Patent application title: Expression of Cry3B Insecticidal Protein in Plants
Inventors:
Charles P. Romano (Medfield, MA, US)
IPC8 Class: AA01H500FI
USPC Class:
800302
Class name: Plant, seedling, plant seed, or plant part, per se higher plant, seedling, plant seed, or plant part (i.e., angiosperms or gymnosperms) insect resistant plant which is transgenic or mutant
Publication date: 2009-01-15
Patent application number: 20090019609
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: Expression of Cry3B Insecticidal Protein in Plants
Inventors:
Charles P. Romano
Agents:
MONSANTO COMPANY
Assignees:
Origin: ST. LOUIS, MO US
IPC8 Class: AA01H500FI
USPC Class:
800302
Abstract:
The present invention discloses methods and compositions comprising a
group of novel expression cassettes which provide significantly improved
levels of accumulation of Coleopteran inhibitory Cry3B and Cry3B variant
amino acid sequences when these are expressed in plants. The preferred
embodiments of the invention provide at least up to ten fold higher
levels of insect controlling protein relative to the highest levels
obtained using prior compositions. In particular, transgenic maize
expressing higher levels of a protein designed to exhibit increased
toxicity toward Coleopteran pests deliver superior levels of insect
protection and are less likely to sponsor development of populations of
target insects that are resistant to the insecticidally active protein.Claims:
1.-47. (canceled)
48. A transgenic corn plant for controlling coleopteran insect pest infestation, said plant comprising a Cry3B protein the amino acid sequence of which is selected from the group consisting of SEQ ID NO:10 and SEQ ID NO:16, and wherein said plant is supplemented with an insecticidally effective amount of a protein different from said Cry3B, said different protein being selected from the group consisting of a Cry3A, a Cry3D, a CryET33 and CryET34, a CryET70, a CryET29, a Cry6A, a Cry6B, a Cry8B, an insecticidal acyl lipid hydrolase, a VIP1, a VIP3, and variants thereof.
49. The transgenic corn plant of claim 48 wherein said coleopteran insect pest is a Diabrotica species.
50. The transgenic corn plant of claim 48 wherein said protein different from said Cry3B is a Cry3A variant.
51. A seed of the plant of claim 50 which gives rise to plants comprising the Cry3B protein and the Cry3A variant.
Description:
1.0 BACKGROUND OF THE INVENTION
[0001]1.1 Field of the Invention
[0002]The present invention discloses transgenic plants expressing substantially higher levels of insect controlling Bacillus thuringiensis δ-endotoxin. Methods for obtaining such plants and compositions, and methods for using such plants and compositions are described. Also disclosed are improved polynucleotide cassettes containing preferred protein coding sequences which impart the substantially higher levels of insect controlling δ-endotoxins. The preferred embodiments of the invention surprisingly provide up to ten fold higher levels of insect controlling protein relative to the highest levels obtained using prior compositions. In particular, transgenic maize expressing higher levels of a protein designed to exhibit increased toxicity toward Coleopteran pests deliver superior levels of insect protection and are less likely to sponsor development of populations of target insects that are resistant to the insecticidally active protein.
[0003]1.2 Description of the Related Art
[0004]Almost all field crops, plants, and commercial farming areas are susceptible to attack by one or more insect pests. Particularly problematic are Coleopteran and Lepidopteran pests. Because crops of commercial interest are often the target of insect attack, environmentally-sensitive methods for controlling or eradicating insect infestation are desirable. This is particularly true for farmers, nurserymen, growers, and commercial and residential areas which seek to control insect populations using ecologically friendly compositions.
[0005]The most widely used environmentally-sensitive insecticidal formulations developed in recent years have been composed of microbial protein pesticides derived from the bacterium Bacillus thuringiensis, a Gram-positive bacterium that produces crystal proteins or inclusion bodies which are specifically toxic to certain orders and species of insects. Many different strains of B. thuringiensis have been identified which produce one or more insecticidal crystal proteins as well as other insecticidal non-crystal forming proteins. Compositions including B. thuringiensis strains which produce insecticidal proteins have been commercially available and used as environmentally acceptable insecticides because they are quite toxic to specific target insect pests, but are harmless to plants and to vertebrate and invertebrate animals. More importantly, because these insect controlling proteins have to be ingested by susceptible target insect pests in order to exert their insecticidal or toxic effects, judicious application of such protein compositions limits or prevents non-target insect members of the susceptible order which may also be susceptible to the composition from significant exposure to the proteins (for example, non-target Lepidopteran species where Lepidopteran specific B.t. crystal protein is used in an insecticidal formulation). Additionally, insects of various orders have been shown to totally lack susceptibility to specifically targeted insecticidal proteins even when ingested in large amounts.
[0006]1.2.1 δ-Endotoxins
δ-endotoxins are used to control a wide range of plant-eating caterpillars and beetles, as well as mosquitoes. These proteins, also referred to as insecticidal crystal proteins, crystal proteins, and Bt toxins, represent a large collection of insecticidal proteins produced by B. thuringiensis that are toxic upon ingestion by a susceptible insect host. Over the past decade research on the structure and function of B. thuringiensis toxins has covered all of the major toxin categories, and while these toxins differ in specific structure and function, general similarities in the structure and function are assumed. A recent review describes the genetics, biochemistry, and molecular biology of Bt toxins (Schnepf et al., Bacillus thuringiensis and its Pesticidal Crystal Proteins, Microbiol. Mol. Biol. Rev. 62:775-806, 1998). Based on the accumulated knowledge of B. thuringiensis toxins, a generalized mode of action for B. thuringiensis toxins has been created and includes: ingestion by the insect, solubilization in the insect midgut (a combination stomach and small intestine), resistance to digestive enzymes sometimes with partial digestion by gut specific proteases catalyzing specifically a cleavage at a peptide site within a protoxin structure which "activates" the toxin, binding of the toxin to the midgut cells' brush border, formation of a pore in the insect midgut cell, and the disruption of cellular homeostasis (English and Slatin, 1992).
[0008]1.2.2 Genes Encoding Crystal Proteins
[0009]Many of the δ-endotoxins are related to various degrees by similarities in their amino acid sequences. Historically, the proteins find the genes which encode them were classified based largely upon their spectrum of insecticidal activity. A review by Hofte and Whiteley (1989) discusses the genes and proteins that were identified in B. thuringiensis prior to 1990, and sets forth the nomenclature and classification scheme which has traditionally been applied to B. thuringiensis genes and proteins. The original nomenclature took advantage of the discovery that the few Bt Cry proteins known at the time generally fell into a limited number of classes, wherein each class represented proteins having specificity for specific orders of insects. For example, cry1 genes encoded Lepidopteran-toxic Cry1 proteins. cry2 genes encoded Cry2 proteins that were generally toxic to both Lepidopteran as well to as to Dipterans. cry3 genes encoded Coleopteran-toxic Cry3 proteins, while cry4 genes encoded Dipteran-specific toxic Cry4 proteins. The nomenclature has, for the past decade or more become rather confusing with the discovery of more distantly related classes of insecticidal Bt proteins. More recently, a simplified homogeneous nomenclature and basis for classifications of Bt proteins has been adopted and has been reviewed by Schnepf et al. (1998). Schnepf et al. (1998) also provides a structural solution for a Cry1 crystal. This simplified nomenclature will be adopted herein. The convention of identifying Bt genes with lower case, italicized letters (eg. cry1Ab1) and identifying Bt proteins with uppercase first character (eg. Cry1Ab1) will also be observed herein.
[0010]Based on the degree of sequence similarity, the proteins have been further classified into subfamilies. Proteins which appeared to be more closely related within each family were assigned divisional letters such as Cry1A, Cry1B, Cry1C, etc. Even more closely related proteins within each division were given names such as Cry1Ca, Cry1Cb, etc. and still even more closely related proteins within each division were designated with names such as Cry1Bb1, Cry1Bb2, etc.
[0011]The modern nomenclature systematically classifies the Cry proteins based upon amino acid sequence homology rather than upon insect target specificities. The classification scheme for many known toxins, not including allelic variations in individual proteins, is summarized in regularly updated tables which can be obtained from Dr. Neil Crickmore at http://cpunix.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/index.html.
[0012]1.2.3 Bio-Insecticide Polypeptide Compositions
[0013]The utility of bacterial crystal proteins as insecticides was extended beyond Lepidopterans and Dipteran larvae when the first isolation of a Coleopteran-toxic B. thuringiensis strain was reported (Krieg et al., 1983; 1984). This strain (described in U.S. Pat. No. 4,766,203, specifically incorporated herein by reference), designated B. thuringiensis var. tenebrionis, was reported to be toxic to larvae of the Coleopteran insects Agelastica alni (blue alder leaf beetle) and Leptinotarsa decemlineata (Colorado potato beetle).
[0014]U.S. Pat. No. 5,024,837 also describes hybrid B. thuringiensis var. kurstaki strains which showed activity against Lepidopteran insects. U.S. Pat. No. 4,797,279 (corresponding to EP 0221024) discloses a hybrid B. thuringiensis containing a plasmid from B. thuringiensis var. kurstaki encoding a Lepidopteran-toxic crystal protein-encoding gene and a plasmid from B. thuringiensis tenebrionis encoding a Coleopteran-toxic crystal protein-encoding gene. The hybrid B. thuringiensis strain produces crystal proteins characteristic of those made by both B. thuringiensis kurstaki and B. thuringiensis tenebrionis. U.S. Pat. No. 4,910,016 (corresponding to EP 0303379) discloses a B. thuringiensis isolate identified as B. thuringiensis MT 104 which has insecticidal activity against Coleopterans and Lepidopterans. More recently, Osman et al. disclosed a natural Bacillus thuringiensis isolate which displayed activity against at least two orders of insects and against nematodes (WO 98/30700).
[0015]It has been known for more than two decades that compositions comprising Bt insecticidal proteins are effective in providing protection from insect infestation to plants treated with such compositions. More recently, molecular genetic techniques have enabled the expression of Bt insecticidal proteins from nucleotide sequences stably inserted into plant genomes (Perlak et al., Brown & Santino, etc.). However, expression of transgenes in plants has provided an avenue for increased insect resistance to Bt's produced in plants because plants have not been shown to produce high levels of insecticidal proteins. It was initially believed that gross morphological or topological differences in gene structure and architecture between plant and bacterial systems was the limitation which prevented over-expression of Bt transgenes in plants. These differences were seemingly overcome as disclosed by Perlak et al. (U.S. Pat. No. 5,500,365) and by Brown et al. (U.S. Pat. Nos. 5,424,412 and 5,689,052) wherein transgenes encoding Bt insecticidal protein which contained plant preferred codons were shown to improve the levels of expression. Alternatively, truncating the protoxin coding domain to the shortest peptide coding domain which still encoded an insecticidal protein was also deemed sufficient to overcome the limitation of vanishingly low expression levels of the Bt encoding transgene in planta. Expression levels of Bt proteins in planta from transgenes has varied widely independent of the means used for expression, and accumulated protein levels have ranged from virtually undetectable to 2 parts per million to around 20 to 30 parts per million. However, even though all of these approaches provided improved levels of Bt protein accumulation in plants, none provided levels of expression which could ensure that insect resistance would not become a problem without the necessity of coordinate expression of one or more additional insecticidal toxins by the transgenic plant, or alternatively without the coordinate topical application of additional supplemental Bt or insecticidal chemical compositions.
[0016]The importance of accumulation of higher levels of Bt toxin for preventing insect resistance to individual Bt toxins has been understood for some time. Various laboratory studies in which selection against Bt was applied over several generations of insects have confirmed that resistance against Bt insecticidal proteins is seldom obtained. It should be emphasized that laboratory conditions represent rather low but constant selection pressure conditions, allowing for the survival of a sub-population of insects which have been subjected to insecticidal pressure and which produce the subsequent generations of insects. Succeeding generations are also maintained on media containing low but constant concentrations of insecticidal protein. Generally, concentrations used for selection pressures range from LC40 to around LC60 or so, however, LC95 concentrations have also tested for the development of resistance. In most cases, resistance is acquired slowly, generally developing within a reasonably few generations, for example 10-50 generations. However, such resistance is not observed where substantially higher levels of toxin are used, or in situations in which multiple toxins are provided.
[0017]At present, recombinant plants expressing commercially useful levels of Bt insecticidal protein generally contain only one gene encoding a single class of Bt. Such plants are anticipated to have a very limited duration of use for two reasons. First, these plants are expressing insufficient levels of the insecticidal protein to ensure that all target insects exposed to and feeding from the plant tissues will succumb due to the dose of toxin ingested. Second, because of the insufficient insecticidal protein levels, the potential for development of resistance is unreasonably increased. This is not to say that the level of toxin produced by such transgenic plants is insufficient to be effective. This merely represents the limitations of expression of δ-endotoxins in planta even when using sequences encoding Bt δ-endotoxin which have been modified to conform to plant preferred sequences. One limitation which has been observed for many Bt δ-endotoxin encoding sequences modified for expression in plants is that is has been impossible to predict which Bt δ-endotoxin would be effective for expression in plants. (For example, expression of Cry2Aa in cotton plants results in phytotoxicity when targeted to the chloroplast, however expression of a closely related cry2Ab sequence is not phytotoxic when targeted to the chloroplast. (Corbin et al., U.S. patent application Ser. No. 09/186,002). Even so, levels of δ-endotoxin protein produced in plants is not sufficient to be effective against all desired target insect species known to be susceptible to a given type and class of δ-endotoxin.
[0018]As indicated above, alternative approaches to development of resistance to insecticidal proteins has included ineffective attempts to increase the expression levels of transgenes in plants. Alternatively, additional insecticidal genes could be engineered into plants so that multiple toxins are coordinately expressed. This would provide a more effective means for delaying the onset of resistance to any one combination of Bt's, however, this still does not overcome the limitation of insufficient levels of insecticidal protein accumulating in the recombinant plant(s). An additional alternative to insufficient levels of expression has been to engineer genes encoding Bt insecticidal crystal proteins which demonstrate improved insecticidal properties, having either a broader host range or an increased biological activity, which could conceivably result in requiring less of the recombinant protein to control a target insect species than was required of the native form of the protein.
[0019]The combination of structural analyses of B. thuringiensis toxins followed by an investigation of the function of such structures, motifs, and the like has taught that specific regions of crystal protein endotoxins are, in a general way, responsible for particular functions.
[0020]Domain 1, for example, from Cry3Bb and Cry1Ac has been found to be responsible for ion channel activity, the initial step in formation of a pore (Walters et al., 1993; Von Tersch et al., 1994). Domains 2 and 3 have been found to be responsible for receptor binding and insecticidal specificity (Aronson et al., 1995; Caramori et al., 1991; Chen et al. 1993; de Maagd et al., 1996; Ge et al., 1991; Lee et al., 1992; Lee et al., 1995; Lu et al., 1994; Smedley and Ellar, 1996; Smith and Ellar, 1994; Rajamohan et al., 1995; Rajamohan et al., 1996; Wu and Dean, 1996). Regions in domain 2 and 3 can also impact the ion channel activity of some toxins (Chen et al., 1993, Wolfersberger et al., 1996; Von Tersch et al., 1994).
[0021]Unfortunately, while many investigators have attempted, few have succeeded in making mutated crystal proteins with improved insecticidal toxicity. In almost all of the examples of genetically-engineered B. thuringiensis toxins in the literature, the biological activity of the mutated crystal protein is no better than that of the wild-type protein, and in many cases, the activity is decreased or destroyed altogether (Almond and Dean, 1993; Aronson et al., 1995; Chen et al., 1993, Chen et al., 1995; Ge et al., 1991; Kwak et al., 1995; Lu et al., 1994; Rajamohan et al., 1995; Rajamohan et al., 1996; Smedley and Ellar, 1996; Smith and Ellar, 1994; Wolfersberger et al., 1996; Wu and Aronson, 1992). However, Van Rie et al. have recently accomplished the improvement of a Cry3A δ-endotoxin having increased Coleopteran insecticidal activity by identifying a single mutant having increased insecticidal activity. Van Rie et al. propose a method for identifying mutants having increased insecticidal activity in which the method consists of identifying amino acid mutations which decrease the insecticidal activity, and selectively altering those residues by site directed mutagenesis to incorporate one or more of the naturally occurring 20 amino acids at those positions, and feeding the various forms of the resulting altered protein to western or northern corn rootworms to identify those having improved activity (U.S. Pat. No. 5,659,123). While no sequences were enabled using the method, as mentioned above, Van Rie et al. succeeded in identifying only one sequence having increased activity and did not demonstrate an increase in expression of the mutant form as compared to the native sequence.
[0022]For a crystal protein having approximately 650 amino acids in the sequence of its active toxin, and the possibility of 20 different amino acids at each position in this sequence, the likelihood of arbitrarily creating a successful new structure is remote, even if a general function to a stretch of 250-300 amino acids can be assigned. Indeed, the above prior art with respect to crystal protein gene mutagenesis has been concerned primarily with studying the structure and function of the crystal proteins, using mutagenesis to perturb some step in the mode of action, rather than with engineering improved toxins.
[0023]Collectively, the limited successes in the art to develop non-naturally occurring toxins with improved insecticidal activity have stifled progress in this area and confounded the search for improved endotoxins or crystal proteins. Rather than following simple and predictable rules, the successful engineering of an improved crystal protein may involve different strategies, depending on the crystal protein being improved and the insect pests being targeted. Thus, the process is highly empirical.
[0024]Accordingly, traditional recombinant DNA technology is clearly not routine experimentation for providing improved insecticidal crystal proteins. What has been lacking in the prior art are rational methods for producing genetically-engineered B. thuringiensis crystal proteins that have improved insecticidal activity and, in particular, improved toxicity towards a wide range of Lepidopteran, Coleopteran, or Dipteran insect pests. Methods and compositions which address these concerns were disclosed in U.S. patent application Ser. No. 08/993,170 (Dec. 18, 1997; English et al.) and other related U.S. applications (Ser. Nos. 08/993,722, Dec. 18, 1997, English et al.; 08/993,755, Dec. 18, 1997, English et al.; and 08/996,441, Dec. 18, 1997, English et al.) and in Van Rie et al. (U.S. Pat. No. 5,659,123, Jun. 1, 1999). In addition, recombinantly improved δ-endotoxins have continued to be expressed poorly and/or cause phytoxic effects when expressed in plants, thus leading to the recovery of fewer commercially useful transgenic events.
2.0 SUMMARY OF THE INVENTION
[0025]Described herein are novel compositions and methods for expressing in transformed plants variant Cry3 B. thuringiensis δ-endotoxins having significant Coleopteran inhibitory activity. These compositions and methods advantageously result in plants expressing B. thuringiensis Cry3 δ-endotoxins at increased levels not previously observed for Cry δ-endotoxins. Increased levels of Cry3 δ-endotoxin expression are reflected in the attainment of higher maximal expression levels in individual transgenic insertion events. Unexpectedly, the particular compositions disclosed herein result in the recovery of an increased percentage of transgenic events which manifest expression levels that far exceed threshold levels of expression necessary for Coleopteran insect control and which provide sufficient toxin levels capable of supporting a resistance management strategy. Since Cry3 δ-endotoxins are typically less potent than other δ-endotoxins commonly used to control Lepidopteran or Dipteran target pests when expressed in transgenic plants, attainment of higher maximal levels of Cry3 δ-endotoxin expression and recovery of more transgenic events with effective expression levels are both critical in isolating transgenic events expressing Cry3 δ-endotoxin which exhibit commercially useful levels of target insect control.
[0026]Another limitation of the prior art addressed by the present invention is the development of insect resistance to δ-endotoxins provided by plant expression. Specifically, the instant invention provides a superior strategy for the delay or elimination of the development of resistance to Cry3 δ-endotoxins through improved accumulation of δ-endotoxin within plant cells so that levels of the δ-endotoxin are maintained in-planta above a threshold level of protein, typically measured in parts per million (ppm). Improved expression of δ-endotoxins, which also should be taken to mean increased expression in view of what has been previously observed in the art, is believed to result in delayed onset of insect resistance and thus extends the utility of plant expressed δ-endotoxins as insect control agents.
[0027]In preferred embodiments, the present invention provides isolated and purified novel Cry3B δ-endotoxin proteins exhibiting particularly effective insecticidal activity directed toward controlling Coleopteran pest insect species. Such δ-endotoxin proteins of the present invention are provided by expression from isolated, purified and improved or enhanced DNA or polynucleotide sequences each comprising a Cry3 δ-endotoxin coding sequence placed under the control of preferred plant functional gene expression elements such as a promoter, an untranslated leader sequence, an intron and a transcription termination and polyadenylation sequence. Some preferred DNA or polynucleotide sequences may also provide for plastid or chloroplast targeting protein sequences. Preferred DNA constructs of the present invention include those constructs which encode Cry3 δ-endotoxins exhibiting Coleopteran-inhibitory or Coleopteran-controlling activity. In an illustrative embodiment, polynucleotide sequences are assembled into an expression cassette for introduction into plant genomic DNA, wherein the expression cassette comprises a Cry3Bb δ-endotoxin variant coding sequence operably linked to a sequence comprising a promoter, an untranslated leader sequence, an intron and a transcription termination and polyadenylation sequence. In particular, a transgene localized within a plant operable polynucleotide expression cassette or polynucleotide sequence comprising an expression cassette which is comprised of genetic elements which function in plant cells to express a desired protein from a nucleic acid coding sequence (the transgene) which is operably localized within said expression cassette. The coding sequence is linked upstream to at least a promoter sequence, an untranslated leader sequence (UTL), an intron sequence, and in-frame in certain indicated embodiments to a sequence encoding a plastid or chloroplast targeting peptide. The coding sequence is also linked downstream to at least a plant functional transcription termination and polyadenylation sequence. Polynucleotide sequences comprising such an expression cassette are shown herein to improve expression of the desired protein encoded from within the cassette, improve the number of events obtained from the use of the polynucleotide sequence in plant transformation, wherein said improved number of events contain the desired transgene localized within the expression cassette and exhibit improved levels of expression of one or more desired proteins. The improved number of events are also surprisingly observed to express the desired protein at levels above 2 to 5 parts per million but in general below 200 to 500 parts per million of total cell protein. Even more surprising were some events in particular which expressed the desired protein at levels well above 500 ppm. Indicated embodiments disclose a sequence encoding a variant Cry3Bb δ-endotoxin comprising the isolated and purified SEQ ID NO:9, from NcoI to EcoRI as set forth in FIG. 1 illustrating plasmid pMON25096. Yet other embodiments disclose a variant Cry3Bb δ-endotoxin coding sequence comprising an isolated and purified SEQ ID NO:11, from NcoI to EcoRI as set forth in FIG. 2 illustrating plasmid pMON33741. It is contemplated, however, that any Cry3 δ-endotoxin exhibiting substantial Coleopteran-inhibitory or Coleopteran-controlling activity greater than or equal to that disclosed in the present invention could be utilized according to the embodiments of the present invention, with those Cry3 proteins bearing substantial homologies to Cry3Bb being particularly preferred.
[0028]In a preferred embodiment, the invention provides for transgenic plants which have been transformed with a DNA construct or expression cassette of the present invention that is expressed and translated at unexpectedly high levels by the plant which results in surprisingly high levels of δ-endotoxin accumulation. Monocotyledenous plants may be transformed according to the methods and with the DNA constructs disclosed herein. However, it is also anticipated that dicotyledenous plants could also be transformed with DNA sequences disclosed herein by one skilled in the art in order to obtain transgenic plants providing unexpectedly useful levels of insect resistance without the risk of development of insect resistance to the δ-endotoxin. The plant transformed by the instant invention may be prepared, in a further preferred embodiment, by a process including obtainment of the isolated and purified DNA construct contained within the expression cassette, and then transforming the plant with the construct so that the plant expresses the protein for which the construct encodes. Alternatively, the plant transformed by the instant invention may be prepared, in a further preferred embodiment, by a process including introduction of the isolated and purified DNA construct into a transformation competent Agrobacterium strain, and then transforming the plant with the Agrobacterium strain containing the construct so that the plant expresses the proteins for which the construct encodes. It has been observed herein that transformation of plants by the disclosed compositions and methods results surprisingly in increased frequencies of transformants exhibiting transgene expression as well as in the recovery of individual transgenic events exhibiting unexpectedly higher absolute levels of transgene expression.
[0029]It is contemplated that the increased expression levels observed in the disclosed invention will allow for reduced development of insect resistance to Bt δ-endotoxins presented to target insect pests. This may be achieved by transforming a plant with the preferred DNA construct to achieve high rates of Cry3 expression alone, or by simultaneously exposing target insects to the disclosed Cry3 δ-endotoxins along with other compositions effective in controlling Coleopteran species such as variants of Cry3B (English et al., WO 99/31248), variant Cry3A or variant Cry3D (U.S. Pat. No. 5,659,123), CryET33 and CryET34 (Donovan et al., WO 97/17600), CryET70 (U.S. application Ser. No. 09/184,748; Mettus et al., Nov. 2, 1998), Cry6A. Cry6B, Cry8B (U.S. Pat. No. 5,277,905), CryET29 (Rupar et al., WO 97/21587), insecticidal acyl lipid hydrolases, combinations of amino acid oxidases and tedanalactam synthases (Romano et al., U.S. application Ser. No. 09/063,733, filed Apr. 21, 1998), or insecticidal proteins such as VIP1 (Gay, WO 97/26339; Gourlet et al., WO 98/02453) and VIP3 (Estruch et al., U.S. Pat. No. 5,877,012; 1999) among others. Susceptible target insects include Diabroticus spp. Wire Worm in Zea mays and Leptinotarsa decemlineata (Say) in Solanum tuberosum, and Boll Weevil in Gossypium species (cotton).
[0030]It is therefore contemplated that the compositions and methods disclosed by the present invention will provide many advantages over the prior art including those specifically outlined above. Other advantages include improved control of susceptible target insect pests and achieving season long protection from insect pathogens. An additional advantage of the present invention provides for reducing the number of transgenic events that have to be screened in order to identify one which contains beneficial levels of one or more insect controlling compositions. The present invention also encompasses cells transformed with the DNA constructs disclosed herein. Also, transformation vectors such as plasmids, bacmids, artificial chromosomes, viral vectors and such are contemplated as elements for use in delivering the nucleotide compositions of the present invention into contemplated cells in order to obtain transformed host cells, both prokaryotic and eukaryotic, which express the δ-endotoxin proteins encoded by the novel DNA construct disclosed herein. It is further contemplated that in some instances the genome of a transgenic plant of the present invention will have been augmented through the stable integration of an expression cassette encoding a Coleopteran inhibitory or controlling B. thuringiensis δ-endotoxin or variants thereof as described herein. Furthermore, more than one transgene encoding an insecticidal composition will be incorporated into the nuclear genome, or alternatively, into the chloroplast or plastid genome of the transformed host plant cell. It is envisioned that more than one polynucleotide encoding an insecticidal crystal protein will be incorporated into the genome of a plant cell and it may be desirable to have two or even more sequences encoding insecticidal or other plant beneficial proteins within the nucleotide sequences contained within the cell. Such recombinantly derived proteins may exist as precursors, pro-toxins, or as fusions of beneficial proteins linked by flexible amino acid linker sequences or by protease specific cleavage sequences well known in the art. Chimeras comprising fusions of insecticidal proteins are also envisioned. The offspring of transgenic plant host cells can be manipulated artificially to produce whole recombinant plants exhibiting improved insecticidal properties, and the recombinant nucleotide sequences are shown herein to be heritable. The heritability of the elements is a preferred aspect of this invention, so that the expression elements are able to be delivered to lineal descendants of the original transformed host plant cell, giving rise first to a stably transformed plant whose constituent cells express the desired transgene, albeit tissue specific expression can be selectively manipulated generally through the choice of plant operable promoter selected for use in a given expression cassette, as described above. Transformed plants give rise to seeds containing the heritable expression cassette, and the seeds thus give rise to plants in lineal fashion which contain the expression cassette, generally in Mendelian fashion, particularly when selfed according to well known methods in the art.
3.0 BRIEF DESCRIPTION OF THE DRAWINGS
[0031]FIG. 1 illustrates plasmid pMON25096.
[0032]FIG. 2 illustrates plasmid pMON33741.
[0033]FIG. 3 illustrates plasmid pMON25097.
[0034]FIG. 4 illustrates plasmid pMON33748.
[0035]FIG. 5 illustrates the nucleotide and amino acid sequence translation of a variant Cry3Bb.11098 insecticidal protein as shown in SEQ ID NO:9.
[0036]FIG. 6 illustrates the nucleotide and amino acid sequence translation of a variant Cry3Bb.11231 insecticidal protein as shown in SEQ ID NO:11.
4.0 DETAILED DESCRIPTION OF THE INVENTION
[0037]The following detailed description of the invention is provided to aid those skilled in the art in practicing the present invention. Even so, the following detailed description should not be construed to unduly limit the present invention as modifications and variations in the embodiments discussed herein may be made by those of ordinary skill in the art without departing from the spirit and scope of the present invention.
4.1 DEFINITIONS
[0038]The following words and phrases have the meanings set forth below.
Biological functional equivalents. As used herein such equivalents with respect to the insecticidal proteins of the present invention are peptides, polypeptides and proteins that contain a sequence or moiety exhibiting sequence similarity to the novel peptides of the present invention, such as Cry3Bb.11231, and which exhibit the same or similar functional properties as that of the polypeptides disclosed herein, including insecticidal activity. Biological equivalents also include peptides, polypeptides and proteins that react with, i.e. specifically bind to antibodies raised against Cry3Bb and that exhibit the same or similar insecticidal activity, including both monoclonal and polyclonal antibodies.Combating or Controlling Insect Damage in an agricultural context refers to reduction of damage in relative units to a crop or plant part caused by infestation of an insect pest. More generally, this phrase refers to reduction in the adverse effects caused by the presence of an undesired insect in any particular location.Event refers to a transgenic plant derived from one of the following:
[0039]1. the insertion of foreign DNA into one or more unique sites in the nuclear genomic DNA; [0040]2. the insertion of foreign DNA into one or more unique sites in the plastid, chloroplast or mitochondrial genome; [0041]3. the introduction of a stable, heritable, epigenetic vector into the cytoplasm of a plastid, chloroplast, or mitochondria; or [0042]4. a combination of any of the foregoing processes.Events derived from these processes contain an expression cassette expressing a desired coding sequence as described herein. Events are also referred to as ITE's (independent transformation events).Expression: The combination of intracellular processes, including transcription, translation, and other intracellular protein and RNA processing and stabilization functions, undergone by a nucleic acid coding sequence controlled by genetic sequences which function in plant cells to achieve production of a desired product, such as a structural gene encoding an RNA molecule, or an RNA molecule being used as a substrate for a reverse transcriptase enzyme or enzyme complex.Improved or enhanced expression cassette refers to the specific combination and order of genetic elements associated with the insecticidal protein encoding sequence which, when expressed within a plant cell: [0043]gives rise to the surprising average level of that protein expressed in plants, plant tissue, or plant cells; [0044]gives rise to the unexpected number of transformation events expressing a surprisingly higher average level of insecticidal protein; [0045]gives rise to individual plants, plant tissue, or plant cells expressing an unexpectedly high level of the insecticidal protein; and [0046]gives rise to plants expressing unexpected levels of insecticidal protein effective in controlling or combating Coleopteran pests and preventing development of resistance by the Coleopteran pest to the particular insecticidal protein.Insecticidal polypeptide refers to a polypeptide having insecticidal properties, e.g., a polypeptide which exhibits the properties of inhibiting the growth, development, viability or fecundity of target insect pests.Operably Linked: Nucleic acid or polynucleotide sequences connected sequentially in linear form, so that the properties of one influence the expression characteristics of the other. A promoter, for example, operably linked to other polynucleotide sequences (which may consist of operator or enhancer sequences, untranslated or translated leader sequences, intron sequences, structural gene coding sequences, non-structural genes, transcription and translation termination sequences, and polyadenylation sequences) influences the expression of a coding or noncoding sequence, whether the product is RNA, protein, or other product. Similarly, an intron or an untranslated leader sequence can influence the expression and stability of sequences operably linked to them, and structural or non-structural gene sequences can be influenced by elements operably linked upstream, within, or downstream.Plant-Expressible Coding Regions: Amino acid coding regions or open reading frames (ORFs) which are expressible in planta because they contain typical plant regulatory elements facilitating their expression, and often include changes to the coding sequence such that plant preferred codons are utilized in place of non-preferred codons where heterologous coding regions are contemplated.Plastid Transit Peptide: Any amino acid sequence useful in targeting a linked amino acid, such as a protein fusion, to a subcellular compartment or organelle such as a plastid or chloroplast.Polynucleotide sequence: Any DNA or RNA sequence of four or more consecutive nucleotides or ribonucleotides. Generally polynucleotide sequences as disclosed herein comprise at least 50 or more nucleotides or ribonucleotides.Progeny: "Progeny" includes any offspring or descendant of the transgenic plant, or any subsequent plant which contains the transgene(s) in operable form. Progeny is not limited to one generation, but rather encompasses the transformant's descendants so to long as they contain or express the transgene(s). Seeds containing transgenic embryos as well as seeds from the transgenic plants and their offspring or descendants which, after Mendelian segregation continue to contain the transgene(s), are also important parts of the invention.Promoter: A recognition site on a DNA sequence or group of DNA sequences that provide an expression control element for a preferred polynucleotide sequence and to which RNA polymerase specifically binds and initiates RNA synthesis (transcription) of that preferred sequence.R0 is the primary regenerant plant derived from transformation of plant tissue or cells in culture. Subsequent progeny or generations derived from the R0 are referred to as R1 (first generation), R2 (second generation), etc.Regeneration: The process of growing a plant from a plant cell or group of plant cells (e.g., plant protoplast, embryo, callus, or explant).Structural Coding Sequence refers to a DNA sequence that encodes a peptide, polypeptide, or protein that is made by a cell following transcription of the structural coding sequence to messenger RNA (mRNA), followed by translation of the mRNA to the desired peptide, polypeptide, or protein product.Structural gene: A gene or polynucleotide sequence containing the coding sequence of a desired polypeptide that is expressed by transcription and translation to produce the desired polypeptide.Synthetic gene: Synthetic genes encoding the B. thuringiensis δ-endotoxins of the present invention are those prepared in a manner involving any sort of genetic isolation or manipulation which alters the naturally occurring coding sequence of the δ-endotoxin gene. This includes isolation of the gene from its naturally occurring state, manipulation of the gene as by codon modification (as described herein), or site-specific mutagenesis (as described herein), truncation of the gene or any other manipulative or isolative method. A synthetic gene can also be a polynucleotide sequence which is not known to be naturally occurring but which encodes a useful polypeptide or other product such as a tRNA or an antisense polynucleotide. A non-naturally occurring polynucleotide sequence.Substantial homology: As this term is used herein, it refers to nucleic acid or polypeptide sequences which are about 86% homologous, to about 90% homologous, to about 95% homologous, to about 99% homologous. More specifically, the to inventors envision substantial homologues to be about 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, and 99 percent homologous to the referent nucleic acid sequence of polypeptide.Terminator: With reference to eukaryotic nuclear gene expression processes, the operable 3' end transcription termination and polyadenylation sequence. With reference to prokaryotic gene expression, and including plastid or chloroplast gene expression, the operable DNA sequence at the 3' end of an open reading frame which, for ORFs expressing protein product, at least one termination codon in frame with the coding sequence of the ORF, which may also be followed by a DNA sequence encoding a transcription termination signal which may cause the translated RNA or mRNA product to form a hairpin or other three dimensional structure which may or may not act together with one or more soluble structural proteins to cause transcription to be interrupted.Transformation: A process of introducing an exogenous polynucleotide sequence (e.g., a vector, or a recombinant or non-recombinant DNA or RNA molecule) into a cell or protoplast in which that exogenous polynucleotide is incorporated into a heritable genetic element or is capable of autonomous replication and thus stably maintained within that cell or protoplast as well as in the progeny of that cell or protoplast.Transformed cell: A cell which contains a heritable genetic element altered by the introduction of one or more exogenous DNA molecules. A transgenic cell. Exemplary transformed or transgenic cells include plant calli derived from a transformed plant cell and particular cells such as leaf, root, stem, e.g., somatic cells, or reproductive (germ) cells obtained from a transgenic plant.Transgene: A gene construct, expression cassette, or DNA segment or sequence comprising an ORF which is desired to be expressed in the recipient cell, tissue or organism. This may include an entire plasmid, or other vector, or may simply include the functional coding sequence, region, domain, or segment of the transferred DNA sequence.Transgenic event: A plant or progeny thereof derived from a plant cell or protoplast manufactured or constructed to contain one or more exogenous DNA molecules inserted into the nuclear or other genome of the plant cell, or introduced and stably maintained within the cytoplasm of a plastid, chloroplast, or mitochondria, which confers some physically detectable phenotype upon the plant or progeny thereof.Transgenic plant: A plant or progeny thereof which has been genetically modified to contain and express heterologous DNA sequences either as proteins or as nucleic acids. As specifically exemplified herein, a transgenic corn plant is genetically modified to contain and express at least one heterologous DNA sequence operably linked to and under the regulatory control of transcriptional control sequences which function together in plant cells or tissue or in whole plants to achieve expression from a nucleic acid sequence encoding an insecticidal δ-endotoxin protein or an amino acid sequence variant thereof. A transgenic plant may also be referred to as a transformed plant. A transgenic plant also refers to progeny of the initial transgenic plant where those progeny contain and express the heterologous coding sequence under the regulatory control of the plant-expressible transcription control sequences described herein.Vector: A polynucleotide capable of replication in a host cell and/or to which another polynucleotide sequence can be operatively linked so as to bring about replication of the linked sequence. A plasmid is an exemplary vector.
[0047]The present invention discloses novel DNA constructs comprising polynucleotide sequences encoding B. thuringiensis δ-endotoxins. Methods for the construction and expression of synthetic B. thuringiensis genes in plants are well known by those of skill in the art and are described in detail in U.S. Pat. No. 5,500,365. The present invention contemplates the use of Cry3B B. thuringiensis genes in the transformation of both monocotyledonous and dicotyledonous plants. To potentiate the expression of these genes, the present invention provides DNA constructs comprising polynucleotide segments encoding plastid targeting peptides positioned upstream of and in frame with the polynucleotide sequences encoding the desired B. thuringiensis δ-endotoxins, along with various combinations of untranslated leader sequences, plant functional intron sequences, and transcription termination and polyadenylation sequences.
[0048]In one aspect, nucleotide sequence information provided by the invention allows for the preparation of relatively short DNA sequences having the ability to specifically hybridize to gene sequences of the selected polynucleotides disclosed herein. In these aspects, nucleic acid probes of an appropriate length are prepared based on a consideration of selected polypeptide sequences encoding Coleopteran inhibitory Cry3B δ-endotoxin polypeptides. e.g., a sequence such as that shown in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, and SEQ ID NO:12. These nucleic acid probes may also be prepared based on a consideration of selected polynucleotide sequences encoding a plastid targeting peptide, such as those shown in SEQ ID NO:26 The ability of such nucleic acid probes to specifically hybridize to a gene sequence encoding a δ-endotoxin polypeptide or a plastid targeting peptide sequence lends to them particular utility in a variety of embodiments. Most importantly, the probes may be used in a variety of assays for detecting the presence of complementary sequences in a given sample.
[0049]In certain embodiments, it is advantageous to use oligonucleotide primers. The sequence of such primers is designed using a polynucleotide of the present invention for use in detecting, amplifying or mutating a defined segment of a crystal protein gene from B. thuringiensis using thermal amplification technology. The process may also be used to detect, amplify or mutate a defined segment of the polynucleotide encoding a plastid targeting peptide. Segments of genes related to the polynucleotides encoding the δ-endotoxin polypeptides and plastid targeting peptides of the present invention may also be amplified by using such primers and thermal amplification methods.
[0050]To provide certain of the advantages in accordance with the present invention, a preferred nucleic acid sequence employed for hybridization studies or assays includes a polynucleotide sequences at least about 14 to 30 or so nucleotides in length complimentary to a nucleotide sequence encoding a crystal protein, or polynucleotide sequences at least about 14 to 30 or so nucleotides in length complimentary to a nucleotide sequence encoding a plastid targeting peptide.
[0051]A size of at least 14 nucleotides in length helps to ensure that the fragment will be of sufficient length to form a duplex molecule that is both stable and selective. Molecules having complementary sequences over segments greater than 14 bases in length are generally preferred. In order to increase stability and selectivity of the hybrid, and thereby improve the quality and degree of specific hybrid molecules obtained, one will generally prefer to design nucleic acid molecules having gene-complementary sequences of 14 to 20 nucleotides, or even longer where desired. Such fragments may be readily prepared by, for example, directly synthesizing the fragment by chemical means, by application of nucleic acid reproduction technology, such as the PCR® technology of U.S. Pat. Nos. 4,683,195, and 4,683,202, or by excising selected DNA fragments from recombinant plasmids containing appropriate inserts and suitable restriction sites.
[0052]The present invention also contemplates an expression vector comprising a polynucleotide of the present invention. Thus, in one embodiment an expression vector is an isolated and purified DNA molecule comprising a promoter operatively linked to a coding region that encodes a polypeptide of the present invention, which coding region is operatively linked to a transcription-terminating region, whereby the promoter drives the transcription of the coding region. The coding region may include a segment encoding a B. thuringiensis δ-endotoxin and a segment encoding a plastid target peptide. The DNA molecule comprising the expression vector may also contain a functional intron. As used herein, the terms "operatively linked" or "operably linked" mean that a promoter is connected to a coding region in such a way that the transcription of that coding region is controlled and regulated by that promoter. Means for operatively linking a promoter to a coding region to regulate both upstream and downstream are well known in the art.
[0053]Preferred plant transformation vectors include those derived from a Ti plasmid of Agrobacterium tumefaciens, as well as those disclosed, e.g., by Herrera-Estrella (1983), Bevan (1983), Klee (1985) and Eur. Pat Appl. No. EP0120516.
[0054]Promoters that function in bacteria are well known in the art. Exemplary and preferred promoters for the B. thuringiensis crystal proteins include the sigA, sigE, and sigK gene promoters. Alternatively, native, mutagenized, heterologous, or recombinant promoters derived from Bacillus thuringiensis δ-endotoxin protein coding sequences can be used.
[0055]Where an expression vector of the present invention is to be used to transform a plant, a promoter is selected that has the ability to drive expression in that particular species of plant. Promoters that function in different plant species are also well known in the art. Promoters useful in expression of polypeptide coding sequences in plants are those which are inducible, viral, synthetic, or constitutive as described (Poszkowski et al., 1989; Odell et al., 1985), and/or temporally regulated, spatially regulated, and spatio-temporally regulated (Chau et al., 1989). Preferred promoters include the enhanced CaMV35S promoters, and the FMV35S promoter. Other promoters include the POX promoter, the ScbDNA virus early promoter, and the yellow mottle virus promoter.
[0056]In accordance with the present invention, expression vectors designed to specifically potentiate the expression of the polypeptide in the transformed plant may include certain regions encoding plastid targeting peptides (PTP). These regions allow for the cellular processes involved in transcription, translation and expression of the encoded protein to be fully exploited when associated with certain B. thuringiensis δ-endotoxins. Such plastid targeting peptides function in a variety of ways, such as for example, by transferring the expressed protein to the cell structure in which it most effectively operates, or by transferring the expressed protein to areas of the cell in which cellular processes necessary for expression are concentrated.
[0057]In the case of Cry3B, elevated expression is critical in obtaining transgenic corn with CRW control since the LC50 of Cry3B against CRW is significantly higher than the LC50 of the B. thuringiensis toxins currently used to control target pests such as Colorado Potato Beetle in potato (Cry3A) or European Corn Borer in corn (Cry1Ab).
[0058]Increased expression is also especially valuable in that it provides additional protection against development of resistance vial a high dose strategy (McGaughey and Whalon, 1993; Roush, 1994). High level expression is even further desirable as it provides sustained insect protection in instances where insecticidal gene expression decreases due to environmental conditions. Additionally and unexpectedly, corn plants transformed with vectors expressing Coleopteran inhibitory Cry3B or variant proteins exhibited normal growth and development.
[0059]An example of a plastid or chloroplast targeting peptide (CTP) is a chloroplast targeting peptide. Chloroplast targeting peptides have been found particularly useful in the glyphosate resistant selectable marker system. In this system, plants transformed to express a protein conferring glyphosate resistance are transformed with a PTP that targets the peptide to the cell's chloroplasts. Glyphosate inhibits the shikimic acid pathway which leads to the biosynthesis of aromatic compounds including amino acids and vitamins. Specifically, glyphosate inhibits the conversion of phosphoenolpyruvic acid and 3-phosphoshikimic acid to 5-enolpyruvyl-3-phosphoshikimic acid by inhibiting the enzyme 5-enolpyruvyl-3-phosphoshikimic acid synthase (EPSP synthase or EPSPS). Supplemental EPSPS, conferred via insertion of a transgene encoding this enzyme, allows the cell to resist the effects of the glyphosate. Thus, as the herbicide glyphosate functions to kill the cell by interrupting aromatic amino acid biosynthesis, particularly in the cell's chloroplast, the CTP allows increased resistance to the herbicide by concentrating what glyphosate resistance enzyme the cell expresses in the chloroplast, i.e. in the target organelle of the cell. Exemplary herbicide resistance enzymes include EPSPS as noted above, glyphosate oxido-reductase (GOX) and the aro-A gene (U.S. Pat. No. 4,535,060).
[0060]CTP's can target proteins to chloroplasts and other plastids. For example, the target organelle may be the amyloplast. Preferred CTP's of the present invention include those targeting both chloroplasts as well as other plastids. Specific examples of preferred CTP's include the maize RUBISCO SSU protein CTP, and functionally related peptides. An exemplary CTP polypeptide is shown in SEQ ID NO:26. A polynucleotide sequence encoding for this CTP polypeptide is shown in SEQ ID NO:25.
[0061]The expression of a gene which exists in double-stranded DNA form involves transcription of messenger RNA (mRNA) from the coding strand of the DNA by an RNA polymerase enzyme, and the subsequent processing of the mRNA primary transcript inside the nucleus. Transcription of DNA into mRNA is regulated by a region of DNA usually referred to as the "promoter". The promoter region contains a sequence of bases that signals RNA polymerase to associate with the DNA and to initiate the transcription of mRNA using one of the DNA strands as a template to make a corresponding strand of RNA. The particular promoter selected should be capable of causing sufficient expression of the enzyme coding sequence to result in the production of an effective insecticidal amount of the B. thuringiensis protein.
[0062]The 3' non-translated region of the chimeric plant genes or the present invention also contains a polyadenylation signal which functions in plants to cause the addition of adenylate nucleotides to the 3' end of the RNA. Examples of preferred 3' regions are (1) the 3' transcribed, non-translated regions containing the polyadenylation signal of Agrobacterium tumor-inducing (Ti) plasmid genes, such as the nopaline synthase (NOS) gene and (2) the 3' ends of plant genes such as the pea ssRUBISCO E9 gene (Fischhoff et al., 1987).
[0063]A promoter is selected for its ability to direct the transformed plant cell's or transgenic plant's transcriptional activity to the coding region, to ensure sufficient to expression of the enzyme coding sequence to result in the production of insecticidal amounts of the B. thuringiensis protein. Structural genes can be driven by a variety of promoters in plant tissues. Promoters can be near-constitutive (i.e. they drive transcription of the transgene in all tissue), such as the CaMV35S promoter, or tissue-specific or developmentally specific promoters affecting dicots or monocots. Where the promoter is a near-constitutive promoter such as CaMV35S or FMV35S, increases in polypeptide expression are found in a variety of transformed plant tissues and most plant organs (e.g., callus, leaf, seed and root). Enhanced or duplicate versions of the CaMV35S and FMV35S promoters are particularly useful in the practice of this invention (Kay et al., 1987; Rogers, U.S. Pat. No. 5,378,619). Tandemly duplicated enhancer sequences have been demonstrated to be of particular significance, for example, as described in Neuhaus et al. (Tissue-specific expression from promoter AS-1 in transgenic tobacco. Plant Cell 6: 827-834; 1994).
[0064]Those skilled in the art will recognize that there are a number of promoters which are active in plant cells, and have been described in the literature. Such promoters may be obtained from plants or plant viruses and include, but are not limited to, the nopaline synthase (NOS) and octopine synthase (OCS) promoters (which are carried on tumor-inducing plasmids of A. tumefaciens), the cauliflower mosaic virus (CaMV) 19S and 35S promoters, the light-inducible promoter from the small subunit of ribulose 1,5-bisphosphate carboxylase (ssRUBISCO, a very abundant plant polypeptide), the rice Act1 promoter, POX promoter, yellow mottle virus promoter, ScBV virus early promoter, the Figwort Mosaic Virus (FMV) 35S promoter, and the AS4 35S promoter (root enhanced expression from 35S promoter linked to multiple tandem as-1 sequences as in Neuhaus et al.). All of these promoters have been used to create various types of DNA constructs which have been expressed in plants (see e.g., McElroy et al., 1990, U.S. Pat. No. 5,463,175).
[0065]In addition, it may also be preferred to bring about expression of the B. thuringiensis δ-endotoxin in specific tissues of the plant by using plant integrating vectors containing a tissue-specific promoter. Specific target tissues may include the leaf, stem, root, tuber, seed, fruit, etc., and the promoter chosen should have the desired tissue and developmental specificity. Therefore, promoter function should be optimized by selecting a promoter with the desired tissue expression capabilities and approximate promoter strength and selecting a transformant which produces the desired insecticidal activity in the target tissues. This selection approach from the pool of transformants is routinely employed in expression of heterologous structural genes in plants since there is variation between transformants containing the same heterologous gene due to the site of gene insertion within the plant genome (commonly referred to as "position effect"). In addition to promoters which are known to cause transcription (constitutive or tissue-specific) of DNA in plant cells, other promoters may be identified for use in the current invention by screening a plant cDNA library for genes which are selectively or preferably expressed in the target tissues and then determine the promoter regions.
[0066]An exemplary tissue-specific promoter is the lectin promoter, which is specific for seed tissue. The lectin protein in soybean seeds is encoded by a single gene (Le1) that is only expressed during seed maturation and accounts for about 2 to about 5% of total seed mRNA. The lectin gene and seed-specific promoter have been fully characterized and used to direct seed specific expression in transgenic tobacco plants (Vodkin et al., 1983; Lindstrom et al., 1990). An expression vector containing a coding region that encodes a polypeptide of interest can be engineered to be under control of the lectin promoter and that vector may be introduced into plants using, for example, a protoplast transformation method (Dhir et al., 1991). The expression of the polypeptide would then be directed specifically to the seeds of the transgenic plant.
[0067]A transgenic plant of the present invention produced from a plant cell transformed with a tissue specific promoter can be crossed with a second transgenic plant developed from a plant cell transformed with a different tissue specific promoter to produce a hybrid transgenic plant that shows the effects of transformation in more than one specific tissue.
[0068]Other exemplary tissue-specific promoters are corn sucrose synthetase 1 (Yang et al., 1990), corn alcohol dehydrogenase 1 (Vogel et al., 1989), corn light harvesting complex (Simpson, 1986), corn heat shock protein (Odell et al., 1985), pea small subunit RuBP carboxylase (Poulsen et al., 1986; Cashmore et al., 1983), Ti plasmid mannopine synthase (McBride and Summerfelt, 1989), Ti plasmid nopaline synthase (Langridge et al., 1989), petunia chalcone isomerase (Van Tunen et al., 1988), bean glycine rich protein 1 (Keller et al., 1989), CaMV 35S transcript (Odell et al., 1985) and Potato patatin (Wenzier et al., 1989). Preferred promoters are the cauliflower mosaic virus (CaMV 35S) promoter and the S-E9 small subunit RuBP carboxylase promoter.
[0069]The promoters used in the DNA constructs of the present invention may be modified, if desired, to affect their control characteristics. For example, the CaMV35S promoter may be ligated to the portion of the ssRUBISCO gene that represses the expression of ssRUBISCO in the absence of light, to create a promoter which is active in leaves but not in roots. The resulting chimeric promoter may be used as described herein. For purposes of this description, the phrase "CaMV35S" promoter thus includes variations of CaMV35S promoter, e.g., promoters derived by means of ligation with operator regions, random or controlled mutagenesis, etc. Furthermore, the promoters may be altered to contain multiple "enhancer sequences" to assist in elevating gene expression. Examples of such enhancer sequences have been reported by Kay et al. (1987) and Neuhaus et al. (1994).
[0070]The RNA produced by a DNA construct of the present invention also contains a 5' non-translated leader sequence. This sequence can be derived from the promoter selected to express the gene, and can be specifically modified so as to increase translation of the mRNA. The 5' non-translated regions can also be obtained from viral RNAs, from suitable eukaryotic genes, or from a synthetic gene sequence. The present invention is not limited to constructs wherein the non-translated region is derived from the 5' non-translated sequence that accompanies the promoter sequence. As shown below, a plant gene leader sequence which is useful in the present invention is the petunia heat shock protein 70 (hsp70) lender (Winter et al., 1988), the wheat CAB leader, or the wheat PER leader.
[0071]An exemplary embodiment of the invention involves the plastid targeting of the B. thuringiensis sequence. Such plastid targeting sequences have been isolated from numerous nuclear encoded plant genes and have been shown to direct importation of cytoplasmically synthesized proteins into plastids (reviewed in Keegstra and Olsen, 1989). A variety of plastid targeting sequences, well known in the art, including but not limited to ADPGPP, EPSP synthase, or ssRUBISCO, may be utilized in practicing this invention. In alternative embodiments preferred, plastidic targeting sequences (peptide and nucleic acid) for monocotyledonous crops may consist of a genomic fragment coding containing an intronic sequence as well as a duplicated proteolytic cleavage site in the encoded plastidic targeting sequences.
[0072]The most preferred CTP encoding nucleic acid sequence, referred to herein as zmSSU CTP (SEQ ID NO:25), consisting of a genomic fragment containing an intronic sequence as well as a duplicated proteolytic cleavage site in the encoded plastidic targeting sequences, was derived from plastidic targeting sequence zmS1 (Russell et al., 1993). Direct translational fusions of zmSSU CTP peptide sequence (SEQ ID NO:26) to the amino terminus of the sequence has been shown to be useful in obtaining elevated levels of the polypeptide in transgenic maize. In-frame fusions of the zmSSU CTP nucleic acid sequence (SEQ ID NO:25) to a cry3b gene (SEQ ID NO:1) or gene variant can be effected by ligation of an NcoI site engineered into the 3' (C-terminal encoding) end of the zmSSU CTP sequence to a 5' NcoI site engineered into the N-terminal encoding end of the cry3B or variant coding sequence.
[0073]The preferred CTP sequence for dicotyledonous crops consists of a genomic coding fragment containing the chloroplast targeting peptide sequence from the EPSP synthase gene of Arabidopsis thaliana in which the transit peptide cleavage site of the pea ssRUBISCO CTP replaces the native EPSP synthase CTP cleavage site (Klee et al., 1987).
[0074]As noted above, the 3' non-translated region of the chimeric plant genes of the present invention contains a polyadenylation signal which functions in plants to cause the addition of adenylate nucleotides to the 3' end of the RNA. Examples of preferred 3' regions are (I) the 3' transcribed, non-translated regions containing the polyadenylate signal of Agrobacterium tumor-inducing (Ti) plasmid genes, such as the nopaline synthase (NOS) gene and (2) plant genes such as the pen ssRUBISCO E9 gene (Fischhoff et al., 1987).
[0075]For optimized expression in monocotyledonous plants, an intron may also be included in the DNA expression construct. Such an intron is typically placed near the 5'-end of the mRNA in an untranslated sequence. This intron could be obtained from, but not limited to, a set of introns consisting of the maize Heat Shock Protein (HSP) 70 intron (U.S. Pat. No. 5,424,412; 1995), the rice Act1 intron (McElroy et al., 1990), the Adh intron 1 (Callis et al., 1987), or the sucrose synthase intron (Vasil et al., 1989). As shown herein, the maize HSP70 intron (SEQ ID NO:33) and the rice actin intron (SEQ ID NO:32) are particularly useful in the present invention.
[0076]RNA polymerase transcribes through a coding DNA sequence to a site where polyadenylation occurs. Typically, DNA sequences located a few hundred base pairs downstream of the polyadenylation site serve to terminate transcription. Those DNA sequences are referred to herein as transcription-termination regions. Those regions are required for efficient polyadenylation of transcribed messenger RNA (mRNA).
[0077]Constructs will typically include the gene of interest along with a 3' end DNA sequence that acts as a signal to terminate transcription and allow for the poly-adenylation of the resultant mRNA. The most preferred 3' elements are contemplated to be those from the nopaline synthase gene of A. tumefaciens (nos 3' end) (Bevan et al., 1983), the terminator for the T7 transcript from the octopine synthase gene of A. tumefaciens, and the 3' end of the protease inhibitor i or ii genes from potato or tomato. Regulatory elements such as TMV Ω element (Gallie, et al., 1989), may further be included where desired.
[0078]Another type of element which can regulate gene expression is the DNA sequence between the transcription initiation site and the start of the coding sequence, termed the untranslated leader sequence. The leader sequence can influence gene expression. Compilations of leader sequences have been made to predict optimum or sub-optimum sequences and generate "consensus" and preferred leader sequences (Joshi, 1987). Preferred leader sequences are contemplated to include those which comprise sequences predicted to direct optimum expression of the linked structural gene. i.e. to include a preferred consensus leader sequence which may increase or maintain mRNA stability and prevent inappropriate initiation of translation. The choice of such sequences will be known to those of skill in the art in light of the present disclosure. Sequences that are derived from genes that are highly expressed in plants, and in maize in particular, will be most preferred. One particularly preferred leader may be the wheat CAB leader (SEQ ID NO:31).
[0079]Transcription enhancers or duplications of enhancers could be used to increase expression. These enhancers often are found 5' to the start of transcription in a promoter that functions in eukaryotic cells, but can often be inserted in the forward or reverse orientation 5' or 3' to the coding sequence. Examples of enhancers include elements from the CaMV 35S promoter, octopine synthase genes (Ellis et al., 1987), the rice actin gene, and promoter from non-plant eukaryotes (e.g., yeast; Ma et al., 1988).
[0080]The choice of which expression vector and ultimately to which promoter a polypeptide coding region is operatively linked depends directly on the functional properties desired, e.g., the location and timing of protein expression, and the host cell to be transformed. These are well known limitations inherent in the art of constructing recombinant DNA molecules. However, a vector useful in practicing the present invention is capable of directing the expression of the polypeptide coding region to which it is operatively linked.
[0081]Typical vectors useful for expression of genes in higher plants are well known in the art and include vectors derived from the tumor-inducing (Ti) plasmid of A. tumefaciens described (Rogers et al., 1987). However, several other plant integrating vector systems are known to function in plants including pCaMVCN transfer control vector described (Fromm et al., 1985). pCaMVCN (available from Pharmacia, Piscataway, N.J.) includes the CaMV35S promoter.
[0082]In preferred embodiments, the vector used to express the polypeptide includes a selection marker that is effective in a plant cell, preferably a drug resistance selection marker. One preferred drug resistance marker is the gene whose expression results in kanamycin resistance; i.e. the chimeric gene containing the nopaline synthase promoter, Tn5 neomycin phosphotransferase II (nptII) and nopaline synthase 3' non-translated region described (Rogers et al., 1988).
[0083]Means for preparing expression vectors are well known in the art. Expression (transformation) vectors used to transform plants and methods of making those vectors are described in U.S. Pat. Nos. 4,971,908, 4,940,835, 4,769,061 and 4,757,011. Those vectors can be modified to include a coding sequence in accordance with the present invention.
[0084]A coding region that encodes a polypeptide having the ability to confer insecticidal activity to a cell is preferably a polynucleotide encoding a B. thuringiensis δ-endotoxin or a functional equivalent of such a polynucleotide. In accordance with such embodiments, a coding region comprising the DNA sequences of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, and SEQ ID NO:11 are also preferred.
[0085]Specific B. thuringiensis δ-endotoxin polypeptide-encoding ORFs contained within expression cassettes that have been shown to express the B. thuringiensis δ-endotoxins at high levels in transformed plants. Preferred cassettes include those contained in plasmids pMON33709, pMON33710, pMON33722, pMON33723, pMON25096, pMON25097, pMON33741, and pMON33748. The expression cassettes in these plasmids are respectively encoded for by the sequences shown in SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, and SEQ ID NO:23. More preferably, plants may be successfully transformed with any expression cassettes comprising the nucleotide sequences of nucleotide 14 to 3431 of SEQ ID NO:36, 14 to 3025 of SEQ ID NO:38, 14 to 3431 of SEQ ID NO:17, 14 to 3020 of SEQ ID NO:19, 14 to 3020 of SEQ ID NO:21, or 25 to 3450 of SEQ ID NO:23 (pMON33722, pMON33723, pMON25096, pMON25097, pMON33741, and pMON33748). Most preferably, plants may be successfully transformed with any expression cassettes comprising the nucleotide sequences of nucleotide 14 to 3431 of SEQ ID NO:17, 14 to 3020 of SEQ ID NO:19, 14 to 3020 of SEQ ID NO:21, or 25 to 3450 of SEQ ID NO:23 (pMON25096, pMON25097, pMON33741, and pMON33748).
[0086]The work described herein has identified methods of potentiating in planta expression of B. thuringiensis δ-endotoxins, which confer resistance to insect pathogens when incorporated into the genome of susceptible plants. U.S. Pat. No. 5,500,365 describes a method for synthesizing plant genes to optimize the expression level of the protein for which the synthesized gene encodes. This method relates to the modification of the structural gene sequences of the exogenous transgene, to make them more "plant-like" and therefore more likely to be translated and expressed by the plant. A similar method for enhanced expression of transgenes in monocotyledonous plants is disclosed in U.S. Pat. No. 5,689,052. Agronomic, horticultural, ornamental, and other economically or commercially useful plants can be made in accordance with the methods described herein, to express B. thuringiensis δ-endotoxins at levels high enough to confer resistance to insect pathogens.
[0087]Such plants may co-express the B. thuringiensis δ-endotoxin polypeptide along with other antifungal, antibacterial, or antiviral pathogenesis-related peptides, polypeptides, or proteins; insecticidal proteins; proteins conferring herbicide resistance, and proteins involved in improving the quality of plant products or agronomic performance of plants. Simultaneous co-expression of multiple proteins in plants is advantageous in that it exploits more than one mode of action to control plant pathogenic damage. This can minimize the possibility of developing resistant to pathogen strains, broaden the scope of resistance, and potentially result in a synergistic insecticidal effect, thereby enhancing plants ability to resist insect infestation (WO 92/17591).
[0088]Ultimately, the most desirable DNA segments for introduction into a monocot genome may be homologous genes or gene families which encode a desired trait (for example, increased yield), and which are introduced under the control of novel promoters or enhancers, etc., or perhaps even homologous or tissue specific (e.g., root-collar/sheath-, whorl-, stalk-, earshank-, kernel- or leaf-specific) promoters or control elements. Indeed, it is envisioned that a particular use of the present invention may be the production of transformants comprising a transgene which is targeted in a tissue-specific manner. For example, insect resistant genes may be expressed specifically in the whorl and collar/sheath tissues which are targets for the first and second broods, respectively, of ECB. Likewise, it is desirable that genes encoding proteins with particular activity against rootworm be preferentially expressed in root tissues.
[0089]Vectors for use in tissue-specific targeting of gene expression in transgenic plants typically will include tissue-specific promoters and also may include other tissue-specific control elements such as enhancer sequences. Promoters which direct specific or enhanced expression in certain plant tissues will be known to those of skill in the art in light of the present disclosure.
[0090]It also is contemplated that tissue specific expression may be functionally accomplished by introducing a constitutively expressed gene (all tissues) in combination with an antisense gene that is expressed only in those tissues where the gene product is not desired. For example, a gene coding for the crystal toxin protein from B. thuringiensis may be introduced such that it is expressed in all tissues using the 35S promoter from Cauliflower Mosaic Virus. Alternatively, a rice actin promoter or a histone promoter from a dicot or monocot species also could be used for constitutive expression of a gene. Furthermore, it is contemplated that promoters combining elements from more than one promoter may be useful. For example, U.S. Pat. No. 5,491,288 discloses combining a Cauliflower Mosaic Virus promoter with a histone promoter. Therefore, expression of an antisense transcript of a Bt δ-endotoxin gene in a maize kernel, using for example a zein promoter, would prevent accumulation of the δ-endotoxin in seed. Hence the protein encoded by the introduced gene would be present in all tissues except the kernel. It is specifically contemplated by the inventors that a similar strategy could be used with the instant invention to direct expression of a screenable or selectable marker in seed tissue.
[0091]Alternatively, one may wish to obtain novel tissue-specific promoter sequences for use in accordance with the present invention. To achieve this, one may first isolate cDNA clones from the tissue concerned and identify those clones which are expressed specifically in that tissue, for example, using Northern blotting. Ideally, one would like to identify a gene that is not present in a high copy number, but which gene product is relatively abundant in specific tissues. The promoter and control elements of corresponding genomic clones may thus be localized using the techniques of molecular biology known to those of skill in the art.
[0092]It is contemplated that expression of some genes in transgenic plants will be desired only under specified conditions. For example, it is proposed that expression of certain genes that confer resistance to environmentally stress factors such as drought will be desired only under actual stress conditions. It further is contemplated that expression of such genes throughout a plants development may have detrimental effects. It is known that a large number of genes exist that respond to the environment. For example, expression of some genes such as rbcS, encoding the small subunit of ribulose bisphosphate carboxylase, is regulated by light as mediated through phytochrome. Other genes are induced by secondary stimuli. For example, synthesis of abscisic acid (ABA) is induced by certain environmental factors, including but not limited to water stress. A number of genes have been shown to be induced by ABA (Skriver and Mundy, 1990). It also is expected that expression of genes conferring resistance to insect predation would be desired only under conditions of actual insect infestation. Therefore, for some desired traits, inducible expression of genes in transgenic plants will be desired.
[0093]It is proposed that, in some embodiments of the present invention, expression of a gene in a transgenic plant will be desired only in a certain time period during the development of the plant. Developmental timing frequently is correlated with tissue specific gene expression. For example expression of zein storage proteins is initiated in the endosperm about 15 days after pollination.
[0094]It is contemplated that the method described in this invention could be used to obtain substantially improved expression of a number of novel B. thuringiensis to endotoxins isolated as described below. Identification of new Bacillus thuringiensis strains encoding crystalline endotoxins with insecticidal activity has been described previously (Donovan et al., 1992). Isolation of the B. thuringiensis endotoxin, followed by amino terminal amino acid sequencing, back-translation of the amino acid sequence to design an oligonucleotide probe or use of a related B. thuringiensis gene as a probe, followed by cloning of the gene encoding the endotoxin by hybridization are familiar to those skilled in the art and have been described (see e.g., Donovan et al., 1992, U.S. Pat. No. 5,264,364). Cry3Bb Bacillus thuringiensis δ-endotoxins with improved Coleopteran inhibitory activity can be achieved using the methods described in English et al. (WO 99/31248).
[0095]A plant transformed with an expression vector of the present invention is also contemplated. A transgenic plant derived from such a transformed or transgenic cell is also contemplated. Those skilled in the art will recognize that a chimeric plant gene containing a structural coding sequence of the present invention can be inserted into the genome of a plant by methods well known in the art. Such methods for DNA transformation of plant cells include Agrobacterium-mediated plant transformation, the use of liposomes, transformation using viruses or pollen, electroporation, protoplast transformation, gene transfer into pollen, injection or vacuum infiltration (Bechtold et al., Meth. Mo. Biol., 82:259-266; 1998) into reproductive organs, injection into immature embryos and particle bombardment. Each of these methods has distinct advantages and disadvantages. Thus, one particular method of introducing genes into a particular plant strain may not necessarily be the most effective for another plant strain, but it is well known which methods are useful for a particular plant strain.
[0096]Technology for introduction of DNA into cells is well-known to those of skill in the art. Four general methods for delivering a gene into cells have been described: (1) chemical methods (Graham and van der Eb, 1973); (2) physical methods such as microinjection (Capecchi, 1980), electroporation (Wong and Neumann, 1982; Fromm et al., 1985) and the gene gun (Johnston and Tang, 1994; Fynan et al., 1993); (3) viral vectors (Clapp, 1993; Lu et al., 1993; Eglitis and Anderson, 1988a; 1988b); and (4) receptor-mediated mechanisms (Curiel et al., 1991; 1992; Wagner et al., 1992).
[0097]An advantageous method for delivering transforming DNA segments to plant cells is microprojectile bombardment. In this method, particles may be coated with nucleic acids and delivered into cells by a propelling force. Exemplary particles include those comprised of tungsten, gold, platinum, and the like. Using these particles, DNA is carried through the cell wall and into the cytoplasm on the surface of small metal particles as described (Klein et al., 1987; Klein et al., 1988, Kawata et al., 1988). The metal particles penetrate through several layers of cells and thus allow the transformation of cells within tissue explants.
[0098]An advantage of microprojectile bombardment, in addition to it being an effective means of reproducibly stably transforming plant cells, is that neither the isolation of protoplasts (Cristou et al., 1988) nor the susceptibility to Agrobacterium infection is required. An illustrative embodiment of a method for delivering DNA into plant cells by acceleration is a Biolistics Particle Delivery System, which can be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with the plant cultured cells in suspension. The screen disperses the particles so that they are not delivered to the recipient cells in large aggregates. It is believed that a screen intervening between the projectile apparatus and the cells to be bombarded reduces the size of projectiles aggregate and may contribute to a higher frequency of transformation by reducing damage inflicted on the recipient cells by projectiles that are too large.
[0099]For the bombardment, cells in suspension are preferably concentrated on filters or solid culture medium. Alternatively, immature embryos or other target cells may be arranged on solid culture medium. The cells to be bombarded are positioned at an appropriate distance below the macroprojectile stopping plate. If desired, one or more screens are also positioned between the acceleration device and the cells to be bombarded. Through the use of techniques set forth herein one may obtain up to 1000 or more foci of cells transiently expressing a marker gene. The number of cells in a focus which express the exogenous gene product 48 hours post-bombardment often range from 1 to 10 and average 1 to 3.
[0100]In bombardment transformation, one may optimize the pre-bombardment culturing conditions and the bombardment parameters to yield the maximum numbers of stable transformants. Both the physical and biological parameters for bombardment are important in this technology. Physical factors are those that involve manipulating the DNA/microprojectile precipitate or those that affect the flight and velocity of either the macro- or microprojectiles. Biological factors include all steps involved in manipulation of cells before and immediately after bombardment, the osmotic adjustment of target cells to help alleviate the trauma associated with bombardment, and also the nature of the transforming DNA, such as linearized DNA or intact supercoiled plasmids. It is believed that pre-bombardment manipulations are especially important for successful transformation of immature plant embryos.
[0101]Accordingly, it is contemplated that one may desire to adjust various of the bombardment parameters in small scale studies to fully optimize the conditions. One may particularly wish to adjust physical parameters such as gap distance, flight distance, tissue distance, and helium pressure. One may also minimize the trauma reduction factors (TRFs) by modifying conditions which influence the physiological state of the recipient cells and which may therefore influence transformation and integration efficiencies. For example, the osmotic state, tissue hydration and the subculture stage or cell cycle of the recipient cells may be adjusted for optimum transformation. The execution of other routine adjustments will be known to those of skill in the art in light of the present disclosure.
[0102]The methods of particle-mediated transformation is well-known to those of skill in the art. U.S. Pat. No. 5,015,580 describes the transformation of soybeans using such a technique.
[0103]Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because the DNA can be introduced into whole plant tissues, thereby bypassing the need for regeneration of an intact plant from a protoplast. The use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art. See, for example, the methods described (Fraley et al., 1985; Rogers et al., 1987). The genetic engineering of cotton plants using Agrobacterium-mediated transfer is described in U.S. Pat. No. 5,004,863; like transformation of lettuce plants is described in U.S. Pat. No. 5,349,124; and the Agrobacterium-mediated transformation of soybean is described in U.S. Pat. No. 5,416,011. Further, the integration of the Ti-DNA is a relatively precise process resulting in few rearrangements. The region of DNA to be transferred is defined by the border sequences, and intervening DNA is usually inserted into the plant genome as described (Spielmann et al., 1986; Jorgensen et al., 1987).
[0104]Modern Agrobacterium transformation vectors are capable of replication in E. coli as well as Agrobacterium, allowing for convenient manipulations as described (Klee et al., 1985). Moreover, recent technological advances in vectors for Agrobacterium-mediated gene transfer have improved the arrangement of genes and restriction sites in the vectors to facilitate construction of vectors capable of expressing various polypeptide coding genes. The vectors described (Rogers et al., 1987), have convenient multi-linker regions flanked by a promoter and a polyadenylation site for direct expression of inserted polypeptide coding genes and are suitable for present purposes. In addition, Agrobacterium containing both armed and disarmed Ti genes can be used for the transformations. In those plant varieties where Agrobacterium-mediated transformation is efficient, it is the method of choice because of the facile and defined nature of the gene transfer.
[0105]Agrobacterium-mediated transformation of leaf disks and other tissues such as cotyledons and hypocotyls appears to be limited to plants that Agrobacterium naturally infects. Agrobacterium-mediated transformation is most efficient in dicotyledonous plants. Few monocots appear to be natural hosts for Agrobacterium, although transgenic plants have been produced in asparagus using Agrobacterium vectors as described (Bytebier et al., 1987). Other monocots recently have also been transformed with Agrobacterium. Included in this group are corn (Ishida et al.) and rice (Cheng et al.).
[0106]A transgenic plant formed using Agrobacterium transformation methods typically contains a single gene on one chromosome. Such transgenic plants can be referred to as being heterozygous for the added gene. However, inasmuch as use of the word "heterozygous" usually implies the presence of a complementary gene at the same locus of the second chromosome of a pair of chromosomes, and there is no such gene in a plant containing one added gene as here, it is believed that a more accurate name for such a plant is an independent segregant, because the added, exogenous gene segregates independently during mitosis and meiosis.
[0107]An independent segregant may be preferred when the plant is commercialized as a hybrid, such as corn. In this case, an independent segregant containing the gene is crossed with another plant, to form a hybrid plant that is heterozygous for the gene of interest.
[0108]An alternate preference is for a transgenic plant that is homozygous for the added structural gene, i.e. a transgenic plant that contains two added genes, one gene at the same locus on each chromosome of a chromosome pair. A homozygous transgenic plant can be obtained by sexually mating (selfing) an independent segregant transgenic plant that contains a single added gene, germinating some of the seed produced and analyzing the resulting plants produced for gene of interest activity and mendelian inheritance indicating homozygosity relative to a control (native, non-transgenic) or an independent segregant transgenic plant.
[0109]Two different transgenic plants can be mated to produce offspring that contain two independently segregating added, exogenous genes. Selfing of appropriate progeny can produce plants that are homozygous for both added, exogenous genes that encode a polypeptide of interest. Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated.
[0110]Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments (see e.g., Potrykus et al., 1985; Lorz et al., 1985; Fromm et al., 1985; Uchimiya et al., 1986; Callis et al., 1987; Marcotte et al., 1988). Application of these systems to different plant germplasm depends upon the ability to regenerate that particular plant variety from protoplasts. Illustrative methods for the regeneration of cereals from protoplasts are described (see, e.g., Fujimura et al., 1985; Toriyama et al., 1986; Yamada et al., 1986; Abdullah et al., 1986). To transform plant germplasm that cannot be successfully regenerated from protoplasts, other ways to introduce DNA into intact cells or tissues can be utilized. For example, regeneration of cereals from immature embryos or explants can be effected as described (Vasil, 1988). DNA can also be introduced into plants by direct DNA transfer into pollen as described (Zhou et al., 1983; Hess, 1987). Expression of polypeptide coding genes can be obtained by injection of the DNA into reproductive organs of a plant as described (Pena et al., 1987). DNA can also be injected directly into the cells of immature embryos and the rehydration of desiccated embryos as described (Neuhaus et al., 1987; Benbrook et al., 1986).
[0111]Unmodified bacterial genes are often poorly expressed in transgenic plant cells. Several reports have disclosed methods for improving expression of recombinant genes in plants (Murray et al., 1989; Diehn et al., 1996; Iannacone et al., 1997; Rouwendal et al., 1997; Futterer et al., 1997; and Futterer and Hohn, 1996). These reports disclose various methods for engineering coding sequences to represent sequences which are more efficiently translated based on plant codon frequency to tables, improvements in codon third base position bias, using recombinant sequences which avoid suspect polyadenylation or A/T rich domains or intron splicing consensus sequences. While these methods for synthetic gene construction are notable, synthetic genes of the present invention were prepared according to the method of Brown et al. (U.S. Pat. No. 5,689,052; 1997). Thus, the present invention provides a method for preparing synthetic plant genes express it planta a desired protein product at levels significantly higher than the wild-type genes. Briefly, according to Brown et al., the frequency of rare and semi-rare monocotyledonous codons in a polynucleotide sequence encoding a desired protein are reduced and replaced with more preferred monocotyledonous codons. Enhanced accumulation of a desired polypeptide encoded by a modified polynucleotide sequence in a monocotyledonous plant is the result of increasing the frequency of preferred codons by analyzing the coding sequence in successive six nucleotide fragments and altering the sequence based on the frequency of appearance of the six-mers as to the frequency of appearance of the rarest 284, 484, and 664 six-mers in monocotyledenous plants. Furthermore, Brown et al. disclose the enhanced expression of a recombinant gene by applying the method for reducing the frequency of rare codons with methods for reducing the occurrence of polyadenylation signals and intron splice sites in the nucleotide sequence, removing self-complementary sequences in the nucleotide sequence and replacing such sequences with nonself-complementary nucleotides while maintaining a structural gene encoding the polypeptide, and reducing the frequency of occurrence of 5'-CG-3' dinucleotide pairs in the nucleotide sequence. These steps are performed sequentially and have a cumulative effect resulting in a nucleotide sequence containing a preferential utilization of the more-preferred monocotyledonous codons for monocotyledonous plants for a majority of the amino acids present in the desired polypeptide.
[0112]Thus, the amount of a gene coding for a polypeptide of interest (i.e. a bacterial crystal protein or δ-endotoxin polypeptide or such δ-endotoxin linked to a plastid targeting peptide) can be increased in plants by transforming those plants using transformation methods such as those disclosed herein.
[0113]After effecting delivery of exogenous DNA to recipient cells, the next step to obtain a transgenic plant generally concern identifying the transformed cells for further culturing and plant regeneration. As mentioned herein, in order to improve the to ability to identify transformants, it is preferable to employ a selectable or screenable marker gene as, or in addition to, the expressible gene of interest. In this case, one would then generally assay the potentially transformed cell population by exposing the cells to a selective agent or agents, or one would screen the cells for the desired marker gene trait.
[0114]An exemplary embodiment of methods for identifying transformed cells involves exposing the transformed cultures to a selective agent, such as a metabolic inhibitor, an antibiotic, herbicide or the like. Cells which have been transformed and have stably integrated a marker gene conferring resistance to the selective agent used, will grow and divide in culture. Sensitive cells will not be amenable to further culturing. One example of a preferred marker gene encoding an EPSPS synthase which is resistant to glyphosate inhibition. When this gene is used as a selectable marker, the putatively transformed cell culture is treated with glyphosate. Upon treatment, transgenic cells will be available for further culturing while sensitive, or non-transformed cells, will not. This method is described in detail in U.S. Pat. No. 5,569,834. Another example of a preferred selectable marker system is the nptII system by which resistance to the antibiotics kanamycin, neomycin, and paromomycin or related antibiotics is conferred, as described in U.S. Pat. No. 5,569,834. Again, after transformation with this system transformed cells containing a plant expressible nptII gene will be available for further culturing upon treatment with kanamycin or related antibiotic, while non-transformed cells will not. Use of this type of a selectable marker system is described in Brown et al. (U.S. Pat. No. 5,424,412). Another screenable marker which may be used is the gene coding for green fluorescent protein. All contemplated assays are nondestructive and transformed cells may be cultured further following identification.
[0115]It is further contemplated that combinations of screenable and selectable markers will be useful for identification of transformed cells. In some cell or tissue types a selection agent, such as glyphosate or kanamycin, may either not provide enough killing activity to clearly recognize transformed cells or may cause substantial nonselective inhibition of transformants and non-transformants alike, thus causing the selection technique to not be effective. It is proposed that selection with a growth inhibiting compound, such as glyphosate at concentrations below those that cause 100% inhibition followed by screening of growing tissue for expression of a screenable marker gene such as kanamycin would allow one to recover transformants from cell or tissue types that are not amenable to selection alone. It is proposed that combinations of selection and screening may enable one to identify transformants in a wider variety of cell and tissue types.
[0116]The development or regeneration of plants from either single plant protoplasts or various explants is well known in the art (Weissbach and Weissbach, 1988). This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil.
[0117]The development or regeneration of plants containing the foreign, exogenous gene that encodes a polypeptide of interest introduced by Agrobacterium from leaf explants can be achieved by methods well known in the art such as described (Horsch et al., 1985). In this procedure, transformants are cultured in the presence of a selection agent and in a medium that induces the regeneration of shoots in the plant strain being transformed as described (Fraley et al., 1983). In particular, U.S. Pat. No. 5,349,124 details the creation of genetically transformed lettuce cells and plants resulting therefrom which express hybrid crystal proteins conferring insecticidal activity against Lepidopteran larvae to such plants. This procedure typically produces shoots within two to four months and those shoots are then transferred to an appropriate root-inducing medium containing the selective agent and an antibiotic to prevent bacterial growth. Shoots that rooted in the presence of the selective agent to form plantlets are then transplanted to soil or other media to allow the production of roots. These procedures vary depending upon the particular plant strain employed, such variations being well known in the art.
[0118]A transgenic plant of this invention thus has an increased amount of a coding region encoding a B. thuringiensis δ-endotoxin polypeptide or variant thereof or may encode such a δ-endotoxin linked to a plastid targeting peptide. A preferred transgenic plant is an independent segregant and can transmit that gene and its activity to its progeny. A more preferred transgenic plant is homozygous for that gene, and transmits that gene to all of its offspring on sexual mating. Seed from a transgenic plant may be grown in the field or greenhouse, and resulting sexually mature transgenic plants are self-pollinated to generate true breeding plants. The progeny from these plants become true breeding lines that are evaluated for increased expression of the transgene encoding the δ-endotoxin.
[0119]To identify a transgenic plant expressing high levels of the δ-endotoxin of interest, it is necessary to screen the herbicide or antibiotic resistant transgenic, regenerated plants (R0 generation) for insecticidal activity and/or expression of the gene of interest. This can be accomplished by various methods well known to those skilled in the art, including but not limited to: 1) obtaining small tissue samples from the transgenic R0 plant and directly assaying the tissue for activity against susceptible insects in parallel with tissue derived from a non-expressing, negative control plant. For example, R0 transgenic corn plants expressing B. thuringiensis endotoxins such as Cry3B can be identified by assaying leaf tissue or root tissue derived from such plants for activity against CRW; 2) analysis of protein extracts by enzyme linked immunoassays (ELISAs) specific for the gene of interest (Cry3B); or 3) reverse transcriptase thermal amplification to identify events expressing the gene of interest.
[0120]The genes and δ-endotoxins according to the subject invention include not only the full length sequences disclosed herein but also fragments of these sequences, or fusion proteins, which retain the characteristic insecticidal activity of the sequences specifically exemplified herein.
[0121]It should be apparent to a person of skill in the art that insecticidal δ-endotoxins can be identified and obtained through several means. The specific genes, or portions thereof, may be obtained from a culture depository, or constructed synthetically, for example, by use of a gene machine. Variations of these genes may be readily constructed using standard techniques for making point mutations. Also, fragments of these genes can be made using commercially available exonucleases or endonucleases according to standard procedures. For example, enzymes such as Bal31 or site-directed mutagenesis can be used to systematically cut off nucleotides from the ends of these genes. Also, genes which code for active fragments may be obtained using a variety of other restriction enzymes. Proteases may be used to directly obtain active fragments of these δ-endotoxins.
[0122]Equivalent δ-endotoxins and/or genes-encoding these δ-endotoxins car also be isolated from Bacillus strains and/or DNA libraries using the teachings provided herein. For example, antibodies to the δ-endotoxins disclosed and claimed herein can be used to identify and isolate other δ-endotoxins from a mixture of proteins. Specifically, antibodies may be raised to the portions of the δ-endotoxins which are most constant and most distinct from other B. thuringiensis δ-endotoxins. These antibodies can then be used to specifically identify equivalent δ-endotoxins with the characteristic insecticidal activity by immunoprecipitation, enzyme linked immunoassay (ELISA), or Western blotting.
[0123]A further method for identifying the δ-endotoxins and genes of the subject invention is through the use of oligonucleotide probes. These probes are nucleotide sequences having a detectable label. As is well known in the art, if the probe molecule and nucleic acid sample hybridize when together in a sample by forming hydrogen bonds between the two molecules, it can be reasonably assumed that the probe and sample are essentially identical or substantially similar or homologous at least along the length of the probe. The probe's detectable label provides a means for determining in a known manner whether hybridization has occurred. Such a probe analysis provides a rapid method for identifying insecticidal δ-endotoxin genes of the subject invention.
[0124]Duplex formation and stability depend on substantial complementary between the two strands of a hybrid, and, as noted above, a certain degree of mismatch can be tolerated. Therefore, the probes of the subject invention include mutations (both single and multiple), deletions, insertions of the described sequences, and combinations thereof, wherein said mutations, insertions and deletions permit formation of stable hybrids with the target polynucleotide of interest. Mutations insertions, and deletions can be produced in a given polynucleotide sequence in many ways, by methods currently known to an ordinarily skilled artisan, and perhaps by other methods which may become known in the future.
[0125]The potential variations in the probes listed is due, in part, to the redundancy of the genetic code. Because of the redundancy of the genetic code, more than one coding nucleotide triplet (codon) can be used for most of the amino acids used to make proteins. Therefore different nucleotide sequences can code for a particular amino acid. Thus, the amino acid sequences of the B. thuringiensis δ-endotoxins and peptides, and the plastid targeting peptides and the polynucleotides which code for them, can be prepared by equivalent nucleotide sequences encoding the same amino acid sequence of the protein or peptide.
[0126]Site-specific mutagenesis is a technique useful in the preparation of individual peptides, or biologically functional equivalent proteins or peptides, through specific mutagenesis of the underlying DNA. The technique further provides a ready ability to prepare and test sequence variants, for example, incorporating one or more of the foregoing considerations, by introducing one or more nucleotide sequence changes into the DNA.
[0127]In general, the technique of site-specific mutagenesis is well known in the art, as exemplified by various publications. As will be appreciated, the technique typically employs a phage vector which exists in both a single stranded and double stranded form. Typical vectors useful in site-directed mutagenesis include vectors such as the M13 phage or plasmids containing an M13 origin of replication. These phage are readily commercially available and their use is generally well known to those skilled in the art.
[0128]Modification and changes may be made in the structure of the peptides of the present invention and DNA segments which encode them and still obtain a functional molecule that encodes a protein or peptide with desirable characteristics. The biologically functional equivalent peptides, polypeptides, and proteins contemplated herein should possess about 80% or greater sequence similarity, preferably about 85% or greater sequence similarity, and most preferably about 90% or greater sequence similarity, to the sequence of, or corresponding moiety within, the fundamental Cry3B amino acid sequence.
[0129]The following is a discussion based upon changing the amino acids of a protein to create an equivalent, or even an improved, second-generation molecule. In particular embodiments of the invention, mutated crystal proteins are contemplated to be useful for increasing the insecticidal activity of the protein, and consequently increasing the insecticidal activity and/or expression of the recombinant transgene in a plant cell. The amino acid changes may be achieved by changing the codons of the DNA sequence, according to the codons given in readily available amino acid codon tables.
[0130]For example, certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies or binding sites on substrate molecules. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid sequence substitutions can be made in a protein sequence, and, of course, its underlying DNA coding sequence, and nevertheless obtain a protein with like properties. It is thus contemplated by the inventors that various changes may be made in the peptide sequences of the disclosed compositions, or corresponding DNA sequences which encode said peptides without appreciable loss of their biological utility or activity.
[0131]In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte and Doolittle, 1982, incorporate herein by reference). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.
[0132]It is known in the art that certain amino acids may be substituted by other amino acids having a similar hydropathic index or score and still result in a protein with similar biological activity, i.e. still obtain a biological functionally equivalent protein. It is also understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Pat. No. 4,554,101 states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still obtain a biologically equivalent, and in particular, an immunologically equivalent protein.
[0133]As outlined above, amino acid substitutions are generally therefore based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions which take various of the foregoing characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine glutamine and asparagine; and valine, leucine and isoleucine.
[0134]Polynucleotides encoding δ-endotoxins derived from B. thuringiensis are known by those skilled in the art, to be poorly expressed when incorporated into the nuclear DNA of transgenic plants (reviewed by Diehn et al., 1996). Preferably, a nucleotide sequence encoding the δ-endotoxin of interest is designed essentially as described in U.S. Pat. Nos. 5,500,365 and 5,689,052. Examples of nucleotide sequences useful for expression include but are not limited to, cry3B (SEQ ID NO:5), cry3Bb1 (SEQ ID NO:1), cry3Bb2 (SEQ ID NO:3), v11231 (SEQ ID NO:7), 11231mv1 (SEQ ID NO:9), and 11231mv2 (SEQ ID NO:11).
[0135]Peptides, polypeptides, and proteins biologically functionally equivalent to Cry3B include amino acid sequences containing conservative amino acid changes in the fundamental sequence shown in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:8, SEQ ID NO:10, and SEQ ID NO:12 (Cry3Bb1, Cry3Bb2, v11231, 11231mv1, 11231mv2, Cry3Bb.11231, or Cry3Bb.11098, etc). In such amino acid sequences, one or more amino acids in the fundamental sequence is (are) substituted with another amino acid(s), the charge and polarity of which is similar to that of the native amino acid, i.e. a conservative amino acid substitution, resulting in a silent change.
[0136]Substitutes for an amino acid within the fundamental polypeptide sequence can be selected from other members of the class to which the naturally occurring amino acid belongs. Amino acids can be divided into the following four groups: (1) acidic amino acids; (2) basic amino acids; (3) neutral polar amino acids; and (4) neutral non-polar amino acids. Representative amino acids within these various groups include, but are not limited to: (1) acidic (negatively charged) amino acids such as aspartic acid and glutamic acid; (2) basic (positively charged) amino acids such as arginine, histidine, and lysine: (3) neutral polar amino acids such as glycine, serine, threonine, cyteine, cystine, tyrosine, asparagine, and glutamine; (4) neutral nonpolar (hydrophobic) amino acids such as alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine.
[0137]Conservative amino acid changes within the fundamental polypeptide sequence can be made by substituting one amino acid within one of these groups with another amino acid within the same group. Biologically functional equivalents of Cry3B can have 10 or fewer conservative amino acid changes, more preferably seven or fewer conservative amino acid changes, and most preferably five or fewer conservative amino acid changes. The encoding nucleotide sequence (gene, plasmid DNA, cDNA, non-naturally occurring, or synthetic DNA) will thus have corresponding base substitutions, permitting it to encode biologically functional equivalent forms of Cry3B.
[0138]The present invention provides methods and compositions for expressing Coleopteran inhibitory Cry3B B. thuringiensis δ-endotoxins or amino acid sequence variants thereof at unexpectedly high levels in transgenic plants. The disclosed methods and compositions may exploit any of the DNA constructs disclosed as well as any of the transformation vectors disclosed herein. The contemplated methods and compositions enable Cry3Bb δ-endotoxins or amino acid sequence variants thereof to be expressed in plants without negatively affecting the recovery of agronomic qualities of transgenic plants. The inventions described herein also enables expression of Cry3B δ-endotoxins and variants at levels up to 500 times higher than that achieved by previous methods and compositions.
[0139]The methods described here thus enables plants expressing Cry3B or variants to be used as either an alternative or supplement to plants expressing other Cry proteins such as a Cry3B variant, a Cry3A or Cry3D or variant, CryET33 and CryET34 or variants thereof, a CryET70 or variant, a CryET29 or variant, a Cry6A or Cry6B or variant, a Cry8B or variant, insecticidal acyl lipid hydrolases, combinations of amino acid oxidases and tedanalactam synthases, and other insecticidal proteins such as VIP1 and VIP3 and various combinations isolated from Heterorhabdus, Photorhabdus, and Xenorhabdus species for both control and resistance management of key insect pests, including Ostrina sp, Diatraea sp, Diabrotica, Helicoverpa sp, Spodoptera sp in Zea mays; Heliothis virescens, Helicoverpa sp, Pectinophora sp. in Gossypium hirsutum; and Anticarsia sp, Pseudoplusia sp, Epinotia sp in Glycine max. It is also contemplated that the methods described may be used to dramatically increase expression of B. thuringiensis δ-endotoxins including and related to Cry3, thus increasing its effectiveness against target pests and decreasing the likelihood of evolved resistance to these proteins. In one embodiment of the present invention, a Cry3 δ-endotoxin is expressed. Target pests of this protein and their common hosts are shown below in Table 1.
TABLE-US-00001 TABLE 1 Target Pests Affected by Coleopteran Active (Inhibitory) Cry3B δ-Endotoxin and Common Plant Hosts of Those Pests Pests Hosts Leptinotarsa decemlineata Potato (Colorado Potato Beetle) Diabrotica barberi Corn (Northern Corn Rootworm) Diabrotica undecimpunctata Corn (Southern Corn Rootworm) Diabrotica virgifera Corn (Western Corn Rootworm) Anthonomis grandis Cotton (Boll Weevil) Triboleum castaneum Wheat (Red Flour Beetle) Papilla japonica Wheat (Japanese Flour Beetle)
[0140]Antibodies were required for studies comparing expression of various Cry3 coding sequences, so polyclonal serum was generated as follows. Cry3 Bt crystals were collected from a sporulated fermentation of Bacillus thuringiensis recombinant strain 11037 expressing native Cry3Bb. Crystals were solubilized in 100 mM sodium carbonate buffer, pH10.5, to give a concentration of 2.7 mg protein per mL as measured by a colorimetric bicinchoninic acid assay (Smith et al, 1985). A sample was diluted to a concentration of 0.4 mg/mL and mixed with an equal volume of Freund's complete adjuvant. A 1 milliliter inoculum of this mixture was used for the first intradermal injection into a rabbit. A first bleed was collected two weeks later. Subsequent injections of Cry3Bb protein designed to boost the immune titer were prepared by mixing equal volumes of 0.2 mg/mL protein with equal volumes of Freund's incomplete adjuvant. 1 milliliter injections were administered at four week intervals, and additional bleeds were obtained every two weeks. Immune serum adequate for analytical purposes was prepared from rabbit #783 after purification over a Protein A Sepharose CL-4B affinity chromatography according to the manufacturers' instructions (Sigma Chemical Co, St. Louis, Mo.) and concentrated to 1 milligram of IgG protein per milliliter and stored in the dark at 4° C. A sample of this antiserum was conjugated to alkaline phosphatase enzyme for subsequent use in quantitative ELISA assays.
[0141]Leaf and root samples were collected from plants expressing Cry3Bb variant proteins 11231, 11084, 11098, and 11247. Extracts of plant samples were prepared as follows. Plant tissue, root or leaf parts, was harvested and weighed on a gram scale. Leaf tissue was mixed with 20 parts TBA buffer, weight to volume. Root tissue was mixed with 10 parts TBA buffer, weight to volume. Tissues were ground into an emulsion using a Wheaton® overhead grinder and stored on ice or at -20° C. 250 microliters of rabbit anti-Cry3Bb antiserum diluted 1:1000 in carbonate coating buffer, pH9.6, was distributed onto each well of a 96-well microtiter plate and incubated overnight at 4° C. The plate was then washed with PBST (3×5 min). Tissue extract samples were loaded in duplicate at 20 microliters per well and at varying dilutions in order to obtain a value within a standard curve established using Cry3Bb variant 11231. Plates were incubated overnight at 4° C., then washed with PBST three times, five minutes each time. 50 microliters of the rabbit anti-Cry3B alkaline phosphatase conjugated polyclonal antibody was added to each well, followed by the addition of 180 uL of PBST containing 1% PVP-40 (Sigma). After overnight incubation, plates were washed with PBST (3×5 min) and developed with alkaline phosphatase color development solution consisting of 20 mg para-nitrophenyl phosphate in 25 mL diethanolamine, pH9.8, 200 uL/well). Plates were read at λ405 after 15-20 minutes, using a quadratic curve fit to a protein standard curve where the optical density of the highest standard was approximately 1.00.
5.0 EXAMPLES
[0142]The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
5.1 Example 1
Isolation, Characterization, and Identification of Cry3 Proteins and Genes, and Construction of Amino Acid Sequence Variants Thereof
[0143]Means for identifying and characterizing Coleopteran toxic gene products are well documented in the art, and methods for isolating, characterizing and identifying the genes which encode such gene products are also well known in the art. In addition, the means for producing amino acid sequence variants of such Coleopteran toxic δ-endotoxin proteins are also well known. In particular, Van Rie et al. (U.S. Pat. No. 5,659,123; 1997) identify Cry3A and D toxins which exhibit Coleopteran inhibitory properties, and also set forth a method for identifying mutants which can be constructed which have reduced insecticidal activity with reference to the wild type protein. Van Rie et al. describe how those particular mutants can be further manipulated to identify amino acid sequence variant toxins which exhibit increased insecticidal activity with reference to the wild type protein. English et al. (WO 99/31248) describe other methods and compositions, in particular for Cry3B, which enable the identification of Cry3 encoding genes and gene products and the methods which can be used to construct and identify amino acid sequence variants exhibiting improved insecticidal activity with reference to that of the wild type Cry3 protein. Several coding sequences used herein were derived from those described in English et al. and the proteins produced from these coding sequences represent in particular the variants 11231 or 11098 as described therein.
5.2 Example 2
Construction of Monocot Plant Expression Vectors for the Cry3Bb Variants
[0144]Design of cry3Bb Variant Genes for Plant Expression:
[0145]For efficient expression of the Cry3Bb variants in transgenic plants the gene encoding the variants must have a suitable sequence composition (Diehn et al. 1996). One example of such a sequence is shown for the v11231 gene (SEQ ID NO:7) which encodes the 11231 variant of the Cry3Bb protein (SEQ ID NO: 8) exhibiting Diabroticus activity. This gene was derived via mutagenesis (Kunkel, 1985) of a Cry3Bb synthetic gene (SEQ ID NO:5) encoding a protein essentially homologous to the protein encoded by the native Cry3Bb gene (Gen Bank Accession Number m89794; SEQ ID NO:1). The following oligonucleotides were used in the mutagenesis of the original Cry3Bb synthetic gene (SEQ ID NO:5) to create the v11231 gene (SEQ ID NO:7)
TABLE-US-00002 Oligo #1: (SEQ ID NO: 40) TAGGCCTCCATCCATGGCAAACCCTAACAATC Oligo #2: (SEQ ID NO: 41) TCCCATCTTCCTACTTACGACCCTGCAGAAATACGGTCCAAC Oligo #3: (SEQ ID NO: 42) GACCTCACCTACCAAACATTCGATCTTG Oligo #4: (SEQ ID NO: 43) CGAGTTCTACCGTAGGCAGCTCAAG
Construction of Cry3Bb Monocot Plant Expression Vector:
[0146]To place the Cry3Bb variant gene v11231 in a vector suitable for expression in monocotyledonous plants (i.e. under control of the enhanced Cauliflower Mosaic Virus 35S promoter and linker to the hsp70 intron followed by a nopaline synthase polyadenylation site as in Brown and Santino U.S. Pat. No. 5,424,412; 1995), the vector pMON19469 was digested with NcoI and EcoRI. The larger vector band of approximately 4.6 kb was isolated after electrophoresis of the digestion products through an agarose gel, purified, and ligated with T4 DNA ligase to the NcoI-EcoRI fragment of approximately 2 kb containing the v11231 gene (SEQ ID NO:7). The ligation mix was transformed into a useful laboratory strain of E. coli, and carbenicillin resistant colonies were recovered. Plasmid DNA was recovered by miniprep DNA procedures from subsequent overnight cultures of carbenicillin resistant colonies selected into broth containing antibiotics. This DNA was subjected to restriction endonuclease analysis with enzymes such as NcoI and EcoRI, NotI, and PstI to identify clones containing the v11231 coding sequence fused to the hsp70 intron under control of the enhanced CaMV35S promoter. Clones identified as such were designated as pMON33708.
[0147]To place the v11231 gene in a vector suitable for recovery of stably transformed and insect resistant plants, the 3.75 kb NotI restriction fragment from pMON33708 containing the lysine oxidase coding sequence fused to the hsp70 intron under control of the enhanced CaMV35S promoter was isolated and purified after extraction from an agarose gel. This fragment was ligated with pMON30460 treated with NotI and calf intestinal alkaline phosphatase. pMON30460 contains the neomycin phosphotransferase coding sequence under control of the CaMV35S promoter. Kanamycin resistant colonies were obtained by transformation of this ligation mix into E. coli and colonies containing the appropriate band were identified by restriction endonuclease digestion and designated as pMON33710. Restriction enzymes such as NotI, EcoRV, HindIII, NcoI, EcoRI, and BglII were used to identify the appropriate clones containing the NotI fragment of pMON33708 in the NotI site of pMON30460 (i.e. pMON33710) in the orientation such that both genes are in tandem (i.e. the 3' end of the v1123 expression cassette is linked to the 5' end of the nptII expression cassette). Expression of the v11231 protein by pMON33710 in corn protoplasts was confirmed by electroporation of pMON33710 covalently closed circular plasmid DNA into protoplasts followed by protein blot and ELISA analysis. This vector can be introduced into the genomic DNA of corn embryos by particle gun bombardment followed by paromomycin selection to obtain corn plants expressing the v11231 gene essentially as described in Brown and Santino U.S. Pat. No. 5,424,412. In this example, the vector was introduced into immature embryo scutella (IES) of maize via co-bombardment along with a plasmid conferring hygromycin resistance, followed by hygromycin selection, and regeneration. Transgenic corn lines expressing the v11231 protein were identified by ELISA analysis scoring for both the presence and amount of v11231 protein present in each extract sample. Plants were selfed and allowed to go to seed. Progeny seed were cured and planted to produce seedling corn plants which were subsequently tested for protection from Diabroticus feeding.
In Plant Performance of Cry3Bb Variant 11231:
[0148]Transformed corn plants expressing Cry3Bb variant 11231 protein were challenged with western corn rootworm (WCR) larvae in both a seedling and 10 inch pot assay. The transformed genotype was A634, where the progeny of the R0 cross by A634 was evaluated. Observations included effect on larval development (weight), root damage rating (RDR), and protein expression. The transformation vector containing the Cry3Bb variant gene was pMON33710. Treatments included the positive and negative iso-populations for each event and an A634 check.
[0149]The seedling assay consisted of the following steps, i. single seeds were placed in 1 oz cups containing potting soil; ii. at spiking, each seedling was infested with 4 neonate larvae, and iii. after infestation, seedlings were incubated for 7 days at 25° C., 50% RH, and 14:10 (L:D) photo period. Adequate moisture was added to the potting soil during the incubation period to maintain seedling vigor.
[0150]The 10 inch pot assay consisted of the following steps; i. single seeds were placed in 10 inch pots containing potting soil; ii. at 14 days post planting, each pot was infested with 800 eggs which have been pre-incubated such that hatch would occur 5-7 days post infestation; and iii. after infestation, plants were incubated for 4 weeks under the same environmental conditions as the seedling assay. Pots were both sub & top irrigated daily.
[0151]For the seedling assay, on day 7 plants were given a root damage rating (Table 1.) and surviving larvae were weighed. Also at this time, Cry3Bb protein concentrations in the roots were determined by ELISA.
TABLE-US-00003 TABLE 1 Root Damage Rating Scale for seedling assay. RDR 0 = no visible feeding 1 = very light feeding 2 = light feeding 3 = moderate feeding 4 = heavy feeding 5 = very heavy feeding
[0152]Results of the seedling assay are shown in Table 2. Plants expressing Cry3Bb protein were completely protected by WCR feeding, where surviving larvae within this treatment had not grown. Mean larval weights ranged from 2.03-2.73 mg for the non-expressing treatments, where the surviving larval average weight was 0.11 mg on the expressing Cry3Bb treatment. Root damage ratings were 3.86 and 0.33 for the non-expressing and expressing iso-populations, respectively. Larval survival ranged from 75-85% for the negative and check treatments, where only 25% of the larvae survived on the Cry3Bb treatment.
TABLE-US-00004 TABLE 2 Effect of Cry3Bb expressing plants on WCR larvae in a seedling assay. Plants Larvae Root % Mean ± SD Event Treatment N (ppm) RDR ± SD N Surv Wt. (mg) 16 Negative 7 0.0 3.86 ± 0.65 21 75 2.73 ± 1.67 16 Positive 3 29.01 0.33 ± 0.45 3 25 0.11 ± 0.07 A634 Check 4 0.0 -- 13 81 2.03 ± 0.83
[0153]For the 10 inch pot assay, at 4 weeks post infestation plant height was recorded and a root damage rating was given (Iowa 1-6 scale; Hills, T. M. and D. C. Peters. 1971; A method of evaluating post planting insecticide treatments for control of western corn rootworm larvae. Journal of Economic Entomology 64: 764-765.).
[0154]Results of the 10 inch pot assay are shown in Table 3. Plants expressing Cry3Bb protein had significantly less feeding damage and were taller than the non-expressing plants. Event 16, the higher of the two expressing events provided nearly complete control. The negative treatments had very high root damage ratings indicating very high insect pressure. The positive mean root damage ratings were 3.4 and 2.2 for event 6 & 16, respectively. Mean RDR for the negative treatment was 5.0 & 5.6.
TABLE-US-00005 TABLE 3 Effect of Cry3Bb expressed in corn in controlling WCR larval feeding in a 10 inch pot assay. Root Plant Event Treatment N (ppm) RDR ± SD Height (cm) 6 Negative 7 0.0 5.0 ± 1.41 49.7 ± 18.72 6 Positive 5 7.0 3.4 ± 1.14 73.9 ± 8.67 16 Negative 5 0.0 5.6 ± 0.89 61.2 ± 7.75 16 Positive 5 55.0 2.2 ± 0.84 83.8 ± 27.15
[0155]In summary, corn plants expressing Cry3Bb protein have a significant biological effect on WCR larval development as seen in the seedling assay. When challenged with very high infestation levels, plants expressing the Cry3Bb protein were protected from WCR larval feeding damage as illustrated in the 10 inch pot assay.
Example 3
Increased Expression of a Cry3Bb Protein in Transgenic Maize
[0156]Expression of a Cry3Bb protein was compared in corn plants transformed with standard or preferred Cry3Bb expression vectors. Plants transformed with the improved vectors consistently demonstrated significantly higher levels of expression of Cry3Bb when compared to plants transformed with the standard Cry3Bb vectors. A standard Cry3Bb plant expression vector pMON33710 contains an expression cassette composed of an enhanced CaMV35S promoter sequence (P-CaMV.35S, SEQ ID NO:29), a Zea mays Hsp70 intron sequence (1-Zm.Hsp70, SEQ ID NO:33), a non-naturally occurring sequence encoding Cry3Bb variant protein v11231 (Bt.cry3Bb.v11231, SEQ ID NO: 7), and a nopaline synthase transcription termination and polyadenylation sequence (T-AGRtu.nos, SEQ ID NO:34). Another standard Cry3Bb plant expression vector pMON33709 contains an expression cassette composed of an enhanced CaMV35S promoter sequence (P-CaMV.35S, SEQ ID NO:29), a Zea mays Hsp70 intron sequence (I-Zm.Hsp70, SEQ ID NO:33), a Zea mays CTP encoding sequence (TS-Zm.rbc1, SEQ ID NO:25), a non-naturally occurring sequence encoding Cry3Bb variant protein v11231 (Bt.cry3Bb.v11231, SEQ ID NO:7), and a nopaline synthase transcription termination and polyadenylation sequence (T-AGRtu.nos, SEQ ID NO:34). The plant expression vector pMON25097 is improved compared to pMON33710 as judged by Cry3Bb expression levels it planta, and contains an expression cassette comprising a non-naturally occurring CaMV35S AS4 promoter sequence (P-CaMV.AS4, SEQ ID NO:30), a wheat chlorophyll A/B binding protein untranslated leader sequence (L-Ta.hcb1, SEQ ID NO:31), a rice actin intron sequence (I-Os.Act1, SEQ ID NO:32), and a non-naturally occurring sequence encoding Cry3Bb variant protein 11231mv1 (11098) (Bt.cry3Bb.11231mv1, SEQ ID NO:9) linked to a wheat heat shock Hsp17 transcription termination and polyadenylation sequence (T-Ta.Hsp17, SEQ ID NO:35). Another preferred vector is pMON25096, which contains an expression cassette (SEQ ID NO:17) comprising a non-naturally occurring CaMV35S AS4 promoter sequence (P-CaMV.AS4, SEQ ID NO:30), a wheat chlorophyll A/B binding protein untranslated leader sequence (L-Ta.hcb1, SEQ ID NO:31), a rice actin intron sequence (I-Os.Act1, SEQ ID NO:32), a Zea mays CTP encoding sequence (TS-Zm.rbc1, SEQ ID NO:25), and a non-naturally occurring sequence encoding Cry3Bb variant protein 11231mv1 (Bt.cry3Bb.11231mv1, SEQ ID NO:9) linked to a wheat heat shock Hsp17 transcription termination and polyadenylation sequence (T-Ta.Hsp17, SEQ ID NO:35). All vectors contain an identical cassette linked to the Cry3Bb expression cassette to which confers paromomycin resistance to transformed plant tissue. This resistance cassette consists of an enhanced CaMV35S promoter sequence, and a neomycin phosphotransferase coding sequence linked to a nopaline synthase transcription termination and polyadenylation sequence. A summary of the standard and improved vectors is presented in Table 4. Transgenic corn plants resistant to paromomycin were derived essentially as described in U.S. Pat. No. 5,424,412 (1995).
TABLE-US-00006 TABLE 4 Plant Expression Vector Summary Selection Vector Expression Cassette Cassette pMON33709 35S/HSP70/ZmRBC/v11231/NOS e35S/nptII/nos pMON33710 e35S/HSP70/11231v/nos e35S/nptII/nos pMON33722 AS4/TaCAB/OsAct1/ZmRBC/v11231/ e35S/nptII/nos tahsp17 pMON33723 AS4//TaCAB/OsAct1/v11231/tahsp17 e35S/nptII/nos pMON25096 AS4/TaCAB/OsAct1/ZmRBC/11231mv1/ e35S/nptII/nos tahsp17 pMON25097 AS4/TaCAB/OsAct1/11231mv1/tahsp17 e35S/nptII/nos pMON33741 AS4/TaCAB/OsAct1/11231mv2/tahsp17 e35S/nptII/nos pMON33748 e35S/TaCAB/OsAct1/11231mv2/tahsp17 e35S/nptII/nos
[0157]Maize leaf protoplasts were electroporated with standard vectors (pMON33709 or pMON33710) or improved vectors (pMON33722, pMON33723, pMON25096, pMON25097, pMON33741) as described (Sheen, Plant Cell 2:1027-1038, 1990) and transient expression of Cry3Bb variant proteins was compared by ELISA and Western Blot analysis methods. The ELISA used a rabbit anti-Cry3B chromatography purified IgG capture antibody raised against Cry3B 11231, a sample of that antibody conjugated to alkaline phosphatase as the secondary detecting antibody, and a purified Cry3Bb native protein as a standard. Comparison of the ratio of Cry3Bb to neomycin phosphotransferase (Npt II) expression levels by ELISA indicated that approximately two-fold increases in the normalized expression levels of Cry3Bb variant protein 11231 were obtained with improved vectors pMON33723 and pMON33722 relative to the standard vectors pMON33710 and pMON33709, respectively. (Expt. 1, Table 5). Differences in Cry3Bb expression are directly ascribed to the improved expression cassette in the improved vectors rather than to differences in protoplast electroporation efficiency since expression of Cry3Bb protein is normalized to Npt II produced by the identical linked nptII gene present in all vectors. The most preferred improved vectors such as pMON25096, pMON25097, and pMON33741 expressed approximately 10-fold higher normalized levels of Cry3Bb and variant Cry3Bb protein than the preferred improved vectors such as pMON33722 or pMON33723 (Table 5, Expt. 2, 3). Finally, the equally preferred pMON33741 and pMON25097 vectors yielded roughly equivalent normalized Cry3Bb expression (Table 5, Expt. 4)
TABLE-US-00007 TABLE 5 Transient Cry3Bb and Cry3Bb Variant Expression in Corn Leaf Protoplasts (normalized to NptII expression) Expt. 1 pMON33710 pMON33723 5.79 12.3 pMON33709 pMON33722 2.7 7.7 Expt. 2 pMON33722 pMON25096 1.9 26.2 pMON33723 pMON25097 3.7 37.5 Expt. 3 pMON33723 pMON33741 30 319 Expt. 4 pMON33741 pMON25097 20 25
[0158]Since the improved expression cassette in pMON25097 encodes the Cry3Bb 11231mv1 (11098) variant toxin, and the standard cassette in pMON33710 encodes the Cry3Bb v11231 variant which differ by a single amino acid, the intrinsic immunoreactivity of the two proteins in the ELISA assay was compared. Subsequent ELISA experiments with Cry3Bb v11231 and 11231mv1 (11098) variant proteins produced in and purified from B. thuringiensis indicate that the two proteins have similar levels of immunoreactivity. Consequently, the observed increase in levels of Cry3Bb 11231mv1 (11098) protein produced from the expression cassette in pMON25097 is due to increased expression levels rather than a difference in immunoreactivity. Protein blot analyses confirm that the increased level of cross reactive material produced in maize protoplasts from the improved Cry3Bb expression cassette in pMON25097 were due to increased accumulation of an approximately 60,000 Mr protein immunoreactive with Cry3B antiserum that also co-migrates with Cry3Bb variant 11231 protein produced in a recombinant cry-B. thuringiensis strain from pEG7174. Equally preferred and improved Cry3Bb variant protein expression cassettes in pMON33741 and pMON33748 that encode Cry3Bb.11231 also exhibit increased expression levels of Cry3Bb relative to expression observed from the standard cassette in pMON33710. These results confirm that expression differences are due to the improved compositions disclosed herein rather than to differences in the intrinsic immunoreactivity of the different variants.
[0159]Root tissue from transgenic plants in the R0 stage independently obtained after transformation with an improved vectors (pMON33723, 25097) or with a standard vector (pMON 33710) was subjected to quantitative analysis of Cry3Bb protein levels by a quantitative ELISA assay. Comparison of Cry3Bb or Cry3Bb protein variant expression levels in improved and standard vector transformed corn plants show that Cry3Bb.11231 variant expression does not exceed 50 ppm in the standard pMON33710 transgenics while Cry3Bb.11098 (11231mv1) expression in the improved pMON25097 transgenics is frequently higher than 50 ppm (Table 6). Protein blot analyses confirm that the increased level of cross reactive material produced by pMON25097 (improved) were due to increased accumulation of an approximately Mr 60,000 protein that migrates with Cry3Bb1 standard from B. thuringiensis. Other improved Cry3Bb protein variant expression cassettes found in pMON33741 and 33748 also consistently yield select independently transformed events (ITE's) with Cry3Bb protein variant levels greater than 100 PPM whereas the standard vectors have never given rise to ITE's with greater than 50 PPM of Cry3Bb protein variant (Table 7). High level expression is evident in both the H99 and A634 maize genotypes, indicating that the compositions disclosed herein have broad utility to many varieties of commercially cultivated maize. Such select high expressing Cry3 protein variant lines obtained with the vectors described herein are expected to be especially advantageous in conferring high levels of protection to insect feeding damage and in reducing the incidence of insect resistance to Cry3 insecticidal proteins.
TABLE-US-00008 TABLE 6 Comparison of Cry3Bb Expression in R0 Corn Transformed with Standard and Improved Cry3Bb Protein Variant Expression Cassettes Cry3B Expression Level (ppm) Vector Total 5-10 10-50 50-100 100-200 >200 (genotype) Events ppm ppm ppm ppm ppm L25097 A634 45 3 7 3 H99 589 32 36 5 3 5 L33710 A634 22 2 2 H99 336 13 15 L33723 A634 0 H99 67 6 9
TABLE-US-00009 TABLE 7 Cry3Bb Expression in R0 Corn Trans-formed with Improved Cry3Bb Protein Variant Expression Cassettes Cry3B Expression Level (ppm) Total 5-10 10-50 50-100 100-200 >200 Vector Events ppm ppm ppm ppm ppm L25097 A634 112 7 4 5 1 4 H99 45 1 4 2 L33741 H99 108 11 5 2 4 L33748 A634 82 1 11 2 2 1 H99 209 23 13 3 3 11
[0160]Progeny derived from corn plants transformed with both the standard (pMON33709 and pMON33710) and preferred (pMON25096, 25097, 33722, 33723, 33726, 33741, and 33748) cassettes expressing 10 ppm or more of Cry3Bb protein were further tested for resistance to Corn Rootworm (CRW) feeding damage in greenhouse or growth chamber based bioassays as previously described (English et al., WO 99/31248). Corn Rootworm resistant transgenic corn plants were obtained from essentially all of the preferred vectors (Table 8). For example, the improved pMON25096 vector was used to generate 89 independently transformed events (ITE's), 14 independent pMON25096 F1 progeny lines expressing 10 ppm or more of Cry3Bb and 7 F1 progeny lines displaying significant levels of CRW resistance (an RDR rating ≧3.5 on a rating scale of 0-6). In contrast, not a single event with a RDR rating ≦3.5 was obtained from 12 of the standard pMON33710 cassette F1 progeny lines expressing 10 PPM or more of Cry3Bb protein variant. Failure to obtain CRW resistant lines with either of the standard vectors (pMON33709 or pMON33710) was not due to insufficient numbers of ITE's as over 300 ITE's from each of these two vectors were generated and screened for CRW resistant F1 progeny. Far fewer ITE's were generated with preferred vectors such as pMON33722, pMON33723, and pMON25096, yet all ultimately gave rise to CRW resistant F1 progeny lines.
TABLE-US-00010 TABLE 8 Numbers of CRW resistant independent transformation events obtained with the standard and improved Cry3Bb Protein Variant expression cassettes Number and Total Number Percent of Expression Number of of ITE's ITEs with cassette Genotype ITE's Tested RDR ≦ 3.5 L33709 H99 318 11 0 L33710 H99 336 10 0 A634 22 2 0 L25096 H99 52 4 2 (50%) A634 37 10 5 (50%) L25097 H99 634 17 10 (59%) A634 157 18 8 (44%) L33722 H99 107 10 6 (60%) L33723 H99 93 7 3 (43%) L33726 H99 65 6 5 (83%) A634 10 0 L33727 H99 86 0 A634 1 1 0 33736ABI H99 3 3 2 (67%) L33741 H99 108 1 0 L33748 H99 223 6 3 (50%) A634 82 7 4 (57%) L33749ABI H99 73 14 13 (93%)
[0161]In examples provided herein, experimental evidence that substantially equivalent compositions based on the improvements disclosed herein yield equivalent improvements in performance relative to the previously disclosed standards. More specifically, we demonstrate that improved compositions encoding both the Cry3Bb. 11098 and Cry3Bb. 11231 variants both yield equivalently improved performance relative to the previously disclosed standard compositions encoding Cry3Bb.11231. It thus follows that use of other Cry3B variants with specific biological activities that are greater than or equal to Cry3Bb.11098 or Cry3Bb.11231 is contemplated by and within the scope of this invention. For example, improved vector compositions encoding Cry3Bb variants include 11231, 11084, 11098, 11247, and others as set forth in English et al., U.S. application Ser. Nos. 08/993,170, 08/993,722, 08/993,755, and 08/996,441, all filed Dec. 18, 1997 can be derived from pMON25095 using standard mutagenesis procedures in a manner essentially equivalent to the construction of pMON33740.
5.4 Example 4
Preferred Expression Cassettes Confer Resistance to CRW Damage in Field Tests
[0162]Corn plants genetically modified to express Cry3Bb protein variants derived from the preferred vectors pMON33722, pMON33723, pMON25096, and pMON25097 were evaluated in the field for control of western corn rootworm, Diabrotica vergifera vergifera LeConte (WCR). None of the corn plants transformed with the standard vectors were advanced to field testing as none displayed adequate Corn Rootworm control in greenhouse tests (Example 3. Table 8). The efficacy trials were held at a Monsanto research farm in Jerseyville, Ill. and at the Northern Grain Insects Research Laboratory, USDA ARS research station in Brookings, S. Dak. These trials serve to evaluate performance of the preferred cassettes in the field under heavy insect pressure and to compare their performance to the current commercially available insecticides.
[0163]Seventeen independent transformation events (ITE) were selected for field evaluation based on greenhouse performance. The amount of seed available for the field evaluation varied for each ITE. Of these 17 events, only seven were planted at the Brookings research station. The field design for the Brookings' location was a randomized complete block (RCB) with 2 replications, where each plot was a single row containing a maximum of 30 plants. All 17 ITE's were planted at the Jerseyville location, where the design was a RCB with a maximum of 4 replications, 1 row plots each, where the number of replications depended on the seed available from each ITE. Because of this, the number of replications at Jerseyville ranged from two to four. Additional treatments included an untreated check (nontransgenic corn) and commercial insecticides, including Counter®, Lorsban®, and Force®. The insecticide treatments were only at the Jerseyville location. The insecticides were applied as an eight inch band at planting using the recommended rates.
[0164]Planting dates where May 28th and June 3rd for the Jerseyville & Brookings, respectively. The study was performed as follows; plots were infested % with CRW eggs at planting with 1,600 eggs per foot of row, approximately 800 eggs per plant. At the V1-V2 plant growth stage, plants were analyzed for presence of the Cry3Bb protein variant expression using an ELISA. Plants negative for the gene were culled from the plot.
[0165]At the end of the CRW larval feeding stage, when maximum damage would have occurred, all remaining plants in each plot were evaluated for root feeding injury using a 1-6 root damage rating (RDR) scale described by Hills and Peters (1971). The RDR scale is as follows;
Root Damage Rating:
[0166]1. No feeding scars [0167]2, Visible feeding scars, but no roots pruned to within 4 cm of the stalk [0168]3. One or more nodal roots pruned to within 4 cm of the stalk, but less than one nodes worth of roots [0169]4. One node worth of pruned roots [0170]5. Two nodes worth of pruned roots [0171]6. Three or more nodes worth of pruned roots
[0172]On July 25th and August 3rd the field trials were evaluated at Jerseyville and Brookings, respectively. The average RDR's for all treatments are illustrated in Table 9. Of the seventeen ITE's evaluated, 16 ITE's controlled CRW feeding, ≦3.0 RDR. Two of the three chemical standards had a RDR less than 30. Force® had a root damage rating of 3.2. Except for one ITE, WCR20, all treatments were significantly better than the checks (p<0.01) but did not differ significantly from each other. Figure one illustrates the difference in larval feeding damage between a transgenic CRW resistant plant and an untreated check.
[0173]Even though the ITE's did not differ significantly from the chemical standards with respect to root damage rating, the amount of feeding injury observed on roots from the insecticide treatments were greater than the roots expressing Monsanto's proprietary gene. The lack of difference between root damage rating is an artifact of the root rating scale, where this scale is based on "pruned" roots. Hills and Peters describe a pruned root as being less than 4 cm in length due to CRW feeding. Therefore, root masses without a "pruned" root but visible feeding scares are given a rating of 2. Roots outside of the zone of protection from the insecticide treatments had many more feeding scars and in most cases the root tips were destroyed as compared to the ITE's. Unlike the insecticide treatments, the transgenic plants express the CRW resistant gene throughout the entire root mass. But because the mechanism for control of the transgenic plant is orally mediated, a minimum amount of feeding is required to control any further injury by the CRW larvae. This minimal feeding requirement resulted in a RDR of 2.
[0174]In summary, corn plants expressing Cry3Bb protein variants were fully protected from CRW larval feeding. This level of protection eliminates the need for an insecticide treatment. Insecticides, including organophosphates, carbamates and pyrethroids are incorporated into the soil on over 16 million corn acres annually to control CRW. CRW resistance technology has the potential to significantly reduce the current exposure level of these insecticides to the environment. The benefits of shifting away from soil insecticides to a transgenic approach are impressive and include a reduction in potential human health and safety risks, reduced direct impacts on nontarget organisms, reduced contamination of surface and ground water supplies, decreased pesticide container disposal problems, and general compatibility with other pest management and agronomic programs.
TABLE-US-00011 TABLE 9 Corn rootworm root feeding damage (RDR) means for corn independent transformation events containing Monsanto's proprietary CRW resistant gene. Root Damage Rating (RDR) Treatment Jerseyville Brookings Average (RDR) pMON 25097-1 2.3 1.9 2.1 pMON 33722-1 2.6 2.3 2.5 pMON 33723-1 2.6 2.9 2.8 pMON 33723-2 2.6 2.0 2.3 pMON 33722-2 2.5 1.9 2.2 pMON 25096-1 2.8 2.5 2.7 pMON 25097-2 2.5 2.3 2.4 pMON 25096-2 2.4 n/a 2.4 pMON 25097-3 2.6 n/a 2.6 pMON 25096-3 2.2 n/a 2.2 pMON 25097-4 2.2 n/a 2.2 pMON 25096-4 2.6 n/a 2.6 pMON 33723-3 2.5 n/a 2.5 pMON 25097-5 3.0 n/a 3.0 pMON 25097-6 4.0 n/a 4.0 pMON 25097-7 2.2 n/a 2.2 pMON 33722-3 2.6 n/a 2.6 COUNTER ® 2.4 n/a 2.4 LORSBAN ® 2.4 n/a 2.4 FORCE ® 3.2 n/a 3.2 CHECK 4.1 4.1 4.1
5.5 Example 5
Transformation of Tobacco Chloroplast with a Cry3B gene
[0175]Recombinant plants can be produced in which only the mitochondrial or chloroplast DNA has been altered to incorporate the molecules envisioned in this application. Promoters which function in chloroplasts have been known in the art (Hanley-Bowden et al., Trends in Biochemical Sciences 12:67-70, 1987). Methods and compositions for obtaining cells containing chloroplasts into which heterologous DNA has been inserted have been described, for example by Daniell et al. (U.S. Pat. No. 5,693,507; 1997) and Maliga et al. (U.S. Pat. No. 5,451,513; 1995). A vector can be constructed which contains an expression cassette from which a Cry3B protein could be produced. A cassette could contain a chloroplast operable promoter sequence driving expression of a cry3B crystal protein gene, constructed in much the same manner as other polynucleotides herein, using thermal amplification methodologies, restriction endonuclease digestion, and ligation etc. A chloroplast expressible gene would provide a promoter and a 5' untranslated region from a heterologous gene or chloroplast gene such as psbA, which would provide for transcription and translation of a DNA sequence encoding a Cry3B protein in the chloroplast; a DNA sequence encoding Cry3B protein, and a transcriptional and translational termination region such as a 3' inverted repeat region of a chloroplast gene that could stabilize an expressed cry3B mRNA. Expression from within the to chloroplast would enhance cry3B gene product accumulation. A host cell containing chloroplasts or plastids can be transformed with the expression cassette and then the resulting cell containing the transformed chloroplasts can be grown to express the Cry3B protein. A cassette may also include an antibiotic, herbicide tolerance, or other selectable marker gene in addition to the cry3B gene. The expression cassette may be flanked by DNA sequences obtained from a chloroplast DNA which would facilitate stable integration of the expression cassette into the chloroplast genome, particularly by homologous recombination. Alternatively, the expression cassette may not integrate, but by including an origin of replication obtained from a chloroplast DNA, would be capable of providing for replication of the heterologous cry3B gene in the chloroplast. Plants can be generated from cells containing transformed chloroplasts and can then be grown to produce seeds, from which additional plants can be generated. Such transformation methods are advantageous over nuclear genome transformation, in particular where chloroplast transformation is effected by integration into the chloroplast genome, because chloroplast genes in general are maternally inherited. This provides environmentally "safer" transgenic plants, virtually eliminating the possibility of escapes into the environment. Furthermore, chloroplasts can be transformed multiple times to produce functional chloroplast genomes which express multiple desired recombinant proteins, whereas nuclear genomic transformation has been shown to be rather limited when multiple genes are desired. Segregational events are thus avoided using chloroplast or plastid transformation. Unlike plant nuclear genome expression, expression in chloroplasts or plastids can be initiated from only one promoter and continue through a polycistronic region to produce multiple peptides from single mRNA.
[0176]The expression cassette would be produced in much the same way that other plant transformation vectors are constructed. Plant chloroplast operable DNA sequences can be inserted into a bacterial plasmid and linked to DNA sequences expressing desired gene products, such as Cry3B proteins, so that Cry3B protein is produced within the chloroplast, obviating the requirement for nuclear gene regulation, capping, splicing, or polyadenylation of nuclear regulated genes, or chloroplast or plastid targeting sequences. An expression cassette comprising a cry3B gene, which is either synthetically constructed or a native gene derived directly from a B. thuringiensis genome or a B. thuringiensis episomal element, would be inserted into a restriction site in a vector constructed for the purpose of chloroplast or plastid transformation. The cassette would be flanked upstream by a chloroplast or plastid functional promoter and downstream by a chloroplast or plastid functional transcription and translation termination sequence. The resulting cassette would be incorporated into the chloroplast or plastid genome using well known homologous recombination methods.
[0177]Alternatively, chloroplast or plastid transformation could be obtained by using an autonomously replicating plasmid or other vector capable of propagation within the chloroplast or plastid. One means of effectuating this method would be to utilize a portion of the chloroplast or plastid genome required for chloroplast or plastid replication initiation as a means for maintaining the plasmid or vector in the transformed chloroplast or plastid. A sequence enabling stable replication of a chloroplast or plastid epigenetic element would easily be identified from random cloning of a chloroplast or plastid genome into a standard bacterial vector which also contains a chloroplast or plastid selectable marker gene, followed by transformation of chloroplasts or plastids and selection for transformed cells on an appropriate selection medium. Introduction of an expression cassette as described herein into a chloroplast or plastid replicable epigenetic element would thus provide an effective means for localizing a Cry3B B. thuringiensis δ-endotoxin to the chloroplast or plastid.
5.6 Example 6
Targeting Cry3Bb or Variant Cry3Bb Protein to Plastids
[0178]Improved expression by targeting recombinant insecticidal protein to the chloroplast may result in tissues which are light exposed and which accumulate mature chloroplasts as a result. Improving expression in leaf tissue to inhibit leaf-feeding pests susceptible to the insecticidal protein could be advantageous. To test this, two plasmids, pMON33709 and pMON33710 were constructed which were isogenic with respect to all elements with the exception of a plastid or chloroplast targeting sequence linked in frame to the insecticidal Cry3Bb improved variant in pMON33709. R0 corn plants were recovered and were shown to contain and express the transgene by ELISA. Six pMON33709 lines and sixteen pMON33710 lines were recovered which expressed the transgene in both the root and the leaves. Leaf and root tissue were recovered and analyzed for the presence and amount of Cry3Bb variant protein, measured in parts per million. The results are shown in Table 10.
TABLE-US-00012 TABLE 10 Comparison of Non-Targeted and Plaslid Targeted Leaf vs Root Expression of Cry3Bb Variant v11231 in Rn Corn Transformation Events R0 # Event # Construct Tissue ppm 11231(ug/g tissue) R053608 2027-05-01 L33709 Leaf 14.69 R053608 2027-05-01 L33709 Root 3.97 R053621 2028-06-06 L33709 Leaf 22.65 R053621 2028-06-06 L33709 Root 0.10 R053643 2029-03-09 L33709 Leaf 1.05 R053643 2029-03-09 L33709 Root 3.83 R053675 2028-03-06 L33709 Leaf 7.13 R053675 2028-03-06 L33709 Root 2.23 R053688 2028-04-02 L33709 Leaf 56.80 R053688 2028-04-02 L33709 Root 9.83 R053690 2028-04-02 L33709 Leaf 98.69 R053690 2028-04-02 L33709 Root 6.38 R053708 2027-01-02 L33710 Leaf 12.79 R053708 2027-01-02 L33710 Root 4.94 R053781 2028-02-19 L33710 Leaf 8.47 R053781 2028-02-19 L33710 Root 4.72 R053785 2027-04-06 L33710 Leaf 21.97 R053785 2027-04-06 L33710 Root 7.20 R053799 2028-01-16 L33710 Leaf 12.41 R053799 2028-01-16 L33710 Root 6.19 R053800 2028-01-16 L33710 Leaf 5.69 R053800 2028-01-16 L33710 Root 3.32 R053801 2028-01-16 L33710 Leaf 16.19 R053801 2028-01-16 L33710 Root 7.80 R053824 2027-01-11 L33710 Leaf 6.93 R053824 2027-01-11 L33710 Root 10.35 R053838 2030-08-12 L33710 Leaf 14.32 R053838 2030-08-12 L33710 Root 5.64 R053857 2030-08-08 L33710 Leaf 12.70 R053857 2030-08-08 L33710 Root 3.97 R053858 2028-02-32 L33710 Leaf 2.33 R053858 2028-02-32 L33710 Root 4.15 R053859 2028-02-32 L33710 Leaf 9.39 R053859 2028-02-32 L33710 Root 5.76 R053904 2027-02-03 L33709 Leaf 226.05 R053904 2027-02-03 L33709 Root 1.55 R053923 2029-01-08 L33710 Leaf 12.16 R053923 2029-01-08 L33710 Root 11.77 R053924 2029-01-08 L33710 Leaf 10.74 R053924 2029-01-08 L33710 Root 7.94 R053928 2029-01-05 L33710 Leaf 14.86 R053928 2029-01-05 L33710 Root 3.84 R053929 2029-01-05 L33710 Leaf 15.04 R053929 2029-01-05 L33710 Root 3.49
[0179]All but one pMON33709 line (Ro53643) produced between 3 to 15 times more insecticidal protein in the leaves than in the root tissue. The one line that produced less in the leaves also produced less than 1 ppm in the root, whereas the other lines produced up to almost 100 ppm in the leaves. The amount of Cry3Bb variant protein expressed was even more variable in the non-targeted lines derived from pMON33710 transformation events which were determined to be expressing the recombinant protein in both leaf and root tissues. While most of these lines produced more protein in the leaves than in the roots, some also produced more in the roots, but the difference between the amount produced in the roots in those improved root-expressors was less substantial than in the single pMON33709 targeted event. Also, the range of expression levels was less pronounced in the non-targeted events with one exception. Surprisingly, one line (Ro53904) produced substantially more protein in the leaves than was observed in any other line, targeted or non-targeted. This line would be expected to be a candidate for a commercial line directed to protection against Coleopteran pests which feed on leaf tissues. Conversely, lines such as Ro53923 would be expected to be optimum candidates for protecting corn plants against root-feeding pests such as corn rootworms.
[0180]The data in summary indicates that targeting the Bt Cry3B protein to the plastid or chloroplast improves the accumulation of the protein in leaf tissue but not in root tissue, and improves the overall expression of the protein in leaves in plants transformed with such constructs as compared to the levels of expression observed in root tissues in those same plants.
[0181]In view of the above, it will be seen that the several advantages of the invention are achieved and other advantageous results attained. As various changes could be made in the above methods and compositions without departing from the scope of the invention, it is intended that all matter contained in the above description and shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense.
[0182]In addition, all references referred to in this application are herein incorporated by reference in their entirety.
Sequence CWU
1
4311959DNABacillus thuringiensisCDS(1)..(1956)Description of Artificial
Sequence naturally occurring nucleotide sequence encoding a Cry3Bb1
amino acid sequence 1atg aat cca aac aat cga agt gaa cat gat acg ata
aag gtt aca cct 48Met Asn Pro Asn Asn Arg Ser Glu His Asp Thr Ile
Lys Val Thr Pro 1 5 10
15aac agt gaa ttg caa act aac cat aat caa tat cct tta gct gac aat
96Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Ala Asp Asn
20 25 30cca aat tca aca cta gaa gaa
tta aat tat aaa gaa ttt tta aga atg 144Pro Asn Ser Thr Leu Glu Glu
Leu Asn Tyr Lys Glu Phe Leu Arg Met 35 40
45act gaa gac agt tct acg gaa gtg cta gac aac tct aca gta aaa
gat 192Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys
Asp 50 55 60gca gtt ggg aca gga att
tct gtt gta ggg cag att tta ggt gtt gta 240Ala Val Gly Thr Gly Ile
Ser Val Val Gly Gln Ile Leu Gly Val Val 65 70
75 80gga gtt cca ttt gct ggg gca ctc act tca ttt
tat caa tca ttt ctt 288Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe
Tyr Gln Ser Phe Leu 85 90
95aac act ata tgg cca agt gat gct gac cca tgg aag gct ttt atg gca
336Asn Thr Ile Trp Pro Ser Asp Ala Asp Pro Trp Lys Ala Phe Met Ala
100 105 110caa gtt gaa gta ctg ata
gat aag aaa ata gag gag tat gct aaa agt 384Gln Val Glu Val Leu Ile
Asp Lys Lys Ile Glu Glu Tyr Ala Lys Ser 115 120
125aaa gct ctt gca gag tta cag ggt ctt caa aat aat ttc gaa
gat tat 432Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu
Asp Tyr 130 135 140gtt aat gcg tta aat
tcc tgg aag aaa aca cct tta agt ttg cga agt 480Val Asn Ala Leu Asn
Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg Ser145 150
155 160aaa aga agc caa gat cga ata agg gaa ctt
ttt tct caa gca gaa agt 528Lys Arg Ser Gln Asp Arg Ile Arg Glu Leu
Phe Ser Gln Ala Glu Ser 165 170
175cat ttt cgt aat tcc atg ccg tca ttt gca gtt tcc aaa ttc gaa gtg
576His Phe Arg Asn Ser Met Pro Ser Phe Ala Val Ser Lys Phe Glu Val
180 185 190ctg ttt cta cca aca tat
gca caa gct gca aat aca cat tta ttg cta 624Leu Phe Leu Pro Thr Tyr
Ala Gln Ala Ala Asn Thr His Leu Leu Leu 195 200
205tta aaa gat gct caa gtt ttt gga gaa gaa tgg gga tat tct
tca gaa 672Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser
Ser Glu 210 215 220gat gtt gct gaa ttt
tat cat aga caa tta aaa ctt aca caa caa tac 720Asp Val Ala Glu Phe
Tyr His Arg Gln Leu Lys Leu Thr Gln Gln Tyr225 230
235 240act gac cat tgt gtt aat tgg tat aat gtt
gga tta aat ggt tta aga 768Thr Asp His Cys Val Asn Trp Tyr Asn Val
Gly Leu Asn Gly Leu Arg 245 250
255ggt tca act tat gat gca tgg gtc aaa ttt aac cgt ttt cgc aga gaa
816Gly Ser Thr Tyr Asp Ala Trp Val Lys Phe Asn Arg Phe Arg Arg Glu
260 265 270atg act tta act gta tta
gat cta att gta ctt ttc cca ttt tat gat 864Met Thr Leu Thr Val Leu
Asp Leu Ile Val Leu Phe Pro Phe Tyr Asp 275 280
285att cgg tta tac tca aaa ggg gtt aaa aca gaa cta aca aga
gac att 912Ile Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg
Asp Ile 290 295 300ttt acg gat cca att
ttt tca ctt aat act ctt cag gag tat gga cca 960Phe Thr Asp Pro Ile
Phe Ser Leu Asn Thr Leu Gln Glu Tyr Gly Pro305 310
315 320act ttt ttg agt ata gaa aac tct att cga
aaa cct cat tta ttt gat 1008Thr Phe Leu Ser Ile Glu Asn Ser Ile Arg
Lys Pro His Leu Phe Asp 325 330
335tat tta cag ggg att gaa ttt cat acg cgt ctt caa cct ggt tac ttt
1056Tyr Leu Gln Gly Ile Glu Phe His Thr Arg Leu Gln Pro Gly Tyr Phe
340 345 350ggg aaa gat tct ttc aat
tat tgg tct ggt aat tat gta gaa act aga 1104Gly Lys Asp Ser Phe Asn
Tyr Trp Ser Gly Asn Tyr Val Glu Thr Arg 355 360
365cct agt ata gga tct agt aag aca att act tcc cca ttt tat
gga gat 1152Pro Ser Ile Gly Ser Ser Lys Thr Ile Thr Ser Pro Phe Tyr
Gly Asp 370 375 380aaa tct act gaa cct
gta caa aag cta agc ttt gat gga caa aaa gtt 1200Lys Ser Thr Glu Pro
Val Gln Lys Leu Ser Phe Asp Gly Gln Lys Val385 390
395 400tat cga act ata gct aat aca gac gta gcg
gct tgg ccg aat ggt aag 1248Tyr Arg Thr Ile Ala Asn Thr Asp Val Ala
Ala Trp Pro Asn Gly Lys 405 410
415gta tat tta ggt gtt acg aaa gtt gat ttt agt caa tat gat gat caa
1296Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp Gln
420 425 430aaa aat gaa act agt aca
caa aca tat gat tca aaa aga aac aat ggc 1344Lys Asn Glu Thr Ser Thr
Gln Thr Tyr Asp Ser Lys Arg Asn Asn Gly 435 440
445cat gta agt gca cag gat tct att gac caa tta ccg cca gaa
aca aca 1392His Val Ser Ala Gln Asp Ser Ile Asp Gln Leu Pro Pro Glu
Thr Thr 450 455 460gat gaa cca ctt gaa
aaa gca tat agt cat cag ctt aat tac gcg gaa 1440Asp Glu Pro Leu Glu
Lys Ala Tyr Ser His Gln Leu Asn Tyr Ala Glu465 470
475 480tgt ttc tta atg cag gac cgt cgt gga aca
att cca ttt ttt act tgg 1488Cys Phe Leu Met Gln Asp Arg Arg Gly Thr
Ile Pro Phe Phe Thr Trp 485 490
495aca cat aga agt gta gac ttt ttt aat aca att gat gct gaa aag att
1536Thr His Arg Ser Val Asp Phe Phe Asn Thr Ile Asp Ala Glu Lys Ile
500 505 510act caa ctt cca gta gtg
aaa gca tat gcc ttg tct tca ggt gct tcc 1584Thr Gln Leu Pro Val Val
Lys Ala Tyr Ala Leu Ser Ser Gly Ala Ser 515 520
525att att gaa ggt cca gga ttc aca gga gga aat tta cta ttc
cta aaa 1632Ile Ile Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe
Leu Lys 530 535 540gaa tct agt aat tca
att gct aaa ttt aaa gtt aca tta aat tca gca 1680Glu Ser Ser Asn Ser
Ile Ala Lys Phe Lys Val Thr Leu Asn Ser Ala545 550
555 560gcc ttg tta caa cga tat cgt gta aga ata
cgc tat gct tct acc act 1728Ala Leu Leu Gln Arg Tyr Arg Val Arg Ile
Arg Tyr Ala Ser Thr Thr 565 570
575aac tta cga ctt ttt gtg caa aat tca aac aat gat ttt ctt gtc atc
1776Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val Ile
580 585 590tac att aat aaa act atg
aat aaa gat gat gat tta aca tat caa aca 1824Tyr Ile Asn Lys Thr Met
Asn Lys Asp Asp Asp Leu Thr Tyr Gln Thr 595 600
605ttt gat ctc gca act act aat tct aat atg ggg ttc tcg ggt
gat aag 1872Phe Asp Leu Ala Thr Thr Asn Ser Asn Met Gly Phe Ser Gly
Asp Lys 610 615 620aat gaa ctt ata ata
gga gca gaa tct ttc gtt tct aat gaa aaa atc 1920Asn Glu Leu Ile Ile
Gly Ala Glu Ser Phe Val Ser Asn Glu Lys Ile625 630
635 640tat ata gat aag ata gaa ttt atc cca gta
caa ttg taa 1959Tyr Ile Asp Lys Ile Glu Phe Ile Pro Val
Gln Leu 645 6502652PRTBacillus
thuringiensis 2Met Asn Pro Asn Asn Arg Ser Glu His Asp Thr Ile Lys Val
Thr Pro 1 5 10 15Asn Ser
Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Ala Asp Asn 20
25 30Pro Asn Ser Thr Leu Glu Glu Leu Asn
Tyr Lys Glu Phe Leu Arg Met 35 40
45Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys Asp
50 55 60Ala Val Gly Thr Gly Ile Ser Val
Val Gly Gln Ile Leu Gly Val Val 65 70
75 80Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln
Ser Phe Leu 85 90 95Asn
Thr Ile Trp Pro Ser Asp Ala Asp Pro Trp Lys Ala Phe Met Ala
100 105 110Gln Val Glu Val Leu Ile Asp
Lys Lys Ile Glu Glu Tyr Ala Lys Ser 115 120
125Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp
Tyr 130 135 140Val Asn Ala Leu Asn Ser
Trp Lys Lys Thr Pro Leu Ser Leu Arg Ser145 150
155 160Lys Arg Ser Gln Asp Arg Ile Arg Glu Leu Phe
Ser Gln Ala Glu Ser 165 170
175His Phe Arg Asn Ser Met Pro Ser Phe Ala Val Ser Lys Phe Glu Val
180 185 190Leu Phe Leu Pro Thr Tyr
Ala Gln Ala Ala Asn Thr His Leu Leu Leu 195 200
205Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser
Ser Glu 210 215 220Asp Val Ala Glu Phe
Tyr His Arg Gln Leu Lys Leu Thr Gln Gln Tyr225 230
235 240Thr Asp His Cys Val Asn Trp Tyr Asn Val
Gly Leu Asn Gly Leu Arg 245 250
255Gly Ser Thr Tyr Asp Ala Trp Val Lys Phe Asn Arg Phe Arg Arg Glu
260 265 270Met Thr Leu Thr Val
Leu Asp Leu Ile Val Leu Phe Pro Phe Tyr Asp 275
280 285Ile Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu
Thr Arg Asp Ile 290 295 300Phe Thr Asp
Pro Ile Phe Ser Leu Asn Thr Leu Gln Glu Tyr Gly Pro305
310 315 320Thr Phe Leu Ser Ile Glu Asn
Ser Ile Arg Lys Pro His Leu Phe Asp 325
330 335Tyr Leu Gln Gly Ile Glu Phe His Thr Arg Leu Gln
Pro Gly Tyr Phe 340 345 350Gly
Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr Arg 355
360 365Pro Ser Ile Gly Ser Ser Lys Thr Ile
Thr Ser Pro Phe Tyr Gly Asp 370 375
380Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys Val385
390 395 400Tyr Arg Thr Ile
Ala Asn Thr Asp Val Ala Ala Trp Pro Asn Gly Lys 405
410 415Val Tyr Leu Gly Val Thr Lys Val Asp Phe
Ser Gln Tyr Asp Asp Gln 420 425
430Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn Gly
435 440 445His Val Ser Ala Gln Asp Ser
Ile Asp Gln Leu Pro Pro Glu Thr Thr 450 455
460Asp Glu Pro Leu Glu Lys Ala Tyr Ser His Gln Leu Asn Tyr Ala
Glu465 470 475 480Cys Phe
Leu Met Gln Asp Arg Arg Gly Thr Ile Pro Phe Phe Thr Trp
485 490 495Thr His Arg Ser Val Asp Phe
Phe Asn Thr Ile Asp Ala Glu Lys Ile 500 505
510Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu Ser Ser Gly
Ala Ser 515 520 525Ile Ile Glu Gly
Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu Lys 530
535 540Glu Ser Ser Asn Ser Ile Ala Lys Phe Lys Val Thr
Leu Asn Ser Ala545 550 555
560Ala Leu Leu Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser Thr Thr
565 570 575Asn Leu Arg Leu Phe
Val Gln Asn Ser Asn Asn Asp Phe Leu Val Ile 580
585 590Tyr Ile Asn Lys Thr Met Asn Lys Asp Asp Asp Leu
Thr Tyr Gln Thr 595 600 605Phe Asp
Leu Ala Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp Lys 610
615 620Asn Glu Leu Ile Ile Gly Ala Glu Ser Phe Val
Ser Asn Glu Lys Ile625 630 635
640Tyr Ile Asp Lys Ile Glu Phe Ile Pro Val Gln Leu
645 65031959DNABacillus
thuringiensisCDS(1)..(1956)naturally occurring nucleotide sequence
encoding a Cry3Bb2 amino acid sequence 3atg aat cca aac aat cga agt
gaa cat gat acg ata aag gtt aca cct 48Met Asn Pro Asn Asn Arg Ser
Glu His Asp Thr Ile Lys Val Thr Pro 1 5
10 15aac agt gaa ttg cca act aac cat aat caa tat cct tta
gct gac aat 96Asn Ser Glu Leu Pro Thr Asn His Asn Gln Tyr Pro Leu
Ala Asp Asn 20 25 30cca aat
tcg aca cta gaa gaa tta aat tat aaa gaa ttt tta aga atg 144Pro Asn
Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg Met 35
40 45act gaa gac agt tct acg gaa gtg cta gac
aac tct aca gta aaa gat 192Thr Glu Asp Ser Ser Thr Glu Val Leu Asp
Asn Ser Thr Val Lys Asp 50 55 60gca
gtt ggg aca gga att tct gtt gta ggg cag att tta ggt gtt gta 240Ala
Val Gly Thr Gly Ile Ser Val Val Gly Gln Ile Leu Gly Val Val 65
70 75 80gga gtt cca ttt gct ggg
gca ctc act tca ttt tat caa tca ttt ctt 288Gly Val Pro Phe Ala Gly
Ala Leu Thr Ser Phe Tyr Gln Ser Phe Leu 85
90 95gac act ata tgg cca agt gat gct gac cca tgg aag
gct ttt atg gca 336Asp Thr Ile Trp Pro Ser Asp Ala Asp Pro Trp Lys
Ala Phe Met Ala 100 105 110caa
gtt gaa gta ctg ata gat aag aaa ata gag gag tat gct aaa agt 384Gln
Val Glu Val Leu Ile Asp Lys Lys Ile Glu Glu Tyr Ala Lys Ser 115
120 125aaa gct ctt gca gag tta cag ggt ctt
caa aat aat ttc gaa gat tat 432Lys Ala Leu Ala Glu Leu Gln Gly Leu
Gln Asn Asn Phe Glu Asp Tyr 130 135
140gtt aat gcg tta aat tcc tgg aag aaa aca cct tta agt ttg cga agt
480Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg Ser145
150 155 160aaa aga agc caa
gat cga ata agg gaa ctt ttt tct caa gca gaa agt 528Lys Arg Ser Gln
Asp Arg Ile Arg Glu Leu Phe Ser Gln Ala Glu Ser 165
170 175cat ttt cgt aat tcc atg ccg tca ttt gca
gtt tcc aaa ttc gaa gtg 576His Phe Arg Asn Ser Met Pro Ser Phe Ala
Val Ser Lys Phe Glu Val 180 185
190ctg ttt cta cca aca tat gca caa gct gca aat aca cat tta ttg cta
624Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His Leu Leu Leu
195 200 205tta aaa gat gct caa gtt ttt
gga gaa gaa tgg gga tat tct tca gaa 672Leu Lys Asp Ala Gln Val Phe
Gly Glu Glu Trp Gly Tyr Ser Ser Glu 210 215
220gat gtt gct gaa ttt tat cat aga caa tta aaa ctt acg caa caa tac
720Asp Val Ala Glu Phe Tyr His Arg Gln Leu Lys Leu Thr Gln Gln Tyr225
230 235 240act gac cat tgt
gtc aat tgg tat aat gtt gga tta aat ggt tta aga 768Thr Asp His Cys
Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu Arg 245
250 255ggt tca act tat gat gca tgg gtc aaa ttt
aac cgt ttt cgc aga gaa 816Gly Ser Thr Tyr Asp Ala Trp Val Lys Phe
Asn Arg Phe Arg Arg Glu 260 265
270atg act tta act gta tta gat cta att gta ctt ttc cca ttt tat gat
864Met Thr Leu Thr Val Leu Asp Leu Ile Val Leu Phe Pro Phe Tyr Asp
275 280 285gtt cgg tta tac tca aaa ggt
gtt aaa aca gaa cta aca aga gac att 912Val Arg Leu Tyr Ser Lys Gly
Val Lys Thr Glu Leu Thr Arg Asp Ile 290 295
300ttt acg gat cca att ttt tca ctc aat act ctt cag gag tat gga cca
960Phe Thr Asp Pro Ile Phe Ser Leu Asn Thr Leu Gln Glu Tyr Gly Pro305
310 315 320act ttt ttg agt
ata gaa aac tct att cga aaa cct cat tta ttt gat 1008Thr Phe Leu Ser
Ile Glu Asn Ser Ile Arg Lys Pro His Leu Phe Asp 325
330 335tat tta cag ggt att gaa ttt cat acg cgt
ctt caa cct ggt tac tct 1056Tyr Leu Gln Gly Ile Glu Phe His Thr Arg
Leu Gln Pro Gly Tyr Ser 340 345
350ggg aaa gat tct ttc aat tat tgg tct ggt aat tat gta gaa act aga
1104Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr Arg
355 360 365cct agt ata gga tct agt aag
aca att act tcc cca ttt tat gga gat 1152Pro Ser Ile Gly Ser Ser Lys
Thr Ile Thr Ser Pro Phe Tyr Gly Asp 370 375
380aaa tct act gaa cct gta caa aag tta agc ttt gat gga caa aaa gtt
1200Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys Val385
390 395 400tat cga act ata
gct aat aca gac gta gcg gct tgg ccg aat ggc aag 1248Tyr Arg Thr Ile
Ala Asn Thr Asp Val Ala Ala Trp Pro Asn Gly Lys 405
410 415ata tat ttt ggt gtt acg aaa gtt gat ttt
agt caa tat gat gat caa 1296Ile Tyr Phe Gly Val Thr Lys Val Asp Phe
Ser Gln Tyr Asp Asp Gln 420 425
430aaa aat gaa act agt aca caa aca tat gat tca aaa aga aac aat ggc
1344Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn Gly
435 440 445cat gta ggt gca cag gat tct
att gac caa tta cca cca gaa aca aca 1392His Val Gly Ala Gln Asp Ser
Ile Asp Gln Leu Pro Pro Glu Thr Thr 450 455
460gat gaa cca ctt gaa aaa gca tat agt cat cag ctt aat tac gcg gaa
1440Asp Glu Pro Leu Glu Lys Ala Tyr Ser His Gln Leu Asn Tyr Ala Glu465
470 475 480tgt ttc tta atg
cag gac cgt cgt gga aca att cca ttt ttt act tgg 1488Cys Phe Leu Met
Gln Asp Arg Arg Gly Thr Ile Pro Phe Phe Thr Trp 485
490 495aca cat aga agt gta gac ttt ttt aat aca
att gat gct gaa aag att 1536Thr His Arg Ser Val Asp Phe Phe Asn Thr
Ile Asp Ala Glu Lys Ile 500 505
510act caa ctt cca gta gtg aaa gca tat gcc ttg tct tca ggt gct tcc
1584Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu Ser Ser Gly Ala Ser
515 520 525att att gaa ggt cca gga ttc
aca gga gga aat tta cta ttc cta aaa 1632Ile Ile Glu Gly Pro Gly Phe
Thr Gly Gly Asn Leu Leu Phe Leu Lys 530 535
540gaa tct agt aat tca att gct aaa ttt aaa gtt aca tta aat tca gca
1680Glu Ser Ser Asn Ser Ile Ala Lys Phe Lys Val Thr Leu Asn Ser Ala545
550 555 560gcc ttg tta caa
cga tat cgt gta aga ata cgc tat gct tct acc act 1728Ala Leu Leu Gln
Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser Thr Thr 565
570 575aac tta cga ctt ttt gtg caa aat tca aac
aat gat ttt att gtc atc 1776Asn Leu Arg Leu Phe Val Gln Asn Ser Asn
Asn Asp Phe Ile Val Ile 580 585
590tac att aat aaa act atg aat ata gat gat gat tta aca tat caa aca
1824Tyr Ile Asn Lys Thr Met Asn Ile Asp Asp Asp Leu Thr Tyr Gln Thr
595 600 605ttt gat ctc gca act act aat
tct aat atg ggg ttc tcg ggt gat acg 1872Phe Asp Leu Ala Thr Thr Asn
Ser Asn Met Gly Phe Ser Gly Asp Thr 610 615
620aat gaa ctt ata ata gga gca gaa tct ttc gtt tct aat gaa aaa atc
1920Asn Glu Leu Ile Ile Gly Ala Glu Ser Phe Val Ser Asn Glu Lys Ile625
630 635 640tat ata gat aag
ata gaa ttt atc cca gta caa ttg taa 1959Tyr Ile Asp Lys
Ile Glu Phe Ile Pro Val Gln Leu 645
6504652PRTBacillus thuringiensis 4Met Asn Pro Asn Asn Arg Ser Glu His Asp
Thr Ile Lys Val Thr Pro 1 5 10
15Asn Ser Glu Leu Pro Thr Asn His Asn Gln Tyr Pro Leu Ala Asp Asn
20 25 30Pro Asn Ser Thr Leu
Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg Met 35
40 45Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr
Val Lys Asp 50 55 60Ala Val Gly Thr
Gly Ile Ser Val Val Gly Gln Ile Leu Gly Val Val 65 70
75 80Gly Val Pro Phe Ala Gly Ala Leu Thr
Ser Phe Tyr Gln Ser Phe Leu 85 90
95Asp Thr Ile Trp Pro Ser Asp Ala Asp Pro Trp Lys Ala Phe Met
Ala 100 105 110Gln Val Glu Val
Leu Ile Asp Lys Lys Ile Glu Glu Tyr Ala Lys Ser 115
120 125Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn
Phe Glu Asp Tyr 130 135 140Val Asn Ala
Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg Ser145
150 155 160Lys Arg Ser Gln Asp Arg Ile
Arg Glu Leu Phe Ser Gln Ala Glu Ser 165
170 175His Phe Arg Asn Ser Met Pro Ser Phe Ala Val Ser
Lys Phe Glu Val 180 185 190Leu
Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His Leu Leu Leu 195
200 205Leu Lys Asp Ala Gln Val Phe Gly Glu
Glu Trp Gly Tyr Ser Ser Glu 210 215
220Asp Val Ala Glu Phe Tyr His Arg Gln Leu Lys Leu Thr Gln Gln Tyr225
230 235 240Thr Asp His Cys
Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu Arg 245
250 255Gly Ser Thr Tyr Asp Ala Trp Val Lys Phe
Asn Arg Phe Arg Arg Glu 260 265
270Met Thr Leu Thr Val Leu Asp Leu Ile Val Leu Phe Pro Phe Tyr Asp
275 280 285Val Arg Leu Tyr Ser Lys Gly
Val Lys Thr Glu Leu Thr Arg Asp Ile 290 295
300Phe Thr Asp Pro Ile Phe Ser Leu Asn Thr Leu Gln Glu Tyr Gly
Pro305 310 315 320Thr Phe
Leu Ser Ile Glu Asn Ser Ile Arg Lys Pro His Leu Phe Asp
325 330 335Tyr Leu Gln Gly Ile Glu Phe
His Thr Arg Leu Gln Pro Gly Tyr Ser 340 345
350Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu
Thr Arg 355 360 365Pro Ser Ile Gly
Ser Ser Lys Thr Ile Thr Ser Pro Phe Tyr Gly Asp 370
375 380Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp
Gly Gln Lys Val385 390 395
400Tyr Arg Thr Ile Ala Asn Thr Asp Val Ala Ala Trp Pro Asn Gly Lys
405 410 415Ile Tyr Phe Gly Val
Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp Gln 420
425 430Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys
Arg Asn Asn Gly 435 440 445His Val
Gly Ala Gln Asp Ser Ile Asp Gln Leu Pro Pro Glu Thr Thr 450
455 460Asp Glu Pro Leu Glu Lys Ala Tyr Ser His Gln
Leu Asn Tyr Ala Glu465 470 475
480Cys Phe Leu Met Gln Asp Arg Arg Gly Thr Ile Pro Phe Phe Thr Trp
485 490 495Thr His Arg Ser
Val Asp Phe Phe Asn Thr Ile Asp Ala Glu Lys Ile 500
505 510Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu
Ser Ser Gly Ala Ser 515 520 525Ile
Ile Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu Lys 530
535 540Glu Ser Ser Asn Ser Ile Ala Lys Phe Lys
Val Thr Leu Asn Ser Ala545 550 555
560Ala Leu Leu Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser Thr
Thr 565 570 575Asn Leu Arg
Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Ile Val Ile 580
585 590Tyr Ile Asn Lys Thr Met Asn Ile Asp Asp
Asp Leu Thr Tyr Gln Thr 595 600
605Phe Asp Leu Ala Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp Thr 610
615 620Asn Glu Leu Ile Ile Gly Ala Glu
Ser Phe Val Ser Asn Glu Lys Ile625 630
635 640Tyr Ile Asp Lys Ile Glu Phe Ile Pro Val Gln Leu
645 65051962DNAArtificial SequenceDescription
of Artificial Sequence synthetic or non-naturally occurring
nucleotide sequence encoding a Cry3Bb amino acid sequence 5atg aac
cct aac aat cgt tcc gaa cac gac acc atc aag gtt act cca 48Met Asn
Pro Asn Asn Arg Ser Glu His Asp Thr Ile Lys Val Thr Pro 1
5 10 15aac tct gag ttg caa act aat cac
aac cag tac cca ttg gct gac aat 96Asn Ser Glu Leu Gln Thr Asn His
Asn Gln Tyr Pro Leu Ala Asp Asn 20 25
30cct aac agt act ctt gag gaa ctt aac tac aag gag ttt ctc cgg
atg 144Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg
Met 35 40 45acc gaa gat agc tcc
act gag gtt ctc gat aac tct aca gtg aag gac 192Thr Glu Asp Ser Ser
Thr Glu Val Leu Asp Asn Ser Thr Val Lys Asp 50 55
60gct gtt gga act ggc att agc gtt gtg gga cag att ctt gga
gtg gtt 240Ala Val Gly Thr Gly Ile Ser Val Val Gly Gln Ile Leu Gly
Val Val 65 70 75 80ggt
gtt cca ttc gct gga gct ttg acc agc ttc tac cag tcc ttt ctc 288Gly
Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe Leu
85 90 95aac acc atc tgg cct tca gat
gct gat ccc tgg aag gct ttc atg gcc 336Asn Thr Ile Trp Pro Ser Asp
Ala Asp Pro Trp Lys Ala Phe Met Ala 100 105
110caa gtg gaa gtc ttg atc gat aag aag atc gaa gag tat gcc
aag tct 384Gln Val Glu Val Leu Ile Asp Lys Lys Ile Glu Glu Tyr Ala
Lys Ser 115 120 125aaa gcc ttg gct
gag ttg caa ggt ttg cag aac aac ttc gag gat tac 432Lys Ala Leu Ala
Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp Tyr 130
135 140gtc aac gca ctc aac agc tgg aag aaa act ccc ttg
agt ctc agg tct 480Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu
Ser Leu Arg Ser145 150 155
160aag cgt tcc cag gac cgt att cgt gaa ctt ttc agc caa gcc gaa tcc
528Lys Arg Ser Gln Asp Arg Ile Arg Glu Leu Phe Ser Gln Ala Glu Ser
165 170 175cac ttc aga aac tcc
atg cct agc ttt gcc gtt tct aag ttc gag gtg 576His Phe Arg Asn Ser
Met Pro Ser Phe Ala Val Ser Lys Phe Glu Val 180
185 190ctc ttc ttg cca aca tac gca caa gct gcc aac act
cat ctc ttg ctt 624Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr
His Leu Leu Leu 195 200 205ctc aaa
gac gct cag gtg ttt ggt gag gaa tgg ggt tac tcc agt gaa 672Leu Lys
Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser Glu 210
215 220gat gtt gcc gag ttc tac cat agg cag ctc aag
ttg act caa cag tac 720Asp Val Ala Glu Phe Tyr His Arg Gln Leu Lys
Leu Thr Gln Gln Tyr225 230 235
240aca gac cac tgc gtc aac tgg tac aac gtt ggg ctc aat ggt ctt aga
768Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu Arg
245 250 255gga tct acc tac gac
gca tgg gtg aag ttc aac agg ttt cgt aga gag 816Gly Ser Thr Tyr Asp
Ala Trp Val Lys Phe Asn Arg Phe Arg Arg Glu 260
265 270atg acc ttg act gtg ctc gat ctt atc gtt ctc ttt
cca ttc tac gac 864Met Thr Leu Thr Val Leu Asp Leu Ile Val Leu Phe
Pro Phe Tyr Asp 275 280 285att cgt
ctt tac tcc aaa ggc gtt aag aca gag ctg acc aga gac atc 912Ile Arg
Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp Ile 290
295 300ttc acc gat ccc atc ttc tca ctt aac acc ctg
cag gaa tac ggt cca 960Phe Thr Asp Pro Ile Phe Ser Leu Asn Thr Leu
Gln Glu Tyr Gly Pro305 310 315
320act ttt ctc tcc att gag aac agc atc agg aag cct cac ctc ttc gac
1008Thr Phe Leu Ser Ile Glu Asn Ser Ile Arg Lys Pro His Leu Phe Asp
325 330 335tat ctg caa ggc att
gag ttt cac acc agg ttg caa cct ggt tac ttc 1056Tyr Leu Gln Gly Ile
Glu Phe His Thr Arg Leu Gln Pro Gly Tyr Phe 340
345 350ggt aag gat tcc ttc aac tac tgg agc gga aac tac
gtt gaa acc aga 1104Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr
Val Glu Thr Arg 355 360 365cca tcc
atc gga tct agc aag acc atc act tct cca ttc tac ggt gac 1152Pro Ser
Ile Gly Ser Ser Lys Thr Ile Thr Ser Pro Phe Tyr Gly Asp 370
375 380aag agc act gag cca gtg cag aag ttg agc ttc
gat ggg cag aag gtg 1200Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe
Asp Gly Gln Lys Val385 390 395
400tat aga acc atc gcc aat acc gat gtt gca gct tgg cct aat ggc aag
1248Tyr Arg Thr Ile Ala Asn Thr Asp Val Ala Ala Trp Pro Asn Gly Lys
405 410 415gtc tac ctt gga gtt
act aaa gtg gac ttc tcc caa tac gac gat cag 1296Val Tyr Leu Gly Val
Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp Gln 420
425 430aag aac gag aca tct act caa acc tac gat agt aag
agg aac aat ggc 1344Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys
Arg Asn Asn Gly 435 440 445cat gtt
tcc gca caa gac tcc att gac caa ctt cca cct gaa acc act 1392His Val
Ser Ala Gln Asp Ser Ile Asp Gln Leu Pro Pro Glu Thr Thr 450
455 460gat gaa cca ttg gag aag gct tac agt cac caa
ctt aac tac gcc gaa 1440Asp Glu Pro Leu Glu Lys Ala Tyr Ser His Gln
Leu Asn Tyr Ala Glu465 470 475
480tgc ttt ctc atg caa gac agg cgt ggc acc att ccg ttc ttt aca tgg
1488Cys Phe Leu Met Gln Asp Arg Arg Gly Thr Ile Pro Phe Phe Thr Trp
485 490 495act cac agg tct gtc
gac ttc ttt aac act atc gac gct gag aag att 1536Thr His Arg Ser Val
Asp Phe Phe Asn Thr Ile Asp Ala Glu Lys Ile 500
505 510acc caa ctt ccc gtg gtc aag gct tat gcc ttg tcc
agc gga gct tcc 1584Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu Ser
Ser Gly Ala Ser 515 520 525atc att
gaa ggt cca ggc ttc acc ggt ggc aac ttg ctc ttc ctt aag 1632Ile Ile
Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu Lys 530
535 540gag tcc agc aac tcc atc gcc aag ttc aaa gtg
aca ctt aac tca gca 1680Glu Ser Ser Asn Ser Ile Ala Lys Phe Lys Val
Thr Leu Asn Ser Ala545 550 555
560gcc ttg ctc caa cgt tac agg gtt cgt atc aga tac gca agc act acc
1728Ala Leu Leu Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser Thr Thr
565 570 575aat ctt cgc ctc ttt
gtc cag aac agc aac aat gat ttc ctt gtc atc 1776Asn Leu Arg Leu Phe
Val Gln Asn Ser Asn Asn Asp Phe Leu Val Ile 580
585 590tac atc aac aag act atg aac aaa gac gat gac ctc
acc tac aac aca 1824Tyr Ile Asn Lys Thr Met Asn Lys Asp Asp Asp Leu
Thr Tyr Asn Thr 595 600 605ttc gat
ctt gcc act acc aat agt aac atg gga ttc tct ggt gac aag 1872Phe Asp
Leu Ala Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp Lys 610
615 620aac gag ctg atc ata ggt gct gag agc ttt gtc
tct aat gag aag att 1920Asn Glu Leu Ile Ile Gly Ala Glu Ser Phe Val
Ser Asn Glu Lys Ile625 630 635
640tac ata gac aag atc gag ttc att cca gtt caa ctc taatag
1962Tyr Ile Asp Lys Ile Glu Phe Ile Pro Val Gln Leu 645
6506652PRTArtificial SequenceDescription of Artificial
Sequence synthetic or non-naturally occurring amino acid sequence
encoded by SEQ ID NO5 6Met Asn Pro Asn Asn Arg Ser Glu His Asp Thr Ile
Lys Val Thr Pro 1 5 10
15Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Ala Asp Asn
20 25 30Pro Asn Ser Thr Leu Glu Glu
Leu Asn Tyr Lys Glu Phe Leu Arg Met 35 40
45Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys
Asp 50 55 60Ala Val Gly Thr Gly Ile
Ser Val Val Gly Gln Ile Leu Gly Val Val 65 70
75 80Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe
Tyr Gln Ser Phe Leu 85 90
95Asn Thr Ile Trp Pro Ser Asp Ala Asp Pro Trp Lys Ala Phe Met Ala
100 105 110Gln Val Glu Val Leu Ile
Asp Lys Lys Ile Glu Glu Tyr Ala Lys Ser 115 120
125Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu
Asp Tyr 130 135 140Val Asn Ala Leu Asn
Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg Ser145 150
155 160Lys Arg Ser Gln Asp Arg Ile Arg Glu Leu
Phe Ser Gln Ala Glu Ser 165 170
175His Phe Arg Asn Ser Met Pro Ser Phe Ala Val Ser Lys Phe Glu Val
180 185 190Leu Phe Leu Pro Thr
Tyr Ala Gln Ala Ala Asn Thr His Leu Leu Leu 195
200 205Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly
Tyr Ser Ser Glu 210 215 220Asp Val Ala
Glu Phe Tyr His Arg Gln Leu Lys Leu Thr Gln Gln Tyr225
230 235 240Thr Asp His Cys Val Asn Trp
Tyr Asn Val Gly Leu Asn Gly Leu Arg 245
250 255Gly Ser Thr Tyr Asp Ala Trp Val Lys Phe Asn Arg
Phe Arg Arg Glu 260 265 270Met
Thr Leu Thr Val Leu Asp Leu Ile Val Leu Phe Pro Phe Tyr Asp 275
280 285Ile Arg Leu Tyr Ser Lys Gly Val Lys
Thr Glu Leu Thr Arg Asp Ile 290 295
300Phe Thr Asp Pro Ile Phe Ser Leu Asn Thr Leu Gln Glu Tyr Gly Pro305
310 315 320Thr Phe Leu Ser
Ile Glu Asn Ser Ile Arg Lys Pro His Leu Phe Asp 325
330 335Tyr Leu Gln Gly Ile Glu Phe His Thr Arg
Leu Gln Pro Gly Tyr Phe 340 345
350Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr Arg
355 360 365Pro Ser Ile Gly Ser Ser Lys
Thr Ile Thr Ser Pro Phe Tyr Gly Asp 370 375
380Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys
Val385 390 395 400Tyr Arg
Thr Ile Ala Asn Thr Asp Val Ala Ala Trp Pro Asn Gly Lys
405 410 415Val Tyr Leu Gly Val Thr Lys
Val Asp Phe Ser Gln Tyr Asp Asp Gln 420 425
430Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn
Asn Gly 435 440 445His Val Ser Ala
Gln Asp Ser Ile Asp Gln Leu Pro Pro Glu Thr Thr 450
455 460Asp Glu Pro Leu Glu Lys Ala Tyr Ser His Gln Leu
Asn Tyr Ala Glu465 470 475
480Cys Phe Leu Met Gln Asp Arg Arg Gly Thr Ile Pro Phe Phe Thr Trp
485 490 495Thr His Arg Ser Val
Asp Phe Phe Asn Thr Ile Asp Ala Glu Lys Ile 500
505 510Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu Ser
Ser Gly Ala Ser 515 520 525Ile Ile
Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu Lys 530
535 540Glu Ser Ser Asn Ser Ile Ala Lys Phe Lys Val
Thr Leu Asn Ser Ala545 550 555
560Ala Leu Leu Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser Thr Thr
565 570 575Asn Leu Arg Leu
Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val Ile 580
585 590Tyr Ile Asn Lys Thr Met Asn Lys Asp Asp Asp
Leu Thr Tyr Asn Thr 595 600 605Phe
Asp Leu Ala Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp Lys 610
615 620Asn Glu Leu Ile Ile Gly Ala Glu Ser Phe
Val Ser Asn Glu Lys Ile625 630 635
640Tyr Ile Asp Lys Ile Glu Phe Ile Pro Val Gln Leu
645 65071989DNAArtificial SequenceDescription of
Artificial Sequence non-naturally occurring nucleotide sequence
encoding a variant Cry3Bb amino acid sequence v11231 7cc atg gca aac
cct aac aat cgt tcc gaa cac gac acc atc aag gtt 47 Met Ala Asn
Pro Asn Asn Arg Ser Glu His Asp Thr Ile Lys Val 1 5
10 15act cca aac tct gag ttg caa act aat
cac aac cag tac cca ttg gct 95Thr Pro Asn Ser Glu Leu Gln Thr Asn
His Asn Gln Tyr Pro Leu Ala 20 25
30gac aat cct aac agt act ctt gag gaa ctt aac tac aag gag ttt ctc
143Asp Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu
35 40 45cgg atg acc gaa gat agc
tcc act gag gtt ctc gat aac tct aca gtg 191Arg Met Thr Glu Asp Ser
Ser Thr Glu Val Leu Asp Asn Ser Thr Val 50 55
60aag gac gct gtt gga act ggc att agc gtt gtg gga cag att ctt
gga 239Lys Asp Ala Val Gly Thr Gly Ile Ser Val Val Gly Gln Ile Leu
Gly 65 70 75gtg gtt ggt gtt cca ttc
gct gga gct ttg acc agc ttc tac cag tcc 287Val Val Gly Val Pro Phe
Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser80 85
90 95ttt ctc aac acc atc tgg cct tca gat gct gat
ccc tgg aag gct ttc 335Phe Leu Asn Thr Ile Trp Pro Ser Asp Ala Asp
Pro Trp Lys Ala Phe 100 105
110atg gcc caa gtg gaa gtc ttg atc gat aag aag atc gaa gag tat gcc
383Met Ala Gln Val Glu Val Leu Ile Asp Lys Lys Ile Glu Glu Tyr Ala
115 120 125aag tct aaa gcc ttg gct gag
ttg caa ggt ttg cag aac aac ttc gag 431Lys Ser Lys Ala Leu Ala Glu
Leu Gln Gly Leu Gln Asn Asn Phe Glu 130 135
140gat tac gtc aac gca ctc aac agc tgg aag aaa act ccc ttg agt ctc
479Asp Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu
145 150 155agg tct aag cgt tcc cag gac
cgt att cgt gaa ctt ttc agc caa gcc 527Arg Ser Lys Arg Ser Gln Asp
Arg Ile Arg Glu Leu Phe Ser Gln Ala160 165
170 175gaa tcc cac ttc aga aac tcc atg cct agc ttt gcc
gtt tct aag ttc 575Glu Ser His Phe Arg Asn Ser Met Pro Ser Phe Ala
Val Ser Lys Phe 180 185
190gag gtg ctc ttc ttg cca aca tac gca caa gct gcc aac act cat ctc
623Glu Val Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His Leu
195 200 205ttg ctt ctc aaa gac gct cag
gtg ttt ggt gag gaa tgg ggt tac tcc 671Leu Leu Leu Lys Asp Ala Gln
Val Phe Gly Glu Glu Trp Gly Tyr Ser 210 215
220agt gaa gat gtt gcc gag ttc tac cgt agg cag ctc aag ttg act caa
719Ser Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln
225 230 235cag tac aca gac cac tgc gtc
aac tgg tac aac gtt ggg ctc aat ggt 767Gln Tyr Thr Asp His Cys Val
Asn Trp Tyr Asn Val Gly Leu Asn Gly240 245
250 255ctt aga gga tct acc tac gac gca tgg gtg aag ttc
aac agg ttt cgt 815Leu Arg Gly Ser Thr Tyr Asp Ala Trp Val Lys Phe
Asn Arg Phe Arg 260 265
270aga gag atg acc ttg act gtg ctc gat ctt atc gtt ctc ttt cca ttc
863Arg Glu Met Thr Leu Thr Val Leu Asp Leu Ile Val Leu Phe Pro Phe
275 280 285tac gac att cgt ctt tac tcc
aaa ggc gtt aag aca gag ctg acc aga 911Tyr Asp Ile Arg Leu Tyr Ser
Lys Gly Val Lys Thr Glu Leu Thr Arg 290 295
300gac atc ttc acc gat ccc atc ttc cta ctt acg acc ctg cag aaa tac
959Asp Ile Phe Thr Asp Pro Ile Phe Leu Leu Thr Thr Leu Gln Lys Tyr
305 310 315ggt cca act ttt ctc tcc att
gag aac agc atc agg aag cct cac ctc 1007Gly Pro Thr Phe Leu Ser Ile
Glu Asn Ser Ile Arg Lys Pro His Leu320 325
330 335ttc gac tat ctg caa ggc att gag ttt cac acc agg
ttg caa cct ggt 1055Phe Asp Tyr Leu Gln Gly Ile Glu Phe His Thr Arg
Leu Gln Pro Gly 340 345
350tac ttc ggt aag gat tcc ttc aac tac tgg agc gga aac tac gtt gaa
1103Tyr Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu
355 360 365acc aga cca tcc atc gga tct
agc aag acc atc act tct cca ttc tac 1151Thr Arg Pro Ser Ile Gly Ser
Ser Lys Thr Ile Thr Ser Pro Phe Tyr 370 375
380ggt gac aag agc act gag cca gtg cag aag ttg agc ttc gat ggg cag
1199Gly Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln
385 390 395aag gtg tat aga acc atc gcc
aat acc gat gtt gca gct tgg cct aat 1247Lys Val Tyr Arg Thr Ile Ala
Asn Thr Asp Val Ala Ala Trp Pro Asn400 405
410 415ggc aag gtc tac ctt gga gtt act aaa gtg gac ttc
tcc caa tac gac 1295Gly Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe
Ser Gln Tyr Asp 420 425
430gat cag aag aac gag aca tct act caa acc tac gat agt aag agg aac
1343Asp Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn
435 440 445aat ggc cat gtt tcc gca caa
gac tcc att gac caa ctt cca cct gaa 1391Asn Gly His Val Ser Ala Gln
Asp Ser Ile Asp Gln Leu Pro Pro Glu 450 455
460acc act gat gaa cca ttg gag aag gct tac agt cac caa ctt aac tac
1439Thr Thr Asp Glu Pro Leu Glu Lys Ala Tyr Ser His Gln Leu Asn Tyr
465 470 475gcc gaa tgc ttt ctc atg caa
gac agg cgt ggc acc att ccg ttc ttt 1487Ala Glu Cys Phe Leu Met Gln
Asp Arg Arg Gly Thr Ile Pro Phe Phe480 485
490 495aca tgg act cac agg tct gtc gac ttc ttt aac act
atc gac gct gag 1535Thr Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr
Ile Asp Ala Glu 500 505
510aag att acc caa ctt ccc gtg gtc aag gct tat gcc ttg tcc agc gga
1583Lys Ile Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu Ser Ser Gly
515 520 525gct tcc atc att gaa ggt cca
ggc ttc acc ggt ggc aac ttg ctc ttc 1631Ala Ser Ile Ile Glu Gly Pro
Gly Phe Thr Gly Gly Asn Leu Leu Phe 530 535
540ctt aag gag tcc agc aac tcc atc gcc aag ttc aaa gtg aca ctt aac
1679Leu Lys Glu Ser Ser Asn Ser Ile Ala Lys Phe Lys Val Thr Leu Asn
545 550 555tca gca gcc ttg ctc caa cgt
tac agg gtt cgt atc aga tac gca agc 1727Ser Ala Ala Leu Leu Gln Arg
Tyr Arg Val Arg Ile Arg Tyr Ala Ser560 565
570 575act acc aat ctt cgc ctc ttt gtc cag aac agc aac
aat gat ttc ctt 1775Thr Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn
Asn Asp Phe Leu 580 585
590gtc atc tac atc aac aag act atg aac aaa gac gat gac ctc acc tac
1823Val Ile Tyr Ile Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr
595 600 605caa aca ttc gat ctt gcc act
acc aat agt aac atg gga ttc tct ggt 1871Gln Thr Phe Asp Leu Ala Thr
Thr Asn Ser Asn Met Gly Phe Ser Gly 610 615
620gac aag aac gag ctg atc ata ggt gct gag agc ttt gtc tct aat gag
1919Asp Lys Asn Glu Leu Ile Ile Gly Ala Glu Ser Phe Val Ser Asn Glu
625 630 635aag att tac ata gac aag atc
gag ttc att cca gtt caa ctc 1961Lys Ile Tyr Ile Asp Lys Ile
Glu Phe Ile Pro Val Gln Leu640 645
650taatagatcc cccgggctgc aggaattc
19898653PRTArtificial SequenceDescription of Artificial Sequence
non-naturally occurring amino acid sequence encoded by SEQ ID NO7
8Met Ala Asn Pro Asn Asn Arg Ser Glu His Asp Thr Ile Lys Val Thr 1
5 10 15Pro Asn Ser Glu Leu Gln
Thr Asn His Asn Gln Tyr Pro Leu Ala Asp 20
25 30Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu
Phe Leu Arg 35 40 45Met Thr Glu
Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys 50
55 60Asp Ala Val Gly Thr Gly Ile Ser Val Val Gly Gln
Ile Leu Gly Val 65 70 75
80Val Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe
85 90 95Leu Asn Thr Ile Trp
Pro Ser Asp Ala Asp Pro Trp Lys Ala Phe Met 100
105 110Ala Gln Val Glu Val Leu Ile Asp Lys Lys Ile Glu
Glu Tyr Ala Lys 115 120 125Ser Lys
Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 130
135 140Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr
Pro Leu Ser Leu Arg145 150 155
160Ser Lys Arg Ser Gln Asp Arg Ile Arg Glu Leu Phe Ser Gln Ala Glu
165 170 175Ser His Phe Arg
Asn Ser Met Pro Ser Phe Ala Val Ser Lys Phe Glu 180
185 190Val Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala
Asn Thr His Leu Leu 195 200 205Leu
Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210
215 220Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln
Leu Lys Leu Thr Gln Gln225 230 235
240Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly
Leu 245 250 255Arg Gly Ser
Thr Tyr Asp Ala Trp Val Lys Phe Asn Arg Phe Arg Arg 260
265 270Glu Met Thr Leu Thr Val Leu Asp Leu Ile
Val Leu Phe Pro Phe Tyr 275 280
285Asp Ile Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290
295 300Ile Phe Thr Asp Pro Ile Phe Leu
Leu Thr Thr Leu Gln Lys Tyr Gly305 310
315 320Pro Thr Phe Leu Ser Ile Glu Asn Ser Ile Arg Lys
Pro His Leu Phe 325 330
335Asp Tyr Leu Gln Gly Ile Glu Phe His Thr Arg Leu Gln Pro Gly Tyr
340 345 350Phe Gly Lys Asp Ser Phe
Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr 355 360
365Arg Pro Ser Ile Gly Ser Ser Lys Thr Ile Thr Ser Pro Phe
Tyr Gly 370 375 380Asp Lys Ser Thr Glu
Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys385 390
395 400Val Tyr Arg Thr Ile Ala Asn Thr Asp Val
Ala Ala Trp Pro Asn Gly 405 410
415Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp
420 425 430Gln Lys Asn Glu Thr
Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn 435
440 445Gly His Val Ser Ala Gln Asp Ser Ile Asp Gln Leu
Pro Pro Glu Thr 450 455 460Thr Asp Glu
Pro Leu Glu Lys Ala Tyr Ser His Gln Leu Asn Tyr Ala465
470 475 480Glu Cys Phe Leu Met Gln Asp
Arg Arg Gly Thr Ile Pro Phe Phe Thr 485
490 495Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr Ile
Asp Ala Glu Lys 500 505 510Ile
Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu Ser Ser Gly Ala 515
520 525Ser Ile Ile Glu Gly Pro Gly Phe Thr
Gly Gly Asn Leu Leu Phe Leu 530 535
540Lys Glu Ser Ser Asn Ser Ile Ala Lys Phe Lys Val Thr Leu Asn Ser545
550 555 560Ala Ala Leu Leu
Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser Thr 565
570 575Thr Asn Leu Arg Leu Phe Val Gln Asn Ser
Asn Asn Asp Phe Leu Val 580 585
590Ile Tyr Ile Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln
595 600 605Thr Phe Asp Leu Ala Thr Thr
Asn Ser Asn Met Gly Phe Ser Gly Asp 610 615
620Lys Asn Glu Leu Ile Ile Gly Ala Glu Ser Phe Val Ser Asn Glu
Lys625 630 635 640Ile Tyr
Ile Asp Lys Ile Glu Phe Ile Pro Val Gln Leu 645
65091984DNAArtificial SequenceDescription of Artificial Sequence
non-naturally occurring nucleotide sequence encoding a Cry3Bb
variant 11231mv1 amino acid sequence 9cc atg gcc aac ccc aac aat cgc tcc
gag cac gac acg atc aag gtc 47 Met Ala Asn Pro Asn Asn Arg Ser
Glu His Asp Thr Ile Lys Val 1 5 10
15acc ccc aac tcc gag ctc cag acc aac cac aac cag tac ccg
ctg gcc 95Thr Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro
Leu Ala 20 25 30gac aac ccc
aac tcc acc ctg gaa gag ctg aac tac aag gag ttc ctg 143Asp Asn Pro
Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu 35
40 45cgc atg acc gag gac tcc tcc acg gag gtc ctg
gac aac tcc acc gtc 191Arg Met Thr Glu Asp Ser Ser Thr Glu Val Leu
Asp Asn Ser Thr Val 50 55 60aag
gac gcc gtc ggg acc ggc atc tcc gtc gtt ggg cag atc ctg ggc 239Lys
Asp Ala Val Gly Thr Gly Ile Ser Val Val Gly Gln Ile Leu Gly 65
70 75gtc gtt ggc gtc ccc ttc gca ggt gct ctc acc
tcc ttc tac cag tcc 287Val Val Gly Val Pro Phe Ala Gly Ala Leu Thr
Ser Phe Tyr Gln Ser80 85 90
95ttc ctg aac acc atc tgg ccc tcc gac gcc gac ccc tgg aag gcc ttc
335Phe Leu Asn Thr Ile Trp Pro Ser Asp Ala Asp Pro Trp Lys Ala Phe
100 105 110atg gcc caa gtc gaa gtc
ctg atc gac aag aag atc gag gag tac gcc 383Met Ala Gln Val Glu Val
Leu Ile Asp Lys Lys Ile Glu Glu Tyr Ala 115 120
125aag tcc aag gcc ctg gcc gag ctg caa ggc ctg caa aac aac
ttc gag 431Lys Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn
Phe Glu 130 135 140gac tac gtc aac
gcg ctg aac tcc tgg aag aag acg cct ctg tcc ctg 479Asp Tyr Val Asn
Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu 145 150
155cgc tcc aag cgc tcc cag ggc cgc atc cgc gag ctg ttc tcc
cag gcc 527Arg Ser Lys Arg Ser Gln Gly Arg Ile Arg Glu Leu Phe Ser
Gln Ala160 165 170 175gag
tcc cac ttc cgc aac tcc atg ccg tcc ttc gcc gtc tcc aag ttc 575Glu
Ser His Phe Arg Asn Ser Met Pro Ser Phe Ala Val Ser Lys Phe
180 185 190gag gtc ctg ttc ctg ccc acc
tac gcc cag gct gcc aac acc cac ctc 623Glu Val Leu Phe Leu Pro Thr
Tyr Ala Gln Ala Ala Asn Thr His Leu 195 200
205ctg ttg ctg aag gac gcc cag gtc ttc ggc gag gaa tgg ggc tac
tcc 671Leu Leu Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr
Ser 210 215 220tcg gag gac gtc gcc
gag ttc tac cgt cgc cag ctg aag ctg acc caa 719Ser Glu Asp Val Ala
Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln 225 230
235cag tac acc gac cac tgc gtc aac tgg tac aac gtc ggc ctg aac
ggc 767Gln Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn
Gly240 245 250 255ctg agg
ggc tcc acc tac gac gca tgg gtc aag ttc aac cgc ttc cgc 815Leu Arg
Gly Ser Thr Tyr Asp Ala Trp Val Lys Phe Asn Arg Phe Arg 260
265 270agg gag atg acc ctg acc gtc ctg gac
ctg atc gtc ctg ttc ccc ttc 863Arg Glu Met Thr Leu Thr Val Leu Asp
Leu Ile Val Leu Phe Pro Phe 275 280
285tac gac atc cgc ctg tac tcc aag ggc gtc aag acc gag ctg acc cgc
911Tyr Asp Ile Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg
290 295 300gac atc ttc acg gac ccc atc
ttc ctg ctc acg acc ctc cag aag tac 959Asp Ile Phe Thr Asp Pro Ile
Phe Leu Leu Thr Thr Leu Gln Lys Tyr 305 310
315ggt ccc acc ttc ctg tcc atc gag aac tcc atc cgc aag ccc cac ctg
1007Gly Pro Thr Phe Leu Ser Ile Glu Asn Ser Ile Arg Lys Pro His Leu320
325 330 335ttc gac tac ctc
cag ggc atc gag ttc cac acg cgc ctg agg cca ggc 1055Phe Asp Tyr Leu
Gln Gly Ile Glu Phe His Thr Arg Leu Arg Pro Gly 340
345 350tac ttc ggc aag gac tcc ttc aac tac tgg tcc
ggc aac tac gtc gag 1103Tyr Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser
Gly Asn Tyr Val Glu 355 360
365acc agg ccc tcc atc ggc tcc tcg aag acg atc acc tcc cct ttc tac
1151Thr Arg Pro Ser Ile Gly Ser Ser Lys Thr Ile Thr Ser Pro Phe Tyr
370 375 380ggc gac aag tcc acc gag ccc
gtc cag aag ctg tcc ttc gac ggc cag 1199Gly Asp Lys Ser Thr Glu Pro
Val Gln Lys Leu Ser Phe Asp Gly Gln 385 390
395aag gtc tac cgc acc atc gcc aac acc gac gtc gcg gct tgg ccg aac
1247Lys Val Tyr Arg Thr Ile Ala Asn Thr Asp Val Ala Ala Trp Pro Asn400
405 410 415ggc aag gtc tac
ctg ggc gtc acg aag gtc gac ttc tcc cag tac gat 1295Gly Lys Val Tyr
Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp 420
425 430gac cag aag aat gaa acc tcc acc cag acc tac
gac tcc aag cgc aac 1343Asp Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr
Asp Ser Lys Arg Asn 435 440
445aat ggc cac gtc tcc gcc cag gac tcc atc gac cag ctg ccg cct gag
1391Asn Gly His Val Ser Ala Gln Asp Ser Ile Asp Gln Leu Pro Pro Glu
450 455 460acc act gac gag ccc ctg gag
aag gcc tac tcc cac cag ctg aac tac 1439Thr Thr Asp Glu Pro Leu Glu
Lys Ala Tyr Ser His Gln Leu Asn Tyr 465 470
475gcg gag tgc ttc ctg atg caa gac cgc agg ggc acc atc ccc ttc ttc
1487Ala Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr Ile Pro Phe Phe480
485 490 495acc tgg acc cac
cgc tcc gtc gac ttc ttc aac acc atc gac gcc gag 1535Thr Trp Thr His
Arg Ser Val Asp Phe Phe Asn Thr Ile Asp Ala Glu 500
505 510aag atc acc cag ctg ccc gtg gtc aag gcc tac
gcc ctg tcc tcg ggt 1583Lys Ile Thr Gln Leu Pro Val Val Lys Ala Tyr
Ala Leu Ser Ser Gly 515 520
525gcc tcc atc att gag ggt cca ggc ttc acc ggt ggc aac ctg ctg ttc
1631Ala Ser Ile Ile Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe
530 535 540ctg aag gag tcc tcg aac tcc
atc gcc aag ttc aag gtc acc ctg aac 1679Leu Lys Glu Ser Ser Asn Ser
Ile Ala Lys Phe Lys Val Thr Leu Asn 545 550
555tcc gct gcc ttg ctg caa cgc tac cgc gtc cgc atc cgc tac gcc tcc
1727Ser Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser560
565 570 575acc acg aac ctg
cgc ctg ttc gtc cag aac tcc aac aat gac ttc ctg 1775Thr Thr Asn Leu
Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu 580
585 590gtc atc tac atc aac aag acc atg aac aag gac
gat gac ctg acc tac 1823Val Ile Tyr Ile Asn Lys Thr Met Asn Lys Asp
Asp Asp Leu Thr Tyr 595 600
605cag acc ttc gac ctc gcc acc acg aac tcc aac atg ggc ttc tcg ggc
1871Gln Thr Phe Asp Leu Ala Thr Thr Asn Ser Asn Met Gly Phe Ser Gly
610 615 620gac aag aat gaa ctg atc att
ggt gct gag tcc ttc gtc tcc aat gaa 1919Asp Lys Asn Glu Leu Ile Ile
Gly Ala Glu Ser Phe Val Ser Asn Glu 625 630
635aag atc tac atc gac aag atc gag ttc atc ccc gtc cag ctg
1961Lys Ile Tyr Ile Asp Lys Ile Glu Phe Ile Pro Val Gln Leu640
645 650tgataggaac tctgattgaa ttc
198410653PRTArtificial SequenceDescription of
Artificial Sequence non-naturally occurring amino acid sequence
encoded by SEQ ID NO9 10Met Ala Asn Pro Asn Asn Arg Ser Glu His Asp Thr
Ile Lys Val Thr 1 5 10
15Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Ala Asp
20 25 30Asn Pro Asn Ser Thr Leu Glu
Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35 40
45Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val
Lys 50 55 60Asp Ala Val Gly Thr Gly
Ile Ser Val Val Gly Gln Ile Leu Gly Val 65 70
75 80Val Gly Val Pro Phe Ala Gly Ala Leu Thr Ser
Phe Tyr Gln Ser Phe 85 90
95Leu Asn Thr Ile Trp Pro Ser Asp Ala Asp Pro Trp Lys Ala Phe Met
100 105 110Ala Gln Val Glu Val Leu
Ile Asp Lys Lys Ile Glu Glu Tyr Ala Lys 115 120
125Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe
Glu Asp 130 135 140Tyr Val Asn Ala Leu
Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg145 150
155 160Ser Lys Arg Ser Gln Gly Arg Ile Arg Glu
Leu Phe Ser Gln Ala Glu 165 170
175Ser His Phe Arg Asn Ser Met Pro Ser Phe Ala Val Ser Lys Phe Glu
180 185 190Val Leu Phe Leu Pro
Thr Tyr Ala Gln Ala Ala Asn Thr His Leu Leu 195
200 205Leu Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp
Gly Tyr Ser Ser 210 215 220Glu Asp Val
Ala Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln225
230 235 240Tyr Thr Asp His Cys Val Asn
Trp Tyr Asn Val Gly Leu Asn Gly Leu 245
250 255Arg Gly Ser Thr Tyr Asp Ala Trp Val Lys Phe Asn
Arg Phe Arg Arg 260 265 270Glu
Met Thr Leu Thr Val Leu Asp Leu Ile Val Leu Phe Pro Phe Tyr 275
280 285Asp Ile Arg Leu Tyr Ser Lys Gly Val
Lys Thr Glu Leu Thr Arg Asp 290 295
300Ile Phe Thr Asp Pro Ile Phe Leu Leu Thr Thr Leu Gln Lys Tyr Gly305
310 315 320Pro Thr Phe Leu
Ser Ile Glu Asn Ser Ile Arg Lys Pro His Leu Phe 325
330 335Asp Tyr Leu Gln Gly Ile Glu Phe His Thr
Arg Leu Arg Pro Gly Tyr 340 345
350Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr
355 360 365Arg Pro Ser Ile Gly Ser Ser
Lys Thr Ile Thr Ser Pro Phe Tyr Gly 370 375
380Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln
Lys385 390 395 400Val Tyr
Arg Thr Ile Ala Asn Thr Asp Val Ala Ala Trp Pro Asn Gly
405 410 415Lys Val Tyr Leu Gly Val Thr
Lys Val Asp Phe Ser Gln Tyr Asp Asp 420 425
430Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg
Asn Asn 435 440 445Gly His Val Ser
Ala Gln Asp Ser Ile Asp Gln Leu Pro Pro Glu Thr 450
455 460Thr Asp Glu Pro Leu Glu Lys Ala Tyr Ser His Gln
Leu Asn Tyr Ala465 470 475
480Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr Ile Pro Phe Phe Thr
485 490 495Trp Thr His Arg Ser
Val Asp Phe Phe Asn Thr Ile Asp Ala Glu Lys 500
505 510Ile Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu
Ser Ser Gly Ala 515 520 525Ser Ile
Ile Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu 530
535 540Lys Glu Ser Ser Asn Ser Ile Ala Lys Phe Lys
Val Thr Leu Asn Ser545 550 555
560Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser Thr
565 570 575Thr Asn Leu Arg
Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val 580
585 590Ile Tyr Ile Asn Lys Thr Met Asn Lys Asp Asp
Asp Leu Thr Tyr Gln 595 600 605Thr
Phe Asp Leu Ala Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp 610
615 620Lys Asn Glu Leu Ile Ile Gly Ala Glu Ser
Phe Val Ser Asn Glu Lys625 630 635
640Ile Tyr Ile Asp Lys Ile Glu Phe Ile Pro Val Gln Leu
645 650111984DNAArtificial SequenceDescription of
Artificial Sequence non-naturally occurring nucleotide sequence
encoding a Cry3Bb variant 11231mv2 amino acid sequence 11cc atg gcc
aac ccc aac aat cgc tcc gag cac gac acg atc aag gtc 47Met Ala Asn
Pro Asn Asn Arg Ser Glu His Asp Thr Ile Lys Val 1 5
10 15acc ccc aac tcc gag ctc cag acc aac cac
aac cag tac ccg ctg gcc 95Thr Pro Asn Ser Glu Leu Gln Thr Asn His
Asn Gln Tyr Pro Leu Ala 20 25
30gac aac ccc aac tcc acc ctg gaa gag ctg aac tac aag gag ttc ctg
143Asp Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu
35 40 45cgc atg acc gag gac tcc tcc
acg gag gtc ctg gac aac tcc acc gtc 191Arg Met Thr Glu Asp Ser Ser
Thr Glu Val Leu Asp Asn Ser Thr Val 50 55
60aag gac gcc gtc ggg acc ggc atc tcc gtc gtt ggg cag atc ctg ggc
239Lys Asp Ala Val Gly Thr Gly Ile Ser Val Val Gly Gln Ile Leu Gly
65 70 75gtc gtt ggc gtc ccc ttc gca ggt
gct ctc acc tcc ttc tac cag tcc 287Val Val Gly Val Pro Phe Ala Gly
Ala Leu Thr Ser Phe Tyr Gln Ser80 85 90
95ttc ctg aac acc atc tgg ccc tcc gac gcc gac ccc tgg
aag gcc ttc 335Phe Leu Asn Thr Ile Trp Pro Ser Asp Ala Asp Pro Trp
Lys Ala Phe 100 105 110atg
gcc caa gtc gaa gtc ctg atc gac aag aag atc gag gag tac gcc 383Met
Ala Gln Val Glu Val Leu Ile Asp Lys Lys Ile Glu Glu Tyr Ala 115
120 125aag tcc aag gcc ctg gcc gag ctg caa
ggc ctg caa aac aac ttc gag 431Lys Ser Lys Ala Leu Ala Glu Leu Gln
Gly Leu Gln Asn Asn Phe Glu 130 135
140gac tac gtc aac gcg ctg aac tcc tgg aag aag acg cct ctg tcc ctg
479Asp Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu 145
150 155cgc tcc aag cgc tcc cag gac cgc atc
cgc gag ctg ttc tcc cag gcc 527Arg Ser Lys Arg Ser Gln Asp Arg Ile
Arg Glu Leu Phe Ser Gln Ala160 165 170
175gag tcc cac ttc cgc aac tcc atg ccg tcc ttc gcc gtc tcc
aag ttc 575Glu Ser His Phe Arg Asn Ser Met Pro Ser Phe Ala Val Ser
Lys Phe 180 185 190gag gtc
ctg ttc ctg ccc acc tac gcc cag gct gcc aac acc cac ctc 623Glu Val
Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His Leu 195
200 205ctg ttg ctg aag gac gcc cag gtc ttc ggc
gag gaa tgg ggc tac tcc 671Leu Leu Leu Lys Asp Ala Gln Val Phe Gly
Glu Glu Trp Gly Tyr Ser 210 215
220tcg gag gac gtc gcc gag ttc tac cgt cgc cag ctg aag ctg acc caa
719Ser Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln 225
230 235cag tac acc gac cac tgc gtc aac tgg
tac aac gtc ggc ctg aac ggc 767Gln Tyr Thr Asp His Cys Val Asn Trp
Tyr Asn Val Gly Leu Asn Gly240 245 250
255ctg agg ggc tcc acc tac gac gca tgg gtc aag ttc aac cgc
ttc cgc 815Leu Arg Gly Ser Thr Tyr Asp Ala Trp Val Lys Phe Asn Arg
Phe Arg 260 265 270agg gag
atg acc ctg acc gtc ctg gac ctg atc gtc ctg ttc ccc ttc 863Arg Glu
Met Thr Leu Thr Val Leu Asp Leu Ile Val Leu Phe Pro Phe 275
280 285tac gac atc cgc ctg tac tcc aag ggc gtc
aag acc gag ctg acc cgc 911Tyr Asp Ile Arg Leu Tyr Ser Lys Gly Val
Lys Thr Glu Leu Thr Arg 290 295
300gac atc ttc acg gac ccc atc ttc ctg ctc acg acc ctc cag aag tac
959Asp Ile Phe Thr Asp Pro Ile Phe Leu Leu Thr Thr Leu Gln Lys Tyr 305
310 315ggt ccc acc ttc ctg tcc atc gag aac
tcc atc cgc aag ccc cac ctg 1007Gly Pro Thr Phe Leu Ser Ile Glu Asn
Ser Ile Arg Lys Pro His Leu320 325 330
335ttc gac tac ctc cag ggc atc gag ttc cac acg cgc ctg agg
cca ggc 1055Phe Asp Tyr Leu Gln Gly Ile Glu Phe His Thr Arg Leu Arg
Pro Gly 340 345 350tac ttc
ggc aag gac tcc ttc aac tac tgg tcc ggc aac tac gtc gag 1103Tyr Phe
Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu 355
360 365acc agg ccc tcc atc ggc tcc tcg aag acg
atc acc tcc cct ttc tac 1151Thr Arg Pro Ser Ile Gly Ser Ser Lys Thr
Ile Thr Ser Pro Phe Tyr 370 375
380ggc gac aag tcc acc gag ccc gtc cag aag ctg tcc ttc gac ggc cag
1199Gly Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln 385
390 395aag gtc tac cgc acc atc gcc aac acc
gac gtc gcg gct tgg ccg aac 1247Lys Val Tyr Arg Thr Ile Ala Asn Thr
Asp Val Ala Ala Trp Pro Asn400 405 410
415ggc aag gtc tac ctg ggc gtc acg aag gtc gac ttc tcc cag
tac gat 1295Gly Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln
Tyr Asp 420 425 430gac cag
aag aat gaa acc tcc acc cag acc tac gac tcc aag cgc aac 1343Asp Gln
Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn 435
440 445aat ggc cac gtc tcc gcc cag gac tcc atc
gac cag ctg ccg cct gag 1391Asn Gly His Val Ser Ala Gln Asp Ser Ile
Asp Gln Leu Pro Pro Glu 450 455
460acc act gac gag ccc ctg gag aag gcc tac tcc cac cag ctg aac tac
1439Thr Thr Asp Glu Pro Leu Glu Lys Ala Tyr Ser His Gln Leu Asn Tyr 465
470 475gcg gag tgc ttc ctg atg caa gac cgc
agg ggc acc atc ccc ttc ttc 1487Ala Glu Cys Phe Leu Met Gln Asp Arg
Arg Gly Thr Ile Pro Phe Phe480 485 490
495acc tgg acc cac cgc tcc gtc gac ttc ttc aac acc atc gac
gcc gag 1535Thr Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr Ile Asp
Ala Glu 500 505 510aag atc
acc cag ctg ccc gtg gtc aag gcc tac gcc ctg tcc tcg ggt 1583Lys Ile
Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu Ser Ser Gly 515
520 525gcc tcc atc att gag ggt cca ggc ttc acc
ggt ggc aac ctg ctg ttc 1631Ala Ser Ile Ile Glu Gly Pro Gly Phe Thr
Gly Gly Asn Leu Leu Phe 530 535
540ctg aag gag tcc tcg aac tcc atc gcc aag ttc aag gtc acc ctg aac
1679Leu Lys Glu Ser Ser Asn Ser Ile Ala Lys Phe Lys Val Thr Leu Asn 545
550 555tcc gct gcc ttg ctg caa cgc tac cgc
gtc cgc atc cgc tac gcc tcc 1727Ser Ala Ala Leu Leu Gln Arg Tyr Arg
Val Arg Ile Arg Tyr Ala Ser560 565 570
575acc acg aac ctg cgc ctg ttc gtc cag aac tcc aac aat gac
ttc ctg 1775Thr Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp
Phe Leu 580 585 590gtc atc
tac atc aac aag acc atg aac aag gac gat gac ctg acc tac 1823Val Ile
Tyr Ile Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr 595
600 605cag acc ttc gac ctc gcc acc acg aac tcc
aac atg ggc ttc tcg ggc 1871Gln Thr Phe Asp Leu Ala Thr Thr Asn Ser
Asn Met Gly Phe Ser Gly 610 615
620gac aag aat gaa ctg atc att ggt gct gag tcc ttc gtc tcc aat gaa
1919Asp Lys Asn Glu Leu Ile Ile Gly Ala Glu Ser Phe Val Ser Asn Glu 625
630 635aag atc tac atc gac aag atc gag ttc
atc ccc gtc cag ctg 1961Lys Ile Tyr Ile Asp Lys Ile Glu Phe
Ile Pro Val Gln Leu640 645 650tgataggaac
tctgattgaa ttc
198412653PRTArtificial SequenceDescription of Artificial Sequence
non-naturally occurring amino acid sequence encoded by SEQ ID NO11
12Met Ala Asn Pro Asn Asn Arg Ser Glu His Asp Thr Ile Lys Val Thr 1
5 10 15Pro Asn Ser Glu Leu Gln
Thr Asn His Asn Gln Tyr Pro Leu Ala Asp 20
25 30Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu
Phe Leu Arg 35 40 45Met Thr Glu
Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys 50
55 60Asp Ala Val Gly Thr Gly Ile Ser Val Val Gly Gln
Ile Leu Gly Val 65 70 75
80Val Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe
85 90 95Leu Asn Thr Ile Trp
Pro Ser Asp Ala Asp Pro Trp Lys Ala Phe Met 100
105 110Ala Gln Val Glu Val Leu Ile Asp Lys Lys Ile Glu
Glu Tyr Ala Lys 115 120 125Ser Lys
Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 130
135 140Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr
Pro Leu Ser Leu Arg145 150 155
160Ser Lys Arg Ser Gln Asp Arg Ile Arg Glu Leu Phe Ser Gln Ala Glu
165 170 175Ser His Phe Arg
Asn Ser Met Pro Ser Phe Ala Val Ser Lys Phe Glu 180
185 190Val Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala
Asn Thr His Leu Leu 195 200 205Leu
Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210
215 220Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln
Leu Lys Leu Thr Gln Gln225 230 235
240Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly
Leu 245 250 255Arg Gly Ser
Thr Tyr Asp Ala Trp Val Lys Phe Asn Arg Phe Arg Arg 260
265 270Glu Met Thr Leu Thr Val Leu Asp Leu Ile
Val Leu Phe Pro Phe Tyr 275 280
285Asp Ile Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290
295 300Ile Phe Thr Asp Pro Ile Phe Leu
Leu Thr Thr Leu Gln Lys Tyr Gly305 310
315 320Pro Thr Phe Leu Ser Ile Glu Asn Ser Ile Arg Lys
Pro His Leu Phe 325 330
335Asp Tyr Leu Gln Gly Ile Glu Phe His Thr Arg Leu Arg Pro Gly Tyr
340 345 350Phe Gly Lys Asp Ser Phe
Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr 355 360
365Arg Pro Ser Ile Gly Ser Ser Lys Thr Ile Thr Ser Pro Phe
Tyr Gly 370 375 380Asp Lys Ser Thr Glu
Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys385 390
395 400Val Tyr Arg Thr Ile Ala Asn Thr Asp Val
Ala Ala Trp Pro Asn Gly 405 410
415Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp
420 425 430Gln Lys Asn Glu Thr
Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn 435
440 445Gly His Val Ser Ala Gln Asp Ser Ile Asp Gln Leu
Pro Pro Glu Thr 450 455 460Thr Asp Glu
Pro Leu Glu Lys Ala Tyr Ser His Gln Leu Asn Tyr Ala465
470 475 480Glu Cys Phe Leu Met Gln Asp
Arg Arg Gly Thr Ile Pro Phe Phe Thr 485
490 495Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr Ile
Asp Ala Glu Lys 500 505 510Ile
Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu Ser Ser Gly Ala 515
520 525Ser Ile Ile Glu Gly Pro Gly Phe Thr
Gly Gly Asn Leu Leu Phe Leu 530 535
540Lys Glu Ser Ser Asn Ser Ile Ala Lys Phe Lys Val Thr Leu Asn Ser545
550 555 560Ala Ala Leu Leu
Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser Thr 565
570 575Thr Asn Leu Arg Leu Phe Val Gln Asn Ser
Asn Asn Asp Phe Leu Val 580 585
590Ile Tyr Ile Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln
595 600 605Thr Phe Asp Leu Ala Thr Thr
Asn Ser Asn Met Gly Phe Ser Gly Asp 610 615
620Lys Asn Glu Leu Ile Ile Gly Ala Glu Ser Phe Val Ser Asn Glu
Lys625 630 635 640Ile Tyr
Ile Asp Lys Ile Glu Phe Ile Pro Val Gln Leu 645
650134149DNAArtificial SequenceDescription of Artificial Sequence
expression cassette 13gcggccgcgt taacaagctt ctgcaggtcc gatgtgagac
ttttcaacaa agggtaatat 60ccggaaacct cctcggattc cattgcccag ctatctgtca
ctttattgtg aagatagtgg 120aaaaggaagg tggctcctac aaatgccatc attgcgataa
aggaaaggcc atcgttgaag 180atgcctctgc cgacagtggt cccaaagatg gacccccacc
cacgaggagc atcgtggaaa 240aagaagacgt tccaaccacg tcttcaaagc aagtggattg
atgtgatggt ccgatgtgag 300acttttcaac aaagggtaat atccggaaac ctcctcggat
tccattgccc agctatctgt 360cactttattg tgaagatagt gaaaaggaag gtggctccta
caaatgccat cattgcgata 420aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg
tcccaaagat ggacccccac 480ccacgaggag catcgtggaa aaagaagacg ttccaaccac
gtcttcaaag caagtggatt 540gatgtgatat ctccactgac gtaagggatg acgcacaatc
ccactatcct tcgcaagacc 600cttcctctat ataaggaagt tcatttcatt tggagaggac
acgctgacaa gctgactcta 660gcagatctac cgtcttcggt acgcgctcac tccgccctct
gcctttgtta ctgccacgtt 720tctctgaatg ctctcttgtg tggtgattgc tgagagtggt
ttagctggat ctagaattac 780actctgaaat cgtgttctgc ctgtgctgat tacttgccgt
cctttgtagc agcaaaatat 840agggacatgg tagtacgaaa cgaagataga acctacacag
caatacgaga aatgtgtaat 900ttggtgctta gcggtattta tttaagcaca tgttggtgtt
atagggcact tggattcaga 960agtttgctgt taatttaggc acaggcttca tactacatgg
gtcaatagta tagggattca 1020tattataggc gatactataa taatttgttc gtctgcagag
cttattattt gccaaaatta 1080gatattccta ttctgttttt gtttgtgtgc tgttaaattg
ttaacgcctg aaggaataaa 1140tataaatgac gaaattttga tgtttatctc tgctccttta
ttgtgaccat aagtcaagat 1200cagatgcact tgttttaaat attgttgtct gaagaaataa
gtactgacag tattttgatg 1260cttgatctgc ttgtttgttg taacaaaatt taaaaataaa
gagtttcctt tttgttgctc 1320tccttacctc ctgatggtat ctagtatcta ccaactgaca
ctatattgct tctctttaca 1380tacgtatctt gctcgatgcc ttctccctag tgttgaccag
tgttactcac atagtctttg 1440ctcatttcat tgtaatgcag ataccaagcg gcctctagag
gatcagcatg gcgcccaccg 1500tgatgatggc ctcgtcggcc accgccgtcg ctccgttcct
ggggctcaag tccaccgcca 1560gcctccccgt cgcccgccgc tcctccagaa gcctcggcaa
cgtcagcaac ggcggaagga 1620tccggtgcat gcaggtaaca aatgcatcct agctagtagt
tctttgcatt gcagcagctg 1680cagctagcga gttagtaata ggaagggaac tgatgatcca
tgcatggact gatgtgtgtt 1740gcccatccca tcccatccca tttcccaaac gaaccgaaaa
caccgtacta cgtgcaggtg 1800tggccctacg gcaacaagaa gttcgagacg ctgtcgtacc
tgccgccgct gtcgaccggc 1860gggcgcatcc gctgcatgca ggcc atg gca aac cct
aac aat cgt tcc gaa 19 Met Ala Asn Pro Asn
Asn Arg Ser Glu 1 5cac gac acc
atc aag gtt act cca aac tct gag ttg caa act aat cac 1959His Asp Thr
Ile Lys Val Thr Pro Asn Ser Glu Leu Gln Thr Asn His 10
15 20 25aac cag tac cca ttg gct gac aat
cct aac agt act ctt gag gaa ctt 2007Asn Gln Tyr Pro Leu Ala Asp Asn
Pro Asn Ser Thr Leu Glu Glu Leu 30 35
40aac tac aag gag ttt ctc cgg atg acc gaa gat agc tcc act
gag gtt 2055Asn Tyr Lys Glu Phe Leu Arg Met Thr Glu Asp Ser Ser Thr
Glu Val 45 50 55ctc gat aac
tct aca gtg aag gac gct gtt gga act ggc att agc gtt 2103Leu Asp Asn
Ser Thr Val Lys Asp Ala Val Gly Thr Gly Ile Ser Val 60
65 70gtg gga cag att ctt gga gtg gtt ggt gtt cca
ttc gct gga gct ttg 2151Val Gly Gln Ile Leu Gly Val Val Gly Val Pro
Phe Ala Gly Ala Leu 75 80 85acc agc
ttc tac cag tcc ttt ctc aac acc atc tgg cct tca gat gct 2199Thr Ser
Phe Tyr Gln Ser Phe Leu Asn Thr Ile Trp Pro Ser Asp Ala 90
95 100 105gat ccc tgg aag gct ttc atg
gcc caa gtg gaa gtc ttg atc gat aag 2247Asp Pro Trp Lys Ala Phe Met
Ala Gln Val Glu Val Leu Ile Asp Lys 110
115 120aag atc gaa gag tat gcc aag tct aaa gcc ttg gct
gag ttg caa ggt 2295Lys Ile Glu Glu Tyr Ala Lys Ser Lys Ala Leu Ala
Glu Leu Gln Gly 125 130 135ttg
cag aac aac ttc gag gat tac gtc aac gca ctc aac agc tgg aag 2343Leu
Gln Asn Asn Phe Glu Asp Tyr Val Asn Ala Leu Asn Ser Trp Lys 140
145 150aaa act ccc ttg agt ctc agg tct aag
cgt tcc cag gac cgt att cgt 2391Lys Thr Pro Leu Ser Leu Arg Ser Lys
Arg Ser Gln Asp Arg Ile Arg 155 160
165gaa ctt ttc agc caa gcc gaa tcc cac ttc aga aac tcc atg cct agc
2439Glu Leu Phe Ser Gln Ala Glu Ser His Phe Arg Asn Ser Met Pro Ser170
175 180 185ttt gcc gtt tct
aag ttc gag gtg ctc ttc ttg cca aca tac gca caa 2487Phe Ala Val Ser
Lys Phe Glu Val Leu Phe Leu Pro Thr Tyr Ala Gln 190
195 200gct gcc aac act cat ctc ttg ctt ctc aaa
gac gct cag gtg ttt ggt 2535Ala Ala Asn Thr His Leu Leu Leu Leu Lys
Asp Ala Gln Val Phe Gly 205 210
215gag gaa tgg ggt tac tcc agt gaa gat gtt gcc gag ttc tac cgt agg
2583Glu Glu Trp Gly Tyr Ser Ser Glu Asp Val Ala Glu Phe Tyr Arg Arg
220 225 230cag ctc aag ttg act caa cag
tac aca gac cac tgc gtc aac tgg tac 2631Gln Leu Lys Leu Thr Gln Gln
Tyr Thr Asp His Cys Val Asn Trp Tyr 235 240
245aac gtt ggg ctc aat ggt ctt aga gga tct acc tac gac gca tgg gtg
2679Asn Val Gly Leu Asn Gly Leu Arg Gly Ser Thr Tyr Asp Ala Trp Val250
255 260 265aag ttc aac agg
ttt cgt aga gag atg acc ttg act gtg ctc gat ctt 2727Lys Phe Asn Arg
Phe Arg Arg Glu Met Thr Leu Thr Val Leu Asp Leu 270
275 280atc gtt ctc ttt cca ttc tac gac att cgt
ctt tac tcc aaa ggc gtt 2775Ile Val Leu Phe Pro Phe Tyr Asp Ile Arg
Leu Tyr Ser Lys Gly Val 285 290
295aag aca gag ctg acc aga gac atc ttc acc gat ccc atc ttc cta ctt
2823Lys Thr Glu Leu Thr Arg Asp Ile Phe Thr Asp Pro Ile Phe Leu Leu
300 305 310acg acc ctg cag aaa tac ggt
cca act ttt ctc tcc att gag aac agc 2871Thr Thr Leu Gln Lys Tyr Gly
Pro Thr Phe Leu Ser Ile Glu Asn Ser 315 320
325atc agg aag cct cac ctc ttc gac tat ctg caa ggc att gag ttt cac
2919Ile Arg Lys Pro His Leu Phe Asp Tyr Leu Gln Gly Ile Glu Phe His330
335 340 345acc agg ttg caa
cct ggt tac ttc ggt aag gat tcc ttc aac tac tgg 2967Thr Arg Leu Gln
Pro Gly Tyr Phe Gly Lys Asp Ser Phe Asn Tyr Trp 350
355 360agc gga aac tac gtt gaa acc aga cca tcc
atc gga tct agc aag acc 3015Ser Gly Asn Tyr Val Glu Thr Arg Pro Ser
Ile Gly Ser Ser Lys Thr 365 370
375atc act tct cca ttc tac ggt gac aag agc act gag cca gtg cag aag
3063Ile Thr Ser Pro Phe Tyr Gly Asp Lys Ser Thr Glu Pro Val Gln Lys
380 385 390ttg agc ttc gat ggg cag aag
gtg tat aga acc atc gcc aat acc gat 3111Leu Ser Phe Asp Gly Gln Lys
Val Tyr Arg Thr Ile Ala Asn Thr Asp 395 400
405gtt gca gct tgg cct aat ggc aag gtc tac ctt gga gtt act aaa gtg
3159Val Ala Ala Trp Pro Asn Gly Lys Val Tyr Leu Gly Val Thr Lys Val410
415 420 425gac ttc tcc caa
tac gac gat cag aag aac gag aca tct act caa acc 3207Asp Phe Ser Gln
Tyr Asp Asp Gln Lys Asn Glu Thr Ser Thr Gln Thr 430
435 440tac gat agt aag agg aac aat ggc cat gtt
tcc gca caa gac tcc att 3255Tyr Asp Ser Lys Arg Asn Asn Gly His Val
Ser Ala Gln Asp Ser Ile 445 450
455gac caa ctt cca cct gaa acc act gat gaa cca ttg gag aag gct tac
3303Asp Gln Leu Pro Pro Glu Thr Thr Asp Glu Pro Leu Glu Lys Ala Tyr
460 465 470agt cac caa ctt aac tac gcc
gaa tgc ttt ctc atg caa gac agg cgt 3351Ser His Gln Leu Asn Tyr Ala
Glu Cys Phe Leu Met Gln Asp Arg Arg 475 480
485ggc acc att ccg ttc ttt aca tgg act cac agg tct gtc gac ttc ttt
3399Gly Thr Ile Pro Phe Phe Thr Trp Thr His Arg Ser Val Asp Phe Phe490
495 500 505aac act atc gac
gct gag aag att acc caa ctt ccc gtg gtc aag gct 3447Asn Thr Ile Asp
Ala Glu Lys Ile Thr Gln Leu Pro Val Val Lys Ala 510
515 520tat gcc ttg tcc agc gga gct tcc atc att
gaa ggt cca ggc ttc acc 3495Tyr Ala Leu Ser Ser Gly Ala Ser Ile Ile
Glu Gly Pro Gly Phe Thr 525 530
535ggt ggc aac ttg ctc ttc ctt aag gag tcc agc aac tcc atc gcc aag
3543Gly Gly Asn Leu Leu Phe Leu Lys Glu Ser Ser Asn Ser Ile Ala Lys
540 545 550ttc aaa gtg aca ctt aac tca
gca gcc ttg ctc caa cgt tac agg gtt 3591Phe Lys Val Thr Leu Asn Ser
Ala Ala Leu Leu Gln Arg Tyr Arg Val 555 560
565cgt atc aga tac gca agc act acc aat ctt cgc ctc ttt gtc cag aac
3639Arg Ile Arg Tyr Ala Ser Thr Thr Asn Leu Arg Leu Phe Val Gln Asn570
575 580 585agc aac aat gat
ttc ctt gtc atc tac atc aac aag act atg aac aaa 3687Ser Asn Asn Asp
Phe Leu Val Ile Tyr Ile Asn Lys Thr Met Asn Lys 590
595 600gac gat gac ctc acc tac caa aca ttc gat
ctt gcc act acc aat agt 3735Asp Asp Asp Leu Thr Tyr Gln Thr Phe Asp
Leu Ala Thr Thr Asn Ser 605 610
615aac atg gga ttc tct ggt gac aag aac gag ctg atc ata ggt gct gag
3783Asn Met Gly Phe Ser Gly Asp Lys Asn Glu Leu Ile Ile Gly Ala Glu
620 625 630agc ttt gtc tct aat gag aag
att tac ata gac aag atc gag ttc att 3831Ser Phe Val Ser Asn Glu Lys
Ile Tyr Ile Asp Lys Ile Glu Phe Ile 635 640
645cca gtt caa ctc taatagatcc cccgggctgc aggaattccc gatcgttcaa
3883Pro Val Gln Leu650acatttggca ataaagtttc ttaagattga atcctgttgc
cggtcttgcg atgattatca 3943tataatttct gttgaattac gttaagcatg taataattaa
catgtaatgc atgacgttat 4003ttatgagatg ggtttttatg attagagtcc cgcaattata
catttaatac gcgatagaaa 4063acaaaatata gcgcgcaaac taggataaat tatcgcgcgc
ggtgtcatct atgttactag 4123atcggggata tccccggggc ggccgc
414914653PRTArtificial SequenceDescription of
Artificial Sequence peptide encoded by SEQ ID NO13 14Met Ala Asn Pro
Asn Asn Arg Ser Glu His Asp Thr Ile Lys Val Thr 1 5
10 15Pro Asn Ser Glu Leu Gln Thr Asn His Asn
Gln Tyr Pro Leu Ala Asp 20 25
30Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg
35 40 45Met Thr Glu Asp Ser Ser Thr
Glu Val Leu Asp Asn Ser Thr Val Lys 50 55
60Asp Ala Val Gly Thr Gly Ile Ser Val Val Gly Gln Ile Leu Gly Val
65 70 75 80Val Gly Val
Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe 85
90 95Leu Asn Thr Ile Trp Pro Ser Asp Ala
Asp Pro Trp Lys Ala Phe Met 100 105
110Ala Gln Val Glu Val Leu Ile Asp Lys Lys Ile Glu Glu Tyr Ala Lys
115 120 125Ser Lys Ala Leu Ala Glu
Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 130 135
140Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu
Arg145 150 155 160Ser Lys
Arg Ser Gln Asp Arg Ile Arg Glu Leu Phe Ser Gln Ala Glu
165 170 175Ser His Phe Arg Asn Ser Met
Pro Ser Phe Ala Val Ser Lys Phe Glu 180 185
190Val Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His
Leu Leu 195 200 205Leu Leu Lys Asp
Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210
215 220Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys
Leu Thr Gln Gln225 230 235
240Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu
245 250 255Arg Gly Ser Thr Tyr
Asp Ala Trp Val Lys Phe Asn Arg Phe Arg Arg 260
265 270Glu Met Thr Leu Thr Val Leu Asp Leu Ile Val Leu
Phe Pro Phe Tyr 275 280 285Asp Ile
Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290
295 300Ile Phe Thr Asp Pro Ile Phe Leu Leu Thr Thr
Leu Gln Lys Tyr Gly305 310 315
320Pro Thr Phe Leu Ser Ile Glu Asn Ser Ile Arg Lys Pro His Leu Phe
325 330 335Asp Tyr Leu Gln
Gly Ile Glu Phe His Thr Arg Leu Gln Pro Gly Tyr 340
345 350Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly
Asn Tyr Val Glu Thr 355 360 365Arg
Pro Ser Ile Gly Ser Ser Lys Thr Ile Thr Ser Pro Phe Tyr Gly 370
375 380Asp Lys Ser Thr Glu Pro Val Gln Lys Leu
Ser Phe Asp Gly Gln Lys385 390 395
400Val Tyr Arg Thr Ile Ala Asn Thr Asp Val Ala Ala Trp Pro Asn
Gly 405 410 415Lys Val Tyr
Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420
425 430Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr
Asp Ser Lys Arg Asn Asn 435 440
445Gly His Val Ser Ala Gln Asp Ser Ile Asp Gln Leu Pro Pro Glu Thr 450
455 460Thr Asp Glu Pro Leu Glu Lys Ala
Tyr Ser His Gln Leu Asn Tyr Ala465 470
475 480Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr Ile
Pro Phe Phe Thr 485 490
495Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr Ile Asp Ala Glu Lys
500 505 510Ile Thr Gln Leu Pro Val
Val Lys Ala Tyr Ala Leu Ser Ser Gly Ala 515 520
525Ser Ile Ile Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu
Phe Leu 530 535 540Lys Glu Ser Ser Asn
Ser Ile Ala Lys Phe Lys Val Thr Leu Asn Ser545 550
555 560Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg
Ile Arg Tyr Ala Ser Thr 565 570
575Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val
580 585 590Ile Tyr Ile Asn Lys
Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln 595
600 605Thr Phe Asp Leu Ala Thr Thr Asn Ser Asn Met Gly
Phe Ser Gly Asp 610 615 620Lys Asn Glu
Leu Ile Ile Gly Ala Glu Ser Phe Val Ser Asn Glu Lys625
630 635 640Ile Tyr Ile Asp Lys Ile Glu
Phe Ile Pro Val Gln Leu 645
650153754DNAArtificial SequenceDescription of Artificial Sequence
expression cassette 15gcggccgcgt taacaagctt ctgcaggtcc gatgtgagac
ttttcaacaa agggtaatat 60ccggaaacct cctcggattc cattgcccag ctatctgtca
ctttattgtg aagatagtgg 120aaaaggaagg tggctcctac aaatgccatc attgcgataa
aggaaaggcc atcgttgaag 180atgcctctgc cgacagtggt cccaaagatg gacccccacc
cacgaggagc atcgtggaaa 240aagaagacgt tccaaccacg tcttcaaagc aagtggattg
atgtgatggt ccgatgtgag 300acttttcaac aaagggtaat atccggaaac ctcctcggat
tccattgccc agctatctgt 360cactttattg tgaagatagt ggaaaaggaa ggtggctcct
acaaatgcca tcattgcgat 420aaaggaaagg ccatcgttga agatgcctct gccgacagtg
gtcccaaaga tggaccccca 480cccacgagga gcatcgtgga aaaagaagac gttccaacca
cgtcttcaaa gcaagtggat 540tgatgtgata tctccactga cgtaagggat gacgcacaat
cccactatcc ttcgcaagac 600ccttcctcta tataaggaag ttcatttcat ttggagagga
cacgctgaca agctgactct 660agcagatcta ccgtcttcgg tacgcgctca ctccgccctc
tgcctttgtt actgccacgt 720ttctctgaat gctctcttgt gtggtgattg ctgagagtgg
tttagctgga tctagaatta 780cactctgaaa tcgtgttctg cctgtgctga ttacttgccg
tcctttgtag cagcaaaata 840tagggacatg gtagtacgaa acgaagatag aacctacaca
gcaatacgag aaatgtgtaa 900tttggtgctt agcggtattt atttaagcac atgttggtgt
tatagggcac ttggattcag 960aagtttgctg ttaatttagg cacaggcttc atactacatg
ggtcaatagt atagggattc 1020atattatagg cgatactata ataatttgtt cgtctgcaga
gcttattatt tgccaaaatt 1080agatattcct attctgtttt tgtttgtgtg ctgttaaatt
gttaacgcct gaaggaataa 1140atataaatga cgaaattttg atgtttatct ctgctccttt
attgtgacca taagtcaaga 1200tcagatgcac ttgttttaaa tattgttgtc tgaagaaata
agtactgaca gtattttgat 1260gcattgatct gcttgtttgt tgtaacaaaa tttaaaaata
aagagtttcc tttttgttgc 1320tctccttacc tcctgatggt atctagtatc taccaactga
cactatattg cttctcttta 1380catacgtatc ttgctcgatg ccttctccct agtgttgacc
agtgttactc acatagtctt 1440tgctcatttc attgtaatgc agataccaag cggcctctag
aggatctcc atg gca aac 1498
Met Ala Asn
1cct aac aat cgt tcc gaa cac gac acc atc aag gtt act cca aac tct
1546Pro Asn Asn Arg Ser Glu His Asp Thr Ile Lys Val Thr Pro Asn Ser
5 10 15gag ttg caa act aat cac aac cag
tac cca ttg gct gac aat cct aac 1594Glu Leu Gln Thr Asn His Asn Gln
Tyr Pro Leu Ala Asp Asn Pro Asn 20 25
30 35agt act ctt gag gaa ctt aac tac aag gag ttt ctc cgg
atg acc gaa 1642Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg
Met Thr Glu 40 45 50gat
agc tcc act gag gtt ctc gat aac tct aca gtg aag gac gct gtt 1690Asp
Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys Asp Ala Val
55 60 65gga act ggc att agc gtt gtg gga
cag att ctt gga gtg gtt ggt gtt 1738Gly Thr Gly Ile Ser Val Val Gly
Gln Ile Leu Gly Val Val Gly Val 70 75
80cca ttc gct gga gct ttg acc agc ttc tac cag tcc ttt ctc aac acc
1786Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe Leu Asn Thr
85 90 95atc tgg cct tca gat gct gat ccc
tgg aag gct ttc atg gcc caa gtg 1834Ile Trp Pro Ser Asp Ala Asp Pro
Trp Lys Ala Phe Met Ala Gln Val100 105
110 115gaa gtc ttg atc gat aag aag atc gaa gag tat gcc
aag tct aaa gcc 1882Glu Val Leu Ile Asp Lys Lys Ile Glu Glu Tyr Ala
Lys Ser Lys Ala 120 125
130ttg gct gag ttg caa ggt ttg cag aac aac ttc gag gat tac gtc aac
1930Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp Tyr Val Asn
135 140 145gca ctc aac agc tgg aag
aaa act ccc ttg agt ctc agg tct aag cgt 1978Ala Leu Asn Ser Trp Lys
Lys Thr Pro Leu Ser Leu Arg Ser Lys Arg 150 155
160tcc cag gac cgt att cgt gaa ctt ttc agc caa gcc gaa tcc
cac ttc 2026Ser Gln Asp Arg Ile Arg Glu Leu Phe Ser Gln Ala Glu Ser
His Phe 165 170 175aga aac tcc atg cct
agc ttt gcc gtt tct aag ttc gag gtg ctc ttc 2074Arg Asn Ser Met Pro
Ser Phe Ala Val Ser Lys Phe Glu Val Leu Phe180 185
190 195ttg cca aca tac gca caa gct gcc aac act
cat ctc ttg ctt ctc aaa 2122Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr
His Leu Leu Leu Leu Lys 200 205
210gac gct cag gtg ttt ggt gag gaa tgg ggt tac tcc agt gaa gat gtt
2170Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser Glu Asp Val
215 220 225gcc gag ttc tac cgt agg
cag ctc aag ttg act caa cag tac aca gac 2218Ala Glu Phe Tyr Arg Arg
Gln Leu Lys Leu Thr Gln Gln Tyr Thr Asp 230 235
240cac tgc gtc aac tgg tac aac gtt ggg ctc aat ggt ctt aga
gga tct 2266His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu Arg
Gly Ser 245 250 255acc tac gac gca tgg
gtg aag ttc aac agg ttt cgt aga gag atg acc 2314Thr Tyr Asp Ala Trp
Val Lys Phe Asn Arg Phe Arg Arg Glu Met Thr260 265
270 275ttg act gtg ctc gat ctt atc gtt ctc ttt
cca ttc tac gac att cgt 2362Leu Thr Val Leu Asp Leu Ile Val Leu Phe
Pro Phe Tyr Asp Ile Arg 280 285
290ctt tac tcc aaa ggc gtt aag aca gag ctg acc aga gac atc ttc acc
2410Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp Ile Phe Thr
295 300 305gat ccc atc ttc cta ctt
acg acc ctg cag aaa tac ggt cca act ttt 2458Asp Pro Ile Phe Leu Leu
Thr Thr Leu Gln Lys Tyr Gly Pro Thr Phe 310 315
320ctc tcc att gag aac agc atc agg aag cct cac ctc ttc gac
tat ctg 2506Leu Ser Ile Glu Asn Ser Ile Arg Lys Pro His Leu Phe Asp
Tyr Leu 325 330 335caa ggc att gag ttt
cac acc agg ttg caa cct ggt tac ttc ggt aag 2554Gln Gly Ile Glu Phe
His Thr Arg Leu Gln Pro Gly Tyr Phe Gly Lys340 345
350 355gat tcc ttc aac tac tgg agc gga aac tac
gtt gaa acc aga cca tcc 2602Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr
Val Glu Thr Arg Pro Ser 360 365
370atc gga tct agc aag acc atc act tct cca ttc tac ggt gac aag agc
2650Ile Gly Ser Ser Lys Thr Ile Thr Ser Pro Phe Tyr Gly Asp Lys Ser
375 380 385act gag cca gtg cag aag
ttg agc ttc gat ggg cag aag gtg tat aga 2698Thr Glu Pro Val Gln Lys
Leu Ser Phe Asp Gly Gln Lys Val Tyr Arg 390 395
400acc atc gcc aat acc gat gtt gca gct tgg cct aat ggc aag
gtc tac 2746Thr Ile Ala Asn Thr Asp Val Ala Ala Trp Pro Asn Gly Lys
Val Tyr 405 410 415ctt gga gtt act aaa
gtg gac ttc tcc caa tac gac gat cag aag aac 2794Leu Gly Val Thr Lys
Val Asp Phe Ser Gln Tyr Asp Asp Gln Lys Asn420 425
430 435gag aca tct act caa acc tac gat agt aag
agg aac aat ggc cat gtt 2842Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys
Arg Asn Asn Gly His Val 440 445
450tcc gca caa gac tcc att gac caa ctt cca cct gaa acc act gat gaa
2890Ser Ala Gln Asp Ser Ile Asp Gln Leu Pro Pro Glu Thr Thr Asp Glu
455 460 465cca ttg gag aag gct tac
agt cac caa ctt aac tac gcc gaa tgc ttt 2938Pro Leu Glu Lys Ala Tyr
Ser His Gln Leu Asn Tyr Ala Glu Cys Phe 470 475
480ctc atg caa gac agg cgt ggc acc att ccg ttc ttt aca tgg
act cac 2986Leu Met Gln Asp Arg Arg Gly Thr Ile Pro Phe Phe Thr Trp
Thr His 485 490 495agg tct gtc gac ttc
ttt aac act atc gac gct gag aag att acc caa 3034Arg Ser Val Asp Phe
Phe Asn Thr Ile Asp Ala Glu Lys Ile Thr Gln500 505
510 515ctt ccc gtg gtc aag gct tat gcc ttg tcc
agc gga gct tcc atc att 3082Leu Pro Val Val Lys Ala Tyr Ala Leu Ser
Ser Gly Ala Ser Ile Ile 520 525
530gaa ggt cca ggc ttc acc ggt ggc aac ttg ctc ttc ctt aag gag tcc
3130Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu Lys Glu Ser
535 540 545agc aac tcc atc gcc aag
ttc aaa gtg aca ctt aac tca gca gcc ttg 3178Ser Asn Ser Ile Ala Lys
Phe Lys Val Thr Leu Asn Ser Ala Ala Leu 550 555
560ctc caa cgt tac agg gtt cgt atc aga tac gca agc act acc
aat ctt 3226Leu Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser Thr Thr
Asn Leu 565 570 575cgc ctc ttt gtc cag
aac agc aac aat gat ttc ctt gtc atc tac atc 3274Arg Leu Phe Val Gln
Asn Ser Asn Asn Asp Phe Leu Val Ile Tyr Ile580 585
590 595aac aag act atg aac aaa gac gat gac ctc
acc tac caa aca ttc gat 3322Asn Lys Thr Met Asn Lys Asp Asp Asp Leu
Thr Tyr Gln Thr Phe Asp 600 605
610ctt gcc act acc aat agt aac atg gga ttc tct ggt gac aag aac gag
3370Leu Ala Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp Lys Asn Glu
615 620 625ctg atc ata ggt gct gag
agc ttt gtc tct aat gag aag att tac ata 3418Leu Ile Ile Gly Ala Glu
Ser Phe Val Ser Asn Glu Lys Ile Tyr Ile 630 635
640gac aag atc gag ttc att cca gtt caa ctc taatagatcc
cccgggctgc 3468Asp Lys Ile Glu Phe Ile Pro Val Gln Leu 645
650aggaattccc gatcgttcaa acatttggca ataaagtttc ttaagattga
atcctgttgc 3528cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg
taataattaa 3588catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc
cgcaattata 3648catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat
tatcgcgcgc 3708ggtgtcatct atgttactag atcggggata tccccggggc ggccgc
375416653PRTArtificial SequencePRT(1)..(653)Cry3Bb1 variant
v11231 16Met Ala Asn Pro Asn Asn Arg Ser Glu His Asp Thr Ile Lys Val Thr
1 5 10 15Pro Asn Ser Glu
Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Ala Asp 20
25 30Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr
Lys Glu Phe Leu Arg 35 40 45Met
Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys 50
55 60Asp Ala Val Gly Thr Gly Ile Ser Val Val
Gly Gln Ile Leu Gly Val 65 70 75
80Val Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser
Phe 85 90 95Leu Asn Thr
Ile Trp Pro Ser Asp Ala Asp Pro Trp Lys Ala Phe Met 100
105 110Ala Gln Val Glu Val Leu Ile Asp Lys Lys
Ile Glu Glu Tyr Ala Lys 115 120
125Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 130
135 140Tyr Val Asn Ala Leu Asn Ser Trp
Lys Lys Thr Pro Leu Ser Leu Arg145 150
155 160Ser Lys Arg Ser Gln Asp Arg Ile Arg Glu Leu Phe
Ser Gln Ala Glu 165 170
175Ser His Phe Arg Asn Ser Met Pro Ser Phe Ala Val Ser Lys Phe Glu
180 185 190Val Leu Phe Leu Pro Thr
Tyr Ala Gln Ala Ala Asn Thr His Leu Leu 195 200
205Leu Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr
Ser Ser 210 215 220Glu Asp Val Ala Glu
Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln225 230
235 240Tyr Thr Asp His Cys Val Asn Trp Tyr Asn
Val Gly Leu Asn Gly Leu 245 250
255Arg Gly Ser Thr Tyr Asp Ala Trp Val Lys Phe Asn Arg Phe Arg Arg
260 265 270Glu Met Thr Leu Thr
Val Leu Asp Leu Ile Val Leu Phe Pro Phe Tyr 275
280 285Asp Ile Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu
Leu Thr Arg Asp 290 295 300Ile Phe Thr
Asp Pro Ile Phe Leu Leu Thr Thr Leu Gln Lys Tyr Gly305
310 315 320Pro Thr Phe Leu Ser Ile Glu
Asn Ser Ile Arg Lys Pro His Leu Phe 325
330 335Asp Tyr Leu Gln Gly Ile Glu Phe His Thr Arg Leu
Gln Pro Gly Tyr 340 345 350Phe
Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr 355
360 365Arg Pro Ser Ile Gly Ser Ser Lys Thr
Ile Thr Ser Pro Phe Tyr Gly 370 375
380Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys385
390 395 400Val Tyr Arg Thr
Ile Ala Asn Thr Asp Val Ala Ala Trp Pro Asn Gly 405
410 415Lys Val Tyr Leu Gly Val Thr Lys Val Asp
Phe Ser Gln Tyr Asp Asp 420 425
430Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn
435 440 445Gly His Val Ser Ala Gln Asp
Ser Ile Asp Gln Leu Pro Pro Glu Thr 450 455
460Thr Asp Glu Pro Leu Glu Lys Ala Tyr Ser His Gln Leu Asn Tyr
Ala465 470 475 480Glu Cys
Phe Leu Met Gln Asp Arg Arg Gly Thr Ile Pro Phe Phe Thr
485 490 495Trp Thr His Arg Ser Val Asp
Phe Phe Asn Thr Ile Asp Ala Glu Lys 500 505
510Ile Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu Ser Ser
Gly Ala 515 520 525Ser Ile Ile Glu
Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu 530
535 540Lys Glu Ser Ser Asn Ser Ile Ala Lys Phe Lys Val
Thr Leu Asn Ser545 550 555
560Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser Thr
565 570 575Thr Asn Leu Arg Leu
Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val 580
585 590Ile Tyr Ile Asn Lys Thr Met Asn Lys Asp Asp Asp
Leu Thr Tyr Gln 595 600 605Thr Phe
Asp Leu Ala Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp 610
615 620Lys Asn Glu Leu Ile Ile Gly Ala Glu Ser Phe
Val Ser Asn Glu Lys625 630 635
640Ile Tyr Ile Asp Lys Ile Glu Phe Ile Pro Val Gln Leu
645 650173450DNAArtificial SequenceDescription of
Artificial Sequence expression cassette 17gcggccgcgt taacaagctt
ctgacgtaag ggatgacgca cctgacgtaa gggatgacgc 60acctgacgta agggatgacg
cacctgacgt aagggatgac gcactcgaga tccccatctc 120cactgacgta agggatgacg
cacaatccca ctatccttcg caagaccctt cctctatata 180aggaagttca tttcatttgg
agaggacacg ctgacaagct agcttggctg caggtagatc 240ctagaaccat cttccacaca
ctcaagccac actattggag aacacacagg gacaacacac 300cataagatcc aagggaggcc
tccgccgccg ccggtaacca ccccgcccct ctcctctttc 360tttctccgtt tttttttccg
tctcggtctc gatctttggc cttggtagtt tgggtgggcg 420agaggcggct tcgtgcgcgc
ccagatcggt gcgcgggagg ggcgggatct cgcggctggg 480gctctcgccg gcgtggatcc
ggcccggatc tcgcggggaa tggggctctc ggatgtagat 540ctgcgatccg ccgttgttgg
gggagatgat ggggggttta aaatttccgc cgtgctaaac 600aagatcagga agaggggaaa
agggcactat ggtttatatt tttatatatt tctgctgctt 660cgtcaggctt agatgtgcta
gatctttctt tcttcttttt gtgggtagaa tttgaatccc 720tcagcattgt tcatcggtag
tttttctttt catgatttgt gacaaatgca gcctcgtgcg 780gagctttttt gtaggtagaa
gtgatcaacc tctagaggat cagcatggcg cccaccgtga 840tgatggcctc gtcggccacc
gccgtcgctc cgttcctggg gctcaagtcc accgccagcc 900tccccgtcgc ccgccgctcc
tccagaagcc tcggcaacgt cagcaacggc ggaaggatcc 960ggtgcatgca ggtaacaaat
gcatcctagc tagtagttct ttgcattgca gcagctgcag 1020ctagcgagtt agtaatagga
agggaactga tgatccatgc atggactgat gtgtgttgcc 1080catcccatcc catcccattt
cccaaacgaa ccgaaaacac cgtactacgt gcaggtgtgg 1140ccctacggca acaagaagtt
cgagacgctg tcgtacctgc cgccgctgtc gaccggcggg 1200cgcatccgct gcatgcaggc c
atg gcc aac ccc aac aat cgc tcc gag cac 1251
Met Ala Asn Pro Asn Asn Arg Ser Glu His 1
5 10gac acg atc aag gtc acc ccc aac tcc gag ctc
cag acc aac cac aac 1299Asp Thr Ile Lys Val Thr Pro Asn Ser Glu Leu
Gln Thr Asn His Asn 15 20
25cag tac ccg ctg gcc gac aac ccc aac tcc acc ctg gaa gag ctg aac
1347Gln Tyr Pro Leu Ala Asp Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn
30 35 40tac aag gag ttc ctg cgc
atg acc gag gac tcc tcc acg gag gtc ctg 1395Tyr Lys Glu Phe Leu Arg
Met Thr Glu Asp Ser Ser Thr Glu Val Leu 45 50
55gac aac tcc acc gtc aag gac gcc gtc ggg acc ggc atc tcc
gtc gtt 1443Asp Asn Ser Thr Val Lys Asp Ala Val Gly Thr Gly Ile Ser
Val Val 60 65 70ggg cag atc ctg ggc
gtc gtt ggc gtc ccc ttc gca ggt gct ctc acc 1491Gly Gln Ile Leu Gly
Val Val Gly Val Pro Phe Ala Gly Ala Leu Thr 75 80
85 90tcc ttc tac cag tcc ttc ctg aac acc atc
tgg ccc tcc gac gcc gac 1539Ser Phe Tyr Gln Ser Phe Leu Asn Thr Ile
Trp Pro Ser Asp Ala Asp 95 100
105ccc tgg aag gcc ttc atg gcc caa gtc gaa gtc ctg atc gac aag aag
1587Pro Trp Lys Ala Phe Met Ala Gln Val Glu Val Leu Ile Asp Lys Lys
110 115 120atc gag gag tac gcc aag
tcc aag gcc ctg gcc gag ctg caa ggc ctg 1635Ile Glu Glu Tyr Ala Lys
Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu 125 130
135caa aac aac ttc gag gac tac gtc aac gcg ctg aac tcc tgg
aag aag 1683Gln Asn Asn Phe Glu Asp Tyr Val Asn Ala Leu Asn Ser Trp
Lys Lys 140 145 150acg cct ctg tcc ctg
cgc tcc aag cgc tcc cag ggc cgc atc cgc gag 1731Thr Pro Leu Ser Leu
Arg Ser Lys Arg Ser Gln Gly Arg Ile Arg Glu155 160
165 170ctg ttc tcc cag gcc gag tcc cac ttc cgc
aac tcc atg ccg tcc ttc 1779Leu Phe Ser Gln Ala Glu Ser His Phe Arg
Asn Ser Met Pro Ser Phe 175 180
185gcc gtc tcc aag ttc gag gtc ctg ttc ctg ccc acc tac gcc cag gct
1827Ala Val Ser Lys Phe Glu Val Leu Phe Leu Pro Thr Tyr Ala Gln Ala
190 195 200gcc aac acc cac ctc ctg
ttg ctg aag gac gcc cag gtc ttc ggc gag 1875Ala Asn Thr His Leu Leu
Leu Leu Lys Asp Ala Gln Val Phe Gly Glu 205 210
215gaa tgg ggc tac tcc tcg gag gac gtc gcc gag ttc tac cgt
cgc cag 1923Glu Trp Gly Tyr Ser Ser Glu Asp Val Ala Glu Phe Tyr Arg
Arg Gln 220 225 230ctg aag ctg acc caa
cag tac acc gac cac tgc gtc aac tgg tac aac 1971Leu Lys Leu Thr Gln
Gln Tyr Thr Asp His Cys Val Asn Trp Tyr Asn235 240
245 250gtc ggc ctg aac ggc ctg agg ggc tcc acc
tac gac gca tgg gtc aag 2019Val Gly Leu Asn Gly Leu Arg Gly Ser Thr
Tyr Asp Ala Trp Val Lys 255 260
265ttc aac cgc ttc cgc agg gag atg acc ctg acc gtc ctg gac ctg atc
2067Phe Asn Arg Phe Arg Arg Glu Met Thr Leu Thr Val Leu Asp Leu Ile
270 275 280gtc ctg ttc ccc ttc tac
gac atc cgc ctg tac tcc aag ggc gtc aag 2115Val Leu Phe Pro Phe Tyr
Asp Ile Arg Leu Tyr Ser Lys Gly Val Lys 285 290
295acc gag ctg acc cgc gac atc ttc acg gac ccc atc ttc ctg
ctc acg 2163Thr Glu Leu Thr Arg Asp Ile Phe Thr Asp Pro Ile Phe Leu
Leu Thr 300 305 310acc ctc cag aag tac
ggt ccc acc ttc ctg tcc atc gag aac tcc atc 2211Thr Leu Gln Lys Tyr
Gly Pro Thr Phe Leu Ser Ile Glu Asn Ser Ile315 320
325 330cgc aag ccc cac ctg ttc gac tac ctc cag
ggc atc gag ttc cac acg 2259Arg Lys Pro His Leu Phe Asp Tyr Leu Gln
Gly Ile Glu Phe His Thr 335 340
345cgc ctg agg cca ggc tac ttc ggc aag gac tcc ttc aac tac tgg tcc
2307Arg Leu Arg Pro Gly Tyr Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser
350 355 360ggc aac tac gtc gag acc
agg ccc tcc atc ggc tcc tcg aag acg atc 2355Gly Asn Tyr Val Glu Thr
Arg Pro Ser Ile Gly Ser Ser Lys Thr Ile 365 370
375acc tcc cct ttc tac ggc gac aag tcc acc gag ccc gtc cag
aag ctg 2403Thr Ser Pro Phe Tyr Gly Asp Lys Ser Thr Glu Pro Val Gln
Lys Leu 380 385 390tcc ttc gac ggc cag
aag gtc tac cgc acc atc gcc aac acc gac gtc 2451Ser Phe Asp Gly Gln
Lys Val Tyr Arg Thr Ile Ala Asn Thr Asp Val395 400
405 410gcg gct tgg ccg aac ggc aag gtc tac ctg
ggc gtc acg aag gtc gac 2499Ala Ala Trp Pro Asn Gly Lys Val Tyr Leu
Gly Val Thr Lys Val Asp 415 420
425ttc tcc cag tac gat gac cag aag aat gaa acc tcc acc cag acc tac
2547Phe Ser Gln Tyr Asp Asp Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr
430 435 440gac tcc aag cgc aac aat
ggc cac gtc tcc gcc cag gac tcc atc gac 2595Asp Ser Lys Arg Asn Asn
Gly His Val Ser Ala Gln Asp Ser Ile Asp 445 450
455cag ctg ccg cct gag acc act gac gag ccc ctg gag aag gcc
tac tcc 2643Gln Leu Pro Pro Glu Thr Thr Asp Glu Pro Leu Glu Lys Ala
Tyr Ser 460 465 470cac cag ctg aac tac
gcg gag tgc ttc ctg atg caa gac cgc agg ggc 2691His Gln Leu Asn Tyr
Ala Glu Cys Phe Leu Met Gln Asp Arg Arg Gly475 480
485 490acc atc ccc ttc ttc acc tgg acc cac cgc
tcc gtc gac ttc ttc aac 2739Thr Ile Pro Phe Phe Thr Trp Thr His Arg
Ser Val Asp Phe Phe Asn 495 500
505acc atc gac gcc gag aag atc acc cag ctg ccc gtg gtc aag gcc tac
2787Thr Ile Asp Ala Glu Lys Ile Thr Gln Leu Pro Val Val Lys Ala Tyr
510 515 520gcc ctg tcc tcg ggt gcc
tcc atc att gag ggt cca ggc ttc acc ggt 2835Ala Leu Ser Ser Gly Ala
Ser Ile Ile Glu Gly Pro Gly Phe Thr Gly 525 530
535ggc aac ctg ctg ttc ctg aag gag tcc tcg aac tcc atc gcc
aag ttc 2883Gly Asn Leu Leu Phe Leu Lys Glu Ser Ser Asn Ser Ile Ala
Lys Phe 540 545 550aag gtc acc ctg aac
tcc gct gcc ttg ctg caa cgc tac cgc gtc cgc 2931Lys Val Thr Leu Asn
Ser Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg555 560
565 570atc cgc tac gcc tcc acc acg aac ctg cgc
ctg ttc gtc cag aac tcc 2979Ile Arg Tyr Ala Ser Thr Thr Asn Leu Arg
Leu Phe Val Gln Asn Ser 575 580
585aac aat gac ttc ctg gtc atc tac atc aac aag acc atg aac aag gac
3027Asn Asn Asp Phe Leu Val Ile Tyr Ile Asn Lys Thr Met Asn Lys Asp
590 595 600gat gac ctg acc tac cag
acc ttc gac ctc gcc acc acg aac tcc aac 3075Asp Asp Leu Thr Tyr Gln
Thr Phe Asp Leu Ala Thr Thr Asn Ser Asn 605 610
615atg ggc ttc tcg ggc gac aag aat gaa ctg atc att ggt gct
gag tcc 3123Met Gly Phe Ser Gly Asp Lys Asn Glu Leu Ile Ile Gly Ala
Glu Ser 620 625 630ttc gtc tcc aat gaa
aag atc tac atc gac aag atc gag ttc atc ccc 3171Phe Val Ser Asn Glu
Lys Ile Tyr Ile Asp Lys Ile Glu Phe Ile Pro635 640
645 650gtc cag ctg tgataggaac tctgattgaa
ttctgcatgc gtttggacgt 3220Val Gln Leuatgctcattc aggttggagc
caatttggtt gatgtgtgtg cgagttcttg cgagtctgat 3280gagacatctc tgtattgtgt
ttctttcccc agtgttttct gtacttgtgt aatcggctaa 3340tcgccaacag attcggcgat
gaataaatga gaaataaatt gttctgattt tgagtgcaaa 3400aaaaaaggaa ttagatctgt
gtgtgttttt tggatccccg gggcggccgc 345018653PRTArtificial
SequencePRT(1)..(653)Cry3Bb1 variant 11231mv1 18Met Ala Asn Pro Asn Asn
Arg Ser Glu His Asp Thr Ile Lys Val Thr 1 5
10 15Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr
Pro Leu Ala Asp 20 25 30Asn
Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35
40 45Met Thr Glu Asp Ser Ser Thr Glu Val
Leu Asp Asn Ser Thr Val Lys 50 55
60Asp Ala Val Gly Thr Gly Ile Ser Val Val Gly Gln Ile Leu Gly Val 65
70 75 80Val Gly Val Pro Phe
Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe 85
90 95Leu Asn Thr Ile Trp Pro Ser Asp Ala Asp Pro
Trp Lys Ala Phe Met 100 105
110Ala Gln Val Glu Val Leu Ile Asp Lys Lys Ile Glu Glu Tyr Ala Lys
115 120 125Ser Lys Ala Leu Ala Glu Leu
Gln Gly Leu Gln Asn Asn Phe Glu Asp 130 135
140Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu
Arg145 150 155 160Ser Lys
Arg Ser Gln Gly Arg Ile Arg Glu Leu Phe Ser Gln Ala Glu
165 170 175Ser His Phe Arg Asn Ser Met
Pro Ser Phe Ala Val Ser Lys Phe Glu 180 185
190Val Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His
Leu Leu 195 200 205Leu Leu Lys Asp
Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210
215 220Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys
Leu Thr Gln Gln225 230 235
240Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu
245 250 255Arg Gly Ser Thr Tyr
Asp Ala Trp Val Lys Phe Asn Arg Phe Arg Arg 260
265 270Glu Met Thr Leu Thr Val Leu Asp Leu Ile Val Leu
Phe Pro Phe Tyr 275 280 285Asp Ile
Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290
295 300Ile Phe Thr Asp Pro Ile Phe Leu Leu Thr Thr
Leu Gln Lys Tyr Gly305 310 315
320Pro Thr Phe Leu Ser Ile Glu Asn Ser Ile Arg Lys Pro His Leu Phe
325 330 335Asp Tyr Leu Gln
Gly Ile Glu Phe His Thr Arg Leu Arg Pro Gly Tyr 340
345 350Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly
Asn Tyr Val Glu Thr 355 360 365Arg
Pro Ser Ile Gly Ser Ser Lys Thr Ile Thr Ser Pro Phe Tyr Gly 370
375 380Asp Lys Ser Thr Glu Pro Val Gln Lys Leu
Ser Phe Asp Gly Gln Lys385 390 395
400Val Tyr Arg Thr Ile Ala Asn Thr Asp Val Ala Ala Trp Pro Asn
Gly 405 410 415Lys Val Tyr
Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420
425 430Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr
Asp Ser Lys Arg Asn Asn 435 440
445Gly His Val Ser Ala Gln Asp Ser Ile Asp Gln Leu Pro Pro Glu Thr 450
455 460Thr Asp Glu Pro Leu Glu Lys Ala
Tyr Ser His Gln Leu Asn Tyr Ala465 470
475 480Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr Ile
Pro Phe Phe Thr 485 490
495Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr Ile Asp Ala Glu Lys
500 505 510Ile Thr Gln Leu Pro Val
Val Lys Ala Tyr Ala Leu Ser Ser Gly Ala 515 520
525Ser Ile Ile Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu
Phe Leu 530 535 540Lys Glu Ser Ser Asn
Ser Ile Ala Lys Phe Lys Val Thr Leu Asn Ser545 550
555 560Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg
Ile Arg Tyr Ala Ser Thr 565 570
575Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val
580 585 590Ile Tyr Ile Asn Lys
Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln 595
600 605Thr Phe Asp Leu Ala Thr Thr Asn Ser Asn Met Gly
Phe Ser Gly Asp 610 615 620Lys Asn Glu
Leu Ile Ile Gly Ala Glu Ser Phe Val Ser Asn Glu Lys625
630 635 640Ile Tyr Ile Asp Lys Ile Glu
Phe Ile Pro Val Gln Leu 645
650193039DNAArtificial SequenceDescription of Artificial Sequence
expression cassette 19gcggccgcgt taacaagctt ctgacgtaag ggatgacgca
cctgacgtaa gggatgacgc 60acctgacgta agggatgacg cacctgacgt aagggatgac
gcactcgaga tccccatctc 120cactgacgta agggatgacg cacaatccca ctatccttcg
caagaccctt cctctatata 180aggaagttca tttcatttgg agaggacacg ctgacaagct
agcttggctg caggtagatc 240ctagaaccat cttccacaca ctcaagccac actattggag
aacacacagg gacaacacac 300cataagatcc aagggaggcc tccgccgccg ccggtaacca
ccccgcccct ctcctctttc 360tttctccgtt tttttttccg tctcggtctc gatctttggc
cttggtagtt tgggtgggcg 420agaggcggct tcgtgcgcgc ccagatcggt gcgcgggagg
ggcgggatct cgcggctggg 480gctctcgccg gcgtggatcc ggcccggatc tcgcggggaa
tggggctctc ggatgtagat 540ctgcgatccg ccgttgttgg gggagatgat ggggggttta
aaatttccgc cgtgctaaac 600aagatcagga agaggggaaa agggcactat ggtttatatt
tttatatatt tctgctgctt 660cgtcaggctt agatgtgcta gatctttctt tcttcttttt
gtgggtagaa tttgaatccc 720tcagcattgt tcatcggtag tttttctttt catgatttgt
gacaaatgca gcctcgtgcg 780gagctttttt gtaggtagaa gtgatcaacc atg gcc aac
ccc aac aat cgc tcc 834 Met Ala Asn
Pro Asn Asn Arg Ser 1
5gag cac gac acg atc aag gtc acc ccc aac tcc gag ctc cag acc aac
882Glu His Asp Thr Ile Lys Val Thr Pro Asn Ser Glu Leu Gln Thr Asn 10
15 20cac aac cag tac ccg ctg gcc gac
aac ccc aac tcc acc ctg gaa gag 930His Asn Gln Tyr Pro Leu Ala Asp
Asn Pro Asn Ser Thr Leu Glu Glu 25 30
35 40ctg aac tac aag gag ttc ctg cgc atg acc gag gac tcc
tcc acg gag 978Leu Asn Tyr Lys Glu Phe Leu Arg Met Thr Glu Asp Ser
Ser Thr Glu 45 50 55gtc
ctg gac aac tcc acc gtc aag gac gcc gtc ggg acc ggc atc tcc 1026Val
Leu Asp Asn Ser Thr Val Lys Asp Ala Val Gly Thr Gly Ile Ser
60 65 70gtc gtt ggg cag atc ctg ggc gtc
gtt ggc gtc ccc ttc gca ggt gct 1074Val Val Gly Gln Ile Leu Gly Val
Val Gly Val Pro Phe Ala Gly Ala 75 80
85ctc acc tcc ttc tac cag tcc ttc ctg aac acc atc tgg ccc tcc gac
1122Leu Thr Ser Phe Tyr Gln Ser Phe Leu Asn Thr Ile Trp Pro Ser Asp
90 95 100gcc gac ccc tgg aag gcc ttc atg
gcc caa gtc gaa gtc ctg atc gac 1170Ala Asp Pro Trp Lys Ala Phe Met
Ala Gln Val Glu Val Leu Ile Asp105 110
115 120aag aag atc gag gag tac gcc aag tcc aag gcc ctg
gcc gag ctg caa 1218Lys Lys Ile Glu Glu Tyr Ala Lys Ser Lys Ala Leu
Ala Glu Leu Gln 125 130
135ggc ctg caa aac aac ttc gag gac tac gtc aac gcg ctg aac tcc tgg
1266Gly Leu Gln Asn Asn Phe Glu Asp Tyr Val Asn Ala Leu Asn Ser Trp
140 145 150aag aag acg cct ctg tcc
ctg cgc tcc aag cgc tcc cag ggc cgc atc 1314Lys Lys Thr Pro Leu Ser
Leu Arg Ser Lys Arg Ser Gln Gly Arg Ile 155 160
165cgc gag ctg ttc tcc cag gcc gag tcc cac ttc cgc aac tcc
atg ccg 1362Arg Glu Leu Phe Ser Gln Ala Glu Ser His Phe Arg Asn Ser
Met Pro 170 175 180tcc ttc gcc gtc tcc
aag ttc gag gtc ctg ttc ctg ccc acc tac gcc 1410Ser Phe Ala Val Ser
Lys Phe Glu Val Leu Phe Leu Pro Thr Tyr Ala185 190
195 200cag gct gcc aac acc cac ctc ctg ttg ctg
aag gac gcc cag gtc ttc 1458Gln Ala Ala Asn Thr His Leu Leu Leu Leu
Lys Asp Ala Gln Val Phe 205 210
215ggc gag gaa tgg ggc tac tcc tcg gag gac gtc gcc gag ttc tac cgt
1506Gly Glu Glu Trp Gly Tyr Ser Ser Glu Asp Val Ala Glu Phe Tyr Arg
220 225 230cgc cag ctg aag ctg acc
caa cag tac acc gac cac tgc gtc aac tgg 1554Arg Gln Leu Lys Leu Thr
Gln Gln Tyr Thr Asp His Cys Val Asn Trp 235 240
245tac aac gtc ggc ctg aac ggc ctg agg ggc tcc acc tac gac
gca tgg 1602Tyr Asn Val Gly Leu Asn Gly Leu Arg Gly Ser Thr Tyr Asp
Ala Trp 250 255 260gtc aag ttc aac cgc
ttc cgc agg gag atg acc ctg acc gtc ctg gac 1650Val Lys Phe Asn Arg
Phe Arg Arg Glu Met Thr Leu Thr Val Leu Asp265 270
275 280ctg atc gtc ctg ttc ccc ttc tac gac atc
cgc ctg tac tcc aag ggc 1698Leu Ile Val Leu Phe Pro Phe Tyr Asp Ile
Arg Leu Tyr Ser Lys Gly 285 290
295gtc aag acc gag ctg acc cgc gac atc ttc acg gac ccc atc ttc ctg
1746Val Lys Thr Glu Leu Thr Arg Asp Ile Phe Thr Asp Pro Ile Phe Leu
300 305 310ctc acg acc ctc cag aag
tac ggt ccc acc ttc ctg tcc atc gag aac 1794Leu Thr Thr Leu Gln Lys
Tyr Gly Pro Thr Phe Leu Ser Ile Glu Asn 315 320
325tcc atc cgc aag ccc cac ctg ttc gac tac ctc cag ggc atc
gag ttc 1842Ser Ile Arg Lys Pro His Leu Phe Asp Tyr Leu Gln Gly Ile
Glu Phe 330 335 340cac acg cgc ctg agg
cca ggc tac ttc ggc aag gac tcc ttc aac tac 1890His Thr Arg Leu Arg
Pro Gly Tyr Phe Gly Lys Asp Ser Phe Asn Tyr345 350
355 360tgg tcc ggc aac tac gtc gag acc agg ccc
tcc atc ggc tcc tcg aag 1938Trp Ser Gly Asn Tyr Val Glu Thr Arg Pro
Ser Ile Gly Ser Ser Lys 365 370
375acg atc acc tcc cct ttc tac ggc gac aag tcc acc gag ccc gtc cag
1986Thr Ile Thr Ser Pro Phe Tyr Gly Asp Lys Ser Thr Glu Pro Val Gln
380 385 390aag ctg tcc ttc gac ggc
cag aag gtc tac cgc acc atc gcc aac acc 2034Lys Leu Ser Phe Asp Gly
Gln Lys Val Tyr Arg Thr Ile Ala Asn Thr 395 400
405gac gtc gcg gct tgg ccg aac ggc aag gtc tac ctg ggc gtc
acg aag 2082Asp Val Ala Ala Trp Pro Asn Gly Lys Val Tyr Leu Gly Val
Thr Lys 410 415 420gtc gac ttc tcc cag
tac gat gac cag aag aat gaa acc tcc acc cag 2130Val Asp Phe Ser Gln
Tyr Asp Asp Gln Lys Asn Glu Thr Ser Thr Gln425 430
435 440acc tac gac tcc aag cgc aac aat ggc cac
gtc tcc gcc cag gac tcc 2178Thr Tyr Asp Ser Lys Arg Asn Asn Gly His
Val Ser Ala Gln Asp Ser 445 450
455atc gac cag ctg ccg cct gag acc act gac gag ccc ctg gag aag gcc
2226Ile Asp Gln Leu Pro Pro Glu Thr Thr Asp Glu Pro Leu Glu Lys Ala
460 465 470tac tcc cac cag ctg aac
tac gcg gag tgc ttc ctg atg caa gac cgc 2274Tyr Ser His Gln Leu Asn
Tyr Ala Glu Cys Phe Leu Met Gln Asp Arg 475 480
485agg ggc acc atc ccc ttc ttc acc tgg acc cac cgc tcc gtc
gac ttc 2322Arg Gly Thr Ile Pro Phe Phe Thr Trp Thr His Arg Ser Val
Asp Phe 490 495 500ttc aac acc atc gac
gcc gag aag atc acc cag ctg ccc gtg gtc aag 2370Phe Asn Thr Ile Asp
Ala Glu Lys Ile Thr Gln Leu Pro Val Val Lys505 510
515 520gcc tac gcc ctg tcc tcg ggt gcc tcc atc
att gag ggt cca ggc ttc 2418Ala Tyr Ala Leu Ser Ser Gly Ala Ser Ile
Ile Glu Gly Pro Gly Phe 525 530
535acc ggt ggc aac ctg ctg ttc ctg aag gag tcc tcg aac tcc atc gcc
2466Thr Gly Gly Asn Leu Leu Phe Leu Lys Glu Ser Ser Asn Ser Ile Ala
540 545 550aag ttc aag gtc acc ctg
aac tcc gct gcc ttg ctg caa cgc tac cgc 2514Lys Phe Lys Val Thr Leu
Asn Ser Ala Ala Leu Leu Gln Arg Tyr Arg 555 560
565gtc cgc atc cgc tac gcc tcc acc acg aac ctg cgc ctg ttc
gtc cag 2562Val Arg Ile Arg Tyr Ala Ser Thr Thr Asn Leu Arg Leu Phe
Val Gln 570 575 580aac tcc aac aat gac
ttc ctg gtc atc tac atc aac aag acc atg aac 2610Asn Ser Asn Asn Asp
Phe Leu Val Ile Tyr Ile Asn Lys Thr Met Asn585 590
595 600aag gac gat gac ctg acc tac cag acc ttc
gac ctc gcc acc acg aac 2658Lys Asp Asp Asp Leu Thr Tyr Gln Thr Phe
Asp Leu Ala Thr Thr Asn 605 610
615tcc aac atg ggc ttc tcg ggc gac aag aat gaa ctg atc att ggt gct
2706Ser Asn Met Gly Phe Ser Gly Asp Lys Asn Glu Leu Ile Ile Gly Ala
620 625 630gag tcc ttc gtc tcc aat
gaa aag atc tac atc gac aag atc gag ttc 2754Glu Ser Phe Val Ser Asn
Glu Lys Ile Tyr Ile Asp Lys Ile Glu Phe 635 640
645atc ccc gtc cag ctg tgataggaac tctgattgaa ttctgcatgc
gtttggacgt 2809Ile Pro Val Gln Leu 650atgctcattc aggttggagc
caatttggtt gatgtgtgtg cgagttcttg cgagtctgat 2869gagacatctc tgtattgtgt
ttctttcccc agtgttttct gtacttgtgt aatcggctaa 2929tcgccaacag attcggcgat
gaataaatga gaaataaatt gttctgattt tgagtgcaaa 2989aaaaaaggaa ttagatctgt
gtgtgttttt tggatccccg gggcggccgc 303920653PRTArtificial
SequencePRT(1)..(653)Cry3Bb1 variant 11231mv1 20Met Ala Asn Pro Asn Asn
Arg Ser Glu His Asp Thr Ile Lys Val Thr 1 5
10 15Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr
Pro Leu Ala Asp 20 25 30Asn
Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35
40 45Met Thr Glu Asp Ser Ser Thr Glu Val
Leu Asp Asn Ser Thr Val Lys 50 55
60Asp Ala Val Gly Thr Gly Ile Ser Val Val Gly Gln Ile Leu Gly Val 65
70 75 80Val Gly Val Pro Phe
Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe 85
90 95Leu Asn Thr Ile Trp Pro Ser Asp Ala Asp Pro
Trp Lys Ala Phe Met 100 105
110Ala Gln Val Glu Val Leu Ile Asp Lys Lys Ile Glu Glu Tyr Ala Lys
115 120 125Ser Lys Ala Leu Ala Glu Leu
Gln Gly Leu Gln Asn Asn Phe Glu Asp 130 135
140Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu
Arg145 150 155 160Ser Lys
Arg Ser Gln Gly Arg Ile Arg Glu Leu Phe Ser Gln Ala Glu
165 170 175Ser His Phe Arg Asn Ser Met
Pro Ser Phe Ala Val Ser Lys Phe Glu 180 185
190Val Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His
Leu Leu 195 200 205Leu Leu Lys Asp
Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210
215 220Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys
Leu Thr Gln Gln225 230 235
240Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu
245 250 255Arg Gly Ser Thr Tyr
Asp Ala Trp Val Lys Phe Asn Arg Phe Arg Arg 260
265 270Glu Met Thr Leu Thr Val Leu Asp Leu Ile Val Leu
Phe Pro Phe Tyr 275 280 285Asp Ile
Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290
295 300Ile Phe Thr Asp Pro Ile Phe Leu Leu Thr Thr
Leu Gln Lys Tyr Gly305 310 315
320Pro Thr Phe Leu Ser Ile Glu Asn Ser Ile Arg Lys Pro His Leu Phe
325 330 335Asp Tyr Leu Gln
Gly Ile Glu Phe His Thr Arg Leu Arg Pro Gly Tyr 340
345 350Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly
Asn Tyr Val Glu Thr 355 360 365Arg
Pro Ser Ile Gly Ser Ser Lys Thr Ile Thr Ser Pro Phe Tyr Gly 370
375 380Asp Lys Ser Thr Glu Pro Val Gln Lys Leu
Ser Phe Asp Gly Gln Lys385 390 395
400Val Tyr Arg Thr Ile Ala Asn Thr Asp Val Ala Ala Trp Pro Asn
Gly 405 410 415Lys Val Tyr
Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420
425 430Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr
Asp Ser Lys Arg Asn Asn 435 440
445Gly His Val Ser Ala Gln Asp Ser Ile Asp Gln Leu Pro Pro Glu Thr 450
455 460Thr Asp Glu Pro Leu Glu Lys Ala
Tyr Ser His Gln Leu Asn Tyr Ala465 470
475 480Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr Ile
Pro Phe Phe Thr 485 490
495Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr Ile Asp Ala Glu Lys
500 505 510Ile Thr Gln Leu Pro Val
Val Lys Ala Tyr Ala Leu Ser Ser Gly Ala 515 520
525Ser Ile Ile Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu
Phe Leu 530 535 540Lys Glu Ser Ser Asn
Ser Ile Ala Lys Phe Lys Val Thr Leu Asn Ser545 550
555 560Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg
Ile Arg Tyr Ala Ser Thr 565 570
575Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val
580 585 590Ile Tyr Ile Asn Lys
Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln 595
600 605Thr Phe Asp Leu Ala Thr Thr Asn Ser Asn Met Gly
Phe Ser Gly Asp 610 615 620Lys Asn Glu
Leu Ile Ile Gly Ala Glu Ser Phe Val Ser Asn Glu Lys625
630 635 640Ile Tyr Ile Asp Lys Ile Glu
Phe Ile Pro Val Gln Leu 645
650213039DNAArtificial SequenceDescription of Artificial Sequence
expression cassette 21gcggccgcgt taacaagctt ctgacgtaag ggatgacgca
cctgacgtaa gggatgacgc 60acctgacgta agggatgacg cacctgacgt aagggatgac
gcactcgaga tccccatctc 120cactgacgta agggatgacg cacaatccca ctatccttcg
caagaccctt cctctatata 180aggaagttca tttcatttgg agaggacacg ctgacaagct
agcttggctg caggtagatc 240ctagaaccat cttccacaca ctcaagccac actattggag
aacacacagg gacaacacac 300cataagatcc aagggaggcc tccgccgccg ccggtaacca
ccccgcccct ctcctctttc 360tttctccgtt tttttttccg tctcggtctc gatctttggc
cttggtagtt tgggtgggcg 420agaggcggct tcgtgcgcgc ccagatcggt gcgcgggagg
ggcgggatct cgcggctggg 480gctctcgccg gcgtggatcc ggcccggatc tcgcggggaa
tggggctctc ggatgtagat 540ctgcgatccg ccgttgttgg gggagatgat ggggggttta
aaatttccgc cgtgctaaac 600aagatcagga agaggggaaa agggcactat ggtttatatt
tttatatatt tctgctgctt 660cgtcaggctt agatgtgcta gatctttctt tcttcttttt
gtgggtagaa tttgaatccc 720tcagcattgt tcatcggtag tttttctttt catgatttgt
gacaaatgca gcctcgtgcg 780gagctttttt gtaggtagaa gtgatcaacc atg gcc aac
ccc aac aat cgc tcc 834 Met Ala Asn
Pro Asn Asn Arg Ser 1
5gag cac gac acg atc aag gtc acc ccc aac tcc gag ctc cag acc aac
882Glu His Asp Thr Ile Lys Val Thr Pro Asn Ser Glu Leu Gln Thr Asn 10
15 20cac aac cag tac ccg ctg gcc gac
aac ccc aac tcc acc ctg gaa gag 930His Asn Gln Tyr Pro Leu Ala Asp
Asn Pro Asn Ser Thr Leu Glu Glu 25 30
35 40ctg aac tac aag gag ttc ctg cgc atg acc gag gac tcc
tcc acg gag 978Leu Asn Tyr Lys Glu Phe Leu Arg Met Thr Glu Asp Ser
Ser Thr Glu 45 50 55gtc
ctg gac aac tcc acc gtc aag gac gcc gtc ggg acc ggc atc tcc 1026Val
Leu Asp Asn Ser Thr Val Lys Asp Ala Val Gly Thr Gly Ile Ser
60 65 70gtc gtt ggg cag atc ctg ggc gtc
gtt ggc gtc ccc ttc gca ggt gct 1074Val Val Gly Gln Ile Leu Gly Val
Val Gly Val Pro Phe Ala Gly Ala 75 80
85ctc acc tcc ttc tac cag tcc ttc ctg aac acc atc tgg ccc tcc gac
1122Leu Thr Ser Phe Tyr Gln Ser Phe Leu Asn Thr Ile Trp Pro Ser Asp
90 95 100gcc gac ccc tgg aag gcc ttc atg
gcc caa gtc gaa gtc ctg atc gac 1170Ala Asp Pro Trp Lys Ala Phe Met
Ala Gln Val Glu Val Leu Ile Asp105 110
115 120aag aag atc gag gag tac gcc aag tcc aag gcc ctg
gcc gag ctg caa 1218Lys Lys Ile Glu Glu Tyr Ala Lys Ser Lys Ala Leu
Ala Glu Leu Gln 125 130
135ggc ctg caa aac aac ttc gag gac tac gtc aac gcg ctg aac tcc tgg
1266Gly Leu Gln Asn Asn Phe Glu Asp Tyr Val Asn Ala Leu Asn Ser Trp
140 145 150aag aag acg cct ctg tcc
ctg cgc tcc aag cgc tcc cag gac cgc atc 1314Lys Lys Thr Pro Leu Ser
Leu Arg Ser Lys Arg Ser Gln Asp Arg Ile 155 160
165cgc gag ctg ttc tcc cag gcc gag tcc cac ttc cgc aac tcc
atg ccg 1362Arg Glu Leu Phe Ser Gln Ala Glu Ser His Phe Arg Asn Ser
Met Pro 170 175 180tcc ttc gcc gtc tcc
aag ttc gag gtc ctg ttc ctg ccc acc tac gcc 1410Ser Phe Ala Val Ser
Lys Phe Glu Val Leu Phe Leu Pro Thr Tyr Ala185 190
195 200cag gct gcc aac acc cac ctc ctg ttg ctg
aag gac gcc cag gtc ttc 1458Gln Ala Ala Asn Thr His Leu Leu Leu Leu
Lys Asp Ala Gln Val Phe 205 210
215ggc gag gaa tgg ggc tac tcc tcg gag gac gtc gcc gag ttc tac cgt
1506Gly Glu Glu Trp Gly Tyr Ser Ser Glu Asp Val Ala Glu Phe Tyr Arg
220 225 230cgc cag ctg aag ctg acc
caa cag tac acc gac cac tgc gtc aac tgg 1554Arg Gln Leu Lys Leu Thr
Gln Gln Tyr Thr Asp His Cys Val Asn Trp 235 240
245tac aac gtc ggc ctg aac ggc ctg agg ggc tcc acc tac gac
gca tgg 1602Tyr Asn Val Gly Leu Asn Gly Leu Arg Gly Ser Thr Tyr Asp
Ala Trp 250 255 260gtc aag ttc aac cgc
ttc cgc agg gag atg acc ctg acc gtc ctg gac 1650Val Lys Phe Asn Arg
Phe Arg Arg Glu Met Thr Leu Thr Val Leu Asp265 270
275 280ctg atc gtc ctg ttc ccc ttc tac gac atc
cgc ctg tac tcc aag ggc 1698Leu Ile Val Leu Phe Pro Phe Tyr Asp Ile
Arg Leu Tyr Ser Lys Gly 285 290
295gtc aag acc gag ctg acc cgc gac atc ttc acg gac ccc atc ttc ctg
1746Val Lys Thr Glu Leu Thr Arg Asp Ile Phe Thr Asp Pro Ile Phe Leu
300 305 310ctc acg acc ctc cag aag
tac ggt ccc acc ttc ctg tcc atc gag aac 1794Leu Thr Thr Leu Gln Lys
Tyr Gly Pro Thr Phe Leu Ser Ile Glu Asn 315 320
325tcc atc cgc aag ccc cac ctg ttc gac tac ctc cag ggc atc
gag ttc 1842Ser Ile Arg Lys Pro His Leu Phe Asp Tyr Leu Gln Gly Ile
Glu Phe 330 335 340cac acg cgc ctg agg
cca ggc tac ttc ggc aag gac tcc ttc aac tac 1890His Thr Arg Leu Arg
Pro Gly Tyr Phe Gly Lys Asp Ser Phe Asn Tyr345 350
355 360tgg tcc ggc aac tac gtc gag acc agg ccc
tcc atc ggc tcc tcg aag 1938Trp Ser Gly Asn Tyr Val Glu Thr Arg Pro
Ser Ile Gly Ser Ser Lys 365 370
375acg atc acc tcc cct ttc tac ggc gac aag tcc acc gag ccc gtc cag
1986Thr Ile Thr Ser Pro Phe Tyr Gly Asp Lys Ser Thr Glu Pro Val Gln
380 385 390aag ctg tcc ttc gac ggc
cag aag gtc tac cgc acc atc gcc aac acc 2034Lys Leu Ser Phe Asp Gly
Gln Lys Val Tyr Arg Thr Ile Ala Asn Thr 395 400
405gac gtc gcg gct tgg ccg aac ggc aag gtc tac ctg ggc gtc
acg aag 2082Asp Val Ala Ala Trp Pro Asn Gly Lys Val Tyr Leu Gly Val
Thr Lys 410 415 420gtc gac ttc tcc cag
tac gat gac cag aag aat gaa acc tcc acc cag 2130Val Asp Phe Ser Gln
Tyr Asp Asp Gln Lys Asn Glu Thr Ser Thr Gln425 430
435 440acc tac gac tcc aag cgc aac aat ggc cac
gtc tcc gcc cag gac tcc 2178Thr Tyr Asp Ser Lys Arg Asn Asn Gly His
Val Ser Ala Gln Asp Ser 445 450
455atc gac cag ctg ccg cct gag acc act gac gag ccc ctg gag aag gcc
2226Ile Asp Gln Leu Pro Pro Glu Thr Thr Asp Glu Pro Leu Glu Lys Ala
460 465 470tac tcc cac cag ctg aac
tac gcg gag tgc ttc ctg atg caa gac cgc 2274Tyr Ser His Gln Leu Asn
Tyr Ala Glu Cys Phe Leu Met Gln Asp Arg 475 480
485agg ggc acc atc ccc ttc ttc acc tgg acc cac cgc tcc gtc
gac ttc 2322Arg Gly Thr Ile Pro Phe Phe Thr Trp Thr His Arg Ser Val
Asp Phe 490 495 500ttc aac acc atc gac
gcc gag aag atc acc cag ctg ccc gtg gtc aag 2370Phe Asn Thr Ile Asp
Ala Glu Lys Ile Thr Gln Leu Pro Val Val Lys505 510
515 520gcc tac gcc ctg tcc tcg ggt gcc tcc atc
att gag ggt cca ggc ttc 2418Ala Tyr Ala Leu Ser Ser Gly Ala Ser Ile
Ile Glu Gly Pro Gly Phe 525 530
535acc ggt ggc aac ctg ctg ttc ctg aag gag tcc tcg aac tcc atc gcc
2466Thr Gly Gly Asn Leu Leu Phe Leu Lys Glu Ser Ser Asn Ser Ile Ala
540 545 550aag ttc aag gtc acc ctg
aac tcc gct gcc ttg ctg caa cgc tac cgc 2514Lys Phe Lys Val Thr Leu
Asn Ser Ala Ala Leu Leu Gln Arg Tyr Arg 555 560
565gtc cgc atc cgc tac gcc tcc acc acg aac ctg cgc ctg ttc
gtc cag 2562Val Arg Ile Arg Tyr Ala Ser Thr Thr Asn Leu Arg Leu Phe
Val Gln 570 575 580aac tcc aac aat gac
ttc ctg gtc atc tac atc aac aag acc atg aac 2610Asn Ser Asn Asn Asp
Phe Leu Val Ile Tyr Ile Asn Lys Thr Met Asn585 590
595 600aag gac gat gac ctg acc tac cag acc ttc
gac ctc gcc acc acg aac 2658Lys Asp Asp Asp Leu Thr Tyr Gln Thr Phe
Asp Leu Ala Thr Thr Asn 605 610
615tcc aac atg ggc ttc tcg ggc gac aag aat gaa ctg atc att ggt gct
2706Ser Asn Met Gly Phe Ser Gly Asp Lys Asn Glu Leu Ile Ile Gly Ala
620 625 630gag tcc ttc gtc tcc aat
gaa aag atc tac atc gac aag atc gag ttc 2754Glu Ser Phe Val Ser Asn
Glu Lys Ile Tyr Ile Asp Lys Ile Glu Phe 635 640
645atc ccc gtc cag ctg tgataggaac tctgattgaa ttctgcatgc
gtttggacgt 2809Ile Pro Val Gln Leu 650atgctcattc aggttggagc
caatttggtt gatgtgtgtg cgagttcttg cgagtctgat 2869gagacatctc tgtattgtgt
ttctttcccc agtgttttct gtacttgtgt aatcggctaa 2929tcgccaacag attcggcgat
gaataaatga gaaataaatt gttctgattt tgagtgcaaa 2989aaaaaaggaa ttagatctgt
gtgtgttttt tggatccccg gggcggccgc 303922653PRTArtificial
SequencePRT(1)..(653)Cry3Bb1 variant 11231mv2 22Met Ala Asn Pro Asn Asn
Arg Ser Glu His Asp Thr Ile Lys Val Thr 1 5
10 15Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr
Pro Leu Ala Asp 20 25 30Asn
Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35
40 45Met Thr Glu Asp Ser Ser Thr Glu Val
Leu Asp Asn Ser Thr Val Lys 50 55
60Asp Ala Val Gly Thr Gly Ile Ser Val Val Gly Gln Ile Leu Gly Val 65
70 75 80Val Gly Val Pro Phe
Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe 85
90 95Leu Asn Thr Ile Trp Pro Ser Asp Ala Asp Pro
Trp Lys Ala Phe Met 100 105
110Ala Gln Val Glu Val Leu Ile Asp Lys Lys Ile Glu Glu Tyr Ala Lys
115 120 125Ser Lys Ala Leu Ala Glu Leu
Gln Gly Leu Gln Asn Asn Phe Glu Asp 130 135
140Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu
Arg145 150 155 160Ser Lys
Arg Ser Gln Asp Arg Ile Arg Glu Leu Phe Ser Gln Ala Glu
165 170 175Ser His Phe Arg Asn Ser Met
Pro Ser Phe Ala Val Ser Lys Phe Glu 180 185
190Val Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His
Leu Leu 195 200 205Leu Leu Lys Asp
Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210
215 220Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys
Leu Thr Gln Gln225 230 235
240Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu
245 250 255Arg Gly Ser Thr Tyr
Asp Ala Trp Val Lys Phe Asn Arg Phe Arg Arg 260
265 270Glu Met Thr Leu Thr Val Leu Asp Leu Ile Val Leu
Phe Pro Phe Tyr 275 280 285Asp Ile
Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290
295 300Ile Phe Thr Asp Pro Ile Phe Leu Leu Thr Thr
Leu Gln Lys Tyr Gly305 310 315
320Pro Thr Phe Leu Ser Ile Glu Asn Ser Ile Arg Lys Pro His Leu Phe
325 330 335Asp Tyr Leu Gln
Gly Ile Glu Phe His Thr Arg Leu Arg Pro Gly Tyr 340
345 350Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly
Asn Tyr Val Glu Thr 355 360 365Arg
Pro Ser Ile Gly Ser Ser Lys Thr Ile Thr Ser Pro Phe Tyr Gly 370
375 380Asp Lys Ser Thr Glu Pro Val Gln Lys Leu
Ser Phe Asp Gly Gln Lys385 390 395
400Val Tyr Arg Thr Ile Ala Asn Thr Asp Val Ala Ala Trp Pro Asn
Gly 405 410 415Lys Val Tyr
Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420
425 430Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr
Asp Ser Lys Arg Asn Asn 435 440
445Gly His Val Ser Ala Gln Asp Ser Ile Asp Gln Leu Pro Pro Glu Thr 450
455 460Thr Asp Glu Pro Leu Glu Lys Ala
Tyr Ser His Gln Leu Asn Tyr Ala465 470
475 480Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr Ile
Pro Phe Phe Thr 485 490
495Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr Ile Asp Ala Glu Lys
500 505 510Ile Thr Gln Leu Pro Val
Val Lys Ala Tyr Ala Leu Ser Ser Gly Ala 515 520
525Ser Ile Ile Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu
Phe Leu 530 535 540Lys Glu Ser Ser Asn
Ser Ile Ala Lys Phe Lys Val Thr Leu Asn Ser545 550
555 560Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg
Ile Arg Tyr Ala Ser Thr 565 570
575Thr Asn Leu Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val
580 585 590Ile Tyr Ile Asn Lys
Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln 595
600 605Thr Phe Asp Leu Ala Thr Thr Asn Ser Asn Met Gly
Phe Ser Gly Asp 610 615 620Lys Asn Glu
Leu Ile Ile Gly Ala Glu Ser Phe Val Ser Asn Glu Lys625
630 635 640Ile Tyr Ile Asp Lys Ile Glu
Phe Ile Pro Val Gln Leu 645
650233469DNAArtificial SequenceDescription of Artificial Sequence
expression cassette 23gcggccgcgt taacaagctt ctgcaggtcc gatgtgagac
ttttcaacaa agggtaatat 60ccggaaacct cctcggattc cattgcccag ctatctgtca
ctttattgtg aagatagtgg 120aaaaggaagg tggctcctac aaatgccatc attgcgataa
aggaaaggcc atcgttgaag 180atgcctctgc cgacagtggt cccaaagatg gacccccacc
cacgaggagc atcgtggaaa 240aagaagacgt tccaaccacg tcttcaaagc aagtggattg
atgtgatggt ccgatgtgag 300acttttcaac aaagggtaat atccggaaac ctcctcggat
tccattgccc agctatctgt 360cactttattg tgaagatagt ggaaaaggaa ggtggctcct
acaaatgcca tcattgcgat 420aaaggaaagg ccatcgttga agatgcctct gccgacagtg
gtcccaaaga tggaccccca 480cccacgagga gcatcgtgga aaaagaagac gttccaacca
cgtcttcaaa gcaagtggat 540tgatgtgata tctccactga cgtaagggat gacgcacaat
cccactatcc ttcgcaagac 600ccttcctcta tataaggaag ttcatttcat ttggagagga
cacgctgaca agctgactct 660agcagatcct ctagaaccat cttccacaca ctcaagccac
actattggag aacacacagg 720gacaacacac cataagatcc aagggaggcc tccgccgccg
ccggtaacca ccccgcccct 780ctcctctttc tttctccgtt tttttttccg tctcggtctc
gatctttggc cttggtagtt 840tgggtgggcg agaggcggct tcgtgcgcgc ccagatcggt
gcgcgggagg ggcgggatct 900cgcggctggg gctctcgccg gcgtggatcc ggcccggatc
tcgcggggaa tggggctctc 960ggatgtagat ctgcgatccg ccgttgttgg gggagatgat
ggggggttta aaatttccgc 1020cgtgctaaac aagatcagga agaggggaaa agggcactat
ggtttatatt tttatatatt 1080tctgctgctt cgtcaggctt agatgtgcta gatctttctt
tcttcttttt gtgggtagaa 1140tttgaatccc tcagcattgt tcatcggtag tttttctttt
catgatttgt gacaaatgca 1200gcctcgtgcg gagctttttt gtaggtagaa gtgatcaacc
atg gcc aac ccc aac 1255
Met Ala Asn Pro Asn 1
5aat cgc tcc gag cac gac acg atc aag gtc acc ccc aac tcc gag ctc
1303Asn Arg Ser Glu His Asp Thr Ile Lys Val Thr Pro Asn Ser Glu Leu
10 15 20cag acc aac cac aac
cag tac ccg ctg gcc gac aac ccc aac tcc acc 1351Gln Thr Asn His Asn
Gln Tyr Pro Leu Ala Asp Asn Pro Asn Ser Thr 25
30 35ctg gaa gag ctg aac tac aag gag ttc ctg cgc atg
acc gag gac tcc 1399Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg Met
Thr Glu Asp Ser 40 45 50tcc acg
gag gtc ctg gac aac tcc acc gtc aag gac gcc gtc ggg acc 1447Ser Thr
Glu Val Leu Asp Asn Ser Thr Val Lys Asp Ala Val Gly Thr 55
60 65ggc atc tcc gtc gtt ggg cag atc ctg ggc gtc
gtt ggc gtc ccc ttc 1495Gly Ile Ser Val Val Gly Gln Ile Leu Gly Val
Val Gly Val Pro Phe 70 75 80
85gca ggt gct ctc acc tcc ttc tac cag tcc ttc ctg aac acc atc tgg
1543Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe Leu Asn Thr Ile Trp
90 95 100ccc tcc gac gcc gac
ccc tgg aag gcc ttc atg gcc caa gtc gaa gtc 1591Pro Ser Asp Ala Asp
Pro Trp Lys Ala Phe Met Ala Gln Val Glu Val 105
110 115ctg atc gac aag aag atc gag gag tac gcc aag tcc
aag gcc ctg gcc 1639Leu Ile Asp Lys Lys Ile Glu Glu Tyr Ala Lys Ser
Lys Ala Leu Ala 120 125 130gag ctg
caa ggc ctg caa aac aac ttc gag gac tac gtc aac gcg ctg 1687Glu Leu
Gln Gly Leu Gln Asn Asn Phe Glu Asp Tyr Val Asn Ala Leu 135
140 145aac tcc tgg aag aag acg cct ctg tcc ctg cgc
tcc aag cgc tcc cag 1735Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg
Ser Lys Arg Ser Gln150 155 160
165gac cgc atc cgc gag ctg ttc tcc cag gcc gag tcc cac ttc cgc aac
1783Asp Arg Ile Arg Glu Leu Phe Ser Gln Ala Glu Ser His Phe Arg Asn
170 175 180tcc atg ccg tcc ttc
gcc gtc tcc aag ttc gag gtc ctg ttc ctg ccc 1831Ser Met Pro Ser Phe
Ala Val Ser Lys Phe Glu Val Leu Phe Leu Pro 185
190 195acc tac gcc cag gct gcc aac acc cac ctc ctg ttg
ctg aag gac gcc 1879Thr Tyr Ala Gln Ala Ala Asn Thr His Leu Leu Leu
Leu Lys Asp Ala 200 205 210cag gtc
ttc ggc gag gaa tgg ggc tac tcc tcg gag gac gtc gcc gag 1927Gln Val
Phe Gly Glu Glu Trp Gly Tyr Ser Ser Glu Asp Val Ala Glu 215
220 225ttc tac cgt cgc cag ctg aag ctg acc caa cag
tac acc gac cac tgc 1975Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln
Tyr Thr Asp His Cys230 235 240
245gtc aac tgg tac aac gtc ggc ctg aac ggc ctg agg ggc tcc acc tac
2023Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu Arg Gly Ser Thr Tyr
250 255 260gac gca tgg gtc aag
ttc aac cgc ttc cgc agg gag atg acc ctg acc 2071Asp Ala Trp Val Lys
Phe Asn Arg Phe Arg Arg Glu Met Thr Leu Thr 265
270 275gtc ctg gac ctg atc gtc ctg ttc ccc ttc tac gac
atc cgc ctg tac 2119Val Leu Asp Leu Ile Val Leu Phe Pro Phe Tyr Asp
Ile Arg Leu Tyr 280 285 290tcc aag
ggc gtc aag acc gag ctg acc cgc gac atc ttc acg gac ccc 2167Ser Lys
Gly Val Lys Thr Glu Leu Thr Arg Asp Ile Phe Thr Asp Pro 295
300 305atc ttc ctg ctc acg acc ctc cag aag tac ggt
ccc acc ttc ctg tcc 2215Ile Phe Leu Leu Thr Thr Leu Gln Lys Tyr Gly
Pro Thr Phe Leu Ser310 315 320
325atc gag aac tcc atc cgc aag ccc cac ctg ttc gac tac ctc cag ggc
2263Ile Glu Asn Ser Ile Arg Lys Pro His Leu Phe Asp Tyr Leu Gln Gly
330 335 340atc gag ttc cac acg
cgc ctg agg cca ggc tac ttc ggc aag gac tcc 2311Ile Glu Phe His Thr
Arg Leu Arg Pro Gly Tyr Phe Gly Lys Asp Ser 345
350 355ttc aac tac tgg tcc ggc aac tac gtc gag acc agg
ccc tcc atc ggc 2359Phe Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr Arg
Pro Ser Ile Gly 360 365 370tcc tcg
aag acg atc acc tcc cct ttc tac ggc gac aag tcc acc gag 2407Ser Ser
Lys Thr Ile Thr Ser Pro Phe Tyr Gly Asp Lys Ser Thr Glu 375
380 385ccc gtc cag aag ctg tcc ttc gac ggc cag aag
gtc tac cgc acc atc 2455Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys
Val Tyr Arg Thr Ile390 395 400
405gcc aac acc gac gtc gcg gct tgg ccg aac ggc aag gtc tac ctg ggc
2503Ala Asn Thr Asp Val Ala Ala Trp Pro Asn Gly Lys Val Tyr Leu Gly
410 415 420gtc acg aag gtc gac
ttc tcc cag tac gat gac cag aag aat gaa acc 2551Val Thr Lys Val Asp
Phe Ser Gln Tyr Asp Asp Gln Lys Asn Glu Thr 425
430 435tcc acc cag acc tac gac tcc aag cgc aac aat ggc
cac gtc tcc gcc 2599Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn Gly
His Val Ser Ala 440 445 450cag gac
tcc atc gac cag ctg ccg cct gag acc act gac gag ccc ctg 2647Gln Asp
Ser Ile Asp Gln Leu Pro Pro Glu Thr Thr Asp Glu Pro Leu 455
460 465gag aag gcc tac tcc cac cag ctg aac tac gcg
gag tgc ttc ctg atg 2695Glu Lys Ala Tyr Ser His Gln Leu Asn Tyr Ala
Glu Cys Phe Leu Met470 475 480
485caa gac cgc agg ggc acc atc ccc ttc ttc acc tgg acc cac cgc tcc
2743Gln Asp Arg Arg Gly Thr Ile Pro Phe Phe Thr Trp Thr His Arg Ser
490 495 500gtc gac ttc ttc aac
acc atc gac gcc gag aag atc acc cag ctg ccc 2791Val Asp Phe Phe Asn
Thr Ile Asp Ala Glu Lys Ile Thr Gln Leu Pro 505
510 515gtg gtc aag gcc tac gcc ctg tcc tcg ggt gcc tcc
atc att gag ggt 2839Val Val Lys Ala Tyr Ala Leu Ser Ser Gly Ala Ser
Ile Ile Glu Gly 520 525 530cca ggc
ttc acc ggt ggc aac ctg ctg ttc ctg aag gag tcc tcg aac 2887Pro Gly
Phe Thr Gly Gly Asn Leu Leu Phe Leu Lys Glu Ser Ser Asn 535
540 545tcc atc gcc aag ttc aag gtc acc ctg aac tcc
gct gcc ttg ctg caa 2935Ser Ile Ala Lys Phe Lys Val Thr Leu Asn Ser
Ala Ala Leu Leu Gln550 555 560
565cgc tac cgc gtc cgc atc cgc tac gcc tcc acc acg aac ctg cgc ctg
2983Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser Thr Thr Asn Leu Arg Leu
570 575 580ttc gtc cag aac tcc
aac aat gac ttc ctg gtc atc tac atc aac aag 3031Phe Val Gln Asn Ser
Asn Asn Asp Phe Leu Val Ile Tyr Ile Asn Lys 585
590 595acc atg aac aag gac gat gac ctg acc tac cag acc
ttc gac ctc gcc 3079Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln Thr
Phe Asp Leu Ala 600 605 610acc acg
aac tcc aac atg ggc ttc tcg ggc gac aag aat gaa ctg atc 3127Thr Thr
Asn Ser Asn Met Gly Phe Ser Gly Asp Lys Asn Glu Leu Ile 615
620 625att ggt gct gag tcc ttc gtc tcc aat gaa aag
atc tac atc gac aag 3175Ile Gly Ala Glu Ser Phe Val Ser Asn Glu Lys
Ile Tyr Ile Asp Lys630 635 640
645atc gag ttc atc ccc gtc cag ctg tgataggaac tctgattgaa ttctgcatgc
3229Ile Glu Phe Ile Pro Val Gln Leu 650gtttggacgt
atgctcattc aggttggagc caatttggtt gatgtgtgtg cgagttcttg 3289cgagtctgat
gagacatctc tgtattgtgt ttctttcccc agtgttttct gtacttgtgt 3349aatcggctaa
tcgccaacag attcggcgat gaataaatga gaaataaatt gttctgattt 3409tgagtgcaaa
aaaaaaggaa ttagatctgt gtgtgttttt tggatccccg gggcggccgc
346924653PRTArtificial SequencePRT(1)..(653)Cry3Bb1 variant 11231mv2
24Met Ala Asn Pro Asn Asn Arg Ser Glu His Asp Thr Ile Lys Val Thr 1
5 10 15Pro Asn Ser Glu Leu Gln
Thr Asn His Asn Gln Tyr Pro Leu Ala Asp 20
25 30Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu
Phe Leu Arg 35 40 45Met Thr Glu
Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr Val Lys 50
55 60Asp Ala Val Gly Thr Gly Ile Ser Val Val Gly Gln
Ile Leu Gly Val 65 70 75
80Val Gly Val Pro Phe Ala Gly Ala Leu Thr Ser Phe Tyr Gln Ser Phe
85 90 95Leu Asn Thr Ile Trp
Pro Ser Asp Ala Asp Pro Trp Lys Ala Phe Met 100
105 110Ala Gln Val Glu Val Leu Ile Asp Lys Lys Ile Glu
Glu Tyr Ala Lys 115 120 125Ser Lys
Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn Asn Phe Glu Asp 130
135 140Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys Thr
Pro Leu Ser Leu Arg145 150 155
160Ser Lys Arg Ser Gln Asp Arg Ile Arg Glu Leu Phe Ser Gln Ala Glu
165 170 175Ser His Phe Arg
Asn Ser Met Pro Ser Phe Ala Val Ser Lys Phe Glu 180
185 190Val Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala
Asn Thr His Leu Leu 195 200 205Leu
Leu Lys Asp Ala Gln Val Phe Gly Glu Glu Trp Gly Tyr Ser Ser 210
215 220Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln
Leu Lys Leu Thr Gln Gln225 230 235
240Tyr Thr Asp His Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly
Leu 245 250 255Arg Gly Ser
Thr Tyr Asp Ala Trp Val Lys Phe Asn Arg Phe Arg Arg 260
265 270Glu Met Thr Leu Thr Val Leu Asp Leu Ile
Val Leu Phe Pro Phe Tyr 275 280
285Asp Ile Arg Leu Tyr Ser Lys Gly Val Lys Thr Glu Leu Thr Arg Asp 290
295 300Ile Phe Thr Asp Pro Ile Phe Leu
Leu Thr Thr Leu Gln Lys Tyr Gly305 310
315 320Pro Thr Phe Leu Ser Ile Glu Asn Ser Ile Arg Lys
Pro His Leu Phe 325 330
335Asp Tyr Leu Gln Gly Ile Glu Phe His Thr Arg Leu Arg Pro Gly Tyr
340 345 350Phe Gly Lys Asp Ser Phe
Asn Tyr Trp Ser Gly Asn Tyr Val Glu Thr 355 360
365Arg Pro Ser Ile Gly Ser Ser Lys Thr Ile Thr Ser Pro Phe
Tyr Gly 370 375 380Asp Lys Ser Thr Glu
Pro Val Gln Lys Leu Ser Phe Asp Gly Gln Lys385 390
395 400Val Tyr Arg Thr Ile Ala Asn Thr Asp Val
Ala Ala Trp Pro Asn Gly 405 410
415Lys Val Tyr Leu Gly Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp
420 425 430Gln Lys Asn Glu Thr
Ser Thr Gln Thr Tyr Asp Ser Lys Arg Asn Asn 435
440 445Gly His Val Ser Ala Gln Asp Ser Ile Asp Gln Leu
Pro Pro Glu Thr 450 455 460Thr Asp Glu
Pro Leu Glu Lys Ala Tyr Ser His Gln Leu Asn Tyr Ala465
470 475 480Glu Cys Phe Leu Met Gln Asp
Arg Arg Gly Thr Ile Pro Phe Phe Thr 485
490 495Trp Thr His Arg Ser Val Asp Phe Phe Asn Thr Ile
Asp Ala Glu Lys 500 505 510Ile
Thr Gln Leu Pro Val Val Lys Ala Tyr Ala Leu Ser Ser Gly Ala 515
520 525Ser Ile Ile Glu Gly Pro Gly Phe Thr
Gly Gly Asn Leu Leu Phe Leu 530 535
540Lys Glu Ser Ser Asn Ser Ile Ala Lys Phe Lys Val Thr Leu Asn Ser545
550 555 560Ala Ala Leu Leu
Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser Thr 565
570 575Thr Asn Leu Arg Leu Phe Val Gln Asn Ser
Asn Asn Asp Phe Leu Val 580 585
590Ile Tyr Ile Asn Lys Thr Met Asn Lys Asp Asp Asp Leu Thr Tyr Gln
595 600 605Thr Phe Asp Leu Ala Thr Thr
Asn Ser Asn Met Gly Phe Ser Gly Asp 610 615
620Lys Asn Glu Leu Ile Ile Gly Ala Glu Ser Phe Val Ser Asn Glu
Lys625 630 635 640Ile Tyr
Ile Asp Lys Ile Glu Phe Ile Pro Val Gln Leu 645
65025416DNAArtificial SequenceDescription of Artificial Sequence
non-naturally occurring nucleotide sequence encoding Zea mays
ribulose bis-phosphate carboxylase chloroplast targeting peptide
25ttctagagga tcagc atg gcg ccc acc gtg atg atg gcc tcg tcg gcc acc
51 Met Ala Pro Thr Val Met Met Ala Ser Ser Ala Thr
1 5 10gcc gtc gct ccg ttc ctg
ggg ctc aag tcc acc gcc agc ctc ccc gtc 99Ala Val Ala Pro Phe Leu
Gly Leu Lys Ser Thr Ala Ser Leu Pro Val 15 20
25gcc cgc cgc tcc tcc aga agc ctc ggc aac gtc agc aac ggc
gga agg 147Ala Arg Arg Ser Ser Arg Ser Leu Gly Asn Val Ser Asn Gly
Gly Arg 30 35 40atc cgg tgc atg cag
gtaacaaatg catcctagct agtagttctt tgcattgcag 202Ile Arg Cys Met Gln
45cagctgcagc tagcgagtta gtaataggaa gggaactgat gatccatgca tggactgatg
262tgtgttgccc atcccatccc atcccatttc ccaaacgaac cgaaaacacc gtactacgtg
322cag gtg tgg ccc tac ggc aac aag aag ttc gag acg ctg tcg tac ctg
370 Val Trp Pro Tyr Gly Asn Lys Lys Phe Glu Thr Leu Ser Tyr Leu 50
55 60ccg ccg ctg tcg acc ggc ggg cgc
atc cgc tgc atg cag gcc atg g 416Pro Pro Leu Ser Thr Gly Gly Arg
Ile Arg Cys Met Gln Ala Met 65 70
752679PRTArtificial SequencePRT(1)..(48)full length zea mays transit
peptide 26Met Ala Pro Thr Val Met Met Ala Ser Ser Ala Thr Ala Val Ala Pro
1 5 10 15Phe Leu Gly Leu
Lys Ser Thr Ala Ser Leu Pro Val Ala Arg Arg Ser 20
25 30Ser Arg Ser Leu Gly Asn Val Ser Asn Gly Gly
Arg Ile Arg Cys Met 35 40 45Gln
Val Trp Pro Tyr Gly Asn Lys Lys Phe Glu Thr Leu Ser Tyr Leu 50
55 60Pro Pro Leu Ser Thr Gly Gly Arg Ile Arg
Cys Met Gln Ala Met 65 70
752749PRTArtificial SequencePRT(1)..(49)Zea mays targeting peptide
sequence encoded 5' of the intronic sequence indicated in SEQID NO25
27Met Ala Pro Thr Val Met Met Ala Ser Ser Ala Thr Ala Val Ala Pro 1
5 10 15Phe Leu Gly Leu Lys Ser
Thr Ala Ser Leu Pro Val Ala Arg Arg Ser 20
25 30Ser Arg Ser Leu Gly Asn Val Ser Asn Gly Gly Arg Ile
Arg Cys Met 35 40
45Gln2830PRTArtificial SequencePRT(1)..(30)Zea mays targeting peptide
sequence encoded 3' of the intronic sequence indicated in SEQID NO25
28Val Trp Pro Tyr Gly Asn Lys Lys Phe Glu Thr Leu Ser Tyr Leu Pro 1
5 10 15Pro Leu Ser Thr Gly Gly
Arg Ile Arg Cys Met Gln Ala Met 20 25
3029202DNACauliflower mosaic virusPRT(1)..(30)a cauliflower
mosaic virus 35S promoter sequence, P-CaMV.35S 29gacgcacctg
acgtaaggga tgacgcacct gacgtaaggg atgacgcacc tgacgtaagg 60gatgacgcac
tcgagatccc catctccact gacgtaaggg atgacgcaca atcccactat 120ccttcgcaag
acccttcctc tatataagga agttcatttc atttggagag gacacgctga 180caagctagct
tggctgcagg ta
20230416DNAArtificial SequenceDescription of Artificial Sequence modified
cauliflower mosaic virus promoter AS4 30ttctagagga tcagcatggc
gcccaccgtg atgatggcct cgtcggccac cgccgtcgct 60ccgttcctgg ggctcaagtc
caccgccagc ctccccgtcg cccgccgctc ctccagaagc 120ctcggcaacg tcagcaacgg
cggaaggatc cggtgcatgc aggtaacaaa tgcatcctag 180ctagtagttc tttgcattgc
agcagctgca gctagcgagt tagtaatagg aagggaactg 240atgatccatg catggactga
tgtgtgttgc ccatcccatc ccatcccatt tcccaaacga 300accgaaaaca ccgtactacg
tgcaggtgtg gccctacggc aacaagaagt tcgagacgct 360gtcgtacctg ccgccgctgt
cgaccggcgg gcgcatccgc tgcatgcagg ccatgg 4163175DNATriticum
aestivum 31ctagaaccat cttccacaca ctcaagccac actattggag aacacacagg
gacaacacac 60cataagatcc aaggg
7532804DNAOryza sp. 32accgtcttcg gtacgcgctc actccgccct
ctgcctttgt tactgccacg tttctctgaa 60tgctctcttg tgtggtgatt gctgagagtg
gtttagctgg atctagaatt acactctgaa 120atcgtgttct gcctgtgctg attacttgcc
gtcctttgta gcagcaaaat atagggacat 180ggtagtacga aacgaagata gaacctacac
agcaatacga gaaatgtgta atttggtgct 240tagcggtatt tatttaagca catgttggtg
ttatagggca cttggattca gaagtttgct 300gttaatttag gcacaggctt catactacat
gggtcaatag tatagggatt catattatag 360gcgatactat aataatttgt tcgtctgcag
agcttattat ttgccaaaat tagatattcc 420tattctgttt ttgtttgtgt gctgttaaat
tgttaacgcc tgaaggaata aatataaatg 480acgaaatttt gatgtttatc tctgctcctt
tattgtgacc ataagtcaag atcagatgca 540cttgttttaa atattgttgt ctgaagaaat
aagtactgac agtattttga tgcattgatc 600tgcttgtttg ttgtaacaaa atttaaaaat
aaagagtttc ctttttgttg ctctccttac 660ctcctgatgg tatctagtat ctaccaactg
acactatatt gcttctcttt acatacgtat 720cttgctcgat gccttctccc tagtgttgac
cagtgttact cacatagtct ttgctcattt 780cattgtaatg cagataccaa gcgg
80433804DNAZea mays 33accgtcttcg
gtacgcgctc actccgccct ctgcctttgt tactgccacg tttctctgaa 60tgctctcttg
tgtggtgatt gctgagagtg gtttagctgg atctagaatt acactctgaa 120atcgtgttct
gcctgtgctg attacttgcc gtcctttgta gcagcaaaat atagggacat 180ggtagtacga
aacgaagata gaacctacac agcaatacga gaaatgtgta atttggtgct 240tagcggtatt
tatttaagca catgttggtg ttatagggca cttggattca gaagtttgct 300gttaatttag
gcacaggctt catactacat gggtcaatag tatagggatt catattatag 360gcgatactat
aataatttgt tcgtctgcag agcttattat ttgccaaaat tagatattcc 420tattctgttt
ttgtttgtgt gctgttaaat tgttaacgcc tgaaggaata aatataaatg 480acgaaatttt
gatgtttatc tctgctcctt tattgtgacc ataagtcaag atcagatgca 540cttgttttaa
atattgttgt ctgaagaaat aagtactgac agtattttga tgcattgatc 600tgcttgtttg
ttgtaacaaa atttaaaaat aaagagtttc ctttttgttg ctctccttac 660ctcctgatgg
tatctagtat ctaccaactg acactatatt gcttctcttt acatacgtat 720cttgctcgat
gccttctccc tagtgttgac cagtgttact cacatagtct ttgctcattt 780cattgtaatg
cagataccaa gcgg
80434257DNAAgrobacterium tumefaciens 34tcccgatcgt tcaaacattt ggcaataaag
tttcttaaga ttgaatcctg ttgccggtct 60tgcgatgatt atcatataat ttctgttgaa
ttacgttaag catgtaataa ttaacatgta 120atgcatgacg ttatttatga gatgggtttt
tatgattaga gtcccgcaat tatacattta 180atacgcgata gaaaacaaaa tatagcgcgc
aaactaggat aaattatcgc gcgcggtgtc 240atctatgtta ctagatc
25735234DNATriticum aestivum
35aattctgcat gcgtttggac gtatgctcat tcaggttgga gccaatttgg ttgatgtgtg
60tgcgagttct tgcgagtctg atgagacatc tctgtattgt gtttctttcc ccagtgtttt
120ctgtacttgt gtaatcggct aatcgccaac agattcggcg atgaataaat gagaaataaa
180ttgttctgat tttgagtgca aaaaaaaagg aattagatct gtgtgtgttt tttg
234363455DNAArtificial SequenceDescription of Artificial Sequence
expression cassette 36gcggccgcgt taacaagctt ctgacgtaag ggatgacgca
cctgacgtaa gggatgacgc 60acctgacgta agggatgacg cacctgacgt aagggatgac
gcactcgaga tccccatctc 120cactgacgta agggatgacg cacaatccca ctatccttcg
caagaccctt cctctatata 180aggaagttca tttcatttgg agaggacacg ctgacaagct
agcttggctg caggtagatc 240ctagaaccat cttccacaca ctcaagccac actattggag
aacacacagg gacaacacac 300cataagatcc aagggaggcc tccgccgccg ccggtaacca
ccccgcccct ctcctctttc 360tttctccgtt tttttttccg tctcggtctc gatctttggc
cttggtagtt tgggtgggcg 420agaggcggct tcgtgcgcgc ccagatcggt gcgcgggagg
ggcgggatct cgcggctggg 480gctctcgccg gcgtggatcc ggcccggatc tcgcggggaa
tggggctctc ggatgtagat 540ctgcgatccg ccgttgttgg gggagatgat ggggggttta
aaatttccgc cgtgctaaac 600aagatcagga agaggggaaa agggcactat ggtttatatt
tttatatatt tctgctgctt 660cgtcaggctt agatgtgcta gatctttctt tcttcttttt
gtgggtagaa tttgaatccc 720tcagcattgt tcatcggtag tttttctttt catgatttgt
gacaaatgca gcctcgtgcg 780gagctttttt gtaggtagaa gtgatcaacc tctagaggat
cagcatggcg cccaccgtga 840tgatggcctc gtcggccacc gccgtcgctc cgttcctggg
gctcaagtcc accgccagcc 900tccccgtcgc ccgccgctcc tccagaagcc tcggcaacgt
cagcaacggc ggaaggatcc 960ggtgcatgca ggtaacaaat gcatcctagc tagtagttct
ttgcattgca gcagctgcag 1020ctagcgagtt agtaatagga agggaactga tgatccatgc
atggactgat gtgtgttgcc 1080catcccatcc catcccattt cccaaacgaa ccgaaaacac
cgtactacgt gcaggtgtgg 1140ccctacggca acaagaagtt cgagacgctg tcgtacctgc
cgccgctgtc gaccggcggg 1200cgcatccgct gcatgcaggc c atg gca aac cct aac
aat cgt tcc gaa cac 1251 Met Ala Asn Pro Asn
Asn Arg Ser Glu His 1 5
10gac acc atc aag gtt act cca aac tct gag ttg caa act aat cac aac
1299Asp Thr Ile Lys Val Thr Pro Asn Ser Glu Leu Gln Thr Asn His Asn
15 20 25cag tac cca ttg gct
gac aat cct aac agt act ctt gag gaa ctt aac 1347Gln Tyr Pro Leu Ala
Asp Asn Pro Asn Ser Thr Leu Glu Glu Leu Asn 30
35 40tac aag gag ttt ctc cgg atg acc gaa gat agc tcc
act gag gtt ctc 1395Tyr Lys Glu Phe Leu Arg Met Thr Glu Asp Ser Ser
Thr Glu Val Leu 45 50 55gat aac
tct aca gtg aag gac gct gtt gga act ggc att agc gtt gtg 1443Asp Asn
Ser Thr Val Lys Asp Ala Val Gly Thr Gly Ile Ser Val Val 60
65 70gga cag att ctt gga gtg gtt ggt gtt cca ttc
gct gga gct ttg acc 1491Gly Gln Ile Leu Gly Val Val Gly Val Pro Phe
Ala Gly Ala Leu Thr 75 80 85
90agc ttc tac cag tcc ttt ctc aac acc atc tgg cct tca gat gct gat
1539Ser Phe Tyr Gln Ser Phe Leu Asn Thr Ile Trp Pro Ser Asp Ala Asp
95 100 105ccc tgg aag gct ttc
atg gcc caa gtg gaa gtc ttg atc gat aag aag 1587Pro Trp Lys Ala Phe
Met Ala Gln Val Glu Val Leu Ile Asp Lys Lys 110
115 120atc gaa gag tat gcc aag tct aaa gcc ttg gct gag
ttg caa ggt ttg 1635Ile Glu Glu Tyr Ala Lys Ser Lys Ala Leu Ala Glu
Leu Gln Gly Leu 125 130 135cag aac
aac ttc gag gat tac gtc aac gca ctc aac agc tgg aag aaa 1683Gln Asn
Asn Phe Glu Asp Tyr Val Asn Ala Leu Asn Ser Trp Lys Lys 140
145 150act ccc ttg agt ctc agg tct aag cgt tcc cag
gac cgt att cgt gaa 1731Thr Pro Leu Ser Leu Arg Ser Lys Arg Ser Gln
Asp Arg Ile Arg Glu155 160 165
170ctt ttc agc caa gcc gaa tcc cac ttc aga aac tcc atg cct agc ttt
1779Leu Phe Ser Gln Ala Glu Ser His Phe Arg Asn Ser Met Pro Ser Phe
175 180 185gcc gtt tct aag ttc
gag gtg ctc ttc ttg cca aca tac gca caa gct 1827Ala Val Ser Lys Phe
Glu Val Leu Phe Leu Pro Thr Tyr Ala Gln Ala 190
195 200gcc aac act cat ctc ttg ctt ctc aaa gac gct cag
gtg ttt ggt gag 1875Ala Asn Thr His Leu Leu Leu Leu Lys Asp Ala Gln
Val Phe Gly Glu 205 210 215gaa tgg
ggt tac tcc agt gaa gat gtt gcc gag ttc tac cgt agg cag 1923Glu Trp
Gly Tyr Ser Ser Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln 220
225 230ctc aag ttg act caa cag tac aca gac cac tgc
gtc aac tgg tac aac 1971Leu Lys Leu Thr Gln Gln Tyr Thr Asp His Cys
Val Asn Trp Tyr Asn235 240 245
250gtt ggg ctc aat ggt ctt aga gga tct acc tac gac gca tgg gtg aag
2019Val Gly Leu Asn Gly Leu Arg Gly Ser Thr Tyr Asp Ala Trp Val Lys
255 260 265ttc aac agg ttt cgt
aga gag atg acc ttg act gtg ctc gat ctt atc 2067Phe Asn Arg Phe Arg
Arg Glu Met Thr Leu Thr Val Leu Asp Leu Ile 270
275 280gtt ctc ttt cca ttc tac gac att cgt ctt tac tcc
aaa ggc gtt aag 2115Val Leu Phe Pro Phe Tyr Asp Ile Arg Leu Tyr Ser
Lys Gly Val Lys 285 290 295aca gag
ctg acc aga gac atc ttc acc gat ccc atc ttc cta ctt acg 2163Thr Glu
Leu Thr Arg Asp Ile Phe Thr Asp Pro Ile Phe Leu Leu Thr 300
305 310acc ctg cag aaa tac ggt cca act ttt ctc tcc
att gag aac agc atc 2211Thr Leu Gln Lys Tyr Gly Pro Thr Phe Leu Ser
Ile Glu Asn Ser Ile315 320 325
330agg aag cct cac ctc ttc gac tat ctg caa ggc att gag ttt cac acc
2259Arg Lys Pro His Leu Phe Asp Tyr Leu Gln Gly Ile Glu Phe His Thr
335 340 345agg ttg caa cct ggt
tac ttc ggt aag gat tcc ttc aac tac tgg agc 2307Arg Leu Gln Pro Gly
Tyr Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser 350
355 360gga aac tac gtt gaa acc aga cca tcc atc gga tct
agc aag acc atc 2355Gly Asn Tyr Val Glu Thr Arg Pro Ser Ile Gly Ser
Ser Lys Thr Ile 365 370 375act tct
cca ttc tac ggt gac aag agc act gag cca gtg cag aag ttg 2403Thr Ser
Pro Phe Tyr Gly Asp Lys Ser Thr Glu Pro Val Gln Lys Leu 380
385 390agc ttc gat ggg cag aag gtg tat aga acc atc
gcc aat acc gat gtt 2451Ser Phe Asp Gly Gln Lys Val Tyr Arg Thr Ile
Ala Asn Thr Asp Val395 400 405
410gca gct tgg cct aat ggc aag gtc tac ctt gga gtt act aaa gtg gac
2499Ala Ala Trp Pro Asn Gly Lys Val Tyr Leu Gly Val Thr Lys Val Asp
415 420 425ttc tcc caa tac gac
gat cag aag aac gag aca tct act caa acc tac 2547Phe Ser Gln Tyr Asp
Asp Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr 430
435 440gat agt aag agg aac aat ggc cat gtt tcc gca caa
gac tcc att gac 2595Asp Ser Lys Arg Asn Asn Gly His Val Ser Ala Gln
Asp Ser Ile Asp 445 450 455caa ctt
cca cct gaa acc act gat gaa cca ttg gag aag gct tac agt 2643Gln Leu
Pro Pro Glu Thr Thr Asp Glu Pro Leu Glu Lys Ala Tyr Ser 460
465 470cac caa ctt aac tac gcc gaa tgc ttt ctc atg
caa gac agg cgt ggc 2691His Gln Leu Asn Tyr Ala Glu Cys Phe Leu Met
Gln Asp Arg Arg Gly475 480 485
490acc att ccg ttc ttt aca tgg act cac agg tct gtc gac ttc ttt aac
2739Thr Ile Pro Phe Phe Thr Trp Thr His Arg Ser Val Asp Phe Phe Asn
495 500 505act atc gac gct gag
aag att acc caa ctt ccc gtg gtc aag gct tat 2787Thr Ile Asp Ala Glu
Lys Ile Thr Gln Leu Pro Val Val Lys Ala Tyr 510
515 520gcc ttg tcc agc gga gct tcc atc att gaa ggt cca
ggc ttc acc ggt 2835Ala Leu Ser Ser Gly Ala Ser Ile Ile Glu Gly Pro
Gly Phe Thr Gly 525 530 535ggc aac
ttg ctc ttc ctt aag gag tcc agc aac tcc atc gcc aag ttc 2883Gly Asn
Leu Leu Phe Leu Lys Glu Ser Ser Asn Ser Ile Ala Lys Phe 540
545 550aaa gtg aca ctt aac tca gca gcc ttg ctc caa
cgt tac agg gtt cgt 2931Lys Val Thr Leu Asn Ser Ala Ala Leu Leu Gln
Arg Tyr Arg Val Arg555 560 565
570atc aga tac gca agc act acc aat ctt cgc ctc ttt gtc cag aac agc
2979Ile Arg Tyr Ala Ser Thr Thr Asn Leu Arg Leu Phe Val Gln Asn Ser
575 580 585aac aat gat ttc ctt
gtc atc tac atc aac aag act atg aac aaa gac 3027Asn Asn Asp Phe Leu
Val Ile Tyr Ile Asn Lys Thr Met Asn Lys Asp 590
595 600gat gac ctc acc tac caa aca ttc gat ctt gcc act
acc aat agt aac 3075Asp Asp Leu Thr Tyr Gln Thr Phe Asp Leu Ala Thr
Thr Asn Ser Asn 605 610 615atg gga
ttc tct ggt gac aag aac gag ctg atc ata ggt gct gag agc 3123Met Gly
Phe Ser Gly Asp Lys Asn Glu Leu Ile Ile Gly Ala Glu Ser 620
625 630ttt gtc tct aat gag aag att tac ata gac aag
atc gag ttc att cca 3171Phe Val Ser Asn Glu Lys Ile Tyr Ile Asp Lys
Ile Glu Phe Ile Pro635 640 645
650gtt caa ctc taatagatcc cccgggctgc aggaattctg catgcgtttg
3220Val Gln Leugacgtatgct cattcaggtt ggagccaatt tggttgatgt gtgtgcgagt
tcttgcgagt 3280ctgatgagac atctctgtat tgtgtttctt tccccagtgt tttctgtact
tgtgtaatcg 3340gctaatcgcc aacagattcg gcgatgaata aatgagaaat aaattgttct
gattttgagt 3400gcaaaaaaaa aggaattaga tctgtgtgtg ttttttggat ccccggggcg
gccgc 345537653PRTArtificial SequencePRT(1)..(653)variant Cry3BB1
coding sequence encoding v11231 37Met Ala Asn Pro Asn Asn Arg Ser
Glu His Asp Thr Ile Lys Val Thr 1 5 10
15Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu
Ala Asp 20 25 30Asn Pro Asn
Ser Thr Leu Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35
40 45Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp
Asn Ser Thr Val Lys 50 55 60Asp Ala
Val Gly Thr Gly Ile Ser Val Val Gly Gln Ile Leu Gly Val 65
70 75 80Val Gly Val Pro Phe Ala Gly
Ala Leu Thr Ser Phe Tyr Gln Ser Phe 85
90 95Leu Asn Thr Ile Trp Pro Ser Asp Ala Asp Pro Trp Lys
Ala Phe Met 100 105 110Ala Gln
Val Glu Val Leu Ile Asp Lys Lys Ile Glu Glu Tyr Ala Lys 115
120 125Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu
Gln Asn Asn Phe Glu Asp 130 135 140Tyr
Val Asn Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg145
150 155 160Ser Lys Arg Ser Gln Asp
Arg Ile Arg Glu Leu Phe Ser Gln Ala Glu 165
170 175Ser His Phe Arg Asn Ser Met Pro Ser Phe Ala Val
Ser Lys Phe Glu 180 185 190Val
Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His Leu Leu 195
200 205Leu Leu Lys Asp Ala Gln Val Phe Gly
Glu Glu Trp Gly Tyr Ser Ser 210 215
220Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln225
230 235 240Tyr Thr Asp His
Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu 245
250 255Arg Gly Ser Thr Tyr Asp Ala Trp Val Lys
Phe Asn Arg Phe Arg Arg 260 265
270Glu Met Thr Leu Thr Val Leu Asp Leu Ile Val Leu Phe Pro Phe Tyr
275 280 285Asp Ile Arg Leu Tyr Ser Lys
Gly Val Lys Thr Glu Leu Thr Arg Asp 290 295
300Ile Phe Thr Asp Pro Ile Phe Leu Leu Thr Thr Leu Gln Lys Tyr
Gly305 310 315 320Pro Thr
Phe Leu Ser Ile Glu Asn Ser Ile Arg Lys Pro His Leu Phe
325 330 335Asp Tyr Leu Gln Gly Ile Glu
Phe His Thr Arg Leu Gln Pro Gly Tyr 340 345
350Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val
Glu Thr 355 360 365Arg Pro Ser Ile
Gly Ser Ser Lys Thr Ile Thr Ser Pro Phe Tyr Gly 370
375 380Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe
Asp Gly Gln Lys385 390 395
400Val Tyr Arg Thr Ile Ala Asn Thr Asp Val Ala Ala Trp Pro Asn Gly
405 410 415Lys Val Tyr Leu Gly
Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420
425 430Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser
Lys Arg Asn Asn 435 440 445Gly His
Val Ser Ala Gln Asp Ser Ile Asp Gln Leu Pro Pro Glu Thr 450
455 460Thr Asp Glu Pro Leu Glu Lys Ala Tyr Ser His
Gln Leu Asn Tyr Ala465 470 475
480Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr Ile Pro Phe Phe Thr
485 490 495Trp Thr His Arg
Ser Val Asp Phe Phe Asn Thr Ile Asp Ala Glu Lys 500
505 510Ile Thr Gln Leu Pro Val Val Lys Ala Tyr Ala
Leu Ser Ser Gly Ala 515 520 525Ser
Ile Ile Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu 530
535 540Lys Glu Ser Ser Asn Ser Ile Ala Lys Phe
Lys Val Thr Leu Asn Ser545 550 555
560Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser
Thr 565 570 575Thr Asn Leu
Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val 580
585 590Ile Tyr Ile Asn Lys Thr Met Asn Lys Asp
Asp Asp Leu Thr Tyr Gln 595 600
605Thr Phe Asp Leu Ala Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp 610
615 620Lys Asn Glu Leu Ile Ile Gly Ala
Glu Ser Phe Val Ser Asn Glu Lys625 630
635 640Ile Tyr Ile Asp Lys Ile Glu Phe Ile Pro Val Gln
Leu 645 650383044DNAArtificial
SequenceDescription of Artificial Sequence expression cassette
38gcggccgcgt taacaagctt ctgacgtaag ggatgacgca cctgacgtaa gggatgacgc
60acctgacgta agggatgacg cacctgacgt aagggatgac gcactcgaga tccccatctc
120cactgacgta agggatgacg cacaatccca ctatccttcg caagaccctt cctctatata
180aggaagttca tttcatttgg agaggacacg ctgacaagct agcttggctg caggtagatc
240ctagaaccat cttccacaca ctcaagccac actattggag aacacacagg gacaacacac
300cataagatcc aagggaggcc tccgccgccg ccggtaacca ccccgcccct ctcctctttc
360tttctccgtt tttttttccg tctcggtctc gatctttggc cttggtagtt tgggtgggcg
420agaggcggct tcgtgcgcgc ccagatcggt gcgcgggagg ggcgggatct cgcggctggg
480gctctcgccg gcgtggatcc ggcccggatc tcgcggggaa tggggctctc ggatgtagat
540ctgcgatccg ccgttgttgg gggagatgat ggggggttta aaatttccgc cgtgctaaac
600aagatcagga agaggggaaa agggcactat ggtttatatt tttatatatt tctgctgctt
660cgtcaggctt agatgtgcta gatctttctt tcttcttttt gtgggtagaa tttgaatccc
720tcagcattgt tcatcggtag tttttctttt catgatttgt gacaaatgca gcctcgtgcg
780gagctttttt gtaggtagaa gtgatcaacc atg gca aac cct aac aat cgt tcc
834 Met Ala Asn Pro Asn Asn Arg Ser
1 5gaa cac gac acc atc aag gtt
act cca aac tct gag ttg caa act aat 882Glu His Asp Thr Ile Lys Val
Thr Pro Asn Ser Glu Leu Gln Thr Asn 10 15
20cac aac cag tac cca ttg gct gac aat cct aac agt act ctt gag gaa
930His Asn Gln Tyr Pro Leu Ala Asp Asn Pro Asn Ser Thr Leu Glu Glu 25
30 35 40ctt aac tac aag
gag ttt ctc cgg atg acc gaa gat agc tcc act gag 978Leu Asn Tyr Lys
Glu Phe Leu Arg Met Thr Glu Asp Ser Ser Thr Glu 45
50 55gtt ctc gat aac tct aca gtg aag gac gct
gtt gga act ggc att agc 1026Val Leu Asp Asn Ser Thr Val Lys Asp Ala
Val Gly Thr Gly Ile Ser 60 65
70gtt gtg gga cag att ctt gga gtg gtt ggt gtt cca ttc gct gga gct
1074Val Val Gly Gln Ile Leu Gly Val Val Gly Val Pro Phe Ala Gly Ala
75 80 85ttg acc agc ttc tac cag tcc
ttt ctc aac acc atc tgg cct tca gat 1122Leu Thr Ser Phe Tyr Gln Ser
Phe Leu Asn Thr Ile Trp Pro Ser Asp 90 95
100gct gat ccc tgg aag gct ttc atg gcc caa gtg gaa gtc ttg atc gat
1170Ala Asp Pro Trp Lys Ala Phe Met Ala Gln Val Glu Val Leu Ile Asp105
110 115 120aag aag atc gaa
gag tat gcc aag tct aaa gcc ttg gct gag ttg caa 1218Lys Lys Ile Glu
Glu Tyr Ala Lys Ser Lys Ala Leu Ala Glu Leu Gln 125
130 135ggt ttg cag aac aac ttc gag gat tac gtc
aac gca ctc aac agc tgg 1266Gly Leu Gln Asn Asn Phe Glu Asp Tyr Val
Asn Ala Leu Asn Ser Trp 140 145
150aag aaa act ccc ttg agt ctc agg tct aag cgt tcc cag gac cgt att
1314Lys Lys Thr Pro Leu Ser Leu Arg Ser Lys Arg Ser Gln Asp Arg Ile
155 160 165cgt gaa ctt ttc agc caa gcc
gaa tcc cac ttc aga aac tcc atg cct 1362Arg Glu Leu Phe Ser Gln Ala
Glu Ser His Phe Arg Asn Ser Met Pro 170 175
180agc ttt gcc gtt tct aag ttc gag gtg ctc ttc ttg cca aca tac gca
1410Ser Phe Ala Val Ser Lys Phe Glu Val Leu Phe Leu Pro Thr Tyr Ala185
190 195 200caa gct gcc aac
act cat ctc ttg ctt ctc aaa gac gct cag gtg ttt 1458Gln Ala Ala Asn
Thr His Leu Leu Leu Leu Lys Asp Ala Gln Val Phe 205
210 215ggt gag gaa tgg ggt tac tcc agt gaa gat
gtt gcc gag ttc tac cgt 1506Gly Glu Glu Trp Gly Tyr Ser Ser Glu Asp
Val Ala Glu Phe Tyr Arg 220 225
230agg cag ctc aag ttg act caa cag tac aca gac cac tgc gtc aac tgg
1554Arg Gln Leu Lys Leu Thr Gln Gln Tyr Thr Asp His Cys Val Asn Trp
235 240 245tac aac gtt ggg ctc aat ggt
ctt aga gga tct acc tac gac gca tgg 1602Tyr Asn Val Gly Leu Asn Gly
Leu Arg Gly Ser Thr Tyr Asp Ala Trp 250 255
260gtg aag ttc aac agg ttt cgt aga gag atg acc ttg act gtg ctc gat
1650Val Lys Phe Asn Arg Phe Arg Arg Glu Met Thr Leu Thr Val Leu Asp265
270 275 280ctt atc gtt ctc
ttt cca ttc tac gac att cgt ctt tac tcc aaa ggc 1698Leu Ile Val Leu
Phe Pro Phe Tyr Asp Ile Arg Leu Tyr Ser Lys Gly 285
290 295gtt aag aca gag ctg acc aga gac atc ttc
acc gat ccc atc ttc cta 1746Val Lys Thr Glu Leu Thr Arg Asp Ile Phe
Thr Asp Pro Ile Phe Leu 300 305
310ctt acg acc ctg cag aaa tac ggt cca act ttt ctc tcc att gag aac
1794Leu Thr Thr Leu Gln Lys Tyr Gly Pro Thr Phe Leu Ser Ile Glu Asn
315 320 325agc atc agg aag cct cac ctc
ttc gac tat ctg caa ggc att gag ttt 1842Ser Ile Arg Lys Pro His Leu
Phe Asp Tyr Leu Gln Gly Ile Glu Phe 330 335
340cac acc agg ttg caa cct ggt tac ttc ggt aag gat tcc ttc aac tac
1890His Thr Arg Leu Gln Pro Gly Tyr Phe Gly Lys Asp Ser Phe Asn Tyr345
350 355 360tgg agc gga aac
tac gtt gaa acc aga cca tcc atc gga tct agc aag 1938Trp Ser Gly Asn
Tyr Val Glu Thr Arg Pro Ser Ile Gly Ser Ser Lys 365
370 375acc atc act tct cca ttc tac ggt gac aag
agc act gag cca gtg cag 1986Thr Ile Thr Ser Pro Phe Tyr Gly Asp Lys
Ser Thr Glu Pro Val Gln 380 385
390aag ttg agc ttc gat ggg cag aag gtg tat aga acc atc gcc aat acc
2034Lys Leu Ser Phe Asp Gly Gln Lys Val Tyr Arg Thr Ile Ala Asn Thr
395 400 405gat gtt gca gct tgg cct aat
ggc aag gtc tac ctt gga gtt act aaa 2082Asp Val Ala Ala Trp Pro Asn
Gly Lys Val Tyr Leu Gly Val Thr Lys 410 415
420gtg gac ttc tcc caa tac gac gat cag aag aac gag aca tct act caa
2130Val Asp Phe Ser Gln Tyr Asp Asp Gln Lys Asn Glu Thr Ser Thr Gln425
430 435 440acc tac gat agt
aag agg aac aat ggc cat gtt tcc gca caa gac tcc 2178Thr Tyr Asp Ser
Lys Arg Asn Asn Gly His Val Ser Ala Gln Asp Ser 445
450 455att gac caa ctt cca cct gaa acc act gat
gaa cca ttg gag aag gct 2226Ile Asp Gln Leu Pro Pro Glu Thr Thr Asp
Glu Pro Leu Glu Lys Ala 460 465
470tac agt cac caa ctt aac tac gcc gaa tgc ttt ctc atg caa gac agg
2274Tyr Ser His Gln Leu Asn Tyr Ala Glu Cys Phe Leu Met Gln Asp Arg
475 480 485cgt ggc acc att ccg ttc ttt
aca tgg act cac agg tct gtc gac ttc 2322Arg Gly Thr Ile Pro Phe Phe
Thr Trp Thr His Arg Ser Val Asp Phe 490 495
500ttt aac act atc gac gct gag aag att acc caa ctt ccc gtg gtc aag
2370Phe Asn Thr Ile Asp Ala Glu Lys Ile Thr Gln Leu Pro Val Val Lys505
510 515 520gct tat gcc ttg
tcc agc gga gct tcc atc att gaa ggt cca ggc ttc 2418Ala Tyr Ala Leu
Ser Ser Gly Ala Ser Ile Ile Glu Gly Pro Gly Phe 525
530 535acc ggt ggc aac ttg ctc ttc ctt aag gag
tcc agc aac tcc atc gcc 2466Thr Gly Gly Asn Leu Leu Phe Leu Lys Glu
Ser Ser Asn Ser Ile Ala 540 545
550aag ttc aaa gtg aca ctt aac tca gca gcc ttg ctc caa cgt tac agg
2514Lys Phe Lys Val Thr Leu Asn Ser Ala Ala Leu Leu Gln Arg Tyr Arg
555 560 565gtt cgt atc aga tac gca agc
act acc aat ctt cgc ctc ttt gtc cag 2562Val Arg Ile Arg Tyr Ala Ser
Thr Thr Asn Leu Arg Leu Phe Val Gln 570 575
580aac agc aac aat gat ttc ctt gtc atc tac atc aac aag act atg aac
2610Asn Ser Asn Asn Asp Phe Leu Val Ile Tyr Ile Asn Lys Thr Met Asn585
590 595 600aaa gac gat gac
ctc acc tac caa aca ttc gat ctt gcc act acc aat 2658Lys Asp Asp Asp
Leu Thr Tyr Gln Thr Phe Asp Leu Ala Thr Thr Asn 605
610 615agt aac atg gga ttc tct ggt gac aag aac
gag ctg atc ata ggt gct 2706Ser Asn Met Gly Phe Ser Gly Asp Lys Asn
Glu Leu Ile Ile Gly Ala 620 625
630gag agc ttt gtc tct aat gag aag att tac ata gac aag atc gag ttc
2754Glu Ser Phe Val Ser Asn Glu Lys Ile Tyr Ile Asp Lys Ile Glu Phe
635 640 645att cca gtt caa ctc
taatagatcc cccgggctgc aggaattctg catgcgtttg 2809Ile Pro Val Gln Leu
650gacgtatgct cattcaggtt ggagccaatt tggttgatgt gtgtgcgagt tcttgcgagt
2869ctgatgagac atctctgtat tgtgtttctt tccccagtgt tttctgtact tgtgtaatcg
2929gctaatcgcc aacagattcg gcgatgaata aatgagaaat aaattgttct gattttgagt
2989gcaaaaaaaa aggaattaga tctgtgtgtg ttttttggat ccccggggcg gccgc
304439653PRTArtificial SequencePRT(1)..(653)variant Cry3Bb1 coding
sequence encoding v11231 39Met Ala Asn Pro Asn Asn Arg Ser Glu His Asp
Thr Ile Lys Val Thr 1 5 10
15Pro Asn Ser Glu Leu Gln Thr Asn His Asn Gln Tyr Pro Leu Ala Asp
20 25 30Asn Pro Asn Ser Thr Leu
Glu Glu Leu Asn Tyr Lys Glu Phe Leu Arg 35 40
45Met Thr Glu Asp Ser Ser Thr Glu Val Leu Asp Asn Ser Thr
Val Lys 50 55 60Asp Ala Val Gly Thr
Gly Ile Ser Val Val Gly Gln Ile Leu Gly Val 65 70
75 80Val Gly Val Pro Phe Ala Gly Ala Leu Thr
Ser Phe Tyr Gln Ser Phe 85 90
95Leu Asn Thr Ile Trp Pro Ser Asp Ala Asp Pro Trp Lys Ala Phe Met
100 105 110Ala Gln Val Glu Val
Leu Ile Asp Lys Lys Ile Glu Glu Tyr Ala Lys 115
120 125Ser Lys Ala Leu Ala Glu Leu Gln Gly Leu Gln Asn
Asn Phe Glu Asp 130 135 140Tyr Val Asn
Ala Leu Asn Ser Trp Lys Lys Thr Pro Leu Ser Leu Arg145
150 155 160Ser Lys Arg Ser Gln Asp Arg
Ile Arg Glu Leu Phe Ser Gln Ala Glu 165
170 175Ser His Phe Arg Asn Ser Met Pro Ser Phe Ala Val
Ser Lys Phe Glu 180 185 190Val
Leu Phe Leu Pro Thr Tyr Ala Gln Ala Ala Asn Thr His Leu Leu 195
200 205Leu Leu Lys Asp Ala Gln Val Phe Gly
Glu Glu Trp Gly Tyr Ser Ser 210 215
220Glu Asp Val Ala Glu Phe Tyr Arg Arg Gln Leu Lys Leu Thr Gln Gln225
230 235 240Tyr Thr Asp His
Cys Val Asn Trp Tyr Asn Val Gly Leu Asn Gly Leu 245
250 255Arg Gly Ser Thr Tyr Asp Ala Trp Val Lys
Phe Asn Arg Phe Arg Arg 260 265
270Glu Met Thr Leu Thr Val Leu Asp Leu Ile Val Leu Phe Pro Phe Tyr
275 280 285Asp Ile Arg Leu Tyr Ser Lys
Gly Val Lys Thr Glu Leu Thr Arg Asp 290 295
300Ile Phe Thr Asp Pro Ile Phe Leu Leu Thr Thr Leu Gln Lys Tyr
Gly305 310 315 320Pro Thr
Phe Leu Ser Ile Glu Asn Ser Ile Arg Lys Pro His Leu Phe
325 330 335Asp Tyr Leu Gln Gly Ile Glu
Phe His Thr Arg Leu Gln Pro Gly Tyr 340 345
350Phe Gly Lys Asp Ser Phe Asn Tyr Trp Ser Gly Asn Tyr Val
Glu Thr 355 360 365Arg Pro Ser Ile
Gly Ser Ser Lys Thr Ile Thr Ser Pro Phe Tyr Gly 370
375 380Asp Lys Ser Thr Glu Pro Val Gln Lys Leu Ser Phe
Asp Gly Gln Lys385 390 395
400Val Tyr Arg Thr Ile Ala Asn Thr Asp Val Ala Ala Trp Pro Asn Gly
405 410 415Lys Val Tyr Leu Gly
Val Thr Lys Val Asp Phe Ser Gln Tyr Asp Asp 420
425 430Gln Lys Asn Glu Thr Ser Thr Gln Thr Tyr Asp Ser
Lys Arg Asn Asn 435 440 445Gly His
Val Ser Ala Gln Asp Ser Ile Asp Gln Leu Pro Pro Glu Thr 450
455 460Thr Asp Glu Pro Leu Glu Lys Ala Tyr Ser His
Gln Leu Asn Tyr Ala465 470 475
480Glu Cys Phe Leu Met Gln Asp Arg Arg Gly Thr Ile Pro Phe Phe Thr
485 490 495Trp Thr His Arg
Ser Val Asp Phe Phe Asn Thr Ile Asp Ala Glu Lys 500
505 510Ile Thr Gln Leu Pro Val Val Lys Ala Tyr Ala
Leu Ser Ser Gly Ala 515 520 525Ser
Ile Ile Glu Gly Pro Gly Phe Thr Gly Gly Asn Leu Leu Phe Leu 530
535 540Lys Glu Ser Ser Asn Ser Ile Ala Lys Phe
Lys Val Thr Leu Asn Ser545 550 555
560Ala Ala Leu Leu Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser
Thr 565 570 575Thr Asn Leu
Arg Leu Phe Val Gln Asn Ser Asn Asn Asp Phe Leu Val 580
585 590Ile Tyr Ile Asn Lys Thr Met Asn Lys Asp
Asp Asp Leu Thr Tyr Gln 595 600
605Thr Phe Asp Leu Ala Thr Thr Asn Ser Asn Met Gly Phe Ser Gly Asp 610
615 620Lys Asn Glu Leu Ile Ile Gly Ala
Glu Ser Phe Val Ser Asn Glu Lys625 630
635 640Ile Tyr Ile Asp Lys Ile Glu Phe Ile Pro Val Gln
Leu 645 6504032DNAArtificial
SequenceDescription of Artificial Sequence synthetic oligonucleotide
40taggcctcca tccatggcaa accctaacaa tc
324142DNAArtificial SequenceDescription of Artificial Sequence synthetic
oligonucleotide 41tcccatcttc ctacttagca ccctgcagaa atacggtcca ac
424228DNAArtificial SequenceDescription of Artificial
Sequence synthetic oligonucleotide 42gacctcacct accaaacatt cgatcttg
284325DNAArtificial
SequenceDescription of Artificial Sequence synthetic oligonucleotide
43cgagttctac cgtaggcagc tcaag
25
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20090290275 | Fault Protection System and Method for an Electrical Power Distribution System |
20090290274 | REMOVABLE MEMORY CARD |
20090290273 | LIGHT-EMITTING DIODE PACKAGE HAVING ELECTROSTATIC DISCHARGE PROTECTION FUNCTION AND METHOD OF FABRICATING THE SAME |
20090290270 | OVERLOAD CONTROL OF AN ELECTRIC POWER GENERATION SYSTEM WITH UNKNOWN AVAILABILITY OF MECHANICAL POWER CAPACITY |
20090290269 | Power converter |