Hanson, US
Amy Hanson, Peoria, AZ US
Patent application number | Description | Published |
---|---|---|
20110120132 | DUAL WALLED COMBUSTORS WITH IMPINGEMENT COOLED IGNITERS - A combustor for a gas turbine engine includes an inner liner and an outer liner circumscribing the inner liner and forming a combustion chamber therewith. The outer liner is a dual walled liner with a first wall and a second wall. A fuel igniter includes a tip portion configured to ignite an air and fuel mixture in the combustion chamber. An igniter support assembly positions the fuel igniter relative to the combustion chamber. The igniter support assembly defines a plurality of holes configured to direct cooling air toward the tip portion of the fuel igniter. The igniter support assembly includes first and second floating seals that are configured to accommodate radial and axial relative movements. | 05-26-2011 |
20110120133 | DUAL WALLED COMBUSTORS WITH IMPROVED LINER SEALS - A combustor for a turbine engine is provided. The combustor includes a first liner and a second liner forming a combustion chamber. The combustion chamber is configured to receive an air-fuel mixture for combustion therein and having a longitudinal axis that defines axial and radial directions. The first liner is a first dual walled liner having a first hot wall facing the combustion chamber and a first cold wall that forms a first liner cavity with the first hot wall, the first liner cavity having first and second ends. A first liner seal is configured to seal the second end of the first liner cavity and to accommodate relative movement of the first hot wall and first cold wall generally in the axial and radial directions. | 05-26-2011 |
Amy T. Hanson, Peoria, AZ US
Patent application number | Description | Published |
---|---|---|
20090188256 | EFFUSION COOLING FOR GAS TURBINE COMBUSTORS - A combustor for a turbine engine includes an outer liner and an inner liner circumscribed by the outer liner to form a combustion chamber therewith in which an air and fuel mixture is combusted to form streamlines of combustion gases. A first plurality of effusion cooling holes is formed in at least one of the inner or outer liners, with the first plurality of effusion cooling holes being oriented as a function of the streamlines. | 07-30-2009 |
20090293486 | COMBUSTORS WITH IGNITERS HAVING PROTRUSIONS - A combustor for a gas turbine engine is provided, and includes an inner case; an outer case circumscribing the inner case and forming an annular pressure vessel therebetween; an inner liner positioned within the annular pressure vessel; an outer liner circumscribing the inner liner and forming a combustion chamber with the inner liner; and an igniter coupled to the outer case and extending to the outer liner such that the igniter is positioned to ignite an air and fuel mixture in the combustion chamber. The igniter includes a protrusion for coupling the igniter to the outer liner. | 12-03-2009 |
Arlis Hanson, Bath, SD US
Patent application number | Description | Published |
---|---|---|
20090185963 | METHOD FOR MAKING DIESEL FUEL ADDITIVE - Embodiments described herein include a system for making a biofuel, comprising: one or more vessels for storing an unreacted oil or fat; an enclosed vessel and mixer for mixing ethanol and a catalyst in quantities effective to make a biofuel; a vessel for mixing the oil or fat with the ethanol and catalyst to make a blend; a pressurized vessel for subjecting the blend to a pressure of 7500 to 8000 psi; an expansion vessel for releasing pressure on the blend; and a vessel with heating elements for heating the blend. | 07-23-2009 |
20110258911 | BIOFUEL PRODUCTION METHOD AND SYSTEM - In an embodiment of the present invention, a renewable energy fuel is prepared by a process including the steps of: a) providing a renewable energy feedstock; b) providing an alcohol; c) providing a catalyst; d) mixing (a), (b), and (c) to form a blend; and e) homogenizing the blend at a pressure greater than 400 kilogram-force per square centimeter (Kg/cm2). | 10-27-2011 |
20140290128 | BIOFUEL PRODUCTION METHOD AND SYSTEM - In an embodiment of the present invention, a renewable energy fuel is prepared by a process including the steps of: a) providing a renewable energy feedstock; b) providing an alcohol; c) providing a catalyst; d) mixing (a), (b), and (c) to form a blend; and e) homogenizing the blend at a pressure greater than 400 kilogram-force per square centimeter (Kg/cm2). | 10-02-2014 |
Beverly J. Ballard Hanson, Marlborough, MA US
Patent application number | Description | Published |
---|---|---|
20090313951 | Food storage bag fill facilitation method - The new idea the inventors are patenting is the method of using a square (or almost square) cardboard (or other non-slippery material) box of the right size to secure food storage bags without using clips while they are being filled making filling, sealing and storing much simpler. Also, inventors are proposing that manufacturers either sell the food storage bags in a container per above that could be used to hold the bags for filling or enclose a collapsible box in with the bags that would be the right size for holding the bags for filling. | 12-24-2009 |
Bradley C. Hanson, Harrisburg, SD US
Patent application number | Description | Published |
---|---|---|
20090078757 | Information management system and method - An information management system includes a computer server. The computer server includes an interface module. The information management system also includes a plurality of card processors in communication with the computer server via the interface module. The computer server is configured to interface with each of the plurality of card processors via the interface module. The computer server is configured to choose one of the plurality of card processors in accordance with a unique identifier associated with a card product to process information associated with the card product. | 03-26-2009 |
20120209731 | COMPUTER-BASED FUND TRANSMITTAL SYSTEM AND METHOD - A fund transmittal system includes a first agent portal module for receiving funds from a first entity to initiate a first fund transaction. The system includes a transaction network and a transaction processor. The first agent portal module routes the first fund transaction to the transaction processor via the transaction network. The transaction processor supplies an authorization code associated with the first fund transaction to the first entity. The first entity provides the authorization code to a second entity. The system includes a second agent portal module that receives the authorization code from the second entity to initiate a second fund transaction. The second agent portal module routes the authorization code to the transaction processor via the transaction network. The transaction processor approves the second fund transaction in accordance with the authorization code. Upon approval, the second agent portal module supplies the funds to the second entity. | 08-16-2012 |
20130161384 | INFORMATION MANAGEMENT SYSTEM AND METHOD FOR A PLURALITY OF INTERFACED CARD PROCESSORS - An information management system includes a computer server. The computer server includes an interface module. The information management system also includes a plurality of card processors in communication with the computer server via the interface module. The computer server is configured to interface with each of the plurality of card processors via the interface module. The computer server is configured to choose one of the plurality of card processors in accordance with a unique identifier associated with a card product to process information associated with the card product. | 06-27-2013 |
20140207653 | SYSTEM, PROGRAM AND METHOD FOR PROVIDING A SECURED CREDIT CARD COLLATERALIZED BY A TAX REFUND - A system, program and method of providing a secured credit card product to a customer may comprise steps generally relating to preparing a tax return for a customer for a previous year, and determining, based upon the preparation of the tax return, whether the customer is entitled to receive a tax refund. If the customer is entitled to receive a tax refund, offering a secured credit card product to the customer; determining if the customer meets eligibility requirements for the secured credit card product; and receiving the tax refund and using at least a portion of the amount of the tax refund of the customer to provide collateral for the secured credit card product of the customer. | 07-24-2014 |
Bradley J. Hanson, North Augusta, SC US
Patent application number | Description | Published |
---|---|---|
20090108618 | Instrument Panel Assembly of a Light-Weight Utility Vehicle - A multi-component instrument panel assembly for a light-weight utility vehicle is provided. The multi-component instrument panel assembly includes an instrument panel component including a first storage unit and a second storage unit. A first insert component is adapted to interconnect with a first side of the instrument panel component. A second insert component is adapted to interconnect with a second side of the instrument panel component. An eyebrow component is adapted to interconnect with the first insert component, the second insert component, and the instrument panel component. A beverage holder is adapted to interconnect with and outwardly extend from the instrument panel component and the eyebrow component. | 04-30-2009 |
20090108636 | Utility Vehicle Canopy - A utility vehicle canopy including a pair of lateral rain channels formed along a forward portion and an aft portion of a top side of the canopy. The canopy additionally includes a pair of longitudinal rain channels formed along a driver side portion and a passenger side portion of the canopy. The longitudinal rain channels interconnected with the lateral rain channels. The vehicle canopy further includes at least one outlet rain channel formed in the top side of the canopy. The outlet rain channel extends between an outer edge of the canopy and one of the lateral rain channels and/or one of the longitudinal rain channels. | 04-30-2009 |
Brian E. Hanson, Blacksburg, VA US
Patent application number | Description | Published |
---|---|---|
20090118454 | Nanocomposite Organolithic Macromolecular Material with Long-Range Structural Order - The present invention relates to compositions of matter comprising polyhedral structural units of empirical formula Si | 05-07-2009 |
Bruce Hanson, Melbourne, FL US
Patent application number | Description | Published |
---|---|---|
20090070745 | SYSTEM AND CORRESPONDING METHOD FOR TESTING SOFTWARE EMBEDDED IN AN ELECTRONIC DEVICE - A system includes an electronic device and an external tester to be temporarily coupled thereto. The electronic device includes an integrated circuit processor. The integrated circuit processor includes processor circuitry for executing dedicated code to perform a dedicated application, and an execution unit coupled to the processor circuitry. The external tester is to be temporarily coupled to the execution unit to collect execution characteristics while the processor circuitry executes the dedicated code to thereby test the dedicated code. | 03-12-2009 |
20120290164 | MULTI-ROLE UNMANNED VEHICLE SYSTEM AND ASSOCIATED METHODS - An unmanned vehicle may include a vehicle body that comprises an enclosed hull. The unmanned vehicle may include a propulsion, a ballast control system, a center of gravity system, a pressurization system, a control surface system, a navigation control system, and an on board master control system. The on board master control system may execute local control over operation of the various systems of the unmanned vehicle. The unmanned vehicle may also include a power supply carried by a portion of the vehicle body to provide power to the various systems. The various systems of the unmanned vehicle may be independently operable to support selective operation of the unmanned vehicle in the air, on the surface of the water, and below the surface of the water. | 11-15-2012 |
Chad W. Hanson, Jackson, TN US
Patent application number | Description | Published |
---|---|---|
20110123362 | AIR COMPRESSOR - An air compressor assembly can include a support structure with a compressor mechanism, at least one fluid tank, a pair of wheels, and a handle attached thereto. The air compressor assembly can be configured with the compressor mechanism having a perpendicular orientation relative to the at least one fluid tank so as to provide a relatively narrow assembly and to facilitate servicing and/or maintenance of the assembly. Furthermore, the wheels and handle can be configured so that the assembly can be relatively easily located in a balanced transport position. Additionally, an accessory support plate can be attached to the top of the assembly to serve as a dolly. | 05-26-2011 |
Daryl W. Hanson US
Patent application number | Description | Published |
---|---|---|
20110088555 | COMPRESSOR LUBRICANT RECLAIMING PROCESS AND SYSTEM - A system and method for reclaiming compressor lubricants wherein a gas stream containing a lubricant contaminant is compressed to produce a compressed gas stream containing lubricant, the compressed gas stream being separated to produce a lubricant stream containing contaminant, the lubricant/contaminant stream being sent through a separator wherein the contaminant is separated from the lubricant. | 04-21-2011 |
David Hanson, Pella, IA US
Patent application number | Description | Published |
---|---|---|
20090109081 | Positioning correction system and method for single and multi-channel ground penetrating radar - A mobile geophysical instrument produces geophysical data sets each associated with a position computed by use of a position sensor. A variable time delay results between a time when data for each geophysical data set is collected and a time when a position associated with each geophysical data set is recorded. A module receives distance transducer data and includes circuitry configured to generate a module signal based on trigger signals from the distance transducer and a calibration value. A data acquisition system (DAS) receives geophysical data sets from the geophysical instrument, positioning data from the positioning sensor, and the module signals. The DAS generates a DAS timestamp in response to each module signal and associates the DAS timestamp with each geophysical data set and a position associated with the geophysical data set, so as to substantially eliminate the variable time delay. | 04-30-2009 |
20140262509 | IMAGING UNDERGROUND OBJECTS USING SPATIAL SAMPLING CUSTOMIZATION - A system includes a drill string to which a sensor is attached, a rotation unit configured to rotate the drill string, and a displacement unit configured to longitudinally displace the drill string. A processor is coupled to the rotation and displacement units. The processor is configured to coordinate sampling, by the sensor, of three-dimensional space surrounding the sensor while rotating and displacing the drill string. The processor is further configured to coordinate adjusting of at least one of drill string rotation and drill string displacement so that acceptable spatial sampling of the space surrounding the sensor is achieved. | 09-18-2014 |
David A. Hanson, Urbandale, IA US
Patent application number | Description | Published |
---|---|---|
20080208342 | SPINAL IMPLANT - An implant is provided that includes a body having a convex and tapered leading end, a convex trailing end, opposing generally planar sides extending between the leading and trailing ends and superior and inferior surfaces. An opening extends through the body between the superior and inferior surfaces. The implant further includes a plurality of protrusions provided on each of the superior and inferior surfaces. Each protrusion has a flattened distal surface. The leading end includes first and second inclined surfaces and an intermediate surface, with the first inclined surface sloping downward from the superior surface to the intermediate surface and the second inclined surface sloping upward from the inferior surface to the intermediate surface. | 08-28-2008 |
Douglas Hanson, Niantic, CT US
Patent application number | Description | Published |
---|---|---|
20090117132 | Anti-Ctla-4 Antibody and Cpg-Motif-Containing Synthetic Oligodeoxynucleotide Combination Therapy for Cancer Treatment - The invention relates to administration of an anti-CTLA-4 antibody, particularly human antibodies to human CTLA-4, such as those having amino acid sequences of antibodies 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, 12.9.1.1, and MDX-010, in combination with an immunostimulatory nucleotide, i.e, CpG ODN PF3512676, for treatment of cancer. The invention relates to administering a combination of an anti-CTLA-4 antibody and CpG ODN PF3512676 as neoadjuvant, adjuvant, first-line, second-line, and third-line therapy of cancer, whether localized or metastasized, and at any point(s) along the disease continuum (e.g, at any stage of the cancer). | 05-07-2009 |
20120003179 | ANTI-CTLA-4 AND CPG-MOTIF-CONTAINING SYNTHETIC OLIGODEOXYNUCLEOTIDE COMBINATION THERAPY FOR CANCER TREATMENT - The invention relates to administration of an anti-CTLA-4 antibody, particularly human antibodies to human CTLA-4, such as those having amino acid sequences of antibodies 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, 12.9.1.1, and MDX-010, in combination with an immunostimulatory nucleotide, i.e., CpG ODN PF3512676, for treatment of cancer. The invention relates to administering a combination of an anti-CTLA-4 antibody and CpG ODN PF3512676 as neoadjuvant, adjuvant, first-line, second-line, and third-line therapy of cancer, whether localized or metastasized, and at any point(s) along the disease continuum (e.g., at any stage of the cancer). | 01-05-2012 |
Douglas C. Hanson, Niantic, CT US
Patent application number | Description | Published |
---|---|---|
20090087446 | COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY - Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines. | 04-02-2009 |
20120219571 | COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY - Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines. | 08-30-2012 |
Douglas Charles Hanson, Niantic, CT US
Patent application number | Description | Published |
---|---|---|
20080233116 | Human monoclonal antibodies to CTLA-4 - In accordance with the present invention, there are provided fully human monoclonal antibodies against human cytotoxic T-lymphocyte antigen 4 (CTLA-4). Nucleotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly contiguous heavy and light chain sequences spanning the complementarity determining regions (CDRs), specifically from within FR1 and/or CDR1 through CDR3 and/or within FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein. | 09-25-2008 |
20080233122 | Human monoclonal antibodies to CTLA-4 - In accordance with the present invention, there are provided fully human monoclonal antibodies against human cytotoxic T-lymphocyte antigen 4 (CTLA-4). Nucelotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly contiguous heavy and light chain sequences spanning the complementarity determining regions (CDRs), specifically from within FR1 and/or CDR1 through CDR3 and/or within FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein. | 09-25-2008 |
20120045442 | HUMAN MONOCLONAL ANTIBODIES TO CTLA-4 - In accordance with the present invention, there are provided fully human monoclonal antibodies against human cytotoxic T-lymphocyte antigen 4 (CTLA-4). Nucelotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly contiguous heavy and light chain sequences spanning the complementarity determining regions (CDRs), specifically from within FR1 and/or CDR1 through CDR3 and/or within FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein. | 02-23-2012 |
20120148597 | HUMAN MONOCLONAL ANTIBODIES TO CTLA-4 - In accordance with the present invention, there are provided fully human monoclonal antibodies against human cytotoxic T-lymphocyte antigen 4 (CTLA-4). Nucleotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly contiguous heavy and light chain sequences spanning the complementarity determining regions (CDRs), specifically from within FR1 and/or CDR1 through CDR3 and/or within FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein. | 06-14-2012 |
20140099325 | HUMAN MONOCLONAL ANTIBODIES TO CTLA-4 - In accordance with the present invention, there are provided fully human monoclonal antibodies against human cytotoxic T-lymphocyte antigen 4 (CTLA-4). Nucleotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly contiguous heavy and light chain sequences spanning the complementarity determining regions (CDRs), specifically from within FR1 and/or CDR1 through CDR3 and/or within FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein. | 04-10-2014 |
Eric H. Hanson, Las Vegas, NV US
Patent application number | Description | Published |
---|---|---|
20090170717 | RE-SEQUENCING PATHOGEN MICROARRAY - The present invention relates to pathogen detection and identification by use of DNA resequencing microarrays. The present invention also provides resequencing microarray chips for differential diagnosis and serotyping of pathogens present in a biological sample. The present invention further provides methods of detecting the presence and identity of pathogens present in a biological sample. | 07-02-2009 |
20110183856 | Diagnosis and Prognosis of Infectious Disease Clinical Phenotypes and other Physiologic States Using Host Gene Expression Biomarkers In Blood - The present invention provides a specific set of gene expression markers from peripheral blood leukocytes that are indicative of a host response to exposure, response, and recovery infectious pathogen infections. The present invention further provides methods for identifying the specific set of gene expression markers, methods of monitoring disease progression and treatment of infectious pathogen infections, methods of prognosing the onset of an infectious pathogen infection, and methods of diagnosing an infectious pathogen infection and identifying the pathogen involved. | 07-28-2011 |
George E. Hanson, Andover, KS US
Patent application number | Description | Published |
---|---|---|
20090046609 | TRANSACTION CONTROL SYSTEM INCLUDING PORTABLE DATA TERMINAL AND MOBILE CUSTOMER SERVICE STATION - A mobile customer service station operating within a wireless multi-hop communication network includes a console on a wheeled chassis. The console carries and houses a number of components which are used in merchandising operations to conclude customer purchase transactions. The items supported externally on the console are a printer for printing purchase receipts, customer credit charge agreements and records of transactions, and a magnetic card reader for reading information from a magnetic stripe of a customer's credit card. In one embodiment, the operation of the printer, credit card reader and the cash drawer is controlled by a multi-function control unit located within an enclosure of the console. The control unit is electrically powered by a self-contained power source which is preferably a deep cycle rechargeable battery. The console also houses a transceiver unit which under the control of the control unit is capable of interactive communication with a premises network. In another embodiment, the mobile service station comprises an access device which participates with a variety of peripherals at the station in a lower power communication LAN, while providing higher power communication to other network devices via a premises network with routing via a wireless spanning tree configuration. | 02-19-2009 |
20100167782 | TRANSACTION CONTROL SYSTEM INCLUDING PORTABLE DATA TERMINAL AND MOBILE CUSTOMER SERVICE STATION - A mobile customer service station operating within a wireless multi-hop communication network includes a console on a wheeled chassis. The console carries and houses a number of components which are used in merchandising operations to conclude customer purchase transactions. The items supported externally on the console are a printer for printing purchase receipts, customer credit charge agreements and records of transactions, and a magnetic card reader for reading information from a magnetic stripe of a customer's credit card. In one embodiment, the operation of the printer, credit card reader and the cash drawer is controlled by a multi-function control unit located within an enclosure of the console. The control unit is electrically powered by a self-contained power source which is preferably a deep cycle rechargeable battery. The console also houses a transceiver unit which under the control of the control unit is capable of interactive communication with a premises network. In another embodiment, the mobile service station comprises an access device which participates with a variety of peripherals at the station in a lower power communication LAN, while providing higher power communication to other network devices via a premises network with routing via a wireless spanning tree configuration. | 07-01-2010 |
George E. Hanson, Cedar Rapids, IA US
Patent application number | Description | Published |
---|---|---|
20090175318 | MULTI-LEVEL HIERARCHICAL RADIO-FREQUENCY COMMUNICATION SYSTEM - Portable measuring devices which communicate by low power transceivers through a communication controller with a printer device collect weight and size data on articles to be shipped. The collected weight and size data are combined with origin and destination data, and labels are printed bearing pertinent shipping and routing information in machine readable format. The labels are attached to the articles to be shipped and accompany the articles to their respective destinations. At transfer points the labels are read by scanner devices which also communicate by low power transceiver links with the communication controller. The wireless linking of the scanner devices promotes human safety by the absence of cords which could cause entanglement of an operator in mechanized conveying equipment. The communication controllers at each stage of the shipping process have the capability of transferring received and updated status information on the shipped articles to a central data station. | 07-09-2009 |
20100105444 | DATA PROCESSING AND COMMUNICATIONS DEVICE WITH INTERCHANGEABLE MODULES - A portable, hand-held data terminal of modular structure includes a base module with a keyboard and a display screen. A data and communications module may be selected from a number of different data and communications modules, each having different types of data communications transceivers, or including in addition data collection devices, such as shelf label readers or bar code readers. The base module includes a microprocessor-controlled data communications and control interface having a predetermined protocol. To adapt the various types of data and communications modules for selection of any one thereof to become attached to the base module and function therewith, each of the data and communications modules includes a microprocessor operable to function as an emulator to interact with the microprocessor of the base module and communicate with the microprocessor of the base module in accordance with the protocol of the data communications and control interface of the base module. | 04-29-2010 |
Goodwin F. Hanson, Logan, UT US
Patent application number | Description | Published |
---|---|---|
20110259002 | STIRLING CYCLE EPITROCHOIDAL HEAT ENGINE - An epitrochoidal Stirling type engine operating on a Carnot cycle. The engine has a hot end and a cool end. Each end has a three-lobed rotary piston or rotor eccentrically mounted. Each rotor is in a four-lobed housing. There are connections for fluid flow between pairs of lobes with regenerators in the connections. The thermodynamic cycle corresponds to that of the Stirling engine. Heat is applied to one end of the engine and heat is discharged at the other end. As each rotor moves in and out of the housing lobes, a hydrodynamic fluid film of gas is produced between the rotor and the housing which keeps the rotor from contacting the housing. | 10-27-2011 |
Gregory R. Hanson, Clinton, TN US
Patent application number | Description | Published |
---|---|---|
20090212226 | SPACE CHARGE DOSIMETERS FOR EXTREMELY LOW POWER MEASUREMENTS OF RADIATION IN SHIPPING CONTAINERS - Methods and apparatus are described for space charge dosimeters for extremely low power measurements of radiation in shipping containers. A method includes insitu polling a suite of passive integrating ionizing radiation sensors including reading-out dosimetric data from a first passive integrating ionizing radiation sensor and a second passive integrating ionizing radiation sensor, where the first passive integrating ionizing radiation sensor and the second passive integrating ionizing radiation sensor remain situated where the dosimetric data was integrated while reading-out. Another method includes arranging a plurality of ionizing radiation sensors in a spatially dispersed array; determining a relative position of each of the plurality of ionizing radiation sensors to define a volume of interest; collecting ionizing radiation data from at least a subset of the plurality of ionizing radiation sensors; and triggering an alarm condition when a dose level of an ionizing radiation source is calculated to exceed a threshold. | 08-27-2009 |
20100072380 | SPACE CHARGE DOSIMETERS FOR EXTREMELY LOW POWER MEASUREMENTS OF RADIATION IN SHIPPING CONTAINERS - Methods and apparatus are described for space charge dosimeters for extremely low power measurements of radiation in shipping containers. A method includes insitu polling a suite of passive integrating ionizing radiation sensors including reading-out dosimetric data from a first passive integrating ionizing radiation sensor and a second passive integrating ionizing radiation sensor, where the first passive integrating ionizing radiation sensor and the second passive integrating ionizing radiation sensor remain situated where the dosimetric data was integrated while reading-out. Another method includes arranging a plurality of ionizing radiation sensors in a spatially dispersed array; determining a relative position of each of the plurality of ionizing radiation sensors to define a volume of interest; collecting ionizing radiation data from at least a subset of the plurality of ionizing radiation sensors; and triggering an alarm condition when a dose level of an ionizing radiation source is calculated to exceed a threshold. | 03-25-2010 |
Harold Garth Hanson, Queen Creek, AZ US
Patent application number | Description | Published |
---|---|---|
20100194432 | DEVICE FOR TRANSFORMING INPUT IN OUTPUT SIGNALS WITH DIFFERENT VOLTAGE RANGES - Arrangement for accepting an input signal in a first voltage range and producing an output signal in a second voltage range. A transition detection circuit ( | 08-05-2010 |
20110291704 | Input Pin State Detection Circuit and Method Therefor - A state-detection circuit facilitates the detection of the state of an input pin relative to several different types of input circuits. According to an example embodiment, a state-detection circuit includes a plurality of comparators and circuit components, configured to provide a plurality of binary output signals that collectively indicate a state of an input pin to which the comparators are coupled. The state-detection circuit is configured to facilitate the detection of several different types of input circuits, based upon the binary output signals. | 12-01-2011 |
20120137031 | COMMUNICATION BUS WITH SHARED PIN SET - Bus communications are effected. In accordance with one or more example embodiments, a bus circuit is configured for communicating data in accordance with a main protocol (e.g., as a default), and for communicating with an alternate protocol when signals corresponding to the main protocol are not present. In some implementations, a sense circuit is used with input pins to sense a type of signal for bus communications, and to control communications on the bus with a protocol appropriate for the sensed signals, and for a main protocol when main protocol signals are sensed (e.g., for a default bus operation, or for test operation). | 05-31-2012 |
James Hanson, St. Petersburg, FL US
Patent application number | Description | Published |
---|---|---|
20100203240 | METHOD FOR SPIN COATING A SURFACE OF AN OPTICAL ARTICLE - A method for spin coating a surface of an optical article, includes the steps of: | 08-12-2010 |
James Edward Hanson, Tucson, AZ US
Patent application number | Description | Published |
---|---|---|
20100026577 | RADIO-BASED POSITION LOCATION SYSTEMS, ANTENNA CONFIGURATIONS, AND METHODS FOR DETERMINING ANTENNA CONFIGURATIONS - A radio-based position location system for determining a relative position of a first object with respect to a second object may include a first radio operatively associated with the first object. A first directional antenna having at least a high gain region is mounted to the second object so that the high gain region is directed generally outwardly from the second object and defines a first detection zone. A second directional antenna having at least a high gain region is also mounted to the second object and is oriented so that the high gain region is also directed generally outwardly and defines a second detection zone. A second radio connected to the first and second directional antennas exchanges radio signals with at least the first radio to determine the relative position of the first object with respect to the second object at least in part by determining a time-of-flight of a radio signal. The radio signals are primarily exchanged via the first directional antenna when the first object is in the first detection zone, whereas the radio signals are primarily exchanged via the second directional antenna when the first object is in the second detection zone. | 02-04-2010 |
20100127853 | METHOD AND APPARATUS FOR LOCATING AND TRACKING OBJECTS IN A MINING ENVIRONMENT - Methods and apparatus for locating and tracking objects in a mining environment are disclosed that include selecting an operational area within which the locations of a plurality of objects are to be determined and tracked over time. Radio transceiver systems and associated display systems provided to the plurality objects are operated to form an ad-hoc, peer-to-peer network. The relative positions of the various objects are determined by measuring the time-of-flight of radio signals exchanged between various ones of the radio transceiver systems and analyzing the time-of-flight of such exchanged radio signals. The relative positions of at least some of the objects within the operational area are then displayed on the display system. | 05-27-2010 |
Jennifer Elizabeth Hanson, Norwalk, CT US
Patent application number | Description | Published |
---|---|---|
20100145770 | Methods and Systems of Performing Marketing and Market Research - Some embodiments of the disclosed subject matter include a method of performing marketing and market research. In some embodiments, the method includes the following: observing a consumer using at least one of a product and a service, thereby creating data; analyzing behaviors of the consumer using the product or service by reviewing and coding the data, according to a predefined dictionary of terms thereby generating research data; interviewing the consumer thereby generating additional research data; entering the research data and the additional research data into a database; mining and analyzing the database to link the behaviors of the consumer with potential business implications, thereby generating findings; and reporting findings. | 06-10-2010 |
Jesse M. Hanson, Cedar Rapids, IA US
Patent application number | Description | Published |
---|---|---|
20110142626 | SERVICEABLE YAW BRAKE DISC SEGMENTS WITHOUT NACELLE REMOVAL - A wind turbine yaw brake apparatus includes a circular rotation support base having an inner and an outer cylinder wall. The circular rotation support base is mounted to a top face of a wind turbine tower and a nacelle such that the nacelle can rotate relative to the wind turbine tower. A plurality of brake lining elements are removably mounted to the circular rotation support base. A disc brake unit acts upon the brake aligning elements. | 06-16-2011 |
Jim Hanson, Ellicott City, MD US
Patent application number | Description | Published |
---|---|---|
20110277034 | SYSTEM AND METHOD FOR THREE-DIMENSIONAL VISUALIZATION OF VULNERABILITY AND ASSET DATA - The system and method for three-dimensional visualization of vulnerability and asset data described herein may provide a management console that integrates various active vulnerability scanners, various passive vulnerability scanners, and a log correlation engine distributed in a network. In particular, the management console may include a three-dimensional visualization tool that can be used to generate three-dimensional visualizations that graphically represent vulnerabilities and assets in the network from the integrated information that management console collects the active vulnerability scanners, the passive vulnerability scanners, and the log correlation engine distributed in the network. As such, the three-dimensional visualization tool may generate three-dimensional representations of the vulnerabilities and assets in the network that can be used to substantially simplify management of the network. | 11-10-2011 |
John D. Hanson, West Jordan, UT US
Patent application number | Description | Published |
---|---|---|
20090262953 | SYSTEM INCLUDING DEVICE FOR SECURING THE STATES OF ELECTRONIC CONTROLS - A system comprises an audio processor adapted for communication with an audio source and a control cover. The audio processor may have a plurality of manual controls to adjust audio processing parameters based on selected states of the controls. The control cover may engage the audio processor to restrict movement of the manual controls and maintain the manual controls in their selected states. The audio processor may be a pedal-processor. | 10-22-2009 |
20130327201 | PROGRAMMABLE MUSICAL INSTRUMENT PEDALBOARD - In one embodiment, a programmable pedalboard for a musical instrument is provided. The pedalboard includes a docking station for receiving a removable portable computer that provides a plurality of instrument effects. The docking station is configured to receive an audio signal from a musical instrument and to modify the audio signal from the musical instrument based on at least one instrument effect from the plurality of instrument effects. | 12-12-2013 |
Kathleen E. Hanson, Aikens, SC US
Patent application number | Description | Published |
---|---|---|
20080283706 | Personal Item Holder - A personal Item holder having a backing, a framing device for providing support and shape to the backing, attachment devices for attaching the personal items to the backing, and mounts attached to the backing for mounting the holder. | 11-20-2008 |
Kelly M. Hanson, Euclid, OH US
Patent application number | Description | Published |
---|---|---|
20090193760 | REFRIGERATOR DOOR VACUUM PRESERVATION SYSTEM - A refrigerator includes a hands-free vacuum preservation system mounted on a door of the refrigerator comprising a main body portion having a slot therein for receiving an open end of a plastic bag. Sensors within the slot detect the presence of the bag and a retaining device is actuated to punch holes in the bag and retain the bag in position for a vacuum sealing event. An intake port within the system communicates with a vacuum source to remove air from the bag, and a heat sealer seals the bag closed. In a preferred embodiment, once sensors located on the main body portion detect the presence of a consumer's hand, the retaining device releases the bag. The resultant vacuum sealed bag can be stored in a conventional manner, or by hanging the bag from hooks extending through the holes formed therein by the retaining device. | 08-06-2009 |
20090194193 | REFRIGERATOR VACUUM STORAGE SYSTEM - A vacuum storage system in a refrigerator includes a bin or drawer unit removably received in a housing. The vacuum storage system may be utilized in a storage configuration or in a vacuum sealing configuration to remove air from one or more food preservation containers having one-way evacuation valves. A switch on a control interface actuates a vacuum source and a front wall of the bin or drawer unit seals against the cabinet. Air is drawn from the storage space via a hose in communication with the vacuum source and air pressure within the storage space is reduced below atmospheric pressure, whereby air is simultaneously evacuated from the containers housed in the storage space. At a predetermined pressure, a control deactivates the vacuum source and an equalizing valve is opened to return the storage space to atmospheric pressure. | 08-06-2009 |
20100126117 | REFRIGERATOR DOOR VACUUM PRESERVATION SYSTEM - A refrigerator includes a hands-free vacuum preservation system mounted on a door of the refrigerator comprising a main body portion having a slot therein for receiving an open end of a plastic bag. Sensors within the slot detect the presence of the bag and a retaining device is actuated to punch holes in the bag and retain the bag in position for a vacuum sealing event. An intake port within the system communicates with a vacuum source to remove air from the bag, and a heat sealer seals the bag closed. In a preferred embodiment, once sensors located on the main body portion detect the presence of a consumer's hand, the retaining device releases the bag. The resultant vacuum sealed bag can be stored in a conventional manner, or by hanging the bag from hooks extending through the holes formed therein by the retaining device. | 05-27-2010 |
20120326588 | REFRIGERATOR VACUUM STORAGE SYSTEM - A vacuum storage system in a refrigerator includes a bin or drawer unit removably received in a housing. The vacuum storage system may be utilized in a storage configuration or in a vacuum sealing configuration to remove air from one or more food preservation containers having one-way evacuation valves. A switch on a control interface actuates a vacuum source and a front wall of the bin or drawer unit seals against the cabinet. Air is drawn from the storage space via a hose in communication with the vacuum source and air pressure within the storage space is reduced below atmospheric pressure, whereby air is simultaneously evacuated from the containers housed in the storage space. At a predetermined pressure, a control deactivates the vacuum source and an equalizing valve is opened to return the storage space to atmospheric pressure. | 12-27-2012 |
Kyle M. Hanson, Kalispell, MT US
Patent application number | Description | Published |
---|---|---|
20080217165 | APPARATUS AND METHODS FOR ELECTROCHEMICAL PROCESSING OF MICROELECTRONIC WORKPIECES - An apparatus and method for electrochemical processing of microelectronic workpieces in a reaction vessel. In one embodiment, the reaction vessel includes: an outer container having an outer wall; a distributor coupled to the outer container, the distributor having a first outlet configured to introduce a primary flow into the outer container and at least one second outlet configured to introduce a secondary flow into the outer container separate from the primary flow; a primary flow guide in the outer container coupled to the distributor to receive the primary flow from the first outlet and direct it to a workpiece processing site; a dielectric field shaping unit in the outer container coupled to the distributor to receive the secondary flow from the second outlet, the field shaping unit being configured to contain the secondary flow separate from the primary flow through at least a portion of the outer container, and the field shaping unit having at least one electrode compartment through which the secondary flow can pass while the secondary flow is separate from the primary flow; an electrode in the electrode compartment; and an interface member carried by the field shaping unit downstream from the electrode, the interface member being in fluid communication with the secondary flow in the electrode compartment, and the interface member being configured to prevent selected matter of the secondary flow from passing to the primary flow. | 09-11-2008 |
20080217166 | APPARATUS AND METHODS FOR ELECTROCHEMICAL PROCESSSING OF MICROELECTRONIC WORKPIECES - An apparatus and method for electrochemical processing of microelectronic workpieces in a reaction vessel. In one embodiment, the reaction vessel includes: an outer container having an outer wall; a distributor coupled to the outer container, the distributor having a first outlet configured to introduce a primary flow into the outer container and at least one second outlet configured to introduce a secondary flow into the outer container separate from the primary flow; a primary flow guide in the outer container coupled to the distributor to receive the primary flow from the first outlet and direct it to a workpiece processing site; a dielectric field shaping unit in the outer container coupled to the distributor to receive the secondary flow from the second outlet, the field shaping unit being configured to contain the secondary flow separate from the primary flow through at least a portion of the outer container, and the field shaping unit having at least one electrode compartment through which the secondary flow can pass while the secondary flow is separate from the primary flow; an electrode in the electrode compartment; and an interface member carried by the field shaping unit downstream from the electrode, the interface member being in fluid communication with the secondary flow in the electrode compartment, and the interface member being configured to prevent selected matter of the secondary flow from passing to the primary flow. | 09-11-2008 |
20080217167 | APPARATUS AND METHODS FOR ELECTROCHEMICAL PROCESSING OF MICROELECTRONIC WORKPIECES - An apparatus and method for electrochemical processing of microelectronic workpieces in a reaction vessel. In one embodiment, the reaction vessel includes: an outer container having an outer wall; a distributor coupled to the outer container, the distributor having a first outlet configured to introduce a primary flow into the outer container and at least one second outlet configured to introduce a secondary flow into the outer container separate from the primary flow; a primary flow guide in the outer container coupled to the distributor to receive the primary flow from the first outlet and direct it to a workpiece processing site; a dielectric field shaping unit in the outer container coupled to the distributor to receive the secondary flow from the second outlet, the field shaping unit being configured to contain the secondary flow separate from the primary flow through at least a portion of the outer container, and the field shaping unit having at least one electrode compartment through which the secondary flow can pass while the secondary flow is separate from the primary flow; an electrode in the electrode compartment; and an interface member carried by the field shaping unit downstream from the electrode, the interface member being in fluid communication with the secondary flow in the electrode compartment, and the interface member being configured to prevent selected matter of the secondary flow from passing to the primary flow. | 09-11-2008 |
20090114533 | Chambers, systems, and methods for electrochemically processing microfeature workpieces - Chambers, systems, and methods for electrochemically processing microfeature workpieces are disclosed herein. In one embodiment, an electrochemical deposition chamber includes a processing unit having a first flow system configured to convey a flow of a first processing fluid to a microfeature workpiece. The chamber further includes an electrode unit having an electrode and a second flow system configured to convey a flow of a second processing fluid at least proximate to the electrode. The chamber further includes a nonporous barrier between the processing unit and the electrode unit to separate the first and second processing fluids. The nonporous barrier is configured to allow cations or anions to flow through the barrier between the first and second processing fluids. | 05-07-2009 |
20100078334 | ELECTRO-CHEMICAL PROCESSOR - An electro-chemical processor for making porous silicon or processing other substrates has first and second chamber assemblies. The first and second chamber assemblies include first and second seals for sealing against a wafer, and first and second electrodes, respectively. The first seal is moveable towards and away from a wafer in the processor, to move between a wafer load/unload position, and a wafer process position. The first electrode may move along with the first seal. The processor may be pivotable from a substantially horizontal orientation, for loading and unloading a wafer, to a substantially vertical orientation, for processing a wafer. | 04-01-2010 |
20120037495 | DEPLATING CONTACTS IN AN ELECTROCHEMICAL PLATING APPARATUS - An electroplating apparatus having improved contact deplating features includes a bowl assembly having a bowl for holding an electroplating solution. A head having a rotor including a contact ring and a head motor for rotating the rotor cooperates with the bowl assembly during plating operations. A lift/rotate actuator may be used to move the head to position a sector of the contact ring in a ring slot or opening of a deplating module. Since the deplating is performed within the deplating module, and not within the bowl assembly, the electroplating solution in the bowl assembly is not affected by the deplating process. | 02-16-2012 |
20120138091 | PROCESSING ASSEMBLY FOR SEMICONDUCTOR WORKPIECE AND METHODS OF PROCESSING SAME - A processing assembly for a semiconductor workpiece generally includes a rotor assembly capable of spinning a workpiece, a chemistry delivery assembly for delivering chemistry to the workpiece, and a chemistry collection assembly for collecting spent chemistry from the workpiece. The chemistry collection assembly may include a weir that is configured to spin with the rotor assembly. A method of processing a semiconductor workpiece is also provided. | 06-07-2012 |
20120142196 | PROCESSING ASSEMBLY FOR SEMICONDUCTOR WORKPIECE AND METHODS OF PROCESSING SAME - A processing assembly for a semiconductor workpiece generally includes a rotor assembly capable of spinning a workpiece, a chemistry delivery assembly for delivering chemistry to the workpiece, and a chemistry collection assembly for collecting spent chemistry from the workpiece. The chemistry collection assembly includes a weir assembly surrounding the rotor assembly and having a plurality of weirs. Methods for processing a semiconductor workpiece generally include moving at least one of the rotor assembly and the weir assembly. | 06-07-2012 |
20120152751 | ELECTROLYTIC COPPER PROCESS USING ANION PERMEABLE BARRIER - Processes and systems for electrolytically processing a microfeature workpiece with a first processing fluid and a counter electrode are described. Microfeature workpieces are electrolytically processed using a first processing fluid, a counter electrode, a second processing fluid, and an anion permeable barrier layer. The anion permeable barrier layer separates the first processing fluid from the second processing fluid while allowing certain anionic species to transfer between the two fluids. Some of the described processes produce deposits over repeated plating cycles that exhibit resistivity values within desired ranges. | 06-21-2012 |
20120292181 | ELECTROCHEMICAL PROCESSOR - An electrochemical processor may include a head having a rotor configured to hold a workpiece, with the head moveable to position the rotor in a vessel. Inner and outer anodes are in inner and outer anolyte chambers within the vessel. An upper cup in the vessel, has a curved upper surface and inner and outer catholyte chambers. A current thief is located adjacent to the curved upper surface. Annular slots in the curved upper curved surface connect into passageways, such as tubes, leading into the outer catholyte chamber. Membranes may separate the inner and outer anolyte chambers from the inner and outer catholyte chambers, respectively. | 11-22-2012 |
20120292194 | ELECTROLYTIC PROCESS USING CATION PERMEABLE BARRIER - Processes and systems for electrolytically processing a microfeature workpiece with a first processing fluid and an anode are described. Microfeature workpieces are electrolytically processed using a first processing fluid, an anode, a second processing fluid, and a cation permeable barrier layer. The cation permeable barrier layer separates the first processing fluid from the second processing fluid while allowing certain cationic species to transfer between the two fluids. The described processes produce deposits over repeated plating cycles that exhibit deposit properties (e.g., resistivity) within desired ranges. | 11-22-2012 |
20140209472 | ELECTROLYTIC PROCESS USING CATION PERMEABLE BARRIER - Processes and systems for electrolytically processing a microfeature workpiece with a first processing fluid and an anode are described. Microfeature workpieces are electrolytically processed using a first processing fluid, an anode, a second processing fluid, and a cation permeable barrier layer. The cation permeable barrier layer separates the first processing fluid from the second processing fluid while allowing certain cationic species to transfer between the two fluids. The described processes produce deposits over repeated plating cycles that exhibit deposit properties (e.g., resistivity) within desired ranges. | 07-31-2014 |
20140246324 | METHODS FOR ELECTROCHEMICAL DEPOSITION OF MULTI-COMPONENT SOLDER USING CATION PERMEABLE BARRIER - Processes and systems for electrochemical deposition of a multi-component solder by processing a microfeature workpiece with a first processing fluid and an anode are described. Microfeature workpieces are electrolytically processed using a first processing fluid, an anode, a second processing fluid, and a cation permeable barrier layer. The cation permeable barrier layer separates the first processing fluid from the second processing fluid while allowing certain cationic species to transfer between the two fluids. | 09-04-2014 |
20140356663 | FLOW BATTERY SYSTEMS - Embodiments of the invention generally provide for flow battery cells and systems containing a plurality of flow battery cells, and methods for improving metal plating within the flow battery cell, such as by flowing and exposing the catholyte to various types of cathodes. In one embodiment, a flow battery cell is provided which includes a cathodic half cell and an anodic half cell separated by an electrolyte membrane, wherein the cathodic half cell contains a plurality of cathodic wires extending perpendicular or substantially perpendicular to and within the catholyte pathway and in contact with the catholyte, and each of the cathodic wires extends parallel or substantially parallel to each other. In some examples, the plurality of cathodic wires may have at least two arrays of cathodic wires, each array contains at least one row of cathodic wires, and each row extends along the catholyte pathway. | 12-04-2014 |
20150050752 | METHODS FOR CLEANING A WAFER EDGE INCLUDING A NOTCH - In a method for removing metal at the edge of a wafer, including from a notch in the edge of the wafer, water is dripped or otherwise supplied onto the up-facing metal-plated front side of the wafer, while rotating the wafer. A metal etchant, such as sulfuric acid, is provided onto the back side of the wafer, at a flow rate multiple times greater than the water flow rate. The etchant flows over the edge of the wafer and the notch, and onto an annular edge on the front side of the wafer. The metal plated in the notch is removed, even if the notch has a radial depth greater than the width of the exclusion zone. The flow rates of the water and the etchant, and the rotation speed may be adjusted to provide a static water film, with the etchant diffusing into the outer edge of the water film. | 02-19-2015 |
20150069043 | ANNEAL MODULE FOR SEMICONDUCTOR WAFERS - An anneal module for annealing semiconductor material wafers and similar substrates reduces particle contamination and oxygen ingress while providing uniform heating including for 500° C. processes. The anneal module may include a process chamber formed in a metal body having internal cooling lines. A hot plate has a pedestal supported on a thermal choke on the body. A gas distributor in the lid over the hot plate flows gas uniformly over the wafer. A transfer mechanism moves a hoop to shift the wafer between the hot plate and a cold plate. | 03-12-2015 |
20150083600 | ELECTROLYTIC COPPER PROCESS USING ANION PERMEABLE BARRIER - Processes and systems for electrolytically processing a microfeature workpiece with a first processing fluid and a counter electrode are described. Microfeature workpieces are electrolytically processed using a first processing fluid, a counter electrode, a second processing fluid, and an anion permeable barrier layer. The anion permeable barrier layer separates the first processing fluid from the second processing fluid while allowing certain anionic species to transfer between the two fluids. | 03-26-2015 |
Laura O'Connor Hanson, Manchester, CT US
Patent application number | Description | Published |
---|---|---|
20100100398 | SOCIAL NETWORK INTERFACE - A system and method for providing online insurance quotes to a client on a social network web site includes an insurance server adapted to execute a coverage calculator application and an insurance database in communication with the insurance server for storing a plurality of personas, a plurality of insurance coverage options associated with each persona, and a price quote associated with each insurance coverage option. The system is in communication with a platform application on the social network web site. The platform application is in communication with a social network database for storing user content of the social network client. In one embodiment, the platform application uses an inference engine to query the user content of the social network client and return a set of inferred characteristics. The coverage calculator application selects a persona in response to the set of inferred characteristics and selects one of the insurance coverage options in response to the selected persona. | 04-22-2010 |
20130066656 | SYSTEM AND METHOD FOR CALCULATING AN INSURANCE PREMIUM BASED ON INITIAL CONSUMER INFORMATION - According to some embodiments, initial consumer information may be received from a remote consumer device associated with a potential consumer. For example, the potential consumer might provide his or her name and address via a web page. According to some embodiments, the initial consumer information does not include vehicle information. Responsive to the initial consumer information, supplemental information may be automatically requested from a third-party data source. The supplemental information, including vehicle information associated with the potential consumer, may then be received from the third-party data source. An automobile insurance premium may then be calculated for the potential consumer based at least in part on the supplemental information. At least one potentially binding insurance quote may then be transmitted to the remote consumer device based on the calculated automobile insurance premium. | 03-14-2013 |
Lee Hanson US
Patent application number | Description | Published |
---|---|---|
20090092570 | ODOR-CONTROLLING COMPOSITION - A composition for odor reduction and odor elimination and methods for reducing and eliminating odors and preparing the composition. | 04-09-2009 |
Mark Hanson, Fincastle, VA US
Patent application number | Description | Published |
---|---|---|
20090265038 | Magnetic Thrust Bearing with Integrated Electronics - Certain exemplary embodiments can provide a machine comprising: a magnetic thrust bearing comprising: a rotor portion; a stator portion; and a housing substantially surrounding said stator portion and said rotor portion; said rotor portion comprising a thrust disk adapted to be circumferentially attached to a rotor and to rotate with the rotor, said thrust disk defining a thrust disk first side and a thrust disk second side, said first side opposing said second side. | 10-22-2009 |
Mark Hanson US
Patent application number | Description | Published |
---|---|---|
20100080202 | WIRELESS DEVICE REGISTRATION, SUCH AS AUTOMATIC REGISTRATION OF A WI-FI ENABLED DEVICE - A system for providing a wireless device with access to a computer network includes an access point that sets up a radio link with the wireless device and couples the wireless device to the network. The system also includes a server that receives data packets from the access point through the computer network. The data packets include at least one data packet that has a first identifier that uniquely identifies the wireless device and a second identifier that corresponds to at least one of a manufacturer code or a vendor code of the wireless device. The system further includes a database that is coupled to the server and stores data for associating a service plan with the first and second identifiers and basing the service plan, at least in part, on the second identifier. Other features and systems are also disclosed. | 04-01-2010 |
Matthew Hanson, Cuyahoga, OH US
Patent application number | Description | Published |
---|---|---|
20100228172 | Toe protectors, shrouds, and protective covers for shrouds - Toe protectors for patients that have had toe surgery or otherwise have a need to protect the toes. The toe protectors are easy to ship or transport, are easy to assemble and apply to the foot, are easy to remove for ascertaining the progress of the surgery or injury, are economical to manufacture, and are sturdy and easy to clean. | 09-09-2010 |
Michael Hanson, Liberal, KS US
Patent application number | Description | Published |
---|---|---|
20080314838 | FLUIDIZED BED PRECIPITATOR WITH OPTIMIZED SOLIDS SETTLING AND SOLIDS HANDLING FEATURES FOR USE IN RECOVERING PHOSPHORUS FROM WASTEWATER - Improved fluidized bed precipitators ( | 12-25-2008 |
Nancy D. Hanson, Gretna, NE US
Patent application number | Description | Published |
---|---|---|
20090317807 | Primers for Use in Detecting Metallo-Beta-Lactamases - Oliognucleotide primers are provided that are specific for nucleic acid characteristic of certain beta-lactamases. The primers can be employed in methods to identify nucleic acid characteristic of family-specific beta-lactamase enzymes in samples, and particularly, in clinical isolates of Gram-negative bacteria. | 12-24-2009 |
20110311976 | PRIMERS FOR USE IN DETECTING BETA-LACTAMASES - Oliognucleotide primers are provided that are specific for nucleic acid characteristic of certain beta-lactamases. The primers can be employed in methods to identify nucleic acid characteristic of family-specific beta-lactamase enzymes in samples, and particularly, in clinical isolates of Gram-negative bacteria. | 12-22-2011 |
Nathan Hanson, Jupiter, FL US
Patent application number | Description | Published |
---|---|---|
20090125436 | RENEWABLE ENERGY TRUST SYSTEM AND METHOD - A renewable energy trust system and methods of using same are disclosed. In certain embodiments, a renewable energy trust is funded and the trust funds or a portion thereof are used to develop renewable energy. | 05-14-2009 |
Paul Ronald Hanson, Lawrence, KS US
Patent application number | Description | Published |
---|---|---|
20110301311 | SILICA-SUPPORTED OLIGOMERIC HYBRID MATERIALS - A particle-polymer hybrid material can include: a substance having the structure of Formula 1 (Z—(Y—FP) | 12-08-2011 |
20120226007 | HIGH CAPACITY MAGNETIC NANOPARTICLES AS SUPPORTS FOR REAGENTS AND CATALYSTS - A magnetic particle-polymer hybrid material can include: a substance having a structure of Z-(Y-Triazole-X-(FP) | 09-06-2012 |
Richard A. Hanson, Leedburg, FL US
Patent application number | Description | Published |
---|---|---|
20100327693 | MINIATURE MECHANICAL RESONATOR DEVICE - Novel configurations for a miniature vibrating beam mechanical resonator provide low energy transfer to a supporting structure and low sensitivity to mounting misalignment. A symmetric suspended portion includes two vibrating beams that vibrate normal to a quiescent plane of the resonator, 180 degrees out of phase relative to one another. The vibrating beams are attached, at least at one end, to a torsional coupling element that is joined to a mounting pad along a non-translating suspension boundary. Counterbalances are attached to the vibrating beams, and the resonator is configured such that dynamic forces and moments coupled to each torsional coupling element from the vibrating beams are balanced along each nominal non-translating suspension boundary proximate to the symmetry axis and along the symmetry axis proximate to each nominal non-translating suspension boundary. Each non-translating suspension boundary is a torsional axis for a twisting deformation of the first torsional coupling element. | 12-30-2010 |
Robert J. Hanson, Boise, ID US
Patent application number | Description | Published |
---|---|---|
20080254637 | Methods for removing photoresist defects and a source gas for same - A method for removing at least one photoresist defect is disclosed. The photoresist defect is exposed to a plasma produced from a source gas including oxygen and a non-oxidizing gas in a plasma reactor, wherein the oxygen is present in the source gas at from 1% by volume to about 89% by volume. The non-oxidizing gas includes a mixture of hydrogen and nitrogen, ammonia or combinations thereof. A method for processing a semiconductor device structure is also disclosed, as are embodiments of the source gas. | 10-16-2008 |
20090017596 | Methods Of Forming Oxides, Methods Of Forming Semiconductor Constructions, And Methods Of Forming Isolation Regions - Some embodiments include methods of forming isolation regions in which spin-on material (for example, polysilazane) is converted to a silicon dioxide-containing composition. The conversion may utilize one or more oxygen-containing species (such as ozone) and a temperature of less than or equal to 300° C. In some embodiments, the spin-on material is formed within an opening in a semiconductor material to form a trenched isolation region. Other dielectric materials may be formed within the opening in addition to the silicon dioxide-containing composition formed from the spin-on material. Such other dielectric materials may include silicon dioxide formed by chemical vapor deposition and/or silicon dioxide formed by high-density plasma chemical vapor deposition. | 01-15-2009 |
20090072288 | Terraced Film Stack - A process and apparatus directed to forming a terraced film stack of a semiconductor device, for example, a DRAM memory device, is disclosed. The present invention addresses etch undercut resulting from materials of different etch selectivity used in the film stack, which if not addressed can cause device failure. | 03-19-2009 |
20090085459 | PROTECTIVE LAYER FOR CORROSION PREVENTION DURING LITHOGRAPHY AND ETCH - Forming a protective layer such as chromium, chrome alloys, nickel or cobalt as a cap over an aluminum film protects an underlying ITO layer from corrosion during the fabrication of flat panel displays such as field emission devices and the like. The presence of the protective layer during fabrication processes such as photolithography prevents diffusion of solutions through the aluminum into the ITO. This protective layer is especially effective during the development and resist stripping stages of photolithography which use solutions or solvents that would otherwise cause reductive corrosion of ITO in contact with aluminum. The methods and apparatus described herein are particularly advantageous for the fabrication of flat panel displays such as field emission devices and other display devices, because ITO is often used in such devices in contact with aluminum while exposed to corrosion-inducing media. | 04-02-2009 |
20090305511 | Methods of Treating Semiconductor Substrates, Methods Of Forming Openings During Semiconductor Fabrication, And Methods Of Removing Particles From Over Semiconductor Substrates - Some embodiments include methods of treating semiconductor substrates. The substrates may be exposed to one or more conditions that vary continuously. The conditions may include temperature gradients, concentration gradients of one or more compositions that quench etchant, pH gradients to assist in removing particles, and/or concentration gradients of one or more compositions that assist in removing particles. The continuously varying conditions may be imparted by placing the semiconductor substrates in a bath of flowing rinsing solution, with the bath having at least two feed lines that provide the rinsing solution therein. One of the feed lines may be at a first condition, and the other may be at a second condition that is different from the first condition. The relative amount of rinsing solution provided to the bath by each feed line may be varied to continuously vary the condition within the bath. | 12-10-2009 |
20100148234 | SUBRESOLUTION SILICON FEATURES AND METHODS FOR FORMING THE SAME - Novel etch techniques are provided for shaping silicon features below the photolithographic resolution limits. FinFET devices are defined by recessing oxide and exposing a silicon protrusion to an isotropic etch, at least in the channel region. In one implementation, the protrusion is contoured by a dry isotropic etch having excellent selectivity, using a downstream microwave plasma etch. | 06-17-2010 |
20110086476 | Methods of Forming Field Effect Transistors on Substrates - The invention includes methods of forming field effect transistors. In one implementation, the invention encompasses a method of forming a field effect transistor on a substrate, where the field effect transistor comprises a pair of conductively doped source/drain regions, a channel region received intermediate the pair of source/drain regions, and a transistor gate received operably proximate the channel region. Such implementation includes conducting a dopant activation anneal of the pair of source/drain regions prior to depositing material from which a conductive portion of the transistor gate is made. Other aspects and implementations are contemplated. | 04-14-2011 |
20110183492 | Methods of forming oxides, methods of forming semiconductor constructions, and methods of forming isolation regions - Some embodiments include methods of forming isolation regions in which spin-on material (for example, polysilazane) is converted to a silicon dioxide-containing composition. The conversion may utilize one or more oxygen-containing species (such as ozone) and a temperature of less than or equal to 300° C. In some embodiments, the spin-on material is formed within an opening in a semiconductor material to form a trenched isolation region. Other dielectric materials may be formed within the opening in addition to the silicon dioxide-containing composition formed from the spin-on material. Such other dielectric materials may include silicon dioxide formed by chemical vapor deposition and/or silicon dioxide formed by high-density plasma chemical vapor deposition. | 07-28-2011 |
20120061740 | SUBRESOLUTION SILICON FEATURES AND METHODS FOR FORMING THE SAME - Novel etch techniques are provided for shaping silicon features below the photolithographic resolution limits. FinFET devices are defined by recessing oxide and exposing a silicon protrusion to an isotropic etch, at least in the channel region. In one implementation, the protrusion is contoured by a dry isotropic etch having excellent selectivity, using a downstream microwave plasma etch. | 03-15-2012 |
20120231561 | REMOVAL OF METAL - Methods of removing metal from a portion of a substrate are useful in integrated circuit fabrication. Methods include exposing the substrate to an oxidizing environment comprising at least one oxidizing agent and at least one reducing agent, and exposing the substrate to a reducing environment comprising at least one reducing agent and at least one oxidizing agent. | 09-13-2012 |
20130230957 | Methods of Forming Field Effect Transistors on Substrates - The invention includes methods of forming field effect transistors. In one implementation, the invention encompasses a method of forming a field effect transistor on a substrate, where the field effect transistor comprises a pair of conductively doped source/drain regions, a channel region received intermediate the pair of source/drain regions, and a transistor gate received operably proximate the channel region. Such implementation includes conducting a dopant activation anneal of the pair of source/drain regions prior to depositing material from which a conductive portion of the transistor gate is made. Other aspects and implementations are contemplated. | 09-05-2013 |
20130302995 | Methods Of Treating Semiconductor Substrates, Methods Of Forming Openings During Semiconductor Fabrication, And Methods Of Removing Particles From Over Semiconductor Substrates - Some embodiments include methods of treating semiconductor substrates. The substrates may be exposed to one or more conditions that vary continuously. The conditions may include temperature gradients, concentration gradients of one or more compositions that quench etchant, pH gradients to assist in removing particles, and/or concentration gradients of one or more compositions that assist in removing particles. The continuously varying conditions may be imparted by placing the semiconductor substrates in a bath of flowing rinsing solution, with the bath having at least two feed lines that provide the rinsing solution therein. One of the feed lines may be at a first condition, and the other may be at a second condition that is different from the first condition. The relative amount of rinsing solution provided to the bath by each feed line may be varied to continuously vary the condition within the bath. | 11-14-2013 |
20150054164 | Semiconductor Constructions - Some embodiments include semiconductor constructions having first and second electrically conductive lines that intersect with one another at an intersection. The first line has primarily a first width, and has narrowed regions directly against the second line and on opposing sides of the second line from one another. Electrically conductive contacts are along the first line and directly electrically coupled to the first line, and one of the electrically conductive contacts is directly against the intersection. Some embodiments include methods of forming intersecting lines of material. First and second trenches are formed, and intersect with one another at an intersection. The first trench has primarily a first width, and has narrowed regions directly against the second trench and on opposing sides of the second trench from one another. Material is deposited within the first and second trenches to substantially entirely fill the first and second trenches. | 02-26-2015 |
Robert N. Hanson, Newton, MA US
Patent application number | Description | Published |
---|---|---|
20100260676 | PRECISION-GUIDED NANOPARTICLE SYSTEMS FOR DRUG DELIVERY - A method of preparing multifunctionalized nanoparticles involves using a modular system of half-linkers to attach functional moieties that serve to deliver the nanoparticles to a desired target, exert an effect at the target, or track the nanoparticles within a cell or an animal. The modular chemistry of the half-linker system permits the custom design and synthesis of functionalized nanoparticles bearing multiple groups and therefore results in precise delivery to desired cell types and intracellular locations. The functionalized nanoparticles can be used to treat or diagnose a variety of medical conditions, including neoplastic diseases, infectious diseases, and chronic diseases. | 10-14-2010 |
20110105608 | MODULATORS OF NUCLEAR RECEPTOR CO-REGULATORY PROTEIN BINDING - Disclosed are novel compounds and compositions for inhibition of androgen and estrogen receptor signaling, methods for inhibiting androgen signaling, methods for inhibiting estrogen signaling, methods for inhibiting the interaction between a co-regulatory protein and an androgen or estrogen receptor, and methods for treating cancer. | 05-05-2011 |
20120046461 | STEROIDAL ANTI-HORMONE HYBRIDS - Disclosed are novel compounds and compositions for inhibition of androgen and estrogen receptor signaling, methods for inhibiting androgen signaling, methods for inhibiting estrogen signaling, methods for inhibiting the interaction between a co-regulatory protein and an androgen or estrogen receptor, and methods for treating cancer. | 02-23-2012 |
Rolf Raymond Hanson, Lindon, UT US
Patent application number | Description | Published |
---|---|---|
20110233976 | MODULAR FURNITURE - A modular furniture assembly unit includes a box having a length, a width, and a depth, the box having first and second major sides in opposition to each other that define the length and the width of the box, and having third, fourth, fifth, and sixth sides therebetween, the first side having a first connector attached thereto at a distance from the third side of the box substantially equivalent to the depth of the box, the second side of the box having a plurality of second connectors attached near at least three of the third, fourth, fifth, and sixth sides of the box, wherein the first connector is configured to attach to a second connector of an identical box to couple the box to the identical box to form a modular furniture piece. In a further aspect, the first connector is a rotatable clamp and the second connectors are hooks to which the rotatable clamp is connectable. | 09-29-2011 |
Russell B. Hanson, Jupiter, FL US
Patent application number | Description | Published |
---|---|---|
20100139285 | THRUST VECTORABLE FAN VARIABLE AREA NOZZLE FOR A GAS TURBINE ENGINE FAN NACELLE - A thrust vectorable fan variable area nozzle (FVAN) includes a synchronizing ring, a static ring, and a flap assembly mounted within a fan nacelle. An actuator assembly selectively rotates synchronizing ring segments relative the static ring to adjust segments of the flap assembly to vary the annular fan exit area and vector the thrust through asymmetrical movement of the thrust vectorable FVAN segments. In operation, adjustment of the entire periphery of the thrust vectorable FVAN in which all segments are moved simultaneously to maximize engine thrust and fuel economy during each flight regime. By separately adjusting the segments of the thrust vectorable FVAN, engine trust is selectively vectored to provide, for example only, trim balance or thrust controlled maneuvering. | 06-10-2010 |
20120076987 | ISO-GRID COMPOSITE COMPONENT - An iso-grid composite component includes a spacer transverse to a uni-tape ply bundle, the spacer interrupted by the uni-tape ply bundle. | 03-29-2012 |
20140138945 | TUBE HAVING AN INTEGRAL, SPRING-LOADED, SPHERICAL JOINT | 05-22-2014 |
20140174088 | ALIGNMENT SYSTEM AND METHODOLOGY TO ACCOUNT FOR VARIATION IN A GAS TURBINE ENGINE - A gas turbine engine includes a bushing that is non-round in cross-section, the bushing receivable within an aperture. A fastener passes through the bushing to retain a second component to a third component with respect to the first component. | 06-26-2014 |
20140216042 | COMBUSTOR COMPONENT WITH COOLING HOLES FORMED BY ADDITIVE MANUFACTURING - Combustor liners made using additive manufacturing techniques can employ cooling hole patterns which are not possible, or at least time consuming or expensive, to make using traditional subtractive manufacturing techniques. By additively manufacturing floatwall panels, cooling holes may be placed along axes that transect features on the floatwall panel, such as mounting studs, spacers, cooling pedestals, and rails. | 08-07-2014 |
Russell W. Hanson, Livingston, AL US
Patent application number | Description | Published |
---|---|---|
20080263934 | Water-degradable fishing lure - A fishing lure that is water-degradable is described. The fishing lure can be a polymeric fishing lure. The fishing lure can have a body that includes vinyl resin and epoxy plasticizer, and may also include one or more of a supplemental plasticizer, heat stabilizer and/or fish attractant, and wherein the body is degradable upon immersing the body in water a body. | 10-30-2008 |
Ryan A. Hanson, Olathe, KS US
Patent application number | Description | Published |
---|---|---|
20090114095 | FILTER CLEANING SYSTEM AND METHOD - A filter cleaning system according to one aspect of the invention comprises a baghouse including a tubesheet having a plurality of openings extending therethrough. A plurality of filter cartridges is sealingly mounted to the tubesheet at respective openings. Each filter cartridge has an open end and pleated media for filtering particulates from gas flowing therethrough. The filter cartridge has particulates accumulate on the pleated media. A pulse cleaning system intermittently directs cleaning pulses of air into the open ends of the filter cartridges media at a supply pressure in the range of about 20 PSI to 60 PSI to dislodge accumulated particulates from the pleated media. | 05-07-2009 |
Samantha Hanson, Wateloo, IA US
Patent application number | Description | Published |
---|---|---|
20110303035 | FINAL DRIVE FOR A WORK MACHINE - A final drive for a work machine includes a housing, a pinion gear, a first idler gear, a second idler gear, and a bull gear. The pinion gear is restrained within the housing. The first idler gear and the second idler gears are rotatably connected to the housing and positioned for engagement with the pinion gear. The bull gear is rotatably connected to the housing and positioned for engagement with the first idler gear and the second idler gear. The housing, the pinion gear, the first idler gear, and the second idler gear are configured to permit the pinion gear to float between the first idler gear, and the second idler to provide even sharing of the load from the pinion gear to the first idler gear and the second idler gear. | 12-15-2011 |
Sarah R. Hanson US
Patent application number | Description | Published |
---|---|---|
20080299595 | Tailored glycoproteomic methods for the sequencing, mapping and identification of cellular glycoproteins - The present disclosure relates to tailored glycoproteomic methods, and more particularly to methods for the sequencing, mapping and identification of cellular glycoproteins using saccharide-selective bioorthogonal probes. A method is disclosed for saccharide-selective glycoprotein identification (ID) and glycan mapping (GIDmap) that generates glycoproteins tailored with bioorthogonally tagged alkynyl saccharides that can be selectively isolated, allowing for glycoprotein ID and glycan mapping via mass spectromic proteomics, including liquid chromatography-tandmen mass spectroscopy (LC-MS | 12-04-2008 |
Shaun Hanson, West Chester, PA US
Patent application number | Description | Published |
---|---|---|
20100131016 | LESS INVASIVE SURGICAL SYSTEM AND METHODS - A system for performing a less invasive surgical procedure and, in particular, devices and methods for spinal fixation. The system comprises dilation tool(s), at least one working/insertion cannula, a plurality of screws, at least one fixation rod for connecting the screws, and a rod inserter. The dilation tool(s) may be used to dilate an incision made in a patient to form an opening. Thereafter, a drill may be used to form holes in the vertebrae. An insertion cannula may be attached to a screw and inserted into the opening. The screws may be polyaxial screws and may be inserted into the vertebrae using a screwdriver. An operator may then move the insertion cannula to manipulate a head portions of the screws such that the head portions may be aligned to receive a fixation rod. A rod inserter may be used to insert a fixation rod into the head portions. After the fixation rod is in place, it may be locked to the screws, thereby fixing the system in place on the spine. | 05-27-2010 |
20100217395 | INTERVERTEBRAL IMPLANT WITH KEEL - An intervertebral implant component of an intervertebral implant includes an outer surface for engaging an adjacent vertebra and an inner surface. A keel extends from the outer surface and is designed to be disposed in a slot provided in the adjacent vertebra. This keel extends in a plane which is non-perpendicular to the outer surface; and preferably there are two of the keels extending from the outer surface which are preferably offset laterally from one another. In another embodiment, an anterior shelf is provided at an anterior end of the outer surface, and this anterior shelf extends vertically away from the inner surface in order to help prevent bone growth from the adjacent vertebra towards the inner surface. Further in accordance with disclosed embodiments, various materials, shapes and forms of construction of the component and/or keel provide various benefits. | 08-26-2010 |
20100268284 | MINIMALLY INVASIVE FIXATION SYSTEM - A minimally invasive fixation system and method for providing access to a surgical site. The fixation system may include a holding assembly, the holding assembling preferably including a lateral implant holder which may be attached to a pedicle screw and a sleeve positioned in connection with the lateral implant holder to prevent the lateral implant holder from separating from the pedicle screw. The sleeve may further include a tissue protection portion to keep the tissue out of the surgical site. A holding sleeve may be operably connected to the holding assembly and pedicle screw and may be used to insert the pedicle screw into the body. Multiple constructs may be inserted into the body so that a portion of the holding assembly extends from the body and provides access to and visualization of the surgical site. A rod holder may also be used to insert a rod into the head of the screw. The rod may be held by the rod holder so that the rod may be angulated as the rod is inserted into the screw heads. Once the rod is positioned in the screw heads, locking caps and/or set screws may be positioned over the rod and engage the screw heads so that the position of the rod may be fixed with respect to the screws. In some embodiments, a movement mechanism may be used to move the screws relative to each other to compress and/or distract the vertebrae. | 10-21-2010 |
Shaun Hanson, Phoenixville, PA US
Patent application number | Description | Published |
---|---|---|
20100234960 | Articulating Implant System - An articulating implant system is provided for fixation to a bone. The articulating implant system includes a fixation component for fixation to the bone and an articulating member for articulating against bone or cartilage. Specifically, a modular ulnar implant is provided in accordance with the articulating implant system of the present invention wherein the fixation component is a stem for insertion into the intramedullary canal of the distal ulna and the articulating member is a head for articulating with the radial sigmoid notch. | 09-16-2010 |
Shaun B. Hanson, West Chester, PA US
Patent application number | Description | Published |
---|---|---|
20110125159 | INSTRUMENTS FOR A VARIABLE ANGLE APPROACH TO A JOINT - Instruments and associated methods are disclosed for treating joints, and particularly bone tissue. One of these instruments may be a positioning instrument for controlled delivery of a device to a target site of the bone tissue being treated. The positioning instrument may comprise a main body extending at one end into an indicator probe for visual determination of a target site of a bone to be treated, and at an opposite end into a handle. A rail extends from the main body. The instrument also includes an alignment guide having a device portal for insertion of a device therethrough, the alignment guide being detachable and movable along a length of the rail. The device may comprise an implant insertion tool, an injection catheter, a cavity creation tool such as a bone drill, for example, or the device may be an implantable device. | 05-26-2011 |
20110125160 | INSTRUMENTS FOR TARGETING A JOINT DEFECT - Instruments and associated methods are disclosed for treating joints, and particularly bone tissue. One of these instruments may be a positioning instrument for controlled delivery of a device to a target site of the bone tissue being treated. The positioning instrument may comprise an alignment guide having a device portal for insertion of a device therethrough. The positioning instrument may have an indicator probe having an extended arm, and a handle portion for maneuvering the positioning instrument. Another instrument may be a device for placement through the device portal of the alignment guide and to the target site. The device may comprise an implant insertion tool, an injection catheter, a cavity creation tool such as a bone drill, for example, or the device may be an implantable device. | 05-26-2011 |
20110125200 | NAVIGATION AND POSITIONING INSTRUMENTS FOR JOINT REPAIR AND METHODS OF USE - An instrument for controlled delivery of a device to a target area near a defect of a bone is provided. The instrument comprises a guide frame having a plurality of device portals, each portal defining a trajectory. The guide frame further includes visual markers for aligning the guide frame to an anatomical landmark on the bone to be treated. The instrument also includes a holder for releasable attachment with the guide frame. Each device portal is configured to provide accurate and controlled delivery of the device to the target area. In one example, the markers are radiopaque, and are visualized through fluoroscopy. A method of using the instrument is also provided. | 05-26-2011 |
20110125201 | COORDINATE MAPPING SYSTEM FOR JOINT TREATMENT - A coordinate mapping system is provided for locating a defect in a bone. The system comprises a positioning instrument for controlled delivery of a device to a target site, the instrument comprising a main body and a rail extending from the main body, the rail including a series of indicia corresponding to predefined grid lines, and a template configured to overlay an image of a bone having a defect at the target site, the template including a predefined grid for determining a set of coordinates to locate the target site using the positioning instrument. A method of accessing a target site near a defect in a bone using the radial coordinate mapping system is also provided. | 05-26-2011 |
20110125264 | IMPLANTABLE DEVICES FOR SUBCHONDRAL TREATMENT OF JOINT PAIN - Devices and associated methods are disclosed for treating bone, and particularly bone tissue at the joints. Disclosed are curved implantable devices that can be used either alone or in combination with this augmentation or hardening material for the repair of bone defects and which are particularly suited for use at the joints, and even more particularly, suited for use at the subchondral bone level. | 05-26-2011 |
20110125265 | IMPLANTABLE DEVICES FOR SUBCHONDRAL TREATMENT OF JOINT PAIN - Devices and associated methods are disclosed for treating bone, and particularly bone tissue at the joints. Disclosed are implantable devices that can be used either alone or in combination with this augmentation or hardening material for the repair of bone defects and which are particularly suited for use at the joints, and even more particularly, suited for use at the subchondral bone level. | 05-26-2011 |
20110125272 | BONE-DERIVED IMPLANTABLE DEVICES FOR SUBCHONDRAL TREATMENT OF JOINT PAIN - Implantable devices for the surgical treatment of bone, and particularly to a bone defect at a joint region, and even more particularly at the subchondral bone level of the joint region, are disclosed. The implantable devices may be formed of a bone material, and configured to serve the dual functions of providing mechanical strength and structural integrity to the area to be treated, while also facilitating the dispersal of a flowable material in the same area. Associated delivery tools are also provided. | 05-26-2011 |
20120245645 | NAVIGATION AND POSITIONING SYSTEMS AND GUIDE INSTRUMENTS FOR JOINT REPAIR - A system and associated instruments for locating, and accurately and controllably delivering, a device to an area sufficiently near a bone defect using anatomical landmarks is provided. The instruments allow the surgeon to navigate to the area around the bone defect quickly and easily, while also facilitating proper insertion of the device. In some embodiments, the defect is located on a femur. Guide instruments having a plurality of device portals are also provided for use as standalone instruments or as accessories to the system. In addition, a protective guide sleeve is provided for the insertion of small diameter devices. | 09-27-2012 |
20120316513 | INSTRUMENTS AND DEVICES FOR SUBCHONDRAL JOINT REPAIR - Instruments and associated methods are disclosed for treating joints, and particularly bone tissue. In general, the embodiments relate to instruments and associated methods for the surgical treatment of a joint, and particularly to a subchondral bone defect at that joint region. More specifically, the embodiments relate to instruments that allow fast, easy, precise, and controllable subchondral delivery to, or removal of materials from, a bone joint being treated. | 12-13-2012 |
20130090662 | METHODS AND INSTRUMENTS FOR SUBCHONDRAL TREATMENT OF OSTEOARTHRITIS IN A SMALL JOINT - Devices, instruments and associated methods for the subchondral treatment of osteoarthritis in small joints are provided. In addition, a method for treating joint pain in small joints is provided. These small joints may be ankle, elbow or wrist joints. The methods may target one of many different access points having trajectories with a common focal point at or near the small joint. The instruments may limit access to areas within or near the small joint by providing predefined entry paths that avoid damage to surrounding tissues. | 04-11-2013 |
20130261650 | SURGICAL ACCESS SYSTEMS, INSTRUMENTS AND ACCESSORIES - The present disclosure provides a modular instrument system for accessing a site within a patient's body, such as for example, to inject or remove material. In one exemplary embodiment, an access device is coupled to an adapter and power drilled into a site within a patient. Once the access device is in position, the adapter may be further attached to other instruments, or to an injection or extraction system. The adapter may accommodate various other connectors to make the instrument system compatible with a variety of other surgical instruments and tools. | 10-03-2013 |
20140074102 | INSTRUMENTS FOR CONTROLLED DELIVERY OF INJECTABLE MATERIALS INTO BONE - Instruments for treating bone defects of the joint, particularly at the subchondral level, such as bone marrow lesions or bone marrow edema, are provided. In particular, these instruments may be delivery instruments that comprise features to control the location to which they deliver injectable materials or other tools to the bone to be treated. Also provided is an injection instrument that delivers a treatment material to the bone defect and stimulates a natural healing response in the bone. | 03-13-2014 |
20140074103 | SUBCHONDRAL TREATMENT OF BONE DEFECTS WITH BONE-DERIVED IMPLANT - Methods of treating bone defects of the joint, particularly at the subchondral level, such as with bone-derived implants or injectable bone augmentation materials, either in combination or alone, are provided. A system of instruments and tools for delivering the implant and injectable material is also provided. These instruments and tools may be provided with depth control features. | 03-13-2014 |
20140074117 | NAVIGATION INSTRUMENTS FOR SUBCHONDRAL BONE TREATMENT - Navigation instruments and guides for targeting a subchondral region of bone and subchondral bone defects are provided. The instruments and guides may be used in reference to an anatomical landmark of a joint. | 03-13-2014 |
20140107781 | IMPLANTABLE DEVICES FOR SUBCHONDRAL TREATMENT OF JOINT PAIN - Devices and associated methods are disclosed for treating bone, and particularly bone tissue at the joints. Disclosed are implantable devices that can be used either alone or in combination with this augmentation or hardening material for the repair of bone defects and which are particularly suited for use at the joints, and even more particularly suited for use at the subchondral bone level. | 04-17-2014 |
20140114369 | NAVIGATION AND POSITIONING INSTRUMENTS FOR JOINT REPAIR - An instrument for controlled delivery of a device to a target area near a defect of a bone is provided. The instrument comprises a guide frame having a plurality of device portals, each portal defining a trajectory. The guide frame further includes visual markers for aligning the guide frame to an anatomical landmark on the bone to be treated. The instrument also includes a holder for releasable attachment with the guide frame. Each device portal is configured to provide accurate and controlled delivery of the device to the target area. In one example, the markers are radiopaque, and are visualized through fluoroscopy. A method of using the instrument is also provided. | 04-24-2014 |
20140277544 | SYSTEMS AND METHODS FOR JOINT REPAIR INCLUDING SUBCHONDRAL TREATMENT OF BONE - Systems and methods for the treatment of a joint are provided. These systems and methods may also include a subchondral treatment of bone of the same joint. These joint treatment methods may be non-surgical or surgical. Also provided are devices and instruments associated with the methods. | 09-18-2014 |
20140350685 | BONE-DERIVED IMPLANTABLE DEVICES FOR SUBCHONDRAL TREATMENT OF JOINT PAIN - Implantable devices for the surgical treatment of bone, and particularly to a bone defect at a joint region, and even more particularly at the subchondral bone level of the joint region, are disclosed. The implantable devices may be formed of a bone material, and configured to serve the dual functions of providing mechanical strength and structural integrity to the area to be treated, while also facilitating the dispersal of a flowable material in the same area. Associated delivery tools are also provided. | 11-27-2014 |
20150025589 | COORDINATE MAPPING SYSTEM FOR JOINT TREATMENT - A coordinate mapping system is provided for locating a defect in a bone. The system comprises a positioning instrument for controlled delivery of a device to a target site, the instrument comprising a main body and a rail extending from the main body, the rail including a series of indicia corresponding to predefined grid lines, and a template configured to overlay an image of a bone having a defect at the target site, the template including a predefined grid for determining a set of coordinates to locate the target site using the positioning instrument. A method of accessing a target site near a defect in a bone using the radial coordinate mapping system is also provided. | 01-22-2015 |
Stephen F. Hanson, North Attleboro, MA US
Patent application number | Description | Published |
---|---|---|
20100130462 | LANOLIN COMPOSITIONS AND METHODS FOR MAKING AND USING SAME - A composition suitable for application to the skin comprising lanolin, an oil, an anti-oxidant, and a combination thereof. The composition is suitable for particular application to a human breast. | 05-27-2010 |
Steven F. Hanson, Derby, KS US
Patent application number | Description | Published |
---|---|---|
20090051069 | RAPID RECONFIGURABLE FUSELAGE MANDREL - A system and method for making and using a reconfigurable composite part mandrel operable in the manufacture of composite parts. The system may comprise an assembly fixture, a generic mandrel, a reconfigurable simulated skin, a reconfigurable frame portion, and state-changing material operable to harden into a desired configuration for forming a particular composite part. The method of forming and using the reconfigurable composite part mandrel may comprise: inserting the simulated skin within the assembly fixture, inserting or assembling the frame portion within the assembly fixture; inserting the generic mandrel into the assembly fixture; filling a cavity between the generic mandrel and the assembly fixture with the state-changing mixture to encapsulate the frame portion; hardening the state-changing mixture; and removing the assembly fixture and the simulated skin. | 02-26-2009 |
20090278319 | VACUUM TRANSFER SEAL - An intermediate sealing element and method for unsealing a vacuum membrane from one tool surface and transferring it to another tool surface without damaging the vacuum membrane. The intermediate sealing element forms a continuous path around the periphery of a vacuum membrane and is sealed directly to one or more vacuum membranes and a tool surface using any means known in the art to create an airtight seal between two surfaces. The intermediate sealing element is able to withstand high temperatures and high pressure without altering its structural characteristics. Because of its durability, the intermediate sealing element can be removed from the tool surface without tearing or elongating, subsequently allowing the vacuum membranes to be detached from the tool surface without tearing or elongating. | 11-12-2009 |
20110027405 | Corner-Consolidating Inflatable Method for Manufacturing Composite Structures - An inflatable compaction tool for consolidating a composite material inside a faceted hollow or tubular mold for a composite part is made from an elastic material. The compaction tool includes relatively flat wall segments conjoined by corner segments that define a sealed chamber. The wall segments curve away from the mold surface toward the midpoint of each wall segment, so that as a pressurized fluid is introduced into the compaction tool, a component of the force exerted on the tool interior surface is transmitted through the wall segments toward the corner segments. Thus, during initial inflation, the corner segments are forced toward the corner regions of the mold before the wall segments contact the composite material, firmly compressing the composite material into the corner regions of the mold before the friction of the wall segments against the composite material inhibits expansion of the corner segments into the mold corner regions. | 02-03-2011 |
20110195230 | Apparatuses, Systems, and Methods for Manufacturing Composite Parts - Tooling aids for applying pressure in laminating, and methods for their use, are described herein. In one embodiment, a caul for applying pressure in laminating includes a base portion positioned between first and second corner portions. The base portion can have a curved shape when it is in a relaxed state, but it moves to a flatter shape when subjected to pressure during lamination. Movement of the base portion to the flatter shape causes the first and second corner portions to move outwardly and away from the base portion. In this manner, the caul can be used to compact laminating materials into corner regions of a corresponding female mold surface. | 08-11-2011 |
Susan Kloek Hanson, Los Alamos, NM US
Patent application number | Description | Published |
---|---|---|
20110040109 | METHOD OF CARBON CHAIN EXTENSION USING NOVEL ALDOL REACTION - Method of producing C | 02-17-2011 |
20110040110 | METHOD OF CARBON CHAIN EXTENSION USING NOVEL ALDOL REACTION - Method of producing C | 02-17-2011 |
20120232279 | Mild and Selective Vanadium-Catalyzed Oxidation of Benzylic, Allylic, and Propargylic Alcohols Using Air - The invention concerns processes for oxidizing an alcohol to produce a carbonyl compound. The processes comprise contacting the alcohol with (i) a gaseous mixture comprising oxygen; and (ii) an amine compound in the presence of a catalyst, having the formula: | 09-13-2012 |
20120289719 | Method Of Carbon Chain Extension Using Novel Aldol Reaction - Method of producing C | 11-15-2012 |
20120289720 | Method Of Carbon Chain Extension Using Novel Aldol Reaction - Method of producing C | 11-15-2012 |
20130248128 | PROCESS FOR DECOMPOSING LIGNIN IN BIOMASS - A mild inexpensive process for treating lignocellulosic biomass involves oxidative delignification of wood using an aqueous solution prepared by dissolving a catalytic amount of manganese (III) acetate into water and adding hydrogen peroxide. Within 4 days and without agitation, the solution was used to convert poplar wood sections into a fine powder-like delignified, cellulose rich materials that included individual wood cells. | 09-26-2013 |
Thomas Hanson, Sioux Falls, SD US
Patent application number | Description | Published |
---|---|---|
20090147081 | HAIR STYLING SYSTEM AND APPARATUS - A hair styling apparatus that may include a body portion; a handle portion that may extend away from the body portion; and a camera unit that may be coupled to the body portion, the camera unit may include a camera unit body portion; a lens that may be coupled to the camera unit body portion; and a transmitter that may be coupled within the camera unit body portion, wherein the transmitter may be operatively coupled to the lens. | 06-11-2009 |
Thomas C. Hanson, Boulder, CO US
Patent application number | Description | Published |
---|---|---|
20110137931 | Search Strategy Capture and Retrieval Method - A system that improves searching based on a search term by first capturing successful search strategies and then offering them in the results of a subsequent search based on the same search term. In the illustrative embodiment of the present invention, a search engine collects successful search sequences based on a search term, a database stores the search sequences and then provides them to the search engine in response to subsequent uses of the search term. The search engine comprises a data capture mechanism that gives a searcher a way of indicating when a successful search has been completed. | 06-09-2011 |
Thomas E. Hanson, Newark, DE US
Patent application number | Description | Published |
---|---|---|
20090246519 | Biosynthesis of Metalloid Containing Nanoparticles by Aerobic Microbes - Isolated tellurite-resistant or selenite-resistant marine organisms capable of precipitating tellurium or selenium when grown aerobically are described. A method for using these isolated organisms to produce an aqueous suspension of purified nanoparticles comprising tellurium or selenium and the nanoparticles comprising tellurium or selenium produced by this method are also described. The nanoparticles may further comprise cadmium or zinc. A method of remediation utilizing the described organisms is also presented. | 10-01-2009 |
Thomas W. Hanson, Loveland, OH US
Patent application number | Description | Published |
---|---|---|
20080283329 | MOTORIZED TRACTION DEVICE FOR A PATIENT SUPPORT - A patient support including a traction device for powered movement of the patient support. The traction device includes a storage position and a use position. | 11-20-2008 |
20120012408 | MOTORIZED TRACTION DEVICE FOR A PATIENT SUPPORT - A patient support including a traction device for powered movement of the patient support. | 01-19-2012 |
Thomas W. Hanson, Englewood, CO US
Patent application number | Description | Published |
---|---|---|
20080215193 | ELECTRONIC FLIGHT BAG HAVING FILTER SYSTEM AND METHOD - A system and method for filtering information from an electronic flight bag system (EFB) used on a mobile platform, for example, on an aircraft. In one embodiment the system makes use of an EFB having a display with a selection to enable a filter. When the filter is enabled, the user is presented with a plurality of options for limiting retrieved information to only specific types of information or data. This allows one, two or more layers of filtering to be implemented on the information that is searched and obtained from the EFB, and enables a limited subset of information to be obtained that is available for viewing on a display associated with the EFB. The system and method eliminates or significantly reduces the amount of non-relevant information that the crew members are required to review when attempting to obtain specific types of information from the EFB. | 09-04-2008 |
Van Hanson, Forest, VA US
Patent application number | Description | Published |
---|---|---|
20100167639 | SYSTEM AND METHOD FOR FEEDBACK CANCELLATION IN REPEATERS - An apparatus for repeating signals includes a receive antenna for receiving input signals, processing circuitry for processing the input signals to form repeated signals, and a transmit antenna for transmitting the repeated signals. The processing circuitry includes an adaptive digital filter configured to generate cancellation signals that are added to the input signals to cancel unwanted feedback signals from the input signals. A frequency shifting circuit adds a frequency shift to the input signals, after the addition of the cancellation signals, to form repeated signals that are frequency shifted from the input signals. A digital signal processor is coupled to the adaptive digital filter for digitally adapting the filter. The digital signal processor utilizes the frequency shift of the transmission signals to adapt the adaptive digital filter. | 07-01-2010 |
20100265848 | SYSTEM FOR AUTOMATIC CONFIGURATION OF A MOBILE COMMUNICATION SYSTEM - A communication system includes a receive antenna for receiving communication signals, processing circuitry for processing the received communication signals and repeating the signals for further transmission and at least one transmit antenna for transmitting the repeated signals. The processing circuitry utilizes configurable settings for controlling the operation of the communication system and the configurable settings are variable for varying the operation of the system. The processing circuitry is further operable for receiving inputs regarding current operating conditions of the communication system and for selectively adapting the configurable settings of the system based upon the operating condition inputs. | 10-21-2010 |
20100278530 | DISTRIBUTED ANTENNA SYSTEM FOR WIRELESS NETWORK SYSTEMS - A distributed antenna system is provided for communicating with a plurality of base stations. The distributed antenna system includes a system controller and a master unit communicating with at least one of the plurality of base stations. A remote unit communicates over a high data rate media with the master unit and/or a downstream remote unit. Alternatively, the distributed antenna system includes a controller and a digital time/space crosspoint switch controlled by the controller. A digitizing transceiver is in communication with the digital time/space crosspoint switch. The crosspoint switch is configured to transmit and receive digital data through the digitizing transceiver. | 11-04-2010 |
20110009056 | RADIO COMMUNICATION SYSTEMS WITH INTEGRATED LOCATION-BASED MEASUREMENTS FOR DIAGNOSTICS AND PERFORMANCE OPTIMIZATION - A radio communication system includes at least one receive antenna for receiving communication signals, processing circuitry for processing the received communication signals and repeating the signals for further transmission, and at least one transmit antenna for transmitting the repeated signals. The processing circuitry is operable for receiving an input regarding the current geographic location of the communication system. The processing circuitry is further capable of recording measurements and data regarding the operation and use of the radio communication system and its operating environment including where and when the measurements and data were taken. The processing circuitry further provides a user interface and capabilities to analyze and visualize the recorded information to diagnose problems and optimize performance. Additionally, the recorded information can be transmitted to a remote server where can be used to determine optimal operational settings for other radio communication systems when they are operating in the same location where the measurements were taken, and these operational settings can be transmitted to these other radio communications systems prior to their use in these locations. | 01-13-2011 |
20110143658 | SYSTEM AND METHOD FOR DETERMINING AND CONTROLLING GAIN MARGIN IN AN RF REPEATER - An apparatus for repeating signals includes a receive antenna for capturing a receive signal, processing circuitry for processing the receive signal to form a repeated signal, and a transmit antenna for transmitting the repeated signal. The processing circuitry includes gain circuitry for gain in the repeated signal and decorrelation circuitry configured for modifying the repeated signal with respect to the receive signal to thereby decorrelate the repeated signal from the receive signal. The processing circuitry further comprises circuitry configured for calculating a gain margin for the apparatus utilizing the decorrelated receive and repeated signals. | 06-16-2011 |
20120170620 | SYSTEM AND METHOD FOR FEEDBACK CANCELLATIO IN REPEATERS - An apparatus for repeating signals includes a receive antenna for receiving input signals, processing circuitry for processing the input signals to form repeated signals, and a transmit antenna for transmitting the repeated signals. The processing circuitry includes an adaptive digital filter configured to generate cancellation signals that are added to the input signals to cancel unwanted feedback signals from the input signals. A frequency shifting circuit adds a frequency shift to the input signals, after the addition of the cancellation signals, to form repeated signals that are frequency shifted from the input signals. A digital signal processor is coupled to the adaptive digital filter for digitally adapting the filter. The digital signal processor utilizes the frequency shift of the transmission signals to adapt the adaptive digital filter. | 07-05-2012 |
20130121703 | DISTRIBUTED ANTENNA SYSTEM FOR WIRELESS NETWORK SYSTEMS - A distributed antenna system is provided for communicating with a plurality of base stations. The distributed antenna system includes a system controller and a master unit communicating with at least one of the plurality of base stations. A remote unit communicates over a high data rate media with the master unit and/or a downstream remote unit. Alternatively, the distributed antenna system includes a controller and a digital time/space crosspoint switch controlled by the controller. A digitizing transceiver is in communication with the digital time/space crosspoint switch. The crosspoint switch is configured to transmit and receive digital data through the digitizing transceiver. | 05-16-2013 |
20130136202 | SYSTEMS AND METHODS FOR TRANSPORTING DIGITAL RF SIGNALS - A telecommunications system is provided that can re-sample a digitized signal at a resample rate that is based on one or more factors to better utilize bandwidth. The factors can include the bandwidth of the signal that the digitized signal represents, the amount of bandwidth owned or used by the carrier, the full bandwidth of the designated RF band, the bandwidth of the serial link, the frame length of the serial link, the segmentation of the frames on the serial link, and the capability of the equipment at the receiving end of a serial link. The re-sampled signal can be transmitted to another unit that is remote to the unit transmitting the signal. The other unit can include a re-sampling device that restores the re-sampled signal to a digital signal that can be converted to an analog signal for wireless transmission. | 05-30-2013 |
20130308537 | DISTRIBUTED ANTENNA SYSTEM FOR WIRELESS NETWORK SYSTEMS - A distributed antenna system is provided for communicating with a plurality of base stations. The distributed antenna system includes a system controller and a master unit communicating with at least one of the plurality of base stations. A remote unit communicates over a high data rate media with the master unit and/or a downstream remote unit. Alternatively, the distributed antenna system includes a controller and a digital time/space crosspoint switch controlled by the controller. A digitizing transceiver is in communication with the digital time/space crosspoint switch. The crosspoint switch is configured to transmit and receive digital data through the digitizing transceiver. | 11-21-2013 |
20150016296 | RADIO COMMUNICATION SYSTEMS WITH INTEGRATED LOCATION-BASED MEASUREMENTS FOR DIAGNOSTICS AND PERFORMANCE OPTIMIZATION - A radio communication system includes at least one receive antenna for receiving communication signals, processing circuitry for processing the received communication signals and repeating the signals for further transmission, and at least one transmit antenna for transmitting the repeated signals. The processing circuitry is operable for receiving an input regarding the current geographic location of the communication system. The processing circuitry is further capable of recording measurements and data regarding the operation and use of the radio communication system and its operating environment including where and when the measurements and data were taken. The processing circuitry further provides a user interface and capabilities to analyze and visualize the recorded information to diagnose problems and optimize performance. Additionally, the recorded information can be transmitted to a remote server where can be used to determine optimal operational settings for other radio communication systems when they are operating in the same location where the measurements were taken, and these operational settings can be transmitted to these other radio communications systems prior to their use in these locations. | 01-15-2015 |
Wayne H. Hanson, Belgrade, MT US
Patent application number | Description | Published |
---|---|---|
20090309336 | MULTIFUNCTIONAL FOLDABLE MOBILITY BASE - A foldable wheel chair or mobility base is disclosed that comprises a chair portion and a wheeled frame. The chair portion has a back hinged to a seat. The frame supports the chair portion, a spaced pair of front wheel caster assemblies and a spaced pair of rear wheels. A lower end of the back of the chair portion attaches to the frame via two spaced brackets which are slidably connected to upright curved rear support members such that they can be moved along the curved rear support members to permit adjustment of the chair tilt between predetermined stop positions along the curved rear support members without changing a seat to back angle. The chair portion is connected to the frame via front support members and diagonal struts connected to common pins fastened to each of the front wheel caster assemblies. The other end of each diagonal strut is hinged to one of the spaced brackets. The chair preferably provides a different distance between front and rear wheels at different seat to back angles and tilt positions of the chair portion. Further, the configuration permits virtually independent adjustment of chair portion tilt, seat to back angles and permits a separate dynamic movement of the seat to back angle to facilitate therapeutic exercise capability for a chair occupant. | 12-17-2009 |
William J. Hanson, Bolton, MA US
Patent application number | Description | Published |
---|---|---|
20090216339 | Through-Liner Electrode System for Prosthetics and the Like - A system for passing myoelectric signals through a suspension liner of a prosthetic device, the suspension liner having an inner surface that is in contact with a user's skin and an outer surface that is adjacent to an outer socket of the prosthetic device. The system in one embodiment includes a flexible conductive electrode insert defining a first portion located on or adjacent the inner surface of the suspension liner such that it touches the user's skin, a second portion passing through the suspension liner, and a third portion on the outer surface of the suspension liner, and an adhesive that adheres at least the second and third portions of the insert to the suspension liner. | 08-27-2009 |
William P. Hanson, Carlisle, PA US
Patent application number | Description | Published |
---|---|---|
20090217777 | ANALYTE SCREENING AND DETECTION SYSTEMS AND METHODS - Methods of concentrating an analyte that is in liquid and method of detecting an analyte in a liquid are disclosed. Methods of screening a liquid for the presence of an analyte are also disclosed. Processes comprising continuously collecting a sample of fluid throughout the process and analyzing the sample are disclosed as are processes comprising treating ultrafilter membranes. Devices and systems for concentrating an analyte that is in liquid and for screening a liquid for an analyte are disclosed as well as devices and systems for concentrating an analyte from a continuous sample are disclosed. | 09-03-2009 |
Yvonne Hanson, Tucson, AZ US
Patent application number | Description | Published |
---|---|---|
20090122796 | SYSTEM AND ARTICLE OF MANUFACTURE FOR DATA TRANSMISSION - Provided are a system and article of manufacture for data communications. A transmitter transmits a plurality of packets, wherein each packet is transmitted after a time interval. A receiver receives at least one part of the plurality of packets. The receiver determines whether all parts of a packet are received before expiration of the time interval, wherein the received packet is valid if all parts are received before the expiration of the time interval. | 05-14-2009 |