Whitmore
Alan Whitmore, Dyrham GB
Patent application number | Description | Published |
---|---|---|
20130296632 | DRUG DELIVERY SYSTEM - An ocular drug delivery system comprising a photocaged drug comprising a therapeutic agent that is rendered biologically inactive by being coupled to a protective ligand or caging group by a photocleavable bond, with the therapeutic agent being capable of being activated and/or released in response to a predetermined wavelength and/or intensity of light which breaks the photocleavable bond. | 11-07-2013 |
Alan Whitmore, Allerwash GB
Patent application number | Description | Published |
---|---|---|
20090030261 | DRUG DELIVERY SYSTEM - Currently, no efficient, non-invasive methods exist for delivering drugs and/or other therapeutic agents to the interior of the eye to treat or prevent disease or injury. The present invention relates to a novel method that is suitable for the delivery of any therapeutic agent (suitably modified) to the interior of the eye without the need for the penetration of a needle into the eyeball. In a preferred embodiment, it involves an injection into a peripheral vein (or oral administration, or administration by some other enteral or parenteral route) of a solution of inert drug which is trapped in the eye by a magnetic field and activated by radiation once it is in position, so that the active agent is released only where it is needed and can have its therapeutic effect without affecting other tissues or organs. The inert drug may be composed of a biologically compatible magnetic nanoparticle chemically bound to a specially inactivated (caged) form of the drug to be delivered and to a luminescent marker. | 01-29-2009 |
David Whitmore, Winnipeg CA
Patent application number | Description | Published |
---|---|---|
20080202941 | CATHODIC PROTECTION OF A CONCRETE STRUCTURE HAVING A PART IN CONTACT WITH A WETTING MEDIUM AND A PART ABOVE THE MEDIUM - Corrosion of steel in a concrete structure such as a column in sea water occurs primarily at the zone which is subject to a wetting and drying action and is inhibited using cathodic protection by attaching to the column at the zone an impervious sealed sleeve which carries no anode itself but which cooperates with an anode body in the water below the sleeve. The sleeve acts to inhibit permeation of oxygen through the concrete to the steel and at the same time acts to promote transfer of current from the anode through the concrete under the sleeve by preventing drying by preventing moisture escape. An anode arrangement may be provided only at the top of the sleeve to consume oxygen in that area. The sleeve may be applied over a layer of grout. The top edge surface of the grout may be sealed from the sleeve to the column. | 08-28-2008 |
20110214984 | Cathodic Protection - Cathodic protection of a structure including a steel member at least partly buried in a covering layer, such as steel rebar in a concrete structure, is provided by embedding sacrificial anodes into the concrete layer at spaced positions over the layer and connecting the anodes to the rebar. The anode body is formed, by pressing together finely divided powder, flakes or fibers of a sacrificial anode material such as zinc to define a porous body having pores therein. The sacrificial anode material of the anode member is directly in contact with the covering material by being buried or inserted as a tight fit into a drilled hole so that any expansion forces therefrom would be applied to the concrete with the potential of causing cracking. The pores are arranged however such that corrosion products from corrosion of the anode body are received into the pores sufficiently to prevent expansion of the anode body to an extent which would cause cracking of the covering material. | 09-08-2011 |
20140021039 | Apparatus for Cathodic Protection System Using an Impressed Current Anode and a Sacrificial Anode - Cathodic protection of steel in concrete is provided by locating an anode assembly including both a sacrificial anode and an impressed current anode in contact with the concrete and providing an impressed current from a power supply to the anode. The impressed current anode forms a perforated sleeve surrounding a rod of the sacrificial anode material with an activated ionically-conductive filler material between. The system can be used without the power supply in sacrificial mode or when the power supply is connected, the impressed current anode can be powered to provide an impressed current system and/or to recharge the sacrificial anode from sacrificial anode corrosion products. | 01-23-2014 |
20140021062 | Charging a Sacrificial Anode with Ions of the Sacrificial Material - Cathodic protection of steel in concrete is provided by locating an anode assembly including both a sacrificial anode and an impressed current anode in contact with the concrete and providing an impressed current from a power supply to the anode. The impressed current anode forms a perforated sleeve surrounding a rod of the sacrificial anode material with an activated ionically-conductive filler material between. The system can be used without the power supply in sacrificial mode or when the power supply is connected, the impressed current anode can be powered to provide an impressed current system and/or to recharge the sacrificial anode from sacrificial anode corrosion products. | 01-23-2014 |
20140021063 | Two Stage Cathodic Protection System Using Impressed Current and Galvanic Action - Cathodic protection of steel in concrete is provided by locating an anode assembly including both a sacrificial anode and an impressed current anode in contact with the concrete and providing an impressed current from a power supply to the anode. The impressed current anode forms a perforated sleeve surrounding a rod of the sacrificial anode material with an activated ionically-conductive filler material between. The system can be used without the power supply in sacrificial mode or when the power supply is connected, the impressed current anode can be powered to provide an impressed current system and/or to recharge the sacrificial anode from sacrificial anode corrosion products. | 01-23-2014 |
20140027306 | Cathodic Protection of a Concrete Structure - Corrosion of steel in a concrete structure such as a column in sea water occurs primarily above the water line and is inhibited using cathodic protection by attaching to the column an impervious sealed sleeve in which is provided a sacrificial anode in sheet form in contact with a layer of water transport medium so that water from the location of the bottom of the water transport medium within the water is carried into the area of the sacrificial anode to enhance ionic current. | 01-30-2014 |
20140048975 | Corrosion Protection of Cables in a Concrete Structure - Steel reinforcing cables in concrete are protected against corrosion by injecting a carrier fluid and corrosion inhibitors into interstitial spaces between the wires of the cable at a first location along the cable and causing the fluid to pass through the interstitial spaces between the wires of the cable to a second location along the cable. The cable comprises an array of wires confined together and intimately surrounded by a covering material which is engaged with a periphery of the cable so that there are insufficient interconnected spaces between the cable and the covering material to allow passage of fluid longitudinally along the cable outside the cable itself. The method can be used with pre-stressed concrete, with post-tensioned bonded cables and with extruded un-bonded mono-strand cables. | 02-20-2014 |
David Whitmore, London GB
Patent application number | Description | Published |
---|---|---|
20150218562 | WOUND TREATMENT - The present invention concerns an isolated polynucleotide comprising a nucleotide sequence having substantial homology to any of the following nucleotide sequences: catcgttatgggacta (SEQ ID NO: 2), cattcttgatccttcc (SEQ ID NO: 1), cttttcaatctgactg SEQ ID NO: atgaaaatactcataa (SEQ ID NO: 5), gtgataaaagaaccat (SEQ ID NO: 10), gggttcatgaaagtga (SEQ ID NO: 11), gatgaccctcttatcc (SEQ ID NO: 8), tggaaggaatgtctgg (SEQ ID NO: 4), gcatctgcttccaaca (SEQ ID NO: 3), catcgttaggctagctacaacgatgggacta (SEQ ID NO: 9), tccaccaaggctagctacaacgaccatcaaa (SEQ ID NO: 12), gtcaacaaggctagctacaacgatgagctca (SEQ ID NO: 13), and cttttcaaggctagctacaacgactgactgt (SEQ ID NO: 6), and their use in the treatment of wounds. | 08-06-2015 |
Helen Whitmore, St. Albans GB
Patent application number | Description | Published |
---|---|---|
20140234516 | GELLED FOOD CONCENTRATE - The present invention relates to a food concentrate in the form of a gel for use in stock, soup, sauce, gravy or as a seasoning ingredient for use in cooking and the process for preparing such a food concentrate gel. The concentrate is free or substantially free of syneresis and does not skin or re-gel when completely cold, after it has been diluted in aqueous liquid in a ratio of 1:10 to 1:100 under the application of heat and subsequently been allowed to cool. Gelation is induced by the addition of a sodium source to an aqueous solution of low methoxy pectin. | 08-21-2014 |
Ian Whitmore, Preston GB
Patent application number | Description | Published |
---|---|---|
20140083518 | STRUCTURAL ELEMENT OF AN AIR VEHICLE AIR INTAKE COMPOSED OF AN ARRAY OF PASSAGES WITH A HEXAGONAL CROSS SECTION - An air vehicle powered by a gas turbine engine, particularly, but not exclusively, an air vehicle having a blended wing body includes a gas turbine engine disposed in the body of the vehicle including an inlet face. An inlet channel having a convoluted geometry is configured such that air flow incident on the inlet face during operation is disordered. A structural element associated with the inlet channel and locate upstream of the inlet face is provided. The element is configured to modulate air flow, at least partially, to improve flow ordering in the incident air. | 03-27-2014 |
John Alfred Whitmore, Waterloo CA
Patent application number | Description | Published |
---|---|---|
20120019418 | MOBILE WIRELESS COMMUNICATIONS DEVICE WITH ELECTRICALLY CONDUCTIVE CONTINUOUS RING AND RELATED METHODS - A mobile wireless communications device may include a portable housing that may include an electrically conductive continuous ring defining a perimeter of the portable housing. The electrically conductive continuous ring may be configured to function as an antenna. The mobile wireless communications device may further include a printed circuit board (PCB) carried by the portable housing and may include an electrically conductive layer defining a ground plane. The mobile wireless communications device may further include wireless transceiver circuitry carried by the PCB and coupled to the antenna. The mobile wireless communications device may also include an electrically conductive shorting member coupled between the electrically conductive continuous ring and the ground plane. | 01-26-2012 |
20120021701 | MOBILE WIRELESS COMMUNICATIONS DEVICE WITH SHUNT COMPONENT AND RELATED METHODS - A mobile wireless communications device may include a portable housing including at least one electrically conductive housing portion configured to function as an antenna. The mobile wireless communications device may also include a printed circuit board (PCB) carried by the portable housing, and wireless transceiver circuitry carried by the PCB and including at least one circuit element carried by the PCB. The mobile wireless communications device may also include at least one current shunt component coupled between the at least one electrically conductive housing portion and the at least one circuit element. | 01-26-2012 |
20140099993 | MOBILE WIRELESS COMMUNICATIONS DEVICE WITH SHUNT COMPONENT AND RELATED METHODS - A mobile wireless communications device may include a portable housing including at least one electrically conductive housing portion configured to function as an antenna. The mobile wireless communications device may also include a printed circuit board (PCB) carried by the portable housing, and wireless transceiver circuitry carried by the PCB and including at least one circuit element carried by the PCB. The mobile wireless communications device may also include at least one current shunt component coupled between the at least one electrically conductive housing portion and the at least one circuit element. | 04-10-2014 |
John Alfred Whitmore, Heidelberg CA
Patent application number | Description | Published |
---|---|---|
20110275421 | MOBILE WIRELESS COMMUNICATIONS DEVICE WITH AN INTEGRATED BATTERY/ANTENNA AND RELATED METHODS - A mobile wireless communications device may include a portable housing, a cellular transceiver carried by the portable housing, and a battery carried by the portable housing and comprising a pair of electrodes and an electrolyte therebetween. The mobile wireless communications device may further include a wireless communications circuit carried by the portable housing and configured to wirelessly communicate via at least one of the electrodes. | 11-10-2011 |
20130063314 | MOBILE WIRELESS COMMUNICATIONS DEVICE INCLUDING A SLOT ANTENNA AND RELATED METHODS - A mobile wireless communications device may include a portable housing and a printed circuit board (PCB) carried by the portable housing. The mobile wireless communications device may also include at least one electronic component carried by the PCB and an electrically conductive enclosure coupled to the PCB and having a top spaced above the PCB over the at least one electronic component. The top of the electrically conductive enclosure may have a slot therein defining a slot antenna. | 03-14-2013 |
20140232604 | MOBILE WIRELESS COMMUNICATIONS DEVICE WITH ELECTRICALLY CONDUCTIVE CONTINUOUS RING AND RELATED METHODS - A mobile wireless communications device may include a portable housing that may include an electrically conductive continuous ring defining a perimeter of the portable housing. The electrically conductive continuous ring may be configured to function as an antenna. The mobile wireless communications device may further include a printed circuit board (PCB) carried by the portable housing and may include an electrically conductive layer defining a ground plane. The mobile wireless communications device may further include wireless transceiver circuitry carried by the PCB and coupled to the antenna. The mobile wireless communications device may also include an electrically conductive shorting member coupled between the electrically conductive continuous ring and the ground plane. | 08-21-2014 |
Mark Whitmore, Broadstone GB
Patent application number | Description | Published |
---|---|---|
20130098254 | SCREEN PRINTING - A screen printing head for and method of printing deposits of a print medium onto a workpiece through apertures in a printing screen, the printing head comprising a vibration unit for vibrating a printing blade to condition print medium forward of the printing blade, wherein the printing blade is vibrated at least one frequency in the range of from about 20 kHz to about 200 kHz and with a displacement of at least about 0.4 pm. | 04-25-2013 |
Mark Alfred Whitmore, Dorset GB
Patent application number | Description | Published |
---|---|---|
20090211471 | SUPPORT SYSTEM AND METHOD FOR A SCREEN PRINTING UNIT - A support system and method for supporting a printing screen unit in a screen printing machine. The support system includes a support assembly comprising a support unit for supporting a printing screen unit comprising a printing screen including printing apertures through which printing medium is printed onto a workpiece; and a tensioning mechanism for tensioning the printing screen in a screen printing operation, wherein the tensioning mechanism is configured to tension the printing screen to a first tension in a printing phase in printing printing medium onto a workpiece and a second tension, which is lower than the first tension, in a separation phase in separating the printing screen unit and the workpiece. Other aspects also are disclosed. | 08-27-2009 |
Stuart Joseph Whitmore, Solihull GB
Patent application number | Description | Published |
---|---|---|
20100213746 | VEHICLE SEAT BACKS - In the field of vehicle seats there is a need for an improved vehicle seat back tilt adjustment assembly that allows a user selectively to make small or large adjustments to the inclination of a vehicle seat back. A vehicle seat back tilt adjustment assembly comprises a guide member securable to a vehicle body; and an intermediate mechanism moveably coupled to the guide member. The intermediate mechanism includes first and second locking elements. The first locking element is moveable between a first configuration in which it is engagable with a vehicle seat back to secure the seat back to the intermediate mechanism and a second configuration in which the seat back is disengagable therefrom to allow the seat back to move independently of the intermediate mechanism. The second locking element selectively engages the guide member to secure the position of the intermediate mechanism relative to the guide member. | 08-26-2010 |