Patent application title: MICROORGANISMS FOR THERAPY
Inventors:
IPC8 Class: AA61K39285FI
USPC Class:
1 1
Class name:
Publication date: 2017-04-06
Patent application number: 20170095552
Abstract:
Therapeutic methods and vaccinia virus therefor are provided. The viruses
are designed so that they accumulate in immunoprivileged tissues and
cells, such as in tumors and other proliferating tissue and in inflamed
tissues, compared to other tissues, cells and organs, so that they
exhibit relatively low toxicity to host organisms. Combinations of the
viruses and anti-cancer agents and uses thereof for treating cancer also
are provided.Claims:
1. A method for reducing the mass and/or volume of a tumor, tumor tissue,
cancer or metastasis in a subject, comprising intravenously administering
a recombinant vaccinia virus to the subject, wherein; (i) the recombinant
vaccinia virus has a modification of the thymidine kinase gene affecting
nucleotide metabolism, (ii) the recombinant vaccinia virus replicates in
the subject, (iii) the recombinant vaccinia virus accumulates in the
tumor, tumor tissue, cancer or metastasis in the subject, and (iv) the
mass and/or volume of the tumor, tumor tissue, cancer or metastasis is
reduced.
2. The method of claim 1, wherein the subject is a mouse.
3. The method of claim 1, wherein the subject is a human.
4. The method of claim 1, wherein the tumor, tumor tissue, cancer or metastasis is present in an ovary of the subject.
5. The method of claim 1, wherein the tumor, tumor tissue, cancer or metastasis is present in a lung of the subject.
6. The method of claim 1, further comprising administering a pharmaceutical composition to the subject.
7. The method of claim 6, wherein the pharmaceutical composition comprises a chemotherapeutic agent.
8. The method of claim 1, wherein the recombinant vaccinia virus is administered in a mammalian host cell.
9. The method of claim 8, wherein the mammalian host cell is a stem cell.
Description:
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser. No. 14/301,813, allowed, to Aladar A. Szalay; Tatyana Timiryasova; Yong A. Yu; Qian Zhang, filed on Jun. 11, 2014, entitled "MICROORGANISMS FOR THERAPY," which is a continuation of U.S. application Ser. No. 13/507,572, to Aladar A. Szalay; Tatyana Timiryasova; Yong A. Yu; Qian Zhang, filed Jul. 10, 2012, entitled "MICROORGANISMS FOR THERAPY," now U.S. Pat. No. 8,784,836, issued on Jul. 22, 2014, which is a continuation of U.S. application Ser. No. 12/589,694, to Aladar A. Szalay; Tatyana Timiryasova; Yong A. Yu; Qian Zhang, filed Oct. 26, 2009, entitled "MICROORGANISMS FOR THERAPY," now U.S. Pat. No. 8,221,769, issued Jul. 17, 2012, which is a continuation of U.S. application Ser. No. 11/796,028, to Aladar A. Szalay; Tatyana Timiryasova; Yong A. Yu; Qian Zhang, filed on Apr. 25, 2007, entitled "MICROORGANISMS FOR THERAPY," which is a divisional of U.S. application Ser. No. 10/872,156, to Aladar A. Szalay, Tatyana Timiryasova, Yong A. Yu and Qian Zhang, filed on Jun. 18, 2004, entitled "MICROORGANISMS FOR THERAPY," now U.S. Pat. No. 7,588,767, issued Sep. 15, 2009, which claims the benefit of priority under 35 U.S.C. .sctn.119(a) to each of EP 03 013 826.7, filed 18 Jun. 2003, entitled "RECOMBINANT VACCINIA VIRUSES USEFUL AS TUMOR-SPECIFIC DELIVERY VEHICLE FOR CANCER GENE THERAPY AND VACCINATION;" EP 03 018 478.2, filed 14 Aug. 2003, entitled "METHOD FOR THE PRODUCTION OF A POLYPEPTIDE, RNA OR OTHER COMPOUND IN TUMOR TISSUE;" and EP 03 024 283.8, filed 22 Oct. 2003, entitled "USE OF A MICROORGANISM OR CELL TO INDUCE AUTOIMMUNIZATION OF AN ORGANISM AGAINST A TUMOR." The subject matter of each of these applications is incorporated by reference in its entirety.
[0002] U.S. application Ser. No. 14/301,813, allowed, also is a continuation of U.S. application Ser. No. 12/589,694, to Aladar A. Szalay; Tatyana Timiryasova; Yong A. Yu; Qian Zhang, filed Oct. 26, 2009, entitled "MICROORGANISMS FOR THERAPY," now U.S. Pat. No. 8,221,769, issued Jul. 17, 2012, which is a continuation of U.S. application Ser. No. 11/796,028, to Aladar A. Szalay; Tatyana Timiryasova; Yong A. Yu; Qian Zhang, filed on Apr. 25, 2007, entitled "MICROORGANISMS FOR THERAPY," which is a divisional of U.S. application Ser. No. 10/872,156, to Aladar A. Szalay, Tatyana Timiryasova, Yong A. Yu and Qian Zhang, filed on Jun. 18, 2004, entitled "MICROORGANISMS FOR THERAPY," now U.S. Pat. No. 7,588,767, issued Sep. 15, 2009, which claims the benefit of priority under 35 U.S.C. .sctn.119(a) to each of EP 03 013 826.7, filed 18 Jun. 2003, entitled "RECOMBINANT VACCINIA VIRUSES USEFUL AS TUMOR-SPECIFIC DELIVERY VEHICLE FOR CANCER GENE THERAPY AND VACCINATION;" EP 03 018 478.2, filed 14 Aug. 2003, entitled "METHOD FOR THE PRODUCTION OF A POLYPEPTIDE, RNA OR OTHER COMPOUND IN TUMOR TISSUE;" and EP 03 024 283.8, filed 22 Oct. 2003, entitled "USE OF A MICROORGANISM OR CELL TO INDUCE AUTOIMMUNIZATION OF AN ORGANISM AGAINST A TUMOR." The subject matter of each of these applications is incorporated by reference in its entirety.
[0003] U.S. application Ser. No. 14/301,813, allowed, also is a continuation of U.S. application Ser. No. 11/796,028, to Aladar A. Szalay; Tatyana Timiryasova; Yong A. Yu; Qian Zhang, filed on Apr. 25, 2007, entitled "MICROORGANISMS FOR THERAPY," which is a divisional of U.S. application Ser. No. 10/872,156, to Aladar A. Szalay, Tatyana Timiryasova, Yong A. Yu and Qian Zhang, filed on Jun. 18, 2004, entitled "MICROORGANISMS FOR THERAPY," now U.S. Pat. No. 7,588,767, issued Sep. 15, 2009, which claims the benefit of priority under 35 U.S.C. .sctn.119(a) to each of EP 03 013 826.7, filed 18 Jun. 2003, entitled "RECOMBINANT VACCINIA VIRUSES USEFUL AS TUMOR-SPECIFIC DELIVERY VEHICLE FOR CANCER GENE THERAPY AND VACCINATION;" EP 03 018 478.2, filed 14 Aug. 2003, entitled "METHOD FOR THE PRODUCTION OF A POLYPEPTIDE, RNA OR OTHER COMPOUND IN TUMOR TISSUE;" and EP 03 024 283.8, filed 22 Oct. 2003, entitled "USE OF A MICROORGANISM OR CELL TO INDUCE AUTOIMMUNIZATION OF AN ORGANISM AGAINST A TUMOR." The subject matter of each of these applications is incorporated by reference in its entirety.
[0004] This application also is related to International Application Serial No. PCT/US04/19866, filed on Jun. 18, 2004. This application also is related to U.S. application Ser. No. 10/866,606, filed Jun. 10, 2004, entitled "LIGHT EMITTING MICROORGANISMS AND CELLS FOR DIAGNOSIS AND THERAPY OF TUMORS," now U.S. Pat. No. 8,568,707, issued Oct. 29, 2013, which is a continuation of U.S. application Ser. No. 10/189,918, filed Jul. 3, 2002, entitled "LIGHT EMITTING MICROORGANISMS AND CELLS FOR DIAGNOSIS AND THERAPY OF TUMORS"; U.S. application Ser. No. 10/849,664, filed May 19, 2004, entitled, "LIGHT EMITTING MICROORGANISMS AND CELLS FOR DIAGNOSIS AND THERAPY OF DISEASES ASSOCIATED WITH WOUNDED OR INFLAMED TISSUE," which is a continuation of U.S. application Ser. No. 10/163,763, filed Jun. 5, 2002, entitled "LIGHT EMITTING MICROORGANISMS AND CELLS FOR DIAGNOSIS AND THERAPY OF DISEASES ASSOCIATED WITH WOUNDED OR INFLAMED TISSUE;" International PCT Application PCT/IB2002/004767, published as WO 03/014380, filed Jul. 31, 2002, entitled "MICROOROGANISMS AND CELLS FOR DIAGNOSIS AND THERAPY OF TUMORS;" International PCT Application PCT/EP2003/005907, published as WO 03/104485, filed Jun. 5, 2003, entitled, "LIGHT EMITTING MICROORGANISMS AND CELLS FOR DIAGNOSIS AND THERAPY OF DISEASES ASSOCIATED WITH WOUNDED OR INFLAMED TISSUE;" EP Application No. 01 118 417.3, filed Jul. 31, 2001, entitled "LIGHT EMITTING MICROORGANISMS AND CELLS FOR TUMOUR DIAGNOSIS/THERAPY;" EP Application No. 01 125 911.6, filed Oct. 30, 2001, entitled "LIGHT EMITTING MICROORGANISMS AND CELLS FOR DIAGNOSIS AND THERAPY OF TUMORS;" EP Application No. 02 794 632.6, filed Jan. 28, 2004, entitled "VACCINIA VIRUS FOR DIAGNOSIS AND THERAPY OF TUMORS;" and EP Application No. 02 012 552.2, filed Jun. 5, 2002, entitled "LIGHT EMITTING MICROORGANISMS AND CELLS FOR DIAGNOSIS AND THERAPY OF DISEASES ASSOCIATED WITH WOUNDED OR INFLAMED TISSUE." The subject matter of each of these applications is incorporated by reference in its entirety.
INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED ELECTRONICALLY
[0005] An electronic version of the Sequence Listing is filed herewith, the contents of which are incorporated by reference in their entirety. The electronic file was created on Oct. 21, 2016, is 263 kilobytes in size, and titled 4802Kseq001.txt.
FIELD OF THE INVENTION
[0006] Vaccines that contain attenuated or modified microorganisms, including microbes and cells, and methods for preparing the microorganisms and vaccines are provided. In particular, modified bacteria, eukaryotic cells and viruses are provided and methods of use thereof for treatment of proliferative and inflammatory disorders and for production of products in tumors are provided.
BACKGROUND
[0007] In the late 19th century, a variety of attempts were made to treat cancer patients with microorganisms. One surgeon, William Coley, administered live Streptococcus pyogenes to patients with tumors with limited success. In the early 20th century, scientists documented vaccinia viral oncolysis in mice, which led to administration of several live viruses to patients with tumors from the 1940s through the 1960s. These forays into this avenue of cancer treatment were not successful.
[0008] Since that time, a variety of genetically engineered viruses have been tested for treatment of cancers. In one study, for example, nude mice bearing nonmetastatic colon adenocarcinoma cells were systemically injected with a WR strain of vaccinia virus modified by having a vaccinia growth factor deletion and an enhanced green fluorescence protein inserted into the thymidine kinase locus. The virus was observed to have antitumor effect, including one complete response, despite a lack of exogenous therapeutic genes in the modified virus (McCart et al. (2001) Cancer Res 1:8751-8757). In another study, vaccinia melanoma oncolysate (VMO) was injected into sites near melanoma positive lymph nodes in a Phase III clinical trial of melanoma patients. As a control, New York City Board of Health strain vaccinia virus (VV) was administered to melanoma patients. The melanoma patients treated with VMO had a survival rate better than that for untreated patients, but similar to patients treated with the VV control (Kim et al. (2001) Surgical Oncol 10:53-59).
[0009] Other studies have demonstrated limited success with this approach. This therapy is not completely effective, particularly for systemically delivered viruses or bacteria. Limitations on the control of microbial vehicle function in vivo result in ineffective therapeutic results as well as raising safety concerns. It would be desirable to improve this type of therapy or to develop more effective approaches for treatments of neoplastic disease. Therefore, among the objects herein, it is an object to provide therapeutic methods and microorganisms for the treatment of neoplastic and other diseases.
SUMMARY
[0010] Provided herein are therapeutic methods and microorganisms, including viruses, bacteria and eukaryotic cells, for uses in the methods for the treatment of neoplastic diseases and other diseases. Diseases for treatment are those in which the targeted tissues and/or cells are immunoprivileged in that they, and often the local environment thereof, somehow escape or are inaccessible to the immune system. Such tissues include tumors and other tissues and cells involved in other proliferative disorders, wounds and other tissues involved in inflammatory responses. The microorganisms, which include bacterial cells, viruses and mammalian cells, are selected or are designed to be non-pathogenic and to preferentially accumulate in the immunoprivileged tissues. The microorganisms, once in the tissues or cells or vicinity thereof, affect the cell membranes of the cells in such tissues so that they become leaky or lyse, but sufficiently slowly so that the targeted cells and tumors leak enough antigen or other proteins for a time sufficient to elicit an immune response.
[0011] The microorganisms are administered by any route, including systemic administration, such as i.v. or using oral or nasal or other delivery systems that direct agents to the lymphatics. In exemplary methods, the microorganisms are used to treat tumors and to prevent recurrence and metastatic spread. Exemplary microorganisms include highly attenuated viruses and bacteria, as well as mammalian cells. The microorganisms are optionally modified to deliver other products, including other therapeutic products to the targeted tissues.
[0012] When the microorganisms are administered to a host that contains tumors, the tumors in the host essentially become antigen and protein factories. This can be exploited so that the tumors can be used to produce proteins or other cellular products encoded by or produced by the microorganisms. In addition, the host sera can be harvested to isolate antibodies to products produced by the microorganisms as well as the tumor cells. Hence also provided are methods for producing gene products by administering the microorganisms to an animal, generally a non-human animal, and harvesting the tumors to isolate the product. Also provided are methods for producing antibodies to selected proteins or cell products, such as metabolites or intermediates, by administering a microorganism that expresses or produces the protein or other product to a host, typically a non-human host; and harvesting serum from the host and isolating antibodies that specifically bind to the protein or other product.
[0013] Thus provided are methods and microorganisms for elimination of immunoprivileged cells or tissues, particularly tumors. The methods include administration, typically systemic administration, with a microorganism that preferentially accumulates in immunoprivileged cells, such as tumor cells, resulting in leakage proteins and other compounds, such as tumor antigens, resulting in vaccination of the host against non-host proteins and, such as the tumor antigens, providing for elimination of the immunoprivileged cells, such as tumor cells, by the host's immune system. The microorganisms are selected not for their ability to rapidly lyse cells, but rather for the ability to accumulate in immunoprivileged cells, such as tumors, resulting in a leakage of antigens in a sufficient amount and for a sufficient time to elicit an immune response.
[0014] Hence provided are uses of microorganisms or cells containing heterologous DNA, polypeptides or RNA to induce autoimmunization of an organism against a tumor. In particular, the microorganisms are selected or designed to accumulate in tumors and to accumulate very little, if at all (to be non-toxic to the host) in non-tumorous cells, tissues or organs, and to in some manner result in the tumor cell lyses or cell membrane disruption such that tumor antigens leak. Exemplary of such microorganisms are the LIVP-derived vaccinia virus and the bacteria described herein and also mammalian cells modified to target the tumors and to disrupt the cells membrane. The microorganisms can be modified to express heterologous products that mediate or increase the leakage of the tumor cell antigens and/or that are therapeutic, such as anti-tumor compounds.
[0015] Also provided are methods for production of antibodies against a tumor by (a) injecting a microorganism or cell containing a DNA sequence encoding a desired polypeptide or RNA into an organism bearing a tumor and (b) isolating antibodies against the tumor.
[0016] Provided are attenuated microorganisms that accumulate in immunoprivileged tissues and cells, such as tumor cells, but do not accumulate to toxic levels in non-targeted organs and tissues, and that upon administration to an animal bearing the immunoprivileged tissues and cells, result in autoimmunity, such as by production of anti-tumor (or anti-tumor antigen) antibodies against the immunoprivileged cells or products thereof. The microorganisms are selected or produced to render the immunoprivileged cells leaky, such as by a slow lysis or apoptotic process. The goal is to achieve such leakiness, but to not lyse the cells so rapidly that the host cannot mount an immune response.
[0017] Uses of and methods of use of the microorganisms for eliminating immunoprivileged tissues and cells are provided. The microorganisms optionally include reporter genes and/or other heterologous nucleic acids that disrupt genes in the microorganism and can also encode and provide therapeutic products or products, such as RNA, including RNAi, that alter gene and/or protein expression in the cells or tissues where the microorganism accumulates. Among the viruses provided are attenuated pox viruses that contain a modified TK and HA gene and a modified F3 gene or locus that corresponds to the F3 gene in vaccinia. In particular, provided are recombinant vaccinia viruses that contain a modified TK and HA gene and optionally a modified F3 gene or locus, wherein the resulting virus does not accumulate to toxic levels in non-targeted organs. Vaccinia viruses where the TK gene and F3 gene are modified and vaccinia viruses where the HA and F3 gene are modified, and viruses where all three genes are modified are provided. Modification includes inactivation by insertion, deletion or replacement of one or more nucleotide bases whereby an activity or product of the virus is altered. Included among the alterations is insertion of heterologous nucleic acid, such as therapeutic protein-encoding nucleic acids.
[0018] In exemplary embodiments, the vaccinia viruses are Lister strain viruses, particularly LIVP strain viruses (LIVP refers to the Lister virus from the Institute of Viral Preparations, Moscow, Russia, the original source for this now widely disseminated virus strain). Modifications include modification of the virus at the unique NotI site in the locus designed F3. In particular, the modification can be at position 35 of the F3 locus (gene) or at position 1475 inside of the HindIII-F fragment of vaccinia virus DNA strain LIVP.
[0019] The heterologous nucleic acid can include regulatory sequences operatively linked to the nucleic acid encoding the protein. Regulatory sequences include promoters, such as the vaccinia virus early/late promoter p7.5 and an early/late vaccinia pE/L promoter. The heterologous nucleic acid in the microorganism can encode a detectable protein or a product capable of inducing a detectable signal. Inclusion of detectable protein or a product that can generate a detectable signal permits monitoring of the distribution of the administered microorganism as well as monitoring therapeutic efficacy, since the microorganism will be eliminated when the immunoprivileged cells are eliminated.
[0020] Host cells containing the recombinant viruses, such as the triple mutant vaccinia virus exemplified herein are provided. Also contemplated are tumor cells that contain any of the microorganisms provided herein or used in the methods.
[0021] Pharmaceutical compositions containing the microorganisms in a pharmaceutically acceptable vehicle for use in the methods herein are provided. The pharmaceutical compositions can be formulated for any mode of administration, including, but not limited to systemic administration, such as for intravenous administration or is formulated. The compositions can contain a delivery vehicle, such as a lipid-based carrier, including liposomes and micelles associated with the microorganism.
[0022] Also provided are methods (and uses of the microorganisms) for eliminating immunoprivileged cells, such as tumor cells in an animal, by administering the pharmaceutical compositions to an animal, whereby the virus accumulates in the immunoprivileged cells, thereby mediating autoimmunization resulting in elimination of the cells or a reduction in their number.
[0023] Therapeutic methods for eliminating immunoprivileged cells or tissues, in an animal, by administering a microorganism to an animal, where the microorganism accumulates in the immunoprivileged cells; the microorganism does not accumulate in unaffected organs and tissues and has low toxicity in the animal; and the microorganism results in leakage of the cell membranes in the immunoprivileged cells, whereby the animal produces autoantibodies against the cells or products of the cells are provided. These methods include tumor treatment, treatment for inflammatory conditions, including wounds, and proliferative disorders, including psoriasis, cancers, diabetic retinopathies, restenosis and other such disorders. It is desirable for the microorganisms to not accumulate in unaffected organs, particularly the ovaries or testes.
[0024] The microorganisms attenuated include attenuated viruses, such as pox viruses and other cytoplasmic viruses, bacteria such as vibrio, E. coli, salmonella, streptococcus and listeria and mammalian cells, such as immune cells, including B cells and lymphocytes, such as T cells, and stem cells.
[0025] Also provided are methods for production of a polypeptide or RNA or compound, such as a cellular product, and uses of the microorganism therefore are provided. Such methods can include the steps of: (a) administering a microorganism containing nucleic acid encoding the polypeptide or RNA or producing the product compound to tumor-bearing animal, where the microorganism accumulates in the immunoprivileged cells; and the microorganism does not accumulate to toxic levels in organs and tissues that do not comprise immunoprivileged cells or tissues; (b) harvesting the tumor tissue from the animal; and (c) isolating the polypeptide or RNA or compound from the tumor.
[0026] As noted, the microorganisms include eukaryotic cells, prokaryotic cells and viruses, such as a cytoplasmic virus or an attenuated bacterium or a stem cell or an immune cell. The bacterium can be selected from among attenuated vibrio, E. coli, listeria, salmonella and streptococcus strains. The microorganism can express or produce detectable products, such as a fluorescent protein (i.e., green, red and blue fluorescent proteins and modified variants thereof), and/or luciferase which, when contacted with a luciferin produces light, and also can encode additional products, such as therapeutic products. In the methods and uses provided herein, the animals can be non-human animals or can include humans.
[0027] Also provided are methods for simultaneously producing a polypeptide, RNA molecule or cellular compound and an antibody that specifically reacts with the polypeptide, RNA molecule or compound, by: a) administering a microorganism to a tumor-bearing animal, wherein the microorganism expresses or produces the compound, polypeptide or RNA molecule; and b) isolating the antibody from serum in the animal. The method optionally includes, after step a) harvesting the tumor tissue from the animal; and isolating the polypeptide, RNA molecule or cellular compound from the tumor tissue.
[0028] Also provided are methods for eliminating immunoprivileged cells or tissues in an animal, such as tumor cells, and uses of the microorganisms therefore by administering at least two microorganisms, wherein the microorganisms are administered simultaneously, sequentially or intermittently, wherein the microorganisms accumulate in the immunoprivileged cells, whereby the animal is autoimmunized against the immunoprivileged cells or tissues.
[0029] Uses of at least two microorganisms for formulation of a medicament for elimination of immunoprivileged cells or tissues, wherein they accumulate in the immunoprivileged cells, whereby the animal is autoimmunized against the immunoprivileged cells or tissues are provided. Combinations containing at least two microorganisms formulated for administration to an animal for elimination of immunoprivileged cells or tissues are provided. Kits containing packaged combination optionally with instructions for administration and other reagents are provided.
[0030] Uses of a microorganism encoding heterologous nucleic acid for inducing autoimmunization against products produced in immunoprivileged cells, wherein, when administered, the microorganism accumulates in immunoprivileged tissues and does not accumulate or accumulates at a sufficiently low level in other tissues or organs to be non-toxic to an animal containing the immunoprivileged tissues are provided.
[0031] Methods for the production of antibodies against products produced in immunoprivileged tissues or cells by: (a) administering a microorganism containing nucleic acid encoding a selected protein or RNA into an animal containing the immunoprivileged tissues or cells; and (b) isolating antibodies against the protein or RNA from the blood or serum of the animal are provided.
[0032] Also provided are methods for inhibiting growth of immunoprivileged cells or tissue in a subject by: (a) administering to a subject a modified microorganism, wherein the modified microorganism encodes a detectable gene product; (b) monitoring the presence of the detectable gene product in the subject until the detectable gene product is substantially present only in immunoprivileged tissue or cells of a subject; and (c) administering to a subject a therapeutic compound that works in conjunction with the microorganism to inhibit growth of immunoprivileged cells or tissue or by: (a) administering to a subject a modified microorganism that encodes a detectable gene product; (b) administering to a subject a therapeutic substance that reduces the pathogenicity of the microorganism; (c) monitoring the presence of the detectable gene product in the subject until the detectable gene product is substantially present only in immunoprivileged tissue or cells of a subject; and (d) terminating or suspending administration of the therapeutic compound, whereby the microorganism increases in pathogenicity and the growth of the immunoprivileged cells or tissue is inhibited.
DESCRIPTION OF THE FIGURES
[0033] FIG. 1: Schematic of the various vaccinia strains described in the Examples. Results achieved with the viruses are described in the Examples.
[0034] FIG. 2 sets forth a flow chart for a method for producing products, such as nucleic acid molecules, proteins and metabolic compounds or other cellular products in tumors.
DETAILED DESCRIPTION
[0035] A. Definitions
[0036] B. Microorganisms for Tumor-Specific Therapy
[0037] 1. Characteristics
[0038] a. Attenuated
[0039] i. Reduced toxicity
[0040] ii. Accumulate in immunoprivileged cells and tissues, such as tumor, not substantially in other organs
[0041] iii. Ability to Elicit or Enhance Immune Response to Tumor Cell
[0042] iv. Balance of Pathogenicity and Release of Tumor Antigens
[0043] b. Immunogenicity
[0044] c. Replication Competent
[0045] d. Genetic Variants
[0046] i. Modified Characteristics
[0047] ii. Exogenous Gene Expression
[0048] iii. Detectable gene product
[0049] iv. Therapeutic gene product
[0050] v. Expressing a superantigen
[0051] vi. Expressing a gene product to be harvested
[0052] 2. Viruses
[0053] a. Cytoplasmic viruses
[0054] i. Poxviruses
[0055] a. Vaccinia Virus
[0056] b. Modified Vaccinia Viruses
[0057] c. The F3 Gene
[0058] d. Multiple Modifications
[0059] e. The Lister Strain
[0060] ii. Other cytoplasmic viruses
[0061] b. Adenovirus, Herpes, Retroviruses
[0062] 3. Bacteria
[0063] a. Aerobic bacteria
[0064] b. Anaerobic bacteria
[0065] 4. Eukaryotic cells
[0066] C. Methods for Making an Attenuated Microorganism
[0067] 1. Genetic Modifications
[0068] 2. Screening for above characteristics
[0069] D. Therapeutic Methods
[0070] 1. Administration
[0071] a. Steps prior to administering the microorganism
[0072] b. Mode of administration
[0073] c. Dosage
[0074] d. Number of administrations
[0075] e. Co-administrations
[0076] i. Administering a plurality of microorganisms
[0077] ii. Therapeutic compounds
[0078] f. State of subject
[0079] 2. Monitoring
[0080] a. Monitoring microorganismal gene expression
[0081] b. Monitoring tumor size
[0082] c. Monitoring antibody titer
[0083] d. Monitoring general health diagnostics
[0084] e. Monitoring coordinated with treatment
[0085] E. Methods of Producing Gene Products and Antibodies
[0086] 1. Production of Recombinant Proteins and RNA molecules
[0087] 2. Production of Antibodies
[0088] F. Pharmaceutical Compositions, combinations and kits
[0089] 1. Pharmaceutical Compositions
[0090] 2. Host Cells
[0091] 3. Combinations
[0092] 4. Kits
[0093] G. Examples
A. Definitions
[0094] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the invention(s) belong. All patents, patent applications, published applications and publications, websites and other published materials referred to throughout the entire disclosure herein, unless noted otherwise, are incorporated by reference in their entirety. In the event that there are a plurality of definitions for terms herein, those in this section prevail. Where reference is made to a URL or other such identifier or address, it is understood that such identifiers can change and particular information on the internet can come and go, but equivalent information is known and can be readily accessed, such as by searching the internet and/or appropriate databases. Reference thereto evidences the availability and public dissemination of such information.
[0095] As used herein, microorganisms refers to isolated cells or viruses, including eukaryotic cells, such as mammalian cells, viruses and bacteria. The microorganisms are modified or selected for their ability to accumulate in tumors and other immunoprivileged cells and tissues, and to minimize accumulation in other tissues or organs. Accumulation occurs by virtue of selection or modification of the microorganisms for particular traits or by proper selection of cells. The microorganism can be further modified to alter a trait thereof and/or to deliver a gene product. The microorganisms provided herein are typically modified relative to wild type to exhibit one or more characteristics such as reduced pathogenicity, reduced toxicity, preferential accumulation in tumors relative to normal organs or tissues, increased immunogenicity, increased ability to elicit or enhance an immune response to tumor cells, increased lytic or tumor cell killing capacity, decreased lytic or tumor cell killing capacity.
[0096] As used herein, immunoprivileged cells and tissues refer to cells and tissues, such as solid tumors and wounded tissues, which are sequestered from the immune system. Generally administration of a microorganism elicits an immune response that clears the microorganism; immunoprivileged sites, however, are shielded or sequestered from the immune response, permitting the microorganisms to survive and generally to replicate. Immunoprivileged tissues include inflamed tissues, such as wounded tissues, and proliferating tissues, such as tumor tissues.
[0097] As used herein, "modified" with reference to a gene refers to a deleted gene, or a gene encoding a gene product having one or more truncations, mutations, insertions or deletions, typically accompanied by at least a change, generally a partial loss of function.
[0098] As used herein F3 gene refers to a gene or locus in a virus, such as a vaccinia virus, that corresponds to the F3 gene of vaccinia virus strain LIVP. This includes the F3 gene of any vaccinia virus strain or poxvirus encoding a gene product having substantially the same or at least a related biological function or locus in the genome. F3 genes encompassed herein typically have at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity along the full length of the sequence of nucleotides set forth in SEQ ID NO:1. The proteins encoded by F3 genes encompassed herein typically have at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to the sequence of amino acids set forth SEQ ID NO:2 along the full-length sequence thereof. Also included are corresponding loci in other viruses that when modified or eliminated result in reduced toxicity and/or enhanced accumulation in tumors (compared to non-tumorous cells, tissues and organs). The corresponding loci in other viruses equivalent to the F3 gene in LIVP can be determined by the structural location of the gene in the viral genome: the LIVP F3 gene is located on the HindIII-F fragment of vaccinia virus between open reading frames F14L and F15L as defined by Goebel et al., Virology (1990) 179:247-266, and in the opposite orientation of ORFs F14L and F15L; thus corresponding loci in other viruses such as poxviruses including orthopoxviruses are included.
[0099] As used herein, attenuate toxicity of a microorganism means to reduce or eliminate deleterious or toxic effects to a host upon administration of the microorganism compared to the unattenuated microorganism.
[0100] As use herein, a microorganism with low toxicity means that upon administration a microorganism does not accumulate in organs and tissues in the host to an extent that results in damage or harm to organs or that impact on survival of the host to a greater extent than the disease being treated does.
[0101] As used herein, subject (or organism) refers to an animal, including a human being.
[0102] As used herein, animal includes any animal, such as, but are not limited to primates including humans, gorillas and monkeys; rodents, such as mice and rats; fowl, such as chickens; ruminants, such as goats, cows, deer, sheep; ovine, and other animals including pigs, horses, cats, dogs, and rabbits. Non-human animals exclude humans as the contemplated animal.
[0103] As used herein, accumulation of a microorganism in a targeted tissue refers to the distribution of the microorganism throughout the organism after a time period long enough for the microbes to infect the host's organs or tissues. As one skilled in the art will recognize, the time period for infection of a microbe will vary depending on the microbe, the targeted organ(s) or tissue(s), the immunocompetence of the host, and dosage. Generally, accumulation can be determined at time-points from about 1 day to about 1 week after infection with the microbes. For purposes herein, the microorganisms preferentially accumulate in the target tissue, such as a tumor, but are cleared from other tissues and organs in the host to the extent that toxicity of the microorganism is mild or tolerable and at most not fatal.
[0104] As used herein, preferential accumulation refers to accumulation of a microorganism at a first location at a higher level than accumulation at a second location. Thus, a microorganism that preferentially accumulates in immunoprivileged tissue such as tumor relative to normal tissues or organs refers to a microorganism that accumulates in immunoprivileged tissue such as tumor at a higher level than the microorganism accumulates in normal tissues or organs.
[0105] As used herein, a "compound" produced in a tumor or other immunoprivileged site refers to any compound that is produced in the tumor by virtue of the presence of an introduced microorganism, generally a recombinant microorganism, expressing one or more genes. For example, a compound produced in a tumor can be, for example, a metabolite, an encoded polypeptide or RNA, or compound that is generated by a recombinant polypeptide (e.g., enzyme) and the cellular machinery of the tumor or immunoprivileged tissue or cells.
[0106] As used herein, a delivery vehicle for administration refers to a lipid-based or other polymer-based composition, such as liposome, micelle or reverse micelle, that associates with an agent, such as a microorganism provided herein, for delivery into a host animal.
[0107] As used herein, the term "viral vector" is used according to its art-recognized meaning. It refers to a nucleic acid vector construct that includes at least one element of viral origin and can be packaged into a viral vector particle. The viral vector particles can be used for the purpose of transferring DNA, RNA or other nucleic acids into cells either in vitro or in vivo. Viral vectors include, but are not limited to, retroviral vectors, vaccinia vectors, lentiviral vectors, herpes virus vectors (e.g., HSV), baculoviral vectors, cytomegalovirus (CMV) vectors, papillomavirus vectors, simian virus (SV40) vectors, semliki forest virus vectors, phage vectors, adenoviral vectors, and adeno-associated viral (AAV) vectors.
[0108] As used herein, oncolytic viruses refer to viruses that replicate selectively in tumor cells.
[0109] As used herein, "disease or disorder" refers to a pathological condition in an organism resulting from, e.g., infection or genetic defect, and characterized by identifiable symptoms.
[0110] As used herein, neoplasm (neoplasia) refers to abnormal new growth, and thus means the same as tumor, which can be benign or malignant. Unlike hyperplasia, neoplastic proliferation persists even in the absence of the original stimulus.
[0111] As used herein, neoplastic disease refers to any disorder involving cancer, including tumor development, growth, metastasis and progression.
[0112] As used herein, cancer is a general term for diseases caused by or characterized by any type of malignant tumor.
[0113] As used herein, malignant, as applies to tumors, refers to primary tumors that have the capacity of metastasis with loss of growth control and positional control.
[0114] As used herein, metastasis refers to a growth of abnormal or neoplastic cells distant from the site primarily involved by the morbid process.
[0115] As used herein, an anti-cancer agent or compound (used interchangeably with "anti-tumor or anti-neoplastic agent") refers to any agents or compounds used in anti-cancer treatment. These include any agents, when used alone or in combination with other compounds, that can alleviate, reduce, ameliorate, prevent, or place or maintain in a state of remission of clinical symptoms or diagnostic markers associated with neoplastic disease, tumors and cancer, and can be used in methods, combinations and compositions provided herein. Exemplary anti-neoplastic agents include the microorganism provided herein used singly or in combination and/or in combination with other agents, such as alkylating agents, antimetabolite, certain natural products, platinum coordination complexes, anthracenediones, substituted ureas, methylhydrazine derivatives, adrenocortical suppressants, certain hormones, antagonists and anti-cancer polysaccharides.
[0116] In general, for practice of the methods herein and when using the microorganisms provided herein, the original tumor is not excised, but is employed to accumulate the administered microorganism and as the cells become leaky or lyse to become an antigen or other product factor. The antigens can serve to elicit an immune response in the host. The antigens and products can be isolated from the tumor.
[0117] As used herein, angiogenesis is intended to encompass the totality of processes directly or indirectly involved in the establishment and maintenance of new vasculature (neovascularization), including, but not limited to, neovascularization associated with tumors and neovascularization associated with wounds.
[0118] As used herein, by homologous means about greater than 25% nucleic acid sequence identity, such as 25%, 40%, 60%, 70%, 80%, 90% or 95%. If necessary the percentage homology will be specified. The terms "homology" and "identity" are often used interchangeably but homology for proteins can include conservative amino acid changes. In general, sequences (protein or nucleic acid) are aligned so that the highest order match is obtained (see, e.g.: Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; Carillo et al. (1988) SIAM J Applied Math 48:1073). By sequence identity, the number of identical amino acids is determined by standard alignment algorithm programs, and used with default gap penalties established by each supplier. Substantially homologous nucleic acid molecules would hybridize typically at moderate stringency or at high stringency all along the length of the nucleic acid or along at least about 70%, 80% or 90% of the full length nucleic acid molecule of interest. Also provided are nucleic acid molecules that contain degenerate codons in place of codons in the hybridizing nucleic acid molecule. (For proteins, for determination of homology conservative amino acids can be aligned as well as identical amino acids; in this case percentage of identity and percentage homology vary). Whether any two nucleic acid molecules have nucleotide sequences that are at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% "identical" can be determined using known computer algorithms such as the "FASTA" program, using for example, the default parameters as in Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 85:2444 (other programs include the GCG program package (Devereux, J., et al., Nucleic Acids Research 12(I):387 (1984)), BLASTP, BLASTN, FASTA Altschul, S. F., et al., J Molec Biol 215:403 (1990); Guide to Huge Computers, Mrtin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo et al. (1988) SIAM J Applied Math 48:1073). For example, the BLAST function of the National Center for Biotechnology Information database can be used to determine identity. Other commercially or publicly available programs include, DNAStar "MegAlign" program (Madison, Wis.) and the University of Wisconsin Genetics Computer Group (UWG) "Gap" program (Madison Wis.)). Percent homology or identity of proteins and/or nucleic acid molecules can be determined, for example, by comparing sequence information using a GAP computer program (e.g., Needleman et al. (1970) J. Mol. Biol. 48:443, as revised by Smith and Waterman ((1981) Adv. Appl. Math. 2:482).
[0119] Briefly, a GAP program defines similarity as the number of aligned symbols (i.e., nucleotides or amino acids) that are similar, divided by the total number of symbols in the shorter of the two sequences. Default parameters for the GAP program can include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov et al. (1986) Nucl. Acids Res. 14:6745, as described by Schwartz and Dayhoff, eds., ATLAS OF PROTEIN SEQUENCE AND STRUCTURE, National Biomedical Research Foundation, pp. 353-358 (1979); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps. Therefore, as used herein, the term "identity" represents a comparison between a test and a reference polypeptide or polynucleotide.
[0120] As used herein, recitation that amino acids of a polypeptide correspond to amino acids in a disclosed sequence, such as amino acids set forth in the Sequence listing, refers to amino acids identified upon alignment of the polypeptide with the disclosed sequence to maximize identity or homology (where conserved amino acids are aligned) using a standard alignment algorithm, such as the GAP algorithm.
[0121] As used herein, the term "at least 90% identical to" refers to percent identities from 90 to 100% relative to the reference polypeptides. Identity at a level of 90% or more is indicative of the fact that, assuming for exemplification purposes a test and reference polynucleotide length of 100 amino acids are compared, no more than 10% (i.e., 10 out of 100) of amino acids in the test polypeptide differs from that of the reference polypeptides. Similar comparisons can be made between a test and reference polynucleotides. Such differences can be represented as point mutations randomly distributed over the entire length of an amino acid sequence or they can be clustered in one or more locations of varying length up to the maximum allowable, e.g., 10/100 amino acid difference (approximately 90% identity). Differences are defined as nucleic acid or amino acid substitutions, insertions or deletions. At the level of homologies or identities above about 85-90%, the result should be independent of the program and gap parameters set; such high levels of identity can be assessed readily, often without relying on software.
[0122] As used herein, primer refers to an oligonucleotide containing two or more deoxyribonucleotides or ribonucleotides, typically more than three, from which synthesis of a primer extension product can be initiated. Experimental conditions conducive to synthesis include the presence of nucleoside triphosphates and an agent for polymerization and extension, such as DNA polymerase, and a suitable buffer, temperature and pH.
[0123] As used herein, chemiluminescence refers to a chemical reaction in which energy is specifically channeled to a molecule causing it to become electronically excited and subsequently to release a photon thereby emitting visible light. Temperature does not contribute to this channeled energy. Thus, chemiluminescence involves the direct conversion of chemical energy to light energy.
[0124] As used herein, luminescence refers to the detectable EM radiation, generally, UV, IR or visible EM radiation that is produced when the excited product of an exergic chemical process reverts to its ground state with the emission of light. Chemiluminescence is luminescence that results from a chemical reaction. Bioluminescence is chemiluminescence that results from a chemical reaction using biological molecules (or synthetic versions or analogs thereof) as substrates and/or enzymes.
[0125] As used herein, bioluminescence, which is a type of chemiluminescence, refers to the emission of light by biological molecules, particularly proteins. The essential condition for bioluminescence is molecular oxygen, either bound or free in the presence of an oxygenase, a luciferase, which acts on a substrate, a luciferin. Bioluminescence is generated by an enzyme or other protein (luciferase) that is an oxygenase that acts on a substrate luciferin (a bioluminescence substrate) in the presence of molecular oxygen, and transforms the substrate to an excited state, which, upon return to a lower energy level releases the energy in the form of light.
[0126] As used herein, the substrates and enzymes for producing bioluminescence are generically referred to as luciferin and luciferase, respectively. When reference is made to a particular species thereof, for clarity, each generic term is used with the name of the organism from which it derives, for example, bacterial luciferin or firefly luciferase.
[0127] As used herein, luciferase refers to oxygenases that catalyze a light emitting reaction. For instance, bacterial luciferases catalyze the oxidation of flavin mononucleotide (FMN) and aliphatic aldehydes, which reaction produces light. Another class of luciferases, found among marine arthropods, catalyzes the oxidation of Cypridina (Vargula) luciferin, and another class of luciferases catalyzes the oxidation of Coleoptera luciferin.
[0128] Thus, luciferase refers to an enzyme or photoprotein that catalyzes a bioluminescent reaction (a reaction that produces bioluminescence). The luciferases, such as firefly and Gaussia and Renilla luciferases, are enzymes which act catalytically and are unchanged during the bioluminescence generating reaction. The luciferase photoproteins, such as the aequorin photoprotein to which luciferin is non-covalently bound, are changed, such as by release of the luciferin, during bioluminescence generating reaction. The luciferase is a protein that occurs naturally in an organism or a variant or mutant thereof, such as a variant produced by mutagenesis that has one or more properties, such as thermal stability, that differ from the naturally-occurring protein. Luciferases and modified mutant or variant forms thereof are well known. For purposes herein, reference to luciferase refers to either the photoproteins or luciferases.
[0129] Thus, reference, for example, to "Renilla luciferase" means an enzyme isolated from member of the genus Renilla or an equivalent molecule obtained from any other source, such as from another related copepod, or that has been prepared synthetically. It is intended to encompass Renilla luciferases with conservative amino acid substitutions that do not substantially alter activity. Suitable conservative substitutions of amino acids are known to those of skill in the art and can be made generally without altering the biological activity of the resulting molecule. Those of skill in the art recognize that, in general, single amino acid substitutions in non-essential regions of a polypeptide do not substantially alter biological activity (see, e.g., Watson et al. Molecular Biology of the Gene, 4th Edition, 1987, The Benjamin/Cummings Pub. co., p. 224).
[0130] As used herein, "Aequorea GFP" refers to GFPs from the genus Aequorea and to mutants or variants thereof. Such variants and GFPs from other species are well known and are available and known to those of skill in the art. This nomenclature encompass GFPs with conservative amino acid substitutions that do not substantially alter activity and physical properties, such as the emission spectra and ability to shift the spectral output of bioluminescence generating systems. The luciferases and luciferin and activators thereof are referred to as bioluminescence generating reagents or components. Typically, a subset of these reagents will be provided or combined with an article of manufacture. Bioluminescence will be produced upon contacting the combination with the remaining reagents. Thus, as used herein, the component luciferases, luciferins, and other factors, such as O.sub.2, Mg.sup.2+, Ca.sup.2+ also are referred to as bioluminescence generating reagents (or agents or components).
[0131] As used herein, bioluminescence substrate refers to the compound that is oxidized in the presence of a luciferase, and any necessary activators, and generates light. These substrates are referred to as luciferins herein, are substrates that undergo oxidation in a bioluminescence reaction. These bioluminescence substrates include any luciferin or analog thereof or any synthetic compound with which a luciferase interacts to generate light. Typical substrates include those that are oxidized in the presence of a luciferase or protein in a light-generating reaction. Bioluminescence substrates, thus, include those compounds that those of skill in the art recognize as luciferins. Luciferins, for example, include firefly luciferin, Cypridina (also known as Vargula) luciferin (coelenterazine), bacterial luciferin, as well as synthetic analogs of these substrates or other compounds that are oxidized in the presence of a luciferase in a reaction the produces bioluminescence.
[0132] As used herein, capable of conversion into a bioluminescence substrate means susceptible to chemical reaction, such as oxidation or reduction, that yields a bioluminescence substrate. For example, the luminescence producing reaction of bioluminescent bacteria involves the reduction of a flavin mononucleotide group (FMN) to reduced flavin mononucleotide (FMNH2) by a flavin reductase enzyme. The reduced flavin mononucleotide (substrate) then reacts with oxygen (an activator) and bacterial luciferase to form an intermediate peroxy flavin that undergoes further reaction, in the presence of a long-chain aldehyde, to generate light. With respect to this reaction, the reduced flavin and the long chain aldehyde are substrates.
[0133] As used herein, a bioluminescence generating system refers to the set of reagents required to conduct a bioluminescent reaction. Thus, the specific luciferase, luciferin and other substrates, solvents and other reagents that can be required to complete a bioluminescent reaction from a bioluminescence system. Thus a bioluminescence generating system refers to any set of reagents that, under appropriate reaction conditions, yield bioluminescence. Appropriate reaction conditions refers to the conditions necessary for a bioluminescence reaction to occur, such as pH, salt concentrations and temperature. In general, bioluminescence systems include a bioluminescence substrate, luciferin, a luciferase, which includes enzymes, luciferases and photoproteins, and one or more activators. A specific bioluminescence system may be identified by reference to the specific organism from which the luciferase derives; for example, the Renilla bioluminescence system includes a Renilla luciferase, such as a luciferase isolated from the Renilla or produced using recombinant means or modifications of these luciferases. This system also includes the particular activators necessary to complete the bioluminescence reaction, such as oxygen and a substrate with which the luciferase reacts in the presence of the oxygen to produce light.
[0134] As used herein, a fluorescent protein refers to a protein that possesses the ability to fluoresce (i.e., to absorb energy at one wavelength and emit it at another wavelength). For example, a green fluorescent protein refers to a polypeptide that has a peak in the emission spectrum at about 510 nm.
[0135] As used herein, genetic therapy or gene therapy involves the transfer of heterologous nucleic acid, such as DNA, into certain cells, target cells, of a mammal, particularly a human, with a disorder or conditions for which such therapy is sought. The nucleic acid, such as DNA, is introduced into the selected target cells, such as directly or in a vector or other delivery vehicle, in a manner such that the heterologous nucleic acid, such as DNA, is expressed and a therapeutic product encoded thereby is produced. Alternatively, the heterologous nucleic acid, such as DNA, can in some manner mediate expression of DNA that encodes the therapeutic product, or it can encode a product, such as a peptide or RNA that in some manner mediates, directly or indirectly, expression of a therapeutic product. Genetic therapy also can be used to deliver nucleic acid encoding a gene product that replaces a defective gene or supplements a gene product produced by the mammal or the cell in which it is introduced. The introduced nucleic acid can encode a therapeutic compound, such as a growth factor inhibitor thereof, or a tumor necrosis factor or inhibitor thereof, such as a receptor therefor, that is not normally produced in the mammalian host or that is not produced in therapeutically effective amounts or at a therapeutically useful time. The heterologous nucleic acid, such as DNA, encoding the therapeutic product can be modified prior to introduction into the cells of the afflicted host in order to enhance or otherwise alter the product or expression thereof. Genetic therapy also can involve delivery of an inhibitor or repressor or other modulator of gene expression.
[0136] As used herein, heterologous nucleic acid is nucleic acid that is not normally produced in vivo by the microorganism from which it is expressed or that is produced by a microorganism but is at a different locus or expressed differently or that mediates or encodes mediators that alter expression of endogenous nucleic acid, such as DNA, by affecting transcription, translation, or other regulatable biochemical processes. Heterologous nucleic acid is often not endogenous to the cell into which it is introduced, but has been obtained from another cell or prepared synthetically. Heterologous nucleic acid, however, can be endogenous, but is nucleic acid that is expressed from a different locus or altered in its expression or sequence. Generally, although not necessarily, such nucleic acid encodes RNA and proteins that are not normally produced by the cell or in the same way in the cell in which it is expressed. Heterologous nucleic acid, such as DNA, also can be referred to as foreign nucleic acid, such as DNA. Thus, heterologous nucleic acid or foreign nucleic acid includes a nucleic acid molecule not present in the exact orientation or position as the counterpart nucleic acid molecule, such as DNA, is found in a genome. It also can refer to a nucleic acid molecule from another organism or species (i.e., exogenous). Any nucleic acid, such as DNA, that one of skill in the art would recognize or consider as heterologous or foreign to the cell in which the nucleic acid is expressed is herein encompassed by heterologous nucleic acid; heterologous nucleic acid includes exogenously added nucleic acid that also is expressed endogenously. Examples of heterologous nucleic acid include, but are not limited to, nucleic acid that encodes traceable marker proteins, such as a protein that confers drug resistance, nucleic acid that encodes therapeutically effective substances, such as anti-cancer agents, enzymes and hormones, and nucleic acid, such as DNA, that encodes other types of proteins, such as antibodies. Antibodies that are encoded by heterologous nucleic acid can be secreted or expressed on the surface of the cell in which the heterologous nucleic acid has been introduced.
[0137] As used herein, a therapeutically effective product for gene therapy is a product that is encoded by heterologous nucleic acid, typically DNA, (or an RNA product such as dsRNA, RNAi, including siRNA, that, upon introduction of the nucleic acid into a host, a product is expressed that ameliorates or eliminates the symptoms, manifestations of an inherited or acquired disease or that cures the disease. Also included are biologically active nucleic acid molecules, such as RNAi and antisense.
[0138] As used herein, cancer or tumor treatment or agent refers to any therapeutic regimen and/or compound that, when used alone or in combination with other treatments or compounds, can alleviate, reduce, ameliorate, prevent, or place or maintain in a state of remission of clinical symptoms or diagnostic markers associated with deficient angiogenesis.
[0139] As used herein, nucleic acids include DNA, RNA and analogs thereof, including peptide nucleic acids (PNA) and mixtures thereof. Nucleic acids can be single or double-stranded. When referring to probes or primers, which are optionally labeled, such as with a detectable label, such as a fluorescent or radiolabel, single-stranded molecules are provided. Such molecules are typically of a length such that their target is statistically unique or of low copy number (typically less than 5, generally less than 3) for probing or priming a library. Generally a probe or primer contains at least 14, 16 or 30 contiguous nucleotides of sequence complementary to or identical to a gene of interest. Probes and primers can be 10, 20, 30, 50, 100 or more nucleic acids long.
[0140] As used herein, operative linkage of heterologous nucleic acids to regulatory and effector sequences of nucleotides, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences refers to the relationship between such nucleic acid, such as DNA, and such sequences of nucleotides. For example, operative linkage of heterologous DNA to a promoter refers to the physical relationship between the DNA and the promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA. Thus, operatively linked or operationally associated refers to the functional relationship of nucleic acid, such as DNA, with regulatory and effector sequences of nucleotides, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences. For example, operative linkage of DNA to a promoter refers to the physical and functional relationship between the DNA and the promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA. In order to optimize expression and/or in vitro transcription, it can be necessary to remove, add or alter 5' untranslated portions of the clones to eliminate extra, potentially inappropriate alternative translation initiation (i.e., start) codons or other sequences that can interfere with or reduce expression, either at the level of transcription or translation. Alternatively, consensus ribosome binding sites (see, e.g., Kozak J. Biol. Chem. 266:19867-19870 (1991)) can be inserted immediately 5' of the start codon and can enhance expression. The desirability of (or need for) such modification can be empirically determined.
[0141] As used herein, a sequence complementary to at least a portion of an RNA, with reference to antisense oligonucleotides, means a sequence of nucleotides having sufficient complementarity to be able to hybridize with the RNA, generally under moderate or high stringency conditions, forming a stable duplex; in the case of double-stranded antisense nucleic acids, a single strand of the duplex DNA (or dsRNA) can thus be tested, or triplex formation can be assayed. The ability to hybridize depends on the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with an encoding RNA it can contain and still form a stable duplex (or triplex, as the case can be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
[0142] As used herein, amelioration of the symptoms of a particular disorder such as by administration of a particular pharmaceutical composition, refers to any lessening, whether permanent or temporary, lasting or transient that can be attributed to or associated with administration of the composition.
[0143] As used herein, antisense polynucleotides refer to synthetic sequences of nucleotide bases complementary to mRNA or the sense strand of double-stranded DNA. A mixture of sense and antisense polynucleotides under appropriate conditions leads to the binding of the two molecules, or hybridization. When these polynucleotides bind to (hybridize with) mRNA, inhibition of protein synthesis (translation) occurs. When these polynucleotides bind to double-stranded DNA, inhibition of RNA synthesis (transcription) occurs. The resulting inhibition of translation and/or transcription leads to an inhibition of the synthesis of the protein encoded by the sense strand. Antisense nucleic acid molecules typically contain a sufficient number of nucleotides to specifically bind to a target nucleic acid, generally at least 5 contiguous nucleotides, often at least 14 or 16 or 30 contiguous nucleotides or modified nucleotides complementary to the coding portion of a nucleic acid molecule that encodes a gene of interest.
[0144] As used herein, antibody refers to an immunoglobulin, whether natural or partially or wholly synthetically produced, including any derivative thereof that retains the specific binding ability of the antibody. Hence antibody includes any protein having a binding domain that is homologous or substantially homologous to an immunoglobulin binding domain. Antibodies include members of any immunoglobulin class, including IgG, IgM, IgA, IgD and IgE.
[0145] As used herein, antibody fragment refers to any derivative of an antibody that is less then full length, retaining at least a portion of the full-length antibody's specific binding ability. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab)2, single-chain Fvs (scFV), FV, dsFV diabody and Fd fragments. The fragment can include multiple chains linked together, such as by disulfide bridges. An antibody fragment generally contains at least about 50 amino acids and typically at least 200 amino acids.
[0146] As used herein, a Fv antibody fragment is composed of one variable heavy chain domain (V.sub.H) and one variable light chain domain linked by noncovalent interactions.
[0147] As used herein, a dsFV refers to an Fv with an engineered intermolecular disulfide bond, which stabilizes the V.sub.H-V.sub.L pair.
[0148] As used herein, a F(ab)2 fragment is an antibody fragment that results from digestion of an immunoglobulin with pepsin at pH 4.0-4.5; it can be recombinantly produced to produce the equivalent fragment.
[0149] As used herein, Fab fragments are antibody fragments that result from digestion of an immunoglobulin with papain; it can be recombinantly produced to produce the equivalent fragment.
[0150] As used herein, scFVs refer to antibody fragments that contain a variable light chain (V.sub.L) and variable heavy chain (V.sub.H) covalently connected by a polypeptide linker in any order. The linker is of a length such that the two variable domains are bridged without substantial interference. Included linkers are (Gly-Ser)n residues with some Glu or Lys residues dispersed throughout to increase solubility.
[0151] As used herein, humanized antibodies refer to antibodies that are modified to include human sequences of amino acids so that administration to a human does not provoke an immune response. Methods for preparation of such antibodies are known. For example, to produce such antibodies, the encoding nucleic acid in the hybridoma or other prokaryotic or eukaryotic cell, such as an E. coli or a CHO cell, that expresses the monoclonal antibody is altered by recombinant nucleic acid techniques to express an antibody in which the amino acid composition of the non-variable region is based on human antibodies. Computer programs have been designed to identify such non-variable regions.
[0152] As used herein, diabodies are dimeric scFV; diabodies typically have shorter peptide linkers than scFvs, and they generally dimerize.
[0153] As used herein, production by recombinant means by using recombinant DNA methods means the use of the well known methods of molecular biology for expressing proteins encoded by cloned DNA.
[0154] As used herein the term assessing or determining is intended to include quantitative and qualitative determination in the sense of obtaining an absolute value for the activity of a product, and also of obtaining an index, ratio, percentage, visual or other value indicative of the level of the activity. Assessment can be direct or indirect.
[0155] As used herein, biological activity refers to the in vivo activities of a compound or microorganisms or physiological responses that result upon in vivo administration thereof or of composition or other mixture. Biological activity, thus, encompasses therapeutic effects and pharmaceutical activity of such compounds, compositions and mixtures. Biological activities can be observed in in vitro systems designed to test or use such activities.
[0156] As used herein, an effective amount of a microorganism or compound for treating a particular disease is an amount that is sufficient to ameliorate, or in some manner reduce the symptoms associated with the disease. Such an amount can be administered as a single dosage or can be administered according to a regimen, whereby it is effective. The amount can cure the disease but, typically, is administered in order to ameliorate the symptoms of the disease. Repeated administration can be required to achieve the desired amelioration of symptoms.
[0157] As used herein equivalent, when referring to two sequences of nucleic acids, means that the two sequences in question encode the same sequence of amino acids or equivalent proteins. When equivalent is used in referring to two proteins or peptides or other molecules, it means that the two proteins or peptides have substantially the same amino acid sequence with only amino acid substitutions (such as, but not limited to, conservative changes) or structure and the any changes do not substantially alter the activity or function of the protein or peptide. When equivalent refers to a property, the property does not need to be present to the same extent (e.g., two peptides can exhibit different rates of the same type of enzymatic activity), but the activities are usually substantially the same. Complementary, when referring to two nucleotide sequences, means that the two sequences of nucleotides are capable of hybridizing, typically with less than 25%, 15% or 5% mismatches between opposed nucleotides. If necessary, the percentage of complementarity will be specified. Typically the two molecules are selected such that they will hybridize under conditions of high stringency.
[0158] As used herein, an agent or compound that modulates the activity of a protein or expression of a gene or nucleic acid either decreases or increases or otherwise alters the activity of the protein or, in some manner, up- or down-regulates or otherwise alters expression of the nucleic acid in a cell.
[0159] As used herein, a method for treating or preventing neoplastic disease means that any of the symptoms, such as the tumor, metastasis thereof, the vascularization of the tumors or other parameters by which the disease is characterized are reduced, ameliorated, prevented, placed in a state of remission, or maintained in a state of remission. It also means that the hallmarks of neoplastic disease and metastasis can be eliminated, reduced or prevented by the treatment. Non-limiting examples of the hallmarks include uncontrolled degradation of the basement membrane and proximal extracellular matrix, migration, division, and organization of the endothelial cells into new functioning capillaries, and the persistence of such functioning capillaries.
[0160] As used herein, a prodrug is a compound that, upon in vivo administration, is metabolized or otherwise converted to the biologically, pharmaceutically or therapeutically active form of the compound. To produce a prodrug, the pharmaceutically active compound is modified such that the active compound is regenerated by metabolic processes. The prodrug can be designed to alter the metabolic stability or the transport characteristics of a drug, to mask side effects or toxicity, to improve the flavor of a drug or to alter other characteristics or properties of a drug. By virtue of knowledge of pharmacodynamic processes and drug metabolism in vivo, those of skill in the art, once a pharmaceutically active compound is known, can design prodrugs of the compound (see, e.g., Nogrady (1985) Medicinal Chemistry A Biochemical Approach, Oxford University Press, New York, pages 388-392).
[0161] As used herein, a promoter region or promoter element or regulatory region refers to a segment of DNA or RNA that controls transcription of the DNA or RNA to which it is operatively linked. The promoter region includes specific sequences that are sufficient for RNA polymerase recognition, binding and transcription initiation. This portion of the promoter region is referred to as the promoter. In addition, the promoter region includes sequences that modulate this recognition, binding and transcription initiation activity of RNA polymerase. These sequences can be cis acting or can be responsive to trans acting factors. Promoters, depending upon the nature of the regulation, can be constitutive or regulated. Exemplary promoters contemplated for use in prokaryotes include the bacteriophage T7 and T3 promoters.
[0162] As used herein, a receptor refers to a molecule that has an affinity for a ligand. Receptors can be naturally-occurring or synthetic molecules. Receptors also can be referred to in the art as anti-ligands. As used herein, the receptor and anti-ligand are interchangeable. Receptors can be used in their unaltered state or bound to other polypeptides, including as homodimers. Receptors can be attached to, covalently or noncovalently, or in physical contact with, a binding member, either directly or indirectly via a specific binding substance or linker. Examples of receptors, include, but are not limited to: antibodies, cell membrane receptors surface receptors and internalizing receptors, monoclonal antibodies and antisera reactive with specific antigenic determinants (such as on viruses, cells, or other materials), drugs, polynucleotides, nucleic acids, peptides, cofactors, lectins, sugars, polysaccharides, cells, cellular membranes, and organelles.
[0163] As used herein, sample refers to anything that can contain an analyte for which an analyte assay is desired. The sample can be a biological sample, such as a biological fluid or a biological tissue. Examples of biological fluids include urine, blood, plasma, serum, saliva, semen, stool, sputum, cerebral spinal fluid, tears, mucus, amniotic fluid or the like. Biological tissues are aggregates of cells, usually of a particular kind together with their intercellular substance that form one of the structural materials of a human, animal, plant, bacterial, fungal or viral structure, including connective, epithelium, muscle and nerve tissues. Examples of biological tissues also include organs, tumors, lymph nodes, arteries and individual cell(s).
[0164] As used herein: stringency of hybridization in determining percentage mismatch is as follows:
[0165] 1) high stringency: 0.1.times.SSPE, 0.1% SDS, 65.degree. C.
[0166] 2) medium stringency: 0.2.times.SSPE, 0.1% SDS, 50.degree. C.
[0167] 3) low stringency: 1.0.times.SSPE, 0.1% SDS, 50.degree. C.
[0168] Those of skill in the art know that the washing step selects for stable hybrids and also know the ingredients of SSPE (see, e.g., Sambrook, E. F. Fritsch, T. Maniatis, in: Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989), vol. 3, p. B.13, see, also, numerous catalogs that describe commonly used laboratory solutions). SSPE is pH 7.4 phosphate-buffered 0.18 M NaCl. Further, those of skill in the art recognize that the stability of hybrids is determined by Tm, which is a function of the sodium ion concentration and temperature: (Tm=81.5.degree. C.-16.6(log 10[Na.sup.+])+0.41(% G+C)-600/1)), so that the only parameters in the wash conditions critical to hybrid stability are sodium ion concentration in the SSPE (or SSC) and temperature. Any nucleic acid molecules provided herein can also include those that hybridize under conditions of at least low stringency, generally moderate or high stringency, along at least 70, 80, 90% of the full length of the disclosed molecule. It is understood that equivalent stringencies can be achieved using alternative buffers, salts and temperatures. By way of example and not limitation, procedures using conditions of low stringency are as follows (see also Shilo and Weinberg, Proc. Natl. Acad. Sci. USA 78:6789-6792 (1981)):
[0169] Filters containing DNA are pretreated for 6 hours at 40.degree. C. in a solution containing 35% formamide, 5.times.SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.1% PVP, 0.1% Ficoll, 1% BSA, and 500 .mu.g/ml denatured salmon sperm DNA (10.times.SSC is 1.5 M sodium chloride, and 0.15 M sodium citrate, adjusted to a pH of 7). Hybridizations are carried out in the same solution with the following modifications: 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 Tg/ml salmon sperm DNA, 10% (wt/vol) dextran sulfate, and 5-20.times.10.sup.6 cpm .sup.32P-labeled probe is used. Filters are incubated in hybridization mixture for 18-20 hours at 40.degree. C., and then washed for 1.5 hours at 55.degree. C. in a solution containing 2.times.SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS. The wash solution is replaced with fresh solution and incubated an additional 1.5 hours at 60.degree. C. Filters are blotted dry and exposed for autoradiography. If necessary, filters are washed for a third time at 65-68.degree. C. and reexposed to film. Other conditions of low stringency which can be used are well known in the art (e.g., as employed for cross-species hybridizations).
[0170] By way of example and not way of limitation, procedures using conditions of moderate stringency include, for example, but are not limited to, procedures using such conditions of moderate stringency are as follows: Filters containing DNA are pretreated for 6 hours at 55.degree. C. in a solution containing 6.times.SSC, 5.times. Denhart's solution, 0.5% SDS and 100 .mu.g/ml denatured salmon sperm DNA. Hybridizations are carried out in the same solution and 5-20.times.10.sup.6 cpm .sup.32P-labeled probe is used. Filters are incubated in hybridization mixture for 18-20 hours at 55.degree. C., and then washed twice for 30 minutes at 60.degree. C. in a solution containing 1.times.SSC and 0.1% SDS. Filters are blotted dry and exposed for autoradiography. Other conditions of moderate stringency which can be used are well-known in the art. Washing of filters is done at 37.degree. C. for 1 hour in a solution containing 2.times.SSC, 0.1% SDS. By way of example and not way of limitation, procedures using conditions of high stringency are as follows: Prehybridization of filters containing DNA is carried out for 8 hours to overnight at 65.degree. C. in buffer composed of 6.times.SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 Tg/ml denatured salmon sperm DNA. Filters are hybridized for 48 hours at 65.degree. C. in prehybridization mixture containing 100 .mu.g/ml denatured salmon sperm DNA and 5-20.times.10.sup.6 cpm of .sup.32P-labeled probe. Washing of filters is done at 37.degree. C. for 1 hour in a solution containing 2.times.SSC, 0.01% PVP, 0.01% Ficoll, and 0.01% BSA. This is followed by a wash in 0.1.times.SSC at 50.degree. C. for 45 minutes before autoradiography. Other conditions of high stringency which can be used are well known in the art.
[0171] The term substantially identical or homologous or similar varies with the context as understood by those skilled in the relevant art and generally means at least 60% or 70%, preferably means at least 80%, more preferably at least 90%, and most preferably at least 95%, 96%, 97%, 98%, 99% or greater identity.
[0172] As used herein, substantially identical to a product means sufficiently similar so that the property of interest is sufficiently unchanged so that the substantially identical product can be used in place of the product.
[0173] As used herein, substantially pure means sufficiently homogeneous to appear free of readily detectable impurities as determined by standard methods of analysis, such as thin layer chromatography (TLC), gel electrophoresis and high performance liquid chromatography (HPLC), used by those of skill in the art to assess such purity, or sufficiently pure such that further purification would not detectably alter the physical and chemical properties, such as enzymatic and biological activities, of the substance. Methods for purification of the compounds to produce substantially chemically pure compounds are known to those of skill in the art. A substantially chemically pure compound can, however, be a mixture of stereoisomers or isomers. In such instances, further purification might increase the specific activity of the compound.
[0174] As used herein, a molecule, such as an antibody, that specifically binds to a polypeptide typically has a binding affinity (Ka) of at least about 10.sup.6 l/mol, 10.sup.7 l/mol, 10.sup.8 l/mol, 10.sup.9 l/mol, 10.sup.10 l/mol or greater and binds to a protein of interest generally with at least 2-fold, 5-fold, generally 10-fold or even 100-fold or greater, affinity than to other proteins. For example, an antibody that specifically binds to the protease domain compared to the full-length molecule, such as the zymogen form, binds with at least about 2-fold, typically 5-fold or 10-fold higher affinity, to a polypeptide that contains only the protease domain than to the zymogen form of the full-length. Such specific binding also is referred to as selective binding. Thus, specific or selective binding refers to greater binding affinity (generally at least 2-fold, 5-fold, 10-fold or more) to a targeted site or locus compared to a non-targeted site or locus.
[0175] As used herein, the terms a therapeutic agent, therapeutic compound, therapeutic regimen, or chemotherapeutic include conventional drugs and drug therapies, including vaccines, which are known to those skilled in the art.
[0176] As used herein, treatment means any manner in which the symptoms of a condition, disorder or disease are ameliorated or otherwise beneficially altered. Treatment also encompasses any pharmaceutical use of the microorganisms described and provided herein.
[0177] As used herein, proliferative disorders include any disorders involving abnormal proliferation of cells. Such disorders include, but are not limited to, neoplastic diseases, psoriasis, restenosis, macular degeneration, diabetic retinopathies, inflammatory responses and disorders, including wound healing responses.
[0178] As used herein, vector (or plasmid) refers to discrete elements that are used to introduce heterologous nucleic acid into cells for either expression or replication thereof. The vectors typically remain episomal, but can be designed to effect integration of a gene or portion thereof into a chromosome of the genome. Also contemplated are vectors that are artificial chromosomes, such as yeast artificial chromosomes and mammalian artificial chromosomes. Selection and use of such vectors are well known to those of skill in the art. An expression vector includes vectors capable of expressing DNA that is operatively linked with regulatory sequences, such as promoter regions, that are capable of effecting expression of such DNA fragments. Thus, an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into an appropriate host cell, results in expression of the cloned DNA. Appropriate expression vectors are well known to those of skill in the art and include those that are replicable in eukaryotic cells and/or prokaryotic cells and those that remain episomal or those which integrate into the host cell genome.
[0179] As used herein, a combination refers to any association between two or among more items.
[0180] As used herein, a composition refers to any mixture. It can be a solution, a suspension, an emulsion, liquid, powder, a paste, aqueous, non-aqueous or any combination thereof.
[0181] As used herein, fluid refers to any composition that can flow. Fluids thus encompass compositions that are in the form of semi-solids, pastes, solutions, aqueous mixtures, gels, lotions, creams and other such compositions.
[0182] As used herein, a kit is a packaged combination optionally including instructions for use of the combination and/or other reactions and components for such use.
[0183] For clarity of disclosure, and not by way of limitation, the detailed description is divided into the subsections that follow.
B. Microorganisms for Tumor-Specific Therapy
[0184] Provided herein are microorganisms, and methods for making and using such microorganisms for therapy of neoplastic disease and other proliferative disorders and inflammatory disorders. The microbe (or microorganism)-mediated treatment methods provided herein involve administration of microorganisms to hosts, accumulation of the microorganism in the targeted cell or tissue, such as in a tumor, resulting in leaking or lysing of the cells, whereby an immune response against leaked or released antigens is mounted, thereby resulting in an inhibition of the tissues or cells in which the microorganism accumulates.
[0185] In addition to the gene therapeutic methods of cancer treatment, live attenuated microorganisms can be used for vaccination, such as in cancer vaccination or antitumor immunity. Immunization, for example, against a tumor can include a tumor-specific T-cell-mediated response through microbe-delivered antigens or cytokines. To do so, the microbes can be specifically targeted to the tumor tissues, with minimal infection to any other key organs and also can be modified or provided to produce the antigens and/or cytokines.
[0186] The microorganisms provided herein and the use of such microorganisms herein can accumulate in immunoprivileged cells or immunoprivileged tissues, including tumors and/or metastases, and also including wounded tissues and cells. While the microorganisms provided herein can typically be cleared from the subject to whom the microorganisms are administered by activity of the subject's immune system, microorganisms can nevertheless accumulate, survive and proliferate in immunoprivileged cells and tissues such as tumors because such immunoprivileged areas are sequestered from the host's immune system. Accordingly, the methods provided herein, as applied to tumors and/or metastases, and therapeutic methods relating thereto, can readily be applied to other immunoprivileged cells and tissues, including wounded cells and tissues.
[0187] 1. Characteristics
[0188] The microorganisms provided herein and used in the methods herein are attenuated, immunogenic, and replication competent.
[0189] a. Attenuated
[0190] The microbes used in the methods provided herein are typically attenuated. Attenuated microbes have a decreased capacity to cause disease in a host. The decreased capacity can result from any of a variety of different modifications to the ability of a microbe to be pathogenic. For example, a microbe can have reduced toxicity, reduced ability to accumulate in non-tumorous organs or tissue, reduced ability to cause cell lysis or cell death, or reduced ability to replicate compared to the non-attenuated form thereof. The attenuated microbes provided herein, however, retain at least some capacity to replicate and to cause immunoprivileged cells and tissues, such as tumor cells to leak or lyse, undergo cell death, or otherwise cause or enhance an immune response to immunoprivileged cells and tissues, such as tumor cells.
[0191] i. Reduced Toxicity
[0192] Microbes can be toxic to their hosts by manufacturing one or more compounds that worsen the health condition of the host. Toxicity to the host can be manifested in any of a variety of manners, including septic shock, neurological effects, or muscular effects. The microbes provided herein can have a reduced toxicity to the host. The reduced toxicity of a microbe of the present methods and compositions can range from a toxicity in which the host experiences no toxic effects, to a toxicity in which the host does not typically die from the toxic effects of the microbes. In some embodiments, the microbes are of a reduced toxicity such that a host typically has no significant long-term effect from the presence of the microbes in the host, beyond any effect on tumorous, metastatic or necrotic organs or tissues. For example, the reduced toxicity can be a minor fever or minor infection, which lasts for less than about a month, and following the fever or infection, the host experiences no adverse effects resultant from the fever or infection. In another example, the reduced toxicity can be measured as an unintentional decline in body weight of about 5% or less for the host after administration of the microbes. In other examples, the microbe has no toxicity to the host.
[0193] Exemplary vaccinia viruses of the LIVP strain (a widely available attenuated Lister strain) that have reduced toxicity compared to other vaccinia viruses employed and are further modified. Modified LIVP were prepared. These modified LIVP include insertions in the TK and/or HA genes and in the locus designed F3. As an example of reduced toxicity, recombinant vaccinia viruses were tested for their toxicity to mice with impaired immune systems (nude mice) relative to the corresponding wild type vaccinia virus. Intravenous (i.v.) injection of wild type vaccinia virus VGL (strain LIVP) at 1.times.10.sup.7 PFU/mouse causes toxicity in nude mice: three mice out of seven lost the weight and died (one mouse died in one week after virus injection, one mouse died ten days after virus injection. Similar modifications can be made to other pox viruses and other viruses to reduce toxicity thereof. Such modifications can be empirically identified, if necessary.
[0194] ii. Accumulate in Immunoprivileged Cells and Tissues, Such as Tumor, not Substantially in Other Organs
[0195] Microbes can accumulate in any of a variety of tissues and organs of the host. Accumulation can be evenly distributed over the entire host organism, or can be concentrated in one or a few organs or tissues, The microbes provided herein can accumulate in targeted tissues, such as immunoprivileged cells and tissues, such as tumors and also metastases. In some embodiments, the microbes provided herein exhibit accumulation in immunoprivileged cells and tissues, such as tumor cells relative to normal organs or tissues that is equal to or greater than the accumulation that occurs with wild type microbes. In other embodiments the microbes provided herein exhibit accumulation in immunoprivileged cells and tissues, such as tumor cells that is equal to or greater than the accumulation in any other particular organ or tissue. For example, the microbes provided herein can demonstrate an accumulation in immunoprivileged cells and tissues, such as tumor cells that is at least about 2-fold greater, at least about 5-fold greater, at least about 10-fold greater, at least about 100-fold greater, at least about 1,000-fold greater, at least about 10,000-fold greater, at least about 100,000-fold greater, or at least about 1,000,000-fold greater, than the accumulation in any other particular organ or tissue.
[0196] In some embodiments, a microbe can accumulate in targeted tissues and cells, such as immunoprivileged cells and tissues, such as tumor cells, without accumulating in one or more selected tissues or organs. For example, a microbe can accumulate in tumor cells without accumulating in the brain. In another example, a microbe can accumulate in tumor cells without accumulating in neural cells. In another example, a microbe can accumulate in tumor cells without accumulating in ovaries. In another example, a microbe can accumulate in tumor cells without accumulating in the blood. In another example, a microbe can accumulate in tumor cells without accumulating in the heart. In another example, a microbe can accumulate in tumor cells without accumulating in the bladder. In another example, a microbe can accumulate in tumor cells without accumulating in testes. In another example, a microbe can accumulate in tumor cells without accumulating in the spleen. In another example, a microbe can accumulate in tumor cells without accumulating in the lungs.
[0197] One skilled in the art can determine the desired capability for the microbes to selectively accumulate in targeted tissue or cells, such as in an immunoprivileged cells and tissues, such as tumor rather than non-target organs or tissues, according to a variety of factors known in the art, including, but not limited to, toxicity of the microbes, dosage, tumor to be treated, immunocompetence of host, and disease state of the host.
[0198] Provided herein as an example of selective accumulation in immunoprivileged cells and tissues, such as tumors relative to normal organs or tissues, presence of various vaccinia viruses was assayed in tumor samples and different organs. Wild type VGL virus (LIVP) was recovered from tumor, testes, bladder, and liver and as well as from brain. Recombinant virus RVGL9 was found mostly in tumors, and no virus was recovered from brain tissue in six tested animals. Therefore, this finding demonstrates the tumor accumulation properties of a recombinant vaccinia virus of the LIVP strain with an insertion in the F3 gene for tumor therapy purposes.
[0199] iii. Ability to Elicit or Enhance Immune Response to Tumor Cells
[0200] The microorganisms herein cause or enhance an immune response to antigens in the targeted tissues or cells, such as immunoprivileged cells and tissues, such as tumor cells. The immune response can be triggered by any of a variety of mechanisms, including the presence of immunostimulatory cytokines and the release of antigenic compounds that can cause an immune response.
[0201] Cells, in response to an infection such as a microorganismal infection, can send out signals to stimulate an immune response against the cells. Exemplary signals sent from such cells include antigens, cytokines and chemokines such as interferon-gamma and interleukin-15. The microorganism provided herein can cause targeted cells to send out such signals in response to infection by the microbes, resulting in a stimulation of the host's immune system against the targeted cells or tissues, such as tumor cells.
[0202] In another embodiment, targeted cells or tissues, such as tumor cells, can contain one or more compounds that can be recognized by the host's immune system in mounting an immune response against a tumor. Such antigenic compounds can be compounds on the cell surface or the tumor cell, and can be protein, carbohydrate, lipid, nucleic acid, or combinations thereof. Microbe-mediated release of antigenic compounds can result in triggering the host's immune system to mount an immune response against the tumor. The amount of antigenic compound released by the tumor cells is any amount sufficient to trigger an immune response in a subject; for example, the antigenic compounds released from one or more tumor cells can trigger a host immune response in the organism that is known to be accessible to leukocytes.
[0203] The time duration of antigen release is an amount of time sufficient for the host to establish an immune response to one or more tumor antigens. In some embodiments, the duration is an amount of time sufficient for the host to establish a sustained immune response to one or more tumor antigens. One skilled in the art can determine such a time duration based on a variety of factors affecting the time duration for a subject to develop an immune response, including the level of the tumor antigen in the subject, the number of different tumor antigens, the antigenicity of the antigen, the immunocompetence of the host, and the access of the antigenic material to the vasculature of the host. Typically, the duration of antigen release can be at least about a week, at least about 10 days, at least about two weeks, or at least about a month.
[0204] The microorganism provided herein can have any of a variety of properties that can cause target cells and tissues, such as tumor cells, to release antigenic compounds. Exemplary properties are the ability to lyse cells and the ability to elicit apoptosis in tumor cells. Microbes that are unable to lyse tumor cells or cause tumor cell death can nevertheless be used in the methods provided herein when such microbes can cause some release or display of antigenic compounds from tumor cells. A variety of mechanisms for antigen release or display without lysis or cell death are known in the art, and any such mechanism can be used by the microbes provided herein, including, but not limited to, secretion of antigenic compounds, enhanced cell membrane permeability, or altered cell surface expression or altered MHC presentation in tumor cells when the tumor cells can be accessed by the host's immune system. Regardless of the mechanism by which the host's immune system is activated, the net result of the presence of the microbes in the tumor is a stimulation of the host's immune system, at least in part, against the tumor cells. In one example, the microbes can cause an immune response against tumor cells not infected by the microbes.
[0205] In one embodiment, the microbes provided herein can cause tumor cells to release an antigen that is not present on the tumor cell surface. Tumor cells can produce compounds such as proteins that can cause an immune response; however, in circumstances in which the antigenic compound is not on the tumor cell surface, the tumor can proliferate, and even metastasize, without the antigenic compound causing an immune response. Within the scope of the present methods, the microbes provided herein can cause antigenic compounds within the cell to release away from the cell and away from the tumor, which can result in triggering an immune response to such an antigen. Even if not all cells of a tumor are releasing antigens, the immune response can initially be targeted toward the "leaky" tumor cells, and the bystander effect of the immune response can result in further tumor cell death around the "leaky" tumor cells.
[0206] iv. Balance of Pathogenicity and Release of Tumor Antigens
[0207] Typical methods of involving treatment of targeted cells and tissues, such as immunoprivileged cells and tissues, such as tumors, are designed to cause rapid and complete removal thereof. For example, many viruses, bacterial or eukaryotic cells can cause lysis and/or apoptosis in a variety of cells, including tumor cells. Microorganisms that can vigorously lyse or cause cell death can be highly pathogenic, and can even kill the host. Furthermore, therapeutic methods based upon such rapid and complete lysis are typically therapeutically ineffective.
[0208] In contrast, the microorganisms provided herein are not aggressive in causing cell death or lysis. They can have only a limited or no ability to cause cell death as long as they accumulate in the target cells or tissues and result in alteration of cell membranes to cause leakage of antigens against which an immune response is mounted. It is desirable that their apoptotic or lytic effect is sufficiently slow or ineffective to permit sufficient antigenic leakage for a sufficient time for the host to mount an effective immune response against the target tissues. Such immune response alone or in combination with the lytic/apoptotic effect of the microorganism results in elimination of the target tissue and also elimination of future development, such as metastases and reoccurrence, of such tissues or cells. While the microbes provided herein can have a limited ability to cause cell death, the microbes provided herein can nevertheless stimulate the host's immune system to attack tumor cells. As a result, such microorganisms also are typically unlikely to have substantial toxicity to the host.
[0209] In one embodiment, the microbes have a limited, or no, ability to cause tumor cell death, while still causing or enhancing an immune response against tumor cells. In one example, the rate of microorganism-mediated tumor cell death is less than the rate of tumor cell growth or replication. In another example, the rate of microorganism-mediated tumor cell death is slow enough for the host to establish a sustained immune response to one or more tumor antigens. Typically, the time for of cell death is sufficient to establish an anti-tumor immune response and can be at least about a week, at least about 10 days, at least about two weeks, or at least about a month, depending upon the host and the targeted cells or tissues.
[0210] In another embodiment, the microbes provided herein can cause cell death in tumor cells, without causing substantial cell death in non-tumor tissues. In such an embodiment, the microbes can aggressively kill tumor cells, as long as no substantial cell death occurs in non-tumor cells, and optionally, so long as the host has sufficient capability to mount an immune response against the tumor cells.
[0211] In one embodiment, the ability of the microbes to cause cell death is slower than the host's immune response against the microbes. The ability for the host to control infection by the microbes can be determined by the immune response (e.g., antibody titer) against microorganismal antigens. Typically, after the host has mounted immune response against the microbes, the microbes can have reduced pathogenicity in the host. Thus, when the ability of the microbes to cause cell death is slower than the host's immune response against the microbes, microbe-mediated cell death can occur without risk of serious disease or death to the host. In one example, the ability of the microbes to cause tumor cell death is slower than the host's immune response against the microbes.
[0212] b. Immunogenicity
[0213] The microorganisms provided herein also can be immunogenic. An immunogenic microorganism can create a host immune response against the microorganism. In one embodiment, the microorganisms can be sufficiently immunogenic to result in a large anti-(microorganism) antibody titer. The microorganisms provided herein can have the ability to elicit an immune response. The immune response can be activated in response to viral antigens or can be activated as a result of micro organismal-infection induced cytokine or chemokine production. Immune response against the microorganism can decrease the likelihood of pathogenicity toward the host organism.
[0214] Immune response against the microorganism also can result in target tissue or cell, such as tumor cell, killing. In one embodiment, the immune response against microorganismal infection can result in an immune response against tumor cells, including developing antibodies against tumor antigens. In one example, an immune response mounted against the microorganism can result in tumor cell killing by the "bystander effect," where uninfected tumor cells nearby infected tumor cells are killed at the same time as infected cells, or alternatively, where uninfected tumor cells nearby extracellular microorganisms are killed at the same time as the microorganisms. As a result of bystander effect tumor cell death, tumor cell antigens can be released from cells, and the host organism's immune system can mount an immune response against tumor cell antigens, resulting in an immune response against the tumor itself.
[0215] In one embodiment, the microorganism can be selected or modified to express one or more antigenic compounds, including superantigenic compounds. The antigenic compounds such as superantigens can be endogenous gene products or can be exogenous gene products. Superantigens, including toxoids, are known in the art and described elsewhere herein.
[0216] c. Replication Competent
[0217] The microorganisms provided herein can be replication competent. In a variety of viral or bacterial systems, the administered microorganism is rendered replication incompetent to limit pathogenicity risk to the host. While replication incompetence can protect the host from the microorganism, that also limits the ability of the microorganism to infect and kill tumor cells, and typically results in only a short-lived effect. In contrast, the microorganisms provided herein can be attenuated but replication competent, resulting in low toxicity to the host and accumulation mainly or solely in tumors. Thus, the microorganisms provided herein can be replication competent without creating a pathogenicity risk to the host.
[0218] Attenuation of the microorganisms provided herein can include, but is not limited to, reducing the replication competence of the microorganism. For example, a microorganism can be modified to decrease or eliminate an activity related to replication, such as a transcriptional activator that regulates replication in the microorganism. In an example, a microorganism, such as a virus, can have the viral thymidine kinase gene modified.
[0219] d. Genetic Variants
[0220] The microorganisms provided herein can be modified from their wild type form. Modifications can include any of a variety of changes, and typically include changes to the genome or nucleic acid molecules of the microorganisms. Exemplary nucleic acid molecular modifications include truncations, insertions, deletions and mutations. In an exemplary modification, a microorganismal gene can be modified by truncation, insertion, deletion or mutation. In an exemplary insertion, an exogenous gene can be inserted into the genome of the microorganism.
[0221] i. Modified Characteristics
[0222] Modifications of the microorganisms provided herein can result in a modification of microorganismal characteristics, including those provided herein such as pathogenicity, toxicity, ability to preferentially accumulate in tumor, ability to lyse cells or cause cell death, ability to elicit an immune response against tumor cells, immunogenicity, replication competence. Variants can be obtained by general methods such as mutagenesis and passage in cell or tissue culture and selection of desired properties, as is known in the art, as exemplified for respiratory syncytial virus in Murphy et al., Virus Res. 1994, 32:13-26.
[0223] Variants also can be obtained by mutagenic methods in which nucleic acid residues of the microorganism are added, removed or modified relative to the wild type. Any of a variety of known mutagenic methods can be used, including recombination-based methods, restriction endonuclease-based methods, and PCR-based methods. Mutagenic methods can be directed against particular nucleotide sequences such as genes, or can be random, where selection methods based on desired characteristics can be used to select mutated microorganisms. Any of a variety of microorganismal modifications can be made, according to the selected microorganism and the particular known modifications of the selected microorganism.
[0224] ii. Exogenous Gene Expression
[0225] The microorganisms provided herein also can have the ability to express one or more exogenous genes. Gene expression can include expression of a protein encoded by a gene and/or expression of an RNA molecule encoded by a gene. In some embodiments, the microorganisms can express exogenous genes at levels high enough that permit harvesting products of the exogenous genes from the tumor. Expression of endogenous genes can be controlled by a constitutive promoter, or by an inducible promoter. Expression can also be influenced by one or more proteins or RNA molecules expressed by the microorganism. An exemplary inducible promoter system can include a chimeric transcription factor containing a progesterone receptor fused to the yeast GAL4 DNA-binding domain and to the activation domain of the herpes simplex virus protein VP16, and a synthetic promoter containing a series of GAL4 recognition sequences upstream of the adenovirus major late E1B TATA box, linked to one or more exogenous genes; in this exemplary system, administration of RU486 to a subject can result in induction of the exogenous genes. Exogenous genes expressed can include genes encoding a therapeutic gene product, genes encoding a detectable gene product such as a gene product that can be used for imaging, genes encoding a gene product to be harvested, genes encoding an antigen of an antibody to be harvested. The microorganisms provided herein can be used for expressing genes in vivo and in vitro. Exemplary proteins include reporter proteins (E. coli .beta.-galactosidase, .beta.-glucuronidase, xanthineguanine phosphoribosyltransferase), proteins facilitating detection, i.e., a detectable protein or a protein capable of inducing a detectable signal, (e.g., luciferase, green and red fluorescent proteins, transferrin receptor), proteins useful for tumor therapy (Pseudomonas exotoxin, diphtheria toxin, p53, Arf, Bax, tumor necrosis factor-alpha, HSV TK, E. coli purine nucleoside phosphorylase, angiostatin, endostatin, different cytokines) and many other proteins.
[0226] iii. Detectable Gene Product
[0227] The microorganisms provided herein can express one or more genes whose products are detectable or whose products can provide a detectable signal. A variety of detectable gene products, such as detectable proteins are known in the art, and can be used with the microorganisms provided herein. Detectable proteins include receptors or other proteins that can specifically bind a detectable compound, proteins that can emit a detectable signal such as a fluorescence signal, enzymes that can catalyze a detectable reaction or catalyze formation of a detectable product.
[0228] In some embodiments, the microorganism expresses a gene encoding a protein that can emit a detectable signal or that can catalyze a detectable reaction. A variety of DNA sequences encoding proteins that can emit a detectable signal or that can catalyze a detectable reaction, such as luminescent or fluorescent proteins, are known and can be used in the microorganisms and methods provided herein. Exemplary genes encoding light-emitting proteins include genes from bacterial luciferase from Vibrio harveyi (Belas et al., Science 218 (1982), 791-793), bacterial luciferase from Vibrio fischeri (Foran and Brown, Nucleic acids Res. 16 (1988), 177), firefly luciferase (de Wet et al., Mol. Cell. Biol. 7(1987), 725-737), aequorin from Aequorea victoria (Prasher et al., Biochem. 26 (1987), 1326-1332), Renilla luciferase from Renilla reniformis (Lorenz et al., PNAS USA 88 (1991), 4438-4442) and green fluorescent protein from Aequorea victoria (Prasher et al., Gene 111 (1987), 229-233). Transformation and expression of these genes in microorganisms can permit detection of microorganismal colonies, for example, using a low light imaging camera. Fusion of the lux A and lux B genes can result in a fully functional luciferase protein (Escher et al., PNAS 86 (1989), 6528-6532). This fusion gene (Fab2) has introduced into a variety of microorganisms followed by microorganismal infection and imaging based on luciferase expression. In some embodiments, luciferases expressed in bacteria can require exogenously added substrates such as decanal or coelenterazine for light emission. In other embodiments, microorganisms can express a complete lux operon, which can include proteins that can provide luciferase substrates such as decanal. For example, bacteria containing the complete lux operon sequence, when injected intraperitoneally, intramuscularly, or intravenously, allowed the visualization and localization of bacteria in live mice indicating that the luciferase light emission can penetrate the tissues and can be detected externally (Contag et al., Mol. Microbiol. 18 (1995), 593-603).
[0229] In other embodiments, the microorganism can express a gene that can bind a detectable compound or that can form a product that can bind a detectable compound. A variety of gene products, such as proteins, that can specifically bind a detectable compound are known in the art, including receptors, metal binding proteins, ligand binding proteins, and antibodies. Any of a variety of detectable compounds can be used, and can be imaged by any of a variety of known imaging methods. Exemplary compounds include receptor ligands and antigens for antibodies. The ligand can be labeled according to the imaging method to be used. Exemplary imaging methods include any of a variety magnetic resonance methods such as magnetic resonance imaging (MRI) and magnetic resonance spectroscopy (MRS), and also include any of a variety of tomographic methods including computed tomography (CT), computed axial tomography (CAT), electron beam computed tomography (EBCT), high resolution computed tomography (HRCT), hypocycloidal tomography, positron emission tomography (PET), single-photon emission computed tomography (SPECT), spiral computed tomography and ultrasonic tomography.
[0230] Labels appropriate for magnetic resonance imaging are known in the art, and include, for example, gadolinium chelates and iron oxides. Use of chelates in contrast agents is known in the art. Labels appropriate for tomographic imaging methods are known in the art, and include, for example, .beta.-emitters such as .sup.11C, .sup.13N, .sup.15O or .sup.64Cu or (b) .gamma.-emitters such as .sup.123I. Other exemplary radionuclides that can be used, for example, as tracers for PET include .sup.55Co, .sup.67Ga, .sup.68Ga, .sup.60Cu(II), .sup.67Cu(II), .sup.57Ni, .sup.52Fe and .sup.18F. Examples of useful radionuclide-labeled agents are .sup.64Cu-labeled engineered antibody fragment (Wu et al., PNAS USA 97 (2002), 8495-8500), .sup.64Cu-labeled somatostatin (Lewis et al., J. Med. Chem. 42(1999), 1341-1347), .sup.64Cu-pyruvaldehyde-bis (N4methylthiosemicarbazone)-(.sup.64Cu-PTSM) (Adonai et al., PNAS USA 99 (2002), 3030-3035), .sup.52Fe-citrate (Leenders et al., J. Neural. Transm. Suppl. 43 (1994), 123-132), .sup.52Fe/.sup.52mMn-citrate (Calonder et al., J. Neurochem. 73 (1999), 2047-2055) and .sup.52Fe-labeled iron (III) hydroxide-sucrose complex (Beshara et al., Br. J. Haematol. 104 (1999), 288-295, 296-302).
[0231] iv. Therapeutic Gene Product
[0232] The microorganisms provided herein can express one or more genes whose products cause cell death or whose products cause an anti-tumor immune response, such genes can be considered therapeutic genes. A variety of therapeutic gene products, such as toxic or apoptotic proteins, or siRNA, are known in the art, and can be used with the microorganisms provided herein. The therapeutic genes can act by directly killing the host cell, for example, as a channel-forming or other lytic protein, or by triggering apoptosis, or by inhibiting essential cellular processes, or by triggering an immune response against the cell, or by interacting with a compound that has a similar effect, for example, by converting a less active compound to a cytotoxic compound.
[0233] In some embodiments, the microorganism can express a therapeutic protein. A large number of therapeutic proteins that can be expressed for tumor treatment are known in the art, including, but not limited to tumor suppressors, toxins, cytostatic proteins, and cytokines. An exemplary, non-limiting list of such proteins includes WT1, p53, p16, Rb, BRCA1, cystic fibrosis transmembrane regulator (CFTR), Factor VIII, low density lipoprotein receptor, beta-galactosidase, alpha-galactosidase, beta-glucocerebrosidase, insulin, parathyroid hormone, alpha-1-antitrypsin, rsCD40L, Fas-ligand, TRAIL, TNF, antibodies, microcin E492, diphtheria toxin, Pseudomonas exotoxin, Escherichia coli Shig toxin, Escherichia coli Verotoxin 1, and hyperforin.
[0234] In other embodiments, the microorganism can express a protein that converts a less active compound into a compound that causes tumor cell death. Exemplary methods of conversion of such a prodrug compound include enzymatic conversion and photolytic conversion. A large variety of protein/compound pairs are known in the art, and include, but are not limited to Herpes simplex virus thymidine kinase/gancyclovir, varicella zoster thymidine kinase/gancyclovir, cytosine deaminase/5-fluorouracil, purine nucleoside phosphorylase/6-methylpurine deoxyriboside, beta lactamase/cephalosporin-doxorubicin, carboxypeptidase G2/4-[(2-chloroethyl)(2-mesuloxyethyl)amino]benzoyl-L-glutamic acid, cytochrome P450/acetominophen, horseradish peroxidase/indole-3-acetic acid, nitroreductase/CB1954, rabbit carboxylesterase/7-ethyl-10-[4-(1-piperidino)-1-piperidino]carbonyloxycam- ptothecin, mushroom tyrosinase/bis-(2-chloroethyl)amino-4-hydroxyphenylaminomethanone 28, beta galactosidase/1-chloromethyl-5-hydroxy-1,2-dihyro-3H-benz[e]indole, beta glucuronidase/epirubicin glucuronide, thymidine phosphorylase/5'-deoxy5-fluorouridine, deoxycytidine kinase/cytosine arabinoside, and linamerase/linamarin.
[0235] In another embodiment, the therapeutic gene product can be an siRNA molecule. The siRNA molecule can be directed against expression of a tumor-promoting gene, such as, but not limited to, an oncogene, growth factor, angiogenesis promoting gene, or a receptor. The siRNA molecule also can be directed against expression of any gene essential for cell growth, cell replication or cell survival. The siRNA molecule also can be directed against expression of any gene that stabilizes the cell membrane or otherwise limits the number of tumor cell antigens released from the tumor cell. Design of an siRNA can be readily determined according to the selected target of the siRNA; methods of siRNA design and downregulation of genes are known in the art, as exemplified in U.S. Pat. Pub. No. 20030198627.
[0236] In one embodiment, the therapeutic compound can be controlled by a regulatory sequence. Suitable regulatory sequences which, for example, are functional in a mammalian host cell are well known in the art. In one example, the regulatory sequence can contain a natural or synthetic vaccinia virus promoter. In another embodiment, the regulatory sequence contains a poxvirus promoter. When viral microorganisms are used, strong late promoters can be used to achieve high levels of expression of the foreign genes. Early and intermediate-stage promoters, however, can also be used. In one embodiment, the promoters contain early and late promoter elements, for example, the vaccinia virus early/late promoter p7.5, vaccinia late promoter p11, a synthetic early/late vaccinia pE/L promoter (Patel et al., (1988), Proc. Natl. Acad. Sci. USA 85, 9431-9435; Davison and Moss, (1989), J Mol Biol 210, 749-769; Davison et al., (1990), Nucleic Acids Res. 18, 4285-4286; Chakrabarti et al., (1997), BioTechniques 23, 1094-1097).
[0237] v. Expressing a Superantigen
[0238] The microorganisms provided herein can be modified to express one or more superantigens. Superantigens are antigens that can activate a large immune response, often brought about by a large response of T cells. A variety of superantigens are known in the art including, but not limited to, diphtheria toxin, staphylococcal enterotoxins (SEA, SEB, SEC1, SEC2, SED, SEE and SEH), Toxic Shock Syndrome Toxin 1, Exfoliating Toxins (EXft), Streptococcal Pyrogenic Exotoxin A, B and C (SPE A, B and C), Mouse Mammary Tumor Virus proteins (MMTV), Streptococcal M proteins, Clostridial Perfringens Enterotoxin (CPET), mycoplasma arthritis superantigens.
[0239] Since many superantigens also are toxins, if expression of a microorganism of reduced toxicity is desired, the superantigen can be modified to retain at least some of its superantigenicity while reducing its toxicity, resulting in a compound such as a toxoid. A variety of recombinant superantigens and toxoids of superantigens are known in the art, and can readily be expressed in the microorganisms provided herein. Exemplary toxoids include toxoids of diphtheria toxin, as exemplified in U.S. Pat. No. 6,455,673 and toxoids of Staphylococcal enterotoxins, as exemplified in U.S. Pat. Pub. No. 20030009015.
[0240] vi. Expressing a Gene Product to be Harvested
[0241] Exemplary genes expressible by a microorganism for the purpose of harvesting include human genes. An exemplary list of genes includes the list of human genes and genetic disorders authored and edited by Dr. Victor A. McKusick and his colleagues at Johns Hopkins University and elsewhere, and developed for the World Wide Web by NCBI, the National Center for Biotechnology Information. Online Mendelian Inheritance in Man, OMIM.TM.. Center for Medical Genetics, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md.), 1999. and those available in public databases, such as PubMed and GenBank (see, e.g., (ncbi.nlm.nih.gov/entrez/query.fcgi?db=OMIM) These genes include, but are not limited to: 23912h9, 3pk, 4ebp1, 4ebp2, al1, al2m1, al2m2, al2m3, al2m4, al5, alb, albg, alst, a2m, a2mr, a2mrap, aa, aaa, aaa, aabt, aac1, aac2, aact, aadac, aanat, aars, aas, aat, aavs1, abc1, abc2, abc3, abc7, abc8, abcr, abi1, abl1, abl2, abl1, abo, abp, abp1, abpa, abpx, abr, acaa, acac, acaca, acacb, acad1, acadm, acads, acadsb, acadv1, acat, acat1, acat2, acc, accb, accn1, accn2, accpn, ace1, ach, ache, achm1, achm2, achrb, achrd, achrg, acls, acly, aco1, aco2, acox, acox1, acox2, acox3, acp1, acp2, acp5, acpp, acr, acrv1, acs3, acs3, acs4, act2, act35, acta1, acta2, acta3, actb, actc, actg1, actg2, act11, actn1, actn2, actn3, actsa, acug, acvr1, acvr2b, acvrl1, acvrlk1, acvrlk2, acvrlk3, acy1, ad1, ad2, ad3, ad4, ad5, ada, adam10, adam11, adam12, adam3, adam3a, adam3b, adam8, adar, adarb1, adarb2, adcp1, adcp2, adcy1, adcy2, adcy3, adcy3, adcy4, adcy5, adcy6, adcy7, adcy8, adcy9, adcyap1, adcyaplr1, add1, add2, add3, add1, adfn, adh1, adh2, adh3, adh4, adh5, adh7, adhaps, adhc1, adhr, adhr, adk, adlk, adm, admlx, adora1, adora2a, adora2b, adora21, adora21, adora3, adprt, adra1a, adra1b, adra1c, adra1d, adra2a, adra2b, adra2c, adra211, adra212, adra2r, adrb1, adrb1r, adrb2, adrb2r11, adrb3, adrbk1, adrbk2, ads1, adss, adtb1, adx, adxr, ae1, ae2, ae3, aeg11, aemk, aes, af10, af17, af4, af6, af8t, af9, afd1, afdn, afg3, afg311, afm, afp, afx1, aga, agc1, ager, ag1, agmx1, agmx2, agp1, agp7, agps, agrn, agrp, agrt, ags, agt, agti1, agtr1, agtr1a, agtr2, agtrl1, agxt, ahc, ahcy, and, ands, ahnak, aho2, ahr, ahsg, ahx, aib1, aic, aic1, aied, aih1, aih2, aih3, aim1, air, airc, aire, ak1, ak2, ak3, akap149, akt1, akt2, aku, alad, alas1, alas2, alb, alb2, alba, alcam, ald, aldh1, aldh10, aldh2, aldh3, aldh4, aldh5, aldh6, aldh9, ald11, aldoa, aldob, aldoc, aldr1, alds, alk, alk1, alk2, alk3, alk6, alms1, alox12, alox15, alox5, alp, alpi, alp1, alpp, alpp12, alr, alr, als1, als2, als4, als5, alss, ambn, ambp, amcd1, amcd2b, amcn, amcn1, amcx1, amd1, amdm, amelx, amely, amfr, amg, amg1, amgx, amh, amhr, amhr2, aml1, aml1t1, aml2, aml3, amog, ampd1, ampd2, ampd3, amph, amph1, ampk, amt, amy1a, amy1b, amy1c, amy2a, amy2b, an2, anc, ancr, ang, ang1, anh1, ank1, ank2, ank3, anop1, anova, anp, anpep, anpra, anprb, anprc, ans, ant1, ant2, ant3, ant3y, anx1, anx11, anx13, anx2, anx214, anx3, anx4, anx5, anx6, anx7, anx8, aoah, aoc2, aox1, ap2tf, apah1, apba1, apba2, apbb1, apbb2, apc, apcs, ape, apeced, apeh, apex, api1, api2, api3, apj, aplp, aplp1, aplp2, apnh, apo31, apoa1, apoa2, apoa4, apob, apobec1, apoc1, apoc2, apoc3, apoc4, apod, apoe, apoer2, apoh, apolmt, apolp1, apolp2, app, appbp1, appl1, aprf, aprt, aps, apt1, aptl1g1, apx1, apy, aqdq, aqp0, aqp1, aqp2, aqp21, aqp3, aqp4, aqp5, aqp6, agp7, ar, ar1, ara, araf1, araf2, arcn1, ard1, ard1, areg, arf1, arf2, arf3, arf41, arf5, arg, arg1, args, arh12, arh6, arh9, arha, arhb, arhc, arhg, arhgap2, arhgap3, arhgap6, arhgdia, arhgdib, arhh, arix, ar12, armd1, arnt, arnt1, aro, arp, arp1, arpkd, arr3, arrb1, arrb2, arsa, arsacs, arsb, arsc1, arsc2, arsd, arse, arsf, art, art1, art3, art4, arts, arvd1, arvd2, arvd3, arvd4, as, asat, asb, ascl1, ascl2, asct1, asd1, asd2, asgr1, asgr2, ash1, asip, as1, asln, asm1, asma, asmd, asmt, asmtlx, asmty, asnrs, asns, aspa, ass, astm1, astn, asv, at, at1, at2r1, at3, ata, atbf1, atcay, atf1, ath1, aths, atm, atoh1, atox1, atpla1, atpla2, atpla3, atpla11, atplb1, atplb2, atplb3, atplb11, atplg1, atp2a1, atp2a2, atp2a3, atp2b, atp2b1, atp2b2, atp2b2, atp2b3, atp2b4, atp4a, atp4b, atp5, atp5a, atp5b, atp5g1, atp5g2, atp5g3, atp5o, atp6a, atp6b1, atp6c, atp6e, atp6n1, atp7a, atp7b, atpm, atpsb, atpsk1, atpsk2, atq1, atr, atr, atr1, atr1, atr2, atrc1, atrc2, atrx, ats, atsv, atx1, atx2, au, auf1, auf1a, aut, avcd, aved, avp, avpr1a, avpr1b, avpr2, avpr3, avrp, aysd, awa1, ax1, axl1g, axsf, azf1, azf2, azgp1, azu1, b120, b144, blg1, b29, b2m, b2mr, b3galt4, b4galt1, ba2r, bab1, bag1, bai1, bai2, bai3, bak1, bam22, bap1, bap135, bapx1, bard1, bark2, bas, bat1, bat2, bat3, bat4, bat5, bax, bb1, bbbg1, bbbg2, bbs1, bbs2, bbs3, bbs4, bbs5, bcas1, bcat1, bcat2, bcate2, bcd1, bcei, bche, bckdha, bckdhb, bcl1, bcl10, bcl2, bcl2a1, bcl212, bcl3, bcl5, bcl6, bcl7, bcl7a, bcl8, bcl9, bclw, bcm, bcm1, bcma, bcns, bcns, bcp, bcpm, bcpr, bcr, bcrl2, bcrl3, bcrl4, bcsg1, bct1, bct2, bdb, bdb1, bdc, bde, bdkrb1, bdkrb2, bdmf, bdmr, bdnf, bed, bedp, bek, bene, bevi, bf, bf1, bf2, bfhd, bfic, bfls, bfnc2, bfp, bfsp1, bft, bglap, bgmr, bgn, bgp, bhd, bhpcdh, bhr1, bicd1, bid, bigh3, bin1, bir, bjs, bkma1, blast1, blau, blk, blm, blmh, bltr, blvra, blvrb, blym, bmal1, bmd, bmh, bmi1, bmp1, bmp2, bmp2a, bmp2b1, bmp3, bmp4, bmp5, bmp6, bmp7, bmp8, bmpr1a, bmpr1b, bmx, bmyb, bn51t, bnc, bnc1, bnp, bor, bpad, bpag1, bpag2, bpes, bpes1, bpes2, bpgm, bph1, bpi, br, br140, braf, brca1, brca2, brca3, brcacox, brcd1, brcd2, brdt, brf1, brhc, bric, brks, brn3a, brn3b, brn3c, brrn1, brw1c, bs, bsap, bsep, bsf2, bsg, bsnd, bss1, bst1, bst2, btak, btc, btd, bteb, bteb1, btg1, btg2, bths, btk, btk1, btn, bts, bub1b, bubr1, bwr1a, bwr1b, bws, bwscr1a, bwscr1b, bzrp, bzx, c11orf13, c1nh, c1qa, c1qb, c1qbp, c1qg, c1r, c1s, c2, c21orf1, c21orf2, c21orf3, c2ta, c3, c3br, c3dr, c3g, c4a, c4b, c4bpa, c4bpb, c4f, c4s, c5, c5ar, c5r1, c6, c7, c8a, c8b, c8g, c9, ca1, ca12, ca125, ca2, ca21h, ca3, ca4, ca5, ca6, ca7, ca8, ca9, caaf1, cabp9k, cac, cac, caca, cacd, cacna1a, cacna1b, cacna1c, cacna1d, cacna1e, cacna1f, cacna1s, cacna2, cacnb1, cacnb2, cacnb3, cacnb4, cacng, cacnl1a1, cacnl1a2, cacnl1a3, cacnl1a4, cacnl1a5, cacnl1a6, cacnl2a, cacnlb1, cacnlg, carp, cast, racy, cad, cad11, cadasi1, cae1, cae3, caf, caf1a, caga, cagb, cain, cak, cak1, cal11, calb1, calb2, calb3, calc1, calc2, calca, calcb, calcr, cald1, calla, calm1, calm2, calm3, calm11, calm13, calna, calna3, calnb, calnb1, calr, cals, calt, calu, cam, camk4, camkg, caml1, camlg, camp, can, canp3, canx, cap2, cap3, cap37, capb, capg, cap1, capn1, capn2, capn3, capn4, cappa2, cappb, capr, caps, capza2, capzb, car, carp, cars, cart1, cas, cas2, casi1, casp1, casp10, casp2, casp3, casp3, casp4, casp5, casp6, casp7, casp8, casq1, casq2, casr cast, cat, cat1, cat4, catf1, catm, cav1, cav2, cav3, cbbm, cbd, cbfa1, cbfa2, cbfa2t1, cbfa3, cbfb, cbg, cb1, cb12, cbln2, cbp, cbp, cbp2, cbp68, cbr1, cbs, cbt, cbt1, cc10, cca, cca1, cca11, cca12, ccb11, ccckr5, ccg1, ccg2, cchl1a1, cchl1a2, cchl1a3, cchlb1, cck, cckar, cckbr, cc1, ccm1, ccm2, ccm3, ccn1, ccna, ccnb1, ccnc, ccnd1, ccnd2, ccnd3, ccne, ccnf, ccng1, ccnh, ccnt, ccnt1, cco, ccr10, ccr2, ccr3, ccr9, ccsp, cct, ccv, cczs, cd, cd10, cd11a, cd11b, cd11c, cd13, cd137, cd14, cd15, cd151, cd156, cd16, cd164, cd18, cd19, cd1a, cd1b, cd1c, cd1d, cd1e, cd2, cd20, cd22, cd23, cd24, cd26, cd27, cd271, cd28, cd281g, cd281g2, cd30, cd32, cd33, cd34, cd36, cd3611, cd3612, cd37, cd38, cd39, cd3911, cd3d, cd3e, cd3g, cd3z, cd4, cd40, cd401g, cd41b, cd43, cd44, cd45, cd46, cd47, cd48, cd49b, cd49d, cd5, cd53, cd57, cd58, cd59, cd51, cd6, cd63, cd64, cd68, cd69, cd7, cd70, cd71, cd72, cd74, cd79a, cd79b, cd80, cd81, cd82, cd82, cd86, cd8a, cd8b, cd8b1, cd9, cd94, cd95, cd97, cd99, cda, cda1, cda3, cdan1, cdan2, cdan3, cdb2, cdc2, cdc20, cdc25a, cdc25b, cdc25c, cdc27, cdc211, cdc212, cdc214, cdc34, cdc42, cdc51, cdc7, cdc711, cdcd1, cdcd2, cdcd3, cdc11, cdcre1, cdg1, cdgd1, cdgg1, cdgs2, cdh1, cdh11, cdh12, cdh13, cdh14, cdh15, cdh16, cdh16, cdh17, cd2, cdh3, cdh3, cdh5, cdh7, cdh8, cdhb, cdhh, cdhp, cdhs, cdk2, cdk3, cdk4, cdk5, cdk7, cdk8, cdk9, cdkn1, cdkn1a, cdkn1b, cdkn1c, cdkn2a, cdkn2b, cdkn2d, cdkn3, cdkn4, cdl1, cdm, cdmp1, cdmt, cdpx1, cdpx2, cdpxr, cdr1, cdr2, cdr3, cdr62a, cdsn, cdsp, cdtb, cdw50, cdx1, cdx2, cdx3, cdx4, cea, cebp, cebpa, cebpb, cebpd, cebpe, cecr, ce1, cel1, cen1, cenpa, cenpb, cenpc, cenpc1, cenpe, cenpf, cerd4, ces, ces1, cetn1, cetp, cf, cf2r, cfag, cfag, cfc, cfd1, cfeom1, cfeom2, cfh, cfl1, cfl2, cfnd, cfns, cftr, cg1, cga, cgat, cgb, cgd, cgf1, cgh, cgrp, cgs23, cgt, cgthba, chac, chat, chc1, chd1, chd2, chd3, chd4, chd5, chdr, che1, che2, ched, chek1, chga, chgb, chgc, chh, chi311, chip28, chit, chk1, chlr1, chlr2, chm, chm1, chn, chn1, chn2, chop10, chr, chr39a, chr39b, chr39c, chrm1, chrm2, chrm3, chrm4, chrm5, chrna1, chrna2, chrna3, chrna4, chrna5, chrna7, chrnb1, chrnb2, chrnb3, chrnb4, chrnd, chrne, chrng, chrs, chs1, chx10, ciipx, cip1, cirbp, cish, ck2a1, ckap1, ckb, ckbb, ckbe, ckm, ckmm, ckmt1, ckmt2, ckn1, ckn2, ckr3, ckrl1, ckr13, c1, cl100, cla1, cla1, clac, clapb1, clapm1, claps3, clc, clc7, clck2, clcn1, clcn2, clcn3, clcn4, clcn5, clcn6, clcn7, clcnka, clcnkb, cld, cldn3, cldn5, clg, clg1, clg3, clg4a, clg4b, cli, clim1, clim2, clk2, cllc3, cln1, cln2, cln3, cln5, cln6, cln80, clns1a, clns1b, clp, clpp, clps, clta, cltb, cltc, cltcl1, cltd, clth, clu, cma1, cmah, cmar, cmd1, cmd1a, cmd1b, cmd1c, cmd1d, cmd1e, cmd1f, cmd3a, cmdj, cmh1, cmh2, cmh3, cmh4, cmh6, cmkbr1, cmkbr2, cmkbr3, cmkbr5, cmkbr6, cmkbr7, cmkbr8, cmkbr9, cmkbr12, cmklr1, cmkr11, cmkr12, cm1, cmm, cmm2, cmoat, cmp, cmpd1, cmpd2, cmpd2, cmpd3, cmpx1, cmt1a, cmt1b, cmt2a, cmt2b, cmt2d, cmt2d, cmt4a, cmt4b, cmtnd, cmtx1, cmtx2, cna1, cna2, cnbp1, cnc, cncg1, cncg2, cncg31, cnd, cng3, cnga1, cnga3, cngb1, cnn1, cnn2, cnn3, cnp, cnr1, cnsn, cntf, cntfr, cntn1, co, coca1, coca2, coch, cod1, cod2, coh1, coil, col10a1, col11a1, col11a2, col12a11, col13a1, col15a1, col16a1, col17a1, col18a1, col19a1, col1a1, col1a2, col1ar, col2a1, col3a1, col4a1, col4a2, col4a3, col4a4, col4a5, col4a6, col5a1, col5a2, col6a1, col6a2, col6a3, col7a1, col8a1, col8a2, col9a1, col9a1, col9a2, col9a3, colq, comp, comt, copeb, copt1, copt2, cord1, cord2, cord5, cord6, cort, cot, cox10, cox4, cox5b, cox6a1, cox6b, cox7a1, cox7a2, cox7a3, cox7am, cox8, cp, cp107, cp115, cp20, cp47, cp49, cpa1, cpa3, cpb2, cpb2, cpd, cpe, cpetr2, cpm, cpn, cpn1, cpn2, cpo, cpp, cpp32, cpp32, cppi, cps1, cpsb, cpsd, cpt1a, cpt1b, cpt2, cpu, cpx, cpx, cpxd, cr1, cr2, cr3a, crabp1, crabp2, crapb, crarf, crat, crbp1, crbp2, crd, crd1, creb1, creb2, crebbp, creb11, crem, crfb4, crfr2, crh, crhbp, crhr, crhr1, crhr2, crip, crk, crk1, crm1, crmp1, crmp2, crp, crp1, crs, crs1c, crs2, crs3, crsa, crt, crt11, crtm, crx, cry1, cry2, crya1, crya2, cryaa, cryab, cryb1, cryb2, cryb3, cryba1, cryba2, cryba4, crybb1, crybb2, crybb3, cryg1, cryg2, cryg3, cryg4, cryg8, cryg, cryga, crygb, crygc, crygd, crygs, crym, cryz, cs, csa, csb, csbp1, csci, csd, csd2, csda, cse, cse11, csf1, csf1r, csf2, csf2ra, csf2rb, csf2ry, csf3, csf3r, csh1, csh2, csk, csmf, csn1, csn10, csn2, csn3, csnb1, csnb2, csnb3, csnk1a1, csnk1d, csnk1e, csnk1g2, csnk2a1, csnk2a2, csnk2b, csnu3, cso, cspb, cspg1, cspg2, cspg3, csr, csrb, csrp, csrp1, csrp2, cst1, cst1, cst2, cst3, cst4, cst4, cst5, cst6, csta, cstb, csx, ct2, ctaa1, ctaa2, ctag, ctb, ctbp1, ctbp2, ctgf, cth, cthm, ctk, ctla1, ctla3, ctla4, ctla8, ctm, ctnna1, ctnna2, ctnnb1, ctnnd, ctnnd1, ctnr, ctns, ctp, ctpct, ctps, ctr1, ctr2, ctrb1, ctr1, ctsa, ctsb, ctsc, ctsd, ctse, ctsg, ctsg12, ctsh, ctsk, cts1, ctss, ctsw, ctsz, ctx, cubn, cul3, cul4b, cul5, cutl1, cvap, cvd1, cv1, cx26, cx31, cx32, cx37, cx40, cx43, cx46, cx50, cxb3s, cxcr4, cxorf4, cyb5, cyb561, cyba, cybb, cyc1, cyk4, cyld1, cymp, cyp1, cyp11a, cyp11b1, cyp11b2, cyp17, cyp19, cyp1a1, cyp1a2, cyp1b1, cyp21, cyp24, cyp27, cyp27a1, cyp27b1, cyp2a, cyp2a3, cyp2a6, cyp2b, cyp2c, cyp2c19, cyp2c9, cyp2d, cyp2d, cyp2e, cyp2e1, cyp2f1, cyp2j2, cyp3a4, cyp4a11, cyp4b1, cyp51, cyp7, cyp1a1, cyr61, cyrn1, cyrn2, czp3, d10s105e, d10s170, d10s170, d11s302e, d11s636, d11s813e, d11s833e, d12s2489e, d12s53e, d13s1056e, d13s25, d14s46e, d15s12, d15s226e, d15s227e, d16s2531e, d16s469e, d17s136e, d17s811e, d18s892e, d19s204, d19s381e, d1s111, d1s155e, d1s166e, d1s1733e, d1s2223e, d1s61, d2h, d2s201e, d2s448, d2s488e, d2s69e, d3s1231e, d3s1319e, d3s48e, d4, d4s90, d5s1708, d5s346, d6, d6s1101, d6s207e, d6s2245e, d6s228e, d6s229e, d6s230e, d6s231e, d6s51e, d6s52e, d6s54e, d6s81e, d6s82e, d7s437, d8s2298e, d9s46e, da1, da2b, dab2, dac, dad1, daf, dag, dag1, dag2, dagk1, dagk4, dam00, dam6, damox, dan, dao, dap, dap3, dap5, dapk1, dar, dat1, dax1, daxx, daz, dazh, daz1, dba, dbccr1, dbcn, dbh, dbi, dbi, db1, dbm, dbn1, dbp, dbp, dbp1, dbp2, dbpa, dbt, dbx, dby, dcc, dce, dci, dck, dcn, dcoh, dcp1, dcr, dcr3, dct, dctn1, dcx, ddb1, ddb2, ddc, ddh1, ddh2, ddit1, ddit3, ddost, ddp, ddpac, ddr, ddx1, ddx10, ddx11, ddx12, ddx15, ddx16, ddx2a, ddx3, ddx5, ddx6, ddx9, dec, decr, def1, def4, defy, def6, defa1, defa4, defa5, defa6, defb1, defb2, dek, denn, dents, dep1, der12, des, dff1, dffa, dffrx, dffry, dfn1, dfn2, dfn3, dfn4, dfn6, dfna1, dfna10, dfna11, dfna12, dfna13, dfna2, dfna2, dfna4, dfna5, dfna6, dfna7, dfna8, dfna9, dfnb1, dfnb12, dfnb13, dfnb14, dfnb16, dfnb17, dfnb18, dfnb2, dfnb3, dfnb4, dfnb5, dfnb6, dfnb7, dfnb8, dfnb9, dgcr, dgcr2, dgcr2, dgcr6, dgi1, dgka, dgkq, dgpt, dgpt, dgs, dgs2, dgsi, dgu, dhc2, dhcr7, dhfr, dhlag, dhp, dhpr, dhps, dhrd, dhtr, di, di1, dia, dia1, dia2, dia4, diaph1, diaph2, dif2, diff6, dipi, dir, dkc, dkc1, dlc1, dld, dlg1, dlg2, dlg3, dlg4, dlst, dlx1, dlx2, dlx2, d13, dlx4, dlx5, dlx6, dlx7, dlx8, dm, dm2, dmahp, dmbt1, dmd, dmda1, dmd1, dmh, dmk, dmp1, dmpk, dmsfh, dmt, dmt1, dmtn, dna21, dnah, dnah1, dnah11, dnah12, dnah2, dnahc1, dnahc11, dnahc2, dnahc3, dnase1, dnase111, dnase113, dnase2, dnch2, dnc1, dncm, dnec1, dne11, dn1, dn11, dn111, dnm1, dnmt1, dnmt2, dnpk1, dns, dntt, do, doc1, doc2, dock1, dock180, dod, dok1, dom, dp1, dp1, dp2, dp3, dpagt2, dpc4, dpd, dpde1, dpde2, dpde3, dpde4, dpep1, dph212, dpp, dpp4, dpp6, dpt, dpyd, dpys, dpys11, dpys12, dr1, dr3, dr31g, dr5, dra, drad, drada, dra1, drd1, drd1b, drd1b, drd112, drd2, drd3, drd4, drd5, dril1, drp1, drp1, drp2, drp2, drp3, drp1a, drt, dsc1, dsc2, dsc3, dsc3, dsc4, dscam, dscr, dsg1, dsg2, dsg3, dsp, dspg3, dspp, dss, dss1, dtd, dtdp2, dtdst, dtna, dtr, dts, dus, dusp1, dusp11, dusp2, dusp3, dusp4, dusp5, dusp6, dusp7, dusp8, dut, dv1, dv11, dv11, dv13, dxf68s1e, dxs1272e, dxs128, dxs1283e, dxs423e, dxs435e, dxs522e, dxs648, dxs707, dxs8237e, dxys155e, dylx2, dyrk, dys, dysf, dyt1, dyt3, dyt5, dyt6, dyt7, dyt8, dyt9, dyx1, dyx2, e11s, e14, e1b, e2a, e2f1, e212, e2f3, e2f4, e3, e4f, e4f1, e4tf1a, e4tf1b, ea1, eaac1, eaat1, eaat2, eac, ead, eag, eap, ear1, ear2, ear3, ebaf, ebf, ebi1, ebm, ebn1, ebn1, ebn2, ebr2a, ebs1, ebvm1, ebvs1, ec1, eca1, ecb2, ece1, ecgf1, ech1, echs1, eck, ecm1, ecp, ecs1, ect2, ed1, ed2, ed3, ed4, eda, eda3, eddr1, edg3, edg6, edh, edh17b2, edh17b2, edh17b3, edm1, edm2, edm3, edmd, edmd2, edn, edn1, edn2, edn3, ednra, ednrb, eec1, eec2, eef1a1, eef1a2, eef1b1, eef1b2, eef1b3, eef1b4, eef2, eeg1, eegv1, eek, een, ef1a, eft, efe2, efemp1, efl6, efmr, efna1, efna3, efna4, efnb1, efnb2, efnb3, efp, eftu, egf, egfr, egi, egr1, egr2, egr3, egr4, ehhadh, ehoc1, ei, eif1a, eif2g A, eif2s3 A, eif3s10, eif3s6, eif4a1, eif4a2, eif4c, eif4e, eif4ebp1, eif4e2, eif4e11, eif4e12, eif4g, eif4g1, eif4g2, eif5a, ejm1, el1, ela1, ela2, elam1, elanh2, elav11, elav12, elav14, elc, ele1, elf3, elk1, elk2, elk3, elk4, el1, eln, em9, emap, emap1, emd, emd2, emk 1, emp1, emp55, emr1, ems1, emt, emtb, emx1, emx2, en1, en2, ena78, end, endog, enfl2, eng, en1, eno1, eno2, eno3, enpep, ent1, entk, enur1, enur2, enx2, eos, ep3, ep300, epa, epb3, epb311, epb41, epb4112, epb42, epb49, epb72, epha1, epha2, epha3, epha8, ephb1, ephb2, ephb3, ephb4, ephb6, epht1, epht2, epht3, ephx1, ephx2, epim, eplg1, eplg2, eplg3, eplg4, eplg5, eplg8, epm1, epm2, epm2a, epmr, epo, epor, eppk, eprs, eps15, eps8, ept, erba1, erba2, erba12, erba13, erbb2, erbb3, erbb4, erc55, ercc1, ercc2, ercc3, ercc4, ercc5, ercc6, ercm1, erda1, erf1, erg, erg3, ergic53, erh, erk, erk1, erk2, erk3, erm, erp11, erv1, erv1, erv3, ervr, ervt1ervt2, ervt3, ervt4, ervt5, eryf1, es1, es130, esa, esa1, esa4, esat, esb3, esd, esg, esr, esr1, esr2, esr11, esr12, esrra, esrrb, esrrg, ess1, est, est, est2, est25263, esx, etfa, etfb, etfdh, etk1, etk2, etm1, etm2, eto, ets1, ets2, etv1, etv3, etv4, etv5, etv6, evc, evc1, evda, evdb, evi1, evi2, evi2a, evi2b, evp1, evr1, evx1, evx2, ews, ewsr1, exlm1, ext1, ext2, ext3, ext11, ext12, eya1, eya2, eya3, eyc11, eyc13, ezh1, ezh1, ezh2, f10, f11, f12, f13a, f13a1, f13b, f2, f2r, f2r12, f2r13, f3, f5, f5f8d, f7, f7e, f7r, f8a, f8b, f8c, f8vwf, f9, fa, fa1, faa, fabp1, fabp2fabp3, fabp4, fabp6, fac1, faca, facc, facd, face, fac11, fac12, fac13, fac14, facv11, fad, fadd, fadk, fah, fak2, faldh, fal139, falz, fanca, fancc, fancd, fance, fancg, fap, fapa, farr, fas, fas1, fasn, fast1, fat, fau, fbln1, fbln2, fbn1, fbn2, fbn1, fbp1, fcar, fcc1, fce, fce2, fcer1a, fcer1b, fcer1g, fcer2, fcgr1a, fcgr1b, fcgr1c, fcgr2a, fcgr3a, fcgrt, fcmd, fcn1, fcn2, fcp, fcp1, fcpx, fct3a, fdc, fdft1, fdh, fdps11, fdps12, fdps13, fdps14, fdps15, fdx1, fdxr, fe65, fe6511, fea, feb1, feb2, fecb, fech, fen1, feo, feom, feom1, feom2, fer, fes, fet1, fevr, ffm, fga, fgarat, fgb, fgc, fgd1, fgdy, fgf1, fgf10, fgf11, fgf12, fgf13, fgf14, fgf2, fgf2, fgf3, fgf4, fgf5, fgf6, fgf7, fgf8, faf9, fgfa, fgfb, fgfr1, fgfr2, fgfr3,
fgfr4, fgg, fgr, fgs1, fh, fh, fh3, fhc, fnf1, fhf3, fhf4, fhh2, fhit, fh11, fh12, fhr2, fic1, figf, fih, fim, fim1, fim3, fimg, fkbpl2, fkbp1a, fkbp2, fkh2, fkh11, fkh110, fkh112, fkh115, fkh116, fkh117, fkh12, fkh15, fkh16, fkh17, fkh18, fkh19, fkhr, fkhr11, flg, fli1, flii, fln1, fln2, flna, flnb, flnms, flot2, flt1, flt2, flt3, flt4, fmf, fmn, fmo1, fmo2, fmo3, fmod, fmr1, fmr2, fms, fl1, fn12, fnra, fnrb, fnrb1, fnta, fntb, folh, folh1, folr1, folr2, folt, fos, fosb, fos11, fos12, fpah, fpc, fpd1, fpdmm, fpf, fpgs, fp1, fpp, fpr1, fprh1, fprh2, fpr11, fpr12, fprp, fps12, fps13, fps14, fps15, fr, frap1, fraxa, fraxe, fraxf, frda, freac2, freac6, freac9, frg1, frp1, frv1, frv2, frv3, fsg1, fsgs, fshb, fshd1a, fshmd1a, fshprh1, fshr, fssv, fth1, fth16, ft1, ftz1, ftzf1, fuca1, fuca2, fur, fus, fuse, fut1, fut2, fut3, fut4, fut5, fut6, fut7, fut8, fvt1, fxr1, fxy, fy, fyn, fzd1, fzd2, fzd3, fzd5, fzd6, fzd7, fzr, g0s8, g10p1, g10p2, g17, g17p1, g19p1, g1p1, g1p2, g1p3, g22p1, g6pc, g6pd, g6pd1, g6pd1, g6pt, g6pt1, g6s, g7p1, ga2, gaa, gabatr, gabpa, gabpb1, gabra1, gabra2, gabra3, gabra4, gabra5, gabra6, gabrb1, gabrb2, gabrb3, gabrd, gabre, gabrg1, gabrg2, gabrg3, gabrr1, gabrr2, gad1, gad2, gad3, gadd153, gadd45, gak, ga1, galbp, galc, gale, galgt, galk1, galk2, galn, galnact, galnr, galnr1, galns, galnt1, galnt2, galnt3, galr1, galt, gan, gan1, ganab, ganc, gap, gap1m, gap43, gapd, gar22, garp, gars, gart, gas, gas1, gas2, gas41, gas6, gas7, gasr, gast, gata1, gata2, gata3, gata4, gata6, gay1, gba, gbas, gbbb1, gbbb2, gbe1, gbp1, gbx2, gc, gcap, gcap2, gcdh, gcf1, gcf2, gcfx, gcg, gcgr, gch1, gck, gckr, gcn511, gcn512, gcnf, gcnt1, gcnt2, gcp, gcp2, gcs, gcs1, gcsf, gcsfr, gcsp, gctg, gcy, gda, gde, gdf5, gdf8, gdh, gdi1, gdi2, gdid4, gdld, gdnf, gdnfr, gdnfra, gdnfrb, gdx, gdxy, ge, gem, geney, gey, gf1, gf1, gfap, gfer, gfer, gfi1, gfpt, gfra1, gfra2, ggcx, ggt1, ggt2, ggta1, ggtb1, ggtb2, gh1, gh2, ghc..RTM., ghdx, ghn, ghr, ghrf, ghrh, ghrhr, ghs, ghv, gif, gift, gip, gip, gipr, girk1, girk2, girk3, girk4, gja1, gja3, gja4, gja5, gja8, gjb1, gjb2, gjb3, gk, gk2, gla, glat, glb1, glb2, glc1a, glc1b, glc1c, glc1d, glc1f, glc3a, glc3b, glc1c, glc1r, glct2, glct3, gldc, glepp1, glg1, gli, gli2, gli3, gli4, glnn, gins, glo1, glo2, glp1r, glra1, glra2, glra3, glrb, glrx, gls, glud1, glud2, glu1, glur1, glur2, glur3, glur4, glur5, glur6, glur7, glut1, glut2, glut3, glut4, glut5, glvr1, glvr2, gly96, glya, glyb, glys1, glyt1, glyt1, glyt2, gm2a, gma, gmcsf, gmds, gm1, gmpr, gmps, gna11, gna15, gna16, gnai1, gnai2, gnai2a, gnai2b, gnai21, gnai3, gna1, gnao1, gnaq, gnas, gnas1, gnat1, gnat2, gnaz, gnb1, gnb2, gnb3, gng5, gn11, gnpta, gnrh1, gnrh2, gnrhr, gns, gnt1, golga4, got1, got2, gp130, gp1ba, gp1bb, gp2, gp2b, gp39, gp3a, gp75, gp78, gp9, gpa, gpam, gpat, gpb, gpc, gpc1, gpc3, gpc4, gpd, gpd1, gpd2, gpds1, gpe, gpi, gpi2, gpm6a, gpm6b, gpoa, gpr1, gpr10, gpr11, gpr12, gpr13, gpr15, gpr17, gpr18, gpr19, gpr2, gpr20, gpr21, gpr22, gpr23, gpr25, gpr29, gpr3, gpr30, gpr31, gpr32, gpr35, gpr37, gpr39, gpr4, gpr5, gpr6, gpr7, gpr8, gpr9, gprcy4, gprk21, gprk4, gprk5, gprk6, gprv28, gpsa, gpsc, gpt, gpx1, gpx2, gpx3, gpx4, gr2, grb1, grb10, grb2, grf2, gria1, gria2, gria3, gria4, grid2, grik1, grik2, grik3, grik4, grik5, grin1, grin2a, grin2b, grin2c, grin2d, grina, grk1, grk5, grk6, gr1, gr111, grm3, grm8, grmp, grn, gro1, gro2, gro3, grp, grp58, grp78, grpr, grx, gs, gs1, gsas, gsc, gsc1, gse, gshs, gs1, gsm1, gsn, gsp, gspt1, gsr, gss, gst12, gst11, gst2, gst2, gst3, gst4, gst5, gsta1, gsta2, gstm1, gstm11, gstm2, gstm3, gstm4, gstm5, gstp1, gstt2, gt1, gt335, gta, gtb, gtbp, gtd, gtf2e2, gtf2f1, gtf2h1, gtf2h2, gtf2h4, gtf2i, gtf2s, gtf3a, gtg, guc1a2, guc1a3, guc1b3, guc2c, guc2d, guc2f, guca1a, guca1b, guca2, guca2, guca2a, guca2b, gucsa3, gucsb3, gucy1a2, gucy1a3, gucy1b3, gucy2c, gucy2d, gucy2f, guk1, guk2, gulo, gulop, gusb, gusm, gust, gxp1, gypa, gypb, gypc, gype, gys, gys1, gys2, gzma, gzmb, gzmh, gzmm, h, h142t, h19, h1f0, h1f1, h1f2, h1f3, h1f4, h1f5, h1fv, h2a, h2ax, h2az, h2b, h2b, h3f2, h3f3b, h3 ft, h3t, h4, h4f2, h4f5, h4fa, h4fb, h4fe, h4fg, h4fh, h4fi, h4fj, h4fk, h4fl, h4fm, h4m, h6, ha2, habp1, hadha, hadhb, hadhsc, haf, hagh, hah1, haip1, ha1, hap, hap1, hap2, hars, has2, hat1, hausp, hb1, hb1, hb6, hba1, hba2, hbac, hbb, hbbc, hbd, hbe1, hbegf, hbf2, hbg1, hbg2, hbgr, hbhr, hbm, hbp, hbq1, hbz, hc2, hc3, hca, hcat2, hccs, hcdh, hcf2, hcfc1, hcg, hck, h11, hc12, hc13, hcls1, hcp, hcp1, hcs, hcvs, hd, hdac1, hdc, hdgf, hdhc7, hdlbp, hdld, hdldt1, hdr, hed, hed, hegfl, hek, hek3, heln1, hem1, hema, hemb, hemc, hempas, hen1, hen2, hep, hep10, her2, her4, herg, herv1, hes1, hesx1, het, hexa, hexb, hf1, hf10, hfc1, hfe, hfe2, hfh11, hfsp, hgd, hgf, hgf, hgf1, hg1, hh, hh72, hhc1, hhc2, hhd, hhh, hhmjg, hhr23a, hht1, hht2, hiap2, higm1, hilda, hint, hiomt, hip, hip1, hip116, hip2, hir, hira, his1, his2, hive1, hivep1, hivep2, hjcd, hk1, hk2, hk3, hk33, hke4, hke6, hkr1, hkr2, hkr3, hkr4, hl 11, h119, hla-a, hla-b, hla-c, hla-cda12, hla-dma, hla-dmb, hla-dna, hla-dob, hla-dpalhla-dpb1, hla-dqa1, hla-drlb, hla-dra, hla-e, hla-f, hla-g, hla-ha2, hladp, hlaf, hlals, hlcs, h1m2, hlp, hlp3, hlr1, h1r2, hlt, hlx1, hlxb9, hmaa, hmab, hmat1, hmbs, hmcs, hmg1, hmg14, hmg17, hmg2, hmgc1, hmgcr, hmgcs1, hmgcs2, hmgic, hmgiy, hmgx, hmmr, hmn2, hmox1, hmox2, hmr, hms1, hmsn1, hmx1, hmx2, hnd, hnf1a, hnf2, hnf3a, hnf3b, hnf4a, hnp36, hnpcc6, hnrpa1, hnrpa2b1, hnrpd, hnrpf, hnrpg, hnrph1, hnrph2, hnrph3, hnrpk, homg, hops, hox10, hox11, hox12, hox1, hox1a, hox1b, hox1c, hox1d, hox1e, hox1f, hox1g, hox1h, hox1i, hox1j, hox2, hox2a, hox2b, hox2c, hox2d, hox2e, hox2f, hox2g, hox2h, hox2i, hox3, hox3a, hox3b, hox3c, hox3d, hox3e, hox3f, hox3g, hox4, hox4a, hox4b, hox4c, hox4d, hox4e, hox4f, hox4g, hox4h, hox4i, hox7, hox8, hoxa1, hoxa10, hoxa11, hoxa13, hoxa3, hoxa4, hoxa5, hoxa6, hoxa7, hoxa9, hoxa, hoxb1, hoxb2, hoxb3, hoxb4, hoxb5, hoxb6, hoxb7, hoxb8, hoxb9, hoxb, hoxc12, hoxc13, hoxc4, hoxc5, hoxc6, hoxc8, hoxc9, hoxc, hoxd1, hoxd10, hoxd11, hoxd12, hoxd13, hoxd3, hoxd4, hoxd8, hoxd9, hoxd, hoxhb9, hp, hp4, hpafp, hpc1, hpc2, hpca, hpca11, hpcx, hpd, hpdr1, hpdr2, hpe1, hpe2, hpe3, hpe4, hpe5, hpect1, hpfh, hpfh2, hpgd, hplh1, hplh2, hpn, hpr, hprt, hprt1, hps, hpt, hpt1, hptp, hptx, hpv18i1, hpv18i2, hpx, hr, bras, hrb, hrc, hrc1, hrca1, hrd, hres1, hrf, hrg, hrga, hrh1, hrh2, hrmt111, hrpt2, hrx, hrx, hry, hsa11, hsa12, hsan1, hsas1, hscr2, hsd11, hsd11b1, hsd11b2, hsd11k, hsd111, hsd17b1, hsd17b2, hsd17b3, hsd17b4, hsd3b1, hsd3b2, hsh, hsn1, hsorc1, hsp27, hsp73, hspa1a, hspa1b, hspa11, hspa2, hspa3, hspa4, hspa5, hspa6, hspa7, hspa8, hspa9, hspb1, hspb2, hspc2, hspca11, hspca12, hspca13, hspca14, hspcb, hspg1, hspg2, hsr1, hsst, hstd, hstf1, htc2, htf4, htk, htk1, ht1, htlf, htlvr, htn1, htn2, htn3, htnb, htor, htr1a, htr1b, htr1d, htr1e, htr1e1, htr1f, htr2a, htr2b, htr2c, htr3, htr4, htr5a, htr6, htr7, htrx1, hts1, htt, htx, htx1, hub, hud, hup2, hur, hus, hvls, hvbs1, hvbs6, hvbs7, hvem, hvh2, hvh3, hvh8, hxb, hxb1, hy, hya, hya11, hyd2, hygn1, hy1, hyp, hyplip1, hypp, hypx, hyr, hyrc1, hys, ia1, ia2, iap, iapp, iar, iars, ibd1, ibd2, ibm2, ibsp, ica1, icam1, icam2, icam3, icca, ich1, icr2, icr2b, ics1, id1, id2, id3, id4, ida, idd, iddm1, iddm10, iddm11, iddm12, iddm13, iddm15, iddm17, iddm2, iddm3, iddm4, iddm5, iddm6, iddm7, iddm8, iddmx, ide, idg2, idh1, idh2, idh3a, idh3g, ido, ids, idua, ier1, ier3, iex1, if, ifcr, ifgr2, ifi16, ifi27, ifi35, ifi4, ifi5111, ifi54, ifi56, ifi616, ifi78, ifna1, ifna10, ifna13, ifna14, ifna16, ifna17, ifna21, ifna6, ifna7, ifna8, ifna, ifnai1, ifnar1, ifnar2, ifnb1, ifnb2, ifnb3, ifng, ifngr1, ifngr2, ifngt1, ifnr, ifnw1, ifrd2, iga, igat, igb, igbp1, igd1, igda1, igdc1, igds2, iger, iges, igf1, igf1r, igf2, igf2r, igfbp1, igfbp10, igfbp2, igfbp3, igfbp4, igfbp6, igfbp7, igfr1, igfr2, igfr3, igh, igha1, igha2, ighd, ighdy2, ighe, ighg1, ighg2, ighg3, ighg4, ighj, ighm, ighmbp2, ighr, ighv, igi, igj, igk, igkc, igkde1, igkj, igkjrb1, igkv, iglc, iglc1, iglj, iglp1, iglp2, igiv, igm, igo1, igsf1, ihh, ik1, ikba, il10, il10r, il11, il11ra, il12a, il12b, il12rb1, il12rb2, il13, il13ra1, il13ra2, il15, il15ra, il17, il1a, il1b, il1bc, il1r1, il1r2, il1ra, il1rap, il1rb, il1rn, il2, il2r, il2ra, il2rb, il2rg, il3, il3ra, il3ray, il4, il4r, il4ra, il5, il5ra, il6, il6r, il6st, il7, il7r, il8, il8ra, il8rb, il9, il9r, ila, ilf1, illbp, imd1, imd2, imd4, imd5, imd6, impa1, impdh1, impdh2, impdh11, impg1, impt1, indx, infa2, infa4, infa5, ing1, inha, inhba, inhbb, inhbc, ini1, ink4b, inlu, inp10, inpp1, inpp5a, inpp5b, inpp5d, inpp11, ins, insig1, ins1, ins13, ins14, insr, insrr, int1, int111, int2, int3, int4, int6, iosca, ip2, ipf1, ip1, ipm150, ipox, ipp, ipp2, ipw, iqgap1, ir10, ir20, ireb1, ireb2, irf1, irf2, irf4, irf4, in, irs1, isa, iscw, is11, islr, isot, issx, it15, itba1, itba2, itf, itf2, itga1, itga2, itga2b, itga4, itga5, itga6, itga7, itgad, itga1, itgam, itgav, itgax, itgb1, itgb2, itgb3, itgb4, itgb6, itgb7, iti, itih1, itih2, itih3, itih4, itih11, iti1, itk, itm1, itpa, itpka, itpkb, itpr1, itpr2, itpr3, itsn, ivd, iv1, jag1, jak1, jak2, jak3, jbs, jcap, jh8, jip, jk, jme, jmj, joag, jpd, jrk, jrk1, jtk14, jtv1, jun, junb, jund, jup, jv18, jws, k12t, kai1, ka11, kar, kars, katp1, kcna1, kcna10, kcna1b, kcna2b, kcna3, kcna4, kcna5, kcna6, kcna7, kcna8, kcna9, kcnab1, kcnab2, kcnb1, kcnc1, kcnc2, kcnc3, kcnc4, kcne1, kcnh1, kcnh2, kcnj1, kcnj10, kcnj11, kcnj12, kcnj15, kcnj3, kcnj4, kcnj5, kcnj6, kcnj6, kcnj7, kcnj8, kcnjn1, kcnk1, kcnk2, kcnk3, kcnma1, kcnq1, kcnq2, kcnq3, kcenq4, kcns2, kd, kdr, ke1, kera, kfl, kfs, kfsd, kfs1, khk, kiaa0122, kid, kid1, kif2, kif3c, kif5b, kip1, kip2, kiss1, kit, klc2, klk1, klk2, klk3, klk3, klkb1, klkr, klrb1, klrc1, klrc2, klrc3, klrc4, klrd1, klst, kms, kms, kng, kno, kns1, kns2, kns11, kns14, kox1, kox11, kox12, kox13, kox15, kox16, kox18, kox19, kox2, kox2, kox22, kox25, kox30, kox32, kox4, kox5, kox6, kox7, kox9, kpna3, kpps1, kpps2, krag, kras1p, kras2, krev1, krg2, krn1, krn11, krox20, krt1, krt10, krt12, krt13, krt14, krt15, krt16, krt17, krt18, krt19, krt2a, krt2e, krt3, krt4, krt5, krt6a, krt6b, krt7, krt8, krt9, krtha2, krtha5, krthb1, krthb6, ks, ktn1, ku70, kup, kvlqt1, kwe, 11.2, 11 cam, 123mrp, lab7, lab72, lac, laci, lacs, lad, lad, lad1, laf4, lag3, lag5, lair1, lak1, lalba, lal1, lam1, lama1, lama2, lama3, lama3, lama4, lama5, lamb1, lamb2, lamb2, lamb2t, lamb3, lambr, lamc1, lamc2, lamm, lamnb2, lamp, lamp1, lamp2, lamr1, lams, lap, lap18, laptm5, lar, lar1, lard, large, lars, lbp, lbr, Ica, lca1, Icad, Icamb, lcat, lccs, lcfs2, lch, lck, lcn1, lcn2, lco, lcp1, lcp2, lct, ld, ld78, ldb1, ldb2, ldc, ldh1, ldh3, ldha, ldhb, ldhc, ldlr, le, lect2, lef1, lefty1, lefty2, lep, lepr, lerk5, lerk8, leu1, leu7, leut, lfa1a, lfa3, lfh11, lfp, lga1s1, lga1s3, lga1s3bp, lga1s7, lgcr, Igmd1, lgmd1a, lgmd1b, lgmd1c, lgmd1d, lgmd2b, lgmd2c, lgmd2d, lgmd2e, lgmd2f, lgmd2g, lgmd2h, lgs, lgtn, lhb, lhcgr, lhs, lhx1, lhx3, li, li2, lif, lifr, lig1, lig3, lig4, lim1, lim2, limab1, limk1, limpii, lip2, lipa, lipb, lipc, lipd, lipe, lipo, lis1, lis2, lisx, litaf, lkb1, lkn1, llg11, lman1, lmn1, lmn2, lmna, lmnb1, lmnb2, lmo1, lmo2, lmo3, lmo4, lmo5, lmp10, lmp2, lmp7, lmpx, lms, lmx1, lmx1a, lmx1b, lmyc, lnhr, lnrh, locr, loh11cr2a, lor, lot1, lox, lox1, lox11, lpa, lpaab, lpaata, lpap lpc1, lpc2d, lpd1, lph, lpi, lp1, lpna3, lpp, lps, lpsa, lqt1, lqt2, lqt3, lqt4, lr3, lre1, lre2, lrp, lrp1, lrp2, lrp5, lrp7, lrp8, lrpap1, lrpr1, lrs1, lsamp, lsirf, ls1, lsn, Isp1, lss, lst1, lta, lta4h, ltb, ltb4r, ltbp1, ltbp2, ltbp2, ltbp3, ltbp3, ltbr, ltc4s, Itf, ltk, ltn, lu, lum, luxs, luzp, lw, ly64, ly6e, ly9, lyam1, lyb2, lyf1, ly11, lyn, lyp, lyst, lyt10, lyz, lztr1, m11s1, m130, m17s1, m17s2, m195, m1s1, m3s1, m4s1, m6a, m6b, m6p2, m6pr, m6s1, m7v1, m7vs1, mab211, mac1a, mac2, mac25, macam1, macs, mad, mad211, madd, madh1, madh2, madh3, madh4, madh5, madh6, madh6, madh7, madh9, madm, madr1, maf, mafd1, mafd2, mag, mage1, mageb3, mageb4, mage11, magoh, magp, magp1, magp2, mak, ma1, ma11, man2a2, mana1, mana2, mana2x, manb, manb1, manba, maoa, maob, map1a, map1a1c3, map1b, map1b1c3, map2, map4, map80, map97, mapk1, mapkap3, mapkkk4, mapt, mar, mark3, mars, mas1, masp1, mat1a, mat2a, mata1, mata2, matk, matn1, matn3, max, maz, mb, mbd1, mb1, mb12, mbp, mbp1, mbs, mbs2, mc1r, mc2r, mc3r, mc4r, mc5r, mcad, mcc, mcdc1, mcdr1, mcf2, mcf3, mcfd1, mch2, mch3, mch4, mch5, mckd, mc1, mc11, mcm, mcm2, mcm2, mcm3, mcm6, mcm7, mcmt, mcop, mcor, mcp, mcp1, mcp3, mcph1, mcr, mcs, mcsf, mcsp, mct1, md1, mdb, mdc, mdcr, mddc, mdeg, mdf1, mdg, mdg1, mdh1, mdh2, mdk, mdk, mdm2, mdm4, mdr1, mdr3, mdrs1, mdrv, mds, mds1, mdu1, mdu2, mdu3, mdx, me1, me2, mea, mea6, mec11, mecp2, med, mef, mef2a, mef2b, mef2c, mef2d, mefv, mehmo, meis1, meis2, mekk, mekk1, mekk4, me1, mel18, melf, memo1, men1, men2a, meox1, meox2, mep1a, mep1 b, mer2, mer6, mest, met, metrs, mfap1, mfap2, mfap3, mfap4, mfd1, mfi2, mfs1, mfs2, mft, mfts, mg50, mga, mga1, mga3, mgat1, mgat2, mgat5, mgc1, mgcn, mgcr, mgct, mgdf, mgea, mgf, mgi, mgmt, mgp, mgsa, mgst1, mgst2, mhc, mhc2ta, mhp2, mhs, mhs2, mhs3, mhs4, mhs6, mia, mic10, mic11, mic12, mic17, mic18, mic2, mic2x, mic2y, mic3, mic4, mic7, mica, micb, mid1, midas, mif, mif, mig, mip, mip2a, mip2b, mip3b, mipep, mitf, miwc, mjd, mk, mki67, mkks, mkp2, mkp3, mkpx, mks, mks, mks1, mks2, mla1, mlck, mlf1, mlf2, mlh1, mlk1, mlk3, ml1, ml12, ml1t1, ml1t2, ml1t3, ml1t4, ml1t6, ml1t7, mlm, mlm, min, mlp, mlr, mlrg, mlrw, mls, mltn, mlvar, mlvi2, mlvt, mmac1, mme, mmp1, mmp10, mmp11, mmp12, mmp13, mmp14, mmp15, mmp16, mmp17, mmp19, mmp2, mmp21, mmp22, mmp3, mmp7, mmp8, mmp9, mn, mn, mnb, mnbh, mnda, mng1, mnk, mns, mnt, mocod, mocs1, mocs2, mody1, mody3, mog, mok2, mom1, mos, mot2, mov34, mox1, mox2, mox44, moz, mp19, mpb1, mpd1, mpdz, mpe, mpe16, mpg, mpi, mpif2, mp1, mp11g, mpo, mpp1, mpp2, mpp3, mppb, mpri, mprn, mps2, mps3a, mps3c, mps4a, mpsh, mpts, mpv17, mpz, mr1, mr77, mrbc, mrc1, mre11, mre11a, mrg1, mrgh, mros, mrp, mrp, mrp1, mrp123, mrs, mrsd, mrsr, mrst, mrx1, mrx14, mrx2, mrx20, mrx21, mrx23, mrx29, mrx41, mrx48, mrx49, mrx9, mrxa, mrxs1, mrxs2, mrxs3, mrxs4, mrxs5, mrxs6, mrxs8, ms3315, ms336, msg1, msh2, msh3, msh4, msh6, msi1, msk16, msk39, msk41, mslr1, msmb, msn, msr1, mss1, mss4, mss4, msse, mst, mst1, mst1r, mstd, mstn, msud1, msx1, msx2, mt1a, mt1b, mt1e, mt1f, mt1g, mt1h, mt1i, mt1j, mt1k, mt11, mt1x, mt2, mt2a, mt3, mtacr1, mtap, mtbt1, mtcp1, mterf, mtf1, mth1, mthfc, mthfd, mthfr, mtk1, mtm1, mtmr1, mtmx, mtnr1a, mtnr1b, mtp, mtpa, mtr, mtrns, mtrr, mts, mts, mts1, mts1, mts2, mttf1, mtx, mtxn, mu, muc1, muc2, muc3, muc4, muc5, muc5ac, muc5b, muc6, muc8, mu1, mum1, mupp1, musk, mut, mvk, mvlk, mvwf, mwfe, mx, mx1, mx2, mxi1, mxs1, myb, myb11, myb12, mybpc1, mybpc2, mybpc3, mybpcf, mybph, myc, myc11, myc12, myclk1, mycn, myd88, myf3, myf4, myf5, myf6, myh1, myh10, myh11, myh12, myh2, myh3, myh4, myh6, myh7, myh8, myh9, myk1, my1, my11, my12, my13, my14, my15, mylk, mymy, myo10, myo15, myo1a, myo1c, myo1d, myo1e, myo5a, myo6, myo7a, myo9b, myoc, myod1, myog, myp1, myp2, myp3, myr5, mzf1, n33, nab1, nab2, nabc1, nac1a, naca, nacae, nacp, nadmr, naga, nagc, naglu, nagr1, naip, namsd, nanta3, nap114, nap2, nap21, napb, naptb, nars, nat1, nat1, nat2, nb, nb4s, nbat, nbc3, nbccs, nbccs, nbia1, nbs, nbs, nbs1, nca, ncad, ncam1, ncan, ncbp, ncc1, ncc2, ncc3, ncc4, ncct, ncf1, ncf2, ncf4, nck, nc1, ncst2, ncx1, ncx2, nd, ndhii, ndn, ndp, ndst1, ndufa1, ndufa2, ndufa5, ndufa6, ndufa7, ndufb8, ndufb9, ndufs1, ndufs2, ndufs4, ndufs7, ndufs8, ndufv1, ndufv2, ndufv3, neb, nec1, nec2, nedd1, nedd2, nedd4, nefh, nef1, negf1, negf2, ne111, neb112, nem1, neo1, nep, net, net1, neu, neu, neud4, neurod, neurod2, neurod3, nf1, nf1a, nf2, nfatc1, nfatc2, nfatp, nfe1, nfe2, nfe211, nfe212, nfe2u, nfia, nfib, nfic, nfix, nfkb1, nfkb2, nfkb3, nfkbia, nfkbi11, nfrkb, nfya, nfyb, nga1, ngbe, ngfb, ngfg, ngfic, ngfr, ng1, ngn, nhbp, nhcp1, nhcp2, nhe1, nhe3, nhe4, nhe5, nhlh1, nhlh2, nhp211, nhs, nid, niddm1, ninj1, nipp1, nipsnap1, nipsnap2, nis, nklr, nkcc1, nkcc2, nkg2, nkg2a, nkg2c, nkg2e, nkg2f, nkhc, nkna, nknar, nknb, nkrp1a, nks1, nksf2, nktr, nkx2a, nkx3.2, nkx3a, nkx6a, nli, nm, nm1, nm23, nmb, nmbr, nmdar1, nmdar2a, nmdar2b, nmdar2c, nmdar2d, nmdara1, nme1, nme2, nme4, nmor1, nmor2, nms1, nmyc, nnat, nmnt, nno1, nog, nol1, nos1, nos2a, nos2b, nos2c, nos3, not, notch1, notch2, notch3, notch4, nov, nov, nov2, nova1, nova3, novp, np, np10, npat, npc, npc1, npd, nph1, nph2, nph12, nphn, nphp1, nphp2, nphs1, npm1, nppa, nppb, nppc, npps, npr1, npr2, npr3, nps1, npt1, npt2, nptx2, npy, npy1r, npy2r, npy3r, npy5r, npy6r, nqo2, nramp, nramp1, nramp2, nrap, nras, nrb54, nrcam, nrd1, nrf1, nrf1, nrf2, nrgn, nrip1, nrk2, nr1, nrtn, nru, ns1, nsf, nsp, nsp11, nsrd9, nt4, nt5, nt5, ntcp1, ntcp2, ntf3, ntf4, ntf5, nth11, ntn, ntn, ntn21, ntrk1, ntrk2, ntrk3, ntrk4, ntrkr1, ntrkr3, nts, ntt, ntt, nuc1, nucb1, numa1, nup214, nup98, nurr1, nv1, nys1, nys2, nysa, oa1, oa2, oa3, oar, oasd, oat, oat11, oat22, oat23, oatp, oaz, ob, ob10, obf1, obp, obr, oca2, ocm, ocp2, ocr1, ocr11, oct, oct1, oct1, oct2, oct2, oct3, oct7, octn2, octs3, odc1, oddd, odf1, odg1, odod, ofc1, ofc2, ofc3, ofd1, ofe og22, ogdh, ogg1, ogr1, ogs1, ogs2, ohds, ohs, oias, oip1, ok, olf1, olfmf, olfr1, olfr2, omg, omgp, omp, on, op2, opa1, opa2, opa3, opca3, opcm1, opd1, opg1, ophn1, op11, opn, oppg, oprd1, oprk1, oprm1, oprt, opta2, optb1, oqt1, orld2, orlf1, orc11, orc21, orc41, orc51, orfx, orm1, orm2, orw, osbp, osm, osp, ost, ost48, osx, otc, otf1, otf2, otf3, otm, otof, ots, otx1, otx2, ovc, ovcs, ovo11, ox40, oxa11, oxct, oxt, oxtr, ozf, p, p, p1, p15, p16, p167, p28, p2rx3, p2rx4, p2ry1, p2ry2, p2ry4, p2ry7, p2u, p2x3, p2x4, p2y1, p2y2, p2y2, p2y4, p3p40phox, p450c11, p450c17, p450c2a, p450c2d, p450c2e, p450scc,
p4ha, p4ha1, p4ha1, p4hb, p5cdh, p79r, pa2g4, pab1, pab2, pabp2, pabp11, pac1, pac1, pacapr, pace, pace4, paep, paf1, paf2, pafah, pafah1b1, pafah1b2, pafah1b3, paga, pah, pahx, pai1, pai2, paics, pak1, pak3, palb, pals, pam, pang, pap, papa, papa2, pappa, par1, par1, par2, par3, par4, par4, par5, park1, park2, park3, pawr, pax1, pai2, pax3, pax4, pax5, pax6, pax7, pax8, pax9, pbca, pbcra, pbfe, pbg pbt, pbx1, pbx2, pbx3, pc, pc1, pc2, pc3, pc3, pca1, pcad, pcap, pcar1, pcbc, pcbd, pcbp1, pcbp2, pcca, pccb, pcdh7, pcdx, pchc, pchc1, pci, pck1, pc1, pc1p, pcm1, pcm1, pcmt1, pcna, pent, pcolce, pcp, pcp4, pcs, pctk1, pcsk2, pcsk3, pcsk4, pcsk5, pcsk6, pctk1, pctk3, pcyt1, pdb, pdb2, pdc, pdc, pdcd1, pdcd2, pddr, pde1a, pde1b, pde1b1, pde3b, pde4a, pde4b, pde4c, pde4d, pde5a, pde6a, pde6b, pde6c, pde6d, pde6g, pde6h, pde7a, pdea, pdea2, pdeb pdeb, pdeg, pdeslb, pdgb, pdgfa, pdgfb, pdgfr, pdgfra, pdgfrb, pdha1, pdha2, pdhb, pdj, pdk4, pdnp1, pdnp2, pdnp3, pdr, pds, pds1, pdx1, pdyn, pe1, pea15, pebp2a1, pebp2a3, pecam1, ped, ped, pedf, pee, peg1, peg3, pemp, penk, pent, peo, peo1, peo2, pepa, pepb, pepc, pepd, pepe, pepn, peps, per, per2, peta3, pets1, pex1, pex5, pex6, pex7, pf4, pf4v1, pfas, pfbi, pfc, pfd, pfhb1, pfic1, pfic2, pfkfb1, pfkfb2, pfk1, pfk-mn, pfkp, pfkx, pf1, pfm, pfn1, pfn2, pfrx, pga3, pga4, pga5, pgam1, pgam2, pgamm, pgc, pgd, pgf, pgft, pgk1, pgk2, pgka, pg1, pg11, pg12, pgm1, pgm2, pgm3, pgm5, pgn, pgp, pgp1, pgr, pgs, pgt, pgy1, pgy3, pha1, pha2, pha2a, pha2b, phap1, phb, phc, phe1a, phe3, phex, phf1, phhi, phhi, phk, phka1, phka2, phkb, phkd, phkg1, phkg2, ph1, phl11, phog, phox1, phox2a, php, php1b, phpx, phyh, pi, pi10, pi3, pi4, pi5, pi6, pi7, pi8, pi9, piga, pigc, pigf, pigh, pigr, pik3c2b, pik3ca, pik3r1, pik4cb, pi1, pim1, pin, pin1, pin11, pip, pip5k1b, pir1, pir51, pit, pit1, pitpn, pitx1, pitx2, pitx3, pjs, pk1, pk120, pk3, pk428, pkca, pkcb, pkcc, pkcg, pkcs1, pkd1, pkd2, pkd4, pkdts, pkhd1, pk1r, pkm2, pkp1, pks1, pks1, pks2, pku1, pl, pla2, pla2a, pla2b, pla2glb, pla2g2a, pla2g4, pla2g4a, pla2g5, pla21, pla21, plag1, plag11, planh1, planh2, planh3, plat, plau, plaur, plb, plc, plc1, plcb3, plcb4, plcd1, plce, plcg1, plcg2, plc1, pld1, plec1, plg, plgf, plg1, pli, pin, plod, plod2, plos1, plp, pls, pls1, plt1, pltn, pltp, plzf, pmca1, pmca2, pmca3, pmca4, pmch, pmch11, pmch12, pmd, pme117, pmi1, pm1, pmm1, pmm2, pmp2, pmp22, pmp35, pmp69, pmp70, pms1, pms2, pms11, pms12, pmx1, pn1, pnd, pnem, pnkd, pnlip, pnmt, pnoc, pod1, podx1, pof, pof1, pol2rb, pola, polb, pold1, pold2, pole, polg, polr2a, polr2c, polr2e, polr2g, polr2i, polrmt, polz, pomc, pon, pon1, pon2, pon3, por, porc, potx, poulf1, pou2af1, pou3f1, pou3f2, pou3f3, pou3f4, pou4f1, pou4f3, pou5f1, pp, pp14, pp2, pp4, pp5, ppac, ppard, pparg, pparg1, pparg2, ppat, ppbp, ppcd, ppd, ppef1, ppef2, ppfia3, ppgb, pph, pph1, ppia, ppid, ppil1, ppkb, ppks1, ppks2, pp1, ppla2, ppmx, ppnd, ppnoc, ppo1, ppox, pppla, ppplca, ppplcb, ppp1cc, ppp1r2, ppp1r5, ppp1r7, pppd1r8, ppp2b, ppp2ca, ppp2cb, ppp2r1b, ppp2r4, ppp2r5a, ppp2r5b, ppp2r5c, ppp2r5d, ppp2r5e, ppp3ca, ppp3cb, ppp3cc, pp3r1, ppp4c, ppp5c, ppt, ppt2, ppx, ppy, ppyr1, pr, prad1, prb1, prb2, prb3, prb4, prca1, prca2, prcc, prcp, pre1p, prep, prf1, prg, prg1, prg1, prgs, prh1, prh2, prim1, prim2a, prim2b, prip, prk1, prkaa1, prkaa2, prkab1, prkaca, prkacb, prkacg, prkag1, prkag2, prkar1a, prkar1b, prkar2b, prkca, prkcb1, prkcd, prkcg, prkci, prkcl1, prkcnh1, prkcq, prkcsh, prkdc, prkg1, prkg1b, prkg2, prkgr1b, prkgr2, prkm1, prkm3, prkm4, prkm9, prkn, prkr, prkx, prky, pr1, pr1r, prm1, prm2, prmt2, prnp, proa, proc, prodh, prohb, prop1, pros1, pros30, prox1, prp8, prph, prps1, prps2, pipsap1, prr1, prr2, prs, prsc1, prss1, prss11, prss2, prss7, prss8, prss11, prtn3, prts, psa, psa, psach, psap, psbg1, psbg2, psc2, psc5, psca, psd, psen1, psen2, psf1, psf2, psg1, psg11, psg12, psg13, psg2, psg3, psg4, psg5, psg6, psg7, psg8, psg11, pskh1, psm, psma1, psma2, psma3, psma5, psmb1, psmb10, psmb2, psmb3, psmb4, psmb5, psmb8, psmb9, psmc1, psmc2, psmc3, psmc5, psmd7, psmd9, psme1, psme2, psors1, psors2, psors3, psp, psps1, psps2, pss1, psst, pst, pst, pst1, psti, ptafr, ptc, ptc, ptc, ptch, ptd, pten, ptgds, ptger1, ptger2, ptger3, ptgfr, ptgfrn, ptgir, ptgs1, ptgs2, pth, pthlh, pthr, pthr1, pthr2, ptk1, ptk2, ptk2b, ptk3, ptk7, ptlah, ptma, ptms, ptn, ptos1, ptp18, ptp1b, ptp4a1, ptp4a2, ptpa, ptpa, ptpd, ptpg, ptpg1, ptpgmc1, ptpn1, ptpn10, ptpn11, ptpn12, ptpn13, ptpn14, ptpn2, ptpn5, ptpn6, ptpn7, ptpra, ptprb, ptprc, ptprcap, ptprd, ptpre, ptprf, ptprg, ptprh, ptprj, ptprk, ptpr11, ptpr12, ptprm, ptprn, ptpro, ptprs, ptprz1, ptpt, pts, pts1r, ptx1, ptx3, pujo, pum, pur1, pur1, pura, pvalb, pvr, pvr11, pvr12, pvrr1, pvrr2, pvs, pvt1, pwcr, pwp2, pwp2h, pws, pxaaa1, pxe, pxe1, pxf, pxmp1, pxmp11, pxmp3, pxr1, pycr1, pycs, pygb, pyg1, pygm, pyk2, pyst1, pyst2, pzp, gars, qdpr, qin, qm, qpc, qprs, rab, rab1, rab13, rab1a, rab21, rab3a, rab3b, rab4, rab5, rab5a, rab6, rab7, rabgdla, rabgdib, rabggta, rabggtb, rabif, rac2, rac3, rad1, rad17, rad23a, rad23b, rad51a, rad51c, rad51d, rad5311, rad52, rad54, rad6a, rad6b, raf1, rafa1, rag1, rag2, rage, rala, ralb, ralgds, ramp, ranbp211, ranbp3, rao, rap1a, rap1b, rap1ga1, rap1gds1, rap2a, rap74, rapsn, rara, rarb, rarg, rars, rasa1, rasa2, rasgfr3, rask2, rb1, rbbp2, rbbp5, rbbp6, rb11, rb12, rbm1, rbm2, rbm3, rbmy1a1, rbp1, rbp2, rbp3, rbp4, rbp5, rbp56, rbp6, rbq3, rbtn1, rbtn11, rbtn12, rca1, rcac, rcc1, rccp1, rccp2, rcd1, rcd2, rcdp1, rcn1, rcn2, rcp, rcv1, rd, rdbp, rdc7, rdp, rdpa, rdre, rds, rdt, rdx, reca, recc1, recq1, red1, red2, reg, reg1a, reg1, re1, rela, rein, ren, renbp, rens1, rent1, rep8, req, ret, rev3, rev31, rfc1, rfc2, rfc3, rfc4, rfc5, rfp, rfx1, rfx2, rfx5, rfxank, rfxap, rgc1, rgr, rgs, rgs1, rgs14, rgs16, rgs2, rgs2, rgs3, rgs5, rh50a, rhag, rhbd1, rhc, rhce, rhd, rheb2, rho, rho7, rhogap2, rhogap3, rhohl2, rhoh6, rhoh9, rhok, rhom1, rhom2, rhom3, rieg1, rieg2, rige, rigui, ring1, ring10, ring11, ring12, ring3, ring31, ring4, ring5, ring6, ring7, rip, rip140, riz, rk, rl, rrbp1, rlf, rln1, rln2, rmch1, rmd1, rmrp, rmrpr, rn5s1, rnase1, rnase2, rnase3, rnase4, rnase5, rnase6, rnase1, rnaseli, rne1, rnf1, rnf3, rnf4, rnf5, rnh, rnpep, rnpulz, rnr1, rnr2, rnr3, rnr4, rnr5, rns1, rns2, rns3, rns4, rns4, rns4i, rntmi, rnu1, rnu15a, rnu17a, rnu17b, rnula, rnu2, rnu3, ro52, rom1, romk1, ron, ror1, rora, rorb, rorc, rorg, ros1, rosp1, rox, rp1, rp10, rp105, rp11, rp12, rp13, rp14, rp15, rp17, rp18, rp19, rp2, rp22, rp24, rp25, rp3, rp4, rp6, rp7, rp9, rpa1, rpa2, rpa3, rpd311, rpe, rpe65, rpe119rp122, rp123a, rp1231, rp129, rp130, rp135a, rp136a, rp17a, rpms12, rpn1, rpn2, rpo12, rps11, rps14, rps17, rps17a, rps17b, rps1711, rps1712, rps18, rps20a, rps20b, rps24, rps25, rps3, rps4x, rps4y, rps6, rps6ka1, rps6ka2, rps6ka3, rps8, rpsm12, rptpm, rpu1, rpx, rrad, rras, rrbp1, rreb1, rrm1, rrm2, rrp, rrp22, rs1, rs1, rscla1, rsk1, rsk2, rsk3, rsn, rss, rsts, rsu1, rt6, rtef1, rtkn, rtn1, rtn2, rts, rts, rtt, rws, rxra, rxrb, rxrg, ryr1, ryr2, ryr3, rzrb, rzrg, s100a1, s100a10, s100a11, s100a12, s100a13, s100a2, s100a3, s100a4, s100a5, s100a6, s100a7, s100a8, s100a9, s100b, s100d, s100e, s100, s100p, s152, s4, s7, saa1, saa2, saa4, sacs, safb, sag, sah, sahh, sai1, sakap84, sal11, sal12, sams1, sams2, sap, sap1, sap1, sap2, sap62, sar, sar1, sar2, sard, sas, sat, satb1, satt, sbma, sc, sc1, sc5d1, sca1, sca10, sca2, sca2, sca3, sca4, sca5, sca6, sca7, sca8, sca8, scar, scca1, scca2, sccd, scd, sceh, scg1, scg2, scg3, schad, scida, scidx, scidx1, sc1, sclc1, sc11, scn, scn1a, scn1b, scn2a, scn2a1, scn2a2, scn2b, scn3a, scn4a, scn5a, scn6a, scn8a, scnn1a, scnn1b, scnn1d, scnn1g, scot, scp, scp1, scp2, scpn, scra1, scra1, scs, sctr, scya1, scya11, scya13, scya14, scya15, scya16, scya19, scya2, scya21, scya22, scya24, scya25, scya3, scya311, scya4, scya5, scya7, scya8, scyb5, scyb6, scyd1, sczd1, sczd2, sczd3, sczd4, sczd5, sczd6, sczd7, sczd8, sdc1, sdc2, sdc4, sdf1, sdf2, sdh1, sdh2, sdha, sdhb, sdhc, sdhd, sdhf, sds22, sdty3, sdys, se, sea, sec1311, sec13r, sec141, sec7, sed1, sedt, sef2, sel11, sele, sel1, selp, selp1g, sema3f, sema4, sema5, semg, semg1, semg2, sen1, sep, sepp1, serca1, serca3, serk1, ses1, set, sex, sf, sf1, sfa1, sfd, sfmd, sfrs1, sfrs2, sfrs7, sftb3, sftp1, sftp2, sftp4, sftpa1, sftpa2, sftpb, sftpc, sftpd, sgb, sgca, sgcb, sgcd, sgcg, sgd, sgk, sglt1, sglt2, sgm1, sgne1, sgp2, sgpa, sgsh, sh2d1a, sh3bp2, sh3d1a, sh3gbr, sh3p17, shb, shbg, shc1, shc11, shfd1, shfd2, shfm1, shfm2, shfm3, shh, ship, shmt1, shmt2, shoc2, shot, shox, shox2, shps1, shs, shsf1, si, siah1, siah2, siasd, siat1, siat4, siat4c, siat8, sids, si1, silv, sim1, sim2, sipa1, sis, siv, six1, six5, sja, sjs, ski, ski2, ski2w, skiv21, skp1a, skp1b, skp2, sla, slap, slbp, slc, slc10a1, slc10a2, slc12a1, slc12a2, slc12a3, slc14a1, slc14a2, slc15a1, slc16a1, slc16a2, slc17a1, slc17a2, slc18a1, slc18a2, slc18a3, slc19a1, slc1a1, slc1a2, slc1a3, slc1a4, slc1a5, slc20a1, slc20a2, slc20a3, slc21a2, slc21a3, slc22a1, slc22a2, slc22a5, slc2a1, slc2a2, slc2a3, slc2a4, slc2a5, slc2c, slc3a1, slc4a1, slc4a2, slc4a6, slc5a1, slc5a2, slc5a3, slc5a5, slc6a1, slc6a10, slc6a12, slc6a2, slc6a3, slc6a4, slc6a6, slc6a8, slc6a9, slc7a1, slc1a2, slc1a4, slc7a5, slc7a7, slc8a1, slc8a2, slc9a1, slc9a2, slc9a3, slc9a4, slc9a5, sld, sle1, sleb1, slim1, sln, slo, slos, s1p76, sls, slug, sm1, sm22, sma4, smad1, smad1, smad2, smad3, smad4, smad5, smad6, smad7, smad9, sma1, smam1, smarca1, smarca2, smarca3, smarca5, smarcb1, smax2, smc1, smcc, smcr, smcx, smcy, sm11, smn, smn1, smn2, smnr, smo, smoh, smpd1, sms, smt3, smt3h1, smtn, smubp2, sn, snap25, snat, snca, sncb, sncg, snf2h, snf211, snf212, snf213, snf5, sn1, snn, snrp70, snrpa, snrpe, snrpn, snt1, snt2b1, snt2b2, sntb1, snt1, snx, soat, sod1, sod2, sod3, solh, son, sord, sor11, sos1, sos2, sox1, sox10, sox11, sox2, sox20, sox22, sox3, sox4, sox9, sp1, sp1, sp3, sp3, sp4, spa1, spag1, spag4, spam1, sparc, spat, spbp, spch1, spd, spf30, spg3a, spg4, spg5a, spg6, spg7, spg8, spg9, spgp, spgyla, sph2, spi1, spink1, spk, spmd, spn, spp1, spp2, sppm, spr, sprk, sprr1a, sprr1b, sprr2a, sprr2b, sprr2c, sprr3, sps1, spsma, spta1, sptan1, sptb, sptbn1, sra1, sra2, src, src1, src1, src2, srd5a1, srd5a2, srebf1, srebf2, sri, srk, srm, srn1, srp14, srp19, srp46, srpr, srpx, srs, srvx, sry, ss, ss, ssa, ssa1, ssa2, ssadh, ssav1, ssbp, ssdd, ssr2, ssrc, sst, sstr1, sstr2, sstr3, sstr4, sstr5, ssx1, ssxt, st2, st3, st4, st5, st6, st8, sta, stat, stam, star, stat, stat1, stat3, stat4, stat5, ssx1, stc1, stch, std, std, ste, step, stf1, stfa, stfb, stgd1, stgd2, stgd3, stgd4, sthe, stk1, stk11, stk15, stk2, stk6, st1, stm, stm2, stm7, stmy1, stmy2, stmy3, stp, stp1, stp2, sts, sts1, stx, stxlb, stx7, stxbp1, stxbp2, sultlc1, supt6h, sur, sur1, surf1, surf2, surf3, surf4, surf5, surf6, svct2, svmt, sw, sxi2, syb1, syb2, syb11, sycp1, syk, sym1, syn1, syn2, syn3, syngap, syns1, syp, syt, syt1, syt2, syt3, syt4, syt5, t, t3d, taa16, tac1r, tac2, tac2r, tac3, tacr1, tacr2, taf2, taf2a, taf2a, taf2d, taf2h, taf2n, tafii100, tagln, tak1, ta11, ta12, taldo1, tam, tan1, tap1, tap2, tapa1, tapbp, tapvr1, tars, tas, task, tat, taut, tax, tax1, taz, tbg, tbp, tbp1, tbs, tbx1, tbx2, tbx3, tbx5, tbxa2r, tbxas1, tc1, tc2, tcbp, tcd, tcea1, tceb11, tceb3, tcf1, tcf12, tcf13, tcf1311, tcf14, tcf15, tcf17, tcf19, tcf2, tcf20, tcf21, tcf3, tcf4, tcf5, tcf611, tcf612, tcf7, tcf8, tcf9, tcfeb, tcf11, tcf14, tc11, tc11a, tc12, tc13, tc14, tc15, tcn1, tcn2, tco, tcof1, tcp1, tcp10, tcp11, tcp228, tcpt, tcra, tcrb, tcrd, tag, tcrz, tcs1, tcta, tcte1, tcte3, tcte11, tdf, tdfa, tdfx, tdg, tdgf1, tdn, tdo, tdo2, tdt, tead4, tec, tec, teck, tecta, tef, tegt, tek, te1, tem, tep1, terc, terf1, tert, tes1, tesk1, tex28, tf, tf2s, tf6, tfa, tfam, tfap2a, tfap2b, tfap2c, tfap4, tfcoup1, tfcoup2, tfcp2, tfdp1, tfdp2, tfe3, tff1, tff2, tff3, tfiiia, tfn, tfpi, tfpi2, tfr, tfrc, tfs1, tft, tg, tg737, tgb1, tgb2, tgd, tgfa, tgfb1, tgfb2, tgfb3, tgfb4, tgfbi, tgfbr1, tgfbr2, tgfbr3, tgfbre, tgfr, tgm1, tgm2, tgm3, tgm4, tgn38, tgn46, th, thas, thbd, thbp1, thbs1, thbs2, thbs3, thc, thh, th1, thop1, thpo, thr1, thra, thra1, thra1, thrb, thrm, thrsp, thy1, tial1, tiam1, tiar, tic, tie, tie1, tie2, tigr, ti1, ti13, ti14, tim, timp, timp1, timp2, timp3, tinur, titf1, titf2, tjp1, tk1, tk2, tkc, tkcr, tkr, tkt, tkt2, tkt11, tla519, tlcn, tle1, tle2, tle3, tlh1, tln, tlr1, tlr2, tlr3, tlr4, tlr5, tm4sf1, tm4sf2, tm7sf2, tmc, tmd, tmdci, tmem1, tmf1, tmip, tmod, tmp, tmpo, tmprss2, tms, tmsa, tmsb, tmvcf, tna, tndm, tnf, tnfa, tnfaip1, tnfaip2, tnfaip4, tnfaip6, tnfar, tnfb, tnfbr, tnfc, tnfcr, tnfr1, tnfr2, tnfrsf10b, tnfrsf12, tnfrsf14, tnfrsf16, tnfrsf17, tnfrsf1a, tnfrsf1b, tnfrsf4, tnfrsf5, tnfrsf6, tnfrsf6b, tnfrsf1, tnfrsf8, tnfrsf9, tnfsf11, tnfsf12, tnfsf5, tnfsf6, tnfsf1, tnnc1, tnnc2, tnni1, tnni2, tnni3, tnnt1, tnnt2, tnnt3, tnp1, tnp2, tnr, tns, tnx, tnxa, toc, top1, top2, top2a, top2b, top3, tp1, tp120, tp250, tp53, tp53bp2, tp63, tp73, tpa, tpbg, tpc, tpc, tph, tph2, tpi1, tp12, tpm1, tpm2, tpm3, tpm4, tpmt, tpo, tpo, tpp2, tpr, tpr1, tprd, tps1, tps2, tpsn, tpst1, tpst2, tpt, tpt1, tptps, tpx, tpx1, tr, tr2, tr4, tra1, traf1, traf5, trailr2, tran, trance, trap170, trc3, trc8, tre, treb36, trek, trf1, trg1, trh, trhr, tric5, trio, trip1, trip14, trip6, trk, trk 1, trka, trkb, trkc, trke, tr11, tr12, trm1, trm1, trm2, trma, trmi1, trmi2, tm, trn1, tro, trp1, trp1, trp2, trp3, trpc1, trpm2, trpo, trps1, trps2, trq1, trr, trr3, trrap, trsp, trt1, trt2, trv1, trv2, trv3, trv4, trv5, try1, try2, ts, ts13, ts546, tsbn51, tsc tsc1, tsc2, tsd, tse1, tsg101, tsg7, tshb, tshr, tsix, tsp3, tspy, tssc3, tst1, tst1, tsta3, tsy, ttc1, ttc3, ttf, ttf1, ttf2, ttg2, ttim1, ttn, ttp, ttp1, ttpa, ttr, tuba3, tubal1, tubb, tufm, tuft1, tulp1, tuple1, tw, tweak, twik1, twist, txgp11, txk, txn, txnr, txnrd1, tyh, tyk1, tyk2, tyk3, tyms, tyr, tyr1, tyro3, tyrp1, tyrp2, tys, u17hg, ulrnp, u22hg, u2af1, u2aflrs1, u2aflrs2, u2aflrs3, uba52, ubb, ubc, ubc4, ubc7, ubc8, ubch2, ubc1, ube1, ube2, ube2a, ube2b, ube2e2, ube2g, ube2g2, ube2h, ube2i, ube211, ube2v1, ube3a, ubh1, ubid4, ub11, uch11, ucn, ucp1, ucp2, ucp3, udpgdh, uev1, ufd11, ufs, ugalt, ugb, ugcg, ugdh, ugn, ugp1, ugp2, ugpp2, ugt1, ugt1a1, ugt2b11, ugt2b15, ugt2b17, ugt2b4, ugt2b7, ugt2b8, ugt2b9, ugt1, uhg, uhx1, ukhc, umod, umph2, umpk, umps, unc18, unc18b, und, ung, unr, unr, uox, up, upk1b, ups, uqbp, uqcrb, uqcrc1, uqcrc2, uqcrfs1, uqor1, uqor13, uqor22, urk, urkr, uroc, urod, uros, usf1, usf2, ush1, ush1a, ush1b, ush1c, ush1d, ush1e, ush1f, ush2a, ush3, usp11, usp5, usp7, usp9x, usp9y, ut1, ut2, ute, utr, utrn, utx, uty, uv20, uv24, uvo, yacht, vacm1, vamp1, vamp2, vars1, vasp, vat1, vat2, vav, vav1, vav2, vbch, vbp1, vcam1, vcf, vc1, vcp, vdac1, vdac2, vdd1, vdi, vdr, vegf, vegfb, vegfd, vegfr3, vgf, vg1, vgr1, vh1, vhr, vil1, vil2, vim, vip, vipr1, vipr2, vis1, vla1, vla5a, vlacs, vlcad, vldlr, vmat1, vmcm, vmd1, vmd2, vnra, vnt, vp, vpp1, vpp3, vpreb1, vpreb2, vrf, vrk1, vrk2, vrnf, vrni, vsn11, vtn, vwf, vws, waf1, wars, was, wbs, wd1, wdr2, wee1, wfrs, wfs, wfs1, wgn1, whcr, wi, wisp1, wisp2, wisp3, wnd, wnt1, wnt10b, wnt13, wnt14, wnt15, wnt2, wnt3, wnt5a, wnt7a, wnt7b, wnt8b, wrb, wrn, ws1, ws2a, ws2b, ws4, wsn, wss, wss, wt1, wt2, wt3, wt4, wt5, wts, wts1, wws, x11, xbp1, xbp2, xce, xdh, xe169, xe7, xe7y, xg, xgr, xh2, xiap, xic, xist, xk, xla, xla2, xlp, xlpd, xlrs1, xm, xpa, xpb, xpc, xpcc, xpct, xpf, xpf, xpg, xpmc2h, xpnpep2, xpo1, xrcc1, xrcc2, xrcc3, xrcc4, xrcc5, xrcc9, xrs, xs, xwnt2, yb1, yes1, yk140, y11, yrrm1, yt, ywha1, ywhab, ywhah, ywhaz, yy1, zac, zag, zan, zap70, zf87, zfm1, zfp3, zfp36, zfp37, zfx, zfy, zic1, zic2, zic3, zipk, znf1, znf10, znf117, znf11a, znf11b, znf12, znf121, znf123, znf124, znf125, znf126, znf13, znf14, znf141, znf144, znf146, znf147, znf157, znf16, znf160, znf162, znf163, znf165, znf169, znf173, znf179, znf189, znf19, znf192, znf193, znf195, znf198, znf2, znf20, znf200, znf204, znf217, znf22, znf23, znf24, znf25, znf26, znf27, znf29, znf3, znf32, znf34, znf35, znf36, znf38, znf4, znf40, znf41, znf42, znf44, znf45, znf46, znf5, znf6, znf69, znf7, znf70, znf71, znf72, znf73, znf74, znf75, znf75a, znf75c, znf76, znf77, znf79, znf8, zn80, znf81, znf83, znf9, znfc150, znfc25, znfxy, znt3, znt4, zp3a, zp3b, zpk, zws1, and zyx.
[0242] Furthermore, genes from bacteria, plants, yeast, and mammals (e.g., mice) can be used with the microorganisms provided herein. Non-limiting examples of E. coli genes include: aarF, aas, aat, abpS, abs, accA, accB, accC, accD, acd, aceA, aceB, aceE, aceF, aceK, ackA, ackB, acnA, acnB, acpD, acpP, acpS, acpX, acrA, acrB, acrC, acrD, acrE, acrF, acrR, acs, ada, add, adhB, adhC, adhE, adhR, adiA, adiY, adk, aegA, aer, aes, agaA, agaB, agaC, agaD, agaL agaR, agaS, agaV, agaW, agaZ, agp, ahpC, ahpF, aidB, ais, alaS, alaT, alaU, alaV, alaW, alaX, aldA, aldB, aldH, alkA, alkB, alpA, alr, alsA, alsB, alsC, alsE, alsK, alx, amiA, amiB, amn, ampC, ampD, ampE, ampG, ampH, amtB, amyA, ansA, ansB, apaG, apaH, aphA, appA, appB, appC, appY, apt, aqpZ, araA, araB, araC, araD, araE, araF, araG, araH, araJ, arcA, arcB, argA, argB, argC, argD, argE, argF, argG, argH, argI, argM, argP, argQ, argR, argS, argT, argU, argV, argW, argX, argY, argZ, aroA, aroB, aroC, aroD, aroE, aroF, aroG, aroH, aroI, aroK, aroL, aroM, aroP, aroT, arsB, arsC, arsR, artI, artJ, artM, artP, artQ, ascB, ascF, ascG, asd, aslA, aslB, asmA, asnA, asnB, asnC, asnS, asnT, asnU, asnV, asnW, aspA, aspC, aspS, aspT, aspU, aspV, asr, asu, atoA, atoB, atoC, atoD, atoS, atpA, atpB, atpC, atpD, atpE, atpF, atpG, atpH, atpI, avtA, azaA, azaB, azl, bacA, baeR, baeS, barA, basR, basS, bax, bcp, bcr, betA, betB, betI, betT, bfd, bfm, bfr, bglA, bglB, bglF, bglG, bglJ, bgT, bglX, bioA, bioB, bioC, bioD, bioF, bioH, bioP, bipA, birA, bisC, bisZ, blc, bolA, bRNQ, brnR, brnS brnT, btuB, btuc, btuD, btuE, btuR, bymA, cadA, cadB, cadC, cafA, caiA, caiB, caiC, caiD, caiE, caiF, caiT, calA, caiC, calD, can, carA, carB, cbl, cbpA, cbt, cca, ccmA, ccmB, ccmC, ccmD, ccmE, ccmF, ccmG, ccmH, cdd, cde, cdh, cdsA, cdsS, cedA, celA, celB, ceIC, celD, celF, cfa, cfcA, chaA, chaB, chaC, cheA, cheB, cheR, cheW, cheY, cheZ, chpA, chpB, chpR, chpS, cirA, citA, citB, cld, cipA, clpB, clpP, clpX, cls, cmk, cmlA, cmr, cmtA, cmtB, coaA, cobS, cobT, cobU, codA, codB, cof, cog?, corA, cpdA, cpdB, cpsA, cpsB, cpsC, cpsD, cpsE, cpsF, cpsG, cpxA, cpxB, cpxP, cpxR, crcA, crcB, creA, creB, creC, creD, crg, crl, crp, crr, csdA, csgA, csgB, csgD, csgE, csgF, csgG, csiA, csiB, csiC, csiD, csiE, csiF, cspA, cspB, cspC, cspD, cspE, cspG, csrA, csrB, cstA, cstC, cup, cutA, cutC, cutE, cutF, cvaA(ColV), cvaB(ColV), cvaC(Co-lV), cvi(ColV), cvpA, cxm, cyaA, cybB, cybC, cycA, cydA, cydB, cydC, cydD, cynR, cynS, cynT, cynX, cyoA, cyoB, cyoC, cyoD, cyoE, cysA, cysB, cysC, cysD, cysE, cysG, cysH, cysI, cysJ, cysK, cysM, cysN, cysP, cysQ, cysS, cysT, cysU, cysW, cysX?, cysZ?, cytR, dacA, dacB, dacC, dacD, dadA, dadB, dadQ, dadX, dam, dapA, dapB, dapD, dapE, dapF, dbpA, dcd, dcm, dcp, dcrB, dctA, dctB, dcuA, dcuB, dcuC, ddIA, ddlB, ddpA, ddpB, ddpC, ddpD, ddpF, ddpX, deaD, dedA, dedD, def, degP, degQ, degS, del, deoA, deoB, deoC, deoD, deoR, dfp, dgd, dgkA, dgkR, dgoA, dgoD, dgoK, dgoR, dgoT, dgsA, dgt, dicA, dicB, dicC, dicF, dinB, dinD, dinF, dinG, dinI, dinY, dipZ, djlA, dksA, did, dmsA, dmsB, dmsC, dnaA, dnaB, dnaC, dnaE, dnaG, dnaI, dnaJ, dnaK, dnaL, dnaN, dnaQ, dnaT, dnaX, dppA, dppB, dppC, dppD, dppF, dppG, dps, dsbA, dsbB, dsbC, dsbG, dsdA, dsdC, dsdX, dsrA, dsrB, dut, dvl, dxs, ebgA, ebgB, ebgC, ebgR, ecfa, eco, ecpD, eda, edd, efp, enirA, emrB, emrD, emrE, endA, eno, entA, entB, entC, entD, entE, entF, envN envP, envQ, envR, envT, envY, envZ, epd, EppA, minigene, EppB, minigene, EppC, minigene, EppD, minigene, EppE, minigene, EppG, minigene, EppH, minigene, era, esp, evgA, evgS, exbB, exbC, exbD, expA, exuR, exuT, fabA, fabB, fabD, fabF, fabG, fabH, fabI, fabZ, fadA, fadB, fadD, fadE, fadH, fadL, fadR, farR, fatA, fbaA, fbaB, fbp, fcl, fcsA, fdhD, fdhE, fdhF, fdnG, fdnH, fdnI, fdoG, fdoH, fdoI, fdrA, fdx, feaB, feaR, fecA, fecB, fecC, fecD, fecE, feeI, fecR, feoA, feoB, fepA, fepB, fepC, fepD, fepE, fepG, fes, fexB, ffh, ffs, fhlA, fhlB, fhuA, fhuB, fhuD, fhuE, fhuF, fic, fimA, fimB, fimC, fimD, fimE, fimF, fimG, fimH, fimI, fipB, fipC, fis, fiu, fixA, fixB, fixC, fixX, fklB, fkpA, fldA, flgA, flgB, flgC, flgD, flgE, flgF, flgG, flgH, flgI, flgJ, flgK, flgL, flgM, flgN, flhA, flhB, flhc, flhD, fliA, fliC, fliD, fliE, fliF, fliG, fliH, fliI, fliJ, fliK, fliL, fliM, fliN, fliO, flip, fliQ, fliR, fliS, fliT, fliY, fliZ, flk, flu, fmt, fnr, focA, focB, folA, folC, folD, folE, folK, folP, folX, fpr, frdA, frdB, frdC, frdD, frr, fruA, fruB, fruK, fruR, fsr, ftn, ftsA, ftsE, ftsI, ftsJ, ftsK, ftsL, ftsN, ftsQ, ftsW, ftsX, ftsY, ftsZ, fucA, fuecI, fucK, fucO, fucP, fucR, fumA, fumB, fumC, fur, fusA, fusB, gabC gabD, gabP, gabT, gadA, gadB, gadR, galE, galF, galK, galM, galP, gaiR, galS, galT, galU, gapA, gapC, garA, garB, gatA, gatB, gatC, gatD, gatR, gatY, gatZ, gcd, gcl, gcpE, gcvA, gcvH, gcvP, gcvR, gcvT, gdhA, gef, ggt, gidA, gidB, gip, glcB, glcC, gleD, gIcE, glcG, gldA, glf, glgA, glgB, glgC, glgP, glgS, glgX, glk, glmM, glmS, glmU, glmX, ginA, glnB, ginD, glnE, glnG, glnH, glnK, glhL, glnP, glnQ, glnR, ginS, ginT, ginU, glnV, glnW, glnX, gloA, glpA, glpB, glpC, glpD, gipE, gipF, gipG, glpK, glpQ, gipR, glpT, glpX, gItA, gltB, gltD, gltE, gltF, gltH, gltJ, gltK, gltL, gltM, gltP, gltR, gltS, gltT, gltU, gltv, gltW, gltX, glyA, glyQ, glyS, glyT, glyU, glyv, glyW, glyX, glyY, gmd, gmk, gmm, gnd, gntK, gntP, gntR, gntS, gntT, gntU, gntV, goaG, gor, gph, gpmA, gpp, gprA, gprB, gpsA, gpt, greA, greB, groL, groS, grpE, grxA, grxB, grxC, gshA, gshB, gsk, gsp, gsp*, gst, guaA, guaB, guaC, gurB, gurC, gutM, gutQ, gyrA, gyrB, hcaB, hcaC, hcaD, hcaE, hcaF, hcaR, hcaT, hdeA, hdeB, hdeD, hdhA, helD, hemA, hemB, hemC, hemD, hemE, hemF, hemG, hemH, hemK, hemL, hemM, hemX, hemY, hepA, het, hflB, hflC, hflK, hflX, hfq, hha, hipA, hipB, hisA, hisB, hisC, hisD, hisF, hisG, hisH, hisI, hisJ, hisM, hisP, hisQ, hisR, hisS, hipA, hlyE, hmp, hns, holA, holB, holC, holD, holE, hopB, hopC, hopD, hpt, hrpA, hrpB, hrsA, hscA, hscB, hsdM, hsdR, hsdS, hslC, hslD, hslE-H, hslJ, hslK, hsIL-N, hslO-R, hslU, hslV, hslW, htgA, htpG, htpX, htrB, htrC, htrE, htrL, hupA, hupB, hyaA, hyaB, hyaC, hyaD, hyaE, hyaF, hybA, hybB, hybC, hybD, hybE, hybF, hybG, hycA, hycB, hycC, hycD, hycE, hycF, hycG, hycH, hycI, hydA, hydG, hydH, hydN, hyfA, hyfB, hyfC, hyfD, hyfE, hyfF, hyfG, hyfH, hyfI, hyfJ, hyfR, hypA, hypB, hypC, hypD, hypE, hypF, iadA, iap, ibpA, ibpB, icd, iclR, ihfA, ihfB, ileR, ileS, ileT, ileU, ileV, ileX, ileY, ilvA, ilvB, iivC, iivD, ilvE, ilvF, ilvG, ilvH, ilvI, ilvJ ilvM, ilvN, iivR, ilvU, ilvY, imp, inaA, inaR, infA, infB, infC, inm, insA(IS1), intA, isb(IS1), isfA, ispA, ispB, KanR, katE, katG, kba, kbl, kch, kdgK, kdgR, kdgT, kdpA, kdpB, kdpC, kdpD, kdpE, kdpF, kdsA, kdsB, kdtA, kdtB, kefB, kefC, kgtp, ksgA, ksgB, ksgC, ksgD, lacA, lacI, lacY, lacZ, lamB, lar, ldcC, ldhA, lepA, lepB, leuA, leuB, leuC, leuD, leuJ, leuO, leuP, leuQ, leuR, leuS, leuT, leuU, leuV, leuW, leuX, leuY, leuZ, lev, lexA, lgt, lhr, ligA, ligT, linB, lipA, lipB, lit, livF, livG, livH, livJ, livK, livM, lldD, lldP, lldR, lolA, Ion, lpcA, lpcB, lpd, lplA, lpp, lpxA, lpxB, lpxC, lpxD, lpxK, lrb, lrhA, lrp, Irs lspA, lysA, lysC, lysP, lysQ, lysR, lysS, lysT, lysU, lysV, lysW, lysX, lysY, lysZ, lytA, lytB, lyx, maa, mac, mae, mafA, mafB, malE, malF, malG, malI, malK, malM, malP, malQ, malS, malT, malX, malY, malZ, manA, manC, manX, manY, manZ, map, marA, marB, marR, mbrB, mcrA, mcrB, mcrC, mcrD, mdaB, mdh, mdoB, mdoG, mdoH, meb, melA, melB, melR, menA, menB, menC, menD, menE, menF, mepA, mesJ, metA, metB, metC, metD, metE, metF, metG, metH, metJ, metK, metL, metR, metT, metU, metV, metW, metY, metZ, mfd, mglA, mglB, mglC, mglR, mgsA, mgtA, mhpA, mhpB, mhpC, mhpD, mhpE, mhpF, mhpR, miaA, miaD, micF, minC, minD, minE, mioC, mitA, mltB, mltC, mltD, mmrA(rhlB), mng, mntA, moaA, moaB, moaC, moaD, moaE, mobA, mobB, moc, modA, modB, modC, modE, modF, moeA, moeB, mog, molR, motA, motB, mpl, mppA, mprA, mraA, mraY, mrcA, mrcB, mrdA, mrdB, mreB, mreC, mreD, mrp, mrr, msbA, msbB, mscL, msrA, msyB, mtg, mtgA, mtlA, mtlD, mtlR, mtr, mttA, mttB, mttC, mukB, mukE, mukF, mul, murA, murB, murC, murD, murE, murF, murG, murH, murI, mutG(putative), mutH, mutL, mutM, mutS, mutT, mutY, nac, nadA, nadB, nadC, nadE, nagA, nagB, nagC, nagD, nagE, nalB, nalD, nanA, nanE, nanK, nanR, nanT, napA, napB, napC, napD, napF, napG, napH, narG, narH, narI, narJ, narK, narL, narP, narQ, narU, narV, narW, narX, narY, narZ, ndh, ndk, neaB, nei, nemA, nfi, nfnA, nfnB, nfo, nfrA, nfrB, nfrD, nfsA, nhaA, nhaB, nhaR, nikA, nikB, nikC, nikD, nikE, nirB, nirC, nirD, nlpA, nlpB, nlpC, nlpD, nmpC(qsr'), non, npr, nrdA, nrdB, nrdD, nrdE, nrdF, nrdG, nrfA, nrfB, nrfC, nrfD, nrfE, nrfF, nrfG, nth, ntpA, nuoA, nuoB, nuoC, nuoE, nuoF, nuoG, nuoH, nuoI, nuoJ, nuoK, nuoL, nuoM, nuoN, nupC, nupG, nusA, nusB, nusG, nuvA, nuvC, ogrK, ogt, ompA, ompC, ompF, ompG, ompR, ompT, ompX, oppA, oppB, oppC, oppD, oppE, oppF, opr, ops, oraA, ordL, orf-23(purB, reg)orf195(nikA-reg), orn, osmB, osmC, osmE, osmY, otsA, otsB, oxyR, oxyS, pabA, pabB, pabC, pac, pal, panB, panC, panD, panF, parC, parE, pat, pbpG, pck, pcm, pcnB, pdhR, pdxA, pdxB, pdxH, pdxJ, pdxK, pdxL, pdxY, pepA, pepD, pepE, pepN, pepP, pepQ, pepT, pfkA, pfkB, pflA, pflB, pflC, pflD, pfs, pgi, pgk, pgl, pgm, pgpA, pgpB, pgsA, pheA, pheP, pheS, pheT, pheU, pheV, phnC, phnD, phnE, phnF, phnG, phnH, phnI, phnJ, phnK, phnL, phnM, phnN, phnO, phnP, phoA, phoB, phoE, phoH, phoP, phoQ, phoR, phoU, phrB, phxB, pin, pioO, pit, pldA, pldB, plsB, plsC, plsX, pmbA, pncA, pncB, pnp, pntA, pntB, pnuC, poaR, polA, polB, popD, potA, potB, potC, potD, potE, potF, potG, potH, potI, poxA, poxB, ppa, ppc, pphA, pphB, ppiA, ppiB, ppiC, ppk, pgpA, pps, ppx, pqiA, pqiB, pqqL, pqqM, prc, prfA, prfB, prfC, priA, priB, priC, prlC, prlZ, prmA, prmB, proA, proB, proC, proK, proL, proM, proP, proQ, proS, proT, proV, proW, proX, prpA, prpC, prpR, prr, prs, psd, psiF, pspA, pspB, pspC, pspE, pspF, pssA, pssR, pstA, pstB, pstC, pstS, psu, pta, pth, ptrA, ptrB, ptsG, ptsH, ptsI, ptsN, ptsP, purA, purB, purC, purD, purE, purF, purH, purK, purL, purM, purN, purP, purR, purT, purU, pus, putA, putP, pykA, pykF, pyrB, pyrC, pyrD, pyrE, pyrF, pyrG, pyrH, pyrI, qmeC, qmeD, qmeE, qor, queA, racC, racR, radA, radC, ranA, rarD, ras, rbfA, rbn, rbsA, rbsB, rbsC, rbsD, rbsK, rbsR, rcsA, rcsB, rccsC, rcsF, rdgA, rdgB, recA, recB, recC, recD, recE, recF, recG, recJ, recN, recO, recQ, recR, recT, relA, relB, relE, relF, relX, rep, rer, rfaB, rfaC, rfaD, rfaF, rfaG, rfaH, rfaI, rfaJ, rfaK, rfaL, rfaP, rfaQ, rfaS, rfaY, rfaZ, rfbA, rfbB, rfbC, rfbD, rfbX, rfc, rfe, rffA, rffC, rffD, rffE, rffG, rffH, rffM, rffT, rhaA, rhaB, rhaD, rhaR, rhaS, rhaT, rhlB, rhlE, rho, ribA, ribB, ribC, ribD, ribE, ribF, ridA, ridB, rimB, rimC, rimD, rimE, rimG, rimH, rimI, rimJ, rimK, rimL, rimM, rit, rlpA, rlpB, rluA, rluC, rluD, rmf, ma, mb, mc, md, me, rnhA, rnhB, rnk, rnpA, rnpB, rnr, rnt, rob, rorB, rpe, rph, rpiA, rpiB, rpiR, rplA, rplB, rplC, rplD, rplE, rplF, rplI, rplJ, rplK, rplL, rplM, rplN, rplO, rplP, rplQ, rplR, rplS, rplT, rplU, rplV, rplW, rplX, rplY, rpmA, rpmB, rpmC, rpmD, rpmE, rpmF, rpmG, rpmH, rpmf, rpmJ, rpoA, rpoB, rpoC, rpoD, rpoE, rpoH, rpoN, rpoS, rpoZ, rpsA, rpsB, rpsC, rpsD, rpsE, rpsF, rpsG, rpsH, rpsI, rpsJ, rpsK, rpsL, rpsM, rpsN, rpsO, rpsP, rpsQ, rpsR, rpsS, rpsT, rpsU, rrfA, rrfB, rrfC, rrfD, rrfE, rrfF, rrfG, rrfH, rrlA, rrlB, rrlC, rrlD, rrlE, rrlG, rrlH, rrmA, rrsA, rrsB, rrsC, rrsD, rrsE, rrsG, rrsH, rsd, rseA, rseB, rseC, rspA, rspB, rssA, rssB, rsuA, rtcA, rtcB, rtcR, rtn, rus(qsr'), ruvA, ruvB, ruvC, sad, sanA, sapA, sapB, sapC, sapD, sapF, sbaA, sbcB, sbcC, sbcD, sbmA, sbmC(gyrI), sbp, sdaA, sdaB, sdaC, sdhA, sdhB, sdhC, sdhD, sdiA, sds, secA, secB, secD, secE, secF, secG, secY, selA, selB, selC, selD, semA, seqA, serA, serB, serC, serR serS, serT, serU, serV, serW, serX, sfa, sfcA, sfiC, sfsA, sfsB, shiA, sipC, sipD, sir, sixA, sloB, slp, slr, slt, slyD, slyX, smp, smtA, sodA, sodB, sodC, sohA, sohB, solA, soxR, soxS, speA, speB, speC, speD, speE, speF, speG, spf, spoT, sppA, spr, srlA, srlB, srlD, srlE, srlR, srmB, srnA, ssaE, ssaG, ssaH, ssb, sseA, sseB, sspA, sspB, ssrA, ssrS, ssyA, ssyD stfZ, stkA, stkB, stkC, stkD, stpA, strC, strM, stsA, sucA, sucB, sucC, sucD, sufI, sugE, suhA, suhB, sulA, supQ, surA, surE, syd, tabC, tag, talA, talB, tanA, tanB, tap, tar, tas, tauA, tauB, tauC, tauD, tbpA, tdcA, tdcB, tdcC, tdcD, tdcE, tdcF, tdcG, tdcR, tdh, tdi tdk, tehA, tehB, tesA, tesB, tgt, thdA, thdC, thdD, thiB?, thiC, thiD, thiE, thiF, thiG, thiH, thiI, thiJ, thiK, thiL, thiM, thrA, thrB, thrC, thrS, thrT, thrU, thrV, thrW, thyA, tig, tktA, tktB, tldD, tinA, tmk, tnaA, tnaB, tnaC, tnm, tol-orf1, tol-orf2, tolA, tolB, tolC, tolD, tolE, tolI, tolJ, tolM, tolQ, toIR, tonB, topA, topB, torA, torC, torD, torR, torS, torT, tpiA, tpr, tpx, treA, treB, treC, treF, treR, trg, trkA, trkD, trkG, trkH, trmA, trmB, trmC, trmD, trmE, trmF, trmH, trmU, trnA, trpA, trpB, trpC, trpD, trpE, trpR, trpS, trpT, truA, truB, trxA, trxB, trxC, tsaA, tsf, tsmA, tsr, tsx, ttdA, ttdB, ttk, tufA, tuffB, tus, tynA, tyrA, tyrB, tyrP, tyrR, tyrS, tyrT, tyrU, tyrV, ubiA, ubiB, ubiC, ubiD, ubiE, ubiF, ubiG, ubiH, ubiX, ucpA, udk, udp, ugpA, ugpB, ugpC, ugpE, ugpQ, uhpA, uhpB, uhpC, uhpT, uidA, uidB, uidR, umuC, umuD, ung, upp, uppS, ups, uraA, usg-1, usbA, uspA, uup, uvh, uvrA, uvrB, uvrC, uvrD, uvs, uxaA, uxaB, uxaC, uxuA, uxuB, uxuR, valS, valT, valU, valV, valW, valX, valY, valZ, vsr, wrbA, xapA, xapB, xapR, xasA, xerC, xerD, xni, xseA, xseB, xthA, xylA, xylB, xylE, xylF, xylG, xylH, xylR, yccA, yhhP, yihG, yjaB, fl47, yjaD, yohF, yqiE, yrfE, zipA, zntA, znuA, znuB, znuC, zur, and zwf.
[0243] Non-limiting examples of mouse genes include: Ilr1, Ilr2, Gas10, Tnp1, Inhbb, Inha, Creb1, Mpmv34, Acrd, Acrg, Il110, Otf1, Rab11b-r, Abl1, ald, Amh-rs1, Bc12B, Cchlla3, Ccnb1-rs2, Gpcr16, Htr5b, Idd5, Igfbp2, Igfbp5, I18rb, Kras2-rs1, Mov7, Mpmv6, Mpmv16, Mpmv22, Mpmv25, Mpmv29, Mpmv42, Mtv7, Mtv27, Mtv39, Oprk1, Otf3-rs1, Otf8, Otf11-rs1, Ptgs2, Ren1, Ren2, Ril3, Sxv, Taz4-rs1, Tgfb2, Wnt6, Xmmv6, Xmmv9, Xmmv36, Xmmv61, Xmmv74, Xmv21, Xmv32, Xmv41, I12ra, Ab1, Mpmv3, Rap1a-ps2, anx, Mpmv43, Ryr3, Ras12-4, Adra2b, Avp, Glvr1, Il1a, Il1b, Mpmv28, Oxt, Pcsk2, a, Xmv10, Tcf4, Acra, Acra4, Ak1, Bdnf, bs, Cyct, Cyp24, Dbh, Fshb, Gcg, Gdf5, Gnas, Gper8, Grin1, Hcs4, Hior2, Hsp84-2, Idd12, Ilrn, Jund2, Kras3, Mc3r, Mpmv14, Mtv40, Mxil-rs1, Otf3-rs2, Ptgs1, Ptpra, Rapsn, Src, Svp1, Svp3, Tcf3b, Wt1, Xmmv71, Xmv48, Ccna, Fgf2, Fth-rs1, Csfm, Mov10, Egf, Acrb2, Cap1, Crh, Fim3, Fps11, Glut2, Gper2, Gria2, Hsd3b-1, Hsd3b-2, Hsd3b-3, Hsd3b-4, Hsp86-ps2, Idd3, I12, I17, Mpvmv9, Mpmv20, Mtv4.8, Ngfb, Npra, Nras, Nras, Ntrk, Otf3-rs3, Otf3-rs4, Rap1a, Tshb, Xmmv22, Xmmv65, Mos, Ras12-7, Lyr, Ifa, Ifb, Jun, azh, db, Ipp, Mp1, Do1, Ak2, Ccnb1-rs4, Cdc211, Cga, Fgr, Foc1, Fps12, Gabrr1, Gabrr2, Gdf6, Glut1, Gnb1, Gpcr14, Grb2-ps, Grik3, Grik5, Hsp86-1ps4, Htr1da, Htr1db, Idd9, Ifa1, Ifa2, Ifa3, Ifa4, Ifa5, Ifa6, Ifa7, Ifa8, Ifa9, Ifa10, Lap18, Lmyc1, Mpmv19, Mpmv44, Mtv13, Mtv14, Mtv17, Nppb, Otf6, Otf7, Ri12, Ski, Tnfr2, Wnt4, Xmmv8, Xmmv23, Xmmv62, Xmv1, Xmv2, Xmv8, Xmv9, Xmv14, Xmv44, Xpa, Tec, Fgf5, Nos1, Tcf1, Epo, Gnb2, Flt1, Flt3, Ache, Adra2c, Adrbk2, Afp, Alb1, Ccnb1-rs1, Clock, Cyp3, Cyp3a11, Cyp3a13, Drd1b, Drd5, Fgfr3, Flk1, Gc, Gnrhr, Gpcr1, Hcs5, Hnf1, Htr5a, I15r, I16, Kit, Ltrm3, Mgsa, Mpmv7, Mpmv13, Mpmv23, Mtv32, Mtv41, Pdgfa, Pdgfra, Por, Txk, Xmmv3, Xmmv5, Xmmv52, Xmv17, Xmv28, Xmv34, Xmv38, Xmv45, Zp3, Trh, Raf1, Fth-rs2, Ntf3, Kras2, Pthlh, Mov1, Alox5, Braf2, Cftr, Egr4, Fps110, Fgf6, Gdf3, Ghrfr, Glut3, Grin2a, Hior3, Hoxa10, hop, Ica1, I15r, Int41, Itpr1, Krag, Mad, Met, Mi, Mtv8, Mtv23, Mtv29, Mtv33, Mtv34, Nkna, Npy, ob, Otf3-rs5, Tgfa, Tnfr1, Wnt2, Wnt5B, Wnt7A, Xmmv27, Xmv24, Xmv61, Fosb, Ryr1, Ngfa, Ufo, Xrcc1, Abpa, Abpga, Gabra4, Gas2, Acra1, Ccnb1-rs7, Egfbp3, Xmv30, Zp2, Fes, Pcsk3, Calc, Ccnb1-rs10, Pth, Ad, Bc13, Cea, Cea2, Cea3, Cea4, Cea5, Cea6, Cebp, Dm9, Dm15, Drd4, Egfbp1, Egfbp2, Ercc2, Fgf3, Fgfr2, Gabra5, Gabrb3, Gtx, Hcs1, Igflr, Igf2, I14r, Ins2, Int40, Lhb, Mpmv1, Mtv1, Mtv35, Ngfg, Ntf5, Otf2, 2, Pkcc, Ras14, Rras, Ryr, Svp2, Tcf3g, Tgfb1, tub, Xmmv31, Xmmv35, Xmmv73, Xmv33, Xmv53, Taz83, Adrb3, Junb, Jund1, Me1, Gper19-rs2, Agt, Cadp, Ccnb1-rs9, E, Fgfr1, Gas6, Gnb-rs1, Hcs2, Insr, Maf, Mov34, Mpmv21, Mpmv41, Mtv21, Mtnr1a, Plat, Ras15-2, Ras16, Sntb2, Xmmv29, Xmv12, Xmv26, Xmv62, Epor, Gpcr13, Otf11, Pthr, Acra3, Acra5, Acrb4, Camk1, Cdc25Mm, Crbp, Crbp2, Csk, Cyp11a, Cyp19, Drd2, Ets1, Fli1, Gnai2, Gnat1, Gper6, Gria4, Hgf1, Hior1, Hpx, Hsp86-1ps3, Hst2, Idd2, I11bc, Lag-rs1, Lap18-rs1, M11, Mpmv27, Penk, Pgr, Ras12-2, Tp11, Trf, Xmmv2, Xmmv67, Xmv15, Xmv16, Xmv25, Xmv60, Mgf, Amh, Braf, Cdc2a, Dmd1, Estr, Fps13, Fps14, Fps15, Gli, Gper17, Grik2, Ifgr, Igf1, Mpmv5, Mpmv12, Mpmv40, Myb, Oprm, Pg, Pmch, Ros1, Xmv31, Xmv51, Xmv54, Camk2b, Egfr, Int6, Lif, Mtv44, Ews, Csfgm, Flt4, I13, I14, I15, Irf1, Gria1, Glut4, Crhr, Csfg, Mov9, Xmv20, Acrb, Mpmv4, Mpmv15, Ngfr, Nos2, Rara, Taz4, Tcf2, Xmv42, Mtv3, Adra1, Crko, df, Erbb2, Gabra1, Gabra6, Gabrg2, Gh, Glra1, Grb2, Hnf1b, Hsp86-ps1, Idd4, Igfbp1, Igfbp3, I113, Int4, Mpmv2, Mpmv8, Mpmv18, Mtv45, nu, Pkca, Rab1, Re1, Shbg, Tcf7, Thra, Tnz1, Trp53, Wnt3, Wnt3A, Xmv4, Xmv5, Xmv47, Xmv49, Xmv63, Akt, Amh-rs4, Ccs1, Fps16, Fos, Gdf7, Hcs3, Hsp70-2, Hsp84-3, Hsp86-1, hyt, Ltrm1, Max, Mpmv11, Mpmv24, Mtv9, Mtv30, Pomc1, Tcf3a, Tda2, Tgfb3, Tpo, Tshr, Xmmv21, Xmmv25, Xmmv34, Xmmv50, Gli3, Xmv55, Ryr2, Inhba, Gas1, Pcsk1, Amh-rs2, Ccnb1-rs6, Ccnb1-rs13, Crhpb, Dat1, Drd1a, Fgfr4, Fps17, Fim1, Gper15, Gper18, Hbvi, Hilda, Htr1a, Idd11, I19, Ltrm4, Mak, mes, P11, P12, Pr1, Ra1, Rasa, Srd5a1, Tpbp, Xmv13, Xmv27, Rarb, Rbp3, Htr2, Rb1, Acra2, Camkg, Cch11a2, Ccnb1-rs5, Ccnb1-rs12, Gnrh, Mtv11, Nras-ps, Otf3-rs6, Plau, Ptprg, Trp53-ps, Wnt5A, Xmv19, Ghr, I17r, Lifr, Mlvi2, Pr1r, Myc, Ril1, cog, Amh-rs7, I12rb, Pdgfb, Acr, CP2, Rarg, Sp1-1, Wnt1, Afr1, Atf4, Bzrp, Ccnb1-rs11, Cyp11b, I13rb1, I13rb2, Ins3, Itga, Mlvi1, Mlvi3, Mtv36, Pdgfec, Svp5, Tef, Trhr, Wnt7B, Xmmv55, Xmmv72, Xmv37, Tnp2, Ets2, Casr, Chuck-rs1, din, Drd3, Erg, G22p1, Gap43, Gas4, Grik1, Htr1f, Ifgt, Int53, Ltrm2, Mpmv17, Mtv6, Mtvr1, Pit1, Xmv3, Xmv35, Xmv50, Igf2r, Mas, Tcd3, Glp1r, Idd1, Tla, Aeg1, Ccnb1-rs3, Cdc2b, Csi, Cyp21, Cyp21-ps1, Fps18, Gna-rs1, Gper19-rs1, Grr1, Grr2, Hom1, Hsc70t, Hsp70, Hsp70-1, Hsp70-3, Hsp84-1, Hst1, Hst4, Hst5, Hst6, Hye, Int3, Itpr3, Lap18-rs2, Otf3, Ptprs, Rab11b, Ras12-1, Ras12-3, Ras13, Rrs, Rxrb, Tas, Tcd1, Tcd2, Tera1, Tla-rs, Tnfa, Tnfb, Tpx1, Tpx2, Xmmv15, Xmv36, Xmv57, Csfmr, Pdgfrb, Adrb2, Apc, Camk2a, Camk4, Dcc, Fgf1, Gna1, Gper7, Gr11, Grp, Hsp74, Mcc, Mtv2, Mtv38, Ptpn2, Tp12, Xmv22, Xmv23, Xmv29, Fth, Csfgmra, Mxi1, Adra2a, Adrb1, Adrbk1, Chuck, Cyp17, Gna14, Gnb-ps1, Hcs6, Htr7, Ide, Ins1, Lpc1, Pomc2, Seao, Tlx1, Xmmv42, Xmv18, Tcfe3, Araf, Avpr2, mdx, Ar, Zfx, Otf9, Ccg1, Ccnb1-rs8, Fps19, Gabra3, Glra2, Glra4, Gria3, Grpr, Hsp74-ps1, Hst3, Htr1c, I12rg, Mov14, Mov15, Mtv28, Otf3-rs8, Sts, Sxa, Sxr, Xta, Tdy, Hya, Zfy1, Zfy2, Mov15, Mov24, Mtv31, Mtv42, Sdma, Spy, Sts, Sxa, Sxr, XmmvY, Xmv7, Xmv11, and Xmv40.
[0244] Non-limiting examples of Phaseolus vulgaris genes include: Acc, ace, Adk, Am, Amv-1, Amv-2, Ane, aph, Arc, Are, arg, Ar1 (Arc), asp, B, bc-u, bc-1.sup.1, bc-1.sup.2, bc-2.sup.1, bc-2.sup.2, bc-3, Bcm, Beg, Bip, blu, Bpm, Bsm, By-1, By-2, C, C/c, c.sup.cr, C.sup.cir, C.sup.ma (M, R.sup.ma), C.sup.r, C.sup.res, C.sup.rho, C.sup.st, [C.sup.st R Acc] (Aeq), c.sup.u (inh, i.sub.e), [c.sup.v Prp.sup.i] (Prp, c.sup.ui, Nud), [c.sup.uprp.sup.st] (prp.sup.st), [C Prp] (Prp), c.sup.v, [C R] (R), [C r] (r), Ca, Cam, Cav, cc, ch1, c1, cm1, Co-1 (A), Co-2 (Are), Co-3 (Mexique 1), Co-3.sup.2, Co-4 (Mexique 2), Co-5 (Mexique 3), Co-6, Co-7, cr-1 cr-2, cry, cs, Ct, ctv-1 ctv-2, cyv (by-3), D (Can, Ins), Da, Db, def, dgs (g1, le), dia, Diap-1, Diap-2, diff, dis, D1-1 D1-2 (DL.sub.1 DL.sub.2), do, ds (te), dt-1.sup.a dt-2.sup.a, dt-1.sup.b dt-2.sup.b, dw-1 dw-2, Ea Eb, ers (restr), ers-2, Est-1, Est-2, exp, F, Fa, fast, Fb Fc, fa fb fc, Fcr, Fcr-2, fd, Fe-1 Fe-2, Fin (in), Fop-1, Fop-2, Fr, Fr-2, G (Flav, Ca, Och), Ga, gas, glb, Gpi-c1, Gr, Hb1 (L.sub.HB-1), Hbnc (SC.sub.HB-1), Hbp (PD.sub.HB-1), hmb, Hss, Hsw, Ht-1 Ht-2 (L-1 L-2), I, Ia Ib, ian-1 ian-2 (ia), lbd, ico, Igr (Ih), ilo, ip, iter, iv, iw, J (Sh), Ke, L, la, Lan, Ld, Lds (Ds), Lec, Li (L), lo, Ir-1 lr-2, mar, Me, Mel (Me), Mel-2 (Me-2), mel-3 (me-3), Mf, mi, mia, Mic (Mip), miv, Mrf, Mrf.sup.2, mrf, ms-1, Mue, mu mutator, Nag, Nd-1 Nd-2 (D-1 D-2), nie, and (sym-1), nnd-2, No, nts (nod), Nudus, ol, P, p.sup.gri (Gri, v.sup.Pal), pa, pc, pg (pa.sub.1), Pha, Pmv, ppd (neu), Pr, pre (pc), Prx, punt, ram, Rbcs (rbcS), rf-1, rf-2, rf-3, rfi (i), Rfs (m), Rk, rk, rk.sup.d (lin), rn-1 rn-2 (r r), rnd, Ro, Sal, sb, sb.sup.ms, sb-2, sb-3, si1, Skdh, s1, Smv, St, Sur, sw-1 sw-2, T, t (z-1), Th-1 Th-2, Tm, To, Tor (T), Tr, tri, try, Ts, tw, uni, Uni-2, uni.sup.nde, uni.sup.nie, Ur-1, Ur-2, Ur-2.sup.2, Ur-3 (Ur-3, Ur-4), Ur-3.sup.2, Ur-4, (Up-2, Ur-C), Ur-5, (B-190), Ur-6 (Ur.sub.a, Ur-G), Ur-7 (R.sub.B11), Ur-8 (Up-1), Ur-9 (Ur.sub.p), us, V (B1), v.sup.lae (Cor), v, var, vi (vir.sub.f), wb, Wmv, X.sup.su, y, and Z.
[0245] Non-limiting examples of Saccharomyces cerevisiae genes include: PRE3, PUP1, PUP3, PRE2, PRE10, PRE1, PRE8, SCL1, PUP2, PRE5, PRE7, PRE4, RPT2, RPT3, RPN3, RPN11, RPN12, RPT6, RPN1, RPN2, RPT1, RPT5, RPT4, SKI6, RRP4, DIS3, TSC10, RAT1, GND1, EXO70, ERG10, ACC1, RPP0, ACT1, ARP100, ARP3, PAN1, ARP2, ARP4, ARP9, SPE2, CYR1, ALA1, TPS1, TUB1, ABF1, DED81, NIP1, YHC1, SNU71, ATM1, MAK5, ROK1, DED1, SPB4, AUR1, PSE1, ALG1, TUB2, BPL1, MSL5, ERG24, ERG26, ERG25, CMD1, HCA4, SHE9, SHE10, CAK1, PIS1, CHO1, CDS1, ESR1, NUD1, CDC47, CDC13, CDC37, CDC1, CDC4, CDC20, CDC6, CDC46, CDC3, KAR1, BBP1, HRP1, CCT2, CCT3, HSP10, SMC1, SMC2, CHC1, CFT2, CLP1, COP1, SEC26, SEC27, RET2, SEC21, COF1, CCT4, CCT1, CCT6, SEC24, SEC7, PCF11, RNA15, RNA14, FIP1, YSH1, TFB4, TSM1, APC2, APC5, SEC31, TAF47, TAP42, MPP10, CDC53, CKS1, CDC28, KIN28, CNS1, ERG11, DBP10, DBP8, PRO3, DYS1, ALR1, TID3, DNA2, SSL2, RAD3, RFA3, RFA2, RFA1, RFC4, RFC5, RFC3, RFC2, RFC1, TOP2, RAP1, RPC25, PRI2, PRI1, POL1, POL12, HUS2, CDC2, POL2, DPB2, RPB10, RPA135, RPA190, RPA43, RPB8, RPO26, RPB5, RPC40, RPC19, SRB7, SRB4, RGR1, RPB11, SRB6, RPB2, RPB7, RPO21, RET1, RPO31, RPC31, RPC34, RPC53, RPC82, RPB12, RPB3, DPM1, DIP2, RNT1, CDC8, CDC14, DUT1, UBA2, UBA1, UBC9, CDC34, ENP1, ERD2, SSS1, SEC61, SEC63, SEC62, GNA1, GPI8, DAM1, DUO1, IRR1, PRP3, TIM9, HSH49, SUP35, EXM2, MEX67, ERG9, ERG20, FAS2, FAS1, NOP1, FAD1, AOS1, FBA1, NCB2, BRN1, TUB4, GDI1, GOG5, SRM1, CDC25, SPT16, YIF2, BET4, CDC43, MRS6, BET2, PRO1, GLN1, GLN4, GRS1, YIP1, FOL2, GPA1, CDC42, SAR1, YPT1, SEC4, GSP1, TEM1, RHO1, CDC24, RNA1, GUK1, VMA16, PMA1, HKR1, SIS1, MGE1, HSP60, HSF1, HAS1, MOT3, HTS1, ESA1, HSL7, HOM6, RIB7, SLY1, CSL4, PUR5, CSE1, IPP1, MDM1, USO1, SOF1, MAK11, LAS1, TEL2, DPB11, SGD1, FAL1, MTR3, MTR4, SPP2, SIK1, RRP7, POP4, RRP1, POP3, BFR2, CDC5, NRD1, MET30, MCM6, RRP46, SAS10, SCC2, ECO1, PRP43, BET3, BET5, STN1, NFS1, IDI1, SRP1, KAP95, CBF2, SKP1, CEP3, CTF13, ERG7, KRS1, PSA1, PMI40, ALG2, SSF1, MED7, RSC4, CDC54, MCM2, AFG2, ERG12, MVD1, CDC48, MHP1, ERV1, SSC1, TIM44, TIM17, TIM23, TOM22, TOM40, MAS1, MCD1, MMC1, STU1, JAC1, ABD1, CEG1, PAB1, MTR2, SEC16, ROT1, INO1, MLC1, MYO2, GPI2, SPT14, NAT2, NMT1, TRM1, NCP1, NBP1, ACF2, SPP41, NUT2, LCP5, PRP19, NMD3, RFT1, NNF1, NDC1, CRM1, KAR2, NIP29, NAB2, NIC96, NUP145, NUP49, NUP57, NUP159, NSP1, NUP82, CDC39, NPL4, POP7, NTF2, MAK16, NPL3, NOP2, NOP4, NHP2, NOP10, GAR1, NBP35, WBP1, STT3, SWP1, OST2, OST1, ORC1, ORC6, ORC5, ORC4, ORC3, RRR1, SAT2, PWP2, PEX3, TOR2, PIK1, SEC14, STT4, MSS4, PCM1, GPM1, SEC53, ERG8, YPD1, PAP1, NAB3, RRN7, SEN1, CFT1, PRP11, PRP21, PRP39, PRP24, PRP9, SLU7, PRP28, PRP31, IFH1, PTA1, SUB2, FMI1, MAS2, ESS1, PFY1, POL30, POP1, PDI1, RAM2, CDC7, SMP3, CDC15, YTH1, QRI2, YAE1, SFI1, SEC1, BET1, SEC6, SEC13, SEC2, SEC8, CBF5, CDC19, YRB1, RHC18, DBF4, SDS22, MCM3, CEF1, ALG11, GAA1, MOB1, NIP7, TIP20, SEC5, SEC10, GPI10, RRP3, CDC45, DIB1, MIF2, HOP2, PBN1, NOP5, RPP1, POP5, POP8, POP6, ERO1, MPT1, DNA43, ESP1, SMC3, LST8, STS1, RPM2, RNR1, RNR2, RNR4, RPS20, RPL25, RPL3, RPL30, RPL32, RPL37A, RPL43A, RPL5, RPL10, RPS3, CET1, YRA1, SNM1, GLE1, DBP5, DRS1, DBP6, BRR2, RRN3, RRN6, RRN11, MED6, PRP16, RPR2, DIM1, RRP43, RRP42, RRP45, SEC20, BOS1, CDC12, GLC7, PKC1, IPL1, SGV1, NRK1, RAD53, LCB2, LCB1, MPS1, SES1, SPC3, SEC11, RIO1, ARP7, NEO1, YJU2, POB3, ARH1, IQG1, HRT1, HYM1, MAK21, FUN20, FUN9, NBN1, STB5, YIF1, SMX4, YKT6, SFT1, SMD1, PRP6, LSM2, NUF1, SPC97, SPC42, SPC98, CDC31, SPC19, SPC25, SPC34, SPC24, NUF2, PRP40, MCD4, ERG1, SMC4, CSE4, KRR1, SME1, TRA1, RLP7, SCH9, SMD3, SNP2, SSF2, SPC72, CDC27, CDC23, CDC16, APC1, APC11, APC4, ARC19, RPN6, RPN5, RSC6, RSC8, STH1, SFH1, TIM12, TIM22, TIM10, SQT1, SLS1, JSN1, STU2, SCD5, SSU72, ASM4, SED5, UFE1, SYF1, SYF2, CCT5, TBF1, TOA2, TOA1, SUA7, TAF90, TAF61, TAF25, TAF60, TAF17, TAF145, TAF19, TAF40, TAF67, TFA2, TFA1, FCP1, TFG1, TFG2, TFB1, CCL1, SSL1, TFB3, TFB2, PZF1, BRF1, TFC5, TFC4, TFC3, TFC7, TFC6, TFC1, SPT15, THI80, THS1, SPT6, SPT5, ROX3, REB1, MCM1, MED4, MOT1, MED8, EFB1, YEF3, SUI1, CDC95, TIF11, SUI3, GCD11, SUI2, GCD6, GCD7, GCD2, GCD1, RPG1, GCD10, PRT1, TIF34, CDC33, TIF5, SUP45, GCD14, TIM54, SEC17, TPT1, TRL1, CCA1, SEN54, SEN2, SEN15, SEN34, WRS1, SLN1, TYS1, SNU56, PRP42, CUS1, PRP4, PRP8, SNU114, USS1, UFD1, SMT3, RSP5, QRI1, ALG7, UGP1, VTI1, VAS1, SEC18, CTR86, and ZPR1.
[0246] 2. Viruses
[0247] The microorganisms provided herein include viruses. Such viruses typically have one or more of the microorganism characteristics provided herein. For example, viruses provided herein can have attenuated pathogenicity, reduced toxicity, preferential accumulation in immunoprivileged cells and tissues, such as tumor, ability to activate an immune response against tumor cells, immunogenic, replication competent, and are able to express exogenous proteins, and combinations thereof. In some embodiments, the viruses have an ability to activate an immune response against tumor cells without aggressively killing the tumor cells.
[0248] The viruses provided herein can be cytoplasmic viruses, such as poxviruses, or can be nuclear viruses such as adenoviruses. The viruses provided herein can have as part of their life cycle lysis of the host cell's plasma membrane. Alternatively, the viruses provided herein can have as part of their life cycle exit of the host cell by non-lytic pathways such as budding or exocytosis. The viruses provided herein can cause a host organism to develop an immune response to virus-infected tumor cells as a result of lysis or apoptosis induced as part of the viral life cycle. The viruses provided herein also can be genetically engineered to cause a host organism to develop an immune response to virus-infected tumor cells as a result of lysis or apoptosis, regardless of whether or not lysis or apoptosis is induced as part of the viral life cycle. In some embodiments, the viruses provided herein can cause the host organism to mount an immune response against tumor cells without lysing or causing cell death of the tumor cells.
[0249] One skilled in the art can select from any of a variety of viruses, according to a variety of factors, including, but not limited to, the intended use of the virus (e.g., exogenous protein production, antibody production or tumor therapy), the host organism, and the type of tumor.
[0250] a. Cytoplasmic Viruses
[0251] The viruses provided herein can be cytoplasmic viruses, where the life cycle of the virus does not require entry of viral nucleic acid molecules in to the nucleus of the host cell. A variety of cytoplasmic viruses are known, including, but not limited to, pox viruses, African swine flu family viruses, and various RNA viruses such as picorna viruses, calici viruses, toga viruses, corona viruses and rhabdo viruses. In some embodiments, viral nucleic acid molecules do not enter the host cell nucleus throughout the viral life cycle. In other embodiments, the viral life cycle can be performed without use of host cell nuclear proteins. In other embodiments, the virulence or pathogenicity of the virus can be modulated by modulating the activity of one or more viral proteins involved in viral replication.
[0252] i. Poxviruses
[0253] In one embodiment, the virus provided herein is selected from the pox virus family. Pox viruses include Chordopoxvirinae such as orthopoxvirus, parapoxvirus, avipoxvirus, capripoxvirus, leporipoxvirus, suipoxvirus, molluscipoxvirus and yatapoxvirus, as well as Entomopoxvirinae such as entomopoxvirus A, entomopoxvirus B, and entomopoxvirus A. Chordopoxvirinae are vertebrate poxviruses and have similar antigenicities, morphologies and host ranges; thus, any of a variety of such poxviruses can be used herein. One skilled in the art can select a particular genera or individual chordopoxvirinae according to the known properties of the genera or individual virus, and according to the selected characteristics of the virus (e.g., pathogenicity, ability to elicit and immune response, preferential tumor localization), the intended use of the virus, the tumor type and the host organism. Exemplary chordopoxvirinae genera are orthopoxvirus and avipoxvirus.
[0254] Avipoxviruses are known to infect a variety of different birds and have been administered to humans. Exemplary avipoxviruses include canarypox, fowlpox, juncopox, mynahpox, pigeonpox, psittacinepox, quailpox, peacockpox, penguinpox, sparrowpox, starlingpox, and turkeypox viruses.
[0255] Orthopoxviruses are known to infect a variety of different mammals including rodents, domesticated animals, primates and humans. Several orthopoxviruses have a broad host range, while others have narrower host range. Exemplary orthopoxviruses include buffalopox, camelpox, cowpox, ectromelia, monkeypox, raccoon pox, skunk pox, tatera pox, uasin gishu, vaccinia, variola and volepox viruses. In some embodiments, the orthopoxvirus selected can be an orthopoxvirus known to infect humans, such as cowpox, monkeypox, vaccinia or variola virus. Optionally, the orthopoxvirus known to infect humans can be selected from the group of orthopoxviruses with a broad host range, such as cowpox, monkeypox, or vaccinia virus.
[0256] a. Vaccinia Virus
[0257] One exemplary orthopoxvirus is vaccinia virus. A variety of vaccinia virus strains are available, including Western Reserve (WR), Copenhagen, Tashkent, Tian Tan, Lister, Wyeth, IHD-J, and IHD-W, Brighton, Ankara, MVA, Dairen I, L-IPV, LC16M8, LC16MO, LIVP, WR 65-16, Connaught, New York City Board of Health. Exemplary vaccinia viruses are Lister or LIVP vaccinia viruses. Any known vaccinia virus, or modifications thereof that correspond to those provided herein or known to those of skill in the art to reduce toxicity of a vaccinia virus. Generally, however, the mutation will be a multiple mutant and the virus will be further selected to reduce toxicity.
[0258] The linear dsDNA viral genome of vaccinia virus is approximately 200 kb in size, encoding a total of approximately 200 potential genes. Viral gene expression can be divided into three stages. In the early stage, gene expression is mainly for viral replication, and for defense against the host's immune system. In the intermediate stage, genes not available for expression in the early stage can be expressed, including late stage transactivators. In the late stage, active transcription is mainly for viral structural components for building mature viruses.
[0259] Vaccinia virus possesses a variety of features for use in cancer gene therapy and vaccination. It has a broad host and cell type range. Vaccinia is a cytoplasmic virus, thus, it does not insert its genome into the host genome during its life cycle. Unlike many other viruses that require the host's transcription machinery, vaccinia virus can support its own gene expression in the host cell cytoplasm using enzymes encoded in the viral genome. The vaccinia virus genome has a large carrying capacity for foreign genes, where up to 25 kb of exogenous DNA fragments (approximately 12% of the vaccinia genome size) can be inserted. The genomes of several of the vaccinia strains have been completely sequenced, and many essential and nonessential genes identified. Due to high sequence homology among different strains, genomic information from one vaccinia strain can be used for designing and generating modified viruses in other strains. Finally, the techniques for production of modified vaccinia strains by genetic engineering are well established (Moss, Curr. Opin. Genet. Dev. 3 (1993), 86-90; Broder and Earl, Mol. Biotechnol. 13 (1999), 223-245; Timiryasova et al., Biotechniques 31 (2001), 534-540).
[0260] Historically, vaccinia virus was used to immunize against smallpox infection. More recently, modified vaccinia viruses are being developed as vaccines to combat a variety of diseases. Attenuated vaccinia virus can trigger a cell-mediated immune response. Strategies such as prime/boost vaccination, vaccination with nonreplicating vaccinia virus or a combination of these strategies, have shown promising results for the development of safe and effective vaccination protocols. Mutant vaccinia viruses from previous studies exhibit a variety of shortcomings, including a lack of efficient delivery of the viral vehicle to the desired tissue only (e.g., specific accumulation in a tumors), a lack of safety because of possible serious complications (e.g., in young children, eczema vaccinatum and encephalitis, and in adults disseminated or progressive vaccinia may result if the individual is severely immunodeficient).
[0261] b. Modified Vaccinia Viruses
[0262] Provided herein are vaccinia viruses with insertions, mutations or deletions, as described more generally elsewhere herein. The vaccinia viruses are modified or selected to have low toxicity and to accumulate in the target tissue. Exemplary of such viruses are those from the LIVP strain.
[0263] Exemplary insertions, mutations or deletions are those that result in an attenuated vaccinia virus relative to the wild type strain. For example, vaccinia virus insertions, mutations or deletions can decrease pathogenicity of the vaccinia virus, for example, by reducing the toxicity, reducing the infectivity, reducing the ability to replicate, or reducing the number of non-tumor organs or tissues to which the vaccinia virus can accumulate. Other exemplary insertions, mutations or deletions include, but are not limited to, those that increase antigenicity of the microorganism, those that permit detection or imaging, those that increase toxicity of the microorganism (optionally, controlled by an inducible promoter). For example, modifications can be made in genes that are involved in nucleotide metabolism, host interactions and virus formation. Any of a variety of insertions, mutations or deletions of the vaccinia virus known in the art can be used herein, including insertions, mutations or deletions of: the thymidine kinase (TK) gene, the hemagglutinin (HA) gene, the VGF gene (as taught in U.S. Pat. Pub. No. 20030031681); a hemorrhagic region or an A type inclusion body region (as taught in U.S. Pat. No. 6,596,279); Hind III F, F13L, or Hind III M (as taught in U.S. Pat. No. 6,548,068); A33R, A34R, A36R or B5R genes (see, e.g., Katz et al., J. Virology 77:12266-12275 (2003)); SalF7L (see, e.g., Moore et al., EMBO J. 1992 11:1973-1980); N1L (see, e.g., Kotwal et al., Virology 1989 171:579-587); M1 lambda (see, e.g., Child et al., Virology. 1990 174:625-629); HR, HindIII-MK, HindIII-MKF, HindIII-CNM, RR, or BamF (see, e.g., Lee et al., J Virol. 1992 66:2617-2630); or C21L (see, e.g., Isaacs et al., Proc Natl Acad Sci USA. 1992 89:628-632).
[0264] c. The F3 Gene
[0265] In addition to the mutations known in the art, the vaccinia viruses provided herein can have an insertion, mutation or deletion of the F3 gene (SEQ ID No: 1; an exemplary F3 gene is provided in GenBank Accession No. M57977, which contains the nucleotide and predicted amino acid sequences for LIVP strain F3; see also Mikryukov et al., Biotekhnologiya 4:442-449 (1988)). For example, the F3 gene has been modified at the unique single NotI restriction site located within the F3 gene at position 35 or at position 1475 inside of the HindIII-F fragment of vaccinia virus DNA strain LIVP (Mikryukov et al., Biotekhnologiya 4 (1988), 442-449) by insertion of a foreign DNA sequence into the NotI digested virus DNA. As provided herein, an insertion of a nucleic acid molecule, such as one containing lacZ, into the NotI site of the F3 gene of the LIVP strain (nucleotides 1473-1480 in M57977, or nucleotides 33-40 of SEQ ID NO: 1) can result in decreased accumulation of vaccinia viruses in non-tumorous organs of nude mice, including brain and heart, relative to wild type vaccinia virus. Thus for use in the methods provided herein, vaccinia viruses can contain an insertion, mutation or deletion of the F3 gene or a mutation of a corresponding locus. For example, as provided herein, F3-interrupted modified LIVP vaccinia virus can selectively replicate in tumor cells in vivo. Therefore, modified vaccinia viruses (e.g., modified strain LIVP) with the interrupted F3 gene can be used in the methods provided herein, such as methods of tumor-directed gene therapy and for detection of tumors and metastases.
[0266] Thus, provided herein are vaccinia viruses having a modification of the F3 gene. For example, the vaccinia viruses provided herein can contain an insertion of foreign DNA into the F3 gene. An exemplary insertion of foreign DNA is an insertion at a site equivalent to the NotI site of the F3 gene in vaccinia strain LIVP, or at position 35 of SEQ ID NO:1. An F3-modified vaccinia virus provided herein can colonize in tumors specifically, and therefore, can be used for tumor-specific therapeutic gene delivery. A GenBank data analysis with BLAST (Basic Local Alignment Search Tool) on nucleotide sequences of different strains of vaccinia virus was performed. Based on this analysis, it was found that in vaccinia virus strain Copenhagen (Goebel et al., Virology 179 (1990), 247-266) the NotI restriction site is located between two open reading frames (ORF) encoding F14L and F15L genes. Therefore, insertion of foreign genes into NotI site of the VV genome strain Copenhagen will not interrupt any vital genes. In VV strain LIVP, the NotI restriction site is located in the ORF encoding the F3 gene with unknown function (Mikryukov et al., Biotekhnologiya 4 (1988), 442-449). Thus, the insertion of foreign genes into the NotI site of the F3 gene interrupted the F3 gene. The ability to modify the F3 gene suggests that it may have a nonessential role for virus replication. Although the F3 gene is likely nonessential for virus replication, the results of the animal experiments suggest that interruption of the F3 gene is correlated with decreased viral virulence, the inability to replicate in brain or ovary, and the ability to replicate preferentially in tumor tissue.
[0267] The F3 gene is conserved in a variety of different vaccinia virus strains, including WR (nucleotides 42238-42387 of GenBank Accession No. AY243312.1, Ankara (nucleotides 37155-37304 of GenBank Accession No. U94848.1), Tian Tan (nucleotides 41808-41954 of GenBank Accession No. AF095689), Acambis 3000 (nucleotides 31365-31514 of GenBank Accession No. AY603355.1) and Copenhagen (nucleotides 45368-45517 of GenBank Accession No. M35027.1) strains. The F3 gene also is conserved in the larger family of poxviruses, particularly among orthopoxviruses such as cowpox (nucleotides 58498-58647 of GenBank Accession No. X94355.2), rabbitpox (nucleotides 46969-47118 of GenBank Accession No. AY484669.1), camelpox (nucleotides 43331-43480 of GenBank Accession No. AY009089.1), ectromelia (nucleotides 51008-51157 of GenBank Accession No. AF012825.2), monkeypox (nucleotides 42515-42660 of GenBank Accession No. AF380138.1), and variola viruses (nucleotides 33100-33249 of GenBank Accession No. X69198.1). Accordingly, also provided are modifications of the equivalent of the F3 gene in poxviruses, such as orthopoxviruses including a variety of vaccinia virus strains. One skilled in the art can identify the location of the equivalent F3 gene in a variety of poxviruses, orthopoxviruses and vaccinia viruses. For example, an equivalent of the F3 gene in poxviruses, orthopoxviruses and vaccinia viruses can include a gene that contains at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence of the F3 gene in SEQ ID NO:1. In another example, an equivalent of the F3 gene in poxviruses, orthopoxviruses and vaccinia viruses can include a gene that contains at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of F3 in SEQ ID NO:2. In another example, the equivalent to the F3 gene in LIVP can be determined by its structural location in the viral genome: the F3 gene is located on the HindIII-F fragment of vaccinia virus between open reading frames F14L and F15L as defined by Goebel et al., Virology (1990) 179:247-266, and in the opposite orientation of ORFs F14L and F15L; one skilled in the art can readily identify the gene located in the structurally equivalent region in a large variety of related viruses, such as a large variety of pox viruses.
[0268] Comparative protein sequence analysis revealed some insight into protein function. The closest match with the protein encoded by the F3 gene (strain LIVP) is a proly 1 4-hydroxylase alpha subunit precursor (4-PH alpha) from the nematode Caenorhabditis elegans (Veijola et al., J. Biol. Chem. 269 (1994), 26746-26753). This alpha subunit forms an active alpha-beta dimer with the human protein disulfide isomerase beta subunit. Prolyl 4-hydroxylase (EC 1.14.11.2) catalyzes the formation of 4-hydroxyproline in collagen. The vertebrate enzyme is an alpha 2-beta 2 tetramer, the beta subunit of which is identical to the protein disulfide-isomerase (PDI). The importance of this protein for vaccinia viral replication is unknown, but a deficiency of this protein can result in retargeting vaccinia virus to tumor tissue.
[0269] d. Multiple Modifications
[0270] The vaccinia viruses provided herein also can contain two or more insertions, mutations or deletions. Thus, included are vaccinia viruses containing two or more insertions, mutations or deletions of the loci provided herein or other loci known in the art. In one embodiment, a vaccinia virus contains an insertion, mutation or deletion in the F3 gene, and one or more additional insertions, mutations or deletions. In one embodiment of the modified vaccinia virus, at least the F3 gene has been modified by insertion of a foreign nucleotide sequence. Modifications such as modification of the F3 gene will typically result in at least partial inactivation of the gene or gene product. In one example, the F3 gene and the TK gene have been modified by insertion of a foreign nucleotide sequence. In another example, the F3 gene and the HA gene have been modified by insertion of a foreign nucleotide sequence. In another example, the F3 gene and both the TK and HA genes have been modified by insertion of a foreign nucleotide sequence. In another example, the HA gene and the TK gene have been modified by insertion of a foreign nucleotide sequence. Accordingly, the present compositions and methods include a modified vaccinia virus wherein two or more of (a) the F3 gene, (b) the TK gene, and (c) the HA gene have been modified. In one embodiment, at least two of the F3 gene, TK gene and HA gene have been inactivated, for example by insertion, deletion and/or replacement of nucleotide(s) within the coding region, or regulatory sequences of two or more of these genes have been inactivated by insertion, deletion or mutation.
[0271] e. The Lister Strain
[0272] In another embodiment, the viruses and methods provided herein can be based on modifications to the Lister strain of vaccinia virus. Lister (also referred to as Elstree) vaccinia virus is available from any of a variety of sources. For example, the Elstree vaccinia virus is available at the ATCC under Accession Number VR-1549. The Lister vaccinia strain has high transduction efficiency in tumor cells with high levels of gene expression.
[0273] In one embodiment, the Lister strain can be an attenuated Lister strain, such as the LIVP (Lister virus from the Institute of Viral Preparations, Moscow, Russia) strain, which was produced by further attenuation of the Lister strain. The LIVP strain was used for vaccination throughout the world, particularly in India and Russia, and is widely available.
[0274] The LIVP strain has a reduced pathogenicity while maintaining a high transduction efficiency. For example, as provided herein, F3-interrupted modified LIVP vaccinia virus can selectively replicate in tumor cells in vivo. In one embodiment, provided herein are modified LIVP viruses, including viruses having a modified TK gene, viruses having a modified HA gene, viruses having a modified F3 gene, and viruses having two or more of: modified HA gene, modified TK gene, and modified F3 gene.
[0275] ii. Other Cytoplasmic Viruses
[0276] Also provided herein are cytoplasmic viruses that are not poxviruses. Cytoplasmic viruses can replicate without introducing viral nucleic acid molecules into the nucleus of the host cell. A variety of such cytoplasmic viruses are known in the art, and include African swine flu family viruses and various RNA viruses such as arenaviruses, picornaviruses, caliciviruses, togaviruses, coronaviruses, paramyxoviruses, flaviviruses, reoviruses, and rhaboviruses. Exemplary togaviruses include Sindbis viruses. Exemplary arenaviruses include lymphocytic choriomeningitis virus. Exemplary rhaboviruses include vesicular stomatitis viruses. Exemplary paramyxo viruses include Newcastle Disease viruses and measles viruses. Exemplary picornaviruses include polio viruses, bovine enteroviruses and rhinoviruses. Exemplary flaviviruses include Yellow fever virus; attenuated Yellow fever viruses are known in the art, as exemplified in Barrett et al., Biologicals 25:17-25 (1997), and McAllister et al., J. Virol. 74:9197-9205 (2000).
[0277] Also provided herein are modifications of the viruses provided above to enhance one or more characteristics relative to the wild type virus. Such characteristics can include, but are not limited to, attenuated pathogenicity, reduced toxicity, preferential accumulation in tumor, increased ability to activate an immune response against tumor cells, increased immunogenicity, increased or decreased replication competence, and are able to express exogenous proteins, and combinations thereof. In some embodiments, the modified viruses have an ability to activate an immune response against tumor cells without aggressively killing the tumor cells. In other embodiments, the viruses can be modified to express one or more detectable genes, including genes that can be used for imaging. In other embodiments, the viruses can be modified to express one or more genes for harvesting the gene products and/or for harvesting antibodies against the gene products.
[0278] b. Adenovirus, Herpes, Retroviruses
[0279] Further provided herein are viruses that include in their life cycle entry of a nucleic acid molecule into the nucleus of the host cell. A variety of such viruses are known in the art, and include herpesviruses, papovaviruses, retroviruses, adenoviruses, parvoviruses and orthomyxoviruses. Exemplary herpesviruses include herpes simplex type 1 viruses, cytomegaloviruses, and Epstein-Barr viruses. Exemplary papovaviruses include human papillomavirus and SV40 viruses. Exemplary retroviruses include lentiviruses. Exemplary orthomyxoviruses include influenza viruses. Exemplary parvoviruses include adeno associated viruses.
[0280] Also provided herein are modifications of the viruses provided above to enhance one or more characteristics relative to the wild type virus. Such characteristics can include, but are not limited to, attenuated pathogenicity, reduced toxicity, preferential accumulation in tumor, increased ability to activate an immune response against tumor cells, increased immunogenicity, increased or decreased replication competence, and are able to express exogenous proteins, and combinations thereof. In some embodiments, the modified viruses have an ability to activate an immune response against tumor cells without aggressively killing the tumor cells. In other embodiments, the viruses can be modified to express one or more detectable genes, including genes that can be used for imaging. In other embodiments, the viruses can be modified to express one or more genes for harvesting the gene products and/or for harvesting antibodies against the gene products.
[0281] 3. Bacteria
[0282] Bacteria can also be used in the methods provided herein. Any of a variety of bacteria possessing the desired characteristics can be used. In one embodiment, aerobic bacteria can be used. In another embodiment, anaerobic bacteria can be used. In another embodiment, extracellular bacteria can be used. In another embodiment, intracellular bacteria can be used.
[0283] In some embodiments, the bacteria provided herein can be extracellular bacteria. A variety of extracellular bacteria are known in the art and include vibrio, lactobacillus, streptococcus, escherichia. Exemplary bacteria include Vibrio cholerae, Streptococcus pyogenes, and Escherichia coli. In other embodiments, the bacteria provided herein can be intracellular bacteria. A variety of intracellular bacteria are known in the art and include listeria, salmonella, clostridium, and bifodobacterium. Exemplary intracellular bacteria include Listeria monocytogenes, Salmonella typhimurium, Clostridium histolyticus, Clostridium butyricum, Bifodobacterium longum, and Bifodobacterium adolescentis. Additional bacteria include plant bacteria such as Clavibacter michiganensis subsp. michiganensis, Agrobacterium tumefaciens, Erwinia herbicola, Azorhizobium caulinodans, Xanthomonas campestris pv. vesicatoria, and Xanthomonas campestris pv. campestris.
[0284] A further example of a bacteria provided herein are magnetic bacteria. Such bacteria allow tumor detection through the accumulation of iron-based contrast agents. Magnetic bacteria can be isolated from fresh and marine sediments. Magnetic bacteria can produce magnetic particles (Fe304) (Blakemore, Annu. Rev. Microbiol. 36 (1982), 217-238). To do so, the magnetic bacteria have efficient iron uptake systems, which allow them to utilize both insoluble and soluble forms of iron. Magnetospirillum magnetic AMB-1 is an example of such magnetic bacteria that has been isolated and cultured for magnetic particle production (Yang et al., Enzyme Microb. Technol. 29 (2001), 13-19). As provided herein, these magnetic bacteria (naturally occurring or genetically modified), when injected intravenously, can selectively accumulate in tumor. Accordingly, these bacteria can be used for accumulating iron-based contrast agents in the tumors, which in turn allows tumor detection by MRI. Similarly, other naturally isolated metal accumulating strains of bacteria can be used for tumor targeting, absorption of metals from contrast agents, and tumor imaging.
[0285] Also provided herein are modifications of bacteria to enhance one or more characteristics relative to the wild type bacteria. Such characteristics can include, but are not limited to, attenuated pathogenicity, reduced toxicity, preferential accumulation in tumor, increased ability to activate an immune response against tumor cells, increased immunogenicity, increased or decreased replication competence, and are able to express exogenous proteins, and combinations thereof. In some embodiments, the modified bacteria have an ability to activate an immune response against tumor cells without aggressively killing the tumor cells. In other embodiments, the bacteria can be modified to express one or more detectable genes, including genes that can be used for imaging. In other embodiments, the bacteria can be modified to express one or more genes for harvesting the gene products and/or for harvesting antibodies against the gene products.
[0286] a. Aerobic Bacteria
[0287] Previous studies have postulated that anaerobic bacteria are preferred for administration to tumors (Lemmon et al., 1997 Gene Therapy 4:791-796). As provided herein, it has been determined that aerobic bacteria can survive and grow in tumors. Accordingly, a bacteria used in the methods provided herein can include a bacteria that can survive and grow in an oxygenated environment. In some embodiments, the bacteria must be in an oxygenated environment in order to survive and grow. A variety of aerobic bacteria are known in the art, including lactobacilli, salmonella, streptococci, staphylococci, vibrio, listeria, and escherichia. Exemplary bacteria include Vibrio cholerae, Listeria monocytogenes, Salmonella typhimurium, Streptococcus pyogenes, Escherichia coli, Lactobacillus bulgaricus, Lactobacillus casei, Lacto bacillus acidophilus, Lactobacillus brevis, Lactobacillus paracasei, Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus salivarius, Lactobacillus sporogenes, Lactobacillus lactis, Lactobacillus fermentum, Streptococcus thermophilus, Bacillus subtilis, Bacillus megaterium, Bacillus polymyxa, Myobacterium smegmatis, Mycobacterium vaccae, Mycobacterium microti, Mycobacterium habana, Enterococcus faecalis, Pseudomonas fluorescens, and Pseudomonas putida.
[0288] b. Anaerobic Bacteria
[0289] A bacteria used in the methods provided herein can include a bacteria that does not require oxygen to survive and grow. In some embodiments, the bacteria must be in an oxygen-free environment in order to survive and grow. A variety of aerobic bacteria are known in the art, including clostridium, bifodobacterium. Exemplary bacteria include Clostridium histolyticus, Clostridium butyricum, Clostridium novyi, Clostridium sordellii, Clostridium absonum, Clostridium bifermentans, Clostridium difficile, Clostridium histolyticum, Clostridium perfringens, Clostridium beijerinckii, Clostridium sporogenes, Staphylococcus aureus, Staphylococcus epidermidis, Bifidobacterium longum, Bifidobacterium adolescentis, Bifidobacterium bifidum, Bifidobacterium infantis, Bifidobacterium laterosporus, Bifidobacterium animalis, Actinomyces israelii, Eubacterium lentum, Peptostreptococcus anaerobis, Peptococcus prevotti, and Acidaminococcus fermentans.
[0290] 4. Eukaryotic Cells
[0291] Also encompassed within the microorganisms provided herein and the methods of making and using such microorganisms are eukaryotic cells, including cells from multicellular eukaryotes, including mammals such as primates, where exemplary cells are human cells. Typically the cells are isolated cells. For example, eukaryotic cells can be tumor cells, including mammalian tumor cells such as primate tumor cells, where exemplary primate tumor cells are human tumor cells such as human breast cancer cells. In another example, eukaryotic cells can include fibrosarcoma cells such as human fibrosarcoma cells. Exemplary human fibrosarcoma cells include HT1080 (ATCC Accession Nos. CCL-121, CRL-12011 or CRL-12012). In another example, eukaryotic cells can include stem cells, including mammalian stem cells such as primate stem cells, where exemplary primate stem cells are human stem cells.
[0292] Also provided herein are modifications of eukaryotic cells to enhance one or more characteristics relative to the wild type cells. Such characteristics can include, but are not limited to, attenuated pathogenicity, reduced toxicity, preferential accumulation in tumor, increased ability to activate an immune response against tumor cells, increased immunogenicity, increased or decreased replication competence, and are able to express exogenous proteins, and combinations thereof. In some embodiments, the modified eukaryotic cells have an ability to activate an immune response against tumor cells without aggressively killing the tumor cells. In other embodiments, the eukaryotic cells can be modified to express one or more detectable genes, including genes that can be used for imaging. In other embodiments, the eukaryotic cells can be modified to express one or more genes for harvesting the gene products and/or for harvesting antibodies against the gene products.
C. Methods for Making a Modified Microorganism
[0293] The microorganisms provided herein can be formed by standard methodologies well known in the art for modifying microorganisms such as viruses, bacteria and eukaryotic cells. Briefly, the methods include introducing into microorganisms one or more genetic modification, followed by screening the microorganisms for properties reflective of the modification or for other desired properties.
[0294] 1. Genetic Modifications
[0295] Standard techniques in molecular biology can be used to generate the modified microorganisms provided herein. Such techniques include various nucleic acid manipulation techniques, nucleic acid transfer protocols, nucleic acid amplification protocols, and other molecular biology techniques known in the art. For example, point mutations can be introduced into a gene of interest through the use of oligonucleotide mediated site-directed mutagenesis. Alternatively, homologous recombination can be used to introduce a mutation or exogenous sequence into a target sequence of interest. Nucleic acid transfer protocols include calcium chloride transformation/transfection, electroporation, liposome mediated nucleic acid transfer, N-[1-(2,3-Dioloyloxy)propyl]-N,N,N-trimethylammonium methylsulfate meditated transformation, and others. In an alternative mutagenesis protocol, point mutations in a particular gene can also be selected for using a positive selection pressure. See, e.g., Current Techniques in Molecular Biology, (Ed. Ausubel, et al.). Nucleic acid amplification protocols include but are not limited to the polymerase chain reaction (PCR). Use of nucleic acid tools such as plasmids, vectors, promoters and other regulating sequences, are well known in the art for a large variety of viruses and cellular organisms. Further a large variety of nucleic acid tools are available from many different sources including ATCC, and various commercial sources. One skilled in the art will be readily able to select the appropriate tools and methods for genetic modifications of any particular virus or cellular organism according to the knowledge in the art and design choice.
[0296] Any of a variety of modifications can be readily accomplished using standard molecular biological methods known in the art. The modifications will typically be one or more truncations, deletions, mutations or insertions of the microorganismal genome. In one embodiment, the modification can be specifically directed to a particular sequence. The modifications can be directed to any of a variety of regions of the microorganismal genome, including, but not limited to, a regulatory sequence, to a gene-encoding sequence, or to a sequence without a known role. Any of a variety of regions of microorganismal genomes that are available for modification are readily known in the art for many microorganisms, including the microorganisms specifically listed herein. As a non-limiting example, the loci of a variety of vaccinia genes provided hereinelsewhere exemplify the number of different regions that can be targeted for modification in the microorganisms provided herein. In another embodiment, the modification can be fully or partially random, whereupon selection of any particular modified microorganism can be determined according to the desired properties of the modified the microorganism.
[0297] In some embodiments, the microorganism can be modified to express an exogenous gene. Exemplary exogenous gene products include proteins and RNA molecules. The modified microorganisms can express a detectable gene product, a therapeutic gene product, a gene product for manufacturing or harvesting, or an antigenic gene product for antibody harvesting. The characteristics of such gene products are described hereinelsewhere. In some embodiments of modifying an organism to express an exogenous gene, the modification can also contain one or more regulatory sequences to regulate expression of the exogenous gene. As is known in the art, regulatory sequences can permit constitutive expression of the exogenous gene or can permit inducible expression of the exogenous gene. Further, the regulatory sequence can permit control of the level of expression of the exogenous gene. In some examples, inducible expression can be under the control of cellular or other factors present in a tumor cell or present in a microorganism-infected tumor cell. In other examples, inducible expression can be under the control of an administrable substance, including IPTG, RU486 or other known induction compounds. Any of a variety of regulatory sequences are available to one skilled in the art according to known factors and design preferences. In some embodiments, such as gene product manufacture and harvesting, the regulatory sequence can result in constitutive, high levels of gene expression. In some embodiments, such as anti-(gene product) antibody harvesting, the regulatory sequence can result in constitutive, lower levels of gene expression. In tumor therapy embodiments, a therapeutic protein can be under the control of an internally inducible promoter or an externally inducible promoter.
[0298] In other embodiments, organ or tissue-specific expression can be controlled by regulatory sequences. In order to achieve expression only in the target organ, for example, a tumor to be treated, the foreign nucleotide sequence can be linked to a tissue specific promoter and used for gene therapy. Such promoters are well known to those skilled in the art (see e.g., Zimmermann et al., (1994) Neuron 12, 11-24; Vidal et al.; (1990) EMBO J. 9, 833-840; Mayford et al., (1995), Cell 81, 891-904; Pinkert et al., (1987) Genes & Dev. 1, 268-76).
[0299] In some embodiments, the microorganisms can be modified to express two or more proteins, where any combination of the two or more proteins can be one or more detectable gene products, therapeutic gene products, gene products for manufacturing or harvesting, or antigenic gene products for antibody harvesting. In one embodiment, a microorganism can be modified to express a detectable protein and a therapeutic protein. In another embodiment, a microorganism can be modified to express two or more gene products for detection or two or more therapeutic gene products. For example, one or more proteins involved in biosynthesis of a luciferase substrate can be expressed along with luciferase. When two or more exogenous genes are introduced, the genes can be regulated under the same or different regulatory sequences, and the genes can be inserted in the same or different regions of the microorganismal genome, in a single or a plurality of genetic manipulation steps. In some embodiments, one gene, such as a gene encoding a detectable gene product, can be under the control of a constitutive promoter, while a second gene, such as a gene encoding a therapeutic gene product, can be under the control of an inducible promoter. Methods for inserting two or more genes in to a microorganism are known in the art and can be readily performed for a wide variety of microorganisms using a wide variety of exogenous genes, regulatory sequences, and/or other nucleic acid sequences.
[0300] In an example of performing microorganismal modification methods, vaccinia virus strain LIVP was modified to contain insertions of exogenous DNA in three different locations of the viral genome. Using general methods known in the art, known molecular biology tools, and sequences known in the art or disclosed herein can be used to create modified vaccinia virus strains, including viruses containing insertions in the F3 gene, TK gene and/or HA gene. See, e.g., Mikryukov, et al., Biotekhnologya 4 (1998), 442-449; Goebel et al., Virology 179 (1990), 247-266; Antoine et al., Virology 244 (1998), 365-396; Mayr et al., Zentbl. Bakteriol. Hyg. Abt 1 Orig. B 167 (1978), 375-390; Ando and Matumoto, Jpn. J. Microbial. 14 (1979), 181-186; Sugimoto et al., Microbial. Immuol. 29 (1985), 421-428; Takahashi-Nishimaki et al., J. Gen. Virol. 68 (1987), 2705-2710). These methods include, for example, in vitro recombination techniques, synthetic methods and in vivo recombination methods as described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, cold Spring Harbor N.Y. (1989), and in the Examples disclosed herein. The person skilled in the art can isolate the gene encoding the gene product of F3 (or a related gene product) from any vaccinia strain using, for example, the nucleotide sequence of the F3 gene of SEQ ID NO:1 or SEQ ID NOS: 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32, or a fragment thereof as a probe for screening a library.
[0301] Methods of producing recombinant microorganisms are known in the art. Provided herein for exemplary purposes are methods of producing a recombinant vaccinia virus. A recombinant vaccinia virus with an insertion in the F3 gene (NotI site of LIVP) can be prepared by the following steps: (a) generating (i) a vaccinia shuttle plasmid containing the modified F3 gene inserted at restriction site X and (ii) a dephosphorylated wt VV (VGL) DNA digested at restriction site X; (b) transfecting host cells infected with PUV-inactivated helper VV (VGL) with a mixture of the constructs of (i) and (ii) of step a; and (c) isolating the recombinant vaccinia viruses from the transfectants. One skilled in the art knows how to perform such methods, for example by following the instructions given in Example 1 and the legend to FIG. 1; see also Timiryasova et al., Biotechniques 31 (2001), 534-540. In one embodiment, restriction site X is a unique restriction site. A variety of suitable host cells also are known to the person skilled in the art and include many mammalian, avian and insect cells and tissues which are susceptible for vaccinia virus infection, including chicken embryo, rabbit, hamster and monkey kidney cells, for example, HeLa cells, RK.sub.13, CV-1, Vero, BSC40 and BSC-1 monkey kidney cells.
[0302] 2. Screening for Above Characteristics
[0303] Modified microorganisms can be screened for any desired characteristics, including the characteristics described herein such as attenuated pathogenicity, reduced toxicity, preferential accumulation in tumor, increased ability to activate an immune response against tumor cells, increased immunogenicity, increased or decreased replication competence, and are able to express exogenous proteins, and combinations thereof. For example, the modified microorganisms can be screened for the ability to activate an immune response against tumor cells without aggressively killing the tumor cells. In another example, the microorganisms can be screened for expression of one or more detectable genes, including genes that can be used for imaging, or for expression of one or more genes for manufacture or harvest of the gene products and/or for harvest of antibodies against the gene products.
[0304] Any of a variety of known methods for screening for such characteristics can be performed, as demonstrated in the Examples provided herein. One Exemplary method for screening for desired characteristics includes, but is not limited to, monitoring growth, replication and/or gene expression (including expression of an exogenous gene) in cell culture or other in vitro medium. The cell culture can be from any organism, and from any tissue source, and can include tumorous tissues. Other exemplary methods for screening for desired characteristics include, but are not limited to, administering a microorganism to animal, including non-human animals such as a mouse, monkey or ape, and optionally also including humans, and monitoring the microorganism, the tumor, and or the animal; monitoring can be performed by in vivo imaging of the microorganism and/or the tumor (e.g., low light imaging of microorganismal gene expression or ultrasonic tumor imaging), external monitoring of the tumor (e.g., external measurement of tumor size), monitoring the animal (e.g., monitoring animal weight, blood panel, antibody titer, spleen size, or liver size). Other exemplary methods for screening for desired characteristics include, but are not limited to, harvesting a non-human animal for the effects and location of the microorganism and expression by the microorganism, including methods such as harvesting a variety of organs including a tumor to determine presence of the microorganism and/or gene expression by the microorganism in the organs or tumor, harvesting of organs associated with an immune response or microorganismal clearance such as the spleen or liver, harvesting the tumor to determine tumor size and viability of tumor cells, harvesting antibodies or antibody producing cells. Such screening and monitoring methods can be used in any of a variety of combinations, as is known in art. In one embodiment, a microorganism can be screened by administering the microorganism to an animal such as a non-human animal or a human, followed by monitoring by in vivo imaging. In another embodiment, a microorganism can be screened by administering the microorganism to an animal such as a non-human animal, monitoring by in vivo imaging, and then harvesting the animal. Thus, provided herein are methods for screening a microorganism for desired characteristics by administering the microorganism to an animal such as an animal with a tumor, and monitoring the animal, tumor (if present), and/or microorganism in the animal for one or more characteristics. Also provided herein are methods for screening a microorganism for desired characteristics by administering the microorganism to a non-human animal such as a non-human animal with a tumor, harvesting the animal, and assaying the animal's organs, antibody titer, and/or tumor (if present) for one or more characteristics.
[0305] Provided herein are methods for screening a microorganism for attenuated pathogenicity or reduced toxicity, where the pathogenicity or toxicity can be determined by a variety of techniques, including, but not limited to, assessing the health state of the subject, measuring the body weight of a subject, blood or urine analysis of a subject, and monitoring tissue distribution of the microorganism within the subject; such techniques can be performed on a living subject in vivo, or can be performed post mortem. Methods also can include the ability of the microorganisms to lyse cells or cause cell death, which can be determined in vivo or in vitro.
[0306] When a subject drops below a threshold body weight, the microorganism can be considered pathogenic to the subject. Exemplary thresholds can be a drop of about 5% or more, a drop of about 10% or more, or a drop of about 15% or more in body weight relative to a reference. A body weight reference can be selected from any of a variety of references used in the art; for example, a body weight reference can be the weight of the subject prior to administration of the microorganism, the body weight reference can be a control subject having the same condition as the test subject (e.g., normal or tumor-injected), where the change in weight of the control is compared to the change in weight of the test subject for the time period after administration of the microorganism.
[0307] Blood or urine analysis of the subject can indicate level of immune response, level of toxins in the subject, or other levels of stress to cells, tissues or organs of the subject such as kidneys, pancreas, liver and spleen. Levels increased above established threshold levels can indicate pathogenicity of the microorganism to the subject. Threshold levels of components of blood or urine for indicating microorganismal pathogenicity are well known in the art, and any such thresholds can be selected herein according to the desired tolerance of pathogenicity or toxicity of the microorganism.
[0308] Tissue distribution of a microorganism in a subject can indicate pathogenicity or toxicity of the microorganism. In one embodiment, tissue distribution of a microorganism that is not pathogenic or toxic can be mostly in tumor relative to other tissues or organs. Microorganisms located mostly in tumor can accumulate, for example, at least about 2-fold greater, at least about 5-fold greater, at least about 10-fold greater, at least about 100-fold greater, at least about 1,000-fold greater, at least about 10,000-fold greater, at least about 100,000-fold greater, or at least about 1,000,000-fold greater, than the microorganisms that accumulate in any other particular organ or tissue.
[0309] Provided herein are methods for screening a microorganism for tissue distribution or accumulation, where the tissue distribution can be determined by a variety of techniques, including, but not limited to, harvesting a non-human subject, in vivo imaging a detectable gene product in subject. Harvesting can be accomplished by euthanizing the non-human subject, and determining the accumulation of microorganisms in tumor and, optionally, the accumulation in one or more additional tissues or organs. The accumulation can be determined by any of a variety of methods, including, but not limited to, detecting gene products such as detectable gene products (e.g., gfp or beta galactosidase), histological or microscopic evaluation of tissue, organ or tumor samples, or measuring the number of plaque or colony forming units present in a tissue, organ or tumor sample. In one embodiment, the desired amount of tissue distribution of a microorganism can be mostly in tumor relative to other tissues or organs. Microorganisms located mostly in tumor can accumulate, for example, at least about 2-fold greater, at least about 5-fold greater, at least about 10-fold greater, at least about 100-fold greater, at least about 1,000-fold greater, at least about 10,000-fold greater, at least about 100,000-fold greater, or at least about 1,000,000-fold greater, than the microorganisms that accumulate in any other particular organ or tissue.
[0310] Also provided herein are methods of screening for microorganisms that can elicit an immune response, where the immune response can be against the tumor cells or against the microorganisms. A variety of methods for measuring the ability to elicit an immune response are known in the art, and include measuring an overall increase in immune activity in a subject, measuring an increase in anti-microorganism or anti-tumor antibodies in a subject, testing the ability of a microorganism-treated (typically a non-human) subject to prevent later infection/tumor formation or to rapidly eliminate microorganisms or tumor cells. Methods also can include the ability of the microorganisms to lyse cells or cause cell death, which can be determined in vivo or in vitro.
[0311] Also provided herein are methods for determining increased or decreased replication competence, by monitoring the speed of replication of the microorganisms. Such measurements can be performed in vivo or in vitro. For example, the speed of replication in a cell culture can be used to determine replication competence of a microorganism. In another example, the speed of replication in a tissue, organ or tumor in a subject can be used to measure replication competence. In some embodiments, decreased replication competence in non-tumor tissues and organs can be the characteristic to be selected in a screen. In other embodiments, increased replication competence in tumors can be the characteristic to be selected in a screen.
[0312] Also provided herein are methods for determining the ability of a microorganism to express genes, such as exogenous genes. Such methods can be performed in vivo or in vitro. For example, the microorganisms can be screened on selective plates for the ability to express a gene that permits survival of the microorganism or permits the microorganism to provide a detectable signal, such as turning X-gal blue. Such methods also can be performed in vivo, where expression can be determined, for example, by harvesting tissues, organs or tumors a non-human subject or by in vivo imaging of a subject.
[0313] Also provided herein are methods for determining the ability of a microorganism to express genes toward which the subject can develop antibodies, including exogenous genes toward which the subject can develop antibodies. Such methods can be performed in vivo using any of a variety of non-human subjects. For example, gene expression can be determined, for example, by bleeding a non-human subject to which a microorganism has been administered, and assaying the blood (or serum) for the presence of antibodies against the microorganism-expressed gene, or by any other method generally used for polyclonal antibody harvesting, such as production bleeds and terminal bleeds.
[0314] Also provided herein are methods for screening a microorganism that has two or more characteristics provided herein, including screening for attenuated pathogenicity, reduced toxicity, preferential accumulation in tumor, increased ability to activate an immune response against tumor cells, increased immunogenicity, increased or decreased replication competence, ability to express exogenous proteins, and ability to elicit antibody production against a microorganismally expressed gene product. A single monitoring technique, such as in vivo imaging, can be used to verify two or more characteristics, or a variety of different monitoring techniques can be used, as can be determined by one skilled in the art according to the selected characteristics and according to the monitoring techniques used.
D. Therapeutic Methods
[0315] Provided herein are therapeutic methods, including methods of treating or preventing immunoprivileged cells or tissue, including cancerous cells, tumor and metastasis. The methods provided herein include administering a microorganism to a subject containing a tumor and/or metastases. The methods provided herein do not require the microorganism to kill tumor cells or decrease the tumor size. Instead, the methods provided herein include administering to a subject a microorganism that can cause or enhance an anti-tumor immune response in the subject. In some embodiments, the microorganisms provided herein can be administered to a subject without causing microorganism-induced disease in the subject. In some embodiments, the microorganisms can accumulate in tumors or metastases. In some embodiments, the microorganisms can elicit an anti-tumor immune response in the subject, where typically the microorganism-mediated anti-tumor immune response can develop over several days, such as a week or more, 10 days or more, two weeks or more, or a month or more, as a result of little or no microorganism-cause tumor cell death. In some exemplary methods, the microorganism can be present in the tumor, and can cause an anti-tumor immune response without the microorganism itself causing enough tumor cell death to prevent tumor growth.
[0316] In some embodiments, provided herein are methods for eliciting or enhancing antibody production against a selected antigen or a selected antigen type in a subject, where the methods include administering to a subject a microorganism that can accumulate in a tumor and/or metastasis, and can cause release of a selected antigen or selected antigen type from the tumor, resulting in antibody production against the selected antigen or selected antigen type. The administered microorganisms can posses one or more characteristics including attenuated pathogenicity, low toxicity, preferential accumulation in tumor, ability to activate an immune response against tumor cells, immunogenicity, replication competence, ability to express exogenous genes, and ability to elicit antibody production against a microorganismally expressed gene product.
[0317] Any of a variety of antigens can be targeted in the methods provided herein, including a selected antigen such as an exogenous gene product expressed by the microorganism, or a selected antigen type such as one or more tumor antigens release from the tumor as a result of microorganism infection of the tumor (e.g., by lysis, apoptosis, secretion or other mechanism of causing antigen release from the tumor). In at least some embodiments, it can be desirable to maintain release of the selected antigen or selected antigen type over a series of days, for example, at least a week, at least ten days, at least two weeks or at least a month.
[0318] Also provided herein are methods for providing a sustained antigen release within a subject, where the methods include administering to a subject a microorganism that can accumulate in a tumor and/or metastasis, and can cause sustained release of an antigen, resulting in antibody production against the antigen. The sustained release of antigen can last for several days, for example, at least a week, at least ten days, at least two weeks or at least a month. The administered microorganisms can posses one or more characteristics including attenuated pathogenicity, low toxicity, preferential accumulation in tumor, ability to activate an immune response against tumor cells, immunogenicity, replication competence, ability to express exogenous genes, and ability to elicit antibody production against a microorganismally expressed gene product. The sustained release of antigen can result in an immune response by the microorganism-infected host, in which the host can develop antibodies against the antigen, and/or the host can mount an immune response against cells expressing the antigen, including an immune response against tumor cells. Thus, the sustained release of antigen can result in immunization against tumor cells. In some embodiments, the microorganism-mediated sustained antigen release-induced immune response against tumor cells can result in complete removal or killing of all tumor cells.
[0319] Also provided herein are methods for inhibiting tumor growth in a subject, where the methods include administering to a subject a microorganism that can accumulate in a tumor and/or metastasis, and can cause or enhance an anti-tumor immune response. The anti-tumor immune response induced as a result of tumor or metastases-accumulated microorganisms can result in inhibition of tumor growth. The administered microorganisms can posses one or more characteristics including attenuated pathogenicity, low toxicity, preferential accumulation in tumor, ability to activate an immune response against tumor cells, immunogenicity, replication competence, ability to express exogenous genes, and ability to elicit antibody production against a microorganismally expressed gene product.
[0320] Also provided herein are methods for inhibiting growth or formation of a metastasis in a subject, where the methods include administering to a subject a microorganism that can accumulate in a tumor and/or metastasis, and can cause or enhance an anti-tumor immune response. The anti-tumor immune response induced as a result of tumor or metastasis-accumulated microorganisms can result in inhibition of metastasis growth or formation. The administered microorganisms can posses one or more characteristics including attenuated pathogenicity, low toxicity, preferential accumulation in tumor, ability to activate an immune response against tumor cells, immunogenicity, replication competence, ability to express exogenous genes, and ability to elicit antibody production against a microorganismally expressed gene product.
[0321] Also provided herein are methods for decreasing the size of a tumor and/or metastasis in a subject, where the methods include administering to a subject a microorganism that can accumulate in a tumor and/or metastasis, and can cause or enhance an anti-tumor immune response. The anti-tumor immune response induced as a result of tumor or metastasis-accumulated microorganisms can result in a decrease in the size of the tumor and/or metastasis. The administered microorganisms can posses one or more characteristics including attenuated pathogenicity, low toxicity, preferential accumulation in tumor, ability to activate an immune response against tumor cells, immunogenicity, replication competence, ability to express exogenous genes, and ability to elicit antibody production against a microorganismally expressed gene product.
[0322] Also provided herein are methods for eliminating a tumor and/or metastasis from a subject, where the methods include administering to a subject a microorganism that can accumulate in a tumor and/or metastasis, and can cause or enhance an anti-tumor immune response. The anti-tumor immune response induced as a result of tumor or metastasis-accumulated microorganisms can result in elimination of the tumor and/or metastasis from the subject. The administered microorganisms can posses one or more characteristics including attenuated pathogenicity, low toxicity, preferential accumulation in tumor, ability to activate an immune response against tumor cells, immunogenicity, replication competence, ability to express exogenous genes, and ability to elicit antibody production against a microorganismally expressed gene product.
[0323] Methods of reducing inhibiting tumor growth, inhibiting metastasis growth and/or formation, decreasing the size of a tumor or metastasis, eliminating a tumor or metastasis, or other tumor therapeutic methods provided herein include causing or enhancing an anti-tumor immune response in the host. The immune response of the host, being anti-tumor in nature, can be mounted against tumors and/or metastases in which microorganisms have accumulated, and can also be mounted against tumors and/or metastases in which microorganisms have not accumulated, including tumors and/or metastases that form after administration of the microorganisms to the subject. Accordingly, a tumor and/or metastasis whose growth or formation is inhibited, or whose size is decreased, or that is eliminated, can be a tumor and/or metastasis in which the microorganisms have accumulated, or also can be a tumor and/or metastasis in which the microorganisms have not accumulated. Accordingly, provided herein are methods of reducing inhibiting tumor growth, inhibiting metastasis growth and/or formation, decreasing the size of a tumor or metastasis, eliminating a tumor or metastasis, or other tumor therapeutic methods, where the method includes administering to a subject a microorganism, where the microorganism accumulates in at least one tumor or metastasis and causes or enhances an anti-tumor immune response in the subject, and the immune response also is mounted against a tumor and/or metastasis in which the microorganism cell did not accumulate. In another embodiment, methods are provided for inhibiting or preventing recurrence of a neoplastic disease or inhibiting or preventing new tumor growth, where the methods include administering to a subject a microorganism that can accumulate in a tumor and/or metastasis, and can cause or enhance an anti-tumor immune response, and the anti-tumor immune response can inhibit or prevent recurrence of a neoplastic disease or inhibit or prevent new tumor growth.
[0324] The tumor or neoplastic disease therapeutic methods provided herein, such as methods of reducing inhibiting tumor growth, inhibiting metastasis growth and/or formation, decreasing the size of a tumor or metastasis, eliminating a tumor or metastasis, or other tumor therapeutic methods, also can include administering to a subject a microorganism that can cause tumor cell lysis or tumor cell death. Such a microorganism can be the same microorganism as the microorganism that can cause or enhance an anti-tumor immune response in the subject. Microorganisms, such as the microorganisms provided herein, can cause cell lysis or tumor cell death as a result of expression of an endogenous gene or as a result of an exogenous gene. Endogenous or exogenous genes can cause tumor cell lysis or inhibit cell growth as a result of direct or indirect actions, as is known in the art, including lytic channel formation or activation of an apoptotic pathway. Gene products, such as exogenous gene products can function to activate a prodrug to an active, cytotoxic form, resulting in cell death where such genes are expressed.
[0325] Such methods of antigen production or tumor and/or metastasis treatment can include administration of a modified microorganism described herein or a microorganism having modifications with a functional equivalence to the vaccinia virus provided herein containing a modification of the F3 gene and the TK gene and/or the HA gene, for therapy, such as for gene therapy, for cancer gene therapy, or for vaccine therapy. Such a microorganism can be used to stimulate humoral and/or cellular immune response, induce strong cytotoxic T lymphocytes responses in subjects who may benefit from such responses. For example, the microorganism can provide prophylactic and therapeutic effects against a tumor infected by the microorganism or other infectious diseases, by rejection of cells from tumors or lesions using microorganisms that express immunoreactive antigens (Earl et al. (1986), Science 234, 728-831; Lathe et al. (1987), Nature (London) 326, 878-880), cellular tumor-associated antigens (Bernards et al., (1987), Proc. Natl. Acad. Sci. USA 84, 6854-6858; Estin et al. (1988), Proc. Natl. Acad. Sci. USA 85, 1052-1056; Kantor et al. (1992), J. Natl. Cancer Inst. 84, 1084-1091; Roth et al. (1996), Proc. Natl. Acad. Sci. USA 93, 4781-4786) and/or cytokines (e.g., IL-2, IL-12), costimulatory molecules (B7-1, B7-2) (Rao et al. (1996), J. Immunol. 156, 3357-3365; Chamberlain et al. (1996), Cancer Res. 56, 2832-2836; Oertli et al. (1996), J. Gen. Virol. 77, 3121-3125; Qin and Chatterjee (1996), Human Gene. Ther. 7, 1853-1860; McAneny et al. (1996), Ann. Surg. Oncol. 3, 495-500), or other therapeutic proteins.
[0326] Provided herein, solid tumors can be treated with microorganisms, such as vaccinia viruses, resulting in an enormous tumor-specific microorganism replication, which can lead to tumor protein antigen and viral protein production in the tumors. As provided herein, vaccinia virus administration to mice resulted in lysis of the infected tumor cells and a resultant release of tumor-cell-specific antigens. Continuous leakage of these antigens into the body led to a very high level of antibody titer (in approximately 7-14 days) against tumor proteins, viral proteins, and the virus encoded engineered proteins in the mice. The newly synthesized antitumor antibodies and the enhanced macrophage, neutrophils count were continuously delivered via the vasculature to the tumor and thereby provided for the recruitment of an activated immune system against the tumor. The activated immune system then eliminated the foreign compounds of the tumor including the viral particles. This interconnected release of foreign antigens boosted antibody production and continuous response of the antibodies against the tumor proteins to function like an autoimmunizing vaccination system initiated by vaccinia viral infection and replication, followed by cell lysis, protein leakage and enhanced antibody production. Thus, the present methods can provide a complete process that can be applied to all tumor systems with immunoprivileged tumor sites as site of privileged viral, bacterial, and mammalian cell growth, which can lead to tumor elimination by the host's own immune system.
[0327] In other embodiments, methods are provided for immunizing a subject, where the methods include administering to the subject a microorganism that expresses one or more antigens against which antigens the subject will develop an immune response. The immunizing antigens can be endogenous to the microorganism, such as vaccinia antigens on a vaccinia virus used to immunize against smallpox, or the immunizing antigens can be exogenous antigens expressed by the microorganism, such as influenza or HIV antigens expressed on a viral capsid or bacterial cell surface. Thus, the microorganisms provided herein, including the modified vaccinia viruses can be used as vaccines.
[0328] 1. Administration
[0329] In performing the methods provided herein, a microorganism can be administered to a subject, including a subject having a tumor or having neoplastic cells, or a subject to be immunized. An administered microorganism can be a microorganism provided herein or any other microorganism known for administration to a subject, for example, any known microorganism known for therapeutic administration to a subject, including antigenic microorganisms such as any microorganism known to be used for vaccination. In some embodiments, the microorganism administered is a microorganism containing a characteristic such as attenuated pathogenicity, low toxicity, preferential accumulation in tumor, ability to activate an immune response against tumor cells, high immunogenicity, replication competence, and ability to express exogenous proteins, and combinations thereof.
[0330] a. Steps Prior to Administering the Microorganism
[0331] In some embodiments, one or more steps can be performed prior to administration of the microorganism to the subject. Any of a variety of preceding steps can be performed, including, but not limited to diagnosing the subject with a condition appropriate for microorganismal administration, determining the immunocompetence of the subject, immunizing the subject, treating the subject with a chemotherapeutic agent, treating the subject with radiation, or surgically treating the subject.
[0332] For embodiments that include administering a microorganism to a tumor-bearing subject for therapeutic purposes, the subject has typically been previously diagnosed with a neoplastic condition. Diagnostic methods also can include determining the type of neoplastic condition, determining the stage of the neoplastic conditions, determining the size of one or more tumors in the subject, determining the presence or absence of metastatic or neoplastic cells in the lymph nodes of the subject, or determining the presence of metastases of the subject. Some embodiments of therapeutic methods for administering a microorganism to a subject can include a step of determination of the size of the primary tumor or the stage of the neoplastic disease, and if the size of the primary tumor is equal to or above a threshold volume, or if the stage of the neoplastic disease is at or above a threshold stage, a microorganism is administered to the subject. In a similar embodiment, if the size of the primary tumor is below a threshold volume, or if the stage of the neoplastic disease is at or below a threshold stage, the microorganism is not yet administered to the subject; such methods can include monitoring the subject until the tumor size or neoplastic disease stage reaches a threshold amount, and then administering the microorganism to the subject. Threshold sizes can vary according to several factors, including rate of growth of the tumor, ability of the microorganism to infect a tumor, and immunocompetence of the subject. Generally the threshold size will be a size sufficient for a microorganism to accumulate and replicate in or near the tumor without being completely removed by the host's immune system, and will typically also be a size sufficient to sustain a microorganismal infection for a time long enough for the host to mount an immune response against the tumor cells, typically about one week or more, about ten days or more, or about two weeks or more. Exemplary threshold tumor sizes for viruses such as vaccinia viruses are at least about 100 mm.sup.3, at least about 200 mm.sup.3, at least about 300 mm.sup.3, at least about 400 mm.sup.3, at least about 500 mm.sup.3, at least about 750 mm.sup.3, at least about 1000 mm.sup.3, or at least about 1500 mm.sup.3. Threshold neoplastic disease stages also can vary according to several factors, including specific requirement for staging a particular neoplastic disease, aggressiveness of growth of the neoplastic disease, ability of the microorganism to infect a tumor or metastasis, and immunocompetence of the subject. Generally the threshold stage will be a stage sufficient for a microorganism to accumulate and replicate in a tumor or metastasis without being completely removed by the host's immune system, and will typically also be a size sufficient to sustain a microorganismal infection for a time long enough for the host to mount an immune response against the neoplastic cells, typically about one week or more, about ten days or more, or about two weeks or more. Exemplary threshold stages are any stage beyond the lowest stage (e.g., Stage I or equivalent), or any stage where the primary tumor is larger than a threshold size, or any stage where metastatic cells are detected.
[0333] In other embodiments, prior to administering to the subject a microorganism, the immunocompetence of the subject can be determined. The methods of administering a microorganism to a subject provided herein can include causing or enhancing an immune response in a subject. Accordingly, prior to administering a microorganism to a subject, the ability of a subject to mount an immune response can be determined. Any of a variety of tests of immunocompetence known in the art can be performed in the methods provided herein. Exemplary immunocompetence tests can examine ABO hemagglutination titers (IgM), leukocyte adhesion deficiency (LAD), granulocyte function (NBT), T and B cell quantitation, tetanus antibody titers, salivary IgA, skin test, tonsil test, complement C3 levels, and factor B levels, and lymphocyte count. One skilled in the art can determine the desirability to administer a microorganism to a subject according to the level of immunocompetence of the subject, according to the immunogenicity of the microorganism, and, optionally, according to the immunogenicity of the neoplastic disease to be treated. Typically, a subject can be considered immunocompetent if the skilled artisan can determine that the subject is sufficiently competent to mount an immune response against the microorganism.
[0334] In some embodiments, the subject can be immunized prior to administering to the subject a microorganism according to the methods provided herein. Immunization can serve to increase the ability of a subject to mount an immune response against the microorganism, or increase the speed at which the subject can mount an immune response against a microorganism. Immunization also can serve to decrease the risk to the subject of pathogenicity of the microorganism. In some embodiments, the immunization can be performed with an immunization microorganism that is similar to the therapeutic microorganism to be administered. For example, the immunization microorganism can be a replication-incompetent variant of the therapeutic microorganism. In other embodiments, the immunization material can be digests of the therapeutic microorganism to be administered. Any of a variety of methods for immunizing a subject against a known microorganism are known in the art and can be used herein. In one example, vaccinia viruses treated with, for example, 1 microgram of psoralen and ultraviolet light at 365 nm for 4 minutes, can be rendered replication incompetent. In another embodiment, the microorganism can be selected as the same or similar to a microorganism against which the subject has been previously immunized, e.g., in a childhood vaccination.
[0335] In another embodiment, the subject can have administered thereto a microorganism without any previous steps of cancer treatment such as chemotherapy, radiation therapy or surgical removal of a tumor and/or metastases. The methods provided herein take advantage of the ability of the microorganisms to enter or localize near a tumor, where the tumor cells can be protected from the subject's immune system; the microorganisms can then proliferate in such an immunoprotected region and can also cause the release, typically a sustained release, of tumor antigens from the tumor to a location in which the subject's immune system can recognize the tumor antigens and mount an immune response. In such methods, existence of a tumor of sufficient size or sufficiently developed immunoprotected state can be advantageous for successful administration of the microorganism to the tumor, and for sufficient tumor antigen production. If a tumor is surgically removed, the microorganisms may not be able to localize to other neoplastic cells (e.g., small metastases) because such cells may not yet have matured sufficiently to create an immunoprotective environment in which the microorganisms can survive and proliferate, or even if the microorganisms can localize to neoplastic cells, the number of cells or size of the mass may be too small for the microorganisms to cause a sustained release of tumor antigens in order for the host to mount an anti-tumor immune response. Thus, for example, provided herein are methods of treating a tumor or neoplastic disease in which microorganisms are administered to a subject with a tumor or neoplastic disease without removing the primary tumor, or to a subject with a tumor or neoplastic disease in which at least some tumors or neoplastic cells are intentionally permitted to remain in the subject. In other typical cancer treatment methods such as chemotherapy or radiation therapy, such methods typically have a side effect of weakening the subject's immune system. This treatment of a subject by chemotherapy or radiation therapy can reduce the subject's ability to mount an anti-tumor immune response. Thus, for example, provided herein are methods of treating a tumor or neoplastic disease in which microorganisms are administered to a subject with a tumor or neoplastic disease without treating the subject with an immune system-weakening therapy, such as chemotherapy or radiation therapy.
[0336] In an alternative embodiment, prior to administration of a microorganism to the subject, the subject can be treated in one or more cancer treatment steps that do not remove the primary tumor or that do not weaken the immune system of the subject. A variety of more sophisticated cancer treatment methods are being developed in which the tumor can be treated without surgical removal or immune-system weakening therapy. Exemplary methods include administering a compound that decreases the rate of proliferation of the tumor or neoplastic cells without weakening the immune system (e.g., by administering tumor suppressor compounds or by administering tumor cell-specific compounds) or administering an angiogenesis-inhibiting compound. Thus, combined methods that include administering a microorganism to a subject can further improve cancer therapy. Thus, provided herein are methods of administering a microorganism to a subject, along with prior to or subsequent to, for example, administering a compound that slows tumor growth without weakening the subject's immune system or a compound that inhibits vascularization of the tumor.
[0337] b. Mode of Administration
[0338] Any mode of administration of a microorganism to a subject can be used, provided the mode of administration permits the microorganism to enter a tumor or metastasis. Modes of administration can include, but are not limited to, intravenous, intraperitoneal, subcutaneous, intramuscular, topical, intratumor, multipuncture (e.g., as used with smallpox vaccines), inhalation, intranasal, oral, intracavity (e.g., administering to the bladder via a catheter, administering, to the gut by suppository or enema), aural, or ocular administration. One skilled in the art can select any mode of administration compatible with the subject and the microorganism, and that also is likely to result in the microorganism reaching tumors and/or metastases. The route of administration can be selected by one skilled in the art according to any of a variety of factors, including the nature of the disease, the kind of tumor, and the particular microorganism contained in the pharmaceutical composition. Administration to the target site can be performed, for example, by ballistic delivery, as a colloidal dispersion system, or systemic administration can be performed by injection into an artery.
[0339] c. Dosage
[0340] The dosage regimen can be any of a variety of methods and amounts, and can be determined by one skilled in the art according to known clinical factors. As is known in the medical arts, dosages for any one patient can depend on many factors, including the subject's species, size, body surface area, age, sex, immunocompetence, and general health, the particular microorganism to be administered, duration and route of administration, the kind and stage of the disease, for example, tumor size, and other compounds such as drugs being administered concurrently. In addition to the above factors, such levels can be affected by the infectivity of the microorganism, and the nature of the microorganism, as can be determined by one skilled in the art. At least some of the viruses used the in the methods provided herein can be more infectious than the bacteria used herein. Thus, in some embodiments of the present methods, virus can be administered at lower levels than bacteria. In the present methods, appropriate minimum dosage levels of microorganisms can be levels sufficient for the microorganism to survive, grow and replicate in a tumor or metastasis. Exemplary minimum levels for administering a virus to a 65 kg human can include at least about 5.times.10.sup.5 plaque forming units (pfu), at least about 1.times.10.sup.6 pfu, at least about 5.times.10.sup.6 pfu, at least about 1.times.10.sup.7 pfu, or at least about 1.times.10.sup.8 pfu. Exemplary minimum levels for administering a bacterium to a 65 kg human can include at least about 5.times.10.sup.6 colony forming units (cfu), at least about 1.times.10.sup.7 cfu, at least about 5.times.10.sup.7 cfu, at least about 1.times.10.sup.8 cfu, or at least about 1.times.10.sup.9 cfu. In the present methods, appropriate maximum dosage levels of microorganisms can be levels that are not toxic to the host, levels that do not cause splenomegaly of 3.times. or more, levels that do not result in colonies or plaques in normal tissues or organs after about 1 day or after about 3 days or after about 7 days. Exemplary maximum levels for administering a virus to a 65 kg human can include no more than about 5.times.10.sup.10 pfu, no more than about 1.times.10.sup.10 pfu, no more than about 5.times.10.sup.9 pfu, no more than about 1.times.10.sup.9 pfu, or no more than about 1.times.10.sup.8 pfu. Exemplary maximum levels for administering a bacterium to a 65 kg human can include no more than about 5.times.10.sup.11 pfu, no more than about 1.times.10.sup.11 pfu, no more than about 5.times.10.sup.10 pfu, no more than about 1.times.10.sup.10 pfu, or no more than about 1.times.10.sup.9 pfu.
[0341] d. Number of Administrations
[0342] The methods provided herein can include a single administration of a microorganism to a subject or multiple administrations of a microorganism to a subject. In some embodiments, a single administration is sufficient to establish a microorganism in a tumor, where the microorganism can proliferate and can cause or enhance an anti-tumor response in the subject; such methods do not require additional administrations of a microorganism in order to cause or enhance an anti-tumor response in a subject, which can result, for example in inhibition of tumor growth, inhibition of metastasis growth or formation, reduction in tumor or metastasis size, elimination of a tumor or metastasis, inhibition or prevention of recurrence of a neoplastic disease or new tumor formation, or other cancer therapeutic effects. In other embodiments, a microorganism can be administered on different occasions, separated in time typically by at least one day. Separate administrations can increase the likelihood of delivering a microorganism to a tumor or metastasis, where a previous administration may have been ineffective in delivering a microorganism to a tumor or metastasis. Separate administrations can increase the locations on a tumor or metastasis where microorganism proliferation can occur or can otherwise increase the titer of microorganism accumulated in the tumor, which can increase the scale of release of antigens or other compounds from the tumor in eliciting or enhancing a host's anti-tumor immune response, and also can, optionally, increase the level of microorganism-based tumor lysis or tumor cell death. Separate administrations of a microorganism can further extend a subject's immune response against microorganismal antigens, which can extend the host's immune response to tumors or metastases in which microorganisms have accumulated, and can increase the likelihood of a host mounting an anti-tumor immune response.
[0343] When separate administrations are performed, each administration can be a dosage amount that is the same or different relative to other administration dosage amounts. In one embodiment, all administration dosage amounts are the same. In other embodiments, a first dosage amount can be a larger dosage amount than one or more subsequent dosage amounts, for example, at least 10.times. larger, at least 100.times. larger, or at least 1000.times. larger than subsequent dosage amounts. In one example of a method of separate administrations in which the first dosage amount is greater than one or more subsequent dosage amounts, all subsequent dosage amounts can be the same, smaller amount relative to the first administration.
[0344] Separate administrations can include any number of two or more administrations, including two, three, four, five or six administrations. One skilled in the art can readily determine the number of administrations to perform or the desirability of performing one or more additional administrations according to methods known in the art for monitoring therapeutic methods and other monitoring methods provided herein. Accordingly, the methods provided herein include methods of providing to the subject one or more administrations of a microorganism, where the number of administrations can be determined by monitoring the subject, and, based on the results of the monitoring, determining whether or not to provide one or more additional administrations. Deciding on whether or not to provide one or more additional administrations can be based on a variety of monitoring results, including, but not limited to, indication of tumor growth or inhibition of tumor growth, appearance of new metastases or inhibition of metastasis, the subject's anti-microorganism antibody titer, the subject's anti-tumor antibody titer, the overall health of the subject, the weight of the subject, the presence of microorganism solely in tumor and/or metastases, the presence of microorganism in normal tissues or organs.
[0345] The time period between administrations can be any of a variety of time periods. The time period between administrations can be a function of any of a variety of factors, including monitoring steps, as described in relation to the number of administrations, the time period for a subject to mount an immune response, the time period for a subject to clear microorganism from normal tissue, or the time period for microorganismal proliferation in the tumor or metastasis. In one example, the time period can be a function of the time period for a subject to mount an immune response; for example, the time period can be more than the time period for a subject to mount an immune response, such as more than about one week, more than about ten days, more than about two weeks, or more than about a month; in another example, the time period can be less than the time period for a subject to mount an immune response, such as less than about one week, less than about ten days, less than about two weeks, or less than about a month. In another example, the time period can be a function of the time period for a subject to clear microorganism from normal tissue; for example, the time period can be more than the time period for a subject to clear microorganism from normal tissue, such as mote than about a day, more than about two days, more than about three days, more than about five days, or more than about a week. In another example, the time period can be a function of the time period for microorganismal proliferation in the tumor or metastasis; for example, the time period can be more than the amount of time for a detectable signal to arise in a tumor or metastasis after administration of a microorganism expressing a detectable marker, such as about 3 days, about 5 days, about a week, about ten days, about two weeks, or about a month.
[0346] e. Co-Administrations
[0347] Also provided are methods in which an additional therapeutic substance, such as a different therapeutic microorganism or a therapeutic compound is administered. These can be administered simultaneously, sequentially or intermittently with the first microorganism. The additional therapeutic substance can interact with the microorganism or a gene product thereof, or the additional therapeutic substance can act independently of the microorganism.
[0348] i. Administration of a Plurality of Microorganisms
[0349] Methods are provided for administering to a subject two or more microorganisms. Administration can be effected simultaneously, sequentially or intermittently. The plurality of microorganisms can be administered as a single composition or as two or more compositions. The two or more microorganisms can include at least two bacteria, at least two viruses, at least two eukaryotic cells, or two or more selected from among bacteria, viruses and eukaryotic cells. The plurality of microorganisms can be provided as combinations of compositions containing and/or as kits that include the microorganisms packaged for administration and optionally including instructions therefore. The compositions can contain the microorganisms formulated for single dosage administration (i.e., for direct administration) and can require dilution or other additions.
[0350] In one embodiment, at least one of the microorganisms is a modified microorganism such as those provided herein, having a characteristic such as low pathogenicity, low toxicity, preferential accumulation in tumor, ability to activate an immune response against tumor cells, immunogenic, replication competent, ability to express exogenous proteins, and combinations thereof. The microorganisms can be administered at approximately the same time, or can be administered at different times. The microorganisms can be administered in the same composition or in the same administration method, or can be administered in separate composition or by different administration methods.
[0351] In one example, a bacteria and a virus can be administered to a subject. The bacteria and virus can be administered at the same time, or at different times. For example, the virus can be administered prior to administering the bacteria, or the bacteria can be administered prior to administering the virus; typically the virus is administered prior to administering the bacteria. As provided herein, administering to a subject a virus prior to administering to the subject a bacterium can increase the amount of bacteria that can accumulate and/or proliferate in a tumor, relative to methods in which bacteria alone are administered.
[0352] Accordingly, the methods provided herein that include administration of virus prior to administration of bacteria permit the administration of a lower dosage amount of bacteria than would otherwise be administered in a method in which bacteria alone are administered or a method in which bacteria are administered at the same time as or prior to administration of a virus. For example, in some embodiments, a bacterium to be administered can have one or more properties that limit the ability of the bacterium to be used, such properties can include, but are not limited to toxicity, low tumor specificity of accumulation, and limited proliferation capacity. A bacterium to be administered that has one or more limiting properties can require administration in lower dosage amounts, or can require assistance in tumor-specific accumulation and/or proliferation. Provided herein are methods of administering such a bacterium with limiting properties, where prior to administering the bacterium, a virus is administered such that the limited bacterium can be administered in smaller quantities, can accumulate in tumor with increased specificity, and/or can have an increased ability to proliferate in a tumor.
[0353] The time period between administrations can be any time period that achieves the desired effects, as can be determined by one skilled in the art. Selection of a time period between administrations of different microorganisms can be determined according to parameters similar to those for selecting the time period between administrations of the same microorganism, including results from monitoring steps, the time period for a subject to mount an immune response, the time period for a subject to clear microorganism from normal tissue, or the time period for microorganismal proliferation in the tumor or metastasis. In one example, the time period can be a function of the time period for a subject to mount an immune response; for example, the time period can be more than the time period for a subject to mount an immune response, such as more than about one week, more than about ten days, more than about two weeks, or more than about a month; in another example, the time period can be less than the time period for a subject to mount an immune response, such as less than about one week, less than about ten days, less than about two weeks, or less than about a month. In another example, the time period can be a function of the time period for a subject to clear microorganism from normal tissue; for example, the time period can be more than the time period for a subject to clear microorganism from normal tissue, such as more than about a day, more than about two days, more than about three days, more than about five days, or more than about a week. In another example, the time period can be a function of the time period for microorganismal proliferation in the tumor or metastasis; for example, the time period can be more than the amount of time for a detectable signal to arise in a tumor or metastasis after administration of a microorganism expressing a detectable marker, such as about 3 days, about 5 days, about a week, about ten days, about two weeks, or about a month. In one example a virus can first be administered, and a bacteria can be administered about 5 days after administration of the virus. In another example, a virus can be first administered, and a bacterium can be administered upon detection of a virally-encoded detectable gene product in the tumor of the subject, optionally when the virally-encoded detectable gene product is detected only in the tumor of the subject.
[0354] ii. Therapeutic Compounds
[0355] The methods can include administering one or more therapeutic compounds to the subject in addition to administering a microorganism or plurality thereof to a subject. Therapeutic compounds can act independently, or in conjunction with the microorganism, for tumor therapeutic effects. Therapeutic compounds that can act independently include any of a variety of known chemotherapeutic compounds that can inhibit tumor growth, inhibit metastasis growth and/or formation, decrease the size of a tumor or metastasis, eliminate a tumor or metastasis, without reducing the ability of a microorganism to accumulate in a tumor, replicate in the tumor, and cause or enhance an anti-tumor immune response in the subject.
[0356] Therapeutic compounds that act in conjunction with the microorganisms include, for example, compounds that alter the expression of the microorganism or compounds that can interact with a microorganism-expressed gene, or compounds that can inhibit microorganismal proliferation, including compounds toxic to the microorganism. Therapeutic compounds that can act in conjunction with the microorganism include, for example, therapeutic compounds that increase the proliferation, toxicity, tumor cell killing, or immune response eliciting properties of a microorganism, and also can include, for example, therapeutic compounds that decrease the proliferation, toxicity, or cell killing properties of a microorganism. Thus, provided herein are methods of administering to a subject one or more therapeutic compounds that can act in conjunction with the microorganism to increase the proliferation, toxicity, tumor cell killing, or immune response eliciting properties of a microorganism. Also provided herein are methods of administering to a subject one or more therapeutic compounds that can act in conjunction with the microorganism to decrease the proliferation, toxicity, or cell killing properties of a microorganism.
[0357] In one embodiment, therapeutic compounds that can act in conjunction with the microorganism to increase the proliferation, toxicity, tumor cell killing, or immune response eliciting properties of a microorganism are compounds that can alter gene expression, where the altered gene expression can result in an increased killing of tumor cells or an increased anti-tumor immune response in the subject. A gene expression-altering compound can, for example, cause an increase or decrease in expression of one or more microorganismal genes, including endogenous microorganismal genes and/or exogenous microorganismal genes. For example, a gene expression-altering compound can induce or increase transcription of a gene in a microorganism such as an exogenous gene that can cause cell lysis or cell death, that can provoke an immune response, that can catalyze conversion of a prodrug-like compound, or that can inhibit expression of a tumor cell gene. Any of a wide variety of compounds that can alter gene expression are known in the art, including IPTG and RU486. Exemplary genes whose expression can be up-regulated include proteins and RNA molecules, including toxins, enzymes that can convert a prodrug to an anti-tumor drug, cytokines, transcription regulating proteins, siRNA, and ribozymes. In another example, a gene expression-altering compound can inhibit or decrease transcription of a gene in a microorganism such as an exogenous gene that can reduce microorganismal toxicity or reduces microorganismal proliferation. Any of a variety of compounds that can reduce or inhibit gene expression can be used in the methods provided herein, including siRNA compounds, transcriptional inhibitors or inhibitors of transcriptional activators. Exemplary genes whose expression can be down-regulated include proteins and RNA molecules, including microorganismal proteins or RNA that suppress lysis, nucleotide synthesis or proliferation, and cellular proteins or RNA molecules that suppress cell death, immunoreactivity, lysis, or microorganismal replication.
[0358] In another embodiment, therapeutic compounds that can act in conjunction with the microorganism to increase the proliferation, toxicity, tumor cell killing, or immune response eliciting properties of a microorganism are compounds that can interact with a microorganism-expressed gene product, and such interaction can result in an increased killing of tumor cells or an increased anti-tumor immune response in the subject. A therapeutic compound that can interact with a microorganism-expressed gene product can include, for example a prodrug or other compound that has little or no toxicity or other biological activity in its subject-administered form, but after interaction with a microorganism-expressed gene product, the compound can develop a property that results in tumor cell death, including but not limited to, cytotoxicity, ability to induce apoptosis, or ability to trigger an immune response. A variety of prodrug-like substances are known in the art and an exemplary set of such compounds are disclosed elsewhere herein, where such compounds can include gancyclovir, 5-fluorouracil, 6-methylpurine deoxyriboside, cephalosporin-doxorubicin, 4-[(2-chloroethyl)(2-mesuloxyethyl)amino]benzoyl-L-glutamic acid, acetominophen, indole-3-acetic acid, CB1954, 7-ethyl-10-[4-(1-piperidino)-1-piperidino]carbonyloxycamptothecin, bis-(2-chloroethyl)amino-4-hydroxyphenylaminomethanone 28, 1-chloromethyl-5-hydroxy-1,2-dihyro-3H-benz[e]indole, epirubicin-glucuronide, 5'-deoxy5-fluorouridine, cytosine arabinoside, and linamarin.
[0359] In another embodiment, therapeutic compounds that can act in conjunction with the microorganism to decrease the proliferation, toxicity, or cell killing properties of a microorganism are compounds that can inhibit microorganismal replication, inhibit microorganismal toxins, or cause microorganismal death. A therapeutic compound that can inhibit microorganismal replication, inhibit microorganismal toxins, or cause microorganismal death can generally include a compound that can block one or more steps in the microorganismal life cycle, including, but not limited to, compounds that can inhibit microorganismal DNA replication, microorganismal RNA transcription, viral coat protein assembly, outer membrane or polysaccharide assembly. Any of a variety of compounds that can block one or more steps in a microorganismal life cycle are known in the art, including any known antibiotic, microorganismal DNA polymerase inhibitors, microorganismal RNA polymerase inhibitors, inhibitors of proteins that regulate microorganismal DNA replication or RNA transcription. In one example, when a microorganism is a bacteria, a compound can be an antibiotic. In another example, a microorganism can contain a gene encoding a microorganismal life cycle protein, such as DNA polymerase or RNA polymerase that can be inhibited by a compound that is, optionally, non-toxic to the host organism.
[0360] f. State of Subject
[0361] In another embodiment, the methods provided herein for administering a microorganism to a subject can be performed on a subject in any of a variety of states, including an anesthetized subject, an alert subject, a subject with elevated body temperature, a subject with reduced body temperature, or other state of the subject that is known to affect the accumulation of microorganism in the tumor. As provided herein, it has been determined that a subject that is anesthetized can have a decreased rate of accumulation of a microorganism in a tumor relative to a subject that is not anesthetized. Further provided herein, it has been determined that a subject with decreased body temperature can have a decreased rate of accumulation of a microorganism in a tumor relative to a subject with a normal body temperature. Accordingly, provided herein are methods of administering a microorganism to a subject, where the methods can include administering a microorganism to a subject where the subject is not under anesthesia, such as general anesthesia; for example, the subject can be under local anesthesia, or can be unanesthetized. Also provided herein are methods of administering a microorganism to a subject, where the methods can include administering a microorganism to a subject with altered body temperature, where the alteration of the body temperature can influence the ability of the microorganism to accumulate in a tumor; typically, a decrease in body temperature can decrease the ability of a microorganism to accumulate in a tumor. Thus, in one exemplary embodiment, a method is provided for administering a microorganism to a subject, where the method includes elevating the body temperature of the subject to a temperature above normal, and administering a microorganism to the subject, where the microorganism can accumulate in the tumor more readily in the subject with higher body temperature relative to the ability of the microorganism to accumulate in a tumor of a subject with a normal body temperature.
[0362] 2. Monitoring
[0363] The methods provided herein can further include one or more steps of monitoring the subject, monitoring the tumor, and/or monitoring the microorganism administered to the subject. Any of a variety of monitoring steps can be included in the methods provided herein, including, but not limited to, monitoring tumor size, monitoring anti-(tumor antigen) antibody titer, monitoring the presence and/or size of metastases, monitoring the subject's lymph nodes, monitoring the subject's weight or other health indicators including blood or urine markers, monitoring anti-(microorganismal antigen) antibody titer, monitoring microorganismal expression of a detectable gene product, and directly monitoring microorganismal titer in a tumor, tissue or organ of a subject.
[0364] The purpose of the monitoring can be simply for assessing the health state of the subject or the progress of therapeutic treatment of the subject, or can be for determining whether or not further administration of the same or a different microorganism is warranted, or for determining when or whether or not to administer a compound to the subject where the compound can act to increase the efficacy of the therapeutic method, or the compound can act to decrease the pathogenicity of the microorganism administered to the subject.
[0365] a. Monitoring Microorganismal Gene Expression
[0366] In some embodiments, the methods provided herein can include monitoring one or more microorganismally expressed genes. Microorganisms, such as those provided herein or otherwise known in the art, can express one or more detectable gene products, including but not limited to, detectable proteins.
[0367] As provided herein, measurement of a detectable gene product expressed in a microorganism can provide an accurate determination of the level of microorganism present in the subject. As further provided herein, measurement of the location of the detectable gene product, for example, by imaging methods including tomographic methods, can determine the localization of the microorganism in the subject. Accordingly, the methods provided herein that include monitoring a detectable microorganismal gene product can be used to determine the presence or absence of the microorganism in one or more organs or tissues of a subject, and/or the presence or absence of the microorganism in a tumor or metastases of a subject. Further, the methods provided herein that include monitoring a detectable microorganismal gene product can be used to determine the titer of microorganism present in one or more organs, tissues, tumors or metastases. Methods that include monitoring the localization and/or titer of microorganisms in a subject can be used for determining the pathogenicity of a microorganism; since microorganismal infection, and particularly the level of infection, of normal tissues and organs can indicate the pathogenicity of the probe, methods of monitoring the localization and/or amount of microorganisms in a subject can be used to determine the pathogenicity of a microorganism. Since methods provided herein can be used to monitor the amount of microorganisms at any particular location in a subject, the methods that include monitoring the localization and/or titer of microorganisms in a subject can be performed at multiple time points, and, accordingly can determine the rate of microorganismal replication in a subject, including the rate of microorganismal replication in one or more organs or tissues of a subject; accordingly, the methods of monitoring a microorganismal gene product can be used for determining the replication competence of a microorganism. The methods provided herein also can be used to quantitate the amount of microorganism present in a variety of organs or tissues, and tumors or metastases, and can thereby indicate the degree of preferential accumulation of the microorganism in a subject; accordingly, the microorganismal gene product monitoring methods provided herein can be used in methods of determining the ability of a microorganism to accumulate in tumor or metastases in preference to normal tissues or organs. Since the microorganisms used in the methods provided herein can accumulate in an entire tumor or can accumulate at multiple sites in a tumor, and can also accumulate in metastases, the methods provided herein for monitoring a microorganismal gene product can be used to determine the size of a tumor or the number of metastases are present in a subject. Monitoring such presence of microorganismal gene product in tumor or metastasis over a range of time can be used to assess changes in the tumor or metastasis, including growth or shrinking of a tumor, or development of new metastases or disappearance of metastases, and also can be used to determine the rate of growth or shrinking of a tumor, or development of new metastases or disappearance of metastases, or the change in the rate of growth or shrinking of a tumor, or development of new metastases or disappearance of metastases. Accordingly, the methods of monitoring a microorganismal gene product can be used for monitoring a neoplastic disease in a subject, or for determining the efficacy of treatment of a neoplastic disease, by determining rate of growth or shrinking of a tumor, or development of new metastases or disappearance of metastases, or the change in the rate of growth or shrinking of a tumor, or development of new metastases or disappearance of metastases.
[0368] Any of a variety of detectable proteins can be detected in the monitoring methods provided herein; an exemplary, non-limiting list of such detectable proteins includes any of a variety of fluorescence proteins (e.g., green fluorescence proteins), any of a variety of luciferases, transferrin or other iron binding proteins; or receptors, binding proteins, and antibodies, where a compound that specifically binds the receptor, binding protein or antibody can be a detectable agent or can be labeled with a detectable substance (e.g., a radionuclide or imaging agent).
[0369] b. Monitoring Tumor Size
[0370] Also provided herein are methods of monitoring tumor and/or metastasis size and location. Tumor and/or metastasis size can be monitored by any of a variety of methods known in the art, including external assessment methods or tomographic or magnetic imaging methods. In addition to the methods known in the art, methods provided herein, for example, monitoring microorganismal gene expression, can be used for monitoring tumor and/or metastasis size.
[0371] Monitoring size over several time points can provide information regarding the increase or decrease in size of a tumor or metastasis, and can also provide information regarding the presence of additional tumors and/or metastases in the subject. Monitoring tumor size over several time points can provide information regarding the development of a neoplastic disease in a subject, including the efficacy of treatment of a neoplastic disease in a subject.
[0372] c. Monitoring Antibody Titer
[0373] The methods provided herein also can include monitoring the antibody titer in a subject, including antibodies produced in response to administration of a microorganism to a subject. The microorganisms administered in the methods provided herein can elicit an immune response to endogenous microorganismal antigens. The microorganisms administered in the methods provided herein also can elicit an immune response to exogenous genes expressed by a microorganism. The microorganisms administered in the methods provided herein also can elicit an immune response to tumor antigens. Monitoring antibody titer against microorganismal antigens, microorganismally expressed exogenous gene products, or tumor antigens can be used in methods of monitoring the toxicity of a microorganism, monitoring the efficacy of treatment methods, or monitoring the level of gene product or antibodies for production and/or harvesting.
[0374] In one embodiment, monitoring antibody titer can be used to monitor the toxicity of a microorganism. Antibody titer against a microorganism can vary over the time period after administration of the microorganism to the subject, where at some particular time points, a low anti-(microorganismal antigen) antibody titer can indicate a higher toxicity, while at other time points a high anti-(microorganismal antigen) antibody titer can indicate a higher toxicity. The microorganisms used in the methods provided herein can be immunogenic, and can, therefore, elicit an immune response soon after administering the microorganism to the subject. Generally, a microorganism against which a subject's immune system can quickly mount a strong immune response can be a microorganism that has low toxicity when the subject's immune system can remove the microorganism from all normal organs or tissues. Thus, in some embodiments, a high antibody titer against microorganismal antigens soon after administering the microorganism to a subject can indicate low toxicity of a microorganism. In contrast, a microorganism that is not highly immunogenic may infect a host organism without eliciting a strong immune response, which can result in a higher toxicity of the microorganism to the host. Accordingly, in some embodiments, a high antibody titer against microorganismal antigens soon after administering the microorganism to a subject can indicate low toxicity of a microorganism.
[0375] In other embodiments, monitoring antibody titer can be used to monitor the efficacy of treatment methods. In the methods provided herein, antibody titer, such as anti-(tumor antigen) antibody titer, can indicate the efficacy of a therapeutic method such as a therapeutic method to treat neoplastic disease. Therapeutic methods provided herein can include causing or enhancing an immune response against a tumor and/or metastasis. Thus, by monitoring the anti-(tumor antigen) antibody titer, it is possible to monitor the efficacy of a therapeutic method in causing or enhancing an immune response against a tumor and/or metastasis. The therapeutic methods provided herein also can include administering to a subject a microorganism that can accumulate in a tumor and can cause or enhance an anti-tumor immune response. Accordingly, it is possible to monitor the ability of a host to mount an immune response against microorganisms accumulated in a tumor or metastasis, which can indicate that a subject has also mounted an anti-tumor immune response, or can indicate that a subject is likely to mount an anti-tumor immune response, or can indicate that a subject is capable of mounting an anti-tumor immune response.
[0376] In other embodiments, monitoring antibody titer can be used for monitoring the level of gene product or antibodies for production and/or harvesting. As provided herein, methods can be used for producing proteins, RNA molecules or other compounds by expressing an exogenous gene in a microorganism that has accumulated in a tumor. Further provided herein are methods for producing antibodies against a protein, RNA molecule or other compound produced by exogenous gene expression of a microorganism that has accumulated in a tumor. Monitoring antibody titer against the protein, RNA molecule or other compound can indicate the level of production of the protein, RNA molecule or other compound by the tumor-accumulated microorganism, and also can directly indicate the level of antibodies specific for such a protein, RNA molecule or other compound.
[0377] d. Monitoring General Health Diagnostics
[0378] The methods provided herein also can include methods of monitoring the health of a subject. Some of the methods provided herein are therapeutic methods, including neoplastic disease therapeutic methods. Monitoring the health of a subject can be used to determine the efficacy of the therapeutic method, as is known in the art. The methods provided herein also can include a step of administering to a subject a microorganism. Monitoring the health of a subject can be used to determine the pathogenicity of a microorganism administered to a subject. Any of a variety of health diagnostic methods for monitoring disease such as neoplastic disease, infectious disease, or immune-related disease can be monitored, as is known in the art. For example, the weight, blood pressure, pulse, breathing, color, temperature or other observable state of a subject can indicate the health of a subject. In addition, the presence or absence or level of one or more components in a sample from a subject can indicate the health of a subject. Typical samples can include blood and urine samples, where the presence or absence or level of one or more components can be determined by performing, for example, a blood panel or a urine panel diagnostic test. Exemplary components indicative of a subject's health include, but are not limited to, white blood cell count, hematocrit, c-reactive protein concentration.
[0379] e. Monitoring Coordinated with Treatment
[0380] Also provided herein are methods of monitoring a therapy, where therapeutic decisions can be based on the results of the monitoring. Therapeutic methods provided herein can include administering to a subject a microorganism, where the microorganism can preferentially accumulate in a tumor and/or metastasis, and where the microorganism can cause or enhance an anti-tumor immune response. Such therapeutic methods can include a variety of steps including multiple administrations of a particular microorganism, administration of a second microorganism, or administration of a therapeutic compound. Determination of the amount, timing or type of microorganism or compound to administer to the subject can be based on one or more results from monitoring the subject. For example, the antibody titer in a subject can be used to determine whether or not it is desirable to administer a microorganism or compound, the quantity of microorganism or compound to administer, and the type of microorganism or compound to administer, where, for example, a low antibody titer can indicate the desirability of administering additional microorganism, a different microorganism, or a therapeutic compound such as a compound that induces microorganismal gene expression. In another example, the overall health state of a subject can be used to determine whether or not it is desirable to administer a microorganism or compound, the quantity of microorganism or compound to administer, and the type of microorganism or compound to administer, where, for example, determining that the subject is healthy can indicate the desirability of administering additional microorganism, a different microorganism, or a therapeutic compound such as a compound that induces microorganismal gene expression. In another example, monitoring a detectable microorganismally expressed gene product can be used to determine whether or not it is desirable to administer a microorganism or compound, the quantity of microorganism or compound to administer, and the type of microorganism or compound to administer. Such monitoring methods can be used to determine whether or not the therapeutic method is effective, whether or not the therapeutic method is pathogenic to the subject, whether or not the microorganism has accumulated in a tumor or metastasis, and whether or not the microorganism has accumulated in normal tissues or organs. Based on such determinations, the desirability and form of further therapeutic methods can be derived.
[0381] In one embodiment, determination of whether or not a therapeutic method is effective can be used to derive further therapeutic methods. Any of a variety of methods of monitoring can be used to determine whether or not a therapeutic method is effective, as provided herein or otherwise known in the art. If monitoring methods indicate that the therapeutic method is effective, a decision can be made to maintain the current course of therapy, which can include further administrations of a microorganism or compound, or a decision can be made that no further administrations are required. If monitoring methods indicate that the therapeutic method is ineffective, the monitoring results can indicate whether or not a course of treatment should be discontinued (e.g., when a microorganism is pathogenic to the subject), or changed (e.g., when a microorganism accumulates in a tumor without harming the host organism, but without eliciting an anti-tumor immune response), or increased in frequency or amount (e.g., when little or no microorganism accumulates in tumor).
[0382] In one example, monitoring can indicate that a microorganism is pathogenic to a subject. In such instances, a decision can be made to terminate administration of the microorganism to the subject, to administer lower levels of the microorganism to the subject, to administer a different microorganism to a subject, or to administer to a subject a compound that reduces the pathogenicity of the microorganism. In one example, administration of a microorganism that is determined to be pathogenic can be terminated. In another example, the dosage amount of a microorganism that is determined to be pathogenic can be decreased for subsequent administration; in one version of such an example, the subject can be pre-treated with another microorganism that can increase the ability of the pathogenic microorganism to accumulate in tumor, prior to re-administering the pathogenic microorganism to the subject. In another example, a subject can have administered thereto a bacteria or virus that is pathogenic to the subject; administration of such a pathogenic microorganism can be accompanied by administration of, for example an antibiotic, anti-microorganismal compound, pathogenicity attenuating compound (e.g., a compound that down-regulates the expression of a lytic or apoptotic gene product), or other compound that can decrease the proliferation, toxicity, or cell killing properties of a microorganism, as described herein elsewhere. In one variation of such an example, the localization of the microorganism can be monitored, and, upon determination that the microorganism is accumulated in tumor and/or metastases but not in normal tissues or organs, administration of the antibiotic, anti-microorganismal compound or pathogenicity attenuating compound can be terminated, and the pathogenic activity of the microorganism can be activated or increased, but limited to the tumor and/or metastasis. In another variation of such an example, after terminating administration of an antibiotic, anti-microorganismal compound or pathogenicity attenuating compound, the presence of the microorganism and/or pathogenicity of the microorganism can be further monitored, and administration of such a compound can be reinitiated if the microorganism is determined to pose a threat to the host by, for example, spreading to normal organs or tissues, releasing a toxin into the vasculature, or otherwise having pathogenic effects reaching beyond the tumor or metastasis.
[0383] In another example, monitoring can determine whether or not a microorganism has accumulated in a tumor or metastasis of a subject. Upon such a determination, a decision can be made to further administer additional microorganism, a different microorganism or a compound to the subject. In one example, monitoring the presence of a virus in a tumor or metastasis can be used in deciding to administer to the subject a bacterium, where, for example, the quantity of bacteria administered can be reduced according to the presence and/or quantity of virus in a tumor or metastasis. In a similar example, monitoring the presence of a virus in a tumor or metastasis can be used in deciding when to administer to the subject a bacterium, where, for example, the bacteria can be administered upon detecting to the presence and/or a selected quantity of virus in a tumor or metastasis. In another example, monitoring the presence of a microorganism in a tumor can be used in deciding to administer to the subject a compound, where the compound can increase the pathogenicity, proliferation, or immunogenicity of a microorganism or the compound can otherwise act in conjunction with the microorganism to increase the proliferation, toxicity, tumor cell killing, or immune response eliciting properties of a microorganism; in one variation of such an example, the microorganism can, for example have little or no lytic or cell killing capability in the absence of such a compound; in a further variation of such an example, monitoring of the presence of the microorganism in a tumor or metastasis can be coupled with monitoring the absence of the microorganism in normal tissues or organs, where the compound is administered if the microorganism is present in tumor or metastasis and not at all present or substantially not present in normal organs or tissues; in a further variation of such an example, the amount of microorganism in a tumor or metastasis can be monitored, where the compound is administered if the microorganism is present in tumor or metastasis at sufficient levels.
E. Methods of Producing Gene Products and Antibodies
[0384] Provided herein are microorganisms, and methods for making and using such microorganisms for production products of exogenous genes and/or for production of antibodies specific for exogenous gene products. The methods provided herein result in efficient recombinant production of biologically active proteins. In EP A1 1 281 772, it is disclosed that when vaccinia virus (LIVP strain) carrying the light emitting fusion gene construct rVV-ruc-gfp (RVGL9) was injected intravenously into nude mice, the virus particles were found to be cleared from all internal organs within 4 days, as determined by extinction of light emission. In contrast, when the fate of the injected vaccinia virus was similarly followed in nude mice bearing tumors grown from subcutaneously implanted C6 rat glioma cells, virus particles were found to be retained over time in the tumor tissues, resulting in lasting light emission. The presence and amplification of the virus-encoded fusion proteins in the same tumor were monitored in live animals by observing GFP fluorescence under a stereomicroscope and by detecting luciferase-catalyzed light emission under a low-light video-imaging camera. Tumor-specific light emission was detected 4 days after viral injection in nude mice carrying subcutaneous C6 glioma implants. Tumor accumulation of rVV-ruc-gfp (RVGL9) virus particles was also seen in nude mice carrying subcutaneous tumors developed from implanted PC-3 human prostate cells, and in mice with orthotopically implanted MCF-7 human breast tumors. Further, intracranial C6 rat glioma cell implants in immunocompetent rats and MB-49 human bladder tumor cell implants in C57 mice were also targeted by the vaccinia virus. In addition to primary breast tumors, small metastatic tumors were also detected externally in the contralateral breast region, as well as in nodules on the exposed lung surface, suggesting metastasis to the contralateral breast and lung. In summary it was shown that light-emitting cells or microorganisms, for example, vaccinia virus can be used to detect and treat metastatic tumors.
[0385] Similar results were obtained with light-emitting bacteria (Salmonella, Vibrio, Listeria, E. coli) which were injected intravenously into mice and which could be visualized in whole animals under a low light imager immediately. No light emission was detected twenty four hours after bacterial injection in both athymic (nu/nu) mice and immunocompetent C57 mice as a result of clearing by the immune system. In nude mice bearing tumors developed from implanted C6 glioma cells, light emission was abolished from the animal entirely twenty four hours after delivery of bacteria, similar to mice without tumors. However, forty eight hours post-injection, a strong, rapidly increasing light emission originated only from the tumor regions was observed. This observation indicated a continuous bacterial replication in the tumor tissue. The extent of light emission was dependent on the bacterial strain used. The homing-in process together with the sustained light emission was also demonstrated in nude mice carrying prostate, bladder, and breast tumors. In addition to primary tumors, metastatic tumors could also be visualized as exemplified in the breast tumor model. Tumor-specific light emission was also observed in immunocompetent C57 mice, with bladder tumors as well as in Lewis rats with brain glioma implants. Once in the tumor, the light-emitting bacteria were not observed to be released into the circulation and to re-colonize subsequently implanted tumors in the same animal. Further, mammalian cells expressing the Ruc-GFP fusion protein, upon injection into the bloodstream, were also found to home in to, and propagate in, glioma tumors. These findings opened the way for designing multifunctional viral vectors useful for the detection of tumors based on signals such as light emission, for suppression of tumor development and angiogenesis signaled by, for example, light extinction and the development of bacterial and mammalian cell-based tumor targeting systems in combination with therapeutic gene constructs for the treatment of cancer. These systems have the following advantages: (a) They target the tumor specifically without affecting normal tissue; (b) the expression and secretion of the therapeutic gene constructs can be, optionally, under the control of an inducible promoter enabling secretion to be switched on or off; and (c) the location of the delivery system inside the tumor can be verified by direct visualization before activating gene expression and protein delivery.
[0386] As provided herein, the system described above based on the accumulation of bacteria, viruses and eukaryotic cells in tumors can be used for simple, quick, and inexpensive production of proteins and other biological compounds originating from cloned nucleotide sequences. This system also is useful for the concomitant overproduction of polypeptides, RNA or other biological compounds (in tumor tissue) and antibodies against those compounds (in the serum) in the same animal. As provided herein, after intravenous injection, a microorganism such as vaccinia virus can enter the tumor of an animal and, due to the immunoprivileged state of the tumor, can replicate preferentially in the tumor tissues and thereby can overproduce the inserted gene encoded protein in the tumors. After harvesting the tumor tissues, the localized and overexpressed protein can be isolated by a simple procedure from tumor homogenates. In addition, based on the findings that only 0.2 to 0.3% of the desired proteins produced in the tumor were found in the blood stream of the same animal, a simultaneous vaccination of the mouse and efficient antibody production against the overproduced protein was achieved. Thus, serum from the same mouse (or any other animal) can be harvested and used as mouse-derived antibodies against the proteins or other products overproduced in the tumor.
[0387] Thus, provided herein are methods of producing gene products and or antibodies in a non-human subject, by administering to a subject containing a tumor, a microorganism, where the microorganism expresses a selected protein or RNA to be produced, a protein or RNA whose expression can result in the formation of a compound to be produced, or a selected protein or RNA against which an antibody is to be produced. The methods provided herein can further include administering to a subject containing a tumor, a microorganism expressing an exogenous gene encoding a selected protein or RNA to be produced, a protein or RNA whose expression can result in the formation of a compound to be produced, or a selected protein or RNA against which an antibody is to be produced. The methods provided herein can further include administering to a subject containing a tumor, a microorganism expressing a gene encoding a selected protein or RNA to be produced, a protein or RNA whose expression can result in the formation of a compound to be produced, or a selected protein or RNA against which an antibody is to be produced, where such gene expression can be regulated, for example, by a transcriptional activator or inducer, or a transcriptional suppressor. The methods provided herein for producing a protein, RNA, compound or antibody can further include monitoring the localization and/or level of the microorganism in the subject by detecting a detectable protein, where the detectable protein can indicate the expression of the selected gene, or can indicate the readiness of the microorganism to be induced to express the selected gene or for suppression of expression to be terminated or suspended. Also provided herein are methods of producing gene products and or antibodies in a non-human subject, by administering to a subject containing a tumor, a microorganism, where the microorganism expresses a selected protein or RNA to be produced, a protein or RNA whose expression can result in the formation of a compound to be produced, or a selected protein or RNA against which an antibody is to be produced, where the subject to which the microorganism is administered is not a transgenic animal. Also provided herein are methods of producing gene products and or antibodies in a non-human subject, by administering to a subject containing a tumor, a microorganism, where the microorganism expresses a selected protein to be produced, where the tumor within the subject is selected according to its ability to post-translationally process the selected protein.
[0388] The advantages of the system, include:
(a) No production of a transgenic animal carrying the novel polypeptide-encoding cassette is required; (b) the tumor system is more efficient than tissue culture; (c) proteins interfering with animal development and other toxic proteins can be overproduced in tumors without negative effects to the host animal; (d) the system is fast: within 4 to 6 weeks from cDNA cloning to protein and antisera purification; (e) the system is relatively inexpensive and can be scaled up easily; (f) correct protein folding and modifications can be achieved; (g) high antigenicity can be achieved, which is beneficial for better antibody production; and (h) species-specific-cell-based production of proteins in animals such as mice, with tumors as fermentors can be achieved.
[0389] Depiction of an exemplary method for production of gene products and/or antibodies against gene products is provided in FIG. 2.
[0390] In one embodiment, methods are provided for producing a desired polypeptide, RNA or compound, the method including the following steps: (a) injecting a microorganism containing a nucleotide sequence encoding the desired polypeptide or RNA into an animal bearing a tumor; (b) harvesting the tumor tissue from the animal; and (c) isolating the desired polypeptide, RNA or compound from the tumor tissue.
[0391] Steps of an exemplary method can be summarized as follows (shown for a particular embodiment, i.e. vaccinia virus additionally containing a gene encoding a light-emitting protein):
(1) Insertion of the desired DNA or cDNA into the vaccinia virus genome; (2) modification of the vaccinia virus genome with light-emitting protein construct as expression marker; (3) recombination and virus assembly in cell culture; (4) screening of individual viral particles carrying inserts followed by large scale virus production and concentration; (5) administration of the viral particles into mice or other animals bearing tumors of human, non-human primate or other mammalian origins; (6) verification of viral replication and protein overproduction in animals based on light emission; (7) harvest of tumor tissues and, optionally, the blood (separately); and (8) purification of overexpressed proteins from tumors and, optionally, antisera from blood using conventional methods.
[0392] Any microorganism can be used in the methods provided herein, provided that they replicate in the animal, are not pathogenic for the animal, for example, are attenuated, and are recognized by the immune system of the animal. In some embodiments, such microorganisms also can express exogenous genes. Suitable microorganisms and cells are, for example, disclosed in EP A1 1 281 772 and EP A1 1 281 767. The person skilled in the art also knows how to generate animals carrying the desired tumor (see, e.g., EP A1 1 281 767 or EP A1 1 281 777).
[0393] Also provided is a method for simultaneously producing a desired polypeptide, RNA or compound and an antibody directed to the polypeptide, RNA or compound, the method having the following steps: (a) administering a microorganism containing a nucleotide sequence encoding the desired polypeptide or RNA into an animal bearing a tumor; (b) harvesting the tumor tissue from the animal; (c) isolating the desired polypeptide, RNA or compound from the tumor tissue; and (d) isolating the antibody directed to the polypeptide, RNA or compound from the serum obtained from the animal. This approach can be used for generating polypeptides and/or antibodies against the polypeptides which are toxic or unstable, or which require species specific cellular environment for correct folding or modifications.
[0394] In another embodiment, the microorganism can further contain a nucleotide sequence encoding a detectable protein, such as a luminescent or fluorescent protein, or a protein capable of inducing a detectable signal.
[0395] Typically in methods for transfecting the microorganisms or cells with nucleotide sequences encoding the desired polypeptide or RNA and, optionally, a nucleotide sequence encoding a detectable protein such as a luminescent or fluorescent protein, or a protein capable of inducing a detectable signal, the nucleotide sequences are present in a vector or an expression vector. A person skilled in the art is familiar with a variety of expression vectors, which can be selected according to the microorganism used to infect the tumor, the cell type of the tumor, the organism to be infected, and other factors known in the art. In some embodiments, the microorganism can be a virus, including the viruses disclosed herein. Thus, the nucleotide sequences can be contained in a recombinant virus containing appropriate expression cassettes. Suitable viruses for use herein, include, but are not limited to, baculovirus, vaccinia, Sindbis virus, Sendai virus, adenovirus, an AAV virus or a parvovirus, such as MVM or H-1. The vector can also be a retrovirus, such as MoMULV, MoMuLV, HaMuSV, MuMTV, RSV or GaLV. For expression in mammalian cells, a suitable promoter is, for example, human cytomegalovirus immediate early promoter (pCMV). Furthermore, tissue and/or organ specific promoters can be used. For example, the nucleotide sequences can be operatively linked with a promoter allowing high expression. Such promoters can include, for example, inducible promoters; a variety of such promoters are known to persons skilled in the art.
[0396] For generating protein or RNA-encoding nucleotide sequences and for constructing expression vectors or viruses that contain the nucleotide sequences, it is possible to use general methods known in the art. These methods include, for example, in vitro recombination techniques, synthetic methods and in vivo recombination methods as known in the art, and exemplified in Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Methods of transfecting cells, of phenotypically selecting transfectants cells, of phenotypically selecting transfectants and of expressing the nucleotide sequences by using vectors containing protein or RNA-encoding DNA are known in the art.
[0397] In some embodiments, the protein or RNA to be produced in the tumor can be linked to an inducible promoter, such as a promoter that can be induced by a substance endogenous to the subject, or by a substance that can be administered to a subject. Accordingly, provided herein are methods of producing a protein or RNA in a tumor, where the production can be induced by administration of a substance to a subject, and, optionally, harvesting the tumor and isolating the protein or RNA from the tumor. Such induction methods can be coupled with methods of monitoring a microorganism in a subject. For example, a microorganism can be monitored by detecting a detectable protein. In methods that include monitoring, detection of a desired localization and/or level of microorganism in the subject can be coordinated with induction of microorganismal gene expression. For example, when a microorganismally expressed detectable protein is detected in tumor, but not appreciably in normal organs or tissues, an inducer can be administered to the subject. In another example, when a microorganismally expressed detectable protein is detected in tumor, and also in normal organs or tissues, administration of an inducer can be suspended or postponed until the detectable protein is no longer detected in normal organs or tissues. In another example, when a microorganismally expressed detectable protein is detected at sufficient levels in tumor, an inducer can be administered to the subject. In another example, when a microorganismally expressed detectable protein is not detected at sufficient levels in tumor administration of an inducer can be suspended or postponed until the detectable protein is detected at sufficient levels in the tumor.
[0398] Also provided herein are methods of producing a protein or RNA in a tumor, by administering a microorganism encoding the protein or RNA, and a suppressor of gene expression. The suppressor of gene expression can be administered for a pre-defined period of time, or until the microorganism accumulated in tumor but not in normal organs or tissues, or until sufficient levels of the microorganism have accumulated in the tumor, at which point administration of the suppressor can be terminated or suspended, which can result in expression of the protein or RNA. As will be recognized by one skilled in the art, methods similar to those provided herein in regard to monitoring a detectable protein and administering an inducer, can also apply for terminating or suspending administration of a suppressor.
[0399] In one embodiment, the microorganism is a bacterium, for example, an attenuated bacterium, such as those provided herein. Exemplary bacteria include attenuated Salmonella typhimurium, attenuated Vibrio cholerae, attenuated Listeria monocytogenes or E. coli. Alternatively, viruses such as vaccinia virus, AAV, a retrovirus can be used in the methods provided herein. In exemplary methods, the virus is vaccinia virus. Other cells that can be used in the present methods include mammalian cells, such as fibroma cells, including human cells such as human fibroma cells.
[0400] Any of a variety of animals, including laboratory or livestock animals can be used, including for example, mice, rats and other rodents, rabbits, guinea pigs, pigs, sheep, goats, cows and horses. Exemplary animals are mice. The tumor can be generated by implanting tumor cells into the animal. Generally, for the production of a desired polypeptide, RNA, or compound, any solid tumor type can be used, such as a fast growing tumor type. Exemplary fast growing tumor types include C6 rat glioma and HCT116 human colon carcinoma. Generally, for the production of a desired antibody, a relatively slow growing tumor type can be used. Exemplary slow growing tumor types include HT1080 human fibrosarcoma and GI-101A human breast carcinoma. For T-independent antibody production, nu-/nu-mice bearing allogenic tumor or xenografts can be used; while for T-dependent antibody production, immunocompetent mice with syngenic tumors can be used. In some embodiments, such as where the compound to be produced is a protein, the microorganism selected can be a microorganism that uses the translational components (e.g., proteins, vesicles, substrates) of the tumor cells, such as, for example, a virus that uses the translational components of a tumor cell. In such instances, the tumor cell type can be selected according to the desired post-translational processing to be performed on the protein, including proteolysis, glycosylation, lipidylation, disulfide formation, and any refolding or multimer assembly that can require cellular components for completing. In some examples, the tumor cell type selected can be the same species as the protein to be expressed, thus resulting in species-specific post-translational processing of the protein; an exemplary tumor cell type-expressed protein species is human.
[0401] 1. Production of Recombinant Proteins and RNA Molecules
[0402] The tumor tissue can be surgically removed from the animal. After homogenization of the tumor tissue, the desired polypeptide, RNA or other biological compound can be purified according to established methods. For example, in the case of a recombinant polypeptide, the polypeptide might contain a bindable tag such as a his-tag, and can be purified, for example, via column chromatography. The time necessary for accumulation of sufficient amounts of the polypeptide or RNA in the tumor of the animal depends on many factors, for example, the kind of animal or the kind of tumor, and can be determined by the skilled person by routine experimentation. In general, expression of the desired polypeptide can be detected two days after virus injection. The expression peaks approximately two weeks after injection, and lasts up to two months. In some embodiments, the amount of desired polypeptide or RNA in the tumor can be determined by monitoring a microorganismally expressed detectable substance, where the concentration of the detectable substance can reflect the amount of desired polypeptide or RNA in the tumor.
[0403] In another embodiment, the desired polypeptide, RNA or other compound can be manufactured in the subject, and provide a beneficial effect to the subject. In one example, a microorganism can encode a protein or RNA, or a protein that manufactures a compound that is not manufactured by the subject. In one example, a microorganism can encode a peptide hormone or cytokine, such as insulin, which can be released into the vasculature of a subject lacking the ability to produce insulin or requiring increased insulin concentrations in the vasculature. In another example, blood clotting factors can be manufactured in a subject with blood clotting deficiency, such as a hemophiliac. In some embodiments, the protein or RNA to be produced in the tumor can be linked to an inducible promoter, such as a promoter that can be induced by increased glucose concentrations. In such instances, the manufacture of the protein or RNA can be controlled in response to one or more substances in the subject or by one or more substances that can be administered to a subject, such as a compound that can induce transcription, for example, RU486. Thus, in some embodiments, the methods provided herein can include administering to a subject having a tumor, a microorganism that can express one or more genes encoding a beneficial gene product or a gene product that can manufacture a beneficial compound.
[0404] 2. Production of Antibodies
[0405] Also provided are methods for producing a desired antibody, the method comprising the following steps: (a) administering a microorganism containing a nucleotide sequence encoding an antigen into an animal bearing a tumor; and (b) isolating the antibody directed to the antigen from the serum obtained from the animal. The antibodies directed to the antigen can be isolated and purified according to well known methods. Antibodies that are directed against specific contaminating antigens (e.g., bacteria antigens) can be removed by adsorption, and the antibodies directed against the target antigen can be separated from contaminating antibodies by affinity purification, for example, by immuno affinity chromatography using the recombinant antigen as the ligand of the column, by methods known in the art. Antibodies can be collected from the animal in a single harvest, or can be collected over time by collection bleeds, as is known in the art.
F. Pharmaceutical Compositions, Combinations and Kits
[0406] Provided herein are pharmaceutical compositions, combinations and kits containing a microorganism provided herein and one or more components. Pharmaceutical compositions can include a microorganism and a pharmaceutical carrier. Combinations can include two or more microorganisms, a microorganism and a detectable compound, a microorganism and a microorganism expression modulating compound, a microorganism and a therapeutic compound. Kits can include the pharmaceutical compositions and/or combinations provided herein, and one or more components such as instructions for use, a device for detecting a microorganism in a subject, a device for administering a compound to a subject, and a device for administering a compound to a subject.
[0407] 1. Pharmaceutical Compositions
[0408] Also provided herein are pharmaceutical compositions containing a modified microorganism and a suitable pharmaceutical carrier. Examples of suitable pharmaceutical carriers are known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions, etc. Such carriers can be formulated by conventional methods and can be administered to the subject at a suitable dose. Colloidal dispersion systems that can be used for delivery of microorganisms include macromolecule complexes, nanocapsules, microspheres, beads and lipid-based systems including oil-in-water emulsions (mixed), micelles, liposomes and lipoplexes. An exemplary colloidal system is a liposome. Organ-specific or cell-specific liposomes can be used in order to achieve delivery only to the desired tissue. The targeting of liposomes can be carried out by the person skilled in the art by applying commonly known methods. This targeting includes passive targeting (utilizing the natural tendency of the liposomes to distribute to cells of the RES in organs which contain sinusoidal capillaries) or active targeting (for example by coupling the liposome to a specific ligand, for example, an antibody, a receptor, sugar, glycolipid, protein etc., by well known methods). In the present methods, monoclonal antibodies can be used to target liposomes to specific tissues, for example, tumor tissue, via specific cell-surface ligands.
[0409] 2. Host Cells
[0410] Also provided herein are host cells that contain a microorganism provided herein such as a modified vaccinia virus. These host cells can include any of a variety of mammalian, avian and insect cells and tissues that are susceptible to microorganisms, such as vaccinia virus infection, including chicken embryo, rabbit, hamster and monkey kidney cells, for example, CV-1, BSC40, Vero, BSC40 and BSC-1, and human HeLa cells. Methods of transforming these host cells, of phenotypically selecting transformants etc., are known in the art.
[0411] 3. Combinations
[0412] Combinations can include a microorganism and one or more components. Any combination herein also can, in place of a microorganism, contain a pharmaceutical composition and/or a host cell containing a microorganism and one or more components.
[0413] Exemplary combinations can contain two or more microorganisms, a microorganism and a detectable compound, a microorganism and a microorganism expression modulating compound, or a microorganism and a therapeutic compound. Combinations that contain two or more microorganisms can contain, for example, two or more microorganisms that can both be administered to a subject in performing the methods provided herein, including sequentially administering the tow microorganisms. In one example, a combination can contain a virus and a bacterium, where, for example, the virus can first be administered to the subject, and the bacterium can be subsequently administered to the subject.
[0414] Combinations provided herein can contain a microorganism and a detectable compound. A detectable compound can include a ligand or substrate or other compound that can interact with and/or bind specifically to a microorganismally expressed protein or RNA molecule, and can provide a detectable signal, such as a signal detectable by tomographic, spectroscopic or magnetic resonance techniques. Exemplary detectable compounds can be, or can contain, an imaging agent such as a magnetic resonance, ultrasound or tomographic imaging agent, including a radionuclide. The detectable compound can include any of a variety of compounds as provided elsewhere herein or are otherwise known in the art. Typically, the detectable compound included with a microorganism in the combinations provided herein will be a compound that is a substrate, a ligand, or can otherwise specifically interact with, a protein or RNA encoded by the microorganism; in some examples, the protein or RNA is an exogenous protein or RNA. Exemplary microorganisms/detectable compounds include a microorganism encoding luciferase/luciferin, f3-galactosidase/(4,7,10-tri(acetic acid)-1-(2-.beta.-galactopyranosylethoxy)-1,4,7,10-tetraazacyclododecane) gadolinium (Egad), and other combinations known in the art.
[0415] Combinations provided herein can contain a microorganism and a microorganism gene expression modulating compound. Compounds that modulate gene expression are known in the art, and include, but are not limited to, transcriptional activators, inducers, transcriptional suppressors, RNA polymerase inhibitors, and RNA binding compounds such as siRNA or ribozymes. Any of a variety of gene expression modulating compounds known in the art can be included in the combinations provided herein. Typically, the gene expression modulating compound included with a microorganism in the combinations provided herein will be a compound that can bind, inhibit, or react with one or more compounds active in gene expression such as a transcription factor or RNA, of the microorganism of the combination. An exemplary microorganism/expression modulator can be a microorganism encoding a chimeric transcription factor complex having a mutant human progesterone receptor fused to a yeast GAL4 DNA-binding domain an activation domain of the herpes simplex virus protein VP16 and also containing a synthetic promoter containing a series of GAL4 recognition sequences upstream of the adenovirus major late E1B TATA box, where the compound can be RU486 (see, e.g., Yu et al., Mol Genet Genomics 2002 268:169-178). A variety of other microorganism/expression modulator combinations known in the art also can be included in the combinations provided herein.
[0416] Combinations provided herein can contain a microorganism and a therapeutic compound. Therapeutic compounds can include compounds that are substrates for microorganismally expressed enzymes, compound that can kill or inhibit microorganism growth or toxicity, or other therapeutic compounds provided herein or known in the art to act in concert with a microorganism. Typically, the therapeutic compound included with a microorganism in the combinations provided herein will be a compound that can act in concert with a microorganism, such as a substrate of an enzyme encoded by the microorganism, or an antimicroorganismal agent known to be effective against the microorganism of the combination. Exemplary microorganism/therapeutic compound combinations can include a microorganism encoding Herpes simplex virus thymidine kinase/gancyclovir, and streptococcus pyogenes/penicillin. Any of a variety of known combinations provided herein or otherwise known in the art can be included in the combinations provided herein.
[0417] 4. Kits
[0418] Kits are packaged in combinations that optionally include other reagents or devices, or instructions for use. Any kit provided herein also can, in place of a microorganism, contain a pharmaceutical composition, a host cell containing a microorganism, and/or a combination, and one or more components.
[0419] Exemplary kits can include the microorganisms provided herein, and can optionally include one or more components such as instructions for use, a device for detecting a microorganism in a subject, a device for administering a compound to a subject, and a device for administering a compound to a subject.
[0420] In one example, a kit can contain instructions. Instructions typically include a tangible expression describing the microorganism and, optionally, other components included in the kit, and methods for administration, including methods for determining the proper state of the subject, the proper dosage amount, and the proper administration method, for administering the microorganism. Instructions can also include guidance for monitoring the subject over the duration of the treatment time.
[0421] In another example, a kit can contain a device for detecting a microorganism in a subject. Devices for detecting a microorganism in a subject can include a low light imaging device for detecting light, for example emitted from luciferase, or fluoresced from green fluorescence protein, a magnetic resonance measuring device such as an MRI or NMR device, a tomographic scanner, such as a PET, CT, CAT, SPECT or other related scanner, an ultrasound device, or other device that can be used to detect a protein expressed by the microorganism within the subject. Typically, the device of the kit will be able to detect one or more proteins expressed by the microorganism of the kit. Any of a variety of kits containing microorganisms and detection devices can be included in the kits provided herein, for example, a microorganism expressing luciferase and a low light imager, or a microorganism expressing green fluorescence protein and a low light imager.
[0422] Kits provided herein also can include a device for administering a microorganism to a subject. Any of a variety of devices known in the art for administering medications or vaccines can be included in the kits provided herein. Exemplary devices include a hypodermic needle, an intravenous needle, a catheter, a needle-less injection device, an inhaler, and a liquid dispenser such as an eyedropper. Typically, the device for administering a microorganism of the kit will be compatible with the microorganism of the kit; for example, a needle-less injection device such as a high pressure injection device can be included in kits with microorganisms not damaged by high pressure injection, but is typically not included in kits with microorganisms damaged by high pressure injection.
[0423] Kits provided herein also can include a device for administering a compound to a subject. Any of a variety of devices known in the art for administering medications to a subject can be included in the kits provided herein. Exemplary devices include a hypodermic needle, an intravenous needle, a catheter, a needle-less injection an inhaler, and a liquid dispenser. Typically the device for administering the compound of the kit will be compatible with the desired method of administration of the compound. For example, a compound to be delivered subcutaneously can be included in a kit with a hypodermic needle and syringe.
G. Examples
[0424] The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention.
Example 1
Generation of Recombinant Viruses
[0425] A Wild type vaccinia virus (VV) strain LIVP (the well known viral strain, originally derived by attenuation of the strain Lister from the ATCC under Accession Number VR-1549, from the Institute of Viral Preparations, Moscow, Russia; see, Al'tshtein et al., (1983) Dokl. Akad. Nauk USSR 285:696-699) designed as VGL was used as a parental virus for the construction of recombinant viruses designated RVGLX herein. All vaccinia viruses were purified using sucrose gradient (Yoklik). VVs were propagated and titers were determined by plaque assays using CV-1 cells (ATCC No. CCL-70). Methods for constructing recombinant vaccinia viruses are known to those of skill in the art (see, e.g., Chakrabarti et al., (1985 Mol. Cell Biol. 5:3403 and U.S. Pat. No. 4,722,848)). Table 1 summarizes the recombinant VV strains described in this Example.
[0426] Inactivation of VV by PUV Treatment
[0427] LIVP VV (3.times.10.sup.8 pfu/ml) was incubated with 1 .mu.g/ml psoralen (Calbiochem, La Jolla, Calif.), suspended in Hank's buffer at room temperature for 10 min, and then irradiated for 5 min in Stratalinker 1800 UV crosslinking unit (Stratagene, La Jolla Calif.) equipped with five 365 nm long wave UV bulb to produce PUV-VV.
RVGL8: LacZ Insertion into F3 of LIVP
[0428] Construction of recombinant vaccinia virus RVGL8 containing a lacZ gene inserted the NotI site was prepared as described in Timiryasova et al. (2001), BioTechniques 31, 534-540. Briefly it was prepared as follows. The BamHI/SmaI fragment (3293 bp) of pSC65 (see, Chakrabarti et al. (1997), BioTechniques 23, 1094-1097; see, also Current Protocols in Molecular Biology, Green Publishing and Wiley-Interscience Supplement 15:16.17.2 (1992); see also SEQ ID NO: 5 herein and SEQ ID NO: 57 in PCT International application No. WO 99/32646) containing the lacZ gene under the control of the vaccinia p7.5 promoter and strong synthetic vaccinia pE/L promoter was isolated by digestion with restriction enzymes, blunted with Klenow enzyme, and cloned into SmaI site of pNT8 plasmid (Timiryasova et al. (2001), BioTechniques 31: 534-540) to produce pNZ2 a shuttle plasmid.
[0429] To construct pNT8, the NotI region of the wild type VV strain LIVP was amplified using the following primers:
TABLE-US-00001 Forward: (SEQ ID NO: 3) 5'-GGGAATTCTTATACATCCTGTTCTATC-3'; Reverse: (SED ID NO: 4) 5'-CCAAGCTTATGAGGAGTATTGCGGGGCTAC-3'
with the VV as a template. The resulting 972 bp fragment contained flanking EcoRI and HindIII sites at the 5' and 3' ends, respectively. The PCR product was cleaved with EcoRI and HindIII and inserted in pUC28 (Benes et al., (1993) Gene 130: 151. Plasmid pUC28 is prepared from pUC18 (available from the ATCC under Accession Number 37253 by introducing a synthetic oligo adaptor using primers: pUC28 I: 5'AATTCAGATCTCCATGGATCGATGAGCT 3' (SEQ ID NO: 6); pUC28 II: 3'GTCTAGAGGTACCTAGCTAC 5' (SEQ ID NO: 7) into the EcoRI and SstI sites of pUC18. This introduces BglII, ClaI, and NcoI sites into the polylinker of pUC18.
[0430] Plasmid pNZ2 contains cDNA encoding the E. coli lacZ gene under the control of the vaccinia virus early/late promoter p7.5 and a synthetic early/late vaccinia pE/L promoter derived from the plasmid pSC65 (see, Chakrabarti et al. (1997), BioTechniques 23, 1094 1097; see, also Current Protocols in Molecular Biology, Green Publishing and Wiley-Interscience Supplement 15:16.17.2 (1992); see also SEQ ID NO: 5 herein and SEQ ID NO: 57 in PCT International application No. WO 99/32646). Plasmid pNZ2 provides for homologous recombination of lacZ into the NotI site of the VGL virus (ATCC VR-1549), to produce the recombinant vaccinia virus designated RVGL8. The complex of wild type vaccinia virus DNA digested with NotI and not digested plasmid DNA pNZ2 was transfected for in vivo recombination into PUV VV infected cells to produce RVGL8 (see FIG. 1). RVGL8 and the other recombinant vaccinia viruses described herein are listed in Table 1, below.
[0431] Mutant Virus Formation/Transfection
[0432] CV-1 African green monkey kidney fibroblasts (ATCC No. CCL-70) grown on 60 mm dishes (Corning, Corning, N.Y., USA) were infected with PUV-VV (strain LIVP treated with psoralen and UV; see, e.g., Tsung et al. (1996), J. Virol. 70, 165-171; Timiryasova et al. (2001), BioTechniques 31, 534-540; Timiryasova et al. (2001), J. Gene 3 Med. 3, 468-477) at multiplicity of infection (MOI) of 1.
[0433] Two hours post-infection, the cells were transfected with a mixture of NotI-digested viral DNA (4:g) and intact plasmid DNA (4:g). Lipid-mediated transfection of cells was carried out using 5:1 of GenePORTER reagent (Gene Therapy Systems, San Diego, Calif., USA) per:g of the DNA according to manufacturers' instructions. Cells were incubated in transfection mixture for 4 h and then supplemented with a medium containing 20% of fetal bovine serum. Cytopathic effects were monitored daily by light microscopy. Cells were incubated for 5-7 days until formation of the virus plaques and complete cytopathic effect. Then, infected cells were harvested, resuspended in 0.5 ml of medium, and frozen and thawed three times to release the virus. Single virus plaques were selected for the preparation of small and large recombinant virus stocks and analyzed for the insertion and expression of the genes.
[0434] Confirm Mutant
[0435] Viral DNA was analyzed by Southern blots. Briefly, to isolate viral DNA, confluent monolayers of CV-1 cells, grown on 10 cm plates, were infected with the wild type VV (strain LIVP) or VV of the virus stock obtained from a single recombinant plaque. When the cytopathic effect was complete, cells were harvested and the pellet was resuspended in 3 ml of 10 mM Tris-HCl, pH 9.0. Viral particles were lysed, treated with proteinase K, and the virus DNA was isolated by phenol/chloroform extraction, followed by ethanol precipitation. The DNA was resuspended in 100:1 of sterile water. The viral DNA samples were digested by NotI overnight at 37.degree. C., followed by phenol-chloroform treatment, precipitated and 10 Tg of DNA samples were separated through a 0.8% agarose gel. The DNA was transferred to a positively charged nylon membrane (Roche Diagnostics Corporation, Indianapolis, Ind., USA) and fixed to the membrane using a GS Gene Linker (Bio-Rad Laboratories, Hercules, Calif., USA). The DIG-labeling of DNA was performed using a nonradioactive DNA labeling and detection kit (Roche Diagnostics Corporation) and incubating for 60 min at 37.degree. C. The membrane was hybridized with a denatured DIG-labeled 3357 bp NotI-NotI DNA fragment of the plasmid pNZ2 encoding the lacZ gene. Hybridization conditions and blot development were performed as suggested by the manufacturer.
[0436] The predicted size of the band is 3357 bp. The hybridization of NotI digested viral DNAs with a 3357 bp DNA probe confirmed the integration of the lacZ gene into NotI site of virus genome.
[0437] Construction of RVGL2 and RVGL23 Viruses with a Single TK Gene Mutation
[0438] Vaccinia virus LIVP was used for the construction of recombinant virus RVGL2. Vaccinia virus Western Reserve (WR) was used for the construction of recombinant virus RVGL23. The cDNA of Renilla luciferase and Aequorea GFP fusion (ruc-gfp; 1788 bp; see, Wang et al., (1996) Bioluminescence Chemiluminescence 9:419-422; Wang et al., (2002) Mol. Genet. Genomics 268:160-168; Wang et al. (1997) pp 419-422 in Bioluminescence and Chemiluminescence: molecular reporting with photons, Hastings et al., eds., Wiley, Chicheser UK; see, also U.S. Pat. No. 5,976,796; see also SEQ ID NO: 8 herein, which sets forth a sequence for a ruc-gfp construct) was excised from plasmid pcDNA-ruc-gfp (RG), which is described in Wang et al., (1996) Bioluminescence Chemiluminescence 9:419-422 and Wang et al., (2002) Mol. Genet. Genomics 268:160-168 and briefly below, by restriction endonuclease PmeI and inserted into the SmaI site of pSC65 plasmid (see SEQ ID NO: 5; see, also herein and SEQ ID NO: 57 in PCT International application No. WO 99/32646), resulting in pSC65-RG-1 plasmid DNA.
[0439] Briefly to prepare pcDNA-ruc-gfp, the EcoRI-NotI fragment encoding the modified Renilla luciferase-ending DNA (see, Wang et al. (1997) pp 419-422 in Bioluminescence and Chemiluminescence: molecular reporting with photons, Hastings et al., eds., Wiley, Chicheser UK) was cloned into the pcDNA3.1 vector (Invitrogen, Carlsbad, Calif.), placing expression of the Renilla luciferase under control of the CMV promoter. The stop codon at the end of the Renilla luciferase ORF was removed, and the resulting plasmid digested with NotI. The NotI fragment containing the ORF encoding humanized Aequorea GFP (Zolotukhin et al., (1996) J. Virol. 70:4646-4654) was excised from the pTR-.beta.-actin plasmid and inserted into the NotI site of the plasmid encoding the Renilla luciferase. The resulting plasmid was designated pcDNA-ruc- the ruc-gfp.
[0440] New plasmid pSC65-RG-1 containing ruc-gfp fusion under the control of the vaccinia PE/L promoter and E. coli .beta.-galactosidase under control of p7.5 promoter of VV was used for the construction of a single TK gene interrupted virus RVGL2 of strain LIVP and RVGL23 of strain WR. CV-1 cells were infected with wt LIVP or wt WR virus at MOI of 0.1, and two hours later, pSC65-RG-1 plasmid DNA was transfected using FuGene6 transfection reagent (Roche). After 24 h of incubation, cells were three times frozen and thawed to release the virus. Recombinant viruses were screened on CV-cells in the presence of substrate 5-bromo-4-chloro-3-indolyl-.beta.-D-galactopyranoside (X-gal, Stratagene, Cedar Creek, Tex., USA). After four cycles of virus purification, all virus plaques were positive for .beta.-galactosidase expression. The expression of the ruc-gfp fusion protein was confirmed by luminescence assay and fluorescence microscopy, respectively. Schematic maps of the viruses are set forth in FIG. 1.
[0441] Construction of RVGL5 and RVGL9 Viruses with Single Gene Mutations
[0442] Recombinant vaccinia virus RVGL5 contains the lacZ gene under the control of the vaccinia late p11 promoter inserted into the HA gene of vaccinia genome (Timiryasova et al. (1993) Mol Biol 27:392-402; see, also, Timiryasova et al., (1992) Oncol. Res 11:133-144.). Recombinant vaccinia virus RVGL9 contains a fusion of the Renilla luciferase gene (ruc) and cDNA of green fluorescence protein (GFP) under the control of a synthetic early/late vaccinia promoter (PE/L) inserted into the F3 gene of the VV genome (Timiryasova et al., (2000)) pp. 457-459 in Proceedings of the 11th International Symposium on Bioluminescence and Chemiluminescence, Case et al., eds). RVGP5 and RVGLP9 were constructed as described for RVGLP2 and RVGLP23.
[0443] Construction of RVGL20 Virus with Double TK and F3 Gene Mutations
[0444] The cDNA of human transferrin receptor (hTR) (2800 bp) with polyA sequence was isolated from pCDTR1 plasmid (ATCC Accession No. 59324 and 59325) by BamHI, treated with Klenow and inserted into SalI site of pSC65 plasmid (SEQ ID NO: 5 herein and SEQ ID NO: 57 in PCT International application No. WO 99/32646), resulting in pSC-TfR and pSC-rTfR. Plasmid pSC-rTfR contains cDNA hTR in an orientation opposite to the vaccinia PE/L promoter and E. coli .beta.-galactosidase under control of the early/late vaccinia p7.5 promoter flanked by vaccinia sequences for insertion into vaccinia TK gene. pSC-rTfR was used for the construction of RVGL20 virus. RVGL9, a recombinant virus with single deletion carrying ruc-gfp fusion in the F3 gene locus, which contains a unique NotI site in the LIVP strain (see above, see, also, Timiryasova et al., (2000) pp. 457-459 in Proceedings of the 11.sup.th International Symposium on Bioluminescence and Chemiluminescence, Case et al., eds), was used as a parental virus for the creation of RVGL20 virus by homologous recombination as described above. A schematic of RVGL20 virus is set forth in FIG. 1.
[0445] Construction of RVGL21 Virus with Triple TK, F3 and HA Gene Mutations
[0446] The cDNA of the .beta.-glucuronidase (gus) of E. coli (1879 bp) was released from pLacGus plasmid (Invitrogen; see SEQ ID NO: 9 herein) with XbaI (blunt ended with Klenow fragment) and HindIII, and cloned into pSC11 plasmid pSC65 (Chakrabarti et al. (1985) Mol. Cell Biol. 5:3403-3409; SEQ ID NO: 5 herein and SEQ ID NO: 57 in PCT International application No. WO 99/32646) digested with XhoI (treated with Klenow) and HindIII under the control of a vaccinia p11 late promoter, resulting in a plasmid pSC-GUS. The SmaI-HindIII fragment from pSC-GUS plasmid was inserted into pVY6 plasmid, a vector for inserting antigen genes into the hemagglutinin gene of vaccinia (see, e.g., Flexner et al., (1988) Nature 355:259-262; Flexner et al., (1988) Virology 166: 339-349; see also U.S. Pat. No. 5,718,902) digested with SmaI and BamHI, resulting in pVY-GUS plasmid. The resulting plasmid, designated pVY-GUS plasmid, contains the cDNA encoding gus under the control of the vaccinia late promoter p11 flanked by vaccinia sequences for insertion into the hemagglutinin (HA) gene. Recombinant virus RVGL20 with double deletions was used as the parental virus for the construction of RVGL21 virus. CV-1 cells were infected with RVGL20 virus at MOI of 0.1. Two hours after infection, cells were transected with pVY-GUS plasmid DNA using FuGene6 transfection reagent (Roche). Recombinant virus plagues were selected in CV-1 cells by color screening upon addition of .beta.-glucuronidase substrate 5-bromo-4-chloro-3-indolyl-.beta.-D-glucuronicacid (X-GlcA) (Research Products Int. Co., Mt. Prospect, Ill., USA) into agar medium. After eight cycles of purification in agar medium in the presence of X-GlcA pure recombinant virus RVGL21 was selected. RVGL21 virus has interruptions of TK, F3 and HA genes and is presented schematically in FIG. 1.
[0447] In Vitro Virus Growth
[0448] CV-1, C6 (ATCC No. CCL-107), B16-F10 (ATCC No. CRL-6475), and GI-101A (Rumbaugh-Goodwin Institute for Cancer Research Inc. Plantation, Fla.; U.S. Pat. No. 5,693,533) cells were seeded in 24-well plates at the density of 1.times.10.sup.5, 2.times.10.sup.5, 4.times.10.sup.5, and 2.times.10.sup.5 cells/well, respectively. The next day, the cells were simultaneously infected with 0.001 or 0.01 PFU/cell of a wild type LIVP and its mutants. The virus suspension was added to cell monolayer (0.15 ml/well) and incubated at 37.degree. C. for 1 h with brief agitation every 10 min. Then, the virus was removed, appropriate complete growth medium was added (1 ml/well), and the cells were then incubated at 37.degree. C. for 24, 48, 72 and 96 h after virus infection. To establish resting cell culture, a confluent monolayer of CV-1 cells was incubated for 6 days in DMEM with 5% FBS at 37.degree. C. These resting cells were infected and harvested at the same time points after infection as described above. Virus from the infected cells was released by one cycle of freezing and thawing. Viral titers were determined in duplicates by plaque assay on CV-1 cells and expressed as PFU/ml.
TABLE-US-00002 TABLE 1 List of recombinant vaccinia viruses (VV) Prior InsertionLocus/ Designation Designation Description loci Reference VGL wt VV strain LIVP No Publicly available VV Insertions RVGL1 recVV2 (p7.5) Luc- HindIII-N- Timiryasova T M, (p11) LacZ of Interrupted Kopylova-Sviridova T N, LIVP VV Fodor I. Mol. Biol. (Russian) 27: 392-401 (1993); Timiryasova T M, Li J, Chen B. Chong D. Langridge W H R, Gridley D S, Fodor I. Oncol. Res. 11: 133-144 (1999) RVGL5 recVV8 (p11) LacZ of HA- Timiryasova T M, LIVP VV Interrupted Kopylova-Sviridova T N, Fodor I. Mol. Biol. (Russian) 27: 392-401 (1993) RVGL7 rVV-EGFP (PE/L) EGFP- TK- Umphress S, Timiryasova T., or (p7.5) LacZ of Interrupted Arakawa T, Hilliker S, rVV-GFP LIVP VV Fodor I, Langridge W. Transgenics 4: 19-33 (2003) RVGL8 rVV-Not-LacZ (p7.5) LacZ of NotI (F3)- Timiryasova T M, or LIVP VV Interrupted Chen B, Fodor N, rVV-Not-LZ Fodor I. BioTechniques 31: 534-540 (2001) RVGL9 rVV-RG (PE/L) NotI (F3)- Timiryasova T M, Yu Ya, or Ruc-GFP of Interrupted Shabahang S, rVV-ruc-gfp LIVP VV Fodor I, Szalay A A. Proceedings of the 11.sup.th International Symposium on Bioluminescence & Chemiluminescence pp. 457-460 (2000) RVGL12 Same as RVGL7, except that HSV TK is inserted in place of gfp RVGL19 (PE/L) TK- and Herein Trf-(p7.5) NotI (F3)- LacZ in Tk Interrupted locus (PE/L) Ruc-GFP in F3 locus of LIVP VV RVGL20 (PE/L) Tk- and Herein rTrf-(p7.5) NotI (F3)- LacZ in TK Interrupted locus (PE/L) Ruc-GFP in F3 locus of LIVP V RVGL21 (PE/L) Tk-, HA- Herein rTrf-(p7.5) interrupted LacZ in TK and NotI locus, (p11) (F3)- LacZ in HA Interrupted locus, (PE/L) Ruc-GFP in F3 locus of LIVP VV RVGL23 (PE/L) Tk- Herein rTrf-(p7.5) Interrupted LacZ in TK locus of WR VV
Example 2
In Vitro Analysis of Virus Levels
[0449] LacZ
[0450] Analysis of lacZ expression induced by recombinant vaccinia virus was performed as described previously (Timiryasova et al. (2001), BioTechniques 31, 534-540). Briefly, CV-1 cells grown 6-well plates (Corning, Corning, N.Y., USA) were infected with ten-fold dilutions of the virus stock. The virus was allowed to absorb for 1 h at 37.degree. C. with occasional rocking. Then, the virus inoculum was replaced with a complete medium containing 1% of agar, and the incubation was carried out for 48 h. To visualize the virus plaques, 300 Tg of X-Gal (Molecular Probes, Eugene, Oreg., USA) per ml and 0.1% of neutral red (Sigma, St. Louis, Mo., USA) were added to the second agar overlay, and plaques were counted and isolated after 12 h incubation at 37.degree. C. Levels of vaccinia virus in cells in vitro could also be determined by measuring the plaque forming units (PFU) in the cells.
In Vitro Infectivity of VV's Measured by Plaque Forming Units
[0451] The ability of wt LIVP virus and its mutants to infect and replicate was analyzed in dividing and resting CV-1 cells as well as in three tumor cell lines (C6, GI-101A, B16-F10). The results demonstrate that vaccinia mutants can efficiently infect and replicate in dividing CV-1 cells at an MOI of 0.001. A significant yield of vaccinia virus was obtained from dividing CV-1 cells. The yield of wt VV and its mutants in dividing CV-1 cells was about 10 times higher than in resting CV-1 cells. There was no significant difference in viral recovery between vaccinia mutants and wt virus in vitro studies. The interruption of TK, F3 and HA genes made no difference to VV mutants replication in the dividing CV-1 cells. Three tumor cells were tested. The relative sensitivities to cytopathic effects at MOI of 0.001 were follows: CV-1 (dividing, highest), CV-1 (resting), C6, GI-101A, B16-F10 (lowest). Mouse B16-F10 melanoma cells were not sensitive to virus infection at MOI of 0.001. Very low viral titer was recovered from melanoma cells infected at MOI of 0.01. Also observed was that wt WR strain was able to infect melanoma cells in vitro more efficiently compared to LIVP strain and virus recovery was higher compared to LIVP strain.
Example 3
Animal Models and Assays
[0452] Animal Models
[0453] Athymic nude mice (nu/nu) and C57BL/6 mice (Harlan Animal Res., Inc., Wilmington, Mass.) at 6-8 weeks of age were used for animal studies. Mice in groups of five or four were infected i.v. with 10.sup.7PFU of VV in a volume of 0.1 ml i.v. Mice were imaged by low-light imager and fluorescence imager for ruc and for gfp expression, respectively. The study was approved prior to initiation by the Animal Research Committee of LAB Research International Inc. (San Diego, Calif., USA). All animal care was performed under the direction of a licensed veterinarian of LAB Research International Inc. (San Diego, Calif., USA).
[0454] Glioma Model
[0455] To establish subcutaneous glioma tumor, rat glioma C6 cells (ATCC No. CCL-107) were collected by trypsinization, and 5.times.10.sup.5 cells/0.1 ml/mouse were injected subcutaneously (s.c.) into right hind leg of 6-8 week old male athymic mice. On day 7 after C6 cell implantation when median tumor size was about 150 mm.sup.3, viruses at the dose of 10.sup.7 PFU/0.1 ml/mouse were injected intravenously (i.v.). Mice were sacrificed 14 days after virus injection. In the kinetic studies using of RVGL9 virus, mice were sacrificed at 20 min, 1 h, 4 h, 18 h, 36 h, 3 d, 5 d, 7 d and 14 days after virus injection.
[0456] Breast Tumor Model
[0457] To develop sub cutaneous (s.c). breast tumor, human breast cancer GI-101 A cells (Rumbaugh-Goodwin Institute for Cancer Research Inc. Plantation, Fla.; U.S. Pat. No. 5,693,533) at the dose of 5.times.10.sup.6 cells/0.1 ml/mouse were injected s.c. into the right hind leg of 6-8 week old female athymic mice. On day 30 after GI-101A cell implantation, when median tumor size was about 500 mm.sup.3, viruses at the dose of 10.sup.7 PFU/mouse were injected i.v. Mice were sacrificed on day 14 after virus injection. Mice for survival experiments and breast tumor therapy studies were kept for long time periods (more than 100 days after virus injection). Mice that developed tumor with the size about 4000 mm.sup.3, and/or lost 50% of body weight were sacrificed.
[0458] Melanomal Model
[0459] For a melanoma model, mouse melanoma B16-F10 cells (ATCC No. CRL-6475) at the dose of 2.times.10.sup.5 cells/0.04 ml/mouse were injected into the foot pad of 6-8 week old male C57BL/6 mice. When the tumor was established (median size of tumor about 100 mm.sup.3), on day 18 after cell implantation, viruses at the dose of 10.sup.7/mouse were injected i.v. Mice were sacrificed 10 days after virus injection.
[0460] Vaccinia Virus in Animal Models
[0461] Vaccinia Virus Recovery from Tumor and Organs of Nude Mice
[0462] From sacrificed animals blood was collected, and organs (lung, liver, spleen, kidneys, testes, ovaries, bladder, brain, heart) and tumors were harvested and homogenized in PBS containing a mixture of protease inhibitors. Scissors and forceps were changed after each organ dissection or incision to avoid cross-contamination of the tissues. Samples were frozen and thawed, centrifuged at 1,000 g for 5 min. Viral titer was determined in the supernatant diluted in serum-free medium on CV-1 cells by plaque assay and staining them with 1% (wt/vol) crystal violet solution after 48 h incubation. Each sample was assayed in duplicate and viral titer was expressed as mean PFU/g of tissue.
[0463] Assay Measurements
[0464] Survival studies were performed on 6-week old nude mice bearing s.c. human breast tumor. Mice were injected i.v. with 10.sup.7 of vaccinia viruses and followed for survival. Individual body weight was measured twice a week. Gain/loss of body weight after virus infection was calculated as the percentage: body weight (g)-tumor weight (g) on day of virus injection/body weight (g)-tumor weight (g) on day of monitoring.times.100%. Spleens were excised from euthanized animals and weighed. The RSW was calculated as follows: RSW=weight of spleen (g).times.10.sup.4/animal body weight (g)-tumor weight (g). Mice were euthanized when the mean tumor volume reached 3000 mm.sup.3 or developed the signs of disease. Rapid CO.sub.2 euthanasia was humanely performed in compliance with the NIH Guide for the Care and Use of Laboratory Animals.
[0465] Reporter Genes Assays
[0466] LacZ
[0467] E. coli .beta.-galactosidase activity in tissue samples and in the serum of the mice was determined using chemiluminescent Galacto-Light Plus.TM. Assay system (Applied Biosystems, Bedford, Mass., USA) according to the instructions of the kit manufacturer. Briefly, 1-20 .mu.l of the sample was transferred into the tube with 200 .mu.l of 1:100 diluted Reaction Buffer Diluent and incubated at RT for 30 min. A 300 .mu.l aliquot of accelerator (-II) was added into the tube with the sample, mixed quickly and the signal was read using luminometer. .beta.-galactosidase activity was expressed as relative light units (RLU) per g of tissue. Purified E. coli .beta.-galactosidase (Sigma) was used as a positive control and to generate a standard curve.
[0468] Luciferase
[0469] Renilla luciferase activity was measured in the supernatant of the tissue samples after they had been homogenized using a Turner TD 20e luminometer (Turner Designs, Sunnyvale, Calif., USA) as described previously (Yu and Szalay, 2002) with some modifications. In brief, 20 .mu.l of the samples was added into 500 .mu.l of luciferase assay buffer (0.5 M NaCl, 1 mM EDTA, 0.1 M potassium phosphate pH 7.4) containing a substrate coelenterazine. Luciferase activity was measured during 10-s interval and expressed as RLU per g of tissue.
Assay Results
[0470] Presence of RVGL9 Over Time
[0471] A vaccinia virus RVGL9 with a single F3 gene mutation and carrying ruc-gfp was used to assess the pattern of vector tissue distribution following i.v. administration into immunocompromised athymic mice bearing s.c. glioma tumors. The tissue distribution data using this recombinant virus showed virus distribution and tumor targeting by this VV strain. Kinetics studies were performed by noninvasive imaging of virus replication in the mice based on ruc and gfp expression. Four to five animals per group bearing s.c. rat glioma C6 tumor were injected with 10.sup.7 of RVGL9 virus via the tail vein. The animals were sacrificed at 20 min, 1, 4, 18 and 36 hours, 3, 5, and 14 days after virus injection. No viable viral particles were recovered from brain, bladder or testes at any time point after i.v. injection of virus. Some viral particles were recovered from spleen, heart and lung at early time points after virus injection. After 18 h post-infection, the titer of RVGL9 virus in these organs decreased. No virus was recovered in the heart tissue after 18 h; around 156.5 and 44 PFU/g tissue was recovered from spleen and lung, respectively, on day 14 as compared to 3221.0 and 3521.9 PFU/g tissue at 20 min after virus injection, respectively. The pattern of virus recovery from liver and kidneys was different from the pattern in the spleen, heart, or lung. No virus in the kidneys and 174.9 PFU/g tissue of virus was recovered from liver at an early time after virus injection. On day 5 after virus injection, the titer of virus in these organs increased and went down on day 14 post virus injection. In tumor tissue virus was detected starting 18 h after virus administration (1.6.times.10.sup.3 PFU/g tissue), and dramatically increased over the time of observation (1.8.times.10.sup.8 PFU/g tissue on day 7). Virus in the tumor tissue was detectable for more then 60 days after a single i.v. virus injection. The results demonstrate tumor-specific replication of these vaccinia mutants. A correlation was observed between the virus recovery and the transgene expression in tumors and in organs. Based on the data of RVGL9 virus kinetics, day 10 or day 14 was used for tissue distribution studies of different vaccinia mutants in melanoma and glioma and breast tumor models, respectively.
[0472] Presence of Various VV in Mice Bearing a Glioma Tumor
[0473] To examine tissue distribution of vaccinia virus in immunodeficient mice bearing an s.c. glioma tumor, viruses were injected i.v. at a dose of 1.times.10.sup.7 PFU/0.1 ml/mouse on day 7 after C6 rat glioma cell implantation. Fourteen days after virus injection, mice were sacrificed and virus titer was determined in different tissues. Mice injected with wt WR virus were sick and dying due to viral pathogenicity. Hence, WR-injected mice were sacrificed on day 7 after virus injection. Wild type LIVP virus was recovered from all analyzed tissues as well as from brain. The amount of recovered virus particles from the mice injected with wt LIVP was much lower than wt WR strain of VV. The results are presented in Table 1A.
TABLE-US-00003 TABLE 1A Viral recovery from nude mice tissues in glioma model..sup.a RVGL21 LIVP RVGL2 RVGL5 RVGL9 RVGL20 TK-, F3-, WR.sup.b RVGL23 Wt TK- HA- F3- TK-, F3- HA- Wt TK-, WR Brain 1.2 .times. 10.sup.3 1.4 .times. 10.sup.3 0 0 0 0 1.4 .times. 10.sup.7 1.9 .times. 10.sup.6 Kidneys 6.1 .times. 10.sup.2 6.7 .times. 10.sup.2 1.6 .times. 10.sup.2 34.6 33.3 36.6 5.4 .times. 10.sup.6 7.9 .times. 10.sup.2 Lung 2.9 .times. 10.sup.3 0 1.6 .times. 10.sup.2 1.4 .times. 10.sup.4 6.7 .times. 10.sup.3 2.4 .times. 10.sup.3 1.9 .times. 10.sup.6 2.1 .times. 10.sup.3 Spleen 1.9 .times. 10.sup.2 0 1.8 .times. 10.sup.2 1.0 .times. 10.sup.3 1.0 .times. 10.sup.2 1.7 .times. 10.sup.2 1.6 .times. 10.sup.6 1.8 .times. 10.sup.3 Testes 5.8 .times. 10.sup.4 64.3 6.4 .times. 10.sup.2 7.5 .times. 10.sup.2 0 0 9.8 .times. 10.sup.4 1.7 .times. 10.sup.3 Bladder 6.4 .times. 10.sup.3 0 0 2.9 .times. 10.sup.3 0 0 2.8 .times. 10.sup.5 1.2 .times. 10.sup.3 Liver 3.4 .times. 10.sup.4 63.6 4.2 .times. 10.sup.2 33.6 96.6 30.8 7.1 .times. 10.sup.3 5.6 .times. 10.sup.3 Heart 6.0 .times. 10.sup.3 0 0 0 0 0 1.4 .times. 10.sup.5 0 Serum.sup.c 0 0 0 0 0 0 6.0 .times. 10.sup.2 0 Tumor 5.4 .times. 10.sup.7 1.5 .times. 10.sup.7 3.8 .times. 10.sup.7 2.9 .times. 10.sup.7 3.9 .times. 10.sup.7 1.9 .times. 10.sup.7 1.9 .times. 10.sup.8 3.7 .times. 10.sup.7
The results demonstrate that 10000-fold more virus was recovered in the brain of mice injected with WR strain versus wt LIVP strain. Wild type WR strain virus was recovered from the serum (600 PFU/20 .mu.l) of mice on day 7 after virus injection. No virus was recovered in the serum of the mice injected with LIVP mutants on day 14. The level of wt LIVP in serum was not tested on day 7. About 1.9.times.10.sup.6 PFU/g tissue of TK-mutant of WR strain (RVGL23) was found in the brain tissue compared to 1.4.times.10.sup.3 PFU/g tissue for mice injected with the TK-mutant of LIVP strain (RVGL2).
[0474] All other mutants of VV strain LIVP were found mostly in tumor only and no virus was recovered from brain tissue of mice injected with a double or triple mutant (Table 1A). Three times as many virus particles were recovered from the tumors of mice injected with WR compared to wt LIVP. The mean of viral recovery in tumor tissue of the mutants of LIVP strain was similar to the wt LIVP and equivalent to TK-mutant of WR strain.
[0475] Presence of Various VV in Mice Bearing a Breast Tumor
[0476] Data for tissue distribution in immunocompromised mice bearing s.c. GI-101A human breast are presented in Table 1B:
TABLE-US-00004 TABLE 1B Viral recovery from nude mice tissues in breast cancer model. RVGL21 LIVP RVGL2 RVGL5 RVGL9 RVGL20 TK-, F3-, WR.sup.b RVGL23 Wt TK- HA- F3- TK-, F3- HA- Wt TK-, WR Brain 0 0 0 0 0 0 7.2 .times. 10.sup.6 1.6 .times. 10.sup.4 Kidneys 3.6 .times. 10.sup.3 38.3 27 3.3 .times. 10.sup.2 25.8 0 3.2 .times. 10.sup.7 2.8 .times. 10.sup.5 Lung 8.6 .times. 10.sup.3 5.5 .times. 10.sup.2 29.1 1.6 .times. 10.sup.3 1.6 .times. 10.sup.3 1.0 .times. 10.sup.3 2.1 .times. 10.sup.6 3.7 .times. 10.sup.3 Spleen 5.5 .times. 10.sup.3 99.5 0 1.8 .times. 10.sup.2 0 0 1.6 .times. 10.sup.6 1.8 .times. 10.sup.3 Ovaries 1.6 .times. 10.sup.3 0 0 0 0 0 8.0 .times. 10.sup.7 2.7 .times. 10.sup.7 Bladder 3.9 .times. 10.sup.3 0 0 0 0 0 2.8 .times. 10.sup.4 1.2 .times. 10.sup.3 Liver 1.2 .times. 10.sup.4 0 1.7 .times. 10.sup.2 5.2 .times. 10.sup.2 1.7 .times. 10.sup.2 1.0 .times. 10.sup.2 4.0 .times. 10.sup.5 4.8 .times. 10.sup.5 Heart 1.4 .times. 10.sup.2 0 0 58.2 4.6 .times. 10.sup.2 0 6.3 .times. 10.sup.4 2.2 .times. 10.sup.3 Serum.sup.c 0 0 0 0 0 0 2.4 .times. 10.sup.3 0 Tumor 8.6 .times. 10.sup.8 1.0 .times. 10.sup.9 2.5 .times. 10.sup.8 1.1 .times. 10.sup.9 5.6 .times. 10.sup.8 1.0 .times. 10.sup.9 2.9 .times. 10.sup.9 6.6 .times. 10.sup.8
About 10-fold more viral particles were recovered from breast tumor tissue compared to glioma tumor tissue. No virus particles were recovered from the brain tissue of mice injected with either wt LIVP or its mutants. 7.2.times.10.sup.6 and 1.6.times.10.sup.4 PFU/g was recovered from brain tissue of mice injected with wt WR and TK-virus of WR strain VV, respectively (Table 1B). During the dissection of organs from euthanized mice, it was found that the ovaries from the mice being injected with wt WR and TK- of WR virus were drastically enlarged as compared to all other groups of mice. The analysis of viral recovery from ovaries demonstrated high titer of wt WR and TK-WR strain in ovaries, for example, 8.0.times.10.sup.7 and 2.7.times.10.sup.7 PFU/g, respectively. About 1.6.times.10.sup.3 PFU/g was recovered from the ovaries of the mice injected with wt LIVP virus, however no virus particles at all were recovered from either ovaries or from brain of mice injected with the mutants derived from LIVP strain (Table 1B).
[0477] Presence of Various VV in Mice Bearing a Melanoma Tumor
[0478] The tissue distribution of VV in the immunocompetent mice bearing melanoma tumors on foot pads also were studied. BL/6 mice on day 17 after B16F10 melanoma cell implantation were i.v. injected with the viruses at the dose of 10.sup.7 PFU/mouse via the tail vein. All groups of mice were sacrificed on day 10 after virus injection due to huge tumor size in the PBS-injected control group. The results are set forth in Table 1C:
TABLE-US-00005 TABLE 1C Viral recovery from C57BL/6 mice tissues in melanoma model. RVGL21 LIVP RVGL2 RVGL5 RVGL9 RVGL20 TK-, F3-, WR.sup.b RVGL23 Wt TK- HA- F3- TK-, F3- HA- Wt TK-, WR Tumor 5.4 .times. 10.sup.6 3.9 .times. 10.sup.6 3.7 .times. 10.sup.5 9.5 .times. 10.sup.5 2.5 .times. 10.sup.5 2.4 .times. 10.sup.5 9.9 .times. 10.sup.6 2.2 .times. 10.sup.6 Tissues.sup.e 0 0 0 0 0 0 0 0 .sup.aMean of viral recovery PFU/g of tissue for 3-5 mice/group. .sup.bMice were sacrificed on day 7 after virus injection. .sup.cPFU/20 .mu.l of serum .sup.dMice were sacrificed on day 9 after virus injection. .sup.eNo virus was recovered in all tested tissue.
No virus was recovered from kidneys, lung, spleen, brain, testes, bladder, liver, heart, and serum of the immunocompetent mice injected with the viruses. Virus was only recovered from the tumor tissue. About 10-fold virus particles were recovered from the tumors of mice injected with wt LIVP, TK-LIVP, wt WR, and TK-WR compared to other groups.
Example 4
Reduction of Human Breast Tumor Implanted in Nude Mice by Recombinant Vaccinia Viruses RVGL7, RVGL9 and RVGL21
[0479] RVGL7 and RVGL9
[0480] FIG. 1 shows a schematic representation of the recombinant vaccinia viruses used for these experiments. RVGL7 was prepared as described for the preparation of RVGL9. RVGL7 contains nucleic acid encoding EGFP and lacZ, and includes pE/L and p7.5 regulator regions inserted into the TK gene.
[0481] Luminescence and Fluorescence Images of Tumors in a Nude Mouse
[0482] Human breast GI-101A cancer cells (5.times.10.sup.6 cells/mouse) were subcutaneously implanted into the right thigh of the mice. Thirty days after cell implantation RVGL9, the Nog (F3)-interrupted virus expressing a fusion of Renilla luciferase and green fluorescence protein (RVGL9=rVV-RG=rVVruc-gfp) was injected intravenously via tail vein at a dose of 1.times.10.sup.7PFU/mouse. A fluorescence image of GFP and low-light image of luciferase expression were taken nine days after virus injection, i.e. 39 days post cell implantation showing dissemination of the virus.
[0483] Reduction of Human Breast Tumor Implanted into Nude Mice by Vaccinia Viruses RVGL7 or RVGL9
[0484] Human breast GI-101A cancer cells (5.times.10.sup.6 cells/mouse) were subcutaneously implanted into the right thigh of the mice. Mice were injected i.v. with RVGL7=rVV-GFT=TK- or RVGL9-rVV-ruc-gfp=NotI (3)-interrupted viruses (1.times.10.sup.7PFU/mouse in 0.1 ml) and PBS control on day 30 after cell implantation. Images were taken on day 65 after GI-101A cell implantation and 35 days after virus or PBS injection. The results demonstrate drastic reduction of tumor volume in the mice injected with TK- or NotI (F3)-interrupted vaccinia viruses compared with the tumor in the mice injected with PBS.
[0485] GFP in Human Breast Tumor after Viral Administration
[0486] Human breast GI-101A cancer cells (5.times.10.sup.6 cells/mouse) were subcutaneously implanted into the right thigh of the mice. Mice were injected i.v. with RVGL7=rVV-GFP=TK- or RVGL9=rVV-RG-rVV-ruc-gfp-NotI (F3)-interrupted viruses (1.times.10.sup.7 PFU/mouse in 0.1 ml) on day 30 after cell implantation. The data demonstrate GFP expression in tumor area in the mice injected with TK.sup.- or NotI (F3)-interrupted vaccinia viruses. No GFP signals were observed in other parts of the mice bodies. The results also showed that expression of GFP can be visualized as early as 48 h after virus injection through the tail vein. On day 16 after virus injection very strong signals of GFP which correspond to a tumor volume of about 1300-1620 mm.sup.3 for TK- or NotI (F3)-interrupted virus, respectively were observed. Reduced GFP signals were observed on day 25 (1218-1277 mm.sup.3 for TK- or NotI (F3)-interrupted virus, respectively) and 32 (514-887 mm.sup.3 for TK- or NotI (F3)-interrupted virus, respectively) due to reduction of tumor volume.
Time Course of Breast Tumor Volume Over Time
[0487] G1-101A breast cancer cells were implanted subcutaneously into the right thigh of 4-5-week old female athymic (nu/nu) mice in the dose of 5.times.10.sup.6cells/mouse. Thirty days after tumor implantation, when the tumor reached about 500 mm.sup.3 in volume, a single dose (1.times.10.sup.7 PFU/mouse in 0.1 ml) of RVGL7=rVV-GFP=TK- or RVGL9=rVV-RG=rVV-ruc-gfp=NotI (F3)-interrupted vaccinia viruses or PBS control was injected intravenously (via tail vein). Tumor dimensions were measured with vernier caliper twice a week and volumes were calculated as (L.times.H.times.W)/2, where L, H and W represent the length, width, and height of the tumor, respectively and expressed in mm.sup.3. The data demonstrate significant (60-80% on day 65) tumor reduction in the mice injected with TK-, NotI (F3)-interrupted vaccinia viruses. In contrast, tumors grew very rapidly in the mice injected with PBS.
Monitoring of Tumor Regression by Light Extinction.
[0488] Subcutaneous GI-101A breast tumor reduction occurred in 100% of immunocompromised mice treated with a single i.v. injection of wt LIVP, single F3-, single TK-, and double F3-, TK-, mutants of LIVP strain. Some degree of toxicity was seen in the mice treated with the above viruses. RVGL21 virus with the triple deletions TK, F3 and HA genes which showed no toxicity in nude mice; hence this virus was used for long-term studies. The difference in antitumor activity and survival between high and low doses of treatment using the triple mutant RVGL21 virus was not significant. GFP expression in tumor area in the mice injected with RVGL21 was monitored. No GFP signals were observed in other parts of the mice bodies. Expression of GFP can be visualized as early as 48 h after virus injection through the tail vein. On day 16 after virus injection we observed very strong signals of GFP, which corresponded to tumor volume of about 1300-1620 mm.sup.3 and reduced GFP signals on days 25 (1218-1277 mm.sup.3) and 32 (514-887 mm.sup.3) due to reduction of tumor volume. Tumor volume reduction also was apparent by visual inspection of the mice.
Example 5
[0489] Reduction of Vaccinia Virus Toxicity and Virulence
[0490] Reduction of Vaccinia Virus Pathogenicity by Monitoring Mouse Body Weight and Survival
[0491] The percentage of body weight change in athymic and immunocompetent mice bearing different s.c. tumors after i.v. administration of the viruses was examined. Injection of wt LIVP and wt WR and some mutants at the dose of 10.sup.7 pfu/mouse via the tail vein led to a progressive vaccinia virus infection within a two week observation period. At one week after challenge, the mice showed typical blister formation on the tail and footpad. Later, weight loss, sometimes accompanied by swelling of the mouth region, in several cases led to death of the mice. In the case of wt WR strain of VV, mice started to die on day 7 after i.v. injection of virus. While mice receiving the recombinant LIVP viruses gained weight or remained the same weight over the same time period.
[0492] Body Weight in Glioma Model Nude Mice
[0493] Rat glioma C6 cells at the dose of 5.times.10.sup.5/0.1 ml/mouse were implanted s.c. into the right thigh of nude mice (5-6 old male mice) on day 0. Vaccinia viruses were injected i.v. (via tail vein) at the dose of 1.times.10.sup.7 PFU/0.1 ml/mouse on day 7. Animals were weighed twice a week. Gain/loss of body weight on day 14 post infection was calculated as the percentage: body weight-tumor weight on day of virus injection (g)/body weight-tumor weight on day 14 (g).times.100%. Injection of VGL (wild type vaccinia virus, strain LIVP) and RVGL5 (HindIII-N-interrupted) causes toxicity in nude mice: mice continue to lose the weight. Recombinant vaccinia viruses RVGL5 (HA-interrupted), RVGL7 (TK-interrupted), RVGL8 (NotI(F3)-interrupted), RVGL19 (double, TK- and NotI (F3)-interrupted) were less toxic in nude mice: after losing some body weight, 10 days post-infection, mice started to gain the body weight.
[0494] Nude mice with glioma that were injected with wild type WR strain of VV lost 31.9% of body weight on day 7 after virus injection. Mice injected with TK-virus of WR strain lost 22.4% of body weight on day 14 after virus injection compared to 1.5% in the group of mice injected with TK-virus of LIVP strain of VV. All mice injected with wild type LIVP strain survived for at least 14 days (the duration of the experiment). Mice without tumor injected with VGL (wt VV, strain LIVP) lost 11.23% of body weight. Mice bearing tumor injected with VGL (wt VV) or with RVGL1 (HindIII-N-interrupted) lost 15.79% and 10.18% of body weight, respectively. Mice in the wt LIVP group lost 15.8% of body weight versus 9.4% in the PBS injected group. Tumor-bearing mice injected with RVGL2 (TK-), RVGL5 (HA-), RVGL7 (TK-), RVGL8 (F3-), RVGL9 (F3-), RVGL20 (TK-, F3-), RVGL21 (TK-, F3-, HA-) on day 14 after virus injection lost only 1.5%, 0.4%, 2.1%, 5.0%, 7.3%, 2.4%, and 3.2% of body weight, respectively. Tumor-bearing mice injected with virus carrying double gene interruption, RVGL19 (TK- and F3-) demonstrated 0.73% gain of body weight compared to the body weight on day 0. Based on the results of body weight, a single interruption of HA, TK, F3 (NotI site) and double interruption of TK, F3 (NotI site) genes in vaccinia virus genome reduces virulence and toxicity of the vaccinia virus strain LIVP.
[0495] Injection of wt VV strain WR, however, was extremely toxic to nude mice, which died on day 7 after virus injection. Wild type and mutant VVs of strain LIVP were less toxic in nude mice. Although nude mice injected with various LIVP strains lost some body weight, after day 10-post infection mice started to gain the body weight.
[0496] Body Weight in Breast Tumor Model Athymic Mice
[0497] The body weight change of athymic mice with s.c. GI-101A human breast tumor after i.v. injection of vaccinia viruses was monitored. Mice injected with wt WR strain lost 25.6% of body weight and died due to virus toxicity. Although mice injected with wt LIVP virus survived for longer time, mice lost 26.4% of body weight. Mice injected with TK-WR strain lost 17.8% of body weight, while mice injected with TK-LIVP virus gained 1.9% of body weight. All mice injected with other mutants of LIVP strain were stable; no virus related toxicity was observed in these mice.
[0498] Body Weight in Melanoma Model Immunocompetent Mice
[0499] The toxicity of the vaccinia viruses in immunocompetent C57BL/6 mice bearing mouse B16-F10 melanoma on their foot pad was studied. Although mice in all groups survived during the experiment, wt WR strain was more toxic in immunocompetent mice compared to wt LIVP and recombinant strains. Mice injected with wt WR strain lost about 11.4% of body weight on day 10 after i.v. injection of virus, while mice injected with wt LIVP strain and its double (RVGL20) and triple (RVGL21) mutants lost only 2.2%, 1.3%, and 0.6% of body weight, respectively, versus to 7.1% of body weight lost in PBS injected mice. Mice administered i.v. with RVGL2 (TK-), RVGL5 (HA-), RVGL9 (F3-), and RVGL23 (TK-WR strain) continued to gain weight over this same period.
[0500] Long-Term Survival after Viral Infection for Breast Tumor-Bearing Mice
[0501] To examine the effect of different mutations on long-term survival, mice bearing s.c. GI-101A human breast tumor received doses of 10.sup.7 virus i.v., and were observed for survival after viral infection. The results showed that there are differences in survival depending upon the virus injected. Injection of the nude mice bearing s.c. breast tumor with wt WR strain (i.v., 1.times.10.sup.7/mouse) resulted in 100% mortality: four mice of five died on day 9 and one mouse died on day 11 after virus injection. Mice injected with strain LIVP survived for 35 days. Mice injected with a single mutated virus RVGL9 (F3-) developed the toxicity and 25% of mice died on day 34 after virus injection, however the deletion of F3 gene in LIVP strain prolonged the survival of mice up to 57 days. Mice injected with double mutant virus RVGL20 (F3-, TK-) began to die on day 34 after virus injection, but survived longer than F3-injected mice. The RVGL20 virus injected mice reached 50% survival point on day 65 and showed significantly longer survival time up to 116 days. The single mutant TK-virus of LIVP virus was less pathogenic than the single mutant F3- or double mutant F3-, TK-viruses; all mice were alive on day 80 after injection with TK-virus and 14.3% of the mice survived 130 days. All mice injected with the triple mutant TK-, F3-, and HA-virus (RVGL21) survived 130 days (duration of the experiment) and continued to live without any signs of virus toxicity compared to other groups of mice.
[0502] Splenomegaly in Various Mice
[0503] Immunocompetent C57BL/6 Mice
[0504] Several groups of the animals demonstrated enlargement of the spleen; therefore the relative spleen weight (RSW) was calculated. The results are shown in Table 2 as follows:
TABLE-US-00006 TABLE 2 Relative spleen weight (RSW) in mice with or without tumors. Glioma model Breast cancer model Melanoma model Groups nu/nu mice nu/nu mice C57BL/6 mice No tumor, PBS 43.6 .+-. 4.1.sup.a .sup. 50.5 .+-. 11.2.sup.d 30.1 .+-. 2.8.sup.g No tumor, 67.2 .+-. 11.9 48.0 .+-. 13.1 68.1 .+-. 9.4 LIVP Tumor, PBS 92.4 .+-. 7.4.sup.b .sup. 84.1 .+-. 14.6.sup.e 106.0 .+-. 46.1.sup.h LIVP .sup. 98.2 .+-. 28.2.sup.c 108.4 .+-. 39.4.sup.f 148.4 .+-. 44.8.sup.i RVGL2 96.0 .+-. 34.9 112.7 .+-. 15.6 51.9 .+-. 6.6 RVGL5 143.8 .+-. 20.5 169.6 .+-. 31.7 61.6 .+-. 2.9 RVGL9 73.9 .+-. 10.5 151.8 .+-. 27.9 63.3 .+-. 34.9 RVGL20 84.9 .+-. 6.6 159.9 .+-. 22.7 106.7 .+-. 36.0 RVGL21 114.4 .+-. 12.5 117.7 .+-. 15.3 63.0 .+-. 24.6 WR 37.3 .+-. 3.5 57.9 .+-. 10.9 70.5 .+-. 1.8 RVGL23 46.9 .+-. 15.7 73.1 .+-. 19.3 97.0 .+-. 43.9 Mean .+-. SD for n = 4-8 mice/group. RSW = weight of spleen (g) .times. 10.sup.4/(animal body weight (g) - tumor weight (g)). .sup.ap .ltoreq. 02.02 vs. all groups, except no tumor LIVP, WR, RVGL23 .sup.bp .ltoreq. 0.039 vs. no tumor PBS, no tumor LIVP, RVGL5, WR, RVGL23 .sup.cp .ltoreq. 0.046 vs. all groups, except PBS, RVGL2, RVGL20, RVGL21 .sup.dp .ltoreq. 0.006 vs. all groups except no tumor LIVP, PBS, WR, RVGL23 .sup.ep .ltoreq. 0.048 vs. all groups, except no tumor PBS, LIVP, RVGL2, WR, RVGL23 .sup.fp .ltoreq. 0.045 vs. all groups, except PBS, RVGL2, RVGL21 .sup.gp .ltoreq. 0.035 vs. PBS, LIVP, RVGL20, WR, RVGL23 .sup.hp .ltoreq. 0.049 vs. all other groups, except no tumor LIVP, RVGL20, WR, RVGL23 .sup.ip .ltoreq. 0.049 vs. all other groups.
As shown in the Table 2 above, some degree of splenomegaly was observed in mice. For immunocompetent C57BL/6 mice, a statistically significant difference (p<0.035) was found in tumorous mice injected with PBS, LIVP, RVGL20, WR and RVG123 compared to non-tumorous mice. In mice injected with wt VV strain LIVP spleen was enlarged greatly (p<0.049) versus all other groups. In contrast, the smallest spleens were found in the mice without tumor.
[0505] Nude Mice with a Glioma Tumor
[0506] In nude mice with or without s.c. glioma tumor, mice injected with wt WR or TK- of WR virus had the lowest RSW 37.3 or 46.9, respectively, which was similar to the RSW from the mice without tumor and injected with PBS (43.6). The largest RSW 143.8 and 114.4 was observed in RVGL5 (HA-) and RVGL21 (TK-, F3-, HA-) groups, respectively. No statistically significant difference was found among the groups of mice injected with wt LIVP, RVGL2, RVGL9, RVGL20 versus the PBS injected group.
[0507] Nude Mice with Breast Tumor
[0508] The results of RSW in the immunocompromised mice bearing s.c human breast tumor indicate that all mice injected with wt LIVP and its mutants have an enlarged spleen compared to the mice injected with wt WR or TK-WR viruses (p<0.045). The largest spleen was found in the mice injected with single HA-, single F3-, double F3-, TK-mutants of LIVP strain.
[0509] Other Results Using RVGL21 for Injection
[0510] Two mice, #437 and #458, survived more then 190 days after RVGL21 injection (10.sup.7 and 4.times.10.sup.5, respectively, i.v.) without any signs of diseases or virus related toxicities.
[0511] On day 30 after GI-101A cell implantation (tumor volume=594.9 mm.sup.3), 10.sup.7 of RVGL21 was injected i.v. into mouse #437. On day 101 after virus injection (s.c. tumor size=220.4 mm.sup.3), metastasis (hard tissue) in chest area under the skin was observed. The size of the tumor was 1223.6 mm.sup.3, which disappeared by day 148. The s.c. tumor did not disappear, it started to grow back, but the mouse remained metastasis-free.
[0512] Mouse #458 had a first s.c. tumor (GI-101A) on the right hind quarter. When the first tumor started to shrink (day 29 after RVGL21 virus injection, tumor size=1924.3 mm.sup.3), a second syngeneic tumor was implanted s.c. on the left hind quarter. The second tumor grew slowly, reached the size of 1205.7 mm.sup.3 and started to shrink. The mouse was free of the first tumor on day 127 post virus injection; the size of the second tumor was 439.6 mm.sup.3. The tumor continued to shrink and the cells died. The body gradually absorbed remaining tumor tissues that were contributed by the host (such as the tumor vascular skeleton that was coming from the host). Since these remains are not considered foreign, the immune system doesn't destroy them. The tumor cells, on the other hand, were long gone and cleared by the immune system and the virus. Reduction of the second syngeneic tumor demonstrates that this mouse developed antibodies against the tumor cells. The antibodies resulted in the reduction of the second syngeneic tumor.
Example 6
Use of a Microorganism or Cell to Induce Autoimmunization of an Organism Against a Tumor
[0513] This example shows that the method provided herein and in priority application EP 03 018 478.2 relating to "The production of a polypeptide, RNA or other compound in a tumor tissue" also can be used for the production of antibodies against the tumor tissue. These antibodies provide for autoimmunization of the organism bearing the tumor. Furthermore, these antibodies can be isolated and used for the treatment of tumors in other organisms.
[0514] Methods and uses of microorganisms, including cells, which can contain DNA encoding a desired polypeptide or RNA, to induce autoimmunization of an organism against a tumor are provided. Also provided are methods for the production of antibodies against a tumor by: (a) injecting a microorganism, such as a virus or cell, optionally containing a DNA sequence encoding a desired polypeptide or RNA, into an organism bearing a tumor and (b) isolating antibodies against the tumor.
[0515] This Example further demonstrates that administration of microorganisms, such as the triple mutant vaccinia virus strain provided herein, which accumulate in tumors, causing them to release tumor antigens for a sufficient time to permit production of antibodies by the host. This is exemplified by showing a reduction and elimination of xenogeneic GI-101A solid breast carcinoma tumors and their metastases in nu-/nu-mice (T cell deficient mice).
Step #1: Female nu-/nu-mice of 5 weeks age were chosen, and the GI-101A cells grown in RPMI1640 medium, supplemented with estrogen and progesterone. The confluence was reached, cells were harvested, washed with phosphate buffered saline. Cells (5.times.10.sup.6 cells per mouse) were then injected subcutaneously into mice. The tumor growth was carefully monitored every two days. Step #2: At two stages of tumor growth (at tumor size of 400-600 mm.sup.3, and at tumor size of 1700 mm.sup.3), purified vaccinia viral particles (RVGL12) were delivered to each tumorous mice by intravenous injection through tail vein. The colony purified virus was amplified in CV-1 cell line and the intracellular viral particles were purified by centrifugation in sucrose gradient. Two concentrations of virus (10.sup.6 pfu/100 .mu.l and 10.sup.7 pfu/100 .mu.l resuspended in PBS solution) were injected. The viral replication was monitored externally by visualization of virus-mediated green fluorescence protein expression. The tumor development was monitored by tumor volume determination with a digital caliper.
[0516] Vaccinia viruses RVGL12+GCV(gancyclovir), and RVGL12 (RVGL12 is the same as RVGL7, except that the nucleic acid encoding gfp is replaced by herpes simplex virus thymidine kinase (HSV TK; see, SEQ ID NOS: 35 and 36) were injected 67 days after GI-101A cellular implantation. A second administration referred to as RVGL12a, was injected 30 days after cellular implantation.
Step #3: After viral administration, it was determined that first the tumors continued to grow to a size of .about.900 mm.sup.3 (from 400-600 mm.sup.3 at the time of viral injection), and to a size of .about.2400 mm3 (from 1700 mm.sup.3). Then the growth rate leveled off for approximately 6-8 days. Step #4: Approximately 14 days after viral injection, the tumor volume started to decline rapidly. Forty days after viral application, all the treated animals showed more than 60% tumor regression. Sixty-five days after viral treatment and many of the animals had complete regression of tumors. Step #5: Some of the animals were completely tumor-free for several weeks and their body weight returned to normal. RVGL-12+GCV treatment resulted in 86.3% reduction of tumor size (Day 52 after viral injection) from their peak volumes on Day 13, RVGL-12 treatment resulted in 84.5% reduction of tumor size (Day 52) from their peak volumes (Day 13). RVGL-12a treatment resulted in 98.3% reduction of tumor size (Day 89) from their peak volumes (Day 12). After PBS+GCV control treatment, the average volume of tumors were increased by 91.8% in 38 days Step #6: The level of immune activation was determined. Sera were obtained from the animals with regressing tumors and the immune titer determined against a foreign protein (e.g. green fluorescent protein), vaccinia viral proteins, and GI-101A cancer cell proteins were determined. The following antisera obtained from the following sources were used to analyze the following listed samples.
Samples:
[0517] 1). Mouse cell lysate (control); 2). Purified and denatured vaccinia viral particles; 3). GI-101A tumor cell lysate; 4). Purified green fluorescent protein; 5). Purified luciferase protein; 6). Purified beta-galactosidase protein.
Antisera:
[0518] a). Antiserum from nontumorous mouse; b). Antiserum from GI-101A tumorous mouse; c). Antiserum from GI-101A tumorous mouse 14 days after vaccinia i.v. injection; d). Antiserum from GI-101A tumorous mouse 65 days after vaccinia i.v. injection; e). Antiserum from tumor-free mouse (after elimination of GI-101A tumor) 80 days after vaccinia i.v. injection.
[0519] The results showed that there was enormous tumor-specific vaccinia virus replication in the tumors, which led to tumor protein antigen and viral protein production in the tumors. In addition, the vaccinia virus did lyse the infected tumor cells thereby releasing tumor-cell-specific antigens. The continuous leakage of these antigens into the body led to a very high level of antibody titer (in approximately 7-14 days) against foreign cell proteins (tumor proteins), viral proteins, and the virus encoded engineered proteins in the mouse body. The newly synthesized antitumor antibodies and the enhanced macrophages, neutrophils counts were continuously delivered via the vasculature into the tumor and thereby providing for the recruitment of an activated immune system in the inside of the tumor. The active immune system then eliminated the tumor including the viral particles. This interconnected release of foreign antigens boosted antibody production and continuous return of the antibodies against the tumor-contained proteins function as an autoimmunization vaccination system, initiated by vaccinia viral replication, followed by cell lyses, protein leakage and enhanced antibody production.
Example 7
Production of D-Galactosidase and Anti .beta.-Galactosidase Via Vaccinia Virus Delivered lacZ in Tumor Bearing Mice
[0520] Thirty five athymic nu/nu mice (5 weeks old, 25g, male) were used to demonstrate the biodistribution and tumor targeting of vaccinia virus (strain LIVP) with different deletions in the genome. Mice were divided into 7 groups with 5 in each group as presented in Table 1
TABLE-US-00007 Virus Group No. mice Tumor implanted Injected Insertion locus 1 5 None VGL wtLIVP 2 5 C6, s.c. 5 .times. 10.sup.5 cells VGL wtLIVP 3 5 C6, s.c. 5 .times. 10.sup.5 cells RVGL1 N-luc, lacZ 4 5 C6, s.c. 5 .times. 10.sup.5 cells RVGL5 HA-lacZ 5 5 C6, s.c. 5 .times. 10.sup.5 cells RVGL7 TK-egfp, lacZ 6 5 C6, s.c. 5 .times. 10.sup.5 cells RVGL8 NotI-lacZ 7 5 C6, s.c. 5 .times. 10.sup.5 cells RVGL19 TK-rTrf, lacZ, NotI-RG
C6 gliomas were subcutaneously developed in Groups 2 to 7. Five days after tumor cell implantation (5.times.10.sup.5 cells/mouse), each animal was treated with 0.1 ml of virus at a multiplicity of infection (MOI) of 1.times.10.sup.7 via tail vein injection. Two weeks after virus injection, all mice were sacrificed and blood samples were collected. Various organs and tumors also were taken from animals for virus titer and .beta.-galactosidase analysis.
[0521] The .beta.-galactosidase analysis was performed using the Galacto-Light Plus system (Applied Biosystems), a chemiluminescent reporter gene assay system for the detection of .beta.-galactosidase, according to the manufacturer's instructions.
.beta.-Galactosidase Expression Measurements
[0522] In non-tumorous mice as well as in tumorous mice injected with wild type vaccinia virus (without reporter genes and without .beta.-galactosidase gene) no .beta.-galactosidase expression was detected in organs, blood and tumor samples. By contrast, in the tumors of mice infected with .beta.-galactosidase expressing virus, high levels of .beta.-galactosidase was expressed. .beta.-galactosidase also was detected in blood samples as shown in Table 3, but no virus was recovered from blood samples.
TABLE-US-00008 TABLE 3 Production of .beta. galactosidase by vaccinia virus in tumor and blood from tumor bearing mice (day 14 after virus injection) .beta.-gal in tumor Est. total .beta.- Est. total .beta.- Virus Tg/mg of total .beta.-gal in serum gal/tumor gal/5 ml Group Injected protein Tg/ml of total protein (Tg) blood (Tg) 3 RVGL1 1.59 .+-. 0.41 1.38 .times. 10.sup.-2 .+-. 1.09 .times. 10.sup.-2 489.84 4.00 4 RVGL5 1.51 .+-. 0.37 1.16 .times. 10.sup.-2 .+-. 1.08 .times. 10.sup.-2 330.21 3.62 5 RVGL7 1.35 .+-. 0.59 0.95 .times. 10.sup.-2 .+-. 1.47 .times. 10.sup.-2 616.60 1.83 6 RVGL8 1.81 .+-. 0.42 0.86 .times. 10.sup.-2 .+-. 0.33 .times. 10.sup.-2 962.36 2.38 7 RVGL19 1.30 .+-. 0.44 0.26 .times. 10.sup.-2 .+-. 0.16 .times. 10.sup.-2 463.75 0.60
Anti-.beta.-Galactosidase Antibody Production
[0523] To determine whether the amount of .beta.-galactosidase presented in mouse blood was sufficient to elicit antibody production, sera taken from two mice (mouse #116 from Group 5, and #119 from Group 6) were collected and tested for primary antibodies against .beta.-galactosidase in Western analysis. .beta.-galactosidase from E. coli (Roche, 567 779) was used as the antigen standard, and the mouse monoclonal anti .beta.-galactosidase from E. coli (Sigma, G6282) was used as the antibody positive control. As additional sources of 3-galactosidase, total protein was obtained from CV-1 cells 24 hours after infection with RVGL7 at MOI of 1 pfu/cell, and the tumor protein sample from mouse designated #143 (treated with RVGL7) was obtained.
[0524] The protein samples were prepared in triplicate, each set including a .beta.-galactosidase antigen control, a cell lysate from RVGL7 infected CV-1 cells, and tumor lysate from mouse #143. All protein samples were separated by electrophoresis using a 10% polyacrylamide gel, and transferred to NitroBind nitrocellulose membrane (MSI) using a BioRad semidry blotting system. Immunoblotting was performed with either 1:3000 mouse monoclonal anti .beta.-galactosidase, or 1:3000 mouse serum taken from either mouse #116 or #119, and 1:3000 Goat AntiMouse IgG-HRP (BioRad). An Amplified Opti-4CN Detection Kit (BioRad) was used for detection.
[0525] The results showed that sera taken from mouse #116 and #119 exhibited similar levels of antibody when compared to a commercial mouse anti-.beta.-galactosidase standard, and demonstrated that the tumor bearing mice #116 and #119 produced antibodies against .beta.-galactosidase.
Example 8
Mammalian Cells for Tumor Therapy
[0526] As shown herein, certain bacteria, viruses, and mammalian cells (BVMC), when administered systemically, again enter and selectively replicate in tumors Hence, systemically injected mammalian cells and certain bacterial (anaerobic bacteria, such as Salmonella, Clostridium sp., Vibrio, E. coli) cells gain entry into solid tumors and replicate in tumor-bearing organisms. Genetically-labeled cells can be used for tumor detection and therapy. In addition to gene expression in tumors through BVMC targeting, tumor-specific gene expression can be achieved by linking transgenes to tissue/tumor-specific promoters. To obtain tumor specific gene expression, a variety of systemic targeting schemes can be employed. These strategies include the use of tissue/tumor-specific promoters that allow the activation of gene expression only in specific organs, such as prostate-specific promoter-directed viral gene expression; the use of extracellular matrix (i.e. collagen)-targeted viral vectors; and the use of antibody-directed viral vectors. Conditionally-replicating viruses have also been explored as tumor-specific delivery vehicles for marker genes or therapeutic genes, such as oncolytic adenovirus vector particles, replication-selective HSV, vaccinia viruses and other such viruses.
[0527] When light-emitting protein encoded BVMC are injected systemically into rodents, tumor-specific marker gene expression is achieved and is detected in real time based on light emission. Consequently, the locations of primary tumors and previously unknown metastases in animals are revealed in vivo. Hence diagnosis can be coupled to therapy and to monitoring of therapy. The impaired lymphatic system in tumors may be responsible for the lack of clearance of bacteria from tumors by the host immunosurveillance after escaping the vascular system.
Example 9
Tumor Development is Inhibited Following S. pyogenes Administration
[0528] This example and following examples demonstrate the use of bacterial cells to colonize tumors, use of reporter in the cells to quantitate colonization; use of the colonized attenuated bacterial cells for tumor inhibition. Co-administration or sequential administration of bacteria and viruses. Administration of virus before bacteria increase tumor colonization by the bacteria. Administer bacteria that expresses an enzyme that will activate a prodrug, thereby targeting colonized cells.
Bacterial Strains
[0529] Streptococcus pyogenes M-type 1 T-type 1 (ATCC catalog no. 700294) was transformed with pDC123-luxF plasmid) that contains the bacterial luciferase expression cassette (Lamberton G R, Pereau M J, Illes K, Kelly I L, Chrisler J, Childers B J, Oberg K C, Szalay A A. 2002. Construction and characterization of a bioluminescent Streptococcus pyogenes. Proceedings of the 12th International Symposium on Bioluminescence and Chemiluminescence, Case J F, Herring P J, Robison B H, Haddock S H D, Kricka L J, Stanley P E (eds). Chichester: Wiley, pp 85-88. Luciferase can be detected in the presence of exogenous decanal.
[0530] Transformed S. pyogenes were grown overnight in BH1 media in the presence of 20 .mu.g/ml of chloramphenicol at 37.degree. C. After overnight growth, the bacteria were counted at OD.sub.600 and bacteria were resuspended in BH1 media at the indicated density for injection.
Tumor Development and Bacterial Injection
[0531] Twenty 5-week old mice were injected subcutaneously in the right lateral thigh. Each mouse was injected with 5.times.10.sup.5 C6 glioma cells transformed with pLEIN-derived retrovirus (Clontech; see also WO 03/14380). The subcutaneous tumors were developed for 7 days after implantation before bacterial injection.
[0532] For bacterial injection, the tumor-bearing mice were anesthetized with isofluorane. The suspensions were injected intravenously with a 1-cc insulin syringe equipped with a 291/2-gauge needle through a surgically exposed femoral vein. After the injections, the incisions were sutured.
[0533] Tumor growth was monitored twice a week following bacterial injection using a digital caliper. In addition, fluorescence imaging and photographic images of the animals were taken at the end time points. The presence of luminescent bacteria was analyzed by intravenously injecting the animals with 30 .mu.l of decanal. Analysis of whole animals for bacterial luciferase activity, followed methods similar to Yu et al. (2004) Nature Biotechnology 22(3): 313-20. Briefly, anesthetized animals were placed inside the dark box for photon counting (ARGUS 100 low light Imager, Hamamatsu). Photon collection was for 1 minute from ventral and dorsal sides of the animal and the images were recorded with Image Pro Plus 3.1 software (Media Cybernetics) and/or Lighttools.RTM. macroimaging system. A light image also was recorded. The luminescent images were superimposed on the light image to localize the luminescent activity on the animal. Total intensity of photon emission in localized regions, e.g. in the tumor region, also was recorded. S. pyogenes was isolated from removed tumors and ground tissue was plated on LB-chloramphenicol (20 .mu.g/ml) plates. Luminescent bacteria were counted in the presence of decanal vapor.
Results
[0534] Four groups of mice were tested. Each group contained five mice.
TABLE-US-00009 Group S. Pyogenes 1 None 2 1 .times. 10.sup.6 3 1 .times. 10.sup.7 4 5 .times. 10.sup.7
Tumor volume was measured after 7 days of tumor development and the injection of S. pyogenes, through 21 days post-tumor development.
[0535] The control group of mice with no S. pyogenes had continuous and accelerating tumor growth over the 2-week period. The mice injected with S. pyogenes had slower tumor growth. Groups 3 and 4 had the slowest tumor growth rates. Both groups maintained a slower linear rate throughout the monitoring period, whereas the control group, not injected with bacteria, exhibited tumor growth that accelerated at later time periods.
[0536] At all time points following bacterial injection, tumor volumes were smaller in Groups 3 and 4 mice than in the control mice (Group 1). At day 21, the average tumor volume of the control group was approximately 2.5-3 fold greater than the average tumor volumes in Groups 3 and 4. Group 2, injected with the lowest titer of bacteria, also had a reduced tumor volume from the control group at the later time points, although the tumor volume was larger than Groups 3 and 4.
[0537] Bacterial colonization and tumor inhibition also is assayed in a fibrosarcoma model. HT1080 fibrosarcoma cells transformed with the pLEIN retrovirus are injected subcutaneously into the right lateral thigh of five week old nude male mice 5.times.10.sup.5 cells/mouse). S. pyogenes transformed with pDC123-luxF is injected into the femoral vein of the animals after 8 or 14 days of tumor growth (5 animals on each day). A group of 5 animals are not injected as serve as a control group. Tumor growth and luciferase activity is monitored at subsequent time points. S. pyogenes is isolated from tumors and cultured on BH1+chloramphenicol (20 .mu.g/ml) plates. Luminescent bacterial colonies are counted in the presence of decanal vapor.
Example 10
Vibrio Cholera Localization to Tumors
Plasmids and Bacterial Strains
[0538] Attenuated Vibrio Cholerae, strain Bengal 2 serotype 0139, M010 DattRS1, was transformed with pLITE201 which contains the luxCDABE cassette (Voisey et al. (1998) Biotechniques 24:56-58). The transformed strain is a light emitting strain due to the expression of the luciferase genes.
Tumor Development and Bacterial Injection
[0539] Groups of nude mice (n>20) were implanted with C6 glioma tumors (500 mm.sup.3) as described in the Examples herein. 1.times.10.sup.8 transformed bacteria (V. Cholerae) were suspended in 100 .mu.l of phosphate buffered saline (PBS). The bacterial suspension was injected into the right hind leg of each mouse. The animals were then monitored after injection under a low light imager as described in Example 3.
[0540] In a separate experiment, for comparison, groups of nude mice (n>20) were implanted with C6 glioma tumors (500 mm.sup.3) as described in the Examples herein. These mice were injected with 1.times.10.sup.8 pfu/mouse of rVV-RUC-GFP (RVGL9) virus (see Example 1).
Results
[0541] Titer and Luciferase Activity
[0542] Mice from each of the two injected groups were sacrificed at time points after injection. Tumors were excised and homogenized. Bacterial and viral titers and luciferase activities were measured as described in the Examples herein.
[0543] Both bacterial and viral titer increased following injection. The increase in bacterial growth over time was proportional to luciferase levels in the tumors. A log-log plot of bacterial titer versus luciferase activity in tumors in the mice injected with V. cholera demonstrated a linear relationship between bacterial titer and luciferase activity. The groups of mice injected with rVV-RUC-GFP virus, also demonstrated a linear relationship between virus titer and luciferase activity.
TABLE-US-00010 Time after V. Cholera/pLITE injection 4 hrs 8 hrs 16 hrs 32 hrs Bacterial Titer 3.79 .times. 10.sup.4 .+-. 2.93 3.14 .times. 10.sup.6 .+-. 2.45 1.08 .times. 10.sup.8 .+-. 1.3 5.97 .times. 10.sup.8 .+-. 4.26 (cfu/tumor)
TABLE-US-00011 Time after rVV-ruc-gfp virus injection 36 hrs Day 3 Day 5 Day 7 Viral Titer 3.26 .times. 10.sup.6 .+-. 3.86 7.22 .times. 10.sup.7 .+-. 3.67 1.17 .times. 10.sup.8 .+-. 0.76 3.77 .times. 10.sup.8 .+-. 1.95 (pfu/tumor)
The experiments demonstrated a linear relationship between titer and luciferase activity. Thus, luciferase activity of the injected bacteria and/or virus can be used a correlative measurement of titer.
Localization
[0544] Localization of V. cholera was performed as detailed in the Examples herein for virus. Briefly, organs and blood samples were isolated from animals euthanized with CO.sub.2 gas. The organs were ground and plated on agar plates with chloramphenicol drug selection for analysis of bacterial titer.
[0545] Bacterial titer was assayed in tumor, liver, testes, spleen, kidney, lung, heart, bladder and brain of the injected mice. Samples were taken from mice sacrificed at zero, and subsequent times up to 150 hours following V. cholera injection.
[0546] At the time point immediately following injection (t=0), V. cholera was present in all samples, with the highest levels in the liver and spleen. By 50 hours post-injection, titer of V. cholera in all tissues had reduced with the exception of tumor tissue. In contrast, V. cholera titer had increased about 4 orders of magnitude as compared to time zero. This level increased slightly and then stayed constant throughout the remainder of the experiment. By 150 hours post-infection, titer in all samples except tumor had decreased. For example, the titer in liver had decreased by approximately 5 orders of magnitude from the time zero point. At the 150 hour point, the V. cholera titer in the tumor tissue was about 6 orders of magnitude greater than any other tissue sample.
Example 11
Co-Administration and Sequential Administration of Bacteria and Virus
[0547] V. Cholera/pLITE (see Example 10) and vaccinia virus RVGL2 (see Example 1) were administered together or sequentially. Groups of nude mice with C6 glioma tumors were injected with bacteria and/or virus as shown in the Table below. Three male mice were injected per group. Bacteria and/or virus were injected on day 11 and day 16 following tumor implantation. Tumor growth, luciferase and GFP activity were monitored as described in the Examples herein.
TABLE-US-00012 Group Day 11 injection Day 16 injection 1 1 .times. 10.sup.7 VV-TK.sup.--gfp-lacZ 1 .times. 10.sup.7 V. Cholera/pLITE 2 None 1 .times. 10.sup.7 V. Cholera/pLITE 3 1 .times. 10.sup.7 V. Cholera/pLITE 1 .times. 10.sup.7 VV-TK.sup.--gfp-lacZ 4 None 1 .times. 10.sup.7 VV-TK.sup.--gfp-lacZ 5 None 1 .times. 10.sup.7 VV-TK.sup.--gfp-lacZ and 1 .times. 10.sup.7 V. Cholera/pLITE
Results
[0548] On day 21 (21 days post tumor implantation) animals were sacrificed. Tumors were excised from each animal and ground. Viral titer was assayed on Groups 3, 4 and 5. Bacterial titer was assed on Groups 1, 2 and 5. Titers (colony forming units and plaque forming units) were performed as previously described in the Examples.
[0549] A comparison of the bacterial titer in tumors Groups 1, 2 and 5 demonstrated that bacterial titer was highest in Group 1 that had been injected first with vaccinia virus at day 11, and followed by V. cholera injection on day 16. Co-injection of bacteria and virus at day 16 (Group 5) gave an intermediate bacterial titer. Group 2, injected only with V. cholera at day 16, had a lower bacterial titer in the tumor tissue than either of groups 1 or 5. Thus, tumors were more susceptible to bacterial colonization when first colonized by VV-TK.sup.--gfp-lacZ virus.
[0550] A comparison of the viral titer in Groups 3, 4 and 5 demonstrated that Group 4, with only virus injection at day 16, had the highest viral titer followed by Groups 5 and 3. The viral titer of Group 5 was slightly higher than Group 3, but not apparently significantly different. One mouse in Group 4 had a viral titer that was an extreme outlier in comparison to the viral titer of the other 2 mice in Group 4. When the numbers were reassessed without this mouse, the general trend remained the same. The average viral titer in Group 4 was much closer to the viral titers of Groups 3 and 5. The data from the three groups in this analysis was not significantly different. Thus, pre-administration of bacteria followed by administration of virus did not significantly change the viral colonization of the tumor as compared with viral administration alone.
Example 12
Tumor Inhibition by Administering PNP-Expressing Bacteria and Prodrug Plasmids
[0551] SOD-DeoD contains the bacterial purine nucleoside phosphorylase gene (PNP) (Sorcher et al. (1994) GeneTher. 1(4):223-238), under the control of the constitutive SOD (superoxide dismutase) promoter. Plasmid pSOD-DeoD-lux, contains the luxCDABE expression cassette (Voisey et al. (1998) Biotechniques 24:56-58) inserted into pSOD-DeoD.
[0552] PNP converts the non-toxic prodrug 6-methylpurine deoxyribose (6-MPDR) to 6-methyl purine which inhibits DNA replication, transcription and translation (Sorcher et al. (1994) Gene Ther. 1(4):223-238).
Tumor Growth Inhibition
[0553] Nude mice were injected with pLEIN retrovirus transformed C6 glioma cells. The pLEIN retrovirus expresses EGFP under the control of the viral promoter LTR (Clontech; see also WO 03/14380). E. coli DH5a expressing the bacterial purine nucleoside phosphorylase gene was injected at day 8 following tumor implantation with or without prodrug (6-methylpurine deoxyribose (6-MPDR)). Tumor volume was monitored at subsequent time points (as performed in previous examples).
TABLE-US-00013 Group Administered 1 E. coli/PNP + prodrug 2 E. coli/PNP 3 E. coli control + prodrug
Groups 2 and 3 exhibited equal tumor growth over time points from 8 to 21 days post tumor implantation. Group 1, which received both the E. coli expressing PNP and the prodrug exhibited .about.20% reduction in tumor size as compared to the control Groups 2 and 3 at the end time points.
[0554] To further test bacterial colonization and prodrug effects on tumor growth, a human breast cancer model, GI-101A adenocarcinoma in nude mice, was chosen. GI-101A was derived from GI-101. GI-101 originated from a local first recurrence of an infiltrating duct adenocarcinoma (stage IIIa, T3N2MX) in a 57 year old female patient by researchers at Rumbaugh-Goodwin Institute for Cancer Research. In the subcutaneous xenograft nude mice model, the tumor consistently metastasizes to the lungs. The GI-101A is a slower growing tumor model as compared to the C6 glioma tumor model.
[0555] Fifteen 4 week old female nude mice are each injected subcutaneously in the right lateral thigh with GI-101A cells. Thirty days after tumor development, bacteria are injected. Escherichia coli DH5a is transformed with pSOD-DeoD or pSOD-DeoD-lux. The bacteria are grown overnight in LB media in the presence of 20 .mu.g/ml of chloramphenicol at 37.degree. C. After overnight growth, the bacteria are counted at OD.sub.600 and bacteria resuspended in BH1 media at the indicated density. The suspensions are injected intravenously with a 1-cc insulin syringe equipped with a 291/2-gauge needle into the animal through a surgically exposed vein or as otherwise indicated. After the injections, the incisions are sutured.
[0556] Prodrug is administered to groups of mice every four days following injection of bacteria. Tumor growth is monitored twice per week using a digital caliper. Luciferase imaging is performed as described in the Examples herein. At the end point, the animal are sacrificed and organs are assayed as described in Example 9. Histological analyses are performed to determine the degree of tumor necrosis due to bacterial colonization and/or drug treatment.
[0557] Since modifications will be apparent to those of skill in the art, it is intended that this invention be limited only by the scope of the appended claims.
Sequence CWU
1
1
361148DNAArtificial SequenceLIVP F3 1aatatagcaa cagtagttct tgctcctcct
tgattctagc atcctcttca ttattttctt 60ctacgtacat aaacatgtcc aatacgttag
acaacacacc gacgatggcg gccgctacag 120acacgaatat gactaaaccg atgaccat
148249PRTArtificial SequenceTranslation
LIVP F3 2Met Val Ile Gly Leu Val Ile Phe Val Ser Val Ala Ala Ala Ile Val
1 5 10 15 Gly Val
Leu Ser Asn Val Leu Asp Met Phe Met Tyr Val Glu Glu Asn 20
25 30 Asn Glu Glu Asp Ala Arg Ile
Lys Glu Glu Gln Glu Leu Leu Leu Leu 35 40
45 Tyr327DNAArtificial SequenceForward primer
3gggaattctt atacatcctg ttctatc
27430DNAArtificial SequenceReverse primer 4ccaagcttat gaggagtatt
gcggggctac 3057252DNAArtificial
Sequencepsc65 5agcttttgcg atcaataaat ggatcacaac cagtatctct taacgatgtt
cttcgcagat 60gatgattcat tttttaagta tttggctagt caagatgatg aaatcttcat
tatctgatat 120attgcaaatc actcaatatc tagactttct gttattatta ttgatccaat
caaaaaataa 180attagaagcc gtgggtcatt gttatgaatc tctttcagag gaatacagac
aattgacaaa 240attcacagac tttcaagatt ttaaaaaact gtttaacaag gtccctattg
ttacagatgg 300aagggtcaaa cttaataaag gatatttgtt cgactttgtg attagtttga
tgcgattcaa 360aaaagaatcc tctctagcta ccaccgcaat agatcctgtt agatacatag
atcctcgtcg 420caatatcgca ttttctaacg tgatggatat attaaagtcg aataaagtga
acaataatta 480attctttatt gtcatcatga acggcggaca tattcagttg ataatcggcc
ccatgttttc 540aggtaaaagt acagaattaa ttagacgagt tagacgttat caaatagctc
aatataaatg 600cgtgactata aaatattcta acgataatag atacggaacg ggactatgga
cgcatgataa 660gaataatttt gaagcattgg aagcaactaa actatgtgat ctcttggaat
caattacaga 720tttctccgtg ataggtatcg atgaaggaca gttctttcca gacattgttg
aattagatcg 780ataaaaatta attaattacc cgggtaccag gcctagatct gtcgacttcg
agcttattta 840tattccaaaa aaaaaaaata aaatttcaat ttttaagctt tcactaattc
caaacccacc 900cgctttttat agtaagtttt tcacccataa ataataaata caataattaa
tttctcgtaa 960aagtagaaaa tatattctaa tttattgcac ggtaaggaag tagatcataa
ctcgagcatg 1020ggagatcccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac
ccaacttaat 1080cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc
ccgcaccgat 1140cgcccttccc aacagttgcg cagcctgaat ggcgaatggc gctttgcctg
gtttccggca 1200ccagaagcgg tgccggaaag ctggctggag tgcgatcttc ctgaggccga
tactgtcgtc 1260gtcccctcaa actggcagat gcacggttac gatgcgccca tctacaccaa
cgtaacctat 1320cccattacgg tcaatccgcc gtttgttccc acggagaatc cgacgggttg
ttactcgctc 1380acatttaatg ttgatgaaag ctggctacag gaaggccaga cgcgaattat
ttttgatggc 1440gttaactcgg cgtttcatct gtggtgcaac gggcgctggg tcggttacgg
ccaggacagt 1500cgtttgccgt ctgaatttga cctgagcgca tttttacgcg ccggagaaaa
ccgcctcgcg 1560gtgatggtgc tgcgttggag tgacggcagt tatctggaag atcaggatat
gtggcggatg 1620agcggcattt tccgtgacgt ctcgttgctg cataaaccga ctacacaaat
cagcgatttc 1680catgttgcca ctcgctttaa tgatgatttc agccgcgctg tactggaggc
tgaagttcag 1740atgtgcggcg agttgcgtga ctacctacgg gtaacagttt ctttatggca
gggtgaaacg 1800caggtcgcca gcggcaccgc gcctttcggc ggtgaaatta tcgatgagcg
tggtggttat 1860gccgatcgcg tcacactacg tctcaacgtc gaaaacccga aactgtggag
cgccgaaatc 1920ccgaatctct atcgtgcggt ggttgaactg cacaccgccg acggcacgct
gattgaagca 1980gaagcctgcg atgtcggttt ccgcgaggtg cggattgaaa atggtctgct
gctgctgaac 2040ggcaagccgt tgctgattcg aggcgttaac cgtcacgagc atcatcctct
gcatggtcag 2100gtcatggatg agcagacgat ggtgcaggat atcctgctga tgaagcagaa
caactttaac 2160gccgtgcgct gttcgcatta tccgaaccat ccgctgtggt acacgctgtg
cgaccgctac 2220ggcctgtatg tggtggatga agccaatatt gaaacccacg gcatggtgcc
aatgaatcgt 2280ctgaccgatg atccgcgctg gctaccggcg atgagcgaac gcgtaacgcg
aatggtgcag 2340cgcgatcgta atcacccgag tgtgatcatc tggtcgctgg ggaatgaatc
aggccacggc 2400gctaatcacg acgcgctgta tcgctggatc aaatctgtcg atccttcccg
cccggtgcag 2460tatgaaggcg gcggagccga caccacggcc accgatatta tttgcccgat
gtacgcgcgc 2520gtggatgaag accagccctt cccggctgtg ccgaaatggt ccatcaaaaa
atggctttcg 2580ctacctggag agacgcgccc gctgatcctt tgcgaatacg cccacgcgat
gggtaacagt 2640cttggcggtt tcgctaaata ctggcaggcg tttcgtcagt atccccgttt
acagggcggc 2700ttcgtctggg actgggtgga tcagtcgctg attaaatatg atgaaaacgg
caacccgtgg 2760tcggcttacg gcggtgattt tggcgatacg ccgaacgatc gccagttctg
tatgaacggt 2820ctggtctttg ccgaccgcac gccgcatcca gcgctgacgg aagcaaaaca
ccagcagcag 2880tttttccagt tccgtttatc cgggcaaacc atcgaagtga ccagcgaata
cctgttccgt 2940catagcgata acgagctcct gcactggatg gtggcgctgg atggtaagcc
gctggcaagc 3000ggtgaagtgc ctctggatgt cgctccacaa ggtaaacagt tgattgaact
gcctgaacta 3060ccgcagccgg agagcgccgg gcaactctgg ctcacagtac gcgtagtgca
accgaacgcg 3120accgcatggt cagaagccgg gcacatcagc gcctggcagc agtggcgtct
ggcggaaaac 3180ctcagtgtga cgctccccgc cgcgtcccac gccatcccgc atctgaccac
cagcgaaatg 3240gatttttgca tcgagctggg taataagcgt tggcaattta accgccagtc
aggctttctt 3300tcacagatgt ggattggcga taaaaaacaa ctgctgacgc cgctgcgcga
tcagttcacc 3360cgtgcaccgc tggataacga cattggcgta agtgaagcga cccgcattga
ccctaacgcc 3420tgggtcgaac gctggaaggc ggcgggccat taccaggccg aagcagcgtt
gttgcagtgc 3480acggcagata cacttgctga tgcggtgctg attacgaccg ctcacgcgtg
gcagcatcag 3540gggaaaacct tatttatcag ccggaaaacc taccggattg atggtagtgg
tcaaatggcg 3600attaccgttg atgttgaagt ggcgagcgat acaccgcatc cggcgcggat
tggcctgaac 3660tgccagctgg cgcaggtagc agagcgggta aactggctcg gattagggcc
gcaagaaaac 3720tatcccgacc gccttactgc cgcctgtttt gaccgctggg atctgccatt
gtcagacatg 3780tataccccgt acgtcttccc gagcgaaaac ggtctgcgct gcgggacgcg
cgaattgaat 3840tatggcccac accagtggcg cggcgacttc cagttcaaca tcagccgcta
cagtcaacag 3900caactgatgg aaaccagcca tcgccatctg ctgcacgcgg aagaaggcac
atggctgaat 3960atcgacggtt tccatatggg gattggtggc gacgactcct ggagcccgtc
agtatcggcg 4020gaattcagct gagcgccggt cgctaccatt accagttggt ctggtgtcaa
aaataataat 4080aaccgggcag gggggatcct tctgtgagcg tatggcaaac gaaggaaaaa
tagttatagt 4140agccgcactc gatgggacat ttcaacgtaa accgtttaat aatattttga
atcttattcc 4200attatctgaa atggtggtaa aactaactgc tgtgtgtatg aaatgcttta
aggaggcttc 4260cttttctaaa cgattgggtg aggaaaccga gatagaaata ataggaggta
atgatatgta 4320tcaatcggtg tgtagaaagt gttacatcga ctcataatat tatatttttt
atctaaaaaa 4380ctaaaaataa acattgatta aattttaata taatacttaa aaatggatgt
tgtgtcgtta 4440gataaaccgt ttatgtattt tgaggaaatt gataatgagt tagattacga
accagaaagt 4500gcaaatgagg tcgcaaaaaa actgccgtat caaggacagt taaaactatt
actaggagaa 4560ttattttttc ttagtaagtt acagcgacac ggtatattag atggtgccac
cgtagtgtat 4620ataggatctg ctcccggtac acatatacgt tatttgagag atcatttcta
taatttagga 4680gtgatcatca aatggatgct aattgacggc cgccatcatg atcctatttt
aaatggattg 4740cgtgatgtga ctctagtgac tcggttcgtt gatgaggaat atctacgatc
catcaaaaaa 4800caactgcatc cttctaagat tattttaatt tctgatgtga gatccaaacg
aggaggaaat 4860gaacctagta cggcggattt actaagtaat tacgctctac aaaatgtcat
gattagtatt 4920ttaaaccccg tggcgtctag tcttaaatgg agatgcccgt ttccagatca
atggatcaag 4980gacttttata tcccacacgg taataaaatg ttacaacctt ttgctccttc
atattcagct 5040gaaatgagat tattaagtat ttataccggt gagaacatga gactgactcg
ggccgcgttg 5100ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg
acgctcaagt 5160cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc
tggaagctcc 5220ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc
ctttctccct 5280tcgggaagcg tggcgctttc tcaatgctca cgctgtaggt atctcagttc
ggtgtaggtc 5340gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg
ctgcgcctta 5400tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc
actggcagca 5460gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga
gttcttgaag 5520tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc
tctgctgaag 5580ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac
caccgctggt 5640agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg
atctcaagaa 5700gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc
acgttaaggg 5760attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa
ttaaaaatga 5820agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta
ccaatgctta 5880atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt
tgcctgactc 5940cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag
tgctgcaatg 6000ataccgcgag acccacgctc accggctcca gatttatcag caataaacca
gccagccgga 6060agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc
tattaattgt 6120tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt
tgttgccatt 6180gctgcaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag
ctccggttcc 6240caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt
tagctccttc 6300ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat
ggttatggca 6360gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt
gactggtgag 6420tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc
ttgcccggcg 6480tcaacacggg ataataccgc gccacatagc agaactttaa aagtgctcat
cattggaaaa 6540cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag
ttcgatgtaa 6600cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt
ttctgggtga 6660gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg
gaaatgttga 6720atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta
ttgtctcatg 6780agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc
gcgcacattt 6840ccccgaaaag tgccacctga cgtctaagaa accattatta tcatgacatt
aacctataaa 6900aataggcgta tcacgaggcc ctttcgtctt cgaataaata cctgtgacgg
aagatcactt 6960cgcagaataa ataaatcctg gtgtccctgt tgataccggg aagccctggg
ccaacttttg 7020gcgaaaatga gacgttgatc ggcacgtaag aggttccaac tttcaccata
atgaaataag 7080atcactaccg ggcgtatttt ttgagttatc gagattttca ggagctaagg
aagctaaaat 7140ggagaaaaaa atcactggat ataccaccgt tgatatatcc caatggcatc
gtaaagaaca 7200ttttgaggca tttcagtcag ttgctcaatg tacctataac cagaccgttc
ag 7252628DNAArtificial SequencePrimer pUC28 I 6aattcagatc
tccatggatc gatgagct
28720DNAArtificial SequencePrimer pUC28 II 7catcgatcca tggagatctg
2081665DNAArtificial
SequenceRenilla luciferase-Aequeora GFP fusion gene 8atgacttcga
aagtttatga tccagaacaa aggaaacgga tgataactgg tccgcagtgg 60tgggccagat
gtaaacaaat gaatgttctt gattcattta ttaattatta tgattcagaa 120aaacatgcag
aaaatgctgt tattttttta catggtaacg cggcctcttc ttatttatgg 180cgacatgttg
tgccacatat tgagccagta gcgcggtgta ttataccaga tcttattggt 240atgggcaaat
caggcaaatc tggtaatggt tcttataggt tacttgatca ttacaaatat 300cttactgcat
ggtttgaact tcttaattta ccaaagaaga tcatttttgt cggccatgat 360tggggtgctt
gtttggcatt tcattatagc tatgagcatc aagataagat caaagcaata 420gttcacgctg
aaagtgtagt agatgtgatt gaatcatggg atgaatggcc tgatattgaa 480gaagatattg
cgttgatcaa atctgaagaa ggagaaaaaa tggttttgga gaataacttc 540ttcgtggaaa
ccatgttgcc atcaaaaatc atgagaaagt tagaaccaga agaatttgca 600gcatatcttg
aaccattcaa agacaaaggt gaagttcgtc gtccaacatt atcatggcct 660cgtgaaatcc
cgttagtaaa aggtggtaaa cctgacgttg tacaaattgt taggaattat 720aatgcttatc
tacgtgcaag tgatgattta ccaaaaatgt ttattgaatc ggatccagga 780ttcttttcca
atgctattgt tgaaggcgcc aagaagtttc ctaatactga atttgtcaaa 840gtaaaaggtc
ttcatttttc gcaagaagat gcacctgatg aaatgggaaa atatatcaaa 900tcgttcgttg
agcgagttct caaaaatgaa caagcggccg caccgcatat gagtaaagga 960gaagaacttt
tcactggagt tgtcccaatt cttgttgaat tagatggtga tgttaatggg 1020cacaaatttt
ctgtcagtgg agagggtgaa ggtgatgcaa catacggaaa acttaccctt 1080aaatttattt
gcactactgg aaaactacct gttccatggc caacacttgt cactactttc 1140tcttatggtg
ttcaatgctt ttcaagatac ccagatcata tgaaacagca tgactttttc 1200aagagtgcca
tgcccgaagg ttatgtacag gaaagaacta tatttttcaa agatgacggg 1260aactacaaga
cacgtgctga agtcaagttt gaaggtgata cccttgttaa tagaatcgag 1320ttaaaaggta
ttgattttaa agaagatgga aacattcttg gacacaaatt ggaatacaac 1380tataactcac
acaatgtata catcatggca gacaaacaaa agaatggaat caaagttaac 1440ttcaaaatta
gacacaacat tgaagatgga agcgttcaac tagcagacca ttatcaacaa 1500aatactccaa
ttggcgatgg ccctgtcctt ttaccagaca accattacct gtccacacaa 1560tctgcccttt
cgaaagatcc caacgaaaag agagaccaca tggtccttct tgagtttgta 1620acagctgctg
ggattacaca tggcatggat gaactataca aataa
1665911096DNAArtificial SequencepLacGus Plasmid 9aagcttgcat gcctgcagca
attcccgagg ctgtagccga cgatggtgcg ccaggagagt 60tgttgattca ttgtttgcct
ccctgctgcg gtttttcacc gaagttcatg ccagtccagc 120gtttttgcag cagaaaagcc
gccgacttcg gtttgcggtc gcgagtgaag atccctttct 180tgttaccgcc aacgcgcaat
atgccttgcg aggtcgcaaa atcggcgaaa ttccatacct 240gttcaccgac gacggcgctg
acgcgatcaa agacgcggtg atacatatcc agccatgcac 300actgatactc ttcactccac
atgtcggtgt acattgagtg cagcccggct aacgtatcca 360cgccgtattc ggtgatgata
atcggctgat gcagtttctc ctgccaggcc agaagttctt 420tttccagtac cttctctgcc
gtttccaaat cgccgctttg gacataccat ccgtaataac 480ggttcaggca cagcacatca
aagagatcgc tgatggtatc ggtgtgagcg tcgcagaaca 540ttacattgac gcaggtgatc
ggacgcgtcg ggtcgagttt acgcgttgct tccgccagtg 600gcgcgaaata ttcccgtgca
ccttgcggac gggtatccgg ttcgttggca atactccaca 660tcaccacgct tgggtggttt
ttgtcacgcg ctatcagctc tttaatcgcc tgtaagtgcg 720cttgctgagt ttccccgttg
actgcctctt cgctgtacag ttctttcggc ttgttgcccg 780cttcgaaacc aatgcctaaa
gagaggttaa agccgacagc agcagtttca tcaatcacca 840cgatgccatg ttcatctgcc
cagtcgagca tctcttcagc gtaagggtaa tgcgaggtac 900ggtaggagtt ggccccaatc
cagtccatta atgcgtggtc gtgcaccatc agcacgttat 960cgaatccttt gccacgcaag
tccgcatctt catgacgacc aaagccagta aagtagaacg 1020gtttgtggtt aatcaggaac
tgttcgccct tcactgccac tgaccggatg ccgacgcgaa 1080gcgggtagat atcacactct
gtctggcttt tggctgtgac gcacagttca tagagataac 1140cttcacccgg ttgccagagg
tgcggattca ccacttgcaa agtcccgcta gtgccttgtc 1200cagttgcaac cacctgttga
tccgcatcac gcagttcaac gctgacatca ccattggcca 1260ccacctgcca gtcaacagac
gcgtggttac agtcttgcgc gacatgcgtc accacggtga 1320tatcgtccac ccaggtgttc
ggcgtggtgt agagcattac gctgcgatgg attccggcat 1380agttaaagaa atcatggaag
taagactgct ttttcttgcc gttttcgtcg gtaatcacca 1440ttcccggcgg gatagtctgc
cagttcagtt cgttgttcac acaaacggtg atacgtacac 1500ttttcccggc aataacatac
ggcgtgacat cggcttcaaa tggcgtatag ccgccctgat 1560gctccatcac ttcctgatta
ttgacccaca ctttgccgta atgagtgacc gcatcgaaac 1620gcagcacgat acgctggcct
gcccaacctt tcggtataaa gacttcgcgc tgataccaga 1680cgttgcccgc ataattacga
atatctgcat cggcgaactg atcgttaaaa ctgcctggca 1740cagcaattgc ccggctttct
tgtaacgcgc tttcccacca acgctgatca attccacagt 1800tttcgcgatc cagactgaat
gcccacaggc cgtcgagttt tttgatttca cgggttgggg 1860tttctacagg acgtaacatt
ctagacatta tagttttttc tccttgacgt taaagtatag 1920aggtatatta acaatttttt
gttgatactt ttattacatt tgaataagaa gtaatacaaa 1980ccgaaaatgt tgaaagtatt
agttaaagtg gttatgcagt ttttgcattt atatatctgt 2040taatagatca aaaatcatcg
gttcgctgat taattacccc agaaataagg ctaaaaaact 2100aatcgcatta tcatccctcg
agctatcacc gcaagggata aatatctaac accgtgcgtg 2160ttgactattt tacctctggc
ggtgataatg ctcgaggtaa gattagatat ggatatgtat 2220atggatatgt atatggtggt
aatgccatgt aatatgatta ttaaacttct ttgcgtccat 2280ccaaaaaaaa agtaagaatt
tttgaaaatt caatataaat gacagctcag ttacaaagtg 2340aaagtacttc taaaattgtt
ttggttacag gtggtgctgg atacattggt tcacacactg 2400tggtagagct aattgagaat
ggatatgact gtgttgttgc tgataacctg tcgaatagat 2460cgacctgaag tctaggtccc
tatttatttt tttatagtta tgttagtatt aagaacgtta 2520tttatatttc aaatttttct
tttttttctg tacagacgcg tgtacgaatt tcgacctcga 2580ccggccggtt ttacaaatca
gtaagcaggt cagtgcgtac gccatggccg gagtggctca 2640cagtcggtgg tccggcagta
caatggattt ccttacgcga aatacgggca gacatggcct 2700gcccggttat tattattttt
gacaccagac caactggtaa tggtagcgac cggcgctcag 2760ctggaattcc gccgatactg
acgggctcca ggagtcgtcg ccaccaatcc ccatatggaa 2820accgtcgata ttcagccatg
tgccttcttc cgcgtgcagc agatggcgat ggctggtttc 2880catcagttgc tgttgactgt
agcggctgat gttgaactgg aagtcgccgc gccactggtg 2940tgggccataa ttcaattcgc
gcgtcccgca gcgcagaccg ttttcgctcg ggaagacgta 3000cggggtatac atgtctgaca
atggcagatc ccagcggtca aaacaggcgg cagtaaggcg 3060gtcgggatag ttttcttgcg
gccctaatcc gagccagttt acccgctctg ctacctgcgc 3120cagctggcag ttcaggccaa
tccgcgccgg atgcggtgta tcgctcgcca cttcaacatc 3180aacggtaatc gccatttgac
cactaccatc aatccggtag gttttccggc tgataaataa 3240ggttttcccc tgatgctgcc
acgcgtgagc ggtcgtaatc agcaccgcat cagcaagtgt 3300atctgccgtg cactgcaaca
acgctgcttc ggcctggtaa tggcccgccg ccttccagcg 3360ttcgacccag gcgttagggt
caatgcgggt cgcttcactt acgccaatgt cgttatccag 3420cggtgcacgg gtgaactgat
cgcgcagcgg cgtcagcagt tgttttttat cgccaatcca 3480catctgtgaa agaaagcctg
actggcggtt aaattgccaa cgcttattac ccagctcgat 3540gcaaaaatcc atttcgctgg
tggtcagatg cgggatggcg tgggacgcgg cggggagcgt 3600cacactgagg ttttccgcca
gacgccactg ctgccaggcg ctgatgtgcc cggcttctga 3660ccatgcggtc gcgttcggtt
gcactacgcg tactgtgagc cagagttgcc cggcgctctc 3720cggctgcggt agttcaggca
gttcaatcaa ctgtttacct tgtggagcga catccagagg 3780cacttcaccg cttgccagcg
gcttaccatc cagcgccacc atccagtgca ggagctcgtt 3840atcgctatga cggaacaggt
attcgctggt cacttcgatg gtttgcccgg ataaacggaa 3900ctggaaaaac tgctgctggt
gttttgcttc cgtcagcgct ggatgcggcg tgcggtcggc 3960aaagaccaga ccgttcatac
agaactggcg atcgttcggc gtatcgccaa aatcaccgcc 4020gtaagccgac cacgggttgc
cgttttcatc atatttaatc agcgactgat ccacccagtc 4080ccagacgaag ccgccctgta
aacggggata ctgacgaaac gcctgccagt atttagcgaa 4140accgccaaga ctgttaccca
tcgcgtgggc gtattcgcaa aggatcagcg ggcgcgtctc 4200tccaggtagc gaaagccatt
ttttgatgga ccatttcggc acagccggga agggctggtc 4260ttcatccacg cgcgcgtaca
tcgggcaaat aatatcggtg gccgtggtgt cggctccgcc 4320gccttcatac tgcaccgggc
gggaaggatc gacagatttg atccagcgat acagcgcgtc 4380gtgattagcg ccgtggcctg
attcattccc cagcgaccag atgatcacac tcgggtgatt 4440acgatcgcgc tgcaccattc
gcgttacgcg ttcgctcatc gccggtagcc agcgcggatc 4500atcggtcaga cgattcattg
gcaccatgcc gtgggtttca atattggctt catccaccac 4560atacaggccg tagcggtcgc
acagcgtgta ccacagcgga tggttcggat aatgcgaaca 4620gcgcacggcg ttaaagttgt
tctgcttcat cagcaggata tcctgcacca tcgtctgctc 4680atccatgacc tgaccatgca
gaggatgatg ctcgtgacgg ttaacgcctc gaatcagcaa 4740cggcttgccg ttcagcagca
gcagaccatt ttcaatccgc acctcgcgga aaccgacatc 4800gcaggcttct gcttcaatca
gcgtgccgtc ggcggtgtgc agttcaacca ccgcacgata 4860gagattcggg atttcggcgc
tccacagttt cgggttttcg acgttcagac gtagtgtgac 4920gcgatcggca taaccaccac
gctcatcgat aatttcaccg ccgaaaggcg cggtgccgct 4980ggcgacctgc gtttcaccct
gccataaaga aactgttacc cgtaggtagt cacgcaactc 5040gccgcacatc tgaacttcag
cctccagtac agcgcggctg aaatcatcat taaagcgagt 5100ggcaacatgg aaatcgctga
tttgtgtagt cggtttatgc agcaacgaga cgtcacggaa 5160aatgccgctc atccgccaca
tatcctgatc ttccagataa ctgccgtcac tccagcgcag 5220caccatcacc gcgaggcggt
tttctccggc gcgtaaaaat gcgctcaggt caaattcaga 5280cggcaaacga ctgtcctggc
cgtaaccgac ccagcgcccg ttgcaccaca gatgaaacgc 5340cgagttaacg ccatcaaaaa
taattcgcgt ctggccttcc tgtagccagc tttcatcaac 5400attaaatgtg agcgagtaac
aacccgtcgg attctccgtg ggaacaaacg gcggattgac 5460cgtaatggga taggtcacgt
tggtgtagat gggcgcatcg taaccgtgca tctgccagtt 5520tgaggggacg acgacagtat
cggcctcagg aagatcgcac tccagccagc tttccggcac 5580cgcttctggt gccggaaacc
aggcaaagcg ccattcgcca ttcaggctgc gcaactgttg 5640ggaagggcga tcggtgcggg
cctcttcgct attacgccag ctggcgaaag ggggatgtgc 5700tgcaaggcga ttaagtcggg
aaacctgtcg tgccagctgc attaatgaat cggccaacgc 5760gcggggagag gcggtttgcg
tattgggcgc cagggtggtt tttcttttca ccagtgagac 5820gggcaacagc caagctccgg
atccgggctt ggccaagctt ggaattccgc acttttcggc 5880caatggtctt ggtaattcct
ttgcgctaga attgaactca ggtacaatca cttcttctga 5940atgagattta gtcattatag
ttttttctcc ttgacgttaa agtatagagg tatattaaca 6000attttttgtt gatactttta
ttacatttga ataagaagta atacaaaccg aaaatgttga 6060aagtattagt taaagtggtt
atgcagtttt tgcatttata tatctgttaa tagatcaaaa 6120atcatcgctt cgctgattaa
ttaccccaga aataaggcta aaaaactaat cgcattatca 6180tcccctcgac gtactgtaca
tataaccact ggttttatat acagcagtac tgtacatata 6240accactggtt ttatatacag
cagtcgacgt actgtacata taaccactgg ttttatatac 6300agcagtactg gacatataac
cactggtttt atatacagca gtcgaggtaa gattagatat 6360ggatatgtat atggatatgt
atatggtggt aatgccatgt aatatgatta ttaaacttct 6420ttgcgtccat ccaaaaaaaa
agtaagaatt tttgaaaatt caatataaat gacagctcag 6480ttacaaagtg aaagtacttc
taaaattgtt ttggttacag gtggtgctgg atacattggt 6540tcacacactg tggtagagct
aattgagaat ggatatgact gtgttgttgc tgataacctg 6600tcgaattcca agctcggatc
cccgagctcg gatcccccta agaaaccatt attatcatga 6660cattaaccta taaaaatagg
cgtatcacga ggccctttcg tctcgcgcgt ttcggtgatg 6720acggtgaaaa cctctgacac
atgcagctcc cggagacggt cacagcttgt ctgtaagcgg 6780atgccgggag cagacaagcc
cgtcagggcg cgtcagcggg tgttggcggg tgtcggggct 6840ggcttaacta tgcggcatca
gagcagattg tactgagagt gcaccataac gcatttaagc 6900ataaacacgc actatgccgt
tcttctcatg tatatatata tacaggcaac acgcagatat 6960aggtgcgacg tgaacagtga
gctgtatgtg cgcagctcgc gttgcatttt cggaagcgct 7020cgttttcgga aacgctttga
agttcctatt ccgaagttcc tattctctag ctagaaagta 7080taggaacttc agagcgcttt
tgaaaaccaa aagcgctctg aagacgcact ttcaaaaaac 7140caaaaacgca ccggactgta
acgagctact aaaatattgc gaataccgct tccacaaaca 7200ttgctcaaaa gtatctcttt
gctatatatc tctgtgctat atccctatat aacctaccca 7260tccacctttc gctccttgaa
cttgcatcta aactcgacct ctacattttt tatgtttatc 7320tctagtatta ctctttagac
aaaaaaattg tagtaagaac tattcataga gtgaatcgaa 7380aacaatacga aaatgtaaac
atttcctata cgtagtatat agagacaaaa tagaagaaac 7440cgttcataat tttctgacca
atgaagaatc atcaacgcta tcactttctg ttcacaaagt 7500atgcgcaatc cacatcggta
tagaatataa tcggggatgc ctttatcttg aaaaaatgca 7560cccgcagctt cgctagtaat
cagtaaacgc gggaagtgga gtcaggcttt ttttatggaa 7620gagaaaatag acaccaaagt
agccttcttc taaccttaac ggacctacag tgcaaaaagt 7680tatcaagaga ctgcattata
gagcgcacaa aggagaaaaa aagtaatcta agatgctttg 7740ttagaaaaat agcgctctcg
ggatgcattt ttgtagaaca aaaaagaagt atagattctt 7800tgttggtaaa atagcgctct
cgcgttgcat ttctgttctg taaaaatgca gctcagattc 7860tttgtttgaa aaattagcgc
tctcgcgttg catttttgtt ttacaaaaat gaagcacaga 7920ttcttcgttg gtaaaatagc
gctttcgcgt tgcatttctg ttctgtaaaa atgcagctca 7980gattctttgt ttgaaaaatt
agcgctctcg cgttgcattt ttgttctaca aaatgaagca 8040cagatgcttc gttgcttccg
tgtggaagaa cgattacaac aggtgttgtc ctctgaggac 8100ataaaataca caccgagatt
catcaactca ttgctggagt tagcatatct acaattcaga 8160agaactcgtc aagaaggcga
tagaaggcga tgcgctgcga atcgggagcg gcgataccgt 8220aaagcacgag gaagcggtca
gcccattcgc cgccaagctc ttcagcaata tcacgggtag 8280ccaacgctat gtcctgatag
cggtccgcca cacccagccg gccacagtcg atgaatccag 8340aaaagcggcc attttccacc
atgatattcg gcaagcaggc atcgccatgg gtcacgacga 8400gatcctcgcc gtcgggcatg
ctcgccttga gcctggcgaa cagttcggct ggcgcgagcc 8460cctgatgctc ttcgtccaga
tcatcctgat cgacaagacc ggcttccatc cgagtacgtg 8520ctcgctcgat gcgatgtttc
gcttggtggt cgaatgggca ggtagccgga tcaagcgtat 8580gcagccgccg cattgcatca
gccatgatgg atactttctc ggcaggagca aggtgagatg 8640acaggagatc ctgccccggc
acttcgccca atagcagcca gtcccttccc gcttcagtga 8700caacgtcgag cacagctgcg
caaggaacgc ccgtcgtggc cagccacgat agccgcgctg 8760cctcgtcttg cagttcattc
agggcaccgg acaggtcggt cttgacaaaa agaaccgggc 8820gcccctgcgc tgacagccgg
aacacggcgg catcagagca gccgattgtc tgttgtgccc 8880agtcatagcc gaatagcctc
tccacccaag cggccggaga acctgcgtgc aatccatctt 8940gttcaatcat gcgaaacgat
cctcatcctg tctcttgatc agagcttgat cccctgcgcc 9000atcagatcct tggcggcaag
aaagccatcc agtttacttt gcagggcttc ccaaccttac 9060cagagggcgc cccagctggc
aattccggtt cgcttgctgt ccataaaacc gcccagtcta 9120gctatcgcca tgtaagccca
ctgcaagcta cctgctttct ctttgcgctt gcgttttccc 9180ttgtccagat agcccagtag
ctgacattca tccggggtca gcaccgtttc tgcggactgg 9240ctttctacgt gaaaaggatc
taggtgaaga tcctttttga taatctcatg accaaaatcc 9300cttaacgtga gttttcgttc
cactgagcgt cagaccccgt agaaaagatc aaaggatctt 9360cttgagatcc tttttttctg
cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac 9420cagcggtggt ttgtttgccg
gatcaagagc taccaactct ttttccgaag gtaactggct 9480tcagcagagc gcagatacca
aatactgttc ttctagtgta gccgtagtta ggccaccact 9540tcaagaactc tgtagcaccg
cctacatacc tcgctctgct aatcctgtta ccagtggctg 9600ctgccagtgg cgataagtcg
tgtcttaccg ggttggactc aagacgatag ttaccggata 9660aggcgcagcg gtcgggctga
acggggggtt cgtgcacaca gcccagcttg gagcgaacga 9720cctacaccga actgagatac
ctacagcgtg agctatgaga aagcgccacg cttcccgaag 9780ggagaaaggc ggacaggtat
ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg 9840agcttccagg gggaaacgcc
tggtatcttt atagtcctgt cgggtttcgc cacctctgac 9900ttgagcgtcg atttttgtga
tgctcgtcag gggggcggag cctatggaaa aacgccagca 9960acgcggcctt tttacggttc
ctggcctttt gctggccttt tgctcacatg atataattca 10020attgaagctc taatttgtga
gtttagtata catgcattta cttataatac agttttttag 10080ttttgctggc cgcatcttct
caaatatgct tcccagcctg cttttctgta acgttcaccc 10140tctaccttag catcccttcc
ctttgcaaat agtcctcttc caacaataat aatgtcagat 10200cctgtagaga ccacatcatc
cacggttcta tactgttgac ccaatgcgtc tcccttgtca 10260tctaaaccca caccgggtgt
cataatcaac caatcgtaac cttcatctct tccacccatg 10320tctctttgag caataaagcc
gataacaaaa tctttgtcgc tcttcgcaat gtcaacagta 10380cccttagtat attctccagt
agatagggag cccttgcatg acaattctgc taacatcaaa 10440aggcctctag gttcctttgt
tacttcttct gccgcctgct tcaaaccgct aacaatacct 10500gggcccacca caccgtgtgc
attcgtaatg tctgcccatt ctgctattct gtatacaccc 10560gcagagtact gcaatttgac
tgtattacca atgtcagcaa attttctgtc ttcgaagagt 10620aaaaaattgt acttggcgga
taatgccttt agcggcttaa ctgtgccctc catggaaaaa 10680tcagtcaaga tatccacatg
tgtttttagt aaacaaattt tgggacctaa tgcttcaact 10740aactccagta attccttggt
ggtacgaaca tccaatgaag cacacaagtt tgtttgcttt 10800tcgtgcatga tattaaatag
cttggcagca acaggactag gatgagtagc agcacgttcc 10860ttatatgtag ctttcgacat
gatttatctt cgtttcctgc aggtttttgt tctgtgcagt 10920tgggttaaga atactgggca
atttcatgtt tcttcaacac tacatatgcg tatatatacc 10980aatctaagtc tgtgctcctt
ccttcgttct tccttctgtt cggagattac cgaatcaaaa 11040aaatttcaag gaaaccgaaa
tcaaaaaaaa gaataaaaaa aaaatgatga attgaa 1109610150DNAVaccinia
VirusLIVP 10atggtcatcg gtttagtcat attcgtgtct gtggcggccg ccatcgtcgg
tgtgttgtct 60aacgtattgg acatgcttat gtacgtagaa gaaaataatg aagaggatgc
tagaatcaag 120gaggagcaag aactactgtt gctatattga
1501149PRTVaccinia VirusLIVP 11Met Val Ile Gly Leu Val Ile
Phe Val Ser Val Ala Ala Ala Ile Val 1 5 10
15 Gly Val Leu Ser Asn Val Leu Asp Met Leu Met Tyr
Val Glu Glu Asn 20 25 30
Asn Glu Glu Asp Ala Arg Ile Lys Glu Glu Gln Glu Leu Leu Leu Leu
35 40 45
Tyr12150DNAVaccinia VirusWR 12tcaatatagc aacagtagtt cttgctcctc cttgattcta
gcatcctctt cattattttc 60ttctacgtac ataagcatgt ccaatacgtt agacaacaca
ccgacgatgg cggccgccac 120agacacgaat atgactagac cgatgaccat
1501349PRTVaccinia VirusWR 13Met Val Ile Gly Leu
Val Ile Phe Val Ser Val Ala Ala Ala Ile Val 1 5
10 15 Gly Val Leu Ser Asn Val Leu Asp Met Leu
Met Tyr Val Glu Glu Asn 20 25
30 Asn Glu Glu Asp Ala Arg Ile Lys Glu Glu Gln Glu Leu Leu Leu
Leu 35 40 45
Tyr14150DNAVaccinia VirusAnkara 14tcaatatagc aacagtagtt cttgctcctc
cttgattcta gcatcctctt cattattttc 60ttctacgtac ataaacatgt ccaatacgtt
agacaacaca ccgacgatgg cggccgccac 120agacacgaat atgactaaac cgatgaccat
1501549PRTVaccinia VirusAnkara 15Met
Val Ile Gly Leu Val Ile Phe Val Ser Val Ala Ala Ala Ile Val 1
5 10 15 Gly Val Leu Ser Asn Val
Leu Asp Met Phe Met Tyr Val Glu Glu Asn 20 25
30 Asn Glu Glu Asp Ala Arg Ile Lys Glu Glu Gln
Glu Leu Leu Leu Leu 35 40 45
Tyr16146DNAVaccinia VirusTian Tan 16caatatagca acagtagttc
ttgctcctcc ttgattctag catcctcttc attattttct 60tctacgtaca taaacatgtc
caatacgtta gacaacacac cgacgatggc cgccacagac 120acgaatatga ctagaccgat
gaccat 1461748PRTVaccinia
VirusTian Tan 17Met Val Ile Gly Leu Val Ile Phe Val Ser Val Ala Ala Ile
Val Gly 1 5 10 15
Val Leu Ser Asn Val Leu Asp Met Phe Met Tyr Val Glu Glu Asn Asn
20 25 30 Glu Glu Asp Ala Arg
Ile Lys Glu Glu Gln Glu Leu Leu Leu Leu Tyr 35 40
45 18150DNAVaccinia VirusAcambis 3000 MVA
18tcaatatagc aacagtagtt cttgctcctc cttgattcta gcatcctctt cattattttc
60ttctacgtac ataaacatgt ccaatacgtt agacaacaca ccgacgatgg cggccgccac
120agacacgaat atgactaaac cgatgaccat
1501949PRTVaccinia VirusAcambis 3000 MVA 19Met Val Ile Gly Leu Val Ile
Phe Val Ser Val Ala Ala Ala Ile Val 1 5 10
15 Gly Val Leu Ser Asn Val Leu Asp Met Phe Met Tyr
Val Glu Glu Asn 20 25 30
Asn Glu Glu Asp Ala Arg Ile Lys Glu Glu Gln Glu Leu Leu Leu Leu
35 40 45
Tyr20150DNAVaccinia VirusCopenhagen 20tcaatatagc aacagtagtt cttgctcctc
cttgattcta gcatcctctt cattattttc 60ttctacgtac ataaacatgt ccaatacgtt
agacaacaca ccgacgatgg cggccgccac 120agacacgaat atgactagac cgatgaccat
1502149PRTVaccinia VirusCopenhagen
21Met Val Ile Gly Leu Val Ile Phe Val Ser Val Ala Ala Ala Ile Val 1
5 10 15 Gly Val Leu Ser
Asn Val Leu Asp Met Phe Met Tyr Val Glu Glu Asn 20
25 30 Asn Glu Glu Asp Ala Arg Ile Lys Glu
Glu Gln Glu Leu Leu Leu Leu 35 40
45 Tyr22150DNACowpox VirusGenBank No. X94355.22003-05-09
22tcaatatagc aacagtagtt cttgctcctc cttgattcta gcatcctctt cattattttc
60ttctacgtac ataagcatgt ccaatacgtt agacaacaca ccgacgatgg cggccgccac
120agacacgaat atgactagac cgatgaccat
1502349PRTCowpox Virus 23Met Val Ile Gly Leu Val Ile Phe Val Ser Val Ala
Ala Ala Ile Val 1 5 10 15
Gly Val Leu Ser Asn Val Leu Asp Met Leu Met Tyr Val Glu Glu Asn
20 25 30 Asn Glu Glu Asp
Ala Arg Ile Lys Glu Glu Gln Glu Leu Leu Leu Leu 35
40 45 Tyr24150DNARabbitpox VirusGenBank
No. AY4846692004-03-30 24tcaatatagc aacagtagtt cttgctcctc cttgattcta
gcatcctctt cattattttc 60ttctacgtac ataagcatgt ccaatacgtt agacaacaca
ccgacgatgg cggccgccac 120agacacgaat atgactagac cgatgaccat
1502549PRTRabbitpox Virus 25Met Val Ile Gly Leu
Val Ile Phe Val Ser Val Ala Ala Ala Ile Val 1 5
10 15 Gly Val Leu Ser Asn Val Leu Asp Met Leu
Met Tyr Val Glu Glu Asn 20 25
30 Asn Glu Glu Asp Ala Arg Ile Lys Glu Glu Gln Glu Leu Leu Leu
Leu 35 40 45
Tyr26150DNACamelpox VirusCMS 26tcaatatagc aacagtagtt cttgctcctc
cttaattcta gcatcttctt cattattttc 60ttctacatac ataagcatgt ccaatacgtt
agacaacaca ccgacgatgg cggccgccac 120agacacgaat atgactagac cgatgaccat
1502749PRTCamelpox VirusCMS 27Met Val
Ile Gly Leu Val Ile Phe Val Ser Val Ala Ala Ala Ile Val 1 5
10 15 Gly Val Leu Ser Asn Val Leu
Asp Met Leu Met Tyr Val Glu Glu Asn 20 25
30 Asn Glu Glu Asp Ala Arg Ile Lys Glu Glu Gln Glu
Leu Leu Leu Leu 35 40 45
Tyr28150DNAEctromelia VirusMoscow 28tcaatatagc aacaacagtt cttgctcctc
cttgattcta gcatcctctt cattattttc 60ttctacgtac ataagcatgt ccaatacgtt
agacaacaca ccgacaatgg cggccgccac 120agacacgaat atgactagac cgaggaccat
1502949PRTEctromelia VirusMoscow 29Met
Val Leu Gly Leu Val Ile Phe Val Ser Val Ala Ala Ala Ile Val 1
5 10 15 Gly Val Leu Ser Asn Val
Leu Asp Met Leu Met Tyr Val Glu Glu Asn 20 25
30 Asn Glu Glu Asp Ala Arg Ile Lys Glu Glu Gln
Glu Leu Leu Leu Leu 35 40 45
Tyr30146DNAMonkeypox VirusZaire 30tatagcaaca gtaattcttg
ctcctccttg attttagcat cctcttcatt attttcttct 60acgtacataa gcatgtccaa
tacgttagac aacacaccga cgatggtggc cgccacagac 120acgaatatga ctagaccgat
gaccat 1463148PRTMonkeypox
VirusZaire 31Met Val Ile Gly Leu Val Ile Phe Val Ser Val Ala Ala Thr Ile
Val 1 5 10 15 Gly
Val Leu Ser Asn Val Leu Asp Met Leu Met Tyr Val Glu Glu Asn 20
25 30 Asn Glu Glu Asp Ala Lys
Ile Lys Glu Glu Gln Glu Leu Leu Leu Leu 35 40
45 32150DNAVariola VirusGenBank No.
X69198.11996-12-13 32tcaatatagc aacagtagtt cttgctcctc cttaattcta
gcatcttctt cattattttc 60ttctacatac ataagcatct ccaatacgtt agacagcaca
ccgatgatgg cggccgccac 120agacacgaat atgactagac tgatgaccat
1503349PRTVariola Virus 33Met Val Ile Ser Leu Val
Ile Phe Val Ser Val Ala Ala Ala Ile Ile 1 5
10 15 Gly Val Leu Ser Asn Val Leu Glu Met Leu Met
Tyr Val Glu Glu Asn 20 25 30
Asn Glu Glu Asp Ala Arg Ile Lys Glu Glu Gln Glu Leu Leu Leu Leu
35 40 45
Tyr34186854DNAArtificial SequenceLIVP Complete Genome 34ttccactatc
tgtggtacga acggtttcat cttctttgat gccatcaccc agatgttcta 60taaacttggt
atcctcgtcc gatttcatat cctttgccaa ccaatacata tagctaaact 120caggcatatg
ttccacacat cctgaacaat gaaattctcc agaagatgtt acaatgtcta 180gatttggaca
tttggtttca accgcgttaa catatgagtg aacacaccca tacatgaaag 240cgatgagaaa
taggattctc atcttgccaa aatatcacta gaaaaaattt atttatcaat 300tttaaaggta
taaaaaatac ttattgttgc tcgaatattt tgtatttgat ggtatacgga 360agattagaaa
tgtaggtatt atcatcaact gattctatgg ttttatgtat tctatcatgt 420ttcactattg
cgttggaaat aatatcatat gcttccacat atattttatt ttgttttaac 480tcataatact
cacgtaattc tggattattg gcatatctat gaataatttt agctccatga 540tcagtaaata
ttaatgagaa catagtatta ccacctacca ttattttttt catctcattc 600aattcttaat
tgcaaagatc tatataatca ttatagcgtt gacttatgga ctctggaatc 660ttagacgatg
tacagtcatc tataatcatg gcatatttaa tacattgttt tatagcatag 720tcgttatcta
cgatgttaga tatttctctc aatgaatcaa tcacacaatc taatgtaggt 780ttatgacata
atagcatttt cagcagttca atgtttttag attcgttgat ggcaatggct 840atacatgtat
atccgttatt tgatctaatg ttgacatctg aaccggattc tagcagtaaa 900gatactagag
attgtttatt atatctaaca gccttgtgaa gaagtgtttc tcctcgtttg 960tcaatcatgt
taatgtcttt aagataaggt aggcaaatgt ttatagtact aagaattggg 1020caagcataag
acatgtcaca aagacccttt tttgtatgta taagtgtaaa aattataaca 1080tccatagttg
gatttacata ggtgtccaat cgggatctct ccatcatcga gataattgat 1140ggcatctccc
ttcctttttt agtagatatt tcatcgtgta agaatcaata ttaatatttc 1200taaagtatcc
gtgtatagcc tctttattta ccacagctcc atattccact agagggatat 1260cgccgaatgt
catatactca attagtatat gttggaggac atccgagttc attgttttca 1320atatcaaaga
gatggtttcc ttatcatttc tccatagtgg tacaatacta cacattattc 1380cgtgcggctt
tccattttcc aaaaacaatt tgaccaaatc taaatctaca tctttattgt 1440atctataatc
actatttaga taatcagcca taattcctcg agtgcaacat gttagatcgt 1500ctatatatga
ataagcagtg ttatctattc ctttcattaa caatttaacg atgtctatat 1560ctatatgaga
tgacttaata taatattgaa gagctgtaca atagttttta tctataaaag 1620acggcttgat
tccgtgatta attagacatt taacaacttc cggacgcaca tatgctctcg 1680tatccgactc
tgaatacaga tgagagatga tatacagatg caatacggta ccgcaatttc 1740gtagttgata
atcatcatac gcgtatcagt actcgtcctc ataaagaaca ctgcagccat 1800tttctatgaa
caaatcaata attttagaaa caggatcatt gtcattacat aattttctat 1860aactgaacga
tggttttcac atttaacact caagtcaaat ccatgttcta ccaacacctt 1920tatcaagtca
acgtctacat ttttggattt catatagctg aatatattaa agttatttat 1980gttgctaaat
ccagtggctt ctagtagagc catcgctata tccttattaa ctttaacatg 2040tctactattt
gtgtattctt ctaatggggt aagctgtctc caatttttgc gtaatggatt 2100agtgccactg
tctagtagta gtttgacgac ctcgacatta ttacaatgct cattaaaaag 2160gtatgcgtgt
aaagcattat tcttgaattg gttcctggta tcattaggat ctctgtcttt 2220caacatctgt
ttaagttcat caagagccac ctcctcattt tccaaatagt caaacatttt 2280gactgaatga
gctactgtga actctataca cccacacaac taatgtcatt aaatatcatg 2340tcaaaaactt
gtacaattat taataaaaat aatttagtgt ttaaatttta ccagttccag 2400attttacacc
tccgttaata cctccattaa ccccactgga cgatcctcct ccccacattc 2460caccgccacc
agatgtataa gttttagatc ctttattact accatcatgt ccatggataa 2520agacactcca
catgccgcca ctaccccctt tagaagacat attaataaga cttaaggaca 2580agtttaacaa
taaaattaat cacgagtacc ctactaccaa cctacactat tatatgatta 2640tagtttctat
ttttacagta ccttgactaa agtttctagt cacaagagca atactaccaa 2700cctacactat
tatatgatta tagtttctat ttttatagga acgcgtacga gaaaatcaaa 2760tgtctaattt
ctaacggtag tgttgataaa cgattgttat ccgcggatac ctcctctatc 2820atgtcgtcta
ttttcttact ttgttctatt aacttattag cattatatat tatttgatta 2880taaaacttat
attgcttatt agcccaatct gtaaatatcg gattattaac atatcgtttc 2940tttgtaggtt
tatttaacat gtacatcact gtaagcatgt ccttaccatt tattttaatt 3000tgacgcatat
ccgcaatttc tttttcgcag tcggttataa attctatata tgatggatac 3060atgctacatg
tgtacttata atcgactaat atgaagtact tgatacatat tttcagtaac 3120gatttattat
taccacctat gaataagtac ctgtgatcgt ctaggtaatc aactgttttc 3180ttaatacatt
cgatggttgg taatttactc agaataattt ccaatatctt aatatataat 3240tctgctattt
ctgggatata tttatctgcc agtataacac aaatagtaat acatgtaaac 3300ccatattttg
ttattatatt aatgtctgcg ccattatcta ttaaccattc tactaggctg 3360acactatgcg
actcaataca atgataaagt atactacatc catgtttatc tattttgttt 3420atatcatcaa
tatacggctt acaaagtttt agtatcgata acacatccaa ctcacgcata 3480gagaaggtag
ggaataatgg cataatattt attaggttat catcattgtc attatctaca 3540actaagtttc
cattttttaa aatatactcg acaactttag gatctctatt gccaaatttt 3600tgaaaatatt
tatttatatg cttaaatcta tataatgtag ctccttcatc aatcatacat 3660ttaataacat
tgatgtatac tgtatgataa gatacatatt ctaacaatag atcttgtata 3720gaatctgtat
atcttttaag aattgtggat attaggatat tattacataa actattacac 3780aattctaaaa
tataaaacgt atcacggtcg aataatagtt gatcaactat ataattatcg 3840attttgtgat
ttttcttcct aaactgttta cgtaaatagt tagatagaat attcattagt 3900tcatgaccac
tatagttact atcgaataac gcgtcaaata tttcccgttt aatatcgcat 3960ttgtcaagat
aataatagag tgtggtatgt tcacgataag tataataacg catctctttt 4020tcgtgtgaaa
ttaaatagtt tattacgtcc aaagatgtag cataaccatc ttgtgaccta 4080gtaataatat
aataatagag aactgtttta cccattctat catcataatc agtggtgtag 4140tcgtaatcgt
aatcgtctaa ttcatcatcc caattataat attcaccagc acgtctaatc 4200tgttctattt
tgatcttgta tccatactgt atgttgctac atgtaggtat tcctttatcc 4260aataatagtt
taaacacatc tacattggga tttgatgttg tagcgtattt ttctacaata 4320ttaataccat
ttttgatact atttatttct atacctttcg aaattagtaa tttcaataag 4380tctatattga
tgttatcaga acatagatat tcgaatatat caaaatcatt gatattttta 4440tagtcgactg
acgacaataa caaaatcaca acatcgtttt tgatattatt atttttcttg 4500gtaacgtatg
cctttaatgg agtttcacca tcatactcat ataatggatt tgcaccactt 4560tctatcaatg
attgtgcact gctggcatcg atgttaaatg ttttacaact atcatagagt 4620atcttatcgt
taaccatgat tggttgttga tgctatcgca ttttttggtt tctttcattt 4680cagttatgta
tggatttagc acgtttggga agcatgagct catatgattt cagtactgta 4740gtgtcagtac
tattagtttc aataagatca atctctagat ctatagaatc aaaacacgat 4800aggtcagaag
ataatgaata tctgtaggct tcttgttgta ctgtaacttc tggttttgtt 4860agatggttgc
atcgtgcttt aacgtcaatg gtacaaattt tatcctcgct ttgtgtatca 4920tattcgtccc
tactataaaa ttgtatattc agattatcat gcgatgtgta tacgctaacg 4980gtatcaataa
acggagcaca ccatttagtc ataaccgtaa tccaaaaatt tttaaagtat 5040atcttaacga
aagaagttgt gtcattgtct acggtgtatg gtactagatc ctcataagtg 5100tatatatcta
gagtaatgtt taatttatta aatggttgat aatatggatc ctcgtgacaa 5160tttccgaaga
tggaaataag acataaacac gcaataaatc taattgcgga catggttact 5220ccttaaaaaa
atacgaataa tcaccttggc tatttagtaa gtgtcattta acactatact 5280catattaatc
catggactca taatctctat acgggattaa cggatgttct atatacgggg 5340atgagtagtt
ctcttcttta actttatact ttttactaat catatttaga ctgatgtatg 5400ggtaatagtg
tttgaagagc tcgttctcat catcagaata aatcaatatc tctgtttttt 5460tgttatacag
atgtattaca gcctcatata ttacgtaata gaacgtgtca tctaccttat 5520taactttcac
cgcatagttg tttgcaaata cggttaatcc tttgacctcg tcgatttccg 5580accaatctgg
gcgtataatg aatctaaact ttaattgctt gtaatcattc gaaataattt 5640ttagtttgca
tccgtagtta tcccctttat gtaactgtaa atttctcaac gcgatatctc 5700cattaataat
gatgtcgaat tcgtgctgta tacccatact gaatggatga acgaataccg 5760acggcgttaa
tagtaattta ctttttcatc tttacatatt gggtactagt tttactatca 5820taagtttata
aattccacaa gctactatgg aataagccaa ccatcttagt ataccacaca 5880tgtcttaaag
tttattaatt aattacatgt tgttttatat atatcgctac gaatttaaag 5940agaaattagt
ttaggaagaa aaattatcta tctacatcat cacgtctctg tattctacga 6000tagagtgcta
ctttaagatg cgacagatcc gtgtcatcaa atatatactc cattaaaatg 6060attattccgg
cagcgaactt gatattggat atatcacaac ctttgttaat atctacgaca 6120atagacagca
gtcccatggt tccataaaca gtgagtttat ctttctttga agagatattt 6180tgtagagatc
ttataaaact gtcgaatgac atcgcattta tatctttagc taaatcgtat 6240atgttaccat
cgtaatatct aaccgcgtct atcttaaacg tttccatcgc tttaaagacg 6300tttccgatag
atggtctcat ttcatcagtc atactgagcc aacaaatata atcgtgtata 6360acatctttga
tagaatcaga ctctaaagaa aacgaatcgg ctttattata cgcattcatg 6420ataaacttaa
tgaaaaatgt ttttcgttgt ttaagttgga tgaatagtat gtcttaataa 6480ttgttattat
ttcattaatt aatatttagt aacgagtaca ctctataaaa acgagaatga 6540cataactaat
cataactagt tatcaaagtg tctaggacgc gtaattttca tatggtatag 6600atcctgtaag
cattgtctgt attctggagc tattttctct atcgcattag tgagttcaga 6660atatgttata
aatttaaatc gaataacgaa cataacttta gtaaagtcgt ctatattaac 6720tcttttattt
tctagccatc gtaataccat gtttaagata gtatattctc tagttactac 6780gatctcatcg
ttgtctagaa tatcacatac tgaatctaca tccaatttta gaaattggtc 6840tgtgttacat
atctcttcta tattattgtt gatgtattgt cgtagaaaac tattacgtag 6900accattttct
ttataaaacg aatatatagt actccaatta tctttaccga tatatttgca 6960cacataatcc
attctctcaa tcactacatc tttaagattt tcgttgttaa gatatttggc 7020taaactatat
aattctatta gatcatcaac agaatcagta tatatttttc tagatccaaa 7080gacgaactct
ttggcgtcct ctataatatt cccagaaaag atattttcgt gttttagttt 7140atcgagatct
gatctgttca tatacgccat gattgtacgg tacgttatga taaccgcata 7200aaataaaaat
ccattttcat ttttaaccaa tactattcat aattgagatt gatgtaatac 7260tttgttactt
tgaacgtaaa gacagtacac ggatccgtat ctccaacaag cacgtagtaa 7320tcaaatttgg
tgttgttaaa cttcgcaata ttcatcaatt tagatagaaa cttatactca 7380tcatctgttt
taggaatcca tgtattatta ccactttcca acttatcatt atcccaggct 7440atgtttcgtc
catcatcgtt gcgcagagtg aataattctt ttgtattcgg tagttcaaat 7500atatgatcca
tgcatagatc ggcaaagcta ttgtagatgt gatttttcct aaatctaata 7560taaaactcgt
ttactagcaa acactttcct gatttatcga ccaagacaca tatggtttct 7620aaatctatca
agtggtgggg atccatagtt atgacgcagt aacatatatt attacattct 7680tgactgtcgc
taatatctaa atatttattg ttatcgtatt ggattctgca tatagatggc 7740ttgtatgtca
aagatataga acacataacc aatttatagt cgcgctttac attctcgaat 7800ctaaagttaa
gagatttaga aaacattata tcctcggatg atgttatcac tgtttctgga 7860gtaggatata
ttaaagtctt tacagatttc gtccgattca aataaatcac taaataatat 7920cccacattat
catctgttag agtagtatca ttaaatctat tatattttat gaaagatata 7980tcactgctca
cctctatatt tcgtacattt ttaaactgtt tgtataatat ctctctgata 8040caatcagata
tatctattgt gtcggtagac gataccgtta catttgaatt aatggtgttc 8100cattttacaa
cttttaacaa gttgaccaat tcatttctaa tagtatcaaa ctctccatga 8160ttaaatattt
taatagtatc cattttatat cactacggac acaaagtagc tgacataaac 8220cattgtataa
tttttatgtt ttatgtttat tagcgtacac attttggaag ttccggcttc 8280catgtatttc
ctggagagca agtagatgat gaggaaccag atagtttata tccgtacttg 8340cacttaaagt
ctacattgtc gttgtatgag tatgatcttt taaacccgct agacaagtat 8400ccgtttgata
ttgtaggatg tggacattta acaatctgac acgtgggtgg atcggaccat 8460tctcctcctg
aacacaggac actagagtta ccaatcaacg aatatccact attgcaacta 8520taagttacaa
cgctcccatc ggtataaaaa tcctcgtatc cgttatgtct tccgttggat 8580atagatggag
gggattggca tttaacagat tcacaaatag gtgcctcggg attccatacc 8640atagatccag
tagatcctaa ttcacaatac gatttagatt caccgatcaa ctgatatccg 8700ctattacaag
agtacgttat actagagcca aagtctactc caccaatatc aagttggcca 8760ttatcgatat
ctcgaggcga tgggcatctc cgtttaatac attgattaaa gagtgtccat 8820ccagtacctg
tacatttagc atatataggt cccatttttt gctttctgta tccaggtaga 8880catagatatt
ctatagtgtc tcctatgttg taattagcat tagcatcagt ctccacacta 8940ttcttaaatt
tcatattaat gggtcgtgac ggaatagtac agcatgatag aacgcatcct 9000attcccaaca
atgtcaggaa cgtcacgctc tccaccttca tatttattta tccgtaaaaa 9060tgttatcctg
gacatcgtac aaataataaa aagcccatat atgttcgcta ttgtagaaat 9120tgtttttcac
agttgctcaa aaacgatggc agtgacttat gagttacgtt acactttgga 9180gtctcatctt
tagtaaacat atcataatat tcgatattac gagttgacat atcgaacaaa 9240ttccaagtat
ttgattttgg ataatattcg tattttgcat ctgctataat taagatataa 9300tcaccgcaag
aacacacgaa catctttcct acatggttaa agtacatgta caattctatc 9360catttgtctt
ccttaactat atatttgtat agataattac gagtctcgtg agtaattcca 9420gtaattacat
agatgtcgcc gtcgtactct acagcataaa ctatactatg atgtctaggc 9480atgggagact
tttttatcca acgattttta gtgaaacatt ccacatcgtt taatactaca 9540tatttctcat
acgtggtata aactccaccc attacatata tatcatcgtt tacgaatacc 9600gacgcgcctg
aatatctagg agtaattaag tttggaagtc ttatccattt cgaagtgccg 9660tgtttcaaat
attctgccac acccgttgaa atagaaaatt ctaatcctcc tattacatat 9720aactttccat
cgttaacaca agtactaact tctgatttta acgacgacat attagtaacc 9780gttttccatt
ttttcgtttt aagatctacc cgcgatacgg aataaacatg tctattgtta 9840atcatgccgc
caataatgta tagacaatta tgtaaaacat ttgcattata gaattgtcta 9900tctgtattac
cgactatcgt ccaatattct gttctaggag agtaatgggt tattgtggat 9960atataatcag
agtttttaat gactactata ttatgtttta taccatttcg tgtcactggc 10020tttgtagatt
tggatatagt taatcccaac aatgatatag cattgcgcat agtattagtc 10080ataaacttgg
gatgtaaaat gttgatgata tctacatcgt ttggattttt atgtatccac 10140tttaataata
tcatagctgt aacatcctca tgatttacgt taacgtcttc gtgggataag 10200atagttgtca
gttcatcctt tgataatttt ccaaattctg gatcggatgt caccgcagta 10260atattgttga
ttatttctga catcgacgca ttatatagtt ttttaattcc atatctttta 10320gaaaagttaa
acatccttat acaatttgtg aaattaatat tatgaatcat agtttttaca 10380catagatcta
ctacaggcgg aacatcaatt attatggcag caactagtat catttctaca 10440ttgtttatgg
tgatgtttat cttcttccag cgcatatagt ctaatagcga ttcaaacgcg 10500tgatagttta
taccattcaa tataatcgct tcatccttta gatggtgatc ctgaatgcgt 10560ttaaaaaaat
tatacggaga cgccgtaata atttccttat tcacttgtat aatttcccca 10620ttgatagaaa
atattacgct ttccattctt aaagtactat aagtaattat agtataatgt 10680aaacgtttat
atattcaata tttttataaa aatcattttg acattaattc ctttttaaat 10740ttccgtctat
catctataga aacgtattct atgaatttat aaaatgcttt tacgtgtcct 10800atcgtaggcg
atagaaccgc taaaaagcct atcgaatttc tacaaaagaa tctgttatat 10860ggtataggga
gagtataaaa cattaaatgt ccgtacttat taaagtattc agtagccaat 10920cctaactctt
tcgaatactt attaatggct cttgttctgt acgaatctat ttttttgaac 10980aacggaccta
gtggtatatc ttgttctatg tatctaaaat aatgtctgac tagatccgtt 11040agtttaatat
ccgcagtcat cttgtctaga atggcaaatc taactgcggg tttaggcttt 11100agtttagttt
ctatatctac atctatgtct ttatctaaca ccaaaaatat aatagctaat 11160attttattac
aatcatccgg atattcttct acgatctcac taactaatgt ttctttggtt 11220atactagtat
agtcactatc ggacaaataa agaaaatcag atgatcgatg aataatacat 11280ttaaattcat
catctgtaag atttttgaga tgtctcatta gaatattatt agggttagta 11340ctcattatca
ttcggcagct attacttatt ttattatttt tcaccatata gatcaatcat 11400tagatcatca
aaatatgttt caatcatcct aaagagtatg gtaaatgact cttcccatct 11460aatttctgaa
cgttcaccaa tgtctctagc cactttggca ctaatagcga tcattcgctt 11520agcgtcttct
atattattaa ctggttgatt caatctatct agcaatggac cgtcggacag 11580cgtcattctc
atgttcttaa tcaatgtaca tacatcgccg tcatctacca attcatccaa 11640caacataagc
tttttaaaat catcattata ataggtttga tcgttgtcat ttctccaaag 11700aatatatcta
ataagtagag tcctcatgct tagttaacaa ctatttttta tgttaaatca 11760attagtacac
cgctatgttt aatacttatt catattttag tttttaggat tgagaatcaa 11820tacaaaaatt
aatgcatcat taattttaga aatacttagt ttccacgtag tcaatgaaac 11880atttgaactc
atcgtacagg acgttctcgt acaggacgta actataaacc ggtttatatt 11940tgttcaagat
agatacaaat ccgataactt tttttacgaa ttctacggga tccactttaa 12000aagtgtcata
ccgggttctt tttatttttt taaacagatc aatggtgtga tgttgattag 12060gtcttttacg
aatttgatat agaatagcgt ttacatatcc tccataatgg tcaatcgcca 12120tttgttcgta
tgtcataaat tctttaatta tatgacactg tgtattattt agttcatcct 12180tgttcattgt
taggaatcta tccaaaatgg caattatact agaactatag gtgcgttgta 12240tacacatatt
gatgtgtctg tttatacaat caatgctact accttcgggt aaaattgtag 12300catcatatac
catttctagt actttaggtt cattattatc cattgcagag gacgtcatga 12360tcgaatcata
aaaaaatata ttatttttat gttattttgt taaaaataat catcgaatac 12420ttcgtaagat
actccttcat gaacataatc agttacaaaa cgtttatatg aagtaaagta 12480tctacgattt
ttacaaaagt ccggatgcat aagtacaaag tacgcgataa acggaataat 12540aatagattta
tctagtctat ctttttctat agctttcata gttagataca tggtctcaga 12600agtaggatta
tgtaacatca gcttcgataa aatgactggg ttatttagtc ttacacattc 12660gctcatacat
gtatgaccgt taactacaga gtctacacta aaatgattga acaatagata 12720gtctaccatt
gtttcgtatt cagatagtac agcgtagtac atggcatctt cacaaattat 12780atcattgtct
aatagatatt tgacgcatct tatggatccc acttcaacag ccatcttaaa 12840atcggtagaa
tcatattgct ttcctttatc attaataatt tctagaacat catctctatc 12900ataaaagata
caaatattaa ctgtttgatc cgtaataaca ttgctagtcg atagcaattt 12960gttaataaga
tgcgctgggc tcaatgtctt aataagaagt gtaagaggac tatctccgaa 13020tttgttttgt
ttattaacat ccgttgatgg aagtaaaaga tctataatgt ctacattctt 13080gactgtttta
gagcatacaa tatggagagg tgtatttcca tcatgatctg gttttgaggg 13140actaattcct
agtttcatca tccatgagat tgtagaagct tttggattgt ctgacataag 13200atgtctatga
atatgatttt tgccaaattt atccactatc ctggcttcga atccgatgga 13260cattattttt
ttaaacactc tttctgaagg atctgtacac gccaacaacg gaccacatcc 13320ttcttcatca
accgagttgt taatcttggc tccatactgt accaataaat ttattctctc 13380tatgacttca
tcatctgttc ccgagagata atatagaggc gttttatgct gtttatcaca 13440cgcgtttgga
tctgcgccgt gcgtcagcag catcgcgact attctattat tattaatttt 13500agaagctata
tgcaatggat aatttccatc atcatccgtc tcatttggag agtatcctct 13560atgaagaagt
tcttcgacaa atcgttcatc tagtccttta attccacaat acgcatgtag 13620aatgtgataa
ttatttccag aaggttcgat agcttgtagc atattcctaa atacatctaa 13680atttttacta
ttatatttgg cataaagaga tagataatac tcggccgaca taatgttgtc 13740cattgtagta
taaaaattaa tatttctatt tctgtatatt tgcaacaatt tactctctat 13800aacaaatatc
ataacttagt tcttttatgt caagaaggca ctggtttagt tcatctataa 13860atgtcacgcc
ataactacca cgcatgccat actcagaatt atgataaaga tatttatcct 13920tggggtgtag
gtaatgggga ttaatctttg ttggatcagt ctctaagtta acacatgtca 13980cacatgatcc
atttatagtt atatcacacg atgatgattt atgaattgat tccggaagat 14040cgctatcgta
ttttgtggtt ccacaattca tttccataca tgttattgtc acactaatat 14100tatgatgaac
tttatctagc cgctgagtgg taaacaacag aacagatagt ttattatctt 14160taccaacacc
ctcagccgct gccacaaatc tctgatccgt atccatgatg gtcatgttta 14220tttctagtcc
gtatccagtc aacactatgt tagcatttct gtcgatatag ctttcactca 14280tatgacactc
accaataata gtagaattaa tgtcgtaatt tacaccaata gtgagttcgg 14340cggcaaagta
ccaataccgg taatcttgtc gaggaggaca tatagtattc ttgtattcta 14400ccgaataccc
gagagatgcg atacaaaaga gcaagactaa tttgtaaacc atcttactca 14460aaatatgtaa
caatagtacg atgcaatgag taagacaata ggaaatctat cttatataca 14520cataattatt
ctatcaattt taccaattag ttagtgtaat gttaacaaaa atgtgggaga 14580atctaattag
tttttcttta cacaattgac gtacatgagt ctgagttcct tgtttttgct 14640aattatttca
tccaatttat tattcttgac gatatcgaga tcttttgtat aggagtcaaa 14700cttgtattca
acatgctttt ctataatcat tttagctatt tcggcatcat ccaatagtac 14760attttccaga
ttagcagaat agatattaat gtcgtatttg aacagagcct gtaacatctc 14820aatgtcttta
ttatctatag ccaatttaat gtccggaatg aagagaaggg aattattggt 14880gtttgtcgac
gtcatatagt cgagcaagag aatcatcata tccacgtgtc cattttttat 14940agtgatgtga
atacaactaa ggagaatagc cagatcaaaa gtagatggta tctctgaaag 15000aaagtaggaa
acaatactta catcattaag catgacggca tgataaaatg aagttttcca 15060tccagttttc
ccatagaaca tcagtctcca atttttctta acaaacagtt ttaccgtttg 15120catgttacca
ctatcaaccg cataatacaa tgcggtgttt cccttgtcat caaattgtga 15180atcatccagt
ccactgaata gcaaaatctt tactattttg gtatcttcca atgtggctgc 15240ctgatgtaat
ggaaattcat tctctagaag atttttcaat gctccagcgt tcaacaacgt 15300acatactaga
cgcacgttat tatcagctat tgcataatac aaggcactat gtccatggac 15360atccgcctta
aatgtatctt tactagagag aaagcttttc agctgcttag acttccaagt 15420attaattcgt
gacagatcca tgtctgaaac gagacgctaa ttagtgtata ttttttcatt 15480ttttataatt
ttgtcatatt gcaccagaat taataatatc tttaatagat ctgattagta 15540gatacatggc
tatcgcaaaa caacatatac acatttaata aaaataatat ttattaagaa 15600aattcagatt
tcacgtaccc atcaatataa ataaaataat gattccttac accgtaccca 15660tattaaggag
attccacctt acccataaac aatataaatc cagtaatatc atgtctgatg 15720atgaacacaa
atggtgtatt aaattccagt ttttcaggag atgatctcgc cgtagctacc 15780ataatagtag
atgcctctgc tacagttcct tgttcgtcga catctatctt tgcattctga 15840aacattttat
aaatatataa tgggtcccta gtcatatgtt taaacgacgc attatctgga 15900ttaaacatac
taggagccat catttcggct atcgacttaa tatccctctt attttcgata 15960gaaaatttag
ggagtttaag attgtacact ttattcccta attgagacga ccaatagtct 16020aattttgcag
ccgtgataga atctgtgaaa tgggtcatat tatcacctat tgccaggtac 16080atactaatat
tagcatcctt atacggaagg cgtaccatgt catattcttt gtcatcgatt 16140gtgattgtat
ttccttgcaa tttagtaact acgttcatca tgggaaccgt tttcgtaccg 16200tacttattag
taaaactagc attgcgtgtt ttagtgatat caaacggata ttgccatata 16260cctttaaaat
atatagtatt aatgattgcc catagagtat tattgtcgag catattagaa 16320tctactacat
tagacatacc ggatctacgt tctactatag aattaatttt attaaccgca 16380tctcgtctaa
agtttaatct atataggccg aatctatgat attgttgata atacgacggt 16440ttaatgcaca
cagtattatc tacgaaactt tgataagtta gatcagtgta cgtatattta 16500gatgttttca
gcttagctaa tcctgatatt aattctgtaa atgctggacc cagatctctt 16560tttctcaaat
ccatagtctt caataattct attctagtat tacctgatgc aggcaatagc 16620gacataaaca
tagaaaacga ataaccaaac ggtgagaaga caatattatc atcttgaata 16680tttttatacg
ctactatacc ggcattggta aatccttgta gacgataggc ggacgctgaa 16740cacgctaacg
atagtatcaa taacgcaatc atgattttat ggtattaata attaacctta 16800tttttatgtt
cggtataaaa aaattattga tgtctacaca tccttttgta attgacatct 16860atatatcctt
ttgtataatc aactctaatc actttaactt ttacagtttt ccctaccagt 16920ttatccctat
attcaacata tctatccata tgcatcttaa cactctctgc caagatagct 16980tcagagtgag
gatagtcaaa aagataaata tatagagcat aatcattctc gtatactctg 17040ccctttatta
catcacccgc attgggcaac gaataacaaa atgcaagcat cttgttaacg 17100ggctcgtaaa
ttgggataaa aattatgttt ttattgtctt atatctattt tattcaagag 17160aatattcagg
aatttctttt tccggttgta tctcgtcgca gtatatatca tttgtacatt 17220gtttcatatt
ttttaatagt ttacaccttt tagtaggact agtatcgtac aattcatagc 17280tgtattttga
attccaatca cgcataaaaa tatcttccaa ttgttgacga agacctaatc 17340catcatccgg
tgtaatatta atagatgctc cacatgtatc cgtaaagtaa tttcctgtcc 17400aatttgaggt
acctatatag gccgttttat cggttaccat atatttggca tggtttaccc 17460tagaatacgg
aatgggagga tcagcatctg gtacaataaa tagctttact tctatattta 17520tgtttttaga
ttttagcata gcgatagatc ttaaaaagtt tctcatgata aacgaagatc 17580gttgccagca
actaatcaat agcttaacgg atacttgtct gtctatagcg gatcttctta 17640attcatcttc
tatataaggc caaaacaaaa ttttacccgc cttcgaataa ataataggga 17700taaagttcat
aacagataca taaacgaatt tactcgcatt tctaatacat gacaataaag 17760cggttaaatc
attggttctt tccatagtac atagttgttg cggtgcagaa gcaataaata 17820cagagtgtgg
aacgccgctt acgttaatac taagaggatg atctgtatta taatacgacg 17880gataaaagtt
tttccaatta tatggtagat tgttaactcc aagataccag tatacctcaa 17940aaatttgagt
gagatccgct gccaagttcc tattattgaa gatcgcaata cccaattcct 18000tgacctgagt
tagtgatctc caatccatgt tagcgcttcc taaataaata tgtgtattat 18060cagatatcca
aaattttgta tgaagaactc ctcctaggat atttgtaata tctatgtatc 18120gtacttcaac
tccggccatt tgtagtcttt caacatcctt taatggtttg ttagatttat 18180taacggctac
tctaactcgt actcctcttt tgggtaattg tacaatctcg tttaatatta 18240tcgtgccgaa
attcgtaccc acttcatccg ataaactcca ataaaaagat gatatatcta 18300gtgtttttgt
ggtattggat agaatttccc tccacatgtt aaatgtagac aaatatactt 18360tatcaaattg
catacctata ggaatagttt ctgtaatcac tgcgattgta ttatccggat 18420tcattttatt
tgttaaaaga ataatcctat atcacttcac tctattaaaa atccaagttt 18480ctatttcttt
catgactgat tttttaactt catccgtttc cttatgaaga tgatgtttgg 18540caccttcata
aatttttatt tctctattac aatttgcatg ttgcatgaaa taatatgcac 18600ctaaaacatc
gctaatctta ttgtttgttc cctggagtat gagagtcggg ggggtgttaa 18660tcttggaaat
tatttttcta accttgttgg tagccttcaa gacctgacta gcaaatccag 18720ccttaatttt
ttcatgattg actaatgggt cgtattggta tttataaact ttatccatat 18780ctctagatac
tgattctgga catagctttc cgactggcgc atttggtgtg atggttccca 18840taagtttggc
agctagcaga ttcagtcttg aaacagcatc tgcattaact agaggagaca 18900ttagaatcat
tgctgtaaac aagtttggat tatcgtaaga ggctagctcc catggaatga 18960cccaataagt
agatttaata gttaccacgt gctgtaccaa agtcatcaat catcattttt 19020tcaccattac
ttcttccatg tccaatatga tcatgtgaga atactaaaat tcctaacgat 19080gatatgtttt
cagctagttc gtcataacgt ccagaatgtt taccagctcc atgacttatg 19140aatactaatg
ccttaggata tgtaataggt ttccaatatt tacaatatat gtaatcattg 19200tccagattga
acatacagtt tgcactcatg attcacgtta tataactatc aatattaaca 19260gttcgtttga
tgatcatatt atttttatgt tttattgata attgtaaaaa catacaatta 19320aatcaatata
gaggaaggag acggctactg tcttttgtaa gatagtcatg gcgactaaat 19380tagattatga
ggatgctgtt ttttactttg tggatgatga taaaatatgt agtcgcgact 19440ccatcatcga
tctaatagat gaatatatta cgtggagaaa tcatgttata gtgtttaaca 19500aagatattac
cagttgtgga agactgtaca aggaattgat gaagttcgat gatgtcgcta 19560tacggtacta
tggtattgat aaaattaatg agattgtcga agctatgagc gaaggagacc 19620actacatcaa
ttttacaaaa gtccatgatc aggaaagttt attcgctacc ataggaatat 19680gtgctaaaat
cactgaacat tggggataca aaaagatttc agaatctaga ttccaatcat 19740tgggaaacat
tacagatttg atgaccgacg ataatataaa catcttgata ctttttctag 19800aaaaaaaatt
gaattgatga tataggggtc ttcataacgc ataattatta cgttagcatt 19860ctatatccgt
gttaaaaaaa attatcctat catgtatttg agagttttat atgtagcaaa 19920catgatagct
gtgatgccaa taagctttag atattcacgc gtgctagtgt tagggatggt 19980attatctggt
ggtgaaatgt ccgttatata atctacaaaa caatcatcgc atatagtatg 20040cgatagtaga
gtaaacattt ttatagtttt tactggattc atacatcgtc tacccaattc 20100ggttataaat
gaaattgtcg ccaatcttac acccaacccc ttgttatcca ttagcatagt 20160attaacttcg
ttatttatgt cataaactgt aaatgatttt gtagatgcca tatcatacat 20220gatattcatg
tccctattat aatcattact aactttatca caatatatgt tgataatatc 20280tatatatgat
ctagtctttg tgggcaactg tctatacaag tcgtctaaac gttgtttact 20340catatagtat
cgaacagcca tcattacatg gtcccgttcc gttgatagat aatcgagtat 20400gttagtggac
ttgtcaaatc tatataccat attttctgga agtggatata catagtcgtg 20460atcaacatta
ttgctagcct catcttctat atcctgtact ataccattat ctatatcatc 20520tacataatct
atgatattat tacacataaa catcgacaac atactattgt ttattatcta 20580agtcctgttg
atccaaaccc ttgatctcct ctatttgtac tatctagaga ttgtacttct 20640tccagttctg
gataatatat acgttgatag attagctgag ctattctatc tccagtattt 20700acattaaacg
tacattttcc attattaata agaatgactc ctatgtttcc cctataatct 20760tcgtctatta
caccacctcc tatatcaatg ccttttagtg acagaccaga cctaggagct 20820attctaccat
agcagaactt aggcatggac atactaatat ctgtcttaat taactgtctt 20880tctcctggag
ggatagtata atcgtaagcg ctatacaaat catatccggc agcacccggc 20940gattgcctag
taggagattt agctctgtta gtttccttaa caaatctaac tggtgagtta 21000atattcatgt
tgaacataaa actaatattt tatttcaaaa ttatttacca tcccatatat 21060tccatgaata
agtgtgatga ttgtacactt ctatagtatc tatatacgat ccacgataaa 21120atcctcctat
caatagcagt ttattatcca ctatgatcaa ttctggatta tccctcggat 21180aaataggatc
atctatcaga gtccatgtat tgctggattc acaataaaat tccgcatttc 21240taccaaccaa
gaataacctt ctaccgaaca ctaacgcgca tgatttataa tgaggataat 21300aagtggatgg
tccaaactgc cactgatcat gattgggtag caaatattct gtagttgtat 21360cagtttcaga
atgtcctccc attacgtata taacattgtt tatggatgcc actgctggat 21420tacatctagg
tttcagaaga ctcggcatat taacccaagc agcatccccg tggaaccaac 21480gctcaacaga
tgtgggattt ggtagacctc ctactacgta taatttattg ttagcgggta 21540tcccgctagc
atacagtctg gggctattca tcggaggaat tggaatccaa ttgtttgata 21600tataatttac
cgctatagca ttgttatgta tttcattgtt catccatcca ccgatgagat 21660atactacttc
tccaacatga gtacttgtac acatatggaa tatatctata atttgatcca 21720tgttcatagg
atactctatg aatggatact tgtatgattt gcgtggttgt ttatcacaat 21780gaaatatttt
ggtacagtct agtatccatt ttacattatt tatacctctg ggagaaagat 21840aatttgacct
gattacattt ttgataagga gtagcagatt tcctaattta tttcttcgct 21900ttatatacca
cttaatgaca aaatcaacta cataatcctc atctggaaca tttagttcat 21960cgctttctag
aataagtttc atagatagat aatcaaaatt gtctatgatg tcatcttcca 22020gttccaaaaa
gtgtttggca ataaagtttt tagtatgaca taagagattg gatagtccgt 22080attctatacc
catcatgtaa cactcgacac aatattcctt tctaaaatct cgtaagataa 22140agtttataca
agtgtagatg ataaattcta cagaggttaa tatagaagca cgtaataaat 22200tgacgacgtt
atgactatct atatatacct ttccagtata cgagtaaata actatagaag 22260ttaaactgtg
aatgtcaagg tctagacaaa ccctcgtaac tggatcttta tttttcgtgt 22320atttttgacg
taaatgtgtg cgaaagtaag gagataactt tttcaatatc gtagaattga 22380ctattatatt
gcctcctatg gcatcaataa ttgttttgaa tttcttagtc atagacaatg 22440ctaatatatt
cttacagtac acagtattga caaatatcgg catttatgtt tctttaaaag 22500tcaacatcta
gagaaaaatg attatctttt tgagacataa ctcccatttt ttggtattca 22560cccacacgtt
tttcgaaaaa attagttttt ccttccaatg atatattttc catgaaatca 22620aacggattgg
taacattata aattttttta aatcccaatt cagaaatcaa tctatccgcg 22680acgaattcta
tatatgtttt catcatttca caattcattc ctataagttt aactggaaga 22740gccgcagtaa
gaaattcttg ttcaatggat actgcatctg ttataataga tctaacggtt 22800tcttcactcg
gtggatgcaa taaatgttta aacatcaaac atgcgaaatc gcagtgcaga 22860ccctcgtctc
tactaattag ttcgttggaa aacgtgagtc cgggcattag gccacgcttt 22920ttaagccaaa
atatggaagc gaatgatccg gaaaagaaga ttccttctac tgcagcaaag 22980gcaataagtc
tctctccata accggcgctg tcatgtatcc acttttgagc ccaatcggcc 23040ttctttttta
cacaaggcat cgtttctatg gcattaaaga gatagttttt ttcattacta 23100tctttaacat
aagtatcgat caaaagacta tacatttccg aatgaatgtt ttcaatggcc 23160atctgaaatc
cgtagaaaca tctagcctcg gtaatctgta cttctgtaca aaatcgttcc 23220gccaaatttt
cattcactat tccgtcactg gctgcaaaaa acgccaatac atgttttata 23280aaatattttt
cgtctggtgt tagtttattc caatcattga tatctttaga tatatctact 23340tcttccactg
tccaaaatga tgcctctgcc tttttataca tgttccagat gtcatgatat 23400tggattggga
aaataacaaa tctatttgga tttggtgcaa ggatgggttc cataactaaa 23460ttaacaataa
caataaattt tttttcagtt atctatatgc ctgtacttgg attttttgta 23520catcgatatc
gccgcaatca ctacaataat tacaagtatt attgatagca ttgttattag 23580tactatcata
attaaattat ctacattcat gggtgctgaa taatcgttat tatcatcatt 23640atcattttgt
aattgtgaca tcatactaga taaatcgttt gcgagattgt tgtgggaagc 23700gggcatggag
gatgcattat cattattatt taacgccttc catttggatt cacaaatgtt 23760acgcacattc
aacattttat ggaaactata attttgtgaa aacaaataac aagaaaactc 23820gtcatcgttc
aaatttttaa cgatagtaaa ccgattaaac gtcgagctaa tttctaacgc 23880tagcgactct
gttggatatg ggtttccaga tatatatctt ttcagttccc ctacgtatct 23940ataatcatct
gtaggaaatg gaagatattt ccatttatct actgttccta atatcatatg 24000tggtggtgta
gtagaaccat taagcgcgaa agatgttatt tcgcatcgta ttttaacttc 24060gcaataattt
ctggttagat aacgcactct accagtcaag tcaatgatat tagcctttac 24120agatatattc
atagtagtcg taacgatgac tccatctttt agatgcgata ctcctttgta 24180tgtaccagaa
tcttcgtacc tcaaactcga tatatttaaa caagttaatg agatattaac 24240gcgttttatg
aatgatgata tataaccaga agttttatcc tcggtggcta gcgctataac 24300cttatcatta
taataccaac tagtgtgatt aatatgtgac acgtcagtgt gggtacaaat 24360atgtacatta
tcgtctacgt cgtattcgat acatccgcat acagccaaca aatataaaat 24420gacaaatact
ctaacgccgt tcgtacccat cttgatgcgg tttaataaat gttttgattt 24480caatttattg
taaaaaaaga ttcggtttta tactgttcga tattctcatt gcttatattt 24540tcatctatca
tctccacaca gtcaaatccg tggttagcat gcacctcatc aaccggtaaa 24600agactatcgg
actcttctat cattataact ctagaatatt taatttggtc attattaatc 24660aagtcaatta
tcttattttt aacaaacgtg agtattttac tcatttttta taaaaacttt 24720tagaaatata
cagactctat cgtgtgtcta tatcttcttt ttatatccaa tgtatttatg 24780tctgattttt
cttcatttat catatataat ggtccaaatt ctacacgtgc ttcggattca 24840tccagatcat
taaggttctt ataattgtaa catccttctc ttccctcttc tacatcttcc 24900ttcttattct
tattcttagc gtcacagaat ctaccacagc aggatcccat gacgagcgtc 24960atattaaact
aatccatttt caattataat atatgattag taatgaccat taaaataaaa 25020aatattcttc
ataaccggca agaaagtgaa aagttcacat tgaaactatg tcagtagtat 25080acatcatgaa
atgatgatat atatatactc tattttggtg gaggattata tgatataatt 25140cgtggataat
catttttaag acacatttct ttattcgtaa atcttttcac gttaaatgag 25200tgtccatatt
ttgcaatttc ttcatatgat ggcggtgtac gtggacgagg ctgctcctgt 25260tcttgttgtg
gtcgccgact gtcgtgtctg cgtttagatc cctccattat cgcgattgcg 25320tagatggagt
actattttat accttgtaat taaatttttt tattaattaa acgtataaaa 25380acgttccgta
tctgtattta agagccagat ttcgtctaat agaacaaata gctacagtaa 25440aaataactag
aataattgct acacccacta gaaaccacgg atcgtaatac ggcaatcggt 25500tttcgataat
aggtggaacg tatattttat ttaaggactt aacaattgtc tgtaaaccac 25560aatttgcttc
cgcggatcct gtattaacta tctgtaaaag catatgttga ccgggcggag 25620ccgaacattc
tccgatatct aatttctgta tatctataat attattaacc tccgcatacg 25680cattacagtt
cttttctagc ttggataccg cactaggtac atcgtctaga tctattccta 25740tttcctcagc
gatagctctt ctatcctttt ccggaagcaa tgaaatcact tcaataaatg 25800attcaaccat
gagtgtgaaa ctaagtcgag aattactcat gcatttgtta gttattcgga 25860gcgcgcaatt
tttaaactgt cctataacct ctcctatatg aatagcacaa gtgacattag 25920tagggataga
atgttgagct aatttttgta aataactatc tataaaaaga ttatacaaag 25980ttttaaactc
tttagtttcc gccatttatc cagtctgaga aaatgtctct cataataaat 26040ttttccaaga
aactaattgg gtgaagaatg gaaaccttta atctatattt atcacagtct 26100gttttggtac
acatgatgaa ttcttccaat gccgtactaa attcgatatc tttttcgatt 26160tctggatatg
tttttaataa agtatgaaca aagaaatgga aatcgtaata ccagttatgt 26220ttaactttga
aattgttttt tattttcttg ttaatgattc cagccacttg ggaaaagtca 26280aagtcgttta
atgccgattt aatacgttca ttaaaaacaa actttttatc ctttagatga 26340attattattg
gttcattgga atcaaaaagt aagatattat cgggtttaag atctgcgtgt 26400aaaaagttgt
cgcaacaggg tagttcgtag attttaatgt ataacagagc catctgtaaa 26460aagataaact
ttatgtattg taccaaagat ttaaatccta atttgatagc taactcggta 26520tctactttat
ctgccgaata cagtgctagg ggaaaaatta taatgtttcc tctttcatat 26580tcgtagttag
ttctcttttc atgttcgaaa aagtgaaaca tgcggttaaa atagtttata 26640acattaatat
tactgttaat aactgccgga taaaagtggg atagtaattt cacgaatttg 26700atactgtcct
ttctctcgtt aaacgccttt aaaaaaactt tagaagaata tctcaatgag 26760agttcctgac
catccatagt ttgtatcaat aatagcaaca tatgaagaac acgtttatac 26820agagtatgta
aaaatgttaa tttatagttt aatcccatgg cccacgcaca cacgattaat 26880tttttttcat
ctccctttag attgttgtat agaaatttgg gtactgtgaa ctccgccgta 26940gtttccatgg
gactatataa ttttgtggcc tcgaatacaa attttactac atagttatct 27000atcttaaaga
ctataccata tcctcctgta gatatgtgat aaaaatcgtc gtttatagga 27060taaaatcgtt
tatccttttg ttggaaaaag gatgaattaa tgtaatcatt ctcttctatc 27120tttagtagtg
tttccttatt aaaattctta aaataattta acaatctaac tgacggagcc 27180caattttggt
gtaaatctaa ttgggacatt atattgttaa aatacaaaca gtctcctaat 27240ataacagtat
ctgataatct atggggagac atccattgat attcagggga tgaatcattg 27300gcaacaccca
tttattgtac aaaaagcccc aatttacaaa cgaaagtcca ggtttgatag 27360agacaaacaa
ttaactattt tgtctctgtt tttaacacct ccacagtttt taatttcttt 27420agtaatgaaa
ttattcacaa tatcagtatc ttctttatct accagagatt ttactaactt 27480gataaccttg
gctgtctcat tcaatagggt agtaatattt gtatgtgtga tattgatatc 27540tttttgaatt
gtttctttta gaagtgattc tttgatggtg ccagcatacg aattacaata 27600atgcagaaac
tcggttaaca tgcaggaatt atagtaagcc aattccaatt gttgcctgtg 27660ttgtattaga
gtgtcaatat gagcaatggt gtccttgcgt ttctctgata gaatgcgagc 27720agcgattttg
gcgttatcat ttgacgatat ttctggaatg acgaatcctg tttctactaa 27780ctttttggta
ggacaaagtg aaacaatcaa gaagatagct tctcctccta tttgtggaag 27840aaattgaact
cctctagatg atctactgac gatagtatct ccttgacaga tattggaccg 27900aattacagaa
gtacctggaa tgtaaagccc tgaaaccccc tcatttttta agcagattgt 27960tgccgtaaat
cctgcactat gcccaagata gagagctcct ttggtgaatc catctctatg 28020tttcagttta
accaagaaac agtcagctgg tctaaaattt ccatctctat ctaatacagc 28080atctaacttg
atgtcaggaa ctatgaccgg tttaatgtta tatgtaacat tgagtaaatc 28140cttaagttca
taatcatcac tgtcatcagt tatgtacgat ccaaacaatg tttctaccgg 28200catagtggat
acgaagatgc tatccatcag aatgtttccc tgattagtat tttctatata 28260gctattcttc
tttaaacgat tttccaaatc agtaactatg ttcatttttt taggagtagg 28320acgcctagcc
agtatggaag aggattttct agatcctctc ttcaacatct ttgatctcga 28380tggaatgcaa
aaccccatag tgaaacaacc aacgataaaa ataatattgt ttttcacttt 28440ttataatttt
accatctgac tcatggattc attaatatct ttataagagc tactaacgta 28500taattcttta
taactgaact gagatatata caccggatct atggtttcca taattgagta 28560aatgaatgct
cggcaataac taatggcaaa tgtatagaac aacgaaatta tactagagtt 28620gttaaagtta
atattttcta tgagctgttc caataaatta tttgttgtga ctgcgttcaa 28680gtcataaatc
atcttgatac tatccagtaa accgttttta agttctggaa tattatcatc 28740ccattgtaaa
gcccctaatt cgactatcga atatcctgct ctgatagcag tttcaatatc 28800gacggacgtc
aatactgtaa taaaggtggt agtattgtca tcatcgtgat aaactacggg 28860aatatggtcg
ttagtaggta cggtaacttt acacaacgcg atatataact ttccttttgt 28920accattttta
acgtagttgg gacgtcctgc agggtattgt tttgaagaaa tgatatcgag 28980aacagatttg
atacgatatt tgttggattc ctgattattc actataatat aatctagaca 29040gatagatgat
tcgataaata gagaaggtat atcgttggta ggataataca tccccattcc 29100agtattctcg
gatactctat tgatgacact agttaagaac atgtcttcta ttctagaaaa 29160cgaaaacatc
ctacatggac tcattaaaac ttctaacgct cctgattgtg tctcgaatgc 29220ctcgtacaag
gatttcaagg atgccataga ttctttgacc aacgatttag aattgcgttt 29280agcatctgat
ttttttatta aatcgaatgg tcggctctct ggtttgctac cccaatgata 29340acaatagtct
tgtaaagata aaccgcaaga aaatttatac gcatccatcc aaataaccct 29400agcaccatcg
gatgatatta atgtattatt atagattttc catccacaat tattgggcca 29460gtatactgtt
agcaacggta tatcgaatag attactcatg taacctacta gaatgatagt 29520tcgtgtacta
gtcataatat ctttaatcca atctaaaaaa tttaaaatta gattttttac 29580actgttaaag
ttaacaaaag tattacccgg gtacgtggat atcatatatg gcattggtcc 29640attatcagta
atagctccat aaactgatac ggcgatggtt tttatatgtg tttgatctaa 29700cgaggaagaa
attcgcgccc acaattcatc tctagatatg tatttaatat caaacggtaa 29760cacatcaatt
tcgggacgcg tatatgtttc taaattttta atccaaatat aatgatgacc 29820tatatgccct
attatcatac tgtcaactat agtacaccta gggaacttac gatacatctg 29880tttcctataa
tcgttaaatt ttacaaatct ataacatgct aaaccttttg acgacagcca 29940ttcattaatt
tctgatatgg aatctgtatt ctcgataccg tatcgttcta aagccagtgc 30000tatatctccc
tgttcgtggg aacgctttcg tataatatcg atcaacggat aatctgaagt 30060ttttggagaa
taatatgact catgatctat ttcgtccata aacaatctag acataggaat 30120tggaggcgat
gatcttaatt ttgtgcaatg agtcgtcaat cctataactt ctaatcttgt 30180aatattcatc
atcgacataa tactatctat gttatcatcg tatattagta taccatgacc 30240ttcttcattt
cgtgccaaaa tgatatacag tcttaaatag ttacgcaata tctcaatagt 30300ttcataattg
ttagctgttt tcatcaaggt ttgtatcctg tttaacatga tggcgttcta 30360taacgtctct
attttctatt tttaattttt taaattttta acgatttact gtggctagat 30420acccaatctc
tctcaaatat ttttttagcc tcgcttacaa gctgtttatc tatactatta 30480aaactgacga
atccgtgatt ttggtaatgg gttccgtcga aatttgccga agtgatatga 30540acatattcgt
cgtcgactat caacaatttt gtattattct gaatagtgaa aaccttcaca 30600gatagatcat
tttgaacaca caacgcatct agacttttgg cggttgccat agaatatacg 30660tcgttcttat
cccaattacc aactagaagt ctgatcttaa ctcctctatt aatggctgct 30720tctataatgg
agttgtaaat gtcgggccaa tagtagctat taccgtcgac acgtgtagtg 30780ggaactatgg
ccaaatgttc aatatctata ctagtcttag ctgacctgag tttatcaata 30840actacatcgg
tatctagatc tctagaatat cccaataggt gttccggaga atcagtaaag 30900aacactccac
ctataggatt cttaatatga tacgcagtgc taactggcaa acaacaagcc 30960gcagagcata
aattcaacca tgaatttttt gcgctattaa aggctttaaa agtatcaaat 31020cttctacgaa
gatctgtggc cagcggggga taatcagaat atacacctaa cgttttaatc 31080gtatgtatag
atcctccagt aaatgacgcg tttcctacat aacatctttc atcatctgac 31140acccaaaaac
aaccgagtag tagtcccaca ttattttttt tatctatatt aacggttata 31200aaatttatat
ccgggcagtg actttgtagc tctcccagat ttcttttccc tcgttcatct 31260agcaaaacta
ttattttaat ccctttttca gatgcctctt ttagtttatc aaaaataagc 31320gctcccctag
tcgtactcag aggattacaa caaaaagatg ctatgtatat atatttctta 31380gctagagtga
taatttcgtt aaaacattca aatgttgtta aatgatcgga tctaaaatcc 31440atattttctg
gtagtgtttc taccagccta cattttgctc ccgcaggtac cgatgcaaat 31500ggccacattt
agttaacata aaaacttata catcctgttc tatcaacgat tctagaatat 31560catcggctat
atcgctaaaa ttttcatcaa agtcgacatc acaacctaac tcagtcaata 31620tattaagaag
ttccatgatg tcatcttcgt ctatttctat atccgtatcc attgtagatt 31680gttgaccgat
tatcgagttt aaatcattac taatactcaa tccttcagaa tacaatctgt 31740gtttcattgt
aaatttatag gcggtgtatt taagttggta gattttcaat tatgtattaa 31800tatagcaaca
gtagttcttg ctcctccttg attctagcat cctcttcatt attttcttct 31860acgtacataa
acatgtccaa tacgttagac aacacaccga cgatggcggc cgctacagac 31920acgaatatga
ctaaaccgat gaccatttaa aaacccctct ctagctttca cttaaactgt 31980atcgatcatt
cttttagcac atgtataata taaaaacatt attctatttc gaatttaggc 32040ttccaaaaat
ttttcatccg taaaccgata ataatatata tagacttgtt aatagtcgga 32100ataaatagat
taatgcttaa actatcatca tctccacgat tagagataca atatttacat 32160tctttttgct
gtttcgaaac tttatcaata cacgttaata caaacccagg aaggagatat 32220tgaaactgag
gctgttgaaa atgaaacggt gaatacaata attcagataa tgtaaaatca 32280tgattccgta
ttctgatgat attagaactg ctaatggatg tcgatggtat gtatctagga 32340gtatctattt
taacaaagca tcgatttgct aatatacaat tatccttttg attaattgtt 32400attttattca
tattcttaaa aggtttcata tttatcaatt cttctacatt aaaaatttcc 32460atttttaatt
tatgtagccc cgcaatactc ctcattacgt ttcatttttt gtctataata 32520tccattttgt
tcatctcggt acatagatta tccaattgag aagcgcattt agtagttttg 32580tacattttaa
gtttattgac gaatcgtcga aaactagtta tagttaacat tttattattt 32640gataccctga
tattaatacc cctgccgtta ctattattta taactgatgt aatccacgta 32700acattggaat
taactatcga tagtaatgca tcgacgcttc caaaattgtc tattataaac 32760tcaccgataa
tttttttatt gcatgttttc atattcatta ggattatcaa atctttaatc 32820ttattacgat
tgtatgcgtt gatattacaa gacgtcattc taaaagacgg aggatctcca 32880tcaaatgcca
gacaatcacg tacaaagtac atggaaatag gttttgttct attgcgcatc 32940atagatttat
atagaacacc cgtagaaata ctaatttgtt ttactctata aaatactaat 33000gcatctattt
catcgttttg tataacgtct ttccaagtgt caaattccaa atttttttca 33060ttgatagtac
caaattcttc tatctcttta actacttgca tagataggta attacagtga 33120tgcctacatg
ccgttttttg aaactgaata gatgcgtcta gaagcgatgc tacgctagtc 33180acaatcacca
ctttcatatt tagaatatat atatgtaaaa atatagtaga atttcatttt 33240gtttttttct
atgctataaa tgaattctca ttttgcatct gctcatactc cgttttatat 33300taataccaaa
gaaggaagat atctggttct aaaagccgtt aaagtatgcg atgttagaac 33360tgtagaatgc
gaaggaagta aagcttcctg cgtactcaaa gtagataaac cctcatcgcc 33420cgcgtgtgag
agaagacctt cgtccccgtc cagatgcgag agaatgaata accctggaaa 33480acaagttccg
tttatgagga cggacatgct acaaaatatg ttcgcggcta atcgcgataa 33540tgtagcttct
agacttttgt cctaaaatac tattatatcc ttttcgatat taataaatcc 33600gtgtcgtcca
ggttttttat ctctttcagt atgtgaatag ataggtattt tatctctatt 33660catcatcgaa
tttaagagat ccgataaaca ttgtttgtat tctccagatg tcagcatctg 33720atacaacaat
atatgtgcac ataaacctct ggcacttatt tcatgtacct tccccttatc 33780actaaggaga
atagtatttg agaaatatgt atacatgata ttatcatgaa ttagatatac 33840agaatttgta
acactctcga aatcacacga tgtgtcggcg ttaagatcta atatatcact 33900cgataacaca
ttttcatcta gatacactag acatttttta aagctaaaat agtctttagt 33960agtaacagta
actatgcgat tattttcatc gatgatacat ttcatcggca tattattacg 34020cttaccatca
aagactatac catgtgtata tctaacgtat tctagcatgg ttgccatacg 34080cgcattaaac
ttttcaggat ctttggatag atcttccaat ctatctattt gagaaaacat 34140ttttatcatg
ttcaatagtt gaaacgtcgg atccactata tagatattat ctataaagat 34200tttaggaact
acgttcatgg tatcctggcg aatattaaaa ctatcaatga tatgattatc 34260gttttcatct
tttatcacca tatagtttct aagatatggg attttactta atataatatt 34320atttcccgtg
ataaatttta ttagaaaggc caaatctata agaaaagtcc tagaattagt 34380ctgaagaata
tctatatcgc cgtatagtat atttggatta attagatata gagaatatga 34440tccgtaacat
atacaacttt tattatggcg tctaagatat tcttccatca acttattaac 34500atttttgact
agggaagata cattatgacg tcccattact tttgccttgt ctattactgc 34560gacgttcata
gaatttagca tatctcttgc caattcttcc attgatgtta cattataaga 34620aattttagat
gaaattacat ttggagcttt aatagtaaga actcctaata tgtccgtgta 34680tgtggtcact
aatacagatt gtagttctat aatcgtaaat aatttaccta tattatatgt 34740ttgagtctgt
ttagaaaagt agctaagtat acgatctttt atttctgatg cagatgtatt 34800aacatcggaa
aaaaatcttt ttttattctt ttttactaaa gatacaaata tgtctttgtt 34860aaaaacagtt
attttctgaa tatttctagc ttgtaatttt aacatatgat attcgttcac 34920actaggtact
ctgcctaaat aggtttctat aatctttaat gtaatattag gaaaagtatt 34980ctgatcagga
ttcctattca ttttgaggat ttaaaactct gattattgtc taatatggtc 35040tctacgcaaa
ctttttcaca gagcgataga gtttttgata actcgttttt cttaagaaat 35100ataaaactac
tgtctccaga gctcgctcta tcttttattt tatctaattc gatacaaact 35160cctgatactg
gttcagaaag taattcatta attttcagtc ctttatagaa gatatttaat 35220atagataata
caaaatcttc agtttttgat atcgatctga ttgatcctag aactagatat 35280attaataacg
tgctcattag gcagtttatg gcagcttgat aattagatat agtatattcc 35340agttcatatt
tattagatac cgcattgccc agattttgat attctatgaa ttcctctgaa 35400aataaatcca
aaataactag acattctatt ttttgtggat tagtgtactc tcttccctct 35460atcatgttca
ctactggtgt ccacgatgat aaatatctag agggaatata atatagtcca 35520taggatgcca
atctagcaat gtcgaataac tgtaatttta ttcttcgctc ttcattatga 35580attgattctt
gaggtataaa cctaacacaa attatattat tagacttttc gtatgtaatg 35640tctttcatgt
tataagtttt taatcctgga atagaatcta ttttaatgag gcttttaaac 35700gcagagttct
ccaacgagtc aaagcataat actctgttgt ttttcttata tacgatgtta 35760cgattttctt
ctttgaatgg aataggtttt tgaattagtt tataattaca acataataga 35820taaggaagtg
tgcaaatagt acgcggaaaa aacataatag ctcccctgtt ttcatccatg 35880gttttaagta
aatgatcact ggcttcttta gtcaatggat attcgaacat taaccgtttc 35940atcatcattg
gacagaatcc atatttctta atgtaaagag tgatcaaatc attgtgttta 36000ttgtaccatc
ttgttgtaaa tgtgtattcg gttatcggat ctgctccttt ttctattaaa 36060gtatcgatgt
caatctcgtc taagaattca actatatcga catatttcat ttgtatacac 36120ataaccatta
ctaacgtaga atgtatagga agagatgtaa cgggaacagg gtttgttgat 36180tcgcaaacta
ttctaataca taattcttct gttaatacgt cttgcacgta atctattata 36240gatgccaaga
tatctatata attattttgt aagatgatgt taactatgtg atctatataa 36300gtagtgtaat
aattcatgta ttttgatata tgttccaact ctgtctttgt gatgtctagt 36360ttcgtaatat
ctatagcatc ctcaaaaaat atattcgcat atattcccaa gtcttcagtt 36420ctatcttcta
aaaaatcttc aacgtatgga atataataat ctattttacc tcttctgata 36480tcattaatga
tatagttttt gacactatct tctgtcaatt gattcttatt cactatatct 36540aagaaacgga
tagcgtccct aggacgaact actgccatta atatctctat tatagcttct 36600ggacataatt
catctattat accagaatta atgggaacta ttccgtatct atctaacata 36660gttttaagaa
agtcagaatc taagacttga tgttcatata ttggttcata catgaaatga 36720tctctattga
tgatagtgac tatttcattc tctgaaaatt ggtaactcat tctatatatg 36780ctttccttgt
tgatgaagga tagaatatac tcaatagaat ttgtaccaac aaactgttct 36840cttatgaatc
gtatatcatc atctgaaata atcatgtaag gcatacattt aacaattaga 36900gacttgtctc
ctgttatcaa tatactattc ttgtgataat ttatgtgtga ggcaaatttg 36960tccacgttct
ttaattttgt tatagtagat atcaaatcca atggagctac agttcttggc 37020ttaaacagat
atagtttttc tggaacaaat tctacaacat tattataaag gactttgggt 37080aaataagtgg
gatgaaatcc tattttaatt aatgcgatag ccttgtcctc gtgcagatat 37140ccaaacgctt
ttgtgatagt atggcattca ttgtctagaa acgctctacg aatatctgtg 37200acagatatca
tctttagaga atatactagt cgcgttaata gtactacaat ttgtattttt 37260taatctatct
caataaaaaa attaatatgt atgattcaat gtataactaa actactaact 37320gttattgata
actagaatca gaatctaatg atgacgtacc caagaagttt atctactgcc 37380aatttagctg
cattattttt agcatctcgt ttagattttc catctgcctt atcgaatact 37440cttccgtcga
tatctacaca ggcataaaat gtaggagagt tactaggccc aactgattca 37500atacgaaaag
accaatctct cttagttatt tggcagtact cattaataac ggtgacaggg 37560ttagcatctt
tccaatcaat aattttttta gccggaataa catcatcaaa agacttatga 37620tcctctctca
ttgatttttc gcgggataca tcatctatta tgacgtcagc cataacatca 37680gcatccggct
tatccgcctc cgttgtcata aaccaacgag gaggaatatc gtcggagctg 37740tacaccatag
cactacgttg aagatcgtac agagctttat taacttctcg cttctccata 37800ttaagttgtc
tagttagttg tgcagcagta gctccttcga ttccaatggt tttaatagcc 37860tcacacacaa
tctctgcgtt agaacgttcg tcgatataga ttttagacat ttttagagag 37920aactaacaca
accagcaata aaactgaacc tactttatca tttttttatt catcatcctc 37980tggtggttcg
tcgttcctat caaatgtagc tctgattaac ccgtcatcta taggtgatgc 38040tggttctgga
gattctggag gagatggatt attatctgga agaatctctg ttatttcctt 38100gttttcatgt
atcgattgcg ttgtaacatt aagattgcga aatgctctaa atttgggagg 38160cttaaagtgt
tgtttgcaat ctctacacgc gtgtctaact agtggaggtt cgtcagctgc 38220tctagtttga
atcatcatcg gcgtagtatt cctactttta cagttaggac acggtgtatt 38280gtatttctcg
tcgagaacgt taaaataatc gttgtaactc acatccttta ttttatctat 38340attgtattct
actcctttct taatgcattt tataccgaat aagagatagc gaaggaattc 38400tttttcggtg
ccgctagtac ccttaatcat atcacatagt gttttatatt ccaaatttgt 38460ggcaatagac
ggtttatttc tatacgatag tttgtttctg gaatcctttg agtattctat 38520accaatatta
ttctttgatt cgaatttagt ttcttcgata ttagattttg tattacctat 38580attcttgatg
tagtactttg atgatttttc catggcccat tctattaagt cttccaagtt 38640ggcatcatcc
acatattgtg atagtaattc tcggatatca gtagcggcta ccgccattga 38700tgtttgttca
ttggatgagt aactactaat gtatacattt tccatttata acacttatgt 38760attaactttg
ttcatttata ttttttcatt attatgttga tattaacaaa agtgaatata 38820tatatatgtt
aataattgta ttgtggttat acggctacaa ttttataatg agtgaaagtc 38880agtgtccgat
gatcaatgac gatagcttta ctctgaaaag aaagtatcaa atcgatagtg 38940cggagtcaac
aataaaaatg gataagaaga ggataaagtt tcagaataga gccaaaatgg 39000taaaagaaat
aaatcagaca ataagagcag cacaaactca ttacgagaca ttgaaactag 39060gatacataaa
atttaagaga atgattagga ctactactct agaagatata gcaccatcta 39120ttccaaataa
tcagaaaact tataaactat tctcggacat ttcagccatc ggcaaagcat 39180cacagaatcc
gagtaagatg gtatatgctc tgctgcttta catgtttccc aatttgtttg 39240gagatgatca
tagattcatt cgttatagaa tgcatccaat gagtaaaatc aaacacaaga 39300tcttctctcc
tttcaaactt aatcttatta gaatattagt ggaagaaaga ttctataata 39360atgaatgcag
atctaataaa tggaaaataa ttggaacaca agttgataaa atgttgatag 39420ctgaatctga
taaatataca atagatgcaa ggtataacct aaaacccatg tatagaatca 39480agggagaatc
tgaagaagat accctcttca tcaaacagat ggtagaacaa tgtgtgacat 39540cccaggaatt
ggtggaaaaa gtgttgaaga tactgtttag agatttgttc aagagtggag 39600aatacaaagc
gtacagatac gatgatgatg tagaaaatgg atttattgga ttggatacac 39660taaaattaaa
cattgttcat gatatagttg aaccatgtat gcctgttcgt aggccagtgg 39720ctaagatact
gtgtaaagaa atggtaaata aatactttga gaatccgcta catattattg 39780gtaagaatct
tcaagagtgc attgactttg ttagtgaata ggcatttcat ctttctccaa 39840tactaattca
aattgttaaa ttaataatgg atagtataaa tagtaaaaat aattattaga 39900ataagagtgt
agtatcatag ataactctct tctataaaaa tggattttat tcgtagaaag 39960tatcttatat
acacagtaga aaataatata gattttttaa aggatgatac attaagtaaa 40020gtaaacaatt
ttaccctcaa tcatgtacta gctctcaagt atctagttag caattttcct 40080caacacgtta
ttactaagga tgtattagct aataccaatt tttttgtttt catacatatg 40140gtacgatgtt
gtaaagtgta cgaagcggtt ttacgacacg catttgatgc acccacgttg 40200tacgttaaag
cattgactaa gaattattta tcgtttagta acgcaataca atcgtacaag 40260gaaaccgtgc
ataaactaac acaagatgaa aaatttttag aggttgccga atacatggac 40320gaattaggag
aacttatagg cgtaaattat gacttagttc ttaatccatt atttcacgga 40380ggggaaccca
tcaaagatat ggaaatcatt tttttaaaac tgtttaagaa aacagacttc 40440aaagttgtta
aaaaattaag tgttataaga ttacttattt gggcatacct aagcaagaaa 40500gatacaggca
tagagtttgc ggataatgat agacaagata tatatactct atttcaacaa 40560actggtagaa
tcgtccatag caatctaaca gaaacgttta gagattatat ctttcccgga 40620gataagacta
gctattgggt gtggttaaac gaaagtatag ctaatgatgc ggatatcgtt 40680cttaatagac
ccgccattac catgtatgat aaaattctta gttatatata ctctgagata 40740aaacaaggac
gcgttaataa aaacatgctt aagttagttt atatctttga gcctgaaaaa 40800gatatcagag
aacttctgct agaaatcata tatgatattc ctggagatat cctatctatt 40860attgatgcaa
aaaacgacga ttggaaaaaa tattttatta gtttttataa agctaatttt 40920attaacggta
atacatttat tagtgataga acgtttaacg aggacttatt cagagttgtt 40980gttcaaatag
atcccgaata tttcgataat gaacgaatta tgtctttatt ctctacgagt 41040gctgcggaca
ttaaacgatt tgatgagtta gatattaata acagttatat atctaatata 41100atttatgagg
tgaacgatat cacattagat acaatggatg atatgaagaa gtgtcaaatc 41160tttaacgagg
atacgtcgta ttatgttaag gaatacaata catacctgtt tttgcacgag 41220tcggatccca
tggtcataga gaacggaata ctaaagaaac tgtcatctat aaaatccaag 41280agtagacggc
tgaacttgtt tagcaaaaac attttaaaat attatttaga cggacaattg 41340gctcgtctag
gtcttgtgtt agatgattat aaaggagact tgttagttaa aatgataaac 41400catcttaagt
ctgtggagga tgtatccgca ttcgttcgat tttctacaga taaaaaccct 41460agtattcttc
catcgctaat caaaactatt ttagctagtt ataatatttc catcatcgtc 41520ttatttcaaa
ggtttttgag agataatcta tatcatgtag aagaattctt ggataaaagc 41580atccatctaa
ccaagacgga taagaaatat atacttcaat tgataagaca cggtagatca 41640tagaacagac
caaatatatt attaataatt tgtatataca tagatataat tatcacacat 41700ttttgataaa
tgggaactgc tgcaacaatt cagactccca ccaaattaat gaataaagaa 41760aatgcagaaa
tgattttgga aaaaattgtt gatcatatag ttatgtatat tagtgacgaa 41820tcaagtgatt
cagaaaataa tcctgaatat attgattttc gtaacagata cgaagactat 41880agatctctca
ttataaaaag tgatcacgag tttgtaaagc tatgtaaaaa tcatgcggag 41940aaaagttctc
cagaaacgca acaaatgatt atcaaacaca tatacgaaca atatcttatt 42000ccagtatctg
aagtactatt aaaacctata atgtccatgg gtgacataat tacatataac 42060ggatgtaaag
acaatgaatg gatgctagaa caactctcta ccctaaactt taacaatctc 42120cgcacatgga
actcatgtag cataggcaat gtaacgcgtc tgttttatac attttttagt 42180tatctgatga
aagataaact aaatatataa gtataatccc attctaatac tttaacctga 42240tgtattagca
tcttattaga atattaacct aactaaaaga cataacataa aaactcatta 42300catagttgat
aaaaagcggt aggatataaa tattatggct gccaccgttc cgcgttttga 42360cgacgtgtac
aaaaatgcac aaagaagaat tctagatcaa gaaacatttt ttagtagagg 42420tctaagtaga
ccgttaatga aaaacacata tctatttgat aattacgcgt atggatggat 42480accagaaact
gcaatttgga gtagtagata cgcaaactta gatgcaagtg actattatcc 42540catttcgttg
ggattactta aaaagttcga gtttctcatg tctctatata aaggtcctat 42600tccagtatac
gaagaaaaag taaatactga attcattgct aatggatctt tctccggtag 42660atacgtatca
tatcttagaa agttttctgc tcttccaaca aacgagttta ttagtttttt 42720gttactgact
tccattccaa tctataatat cttgttctgg tttaaaaata ctcagtttga 42780tattactaaa
cacacattat tcagatacgt ctatacagat aatgccaaac acctggcgtt 42840ggctaggtat
atgtatcaaa caggagacta taagcctttg tttagtcgtc tcaaagagaa 42900ttatatattt
accggtcccg ttccaatatg tatcaaagat atagatcacc ctaatcttag 42960tagagcaaga
agtccatccg attatgagac attagctaat attagtacta tattgtactt 43020taccaagtat
gatccggtat taatgttttt attgttttac gtacctgggt attcaattac 43080tacaaaaatt
actccagccg tagaatatct aatggataaa ctgaatctaa caaagagcga 43140cgtacaactg
ttgtaaatta ttttatgctt cgtaaaatgt aggttttgaa ccaaacattc 43200tttcaaagaa
tgagatgcat aaaactttat tatccaatag attgactatt tcggacgtca 43260atcgtttaaa
gtaaacttcg taaaatattc tttgatcact gccgagttta aaacttctat 43320cgataattgt
ttcatatgtt ttaatattta caagtttttt ggtccatggt ccattaggac 43380aaatatatgc
aaaataatat cgttctccaa gttctatagt ctctggatta tttttattat 43440attcagtaac
caaatacata ttagggttat ctgcggattt ataatttgag tgatgcattc 43500gactcaacat
aaataattct agaggagacg atctactatc aaattcggat cgtaaatctg 43560tttctaaaga
acggagaata tctatacata cctgattaga attcatccgt ccttcagaca 43620acatctcaga
cagtctggtt ttgtacatct taatcatatt cttatgaaac ttggaaacat 43680ctcttctagt
ttcactagta cctttattaa ttctctcagg tacagatttt gaattcgacg 43740atgctgagta
tttcatcgtt gtatatttct tcttcgattg cataatcaga ttcttatata 43800ccgcctcaaa
ctctatttta aaattattaa acaatactct attattaatc agtcgttcta 43860actctttcgc
tatttctata gacttatcta catcttgact gtctatctct gtaaacacgg 43920agtcggtatc
tccatacacg ctacgaaaac gaaatctgta atctataggc aacgatgttt 43980tcacaatcgg
attaatatct ctatcgtcca tataaaatgg attacttaat ggattggcaa 44040accgtaacat
accgttagat aactctgctc catttagtac cgattctaga tacaagatca 44100ttctacgtcc
tatggatgtg caactcttag ccgaagcgta tgagtataga gcactatttc 44160taaatcccat
cagaccatat actgagttgg ctactatctt gtacgtatat tgcatggaat 44220catagatggc
cttttcagtt gaactggtag cctgttttag catcttttta tatctggctc 44280tctctgccaa
aaatgttctt aatagtctag gaatggttcc ttctatcgat ctatcgaaaa 44340ttgctatttc
agagatgagg ttcggtagtc taggttcaca atgaaccgta atatatctag 44400gaggtggata
tttctgaagc aatagctgat tatttatttc ttcttccaat ctattggtac 44460taacaacgac
accgactaat gtttccggag atagatttcc aaagatacac acattaggat 44520acagactgtt
ataatcaaag attaatacat tattactaaa cattttttgt tttggagcaa 44580ataccttacc
gccttcataa ggaaactttt gttttgtttc tgatctaact aagatagttt 44640tagtttccaa
caatagcttt aacagtggac ccttgatgac tgtactcgct ctatattcga 44700ataccatgga
ttgaggaagc acatatgttg acgcacccgc gtctgttttt gtttctactc 44760cataatactc
ccacaaatac tgacacaaac aagcatcatg aatacagtat ctagccatat 44820ctaaagctat
gtttagatta taatccttat acatctgagc taaatcaacg tcatcctttc 44880cgaaagataa
tttatatgta tcattaggta aagtaggaca taatagtacg actttaaatc 44940cattttccca
aatatcttta cgaattactt tacatataat atcctcatca acagtcacat 45000aattacctgt
ggttaaaacc tttgcaaatg cagcggcttt gcctttcgcg tctgtagtat 45060cgtcaccgat
gaacgtcatt tctctaactc ctctatttaa tactttaccc atgcaactga 45120acgcgttctt
ggatatagaa tccaatttgt acgaatccaa tttttcaaat ttttgaatga 45180atgaatatag
atcgaaaaat atagttccat tattgttatt aacgtgaaac gtagtattgg 45240ccatgccgcc
tactccctta tgactagact gatttctctc ataaatacag agatgtacag 45300cttccttttt
gtccggagat ctaaagataa ttttctctcc tgttaataac tctagacgat 45360tagtaatata
tctcagatca aagttatgtc cgttaaaggt aacgacgtag tcgaacgtta 45420gttccaacaa
ttgtttagct attcgtaaca aaactatttc agaacataga actagttctc 45480gttcgtaatc
catttccatt agtgactgta tcctcaaaca tcctctatcg acggcttctt 45540gtatttcctg
ttccgttaac atctcttcat taatgagcgt aaacaataat cgtttaccac 45600ttaaatcgat
ataacagtaa cttgtatgcg agattgggtt aataaataca gaaggaaact 45660tcttatcgaa
gtgacactct atatctagaa ataagtacga tcttgggata tcgaatctag 45720gtattttttt
agcgaaacag ttacgtggat cgtcacaatg ataacatcca ttgttaatct 45780ttgtcaaata
ttgctcgtcc aacgagtaac atccgtctgg agatatcccg ttagaaatat 45840aaaaccaact
aatattgaga aattcatcca tggtggcatt ttgtatgctg cgtttctttg 45900gctcttctat
caaccacata tctgcgacgg agcattttct atctttaata tctagattat 45960aacttattgt
ctcgtcaatg tctatagttc tcatctttcc caacggcctc gcattaaatg 46020gaggaggaga
caatgactga tatatttcgt ccgtcactac gtaataaaag taatgaggaa 46080atcgtataaa
tacggtctca ccatttcgac atctggattt cagatataaa aatctgtttt 46140caccgtgact
ttcaaaccaa ttaatgcacc gaacatccat ttatagaatt tagaaatata 46200ttttcattta
aatgaatccc aaacattggg gaagagccgt atggaccatt atttttatag 46260tactttcgca
agcgggttta gacggcaaca tagaagcgtg taaacgaaaa ctatatacta 46320tagttagcac
tcttccatgt cctgcatgta gacggcacgc gactatcgct atagaggaca 46380ataatgtcat
gtctagcgat gatctgaatt atatttatta ttttttcatc agattattta 46440acaatttggc
atctgatccc aaatacgcga tcgatgtgac aaaggttaac cctttataaa 46500cttaacccat
tataaaactt atgattagtc acaactgaaa taaccgcgtg attatttttt 46560ggtataattc
tacacggcat ggtttctgtg actatgaatt caacccccgt tacattagtg 46620aaatctttaa
caaacagcaa gggttcgtca aagacataaa actcattgtt tacaatcgaa 46680atagaccccc
tatcacactt aaaataaaaa atatccttat cctttaccac caaataaaat 46740tctgattggt
caatgtgaat gtattcactt aacagttcca caaatttatt tattaactcc 46800gaggcacata
catcgtcggt attttttatg gcaaacttta ctcttccagc atccgtttct 46860aaaaaaatat
taacgagttc catttatatc atccaatatt attgaaatga cgttgatgga 46920cagatgatac
aaataagaag gtacggtacc tttgtccacc atctcctcca attcatgctc 46980tattttgtca
ttaactttaa tgtatgaaaa cagtacgcca catgcttcca tgacagtgtg 47040taacactttg
gatacaaaat gtttgacatt agtataattg ttcaagactg tcaatctata 47100atagatagta
gctataatat attctatgat ggtattgaag aagatgacaa ccttggcata 47160ttgatcattt
aacacagaca tggtatcaac agatagcttg aatgaaagag aatcagtaat 47220tggaataagc
gtcttctcga tagagtgtcc gtataccaac atgtctgata ttttgatgta 47280ttccattaaa
ttatttagtt ttttcttttt attctcgtta aacagcattt ctgtcaacgg 47340accccaacat
cgttgaccga ttaagttttg attgattttt ccgtgtaagg cgtatctagt 47400cagatcgtat
agcctatcca ataatccatc atctgtgcgt agatcacatc gtacactttt 47460taattctcta
tagaagagcg acagacatct ggagcaatta cagacagcaa tttctttatt 47520ctctacagat
gtaagatact tgaagacatt cctatgatga tgcagaattt tggataacac 47580ggtattgatg
gtatctgtta ccataattcc tttgatggct gatagtgtca gagcacaaga 47640tttccaatct
ttgacaattt ttagcaccat tatctttgtt ttgatatcta tatcagacag 47700catggtgcgt
ctgacaacac agggattaag acggaaagat gaaatgattc tctcaacatc 47760ttcaatagat
accttgctat tttttctggc attatctata tgtgcgagaa tatcctctag 47820agaatcagta
tcctttttga tgatagtgga tctcaatgac atgggacgtt taaaccttct 47880tattctatca
ccagattgca tggtgatttg tcttctttct tttatcataa tgtaatctct 47940aaattcatcg
gcaaattgtc tatatctaaa atcataatat gagatgttta cctctacaaa 48000tatctgttcg
tccaatgtta gagtatttac atcagttttg tattccaaat taaacatggc 48060aacggattta
attttatatt cctctattaa gtcctcgtcg ataataacag aatgtagata 48120atcatttaat
ccatcgtaca tggttggaag atgcttgttg acaaaatctt taattgtctt 48180gatgaaggtg
ggactatatc taacatcttg attaataaaa tttataacat tgtccatagg 48240atactttgta
actagtttta tacacatctc ttcatcggta agtttagaca gaatatcgtg 48300aacaggtggt
atattatatt catcagatat acgaagaaca atgtccaaat ctatattgtt 48360taatatatta
tatagatgta gcgtagctcc tacaggaata tctttaacta agtcaatgat 48420ttcatcaacc
gttagatcta ttttaaagtt aatcatatag gcattgattt ttaaaaggta 48480tgtagccttg
actacattct cattaattaa ccattccaag tcactgtgtg taagaagatt 48540atattctatc
ataagcttga ctacatttgg tcccgatacc attaaagaat tcttatgata 48600taaggaaaca
gcttttaggt actcatctac tctacaagaa ttttggagag ccttaacgat 48660atcagtgacg
tttattattt caggaggaaa aaacctaaca ttgagaatat cggaattaat 48720agcttccaga
tacagtgatt ttggcaatag tccgtgtaat ccataatcca gtaacacgag 48780ctggtgcttg
ctagacacct tttcaatgtt taattttttt gaaataagct ttgataaagc 48840cttcctcgca
aattccggat acatgaacat gtcggcgaca tgattaagta ttgttttttc 48900attattttct
caatacccca atagatgata gaatatcacc caatgcgtcc atgttgtcta 48960tttccaacag
gtcgctatat ccaccaatag aagtttttcc aaaaaagatt ctaggaacag 49020ttctaccacc
agtaatttgt tcaaaatagt cacgcaattc attttcgggt ttaaattctt 49080taatatcgac
aatttcatac gctcctcttt tgaaactaaa cttatttaga atatccagtg 49140catttctaca
aaaaggacat gtatacttga caaaaattgt cactttgtta ttggccaacc 49200tttgttgtac
aaattcctcg gccattttaa tatttaagtg atataaaact atctcgactt 49260atttaactct
ttagtcgaga tatatggacg cagatagcta tatgatagcc aactacagaa 49320ggcaaacgct
ataaaaaaca taattacgac gagcatattt ataaatattt ttattcagca 49380ttacttgata
tagtaatatt aggcacagtc aaacattcaa ccactctcga tacattaact 49440ctctcatttt
ctttaacaaa ttctgcaata tcttcgtaaa aagattcttg aaacttttta 49500gaatatctat
cgactctaga tgaaatagcg ttcgtcaaca tactatgttt tgtatacata 49560aaggcgccca
ttttaacagt ttctagtgac aaaatgctag cgatcctagg atcctttaga 49620atcacataga
ttgacgattc gtctctctta gtaactctag taaaataatc atacaatcta 49680gtacgcgaaa
taatattatc cttgacttga ggagatctaa acaatctagt tttgagaaca 49740tcgataagtt
catcgggaat gacatacata ctatctttaa tagaactctt ttcatccagt 49800tgaatggatt
cgtccttaac caactgatta atgagatctt ctattttatc attttccaga 49860tgatatgtat
gtccattaaa gttaaattgt gtagcgcttc tttttagtct agcagccaat 49920actttaacat
cactaatatc gatatacaaa ggagatgatt tatctatggt attaagaatt 49980cgtttttcga
catccgtcaa aaccaattcc tttttgcctg tatcatccag ttttccatcc 50040tttgtaaaga
aattattttc tactagacta ttaataagac tgataaggat tcctccataa 50100ttgcacaatc
caaacttttt cacaaaacta gactttacaa gatctacagg aatgcgtact 50160tcaggttttt
tagcttgtga ttttttcttt tgcggacatt ttcttgtgac caactcatct 50220accatttcat
tgattttagc agtgaaataa gctttcaatg cacgggcact gatactattg 50280aaaacgagtt
gatcttcaaa ttccgccatt taagttcacc aaacaacttt taaatacaaa 50340tatatcaata
gtagtagaat aagaactata aaaaaaataa taattaacca ataccaaccc 50400caacaaccgg
tattattagt tgatgtgact gttttctcat cacttagaac agatttaaca 50460atttctataa
agtctgtcaa atcatcttcc ggagacccca taaatacacc aaatatagcg 50520gcgtacaact
tatccattta tacattgaat attggctttt ctttatcgct atcttcatca 50580tattcatcat
caatatcaac aagtcccaga ttacgagcca gatcttcttc tacattttca 50640gtcattgata
cacgttcact atctccagag agtccgataa cgttagccac cacttctcta 50700tcaatgatta
gtttcttgag cgcgaaagta atttttgttt ccgttccgga tctatagaag 50760acgataggtg
tgataattgc cttggccaat tgtctttctc ttttactgag tgattctagt 50820tcaccttcta
tagatctgag aatggatgat tctccagtcg aaacatattc taccatggat 50880ccgtttaatt
tgttgatgaa gatggattca tccttaaatg ttttctctgt aatagtttcc 50940accgaaagac
tatgcaaaga atttggaatg cgttccttgt gcttaatgtt tccatagacg 51000gcttctagaa
gttgatacaa cataggacta gccgcggtaa cttttatttt tagaaagtat 51060ccatcgcttc
tatcttgttt agatttattt ttataaagtt tagtctctcc ttccaacata 51120ataaaagtgg
aagtcatttg actagataaa ctatcagtaa gttttataga gatagacgaa 51180caattagcgt
attgagaagc atttagtgta acgtattcga tacattttgc attagattta 51240ctaatcgatt
ttgcatactc tataacaccc gcacaagtct gtagagaatc gctagatgca 51300gtaggtcttg
gtgaagtttc aactctcttc ttgattacct tactcatgat taaacctaaa 51360taattgtact
ttgtaatata atgatatata ttttcacttt atctcatttg agaataaaaa 51420tgtttttgtt
taaccactgc atgatgtaca gatttcggaa tcgcaaacca ccagtggttt 51480tattttatcc
ttgtccaatg tgaattgaat gggagcggat gcgggtttcg tacgtagata 51540gtacattccc
gtttttagac cgagactcca tccgtaaaaa tgcatactcg ttagtttgga 51600ataactcgga
tctgctatat ggatattcat agattgactt tgatcgatga aggctcccct 51660gtctgcagcc
atttttatga tcgtcttttg tggaatttcc caaatagttt tataaactcg 51720cttaatatct
tctggaaggt ttgtattctg aatggatcca ccatctgcca taatcctatt 51780cttgatctca
tcattccata attttctctc ggttaaaact ctaaggagat gcggattaac 51840tacttgaaat
tctccagaca atactctccg agtgtaaata ttactggtat acggttccac 51900cgactcatta
tttcccaaaa tttgagcagt tgatgcagtc ggcataggtg ccaccaataa 51960actatttcta
agaccgtatg ttctgatttt atcttttaga ggttcccaat tccaaagatc 52020cgacggtaca
acattccaaa gatcatattg tagaataccg ttactggcgt acgatcctac 52080atatgtatcg
tatggtcctt ccttctcagc tagttcacaa ctcgcctcta atgcaccgta 52140ataaatggtt
tcgaagatct tcttatttag atcttgtgct tccaggctat caaatggata 52200atttaagaga
ataaacgcgt ccgctaatcc ttgaacacca ataccgatag gtctatgtct 52260cttattagag
atttcagctt ctggaatagg ataataatta atatctataa ttttattgag 52320atttctgaca
attactttga ccacatcctt cagtttgaga aaatcaaatc gcccatctat 52380tacaaacatg
ttcaaggcaa cagatgccag attacaaacg gctacctcat tagcatccgc 52440atattgtatt
atctcagtgc aaagattact acacttgata gttcctaaat tttgttgatt 52500actctttttg
ttacacgcat ccttataaag aatgaatgga gtaccagttt caatctgaga 52560ttctataatc
gctttccaga cgactcgagc ctttattata gatttgtatc tcctttctct 52620ttcgtatagt
gtatacaatc gttcgaactc gtctccccaa acattgtcca atccaggaca 52680ttcatccgga
cacatcaacg accactctcc gtcatccttc actcgtttca taaagagatc 52740aggaatccaa
agagctataa atagatctct ggttctatgt tcctcgtttc ctgtattctt 52800tttaagatcg
aggaacgcca taatatcaga atgccacggt tccaagtata tggccataac 52860tccaggccgt
ttgtttcctc cctgatctat gtatctagcg gtgttattat aaactctcaa 52920cattggaata
ataccgtttg atataccatt ggtaccggag atatagcttc cactggcacg 52980aatattacta
attgatagac ctattccccc tgccatttta gagattaatg cgcatcgttt 53040taacgtgtca
tagataccct ctatgctatc atcgatcatg ttaagtagaa aacagctaga 53100catttggtga
cgactagttc ccgcattaaa taaggtagga gaagcgtgcg taaaccattt 53160ttcagaaagt
agattgtacg tctcaatagc tgagtctata tcccattgat gaattcctac 53220tgcgacacgc
attaacatgt gctgaggtct ttcaacgatc ttgttgttta ttttcaacaa 53280gtaggatttt
tccaaagttt taaaaccaaa atagttgtat gaaaagtctc gttcgtaaat 53340aataaccgag
ttgagtttat ccttatattt gttaactata tccatggtga tacttgaaat 53400aatcggagaa
tgtttcccat ttttaggatt aacatagttg aataaatcct ccatcacttc 53460actaaatagt
ttttttgttt ccttgtgtag atttgatacg gctattctgg cggctagaat 53520ggcataatcc
ggatgttgtg tagtacaagt ggctgctatt tcggctgcca gagtgtccaa 53580ttctaccgtt
gttactccat tatatattcc ttgaataacc ttcatagcta ttttaatagg 53640atctatatga
tccgtgttta agccataaca taattttcta atacgagacg tgattttatc 53700aaacatgaca
ttttccttgt atccatttcg tttaatgaca aacatttttg ttggtgtaat 53760aaaaaaatta
tttaactttt cattaatagg gatttgacgt atgtagcgta caaaatgatc 53820gttcctggta
tatagataaa gagtcctata tatttgaaaa tcgttacggc tcgattaaac 53880tttaatgatt
gcatagtgaa tatatcatta ggatttaact ccttgactat catggcggcg 53940ccagaaatta
ccatcaaaag cattaataca gttatgccga tcgcagttaa aacggttata 54000gcatccacca
tttatatcta aaaattagat caaagaatat gtgacaaagt cctagttgta 54060tactgagaat
tgacgaaaca atgtttctta catatttttt tcttattagt aactgactta 54120atagtaggaa
ctggaaagct agacttgatt attctataag tatagatacc cttccagata 54180atgttctctt
tgataaaagt tccagaaaat gtagaatttt ttaaaaagtt atcttttgct 54240attaccaaga
ttgtgtttag acgcttatta ttaatatgag tgatgaaatc cacaccgcct 54300ctagatatcg
cctttatttc cacattagat ggtaaatcca atagtgaaac tatcttttta 54360ggaatgtatg
gactcgcgtt tagaggagtg aacgtcttgg gcgtcggaaa ggatgattcg 54420tcaaacgaat
aaacaatttc acaaatggat gttaatgtat tagtaggaaa ttttttgacg 54480ctagtggaat
tgaagattct aatggatgat gttctaccta tttcatccga taacatgtta 54540atttccgaca
ccaacggttt taatatttcg atgatatacg gtagtctctc tttcggactt 54600atatagctta
ttccacaata cgagtcatta tatactccaa aaaacaaaat aactagtata 54660aaatctgtat
cgaatgggaa aaacgaaatt atcgacatag gtatagaatc cggaacattg 54720aacgtattaa
tacttaattc tttttctgtg gtaagtaccg ataggttatt gacattgtat 54780ggttttaaat
attctataac ttgagacttg atagatatta gtgatgaatt gaaaattatt 54840tttatcacca
cgtgtgtttc aggatcatcg tcgacgcccg tcaaccaacc gaatggagta 54900aaataaatat
cattaatata tgctctagat attagtattt ttattaatcc tttgattatc 54960atcttctcgt
aggcgaatga ttccatgatc aagagtgatt tgagaacatc ctccggagta 55020ttaatgggct
tagtaaacag tccatcgttg caataataaa agttatccaa gttaaaggat 55080attatgcatt
cgtttaaaga tatcacctca tctgacggag acaatttttt ggtaggtttt 55140agagactttg
aagctacttg tttaacaaag ttattcatcg tcgtctacta ttctatttaa 55200ttttgtagtt
aatttatcac atatcacatt aattgacttt ttggtccatt tttccatacg 55260tttatattct
tttaatcctg cgttatccgt ttccgttata tccagggata gatcttgcaa 55320gttaaataga
atgctcttaa ataatgtcat tttcttatcc gctaaaaatt taaagaatgt 55380ataaaccttt
ttcagagatt tgaaactctt aggtggtgtc ctagtacaca atatcataaa 55440caaactaata
aacattccac attcagattc caacagctga ttaacttcca cattaataca 55500gcctattttc
gctccaaatg tacattcgaa aaatctgaat aaaacatcga tgtcacaatt 55560tgtattatcc
aatacagaat gtttgtgatt cgtgttaaaa ccatcggaga aggaatagaa 55620ataaaaatta
ttatagtggt ggaattcagt tggaatattg cctccggagt cataaaagga 55680tactaaacat
tgttttttat cataaattac acatttccaa tgagacaaat aacaaaatcc 55740aaacattaca
aatctagagg tagaactttt aattttgtct ttaagtatat acgataagat 55800atgtttattc
ataaacgcgt caaatttttc atgaatcgct aaggagttta agaatctcat 55860gtcaaattgt
cctatataat ccacttcgga tccataagca aactgagaga ctaagttctt 55920aatacttcga
ttgctcatcc aggctcctct ctcaggctct attttcatct tgacgacctt 55980tggattttca
ccagtatgta ttcctttacg tgataaatca tcgattttca aatccatttg 56040tgagaagtct
atcgccttag atactttttc ccgtagtcga ggtttaaaaa aatacgctaa 56100cggtatacta
gtaggtaact caaagacatc atatatagaa tggtaacgcg tctttaactc 56160gtcggttaac
tctttctttt gatcgagttc gtcgctacta ttgggtctgc tcaggtgccc 56220cgactctact
agttccaaca tcataccgat aggaatacaa gacactttgc cagcggttgt 56280agatttatca
tatttctcca ctacatatcc gttacaattt gttaaaaatt tagatacatc 56340tatattgcta
cataatccag ctagtgaata tatatgacat aataaattgg taaatcctag 56400ttctggtatt
ttactaatta ctaaatctgt atatctttcc atttatcatg gaaaagaatt 56460taccagatat
cttctttttt ccaaactgcg ttaatgtatt ctcttacaaa tattcacaag 56520atgaattcag
taatatgagt aaaacggaac gtgatagttt ctcattggcc gtgtttccag 56580ttataaaaca
tagatggcat aacgcacacg ttgtaaaaca taaaggaata tacaaagtta 56640gtacagaagc
acgtggaaaa aaagtatctc ctccatcact aggaaaaccc gcacacataa 56700acctaaccgc
gaagcaatat atatacagtg aacacacaat aagctttgaa tgttatagtt 56760ttctaaaatg
tataacaaat acagaaatca attcgttcga tgagtatata ttaagaggac 56820tattagaagc
tggtaatagt ttacagatat tttccaattc cgtaggtaaa cgaacagata 56880ctataggtgt
actagggaat aagtatccat ttagcaaaat tccattggcc tcattaactc 56940ctaaagcaca
acgagagata ttttcagcgt ggatttctca tagacctgta gttttaactg 57000gaggaactgg
agtgggtaag acgtcacagg tacccaagtt attgctttgg tttaattatt 57060tatttggtgg
attctctact ctagataaaa tcactgactt tcacgaaaga ccagtcattc 57120tatctcttcc
taggatagct ttagttagat tgcatagcaa taccatttta aaatcattgg 57180gatttaaggt
actagatgga tctcctattt ctttacggta cggatctata ccggaagaat 57240taataaacaa
acaaccaaaa aaatatggaa ttgtattttc tacccataag ttatctctaa 57300caaaactatt
tagttatggc actcttatta tagacgaagt tcatgagcat gatcaaatag 57360gagatattat
tatagcagta gcgagaaagc atcatacgaa aatagattct atgtttttaa 57420tgactgccac
gttagaggat gacagggaac ggctaaaagt atttttacct aatcccgcat 57480ttatacatat
tcctggagat acactgttta aaattagcga ggtatttatt cataataaga 57540taaatccatc
ttccagaatg gcatacatag aagaagaaaa gagaaattta gttactgcta 57600tacagatgta
tactcctcct gatggatcat ccggtatagt ctttgtggca tccgttgcac 57660agtgtcacga
atataaatca tatttagaaa aaagattacc gtatgatatg tatattattc 57720atggtaaggt
cttagatata gacgaaatat tagaaaaagt gtattcatca cctaatgtat 57780cgataattat
ttctactcct tatttggaat ccagcgttac tatacgcaat gttacacaca 57840tttatgatat
gggtagagtt tttgtccccg ctccttttgg aggatcgcaa caatttattt 57900ctaaatctat
gagagatcaa cgaaaaggaa gagtaggaag agttaatcct ggtacatacg 57960tctatttcta
tgatctgtct tatatgaagt ctatacagcg aatagattca gaatttctac 58020ataattatat
attgtacgct aataagttta atctaacact ccccgaagat ttgtttataa 58080tccctacaaa
tttggatatt ctatggcgta caaaggaata tatagactcg ttcgatatta 58140gtacagaaac
atggaataaa ttattatcca attattatat gaagatgata gagtatgcta 58200aactttatgt
actaagtcct attctcgctg aggagttgga taactttgag aggacgggag 58260aattaactag
tattgtacga gaagccattt tatctctaaa tttacaaatt aagattttaa 58320attttaaaca
taaagatgat gatacgtata tacacttttg taaaatatta ttcggtgtct 58380ataacggaac
aaacgctact atatattatc atagacctct aacgggatat atgaatatga 58440tttcagatac
tatatttgtt cctgtagata ataactaaaa atcaaactct aatgaccaca 58500tcttttttta
gagatgaaaa attttccaca tctccttttg tagacacgac taaacatttt 58560gcagaaaaaa
gtttattagt gtttagataa tcgtatactt catcagtgta gatagtaaat 58620gtgaacagat
aaaaggtatt cttgctcaat agattggtaa attccataga atatattaat 58680cctttcttct
tgagatccca catcatttca accagagacg ttttatccaa tgatttacct 58740cgtactatac
cacatacaaa actagatttt gcagtgacgt cgtacctggt attcctacca 58800aacaaaattt
tacttttagt tcttttagaa aattctaagg tagaatctct atttgccaat 58860atgtcatcta
tggaattacc actagcaaaa aatgatagaa atatatattg atacatcgca 58920gctggttttg
atctactata ctttaaaaac gaatcagatt ccataattgc ctgtatatca 58980tcagctgaaa
aactatgttt tacacgtatt ccttcggcat ttctttttaa tgatatatct 59040tgtttagaca
atgataaagt tatcatgtcc atgagagacg cgtctccgta tcgtataaat 59100atttcattag
atgttagacg cttcattagg ggtatacttc tataaggttt cttaatcagt 59160ccatcattgg
ttgcgtcaag aactactatc ggatgttgtt gggtatctct agtgttacac 59220atggccttac
taaagtttgg gtaaataact atgatatctc tattaattat agatgcatat 59280atttcattcg
tcaaggatat tagtatcgac ttgctatcgt cattaatacg tgtaatgtaa 59340tcatataaat
catgcgatag ccaaggaaaa tttaaataga tgttcatcat ataatcgtcg 59400ctataattca
tattaatacg ttgacattga ctaatttgta atatagcctc gccacgaaga 59460aagctctcgt
attcagtttc atcgataaag gataccgtta aatataactg gttgccgata 59520gtctcatagt
ctattaagtg gtaagtttcg tacaaataca gaatccctaa aatattatct 59580aatgttggat
taatctttac cataactgta taaaatggag acggagtcat aactatttta 59640ccgtttgtac
ttactggaat agatgaagga ataatctccg gacatgctgg taaagaccca 59700aatgtctgtt
tgaagaaatc caatgttcca ggtcctaatc tcttaacaaa aattacgata 59760ttcgatcccg
atatcctttg cattctattt accagcatat cacgaactat attaagatta 59820tctatcatgt
ctattctccc accgttatat aaatcgcctc cgctaagaaa cgttagtata 59880tccatacaat
ggaatacttc atttctaaaa tagtattcgt tttctaattc tttaatgtga 59940aatcgtatac
tagaaaggga aaaattatct ttgagttttc cgttagaaaa gaaccacgaa 60000actaatgttc
tgattgcgtc cgattccgtt gctgaattaa tggatttaca ccaaaaactc 60060atataacttc
tagatgtaga agcattcgct aaaaaattag tagaatcaaa ggatataagt 60120agatgttcca
acaagtgagc aattcccaag atttcatcta tatcattctc gaatccgaaa 60180ttagaaattc
ccaagtagat atcctttttc atccgatcgt tgatgaaaat acgaacttta 60240ttcggtaaga
caatcattta ctaaggagta aaataggaag taatgttcgt atgtcgttat 60300catcgtataa
attaaaggtg tgttttttac cattaagtga cattataatt ttaccaatat 60360tggaattata
atataggtgt atttgcgcac tcgcgacggt tgatgcatcg gtaaatatag 60420ctgtatctaa
tgttctagtc ggtatttcat catttcgctg tctaataata gcgttttctc 60480tatctgtttc
cattacagct gcctgaagtt tattggtcgg ataatatgta aaataataag 60540aaatacatac
gaataacaaa aataaaataa gatataataa agatgccatt tagagatcta 60600attttgttta
acttgtccaa attcctactt acagaagatg aggaatcgtt ggagatagtg 60660tcttccttat
gtagaggatt tgaaatatct tataatgact tgataactta ctttccagat 60720aggaaatacc
ataaatatat ttataaagta tttgaacatg tagatttatc ggaggaatta 60780agtatggaat
tccatgatac aactctgaga gatttagtct atcttagatt gtacaagtat 60840tccaagtgta
tacggccgtg ttataaatta ggagataatc taaaaggcat agttgttata 60900aaggacagga
atatttatat tagggaagca aatgatgact tgatagaata tctcctcaag 60960gaatacactc
ctcagattta tacatattct aatgagcgcg tccccataac tggttcaaaa 61020ttaattcttt
gtggattttc tcaagttaca tttatggcgt atacaacgtc gcatataaca 61080acaaataaaa
aggtagatgt tctcgtttcc aaaaaatgta tagatgaact agtcgatcca 61140ataaattatc
aaatacttca aaatttattt gataaaggaa gcggaacaat aaacaaaata 61200ctcaggaaga
tattttattc ggtaacaggt ggccaaactc cataggtagc tttttctatt 61260tcggatttta
gaatttccaa attcaccagc gatttatcgg ttttggtgaa atccaaggat 61320ttattaatgt
ccacaaatgc catttgtttt gtctgtggat tgtatttgaa aatggaaacg 61380atgtagttag
atagatgcgc tgcgaagttt cctattaggg ttccgcgctt cacgtcaccc 61440agcatacttg
aatcaccatc ctttaaaaaa aatgataaga tatcaacatg gagtatatca 61500tactcggatt
ttaattcttc tactgcatca ctgacatttt cacaaatact acaatacggt 61560ttaccgaaaa
taatcagtac gttcttcatt tatgggtatc aaaaacttaa aatcgttact 61620gctggaaaat
aaatcactga cgatattaga tgataattta tacaaagtat acaatggaat 61680atttgtggat
acaatgagta tttatatagc cgtcgccaat tgtgtcagaa acttagaaga 61740gttaactacg
gtattcataa aatacgtaaa cggatgggta aaaaagggag ggcatgtaac 61800cctttttatc
gatagaggaa gtataaaaat taaacaagac gttagagaca agagacgtaa 61860atattctaaa
ttaaccaagg acagaaaaat gttagaatta gaaaagtgta catccgaaat 61920acaaaatgtt
accggattta tggaagaaga aataaaggca gaaatgcaat taaaaatcga 61980taaactcaca
tttcaaatat atttatctga ttctgataac ataaaaatat cattgaatga 62040gatactaaca
catttcaaca ataatgagaa tgttacatta ttttattgtg atgaacgaga 62100cgcagaattc
gttatgtgtc tcgaggctaa aacacatttc tctaccacag gagaatggcc 62160gttgataata
agtaccgatc aggatactat gctatttgca tctgctgata atcatcctaa 62220gatgataaaa
aacttaactc aactgtttaa atttgttccc tcggcagagg ataactattt 62280agcaaaatta
acggcgttag tgaatggatg tgatttcttt cctggactct atggggcatc 62340tataacaccc
accaacttaa acaaaataca attgtttagt gattttacaa tcgataatat 62400agtcactagt
ttggcaatta aaaattatta tagaaagact aactctaccg tagacgtgcg 62460taatattgtt
acgtttataa acgattacgc taatttagac gatgtctact cgtatattcc 62520tccttgtcaa
tgcactgttc aagaatttat attttccgca ttagatgaaa aatggaatga 62580atttaaatca
tcttatttag aaagcgtgcc gttaccctgc caattaatgt acgcgttaga 62640accacgcaag
gagattgatg tttcagaagt taaaacttta tcatcttata tagatttcga 62700aaatactaaa
tcagatatcg atgttataaa atctatatcc tcgatcttcg gatattctaa 62760cgaaaactgt
aacacgatag tattcggcat ctataaggat aatttactac tgagtataaa 62820taattcattt
tactttaacg atagtctgtt aataaccaat actaaaagtg ataatataat 62880aaatataggt
tactagatta aaaatggtgt tccaactcgt gtgctctaca tgcggtaaag 62940atatttctca
cgaacgatat aaattgatta tacgaaaaaa atcattaaag gatgtactcg 63000tcagtgtaaa
gaacgaatgt tgtaggttaa aattatctac acaaatagaa cctcaacgta 63060acttaacagt
gcaacctcta ttggatataa actaatatgg atccggttaa ttttatcaag 63120acatatgcgc
ctagaggttc tattattttt attaattata ccatgtcatt aacaagtcat 63180ttgaatccat
cgatagaaaa acatgtgggt atttattatg gtacgttatt atcggaacac 63240ttggtagttg
aatctaccta tagaaaagga gttcgaatag tcccattgga tagttttttt 63300gaaggatatc
ttagtgcaaa agtatacatg ttagagaata ttcaagttat gaaaatagca 63360gctgatacgt
cattaacttt attgggtatt ccgtatggat ttggtcataa tagaatgtat 63420tgttttaaat
tggtagctga ctgttataaa aatgccggta ttgatacatc gtctaaacga 63480atattgggca
aagatatttt tctgagccaa aacttcacag acgataatag atggataaag 63540atatatgatt
ctaataattt aacattttgg caaattgatt accttaaagg gtgagttaat 63600atgcataact
actcctccgt tgttttttcc ctcgttcttt ttcttaacgt tgtttgccat 63660cactctcata
atgtaaagat attctaaaat ggtaaacttt tgcatatcgg acgcagaaat 63720tggtataaat
gttgtaattg tattatttcc cgtcaatgga ctagtcacag ctccatcagt 63780tttatatcct
ttagagtatt tctcactcgt gtctaacatt ctagagcatt ccatgatctg 63840tttatcgttg
atattggccg gaaagataga ttttttattt tttattatat tactattggc 63900aattgtagat
ataacttctg gtaaatattt ttctaccttt tcaatctctt ctattttcaa 63960gccggctata
tattctgcta tattgttgct agtatcaata ccttttctgg ctaagaagtc 64020atatgtggta
ttcactatat cagttttaac tggtagttcc attagccttt ccacttctgc 64080agaataatca
gaaattggtt ctttaccaga aaatccagct actataatag gctcaccgat 64140gatcattggc
aaaatcctat attgtaccag attaatgaga gcatatttca tttccaataa 64200ttctgctagt
tcttgagaca ttgatttatt tgatgaatct agttggttct ctagatactc 64260taccatttct
gccgcataca ataacttgtt agataaaatc agggttatca aagtgtttag 64320cgtggctaga
atagtgggct tgcatgtatt aaagaatgcg gtagtatgag taaaccgttt 64380taacgaatta
tatagtctcc agaaatctgt ggcgttacat acatgagccg aatgacatcg 64440aagattgtcc
aatattttta atagctgctc tttgtccatt atttctatat ttgactcgca 64500acaattgtag
ataccattaa tcaccgattc ctttttcgat gccggacaat agcacaattg 64560tttagctttg
gactctatgt attcagaatt aatagatata tctctcaata cagattgcac 64620tatacatttt
gaaactatgt caaaaattgt agaacgacgc tgttctgcag ccatttaact 64680ttaaataatt
tacaaaaatt taaaatgagc atccgtataa aaatcgataa actgcgccaa 64740attgtggcat
atttttcaga gttcagtgaa gaagtatcta taaatgtaga ctcgacggat 64800gagttaatgt
atatttttgc cgccttgggc ggatctgtaa acatttgggc cattatacct 64860ctcagtgcat
cagtgtttta ccgaggagcc gaaaatattg tgtttaatct tcctgtgtcc 64920aaggtaaaat
cgtgtttgtg tagttttcac aatgatgcca tcatagatat agaacctgat 64980ctggaaaata
atctagtaaa actttctagt tatcatgtag taagtgtcga ttgtaacaag 65040gaactgatgc
ctattaggac agatactact atttgtctaa gtatagatca aaagaaatct 65100tacgtgttta
attttcacaa gtatgaagaa aaatgttgtg gtagaaccgt cattcattaa 65160gtgacattat
aattttacca atattggaat tataatatag gtgtatttgc gcacttgcga 65220cggttgatgc
atcggtaaat atagctgtat ctaatgttct agtcggtatt tcatcatttc 65280gctgtctaat
aatagcgttt tctctatctg tttccattac agctgcctga agtttattgg 65340tcggataata
tgtaaaataa taagaaatac atacgaataa caaaaataaa ataagatata 65400ataaagatgc
catttagaga tctaattttg tttaacttgt ccaaattcct acttacagaa 65460gatgaggaat
cgttggagat agtgtcttcc ttatgtagag gatttgaaat atcttataat 65520gacttgataa
cttactttcc agataggaaa taccataaat atatttataa agtatttgaa 65580catgtagatt
tatcggagga attaagtatg gaattccatg atacaactct gagagattta 65640gtctatctta
gattgtacaa gtattccaag tgtatacggc cgtgttataa attaggagat 65700aatctaaaag
gcatagttgt tataaaggac aggaatattt atattaggga agcaaatgat 65760gacttgatag
aatatctcct caaggaatac actcctcaga tttatacata ttctaatgag 65820cgcgtcccca
taactggttc aaaattaatt ctttgtggat tttctcaagt tacatttatg 65880gcgtatacaa
cgtcgcatat aacaacaaat aaaaaggtag atgttctcgt ttccaaaaaa 65940tgtatagatg
aactagtcga tccaataaat tatcaaatac ttcaaaattt atttgataaa 66000ggaagcggaa
caataaacaa aatactcagg aagatatttt attcggtaac aggtggccaa 66060actccatagg
tagctttttc tatttcggat tttagaattt ccaaattcac cagcgattta 66120tcggttttgg
tgaaatccaa ggatttatta atgtccacaa atgccatttg ttttgtctgt 66180ggattgtatt
tgaaaatgga aacgatgtag ttagatagat gcgctgcgaa gtttcctatt 66240agggttccgc
gcttcacgtc acccagcata cttgaatcac catcctttaa aaaaaatgat 66300aagatatcaa
catggagtat atcatactcg gattttaatt cttctactgc atcactgaca 66360ttttcacaaa
tactacaata cggtttaccg aaaataatca gtacgttctt catttatggg 66420tatcaaaaac
ttaaaatcgt tactgctgga aaataaatca ctgacgatat tagatgataa 66480tttatacaaa
gtatacaatg gaatatttgt ggatacaatg agtatttata tagccgtcgc 66540caattgtgtc
agaaacttag aagagttaac tacggtattc ataaaatacg taaacggatg 66600ggtaaaaaag
ggagggcatg taaccctttt tatcgataga ggaagtataa aaattaaaca 66660agacgttaga
gacaagagac gtaaatattc taaattaacc aaggacagaa aaatgctaga 66720attagaaaag
tgtacatccg aaatacaaaa tgttaccgga tttatggaag aagaaataaa 66780ggcagaaatg
caattaaaaa tcgataaact cacatttcaa atatatttat ctgattctga 66840taacataaaa
atatcattga atgagatact aacacatttc aacaataatg agaatgttac 66900attattttat
tgtgatgaac gagacgcaga attcgttatg tgtctcgagg ctaaaacaca 66960tttctctacc
acaggagaat ggccgttgat aataagtacc gatcaggata ctatgctatt 67020tgcatctgct
gataatcatc ctaagatgat aaaaaactta actcaactgt ttaaatatgt 67080tccatctgca
gaggataact atttagcaaa attaacggcg ttagtgaatg gatgtgattt 67140ctttcctgga
ctctatgggg catctataac acccaccaac ttaaacaaaa tacaattgtt 67200tagtgatttt
acaatcgata atatagtcac tagtttggca attaaaaatt attatagaaa 67260gactaactct
accgtagacg tgcgtaatat tgttacgttt ataaacgatt acgctaattt 67320agacgatgtc
tactcgtatg ttcctccttg tcaatgcact gttcaagaat ttatattttc 67380cgcattagat
gaaaaatgga atgaatttaa atcatcttat ttagagaccg tgccgttacc 67440ctgtcaatta
atgtacgcgt tagaaccacg taaggagatt gatgtttcag aagttaaaac 67500tttatcatct
tatatagatt tcgaaaatac taaatcagat atcgatgtta taaaatctat 67560atcctcgatc
ttcggatatt ctaacgaaaa ctgtaacacg atagtattcg gcatctataa 67620ggataattta
ctactgagta taaataattc attttacttt aacgatagtc tgttaataac 67680caatactaaa
agtgataata taataaatat aggttactag attaaaaatg gtgttccaac 67740tcgtgtgctc
tacatgcggt aaagatattt ctcacgaacg atataaattg attatacgaa 67800aaaaatcatt
aaaggatgta ctcgtcagtg taaagaacga atgttgtagg ttaaaattat 67860ctacacaaat
agaacctcaa cgtaacttaa cagtgcaacc tctattggat ataaactaat 67920atggatccgg
ttaattttat caagacatat gcgcctagag gttctattat ttttattaat 67980tataccatgt
cattaacaag tcatttgaat ccatcgatag aaaaacatgt gggtatttat 68040tatggtacgt
tattatcgga acacttggta gttgaatcta cctatagaaa aggagttcga 68100atagtcccat
tggatagttt ttttgaagga tatcttagtg caaaagtata catgttagag 68160aatattcaag
ttatgaaaat agcagctgat acgtcattaa ctttattggg tattccgtat 68220ggatttggtc
ataatagaat gtattgtttt aaattggtag ctgactgtta taaaaatgcc 68280ggtattgata
catcgtctaa acgaatattg ggcaaagata tttttctgag ccaaaacttc 68340acagacgata
atagatggat aaagatatat gattctaata atttaacatt ttggcaaatt 68400gattacctta
aagggtgagt taatatgcat aactactcct ccgttgtttt ttccctcgtt 68460ctttttctta
acgttgtttg ccatcactct cataatgtaa agatattcta aaatggtaaa 68520cttttgcata
tcggacgcag aaattggtat aaatgttgta attgtattat ttccatatta 68580ttatgaagac
tcctggtaat actgatggcg ttttccaggg aatattctat gactgaatgt 68640tctcaagaac
tacaaaagtt ttctttcaaa atagctatct cgtctctcaa caaactacga 68700ggattcaaaa
agagagtcaa tgtttttgaa actagaatcg taatggataa tgacgataac 68760attttaggaa
tgttgttttc ggatagagtt caatccttta agatcaacat ctttatggcg 68820tttttagatt
aatactttca atgagataaa tatgggtggc ggagtaagtg ttgagctccc 68880taaacgggat
ccgcacccgg gagtacccac tgatgagatg ttattaaacg tggataaaat 68940gcatgacgtg
atagctcccg ctaagctttt agaatatgtg catataggac cactagcaaa 69000agataaagag
gataaagtaa agaaaagata tccagagttt agattagtca acacaggacc 69060cggtggtctt
tcggcattgt taagacaatc gtataatgga accgcaccca attgctgtcg 69120cacttttaat
cgtactcatt attggaagaa ggatggaaag atatcagata agtatgaaga 69180gggtgcagta
ttagaatcgt gttggccaga cgttcacgac actggaaaat gcgatgttga 69240tttattcgac
tggtgtcagg gggatacgtt cgatagaaac atatgccatc agtggatcgg 69300ttcagccttt
aataggagta atagaactgt agagggtcaa caatcgttaa taaatctgta 69360taataagatg
caaacattat gtagtaaaga tgctagtgta ccaatatgcg aatcattttt 69420gcattattta
cgcgcacaca atacagaaga tagcaaagag atgatcgatt atattctaag 69480acaacagtct
gcggacttta aacagaaata tatgagatgt agttatccca ctagagataa 69540gttagaagag
tcattaaaat atgcggaacc tcgagaatgt tgggatccag agtgttcgaa 69600tgccaatgtt
aatttcttac taacacgtaa ttataataat ttaggacttt gcaatattgt 69660acgatgtaat
accagcgtga acaacttaca gatggataaa acttcctcat taagattgtc 69720atgtggatta
agcaatagtg atagattttc tactgttccc gtcaatagag caaaagtagt 69780tcaacataat
attaaacact cgttcgacct aaaattgcat ttgatcagtt tattatctct 69840cttggtaata
tggatactaa ttgtagctat ttaaatgggt gccgcggcaa gcatacagac 69900gacggtgaat
acactcagcg aacgtatctc gtctaaatta gaacaagaag cgaacgctag 69960tgctcaaaca
aaatgtgata tagaaatcgg aaatttttat atccgacaaa accatggatg 70020taacctcact
gttaaaaata tgtgctctgc ggacgcggat gctcagttgg atgctgtgtt 70080atcagccgct
acagaaacat atagtggatt aacaccggaa caaaaagcat acgtgccagc 70140tatgtttact
gctgcgttaa acattcagac gagtgtaaac actgttgtta gagattttga 70200aaattatgtg
aaacagactt gtaattctag cgcggtcgtc gataacaaat taaagataca 70260aaacgtaatc
atagatgaat gttacggagc cccaggatct ccaacaaatt tggaatttat 70320taatacagga
tctagcaaag gaaattgtgc cattaaagcg ttgatgcaat tgacgactaa 70380ggccactact
caaatagcac ctagacaagt tgctggtaca ggagttcagt tttatatgat 70440tgttatcggt
gttataatat tggcagcgtt gtttatgtac tatgccaagc gtatgttgtt 70500cacatccacc
aatgataaaa tcaaacttat tttagccaat aaggaaaacg tccattggac 70560tacttacatg
gacacattct ttagaacttc tccgatggtt attgctacca cggatatgca 70620aaactgaaaa
tatattgata atattttaat agattaacat ggaagttatc gctgatcgtc 70680tagacgatat
agtgaaacaa aatatagcgg atgaaaaatt tgtagatttt gttatacacg 70740gtctagagca
tcaatgtcct gctatacttc gaccattaat taggttgttt attgatatac 70800tattatttgt
tatagtaatt tatattttta cggtacgtct agtaagtaga aattatcaaa 70860tgttgttggt
ggtgctagtc atcacattaa ctatttttta ttactttata ctataatagt 70920actagactga
cttctaacaa acatctcacc tgccataaat aaatgcttga tattaaagtc 70980ttctatttct
aacactattc catctgtgga aaataatact ctgacattat cgctaattga 71040cacatcggtg
agtgatatgc ctataaagta ataatcttct ttgggcacat ataccagtgt 71100accaggttct
aacaacctat ttactggtgc tcctgtagca tactttttct ttaccttgag 71160aatatccatc
gtttgcttgg tcaatagcga tatgtgattt tttatcaacc actcaaaaaa 71220gtaattggag
tgttcatatc ctctacgggc tattgtctca tggccgtgta tgaaatttaa 71280gtaacacgac
tgtggtagat ttgttctata gagccgattg ccgcaaatag atagaactac 71340caatatgtct
gtacaaatgt taaacattaa ttgattaaca gaaaaaacaa tgttcgttct 71400gggaatagaa
accagatcaa aacaaaattc gttagaatat atgccacgtt tatacatgga 71460atataaaata
actacagttt gaaaaataac agtatcattt aaacatttaa cttgcggggt 71520taatctcaca
actttactgt ttttgaactg ttcaaaatat agcatcgatc cgtgagaaat 71580acgtttagcc
gcctttaata gaggaaatcc caccgccttt ctggatctca ccaacgacga 71640tagttctgac
cagcaactca tttcttcatc atccacctgt tttaacatat aataggcagg 71700agatagatat
ccgtcattgc aatattcctt ctcgtaggca cacaatctaa tattgataaa 71760atctccattc
tcttctctgc atttattatc ttgtctcggt ggctgattag gctgtggtct 71820tggtttaggc
cttggtctat cgttgttgaa tctattttgg tcattaaatc tttcatttct 71880tcctggtata
tttctatcac ctcgtttggt tggatttttg tctatattat cgtttgtaac 71940atcggtacgg
gtattcattt atcacaaaaa aaacttctct aaatgagtct actgctagaa 72000aacctcatcg
aagaagatac catatttttt gcaggaagta tatctgagta tgatgattta 72060caaatggtta
ttgccggcgc aaaatccaaa tttccaagat ctatgctttc tatttttaat 72120atagtaccta
gaacgatgtc aaaatatgag ttggagttga ttcataacga aaatatcaca 72180ggagcaatgt
ttaccacaat gtataatata agaaacaatt tgggtctagg agatgataaa 72240ctaactattg
aagccattga aaactatttc ttggatccta acaatgaagt tatgcctctt 72300attattaata
atacggatat gactgccgtc attcctaaaa aaagtggtag gagaaagaat 72360aagaacatgg
ttatcttccg tcaaggatca tcacctatct tgtgcatttt cgaaactcgt 72420aaaaagatta
atatttataa agaaaatatg gaatccgcgt cgactgagta tacacctatc 72480ggagacaaca
aggctttgat atctaaatat gcgggaatta atgtcctgaa tgtgtattct 72540ccttccacat
ccataagatt gaatgccatt tacggattca ccaataaaaa taaactagag 72600aaacttagta
ctaataagga actagaatcg tatagttcta gccctcttca agaacccatt 72660aggttaaatg
attttctggg actattggaa tgtgttaaaa agaatattcc tctaacagat 72720attccgacaa
aggattgatt actataaatg gagaatgttc ctaatgtata ctttaatcct 72780gtgtttatag
agcccacgtt taaacattct ttattaagtg tttataaaca cagattaata 72840gttttatttg
aagtattcgt tgtattcatt ctaatatatg tattttttag atctgaatta 72900aatatgttct
tcatgcctaa acgaaaaata cccgatccta ttgatagatt acgacgtgct 72960aatctagcgt
gtgaagacga taaattaatg atctatggat taccatggat gacaactcaa 73020acatctgcgt
tatcaataaa tagtaaaccg atagtgtata aagattgtgc aaagcttttg 73080cgatcaataa
atggatcaca accagtatct cttaacgatg ttcttcgcag atgatgattc 73140attttttaag
tatttggcta gtcaagatga tgaatcttca ttatctgata tattgcaaat 73200cactcaatat
ctagactttc tgttattatt attgatccaa tcaaaaaata aattagaagc 73260tgtgggtcat
tgttatgaat ctctttcaga ggaatacaga caattgacaa aattcacaga 73320ctttcaagat
tttaaaaaac tgtttaacaa ggtccctatt gttacagatg gaagggtcaa 73380acttaataaa
ggatatttgt tcgactttgt gattagtttg atgcgattca aaaaagaatc 73440ctctctagct
accaccgcaa tagatcctgt tagatacata gatcctcgtc gtgatatcgc 73500attttctaac
gtgatggata tattaaagtc gaataaagtg aacaataatt aattctttat 73560tgtcatcatg
aacggcggac atattcagtt gataatcggc cccatgtttt caggtaaaag 73620tacagaatta
attagacgag ttagacgtta tcaaatagct caatataaat gcgtgactat 73680aaaatattct
aacgataata gatacggaac gggactatgg acgcatgata agaataattt 73740tgaagcattg
gaagcaacta aactatgtga tgtcttggaa tcaattacag atttctccgt 73800gataggtatc
gatgaaggac agttctttcc agacattgtt taattctgtg agcgtatggc 73860aaacgaagga
aaaatagtta tagtagccgc actcgatggg acatttcaac gtaaaccgtt 73920taataatatt
ttgaatctta ttccattatc tgaaatggtg gtaaaactaa ctgctgtgtg 73980tatgaaatgc
tttaaggagg cttccttttc taaacgattg ggtgaggaaa ccgagataga 74040gataatagga
ggtaatgata tgtatcaatc ggtgtgtaga aagtgttacg tcggctcata 74100atattatatt
ttttatctaa aaaactaaaa ataaacattg attaaatttt aatataatac 74160ttaaaaatgg
atgttgtgtc gttagataaa ccgtttatgt attttgagga aattgataat 74220gagttagatt
acgaaccaga aagtgcaaat gaggtcgcaa aaaaactgcc gtatcaagga 74280cagttaaaac
tattactagg agaattattt tttcttagta agttacagcg acacggtata 74340ttagatggtg
ccaccgtagt gtatatagga tcggctcctg gtacacatat acgttatttg 74400agagatcatt
tctataattt aggagtgatc atcaaatgga tgctaattga cggccgccat 74460catgatccta
ttttaaatgg attgcgtgat gtaactctag tgactcggtt cgttgatgag 74520gaatatctac
gatccatcaa aaaacaactg catccttcta agattatttt aatttctgat 74580gtaagatcca
aacgaggagg aaatgaacct agtacggcgg atttactaag taattacgct 74640ctacaaaatg
tcatgattag tattttaaac cccgtggcat ctagtcttaa atggagatgc 74700ccgtttccag
atcaatggat caaggacttt tatatcccac acggtaataa aatgttacaa 74760ccttttgctc
cttcatattc agctgaaatg agattattaa gtatttatac cggtgagaac 74820atgagactga
ctcgagttac caaattagac gctgtaaatt atgaaaaaaa gatgtactac 74880cttaataaga
tcgtccgtaa caaagtagtt gttaactttg attatcctaa tcaggaatat 74940gactattttc
acatgtactt tatgctgagg accgtgtact gcaataaaac atttcctact 75000actaaagcaa
aggtactatt tctacaacaa tctatatttc gtttcttaaa tattccaaca 75060acatcaactg
aaaaagttag tcatgaacca atacaacgta aaatatctag caaaaattct 75120atgtctaaaa
acagaaatag caagagatcc gtacgcggta ataaatagaa acgtactact 75180gagatatact
accgatatag agtataatga tttagttact ttaataaccg ttagacataa 75240aattgattct
atgaaaactg tgtttcaggt atttaacgaa tcatccataa attatactcc 75300ggttgatgat
gattatggag aaccaatcat tataacatcg tatcttcaaa aaggtcataa 75360caagtttcct
gtaaattttc tatacataga tgtggtaata tctgacttat ttcctagctt 75420tgttagacta
gatactacag aaactaatat agttaatagt gtactacaaa caggcgatgg 75480taaaaagact
cttcgtcttc ccaaaatgtt agagacggaa atagttgtca agattctcta 75540tcgccctaat
ataccattaa aaattgttag atttttccgc aataacatgg taactggagt 75600agagatagcc
gatagatctg ttatttcagt cgctgattaa tcaattagta gagatgagat 75660aagaacatta
taataatcaa taatatatct tatatcttat atcttatatc ttatatcttg 75720tttagaaaaa
tgctaatatt aaaatagcta acgctagtaa tccaatcgga agccatttga 75780tatctataat
agggtatcta atttcctgat ttaaatagcg gacagctata ttctcggtag 75840ctactcgttt
ggaatcacaa acattattta catctaattt actatctgta atggaaacgt 75900ttcccaatga
aatggtacaa tccgatacat tgcattttgt tatatttttt tttaaagagg 75960ctggtaacaa
cgcatcgctt cgtttacatg gctcgtacca acaataatag ggtaatcttg 76020tatctattcc
tatccgtact atgcttttat caggataaat acatttacat cgtatatcgt 76080ctttgttagc
atcacagaat gcataaattt gttcgtccgt catgataaaa atttaaagtg 76140taaatataac
tattattttt atagttgtaa taaaaaggga aatttgattg tatactttcg 76200gttctttaaa
agaaactgac ttgataaaaa tggctgtaat ctctaaggtt acgtatagtc 76260tatatgatca
aaaagagatt aatgctacag atattatcat tagtcatgtt aaaaatgacg 76320acgatatcgg
taccgttaaa gatggtagac taggtgctat ggatggggca ttatgtaaga 76380cttgtgggaa
aacggaattg gaatgtttcg gtcactgggg taaagtaagt atttataaaa 76440ctcatatagt
taagcctgaa tttatttcag aaattattcg tttactgaat catatatgta 76500ttcactgcgg
attattgcgt tcacgagaac cgtattccga cgatattaac ctaaaagagt 76560tatcgggaca
cgctcttagg agattaaagg ataaaatatt atccaagaaa aagtcatgtt 76620ggaacagtga
atgtatgcaa ccgtatcaaa aaattacttt ttcaaagaaa aaggtttgtt 76680tcgtcaacaa
gttggatgat attaacgttc ctaattctct catctatcaa aagttaattt 76740ctattcatga
aaagttttgg ccattattag aaattcatca atatccagct aacttatttt 76800atacagacta
ctttcccatc cctccgttga ttattagacc ggctattagt ttttggatag 76860atagtatacc
caaagagacc aatgaattaa cttacttatt aggtatgatc gttaagaatt 76920gtaacttgaa
tgctgatgaa caggttatcc agaaggcggt aatagaatac gatgatatta 76980aaattatttc
taataacact accagtatca atttatcata tattacatcc ggcaaaaata 77040atatgattag
aagttatatc gtcgcccgac gaaaagatca gaccgctaga tctgtaattg 77100gtcccagtac
atctatcacc gttaatgagg taggaatgcc cgcatatatt agaaatacac 77160ttacagaaaa
gatatttgtt aatgccttta cagtggataa agttaaacaa ctattagcgt 77220caaaccaagt
taaattttac tttaataaac gattaaacca attaacaaga atacgccaag 77280gaaagtttat
taaaaataaa atacatttat tgcctggtga ttgggtagaa gtagctgttc 77340aagaatatac
aagtattatt tttggaagac agccgtctct acatagatac aacgtcatcg 77400cttcatctat
cagagctacc gaaggagata ctatcaaaat atctcccgga attgccaact 77460ctcaaaatgc
tgatttcgac ggggatgagg aatggatgat attagaacaa aatcctaaag 77520ctgtaattga
acaaagtatt cttatgtatc cgacgacgtt actcaaacac gatattcatg 77580gagcccccgt
ttatggatct attcaagatg aaatcgtagc agcgtattca ttgtttagga 77640tacaagatct
ttgtttagat gaagtattga acatcttggg gaaatatgga agagagttcg 77700atcctaaagg
taaatgtaaa ttcagcggta aagatatcta tacttacttg ataggtgaaa 77760agattaatta
tccgggtctc ttaaaggatg gtgaaattat tgcaaacgac gtagatagta 77820attttgttgt
ggctatgagg catctgtcat tggctggact cttatccgat cataagtcga 77880acgtggaagg
tatcaacttt attatcaagt catcttatgt ttttaagaga tatctatcta 77940tttacggttt
tggggtgaca ttcaaagatc tgagaccaaa ttcgacgttc actaataaat 78000tggaggccat
caacgtagaa aaaatagaac ttatcaaaga agcatacgcc aaatatctca 78060acgatgtaag
agacgggaaa atagttccat tatctaaagc tttagaggcg gactatgtgg 78120aatccatgtt
atccaacttg acaaatctta atatccgaga gatagaagaa catatgagac 78180aaacgctgat
agatgatcca gataataacc tcctgaaaat ggccaaagcg ggttataaag 78240taaatcccac
agaactaatg tatattctag gtacgtatgg acaacaaagg attgatggtg 78300aaccagcaga
gactcgagta ttgggtagag ttttacctta ctatcttcca gactctaagg 78360atccagaagg
aagaggttat attcttaatt ctttaacaaa aggattaacg ggttctcaat 78420attacttttc
gatgctggtt gcaagatctc aatctactga tatcgtctgt gaaacatcac 78480gtaccggaac
actggctaga aaaatcatta aaaagatgga ggatatggtg gtcgacggat 78540acggacaagt
agttataggt aatacgctca tcaagtacgc cgccaattat accaaaattc 78600taggctcagt
atgtaaacct gtagatctta tctatccaga tgagtccatg acttggtatt 78660tggaaattag
tgctctgtgg aataaaataa aacagggatt cgtttactct cagaaacaga 78720aacttgcaaa
gaagacattg gcgccgttta atttcctagt attcgtcaaa cccaccactg 78780aggataatgc
tattaaggtt aaggatctgt acgatatgat tcataacgtc attgatgatg 78840tgagagagaa
atacttcttt acggtatcta atatagattt tatggagtat atattcttga 78900cgcatcttaa
tccttctaga attagaatta caaaagaaac ggctatcact atctttgaaa 78960agttctatga
aaaactcaat tatactctag gtggtggaac tcctattgga attatttctg 79020cacaggtatt
gtctgagaag tttacacaac aagccctgtc cagttttcac actactgaaa 79080aaagtggtgc
cgtcaaacaa aaacttggtt tcaacgagtt taataacttg actaatttga 79140gtaagaataa
gaccgaaatt atcactctgg tatccgatga tatctctaaa cttcaatctg 79200ttaagattaa
tttcgaattt gtatgtttgg gagaattaaa tccaaacatc actcttcgaa 79260aagaaacaga
taggtatgta gtagatataa tagtcaatag attatacatc aagagagcag 79320aaataaccga
attagtcgtc gaatatatga ttgaacgatt catctccttt agcgtcattg 79380taaaggaatg
gggtatggag acattcattg aggacgagga taatattaga tttactgtct 79440acctaaattt
cgttgaaccg gaagaattga atcttagtaa gtttatgatg gttcttccgg 79500gggcagccaa
caagggaaag attagtaaat tcaagattcc tatctctgac tatacgggat 79560atgacgactt
caatcaaaca aaaaagctca ataagatgac tgtagaactc atgaatctaa 79620aagaattggg
ttctttcgat ttggaaaacg tcaacgtgta tcctggagta tggaatacat 79680acgatatctt
cggtatcgag gccgctcgtg aatacttgtg cgaagccatg ttaaacacct 79740atggagaagg
gttcgattat ctgtatcagc cttgtgatct tctcgctagt ttactatgtg 79800ctagttacga
accagaatca gtgaataaat tcaagttcgg cgcagctagt actcttaaga 79860gagctacgtt
cggagacaat aaagcattgt taaacgcggc tcttcataaa aagtcagaac 79920ctattaacga
taatagtagc tgccactttt ttagcaaggt ccctaatata ggaactggat 79980attacaaata
ctttatcgac ttgggtcttc tcatgagaat ggaaaggaaa ctatctgata 80040agatatcttc
tcaaaagatc aaggaaatgg aagaaacaga agacttttaa ttcttatcaa 80100taacatattt
ttctatgatc tgtcttttaa acgatggatt ttccacaaat gcgcctctca 80160agtccctcat
agaatgatac acgtataaaa aatatagcat aggcaatgac tccttatttt 80220tagacattag
atatgccaaa atcatagccc cgcttctatt tactcccgca gcacaatgaa 80280ccaacacggg
ctcgtttcgt tgatcacatt tagataaaaa ggcggttacg tcgtcaaaat 80340atttactaat
atcggtagtt gtatcatcta ccaacggtat atgaataata ttaatattag 80400agttaggtaa
tgtatattta tccatcgtca aatttaaaac atatttgaac ttaacttcag 80460atgatggtgc
atccatagca tttttataat ttcccaaata cacattattg gttacccttg 80520tcattatagt
gggagatttg gctctgtgca tatctccagt tgaacgtagt agtaagtatt 80580tatacaaact
tttcttatcc atttataacg tacaaatgga taaaactact ttatcggtaa 80640acgcgtgtaa
tttagaatac gttagagaaa aggctatagt aggcgtacaa gcagccaaaa 80700catcaacact
tatattcttt gttattatat tggcaattag tgcgctatta ctctggtttc 80760agacgtctga
taatccagtc tttaatgaat taacgagata tatgcgaatt aaaaatacgg 80820ttaacgattg
gaaatcatta acggatagca aaacaaaatt agaaagtgat agaggtagac 80880ttctagccgc
tggtaaggat gatatattcg acttcaaatg tgtggatttc ggcgcctatt 80940ttatagctat
gcgattggat aagaaaacat atctgccgca agctattagg cgaggtactg 81000gagacgcgtg
gatggttaaa aaggcggcaa aggtcgatcc atctgctcaa caattttgtc 81060agtatttgat
aaaacacaag tctaataatg ttattacttg tggtaatgag atgttaaatg 81120aattaggtta
tagcggttat tttatgtcac cgcattggtg ttccgatttt agtaatatgg 81180aatagtgtta
gataaatgcg gtaacgaatg ttcctgtaag gaaccataac agcttagatt 81240taacgttaaa
gatgagcata aacataataa acaaaattac aatcaaactt ataacattaa 81300tatcaaacaa
tccaaaaaat gaaatcagtg gagtagtaaa cgcgtacata actcctggat 81360aacgtttagc
agctgccgtt cctattctag accaaaaatt cggtttcatg ttttcgaaac 81420ggtattctgc
aacaagtcga ggatcgtgtt ctacatattt ggcggcatta tccagtatct 81480gcctattgat
cttcatttcg ttttcaattc tggctatttc aaaataaaat cccgatgata 81540gacctccaga
ctttataatt tcatctacga tgttcagcgc cgtagtaact ctaataatat 81600aggctgataa
gctaacatca taccctcctg tatatgtgaa tatggcatga tttttgtcca 81660ttacaagctc
ggttttaact ttattgcctg taataatttc tctcatctgt aggatatcta 81720tttttttgtc
atgcattgcc ttcaagacgg gacgaagaaa cgtaatatcc tcaataacgt 81780tatcgttttc
tacaataact acatattcta cctttttatt ttctaactcg gtaaaaaaat 81840tagaatccca
tagggctaaa tgtctagcga tatttctttt cgtttcctct gtacacatag 81900tgttacaaaa
ccctgaaaag aagtgagtat acttgtcatc atttctaatg tttcctccag 81960tccactgtat
aaacgcataa tccttgtaat gatctggatc atccttgact accacaacat 82020ttcttttttc
tggcataact tcgttgtcct ttacatcatc gaacttctga tcattaatat 82080gctcatgaac
attaggaaat gtttctgatg gaggtctatc aataactggc acaacaataa 82140caggagtttt
caccgccgcc atttagttat tgaaattaat catatacaac tctttaatac 82200gagttatatt
ttcgtctatc cattgtttca cattgacata tttcgacaaa aagatataaa 82260atgcgtattc
caatgcttct ctgtttaatg aattactaaa atatacaaac acgtcactgt 82320ctggcaataa
atgatatctt agaatattgt aacaatgtaa ggaaccataa cagtttagat 82380ttaacgttaa
agatgagcat aaacataata aacaaaatta caatcaaacc tataacatta 82440atatcaaaca
atccaaaaaa tgaaatcagt ggagtagtaa acgcgtacat aactcctgga 82500taacgtttag
cagctgccgt tcctattcta gaccaaaaat ttggtttcat gttttcgaaa 82560cggtattctg
caacaagtcg gggatcgtgt tctacatatt tggcggcatt atccagtatc 82620tgcctattga
tcttcatttc gttttcgatt ctggctattt caaaataaaa tcccgatgat 82680agacctccag
actttataat ttcatctacg atgttcagcg ccgtagtaac tctaataata 82740taggctgata
agctaacatc ataccctcct gtatatgtga atatggcatg atttttgtcc 82800attacaagct
cggttttaac tttattgcct gtaataattt ctctcatctg taggatatct 82860atttttttgt
catgcattgc cttcaagacg ggacgaagaa acgtaatatc ctcaataacg 82920ttatcgtttt
ctacaataac tacatattct acctttttat tttctaactc ggtaaaaaaa 82980ttagaatccc
atagggctaa atgtctagcg atatttcttt tcgtttcctc tgtacacata 83040gtgttacaaa
accctgaaaa gaagtgagta tacttgtcat catttctaat gtttcctcca 83100gtccactgta
taaacgcata atccttgtaa tgatctggat catccttgac taccacaaca 83160tttctttttt
ctggcataac ttcgttgtcc tttacatcat cgaacttctg atcattaata 83220tgctcatgaa
cattaggaaa tgtttctgat ggaggtctat caataactgg cacaacaata 83280acaggagttt
tcaccgccgc catttagtta ttgaaattaa tcatatacaa ctctttaata 83340cgagttatat
tttcgtctat ccattgtttc acatttacat atttcgacaa aaagatataa 83400aatgcgtatt
ccaatgcttc tctgtttaat gaattactaa aatatacaaa cacgtcactg 83460tctggcaata
aatgatatct tagaatattg taacaattta ttttgtattg cacatgttcg 83520tgatctatga
gttcttcttc gaatggcata ggatctccga atctgaaaac gtataaatag 83580gagttagaat
aataatattt gagagtattg gtaatatata aactctttag cggtataatt 83640agtttttttc
tctcaatttc tatttttaga tgtgatggaa aaatgactaa ttttgtagca 83700ttagtatcat
gaactctaat caaaatctta atatcttcgt cacacgttag ctctttgaag 83760tttttaagag
atgcatcagt tggttctaca gatggagtag gtgcaacaat tttttgttct 83820acacatgtat
gtactggagc cattgtttta actataatgg tgcttgtatc gaaaaacttt 83880aatgcagata
gcggaagctc ttcgccgcga ctttctacgt cgtaattggg ttctaacgcc 83940gatctctgaa
tggatactag ttttctaagt tctaatgtga ttctctgaaa atgtaaatcc 84000aattcctccg
gcattataga tgtgtataca tcggtaaata aaactatagt atccaacgat 84060cccttctcgc
aaattctagt cttaaccaaa aaatcgtata taaccacgga gatggcgtat 84120ttaagagtgg
attcttctac cgttttgttc ttggatgtca tataggaaac tataaagtcc 84180gcactactgt
taagaatgat tactaacgca actatatagt ttaaattaag cattttggaa 84240acataaaata
actctgtaga cgatacttga ctttcgaata agtttgcaga caaacgaaga 84300aagaacagac
ctctcttaat ttcagaagaa aacttttttt cgtattcctg acgtctagag 84360tttatatcaa
taagaaagtt aagaattagt cggttaatgt tgtatttcat tacccaagtt 84420tgagatttca
taatattatc aaaagacatg ataatattaa agataaagcg ctgactatga 84480acgaaatagc
tatatggttc gctcaagaat atagtcttgt taaacgtgga aacgataact 84540gtatttttaa
tcacgtcagc ggcatctaaa ttaaatatag gtatatttat tccacacact 84600ctacaatatg
ccacaccatc ttcataataa ataaattcgt tagcaaaatt attaatttta 84660gtgaaatagt
tagcgtcaac tttcatagct tccttcaatc taatttgatg ctcacacggt 84720gcgaattcca
ctctaacatc ccttttccat gcctcaggtt catcgatctc tataatatct 84780agttttttgc
gtttcacaaa cacaggctcg tctctcgcga tgagatctgt atagtaacta 84840tgtaaatgat
aactagatag aaagatgtag ctatatagat gacgatcctt taagagaggt 84900ataataactt
taccccaatc agatagactg ttgttatggt cttcggaaaa agaattttta 84960taaatttttc
cagtattttc caaatatacg tacttaacat ctaaaaaatc cttaatgata 85020ataggaatgg
ataatccgtc tattttataa agaaatacat atcgcacatt atactttttt 85080ttggaaatgg
gaataccgat gtgtctacat aaatatgcaa agtctaaata ttttttagag 85140aatcttagtt
ggtccaaatt cttttccaag tacggtaata gatttttcat attgaacggt 85200atcttcttaa
tctctggttc tagttccgca ttaaatgatg aaactaagtc actattttta 85260taactaacga
ttacatcacc tctaacatca tcatttacca gaatactgat cttcttttgt 85320cgtaaataca
tgtctaatgt gttaaaaaaa agatcataca agttatacgt catttcatct 85380gtggtattct
tgtcattgaa ggataaactc gtactaatct cttctttaac agcctgttca 85440aatttatatc
ctatatacga aaaaatagca accagtgttt gatcatccgc gtcaatattc 85500tgttctatcg
tagtgtataa caatcgtata tcttcttctg tgatagtcga tacgttataa 85560aggttgataa
cgaaaatatt tttatttcgt gaaataaagt catcgtagga ttttggactt 85620atattcgcgt
ctagtagata tgcttttatt tttggaatga tctcaattag aatagtctct 85680ttagagtcca
tttaaagtta caaacaacta ggaaattggt ttatgatgta taattttttt 85740agtttttata
gattctttat tctatactta aaaaatgaaa ataaatacaa aggttcttga 85800gggttgtgtt
aaattgaaag cgagaaataa tcataaatta tttcattatc gcgatatccg 85860ttaagtttgt
atcgtaatgg cgtggtcaat tacgaataaa gcggatacta gtagcttcac 85920aaagatggct
gaaatcagag ctcatctaaa aaatagcgct gaaaataaag ataaaaacga 85980ggatattttc
ccggaagatg taataattcc atctactaag cccaaaacca aacgagccac 86040tactcctcgt
aaaccagcgg ctactaaaag atcaaccaaa aaggaggaag tggaagaaga 86100agtagttata
gaggaatatc atcaaacaac tgaaaaaaat tctccatctc ctggagtcag 86160cgacattgta
gaaagcgtgg ccgctgtaga gctcgatgat agcgacgggg atgatgaacc 86220tatggtacaa
gttgaagctg gtaaagtaaa tcatagtgct agaagcgatc tctctgacct 86280aaaggtggct
accgacaata tcgttaaaga tcttaagaaa attattacta gaatctctgc 86340agtatcgacg
gttctagagg atgttcaagc agctggtatc tctagacaat ttacttctat 86400gactaaagct
attacaacac tatctgatct agtcaccgag ggaaaatcta aagttgttcg 86460taaaaaagtt
aaaacttgta agaagtaaat gcgtgcactt ttttataaag atggtaaact 86520ctttaccgat
aataattttt taaatcctgt atcagacgat aatccagcgt atgaggtttt 86580gcaacatgtt
aaaattccta ctcatttaac agatgtagta gtatatgaac aaacgtggga 86640ggaggcgtta
actagattaa tttttgtggg aagcgattca aaaggacgta gacaatactt 86700ttacggaaaa
atgcatgtac agaatcgcaa cgctaaaaga gatcgtattt ttgttagagt 86760atataacgtt
atgaaacgaa ttaattgttt tataaacaaa aatataaaga aatcgtccac 86820agattccaat
tatcagttgg cggtttttat gttaatggaa actatgtttt ttattagatt 86880tggtaaaatg
aaatatctta aggagaatga aacagtaggg ttattaacac taaaaaataa 86940acacatagaa
ataagtcccg atgaaatagt tatcaagttt gtaggaaagg acaaagtttc 87000acatgaattt
gttgttcata agtctaatag actatataaa ccgctattga aactgacgga 87060tgattctagt
cccgaagaat ttctgttcaa caaactaagt gaacgaaagg tatacgaatg 87120tatcaaacag
tttggtatta gaatcaagga tctccgaacg tatggagtca attatacgtt 87180tttatataat
ttttggacaa atgtaaagtc catatctcct cttccgtcac caaaaaagtt 87240aatagcgtta
actatcaaac aaactgctga agtggtaggt catactccat caatttcaaa 87300aagagcttat
atggcaacga ctattttaga aatggtaaag gataaaaatt ttttagatgt 87360agtatctaaa
actacgttcg atgaattcct atctatagtc gtagatcacg ttaaatcatc 87420tacggatgga
tgatatagat ctttacacaa ataattacaa gaccgataaa tggaaatgga 87480taagcgtatg
aaatctctcg caatgacagc tttcttcgga gagctaagca cattagatat 87540tatggcattg
ataatgtcta tatttaaacg ccatccaaac aataccattt tttcagtgga 87600taaggatggt
cagtttatga ttgatttcga atacgataat tataaggctt ctcaatattt 87660ggatctgacc
ctcactccga tatctggaga tgaatgcaag actcacgcat cgagtatagc 87720cgaacaattg
gcgtgtgtgg atattattaa agaggatatt agcgaatata tcaaaactac 87780tccccgtctt
aaacgattta taaaaaaata ccgcaataga tcagatactc gcatcagtcg 87840agatacagaa
aagcttaaaa tagctctagc taaaggcata gattacgaat atataaaaga 87900cgcttgttaa
taagtaaatg aaaaaaaact agtcgtttat aataaaacac gatatggatg 87960ccaacgtagt
atcatcttct actattgcga cgtatataga cgctttagcg aagaatgctt 88020cagaattaga
acagaggtct accgcatacg aaataaataa tgaattggaa ctagtattta 88080ttaagccgcc
attgattact ttgacaaatg tagtgaatat ctctacgatt caggaatcgt 88140ttattcgatt
taccgttact aataaggaag gtgttaaaat tagaactaag attccattat 88200ctaaggtaca
tggtctagat gtaaaaaatg tacagttagt agatgctata gataacatag 88260tttgggaaaa
gaaatcatta gtgacggaaa atcgtcttca caaagaatgc ttgttgagac 88320tatcgacaga
ggaacgtcat atatttttgg attacaagaa atatggatcc tctatccgac 88380tagaattagt
caatcttatt caagcaaaaa caaaaaactt tacgatagac tttaagctaa 88440aatattttct
aggatccggt gcccaatcta aaagttcttt gttgcacgct attaatcatc 88500caaagtcaag
gcctaataca tctctggaaa tagaattcac acctagagac aatgaaacag 88560ttccatatga
tgaactaata aaggaattga cgactctctc gcgtcatata tttatggctt 88620ctccagagaa
tgtaattctt tctccgccta ttaacgcgcc tataaaaacc tttatgttgc 88680ctaaacaaga
tatagtaggt ttggatctgg aaaatctata tgccgtaact aagactgacg 88740gcattcctat
aactatcaga gttacatcaa acgggttgta ttgttatttt acacatcttg 88800gttatattat
tagatatcct gttaagagaa taatagattc cgaagtagta gtctttggtg 88860aggcagttaa
ggataagaac tggaccgtat atctcattaa gctaatagag cccgtgaatg 88920ctatcagtga
tagactagaa gaaagtaagt atgttgaatc taaactagtg gatatttgtg 88980atcggatagt
attcaagtca aagaaatacg aaggtccgtt tactacaact agtgaagtcg 89040tcgatatgtt
atctacatat ttaccaaagc aaccagaagg tgttattctg ttctattcaa 89100agggacctaa
atctaacatt gattttaaaa ttaaaaagga aaatactata gaccaaactg 89160caaatgtagt
atttaggtac atgtccagtg aaccaattat ctttggagaa tcgtctatct 89220ttgtagagta
taagaaattt agcaacgata aaggctttcc taaagaatat ggttctggta 89280agattgtgtt
atataacggc gttaattatc taaataatat ctattgtttg gaatatatta 89340atacacataa
tgaagtgggt attaagtccg tggttgtacc tattaagttt atagcagaat 89400tcttagttaa
tggagaaata cttaaaccta gaattgataa aaccatgaaa tatattaact 89460cagaagatta
ttatggaaat caacataata tcatagtcga acatttaaga gatcaaagca 89520tcaaaatagg
agatatcttt aacgaggata aactatcgga tgtgggacat caatacgcca 89580ataatgataa
atttagatta aatccagaag ttagttattt tacgaataaa cgaactagag 89640gaccgttggg
aattttatca aactacgtca agactcttct tatttctatg tattgttcca 89700aaacattttt
agacgattcc aacaaacgaa aggtattggc gattgatttt ggaaacggtg 89760ctgacctgga
aaaatacttt tatggagaga ttgcgttatt ggtagcgacg gatccggatg 89820ctgatgctat
agctagagga aatgaaagat acaacaaatt aaactctgga attaaaacca 89880agtactacaa
atttgactac attcaggaaa ctattcgatc cgatacattt gtctctagtg 89940tcagagaagt
attctatttt ggaaagttta atatcatcga ctggcagttt gctatccatt 90000attcttttca
tccgagacat tatgctaccg tcatgaataa cttatccgaa ctaactgctt 90060ctggaggcaa
ggtattaatc actaccatgg acggagacaa attatcaaaa ttaacagata 90120aaaagacttt
tataattcat aagaatttac ctagtagcga aaactatatg tctgtagaaa 90180aaatagctga
tgatagaata gtggtatata atccatcaac aatgtctact ccaatgactg 90240aatacattat
caaaaagaac gatatagtca gagtgtttaa cgaatacgga tttgttcttg 90300tagataacgt
tgatttcgct acaattatag aacgaagtaa aaagtttatt aatggcgcat 90360ctacaatgga
agatagaccg tctacaaaaa actttttcga actaaataga ggagccatta 90420aatgtgaagg
tttagatgtc gaagacttac ttagttacta tgttgtttat gtcttttcta 90480agcggtaaat
aataatatgg tatgggttct gatatccccg ttctaaatgc attaaataat 90540tccaatagag
cgatttttgt tcctatagga ccttccaact gtggatactc tgtattgtta 90600atagatatat
taatactttt gtcgggtaac agaggttcta cgtcttctaa aaataaaagt 90660tttataacat
ctggcctgtt cataaataaa aacttggcga ttctatatat actcttatta 90720tcaaatctag
ccattgtctt atagatgtga gctactgtag gtgtaccatt tgattttctt 90780tctaatacta
tatatttctc tcgaagaagt tcttgcacat catctgggaa taaaatacta 90840ctgttgagta
aatcagttat tttttttata tcgatattga tggacatttt tatagttaag 90900gataataagt
atcccaaagt cgataacgac gataacgaag tatttatact tttaggaaat 90960cacaatgact
ttatcagatt aaaattaaca aaattaaagg agcatgtatt tttttctgaa 91020tatattgtga
ctccagatac atatggatct ttatgcgtcg aattaaatgg gtctagtttt 91080cagcacggtg
gtagatatat agaggtggag gaatttatag atgctggaag acaagttaga 91140tggtgttcta
catccaatca tatatctaaa gatatacccg aagatatgca cactgataaa 91200tttgtcattt
atgatatata cacttttgac gctttcaaga ataaacgatt ggtattcgta 91260caggtacctc
cgtcgttagg agatgatagt catttgacta atccgttatt gtctccgtat 91320tatcgtaatt
cagtagccag acaaatggtc aataatatga tttttaatca agattcattt 91380ttaaaatatt
tattagaaca tctgattaga agccactata gagtttctaa acatataaca 91440atagttagat
acaaggatac cgaagaatta aatctaacga gaatatgtta taatagagat 91500aagtttaagg
cgtttgtatt cgcttggttt aacggcgttt cggaaaatga aaaggtacta 91560gatacgtata
aaaaggtatc taatttgata taatgaattc agtgactgta tcacacgcgc 91620catatactat
tacttatcac gatgattggg aaccagtaat gagtcaattg gtagagtttt 91680ataacgaagt
agccagttgg ctgctacgag acgagacgtc gcctattcct gataagttct 91740ttatacagtt
gaaacaaccg cttagaaata aacgagtatg tgtgtgcggt atagatccgt 91800atccgaaaga
tggaactggt gtaccgttcg aatcaccaaa ttttacaaaa aaatcaatta 91860aggagatagc
ttcatctata tctagattaa ccggagtaat tgattataaa ggttataacc 91920ttaatataat
agacggggtt ataccctgga attattactt aagttgtaaa ttaggagaaa 91980caaaaagtca
cgcgatctac tgggataaga tttccaagtt actgctgcag catataacta 92040aacacgttag
tgttctttat tgtttgggta aaacagattt ctcgaatata cgggcaaagt 92100tagaatcccc
ggtaactacc atagtcggat atcatccagc ggctagagac cgccaattcg 92160agaaagatag
atcatttgaa attatcaacg ttttactgga attagacaac aaggcaccta 92220taaattgggc
tcaagggttt atttattaat gctttagtga aattttaact tgtgttctaa 92280atggatgcgg
ctattagagg taatgatgtt atctttgttc ttaagactat aggtgtcccg 92340tcagcgtgca
gacaaaatga agatccaaga tttgtagaag catttaaatg cgacgagtta 92400gaaagatata
ttgagaataa tccagaatgt acactattcg aaagtcttag ggatgaggaa 92460gcatactcta
tagtcagaat tttcatggat gtagatttag acgcgtgtct agacgaaata 92520gattatttaa
cggctattca agattttatt atcgaggtgt caaactgtgt agctagattc 92580gcgtttacag
aatgcggtgc cattcatgaa aatgtaataa aatccatgag atctaatttt 92640tcattgacta
agtctacaaa tagagataaa acaagttttc atattatctt tttagacacg 92700tataccacta
tggatacatt gatagctatg aaacgaacac tattagaatt aagtagatca 92760tctgaaaatc
cactaacaag atcgatagac actgccgtat ataggagaaa aacaactctt 92820cgggttgtag
gtactaggaa aaatccaaat tgcgacacta ttcatgtaat gcaaccaccg 92880catgataata
tagaagatta cctattcact tacgtggata tgaacaacaa tagttattac 92940ttttctctac
aacaacgatt ggaggattta gttcctgata agttatggga accagggttt 93000atttcattcg
aagacgctat aaaaagagtt tcaaaaatat tcattaattc tataataaac 93060tttaatgatc
tcgatgaaaa taattttaca acggtaccac tggtcataga ttacgtaaca 93120ccttgtgcat
tatgtaaaaa acgatcgcat aaacatccgc atcaactatc gttggaaaat 93180ggtgctatta
gaatttacaa aactggtaat ccacatagtt gtaaagttaa aattgttccg 93240ttggatggta
ataaactgtt taatattgca caaagaattt tagacactaa ctctgtttta 93300ttaaccgaac
gaggagacca tatagtttgg attaataatt catggaaatt taacagcgaa 93360gaacccttga
taacaaaact aattttgtca ataagacatc aactacctaa ggaatattca 93420agcgaattac
tctgtccgag gaaacgaaag actgtagaag ctaacatacg agacatgtta 93480gtagattcag
tggagaccga tacctatccg gataaacttc cgtttaaaaa tggtgtattg 93540gacctggtag
acggaatgtt ttactctgga gatgatgcta aaaaatatac gtgtactgta 93600tcaaccggat
ttaaatttga cgatacaaag ttcgtcgaag acagtccaga aatggaagag 93660ttaatgaata
tcattaacga tatccaacca ttaacggatg aaaataagaa aaatagagag 93720ctatatgaaa
aaacattatc tagttgttta tgcggtgcta ccaaaggatg tttaacattc 93780ttttttggag
aaactgcaac tggaaagtcg acaaccaaac gtttgttaaa gtctgctatc 93840ggtgacctgt
ttgttgagac gggtcaaaca attttaacag atgtattgga taaaggacct 93900aatccattta
tcgctaacat gcatttgaaa agatctgtat tctgtagcga actacctgat 93960tttgcatgta
gtgggtcaaa gaaaatcaga tctgataata ttaaaaagtt gacagaacct 94020tgtgtcattg
gaagaccgtg tttctccaat aaaattaata atagaaacca tgcgacaatc 94080attatcgata
ctaattacaa acctgttttt gataggatag ataacgcatt aatgagaaga 94140attgccgtcg
tgcgattcag aacacacttt tctcaacctt ctggtagaga ggctgctgaa 94200aataatgacg
cgtacgataa agtcaaacta ttagacgagg ggttagatgg taaaatacaa 94260aataatagat
atagattcgc atttctatac ttgttggtga aatggtacag aaaatatcat 94320gttcctatta
tgaaactata tcctacaccc gaagagattc ctgactttgc attctatctc 94380aaaataggta
ctctgttggt atctagctct gtaaagcata ttccattaat gacggacctc 94440tccaaaaagg
gatatatatt gtacgataat gtggtcactc ttccgttgac tactttccaa 94500cagaaaatat
ccaagtattt taattctaga ctatttggac acgatataga gagcttcatc 94560aatagacata
agaaatttgc caatgttagt gatgaatatc tgcaatatat attcatagag 94620gatatttcat
ctccgtaaat atatgctcat atatttatag aagatatcac atatctaaat 94680gaataccgga
atcatagatt tatttgataa tcatgttgat agtataccaa ctatattacc 94740tcatcagtta
gctactctag attatctagt tagaactatc atagatgaga acagaagcgt 94800gttattgttc
catattatgg gatcaggtaa aacaataatc gctttgttgt tcgccttggt 94860agcttccaga
tttaaaaagg tttacattct agtgccgaac atcaacatct taaaaatttt 94920caattataat
atgggtgtag ctatgaactt gtttaatgac gaattcatag ctgagaatat 94980ctttattcat
tccacaacaa gtttttattc tcttaattat aacgataacg tcattaatta 95040taacggatta
tctcgctaca ataactctat ttttatcgtt gatgaggcac ataatatctt 95100tgggaataat
actggagaac ttatgaccgt gataaaaaat aaaaacaaga ttcctttttt 95160actattgtct
ggatctccca ttactaacac acctaatact ctgggtcata ttatagattt 95220aatgtccgaa
gagacgatag attttggtga aattattagt cgtggtaaga aagtaattca 95280gacacttctt
aacgaacgcg gtgtgaatgt acttaaggat ttgcttaaag gaagaatatc 95340atattacgaa
atgcctgata aagatctacc aacgataaga tatcacggac gtaagtttct 95400agatactaga
gtagtatatt gtcacatgtc taaacttcaa gagagagatt atatgattac 95460tagacgacag
ctatgttatc atgaaatgtt tgataaaaat atgtataacg tgtcaatggc 95520agtattggga
caacttaatc tgatgaataa tttagatact ttatttcagg aacaggataa 95580ggaattgtac
ccaaatctga aaataaataa tggcgtgtta tacggagaag aattggtaac 95640gttaaacatt
agttccaaat ttaaatactt tattaatcgg atacagacac tcaacggaaa 95700acattttata
tacttttcta attctacata tggcggattg gtaattaaat atatcatgct 95760cagtaatgga
tattctgaat ataatggttc tcagggaact aatccacata tgataaacgg 95820caaaccaaaa
acatttgcta tcgttactag taaaatgaaa tcgtctttag aggatctatt 95880agatgtgtat
aattctcctg aaaacgatga tggtagtcaa ttgatgtttt tgttttcatc 95940aaacattatg
tccgaatcct atactctaaa agaggtaagg catatttggt ttatgactat 96000cccagatact
ttttctcaat acaaccaaat tcttggacga tctattagaa aattctctta 96060cgccgatatt
tctgaaccag ttaatgtata tcttttagcc gccgtatatt ccgatttcaa 96120tgacgaagtg
acgtcattaa acgattacac acaggatgaa ttaattaatg ttttaccatt 96180tgacatcaaa
aagctgttgt atctaaaatt taagacgaaa gaaacgaata gaatatactc 96240tattcttcaa
gagatgtctg aaacgtattc tcttccacca catccatcaa ttgtaaaagt 96300tttattggga
gaattggtca gacaattttt ttataataat tctcgtatta agtataacga 96360taccaagtta
cttaaaatgg ttacatcagt tataaaaaat aaagaagacg ctaggaatta 96420catagatgat
attgtaaacg gtcacttctt tgtatcgaat aaagtatttg ataaatctct 96480tttatacaaa
tacgaaaacg atattattac agtaccgttt agactttcct acgaaccatt 96540tgtttgggga
gttaactttc gtaaagaata taacgtggta tcttctccat aaaactgatg 96600agatatataa
agaaataaat gtcgagcttt gttaccaatg gatacctttc cgttacattg 96660gaacctcatg
agctgacgtt agacataaaa actaatatta ggaatgccgt atataagacg 96720tatctccata
gagaaattag tggtaaaatg gccaagaaaa tagaaattcg tgaagacgtg 96780gaattacctc
tcggcgaaat agttaataat tctgtagtta taaacgttcc gtgtgtaata 96840acctacgcgt
attatcacgt tggggatata gtcagaggaa cattaaacat cgaagatgaa 96900tcaaatgtaa
ctattcaatg tggagattta atctgtaaac taagtagaga ttcgggtact 96960gtatcattta
gcgattcaaa gtactgcttt tttcgaaatg gtaatgcgta tgacaatggc 97020agcgaagtca
ctgccgttct aatggaggct caacaaggta tcgaatctag ttttgttttt 97080ctcgcgaata
tcgtcgactc ataaaaaaga gaatagcggt aagtataaac acgaatacta 97140tggcaataat
tgcgaatgtt ttattctctt cgatatattt ttgataatat gaaaaacatg 97200tctctctcaa
atcggacaac catctcataa aatagttctc gcgcgctgga gaggtagttg 97260ccgctcgtat
aatctctcca gaataatata cttgcgtgtc gtcgttcaat ttatacggat 97320ttctatagtt
ctctgttata taatgcggtt tgccctcatg attagacgac gacaatagtg 97380ttctaaattt
agatagttga tcagaatgaa tgtttattgg cgttggaaaa attatccata 97440cagcgtctgc
agagtggttg atagttgttc ctagatatgt aaaataatcc aacttactag 97500gcagcaaatt
gtctagataa aatactgaat caaacggtgc agacgtattg gcggatctaa 97560tggaatccaa
ttgattaact atcttttgaa aatatacatt tttatgatcc aatacttgta 97620agaatataga
aataatgata agtccatcat cgtgtttttt tgcctcttca taagaactat 97680attttttctt
attccaatga acaagattaa tctctccaga gtatttgtac acatctatca 97740agtgattgga
tccataatcg tcttcctttc cccaatatat atgtagtgat gataacacat 97800attcattggg
gagaaaccct ccacttatat atcctccttt aaaattaatc cttactagtt 97860ttccagtgtt
ctggatagtg gttggtttcg actcattata atgtatgtct aacggcttca 97920atcgcgcgtt
agaaattgct tttttagttt ctatattaat aggagatagt tgttgcggca 97980tagtaaaaat
gaaatgataa ctgtttaaaa atagctctta gtatgggaat tacaatggat 98040gaggaagtga
tatttgaaac tcctagagaa ttaatatcta ttaaacgaat aaaagatatt 98100ccaagatcaa
aagacacgca tgtgtttgct gcgtgtataa caagtgacgg atatccgtta 98160ataggagcta
gaagaacttc attcgcgttc caggcgatat tatctcaaca aaattcagat 98220tctatcttta
gagtatccac taaactatta cggtttatgt actacaatga actaagagaa 98280atctttagac
ggttgagaaa aggttctatc aacaatatcg atcctcactt tgaagagtta 98340atattattgg
gtggtaaact agataaaaag gaatctatta aagattgttt aagaagagaa 98400ttaaaagagg
aaagtgatga acgtataaca gtaaaagaat ttggaaatgt aattctaaaa 98460cttacaacac
gggataaatt atttaataaa gtatatataa gttattgcat ggcgtgtttt 98520attaatcaat
cgttggagga tttatcgcat actagtattt acaatgtaga aattagaaag 98580attaaatcat
taaatgattg tattaacgac gataaatacg aatatctgtc ttatatttat 98640aatatgctag
ttaatagtaa atgaactttt acagatctag tataattagt cagattatta 98700agtataatag
acgactagct aagtctatta tttgcgagga tgactctcaa attattacac 98760tcacggcatt
cgttaaccaa tgcctatggt gtcataaacg agtatccgtg tccgctattt 98820tattaactac
tgataacaaa atattagtat gtaacagacg agatagtttt ctctattctg 98880aaataattag
aactagaaac atgtttagaa agaaacgatt atttctgaat tattccaatt 98940atttgaacaa
acaggaaaga agtatactat cgtcattttt ttctctagat ccagctacta 99000ctgataatga
tagaatagac gctatttatc cgggtggcat acccaaaagg ggtgagaatg 99060ttccagagtg
tttatccagg gaaattaaag aagaagttaa tatagacaat tcttttgtat 99120tcatagacac
tcggtttttt attcatggca tcatagaaga taccattatt aataaatttt 99180ttgaggtaat
cttctttgtc ggaagaatat ctctaacgag tgatcaaatc attgatacat 99240ttaaaagtaa
tcatgaaatc aaggatctaa tatttttaga tccgaattca ggtaatggac 99300tccaatacga
aattgcaaaa tatgctctag atactgcaaa acttaaatgt tacggccata 99360gaggatgtta
ttatgaatca ttaaaaaaat taactgagga tgattgatta aaaaatataa 99420attaatttac
catcgtgtat ttttataacg ggattgtccg gcatatcatg tagatagtta 99480ccgtctacat
cgtatactcg accatctacg cctttaaatc ctctatttat tgacattaat 99540ctattagaat
tggaatacca aatattagta ccctcaatta gtttattggt aatatttttt 99600ttagacgata
gatcgatggc tcttgaaacc aaggttttcc aaccggactc attgtcgatc 99660ggtgagaagt
ctttttcatt agcatgaatc cattctaatg atgtatgttt aaacactcta 99720aacaattgga
caaattcttt tgatttgctt tgaatgattt caaataggtc ttcgtctaca 99780gtaggcatac
cattagataa tctagccatt ataaagtgca cgtttacata tctacgttct 99840ggaggagtaa
gaacgtgact attgagacga atggctcttc ctactatctg acgaagagac 99900gcctcgttcc
atgtcatatc taaaatgaag atatcattaa ttgagaaaaa actaataccc 99960tcgcctccac
tagaagagaa tacgcatgtt ttaatgcatt ctccgttagt gtttgattct 100020tggttaaact
cagccaccgc cttgattcta gtatcttttg ttctagatga gaactctata 100080ttagagatac
caaagacttt gaaatatagt aataagattt ctattcctga ctgattaaca 100140aatggttcaa
agactagaca tttaccatgg gatgctaata ttcccaaaca tacatctata 100200aatttgacgc
ttttctcttt taattcagta aatagagaga tatcagccgc actagcatcc 100260cctttcaata
gttctccctt tttaaaggta tctaatgcgg atttagaaaa ctctctatct 100320cttaatgaat
ttttaaaatc attatatagt gttgctatct cttgcgcgta ttcgcccgga 100380tcacgatttt
gtctttcagg aaagctatcg aacgtaaacg tagtagccat acgtctcaga 100440attctaaatg
atgatatacc tgtttttatt tcagcgagtt tagccttttg ataaatttct 100500tcttgctttt
tcgacatatt aacgtatcgc attaatactg ttttcttagc gaatgatgca 100560gacccttcta
cgtcatcaaa aatagaaaac tcgttattaa ctatatacga acatagtcct 100620cctagtttgg
agactaattc tttttcatcg actagacgtt tattctcaaa tagtgattgg 100680tgttgtaagg
atcctggtcg tagtaagtta accaacatgg tgaattcttg cacactattg 100740acgataggtg
tagccgataa acaaatcatc ttatggtttt ttaacgcaat ggtcttagat 100800aaaaaattat
atactgaacg agtaggacgg atcttaccat cttctttgat taatgattta 100860gaaatgaagt
tatgacattc atcaatgatg acgcatattc tactcttgga attaatagtt 100920ttgatattag
taaaaaattt atttctaaaa ttttgatcat cgtaattaat aaaaatacaa 100980tccttcgtta
tctctggagc gtatctgagt atagtgttca tccaaggatc ttctatcaaa 101040gcctttttca
ccaataagat aatagcccaa ttcgtataaa tatccttaag atgtttgaga 101100atatatacag
tagtcattgt tttaccgaca cccgtttcat ggaacaataa aagagaatgc 101160atactgtcta
atcctaagaa aactcttgct acaaaatgtt gataatcctt gaggcgtact 101220acgtccgacc
ccatcatttc aacgggcata ttagtagttc tgcgtaaggc ataatcgata 101280taggccgcgt
gtgatttact catttatgag tgataagtaa taactatgtt ttaaaaatca 101340cagcagtagt
ttaactagtc ttctctgatg tttgttttcg atactttttg aatcagaagt 101400catactagaa
taaagcaacg agtgaacgta atagagagct tcgtatactc tattcgaaaa 101460ctctaagaac
ttattaatga attccgtatc cactggattg tttaaaatac taaattgaac 101520actgttcaca
tccttccaag aagaagactt agtgacggac ttaacatgag acataaataa 101580atccaaattt
tttttacaaa catcactagc caccataatg gcgctatctt tcaaccagct 101640atcgcttacg
cattttagca gtctaacatt tttaaagaga ctacaatata ttctcatagt 101700atcgattaca
cctctaccga ataaagttgg aagtttaata atacaatatt tttcgtttac 101760aaaatcaaat
aatggtcgaa acacgtcgaa ggttaacatc ttataatcgc taatgtatag 101820attgttttca
gtgagatgat tattagattt aatagcatct cgttcacgtt tgaacagttt 101880attgcgtgcg
ctgaggtcgg caactacggc gtccgcttta gtactcctcc cataatactt 101940tacgctatta
atctttaaaa tttcatagac tttatctaga tcgctttctg gtaacatgat 102000atcatgtgta
aaaagtttta acatgtcggt cggcattcta tttagatcat taactctaga 102060aatctgaaga
aagtaattag ctccgtattc cagactaggt aatgggcttt tacctagaga 102120cagattaagt
tctggcaatg tttcataaaa tggaagaagg acatgcgttc cctcccggat 102180attttttaca
atttcatcca tttacaactc tatagtttgt tttcattatt attagttatt 102240atctcccata
atcttggtaa tacttacccc ttgatcgtaa gataccttat acaggtcatt 102300acatacaact
accaattgtt tttgtacata atagattgga tggttgacat ccatggtgga 102360ataaactact
cgaacagata gtttatcttt ccccctagat acattagccg taatagttgt 102420cggcctaaag
aatatctttg gtgtaaagtt aaaagttagg gttcttgttc cattattgct 102480ttttgtcagt
agttcattat aaattctcga gatgggtccg ttctctgaat atagaacatc 102540atttccaaat
ctaacttcta gtctagaaat aatatcggtc ttattcttaa aatctattcc 102600cttgatgaag
ggatcgttaa tgaacaaatc cttggccttt gattcggctg atctattatc 102660tccgttatag
acgttacgtt gactagtcca aagacttaca ggaatagatg tatcgatgat 102720gttgatacta
tgtgatatgt gagcaaagat tgttctctta gtggcatcac tatatgttcc 102780agtaatggcg
gaaaactttt tagaaatgtt atatataaaa gaattttttc gtgttccaaa 102840cattagcaga
ttagtatgaa gataaacact catattatca ggaacattat caatttttac 102900atacacatca
gcatcttgaa tagaaacgat accatcttct ggaacctcta cgatctcggc 102960agactccgga
taaccagtcg gtgggccatc gctaacaata actagatcat ccaacaatct 103020actcacatat
gcatctatat aatctttttc atcttgtgag taccctggat acgaaataaa 103080tttattatcc
gtatttccat aataaggttt agtataaaca gagagagatg ttgccgcatg 103140aacttcagtt
acagtcgccg ttggttggtt tatttgacct attactctcc taggtttctc 103200tataaacgat
ggtttaattt gtacattctt aaccatatat ccaataaagc tcaattcagg 103260aacataaaca
aattctttgt tgaacgtttc aaagtcgaac gaagagtcac gaataacgat 103320atcggatact
ggattgaagg ttaccgttac ggtaattttt gaatcggata gtttaagact 103380gctgaatgta
tcttccacat caaacggagt tttaatataa acgtatactg tagatggttc 103440tttaatagtg
tcattaggag ttaggccaat agaaatatca ttaagttcac tagaatatcc 103500agagtgtttc
aaagcaattg tattattgat acaattatta tataattctt cgccctcaat 103560ttcccaaata
acaccgttac acgaagagat agatacgtga ttaatacatt tatatccaac 103620atatggtacg
taactgaatc ttcccatacc tttaacttct ggaagttcca aactcagaac 103680caaatgatta
agcgcagtaa tatactgatc cctaatttcg aagctagcga tagcctgatt 103740gtctggacca
tcgtttgtca taactccgga tagagaaata tattgcggca tatataaagt 103800tggaatttga
ctatcgactg cgaagacatt agaccgttta atagagtcat ccccaccgat 103860caaagaatta
atgatagtat tattcatttt ctatttaaaa tggaaaaagc ttacaataaa 103920ctccgtagag
aaatatctat aatttgtgag ttttccttaa agtaacagct tccgtaaacg 103980ccgtctttat
ctcttagtag gtttattgta tttatgacct tttccttatc ttcatagaat 104040actaaaggca
acaaagaaat ttttggttct tctctaagag ctacgtgaga cttaaccata 104100gaagccaacg
aatccctaca tattttagaa cagaaatacc ctacttcacc acccttgtat 104160gtctcaatac
taataggtct aaaaaccaaa tcttgattac aaaaccaaca cttatcaatt 104220acactatttg
tcttaataga cacatctgcc atagatttat aatactttgg tagtatacaa 104280gcgagtgctt
cttctttagc gggcttaaag actgctttag gtgctgaaat aaccacatct 104340ggaaggctta
ctcgcttagc catttaatta cggaactatt tttttatact tctaatgagc 104400aagtagaaaa
cctctcatct acaaaaacgt actcgtgtcc ataatcctct accatagtta 104460cacgtttttt
agatctcata tgtgctaaaa agttttccca tactaattgg ttactattat 104520ttttcgtata
atttttaaca gtttgaggtt ttagattttt agttacagaa gtgatatcga 104580atattttatc
caaaaagaat gaataattaa ttgtcttaga aggagtgttt tcttggcaaa 104640agaataccaa
gtgcttaaat atttctacta cttcattaat cttttctgta ctcagattca 104700gtttctcatc
ttttacttga ttgattattt caaagactaa cttataatcc tttttattta 104760ttctctcgtt
agccttaaga aaactagata caaaatttgc atctacatca tccgtggata 104820tttgattttt
ttccatgata tccaagagtt ccgagataat ttctccagaa cattgatgag 104880acaataatct
ccgcaataca tttctcaaat gaataagttt attagacacg tggaagtttg 104940actttttttg
tacctttgta catttttgaa ataccgactc gcaaaaaata caatattcat 105000atccttgttc
agatactata ccgttatgtc tacaaccgct acataatcgt agattcatgt 105060taacactcta
cgtatctcgt cgtccaatat tttatataaa aacattttat ttctagacgt 105120tgccagaaaa
tcctgtaata tttttagttt tttgggctgt gaataaagta tcgccctaat 105180attgttaccg
tcttccgcca atatagtagt taaattatcc gcacatgcag aagaacaccg 105240cttaggcgga
ttcagtacaa tgttatattt ttcgtaccaa ctcatttaaa tatcataatc 105300taaaatagtt
ctgtaatatg tctagcgcta atatattgat cataatcctg tgcataaatt 105360aagatacaac
aatgtctcga aatcatcgac atggcttctt ccatagttag aagatcgtcg 105420tcaaagttag
caacgtgatt catcaacatt tgctgttttg aggcagcaaa tactgaaccg 105480tcgccattca
accattcata aaaaccatcg tctgaatcca ttgataattt cttgtactgg 105540tttttgagag
ctcgcatcaa tctagcattt ctagctcccg gattgaaaac agaaagagga 105600tcgtacatcc
agggtccatt ttctgtaaat agaatcgtat aatgtccctt caagaagata 105660tcagacgatc
cacaatcaaa gaattggtct ccgagtttgt aacaaactgc ggactttaac 105720ctatacatga
taccgtttag cataatttct ggtgatacgt caatcggagt atcatctatt 105780agagatctaa
agccggtgta acattctcca ccaaacatat tcttattctg acgtcgttct 105840acataaaaca
tcattgctcc attaacgata acaggggaat gaacagcact acccatcaca 105900ttagttccca
atggatcaat gtgtgtaact ccagaacatc ttccatagcc tatgttagga 105960ggagcgaaca
ccactcttcc actattgcca tcgaatgcca tagaataaat atccttggaa 106020ttgatagaaa
tcggactgtc ggatgttgtg atcatcttca taggattaac aactatgtat 106080ggtgccgcct
gaagtttcat atcgtaactg atgccgttta taggtctagc cacagaaacc 106140aacgtaggtc
taaatccaac tatagacaaa atagaagcca atatctgttc ctcatctgtc 106200ataacttgag
agcatccagt atgaataatc ttcattagat ggggatctac cgcatcatca 106260tcgttacaat
aaaaaattcc cattctaatg ttcataattg cttttctaat catggtatgc 106320atgtttgctc
tctgaatctc tgtggaaatt agatctgata cacctgtaat cactatcgga 106380ttatcctccg
taagacgatt aaccaacaac atataattat aagactttac ttttctaaat 106440tcataaagtt
gctggattag gctataggtg tctccatgta catacgcgtt ctcgagcgca 106500ggaagtttaa
taccgaatag tgccatcaga ataggatgaa tatagtaatt agtttctggt 106560tttctataaa
taaaagacaa atcttgtgaa ctagacatat cggtaaaatg catggattgg 106620aatcgtgtag
tcgacagaag aatatgatga ttagatggag agtatatttt atctaactct 106680ttgagttggt
caccgattct aggactagct cgagaatgaa taagtactaa aggatgagta 106740catttcacag
aaacactagc attgttcaat gtgctcttta catgggtaag gagttgaaat 106800agctcgtttc
tatttgttct gacaatattt agtttattca taatgttaag catatcctga 106860atagtaaagt
tagatgtgtc atacttgtta gtagttagat atttagcaat tgcattccca 106920tcatttctca
atctcgtact ccaatcatgt gtagatgcta cttcgtcgat ggaaaccata 106980caatcctttt
tgataggctg ttgagattga tcatttcctg cacgtttagg tttggtacgt 107040tgatttctag
cccctgcgga tataaagtca tcgtctacaa tttgggacaa tgaattgcat 107100acactacaag
acaaagattt atcagaagtg tgaatatgat cttcatctac caaagaaaga 107160gtttgattag
tataactaga ttttagtcct gcgttagatg ttaaaaaaac atcgctattg 107220accacggctt
ccattattta tattcgtagt ttttactcga aagcgtgatt ttaatatcca 107280atcttattac
ttttggaatc gttcaaaacc tttgactagt tgtagaattt gatctattgc 107340cctacgcgta
tactcccttg catcatatac gttcgtcacc agatcgtttg tttcggcctg 107400aagttggtgc
atatctcttt caacattcga catgagatcc ttaagggcca tatcgtctag 107460attttgttga
gatgctgctc ctggatttgg attttgttgt gctgttgtac atactgtacc 107520accagtaggt
gtaggagtac atacagtggc cacaatagga ggttgagaaa gtgtaaccgt 107580tggagtagta
caagaaatac ttccatccga ttgttgtgta catgtagttg ttggtaacgt 107640ctgagaaggt
tgggtagatg gcggcgtcgt cgttttttga tctttattaa atttagagat 107700aatatcctga
acagcattgc tcggcgtcaa cgctggaagg agtgaactcg ccggcgcatc 107760agtatcttca
gacagccaat caaaaagatt agacatatca gatgatgtat tagtttgttg 107820tcgtggtttt
ggtgtaggag cagtactact aggtagaaga ataggagccg atgtagctgt 107880tggaaccggc
tgtggagtta tatgaatagt tggttgtagc ggttggatag gctgtctgct 107940ggcggccatc
atattatctc tagctagttg ttctcgcaac tgtctttgat aatacgactc 108000ttgagacttt
agtcctattt caatcgcttc atcctttttc gtatccggat ccttttcttc 108060agaataatag
attgacgact ttggtgtaga ggattctgcc agcctctgtg agaacttgtt 108120aaagaagtcc
atttaaggct ttaaaattga attgcgatta taagattaaa tggcagacac 108180agacgatatt
atcgactatg aatccgatga tctcaccgaa tacgaggatg atgaagaaga 108240ggaagaagat
ggagagtcac tagaaactag tgatatagat cccaaatctt cttataagat 108300tgtagaatca
gcatccactc atatagaaga tgcgcattcc aatcttaaac atatagggaa 108360tcatatatct
gctcttaaac gacgctatac tagacgtata agtctatttg aaatagcggg 108420tataatagca
gaaagctata acttgcttca acgaggaaga ttacctctag tttcagaatt 108480ttctgacgaa
acgatgaagc aaaatatgct acatgtaatt atacaagaga tagaggaggg 108540ttcttgtcct
atagtcatcg aaaagaacgg agaattgttg tcggtaaacg attttgacaa 108600agatggtcta
aaattccatc tagactatat tatcaaaatt tggaaacttc aaaaacgata 108660ttagaattta
tacgaatatc gttctctaaa tgtcacaatc aagtctcgca tgttcagcaa 108720tttattgtcg
tactttatat cgtgttcatt aacgatatct tgcaaaatag taatgattct 108780atcttccttc
gatagatatt cttcagagat tattgtctta tattctttct tgttatcaga 108840tatgaatttg
ataagacttt gaacattatt gatacccgtc tgtttaattt tttctacaga 108900tattttagtt
ttggcagatt ctatcgtatc tgtcaataga catccaacat cgacattcga 108960cgtcaattgt
ctataaatca acgtataaat tttagaaata acattagcga attgttgtgc 109020gttgatgtcg
ttattctgaa acagtatgat tttaggtagc attttcttaa caaagagaac 109080gtatttattg
ttactcagtt gaacagatga tatatccaga ttactaacgc atctgattcc 109140gtataccaaa
ctttcagaag aaatggtata caattgtttg tattcattca atgtctcttt 109200ttcagaaatt
agtttagagt cgaatactgc aataattttc aagagatagt tttcatcaga 109260taagatttta
tttagtgtag atatgataaa actattgttt tgttggagaa cttgatacgc 109320cgcgttctct
gtagtcgacg ctctcaaatg ggaaacaatc tccattattt ttttggaatc 109380ggatactata
tcttcggtat cttgacgcag tctagtatac atagagttaa gagagattag 109440agtttgtaca
ttaagcaaca tgtctctaaa tgtggctaca aacttttcct ttttcacatc 109500atctagttta
ttatataccg atttcacaac ggcaccagat ttaaggaacc agaatgaaaa 109560actctgataa
ctacaatatt tcatcatagt tacgatttta tcatcttcta tagttggtgt 109620aatagcgcat
acctttttct ccaagactgg aaccaacgtc ataaaaatgt ttaaatcaaa 109680atccatatca
acatctgatg cgctaagacc agtctcgcgt tcaagattat ctttactaat 109740ggtgacgaac
tcatcgtata aaactctaag tttgtccatt atttatttac agatttagtt 109800gtttaattta
tttgtgctct tccagagttg ggatagtatt tttctaacgt cggtattata 109860ttattaggat
ctacgttcat atgtatcata atattaatca tccacgtttt gataaatcta 109920tctttagctt
ctgaaataac gtatttaaac aaaggagaaa aatatttagc tacggcatca 109980gacgcaataa
cattttttgt aaatgtaacg tatttagacg acagatcttc gttaaaaagt 110040tttccatcta
tgtagaatcc atcggttgtt aacaccattc ccgcgtcaga ttgaatagga 110100gtttgaatag
tttgttttgg aaatagatcc ttcaataact tatagttggg tgggaaaaaa 110160tcgattttat
cactagactc tttctttttt actatcatta cctcatgaac tatttcttga 110220atgagtatat
gtattttctt tcctatatcg gacgcgttca ttggaaaata taccatgtcg 110280ttaactataa
gaatattttt atcctcgttt acaaactgaa taatatcaga tgtagttcgt 110340aaacgaacta
tatcatcacc agcacaacat ctaactatat gatatccact agtttccttt 110400agccgtttat
tatcttgttc catattagca gtcattccat catttaagaa ggcgtcaaag 110460ataataggga
gaaatgacat tttggattct gttacgactt taccaaaatt aaggatatac 110520ggacttacta
tctttttctc aacgtcaatt tgatgaacac acgatgaaaa tgtgcttcta 110580tgagattgat
catgtagaaa acaacaaggg atacaatatt tccgcatatc atgaaatata 110640ttaagaaatc
ccaccttatt atatttcccc aaaggatcca tgcacgtaaa cattatgccg 110700ttatcattaa
taaagacttc tttctcatcg gatctgtaaa agttgttact gatttttttc 110760attccaggat
ctagataatt aataatgatg ggttttctat tcttattctt tgtattttgg 110820catatcctag
accagtaaac agtttccact ttggtaaaat cagcagactt ttgaacgcta 110880ttaaacatgg
cattaatggc aataactaaa aatgtaaaat atttttctat gttaggaata 110940tggtttttca
ctttaataga tatatggttt ttggccaaaa tgatagatat ttttttatcc 111000gaggatagta
aaatattatt agtcgccgtc tctataaaaa tgaagctagt ctcgatatcc 111060aattttattc
tagaattgat aggagtcgcc aaatgtacct tatacgttat atctcccttg 111120atgcgttcca
tttgtgtatc tatatcggac acaagatctg taaatagttt tacgttatta 111180atcatcacgg
tatcgccgtc gctagataac gctaatgtac catccaagtc ccaaatggag 111240agatttaact
gttcatcgtt tagaataaaa tgattaccgg tcatattaat aaagtgttca 111300tcgtatctag
ataacaacga cttataatta atgtccaagt cttgaactcg ctgaatgatc 111360ttttttaacc
cagttagttt tagattggta cgaaatatat tgttaaactt tgattctaca 111420gtaatgtcca
aatctagttg tggaaatact tccatcaaca ttgtttcaaa cttgataata 111480ttattatcta
catcttcgta cgatccaaat tccggaatag atgtatcgca cgctctggcc 111540acccagataa
ccaaaaagtc acacgctcca ggatatacat tgtataaaaa gctatcgttt 111600tttagtaggg
tttttttctg cgtgtatacg aagggattaa aaatagtatt atcaacgtaa 111660ctatattcca
aattattctt atgagaatag ataataatat cgtccttaat atctaacaaa 111720tttcctaaat
atccctttaa ttgagtcatt cgaagcgtca atagaatatg tctcttaact 111780atttccggct
gttgtatatt taaatgactt cgtaaaaaat aatatatggg cgacttctca 111840tctatgtaat
catatggagt gagatatagg gctcgttcta cctcctgccc cttacccacc 111900tgtaatacca
attgcggact tactatatat cgcatattta tatcgtgggg taaagtgaaa 111960atctactacc
gatgatgtaa gtcttacaat gttcgaacca gtaccagatc ttaatttgga 112020ggcctccgta
gaactagggg aggtaaatat agatcaaaca acacctatga taaaggagaa 112080tagcggtttt
atatcccgca gtagacgtct attcgcccat agatctaagg atgatgagag 112140aaaactagca
ctacgattct ttttacaaag actttatttt ttagatcata gagagattca 112200ttatttgttc
agatgcgttg acgctgtaaa agacgtcact attaccaaaa aaaataacat 112260tatcgtggcg
ccttatatag cacttttaac tatcgcatca aaaggatgca aacttacaga 112320aacaatgatt
gaagcattct ttccagaact atataatgaa catagtaaga aatttaaatt 112380caactctcaa
gtatccatca tccaagaaaa actcggatac cagtttggaa actatcacgt 112440ttatgatttt
gaaccgtatt actctacagt agctctggct attcgagatg aacattcatc 112500tggcattttt
aatatccgtc aagagagtta tctggtaagt tcattatctg aaataacata 112560tagattttat
ctaattaatc taaaatctga tcttgttcaa tggagtgcta gtacgggcgc 112620tgtaattaat
caaatggtaa atactgtatt gattacagtg tatgaaaagt tacaactggt 112680catagaaaat
gattcacaat ttacatgttc attggctgtg gaatcaaaac ttccaataaa 112740attacttaaa
gatagaaatg aattatttac aaaattcatt aacgagttaa aaaagaccag 112800ttcattcaag
ataagcaaac gcgataagga tacgctacta aaatatttta cttaggactg 112860gagttagaat
ttatagacga ctcatttcgt ttatcattgt tactattatt actattacta 112920tcattattag
tgttggcatt attagtattc ttcttgtcat cttgttcaga aatatacagc 112980aatgctatac
ctaatactaa atacattatc atgctcgcaa tggctctaac aacaacgaac 113040caaaatgaat
ttggtcgtag cttttgttca caaaaataca taaagaaatg tctacataaa 113100tctatggcgc
cattggctac ttgaaatagc gccagtcctc ctacagattt taatatagct 113160gtataacatg
acatttattc atcatcaaaa gagacagagt caccatctgt catatttaga 113220ttttttttca
tgtgttcaaa gtatcctcta ctcatttcat tataatagtt tatcatactt 113280agaattttag
gacggatcaa tgagtaagac ttgactagat cgtcagtagt aatttgtgca 113340tcgtctattc
tgcatccgct tcgtcgaata atgtatagca tcgctttgag attctccata 113400gctatcaagt
ctttatacaa tgacatggaa atatctgtga atactttata cttctccaac 113460atcgatgcct
taacatcatc gcctacttta gcattgaaaa tacgttctat tgtgtagatg 113520gatgtagcaa
gatttttaaa caacaatgcc atcttacacg atgattgcct caagtctcca 113580atcgtttgtt
tagaacgatt agctacagag tccaatgctt ggctgactag catattatta 113640tctttagaaa
ttgtattctt caatgaggcg tttatcatat ctgtgatttc gttagtcata 113700ttacagtctg
actgggttgt aatgttatcc aacatatcac ctatggatac ggtacacgta 113760ccagcatttg
taataatcct atctaagatg ttgtatggca ttgcgcagaa aatatcttct 113820cctgtaatat
ctccactctc gataaatcta ctcagattat tcttaaatgc cttattctct 113880ggagaaaaga
tatcagtgtc catcatttca ttaatagtat acgcagaaaa gataccacga 113940gtatcaattc
tatccaagat acttatcggt tccgagtcac agataatggt ttcctctcct 114000tcgggagatc
ctgcatagaa atatctagga caatagtttc tatactgtct gtaactctga 114060taatctctaa
agtcactaac tgataccatg aaattgagaa gatcaaacgc tgaagtaatt 114120aatttttctg
cctcgttttt actacaacta gttttcatca atgtagtgac gatgtattgt 114180ttagttactt
ttggtctaat actgatgata gagatattat tgcttcccat aatggatctt 114240ctagtagtca
ccttaaagcc cattgatgcg aatagcagat agataaagtc ttggtatgac 114300tcctttctaa
tatagtacgg actacctttg tcacccaact ttatacccac ataagccata 114360acaacctctt
taatagccgt ttcatgaggt ttatcagcca tgagcctgag tagttggaag 114420aatctcatga
atcccgtctc agaaagtcct atatgcatga tagatttatc tttcctggga 114480aactctcgta
tagtcataga tgaaatactc tttaaagttt ctgaaataag attagtaaca 114540gtcttacctc
cgactactct aggtaacaaa caaactctaa taggtgtttt ctctgcggag 114600ataatatcag
aaaggataga gcaataagta gtattattgt gattataaag accgaataca 114660taacaggtag
aatttataaa catcatgtcc tgaaggtttt tagacttgta ttcctcgtaa 114720tccataccgt
cccaaaacat ggatttggta actttgatag ccgtagatct ttgttccttc 114780gccaacaggt
taaagaaatt aataaagaat ttgttgtttc tatttatgtc cacaaattgc 114840acgtttggaa
gcgccacggt tacattcact gcagcatttt gaggatcgcg agtatgaagt 114900acgatgttat
tgtttactgg tatatctgga aagaaatcta ccagtctagg aataagagat 114960tgatatcgca
tagaaatagt aaagtttata atctcatcat cgaagagcat tttgttacca 115020ttgtaataaa
tatccactct gtcatatgta taaatgaagt actgttcaaa catgatgaga 115080tgtttatatg
ttggcatagt agtgagatcg acgtttggta atggcaatgt attaagatta 115140actccataat
gtctagcagc atctgcgatg ttataagcgt cgtcaaagcg gggtcgatct 115200tgtattgtta
tatattgtct aacacctata agattatcaa aatcttgtct gcttaataca 115260ccgttaacaa
tttttgcctt gaattctttt attggtgcat taataacatc cttatagagg 115320atgttaaaca
aataagtgtt atcaaagtta agatctggat atttcttttc tgctagaaca 115380tccattgagt
cggagccatc tggtttaata taaccaccga taaatctagc tctgtattct 115440gtatccgtca
atctaatatt aagaaggtgt tgagtgaaag gtggaagatc gtaaaagctg 115500tgagtattaa
tgataggatt agtttccgaa ctaatgttaa ttggggtatt aataatatct 115560atatttccag
cgttaagtgt aacattaaac agttttaatt cacgtgacgt ggtatcaatt 115620aaataattaa
tgcccaattt ggatatagca gcctgaagct catcttgttt agttacggat 115680cctaatgagt
tattaagcaa tatatcgaac ggatgaacga aggttgtttt aagttggtca 115740catactttgt
aatctagaca tagatgcgga agaacggtag aaactatacg aaataaatat 115800tcagagtcct
ctaattgatc aagagtaact attgacttaa taggcatcat ttatttagta 115860ttaaatgacg
accgtaccag tgacggatat acaaaacgat ttaattacag agttttcaga 115920agataattat
ccatctaaca aaaattatga aataactctt cgtcaaatgt ctattctaac 115980tcacgttaac
aacgtggtag atagagaaca taatgccgcc gtagtgtcat ctccagagga 116040aatatcctca
caacttaatg aagatctatt tccagatgat gattcaccgg ccactattat 116100cgaacgagta
caacctcata ctactattat tgacgatact ccacctccta cgtttcgtag 116160agagttatta
atatcggaac aacgtcaaca acgagaaaaa agatttaata ttacagtatc 116220gaaaaatgct
gaagcaataa tggaatctag atctatgata acttctatgc caacacaaac 116280accatccttg
ggagtagttt atgataaaga taaaagaatt cagatgttag aggatgaagt 116340ggttaatctt
agaaatcaac gatctaatac aaaatcatct gataatttag ataattttac 116400caaaatacta
tttggtaaga ctccgtacaa atcaacagaa gttaataagc gtatagccat 116460cgttaattat
gcaaatttga acgggtcccc cttatcagtc gaggacttgg atgtttgttc 116520ggaggatgaa
atagatagaa tctataaaac gattaaacaa tatcacgaaa gtagaaaacg 116580aaaaattatc
gtcactaacg tgattattat tgtcataaac attatcgagc aggcattgct 116640aaaactcgga
tttgaagaaa tcaaaggact gagtaccgat atcacttcag aaattatcga 116700tgtggagatc
ggagatgact gcgatgctgt agcatctaaa ctaggaatcg gtaacagtcc 116760ggttcttaat
attgtattgt ttatactcaa gatattcgtt aaacgaatta aaattattta 116820atttaataca
ttcccatatc cagacaacaa tcgtctggat taatctgttc ctgtcgtctc 116880ataccggacg
acatattaat ctttttatta gtgggcatct ttttagatgg tttctttttc 116940ccagcattaa
ctgagtcgat acctagaaga tcgtgattga tctctccgac cattccacga 117000acttctaatt
ggccgtctct gacggtacca taaactattt taccagcatt agtaacagct 117060tggacaatct
gaccatccat cgcattgtac gatgtagtag taactgttgt tctacgtcta 117120ggagcaccag
aagtattttt ggagcccttg gatgttgatg tagaagaaga cgaggatttt 117180gattttggtt
tacatgtaat acattttgaa ctctttgatt ttgtatcaca tgcgccggca 117240gtcacatctg
tttgagaatt aagattattg ttgcctcctt tgacggctgc atctccaccg 117300atttgcgcta
gtagattttt aagctgtggt gtaatcttat taactgtttc gatataatca 117360tcgtaactgc
ttctaacggc taaatttttt ttatccgcca tttagaagct aaaaatattt 117420ttatttatgc
agaagattta actagattat acaatgaact aatatgatcc ttttccagat 117480tatttacaaa
cttggtattt tttggttctg gaggaggcga atttaaattc ggacttggat 117540tcggattttg
taagttcttg atcttattat acatcgagta taggatggcg acagtaactg 117600ctacacaaat
accgatcaaa agaagaatac caatcattta ttgacaataa cttcactatt 117660gatcaagtat
gcaatatatc atcttttcac taaataagta gtaataatga ttcaacaatg 117720tcgagatata
tggacgataa taatttagtt catggaaata tcgctatgat tggtgtgaat 117780gactccgcta
actctgtggg gtgcgcagtg ctttccccac atagaataaa ttagcattcc 117840gactgtgata
ataataccaa gtataaacgc cataatactc aatactttcc atgtacgagt 117900gggactggta
gacttactaa agtcaataaa ggcgaagata cacgaaagaa tcaaaagaat 117960gattccagcg
attagcacgc cggaaaaata atttccaatc ataagcatca tgtccattta 118020actaataaaa
attttaaatc gccgaatgaa caaagtggaa tataaaccat ataaaaacaa 118080tagtttgtac
tgcaaaaata atatctattt ttgttttcga agatatggta aaattaaata 118140gtagtacaca
gcatgttata actaacagca gcaacggctc gtaattactt atcatttact 118200agacgaaaag
gtggtgggat attttcttgc tcaaataata cgaatatatc acccatccat 118260tttatgcgat
gtttatatac tctaatcttt aatagatcta tagacgacgg gtttaccaac 118320aatatagatt
ttatcgattc atctaattta aacccttcct taaacgtgaa tgatctatta 118380tctggcataa
cgatgaccct acctgatgaa tcggacaatg tactgggcca tgtagaataa 118440attatcaacg
aattatcgtc tacgaacatt tatatcattt gttttaattt taggacgcga 118500ataaatggat
ataaaataga aaataacaga tattacaacc agtgttatgg ccgcgcccaa 118560ccaggtaggc
agttttattt tatcttttac tacaggttct cctggatgta cgtcaccaac 118620ggcggacgta
gttctagtac aattagacgt aagttccgct tgggaatttt ttaacgctaa 118680agagttaacg
ttaatcgtgc acccaacgta tttacatcta gttcgttgaa catcttgatt 118740ataatataac
cattttctat ctctagattc gtcagtgcac tcatgtaacc aacataccct 118800aggtcctaaa
tatttatctc cggaattaga ttttggataa ttcgcgcacc aacaatttct 118860atttccttta
tgatcgttac aaaagacgta taatgccgta tccccaaaag taaaataatc 118920aggacgaata
attctaataa actcagaaca atatctcgca tccatatgtt tggagcaaat 118980atcggaataa
gtagacatag ccggtttccg ttttgcacgt aaccattcta aacaattggg 119040gtttccagga
tcgtttctac aaaatccagt catgaaatcg tcacaatgtt ctgtcttgta 119100attattatta
aatatttttg gacagtgttt ggtatttgtc ttagaacaac attttgccac 119160gctatcacta
tcgcccagga gataatcctt ttttataaaa tgacatcgtt gcccggatgc 119220tatataatca
gtagcgtgtt ttaaatcctt aatatattca ggagttacct cgttctgata 119280atagattaat
gatccaggac gaaatttgaa agaactacat ggttctccat gaattaatac 119340atattgttta
gcaaattcag gaactataaa actactacaa tgatctatcg acataccatc 119400tatcaaacaa
aacttgggtt taatttctcc cggagatgtt tcataatagt acgtataact 119460ttcttctgca
aacttaacag ctctattata ttcaggataa ttaaaaccta attccatata 119520tttgtctcgt
atatctgcta ttcctggtgc tattttgatt ctattaagag taacagctgc 119580ccccattctt
aataatcgtc agtatttaaa ctgttaaatg ttggtatatc aacatctacc 119640ttatttcccg
cagtataagg tttgttgcag gtatactgtt caggaatggt tacatttata 119700cttcttctat
agtcctgtct ttcgatgttc atcacatatg caaagaacag aataaacaaa 119760ataatgtaag
aaataatatt aaatatctgt gaattcgtaa atacattgat tgccataata 119820attacagcag
ctacaataca cacaatagac attcccacag tgttgccatt acctccacga 119880tacatttgag
ttactaagca ataggtaata actaagctag taagaggcaa tagaaaagat 119940gagataaata
tcatcaatat agagattaga ggagggctat atagagccaa gacgaacaaa 120000atcaaaccga
gtaacgttct aacatcatta tttttgaaga ttcccaaata atcattcatt 120060cctccataat
cgttttgcat catacctcca tctttaggca taaacgattg ctgctgttcc 120120tctgtaaata
aatctttatc aagcactcca gcacccgcag agaagtcgtc aagcatattg 120180taatatctta
aataactcat ttatatatta aaaaatgtca ctattaaaga tggagtataa 120240tctttatgcc
gaactaaaaa aaatgacttg tggtcaaccc ctaagtcttt ttaacgaaga 120300cggggatttc
gtagaagttg aaccgggatc atcctttaag tttctgatac ctaagggatt 120360ttacgcctct
ccttccgtaa agacgagtct agtattcgag acattaacaa cgaccgataa 120420taaaatcact
agtatcaatc caacaaatgc gccaaagtta tatcctcttc aacgcaaagt 120480cgtatctgaa
gtagtttcta atatgaggaa aatgatcgaa tcaaaacgtc ctctatacat 120540tactcttcac
ttggcgtgtg gatttggtaa gactattacc acgtgttatc ttatggctac 120600acacggtaga
aaaaccgtca tttgcgtacc caataaaatg ttaatacatc aatggaagac 120660acaggtagag
gcagtcggat tggaacataa gatatccata gatggagtaa gtagtctatt 120720aaaggaacta
aagactcaaa gtccggatgt attaatagta gtcagtagac atctgacaaa 120780cgatgccttt
tgtaaatata tcaataagca ttatgatttg ttcatcttgg atgaatcaca 120840tacgtataat
ctgatgaaca atacagcagt tacaagattt ttagcgtatt atcctccgat 120900gatgtgttat
tttttaactg ctacacctag accatctaac cgaatttatt gtaacagtat 120960tattaatatt
gccaagttat ccaatctaaa aaaaactatc tatgcagtag atagtttttt 121020tgagccatat
tccacagata atattagaca tatggtaaaa cgactagatg gaccatctaa 121080taaatatcat
atatataccg agaagttatt atctgtagac gagcctagaa atcaacttat 121140tcttgatacc
ctggtagaag aattcaagtc aggaactatt aatcgcattt tagttattac 121200taaactacgt
gaacatatgg tattattcta caaacgatta ttagattttt tcggaccaga 121260ggttgtattt
ataggagacg cccaaaatag acgtactcca gatatggtca aatcaatcaa 121320ggaactaaat
agatttatat tcgtatccac cttattttat tccggtactg gtttagatat 121380tcctagtttg
gattcgttgt tcatttgctc ggcagtaatc aacaatatgc aaatagagca 121440attactaggg
agggtatgtc gagaaacaga actattagat aggacggtat atgtatttcc 121500taacacatcc
atcaaagaaa taaagtacat gataggaaat ttcatgcaac gaattattag 121560tctgtctgta
gataaactag gatttaaaca aaaaagttat cggaaacatc aagaatccga 121620tcccacttct
gcatgtacaa catcatccag agaagaacgt gtattaaata gaatatttaa 121680ctcgcaaaat
cgttaagaag tttaagcgac gatccgcatg ctgcgcaggc cagtgtatta 121740cccctcatag
tattaatata atccaatgat acttttgtga tgtcggaaat cttaaccaat 121800ttagactgac
aggcagaaca cgtcatgcaa tcatcatcgt catcgataac tgtagtcttg 121860ggcttctttt
tgcgactctt cattccggaa cgcacattgg tgctatccat ttaggtagta 121920aaaaataagt
cagaatatgc cctataacac gatcgtgcaa aacctggtat atcgtctcta 121980tctttatcac
aatatagtgt atcgacattt ttattattat tgacctcgtt tatcttggaa 122040catggaatgg
gaacattttt gttatcaacg gccatctttg ccttaattcc agatgttgta 122100aaattataac
taaacagtct atcatcgaca caaatgaaat tcttgtttag acgtttgtag 122160tttacgtatg
cggctcgttc gcgtctcatt ttttcagata ttgcaggtac tataatatta 122220aaaataagaa
tgaaataaca taggattaaa aataaagtta tcatgacttc tagcgctgat 122280ttaactaact
taaaagaatt acttagtctg tacaaaagtt tgagattttc agattctgcg 122340gctatagaaa
agtataattc tttggtagaa tggggaacat ctacttactg gaaaataggc 122400gtgcaaaagg
tagctaatgt cgagacgtca atatctgatt attatgatga ggtaaaaaat 122460aaaccgttta
atattgatcc gggctattac attttcttac cggtatattt tgggagcgtc 122520tttatttatt
cgaagggtaa aaatatggta gaacttggat ctggaaactc ttttcaaata 122580ccagatgata
tgcgaagtgc gtgtaacaaa gtattagaca gcgataacgg aatagacttt 122640ctgagatttg
ttttgttaaa caatagatgg ataatggaag atgctatatc aaaatatcag 122700tctccagtta
atatatttaa actagctagt gagtacggat taaacatacc caaatattta 122760gaaattgaaa
tagaggaaga cacattattt gacgacgagt tatactctat tatagaacgc 122820tctttcgatg
ataaatttcc aaaaatatcc atatcgtata ttaagttggg agaacttaga 122880cggcaagttg
tagacttttt caaattctca ttcatgtata ttgagtccat caaggtagat 122940cgtataggag
ataatatttt tattcctagc gttataacaa aatcaggaaa aaagatatta 123000gtaaaagatg
tagaccattt aatacgatcc aaggttagag aacatacatt tgtaaaagta 123060aaaaagaaaa
acacattttc cattttatac gactatgatg gaaacggaac agaaactaga 123120ggagaagtaa
taaaacgaat tatagacact ataggacgag actattatgt taacggaaag 123180tatttctcta
aggttggtag tgcaggctta aagcaattga ctaataaatt agatattaat 123240gagtgcgcaa
ctgtcgatga gttagttgat gagattaata aatccggaac tgtaaaacga 123300aaaataaaaa
accaatcagc atttgattta agcagagaat gtttgggata tccagaagcg 123360gattttataa
cgttagttaa taacatgcgg ttcaaaatag aaaattgtaa ggttgtaaat 123420ttcaatattg
aaaatactaa ttgtttaaat aacccgagta ttgaaactat atatggaaac 123480tttaaccagt
tcgtctcaat ctttaatgtc gtcaccgatg tcaaaaaaag attattcgag 123540tgaaataata
tgcgcctttg atataggtgc aaaaaatcct gccagaactg ttttagaagt 123600caaggataac
tccgttaggg tattggatat atcaaaatta gactggagtt ctgattggga 123660aaggcgcata
gctaaagatt tgtcacaata tgaatacact acagttcttc tagaacgtca 123720gcctagaagg
tcgccgtatg ttaaatttat ctattttatt aaaggctttt tatatcatac 123780atcggctgcc
aaagttattt gcgtctcgcc tgtcatgtct ggtaattcat atagagatcg 123840aaaaaagaga
tcggtcgaag catttcttga ttggatggac acattcggat tgcgagactc 123900cgttccggat
agacgcaaat tagacgatgt agcggatagt ttcaatttgg ctatgagata 123960cgtattagat
aaatggaata ctaattatac accttataat aggtgtaaat ctagaaatta 124020cataaaaaaa
atgtaataac gttagtaacg ccattatgga taatctattt acctttctac 124080atgaaataga
agatagatat gccagaacta tttttaactt tcatctaata agttgcgatg 124140aaataggaga
tatatatggt cttatgaaag aacgcatttc ctcagaggat atgtttgata 124200atatagtgta
taataaagat atacatcctg ccattaagaa actagtgtat tgcgacatcc 124260aacttactaa
acacattatt aatcagaata cgtatccggt atttaacgat tcttcacaag 124320tgaaatgttg
tcattatttc gacataaact cagataatag caatattagc tctcgtacag 124380tagagatatt
tgagagggaa aagtcatctc ttgtatcata tattaaaact accaataaga 124440agagaaaggt
caattacggc gaaataaaga aaactgttca tggaggcact aatgcaaatt 124500acttttccgg
taaaaagtct gacgagtatc tgagtactac agttagatcc aacattaatc 124560aaccttggat
caaaaccatc tctaagagga tgagagttga tatcattaat cactctatag 124620taacgcgtgg
aaaaagctct atattacaaa ctatagaaat tatttttact aatagaacat 124680gtgtgaaaat
attcaaggat tctactatgc acattattct atccaaggac aaggatgaaa 124740aggggtgtat
acacatgatt gacaaattat tctatgtcta ttataattta tttctgttgt 124800tcgaagatat
catccaaaac gagtacttta aagaagtagc taatgttgta aaccacgtac 124860tcacggctac
ggcattagat gagaaattat tcctaattaa gaaaatggct gaacacgatg 124920tttatggagt
tagcaatttc aaaataggga tgtttaacct gacatttatt aagtcgttgg 124980atcataccgt
tttcccctct ctgttagatg aggatagcaa aataaagttt tttaagggga 125040aaaagctcaa
tattgtagca ttacgatctc tggaggattg tataaattac gtgactaaat 125100ccgagaatat
gatagaaatg atgaaggaaa gatcgactat tttaaatagc atagatatag 125160aaacggaatc
ggtagatcgt ctaaaagaat tgcttctaaa atgaaaaaaa acactaattc 125220agaaatggat
caacgactag ggtataagtt tttggtgcct gatcctaaag ccggagtttt 125280ttatagaccg
ttacatttcc aatatgtatc gtattctaat tttatattgc atcgattgca 125340tgaaatcttg
accgtcaagc ggccactctt atcgtttaag aataatacag aacgaattat 125400gatagaaatt
agcaatgtta aagtgactcc tccagattac tcacctataa tcgcgagtat 125460taaaggtaag
agttatgacg cattagccac gttcactgta aatatcttta aagaggtaat 125520gaccaaagag
ggtatatcca tcactaaaat aagtagttat gagggaaaag attctcattt 125580gataaaaatt
ccgctactaa taggatacgg gaataaaaat ccacttgata cagccaagta 125640tcttgttcct
aatgtcatag gtggagtctt tatcaataaa caatctgtcg aaaaagtagg 125700aattaatcta
gtagaaaaga ttacaacatg gccaaaattt agggttgtta agccaaactc 125760attcactttc
tcgttttcct ccgtatcccc tcctaatgta ttaccgacaa gatatcgcca 125820ttacaagata
tctctggata tatcacaatt ggaagcgttg aatatatcat cgacaaagac 125880atttataacg
gtcaatattg ttttgctgtc tcaatattta tctagagtga gtctagaatt 125940cattagacgt
agtttatcat acgatatgcc tccagaagtt gtctatctag taaacgcgat 126000aatagatagt
gctaaacgaa ttactgaatc tattactgac tttaatattg atacatacat 126060taatgacctg
gtggaagctg aacacattaa acaaaaatct cagttaacga ttaacgagtt 126120caaatatgaa
atgctgcata actttttacc tcatatgaac tatacacccg atcaactaaa 126180gggattttat
atgatatctt tactaagaaa gtttctctac tgtatcttcc acacttctag 126240atatccagat
agagattcga tggtttgtca tcgcatccta acgtacggca aatattttga 126300gacgttggca
catgatgaat tagagaatta cataggcaac atccgaaacg atatcatgaa 126360caatcacaag
aacagaggca cttacgcggt aaacattcat gtactaacaa ctcccggact 126420taatcacgcg
ttttctagct tattgagtgg aaagttcaaa aagtcagacg gtagttatcg 126480aacacatcct
cactattcat ggatgcagaa tatttctatt cctaggagtg ttggatttta 126540tccggatcaa
gtaaagattt caaagatgtt ttctgtcaga aaataccatc caagtcaata 126600tctttacttt
tgttcatcag acgttccgga aagaggtcct caggtaggtt tagtatctca 126660attgtctgtc
ttgagttcca ttacaaatat actaacgtct gagtatttgg atttggaaaa 126720gaaaatttgt
gagtatatca gatcatatta taaagatgat ataagttact ttgaaacagg 126780atttccaatc
actatagaaa atgctctagt cgcatctctt aatccaaata tgatatgtga 126840ttttgtaact
gactttagac gtagaaaacg gatgggattc ttcggtaact tggaggtagg 126900tattacttta
gttagggatc acatgaatga aattcgcatt aatattggag cgggaagatt 126960agtcagacca
ttcttggttg tggataacgg agagctcatg atggatgtgt gtccggagtt 127020agaaagcaga
ttagacgaca tgacattctc tgacattcag aaagagtttc cgcatgtcat 127080cgaaatggta
gatatagaac aatttacttt tagtaacgta tgtgaatcgg ttcaaaaatt 127140tagaatgatg
tcaaaggatg aaagaaagca atacgattta tgtgactttc ctgccgaatt 127200tagagatgga
tatgtagcat cttcactagt gggaatcaat cacaattctg gacccagagc 127260tattcttgga
tgtgctcaag ctaaacaagc tatctcttgt ctgagttcgg atatacgaaa 127320taaaatagac
aatggaattc atttgatgta tccagagagg ccaatcgtga ttagtaaggc 127380tttagaaact
tcaaagattg cggctaattg cttcggccaa catgttacta tagcattaat 127440gtcgtacaaa
ggtatcaatc aagaggatgg aattatcatc aaaaaacaat ttattcagag 127500aggcggtctc
gatattgtta cagccaagaa acatcaagta gaaattccat tggaaaactt 127560taataacaaa
gaaagagata ggtctaacgc ctattcaaaa ttagaaagta atggattagt 127620tagactgaat
gctttcttgg aatccggaga cgctatggca cgaaatatct catcaagaac 127680tcttgaagat
gattttgcta gagataatca gattagcttc gatgtttccg agaaatatac 127740cgatatgtac
aaatctcgcg ttgaacgagt acaagtagaa cttactgaca aagttaaggt 127800acgagtatta
accatgaaag aaagaagacc cattctagga gacaaattta ccactagaac 127860gagtcaaaag
ggaacagtcg cgtatgtcgc ggatgaaacg gaacttccat acgacgaaaa 127920tggtatcaca
ccagatgtca ttattaattc tacatccatc ttctctagaa aaactatatc 127980tatgttgata
gaagttattt taacagccgc atattctgct aagccgtaca acaataaggg 128040agaaaaccga
cctgtctgtt ttcctagtag taacgaaaca tccatcgata catatatgca 128100attcgctaaa
caatgttatg agcattcaaa tccgaaattg tccgatgaag aattatcgga 128160taaaatcttt
tgtgaaaaga ttctctatga tcctgaaacg gataagcctt atgcatccaa 128220agtatttttt
ggaccaattt attacttgcg tctgaggcat ttaactcagg acaaggcaac 128280cgttagatgt
agaggtaaaa agacgaagct cattagacag gcgaatgagg gacgaaaacg 128340tggaggaggt
atcaagttcg gagaaatgga gagagactgt ttaatagcgc atggtgcagc 128400caatactatt
acagaagttt tgaaagattc ggaagaagat tatcaagatg tgtatgtttg 128460tgaaaattgt
ggagacatag cagcacaaat caagggtatt aatacatgtc ttagatgttc 128520aaaacttaat
ctctctcctc tcttaacaaa aattgatacc acgcacgtat ctaaagtatt 128580tcttactcaa
atgaacgcca gaggcgtaaa agtcaaatta gatttcgaac gaaggcctcc 128640ttcgttttat
aaaccattag ataaagttga tctcaagccg tcttttctgg tgtaatattc 128700tagtttggta
gtagatacat atcaatatca tcaaattcga gatccgaatt ataaaatggg 128760cgtggattgt
taactataga atcggacgtc tgatattcga aaatctgtgg agtttcaggt 128820tttggtggag
gtgtaactgc tacttgggat actgaagtct gatattcaga aagctgtgga 128880tgttctggtt
cggcatccac cgatggtgtc acatcactaa tcggttcggt aacgtctgtg 128940gatggaggtg
ctacttctac agaacctgta gcctcagttg tcaacggaga tacattttta 129000atgcgagaaa
atgtataatt tggtaatggt ttcttatgtg gatctgaaga agaggtaaga 129060tatctactag
aaagataccg atcacgttct agttctcttt tgtagaactt aactttttct 129120ttctccgcat
ctagttgata ttccaacctc ttcacgttac tacgttcaga ttccaattca 129180cgttcgcatg
ggttacctcc gcagttttta cgagcgattt cacgttcagc cttcatgcgt 129240ctctccctct
ctctatcgag tttatcagag cagtctttct gaaggcgatc gaactccata 129300aatttctcca
acgctttgat tgtttccata gatttccgaa gttcagcttt taggactgtg 129360attctttttc
tttcgaattc acagctggat gtacaaccgt ttccattacc gccatctcta 129420agtttctttt
ctagatcggc aacatttcat ccccatgcct tttacattcc tcgagtctac 129480tgtcgtcgaa
atatcgttcc agctcctttt cgacatcaat aactttagca cgttgtctct 129540caagctctct
tttgtagtta tctgattccc tggcacgttt aagatcttca tgcaattgag 129600tcagctctta
acttcctctc ttgcttcttc gtcatagtac gcgcaatcac tgtgagatcc 129660attgttacca
cgtctacact cggcgagctc gcgtttaaga gattcaattt cccgtttgta 129720ttggtccatg
tttccattgc taccaccatt agatttacag gctgctagtt gtcgttcgag 129780atcagaaata
cgggttttct tggaattgat ttcgtcgatg tacttggcat cgaaacactt 129840attaagttct
ttttccaatt ctacgatttt atttctttcg cgagtcaatt ccctcctgta 129900gtaactatct
gttttgtcag attcacgctc tctacgtaga ctttcttgca agttactaat 129960ttgttcccta
gcacgtccga gtttagtttt atatgctgaa tagagttctg attcatcctt 130020tgagcagatc
tctagcgatc gtttaagatt cctaattcta gtctttagcc tatttacctc 130080ctcagaagat
gttccgttac cgttgcgttt acactcgtta agctgtctat caagatccat 130140gattctatct
ctaagacgtt gcatctctct ttccatatca gcattgcttt cattattacg 130200tctgcagtca
ctcaactgtc tttcaatatc tgagattcta tctctaagac gtcgcatctc 130260tctctgtttc
ggcattggtt tcattattac gtctacagtc gttcaactgt ctttcaagat 130320ctgatattct
agattggagt ctgctaatct ctgtagcatt ttcacggcat tcactcagtt 130380gtctttcaag
atctgaaatt ttagattgga gtctgctaat ctctgtaaga tttcctcctc 130440cgctctcgat
gcagtcggtc aacttattct ctagttctct aatacgcgaa cgcagtgcat 130500caacttcttg
cgtgtcttcc tggttgcgtg tacattcatc gagtctagat tcgagatctc 130560taacgcgtcg
tcgttcttcc tcaagttctc tgcgtactac agaaagcgtg tccttatctt 130620gttgatattt
agcaatttct gattctagag tactgatttt gcttacgtag ttactaatat 130680ttgtcttggc
cttatcaaga tcctccttgt atttgtcgca ttccttgata tccctacgaa 130740gtctggacag
ttcccattcg acattacgac gtttatcgat ttcagctcgg agatcgtcat 130800cgcgttgttt
tagccacata cgactgagtt caagttctcg ttgacaagat ccatctactt 130860ttccattcct
aatagtatcc agttcctttt ctagttctga acgcatttct cgttccctat 130920caagcgattc
tctcaattct cggatagtct tcttatcaat ttctaataaa tctgaaccat 130980catctgtccc
attttgaata tccctgtgtt ctttgatctc ttttgtaagt cggtcgattc 131040tttcggtttt
ataaacagaa tccctttcca aagtcctaat cttactgagt ttatcactaa 131100gttctgcatt
caattcggtg agttttctct tggcttcttc caactctgtt ttaaactctc 131160cactatttcc
gcattcttcc tcgcatttat ctaaccattc aattagttta ttaataacta 131220gttggtaatc
agcgattcct atagccgttc ttgtaattgt gggaacataa ttaggatctt 131280ctaatggatt
gtatggcttg atagcatcat ctttatcatt attaggggga tggacaacct 131340taattggttg
gtcctcatct cctccagtag cgtgtggttc ttcaatacca gtgttagtaa 131400taggcttagg
caaatgcttg tcgtacgcgg gcacttcctc atccatcaag tatttataat 131460cgggttctac
ttcagaatat tcttttctaa gagacgcgac ttcgggagtt agtagaagaa 131520ctctgtttct
gtatctatca acgctggaat caatactcaa gttaaggata gcgaatacct 131580catcgtcatc
atccgtatct tctgaaacac catcatatga catttcatga agtctaacgt 131640attgataaat
agaatcagat ttagtattaa acagatcctt aaccttttta gtaaacgcat 131700atgtatattt
tagatctcca gatttcataa tatgatcaca tgccttaaat gtcagtgctt 131760ccatgatata
atctggaaca ctaatgggtg acgaaaaaga tacagcacca tatgctacgt 131820tgataaataa
atctgaacca ctaagtagat aatgattaat gttaagaaag aggaaatatt 131880cagtgtatag
gtatgtcttg gcgtcatatc ttgtactaaa cacgctaaac agtttgttaa 131940tgtgatcaat
ttccaataga ttaattagag cagcgggaat accaacaaac atattaccac 132000atccgtattt
tctatgaata tcacatatca tgttaaaaaa tcttgataga agagcgaata 132060tctcgtctga
cttaatgagt cgtagttcag cagcaacata agtcataact gtaaatagaa 132120catactttcc
tgtagtgttg attctagact ccacatcaac accattatta aaaatagttt 132180tatatacatc
tttaatctgc tctccgttaa tcgtcgaacg ttctagtata cggaaacact 132240ttgatttctt
atctgtagtt aatgacttag tgatatcacg aagaatatta cgaattacat 132300ttcttgtttt
tcttgagaga cctgattcag aactcaactc atcgttccat agtttttcta 132360cctcagtggc
gaaatctttg gagtgcttgg tacatttttc aataaggttc gtgacctcca 132420tttattataa
aaaatttatt caaaacttaa ctacaatcgg gtaattataa aatcgtagat 132480ctcccatgtg
gcggaatact accatctatc gcatgtggat ggacagtagg taatggccat 132540gggaacagta
atgtttgcat atttatcttt cttgccagta ttactgcata ttgtcccaat 132600gtttcgatgt
gatgttctaa cctatcaact gccgctgtat cacaacaata gtgtccgatg 132660aaattaagat
tatgatccaa tgtgtttaat atatgattat caagtcttat acgatccgcg 132720tcttttttga
caggatcagg ttcttctaca ggaagaagtt tcggcctctt atgatattca 132780tgtctgggaa
acggtggtct agggtgaggc tccggtatcg gagtgggttt tggattataa 132840tcatcatcgt
ctatgacatc atcttcgact tcgatattta ttttgctatc ttgatgatgt 132900cctgtatcag
ttgcattttc agcactcgac tgaatattag cgcattcatt gtctattatt 132960accatatttc
taaacccaaa atgtatgtgt tgaacatcag tactatcgtt gatgagtctt 133020atagcatgaa
ttcgcttatc gttatcgggt ttatcttctg tcaccttagc aattcctttt 133080ttattaaact
ctacataatc atatccattt ctattgtttg ttctaatata aacgagtata 133140gcatcattgc
taaatttttc aatagtatca aaaacagaat atcctaaacc atataatata 133200tattcaggaa
cactcaaact aaatgtccag gattctccta aatacgtaaa ctttaatagt 133260gcgaaatcat
tcaaaaatct accacttata gatagatagt acataaatgc gtatagtagt 133320ctacctatct
ctttattatg aaaaccggca ttacgatcat atatgtcgtg atatacctgt 133380gatccgttta
cgttaaacca taaatacatg ggtgatccta taaacatgaa tttatttcta 133440attctcagag
ctatagttaa ttgaccgtgt aatatttgct tacatgcata cttgatacgc 133500ttattaataa
gatttttatc attgctcgtt atttcagaat cgtatatata aggagtacca 133560tcgtgattct
taccagatat tatacaaaat actatatata aaatatattg acccacgtta 133620gtaatcatat
aaatgtttaa cgttttaaat tttgtattca atgatccatt atcatacgct 133680atcatggtct
tgtaatattc attctttaaa atataatatt gtgttagcca ttgcattgga 133740gctcctaatg
gagattttct attctcatcc attttaggat aggctttcat aaagtcccta 133800ataacttcgt
gaataatgtt tctatgtttt ctactgatgc atgtatttgc ttcgattttt 133860ttatcccatg
tttcatctat catagattta aacgcagtaa tgctcgcaac attaacatct 133920tgaaccgttg
gtacaattcc gttccataaa tttataatgt tcgccattta tataactcat 133980tttttgaata
tacttttaat taacaaaaga gttaagttac tcatatggac gccgtccagt 134040ctgaacatca
atctttttag ccagagatat catagccgct cttagagttt cagcgtgatt 134100ttccaaccta
aatagaactt catcgttgcg tttacaacac ttttctattt gttcaaactt 134160tgttgttaca
ttagtaatct ttttttccaa attagttagc cgttgtttga gagtttcctc 134220attgtcgtct
tcatcggctt taacaattgc ttcgcgttta gcctctggct ttttagcagc 134280ctttgtagaa
aaaaattcag ttgctggaat tgcaagatcg tcatctccgg ggaaaagagt 134340tccgtccatt
taaagtacag attttagaaa ctgacactct gcgttattta tatttggtac 134400aacacatgga
ttataaatat tgatgttaat aacatcagaa aatgtaaagt ctatacattg 134460ttgcatcgtg
ttaaattttc taatggatct agtattattg ggtccaactt ctgcctgaaa 134520tccaaatatg
gaagcggata caaaaccgtt tcctggataa accacacatc tccacttttg 134580ctttacatca
gaaattgtgt cgttgacatc ttgaactctc ctatctaatg ccggtgttcc 134640acctatagat
tttgaatatt cgaatgctgc atgagtagca ttaaattcct taatattgcc 134700ataattttca
tatattgagt aaccctggat aaaaagtaaa cacaccgcag ccgtcgctac 134760cacaataaaa
aaaattgata gagagttcat ttataatcta ttagaagctg acaaaatttt 134820tttacacgca
tcagacaatg ctttaataaa tagttcaaca tctacttttg tcatatcgaa 134880ccgatggtat
gattctaacc tagaattaca tccgaaaaag ttgactatgt tcatagtcat 134940taagtcatta
acaaacaaca ttccagactc tggattataa gacgatactg tttcgtcaca 135000attacctacc
ttaatcatgt gattatgaat attggctatt agagcacctt ctaagaaatc 135060tataatatct
ttgaaacacg atttaaaatc aaaccacgaa tatacttcta cgaagaaagt 135120tagtttaccc
ataggagaaa taactataaa tggagatcta aatacaaaat ccggatctat 135180gatagtttta
acattattat attctctatt aaatacctcc acatctaaaa atgttaattt 135240tgaaactatg
tcttcgttta ttaccgtacc tgaactaaac gctataagct ctattgtttg 135300agaactcttt
aaacgatatt cttgaaatac atgtaacaaa gtttccttta actcggtcgg 135360tttatctacc
atagttacag aatttgtatc cttatctata atataataat caaaatcgta 135420taaagttata
taattatcgc gttcagattg ggatcttttc aaatagacta aaaaccccat 135480ttctctagta
agtatcttat gtatatgttt gtaaaatatc ttcatggtgg gaatatgctc 135540taccgcagtt
agccattcct cattgacagc ggtagatgta ttagacaaaa ctattccaat 135600gtttaacaag
ggccatttta cgagattatt aaatccttgt ttgataaatg tagccaatga 135660gggttcgagt
tcaacgacga ttgaattctc ttcccgcgga tgctgcatga tgaacgacgg 135720gatgttgttc
gattgatttg gaattctttt tcgacttttt gtttatatta aatattttaa 135780aatttatagc
ggatagcaat tcatgtacca cggataatgt agacgcgtat tgcgcatcga 135840tatctttatt
attagataaa tttatcaata aatgtgagaa gtttgcctcg ttaaggtctt 135900ccatttaaat
attatataaa catttgtgtt tgtaacttat tcgtctttta tggaatagtt 135960ttttactagt
aaagctgcaa ttacacactt tgtccgtaaa acataaatat aaacaccagc 136020ttttatcaat
cgttccaaaa agtcgacggc ggacattttt aacatggcat ctattttaaa 136080tacacttagg
tttttggaaa aaacatcatt ttataattgt aacgattcaa taactaaaga 136140aaagattaag
attaaacata agggaatgtc atttgtattt tataagccaa agcattctac 136200cgttgttaaa
tacttgtctg gaggaggtat atatcatgat gatttggttg tattggggaa 136260ggtaacaatt
aataatctaa agatgatgct attttacatg gatttatcat atcatggagt 136320gacaagtagt
ggagcaattt acaaattggg atcgtctatc gatagacttt ctctaaatag 136380gactattgtt
acaaaagtta ataattatga tgatacattt tttgacgacg atgattgatc 136440gctattgcac
aattttgttt ttgtactttc taatatagtg tttaggttct ttttcatatg 136500agaatattga
tttactaaaa tatctatgtt taacttttgt tctatgacgt ccttatcggc 136560ggtatcggta
catatacgta attcaccttc acaaaatacg gagtcttcga taataatagc 136620caatcgatta
ttggatctag ctgtctgtat catattcaac atgtttaata tatcctttcg 136680tttccccttt
acaggcatcg atcgtagcat attttccgcg tctgatatgg aaatgttaaa 136740actacaaaaa
tgcgtaatgt tagcccgtcc taatattggt acgtgtctat aagtttggca 136800tagtagaata
atagacgtgt ttaaatgcct tccaaagttt aagaattcta ttagagtatt 136860gcattttgat
agtttatcgc ctacatcatc aaaaataagt aaaaagtgtg ctgatttttt 136920atgattttgt
gcgacagcaa tacatttttc tatgttactt ttagttcgta tcagattata 136980ttctagagat
tcctgactac taacgaaatt aatatgattt ggccaaatgt atccatcata 137040atctgggtta
taaacgggtg taaacaagaa tatatgttta tattttttaa ctagtgtaga 137100aaacagagat
agtaaataga tagtttttcc agatccagat cctcctgtta aaaccattct 137160aaacggcatt
tttaataaat tttctcttga aaattgtttt tcttggaaac aattcataat 137220tatatttaca
gttactaaat taatttgata ataaatcaaa atatggaaaa ctaaggttgt 137280tagtagggag
gagaacaaag aaggcacatc gtgatataaa taacatttat tatcatgatg 137340acaccagaaa
acgacgaaga gcagacatct gtgttctccg ctactgttta cggagacaaa 137400attcagggaa
agaataaacg caaacgcgtg attggtctat gtattagaat atctatggtt 137460atttcactac
tatctatgat taccatgtcc gcgtttctca tagtgcgcct aaatcaatgc 137520atgtctgcta
acgaggctgc tattactgac gccgctgttg ccgttgctgc tgcatcatct 137580actcatagaa
aggttgcgtc tagcactaca caatatgatc acaaagaaag ctgtaatggt 137640ttatattacc
agggttcttg ttatatatta cattcagact accagttatt ctcggatgct 137700aaagcaaatt
gcactgcgga atcatcaaca ctacccaata aatccgatgt cttgactacc 137760tggctcattg
attatgttga ggatacatgg ggatctgatg gtaatccaat tacaaaaact 137820acatccgatt
atcaagattc tgatgtatca caagaagtta gaaagtattt ttgtgttaaa 137880acaatgaact
aatatttatt tttgtacatt aataaatgaa atcgcttaat agacaaactg 137940taagtaggtt
taagaagttg tcggtgccgg ccgctataat gatgatactc tcaaccatta 138000ttagtggcat
aggaacattt ctgcattaca aagaagaact gatgcctagt gcttgcgcca 138060atggatggat
acaatacgat aaacattgtt atttagatac taacattaaa atgtctacag 138120ataatgcggt
ttatcagtgt cgtaaattac gagctagatt gcctagacct gatactagac 138180atctgagagt
attgtttagt attttttata aagattattg ggtaagttta aaaaagacca 138240atgataaatg
gttagatatt aataatgata aagatataga tattagtaaa ttaacaaatt 138300ttaaacaact
aaacagtacg acggatgctg aagcgtgtta tatatacaag tctggaaaac 138360tggttaaaac
agtatgtaaa agtactcaat ctgtactatg tgttaaaaaa ttctacaagt 138420gacaacaaaa
aatgaattaa taataagtcg ttaacgtacg ccgccatgga cgccgcgttt 138480gttattactc
caatgggtgt gttgactata acagatacat tgtatgatga tctcgatatc 138540tcaatcatgg
actttatagg accatacatt ataggtaaca taaaaactgt ccaaatagat 138600gtacgggata
taaaatattc cgacatgcaa aaatgctact ttagctataa gggtaaaata 138660gttcctcagg
attctaatga tttggctaga ttcaacattt atagcatttg tgccgcatac 138720agatcaaaaa
ataccatcat catagcatgc gactatgata tcatgttaga tatagaagat 138780aaacatcagc
cattttatct attcccatct attgatgttt ttaacgctac aatcatagaa 138840gcgtataacc
tgtatacagc tggagattat catctaatca tcaatccttc agataatctg 138900aaaatgaaat
tgtcgtttaa ttcttcattc tgcatatcag acggcaatgg atggatcata 138960attgatggga
aatgcaatag taatttttta tcataaaagt tgtaaagtaa ataataaaac 139020aataaatatt
gaactagtag tacgtatatt gagcaatcag aaatgatgct ggtacctctt 139080atcacggtga
ccgtagttgc gggaacaata ttagtatgtt atatattata tatttgtagg 139140aaaaagatac
gtactgtcta taatgacaat aaaattatca tgacaaaatt aaaaaagata 139200aagagttcta
attccagcaa atctagtaaa tcaactgata gcgaatcaga ctgggaggat 139260cactgtagtg
ctatggaaca aaacaatgac gtagataata tttctaggaa tgagatattg 139320gacgatgata
gcttcgctgg tagtttaata tgggataacg aatccaatgt tatggcgcct 139380agcacagaac
acatttacga tagtgttgct ggaagcacgc tgctaataaa taatgatcgt 139440aatgaacaga
ctatttatca gaacactaca gtagtaatta atgaaacgga gactgttgaa 139500gtacttaatg
aagataccaa acagaatcct aactattcat ccaatccttt cgtaaattat 139560aataaaacca
gtatttgtag caagtcaaat ccgtttatta cagaacttaa caataaattt 139620agtgagaata
atccgtttag acgagcacat agcgatgatt atcttaataa gcaagaacaa 139680gatcatgaac
acgatgatat agaatcatcg gtcgtatcat tggtgtgatt agtttccttt 139740ttataaaatt
gaagtaatat ttagtattat tgctgccgtc acgttgtaca aatggagata 139800ttccctgtat
tcggcatttc taaaattagc aattttattg ctaataatga ctgtagatat 139860tatatagata
cagaacatca aaaaattata tctgatgaga tcaatagaca gatggatgaa 139920acggtacttc
ttaccaacat cttaagcgta gaagttgtaa atgacaatga gatgtaccat 139980cttattcctc
atagattatc gacgattata ctctgtatta gttctgtcgg aggatgtgtt 140040atctctatag
ataatgacat caatggcaaa aatattctaa cctttcccat tgatcatgct 140100gtaatcatat
ccccactgag taaatgtgtc gtagttagca agggtcctac aaccatattg 140160gttgttaaag
cggatatacc tagcaaacga ttggtaacat cgtttacaaa cgacatacta 140220tatgtaaaca
atctgtcact gattaattat ttgccgttgt ctgtattcat tattagacga 140280gtcaccgact
atttggatag acacatatgc gatcagatat ttgctaataa taagtggtat 140340tcccttataa
ccatcgacga taagcaatat cctattccat caaactgtat aggtatgtcc 140400tctgccaagt
acataaattc tagcatcgag caagatactt taatccatgt ttgtaacctc 140460gagcatccgt
tcgactcagt atacaaaaaa atgcagtcgt acaattctct acctatcaag 140520gaacaaatat
tgtacggtag aattgataat ataaatatga gcattagtat ttctgtggat 140580taatagattt
ctagtatggg gatcattaat catctctaat ctctaaatac ctcataaaac 140640gaaaaaaaag
ctattatcaa atactgtacg gaatggattc attctcttct ctttttatga 140700aactctgttg
tatatctact gataaaactg gaagcaaaaa atctgataga aagaataaga 140760ataagatcaa
ggattatatg gaacacgatt attataaaat aacaatagtt cctggttcct 140820cttccacgtc
tactagctcg tggtattata cacatgccta gtaatagtct ctttgcgttg 140880acggaaagca
gactagaaat aacaggctaa aatgttcaga caccataata gttcccaacc 140940cagataataa
cagagttcca tcaacacatt cctttaaact caatcccaaa cccaaaaccg 141000ttaaaatgta
tccggccaat tgatagtaga taatgaggtg tacagcgcat gataatttac 141060acagtaacca
aaatgaaaat actttagtaa ttataagaaa tatagacggt aatgtcatca 141120tcaacaatcc
gataatatgc ctgagagtaa acattgacgg ataaaacaaa aatgctccgc 141180ataactctat
catggcaata acacaaccaa atacttgtaa gattcctaaa ttagtagaaa 141240atacaacgaa
tatcgatgta taagtgatct cgagaaataa taagaataaa gtaatgcccg 141300taaagataaa
catcaacatt gtttggtaat cattaaacca attagtatga agttgaacta 141360atttcacagt
agattttatt ccagtgttat cctcgcatgt ataagtacct ggtaagatat 141420ctttatattc
cataatcaat gagacatcac tatctgataa cgaatgaagt ctagcactag 141480tatgccattt
acttaatatt gtcgtcttgg aagttttatt ataagttaaa atatcatggt 141540tatccaattt
ccatctaata tactttgtcg gattatctat agtacacgga ataatgatgg 141600tatcattaca
tgctgtatac tctatggtct ttgtagttgt tataacaacc aacgtataga 141660ggtatatcaa
cgatattcta actcttgaca ttttttattt atttaaaatg atacctttgt 141720tatttatttt
attctatttt gctaacggta ttgaatggca taagtttgaa acgagtgaag 141780aaataatttc
tacttactta ttagacgacg tattatacac gggtgttaat ggggcggtat 141840acacattttc
aaataataaa ctaaacaaaa ctggtttaac taataataat tatataacaa 141900catctataaa
agtagaggat gcggataagg atacattagt atgcggaacc aataacggaa 141960atcccaaatg
ttggaaaata gacggttcag acgacccaaa acatagaggt agaggatacg 142020ctccttatca
aaatagcaaa gtaacgataa tcagtcacaa cggatgtgta ctatctgaca 142080taaacatatc
aaaagaagga attaaacgat ggagaagatt tgacggacca tgtggttatg 142140atttattcac
ggcggataac gtaattccaa aagatggttt acgaggagca ttcgtcgata 142200aagacggtac
ttatgacaaa gtttacattc ttttcactga tactatcggc tcaaagagaa 142260ttgtcaaaat
tccgtatata gcacaaatgt gcctaaacga cgaaggtggt ccatcatcat 142320tgtctagtca
tagatggtcg acgtttctca aagtcgaatt agaatgtgat atcgacggaa 142380gaagttatag
acaaattatt cattctagaa ctataaaaac agataatgat acgatactat 142440atgtattctt
cgatagtcct tattccaagt ccgcattatg tacctattct atgaatacca 142500ttaaacaatc
tttttctacg tcaaaattgg aaggatatac aaagcaattg ccgtctccag 142560ctcctggtat
atgtttacca gctggaaaag ttgttccaca taccacgttt gaagtcatag 142620aacaatataa
tgtactagat gatattataa agcctttatc taaccaacct atcttcgaag 142680gaccgtctgg
tgttaaatgg ttcgatataa aggagaagga aaatgaacat cgggaatata 142740gaatatactt
cataaaagaa aattctatat attcgttcga tacaaaatct aaacaaactc 142800gtagctcgca
agtcgatgcg cgactatttt cagtaatggt aactgcgaaa ccgttattta 142860tagcagatat
agggatagga gtaggaatgc cacaaatgaa aaaaatactt aaaatgtaat 142920cttaatcgag
tacaccacac gacaatgaac aaacataaga cagattatgc tggttatgct 142980tgctgcgtaa
tatgcggtct aattgtcgga attattttta cagcgacact attaaaagtt 143040gtagaacgta
aattagttca tacaccatta atagataaaa cgataaaaga tgcatatatt 143100agagaagatt
gtcctactga ctggataagc tataataata aatgtatcca tttatctact 143160gatcgaaaaa
cctgggagga aggacgtaat gcatgcaaag ctctaaattc aaattcggat 143220ctaattaaga
tagagactcc aaacgagtta agttttttaa gaagccttag acgaggctat 143280tgggtaggag
aatccgaaat attaaaccag acaaccccat ataattttat agctaagaat 143340gccacgaaga
atggaactaa aaaacggaaa tatatttgta gcacaacgaa tactcccaaa 143400ctgcattcgt
gttacactat ataacaatta cactacattt ttatcatacc actacttcgg 143460ttagatgttt
tagaaaaaaa taaatatcgc cgtaccgttc ttgtttttat aaaaataaca 143520attaacaatt
atcaaatttt ttctttaata ttttacgtgg ttgaccattc ttggtggtaa 143580aataatctct
tagtgttgga atggaatgct gtttaatgtt tccacactca tcgtatattt 143640tgacgtatgt
agtcacatcg tttacgcaat agtcagactg tagttctatc atgcttccta 143700catcagaagg
aggaacagtt ttaaagtctc ttggttttaa tctattaccg ttagttttca 143760tgaaatcctt
tgttttatcc acttcacatt ttaaataaat gtccactata cattcttttg 143820ttaattttac
tagatcgtca tgggtcatag aatttatagg ttccgtagtc catggatcca 143880aactagcaaa
cttcgcgtat acggtatcgc gattagtgta tacaccaact gtatgaaaat 143940taagaaaaca
gtttaataaa tcaacagaaa tatttaatcc tccgtttgat acagatgcgc 144000catatttatg
gatttcggat tcacacgttg tttgtctgag gtgttcgtct agtgttgctt 144060ctacgtaaac
ttcgattccc atatattctt tattgtcaga atcgcatacc gatttatcat 144120catacactgt
ttgaaaacta aatggtatac acatcaaaat aataaataat aacgagtaca 144180ttctgcaata
ttgttatcgt aattggaaaa atagtgttcg agtgagttgg attatgtgag 144240tattggattg
tatattttat tttatatttt gtaataagaa taaaatgcta atgtcaagtt 144300tattccaata
gatgtcttat taaaaacata tataataaat aacaatggct gaatggcata 144360aaattatcga
ggatatctca aaaaataata agttcgagga tgccgccatc gttgattaca 144420agactacaaa
gaatgttcta gctgctattc ctaacagaac atttgccaag attaatccgg 144480gtgaaattat
tcctctcatc actaatcgta atattctaaa acctcttatt ggtcagaaat 144540attgtattgt
atatactaac tctctaatgg atgagaacac gtatgctatg gagttgctta 144600ctgggtacgc
ccctgtatct ccgatcgtta tagcgagaac tcataccgca cttatatttt 144660tgatgggtaa
gccaacaaca tccagacgtg acgtgtatag aacgtgtaga gatcacgcta 144720cccgtgtacg
tgcaactggt aattaaaata aaaagtaata ttcatatgta gtgtcaattt 144780taaatgatga
tgatgaaatg gataatatcc atattgacga tgtcaataat gccggtattg 144840gcatacagtt
catcgatttt tagatttcat tcagaggatg tggaattatg ttatgggcat 144900ttgtattttg
ataggatcta taatgtagta aatataaaat ataatccgca tattccatat 144960agatataatt
ttattaatcg cacgttaacc gtagatgaac tagacgataa tgtctttttt 145020acacatggtt
attttttaaa acacaaatat ggttcactta atcctagttt gattgtctca 145080ttatcaggaa
acttaaaata taatgatata caatgctcag taaatgtatc gtgtctcatt 145140aaaaatttgg
caacgagtac atctactata ttaacatcta aacataagac ttattctcta 145200catcggtcca
cgtgtattac tataatagga tacgattcta ttatatggta taaagatata 145260aatgacaagt
ataatgacat ctatgatttt actgcaatat gtatgctaat agcgtctaca 145320ttgatagtga
ccatatacgt gtttaaaaaa ataaaaatga actcttaatt atgctatgct 145380attagaaatg
gataaaatca aaattacggt tgattcaaaa attggtaatg ttgttaccat 145440atcgtataac
ttggaaaaga taactattga tgtcacacct aaaaagaaaa aagaaaagga 145500tgtattatta
gcgcaatcag ttgctgtcga agaggcaaaa gatgtcaagg tagaagaaaa 145560aaatattatc
gatattgaag atgacgatga tatggatgta gaaagcgcat aatacgatct 145620ataaaaataa
gtatataaat actttttatt tactgtactc ttactgtgta gtggtgatac 145680cctactcgat
tattttttta aaaaaaaaat acttattctg attcttctaa ccatttccgt 145740gttcgttcga
atgccacatc gacgtcaaag ataggggagt agttaaaatc tagttctgca 145800ttgttggtac
acaccttaaa tgtagtgttg gatatcttca acgtatagtt gttgagtagt 145860gatggttttc
taaatagaat tctcttcata tcattcttgc acgcgtacat ttttagcatc 145920catcttggaa
accttaactt tcgaggttat tggttgtgga tcttctacaa tatctatgac 145980tctgatttct
tgaacatcat ctgcactaat taacagtttt actatatacc tgcctagaaa 146040tccggcacca
ccagtaaccg cgtacacggc cattgctgcc actcataata tcagactact 146100tattctattt
tactaaataa tggctgtttg tataatagac cacgataata tcagaggagt 146160tatttacttt
gaaccagtcc atggaaaaga taaagtttta ggatcagtta ttggattaaa 146220atccggaacg
tatagtttga taattcatcg ttacggagat attagtcaag gatgtgattc 146280cataggcagt
ccagaaatat ttatcggtaa catctttgta aacagatatg gtgtagcata 146340tgtttattta
gatacagatg taaatatatc tacaattatt ggaaaggcgt tatctatttc 146400aaaaaatgat
cagagattag cgtgtggagt tattggtatt tcttacataa atgaaaagat 146460aatacatttt
cttacaatta acgagaatgg cgtttgatat atcagttaat gcgtctaaaa 146520caataaatgc
attagtttac ttttctactc agcaaaataa attagtcata cgtaatgaag 146580ttaatgatac
acactacact gtcgaatttg atagggacaa agtagttgac acgtttattt 146640catataatag
acataatgac accatagaga taagaggggt gcttccagag gaaactaata 146700ttggttgcgc
ggttaatacg ccggttagta tgacttactt gtataataag tatagtttta 146760aactgatttt
agcagaatat ataagacaca gaaatactat atccggcaat atttattcgg 146820cattgatgac
actagatgat ttggctatta aacagtatgg agacattgat ctattattta 146880atgagaaact
taaagtagac tccgattcgg gactatttga ctttgtcaac tttgtaaagg 146940atatgatatg
ttgtgattct agaatagtag tagctctatc tagtctagta tctaaacatt 147000gggaattgac
aaataaaaag tataggtgta tggcattagc cgaacatata tctgatagta 147060ttccaatatc
tgagctatct agactacgat acaatctatg taagtatcta cgcggacaca 147120ctgagagcat
agaggataaa tttgattatt ttgaagacga tgattcgtct acatgttctg 147180ccgtaaccga
cagggaaacg gatgtataat tttttttata gcgtgaagga tatgataaaa 147240aatataattg
ttgtatttat cccattccaa tcaccttata tgattctgta acacaataaa 147300ggagtcttat
agatgtatag aggtcagata ctggtttgat aaactgttta ttccacataa 147360gtatgtttga
ctttatggtt agacccgcat actttaacaa atcactgaaa attggagtta 147420ggtattgacc
tctcagaatc agttgccgtt ctggaacatt aaatgtattt tttatgatat 147480actccaacgc
atttatgtgg gcatacaaca agtcattact aatggaatat tccaagagtt 147540ttagttgtct
agtatttaac aagagaagag atttcaacag actgtttatg aactcgaatg 147600ccgcctcatt
gtcgcttata ttgatgatgt cgaattctcc caatatcatc accgatgagt 147660agctcatctt
gttatcggga tccaagtttt ctaaagatgt cattaaaccc tcgatcatga 147720atggatttat
catcatcgtt tttatgttgg acatgagctt agtccgtttg tccacatcta 147780tagaagatga
tttctgaatt atttcatata tctctctctt taactccagg aacttgtcag 147840gatggtctac
tttaatatgt tctcgtctaa gagatgaaaa tctttggatg gttgcacgcg 147900acttttctct
aaaggatgac gttgcccaag atcctctctt aaatgaatcc atcttatcct 147960tggacaagat
ggacagtcta ttttccttag atggtttaat atttttgtta cccatgatct 148020ataaaggtag
acctaatcgt ctcggatgac catatattta ttttcagttt tattatacgc 148080ataaattgta
aaaaatatgt taggtttaca aaaatgtctc gtggggcatt aatcgttttt 148140gaaggattgg
acaaatctgg aaaaacaaca caatgtatga acatcatgga atctataccg 148200gcaaacacga
taaaatatct taactttcct cagagatcca ctgtcactgg aaaaatgata 148260gatgactatc
taactcgtaa aaaaacctat aatgatcata tagttaatct attattttgt 148320gcaaatagat
gggagtttgc atcttttata caagaacaac tagaacaggg aattacttta 148380atagttgata
gatacgcatt ttctggagta gcgtatgccg ccgctaaagg cgcgtcaatg 148440actctcagta
agagttatga atctggattg cctaaacccg acttagttat attcttggaa 148500tctggtagca
aagaaattaa tagaaacgtc ggcgaggaaa tttatgaaga tgttacattc 148560caacaaaagg
tattacaaga atataaaaaa atgattgaag aaggagatat tcattggcaa 148620attatttctt
ctgaattcga ggaagatgta aagaaggagt tgattaagaa tatagttata 148680gaggctatac
acacggttac tggaccagtg gggcaactgt ggatgtaata gtgaaattac 148740attttttata
aatagatgtt agtacagtgt tataaatgga tgaagcatat tactctggca 148800acttggaatc
agtactcgga tacgtgtccg atatgcatac cgaactcgca tcaatatctc 148860aattagttat
tgccaagata gaaactatag ataatgatat attaaacaag gacattgtaa 148920attttatcat
gtgtagatca aacttggata atccatttat ctctttccta gatactgtat 148980atactattaa
aaataactag ttataagttt gaatccgtca attttgattc caaaattgaa 149040tggactgggg
atggtctata caatatatcc cttaaaaatt atggcatcaa gacgtggcaa 149100acaatgtata
caaatgtacc agaaggaaca tacgacatat ccgcatttcc aaagaatgat 149160ttcgtatctt
tctgggttaa atttgaacaa ggcgattata aagtggaaga gtattgtacg 149220ggactatgcg
tcgaagtaaa aattggacca ccgactgtaa cattaactga atacgacgac 149280catatcaatt
tgtacatcga gcatccgtat gctactagag gtagcaaaaa gattcctatt 149340tacaaacgcg
gtgacatgtg tgatatctac ttgttgtata cggctaactt cacattcgga 149400gattctaaag
aaccagtacc atatgatatc gatgactacg attgcacgtc tacaggttgc 149460agcatagact
ttgtcacaac agaaaaagtg tgcgtgacag cacagggagc cacagaaggg 149520tttctcgaaa
aaattactcc atggagttcg aaagtatgtc tgacacctaa aaagagtgta 149580tatacatgcg
caattagatc caaagaagat gttcccaatt tcaaggacaa aatggccaga 149640gttatcaaga
gaaaatttaa tacacagtct caatcttatt taactaaatt tctcggtagc 149700acatcaaatg
atgttaccac ttttcttagc atgcttaact tgactaaata ttcataatta 149760ttttttatta
atgatacaaa aacgaaataa aactgcatat tatacactgg ttaacgccct 149820tataggctct
aaccattttc aagatgaggt ccctgattat agtccttctg ttcccctcta 149880tcatctactc
catgtctatt agacgatgtg agaagactga agaggaaaca tggggattga 149940aaatagggtt
gtgtataatt gccaaagatt tctatcccga aagaactgat tgcagtgttc 150000atctcccaac
tgcaagtgaa ggattgataa ctgaaggcaa tggattcagg gatatacgaa 150060acaccgataa
attataaaaa aagcaatgtg tccgctgttt ccgttaataa tactattttc 150120gtaactggcg
gattattcat aaataactct aatagcacga tcgtggacat ttataaagac 150180aaacaatggt
cgattataga aatggctagg gtatatcacg gcatcgactc gacatttgga 150240atgttatatt
ttgccggagg tctatccgtt accgaacaat atggtaattt agagaaaaac 150300aacgagatat
cttgttacaa tcctagaacg aataagtggt ttgatatttc atatactatt 150360tataagatat
ccatatcatc attgtgtaaa ctaaataacg tcttctatgt atttagtaag 150420gacattggat
atgtggaaaa gtatgatggt gcatggaagt tagtacatga tcgtctcccc 150480gctataaagg
cattatcaac ttctccttat tgattgaaaa tgaaaatata aatagttttt 150540atgtatagca
gtattaccct atagttttat tgcttactac taacatggat acagatgtta 150600caaatgtaga
agatatcata aatgaaatag atagagagaa agaagaaata ctaaaaaatg 150660tagaaattga
aaataataaa aacattaaca agaatcatcc caatgaatat attagagaag 150720cactcgttat
taataccagt agtaatagtg attccattga taaagaagtt atagaatgta 150780tcagtcacga
tgtaggaata tagatcatat ctactaattt ttataatcga tacaaaacat 150840aaaaaacaac
tcgttattac atagcaggca tggaatcctt caagtattgt tttgataacg 150900atggcaagaa
atggattatc ggaaatactt tatattctgg taattcaata ctctataagg 150960tcagaaaaaa
tttcactagt tcgttctaca attacgtaat gaagatagat cacaaatcac 151020acaagccatt
gttgtctgaa atacgattct atatatctgt attggatcct ttgactatcg 151080acaactggac
acgggaacgt ggtataaagt atttggctat tccagatctg tatggaattg 151140gagaaaccga
tgattatatg ttcttcgtta taaagaattc gggaagagta ttcgccccaa 151200aggatactga
atcagtcttc gaagcatgcg tcactatgat aaacacgtta gagtttatac 151260actctcgagg
atttacccat ggaaaaatag aaccgaggaa tatactgatt agaaataaac 151320gtctttcact
aattgactat tctagaacta acaaactata caagagtgga aactcacata 151380tagattacaa
cgaggacatg ataacttcag gaaatatcaa ttatatgtgt gtagacaatc 151440atcttggagc
aacagtttca agacgaggag atttagaaat gttgggatat tgcatgatag 151500aatggttcgg
tggcaaactt ccatggaaaa acgaaagtag tataaaagta ataaaacaaa 151560aaaaagaata
taaaaaattt atagctactt tctttgagga ctgttttcct gaaggaaatg 151620aacctctgga
attagttaga tatatagaat tagtatacac gttagattat tctcaaactc 151680ctaattatga
cagactacgt aaactgttta tacaagattg aaattatatt ctttttttta 151740tagagtgtgg
tagtgttacg gatatctaat attaatatta gactatctct atcgcgctac 151800acgaccaata
tcgattacta tggatatctt ctatgaaagg agagaatgta tttatttctc 151860cagcgtcaat
ctcgtcagta ttgacaatac tgtattatgg agctaatgga tccactgctg 151920aacagctatc
aaaatatgta gaaacggagg agaacacgga taaggttagc gctcagaata 151980tctcattcaa
atccatgaat aaagtatatg ggcgatattc tgccgtgttt aaagattcct 152040ttttgagaaa
aattggcgat aagtttcaaa ctgttgactt cactgattgt cgcactatag 152100atgcaatcaa
caagtgtgta gatatcttta ctgaggggaa aatcaatcca ctattggatg 152160aaccattgtc
tcctagcaat tagtgccgta tactttaaag caaaatggtt gacgccattc 152220gaaaaggaat
ttaccagtga ttatcccttt tacgtatctc cgacggaaat ggtagacgta 152280agtatgatgt
ctatgtacgg caaggcattt aatcacgcat ctgtaaaaga atcattcggc 152340aacttttcaa
tcatagaact gccatatgtt ggagatacta gtatgatggt cattcttcca 152400gacaagattg
atggattaga atccatagaa caaaatctaa cagatacaaa ttttaagaaa 152460tggtgtgact
ttatggatgc tatgtttata gatgttcaca ttcccaagtt taaggtaaca 152520ggctcgtata
atctggtgga tactctagta aagtcaggac tgacagaggt gttcggttca 152580actggagatt
atagcaatat gtgtaattta gatgtgagtg tcgacgctat gatccacaaa 152640acgtatatag
atgtcaatga agagtataca gaagcagctg cagcaacttc tgtactagtg 152700gcagactgtg
catcaacaat tacaaatgag ttctgtgcag atcatccgtt catctatgtg 152760attaggcatg
ttgatggaaa aattcttttc gttggtagat attgctctcc gacaactaat 152820tgttaaccat
tttttttaaa aaaaacaatg ggtgatggat acacttgatg gtataatgat 152880gaatgaacgc
gatgtttctg taagcgttgg caccggaata ctattcatgg aaatgttttt 152940ccgttacaat
aaaaatagta tcaacaatca actaatgtat gatataatta atagcgtatc 153000tataagtgta
gctaattata gatatagaag ctgcttttaa cgacgatggt atatacatcc 153060gtagaaatat
gattaacaag ttgtacggat acgcatctct aactactatt ggcacgatcg 153120ctggaggtgt
ttgttattat ctgttgatgc atctagttag tttgtataaa taattatttc 153180aatatactag
ttaaaatttt aagattttaa atgtataaaa aactaataac gtttttattt 153240gtaataggtg
cattagcatc ctattcgaat aatgagtaca ctccgtttaa taaactgagt 153300gtaaaactct
atatagatgg agtagataat atagaaaatt catatactga tgataataat 153360gaattggtgt
taaattttaa agagtacaca atttctatta ttacagagtc atgcgacgtc 153420ggatttgatt
ccatagatat agatgttata aacgactata aaattattga tatgtatacc 153480attgactcgt
ctactattca acgcagaggt cacacgtgta gaatatctac caaattatca 153540tgccattatg
ataagtaccc ttatattcac aaatatgatg gtgatgagcg acaatattct 153600attactgcag
agggaaaatg ctataaagga ataaaatatg aaataagtat gatcaacgat 153660gatactctat
tgagaaaaca tactcttaaa attggatcta cttatatatt tgatcgtcat 153720ggacatagta
atacatatta ttcaaaatat gatttttaaa aatttaaaat atattatcac 153780ttcagtgaca
gtagtcaaat aacaaacaac accatgagat atattataat tctcgcagtt 153840ttgttcatta
atagtataca cgctaaaata actagttata agtttgaatc cgtcaatttt 153900gattccaaaa
ttgaatggac tggggatggt ctatacaata tatcccttaa aaattatggc 153960atcaagacgt
ggcaaacaat gtatacaaat gtaccagaag gaacatacga catatccgca 154020tttccaaaga
atgatttcgt atctttctgg gttaaatttg aacaaggcga ttataaagtg 154080gaagagtatt
gtacgggact atgcgtcgaa gtaaaaattg gaccaccgac tgtaacattg 154140actgaatacg
acgaccatat caatttgtac atcgagcatc cgtatgctac tagaggtagc 154200aaaaagattc
ctatttacaa acgcggtgac atgtgtgata tctacttgtt gtatacggct 154260aacttcacat
tcggagattc taaagaacca gtaccatatg atatcgatga ctacgattgc 154320acgtctacag
gttgcagcat agactttgtc acaacagaaa aagtgtgcgt gacagcacag 154380ggagccacag
aagggtttct cgaaaaaatt actccatgga gttcgaaagt atgtctgaca 154440cctaaaaaga
gtgtatatac atgcgcaatt agatccaaag aagatgttcc caatttcaag 154500gacaaaatgg
ccagagttat caagagaaaa tttaatacac agtctcaatc ttatttaact 154560aaatttctcg
gtagcacatc aaatgatgtt accacttttc ttagcatgct taacttgact 154620aaatattcat
aactaatttt tattaatgat acaaaaacga aataaaactg catattatac 154680actggttaac
gcccttatag gctctaacca ttttcaagat gaggtccctg attatagtcc 154740ttctgttccc
ctccatgtct attagacgat gtgagaagac tgaagaggaa acatggggat 154800tgaaaatagg
gttgtgtata attgccaaag atttttatcc cgaaagaact gattgcagtg 154860ttcatctccc
aactgcaagt gaaggattga taactgaagg caatggattc agggatatac 154920gaaacaccga
taaattataa aaaaagcaat gtgtccgctg tttccgttaa taatactatt 154980ttcgtaactg
gcggattatt cataaataac tctaatagca cgatcgtgga catttataaa 155040gacaaacaat
ggtcgattat agaaatggct agggtatatc acggcatcga ctcgacattt 155100ggaatgttat
attttgccgg aggtctatcc gttaccgaac aatatggtaa tttatagaaa 155160aacaacgaga
tatcttgtta caatcctaga acgaataagt ggtttgatat ttcatatact 155220atttataaga
tatccatatc atcattgtgt aaactaaata acgtcttcta tgtatttagt 155280aaggacattg
gatatgtgga aaagtatgat ggtgcatgga agttagtaca tgatcgtctc 155340cccgctataa
aggcattatc aacttctcct tattgattga aaatgaaaat ataaatagtt 155400tttatgtata
gcagtattac cctatagttt tattgcttac tactaacatg gatacagatg 155460ttacaaatgt
agaagatatc ataaatgaaa tagatagaga gaaagaagaa atactaaaaa 155520atgtagaaat
tgaaaataat aaaaacatta acaagaatca tcccaatgaa tatattagag 155580aagcactcgt
tattaatacc agtagtaata gtgattccat tgataaagaa gttatagaat 155640gtatcagtca
cgatgtagga atatagatca tatctactaa tttttataat cgatacaaaa 155700cataaaaaac
aactcgttat tacatagcag gcatggaatc cttcaagtat tgttttgata 155760acgatggcaa
gaaatggatt atcggaaata ctttatattc tggtaattca atactctata 155820aggtcagaaa
aaatttcact agttcgttct acaattacgt aatgaagata gatcacaaat 155880cacacaagcc
attgttgtct gaaatacgat tctatatatc tgtattggat cctttgacta 155940tcgacaactg
gacacgggaa cgtggtataa agtatttggc tattccagat ctgtatggaa 156000ttggagaaac
cgatggatta tatgttcttc gttataaaga attcgggaag agtattcgcc 156060ccaaaggata
ctgaatcagt cttcgaagca tgcgtcacta tgataaacac gttagagttt 156120atacactctc
gaggatttac ccatggaaaa atagaaccga ggaatataat attaaaactt 156180accacgtaaa
acttaaaatt taaaatgata tttcattgac agatagatca cacattatga 156240actttcaagg
acttgtgtta actgacaatt gcaaaaatca atgggtcgtt ggaccattaa 156300taggaaaagg
tggatttggt agtatttata ctactaatga caataattat gtagtaaaaa 156360tagagcccaa
agctaacgga tcattattta ccgaacaggc attttatact agagtactta 156420aaccatccgt
tatcgaagaa tggaaaaaat ctcacaatat aaagcacgta ggtcttatca 156480cgtgcaaggc
atttggtcta tacaaatcca ttaatgtgga atatcgattc ttggtaatta 156540atagattagg
tgcagatcta gatgcggtga tcagagccaa taataataga ctaccaaaaa 156600ggtcggtgat
gttgatcgga atcgaaatct taaataccat acaatttatg cacgagcaag 156660gatattctca
cggagatatt aaagcgagta atatagtctt agatcaaata gataagaata 156720aattatatct
agtggattac ggattggttt ctaaattcat gtctaatggc gaacatgttc 156780catttataag
aaatccaaat aaaatggata acggtactct agaatttaca cctatagatt 156840cgcataaagg
atacgttgta tctagacgtg gagatctaga aacacttgga tattgtatga 156900ttagatggtt
gggaggtatc ttaccatgga ctaagatatc tgaaacaaag aattgtgcat 156960tagtaagtgc
cacaaaacag aaatatgtta acaatactgc gactttgtta atgaccagtt 157020tgcaatatgc
acctagagaa ttgctgcaat atattaccat ggtaaactct ttgacatatt 157080ttgaggaacc
caattacgac aagtttcggc acatattaat gcagggtgta tattattaag 157140tgtggtgttt
ggtcgataaa aattaaaaaa taacttaatt tattattgat ctcgtgtgta 157200caaccgaaat
catggcgatg ttttacgcac acgctctcgg tgggtacgac gagaatcttc 157260atgcctttcc
tggaatatca tcgactgttg ccaatgatgt caggaaatat tctgttgtgt 157320cagtttataa
taacaagtat gacattgtaa aagacaaata tatgtggtgt tacagtcagg 157380tgaacaagag
atatattgga gcactgctgc ctatgtttga gtgcaatgaa tatctacaaa 157440ttggaaatcc
gatccatgat caagaaggaa atcaaatctc tatcatcaca tatcgccaca 157500aaaactacta
tgctctaagc ggaatcgggt acgagagtct agacttgtgt ttggaaggag 157560tagggattca
tcatcacgta cttgaaacag gaaacgctgt atatggaaaa gttcaacatg 157620attattctac
tatcaaagag aaggccaaag aaatgagtgc acttagtcca ggacctatca 157680tcgattacca
cgtctggata ggagattgta tctgtcaagt tactgctgtg gacgtacatg 157740gaaaggaaat
tatgaaaatg agattcaaaa agggtgcggt gcttccgatc ccaaatctgg 157800taaaagttaa
acttggggag aatgatacag aaaatctttc ttctactata tcggcgacac 157860catcgaggta
accacctctc tggaagacag cgtgaataat gtactcatga aacgtttgga 157920aactatacgc
catatgtggt ctgttgtata tgatcatttt gatattgtga atggtaaaga 157980atgctgttat
gtgcatacgc atttgtctaa tcaaaatctt ataccgagta ctgtaaaaac 158040aaatttgtac
atgaagacta tgggatcatg cattcaaatg gattccatgg aagctctaga 158100gtatcttagc
gaactgaagg aatcaggtgg atggagtccc agaccagaaa tgcaggaatt 158160tgaatatcca
gatggagtgg aagacactga atcaattgag agattggtag aggagttctt 158220caatagatca
gaacttcagg ctggtgaatc agtcaaattt ggtaattcta ttaatgttaa 158280acatacatct
gtttcagcta agcaactaag aacacgtata cggcagcagc ttccttctat 158340actctcatct
tttaccaaca caaagggtgg atatttgttc attggagttg ataataatac 158400acacaaagta
tttggattca cggtgggtta cgactacctc agactgatag agaatgatat 158460agaaaagcat
atcaaaagac tttgtgttgt gtatttctgt gagaagaaag aggacatcaa 158520gtacgcgtgt
cgattcatca aggtatataa acctggggat gaggctacct cgacatacgt 158580gtgcgctatc
aaagtggaaa gatgctgttg tgctgtgttt gcagattggc cagaatcatg 158640gtatatggat
actaatggta tcaagaagta ttctccagat gaatgggtgt cacatataaa 158700attttaatta
atgtaactat agagaacaaa taataaggtt gtaatatcat atagacaata 158760actaacaatt
aattagtaac tgttatctct tttttaatta accaactaac tatataccta 158820ttaatacatc
gtaattatag ttcttaacat ctattaatca ttaattcgct tctttaattt 158880tttataaact
aacattgtta attgaaaagg gataacatgt tacagaatat aaattatata 158940tggatttttt
taaaaaggaa atacttgact ggagtatata tttatctctt cattatatag 159000cacgcgtgtt
ttccaatttt tccacatccc atataataca ggattataat ctcgttcgaa 159060catacgagaa
agtggataaa acaatagttg attttttatc taggttgcca aatttattcc 159120atattttaga
atatggggaa aatattctac atatttattc tatggatgat gctaatacga 159180atattataat
tttttttcta gatagagtat taaatattaa taagaacggg tcatttatac 159240acaatctcgg
gttatcatca tccattaata taaaagaata tgtatatcaa ttagttaata 159300atgatcatcc
agataatagg ataagactaa tgcttgaaaa tggacgtaga acaagacatt 159360ttttgtccta
tatatcagat acagttaata tctatatatg tattttaata aatcatggat 159420tttatataga
tgccgaagac agttacggtt gtacattatt acatagatgt atatatcact 159480ataagaaatc
agaatcagaa tcatacaatg aattaattaa gatattgtta aataatggat 159540cagatgtaga
taaaaaagat acgtacggaa acacaccttt tatcctatta tgtaaacacg 159600atatcaacaa
cgtggaattg tttgagatat gtttagagaa tgctaatata gactctgtag 159660actttaatag
atatacacct cttcattatg tctcatgtcg taataaatat gattttgtaa 159720agttattaat
ttctaaagga gcaaatgtta atgcgcgtaa taaattcgga actactccat 159780tttattgtgg
aattatacac ggtatctcgc ttataaaact atatttggaa tcagacacag 159840agttagaaat
agataatgaa catatagttc gtcatttaat aatttttgat gctgttgaat 159900ctttagatta
tctattatcc agaggagtta ttgatattaa ctatcgtact atatacaacg 159960aaacatctat
ttacgacgct gtcagttata atgcgtataa tacgttggtc tatctattaa 160020acaaaaatgg
tgattttgag acgattacta ctagtggatg tacatgtatt tcggaagcag 160080tcgcaaacaa
caacaaaata ataatggaag tactattgtc taaacgacca tctttgaaaa 160140ttatgataca
gtctatgata gcaattacta aacataaaca gcataatgca gatttattga 160200aaatgtgtat
aaaatatact gcgtgtatga ccgattatga tactcttata gatgtacagt 160260cgctacagca
atataaatgg tatattttaa gatgtttcga tgaaatagat atcatgaaga 160320gatgttatat
aaaaaataaa actgtattcc aattagtttt ttgtatcaaa gacattaata 160380ctttaatgag
atacggtaaa catccttctt tcgtgaaatg cactagtctc gacgtatacg 160440gaagtcgtgt
acgtaatatc atagcatcta ttagatatcg tcagagatta attagtctat 160500tatccaagaa
gctggatcct ggagataaat ggtcgtgttt tcctaacgaa ataaaatata 160560aaatattgga
aaactttaac gataacgaac tatccacata tctaaaaatc ttataaacat 160620tattaaaata
taaaatctaa gtaggataaa atcacactac atcattgttt ccttttagtg 160680ctcgacagtg
tatactattt ttaacgctca taaataaaaa tgaaaacgat ttccgttgtt 160740acgttgttat
gcgtactacc tgctgttgtt tattcaacat gtactgtacc cactatgaat 160800aacgctaaat
taacgtctac cgaaacatcg tttaatgata accagaaagt tacgtttaca 160860tgtgatcagg
gatatcattc tttggatcca aatgctgtct gtgaaacaga taaatggaaa 160920tacgaaaatc
catgcaaaaa aatgtgcaca gtttctgatt atgtctctga actatataat 160980aaaccgctat
acgaagtgaa ttccaccatg acactaagtt gcaacggcga aacaaaatat 161040tttcgttgcg
aagaaaaaaa tggaaatact tcttggaatg atactgttac gtgtcctaat 161100gcggaatgtc
aacctcttca attagaacac ggatcgtgtc aaccagttaa agaaaaatac 161160tcatttgggg
aatatatgac tatcaactgt gatgttggat atgaggttat tggtgcttcg 161220tacataagtt
gtacagctaa ttcttggaat gttattccat catgtcaaca aaaatgtgat 161280atgccgtctc
tatctaacgg attaatttcc ggatctacat tttctatcgg tggcgttata 161340catcttagtt
gtaaaagtgg ttttacacta acggggtctc catcatccac atgtatcgac 161400ggtaaatgga
atcccatact cccaatatgt gtacgaacta acgaaaaatt tgatccagtg 161460gatgatggtc
ccgacgatga gacagatttg agcaaactct cgaaagacgt tgtacaatat 161520gaacaagaaa
tagaatcgtt agaagcaact tatcatataa tcatagtggc gttgacaatt 161580atgggcgtca
tatttttaat ctccgttata gtattagttt gttcctgtga caaaaataat 161640gaccaatata
agttccataa attgctaccg taaatataaa tccgttaaaa taattaataa 161700tttaataaca
aacaagtatc aaaagattaa agacttatag ctagaatcaa ttgagatgtc 161760ttcttcagtg
gatgttgata tctacgatgc cgttagagca tttttactca ggcactatta 161820taacaagaga
tttattgtgt atggaagaag taacgccata ttacataata tatacaggct 161880atttacaaga
tgcgccgtta taccgttcga tgatatagta cgtactatgc caaatgaatc 161940acgtgttaaa
caatgggtga tggatacact taatggtata atgatgaatg aacgcgatgt 162000ttctgtaagc
gttggcaccg gaatactatt catggaaatg tttttcgatt acaataaaaa 162060tagtatcaac
aatcaactaa tgtatgatat aattaatagc gtatctataa ttctagctaa 162120tgagagatat
agaagcgctt ttaacgacga tggtatatac atccgtagaa atatgattaa 162180caagttgtac
ggatacgcat ctctaactac tattggcacg atcgctggag gtgtttgtta 162240ttatctgttg
atgcatctag ttagtttgta taaataatta tttcaatata ctagttaaaa 162300ttttaagatt
ttaaatgtat aaaaaactaa taacgttttt atttgtaata ggtgcattag 162360catcctattc
gaataatgag tacactccgt ttaataaact gagtgtaaaa ctctatatag 162420atggagtaga
taatatagaa aattcatata ctgatgataa taatgaattg gtgttaaatt 162480ttaaagagta
cacaatttct attattacag agtcatgcga cgtcggattt gattccatag 162540atatagatgt
tataaacgac tataaaatta ttgatatgta taccattgac tcgtctacta 162600ttcaacgcag
aggtcacacg tgtagaatat ctaccaaatt atcatgccat tatgataagt 162660acccttatat
tcacaaatat gatggtgatg agcgacaata ttctattact gcagagggaa 162720aatgctataa
aggaataaaa tatgaaataa gtatgatcaa cgatgatact ctattgagaa 162780aacatactct
taaaattgga tctacttata tatttgatcg tcatggacat agtaatacat 162840attattcaaa
atatgatttt taaaaattta aaatatatta tcacttcagt gacagtagtc 162900aaataacaaa
caacaccatg agatatatta taattctcgc agttttgttc attaatagta 162960tacatgctaa
aataactagt tataagtttg aatccgtcaa ttttgattcc aaaattgaat 163020ggactgggga
tggtctatac aatatatccc ttaaaaatta tggcatcaag acgtggcaaa 163080caatgtatac
aaatgtacca gaaggaacat acgacatatc cgcatttcca aagaatgatt 163140tcgtatcttt
ctgggttaaa tttgaacaag gcgattataa agtggaagag tattgtacgg 163200gactatgcgt
cgaagtaaaa attggaccac cgactgtaac attgactgaa tacgacgacc 163260ataaacagaa
aaagtgtgcg tgacagcaca gggagccaca gaagggtttc tcgaaaaaat 163320tactccatgg
agttcgaaag tatgtctgac acctaaaaag agtgtatata catgcgcaat 163380tagatccaaa
gaagatgttc ccaatttcaa ggacaaaatg gccagagtta tcaagagaaa 163440atttaataca
cagtctcaat cttatttaac taaatttctc ggtagcacat caaatgatgt 163500taccactttt
cttagcatgc ttaacttgac taaatattca taactaattt ttattaatga 163560tacaaaaacg
aaataaaact gcatattata cactggttaa cgcccttata ggctctaacc 163620attttcaaga
tgaggtccct gattatagtc cttctgttcc cctctatcat ctactccatg 163680tctattagac
gatgtgagaa gactgaagag gaaacatggg gattgaaaat agggttgtgt 163740ataattgcca
aagatttcta tcccgaaaga actgattgca gtgttcatct cccaactgca 163800agtgaaggat
tgataactga aggcaatgga ttcagggata tacgaaacac cgataaatta 163860taaaaaaagc
aatgtgtccg ctgtttccgt taataatact attttcgtaa ctggcggatt 163920attcataaat
aactctaata gcacgatcgt ggttaacaat atggaaaaac ttgacattta 163980taaagacaaa
caatggtcga ttatagaaat gcctatggct agggtatatc acggcattga 164040ctcgacattt
ggaatgttat attttgccgg aggtctatcc gttaccgaac aatatggtaa 164100tttagagaaa
aacaacgaga tatcttgtta caatcctaga acgaataagt ggtttgatat 164160ttcatatact
atttataaga tatccatatc atcattgtgt aaactaaata acgtcttcta 164220tgtatttagt
aaggacattg gatatgtgga aaagtatgat ggtgcatgga agttagtaca 164280tgatcgtctc
cccgctataa aggcattatc aacttctcct tattgattga aaatataaat 164340agtttttatg
tatagcagta ttaccctata gttttattgc ttactactaa catggataca 164400gatgttacaa
atgtagaaga tatcataaat gaaatagata gagagaaaga agaaatacta 164460aaaaatgtag
aaattgaaaa taataaaaac attaacaaga atcatcccaa tgaatatatt 164520agagaagcac
tcgttattaa taccagtagt aatagtgatt ccattgataa agaagttata 164580gaatgtatca
gtcacgatgt aggaatatag atcatatcta ctaattttta taatcgatac 164640aaaacataaa
aaacaactcg ttattacata gcaggcatgg aatccttcaa gtattgtttt 164700gataacgatg
gcaagaaatg gattatcgga aatactttat attctggtaa ttcaatactc 164760tataaggtca
gaaaaaattt cactagttcg ttctacaatt acgtaatgaa gatagatcac 164820aaatcacaca
agccattgtt gtctgaaata cgattctata tatctgtatt ggatcctttg 164880actatcgaca
actggacacg ggaacgtggt ataaagtatt tggctattcc agatctgtat 164940ggaattggag
aaaccgatga ttatatgttc ttcgttataa agaattcggg aagagtattc 165000gccccaaagg
atactgaatc agtcttcgaa gcatgcgtca ctatgataaa cacgttagag 165060tttatacact
ctcgaggatt tacccatgga aaaatagaac cgaggaatat actgattaga 165120aataaacgtc
tttcactaat tgactattct agaactaaca aactatacaa gagtggaaac 165180tcacatatag
attacaacga ggacatgata acttcaggaa atatcaatta tatgtgtgta 165240gacaatcatc
ttggagcaac agtttcaaga cgaggagatt tagaaatgtt gggatattgc 165300atgatagaat
ggttcggtgg caaacttcca tggaaaaacg aaagtagtat aaaagtaata 165360aaacaaaaaa
aagaatataa aaaatttata gctactttct ttgaggactg ttttcctgaa 165420ggaaatgaac
ctctggaatt agttagatat atagaattag tatacacgtt agattattct 165480caaactccta
attatgacag actacgtaaa ctgtttatac aagattgaaa ttatattctt 165540ttttttatag
agtgtggtag tgttacggat atctaatatt aatattagac tatctctatc 165600gcgctacacg
accaatatcg attactatgg atatcttcta tgaaaggaga gaatgtattt 165660atttctccag
cgtcaatctc gtcagtattg acaatactgt attatggagc taatggatcc 165720actgctgaac
agctatcaaa atatgtagaa acggaggaga acacggataa ggttagcgct 165780cagaatatct
cattcaaatc catgaataaa gtatatgggc gatattctgc cgtgtttaaa 165840gattcctttt
tgagaaaaat tggcgataag tttcaaactg ttgacttcac tgattgtcgc 165900actatagatg
caatcaacaa gtgtgtagat atctttactg aggggaaaat caatccacta 165960ttggatgaac
cattgtctcc tagcaattag tgccgtatac tttaaagcaa aatggttgac 166020gccattcgaa
aaggaattta ccagtgatta tcccttttac gtatctccga cggaaatggt 166080agacgtaagt
atgatgtcta tgtacggcaa ggcatttaat cacgcatctg taaaagaatc 166140attcggcaac
ttttcaatca tagaactgcc atatgttgga gatactagta tgatggtcat 166200tcttccagac
aagattgatg gattagaatc catagaacaa aatctaacag atacaaattt 166260taagaaatgg
tgtgacttta tggatgctat gtttatagat gttcacattc ccaagtttaa 166320ggtaacaggc
tcgtataatc tggtggatac tctagtaaag tcaggactga cagaggtgtt 166380cggttcaact
ggagattata gcaatatgtg taatttagat gtgagtgtcg acgctatgat 166440ccacaaaacg
tatatagatg tcaatgaaga gtatacagaa gcagctgcag caacttctgt 166500actagtggca
gactgtgcat caacaattac aaatgagttc tgtgcagatc atccgttcat 166560ctatgtgatt
aggcatgttg atggaaaaat tcttttcgtt ggtagatatt gctctccgac 166620aactaattgt
taaccatttt ttttaaaaaa aatagaaaaa acatgtggta ttagtgcagg 166680tcgttgttct
tccaattgca attggtaaga tgacggccaa ctttagtacc cacgtctttt 166740caccacagca
ctgtggatgt gacagactga ccagtattga tgacgtcaaa caatgtttga 166800ctgaatatat
ttattggtcg tcctatgcat accgcaacag gcaatgcgct ggacaattgt 166860attccacact
cctctctttt agagatgatg cggaattagt gttcatcgac attcgcgagc 166920tggtaaaaaa
tatgccgtgg gatgatgtca aagattgtac agaaatcatc cgttgttata 166980taccggatga
gcaaaaaacc atcagagaga tttcggccat catcggactt tgtgcatatg 167040ctgctactta
ctggggaggt gaagaccatc ccactagtaa cagtctgaac gcattgtttg 167100tgatgcttga
gatgctaaat tacgtggatt ataacatcat attccggcgt atgaattgat 167160gagttgtaca
tcttgacatt ttctttcttc tcttctccct ttcttctctt ctcccttcct 167220ccctcttctc
cctttcccag aaacaaactt ttttacccac tataaaataa aatgagtata 167280ctacctgtta
tatttctttc tatatttttt tattcttcat tcgttcagac ttttaacgcg 167340tctgaatgta
tcgacaaagg gcaatatttt gcatcattca tggagttaga aaacgagcca 167400gtaatcttac
catgtcctca aataaatacg ctatcatccg gatataatat attagatatt 167460ttatgggaaa
aacgaggagc ggataatgat agaattatac cgatagataa tggtagcaat 167520atgctaattc
tgaacccgac acaatcagac tctggtattt atatatgcat taccacgaac 167580gaaacctact
gtgacatgat gtcgttaaat ttgacaatcg tgtctgtctc agaatcaaat 167640atagatttta
tctcgtatcc acaaatagta aatgagagat ctactggcga aatggtatgt 167700cccaatatta
atgcatttat tgctagtaac gtaaacgcag atattatatg gagcggacat 167760cgacgcctta
gaaataagag acttaaacaa cggacacctg gaattattac catagaagat 167820gttagaaaaa
atgatgctgg ttattataca tgtgttttag aatatatata cggtggcaaa 167880acatataacg
taaccagaat tgtaaaatta gaggtacggg ataaaataat accttctact 167940atgcaattac
cagatggcat tgtaacttca ataggtagta atttgactat tgcatcgttg 168000agacctccca
caacggatgc agacgtcttt tggataagta atggtatgta ttacgaagaa 168060gatgatgggg
acggaaacgg tagaataagt gtagcaaata aaatctatat gaccgataag 168120agacgtgtta
ttacatcccg gttaaacatt aatcctgtca aggaagaaga tgctacaacg 168180tttacgtgta
tggcgtttac tattcctagc atcagcaaaa cagttactgt tagtataacg 168240tgaatgtatg
ttgttacatt tccatgtcaa ttgagtttat aagaattttt atacattatc 168300ttccaacaaa
caattgacga acgtattgct atgattaact cccacgatac tatgcatatt 168360attaatcatt
aacttgcaga ctatacctag tgctattttg acatactcat gttcttgtgt 168420aattgcggta
tctatattat taaagtacgt aaatctagct atagttttat tatttaattt 168480tagataatat
accgtctcct tatttttaaa aattgccaca tcctttatta aatcatgaat 168540gggaatttct
atgtcatcgt tagtatattg tgaacaacaa gagcagatat ctataggaaa 168600gggtggaatg
cgatacattg atctatgtag ttttaaaaca cacgcgaact ttgaagaatt 168660tatataaatc
attccatcga tacatccttc tatgttgaga tgtatatatc caggaattcg 168720tttattaata
tcgggaaatg tataaactaa aacattgccc gaaagcggtg cctctatctg 168780cgttatatcc
gttcttaact tacaaaatgt aaccaatacc tttgcatgac ttgttttgtt 168840cggcaacgtt
agtttaaact tgacgaatgg attaattaca atagcatgat ccgcgcatct 168900attaagtttt
tttactttaa cgcccttgta tgtttttaca gagactttat ctaaatttct 168960agtgcttgta
tgtgttataa atataacggg atatagaacc gaatcaccta ccttagatac 169020ccaattacat
tttatcagat ccagataata aacaaatttt gtcgccctaa ctaattctat 169080attgttatat
attttacaat tggttatgat atcatgtaat aacttggagt ctaacgcgca 169140tcgtcgtacg
tttatacaat tgtgatttag tgtagtatat ctacacatgt atttttccgc 169200actatagtat
tctggactag tgataaaact atcgttatat ctatcttcaa tgaactcatc 169260gagatattgc
tctctgtcat attcatacac ctgcataaac tttctagaca tcttacaatc 169320cgtgttattt
taggatcata tttacatatt tacgggtata tcaaagatgt tagattagtt 169380aatgggaatc
gtctataata atgaatatta aacaattata tgaggacttt taccacaaag 169440catcataaaa
atgagtcgtc gtctgattta tgttttaaat atcaaccgca aatcaactca 169500taaaatacaa
gagaatgaaa tatatacata ttttagtcat tgcaatatag accatacttc 169560tacagaactt
gattttgtag ttaaaaacta tgatctaaac agacgacaac ctgtaactgg 169620gtatactgca
ctacactgct atttgtataa taattacttt acaaacgatg tactgaagat 169680attattaaat
catggagtgg atgtaacgat gaaaaccagt agcggacgta tgcctgttta 169740tatattgctt
actagatgtt gtaatatttc acatgatgta gtgatagata tgatagacaa 169800agataaaaac
cacttattac atagagacta ttccaaccta ttactagagt atataaaatc 169860tcgttacatg
ttattaaagg aagaggatat cgatgagaac atagtatcca ctttattaga 169920taagggaatc
gatcctaact ttaaacaaga cggatataca gcgttacatt attattattt 169980gtgtctcgca
cacgtttata aaccaggtga gtgtagaaaa ccgataacga taaaaaaggc 170040caagcgaatt
atttctttgt ttatacaaca tggagctaat ctaaacgcgt tagataattg 170100tggtaataca
ccattccatt tgtatcttag tattgaaatg tgtaataata ttcatatgac 170160taaaatgctg
ttgactttta atccgaattt cgaaatatgt aataatcatg gattaacgcc 170220tatactatgt
tatataactt ccgactacat acaacacgat attcttgtta tgttaataca 170280tcactatgaa
acaaatgttg gagaaatgcc gatagatgag cgtcgtatga tcgtattcga 170340gtttatcaaa
acatattcta cacgtccggc agattcgata acttatttga tgaataggtt 170400taaaaatata
aatatttata cccgctatga aggaaagaca ttattacacg tagcatgtga 170460atataataat
acacacgtaa tagattatct tatacgtatc aacggagata taaatgcgtt 170520aaccgacaat
aacaaacacg ctacacaact cattatagat aacaaagaaa attccccata 170580taccattaat
tgtttactgt atatacttag atatattgta gataagaatg tgataagatc 170640gttggtggat
caacttccat ctctacctat cttcgatata aaatcatttg agaaattcat 170700atcctactgt
atacttttag atgacacatt ttacgatagg cacgttaaga atcgcgattc 170760taaaacgtat
cgatacgcat tttcaaaata catgtcgttt gataaatacg atggtataat 170820aactaaatgt
cacgacgaaa caatgttact caaactgtcc actgttctag acactacact 170880atatgcagtt
ttaagatgtc ataattcgag aaagttaaga agatacctca acgagttaaa 170940aaaatataat
aacgataagt cctttaaaat atattctaat attatgaatg agagatacct 171000taatgtatat
tataaagata tgtacgtgtc aaaggtatat gataaactat ttcctgtttt 171060cacagataaa
aattgtctac taacattact accttcagaa attatatacg aaatattata 171120catgctgaca
attaacgatc tttataatat atcgtatcca cctaccaaag tatagttgta 171180tttttctcat
gcgatgtgtg taaaaaaact gatattatat aaatatttta gtgccgtata 171240ataaagatga
cgatgaaaat gatggtacat atatatttcg tatcattatt gttattgcta 171300ttccacagtt
acgccataga catcgaaaat gaaatcacag aattcttcaa taaaatgaga 171360gatactctac
cagctaaaga ctctaaatgg ttgaatccag catgtatgtt cggaggcaca 171420atgaatgata
tagccgctct aggagagcca ttcagcgcaa agtgtcctcc tattgaagac 171480agtcttttat
cgcacagata taaagactat gtggttaaat gggagaggct agaaaagaat 171540agacggcgac
aggtttctaa taaacgtgtt aaacatggtg atttatggat agccaactat 171600acatctaaat
tcagtaaccg taggtatttg tgcaccgtaa ctacaaagaa tggtgactgt 171660gttcagggta
tagttagatc tcatattaaa aaacctcctt catgcattcc aaaaacatat 171720gaactaggta
ctcatgataa gtatggcata gacttatact gtggaattct ttacgcaaaa 171780cattataata
atataacttg gtataaagat aataaggaaa ttaatatcga cgacattaag 171840tattcacaaa
cgggaaagga attaattatt cataatccag agttagaaga tagcggaaga 171900tacgactgtt
acgttcatta cgacgacgtt agaatcaaga atgatatcgt agtatcaaga 171960tgtaaaatac
ttacggttat accgtcacaa gaccacaggt ttaaactaat actagatccg 172020aaaatcaacg
taacgatagg agaacctgcc aatataacat gcactgctgt gtcaacgtca 172080ttattgatcg
acgatgtact gattgaatgg gaaaatccat ccggatggct tataggattc 172140gattttgatg
tatactctgt tttaactagt agaggcggta tcaccgaggc gaccttgtac 172200tttgaaaatg
ttactgaaga atatataggt aatacatata aatgtcgtgg acacaactat 172260tattttgaaa
aaacccttac aactacagta gtattggagt aaatatacaa tgcattttta 172320tatacattac
tgaattatta ttactgaatt attattactg aattattatt aattatatcg 172380tatttgtgct
atagaatgga tgaagatacg cgactatcta ggtatttgta tctcaccgat 172440agagaacata
taaatgtaga ctctattaaa cagttgtgta aaatatcaga tcctaatgca 172500tgttatagat
gtggatgtac ggctttacat gagtactttt ataattatag atcagtcaac 172560ggaaaataca
agtatagata caacggttac tatcaatatt attcatctag cgattatgaa 172620aattataatg
aatattatta tgatagaact ggtatgaaca gtgagagtga taatatatca 172680atcaaaacag
aatatgaatt ctatgatgaa acacaagatc aaagtacaca actagtaggt 172740tacgacatta
aactcaaaac caatgaggat gattttatgg ctatgataga tcagtgggtg 172800tccatgatta
tatagatgaa tcaattaata aagtagtata tggaagagag tctcacgtaa 172860gatggcggga
tatatggcaa gaacataatg atggcgtata cagtatagga aaggagtgca 172920tagataatat
atacgaagac aaccataccg tagacgaatt ctacaagata gacagcgtat 172980cagatgtaga
tgacgcggaa cacatatctc cgataactaa aaaaccatag aatcagttga 173040tgataatacc
tacatttcta atcttccgta taccatcaaa tacaaaatat tcgagcaaca 173100ataagtattt
tttatacctt taaaactgat aaataaattt tttctagtga tattttggca 173160agatgagaat
cctatttctc atcgctttca tgtatgggtg tgttcactca tatgttaacg 173220cggttgaaac
caaatgtcca aatctagaca ttgtaacatc ttctggagaa tttcattgtt 173280caggatgtgt
ggaacatatg cctgagttta gctatatgta ttggttggca aaggatatga 173340aatcggacga
ggataccaag tttatagaac atctgggtga tggcatcaaa gaagatgaaa 173400ccgttcgtac
cacagatagt ggaatcgtca ctctacgtaa agtccttcat gtaaccgata 173460ctaataaatt
tgataattat aggttcactt gtgtcctcac tacgatagat ggcgtttcaa 173520aaaagaatat
ttggctgaag tagtgcgtgc tactattttt atttatgata taatctaatg 173580gaattaattt
gaattgatat ttatccaata ctaaagatta tattagaatc aaattaatct 173640tttatacgag
aaaaaataac gacatacgtc gtcaacaaat taaacttttt atttattagt 173700taactagctt
atagaacttg ctcattgtta tgtttctaaa acgggtacgg catataggac 173760aattatccga
cgcaccggtt tctcttcgtg ttctatgcca tatattgatg catgttatgc 173820aaaatatatg
agtacacgaa tccaataaac caaagtatct atcgttttga gtaaacaact 173880tcatagcaaa
ttccacattc tttttcttta cttactctat acacgtcctc gtatttattt 173940agtattttga
tgatatccaa ctcagaaatg gttgttgtat tattgggtgt ataggtatta 174000ttagctatgt
accaatttac caaccctctt aatattgatt gataatcaca tcggttatcc 174060aatcaataac
cacattaata actaaattgt agtgtatata tagaccatat atgtttctat 174120ttttttgaca
gttacgtata gtttcagtaa gttttgattg ttgtattcct gtatctctag 174180ataagttagt
catatagtcc cttccggcga tacgtttttt ccaagcccga aattgattag 174240ccaaatgtgt
atttattttt gtgatattga tataatattt cggataatgc atactgttag 174300tcttatatca
tttggttcat ctatgtattg taatattgtt acatgatcta tagatgatgt 174360attgattttg
gcaggatcga attccatatc cgcgactaaa cagtgaaaaa aatgtaaata 174420ctttttaaat
tttaaattag taaaactttt ttttattttt tatgattcca aaaatactga 174480atacaaagtc
ctaaattata aatatggaga tcatactacc acaacttatt attatgtata 174540caaggccggt
gtaatagata gatatatata attctattac accggcagac aattaccgac 174600cggtatttgt
cgttaccaac ataccgtata atatgtaata tacaattcca taacccattg 174660acagttgtta
tacatcaaaa ttgcaattct tttgattacg atgttataag aatgtagtta 174720attgatgtat
gatgttaatg tgtcctcttt cctcttataa catcgtaatc aaaaactttt 174780ttataatata
tacctaataa tgtgtcttaa tagttctcgt gattcgtcaa acaatcattc 174840ttataaaata
taataaagca acgtaaaaac acataaaaat aagcgtaact aataagacaa 174900tggatattta
cgacgataaa ggtctacaga ctattaaact gtttaataat gaatttgatt 174960gtataaggaa
tgacatcaga gaattattta aacatgtaac tgattccgat agtatacaac 175020ttccgatgga
agacaattct gatattatag aaaatatcag aaaaatacta tatagacgat 175080taaaaaatgt
agaatgtgtt gacatcgata acacaataac ttttatgaaa tacgatccaa 175140atgatgataa
taagcgtacg tgttctaatt gggtaccctt aactaataac tatatggaat 175200attgtctagt
aatatatttg gaaacaccga tatgtggagg caaaataaaa ttataccacc 175260ctacaggaaa
tataaagtcg gataaggata ttatgtttgc aaagactcta gactaagata 175320gacagcgtat
cagatgtaga tgacgcggaa cacatatctc ctataactaa tgatgtatct 175380acacaaacat
gggaaaagaa atcagagtta gatagataca tggaatcgta tcctcgtcat 175440agatatagta
aacattctgt atttaaggga ttttctgata aagttagaaa aaatgattta 175500gacatgaatg
tggtaaaaga attactttct aacggtgcat ctctaacaat caaggatagc 175560agtaataagg
atccaattgc tgtttatttt agaagaacga taatgaattt agaaatgatt 175620gatattatta
acaaacatac aactattgat gaacgaaagt atatagtaca ctcctatcta 175680aaaaattata
gaaatttcga ttatccattt ttcaggaagt tagttttgac taataaacat 175740tgtctcaaca
attattataa tataagcgac agcaaatatg gaacaccgct acatatattg 175800gcgtctaata
aaaaattaat aactcctaat tacatgaagt tattagtgta taacggaaat 175860gatataaacg
cacgaggtga agatacacaa atgcgaacca actcagaaat ggttgttgta 175920ttattgggtg
tataggtatt attagctatg taccaattta ccaaccctct taatattgat 175980tgataatcac
atcggttatc caattaataa ctaaattgta gtgtatatat agaccatata 176040tgtttctatt
tttttgacag ttacgtatag tttcagtaag ttttgattgt tgtattcctg 176100tatctctaga
taagttagtc atatagtccc ttccggcgat acgttttttc caagcccgaa 176160attgattagc
caaatgtgta tttatttttg tgatattgat ataatatttc ggataatgca 176220tactgttagt
cttatatcat ttggttcatc tatgtattgt aatattgtta catgatctat 176280agatgatgta
ttgattttgg caggatcgaa ttccatatcc gcgactaaac agtgaaaaaa 176340atgtaaatac
tttttaaatt ttaaattagt aaaacttttt tttatttttt atgattccaa 176400aaatactgaa
tacaaagtcc taaattataa atatggagat catactacca caacttatta 176460ttatgtatac
aaggccggtg taatagatag atatatataa ttctattaca ccggcagaca 176520attaccgacc
ggtatttgtc gttaccaaca taccgtataa tatgtaatat acaattccat 176580aacccattga
cagttgttat acatcaaaat tgcaattctt ttgattacga tgttataaga 176640atgtagttaa
ttgatgtatg atgttaatgt gtcctctttc ctcttataac atcgtaatca 176700aaaacttttt
tataatatat acctaataat gtgtcttaat agttctcgtg attcgtcaaa 176760caatcattct
tataaaatat aataaagcaa cgtaaaaaca cataaaaata agcgtaacta 176820ataagacaat
ggatatttac gacgataaag gtctacagac tattaaactg tttaataatg 176880aatttgattg
tataaggaat gacatcagag aattatttaa acatgtaact gattccgata 176940gtatacaact
tccgatggaa gacaattctg atattataga aaatatcaga aaaatactat 177000atagacgatt
aaaaaatgta gaatgtgttg acatcgataa cacaataact tttatgaaat 177060acgatccaaa
tgatgataat aagcgtacgt gttctaattg ggtaccctta actaataact 177120atatggaata
ttgtctagta atatatttgg aaacaccgat atgtggaggc aaaataaaat 177180tataccaccc
tacaggaaat ataaagtcgg ataaggatat tatgtttgca aagactctag 177240actttaaatc
aacgaaagtg ttaactggac gtaaaacaat tgccgttcta gacatatccg 177300tttcatataa
tagatcaatg actactattc actacaacga cgacgttgat atagatatac 177360atactgataa
aaatggaaaa gagttatgtt attgttatat aacaatagat gatcattact 177420tggttgatgt
ggaaactata ggagttatag tcaatagatc tggaaaatgt ctgttagtaa 177480ataaccatct
aggtataggt atcgttaaag ataaacgtat aagcgatagt tttggagatg 177540tatgtatgga
tacaatattt gacttttctg aagcacgaga gttattttca ttaactaatg 177600atgataacag
gaatatagca tgggacactg ataaactaga cgatgataca gatatatgga 177660ctcccgtcac
agaagatgat tacaaatttc tttctagact agtattgtat gcaaaatctc 177720aatcggatac
tgtatttgac tattatgttc ttactggtga tacggaacca cccactgtat 177780tcattttcaa
ggtaactaga ttttacttta atatgccgaa ataaaaaatt tttgtataat 177840atctagaggt
agaggtattg tttagataaa tacaaataac atagatacat cgcatactta 177900gcatttttat
aaatatacat aagacataca ctttatacat ttttgtaaaa atactcataa 177960aaaaatttat
aaaaattatg gcacaaccat atcttgtata ggtagtttag ttcgtcgagt 178020gaacctataa
acagataata gacaacacat aataatgcct actaatacaa gcataatacc 178080gggagatggg
atatatgacg ttgtagtgtt tgggttttct gaacgttgat agtctactaa 178140tactacatgc
tgacatctaa tgcctgtata accatgagag catctacaat acataccgtc 178200aatatctcta
gcgtggatac agtcaccgtg taaacaatat ccatctccct ctggaccgca 178260taatctgata
gctggaatat ctgttgtagc gtttgtaatt tctggcaatg tcgtttcgat 178320agcgttacca
ctatcggcga atgatctgat tatcatagca gcgaacaaca acatcagata 178380atttatcaac
atttttgatg gattctgtgt ttatgctgtt tctcagtgtg tgtttatgac 178440aagattggga
attttatatt attaattcag taatataaac taataatata ttgttaattg 178500tgtaaataat
ataaaaataa caatacaata ttgaatgtgt tgctgttaaa aatgtatgtg 178560ttaatataat
agaataaaat aaatgagtat gatcatttta gataacgatt gattttatca 178620ttaccgcttc
attcttatat tctttgctta cggaacctat atttagaaac atctactaac 178680aattttttat
gcttgcatta ttaatggtat gtaatatgat tgattgtgta cgcaatacca 178740atttgttaag
tatgaatacg gggtacaaac ataaattgaa atttaacatt atttatttat 178800gatatatatc
gttatcgtta ggtctatacc atggatatct ttaaagaact aatcttaaaa 178860caccctgatg
aaaatgtttt gatttctcca gtttccattt tatctacttt atctattcta 178920aatcatggag
cagctggttc tacagctgaa caactatcaa aatatataga gaatatgaat 178980gagaatacac
ccgatgacaa taatgatgac atggaggtag atattccgta ttgtgcgaca 179040ctagctaccg
caaataaaat atacggtagc gatagtatcg agttccacgc ctccttccta 179100caaaaaataa
aagacgattt tcaaactgta aactttaata atgctaacca aacaaaggaa 179160ctaatcaacg
aatgggttaa gacaatgaca aatggtaaaa ttaattcctt attgactagt 179220ccgctatcca
ttaatactcg tatgacagtt gttagcgccg tccattttaa agcaatgtgg 179280aaatatccat
tttctaaaca tcttacatat acagacaagt tttatatttc taagaatata 179340gttaccagcg
ttgatatgat ggtgggtacc gagaataact tgcaatatgt acatattaat 179400gaattattcg
gaggattctc tattatcgat attccatacg agggaaactc tagtatggta 179460attatactac
cggacgacat agaaggtata tataacatag aaaaaaatat aacagatgaa 179520aaatttaaaa
aatggtgtgg tatgttatct actaaaagta tagacttgta tatgccaaag 179580tttaaagtgg
aaatgacaga accgtataat ctggtaccga ttttagaaaa tttaggactt 179640actaatatat
tcggatatta tgcagatttt agcaagatgt gtaatgaaac tatcactgta 179700gaaaaatttc
tacatacgac gtttatagat gttaatgagg agtatacaga agcatcggcc 179760gttacaggag
tatttacgat taacttttcg atggtatatc gtacgaaggt ctacataaac 179820catccattca
tgtacatgat taaagacacc acaggacgta tactttttat agggaaatac 179880tgctatccgc
aataaatata aacaaataga cttttataaa gagtcttcaa cgataagtat 179940atcgacatac
tacttatgct gcgaaagatt ctgaacgaga acgactatct caccctcttg 180000gatcatatcc
gcactgctaa atactaaatc tccactacac tttttatcat cttatgagga 180060atgattgcct
tcgtgaaata ggaataatta gcaccagaat agctatggat tattgtggta 180120gagagtgcac
tattctatgt cgtctactgg atgaagatgt gacgtacaaa aaaataaaac 180180tagaaattga
aacgtgtcac aacttatcaa aacatataga tagacgagga aacaatgcgc 180240tacattgtta
cgtctccaat aaatgcgata cagacattaa gattgttctc tcgcggagtc 180300gagagacttt
gtagaaacaa cgaaggatta actccgctag gagtatacag taagcataga 180360tacgtaaaat
ctcagattgt gcatctactg atatccagct attcaaattc ctctaacgaa 180420ctcaagtcga
atataaatga tttcgatctg tattcggata atatcgactt acgtctgcta 180480aaatacctaa
ttgtggataa acggatacgt ccgtccaaga atacgaatta tgcaatcaat 180540ggtctcggat
tggtggatat atacgtaacg acgcctaatc cgagaccaga agtattgcta 180600tggcttctta
aatcagaatg ttacagcacc ggttacgtat ttcgtacctg tatgtacgac 180660agtgatatgt
gtaagaactc tcttcattac tatatatcgt ctcatagaga atctcaatct 180720ctatccaagg
atgtaattaa atgtttgatc gataacaatg tttccatcca tggcagagac 180780gaaggaggat
ctttacccat ccaatactac tggtctttct caaccataga tatagagatt 180840gttaaattat
tattaataaa ggatgtggac acgtgtagag tatacgacgt cagccctata 180900ttagaggcgt
attatctaaa caagcgattt agagtaaccc catataatgt agacatggaa 180960atcgttaatc
ttcttattga gagacgtcat actcttgtcg acgtaatgcg tagtattact 181020tcgtacgatt
ccagagaata taaccactac atcatcgata acattctaaa gagatttaga 181080caacaggatg
tacaagccat gttgataaac tacttacatt acggcgatat ggtcgttcga 181140tgcatgttag
ataacggaca acaactatcc tctgcacgac tactttgtta ataataatct 181200cgtcgatgta
aacgtcgtaa ggtttatcgt ggaaaatatg gacacgcggc tgtaaatcac 181260gtatcgaaca
atggccgtct atgtatgtac ggtctgatat tatcgagatt taataattgc 181320gggtatcact
gttatgaaac catactgata gatgtatttg atatactaag caagtacatg 181380gatgatatag
atatgatcga taactctact atattacgcg gtcgatgtca ataatataca 181440atttgcaaag
cggttattgg aatatggagc gagtgtcacg ctcgataatc aatacggcca 181500tccagaaaag
cagttaccaa agagaaaaca aaacgaagct agttgattta ttactgagtt 181560accatcccac
tctagagact atgattgacg catttaatag agatatacgc tatctatatc 181620ctgaaccatt
attcgcctgt atcagatacg ccttaatcct agatgatgat tttccttcta 181680aagtaaagta
tgatatcgcc ggtcgtcata aggaactaaa gcgctataga gtagacatta 181740atagaatgaa
gaatgtctac atatcaggcg tctccatgtt tgatatatta tttaaacgaa 181800gcaaacgcca
caaattgaga tacgcaaaga atccgacatc aaatggtaca aaaaagaact 181860aacgtccatc
attacagaaa ctgtaaagaa caatgagagg atcgactcca tagtggacaa 181920cattaataca
gacgataact tgatttcgaa attacccatg gagatacttt attactccat 181980taaataattt
atcatggagc gataatgtcc tgtttcattt gtttccatga catattacaa 182040aatcgattcc
gtccaagatg ataaaaacat ttaccggcat cataaacacg gagtttattt 182100tatatgtctc
gcataaacat tactaaaaaa atatattgtc gataacttga tttcgaaatt 182160acccatggag
atactttatt actccattaa ataatttatc atggagcgat aatgtcctgt 182220ttcatttgtt
tccatgacat attacaaaat cgattccgtc caagatgata aaaacattta 182280ccggcatcat
aaacacggag tttattttat atgtctcgca taaacattac taaaaaaata 182340tattgttctg
tttttctttc acatctttaa ttatgaaaaa gtaaatcatt atgagatgga 182400cgagattgta
cgcatcgttc gcgacagtat gtggtacata cctaacgtat ttatggacga 182460cggtaagaat
gaaggtcacg tttctgtcaa caatgtctgt catatgtatt ttacgttctt 182520tgatgtggat
acatcgtctc atctgtttaa gctagttatt aaacactgcg atctgaataa 182580acgaggtaac
tctccattac attgctatac gatgaataca cgatttaatc catctgtatt 182640aaagatattg
ttacaccacg gcatgcgtaa ctttgatagc aaggatgacc actatcaatc 182700gataacaaga
tctttgatat actaacggac accattgatg actttagtaa atcatccgat 182760ctattgctgt
gttatcttag atataaattc aatgggagct taaactatta cgttctgtac 182820aaaggatccg
accctaattg cgccgacgag gatgaactca cttctcttca ttactactgt 182880aaacacatat
ccacgttcta cgaaagcaat tattacaagt taagtcacac taagatgcga 182940gccgagaagc
gattcatcta cgcgataata gattatggag caaacattaa cgcggttaca 183000cacttacctt
caacagtata ccaaacatag tcctcgtgtg gtgtatgctc ttttatctcg 183060aggagccgat
acgaggatac gtaataatct tgattgtaca cccatcatgg aacgattgtg 183120caacaggtca
tattctcata atgttactca attggcacga acaaaaggaa gaaggacaac 183180atctacttta
tctattcata aaacataatc aaggatacac tctcaatata ctacggtatc 183240tattagatag
gttcgacatt cagaaagacg aatactataa taccgccttt caaaattgta 183300acaacaatgt
tgcctcatac atcggatacg acatcaacct tccgactaaa gacggtattc 183360gacttggtgt
ttgaaaacag aaacatcata tacaaggcgg atgttgtgaa tgacatcatc 183420caccacagac
tgaaagtatc tctacctatg attaaatcgt tgttctacaa gatgtctctc 183480cctacgacga
ttactacgta aaaaagatac tagcctactg cctattaagg gacgagtcat 183540tcgcggaact
acatagtaaa ttctgtttaa acgaggacta taaaagtgta tttatgaaaa 183600atatatcatt
cgataagata gattccatca tcgtgacata agtcgcctca aagagattcg 183660aatctccgac
accgacctgt atacggtatc acagctatct taaagccata cattcagaca 183720gtcacatttc
atttcccatg tacgacgatc tcatagaaca gtgccatcta tcgatggagc 183780gtaaaagtaa
actcgtcgac aaagcactca ataaattaga gtctaccatc ggtcaatcta 183840gactatcgta
tttgcctccg gaaattatgc gcaatatcat ctaaacagta tgttgtacgg 183900aaagaaccat
tacaaatatt atccatgata gaaagaaaat atctatatga ttggagaagt 183960aggaaacagg
aacaagacaa cgattactac attattaaat catgaagtcc gtattatact 184020cgtatatatt
gtttctctca tgtataataa taaacggaag agatatagca ccgcatgcac 184080catccgatgg
aaagtgtaaa gacaacgaat acaaacgcca taatttgtgt ccgggaacat 184140acgcttccag
attatgcgat agcaagacta acacacgatg tacgccgtgt ggttcgggta 184200ccttcacatc
tcgcaataat catttacccg cttgtctaag ttgtaacgga agacgcgatc 184260gtgtaacacg
actcacaata gaatctgtga atgctctccc ggatattatt gtcttctcaa 184320aggatcatcc
ggatgcaagg catgtgtttc ccaaacaaaa tgtggaatag gatacggagt 184380atccggagac
gtcatctgtt ctccgtgtgg tctcggaaca tattctcaca ccgtctcttc 184440cgcagataaa
tgcgaacccg tacccagaaa tacgtttaac tatatcgatg tggaaattaa 184500cctgtatcca
gttaacgaca cgtcgtgtac tcggacgacc actaccggtc tcagcgaatc 184560catctcaacg
tcggaactaa ctattactat gaatcataaa gactgtaatc ccgtatttcg 184620tgatggatac
ttctccgttc ttaataaggt agcgacttca ggtttcttta caggagaaag 184680gtgtgcactc
tgaatttcga gattaaatgc aataacaaag attcttcctc caaacagtta 184740acgaaagcaa
agaatgatac tatcatgccg cattcggaga cagtaactct agtgggcgac 184800atctatatac
tatatagtaa taccaatact caagactacg aaactgatac aatctcttat 184860catgtgggta
atgttctcga tgtcgatagc catatgcccg gtagttgcga tatacataaa 184920ctgatcacta
attccaaacc cacccacttt ttatagtaag tttttcaccc ataaataata 184980aatacaataa
ttaatttctc gtaaaagtag aaaatatatt ctaatttatt gcacggtaag 185040gaagtagaat
cataaagaac agtactcaat caatagcaat tatgaaacaa tatatcgtcc 185100tggcatgcat
gtgcctggcg gcagctgcta tgcctgccag tcttcagcaa tcatcctcat 185160cctcctcctc
gtgtacggaa gaagaaaaca aacatcatat gggaatcgat gttattatca 185220aagtcacaaa
gcaagaccaa acaccgacca atgataagat ttgccaatcc gtaacggaaa 185280ttacagagtc
cgagtcagat ccagatcccg aggtggaatc agaagatgat tccacatcag 185340tcgaggatgt
agatcctcct accacttatt actccatcat cggtggaggt ctgagaatga 185400actttggatt
caccaaatgt cctcagatta aatccatctc agaatccgct gatggaaaca 185460cagtgaatgc
tagattgtcc agcgtgtccc caggacaagg taaggactct cccgcgatca 185520ctcatgaaga
agctcttgct atgatcaaag actgtgaagt gtctatcgac atcagatgta 185580gcgaagaaga
gaaagacagc gacatcaaga cccatccagt actcgggtct aacatctctc 185640ataagaaagt
gagttacgaa gatatcatcg gttcaacgat cgtcgataca aaatgcgtca 185700agaatctaga
gtttagcgtt cgtatcggag acatgtgcaa ggaatcatct gaacttgagg 185760tcaaggatgg
attcaagtat gtcgacggat cggcatctga aggtgcaacc gatgatactt 185820cactcatcga
ttcaacaaaa ctcaaagcgt gtgtctgaat cgataactct attcatctga 185880aattggatga
gtagggttaa tcgaacgatt caggcacacc acgaattaaa aaagtgtacc 185940ggacactata
ttccggtttg caaaacaaaa atgttcttaa ctacattcac aaaaagttac 186000ctctcgcgac
ttcttctttt tctgtctcaa tagtgtgata cgattatgac actattccta 186060ttcctattcc
tatttccttt cagagtatca caaaaatatt aaacctcttt ctgatggtct 186120cataaaaaaa
gttttacaaa aatattttta ttctctttct ctctttgatg gtctcataaa 186180aaaagtttta
caaaaatatt tttattctct ttctctcttt gatggtctca taaaaaaagt 186240tttacaaaaa
tatttttatt ctctttctct ctttgatggt ctcataaaaa aagttttaca 186300aaaatatttt
tattctcttt ctctctttga tggtctcata aaaaaagttt tacaaaaata 186360tttttattct
ctttctctct ttgatggtct cataaaaaaa gttttacaaa aatattttta 186420ttctctttct
ctctttgatg gtctcataaa aaaagtttta caaaaatatt tttattctct 186480ttctctcttt
gatggtctca taaaaaaagt tttacaaaaa tatttttatt ctctttctct 186540ctttgatggt
ctcataaaaa aagttttaca aaaatatttt tattctcttt ctctctttga 186600tggtctcata
aaaaaagttt tacaaaaata tttttattct ctttctctct ttgatggtct 186660cataaaaaaa
gttttacaaa aatattttta ttctctttct ctctttgatg gtctcataaa 186720aaaagtttta
caaaaatatt tttattctct ttctctcttt gatggtctca taaaaaaagt 186780tttacaaaaa
tatttttatt ctctttctct ctttgatggt ctcataaaaa aagttttaca 186840aaaatatttt
tatt
186854351131DNAHuman Herpesvirus1 35atggcttcgt acccctgcca tcaacacgcg
tctgcgttcg accaggctgc gcgttctcgc 60ggccataaca accgacgtac ggcgttgcgc
cctcgccggc aacaaaaagc cacggaagtc 120cgcctggagc agaaaatgcc cacgctactg
cgggtttata tagacggtcc ccacgggatg 180gggaaaacca ccaccacgca actgctggtg
gccctgggtt cgcgcgacga tatcgtctac 240gtacccgagc cgatgactta ctggcgggtg
ttgggggctt ccgagacaat cgcgaacatc 300tacaccacac aacaccgcct cgaccagggt
gagatatcgg ccggggacgc ggcggtggta 360atgacaagcg cccagataac aatgggcatg
ccttatgccg tgaccgacgc cgttctggct 420cctcatatcg ggggggaggc tgggagctca
catgccccgc ccccggccct caccctcatc 480ttcgaccgcc atcccatcgc cgccctcctg
tgctacccgg ccgcgcgata ccttatgggc 540agcatgaccc cccaggccgt gctggcgttc
gtggccctca tcccgccgac cttgcccggc 600acaaacatcg tgttgggggc ccttccggag
gacagacaca tcgaccgcct ggccaaacgc 660cagcgccccg gcgagcggct tgacctggct
atgctggccg cgattcgccg cgtttatggg 720ctgcttgcca atacggtgcg gtatctgcag
ggcggcgggt cgtggcggga ggattgggga 780cagctttcgg gggcggccgt gccgccccag
ggtgccgagc cccagagcaa cgcgggccca 840cgaccccata tcggggacac gttatttacc
ctgtttcggg cccccgagtt gctggccccc 900aacggcgacc tgtataacgt gtttgcctgg
gctttggacg tcttggccaa acgcctccgt 960cccatgcatg tctttatcct ggattacgac
caatcgcccg ccggctgccg ggacgccctg 1020ctgcaactta cctccgggat ggtccagacc
cacgtcacca ccccaggctc cataccgacg 1080atctgcgacc tggcgcgcac gtttgcccgg
gagatggggg aggctaactg a 113136376PRTHuman Herpesvirus1 36Met
Ala Ser Tyr Pro Cys His Gln His Ala Ser Ala Phe Asp Gln Ala 1
5 10 15 Ala Arg Ser Arg Gly His
Asn Asn Arg Arg Thr Ala Leu Arg Pro Arg 20 25
30 Arg Gln Gln Lys Ala Thr Glu Val Arg Leu Glu
Gln Lys Met Pro Thr 35 40 45
Leu Leu Arg Val Tyr Ile Asp Gly Pro His Gly Met Gly Lys Thr Thr
50 55 60 Thr Thr Gln
Leu Leu Val Ala Leu Gly Ser Arg Asp Asp Ile Val Tyr65 70
75 80 Val Pro Glu Pro Met Thr Tyr Trp
Arg Val Leu Gly Ala Ser Glu Thr 85 90
95 Ile Ala Asn Ile Tyr Thr Thr Gln His Arg Leu Asp Gln
Gly Glu Ile 100 105 110
Ser Ala Gly Asp Ala Ala Val Val Met Thr Ser Ala Gln Ile Thr Met
115 120 125 Gly Met Pro Tyr
Ala Val Thr Asp Ala Val Leu Ala Pro His Ile Gly 130
135 140 Gly Glu Ala Gly Ser Ser His Ala
Pro Pro Pro Ala Leu Thr Leu Ile145 150
155 160 Phe Asp Arg His Pro Ile Ala Ala Leu Leu Cys Tyr
Pro Ala Ala Arg 165 170
175 Tyr Leu Met Gly Ser Met Thr Pro Gln Ala Val Leu Ala Phe Val Ala
180 185 190 Leu Ile Pro
Pro Thr Leu Pro Gly Thr Asn Ile Val Leu Gly Ala Leu 195
200 205 Pro Glu Asp Arg His Ile Asp Arg
Leu Ala Lys Arg Gln Arg Pro Gly 210 215
220 Glu Arg Leu Asp Leu Ala Met Leu Ala Ala Ile Arg Arg
Val Tyr Gly225 230 235
240 Leu Leu Ala Asn Thr Val Arg Tyr Leu Gln Gly Gly Gly Ser Trp Arg
245 250 255 Glu Asp Trp Gly
Gln Leu Ser Gly Ala Ala Val Pro Pro Gln Gly Ala 260
265 270 Glu Pro Gln Ser Asn Ala Gly Pro Arg
Pro His Ile Gly Asp Thr Leu 275 280
285 Phe Thr Leu Phe Arg Ala Pro Glu Leu Leu Ala Pro Asn Gly
Asp Leu 290 295 300
Tyr Asn Val Phe Ala Trp Ala Leu Asp Val Leu Ala Lys Arg Leu Arg305
310 315 320 Pro Met His Val Phe
Ile Leu Asp Tyr Asp Gln Ser Pro Ala Gly Cys 325
330 335 Arg Asp Ala Leu Leu Gln Leu Thr Ser Gly
Met Val Gln Thr His Val 340 345
350 Thr Thr Pro Gly Ser Ile Pro Thr Ile Cys Asp Leu Ala Arg Thr
Phe 355 360 365 Ala
Arg Glu Met Gly Glu Ala Asn 370 375
User Contributions:
Comment about this patent or add new information about this topic: