Shuping
Shuping Chen, Beijing CN
Patent application number | Description | Published |
---|---|---|
20100329279 | METHOD AND APPARATUS FOR DATA PROCESSING - A method for data processing is provided, the method comprises: determining the predicted transmission time required by the data packet to be transmitted currently during the transmission course and the residence time for the data packet residing in the buffer; when the sum of the predicted transmission time and the residence time is greater than the predetermined air interface time delay, discarding the data packet. By utilizing the technical scheme of the invention, the discarding time of the data packet is dynamically adjusted, the packet discarding rate is reduced, and the service quality is improved. An apparatus for data processing is also provided. | 12-30-2010 |
20150215979 | METHODS AND APPARATUS FOR DEVICE TO DEVICE COMMUNICATIONS - Various embodiments are directed to methods and apparatus efficiently utilizing WAN system resources that would otherwise go unused for device to device communications. In one exemplary embodiment the air link resources correspond to Guard Periods (GPs) in Special Sub-Frames of an LTE TDD WAN system. In various embodiments, wireless communications devices e.g., UE devices with device to device communications capability, self-configure to operate using a portion of the GP such as not to interfere with ongoing WAN signaling. Thus the WAN signaling and device to device signaling do not interfere with respect to one another. This approach facilities recurring availability of device to device air link communications resources in a recurring timing structure in a manner that does not interfere with WAN communications and improves the likelihood that transmitted device to device signals will be successfully recovered. | 07-30-2015 |
20150327263 | SUBFRAME CONFIGURATIONS FOR LTE TDD SYSTEMS - Certain aspects of the present disclosure propose techniques for transmitting uplink transmissions in special subframes for LTE TDD systems. Certain aspects provide a method that generally includes determining a region of uplink transmissions in uplink pilot timeslot (UpPTS), wherein the UpPTS comprises three or more symbols allocated for uplink transmissions, and transmitting in the UpPTS. | 11-12-2015 |
Shuping Kang, Shenzhen CN
Patent application number | Description | Published |
---|---|---|
20160126361 | SOLAR CELL MODULE AND MANUFACTURING METHOD THEREOF - A solar cell module comprises an upper cover plate, a front adhesive layer, a cell array, a back adhesive layer and a back plate superposed in sequence, the cell array comprising multiple cells, adjacent cells connected by a plurality of conductive wires, at least two conductive wires comprising the metal wire which extends reciprocally between surfaces of adjacent cells, the conductive wires being in contact with the cells, the front adhesive layer in direct contact with the conductive wires and filling between adjacent conductive wires. | 05-05-2016 |
Shuping Li, Shenzhen CN
Patent application number | Description | Published |
---|---|---|
20140236510 | DISTRIBUTED BATTERY MANAGEMENT SYSTEM AND METHOD OF IDENTIFICATION DISTRIBUTION USING THE SAME - A distributed battery management device and a method thereof are provided. The method comprises: receiving, by a battery management control module, a first identification distribution request from a first data acquisition module; activating, by the battery management control module, the first data acquisition module for monitoring one or more batteries; and sending, by the battery management control module, a first identification message corresponding to the first identification distribution request, to the first data acquisition module. The device comprises: a battery management control module; and a first data acquisition module communicatively coupled with the battery management control module, wherein the battery management control module and the first data acquisition module are configured to communicate with each other to identify the data acquisition module. | 08-21-2014 |
Shuping Liu, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140162261 | DETECTION KIT FOR IDENTIFYING GENOTYPE IN DEPRESSION PATIENTS AND METHOD OF USING THE SAME - The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment. | 06-12-2014 |
Shuping Ng, Alexandra Technopark SG
Patent application number | Description | Published |
---|---|---|
20110317179 | PRINTER DEVICE AND PRINTER SYSTEM - A printer device for printing character strings of a data item having the same content in a plurality of languages. The character strings are of a data item which is predetermined in each of a plurality of fields (FIELD | 12-29-2011 |
Shuping Pan, Meishan CN
Patent application number | Description | Published |
---|---|---|
20150210299 | Sub-frame Radial Bogie - A sub-frame radial bogie comprises wheelsets, a side frame, a swing bolster, a wheelset radial device and a brake gear. Bearing adapters ( | 07-30-2015 |
Shuping Tong, Barrington, RI US
Patent application number | Description | Published |
---|---|---|
20160024223 | Treating Hepatitus B Virus Infections - The specification provides compositions and methods of reducing a risk of a HBV infection in a subject and of treating a subject infected with HBV. | 01-28-2016 |
Shuping Xu, Changchun CN
Patent application number | Description | Published |
---|---|---|
20100140548 | Nanoaggregate composition and method for making - A nanoaggregate composition and method for making nanoaggregate compositions constructed with one, two, and three nanoparticle building blocks includes coating the building blocks with a concentration of polyvinylpyrrolidone (PVP) molecules based on a known relationship between the concentration and an extent of aggregation of the building blocks, and producing nanoaggregates from the building blocks comprising a mixture of single-core nanoaggregates, double-core nanoaggregates, and triple-core nanoaggregates as a function of the extent of aggregation. | 06-10-2010 |
Shuping Xu, Grand Forks, ND US
Patent application number | Description | Published |
---|---|---|
20120276290 | SILICA NANOPARTICLES WITH ROUGH SURFACE - A method for preparing nanoparticles includes preparing a mixture containing an organic solvent, surfactant and water; adding a first quantity of a first silica precursor and ammonia to the mixture; adding a second quantity of the first silica precursor and a second silica precursor to the mixture; adding acetone to the mixture; removing silica nanoparticles from the mixture; and drying the silica nanoparticles. | 11-01-2012 |
Shuping Zhang, Shenzhen CN
Patent application number | Description | Published |
---|---|---|
20120113815 | METHOD, DEVICE AND SYSTEM FOR EVALUATING NETWORK RELIABILITY - A method, a device and a system for evaluating network reliability are disclosed in the embodiments of the present invention. The method includes: determining an analysis object by acquiring network topology information; acquiring a network failure mode of the analysis object; and analyzing and evaluating reliability of the analysis object in a hierarchical and overall way with respect to the failure mode. As the concept of a hierarchical analysis is introduced into the analysis, analysis properties of analysis objects (for example, a node and a connection) are divided according to hierarchies, so that the network is effectively decomposed, an overall decomposing analysis is ensured, and the difficulty of the analysis is reduced. | 05-10-2012 |
Shuping Zhang, Beijing CN
Patent application number | Description | Published |
---|---|---|
20090222931 | NOVEL IDENTIFIED ONCOGENE WITH KINASE-DOMAIN (NOK) - A newly identified oncogene with kinase-domain (NOK) and its encoded polypeptide, and vectors, fusions, host cells and transgenic animals comprising the said nucleotide sequence. Furthermore, the present invention also describes the methods for diagnosing diseases including tumor and the methods for screening agents capable of inhibiting the occurrence and/or metastasis of tumor. | 09-03-2009 |
20120288876 | NOVEL IDENTIFIED ONCOGENE WITH KINASE-DOMAIN (NOK) - A newly identified oncogene with kinase domain (NOK) and its encoded polypeptide, and vectors, fusions, host cells and transgenic animals comprising the said nucleotide sequence. Furthermore, the present invention also describes the methods for diagnosing diseases including tumor and the methods for screening agents capable of inhibiting the occurrence and/or metastasis of tumor. | 11-15-2012 |