Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees


Ulrike

Ulrike Ahlrichs, Korntal-Muenchingen DE

Patent application numberDescriptionPublished
20090299578SAFETY DEVICE FOR MOTOR VEHICLES - A safety device for motor vehicles includes an impact detection system and a triggering device for triggering a braking operation as a function of a signal of the impact detection system characterized in that the triggering device is designed for the purpose of triggering the braking operation when the impact detection system indicates the beginning of an impact.12-03-2009

Patent applications by Ulrike Ahlrichs, Korntal-Muenchingen DE

Ulrike Albrecht, Aulendorf DE

Patent application numberDescriptionPublished
20080201182Method for determining an aggregated forecast deviation - In the method for determining an aggregated forecast deviation, deviations are aggregated in a predefined environment at all reference points in time and are incorporated into an error determination. Using this method, the aggregated forecast deviation for a product is determinable so that this product may be made available in a sufficient quantity. The method is thus suitable, e.g., for disposition planning, warehouse management, or warehousing products of all types.08-21-2008

Ulrike Bauder-Wuest, Schriesheim DE

Patent application numberDescriptionPublished
20110177002CYLIC POLYAMINES FOR BINDING PHOSPHATIDYLSERINE - The invention pertains to a compound for detecting cell death. According to the invention, the compound comprises a cyclic polyamine unit for the complexation of a bi- or trivalent metal ion. The compound of the invention may contain a reporting tag like fluorescein or a radioisotope including substituent.07-21-2011

Ulrike Bauder-Wust, Schriesheim DE

Patent application numberDescriptionPublished
20090130020DIAGNOSTIC AGENTS FOR POSITRON EMISSION IMAGING USING F-18 RADIO-LABELED AMINO-ALCOHOLS - This invention relates to novel compounds F-18 radio-labeled amino-alcohols suitable for labeling or already labeled by 05-21-2009

Ulrike Becker, Weil Am Rhein DE

Patent application numberDescriptionPublished
20090061491Novel fermentation method - This invention relates to a process for recycling biomass in fermentation processes, whereby the biomass that accumulates in the production of fermentation products is prepared by means of a special process and is recycled into the system. The prepared biomass can be used again in the fermentative production of vitamins, in particular vitamin B2, as a medium component in fermentation.03-05-2009

Ulrike Beutling, Braunschweig DE

Patent application numberDescriptionPublished
20090018027Method for Producing Chemical Microarrays - A method of producing a microarray, the microarray itself and the use of the microarray for detecting interactions between probe molecules and analyte molecules from a sample is provided. The method comprises the steps of synthesis, in two or more stages, of probe molecules on a polymeric support, bonds being formed between the probe molecules and the polymeric support; dispersion of the polymeric support having the synthetic probe molecules,01-15-2009

Ulrike Bewersdorff-Sarlette, Radebeul DE

Patent application numberDescriptionPublished
20090189280Method of Forming a Non Volatile Memory Device - In one embodiment, a method of forming a semiconductor device is disclosed. A high-k dielectric is deposited of over a semiconductor body, and a portion of the high-k dielectric is wet etched an etchant selected from the group consisting of hot phos, piranha, and SC1.07-30-2009

Ulrike Blume-Peytavi, Berlin DE

Patent application numberDescriptionPublished
20100285099VACCINATION BY TRANSCUTANEOUS TARGETING - The present invention relates to a method of vaccination via hair follicles that makes it possible to target vaccine components to the antigen-presenting cells in order to induce a protective and effective immune response against pathogens.11-11-2010

Ulrike Bockau, Muenster DE

Patent application numberDescriptionPublished
20110008835SYSTEM FOR THE HETEROLOGOUS EXPRESSION OF A VIRAL PROTEIN IN A CILIATE HOST CELL - The present invention relates to a system for the heterologous expression of a viral protein or a fragment thereof, said system comprising 01-13-2011

Ulrike Bockau, Munster DE

Patent application numberDescriptionPublished
20100021952Tetrahymena bifunctional dihydrofolate reductase-thymidylate synthase deficiency and its use - A method for producing a ciliate cell with reduced or essentially no dihydrofolate reductase (DHFS) activity or reduced or essentially no thymidylate synthase (TS) activity or both reduced or essentially no dihydrofolate reductase and thymidylate synthase (DHFR-TS) activity is claimed, comprising the steps of 01-28-2010

Ulrike Bromberger, Allschwil CH

Patent application numberDescriptionPublished
20090105480PROCESS FOR THE PREPARATION OF A DPP-IV INHIBITOR - The present invention is concerned with an improved process for the preparation of pyrido[2,1-a]isoquinoline derivatives of formula I04-23-2009

Ulrike Bruggaier, Oberhaching DE

Patent application numberDescriptionPublished
20090167050SOFT TOP CLOTH WITH STYLING EDGE - The object of providing a technical function edge and a styling edge is solved by the cloth for a soft top according to the invention which is designed to be stretchable over at least one solid element, wherein the solid element comprises at least one offsetting or indentation, and wherein the cloth overstretching the solid element is deformed by suitable clamping devices such that the cloth substantially follows the contour of the offsetting or indentation in the region of the offsetting or indentation.07-02-2009

Ulrike Clausen-Meiring, Senden DE

Patent application numberDescriptionPublished
20100197867BINDING AGENTS HAVING HIGH OH NUMBER AND CLEAR PAINT COMPOSITION COMPRISING SAID AGENTS AND HAVING GOOD OPTICAL CHARACTERISTICS AND GOOD SCRATCH AND CHEMICAL RESISTANCE - Disclosed are hydroxyl-functional binders having an OH number greater than or equal to 180 mg KOH/g as determined in accordance with DIN 53240 and a solubility parameter SP=10, and to clearcoat compositions comprising said binders. Also disclosed are processes for preparing the disclosed hydroxyl-functional binders, methods of making coated automotive substrates by applying the disclosed clearcoat compositions to automotive substrates, and to coated substrates made therefrom.08-05-2010
20100273975POLYOLS BASED ON MODIFIED AMINO RESINS, THEIR PREPARATION AND - Disclosed herein is a polyol (A) based on modified amino resins, prepared by reacting: an amino resin (B) comprising three acetalized or etherified N-methylol groups of the general formula (I)>N—CHR—OR10-28-2010

Ulrike Duderstadt, Hasselroth DE

Patent application numberDescriptionPublished
20110166312RHEOLOGY MODIFIER - The invention relates to a rheology modifier for improving the flowability of technical plastics, which drastically improves the thermoplastic processing behavior of the plastics without impairing the usage properties of the manufactured molded bodies.07-07-2011

Ulrike Folkers, Munchen DE

Patent application numberDescriptionPublished
20090232936Novel lipases and uses thereof - The invention relates to a newly identified polynucleotide sequence comprising a gene that encodes a novel lipolytic enzyme from 09-17-2009
20090275079Novel genes encoding novel proteolytic enzymes - The invention relates to newly identified gene sequences that encode novel proteases obtainable from 11-05-2009

Ulrike Gerdemann, Houston, TX US

Patent application numberDescriptionPublished
20110182870GENERATION OF CTL LINES WITH SPECIFICITY AGAINST MULTIPLE TUMOR ANTIGENS OR MULTIPLE VIRUSES - The present invention encompasses methods and compositions for the generation and use of cytotoxic T lymphocytes that target multiple viruses or that are specific for multiple tumor antigens. In specific embodiments, the generation methods employ use of certain cytokines to promote proliferation and reduce cell death in an activated T cell population and/or that employ a particular bioreactor having a gas permeable membrane.07-28-2011

Ulrike Gnabs, Kelkheim/taunus DE

Patent application numberDescriptionPublished
20110178345METHOD FOR UTILIZATION OF THE REACTION HEAT THAT OCCURS IN THE PRODUCTION PROCESS OF 1,2-DICHLOROETHANE FROM ETHYLENE IN A FLUIDIZED BED REACTOR - With a method for utilization of the reaction heat that occurs in the production of 1,2-dichloroethane from ethylene, by reaction with oxygen and hydrochloride (oxychlorination), in a fluidized bed reactor, with dissipation of this reaction heat through cooling pipe bundles situated within the reactor, positioned in the fluidized bed, utilization of the heat is supposed to be improved, while simultaneously reducing the size of the corresponding system elements. This is achieved in that part of the reaction heat is dissipated by heating boiler feed water, whereby the heated boiler feed water is used to heat heat sinks in the production process.07-21-2011

Ulrike Gnad-Vogt, Frankfurt DE

Patent application numberDescriptionPublished
20100330029Cancer Treatments with Radiation and Immunocytokines - The present invention is directed to a method for treating tumors and cancer cells by administering an immunocytokine following radiation treatment. This combination of treatments can stimulate an immune response at irradiated and non-irradiated sites, which is useful in eradicating cancer cells that have spread from the site of the primary tumor. In addition, immunocytokines can be administered at a dose that is less that the maximum tolerated dose, which reduces the side effects associated with immunocytokine therapy.12-30-2010

Ulrike Gruene De Jong, Wuppertal DE

Patent application numberDescriptionPublished
20100151242IMPREGNATING COMPOSITIONS - A composition for fixing wound items having excellent thermal transfer properties and a high level of electrical insulating properties under humid conditions comprising: 06-17-2010
20110160341COMPOSITION FOR FIXING WOUND ITEMS - The invention provides a composition for fixing wound items comprising at least one α,β-unsaturated polyester, and at least two different monomeric or oligomeric ethylenically unsaturated components. The composition of the present invention provides a composition having low curing emissions, low viscosities and excellent impregnation properties. After curing, these impregnation materials show high mechanical toughness levels even at elevated temperatures.06-30-2011

Ulrike Gruening-Von Schwerin, Munich DE

Patent application numberDescriptionPublished
20090190388RESISTIVE MEMORY AND METHODS FOR FORMING SAME - A method of fabricating a resistive storage device is provided. The method generally comprises providing an electrode structure stack comprising a first electrode and an electrode structure mask arranged at the first electrode, forming a support structure at least partly at the electrode structure mask, removing the electrode structure mask to leave a storage region window in the support structure, and forming a resistive storage region in the storage region window at the first electrode.07-30-2009
20090296449Integrated Circuit and Method of Operating an Integrated Circuit - According to one embodiment of the present invention, an integrated circuit is provided including a plurality of resistivity changing memory elements and a plurality of memory element select devices, wherein the select devices are floating body select devices.12-03-2009
20100084741Integrated Circuit - According to an embodiment, an integrated circuit including a plurality of resistance changing memory cells is disclosed. Each memory cell includes a first electrode, a second electrode and resistance changing memory element arranged between the first electrode and the second electrode. A front surface area of an end section of the first electrode that faces the resistance changing memory element is smaller than a front surface area of an end section of the second electrode that faces the resistance changing memory element.04-08-2010

Patent applications by Ulrike Gruening-Von Schwerin, Munich DE

Ulrike Henneboehle, Stuttgart DE

Patent application numberDescriptionPublished
20080296350Friction-Stir Tool with Form-Adaptable Shoulder - A friction-stir tool including a rotary-drivable tool body, at whose end facing away from the drive is provided a shoulder, from which extends in the direction of that end of the tool body that faces away from the drive, a rotatable rod-shaped projection that has a smaller diameter than the shoulder. The surface of the shoulder that points in the direction of the projection is form-adaptable.12-04-2008

Ulrike Hoesch-Vial, Nideggen DE

Patent application numberDescriptionPublished
20100233452Sandwich Structure and Method of Producing Same - The present invention concerns a method of producing a sandwich structure which is easy to produce and which has particular physical and/or chemical properties. To achieve that there is proposed a method of producing that sandwich structure which has the following steps: 09-16-2010

Ulrike Hohenthanner, Hanau DE

Patent application numberDescriptionPublished
20110107788CLIMATE CONTROL UNIT WITH GERM-PROOF SEPARATED SECTIONS - Climate control unit with an interior section containing a storage space and with a closable access opening to the storage section whereby at least one part of the interior section is separated and sealed against the rest of the interior section thus forming a separate germ-proof section. The division takes place at least in part by a membrane that is permeable for water vapor and gas but impermeable for microorganisms.05-12-2011

Ulrike Janhoefer, Heidelberg DE

Patent application numberDescriptionPublished
20090063258Engineered Labor Standards ("ELS") Management - An Engineered Labor Standards (“ELS”) scheduling system prepares preliminary estimates of task durations based on a subset of the conditions affecting task duration, then later prepares adjusted estimates when more information about the conditions becomes available. The actual time a resource spends performing the task is measured, and the estimates and measurements are stored in a database.03-05-2009
20090064025KPI Builder - A system and process that provides a set of tools and interfaces that facilitate the generation of reports for the monitoring of key performance indicators. The process may provide a basic set of measurement services that can be combined and re-used with one another to form more complex measurement services, queries and reports. The system provides an interface to facilitate the ease with which the basic measurement services can be modified and combined to create desired reports without the need for programming knowledge or skills.03-05-2009

Ulrike Kamecke, Mannheim DE

Patent application numberDescriptionPublished
20080275326SENSOR FOR MONITORING A CONDITION OF A PATIENT - A sensor may include a substrate having a sensing portion defining a sensor thereon and a circuit mounting portion defining at least one electrically conductive pad that is electrically connected to the sensor. The sensor may be configured to produce a signal indicative of a condition of the patient. An anisotropic medium may be disposed on the circuit mounting portion and may be electrically conductive in a direction through the medium and electrically insulating in directions along the medium. An electrical circuit may be mechanically mounted to the circuit mounting portion of the first substrate via the anisotropic medium with at least one electrically conductive terminal juxtaposed over the at least one electrically conductive pad. The anisotropic medium may establish local electrical contact between the at least one electrically conductive terminal and the at least one electrically conductive pad.11-06-2008

Ulrike Kaufmann-Reiche, Berlin DE

Patent application numberDescriptionPublished
20110003778MINERALCORTICOID RECEPTOR ANTAGONISTS FOR THE TREATMENT OF ENDOMETRIOSIS - The present invention provides the use of mineralocorticoid receptor antagonists for preparing a medicament for the treatment of endometriosis.01-06-2011

Ulrike Klauk, Pettendorf DE

Patent application numberDescriptionPublished
20100307456METHOD AND CONTROL UNIT FOR ELECTRIC CONTROL OF AN ACTUATOR OF AN INJECTION VALVE - A method for the electric control of an actuator of an injection valve in an injection facility for an internal combustion engine has the following steps: specifying a target value for a controlled variable (E) of the actuator, pilot controlling the controlled variable (E) according to a pilot control characteristic that is specified by an axis section (OffsCal, Offs-Real) and a characteristic gradient, wherein as part of the pilot control corresponding to the specified target value according to the pilot control characteristic a control variable for the electric control of the actuator is determined, and readjustment of the pilot control characteristic, wherein a control deviation (ΔE) is ascertained as part of the readjustment and the pilot control characteristic is adapted as a function of the control deviation (ΔE). It is proposed that as part of the readjustment the axis section of the pilot control characteristic is set.12-09-2010

Ulrike Koch, Dresden DE

Patent application numberDescriptionPublished
20110097338Use of Substances for Sensitization of Tumor Cells to Radiation and/or Chemotherapy - The invention relates to the use of substances to increase the sensitivity of tumor cells to treatment with radiation and/or chemotherapy. This is accomplished through the use of substances which block or limit the function of the PINCH-1 protein for sensitization of tumor cells to radiation and/or chemotherapy.04-28-2011

Ulrike Kramm, Berlin DE

Patent application numberDescriptionPublished
20110130270METHOD FOR PREPARING FUEL CELL ELECTRODE CATALYST AND SOLID POLYMER FUEL CELL - According to the present invention, the catalyst performance of a chelate catalyst comprising a complex of a macrocyclic compound such as a porphyrin derivative is improved. Also, the following method is provided: a method for preparing a fuel cell electrode catalyst comprising a nitrogen-containing metal complex in which a metallic element is coordinated with a macrocyclic organic compound, such method comprising the steps of: adding tin oxalate to the nitrogen-containing metal complex; and baking a mixture of the nitrogen-containing metal complex and tin oxalate in an inert gas atmosphere, wherein elution of metal tin is carried out via acid treatment.06-02-2011

Ulrike Kuckelkorn, Berlin DE

Patent application numberDescriptionPublished
20090012007Mimetic Peptides and the Use Thereof in the Form of 20S, 26S and Immunoproteasome Inhitibors - The present invention relates to peptide-mimetic compounds, the synthesis and use thereof fort he inhibition of proteasomes and the induction of apoptosis in tumour cells. The present invention furthermore relates to pharmaceutical compositions comprising the compounds and the use of the compounds for a treatment of diseases, in particular cancer and neurodegenerative diseases.01-08-2009

Ulrike Lange, Cambridge GB

Patent application numberDescriptionPublished
20090298155Epigenetic Regulatory Complex for Control of Gene Expression - An epigenetic regulatory polypeptide complex comprises at least a first domain having site-specific DNA binding activity and at least a second domain having an arginine methyltransferase activity, wherein the second domain is capable of methylating an arginine residue located in the tail region of a histone H2A. The complex is able to regulate gene expression in cells, particularly in mammalian stem cells by controlling the methylation of R3 in the tail regions of histones H2A and H4. The complex is exemplified by a polypeptide complex comprising the DNA binding activity of Blimpi and the arginine methyltransferase activity of Prmt5.12-03-2009

Ulrike Lindequist, Greifswald DE

Patent application numberDescriptionPublished
20090280179Resorbable Calcium Phosphate Based Biopolymer-Cross-Linked Bone Replacement Material - A resorbable bone replacement material made of calcium phosphate particles of different phases which are embedded in an inventive-specific cross-linked collagen matrix. The goal is to form a non-brittle, bone replacement moulded body having a positive fit, i.e. having a shape which is anatomic and/or corresponds to the defect, which perfectly fills the bone defect and can be resorbed thereby. Said goal is achieved by producing the bone replacement material made of a mixture of calcium phosphate particles which is embedded in an inventive cross-linked collagen matrix. In particular, the collagen cross-linking is achieved by a Laccase-induced peptide cross-linking and suitable bridge molecules. Essentially substituted dihydroxyarmotes and/or substrates of the lignolytic polyphenoloxidases, such as Laccases, are suitable as bridge molecules. Also, monocyclic ortho-dihydroxyaromates, monocyclic para-dihydroxyaromates, bicyclic monohydroxyaromates, polycyclic monohydroxyaromates, bicyclic dihydroxyaromates, polycyclic dihydroxyaromates, bicyclic trihydroxyaromates, polycyclic trihydroxyaromates, or mixtures thereof are used. The inventive hydroxyaromates are not part of a polymer chain as opposed to the known conchal adhesive.11-12-2009
20090318584Adhesive for Medical Applications and Means for Haemostasis - The invention relates to a kit comprising the following individual components: (a) polymers comprising at least one free amino group, (b) bridge molecules selected from the group consisting of monocyclic ortho-dihydroxyaromates, mono-cyclic para-dihydroxyaromates, bicyclic monohydrxyaromates, polycyclic monohydroxyaromates, bicyclic dihydroxyaromates, polycyclic dihydroxyaromates, bicyclic trihydroxyaromates, polycyclic trihydroxyaromates, and mixtures thereof, and (c) polyphenoloxidases, in particular, lignolytic polyphenoloxidases, whereby the individual components b) and c) are not in contact.12-24-2009
20110040086Novel Beta-Lactam Antibiotics, Methods for Their Production, and Their Use - The invention relates to novel antimicrobial agents that are based on β-lactam derivatives and are produced by reacting previously known β-lactam derivatives with polyphenol oxidase substrates under the influence of free radicals and by forming salts of any β-lactam derivatives with polyhexamethylene biguanide hydrogen carbonate. Said novel compounds are suitable as an antibiotic.02-17-2011
20110150943ADHESIVE FOR MEDICAL APPLICATIONS AND MEANS FOR HAEMOSTASIS - The invention relates to adhesives for medical applications and methods of their preparation and use.06-23-2011

Patent applications by Ulrike Lindequist, Greifswald DE

Ulrike Mahring, Essen DE

Patent application numberDescriptionPublished
20100266651EMULSIFIER INCLUDING GLYCERIN-MODIFIED ORGANOPOLYSILOXANES - The invention relates to emulsifiers comprising glycerin-modified organopolysiloxanes and to their use for the preparation of extraordinarily stable emulsions and dispersions.10-21-2010

Ulrike Moedder, Rochester, MN US

Patent application numberDescriptionPublished
20100062476ASSESSING MAMMALS FOR VASCULAR DISEASES AND VALVULAR DISEASES - This document provides methods and materials related to assessing mammals for vascular disease. This document also provides methods and materials related to assessing mammals for valvular disease. For example, methods and materials for assessing mammals for vascular disease using elevated levels of endothelial progenitor cells expressing a bone-related polypeptide (e.g., an osteocalcin polypeptide) as markers are provided.03-11-2010

Ulrike Müller, Frankfurt DE

Patent application numberDescriptionPublished
20100322956METHODS AND SUBSTANCES FOR THE TREATMENT OF ALZHEIMER'S - The present invention relates to a combination of one or more nucleic acids encoding, (a) in a first open reading frame (i) a promoter, (U) an amyloid peptide, (iii) a cell surface targeting signal, (iv) a transmembrane anchoring domain and (b) in a second open reading frame (i) a group specific antigen (gag). Also the invention relates to a pharmaceutical composition and a vaccine comprising Aβ-retrop articles.12-23-2010

Ulrike Müller, Frankfurt DE

Patent application numberDescriptionPublished
20100322956METHODS AND SUBSTANCES FOR THE TREATMENT OF ALZHEIMER'S - The present invention relates to a combination of one or more nucleic acids encoding, (a) in a first open reading frame (i) a promoter, (U) an amyloid peptide, (iii) a cell surface targeting signal, (iv) a transmembrane anchoring domain and (b) in a second open reading frame (i) a group specific antigen (gag). Also the invention relates to a pharmaceutical composition and a vaccine comprising Aβ-retrop articles.12-23-2010

Ulrike Ohnemuller, Wachenheim DE

Patent application numberDescriptionPublished
20090209699Method of producing a rubber composition - The invention is directed to a method of manufacturing a rubber composition with improved processing properties and optimized abrasion characteristics. Three methods with differing number of processing steps for the manufacture of a rubber composition with improved processing properties and optimized abrasion characteristics are disclosed.08-20-2009

Ulrike Palm-Plessmann, Fuerth DE

Patent application numberDescriptionPublished
20090060302METHOD AND IMAGE EVALUATION SYSTEM FOR PREPARATION OF MEDICAL 2D OR 3 D DATA - In a method and system to prepare medical 2D or 3D data, in particular 2D or 3D image data acquired by means of computed tomography, a data set composed of medical 2D or 3D data is segmented with predeterminable first segmentation parameters, so a first data set with segmented data and a second data set with data complementary to the first data set are generated and stored. Predeterminable color or grey value tables (known as presets) are provided that respectively associate colors or grey values with individual data value ranges. Respective presets are automatically associated with the first data set and the second data set. At an output unit, at least one slice or volume image of the first and/or second data set is presented as a resulting image/resulting images in colors/grey scales according to the associated presets.03-05-2009

Ulrike Pfaar, Rheinfelden DE

Patent application numberDescriptionPublished
20090239879N-OXIDES OF N-PHENYL-2-PYRIMIDINE-AMINE DERIVATIVES - The invention relates to N-phenyl-2-pyrimidine-amine derivatives derivatives in which at least one nitrogen atom carries an oxygen atom to form the corresponding N-oxides, to processes for the preparation thereof, to pharmaceutical compositions comprising those compounds, and to the use thereof in the preparation of pharmaceutical compositions for the therapeutic treatment of warm-blooded animals, including humans.09-24-2009
20100222362N-OXIDES OF N-PHENYL-2-PYRAMIDINE-AMINE DERIVATIVES - The invention relates to N-phenyl-2-pyrimidine-amine derivatives derivatives in which at least one nitrogen atom carries an oxygen atom to form the corresponding N-oxides, to processes for the preparation thereof, to pharmaceutical compositions comprising those compounds, and to the use thereof in the preparation of pharmaceutical compositions for the therapeutic treatment of warm-blooded animals, including humans.09-02-2010

Patent applications by Ulrike Pfaar, Rheinfelden DE

Ulrike Rakusch, Graz AT

Patent application numberDescriptionPublished
20090126506Method For Determining The Density Of Fluid Media - The actual density of liquids is determined with a flexural oscillator that is excited at two different natural vibrations. The presence of air/gas inclusions or other inhomogeneities in a liquid is detected and their influence can be eliminated. In an initial step, the periods of the inherent vibrations and of at least one vibration damping value of the natural vibrations are determined for liquids having different densities ρ and viscosities. Liquid densities as well as the difference between them and between the vibration damping values are determined from this. An inclusion-free curve (KB) which reflects the functional dependence F(ρδ) between the relative density differences and the vibration damping differences is calculated and the exact function determined; i.e. the gas/air inclusion-free curve (KB) is expanded by introducing a deviation bandwidth (ab) to form an inclusion-free curve area (KF), which is stored. The functional value F(ρδ) of the liquid to be tested is determined and a check is performed to ascertain whether it is within the inclusion-free curve area and whether the resulting value of the density ρ is or is not applicable to the liquid being tested.05-21-2009

Ulrike Rockrath, Seden DE

Patent application numberDescriptionPublished
20080249250Copolymers Containing Lateral Carbamate Groups And Groups Which Can Be Activated With Actinic Radiation, Processes For Preparing Them, And Their Use - Copolymers (A) containing lateral, primary and/or secondary carbamate groups (a12) and groups (a31) which can be activated with actinic radiation, preparable by10-09-2008

Ulrike Rockrath, Senden DE

Patent application numberDescriptionPublished
20090306279STRUCTURALLY VISCOUS, CURABLE, AQUEOUS POWDER DISPERSIONS FREE ENTIRELY OR SUBSTANTIALLY FROM ORGANIC SOLVENTS, PROCESS FOR PREPARING THEM, AND USE THEREOF - Structurally viscous, curable, aqueous powder dispersions free entirely or substantially from organic solvents and comprising dimensionally stable particles (A) having an average particle size as measured by the laser diffraction method of D (v, 0.5)=1 to 10 μm, the dimensionally stable particles (A) comprising as binder 10% to 100% by weight of at least one (meth)acrylate copolymer (A1) having an OH number of 40 to 250 mg KOH/g and an acid number of 5 to 100 mg KOH/g and prepared by multistage copolymerization of12-10-2009
20100273975POLYOLS BASED ON MODIFIED AMINO RESINS, THEIR PREPARATION AND - Disclosed herein is a polyol (A) based on modified amino resins, prepared by reacting: an amino resin (B) comprising three acetalized or etherified N-methylol groups of the general formula (I)>N—CHR—OR10-28-2010

Patent applications by Ulrike Rockrath, Senden DE

Ulrike Salat, Eberfing DE

Patent application numberDescriptionPublished
20100221715DETECTION OF BORDETELLA - The invention provides methods to detect 09-02-2010
20100227322Detection of Bordetella - The invention provides methods to detect 09-09-2010

Ulrike Samulowitz, Langenfeld DE

Patent application numberDescriptionPublished
20090087446COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY - Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.04-02-2009
20090137519SEMI-SOFT C-CLASS IMMUNOSTIMULATORY OLIGONUCLEOTIDES - The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.05-28-2009

Patent applications by Ulrike Samulowitz, Langenfeld DE

Ulrike Scheuvens, Langenfeld DE

Patent application numberDescriptionPublished
20090257812RUCKSACK APPLICATOR DEVICE - A device, for applying a flowable medium to a surface, includes a container, equipment to be worn on a back, a hose and a hose adapter, which can attach the hose to an outlet opening of the container, and which includes a ventilating element. The device further includes a handle having an end to which a wiping or applying device is mounted. The equipment includes a mounting plate attached to supporting straps to hold the container; and the container includes coupling elements for coupling the container to the mounting plate. A duct of the device extends from a first end of the hose, such that, when the hose is attached to the container, at the first end thereof, by the hose adapter, the duct conducts the flowable medium, from the container, to an outlet of the handle, which outlet is spaced apart from the wiping or applying device.10-15-2009

Patent applications by Ulrike Scheuvens, Langenfeld DE

Ulrike Schloeder, Reutlingen DE

Patent application numberDescriptionPublished
20100002460Projection Module of an Automobile Headlight - The invention relates to a projection module (01-07-2010

Ulrike Schmid, Az Wormerveer NL

Patent application numberDescriptionPublished
20100330228SOUP OR SAUCE COMPOSITION - A soup or sauce comprising: water; one or more components selected from meat ingredients, vegetable ingredients and carbohydrates; and from 0.5% to 20% by weight added fat, wherein said fat comprises at least 90% by weight conjugated linoleic acid.12-30-2010
20110124897Process for Refining a Triglyceride Oil - A process for refining a triglyceride oil comprises:—providing a triglyceride oil;—bleaching the oil in the presence of an added antioxidant in a first bleaching step;—bleaching the oil in a second bleaching step; and—deodorizing the bleached oil, wherein the antioxidant comprises a rosemary extract.05-26-2011

Ulrike Schmidt, Boeblingen DE

Patent application numberDescriptionPublished
20090112554Test Bench, Method, and Computer Program Product for Performing a Test Case on an Integrated Circuit - The disclosure relates to a test bench, method, and computer program product for performing a test case on an integrated circuit. The test bench may comprise a simulation environment representing an environment for implementing the integrated circuit and a reference model of the integrated circuit, wherein the reference model may be prepared for running within the simulation environment. The test bench may further comprise a device for running a simulation on the reference model within the simulation environment. The reference model may be based on an original reference model provided for a formal verification.04-30-2009

Ulrike Schmidt-Freytag, Dusseldorf DE

Patent application numberDescriptionPublished
20100113639METAL COMPOUNDS FOR USE AS INITIATORS - The present invention relates to initiators of the general formula {[M(L)05-06-2010
20100151253Primer Compositions for Adhesive Bonding Systems - The present invention relates to primer compositions for adhesive bonding systems. The primer compositions may be in the form of sprayable aqueous dispersions, which are shelf stable at ambient temperatures for up to three months under ambient temperature conditions, and demonstrate a cure profile of 45 to 120 minutes within the temperature range of 220° F. to 350° F. within 60 minutes of application. Significantly, the inventive primer compositions are substantially free of chromate.06-17-2010

Ulrike Schmidt-Freytag, Duesseldorf DE

Patent application numberDescriptionPublished
20100160476FLAME-RETARDANT ADDITIVES - The present invention relates to a curable preparation, containing an epoxy resin system, an initiator, and at least one flame-retardant agent, selected from a compound of the formula KA, wherein K=mono, di, oligo, and/or polphosphonium cation, and A=low-coordinating anion, and to the sue of the compounds of the general formula KA as a flame-retardant agent for resins systems.06-24-2010
20100285309PRIMER COMPOSITIONS FOR ADHESIVE BONDING SYSTEMS AND COATINGS - The present invention relates to aqueous-based primer composition, comprising at least one thermosetting, self-emulsifying epoxy resin composition; at least one thermosetting, non-self-emulsifying resin composition; water; and at least one curative.11-11-2010

Ulrike Scholz, Korntal DE

Patent application numberDescriptionPublished
20090261962Tire Sensor Module and Method for its Manufacture - A tire sensor module having a circuit carrier, on or in which at least one sensor element is attached for measuring a measured variable, an antenna for transmitting sensor signals to a receiving unit of the vehicle, and a housing, in whose housing inner chamber the circuit carrier is received, the antenna being provided in the housing material of the housing or on a housing side of the housing.10-22-2009

Ulrike Schubert, Munchen DE

Patent application numberDescriptionPublished
20110027268ANTI-MESOTHELIN ANTIBODIES AND USES THEREOF - The present invention provides recombinant antigen-binding regions and antibodies and functional fragments containing such antigen-binding regions that are specific for the membrane-anchored, 4O.kDa mesothelin polypeptide, which is overexpressed in several tumors, such as pancreatic and ovarian tumors, mesothelioma and lung cancer cells. These antibodies, accordingly, can be used to treat these and other disorders and conditions. Antibodies of the invention also can be used in the diagnostics field, as well as for further investigating the role of mesothelin in the progression of disorders associated with cancer. The invention also provides nucleic acid sequences encoding the foregoing antibodies, vectors containing the same, pharmaceutical compositions and kits with instructions for use.02-03-2011

Ulrike Schulz, Jena DE

Patent application numberDescriptionPublished
20090053465SCRATCH RESISTANT, REFLECTION REDUCING SURFACE HAVING ANTI-FOGGING PROPERTIES - An optical element or component having excellent anti-fog effects as well as excellent scratch resistance and/or reflection reducing effects and optionally also hydrophobic and/or oleophobic properties, and a method for producing such an optical element or component. The element or component includes, in the following order, a glass substrate, a water-absorbing first layer, and a second layer selected from (i) an anti-reflecting coating; a mirror coating and a hard layer; (ii) a compound and/or combination of a hard layers and anti-reflecting coatings; and (iii) a compound and/or combination of hard layers and mirror coating. Blind holes or bores are introduced into the second layer and the water-absorbing first layer with the holes opening out from the second layer and extending completely through the second layer, and at least partially through the water-absorbing first layer.02-26-2009
20090261063Method for Producing a Nanostructure on a Plastic Surface - A nanostructure is produced at a surface of a substrate composed of a plastic by means of a plasma etching process. A thin layer is applied to the plastic substrate and the plasma etching process is subsequently carried out.10-22-2009
20100033819Optical Element with an Anti-Fog Layer and Method for its Production - An optical element is provided with a fog reducing polymer layer. A reflection reducing nanostructure is formed on the surface of the fog reducing polymer layer.02-11-2010
20100062175Method for Manufacturing an Optical Waveguide Layer - A method for manufacturing an optical waveguide layer includes a substrate that is prepared, onto which a first part-layer is first grown. Subsequently, a second part-layer of the waveguide layer, consisting of the same material as the first part-layer, is grown on the first part-layer. The second part-layer is bombarded with ions as it grows. The method permits manufacturing optical waveguide layers on temperature-sensitive polymer substrates.03-11-2010
20110051246Reflection-Reducing Interference Layer System and Method for Producing It - A reflection-reducing interference layer system is disclosed, which has at least three alternating layers having different refractive indices. At least one nanostructured layer comprising an organic material or an organic-inorganic hybrid material is applied to the alternating layers. With the interference layer system, it is possible to obtain very low reflection over a wide wavelength and incident angle range.03-03-2011

Patent applications by Ulrike Schulz, Jena DE

Ulrike Simchen, Holzminden DE

Patent application numberDescriptionPublished
20110081303TEETH CLEANING COMPOUND CONTAINING MENTHOL WITH REDUCED BITTER SENSATION - The present invention primarily concerns teeth cleaning compounds containing menthol for use with a toothbrush, preferably tooth pastes, tooth crèmes, tooth cleaning gels or tooth powders. Such a tooth cleaning compound according to the invention contains menthol and a quantity, for masking the bitterness of the menthol, of menthane carboxylic acid-N-(4-methoxyphenyl)-amide (WS-12) of the following formula (Ia), in particular of the following formula (Ib), i.e. L-menthane carboxylic acid-N-(4-methoxyphenyl)-amide.04-07-2011

Ulrike Simnacher, Ulm DE

Patent application numberDescriptionPublished
20100143952BIOCHIP, AND METHOD FOR THE SELECTIVE IDENTIFICATION OF CHLAMYDIA TRACHOMATIS INFECTIONS - The present invention relates to a method for the selective identification of 06-10-2010

Ulrike Stierschneider, Vienna AT

Patent application numberDescriptionPublished
20100129388PROTECTIVE PROTEINS OF S. AGALACTIAE, COMBINATIONS THEREOF AND METHODS OF USING THE SAME - The invention relates to a composition comprising at least two protective proteins against 05-27-2010
20100260790S. Pneumoniae Antigens - The present invention discloses isolated nucleic acid molecules encoding a hyperimmune serum reactive antigen or a fragment thereof as well as hyperimmune serum reactive antigens or fragments thereof from 10-14-2010

Ulrike Stöhr, Mainz DE

Patent application numberDescriptionPublished
20100130246Method and Apparatus for Producing Hybrid Lenses - The invention generally concerns optical systems and, in particular, a method and device for joining at least one first and one second optical element to an optical composite element, as well as an optical composite element itself. In order to produce optical systems having at least two optical elements more easily and more economically, the invention provides a method for joining at least one first and one second optical element, in which the first optical element contains a first glass or a crystalline material, the second optical element contains a second glass, and the first glass or the crystalline material has a transformation temperature Tg1 or a melting temperature that differs from the transformation temperature Tg2 of the second glass, and at least the glass of the second optical element is heated and brought into contact with the glass or with the crystalline material of the first optical element. The invention also relates to a device for carrying out the method and to an optical composite element that can be produced using the method.05-27-2010

Ulrike Tontsch-Grunt, Baden AT

Patent application numberDescriptionPublished
200901052163- (AMINOMETHYLIDEN) 2-INDOLINONE DERIVATES AND THEIR USE AS CELL PROLIFERATION INHIBITORS - The present invention encompasses compounds of general formula (1) wherein R04-23-2009
20090163467New compounds - The present invention encompasses compounds of general formula (1)06-25-2009
20090197876INDOLINONE DERIVATIVES SUBSTITUTED IN THE 6 POSITION, THEIR PREPARATION AND THEIR USE AS MEDICAMENTS - The present invention relates to indolinone derivatives, substituted in the 6-position, of the formula08-06-2009
20100144706Compounds - The present invention encompasses compounds of general formula (1) wherein R06-10-2010
20100222331NEW COMPOUNDS - The present invention encompasses compounds of general Formula (1) wherein R09-02-2010

Patent applications by Ulrike Tontsch-Grunt, Baden AT

Ulrike Umgelder, Leverkusen DE

Patent application numberDescriptionPublished
20090011045Pharmaceutical for Hygienic Administration in the Ear - The invention relates to a system for hygienically administering, particularly in animals, an ear medicament which can be dosed reproducibly even in the case of low volumes and which is not flung out once again even when the head is shaken.01-08-2009

Ulrike Umgelder, Koln DE

Patent application numberDescriptionPublished
20090239835STABILIZATION OF GLUCOCORTICOID ESTERS WITH ACIDS - The invention relates to nonaqueous pharmaceutical preparations comprising a glucocorticoid ester and an acid, and to the stabilization of glucocorticoid esters in such preparations by acids.09-24-2009

Ulrike Wachendorff-Neumann, Newied DE

Patent application numberDescriptionPublished
20100029588SUBSTITUTED PHENYLAMIDINES AND THE USE THEREOF AS FUNGICIDES - The present invention relates to oxime ether-, hydrazone- or azomethine-substituted phenylamidines of the general formula (I), to a process for their preparation, to the use of the amidines according to the invention for controlling unwanted microorganisms and also to a composition for this purpose, comprising the amidines according to the invention. Furthermore, the invention relates to a method for controlling unwanted microorganisms by applying the compounds according to the invention to the microorganisms and/or their habitat.02-04-2010

Ulrike Wachendorf-Neumann, Neuwied DE

Patent application numberDescriptionPublished
20090118286Heterobicyclic Acrylamides - Use of heterobicyclic acrylamides of the formula (I)05-07-2009
20100113276USE OF N2-PHENYLAMIDINES AS HERBICIDES - The use of N05-06-2010

Ulrike Weber, Potsdam DE

Patent application numberDescriptionPublished
20110077625OPHTHALMIC APPARATUS AND METHOD OF OPERATING THE SAME - An ophthalmic apparatus including an observation system configured for displaying a moving image of a patient's eye, an optical system for directing an illumination beam into the patient's eye and for directing an observation beam from the patient's eye into the observation system, a control system configured for controlling the optical system, and a control stick for inputting control signals into the control system including an auxiliary control element being provided on the control stick for inputting auxiliary control signals into the control system, wherein the control system is configured for controlling a display mode of displaying the moving image of the observation system according to the auxiliary control signals. The invention further relates to a method of operating said ophthalmic apparatus.03-31-2011

Ulrike Weber, Waldbrunn DE

Patent application numberDescriptionPublished
20090117389Coating Materials with Oxygen Scavenger and/or Oxygen Indicator Function for Coating or Bonding and Products Produced Therewith - The present invention relates to a surface-coating material comprising a matrix of an at least partly organic polymer and also at least one component selected from components which, following appropriate triggering, are reactive towards oxygen. These components are preferably oxygen-consuming and/or they are able to indicate the presence of oxygen. The surface-coating material is suitable in particular as a coating material or as an adhesive. The invention further relates to a substrate provided with a coating of the stated surface-coating material, to a composite material composed of a plurality of layers which have been joined using this surface-coating material, and to production processes therefor. In one particular embodiment the matrix is formed from an organic-inorganic hybrid polymer; alternatively it may have a purely organic construction. The component that is reactive towards oxygen may either be embedded in the matrix or incorporated covalently therein.05-07-2009

Ulrike Wegerle, Worms DE

Patent application numberDescriptionPublished
20090259083METHOD OF REGENERATING RUTHENIUM CATALYSTS FOR THE HYDROGENATION OF BENZENE - The present patent application describes a method of regenerating a ruthenium catalyst for the hydrogenation of benzene, which comprises flushing the catalyst with inert gas in a regeneration step until the original activity or part of the original activity has been attained.10-15-2009
20110130607REACTOR FOR CARRYING OUT AUTOTHERMAL GAS-PHASE DEHYDROGENATIONS - A reactor (06-02-2011
20110152576PROCESS FOR PREPARING CYCLIC KETONES - The present invention relates to a process for preparing at least one monocyclic ketone having from 4 to 20 carbon atoms by reacting a mixture G06-23-2011

Patent applications by Ulrike Wegerle, Worms DE

Ulrike Wenning, Pullach DE

Patent application numberDescriptionPublished
20080216652PROCESS AND DEVICE FOR SEPARATING HYDROGEN FROM GAS FLOWS HAVING AN OXYGEN CONSTITUENT - A process and a device for separating hydrogen from a gas flow having an oxygen constituent, comprised primarily of hydrogen, nitrogen, oxygen, carbon dioxide, carbon monoxide, methane and/or other hydrocarbons, is disclosed. The gas flow is compressed in a multi-stage compression process and then cooled to room temperature by a heat exchanger. After a pre-adsorber, the gas flow is fed to a catalytic process for removing the oxygen. The catalytic reaction for removing the oxygen takes place exothermically. The gas flow is then cooled to room temperature via another heat exchanger and fed to a pressure swing adsorption process for hydrogen separation. The hydrogen is separated there from the residual gas.09-11-2008
20080311015PROCESS AND DEVICE FOR SEPARATING HYDROGEN FROM GAS FLOWS BY A PRESSURE SWING ADSORPTION PROCESS - A process for separating hydrogen from a gas flow having an oxygen constituent and including predominantly hydrogen, nitrogen, oxygen, carbon dioxide, carbon monoxide, methane and/or other hydrocarbons, as well as a device for conducting the process, is disclosed. The gas flow undergoes a process to thermally convert oxygen prior to the pressure swing adsorption process.12-18-2008

Ulrike Werthmann, Biberach DE

Patent application numberDescriptionPublished
20110130437SALT FORMS OF A 6-FLUORO-1,2-DIHYDRO-2-OXO-3H-INDOL-3-YLIDENE DERIVATIVE, PROCESS FOR THEIR MANUFACTURE AND PHARMACEUTICAL COMPOSITIONS CONTAINING SAME - The present invention relates to salt forms of the compound 4-[(Z)-[[4-[(dimethylaminoJmethyllphenyllaminolCe-fluoro-1,2-dihydro2-oxo-3H-indol-3-ylidene)methyl]-benzenepropanoic acid which are suitable for pharmaceutical development and to a process for their manufacture.06-02-2011

Ulrike Weyer-Czernilofsky, Baden AT

Patent application numberDescriptionPublished
20100113414THIAZOLYL-DIHYDRO-INDAZOLES - The present invention encompasses compounds of the general formula (1)05-06-2010

Patent applications by Ulrike Weyer-Czernilofsky, Baden AT

Ulrike Weyer-Czernilofsky, Ingelheim Am Rhein DE

Patent application numberDescriptionPublished
20110118208Thiazolyl-Dihydro-Indazoles - The present invention encompasses compounds of general formula (1)05-19-2011