De Franciscis
Sergio De Franciscis, Florence IT
Sergio De Franciscis, Firenze IT
Patent application number | Description | Published |
---|---|---|
20130162186 | SENSORLESS TORSIONAL MODE DAMPING SYSTEM AND METHOD - A torsional mode damping controller system is connected to a converter that drives an electrical machine mechanically connected to a train. The controller system includes an input interface configured to receive measured data related to variables of the converter or the electrical machine, and a controller connected to the input interface. The controller calculates at least one dynamic torque component along a section of a shaft of the train based on the data from the input interface, generates control data for the converter for damping a torsional oscillation in the mechanical drive train based on the at least one dynamic torque component, and sends the control data to the converter for modulating an active power exchanged between the converter and the electrical machine. | 06-27-2013 |
Vittorio De Franciscis, Napoli (na) IT
Patent application number | Description | Published |
---|---|---|
20130177556 | EGFR APTAMER INHIBITOR FOR USE IN THERAPY AND DIAGNOSIS - The present invention concerns a nucleotide aptamer having the sequence 5′ GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3′ (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit. | 07-11-2013 |
20130197070 | AXL RECEPTOR TYROSINE KINASE APTAMER INHIBITOR FOR USE IN THERAPY - The present invention concerns a nucleotide aptamer having the sequence: 5′-AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC-3′(SEQ ID NO: 1) for use in the treatment and/or prevention and/or diagnosis of an Axl receptor tyrosine kinase induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of an Axl receptor tyrosine kinase induced disorder in a patient from which a sample is obtained and related diagnostic kit. | 08-01-2013 |