| Patent application number | Description | Published |
|---|
| 20090087446 | COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY - Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines. | 04-02-2009 |
| 20090306177 | Modulation of Immunostimulatory Properties of Short Interfering Ribonucleic Acid (Sirna) by Nucleotide Modification - Double-stranded short interfering ribonucleic acid (siRNA) are modified to reduce or eliminate their immunostimulatory effect without significantly affecting their gene silencing effect. Modified siRNA include one or more 2′ sugar modifications and, optionally, internucleotide linkages on the sense strand. Compositions containing the modified siRNA and methods of making and using the modified siRNA are disclosed. New and previously characterized siRNA can be synthesized to incorporate modifications according to the invention. | 12-10-2009 |
| 20100022016 | POLYAMIDE NUCLEIC ACID DERIVATIVES AND AGENTS, AND PROCESSES FOR PREPARING THEM - The present invention relates to PNA derivatives which carry, at the C terminus, or at both the C and N termini of the PNA backbone, one or more phosphoryl radicals. The phosphoryl radicals carry, where appropriate, one or more labeling groups, groups for crosslinking, groups which promote intracellular uptake, or groups which increase the binding affinity of the PNA derivative for nucleic acids. The invention furthermore relates to a process for preparing the above-mentioned PNA derivatives and to their use as pharmaceuticals or diagnostic agents. | 01-28-2010 |
| 20100144846 | Oligoribonucleotides and uses thereof - The invention relates to immunostimulatory RNA oligonucleotides (ORN). In particular the ORN have an immunostimulatory ORN motif directly or indirectly flanked by a 3′ poly G motif and optionally a 5′ poly-G motif. The invention also relates to methods including therapeutic methods and screening methods and related kits for use of the ORN. | 06-10-2010 |
| 20100166780 | CpG Oligonucleotide Analogs Containing Hydrophobic T Analogs with Enhanced Immunostimulatory Activity - The invention relates to oligonucleotides including at least one lipophilic substituted nucleotide analog and a pyrimidine-purine dinucleotide. The invention also relates to pharmaceutical compositions and methods of use thereof. | 07-01-2010 |
| 20100183639 | NUCLEIC ACID-LIPOPHILIC CONJUGATES - The invention relates to a nucleic acid-lipophilic conjugates and methods for modulating an immune response using the conjugates. The lipophilic moiety associated with an immunostimulatory nucleic acid. | 07-22-2010 |
| 20100189772 | Compositions of TLR ligands and antivirals - The invention relates to methods and products for the treatment of viral infection using a combination of anti-viral agents and TLR ligands. The invention also relates to screening assays, associated products, kits, and in vitro methods. | 07-29-2010 |
| 20100261779 | Phosphate-Modified Oligonucleotide Analogs with Enhanced Immunostimulatory Activity - The invention relates to oligonucleotides including at least one backbone modification and a pyrimidine-purine dinucleotide. The invention also relates to pharmaceutical compositions and methods of use thereof. | 10-14-2010 |
| 20100285041 | Class A Oligonucleotides with Immunostimulatory Potency - The invention provides an immunostimulatory nucleic acid comprising CpG motifs, and methods of use thereof in stimulating immunity. | 11-11-2010 |
| 20110098456 | IMMUNE STIMULATORY OLIGONUCLEOTIDE ANALOGS CONTAINING MODIFIED SUGAR MOIETIES - The invention relates to oligonucleotides including at least one FANA substituted nucleotide analog and a pyrimidine-purine dinucleotide. The invention also relates to pharmaceutical compositions and methods of use thereof. | 04-28-2011 |
