|
Frequently Asked Questions (FAQ) for
bionet.info-theory Biological Information Theory and Chowder Society See reader questions & answers on this topic! - Help others by sharing your knowledge
version = 2.20 of bionet.info-theory.faq.html 1998 October 8
http://www-lecb.ncifcrf.gov/~toms/bionet.info-theory.faq.html
------------------------------------------------------------------------
Summary:
This is the Frequently Asked Questions monthly posting for BITCS. The news
group bionet.info-theory is a forum for discussing information theory in
biology and for tossing food for thought around. Other interesting
mathematical problems in biology are also welcome, as we will try our best
to take the log of them, so as to convert them into information theory
problems.
*** NEWCOMERS PLEASE NOTE:
Although the name of this group, bionet.info-theory has the word "info" in
it, this newsgroup is NOT an appropriate forum for persons seeking
information about general questions related to biology or medicine! This
newsgroup is devoted to DISCUSSIONS ABOUT BIOLOGICAL APPLICATIONS OF
INFORMATION THEORY, principally referring to Shannon's theory of
information, although we also discuss the mathematical and physical meaning
of entropy, alternative definitions of information, and related fundamental
issues in information theory and biology.
------------------------------------------------------------------------
* Questions about The BITCS, the newsgroup, and this FAQ
o What is The Biological Information Theory and Chowder Society?
o How Do I obtain bionet.info-theory BY EMAIL?
o Where Did I Get This FAQ File Originally?
o What is the IP number of the FAQ archive?
o Where Are the Bionet Archives?
o Are There Other Archives?
o I Posted But Nothing Happened?!?
o What is an Appropriate Posting?
o What Can I Do About Inappropriate Postings?
o Should I send private email to someone to respond to a posting or
to ask a question?
o What is the official word on copyright of this FAQ?
o Who Takes Care of This Group?
o What Kind of Questions Are Appropriate For Discussion?
o When and Where are Meetings?
o Acknowledgments
* Questions about Information Theory
o What is Information Theory?
o Is There a Quick Introduction to Information Theory Somewhere?
o I'm Confused: How Could Information Equal Entropy?
o How Can I Learn More About Information Theory and Biology?
References
+ REFERENCES - General
+ REFERENCES - Information Theory
+ REFERENCES - Jaynes
+ REFERENCES - Schneider
+ REFERENCES - Yockey
+ REFERENCES - Adleman and papers related to molecular
computation
+ REFERENCES - Gad Yagil and papers related to Algorithmic
Information Theory (AIT) or Algorithmic Complexity [new]
+ REFERENCES - Chris Hillman and papers related to entropy
measures [new]
o Will Authors Send Me Papers?
o Where Can I Get BIG Coins?
o Are there other organizations for information theory?
o What are Sequence Logos?
+ How Do I find Sequence Logos on the Web?
+ Is There a Shell Script for Making Sequence Logos?
+ Is There a World Wide Web Page for Making Sequence Logos?
------------------------------------------------------------------------
What is The Biological Information Theory and Chowder Society?
The Biological Information Theory and Chowder Society (BITCS) is a group of
scientists interested in the biological applications of information theory
(thus the "BIT") who meet informally for dinner (thus the "CS") from time to
time in the Washington, DC, area. At our dinners we have only one rule ---
food fights are discouraged.
The guys who started this thing did it because we weren't certain we
understood the biological implications of information theory. Some of us are
more comfortable with the mathematical machinery and assemble biological
systems into grand canonical ensembles whether they want to be there or not;
and some of us think they understand what the biological systems are doing
but can't take a log to base 2. What we try to do is pry from one another
the bits of knowledge that will help us understand what's going on.
Some of the topics up for discussion in our group are:
* biological applications of information theory
* biochemical molecular machines and computers
* computer methods for recognition of molecular structure and function
* database organization for biomolecular information
* nanotechnology
* the limits of computation
* "dissipation-less"(?) computation
* Maxwell's demon
* anecdotes and humor about all these topics
* methods and theories of molecular computation
* macroscopic versus microscopic thermodynamics
A few relevant papers are given in the references.
The group started when Tom Schneider was introduced to John Spouge in 1988.
Tom bounced his ideas about molecular machines off John, and John kept
finding flaws. Tom would go away rather unhappily for a month and then find
a solution. But John was always one step ahead... (and still is, on last
account.) Tom gave a talk about molecular machines at the Lambda Lunch
meeting on the Bethesda NIH campus, and John introduced John (Steve)
Garavelli. We all got together with Peter Basser for dinner once in a while
to talk about information theory. Steve brought in one of the first people
to apply information theory to biology, Hubert Yockey. Steve Garavelli
dubbed the group the "Biological Information Theory and Chowder Society",
which it is still called. We are known sometimes as 'chowderheads', and talk
about food fights, but so far have only had electronic food fights! We hold
dinners in Bethesda, Maryland on random occasions.
When our informal mailing list became difficult to handle, we petitioned to
start a bionet news group. We have held roaring discussions and look forward
to more, and everyone is welcome to join. You can look at some of the
ancient discussions in the bionet archives. If you are uncertain about
something, quit lurking and ask on the net. It may well be that what
bothered you is the key to a new piece of information theory in biology.
(The major advances so far have been by things that REALLY bugged people.)
We will also announce when and where our (irregular) eatings are and you are
welcome to join if the travel is not too far. John Spouge usually makes the
arrangements. If you would like to give a talk to the group, contact us to
make arrangements. (Our addresses are below.)
------------------------------------------------------------------------
How Do I obtain bionet.info-theory BY EMAIL?
If you have access to USENET news YOU DO NOT NEED AN E-MAIL SUBSCRIPTION!!
We strongly encourage all interested users to explore getting USENET news at
your site. It's MUCH easier on you than an e-mail subscription! Please
consult your systems manager or contact biosci-help@net.bio.net for
assistance if needed.
The BIOSCI (email) name for the forum is BIO-INFO.
Depending on where you are, you have to do different things to subscribe or
be removed from the email subscription list:
SUBSCRIBING / UNSUBSCRIBING
North or South America or Pacific Rim:
Using the computer account in which you want to receive mail messages,
please send an email message to the e-mail server at
biosci-server@net.bio.net
Leave the Subject: line blank. In the body of the message include the line
subscribe bio-info
to add yourself to the mailing list or
unsubscribe bio-info
to cancel an existing subscription. If you need personal subscription
assistance, please contact biosci-help@net.bio.net
Europe, Africa, and Central Asia:
Send a email message to the person at biosci@daresbury.ac.uk requesting a
subscription or removal from the BIO-INFO forum.
SENDING OUT POSTINGS
Thereafter, address email messages for this forum to one of:
North or South America or Pacific Rim:
bio-info@net.bio.net
Europe, Africa, and Central Asia:
bio-info@daresbury.ac.uk
You can post to either of the above address if you want. We only request
that you sign up at your local node in order to optimize the use of the
network resources for message distribution.
Do not send subscription requests to any of these addresses, or you will
have sent it to everybody on the planet (to your great embarrassment, and we
will drub you with food cake)! Let me say that again: please do not post
requests for subscription or being removed from the list to the list itself,
that takes up bandwidth all over the world!
If you have problems, contact the subscription site manager who you signed
up with. If your problem is not resolved, please contact
biosci-help@net.bio.net
DO NOT CONTACT TOM SCHNEIDER FOR SUBSCRIPTIONS OR UNSUBSCRIBING!
This is so complicated! It would be a lot easier for you to use a news
reader!
------------------------------------------------------------------------
Where Did I Get This FAQ File Originally?
The latest flatfile version of this FAQ is stored in the anonymous ftp
archive ftp.ncifcrf.gov in pub/delila under the name
"bionet.info-theory.faq". The URL is:
ftp://ftp.ncifcrf.gov/pub/delila/
The hypertext version is also available from
http://www-lecb.ncifcrf.gov/~toms/bionet.info-theory.faq.html
This file is posted monthly on news.answers and bionet.info-theory.
Please send questions and comments to: Tom Schneider (toms@ncifcrf.gov).
------------------------------------------------------------------------
What is the IP number of the FAQ archive?
For ftp.ncifcrf.gov you can use 129.43.1.11
------------------------------------------------------------------------
Where Are the Bionet Archives?
The hypertext archives for this newsgroup are at:
http://www.bio.net/hypermail/BIOLOGICAL-INFORMATION-THEORY/
The entire collection of BIOSCI/bionet messages from inception are available
via the biosci.src WAIS source at net.bio.net. Contact
biosci-help@net.bio.net for further help with accessing this WAIS source.
------------------------------------------------------------------------
Are There Other Archives?
* BIOSCI Archive of Monthly Postings.
ftp://net.bio.net/pub/BIOSCI/BIOLOGICAL-INFORMATION-THEORY. This
archive contains postings from each month as a single document. Files
are in mailbox format, with names of the form YYMM (YY=last 2 digits of
the year, MM=cardinal number of the month, zero padded). The current
months postings are in the file 'current'. Contact
biosci-help@net.bio.net for further help with or comments on the
archives. For the record, the IP number for net.bio.net is
[134.172.2.69].
* These are the BIOSCI raw postings, just numbered:
ftp://net.bio.net/pub/BIOSCI/bionet/
* Archive of Postings at IUBO:
ftp://ftp.bio.indiana.edu/usenet/bionet/info-theory/. This archive
contains individual postings. Older postings are collected by the month
as a single document. There is an index for each month.
* Archive of Life Related Newsgroups
http://www.krl.caltech.edu/~brown/alife/news/. This is an incredibly
nicely organized HTML archive of links maintained by Titus Brown at
Caltech (brown@krl.caltech.edu). This archive contains individual
postings. Check it out!!
* current newsgroup articles on your own computer: bionet.info-theory
* The BIOSCI home page carries all bionet news groups:
http://www.bio.net/
------------------------------------------------------------------------
I Posted But Nothing Happened?!?
Michael Harman (rmharman@jhu.edu)
| I attempted to post a question ... about a
| month and a half ago, but never saw any response.
Go to the bionet archives
http://www.bio.net/hypermail/BIOLOGICAL-INFORMATION-THEORY/
and search for your posting. If your posting does not appear there within a
day it may mean that your posting never made it out of your system. Try
again to see if it was a transient failure. If that fails, talk to your
systems admin. If your systems administrator is stumped, contact Dave
Kristofferson at biosci-help@net.bio.net for further help. You could also
check by posting on misc.test (it's fun, I promise! :-).
------------------------------------------------------------------------
What is an Appropriate Posting?
Name calling and libelous statements are not acceptable on this news group.
It's best to learn about net etiquette (netiquette) before you post
anything.
On the other hand, polite, carefully worded, even aggressive scientific
criticism that specifically addresses issues is encouraged. If you critique
someone's work, be willing to defend your statements, and be willing to
admit publically when you are wrong. When ad hominem postings appear, we
will quickly conclude that you are a net-abusing hacker and will take
appropriate, but legal, actions against you.
To maintain a high professional level of discussion, we encourage all
participants to identify themselves. You do not need any degrees or
professional affiliation to join the conversation, and you should not
hesitate to post if you feel you have something worthwhile to contribute.
However, if you want to avoid looking naive, some knowledge about basic
molecular biology and information theory also helps (see the references),
but we don't expect you to be an expert on everything. Also, to make a good
impression on others, trim any text you copy from previous postings, run
your text through a spell checker, and use proper English.
------------------------------------------------------------------------
What Can I Do About Inappropriate Postings?
The short form of this news group's name, bio-info, can be confusing to some
people inexperienced in network communications or with little knowledge of
the discipline (if there is any :-) of biological information theory. It can
and has been mistaken as a news group for general biological information.
Our readers should be aware that when such postings come to our attention,
the discussion leaders do attempt to inform, privately, the people who make
these inappropriate postings of the error of their ways and suggest
alternative or more appropriate venues.
Subjecting the writers of inappropriate posting to public excoriation is not
a good policy because it may be an inadvertent mistake and follow-up
postings will only add to the irritation of our regular readers. When others
publicly reply to such posts in this news group, although they may think
they are being polite to the original poster, they are still annoying our
regular readers. We suggest that a better policy for readers who do wish to
reply to inappropriate posts is to do so privately or to an appropriate news
group.
If you have nothing better to do with your time and feel you must reply to
an inappropriate posting, either because you think it might be a sincere
though misguided request for information, or because you want to express
your opinions on the poster's ancestry, cool your jets one minute and
carefully consider the poster's address. Look in the mail header for the
"From:" line, the "Reply-to:" line, the "Message-id:" line, and the
"Posting-Host:" line. If the "From:" or "Reply-to:" lines contain obviously
forged information, like
From: Anonymous@net.bio.net (Unknown)
Reply-to: No.one.@net.bio.net
or if the address looks legitimate but contains inconsistent node addresses
like
From: ReadMe@ReadMe.net
Message-id: <4upgib$af8@dfw-ixnews5.ix.netcom.com>
(the part after the "@" in these two lines is not consistent), do not waste
your time. The poster will never read your reply. The posting is either a
"spam" or an attempt to sabotage the system whose address has been forged.
More importantly, do not waste other scientists' time and money (yes, some
people do pay for the e-mail they receive) by replying to an inappropriate
posting through the bulletin board. No one else will be interested in seeing
your inappropriate reply to an inappropriate posting. They may, however,
note for future reference your lack of courtesy and good judgement.
For information about how to deal with intransigent cases, see:
http://math-www.uni-paderborn.de/~axel/blacklist.html
For dealing with Make Money Fast schemes, see:
http://www-lecb.ncifcrf.gov/~toms/mmf.html
Another anti-spam resource is at
http://www.canismajor.demon.co.uk/antispam/antispam.htm
------------------------------------------------------------------------
Should I send private email to someone to respond to a posting or to ask a
question?
It's fine to email someone a question or comment about one of their
postings, but remember that you will then be holding a private conversation
with only that person and the rest of us will miss out on your thoughts and
won't be able to help you. Of course, private email is appropriate if you
are thinking of forming a collaboration with someone and don't want the
ideas to be public, or if you have a technical question about the news
group. Also, please don't post and send email to someone unless you have a
good reason to think they will miss the posting.
In other words, please don't email to Tom Schneider general comments that
could be public.
------------------------------------------------------------------------
What is the official word on copyright of this FAQ?
This FAQ fits the description in the U. S. Copyright Act of a "United States
Government work". It was written as a part of my official duties as
Government employee. This means it cannot be copyrighted. The article is
freely available without a copyright notice, and there are no restrictions
on its use, now or subsequently. I retain no rights in the FAQ.
Thomas D. Schneider
------------------------------------------------------------------------
Who Takes Care of This Group?
John S. Garavelli
Protein Information Resource
National Biomedical Research Foundation
Washington, DC 20007
garavelli@NBRF.Georgetown.Edu
http://www-nbrf.georgetown.edu/
Tom Schneider
National Cancer Institute
Laboratory of Experimental and Computational Biology
Frederick, Maryland 21702-1201
toms@ncifcrf.gov
http://www-lecb.ncifcrf.gov/~toms/
John L. Spouge
National Center for Biotechnology Information
National Library of Medicine
Bethesda, MD 20894
spouge@ncbi.nlm.nih.gov
Please email comments and suggestions on this faq sheet to Tom.
John Garavelli (who also answers to "Steve" if you want to avoid confusion)
often organizes dinner speakers.
John Spouge often arranges dinner locations.
------------------------------------------------------------------------
What Kind of Questions Are Appropriate For Discussion?
This faq sheet answers simple questions about this group. The BIG questions
should be discussed on the net, where we can all haggle over them. Here are
a few for starters:
* What is the role of theory in biology today?
* What should be the role of biological theory?
* What is information? How should it be defined?
* What bothers you when you read the two papers on the theory of
molecular machines? (It is only from the things that bother us that we
can make progress in understanding.) (See references below.)
* What are flaws in the theory of molecular machines?
* How is ATP used to drive molecular machines?
* All communication systems are associated with living things, so is it
true that information theory is really a theory about living things?
Was Shannon really a great biologist?
* What does Maxwell's Demon have to do with all of this?
* What are the limits of computers?
* What are the limits of nanotechnology?
* Can we build molecular machines and molecular computers and how would
they work?
------------------------------------------------------------------------
When and Where are Meetings?
Meetings are announced in the bionet.info-theory news group. As of 1997
September 15, meetings and talks are announced at the Biological Information
Theory and Chowder Society web page. If you know of are going to give a
relevant talk, please submit information to Tom Schneider.
------------------------------------------------------------------------
What is Information Theory?
Information theory is a branch of mathematics concerned with the process of
making choices. Although it has a rich history going back centuries, it was
the work of Claude Shannon, published in 1948 and later, that started the
field. The theory is powerful and has resulted in great achievements. The
beautiful sound we enjoy from compact disks (CD's) became possible only
because of Shannon's work. The bionet.info-theory news group was formed to
discuss the many applications of information theory to biology. (It is not a
general information news group as some might be mislead to think.) It is
worth at least some of your time to see why we are so excited about this
application, as it could turn your research around by sharpening your
experimental approaches.
------------------------------------------------------------------------
Is There a Quick Introduction to Information Theory Somewhere?
See the primer on information theory:
ftp://ftp.ncifcrf.gov/pub/delila/
or
http://www-lecb.ncifcrf.gov/~toms/paper/primer
------------------------------------------------------------------------
I'm Confused: How Could Information Equal Entropy?
If someone says that information = uncertainty = entropy, then they are
confused, or something was not stated that should have been. Those
equalities lead to a contradiction, since entropy of a system increases as
the system becomes more disordered. So information corresponds to disorder
according to this confusion.
If you always take information to be a decrease in uncertainty at the
receiver and you will get straightened out:
R = Hbefore - Hafter.
where H is the Shannon uncertainty:
H = - sum (from i = 1 to number of symbols) Pi log2 Pi (bits per symbol)
and Pi is the probability of the ith symbol. If you don't understand this,
please refer to "Is There a Quick Introduction to Information Theory
Somewhere?".
Imagine that we are in communication and that we have agreed on an alphabet.
Before I send you a bunch of characters, you are uncertain (Hbefore) as to
what I'm about to send. After you receive a character, your uncertainty goes
down (to Hafter). Hafter is never zero because of noise in the communication
system. Your decrease in uncertainty is the information (R) that you gain.
Since Hbefore and Hafter are state functions, this makes R a function of
state. It allows you to lose information (it's called forgetting). You can
put information into a computer and then remove it in a cycle.
Many of the statements in the early literature assumed a noiseless channel,
so the uncertainty after receipt is zero (Hafter=0). This leads to the
SPECIAL CASE where R = Hbefore. But Hbefore is NOT "the uncertainty", it is
the uncertainty of the receiver BEFORE RECEIVING THE MESSAGE.
A way to see this is to work out the information in a bunch of DNA binding
sites.
Definition of "binding": many proteins stick to certain special spots on DNA
to control genes by turning them on or off. The only thing that
distinguishes one spot from another spot is the pattern of letters
(nucleotide bases) there. How much information is required to define this
pattern?
Here is an aligned listing of the binding sites for the cI and cro proteins
of the bacteriophage (i.e., virus) named lambda:
alist 5.66 aligned listing of:
* 96/10/08 19:47:44, 96/10/08 19:31:56, lambda cI/cro sites
piece names from:
* 96/10/08 19:47:44, 96/10/08 19:31:56, lambda cI/cro sites
The alignment is by delila instructions
The book is from: -101 to 100
This alist list is from: -15 to 15
------ ++++++
111111--------- +++++++++111111
5432109876543210123456789012345
...............................
OL1 J02459 35599 + 1 tgctcagtatcaccgccagtggtatttatgt
J02459 35599 - 2 acataaataccactggcggtgatactgagca
OL2 J02459 35623 + 3 tttatgtcaacaccgccagagataatttatc
J02459 35623 - 4 gataaattatctctggcggtgttgacataaa
OL3 J02459 35643 + 5 gataatttatcaccgcagatggttatctgta
J02459 35643 - 6 tacagataaccatctgcggtgataaattatc
OR3 J02459 37959 + 7 ttaaatctatcaccgcaagggataaatatct
J02459 37959 - 8 agatatttatcccttgcggtgatagatttaa
OR2 J02459 37982 + 9 aaatatctaacaccgtgcgtgttgactattt
J02459 37982 - 10 aaatagtcaacacgcacggtgttagatattt
OR1 J02459 38006 + 11 actattttacctctggcggtgataatggttg
J02459 38006 - 12 caaccattatcaccgccagaggtaaaatagt
^
Each horizontal line represents a DNA sequence, starting with the 5' end on
the left, and proceeding to the 3' end on the right. The first sequence
begins with: 5' tgctcag ... and ends with ... tttatgt 3'. Each of these
twelve sequences is recognized by the lambda repressor protein (called cI)
and also by the lambda cro protein.
What makes these sequences special so that these proteins like to stick to
them? Clearly there must be a pattern of some kind.
Read the numbers on the top vertically. This is called a "numbar". Notice
that position +7 always has a T (marked with the ^). That is, according to
this rather limited data set, one or both of the proteins that bind here
always require a T at that spot. Since the frequency of T is 1 and the
frequencies of other bases there are 0, H(+7) = 0 bits. But that makes no
sense whatsoever! This is a position where the protein requires information
to be there.
That is, what is really happening is that the protein has two states. In the
BEFORE state, it is somewhere on the DNA, and is able to probe all 4
possible bases. Thus the uncertainty before binding is Hbefore = log2(4) = 2
bits. In the AFTER state, the protein has bound and the uncertainty is
lower: Hafter(+7) = 0 bits. The information content, or sequence
conservation, of the position is Rsequence(+7) = Hbefore - Hafter = 2 bits.
That is a sensible answer. Notice that this gives Rsequence close to zero
outside the sites.
If you have uncertainty and information and entropy confused, I don't think
you would be able to work through this problem. For one thing, one would get
high information OUTSIDE the sites. Some people have published graphs like
this.
A nice way to display binding site data so you can see them and grasp their
meaning rapidly is by the sequence logo method. The sequence logo for the
example above is at
http://www-lecb.ncifcrf.gov/~toms/gallery/hawaii.fig1.gif. More information
on sequence logos is in the section What are Sequence Logos?
More information about the theory of BEFORE and AFTER states is given in the
papers http://www-lecb.ncifcrf.gov/~toms/paper/nano2 ,
http://www-lecb.ncifcrf.gov/~toms/paper/ccmm and
http://www-lecb.ncifcrf.gov/~toms/paper/edmm.
------------------------------------------------------------------------
How Can I Learn More About Information Theory and Biology? References
REFERENCES - General
There are a huge number of papers related to this topic, just about
everything in molecular biology, lots of chemistry, physics, electronics,
evolutionary theory, thermodynamics, statistical mechanics and the kitchen
sink ... References are given in BiBTeX format, the bibliography program
associated with LaTeX, the powerful and portable typesetting program.
By arrangement, books that have prices listed can be ordered over Internet
from:
Reiter's Scientific & Professional Books
2021 K Street, NW
Washington, DC 20006
1-800-537-4314
1-202-223-3327
1-202-296-9103 FAX
EMAIL:
books@reiters.com
WWW:
http://reiters.com/
Shipping and handling charges are: in the DC metropolitan area $4.00 for one
item, $0.50 for each additional item, outside the area $4.50 for one item,
$0.50 for each additional item.
The prices are current as of October 1994; because publishers are constantly
changing their prices, they should be considered estimates rather than
guaranteed prices. To open an account you must first either phone or FAX
them and provide a credit card number. Book orders can be then placed at any
time over the Internet. **DO NOT SEND CREDIT CARD NUMBERS OVER THE
INTERNET!**
Reiter's carries all of the books on this list except "Information Theory:
Saving Bits", and that one can be special ordered. If enough interest in
this book is generated by the FAQ, it will be added as regular stock. (It
can also be ordered directly from the company using the information given.)
Gonick's Wonderful books (Don't be shy! They are worth the money!!):
@book{Gonick.computers,
author = "L. Gonick",
title = "The Cartoon Guide to Computers",
edition = "second",
publisher = "HarperCollins",
address = "New York, NY",
isbn = "0-06-273097-5",
price = "price as of 1994 October 31: \$11.00",
year = "1991"}
@book{Gonick.genetics,
author = "L. Gonick",
title = "The Cartoon Guide to Genetics",
edition = "updated",
publisher = "Barnes \& Nobel",
address = "New York, NY",
isbn = "0-06-273099-1",
price = "price as of 1994 October 31: \$12.00",
year = "1991"}
@book{Gonick.physics,
author = "L. Gonick
and A. Huffman",
title = "The Cartoon Guide to Physics",
publisher = "HarperPerennial",
address = "New York, NY",
isbn = "0-06-273100-9",
price = "price as of 1994 October 31: \$12.00",
year = "1990"}
A good starting point if you don't know much molecular biology: (Two
volumes)
@book{Watson1987,
author = "J. D. Watson
and N. H. Hopkins
and J. W. Roberts
and J. A. Steitz
and A. M. Weiner",
title = "Molecular Biology of the Gene",
edition = "fourth",
publisher = "The Benjamin/Cummings Publishing Co., Inc.",
address = "Menlo Park, California",
isbn = "0-8053-9614-4",
price = "price as of 1994 October 31: \$59.95",
year = "1987"}
This book describes LaTex and BiBTeX:
@book{Lamport1994,
author = "L. Lamport",
title = "\LaTeX: A Document Preparation System,
User's Guide \& Reference Manual",
edition = "second",
publisher = "Addison-Wesley Publishing Company",
address = "Reading, Massachusetts",
isbn = "0-201-52983-1",
price = "price as of 1994 October 31: \$32.95",
year = "1994"}
------------------------------------------------------------------------
REFERENCES - Information Theory
* Basic References
o John Pierce was at Bell Labs while Shannon dreamed up information
theory. He saw the development from the inside, and wrote it up in
"An Introduction to Information Theory: Symbols, Signals and
Noise". Although it is not highly mathematical, this book is still
the best one to start with because it gives one a feeling for the
scope and implications of the theory, without dumping on the math,
yet without leaving out important topics that later generations of
popular writers skipped.
@book{Pierce1980,
author = "J. R. Pierce",
title = "An Introduction to Information Theory:
Symbols, Signals and Noise",
edition = "second",
publisher = "Dover Publications, Inc.",
address = "New York",
isbn = "0-486-24061-4",
comment = "
original copyright 1961
Ordering information: Pierce1980 is currently available by mail
from:
Dover Publications, Inc.
31 East 2nd street
Mineola, New York 11501
order:
Pierce, An Introduction to Information Theory: Symbols, Signals
and Noise
code number: 24061-4
$7.95 + charges. Payment in full, no telephone or credit card
orders.
Postage and Handling charges are:
Bookrate: $3 (US only)
UPS: $4.50 (US only, not Alaska or Hawaii or PO boxes)
Foreign orders: add 20% of total (minimum $2.50)
Sales Tax (Ny residents only)
Foreign Orders Note: Remittances must be sent by international
money order or in U.S. funds via Federal Wire System to Chemical
Bank, N. Y. ABA #021000128. Mark all remittances `For the account
of Dover Publications, Inc. #001 053 272'. This information is
from the Dover Math and Science Catalogue 9/92", price = "price as
of 1994 October 31: \$8.95", year = "1980"}
o Christopher Hillman (hillman@math.washington.edu) suggests that
Cover and Thomas' book is a better starting point, but that's
because he is a mathematician People who have seen both could post
their opinions.
@book{Cover.Thomas1991,
author = "Thomas M. Cover
and Joy A. Thomas",
title = "Elements of Information Theory",
publisher = "John Wiley \& Sons, Inc.",
address = "N. Y.",
isbn = "0-471-06259-6",
year = "1991"}
o A good introduction to the mathematics, written for high school
students:
@book{Sacco1988,
author = "W. Sacco
and W. Copes
and C. Sloyer
and R. Stark",
title = "Information Theory: Saving Bits",
publisher = "Janson Publications, Inc.",
comment = "original address was Providence, Rhode Island",
address = "Dedham, MA",
isbn = "0-939765-25-X",
phone = "(800) 322-6284",
price = "price as of 1994 October 31: \$11.95",
year = "1988"}
* Important originals:
o @article{Shannon1948,
author = "C. E. Shannon",
title = "A Mathematical Theory of Communication",
year = "1948",
journal = "Bell System Tech. J.",
volume = "27",
pages = "379-423, 623-656"}
o @book{ShannonWeaver1949,
author = "C. E. Shannon
and W. Weaver",
title = "The Mathematical Theory of Communication",
publisher = "University of Illinois Press",
address = "Urbana",
isbn = "0-252-72548-4",
price = "price as of 1994 October 31: \$9.95",
year = "1949"}
o @article{Shannon1949,
author = "C. E. Shannon",
title = "Communication in the Presence of Noise",
year = "1949",
journal = "Proc. IRE",
volume = "37",
pages = "10-21"}
o For the committed: The Complete Works!
@book{Sloane.Wyner1993,
author = "N. J. A. Sloane and A. D. Wyner",
title = "Claude Elwood Shannon: Collected Papers",
publisher = "IEEE Press",
address = "Piscataway, NJ",
isbn = "0-7803-0434-9",
comment = "IEEE Order Number: PC0331-9
ll To order directly by charge card (eg Visa works) you can call
(908)-981-0060
$69.95 + $5 handling charge
delivery in about 2 weeks",
price = "price as of 1994 October 31: \$69.95",
comment = "this was previously called Shannon1993",
year = "1993"}
* Other basic references
o How locks work and other cool stuff:
@book{Macaulay1988,
author = "D. Macaulay",
title = "The Way Things Work",
publisher = "Houghton Mifflin Company",
address = "Boston",
isbn = "0-395-42857-2",
price = "price as of 1994 October 31: \$29.95",
comment = "This book is also available on Windows-Compatible
CD-ROM
cdrom isbn = 1-56458-901-3 Price as of 1994 October 31: \$99.95",
year = "1988"}
o Leff1990 gives a review of the Maxwell's Demon problem.
See also Schneider.edmm, listed below.
@book{Leff1990,
author = "H. S. Leff and A. F. Rex",
title = "Maxwell's Demon: Entropy, Information, Computing",
publisher = "Princeton University Press",
address = "Princeton, N. J.",
phone = "1(800) 777-4726",
isbn.hard = "0-691-08726-1 (hard cover)",
price.hard = "price as of 1994 October 31: \$80.00",
isbn.paper = "0-691-08727-X (paperback)",
price.paper = "price as of 1994 October 31: \$26.95",
year = "1990"}
------------------------------------------------------------------------
REFERENCES - Jaynes
@article{JaynesI,
author = "Edwin T. Jaynes",
title = "Information Theory and Statistical Mechanics",
year = 1957,
journal = "Physical Review",
volume = "106",
pages = "620-630"}
@article{JaynesII,
author = "Edwin T. Jaynes",
title = "Information Theory and Statistical Mechanics. {II}",
year = 1957,
journal = "Physical Review",
volume = "108",
pages = "171-190"}
A version of Jaynes' new book "PROBABILITY THEORY -- THE LOGIC OF SCIENCE"
is available on the net. See:
ftp://bayes.wustl.edu/Jaynes.book/
Larry Bretthorst (larry@bayes.wustl.edu)
http://omega.albany.edu:8008/JaynesBook.html
Carlos Rodriguez (carlos@math.albany.edu)
Tom Schneider's pointers to these places:
http://www-lecb.ncifcrf.gov/~toms/jaynes.html
Note: The book is being written now and new versions come out every once in
a while. One of these locations may be more up to date than the other.
------------------------------------------------------------------------
REFERENCES - Schneider
To see online papers, go to http://www-lecb.ncifcrf.gov/~toms/paper.
@article{Schneider1986,
author = "T. D. Schneider
and G. D. Stormo
and L. Gold
and A. Ehrenfeucht",
title = "Information content of binding sites on nucleotide sequences",
journal = "J. Mol. Biol.",
volume = "188",
pages = "415-431",
year = "1986"}
@inproceedings{Schneider1988,
author = "T. D. Schneider",
editor = "G. J. Erickson and C. R. Smith",
title = "Information and entropy of patterns in genetic switches",
booktitle = "Maximum-Entropy and Bayesian Methods in Science and
Engineering",
volume = "2",
pages = "147-154",
publisher = "Kluwer Academic Publishers",
address = "Dordrecht, The Netherlands",
year = "1988"}
@article{Schneider1989,
author = "T. D. Schneider
and G. D. Stormo",
title = "Excess Information at Bacteriophage {T7} Genomic Promoters
Detected by a Random Cloning Technique",
year = "1989",
journal = "Nucl. Acids Res.",
volume = "17",
pages = "659-674"}
@article{Schneider.Stephens.Logo,
author = "T. D. Schneider
and R. M. Stephens",
title = "Sequence Logos: A New Way to Display Consensus Sequences",
journal = "Nucl. Acids Res.",
volume = "18",
pages = "6097-6100",
year = "1990"}
@article{Schneider.ccmm,
author = "T. D. Schneider",
title = "Theory of Molecular Machines.
{I. Channel} Capacity of Molecular Machines",
journal = "J. Theor. Biol.",
volume = "148",
number = "1",
pages = "83-123",
note = "{(Note: The figures were printed out of order!
Fig. 1 is on p. 97.)}",
year = 1991}
@article{Schneider.edmm,
author = "T. D. Schneider",
title = "Theory of Molecular Machines.
{II. Energy} Dissipation from Molecular Machines",
journal = "J. Theor. Biol.",
volume = "148",
number = "1",
pages = "125-137",
year = 1991}
@article{Herman.Schneider1992,
author = "N. D. Herman
and T. D. Schneider",
title = "High Information Conservation Implies that at Least Three Proteins
Bind Independently to {F} Plasmid {{\em incD\/}} Repeats",
journal = "J. Bact.",
volume = "174",
pages = "3558-3560",
year = "1992"}
@article{Stephens.Schneider.Splice,
author = "R. M. Stephens
and T. D. Schneider",
title = "Features of spliceosome evolution and function
inferred from an analysis of the information at human splice sites",
journal = "J. Mol. Biol.",
volume = "228",
pages = "1124-1136",
year = "1992"}
@article{Papp.helixrepa,
author = "P. P. Papp
and D. K. Chattoraj
and T. D. Schneider",
title = "Information Analysis of Sequences that Bind the Replication
Initiator {RepA}",
journal = "J. Mol. Biol.",
comment = "Cover of 233, number 2!",
volume = "233",
pages = "219-230",
year = "1993"}
@article{Schneider.nano2,
author = "T. D. Schneider",
title = "Sequence Logos, Machine/Channel Capacity,
{Maxwell}'s Demon, and Molecular Computers: a Review of the Theory of
Molecular Machines",
journal = "Nanotechnology",
volume = "5",
number = "1",
pages = "1-18",
year = "1994"}
ftp://ftp.ncifcrf.gov/pub/delila/
------------------------------------------------------------------------
REFERENCES - Yockey
@book{Yockey1958a,
editor = "Hubert P. Yockey and Robert P. Platzman and Henry Quastler",
title = "Symposium on Information Theory in Biology",
booktitle = "Symposium on Information Theory in Biology",
publisher = "Pergamon Press",
address = "New York, London",
comment = "out of print",
year = "1958"}
@article{Yockey1981,
author = "Hubert P. Yockey",
year = 1981,
title = "Self-organization Origin of Life Scenarios and Information Theory",
journal = "J. Theor. Biol.",
volume = "91",
pages = "13-31"}
@book{Yockey1992,
author = "H. P. Yockey",
title = "Information Theory in Molecular Biology",
publisher = "Cambridge University Press",
address = "Cambridge",
isbn = "0-521-35005-0",
comment = "40 West 20th Street,
New York, N. Y. 10011-4211,
order number 350050",
phone = "1-800-827-7423",
price = "price as of 1994 October 31: \$74.95",
year = "1992"}
Following is Hubert Yockey's reference list:
* Yockey, Hubert P. Information Theory and Molecular Biology, Cambridge
UK: Cambridge University Press (1992)
* When is random random? Nature 344 (1990) p823, Hubert P. Yockey
* Yockey, Hubert P. (1981). Self-organization origin of life scenarios
and information theory. Journal of Theoretical Biology, 91, 13-31.
* Yockey, Hubert P. (1979). Do overlapping genes violate molecular
biology and the theory of evolution? Journal of Theoretical Biology,
80, 21-26.
* Yockey, Hubert P. (1978). Can the Central Dogma be derived from
information theory? Journal of Theoretical Biology, 74, 149-152.
* Yockey, Hubert P. (1977a). A prescription which predicts functionally
equivalent residues at given sites in protein sequences. 67, 337-343.
* Yockey, Hubert P. (1977b). On the information content of cytochrome c.
Journal of Theoretical Biology, 67, 345-376.
* Yockey, Hubert P. (1977c). A calculation of the probability of
spontaneous biogenesis by information theory. Journal of Theoretical
Biology, 67, 377-398.
* Yockey, Hubert P (1974). An application of information theory to the
Central Dogma and the sequence hypothesis. Journal of Theoretical
Biology,.46, 369-406.
* Yockey, Hubert P. (1960) The Use of Information Theory in Aging and
Radiation Damage In The Biology of Aging American Institute of
Biological Sciences Symposium No. 6 (160) pp338-347.
* Yockey, Hubert P., Platzman, Robert P. & Quastler, Henry, eds. (1958a).
Symposium on Information Theory in Biology, New York, London: Pergamon
Press.
* Yockey, Hubert P. (1958b). A study of aging, thermal killing and
radiation damage by information theory. In Symposium on Information
Theory in Biology. eds. Hubert P. Yockey, Robert Platzman & Henry
Quastler, pp297-316. New York,London: Pergamon Press.
* Yockey, Hubert P. (1956). An application of information theory to the
physics of tissue damage. Radiation.Research, 5, 146-155.
* Information in bits and bytes; Reply to Lifson's Review of "Information
Theory and Molecular" Biology BioEssays v17 p85-88 (1995)
* Comments on "Let there be life; Thermodynamic Reflections on Biogenesis
and Evolution by Avshalom C. Elitzur Journal of Theoretical Biology in
press (1995).
------------------------------------------------------------------------
REFERENCES - Adleman and papers related to molecular computation
Tom Schneider has a list of molecular computation resources.
A longer and more complete list of references is maintained by J.H.M.Dassen
(jdassen@wi.leidenuniv.nl) in A biblography on Molecular Computation and
Splicing Systems (http://www.wi.LeidenUniv.nl/~jdassen/dna.bib). There are
also hyperlinks to most of the (90+) papers
(http://www.wi.LeidenUniv.nl/~jdassen/dna.html).
@article{Adleman1994,
author = "Leonard M. Adleman",
title = "Molecular computation of solutions to combinatorial problems",
journal = "Science",
volume = "266",
pages = "1021-1024",
date = "November 11",
year = 1994}
@article{Baum1995,
author = "Eric B. Baum",
title = "Building an associative memory vastly larger that the brain",
journal = "Science",
volume = "268",
pages = "583-585",
date = "April 28",
year = 1995}
@article{Lipton1995,
author = "Richard J. Lipton",
title = "DNA solution of hard computational problems",
journal = "Science",
volume = "268",
pages = "542-545",
date = "April 28",
year = 1995}
@manuscript{Adleman1995,
author = "Leonard M. Adleman",
title = "On constructing a molecular computer",
note = "Available by anonymous ftp:
/pub/csinfo/papers/adleman/molecular_computer.ps on usc.edu",
year = 1995}
Other available manuscripts:
1. Dick Lipton of Princeton
Speeding up computations via molecular biology. Draft. Dec. 9, 1994.
ftp://ftp.cs.princeton.edu/pub/people/rjl/bio.ps
2. Dan Boneh of Princeton has several manuscripts available at:
Breaking DES Using a Molecular Computer.
Authors: D. Boneh, C. Dunworth, R. Lipton
This paper contains the talk from the workshop.
http://www.cs.princeton.edu/~dabo/biocomp.html
On the Computational Power of DNA.
Authors: D. Boneh, C. Dunworth, R. Lipton, J. Sgall
This is a new paper which contains several results:
a. Shows how to solve the circuit satisfaction problem.
b. Shows how to solve optimization problems such as MAX-Clique without going
through decision problems.
c. Shows how to evaluate predicates in the polynomial hirarchy.
Making DNA Computers Error Resistant.
Authors: D. Boneh, R. Lipton
This paper shows how to transform volume reducing DNA algorithms into
algorithm that are resistant to errors.
------------------------------------------------------------------------
REFERENCES - Gad Yagil and papers related to Algorithmic Information Theory
(AIT) or Algorithmic Complexity
An alternative way to analyze biosystems is by the Algorithmic Information
Theory (AIT) or Algorithmic Complexity (AC) approach, first formulated by
Kolmogoroff, Solomonoff and Chaitin in the 1960's. According to this
approach, the information in a string of symbols is equal to the length of
the shortest program caparisons of reproducing the string. This concept has
been reformulated to tackle real molecular and biosystems ("Structural
Complexity") and applied to a range of biosystems by G. Yagil. The more
recent publications, which include references to the work of Kolmogoroff and
of Chaitin, can be found at:
http://www.weizmann.ac.il/~lcyagil
also at http://interjournal.org, Manuscript Number 135. (Do a search for the
manuscript number.)
The book of Cover and Thomas covers AC extensively. In particular, it shows
that under certain conditions, AC can become equal to the Shannon
information (or uncertainty) measure. In a series of papers, C.H. Bennett
has proposed a concept of "logical depth", related to the time required by a
universal machine to compute a sequence, as another measure of the
information content of a string or sequence:
see: C.H. Bennett, "Logical Depth and Physical Complexity". In: "The
Universal Turing Machine -A half century", Rolf Herken, Editor, Oxford
University press, 1988.
Gad Yagil, Ph. D.
Dept. of Molecular Cell Biology
The Weizmann Institute of Science
Rehovot, Israel, 76100
Tel. 089-460-918 (home)
Fax 089-344-125
e-mail lcyagil@wiccmail.weizmann.ac.il.
------------------------------------------------------------------------
REFERENCES - Chris Hillman and papers related to entropy
* Chris Hillman's Home Page:
http://www.math.washington.edu/~hillman/personal.html
* Entropy on the World Wide Web:
http://www.math.washington.edu/~hillman/entropy.html
------------------------------------------------------------------------
Will Authors Send Me Papers?
Tom Schneider will mail you copies of some of his papers. You can request
them through the World Wide Web from
http://www-lecb.ncifcrf.gov/~toms/papers.html or by sending your physical
address to him at toms@ncifcrf.gov.
If you are willing to send out papers or have papers you would like listed
here, please contact Tom Schneider.
------------------------------------------------------------------------
Where Can I Get BIG Coins?
BIG coins are nice for explaining that a bit represents the choice between
two equally likely possibilities.
News Emporium, Inc. (703) 661-3550 sells large coins at Dulles International
Airport.
Parks and History has big coins for sale. They will have a web site Bookshop
soon. In the meantime, you could call (202) 755-0461 or (800) 990-7275. They
accept VISA, MasterCard or American Express. Contact: Linda Depew their Mail
Order & Wholesale Manager.
If you find other sources, please tell Tom Schneider.
------------------------------------------------------------------------
What are Sequence Logos?
A sequence logo is a graphical
method for showing patterns created
by using information theory.
------------------------------------------------------------------------
How Do I find Sequence Logos on the Web?
http://www-lecb.ncifcrf.gov/~toms/sequencelogo.html
------------------------------------------------------------------------
Is There a Shell Script for Making Sequence Logos?
Yes, you will find the one Shmuel Pietrokovski wrote in the ftp archive
ftp.ncifcrf.gov in pub/delila/logoaid. (Also available in
bioinformatics.weizmann.ac.il/pub/software/logoaid.)
------------------------------------------------------------------------
Is There a World Wide Web Page for Making Sequence Logos?
Yes, Steve Brenner has done it!
http://www.bio.cam.ac.uk/seqlogo/
------------------------------------------------------------------------
Are There Other Organizations for Information Theory?
IEEE Information Theory Society
------------------------------------------------------------------------
Acknowledgments
This FAQ is written and maintained by Tom Schneider. It was HTMLized by
Susan Hogarth (sjhogart@unity.ncsu.edu) in February, 1997 but is NOT
maintained by her. Please look at Who Takes Care of This Group if you have
questions about this FAQ.
------------------------------------------------------------------------
User Contributions:
[ Usenet FAQs | Web FAQs | Documents | RFC Index ]
Send corrections/additions to the FAQ Maintainer: toms@ncifcrf.gov (Tom Schneider)
Last Update March 27 2014 @ 02:11 PM
|

Comment about this article, ask questions, or add new information about this topic: