotides or cys-labeled nucleotides. Recombinant polynucleotides comprising the sequences otherwise not naturally occurring are also provided in this invention.
[0071]Although polynucleotides having naturally occurring sequences may be employed, such polynucleotides may be altered, e.g., by deletion, substitution, or insertion. One skilled in the art will know appropriate changes in the sequence that will encode proteins that retain biological activity. In certain preferred embodiments, polynucleotides may be changed to encode different conservative amino acid substitutions. Conservative amino acid substitutions include, but are not limited to, a change in which a given amino acid may be replaced, for example, by a residue having similar physiochemical characteristics. Examples of such conservative substitutions include, but are not limited to, substitution of one aliphatic residue for another, such as Ile, Val, Leu, or Ala for one another; substitutions of one polar residue for another, such as between Lys and Arg, Glu and Asp, or Gln and Asn; or substitutions of one aromatic residue for another, such as Phe, Trp, or Tyr for one another. Other conservative substitutions, e.g., involving substitutions of entire regions having similar hydrophobicity characteristics, are well-known. See Biochemistry: A Problems Approach, (Wood, W. B., Wilson, J. H., Benbow, R. M., and Hood, L. E., eds.) Benjamin/Cummings Publishing Co., Inc., Menlo Park, Calif. (1981), page 14-15.
[0072]cDNA or genomic libraries of various types may be screened as natural sources of the polynucleotides of the present invention, or such nucleic acids may be provided by amplification of sequences that exist in genomic DNA or other natural sources, e.g., by PCR. See, e.g., PCR Protocols: A Guide to Methods and Application, Innis, M., et al., eds., Academic Press: San Diego (1990). Genomic polynucleotides encoding the archaeal replication accessory factors may contain additional non-coding bases, or inteins, and one skilled in the art would know how to obtain such polynucleotides. One way to obtain genomic DNA sequences is by probing a genomic library with all or part of a known DNA sequence. The obtained genomic DNA sequence should encode functional proteins.
[0073]In certain embodiments of this invention, the nucleic acid sequences of the isolated polynucleotides encoding the replication accessory factors have been obtained and may be used for various purposes. In certain embodiments, the invention includes isolated and purified polynucleotides that encode the following: an archaeal PCNA, an archaeal RFC subunit P38 protein, archaeal RFC subunit P55, archaeal RFC subunit P98, archaeal RFA, and various archaeal helicases. According to certain embodiments, the invention includes eight different helicases that exist in Pfu, i.e., helicase 2 to 8, and helicase dna2. According to certain embodiments, the polynucleotide sequences are set forth in FIGS. 3, 8, 16, 23 to 28, and 40.
[0074]As used herein, the term "PCNA" may also be referred to as a "clamp" or a "sliding clamp" protein, in view of its role in clamping the DNA polymerase to the DNA template in eukaryotes.
[0075]In certain embodiments, the term "RFC subunits" includes, but is not limited to, proteins of about 55 kDa and about 38 kDa in molecular weight or subunits having the amino acid sequence set forth in FIG. 10 and FIG. 11, respectively. These subunits are referred to herein as "P55" and "P38." These subunits are part of a complex having one large subunit and at least one small subunit. P55 is considered a large subunit and P38 a small subunit.
[0076]This invention further provides for isolated and purified polynucleotides that encode amino acid sequences for various replication accessory factors, such as an archaeal PCNA, archaeal RFC subunit P38 protein, archaeal RFC subunit P55, archaeal RFA, and various archaeal helicases. According to certain embodiments, the amino acids sequences of those polynucleotides are set forth in FIGS. 4, 9 to 11, 17, 29 to 35, and 41.
[0077]These polynucleotides described herein also include nucleic acid sequences that encode for polypeptide analogs or derivatives of the various archaeal replication accessory factors, which differ from naturally-occurring forms, e.g., deletion analogs that contain less than all of the amino acids of the naturally-occurring forms, substitution analogs that have one or more amino acids replaced by other residues, and addition analogs that have one or more amino acids added to the naturally-occurring sequence. These various analogs share some or all of the biological properties of the archaeal replication accessory factors. As noted above, one skilled in the art will be able to design suitable analogs. In certain preferred embodiments, conservative amino acid substitutions will be made. In certain embodiments, the analogs will be 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to the naturally-occurring sequence.
[0078]Percent identity involves the relatedness between amino acid or nucleic acid sequences. One determines the percent of identical matches between two or more sequences with gap alignments that are addressed by a particular method. The percent identity may be determined by visual inspection and mathematical calculation. Alternatively, the percent identity of two nucleic acid sequences can be determined by comparing sequence information using the GAP computer program, version 6.0 described by Devereux et al. (Nucl. Acids Res. 12:387, 1984) and available from the University of Wisconsin Genetics Computer Group (UWGCG). The preferred default parameters for the GAP program include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) for nucleotides, and the weighted comparison matrix of Gribskov and Burgess, Nuci. Acids Res. 14:6745, 1986, as described by Schwartz and Dayhoff, eds., Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp. 353-358, 1979; (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps. Other programs used by one skilled in the art of sequence comparison may also be used.
[0079]In certain embodiments, nucleic acids may be those that hybridize under moderately or highly stringent conditions to the complement of naturally-occurring encoding nucleic acids or to nucleic acids that encode proteins having naturally-occurring amino acid sequences. As used herein, conditions of moderate stringency can be readily determined by those having ordinary skill in the art based on, for example, the length of the DNA. The basic conditions are set forth by Sambrook et al. Molecular Cloning. A Laboratory Manual, 2 ed. Vol. 1, pp. 1.101-104, Cold Spring Harbor Laboratory Press, (1989), and include use of a prewashing solution for the nitrocellulose filters 5×SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization conditions of about 50% formamide, 6×SSC at about 42° C. (or other similar hybridization solution, such as Stark's solution, in about 50% formamide at about 42° C.) and washing conditions of about 60° C., 0.5×SSC, 0.1% SDS. Conditions of high stringency can also be readily determined, by the skilled artisan based on, for example, the length of the DNA. Generally, such conditions are defined as hybridization conditions as above, and with washing at approximately 68° C., 0.2×SSC, 0.1% SDS. The skilled artisan will recognize that the temperature and wash solution salt concentration can be adjusted as necessary according to factors such as the length of the probe.
[0080]In certain embodiments, polynucleotides may have sequences different from the naturally-occurring nucleic acid sequence in view of the redundancy in the genetic code, especially if the amino acid sequences are known. Various codon substitutions may be introduced to produce various restriction sites or to optimize expression in a particular system.
[0081]The polynucleotides used in this invention will usually comprise at least about 15 nucleotides. In certain embodiments, the number of nucleotides is the minimal length required to express a biologically active replication accessory factor or, to probe for nucleic acid sequences encoding a replication accessory factor, or for nucleic acid priming.
[0082]Techniques for manipulating polynucleotides are described generally in Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd edition, eds. Sambrook et al. (Cold Spring Harbor Laboratory Press 1989)). Reagents useful in applying such techniques, e.g., restriction enzymes, are widely known in the art and commercially available from vendors such as Stratagene.
[0083]These polynucleotides may be used as nucleic acid probes and primers. Such probes and primers would be useful in screening for other archaeal replication accessory factors or screening other species for homologous replication accessory factors. The probe or primer may comprise an isolated nucleic acid, and may include a detectable label, such as a reporter molecule.
[0084]In certain embodiments of this invention, one may also want to generate viral or plasmid DNA vectors using the polynucleotides disclosed herein. The contemplated vectors include various viral vectors. Some commonly used examples are, but are not limited to, plasmids, bacteriophages, retroviruses, and adenovirus. Such vectors may be coupled with nucleic acids that encode an origin of replication (ORI) or autonomously replicating sequence (ARS), expression control sequences, e.g., promoter and enhancer sequences, and, protein processing information sites, such as RNA splice sites, polyadenylation sites, ribosome-bind sites, and mRNA stabilizing sequences. Such vectors and the methods used in constructing them are well known in the art. See, e.g., Sambrook et al: Molecular Cloning. A Laboratory Manual, 2 ed. Vol. 1, Cold Spring Harbor Laboratory Press, (1989); Pouwels et al., Cloning Vectors: A Laboratory Manual, Elsevier, N.Y., (1985); "Gene Expression Technology" Methods in Enzymology, v. 185, D. V. Goeddel, ed. Academic Press Inc., San Diego, Calif. (1990); and "Viral Vectors: Gene Therapy and Neuroscience Applications" (Kaplitt, M. G., and Loewy, A. D., eds.) Academic Press, San Diego, Calif. (1995).
[0085]These polynucleotide may include the incorporation of codons "preferred" for expression of the polynucleotides in selected nonmammalian hosts, e.g., prokaryotic or non-mammalian eukaryotic host cells.
[0086]Vectors may be used to introduce the polynucleotides of this invention into a host cell. Typically, these vectors also include transcription and translational initiation regulatory sequences operably linked to the polynucleotide that encodes an archaeal replication accessory factor. These vectors would facilitate the production of such a factor in a host cell.
[0087]In certain embodiments, to produce the replication accessory factor encoded by the polynucleotide, an appropriate promoter and compatible host cell may be chosen. Examples of compatible cells lines and expression vectors are well known in the art. Certain well known host cells are prokaryotes like E. coli, and B. Subtilis. In a prokaryotic host cell, such as E. coli, a polypeptide may include an N-terminal methionine residue to facilitate expression of the recombinant polypeptide in the prokaryotic host cell. The N-terminal Met may be cleaved from the expressed recombinant polypeptide. Examples of eukaryotic host cells are yeast, fungi, plant, insect, amphibian, avian, or mammalian cells. See, e.g., "Gene Expression Technology" Methods in Enzymology, v. 185, D. V. Goeddel, ed. Academic Press Inc., San Diego, Calif. (1990).
[0088]In certain embodiments, one may employ a selectable marker in the host cell system or vector such that transformed cells are easily detectable. In certain embodiments, such markers are detectable after the cells have been transformed. An example includes, but is not limited to, antibiotic resistance.
[0089]Those skilled in the art will be able to construct suitable expression systems in suitable host cells, especially in view of the many publications, including manuals, that discuss such information.
[0090]This invention provides a method for producing archaeal replication accessory factors by expressing a vector that comprises a polynucleotide that encodes a replication accessory factor in a suitable host-cell and purifying the expressed product. Techniques using such host cells to express, such polynucleotides are well known in the art. See, e.g., Sambrook et al. (1989).
[0091]This invention also provides recombinant protein produced by the above-described method.
[0092]The invention also provides isolated and purified archaeal replication accessory factors including, but not limited to, archaeal PCNA, archaeal RFC-P38, archaeal RFC-P55, archaeal RFA, and archaeal helicases, e.g., dna2 and helicases 2 to 8.
[0093]In certain embodiments, these accessory factors have part or all of the primary structural conformation and one or more of the biological properties of a replication accessory factor.
[0094]As used herein, "isolated and purified protein" describes a replication accessory factor separate from at least one other protein that naturally accompanies the protein.
[0095]In addition to naturally-occurring allelic forms of the replication accessory factors, this invention also includes polypeptide analogs or fragments. One of skill in the art can readily design nucleic acid sequences that express such analogs or fragments of the replication accessory factors. For example, one may use well-known site-directed mutagenesis techniques to generate polynucleotides encoding such analogs or fragments. Those analogs and fragments may have one or more of the biological functions of the naturally-occurring replication accessory factor.
[0096]Further, this invention provides a composition comprising at least one archaeal replication accessory factor for use in nucleic acid polymerase reactions. As used herein "nucleic acid polymerase reactions" includes, but is not limited to, PCR-based reactions that may include site-directed mutagenesis, amplification, and synthesis of nucleic acid of interest.
[0097]In certain embodiments of the invention, the composition further comprises at least one polymerase. Such a polymerase may include, but would not be limited to, Pfu polymerase, P. furiosus pol II polymerase, and/or Taq polymerase.
[0098]In certain embodiments, the polymerase is an archaeal polymerase. The archaeal DNA polymerase may be obtained from archaea such as Pyrococcus species GB-D, Pyrococcus species strain KOD 1, Pyrococcus woesii, Pyrococcus abysii, Pyrococcus horikoshii, Pyrodictium occultum, Archaeoglobus fulgidus, Sulfolobus solfatanicus, Sulfolobus acidocaldarium, Thermococcus litorails, Thermococcus species 9 degrees North-7, Thermococcus species JDF-3, Thermococcus gorgonarius, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Methanococcus voltae, Thermoplasma acidophilum. Related archaea from which the archaeal DNA polymerase may be obtained are also described in Archaea: A Laboratory Manual (Robb, F. T and Place, A. R., eds, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1995).
[0099]According to certain embodiments, the archaeal polymerase is related to Pfu (pol I) or P. furiosus pol II. Commercial enzymes that are related to Pfu (pol I) that are likely to function with the P. furiosus replication factors are; KOD (Toyoba), pfx (Life Technologies Inc.), Vent (New England Biolabs), Deep Vent (New England Biolabs), and Pwo (Roche Molecular Biochemicals). Archaea which contain genes that exhibit DNA sequence homology to P. furiosus pol II subunits are described in references (Makinjemi, M. et al. (1999) Trends in Biochem., Sci. 24:14-16; Ishino et al. (1998) J. Bacteriol., 180 2232-6).
[0100]In certain embodiments the archaeal factors are used with a thermostable eubacterial polymerase, or are used with a mixture of a eubacterial and archaeal polymerase. Thermostable eubacterial polymerases may be related to the pol I, pol II, or pol III class of DNA polymerases. Thermostable pol I DNA polymerases have been described in Thermus species (aquaticus, flavus, thermohilus HB-8, ruber, brokianus, caldophius GKI4, Filiformis), Bacillus species (stearothermopliilus, caldotenex YT-G, caldovelax YT-F), and Thermotoga maritima. Commercial enzymes that are related to eubacterial pol I enzymes include Taq (Stratagene) Tth (Perkin Elmer), Hot Tub/Tfl (Amersham), Klen Taq (Clone Tech), Stoffel fragment (Perkin Elmer), UlTma (Perkin Elmer), DynaZyme (Finnzymes), Bst (New England Biolabs), and Bca (Panvera). Thermostable pol III DNA polymerases have been described in Thermus aquaticus (Huang, et al. (1999) J. Mol. Evol. 48:756-69) and Thermus thermohilus (reference #13), but could be obtained from other thermophilic eubacteria. Additional thermophilic eubacteria are described in the reference: "Thermophilic Bacteria," Kristjansson, J. K., CRC Press, Inc., Boca Raton, Fla., 1992.
[0101]In certain embodiments, to further enhance the nucleic acid polymerase reaction, the invention may also include an archaeal dUTPase (PEF) in the composition.
[0102]Unlike current methods of enhancing nucleic acid polymerase reactions, this invention also discloses a method of enhancing nucleic acid polymerase reactions comprising employing a composition comprising at least one archaeal replication accessory factor. Such method will enhance the synthesis, amplification, or mutagenesis of nucleic acids of interest.
[0103]According to certain embodiments, the accessory factors enhance any polymerization reaction. Polymerization reactions include primer extension reactions, PCR, mutagenesis, isothermal amplification, DNA sequencing, and probe labeling. Such methods are well known in the art. Enhancement may be provided by stimulating nucleotide incorporation and reducing dissociation of the polymerase from the template. In addition, enhancement may be provided by reducing impediments in the nucleic acid templates, such as secondary structure and duplex DNA. Overcoming or improving such impediments through the addition of accessory factors like RFA and helicase, can allow polymerization reactions to occur more accurately or efficiently, or allow the use of lower denaturation/extension temperatures or isothermal temperatures. In addition, according to certain embodiments, RFA and helicase may provide additional benefits in non-polymerizing applications which require single-stranded nucleic acids. For example, RFA may improve the specificity of protein/nucleic acid interactions.
[0104]According to certain embodiments, PCNA alone or with other accessory factors may enhance exonuclease reactions carried out by the 3'-5' exonuclease activity of Pfu. Exonuclease reactions are used to prepare long single-stranded DNA templates. Enhancement may be provided by reducing dissociation of the polymerase from the template.
[0105]In addition to enhancing polymerization and exonuclease reactions, PCNA is expected to enhance repair processes that are mediated by Pfu or P. furiosus pol II, and that typically require additional repair proteins, such as Fen-1 and ligase.
[0106]According to certain embodiments, PCNA can also be used to enhance processes that are based upon the binding of nucleic acid sequences to complementary nucleic acid strands. For example, hybridization of labeled probes to complementary DNA or RNA strands is used in such methods as library screening, Southern blotting, Northern blotting, chip-based detection strategies, and Q-PCR detection strategies (e.g., molecular beacon hybridization probes). Such methods are well known in the art. Increasing the stability of annealed probes by the addition of PCNA may enhance specificity of hybridization reactions by allowing more stringent hybridization conditions to be used, such as higher temperature and/or lower ionic strength. Increasing the stability of primer/template interactions may also allow one to carry out more efficient polymerization reactions using RNA polymerases, reverse transcriptases and other nucleic acid polymerizing enzymes.
[0107]This invention also provides kits for nucleic acid polymerase reactions that include at least one archaeal replication accessory factor, and possibly other proteins or compounds known to enhance such reactions. In certain embodiments, the kits may also include one or more polymerases.
[0108]In certain embodiments, the kits are for synthesizing, amplifying, or mutagenizing nucleic acids of interest.
[0109]Certain embodiments of the invention are described in the following examples. However, these examples are offered solely for the purpose of illustrating the invention, and should not be interpreted as limiting the invention to these examples.
Experiments
Methods
[0110]1. Production of Accessory Factors from Pyrococcus furiosus
[0111]A. DNA Sequence Identification/PCR Primers.
[0112]The DNA sequences surrounding the DNA sequences of interest were examined for likely start and stop codons. The majority of DNA sequences of interest were identified in archaeal genome databases (Pyrococcus horekoshi, Pyrococcus furious, Methanococcus jannaschii, Methanobacterium thermoautotrophicum), through similarity to eukaryotic genes encoding replication factors of interest (see reference No. 5). Also, the oligonucleotide sequence for PCNA was identified by N-terminal peptide sequencing of a protein isolated from a native protein preparation (see below). Table 1 below lists PCR primers used to amplify the genes and to produce ends that can be modified to produce cohesive ends with a cloning vector. The sequence corresponding to the vector sequence is double underlined.
TABLE-US-00001 TABLE 1 Gene Name Forward Primer Reverse Primer RFC P98/P38 GACGACGACAAGATGAGCGAAGAGATT GGAACAAGACCCGTTCACTTCTTCCC AGAGAA AATTAGGGT (SEQ ID NO: 2) (SEQ ID NO: 3) RFC P55 GACGACGACAAGATGCCAGAGCTTCCCT GGAACAAGACCCGTTCACTTTTTAAG GGGTA AAAGTCAAA (SEQ ID NO: 4) (SEQ ID NO: 5) PCNA GACGACGACAAGATGCCATTCGAAATA GGAACAAGACCCGTTCACTCCTCAAC GTCTTTG CCTTGGGGCTA (SEQ ID NO: 6) (SEQ ID NO: 7) RFC ACTACAGCGGCTTTGG CTTTCCGACACCAGGG P98Intein (SEQ ID NO: 8) (SEQ ID NO: 9) Deletion RFA GACGACGACAAGATGATCATGAGTGCAT GGAACAAGACCCGTTCACATCACCCC TTACAAAAGAAGAAATAATC CAATTCTTCCAATTCCC (SEQ ID NO: 10) (SEQ ID NO: 11) Dna2 helicase GACGACGACAAGATGAACATAAAGAGC GGAACAAGACCCGTTCAAATGCTATC TTCATAAACAGGCTT CTTCGTTAGCACAACATA (SEQ ID NO: 12) (SEQ ID NO: 13) Helicase 2 GACGACGACAAGATGATTTGAGGAGCT GGAACAAGACCCGTTCATCTTTTTAC GTTCAAGGGATTAGAGAGTGAAAT GGCAAATGCGAATTCTTCTCCCTT (SEQ ID NO: 14) (SEQ ID NO: 15) Helicase 3 GACGACGACAAGATGTTAATAGTTGTAA GGAACAAGACCCGTTCATCGTCTCTC GACCAGGAAGAAAAAAGAATGA ACCCTTCAAAATTTTTCCTTCTTC (SEQ ID NO: 16) (SEQ ID NO: 17) Helicase 4 GACGACGACAAGATGCACATATTGATAA GGAACAAGACCCGTCTATTCCCAAA AAAAGGCAATAAAAGAGAGATT ACTTTCTAGTTTGGATGTAGTGTTT (SEQ ID NO: 18) (SEQ ID NO: 19) Helicase 5 GACGACGACAAGATGTTATTAAGGAGA GGAACAAGACCCGTCTACTCCTCATC GACTTAATACAGCCTAGGATAT CTCTATATATGGGGCAGTTATTA (SEQ ID NO: 20) (SEQ ID NO: 21) Helicase 6 GACGACGACAAGATGCTCATGAGGCCA GGAACAAGACCCGTCTAGCTTAACTT GTGAGGCTAATGATAGCTGATG AAGTAAATGCCTATCTTTCTTCT (SEQ ID NO: 22) (SEQ ID NO: 23) Helicase 7 GACGACGACAAGATGATCGAAGGTTAC GGAACAAGACCCGTTCAAAAACCTTT GAAATTAAACTAGCTGTTGTAAC CCCAGGTATGCGGGGGTCGCT (SEQ ID NO: 24) (SEQ ID NO: 25) Helicase 8 GACGACGACAAGATGAGGGTTGATGAG GGAACAAGACCCGTTCAAGATTTCAC CTGAGAGTTGATGAGAGGATA AAACTAATCAAGGGTACTTTTTCT (SEQ ID NO: 26) (SEQ ID NO: 27)
[0113]B. PCR Amplification.
[0114]1) Procedure.
[0115]DNA sequences for PCNA, RFC P98/38, RFC P55, RFA, and helicases dna2 and helicases 2-8 were amplified with various PCR enzymes and polymerase blends using the primers in Table 1. The optimal amplification procedure is described below.
[0116]PCR Reaction Mixture:
TABLE-US-00002 10 μl 10x cloned Pfu buffer (Stratagene) 0.8 100 mM dNTP 3 μl mixed primers (100 ng/μl of each primer) 1.5 μl PfuTurbo DNA polymerase (2.5 U/μl) (Stratagene) 1 μl genomic or plasmid DNA (approximately 100 ng/μl) 83.7 μl H20
[0117]2) Temperature Cycling.
[0118]Samples were amplified in a RoboCycler® temperature cycler (Stratagene). The extension time used was proportional to the amplification product size. Optimally, the extension time is 2 minutes per kilobase. The annealing temperature depended on the length and composition of the primers, which were usually designed with a Tm (melting temperature) between 50° C.-60° C. A standard temperature cycling scheme is listed below: [0119]95° C. 1 minute 1 cycle
[0120]The following three steps are performed sequentially and are repeated for 30 cycles: [0121]95° C. 1 minute [0122]50° C. 1 minute [0123]72° C. 2 minutes/kb of target
[0124]C. Cloning of PCR Products.
[0125]1) PCR Product Purification.
[0126]Three to 10 PCR reactions were generated for each DNA sequence. The PCR products were combined and purified with Stratagene's StrataPrep® PCR purification kit according to its instructions. The purified products were examined on agarose gels (1% agarose/1×TBE) to verify product size and homogeneity. The gels were stained with ethidium bromide and visualized. If any spurious bands were present, products of the correct size were isolated with Stratagene's StrataPrep® DNA gel extraction kit.
[0127]2) Insert Preparation (Ligation Independent Cloning (LIC) Method).
[0128]35 μl of purified PCR products were added to reactions containing:
TABLE-US-00003 5 μl 10x cloned Pfu buffer 1 μl 25 mM dATP 1 μl cloned Pfu DNA polymerase (2.5 u/μl)
and the volume of each reaction was brought to 50 μl with 8 μl H20. The samples were incubated for 20 minutes at 72° C. in the RoboCycler® temperature cycler. This process allows the 3' to 5' exonuclease activity of the polymerase to remove bases at the 3' ends of the PCR products until a dA nucleotide is encountered. The presence of dATP in the reaction prevents further exonucleolytic degradation of the PCR product and the exposed 5'overhangs anneal precisely with the pCALnEK vector. This vector is available commercially from Stratagene and is used to produce annealing termini complimentary to the prepared insert.
[0129]3) Annealing.
[0130]The treated PCR products were allowed to come to room temperature before 40 μl of each prepared insert was added to separate tubes containing 40 ng of the LIC-ready pCALnEK vector. Samples were mixed and left to anneal for 16 hours at room temperature.
[0131]D. Transformation.
[0132]The annealed vector/inserts were transformed into competent cells, namely, Stratagene's Epicurian Coli® XL1 10-Gold® ultracompetent cells, and selected on LB-ampicillin plates. LB media is a commonly used reagent that would be understood by those practiced in the arts. LB amp plates are made by mixing:
TABLE-US-00004 10 g NaCl 5 g Yeast Extract 10 g Tryptone 10 g Agar.
[0133]Add H20 to a final volume of 1 liter. Autoclave. Cool to 55° C. Add ampicillin to a concentration of 100 micrograms per ml. Mix well. Pour about 25 ml per plate.
[0134]Supercoiled DNA was isolated from the transformants using the instructions recommended in Stratagene's StrataPrep® Plasmid Miniprep Kit. The plasmids were used to transform BL21(DE3) CodonPlus® or BL21 (DE3) pLysS (Stratagene) cells. These cells were again selected on LB-ampicillin plates.
[0135]E. Preparation of Recombinant Protein.
[0136]1) Bacterial Expression of Recombinant Proteins.
[0137]The transformants were grown up in multiple liter batches from overnight cultures preferably in LB media supplemented with Turbo Amp® antibiotic (Stratagene) at 100 μg/_l at 37° C. with moderate aeration. When the cultures reached OD600 readings of 0.6 to 1.0, the cells were induced with 1 mM IPTG (Stratagene) and incubated in the same manner for 2 hours to overnight (16 hours). Induction causes the vector to produce recombinant protein with a calmodulin binding peptide (CBP) amino tag. The induced cells were collected by centrifugation and stored at -20° C.
[0138]Some helicase clones appeared to be unstable in BL21 (DE3) cells. Supercoiled plasmids containing these helicases were transformed into BL21 CodonPlus® cells (Stratagene) and induced with bacteriophage Lambda CE6 (Stratagene) which contains the T7 RNA polymerase gene that provides significant production of protein in BL21 cells. Five to ten ml of 3×1010 plaque forming unit (pfu)/ml lambda CE6 stock (made according to provided instructions in Lambda CE6 Induction Kit (Stratagene)) was used to induce 500 ml cultures for four hours at 37° C. with moderate aeration.
[0139]2) Purification of Recombinant Proteins.
[0140]Frozen cells were resuspended to an approximate concentration of 0.25 g/ml in buffers identical or similar to calcium binding buffer: 50 mM Tris-HCL (pH 8.0), 150 mM NaCl, 1 mM magnesium acetate and 2 mM CaCl2. Cell suspensions were subjected to sonication three times with a Bronson Sonifier 250 at a duty cycle of 80% and an output level of 5 for 45 seconds. The suspensions were left on ice to cool between sonication events. The lysate was cleared by centrifugation at 26,890 g.
[0141]The cleared lysates were added to a milliliter of calmodulin agarose (CAM agarose), equilibrated in buffer. Recombinant protein was bound to the CAM agarose (Stratagene) via the CBP tag by incubation with gentle agitation at 4° C. After two hours, the reactions were centrifuged at 3000 g for 5 minutes to collect the CAM agarose and recombinant protein. The lysate supernatant was removed and the CAM agarose was washed at least once by resuspending the resin in 50 ml of calcium binding buffer followed by collection of the CAM agarose by centrifugation as described above. The CAM agarose was transferred to a disposable 15 ml column, packed, and then washed with at least 50 ml of the calcium binding buffer. Recombinant proteins were eluted from the column by using a buffer similar or identical to 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 2 mM EGTA. Similar buffers may include 2 mM EGTA and the salt requirement may vary from protein to protein. Certain proteins required elution at higher ionic strength using a buffer with 1 M NaCl. Proteins were evaluated for size and purity using Tris-Glycine 4-20% acrylamide gradient gels (Novex) with an SDS loading dye (Novex). Gels were stained with silver or Sypro Orange (Molecular Probes).
[0142]F. Removal of Intein Sequence from Recombinant RFC P98 Clone.
[0143]By alignment to eukaryotic RFC sequences, it was observed that the RFC P98 clone contained an intein sequence. In FIG. 8, the intein sequences are marked in parentheses, and correspond to nucleotides 374 to 2028. Upon post-translational excision of the intein, the predicted size of the RFC subunit would decrease from 98 kDa to 38 kDa, and hence this RFC subunit is referred to as P38. To improve expression of recombinant P38 from the RFC P98 clone, the intein was removed by making 5' phosphate modified oligonucleotides that primed immediately upstream and downstream to the sequence coding for the intein termini (see primer sequence in table above, marked as *). The oligos were designed to have their 3' termini pointing away from the intein (inverse PCR). By using the RFC P98/pCALnEK plasmid as a template, all the plasmid/insert sequence was amplified with the exception of the intein. The PCR product was purified with StrataPrep PCR Purification Kit and ligated at room temperature for 16 hours prior to transformation, as described in section 1 (D).
2. Protein Analysis Techniques.
[0144]A. Preparation of Antibodies.
[0145]Rabbit sera containing specific IgG was prepared by immunizing rabbits with the recombinant accessory factors. CBP-tagged fusion proteins were used to immunize 1-2 New Zealand white rabbits using the following immunization schedule: each, rabbit was injected with 90-200 μg CBP-tagged fusion protein (as obtained from section 1(E)(2) above) in Complete Freund's Adjuvant (CFA); inject each rabbit with a booster 18 days later including 45-100 μg CBP-tagged fusion protein in incomplete Freund's adjuvant (IFA): inject each rabbit with a second booster of IFA 39 days later; and obtain the first serum sample 45 days later and at various times thereafter.
[0146]B. SDS-PAGE.
[0147]Native and recombinant protein samples were analyzed on 4-20% acrylamide/2.6% bis-acrylamide Tris-Glycine gels (NOVEX), stained with either silver stain or Sypro orange (Molecular Probes). Protein concentrations were determined relative to a bovine serum albumin (BSA) standard (Pierce), using Pierce's Coomassie Blue Protein assay reagent or by comparisons of relative staining intensities on SDS-PAGE gels.
[0148]C. Western Blot.
[0149]Protein samples were transferred from SDS-PAGE to nitrocellulose by 1 electroblotting using standard techniques. The blots were blocked with 1% Blotto/TBS (instant milk in tris buffered saline) for 1 hour at room temperature, followed by incubation with immunized rabbit sera which had been diluted 1:500 or 1:1000 (1 hour). Blots were washed 3 times with TBS containing 0.01% Tween 20. The blots were then incubated for 0.5-1 hour with alkaline phosphatase-conjugated goat anti-rabbit IgG, diluted 1:500 or 1:1000 in TBS-0.01% Tween 20. Finally, the blots were washed as before and then incubated in color development solution (100-mM Tris-HCl, pH 9.5, 100 mM NaCl, 5 mM MgCl2, 0.3 mg/ml NBT, and 0.15 mg/ml BCIP) for approximately 1-10 minutes. The enzyme reaction was stopped and the membrane was washed five times with deionized water.
[0150]D. Amino Acid Sequence Analysis.
[0151]Protein samples were electrophoresed and transferred to polyvinylidene difluoride (PVDF) membranes (BioRad). Blots were sent to Beckman Research Institute-City of Hope (Duarte, Calif.) for N-terminal sequence analysis.
3. Isolating DNA encoding Recombinant RFC from a Genomic Library (Alternative Method)
[0152]A Pyrococcus furiosus genomic library was plated on XL1-Blue MRF E. coli (Stratagene) at a density of approximately 2000 plaques per plate. Duralose filters (nitrocellulose on nylon backing) were used to take replicate lifts from each plate. While the first filter was on the plate, orientation marks were made by stabbing a needle through the filter and into the plate. The orientation marks were marked in pen on the back of the plate before the filter was removed. The filter lifts were treated as follows:
TABLE-US-00005 1.5-2.0 minutes 1.5 M NaCl, 0.5 M NaOH 2 minutes 0.5 M Tris (pH 8.0), 1.5 M NaCl 30 seconds 2xSSC, 0.2 M Tris (pH 7.5)
After treatment, the filters were partially dried until they were still damp, but no standing water was visible. The DNA was fixed onto the filters by UV crosslinking with the Stratalinker (Stratagene) set to the "Autolink" format according to the instructions.The filters were prehybridized in 15 ml of:
[0153]5×SSC
[0154]40 mM NaPO4 pH (6.5)
[0155]5×Denhardt's
[0156]5% Dextran Sulfate
[0157]50% Formamide
[0158]0.1 mg/ml Salmon sperm DNA (Boiled separately and added immediately prior to use)
Prehybridization was carried out at 42° C. for approximately 2 hours.
[0159]Probe was generated from a 200 bp PCR product amplified from Methanococcus jannaschii genomic DNA using the following primers:
TABLE-US-00006 Oligo #576: GAT GAA AGA GGG ATA GAT (SEQ ID NO: 36) Oligo #577: ATC TCC AGT TAG ACA GCT (SEQ ID NO: 37)
These PCR primers were designed to anneal to regions flanking a 200 bp sequence of the Methanococcus Jannaschii RFC gene that exhibits 52% amino acid identity to the RFC gene from human. (See Section 2 under Results below).
[0160]The PCR product was purified from free primers, buffer and nucleotides and 50 ng of the product was labeled with 32P-αdATP using the Stratagene Prime-It II Random Primer Labeling kit. The probe was purified from free nucleotides before being boiled for five minutes and added to the prehybridization reaction. The total probe was calculated to be 20 million cpm. Hybridization was allowed to continue overnight at 42° C. before the hybridization solution was removed and the filters were washed four times with 0.1×SSC, 0.1% SDS at 60° C. (very stringent conditions). The filters were exposed to X-ray film overnight and 20 primary isolates with strong signals on both replicate filters were picked.
[0161]Three primary isolates were diluted, plated, and screened again using the same method described above. Two filters produced positive lambda clones. Bluescript plasmid clones were excised from the lambda clones in SOLR cells (Stratagene) according to the manufacturer's instructions. The clones had inserts sizes of 8 kb and 10 kb. These plasmid clones were cut with Hind III, blotted, and probed with the original 200 bp PCR product discussed above. One positive truncated clone was isolated and sequenced from each end of the insert. The sequence showed two RF-C sequences, specifically, the C-terminus of one sequence, and the N-terminus of another.
4. Production of Accessory Factors from Native Sources
[0162]A. P. furiosus Extract.
[0163]Fermentation of P. furiosus DSM 3638 cells was carried out using the procedure described in Archaea: A Laboratory Manual, Robb, F. T. (editor-in-chief), Cold Spring Harbor Press, CSH, NY 1995. The cell paste was resuspended in lysis buffer (50 mM Tris-HCl (pH 8.2), 1 mM ethylenediaminetetraacetic acid (EDTA), 10 mM beta-mercaptoethanol (β-ME), 0.5 mM phenylmethylsulfonyl fluoride (PMSF), and 2 _g/ml aprotinin) and lysed in a French press, and then the lysate was sonicated and centrifuged.
[0164]B. Column Chromatography.
[0165]The supernatant was chromatographed on a Q-Sepharose Fast Flow column (Pharmacia), equilibrated in 50 mM Tris-HCl (pH 8.2), 1 mM EDTA, and 10 mM β-ME. Follow-through fractions were collected, adjusted to pH 7.5, and then loaded onto an SP Sepharose Big Bead column (Pharmacia), and equilibrated in buffer A (50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 1 mM dithiothreitol (DTT), 10% (v/v) glycerol, 0.1% (v/v) Igepal CA-630, and 0.1% (v/v) Tween 20). The column was eluted with a 0-0.25 M KCl gradient/Buffer A. Fractions containing DNA polymerase activity were dialyzed, and then applied to a Heparin Sepharose CL-6B column (Pharmacia), and equilibrated in Buffer B (same as buffer A, except pH 8.2). The column was eluted with a 0-0.3 M KCl gradient/Buffer B. Fractions exhibiting polymerase enhancing activity (nucleotide incorporation) (using the assay described below in Section 5(B)), or immunocrossreactivity (using the Western Blot described in Section 2(C) above) were identified. Native PCNA was further purified by excising the protein from SDS-PAGE gels.
[0166]C. Immunoaffinity Chromatography.
[0167]Immunoaffinity columns were prepared using the commercial kit from Pierce (ImmunoPure Plus Cat# 44893), following the manufacturer's method. Two milliliters of serum, mixed with 2 milliliters of kit loading/binding buffer, was used to prepare each column. Before using the column, the column and buffers were allowed to warm to room temperature.
[0168]1) Preparation of Extract.
[0169]0.5 g frozen P. furiosus cells were used for each column. The cells were lysed in 2 ml lysis buffer (50 mM Tris pH 8.0, 1 mM EDTA, and 1 mM DTT), and sonicated twice for 2 minutes on ice. The cells were spun at 26,890 g for 15 minutes and the supernatant was recovered. The lysate was mixed with an equal volume of binding buffer (10 mM Tris pH 8.0, 50 mM KCl, 0.1% Tween 80). The lysate was precleared by incubation with 4 ml of protein A beads (Pierce cat #20333) and equilibrated with binding buffer. The slurry was incubated at 4° C. for 1 hour with agitation. The precleared extract was recovered by packing the beads into a disposable column and the flow-through was collected. The column was washed with 2 ml of binding buffer and the wash was collected and pooled with the flow-through fraction. The final volume of pretreated lysate is about 6 ml. In some cases, the lysate was then run over a pre-bleed rabbit IgG control column to further clean up the lysate.
[0170]2) Immunoaffinity Chromatography.
[0171]The column was equilibrated with 15 ml binding buffer (10 mM Tris HCl (pH 8.0), 50 mM KCl, 0.1% Tween 80), and then, the 6 milliliters of precleared lysate was applied to the column. The column was washed with 10 milliliters binding buffer, followed by 10 milliliters wash buffer (10 mM Tris pH 8.0, 500 mM KCl, 0.1% Tween 80). Specific proteins were eluted with seven 1 ml washes of elution buffer (0.1 M glycine pH 2.8). One ml fractions were collected. To each collection tube, was added 50 μl 1 M Tris pH 9.5 to raise the pH of the eluates as they are collected. After eluting the protein of interest, the column was washed with 4 ml of 1M Tris pH 8.0 and then 15 milliliters of binding buffer.
5. Biochemical Assays
[0172]A. Primer Extension Assay.
[0173]The Pyrococcus furiosus accessory proteins were tested for their ability to stimulate the processivity of cloned Pfu polymerase activity on primed single-stranded M13 DNA. One version of this assay provided for detecting extension products under non-denaturing conditions using ethidium bromide staining. For this assay, a reaction cocktail was made containing:
TABLE-US-00007 5 μg/ml single-stranded M13 mp 18(+) strand DNA (Pharmacia cat# 27-1546-01) 275 ng/ml 40-mer primer (5' GGT TTT CCC AGT CAC GAC GTT GTA AAA CGA CGG CCA GTG C3') (SEQ ID NO: 38) 200 μM each Dntp 1 X cPfu buffer water to 20 μl.
[0174]Single stranded M13 DNA was mixed with primer, buffer, and water. The mix was heated to 95° C. for 2 minutes and then cooled to room temperature. The rest of the reaction components were added. Each 20 μl reaction contained 0.05 units of cloned Pfu polymerase and varying amounts of PCNA and RFC. For assessing P. furiosus RF-C enhancement, assays contained 0.025 μl of P. furiosus PCNA (about 1 ng), and varying amounts of native P. furiosus RF-C. The reactions were incubated at 72° C. for 15 minutes. 2 μl DNA loading dye (50% glycerol, 1×TBE, 0.05% bromphenol blue+0.05% xylene cyanol) was added to each sample and 15 μl of sample with dye was loaded in each well of a 1% agarose gel (Reliant, FMC cat# 54907). The gel was stained with ethidium bromide. The double-stranded M13 can be seen as a brightly staining product that migrates higher than a 12 kb marker similar to the position where a double-stranded M13 DNA control migrates. In this assay, one looks for an increase in the size of products synthesized when PCNA or PCNA+RFC are added to Pfu. Ethidium bromide staining is proportional to the amount of double-stranded DNA produced from primed single-stranded M13.
[0175]A second version of this gel-based assay allows detection of radiolabeled extension products under denaturing conditions. The same template is used, except the 40 bp primer has been phosphorylated at the 5' end with [γ-32P]ATP (>5000 Ci/mmole) and T4 polynucleotide kinase. The labeled oligo was purified using a NucTrap probe purification column (Stratagene) and then annealed with single-stranded M13 at equimolar concentrations (100 nM). The reaction cocktail comprised:
[0176]9.5 μg/ml single-stranded M13mp18 (+) strand DNA (Pharmacia)
[0177]52 ng/ml 40-mer
[0178]100 μM each dNTP
[0179]1× cloned Pfu DNA polymerase buffer
[0180]and water to 50 μl.
[0181]Single-stranded M13 DNA was mixed with primer, buffer and water. The mix was heated to 95° C. for 2 minutes and then cooled to room temperature. The rest of the reaction components were added. Each reaction contained diluted cloned Pfu DNA polymerase, and varying amounts of PCNA, and RFC. Reactions were incubated at 72° C. for varying times ranging from 1-30 minutes. The reactions were terminated by adding 3.3 μl of stop dye (95% formamide/20 mM EDTA/0.05% bromophenol blue/0.05% xylene cyanol). The reaction mixtures were then subject to polyacrylamide gel electrophoresis using 6-8% denaturing gels, and the gels are dried down and exposed to autoradiographic film. The size of the full length-extension product was determined by carrying out primer extension using excess cloned Pfu DNA polymerase for 30 minutes.
[0182]B. Stimulation of Nucleotide Incorporation
[0183]The accessory factors were also tested for the capability of increasing dNTP incorporation by Pfu DNA polymerase or P. furiosus pol II DNA polymerase. This assay involves measuring dNTP incorporation into primed M13 DNA, by isolating and counting high-molecular-weight DNA bound to DE81 filter paper. A reaction cocktail is prepared as follows:
[0184]4 μg/ml single-stranded M13 mp18(+) strand DNA (Pharmacia)
[0185]219 ng/ml 40-mer (see Section 5(A) above)
[0186]1× cloned Pfu DNA polymerase buffer (Stratagene)
[0187]300 μM each dGTP, dATP, dCTP
[0188]30 μM dTTP
[0189]5 μM 3H-TTP (NEN NEG-221H)
[0190]To 10 μl of reaction cocktail was added either 0.025 units cloned Pfu Polymerase (Stratagene) or 0.05 units P. furiosus pol II. P. furiosus pol II was PCR amplified using the DNA sequences described in reference 15 below, and recombinant CBP-DPI/DP2 DNA polymerase was cloned, expressed, and purified as described using the procedures outlined above in Section 1. To assay the temperature-dependence of PCNA enhancement (data in FIG. 42), reactions were carried out for 10 minutes in the absence or presence of 100 ng PCNA, using incubation temperatures ranging from 66-99° C.
[0191]The extension reactions were quenched on ice, and then 5 μl aliquots were spotted immediately onto DE81 filters (Whatman). Unincorporated (3H]TTP was removed by 6 washes with 2×SCC (0.3M NaCl, 30 mM sodium citrate, pH 7.0), followed by one wash with 100% ethanol. Incorporated radioactivity was measured by scintillation counting.
[0192]This assay can be modified to allow improved detection of PCNA by reducing dNTP incorporation to background levels through the addition of 200 mM KCL to the reaction mix. PCNA alone or in combination with other accessory factors can be detected by restoration of Pfu's DNA polymerase activity.
[0193]The assay cocktail contains:
TABLE-US-00008 10 μg/ml single-stranded M13 mp 18(+) strand DNA (Pharmacia cat#27-1546-01) 100 ng/ml 40-mer primer (GGT TTT CCC AGT CAC GAG GTT GTA AAA CGA CGG CCA GTG C) (SEQ ID NO: 39) 1 X cPfu buffer 200 mM KCl 30 μM each dATP, dCTP, dGTP 3 μM dTTP 5 μM 3H-dTTP (NEN cat# NET-221H) (100 μCi/mL) 100 U/ml cloned Pfu polymerase
Recombinant accessory factors or fractions derived from native P. furiosus are assayed for their ability to restore polymerase activity to the above cocktail. 1 μl samples were added to 10 μl of reaction cocktail, and reactions were incubated at 72° C. for 30 minutes. Reactions were spotted onto DE81 filter papers, which were then washed and counted as described above.
[0194]C. ATPase Assay.
[0195]One μl of RFC or helicase preparations were incubated with 1 μl of 4.5 μM ATP and 1 μCi of gamma labeled 33P-ATP in 10 mM Tris HCl (pH 8.3), 3.5 mM MgCl2, and 75 mM KCl. The samples were incubated at 72° C. for 20 minutes before being spotted on PEI cellulose F (EM Science). After drying, the PEI cellulose was placed in a shallow reservoir of 0.4 M NaH2PO4 pH 3.5. The liquid front was allowed to migrate 4-5 cm before being removed from the liquid and dried. The samples were exposed to X-ray film for one hour. Evidence of ATPase activity in samples was obtained by looking for radioactivity migrating with the liquid front. The positive control (porcine ATPase) converts 33P-γ-dATP to dADP+33P-γP; the latter product migrates with the liquid front under these TLC conditions, while the 33P-γ-dATP substrate remains near the origin. In some cases, product was quantified by excising the product spots from the PEI plate and then counting in a scintillation counter.
[0196]D. Gel Shift Assay.
[0197]A 38 base oligo (5' GGT TTT CCC AGT CAC GAC GTT GTA AAA CGA CGG CCA GT 3') (SEQ ID NO: 40) was incubated with RFA samples at 95° C. for 10 minutes, followed by 72° C. for 2 minutes, prior to loading on a 4-20% acrylamide gradient gel (Novex) in 1×TBE buffer. Bands were visualized by SYBER green staining (Molecular Probes) and UV illumination. DNA binding activity is monitored by looking for a retardation in the migration of the oligo (higher band) in the presence of RFA. Single-strand DNA binding activity is verified by showing a shift in band position using a single-stranded oligo but no shift using a double-stranded DNA duplex.
[0198]E. Helicase Assay.
[0199]Radioactively labeled oligonucleotides with a 3' overhang or a 5' overhang were annealed to M13 mp18 DNA (Pharmacia). The reactions were incubated with 0.5 μl of putative P. furiosus helicases in 50 mM Tris HCl, pH 8.5, 25 mM KCl, and 5 mM ATP for 30 minutes at 55° C. The positive control was generated by thermally melting the annealed oligo prior to loading. The samples were run on 4-20% gradient acrylamide gels in 1×TBE. The gels were dried and exposed to X-ray film. Samples with helicase activity will displace the annealed radiolabeled oligo from single-stranded M13 DNA. On a gel, helicase-displaced oligo will migrate with the same mobility as oligos melted off M13 DNA with heat (free oligo). In samples lacking helicase activity, oligo will still be bound to M13 and will migrate at a different position which will be identical to "template only" controls.
6. PCR Reactions.
[0200]PCR reactions were carried out under standard conditions. In general, amplification reactions (50 μl) contained 200-450 μM each dNTP, 1×PCR buffer, 50-200 ng of human genomic DNA template (or 100 ng Stratagene's Big Blue transgenic mouse genomic DNA for the 0.5 kb target), 100 ng of each primer, and 2.5-5U of TaqPlus® Long DNA polymerase blend, PfuTurbo DNA-polymerase, or Taq2000 DNA (Stratagene) polymerase. TaqPlus® Long PCRs were carried out in 1× buffer including: 50 mM Tricine pH 9.0, 8 mM ammonium sulfate, 0.1% Tween-20, 2.3 mM MgCl2, and 75 ng/_l BSA. PCRs using PfuTurbo or Taq2000 DNA polymerase were carried out with the PCR buffers provided with the enzymes (Stratagene). Reactions were cycled in 200 μl thin-walled tubes using any of the following temperature cyclers: Stratagene RoboCycler® 96 temperature cycler fitted with a hot top assembly, Perkin Elmer GeneAmp PCR System 9600, or MJ Research PTC-200 Pettier thermocycler. The sequences of the PCR primers are given below:
TABLE-US-00009 23 kb β-globin Forward primer: (SEQ ID NO: 44) 5'-CAC.AAG.GGC.TAC.TGG.TTG.CCG.ATT-3' Reverse primer: (SEQ ID NO: 45) 5'-AGC.TTC.CCA.ACG.TGA.TCG.CCT.TTC.TCC.CAT-3' 30 kb β-globin Forward primer: (SEQ ID NO: 46) 5'-CTC.AGA.TAT.GGC.CAA.AGA.TCT.ATA.CAC.ACC-3' Reverse primer: (SEQ ID NO: 47) 5'-AGC.TTC.CCA.ACG.TGA.TCG.CCT.TTC.TCC.CAT-3' 2.1 kb Alpha 1 Anti-Trypsin Forward primer: (SEQ ID NO: 48) 5'-GAG.GAG.AGC.AGG.AAA.GGT.GGA.AC-3' Reverse primer: (SEQ ID NO: 49) 5'-GAA.AAT.AGG.AGC.TCA.GCT.GCA.G-3' 5.2 kb Alpha 1 Anti-Trypsin Forward primer: (SEQ ID NO: 50) 5'-GAG.GAG.AGC.AGG.AAA.GGT.GGA.AC-3' Reverse primer: (SEQ ID NO: 51) 5'-GCT.GGG.AGA.AGA.CTT.CAC.TGG-3' 0.5 kb λ/lac1 (transgenic mouse genomic DNA) lambda primer: (SEQ ID NO: 52) 5'GAC.AGT.CAC.TCC.GGC.CCG-3' lacZ primer: (SEQ ID NO: 53) 5'CGA.CGA.CTC.GTG.GAG.CCC-3'
[0201]The following temperature cycling conditions were used for the 23 and 30 kb β-globin targets: 92° C. for 2 min. (1 cycle); 92° C. for 10 sec., 65° C. for 30 sec. 68° C. for 25 min. (10 cycles); 92° C. for 10 sec., 65° C. for 30 sec., 68° C. for 25 min. (with a increase of 10 sec. added progressively to the extension time with each cycle)(20 cycles). The 2.1 and 5.2 kb targets were amplified as follows: 95° C. for 1 min. (1 cycle); 95° C. for 1 min., 58° C. for 1 min., 72° C. for 2 min. (for 2 kb target) or 5 min. (for the 5.2 kb target) (30 cycles); 72° C. for 10 min. (1 cycle). The 0.5 kb target was amplified as follows: 94° C. for 1 min. (1 cycle); 94° C. for 1 min., 54° C. for 2 min., 72° C. for 1.5 min. (30 cycles); 72° C. for 10 min. (1 cycle).
Results
[0202]P. furiosus PCNA was first identified in column fractions produced during fractionating native P. furiosus extracts. PCNA was co-purified with Pfu DNA polymerase during the Q and SP column procedures discussed above. Peak PCNA activity could be resolved from peak DNA polymerase activity using the heparin sepharose column, but all PCNA-containing fractions were contaminated with DNA polymerase activity. To isolate native PCNA, fractions that could restore DNA polymerase activity to salt-inactivated Pfu DNA polymerase were studied. Such "restoration" activity was detected in column fractions eluting off the Heparin sepharose (FIG. 1). An active column fraction was then subject to SDS-PAGE and gel slices were excised and extracted to remove proteins. DNA polymerase activity was found in a gel slice recovered from a position in the gel corresponding to the migration of proteins between 64-98 kDa. In contrast, PCNA activity was recovered from a gel slice that was located at a position lying between the 30 and 36 kDa protein markers (FIG. 2). A protein band, migrating at 35 kDa, was visible on SDS-PAGE gels. This protein was transferred to a PVDF membrane (Bio Rad) and sent for amino terminal sequencing. The N-terminal sequence of the 35 kDa protein was:
[0203]PFEIVFEGAKEFAQLIDTASKL(H,I)DEAAFKVTEDG-MR (SEQ ID NO: 54) (where (H,I) means either amino acid could be present and - means that any amino acid could be present). A BLAST search of DNA sequence databases identified the 35 kDa protein as exhibiting significant homology to known eukaryotic PCNA sequences.
[0204]The sequence encoding P. furiosus PCNA was cloned in the pCALnEK vector using the PCNA PCR primers described above. The LIC-primers were designed using the DNA sequence for PCNA identified in the Pyrococcus horekoshi genome sequence database. Although closely related to archaea, Pyrococcus horekoshi is a different species of Pyrococcus than Pyrococcus furiosus. The translated N-terminus of the putative Pyrococcus horekoshi PCNA matches the chemically determined N-terminal sequence of native Pyrococcus furiosus PCNA. The DNA sequence of the pCALnEK clone encoding Pyrococcus furiosus PCNA is shown in FIG. 3, and its translated amino acid sequence is shown in FIG. 4. The predicted molecular weight of P. furiosus PCNA is 28 kDa although the apparent molecular weights of EK-digested recombinant PCNA and native PCNA are 38 and 35 kDa, respectively.
[0205]In addition to stimulating nucleotide incorporation by salt-inactivated Pfu DNA polymerase, both native and recombinant Pyrococcus furiosus PCNA preparations were shown to significantly increase the processivity of Pfu. When PCNA is added to primer extension reactions where a 5' radiolabelled primer is annealed to single stranded M13, the majority of the products generated at early time points are full-length and fewer short truncated products accumulated (FIG. 5). These results indicate that PCNA has significantly increased the processivity of Pfu polymerase (number of bases added per polymerase/DNA binding event), and the overall rate of incorporation (nucleotides incorporated per unit time) is increased.
[0206]The effects of PCNA on P. furiosus pol II DNA polymerase were also tested. PCNA was shown to stimulate dNTP incorporation by both Pfu (pol I) and P. furiosus pol II DNA polymerases. Interestingly, the addition of PCNA altered the optimal reaction temperature for both DNA polymerases. Because DNA duplexes are unstable at elevated temperatures (>Tm), assaying DNA polymerases at temperatures approaching the optimal growth temperatures of hyperthermophilic archaea (>100° C.) has been difficult. For the M13/40-mer duplex shown here, reaction temperatures above 75° C. produce template instability, consistent with the drop in activity for both polymerases between 72 and 80° C. However, in the presence of PCNA, the primer/M13 duplex appears to be stabilized at temperatures>72° C., leading to even higher primer extension activity by both Pfu (pol I) and P. furiosus pol II DNA polymerases. Thus, the M13/oligo duplex remains annealed at temperatures greater than about 80° C.
[0207]These data indicate that the addition of PCNA can have other benefits besides enhancing the polymerization rate and processivity of Pfu (pol I) and P. furiosus pol II DNA polymerases. The use of PCNA should allow the use of these hyperthermophilic enzymes at higher temperatures than has been achieved to date. PCR amplification, DNA sequencing, and isothermal amplification reactions employ extension temperatures of ≦72° C. to ensure stability of the primer/template duplex. However, this temperature is well below the expected temperature optimum of DNA polymerases from hyperthermophilic archaea like P. furiosus. It may be possible to use elevated extension temperatures during these polymerization reactions (e.g., >80° C.), which would have the benefits of increasing polymerase activity (by operating closer to optimum reaction temperature) and reducing interference from secondary structure in DNA templates.
[0208]In addition, the apparent stabilization of primer/M13 DNA duplexes by PCNA may have utility in improving applications that require high stability of nucleic acid duplexes. For example, PCNA may enhance the specificity of probe hybridization reactions by allowing the use of more stringent annealing temperatures or reaction conditions (lower ionic strength).
[0209]The effect of adding PCNA without other accessory factors to PCR amplification reactions has been tested. In the absence of other accessory factors, relatively high concentrations of PCNA (100 ng-1 ug) can inhibit product synthesis by Pfu DNA polymerase. Lower concentrations of PCNA are tolerated in PCR amplification reactions (<100 ng). PCNA is functional and beneficial to PCR amplification reactions (FIGS. 6 and 7). PCNA can dramatically increase the yield of products amplified with DNA polymerase blends including Taq, Pfu, and P. furiosus dUTPase (PEF). In the blends that have been tested, Taq is present at 2.5-5U and Pfu is present at 0.156-0.3125 U. The dUTPase may be in the form of native PEF or recombinant dUTPase (P45) (See WO 98/42860) present at 1-10 ng per reaction. PCNA enhances the processivity of the minor proofreading component in the DNA polymerase blend, while dUTPase is preventing dUTP incorporation (and subsequent Pfu inhibition), so that greater Pfu polymerase activity can be realized. The dUTPase activity is discussed in International Patent Application WO98/42860, which is incorporated in its entirety by reference. Therefore, PCNA in its optimal concentration should enhance archaeal DNA polymerases (such as Pfu, pol II), either alone, or in combination or blended with other non-proofreading DNA polymerases of eubacterial or archaeal origin. In addition, PCNA activity can be improved by the further addition of other accessory factors including P. furiosus RFC, RFA and helicase.
2. RFC.
[0210]Before this invention, the inventors were not aware of the availability of an archaeal genome sequence other than the sequence of Methanococcus jannaschii. Genome sequence of Methanococcus jannaschii contained ORFs, which exhibited significant DNA sequence homology to DNA replication proteins from eukaryotes, including one Family B DNA polymerase, two RFC subunits, and PCNA (Bult et al., 1996 (Reference No. 6)). In eukaryotes, the RFC complex is composed of five distinct subunits (one large subunit and 4 small subunits that are associated with ATPase activity) and is stimulated by PCNA. However, only two genes were identified in Methanococcus jannaschii as exhibiting homology to RFC subunits: one sequence was identified as a putative homolog of the large RFC subunit and a second sequence was identified as a putative homolog of one of the small subunits. Initially, PCR primers were based upon the DNA sequences of the putative Methanococcus jannaschii rfc genes. However, these primers did not amplify a PCR product from P. furiosus genomic DNA, presumably because of the divergence in DNA sequence between Methanococcus jannaschii and Pyrococcus furiosus.
[0211]The inventors used an alternative approach to clone P. furiosus RFC subunits. Amino acid sequence alignments between Methanococcus jannaschii and human RFC identified a 67-amino acid region with 52% identity. A portion of RFC was likely to be highly conserved among archaea, since it was relatively conserved between more distantly related organisms, i.e., humans and archaea.
[0212]A 200 bp sequence encompassing the region encoding the 67-amino acid region was amplified from Methanococcus jannaschii genomic DNA using the following primers: 5' GAT GAA AGA GGG ATA GAT (SEQ ID NO: 36) and 5' ATC TCC AGT TAG ACA GCT (SEQ ID NO: 37). The Methanococcus jannaschii sequence was used to probe a P. furiosus genomic DNA library.
[0213]One positive genomic clone was recovered which contained the sequences encoding both the large and small subunits in tandem. The DNA sequence of the genomic clone is shown is FIG. 8 and the translated amino acid sequence is shown in FIG. 9. The genomic sequences of P38 and P55 are bracketed. The nucleotide sequence of P38 is nucleotides 197 to 2835 (the intein sequence is nucleotide 374 to 2028). The nucleotide sequence of P55 is nucleotides 2839 to 4281. Examination of the DNA sequence encoding the small P. furiosus RFC subunit (P98) revealed the presence of an intein. An intein had also been identified in the gene encoding the putative Methanococcus jannaschii small RFC subunit (Bult et al, 1996).
[0214]Expression constructs were prepared by subcloning the sequences encoding the large and small subunits into the pCALnEK vector. To facilitate expression, the intein was removed from the small RFC subunit clone by amplification with primers designed to anneal to the 5' and 3' regions flanking the intein sequence and to prime in a direction opposite to the intein. The amino acid sequences of the large RFC subunit and the small "intein-less" RFC subunit are shown in FIGS. 10 and 11.
[0215]Antibodies were raised in rabbits against the P55 and P38 subunits. The native RFC complex was purified from P. furiosus extracts by immunoaffinity chromatography using either immobilized anti-P55 or anti-P38 IgG. Western blot analysis of immunoaffinity-purified RFC complex shows the presence of both subunits, regardless of the capture antibody (FIG. 12), indicating that P38 and P55 form a complex in P. furiosus as do the large and small RFC subunits in eukaryotes. The protein composition of one native RFC preparation is shown in FIG. 13. In addition to P55 and P38, there are other protein bands present which have not yet been identified.
[0216]The ATPase activity of the RFC preparations was tested (FIG. 14). RFC subunits are ATPases. That is, they convert ATP to ADP and phosphate. RFC complex in eukaryotes is known to load PCNA clamp onto DNA in a process that typically requires the conversion of ATP to ADP and phosphate. Recombinant P55 and P38 exhibited ATPase activity when assayed separately. A mixture of P55 and P38 subunits was also found to exhibit ATPase activity that increased in the presence of PCNA, but not in the presence of primed M13 DNA. In contrast, native RFC purified by immunoaffinity chromatography exhibited ATPase activity which was further stimulated by both PCNA and DNA. As the eukaryotic RFC complex is stimulated by both PCNA and DNA, it appears that the native RFC preparation, is fully functional, while the mixture of recombinant P55 and P38 may be only partially active. This conclusion was supported by primer extension studies in which a native RFC preparation from P. furiosus (Immunopurified) was shown to enhance the yield of full-length products synthesized with Pfu DNA polymerase in the presence of PCNA (FIG. 15). In contrast, a mixture of recombinant P55 and P38 with similar ATPase activity showed less enhancement of primer extension by Pfu+PCNA. It is presently unknown whether the difference in activity between native and recombinant RFC is due to differences in the P55:P38 ratios or protein modification, or to the absence of additional proteins present in the native RFC preparations. One skilled in the art could determine a solution by attempting different ratios of P55 to P38 or different reaction conditions, or by adding additional protein factors such as the ones present in a native RFC preparation.
3. RFA.
[0217]The large subunit of eukaryotic RFA was used to search the archaeal protein databases with PSI-BLAST. Hits to archaeal sequences were examined. The inventors aligned corresponding sequences to identify the putative start and stop codons of the RFA sequence in the incomplete P. furiosus genome sequence. P. furiosus rfa sequence was PCR amplified and cloned into the pCALnEK vector. The DNA sequence and translated protein sequences are shown in FIGS. 16 and 17. The apparent molecular weight of the expressed fully denatured protein was consistent with the size expected from the translated DNA sequence (41 kDa).
[0218]To assess function, P. furiosus RFA was tested for single-stranded DNA binding activity in a gel shift assay (FIG. 18). When RFA was incubated with a 38 base oligonucleotide, the migration of a percentage of the DNA was reduced, indicating that RFA does exhibit single-stranded DNA binding activity. In comparison. E. coli SSB was found to completely retard the oligo. The weaker single stranded DNA binding activity exhibited by P. furiosus RFA may be explained by use of insufficient protein, the presence of the CBP tag, or the use of suboptimal reaction conditions. The degree of migration of the oligo is related to the mass of the protein-DNA complex and the formation of protein multimers. E. coli SSB is known to form tetramers, but it is presently unknown whether P. furiosus RFA produces multimers as well.
[0219]The addition of P. furiosus RFA to amplifications carried out with Pfu and Taq DNA polymerases was shown to increase amplification specificity (FIGS. 19 and 21) and PCR product yield (FIGS. 20 and 21). The conditions were as described in Section 6 above. In FIG. 21, P. furiosus RFA produced effects which were similar to those generated by E. coli single-stranded DNA binding protein (SSB; Stratagene's Perfect Match), including increased yield and amplification specificity and retardation of DNA migration at excess concentrations (5 μl). No evaluation of the relative performances of P. furiosus RFA and E. coli single-stranded DNA binding protein in PCR has been made; however, the increased thermostability of RFA should provide an additional benefit in temperature cycling.
4. Helicase.
[0220]Coils contain multiple helicases with specialized roles in a number of processes including replication, DNA repair, recombination, transcription, and translation. Known helicases have been classified into five families based upon sequence homology. Mechanistically, there are 2 classes of helicases depending, upon whether unwinding requires a 3' overhang (3'-5' polarity) or a 5' overhang (5'-3' polarity), which is characteristic of helicases functioning in DNA replication. Archaeal replicative helicases were identified by identifying as many ORFs as possible in archaeal genomes that exhibited homology to any known eukaryotic helicase, regardless of specific metabolic role. No putative helicase sequences were excluded because helicase function between archaea and eukaryotes may be different. Moreover, the eukaryotic replicative helicase has not been conclusively identified. Using eukaryotic helicases, a PSI-BLAST search in the archaeal protein databases was conducted.
[0221]Eight putative helicases meeting the criteria were selected for analysis. The incomplete P. furiosus genome sequence was examined to identify the putative start and stop codons of these sequences and to design PCR primers for cloning. The DNA sequences are shown in FIGS. 22-28, and 40, respectively; the translated protein sequences are shown in FIGS. 29-35, and 41, respectively. The apparent molecular weights of the expressed proteins were consistent with the sizes expected from the translated DNA sequence, (see figure description of FIGS. 29-35). Future corrections in the incomplete P. furiosus genome sequence may define alternative start and stop sites.
[0222]Helicases act to displace the complimentary strand of DNA or RNA to uncover template for DNA polymerases, RNA polymerases, accessory factors, and repair factors. Helicases melt the complimentary strand in a process coupled to hydrolysis of ribo- or deoxyribonucleotides. Most helicases displace either a 5' overhang or a 3' overhang, but some helicases displace both templates or utilize different templates under different reaction conditions. Typically, a helicase will utilize one or more nucleotide triphosphates preferentially. To assess the function of the identified eight helicases, recombinant helicases were tested for ATPase activity. The ribonucleotide ATP was used, although other ribo- or deoxyribonucleotides may serve as the preferred substrate. The resulting recombinant proteins were incubated with ATP, and phosphate was detected after separation by TLC. The results in FIGS. 36 and 37 demonstrate that all eight recombinant helicases exhibit ATPase activity.
[0223]Eight recombinant helicases were tested for helicase activity. The templates used included labeled oligonucleotides annealed to single-stranded M13 mp18 DNA. The oligos had either 5' or 3' non-complementary ends. As shown in FIG. 38, helicase 2 was able to displace oligos from both templates. This helicase also melted a template which had non-complementary 5' and 3' ends (data not shown). Such a forked template mimics the "bubble" formed by, the replication fork. In addition, helicase 7 displaced the oligo with a free 3' end (FIG. 38). The lack of detectable oligo displacement does not necessarily mean that the rest of the enzymes are not helicases, because lack of helicase activity may be attributed to the use of suboptimal buffers or reaction conditions, the presence of the N-terminal CBP tag, or the use of insufficient amounts of recombinant protein. Preliminary experiments showed that the addition of diluted preparations of helicase 2 or helicase dna2 to PCRs in combination with Pfu DNA polymerase can lead to increased PCR product yield (data not shown).
[0224]All documents mentioned in this application, including but not limited to, articles, books, reviews, patents and patent applications, are hereby incorporated by reference in their entirety into this specification.
REFERENCES
[0225]1. European Patent No. EP0870832, published on Oct. 14, 1998, invented by Kato I., et al.; and assigned to Takara Shuzo Co. [0226]2. International Patent Application Publication No. WO 98/42860, published on Oct. 1, 1998, invented by Hogrefe, H. and Hansen, C.; and assigned to Stratagene. [0227]3. U.S. Pat. No. 5,866,395 issued on Feb. 2, 1999, to Eric J. Mathur. [0228]4. U.S. Pat. No. 5,545,552 issued on Aug. 13, 1996, to, Eric J. Mathur. [0229]5. Baker, T. A. and Bell, S. P., "Polymerase and the Replisome: Machines within Machines" Cell 92:295-305 (1998). [0230]6. Bult, C. J., et al, "Complete Genome Sequence of the Methanogenic Archeon, Methanococcus jannaschii" Science 273:1066-1073 (1996). [0231]7. Chedin, F., et al., "Novel Homologs of Replication Protein A in Archaea: Implications for the Evolution of ssDNA-Binding Proteins" TIBS 23:273-277 (1998). [0232]8. Cline, J., et al., "PCR Fidelity of Pfu DNA Polymerase and Other Thermostable DNA Polymerases" Nucl. Acids Res. 24: 3546-3551 (1996). [0233]9. Edgell, D. R. and Doolittle, W. F., "Archaea and the Origin(s) of DNA Replication Proteins" Cell 89:995-998 (1997). [0234]10. Kelly, T. J. et al., "Identification and Characterization of a single-stranded DNA Binding Protein from the archeon Methanococcus jannaschii" PNAS 95:14634-1 4639 (1998). [0235]11. Keohavong, P. and Sandhu, D. K., "Effects of the T4 Bacteriophage Gene 32 Product on the Efficiency and Fidelity of DNA Amplification Using T4 DNA Polymerase" Gene 144:53-58 (1994). [0236]12. Lundberg, K. S., et al., "High-Fidelity Amplification Using a Thermostable DNA Polymerase Isolated from Pyrococcus furiosus" Gene 108:1-6 (19911). [0237]13. McHenry, C. S., et al., "A DNA Polymerase Ill Holoenzyme-like Subassembly from an Extreme Thermophilic Eubacterium" J. Mol. Biol. 272:178-189 (1997). [0238]14. Mathur, E., et al., The DNA Polymerase Gene from the Hyperthermophilic Marine Archaeabacterium, Pyrococcus furiosus, Shows Sequence Homology with α-like DNA Polymerases" Nucl. Acids, Res. 19: 6952 (1991). [0239]15. Uemori, T., et al., "A Novel DNA Polymerase in the Hyperthermophilic Archeon, Pyrococctis furiosus. Gene Cloning, Expression, and Characterization" Genes to Cells 2:499-512 (1997).
Sequence CWU
1
84128PRTArtificial SequenceDescription of Artificial Sequence Zinc finger
motif 1Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa 1 5 10 15Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 20
25233DNAArtificial SequenceDescription of Artificial Sequence Primer
2gacgacgaca agatgagcga agagattaga gaa
33335DNAArtificial SequenceDescription of Artificial Sequence Primer
3ggaacaagac ccgttcactt cttcccaatt agggt
35433DNAArtificial SequenceDescription of Artificial Sequence Primer
4gacgacgaca agatgccaga gcttccctgg gta
33535DNAArtificial SequenceDescription of Artificial Sequence Primer
5ggaacaagac ccgttcactt tttaagaaag tcaaa
35634DNAArtificial SequenceDescription of Artificial Sequence Primer
6gacgacgaca agatgccatt cgaaatagtc tttg
34737DNAArtificial SequenceDescription of Artificial Sequence Primer
7ggaacaagac ccgttcactc ctcaaccctt ggggcta
37816DNAArtificial SequenceDescription of Artificial Sequence Primer
8actacagcgg ctttgg
16916DNAArtificial SequenceDescription of Artificial Sequence Primer
9ctttccgaca ccaggg
161048DNAArtificial SequenceDescription of Artificial Sequence Primer
10gacgacgaca agatgatcat gagtgcattt acaaaagaag aaataatc
481143DNAArtificial SequenceDescription of Artificial Sequence Primer
11ggaacaagac ccgttcacat cacccccaat tcttccaatt ccc
431242DNAArtificial SequenceDescription of Artificial Sequence Primer
12gacgacgaca agatgaacat aaagagcttc ataaacaggc tt
421344DNAArtificial SequenceDescription of Artificial Sequence Primer
13ggaacaagac ccgttcaaat gctatccttc gttagcacaa cata
441450DNAArtificial SequenceDescription of Artificial Sequence Primer
14gacgacgaca agatgattga ggagctgttc aagggattag agagtgaaat
501550DNAArtificial SequenceDescription of Artificial Sequence Primer
15ggaacaagac ccgttcatct ttttacggca aatgcgaatt cttctccctt
501650DNAArtificial SequenceDescription of Artificial Sequence Primer
16gacgacgaca agatgttaat agttgtaaga ccaggaagaa aaaagaatga
501750DNAArtificial SequenceDescription of Artificial Sequence Primer
17ggaacaagac ccgttcatcg tctctcaccc ttcaaaattt ttccttcttc
501850DNAArtificial SequenceDescription of Artificial Sequence Primer
18gacgacgaca agatgcacat attgataaaa aaggcaataa aagagagatt
501950DNAArtificial SequenceDescription of Artificial Sequence Primer
19ggaacaagac ccgtctattc ccaaaacttt ctagtttgga tgtagtgttt
502049DNAArtificial SequenceDescription of Artificial Sequence Primer
20gacgacgaca agatgttatt aaggagagac ttaatacagc ctaggatat
492149DNAArtificial SequenceDescription of Artificial Sequence Primer
21ggaacaagac ccgtctactc ctcatcctct atatatgggg cagttatta
492249DNAArtificial SequenceDescription of Artificial Sequence Primer
22gacgacgaca agatgctcat gaggccagtg aggctaatga tagctgatg
492349DNAArtificial SequenceDescription of Artificial Sequence Primer
23ggaacaagac ccgtctagct taacttaagt aaatgcctat ctttcttct
492450DNAArtificial SequenceDescription of Artificial Sequence Primer
24gacgacgaca agatgatcga aggttacgaa attaaactag ctgttgtaac
502547DNAArtificial SequenceDescription of Artificial Sequence Primer
25ggaacaagac ccgttcaaaa acctttccca ggtatgcggg ggtcgct
472648DNAArtificial SequenceDescription of Artificial Sequence Primer
26gacgacgaca agatgagggt tgatgagctg agagttgatg agaggata
482750DNAArtificial SequenceDescription of Artificial Sequence Primer
27ggaacaagac ccgttcaaga tttgagaaag taatcaaggg tactttttct
502848DNAArtificial SequenceDescription of Artificial Sequence Primer
28gacgacgaca agatggacag ggaggagatg attgagagat ttgcaaac
482947DNAArtificial SequenceDescription of Artificial Sequence Primer
29ggaacaagac ccgttcagac ggttttgtag taaccactct ctggcat
473025DNAArtificial SequenceDescription of Artificial Sequence Primer
30aagacctgct gcggaactac ttttg
253126DNAArtificial SequenceDescription of Artificial Sequence Primer
31actgctgcag cagttaggga tgagcg
263244DNAArtificial SequenceDescription of Artificial Sequence Primer
32gacgacgaca agatgaacga aggcatcaaa taaagcttga cgag
443342DNAArtificial SequenceDescription of Artificial Sequence Primer
33ggaacaagac ccgtttagat caacctgctc actcttaagg ga
423449DNAArtificial SequenceDescription of Artificial Sequence Primer
34gacgacgaca agatgggtgt cccaattggt gagattatac caagaaaag
493556DNAArtificial SequenceDescription of Artificial Sequence Primer
35ggaacaagac ccgtttatct cttgaaccaa ctttcaaggg ttgattgttt tccact
563618DNAArtificial SequenceDescription of Artificial Sequence Primer
36gatgaaagag ggatagat
183718DNAArtificial SequenceDescription of Artificial Sequence Primer
37atctccagtt agacagct
183840DNAArtificial SequenceDescription of Artificial Sequence Primer
38ggttttccca gtcacgacgt tgtaaaacga cggccagtgc
403940DNAArtificial SequenceDescription of Artificial Sequence Primer
39ggttttccca gtcacgacgt tgtaaaacga cggccagtgc
404038DNAArtificial SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 40ggttttccca gtcacgacgt tgtaaaacga cggccagt
384160DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 41gagagaattc ataatgataa
ggaggaaaaa attatgatcc tggacgatga ctacatcacc 604224DNAArtificial
SequenceDescription of Artificial Sequence Primer 42cacaagggct actggttgcc
gatt 244330DNAArtificial
SequenceDescription of Artificial Sequence Primer 43cagggcattg acagcagtct
tctcctcagg 304424DNAArtificial
SequenceDescription of Artificial Sequence Primer 44cacaagggct actggttgcc
gatt 244521DNAArtificial
SequenceDescription of Artificial Sequence Primer 45agcttcccaa cgtgatcgcc
t 214630DNAArtificial
SequenceDescription of Artificial Sequence Primer 46ctcagatatg gccaaagatc
tatacacacc 304722DNAArtificial
SequenceDescription of Artificial Sequence Primer 47agcttcccaa cgtgatcgcc
tt 224823DNAArtificial
SequenceDescription of Artificial Sequence Primer 48gaggagagca ggaaaggtgg
aac 234922DNAArtificial
SequenceDescription of Artificial Sequence Primer 49gaaaatagga gctcagctgc
ag 225023DNAArtificial
SequenceDescription of Artificial Sequence Primer 50gaggagagca ggaaaggtgg
aac 235121DNAArtificial
SequenceDescription of Artificial Sequence Primer 51gctgggagaa gacttcactg
g 215218DNAArtificial
SequenceDescription of Artificial Sequence Primer 52gacagtcact ccggcccg
185318DNAArtificial
SequenceDescription of Artificial Sequence Primer 53cgacgactcg tggagccc
185436PRTUnknown
OrganismDescription of Unknown Organism N-terminal sequence 54Pro
Phe Glu Ile Val Phe Glu Gly Ala Lys Glu Phe Ala Gln Leu Ile 1
5 10 15Asp Thr Ala Ser Lys Leu Xaa
Asp Glu Ala Ala Phe Lys Val Thr Glu 20 25
30Asp Gly Met Arg 355518DNAArtificial
SequenceDescription of Artificial Sequence Primer 55gatgaaagag ggatagat
185618DNAArtificial
SequenceDescription of Artificial Sequence Primer 56atctccagtt agacagct
185724DNAArtificial
SequenceDescription of Artificial Sequence Primer 57cacaagggct actggttgcc
gatt 245830DNAArtificial
SequenceDescription of Artificial Sequence Primer 58cagggcattg acagcagtct
tctcctcagg 3059750DNAArtificial
SequenceDescription of Artificial Sequence Recombinant PCNA
59atgccattcg aaatagtctt tgaaggtgca aaagagtttg cccaacttat agacaccgca
60agtaagttaa tagatgaggc cgcgtttaaa gttacagaag atgggataag catgagggcc
120atggatccaa gtagagttgt cctgattgac ctaaatctcc cgtcaagcat atttagcaaa
180tatgaagttg ttgaaccaga aacaattgga gttaacatgg accacctaaa gaagatccta
240aagagaggta aagcaaagga caccttaata ctcaagaaag gagaggaaaa cttcttagag
300ataacaattc aaggaactgc aacaagaaca tttagagttc ccctaataga tgtagaagag
360atggaagttg acctcccaga acttccattc actgcaaagg ttgtagttct tggagaagtc
420ctaaaagatg ctgttaaaga tgcctctcta gtgagtgaca gcataaaatt tattgccagg
480gaaaatgaat ttataatgaa ggcagaggga gaaacccagg aagttgagat aaagctaact
540cttgaagatg agggattatt ggacatcgag gttcaagagg agacaaagag cgcatatgga
600gtcagctatc tctccgacat ggttaaagga cttggaaagg ccgatgaagt tacaataaag
660tttggaaatg aaatgcccat gcaaatggag tattacatta gagatgaagg aagacttaca
720ttcctactag cccctagggt tgaggagtga
75060249PRTArtificial SequenceDescription of Artificial Sequence
Recombinant PCNA 60Met Pro Phe Glu Ile Val Phe Glu Gly Ala Lys Glu
Phe Ala Gln Leu 1 5 10
15Ile Asp Thr Ala Ser Lys Leu Ile Asp Glu Ala Ala Phe Lys Val Thr
20 25 30Glu Asp Gly Ile Ser Met Arg
Ala Met Asp Pro Ser Arg Val Val Leu 35 40
45Ile Asp Leu Asn Leu Pro Ser Ser Ile Phe Ser Lys Tyr Glu Val
Val 50 55 60Glu Pro Glu Thr Ile Gly
Val Asn Met Asp His Leu Lys Lys Ile Leu 65 70
75 80Lys Arg Gly Lys Ala Lys Asp Thr Leu Ile Leu
Lys Lys Gly Glu Glu 85 90
95Asn Phe Leu Glu Ile Thr Ile Gln Gly Thr Ala Thr Arg Thr Phe Arg
100 105 110Val Pro Leu Ile Asp Val
Glu Glu Met Glu Val Asp Leu Pro Glu Leu 115 120
125Pro Phe Thr Ala Lys Val Val Val Leu Gly Glu Val Leu Lys
Asp Ala 130 135 140Val Lys Asp Ala Ser
Leu Val Ser Asp Ser Ile Lys Phe Ile Ala Arg145 150
155 160Glu Asn Glu Phe Ile Met Lys Ala Glu Gly
Glu Thr Gln Glu Val Glu 165 170
175Ile Lys Leu Thr Leu Glu Asp Glu Gly Leu Leu Asp Ile Glu Val Gln
180 185 190Glu Glu Thr Lys Ser
Ala Tyr Gly Val Ser Tyr Leu Ser Asp Met Val 195
200 205Lys Gly Leu Gly Lys Ala Asp Glu Val Thr Ile Lys
Phe Gly Asn Glu 210 215 220Met Pro Met
Gln Met Glu Tyr Tyr Ile Arg Asp Glu Gly Arg Leu Thr225
230 235 240Phe Leu Leu Ala Pro Arg Val
Glu Glu 245614848DNAArtificial SequenceDescription of
Artificial Sequence Genomic RFC clone 61acccaaaatt gttattcagn
tcaacggaga agacggagta ganttggaag gagcttatcc 60agagaaatgt tcttagagaa
gttactctca gctctcagct gatctanngt ttttccttct 120tttcttctgt tcagttatng
cctaggataa gcttaataat actttgatac ctttcttagt 180ttaggtgtgt gagagtatga
gcgaagagat tagagaagtt aaggttctag aaaaaccctg 240ggttgagaag tatagacctc
aaagacttga cgacattgta ggacaagagc acatagtgaa 300aaggctcaag cactacgtca
aaactggatc aatgccccac ctactcttcg caggcccccc 360tggtgtcgga aagtgtctta
ctggagatac caaagttata gctaatggcc aactctttga 420acttggagaa cttgttgaaa
agctttctgg ggggagattt ggaccaactc cagttaaagg 480gctcaaagtt cttggaatag
atgaggatgg aaagcttaga gagtttgaag tccaatacgt 540ctacaaagat agaactgata
ggttgataaa gataaaaact cagcttggca gggagcttaa 600agtaactccg tatcacccac
ttctagtgat tggagagaat ggcgaattaa agtggattaa 660ggctgaagaa ctcaaacttg
gcgacaagct tgcaataccg agctttctcc cacttataac 720tggagaaaat ccccttgcag
agtggcttgg ttactttatg ggaagtggct atgcttatcc 780caagaattct gtcatcacgt
tcactaacga agatccactc ataagacaac gctttatgga 840actaacagag aaacttttcc
ctgatgcaaa gataagggaa agaattcacg ctgatggaac 900tccagaagtt tatgtggtat
ctaggaaagc ttggagcctt gtaaactcta ttagcttaac 960attaataccc agggaggggt
ggaaaggaat tcgttctttc cttagggcat attccgactg 1020caatggtcgg attgaaagtg
atgcaatagt tttatcaacc gataacaatg atatggccca 1080gcagatagcc tatgctttag
ccagctttgg aataatagct aaaatggatg gagaagatgt 1140tattatctca ggctcggaca
acatagagag gttcctaaat gagattggct ttagcaccca 1200aagcaaactt aaagaagccc
agaagctcat tagaaaaacc aatgtaagat ccgatggact 1260aaagattaac tatgagctaa
tctcctatgt aaaagacagg cttaggttaa atgtcaatga 1320taaaagaaat ttgagctaca
gaaatgcaaa ggagctttct tgggaactca tgaaagaaat 1380ttattatcgc cttgaggaac
tggagagact aaagaaggtc ttatcagaac ccatcttgat 1440cgactggaat gaagtagcaa
agaagagtga tgaagtaata gaaaaagcta aaattagagc 1500agagaagctc ctagaataca
taaaaggaga gagaaagcca agtttcaagg agtacattga 1560gatagcaaaa gtccttggaa
ttaacgttga acgtaccatc gaagctatga agatctttgc 1620aaagagatac tcaagctatg
ccgagattgg aagaaaactt ggaacttgga atttcaatgt 1680aaaaacaatt cttgagagcg
acacagtgga taacgttgaa atccttgaaa agataaggaa 1740aattgagctt gagctcatag
aggaaattct ttcggatgga aagctcaaag aaggtatagc 1800atatctcatt ttcctcttcc
agaatgagct ttactgggac gagataactg aagtaaaaga 1860gcttagggga gactttataa
tctatgatct tcatgttcct ggctaccaca actttattgc 1920tgggaacatg ccaacagtag
tccataacac tacagcggct ttggcccttg caagagagct 1980tttcggcgaa aactggaggc
ataacttcct cgagttgaat gcttcagatg aaagaggtat 2040aaacgtaatt agagagaaag
ttaaggagtt tgcgagaaca aagcctatag gaggagcaag 2100cttcaagata attttccttg
atgaggccga cgctttaact caagatgccc aacaagcctt 2160aagaagaacc atggaaatgt
tctcgagtaa cgttcgcttt atcttgagct gtaactacta 2220ctccaagata attgaaccca
tacagtctag atgtgcaata ttccgcttca gacctctccg 2280cgatgaggat atagcgaaga
gactaaggta cattgccgaa aatgagggct tagagctaac 2340tgaagaaggt ctccaagcaa
tactttacat agcagaagga gatatgagaa gagcaataaa 2400cattctgcaa gctgcagcag
ctctagacaa gaagatcacc gacgaaaacg tattcatggt 2460agcgagtaga gctagacctg
aagatataag agagatgatg cttcttgctc tcaaaggcaa 2520cttcttgaag gccagagaaa
agcttaggga gatacttctc aagcaaggac ttagtggaga 2580agatgtacta gttcagatgc
acaaagaagt cttcaacctg ccaatagagg agccaaagaa 2640ggttctgctt gctgataaga
taggagagta taacttcaga ctcgttgaag gggctaatga 2700aataattcag cttgaagcac
tcttagcaca gttcacccta attgggaaga agtgatgaag 2760tatgccagag cttccctggg
tagaaaaata caggccaaaa aagttaagtg aaattgtaaa 2820ccaagaagag gctatagaga
aagttagagc gtggatagag agctggttgc atggccaccc 2880ccctaagaaa aaagccctat
tattagcagg acccccaggg agcggaaaga caaccacagt 2940ctacgctcta gcaaatgagt
acaactttga agtcattgag ctcaacgcga gtgatgagag 3000aacttatgaa aaaatctcca
ggtatgttca agcagcatac actatggata tcctcggaaa 3060gaggaggaag ataatcttcc
tcgatgaagc agataatata gagcccagcg gagctaagga 3120aatcgcaaaa ctaattgata
aggccaaaaa tccaataata atggctgcaa ataagtactg 3180ggaagttcca aaagagatcc
gagaaaaagc tgagctagta gagtacaaga ggttaaccca 3240gagagatgta atgaatgcct
taataaggat cctaaagagg gaaggtataa cagttccaaa 3300agaaatcctc ctagaaatag
caaaaagatc tagtggagat ctaagagcag ctataaatga 3360tctacagacc gttgtagtgg
gtggttacga agatgctacg caagttttgg catatagaga 3420tgtagaaaag acagtctttc
aagccctagg actcgtcttt ggaagtgaca acgccaagag 3480ggcaaagatg gcaatgtgga
acttggacat gtcccctgat gaattcctgc tatgggtaga 3540tgagaacatt cctcacctct
acctaaatcc agaggagatt gcccaggcgt atgatgcaat 3600tagtagagcc gacatatacc
tcggaagggc cgccagaact ggaaactatt cactctggaa 3660gtacgcaata gatatgatga
ctgcaggagt tgccgtggca gggagaaaga gaaggggatt 3720tgtcaagttt tatcctccca
acaccctaaa gattttagcg gaaagcaaag aagaaagaga 3780gatcagagag tccataatta
aaaagataat acgagagatg cncatgagta ggctacaggc 3840aatagaaacg atgaaaataa
ttagagagat tttcgagaac aatctagacc ttgctgcgca 3900ctttacagtg ttccttggtc
tgtctgaaaa agaagttgag tttctagctg gaaaggaaaa 3960agctggtacc atttggggca
aagccttagc attaagaagg aaacttaagg agcttggaat 4020aagagaggag gagaagccta
aagttgaaat tgaagaagag gaagaagagg aagaaaagac 4080cgaagaagaa aaagaggaaa
tagaagaaaa acccgaagaa gagaaagaag aggagaagaa 4140agaaaaggaa aagccaaaga
aaggcaaaca agcaactctc tttgactttc ttaaaaagtg 4200attacccttt ttcttctatt
agagctccga ataaagttgg ccctctaatt ttttctattg 4260tctcctccac attaatcttt
acgaattgga attcctgcag cccgggggat ccactagtcc 4320tagagcggcc gccaccgcgg
tggagctcca gcttttgttc cctttagtga gggttaattt 4380cgagcttggc gtaatcatgg
tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa 4440ttccacacaa catacgaacc
cggaagcata aattgtaaac ccnggggtgc ctaatgantg 4500anctaactca cattaattgc
nttgcgctca ctgcccgctt tccantcggg aaacctgtcg 4560tgccagctgc attaatgaat
cggccaacnc gcgggganaa gcggttgcgt attgggcgct 4620cttccgcttc ctcgctcatg
actcgctgcg ctcggtcntc ggctgcggcg aacggtatca 4680gctcatcaaa ggcggtaata
cggttatccn caaatcaggg gataacgcag gaaaaaactt 4740tnnacaaaag gcnncaaaag
gcggaaacta aaaggcgcnt tctgggtttt tcntaggccc 4800nccccganaa ctcnaaaaat
caacncattc aagtgggaaa ccaaagaa 4848621603PRTArtificial
SequenceDescription of Artificial Sequence Amino acid sequence of
the genomic RFC clone 62Pro Lys Ile Val Ile Gln Xaa Asn Gly Glu Asp Gly
Val Xaa Leu Glu 1 5 10
15Gly Ala Tyr Pro Glu Lys Cys Ser Arg Ser Tyr Ser Gln Leu Ser Ala
20 25 30Asp Leu Xaa Phe Phe Leu Leu
Phe Phe Cys Ser Val Xaa Ala Asp Lys 35 40
45Leu Asn Asn Thr Leu Ile Pro Phe Leu Val Val Cys Glu Ser Met
Ser 50 55 60Glu Glu Ile Arg Glu Val
Lys Val Leu Glu Lys Pro Trp Val Glu Lys 65 70
75 80Tyr Arg Pro Gln Arg Leu Asp Asp Ile Val Gly
Gln Glu His Ile Val 85 90
95Lys Arg Leu Lys His Tyr Val Lys Thr Gly Ser Met Pro His Leu Leu
100 105 110Phe Ala Gly Pro Pro Gly
Val Gly Lys Cys Leu Thr Gly Asp Thr Lys 115 120
125Val Ile Ala Asn Gly Gln Leu Phe Glu Leu Gly Glu Leu Val
Glu Lys 130 135 140Leu Ser Gly Gly Arg
Phe Gly Pro Thr Pro Val Lys Gly Leu Lys Val145 150
155 160Leu Gly Ile Asp Glu Asp Gly Lys Leu Arg
Glu Phe Glu Val Gln Tyr 165 170
175Val Tyr Lys Asp Arg Thr Asp Arg Leu Ile Lys Ile Lys Thr Gln Leu
180 185 190Gly Arg Glu Leu Lys
Val Thr Pro Tyr His Pro Leu Leu Val Ile Gly 195
200 205Glu Asn Gly Glu Leu Lys Trp Ile Lys Ala Glu Glu
Leu Lys Leu Gly 210 215 220Asp Lys Leu
Ala Ile Pro Ser Phe Leu Pro Leu Ile Thr Gly Glu Asn225
230 235 240Pro Leu Ala Glu Trp Leu Gly
Tyr Phe Met Gly Ser Gly Tyr Ala Tyr 245
250 255Pro Lys Asn Ser Val Ile Thr Phe Thr Asn Glu Asp
Pro Leu Ile Arg 260 265 270Gln
Arg Phe Met Glu Leu Thr Glu Lys Leu Phe Pro Asp Ala Lys Ile 275
280 285Arg Glu Arg Ile His Ala Asp Gly Thr
Pro Glu Val Tyr Val Val Ser 290 295
300Arg Lys Ala Trp Ser Leu Val Asn Ser Ile Ser Leu Thr Leu Ile Pro305
310 315 320Arg Glu Gly Trp
Lys Gly Ile Arg Ser Phe Leu Arg Ala Tyr Ser Asp 325
330 335Cys Asn Gly Arg Ile Glu Ser Asp Ala Ile
Val Leu Ser Thr Asp Asn 340 345
350Asn Asp Met Ala Gln Gln Ile Ala Tyr Ala Leu Ala Ser Phe Gly Ile
355 360 365Ile Ala Lys Met Asp Gly Glu
Asp Val Ile Ile Ser Gly Ser Asp Asn 370 375
380Ile Glu Arg Phe Leu Asn Glu Ile Gly Phe Ser Thr Gln Ser Lys
Leu385 390 395 400Lys Glu
Ala Gln Lys Leu Ile Arg Lys Thr Asn Val Arg Ser Asp Gly
405 410 415Leu Lys Ile Asn Tyr Glu Leu
Ile Ser Tyr Val Lys Asp Arg Leu Arg 420 425
430Leu Asn Val Asn Asp Lys Arg Asn Leu Ser Tyr Arg Asn Ala
Lys Glu 435 440 445Leu Ser Trp Glu
Leu Met Lys Glu Ile Tyr Tyr Arg Leu Glu Glu Leu 450
455 460Glu Arg Leu Lys Lys Val Leu Ser Glu Pro Ile Leu
Ile Asp Trp Asn465 470 475
480Glu Val Ala Lys Lys Ser Asp Glu Val Ile Glu Lys Ala Lys Ile Arg
485 490 495Ala Glu Lys Leu Leu
Glu Tyr Ile Lys Gly Glu Arg Lys Pro Ser Phe 500
505 510Lys Glu Tyr Ile Glu Ile Ala Lys Val Leu Gly Ile
Asn Val Glu Arg 515 520 525Thr Ile
Glu Ala Met Lys Ile Phe Ala Lys Arg Tyr Ser Ser Tyr Ala 530
535 540Glu Ile Gly Arg Lys Leu Gly Thr Trp Asn Phe
Asn Val Lys Thr Ile545 550 555
560Leu Glu Ser Asp Thr Val Asp Asn Val Glu Ile Leu Glu Lys Ile Arg
565 570 575Lys Ile Glu Leu
Glu Leu Ile Glu Glu Ile Leu Ser Asp Gly Lys Leu 580
585 590Lys Glu Gly Ile Ala Tyr Leu Ile Phe Leu Phe
Gln Asn Glu Leu Tyr 595 600 605Trp
Asp Glu Ile Thr Glu Val Lys Glu Leu Arg Gly Asp Phe Ile Ile 610
615 620Tyr Asp Leu His Val Pro Gly Tyr His Asn
Phe Ile Ala Gly Asn Met625 630 635
640Pro Thr Val Val His Asn Thr Thr Ala Ala Leu Ala Leu Ala Arg
Glu 645 650 655Leu Phe Gly
Glu Asn Trp Arg His Asn Phe Leu Glu Leu Asn Ala Ser 660
665 670Asp Glu Arg Gly Ile Asn Val Ile Arg Glu
Lys Val Lys Glu Phe Ala 675 680
685Arg Thr Lys Pro Ile Gly Gly Ala Ser Phe Lys Ile Ile Phe Leu Asp 690
695 700Glu Ala Asp Ala Leu Thr Gln Asp
Ala Gln Gln Ala Leu Arg Arg Thr705 710
715 720Met Glu Met Phe Ser Ser Asn Val Arg Phe Ile Leu
Ser Cys Asn Tyr 725 730
735Ser Ser Lys Ile Ile Glu Pro Ile Gln Ser Arg Cys Ala Ile Phe Arg
740 745 750Phe Arg Pro Leu Arg Asp
Glu Asp Ile Ala Lys Arg Leu Arg Tyr Ile 755 760
765Ala Glu Asn Glu Gly Leu Glu Leu Thr Glu Glu Gly Leu Gln
Ala Ile 770 775 780Leu Tyr Ile Ala Glu
Gly Asp Met Arg Arg Ala Ile Asn Ile Leu Gln785 790
795 800Ala Ala Ala Ala Leu Asp Lys Lys Ile Thr
Asp Glu Asn Val Phe Met 805 810
815Val Ala Ser Arg Ala Arg Pro Glu Asp Ile Arg Glu Met Met Leu Leu
820 825 830Ala Leu Lys Gly Asn
Phe Leu Lys Ala Arg Glu Lys Leu Arg Glu Ile 835
840 845Leu Leu Lys Gln Gly Leu Ser Gly Glu Asp Val Leu
Val Gln Met His 850 855 860Lys Glu Val
Phe Asn Leu Pro Ile Glu Glu Pro Lys Lys Val Leu Leu865
870 875 880Ala Asp Lys Ile Gly Glu Tyr
Asn Phe Arg Leu Val Glu Gly Ala Asn 885
890 895Glu Ile Ile Gln Leu Glu Ala Leu Leu Ala Gln Phe
Thr Leu Ile Gly 900 905 910Lys
Lys Ser Met Pro Glu Leu Pro Trp Val Glu Lys Tyr Arg Pro Lys 915
920 925Lys Leu Ser Glu Ile Val Asn Gln Glu
Glu Ala Ile Glu Lys Val Arg 930 935
940Ala Trp Ile Glu Ser Trp Leu His Gly His Pro Pro Lys Lys Lys Ala945
950 955 960Leu Leu Leu Ala
Gly Pro Pro Gly Ser Gly Lys Thr Thr Thr Val Tyr 965
970 975Ala Leu Ala Asn Glu Tyr Asn Phe Glu Val
Ile Glu Leu Asn Ala Ser 980 985
990Asp Glu Arg Thr Tyr Glu Lys Ile Ser Arg Tyr Val Gln Ala Ala Tyr
995 1000 1005Thr Met Asp Ile Leu Gly Lys
Arg Arg Lys Ile Ile Phe Leu Asp Glu 1010 1015
1020Ala Asp Asn Ile Glu Pro Ser Gly Ala Lys Glu Ile Ala Lys Leu
Ile1025 1030 1035 1040Asp Lys
Ala Lys Asn Pro Ile Ile Met Ala Ala Asn Lys Tyr Trp Glu
1045 1050 1055Val Pro Lys Glu Ile Arg Glu
Lys Ala Glu Leu Val Glu Tyr Lys Arg 1060 1065
1070Leu Thr Gln Arg Asp Val Met Asn Ala Leu Ile Arg Ile Leu
Lys Arg 1075 1080 1085Glu Gly Ile Thr
Val Pro Lys Glu Ile Leu Leu Glu Ile Ala Lys Arg 1090
1095 1100Ser Ser Gly Asp Leu Arg Ala Ala Ile Asn Asp Leu
Gln Thr Val Val1105 1110 1115
1120Val Gly Gly Tyr Glu Asp Ala Thr Gln Val Leu Ala Tyr Arg Asp Val
1125 1130 1135Glu Lys Thr Val Phe
Gln Ala Leu Gly Leu Val Phe Gly Ser Asp Asn 1140
1145 1150Ala Lys Arg Ala Lys Met Ala Met Trp Asn Leu Asp
Met Ser Pro Asp 1155 1160 1165Glu Phe
Leu Leu Trp Val Asp Glu Asn Ile Pro His Leu Tyr Leu Asn 1170
1175 1180Pro Glu Glu Ile Ala Gln Ala Tyr Asp Ala Ile
Ser Arg Ala Asp Ile1185 1190 1195
1200Tyr Leu Gly Arg Ala Ala Arg Thr Gly Asn Tyr Ser Leu Trp Lys Tyr
1205 1210 1215Ala Ile Asp Met
Met Thr Ala Gly Val Ala Val Ala Gly Arg Lys Arg 1220
1225 1230Arg Gly Phe Val Lys Phe Tyr Pro Pro Asn Thr
Leu Lys Ile Leu Ala 1235 1240 1245Glu
Ser Lys Glu Glu Arg Glu Ile Arg Glu Ser Ile Ile Lys Lys Ile 1250
1255 1260Ile Arg Glu Met Xaa Met Ser Arg Leu Gln
Ala Ile Glu Thr Met Lys1265 1270 1275
1280Ile Ile Arg Glu Ile Phe Glu Asn Asn Leu Asp Leu Ala Ala His
Phe 1285 1290 1295Thr Val Phe
Leu Gly Leu Ser Glu Lys Glu Val Glu Phe Leu Ala Gly 1300
1305 1310Lys Glu Lys Ala Gly Thr Ile Trp Gly Lys
Ala Leu Ala Leu Arg Arg 1315 1320
1325Lys Leu Lys Glu Leu Gly Ile Arg Glu Glu Glu Lys Pro Lys Val Glu
1330 1335 1340Ile Glu Glu Glu Glu Glu Glu
Glu Glu Lys Thr Glu Glu Glu Lys Glu1345 1350
1355 1360Glu Ile Glu Glu Lys Pro Glu Glu Glu Lys Glu Glu
Glu Lys Lys Glu 1365 1370
1375Lys Glu Lys Pro Lys Lys Gly Lys Gln Ala Thr Leu Phe Asp Phe Leu
1380 1385 1390Lys Lys Leu Pro Phe Phe
Phe Tyr Ser Ser Glu Ser Trp Pro Ser Asn 1395 1400
1405Phe Phe Tyr Cys Leu Leu His Ile Asn Leu Tyr Glu Leu Glu
Phe Leu 1410 1415 1420Gln Pro Gly Gly Ser
Thr Ser Ser Arg Ala Ala Ala Thr Ala Val Glu1425 1430
1435 1440Leu Gln Leu Leu Phe Pro Leu Val Arg Val
Asn Phe Glu Leu Gly Val 1445 1450
1455Ile Met Val Ile Ala Val Ser Cys Val Lys Leu Leu Ser Ala His Asn
1460 1465 1470Ser Thr Gln His Thr
Asn Pro Glu Ala Ile Val Asn Pro Gly Val Pro 1475
1480 1485Asn Xaa Xaa Asn Ser His Leu Xaa Cys Ala His Cys
Pro Leu Ser Xaa 1490 1495 1500Arg Glu Thr
Cys Arg Ala Ser Cys Ile Asn Glu Ser Ala Asn Xaa Arg1505
1510 1515 1520Gly Xaa Ala Val Ala Tyr Trp
Ala Leu Phe Arg Phe Leu Ala His Asp 1525
1530 1535Ser Leu Arg Ser Val Xaa Gly Cys Gly Glu Arg Tyr
Gln Leu Ile Lys 1540 1545 1550Gly
Gly Asn Thr Val Ile Xaa Lys Ser Gly Asp Asn Ala Gly Lys Asn 1555
1560 1565Phe Xaa Gln Lys Ala Xaa Lys Gly Gly
Asn Lys Ala Xaa Ser Gly Phe 1570 1575
1580Phe Xaa Gly Pro Pro Arg Xaa Leu Xaa Lys Ser Thr His Ser Ser Gly1585
1590 1595 1600Lys Pro
Lys63479PRTArtificial SequenceDescription of Artificial Sequence
Recombinant P55 clone 63Met Pro Glu Leu Pro Trp Val Glu Lys Tyr Arg
Pro Lys Lys Leu Ser 1 5 10
15Glu Ile Val Asn Gln Glu Glu Ala Ile Glu Lys Val Arg Ala Trp Ile
20 25 30Glu Ser Trp Leu His Gly
His Pro Pro Lys Lys Lys Ala Leu Leu Leu 35 40
45Ala Gly Pro Pro Gly Ser Gly Lys Thr Thr Thr Val Tyr Ala
Leu Ala 50 55 60Asn Glu Tyr Asn Phe
Glu Val Ile Glu Leu Asn Ala Ser Asp Glu Arg 65 70
75 80Thr Tyr Glu Lys Ile Ser Arg Tyr Val Gln
Ala Ala Tyr Thr Met Asp 85 90
95Ile Leu Gly Lys Arg Arg Lys Ile Ile Phe Leu Asp Glu Ala Asp Asn
100 105 110Ile Glu Pro Ser Gly
Ala Lys Glu Ile Ala Lys Leu Ile Asp Lys Ala 115
120 125Lys Asn Pro Ile Ile Met Ala Ala Asn Lys Tyr Trp
Glu Val Pro Lys 130 135 140Glu Ile Arg
Glu Lys Ala Glu Leu Val Glu Tyr Lys Arg Leu Thr Gln145
150 155 160Arg Asp Val Met Asn Ala Leu
Ile Arg Ile Leu Lys Arg Glu Gly Ile 165
170 175Thr Val Pro Lys Glu Ile Leu Leu Glu Ile Ala Lys
Arg Ser Ser Gly 180 185 190Asp
Leu Arg Ala Ala Ile Asn Asp Leu Gln Thr Val Val Val Gly Gly 195
200 205Tyr Glu Asp Ala Thr Gln Val Leu Ala
Tyr Arg Asp Val Glu Lys Thr 210 215
220Val Phe Gln Ala Leu Gly Leu Val Phe Gly Ser Asp Asn Ala Lys Arg225
230 235 240Ala Lys Met Ala
Met Trp Asn Leu Asp Met Ser Pro Asp Glu Phe Leu 245
250 255Leu Trp Val Asp Glu Asn Ile Pro His Leu
Tyr Leu Asn Pro Glu Glu 260 265
270Ile Ala Gln Ala Tyr Asp Ala Ile Ser Arg Ala Asp Ile Tyr Leu Gly
275 280 285Arg Ala Ala Arg Thr Gly Asn
Tyr Ser Leu Trp Lys Tyr Ala Ile Asp 290 295
300Met Met Thr Ala Gly Val Ala Val Val Gly Arg Lys Arg Arg Gly
Phe305 310 315 320Val Lys
Phe Tyr Pro Pro Asn Thr Leu Lys Ile Leu Ala Glu Ser Lys
325 330 335Glu Glu Arg Glu Ile Arg Glu
Ser Ile Ile Lys Lys Ile Ile Arg Glu 340 345
350Met Xaa Met Ser Arg Leu Gln Ala Ile Glu Thr Met Lys Ile
Ile Arg 355 360 365Glu Ile Phe Glu
Asn Asn Leu Asp Leu Ala Ala His Phe Thr Val Phe 370
375 380Leu Gly Leu Ser Glu Lys Glu Val Glu Phe Leu Ala
Gly Lys Glu Lys385 390 395
400Ala Gly Thr Ile Trp Gly Lys Ala Leu Ala Leu Arg Arg Lys Leu Lys
405 410 415Glu Leu Gly Ile Arg
Glu Glu Glu Lys Pro Lys Val Glu Ile Glu Glu 420
425 430Glu Glu Glu Glu Glu Glu Lys Thr Glu Glu Glu Lys
Glu Glu Ile Glu 435 440 445Glu Lys
Pro Glu Glu Glu Lys Glu Glu Glu Lys Lys Glu Lys Glu Lys 450
455 460Pro Lys Lys Gly Lys Gln Ala Thr Leu Phe Asp
Phe Leu Lys Lys465 470
47564327PRTArtificial SequenceDescription of Artificial Sequence
Recombinant P38 clone 64Met Ser Glu Glu Ile Arg Glu Val Lys Val Leu
Glu Lys Pro Trp Val 1 5 10
15Glu Lys Tyr Arg Pro Gln Arg Leu Asp Asp Ile Val Gly Gln Glu His
20 25 30Ile Val Lys Arg Leu Lys
His Tyr Val Lys Thr Gly Ser Met Pro His 35 40
45Leu Leu Phe Ala Gly Pro Pro Gly Val Gly Lys Thr Thr Ala
Ala Leu 50 55 60Ala Leu Ala Arg Glu
Leu Phe Gly Glu Asn Trp Arg His Asn Phe Leu 65 70
75 80Glu Leu Asn Ala Ser Asp Glu Arg Gly Ile
Asn Val Ile Arg Glu Lys 85 90
95Val Lys Glu Phe Ala Arg Thr Lys Pro Ile Gly Gly Ala Ser Phe Lys
100 105 110Ile Ile Phe Leu Asp
Glu Ala Asp Ala Leu Thr Gln Asp Ala Gln Gln 115
120 125Ala Leu Arg Arg Thr Met Glu Met Phe Ser Ser Asn
Val Arg Phe Ile 130 135 140Leu Ser Cys
Asn Tyr Ser Ser Lys Ile Ile Glu Pro Ile Gln Ser Arg145
150 155 160Cys Ala Ile Phe Arg Phe Arg
Pro Leu Arg Asp Glu Asp Ile Ala Lys 165
170 175Arg Leu Arg Tyr Ile Ala Glu Asn Glu Gly Leu Glu
Leu Thr Glu Glu 180 185 190Gly
Leu Gln Ala Ile Leu Tyr Ile Ala Glu Gly Asp Met Arg Arg Ala 195
200 205Ile Asn Ile Leu Gln Ala Ala Ala Ala
Leu Asp Lys Lys Ile Thr Asp 210 215
220Glu Asn Val Phe Met Val Ala Ser Arg Ala Arg Pro Glu Asp Ile Arg225
230 235 240Glu Met Met Leu
Leu Ala Leu Lys Gly Asn Phe Leu Lys Ala Arg Glu 245
250 255Lys Leu Arg Glu Ile Leu Leu Lys Gln Gly
Leu Ser Gly Glu Asp Val 260 265
270Leu Val Gln Met His Lys Glu Val Phe Asn Leu Pro Ile Glu Glu Pro
275 280 285Lys Lys Val Leu Leu Ala Asp
Lys Ile Gly Glu Tyr Asn Phe Arg Leu 290 295
300Val Glu Gly Ala Asn Glu Ile Ile Gln Leu Glu Ala Leu Leu Ala
Gln305 310 315 320Phe Thr
Leu Ile Gly Lys Lys 325651077DNAArtificial
SequenceDescription of Artificial Sequence RFA clone 65atgagtgcat
ttacaaaaga agaaataatc aagaggatcc tggaagaagt ggaaggaata 60actctagaag
aaattgagaa ccaaataagg caaataatga gggaaaacaa tatttcagag 120catgcagctg
ctctcttact agcagaaagg ctgggagttg aagttaccaa aagagaagaa 180caacctttaa
tgaagattag cgacctatat ccaggaatgg atccccacga ggtcaacatt 240gttggaagaa
tacttaagaa gtatccaccg cgagaataca caaagaagga tggaagcatt 300ggaagggttg
ccagtctagt tatatacgat gatactggga gagcgagggt tgttctttgg 360gattcaaaag
ttttggagta ttacagcaag ctagaagtag gggatgttat taaggtttta 420gacgcccagg
ttagggagag cttatctggt ttgcctgaat tgcacattaa cttcagggct 480agaataatta
aaaacccaga tgatcctagg gttcaggata tcccacctct tgaagaagtt 540agagtggcaa
cttatacgag aaagaagatc agtgaggtcg agcctgggga tagatttgta 600gagcttaggg
gaacaattgc caaagtttac agagttttgg tatatgatgc atgtccagag 660tgtaagaaga
aggttgacta tgacccagga atggacgttt ggatatgtcc agaacatgga 720gaggttgagc
caataaaaat cactattctt gactttgggc ttgatgatgg ctcgggatac 780attaggatta
ccctctttgg agacgatgct gaagagttgc tgggagtagg gccagaagag 840attgcccaaa
agcttaagga aatggagagc atgggcatga ctctcaagga ggcagcgaga 900aaattggcgg
aggaagagtt ctacaatata atagggaaag aaataatcgt gaggggaaat 960gtaattgagg
acaggttctt gggcctaatc ttaagggcct cctcctggga agaagttgac 1020tacaagagag
aaattgagag aattaagagg gaattggaag aattgggggt gatgtga
107766360PRTArtificial SequenceDescription of Artificial Sequence Amino
acid sequence of RFA clone 66Met Ile Met Ser Ala Phe Thr Lys Glu Glu
Ile Ile Lys Arg Ile Leu 1 5 10
15Glu Glu Val Glu Gly Ile Thr Leu Glu Glu Ile Glu Asn Gln Ile Arg
20 25 30Gln Ile Met Arg Glu
Asn Asn Ile Ser Glu His Ala Ala Ala Leu Leu 35
40 45Leu Ala Glu Arg Leu Gly Val Glu Val Thr Lys Arg Glu
Glu Gln Pro 50 55 60Leu Met Lys Ile
Ser Asp Leu Tyr Pro Gly Met Asp Pro His Glu Val 65 70
75 80Asn Ile Val Gly Arg Ile Leu Lys Lys
Tyr Pro Pro Arg Glu Tyr Thr 85 90
95Lys Lys Asp Gly Ser Ile Gly Arg Val Ala Ser Leu Val Ile Tyr
Asp 100 105 110Asp Thr Gly Arg
Ala Arg Val Val Leu Trp Asp Ser Lys Val Leu Glu 115
120 125Tyr Tyr Ser Lys Leu Glu Val Gly Asp Val Ile Lys
Val Leu Asp Ala 130 135 140Gln Val Arg
Glu Ser Leu Ser Gly Leu Pro Glu Leu His Ile Asn Phe145
150 155 160Arg Ala Arg Ile Ile Lys Asn
Pro Asp Asp Pro Arg Val Gln Asp Ile 165
170 175Pro Pro Leu Glu Glu Val Arg Val Ala Thr Tyr Thr
Arg Lys Lys Ile 180 185 190Ser
Glu Val Glu Pro Gly Asp Arg Phe Val Glu Leu Arg Gly Thr Ile 195
200 205Ala Lys Val Tyr Arg Val Leu Val Tyr
Asp Ala Cys Pro Glu Cys Lys 210 215
220Lys Lys Val Asp Tyr Asp Pro Gly Met Asp Val Trp Ile Cys Pro Glu225
230 235 240His Gly Glu Val
Glu Pro Ile Lys Ile Thr Ile Leu Asp Phe Gly Leu 245
250 255Asp Asp Gly Ser Gly Tyr Ile Arg Ile Thr
Leu Phe Gly Asp Asp Ala 260 265
270Glu Glu Leu Leu Gly Val Gly Pro Glu Glu Ile Ala Gln Lys Leu Lys
275 280 285Glu Met Glu Ser Met Gly Met
Thr Leu Lys Glu Ala Ala Arg Lys Leu 290 295
300Ala Glu Glu Glu Phe Tyr Asn Ile Ile Gly Lys Glu Ile Ile Val
Arg305 310 315 320Gly Asn
Val Ile Glu Asp Arg Phe Leu Gly Leu Ile Leu Arg Ala Ser
325 330 335Ser Trp Glu Glu Val Asp Tyr
Lys Arg Glu Ile Glu Arg Ile Lys Arg 340 345
350Glu Leu Glu Glu Leu Gly Val Met 355
360672604DNAArtificial SequenceDescription of Artificial Sequence
Recombinant helicase 2 67atgattgagg agctgttcaa gggattagag agtgaaatcg
ttggacttca cgagattccc 60ccaaagaggg gagagtatgg ggagttcaaa ttcaggaatg
aagaagttaa tgagttagtt 120aagaggctcg gatttagact ttattctcac caagttaaag
ccctagaaaa gctgtattca 180gggaaaaacg tagttgtttc aacgcccaca gctagtggga
aaagcgagat atttaggttg 240tttatctttg acgaaatact gtcaagcccg tcctcaactt
ttctcttaat ctacccaaca 300agagccttaa taaacaacca aatggaaaaa ttcgaaaaag
aaaacactat ctttgaggag 360atttgtggaa aaagagttcg agcagaagtc ttaactggag
atacggaatg ggaaaagaga 420agagaaatca ttaggagcaa accaaacgta atcttcacga
cacccgatat gcttcatcat 480cacattcttc ccaggtggag ggattatttc tggcttttaa
aggggcttag acttcttgtc 540gtggacgaat tgcacgttta tagggggatc tttggaacaa
atgttgctta tgttttcaag 600agactctttc tcaggcttaa gagattaagt tcaagccccc
aaatactggc cctttcagca 660actttgagaa accccaaaga atttgctgaa caattttttg
agactgaatt tgaggaggtc 720aaggaagctg gaagtccaag cccgagaaga attatagtca
tgtttgagcc aagaaggttt 780actggagaac aactaatcaa gcaaattgtt gagagactaa
ctagaaagaa cataaagacc 840ttggtatttt ttgactccag aaaggggaca gaaagaatca
tgaggctttt cctgttctca 900gatgcttttg ataggatcac aacatacaaa gggacgctaa
ctaagaggga aaggtttcta 960atagagagag actttaggga gggcaacctc acagttctcc
taacgacaaa tgcactcgag 1020ttgggaattg acattggaga tttagatgca gtaataaact
atgggattcc ttcagatgga 1080ttgttttcac taattcaaag atttggtagg gccggaaggg
atccaaatag aattgcaata 1140aacgggataa ttttgagaag aaatggattg gactactatt
acaaagaaca tttcgatgag 1200ctcgttgagg gaatagaaaa gggcctagtg gagaaaatcc
ccgttaactt ggacaatgaa 1260aagatagcga aaaagcacct ccactatgcc atagctgaac
ttggagttgt ctcaattaaa 1320gaaattgagg ggagatggaa gagattcata aagaccctcg
tagaggaggg atacgtggaa 1380gttacaagaa atccaataac tggagaggaa gaaataagac
tcagaagacc tcctgtctat 1440tcttcaatta gaacggcgag cgatgaaagc tacttcttag
tcgtggatga accctggata 1500aggggagctt tgcagaggaa gaggggagcc gaacttctcc
gttttgtaaa ctacctcaaa 1560gttagaggaa tggtagttga ggaagttgat gagatagaat
tccacagaag tctactccct 1620ggaatggtct acctttcaag gggaaggccc tacatggcag
ttgataagat aaagattgag 1680aagttccact tcgtttttgc gaggcctctt ccaatcgaag
aagaaataga tactagttca 1740agtaaaattg aaaacattga gatacttgag gttaaagacg
agaaaactgt tggcccaata 1800aaagtgaagt tcggaagact tagagtaagg cacgaataca
ctggatacgc cgtgagggga 1860agagacgttg aaaggcacgt taagagatta gaagagctaa
aagatgaggg gatactaagg 1920ggagagattg acatcgtccc atacatttgg gaatcctgga
agtttgcgag ggtactcttt 1980gacaccccct acattagaga gtttgaaact gaaggtttct
ggcttgagtt tccaaacgat 2040attaggatag ttcccgaaga ggagtttagg gaattctttg
cagtggcctc tgagatagat 2100ccagagctcg cgatgttcct ctacaacaga attagtagaa
aatctctatt ccccacgctt 2160ctgggagcaa ccacacacta cataaggagt ttcatccttc
accacgccaa agataaggga 2220gaagaattcg catttgccgt aaaaaagatg atcgacagca
aggatgggat aggctcaggg 2280cttcatgcaa ttgagcccaa tataataaag cttgctccag
ttgtgactca tgtggattcg 2340agagaaatag gcggctacag ctacgatgac ttccatggaa
agccagtgat cttcatctat 2400gatgggaatg aaggcggaag cggaataatt aggcaggtgt
atgagaacgt agaaaagctg 2460atgtacagga gtttggagca tataaagaag tgtccatgca
aagacggctg tcctgcctgc 2520atatattctc ccaagtgcgg aactttcaat gaattcctcg
acaagtggat ggcaataaga 2580atatgggaaa aagtccttcc ttaa
2604682511DNAArtificial SequenceDescription of
Artificial Sequence Recombinant helicase 3 68atgttaatag ttgtaagacc
aggaagaaaa aagaatgagc tcgaggcttt tataattgaa 60aaccctccag aaaagctctc
tcaaagaaga aatttaaaag ctgatagggt agttaggctc 120ataatgagag ataatagact
ttttaaagct cttgaaggaa gtcagtattt aaatccaaag 180gaagtggaga gagcccttag
aaattcaagg atagttctgg tgaatgccaa cgagtgggaa 240gagtacttta agaagaggtt
aatgaacaaa agagttgaaa aagctgacat ctgtaggctc 300tgccttctca atgggaagat
tacagtactc actgagggaa acaggataag atacagagat 360gaatacatat gtgaaagttg
tgccgaggag gagttgaaga gagagttaag atttcgattt 420aattccatag gaatgcttga
acaggcaaag aagcttttag agagattcag agatttagac 480aaggtgattt caatttttga
tccatccttt gaccccacta agcatccaga gataacaaaa 540tgggatgagc taaaggccaa
gcatataagg gtcgagaaga tgcatataga tgagctcaac 600atccccgaag aattcaaaaa
agttctaaag gccgaaggaa taaacgaact actccccgtt 660caggtgctag cgattaaaaa
cggcctccta gagggggaga atttattggt ggtttcagca 720actgcgagtg gaaaaactct
aatcggagag cttgcaggta ttcctaaggc tctaaaggga 780aagaaaatgc tgttcctagt
tcctctagta gctttagcaa accaaaagta cgaggacttc 840aagagaagat actcaaagct
tggattaaaa gtagccatta gagtcggaat gagcaggata 900aagaccaagg aagagccaat
agttctggat actggaacag atgcacacat aatagtgggg 960acttacgaag gaatagacta
ccttctcaga gctggtaaaa agataggaaa cgttggaacg 1020gttgtaatag atgaaataca
catgctcgat gatgaggaga gaggagctag gctagatggg 1080ctcattgcaa ggttaaggaa
gctctattca aatgcccaat ttattgggct ttcagcaacc 1140gtaggaaacc ctcaggagtt
agccaggaag ctagggatga aactagtgct ttacgatgaa 1200aggcccgttg acttagagag
gcatttaata attgcgagaa atgagagtga gaagtggagg 1260tatatagcta agctgtgcaa
agccgaggcc atgagaaaga gcgagaaggg attcaagggg 1320cagacgatag tatttacatt
ttcaaggaga agatgccatg agcttgcctc attcctaacg 1380gggcagggat tgaaggctaa
ggcctaccac tcgggcctcc cctatgttca gagaaagctt 1440accgaaatgg agtttcaagc
tcaaatgatt gatgtagttg taacaacagc tgctttagga 1500gcgggagttg attttccagc
atcccaagtc atcttcgaaa gcttggccat gggaaacaag 1560tggataacag ttagggagtt
tcaccaaatg cttggcaggg ctggaaggcc acagtaccat 1620gagaaaggta aagtttacat
aatagtcgag cctgggaaaa agtactcagc tcagatggag 1680ggaactgaag atgaagtcgc
cctcaagctc ttgacttcac ccatagaacc agtaattgtt 1740gagtggagcg atgaatttga
agaggataat gtcttagctc atgcctgtgt gtttaataga 1800cttaaagtta ttgaagaagt
tcaatccctc tgcctgggag caaaccaaag tgctaaaaat 1860gttttggaaa aacttatgga
aaaggggctc gtcaaaatat atggagataa agttgaagca 1920accccatatg gaagggcggt
gagcatgagt ttcctacttc ctagggaggc agagttcatc 1980agagataact tggagagcac
tgatccaatt gagatagcaa ttaaactgct accgttcgaa 2040aacgtttacc tcccaggatc
gctccagagg gaaatagagt cagctgttag aggaaagata 2100agctcaaaca tcttttcaag
ctcctttgca tcagtgctag aagagcttga caagattata 2160cccgaaataa gcccaaatgc
tgcagaaagg ctattcctaa tataccaaga tttcttcaac 2220tgcccagagc aagactgtac
ggagtttgca atggagagaa ttgggagaaa gatcattgac 2280ttaagaagag agggatacga
gccctcaaaa atctctgagc actttaggaa ggtctatgca 2340ttaatattat accctggaga
tgtttttaca tggttagacg gaattgtgag aaaactcgag 2400gcaattgaaa gaatagcccg
agtgttcaat aagagaagag tggtagaaga cacaatcagg 2460gttagaaggg aaattgaaga
aggaaaaatt ttgaagggtg agagacgatg a 2511692943DNAArtificial
SequenceDescription of Artificial Sequence Recombinant helicase 4
69atgcacaaat acttctttcc attacctgca actaagtcaa ctttcttgct ccctgccgac
60ctcaccacag caaatccatg cttttccaag agcttaatca attctctctc tgcctgggcc
120ccttttctat acatacaatg tttttcctat ctacctctta taaacttttt aaactccttg
180acataccctc tcgagatgca catattgata aaaaaggcaa taaaagagag atttggaaag
240ttgaatgccc ttcaacaatt agcctttcat aaaattaggg gagaaggtaa aagtgtttta
300ataatagctc cgacaggaag cggaaaaact gaagccgcag taattccaat cttagacgca
360atactacggg agaatcttaa acctatagca gctatttata tagccccatt gaaggcacta
420aatagggact tgctagagag actaaagtgg tgggaagaaa aaactggggt aataatagag
480gttaggcatg gggacacgcc tacctcaaaa agattgaagc aggtaaaaaa tcctccccac
540ctattaatta caacccctga aatgctccct gctattctta cgacaaagtc cttccgtccc
600tatcttaaga acactaaatt tatcgtgata gacgagattg gtgaacttat agagaataaa
660agaggaaccc agctaatcct aaatctaaaa agacttgaat taattacaga agataaacca
720ataaggattg gcctttctgc aacaattgga agtgaagaaa aggtaaggct ttggatggaa
780gcggatgaag tggtaaagcc tcgactaaaa aagaagtaca aatttaccgt tttataccct
840cagccaattc cagaggatga aaagcttgct gaagagctca aagttccaat agaagttgca
900acgaggctaa gagttgtgtg ggatattgta gaaaagcaca agaaggtatt gatctttgtt
960aatacccgac aatttgcaga gatcttaggg catagactta aagcttgggg aaaacctgtt
1020gaagttcacc atggtagcct ttcaagggaa gcaagaatag aggcagagaa gaaacttaag
1080gaaggaaaaa taaaagcact aatttgtacc tcatcaatgg aacttggcat tgacataggg
1140gatgttgatg cagttattca gtacatgagt cctcgacagg taaataggct agtccagaga
1200gctggaagaa gcaaacatag actgtgggaa acaagcgagg cttacatcat aaccacaaac
1260gtagaagatt atctccaaag cttggcaata gcaaagctcg cactagaagg aaaactggaa
1320gatgtaaatc cctacgaaaa tgcccttgat gtcctggctc actttatagt tggtttgaca
1380atagaataca gaaatgttaa cattactgaa ccctattccc ttgcgaaatc tacttatccc
1440tacagaaagc tctcctggga agactatcag aaagttttag agattttaga agaggctaga
1500ataataagaa gagatggaga tgcaattaag ctgggaaaaa atgcctttaa gtattatttc
1560gagaacctct caacaatacc tgacgaaata agttatgcag ttatagatat tgcaagtgga
1620aaatctgttg gaagactaga tgaaaacttt gttacggaac ttgaagagag tatggaattc
1680atcatgcatg gaagaagctg gatcgtgctg gaaattaacg aaaaagaaag gataataaag
1740gttaaggaga gcaacaattt agaaagtgca ctgccaagtt gggaagggga gctcattcca
1800gttcctttgg aagttgcaga atttgttgga aagctgaaga gagagctcct atgggacaaa
1860gagagagcat taaaactgct tgagggcgtt gaatttaata aggaagaact cgaggttgca
1920atttcccaac tagtagaatc agaaccagtg gcgagtgata gagatatcat tatagaatcc
1980tatccaaaat ttgtgataat tcatgctgat tttggaaata aaattaacga agggctcaca
2040agatttatct cagtgttttt atccgcccga tatgggaata ttttcctccc aagaagtcaa
2100gctcatggaa ttataattag aagcccattt aggcttaatc ctgaagaaat aaaggaaata
2160ctgttaatga aagcagaagt tggagatatt gttgctagag gaattagaga cactccaata
2220taccgctgga agatgagtgc aattgctaag agattcggtg ccctaagaag ggacgcgaga
2280ataaaaaaag tagaaaggct gtttgaaggg acaataatag agaaggagac ttttaatgaa
2340atttaccatg ataaaatcga cattgataaa acagagaaaa ttctagaaaa aataagaaag
2400ggagaaatta gaatgaaaac tttgttcaga gaggaaataa cgcctctttc ctcttctttg
2460gcaaccctag gaggagagtt tctaattaga gatatactta cccaggagga agtagaagag
2520atatttaggg agaagttact cgatgctgag ttagtcatgg tttgtacaaa ctgcggattt
2580tcctggagaa caaaagttcg cagggttatg gatagagtca atgagttaag ctgtcccaag
2640tgtgattcca aaatgatagc tcctctacac cccaaagatt ccgaaacttt catctcagct
2700ctcaaaaagt taaaaagagg agaaaagctt agtagggaag aagaaaagta ttaccttaga
2760ggtttaaagg cggctgattt acttaaagcc tacgggaagg acgctctttt agcattagct
2820acctatgggg ttggggtaga aagcgccacc agaatactta gggattatag aggaaaatcc
2880cttataaaag cacttatcga ggcagagaaa cactacatcc aaactagaaa gttttgggaa
2940tag
2943702295DNAArtificial SequenceDescription of Artificial Sequence
Recombinant helicase 5 70gtgatgttat taaggagaga cttaatacag cctaggatat
atcaagaggt aatatacgcc 60aagtgcaaag aaacaaactg cttgattgtt ctgcccacag
gattaggtaa gacgctgata 120gctatgatga tagcagagta tagattaacg aaatatggcg
gaaaagttct aatgctcgcc 180cccactaagc ctctcgttct tcaacatgcg gaaagtttta
ggaggctatt taacctccct 240ccagaaaaaa ttgtagcact tactggagag aagagcccag
aagagagaag taaggcctgg 300gcgagagcaa aagtaattgt agccactcct caaactattg
aaaatgactt attggcggga 360agaatatctt tagaagacgt ttcgctaata gtattcgatg
aagctcacag agctgtgggc 420aattacgctt acgtctttat agcaagagag tataaaagac
aggccaaaaa cccacttgtt 480atagggttaa cagcctcccc tgggagcact cctgaaaaga
tcatggaggt aataaataac 540ttgggaattg agcatattga ataccgctcc gaaaattctc
ccgatgttag accttacgtt 600aagggaataa ggtttgaatg ggttagggtt gatctcccag
aaatatacaa ggaagtaagg 660aaacttttaa gagaaatgct tagagatgcc cttaaaccgt
tggcagaaac tggacttctt 720gaatcttctt ccccagacat tccaaagaaa gaagttctta
gagctgggca aataataaac 780gaagaaatgg cgaaaggtaa tcatgatctc agaggcttgc
ttctctatca cgcaatggct 840cttaagctac atcatgcaat tgagctgttg gaaacccaag
ggttatccgc cctgagggct 900tatataaaga agttgtatga ggaggcaaaa gcgggatcaa
caaaggctag caaggaaata 960ttctcggata agagaatgaa aaaggcaatc tcacttttag
ttcaagcgaa ggagattggg 1020cttgatcacc ccaagatgga caagttaaaa gaaataatta
gggaacaact ccaaaggaaa 1080caaaattcca aaatcatagt tttcactaac tacagagaaa
ctgcaaaaaa gatagtcaat 1140gaacttgtga aagatggaat aaaagctaaa aggttcgttg
gacaggccag caaagaaaat 1200gaccgtggac tgagtcagag agagcagaaa ttaattcttg
acgaattcgc tagaggagaa 1260ttcaacgttc tagtggcaac gagtgtagga gaggaaggac
ttgacgtgcc ggaagttgat 1320ttggttgtgt tttatgagcc agtaccatct gccataagga
gcatccaaag aaggggtaga 1380actggcaggc atatgccggg gagagttata atcctaatgg
ccaaggggac tagagatgaa 1440gcatactact ggagttccag gcaaaaggaa aagataatgc
aagagacaat agctaaggtg 1500agtcaggcaa ttaaaaagca gaagcaaact tctctagttg
attttgtgag agaaaaagag 1560agcgaaaaga cctctctaga caagtggttg aaaaaggaaa
aagaagaagc aactgaaaaa 1620gaggaaaaga aggtaaaggc tcaagagggt gtaaaagtcg
tcgtagatag cagagagctt 1680aggagtgagg ttgtgaagag acttaaactt cttggtgtaa
agttagaggt taaaacgctc 1740gatgtgggag attatataat tagtgaggac gttgcaattg
agaggaagtc agctaacgac 1800ttcattcagt caattattga tggtagactt tttgatcaag
ttaagaggct caaagaggca 1860tactcaagac cgataatgat agtcgaaggt tctttatacg
gaattagaaa cgtccatcca 1920aatgcaataa ggggggcaat agcagcggta accgtagact
ttggggtccc aataatattt 1980tcatctactc cagaggaaac cgctcaatac atctttctaa
ttgcaaagag ggagcaagag 2040gagagagaaa aacctgtgag aattagaagt gagaagaagg
cccttaccct tgccgagagg 2100cagaggttaa tagttgaggg attacctcac gtctcagcaa
ctctagctag gagattgttg 2160aagcactttg gaagtgtgga aagggtattc actgcaagcg
ttgctgagtt aatgaaagtt 2220gaaggcatag gagagaagat tgctaaggag attagaaggg
taataactgc cccatatata 2280gaggatgagg agtag
2295712823DNAArtificial SequenceDescription of
Artificial Sequence Recombinant helicase 6 71ttgaaagggt tgtttaggga
cgttatcctc cacaaccccc acctttttgt ttattcctat 60tctgataaag gcatcattcc
tttcaagcat cagttccaga ccctctatca tgccatgctc 120atgaggccag tgaggctaat
gatagctgat gagataggtc tcggaaagac cattcaagct 180cttttaatag ccaagtacct
cgattttagg ggagagattg agaaagcctt gatagtcgtt 240ccaaaagttc tgagggagca
gtggagggaa gaagtaaaga ggatcttaga ggaagctccg 300gaagtgatag agaatggtag
cgaaattgaa tggaagttga aaaggccgag gaagtacttc 360ataatatcaa tagacctagc
taagagatac accgaggaaa tactccgtca aaagtgggat 420ttagtaatag ttgacgaagt
ccacaacgcc accctgggaa cacagagata tgagttctta 480aaagaactaa ccaagaacaa
ggatttgaac gttatattcc tttcagcaac cccccacagg 540ggaaacaata gagattacct
tgcgaggctt aggctcctcg acccaactat accagaggaa 600atatccccaa tgcacgaaag
gaagatctac atgaagtcaa gagggacatt ggtactaagg 660cgaactaaga aggttgtcaa
cgaacttgaa ggagaagtgt tcaagaagtg tcactttggg 720gctgtcgtgg tagaagttag
cagagaggag agggagttct ttgaagagtt aaatagagcg 780ctattcgagc tgattaagga
tcaagctgat tactctccct taactcttct tgcagtaatc 840attaggaaga gagcctcgtc
cagctacgaa gcggctctaa aaaccctaac caggatcgtt 900gaaagcgctt atataagtgg
gcaagaaaga gccagaggcg ttgaatcata cattgaaaag 960atctttagaa tggggtatga
ggaattggaa atagaagaat ttaacgagat agatgatgcg 1020atacacaaaa taatagatga
atatagggga ttcttaactg aagagcaact cgaaaggctt 1080agaagagttc tcgagcttgg
aaagaaaatt ggcagcaagg atagcaagct tgaggttata 1140tccgatatag ttgcttatca
cattaggaac ggcgaaaagg tcataatatt cacggaattt 1200agagataccc tcgaatacgt
acttgagagg ttaccagata tcctaaggag aaagcacggc 1260attgttttgg aaaaagatga
cattgcaaaa cttcatgggg gcatgaaatc tgaggaaata 1320gagagggaaa tcaacaagtt
tcatgaaagg gctaacctat tagtctctac ggatgttgca 1380tccgaaggac ttaacctgca
cgttgcaagt gttgtaataa actacgaggc cccctggagc 1440ccaataaagc tcgaacagag
ggtgggaaga atatggaggc tcaaccaaac gagagaaacc 1500aaagcatata ccatatttct
tgcaacggaa acggacttgg atgttctaaa caacctctat 1560agaaagatta tgaacataaa
ggaagccgtg ggaagtggac ccattattgg aaggccaata 1620tttgaaggag actttgaaaa
tctatggaat gaaggtgccg aggaagaaaa tagagaagtc 1680tcagagtatg agcttatcct
agcctcaatt aagggagaac tcaagggcta tgccggggct 1740ctagttagga ctctcagaat
cctaaagcag aaagtggagg gagcagttcc tgtaaatcct 1800gcgggaagca taaggagaga
gctcgagata attttagagg acactcctga tgtggaagta 1860ttaaagaaaa tcgttaatag
gaacgttcca aatccgttcc gcttggtgag aggactttta 1920agagaagccg aggggattga
gggaattaga gtattagtta agggctatga tggctctatg 1980gatgtgtact atgccatatt
ctacgacgaa gatgggagag aaatttatag atatccaatt 2040cttgctgaga acggaaagta
ccttgttgga ttcaacttac tcaagaggat tagtgaggta 2100ctatccaaag agtacaaggt
cgttagaggg gcaagtgaag aggtggacta taaagttaag 2160acgctagtta tggacaacat
atacaattta atcgtgaaga agtatctgga atacgatagc 2220ttaaacatca aagaaggtaa
aatcttcaag aggcttaagg ttgaaataaa gaaagccctc 2280gaggtaaagg ggataagtga
agaagaattc gaagtcatca agagagttcc ccctgagatt 2340atggaagttc tagggttaga
ttccacaaaa atagaactac ctaccaacga atacctcaag 2400atcttcgaaa ggaactttgt
tcctctggat aaaatccttg agagtgaaaa gaaggccatg 2460gaaatagtca tggagctaga
gaagagcaga ggatataacg ttgaggacgt atctttaagg 2520gagcactatg acataagggc
ctttacagat ggtgaagaga agtacataga ggtcaaaggc 2580cactatccaa tgctcctact
tgcggagtta acggaaaagg aatttgagtt cgcacaaaaa 2640aatgaagata agtactggat
atacatagtc tcgaacattg ccaaagaccc cgtaattgta 2700aaaatttaca aaccattttc
ccaggataga agagtattcg tggttaagaa tggggaagat 2760gttgaggtta atatcaacat
tgagataaag aagaaagata ggcatttact taagttaagc 2820tag
2823723837DNAArtificial
SequenceDescription of Artificial Sequence Recombinant helicase 7
72gtgattactt tggagctaca tccaagtgag atagctagat atttcgagct tgaagagtgt
60tcccactatt tctctaacct acttttaaga aagagaggcg aattgcagga atttgagccg
120ataataagga gaaaagaaat agaaaccata gagctcgcca aatggggaga cgagttcgag
180ctctcccttc ttcaggaatt taaaaaaggt gaagcattaa aaaagcttgg agttaaagaa
240ctaccaagat tctatggttt tttaacggaa aacgacaccc ctgtaagaaa gttctttgaa
300aagtacttta aagatggaat aatagtggaa gaagatccag acaaactttt agaaattata
360aacagtgaga aaagtgccgt tatctatcaa gcccccttaa aaggcagaat agggaaattt
420gatgtctcag gaagggcaga cttcataata aaggttggga aaacacttta cctactcgag
480gctaagttta ctaaggaaga gaagttctac cacaggattc aggccattat ctatgctcac
540cttctaagtc aaatgatcga aggttacgaa attaaactag ctgttgtaac aaaggagaac
600tttcccattc cctcaaactt cctaagattc ccaggagacg tggaagagtt aaagataacc
660ctagaagaaa agcttggtgg aatactaaga gaacaagaac tttggataga cgcaaggtgt
720actacttgcc cctttgaggc tttatgcttg tctaaggctc ttgaggaaag aagtctagga
780ctattaagcc ttccccctgg gataattaga atactcaaag aagaagggat aaaagactta
840aaagacatgg ctaagctatt tgaattcaaa gaaaattccc ctacaaactt tgaagagccc
900tcaataaaag atccaaagaa gactcaagag atagcaaaaa gaacgggaat aaacttacta
960aagctctcaa ggatagctca ggcaatcctt aaatatttag atgagggaga aacaacaccc
1020ctgttcatcc ccaggacggg gtataatctg ccaatggatg agagagtagg tgatgttgag
1080ccctcttact atcctccaag gagcttagtg aaagtgttct tctatgtcca gacaagccca
1140ataacagaca caataatcgg aatttcagcc cttgtaaaga ataggcaaaa tggagagcgg
1200ataattgtta agttcgtcga tgagcccccc atagaagttt cagatgccca agaaaaggag
1260agaatgcttc taattgagtt ctttagggat gttattgatg ccgtaaagtc actatctcca
1320accgataaag tctacctaca catgtacttt tacaatagaa aacagagaga tgaccttatg
1380gatgccgtaa agagacacaa agagataaga gaaaacaatg cagtcatggc cttgctaagc
1440ttgagaagag ccatagattg ggagagcttt tcaataataa aggatgagat aataaggagg
1500catgccttac cactttctcc tggcctggga ttcgttacag ttgctactca gtttggatac
1560agatggagaa ggaacaaaac ctttgcgcga atgcttgagg ttgtagcaag aagagaaaat
1620ggtaagataa atctcaaaac tctccttaac atttctgaaa cgggaattgg gccagaatat
1680tatccaatca tcgataggga taacgaagga atacccttca cacttttctg gagcgcactg
1740gtcaaattag ctactgagga agacaattca agaattaaga gggatataag ggacatactc
1800tcccaaatgg ttgaggccct caaaacaatt gaagagagaa ttcccgagca atataaagac
1860gccttcgtga aaaaagaggg aatacccaaa gaagatctcg aaaactttga cataaagaag
1920gaagaattag ctgatatcct tcttgaatac ttacaattag agttcgatgc aagatttaga
1980gaacgatccg aatactatag gcttccccta tcaataagag catactcaga ggaatcagca
2040ctaattaaga tagaaaacat tgaaaagaag aaaaatgact gtctgttgtt tggaaaaatc
2100gtgctaattg acgaaaatgg aagaataaaa gagtataatc caaaagaagt tcttatagat
2160attgatgaag gttctcttgt agttgtaacg ccaaagaaat tcttagataa gctaagaaga
2220gatcccgttc aaagaataag caaatcaccg ttaggaatag ttgaggctat agatcacgag
2280acaggaaaag ttgttataag gttaataaga gtctctccag gcagatttac actcaaacac
2340tctaagttta gttgtaaaaa tggactattg acaataacct atcctgaagg ggaagtgaaa
2400gttactcctg gagagatagt tatagtagat cctagcgtcg atgacatagg aatggaaagg
2460gcatacaatg tgctctcaga aatatcccaa ggggaactca agcatgaaat ttatcagaag
2520gtcaaagcaa tatacgaagg gaacacggaa tcaagatacg aagtcaacat ctggaagaaa
2580aagcacatag aagaatttct ctccagagtt aagaagatca acgaagaaca gaaaaagttt
2640gcaattgaca taaacaactt tctagtcacc cttcaaggcc cccctgggac tgggaagaca
2700tcaggggcca tagccccagc aattctcgca agagcatatt caatggtgaa ggacaaaaag
2760aatggcctct ttgtagttac tggagtctca cacagggcag ttaatgaggc cctgataaag
2820actttaaagc taaagaaaga gctggagaat acattaaaag agcttagaaa gatagatcta
2880attagagcag tctctgggga agaggcaatc aaaataatta aagaggaact agagagggaa
2940ataaaggatg atgtcgacag aattagattt acagcacaag aaattaccca ctcttcaaag
3000caaagatcat tagacaaata ttttgctaat tctggaactg tgaggatagt atttggaaca
3060ccacagactt tgaacaagct tatgaagaat acaaaagaag tcgaactagt tgtcatagat
3120gaagctagta tgatggactt accaatgttc ttcctctcaa caaaagtttg taaaggtcaa
3180gttctcttgg tcggggatca caggcagatg gagccaattc aagtccatga atggcaatta
3240gaggacagaa agacatttga agagcactat ccattccttt cagcccttaa cttcattaga
3300tttctcaggg gagagttgga tgaaagagaa cttaagaagt ttaagagaat ccttggaagg
3360gaacctccag aatggaagaa ggacaagaac gaggttctcc ctctctatag gttagtaaga
3420acttataggt tgccccagga aatagctgat ctactgagtg atgcaatata cagagcagat
3480ggcataaaat tgattagtga aaagaaaaag aggagaaaga taattgccag gcacaaggat
3540gagtttctat cgatagtttt agatgacagg tatcctttcg ttctaatact tcatgacgag
3600ggcaattcca caaagattaa cgagctggaa gcaaagatag tagagaagat aatcaaaaga
3660gtagagaata ttgatatagg agttgtagtt ccatatagag ctcaaaagag attaatagct
3720tcattaatag atagtgccca ggtggacaca gttgagagat tccaaggggg agagaaatct
3780ttaatagtaa tttcaatgac ttccagcgac ccccgcatac ctgggaaagg tttttga
3837731968DNAArtificial SequenceDescription of Artificial Sequence
Recombinant helicase dna2 73atgaacataa agagcttcat aaacaggctt
aaggagctag ttgaaatcga gagggaagct 60gaaatagagg ctatgaggtt ggagatgaaa
aggcttagcg gagtggagag ggagaggtta 120ggtagggcaa ttctcagctt aaacggtaaa
atcgttggtg aagagctcgg ttatttcttg 180gttaagtacg gaaggaataa ggagataaag
accgagatca gcgttgggga tttggttgtt 240ataagcaaga gggatcccct gaagagcgac
ctcctgggaa ctgttgttga gaaggggaag 300agattcatcg tcgttgcctt agaaccagtc
ccagagtggg cccttagaga tgtgaggata 360gacctctacg ccaacgatat aacattcaag
aggtggatcg aaaacctcga cagggttagg 420aaggctggaa aaaaggcttt agagttttac
ttaggtttag atgagccttc ccagggggag 480gaagtgagct ttgaaccctt tgataagagc
ctaaacccct ctcaaaggaa agcgatagct 540aaggctttag gtagtgaaga cttcttcctt
atccacggcc cctttggaac tggaaagacg 600aggactttag ttgagctgat taggcaggag
gtaaagaggg ggaacaaagt tctagctaca 660gctgagagca acgttgccgt ggacaattta
gttgaaagat tggccaaaga tggagttaag 720atagttaggg ttgggcaccc aagtagggtt
tcgaggcatt tgcacgagac aactttagct 780tacctcatta ctcagcacga gctctacggt
gagcttaggg agcttagggt gatagggcag 840agtttggcag agaagaggga cacatataca
aagccgactc caaagttcag gaggggactg 900agtgatgctg agataattaa gttggccgag
aagggaagag gggctagagg actctcagct 960agactaataa aggagatggc cgagtggata
aagctaaaca ggcaggttca gaaggccttt 1020gaagatgcta gaaagcttga ggagaggatt
gcgagggata taattaggga agccgatgtg 1080gttttgacaa ctaactcttc tgcagccctt
gatgttgttg atgctaccga ttatgatgtt 1140gcgataatag atgaagcaac tcaggcaact
ataccgagca tattaatacc tctcaacaag 1200gttgataggt ttatacttgc tggagaccac
aagcaactac caccaactat cttaagcttg 1260gaggcccagg agctctccca cacgcttttc
gagggtttaa ttgagaagta cccatggaag 1320agcgaaatgc tgacaattca gtataggatg
aatgagagga taatggagtt tccgagcagg 1380gagttttacg atggaagaat agttgctgat
gaaagtgtaa aaaacataac tctggccgac 1440ctgggaatta aagttaatgc tagtggaata
tggagggaca tcctagatcc aaacaacgtc 1500ctcgtgttca tagatacttg catgctcgaa
aataggttcg agaggcagag aaggggaagc 1560gaaagcaggg agaatccctt ggaggccaag
atagtgagca aaatcgttga aaagctcttg 1620gaaagtgggg ttaaagcgga aatgatggga
gtgattacac cttacgatga ccagagggat 1680ttgataagct tgaatgttcc cgaagaagtt
gaggtcaaga ctgtggatgg ttaccaggga 1740agggagaagg aagtgataat tctatcattt
gtccgctcta acaaagcggg agagatcggc 1800tttctcaagg acttgaggag gctaaacgtg
tccttaacta gggctaagag gaagcttatc 1860atgattggcg attcctcaac gctttcatct
cacgaaacct acaggaggtt aatcgagcac 1920gtgagggaga aggggttata tgttgtgcta
acgaaggata gcatttga 196874867PRTArtificial
SequenceDescription of Artificial Sequence Helicase 2 74Met Ile Glu Glu
Leu Phe Lys Gly Leu Glu Ser Glu Ile Val Gly Leu 1 5
10 15His Glu Ile Pro Pro Lys Arg Gly Glu Tyr
Gly Glu Phe Lys Phe Arg 20 25
30Asn Glu Glu Val Asn Glu Leu Val Lys Arg Leu Gly Phe Arg Leu Tyr
35 40 45Ser His Gln Val Lys Ala Leu
Glu Lys Leu Tyr Ser Gly Lys Asn Val 50 55
60Val Val Ser Thr Pro Thr Ala Ser Gly Lys Ser Glu Ile Phe Arg Leu
65 70 75 80Phe Ile Phe
Asp Glu Ile Leu Ser Ser Pro Ser Ser Thr Phe Leu Leu 85
90 95Ile Tyr Pro Thr Arg Ala Leu Ile Asn
Asn Gln Met Glu Lys Phe Glu 100 105
110Lys Glu Asn Thr Ile Phe Glu Glu Ile Cys Gly Lys Arg Val Arg Ala
115 120 125Glu Val Leu Thr Gly Asp
Thr Glu Trp Glu Lys Arg Arg Glu Ile Ile 130 135
140Arg Ser Lys Pro Asn Val Ile Phe Thr Thr Pro Asp Met Leu His
His145 150 155 160His Ile
Leu Pro Arg Trp Arg Asp Tyr Phe Trp Leu Leu Lys Gly Leu
165 170 175Arg Leu Leu Val Val Asp Glu
Leu His Val Tyr Arg Gly Ile Phe Gly 180 185
190Thr Asn Val Ala Tyr Val Phe Lys Arg Leu Phe Leu Arg Leu
Lys Arg 195 200 205Leu Ser Ser Ser
Pro Gln Ile Leu Ala Leu Ser Ala Thr Leu Arg Asn 210
215 220Pro Lys Glu Phe Ala Glu Gln Phe Phe Glu Thr Glu
Phe Glu Glu Val225 230 235
240Lys Glu Ala Gly Ser Pro Ser Pro Arg Arg Ile Ile Val Met Phe Glu
245 250 255Pro Arg Arg Phe Thr
Gly Glu Gln Leu Ile Lys Gln Ile Val Glu Arg 260
265 270Leu Thr Arg Lys Asn Ile Lys Thr Leu Val Phe Phe
Asp Ser Arg Lys 275 280 285Gly Thr
Glu Arg Ile Met Arg Leu Phe Leu Phe Ser Asp Ala Phe Asp 290
295 300Arg Ile Thr Thr Tyr Lys Gly Thr Leu Thr Lys
Arg Glu Arg Phe Leu305 310 315
320Ile Glu Arg Asp Phe Arg Glu Gly Asn Leu Thr Val Leu Leu Thr Thr
325 330 335Asn Ala Leu Glu
Leu Gly Ile Asp Ile Gly Asp Leu Asp Ala Val Ile 340
345 350Asn Tyr Gly Ile Pro Ser Asp Gly Leu Phe Ser
Leu Ile Gln Arg Phe 355 360 365Gly
Arg Ala Gly Arg Asp Pro Asn Arg Ile Ala Ile Asn Gly Ile Ile 370
375 380Leu Arg Arg Asn Gly Leu Asp Tyr Tyr Tyr
Lys Glu His Phe Asp Glu385 390 395
400Leu Val Glu Gly Ile Glu Lys Gly Leu Val Glu Lys Ile Pro Val
Asn 405 410 415Leu Asp Asn
Glu Lys Ile Ala Lys Lys His Leu His Tyr Ala Ile Ala 420
425 430Glu Leu Gly Val Val Ser Ile Lys Glu Ile
Glu Gly Arg Trp Lys Arg 435 440
445Phe Ile Lys Thr Leu Val Glu Glu Gly Tyr Val Glu Val Thr Arg Asn 450
455 460Pro Ile Thr Gly Glu Glu Glu Ile
Arg Leu Arg Arg Pro Pro Val Tyr465 470
475 480Ser Ser Ile Arg Thr Ala Ser Asp Glu Ser Tyr Phe
Leu Val Val Asp 485 490
495Glu Pro Trp Ile Arg Gly Ala Leu Gln Arg Lys Arg Gly Ala Glu Leu
500 505 510Leu Arg Phe Val Asn Tyr
Leu Lys Val Arg Gly Met Val Val Glu Glu 515 520
525Val Asp Glu Ile Glu Phe His Arg Ser Leu Leu Pro Gly Met
Val Tyr 530 535 540Leu Ser Arg Gly Arg
Pro Tyr Met Ala Val Asp Lys Ile Lys Ile Glu545 550
555 560Lys Phe His Phe Val Phe Ala Arg Pro Leu
Pro Ile Glu Glu Glu Ile 565 570
575Asp Thr Ser Ser Ser Lys Ile Glu Asn Ile Glu Ile Leu Glu Val Lys
580 585 590Asp Glu Lys Thr Val
Gly Pro Ile Lys Val Lys Phe Gly Arg Leu Arg 595
600 605Val Arg His Glu Tyr Thr Gly Tyr Ala Val Arg Gly
Arg Asp Val Glu 610 615 620Arg His Val
Lys Arg Leu Glu Glu Leu Lys Asp Glu Gly Ile Leu Arg625
630 635 640Gly Glu Ile Asp Ile Val Pro
Tyr Ile Trp Glu Ser Trp Lys Phe Ala 645
650 655Arg Val Leu Phe Asp Thr Pro Tyr Ile Arg Glu Phe
Glu Thr Glu Gly 660 665 670Phe
Trp Leu Glu Phe Pro Asn Asp Ile Arg Ile Val Pro Glu Glu Glu 675
680 685Phe Arg Glu Phe Phe Ala Val Ala Ser
Glu Ile Asp Pro Glu Leu Ala 690 695
700Met Phe Leu Tyr Asn Arg Ile Ser Arg Lys Ser Leu Phe Pro Thr Leu705
710 715 720Leu Gly Ala Thr
Thr His Tyr Ile Arg Ser Phe Ile Leu His His Ala 725
730 735Lys Asp Lys Gly Glu Glu Phe Ala Phe Ala
Val Lys Lys Met Ile Asp 740 745
750Ser Lys Asp Gly Ile Gly Ser Gly Leu His Ala Ile Glu Pro Asn Ile
755 760 765Ile Lys Leu Ala Pro Val Val
Thr His Val Asp Ser Arg Glu Ile Gly 770 775
780Gly Tyr Ser Tyr Asp Asp Phe His Gly Lys Pro Val Ile Phe Ile
Tyr785 790 795 800Asp Gly
Asn Glu Gly Gly Ser Gly Ile Ile Arg Gln Val Tyr Glu Asn
805 810 815Val Glu Lys Leu Met Tyr Arg
Ser Leu Glu His Ile Lys Lys Cys Pro 820 825
830Cys Lys Asp Gly Cys Pro Ala Cys Ile Tyr Ser Pro Lys Cys
Gly Thr 835 840 845Phe Asn Glu Phe
Leu Asp Lys Trp Met Ala Ile Arg Ile Trp Glu Lys 850
855 860Val Leu Pro86575836PRTArtificial
SequenceDescription of Artificial Sequence Helicase 3 75Met Leu Ile Val
Val Arg Pro Gly Arg Lys Lys Asn Glu Leu Glu Ala 1 5
10 15Phe Ile Ile Glu Asn Pro Pro Glu Lys Leu
Ser Gln Arg Arg Asn Leu 20 25
30Lys Ala Asp Arg Val Val Arg Leu Ile Met Arg Asp Asn Arg Leu Phe
35 40 45Lys Ala Leu Glu Gly Ser Gln
Tyr Leu Asn Pro Lys Glu Val Glu Arg 50 55
60Ala Leu Arg Asn Ser Arg Ile Val Leu Val Asn Ala Asn Glu Trp Glu
65 70 75 80Glu Tyr Phe
Lys Lys Arg Leu Met Asn Lys Arg Val Glu Lys Ala Asp 85
90 95Ile Cys Arg Leu Cys Leu Leu Asn Gly
Lys Ile Thr Val Leu Thr Glu 100 105
110Gly Asn Arg Ile Arg Tyr Arg Asp Glu Tyr Ile Cys Glu Ser Cys Ala
115 120 125Glu Glu Glu Leu Lys Arg
Glu Leu Arg Phe Arg Phe Asn Ser Ile Gly 130 135
140Met Leu Glu Gln Ala Lys Lys Leu Leu Glu Arg Phe Arg Asp Leu
Asp145 150 155 160Lys Val
Ile Ser Ile Phe Asp Pro Ser Phe Asp Pro Thr Lys His Pro
165 170 175Glu Ile Thr Lys Trp Asp Glu
Leu Lys Ala Lys His Ile Arg Val Glu 180 185
190Lys Met His Ile Asp Glu Leu Asn Ile Pro Glu Glu Phe Lys
Lys Val 195 200 205Leu Lys Ala Glu
Gly Ile Asn Glu Leu Leu Pro Val Gln Val Leu Ala 210
215 220Ile Lys Asn Gly Leu Leu Glu Gly Glu Asn Leu Leu
Val Val Ser Ala225 230 235
240Thr Ala Ser Gly Lys Thr Leu Ile Gly Glu Leu Ala Gly Ile Pro Lys
245 250 255Ala Leu Lys Gly Lys
Lys Met Leu Phe Leu Val Pro Leu Val Ala Leu 260
265 270Ala Asn Gln Lys Tyr Glu Asp Phe Lys Arg Arg Tyr
Ser Lys Leu Gly 275 280 285Leu Lys
Val Ala Ile Arg Val Gly Met Ser Arg Ile Lys Thr Lys Glu 290
295 300Glu Pro Ile Val Leu Asp Thr Gly Thr Asp Ala
His Ile Ile Val Gly305 310 315
320Thr Tyr Glu Gly Ile Asp Tyr Leu Leu Arg Ala Gly Lys Lys Ile Gly
325 330 335Asn Val Gly Thr
Val Val Ile Asp Glu Ile His Met Leu Asp Asp Glu 340
345 350Glu Arg Gly Ala Arg Leu Asp Gly Leu Ile Ala
Arg Leu Arg Lys Leu 355 360 365Tyr
Ser Asn Ala Gln Phe Ile Gly Leu Ser Ala Thr Val Gly Asn Pro 370
375 380Gln Glu Leu Ala Arg Lys Leu Gly Met Lys
Leu Val Leu Tyr Asp Glu385 390 395
400Arg Pro Val Asp Leu Glu Arg His Leu Ile Ile Ala Arg Asn Glu
Ser 405 410 415Glu Lys Trp
Arg Tyr Ile Ala Lys Leu Cys Lys Ala Glu Ala Met Arg 420
425 430Lys Ser Glu Lys Gly Phe Lys Gly Gln Thr
Ile Val Phe Thr Phe Ser 435 440
445Arg Arg Arg Cys His Glu Leu Ala Ser Phe Leu Thr Gly Gln Gly Leu 450
455 460Lys Ala Lys Ala Tyr His Ser Gly
Leu Pro Tyr Val Gln Arg Lys Leu465 470
475 480Thr Glu Met Glu Phe Gln Ala Gln Met Ile Asp Val
Val Val Thr Thr 485 490
495Ala Ala Leu Gly Ala Gly Val Asp Phe Pro Ala Ser Gln Val Ile Phe
500 505 510Glu Ser Leu Ala Met Gly
Asn Lys Trp Ile Thr Val Arg Glu Phe His 515 520
525Gln Met Leu Gly Arg Ala Gly Arg Pro Gln Tyr His Glu Lys
Gly Lys 530 535 540Val Tyr Ile Ile Val
Glu Pro Gly Lys Lys Tyr Ser Ala Gln Met Glu545 550
555 560Gly Thr Glu Asp Glu Val Ala Leu Lys Leu
Leu Thr Ser Pro Ile Glu 565 570
575Pro Val Ile Val Glu Trp Ser Asp Glu Phe Glu Glu Asp Asn Val Leu
580 585 590Ala His Ala Cys Val
Phe Asn Arg Leu Lys Val Ile Glu Glu Val Gln 595
600 605Ser Leu Cys Leu Gly Ala Asn Gln Ser Ala Lys Asn
Val Leu Glu Lys 610 615 620Leu Met Glu
Lys Gly Leu Val Lys Ile Tyr Gly Asp Lys Val Glu Ala625
630 635 640Thr Pro Tyr Gly Arg Ala Val
Ser Met Ser Phe Leu Leu Pro Arg Glu 645
650 655Ala Glu Phe Ile Arg Asp Asn Leu Glu Ser Thr Asp
Pro Ile Glu Ile 660 665 670Ala
Ile Lys Leu Leu Pro Phe Glu Asn Val Tyr Leu Pro Gly Ser Leu 675
680 685Gln Arg Glu Ile Glu Ser Ala Val Arg
Gly Lys Ile Ser Ser Asn Ile 690 695
700Phe Ser Ser Ser Phe Ala Ser Val Leu Glu Glu Leu Asp Lys Ile Ile705
710 715 720Pro Glu Ile Ser
Pro Asn Ala Ala Glu Arg Leu Phe Leu Ile Tyr Gln 725
730 735Asp Phe Phe Asn Cys Pro Glu Gln Asp Cys
Thr Glu Phe Ala Met Glu 740 745
750Arg Ile Gly Arg Lys Ile Ile Asp Leu Arg Arg Glu Gly Tyr Glu Pro
755 760 765Ser Lys Ile Ser Glu His Phe
Arg Lys Val Tyr Ala Leu Ile Leu Tyr 770 775
780Pro Gly Asp Val Phe Thr Trp Leu Asp Gly Ile Val Arg Lys Leu
Glu785 790 795 800Ala Ile
Glu Arg Ile Ala Arg Val Phe Asn Lys Arg Arg Val Val Glu
805 810 815Asp Thr Ile Arg Val Arg Arg
Glu Ile Glu Glu Gly Lys Ile Leu Lys 820 825
830Gly Glu Arg Arg 83576980PRTArtificial
SequenceDescription of Artificial Sequence Helicase 4 76Met His Lys Tyr
Phe Phe Pro Leu Pro Ala Thr Lys Ser Thr Phe Leu 1 5
10 15Leu Pro Ala Asp Leu Thr Thr Ala Asn Pro
Cys Phe Ser Lys Ser Leu 20 25
30Ile Asn Ser Leu Ser Ala Trp Ala Pro Phe Leu Tyr Ile Gln Cys Phe
35 40 45Ser Tyr Leu Pro Leu Ile Asn
Phe Leu Asn Ser Leu Thr Tyr Pro Leu 50 55
60Glu Met His Ile Leu Ile Lys Lys Ala Ile Lys Glu Arg Phe Gly Lys
65 70 75 80Leu Asn Ala
Leu Gln Gln Leu Ala Phe His Lys Ile Arg Gly Glu Gly 85
90 95Lys Ser Val Leu Ile Ile Ala Pro Thr
Gly Ser Gly Lys Thr Glu Ala 100 105
110Ala Val Ile Pro Ile Leu Asp Ala Ile Leu Arg Glu Asn Leu Lys Pro
115 120 125Ile Ala Ala Ile Tyr Ile
Ala Pro Leu Lys Ala Leu Asn Arg Asp Leu 130 135
140Leu Glu Arg Leu Lys Trp Trp Glu Glu Lys Thr Gly Val Ile Ile
Glu145 150 155 160Val Arg
His Gly Asp Thr Pro Thr Ser Lys Arg Leu Lys Gln Val Lys
165 170 175Asn Pro Pro His Leu Leu Ile
Thr Thr Pro Glu Met Leu Pro Ala Ile 180 185
190Leu Thr Thr Lys Ser Phe Arg Pro Tyr Leu Lys Asn Thr Lys
Phe Ile 195 200 205Val Ile Asp Glu
Ile Gly Glu Leu Ile Glu Asn Lys Arg Gly Thr Gln 210
215 220Leu Ile Leu Asn Leu Lys Arg Leu Glu Leu Ile Thr
Glu Asp Lys Pro225 230 235
240Ile Arg Ile Gly Leu Ser Ala Thr Ile Gly Ser Glu Glu Lys Val Arg
245 250 255Leu Trp Met Glu Ala
Asp Glu Val Val Lys Pro Arg Leu Lys Lys Lys 260
265 270Tyr Lys Phe Thr Val Leu Tyr Pro Gln Pro Ile Pro
Glu Asp Glu Lys 275 280 285Leu Ala
Glu Glu Leu Lys Val Pro Ile Glu Val Ala Thr Arg Leu Arg 290
295 300Val Val Trp Asp Ile Val Glu Lys His Lys Lys
Val Leu Ile Phe Val305 310 315
320Asn Thr Arg Gln Phe Ala Glu Ile Leu Gly His Arg Leu Lys Ala Trp
325 330 335Gly Lys Pro Val
Glu Val His His Gly Ser Leu Ser Arg Glu Ala Arg 340
345 350Ile Glu Ala Glu Lys Lys Leu Lys Glu Gly Lys
Ile Lys Ala Leu Ile 355 360 365Cys
Thr Ser Ser Met Glu Leu Gly Ile Asp Ile Gly Asp Val Asp Ala 370
375 380Val Ile Gln Tyr Met Ser Pro Arg Gln Val
Asn Arg Leu Val Gln Arg385 390 395
400Ala Gly Arg Ser Lys His Arg Leu Trp Glu Thr Ser Glu Ala Tyr
Ile 405 410 415Ile Thr Thr
Asn Val Glu Asp Tyr Leu Gln Ser Leu Ala Ile Ala Lys 420
425 430Leu Ala Leu Glu Gly Lys Leu Glu Asp Val
Asn Pro Tyr Glu Asn Ala 435 440
445Leu Asp Val Leu Ala His Phe Ile Val Gly Leu Thr Ile Glu Tyr Arg 450
455 460Asn Val Asn Ile Thr Glu Pro Tyr
Ser Leu Ala Lys Ser Thr Tyr Pro465 470
475 480Tyr Arg Lys Leu Ser Trp Glu Asp Tyr Gln Lys Val
Leu Glu Ile Leu 485 490
495Glu Glu Ala Arg Ile Ile Arg Arg Asp Gly Asp Ala Ile Lys Leu Gly
500 505 510Lys Asn Ala Phe Lys Tyr
Tyr Phe Glu Asn Leu Ser Thr Ile Pro Asp 515 520
525Glu Ile Ser Tyr Ala Val Ile Asp Ile Ala Ser Gly Lys Ser
Val Gly 530 535 540Arg Leu Asp Glu Asn
Phe Val Thr Glu Leu Glu Glu Ser Met Glu Phe545 550
555 560Ile Met His Gly Arg Ser Trp Ile Val Leu
Glu Ile Asn Glu Lys Glu 565 570
575Arg Ile Ile Lys Val Lys Glu Ser Asn Asn Leu Glu Ser Ala Leu Pro
580 585 590Ser Trp Glu Gly Glu
Leu Ile Pro Val Pro Leu Glu Val Ala Glu Phe 595
600 605Val Gly Lys Leu Lys Arg Glu Leu Leu Trp Asp Lys
Glu Arg Ala Leu 610 615 620Lys Leu Leu
Glu Gly Val Glu Phe Asn Lys Glu Glu Leu Glu Val Ala625
630 635 640Ile Ser Gln Leu Val Glu Ser
Glu Pro Val Ala Ser Asp Arg Asp Ile 645
650 655Ile Ile Glu Ser Tyr Pro Lys Phe Val Ile Ile His
Ala Asp Phe Gly 660 665 670Asn
Lys Ile Asn Glu Gly Leu Thr Arg Phe Ile Ser Val Phe Leu Ser 675
680 685Ala Arg Tyr Gly Asn Ile Phe Leu Pro
Arg Ser Gln Ala His Gly Ile 690 695
700Ile Ile Arg Ser Pro Phe Arg Leu Asn Pro Glu Glu Ile Lys Glu Ile705
710 715 720Leu Leu Met Lys
Ala Glu Val Gly Asp Ile Val Ala Arg Gly Ile Arg 725
730 735Asp Thr Pro Ile Tyr Arg Trp Lys Met Ser
Ala Ile Ala Lys Arg Phe 740 745
750Gly Ala Leu Arg Arg Asp Ala Arg Ile Lys Lys Val Glu Arg Leu Phe
755 760 765Glu Gly Thr Ile Ile Glu Lys
Glu Thr Phe Asn Glu Ile Tyr His Asp 770 775
780Lys Ile Asp Ile Asp Lys Thr Glu Lys Ile Leu Glu Lys Ile Arg
Lys785 790 795 800Gly Glu
Ile Arg Met Lys Thr Leu Phe Arg Glu Glu Ile Thr Pro Leu
805 810 815Ser Ser Ser Leu Ala Thr Leu
Gly Gly Glu Phe Leu Ile Arg Asp Ile 820 825
830Leu Thr Gln Glu Glu Val Glu Glu Ile Phe Arg Glu Lys Leu
Leu Asp 835 840 845Ala Glu Leu Val
Met Val Cys Thr Asn Cys Gly Phe Ser Trp Arg Thr 850
855 860Lys Val Arg Arg Val Met Asp Arg Val Asn Glu Leu
Ser Cys Pro Lys865 870 875
880Cys Asp Ser Lys Met Ile Ala Pro Leu His Pro Lys Asp Ser Glu Thr
885 890 895Phe Ile Ser Ala Leu
Lys Lys Leu Lys Arg Gly Glu Lys Leu Ser Arg 900
905 910Glu Glu Glu Lys Tyr Tyr Leu Arg Gly Leu Lys Ala
Ala Asp Leu Leu 915 920 925Lys Ala
Tyr Gly Lys Asp Ala Leu Leu Ala Leu Ala Thr Tyr Gly Val 930
935 940Gly Val Glu Ser Ala Thr Arg Ile Leu Arg Asp
Tyr Arg Gly Lys Ser945 950 955
960Leu Ile Lys Ala Leu Ile Glu Ala Glu Lys His Tyr Ile Gln Thr Arg
965 970 975Lys Phe Trp Glu
98077764PRTArtificial SequenceDescription of Artificial Sequence
Helicase 5 77Val Met Leu Leu Arg Arg Asp Leu Ile Gln Pro Arg Ile Tyr Gln
Glu 1 5 10 15Val Ile Tyr
Ala Lys Cys Lys Glu Thr Asn Cys Leu Ile Val Leu Pro 20
25 30Thr Gly Leu Gly Lys Thr Leu Ile Ala Met
Met Ile Ala Glu Tyr Arg 35 40
45Leu Thr Lys Tyr Gly Gly Lys Val Leu Met Leu Ala Pro Thr Lys Pro 50
55 60Leu Val Leu Gln His Ala Glu Ser Phe
Arg Arg Leu Phe Asn Leu Pro 65 70 75
80Pro Glu Lys Ile Val Ala Leu Thr Gly Glu Lys Ser Pro Glu
Glu Arg 85 90 95Ser Lys
Ala Trp Ala Arg Ala Lys Val Ile Val Ala Thr Pro Gln Thr 100
105 110Ile Glu Asn Asp Leu Leu Ala Gly Arg
Ile Ser Leu Glu Asp Val Ser 115 120
125Leu Ile Val Phe Asp Glu Ala His Arg Ala Val Gly Asn Tyr Ala Tyr
130 135 140Val Phe Ile Ala Arg Glu Tyr
Lys Arg Gln Ala Lys Asn Pro Leu Val145 150
155 160Ile Gly Leu Thr Ala Ser Pro Gly Ser Thr Pro Glu
Lys Ile Met Glu 165 170
175Val Ile Asn Asn Leu Gly Ile Glu His Ile Glu Tyr Arg Ser Glu Asn
180 185 190Ser Pro Asp Val Arg Pro
Tyr Val Lys Gly Ile Arg Phe Glu Trp Val 195 200
205Arg Val Asp Leu Pro Glu Ile Tyr Lys Glu Val Arg Lys Leu
Leu Arg 210 215 220Glu Met Leu Arg Asp
Ala Leu Lys Pro Leu Ala Glu Thr Gly Leu Leu225 230
235 240Glu Ser Ser Ser Pro Asp Ile Pro Lys Lys
Glu Val Leu Arg Ala Gly 245 250
255Gln Ile Ile Asn Glu Glu Met Ala Lys Gly Asn His Asp Leu Arg Gly
260 265 270Leu Leu Leu Tyr His
Ala Met Ala Leu Lys Leu His His Ala Ile Glu 275
280 285Leu Leu Glu Thr Gln Gly Leu Ser Ala Leu Arg Ala
Tyr Ile Lys Lys 290 295 300Leu Tyr Glu
Glu Ala Lys Ala Gly Ser Thr Lys Ala Ser Lys Glu Ile305
310 315 320Phe Ser Asp Lys Arg Met Lys
Lys Ala Ile Ser Leu Leu Val Gln Ala 325
330 335Lys Glu Ile Gly Leu Asp His Pro Lys Met Asp Lys
Leu Lys Glu Ile 340 345 350Ile
Arg Glu Gln Leu Gln Arg Lys Gln Asn Ser Lys Ile Ile Val Phe 355
360 365Thr Asn Tyr Arg Glu Thr Ala Lys Lys
Ile Val Asn Glu Leu Val Lys 370 375
380Asp Gly Ile Lys Ala Lys Arg Phe Val Gly Gln Ala Ser Lys Glu Asn385
390 395 400Asp Arg Gly Leu
Ser Gln Arg Glu Gln Lys Leu Ile Leu Asp Glu Phe 405
410 415Ala Arg Gly Glu Phe Asn Val Leu Val Ala
Thr Ser Val Gly Glu Glu 420 425
430Gly Leu Asp Val Pro Glu Val Asp Leu Val Val Phe Tyr Glu Pro Val
435 440 445Pro Ser Ala Ile Arg Ser Ile
Gln Arg Arg Gly Arg Thr Gly Arg His 450 455
460Met Pro Gly Arg Val Ile Ile Leu Met Ala Lys Gly Thr Arg Asp
Glu465 470 475 480Ala Tyr
Tyr Trp Ser Ser Arg Gln Lys Glu Lys Ile Met Gln Glu Thr
485 490 495Ile Ala Lys Val Ser Gln Ala
Ile Lys Lys Gln Lys Gln Thr Ser Leu 500 505
510Val Asp Phe Val Arg Glu Lys Glu Ser Glu Lys Thr Ser Leu
Asp Lys 515 520 525Trp Leu Lys Lys
Glu Lys Glu Glu Ala Thr Glu Lys Glu Glu Lys Lys 530
535 540Val Lys Ala Gln Glu Gly Val Lys Val Val Val Asp
Ser Arg Glu Leu545 550 555
560Arg Ser Glu Val Val Lys Arg Leu Lys Leu Leu Gly Val Lys Leu Glu
565 570 575Val Lys Thr Leu Asp
Val Gly Asp Tyr Ile Ile Ser Glu Asp Val Ala 580
585 590Ile Glu Arg Lys Ser Ala Asn Asp Phe Ile Gln Ser
Ile Ile Asp Gly 595 600 605Arg Leu
Phe Asp Gln Val Lys Arg Leu Lys Glu Ala Tyr Ser Arg Pro 610
615 620Ile Met Ile Val Glu Gly Ser Leu Tyr Gly Ile
Arg Asn Val His Pro625 630 635
640Asn Ala Ile Arg Gly Ala Ile Ala Ala Val Thr Val Asp Phe Gly Val
645 650 655Pro Ile Ile Phe
Ser Ser Thr Pro Glu Glu Thr Ala Gln Tyr Ile Phe 660
665 670Leu Ile Ala Lys Arg Glu Gln Glu Glu Arg Glu
Lys Pro Val Arg Ile 675 680 685Arg
Ser Glu Lys Lys Ala Leu Thr Leu Ala Glu Arg Gln Arg Leu Ile 690
695 700Val Glu Gly Leu Pro His Val Ser Ala Thr
Leu Ala Arg Arg Leu Leu705 710 715
720Lys His Phe Gly Ser Val Glu Arg Val Phe Thr Ala Ser Val Ala
Glu 725 730 735Leu Met Lys
Val Glu Gly Ile Gly Glu Lys Ile Ala Lys Glu Ile Arg 740
745 750Arg Val Ile Thr Ala Pro Tyr Ile Glu Asp
Glu Glu 755 76078940PRTArtificial
SequenceDescription of Artificial Sequence Helicase 6 78Leu Lys Gly Leu
Phe Arg Asp Val Ile Leu His Asn Pro His Leu Phe 1 5
10 15Val Tyr Ser Tyr Ser Asp Lys Gly Ile Ile
Pro Phe Lys His Gln Phe 20 25
30Gln Thr Leu Tyr His Ala Met Leu Met Arg Pro Val Arg Leu Met Ile
35 40 45Ala Asp Glu Ile Gly Leu Gly
Lys Thr Ile Gln Ala Leu Leu Ile Ala 50 55
60Lys Tyr Leu Asp Phe Arg Gly Glu Ile Glu Lys Ala Leu Ile Val Val
65 70 75 80Pro Lys Val
Leu Arg Glu Gln Trp Arg Glu Glu Val Lys Arg Ile Leu 85
90 95Glu Glu Ala Pro Glu Val Ile Glu Asn
Gly Ser Glu Ile Glu Trp Lys 100 105
110Leu Lys Arg Pro Arg Lys Tyr Phe Ile Ile Ser Ile Asp Leu Ala Lys
115 120 125Arg Tyr Thr Glu Glu Ile
Leu Arg Gln Lys Trp Asp Leu Val Ile Val 130 135
140Asp Glu Val His Asn Ala Thr Leu Gly Thr Gln Arg Tyr Glu Phe
Leu145 150 155 160Lys Glu
Leu Thr Lys Asn Lys Asp Leu Asn Val Ile Phe Leu Ser Ala
165 170 175Thr Pro His Arg Gly Asn Asn
Arg Asp Tyr Leu Ala Arg Leu Arg Leu 180 185
190Leu Asp Pro Thr Ile Pro Glu Glu Ile Ser Pro Met His Glu
Arg Lys 195 200 205Ile Tyr Met Lys
Ser Arg Gly Thr Leu Val Leu Arg Arg Thr Lys Lys 210
215 220Val Val Asn Glu Leu Glu Gly Glu Val Phe Lys Lys
Cys His Phe Gly225 230 235
240Ala Val Val Val Glu Val Ser Arg Glu Glu Arg Glu Phe Phe Glu Glu
245 250 255Leu Asn Arg Ala Leu
Phe Glu Leu Ile Lys Asp Gln Ala Asp Tyr Ser 260
265 270Pro Leu Thr Leu Leu Ala Val Ile Ile Arg Lys Arg
Ala Ser Ser Ser 275 280 285Tyr Glu
Ala Ala Leu Lys Thr Leu Thr Arg Ile Val Glu Ser Ala Tyr 290
295 300Ile Ser Gly Gln Glu Arg Ala Arg Gly Val Glu
Ser Tyr Ile Glu Lys305 310 315
320Ile Phe Arg Met Gly Tyr Glu Glu Leu Glu Ile Glu Glu Phe Asn Glu
325 330 335Ile Asp Asp Ala
Ile His Lys Ile Ile Asp Glu Tyr Arg Gly Phe Leu 340
345 350Thr Glu Glu Gln Leu Glu Arg Leu Arg Arg Val
Leu Glu Leu Gly Lys 355 360 365Lys
Ile Gly Ser Lys Asp Ser Lys Leu Glu Val Ile Ser Asp Ile Val 370
375 380Ala Tyr His Ile Arg Asn Gly Glu Lys Val
Ile Ile Phe Thr Glu Phe385 390 395
400Arg Asp Thr Leu Glu Tyr Val Leu Glu Arg Leu Pro Asp Ile Leu
Arg 405 410 415Arg Lys His
Gly Ile Val Leu Glu Lys Asp Asp Ile Ala Lys Leu His 420
425 430Gly Gly Met Lys Ser Glu Glu Ile Glu Arg
Glu Ile Asn Lys Phe His 435 440
445Glu Arg Ala Asn Leu Leu Val Ser Thr Asp Val Ala Ser Glu Gly Leu 450
455 460Asn Leu His Val Ala Ser Val Val
Ile Asn Tyr Glu Ala Pro Trp Ser465 470
475 480Pro Ile Lys Leu Glu Gln Arg Val Gly Arg Ile Trp
Arg Leu Asn Gln 485 490
495Thr Arg Glu Thr Lys Ala Tyr Thr Ile Phe Leu Ala Thr Glu Thr Asp
500 505 510Leu Asp Val Leu Asn Asn
Leu Tyr Arg Lys Ile Met Asn Ile Lys Glu 515 520
525Ala Val Gly Ser Gly Pro Ile Ile Gly Arg Pro Ile Phe Glu
Gly Asp 530 535 540Phe Glu Asn Leu Trp
Asn Glu Gly Ala Glu Glu Glu Asn Arg Glu Val545 550
555 560Ser Glu Tyr Glu Leu Ile Leu Ala Ser Ile
Lys Gly Glu Leu Lys Gly 565 570
575Tyr Ala Gly Ala Leu Val Arg Thr Leu Arg Ile Leu Lys Gln Lys Val
580 585 590Glu Gly Ala Val Pro
Val Asn Pro Ala Gly Ser Ile Arg Arg Glu Leu 595
600 605Glu Ile Ile Leu Glu Asp Thr Pro Asp Val Glu Val
Leu Lys Lys Ile 610 615 620Val Asn Arg
Asn Val Pro Asn Pro Phe Arg Leu Val Arg Gly Leu Leu625
630 635 640Arg Glu Ala Glu Gly Ile Glu
Gly Ile Arg Val Leu Val Lys Gly Tyr 645
650 655Asp Gly Ser Met Asp Val Tyr Tyr Ala Ile Phe Tyr
Asp Glu Asp Gly 660 665 670Arg
Glu Ile Tyr Arg Tyr Pro Ile Leu Ala Glu Asn Gly Lys Tyr Leu 675
680 685Val Gly Phe Asn Leu Leu Lys Arg Ile
Ser Glu Val Leu Ser Lys Glu 690 695
700Tyr Lys Val Val Arg Gly Ala Ser Glu Glu Val Asp Tyr Lys Val Lys705
710 715 720Thr Leu Val Met
Asp Asn Ile Tyr Asn Leu Ile Val Lys Lys Tyr Leu 725
730 735Glu Tyr Asp Ser Leu Asn Ile Lys Glu Gly
Lys Ile Phe Lys Arg Leu 740 745
750Lys Val Glu Ile Lys Lys Ala Leu Glu Val Lys Gly Ile Ser Glu Glu
755 760 765Glu Phe Glu Val Ile Lys Arg
Val Pro Pro Glu Ile Met Glu Val Leu 770 775
780Gly Leu Asp Ser Thr Lys Ile Glu Leu Pro Thr Asn Glu Tyr Leu
Lys785 790 795 800Ile Phe
Glu Arg Asn Phe Val Pro Leu Asp Lys Ile Leu Glu Ser Glu
805 810 815Lys Lys Ala Met Glu Ile Val
Met Glu Leu Glu Lys Ser Arg Gly Tyr 820 825
830Asn Val Glu Asp Val Ser Leu Arg Glu His Tyr Asp Ile Arg
Ala Phe 835 840 845Thr Asp Gly Glu
Glu Lys Tyr Ile Glu Val Lys Gly His Tyr Pro Met 850
855 860Leu Leu Leu Ala Glu Leu Thr Glu Lys Glu Phe Glu
Phe Ala Gln Lys865 870 875
880Asn Glu Asp Lys Tyr Trp Ile Tyr Ile Val Ser Asn Ile Ala Lys Asp
885 890 895Pro Val Ile Val Lys
Ile Tyr Lys Pro Phe Ser Gln Asp Arg Arg Val 900
905 910Phe Val Val Lys Asn Gly Glu Asp Val Glu Val Asn
Ile Asn Ile Glu 915 920 925Ile Lys
Lys Lys Asp Arg His Leu Leu Lys Leu Ser 930 935
940791278PRTArtificial SequenceDescription of Artificial
Sequence Helicase 7 79Val Ile Thr Leu Glu Leu His Pro Ser Glu Ile Ala Arg
Tyr Phe Glu 1 5 10 15Leu
Glu Glu Cys Ser His Tyr Phe Ser Asn Leu Leu Leu Arg Lys Arg
20 25 30Gly Glu Leu Gln Glu Phe Glu Pro
Ile Ile Arg Arg Lys Glu Ile Glu 35 40
45Thr Ile Glu Leu Ala Lys Trp Gly Asp Glu Phe Glu Leu Ser Leu Leu
50 55 60Gln Glu Phe Lys Lys Gly Glu
Ala Leu Lys Lys Leu Gly Val Lys Glu 65 70
75 80Leu Pro Arg Phe Tyr Gly Phe Leu Thr Glu Asn Asp
Thr Pro Val Arg 85 90
95Lys Phe Phe Glu Lys Tyr Phe Lys Asp Gly Ile Ile Val Glu Glu Asp
100 105 110Pro Asp Lys Leu Leu Glu Ile
Ile Asn Ser Glu Lys Ser Ala Val Ile 115 120
125Tyr Gln Ala Pro Leu Lys Gly Arg Ile Gly Lys Phe Asp Val Ser
Gly 130 135 140Arg Ala Asp Phe Ile Ile
Lys Val Gly Lys Thr Leu Tyr Leu Leu Glu145 150
155 160Ala Lys Phe Thr Lys Glu Glu Lys Phe Tyr His
Arg Ile Gln Ala Ile 165 170
175Ile Tyr Ala His Leu Leu Ser Gln Met Ile Glu Gly Tyr Glu Ile Lys
180 185 190Leu Ala Val Val Thr Lys
Glu Asn Phe Pro Ile Pro Ser Asn Phe Leu 195 200
205Arg Phe Pro Gly Asp Val Glu Glu Leu Lys Ile Thr Leu Glu
Glu Lys 210 215 220Leu Gly Gly Ile Leu
Arg Glu Gln Glu Leu Trp Ile Asp Ala Arg Cys225 230
235 240Thr Thr Cys Pro Phe Glu Ala Leu Cys Leu
Ser Lys Ala Leu Glu Glu 245 250
255Arg Ser Leu Gly Leu Leu Ser Leu Pro Pro Gly Ile Ile Arg Ile Leu
260 265 270Lys Glu Glu Gly Ile
Lys Asp Leu Lys Asp Met Ala Lys Leu Phe Glu 275
280 285Phe Lys Glu Asn Ser Pro Thr Asn Phe Glu Glu Pro
Ser Ile Lys Asp 290 295 300Pro Lys Lys
Thr Gln Glu Ile Ala Lys Arg Thr Gly Ile Asn Leu Leu305
310 315 320Lys Leu Ser Arg Ile Ala Gln
Ala Ile Leu Lys Tyr Leu Asp Glu Gly 325
330 335Glu Thr Thr Pro Leu Phe Ile Pro Arg Thr Gly Tyr
Asn Leu Pro Met 340 345 350Asp
Glu Arg Val Gly Asp Val Glu Pro Ser Tyr Tyr Pro Pro Arg Ser 355
360 365Leu Val Lys Val Phe Phe Tyr Val Gln
Thr Ser Pro Ile Thr Asp Thr 370 375
380Ile Ile Gly Ile Ser Ala Leu Val Lys Asn Arg Gln Asn Gly Glu Arg385
390 395 400Ile Ile Val Lys
Phe Val Asp Glu Pro Pro Ile Glu Val Ser Asp Ala 405
410 415Gln Glu Lys Glu Arg Met Leu Leu Ile Glu
Phe Phe Arg Asp Val Ile 420 425
430Asp Ala Val Lys Ser Leu Ser Pro Thr Asp Lys Val Tyr Leu His Met
435 440 445Tyr Phe Tyr Asn Arg Lys Gln
Arg Asp Asp Leu Met Asp Ala Val Lys 450 455
460Arg His Lys Glu Ile Arg Glu Asn Asn Ala Val Met Ala Leu Leu
Ser465 470 475 480Leu Arg
Arg Ala Ile Asp Trp Glu Ser Phe Ser Ile Ile Lys Asp Glu
485 490 495Ile Ile Arg Arg His Ala Leu
Pro Leu Ser Pro Gly Leu Gly Phe Val 500 505
510Thr Val Ala Thr Gln Phe Gly Tyr Arg Trp Arg Arg Asn Lys
Thr Phe 515 520 525Ala Arg Met Leu
Glu Val Val Ala Arg Arg Glu Asn Gly Lys Ile Asn 530
535 540Leu Lys Thr Leu Leu Asn Ile Ser Glu Thr Gly Ile
Gly Pro Glu Tyr545 550 555
560Tyr Pro Ile Ile Asp Arg Asp Asn Glu Gly Ile Pro Phe Thr Leu Phe
565 570 575Trp Ser Ala Leu Val
Lys Leu Ala Thr Glu Glu Asp Asn Ser Arg Ile 580
585 590Lys Arg Asp Ile Arg Asp Ile Leu Ser Gln Met Val
Glu Ala Leu Lys 595 600 605Thr Ile
Glu Glu Arg Ile Pro Glu Gln Tyr Lys Asp Ala Phe Val Lys 610
615 620Lys Glu Gly Ile Pro Lys Glu Asp Leu Glu Asn
Phe Asp Ile Lys Lys625 630 635
640Glu Glu Leu Ala Asp Ile Leu Leu Glu Tyr Leu Gln Leu Glu Phe Asp
645 650 655Ala Arg Phe Arg
Glu Arg Ser Glu Tyr Tyr Arg Leu Pro Leu Ser Ile 660
665 670Arg Ala Tyr Ser Glu Glu Ser Ala Leu Ile Lys
Ile Glu Asn Ile Glu 675 680 685Lys
Lys Lys Asn Asp Cys Leu Leu Phe Gly Lys Ile Val Leu Ile Asp 690
695 700Glu Asn Gly Arg Ile Lys Glu Tyr Asn Pro
Lys Glu Val Leu Ile Asp705 710 715
720Ile Asp Glu Gly Ser Leu Val Val Val Thr Pro Lys Lys Phe Leu
Asp 725 730 735Lys Leu Arg
Arg Asp Pro Val Gln Arg Ile Ser Lys Ser Pro Leu Gly 740
745 750Ile Val Glu Ala Ile Asp His Glu Thr Gly
Lys Val Val Ile Arg Leu 755 760
765Ile Arg Val Ser Pro Gly Arg Phe Thr Leu Lys His Ser Lys Phe Ser 770
775 780Cys Lys Asn Gly Leu Leu Thr Ile
Thr Tyr Pro Glu Gly Glu Val Lys785 790
795 800Val Thr Pro Gly Glu Ile Val Ile Val Asp Pro Ser
Val Asp Asp Ile 805 810
815Gly Met Glu Arg Ala Tyr Asn Val Leu Ser Glu Ile Ser Gln Gly Glu
820 825 830Leu Lys His Glu Ile Tyr
Gln Lys Val Lys Ala Ile Tyr Glu Gly Asn 835 840
845Thr Glu Ser Arg Tyr Glu Val Asn Ile Trp Lys Lys Lys His
Ile Glu 850 855 860Glu Phe Leu Ser Arg
Val Lys Lys Ile Asn Glu Glu Gln Lys Lys Phe865 870
875 880Ala Ile Asp Ile Asn Asn Phe Leu Val Thr
Leu Gln Glu Pro Pro Gly 885 890
895Thr Gly Lys Thr Ser Gly Ala Ile Ala Pro Ala Ile Leu Ala Arg Ala
900 905 910Tyr Ser Met Val Lys
Asp Lys Lys Asn Gly Leu Phe Val Val Thr Gly 915
920 925Val Ser His Arg Ala Val Asn Glu Ala Leu Ile Lys
Thr Leu Lys Leu 930 935 940Lys Lys Glu
Leu Glu Asn Thr Leu Lys Glu Leu Arg Lys Ile Asp Leu945
950 955 960Ile Arg Ala Val Ser Gly Glu
Glu Ala Ile Lys Ile Ile Lys Glu Glu 965
970 975Leu Glu Arg Glu Ile Lys Asp Asp Val Asp Arg Ile
Arg Phe Thr Ala 980 985 990Gln
Glu Ile Thr His Ser Ser Lys Gln Arg Ser Leu Asp Lys Tyr Phe 995
1000 1005Ala Asn Ser Gly Thr Val Arg Ile Val
Phe Gly Thr Pro Gln Thr Leu 1010 1015
1020Asn Lys Leu Met Lys Asn Thr Lys Glu Val Glu Leu Val Val Ile Asp1025
1030 1035 1040Glu Ala Ser Met
Met Asp Leu Pro Met Phe Phe Leu Ser Thr Lys Val 1045
1050 1055Cys Lys Gly Gln Val Leu Leu Val Gly Asp
His Arg Gln Met Glu Pro 1060 1065
1070Ile Gln Val His Glu Trp Gln Leu Glu Asp Arg Lys Thr Phe Glu Glu
1075 1080 1085His Tyr Pro Phe Leu Ser Ala
Leu Asn Phe Ile Arg Phe Leu Arg Gly 1090 1095
1100Glu Leu Asp Glu Arg Glu Leu Lys Lys Phe Lys Arg Ile Leu Gly
Arg1105 1110 1115 1120Glu Pro
Pro Glu Trp Lys Lys Asp Lys Asn Glu Val Leu Pro Leu Tyr
1125 1130 1135Arg Leu Val Arg Thr Tyr Arg
Leu Pro Gln Glu Ile Ala Asp Leu Leu 1140 1145
1150Ser Asp Ala Ile Tyr Arg Ala Asp Gly Ile Lys Leu Ile Ser
Glu Lys 1155 1160 1165Lys Lys Arg Arg
Lys Ile Ile Ala Arg His Lys Asp Glu Phe Leu Ser 1170
1175 1180Ile Val Leu Asp Asp Arg Tyr Pro Phe Val Leu Ile
Leu His Asp Glu1185 1190 1195
1200Gly Asn Ser Thr Lys Ile Asn Glu Leu Glu Ala Lys Ile Val Glu Lys
1205 1210 1215Ile Ile Lys Arg Val
Glu Asn Ile Asp Ile Gly Val Val Val Pro Tyr 1220
1225 1230Arg Ala Gln Lys Arg Leu Ile Ala Ser Leu Ile Asp
Ser Ala Gln Val 1235 1240 1245Asp Thr
Val Glu Arg Phe Gln Gly Gly Glu Lys Ser Leu Ile Val Ile 1250
1255 1260Ser Met Thr Ser Ser Asp Pro Arg Ile Pro Gly
Lys Gly Phe1265 1270 127580655PRTArtificial
SequenceDescription of Artificial Sequence Helicase dna2 80Met Asn
Ile Lys Ser Phe Ile Asn Arg Leu Lys Glu Leu Val Glu Ile 1
5 10 15Glu Arg Glu Ala Glu Ile Glu Ala
Met Arg Leu Glu Met Lys Arg Leu 20 25
30Ser Gly Val Glu Arg Glu Arg Leu Gly Arg Ala Ile Leu Ser Leu
Asn 35 40 45Gly Lys Ile Val Gly
Glu Glu Leu Gly Tyr Phe Leu Val Lys Tyr Gly 50 55
60Arg Asn Lys Glu Ile Lys Thr Glu Ile Ser Val Gly Asp Leu
Val Val 65 70 75 80Ile
Ser Lys Arg Asp Pro Leu Lys Ser Asp Leu Leu Gly Thr Val Val
85 90 95Glu Lys Gly Lys Arg Phe Ile
Val Val Ala Leu Glu Pro Val Pro Glu 100 105
110Trp Ala Leu Arg Asp Val Arg Ile Asp Leu Tyr Ala Asn Asp
Ile Thr 115 120 125Phe Lys Arg Trp
Ile Glu Asn Leu Asp Arg Val Arg Lys Ala Gly Lys 130
135 140Lys Ala Leu Glu Phe Tyr Leu Gly Leu Asp Glu Pro
Ser Gln Gly Glu145 150 155
160Glu Val Ser Phe Glu Pro Phe Asp Lys Ser Leu Asn Pro Ser Gln Arg
165 170 175Lys Ala Ile Ala Lys
Ala Leu Gly Ser Glu Asp Phe Phe Leu Ile His 180
185 190Gly Pro Phe Gly Thr Gly Lys Thr Arg Thr Leu Val
Glu Leu Ile Arg 195 200 205Gln Glu
Val Lys Arg Gly Asn Lys Val Leu Ala Thr Ala Glu Ser Asn 210
215 220Val Ala Val Asp Asn Leu Val Glu Arg Leu Ala
Lys Asp Gly Val Lys225 230 235
240Ile Val Arg Val Gly His Pro Ser Arg Val Ser Arg His Leu His Glu
245 250 255Thr Thr Leu Ala
Tyr Leu Ile Thr Gln His Glu Leu Tyr Gly Glu Leu 260
265 270Arg Glu Leu Arg Val Ile Gly Gln Ser Leu Ala
Glu Lys Arg Asp Thr 275 280 285Tyr
Thr Lys Pro Thr Pro Lys Phe Arg Arg Gly Leu Ser Asp Ala Glu 290
295 300Ile Ile Lys Leu Ala Glu Lys Gly Arg Gly
Ala Arg Gly Leu Ser Ala305 310 315
320Arg Leu Ile Lys Glu Met Ala Glu Trp Ile Lys Leu Asn Arg Gln
Val 325 330 335Gln Lys Ala
Phe Glu Asp Ala Arg Lys Leu Glu Glu Arg Ile Ala Arg 340
345 350Asp Ile Ile Arg Glu Ala Asp Val Val Leu
Thr Thr Asn Ser Ser Ala 355 360
365Ala Leu Asp Val Val Asp Ala Thr Asp Tyr Asp Val Ala Ile Ile Asp 370
375 380Glu Ala Thr Gln Ala Thr Ile Pro
Ser Ile Leu Ile Pro Leu Asn Lys385 390
395 400Val Asp Arg Phe Ile Leu Ala Gly Asp His Lys Gln
Leu Pro Pro Thr 405 410
415Ile Leu Ser Leu Glu Ala Gln Glu Leu Ser His Thr Leu Phe Glu Gly
420 425 430Leu Ile Glu Lys Tyr Pro
Trp Lys Ser Glu Met Leu Thr Ile Gln Tyr 435 440
445Arg Met Asn Glu Arg Ile Met Glu Phe Pro Ser Arg Glu Phe
Tyr Asp 450 455 460Gly Arg Ile Val Ala
Asp Glu Ser Val Lys Asn Ile Thr Leu Ala Asp465 470
475 480Leu Gly Ile Lys Val Asn Ala Ser Gly Ile
Trp Arg Asp Ile Leu Asp 485 490
495Pro Asn Asn Val Leu Val Phe Ile Asp Thr Cys Met Leu Glu Asn Arg
500 505 510Phe Glu Arg Gln Arg
Arg Gly Ser Glu Ser Arg Glu Asn Pro Leu Glu 515
520 525Ala Lys Ile Val Ser Lys Ile Val Glu Lys Leu Leu
Glu Ser Gly Val 530 535 540Lys Ala Glu
Met Met Gly Val Ile Thr Pro Tyr Asp Asp Gln Arg Asp545
550 555 560Leu Ile Ser Leu Asn Val Pro
Glu Glu Val Glu Val Lys Thr Val Asp 565
570 575Gly Tyr Gln Gly Arg Glu Lys Glu Val Ile Ile Leu
Ser Phe Val Arg 580 585 590Ser
Asn Lys Ala Gly Glu Ile Gly Phe Leu Lys Asp Leu Arg Arg Leu 595
600 605Asn Val Ser Leu Thr Arg Ala Lys Arg
Lys Leu Ile Met Ile Gly Asp 610 615
620Ser Ser Thr Leu Ser Ser His Glu Thr Tyr Arg Arg Leu Ile Glu His625
630 635 640Val Arg Glu Lys
Gly Leu Tyr Val Val Leu Thr Lys Asp Ser Ile 645
650 655812163DNAArtificial SequenceDescription of
Artificial Sequence Recombinant helicase 8 81atgagggttg atgagctgag
agttgatgag aggataaaga gtactttgaa ggagagaggt 60atcgaatcct tttaccctcc
ccaagccgag gccttaaaga gcgggatatt ggaaggtaag 120aatgcattaa tttcaattcc
aacggccagc ggaaaaacac taattgctga gattgccatg 180gttcatagga ttttgaccca
gggaggaaag gctgtataca tagtcccgct gaaggccttg 240gctgaagaaa agtttcagga
gttccaggat tgggagaaga ttgggttaag agtagcgatg 300gccactgggg attacgactc
aaaggatgag tggttgggga aatacgacat aatcattgcg 360acggctgaga agtttgattc
ccttttaagg catggctcaa gttggattaa ggatgtgaag 420attttagttg ctgacgagat
tcatttgatt ggttcaagag acagaggagc tacgcttgaa 480gttatcctag ctcatatgct
cggaaaggcc caaataattg gactctctgc aacgatagga 540aatccagagg agcttgcgga
gtggttaaat gccgagctaa tagtcagtga ctggaggccc 600gttaagctta gaaggggagt
tttttaccaa ggctttgtta cctgggaaga tggaagtata 660gacaggtttt cctcctggga
agagttagtt tacgatgcaa ttaggaagaa gaaaggagcg 720ctaatttttg taaacatgag
aaggaaggct gagagagtag ctttggagct ttctaaaaaa 780gttaagtctc tcctcacgaa
acctgagatt agagctttaa atgaattggc tgattccctc 840gaggaaaatc ccacaaatga
aaagctagct aaggccatta ggggtggagt tgcgttccac 900cacgctggtc ttgggagaga
tgagagggtt ctcgtggagg agaactttag aaagggtata 960ataaaggccg tagttgccac
cccaacactt tcggcgggaa ttaacactcc agcgtttagg 1020gtgattataa gggatatttg
gaggtactct gactttggaa tggagagaat tccgataatc 1080gaggttcacc aaatgcttgg
gagagctgga aggccgaagt atgatgaggt tggggaggga 1140ataatagttt ctacaagcga
tgatccgaga gaggtaatga atcactacat atttggaaag 1200cctgaaaaac tgttctccca
gctctccaac gagagtaatt tgagaagtca agttttggcc 1260ctaatagcga cctttggcta
ttcaactgtg gaggagattt tgaagttcat ctcaaacaca 1320ttctatgctt atcaaaggaa
ggacacatac tctttagagg agaagataag gaacatactc 1380tacttcctcc tagagaatga
gttcatagag atatccttag aggataaaat aaggccgctt 1440tccctgggaa ttaggactgc
aaagctttat atcgatccct atacggccaa gatgttcaag 1500gataaaatgg aggaagttgt
taaagatcca aatcctatag gaatatttca cttaatctcc 1560ctaactccgg atataacccc
cttcaactac tcaaagagag aatttgaaag gctcgaagag 1620gaatactacg aattcaagga
taggttatac tttgacgatc cctacatttc gggttacgac 1680ccctacctag agaggaagtt
cttcagagct ttcaaaactg cactagtgct tctggcatgg 1740ataaatgaag tccctgaggg
agaaatagtt gaaaagtact cggtggaacc tggggacatc 1800tataggatag ttgagacggc
tgagtggctg gtgtactctc taaaggaaat tgcaaaagtt 1860cttggagctt atgagatcgt
tgattatctt gaaacattga gggttagggt caagtatggg 1920attagggagg aattgattcc
cctaatgcaa ctcccgttgg ttggaagaag gagagctaga 1980gctctttaca atagcggatt
tagaagtata gaggatatat ctcaagcgag gccagaagag 2040cttttgaaaa tcgaggggat
aggggtcaag accgttgagg ctatcttcaa gtttcttggt 2100aagaatgtga aaatttcgga
gaaacctaga aaaagtaccc ttgattactt tctcaaatct 2160tga
216382720PRTArtificial
SequenceDescription of Artificial Sequence Recombinant helicase 8
82Met Arg Val Asp Glu Leu Arg Val Asp Glu Arg Ile Lys Ser Thr Leu 1
5 10 15Lys Glu Arg Gly Ile Glu
Ser Phe Tyr Pro Pro Gln Ala Glu Ala Leu 20
25 30Lys Ser Gly Ile Leu Glu Gly Lys Asn Ala Leu Ile Ser
Ile Pro Thr 35 40 45Ala Ser Gly
Lys Thr Leu Ile Ala Glu Ile Ala Met Val His Arg Ile 50
55 60Leu Thr Gln Gly Gly Lys Ala Val Tyr Ile Val Pro
Leu Lys Ala Leu 65 70 75
80Ala Glu Glu Lys Phe Gln Glu Phe Gln Asp Trp Glu Lys Ile Gly Leu
85 90 95Arg Val Ala Met Ala
Thr Gly Asp Tyr Asp Ser Lys Asp Glu Trp Leu 100
105 110Gly Lys Tyr Asp Ile Ile Ile Ala Thr Ala Glu Lys
Phe Asp Ser Leu 115 120 125Leu Arg
His Gly Ser Ser Trp Ile Lys Asp Val Lys Ile Leu Val Ala 130
135 140Asp Glu Ile His Leu Ile Gly Ser Arg Asp Arg
Gly Ala Thr Leu Glu145 150 155
160Val Ile Leu Ala His Met Leu Gly Lys Ala Gln Ile Ile Gly Leu Ser
165 170 175Ala Thr Ile Gly
Asn Pro Glu Glu Leu Ala Glu Trp Leu Asn Ala Glu 180
185 190Leu Ile Val Ser Asp Trp Arg Pro Val Lys Leu
Arg Arg Gly Val Phe 195 200 205Tyr
Gln Gly Phe Val Thr Trp Glu Asp Gly Ser Ile Asp Arg Phe Ser 210
215 220Ser Trp Glu Glu Leu Val Tyr Asp Ala Ile
Arg Lys Lys Lys Gly Ala225 230 235
240Leu Ile Phe Val Asn Met Arg Arg Lys Ala Glu Arg Val Ala Leu
Glu 245 250 255Leu Ser Lys
Lys Val Lys Ser Leu Leu Thr Lys Pro Glu Ile Arg Ala 260
265 270Leu Asn Glu Leu Ala Asp Ser Leu Glu Glu
Asn Pro Thr Asn Glu Lys 275 280
285Leu Ala Lys Ala Ile Arg Gly Gly Val Ala Phe His His Ala Gly Leu 290
295 300Gly Arg Asp Glu Arg Val Leu Val
Glu Glu Asn Phe Arg Lys Gly Ile305 310
315 320Ile Lys Ala Val Val Ala Thr Pro Thr Leu Ser Ala
Gly Ile Asn Thr 325 330
335Pro Ala Phe Arg Val Ile Ile Arg Asp Ile Trp Arg Tyr Ser Asp Phe
340 345 350Gly Met Glu Arg Ile Pro
Ile Ile Glu Val His Gln Met Leu Gly Arg 355 360
365Ala Gly Arg Pro Lys Tyr Asp Glu Val Gly Glu Gly Ile Ile
Val Ser 370 375 380Thr Ser Asp Asp Pro
Arg Glu Val Met Asn His Tyr Ile Phe Gly Lys385 390
395 400Pro Glu Lys Leu Phe Ser Gln Leu Ser Asn
Glu Ser Asn Leu Arg Ser 405 410
415Gln Val Leu Ala Leu Ile Ala Thr Phe Gly Tyr Ser Thr Val Glu Glu
420 425 430Ile Leu Lys Phe Ile
Ser Asn Thr Phe Tyr Ala Tyr Gln Arg Lys Asp 435
440 445Thr Tyr Ser Leu Glu Glu Lys Ile Arg Asn Ile Leu
Tyr Phe Leu Leu 450 455 460Glu Asn Glu
Phe Ile Glu Ile Ser Leu Glu Asp Lys Ile Arg Pro Leu465
470 475 480Ser Leu Gly Ile Arg Thr Ala
Lys Leu Tyr Ile Asp Pro Tyr Thr Ala 485
490 495Lys Met Phe Lys Asp Lys Met Glu Glu Val Val Lys
Asp Pro Asn Pro 500 505 510Ile
Gly Ile Phe His Leu Ile Ser Leu Thr Pro Asp Ile Thr Pro Phe 515
520 525Asn Tyr Ser Lys Arg Glu Phe Glu Arg
Leu Glu Glu Glu Tyr Tyr Glu 530 535
540Phe Lys Asp Arg Leu Tyr Phe Asp Asp Pro Tyr Ile Ser Gly Tyr Asp545
550 555 560Pro Tyr Leu Glu
Arg Lys Phe Phe Arg Ala Phe Lys Thr Ala Leu Val 565
570 575Leu Leu Ala Trp Ile Asn Glu Val Pro Glu
Gly Glu Ile Val Glu Lys 580 585
590Tyr Ser Val Glu Pro Gly Asp Ile Tyr Arg Ile Val Glu Thr Ala Glu
595 600 605Trp Leu Val Tyr Ser Leu Lys
Glu Ile Ala Lys Val Leu Gly Ala Tyr 610 615
620Glu Ile Val Asp Tyr Leu Glu Thr Leu Arg Val Arg Val Lys Tyr
Gly625 630 635 640Ile Arg
Glu Glu Leu Ile Pro Leu Met Gln Leu Pro Leu Val Gly Arg
645 650 655Arg Arg Ala Arg Ala Leu Tyr
Asn Ser Gly Phe Arg Ser Ile Glu Asp 660 665
670Ile Ser Gln Ala Arg Pro Glu Glu Leu Leu Lys Ile Glu Gly
Ile Gly 675 680 685Val Lys Thr Val
Glu Ala Ile Phe Lys Phe Leu Gly Lys Asn Val Lys 690
695 700Ile Ser Glu Lys Pro Arg Lys Ser Thr Leu Asp Tyr
Phe Leu Lys Ser705 710 715
720832163DNAPyrococcus furiosus 83atgagggttg atgagctgag agttgatgag
aggataaaga gtactttgaa ggagagaggt 60atcgaatcct tttaccctcc ccaagccgag
gccttaaaga gcgggatatt ggaaggtaag 120aatgcattaa tttcaattcc aacggccagc
ggaaaaacac taattgctga gattgccatg 180gttcatagga ttttgaccca gggaggaaag
gctgtataca tagtcccgct gaaggccttg 240gctgaagaaa agtttcagga gttccaggat
tgggagaaga ttgggttaag agtagcgatg 300gccactgggg attacgactc aaaggatgag
tggttgggga aatacgacat aatcattgcg 360acggctgaga agtttgattc ccttttaagg
catggctcaa gttggattaa ggatgtgaag 420attttagttg ctgacgagat tcatttgatt
ggttcaagag acagaggagc tacgcttgaa 480gttatcctag ctcatatgct cggaaaggcc
caaataattg gactctctgc aacgatagga 540aatccagagg agcttgcgga gtggttaaat
gccgagctaa tagtcagtga ctggaggccc 600gttaagctta gaaggggagt tttttaccaa
ggctttgtta cctgggaaga tggaagtata 660gacaggtttt cctcctggga agagttagtt
tacgatgcaa ttaggaagaa gaaaggagcg 720ctaatttttg taaacatgag aaggaaggct
gagagagtag ctttggagct ttctaaaaaa 780gttaagtctc tcctcacgaa acctgagatt
agagctttaa atgaattggc tgattccctc 840gaggaaaatc ccacaaatga aaagctagct
aaggccatta ggggtggagt tgcgttccac 900cacgctggtc ttgggagaga tgagagggtt
ctcgtggagg agaactttag aaagggtata 960ataaaggccg tagttgccac cccaacactt
tcggcgggaa ttaacactcc agcgtttagg 1020gtgattataa gggatatttg gaggtactct
gactttggaa tggagagaat tccgataatc 1080gaggttcacc aaatgcttgg gagagctgga
aggccgaagt atgatgaggt tggggaggga 1140ataatagttt ctacaagcga tgatccgaga
gaggtaatga atcactacat atttggaaag 1200cctgaaaaac tgttctccca gctctccaac
gagagtaatt tgagaagtca agttttggcc 1260ctaatagcga cctttggcta ttcaactgtg
gaggagattt tgaagttcat ctcaaacaca 1320ttctatgctt atcaaaggaa ggacacatac
tctttagagg agaagataag gaacatactc 1380tacttcctcc tagagaatga gttcatagag
atatccttag aggataaaat aaggccgctt 1440tccctgggaa ttaggactgc aaagctttat
atcgatccct atacggccaa gatgttcaag 1500gataaaatgg aggaagttgt taaagatcca
aatcctatag gaatatttca cttaatctcc 1560ctaactccgg atataacccc cttcaactac
tcaaagagag aatttgaaag gctcgaagag 1620gaatactacg aattcaagga taggttatac
tttgacgatc cctacatttc gggttacgac 1680ccctacctag agaggaagtt cttcagagct
ttcaaaactg cactagtgct tctggcatgg 1740ataaatgaag tccctgaggg agaaatagtt
gaaaagtact cggtggaacc tggggacatc 1800tataggatag ttgagacggc tgagtggctg
gtgtactctc taaaggaaat tgcaaaagtt 1860cttggagctt atgagatcgt tgattatctt
gaaacattga gggttagggt caagtatggg 1920attagggagg aattgattcc cctaatgcaa
ctcccgttgg ttggaagaag gagagctaga 1980gctctttaca atagcggatt tagaagtata
gaggatatat ctcaagcgag gccagaagag 2040cttttgaaaa tcgaggggat aggggtcaag
accgttgagg ctatcttcaa gtttcttggt 2100aagaatgtga aaatttcgga gaaacctaga
aaaagtaccc ttgattactt tctcaaatct 2160tga
216384720PRTPyrococcus furiosus 84Met
Arg Val Asp Glu Leu Arg Val Asp Glu Arg Ile Lys Ser Thr Leu 1
5 10 15Lys Glu Arg Gly Ile Glu Ser
Phe Tyr Pro Pro Gln Ala Glu Ala Leu 20 25
30Lys Ser Gly Ile Leu Glu Gly Lys Asn Ala Leu Ile Ser Ile
Pro Thr 35 40 45Ala Ser Gly Lys
Thr Leu Ile Ala Glu Ile Ala Met Val His Arg Ile 50
55 60Leu Thr Gln Gly Gly Lys Ala Val Tyr Ile Val Pro Leu
Lys Ala Leu 65 70 75
80Ala Glu Glu Lys Phe Gln Glu Phe Gln Asp Trp Glu Lys Ile Gly Leu
85 90 95Arg Val Ala Met Ala Thr
Gly Asp Tyr Asp Ser Lys Asp Glu Trp Leu 100
105 110Gly Lys Tyr Asp Ile Ile Ile Ala Thr Ala Glu Lys
Phe Asp Ser Leu 115 120 125Leu Arg
His Gly Ser Ser Trp Ile Lys Asp Val Lys Ile Leu Val Ala 130
135 140Asp Glu Ile His Leu Ile Gly Ser Arg Asp Arg
Gly Ala Thr Leu Glu145 150 155
160Val Ile Leu Ala His Met Leu Gly Lys Ala Gln Ile Ile Gly Leu Ser
165 170 175Ala Thr Ile Gly
Asn Pro Glu Glu Leu Ala Glu Trp Leu Asn Ala Glu 180
185 190Leu Ile Val Ser Asp Trp Arg Pro Val Lys Leu
Arg Arg Gly Val Phe 195 200 205Tyr
Gln Gly Phe Val Thr Trp Glu Asp Gly Ser Ile Asp Arg Phe Ser 210
215 220Ser Trp Glu Glu Leu Val Tyr Asp Ala Ile
Arg Lys Lys Lys Gly Ala225 230 235
240Leu Ile Phe Val Asn Met Arg Arg Lys Ala Glu Arg Val Ala Leu
Glu 245 250 255Leu Ser Lys
Lys Val Lys Ser Leu Leu Thr Lys Pro Glu Ile Arg Ala 260
265 270Leu Asn Glu Leu Ala Asp Ser Leu Glu Glu
Asn Pro Thr Asn Glu Lys 275 280
285Leu Ala Lys Ala Ile Arg Gly Gly Val Ala Phe His His Ala Gly Leu 290
295 300Gly Arg Asp Glu Arg Val Leu Val
Glu Glu Asn Phe Arg Lys Gly Ile305 310
315 320Ile Lys Ala Val Val Ala Thr Pro Thr Leu Ser Ala
Gly Ile Asn Thr 325 330
335Pro Ala Phe Arg Val Ile Ile Arg Asp Ile Trp Arg Tyr Ser Asp Phe
340 345 350Gly Met Glu Arg Ile Pro
Ile Ile Glu Val His Gln Met Leu Gly Arg 355 360
365Ala Gly Arg Pro Lys Tyr Asp Glu Val Gly Glu Gly Ile Ile
Val Ser 370 375 380Thr Ser Asp Asp Pro
Arg Glu Val Met Asn His Tyr Ile Phe Gly Lys385 390
395 400Pro Glu Lys Leu Phe Ser Gln Leu Ser Asn
Glu Ser Asn Leu Arg Ser 405 410
415Gln Val Leu Ala Leu Ile Ala Thr Phe Gly Tyr Ser Thr Val Glu Glu
420 425 430Ile Leu Lys Phe Ile
Ser Asn Thr Phe Tyr Ala Tyr Gln Arg Lys Asp 435
440 445Thr Tyr Ser Leu Glu Glu Lys Ile Arg Asn Ile Leu
Tyr Phe Leu Leu 450 455 460Glu Asn Glu
Phe Ile Glu Ile Ser Leu Glu Asp Lys Ile Arg Pro Leu465
470 475 480Ser Leu Gly Ile Arg Thr Ala
Lys Leu Tyr Ile Asp Pro Tyr Thr Ala 485
490 495Lys Met Phe Lys Asp Lys Met Glu Glu Val Val Lys
Asp Pro Asn Pro 500 505 510Ile
Gly Ile Phe His Leu Ile Ser Leu Thr Pro Asp Ile Thr Pro Phe 515
520 525Asn Tyr Ser Lys Arg Glu Phe Glu Arg
Leu Glu Glu Glu Tyr Tyr Glu 530 535
540Phe Lys Asp Arg Leu Tyr Phe Asp Asp Pro Tyr Ile Ser Gly Tyr Asp545
550 555 560Pro Tyr Leu Glu
Arg Lys Phe Phe Arg Ala Phe Lys Thr Ala Leu Val 565
570 575Leu Leu Ala Trp Ile Asn Glu Val Pro Glu
Gly Glu Ile Val Glu Lys 580 585
590Tyr Ser Val Glu Pro Gly Asp Ile Tyr Arg Ile Val Glu Thr Ala Glu
595 600 605Trp Leu Val Tyr Ser Leu Lys
Glu Ile Ala Lys Val Leu Gly Ala Tyr 610 615
620Glu Ile Val Asp Tyr Leu Glu Thr Leu Arg Val Arg Val Lys Tyr
Gly625 630 635 640Ile Arg
Glu Glu Leu Ile Pro Leu Met Gln Leu Pro Leu Val Gly Arg
645 650 655Arg Arg Ala Arg Ala Leu Tyr
Asn Ser Gly Phe Arg Ser Ile Glu Asp 660 665
670Ile Ser Gln Ala Arg Pro Glu Glu Leu Leu Lys Ile Glu Gly
Ile Gly 675 680 685Val Lys Thr Val
Glu Ala Ile Phe Lys Phe Leu Gly Lys Asn Val Lys 690
695 700Ile Ser Glu Lys Pro Arg Lys Ser Thr Leu Asp Tyr
Phe Leu Lys Ser705 710 715
720
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic: