Xinxia
Xinxia Gao, Beijing CN
Patent application number | Description | Published |
---|---|---|
20130021711 | Residual Current Protection Device - A residual current protection device comprises: an arc guiding plate, which is configured to guiding an arc generated during contacts breaking to an arc extinguishing unit. Wherein, the arc extinguishing unit includes an arc extinguishing channel, configured to extinguish the arc; and an enhanced arc extinguisher, disposed between the extinguishing channel and the arc guiding plate, for impelling the arc into the extinguishing channel. | 01-24-2013 |
Xinxia Li, Urumqi CN
Patent application number | Description | Published |
---|---|---|
20130154138 | METHOD FOR PREPARING OF ALLICIN INJECTION AND LOW-TEMPERATURE CONTINUOUS STIRRING ULTRFILTRATION DEVICE THEREOF - The present invention provides a preparing method of an allicin injection and the low temperature continuous stirring ultrafiltration device thereof. Said preparing method consists of the following steps: extracting allicin; diluting the allicin with solvent precooled tol-4 in a clean environment, adding nitrogen gas or argon gas, and then encapsulating the solution to obtain allicin injection with different specifications. | 06-20-2013 |
Xinxia Tian, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140162261 | DETECTION KIT FOR IDENTIFYING GENOTYPE IN DEPRESSION PATIENTS AND METHOD OF USING THE SAME - The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment. | 06-12-2014 |
Xinxia Zhang, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140118652 | ARRAY SUBSTRATE AND DISPLAY DEVICE - Embodiments of the invention provide an array substrate and a display device. The array substrate comprises a base substrate, a plurality of gate lines and a plurality of data lines formed on the base substrate, and a plurality of pixel units defined by the plurality of gate lines and the plurality of data lines intersecting with each other. Each pixel unit is driven by a same gate line and a same data line. Each pixel unit includes a thin film transistor structure and at least two display regions. Each display region includes a pixel electrode. The thin film transistor structure drives the pixel electrodes in the at least two display regions simultaneously and causes voltages applied on the pixel electrodes in the at least two display regions different from one another. | 05-01-2014 |