Patent application title: PFU REPLICATION ACCESSORY FACTORS AND METHODS OF USE

Inventors: Holly Hurlbut Hogrefe (San Diego, CA, US) Janice Marie Cline (San Marcos, CA, US) Connie Jo Hansen (San Diego, CA, US)
Assignees: STRATAGENE CALIFORNIA
IPC8 Class: AC12P2106FI
USPC Class: 435 691
Class name: Recombinant DNA technique included in method of making a protein or polypeptide
Publication date: 09/03/2009
Patent application number: 20090221029

Abstract:

This invention provides isolated polynucleotides that encode replication accessory factors. The invention also provides novel DNA replication accessory factors, which have been isolated and purified from the hyperthermophilic archaea Pyrococcus furiosus. The invention also provides various methods of enhancing a nucleic acid polymerase reaction comprising the addition of the replication accessory factors to the reaction. This invention further provides methods of synthesizing, amplifying, and mutagenizing nucleic acids of interest employing the replication accessory factors. This invention also provides kits comprising, at least one of the replication accessory factors. This invention also provides kits useful for various methods that comprise at least one replication accessory factor.

Claims:

1-3. (canceled)

4. An isolated polynucleotide encoding a helicase, wherein the polynucleotide comprises a nucleic acid sequence that encodes an amino acid sequence at least 70% identical to SEQ ID NO:74.

5. The polynucleotide of claim 4, wherein the polynucleotide is a cDNA.

6. The polynucleotide of claim 4, wherein the polynucleotide is an mRNA.

7-14. (canceled)

15. A vector comprising the polynucleotide of claim 4.

16. The vector of claim 15, wherein the vector is a plasmid.

17. The vector of claim 15, wherein the vector is a bacteriophage.

18. The vector of claim 15, wherein the vector is a retrovirus.

19. The vector of claim 15, wherein the vector is an adenovirus.

20. A host cell comprising the vector of claim 15.

21. The host cell of claim 20, wherein the host cell is a prokaryotic cell.

22. The host cell of claim 20, wherein the host cell is a eukaryotic cell.

23-26. (canceled)

27. A method for producing a polypeptide, comprising: expressing the polynucleotide of the vector of claim 15 in a host cell; and purifying the expressed product.

28. The method of claim 27, wherein the host cell is a prokaryotic cell.

29. The method of claim 27, wherein the host cell is a eukaryotic cell.

30-74. (canceled)

75. The polynucleotide of claim 4, wherein the amino acid sequence is at least 80% identical to SEQ ID NO:74.

76. The polynucleotide of claim 4, wherein the amino acid sequence is at least 90% identical to SEQ ID NO:74.

77. The polynucleotide of claim 4, wherein the amino acid sequence is at least 95% identical to SEQ ID NO:74.

78. The polynucleotide of claim 4, wherein the nucleic acid sequence comprises SEQ ID NO:67.

Description:

RELATED APPLICATION INFORMATION

[0001]This application is a divisional application of U.S. application Ser. No. 10/828,924, filed Apr. 20, 2004 (now U.S. Pat. No. 7,442,766), which is a continuation of U.S. application Ser. No. 09/626,813, filed Jul. 27, 2000 (abandoned), which claims the benefit of U.S. Provisional Application Ser. No. 60/146,580, filed Jul. 30, 1999. Each of these prior application is herein incorporated by reference in its entirety.

BACKGROUND AND SUMMARY OF THE INVENTION

[0002]The invention relates to the field of replicating, amplifying, and sequencing nucleic acids. Further, this invention relates to novel proteins that enhance the activity of the polymerases.

[0003]In vitro polymerization techniques have enormously benefited the fields of biotechnology and medicine. The ability to manipulate nucleic acids with polymerization reactions greatly facilitates techniques ranging from gene characterization and molecular cloning (including, but not limited to sequencing, mutagenesis, synthesis and amplification of DNA), determining allelic variations, and detecting and screening of various diseases and conditions (e.g., hepatitis B).

[0004]An in vitro polymerization technique of great interest is the polymerase chain reaction (PCR). This method rapidly and exponentially replicates and amplifies nucleic acids of interest. PCR is performed by repeated cycles of denaturing a DNA template, usually by high temperatures, then annealing opposing primers to the complementary DNA strands, and then extending the annealed primers with a DNA polymerase. Multiple cycles of PCR result in an exponential amplification of the DNA template.

[0005]Unfortunately, PCR has limitations. These limitations range from 1) the rate of nucleotide incorporation, 2) the fidelity of nucleotide incorporation, 3) the length of the molecule to be amplified, and 4) the specificity of the polymerase.

[0006]Various methods to improve PCR exist. One approach is to optimize the reaction conditions, e.g., such as the pH, dNTP concentrations, or reaction temperatures. Another approach is to add various chemical compounds, e.g., formamide (Sarkar, G., et al. Nucl. Acids Res. 18: 7465 (1990)), tetramethyammonium chloride, and dimethyl sulfoxide (Chevet et al., Nucl. Acids Res. 23:3343-3344 (1995); Hung et al., Nucl. Acids Res. 18:4953 (1990)) to either increase the specificity of the PCR reaction and/or increase yield. Other attempts include adding various proteins, such as replication accessory factors. Replication accessory factors known to be involved in DNA replication have also increased yields and the specificity of PCR products. For example, E. coli single-stranded DNA binding protein, such as RFA, has been used to increase the yield and specificity of primer extension reactions and PCR reactions (U.S. Pat. Nos. 5,449,603, and 5,534,407). Another protein, the gene 32 protein of phage 14, appears to improve the ability to amplify larger DNA fragments (Schwartz et al., Nucl. Acids Res. 18: 1079 (1990).

[0007]An important modification that has enhanced the ease and specificity of PCR is the use of Thermus aquaticus (Taq) DNA polymerase in place of the Klenow fragment of E. coli DNA pol I (Saiki et al., Science 230:1350-1354 (1988)). The use of this thermostable DNA polymerase obviates the need for repeated enzyme additions, permits elevated annealing and primer extension temperatures, and enhances specificity. Further, this modification has enhanced the specificity of binding between the primer and its template. But, Taq polymerase has a fundamental drawback because it does not have 3' to 5' exonuclease activity and, therefore, cannot excise incorrect nucleotides added to the ends of the amplified products. Due to this limitation, the fidelity of Taq-PCR reactions typically have suffered. Therefore, those in the field have searched for another thermostable polymerase that has 3' to 5' exonuclease activity.

[0008]Polymerases having 3' to 5' exonuclease activity have been found in archaebacteria (archaea). Archaebacteria is a third kingdom, different from eukaryotes and bacteria (eubacteria). Many archaebacteria are thermophilic bacteria-like organisms that can grow in extremely high temperatures, i.e., 100° C. One such archaebacteria is Pyrococcus furiosus (Pfu). A monomeric polymerase from Pfu has been identified that has the desired 3' to 5' exonuclease activity and synthesizes nucleic acids of interest at high temperatures (Lundberg et al., Gene 108: 1-6 (1991); Cline et al., Nucl. Acids Res. 24: 3546-3551 (1996) (This polymerase is referred to as Pfu polymerase.)) A second DNA polymerase has been identified in P. furiosus which has two subunits (DP1/DP2) and is referred to as pol II. See References 1 and 15. This polymerase may also be enhanced by the accessory factors.

[0009]Certain natural proteins exist in archaebacteria, i.e., PEF (polymerase enhancing factors) that exhibit deoxyuracil triphosphatase (dUTPase) activity and that enhance the activity of Pfu polymerase (International Patent Application Publication No. WO 98/42860, published on Oct. 1, 1998). The presence of deoxyuracil-containing DNA in a DNA polymerization reaction inhibits polymerase activity (Lasken et al. (J. Biol. Chem. 271: 17692-17696)). Specifically, during the course of a normal PCR reaction, a dCTP may be deaminated into dUTP, thereby introducing a deoxyuridine into the newly synthesized DNA. But, when this newly synthesized DNA is thereafter amplified, the presence of the deoxyuridine inhibits the Pfu polymerase. The archaeal dUTPase (PEF) prevents dUTP incorporation and, thus, avoids the inhibition of the Pfu polymerase. Accordingly, the archaeal dUTPase optimizes the activity of Pfu polymerase.

[0010]According to certain embodiments, the invention provides methods of, and materials for, enhancing the polymerase activity of Pfu polymerase. Certain embodiments involve major components of the replication machinery in eukaryotes, e.g.: a helicase enzyme that unwinds the DNA helix and, thereby, provides a single-stranded DNA template; single-stranded DNA binding proteins (RFA) that bind and stabilize the resulting single-stranded DNA template; a "sliding clamp" protein (PCNA) that stabilizes the interaction between the polymerase and the primed single-stranded DNA template and that enhances synthesis of long DNA strands (also known as "processivity"); and a "clamp-loading" protein complex (RFC) that assembles the PCNA protein.

[0011]According to certain embodiments, the invention provides novel DNA replication accessory factors which have been isolated and purified from the hyperthermophilic archaeal bacteria Pyrococcus furiosus. In certain embodiments, the isolated proteins are thermostable homologues of eukaryotic DNA replication proteins PCNA, RF-C subunits, RFA, and helicases. Recent computer analysis of sequence data do not describe the proteins disclosed herein, although sequences that may be homologous to eukaryotic and/or eubacterial replication factors exist (Chedin et al., TIBS 23:273-277 (1998); Egdell and Doolittle, Cell 89: 995-998 (1997); Bull et al., Science 273:1058-1-73 (1996)).

[0012]According to certain embodiments, this invention also involves isolated polynucleotides that encode the replication accessory factors.

[0013]In certain embodiments, the polynucleotide may be cDNA, genomic DNA, mRNA, or plasmid DNA.

[0014]According to certain embodiments, the invention includes vectors comprising a polynucleotide that encodes a replication accessory factor and host cells comprising such vectors. According to certain embodiments, the invention includes polypeptides expressed in those host cells. Further, this invention provides not only the host cells and their products, but also, the methods of using such host cells to produce the polypeptides of interest.

[0015]According to certain embodiments, the invention includes methods of enhancing a nucleic acid polymerase reaction comprising the addition of one or more of the replication accessory factors to the reaction.

[0016]In certain embodiments, only one archaeal replication accessory factor will be added into the nucleic acid polymerase reaction. In other embodiments, a combination of factors may be added.

[0017]In certain embodiments, an archaeal dUTPase may be combined with one or more of those replication accessory factors to further enhance the polymerase reaction.

[0018]In certain embodiments, this invention also provides methods of synthesizing nucleic acids comprising employing an archaeal polymerase and an archaeal replication accessory factor(s).

[0019]According to certain embodiments, the invention includes methods of amplifying nucleic acids of interest comprising employing an archaeal polymerase and an archaeal replication accessory factor(s).

[0020]In certain embodiments of the inventive methods, the archaeal polymerase is Pfu polymerase. In certain embodiments of these methods, the archaeal polymerase is combined with another polymerase, such as Taq. In other embodiments of these methods, an archaeal dUTPase may also be included to enhance polymerase activity.

[0021]In certain embodiments of the inventive methods, the archaeal polymerase is P. furiosus pol II polymerase.

[0022]In certain embodiments, this invention also provides a kit used in the practice of the above-described methods.

[0023]In certain embodiments, this invention also provides a kit comprising an archaeal polymerase and at least one archaeal replication accessory factor.

[0024]In certain embodiments, those kits would also comprise an archaeal dUTPase and possibly, another polymerase, such as Taq.

BRIEF DESCRIPTION OF THE DRAWINGS

[0025]The abbreviations used herein for amino acids in the translated protein sequences, which are single letter, and the nucleic acids are those conventionally used, as in Stryer et al., Biochemistry. 3rd ed., W.H, Freeman, N.Y. (1988) at the back cover.

[0026]FIG. 1 illustrates the identification of native PCNA in heparin sepharose fractions. Nucleotide incorporation was measured in the absence of salt to detect polymerase activity ("Pol") or in the presence of NaCl+Pfu DNA polymerase to detect PCNA.

[0027]FIG. 2 illustrates the identification of native PCNA activity in SDS-PAGE gel slices. An active heparin sepharose fraction was electrophoresed on an SDS-PAGE gel, and slices of the gel were excised and the proteins eluted. The presence of PCNA or polymerase activity was determined as described above in FIG. 1 and in the Detailed Description of Embodiments of the Invention.

[0028]FIG. 3 illustrates the DNA sequence of PCNA. (SEQ ID NO:59)

[0029]FIG. 4 illustrates the translated protein sequence of PCNA. (SEQ ID NO:60)

[0030]FIG. 5 illustrates that PCNA enhances the processivity of Pfu DNA polymerase. A 5'-radiolabelled 38 bp oligonucleotide was annealed to single-stranded M13. The template was incubated at 72° C. in the presence of cloned Pfu PCR buffer, dNTPs, and either cloned Pfu DNA polymerase or exo^-Pfu DNA polymerase. To certain reactions, ˜0.1 or 10 fmoles of PCNA was added. Reactions were allowed to proceed for 1, 5, 10, or 30 minutes, and then stopped in loading buffer. The extension products were electrophoresed on CastAway® prepoured 6% (7M urea) gels, and the gels were dried and visualized by autoradiography. The length of the fully extended product is approximately 7 kb.

[0031]FIG. 6 illustrates the stimulation of TaqPlus® Long DNA polymerase blend (Stratagene) with PCNA. A 23 kb fragment was amplified from genomic DNA using 5U TaqPlus® Long polymerase blend, in the presence of native PEF, a no KCl buffer, and varying amounts of PCNA.

[0032]FIG. 7 illustrates the stimulation of TaqPlus® Long DNA polymerase blend with PCNA. A 30 kb fragment was amplified from genomic DNA using 5U TaqPlus® Long, in the presence of native PEF, a no KCl buffer, and varying amounts of PCNA.

[0033]FIG. 8 illustrates the DNA sequence of genomic RFC clones. (SEQ ID NO:61) Genomic sequences encoding the P38 and P55 subunits are located in tandem, respectively. The sequence encoding P38 contains an intein. As used herein, the term "intein" includes, but is not limited to protein splicing elements. These elements are involved in the post-translational processing of pre-proteins. The coding regions of the P38 and P55 subunits are bracketed [ ]. The intein sequence is enclosed in parentheses ( ).

[0034]FIG. 9 illustrates the translated protein sequence of the genomic RFC clone. (SEQ ID NO:62) The sequence encoding P38 and P55% respectively, are enclosed in parentheses ( ), while the sequence of the intein is bracketed [ ]. The * indicates a stop codon.

[0035]FIG. 10 illustrates the translated protein sequence of recombinant P55 clone. (SEQ ID NO:63)

[0036]FIG. 11 illustrates the translated protein sequence of recombinant P38 clone. (SEQ ID NO:64)

[0037]FIG. 12 illustrates a Western blot of immunoaffinity purified native RFC complex using anti-P38 IgG (panel A) or anti-P55 IgG (panel B). Immunoaffinity purification was carried out using rabbit anti P55 IgG as the capture reagent. Fractions are labeled as follows: +, positive control; 0, wash. F20-F34 refer to fractions eluted at pH 2.8 from the column.

[0038]FIG. 13 illustrates a protein gel of immunoaffinity purified native RFC complex. Immunoaffinity purification was carried out using rabbit anti P55 IgG as the capture reagent. Fractions are labeled as follows: +, positive P38 control; α-P38 (unrelated expt.) or α-P55 column washes (present expt.). F18-F23 refer to fractions eluted at pH 2.8 from the column.

[0039]FIG. 14 illustrates the ATPase activity of native and recombinant RFC. Positions on the TLC plate containing the released radioactive phosphate were excised and counted in a scintillation counter.

[0040]FIG. 15 illustrates that native clamp loader further stimulates primer extension by Pfu in the presence of PCNA. Primer extension reactions were carried out as described in the Detailed Description of Embodiments of the Invention.

[0041]FIG. 16 illustrates a CDNA sequence of a clone expressing RFA. (SEQ ID NO:65)

[0042]FIG. 17 illustrates the translated protein sequence of RFA. The theoretical molecular weight is 41.3 kDa. The native protein may start at the third methionine. (SEQ ID NO:66)

[0043]FIG. 18 illustrates a gel shift assay that demonstrates single-stranded DNA binding activity of P. furiosus RFA. 50 ng of a 38-mer oligo was incubated with E. coli SSB (lane 1), water (lane 2), or P. furiosus RFA (lanes 3-7) in TE buffer (lanes 1-3), 1× cloned Pfu buffer (lane 4), 50 mM Tris pH 8.5, 25 mM KCl, 2 mM MgCl₂ (lane 5), 50 mM Tris pH 8.5, 25 mM KCl, 5 mM MgCl₂ (lane 6), or 50 mM Tris pH 8.5, 25 mM KCl, 2 mM ZnCl₂ (lane 7). Samples were incubated at 95° C. for 10 minutes, followed by 72° C. for 2 minutes prior to loading on a 4-20% acrylamide gradient gel in 1×TBE buffer. Bands were visualized by SYBR green staining and UV illumination.

[0044]FIG. 19 illustrates an increase in amplification specificity with RFA using cloned Pfu+PEF (Pfu Turbo® DNA polymerase (Stratagene)) (5.2 kb system).

[0045]FIG. 20 illustrates an increase in product yield using RFA in combination with cloned Pfu Turbo® DNA polymerase (2.1 kb system).

[0046]FIG. 21 illustrates an increase in yield and amplification specificity with RFA and E. coli SSB using Taq and Pfu DNA polymerases (0.5 kb system).

[0047]FIG. 22 illustrates the DNA sequence of recombinant helicase 2. This helicase has demonstrated PCR enhancing activity. (SEQ ID NO:67)

[0048]FIG. 23 illustrates the DNA sequence of recombinant helicase 3. (SEQ ID NO:68)

[0049]FIG. 24 illustrates the DNA sequence of recombinant helicase 4. (SEQ ID NO:69)

[0050]FIG. 25 illustrates the DNA sequence of recombinant helicase 5. (SEQ ID NO:70)

[0051]FIG. 26 illustrates the DNA sequence of recombinant helicase 6. (SEQ ID NO:71)

[0052]FIG. 27 illustrates the DNA sequence of recombinant helicase 7. (SEQ ID NO:72)

[0053]FIG. 28 illustrates the DNA sequence of recombinant helicase dna2. (SEQ ID NO:73) This helicase has demonstrated PCR enhancing activity.

[0054]FIG. 29 illustrates the translated protein sequence for helicase 2. (SEQ ID NO:74) The theoretical molecular weight is 87.9 kDa+4.0 kDa (CBP affinity tag).

[0055]FIG. 30 illustrates the translated protein sequence for helicase 3. (SEQ ID NO:75) The theoretical molecular weight is 100.0 kDa+4.0 kDa.

[0056]FIG. 31 illustrates the translated protein sequence for helicase 4. (SEQ ID NO:76) The theoretical molecular weight is 105.0 kDa+4.0 kDa.

[0057]FIG. 32 illustrates the translated protein sequence for helicase 5. (SEQ ID NO:77) The theoretical molecular weight is 86.8 kDa+4.0 kDa.

[0058]FIG. 33 illustrates the translated protein sequence for helicase 6+4.0 kDa (CBP affinity tag). (SEQ ID NO:78)

[0059]FIG. 34 illustrates the translated protein sequence for helicase 7. (SEQ ID NO:79) The theoretical molecular weight is 126.0 kDa+4.0 kDa.

[0060]FIG. 35 illustrates the translated protein sequence for helicase dna2+4.0 kDa (CBP affinity tag). (SEQ ID NO:80)

[0061]FIG. 36 illustrates the ATPase activity of helicases produced by phage induction. 1 microliter of Pfu helicases 3, 4, 5, 6, 7, and 8 (lanes 1-6 respectively), 0.8 units of porcine ATPase (9) or water (10) were incubated with 1 μl of 4.5 micromolar ATP and 1 microCurie of gamma labeled ³³P ATP in 1× Optiprime buffer #3 (10 mM Tris-HCl (pH 8.3), 3.5 mM MgCl₂, 75 mM KCl). The samples were incubated at 72° C. for 20 minutes before being spotted on PEI cellulose F. The samples were allowed to dry before the PEI cellulose was placed in a shallow reservoir of 0.4 M NaH₂PO₄. The liquid front was allowed to migrate 5 cm before being removed from the liquid and dried. The samples were exposed to x-ray film for one hour.

[0062]FIG. 37 illustrates the ATPase activity of helicases produced by IPTG induction of bacterial cultures. 1 microliter of an old lot or new lot of Pfu dna2-like helicase (lanes 1 and 2, respectively), Pfu helicase 2, 3, 4, 5 and 7 (lanes 3-7), water (8), or 0.8 units of porcine ATPase (9) were incubated with 1 μl of 4.5 micromolar ATP and 1 microCurie of gamma labeled ³³P ATP in 1× Optiprime buffer #3 (10 mM Tris-HCl (pH 8.3), 3.5 mM MgCl₂, 75 mM KCl). The samples were incubated at 72° C. for 20 minutes before being spotted on PEI cellulose F. After drying, the PEI cellulose was placed in a shallow reservoir of 0.4 M NaH₂PO₄. The liquid front was allowed to migrate 4 cm before being removed from the liquid and dried. The samples were exposed to x-ray film for one hour.

[0063]FIG. 38 illustrates the helicase displacement of bound oligos. Radioactively labeled oligonucleotides with a 3' overhang (A) or a 5' overhang (B) were annealed to M13 mp18. The reactions were incubated with 0.5 μl of putative Pfu helicases 3-7 and Pfu helicase dna2 in 50 mM Tris pH 8.5, 25 mM KCl, 5 mM MgCl₂ and 5 mM ATP for 30 minutes at 55° C. 1 μl of Pfu helicase 2 was used in an identical reaction. The positive control was generated by thermally melting the annealed oligo prior to loading. The negative control was incubated with water. The samples were run on 4-20% gradient acrylamide gels in 1×TBE. The gels were dried and exposed to x-ray film.

[0064]FIG. 39 illustrates the enhancement of Pfu processivity with Pfu PCNA and RF-C.

[0065]FIG. 40 illustrates the DNA sequence of recombinant helicase 8. (SEQ ID NO:81) Molecular weight is 82.6 kDa+4 kDa CBP tag.

[0066]FIG. 41 illustrates the translated protein sequence of recombinant helicase 8. (SEQ ID NO:82)

[0067]FIG. 42 illustrates the stimulation of nucleotide incorporation by Pfu and P. furiosus pol II DNA polymerases using PCNA. Primer extension reactions were performed at 66-99° C. using primed single-stranded M13 DNA. Optimal activity was observed at or above 80° C. in the presence of PCNA (no measurements carried out between 80 and 95° C.), while reduced activity was observed above 72° C. in the absence of PCNA.

DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION

[0068]The invention provides for isolated and purified polynucleotides that encode novel DNA replication accessory factors from hyperthermophilic archaebacteria. In certain embodiments, the replication accessory factors are from Pyrococcus furiosus. These replication accessory factors may be thermostable homologues of the eukaryotic DNA replication proteins PCNA, RFC subunits, RFA, and helicases.

[0069]As used herein "isolated and purified polynucleotide" is a nucleic acid, which is substantially separate from at least one other DNA sequence that naturally accompanies the native polynucleotide. Such other DNA sequences may be, e.g., a ribosome, a polymerase, and any other human genomic sequence.

[0070]These polynucleotides include RNA, cDNA, genomic DNA, synthetic forms, e.g., oligonucleotides, antisense and sense strands, and may also include chemically or biochemically modified nucleotides, e.g., mutated nucleotides or cys-labeled nucleotides. Recombinant polynucleotides comprising the sequences otherwise not naturally occurring are also provided in this invention.

[0071]Although polynucleotides having naturally occurring sequences may be employed, such polynucleotides may be altered, e.g., by deletion, substitution, or insertion. One skilled in the art will know appropriate changes in the sequence that will encode proteins that retain biological activity. In certain preferred embodiments, polynucleotides may be changed to encode different conservative amino acid substitutions. Conservative amino acid substitutions include, but are not limited to, a change in which a given amino acid may be replaced, for example, by a residue having similar physiochemical characteristics. Examples of such conservative substitutions include, but are not limited to, substitution of one aliphatic residue for another, such as Ile, Val, Leu, or Ala for one another; substitutions of one polar residue for another, such as between Lys and Arg, Glu and Asp, or Gln and Asn; or substitutions of one aromatic residue for another, such as Phe, Trp, or Tyr for one another. Other conservative substitutions, e.g., involving substitutions of entire regions having similar hydrophobicity characteristics, are well-known. See Biochemistry: A Problems Approach, (Wood, W. B., Wilson, J. H., Benbow, R. M., and Hood, L. E., eds.) Benjamin/Cummings Publishing Co., Inc., Menlo Park, Calif. (1981), page 14-15.

[0072]cDNA or genomic libraries of various types may be screened as natural sources of the polynucleotides of the present invention, or such nucleic acids may be provided by amplification of sequences that exist in genomic DNA or other natural sources, e.g., by PCR. See, e.g., PCR Protocols: A Guide to Methods and Application, Innis, M., et al., eds., Academic Press: San Diego (1990). Genomic polynucleotides encoding the archaeal replication accessory factors may contain additional non-coding bases, or inteins, and one skilled in the art would know how to obtain such polynucleotides. One way to obtain genomic DNA sequences is by probing a genomic library with all or part of a known DNA sequence. The obtained genomic DNA sequence should encode functional proteins.

[0073]In certain embodiments of this invention, the nucleic acid sequences of the isolated polynucleotides encoding the replication accessory factors have been obtained and may be used for various purposes. In certain embodiments, the invention includes isolated and purified polynucleotides that encode the following: an archaeal PCNA, an archaeal RFC subunit P38 protein, archaeal RFC subunit P55, archaeal RFC subunit P98, archaeal RFA, and various archaeal helicases. According to certain embodiments, the invention includes eight different helicases that exist in Pfu, i.e., helicase 2 to 8, and helicase dna2. According to certain embodiments, the polynucleotide sequences are set forth in FIGS. 3, 8, 16, 23 to 28, and 40.

[0074]As used herein, the term "PCNA" may also be referred to as a "clamp" or a "sliding clamp" protein, in view of its role in clamping the DNA polymerase to the DNA template in eukaryotes.

[0075]In certain embodiments, the term "RFC subunits" includes, but is not limited to, proteins of about 55 kDa and about 38 kDa in molecular weight or subunits having the amino acid sequence set forth in FIG. 10 and FIG. 11, respectively. These subunits are referred to herein as "P55" and "P38." These subunits are part of a complex having one large subunit and at least one small subunit. P55 is considered a large subunit and P38 a small subunit.

[0076]This invention further provides for isolated and purified polynucleotides that encode amino acid sequences for various replication accessory factors, such as an archaeal PCNA, archaeal RFC subunit P38 protein, archaeal RFC subunit P55, archaeal RFA, and various archaeal helicases. According to certain embodiments, the amino acids sequences of those polynucleotides are set forth in FIGS. 4, 9 to 11, 17, 29 to 35, and 41.

[0077]These polynucleotides described herein also include nucleic acid sequences that encode for polypeptide analogs or derivatives of the various archaeal replication accessory factors, which differ from naturally-occurring forms, e.g., deletion analogs that contain less than all of the amino acids of the naturally-occurring forms, substitution analogs that have one or more amino acids replaced by other residues, and addition analogs that have one or more amino acids added to the naturally-occurring sequence. These various analogs share some or all of the biological properties of the archaeal replication accessory factors. As noted above, one skilled in the art will be able to design suitable analogs. In certain preferred embodiments, conservative amino acid substitutions will be made. In certain embodiments, the analogs will be 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to the naturally-occurring sequence.

[0078]Percent identity involves the relatedness between amino acid or nucleic acid sequences. One determines the percent of identical matches between two or more sequences with gap alignments that are addressed by a particular method. The percent identity may be determined by visual inspection and mathematical calculation. Alternatively, the percent identity of two nucleic acid sequences can be determined by comparing sequence information using the GAP computer program, version 6.0 described by Devereux et al. (Nucl. Acids Res. 12:387, 1984) and available from the University of Wisconsin Genetics Computer Group (UWGCG). The preferred default parameters for the GAP program include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) for nucleotides, and the weighted comparison matrix of Gribskov and Burgess, Nuci. Acids Res. 14:6745, 1986, as described by Schwartz and Dayhoff, eds., Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp. 353-358, 1979; (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps. Other programs used by one skilled in the art of sequence comparison may also be used.

[0079]In certain embodiments, nucleic acids may be those that hybridize under moderately or highly stringent conditions to the complement of naturally-occurring encoding nucleic acids or to nucleic acids that encode proteins having naturally-occurring amino acid sequences. As used herein, conditions of moderate stringency can be readily determined by those having ordinary skill in the art based on, for example, the length of the DNA. The basic conditions are set forth by Sambrook et al. Molecular Cloning. A Laboratory Manual, 2 ed. Vol. 1, pp. 1.101-104, Cold Spring Harbor Laboratory Press, (1989), and include use of a prewashing solution for the nitrocellulose filters 5×SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization conditions of about 50% formamide, 6×SSC at about 42° C. (or other similar hybridization solution, such as Stark's solution, in about 50% formamide at about 42° C.) and washing conditions of about 60° C., 0.5×SSC, 0.1% SDS. Conditions of high stringency can also be readily determined, by the skilled artisan based on, for example, the length of the DNA. Generally, such conditions are defined as hybridization conditions as above, and with washing at approximately 68° C., 0.2×SSC, 0.1% SDS. The skilled artisan will recognize that the temperature and wash solution salt concentration can be adjusted as necessary according to factors such as the length of the probe.

[0080]In certain embodiments, polynucleotides may have sequences different from the naturally-occurring nucleic acid sequence in view of the redundancy in the genetic code, especially if the amino acid sequences are known. Various codon substitutions may be introduced to produce various restriction sites or to optimize expression in a particular system.

[0081]The polynucleotides used in this invention will usually comprise at least about 15 nucleotides. In certain embodiments, the number of nucleotides is the minimal length required to express a biologically active replication accessory factor or, to probe for nucleic acid sequences encoding a replication accessory factor, or for nucleic acid priming.

[0082]Techniques for manipulating polynucleotides are described generally in Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd edition, eds. Sambrook et al. (Cold Spring Harbor Laboratory Press 1989)). Reagents useful in applying such techniques, e.g., restriction enzymes, are widely known in the art and commercially available from vendors such as Stratagene.

[0083]These polynucleotides may be used as nucleic acid probes and primers. Such probes and primers would be useful in screening for other archaeal replication accessory factors or screening other species for homologous replication accessory factors. The probe or primer may comprise an isolated nucleic acid, and may include a detectable label, such as a reporter molecule.

[0084]In certain embodiments of this invention, one may also want to generate viral or plasmid DNA vectors using the polynucleotides disclosed herein. The contemplated vectors include various viral vectors. Some commonly used examples are, but are not limited to, plasmids, bacteriophages, retroviruses, and adenovirus. Such vectors may be coupled with nucleic acids that encode an origin of replication (ORI) or autonomously replicating sequence (ARS), expression control sequences, e.g., promoter and enhancer sequences, and, protein processing information sites, such as RNA splice sites, polyadenylation sites, ribosome-bind sites, and mRNA stabilizing sequences. Such vectors and the methods used in constructing them are well known in the art. See, e.g., Sambrook et al: Molecular Cloning. A Laboratory Manual, 2 ed. Vol. 1, Cold Spring Harbor Laboratory Press, (1989); Pouwels et al., Cloning Vectors: A Laboratory Manual, Elsevier, N.Y., (1985); "Gene Expression Technology" Methods in Enzymology, v. 185, D. V. Goeddel, ed. Academic Press Inc., San Diego, Calif. (1990); and "Viral Vectors: Gene Therapy and Neuroscience Applications" (Kaplitt, M. G., and Loewy, A. D., eds.) Academic Press, San Diego, Calif. (1995).

[0085]These polynucleotide may include the incorporation of codons "preferred" for expression of the polynucleotides in selected nonmammalian hosts, e.g., prokaryotic or non-mammalian eukaryotic host cells.

[0086]Vectors may be used to introduce the polynucleotides of this invention into a host cell. Typically, these vectors also include transcription and translational initiation regulatory sequences operably linked to the polynucleotide that encodes an archaeal replication accessory factor. These vectors would facilitate the production of such a factor in a host cell.

[0087]In certain embodiments, to produce the replication accessory factor encoded by the polynucleotide, an appropriate promoter and compatible host cell may be chosen. Examples of compatible cells lines and expression vectors are well known in the art. Certain well known host cells are prokaryotes like E. coli, and B. Subtilis. In a prokaryotic host cell, such as E. coli, a polypeptide may include an N-terminal methionine residue to facilitate expression of the recombinant polypeptide in the prokaryotic host cell. The N-terminal Met may be cleaved from the expressed recombinant polypeptide. Examples of eukaryotic host cells are yeast, fungi, plant, insect, amphibian, avian, or mammalian cells. See, e.g., "Gene Expression Technology" Methods in Enzymology, v. 185, D. V. Goeddel, ed. Academic Press Inc., San Diego, Calif. (1990).

[0088]In certain embodiments, one may employ a selectable marker in the host cell system or vector such that transformed cells are easily detectable. In certain embodiments, such markers are detectable after the cells have been transformed. An example includes, but is not limited to, antibiotic resistance.

[0089]Those skilled in the art will be able to construct suitable expression systems in suitable host cells, especially in view of the many publications, including manuals, that discuss such information.

[0090]This invention provides a method for producing archaeal replication accessory factors by expressing a vector that comprises a polynucleotide that encodes a replication accessory factor in a suitable host-cell and purifying the expressed product. Techniques using such host cells to express, such polynucleotides are well known in the art. See, e.g., Sambrook et al. (1989).

[0091]This invention also provides recombinant protein produced by the above-described method.

[0092]The invention also provides isolated and purified archaeal replication accessory factors including, but not limited to, archaeal PCNA, archaeal RFC-P38, archaeal RFC-P55, archaeal RFA, and archaeal helicases, e.g., dna2 and helicases 2 to 8.

[0093]In certain embodiments, these accessory factors have part or all of the primary structural conformation and one or more of the biological properties of a replication accessory factor.

[0094]As used herein, "isolated and purified protein" describes a replication accessory factor separate from at least one other protein that naturally accompanies the protein.

[0095]In addition to naturally-occurring allelic forms of the replication accessory factors, this invention also includes polypeptide analogs or fragments. One of skill in the art can readily design nucleic acid sequences that express such analogs or fragments of the replication accessory factors. For example, one may use well-known site-directed mutagenesis techniques to generate polynucleotides encoding such analogs or fragments. Those analogs and fragments may have one or more of the biological functions of the naturally-occurring replication accessory factor.

[0096]Further, this invention provides a composition comprising at least one archaeal replication accessory factor for use in nucleic acid polymerase reactions. As used herein "nucleic acid polymerase reactions" includes, but is not limited to, PCR-based reactions that may include site-directed mutagenesis, amplification, and synthesis of nucleic acid of interest.

[0097]In certain embodiments of the invention, the composition further comprises at least one polymerase. Such a polymerase may include, but would not be limited to, Pfu polymerase, P. furiosus pol II polymerase, and/or Taq polymerase.

[0098]In certain embodiments, the polymerase is an archaeal polymerase. The archaeal DNA polymerase may be obtained from archaea such as Pyrococcus species GB-D, Pyrococcus species strain KOD 1, Pyrococcus woesii, Pyrococcus abysii, Pyrococcus horikoshii, Pyrodictium occultum, Archaeoglobus fulgidus, Sulfolobus solfatanicus, Sulfolobus acidocaldarium, Thermococcus litorails, Thermococcus species 9 degrees North-7, Thermococcus species JDF-3, Thermococcus gorgonarius, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Methanococcus voltae, Thermoplasma acidophilum. Related archaea from which the archaeal DNA polymerase may be obtained are also described in Archaea: A Laboratory Manual (Robb, F. T and Place, A. R., eds, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1995).

[0099]According to certain embodiments, the archaeal polymerase is related to Pfu (pol I) or P. furiosus pol II. Commercial enzymes that are related to Pfu (pol I) that are likely to function with the P. furiosus replication factors are; KOD (Toyoba), pfx (Life Technologies Inc.), Vent (New England Biolabs), Deep Vent (New England Biolabs), and Pwo (Roche Molecular Biochemicals). Archaea which contain genes that exhibit DNA sequence homology to P. furiosus pol II subunits are described in references (Makinjemi, M. et al. (1999) Trends in Biochem., Sci. 24:14-16; Ishino et al. (1998) J. Bacteriol., 180 2232-6).

[0100]In certain embodiments the archaeal factors are used with a thermostable eubacterial polymerase, or are used with a mixture of a eubacterial and archaeal polymerase. Thermostable eubacterial polymerases may be related to the pol I, pol II, or pol III class of DNA polymerases. Thermostable pol I DNA polymerases have been described in Thermus species (aquaticus, flavus, thermohilus HB-8, ruber, brokianus, caldophius GKI4, Filiformis), Bacillus species (stearothermopliilus, caldotenex YT-G, caldovelax YT-F), and Thermotoga maritima. Commercial enzymes that are related to eubacterial pol I enzymes include Taq (Stratagene) Tth (Perkin Elmer), Hot Tub/Tfl (Amersham), Klen Taq (Clone Tech), Stoffel fragment (Perkin Elmer), UlTma (Perkin Elmer), DynaZyme (Finnzymes), Bst (New England Biolabs), and Bca (Panvera). Thermostable pol III DNA polymerases have been described in Thermus aquaticus (Huang, et al. (1999) J. Mol. Evol. 48:756-69) and Thermus thermohilus (reference #13), but could be obtained from other thermophilic eubacteria. Additional thermophilic eubacteria are described in the reference: "Thermophilic Bacteria," Kristjansson, J. K., CRC Press, Inc., Boca Raton, Fla., 1992.

[0101]In certain embodiments, to further enhance the nucleic acid polymerase reaction, the invention may also include an archaeal dUTPase (PEF) in the composition.

[0102]Unlike current methods of enhancing nucleic acid polymerase reactions, this invention also discloses a method of enhancing nucleic acid polymerase reactions comprising employing a composition comprising at least one archaeal replication accessory factor. Such method will enhance the synthesis, amplification, or mutagenesis of nucleic acids of interest.

[0103]According to certain embodiments, the accessory factors enhance any polymerization reaction. Polymerization reactions include primer extension reactions, PCR, mutagenesis, isothermal amplification, DNA sequencing, and probe labeling. Such methods are well known in the art. Enhancement may be provided by stimulating nucleotide incorporation and reducing dissociation of the polymerase from the template. In addition, enhancement may be provided by reducing impediments in the nucleic acid templates, such as secondary structure and duplex DNA. Overcoming or improving such impediments through the addition of accessory factors like RFA and helicase, can allow polymerization reactions to occur more accurately or efficiently, or allow the use of lower denaturation/extension temperatures or isothermal temperatures. In addition, according to certain embodiments, RFA and helicase may provide additional benefits in non-polymerizing applications which require single-stranded nucleic acids. For example, RFA may improve the specificity of protein/nucleic acid interactions.

[0104]According to certain embodiments, PCNA alone or with other accessory factors may enhance exonuclease reactions carried out by the 3'-5' exonuclease activity of Pfu. Exonuclease reactions are used to prepare long single-stranded DNA templates. Enhancement may be provided by reducing dissociation of the polymerase from the template.

[0105]In addition to enhancing polymerization and exonuclease reactions, PCNA is expected to enhance repair processes that are mediated by Pfu or P. furiosus pol II, and that typically require additional repair proteins, such as Fen-1 and ligase.

[0106]According to certain embodiments, PCNA can also be used to enhance processes that are based upon the binding of nucleic acid sequences to complementary nucleic acid strands. For example, hybridization of labeled probes to complementary DNA or RNA strands is used in such methods as library screening, Southern blotting, Northern blotting, chip-based detection strategies, and Q-PCR detection strategies (e.g., molecular beacon hybridization probes). Such methods are well known in the art. Increasing the stability of annealed probes by the addition of PCNA may enhance specificity of hybridization reactions by allowing more stringent hybridization conditions to be used, such as higher temperature and/or lower ionic strength. Increasing the stability of primer/template interactions may also allow one to carry out more efficient polymerization reactions using RNA polymerases, reverse transcriptases and other nucleic acid polymerizing enzymes.

[0107]This invention also provides kits for nucleic acid polymerase reactions that include at least one archaeal replication accessory factor, and possibly other proteins or compounds known to enhance such reactions. In certain embodiments, the kits may also include one or more polymerases.

[0108]In certain embodiments, the kits are for synthesizing, amplifying, or mutagenizing nucleic acids of interest.

[0109]Certain embodiments of the invention are described in the following examples. However, these examples are offered solely for the purpose of illustrating the invention, and should not be interpreted as limiting the invention to these examples.

Experiments

Methods

[0110]1. Production of Accessory Factors from Pyrococcus furiosus

[0111]A. DNA Sequence Identification/PCR Primers.

[0112]The DNA sequences surrounding the DNA sequences of interest were examined for likely start and stop codons. The majority of DNA sequences of interest were identified in archaeal genome databases (Pyrococcus horekoshi, Pyrococcus furious, Methanococcus jannaschii, Methanobacterium thermoautotrophicum), through similarity to eukaryotic genes encoding replication factors of interest (see reference No. 5). Also, the oligonucleotide sequence for PCNA was identified by N-terminal peptide sequencing of a protein isolated from a native protein preparation (see below). Table 1 below lists PCR primers used to amplify the genes and to produce ends that can be modified to produce cohesive ends with a cloning vector. The sequence corresponding to the vector sequence is double underlined.

TABLE-US-00001 TABLE 1 Gene Name Forward Primer Reverse Primer RFC P98/P38 GACGACGACAAGATGAGCGAAGAGATT GGAACAAGACCCGTTCACTTCTTCCC AGAGAA AATTAGGGT (SEQ ID NO: 2) (SEQ ID NO: 3) RFC P55 GACGACGACAAGATGCCAGAGCTTCCCT GGAACAAGACCCGTTCACTTTTTAAG GGGTA AAAGTCAAA (SEQ ID NO: 4) (SEQ ID NO: 5) PCNA GACGACGACAAGATGCCATTCGAAATA GGAACAAGACCCGTTCACTCCTCAAC GTCTTTG CCTTGGGGCTA (SEQ ID NO: 6) (SEQ ID NO: 7) RFC ACTACAGCGGCTTTGG CTTTCCGACACCAGGG P98Intein (SEQ ID NO: 8) (SEQ ID NO: 9) Deletion RFA GACGACGACAAGATGATCATGAGTGCAT GGAACAAGACCCGTTCACATCACCCC TTACAAAAGAAGAAATAATC CAATTCTTCCAATTCCC (SEQ ID NO: 10) (SEQ ID NO: 11) Dna2 helicase GACGACGACAAGATGAACATAAAGAGC GGAACAAGACCCGTTCAAATGCTATC TTCATAAACAGGCTT CTTCGTTAGCACAACATA (SEQ ID NO: 12) (SEQ ID NO: 13) Helicase 2 GACGACGACAAGATGATTTGAGGAGCT GGAACAAGACCCGTTCATCTTTTTAC GTTCAAGGGATTAGAGAGTGAAAT GGCAAATGCGAATTCTTCTCCCTT (SEQ ID NO: 14) (SEQ ID NO: 15) Helicase 3 GACGACGACAAGATGTTAATAGTTGTAA GGAACAAGACCCGTTCATCGTCTCTC GACCAGGAAGAAAAAAGAATGA ACCCTTCAAAATTTTTCCTTCTTC (SEQ ID NO: 16) (SEQ ID NO: 17) Helicase 4 GACGACGACAAGATGCACATATTGATAA GGAACAAGACCCGTCTATTCCCAAA AAAAGGCAATAAAAGAGAGATT ACTTTCTAGTTTGGATGTAGTGTTT (SEQ ID NO: 18) (SEQ ID NO: 19) Helicase 5 GACGACGACAAGATGTTATTAAGGAGA GGAACAAGACCCGTCTACTCCTCATC GACTTAATACAGCCTAGGATAT CTCTATATATGGGGCAGTTATTA (SEQ ID NO: 20) (SEQ ID NO: 21) Helicase 6 GACGACGACAAGATGCTCATGAGGCCA GGAACAAGACCCGTCTAGCTTAACTT GTGAGGCTAATGATAGCTGATG AAGTAAATGCCTATCTTTCTTCT (SEQ ID NO: 22) (SEQ ID NO: 23) Helicase 7 GACGACGACAAGATGATCGAAGGTTAC GGAACAAGACCCGTTCAAAAACCTTT GAAATTAAACTAGCTGTTGTAAC CCCAGGTATGCGGGGGTCGCT (SEQ ID NO: 24) (SEQ ID NO: 25) Helicase 8 GACGACGACAAGATGAGGGTTGATGAG GGAACAAGACCCGTTCAAGATTTCAC CTGAGAGTTGATGAGAGGATA AAACTAATCAAGGGTACTTTTTCT (SEQ ID NO: 26) (SEQ ID NO: 27)

[0113]B. PCR Amplification.

[0114]1) Procedure.

[0115]DNA sequences for PCNA, RFC P98/38, RFC P55, RFA, and helicases dna2 and helicases 2-8 were amplified with various PCR enzymes and polymerase blends using the primers in Table 1. The optimal amplification procedure is described below.

[0116]PCR Reaction Mixture:

TABLE-US-00002 10 μl 10x cloned Pfu buffer (Stratagene) 0.8 100 mM dNTP 3 μl mixed primers (100 ng/μl of each primer) 1.5 μl PfuTurbo DNA polymerase (2.5 U/μl) (Stratagene) 1 μl genomic or plasmid DNA (approximately 100 ng/μl) 83.7 μl H₂₀

[0117]2) Temperature Cycling.

[0118]Samples were amplified in a RoboCycler® temperature cycler (Stratagene). The extension time used was proportional to the amplification product size. Optimally, the extension time is 2 minutes per kilobase. The annealing temperature depended on the length and composition of the primers, which were usually designed with a Tm (melting temperature) between 50° C.-60° C. A standard temperature cycling scheme is listed below: [0119]95° C. 1 minute 1 cycle

[0120]The following three steps are performed sequentially and are repeated for 30 cycles: [0121]95° C. 1 minute [0122]50° C. 1 minute [0123]72° C. 2 minutes/kb of target

[0124]C. Cloning of PCR Products.

[0125]1) PCR Product Purification.

[0126]Three to 10 PCR reactions were generated for each DNA sequence. The PCR products were combined and purified with Stratagene's StrataPrep® PCR purification kit according to its instructions. The purified products were examined on agarose gels (1% agarose/1×TBE) to verify product size and homogeneity. The gels were stained with ethidium bromide and visualized. If any spurious bands were present, products of the correct size were isolated with Stratagene's StrataPrep® DNA gel extraction kit.

[0127]2) Insert Preparation (Ligation Independent Cloning (LIC) Method).

[0128]35 μl of purified PCR products were added to reactions containing:

TABLE-US-00003 5 μl 10x cloned Pfu buffer 1 μl 25 mM dATP 1 μl cloned Pfu DNA polymerase (2.5 u/μl)

and the volume of each reaction was brought to 50 μl with 8 μl H₂₀. The samples were incubated for 20 minutes at 72° C. in the RoboCycler® temperature cycler. This process allows the 3' to 5' exonuclease activity of the polymerase to remove bases at the 3' ends of the PCR products until a dA nucleotide is encountered. The presence of dATP in the reaction prevents further exonucleolytic degradation of the PCR product and the exposed 5'overhangs anneal precisely with the pCALnEK vector. This vector is available commercially from Stratagene and is used to produce annealing termini complimentary to the prepared insert.

[0129]3) Annealing.

[0130]The treated PCR products were allowed to come to room temperature before 40 μl of each prepared insert was added to separate tubes containing 40 ng of the LIC-ready pCALnEK vector. Samples were mixed and left to anneal for 16 hours at room temperature.

[0131]D. Transformation.

[0132]The annealed vector/inserts were transformed into competent cells, namely, Stratagene's Epicurian Coli® XL1 10-Gold® ultracompetent cells, and selected on LB-ampicillin plates. LB media is a commonly used reagent that would be understood by those practiced in the arts. LB amp plates are made by mixing:

TABLE-US-00004 10 g NaCl 5 g Yeast Extract 10 g Tryptone 10 g Agar.

[0133]Add H₂₀ to a final volume of 1 liter. Autoclave. Cool to 55° C. Add ampicillin to a concentration of 100 micrograms per ml. Mix well. Pour about 25 ml per plate.

[0134]Supercoiled DNA was isolated from the transformants using the instructions recommended in Stratagene's StrataPrep® Plasmid Miniprep Kit. The plasmids were used to transform BL21(DE3) CodonPlus® or BL21 (DE3) pLysS (Stratagene) cells. These cells were again selected on LB-ampicillin plates.

[0135]E. Preparation of Recombinant Protein.

[0136]1) Bacterial Expression of Recombinant Proteins.

[0137]The transformants were grown up in multiple liter batches from overnight cultures preferably in LB media supplemented with Turbo Amp® antibiotic (Stratagene) at 100 μg/_l at 37° C. with moderate aeration. When the cultures reached OD₆₀₀ readings of 0.6 to 1.0, the cells were induced with 1 mM IPTG (Stratagene) and incubated in the same manner for 2 hours to overnight (16 hours). Induction causes the vector to produce recombinant protein with a calmodulin binding peptide (CBP) amino tag. The induced cells were collected by centrifugation and stored at -20° C.

[0138]Some helicase clones appeared to be unstable in BL21 (DE3) cells. Supercoiled plasmids containing these helicases were transformed into BL21 CodonPlus® cells (Stratagene) and induced with bacteriophage Lambda CE6 (Stratagene) which contains the T7 RNA polymerase gene that provides significant production of protein in BL21 cells. Five to ten ml of 3×10¹⁰ plaque forming unit (pfu)/ml lambda CE6 stock (made according to provided instructions in Lambda CE6 Induction Kit (Stratagene)) was used to induce 500 ml cultures for four hours at 37° C. with moderate aeration.

[0139]2) Purification of Recombinant Proteins.

[0140]Frozen cells were resuspended to an approximate concentration of 0.25 g/ml in buffers identical or similar to calcium binding buffer: 50 mM Tris-HCL (pH 8.0), 150 mM NaCl, 1 mM magnesium acetate and 2 mM CaCl₂. Cell suspensions were subjected to sonication three times with a Bronson Sonifier 250 at a duty cycle of 80% and an output level of 5 for 45 seconds. The suspensions were left on ice to cool between sonication events. The lysate was cleared by centrifugation at 26,890 g.

[0141]The cleared lysates were added to a milliliter of calmodulin agarose (CAM agarose), equilibrated in buffer. Recombinant protein was bound to the CAM agarose (Stratagene) via the CBP tag by incubation with gentle agitation at 4° C. After two hours, the reactions were centrifuged at 3000 g for 5 minutes to collect the CAM agarose and recombinant protein. The lysate supernatant was removed and the CAM agarose was washed at least once by resuspending the resin in 50 ml of calcium binding buffer followed by collection of the CAM agarose by centrifugation as described above. The CAM agarose was transferred to a disposable 15 ml column, packed, and then washed with at least 50 ml of the calcium binding buffer. Recombinant proteins were eluted from the column by using a buffer similar or identical to 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 2 mM EGTA. Similar buffers may include 2 mM EGTA and the salt requirement may vary from protein to protein. Certain proteins required elution at higher ionic strength using a buffer with 1 M NaCl. Proteins were evaluated for size and purity using Tris-Glycine 4-20% acrylamide gradient gels (Novex) with an SDS loading dye (Novex). Gels were stained with silver or Sypro Orange (Molecular Probes).

[0142]F. Removal of Intein Sequence from Recombinant RFC P98 Clone.

[0143]By alignment to eukaryotic RFC sequences, it was observed that the RFC P98 clone contained an intein sequence. In FIG. 8, the intein sequences are marked in parentheses, and correspond to nucleotides 374 to 2028. Upon post-translational excision of the intein, the predicted size of the RFC subunit would decrease from 98 kDa to 38 kDa, and hence this RFC subunit is referred to as P38. To improve expression of recombinant P38 from the RFC P98 clone, the intein was removed by making 5' phosphate modified oligonucleotides that primed immediately upstream and downstream to the sequence coding for the intein termini (see primer sequence in table above, marked as *). The oligos were designed to have their 3' termini pointing away from the intein (inverse PCR). By using the RFC P98/pCALnEK plasmid as a template, all the plasmid/insert sequence was amplified with the exception of the intein. The PCR product was purified with StrataPrep PCR Purification Kit and ligated at room temperature for 16 hours prior to transformation, as described in section 1 (D).

2. Protein Analysis Techniques.

[0144]A. Preparation of Antibodies.

[0145]Rabbit sera containing specific IgG was prepared by immunizing rabbits with the recombinant accessory factors. CBP-tagged fusion proteins were used to immunize 1-2 New Zealand white rabbits using the following immunization schedule: each, rabbit was injected with 90-200 μg CBP-tagged fusion protein (as obtained from section 1(E)(2) above) in Complete Freund's Adjuvant (CFA); inject each rabbit with a booster 18 days later including 45-100 μg CBP-tagged fusion protein in incomplete Freund's adjuvant (IFA): inject each rabbit with a second booster of IFA 39 days later; and obtain the first serum sample 45 days later and at various times thereafter.

[0146]B. SDS-PAGE.

[0147]Native and recombinant protein samples were analyzed on 4-20% acrylamide/2.6% bis-acrylamide Tris-Glycine gels (NOVEX), stained with either silver stain or Sypro orange (Molecular Probes). Protein concentrations were determined relative to a bovine serum albumin (BSA) standard (Pierce), using Pierce's Coomassie Blue Protein assay reagent or by comparisons of relative staining intensities on SDS-PAGE gels.

[0148]C. Western Blot.

[0149]Protein samples were transferred from SDS-PAGE to nitrocellulose by 1 electroblotting using standard techniques. The blots were blocked with 1% Blotto/TBS (instant milk in tris buffered saline) for 1 hour at room temperature, followed by incubation with immunized rabbit sera which had been diluted 1:500 or 1:1000 (1 hour). Blots were washed 3 times with TBS containing 0.01% Tween 20. The blots were then incubated for 0.5-1 hour with alkaline phosphatase-conjugated goat anti-rabbit IgG, diluted 1:500 or 1:1000 in TBS-0.01% Tween 20. Finally, the blots were washed as before and then incubated in color development solution (100-mM Tris-HCl, pH 9.5, 100 mM NaCl, 5 mM MgCl₂, 0.3 mg/ml NBT, and 0.15 mg/ml BCIP) for approximately 1-10 minutes. The enzyme reaction was stopped and the membrane was washed five times with deionized water.

[0150]D. Amino Acid Sequence Analysis.

[0151]Protein samples were electrophoresed and transferred to polyvinylidene difluoride (PVDF) membranes (BioRad). Blots were sent to Beckman Research Institute-City of Hope (Duarte, Calif.) for N-terminal sequence analysis.

3. Isolating DNA encoding Recombinant RFC from a Genomic Library (Alternative Method)

[0152]A Pyrococcus furiosus genomic library was plated on XL1-Blue MRF E. coli (Stratagene) at a density of approximately 2000 plaques per plate. Duralose filters (nitrocellulose on nylon backing) were used to take replicate lifts from each plate. While the first filter was on the plate, orientation marks were made by stabbing a needle through the filter and into the plate. The orientation marks were marked in pen on the back of the plate before the filter was removed. The filter lifts were treated as follows:

TABLE-US-00005 1.5-2.0 minutes 1.5 M NaCl, 0.5 M NaOH 2 minutes 0.5 M Tris (pH 8.0), 1.5 M NaCl 30 seconds 2xSSC, 0.2 M Tris (pH 7.5)

After treatment, the filters were partially dried until they were still damp, but no standing water was visible. The DNA was fixed onto the filters by UV crosslinking with the Stratalinker (Stratagene) set to the "Autolink" format according to the instructions.The filters were prehybridized in 15 ml of:

[0153]5×SSC

[0154]40 mM NaPO₄ pH (6.5)

[0155]5×Denhardt's

[0156]5% Dextran Sulfate

[0157]50% Formamide

[0158]0.1 mg/ml Salmon sperm DNA (Boiled separately and added immediately prior to use)

Prehybridization was carried out at 42° C. for approximately 2 hours.

[0159]Probe was generated from a 200 bp PCR product amplified from Methanococcus jannaschii genomic DNA using the following primers:

TABLE-US-00006 Oligo #576: GAT GAA AGA GGG ATA GAT (SEQ ID NO: 36) Oligo #577: ATC TCC AGT TAG ACA GCT (SEQ ID NO: 37)

These PCR primers were designed to anneal to regions flanking a 200 bp sequence of the Methanococcus Jannaschii RFC gene that exhibits 52% amino acid identity to the RFC gene from human. (See Section 2 under Results below).

[0160]The PCR product was purified from free primers, buffer and nucleotides and 50 ng of the product was labeled with ³²P-αdATP using the Stratagene Prime-It II Random Primer Labeling kit. The probe was purified from free nucleotides before being boiled for five minutes and added to the prehybridization reaction. The total probe was calculated to be 20 million cpm. Hybridization was allowed to continue overnight at 42° C. before the hybridization solution was removed and the filters were washed four times with 0.1×SSC, 0.1% SDS at 60° C. (very stringent conditions). The filters were exposed to X-ray film overnight and 20 primary isolates with strong signals on both replicate filters were picked.

[0161]Three primary isolates were diluted, plated, and screened again using the same method described above. Two filters produced positive lambda clones. Bluescript plasmid clones were excised from the lambda clones in SOLR cells (Stratagene) according to the manufacturer's instructions. The clones had inserts sizes of 8 kb and 10 kb. These plasmid clones were cut with Hind III, blotted, and probed with the original 200 bp PCR product discussed above. One positive truncated clone was isolated and sequenced from each end of the insert. The sequence showed two RF-C sequences, specifically, the C-terminus of one sequence, and the N-terminus of another.

4. Production of Accessory Factors from Native Sources

[0162]A. P. furiosus Extract.

[0163]Fermentation of P. furiosus DSM 3638 cells was carried out using the procedure described in Archaea: A Laboratory Manual, Robb, F. T. (editor-in-chief), Cold Spring Harbor Press, CSH, NY 1995. The cell paste was resuspended in lysis buffer (50 mM Tris-HCl (pH 8.2), 1 mM ethylenediaminetetraacetic acid (EDTA), 10 mM beta-mercaptoethanol (β-ME), 0.5 mM phenylmethylsulfonyl fluoride (PMSF), and 2 _g/ml aprotinin) and lysed in a French press, and then the lysate was sonicated and centrifuged.

[0164]B. Column Chromatography.

[0165]The supernatant was chromatographed on a Q-Sepharose Fast Flow column (Pharmacia), equilibrated in 50 mM Tris-HCl (pH 8.2), 1 mM EDTA, and 10 mM β-ME. Follow-through fractions were collected, adjusted to pH 7.5, and then loaded onto an SP Sepharose Big Bead column (Pharmacia), and equilibrated in buffer A (50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 1 mM dithiothreitol (DTT), 10% (v/v) glycerol, 0.1% (v/v) Igepal CA-630, and 0.1% (v/v) Tween 20). The column was eluted with a 0-0.25 M KCl gradient/Buffer A. Fractions containing DNA polymerase activity were dialyzed, and then applied to a Heparin Sepharose CL-6B column (Pharmacia), and equilibrated in Buffer B (same as buffer A, except pH 8.2). The column was eluted with a 0-0.3 M KCl gradient/Buffer B. Fractions exhibiting polymerase enhancing activity (nucleotide incorporation) (using the assay described below in Section 5(B)), or immunocrossreactivity (using the Western Blot described in Section 2(C) above) were identified. Native PCNA was further purified by excising the protein from SDS-PAGE gels.

[0166]C. Immunoaffinity Chromatography.

[0167]Immunoaffinity columns were prepared using the commercial kit from Pierce (ImmunoPure Plus Cat# 44893), following the manufacturer's method. Two milliliters of serum, mixed with 2 milliliters of kit loading/binding buffer, was used to prepare each column. Before using the column, the column and buffers were allowed to warm to room temperature.

[0168]1) Preparation of Extract.

[0169]0.5 g frozen P. furiosus cells were used for each column. The cells were lysed in 2 ml lysis buffer (50 mM Tris pH 8.0, 1 mM EDTA, and 1 mM DTT), and sonicated twice for 2 minutes on ice. The cells were spun at 26,890 g for 15 minutes and the supernatant was recovered. The lysate was mixed with an equal volume of binding buffer (10 mM Tris pH 8.0, 50 mM KCl, 0.1% Tween 80). The lysate was precleared by incubation with 4 ml of protein A beads (Pierce cat #20333) and equilibrated with binding buffer. The slurry was incubated at 4° C. for 1 hour with agitation. The precleared extract was recovered by packing the beads into a disposable column and the flow-through was collected. The column was washed with 2 ml of binding buffer and the wash was collected and pooled with the flow-through fraction. The final volume of pretreated lysate is about 6 ml. In some cases, the lysate was then run over a pre-bleed rabbit IgG control column to further clean up the lysate.

[0170]2) Immunoaffinity Chromatography.

[0171]The column was equilibrated with 15 ml binding buffer (10 mM Tris HCl (pH 8.0), 50 mM KCl, 0.1% Tween 80), and then, the 6 milliliters of precleared lysate was applied to the column. The column was washed with 10 milliliters binding buffer, followed by 10 milliliters wash buffer (10 mM Tris pH 8.0, 500 mM KCl, 0.1% Tween 80). Specific proteins were eluted with seven 1 ml washes of elution buffer (0.1 M glycine pH 2.8). One ml fractions were collected. To each collection tube, was added 50 μl 1 M Tris pH 9.5 to raise the pH of the eluates as they are collected. After eluting the protein of interest, the column was washed with 4 ml of 1M Tris pH 8.0 and then 15 milliliters of binding buffer.

5. Biochemical Assays

[0172]A. Primer Extension Assay.

[0173]The Pyrococcus furiosus accessory proteins were tested for their ability to stimulate the processivity of cloned Pfu polymerase activity on primed single-stranded M13 DNA. One version of this assay provided for detecting extension products under non-denaturing conditions using ethidium bromide staining. For this assay, a reaction cocktail was made containing:

TABLE-US-00007 5 μg/ml single-stranded M13 mp 18(+) strand DNA (Pharmacia cat# 27-1546-01) 275 ng/ml 40-mer primer (5' GGT TTT CCC AGT CAC GAC GTT GTA AAA CGA CGG CCA GTG C3') (SEQ ID NO: 38) 200 μM each Dntp 1 X cPfu buffer water to 20 μl.

[0174]Single stranded M13 DNA was mixed with primer, buffer, and water. The mix was heated to 95° C. for 2 minutes and then cooled to room temperature. The rest of the reaction components were added. Each 20 μl reaction contained 0.05 units of cloned Pfu polymerase and varying amounts of PCNA and RFC. For assessing P. furiosus RF-C enhancement, assays contained 0.025 μl of P. furiosus PCNA (about 1 ng), and varying amounts of native P. furiosus RF-C. The reactions were incubated at 72° C. for 15 minutes. 2 μl DNA loading dye (50% glycerol, 1×TBE, 0.05% bromphenol blue+0.05% xylene cyanol) was added to each sample and 15 μl of sample with dye was loaded in each well of a 1% agarose gel (Reliant, FMC cat# 54907). The gel was stained with ethidium bromide. The double-stranded M13 can be seen as a brightly staining product that migrates higher than a 12 kb marker similar to the position where a double-stranded M13 DNA control migrates. In this assay, one looks for an increase in the size of products synthesized when PCNA or PCNA+RFC are added to Pfu. Ethidium bromide staining is proportional to the amount of double-stranded DNA produced from primed single-stranded M13.

[0175]A second version of this gel-based assay allows detection of radiolabeled extension products under denaturing conditions. The same template is used, except the 40 bp primer has been phosphorylated at the 5' end with [γ-³²P]ATP (>5000 Ci/mmole) and T4 polynucleotide kinase. The labeled oligo was purified using a NucTrap probe purification column (Stratagene) and then annealed with single-stranded M13 at equimolar concentrations (100 nM). The reaction cocktail comprised:

[0176]9.5 μg/ml single-stranded M13mp18 (+) strand DNA (Pharmacia)

[0177]52 ng/ml 40-mer

[0178]100 μM each dNTP

[0179]1× cloned Pfu DNA polymerase buffer

[0180]and water to 50 μl.

[0181]Single-stranded M13 DNA was mixed with primer, buffer and water. The mix was heated to 95° C. for 2 minutes and then cooled to room temperature. The rest of the reaction components were added. Each reaction contained diluted cloned Pfu DNA polymerase, and varying amounts of PCNA, and RFC. Reactions were incubated at 72° C. for varying times ranging from 1-30 minutes. The reactions were terminated by adding 3.3 μl of stop dye (95% formamide/20 mM EDTA/0.05% bromophenol blue/0.05% xylene cyanol). The reaction mixtures were then subject to polyacrylamide gel electrophoresis using 6-8% denaturing gels, and the gels are dried down and exposed to autoradiographic film. The size of the full length-extension product was determined by carrying out primer extension using excess cloned Pfu DNA polymerase for 30 minutes.

[0182]B. Stimulation of Nucleotide Incorporation

[0183]The accessory factors were also tested for the capability of increasing dNTP incorporation by Pfu DNA polymerase or P. furiosus pol II DNA polymerase. This assay involves measuring dNTP incorporation into primed M13 DNA, by isolating and counting high-molecular-weight DNA bound to DE81 filter paper. A reaction cocktail is prepared as follows:

[0184]4 μg/ml single-stranded M13 mp18(+) strand DNA (Pharmacia)

[0185]219 ng/ml 40-mer (see Section 5(A) above)

[0186]1× cloned Pfu DNA polymerase buffer (Stratagene)

[0187]300 μM each dGTP, dATP, dCTP

[0188]30 μM dTTP

[0189]5 μM ³H-TTP (NEN NEG-221H)

[0190]To 10 μl of reaction cocktail was added either 0.025 units cloned Pfu Polymerase (Stratagene) or 0.05 units P. furiosus pol II. P. furiosus pol II was PCR amplified using the DNA sequences described in reference 15 below, and recombinant CBP-DPI/DP2 DNA polymerase was cloned, expressed, and purified as described using the procedures outlined above in Section 1. To assay the temperature-dependence of PCNA enhancement (data in FIG. 42), reactions were carried out for 10 minutes in the absence or presence of 100 ng PCNA, using incubation temperatures ranging from 66-99° C.

[0191]The extension reactions were quenched on ice, and then 5 μl aliquots were spotted immediately onto DE81 filters (Whatman). Unincorporated (3H]TTP was removed by 6 washes with 2×SCC (0.3M NaCl, 30 mM sodium citrate, pH 7.0), followed by one wash with 100% ethanol. Incorporated radioactivity was measured by scintillation counting.

[0192]This assay can be modified to allow improved detection of PCNA by reducing dNTP incorporation to background levels through the addition of 200 mM KCL to the reaction mix. PCNA alone or in combination with other accessory factors can be detected by restoration of Pfu's DNA polymerase activity.

[0193]The assay cocktail contains:

TABLE-US-00008 10 μg/ml single-stranded M13 mp 18(+) strand DNA (Pharmacia cat#27-1546-01) 100 ng/ml 40-mer primer (GGT TTT CCC AGT CAC GAG GTT GTA AAA CGA CGG CCA GTG C) (SEQ ID NO: 39) 1 X cPfu buffer 200 mM KCl 30 μM each dATP, dCTP, dGTP 3 μM dTTP 5 μM ³H-dTTP (NEN cat# NET-221H) (100 μCi/mL) 100 U/ml cloned Pfu polymerase

Recombinant accessory factors or fractions derived from native P. furiosus are assayed for their ability to restore polymerase activity to the above cocktail. 1 μl samples were added to 10 μl of reaction cocktail, and reactions were incubated at 72° C. for 30 minutes. Reactions were spotted onto DE81 filter papers, which were then washed and counted as described above.

[0194]C. ATPase Assay.

[0195]One μl of RFC or helicase preparations were incubated with 1 μl of 4.5 μM ATP and 1 μCi of gamma labeled ³³P-ATP in 10 mM Tris HCl (pH 8.3), 3.5 mM MgCl₂, and 75 mM KCl. The samples were incubated at 72° C. for 20 minutes before being spotted on PEI cellulose F (EM Science). After drying, the PEI cellulose was placed in a shallow reservoir of 0.4 M NaH₂PO₄ pH 3.5. The liquid front was allowed to migrate 4-5 cm before being removed from the liquid and dried. The samples were exposed to X-ray film for one hour. Evidence of ATPase activity in samples was obtained by looking for radioactivity migrating with the liquid front. The positive control (porcine ATPase) converts ³³P-γ-dATP to dADP+³³P-γP; the latter product migrates with the liquid front under these TLC conditions, while the ³³P-γ-dATP substrate remains near the origin. In some cases, product was quantified by excising the product spots from the PEI plate and then counting in a scintillation counter.

[0196]D. Gel Shift Assay.

[0197]A 38 base oligo (5' GGT TTT CCC AGT CAC GAC GTT GTA AAA CGA CGG CCA GT 3') (SEQ ID NO: 40) was incubated with RFA samples at 95° C. for 10 minutes, followed by 72° C. for 2 minutes, prior to loading on a 4-20% acrylamide gradient gel (Novex) in 1×TBE buffer. Bands were visualized by SYBER green staining (Molecular Probes) and UV illumination. DNA binding activity is monitored by looking for a retardation in the migration of the oligo (higher band) in the presence of RFA. Single-strand DNA binding activity is verified by showing a shift in band position using a single-stranded oligo but no shift using a double-stranded DNA duplex.

[0198]E. Helicase Assay.

[0199]Radioactively labeled oligonucleotides with a 3' overhang or a 5' overhang were annealed to M13 mp18 DNA (Pharmacia). The reactions were incubated with 0.5 μl of putative P. furiosus helicases in 50 mM Tris HCl, pH 8.5, 25 mM KCl, and 5 mM ATP for 30 minutes at 55° C. The positive control was generated by thermally melting the annealed oligo prior to loading. The samples were run on 4-20% gradient acrylamide gels in 1×TBE. The gels were dried and exposed to X-ray film. Samples with helicase activity will displace the annealed radiolabeled oligo from single-stranded M13 DNA. On a gel, helicase-displaced oligo will migrate with the same mobility as oligos melted off M13 DNA with heat (free oligo). In samples lacking helicase activity, oligo will still be bound to M13 and will migrate at a different position which will be identical to "template only" controls.

6. PCR Reactions.

[0200]PCR reactions were carried out under standard conditions. In general, amplification reactions (50 μl) contained 200-450 μM each dNTP, 1×PCR buffer, 50-200 ng of human genomic DNA template (or 100 ng Stratagene's Big Blue transgenic mouse genomic DNA for the 0.5 kb target), 100 ng of each primer, and 2.5-5U of TaqPlus® Long DNA polymerase blend, PfuTurbo DNA-polymerase, or Taq2000 DNA (Stratagene) polymerase. TaqPlus® Long PCRs were carried out in 1× buffer including: 50 mM Tricine pH 9.0, 8 mM ammonium sulfate, 0.1% Tween-20, 2.3 mM MgCl₂, and 75 ng/_l BSA. PCRs using PfuTurbo or Taq2000 DNA polymerase were carried out with the PCR buffers provided with the enzymes (Stratagene). Reactions were cycled in 200 μl thin-walled tubes using any of the following temperature cyclers: Stratagene RoboCycler® 96 temperature cycler fitted with a hot top assembly, Perkin Elmer GeneAmp PCR System 9600, or MJ Research PTC-200 Pettier thermocycler. The sequences of the PCR primers are given below:

TABLE-US-00009 23 kb β-globin Forward primer: (SEQ ID NO: 44) 5'-CAC.AAG.GGC.TAC.TGG.TTG.CCG.ATT-3' Reverse primer: (SEQ ID NO: 45) 5'-AGC.TTC.CCA.ACG.TGA.TCG.CCT.TTC.TCC.CAT-3' 30 kb β-globin Forward primer: (SEQ ID NO: 46) 5'-CTC.AGA.TAT.GGC.CAA.AGA.TCT.ATA.CAC.ACC-3' Reverse primer: (SEQ ID NO: 47) 5'-AGC.TTC.CCA.ACG.TGA.TCG.CCT.TTC.TCC.CAT-3' 2.1 kb Alpha 1 Anti-Trypsin Forward primer: (SEQ ID NO: 48) 5'-GAG.GAG.AGC.AGG.AAA.GGT.GGA.AC-3' Reverse primer: (SEQ ID NO: 49) 5'-GAA.AAT.AGG.AGC.TCA.GCT.GCA.G-3' 5.2 kb Alpha 1 Anti-Trypsin Forward primer: (SEQ ID NO: 50) 5'-GAG.GAG.AGC.AGG.AAA.GGT.GGA.AC-3' Reverse primer: (SEQ ID NO: 51) 5'-GCT.GGG.AGA.AGA.CTT.CAC.TGG-3' 0.5 kb λ/lac1 (transgenic mouse genomic DNA) lambda primer: (SEQ ID NO: 52) 5'GAC.AGT.CAC.TCC.GGC.CCG-3' lacZ primer: (SEQ ID NO: 53) 5'CGA.CGA.CTC.GTG.GAG.CCC-3'

[0201]The following temperature cycling conditions were used for the 23 and 30 kb β-globin targets: 92° C. for 2 min. (1 cycle); 92° C. for 10 sec., 65° C. for 30 sec. 68° C. for 25 min. (10 cycles); 92° C. for 10 sec., 65° C. for 30 sec., 68° C. for 25 min. (with a increase of 10 sec. added progressively to the extension time with each cycle)(20 cycles). The 2.1 and 5.2 kb targets were amplified as follows: 95° C. for 1 min. (1 cycle); 95° C. for 1 min., 58° C. for 1 min., 72° C. for 2 min. (for 2 kb target) or 5 min. (for the 5.2 kb target) (30 cycles); 72° C. for 10 min. (1 cycle). The 0.5 kb target was amplified as follows: 94° C. for 1 min. (1 cycle); 94° C. for 1 min., 54° C. for 2 min., 72° C. for 1.5 min. (30 cycles); 72° C. for 10 min. (1 cycle).

Results

[0202]P. furiosus PCNA was first identified in column fractions produced during fractionating native P. furiosus extracts. PCNA was co-purified with Pfu DNA polymerase during the Q and SP column procedures discussed above. Peak PCNA activity could be resolved from peak DNA polymerase activity using the heparin sepharose column, but all PCNA-containing fractions were contaminated with DNA polymerase activity. To isolate native PCNA, fractions that could restore DNA polymerase activity to salt-inactivated Pfu DNA polymerase were studied. Such "restoration" activity was detected in column fractions eluting off the Heparin sepharose (FIG. 1). An active column fraction was then subject to SDS-PAGE and gel slices were excised and extracted to remove proteins. DNA polymerase activity was found in a gel slice recovered from a position in the gel corresponding to the migration of proteins between 64-98 kDa. In contrast, PCNA activity was recovered from a gel slice that was located at a position lying between the 30 and 36 kDa protein markers (FIG. 2). A protein band, migrating at 35 kDa, was visible on SDS-PAGE gels. This protein was transferred to a PVDF membrane (Bio Rad) and sent for amino terminal sequencing. The N-terminal sequence of the 35 kDa protein was:

[0203]PFEIVFEGAKEFAQLIDTASKL(H,I)DEAAFKVTEDG-MR (SEQ ID NO: 54) (where (H,I) means either amino acid could be present and - means that any amino acid could be present). A BLAST search of DNA sequence databases identified the 35 kDa protein as exhibiting significant homology to known eukaryotic PCNA sequences.

[0204]The sequence encoding P. furiosus PCNA was cloned in the pCALnEK vector using the PCNA PCR primers described above. The LIC-primers were designed using the DNA sequence for PCNA identified in the Pyrococcus horekoshi genome sequence database. Although closely related to archaea, Pyrococcus horekoshi is a different species of Pyrococcus than Pyrococcus furiosus. The translated N-terminus of the putative Pyrococcus horekoshi PCNA matches the chemically determined N-terminal sequence of native Pyrococcus furiosus PCNA. The DNA sequence of the pCALnEK clone encoding Pyrococcus furiosus PCNA is shown in FIG. 3, and its translated amino acid sequence is shown in FIG. 4. The predicted molecular weight of P. furiosus PCNA is 28 kDa although the apparent molecular weights of EK-digested recombinant PCNA and native PCNA are 38 and 35 kDa, respectively.

[0205]In addition to stimulating nucleotide incorporation by salt-inactivated Pfu DNA polymerase, both native and recombinant Pyrococcus furiosus PCNA preparations were shown to significantly increase the processivity of Pfu. When PCNA is added to primer extension reactions where a 5' radiolabelled primer is annealed to single stranded M13, the majority of the products generated at early time points are full-length and fewer short truncated products accumulated (FIG. 5). These results indicate that PCNA has significantly increased the processivity of Pfu polymerase (number of bases added per polymerase/DNA binding event), and the overall rate of incorporation (nucleotides incorporated per unit time) is increased.

[0206]The effects of PCNA on P. furiosus pol II DNA polymerase were also tested. PCNA was shown to stimulate dNTP incorporation by both Pfu (pol I) and P. furiosus pol II DNA polymerases. Interestingly, the addition of PCNA altered the optimal reaction temperature for both DNA polymerases. Because DNA duplexes are unstable at elevated temperatures (>Tm), assaying DNA polymerases at temperatures approaching the optimal growth temperatures of hyperthermophilic archaea (>100° C.) has been difficult. For the M13/40-mer duplex shown here, reaction temperatures above 75° C. produce template instability, consistent with the drop in activity for both polymerases between 72 and 80° C. However, in the presence of PCNA, the primer/M13 duplex appears to be stabilized at temperatures>72° C., leading to even higher primer extension activity by both Pfu (pol I) and P. furiosus pol II DNA polymerases. Thus, the M13/oligo duplex remains annealed at temperatures greater than about 80° C.

[0207]These data indicate that the addition of PCNA can have other benefits besides enhancing the polymerization rate and processivity of Pfu (pol I) and P. furiosus pol II DNA polymerases. The use of PCNA should allow the use of these hyperthermophilic enzymes at higher temperatures than has been achieved to date. PCR amplification, DNA sequencing, and isothermal amplification reactions employ extension temperatures of ≦72° C. to ensure stability of the primer/template duplex. However, this temperature is well below the expected temperature optimum of DNA polymerases from hyperthermophilic archaea like P. furiosus. It may be possible to use elevated extension temperatures during these polymerization reactions (e.g., >80° C.), which would have the benefits of increasing polymerase activity (by operating closer to optimum reaction temperature) and reducing interference from secondary structure in DNA templates.

[0208]In addition, the apparent stabilization of primer/M13 DNA duplexes by PCNA may have utility in improving applications that require high stability of nucleic acid duplexes. For example, PCNA may enhance the specificity of probe hybridization reactions by allowing the use of more stringent annealing temperatures or reaction conditions (lower ionic strength).

[0209]The effect of adding PCNA without other accessory factors to PCR amplification reactions has been tested. In the absence of other accessory factors, relatively high concentrations of PCNA (100 ng-1 ug) can inhibit product synthesis by Pfu DNA polymerase. Lower concentrations of PCNA are tolerated in PCR amplification reactions (<100 ng). PCNA is functional and beneficial to PCR amplification reactions (FIGS. 6 and 7). PCNA can dramatically increase the yield of products amplified with DNA polymerase blends including Taq, Pfu, and P. furiosus dUTPase (PEF). In the blends that have been tested, Taq is present at 2.5-5U and Pfu is present at 0.156-0.3125 U. The dUTPase may be in the form of native PEF or recombinant dUTPase (P45) (See WO 98/42860) present at 1-10 ng per reaction. PCNA enhances the processivity of the minor proofreading component in the DNA polymerase blend, while dUTPase is preventing dUTP incorporation (and subsequent Pfu inhibition), so that greater Pfu polymerase activity can be realized. The dUTPase activity is discussed in International Patent Application WO98/42860, which is incorporated in its entirety by reference. Therefore, PCNA in its optimal concentration should enhance archaeal DNA polymerases (such as Pfu, pol II), either alone, or in combination or blended with other non-proofreading DNA polymerases of eubacterial or archaeal origin. In addition, PCNA activity can be improved by the further addition of other accessory factors including P. furiosus RFC, RFA and helicase.

2. RFC.

[0210]Before this invention, the inventors were not aware of the availability of an archaeal genome sequence other than the sequence of Methanococcus jannaschii. Genome sequence of Methanococcus jannaschii contained ORFs, which exhibited significant DNA sequence homology to DNA replication proteins from eukaryotes, including one Family B DNA polymerase, two RFC subunits, and PCNA (Bult et al., 1996 (Reference No. 6)). In eukaryotes, the RFC complex is composed of five distinct subunits (one large subunit and 4 small subunits that are associated with ATPase activity) and is stimulated by PCNA. However, only two genes were identified in Methanococcus jannaschii as exhibiting homology to RFC subunits: one sequence was identified as a putative homolog of the large RFC subunit and a second sequence was identified as a putative homolog of one of the small subunits. Initially, PCR primers were based upon the DNA sequences of the putative Methanococcus jannaschii rfc genes. However, these primers did not amplify a PCR product from P. furiosus genomic DNA, presumably because of the divergence in DNA sequence between Methanococcus jannaschii and Pyrococcus furiosus.

[0211]The inventors used an alternative approach to clone P. furiosus RFC subunits. Amino acid sequence alignments between Methanococcus jannaschii and human RFC identified a 67-amino acid region with 52% identity. A portion of RFC was likely to be highly conserved among archaea, since it was relatively conserved between more distantly related organisms, i.e., humans and archaea.

[0212]A 200 bp sequence encompassing the region encoding the 67-amino acid region was amplified from Methanococcus jannaschii genomic DNA using the following primers: 5' GAT GAA AGA GGG ATA GAT (SEQ ID NO: 36) and 5' ATC TCC AGT TAG ACA GCT (SEQ ID NO: 37). The Methanococcus jannaschii sequence was used to probe a P. furiosus genomic DNA library.

[0213]One positive genomic clone was recovered which contained the sequences encoding both the large and small subunits in tandem. The DNA sequence of the genomic clone is shown is FIG. 8 and the translated amino acid sequence is shown in FIG. 9. The genomic sequences of P38 and P55 are bracketed. The nucleotide sequence of P38 is nucleotides 197 to 2835 (the intein sequence is nucleotide 374 to 2028). The nucleotide sequence of P55 is nucleotides 2839 to 4281. Examination of the DNA sequence encoding the small P. furiosus RFC subunit (P98) revealed the presence of an intein. An intein had also been identified in the gene encoding the putative Methanococcus jannaschii small RFC subunit (Bult et al, 1996).

[0214]Expression constructs were prepared by subcloning the sequences encoding the large and small subunits into the pCALnEK vector. To facilitate expression, the intein was removed from the small RFC subunit clone by amplification with primers designed to anneal to the 5' and 3' regions flanking the intein sequence and to prime in a direction opposite to the intein. The amino acid sequences of the large RFC subunit and the small "intein-less" RFC subunit are shown in FIGS. 10 and 11.

[0215]Antibodies were raised in rabbits against the P55 and P38 subunits. The native RFC complex was purified from P. furiosus extracts by immunoaffinity chromatography using either immobilized anti-P55 or anti-P38 IgG. Western blot analysis of immunoaffinity-purified RFC complex shows the presence of both subunits, regardless of the capture antibody (FIG. 12), indicating that P38 and P55 form a complex in P. furiosus as do the large and small RFC subunits in eukaryotes. The protein composition of one native RFC preparation is shown in FIG. 13. In addition to P55 and P38, there are other protein bands present which have not yet been identified.

[0216]The ATPase activity of the RFC preparations was tested (FIG. 14). RFC subunits are ATPases. That is, they convert ATP to ADP and phosphate. RFC complex in eukaryotes is known to load PCNA clamp onto DNA in a process that typically requires the conversion of ATP to ADP and phosphate. Recombinant P55 and P38 exhibited ATPase activity when assayed separately. A mixture of P55 and P38 subunits was also found to exhibit ATPase activity that increased in the presence of PCNA, but not in the presence of primed M13 DNA. In contrast, native RFC purified by immunoaffinity chromatography exhibited ATPase activity which was further stimulated by both PCNA and DNA. As the eukaryotic RFC complex is stimulated by both PCNA and DNA, it appears that the native RFC preparation, is fully functional, while the mixture of recombinant P55 and P38 may be only partially active. This conclusion was supported by primer extension studies in which a native RFC preparation from P. furiosus (Immunopurified) was shown to enhance the yield of full-length products synthesized with Pfu DNA polymerase in the presence of PCNA (FIG. 15). In contrast, a mixture of recombinant P55 and P38 with similar ATPase activity showed less enhancement of primer extension by Pfu+PCNA. It is presently unknown whether the difference in activity between native and recombinant RFC is due to differences in the P55:P38 ratios or protein modification, or to the absence of additional proteins present in the native RFC preparations. One skilled in the art could determine a solution by attempting different ratios of P55 to P38 or different reaction conditions, or by adding additional protein factors such as the ones present in a native RFC preparation.

3. RFA.

[0217]The large subunit of eukaryotic RFA was used to search the archaeal protein databases with PSI-BLAST. Hits to archaeal sequences were examined. The inventors aligned corresponding sequences to identify the putative start and stop codons of the RFA sequence in the incomplete P. furiosus genome sequence. P. furiosus rfa sequence was PCR amplified and cloned into the pCALnEK vector. The DNA sequence and translated protein sequences are shown in FIGS. 16 and 17. The apparent molecular weight of the expressed fully denatured protein was consistent with the size expected from the translated DNA sequence (41 kDa).

[0218]To assess function, P. furiosus RFA was tested for single-stranded DNA binding activity in a gel shift assay (FIG. 18). When RFA was incubated with a 38 base oligonucleotide, the migration of a percentage of the DNA was reduced, indicating that RFA does exhibit single-stranded DNA binding activity. In comparison. E. coli SSB was found to completely retard the oligo. The weaker single stranded DNA binding activity exhibited by P. furiosus RFA may be explained by use of insufficient protein, the presence of the CBP tag, or the use of suboptimal reaction conditions. The degree of migration of the oligo is related to the mass of the protein-DNA complex and the formation of protein multimers. E. coli SSB is known to form tetramers, but it is presently unknown whether P. furiosus RFA produces multimers as well.

[0219]The addition of P. furiosus RFA to amplifications carried out with Pfu and Taq DNA polymerases was shown to increase amplification specificity (FIGS. 19 and 21) and PCR product yield (FIGS. 20 and 21). The conditions were as described in Section 6 above. In FIG. 21, P. furiosus RFA produced effects which were similar to those generated by E. coli single-stranded DNA binding protein (SSB; Stratagene's Perfect Match), including increased yield and amplification specificity and retardation of DNA migration at excess concentrations (5 μl). No evaluation of the relative performances of P. furiosus RFA and E. coli single-stranded DNA binding protein in PCR has been made; however, the increased thermostability of RFA should provide an additional benefit in temperature cycling.

4. Helicase.

[0220]Coils contain multiple helicases with specialized roles in a number of processes including replication, DNA repair, recombination, transcription, and translation. Known helicases have been classified into five families based upon sequence homology. Mechanistically, there are 2 classes of helicases depending, upon whether unwinding requires a 3' overhang (3'-5' polarity) or a 5' overhang (5'-3' polarity), which is characteristic of helicases functioning in DNA replication. Archaeal replicative helicases were identified by identifying as many ORFs as possible in archaeal genomes that exhibited homology to any known eukaryotic helicase, regardless of specific metabolic role. No putative helicase sequences were excluded because helicase function between archaea and eukaryotes may be different. Moreover, the eukaryotic replicative helicase has not been conclusively identified. Using eukaryotic helicases, a PSI-BLAST search in the archaeal protein databases was conducted.

[0221]Eight putative helicases meeting the criteria were selected for analysis. The incomplete P. furiosus genome sequence was examined to identify the putative start and stop codons of these sequences and to design PCR primers for cloning. The DNA sequences are shown in FIGS. 22-28, and 40, respectively; the translated protein sequences are shown in FIGS. 29-35, and 41, respectively. The apparent molecular weights of the expressed proteins were consistent with the sizes expected from the translated DNA sequence, (see figure description of FIGS. 29-35). Future corrections in the incomplete P. furiosus genome sequence may define alternative start and stop sites.

[0222]Helicases act to displace the complimentary strand of DNA or RNA to uncover template for DNA polymerases, RNA polymerases, accessory factors, and repair factors. Helicases melt the complimentary strand in a process coupled to hydrolysis of ribo- or deoxyribonucleotides. Most helicases displace either a 5' overhang or a 3' overhang, but some helicases displace both templates or utilize different templates under different reaction conditions. Typically, a helicase will utilize one or more nucleotide triphosphates preferentially. To assess the function of the identified eight helicases, recombinant helicases were tested for ATPase activity. The ribonucleotide ATP was used, although other ribo- or deoxyribonucleotides may serve as the preferred substrate. The resulting recombinant proteins were incubated with ATP, and phosphate was detected after separation by TLC. The results in FIGS. 36 and 37 demonstrate that all eight recombinant helicases exhibit ATPase activity.

[0223]Eight recombinant helicases were tested for helicase activity. The templates used included labeled oligonucleotides annealed to single-stranded M13 mp18 DNA. The oligos had either 5' or 3' non-complementary ends. As shown in FIG. 38, helicase 2 was able to displace oligos from both templates. This helicase also melted a template which had non-complementary 5' and 3' ends (data not shown). Such a forked template mimics the "bubble" formed by, the replication fork. In addition, helicase 7 displaced the oligo with a free 3' end (FIG. 38). The lack of detectable oligo displacement does not necessarily mean that the rest of the enzymes are not helicases, because lack of helicase activity may be attributed to the use of suboptimal buffers or reaction conditions, the presence of the N-terminal CBP tag, or the use of insufficient amounts of recombinant protein. Preliminary experiments showed that the addition of diluted preparations of helicase 2 or helicase dna2 to PCRs in combination with Pfu DNA polymerase can lead to increased PCR product yield (data not shown).

[0224]All documents mentioned in this application, including but not limited to, articles, books, reviews, patents and patent applications, are hereby incorporated by reference in their entirety into this specification.

REFERENCES

[0225]1. European Patent No. EP0870832, published on Oct. 14, 1998, invented by Kato I., et al.; and assigned to Takara Shuzo Co. [0226]2. International Patent Application Publication No. WO 98/42860, published on Oct. 1, 1998, invented by Hogrefe, H. and Hansen, C.; and assigned to Stratagene. [0227]3. U.S. Pat. No. 5,866,395 issued on Feb. 2, 1999, to Eric J. Mathur. [0228]4. U.S. Pat. No. 5,545,552 issued on Aug. 13, 1996, to, Eric J. Mathur. [0229]5. Baker, T. A. and Bell, S. P., "Polymerase and the Replisome: Machines within Machines" Cell 92:295-305 (1998). [0230]6. Bult, C. J., et al, "Complete Genome Sequence of the Methanogenic Archeon, Methanococcus jannaschii" Science 273:1066-1073 (1996). [0231]7. Chedin, F., et al., "Novel Homologs of Replication Protein A in Archaea: Implications for the Evolution of ssDNA-Binding Proteins" TIBS 23:273-277 (1998). [0232]8. Cline, J., et al., "PCR Fidelity of Pfu DNA Polymerase and Other Thermostable DNA Polymerases" Nucl. Acids Res. 24: 3546-3551 (1996). [0233]9. Edgell, D. R. and Doolittle, W. F., "Archaea and the Origin(s) of DNA Replication Proteins" Cell 89:995-998 (1997). [0234]10. Kelly, T. J. et al., "Identification and Characterization of a single-stranded DNA Binding Protein from the archeon Methanococcus jannaschii" PNAS 95:14634-1 4639 (1998). [0235]11. Keohavong, P. and Sandhu, D. K., "Effects of the T4 Bacteriophage Gene 32 Product on the Efficiency and Fidelity of DNA Amplification Using T4 DNA Polymerase" Gene 144:53-58 (1994). [0236]12. Lundberg, K. S., et al., "High-Fidelity Amplification Using a Thermostable DNA Polymerase Isolated from Pyrococcus furiosus" Gene 108:1-6 (19911). [0237]13. McHenry, C. S., et al., "A DNA Polymerase Ill Holoenzyme-like Subassembly from an Extreme Thermophilic Eubacterium" J. Mol. Biol. 272:178-189 (1997). [0238]14. Mathur, E., et al., The DNA Polymerase Gene from the Hyperthermophilic Marine Archaeabacterium, Pyrococcus furiosus, Shows Sequence Homology with α-like DNA Polymerases" Nucl. Acids, Res. 19: 6952 (1991). [0239]15. Uemori, T., et al., "A Novel DNA Polymerase in the Hyperthermophilic Archeon, Pyrococctis furiosus. Gene Cloning, Expression, and Characterization" Genes to Cells 2:499-512 (1997).

Sequence CWU 1

84128PRTArtificial SequenceDescription of Artificial Sequence Zinc finger motif 1Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1 5 10 15Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 20 25233DNAArtificial SequenceDescription of Artificial Sequence Primer 2gacgacgaca agatgagcga agagattaga gaa 33335DNAArtificial SequenceDescription of Artificial Sequence Primer 3ggaacaagac ccgttcactt cttcccaatt agggt 35433DNAArtificial SequenceDescription of Artificial Sequence Primer 4gacgacgaca agatgccaga gcttccctgg gta 33535DNAArtificial SequenceDescription of Artificial Sequence Primer 5ggaacaagac ccgttcactt tttaagaaag tcaaa 35634DNAArtificial SequenceDescription of Artificial Sequence Primer 6gacgacgaca agatgccatt cgaaatagtc tttg 34737DNAArtificial SequenceDescription of Artificial Sequence Primer 7ggaacaagac ccgttcactc ctcaaccctt ggggcta 37816DNAArtificial SequenceDescription of Artificial Sequence Primer 8actacagcgg ctttgg 16916DNAArtificial SequenceDescription of Artificial Sequence Primer 9ctttccgaca ccaggg 161048DNAArtificial SequenceDescription of Artificial Sequence Primer 10gacgacgaca agatgatcat gagtgcattt acaaaagaag aaataatc 481143DNAArtificial SequenceDescription of Artificial Sequence Primer 11ggaacaagac ccgttcacat cacccccaat tcttccaatt ccc 431242DNAArtificial SequenceDescription of Artificial Sequence Primer 12gacgacgaca agatgaacat aaagagcttc ataaacaggc tt 421344DNAArtificial SequenceDescription of Artificial Sequence Primer 13ggaacaagac ccgttcaaat gctatccttc gttagcacaa cata 441450DNAArtificial SequenceDescription of Artificial Sequence Primer 14gacgacgaca agatgattga ggagctgttc aagggattag agagtgaaat 501550DNAArtificial SequenceDescription of Artificial Sequence Primer 15ggaacaagac ccgttcatct ttttacggca aatgcgaatt cttctccctt 501650DNAArtificial SequenceDescription of Artificial Sequence Primer 16gacgacgaca agatgttaat agttgtaaga ccaggaagaa aaaagaatga 501750DNAArtificial SequenceDescription of Artificial Sequence Primer 17ggaacaagac ccgttcatcg tctctcaccc ttcaaaattt ttccttcttc 501850DNAArtificial SequenceDescription of Artificial Sequence Primer 18gacgacgaca agatgcacat attgataaaa aaggcaataa aagagagatt 501950DNAArtificial SequenceDescription of Artificial Sequence Primer 19ggaacaagac ccgtctattc ccaaaacttt ctagtttgga tgtagtgttt 502049DNAArtificial SequenceDescription of Artificial Sequence Primer 20gacgacgaca agatgttatt aaggagagac ttaatacagc ctaggatat 492149DNAArtificial SequenceDescription of Artificial Sequence Primer 21ggaacaagac ccgtctactc ctcatcctct atatatgggg cagttatta 492249DNAArtificial SequenceDescription of Artificial Sequence Primer 22gacgacgaca agatgctcat gaggccagtg aggctaatga tagctgatg 492349DNAArtificial SequenceDescription of Artificial Sequence Primer 23ggaacaagac ccgtctagct taacttaagt aaatgcctat ctttcttct 492450DNAArtificial SequenceDescription of Artificial Sequence Primer 24gacgacgaca agatgatcga aggttacgaa attaaactag ctgttgtaac 502547DNAArtificial SequenceDescription of Artificial Sequence Primer 25ggaacaagac ccgttcaaaa acctttccca ggtatgcggg ggtcgct 472648DNAArtificial SequenceDescription of Artificial Sequence Primer 26gacgacgaca agatgagggt tgatgagctg agagttgatg agaggata 482750DNAArtificial SequenceDescription of Artificial Sequence Primer 27ggaacaagac ccgttcaaga tttgagaaag taatcaaggg tactttttct 502848DNAArtificial SequenceDescription of Artificial Sequence Primer 28gacgacgaca agatggacag ggaggagatg attgagagat ttgcaaac 482947DNAArtificial SequenceDescription of Artificial Sequence Primer 29ggaacaagac ccgttcagac ggttttgtag taaccactct ctggcat 473025DNAArtificial SequenceDescription of Artificial Sequence Primer 30aagacctgct gcggaactac ttttg 253126DNAArtificial SequenceDescription of Artificial Sequence Primer 31actgctgcag cagttaggga tgagcg 263244DNAArtificial SequenceDescription of Artificial Sequence Primer 32gacgacgaca agatgaacga aggcatcaaa taaagcttga cgag 443342DNAArtificial SequenceDescription of Artificial Sequence Primer 33ggaacaagac ccgtttagat caacctgctc actcttaagg ga 423449DNAArtificial SequenceDescription of Artificial Sequence Primer 34gacgacgaca agatgggtgt cccaattggt gagattatac caagaaaag 493556DNAArtificial SequenceDescription of Artificial Sequence Primer 35ggaacaagac ccgtttatct cttgaaccaa ctttcaaggg ttgattgttt tccact 563618DNAArtificial SequenceDescription of Artificial Sequence Primer 36gatgaaagag ggatagat 183718DNAArtificial SequenceDescription of Artificial Sequence Primer 37atctccagtt agacagct 183840DNAArtificial SequenceDescription of Artificial Sequence Primer 38ggttttccca gtcacgacgt tgtaaaacga cggccagtgc 403940DNAArtificial SequenceDescription of Artificial Sequence Primer 39ggttttccca gtcacgacgt tgtaaaacga cggccagtgc 404038DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 40ggttttccca gtcacgacgt tgtaaaacga cggccagt 384160DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 41gagagaattc ataatgataa ggaggaaaaa attatgatcc tggacgatga ctacatcacc 604224DNAArtificial SequenceDescription of Artificial Sequence Primer 42cacaagggct actggttgcc gatt 244330DNAArtificial SequenceDescription of Artificial Sequence Primer 43cagggcattg acagcagtct tctcctcagg 304424DNAArtificial SequenceDescription of Artificial Sequence Primer 44cacaagggct actggttgcc gatt 244521DNAArtificial SequenceDescription of Artificial Sequence Primer 45agcttcccaa cgtgatcgcc t 214630DNAArtificial SequenceDescription of Artificial Sequence Primer 46ctcagatatg gccaaagatc tatacacacc 304722DNAArtificial SequenceDescription of Artificial Sequence Primer 47agcttcccaa cgtgatcgcc tt 224823DNAArtificial SequenceDescription of Artificial Sequence Primer 48gaggagagca ggaaaggtgg aac 234922DNAArtificial SequenceDescription of Artificial Sequence Primer 49gaaaatagga gctcagctgc ag 225023DNAArtificial SequenceDescription of Artificial Sequence Primer 50gaggagagca ggaaaggtgg aac 235121DNAArtificial SequenceDescription of Artificial Sequence Primer 51gctgggagaa gacttcactg g 215218DNAArtificial SequenceDescription of Artificial Sequence Primer 52gacagtcact ccggcccg 185318DNAArtificial SequenceDescription of Artificial Sequence Primer 53cgacgactcg tggagccc 185436PRTUnknown OrganismDescription of Unknown Organism N-terminal sequence 54Pro Phe Glu Ile Val Phe Glu Gly Ala Lys Glu Phe Ala Gln Leu Ile 1 5 10 15Asp Thr Ala Ser Lys Leu Xaa Asp Glu Ala Ala Phe Lys Val Thr Glu 20 25 30Asp Gly Met Arg 355518DNAArtificial SequenceDescription of Artificial Sequence Primer 55gatgaaagag ggatagat 185618DNAArtificial SequenceDescription of Artificial Sequence Primer 56atctccagtt agacagct 185724DNAArtificial SequenceDescription of Artificial Sequence Primer 57cacaagggct actggttgcc gatt 245830DNAArtificial SequenceDescription of Artificial Sequence Primer 58cagggcattg acagcagtct tctcctcagg 3059750DNAArtificial SequenceDescription of Artificial Sequence Recombinant PCNA 59atgccattcg aaatagtctt tgaaggtgca aaagagtttg cccaacttat agacaccgca 60agtaagttaa tagatgaggc cgcgtttaaa gttacagaag atgggataag catgagggcc 120atggatccaa gtagagttgt cctgattgac ctaaatctcc cgtcaagcat atttagcaaa 180tatgaagttg ttgaaccaga aacaattgga gttaacatgg accacctaaa gaagatccta 240aagagaggta aagcaaagga caccttaata ctcaagaaag gagaggaaaa cttcttagag 300ataacaattc aaggaactgc aacaagaaca tttagagttc ccctaataga tgtagaagag 360atggaagttg acctcccaga acttccattc actgcaaagg ttgtagttct tggagaagtc 420ctaaaagatg ctgttaaaga tgcctctcta gtgagtgaca gcataaaatt tattgccagg 480gaaaatgaat ttataatgaa ggcagaggga gaaacccagg aagttgagat aaagctaact 540cttgaagatg agggattatt ggacatcgag gttcaagagg agacaaagag cgcatatgga 600gtcagctatc tctccgacat ggttaaagga cttggaaagg ccgatgaagt tacaataaag 660tttggaaatg aaatgcccat gcaaatggag tattacatta gagatgaagg aagacttaca 720ttcctactag cccctagggt tgaggagtga 75060249PRTArtificial SequenceDescription of Artificial Sequence Recombinant PCNA 60Met Pro Phe Glu Ile Val Phe Glu Gly Ala Lys Glu Phe Ala Gln Leu 1 5 10 15Ile Asp Thr Ala Ser Lys Leu Ile Asp Glu Ala Ala Phe Lys Val Thr 20 25 30Glu Asp Gly Ile Ser Met Arg Ala Met Asp Pro Ser Arg Val Val Leu 35 40 45Ile Asp Leu Asn Leu Pro Ser Ser Ile Phe Ser Lys Tyr Glu Val Val 50 55 60Glu Pro Glu Thr Ile Gly Val Asn Met Asp His Leu Lys Lys Ile Leu 65 70 75 80Lys Arg Gly Lys Ala Lys Asp Thr Leu Ile Leu Lys Lys Gly Glu Glu 85 90 95Asn Phe Leu Glu Ile Thr Ile Gln Gly Thr Ala Thr Arg Thr Phe Arg 100 105 110Val Pro Leu Ile Asp Val Glu Glu Met Glu Val Asp Leu Pro Glu Leu 115 120 125Pro Phe Thr Ala Lys Val Val Val Leu Gly Glu Val Leu Lys Asp Ala 130 135 140Val Lys Asp Ala Ser Leu Val Ser Asp Ser Ile Lys Phe Ile Ala Arg145 150 155 160Glu Asn Glu Phe Ile Met Lys Ala Glu Gly Glu Thr Gln Glu Val Glu 165 170 175Ile Lys Leu Thr Leu Glu Asp Glu Gly Leu Leu Asp Ile Glu Val Gln 180 185 190Glu Glu Thr Lys Ser Ala Tyr Gly Val Ser Tyr Leu Ser Asp Met Val 195 200 205Lys Gly Leu Gly Lys Ala Asp Glu Val Thr Ile Lys Phe Gly Asn Glu 210 215 220Met Pro Met Gln Met Glu Tyr Tyr Ile Arg Asp Glu Gly Arg Leu Thr225 230 235 240Phe Leu Leu Ala Pro Arg Val Glu Glu 245614848DNAArtificial SequenceDescription of Artificial Sequence Genomic RFC clone 61acccaaaatt gttattcagn tcaacggaga agacggagta ganttggaag gagcttatcc 60agagaaatgt tcttagagaa gttactctca gctctcagct gatctanngt ttttccttct 120tttcttctgt tcagttatng cctaggataa gcttaataat actttgatac ctttcttagt 180ttaggtgtgt gagagtatga gcgaagagat tagagaagtt aaggttctag aaaaaccctg 240ggttgagaag tatagacctc aaagacttga cgacattgta ggacaagagc acatagtgaa 300aaggctcaag cactacgtca aaactggatc aatgccccac ctactcttcg caggcccccc 360tggtgtcgga aagtgtctta ctggagatac caaagttata gctaatggcc aactctttga 420acttggagaa cttgttgaaa agctttctgg ggggagattt ggaccaactc cagttaaagg 480gctcaaagtt cttggaatag atgaggatgg aaagcttaga gagtttgaag tccaatacgt 540ctacaaagat agaactgata ggttgataaa gataaaaact cagcttggca gggagcttaa 600agtaactccg tatcacccac ttctagtgat tggagagaat ggcgaattaa agtggattaa 660ggctgaagaa ctcaaacttg gcgacaagct tgcaataccg agctttctcc cacttataac 720tggagaaaat ccccttgcag agtggcttgg ttactttatg ggaagtggct atgcttatcc 780caagaattct gtcatcacgt tcactaacga agatccactc ataagacaac gctttatgga 840actaacagag aaacttttcc ctgatgcaaa gataagggaa agaattcacg ctgatggaac 900tccagaagtt tatgtggtat ctaggaaagc ttggagcctt gtaaactcta ttagcttaac 960attaataccc agggaggggt ggaaaggaat tcgttctttc cttagggcat attccgactg 1020caatggtcgg attgaaagtg atgcaatagt tttatcaacc gataacaatg atatggccca 1080gcagatagcc tatgctttag ccagctttgg aataatagct aaaatggatg gagaagatgt 1140tattatctca ggctcggaca acatagagag gttcctaaat gagattggct ttagcaccca 1200aagcaaactt aaagaagccc agaagctcat tagaaaaacc aatgtaagat ccgatggact 1260aaagattaac tatgagctaa tctcctatgt aaaagacagg cttaggttaa atgtcaatga 1320taaaagaaat ttgagctaca gaaatgcaaa ggagctttct tgggaactca tgaaagaaat 1380ttattatcgc cttgaggaac tggagagact aaagaaggtc ttatcagaac ccatcttgat 1440cgactggaat gaagtagcaa agaagagtga tgaagtaata gaaaaagcta aaattagagc 1500agagaagctc ctagaataca taaaaggaga gagaaagcca agtttcaagg agtacattga 1560gatagcaaaa gtccttggaa ttaacgttga acgtaccatc gaagctatga agatctttgc 1620aaagagatac tcaagctatg ccgagattgg aagaaaactt ggaacttgga atttcaatgt 1680aaaaacaatt cttgagagcg acacagtgga taacgttgaa atccttgaaa agataaggaa 1740aattgagctt gagctcatag aggaaattct ttcggatgga aagctcaaag aaggtatagc 1800atatctcatt ttcctcttcc agaatgagct ttactgggac gagataactg aagtaaaaga 1860gcttagggga gactttataa tctatgatct tcatgttcct ggctaccaca actttattgc 1920tgggaacatg ccaacagtag tccataacac tacagcggct ttggcccttg caagagagct 1980tttcggcgaa aactggaggc ataacttcct cgagttgaat gcttcagatg aaagaggtat 2040aaacgtaatt agagagaaag ttaaggagtt tgcgagaaca aagcctatag gaggagcaag 2100cttcaagata attttccttg atgaggccga cgctttaact caagatgccc aacaagcctt 2160aagaagaacc atggaaatgt tctcgagtaa cgttcgcttt atcttgagct gtaactacta 2220ctccaagata attgaaccca tacagtctag atgtgcaata ttccgcttca gacctctccg 2280cgatgaggat atagcgaaga gactaaggta cattgccgaa aatgagggct tagagctaac 2340tgaagaaggt ctccaagcaa tactttacat agcagaagga gatatgagaa gagcaataaa 2400cattctgcaa gctgcagcag ctctagacaa gaagatcacc gacgaaaacg tattcatggt 2460agcgagtaga gctagacctg aagatataag agagatgatg cttcttgctc tcaaaggcaa 2520cttcttgaag gccagagaaa agcttaggga gatacttctc aagcaaggac ttagtggaga 2580agatgtacta gttcagatgc acaaagaagt cttcaacctg ccaatagagg agccaaagaa 2640ggttctgctt gctgataaga taggagagta taacttcaga ctcgttgaag gggctaatga 2700aataattcag cttgaagcac tcttagcaca gttcacccta attgggaaga agtgatgaag 2760tatgccagag cttccctggg tagaaaaata caggccaaaa aagttaagtg aaattgtaaa 2820ccaagaagag gctatagaga aagttagagc gtggatagag agctggttgc atggccaccc 2880ccctaagaaa aaagccctat tattagcagg acccccaggg agcggaaaga caaccacagt 2940ctacgctcta gcaaatgagt acaactttga agtcattgag ctcaacgcga gtgatgagag 3000aacttatgaa aaaatctcca ggtatgttca agcagcatac actatggata tcctcggaaa 3060gaggaggaag ataatcttcc tcgatgaagc agataatata gagcccagcg gagctaagga 3120aatcgcaaaa ctaattgata aggccaaaaa tccaataata atggctgcaa ataagtactg 3180ggaagttcca aaagagatcc gagaaaaagc tgagctagta gagtacaaga ggttaaccca 3240gagagatgta atgaatgcct taataaggat cctaaagagg gaaggtataa cagttccaaa 3300agaaatcctc ctagaaatag caaaaagatc tagtggagat ctaagagcag ctataaatga 3360tctacagacc gttgtagtgg gtggttacga agatgctacg caagttttgg catatagaga 3420tgtagaaaag acagtctttc aagccctagg actcgtcttt ggaagtgaca acgccaagag 3480ggcaaagatg gcaatgtgga acttggacat gtcccctgat gaattcctgc tatgggtaga 3540tgagaacatt cctcacctct acctaaatcc agaggagatt gcccaggcgt atgatgcaat 3600tagtagagcc gacatatacc tcggaagggc cgccagaact ggaaactatt cactctggaa 3660gtacgcaata gatatgatga ctgcaggagt tgccgtggca gggagaaaga gaaggggatt 3720tgtcaagttt tatcctccca acaccctaaa gattttagcg gaaagcaaag aagaaagaga 3780gatcagagag tccataatta aaaagataat acgagagatg cncatgagta ggctacaggc 3840aatagaaacg atgaaaataa ttagagagat tttcgagaac aatctagacc ttgctgcgca 3900ctttacagtg ttccttggtc tgtctgaaaa agaagttgag tttctagctg gaaaggaaaa 3960agctggtacc atttggggca aagccttagc attaagaagg aaacttaagg agcttggaat 4020aagagaggag gagaagccta aagttgaaat tgaagaagag gaagaagagg aagaaaagac 4080cgaagaagaa aaagaggaaa tagaagaaaa acccgaagaa gagaaagaag aggagaagaa 4140agaaaaggaa aagccaaaga aaggcaaaca agcaactctc tttgactttc ttaaaaagtg 4200attacccttt ttcttctatt agagctccga ataaagttgg ccctctaatt ttttctattg 4260tctcctccac attaatcttt acgaattgga attcctgcag cccgggggat ccactagtcc 4320tagagcggcc gccaccgcgg tggagctcca gcttttgttc cctttagtga gggttaattt 4380cgagcttggc gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa 4440ttccacacaa catacgaacc cggaagcata aattgtaaac ccnggggtgc ctaatgantg 4500anctaactca cattaattgc nttgcgctca ctgcccgctt tccantcggg aaacctgtcg 4560tgccagctgc attaatgaat cggccaacnc gcgggganaa gcggttgcgt attgggcgct 4620cttccgcttc ctcgctcatg actcgctgcg ctcggtcntc ggctgcggcg aacggtatca 4680gctcatcaaa ggcggtaata cggttatccn caaatcaggg gataacgcag gaaaaaactt 4740tnnacaaaag gcnncaaaag gcggaaacta aaaggcgcnt tctgggtttt tcntaggccc 4800nccccganaa ctcnaaaaat caacncattc aagtgggaaa ccaaagaa 4848621603PRTArtificial SequenceDescription of Artificial Sequence Amino acid sequence of the genomic RFC clone 62Pro Lys Ile Val Ile Gln Xaa Asn Gly Glu Asp Gly Val Xaa Leu Glu 1 5 10 15Gly Ala Tyr Pro Glu Lys Cys Ser Arg Ser Tyr Ser Gln Leu Ser Ala 20 25 30Asp Leu Xaa Phe Phe Leu Leu Phe Phe Cys Ser Val Xaa Ala Asp Lys 35 40

45Leu Asn Asn Thr Leu Ile Pro Phe Leu Val Val Cys Glu Ser Met Ser 50 55 60Glu Glu Ile Arg Glu Val Lys Val Leu Glu Lys Pro Trp Val Glu Lys 65 70 75 80Tyr Arg Pro Gln Arg Leu Asp Asp Ile Val Gly Gln Glu His Ile Val 85 90 95Lys Arg Leu Lys His Tyr Val Lys Thr Gly Ser Met Pro His Leu Leu 100 105 110Phe Ala Gly Pro Pro Gly Val Gly Lys Cys Leu Thr Gly Asp Thr Lys 115 120 125Val Ile Ala Asn Gly Gln Leu Phe Glu Leu Gly Glu Leu Val Glu Lys 130 135 140Leu Ser Gly Gly Arg Phe Gly Pro Thr Pro Val Lys Gly Leu Lys Val145 150 155 160Leu Gly Ile Asp Glu Asp Gly Lys Leu Arg Glu Phe Glu Val Gln Tyr 165 170 175Val Tyr Lys Asp Arg Thr Asp Arg Leu Ile Lys Ile Lys Thr Gln Leu 180 185 190Gly Arg Glu Leu Lys Val Thr Pro Tyr His Pro Leu Leu Val Ile Gly 195 200 205Glu Asn Gly Glu Leu Lys Trp Ile Lys Ala Glu Glu Leu Lys Leu Gly 210 215 220Asp Lys Leu Ala Ile Pro Ser Phe Leu Pro Leu Ile Thr Gly Glu Asn225 230 235 240Pro Leu Ala Glu Trp Leu Gly Tyr Phe Met Gly Ser Gly Tyr Ala Tyr 245 250 255Pro Lys Asn Ser Val Ile Thr Phe Thr Asn Glu Asp Pro Leu Ile Arg 260 265 270Gln Arg Phe Met Glu Leu Thr Glu Lys Leu Phe Pro Asp Ala Lys Ile 275 280 285Arg Glu Arg Ile His Ala Asp Gly Thr Pro Glu Val Tyr Val Val Ser 290 295 300Arg Lys Ala Trp Ser Leu Val Asn Ser Ile Ser Leu Thr Leu Ile Pro305 310 315 320Arg Glu Gly Trp Lys Gly Ile Arg Ser Phe Leu Arg Ala Tyr Ser Asp 325 330 335Cys Asn Gly Arg Ile Glu Ser Asp Ala Ile Val Leu Ser Thr Asp Asn 340 345 350Asn Asp Met Ala Gln Gln Ile Ala Tyr Ala Leu Ala Ser Phe Gly Ile 355 360 365Ile Ala Lys Met Asp Gly Glu Asp Val Ile Ile Ser Gly Ser Asp Asn 370 375 380Ile Glu Arg Phe Leu Asn Glu Ile Gly Phe Ser Thr Gln Ser Lys Leu385 390 395 400Lys Glu Ala Gln Lys Leu Ile Arg Lys Thr Asn Val Arg Ser Asp Gly 405 410 415Leu Lys Ile Asn Tyr Glu Leu Ile Ser Tyr Val Lys Asp Arg Leu Arg 420 425 430Leu Asn Val Asn Asp Lys Arg Asn Leu Ser Tyr Arg Asn Ala Lys Glu 435 440 445Leu Ser Trp Glu Leu Met Lys Glu Ile Tyr Tyr Arg Leu Glu Glu Leu 450 455 460Glu Arg Leu Lys Lys Val Leu Ser Glu Pro Ile Leu Ile Asp Trp Asn465 470 475 480Glu Val Ala Lys Lys Ser Asp Glu Val Ile Glu Lys Ala Lys Ile Arg 485 490 495Ala Glu Lys Leu Leu Glu Tyr Ile Lys Gly Glu Arg Lys Pro Ser Phe 500 505 510Lys Glu Tyr Ile Glu Ile Ala Lys Val Leu Gly Ile Asn Val Glu Arg 515 520 525Thr Ile Glu Ala Met Lys Ile Phe Ala Lys Arg Tyr Ser Ser Tyr Ala 530 535 540Glu Ile Gly Arg Lys Leu Gly Thr Trp Asn Phe Asn Val Lys Thr Ile545 550 555 560Leu Glu Ser Asp Thr Val Asp Asn Val Glu Ile Leu Glu Lys Ile Arg 565 570 575Lys Ile Glu Leu Glu Leu Ile Glu Glu Ile Leu Ser Asp Gly Lys Leu 580 585 590Lys Glu Gly Ile Ala Tyr Leu Ile Phe Leu Phe Gln Asn Glu Leu Tyr 595 600 605Trp Asp Glu Ile Thr Glu Val Lys Glu Leu Arg Gly Asp Phe Ile Ile 610 615 620Tyr Asp Leu His Val Pro Gly Tyr His Asn Phe Ile Ala Gly Asn Met625 630 635 640Pro Thr Val Val His Asn Thr Thr Ala Ala Leu Ala Leu Ala Arg Glu 645 650 655Leu Phe Gly Glu Asn Trp Arg His Asn Phe Leu Glu Leu Asn Ala Ser 660 665 670Asp Glu Arg Gly Ile Asn Val Ile Arg Glu Lys Val Lys Glu Phe Ala 675 680 685Arg Thr Lys Pro Ile Gly Gly Ala Ser Phe Lys Ile Ile Phe Leu Asp 690 695 700Glu Ala Asp Ala Leu Thr Gln Asp Ala Gln Gln Ala Leu Arg Arg Thr705 710 715 720Met Glu Met Phe Ser Ser Asn Val Arg Phe Ile Leu Ser Cys Asn Tyr 725 730 735Ser Ser Lys Ile Ile Glu Pro Ile Gln Ser Arg Cys Ala Ile Phe Arg 740 745 750Phe Arg Pro Leu Arg Asp Glu Asp Ile Ala Lys Arg Leu Arg Tyr Ile 755 760 765Ala Glu Asn Glu Gly Leu Glu Leu Thr Glu Glu Gly Leu Gln Ala Ile 770 775 780Leu Tyr Ile Ala Glu Gly Asp Met Arg Arg Ala Ile Asn Ile Leu Gln785 790 795 800Ala Ala Ala Ala Leu Asp Lys Lys Ile Thr Asp Glu Asn Val Phe Met 805 810 815Val Ala Ser Arg Ala Arg Pro Glu Asp Ile Arg Glu Met Met Leu Leu 820 825 830Ala Leu Lys Gly Asn Phe Leu Lys Ala Arg Glu Lys Leu Arg Glu Ile 835 840 845Leu Leu Lys Gln Gly Leu Ser Gly Glu Asp Val Leu Val Gln Met His 850 855 860Lys Glu Val Phe Asn Leu Pro Ile Glu Glu Pro Lys Lys Val Leu Leu865 870 875 880Ala Asp Lys Ile Gly Glu Tyr Asn Phe Arg Leu Val Glu Gly Ala Asn 885 890 895Glu Ile Ile Gln Leu Glu Ala Leu Leu Ala Gln Phe Thr Leu Ile Gly 900 905 910Lys Lys Ser Met Pro Glu Leu Pro Trp Val Glu Lys Tyr Arg Pro Lys 915 920 925Lys Leu Ser Glu Ile Val Asn Gln Glu Glu Ala Ile Glu Lys Val Arg 930 935 940Ala Trp Ile Glu Ser Trp Leu His Gly His Pro Pro Lys Lys Lys Ala945 950 955 960Leu Leu Leu Ala Gly Pro Pro Gly Ser Gly Lys Thr Thr Thr Val Tyr 965 970 975Ala Leu Ala Asn Glu Tyr Asn Phe Glu Val Ile Glu Leu Asn Ala Ser 980 985 990Asp Glu Arg Thr Tyr Glu Lys Ile Ser Arg Tyr Val Gln Ala Ala Tyr 995 1000 1005Thr Met Asp Ile Leu Gly Lys Arg Arg Lys Ile Ile Phe Leu Asp Glu 1010 1015 1020Ala Asp Asn Ile Glu Pro Ser Gly Ala Lys Glu Ile Ala Lys Leu Ile1025 1030 1035 1040Asp Lys Ala Lys Asn Pro Ile Ile Met Ala Ala Asn Lys Tyr Trp Glu 1045 1050 1055Val Pro Lys Glu Ile Arg Glu Lys Ala Glu Leu Val Glu Tyr Lys Arg 1060 1065 1070Leu Thr Gln Arg Asp Val Met Asn Ala Leu Ile Arg Ile Leu Lys Arg 1075 1080 1085Glu Gly Ile Thr Val Pro Lys Glu Ile Leu Leu Glu Ile Ala Lys Arg 1090 1095 1100Ser Ser Gly Asp Leu Arg Ala Ala Ile Asn Asp Leu Gln Thr Val Val1105 1110 1115 1120Val Gly Gly Tyr Glu Asp Ala Thr Gln Val Leu Ala Tyr Arg Asp Val 1125 1130 1135Glu Lys Thr Val Phe Gln Ala Leu Gly Leu Val Phe Gly Ser Asp Asn 1140 1145 1150Ala Lys Arg Ala Lys Met Ala Met Trp Asn Leu Asp Met Ser Pro Asp 1155 1160 1165Glu Phe Leu Leu Trp Val Asp Glu Asn Ile Pro His Leu Tyr Leu Asn 1170 1175 1180Pro Glu Glu Ile Ala Gln Ala Tyr Asp Ala Ile Ser Arg Ala Asp Ile1185 1190 1195 1200Tyr Leu Gly Arg Ala Ala Arg Thr Gly Asn Tyr Ser Leu Trp Lys Tyr 1205 1210 1215Ala Ile Asp Met Met Thr Ala Gly Val Ala Val Ala Gly Arg Lys Arg 1220 1225 1230Arg Gly Phe Val Lys Phe Tyr Pro Pro Asn Thr Leu Lys Ile Leu Ala 1235 1240 1245Glu Ser Lys Glu Glu Arg Glu Ile Arg Glu Ser Ile Ile Lys Lys Ile 1250 1255 1260Ile Arg Glu Met Xaa Met Ser Arg Leu Gln Ala Ile Glu Thr Met Lys1265 1270 1275 1280Ile Ile Arg Glu Ile Phe Glu Asn Asn Leu Asp Leu Ala Ala His Phe 1285 1290 1295Thr Val Phe Leu Gly Leu Ser Glu Lys Glu Val Glu Phe Leu Ala Gly 1300 1305 1310Lys Glu Lys Ala Gly Thr Ile Trp Gly Lys Ala Leu Ala Leu Arg Arg 1315 1320 1325Lys Leu Lys Glu Leu Gly Ile Arg Glu Glu Glu Lys Pro Lys Val Glu 1330 1335 1340Ile Glu Glu Glu Glu Glu Glu Glu Glu Lys Thr Glu Glu Glu Lys Glu1345 1350 1355 1360Glu Ile Glu Glu Lys Pro Glu Glu Glu Lys Glu Glu Glu Lys Lys Glu 1365 1370 1375Lys Glu Lys Pro Lys Lys Gly Lys Gln Ala Thr Leu Phe Asp Phe Leu 1380 1385 1390Lys Lys Leu Pro Phe Phe Phe Tyr Ser Ser Glu Ser Trp Pro Ser Asn 1395 1400 1405Phe Phe Tyr Cys Leu Leu His Ile Asn Leu Tyr Glu Leu Glu Phe Leu 1410 1415 1420Gln Pro Gly Gly Ser Thr Ser Ser Arg Ala Ala Ala Thr Ala Val Glu1425 1430 1435 1440Leu Gln Leu Leu Phe Pro Leu Val Arg Val Asn Phe Glu Leu Gly Val 1445 1450 1455Ile Met Val Ile Ala Val Ser Cys Val Lys Leu Leu Ser Ala His Asn 1460 1465 1470Ser Thr Gln His Thr Asn Pro Glu Ala Ile Val Asn Pro Gly Val Pro 1475 1480 1485Asn Xaa Xaa Asn Ser His Leu Xaa Cys Ala His Cys Pro Leu Ser Xaa 1490 1495 1500Arg Glu Thr Cys Arg Ala Ser Cys Ile Asn Glu Ser Ala Asn Xaa Arg1505 1510 1515 1520Gly Xaa Ala Val Ala Tyr Trp Ala Leu Phe Arg Phe Leu Ala His Asp 1525 1530 1535Ser Leu Arg Ser Val Xaa Gly Cys Gly Glu Arg Tyr Gln Leu Ile Lys 1540 1545 1550Gly Gly Asn Thr Val Ile Xaa Lys Ser Gly Asp Asn Ala Gly Lys Asn 1555 1560 1565Phe Xaa Gln Lys Ala Xaa Lys Gly Gly Asn Lys Ala Xaa Ser Gly Phe 1570 1575 1580Phe Xaa Gly Pro Pro Arg Xaa Leu Xaa Lys Ser Thr His Ser Ser Gly1585 1590 1595 1600Lys Pro Lys63479PRTArtificial SequenceDescription of Artificial Sequence Recombinant P55 clone 63Met Pro Glu Leu Pro Trp Val Glu Lys Tyr Arg Pro Lys Lys Leu Ser 1 5 10 15Glu Ile Val Asn Gln Glu Glu Ala Ile Glu Lys Val Arg Ala Trp Ile 20 25 30Glu Ser Trp Leu His Gly His Pro Pro Lys Lys Lys Ala Leu Leu Leu 35 40 45Ala Gly Pro Pro Gly Ser Gly Lys Thr Thr Thr Val Tyr Ala Leu Ala 50 55 60Asn Glu Tyr Asn Phe Glu Val Ile Glu Leu Asn Ala Ser Asp Glu Arg 65 70 75 80Thr Tyr Glu Lys Ile Ser Arg Tyr Val Gln Ala Ala Tyr Thr Met Asp 85 90 95Ile Leu Gly Lys Arg Arg Lys Ile Ile Phe Leu Asp Glu Ala Asp Asn 100 105 110Ile Glu Pro Ser Gly Ala Lys Glu Ile Ala Lys Leu Ile Asp Lys Ala 115 120 125Lys Asn Pro Ile Ile Met Ala Ala Asn Lys Tyr Trp Glu Val Pro Lys 130 135 140Glu Ile Arg Glu Lys Ala Glu Leu Val Glu Tyr Lys Arg Leu Thr Gln145 150 155 160Arg Asp Val Met Asn Ala Leu Ile Arg Ile Leu Lys Arg Glu Gly Ile 165 170 175Thr Val Pro Lys Glu Ile Leu Leu Glu Ile Ala Lys Arg Ser Ser Gly 180 185 190Asp Leu Arg Ala Ala Ile Asn Asp Leu Gln Thr Val Val Val Gly Gly 195 200 205Tyr Glu Asp Ala Thr Gln Val Leu Ala Tyr Arg Asp Val Glu Lys Thr 210 215 220Val Phe Gln Ala Leu Gly Leu Val Phe Gly Ser Asp Asn Ala Lys Arg225 230 235 240Ala Lys Met Ala Met Trp Asn Leu Asp Met Ser Pro Asp Glu Phe Leu 245 250 255Leu Trp Val Asp Glu Asn Ile Pro His Leu Tyr Leu Asn Pro Glu Glu 260 265 270Ile Ala Gln Ala Tyr Asp Ala Ile Ser Arg Ala Asp Ile Tyr Leu Gly 275 280 285Arg Ala Ala Arg Thr Gly Asn Tyr Ser Leu Trp Lys Tyr Ala Ile Asp 290 295 300Met Met Thr Ala Gly Val Ala Val Val Gly Arg Lys Arg Arg Gly Phe305 310 315 320Val Lys Phe Tyr Pro Pro Asn Thr Leu Lys Ile Leu Ala Glu Ser Lys 325 330 335Glu Glu Arg Glu Ile Arg Glu Ser Ile Ile Lys Lys Ile Ile Arg Glu 340 345 350Met Xaa Met Ser Arg Leu Gln Ala Ile Glu Thr Met Lys Ile Ile Arg 355 360 365Glu Ile Phe Glu Asn Asn Leu Asp Leu Ala Ala His Phe Thr Val Phe 370 375 380Leu Gly Leu Ser Glu Lys Glu Val Glu Phe Leu Ala Gly Lys Glu Lys385 390 395 400Ala Gly Thr Ile Trp Gly Lys Ala Leu Ala Leu Arg Arg Lys Leu Lys 405 410 415Glu Leu Gly Ile Arg Glu Glu Glu Lys Pro Lys Val Glu Ile Glu Glu 420 425 430Glu Glu Glu Glu Glu Glu Lys Thr Glu Glu Glu Lys Glu Glu Ile Glu 435 440 445Glu Lys Pro Glu Glu Glu Lys Glu Glu Glu Lys Lys Glu Lys Glu Lys 450 455 460Pro Lys Lys Gly Lys Gln Ala Thr Leu Phe Asp Phe Leu Lys Lys465 470 47564327PRTArtificial SequenceDescription of Artificial Sequence Recombinant P38 clone 64Met Ser Glu Glu Ile Arg Glu Val Lys Val Leu Glu Lys Pro Trp Val 1 5 10 15Glu Lys Tyr Arg Pro Gln Arg Leu Asp Asp Ile Val Gly Gln Glu His 20 25 30Ile Val Lys Arg Leu Lys His Tyr Val Lys Thr Gly Ser Met Pro His 35 40 45Leu Leu Phe Ala Gly Pro Pro Gly Val Gly Lys Thr Thr Ala Ala Leu 50 55 60Ala Leu Ala Arg Glu Leu Phe Gly Glu Asn Trp Arg His Asn Phe Leu 65 70 75 80Glu Leu Asn Ala Ser Asp Glu Arg Gly Ile Asn Val Ile Arg Glu Lys 85 90 95Val Lys Glu Phe Ala Arg Thr Lys Pro Ile Gly Gly Ala Ser Phe Lys 100 105 110Ile Ile Phe Leu Asp Glu Ala Asp Ala Leu Thr Gln Asp Ala Gln Gln 115 120 125Ala Leu Arg Arg Thr Met Glu Met Phe Ser Ser Asn Val Arg Phe Ile 130 135 140Leu Ser Cys Asn Tyr Ser Ser Lys Ile Ile Glu Pro Ile Gln Ser Arg145 150 155 160Cys Ala Ile Phe Arg Phe Arg Pro Leu Arg Asp Glu Asp Ile Ala Lys 165 170 175Arg Leu Arg Tyr Ile Ala Glu Asn Glu Gly Leu Glu Leu Thr Glu Glu 180 185 190Gly Leu Gln Ala Ile Leu Tyr Ile Ala Glu Gly Asp Met Arg Arg Ala 195 200 205Ile Asn Ile Leu Gln Ala Ala Ala Ala Leu Asp Lys Lys Ile Thr Asp 210 215 220Glu Asn Val Phe Met Val Ala Ser Arg Ala Arg Pro Glu Asp Ile Arg225 230 235 240Glu Met Met Leu Leu Ala Leu Lys Gly Asn Phe Leu Lys Ala Arg Glu 245 250 255Lys Leu Arg Glu Ile Leu Leu Lys Gln Gly Leu Ser Gly Glu Asp Val 260 265 270Leu Val Gln Met His Lys Glu Val Phe Asn Leu Pro Ile Glu Glu Pro 275 280 285Lys Lys Val Leu Leu Ala Asp Lys Ile Gly Glu Tyr Asn Phe Arg Leu 290 295 300Val Glu Gly Ala Asn Glu Ile Ile Gln Leu Glu Ala Leu Leu Ala Gln305 310 315 320Phe Thr Leu Ile Gly Lys Lys 325651077DNAArtificial SequenceDescription of Artificial Sequence RFA clone 65atgagtgcat ttacaaaaga agaaataatc aagaggatcc tggaagaagt ggaaggaata 60actctagaag aaattgagaa ccaaataagg caaataatga gggaaaacaa tatttcagag 120catgcagctg ctctcttact agcagaaagg ctgggagttg aagttaccaa aagagaagaa 180caacctttaa tgaagattag cgacctatat ccaggaatgg atccccacga ggtcaacatt 240gttggaagaa tacttaagaa gtatccaccg cgagaataca caaagaagga tggaagcatt 300ggaagggttg ccagtctagt tatatacgat gatactggga gagcgagggt tgttctttgg 360gattcaaaag ttttggagta ttacagcaag ctagaagtag gggatgttat taaggtttta 420gacgcccagg

ttagggagag cttatctggt ttgcctgaat tgcacattaa cttcagggct 480agaataatta aaaacccaga tgatcctagg gttcaggata tcccacctct tgaagaagtt 540agagtggcaa cttatacgag aaagaagatc agtgaggtcg agcctgggga tagatttgta 600gagcttaggg gaacaattgc caaagtttac agagttttgg tatatgatgc atgtccagag 660tgtaagaaga aggttgacta tgacccagga atggacgttt ggatatgtcc agaacatgga 720gaggttgagc caataaaaat cactattctt gactttgggc ttgatgatgg ctcgggatac 780attaggatta ccctctttgg agacgatgct gaagagttgc tgggagtagg gccagaagag 840attgcccaaa agcttaagga aatggagagc atgggcatga ctctcaagga ggcagcgaga 900aaattggcgg aggaagagtt ctacaatata atagggaaag aaataatcgt gaggggaaat 960gtaattgagg acaggttctt gggcctaatc ttaagggcct cctcctggga agaagttgac 1020tacaagagag aaattgagag aattaagagg gaattggaag aattgggggt gatgtga 107766360PRTArtificial SequenceDescription of Artificial Sequence Amino acid sequence of RFA clone 66Met Ile Met Ser Ala Phe Thr Lys Glu Glu Ile Ile Lys Arg Ile Leu 1 5 10 15Glu Glu Val Glu Gly Ile Thr Leu Glu Glu Ile Glu Asn Gln Ile Arg 20 25 30Gln Ile Met Arg Glu Asn Asn Ile Ser Glu His Ala Ala Ala Leu Leu 35 40 45Leu Ala Glu Arg Leu Gly Val Glu Val Thr Lys Arg Glu Glu Gln Pro 50 55 60Leu Met Lys Ile Ser Asp Leu Tyr Pro Gly Met Asp Pro His Glu Val 65 70 75 80Asn Ile Val Gly Arg Ile Leu Lys Lys Tyr Pro Pro Arg Glu Tyr Thr 85 90 95Lys Lys Asp Gly Ser Ile Gly Arg Val Ala Ser Leu Val Ile Tyr Asp 100 105 110Asp Thr Gly Arg Ala Arg Val Val Leu Trp Asp Ser Lys Val Leu Glu 115 120 125Tyr Tyr Ser Lys Leu Glu Val Gly Asp Val Ile Lys Val Leu Asp Ala 130 135 140Gln Val Arg Glu Ser Leu Ser Gly Leu Pro Glu Leu His Ile Asn Phe145 150 155 160Arg Ala Arg Ile Ile Lys Asn Pro Asp Asp Pro Arg Val Gln Asp Ile 165 170 175Pro Pro Leu Glu Glu Val Arg Val Ala Thr Tyr Thr Arg Lys Lys Ile 180 185 190Ser Glu Val Glu Pro Gly Asp Arg Phe Val Glu Leu Arg Gly Thr Ile 195 200 205Ala Lys Val Tyr Arg Val Leu Val Tyr Asp Ala Cys Pro Glu Cys Lys 210 215 220Lys Lys Val Asp Tyr Asp Pro Gly Met Asp Val Trp Ile Cys Pro Glu225 230 235 240His Gly Glu Val Glu Pro Ile Lys Ile Thr Ile Leu Asp Phe Gly Leu 245 250 255Asp Asp Gly Ser Gly Tyr Ile Arg Ile Thr Leu Phe Gly Asp Asp Ala 260 265 270Glu Glu Leu Leu Gly Val Gly Pro Glu Glu Ile Ala Gln Lys Leu Lys 275 280 285Glu Met Glu Ser Met Gly Met Thr Leu Lys Glu Ala Ala Arg Lys Leu 290 295 300Ala Glu Glu Glu Phe Tyr Asn Ile Ile Gly Lys Glu Ile Ile Val Arg305 310 315 320Gly Asn Val Ile Glu Asp Arg Phe Leu Gly Leu Ile Leu Arg Ala Ser 325 330 335Ser Trp Glu Glu Val Asp Tyr Lys Arg Glu Ile Glu Arg Ile Lys Arg 340 345 350Glu Leu Glu Glu Leu Gly Val Met 355 360672604DNAArtificial SequenceDescription of Artificial Sequence Recombinant helicase 2 67atgattgagg agctgttcaa gggattagag agtgaaatcg ttggacttca cgagattccc 60ccaaagaggg gagagtatgg ggagttcaaa ttcaggaatg aagaagttaa tgagttagtt 120aagaggctcg gatttagact ttattctcac caagttaaag ccctagaaaa gctgtattca 180gggaaaaacg tagttgtttc aacgcccaca gctagtggga aaagcgagat atttaggttg 240tttatctttg acgaaatact gtcaagcccg tcctcaactt ttctcttaat ctacccaaca 300agagccttaa taaacaacca aatggaaaaa ttcgaaaaag aaaacactat ctttgaggag 360atttgtggaa aaagagttcg agcagaagtc ttaactggag atacggaatg ggaaaagaga 420agagaaatca ttaggagcaa accaaacgta atcttcacga cacccgatat gcttcatcat 480cacattcttc ccaggtggag ggattatttc tggcttttaa aggggcttag acttcttgtc 540gtggacgaat tgcacgttta tagggggatc tttggaacaa atgttgctta tgttttcaag 600agactctttc tcaggcttaa gagattaagt tcaagccccc aaatactggc cctttcagca 660actttgagaa accccaaaga atttgctgaa caattttttg agactgaatt tgaggaggtc 720aaggaagctg gaagtccaag cccgagaaga attatagtca tgtttgagcc aagaaggttt 780actggagaac aactaatcaa gcaaattgtt gagagactaa ctagaaagaa cataaagacc 840ttggtatttt ttgactccag aaaggggaca gaaagaatca tgaggctttt cctgttctca 900gatgcttttg ataggatcac aacatacaaa gggacgctaa ctaagaggga aaggtttcta 960atagagagag actttaggga gggcaacctc acagttctcc taacgacaaa tgcactcgag 1020ttgggaattg acattggaga tttagatgca gtaataaact atgggattcc ttcagatgga 1080ttgttttcac taattcaaag atttggtagg gccggaaggg atccaaatag aattgcaata 1140aacgggataa ttttgagaag aaatggattg gactactatt acaaagaaca tttcgatgag 1200ctcgttgagg gaatagaaaa gggcctagtg gagaaaatcc ccgttaactt ggacaatgaa 1260aagatagcga aaaagcacct ccactatgcc atagctgaac ttggagttgt ctcaattaaa 1320gaaattgagg ggagatggaa gagattcata aagaccctcg tagaggaggg atacgtggaa 1380gttacaagaa atccaataac tggagaggaa gaaataagac tcagaagacc tcctgtctat 1440tcttcaatta gaacggcgag cgatgaaagc tacttcttag tcgtggatga accctggata 1500aggggagctt tgcagaggaa gaggggagcc gaacttctcc gttttgtaaa ctacctcaaa 1560gttagaggaa tggtagttga ggaagttgat gagatagaat tccacagaag tctactccct 1620ggaatggtct acctttcaag gggaaggccc tacatggcag ttgataagat aaagattgag 1680aagttccact tcgtttttgc gaggcctctt ccaatcgaag aagaaataga tactagttca 1740agtaaaattg aaaacattga gatacttgag gttaaagacg agaaaactgt tggcccaata 1800aaagtgaagt tcggaagact tagagtaagg cacgaataca ctggatacgc cgtgagggga 1860agagacgttg aaaggcacgt taagagatta gaagagctaa aagatgaggg gatactaagg 1920ggagagattg acatcgtccc atacatttgg gaatcctgga agtttgcgag ggtactcttt 1980gacaccccct acattagaga gtttgaaact gaaggtttct ggcttgagtt tccaaacgat 2040attaggatag ttcccgaaga ggagtttagg gaattctttg cagtggcctc tgagatagat 2100ccagagctcg cgatgttcct ctacaacaga attagtagaa aatctctatt ccccacgctt 2160ctgggagcaa ccacacacta cataaggagt ttcatccttc accacgccaa agataaggga 2220gaagaattcg catttgccgt aaaaaagatg atcgacagca aggatgggat aggctcaggg 2280cttcatgcaa ttgagcccaa tataataaag cttgctccag ttgtgactca tgtggattcg 2340agagaaatag gcggctacag ctacgatgac ttccatggaa agccagtgat cttcatctat 2400gatgggaatg aaggcggaag cggaataatt aggcaggtgt atgagaacgt agaaaagctg 2460atgtacagga gtttggagca tataaagaag tgtccatgca aagacggctg tcctgcctgc 2520atatattctc ccaagtgcgg aactttcaat gaattcctcg acaagtggat ggcaataaga 2580atatgggaaa aagtccttcc ttaa 2604682511DNAArtificial SequenceDescription of Artificial Sequence Recombinant helicase 3 68atgttaatag ttgtaagacc aggaagaaaa aagaatgagc tcgaggcttt tataattgaa 60aaccctccag aaaagctctc tcaaagaaga aatttaaaag ctgatagggt agttaggctc 120ataatgagag ataatagact ttttaaagct cttgaaggaa gtcagtattt aaatccaaag 180gaagtggaga gagcccttag aaattcaagg atagttctgg tgaatgccaa cgagtgggaa 240gagtacttta agaagaggtt aatgaacaaa agagttgaaa aagctgacat ctgtaggctc 300tgccttctca atgggaagat tacagtactc actgagggaa acaggataag atacagagat 360gaatacatat gtgaaagttg tgccgaggag gagttgaaga gagagttaag atttcgattt 420aattccatag gaatgcttga acaggcaaag aagcttttag agagattcag agatttagac 480aaggtgattt caatttttga tccatccttt gaccccacta agcatccaga gataacaaaa 540tgggatgagc taaaggccaa gcatataagg gtcgagaaga tgcatataga tgagctcaac 600atccccgaag aattcaaaaa agttctaaag gccgaaggaa taaacgaact actccccgtt 660caggtgctag cgattaaaaa cggcctccta gagggggaga atttattggt ggtttcagca 720actgcgagtg gaaaaactct aatcggagag cttgcaggta ttcctaaggc tctaaaggga 780aagaaaatgc tgttcctagt tcctctagta gctttagcaa accaaaagta cgaggacttc 840aagagaagat actcaaagct tggattaaaa gtagccatta gagtcggaat gagcaggata 900aagaccaagg aagagccaat agttctggat actggaacag atgcacacat aatagtgggg 960acttacgaag gaatagacta ccttctcaga gctggtaaaa agataggaaa cgttggaacg 1020gttgtaatag atgaaataca catgctcgat gatgaggaga gaggagctag gctagatggg 1080ctcattgcaa ggttaaggaa gctctattca aatgcccaat ttattgggct ttcagcaacc 1140gtaggaaacc ctcaggagtt agccaggaag ctagggatga aactagtgct ttacgatgaa 1200aggcccgttg acttagagag gcatttaata attgcgagaa atgagagtga gaagtggagg 1260tatatagcta agctgtgcaa agccgaggcc atgagaaaga gcgagaaggg attcaagggg 1320cagacgatag tatttacatt ttcaaggaga agatgccatg agcttgcctc attcctaacg 1380gggcagggat tgaaggctaa ggcctaccac tcgggcctcc cctatgttca gagaaagctt 1440accgaaatgg agtttcaagc tcaaatgatt gatgtagttg taacaacagc tgctttagga 1500gcgggagttg attttccagc atcccaagtc atcttcgaaa gcttggccat gggaaacaag 1560tggataacag ttagggagtt tcaccaaatg cttggcaggg ctggaaggcc acagtaccat 1620gagaaaggta aagtttacat aatagtcgag cctgggaaaa agtactcagc tcagatggag 1680ggaactgaag atgaagtcgc cctcaagctc ttgacttcac ccatagaacc agtaattgtt 1740gagtggagcg atgaatttga agaggataat gtcttagctc atgcctgtgt gtttaataga 1800cttaaagtta ttgaagaagt tcaatccctc tgcctgggag caaaccaaag tgctaaaaat 1860gttttggaaa aacttatgga aaaggggctc gtcaaaatat atggagataa agttgaagca 1920accccatatg gaagggcggt gagcatgagt ttcctacttc ctagggaggc agagttcatc 1980agagataact tggagagcac tgatccaatt gagatagcaa ttaaactgct accgttcgaa 2040aacgtttacc tcccaggatc gctccagagg gaaatagagt cagctgttag aggaaagata 2100agctcaaaca tcttttcaag ctcctttgca tcagtgctag aagagcttga caagattata 2160cccgaaataa gcccaaatgc tgcagaaagg ctattcctaa tataccaaga tttcttcaac 2220tgcccagagc aagactgtac ggagtttgca atggagagaa ttgggagaaa gatcattgac 2280ttaagaagag agggatacga gccctcaaaa atctctgagc actttaggaa ggtctatgca 2340ttaatattat accctggaga tgtttttaca tggttagacg gaattgtgag aaaactcgag 2400gcaattgaaa gaatagcccg agtgttcaat aagagaagag tggtagaaga cacaatcagg 2460gttagaaggg aaattgaaga aggaaaaatt ttgaagggtg agagacgatg a 2511692943DNAArtificial SequenceDescription of Artificial Sequence Recombinant helicase 4 69atgcacaaat acttctttcc attacctgca actaagtcaa ctttcttgct ccctgccgac 60ctcaccacag caaatccatg cttttccaag agcttaatca attctctctc tgcctgggcc 120ccttttctat acatacaatg tttttcctat ctacctctta taaacttttt aaactccttg 180acataccctc tcgagatgca catattgata aaaaaggcaa taaaagagag atttggaaag 240ttgaatgccc ttcaacaatt agcctttcat aaaattaggg gagaaggtaa aagtgtttta 300ataatagctc cgacaggaag cggaaaaact gaagccgcag taattccaat cttagacgca 360atactacggg agaatcttaa acctatagca gctatttata tagccccatt gaaggcacta 420aatagggact tgctagagag actaaagtgg tgggaagaaa aaactggggt aataatagag 480gttaggcatg gggacacgcc tacctcaaaa agattgaagc aggtaaaaaa tcctccccac 540ctattaatta caacccctga aatgctccct gctattctta cgacaaagtc cttccgtccc 600tatcttaaga acactaaatt tatcgtgata gacgagattg gtgaacttat agagaataaa 660agaggaaccc agctaatcct aaatctaaaa agacttgaat taattacaga agataaacca 720ataaggattg gcctttctgc aacaattgga agtgaagaaa aggtaaggct ttggatggaa 780gcggatgaag tggtaaagcc tcgactaaaa aagaagtaca aatttaccgt tttataccct 840cagccaattc cagaggatga aaagcttgct gaagagctca aagttccaat agaagttgca 900acgaggctaa gagttgtgtg ggatattgta gaaaagcaca agaaggtatt gatctttgtt 960aatacccgac aatttgcaga gatcttaggg catagactta aagcttgggg aaaacctgtt 1020gaagttcacc atggtagcct ttcaagggaa gcaagaatag aggcagagaa gaaacttaag 1080gaaggaaaaa taaaagcact aatttgtacc tcatcaatgg aacttggcat tgacataggg 1140gatgttgatg cagttattca gtacatgagt cctcgacagg taaataggct agtccagaga 1200gctggaagaa gcaaacatag actgtgggaa acaagcgagg cttacatcat aaccacaaac 1260gtagaagatt atctccaaag cttggcaata gcaaagctcg cactagaagg aaaactggaa 1320gatgtaaatc cctacgaaaa tgcccttgat gtcctggctc actttatagt tggtttgaca 1380atagaataca gaaatgttaa cattactgaa ccctattccc ttgcgaaatc tacttatccc 1440tacagaaagc tctcctggga agactatcag aaagttttag agattttaga agaggctaga 1500ataataagaa gagatggaga tgcaattaag ctgggaaaaa atgcctttaa gtattatttc 1560gagaacctct caacaatacc tgacgaaata agttatgcag ttatagatat tgcaagtgga 1620aaatctgttg gaagactaga tgaaaacttt gttacggaac ttgaagagag tatggaattc 1680atcatgcatg gaagaagctg gatcgtgctg gaaattaacg aaaaagaaag gataataaag 1740gttaaggaga gcaacaattt agaaagtgca ctgccaagtt gggaagggga gctcattcca 1800gttcctttgg aagttgcaga atttgttgga aagctgaaga gagagctcct atgggacaaa 1860gagagagcat taaaactgct tgagggcgtt gaatttaata aggaagaact cgaggttgca 1920atttcccaac tagtagaatc agaaccagtg gcgagtgata gagatatcat tatagaatcc 1980tatccaaaat ttgtgataat tcatgctgat tttggaaata aaattaacga agggctcaca 2040agatttatct cagtgttttt atccgcccga tatgggaata ttttcctccc aagaagtcaa 2100gctcatggaa ttataattag aagcccattt aggcttaatc ctgaagaaat aaaggaaata 2160ctgttaatga aagcagaagt tggagatatt gttgctagag gaattagaga cactccaata 2220taccgctgga agatgagtgc aattgctaag agattcggtg ccctaagaag ggacgcgaga 2280ataaaaaaag tagaaaggct gtttgaaggg acaataatag agaaggagac ttttaatgaa 2340atttaccatg ataaaatcga cattgataaa acagagaaaa ttctagaaaa aataagaaag 2400ggagaaatta gaatgaaaac tttgttcaga gaggaaataa cgcctctttc ctcttctttg 2460gcaaccctag gaggagagtt tctaattaga gatatactta cccaggagga agtagaagag 2520atatttaggg agaagttact cgatgctgag ttagtcatgg tttgtacaaa ctgcggattt 2580tcctggagaa caaaagttcg cagggttatg gatagagtca atgagttaag ctgtcccaag 2640tgtgattcca aaatgatagc tcctctacac cccaaagatt ccgaaacttt catctcagct 2700ctcaaaaagt taaaaagagg agaaaagctt agtagggaag aagaaaagta ttaccttaga 2760ggtttaaagg cggctgattt acttaaagcc tacgggaagg acgctctttt agcattagct 2820acctatgggg ttggggtaga aagcgccacc agaatactta gggattatag aggaaaatcc 2880cttataaaag cacttatcga ggcagagaaa cactacatcc aaactagaaa gttttgggaa 2940tag 2943702295DNAArtificial SequenceDescription of Artificial Sequence Recombinant helicase 5 70gtgatgttat taaggagaga cttaatacag cctaggatat atcaagaggt aatatacgcc 60aagtgcaaag aaacaaactg cttgattgtt ctgcccacag gattaggtaa gacgctgata 120gctatgatga tagcagagta tagattaacg aaatatggcg gaaaagttct aatgctcgcc 180cccactaagc ctctcgttct tcaacatgcg gaaagtttta ggaggctatt taacctccct 240ccagaaaaaa ttgtagcact tactggagag aagagcccag aagagagaag taaggcctgg 300gcgagagcaa aagtaattgt agccactcct caaactattg aaaatgactt attggcggga 360agaatatctt tagaagacgt ttcgctaata gtattcgatg aagctcacag agctgtgggc 420aattacgctt acgtctttat agcaagagag tataaaagac aggccaaaaa cccacttgtt 480atagggttaa cagcctcccc tgggagcact cctgaaaaga tcatggaggt aataaataac 540ttgggaattg agcatattga ataccgctcc gaaaattctc ccgatgttag accttacgtt 600aagggaataa ggtttgaatg ggttagggtt gatctcccag aaatatacaa ggaagtaagg 660aaacttttaa gagaaatgct tagagatgcc cttaaaccgt tggcagaaac tggacttctt 720gaatcttctt ccccagacat tccaaagaaa gaagttctta gagctgggca aataataaac 780gaagaaatgg cgaaaggtaa tcatgatctc agaggcttgc ttctctatca cgcaatggct 840cttaagctac atcatgcaat tgagctgttg gaaacccaag ggttatccgc cctgagggct 900tatataaaga agttgtatga ggaggcaaaa gcgggatcaa caaaggctag caaggaaata 960ttctcggata agagaatgaa aaaggcaatc tcacttttag ttcaagcgaa ggagattggg 1020cttgatcacc ccaagatgga caagttaaaa gaaataatta gggaacaact ccaaaggaaa 1080caaaattcca aaatcatagt tttcactaac tacagagaaa ctgcaaaaaa gatagtcaat 1140gaacttgtga aagatggaat aaaagctaaa aggttcgttg gacaggccag caaagaaaat 1200gaccgtggac tgagtcagag agagcagaaa ttaattcttg acgaattcgc tagaggagaa 1260ttcaacgttc tagtggcaac gagtgtagga gaggaaggac ttgacgtgcc ggaagttgat 1320ttggttgtgt tttatgagcc agtaccatct gccataagga gcatccaaag aaggggtaga 1380actggcaggc atatgccggg gagagttata atcctaatgg ccaaggggac tagagatgaa 1440gcatactact ggagttccag gcaaaaggaa aagataatgc aagagacaat agctaaggtg 1500agtcaggcaa ttaaaaagca gaagcaaact tctctagttg attttgtgag agaaaaagag 1560agcgaaaaga cctctctaga caagtggttg aaaaaggaaa aagaagaagc aactgaaaaa 1620gaggaaaaga aggtaaaggc tcaagagggt gtaaaagtcg tcgtagatag cagagagctt 1680aggagtgagg ttgtgaagag acttaaactt cttggtgtaa agttagaggt taaaacgctc 1740gatgtgggag attatataat tagtgaggac gttgcaattg agaggaagtc agctaacgac 1800ttcattcagt caattattga tggtagactt tttgatcaag ttaagaggct caaagaggca 1860tactcaagac cgataatgat agtcgaaggt tctttatacg gaattagaaa cgtccatcca 1920aatgcaataa ggggggcaat agcagcggta accgtagact ttggggtccc aataatattt 1980tcatctactc cagaggaaac cgctcaatac atctttctaa ttgcaaagag ggagcaagag 2040gagagagaaa aacctgtgag aattagaagt gagaagaagg cccttaccct tgccgagagg 2100cagaggttaa tagttgaggg attacctcac gtctcagcaa ctctagctag gagattgttg 2160aagcactttg gaagtgtgga aagggtattc actgcaagcg ttgctgagtt aatgaaagtt 2220gaaggcatag gagagaagat tgctaaggag attagaaggg taataactgc cccatatata 2280gaggatgagg agtag 2295712823DNAArtificial SequenceDescription of Artificial Sequence Recombinant helicase 6 71ttgaaagggt tgtttaggga cgttatcctc cacaaccccc acctttttgt ttattcctat 60tctgataaag gcatcattcc tttcaagcat cagttccaga ccctctatca tgccatgctc 120atgaggccag tgaggctaat gatagctgat gagataggtc tcggaaagac cattcaagct 180cttttaatag ccaagtacct cgattttagg ggagagattg agaaagcctt gatagtcgtt 240ccaaaagttc tgagggagca gtggagggaa gaagtaaaga ggatcttaga ggaagctccg 300gaagtgatag agaatggtag cgaaattgaa tggaagttga aaaggccgag gaagtacttc 360ataatatcaa tagacctagc taagagatac accgaggaaa tactccgtca aaagtgggat 420ttagtaatag ttgacgaagt ccacaacgcc accctgggaa cacagagata tgagttctta 480aaagaactaa ccaagaacaa ggatttgaac gttatattcc tttcagcaac cccccacagg 540ggaaacaata gagattacct tgcgaggctt aggctcctcg acccaactat accagaggaa 600atatccccaa tgcacgaaag gaagatctac atgaagtcaa gagggacatt ggtactaagg 660cgaactaaga aggttgtcaa cgaacttgaa ggagaagtgt tcaagaagtg tcactttggg 720gctgtcgtgg tagaagttag cagagaggag agggagttct ttgaagagtt aaatagagcg 780ctattcgagc tgattaagga tcaagctgat tactctccct taactcttct tgcagtaatc 840attaggaaga gagcctcgtc cagctacgaa gcggctctaa aaaccctaac caggatcgtt 900gaaagcgctt atataagtgg gcaagaaaga gccagaggcg ttgaatcata cattgaaaag 960atctttagaa tggggtatga ggaattggaa atagaagaat ttaacgagat agatgatgcg 1020atacacaaaa taatagatga atatagggga ttcttaactg aagagcaact cgaaaggctt 1080agaagagttc tcgagcttgg aaagaaaatt ggcagcaagg atagcaagct tgaggttata 1140tccgatatag ttgcttatca cattaggaac ggcgaaaagg tcataatatt cacggaattt 1200agagataccc tcgaatacgt

acttgagagg ttaccagata tcctaaggag aaagcacggc 1260attgttttgg aaaaagatga cattgcaaaa cttcatgggg gcatgaaatc tgaggaaata 1320gagagggaaa tcaacaagtt tcatgaaagg gctaacctat tagtctctac ggatgttgca 1380tccgaaggac ttaacctgca cgttgcaagt gttgtaataa actacgaggc cccctggagc 1440ccaataaagc tcgaacagag ggtgggaaga atatggaggc tcaaccaaac gagagaaacc 1500aaagcatata ccatatttct tgcaacggaa acggacttgg atgttctaaa caacctctat 1560agaaagatta tgaacataaa ggaagccgtg ggaagtggac ccattattgg aaggccaata 1620tttgaaggag actttgaaaa tctatggaat gaaggtgccg aggaagaaaa tagagaagtc 1680tcagagtatg agcttatcct agcctcaatt aagggagaac tcaagggcta tgccggggct 1740ctagttagga ctctcagaat cctaaagcag aaagtggagg gagcagttcc tgtaaatcct 1800gcgggaagca taaggagaga gctcgagata attttagagg acactcctga tgtggaagta 1860ttaaagaaaa tcgttaatag gaacgttcca aatccgttcc gcttggtgag aggactttta 1920agagaagccg aggggattga gggaattaga gtattagtta agggctatga tggctctatg 1980gatgtgtact atgccatatt ctacgacgaa gatgggagag aaatttatag atatccaatt 2040cttgctgaga acggaaagta ccttgttgga ttcaacttac tcaagaggat tagtgaggta 2100ctatccaaag agtacaaggt cgttagaggg gcaagtgaag aggtggacta taaagttaag 2160acgctagtta tggacaacat atacaattta atcgtgaaga agtatctgga atacgatagc 2220ttaaacatca aagaaggtaa aatcttcaag aggcttaagg ttgaaataaa gaaagccctc 2280gaggtaaagg ggataagtga agaagaattc gaagtcatca agagagttcc ccctgagatt 2340atggaagttc tagggttaga ttccacaaaa atagaactac ctaccaacga atacctcaag 2400atcttcgaaa ggaactttgt tcctctggat aaaatccttg agagtgaaaa gaaggccatg 2460gaaatagtca tggagctaga gaagagcaga ggatataacg ttgaggacgt atctttaagg 2520gagcactatg acataagggc ctttacagat ggtgaagaga agtacataga ggtcaaaggc 2580cactatccaa tgctcctact tgcggagtta acggaaaagg aatttgagtt cgcacaaaaa 2640aatgaagata agtactggat atacatagtc tcgaacattg ccaaagaccc cgtaattgta 2700aaaatttaca aaccattttc ccaggataga agagtattcg tggttaagaa tggggaagat 2760gttgaggtta atatcaacat tgagataaag aagaaagata ggcatttact taagttaagc 2820tag 2823723837DNAArtificial SequenceDescription of Artificial Sequence Recombinant helicase 7 72gtgattactt tggagctaca tccaagtgag atagctagat atttcgagct tgaagagtgt 60tcccactatt tctctaacct acttttaaga aagagaggcg aattgcagga atttgagccg 120ataataagga gaaaagaaat agaaaccata gagctcgcca aatggggaga cgagttcgag 180ctctcccttc ttcaggaatt taaaaaaggt gaagcattaa aaaagcttgg agttaaagaa 240ctaccaagat tctatggttt tttaacggaa aacgacaccc ctgtaagaaa gttctttgaa 300aagtacttta aagatggaat aatagtggaa gaagatccag acaaactttt agaaattata 360aacagtgaga aaagtgccgt tatctatcaa gcccccttaa aaggcagaat agggaaattt 420gatgtctcag gaagggcaga cttcataata aaggttggga aaacacttta cctactcgag 480gctaagttta ctaaggaaga gaagttctac cacaggattc aggccattat ctatgctcac 540cttctaagtc aaatgatcga aggttacgaa attaaactag ctgttgtaac aaaggagaac 600tttcccattc cctcaaactt cctaagattc ccaggagacg tggaagagtt aaagataacc 660ctagaagaaa agcttggtgg aatactaaga gaacaagaac tttggataga cgcaaggtgt 720actacttgcc cctttgaggc tttatgcttg tctaaggctc ttgaggaaag aagtctagga 780ctattaagcc ttccccctgg gataattaga atactcaaag aagaagggat aaaagactta 840aaagacatgg ctaagctatt tgaattcaaa gaaaattccc ctacaaactt tgaagagccc 900tcaataaaag atccaaagaa gactcaagag atagcaaaaa gaacgggaat aaacttacta 960aagctctcaa ggatagctca ggcaatcctt aaatatttag atgagggaga aacaacaccc 1020ctgttcatcc ccaggacggg gtataatctg ccaatggatg agagagtagg tgatgttgag 1080ccctcttact atcctccaag gagcttagtg aaagtgttct tctatgtcca gacaagccca 1140ataacagaca caataatcgg aatttcagcc cttgtaaaga ataggcaaaa tggagagcgg 1200ataattgtta agttcgtcga tgagcccccc atagaagttt cagatgccca agaaaaggag 1260agaatgcttc taattgagtt ctttagggat gttattgatg ccgtaaagtc actatctcca 1320accgataaag tctacctaca catgtacttt tacaatagaa aacagagaga tgaccttatg 1380gatgccgtaa agagacacaa agagataaga gaaaacaatg cagtcatggc cttgctaagc 1440ttgagaagag ccatagattg ggagagcttt tcaataataa aggatgagat aataaggagg 1500catgccttac cactttctcc tggcctggga ttcgttacag ttgctactca gtttggatac 1560agatggagaa ggaacaaaac ctttgcgcga atgcttgagg ttgtagcaag aagagaaaat 1620ggtaagataa atctcaaaac tctccttaac atttctgaaa cgggaattgg gccagaatat 1680tatccaatca tcgataggga taacgaagga atacccttca cacttttctg gagcgcactg 1740gtcaaattag ctactgagga agacaattca agaattaaga gggatataag ggacatactc 1800tcccaaatgg ttgaggccct caaaacaatt gaagagagaa ttcccgagca atataaagac 1860gccttcgtga aaaaagaggg aatacccaaa gaagatctcg aaaactttga cataaagaag 1920gaagaattag ctgatatcct tcttgaatac ttacaattag agttcgatgc aagatttaga 1980gaacgatccg aatactatag gcttccccta tcaataagag catactcaga ggaatcagca 2040ctaattaaga tagaaaacat tgaaaagaag aaaaatgact gtctgttgtt tggaaaaatc 2100gtgctaattg acgaaaatgg aagaataaaa gagtataatc caaaagaagt tcttatagat 2160attgatgaag gttctcttgt agttgtaacg ccaaagaaat tcttagataa gctaagaaga 2220gatcccgttc aaagaataag caaatcaccg ttaggaatag ttgaggctat agatcacgag 2280acaggaaaag ttgttataag gttaataaga gtctctccag gcagatttac actcaaacac 2340tctaagttta gttgtaaaaa tggactattg acaataacct atcctgaagg ggaagtgaaa 2400gttactcctg gagagatagt tatagtagat cctagcgtcg atgacatagg aatggaaagg 2460gcatacaatg tgctctcaga aatatcccaa ggggaactca agcatgaaat ttatcagaag 2520gtcaaagcaa tatacgaagg gaacacggaa tcaagatacg aagtcaacat ctggaagaaa 2580aagcacatag aagaatttct ctccagagtt aagaagatca acgaagaaca gaaaaagttt 2640gcaattgaca taaacaactt tctagtcacc cttcaaggcc cccctgggac tgggaagaca 2700tcaggggcca tagccccagc aattctcgca agagcatatt caatggtgaa ggacaaaaag 2760aatggcctct ttgtagttac tggagtctca cacagggcag ttaatgaggc cctgataaag 2820actttaaagc taaagaaaga gctggagaat acattaaaag agcttagaaa gatagatcta 2880attagagcag tctctgggga agaggcaatc aaaataatta aagaggaact agagagggaa 2940ataaaggatg atgtcgacag aattagattt acagcacaag aaattaccca ctcttcaaag 3000caaagatcat tagacaaata ttttgctaat tctggaactg tgaggatagt atttggaaca 3060ccacagactt tgaacaagct tatgaagaat acaaaagaag tcgaactagt tgtcatagat 3120gaagctagta tgatggactt accaatgttc ttcctctcaa caaaagtttg taaaggtcaa 3180gttctcttgg tcggggatca caggcagatg gagccaattc aagtccatga atggcaatta 3240gaggacagaa agacatttga agagcactat ccattccttt cagcccttaa cttcattaga 3300tttctcaggg gagagttgga tgaaagagaa cttaagaagt ttaagagaat ccttggaagg 3360gaacctccag aatggaagaa ggacaagaac gaggttctcc ctctctatag gttagtaaga 3420acttataggt tgccccagga aatagctgat ctactgagtg atgcaatata cagagcagat 3480ggcataaaat tgattagtga aaagaaaaag aggagaaaga taattgccag gcacaaggat 3540gagtttctat cgatagtttt agatgacagg tatcctttcg ttctaatact tcatgacgag 3600ggcaattcca caaagattaa cgagctggaa gcaaagatag tagagaagat aatcaaaaga 3660gtagagaata ttgatatagg agttgtagtt ccatatagag ctcaaaagag attaatagct 3720tcattaatag atagtgccca ggtggacaca gttgagagat tccaaggggg agagaaatct 3780ttaatagtaa tttcaatgac ttccagcgac ccccgcatac ctgggaaagg tttttga 3837731968DNAArtificial SequenceDescription of Artificial Sequence Recombinant helicase dna2 73atgaacataa agagcttcat aaacaggctt aaggagctag ttgaaatcga gagggaagct 60gaaatagagg ctatgaggtt ggagatgaaa aggcttagcg gagtggagag ggagaggtta 120ggtagggcaa ttctcagctt aaacggtaaa atcgttggtg aagagctcgg ttatttcttg 180gttaagtacg gaaggaataa ggagataaag accgagatca gcgttgggga tttggttgtt 240ataagcaaga gggatcccct gaagagcgac ctcctgggaa ctgttgttga gaaggggaag 300agattcatcg tcgttgcctt agaaccagtc ccagagtggg cccttagaga tgtgaggata 360gacctctacg ccaacgatat aacattcaag aggtggatcg aaaacctcga cagggttagg 420aaggctggaa aaaaggcttt agagttttac ttaggtttag atgagccttc ccagggggag 480gaagtgagct ttgaaccctt tgataagagc ctaaacccct ctcaaaggaa agcgatagct 540aaggctttag gtagtgaaga cttcttcctt atccacggcc cctttggaac tggaaagacg 600aggactttag ttgagctgat taggcaggag gtaaagaggg ggaacaaagt tctagctaca 660gctgagagca acgttgccgt ggacaattta gttgaaagat tggccaaaga tggagttaag 720atagttaggg ttgggcaccc aagtagggtt tcgaggcatt tgcacgagac aactttagct 780tacctcatta ctcagcacga gctctacggt gagcttaggg agcttagggt gatagggcag 840agtttggcag agaagaggga cacatataca aagccgactc caaagttcag gaggggactg 900agtgatgctg agataattaa gttggccgag aagggaagag gggctagagg actctcagct 960agactaataa aggagatggc cgagtggata aagctaaaca ggcaggttca gaaggccttt 1020gaagatgcta gaaagcttga ggagaggatt gcgagggata taattaggga agccgatgtg 1080gttttgacaa ctaactcttc tgcagccctt gatgttgttg atgctaccga ttatgatgtt 1140gcgataatag atgaagcaac tcaggcaact ataccgagca tattaatacc tctcaacaag 1200gttgataggt ttatacttgc tggagaccac aagcaactac caccaactat cttaagcttg 1260gaggcccagg agctctccca cacgcttttc gagggtttaa ttgagaagta cccatggaag 1320agcgaaatgc tgacaattca gtataggatg aatgagagga taatggagtt tccgagcagg 1380gagttttacg atggaagaat agttgctgat gaaagtgtaa aaaacataac tctggccgac 1440ctgggaatta aagttaatgc tagtggaata tggagggaca tcctagatcc aaacaacgtc 1500ctcgtgttca tagatacttg catgctcgaa aataggttcg agaggcagag aaggggaagc 1560gaaagcaggg agaatccctt ggaggccaag atagtgagca aaatcgttga aaagctcttg 1620gaaagtgggg ttaaagcgga aatgatggga gtgattacac cttacgatga ccagagggat 1680ttgataagct tgaatgttcc cgaagaagtt gaggtcaaga ctgtggatgg ttaccaggga 1740agggagaagg aagtgataat tctatcattt gtccgctcta acaaagcggg agagatcggc 1800tttctcaagg acttgaggag gctaaacgtg tccttaacta gggctaagag gaagcttatc 1860atgattggcg attcctcaac gctttcatct cacgaaacct acaggaggtt aatcgagcac 1920gtgagggaga aggggttata tgttgtgcta acgaaggata gcatttga 196874867PRTArtificial SequenceDescription of Artificial Sequence Helicase 2 74Met Ile Glu Glu Leu Phe Lys Gly Leu Glu Ser Glu Ile Val Gly Leu 1 5 10 15His Glu Ile Pro Pro Lys Arg Gly Glu Tyr Gly Glu Phe Lys Phe Arg 20 25 30Asn Glu Glu Val Asn Glu Leu Val Lys Arg Leu Gly Phe Arg Leu Tyr 35 40 45Ser His Gln Val Lys Ala Leu Glu Lys Leu Tyr Ser Gly Lys Asn Val 50 55 60Val Val Ser Thr Pro Thr Ala Ser Gly Lys Ser Glu Ile Phe Arg Leu 65 70 75 80Phe Ile Phe Asp Glu Ile Leu Ser Ser Pro Ser Ser Thr Phe Leu Leu 85 90 95Ile Tyr Pro Thr Arg Ala Leu Ile Asn Asn Gln Met Glu Lys Phe Glu 100 105 110Lys Glu Asn Thr Ile Phe Glu Glu Ile Cys Gly Lys Arg Val Arg Ala 115 120 125Glu Val Leu Thr Gly Asp Thr Glu Trp Glu Lys Arg Arg Glu Ile Ile 130 135 140Arg Ser Lys Pro Asn Val Ile Phe Thr Thr Pro Asp Met Leu His His145 150 155 160His Ile Leu Pro Arg Trp Arg Asp Tyr Phe Trp Leu Leu Lys Gly Leu 165 170 175Arg Leu Leu Val Val Asp Glu Leu His Val Tyr Arg Gly Ile Phe Gly 180 185 190Thr Asn Val Ala Tyr Val Phe Lys Arg Leu Phe Leu Arg Leu Lys Arg 195 200 205Leu Ser Ser Ser Pro Gln Ile Leu Ala Leu Ser Ala Thr Leu Arg Asn 210 215 220Pro Lys Glu Phe Ala Glu Gln Phe Phe Glu Thr Glu Phe Glu Glu Val225 230 235 240Lys Glu Ala Gly Ser Pro Ser Pro Arg Arg Ile Ile Val Met Phe Glu 245 250 255Pro Arg Arg Phe Thr Gly Glu Gln Leu Ile Lys Gln Ile Val Glu Arg 260 265 270Leu Thr Arg Lys Asn Ile Lys Thr Leu Val Phe Phe Asp Ser Arg Lys 275 280 285Gly Thr Glu Arg Ile Met Arg Leu Phe Leu Phe Ser Asp Ala Phe Asp 290 295 300Arg Ile Thr Thr Tyr Lys Gly Thr Leu Thr Lys Arg Glu Arg Phe Leu305 310 315 320Ile Glu Arg Asp Phe Arg Glu Gly Asn Leu Thr Val Leu Leu Thr Thr 325 330 335Asn Ala Leu Glu Leu Gly Ile Asp Ile Gly Asp Leu Asp Ala Val Ile 340 345 350Asn Tyr Gly Ile Pro Ser Asp Gly Leu Phe Ser Leu Ile Gln Arg Phe 355 360 365Gly Arg Ala Gly Arg Asp Pro Asn Arg Ile Ala Ile Asn Gly Ile Ile 370 375 380Leu Arg Arg Asn Gly Leu Asp Tyr Tyr Tyr Lys Glu His Phe Asp Glu385 390 395 400Leu Val Glu Gly Ile Glu Lys Gly Leu Val Glu Lys Ile Pro Val Asn 405 410 415Leu Asp Asn Glu Lys Ile Ala Lys Lys His Leu His Tyr Ala Ile Ala 420 425 430Glu Leu Gly Val Val Ser Ile Lys Glu Ile Glu Gly Arg Trp Lys Arg 435 440 445Phe Ile Lys Thr Leu Val Glu Glu Gly Tyr Val Glu Val Thr Arg Asn 450 455 460Pro Ile Thr Gly Glu Glu Glu Ile Arg Leu Arg Arg Pro Pro Val Tyr465 470 475 480Ser Ser Ile Arg Thr Ala Ser Asp Glu Ser Tyr Phe Leu Val Val Asp 485 490 495Glu Pro Trp Ile Arg Gly Ala Leu Gln Arg Lys Arg Gly Ala Glu Leu 500 505 510Leu Arg Phe Val Asn Tyr Leu Lys Val Arg Gly Met Val Val Glu Glu 515 520 525Val Asp Glu Ile Glu Phe His Arg Ser Leu Leu Pro Gly Met Val Tyr 530 535 540Leu Ser Arg Gly Arg Pro Tyr Met Ala Val Asp Lys Ile Lys Ile Glu545 550 555 560Lys Phe His Phe Val Phe Ala Arg Pro Leu Pro Ile Glu Glu Glu Ile 565 570 575Asp Thr Ser Ser Ser Lys Ile Glu Asn Ile Glu Ile Leu Glu Val Lys 580 585 590Asp Glu Lys Thr Val Gly Pro Ile Lys Val Lys Phe Gly Arg Leu Arg 595 600 605Val Arg His Glu Tyr Thr Gly Tyr Ala Val Arg Gly Arg Asp Val Glu 610 615 620Arg His Val Lys Arg Leu Glu Glu Leu Lys Asp Glu Gly Ile Leu Arg625 630 635 640Gly Glu Ile Asp Ile Val Pro Tyr Ile Trp Glu Ser Trp Lys Phe Ala 645 650 655Arg Val Leu Phe Asp Thr Pro Tyr Ile Arg Glu Phe Glu Thr Glu Gly 660 665 670Phe Trp Leu Glu Phe Pro Asn Asp Ile Arg Ile Val Pro Glu Glu Glu 675 680 685Phe Arg Glu Phe Phe Ala Val Ala Ser Glu Ile Asp Pro Glu Leu Ala 690 695 700Met Phe Leu Tyr Asn Arg Ile Ser Arg Lys Ser Leu Phe Pro Thr Leu705 710 715 720Leu Gly Ala Thr Thr His Tyr Ile Arg Ser Phe Ile Leu His His Ala 725 730 735Lys Asp Lys Gly Glu Glu Phe Ala Phe Ala Val Lys Lys Met Ile Asp 740 745 750Ser Lys Asp Gly Ile Gly Ser Gly Leu His Ala Ile Glu Pro Asn Ile 755 760 765Ile Lys Leu Ala Pro Val Val Thr His Val Asp Ser Arg Glu Ile Gly 770 775 780Gly Tyr Ser Tyr Asp Asp Phe His Gly Lys Pro Val Ile Phe Ile Tyr785 790 795 800Asp Gly Asn Glu Gly Gly Ser Gly Ile Ile Arg Gln Val Tyr Glu Asn 805 810 815Val Glu Lys Leu Met Tyr Arg Ser Leu Glu His Ile Lys Lys Cys Pro 820 825 830Cys Lys Asp Gly Cys Pro Ala Cys Ile Tyr Ser Pro Lys Cys Gly Thr 835 840 845Phe Asn Glu Phe Leu Asp Lys Trp Met Ala Ile Arg Ile Trp Glu Lys 850 855 860Val Leu Pro86575836PRTArtificial SequenceDescription of Artificial Sequence Helicase 3 75Met Leu Ile Val Val Arg Pro Gly Arg Lys Lys Asn Glu Leu Glu Ala 1 5 10 15Phe Ile Ile Glu Asn Pro Pro Glu Lys Leu Ser Gln Arg Arg Asn Leu 20 25 30Lys Ala Asp Arg Val Val Arg Leu Ile Met Arg Asp Asn Arg Leu Phe 35 40 45Lys Ala Leu Glu Gly Ser Gln Tyr Leu Asn Pro Lys Glu Val Glu Arg 50 55 60Ala Leu Arg Asn Ser Arg Ile Val Leu Val Asn Ala Asn Glu Trp Glu 65 70 75 80Glu Tyr Phe Lys Lys Arg Leu Met Asn Lys Arg Val Glu Lys Ala Asp 85 90 95Ile Cys Arg Leu Cys Leu Leu Asn Gly Lys Ile Thr Val Leu Thr Glu 100 105 110Gly Asn Arg Ile Arg Tyr Arg Asp Glu Tyr Ile Cys Glu Ser Cys Ala 115 120 125Glu Glu Glu Leu Lys Arg Glu Leu Arg Phe Arg Phe Asn Ser Ile Gly 130 135 140Met Leu Glu Gln Ala Lys Lys Leu Leu Glu Arg Phe Arg Asp Leu Asp145 150 155 160Lys Val Ile Ser Ile Phe Asp Pro Ser Phe Asp Pro Thr Lys His Pro 165 170 175Glu Ile Thr Lys Trp Asp Glu Leu Lys Ala Lys His Ile Arg Val Glu 180 185 190Lys Met His Ile Asp Glu Leu Asn Ile Pro Glu Glu Phe Lys Lys Val 195 200 205Leu Lys Ala Glu Gly Ile Asn Glu Leu Leu Pro Val Gln Val Leu Ala 210 215 220Ile Lys Asn Gly Leu Leu Glu Gly Glu Asn Leu Leu Val Val Ser Ala225 230 235 240Thr Ala Ser Gly Lys Thr Leu Ile Gly Glu Leu Ala Gly Ile Pro Lys 245 250 255Ala Leu Lys Gly Lys Lys Met Leu Phe Leu Val Pro Leu Val Ala Leu 260 265 270Ala Asn Gln Lys Tyr Glu Asp Phe Lys Arg Arg Tyr Ser Lys Leu Gly 275 280 285Leu Lys Val Ala Ile Arg Val Gly Met Ser Arg Ile Lys Thr Lys Glu 290 295 300Glu Pro Ile Val Leu Asp Thr Gly Thr Asp Ala His Ile Ile Val Gly305 310 315 320Thr Tyr Glu Gly Ile Asp Tyr Leu Leu Arg Ala Gly Lys Lys Ile Gly

325 330 335Asn Val Gly Thr Val Val Ile Asp Glu Ile His Met Leu Asp Asp Glu 340 345 350Glu Arg Gly Ala Arg Leu Asp Gly Leu Ile Ala Arg Leu Arg Lys Leu 355 360 365Tyr Ser Asn Ala Gln Phe Ile Gly Leu Ser Ala Thr Val Gly Asn Pro 370 375 380Gln Glu Leu Ala Arg Lys Leu Gly Met Lys Leu Val Leu Tyr Asp Glu385 390 395 400Arg Pro Val Asp Leu Glu Arg His Leu Ile Ile Ala Arg Asn Glu Ser 405 410 415Glu Lys Trp Arg Tyr Ile Ala Lys Leu Cys Lys Ala Glu Ala Met Arg 420 425 430Lys Ser Glu Lys Gly Phe Lys Gly Gln Thr Ile Val Phe Thr Phe Ser 435 440 445Arg Arg Arg Cys His Glu Leu Ala Ser Phe Leu Thr Gly Gln Gly Leu 450 455 460Lys Ala Lys Ala Tyr His Ser Gly Leu Pro Tyr Val Gln Arg Lys Leu465 470 475 480Thr Glu Met Glu Phe Gln Ala Gln Met Ile Asp Val Val Val Thr Thr 485 490 495Ala Ala Leu Gly Ala Gly Val Asp Phe Pro Ala Ser Gln Val Ile Phe 500 505 510Glu Ser Leu Ala Met Gly Asn Lys Trp Ile Thr Val Arg Glu Phe His 515 520 525Gln Met Leu Gly Arg Ala Gly Arg Pro Gln Tyr His Glu Lys Gly Lys 530 535 540Val Tyr Ile Ile Val Glu Pro Gly Lys Lys Tyr Ser Ala Gln Met Glu545 550 555 560Gly Thr Glu Asp Glu Val Ala Leu Lys Leu Leu Thr Ser Pro Ile Glu 565 570 575Pro Val Ile Val Glu Trp Ser Asp Glu Phe Glu Glu Asp Asn Val Leu 580 585 590Ala His Ala Cys Val Phe Asn Arg Leu Lys Val Ile Glu Glu Val Gln 595 600 605Ser Leu Cys Leu Gly Ala Asn Gln Ser Ala Lys Asn Val Leu Glu Lys 610 615 620Leu Met Glu Lys Gly Leu Val Lys Ile Tyr Gly Asp Lys Val Glu Ala625 630 635 640Thr Pro Tyr Gly Arg Ala Val Ser Met Ser Phe Leu Leu Pro Arg Glu 645 650 655Ala Glu Phe Ile Arg Asp Asn Leu Glu Ser Thr Asp Pro Ile Glu Ile 660 665 670Ala Ile Lys Leu Leu Pro Phe Glu Asn Val Tyr Leu Pro Gly Ser Leu 675 680 685Gln Arg Glu Ile Glu Ser Ala Val Arg Gly Lys Ile Ser Ser Asn Ile 690 695 700Phe Ser Ser Ser Phe Ala Ser Val Leu Glu Glu Leu Asp Lys Ile Ile705 710 715 720Pro Glu Ile Ser Pro Asn Ala Ala Glu Arg Leu Phe Leu Ile Tyr Gln 725 730 735Asp Phe Phe Asn Cys Pro Glu Gln Asp Cys Thr Glu Phe Ala Met Glu 740 745 750Arg Ile Gly Arg Lys Ile Ile Asp Leu Arg Arg Glu Gly Tyr Glu Pro 755 760 765Ser Lys Ile Ser Glu His Phe Arg Lys Val Tyr Ala Leu Ile Leu Tyr 770 775 780Pro Gly Asp Val Phe Thr Trp Leu Asp Gly Ile Val Arg Lys Leu Glu785 790 795 800Ala Ile Glu Arg Ile Ala Arg Val Phe Asn Lys Arg Arg Val Val Glu 805 810 815Asp Thr Ile Arg Val Arg Arg Glu Ile Glu Glu Gly Lys Ile Leu Lys 820 825 830Gly Glu Arg Arg 83576980PRTArtificial SequenceDescription of Artificial Sequence Helicase 4 76Met His Lys Tyr Phe Phe Pro Leu Pro Ala Thr Lys Ser Thr Phe Leu 1 5 10 15Leu Pro Ala Asp Leu Thr Thr Ala Asn Pro Cys Phe Ser Lys Ser Leu 20 25 30Ile Asn Ser Leu Ser Ala Trp Ala Pro Phe Leu Tyr Ile Gln Cys Phe 35 40 45Ser Tyr Leu Pro Leu Ile Asn Phe Leu Asn Ser Leu Thr Tyr Pro Leu 50 55 60Glu Met His Ile Leu Ile Lys Lys Ala Ile Lys Glu Arg Phe Gly Lys 65 70 75 80Leu Asn Ala Leu Gln Gln Leu Ala Phe His Lys Ile Arg Gly Glu Gly 85 90 95Lys Ser Val Leu Ile Ile Ala Pro Thr Gly Ser Gly Lys Thr Glu Ala 100 105 110Ala Val Ile Pro Ile Leu Asp Ala Ile Leu Arg Glu Asn Leu Lys Pro 115 120 125Ile Ala Ala Ile Tyr Ile Ala Pro Leu Lys Ala Leu Asn Arg Asp Leu 130 135 140Leu Glu Arg Leu Lys Trp Trp Glu Glu Lys Thr Gly Val Ile Ile Glu145 150 155 160Val Arg His Gly Asp Thr Pro Thr Ser Lys Arg Leu Lys Gln Val Lys 165 170 175Asn Pro Pro His Leu Leu Ile Thr Thr Pro Glu Met Leu Pro Ala Ile 180 185 190Leu Thr Thr Lys Ser Phe Arg Pro Tyr Leu Lys Asn Thr Lys Phe Ile 195 200 205Val Ile Asp Glu Ile Gly Glu Leu Ile Glu Asn Lys Arg Gly Thr Gln 210 215 220Leu Ile Leu Asn Leu Lys Arg Leu Glu Leu Ile Thr Glu Asp Lys Pro225 230 235 240Ile Arg Ile Gly Leu Ser Ala Thr Ile Gly Ser Glu Glu Lys Val Arg 245 250 255Leu Trp Met Glu Ala Asp Glu Val Val Lys Pro Arg Leu Lys Lys Lys 260 265 270Tyr Lys Phe Thr Val Leu Tyr Pro Gln Pro Ile Pro Glu Asp Glu Lys 275 280 285Leu Ala Glu Glu Leu Lys Val Pro Ile Glu Val Ala Thr Arg Leu Arg 290 295 300Val Val Trp Asp Ile Val Glu Lys His Lys Lys Val Leu Ile Phe Val305 310 315 320Asn Thr Arg Gln Phe Ala Glu Ile Leu Gly His Arg Leu Lys Ala Trp 325 330 335Gly Lys Pro Val Glu Val His His Gly Ser Leu Ser Arg Glu Ala Arg 340 345 350Ile Glu Ala Glu Lys Lys Leu Lys Glu Gly Lys Ile Lys Ala Leu Ile 355 360 365Cys Thr Ser Ser Met Glu Leu Gly Ile Asp Ile Gly Asp Val Asp Ala 370 375 380Val Ile Gln Tyr Met Ser Pro Arg Gln Val Asn Arg Leu Val Gln Arg385 390 395 400Ala Gly Arg Ser Lys His Arg Leu Trp Glu Thr Ser Glu Ala Tyr Ile 405 410 415Ile Thr Thr Asn Val Glu Asp Tyr Leu Gln Ser Leu Ala Ile Ala Lys 420 425 430Leu Ala Leu Glu Gly Lys Leu Glu Asp Val Asn Pro Tyr Glu Asn Ala 435 440 445Leu Asp Val Leu Ala His Phe Ile Val Gly Leu Thr Ile Glu Tyr Arg 450 455 460Asn Val Asn Ile Thr Glu Pro Tyr Ser Leu Ala Lys Ser Thr Tyr Pro465 470 475 480Tyr Arg Lys Leu Ser Trp Glu Asp Tyr Gln Lys Val Leu Glu Ile Leu 485 490 495Glu Glu Ala Arg Ile Ile Arg Arg Asp Gly Asp Ala Ile Lys Leu Gly 500 505 510Lys Asn Ala Phe Lys Tyr Tyr Phe Glu Asn Leu Ser Thr Ile Pro Asp 515 520 525Glu Ile Ser Tyr Ala Val Ile Asp Ile Ala Ser Gly Lys Ser Val Gly 530 535 540Arg Leu Asp Glu Asn Phe Val Thr Glu Leu Glu Glu Ser Met Glu Phe545 550 555 560Ile Met His Gly Arg Ser Trp Ile Val Leu Glu Ile Asn Glu Lys Glu 565 570 575Arg Ile Ile Lys Val Lys Glu Ser Asn Asn Leu Glu Ser Ala Leu Pro 580 585 590Ser Trp Glu Gly Glu Leu Ile Pro Val Pro Leu Glu Val Ala Glu Phe 595 600 605Val Gly Lys Leu Lys Arg Glu Leu Leu Trp Asp Lys Glu Arg Ala Leu 610 615 620Lys Leu Leu Glu Gly Val Glu Phe Asn Lys Glu Glu Leu Glu Val Ala625 630 635 640Ile Ser Gln Leu Val Glu Ser Glu Pro Val Ala Ser Asp Arg Asp Ile 645 650 655Ile Ile Glu Ser Tyr Pro Lys Phe Val Ile Ile His Ala Asp Phe Gly 660 665 670Asn Lys Ile Asn Glu Gly Leu Thr Arg Phe Ile Ser Val Phe Leu Ser 675 680 685Ala Arg Tyr Gly Asn Ile Phe Leu Pro Arg Ser Gln Ala His Gly Ile 690 695 700Ile Ile Arg Ser Pro Phe Arg Leu Asn Pro Glu Glu Ile Lys Glu Ile705 710 715 720Leu Leu Met Lys Ala Glu Val Gly Asp Ile Val Ala Arg Gly Ile Arg 725 730 735Asp Thr Pro Ile Tyr Arg Trp Lys Met Ser Ala Ile Ala Lys Arg Phe 740 745 750Gly Ala Leu Arg Arg Asp Ala Arg Ile Lys Lys Val Glu Arg Leu Phe 755 760 765Glu Gly Thr Ile Ile Glu Lys Glu Thr Phe Asn Glu Ile Tyr His Asp 770 775 780Lys Ile Asp Ile Asp Lys Thr Glu Lys Ile Leu Glu Lys Ile Arg Lys785 790 795 800Gly Glu Ile Arg Met Lys Thr Leu Phe Arg Glu Glu Ile Thr Pro Leu 805 810 815Ser Ser Ser Leu Ala Thr Leu Gly Gly Glu Phe Leu Ile Arg Asp Ile 820 825 830Leu Thr Gln Glu Glu Val Glu Glu Ile Phe Arg Glu Lys Leu Leu Asp 835 840 845Ala Glu Leu Val Met Val Cys Thr Asn Cys Gly Phe Ser Trp Arg Thr 850 855 860Lys Val Arg Arg Val Met Asp Arg Val Asn Glu Leu Ser Cys Pro Lys865 870 875 880Cys Asp Ser Lys Met Ile Ala Pro Leu His Pro Lys Asp Ser Glu Thr 885 890 895Phe Ile Ser Ala Leu Lys Lys Leu Lys Arg Gly Glu Lys Leu Ser Arg 900 905 910Glu Glu Glu Lys Tyr Tyr Leu Arg Gly Leu Lys Ala Ala Asp Leu Leu 915 920 925Lys Ala Tyr Gly Lys Asp Ala Leu Leu Ala Leu Ala Thr Tyr Gly Val 930 935 940Gly Val Glu Ser Ala Thr Arg Ile Leu Arg Asp Tyr Arg Gly Lys Ser945 950 955 960Leu Ile Lys Ala Leu Ile Glu Ala Glu Lys His Tyr Ile Gln Thr Arg 965 970 975Lys Phe Trp Glu 98077764PRTArtificial SequenceDescription of Artificial Sequence Helicase 5 77Val Met Leu Leu Arg Arg Asp Leu Ile Gln Pro Arg Ile Tyr Gln Glu 1 5 10 15Val Ile Tyr Ala Lys Cys Lys Glu Thr Asn Cys Leu Ile Val Leu Pro 20 25 30Thr Gly Leu Gly Lys Thr Leu Ile Ala Met Met Ile Ala Glu Tyr Arg 35 40 45Leu Thr Lys Tyr Gly Gly Lys Val Leu Met Leu Ala Pro Thr Lys Pro 50 55 60Leu Val Leu Gln His Ala Glu Ser Phe Arg Arg Leu Phe Asn Leu Pro 65 70 75 80Pro Glu Lys Ile Val Ala Leu Thr Gly Glu Lys Ser Pro Glu Glu Arg 85 90 95Ser Lys Ala Trp Ala Arg Ala Lys Val Ile Val Ala Thr Pro Gln Thr 100 105 110Ile Glu Asn Asp Leu Leu Ala Gly Arg Ile Ser Leu Glu Asp Val Ser 115 120 125Leu Ile Val Phe Asp Glu Ala His Arg Ala Val Gly Asn Tyr Ala Tyr 130 135 140Val Phe Ile Ala Arg Glu Tyr Lys Arg Gln Ala Lys Asn Pro Leu Val145 150 155 160Ile Gly Leu Thr Ala Ser Pro Gly Ser Thr Pro Glu Lys Ile Met Glu 165 170 175Val Ile Asn Asn Leu Gly Ile Glu His Ile Glu Tyr Arg Ser Glu Asn 180 185 190Ser Pro Asp Val Arg Pro Tyr Val Lys Gly Ile Arg Phe Glu Trp Val 195 200 205Arg Val Asp Leu Pro Glu Ile Tyr Lys Glu Val Arg Lys Leu Leu Arg 210 215 220Glu Met Leu Arg Asp Ala Leu Lys Pro Leu Ala Glu Thr Gly Leu Leu225 230 235 240Glu Ser Ser Ser Pro Asp Ile Pro Lys Lys Glu Val Leu Arg Ala Gly 245 250 255Gln Ile Ile Asn Glu Glu Met Ala Lys Gly Asn His Asp Leu Arg Gly 260 265 270Leu Leu Leu Tyr His Ala Met Ala Leu Lys Leu His His Ala Ile Glu 275 280 285Leu Leu Glu Thr Gln Gly Leu Ser Ala Leu Arg Ala Tyr Ile Lys Lys 290 295 300Leu Tyr Glu Glu Ala Lys Ala Gly Ser Thr Lys Ala Ser Lys Glu Ile305 310 315 320Phe Ser Asp Lys Arg Met Lys Lys Ala Ile Ser Leu Leu Val Gln Ala 325 330 335Lys Glu Ile Gly Leu Asp His Pro Lys Met Asp Lys Leu Lys Glu Ile 340 345 350Ile Arg Glu Gln Leu Gln Arg Lys Gln Asn Ser Lys Ile Ile Val Phe 355 360 365Thr Asn Tyr Arg Glu Thr Ala Lys Lys Ile Val Asn Glu Leu Val Lys 370 375 380Asp Gly Ile Lys Ala Lys Arg Phe Val Gly Gln Ala Ser Lys Glu Asn385 390 395 400Asp Arg Gly Leu Ser Gln Arg Glu Gln Lys Leu Ile Leu Asp Glu Phe 405 410 415Ala Arg Gly Glu Phe Asn Val Leu Val Ala Thr Ser Val Gly Glu Glu 420 425 430Gly Leu Asp Val Pro Glu Val Asp Leu Val Val Phe Tyr Glu Pro Val 435 440 445Pro Ser Ala Ile Arg Ser Ile Gln Arg Arg Gly Arg Thr Gly Arg His 450 455 460Met Pro Gly Arg Val Ile Ile Leu Met Ala Lys Gly Thr Arg Asp Glu465 470 475 480Ala Tyr Tyr Trp Ser Ser Arg Gln Lys Glu Lys Ile Met Gln Glu Thr 485 490 495Ile Ala Lys Val Ser Gln Ala Ile Lys Lys Gln Lys Gln Thr Ser Leu 500 505 510Val Asp Phe Val Arg Glu Lys Glu Ser Glu Lys Thr Ser Leu Asp Lys 515 520 525Trp Leu Lys Lys Glu Lys Glu Glu Ala Thr Glu Lys Glu Glu Lys Lys 530 535 540Val Lys Ala Gln Glu Gly Val Lys Val Val Val Asp Ser Arg Glu Leu545 550 555 560Arg Ser Glu Val Val Lys Arg Leu Lys Leu Leu Gly Val Lys Leu Glu 565 570 575Val Lys Thr Leu Asp Val Gly Asp Tyr Ile Ile Ser Glu Asp Val Ala 580 585 590Ile Glu Arg Lys Ser Ala Asn Asp Phe Ile Gln Ser Ile Ile Asp Gly 595 600 605Arg Leu Phe Asp Gln Val Lys Arg Leu Lys Glu Ala Tyr Ser Arg Pro 610 615 620Ile Met Ile Val Glu Gly Ser Leu Tyr Gly Ile Arg Asn Val His Pro625 630 635 640Asn Ala Ile Arg Gly Ala Ile Ala Ala Val Thr Val Asp Phe Gly Val 645 650 655Pro Ile Ile Phe Ser Ser Thr Pro Glu Glu Thr Ala Gln Tyr Ile Phe 660 665 670Leu Ile Ala Lys Arg Glu Gln Glu Glu Arg Glu Lys Pro Val Arg Ile 675 680 685Arg Ser Glu Lys Lys Ala Leu Thr Leu Ala Glu Arg Gln Arg Leu Ile 690 695 700Val Glu Gly Leu Pro His Val Ser Ala Thr Leu Ala Arg Arg Leu Leu705 710 715 720Lys His Phe Gly Ser Val Glu Arg Val Phe Thr Ala Ser Val Ala Glu 725 730 735Leu Met Lys Val Glu Gly Ile Gly Glu Lys Ile Ala Lys Glu Ile Arg 740 745 750Arg Val Ile Thr Ala Pro Tyr Ile Glu Asp Glu Glu 755 76078940PRTArtificial SequenceDescription of Artificial Sequence Helicase 6 78Leu Lys Gly Leu Phe Arg Asp Val Ile Leu His Asn Pro His Leu Phe 1 5 10 15Val Tyr Ser Tyr Ser Asp Lys Gly Ile Ile Pro Phe Lys His Gln Phe 20 25 30Gln Thr Leu Tyr His Ala Met Leu Met Arg Pro Val Arg Leu Met Ile 35 40 45Ala Asp Glu Ile Gly Leu Gly Lys Thr Ile Gln Ala Leu Leu Ile Ala 50 55 60Lys Tyr Leu Asp Phe Arg Gly Glu Ile Glu Lys Ala Leu Ile Val Val 65 70 75 80Pro Lys Val Leu Arg Glu Gln Trp Arg Glu Glu Val Lys Arg Ile Leu 85 90 95Glu Glu Ala Pro Glu Val Ile Glu Asn Gly Ser Glu Ile Glu Trp Lys 100 105 110Leu Lys Arg Pro Arg Lys Tyr Phe Ile Ile Ser Ile Asp Leu Ala Lys 115 120 125Arg Tyr Thr Glu Glu Ile Leu Arg Gln Lys Trp Asp Leu Val Ile Val 130 135 140Asp Glu Val His Asn Ala Thr Leu Gly Thr Gln Arg Tyr Glu Phe Leu145 150 155 160Lys Glu Leu Thr Lys Asn Lys Asp Leu Asn Val Ile Phe Leu Ser Ala 165 170 175Thr Pro His Arg Gly Asn Asn Arg Asp Tyr Leu Ala Arg Leu Arg Leu 180 185

190Leu Asp Pro Thr Ile Pro Glu Glu Ile Ser Pro Met His Glu Arg Lys 195 200 205Ile Tyr Met Lys Ser Arg Gly Thr Leu Val Leu Arg Arg Thr Lys Lys 210 215 220Val Val Asn Glu Leu Glu Gly Glu Val Phe Lys Lys Cys His Phe Gly225 230 235 240Ala Val Val Val Glu Val Ser Arg Glu Glu Arg Glu Phe Phe Glu Glu 245 250 255Leu Asn Arg Ala Leu Phe Glu Leu Ile Lys Asp Gln Ala Asp Tyr Ser 260 265 270Pro Leu Thr Leu Leu Ala Val Ile Ile Arg Lys Arg Ala Ser Ser Ser 275 280 285Tyr Glu Ala Ala Leu Lys Thr Leu Thr Arg Ile Val Glu Ser Ala Tyr 290 295 300Ile Ser Gly Gln Glu Arg Ala Arg Gly Val Glu Ser Tyr Ile Glu Lys305 310 315 320Ile Phe Arg Met Gly Tyr Glu Glu Leu Glu Ile Glu Glu Phe Asn Glu 325 330 335Ile Asp Asp Ala Ile His Lys Ile Ile Asp Glu Tyr Arg Gly Phe Leu 340 345 350Thr Glu Glu Gln Leu Glu Arg Leu Arg Arg Val Leu Glu Leu Gly Lys 355 360 365Lys Ile Gly Ser Lys Asp Ser Lys Leu Glu Val Ile Ser Asp Ile Val 370 375 380Ala Tyr His Ile Arg Asn Gly Glu Lys Val Ile Ile Phe Thr Glu Phe385 390 395 400Arg Asp Thr Leu Glu Tyr Val Leu Glu Arg Leu Pro Asp Ile Leu Arg 405 410 415Arg Lys His Gly Ile Val Leu Glu Lys Asp Asp Ile Ala Lys Leu His 420 425 430Gly Gly Met Lys Ser Glu Glu Ile Glu Arg Glu Ile Asn Lys Phe His 435 440 445Glu Arg Ala Asn Leu Leu Val Ser Thr Asp Val Ala Ser Glu Gly Leu 450 455 460Asn Leu His Val Ala Ser Val Val Ile Asn Tyr Glu Ala Pro Trp Ser465 470 475 480Pro Ile Lys Leu Glu Gln Arg Val Gly Arg Ile Trp Arg Leu Asn Gln 485 490 495Thr Arg Glu Thr Lys Ala Tyr Thr Ile Phe Leu Ala Thr Glu Thr Asp 500 505 510Leu Asp Val Leu Asn Asn Leu Tyr Arg Lys Ile Met Asn Ile Lys Glu 515 520 525Ala Val Gly Ser Gly Pro Ile Ile Gly Arg Pro Ile Phe Glu Gly Asp 530 535 540Phe Glu Asn Leu Trp Asn Glu Gly Ala Glu Glu Glu Asn Arg Glu Val545 550 555 560Ser Glu Tyr Glu Leu Ile Leu Ala Ser Ile Lys Gly Glu Leu Lys Gly 565 570 575Tyr Ala Gly Ala Leu Val Arg Thr Leu Arg Ile Leu Lys Gln Lys Val 580 585 590Glu Gly Ala Val Pro Val Asn Pro Ala Gly Ser Ile Arg Arg Glu Leu 595 600 605Glu Ile Ile Leu Glu Asp Thr Pro Asp Val Glu Val Leu Lys Lys Ile 610 615 620Val Asn Arg Asn Val Pro Asn Pro Phe Arg Leu Val Arg Gly Leu Leu625 630 635 640Arg Glu Ala Glu Gly Ile Glu Gly Ile Arg Val Leu Val Lys Gly Tyr 645 650 655Asp Gly Ser Met Asp Val Tyr Tyr Ala Ile Phe Tyr Asp Glu Asp Gly 660 665 670Arg Glu Ile Tyr Arg Tyr Pro Ile Leu Ala Glu Asn Gly Lys Tyr Leu 675 680 685Val Gly Phe Asn Leu Leu Lys Arg Ile Ser Glu Val Leu Ser Lys Glu 690 695 700Tyr Lys Val Val Arg Gly Ala Ser Glu Glu Val Asp Tyr Lys Val Lys705 710 715 720Thr Leu Val Met Asp Asn Ile Tyr Asn Leu Ile Val Lys Lys Tyr Leu 725 730 735Glu Tyr Asp Ser Leu Asn Ile Lys Glu Gly Lys Ile Phe Lys Arg Leu 740 745 750Lys Val Glu Ile Lys Lys Ala Leu Glu Val Lys Gly Ile Ser Glu Glu 755 760 765Glu Phe Glu Val Ile Lys Arg Val Pro Pro Glu Ile Met Glu Val Leu 770 775 780Gly Leu Asp Ser Thr Lys Ile Glu Leu Pro Thr Asn Glu Tyr Leu Lys785 790 795 800Ile Phe Glu Arg Asn Phe Val Pro Leu Asp Lys Ile Leu Glu Ser Glu 805 810 815Lys Lys Ala Met Glu Ile Val Met Glu Leu Glu Lys Ser Arg Gly Tyr 820 825 830Asn Val Glu Asp Val Ser Leu Arg Glu His Tyr Asp Ile Arg Ala Phe 835 840 845Thr Asp Gly Glu Glu Lys Tyr Ile Glu Val Lys Gly His Tyr Pro Met 850 855 860Leu Leu Leu Ala Glu Leu Thr Glu Lys Glu Phe Glu Phe Ala Gln Lys865 870 875 880Asn Glu Asp Lys Tyr Trp Ile Tyr Ile Val Ser Asn Ile Ala Lys Asp 885 890 895Pro Val Ile Val Lys Ile Tyr Lys Pro Phe Ser Gln Asp Arg Arg Val 900 905 910Phe Val Val Lys Asn Gly Glu Asp Val Glu Val Asn Ile Asn Ile Glu 915 920 925Ile Lys Lys Lys Asp Arg His Leu Leu Lys Leu Ser 930 935 940791278PRTArtificial SequenceDescription of Artificial Sequence Helicase 7 79Val Ile Thr Leu Glu Leu His Pro Ser Glu Ile Ala Arg Tyr Phe Glu 1 5 10 15Leu Glu Glu Cys Ser His Tyr Phe Ser Asn Leu Leu Leu Arg Lys Arg 20 25 30Gly Glu Leu Gln Glu Phe Glu Pro Ile Ile Arg Arg Lys Glu Ile Glu 35 40 45Thr Ile Glu Leu Ala Lys Trp Gly Asp Glu Phe Glu Leu Ser Leu Leu 50 55 60Gln Glu Phe Lys Lys Gly Glu Ala Leu Lys Lys Leu Gly Val Lys Glu 65 70 75 80Leu Pro Arg Phe Tyr Gly Phe Leu Thr Glu Asn Asp Thr Pro Val Arg 85 90 95Lys Phe Phe Glu Lys Tyr Phe Lys Asp Gly Ile Ile Val Glu Glu Asp 100 105 110Pro Asp Lys Leu Leu Glu Ile Ile Asn Ser Glu Lys Ser Ala Val Ile 115 120 125Tyr Gln Ala Pro Leu Lys Gly Arg Ile Gly Lys Phe Asp Val Ser Gly 130 135 140Arg Ala Asp Phe Ile Ile Lys Val Gly Lys Thr Leu Tyr Leu Leu Glu145 150 155 160Ala Lys Phe Thr Lys Glu Glu Lys Phe Tyr His Arg Ile Gln Ala Ile 165 170 175Ile Tyr Ala His Leu Leu Ser Gln Met Ile Glu Gly Tyr Glu Ile Lys 180 185 190Leu Ala Val Val Thr Lys Glu Asn Phe Pro Ile Pro Ser Asn Phe Leu 195 200 205Arg Phe Pro Gly Asp Val Glu Glu Leu Lys Ile Thr Leu Glu Glu Lys 210 215 220Leu Gly Gly Ile Leu Arg Glu Gln Glu Leu Trp Ile Asp Ala Arg Cys225 230 235 240Thr Thr Cys Pro Phe Glu Ala Leu Cys Leu Ser Lys Ala Leu Glu Glu 245 250 255Arg Ser Leu Gly Leu Leu Ser Leu Pro Pro Gly Ile Ile Arg Ile Leu 260 265 270Lys Glu Glu Gly Ile Lys Asp Leu Lys Asp Met Ala Lys Leu Phe Glu 275 280 285Phe Lys Glu Asn Ser Pro Thr Asn Phe Glu Glu Pro Ser Ile Lys Asp 290 295 300Pro Lys Lys Thr Gln Glu Ile Ala Lys Arg Thr Gly Ile Asn Leu Leu305 310 315 320Lys Leu Ser Arg Ile Ala Gln Ala Ile Leu Lys Tyr Leu Asp Glu Gly 325 330 335Glu Thr Thr Pro Leu Phe Ile Pro Arg Thr Gly Tyr Asn Leu Pro Met 340 345 350Asp Glu Arg Val Gly Asp Val Glu Pro Ser Tyr Tyr Pro Pro Arg Ser 355 360 365Leu Val Lys Val Phe Phe Tyr Val Gln Thr Ser Pro Ile Thr Asp Thr 370 375 380Ile Ile Gly Ile Ser Ala Leu Val Lys Asn Arg Gln Asn Gly Glu Arg385 390 395 400Ile Ile Val Lys Phe Val Asp Glu Pro Pro Ile Glu Val Ser Asp Ala 405 410 415Gln Glu Lys Glu Arg Met Leu Leu Ile Glu Phe Phe Arg Asp Val Ile 420 425 430Asp Ala Val Lys Ser Leu Ser Pro Thr Asp Lys Val Tyr Leu His Met 435 440 445Tyr Phe Tyr Asn Arg Lys Gln Arg Asp Asp Leu Met Asp Ala Val Lys 450 455 460Arg His Lys Glu Ile Arg Glu Asn Asn Ala Val Met Ala Leu Leu Ser465 470 475 480Leu Arg Arg Ala Ile Asp Trp Glu Ser Phe Ser Ile Ile Lys Asp Glu 485 490 495Ile Ile Arg Arg His Ala Leu Pro Leu Ser Pro Gly Leu Gly Phe Val 500 505 510Thr Val Ala Thr Gln Phe Gly Tyr Arg Trp Arg Arg Asn Lys Thr Phe 515 520 525Ala Arg Met Leu Glu Val Val Ala Arg Arg Glu Asn Gly Lys Ile Asn 530 535 540Leu Lys Thr Leu Leu Asn Ile Ser Glu Thr Gly Ile Gly Pro Glu Tyr545 550 555 560Tyr Pro Ile Ile Asp Arg Asp Asn Glu Gly Ile Pro Phe Thr Leu Phe 565 570 575Trp Ser Ala Leu Val Lys Leu Ala Thr Glu Glu Asp Asn Ser Arg Ile 580 585 590Lys Arg Asp Ile Arg Asp Ile Leu Ser Gln Met Val Glu Ala Leu Lys 595 600 605Thr Ile Glu Glu Arg Ile Pro Glu Gln Tyr Lys Asp Ala Phe Val Lys 610 615 620Lys Glu Gly Ile Pro Lys Glu Asp Leu Glu Asn Phe Asp Ile Lys Lys625 630 635 640Glu Glu Leu Ala Asp Ile Leu Leu Glu Tyr Leu Gln Leu Glu Phe Asp 645 650 655Ala Arg Phe Arg Glu Arg Ser Glu Tyr Tyr Arg Leu Pro Leu Ser Ile 660 665 670Arg Ala Tyr Ser Glu Glu Ser Ala Leu Ile Lys Ile Glu Asn Ile Glu 675 680 685Lys Lys Lys Asn Asp Cys Leu Leu Phe Gly Lys Ile Val Leu Ile Asp 690 695 700Glu Asn Gly Arg Ile Lys Glu Tyr Asn Pro Lys Glu Val Leu Ile Asp705 710 715 720Ile Asp Glu Gly Ser Leu Val Val Val Thr Pro Lys Lys Phe Leu Asp 725 730 735Lys Leu Arg Arg Asp Pro Val Gln Arg Ile Ser Lys Ser Pro Leu Gly 740 745 750Ile Val Glu Ala Ile Asp His Glu Thr Gly Lys Val Val Ile Arg Leu 755 760 765Ile Arg Val Ser Pro Gly Arg Phe Thr Leu Lys His Ser Lys Phe Ser 770 775 780Cys Lys Asn Gly Leu Leu Thr Ile Thr Tyr Pro Glu Gly Glu Val Lys785 790 795 800Val Thr Pro Gly Glu Ile Val Ile Val Asp Pro Ser Val Asp Asp Ile 805 810 815Gly Met Glu Arg Ala Tyr Asn Val Leu Ser Glu Ile Ser Gln Gly Glu 820 825 830Leu Lys His Glu Ile Tyr Gln Lys Val Lys Ala Ile Tyr Glu Gly Asn 835 840 845Thr Glu Ser Arg Tyr Glu Val Asn Ile Trp Lys Lys Lys His Ile Glu 850 855 860Glu Phe Leu Ser Arg Val Lys Lys Ile Asn Glu Glu Gln Lys Lys Phe865 870 875 880Ala Ile Asp Ile Asn Asn Phe Leu Val Thr Leu Gln Glu Pro Pro Gly 885 890 895Thr Gly Lys Thr Ser Gly Ala Ile Ala Pro Ala Ile Leu Ala Arg Ala 900 905 910Tyr Ser Met Val Lys Asp Lys Lys Asn Gly Leu Phe Val Val Thr Gly 915 920 925Val Ser His Arg Ala Val Asn Glu Ala Leu Ile Lys Thr Leu Lys Leu 930 935 940Lys Lys Glu Leu Glu Asn Thr Leu Lys Glu Leu Arg Lys Ile Asp Leu945 950 955 960Ile Arg Ala Val Ser Gly Glu Glu Ala Ile Lys Ile Ile Lys Glu Glu 965 970 975Leu Glu Arg Glu Ile Lys Asp Asp Val Asp Arg Ile Arg Phe Thr Ala 980 985 990Gln Glu Ile Thr His Ser Ser Lys Gln Arg Ser Leu Asp Lys Tyr Phe 995 1000 1005Ala Asn Ser Gly Thr Val Arg Ile Val Phe Gly Thr Pro Gln Thr Leu 1010 1015 1020Asn Lys Leu Met Lys Asn Thr Lys Glu Val Glu Leu Val Val Ile Asp1025 1030 1035 1040Glu Ala Ser Met Met Asp Leu Pro Met Phe Phe Leu Ser Thr Lys Val 1045 1050 1055Cys Lys Gly Gln Val Leu Leu Val Gly Asp His Arg Gln Met Glu Pro 1060 1065 1070Ile Gln Val His Glu Trp Gln Leu Glu Asp Arg Lys Thr Phe Glu Glu 1075 1080 1085His Tyr Pro Phe Leu Ser Ala Leu Asn Phe Ile Arg Phe Leu Arg Gly 1090 1095 1100Glu Leu Asp Glu Arg Glu Leu Lys Lys Phe Lys Arg Ile Leu Gly Arg1105 1110 1115 1120Glu Pro Pro Glu Trp Lys Lys Asp Lys Asn Glu Val Leu Pro Leu Tyr 1125 1130 1135Arg Leu Val Arg Thr Tyr Arg Leu Pro Gln Glu Ile Ala Asp Leu Leu 1140 1145 1150Ser Asp Ala Ile Tyr Arg Ala Asp Gly Ile Lys Leu Ile Ser Glu Lys 1155 1160 1165Lys Lys Arg Arg Lys Ile Ile Ala Arg His Lys Asp Glu Phe Leu Ser 1170 1175 1180Ile Val Leu Asp Asp Arg Tyr Pro Phe Val Leu Ile Leu His Asp Glu1185 1190 1195 1200Gly Asn Ser Thr Lys Ile Asn Glu Leu Glu Ala Lys Ile Val Glu Lys 1205 1210 1215Ile Ile Lys Arg Val Glu Asn Ile Asp Ile Gly Val Val Val Pro Tyr 1220 1225 1230Arg Ala Gln Lys Arg Leu Ile Ala Ser Leu Ile Asp Ser Ala Gln Val 1235 1240 1245Asp Thr Val Glu Arg Phe Gln Gly Gly Glu Lys Ser Leu Ile Val Ile 1250 1255 1260Ser Met Thr Ser Ser Asp Pro Arg Ile Pro Gly Lys Gly Phe1265 1270 127580655PRTArtificial SequenceDescription of Artificial Sequence Helicase dna2 80Met Asn Ile Lys Ser Phe Ile Asn Arg Leu Lys Glu Leu Val Glu Ile 1 5 10 15Glu Arg Glu Ala Glu Ile Glu Ala Met Arg Leu Glu Met Lys Arg Leu 20 25 30Ser Gly Val Glu Arg Glu Arg Leu Gly Arg Ala Ile Leu Ser Leu Asn 35 40 45Gly Lys Ile Val Gly Glu Glu Leu Gly Tyr Phe Leu Val Lys Tyr Gly 50 55 60Arg Asn Lys Glu Ile Lys Thr Glu Ile Ser Val Gly Asp Leu Val Val 65 70 75 80Ile Ser Lys Arg Asp Pro Leu Lys Ser Asp Leu Leu Gly Thr Val Val 85 90 95Glu Lys Gly Lys Arg Phe Ile Val Val Ala Leu Glu Pro Val Pro Glu 100 105 110Trp Ala Leu Arg Asp Val Arg Ile Asp Leu Tyr Ala Asn Asp Ile Thr 115 120 125Phe Lys Arg Trp Ile Glu Asn Leu Asp Arg Val Arg Lys Ala Gly Lys 130 135 140Lys Ala Leu Glu Phe Tyr Leu Gly Leu Asp Glu Pro Ser Gln Gly Glu145 150 155 160Glu Val Ser Phe Glu Pro Phe Asp Lys Ser Leu Asn Pro Ser Gln Arg 165 170 175Lys Ala Ile Ala Lys Ala Leu Gly Ser Glu Asp Phe Phe Leu Ile His 180 185 190Gly Pro Phe Gly Thr Gly Lys Thr Arg Thr Leu Val Glu Leu Ile Arg 195 200 205Gln Glu Val Lys Arg Gly Asn Lys Val Leu Ala Thr Ala Glu Ser Asn 210 215 220Val Ala Val Asp Asn Leu Val Glu Arg Leu Ala Lys Asp Gly Val Lys225 230 235 240Ile Val Arg Val Gly His Pro Ser Arg Val Ser Arg His Leu His Glu 245 250 255Thr Thr Leu Ala Tyr Leu Ile Thr Gln His Glu Leu Tyr Gly Glu Leu 260 265 270Arg Glu Leu Arg Val Ile Gly Gln Ser Leu Ala Glu Lys Arg Asp Thr 275 280 285Tyr Thr Lys Pro Thr Pro Lys Phe Arg Arg Gly Leu Ser Asp Ala Glu 290 295 300Ile Ile Lys Leu Ala Glu Lys Gly Arg Gly Ala Arg Gly Leu Ser Ala305 310 315 320Arg Leu Ile Lys Glu Met Ala Glu Trp Ile Lys Leu Asn Arg Gln Val 325 330 335Gln Lys Ala Phe Glu Asp Ala Arg Lys Leu Glu Glu Arg Ile Ala Arg 340 345 350Asp Ile Ile Arg Glu Ala Asp Val Val Leu Thr Thr Asn Ser Ser Ala 355 360 365Ala Leu Asp Val Val Asp Ala Thr Asp Tyr Asp Val Ala Ile Ile Asp 370 375 380Glu Ala Thr Gln Ala Thr Ile Pro Ser Ile Leu Ile Pro Leu Asn Lys385 390 395 400Val Asp Arg Phe Ile Leu Ala Gly Asp His Lys Gln Leu Pro Pro Thr 405 410 415Ile Leu Ser Leu Glu Ala Gln Glu Leu Ser His Thr Leu Phe Glu Gly

420 425 430Leu Ile Glu Lys Tyr Pro Trp Lys Ser Glu Met Leu Thr Ile Gln Tyr 435 440 445Arg Met Asn Glu Arg Ile Met Glu Phe Pro Ser Arg Glu Phe Tyr Asp 450 455 460Gly Arg Ile Val Ala Asp Glu Ser Val Lys Asn Ile Thr Leu Ala Asp465 470 475 480Leu Gly Ile Lys Val Asn Ala Ser Gly Ile Trp Arg Asp Ile Leu Asp 485 490 495Pro Asn Asn Val Leu Val Phe Ile Asp Thr Cys Met Leu Glu Asn Arg 500 505 510Phe Glu Arg Gln Arg Arg Gly Ser Glu Ser Arg Glu Asn Pro Leu Glu 515 520 525Ala Lys Ile Val Ser Lys Ile Val Glu Lys Leu Leu Glu Ser Gly Val 530 535 540Lys Ala Glu Met Met Gly Val Ile Thr Pro Tyr Asp Asp Gln Arg Asp545 550 555 560Leu Ile Ser Leu Asn Val Pro Glu Glu Val Glu Val Lys Thr Val Asp 565 570 575Gly Tyr Gln Gly Arg Glu Lys Glu Val Ile Ile Leu Ser Phe Val Arg 580 585 590Ser Asn Lys Ala Gly Glu Ile Gly Phe Leu Lys Asp Leu Arg Arg Leu 595 600 605Asn Val Ser Leu Thr Arg Ala Lys Arg Lys Leu Ile Met Ile Gly Asp 610 615 620Ser Ser Thr Leu Ser Ser His Glu Thr Tyr Arg Arg Leu Ile Glu His625 630 635 640Val Arg Glu Lys Gly Leu Tyr Val Val Leu Thr Lys Asp Ser Ile 645 650 655812163DNAArtificial SequenceDescription of Artificial Sequence Recombinant helicase 8 81atgagggttg atgagctgag agttgatgag aggataaaga gtactttgaa ggagagaggt 60atcgaatcct tttaccctcc ccaagccgag gccttaaaga gcgggatatt ggaaggtaag 120aatgcattaa tttcaattcc aacggccagc ggaaaaacac taattgctga gattgccatg 180gttcatagga ttttgaccca gggaggaaag gctgtataca tagtcccgct gaaggccttg 240gctgaagaaa agtttcagga gttccaggat tgggagaaga ttgggttaag agtagcgatg 300gccactgggg attacgactc aaaggatgag tggttgggga aatacgacat aatcattgcg 360acggctgaga agtttgattc ccttttaagg catggctcaa gttggattaa ggatgtgaag 420attttagttg ctgacgagat tcatttgatt ggttcaagag acagaggagc tacgcttgaa 480gttatcctag ctcatatgct cggaaaggcc caaataattg gactctctgc aacgatagga 540aatccagagg agcttgcgga gtggttaaat gccgagctaa tagtcagtga ctggaggccc 600gttaagctta gaaggggagt tttttaccaa ggctttgtta cctgggaaga tggaagtata 660gacaggtttt cctcctggga agagttagtt tacgatgcaa ttaggaagaa gaaaggagcg 720ctaatttttg taaacatgag aaggaaggct gagagagtag ctttggagct ttctaaaaaa 780gttaagtctc tcctcacgaa acctgagatt agagctttaa atgaattggc tgattccctc 840gaggaaaatc ccacaaatga aaagctagct aaggccatta ggggtggagt tgcgttccac 900cacgctggtc ttgggagaga tgagagggtt ctcgtggagg agaactttag aaagggtata 960ataaaggccg tagttgccac cccaacactt tcggcgggaa ttaacactcc agcgtttagg 1020gtgattataa gggatatttg gaggtactct gactttggaa tggagagaat tccgataatc 1080gaggttcacc aaatgcttgg gagagctgga aggccgaagt atgatgaggt tggggaggga 1140ataatagttt ctacaagcga tgatccgaga gaggtaatga atcactacat atttggaaag 1200cctgaaaaac tgttctccca gctctccaac gagagtaatt tgagaagtca agttttggcc 1260ctaatagcga cctttggcta ttcaactgtg gaggagattt tgaagttcat ctcaaacaca 1320ttctatgctt atcaaaggaa ggacacatac tctttagagg agaagataag gaacatactc 1380tacttcctcc tagagaatga gttcatagag atatccttag aggataaaat aaggccgctt 1440tccctgggaa ttaggactgc aaagctttat atcgatccct atacggccaa gatgttcaag 1500gataaaatgg aggaagttgt taaagatcca aatcctatag gaatatttca cttaatctcc 1560ctaactccgg atataacccc cttcaactac tcaaagagag aatttgaaag gctcgaagag 1620gaatactacg aattcaagga taggttatac tttgacgatc cctacatttc gggttacgac 1680ccctacctag agaggaagtt cttcagagct ttcaaaactg cactagtgct tctggcatgg 1740ataaatgaag tccctgaggg agaaatagtt gaaaagtact cggtggaacc tggggacatc 1800tataggatag ttgagacggc tgagtggctg gtgtactctc taaaggaaat tgcaaaagtt 1860cttggagctt atgagatcgt tgattatctt gaaacattga gggttagggt caagtatggg 1920attagggagg aattgattcc cctaatgcaa ctcccgttgg ttggaagaag gagagctaga 1980gctctttaca atagcggatt tagaagtata gaggatatat ctcaagcgag gccagaagag 2040cttttgaaaa tcgaggggat aggggtcaag accgttgagg ctatcttcaa gtttcttggt 2100aagaatgtga aaatttcgga gaaacctaga aaaagtaccc ttgattactt tctcaaatct 2160tga 216382720PRTArtificial SequenceDescription of Artificial Sequence Recombinant helicase 8 82Met Arg Val Asp Glu Leu Arg Val Asp Glu Arg Ile Lys Ser Thr Leu 1 5 10 15Lys Glu Arg Gly Ile Glu Ser Phe Tyr Pro Pro Gln Ala Glu Ala Leu 20 25 30Lys Ser Gly Ile Leu Glu Gly Lys Asn Ala Leu Ile Ser Ile Pro Thr 35 40 45Ala Ser Gly Lys Thr Leu Ile Ala Glu Ile Ala Met Val His Arg Ile 50 55 60Leu Thr Gln Gly Gly Lys Ala Val Tyr Ile Val Pro Leu Lys Ala Leu 65 70 75 80Ala Glu Glu Lys Phe Gln Glu Phe Gln Asp Trp Glu Lys Ile Gly Leu 85 90 95Arg Val Ala Met Ala Thr Gly Asp Tyr Asp Ser Lys Asp Glu Trp Leu 100 105 110Gly Lys Tyr Asp Ile Ile Ile Ala Thr Ala Glu Lys Phe Asp Ser Leu 115 120 125Leu Arg His Gly Ser Ser Trp Ile Lys Asp Val Lys Ile Leu Val Ala 130 135 140Asp Glu Ile His Leu Ile Gly Ser Arg Asp Arg Gly Ala Thr Leu Glu145 150 155 160Val Ile Leu Ala His Met Leu Gly Lys Ala Gln Ile Ile Gly Leu Ser 165 170 175Ala Thr Ile Gly Asn Pro Glu Glu Leu Ala Glu Trp Leu Asn Ala Glu 180 185 190Leu Ile Val Ser Asp Trp Arg Pro Val Lys Leu Arg Arg Gly Val Phe 195 200 205Tyr Gln Gly Phe Val Thr Trp Glu Asp Gly Ser Ile Asp Arg Phe Ser 210 215 220Ser Trp Glu Glu Leu Val Tyr Asp Ala Ile Arg Lys Lys Lys Gly Ala225 230 235 240Leu Ile Phe Val Asn Met Arg Arg Lys Ala Glu Arg Val Ala Leu Glu 245 250 255Leu Ser Lys Lys Val Lys Ser Leu Leu Thr Lys Pro Glu Ile Arg Ala 260 265 270Leu Asn Glu Leu Ala Asp Ser Leu Glu Glu Asn Pro Thr Asn Glu Lys 275 280 285Leu Ala Lys Ala Ile Arg Gly Gly Val Ala Phe His His Ala Gly Leu 290 295 300Gly Arg Asp Glu Arg Val Leu Val Glu Glu Asn Phe Arg Lys Gly Ile305 310 315 320Ile Lys Ala Val Val Ala Thr Pro Thr Leu Ser Ala Gly Ile Asn Thr 325 330 335Pro Ala Phe Arg Val Ile Ile Arg Asp Ile Trp Arg Tyr Ser Asp Phe 340 345 350Gly Met Glu Arg Ile Pro Ile Ile Glu Val His Gln Met Leu Gly Arg 355 360 365Ala Gly Arg Pro Lys Tyr Asp Glu Val Gly Glu Gly Ile Ile Val Ser 370 375 380Thr Ser Asp Asp Pro Arg Glu Val Met Asn His Tyr Ile Phe Gly Lys385 390 395 400Pro Glu Lys Leu Phe Ser Gln Leu Ser Asn Glu Ser Asn Leu Arg Ser 405 410 415Gln Val Leu Ala Leu Ile Ala Thr Phe Gly Tyr Ser Thr Val Glu Glu 420 425 430Ile Leu Lys Phe Ile Ser Asn Thr Phe Tyr Ala Tyr Gln Arg Lys Asp 435 440 445Thr Tyr Ser Leu Glu Glu Lys Ile Arg Asn Ile Leu Tyr Phe Leu Leu 450 455 460Glu Asn Glu Phe Ile Glu Ile Ser Leu Glu Asp Lys Ile Arg Pro Leu465 470 475 480Ser Leu Gly Ile Arg Thr Ala Lys Leu Tyr Ile Asp Pro Tyr Thr Ala 485 490 495Lys Met Phe Lys Asp Lys Met Glu Glu Val Val Lys Asp Pro Asn Pro 500 505 510Ile Gly Ile Phe His Leu Ile Ser Leu Thr Pro Asp Ile Thr Pro Phe 515 520 525Asn Tyr Ser Lys Arg Glu Phe Glu Arg Leu Glu Glu Glu Tyr Tyr Glu 530 535 540Phe Lys Asp Arg Leu Tyr Phe Asp Asp Pro Tyr Ile Ser Gly Tyr Asp545 550 555 560Pro Tyr Leu Glu Arg Lys Phe Phe Arg Ala Phe Lys Thr Ala Leu Val 565 570 575Leu Leu Ala Trp Ile Asn Glu Val Pro Glu Gly Glu Ile Val Glu Lys 580 585 590Tyr Ser Val Glu Pro Gly Asp Ile Tyr Arg Ile Val Glu Thr Ala Glu 595 600 605Trp Leu Val Tyr Ser Leu Lys Glu Ile Ala Lys Val Leu Gly Ala Tyr 610 615 620Glu Ile Val Asp Tyr Leu Glu Thr Leu Arg Val Arg Val Lys Tyr Gly625 630 635 640Ile Arg Glu Glu Leu Ile Pro Leu Met Gln Leu Pro Leu Val Gly Arg 645 650 655Arg Arg Ala Arg Ala Leu Tyr Asn Ser Gly Phe Arg Ser Ile Glu Asp 660 665 670Ile Ser Gln Ala Arg Pro Glu Glu Leu Leu Lys Ile Glu Gly Ile Gly 675 680 685Val Lys Thr Val Glu Ala Ile Phe Lys Phe Leu Gly Lys Asn Val Lys 690 695 700Ile Ser Glu Lys Pro Arg Lys Ser Thr Leu Asp Tyr Phe Leu Lys Ser705 710 715 720832163DNAPyrococcus furiosus 83atgagggttg atgagctgag agttgatgag aggataaaga gtactttgaa ggagagaggt 60atcgaatcct tttaccctcc ccaagccgag gccttaaaga gcgggatatt ggaaggtaag 120aatgcattaa tttcaattcc aacggccagc ggaaaaacac taattgctga gattgccatg 180gttcatagga ttttgaccca gggaggaaag gctgtataca tagtcccgct gaaggccttg 240gctgaagaaa agtttcagga gttccaggat tgggagaaga ttgggttaag agtagcgatg 300gccactgggg attacgactc aaaggatgag tggttgggga aatacgacat aatcattgcg 360acggctgaga agtttgattc ccttttaagg catggctcaa gttggattaa ggatgtgaag 420attttagttg ctgacgagat tcatttgatt ggttcaagag acagaggagc tacgcttgaa 480gttatcctag ctcatatgct cggaaaggcc caaataattg gactctctgc aacgatagga 540aatccagagg agcttgcgga gtggttaaat gccgagctaa tagtcagtga ctggaggccc 600gttaagctta gaaggggagt tttttaccaa ggctttgtta cctgggaaga tggaagtata 660gacaggtttt cctcctggga agagttagtt tacgatgcaa ttaggaagaa gaaaggagcg 720ctaatttttg taaacatgag aaggaaggct gagagagtag ctttggagct ttctaaaaaa 780gttaagtctc tcctcacgaa acctgagatt agagctttaa atgaattggc tgattccctc 840gaggaaaatc ccacaaatga aaagctagct aaggccatta ggggtggagt tgcgttccac 900cacgctggtc ttgggagaga tgagagggtt ctcgtggagg agaactttag aaagggtata 960ataaaggccg tagttgccac cccaacactt tcggcgggaa ttaacactcc agcgtttagg 1020gtgattataa gggatatttg gaggtactct gactttggaa tggagagaat tccgataatc 1080gaggttcacc aaatgcttgg gagagctgga aggccgaagt atgatgaggt tggggaggga 1140ataatagttt ctacaagcga tgatccgaga gaggtaatga atcactacat atttggaaag 1200cctgaaaaac tgttctccca gctctccaac gagagtaatt tgagaagtca agttttggcc 1260ctaatagcga cctttggcta ttcaactgtg gaggagattt tgaagttcat ctcaaacaca 1320ttctatgctt atcaaaggaa ggacacatac tctttagagg agaagataag gaacatactc 1380tacttcctcc tagagaatga gttcatagag atatccttag aggataaaat aaggccgctt 1440tccctgggaa ttaggactgc aaagctttat atcgatccct atacggccaa gatgttcaag 1500gataaaatgg aggaagttgt taaagatcca aatcctatag gaatatttca cttaatctcc 1560ctaactccgg atataacccc cttcaactac tcaaagagag aatttgaaag gctcgaagag 1620gaatactacg aattcaagga taggttatac tttgacgatc cctacatttc gggttacgac 1680ccctacctag agaggaagtt cttcagagct ttcaaaactg cactagtgct tctggcatgg 1740ataaatgaag tccctgaggg agaaatagtt gaaaagtact cggtggaacc tggggacatc 1800tataggatag ttgagacggc tgagtggctg gtgtactctc taaaggaaat tgcaaaagtt 1860cttggagctt atgagatcgt tgattatctt gaaacattga gggttagggt caagtatggg 1920attagggagg aattgattcc cctaatgcaa ctcccgttgg ttggaagaag gagagctaga 1980gctctttaca atagcggatt tagaagtata gaggatatat ctcaagcgag gccagaagag 2040cttttgaaaa tcgaggggat aggggtcaag accgttgagg ctatcttcaa gtttcttggt 2100aagaatgtga aaatttcgga gaaacctaga aaaagtaccc ttgattactt tctcaaatct 2160tga 216384720PRTPyrococcus furiosus 84Met Arg Val Asp Glu Leu Arg Val Asp Glu Arg Ile Lys Ser Thr Leu 1 5 10 15Lys Glu Arg Gly Ile Glu Ser Phe Tyr Pro Pro Gln Ala Glu Ala Leu 20 25 30Lys Ser Gly Ile Leu Glu Gly Lys Asn Ala Leu Ile Ser Ile Pro Thr 35 40 45Ala Ser Gly Lys Thr Leu Ile Ala Glu Ile Ala Met Val His Arg Ile 50 55 60Leu Thr Gln Gly Gly Lys Ala Val Tyr Ile Val Pro Leu Lys Ala Leu 65 70 75 80Ala Glu Glu Lys Phe Gln Glu Phe Gln Asp Trp Glu Lys Ile Gly Leu 85 90 95Arg Val Ala Met Ala Thr Gly Asp Tyr Asp Ser Lys Asp Glu Trp Leu 100 105 110Gly Lys Tyr Asp Ile Ile Ile Ala Thr Ala Glu Lys Phe Asp Ser Leu 115 120 125Leu Arg His Gly Ser Ser Trp Ile Lys Asp Val Lys Ile Leu Val Ala 130 135 140Asp Glu Ile His Leu Ile Gly Ser Arg Asp Arg Gly Ala Thr Leu Glu145 150 155 160Val Ile Leu Ala His Met Leu Gly Lys Ala Gln Ile Ile Gly Leu Ser 165 170 175Ala Thr Ile Gly Asn Pro Glu Glu Leu Ala Glu Trp Leu Asn Ala Glu 180 185 190Leu Ile Val Ser Asp Trp Arg Pro Val Lys Leu Arg Arg Gly Val Phe 195 200 205Tyr Gln Gly Phe Val Thr Trp Glu Asp Gly Ser Ile Asp Arg Phe Ser 210 215 220Ser Trp Glu Glu Leu Val Tyr Asp Ala Ile Arg Lys Lys Lys Gly Ala225 230 235 240Leu Ile Phe Val Asn Met Arg Arg Lys Ala Glu Arg Val Ala Leu Glu 245 250 255Leu Ser Lys Lys Val Lys Ser Leu Leu Thr Lys Pro Glu Ile Arg Ala 260 265 270Leu Asn Glu Leu Ala Asp Ser Leu Glu Glu Asn Pro Thr Asn Glu Lys 275 280 285Leu Ala Lys Ala Ile Arg Gly Gly Val Ala Phe His His Ala Gly Leu 290 295 300Gly Arg Asp Glu Arg Val Leu Val Glu Glu Asn Phe Arg Lys Gly Ile305 310 315 320Ile Lys Ala Val Val Ala Thr Pro Thr Leu Ser Ala Gly Ile Asn Thr 325 330 335Pro Ala Phe Arg Val Ile Ile Arg Asp Ile Trp Arg Tyr Ser Asp Phe 340 345 350Gly Met Glu Arg Ile Pro Ile Ile Glu Val His Gln Met Leu Gly Arg 355 360 365Ala Gly Arg Pro Lys Tyr Asp Glu Val Gly Glu Gly Ile Ile Val Ser 370 375 380Thr Ser Asp Asp Pro Arg Glu Val Met Asn His Tyr Ile Phe Gly Lys385 390 395 400Pro Glu Lys Leu Phe Ser Gln Leu Ser Asn Glu Ser Asn Leu Arg Ser 405 410 415Gln Val Leu Ala Leu Ile Ala Thr Phe Gly Tyr Ser Thr Val Glu Glu 420 425 430Ile Leu Lys Phe Ile Ser Asn Thr Phe Tyr Ala Tyr Gln Arg Lys Asp 435 440 445Thr Tyr Ser Leu Glu Glu Lys Ile Arg Asn Ile Leu Tyr Phe Leu Leu 450 455 460Glu Asn Glu Phe Ile Glu Ile Ser Leu Glu Asp Lys Ile Arg Pro Leu465 470 475 480Ser Leu Gly Ile Arg Thr Ala Lys Leu Tyr Ile Asp Pro Tyr Thr Ala 485 490 495Lys Met Phe Lys Asp Lys Met Glu Glu Val Val Lys Asp Pro Asn Pro 500 505 510Ile Gly Ile Phe His Leu Ile Ser Leu Thr Pro Asp Ile Thr Pro Phe 515 520 525Asn Tyr Ser Lys Arg Glu Phe Glu Arg Leu Glu Glu Glu Tyr Tyr Glu 530 535 540Phe Lys Asp Arg Leu Tyr Phe Asp Asp Pro Tyr Ile Ser Gly Tyr Asp545 550 555 560Pro Tyr Leu Glu Arg Lys Phe Phe Arg Ala Phe Lys Thr Ala Leu Val 565 570 575Leu Leu Ala Trp Ile Asn Glu Val Pro Glu Gly Glu Ile Val Glu Lys 580 585 590Tyr Ser Val Glu Pro Gly Asp Ile Tyr Arg Ile Val Glu Thr Ala Glu 595 600 605Trp Leu Val Tyr Ser Leu Lys Glu Ile Ala Lys Val Leu Gly Ala Tyr 610 615 620Glu Ile Val Asp Tyr Leu Glu Thr Leu Arg Val Arg Val Lys Tyr Gly625 630 635 640Ile Arg Glu Glu Leu Ile Pro Leu Met Gln Leu Pro Leu Val Gly Arg 645 650 655Arg Arg Ala Arg Ala Leu Tyr Asn Ser Gly Phe Arg Ser Ile Glu Asp 660 665 670Ile Ser Gln Ala Arg Pro Glu Glu Leu Leu Lys Ile Glu Gly Ile Gly 675 680 685Val Lys Thr Val Glu Ala Ile Phe Lys Phe Leu Gly Lys Asn Val Lys 690 695 700Ile Ser Glu Lys Pro Arg Lys Ser Thr Leu Asp Tyr Phe Leu Lys Ser705 710 715 720

Patent applications by Connie Jo Hansen, San Diego, CA US

Patent applications by Holly Hurlbut Hogrefe, San Diego, CA US

Patent applications by Janice Marie Cline, San Marcos, CA US

Patent applications by STRATAGENE CALIFORNIA

Patent applications in class Recombinant DNA technique included in method of making a protein or polypeptide

Patent applications in all subclasses Recombinant DNA technique included in method of making a protein or polypeptide

User Contributions:

Comment about this patent or add new information about this topic:

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: PFU REPLICATION ACCESSORY FACTORS AND METHODS OF USE

Abstract:

Claims:

Description: