Cerchia
Laura Cerchia, Naples IT
Patent application number | Description | Published |
---|---|---|
20080227735 | Aptamers Selected From Live Tumor Cells and the Use Thereof - The invention relates to aptamers selected from live tumor cells and to the use thereof for diagnosis and treatment of certain cancers and other pathologies. | 09-18-2008 |
Laura Cerchia, Napoli IT
Patent application number | Description | Published |
---|---|---|
20110166213 | METHOD FOR OBTAINING OLIGONUCLEOTIDE APTAMERS AND USES THEREOF - The present invention relates to a method for obtaining nucleic acid aptamers that bind to cancer cell-surface epitopes, to the aptamers generated using this method and their use for therapeutic, diagnostic and prognostic purposes. | 07-07-2011 |
Laura Cerchia, Napoli (na) IT
Patent application number | Description | Published |
---|---|---|
20130177556 | EGFR APTAMER INHIBITOR FOR USE IN THERAPY AND DIAGNOSIS - The present invention concerns a nucleotide aptamer having the sequence 5′ GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3′ (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit. | 07-11-2013 |
20130197070 | AXL RECEPTOR TYROSINE KINASE APTAMER INHIBITOR FOR USE IN THERAPY - The present invention concerns a nucleotide aptamer having the sequence: 5′-AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC-3′(SEQ ID NO: 1) for use in the treatment and/or prevention and/or diagnosis of an Axl receptor tyrosine kinase induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of an Axl receptor tyrosine kinase induced disorder in a patient from which a sample is obtained and related diagnostic kit. | 08-01-2013 |