Patent application title: METHOD FOR THE PRODUCTION OF MULTIPLE-UNSATURATED FATTY ACIDS IN TRANSGENIC ORGANISMS
Inventors:
IPC8 Class: AC12N1582FI
USPC Class:
1 1
Class name:
Publication date: 2017-01-19
Patent application number: 20170016015
Abstract:
The present invention relates to a process for the production of
polyunsaturated fatty acids in an organism by introducing, into the
organism, nucleic acids which encode polypeptides with .DELTA.5-elongase
activity. Advantageously, these nucleic acids can be expressed in the
organism together with further nucleic acids which encode polypeptides of
the biosynthesis of the fatty acid or lipid metabolism. Especially
advantageous are nucleic acids which encode .DELTA.6-desaturases,
.DELTA.5-desaturases, .DELTA.4-desaturases and/or .DELTA.6-elongases.
These desaturases and elongases are advantageously derived from
Thalassiosira, Euglena or Ostreococcus. The invention furthermore relates
to a process for the production of oils and/or triacylglycerides with an
elevated content of long-chain polyunsaturated fatty acids, and oils
and/or triacylglycerides thus obtained. The invention also relates to the
nucleic acids, and constructs, vectors and transgenic organisms
comprising the same, as well as oils, lipids and/or fatty acids produced
by the process according to the invention and to their use.Claims:
1. A process for the production of a transgenic organism having a content
of at least 1% by weight of docosahexaenoic acid and/or eicosapentaenoic
acid based on the total lipid content of the transgenic organism, said
process comprises: a) introducing, into the organism, at least one
nucleic acid encoding a polypeptide with .DELTA.6-desaturase activity; b)
introducing, into the organism, at least one nucleic acid encoding a
polypeptide with .DELTA.6-elongase activity; c) introducing, into the
organism, at least one nucleic acid encoding a polypeptide with
.DELTA.5-desaturase activity; d) introducing, into the organism, at least
one nucleic acid encoding a polypeptide with .DELTA.5-elongase activity;
and e) introducing, into the organism, at least one nucleic acid encoding
a polypeptide with .DELTA.4-desaturase activity, wherein the at least one
nucleic acid encoding a polypeptide with .DELTA.6-desaturase activity
comprises: i) the nucleotide sequence of SEQ ID NO: 17, SEQ ID NO: 19,
SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 71, SEQ ID NO:
73, SEQ ID NO: 89 or SEQ ID NO: 97; ii) a nucleotide sequence encoding
the amino acid sequence of SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22,
SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 90
or SEQ ID NO: 98; or iii) a nucleotide sequence encoding a polypeptide
having at least 70% sequence identity to the amino acid sequence of SEQ
ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26,
SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 90 or SEQ ID NO: 98.
2. The process of claim 1, wherein the at least one nucleic acid encoding a polypeptide with .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase, or .DELTA.4-desaturase activity is selected from the group consisting of: a) a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, or SEQ ID NO: 183; b) a nucleic acid encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, or SEQ ID NO: 184; and c) a nucleic acid encoding a polypeptide having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, or SEQ ID NO: 184.
3. The process of claim 1, wherein a nucleic acid encoding a polypeptide with .omega.3-desaturase activity is additionally introduced into the organism, wherein said nucleic acid comprises: a) the nucleotide sequence of SEQ ID NO: 87 or SEQ ID NO: 105; b) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 88 or SEQ ID NO: 106; or iii) a nucleotide sequence encoding a polypeptide having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 88 or SEQ ID NO: 106.
4. The process of claim 1, wherein a nucleic acid encoding a polypeptide with .DELTA.12-desaturase activity is additionally introduced into the organism, wherein said nucleic acid comprises: a) the nucleotide sequence of SEQ ID NO: 107 or SEQ ID NO: 109; b) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 108 or SEQ ID NO: 110; or iii) a nucleotide sequence encoding a polypeptide having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 108 or SEQ ID NO: 110.
5. The process of claim 1, wherein the transgenic organism is a transgenic microorganism or a transgenic plant.
6. The process of claim 5, wherein the plant is an oil-producing plant, a vegetable plant or an ornamental.
7. The process of claim 1, wherein the transgenic organism is a transgenic plant selected from the group consisting of the plant families: Adelotheciaceae, Anacardiaceae, Asteraceae, Apiaceae, Betulaceae, Boraginaceae, Brassicaceae, Bromeliaceae, Caricaceae, Cannabaceae, Convolvulaceae, Chenopodiaceae, Crypthecodiniaceae, Cucurbitaceae, Ditrichaceae, Elaeagnaceae, Ericaceae, Euphorbiaceae, Fabaceae, Geraniaceae, Gramineae, Juglandaceae, Lauraceae, Leguminosae, Linaceae and Prasinophyceae.
8. The process of claim 1, wherein the docosahexaenoic acid and/or eicosapentaenoic acid is isolated from the organism in the form of oils, lipids or free fatty acids.
9. The process of claim 1, wherein the docosahexaenoic acid or eicosapentaenoic acid is isolated in a concentration of at least 5% by weight based on the total lipid content of the transgenic organism.
10. The process of claim 1, wherein the at least one nucleic acid encoding a polypeptide with .DELTA.6-desaturase activity comprises: a) a nucleotide sequence having at least 70% sequence identity to the nucleotide sequence of SEQ ID NO: 17; or b) a nucleotide sequence encoding a polypeptide having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 18.
11. A transgenic plant obtained by the process of claim 5, or a plant part or seed thereof, wherein said transgenic plant, or said plant part or seed thereof, comprises: a) the at least one nucleic acid sequence which encodes a polypeptide with .DELTA.6-desaturase activity; b) the at least one nucleic acid sequence which encodes a polypeptide with .DELTA.6-elongase activity; c) the at least one nucleic acid sequence which encodes a polypeptide with .DELTA.5-desaturase activity; d) the at least one nucleic acid sequence which encodes a polypeptide with .DELTA.5-elongase activity; and e) the at least one nucleic acid sequence which encodes a polypeptide with .DELTA.4-desaturase activity, and wherein said transgenic plant, or said plant part or seed thereof, has a content of at least 1% by weight of docosahexaenoic acid and/or eicosapentaenoic acid based on the total lipid content of said transgenic plant, or said plant part or seed thereof.
12. A process for the production of oils, lipids, or fatty acids, said process comprises: a) obtaining the transgenic plant of claim 11; and b) isolating oils, lipids, or fatty acids from said transgenic plant or seeds thereof.
13. The process of claim 12, wherein the oils, lipids, or fatty acids are isolated from the seeds of said transgenic plant.
14. A process for the production of feedstuffs, foodstuffs, cosmetics or pharmaceuticals, said process comprises: a) obtaining oils, lipids, or fatty acids produced by the process of claim 12; and b) processing said oils, lipids, or fatty acids to produce feedstuffs, foodstuffs, cosmetics or pharmaceuticals.
15. A process for the production of a transgenic organism having a content of at least 1% by weight of docosahexaenoic acid and/or eicosapentaenoic acid based on the total lipid content of the transgenic organism, said process comprises: a) introducing, into the organism, at least one nucleic acid encoding a polypeptide with .DELTA.6-desaturase activity; b) introducing, into the organism, at least one nucleic acid encoding a polypeptide with .DELTA.6-elongase activity; c) introducing, into the organism, at least one nucleic acid encoding a polypeptide with .DELTA.5-desaturase activity; d) introducing, into the organism, at least one nucleic acid encoding a polypeptide with .DELTA.5-elongase activity; and e) introducing, into the organism, at least one nucleic acid encoding a polypeptide with .DELTA.4-desaturase activity, wherein the at least one nucleic acid encoding a polypeptide with .DELTA.6-elongase activity comprises: i) the nucleotide sequence of SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 69, SEQ ID NO: 81, SEQ ID NO: 111, or SEQ ID NO: 183; ii) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 70, SEQ ID NO: 82, SEQ ID NO: 112, or SEQ ID NO: 184; iii) a nucleotide sequence encoding a polypeptide having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 70, SEQ ID NO: 82, SEQ ID NO: 112, or SEQ ID NO: 184.
16. The process of claim 15, wherein the at least one nucleic acid encoding a polypeptide with .DELTA.6-desaturase, .DELTA.5-desaturase, .DELTA.5-elongase, or .DELTA.4-desaturase activity is selected from the group consisting of: a) a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137; b) a nucleic acid encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, or SEQ ID NO: 138; and c) a nucleic acid encoding a polypeptide having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, or SEQ ID NO: 138.
17. The process of claim 15, wherein a nucleic acid encoding a polypeptide with .omega.3-desaturase activity and/or a nucleic acid encoding a polypeptide with .DELTA.12-desaturase activity is additionally introduced into the organism, wherein said nucleic acid comprises: a) the nucleotide sequence of SEQ ID NO: 87, SEQ ID NO: 105, SEQ ID NO: 107 or SEQ ID NO: 109; b) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 88, SEQ ID NO: 106, SEQ ID NO: 108 or SEQ ID NO: 110; or iii) a nucleotide sequence encoding a polypeptide having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 88, SEQ ID NO: 106, SEQ ID NO: 108 or SEQ ID NO: 110.
18. The process of claim 15, wherein the transgenic organism is a transgenic microorganism or a transgenic plant.
19. The process of claim 15, wherein the at least one nucleic acid encoding a polypeptide with .DELTA.6-desaturase activity comprises: a) a nucleotide sequence having at least 70% sequence identity to the nucleotide sequence of SEQ ID NO: 37; or b) a nucleotide sequence encoding a polypeptide having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 38.
20. A process for the production of a transgenic organism having a content of at least 1% by weight of docosahexaenoic acid and/or eicosapentaenoic acid based on the total lipid content of the transgenic organism, said process comprises: a) introducing, into the organism, at least one nucleic acid encoding a polypeptide with .DELTA.6-desaturase activity; b) introducing, into the organism, at least one nucleic acid encoding a polypeptide with .DELTA.6-elongase activity; c) introducing, into the organism, at least one nucleic acid encoding a polypeptide with .DELTA.5-desaturase activity; d) introducing, into the organism, at least one nucleic acid encoding a polypeptide with .DELTA.5-elongase activity; and e) introducing, into the organism, at least one nucleic acid encoding a polypeptide with .DELTA.4-desaturase activity, wherein the at least one nucleic acid encoding a polypeptide with .DELTA.6-desaturase activity comprises: i) the nucleotide sequence of SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 89 or SEQ ID NO: 97; ii) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 90 or SEQ ID NO: 98; or iii) a nucleotide sequence encoding a polypeptide having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 90 or SEQ ID NO: 98, and wherein the at least one nucleic acid encoding a polypeptide with .DELTA.6-elongase activity comprises: i) the nucleotide sequence of SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 69, SEQ ID NO: 81, SEQ ID NO: 111, or SEQ ID NO: 183; ii) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 70, SEQ ID NO: 82, SEQ ID NO: 112, or SEQ ID NO: 184; iii) a nucleotide sequence encoding a polypeptide having at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 70, SEQ ID NO: 82, SEQ ID NO: 112, or SEQ ID NO: 184.
Description:
RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser. No. 10/566,944, filed Feb. 1, 2006, which is a national stage application (under 35 U.S.C. 371) of PCT/EP2004/007957 filed Jul. 16, 2004, which claims benefit to German application 103 35 992.3 filed Aug. 1, 2003, German application 103 44 557.9 filed Sep. 24, 2003, German application 103 47 869.8 filed Oct. 10, 2003, German application 103 59 593.7 filed Dec. 18, 2003, German application 10 2004 009 457.8 filed Feb. 27, 2004, German application 10 2004 012 370.5 filed Mar. 13, 2004, and German application 10 2004 024 014.0 filed May 14, 2004. The entire contents of each of these applications are hereby incorporated by reference herein in their entirety.
SUBMISSION OF SEQUENCE LISTING
[0002] The Sequence Listing associated with this application is filed in electronic format via EFS-Web and hereby incorporated by reference into the specification in its entirety. The name of the text file containing the Sequence Listing is Sequence_Listing_074008_0193_01. The size of the text file is 562 KB, and the text file was created on Aug. 16, 2016.
FIELD OF THE INVENTION
[0003] The present invention relates to a process for the production of polyunsaturated fatty acids in an organism by introducing, into the organism, nucleic acids which encode polypeptides with .DELTA.5-elongase activity. These nucleic acid sequences, if appropriate together with further nucleic acid sequences which encode polypeptides of the biosynthesis of the fatty acid or lipid metabolism, can advantageously be expressed in the organism. Especially advantageous are nucleic acid sequences which encode a .DELTA.6-desaturase, a .DELTA.5-desaturase, .DELTA.4-desaturase, .DELTA.12-desaturase and/or .DELTA.6-elongase activity. These desaturases and elongases are advantageously derived from Thalassiosira, Euglena or Ostreococcus. The invention furthermore relates to a process for the production of oils and/or triacylglycerides with an elevated content of long-chain polyunsaturated fatty acids.
[0004] In a preferred embodiment, the present invention furthermore relates to a method for the production of unsaturated .omega.3-fatty acids and to a method for the production of triglycerides with an elevated content of unsaturated fatty acids, especially .omega.3-fatty acids with more than three double bonds. The invention relates to the generation of a transgenic organism, preferably a transgenic plant or a transgenic microorganism, with an elevated content of unsaturated .omega.3-fatty acids, oils or lipids with .omega.3-double bonds as the result of the expression of the elongases and desaturases used in the method according to the invention, advantageously in conjunction with .omega.3-desaturases, for example an .omega.3-desaturase from fungi of the family Pythiaceae such as the genus Phytophthora, for example the genus and species Phytophthora infestans, or an .omega.3-desaturase from algae such as the family of the Prasinophyceae, for example the genus Ostreococcus, specifically the genus and species Ostreococcus tauri, or diatoms such as the genus Thalassiosira, specifically the genus and species Thalassiosira pseudonana.
[0005] The invention furthermore relates to the nucleic acid sequences, nucleic acid constructs, vectors and organisms comprising the nucleic acid sequences according to the invention, vectors comprising the nucleic acid sequences and/or the nucleic acid constructs and to transgenic organisms comprising the abovementioned nucleic acid sequences, nucleic acid constructs and/or vectors.
[0006] A further part of the invention relates to oils, lipids and/or fatty acids produced by the process according to the invention and to their use. Moreover, the invention relates to unsaturated fatty acids and to triglycerides with an elevated content of unsaturated fatty acids and to their use.
DESCRIPTION OF RELATED ART
[0007] Fatty acids and triacylglycerides have a multiplicity of applications in the food industry, in animal nutrition, in cosmetics and in the pharmacological sector. Depending on whether they are free saturated or unsaturated fatty acids or else triacylglycerides with an elevated content of saturated or unsaturated fatty acids, they are suitable for very different applications. Polyunsaturated fatty acids such as linoleic acid and linolenic acid are essential for mammals, since they cannot be produced by the latter. Polyunsaturated .omega.3-fatty acids and .omega.6-fatty acids are therefore an important constituent in animal and human nutrition.
[0008] Polyunsaturated long-chain .omega.3-fatty acids such as eicosapentaenoic acid (=EPA, C20:5.sup..DELTA.5,8,11,14,17) or docosahexaenoic acid (=DHA, C22:6.sup..DELTA.4,7,10,13,16,19) are important components in human nutrition owing to their various roles in health aspects, including the development of the child brain, the functionality of the eyes, the synthesis of hormones and other signal substances, and the prevention of cardiovascular disorders, cancer and diabetes (Poulos, A Lipids 30:1-14, 1995; Horrocks, L A and Yeo Y K Pharmacol Res 40:211-225, 1999). This is why there is a demand for the production of polyunsaturated long-chain fatty acids.
[0009] Owing to the present-day composition of human food, an addition of polyunsaturated .omega.3-fatty acids, which are preferentially found in fish oils, to the food is particularly important.
[0010] Thus, for example, polyunsaturated fatty acids such as docosahexaenoic acid (=DHA, C22:6.sup..DELTA.4,7,10,13,16,19) or eicosapentaenoic acid (=EPA, C20:5.sup..DELTA.5,8,11,14,17) are added to infant formula to improve the nutritional value. The unsaturated fatty acid DHA is said to have a positive effect on the development and maintenance of brain functions.
[0011] Hereinbelow, polyunsaturated fatty acids are referred to as PUFA, PUFAs, LCPUFA or LCPUFAs (poly unsaturated fatty acids, PUFA, long chain poly unsaturated fatty acids, LCPUFA).
[0012] The various fatty acids and triglycerides are mainly obtained from microorganisms such as Mortierella and Schizochytrium or from oil-producing plants such as soybean, oilseed rape, algae such as Crypthecodinium or Phaeodactylum and others, where they are obtained, as a rule, in the form of their triacylglycerides (=triglycerides=triglycerols). However, they can also be obtained from animals, such as, for example, fish. The free fatty acids are advantageously prepared by hydrolysis. Very long-chain polyunsaturated fatty acids such as DHA, EPA, arachidonic acid (=ARA, C20:4.sup..DELTA.5,8,11,14), dihomo-.gamma.-linolenic acid (C20:3.sup..DELTA.8,11,14) or docosapentaenoic acid (DPA, C22:5.sup..DELTA.7,10,13,16,19) are not synthesized in oil crops such as oilseed rape, soybean, sunflower or safflower. Conventional natural sources of these fatty acids are fish such as herring, salmon, sardine, redfish, eel, carp, trout, halibut, mackerel, zander or tuna, or algae.
[0013] Depending on the intended use, oils with saturated or unsaturated fatty acids are preferred. In human nutrition, for example, lipids with unsaturated fatty acids, specifically polyunsaturated fatty acids, are preferred. The polyunsaturated .omega.3-fatty acids are said to have a positive effect on the cholesterol level in the blood and thus on the possibility of preventing heart disease. The risk of heart disease, stroke or hypertension can be reduced markedly by adding these .omega.3-fatty acids to the food. Also, .omega.3-fatty acids have a positive effect on inflammatory, specifically on chronically inflammatory, processes in association with immunological diseases such as rheumatoid arthritis. They are therefore added to foodstuffs, specifically to dietetic foodstuffs, or are employed in medicaments. .omega.6-Fatty acids such as arachidonic acid tend to have a negative effect on these disorders in connection with these rheumatic diseases on account of our usual dietary intake.
[0014] .omega.3- and .omega.6-fatty acids are precursors of tissue hormones, known as eicosanoids, such as the prostaglandins, which are derived from dihomo-.gamma.-linolenic acid, arachidonic acid and eicosapentaenoic acid, and of the thromboxanes and leukotrienes, which are derived from arachidonic acid and eicosapentaenoic acid. Eicosanoids (known as the PG.sub.2 series) which are formed from .omega.6-fatty acids generally promote inflammatory reactions, while eicosanoids (known as the PG.sub.3 series) from .omega.3-fatty acids have little or no proinflammatory effect.
[0015] Owing to the positive characteristics of the polyunsaturated fatty acids, there has been no lack of attempts in the past to make available genes which are involved in the synthesis of these fatty acids or triglycerides for the production of oils in various organisms with a modified content of unsaturated fatty acids. Thus, WO 91/13972 and its US equivalent describes a .DELTA.9-desaturase. WO 93/11245 claims a .DELTA.15-desaturase and WO 94/11516 a .DELTA.12-desaturase. Further desaturases are described, for example, in EP-A-0 550 162, WO 94/18337, WO 97/30582, WO 97/21340, WO 95/18222, EP-A-0 794 250, Stukey et al., J. Biol. Chem., 265, 1990: 20144-20149, Wada et al., Nature 347, 1990: 200-203 or Huang et al., Lipids 34, 1999: 649-659. However, the biochemical characterization of the various desaturases has been insufficient to date since the enzymes, being membrane-bound proteins, present great difficulty in their isolation and characterization (McKeon et al., Methods in Enzymol. 71, 1981: 12141-12147, Wang et al., Plant Physiol. Biochem., 26, 1988: 777-792). As a rule, membrane-bound desaturases are characterized by being introduced into a suitable organism which is subsequently analyzed for enzyme activity by analyzing the starting materials and the products. .DELTA.6-Desaturases are described in WO 93/06712, U.S. Pat. No. 5,614,393, U.S. Pat. No. 5,614,393, WO 96/21022, WO 00/21557 and WO 99/27111 and the application for the production of fatty acids in transgenic organisms is described in WO 98/46763, WO 98/46764 and WO 98/46765. In this context, the expression of various desaturases and the formation of polyunsaturated fatty acids is also described and claimed in WO 99/64616 or WO 98/46776. As regards the expression efficacy of desaturases and its effect on the formation of polyunsaturated fatty acids, it must be noted that the expression of a single desaturase as described to date has only resulted in low contents of unsaturated fatty acids/lipids such as, for example, .gamma.-linolenic acid and stearidonic acid. Moreover, a mixture of .omega.3- and .omega.6-fatty acids was obtained, as a rule.
[0016] Especially suitable microorganisms for the production of PUFAs are microalgae such as Phaeodactylum tricornutum, Porphiridium species, Thraustochytrium species, Schizochytrium species or Crypthecodinium species, ciliates such as Stylonychia or Colpidium, fungae such as Mortierella, Entomophthora or Mucor and/or mosses such as Physcomitrella, Ceratodon and Marchantia (R. Vazhappilly & F. Chen (1998) Botanica Marina 41: 553-558; K. Totani & K. Oba (1987) Lipids 22: 1060-1062; M. Akimoto et al. (1998) Appl. Biochemistry and Biotechnology 73: 269-278). Strain selection has resulted in the development of a number of mutant strains of the microorganisms in question which produce a series of desirable compounds including PUFAs. However, the mutation and selection of strains with an improved production of a particular molecule such as the polyunsaturated fatty acids is a time-consuming and difficult process. This is why recombinant methods as described above are preferred whenever possible.
[0017] However, only limited amounts of the desired polyunsaturated fatty acids such as DPA, EPA or ARA can be produced with the aid of the abovementioned microorganisms, and, depending on the microorganism used, these are generally obtained as fatty acid mixtures of, for example, EPA, DPA and ARA.
[0018] A variety of synthetic pathways is being discussed for the synthesis of arachidonic acid, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) (FIG. 1). Thus, EPA or DHA are produced in marine bacteria such as Vibrio sp. or Shewanella sp. via the polyketide pathway (Yu, R. et al. Lipids 35:1061-1064, 2000; Takeyama, H. et al. Micro-biology 143:2725-2731, 1997).
[0019] An alternative strategy is the alternating activity of desaturases and elongases (Zank, T. K. et al. Plant Journal 31:255-268, 2002; Sakuradani, E. et al. Gene 238:445-453, 1999). A modification of the above-described pathway by .DELTA.6-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase and .DELTA.4-desaturase is the Sprecher pathway (Sprecher 2000, Biochim. Biophys. Acta 1486:219-231) in mammals. Instead of the .DELTA.4-desaturation, a further elongation step is effected here to give C.sub.24, followed by a further .DELTA.6-desaturation and finally .beta.-oxidation to give the C.sub.22 chain length. Thus what is known as Sprecher pathway (see FIG. 1) is, however, not suitable for the production in plants and microorganisms since the regulatory mechanisms are not known.
[0020] Depending on their desaturation pattern, the polyunsaturated fatty acids can be divided into two large classes, viz. .omega.6- or .omega.3-fatty acids, which differ with regard to their metabolic and functional activities (FIG. 1).
[0021] The starting material for the .omega.6-metabolic pathway is the fatty acid linoleic acid (18:2.sup..DELTA.9,12) while the .omega.3-pathway proceeds via linolenic acid (18:3.sup..DELTA.9,12,15). Linolenic acid is formed by the activity of an .omega.3-desaturase (Tocher et al. 1998, Prog. Lipid Res. 37, 73-117; Domergue et al. 2002, Eur. J. Biochem. 269, 4105-4113).
[0022] Mammals, and thus also humans, have no corresponding desaturase activity (.DELTA.12- and .omega.3-desaturase) and must take up these fatty acids (essential fatty acids) via the food. Starting with these precursors, the physiologically important polyunsaturated fatty acids arachidonic acid (=ARA, 20:4.sup..DELTA.5,8,11,14), an .omega.6-fatty acid and the two .omega.3-fatty acids eicosapentaenoic acid (=EPA, 20:5.sup..DELTA.5,8,11,14,17) and docosahexaenoic acid (DHA, 22:6.sup..DELTA.4,7,10,13,17,19) are synthesized via the sequence of desaturase and elongase reactions. The application of .omega.3-fatty acids shows the therapeutic activity described above in the treatment of cardiovascular diseases (Shimikawa 2001, World Rev. Nutr. Diet. 88, 100-108), Entzundungen (Calder 2002, Proc. Nutr. Soc. 61, 345-358) and Arthritis (Cleland and James 2000, J. Rheumatol. 27, 2305-2307).
[0023] As regards the physiology of nutrition, it is therefore important, when synthesizing polyunsaturated fatty acids, to achieve a shift between the .omega.6-synthetic pathway and the .omega.3-synthetic pathway (see FIG. 1) so that more .omega.3-fatty acids are produced. The enzymatic activities of a variety of .omega.3-desaturases which desaturate C.sub.18:2-, C.sub.22:4- or C.sub.22:5-fatty acids have been described in the literature (see FIG. 1). However, none of the desaturases which have been described in terms of biochemistry converts a broad substrate spectrum of the .omega.6-synthetic pathway into the corresponding fatty acids of the .omega.3-synthetic pathway.
[0024] There is therefore a continuing high demand for an .omega.3-desaturase which is suitable for the production of .omega.3-polyunsaturated fatty acids. All known plant and cyanobacterial .omega.3-desaturases desaturate C.sub.18-fatty acids with linoleic acid as substrate, but cannot desaturate any C.sub.20- or C.sub.22-fatty acids.
[0025] The fungus Saprolegnia dicilina is known to have an .omega.3-desaturase [Pereira et al. 2004, Biochem. J. 378(Pt 2):665-71] which can desaturate C.sub.20-polyunsaturated fatty acids. However, the disadvantage is that this .omega.3-desaturase cannot desaturate any C.sub.18- or C.sub.22-PUFAs such as the important fatty acids C.sub.18:2-, C.sub.22:4- or C.sub.22:5-fatty acids of the .omega.6-synthetic pathway. A further disadvantage of this enzyme is that it cannot desaturate any fatty acids which are bound to phospholipids. Only the CoA-fatty acid esters are converted.
[0026] The elongation of fatty acids, by elongases, by 2 or 4 C atoms is of crucial importance for the production of C.sub.20- and C.sub.22-PUFAs, respectively. This process proceeds via 4 steps. The first step is the condensation of malonyl-CoA with the fatty-acid-acyl-CoA by ketoacyl-CoA synthase (KCS, hereinbelow referred to as elongase). This is followed by a reduction step (ketoacyl-CoA reductase, KCR), a dehydration step (dehydratase) and a final reduction step (enoyl-CoA reductase). It has been postulated that the elongase activity affects the specificity and rate of the entire process (Millar and Kunst, 1997 Plant Journal 12:121-131).
[0027] There have been a large number of attempts in the past to obtain elongase genes. Millar and Kunst, 1997 (Plant Journal 12:121-131) and Millar et al. 1999, (Plant Cell 11:825-838) describe the characterization of plant elongases for the synthesis of monounsaturated long-chain fatty acids (C22:1) and for the synthesis of very long-chain fatty acids for the formation of waxes in plants (C.sub.28-C.sub.32). Descriptions regarding the synthesis of arachidonic acid and EPA are found, for example, in WO0159128, WO0012720, WO02077213 and WO0208401. The synthesis of polyunsaturated C.sub.24-fatty acids is described, for example, in Tvrdik et al. 2000, JCB 149:707-717 or WO0244320.
[0028] No specific elongase has been described to date for the production of DHA (C22:6 n-3) in organisms which do not naturally produce this fatty acid. Only elongases which provide C.sub.20- or C.sub.24-fatty acids have been described to date. A .DELTA.5-elongase activity has not been described to date.
[0029] Higher plants comprise polyunsaturated fatty acids such as linoleic acid (C18:2) and linolenic acid (C18:3). ARA, EPA and DHA are found not at all in the seed oil of higher plants, or only in miniscule amounts (E. Ucciani: Nouveau Dictionnaire des Huiles Vege-tales [New Dictionary of Vegetable Oils]. Technique & Documentation--Lavoisier, 1995. ISBN: 2-7430-0009-0). However, the production of LCPUFAs in higher plants, preferably in oil crops such as oilseed rape, linseed, sunflower and soybeans, would be advantageous since large amounts of high-quality LCPUFAs for the food industry, animal nutrition and pharmaceutical purposes might be obtained economically. To this end, it is advantageous to introduce, into oil crops, genes which encode enzymes of the LCPUFA biosynthesis via recombinant methods and to express them therein. These genes encode for example .DELTA.6-desaturases, .DELTA.6-elongases, .DELTA.5-desaturases or .DELTA.4-desaturases. These genes can advantageously be isolated from microorganisms and lower plants which produce LCPUFAs and incorporate them in the membranes or triacylglycerides. Thus, it has already been possible to isolate .DELTA.6-desaturase genes from the moss Physcomitrella patens and .DELTA.6-elongase genes from P. patens and from the nematode C. elegans.
[0030] The first transgenic plants which comprise and express genes encoding LCPUFA biosynthesis enzymes and which, as a consequence, produce LCPUFAs were described for the first time, for example, in DE-A-102 19 203 (process for the production of polyunsaturated fatty acids in plants). However, these plants produce LCPUFAs in amounts which require further optimization for processing the oils which are present in the plants.
[0031] To make possible the fortification of food and/or of feed with these polyunsaturated fatty acids, there is therefore a great need for a simple, inexpensive process for the production of these polyunsaturated fatty acids, specifically in eukaryotic systems.
BRIEF DESCRIPTION OF THE DRAWINGS
[0032] FIG. 1 shows various synthetic pathways for the biosynthesis of DHA (docosahexaenoic acid).
[0033] FIG. 2 shows substrate specificity of the .DELTA.5-elongase (SEQ ID NO: 53) for various fatty acids.
[0034] FIG. 3 shows reconstitution of DHA biosynthesis in yeast starting from 20:5.omega.3.
[0035] FIG. 4 shows reconstitution of DHA biosynthesis in yeast starting from 18:4.omega.3.
[0036] FIG. 5 shows fatty acid composition (in mol %) of transgenic yeasts which had been transformed with the vectors pYes3-OmELO3 (SEQ ID NO: 53)/pYes2-EgD4 (SEQ ID NO: 39) or pYes3-OmELO3 (SEQ ID NO: 53)/pYes2-EgD4 (SEQ ID NO: 39)+pESCLeu-PtD5 (SEQ ID NO: 5).
[0037] FIG. 6 shows feeding experiment for determining the functionality and substrate specificity with yeast strains.
[0038] FIG. 7 shows elongation of eicosapentaenoic acid by OtElo1 (SEQ ID NO: 67).
[0039] FIG. 8 shows elongation of arachidonic acid by OtElo1 (SEQ ID NO: 67).
[0040] FIG. 9 shows expression of TpELO1 (SEQ ID NO: 67) in yeast.
[0041] FIG. 10 shows expression of TpELO3 (SEQ ID NO: 45) in yeast.
[0042] FIG. 11 shows expression of Thraustochytrium .DELTA.5-elongase TL16/pYES2.1 in yeast.
[0043] FIG. 12 shows desaturation of linoleic acid (18:2.omega.6-fatty acid) to give adinolenic acid (18:3 .omega.3-fatty acid) by Pi-omega3Des (SEQ ID NO: 87).
[0044] FIG. 13 shows desaturation of .gamma.-linolenic acid (18:3 .omega.6-fatty acid) to give stearidonic acid (18:4 .omega.3-fatty acid) by Pi-omega3Des (SEQ ID NO: 87).
[0045] FIG. 14 shows desaturation of C20:2 .omega.6-fatty acid to give C20:3 .omega.3-fatty acid by Pi-omega3Des (SEQ ID NO: 87).
[0046] FIG. 15 shows desaturation of C20:3 .omega.6-fatty acid to give C20:4 .omega.3-fatty acid by Pi-omega3Des (SEQ ID NO: 87).
[0047] FIG. 16 shows desaturation of arachidonic acid (C20:4 .omega.6-fatty acid) to give eicosapentaenoic acid (C20:5 .omega.3-fatty acid) by Pi-omega3Des (SEQ ID NO: 87).
[0048] FIG. 17 shows desaturation of docosatetraenoic acid (C22:4 .omega.6-fatty acid) to give docosapentaenoic acid (C22:5 .omega.3-fatty acid) by Pi-omega3Des (SEQ ID NO: 87).
[0049] FIG. 18 shows substrate specificity of Pi-omega3Des (SEQ ID NO: 87) for various fatty acids.
[0050] FIG. 19 shows desaturation of phospholipid-bound arachidonic acid to EPA by Pi-Omega3Des (SEQ ID NO: 87).
[0051] FIG. 20 shows conversion by OtDes6.1 (SEQ ID NO: 89) of linoleic acid (arrow) into .gamma.-linolenic acid (.gamma.-18:3).
[0052] FIG. 21 shows conversion of linoleic acid and .alpha.-linolenic acid (A and C) and reconstitution of the ARA and EPA synthetic pathways, respectively, in yeast (B and D) in the presence of OtD6.1 (SEQ ID NO: 89).
[0053] FIG. 22 shows expression of ELO(XI) (SEQ ID NO: 117) in yeast.
[0054] FIG. 23 shows the substrate specificity of ELO (Ci) (SEQ ID NO: 119) after expression and after feeding various fatty acids.
[0055] FIG. 24 shows elongation of eicosapentaenoic acid by OtElo1 (SEQ ID NO: 67) (B) and OtElo1.2 (SEQ ID NO: 113) (D), respectively. The controls (A, C) do not show the elongation product (22:5.omega.3).
[0056] FIG. 25 shows elongation of arachidonic acid by OtElo1 (SEQ ID NO: 67) (B) and OtElo1.2 (SEQ ID NO: 113) (D), respectively. The controls (A, C) do not show the elongation product (22:4.omega.6).
[0057] FIG. 26 shows elongation of 20:5n-3 by the elongases elongase At3g06470 (SEQ ID NO:137).
[0058] FIG. 27 shows substrate specificity of the Xenopus Elongase (A), the Ciona Elongase (B) and the Oncorhynchus Elongase (C).
[0059] FIG. 28 shows substrate specificity of the Ostreococcus .DELTA.5-elongase (A), the Ostreococcus .DELTA.6-elongase (B), the Thalassiosira .DELTA.5-elongase (C) and Thalassiosira Ostreococcus .DELTA.6-elongase (D).
[0060] FIG. 29 shows expression of the Phaeodactylum tricornutum .DELTA.6-elongase (PtELO6; SEQ ID NO: 183) in yeast. A) shows the elongation of the C18:3.sup..DELTA.6,9,12-fatty acid and B) the elongation of the C18:4.sup..DELTA.6,9,12,15-fatty acid.
[0061] FIG. 30 shows the substrate specificity of PtELO6 (SEQ ID NO: 183) with regard to the substrates fed.
DETAILED DESCRIPTION OF THE INVENTION
[0062] It was therefore an object to provide further genes or enzymes which are suitable for the synthesis of LCPUFAs, specifically genes with .DELTA.5-elongase, .DELTA.5-desaturase, .DELTA.4-desaturase, 2-desaturase or .DELTA.6-desaturase activity, for the production of polyunsaturated fatty acids. A further object of the present invention was the provision of genes or enzymes which make possible a shift from the .omega.6-fatty acids to the .omega.3-fatty acids. Another object was to develop a process for the production of polyunsaturated fatty acids in an organism, advantageously in a eukaryotic organism, preferably in a plant or a microorganism. This object was achieved by the process according to the invention for the production of compounds of the formula I
##STR00001##
in transgenic organisms with a content of at least 1% by weight of these compounds based on the total lipid content of the transgenic organism, which comprises the following process steps:
[0063] a) introducing, into the organism, at least one nucleic acid sequence which encodes a .DELTA.9-elongase and/or a .DELTA.6-desaturase activity, and
[0064] b) introducing, into the organism, at least one nucleic acid sequence which encodes a .DELTA.8-desaturase and/or a .DELTA.6-elongase activity, and
[0065] c) introducing, into the organism, at least one nucleic acid sequence which encodes a .DELTA.5-desaturase activity, and
[0066] d) introducing, into the organism, at least one nucleic acid sequence which encodes a .DELTA.5-elongase activity, and
[0067] e) introducing, into the organism, at least one nucleic acid sequence which encodes a .DELTA.4-desaturase activity, and where the variables and substituents in formula I have the following meanings:
[0068] R.sup.1=hydroxyl, coenzyme A (thioester), lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylglycerol, lysodiphosphatidylglycerol, lysophosphatidylserine, lysophosphatidylinositol, sphingo base or a radical of the formula II
[0068] ##STR00002##
[0069] in which
[0070] R.sup.2=hydrogen, lysophosphatidyl choline, lysophosphatidylethanolamine, lysophosphatidylglycerol, lysodiphosphatidylglycerol, lysophosphatidylserine, lysophosphatidylinositol or saturated or unsaturated C.sub.2-C.sub.24-alkylcarbonyl,
[0071] R.sup.3=hydrogen, saturated or unsaturated C.sub.2-C.sub.24-alkylcarbonyl, or R.sup.2 and R.sup.3 independently of one another are a radical of the formula Ia:
##STR00003##
[0071] in which n=2, 3, 4, 5, 6, 7 or 9, m=2, 3, 4, 5 or 6 and p=0 or 3.
[0072] R.sup.1 in the formula I is hydroxyl, coenzyme A (thioester), lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylglycerol, lysodiphosphatidylglycerol, lysophosphatidylserine, lysophosphatidylinositol, sphingo base or a radical of the formula II
##STR00004##
[0073] The abovementioned radicals of R.sup.1 are always bonded to the compounds of the formula I in the form of their thioesters.
[0074] R.sup.2 in the formula II is hydrogen, lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylglycerol, lysodiphosphatidylglycerol, lysophosphatidylserine, lysophosphatidylinositol or saturated or unsaturated C.sub.2-C.sub.24-alkylcarbonyl.
[0075] Alkyl radicals which may be mentioned are substituted or unsubstituted, saturated or unsaturated C.sub.2-C.sub.24-alkylcarbonyl chains such as ethylcarbonyl, n-propylcarbonyl, n-butylcarbonyl, n-pentylcarbonyl, n-hexylcarbonyl, n-heptylcarbonyl, n-octylcarbonyl, n-nonylcarbonyl, n-decylcarbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-heptadecylcarbonyl, n-octadecylcarbonyl-, n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbonyl- or n-tetracosanylcarbonyl, which comprise one or more double bonds. Saturated or unsaturated C.sub.10-C.sub.22-alkylcarbonyl radicals such as n-decylcarbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-heptadecylcarbonyl, n-octadecylcarbonyl, n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbonyl or n-tetracosanylcarbonyl, which comprise one or more double bonds are preferred. Especially preferred are saturated and/or unsaturated C.sub.10-C.sub.22-alkylcarbonyl radicals such as C.sub.10-alkylcarbonyl, C.sub.11-alkylcarbonyl, C.sub.12-alkylcarbonyl, C.sub.13-alkylcarbonyl, C.sub.14-alkylcarbonyl, C.sub.16-alkylcarbonyl, C.sub.18-alkylcarbonyl, C.sub.20-alkylcarbonyl or C.sub.22-alkylcarbonyl radicals which comprise one or more double bonds. Very especially preferred are saturated or unsaturated C.sub.16-C.sub.22-alkylcarbonyl radicals such as C.sub.16-alkylcarbonyl, C.sub.18-alkylcarbonyl, C.sub.20-alkylcarbonyl or C.sub.22-alkylcarbonyl radicals which comprise one or more double bonds. These advantageous radicals can comprise two, three, four, five or six double bonds. The especially preferred radicals with 20 or 22 carbon atoms in the fatty acid chain comprise up to six double bonds, advantageously three, four, five or six double bonds, especially preferably five or six double bonds. All the abovementioned radicals are derived from the corresponding fatty acids.
[0076] R.sup.3 in the formula II is hydrogen, saturated or unsaturated C.sub.2-C.sub.24-alkylcarbonyl.
[0077] Alkyl radicals which may be mentioned are substituted or unsubstituted, saturated or unsaturated C.sub.2-C.sub.24-alkylcarbonyl chains such as ethylcarbonyl, n-propylcarbonyl, n-butylcarbonyl-, n-pentylcarbonyl, n-hexylcarbonyl, n-heptylcarbonyl, n-octylcarbonyl, n-nonylcarbonyl, n-decylcarbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-heptadecylcarbonyl, n-octadecylcarbonyl-, n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbonyl- or n-tetracosanylcarbonyl, which comprise one or more double bonds. Saturated or unsaturated C.sub.10-C.sub.22-alkylcarbonyl radicals such as n-decylcarbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-heptadecylcarbonyl, n-octadecylcarbonyl, n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbonyl or n-tetracosanylcarbonyl, which comprise one or more double bonds are preferred. Especially preferred are saturated and/or unsaturated C.sub.10-C.sub.22-alkylcarbonyl radicals such as C.sub.10-alkylcarbonyl, C.sub.11-alkylcarbonyl, C.sub.12-alkylcarbonyl, C.sub.13-alkylcarbonyl, C.sub.14-alkylcarbonyl, C.sub.16-alkylcarbonyl, C.sub.18-alkylcarbonyl, C.sub.20-alkylcarbonyl or C.sub.22-alkylcarbonyl radicals which comprise one or more double bonds. Very especially preferred are saturated or unsaturated C.sub.16-C.sub.22-alkylcarbonyl radicals such as C.sub.16-alkylcarbonyl, C.sub.18-alkylcarbonyl, C.sub.20-alkylcarbonyl or C.sub.22-alkylcarbonyl radicals which comprise one or more double bonds. These advantageous radicals can comprise two, three, four, five or six double bonds. The especially preferred radicals with 20 or 22 carbon atoms in the fatty acid chain comprise up to six double bonds, advantageously three, four, five or six double bonds, especially preferably five or six double bonds. All the abovementioned radicals are derived from the corresponding fatty acids.
[0078] The abovementioned radicals of R.sup.1, R.sup.2 and R.sup.3 can be substituted by hydroxyl and/or epoxy groups and/or can comprise triple bonds.
[0079] The polyunsaturated fatty acids produced in the process according to the invention advantageously comprise at least two, advantageously three, four, five or six, double bonds. The fatty acids especially advantageously comprise four, five or six double bonds. Fatty acids produced in the process advantageously have 18, 20 or 22 C atoms in the fatty acid chain; the fatty acids preferably comprise 20 or 22 carbon atoms in the fatty acid chain. Saturated fatty acids are advantageously reacted to a minor degree, or not at all, by the nucleic acids used in the process. To a minor degree is to be understood as meaning that the saturated fatty acids are reacted with less than 5% of the activity, advantageously less than 3%, especially advantageously with less than 2%, very especially preferably with less than 1, 0.5, 0.25 or 0.125% of the activity in comparison with polyunsaturated fatty acids. These fatty acids which have been produced can be produced in the process as a single product or be present in a fatty acid mixture.
[0080] The nucleic acid sequences used in the process according to the invention are isolated nucleic acid sequences which encode polypeptides with .DELTA.9-elongase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase and/or .DELTA.4-desaturase activity.
[0081] Nucleic acid sequences which are advantageously used in the process according to the invention are those which encode polypeptides with .DELTA.9-elongase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase or .DELTA.4-desaturase activity, selected from the group consisting of:
[0082] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183, or
[0083] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132 or SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 or SEQ ID NO: 184, or
[0084] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183, which encode polypeptides with at least 40% identity at the amino acid level with SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132 or SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 or SEQ ID NO: 184 or and which have .DELTA.9-elongase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase or .DELTA.4-desaturase activity.
[0085] The substituents R.sup.2 or R.sup.3 in the formulae I and II are advantageously and independently of one another saturated or unsaturated C.sub.18-C.sub.22-alkylcarbonyl, especially advantageously they are, independently of one another, unsaturated C.sub.18-, C.sub.20- or C.sub.22-alkylcarbonyl with at least two double bonds.
[0086] A preferred embodiment of the method is characterized in that a nucleic acid sequence which encodes polypeptides with .omega.3-desaturase activity, selected from the group consisting of:
[0087] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 87 or SEQ ID NO: 105, or
[0088] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 88 or SEQ ID NO: 106, or
[0089] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 87 or SEQ ID NO: 105 which encode polypeptides with at least 60% identity at the amino acid level with SEQ ID NO: 88 or SEQ ID NO: 106 and which have .omega.3-desaturase activity. is additionally introduced into the organism.
[0090] In a further preferred embodiment, the process comprises the additional introduction, into the organism, of a nucleic acid sequence which encodes polypeptides with .DELTA.12-desaturase activity, selected from the group consisting of:
[0091] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 107 or SEQ ID NO: 109 or
[0092] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 108 or SEQ ID NO: 110, or
[0093] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 107 or SEQ ID NO: 109 which encode polypeptides with at least 60% identity at the amino acid level with SEQ ID NO: 108 or SEQ ID NO: 110 and which have .DELTA.12-desaturase activity.
[0094] These abovementioned .DELTA.12-desaturase sequences can be used together with the nucleic acid sequences used in the process and which encode .DELTA.9-elongases, .DELTA.6-desaturases, .DELTA.8-desaturases, .DELTA.6-elongases, .DELTA.5-desaturases, .DELTA.5-elongases and/or .DELTA.4-desaturases, alone or in combination with the .omega.3-desaturase sequences.
[0095] Table 1 shows the nucleic acid sequences, the organism of origin and the sequence ID number.
TABLE-US-00001 No. Organism Activity Sequence number 1. Euglena gracilis .DELTA.8-desaturase SEQ ID NO: 1 2. Isochrysis galbana .DELTA.9-elongase SEQ ID NO: 3 3. Phaedodactylum tricornutum .DELTA.5-desaturase SEQ ID NO: 5 4. Ceratodon pupureus .DELTA.5-desaturase SEQ ID NO: 7 5. Physcomitrella patens .DELTA.5-desaturase SEQ ID NO: 9 6. Thraustrochytrium sp. .DELTA.5-desaturase SEQ ID NO: 11 7. Mortierella alpina .DELTA.5-desaturase SEQ ID NO: 13 8. Caenorhabditis elegans .DELTA.5-desaturase SEQ ID NO: 15 9. Borago officinalis .DELTA.6-desaturase SEQ ID NO: 17 10. Ceratodon purpureus .DELTA.6-desaturase SEQ ID NO: 19 11. Phaeodactylum tricornutum .DELTA.6-desaturase SEQ ID NO: 21 12. Physcomitrella patens .DELTA.6-desaturase SEQ ID NO: 23 13. Caenorhabditis elegans .DELTA.6-desaturase SEQ ID NO: 25 14. Physcomitrella patens .DELTA.6-elongase SEQ ID NO: 27 15. Thraustrochytrium sp. .DELTA.6-elongase SEQ ID NO: 29 16. Phytopthera infestans .DELTA.6-elongase SEQ ID NO: 31 17. Mortierella alpina .DELTA.6-elongase SEQ ID NO: 33 18. Mortierella alpina .DELTA.6-elongase SEQ ID NO: 35 19. Caenorhabditis elegans .DELTA.6-elongase SEQ ID NO: 37 20. Euglena gracilis .DELTA.4-desaturase SEQ ID NO: 39 21. Thraustrochytrium sp. .DELTA.4-desaturase SEQ ID NO: 41 22. Thalassiosira pseudonana .DELTA.5-elongase SEQ ID NO: 43 23. Thalassiosira pseudonana .DELTA.5-elongase SEQ ID NO: 45 24. Crypthecodinium cohnii .DELTA.5-elongase SEQ ID NO: 47 25. Crypthecodinium cohnii .DELTA.5-elongase SEQ ID NO: 49 26. Oncorhynchus mykiss .DELTA.5-elongase SEQ ID NO: 51 27. Oncorhynchus mykiss .DELTA.5-elongase SEQ ID NO: 53 28. Thalassiosira pseudonana .DELTA.5-elongase SEQ ID NO: 59 29. Thalassiosira pseudonana .DELTA.5-elongase SEQ ID NO: 61 30. Thalassiosira pseudonana .DELTA.5-elongase SEQ ID NO: 63 31. Thraustrochytrium aureum .DELTA.5-elongase SEQ ID NO: 65 32. Ostreococcus tauri .DELTA.5-elongase SEQ ID NO: 67 33. Ostreococcus tauri .DELTA.6-elongase SEQ ID NO: 69 34. Primula farinosa .DELTA.6-desaturase SEQ ID NO: 71 35. Primula vialii .DELTA.6-desaturase SEQ ID NO: 73 36. Ostreococcus tauri .DELTA.5-elongase SEQ ID NO: 75 37. Ostreococcus tauri .DELTA.5-elongase SEQ ID NO: 77 38. Ostreococcus tauri .DELTA.5-elongase SEQ ID NO: 79 39. Ostreococcus tauri .DELTA.6-elongase SEQ ID NO: 81 40. Thraustrochytrium sp. .DELTA.5-elongase SEQ ID NO: 83 41. Thalassiosira pseudonana .DELTA.5-elongase SEQ ID NO: 85 42. Phytopthora infestans .omega.3-desaturase SEQ ID NO: 87 43. Ostreococcus tauri .DELTA.6-desaturase SEQ ID NO: 89 44. Ostreococcus tauri .DELTA.5-desaturase SEQ ID NO: 91 45. Ostreococcus tauri .DELTA.5-desaturase SEQ ID NO: 93 46. Ostreococcus tauri .DELTA.4-desaturase SEQ ID NO: 95 47. Thalassiosira pseudonana .DELTA.6-desaturase SEQ ID NO: 97 48. Thalassiosira pseudonana .DELTA.5-desaturase SEQ ID NO: 99 49. Thalassiosira pseudonana .DELTA.5-desaturase SEQ ID NO: 101 50. Thalassiosira pseudonana .DELTA.4-desaturase SEQ ID NO: 103 51. Thalassiosira pseudonana .omega.3-desaturase SEQ ID NO: 105 52. Ostreococcus tauri .DELTA.12-desaturase SEQ ID NO: 107 53. Thalassiosira pseudonana .DELTA.12-desaturase SEQ ID NO: 109 54. Ostreococcus tauri .DELTA.6-elongase SEQ ID NO: 111 55. Ostreococcus tauri .DELTA.5-elongase SEQ ID NO: 113 56. Xenopus laevis (BC044967) .DELTA.5-elongase SEQ ID NO: 117 57. Ciona intestinalis (AK112719) .DELTA.5-elongase SEQ ID NO: 119 58. Euglena gracilis .DELTA.5-elongase SEQ ID NO: 131 59. Euglena gracilis .DELTA.5-elongase SEQ ID NO: 133 60. Arabidopsis thaliana .DELTA.5-elongase SEQ ID NO: 135 61. Arabidopsis thaliana .DELTA.5-elongase SEQ ID NO: 137 62. Phaeodactylum tricornutum .DELTA.6-elongase SEQ ID NO: 183
[0096] The polyunsaturated fatty acids produced in the process are advantageously bound in membrane lipids and/or triacylglycerides, but may also occur in the organisms as free fatty acids or else bound in the form of other fatty acid esters. In this context, they may be present as "pure products" or else advantageously in the form of mixtures of various fatty acids or mixtures of different glycerides. The various fatty acids which are bound in the triacylglycerides can be derived from short-chain fatty acids with 4 to 6 C atoms, medium-chain fatty acids with 8 to 12 C atoms or long-chain fatty acids with 14 to 24 C atoms, preferred are long-chain fatty acids more preferably long-chain polyunsaturated fatty acids with 18, 20 and/or 22 C atoms.
[0097] The process according to the invention advantageously yields fatty acid esters with polyunsaturated C.sub.18-, C.sub.20- and/or C.sub.22-fatty acid molecules with at least two double bonds in the fatty acid ester, advantageously with at least three, four, five or six double bonds in the fatty acid ester, especially advantageously with at least five or six double bonds in the fatty acid ester and advantageously leads to the synthesis of linoleic acid (=LA, C18:2.sup..DELTA.9,12), .gamma.-linolenic acid (=GLA, C18:3.sup..DELTA.6,9,12), stearidonic acid (=SDA, C18:4.sup..DELTA.6,9,12,15), dihomo-.gamma.-linolenic acid (=DGLA, 20:3.sup..DELTA.8,11,14), .omega.3-eicosatetraenoic acid (=ETA, C20:4.sup..DELTA.5,8,11,14), arachidonic acid (ARA, C20:4.sup..DELTA.5,8,11,14), eicosapentaenoic acid (EPA, C20:5.sup..DELTA.5,8,11,14,17), .omega.6-docosapentaenoic acid (C22:5.sup..DELTA.4,7,10,13,16), .omega.6-docosatetraenoic acid (C22:4.sup..DELTA.,7,10,13,16), .omega.3-docosapentaenoic acid (=DPA, C22:5.sup..DELTA.7,10,13,16,19), docosahexaenoic acid (=DHA, C22:6.sup..DELTA.4,7,10,13,16,19) or mixtures of these, preferably ARA, EPA and/or DHA. .omega.3-Fatty acids such as EPA and/or DHA are very especially preferably produced.
[0098] The fatty acid esters with polyunsaturated C.sub.18-, C.sub.20- and/or C.sub.22-fatty acid molecules can be isolated in the form of an oil or lipid, for example in the form of compounds such as sphingolipids, phosphoglycerides, lipids, glycolipids such as glycosphingolipids, phospholipids such as phosphatidylethanolamine, phosphatidylcholine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol or diphosphatidylglycerol, monoacylglycerides, diacylglycerides, triacylglycerides or other fatty acid esters such as the acetyl-coenzyme A esters which comprise the polyunsaturated fatty acids with at least two, three, four, five or six, preferably five or six double bonds, from the organisms which have been used for the preparation of the fatty acid esters; preferably, they are isolated in the form of their diacylglycerides, triacylglycerides and/or in the form of phosphatidylcholine, especially preferably in the form of the triacylglycerides. In addition to these esters, the polyunsaturated fatty acids are also present in the organisms, advantageously the plants as free fatty acids or bound in other compounds. As a rule, the various abovementioned compounds (fatty acid esters and free fatty acids) are present in the organisms with an approximate distribution of 80 to 90% by weight of triglycerides, 2 to 5% by weight of diglycerides, 5 to 10% by weight of monoglycerides, 1 to 5% by weight of free fatty acids, 2 to 8% by weight of phospholipids, the total of the various compounds amounting to 100% by weight.
[0099] The process according to the invention yields the LCPUFAs produced in a content of at least 3% by weight, advantageously at least 5% by weight, preferably at least 8% by weight, especially preferably at least 10% by weight, most preferably at least 15% by weight, based on the total fatty acids in the transgenic organisms, preferably in a transgenic plant. In this context, it is advantageous to convert C.sub.18- and/or C.sub.20-fatty acids which are present in the host organisms to at least 10%, preferably to at least 20%, especially preferably to at least 30%, most preferably to at least 40% to give the corresponding products such as DPA or DHA, to mention just two examples. The fatty acids are advantageously produced in bound form. These unsaturated fatty acids can, with the aid of the nucleic acids used in the process according to the invention, be positioned at the sn1, sn2 and/or sn3 position of the advantageously produced triglycerides. Since a plurality of reaction steps are performed by the starting compounds linoleic acid (C18:2) and linolenic acid (C18:3) in the process according to the invention, the end products of the process such as, for example, arachidonic acid (ARA), eicosapentaenoic acid (EPA) .omega.6-docosapentaenoic acid or DHA are not obtained as absolutely pure products; minor traces of the precursors are always present in the end product. If, for example, both linoleic acid and linolenic acid are present in the starting organism and the starting plant, the end products such as ARA, EPA or DHA are present as mixtures. The precursors should advantageously not amount to more than 20% by weight, preferably not to more than 15% by weight, especially preferably not to more than 10% by weight, most preferably not to more than 5% by weight, based on the amount of the end product in question. Advantageously, only ARA, EPA or only DHA, bound or as free acids, are produced as end products in a transgenic plant owing to the process according to the invention. If the compounds ARA, EPA and DHA are produced simultaneously, they are advantageously produced in a ratio of at least 1:1:2 (EPA:ARA:DHA), advantageously of at least 1:1:3, preferably 1:1:4, especially preferably 1:1:5.
[0100] Fatty acid esters or fatty acid mixtures produced by the process according to the invention advantageously comprise 6 to 15% of palmitic acid, 1 to 6% of stearic acid, 7-85% of oleic acid, 0.5 to 8% of vaccenic acid, 0.1 to 1% of arachic acid, 7 to 25% of saturated fatty acids, 8 to 85% of monounsaturated fatty acids and 60 to 85% of polyunsaturated fatty acids, in each case based on 100% and on the total fatty acid content of the organisms. Advantageous polyunsaturated fatty acids which are present in the fatty acid esters or fatty acid mixtures are preferably at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1% of arachidonic acid, based on the total fatty acid content. Moreover, the fatty acid esters or fatty acid mixtures which have been produced by the process of the invention advantageously comprise fatty acids selected from the group of the fatty acids erucic acid (13-docosaenoic acid), sterculic acid (9,10-methyleneoctadec-9-enoic acid), malvalic acid (8,9-methyleneheptadec-8-enoic acid), chaulmoogric acid (cyclopentenedodecanoic acid), furan fatty acid (9,12-epoxyoctadeca-9,11-dienoic acid), vernolic acid (9,10-epoxyoctadec-12-enoic acid), tariric acid (6-octadecynoic acid), 6-nonadecynoic acid, santalbic acid (t11-octadecen-9-ynoic acid), 6,9-octadecenynoic acid, pyrulic acid (t10-heptadecen-8-ynoic acid), crepenyninic acid (9-octadecen-12-ynoic acid), 13,14-dihydrooropheic acid, octadecen-13-ene-9,11-diynoic acid, petroselenic acid (cis-6-octadecenoic acid), 9c,12t-octadecadienoic acid, calendulic acid (8t10t12c-octadecatrienoic acid), catalpic acid (9t11t13c-octadecatrienoic acid), eleostearic acid (9c11t13t-octadecatrienoic acid), jacaric acid (8c10t12c-octadecatrienoic acid), punicic acid (9c11t13c-octadecatrienoic acid), parinaric acid (9c11t13t15c-octadecatetraenoic acid), pinolenic acid (all-cis-5,9,12-octadecatrienoic acid), laballenic acid (5,6-octadecadienallenic acid), ricinoleic acid (12-hydroxyoleic acid) and/or coriolic acid (13-hydroxy-9c,11t-octadecadienoic acid). The abovementioned fatty acids are, as a rule, advantageously only found in traces in the fatty acid esters or fatty acid mixtures produced by the process according to the invention, that is to say that, based on the total fatty acids, they occur to less than 30%, preferably to less than 25%, 24%, 23%, 22% or 21%, especially preferably to less than 20%, 15%, 10%, 9%, 8%, 7%, 6% or 5%, very especially preferably to less than 4%, 3%, 2% or 1%. In a further preferred form of the invention, these abovementioned fatty acids occur to less than 0.9%, 0.8%, 0.7%, 0.6% or 0.5%, especially preferably to less than 0.4%, 0.3%, 0.2%, 0.1%, based on the total fatty acids. The fatty acid esters or fatty acid mixtures produced by the process according to the invention advantageously comprise less than 0.1%, based on the total fatty acids, and/or no butyric acid, no cholesterol, no clupanodonic acid (=docosapentaenoic acid, C22:5.sup..DELTA.4,8,12,15,21), and no nisinic acid (tetracosahexaenoic acid, C23:6.sup..DELTA.3,8,12,15,18,21).
[0101] Owing to the nucleic acid sequences, or the nucleic acid sequences used in the process according to the invention, an increase in the yield of polyunsaturated fatty acids of at least 50%, advantageously of at least 80%, especially advantageously of at least 100%, very especially advantageously of at least 150%, in comparison with the nontransgenic starting organism, for example a yeast, an alga, a fungus or a plant such as arabidopsis or linseed can be obtained when the fatty acids are detected by GC analysis (see examples).
[0102] Chemically pure polyunsaturated fatty acids or fatty acid compositions can also be synthesized by the processes described above. To this end, the fatty acids or the fatty acid compositions are isolated from the organisms, such as the microorganisms or the plants or the culture medium in or on which the organisms have been grown, or from the organism and the culture medium, in the known manner, for example via extraction, distillation, crystallization, chromatography or a combination of these methods. These chemically pure fatty acids or fatty acid compositions are advantageous for applications in the food industry sector, the cosmetic sector and especially the pharmacological industry sector.
[0103] Suitable organisms for the production in the process according to the invention are, in principle, any organisms such as microorganisms, nonhuman animals or plants.
[0104] Plants which are suitable are, in principle, all those plants which are capable of synthesizing fatty acids, such as all dicotyledonous or monocotyledonous plants, algae or mosses. Advantageous plants are selected from the group of the plant families Adelotheciaceae, Anacardiaceae, Asteraceae, Apiaceae, Betulaceae, Boraginaceae, Brassicaceae, Bromeliaceae, Caricaceae, Cannabaceae, Convolvulaceae, Chenopodiaceae, Crypthecodiniaceae, Cucurbitaceae, Ditrichaceae, Elaeagnaceae, Ericaceae, Euphorbiaceae, Fabaceae, Geraniaceae, Gramineae, Juglandaceae, Lauraceae, Leguminosae, Linaceae, Euglenaceae, Prasinophyceae or vegetable plants or ornamentals such as Tagetes.
[0105] Examples which may be mentioned are the following plants selected from the group consisting of: Adelotheciaceae such as the genera Physcomitrella, for example the genus and species Physcomitrella patens, Anacardiaceae such as the genera Pistacia, Mangifera, Anacardium, for example the genus and species Pistacia vera [pistachio], Mangifer indica [mango] or Anacardium occidentale [cashew], Asteraceae, such as the genera Calendula, Carthamus, Centaurea, Cichorium, Cynara, Helianthus, Lactuca, Locusta, Tagetes, Valeriana, for example the genus and species Calendula officinalis [common marigold], Carthamus tinctorius [safflower], Centaurea cyanus [cornflower], Cichorium intybus [chicory], Cynara scolymus [artichoke], Helianthus annus [sunflower], Lactuca sativa, Lactuca crispa, Lactuca esculenta, Lactuca scariola L. ssp. sativa, Lactuca scariola L. var. integrate, Lactuca scariola L. var. integrifolia, Lactuca sativa subsp. romana, Locusta communis, Valeriana locusta [salad vegetables], Tagetes lucida, Tagetes erecta or Tagetes tenuifolia [african or french marigold], Apiaceae, such as the genus Daucus, for example the genus and species Daucus carota [carrot], Betulaceae, such as the genus Corylus, for example the genera and species Corylus avellana or Corylus colurna [hazelnut], Boraginaceae, such as the genus Borago, for example the genus and species Borago officinalis [borage], Brassicaceae, such as the genera Brassica, Camelina, Melanosinapis, Sinapis, Arabadopsis, for example the genera and species Brassica napus, Brassica rapa ssp. [oilseed rape], Sinapis arvensis Brassica juncea, Brassica juncea var. juncea, Brassica juncea var. crispifolia, Brassica juncea var. foliosa, Brassica nigra, Brassica sinapioides, Camelina sativa, Melanosinapis communis [mustard], Brassica oleracea [fodder beet] or Arabidopsis thaliana, Bromeliaceae, such as the genera Anana, Bromelia (pineapple), for example the genera and species Anana comosus, Ananas ananas or Bromelia comosa [pineapple], Caricaceae, such as the genus Carica, such as the genus and species Carica papaya [pawpaw], Cannabaceae, such as the genus Cannabis, such as the genus and species Cannabis sativa [hemp], Convolvulaceae, such as the genera Ipomea, Convolvulus, for example the genera and species Ipomoea batatus, Ipomoea pandurata, Convolvulus batatas, Convolvulus tiliaceus, Ipomoea fastigiata, Ipomoea tiliacea, Ipomoea triloba or Convolvulus panduratus [sweet potato, batate], Chenopodiaceae, such as the genus Beta, such as the genera and species Beta vulgaris, Beta vulgaris var. altissima, Beta vulgaris var. vulgaris, Beta maritima, Beta vulgaris var. perennis, Beta vulgaris var. conditiva or Beta vulgaris var. esculents [sugarbeet], Crypthecodiniaceae, such as the genus Crypthecodinium, for example the genus and species Cryptecodinium cohnii, Cucurbitaceae, such as the genus Cucurbita, for example the genera and species Cucurbita maxima, Cucurbita mixta, Cucurbita pepo or Cucurbita moschata [pumpkin/squash], Cymbellaceae, such as the genera Amphora, Cymbella, Okedenia, Phaeodactylum, Reimeria, for example the genus and species Phaeodactylum tricornutum, Ditrichaceae, such as the genera Ditrichaceae, Astomiopsis, Ceratodon, Chrysoblastella, Ditrichum, Distichium, Eccremidium, Lophidion, Philibertiella, Pleuridium, Saelania, Trichodon, Skottsbergia, for example the genera and species Ceratodon antarcticus, Ceratodon columbiae, Ceratodon heterophyllus, Ceratodon purpurascens, Ceratodon purpureus, Ceratodon purpureus ssp. convolutus, Ceratodon purpureus ssp. stenocarpus, Ceratodon purpureus var. rotundifolius, Ceratodon ratodon, Ceratodon stenocarpus, Chrysoblastella chilensis, Ditrichum ambiguum, Ditrichum brevisetum, Ditrichum crispatissimum, Ditrichum difficile, Ditrichum falcifolium, Ditrichum flexicaule, Ditrichum giganteum, Ditrichum heteromallum, Ditrichum lineare, Ditrichum lineare, Ditrichum montanum, Ditrichum montanum, Ditrichum pallidum, Ditrichum punctulatum, Ditrichum pusillum, Ditrichum pusillum var. tortile, Ditrichum rhynchostegium, Ditrichum schimperi, Ditrichum tortile, Distichium capillaceum, Distichium hagenii, Distichium inclinatum, Distichium macounii, Eccremidium floridanum, Eccremidium whiteleggei, Lophidion strictus, Pleuridium acuminatum, Pleuridium alternifolium, Pleuridium holdridgei, Pleuridium mexicanum, Pleuridium ravenelii, Pleuridium subulatum, Saelania glaucescens, Trichodon borealis, Trichodon cylindricus or Trichodon cylindricus var. oblongus, Elaeagnaceae, such as the genus Elaeagnus, for example the genus and species Olea europaea [olive], Ericaceae, such as the genus Kalmia, for example the genera and species Kalmia latifolia, Kalmia angustifolia, Kalmia microphylla, Kalmia polifolia, Kalmia occidentalis, Cistus chamaerhodendros or Kalmia lucida [mountain laurel], Euglenaceae, such as the genera Ascoglena, Astasia, Colacium, Cyclidiopsis, Euglena, Euglenopsis, Hyalaphacus, Khawkinea, Lepocinclis, Phacus, Strombomonas, Trachelomonas, for example the genus and species Euglena gracilis; Euphorbiaceae, such as the genera Manihot, Janipha, Jatropha, Ricinus, for example the genera and species Manihot utilissima, Janipha manihot, Jatropha manihot, Manihot aipil, Manihot dulcis, Manihot manihot, Manihot melanobasis, Manihot esculenta [cassava] or Ricinus communis [castor-oil plant], Fabaceae, such as the genera Pisum, Albizia, Cathormion, Feuillea, Inga, Pithecolobium, Acacia, Mimosa, Medicajo, Glycine, Dolichos, Phaseolus, soybean, for example the genera and species Pisum sativum, Pisum arvense, Pisum humile [pea], Albizia berteriana, Albizia julibrissin, Albizia lebbeck, Acacia berteriana, Acacia littoralis, Albizia berteriana, Albizzia berteriana, Cathormion berteriana, Feuillea berteriana, Inga fragrans, Pithecellobium berterianum, Pithecellobium fragrans, Pithecolobium berterianum, Pseudalbizzia berteriana, Acacia julibrissin, Acacia nemu, Albizia nemu, Feuilleea julibrissin, Mimosa julibrissin, Mimosa speciosa, Sericanrda julibrissin, Acacia lebbeck, Acacia macrophylla, Albizia lebbeck, Feuilleea lebbeck, Mimosa lebbeck, Mimosa speciosa, Medicago sativa, Medicago falcata, Medicago varia [alfalfa] Glycine max Dolichos soja, Glycine gracilis, Glycine hispida, Phaseolus max, Soja hispida or Soja max [soybean], Funariaceae, such as the genera Aphanorrhegma, Entosthodon, Funaria, Physcomitrella, Physcomitrium, for example the genera and species Aphanorrhegma serratum, Entosthodon attenuatus, Entosthodon bolanderi, Entosthodon bonplandii, Entosthodon californicus, Entosthodon drummondii, Entosthodon jamesonii, Entosthodon leibergii, Entosthodon neoscoticus, Entosthodon rubrisetus, Entosthodon spathulifolius, Entosthodon tucsoni, Funaria americana, Funaria bolanderi, Funaria calcarea, Funaria californica, Funaria calvescens, Funaria convoluta, Funaria flavicans, Funaria groutiana, Funaria hygrometrica, Funaria hygrometrica var. arctica, Funaria hygrometrica var. calvescens, Funaria hygrometrica var. convoluta, Funaria hygrometrica var. muralis, Funaria hygrometrica var. utahensis, Funaria microstoma, Funaria microstoma var. obtusifolia, Funaria muhlenbergii, Funaria orcuttii, Funaria plano-convexa, Funaria polaris, Funaria ravenelii, Funaria rubriseta, Funaria serrata, Funaria sonorae, Funaria sublimbatus, Funaria tucsoni, Physcomitrella californica, Physcomitrella patens, Physcomitrella readeri, Physcomitrium australe, Physcomitrium californicum, Physcomitrium collenchymatum, Physcomitrium coloradense, Physcomitrium cupuliferum, Physcomitrium drummondii, Physcomitrium eurystomum, Physcomitrium flexifolium, Physcomitrium hookeri, Physcomitrium hookeri var. serratum, Physcomitrium immersum, Physcomitrium kellermanii, Physcomitrium megalocarpum, Physcomitrium pyriforme, Physcomitrium pyriforme var. serratum, Physcomitrium rufipes, Physcomitrium sandbergii, Physcomitrium subsphaericum, Physcomitrium washingtoniense, Geraniaceae, such as the genera Pelargonium, Cocos, Oleum, for example the genera and species Cocos nucifera, Pelargonium grossularioides or Oleum cocois [coconut], Gramineae, such as the genus Saccharum, for example the genus and species Saccharum officinarum, Juglandaceae, such as the genera Juglans, Wallia, for example the genera and species Juglans regia, Juglans ailanthifolia, Juglans sieboldiana, Juglans cinerea, Wallia cinerea, Juglans bixbyi, Juglans californica, Juglans hindsii, Juglans intermedia, Juglans jamaicensis, Juglans major, Juglans microcarpa, Juglans nigra or Wallia nigra [walnut], Lauraceae, such as the genera Persea, Laurus, for example the genera and species Laurus nobilis [bay], Persea americana, Persea gratissima or Persea persea [avocado], Leguminosae, such as the genus Arachis, for example the genus and species Arachis hypogaea [peanut], Linaceae, such as the genera Adenolinum, for example the genera and species Linum usitatissimum, Linum humile, Linum austriacum, Linum bienne, Linum angustifolium, Linum catharticum, Linum flavum, Linum grandiflorum, Adenolinum grandiflorum, Linum lewisii, Linum narbonense, Linum perenne, Linum perenne var. lewisii, Linum pratense or Linum trigynum [linseed], Lythrarieae, such as the genus Punica, for example the genus and species Punica granatum [pomegranate], Malvaceae, such as the genus Gossypium, for example the genera and species Gossypium hirsutum, Gossypium arboreum, Gossypium barbadense, Gossypium herbaceum or Gossypium thurberi [cotton], Marchantiaceae, such as the genus Marchantia, for example the genera and species Marchantia berteroana, Marchantia foliacea, Marchantia macropora, Musaceae, such as the genus Musa, for example the genera and species Musa nana, Musa acuminata, Musa paradisiaca, Musa spp. [banana], Onagraceae, such as the genera Camissonia, Oenothera, for example the genera and species Oenothera biennis or Camissonia brevipes [evening primrose], Palmae, such as the genus Elaeis, for example the genus and species Elaeis guineensis [oil palm], Papaveraceae, such as, for example, the genus Papaver, for example the genera and species Papaver orientale, Papaver rhoeas, Papaver dubium [poppy], Pedaliaceae, such as the genus Sesamum, for example the genus and species Sesamum indicum [sesame], Piperaceae, such as the genera Piper, Artanthe, Peperomia, Steffensia, for example the genera and species Piper aduncum, Piper amalago, Piper angustifolium, Piper auritum, Piper betel, Piper cubeba, Piper longum, Piper nigrum, Piper retrofractum, Artanthe adunca, Artanthe elongata, Peperomia elongata, Piper elongatum, Steffensia elongata [cayenne pepper], Poaceae, such as the genera Hordeum, Secale, Avena, Sorghum, Andropogon, Holcus, Panicum, Oryza, Zea (maize), Triticum, for example the genera and species Hordeum vulgare, Hordeum jubatum, Hordeum murinum, Hordeum secalinum, Hordeum distichon Hordeum aegiceras, Hordeum hexastichon, Hordeum hexastichum, Hordeum irregulare, Hordeum sativum, Hordeum secalinum [barley], Secale cereale [rye], Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida [oats], Sorghum bicolor, Sorghum halepense, Sorghum saccharatum, Sorghum vulgare, Andropogon drummondii, Holcus bicolor, Holcus sorghum, Sorghum aethiopicum, Sorghum arundinaceum, Sorghum caffrorum, Sorghum cernuum, Sorghum dochna, Sorghum drummondii, Sorghum durra, Sorghum guineense, Sorghum lanceolatum, Sorghum nervosum, Sorghum saccharatum, Sorghum subglabrescens, Sorghum verticilliflorum, Sorghum vulgare, Holcus halepensis, Sorghum miliaceum, Panicum militaceum Oryza sativa, Oryza latifolia [rice], Zea mays [maize] Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum or Triticum vulgare [wheat], Porphyridiaceae, such as the genera Chroothece, Flintiella, Petrovanella, Porphyridium, Rhodella, Rhodosorus, Vanhoeffenia, for example the genus and species Porphyridium cruentum, Proteaceae, such as the genus Macadamia, for example the genus and species Macadamia intergrifolia [macadamia], Prasinophyceae, such as the genera Nephroselmis, Prasinococcus, Scherffelia, Tetraselmis, Mantoniella, Ostreococcus, for example the genera and species Nephroselmis olivacea, Prasinococcus capsulatus, Scherffelia dubia, Tetraselmis chui, Tetraselmis suecica, Mantoniella squamata, Ostreococcus tauri, Rubiaceae, such as the genus Coffea, for example the genera and species Coffea spp., Coffea arabica, Coffea canephora or Coffea liberica [coffee], Scrophulariaceae, such as the genus Verbascum, for example the genera and species Verbascum blattaria, Verbascum chaixii, Verbascum densiflorum, Verbascum lagurus, Verbascum longifolium, Verbascum lychnitis, Verbascum nigrum, Verbascum olympicum, Verbascum phlomoides, Verbascum phoenicum, Verbascum pulverulentum or Verbascum thapsus [verbascum], Solanaceae, such as the genera Capsicum, Nicotiana, Solanum, Lycopersicon, for example the genera and species Capsicum annuum, Capsicum annuum var. glabriusculum, Capsicum frutescens [pepper], Capsicum annuum [paprika], Nicotiana tabacum, Nicotiana alata, Nicotiana attenuata, Nicotiana glauca, Nicotiana langsdorffii, Nicotiana obtusifolia, Nicotiana quadrivalvis, Nicotiana repanda, Nicotiana rustica, Nicotiana sylvestris [tobacco], Solanum tuberosum [potato], Solanum melongena [eggplant] Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme, Solanum integrifolium or Solanum lycopersicum [tomato], Sterculiaceae, such as the genus Theobroma, for example the genus and species Theobroma cacao [cacao] or Theaceae, such as the genus Camellia, for example the genus and species Camellia sinensis [tea].
[0106] Advantageous microorganisms are, for example, fungi selected from the group of the families Chaetomiaceae, Choanephoraceae, Cryptococcaceae, Cunninghamellaceae, Demetiaceae, Moniliaceae, Mortierellaceae, Mucoraceae, Pythiaceae, Sacharomycetaceae, Saprolegniaceae, Schizosacharomycetaceae, Sodariaceae or Tuberculariaceae.
[0107] Examples of microorganisms which may be mentioned are those from the groups: Choanephoraceae, such as the genera Blakeslea, Choanephora, for example the genera and species Blakeslea trispora, Choanephora cucurbitarum, Choanephora infundibulifera var. cucurbitarum, Mortierellaceae, such as the genus Mortierella, for example the genera and species Mortierella isabellina, Mortierella polycephala, Mortierella ramanniana, Mortierella vinacea, Mortierella zonata, Pythiaceae, such as the genera Phytium, Phytophthora, for example the genera and species Pythium debaryanum, Pythium intermedium, Pythium irregulare, Pythium megalacanthum, Pythium paroecandrum, Pythium sylvaticum, Pythium ultimum, Phytophthora cactorum, Phytophthora cinnamomi, Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, Phytophthora erythroseptica, Phytophthora lateralis, Phytophthora megasperma, Phytophthora nicotianae, Phytophthora nicotianae var. parasitica, Phytophthora palmivora, Phytophthora parasitica, Phytophthora syringae, Saccharomycetaceae, such as the genera Hansenula, Pichia, Saccharomyces, Saccharomycodes, Yarrowia, for example the genera and species Hansenula anomala, Hansenula californica, Hansenula canadensis, Hansenula capsulata, Hansenula Hansenula glucozyma, Hansenula henricii, Hansenula holstfi, Hansenula minuta, Hansenula nonfermentans, Hansenula philodendri, Hansenula polymorpha, Hansenula saturnus, Hansenula subpefficulosa, Hansenula wickerhamii, Hansenula wingei, Pichia alcoholophila, Pichia angusta, Pichia anomala, Pichia bispora, Pichia burtonii, Pichia canadensis, Pichia capsulata, Pichia carsonii, Pichia cellobiosa, Pichia ciferrii, Pichia farinosa, Pichia fermentans, Pichia finlandica, Pichia glucozyma, Pichia guiffiermondii, Pichia haplophila, Pichia henricii, Pichia holstfi, Pichia jadinii, Pichia findnerfi, Pichia membranaefaciens, Pichia methanolica, Pichia minuta var. minuta, Pichia minuta var. nonfermentans, Pichia norvegensis, Pichia ohmeri, Pichia pastoris, Pichia philodendri, Pichia pini, Pichia polymorpha, Pichia quercuum, Pichia rhodanensis, Pichia sargentensis, Pichia stipitis, Pichia strasburgensis, Pichia subpefficulosa, Pichia toletana, Pichia trehalophila, Pichia vini, Pichia xylosa, Saccharomyces aceti, Saccharomyces bailii, Saccharomyces bayanus, Saccharomyces bisporus, Saccharomyces capensis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces cerevisiae var. effipsoideus, Saccharomyces chevalieri, Saccharomyces delbrueckii, Saccharomyces diastaticus, Saccharomyces drosophilarum, Saccharomyces elegans, Saccharomyces effipsoideus, Saccharomyces fermentati, Saccharomyces florentinus, Saccharomyces fragilis, Saccharomyces heterogenicus, Saccharomyces hienipiensis, Saccharomyces inusitatus, Saccharomyces italicus, Saccharomyces kluyveri, Saccharomyces krusei, Saccharomyces lactis, Saccharomyces marxianus, Saccharomyces microellipsoides, Saccharomyces montanus, Saccharomyces norbensis, Saccharomyces oleaceus, Saccharomyces paradoxus, Saccharomyces pastorianus, Saccharomyces pretoriensis, Saccharomyces rosei, Saccharomyces rouxii, Saccharomyces uvarum, Saccharomycodes ludwigii, Yarrowia lipolytica, Schizosacharomycetaceae such as the genera Schizosaccharomyces e.g. the species Schizosaccharomyces japonicus var. japonicus, Schizosaccharomyces japonicus var. versatilis, Schizosaccharomyces malidevorans, Schizosaccharomyces octosporus, Schizosaccharomyces pombe var. malidevorans, Schizosaccharomyces pombe var. pombe, Thraustochytriaceae such as the genera Althornia, Aplanochytrium, Japonochytrium, Schizochytrium, Thraustochytrium e.g. the species Schizochytrium aggregatum, Schizochytrium limacinum, Schizochytrium mangrovei, Schizochytrium minutum, Schizochytrium octosporum, Thraustochytrium aggregatum, Thraustochytrium amoeboideum, Thraustochytrium antacticum, Thraustochytrium arudimentale, Thraustochytrium aureum, Thraustochytrium benthicola, Thraustochytrium globosum, Thraustochytrium indicum, Thraustochytrium kerguelense, Thraustochytrium kinnei, Thraustochytrium motivum, Thraustochytrium multirudimentale, Thraustochytrium pachydermum, Thraustochytrium proliferum, Thraustochytrium roseum, Thraustochytrium rossii, Thraustochytrium striatum or Thraustochytrium visurgense.
[0108] Further advantageous microorganisms are, for example, bacteria selected from the group of the families Bacillaceae, Enterobacteriacae or Rhizobiaceae.
[0109] Examples which may be mentioned are the following microorganisms selected from the group consisting of: Bacillaceae, such as the genus Bacillus, for example the genera and species Bacillus acidocaldarius, Bacillus acidoterrestris, Bacillus alcalophilus, Bacillus amyloliquefaciens, Bacillus amylolyticus, Bacillus brevis, Bacillus cereus, Bacillus circulans, Bacillus coagulans, Bacillus sphaericus subsp. fusiformis, Bacillus galactophilus, Bacillus globisporus, Bacillus globisporus subsp. marinus, Bacillus halophilus, Bacillus lentimorbus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus polymyxa, Bacillus psychrosaccharolyticus, Bacillus pumilus, Bacillus sphaericus, Bacillus subtilis subsp. spizizenii, Bacillus subtilis subsp. subtilis or Bacillus thuringiensis; Enterobacteriacae such as the genera Citrobacter, Edwardsiella, Enterobacter, Erwinia, Escherichia, Klebsiella, Salmonella or Serratia, for example the genera and species Citrobacter amalonaticus, Citrobacter diversus, Citrobacter freundii, Citrobacter genomospecies, Citrobacter gillenii, Citrobacter intermedium, Citrobacter koseri, Citrobacter murliniae, Citrobacter sp., Edwardsiella hoshinae, Edwardsiella ictaluri, Edwardsiella tarda, Erwinia alni, Erwinia amylovora, Erwinia ananatis, Erwinia aphidicola, Erwinia billingiae, Erwinia cacticida, Erwinia cancerogena, Erwinia carnegieana, Erwinia carotovora subsp. atroseptica, Erwinia carotovora subsp. betavasculorum, Erwinia carotovora subsp. odorifera, Erwinia carotovora subsp. wasabiae, Erwinia chrysanthemi, Erwinia cypripedii, Erwinia dissolvens, Erwinia herbicola, Erwinia mallotivora, Erwinia milletiae, Erwinia nigrifluens, Erwinia nimipressuralis, Erwinia persicina, Erwinia psidii, Erwinia pyrifoliae, Erwinia quercina, Erwinia rhapontici, Erwinia rubrifaciens, Erwinia salicis, Erwinia stewartii, Erwinia tracheiphila, Erwinia uredovora, Escherichia adecarboxylata, Escherichia anindolica, Escherichia aurescens, Escherichia blattae, Escherichia coli, Escherichia coli var. communion, Escherichia coli-mutabile, Escherichia fergusonii, Escherichia hermannii, Escherichia sp., Escherichia vulneris, Klebsiella aerogenes, Klebsiella edwardsii subsp. atlantae, Klebsiella ornithinolytica, Klebsiella oxytoca, Klebsiella planticola, Klebsiella pneumoniae, Klebsiella pneumoniae subsp. pneumoniae, Klebsiella sp., Klebsiella terrigena, Klebsiella trevisanii, Salmonella abony, Salmonella arizonae, Salmonella bongori, Salmonella choleraesuis subsp. arizonae, Salmonella choleraesuis subsp. bongori, Salmonella choleraesuis subsp. cholereasuis, Salmonella choleraesuis subsp. diarizonae, Salmonella choleraesuis subsp. houtenae, Salmonella choleraesuis subsp. indica, Salmonella choleraesuis subsp. salamae, Salmonella daressalaam, Salmonella enterica subsp. houtenae, Salmonella enterica subsp. salamae, Salmonella enteritidis, Salmonella gallinarum, Salmonella heidelberg, Salmonella panama, Salmonella senftenberg, Salmonella typhimurium, Serratia entomophila, Serratia ficaria, Serratia fonticola, Serratia grimesii, Serratia liquefaciens, Serratia marcescens, Serratia marcescens subsp. marcescens, Serratia marinorubra, Serratia odorifera, Serratia plymouthensis, Serratia plymuthica, Serratia proteamaculans, Serratia proteamaculans subsp. quinovora, Serratia quinivorans or Serratia rubidaea; Rhizobiaceae, such as the genera Agrobacterium, Carbophilus, Chelatobacter, Ensifer, Rhizobium, Sinorhizobium, for example the genera and species Agrobacterium atlanticum, Agrobacterium ferrugineum, Agrobacterium gelatinovorum, Agrobacterium larrymoorei, Agrobacterium meteori, Agrobacterium radiobacter, Agrobacterium rhizogenes, Agrobacterium rubi, Agrobacterium stellulatum, Agrobacterium tumefaciens, Agrobacterium vitis, Carbophilus carboxidus, Chelatobacter heintzii, Ensifer adhaerens, Ensifer arboris, Ensifer fredii, Ensifer kostiensis, Ensifer kummerowiae, Ensifer medicae, Ensifer meliloti, Ensifer saheli, Ensifer terangae, Ensifer xinjiangensis, Rhizobium ciceri Rhizobium etli, Rhizobium fredii, Rhizobium galegae, Rhizobium gallicum, Rhizobium giardinii, Rhizobium hainanense, Rhizobium huakuii, Rhizobium huautlense, Rhizobium indigoferae, Rhizobium japonicum, Rhizobium leguminosarum, Rhizobium loessense, Rhizobium loti, Rhizobium lupini, Rhizobium mediterraneum, Rhizobium meliloti, Rhizobium mongolense, Rhizobium phaseoli, Rhizobium radiobacter, Rhizobium rhizogenes, Rhizobium rubi, Rhizobium sullae, Rhizobium tianshanense, Rhizobium trifolii, Rhizobium tropici, Rhizobium undicola, Rhizobium vitis, Sinorhizobium adhaerens, Sinorhizobium arboris, Sinorhizobium fredii, Sinorhizobium kostiense, Sinorhizobium kummerowiae, Sinorhizobium medicae, Sinorhizobium mefiloti, Sinorhizobium morelense, Sinorhizobium saheli or Sinorhizobium xinjiangense.
[0110] Further examples of advantageous microorganisms for the process according to the invention are protists or diatoms selected from the group of the families Dinophyceae, Turaniellidae or Oxytrichidae, such as the genera and species: Crypthecodinium cohnii, Phaeodactylum tricornutum, Stylonychia mytilus, Stylonychia pustulata, Stylonychia putrina, Stylonychia notophora, Stylonychia sp., Colpidium campylum or Colpidium sp.
[0111] Those which are advantageously applied in the process according to the invention are transgenic organisms such as fungi, such as mortierella or thraustrochytrium, yeasts such as Saccharomyces or Schizosaccharomyces, mosses such as Physcomitrella or Ceratodon, nonhuman animals such as Caenorhabditis, algae such as Nephroselmis, Pseudoscourfielda, Prasinococcus, Scherffelia, Tetraselmis, Mantoniella, Ostreococcus, Crypthecodinium or Phaeodactylum or plants such as dicotyledonous or monocotyledonous plants. Organisms which are especially advantageously used in the process according to the invention are organisms which belong to the oil-producing organisms, that is to say which are used for the production of oil, such as fungi, such as Mortierella or Thraustochytrium, algae such as Nephroselmis, Pseudoscourfielda, Prasinococcus, Scherffelia, Tetraselmis, Mantoniella, Ostreococcus, Crypthecodinium, Phaeodactylum, or plants, in particular plants, preferably oilseed or oil crop plants which comprise large amounts of lipid compounds, such as peanut, oilseed rape, canola, sunflower, safflower (Carthamus tinctoria), poppy, mustard, hemp, castor-oil plant, olive, sesame, Calendula, Punica, evening primrose, verbascum, thistle, wild roses, hazelnut, almond, macadamia, avocado, bay, pumpkin/squash, linseed, soybean, pistachios, borage, trees (oil palm, coconut or walnut) or arable crops such as maize, wheat, rye, oats, triticale, rice, barley, cotton, cassava, pepper, Tagetes, Solanaceae plants such as potato, tobacco, eggplant and tomato, Vicia species, pea, alfalfa or bushy plants (coffee, cacao, tea), Salix species, and perennial grasses and fodder crops. Preferred plants according to the invention are oil crop plants such as peanut, oilseed rape, canola, sunflower, safflower, poppy, mustard, hemp, castor-oil plant, olive, Calendula, Punica, evening primrose, pumpkin/squash, linseed, soybean, borage, trees (oil palm, coconut). Especially preferred are plants which are high in C18:2- and/or C18:3-fatty acids, such as sunflower, safflower, tobacco, verbascum, sesame, cotton, pumpkin/squash, poppy, evening primrose, walnut, linseed, hemp or thistle. Very especially preferred plants are plants such as safflower, sunflower, poppy, evening primrose, walnut, linseed or hemp.
[0112] It is therefore advantageous for the above-described method according to the invention additionally to introduce, into the organism, further nucleic acids which encode enzymes of the fatty acid or lipid metabolism, in addition to the nucleic acids introduced in process step (a) to (d) and to the optionally introduced nucleic acid sequences which encode the .omega.3-desaturases.
[0113] In principle, all genes of the fatty acid or lipid metabolism can be used in the process for the production of polyunsaturated fatty acids, advantageously in combination with the .DELTA.5-elongase(s), .DELTA.6-elongase(s) and/or .omega.3-desaturases [for the purposes of the present invention, the plural is understood as comprising the singular and vice versa]. Genes of the fatty acid or lipid metabolism selected from the group consisting of acyl-CoA dehydrogenase(s), acyl-ACP [=acyl carrier protein] desaturase(s), acyl-ACP thioesterase(s), fatty acid acyl transferase(s), acyl-CoA:lysophospholipid acyltransferases, fatty acid synthase(s), fatty acid hydroxylase(s), acetyl-coenzyme A carboxylase(s), acyl-coenzyme A oxidase(s), fatty acid desaturase(s), fatty acid acetylenases, lipoxygenases, triacylglycerol lipases, allenoxide synthases, hydroperoxide lyases or fatty acid elongase(s) are advantageously used in combination with the .DELTA.5-elongase, .DELTA.6-elongase and/or .omega.3-desaturase. Genes selected from the group of the .DELTA.4-desaturases, .DELTA.5-desaturases, .DELTA.6-desaturases, .DELTA.8-desaturases, .DELTA.9-desaturases, .DELTA.12-desaturases, .DELTA.6-elongases or .DELTA.9-elongases are especially preferably used in combination with the above genes for the .DELTA.5-elongase, .DELTA.6-elongase and/or .omega.3-desaturase, it being possible to use individual genes or a plurality of genes in combination.
[0114] In comparison with the human elongases or elongases from nonhuman animals such as those from Oncorhynchus, Xenopus or Ciona, the .DELTA.5-elongases according to the invention have the advantageous property that they do not elongate C.sub.22-fatty acids to the corresponding C.sub.24-fatty acids. Furthermore, they advantageously do not convert fatty acids with a double bond in AB-position, as are converted by the human elongases or the elongases from nonhuman animals. Especially advantageous .DELTA.5-elongases preferentially only convert unsaturated C.sub.20-fatty acids. These advantageous .DELTA.5-elongases have some putative transmembrane helices (5-7). Advantageously, only C.sub.20-fatty acids with one double bond in .DELTA.5-position are converted, with .omega.3-C.sub.20-fatty acids being preferred (EPA). In a preferred embodiment of the invention, they furthermore have the property that they advantageously have no, or only relatively little, .DELTA.6-elongase activity, in addition to the .DELTA.5-elongase activity. In contrast, the human elongases or elongases from nonhuman animals have approximately the same activity on fatty acids with a .DELTA.6- or .DELTA.5-double bond. These advantageous elongases are referred to as what are known as monofunctional elongases. The human elongases or the elongases from nonhuman animals, in contrast, are referred to as multifunctional elongases which, in addition to the abovementioned substrates, also convert monounsaturated C.sub.16- and C.sub.18-fatty acids, for example with a .DELTA.9- or .DELTA.11-double bond. In a yeast feeding test in which EPA had been added to the yeasts to act as substrate, the monofunctional elongases advantageously convert at least 15% of the added EPAs into docosapentaenoic acid (DPA, C22:5.sup..DELTA.7,10,13,16,19), advantageously at least 20% by weight, especially advantageously at least 25% by weight. If .gamma.-linolenic acid (=GLA, C18:3.sup..DELTA.6,9,12) is added as substrate, this substance is advantageously not elongated at all. C18:3.sup..DELTA.5,9,12 is likewise not elongated. In another advantageous embodiment, less than 60% by weight, advantageously less than 55% by weight, especially preferably less than 50% by weight, especially advantageously less than 45% by weight, very especially advantageously less than 40% by weight, of the added GLA are converted into dihomo-.gamma.-linolenic acid (=C20:3.sup..DELTA.8,11,14) In a further, very especially preferred embodiment of the .DELTA.5-elongase activity according to the invention, GLA is not converted.
[0115] FIGS. 27 and 28 show the measured substrate specificities of the different elongases. FIG. 27 shows the specifities of the multifunctional elongases of Xenopus laevis (FIG. 27 A), Ciona intestinalis (FIG. 27 B) and Oncorhynchus mykiss (FIG. 27 C). All of these elongases convert a broad spectrum of substrates. In the method according to the invention, this can give rise to by-products which must be converted by further enzymatic activities. This is why these enzymes are less preferred in the method according to the invention. The preferred monofunctional elongases and their substrate specificity are shown in FIG. 28. FIG. 28 A shows the specificity of the Ostreococcus tauri .DELTA.5-elongase. This enzyme only converts fatty acids with a double bond in the .DELTA.5-position. Advantageously, only C20-fatty acids are converted. A similarly high substrate specificity is shown by the Thalassiosira pseudonana .DELTA.5-elongase (FIG. 28 C). Both the Ostreococcus tauri .DELTA.6-elongase (FIG. 28 B) and that of Thalassiosira pseudonana (FIG. 28 D) advantageously only convert fatty acids with a double bond in the .DELTA.6-position.
[0116] Advantageously, only C18-fatty acids are converted. The .DELTA.5-elongases from Arabidopsis thaliana and Euglena gracilis are also distinguished by their specificity.
[0117] Advantageous .DELTA.6-elongases according to the invention are likewise distinguished by high specificity, that is to say that C.sub.18-fatty acids are elongated by preference. Advantageously, they convert fatty acids with a double bond in the .DELTA.6-position. Especially advantageous .DELTA.6-elongases advantageously convert C.sub.18-fatty acids with three or four double bonds in the molecule, which fatty acids must comprise one double bond in the .DELTA.6-position. In a preferred embodiment of the invention, they furthermore have the characteristic that they advantageously have no, or only relatively little, .DELTA.5-elongase activity, besides the .DELTA.6-elongase activity. In contrast, the human elongases or elongases from nonhuman animals have approximately the same activity on fatty acids with a .DELTA.6- or .DELTA.5-double bond. These advantageous elongases are referred to as what are known as monofunctional elongases. As described above, the human elongases or the elongases from nonhuman animals are referred to, in contrast, as multifunctional elongases which, besides the abovementioned substrates, also convert monounsaturated C.sub.16- and C.sub.18-fatty acids, for example with .DELTA.9- or .DELTA.11-double bond. In a yeast feeding test in which EPA had been added to the yeast to act as substrate, the monofunctional elongases advantageously convert at least 10% by weight of the added .alpha.-linolenic acid (=ALA, C18:3.sup..DELTA.9,12,15) or at least 40% by weight of the added .gamma.-linolenic acid (=GLA, C18:3.sup..DELTA.6,9,12), advantageously at least 20% by weight or 50% by weight, especially advantageously at least 25% by weight or 60% by weight. It is especially advantageous that C18:4.sup..DELTA.6,9,12,15 (stearidonic acid) is also elongated. In this context, SDA is converted to at least 40% by weight, advantageously to at least 50% by weight, especially advantageously to at least 60% by weight, very especially advantageously to at least 70% by weight. Especially advantageous .DELTA.6-elongases show no or only very little activity (conversion rate less than 0.1% by weight) toward the following substrates: C18:1.sup..DELTA.6, C18:1.sup..DELTA.9, C18:1.sup..DELTA.11, C20:2.sup..DELTA.11,14, C20:3.sup..DELTA.11,14,17, C20:3.sup..DELTA.8,11,14, C20:4.sup..DELTA.5,8,11,14, C20:5.sup..DELTA.5,8,11,14,17 or C22:4.sup..DELTA.7,10,13,16.
[0118] FIGS. 29 and 30 and table 18 show the measured substrate specificities of the various elongases.
[0119] In contrast with the known .omega.3-desaturase, the .omega.3-desaturase according to the invention has the advantageous characteristic that it is capable of desaturating a broad spectrum of .omega.6-fatty acids; C.sub.20- and C.sub.22-fatty acids such as C.sub.20:2-, C.sub.20:3-, C.sub.20:4-, C.sub.22:4- or C.sub.22:5-fatty acids are desaturated by preference. However, the shorter C.sub.18-fatty acids such as C.sub.18:2- or C.sub.18:3-fatty acids are also advantageously desaturated. Owing to these characteristics of the .omega.3-desaturase, it is advantageously possible to shift the fatty acid spectrum within an organism, advantageously within a plant or a fungus, from the .omega.6-fatty acids toward the .omega.3-fatty acids. Preferably, the .omega.3-desaturase according to the invention desaturates C.sub.20-fatty acids. Within the organism, these fatty acids from the existing fatty acid pool are converted to at least 10%, 15%, 20%, 25% or 30% into the corresponding .omega.3-fatty acids.
[0120] The activity of the enzyme .omega.3-desaturase toward the C.sub.18-fatty acids is lower by a factor of 10, i.e. only approximately 1.5 to 3% of the fatty acids present in the fatty acid pool are converted into the corresponding .omega.3-fatty acids. Preferred substrate of the .omega.3-desaturase according to the invention are the .omega.6-fatty acids which are bound in phospholipids.
[0121] FIG. 19 demonstrates clearly with reference to the desaturation of dihomo-.gamma.-linolenic acid [C.sub.20:4.sup..DELTA.8,11,14], that, during the desaturation process, the .omega.3-desaturase advantageously does not distinguish between fatty acids which are bound at the sn1 position or at the sn2 position. Both fatty acids bound at the sn1 position and fatty acids bound at the sn2 position in the phospholipids are desaturated. Furthermore, it is advantageous that the .omega.3-desaturase converts a broad range of phospholipids such as phosphatidylcholine (=PC), phosphatidylinositol (=PIS) or phosphatidylethanolamine (=PE). Finally, desaturation products can also be found in the neutral lipids (=NL), that is to say in the triglycerides.
[0122] In comparison with the known .DELTA.4-desaturases, .DELTA.5-desaturases and .DELTA.6-desaturases, the advantage of the .DELTA.4-desaturases, .DELTA.5-desaturases and .DELTA.6-desaturases according to the invention is that they can convert fatty acids which are bound to phospholipids or CoA-fatty acid esters, advantageously CoA-fatty acid esters.
[0123] The .DELTA.12-desaturases used in the process according to the invention advantageously convert oleic acid (C18:1.sup..DELTA.9) into linoleic acid (C18:2.sup..DELTA.9,12) or C18:2.sup..DELTA.6,9 into C18:3.sup..DELTA.6,9,12 (=GLA). The .DELTA.12-desaturases used advantageously convert fatty acids which are bound to phospholipids or CoA-fatty acid esters, advantageously those which are bound to CoA-fatty acid esters.
[0124] Owing to the enzymatic activity of the nucleic acids used in the process according to the invention which encode polypeptides with .DELTA.5-elongase, .DELTA.6-elongase and/or .omega.3-desaturase activity, advantageously in combination with nucleic acid sequences which encode polypeptides of the fatty acid or lipid metabolism, such as additional polypeptides with .DELTA.4-, .DELTA.5-, .DELTA.6-, .DELTA.8-, .DELTA.12-desaturase or .DELTA.5-, .DELTA.6- or .DELTA.9-elongase activity, a wide range of polyunsaturated fatty acids can be produced in the process according to the invention. Depending on the choice of the organisms, such as the advantageous plants, used for the process according to the invention, mixtures of the various polyunsaturated fatty acids or individual polyunsaturated fatty acids, such as EPA or ARA, can be produced in free or bound form. Depending on the prevailing fatty acid composition in the starting plant (C18:2- or C18:3-fatty acids), fatty acids which are derived from C18:2-fatty acids, such as GLA, DGLA or ARA, or fatty acids which are derived from C18:3-fatty acids, such as SDA, ETA or EPA, are thus obtained. If only linoleic acid (=LA, C18:2.sup..DELTA.9,12) is present as unsaturated fatty acid in the plant used for the process, the process can only afford GLA, DGLA and ARA as products, all of which can be present as free fatty acids or in bound form. If only .alpha.-linolenic acid (=ALA, C18:3.sup..DELTA.9,12,15) is present as unsaturated fatty acid in the plant used for the process, as is the case, for example, in linseed, the process can only afford SDA, ETA or EPA and/or DHA as products, all of which can be present as free fatty acids or in bound form, as described above. Owing to the modification of the activity of the enzyme .DELTA.5-elongase advantageously in combination with .DELTA.4-, .DELTA.5-, .DELTA.12-desaturase, and/or .DELTA.6-elongase, or .DELTA.4-, .DELTA.8-, .DELTA.12-desaturase, and/or .DELTA.9-elongase which play a role in the synthesis, it is possible to produce, in a targeted fashion, only individual products in the abovementioned organisms, advantageously in the abovementioned plants. Owing to the activity of .DELTA.6-desaturase and .DELTA.6-elongase, for example, GLA and DGLA, or SDA and ETA, are formed, depending on the starting plant and unsaturated fatty acid. DGLA or ETA or mixtures of these are preferably formed. If .DELTA.5-desaturase, .DELTA.5-elongase and .DELTA.4-desaturase are additionally introduced into the organisms, advantageously into the plant, ARA, EPA and/or DHA are additionally formed. This also applies to organisms into which the .DELTA.8-desaturase and .DELTA.9-elongase had previously been introduced. Advantageously, only ARA, EPA or DHA or mixtures of these are synthesized, depending on the fatty acid present in the organism, or in the plant, which acts as starting substance for the synthesis. Since biosynthetic cascades are involved, the end products in question are not present in pure form in the organisms. Small amounts of the precursor compounds are always additionally present in the end product. These small amounts amount to less than 20% by weight, advantageously less than 15% by weight, especially advantageously less than 10% by weight, most advantageously less than 5, 4, 3, 2 or 1% by weight, based on the end products DGLA, ETA or their mixtures, or ARA, EPA, DHA or their mixtures, advantageously EPA or DHA or their mixtures.
[0125] The protein encoded by the nucleic acid according to the invention demonstrates high specificity for the two precursors C18:4.sup..DELTA.6,9,12,15- and C20:5.sup..DELTA.5,8,11,14,17-fatty acids for the synthesis of DHA (precursors and synthesis of DHA, see FIG. 1). Thus, the protein encoded by SEQ NO: 53 has specificity for .DELTA.6- and .DELTA.5-fatty acids with additionally one .omega.3-double bond (FIG. 2). .DELTA.5-elongase has ketoacyl-CoA synthase activity which advantageously elongates fatty acid residues of acyl-CoA esters by 2 carbon atoms.
[0126] With the aid of the .DELTA.5-elongase genes, the Phaeodacylum .DELTA.5-desaturase and the Euglena .DELTA.4-desaturase, it was possible to demonstrate the synthesis of DHA in yeast (Saccharomyces cerevisiae) (FIG. 3).
[0127] In addition to the production directly in the organism, of the starting fatty acids for the .DELTA.5-elongase, .DELTA.6-elongase and/or .omega.3-desaturase of the invention, the fatty acids can also be fed externally. The production in the organism is preferred for reasons of economy. Preferred substrates of .omega.3-desaturase are linoleic acid (C18:2.sup..DELTA.9,12), .gamma.-linolenic acid (C18:3.sup..DELTA.6,9,12), eicosadienoic acid (C20:2.sup..DELTA.11,14), dihomo-.gamma.-linolenic acid (C20:3.sup..DELTA.8,11,14), arachidonic acid (C20:4.sup..DELTA.5,8,11,14), docosatetraenoic acid (C22:4.sup..DELTA.7,10,13,16) and docosapentaenoic acid (C22:5.sup..DELTA.4,7,10,13,15).
[0128] To increase the yield in the above-described process for the production of oils and/or triglycerides with an advantageously elevated content of polyunsaturated fatty acids, it is advantageous to increase the amount of starting product for the synthesis of fatty acids; this can be achieved for example by introducing, into the organism, a nucleic acid which encodes a polypeptide with .DELTA.12-desaturase. This is particularly advantageous in oil-producing organisms such as those from the family of the Brassicaceae, such as the genus Brassica, for example oilseed rape; the family of the Elaeagnaceae, such as the genus Elaeagnus, for example the genus and species Olea europaea, or the family Fabaceae, such as the genus Glycine, for example the genus and species Glycine max, which are high in oleic acid. Since these organisms are only low in linoleic acid (Mikoklajczak et al., Journal of the American Oil Chemical Society, 38, 1961, 678-681), the use of the abovementioned .DELTA.12-desaturases for producing the starting material linoleic acid is advantageous.
[0129] Nucleic acids used in the process according to the invention are advantageously derived from plants such as algae, for example algae of the family of the Prasinophyceae such as the genera Heteromastix, Mammella, Mantoniella, Micromonas, Nephroselmis, Ostreococcus, Prasinocladus, Prasinococcus, Pseudoscourfielda, Pycnococcus, Pyramimonas, Scherffelia or Tetraselmis such as the genera and species Heteromastix longifillis, Mamiella gilva, Mantoniella squamata, Micromonas pusilla, Nephroselmis olivacea, Nephroselmis pyriformis, Nephroselmis rotunda, Ostreococcus tauri, Ostreococcus sp. Prasinocladus ascus, Prasinocladus lubricus, Pycnococcus provasolii, Pyramimonas amylifera, Pyramimonas disomata, Pyramimonas obovata, Pyramimonas orientalis, Pyramimonas parkeae, Pyramimonas spinifera, Pyramimonas sp., Tetraselmis apiculata, Tetraselmis carteriaformis, Tetraselmis chui, Tetraselmis convolutae, Tetraselmis desikacharyi, Tetraselmis gracilis, Tetraselmis hazeni, Tetraselmis impellucida, Tetraselmis inconspicua, Tetraselmis levis, Tetraselmis maculate, Tetraselmis marina, Tetraselmis striata, Tetraselmis subcordiformis, Tetraselmis suecica, Tetraselmis tetrabrachia, Tetraselmis tetrathele, Tetraselmis verrucosa, Tetraselmis verrucosa fo. rubens or Tetraselmis sp. or from algae of the family Euglenaceae such as the genera Ascoglena, Astasia, Colacium, Cyclidiopsis, Euglena, Euglenopsis, Hyalophacus, Khawkinea, Lepocinclis, Phacus, Strombomonas or Trachelomonas, such as the genera and species Euglena acus, Euglena geniculata, Euglena gracilis, Euglena mixocylindracea, Euglena rostrifera, Euglena viridis, Colacium stentorium, Trachelomonas cylindrica or Trachelomonas volvocina. The nucleic acids used are advantageously derived from algae of the genera Euglena, Mantoniella or Ostreococcus.
[0130] Further advantageous plants are algae such as Isochrysis or Crypthecodinium, algae/diatoms such as Thalassiosira or Phaeodactylum, mosses such as Physcomitrella or Ceratodon, or higher plants such as the Primulaceae such as Aleuritia, Calendula stellata, Osteospermum spinescens or Osteospermum hyoseroides, microorganisms such as fungi, such as Aspergillus, Thraustochytrium, Phytophthora, Entomophthora, Mucor or Mortierella, bacteria such as Shewanella, yeasts or animals such as nematodes such as Caenorhabditis, insects, frogs, abalone, or fish. The isolated nucleic acid sequences according to the invention are advantageously derived from an animal of the order of the vertebrates. Preferably, the nucleic acid sequences are derived from the classes of the Vertebrata; Euteleostomi, Actinopterygii; Neopterygii; Teleostei; Euteleostei, Protacanthopterygii, Salmoniformes; Salmonidae or Oncorhynchus or Vertebrata, Amphibia, Anura, Pipidae, Xenopus or Evertebrata such as Protochordata, Tunicata, Holothuroidea, Cionidae such as Amaroucium constellatum, Botryllus schlosseri, Ciona intestinalis, Molgula citrina, Molgula manhattensis, Perophora viridis or Styela partita. The nucleic acids are especially advantageously derived from fungi, animals, or from plants such as algae or mosses, preferably from the order of the Salmoniformes, such as the family of the Salmonidae, such as the genus Salmo, for example from the genera and species Oncorhynchus mykiss, Trutta trutta or Salmo trutta fario, from algae, such as the genera Mantoniella or Ostreococcus, or from the diatoms such as the genera Thalassiosira or Phaeodactylum or from algae such as Crypthecodinium.
[0131] The process according to the invention advantageously the abovementioned nucleic acid sequences or their derivatives or homologues which encode polypeptides which retain the enzymatic activity of the proteins encoded by nucleic acid sequences. These sequences, individually or in combination with the nucleic acid sequences which encode .DELTA.12-desaturase, .DELTA.4-desaturase, .DELTA.5-desaturase, .DELTA.6-desaturase, .DELTA.5-elongase, .DELTA.6-elongase and/or .omega.3-desaturase, are cloned into expression constructs and used for the introduction into, and expression in, organisms. Owing to their construction, these expression constructs make possible an advantageous optimal synthesis of the polyunsaturated fatty acids produced in the process according to the invention.
[0132] In a preferred embodiment, the process furthermore comprises the step of obtaining a cell or an intact organism which comprises the nucleic acid sequences used in the process, where the cell and/or the organism is transformed with a nucleic acid sequence according to the invention which encodes the .DELTA.12-desaturase, .DELTA.4-desaturase, .DELTA.5-desaturase, .DELTA.6-desaturase, .DELTA.5-elongase, .DELTA.6-elongase and/or .omega.3-desaturase, a gene construct or a vector as described above, alone or in combination with further nucleic acid sequences which encode proteins of the fatty acid or lipid metabolism. In a further preferred embodiment, this process furthermore comprises the step of obtaining the oils, lipids or free fatty acids from the organism or from the culture. The culture can, for example, take the form of a fermentation culture, for example in the case of the cultivation of microorganisms, such as, for example, Mortierella, Thalassiosira, Mantoniella, Ostreococcus, Saccharomyces or Thraustochytrium, or a greenhouse- or field-grown culture of a plant. The cell or the organism produced thus is advantageously a cell of an oil-producing organism, such as an oil crop, such as, for example, peanut, oilseed rape, canola, linseed, hemp, peanut, soybean, safflower, hemp, sunflowers or borage.
[0133] In the case of plant cells, plant tissue or plant organs, "growing" is understood as meaning, for example, the cultivation on or in a nutrient medium, or of the intact plant on or in a substrate, for example in a hydroponic culture, potting compost or on arable land.
[0134] For the purposes of the invention, "transgenic" or "recombinant" means with regard to, for example, a nucleic acid sequence, an expression cassette (=gene construct) or a vector comprising the nucleic acid sequence or an organism transformed with the nucleic acid sequences, expression cassettes or vectors according to the invention, all those constructions brought about by recombinant methods in which either
[0135] a) the nucleic acid sequence according to the invention, or
[0136] b) a genetic control sequence which is operably linked with the nucleic acid sequence according to the invention, for example a promoter, or
[0137] c) a) and b) are not located in their natural genetic environment or have been modified by recombinant methods, it being possible for the modification to take the form of, for example, a substitution, addition, deletion, inversion or insertion of one or more nucleotide residues. The natural genetic environment is understood as meaning the natural genomic or chromosomal locus in the original organism or the presence in a genomic library. In the case of a genomic library, the natural genetic environment of the nucleic acid sequence is preferably retained, at least in part. The environment flanks the nucleic acid sequence at least on one side and has a sequence length of at least 50 bp, preferably at least 500 bp, especially preferably at least 1000 bp, most preferably at least 5000 bp. A naturally occurring expression cassette--for example the naturally occurring combination of the natural promoter of the nucleic acid sequences with the corresponding .DELTA.12-desaturase, .DELTA.4-desaturase, .DELTA.5-desaturase, .DELTA.6-desaturase, .DELTA.8-desaturase, .omega.3-desaturase, .DELTA.9-elongase, .DELTA.6-elongase and/or .DELTA.5-elongase genes--becomes a transgenic expression cassette when this expression cassette is modified by non-natural, synthetic ("artificial") methods such as, for example, mutagenic treatment. Suitable methods are described, for example, in U.S. Pat. No. 5,565,350 or WO 00/15815.
[0138] A transgenic organism or transgenic plant for the purposes of the invention is therefore understood as meaning, as above, that the nucleic acids used in the process are not at their natural locus in the genome of an organism, it being possible for the nucleic acids to be expressed homologously or heterologously. However, as mentioned, transgenic also means that, while the nucleic acids according to the invention are at their natural position in the genome of an organism, the sequence has been modified with regard to the natural sequence, and/or that the regulatory sequences of the natural sequences have been modified. Transgenic is preferably understood as meaning the expression of the nucleic acids according to the invention at an unnatural locus in the genome, i.e. homologous or, preferably, heterologous expression of the nucleic acids takes place. Preferred transgenic organisms are fungi such as Mortierella or Phytophtora, mosses such as Physcomitrella, algae such as Mantoniella, Euglena, Crypthecodinium or Ostreococcus, diatoms such as Thalassiosira or Phaeodactylum, or plants such as the oil crops.
[0139] Organisms or host organisms for the nucleic acids, the expression cassette or the vector used in the process according to the invention are, in principle, advantageously all organisms which are capable of synthesizing fatty acids, specifically unsaturated fatty acids, and/or which are suitable for the expression of recombinant genes. Examples which may be mentioned are plants such as Arabidopsis, Asteraceae such as Calendula or crop plants such as soybean, peanut, castor-oil plant, sunflower, maize, cotton, flax, oilseed rape, coconut, oil palm, safflower (Carthamus tinctorius) or cacao bean, microorganisms, such as fungi, for example the genus Mortierella, Thraustochytrium, Saprolegnia, Phytophtora or Pythium, bacteria, such as the genus Escherichia or Shewanella, yeasts, such as the genus Saccharomyces, cyanobacteria, ciliates, algae such as Mantoniella, Euglena, Thalassiosira or Ostreococcus, or protozoans such as dinoflagellates, such as Crypthecodinium. Preferred organisms are those which are naturally capable of synthesizing substantial amounts of oil, such as fungi, such as Mortierella alpina, Pythium insidiosum, Phytophtora infestans, or plants such as soybean, oilseed rape, coconut, oil palm, safflower, flax, hemp, castor-oil plant, Calendula, peanut, cacao bean or sunflower, or yeasts such as Saccharomyces cerevisiae with soybean, flax, oilseed rape, safflower, sunflower, Calendula, Mortierella or Saccharomyces cerevisiae being especially preferred.
[0140] In principle, host organisms are, in addition to the abovementioned transgenic organisms, also transgenic animals, advantageously nonhuman animals, for example C. elegans, Ciona intestinalis or Xenopus laevis.
[0141] Further utilizable host cells are detailed in: Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990).
[0142] Expression strains which can be used, for example those with a lower protease activity, are described in: Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 119-128.
[0143] These include plant cells and certain tissues, organs and parts of plants in all their phenotypic forms such as anthers, fibers, root hairs, stalks, embryos, calli, cotelydons, petioles, harvested material, plant tissue, reproductive tissue and cell cultures which are derived from the actual transgenic plant and/or can be used for bringing about the transgenic plant.
[0144] Transgenic plants which comprise the polyunsaturated fatty acids synthesized in the process according to the invention can advantageously be marketed directly without there being any need for the oils, lipids or fatty acids synthesized to be isolated. Plants for the process according to the invention are listed as meaning intact plants and all plant parts, plant organs or plant parts such as leaf, stem, seeds, root, tubers, anthers, fibers, root hairs, stalks, embryos, calli, cotelydons, petioles, harvested material, plant tissue, reproductive tissue and cell cultures which are derived from the actual transgenic plant and/or can be used for bringing about the transgenic plant. In this context, the seed comprises all parts of the seed such as the seed coats, epidermal cells, seed cells, endosperm or embryonic tissue. However, the compounds produced in the process according to the invention can also be isolated from the organisms, advantageously plants, in the form of their oils, fats, lipids and/or free fatty acids. Polyunsaturated fatty acids produced by this process can be obtained by harvesting the organisms, either from the crop in which they grow, or from the field. This can be done via pressing or extraction of the plant parts, preferably the plant seeds. In this context, the oils, fats, lipids and/or free fatty acids can be obtained by what is known as cold-beating or cold-pressing without applying heat. To allow for greater ease of disruption of the plant parts, specifically the seeds, they are previously comminuted, steamed or roasted. The seeds which have been pretreated in this manner can subsequently be pressed or extracted with solvents such as warm hexane. The solvent is subsequently removed. In the case of microorganisms, the latter are, after harvesting, for example extracted directly without further processing steps or else, after disruption, extracted via various methods with which the skilled worker is familiar. In this manner, more than 96% of the compounds produced in the process can be isolated. Thereafter, the resulting products are processed further, i.e. refined. In this process, substances such as the plant mucilages and suspended matter are first removed. What is known as desliming can be effected enzymatically or, for example, chemico-physically by addition of acid such as phosphoric acid. Thereafter, the free fatty acids are removed by treatment with a base, for example sodium hydroxide solution. The resulting product is washed thoroughly with water to remove the alkali remaining in the product and then dried. To remove the pigment remaining in the product, the products are subjected to bleaching, for example using filler's earth or active charcoal. At the end, the product is deodorized, for example using steam.
[0145] The PUFAs or LCPUFAs produced by this process are advantageously C.sub.18-, D.sub.20- or C.sub.22-fatty acid molecules, advantageously C.sub.20- or C.sub.22-fatty acid molecules, with at least two double bonds in the fatty acid molecule, preferably three, four, five or six double bonds. These C.sub.18-, C.sub.20- or C.sub.22-fatty acid molecules can be isolated from the organism in the form of an oil, a lipid or a free fatty acid. Suitable organisms are, for example, those mentioned above. Preferred organisms are transgenic plants.
[0146] One embodiment of the invention is therefore oils, lipids or fatty acids or fractions thereof which have been produced by the above-described process, especially preferably oil, lipid or a fatty acid composition comprising PUFAs and being derived from transgenic plants.
[0147] As described above, these oils, lipids or fatty acids advantageously comprise 6 to 15% of palmitic acid, 1 to 6% of stearic acid, 7-85% of oleic acid, 0.5 to 8% of vaccenic acid, 0.1 to 1% of arachic acid, 7 to 25% of saturated fatty acids, 8 to 85% of monounsaturated fatty acids and 60 to 85% of polyunsaturated fatty acids, in each case based on 100% and on the total fatty acid content of the organisms. Advantageous polyunsaturated fatty acids which are present in the fatty acid esters or fatty acid mixtures are preferably at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1% of arachidonic acid, based on the total fatty acid content. Moreover, the fatty acid esters or fatty acid mixtures which have been produced by the process of the invention advantageously comprise fatty acids selected from the group of the fatty acids erucic acid (13-docosaenoic acid), sterculic acid (9,10-methyleneoctadec-9-enoic acid), malvalic acid (8,9-methyleneheptadec-8-enoic acid), chaulmoogric acid (cyclopentenedodecanoic acid), furan fatty acid (9,12-epoxyoctadeca-9,11-dienoic acid), vernolic acid (9,10-epoxyoctadec-12-enoic acid), tariric acid (6-octadecynoic acid), 6-nonadecynoic acid, santalbic acid (t11-octadecen-9-ynoic acid), 6,9-octadecenynoic acid, pyrulic acid (t10-heptadecen-8-ynoic acid), crepenyninic acid (9-octadecen-12-ynoic acid), 13,14-dihydrooropheic acid, octadecen-13-ene-9,11-diynoic acid, petroselenic acid (cis-6-octadecenoic acid), 9c,12t-octadecadienoic acid, calendulic acid (8t10t12c-octadecatrienoic acid), catalpic acid (9t11t13c-octadecatrienoic acid), eleostearic acid (9c11t13t-octadecatrienoic acid), jacaric acid (8c10t12c-octadecatrienoic acid), punicic acid (9c11t13c-octadecatrienoic acid), parinaric acid (9c11t13t15c-octadecatetraenoic acid), pinolenic acid (all-cis-5,9,12-octadecatrienoic acid), laballenic acid (5,6-octadecadienallenic acid), ricinoleic acid (12-hydroxyoleic acid) and/or coriolic acid (13-hydroxy-9c,11t-octadecadienoic acid). The abovementioned fatty acids are, as a rule, advantageously only found in traces in the fatty acid esters or fatty acid mixtures produced by the process according to the invention, that is to say that, based on the total fatty acids, they occur to less than 30%, preferably to less than 25%, 24%, 23%, 22% or 21%, especially preferably to less than 20%, 15%, 10%, 9%, 8%, 7%, 6% or 5%, very especially preferably to less than 4%, 3%, 2% or 1%. In a further preferred form of the invention, these abovementioned fatty acids occur to less than 0.9%, 0.8%, 0.7%, 0.6% or 0.5%, especially preferably to less than 0.4%, 0.3%, 0.2%, 0.1%, based on the total fatty acids. The fatty acid esters or fatty acid mixtures produced by the process according to the invention advantageously comprise less than 0.1%, based on the total fatty acids, and/or no butyric acid, no cholesterol, no clupanodonic acid (=docosapentaenoic acid, C22:5.sup..DELTA.4,8,12,15,21) and no nisinic acid (tetracosahexaenoic acid, C23:6.sup..DELTA.3,8,12,15,18,21).
[0148] The oils, lipids or fatty acids according to the invention advantageously comprise at least 0.5%, 1%, 2%, 3%, 4% or 5%, advantageously at least 6%, 7%, 8%, 9% or 10%, especially advantageously at least 11%, 12%, 13%, 14% or 15% of ARA or at least 0.5%, 1%, 2%, 3%, 4% or 5%, advantageously at least 6% or 7%, especially advantageously at least 8%, 9% or 10% of EPA and/or DHA, based on the total fatty acid content of the production organism, advantageously of a plant, especially preferably of an oil crop plant such as soybean, oilseed rape, coconut, oil palm, safflower, flax, hemp, castor-oil plant, Calendula, peanut, cacao bean, sunflower, or the abovementioned further mono- or dicotyledonous oil crop plants.
[0149] A further embodiment according to the invention is the use of the oil, lipid, the fatty acids and/or the fatty acid composition in feedstuffs, foodstuffs, cosmetics or pharmaceuticals. The oils, lipids, fatty acids or fatty acid mixtures according to the invention can be used in the manner with which the skilled worker is familiar for mixing with other oils, lipids, fatty acids or fatty acid mixtures of animal origin, such as, for example, fish oils. These oils, lipids, fatty acids or fatty acid mixtures, which are composed of vegetable and animal constituents, may also be used for the preparation of feedstuffs, foodstuffs, cosmetics or pharmacologicals.
[0150] The term "oil", "lipid" or "fat" is understood as meaning a fatty acid mixture comprising unsaturated, saturated, preferably esterified, fatty acid(s). The oil, lipid or fat is preferably high in polyunsaturated free or, advantageously, esterified fatty acid(s), in particular linoleic acid, .gamma.-linolenic acid, dihomo-.gamma.-linolenic acid, arachidonic acid, .alpha.-linolenic acid, stearidonic acid, eicosatetraenoic acid, eicosapentaenoic acid, docosapentaenoic acid or docosahexaenoic acid.
[0151] The amount of unsaturated esterified fatty acids preferably amounts to approximately 30%, a content of 50% is more preferred, a content of 60%, 70%, 80% or more is even more preferred. For the analysis, the fatty acid content can, for example, be determined by gas chromatography after converting the fatty acids into the methyl esters by transesterification. The oil, lipid or fat can comprise various other saturated or unsaturated fatty acids, for example calendulic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid and the like. The content of the various fatty acids in the oil or fat can vary, in particular depending on the starting organism.
[0152] The polyunsaturated fatty acids with advantageously at least two double bonds which are produced in the process are, as described above, for example sphingolipids, phosphoglycerides, lipids, glycolipids, phospholipids, monoacylglycerol, diacylglycerol, triacylglycerol or other fatty acid esters.
[0153] Starting from the polyunsaturated fatty acids with advantageously at least five or six double bonds, which acids have been prepared in the process according to the invention, the polyunsaturated fatty acids which are present can be liberated for example via treatment with alkali, for example aqueous KOH or NaOH, or acid hydrolysis, advantageously in the presence of an alcohol such as methanol or ethanol, or via enzymatic cleavage, and isolated via, for example, phase separation and subsequent acidification via, for example, H.sub.2SO.sub.4. The fatty acids can also be liberated directly without the above-described processing step.
[0154] After their introduction into an organism, advantageously a plant cell or plant, the nucleic acids used in the process can either be present on a separate plasmid or, advantageously, integrated into the genome of the host cell. In the case of integration into the genome, integration can be random or else be effected by recombination such that the native gene is replaced by the copy introduced, whereby the production of the desired compound by the cell is modulated, or by the use of a gene in trans, so that the gene is linked operably with a functional expression unit which comprises at least one sequence which ensures the expression of a gene and at least one sequence which ensures the polyadenylation of a functionally transcribed gene. The nucleic acids are advantageously introduced into the organisms via multiexpression cassettes or constructs for multiparallel expression, advantageously into the plants for the multiparallel seed-specific expression of genes.
[0155] Mosses and algae are the only known plant systems which produce substantial amounts of polyunsaturated fatty acids such as arachidonic acid (ARA) and/or eicosapentaenoic acid (EPA) and/or docosahexaenoic acid (DHA). Mosses comprise PUFAs in membrane lipids, while algae, organisms which are related to algae and a few fungi also accumulate substantial amounts of PUFAs in the triacylglycerol fraction. This is why nucleic acid molecules which are isolated from such strains which also accumulate PUFAs in the triacylglycerol fraction are particularly advantageous for the process according to the invention and thus for the modification of the lipid and PUFA production system in a host, in particular plants such as oil crops, for example oilseed rape, canola, linseed, hemp, soybeans, sunflowers and borage. They can therefore be used advantageously in the process according to the invention.
[0156] Substrates which are advantageously suitable for the nucleic acids which are used in the process according to the invention and which encode polypeptides with .DELTA.12-desaturase, .DELTA.5-desaturase, .DELTA.4-desaturase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.9-elongase, .DELTA.5-elongase, .DELTA.6-elongase and/or .omega.3-desaturase activity and/or the further nucleic acids used, such as the nucleic acids which encode polypeptides of the fatty acid or lipid metabolism selected from the group acyl-CoA dehydrogenase(s), acyl-ACP [=acyl carrier protein] desaturase(s), acyl-ACP thioesterase(s), fatty acid acyltransferase(s), acyl-CoA:lysophospholipid acyltransferase(s), fatty acid synthase(s), fatty acid hydroxylase(s), acetyl-coenzyme A carboxylase(s), acyl-coenzyme A oxidase(s), fatty acid desaturase(s), fatty acid acetylenases, lipoxygenases, triacylglycerol lipases, allenoxide synthases, hydroperoxide lyases or fatty acid elongase(s) are advantageously C.sub.16-, C.sub.18 or C.sub.20-fatty acids. The fatty acids converted as substrates in the process are preferably converted in the form of their acyl-CoA esters and/or their phospholipid esters.
[0157] To produce the long-chain PUFAs according to the invention, the polyunsaturated C.sub.18-fatty acids must first be desaturated by the enzymatic activity of a desaturase and subsequently be elongated by at least two carbon atoms via an elongase. After one elongation cycle, this enzyme activity gives C.sub.20-fatty acids and after two elongation cycles C.sub.22-fatty acids. The activity of the desaturases and elongases used in the process according to the invention preferably leads to C.sub.18-, C.sub.20- and/or C.sub.22-fatty acids, advantageously with at least two double bonds in the fatty acid molecule, preferably with three, four, five or six double bonds, especially preferably to give C.sub.20- and/or C.sub.22-fatty acids with at least two double bonds in the fatty acid molecule, preferably with three, four, five or six double bonds, very specially preferably with five or six double bonds in the molecule. After a first desaturation and the elongation have taken place, further desaturation and elongation steps such as, for example, such a desaturation in the .DELTA.5 and .DELTA.4 position may take place. Products of the process according to the invention which are especially preferred are dihomo-.gamma.-linolenic acid, arachidonic acid, eicosapentaenoic acid, docosapentaenoic acid and/or docosahexaenoic acid. The C.sub.20-fatty acids with at least two double bonds in the fatty acid can be elongated by the enzymatic activity according to the invention in the form of the free fatty acid or in the form of the esters, such as phospholipids, glycolipids, sphingolipids, phosphoglycerides, monoacylglycerol, diacylglycerol or triacylglycerol.
[0158] The preferred biosynthesis site of the fatty acids, oils, lipids or fats in the plants which are advantageously used is, for example, in general the seed or cell strata of the seed, so that seed-specific expression of the nucleic acids used in the process makes sense. However, it is obvious that the biosynthesis of fatty acids, oils or lipids need not be limited to the seed tissue, but can also take place in a tissue-specific manner in all the other parts of the plant, for example in epidermal cells or in the tubers.
[0159] If microorganisms such as yeasts, such as Saccharomyces or Schizosaccharomyces, fungi such as Mortierella, Aspergillus, Phytophtora, Entomophthora, Mucor or Thraustochytrium, algae such as Isochrysis, Mantoniella, Euglena, Ostreococcus, Phaeodactylum or Crypthecodinium are used as organisms in the process according to the invention, these organisms are advantageously grown in fermentation cultures.
[0160] Owing to the use of the nucleic acids according to the invention which encode a .DELTA.5-elongase, the polyunsaturated fatty acids produced in the process can be increased by at least 5%, preferably by at least 10%, especially preferably by at least 20%, very especially preferably by at least 50% in comparison with the wild types of the organisms which do not comprise the nucleic acids recombinantly.
[0161] In principle, the polyunsaturated fatty acids produced by the process according to the invention in the organisms used in the process can be increased in two different ways. Advantageously, the pool of free polyunsaturated fatty acids and/or the content of the esterified polyunsaturated fatty acids produced via the process can be enlarged. Advantageously, the pool of esterified polyunsaturated fatty acids in the transgenic organisms is enlarged by the process according to the invention.
[0162] If microorganisms are used as organisms in the process according to the invention, they are grown or cultured in the manner with which the skilled worker is familiar, depending on the host organism. As a rule, microorganisms are grown in a liquid medium comprising a carbon source, usually in the form of sugars, a nitrogen source, usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as salts of iron, manganese and magnesium and, if appropriate, vitamins, at temperatures of between 0.degree. C. and 100.degree. C., preferably between 10.degree. C. and 60.degree. C., while passing in oxygen. The pH of the liquid medium can either be kept constant, that is to say regulated during the culturing period, or not. The cultures can be grown batchwise, semibatchwise or continuously. Nutrients can be provided at the beginning of the fermentation or fed in semicontinuously or continuously. The polyunsaturated fatty acids produced can be isolated from the organisms as described above by processes known to the skilled worker, for example by extraction, distillation, crystallization, if appropriate precipitation with salt, and/or chromatography. To this end, the organisms can advantageously be disrupted beforehand.
[0163] If the host organisms are microorganisms, the process according to the invention is advantageously carried out at a temperature of between 0.degree. C. and 95.degree. C., preferably between 10.degree. C. and 85.degree. C., especially preferably between 15.degree. C. and 75.degree. C., very especially preferably between 15.degree. C. and 45.degree. C.
[0164] In this process, the pH value is advantageously kept between pH 4 and 12, preferably between pH 6 and 9, especially preferably between pH 7 and 8.
[0165] The process according to the invention can be operated batchwise, semibatchwise or continuously. An overview over known cultivation methods can be found in the textbook by Chmiel (Bioproze.beta.technik 1. Einfuhrung in die Bioverfahrenstechnik [Bioprocess technology 1. Introduction to Bioprocess technology] (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (Bioreaktoren and periphere Einrichtungen [Bioreactors and peripheral equipment] (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)).
[0166] The culture medium to be used must suitably meet the requirements of the strains in question. Descriptions of culture media for various microorganisms can be found in the textbook "Manual of Methods fur General Bacteriology" of the American Society for Bacteriology (Washington D.C., USA, 1981).
[0167] As described above, these media which can be employed in accordance with the invention usually comprise one or more carbon sources, nitrogen sources, inorganic salts, vitamins and/or trace elements.
[0168] Preferred carbon sources are sugars, such as mono-, di- or polysaccharides. Examples of very good carbon sources are glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose. Sugars can also be added to the media via complex compounds such as molasses or other by-products from sugar raffination. The addition of mixtures of a variety of carbon sources may also be advantageous. Other possible carbon sources are oils and fats such as, for example, soya oil, sunflower oil, peanut oil and/or coconut fat, fatty acids such as, for example, palmitic acid, stearic acid and/or linoleic acid, alcohols and/or polyalcohols such as, for example, glycerol, methanol and/or ethanol, and/or organic acids such as, for example, acetic acid and/or lactic acid.
[0169] Nitrogen sources are usually organic or inorganic nitrogen compounds or materials comprising these compounds. Examples of nitrogen sources comprise ammonia in liquid or gaseous form or ammonium salts such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate or ammonium nitrate, nitrates, urea, amino acids or complex nitrogen sources such as cornsteep liquor, soya meal, soya protein, yeast extract, meat extract and others. The nitrogen sources can be used individually or as a mixture.
[0170] Inorganic salt compounds which may be present in the media comprise the chloride, phosphorus and sulfate salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron.
[0171] Inorganic sulfur-containing compounds such as, for example, sulfates, sulfites, dithionites, tetrathionates, thiosulfates, sulfides, or else organic sulfur compounds such as mercaptans and thiols may be used as sources of sulfur for the production of sulfur-containing fine chemicals, in particular of methionine.
[0172] Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts may be used as sources of phosphorus.
[0173] Chelating agents may be added to the medium in order to keep the metal ions in solution. Particularly suitable chelating agents include dihydroxyphenols such as catechol or protocatechuate and organic acids such as citric acid.
[0174] The fermentation media used according to the invention for culturing microorganisms usually also comprise other growth factors such as vitamins or growth promoters, which include, for example, biotin, riboflavin, thiamine, folic acid, nicotinic acid, panthothenate and pyridoxine. Growth factors and salts are frequently derived from complex media components such as yeast extract, molasses, cornsteep liquor and the like. It is moreover possible to add suitable precursors to the culture medium. The exact composition of the media compounds heavily depends on the particular experiment and is decided upon individually for each specific case. Information on the optimization of media can be found in the textbook "Applied Microbiol. Physiology, A Practical Approach" (Editors P. M. Rhodes, P. F. Stanbury, IRL Press (1997) pp. 53-73, ISBN 0 19 963577 3). Growth media can also be obtained from commercial suppliers, for example Standard 1 (Merck) or BHI (brain heart infusion, DIFCO) and the like.
[0175] All media components are sterilized, either by heat (20 min at 1.5 bar and 121.degree. C.) or by filter sterilization. The components may be sterilized either together or, if required, separately. All media components may be present at the start of the cultivation or added continuously or batchwise, as desired.
[0176] The culture temperature is normally between 15.degree. C. and 45.degree. C., preferably at from 25.degree. C. to 40.degree. C., and may be kept constant or may be altered during the experiment. The pH of the medium should be in the range from 5 to 8.5, preferably around 7.0. The pH for cultivation can be controlled during cultivation by adding basic compounds such as sodium hydroxide, potassium hydroxide, ammonia and aqueous ammonia or acidic compounds such as phosphoric acid or sulfuric acid. Foaming can be controlled by employing antifoams such as, for example, fatty acid polyglycol esters. To maintain the stability of plasmids it is possible to add to the medium suitable substances having a selective effect, for example antibiotics. Aerobic conditions are maintained by introducing oxygen or oxygen-containing gas mixtures such as, for example, ambient air into the culture. The temperature of the culture is normally 20.degree. to 40.degree. C. and preferably 25.degree. C. to 40.degree. C. The culture is continued until formation of the desired product is at a maximum. This aim is normally achieved within 10 to 160 hours.
[0177] The fermentation broths obtained in this way, in particular those containing polyunsaturated fatty acids, usually contain a dry mass of from 7.5 to 25% by weight.
[0178] The fermentation broth can then be processed further. The biomass may, according to requirement, be removed completely or partially from the fermentation broth by separation methods such as, for example, centrifugation, filtration, decanting or a combination of these methods or be left completely in said broth. It is advantageous to process the biomass after its separation.
[0179] However, the fermentation broth can also be thickened or concentrated without separating the cells, using known methods such as, for example, with the aid of a rotary evaporator, thin-film evaporator, falling-film evaporator, by reverse osmosis or by nanofiltration. Finally, this concentrated fermentation broth can be processed to obtain the fatty acids present therein.
[0180] The fatty acids obtained in the process are also suitable as starting material for the chemical synthesis of further products of interest. For example, they can be used in combination with one another or alone for the preparation of pharmaceuticals, foodstuffs, animal feeds or cosmetics.
[0181] The invention furthermore relates to isolated nucleic acid sequences encoding polypeptides with .DELTA.5-elongase, where the .DELTA.5-elongases encoded by the nucleic acid sequences convert C.sub.20-fatty acids with at least four double bonds in the fatty acid molecule, which are advantageously eventually incorporated into diacylglycerides and/or triacylglycerides.
[0182] Advantageous isolated nucleic acid sequences are nucleic acid sequences which encode polypeptides with .DELTA.5-elongase activity and which comprise an amino acid sequence selected from the group of an amino acid sequence with the sequence shown in SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141 or SEQ ID NO: 142.
[0183] Further advantageous isolated nucleic acid sequences are nucleic acid sequences which encode polypeptides with .DELTA.5-elongase activity and which comprise a combination of the amino acid sequences selected from the group consisting of:
[0184] a) SEQ ID NO: 115 and SEQ ID NO: 139, SEQ ID NO: 115 and SEQ ID NO: 140 or SEQ ID NO: 139 and SEQ ID NO: 140; or
[0185] b) SEQ ID NO: 116 and SEQ ID NO: 141, SEQ ID NO: 116 and SEQ ID NO: 142 or SEQ ID NO: 141 and SEQ ID NO: 142; or
[0186] c) SEQ ID NO: 115, SEQ ID NO: 139 and SEQ ID NO: 140 or SEQ ID NO: 116, SEQ ID NO: 141 and SEQ ID NO: 142.
[0187] The sequences shown in the sequences SEQ ID NO: 115 (NXXXHXXMYXYYX), SEQ ID NO: 116 (HHXXXXWAWW), SEQ ID NO: 139 (LHXXHH), SEQ ID NO: 140 (TXXQXXQF), SEQ ID NO: 141 (DTXFMV) and SEQ ID NO: 142 (TQAQXXQF) constitute conserved regions of the various elongases. Table 2 shows the meaning of the amino acids marked with X, which are present in the abovementioned nucleic acid sequences (column 3). The preferred amino acids in the various positions can also be found in the table (column 3). Column 1 indicates the SEQ ID NO, column 2 the position in the sequence.
TABLE-US-00002 TABLE 2 Meaning of the amino acid marked X in the consensus sequences. Position of the X in the SEQ ID NO: sequence Amino acid Preferred amino acid 115 2 Ser, Cys, Leu, Gly Cys, Leu (NXXXHXXMYXYYX) 115 3 Thr, Phe, Ile, Ser, Phe, Trp Val, Trp, Gly 115 4 Val, Ile Val, Ile 115 6 Val, Ile, Thr Val, Ile 115 7 Ile, Phe, Val, Leu, Cys, Val Cys 115 10 Ser, Gly, Tyr, Thr, Thr, Ser Ala 115 13 Phe, Met, Thr, Leu, Leu Ala, Gly 116 3 Ala, Ser, Thr Ala, Ser especially (HHXXXXWAWW) preferably Ala 116 4 Thr, Met, Val, Leu, Leu, Thr especially Ile, Ser preferably Leu 116 5 Val, Thr, Met, Leu, Ile, Ser especially Ile preferably Ile 116 6 Val, Met, Leu, Ile, Ile, Ser especially Ala, Pro, Ser, Phe preferably Ile 139 3 Val, Tyr, Ile Val, Thr LHXXHH 139 4 Tyr, Phe Tyr 140 2 Asn, Asp, Thr, Gln, Gln TXXQXXQF Met, Ser, Ala 140 3 Thr, Cys, Leu, Met, Ala, Met Ala, Ile, Val, Phe 140 5 Met, Ile, Leu Met 140 6 Val, Ile, Leu, Thr, Leu Phe 141 3 Leu, Ile, Val, Tyr, Phe DTXFMV Phe, Ala 142 5 Met, Ile, Leu Met, Leu especially TQAQXXQF preferably Met 142 6 Val, Ile, Leu, Thr, Leu Phe
[0188] Especially advantageous .DELTA.5-elongases comprise at least one of the sequences SEQ ID NO: 116, SEQ ID NO: 141 and/or SEQ ID NO: 142.
[0189] Especially advantageous isolated nucleic acid sequences are sequences selected from the group consisting of:
[0190] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63; SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 113, SEQ ID NO: 131 or SEQ ID NO: 133,
[0191] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino sequence shown in SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 114, SEQ ID NO: 132 or SEQ ID NO: 134, or
[0192] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63; SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 113, SEQ ID NO: 131 or SEQ ID NO: 133, which encode polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 113, SEQ ID NO: 131 or SEQ ID NO: 133 and which have .DELTA.5-elongase activity.
[0193] The invention furthermore relates to isolated nucleic acid sequences which encode polypeptides with .DELTA.6-elongase activity, selected from the group consisting of:
[0194] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 69, SEQ ID NO: 81, SEQ ID NO: 111 or SEQ ID NO: 183,
[0195] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 70, SEQ ID NO: 82, SEQ ID NO: 112 or SEQ ID NO: 184, or
[0196] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 69, SEQ ID NO: 81, SEQ ID NO: 111 or SEQ ID NO: 183 which encode polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 70, SEQ ID NO: 82, SEQ ID NO: 112 or SEQ ID NO: 184 and which have .DELTA.6-elongase activity.
[0197] The invention furthermore relates to isolated nucleic acid sequences which encode polypeptides with .omega.3-desaturase activity, selected from the group consisting of:
[0198] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 87 or SEQ ID NO: 105,
[0199] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 88 or SEQ ID NO: 106, or
[0200] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 87 or SEQ ID NO: 105 which have polypeptides with at least 60% identity at the amino acid level with SEQ ID NO: 88 or SEQ ID NO: 106 and which have .omega.3-desaturase activity.
[0201] The invention furthermore relates to isolated nucleic acid sequences encoding a polypeptide with .DELTA.6-desaturase activity, selected from the group consisting of:
[0202] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 89 or in SEQ ID NO: 97, or
[0203] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 90 or SEQ ID NO: 98, or
[0204] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 89 or SEQ ID NO: 97 which encode polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 90 or SEQ ID NO: 98 and which have .DELTA.6-desaturase activity.
[0205] The invention furthermore relates to isolated nucleic acid sequences encoding a polypeptide with .DELTA.5-desaturase activity, selected from the group consisting of:
[0206] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 99 or in SEQ ID NO: 101,
[0207] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 100 or in SEQ ID NO: 102, or
[0208] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 99 or in SEQ ID NO: 101 which encode polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 100 or in SEQ ID NO: 102 and which have .DELTA.5-desaturase activity.
[0209] The invention furthermore relates to isolated nucleic acid sequences encoding a polypeptide with .DELTA.4-desaturase activity, selected from the group consisting of:
[0210] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 95 or in SEQ ID NO: 103,
[0211] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 96 or SEQ ID NO: 104, or
[0212] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 95 or SEQ ID NO: 103 which encode polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 96 or SEQ ID NO: 104 and which have .DELTA.4-desaturase activity.
[0213] The invention furthermore relates to isolated nucleic acid sequences encoding a polypeptide with .DELTA.12-desaturase activity, selected from the group consisting of:
[0214] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 107 or in SEQ ID NO: 109,
[0215] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 108 or SEQ ID NO: 110, or
[0216] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 107 or SEQ ID NO: 109 which encode polypeptides with at least 50% homology at the amino acid level with SEQ ID NO: 108 or SEQ ID NO: 110 and which have .DELTA.12-desaturase activity.
[0217] The invention furthermore relates to gene constructs which comprise the nucleic acid sequences SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183, according to the invention, wherein the nucleic acid is linked operably with one or more regulatory signals. In addition, additional biosynthesis genes of the fatty acid or lipid metabolism selected from the group acyl-CoA dehydrogenase(s), acyl-ACP [=acyl carrier protein] desaturase(s), acyl-ACP thioesterase(s), fatty acid acyltransferase(s), acyl-CoA:lysophospholipid acyltransferase(s), fatty acid synthase(s), fatty acid hydroxylase(s), acetyl-coenzyme A carboxylase(s), acyl-coenzyme A oxidase(s), fatty acid desaturase(s), fatty acid acetylenases, lipoxygenases, triacylglycerol lipases, allenoxide synthases, hydroperoxide lyases or fatty acid elongase(s) may be present in the gene construct. Advantageously, biosynthesis genes of the fatty acid or lipid metabolism selected from the group .DELTA.4-desaturase, .DELTA.5-desaturase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.9-desaturase, .DELTA.12-desaturase, .DELTA.6-elongase, .DELTA.9-elongase or .omega.3-desaturase are additionally present.
[0218] All of the nucleic acid sequences used in the process according to the invention are advantageously derived from a eukaryotic organism such as a plant, a microorganism or an animal. The nucleic acid sequences are preferably derived from the order Salmoniformes, algae such as Mantoniella, Crypthecodinium, Euglena or Ostreococcus, fungi such as the genus Phytophthora or from diatoms such as the genera Thalassiosira or Phaeodactylum.
[0219] The nucleic acid sequences used in the process which encode proteins with .omega.3-desaturase, .DELTA.4-desaturase, .DELTA.5-desaturase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.9-desaturase, .DELTA.12-desaturase, .DELTA.5-elongase, .DELTA.6-elongase or .DELTA.9-elongase activity are advantageously introduced alone or, preferably, in combination with an expression cassette (=nucleic acid construct) which makes possible the expression of the nucleic acids in an organism, advantageously a plant or a microorganism. The nucleic acid construct can comprise more than one nucleic acid sequence with an enzymatic activity, such as, for example, of a .DELTA.12-desaturase, .DELTA.4-desaturase, .DELTA.5-desaturase, .DELTA.6-desaturase, .DELTA.5-elongase, .DELTA.6-elongase and/or .omega.3-desaturase.
[0220] To introduce the nucleic acids used in the process, the latter are advantageously amplified and ligated in the known manner. Preferably, a procedure following the protocol for Pfu DNA polymerase or a Pfu/Taq DNA polymerase mixture is followed. The primers are selected taking into consideration the sequence to be amplified. The primers should advantageously be chosen in such a way that the amplificate comprises the entire codogenic sequence from the start codon to the stop codon. After the amplification, the amplificate is expediently analyzed. For example, a gel-electrophoretic separation can be carried out, which is followed by a quantitative and a qualitative analysis. Thereafter, the amplificate can be purified following a standard protocol (for example Qiagen). An aliquot of the purified amplificate is then available for the subsequent cloning step. Suitable cloning vectors are generally known to the skilled worker. These include, in particular, vectors which are capable of replication in microbial systems, that is to say mainly vectors which ensure efficient cloning in yeasts or fungi and which make possible the stable transformation of plants. Those which must be mentioned in particular are various binary and cointegrated vector systems which are suitable for the T-DNA-mediated transformation. Such vector systems are, as a rule, characterized in that they comprise at least the vir genes required for the Agrobacterium-mediated transformation and the T-DNA-delimiting sequences (T-DNA border). These vector systems advantageously also comprise further cis-regulatory regions such as promoters and terminator sequences and/or selection markers, by means of which suitably transformed organisms can be identified. While in the case of cointegrated vector systems vir genes and T-DNA sequences are arranged on the same vector, binary systems are based on at least two vectors, one of which bears vir genes, but no T-DNA, while a second one bears T-DNA, but no vir gene. Owing to this fact, the last-mentioned vectors are relatively small, easy to manipulate and to replicate both in E. coli and in Agrobacterium. These binary vectors include vectors from the series pBIB-HYG, pPZP, pBecks, pGreen. In accordance with the invention, Bin19, pBI101, pBinAR, pGPTV and pCAMBIA are used by preference. An overview of the binary vectors and their use is found in Hellens et al, Trends in Plant Science (2000) 5, 446-451. In order to prepare the vectors, the vectors can first be linearized with restriction endonuclease(s) and then modified enzymatically in a suitable manner. Thereafter, the vector is purified, and an aliquot is employed for the cloning step. In the cloning step, the enzymatically cleaved and, if appropriate, purified amplificate is cloned with vector fragments which have been prepared in a similar manner, using ligase. In this context, a particular nucleic acid construct, or vector or plasmid construct, can have one or else more than one codogenic gene segment. The codogenic gene segments in these constructs are preferably linked operably with regulatory sequences. The regulatory sequences include, in particular, plant sequences such as the above-described promoters and terminator sequences. The constructs can advantageously be stably propagated in microorganisms, in particular in E. coli and Agrobacterium tumefaciens, under selective conditions and make possible the transfer of heterologous DNA into plants or microorganisms.
[0221] The nucleic acids used in the process, the inventive nucleic acids and nucleic acid constructs, can be introduced into organisms such as microorganisms or advantageously plants, advantageously using cloning vectors, and thus be used in the transformation of plants such as those which are published and cited in: Plant Molecular Biology and Biotechnology (CRC Press, Boca Raton, Fla.), Chapter 6/7, p. 71-119 (1993); F. F. White, Vectors for Gene Transfer in Higher Plants; in: Transgenic Plants, Vol. 1, Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press, 1993, 15-38; B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press (1993), 128-143; Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225. Thus, the nucleic acids, the inventive nucleic acids and nucleic acid constructs, and/or vectors used in the process can be used for the recombinant modification of a broad spectrum of organisms, advantageously plants, so that the latter become better and/or more efficient PUFA producers.
[0222] A series of mechanisms by which a modification of the .DELTA.12-desaturase, .DELTA.5-elongase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.4-desaturase, .DELTA.6-desaturase and/or .omega.3-desaturase protein and of the further proteins used in the process, such as .DELTA.12-desaturase, .DELTA.9-elongase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase or .DELTA.4-desaturase protein, is possible exist, so that the yield, production and/or production efficiency of the advantageous polyunsaturated fatty acids in a plant, preferably in an oil crop plant or a microorganism, can be influenced directly owing to this modified protein. The number or activity of the .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.9-elongase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase or .DELTA.4-desaturase proteins or genes can be increased, so that greater amounts of the gene products and, ultimately, greater amounts of the compounds of the general formula I are produced. A de novo synthesis in an organism which has lacked the activity and ability to biosynthesize the compounds prior to introduction of the corresponding gene(s) is also possible. This applies analogously to the combination with further desaturases or elongases or further enzymes of the fatty acid and lipid metabolism. The use of various divergent sequences, i.e. sequences which differ at the DNA sequence level, may also be advantageous in this context, or else the use of promoters for gene expression which make possible a different gene expression in the course of time, for example as a function of the degree of maturity of a seed or an oil-storing tissue.
[0223] Owing to the introduction of a .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.9-elongase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase and/or .DELTA.4-desaturase gene into an organism, alone or in combination with other genes in a cell, it is not only possible to increase biosynthesis flux towards the end product, but also to increase, or to create de novo the corresponding triacylglycerol composition. Likewise, the number or activity of other genes which are involved in the import of nutrients which are required for the biosynthesis of one or more fatty acids, oils, polar and/or neutral lipids, can be increased, so that the concentration of these precursors, cofactors or intermediates within the cells or within the storage compartment is increased, whereby the ability of the cells to produce PUFAs as described below is enhanced further. By optimizing the activity or increasing the number of one or more .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.9-elongase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase or .DELTA.4-desaturase genes which are involved in the biosynthesis of these compounds, or by destroying the activity of one or more genes which are involved in the degradation of these compounds, an enhanced yield, production and/or efficiency of production of fatty acid and lipid molecules in organisms, advantageously in plants, is made possible.
[0224] The isolated nucleic acid molecules used in the process according to the invention encode proteins or parts of these, where the proteins or the individual protein or parts thereof comprise(s) an amino acid sequence with sufficient homology to an amino acid sequence which is shown in the sequences SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 or SEQ ID NO: 184 so that the proteins or parts thereof retain a .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.9-elongase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase or .DELTA.4-desaturase activity. The proteins or parts thereof which is/are encoded by the nucleic acid molecule(s) preferably retains their essential enzymatic activity and the ability of participating in the metabolism of compounds required for the synthesis of cell membranes or lipid bodies in organisms, advantageously in plants, or in the transport of molecules across these membranes. Advantageously, the proteins encoded by the nucleic acid molecules have at least approximately 50%, preferably at least approximately 60% and more preferably at least approximately 70%, 80% or 90% and most preferably at least approximately 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity with the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 or SEQ ID NO: 184. For the purposes of the invention, homology or homologous is understood as meaning identity or identical, respectively.
[0225] The homology was calculated over the entire amino acid or nucleic acid sequence region. The skilled worker has available a series of programs which are based on various algorithms for the comparison of various sequences. Here, the algorithms of Needleman and Wunsch or Smith and Waterman give particularly reliable results. The program PileUp (J. Mol. Evolution, 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the programs Gap and BestFit [Needleman and Wunsch (J. Mol. Biol. 48; 443-453 (1970) and Smith and Waterman (Adv. Appl. Math. 2; 482-489 (1981)], which are part of the GCG software packet [Genetics Computer Group, 575 Science Drive, Madison, Wis., USA 53711 (1991)], were used for the sequence alignment. The sequence homology values which are indicated above as a percentage were determined over the entire sequence region using the program GAP and the following settings: Gap Weight: 50, Length Weight: 3, Average Match: 10.000 and Average Mismatch: 0.000. Unless otherwise specified, these settings were always used as standard settings for the sequence alignments.
[0226] Essential enzymatic activity of the .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.9-elongase, 06-desaturase, .DELTA.8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase or .DELTA.4-desaturase used in the process according to the invention is understood as meaning that they retain at least an enzymatic activity of at least 10%, preferably 20%, especially preferably 30% and very especially 40% in comparison with the proteins/enzymes encoded by the sequence SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 and their derivatives and can thus participate in the metabolism of compounds required for the synthesis of fatty acids, fatty acid esters such as diacylglycerides and/or triacylglycerides in an organism, advantageously a plant or a plant cell, or in the transport of molecules across membranes, meaning C.sub.18, C.sub.20- or C.sub.22-carbon chains in the fatty acid molecule with double bonds at at least two, advantageously three, four, five or six positions.
[0227] Nucleic acids which can advantageously be used in the process are derived from bacteria, fungi, diatoms, animals such as Caenorhabditis or Oncorhynchus or plants such as algae or mosses, such as the genera Shewanella, Physcomitrella, Thraustochytrium, Fusarium, Phytophthora, Ceratodon, Mantoniella, Ostreococcus, Isochrysis, Aleurita, Muscarioides, Mortierella, Borago, Phaeodactylum, Crypthecodinium, specifically from the genera and species Oncorhynchus mykiss, Xenopus laevis, Ciona intestinalis, Thalassiosira pseudonona, Mantoniella squamata, Ostreococcus sp., Ostreococcus tauri, Euglena gracilis, Physcomitrella patens, Phytophtora infestans, Fusarium graminaeum, Cryptocodinium cohnii, Ceratodon purpureus, Isochrysis galbana, Aleurita farinosa, Thraustochytrium sp., Muscarioides viallii, Mortierella alpina, Borago officinalis, Phaeodactylum tricornutum, Caenorhabditis elegans or especially advantageously from Oncorhynchus mykiss, Euglena gracilis, Thalassiosira pseudonona or Crypthecodinium cohnii.
[0228] Alternatively, nucleic acid sequences which encode a .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.9-elongase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase or .DELTA.4-desaturase and which advantageously hybridize under stringent conditions with a nucleic acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 can be used in the process according to the invention.
[0229] The nucleic acid sequences used in the process are advantageously introduced into an expression cassette which makes possible the expression of the nucleic acids in organisms such as microorganisms or plants.
[0230] In doing so, the nucleic acid sequences which encode .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.9-elongase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase or .DELTA.4-desaturase are linked operably with one or more regulatory signals, advantageously for enhancing gene expression. These regulatory sequences are intended to make possible the specific expression of the genes and proteins. Depending on the host organism, this may mean, for example, that the gene is expressed and/or overexpressed only after induction has taken place, or else that it is expressed and/or overexpressed immediately. For example, these regulatory sequences take the form of sequences to which inductors or repressors bind, thus controlling the expression of the nucleic acid. In addition to these novel regulatory sequences, or instead of these sequences, the natural regulatory elements of these sequences may still be present before the actual structural genes and, if appropriate, may have been genetically modified in such a way that their natural regulation is eliminated and the expression of the genes is enhanced. However, the expression cassette (=expression construct=gene construct) can also be simpler in construction, that is to say no additional regulatory signals have been inserted before the nucleic acid sequence or its derivatives, and the natural promoter together with its regulation was not removed. Instead, the natural regulatory sequence has been mutated in such a way that regulation no longer takes place and/or gene expression is enhanced. These modified promoters can also be positioned on their own before the natural gene in the form of part-sequences (=promotor with parts of the nucleic acid sequences used in accordance with the invention) in order to enhance the activity. Moreover, the gene construct may advantageously also comprise one or more what are known as enhancer sequences in operable linkage with the promoter, which make possible an enhanced expression of the nucleic acid sequence. Additional advantageous sequences, such as further regulatory elements or terminator sequences, may also be inserted at the 3' end of the DNA sequences. The .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.4-desaturase, .DELTA.5-desaturase, 06-desaturase, .DELTA.8-desaturase, .DELTA.5-elongase, .DELTA.6-elongase and/or .DELTA.9-elongase genes may be present in one or more copies of the expression cassette (=gene construct). Preferably, only one copy of the genes is present in each expression cassette. This gene construct or the gene constructs can be expressed together in the host organism. In this context, the gene construct(s) can be inserted in one or more vectors and be present in the cell in free form, or else be inserted in the genome. It is advantageous for the insertion of further genes in the genome when the genes to be expressed are present together in one gene construct.
[0231] In this context, the regulatory sequences or factors can, as described above, preferably have a positive effect on the gene expression of the genes introduced, thus enhancing it. Thus, an enhancement of the regulatory elements, advantageously at the transcriptional level, may take place by using strong transcription signals such as promoters and/or enhancers. In addition, however, enhanced translation is also possible, for example by improving the stability of the mRNA.
[0232] A further embodiment of the invention is one or more gene constructs which comprise one or more sequences which are defined by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 or its derivatives and which encode polypeptides as shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 or SEQ ID NO: 184. The abovementioned .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.9-elongase, .DELTA.6-desaturase, A8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase or .DELTA.4-desaturase proteins lead advantageously to a desaturation or elongation of fatty acids, the substrate advantageously having one, two, three, four, five or six double bonds and advantageously 18, 20 or 22 carbon atoms in the fatty acid molecule. The same applies to their homologs, derivatives or analogs, which are linked operably with one or more regulatory signals, advantageously for enhancing gene expression.
[0233] Advantageous regulatory sequences for the novel process are present for example in promoters such as the cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, laclq, T7, T5, T3, gal, trc, ara, SP6, .lamda.-PR or .lamda.-PL promoter and are advantageously employed in Gram-negative bacteria. Further advantageous regulator sequences are, for example, present in the Gram-positive promoters amy and SPO2, in the yeast or fungal promoters ADC1, MF.alpha., AC, P-60, CYC1, GAPDH, TEF, rp28, ADH or in the plant promoters CaMV/35S [Franck et al., Cell 21 (1980) 285-294], PRP1 [Ward et al., Plant. Mol. Biol. 22 (1993)], SSU, OCS, lib4, usp, STLS1, B33, nos or in the ubiquitin or phaseolin promoter. Advantageous in this context are also inducible promoters, such as the promoters described in EP-A-0 388 186 (benzenesulfonamide-inducible), Plant J. 2, 1992:397-404 (Gatz et al., tetracycline-inducible), EP-A-0 335 528 (abscissic acid-inducible) or WO 93/21334 (ethanol- or cyclohexenol-inducible) promoters. Further suitable plant promoters are the cytosolic FBPase promoter or the ST-LSI promoter of potato (Stockhaus et al., EMBO J. 8, 1989, 2445), the glycine max phosphoribosylpyrophosphate amidotransferase promoter (Genbank Accession No. U87999) or the node-specific promoter described in EP-A-0 249 676.
[0234] Especially advantageous promoters are promoters which make possible the expression in tissues which are involved in the biosynthesis of fatty acids. Very especially advantageous are seed-specific promoters, such as the USP promoter as described, but also other promoters such as the LeB4, DC3, phaseolin or napin promoter. Further especially advantageous promoters are seed-specific promoters which can be used for monocotyledonous or dicotyledonous plants and which are described in U.S. Pat. No. 5,608,152 (oilseed rape napin promoter), WO 98/45461 (Arabidopsis oleosin promoter), U.S. Pat. No. 5,504,200 (Phaseolus vulgaris phaseolin promoter), WO 91/13980 (Brassica Bce4 promoter), by Baeumlein et al., Plant J., 2, 2, 1992:233-239 (LeB4 promoter from a legume), these promoters being suitable for dicots. Examples of promoters which are suitable for monocots are the barley lpt-2 or lpt-1 promoter (WO 95/15389 and WO 95/23230), the barley hordein promoter and other suitable promoters described in WO 99/16890.
[0235] In principle, it is possible to use all natural promoters together with their regulatory sequences, such as those mentioned above, for the novel process. It is also possible and advantageous to use synthetic promoters, either in addition or alone, in particular when they mediate seed-specific expression, such as those described in WO 99/16890.
[0236] In order to achieve a particularly high PUFA content, especially in transgenic plants, the PUFA biosynthesis genes should advantageously be expressed in oil crops in a seed-specific manner. To this end, seed-specific promoters can be used, or those promoters which are active in the embryo and/or in the endosperm. In principle, seed-specific promoters can be isolated both from dicotyledonous and from monocotyledonous plants. Preferred promoters are listed hereinbelow: USP (=unknown seed protein) and vicilin (Vicia faba) [Baumlein et al., Mol. Gen Genet., 1991, 225(3)], napin (oilseed rape) [U.S. Pat. No. 5,608,152], acyl carrier protein (oilseed rape) [U.S. Pat. No. 5,315,001 and WO 92/18634], oleosin (Arabidopsis thaliana) [WO 98/45461 and WO 93/20216], phaseolin (Phaseolus vulgaris) [U.S. Pat. No. 5,504,200], Bce4 [WO 91/13980], legumines B4 (LegB4 promoter) [Baumlein et al., Plant J., 2, 2, 1992], Lpt2 and lpt1 (barley) [WO 95/15389 and WO95/23230], seed-specific promoters from rice, maize and wheat [WO 99/16890], Amy32b, Amy 6-6 and aleurain [U.S. Pat. No. 5,677,474], Bce4 (oilseed rape) [U.S. Pat. No. 5,530,149], glycinin (soybean) [EP 571 741], phosphoenol pyruvate carboxylase (soybean) [JP 06/62870], ADR12-2 (soybean) [WO 98/08962], isocitrate lyase (oilseed rape) [U.S. Pat. No. 5,689,040] or .alpha.-amylase (barley) [EP 781 849].
[0237] Plant gene expression can also be facilitated via a chemically inducible promoter (see review in Gatz 1997, Annu. Rev. Plant Physiol. Plant Mol. Biol., 48:89-108). Chemically inducible promoters are particularly suitable when it is desired that gene expression should take place in a time-specific manner. Examples of such promoters are a salicylic-acid-inducible promoter (WO 95/19443), a tetracycline-inducible promoter (Gatz et al. (1992) Plant J. 2, 397-404) and an ethanol-inducible promoter.
[0238] To ensure the stable integration of the biosynthesis genes into the transgenic plant over a plurality of generations, each of the nucleic acids which encode .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.9-elongase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase and/or .DELTA.4-desaturase and which are used in the process should be expressed under the control of a separate promoter, preferably a promoter which differs from the other promoters, since repeating sequence motifs can lead to instability of the T-DNA, or to recombination events. In this context, the expression cassette is advantageously constructed in such a way that a promoter is followed by a suitable cleavage site, advantageously in a polylinker, for insertion of the nucleic acid to be expressed and, if appropriate, a terminator sequence is positioned behind the polylinker. This sequence is repeated several times, preferably three, four or five times, so that up to five genes can be combined in one construct and introduced into the transgenic plant in order to be expressed. Advantageously, the sequence is repeated up to three times. To express the nucleic acid sequences, the latter are inserted behind the promoter via a suitable cleavage site, for example in the polylinker. Advantageously, each nucleic acid sequence has its own promoter and, if appropriate, its own terminator sequence. Such advantageous constructs are disclosed, for example, in DE 101 02 337 or DE 101 02 338. However, it is also possible to insert a plurality of nucleic acid sequences behind a promoter and, if appropriate, before a terminator sequence. Here, the insertion site, or the sequence, of the inserted nucleic acids in the expression cassette is not of critical importance, that is to say a nucleic acid sequence can be inserted at the first or last position in the cassette without its expression being substantially influenced thereby. Advantageously, different promoters such as, for example, the USP, LegB4 or DC3 promoter, and different terminator sequences can be used in the expression cassette. However, it is also possible to use only one type of promoter in the cassette. This, however, may lead to undesired recombination events.
[0239] As described above, the transcription of the genes which have been introduced should advantageously be terminated by suitable terminator sequences at the 3' end of the biosynthesis genes which have been introduced (behind the stop codon). An example of a sequence which can be used in this context is the OCS 1 terminator sequence. As is the case with the promoters, different terminator sequences should be used for each gene.
[0240] As described above, the gene construct can also comprise further genes to be introduced into the organisms. It is possible and advantageous to introduce into the host organisms, and to express therein, regulatory genes such as genes for inductors, repressors or enzymes which, owing to their enzyme activity, engage in the regulation of one or more genes of a biosynthesis pathway. These genes can be of heterologous or of homologous origin. Moreover, further biosynthesis genes of the fatty acid or lipid metabolism can advantageously be present in a nucleic acid construct, or gene construct; however, these genes can also be positioned on one or more further nucleic acid constructs. Biosynthesis genes of the fatty acid or lipid metabolism which are preferably used is a gene selected from the group consisting of acyl-CoA dehydrogenase(s), acyl-ACP [=acyl carrier protein] desaturase(s), acyl-ACP thioesterase(s), fatty acid acyltransferase(s), acyl-CoA:lysophospholipid acyltransferases, fatty acid synthase(s), fatty acid hydroxylase(s), acetyl-coenzyme A carboxylase(s), acyl-coenzyme A oxidase(s), fatty acid desaturase(s), fatty acid acetylenase(s), lipoxygenase(s), triacylglycerol lipase(s), allenoxide synthase(s), hydroperoxide lyase(s) or fatty acid elongase(s) or combinations thereof. Especially advantageous nucleic acid sequences are biosynthesis genes of the fatty acid or lipid metabolism selected from the group of the acyl-CoA:lysophospholipid acyltransferase, .omega.3-desaturase, .DELTA.4-desaturase, .DELTA.5-desaturase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.9-desaturase, .DELTA.12-desaturase, .DELTA.5-elongase, .DELTA.6-elongase and/or .DELTA.9-elongase.
[0241] In this context, the abovementioned nucleic acids or genes can be cloned into expression cassettes, like those mentioned above, in combination with other elongases and desaturases and used for transforming plants with the aid of Agrobacterium.
[0242] Here, the regulatory sequences or factors can, as described above, preferably have a positive effect on, and thus enhance, the expression genes which have been introduced. Thus, enhancement of the regulatory elements can advantageously take place at the transcriptional level by using strong transcription signals such as promoters and/or enhancers. However, an enhanced translation is also possible, for example by improving the stability of the mRNA. In principle, the expression cassettes can be used directly for introduction into the plants or else be introduced into a vector.
[0243] These advantageous vectors, preferably expression vectors, comprise the nucleic acids which encode the .DELTA.12-desaturases, .omega.3-desaturases, .DELTA.9-elongases, .DELTA.6-desaturases, .DELTA.8-desaturases, .DELTA.6-elongases, .DELTA.5-desaturases, .DELTA.5-elongases or .DELTA.4-desaturases and which are used in the process, or else a nucleic acid construct which the nucleic acid used either alone or in combination with further biosynthesis genes of the fatty acid or lipid metabolism such as the acyl-CoA:lysophospholipid acyltransferases, .omega.3-desaturases, .DELTA.4-desaturases, .DELTA.5-desaturases, .DELTA.6-desaturases, .DELTA.8-desaturases, .DELTA.9-desaturases, 2-desaturases, .omega.3-desaturases, .DELTA.5-elongases, .DELTA.6-elongases and/or .DELTA.9-elongases. As used in the present context, the term "vector" refers to a nucleic acid molecule which is capable of transporting another nucleic acid to which it is bound. One type of vector is a "plasmid", a circular double-stranded DNA loop into which additional DNA segments can be ligated. A further type of vector is a viral vector, it being possible for additional DNA segments to be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they have been introduced (for example bacterial vectors with bacterial replication origin). Other vectors are advantageously integrated into the genome of a host cell when they are introduced into the host cell, and thus replicate together with the host genome. Moreover, certain vectors can govern the expression of genes with which they are in operable linkage. These vectors are referred to in the present context as "expression vectors". Usually, expression vectors which are suitable for DNA recombination techniques take the form of plasmids. In the present description, "plasmid" and "vector" can be used exchangeably since the plasmid is the form of vector which is most frequently used. However, the invention is also intended to cover other forms of expression vectors, such as viral vectors, which exert similar functions. Furthermore, the term "vector" is also intended to comprise other vectors with which the skilled worker is familiar, such as phages, viruses such as SV40, CMV, TMV, transposons, IS elements, phasmids, phagemids, cosmids, linear or circular DNA.
[0244] The recombinant expression vectors advantageously used in the process comprise the nucleic acids described below or the above-described gene construct in a form which is suitable for expressing the nucleic acids used in a host cell, which means that the recombinant expression vectors comprise one or more regulatory sequences, selected on the basis of the host cells used for the expression, which regulatory sequence(s) is/are linked operably with the nucleic acid sequence to be expressed. In a recombinant expression vector, "linked operably" means that the nucleotide sequence of interest is bound to the regulatory sequence(s) in such a way that the expression of the nucleotide sequence is possible and they are bound to each other in such a way that both sequences carry out the predicted function which is ascribed to the sequence (for example in an in-vitro transcription/translation system, or in a host cell if the vector is introduced into the host cell). The term "regulatory sequence" is intended to comprise promoters, enhancers and other expression control elements (for example polyadenylation signals). These regulatory sequences are described, for example, in Goeddel: Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990), or see: Gruber and Crosby, in: Methods in Plant Molecular Biology and Biotechnology, CRC Press, Boca Raton, Fla., Ed.: Glick and Thompson, Chapter 7, 89-108, including the references cited therein. Regulatory sequences comprise those which govern the constitutive expression of a nucleotide sequence in many types of host cell and those which govern the direct expression of the nucleotide sequence only in specific host cells under specific conditions. The skilled worker knows that the design of the expression vector can depend on factors such as the choice of host cell to be transformed, the desired expression level of the protein and the like.
[0245] The recombinant expression vectors used can be designed for the expression of .DELTA.12-desaturases, .omega.3-desaturases, .DELTA.9-elongases, .DELTA.6-desaturases, .DELTA.8-desaturases, 06-elongases, .DELTA.5-desaturases, .DELTA.5-elongases and/or .DELTA.4-desaturases in prokaryotic or eukaryotic cells. This is advantageous since intermediate steps of the vector construction are frequently carried out in microorganisms for the sake of simplicity. For example, the .DELTA.12-desaturase, .omega.3-desaturases, .DELTA.9-elongases, .DELTA.6-desaturase, .DELTA.8-desaturases, 06-elongase, .DELTA.5-desaturase, .DELTA.5-elongase and/or .DELTA.4-desaturase genes can be expressed in bacterial cells, insect cells (using Baculovirus expression vectors), yeast and other fungal cells (see Romanos, M. A., et al. (1992) "Foreign gene expression in yeast: a review", Yeast 8:423-488; van den Hondel, C. A. M. J. J., et al. (1991) "Heterologous gene expression in filamentous fungi", in: More Gene Manipulations in Fungi, J. W. Bennet & L. L. Lasure, Ed., pp. 396-428: Academic Press: San Diego; and van den Hondel, C. A. M. J. J., & Punt, P. J. (1991) "Gene transfer systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, Peberdy, J. F., et al., Ed., pp. 1-28, Cambridge University Press: Cambridge), algae (Falciatore et al., 1999, Marine Biotechnology. 1, 3:239-251), ciliates of the types: Holotrichia, Peritrichia, Spirotrichia, Suctoria, Tetrahymena, Paramecium, Colpidium, Glaucoma, Platyophrya, Potomacus, Desaturaseudocohnilembus, Euplotes, Engelmaniella and Stylonychia, in particular of the genus Stylonychia lemnae, using vectors in a transformation method as described in WO 98/01572 and, preferably, in cells of multi-celled plants (see Schmidt, R. and Willmitzer, L. (1988) "High efficiency Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana leaf and cotyledon explants" Plant Cell Rep.: 583-586; Plant Molecular Biology and Biotechnology, C Press, Boca Raton, Fla., Chapter 6/7, pp. 71-119 (1993); F. F. White, B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press (1993), 128-43; Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225 (and references cited therein)). Suitable host cells are furthermore discussed in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). As an alternative, the recombinant expression vector can be transcribed and translated in vitro, for example using T7-promoter regulatory sequences and T7-polymerase.
[0246] In most cases, the expression of proteins in prokaryotes involves the use of vectors comprising constitutive or inducible promoters which govern the expression of fusion or nonfusion proteins. Typical fusion expression vectors are, inter alia, pGEX (Pharmacia Biotech Inc; Smith, D. B., and Johnson, K. S. (1988) Gene 67:31-40), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.), where glutathione S-transferase (GST), maltose-E binding protein and protein A, respectively, is fused with the recombinant target protein.
[0247] Examples of suitable inducible nonfusion E. coli expression vectors are, inter alia, pTrc (Amann et al. (1988) Gene 69:301-315) and pET 11d (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 60-89). The target gene expression from the pTrc vector is based on the transcription from a hybrid trp-lac fusion promoter by the host RNA polymerase. The target gene expression from the vector pET 11d is based on the transcription of a T7-gn10-lac fusion promoter, which is mediated by a viral RNA polymerase (T7 gn1), which is coexpressed. This viral polymerase is provided by the host strains BL21 (DE3) or HMS174 (DE3) from a resident .lamda.-prophage which harbors a T7 gn1 gene under the transcriptional control of the lacUV 5 promoter.
[0248] Other vectors which are suitable for prokaryotic organisms are known to the skilled worker, these vectors are, for example in E. coli pLG338, pACYC184, the pBR series such as pBR322, the pUC series such as pUC18 or pUC19, the M113mp series, pKC30, pRep4, pHS1, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III113-B1, .lamda.gt11 or pBdCl, in Streptomyces pIJ101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667.
[0249] In a further embodiment, the expression vector is a yeast expression vector. Examples for vectors for expression in the yeast S. cerevisiae comprise pYeDesaturasec1 (Baldari et al. (1987) Embo J. 6:229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30:933-943), pJRY88 (Schultz et al. (1987) Gene 54:113-123) and pYES2 (Invitrogen Corporation, San Diego, Calif.). Vectors and processes for the construction of vectors which are suitable for use in other fungi, such as the filamentous fungi, comprise those which are described in detail in: van den Hondel, C. A. M. J. J., & Punt, P. J. (1991) "Gene transfer systems and vector development for filamentous fungi, in: Applied Molecular Genetics of fungi, J. F. Peberdy et al., Ed., pp. 1-28, Cambridge University Press: Cambridge, or in: More Gene Manipulations in Fungi [J. W. Bennet & L. L. Lasure, Ed., pp. 396-428: Academic Press: San Diego]. Further suitable yeast vectors are, for example, pAG-1, YEp6, YEp13 or pEMBLYe23.
[0250] As an alternative, .DELTA.12-desaturases, .omega.3-desaturases, .DELTA.9-elongases, .DELTA.6-desaturases, .DELTA.8-desaturases, .DELTA.6-elongases, .DELTA.5-desaturases, .DELTA.5-elongases and/or .DELTA.4-desaturases can be expressed in insect cells using Baculovirus vectors. Baculovirus expression vectors which are available for the expression of proteins in cultured insect cells (for example Sf9 cells) comprise the pAc series (Smith et al. (1983) Mol. Cell Biol. 3:2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170:31-39).
[0251] The abovementioned vectors are only a small overview over suitable vectors which are possible. Further plasmids are known to the skilled worker and are described, for example, in: Cloning Vectors (Ed. Pouwels, P. H., et al., Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018). For further suitable expression systems for prokaryotic and eukaryotic cells, see the Chapters 16 and 17 in Sambrook, J., Fritsch, E. F., and Maniatis, T., Molecular Cloning: A Laboratory Manual, 2. edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.
[0252] In a further embodiment of the process, the .DELTA.12-desaturases, .omega.3-desaturases, .DELTA.9-elongases, .DELTA.6-desaturases, .DELTA.8-desaturases, .DELTA.6-elongases, .DELTA.5-desaturases, .DELTA.5-elongases and/or .DELTA.4-desaturases can be expressed in single-celled plant cells (such as algae), see Falciatore et al., 1999, Marine Biotechnology 1 (3):239-251 and references cited therein, and in plant cells from higher plants (for example spermatophytes such as arable crops). Examples of plant expression vectors comprise those which are described in detail in: Becker, D., Kemper, E., Schell, J., and Masterson, R. (1992) "New plant binary vectors with selectable markers located proximal to the left border", Plant Mol. Biol. 20:1195-1197; and Bevan, M. W. (1984) "Binary Agrobacterium vectors for plant transformation", Nucl. Acids Res. 12:8711-8721; Vectors for Gene Transfer in Higher Plants; in: Transgenic Plants, Vol. 1, Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press, 1993, p. 15-38.
[0253] A plant expression cassette preferably comprises regulatory sequences which are capable of governing the expression of genes in plant cells and which are linked operably so that each sequence can fulfill its function, such as transcriptional termination, for example polyadenylation signals. Preferred polyadenylation signals are those which are derived from Agrobacterium tumefaciens T-DNA, such as gene 3 of the Ti plasmid pTiACH5 (Gielen et al., EMBO J. 3 (1984) 835 et seq.), which is known as octopine synthase, or functional equivalents thereof, but all other terminator sequences which are functionally active in plants are also suitable.
[0254] Since plant gene expression is very often not limited to the transcriptional level, a plant expression cassette preferably comprises other sequences which are linked operably, such as translation enhancers, for example the overdrive sequence, which enhances the tobacco mosaic virus 5'-untranslated leader sequence, which increases the protein/RNA ratio (Gallie et al., 1987, Nucl. Acids Research 15:8693-8711).
[0255] As described above, plant gene expression must be linked operably with a suitable promoter which triggers gene expression with the correct timing or in a cell- or tissue-specific manner. Utilizable promoters are constitutive promoters (Benfey et al., EMBO J. 8 (1989) 2195-2202), such as those which are derived from plant viruses, such as 35S CaMV (Franck et al., Cell 21 (1980) 285-294), 19S CaMV (see also U.S. Pat. No. 5,352,605 and WO 84/02913), or plant promoters, such as the promoter of the Rubisco subunit, which is described in U.S. Pat. No. 4,962,028.
[0256] Other preferred sequences for use in operable linkage in plant gene expression cassettes are targeting sequences, which are required for steering the gene product into its corresponding cell compartment (see a review in Kermode, Crit. Rev. Plant Sci. 15, 4 (1996) 285-423 and references cited therein), for example into the vacuole, into the nucleus, all types of plastids, such as amyloplasts, chloroplasts, chromoplasts, the extracellular space, the mitochondria, the endoplasmid reticulum, elaioplasts, peroxisomes and other compartments of plant cells.
[0257] As described above, plant gene expression can also be achieved via a chemically inducible promoter (see review in Gatz 1997, Annu. Rev. Plant Physiol. Plant Mol. Biol., 48:89-108). Chemically inducible promoters are particularly suitable when it is desired that the gene expression takes place in a time-specific manner. Examples of such promoters are a salicylic-acid-inducible promoter (WO 95/19443), a tetracyclin-inducible promoter (Gatz et al. (1992) Plant J. 2, 397-404) and an ethanol-inducible promoter.
[0258] Promoters which respond to biotic or abiotic stress conditions are also suitable, for example the pathogen-induced PRP1 gene promoter (Ward et al., Plant. Mol. Biol. 22 (1993) 361-366), the heat-inducible tomato hsp80 promoter (U.S. Pat. No. 5,187,267), the chill-inducible potato alpha-amylase promoter (WO 96/12814) or the wound-inducible pinII promoter (EP-A-0 375 091).
[0259] Especially preferred are those promoters which bring about the gene expression in tissues and organs in which the biosynthesis of fatty acids, lipids and oils takes place, in seed cells, such as cells of the endosperm and of the developing embryo. Suitable promoters are the oilseed rape napin promoter (U.S. Pat. No. 5,608,152), the Vicia faba USP promoter (Baeumlein et al., Mol Gen Genet, 1991, 225 (3):459-67), the Arabidopsis oleosin promoter (WO 98/45461), the Phaseolus vulgaris phaseolin promoter (U.S. Pat. No. 5,504,200), the Brassica Bce4 promoter (WO 91/13980) or the legumine B4 promoter (LeB4; Baeumlein et al., 1992, Plant Journal, 2 (2):233-9), and promoters which bring about the seed-specific expression in monocotyledonous plants such as maize, barley, wheat, rye, rice and the like. Suitable noteworthy promoters are the barley lpt2 or lpt1 gene promoter (WO 95/15389 and WO 95/23230) or the promoters from the barley hordein gene, the rice glutelin gene, the rice oryzin gene, the rice prolamine gene, the wheat gliadine gene, the wheat glutelin gene, the maize zeine gene, the oat glutelin gene, the sorghum kasirin gene or the rye secalin gene, which are described in WO 99/16890.
[0260] In particular, it may be desired to bring about the multiparallel expression of the .DELTA.12-desaturases, .omega.3-desaturases, .DELTA.9-elongases, .DELTA.6-desaturases, .DELTA.8-desaturases, 06-elongases, .DELTA.5-desaturases, .DELTA.5-elongases and/or .DELTA.4-desaturases used in the process. Such expression cassettes can be introduced via the simultaneous transformation of a plurality of individual expression constructs or, preferably, by combining a plurality of expression cassettes on one construct. Also, a plurality of vectors can be transformed with in each case a plurality of expression cassettes and then transferred into the host cell.
[0261] Other promoters which are likewise especially suitable are those which bring about a plastid-specific expression, since plastids constitute the compartment in which the precursors and some end products of lipid biosynthesis are synthesized. Suitable promoters, such as the viral RNA polymerase promoter, are described in WO 95/16783 and WO 97/06250, and the clpP promoter from Arabidopsis, described in WO 99/46394.
[0262] Vector DNA can be introduced into prokaryotic and eukaryotic cells via conventional transformation or transfection techniques. The terms "transformation" and "transfection", conjugation and transduction, as used in the present context, are intended to comprise a multiplicity of methods known in the prior art for the introduction of foreign nucleic acid (for example DNA) into a host cell, including calcium phosphate or calcium chloride coprecipitation, DEAE-dextran-mediated transfection, lipofection, natural competence, chemically mediated transfer, electroporation or particle bombardment. Suitable methods for the transformation or transfection of host cells, including plant cells, can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) and other laboratory textbooks such as Methods in Molecular Biology, 1995, Vol. 44, Agrobacterium protocols, Ed.: Gartland and Davey, Humana Press, Totowa, N.J.
[0263] Host cells which are suitable in principle for taking up the nucleic acid according to the invention, the gene product according to the invention or the vector according to the invention are all prokaryotic or eukaryotic organisms. The host organisms which are advantageously used are microorganisms such as fungi or yeasts, or plant cells, preferably plants or parts thereof. Fungi, yeasts or plants are preferably used, especially preferably plants, very especially preferably plants such as oil crops, which are high in lipid compounds, such as oilseed rape, evening primrose, hemp, thistle, peanut, canola, linseed, soybean, safflower, sunflower, borage, or plants such as maize, wheat, rye, oats, triticale, rice, barley, cotton, cassava, pepper, Tagetes, Solanacea plants such as potato, tobacco, eggplant and tomato, Vicia species, pea, alfalfa, bushy plants (coffee, cacao, tea), Salix species, trees (oil palm, coconut), and perennial grasses and fodder crops. Especially preferred plants according to the invention are oil crops such as soybean, peanut, oilseed rape, canola, linseed, hemp, evening primrose, sunflower, safflower, trees (oil palm, coconut).
[0264] The invention furthermore relates to above-described isolated nucleic acid sequence which encode polypeptides with .DELTA.5-elongase activity, where the elongase encoded by the nucleic acid sequences converts C.sub.16- and C.sub.18-fatty acids with one double bond and advantageously polyunsaturated C.sub.18-fatty acids with one .DELTA.6 double bond and polyunsaturated C.sub.20-fatty acids with one .DELTA.5 double bond. C.sub.22-fatty acids are not elongated.
[0265] Advantageous isolated nucleic acid sequences are nucleic acid sequences which encode polypeptides with .DELTA.5-elongase activity and which comprise an amino acid sequence selected from the group of an amino acid sequence with the sequence shown in SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141 or SEQ ID NO: 142.
[0266] Further advantageous isolated nucleic acid sequences are nucleic acid sequences which encode polypeptides with .DELTA.5-elongase activity and which comprise a combination of the amino acid sequences selected from the group consisting of:
[0267] a) SEQ ID NO: 115 and SEQ ID NO: 139, SEQ ID NO: 115 and SEQ ID NO: 140 or SEQ ID NO: 139 and SEQ ID NO: 140; or
[0268] b) SEQ ID NO: 116 and SEQ ID NO: 141, SEQ ID NO: 116 and SEQ ID NO: 142 or SEQ ID NO: 141 and SEQ ID NO: 142; or
[0269] c) SEQ ID NO: 115, SEQ ID NO: 139 and SEQ ID NO: 140 or SEQ ID NO: 116, SEQ ID NO: 141 and SEQ ID NO: 142.
[0270] Preferred nucleic acid sequences which encode polypeptides with .DELTA.5-elongase activity advantageously comprise the abovementioned amino acid sequences. The latter are described in greater detail in table 2.
[0271] Especially advantageous isolated nucleic acid sequences are sequences selected from the group consisting of:
[0272] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 113, SEQ ID NO: 131 or SEQ ID NO: 133,
[0273] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 114, SEQ ID NO: 132 or SEQ ID NO: 134, or
[0274] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 113, SEQ ID NO: 131 or SEQ ID NO: 133 which have polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 114, SEQ ID NO: 132 or SEQ ID NO: 134 and which have .DELTA.5-elongase activity.
[0275] The invention furthermore relates to the nucleic acid sequences which are enumerated hereinbelow and which encode .DELTA.6-elongases, .omega.3-desaturases, .DELTA.6-desaturases, .DELTA.5-desaturases, .DELTA.4-desaturases or .DELTA.12-desaturases.
[0276] Further advantageous isolated nucleic acid sequences are sequences selected from the group consisting of:
[0277] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 69, SEQ ID NO: 81, SEQ ID NO: 111 or SEQ ID NO: 183,
[0278] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 70, SEQ ID NO: 82, SEQ ID NO: 112 or SEQ ID NO: 184, or
[0279] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 69, SEQ ID NO: 81, SEQ ID NO: 111 or SEQ ID NO: 183 which encode polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 70, SEQ ID NO: 82, SEQ ID NO: 112 or SEQ ID NO: 184 and which have .DELTA.6-elongase activity.
[0280] Isolated nucleic acid sequences encoding polypeptides with .omega.3-desaturase activity, selected from the group consisting of:
[0281] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 87 or SEQ ID NO: 105,
[0282] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 88 or SEQ ID NO: 106, or
[0283] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 87 or SEQ ID NO: 105 which have polypeptides with at least 60% identity at the amino acid level with SEQ ID NO: 88 or SEQ ID NO: 106 and which have .omega.3-desaturase activity.
[0284] Isolated nucleic acid sequences encoding polypeptides with .DELTA.6-desaturase activity, selected from the group consisting of:
[0285] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 89 or in SEQ ID NO: 97,
[0286] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 90 or SEQ ID NO: 98, or
[0287] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 89 or SEQ ID NO: 97 which encode polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 90 or SEQ ID NO: 98 and which have .DELTA.6-desaturase activity.
[0288] Isolated nucleic acid sequences encoding polypeptides with .DELTA.5-desaturase activity, selected from the group consisting of:
[0289] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 99 or in SEQ ID NO: 101,
[0290] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 100 or in SEQ ID NO: 102, or
[0291] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 99 or in SEQ ID NO: 101 which encode polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 92, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 100 or in SEQ ID NO: 102 and which have .DELTA.5-desaturase activity.
[0292] Isolated nucleic acid sequences encoding polypeptides with .DELTA.12-desaturase activity, selected from the group consisting of:
[0293] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 95 or in SEQ ID NO: 103,
[0294] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 96 or in SEQ ID NO: 104, or
[0295] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 95 or in SEQ ID NO: 103 which encode polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 96 or in SEQ ID NO: 104 and which have .DELTA.6-desaturase activity.
[0296] Isolated nucleic acid sequences encoding polypeptides with .DELTA.12-desaturase activity, selected from the group consisting of:
[0297] a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 107 or in SEQ ID NO: 109,
[0298] b) nucleic acid sequences which, as the result of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 108 or SEQ ID NO: 110, or
[0299] c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 107 or SEQ ID NO: 109 which encode polypeptides with at least 50% homology at the amino acid level with SEQ ID NO: 108 or SEQ ID NO: 110 and which have .DELTA.12-desaturase activity.
[0300] The abovementioned nucleic acids according to the invention are derived from organisms such as nonhuman animals, ciliates, fungi, plants such as algae or dinoflagellates which are capable of synthesizing PUFAs.
[0301] The isolated abovementioned nucleic acid sequences are advantageously derived from the order Salmoniformes, Xenopus or Ciona, the diatom genera Thalassiosira or Crythecodinium, or from the family of the Prasinophyceae, such as the genus Ostreococcus or the family Euglenaceae, such as the genus Euglena, or Pythiaceae, such as the genus Phytophthora.
[0302] The invention furthermore relates to isolated nucleic acid sequences as described above which encode polypeptides with .omega.3-desaturase activity, where the .omega.3-desaturases encoded by the nucleic acid sequences convert C.sub.18-, C.sub.20- and C.sub.22-fatty acids with two, three, four or five double bonds and advantageously polyunsaturated C.sub.18-fatty acids with two or three double bonds and polyunsaturated C.sub.20-fatty acids with two, three or four double bonds. C.sub.22-Fatty acids with four or five double bonds are also desaturated.
[0303] As described above, the invention furthermore relates to isolated nucleic acid sequence which encode polypeptides with .DELTA.12-desaturases, .DELTA.4-desaturases, .DELTA.5-desaturases and .DELTA.6-desaturases, where the .DELTA.12-desaturases, .DELTA.4-desaturases, .DELTA.5-desaturases or .DELTA.6-desaturases encoded by these nucleic acid sequences convert C.sub.18-, C.sub.20- and C.sub.22-fatty acids with one, two, three, four or five double bonds and advantageously polyunsaturated C.sub.18-fatty acids with one, two or three double bonds such as C18:1.sup..DELTA.9, C18:2.sup..DELTA.9,12 or C18:3.sup..DELTA.9,12,15, polyunsaturated C.sub.20-fatty acids with three or four double bonds such as C20:3.sup..DELTA.8,11,14 or C20:4.sup..DELTA.8,11,14,17 or polyunsaturated C.sub.22-fatty acids with four or five double bonds such as C22:4.sup..DELTA.7,10,13,16 or C22:5.sup..DELTA.7,10,13,16,19. The fatty acids are advantageously desaturated in the phospholipids or CoA-fatty acid esters, advantageously in the CoA-fatty acid esters.
[0304] In an advantageous embodiment, the term "nucleic acid (molecule)" as used in the present context additionally comprises the untranslated sequence at the 3' and at the 5' end of the coding gene region: at least 500, preferably 200, especially preferably 100 nucleotides of the sequence upstream of the 5' end of the coding region and at least 100, preferably 50, especially preferably 20 nucleotides of the sequence downstream of the 3' end of the coding gene region. An "isolated" nucleic acid molecule is separate from other nucleic acid molecules which are present in the natural source of the nucleic acid. An "isolated" nucleic acid preferably has no sequences which naturally flank the nucleic acid in the genomic DNA of the organism from which the nucleic acid is derived (for example sequences which are located at the 5' and 3' ends of the nucleic acid). In various embodiments, the isolated .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.9-elongase, .DELTA.6-desaturase, .DELTA.8-desaturase, 06-elongase, .DELTA.5-desaturase, .DELTA.5-elongase or .DELTA.4-desaturase molecule can comprise for example fewer than approximately 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in the genomic DNA of the cell from which the nucleic acid is derived.
[0305] The nucleic acid molecules used in the process, for example a nucleic acid molecule with a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 or of a part thereof can be isolated using molecular-biological standard techniques and the sequence information provided herein. Also, for example a homologous sequence or homologous, conserved sequence regions can be identified at the DNA or amino acid level with the aid of comparative algorithms. They can be used as hybridization probe and standard hybridization techniques (such as, for example, those described in Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) for isolating further nucleic acid sequences which can be used in the process. Moreover, a nucleic acid molecule comprising a complete sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 or a part thereof can be isolated by polymerase chain reaction, where oligonucleotide primers which are used on the basis of this sequence or parts thereof (for example a nucleic acid molecule comprising the complete sequence or part thereof can be isolated by polymerase chain reaction using oligonucleotide primers which have been generated based on this same sequence). For example, mRNA can be isolated from cells (for example by means of the guanidinium thiocyanate extraction method of Chirgwin et al. (1979) Biochemistry 18:5294-5299) and cDNA by means of reverse transcriptase (for example Moloney MLV reverse transcriptase, available from Gibco/BRL, Bethesda, Md., or AMV reverse transcriptase, available from Seikagaku America, Inc., St. Petersburg, Fla.). Synthetic oligonucleotide primers for the amplification by means of polymerase chain reaction can be generated based on one of the sequences shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 or with the aid of the amino acid sequences detailed in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 or SEQ ID NO: 184. A nucleic acid according to the invention can be amplified by standard PCR amplification techniques using cDNA or, alternatively, genomic DNA as template and suitable oligonucleotide primers. The nucleic acid amplified thus can be cloned into a suitable vector and characterized by means of DNA sequence analysis. Oligonucleotides which correspond to a desaturase nucleotide sequence can be generated by standard synthetic methods, for example using an automatic DNA synthesizer.
[0306] Homologs of the .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.9-elongase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase or .DELTA.4-desaturase nucleic acid sequences with the sequence SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 means, for example, allelic variants with at least approximately 50 or 60%, preferably at least approximately 60 or 70%, more preferably at least approximately 70 or 80%, 90% or 95% and even more preferably at least approximately 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity or homology with a nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 or its homologs, derivatives or analogs or parts thereof. Furthermore, isolated nucleic acid molecules of a nucleotide sequence which hybridize with one of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 or with a part thereof, for example hybridized under stringent conditions. A part thereof is understood as meaning, in accordance with the invention, that at least 25 base pairs (=bp), 50 bp, 75 bp, 100 bp, 125 bp or 150 bp, preferably at least 175 bp, 200 bp, 225 bp, 250 bp, 275 bp or 300 bp, especially preferably 350 bp, 400 bp, 450 bp, 500 bp or more base pairs are used for the hybridization. It is also possible and advantageous to use the full sequence. Allelic variants comprise in particular functional variants which can be obtained by deletion, insertion or substitution of nucleotides from/into the sequence detailed in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183, it being intended, however, that the enzyme activity of the resulting proteins which are synthesized is advantageously retained for the insertion of one or more genes. Proteins which retain the enzymatic activity of .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.9-elongase, 06-desaturase, .DELTA.8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase or .DELTA.4-desaturase, i.e. whose activity is essentially not reduced, means proteins with at least 10%, preferably 20%, especially preferably 30%, very especially preferably 40% of the original enzyme activity in comparison with the protein encoded by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183. The homology was calculated over the entire amino acid or nucleic acid sequence region. The skilled worker has available a series of programs which are based on various algorithms for the comparison of various sequences. Here, the algorithms of Needleman and Wunsch or Smith and Waterman give particularly reliable results. The program PileUp (J. Mol. Evolution, 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the programs Gap and BestFit [Needleman and Wunsch (J. Mol. Biol. 48; 443-453 (1970) and Smith and Waterman (Adv. Appl. Math. 2; 482-489 (1981)], which are part of the GCG software packet [Genetics Computer Group, 575 Science Drive, Madison, Wis., USA 53711 (1991)], were used for the sequence alignment. The sequence homology values which are indicated above as a percentage were determined over the entire sequence region using the program GAP and the following settings: Gap Weight: 50, Length Weight: 3, Average Match: 10.000 and Average Mismatch: 0.000. Unless otherwise specified, these settings were always used as standard settings for the sequence alignments.
[0307] Homologs of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 means for example also bacterial, fungal and plant homologs, truncated sequences, single-stranded DNA or RNA of the coding and noncoding DNA sequence.
[0308] Homologs of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 also means derivatives such as, for example, promoter variants. The promoters upstream of the nucleotide sequences detailed can be modified by one or more nucleotide exchanges, by insertion(s) and/or deletion(s) without the functionality or activity of the promoters being adversely affected, however. It is furthermore possible that the modification of the promoter sequence enhances their activity or that they are replaced entirely by more active promoters, including those from heterologous organisms.
[0309] The abovementioned nucleic acids and protein molecules with .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.9-elongase, .DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase, .DELTA.5-elongase and/or .DELTA.4-desaturase activity which are involved in the metabolism of lipids and fatty acids, PUFA cofactors and enzymes or in the transport of lipophilic compounds across membranes are used in the process according to the invention for the modulation of the production of PUFAs in transgenic organisms, advantageously in plants, such as maize, wheat, rye, oats, triticale, rice, barley, soybean, peanut, cotton, Linum species such as linseed or flax, Brassica species such as oilseed rape, canola and turnip rape, pepper, sunflower, borage, evening primrose and Tagetes, Solanaceae plants such as potato, tobacco, eggplant and tomato, Vicia species, pea, cassava, alfalfa, bushy plants (coffee, cacao, tea), Salix species, trees (oil palm, coconut) and perennial grasses and fodder crops, either directly (for example when the overexpression or optimization of a fatty acid biosynthesis protein has a direct effect on the yield, production and/or production efficiency of the fatty acid from modified organisms) and/or can have an indirect effect which nevertheless leads to an enhanced yield, production and/or production efficiency of the PUFAs or a reduction of undesired compounds (for example when the modulation of the metabolism of lipids and fatty acids, cofactors and enzymes lead to modifications of the yield, production and/or production efficiency or the composition of the desired compounds within the cells, which, in turn, can affect the production of one or more fatty acids).
[0310] The combination of various precursor molecules and biosynthesis enzymes leads to the production of various fatty acid molecules, which has a decisive effect on lipid composition, since polyunsaturated fatty acids (=PUFAs) are not only incorporated into triacylglycerol but also into membrane lipids.
[0311] Brassicaceae, Boraginaceae, Primulaceae, or Linaceae are particularly suitable for the production of PUFAs, for example stearidonic acid, eicosapentaenoic acid and docosahexaenoic acid. Linseed (Linum usitatissimum) is especially advantageously suitable for the production of PUFAs with the nucleic acid sequences according to the invention, advantageously, as described, in combination with further desaturases and elongases.
[0312] Lipid synthesis can be divided into two sections: the synthesis of fatty acids and their binding to sn-glycerol-3-phosphate, and the addition or modification of a polar head group. Usual lipids which are used in membranes comprise phospholipids, glycolipids, sphingolipids and phosphoglycerides. Fatty acid synthesis starts with the conversion of acetyl-CoA into malonyl-CoA by acetyl-CoA carboxylase or into acetyl-ACP by acetyl transacylase. After condensation reaction, these two product molecules together form acetoacetyl-ACP, which is converted via a series of condensation, reduction and dehydratization reactions so that a saturated fatty acid molecule with the desired chain length is obtained. The production of the unsaturated fatty acids from these molecules is catalyzed by specific desaturases, either aerobically by means of molecular oxygen or anaerobically (regarding the fatty acid synthesis in microorganisms, see F. C. Neidhardt et al. (1996) E. coli and Salmonella. ASM Press: Washington, D.C., pp. 612-636 and references cited therein; Lengeler et al. (Ed.) (1999) Biology of Procaryotes. Thieme: Stuttgart, New York, and the references therein, and Magnuson, K., et al. (1993) Microbiological Reviews 57:522-542 and the references therein). To undergo the further elongation steps, the resulting phospholipid-bound fatty acids must be returned to the fatty acid CoA ester pool. This is made possible by acyl-CoA:lysophospholipid acyltransferases. Moreover, these enzymes are capable of transferring the elongated fatty acids from the CoA esters back to the phospholipids. If appropriate, this reaction sequence can be followed repeatedly.
[0313] Examples of precursors for the biosynthesis of PUFAs are oleic acid, linoleic acid and linolenic acid. The C18-carbon fatty acids must be elongated to C20 and C22 in order to obtain fatty acids of the eicosa and docosa chain type. With the aid of the desaturases used in the process, such as the .DELTA.12-, .omega.3-, .DELTA.5-, .DELTA.6- and .DELTA.8-desaturases and/or .DELTA.5-, .DELTA.6-, .DELTA.9-elongases, arachidonic acid, eicosapentaenoic acid, docosapentaenoic acid or docosahexaenoic acid, advantageously eicosapentaenoic acid and/or docosahexaenoic acid, can be produced and subsequently employed in various applications regarding foodstuffs, feedstuffs, cosmetics or pharmaceuticals. C.sub.20- and/or C.sub.22-fatty acids with at least two, advantageously at least three, four, five or six, double bonds in the fatty acid molecule, preferably C.sub.20- or C.sub.22-fatty acids with advantageously four, five or six double bonds in the fatty acid molecule, can be prepared using the abovementioned enzymes. Desaturation may take place before or after elongation of the fatty acid in question. This is why the products of the desaturase activities and the further desaturation and elongation steps which are possible result in preferred PUFAs with a higher degree of desaturation, including a further elongation from C.sub.20- to C.sub.22-fatty acids, to fatty acids such as .gamma.-linolenic acid, dihomo-.gamma.-linolenic acid, arachidonic acid, stearidonic acid, eicosatetraenoic acid or eicosapentaenoic acid. Substrates of the desaturases and elongases used in the process according to the invention are C.sub.16-, C.sub.18- or C.sub.20-fatty acids such as, for example, linoleic acid, .gamma.-linolenic acid, .alpha.-linolenic acid, dihomo-.gamma.-linolenic acid, eicosatetraenoic acid or stearidonic acid. Preferred substrates are linoleic acid, .gamma.-linolenic acid and/or .alpha.-linolenic acid, dihomo-.gamma.-linolenic acid, arachidonic acid, eicosatetraenoic acid or eicosapentaenoic acid. The synthesized C.sub.20- or C.sub.22-fatty acids with at least two, three, four, five or six double bonds in the fatty acids are obtained in the process according to the invention in the form of the free fatty acid or in the form of their esters, for example in the form of their glycerides.
[0314] The term "glyceride" is understood as meaning glycerol esterified with one, two or three carboxyl radicals (mono-, di- or triglyceride). "Glyceride" is also understood as meaning a mixture of various glycerides. The glyceride or glyceride mixture may comprise further additions, for example free fatty acids, antioxidants, proteins, carbohydrates, vitamins and/or other substances.
[0315] For the purposes of the invention, a "glyceride" is furthermore understood as meaning glycerol derivatives. In addition to the above-described fatty acid glycerides, these also include glycerophospholipids and glyceroglycolipids. Preferred examples which may be mentioned in this context are the glycerophospholipids such as lecithin (phosphatidylcholine), cardiolipin, phosphatidylglycerol, phosphatidylserine and alkylacylglycerophospholipids.
[0316] Furthermore, fatty acids must subsequently be translocated to various modification sites and incorporated into the triacylglycerol storage lipid. A further important step in lipid synthesis is the transfer of fatty acids to the polar head groups, for example by glycerol fatty acid acyltransferase (see Frentzen, 1998, Lipid, 100(4-5):161-166).
[0317] Publications on plant fatty acid biosynthesis and on the desaturation, the lipid metabolism and the membrane transport of lipidic compounds, on beta-oxidation, fatty acid modification and cofactors, triacylglycerol storage and triacylglycerol assembly, including the references therein, see the following papers: Kinney, 1997, Genetic Engeneering, Ed.: J K Setlow, 19:149-166; Ohlrogge and Browse, 1995, Plant Cell 7:957-970; Shanklin and Cahoon, 1998, Annu. Rev. Plant Physiol. Plant Mol. Biol. 49:611-641; Voelker, 1996, Genetic Engeneering, Ed.: J K Setlow, 18:111-13; Gerhardt, 1992, Prog. Lipid R. 31:397-417; Guhnemann-Schafer & Kindl, 1995, Biochim. Biophys Acta 1256:181-186; Kunau et al., 1995, Prog. Lipid Res. 34:267-342; Stymne et al., 1993, in: Biochemistry and Molecular Biology of Membrane and Storage Lipids of Plants, Ed.: Murata and Somerville, Rockville, American Society of Plant Physiologists, 150-158, Murphy & Ross 1998, Plant Journal. 13(1):1-16.
[0318] The PUFAs produced in the process comprise a group of molecules which higher animals are no longer capable of synthesizing and must therefore take up, or which higher animals are no longer capable of synthesizing themselves in sufficient quantity and must therefore take up additional quantities, although they can be synthesized readily by other organisms such as bacteria; for example, cats are no longer capable of synthesizing arachidonic acid.
[0319] Phospholipids for the purposes of the invention are understood as meaning phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol and/or phosphatidylinositol, advantageously phosphatidylcholine. The terms production or productivity are known in the art and comprise the concentration of the fermentation product (compounds of the formula I) which is formed within a specific period of time and in a specific fermentation volume (for example kg of product per hour per liter). It also comprises the productivity within a plant cell or a plant, that is to say the content of the desired fatty acids produced in the process relative to the content of all fatty acids in this cell or plant. The term production efficiency comprises the time required for obtaining a specific production quantity (for example the time required by the cell to establish a certain throughput rate of a fine chemical). The term yield or product/carbon yield is known in the art and comprises the efficiency of the conversion of the carbon source into the product (i.e. the fine chemical). This is usually expressed for example as kg of product per kg of carbon source. By increasing the yield or production of the compound, the amount of the molecules obtained of this compound, or of the suitable molecules of this compound obtained in a specific culture quantity over a specified period of time is increased. The terms biosynthesis or biosynthetic pathway are known in the art and comprise the synthesis of a compound, preferably an organic compound, by a cell from intermediates, for example in a multi-step and strongly regulated process. The terms catabolism or catabolic pathway are known in the art and comprise the cleavage of a compound, preferably of an organic compound, by a cell to give catabolites (in more general terms, smaller or less complex molecules), for example in a multi-step and strongly regulated process. The term metabolism is known in the art and comprises the totality of the biochemical reactions which take place in an organism. The metabolism of a certain compound (for example the metabolism of a fatty acid) thus comprises the totality of the biosynthetic pathways, modification pathways and catabolic pathways of this compound in the cell which relate to this compound.
[0320] In a further embodiment, derivatives of the nucleic acid molecule according to the invention represented in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183 encode proteins with at least 40%, advantageously approximately 50 or 60%, advantageously at least approximately 60 or 70% and more preferably at least approximately 70 or 80%, 80 to 90%, 90 to 95% and most preferably at least approximately 96%, 97%, 98%, 99% or more homology (=identity) with a complete amino acid sequence of SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 132, SEQ ID NO: 134 or SEQ ID NO: 184. The homology was calculated over the entire amino acid or nucleic acid sequence region. The program PileUp (J. Mol. Evolution, 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the programs Gap and BestFit [Needleman and Wunsch (J. Mol. Biol. 48; 443-453 (1970) and Smith and Waterman (Adv. Appl. Math. 2; 482-489 (1981)], which are part of the GCG software packet [Genetics Computer Group, 575 Science Drive, Madison, Wis., USA 53711 (1991)], were used for the sequence alignment. The sequence homology values which are indicated above as a percentage were determined over the entire sequence region using the program BestFit and the following settings: Gap Weight: 50, Length Weight: 3, Average Match: 10.000 and Average Mismatch: 0.000. Unless otherwise specified, these settings were always used as standard settings for the sequence alignments.
[0321] Moreover, the invention comprises nucleic acid molecules which differ from one of the nucleotide sequences shown in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183 (and parts thereof) owing to the degeneracy of the genetic code and which thus encode the same .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.6-desaturase, .DELTA.5-desaturase, .DELTA.4-desaturase, 06-elongase or .DELTA.5-elongase as those encoded by the nucleotide sequences shown in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183.
[0322] In addition to the .DELTA.12-desaturases, .omega.3-desaturases, .DELTA.5-elongases, .DELTA.6-desaturases, .DELTA.5-desaturases, .DELTA.4-desaturases or .DELTA.6-elongases shown in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183, the skilled worker will recognize that DNA sequence polymorphisms which lead to changes in the amino acid sequences of the .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.5-elongase, .DELTA.6-desaturase, .DELTA.5-desaturase, .DELTA.4-desaturase and/or .DELTA.6-elongase may exist within a population. These genetic polymorphisms in the .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.5-elongase, .DELTA.6-desaturase, .DELTA.5-desaturase, .DELTA.4-desaturase and/or .DELTA.6-elongase gene may exist between individuals within a population owing to natural variation. These natural variants usually bring about a variance of 1 to 5% in the nucleotide sequence of the .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.5-elongase, .DELTA.6-desaturase, .DELTA.5-desaturase, .DELTA.4-desaturase and/or .DELTA.6-elongase gene. Each and every one of these nucleotide variations and resulting amino acid polymorphisms in the .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.5-elongase, .DELTA.6-desaturase, .DELTA.5-desaturase, .DELTA.4-desaturase and/or .DELTA.6-elongase which are the result of natural variation and do not modify the functional activity are to be encompassed by the invention.
[0323] Owing to their homology to the .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.5-elongase, .DELTA.6-desaturase, .DELTA.5-desaturase, .DELTA.4-desaturase and/or .DELTA.6-elongase nucleic acids disclosed here, nucleic acid molecules which are advantageous for the process according to the invention can be isolated following standard hybridization techniques under stringent hybridization conditions, using the sequences or part thereof as hybridization probe. In this context it is possible, for example, to use isolated nucleic acid molecules which are least 15 nucleotides in length and which hybridize under stringent conditions with the nucleic acid molecules which comprise a nucleotide sequence of SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183. Nucleic acids with at least 25, 50, 100, 200 or more nucleotides can also be used. The "hybridizes under stringent conditions" as used in the present context is intended to describe hybridization and washing conditions under which nucleotide sequences with at least 60% homology to one another usually remain hybridized with one another. Conditions are preferably such that sequences with at least approximately 65%, preferably at least approximately 70% and especially preferably at least 75% or more homology to one another usually remain hybridized to one another. These stringent conditions are known to the skilled worker and described, for example, in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. A preferred nonlimiting example of stringent hybridization conditions is hybridizations in 6.times. sodium chloride/sodium citrate (=SSC) at approximately 45.degree. C., followed by one or more washing steps in 0.2.times.SSC, 0.1% SDS at 50 to 65.degree. C. The skilled worker knows that these hybridization conditions differ depending on the type of nucleic acid and, for example when organic solvents are present, regarding temperature and buffer concentration. Under "standard hybridization conditions", for example, the hybridization temperature is, depending on the type of nucleic acid, between 42.degree. C. and 58.degree. C. in aqueous buffer with a concentration of 0.1 to 5.times.SSC (pH 7.2). If organic solvents, for example 50% formamide, are present in the abovementioned buffer, the temperature under standard conditions is approximately 42.degree. C. The hybridization conditions for DNA:DNA hybrids, for example, are 0.1.times.SSC and 20.degree. C. to 45.degree. C., preferably 30.degree. C. to 45.degree. C. The hybridization conditions for DNA:RNA hybrids are, for example, 0.1.times.SSC and 30.degree. C. to 55.degree. C., preferably 45.degree. C. to 55.degree. C. The abovementioned hybridization conditions are determined by way of example for a nucleic acid with approximately 100 bp (=base pairs) in length and with a G+C content of 50% in the absence of formamide. The skilled worker knows how to determine the required hybridization conditions on the basis of the abovementioned textbooks or textbooks such as Sambrook et al., "Molecular Cloning", Cold Spring Harbor Laboratory, 1989; Hames and Higgins (Ed.) 1985, "Nucleic Acids Hybridization: A Practical Approach", IRL Press at Oxford University Press, Oxford; Brown (Ed.) 1991, "Essential Molecular Biology: A Practical Approach", IRL Press at Oxford University Press, Oxford.
[0324] In order to determine the percentage of homology (=identity) of two amino acid sequences (for example one of the sequences of SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 114, SEQ ID NO: 132, SEQ ID NO: 134 or SEQ ID NO: 184) or of two nucleic acids (for example SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183) the sequences are written one under the other for an optimal comparison (for example, gaps may be introduced into the sequence of a protein or of a nucleic acid in order to generate an optimal alignment with the other protein or the other nucleic acid). Then, the amino acid residue or nucleotides at the corresponding amino acid positions or nucleotide positions are compared. If a position in a sequence is occupied by the same amino acid residue or the same nucleotide as the corresponding position in the other sequence, then the molecules are homologous at this position (i.e. amino acid or nucleic acid "homology" as used in the present context corresponds to amino acid or nucleic acid "identity"). The percentage of homology between the two sequences is a function of the number of positions which the sequences share (i.e. % homology=number of identical positions/total number of positions.times.100). The terms homology and identity are therefore to be considered as synonymous.
[0325] An isolated nucleic acid molecule which encodes a .DELTA.12-desaturase, .omega.3-desaturase, 06-desaturase, .DELTA.5-desaturase, .DELTA.4-desaturase, .DELTA.5-elongase and/or .DELTA.6-elongase which is homologous to a protein sequence of SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 114, SEQ ID NO: 132, SEQ ID NO: 134 or SEQ ID NO: 184 can be generated by introducing one or more nucleotide substitutions, additions or deletions in/into a nucleotide sequence of SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183 so that one or more amino acid substitutions, additions or deletions are introduced in/into the protein which is encoded. Mutations in one of the sequences of SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183 can be introduced by standard techniques such as site-specific mutagenesis and PCR-mediated mutagenesis. It is preferred to generate conservative amino acid substitutions in one or more of the predicted nonessential amino acid residues. In a "conservative amino acid substitution", the amino acid residue is replaced by an amino acid residue with a similar side chain. Families of amino acid residues with similar side chains have been defined in the art. These families comprise amino acids with basic side chains (for example lysine, arginine, histidine), acidic side chains (for example aspartic acid, glutamic acid), uncharged polar side chains (for example glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), unpolar side chains (for example alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (for example threonine, valine, isoleucine) and aromatic side chains (for example tyrosine, phenylalanine, tryptophan, histidine). A predicted nonessential amino acid residue in a .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.6-desaturase, .DELTA.5-desaturase, .DELTA.4-desaturase, .DELTA.5-elongase or .DELTA.6-elongase is thus preferably replaced by another amino acid residue from the same family of side chains. In another embodiment, the mutations can, alternatively, be introduced randomly over all or part of the sequence encoding the .DELTA.12-desaturase, .omega.3-desaturase, .DELTA.6-desaturase, .DELTA.5-desaturase, .DELTA.4-desaturase, .DELTA.5-elongase or .DELTA.6-elongase, for example by saturation mutagenesis, and the resulting mutants can be screened by recombinant expression for the herein-described .DELTA.12-desaturase, .omega.3-desaturase, 06-desaturase, .DELTA.5-desaturase, .DELTA.4-desaturase, .DELTA.5-elongase or .DELTA.6-elongase activity in order to identify mutants which have retained the .DELTA.12-desaturase, .omega.3-desaturase, 06-desaturase, .DELTA.5-desaturase, .DELTA.4-desaturase, .DELTA.5-elongase or .DELTA.6-elongase activity. Following the mutagenesis of one of the sequences SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183, the protein which is encoded can be expressed recombinantly, and the activity of the protein can be determined, for example using the tests described in the present text.
[0326] The invention furthermore relates to transgenic nonhuman organisms which comprise the nucleic acids SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183 according to the invention or a gene construct or a vector which comprise these nucleic acid sequences according to the invention. The nonhuman organism is advantageously a microorganism, a nonhuman animal or a plant, especially preferably a plant.
[0327] The present invention is illustrated in greater detail by the examples which follow, which are not to be construed as limiting. The content of all of the references, patent applications, patents and published patent applications cited in the present patent application is herewith incorporated by reference.
EXAMPLES
Example 1
General Cloning Methods
[0328] The cloning methods such as, for example, restriction cleavages, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linkage of DNA fragments, transformation of E. coli cells, bacterial cultures and the sequence analysis of recombinant DNA were carried out as described by Sambrook et al. (1989) (Cold Spring Harbor Laboratory Press: ISBN 0-87969-309-6).
Example 2
Sequence Analysis of Recombinant DNA
[0329] Recombinant DNA molecules were sequenced with an ABI laser fluorescence DNA sequencer by the method of Sanger (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467). Fragments obtained by polymerase chain reaction were sequenced and verified to avoid polymerase errors in constructs to be expressed.
Example 3
Cloning of Oncorhynchus mykiss Genes
[0330] The search for conserved regions in the protein sequences corresponding to the elongase genes detailed in the application identified two sequences with corresponding motifs in the Genbank sequence database.
TABLE-US-00003 Name of gene Genbank No. Amino acids OmELO2 CA385234, CA364848, 264 CA366480 OmELO3 CA360014, CA350786 295
[0331] Oncoryhnchus mykiss total RNA was isolated with the aid of the RNAeasy kit from Qiagen (Valencia, Calif., US). Poly-A+ RNA (mRNA) was isolated from the total RNA with the aid of oligo-dT-cellulose (Sambrook et al., 1989). The RNA was subjected to reverse transcription using the Reverse Transcription System kit from Promega, and the cDNA synthesized was cloned into the vector lambda ZAP (lambda ZAP Gold, Stratagene). The cDNA was then unpackaged in accordance with the manufacturer's instructions to give the plasmid DNA. The cDNA plasmid library was then used for the PCR for cloning expression plasmids.
Example 4
Cloning of Expression Plasmids for the Purposes of Heterologous Expression in Yeasts
[0332] The following oligonucleotides were used for the PCR reaction for cloning the two sequences for the heterologous expression in yeasts:
TABLE-US-00004 Primer Nucleotide sequence 5' f* OmELO2 5' aagcttacataatggcttcaac atggcaa (SEQ ID NO: 179) 3' r* OmELO2 5' ggatccttatgtcttcttgctc ttcctgtt (SEQ ID NO: 180) 5' f OmELO3 5' aagcttacataatggagacttt taat (SEQ ID NO: 181) 3' r OmELO3 5' ggatccttcagtcccccctcac tttcc (SEQ ID NO: 182) *f: forward, r: reverse
Composition of the PCR Mix (50 .mu.l):
[0333] 5.00 .mu.l template cDNA
[0334] 5.00 .mu.l 10.times. buffer (Advantage polymerase)+25 mM MgCl.sub.2
[0335] 5.00 .mu.l 2 mM dNTP
[0336] 1.25 .mu.l of each primer (10 .mu.mol/.mu.l)
[0337] 0.50 .mu.l Advantage polymerase
[0338] The Advantage polymerase from Clontech was employed.
PCR Reaction Conditions:
[0339] Annealing temperature: 1 minute at 55.degree. C.
[0340] Denaturation temperature: 1 minute at 94.degree. C.
[0341] Elongation temperature: 2 minutes at 72.degree. C.
[0342] Number of cycles: 35
[0343] The PCR product was incubated for 2 hours at 37.degree. C. with the restriction enzymes HindIII and BamHI. The yeast expression vector pYES3 (Invitrogen) was incubated in the same manner. Thereafter, the 812 bp PCR product, the 905 bp PCR product and the vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The DNA was purified by means of Qiagen gel purification kit following the manufacturer's instructions. Thereafter, vector and elongase cDNA were ligated. The Rapid Ligation kit from Roche was used for this purpose. The resulting plasmids pYES3-OmELO2 and pYES3-OmELO3 were verified by sequencing and transformed into the Saccharomyces strain INVSc1 (Invitrogen) by electroporation (1500 V). As a control, pYES3 was transformed in parallel. Thereafter, the yeasts were plated onto minimal dropout tryptophan medium supplemented with 2% glucose. Cells which were capable of growth without tryptophan in the medium thus comprised the corresponding plasmids pYES3, pYES3-OmELO2 (SEQ ID NO: 51) and pYES3-OmELO3 (SEQ ID NO: 53). After the selection, in each case two transformants were chosen for the further functional expression.
Example 5
Cloning Expression Plasmids for the Purposes of Seed-Specific Expression in Plants
[0344] To transform plants, a further transformation vector based on pSUN-USP was generated. To this end, NotI cleavage sites were introduced at the 5' and 3' ends of the coding sequence, using the following primer pair:
TABLE-US-00005 PSUN-OmELO2 Forward: (SEQ ID NO: 175) 5'-GCGGCCGCATAATGGCTTCAACATGGCAA Reverse: (SEQ ID NO: 176) 3'-GCGGCCGCTTATGTCTTCTTGCTCTTCCTGTT PSUN-OMELO3 Forward: (SEQ ID NO: 177) 5'-GCGGCCGCataatggagacttttaat Reverse: (SEQ ID NO: 178) 3'-GCGGCCGCtcagtcccccctcactttcc
Composition of the PCR Mix (50 .mu.l):
[0345] 5.00 .mu.l template cDNA
[0346] 5.00 .mu.l 10.times. buffer (Advantage polymerase)+25 mM MgCl.sub.2
[0347] 5.00 .mu.l 2 mM dNTP
[0348] 1.25 .mu.l of each primer (10 .mu.mol/.mu.l)
[0349] 0.50 .mu.l Advantage polymerase
[0350] The Advantage polymerase from Clontech was employed.
PCR Reaction Conditions:
[0351] Annealing temperature: 1 minute at 55.degree. C.
[0352] Denaturation temperature: 1 minute at 94.degree. C.
[0353] Elongation temperature: 2 minutes at 72.degree. C.
[0354] Number of cycles: 35
[0355] The PCR products were incubated for 16 hours at 37.degree. C. with the restriction enzyme NotI. The plant expression vector pSUN300-USP was incubated in the same manner. Thereafter, the PCR products and the 7624 bp vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The DNA was purified by means of Qiagen gel purification kit following the manufacturer's instructions. Thereafter, vector and PCR products were ligated. The Rapid Ligation kit from Roche was used for this purpose. The resulting plasmids pSUN-OmELO2 and pSUN-OmELO3 were verified by sequencing.
[0356] pSUN300 is a derivative of plasmid pPZP (Hajdukiewicz, P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25:989-994). pSUN-USP originated from pSUN300, by inserting a USP promoter as EcoRI fragment into pSUN300. The polyadenylation signal is that of the octopine synthase gene from the A. tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montagu, M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl. Genet. 1 (6), 499-511 (1982). The USP promoter corresponds to the nucleotides 1-684 (Genbank Accession X56240), where part of the noncoding region of the USP gene is present in the promoter. The promoter fragment which is 684 base pairs in size was amplified by means of commercially available T7 standard primers (Stratagene) and with the aid of a synthesized primer via a PCR reaction following standard methods (primer sequence: 5'-GTCGACCCGCGGACTAGTGGGCCCTCT-AGACCCGGGGGATCCGGATCTGCTGGCTATGAA-3', SEQ ID NO: 174). The PCR fragment was cut again with EcoRI/SalI and introduced into the vector pSUN300 with OCS terminator. This gave rise to the plasmid with the name pSUN-USP. The construct was used for the transformation of Arabidopsis thaliana, oilseed rape, tobacco and linseed.
Example 6
Lipid Extraction from Yeasts and Seeds
[0357] The effect of the genetic modification in plants, fungi, algae, ciliates or on the production of a desired compound (such as a fatty acid) can be determined by growing the modified microorganisms or the modified plant under suitable conditions (such as those described above) and analyzing the medium and/or the cellular components for the elevated production of desired product (i.e. of the lipids or a fatty acid). These analytical techniques are known to the skilled worker and comprise spectroscopy, thin-layer chromatography, various types of staining methods, enzymatic and microbiological methods and analytical chromatography such as high-performance liquid chromatography (see, for example, Ullman, Encyclopedia of Industrial Chemistry, Vol. A2, p. 89-90 and p. 443-613, VCH: Weinheim (1985); Fallon, A., et al., (1987) "Applications of HPLC in Biochemistry" in: Laboratory Techniques in Biochemistry and Molecular Biology, Vol. 17; Rehm et al. (1993) Biotechnology, Vol. 3, Chapter III: "Product recovery and purification", p. 469-714, VCH: Weinheim; Belter, P. A., et al. (1988) Bioseparations: downstream processing for Biotechnology, John Wiley and Sons; Kennedy, J. F., and Cabral, J. M. S. (1992) Recovery processes for biological Materials, John Wiley and Sons; Shaeiwitz, J. A., and Henry, J. D. (1988) Biochemical Separations, in: Ullmann's Encyclopedia of Industrial Chemistry, Vol. B3; Chapter 11, p. 1-27, VCH: Weinheim; and Dechow, F. J. (1989) Separation and purification techniques in biotechnology, Noyes Publications).
[0358] In addition to the abovementioned processes, plant lipids are extracted from plant material as described by Cahoon et al. (1999) Proc. Natl. Acad. Sci. USA 96 (22):12935-12940 and Browse et al. (1986) Analytic Biochemistry 152:141-145. The qualitative and quantitative analysis of lipids or fatty acids is described by Christie, William W., Advances in Lipid Methodology, Ayr/Scotland: Oily Press (Oily Press Lipid Library; 2); Christie, William W., Gas Chromatography and Lipids. A Practical Guide--Ayr, Scotland: Oily Press, 1989, Repr. 1992, IX, 307 pp. (Oily Press Lipid Library; 1); "Progress in Lipid Research, Oxford: Pergamon Press, 1 (1952)-16 (1977) under the title: Progress in the Chemistry of Fats and Other Lipids CODEN.
[0359] In addition to measuring the end product of the fermentation, it is also possible to analyze other components of the metabolic pathways which are used for the production of the desired compound, such as intermediates and by-products, in order to determine the overall production efficiency of the compound. The analytical methods comprise measuring the amount of nutrients in the medium (for example sugars, hydrocarbons, nitrogen sources, phosphate and other ions), measuring the biomass composition and the growth, analyzing the production of conventional metabolites of biosynthetic pathways and measuring gases which are generated during the fermentation. Standard methods for these measurements are described in Applied Microbial Physiology; A Practical Approach, P. M. Rhodes and P. F. Stanbury, Ed., IRL Press, p. 103-129; 131-163 and 165-192 (ISBN: 0199635773) and references cited therein.
[0360] One example is the analysis of fatty acids (abbreviations: FAME, fatty acid methyl ester; GC-MS, gas liquid chromatography/mass spectrometry; TAG, triacylglycerol; TLC, thin-layer chromatography).
[0361] The unambiguous detection for the presence of fatty acid products can be obtained by analyzing recombinant organisms using analytical standard methods: GC, GC-MS or TLC, as described on several occasions by Christie and the references therein (1997, in: Advances on Lipid Methodology, Fourth Edition: Christie, Oily Press, Dundee, 119-169; 1998, Gaschromatographie-Massenspektrometrie-Verfahren [Gas chromatography/mass spectrometric methods], Lipide 33:343-353).
[0362] The material to be analyzed can be disrupted by sonication, grinding in a glass mill, liquid nitrogen and grinding or via other applicable methods. After disruption, the material must be centrifuged. The sediment is resuspended in distilled water, heated for 10 minutes at 100.degree. C., cooled on ice and recentrifuged, followed by extraction for one hour at 90.degree. C. in 0.5 M sulfuric acid in methanol with 2% dimethoxypropane, which leads to hydrolyzed oil and lipid compounds, which give transmethylated lipids. These fatty acid methyl esters are extracted in petroleum ether and finally subjected to a GC analysis using a capillary column (Chrompack, WCOT Fused Silica, CP-Wax-52 CB, 25 .mu.m, 0.32 mm) at a temperature gradient of between 170.degree. C. and 240.degree. C. for 20 minutes and 5 minutes at 240.degree. C. The identity of the resulting fatty acid methyl esters must be defined using standards which are available from commercial sources (i.e. Sigma).
[0363] Plant material is initially homogenized mechanically by comminuting in a pestle and mortar to make it more amenable to extraction.
[0364] This is followed by heating at 100.degree. C. for 10 minutes and, after cooling on ice, by resedimentation. The cell sediment is hydrolyzed for one hour at 90.degree. C. with 1 M methanolic sulfuric acid and 2% dimethoxypropane, and the lipids are transmethylated. The resulting fatty acid methyl esters (FAMEs) are extracted in petroleum ether. The extracted FAMEs are analyzed by gas liquid chromatography using a capillary column (Chrompack, WCOT Fused Silica, CP-Wax-52 CB, 25 m, 0.32 mm) and a temperature gradient of from 170.degree. C. to 240.degree. C. in 20 minutes and 5 minutes at 240.degree. C. The identity of the fatty acid methyl esters is confirmed by comparison with corresponding FAME standards (Sigma). The identity and position of the double bond can be analyzed further by suitable chemical derivatization of the FAME mixtures, for example to give 4,4-dimethoxyoxazoline derivatives (Christie, 1998) by means of GC-MS.
[0365] Yeasts which had been transformed as described in Example 4 with the plasmids pYES3, pYES3-OmELO2 and pYES3-OmELO3 were analyzed as follows:
[0366] The yeast cells from the main cultures were harvested by centrifugation (100.times.g, 10 min, 20.degree. C.) and washed with 100 mM NaHCO.sub.3, pH 8.0 to remove residual medium and fatty acids. Fatty acid methyl esters (FAMEs) were prepared from the yeast cell sediments by acid methananolysis. To this end, the cell sediments were incubated with 2 ml of 1N methanolic sulfuric acid and 2% (v/v) dimethoxypropane for 1 hour at 80.degree. C. The FAMEs were extracted by extracting twice with petroleum ether (PE). To remove underivatized fatty acids, the organic phases were washed in each case once with 2 ml of 100 mM NaHCO.sub.3, pH 8.0 and 2 ml of distilled water. Thereafter, the PE phases were dried with Na.sub.2SO.sub.4, evaporated under argon and taken up in 100 .mu.l of PE. The samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 .mu.m, Agilent) in a Hewlett-Packard 6850 gas chromatograph flame ionization detector. The conditions for the GLC analysis were as follows: the oven temperature was programmed from 50.degree. C. to 250.degree. C. with a rate of 5.degree. C./min and finally 10 minutes at 250.degree. C. (holding).
[0367] The signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma).
[0368] The methodology is described for example in Napier and Michaelson, 2001, Lipids. 36(8):761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52(360):1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388(2):293-298 and Michaelson et al., 1998, FEBS Letters. 439(3):215-218.
Example 7
Functional Characterization of OmELO2 and OmELO3
[0369] While OmELO2 shows no elongase activity, OmELO3 was shown to have a pronounced activity with different substrates. The substrate specificity of OmElo3 was determined after expression and feeding a variety of fatty acids (FIG. 2). The substrates fed can be detected in large amounts in all transgenic yeasts. All transgenic yeasts show the synthesis of novel fatty acids, the products of the OmElo3 reaction. This means that functional expression of the gene OmElo3 has been possible.
[0370] FIG. 2 shows that OmElo3 has a substrate specificity which leads with high specificity to the elongation of .DELTA.5- and .DELTA.6-fatty acids with one .omega.3-double bond. Moreover, .omega.6-fatty acids (C18 and C20) were furthermore also elongated with less specificity. The best substrates for OmElo3 (up to 66% elongation) were stearidonic acid (C18:4 .omega.3) and eicosapentaenoic acid (C20:5 .omega.3).
Example 8
Reconstitution of the Synthesis of DHA in Yeast
[0371] The reconstitution of the biosynthesis of DHA (22:6 .omega.3) was carried out starting from EPA (20:5 .omega.3) or stearidonic acid (18:4 .omega.3) by coexpressing OmElo3 together with the Euglena gracilis .DELTA.4-desaturase or the Phaeodactylum tricornutum .DELTA.5-desaturase and the Euglena gracilis .DELTA.4-desaturase. To this end, the expression vectors pYes2-EgD4 and pESCLeu-PtD5 were additionally constructed. The abovementioned yeast strain which is already transformed with pYes3-OtElo3 (SEQ ID NO: 55), was transformed further with pYes2-EgD4, or simultaneously with pYes2-EgD4 and pESCLeu-PtD5. The transformed yeasts were selected on complete minimal dropout tryptophan and uracil medium agar plates supplemented with 2% glucose in the case of the pYes3-OmELO/pYes2-EgD4 strain and complete minimal dropout tryptophan, uracil and leucine medium in the case of the pYes3-OmELO/pYes2-EgD4+pESCLeu-PtD5 strain. Expression was induced by addition of 2% (w/v) galactose as indicated above. The cultures were incubated for a further 120 hours at 15.degree. C.
[0372] FIG. 3 shows the fatty acid profiles of transgenic yeasts which had been fed with 20:5 .omega.3. In the control yeast (A), which had been transformed with the vector pYes3-OmElo3 (SEQ ID NO: 53) and the blank vector pYes2, 20:5 .omega.3 was elongated very efficiently to give 22:5 .omega.3 (65% elongation). The additional introduction of Eg.DELTA.-4-desaturase resulted in the conversion of 22:5 .omega.3 into 22:6 .omega.3 (DHA). The fatty acid composition of the transgenic yeasts is shown in FIG. 5. After coexpression of OmElo3 and EgD4, up to 3% of DHA was detected in yeasts.
[0373] In a further coexpression experiment, OmElo3, EgD4 and a.quadrature. P. tricornutum .DELTA.5-desaturase (PtD5) were expressed together. The transgenic yeasts were fed stearidonic acid (18:4 .omega.3) and they were analyzed (FIG. 4). The fatty acid composition of these yeasts is shown in FIG. 5. The fatty acid fed, 18:4 .omega.3, was elongated by OmElo3 to give 20:4 .omega.3 (60% elongation). The latter was desaturated by PtD5 to give 20:5 .omega.3. The PtD5 activity was 15%. Moreover, it was possible to elongate 20:5 .omega.3 by OmElo3 to give 22:5 .omega.3. Thereafter, the newly synthesized 22:5 .omega.3 was desaturated to 22:6 .omega.3 (DHA). Up to 0.7% of DHA was obtained in these experiments.
[0374] It can be seen from these experiments that the sequences OmElo3, EgD4 and PtD5 which are used in the present invention are suitable for the production of DHA in eukaryotic cells.
Example 9
Generation of Transgenic Plants
a) Generation of Transgenic Oilseed Rape Plants (Modified Method of Moloney et al., 1992, Plant Cell Reports, 8:238-242)
[0375] Binary vectors in Agrobacterium tumefaciens C58C1:pGV2260 or Escherichia coli (Deblaere et al, 1984, Nucl. Acids. Res. 13, 4777-4788) can be used for generating transgenic oilseed rape plants. To transform oilseed rape plants (Var. Drakkar, NPZ Nordeutsche Pflanzenzucht, Hohenlieth, Germany), a 1:50 dilution of an overnight culture of a positively transformed agrobacterial colony in Murashige-Skoog medium (Murashige and Skoog 1962 Physiol. Plant. 15, 473) supplemented with 3% sucrose (3MS medium) is used. Petiols or hypocotyls of freshly germinated sterile oilseed rape plants (in each case approx. 1 cm.sup.2) are incubated with a 1:50 agrobacterial dilution for 5-10 minutes in a Petri dish. This is followed by 3 days of coincubation in the dark at 25.degree. C. on 3MS medium supplemented with 0.8% Bacto agar. The cultures are then grown for 3 days at 16 hours light/8 hours dark and the cultivation is continued in a weekly rhythm on MS medium supplemented with 500 mg/l Claforan (cefotaxim sodium), 50 mg/l kanamycin, 20 .mu.M benzylaminopurine (BAP), now supplemented with 1.6 g/l of glucose. Growing shoots are transferred to MS medium supplemented with 2% sucrose, 250 mg/l Claforan and 0.8% Bacto agar. If no roots develop after three weeks, 2-indolebutyric acid was added to the medium as growth hormone for rooting.
[0376] Regenerated shoots were obtained on 2MS medium supplemented with kanamycin and Claforan; after rooting, they were transferred to compost and, after growing on for two weeks in a controlled-environment cabinet or in the greenhouse, allowed to flower, and mature seeds were harvested and analyzed by lipid analysis for elongase expression, such as .DELTA.5-elongase or .DELTA.6-elongase activity or .omega.3-desaturase activity. In this manner, lines with elevated contents of polyunsaturated C.sub.20- and C.sub.22-fatty acids can be identified.
b) Generation of Transgenic Linseed Plants
[0377] Transgenic linseed plants can be generated for example by the method of Bell et al., 1999, In Vitro Cell. Dev. Biol.-Plant. 35(6):456-465 by means of particle bombardment. In general, linseed was transformed by an agrobacteria-mediated transformation, for example by the method of Mlynarova et al. (1994), Plant Cell Report 13: 282-285.
Example 10
Cloning .DELTA.5-Elongase Genes from Thraustochytrium aureum ATCC34304 and Thraustochytrium Ssp
[0378] By comparing the various elongase protein sequences found in the present application, it was possible to define conserved nucleic acid regions (histidine box: His-Val-X-His-His, tyrosine box: Met-Tyr-X-Tyr-Tyr). An EST database of T. aureum ATCC34304 and Thraustochytrium ssp. was screened for further .DELTA.5-elongases with the aid of these sequences. The following new sequences were found:
TABLE-US-00006 Name of gene Nucleotides Amino acids BioTaurELO1 828 bp 275 TL16y2 831 276
[0379] T. aureum ATCC34304 and Thraustochytrium ssp. total RNA was isolated with the aid of the RNAeasy kit from Qiagen (Valencia, Calif., US). mRNA was isolated from the total RNA with the aid of the PolyATract isolation system (Promega). The mRNA was subjected to reverse transcription using the Marathon cDNA amplification kit (BD Biosciences) and adaptors were ligated in accordance with the manufacturer's instructions. The cDNA library was then used for the PCR for cloning expression plasmids by means of 5'- and 3'-RACE (rapid amplification of cDNA ends).
Example 11
Cloning of Expression Plasmids for the Heterologous Expression in Yeasts
[0380] The following oligonucleotides were used for the PCR reaction for cloning the sequence for the heterologous expression in yeasts:
TABLE-US-00007 Primer Nucleotide sequence 5' f* BioTaurELO1 5' gacataatgacgagcaacatga g (SEQ ID NO: 170) 3' r* BioTaurELO1 5' cggcttaggccgacttggcctt ggg (SEQ ID NO: 171) 5' f*TL16y2 5' agacataatggacgtcgtcgag cagcaatg (SEQ ID NO: 172) 3' r*TL16y2 5' ttagatggtcttctgcttcttg ggcgcc (SEQ ID NO: 173) *f: forward, r: reverse
Composition of the PCR Mix (50 .mu.l):
[0381] 5.00 .mu.l template cDNA
[0382] 5.00 .mu.l 10.times. buffer (Advantage polymerase)+25 mM MgCl.sub.2
[0383] 5.00 .mu.l 2 mM dNTP
[0384] 1.25 .mu.l of each primer (10 .mu.mol/.mu.l)
[0385] 0.50 .mu.l Advantage polymerase
[0386] The Advantage polymerase from Clontech was employed.
PCR Reaction Conditions:
[0387] Annealing temperature: 1 minute at 55.degree. C.
[0388] Denaturation temperature: 1 minute at 94.degree. C.
[0389] Elongation temperature: 2 minutes at 72.degree. C.
[0390] Number of cycles: 35
[0391] The PCR products BioTaurELO1 (see SEQ ID NO: 65) and TL16y2 (see SEQ ID NO: 83) were incubated for 30 minutes at 21.degree. C. together with the yeast expression vector pYES2.1-TOPO (Invitrogen) in accordance with the manufacturer's instructions. Here, the PCR product was ligated into the vector by means of a T-overhang and the activity of a topoisomerase (Invitrogen). After the incubation, E. coli DH5.alpha. cells were transformed. Suitable clones were identified by PCR, the plasmid DNA was isolated by means of the Qiagen DNAeasy kit and verified by sequencing. The correct sequence was then transformed into the Saccharomyces strain INVSc1 (Invitrogen) by electroporation (1500 V). As a control, the blank vector pYES2.1 was transformed in parallel. Thereafter, the yeasts were plated out on minimal dropout uracil medium supplemented with 2% glucose. Cells which were capable of growing in the medium without uracil thus comprise the corresponding plasmids pYES2.1, pYES2.1-BioTaurELO1 and pYES2.1-TL16y2. After the selection, in each case two transformants were chosen for the further functional expression.
Example 12
Cloning Expression Plasmids for the Purposes of Seed-Specific Expression in Plants
[0392] To transform plants, a further transformation vector based on pSUN-USP was generated. To this end, NotI cleavage sites were introduced at the 5' and 3' ends of the coding sequence, using the following primer pair:
TABLE-US-00008 PSUN-BioTaurELO1 (SEQ ID NO: 166) Forward: 5'-GCGGCCGCATAATGACGAGCAACATGAGC (SEQ ID NO: 167) Reverse: 3'-GCGGCCGCTTAGGCCGACTTGGCCTTGGG PSUN-TL16y2 (SEQ ID NO: 168) Forward: 5'-GCGGCCGCACCATGGACGTCGTCGAGCAGCAATG (SEQ ID NO: 169) Reverse: 5'-GCGGCCGCTTAGATGGTCTTCTGCTTCTTGGGCGCC
Composition of the PCR mix (50 .mu.l):
[0393] 5.00 .mu.l template cDNA
[0394] 5.00 .mu.l 10.times. buffer (Advantage polymerase)+25 mM MgCl.sub.2
[0395] 5.00 .mu.l 2 mM dNTP
[0396] 1.25 .mu.l of each primer (10 .mu.mol/.mu.l)
[0397] 0.50 .mu.l Advantage polymerase
[0398] The Advantage polymerase from Clontech was employed.
PCR Reaction Conditions:
[0399] Annealing temperature: 1 minute at 55.degree. C.
[0400] Denaturation temperature: 1 minute at 94.degree. C.
[0401] Elongation temperature: 2 minutes at 72.degree. C.
[0402] Number of cycles: 35
[0403] The PCR products were incubated for 16 hours at 37.degree. C. with the restriction enzyme NotI. The plant expression vector pSUN300-USP was incubated in the same manner. Thereafter, the PCR products and the 7624 bp vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The DNA was purified by means of Qiagen gel purification kit following the manufacturer's instructions. Thereafter, vector and PCR products were ligated. The Rapid Ligation kit from Roche was used for this purpose. The resulting plasmids pSUN-BioTaurELO1 and pSUN-TL16y2 were verified by sequencing.
[0404] pSUN300 is a derivative of plasmid pPZP (Hajdukiewicz, P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25:989-994). pSUN-USP originated from pSUN300, by inserting a USP promoter as EcoRI fragment into pSUN300. The polyadenylation signal is that of the octopine synthase gene from the A. tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montagu, M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl. Genet. 1 (6), 499-511 (1982). Der USP promoter corresponds to the nucleotides 1-684 (Genbank Accession X56240), where part of the noncoding region of the USP gene is present in the promoter. The promoter fragment which is 684 base pairs in size was amplified by means of commercially available T7 standard primers (Stratagene) and with the aid of a synthesized primer via a PCR reaction following standard methods (primer sequence: 5'-GTCGACCCGCGGACTAGTGGGCCCTCT-AGACCCGGGGGATCCGGATCTGCTGGCTATGAA-3', SEQ ID NO: 165). The PCR fragment was cut again with EcoRI/SalI and introduced into the vector pSUN300 with OCS terminator. This gave rise to the plasmid with the name pSUN-USP. The construct was used for the transformation of Arabidopsis thaliana, oilseed rape, tobacco and linseed. The lipid extraction from yeasts and seeds was carried out as described in Example 6
Example 13
Functional Characterization of BioTaurELO1 and TL16y2
[0405] The substrate specificity of BioTaurELO1 was determined after expression and feeding of various fatty acids (FIG. 6). FIG. 6 shows the feeding experiments for determining the functionality and substrate specificity with yeast strains which comprise either the vector pYes2.1 (control) or the vector pYes2.1-BioTaurELO1 (=BioTaur) with the .DELTA.5-elongase. In both batches, 200 .mu.M of .gamma.-linolenic acid and eicosapentaenoic acid were added to the yeast incubation medium, and incubation was carried out for 24 hours. After the fatty acids had been extracted from the yeasts, they were transmethylated and separated by gas chromatography. The elongation products obtained from the two fatty acids which had been fed are identified by arrows.
[0406] The substrates fed can be detected in large amounts in all transgenic yeasts. All transgenic yeasts show the synthesis of novel fatty acids, the products of the BioTaurELO1 reaction. This means that functional expression of the gene BioTaurELO1 has been possible.
[0407] FIG. 6 shows that BioTaurELO1 shows a substrate specificity which leads with high specificity to the elongation of .DELTA.5- and .DELTA.6-fatty acids with one .omega.3-double bond. .omega.6-Fatty acids (C18 and C20) were furthermore also elongated. .gamma.-Linolenic acid (C18:3 .omega.6) is converted at a rate of 65.28%, stearidonic acid (C18:4 .omega.3) at a rate of 65.66% and eicosapentaenoic acid (C20:5 .omega.3) at a rate of 22.01%. The substrate specificities of the various feeding experiments are shown in table 3 (see end of description).
[0408] The conversion rate of GLA when GLA and EPA were fed was 65.28%. The conversion rate of EPA when the same amounts of GLA and EPA were fed was 9.99%. If only EPA was fed, the EPA conversion rate was 22.01%. Arachidonic acid (=ARA) was also converted when fed. The conversion rate was 14.47%. Stearidonic acid (=SDA) was also converted. In this case, the conversion rate was 65.66%.
[0409] The functionality and substrate specificity of TL16y2 was determined after expression and feeding of various fatty acids. Table 4 shows the feeding experiments. The feeding experiments were carried out in the same manner as described for BioTaurELO1. The substrates fed can be detected in large amounts in all transgenic yeasts. All transgenic yeasts showed the synthesis of novel fatty acids, the products of the TL16y2 reaction (FIG. 11). This means that functional expression of the gene TL16y2 has been possible.
TABLE-US-00009 TABLE 4 Expression of TL16y2 in yeast. Areas of the gas chromatographic analysis in % C18:3 C18:4 C20:3 C20:4 C20:4 C20:5 C22:4 C22:5 Plasmid Fatty acid (n-6) (n-3) (n-6) (n-6) (n-3) (n-3) (n-6) (n-3) pYES 250 uM EPA 13.79 TL16y2 250 uM EPA 25.81 2.25 pYES 50 uM EPA 5.07 TL16y2 50 uM EPA 2.48 1.73 pYES 250 uMGLA 8.31 TL16y2 250 uM GLA 3.59 10.71 pYES 250 uM ARA 16.03 TL16y2 250 uM ARA 15.2 3.87 pYES 250 uM SDA 26.79 0.35 TL16y2 250 uM SDA 7.74 29.17
[0410] The results for TL16y2 in comparison with the control, which are shown in Table 4, show the following conversion rates in percent: a) % conversion rate EPA (250 .mu.M): 8%, b) conversion rate EPA (50 .mu.M): 41%, c) % conversion rate ARA: 20.3%, d) % conversion rate SDA: 79.4% and e) % conversion rate GLA: 74.9%.
[0411] Thus, TL16y2 shows .DELTA.5-, .DELTA.6- and .DELTA.8-elongase activity. Among these, the activity for C18-fatty acids with .DELTA.6-double bond is the highest. Depending on the concentration of fatty acids fed, this is followed by the elongation of C20-fatty acids with one .DELTA.5- or .DELTA.8-double bond.
Example 14
Cloning Genes from Ostreococcus tauri
[0412] By searching for conserved regions in the protein sequences with the aid of the elongase genes listed in the application with .DELTA.5-elongase activity or .DELTA.6-elongase activity, it was possible to identify two sequences with corresponding motifs in an Ostreococcus tauri sequence database (genomic sequences). The sequences are the following
TABLE-US-00010 Name of gene SEQ ID Amino acids OtELO1 (.DELTA.5-elongase) SEQ ID NO: 67 300 OtELO2 (.DELTA.6-elongase) SEQ ID NO: 81 292
[0413] OtElo1 (SEQ ID NO: 67) has the highest similarity with a Danio rerio elongase (GenBank AAN77156; approx. 26% identity), while OtElo2 (SEQ ID NO: 81) has the greatest similarity with the Physcomitrella Elo (PSE) [approx. 36% identity] (alignments were carried out using the tBLASTn algorithm (Altschul et al., J. Mol. Biol. 1990, 215: 403-410).
[0414] The cloning procedure was carried out as follows:
[0415] 40 ml of an Ostreococcus tauri culture in the stationary phase were spun down and the pellet was resuspended in 100 .mu.l of double-distilled water and stored at -20.degree. C. The relevant genomic DNAs were amplified based on the PCR method. The corresponding primer pairs were selected in such a way that they contained the yeast consensus sequence for highly efficient translation (Kozak, Cell 1986, 44:283-292) next to the start codon. The amplification of the OtElo-DNAs was carried out using in each case 1 .mu.l of defrosted cells, 200 .mu.M dNTPs, 2.5 U Taq polymerase and 100 .mu.mol of each primer in a total volume of 50 .mu.l. The conditions for the PCR were as follows: first denaturation at 95.degree. C. for 5 minutes, followed by 30 cycles at 94.degree. C. for 30 seconds, 55.degree. C. for 1 minute and 72.degree. C. for 2 minutes, and a final elongation step at 72.degree. C. for 10 minutes.
Example 15
Cloning of Expression Plasmids for Heterologous Expression in Yeasts
[0416] To characterize the function of the Ostreococcus tauri elongases, the open reading frames of the DNAs in question were cloned downstream of the galactose-inducible GAL1 promoter of pYES2.1/V5-His-TOPO (Invitrogen), giving rise to pOTE1 and pOTE2.
[0417] The Saccharomyces cerevisiae strain 334 was transformed with the vector pOTE1 or pOTE2, respectively, by electroporation (1500 V). A yeast which was transformed with the blank vector pYES2 was used as control. The transformed yeasts were selected on complete minimal dropout uracil medium (CMdum) agar plates supplemented with 2% glucose. After the selection, in each case three transformants were selected for the further functional expression.
[0418] To express the Ot elongases, precultures consisting of in each case 5 ml of CMdum dropout uracil liquid medium supplemented with 2% (w/v) raffinose were initially inoculated with the selected transformants and incubated for 2 days at 30.degree. C. and 200 rpm. Then, 5 ml of CMdum (dropout uracil) liquid medium supplemented with 2% of raffinose and 300 .mu.M various fatty acids were inoculated with the precultures to an OD.sub.600 of 0.05. Expression was induced by the addition of 2% (w/v) of galactose. The cultures were incubated for a further 96 hours at 20.degree. C.
Example 16
Cloning of Expression Plasmids for the Seed-Specific Expression in Plants
[0419] To transform plants, a further transformation vector based on pSUN-USP was generated. To this end, NotI cleavage sites were inserted at the 5' and 3' end of the coding sequences, using PCR. The corresponding primer sequences were derived from the 5' and 3' regions of OtElo1 (SEQ ID NO: 67) and OtElo2 (SEQ ID NO:81).
Composition of the PCR Mix (50 .mu.l):
[0420] 5.00 .mu.l template cDNA
[0421] 5.00 .mu.l 10.times. buffer (Advantage polymerase)+25 mM MgCl.sub.2
[0422] 5.00 .mu.l 2 mM dNTP
[0423] 1.25 .mu.l of each primer (10 .mu.mol/.mu.l)
[0424] 0.50 .mu.l Advantage polymerase
[0425] The Advantage polymerase from Clontech was employed.
PCR Reaction Conditions:
[0426] Annealing temperature: 1 min 55.degree. C.
[0427] Denaturation temperature: 1 min 94.degree. C.
[0428] Elongation temperature: 2 min 72.degree. C.
[0429] Number of cycles: 35
[0430] The PCR products were incubated with the restriction enzyme NotI for 16 hours at 37.degree. C. The plant expression vector pSUN300-USP was incubated in the same manner.
[0431] Thereafter, the PCR product and the vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The DNA was purified by means of the Qiagen Gel Purification Kit following the manufacturer's instructions. Thereafter, vector and PCR products were ligated. The Rapid Ligation Kit from Roche was used for this purpose. The resulting plasmids pSUN-OtELO1 and pSUN-OtELO2 were verified by sequencing.
[0432] pSUN300 is a derivative of plasmid pPZP (Hajdukiewicz, P, Svab, Z, Maliga, P., (1994). The small versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25:989-994). pSUN-USP originated from pSUN300, by inserting a USP promoter into pSUN300 in the form of an EcoRI fragment. The polyadenylation signal is that of the Ostreococcus gene from the A. tumefaciens Ti plasmid (ocs-Terminator, Genbank Accession V00088) (De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montagu, M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl. Genet. 1 (6), 499-511 (1982). The USP promoter corresponds to nucleotides 1 to 684 (Genbank Accession X56240), where part of the noncoding region of the USP gene is present in the promoter. The promoter fragment which is 684 base pairs in size was amplified by a PCR reaction and standard methods with the aid of a synthesized primer and by means of a commercially available T7 standard primer (Stratagene). Primer sequence: 5'-GTCGACCCGCGGACTAGTGGG-CCCTCTAGACCCGGGGGATCCGGATCTGCTGGCTATGAA-3', SEQ ID NO: 164). The PCR fragment was recut with EcoRI/SalI and inserted into the vector pSUN300 with OCS terminator. This gave rise to the plasmid with the name pSUN-USP. The construct was used for the transformation of Arabidopsis thaliana, oilseed rape, tobacco and linseed.
Example 17
Expression of OtELO1 (SEQ ID NO: 67) and OtELO2 (SEQ ID NO: 81) in Yeasts
[0433] Yeasts which had been transformed with the plasmids pYES3, pYES3-OtELO1 and pYES3-OtELO2 as described in Example 15 were analyzed as follows:
[0434] The yeast cells from the main cultures were harvested by centrifugation (100.times.g, 5 min, 20.degree. C.) and washed with 100 mM NaHCO.sub.3, pH 8.0 to remove residual medium and fatty acids. Starting with the yeast cell sediments, fatty acid methyl esters (FAMEs) were prepared by acid methanolysis. To this end, the cell sediments were incubated for one hour at 80.degree. C. together with 2 ml of 1 N methanolic sulfuric acid and 2% (v/v) of dimethoxypropane. The FAMEs were extracted twice with petroleum ether (PE). To remove nonderivatized fatty acids, the organic phases were washed in each case once with 2 ml of 100 mM NaHCO.sub.3, pH 8.0 and 2 ml of distilled water. Thereafter, the PE phases were dried with Na.sub.2SO.sub.4, evaporated under argon and taken up in 100 .mu.l of PE. The samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 .mu.m, Agilent) in a Hewlett-Packard 6850 gas chromatograph equipped with flame ionization detector. The conditions for the GLC analysis were as follows: the oven temperature was programmed from 50.degree. C. to 250.degree. C. with a rate of 5.degree. C./min and finally 10 min at 250.degree. C. (holding).
[0435] The signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma). The methodology is described for example in Napier and Michaelson, 2001, Lipids. 36(8):761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52(360):1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388(2):293-298 and Michaelson et al., 1998, FEBS Letters. 439(3):215-218.
Example 18
Functional Characterization of OtELO1 (SEQ ID NO: 67) and OtELO2 (SEQ ID NO: 81)
[0436] The substrate specificity of OtElo1 (SEQ ID NO: 67) was determined after expression and after feeding various fatty acids (Tab. 5). The substrates fed can be detected in large amounts in all of the transgenic yeasts. The transgenic yeasts revealed the synthesis of novel fatty acids, the products of the OtElo1 reaction. This means that the gene OtElo1 was expressed functionally.
[0437] Table 4 shows that OtElo1 (SEQ ID NO: 67) has a narrow degree of substrate specificity. OtElo1 (SEQ ID NO: 67) was only capable of elongating the C.sub.20-fatty acids eicosapentaenoic acid (FIG. 7) and arachidonic acid (FIG. 8), but preferentially .omega.3-desaturated eicosapentaenoic acid.
TABLE-US-00011 TABLE 5 Fatty acid substrate Conversion rate (in %) 16:0.sup..quadrature. -- 16:1.sup..quadrature..DELTA.9 -- 18:0.sup..quadrature. -- 18:1.sup..quadrature..DELTA.9 -- 18:1.sup..DELTA.11 -- 18:2.sup..DELTA.9,12 -- 18:3.sup..quadrature..DELTA.6,9,12 -- 18:3.sup..quadrature..DELTA.5,9,12 -- 20:3.sup..DELTA.8,11,14 -- 20:4.sup..DELTA.5,.quadrature.8,11,14 10.8 .+-. 0.6 20:5.sup..DELTA.5,.quadrature.8,11,14,17 46.8 .+-. 3.6 22:4.sup..DELTA.7,.quadrature.10,13,16 -- 22.6.sup..quadrature..DELTA.4,7,10,13,16,19 --
[0438] Table 5 shows the substrate specificity of the elongase OtElo1 (SEQ ID NO: 67) for C.sub.20-polyunsaturated fatty acids with a double bond in the .DELTA.5 position in comparison with various fatty acids.
[0439] The yeasts which had been transformed with the vector pOTE1 were grown in minimal medium in the presence of the fatty acids stated. The fatty acid methyl esters were synthesized by subjecting intact cells to acid methanolysis. Thereafter, the FAMEs were analyzed by GLC. Each value represents the mean (n=3).+-.standard deviation.
[0440] The substrate specificity of OtElo2 (SEQ ID NO: 81) was determined after expression and after feeding various fatty acids (Tab. 6). The substrates fed can be detected in large amounts in all of the transgenic yeasts. The transgenic yeasts revealed the synthesis of novel fatty acids, the products of the OtElo2 reaction. This means that the gene OtElo2 was expressed functionally.
TABLE-US-00012 TABLE 6 Fatty acid substrate Conversion rate (in %) 16:0 -- 16:1.sup..quadrature..DELTA.9 -- 163.sup..quadrature..DELTA.7,10,13 -- 18:0.sup..quadrature. -- 18:1.sup..quadrature..DELTA.6 -- 18:1.sup..quadrature..DELTA.9 -- 18:1.sup..quadrature..DELTA.11 -- 18:2.sup..quadrature..DELTA.9,12 -- 18:3.sup..DELTA.6,9,12 15.3.+-. 18:3.sup..quadrature. .DELTA.5,9,12 -- 18:4.sup..quadrature. .DELTA.6,9,12,15 21.1.+-. 20:2.sup..DELTA.11,14 -- 20:3.sup..DELTA.8,11,14 -- 20:4.sup..DELTA.5,.quadrature.8,11,14 -- 20:5.sup..DELTA.5,.quadrature.8,11,14,17 -- 22:4.sup..DELTA.7,.quadrature.10,13,16 -- 22:5.sup..DELTA.7,.quadrature.10,13,16,19 -- 22:6.sup..quadrature..DELTA.4,7,10,13,16,19 --
[0441] Table 6 shows the substrate specificity of the elongase OtElo2 (SEQ ID NO: 81) with regard to various fatty acids.
[0442] The yeasts which had been transformed with the vector pOTE2 were grown in minimal medium in the presence of the fatty acids stated. The fatty acid methyl esters were synthesized by subjecting intact cells to acid methanolysis. Thereafter, the FAMEs were analyzed by GLC. Each value represents the mean (n=3).+-.standard deviation.
[0443] The enzymatic activity shown in Table 3 clearly demonstrates that OtElo2 (SEQ ID NO: 81) is a .DELTA.6-elongase.
Example 19
Cloning of Genes from Thalassiosira pseudonana
[0444] By searching for conserved regions in the protein sequences with the aid of the elongase genes with .DELTA.5-elongase activity or .DELTA.6-elongase activity, which are detailed in the application, it is possible to identify two sequences with corresponding motifs in a Thalassiosira pseudonana sequence database (genomic sequences). The sequences were the following:
TABLE-US-00013 Name of gene SEQ ID Amino acids TpELO1 (.DELTA.5-elongase) 85 358 TpELO2 (.DELTA.5-elongase) 59 358 TpELO3 (.DELTA.6-elongase) 45 272
[0445] A 2 l culture of T. pseudonana was grown in f/2 medium (Guillard, R. R. L. 1975. Culture of phytoplankton for feeding marine invertebrates. In Culture of Marine Invertebrate Animals (Eds. Smith, W. L. and Chanley, M. H.), Plenum Press, New York, pp 29-60) for 14 days at a light intensity of 80 E/cm.sup.2. After centrifugation of the cells, RNA was isolated with the aid of the RNAeasy kits from Qiagen (Valencia, Calif., US) following the manufacturer's instructions. The mRNA was subjected to reverse transcription with the Marathon cDNA amplification kit (BD Biosciences), and adaptors were ligated in accordance with the manufacturer's instructions. The cDNA library was then used for the PCR for cloning expression plasmids by means of 5'- and 3'-RACE (rapid amplification of cDNA ends).
Example 20
Cloning of Expression Plasmids for the Purposes of Heterologous Expression in Yeasts
[0446] The primer pairs in question were selected in such a way that they bore the yeast consensus sequence for highly efficient translation (Kozak, Cell 1986, 44:283-292) next to the start codon. The amplification of the TpElo DNAs was carried out in each case with 1 .mu.l cDNA, 200 .mu.M dNTPs, 2.5 U Advantage polymerase and 100 pmol of each primer in a total volume of 50 .mu.l. The PCR conditions were as follows: first denaturation at 95.degree. C. for 5 minutes, followed by 30 cycles at 94.degree. C. for 30 seconds, 55.degree. C. for 1 minute and 72.degree. C. for 2 minutes, and a last elongation step at 72.degree. C. for 10 minutes.
[0447] The following oligonucleotides for the PCR reaction were used for cloning the sequence for the heterologous expression in yeasts:
TABLE-US-00014 Name of gene, and SEQ ID NO: Primer sequence TpELO1 F: 5'-accatgtgctcaccaccgccgtc (.DELTA.5-elongase), (SEQ ID NO: 158) SEQ ID NO: 85 R: 5'- ctacatggcaccagtaac (SEQ ID NO: 159) TpELO2 F: 5'-accatgtgctcatcaccgccgtc (.DELTA.5-elongase), (SEQ ID NO: 160) SEQ ID NO: 59 R: 5'-ctacatggcaccagtaac (SEQ ID NO: 161) TpELO3 F: 5'-accatggacgcctacaacgctgc (.DELTA.6-elongase), (SEQ ID NO: 162) SEQ ID NO: 45 R: 5'- ctaagcactcttcttcttt (SEQ ID NO: 163) *F = forward primer, R = reverse primer
[0448] The PCR products were incubated for 30 minutes at 21.degree. C. with the yeast expression vector pYES2.1-TOPO (Invitrogen) following the manufacturer's instructions. The PCR product was ligated into the vector by means of a T-overhang and the activity of a topoisomerase (Invitrogen). After the incubation, E. coli DH5.alpha. cells were transformed. Suitable clones were identified by PCR, the plasmid DNA was isolated by means of the Qiagen DNAeasy kit and verified by sequencing. The correct sequence was then transformed into the Saccharomyces strain INVSc1 (Invitrogen) by electroporation (1500 V). As a control, the blank vector pYES2.1 was transformed in parallel. Thereafter, the yeasts were plated out on minimal dropout uracil medium supplemented with 2% glucose. Cells which were capable of growing in the medium without uracil thus comprise the corresponding plasmids pYES2.1, pYES2.1-TpELO1, pYES2.1-ELO2 and pYES2.1-TpELO3. After the selection, in each case two transformants were chosen for the further functional expression.
Example 21
Cloning Expression Plasmids for the Purposes of Seed-Specific Expression in Plants
[0449] To transform plants, a further transformation vector based on pSUN-USP is generated. To this end, NotI cleavage sites are introduced at the 5' and 3' ends of the coding sequence, using the following primer pair:
TABLE-US-00015 PSUN-TPELO1 (SEQ ID NO: 152) Forward: 5'-GCGGCCGCACCATGTGCTCACCACCGCCGTC (SEQ ID NO: 153) Reverse: 3'-GCGGCCGCCTACATGGCACCAGTAAC PSUN-TPELO2 (SEQ ID NO: 154) Forward: 5'-GCGGCCGCACCATGTGCTCATCACCGCCGTC (SEQ ID NO: 155) Reverse: 3'-GCGGCCGCCTACATGGCACCAGTAAC PSUN-TPELO3 (SEQ ID NO: 156) Forward: 5'-GCGGCCGCaccatggacgcctacaacgctgc (SEQ ID NO: 157) Reverse: 3'-GCGGCCGCCTAAGCACTCTTCTTCTTT
Composition of the PCR Mix (50 .mu.l):
[0450] 5.00 .mu.l template cDNA
[0451] 5.00 .mu.l 10.times. buffer (Advantage polymerase)+25 mM MgCl.sub.2
[0452] 5.00 .mu.l 2 mM dNTP
[0453] 1.25 .mu.l of each primer (10 .mu.mol/.mu.l)
[0454] 0.50 .mu.l Advantage polymerase
[0455] The Advantage polymerase from Clontech was employed.
PCR Reaction Conditions:
[0456] Annealing temperature: 1 minute at 55.degree. C.
[0457] Denaturation temperature: 1 minute at 94.degree. C.
[0458] Elongation temperature: 2 minutes at 72.degree. C.
[0459] Number of cycles: 35
[0460] The PCR products were incubated for 16 hours at 37.degree. C. with the restriction enzyme NotI. The plant expression vector pSUN300-USP was incubated in the same manner. Thereafter, the PCR products and the 7624 bp vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The DNA was purified by means of Qiagen gel purification kit following the manufacturer's instructions. Thereafter, vector and PCR products were ligated. The Rapid Ligation kit from Roche was used for this purpose. The resulting plasmids pSUN-TPELO1, pSUN-TPELO2 and pSUN-TPELO3 were verified by sequencing.
[0461] pSUN300 is a derivative of plasmid pPZP (Hajdukiewicz, P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25:989-994). pSUN-USP originated from pSUN300, by inserting a USP promoter as EcoRI fragment into pSUN300. The polyadenylation signal is that of the octopine synthase gene from the A. tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montagu, M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl. Genet. 1 (6), 499-511 (1982). The USP promoter corresponds to the nucleotides 1-684 (Genbank Accession X56240), where part of the noncoding region of the USP gene is present in the promoter. The promoter fragment which is 684 base pairs in size was amplified by means of commercially available T7 standard primers (Stratagene) and with the aid of a synthesized primer via a PCR reaction following standard methods.
TABLE-US-00016 (Primer sequence: 5'-GTCGACCCGCGGACTAGTGGGCCCTCTAG ACCCGGGGGA-TCCGGATCTGCTGGCTATGAA-3'; SEQ ID NO: 151).
[0462] The PCR fragment was cut again with EcoRI/SalI and introduced into the vector pSUN300 with OCS terminator. This gave rise to the plasmid with the name pSUN-USP. The construct was used for the transformation of Arabidopsis thaliana, oilseed rape, tobacco and linseed.
[0463] The lipid extraction from yeasts and seeds was carried out as described in Example 6
Example 22
Expression of TpELO1 (SEQ ID NO: 85), TpELO2 (SEQ ID NO: 59) and TpELO3 (SEQ ID NO: 45) in Yeasts
[0464] Yeasts which had been transformed with the plasmids pYES2, pYES2-TpELO1, pYES2-TpELO2 and pYES2-TpELO3 as described in Example 4 were analyzed as follows:
[0465] The yeast cells from the main cultures were harvested by centrifugation (100.times.g, 5 min, 20.degree. C.) and washed with 100 mM NaHCO.sub.3, pH 8.0 to remove residual medium and fatty acids. Starting with the yeast cell sediments, fatty acid methyl esters (FAMEs) were prepared by acid methanolysis. To this end, the cell sediments were incubated for 1 hour at 80.degree. C. together with 2 ml of 1 N methanolic sulfuric acid and 2% (v/v) of dimethoxypropane. The FAMEs were extracted twice with petroleum ether (PE). To remove nonderivatized fatty acids, the organic phases were washed in each case once with 2 ml of 100 mM NaHCO.sub.3, pH 8.0 and 2 ml of distilled water. Thereafter, the PE phases were dried with Na.sub.2SO.sub.4, evaporated under argon and taken up in 100 .mu.l of PE. The samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 .mu.m, Agilent) in a Hewlett-Packard 6850 gas chromatograph equipped with flame ionization detector. The conditions for the GLC analysis were as follows: the oven temperature was programmed from 50.degree. C. to 250.degree. C. with a rate of 5.degree. C./min and finally 10 min at 250.degree. C. (holding).
[0466] The signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma). The methodology is described for example in Napier and Michaelson, 2001, Lipids. 36(8):761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52(360):1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388(2):293-298 and Michaelson et al., 1998, FEBS Letters. 439(3):215-218.
Example 23
Functional Characterization of TpELO1 (SEQ ID NO: 85) and TPELO3 (SEQ ID NO: 45)
[0467] The substrate specificity of TpElo1 (SEQ ID NO: 85) was determined after expression and after feeding various fatty acids (FIG. 9). The substrates fed can be detected in large amounts in all of the transgenic yeasts. The transgenic yeasts revealed the synthesis of novel fatty acids, the products of the TpElo1 reaction. This means that the gene TpElo1 was expressed functionally.
[0468] Table 7 shows that TpElo1 (SEQ ID NO: 85) has a narrow degree of substrate specificity. TpElo1 (SEQ ID NO: 85) was only capable of elongating the C20-fatty acids eicosapentaenoic acid and arachidonic acid, but preferentially .omega.3-desaturated eicosapentaenoic acid.
[0469] The yeasts which had been transformed with the vector pYES2-TpELO1 were grown in minimal medium in the presence of the fatty acids stated. Then, the fatty acid methyl esters were synthesized by subjecting intact cells to acid methanolysis. Thereafter the FAMEs were analyzed by GLC.
TABLE-US-00017 TABLE 7 Expression of TpELO1 (SEQ ID NO: 85) in yeast. Columns 1 and 3 show the control reactions for columns 2 (fed 250 .mu.M 20:4 .DELTA.5,8,11,14) and 4 (fed 250 .mu.M 20:5 .DELTA.5,8,11,14,17). Expression Expression Expression Expression Fatty acids 1 2 3 4 16:0 18.8 17.8 25.4 25.2 16:1.sup..DELTA.9 28.0 29.8 36.6 36.6 18:0 5.2 5.0 6.8 6.9 18:1.sup..DELTA.9 25.5 23.6 24.6 23.9 20:4.sup..DELTA.5,8,11,14 22.5 23.4 -- -- 22:4.sup..DELTA.7,10,13,16 -- 0.4 -- -- 20:5.sup..DELTA.5,8,11,14,17 -- -- 6.6 6.5 22:5.sup..DELTA.7,10,13,16,19 -- -- -- 0.9 % conversion 0 1.7 0 12.2 rate
[0470] The substrate specificity of TpElo3 (SEQ ID NO: 45) was determined after expression and after feeding various fatty acids (FIG. 10). The substrates fed can be detected in large amounts in all of the transgenic yeasts. The transgenic yeasts revealed the synthesis of novel fatty acids, the products of the TpElo3 reaction. This means that the gene TpElo3 was expressed functionally.
[0471] Table 8 shows that TpElo3 (SEQ ID NO: 45) has narrow substrate specificity. TpElo3 (SEQ ID NO: 45) was only capable of elongating the C18-fatty acids .gamma.-linolenic acid and stearidonic acid, but preferred .omega.3-desaturated stearidonic acid.
[0472] The yeasts which had been transformed with the vector pYES2-TpELO3 were grown in minimal medium in the presence of the fatty acids stated. Then, the fatty acid methyl esters were synthesized by subjecting intact cells to acid methanolysis. Thereafter the FAMEs were analyzed by GLC.
TABLE-US-00018 TABLE 8 Expression von TpELO3 in yeast. Column 1 shows the fatty acid profile of yeast without feeding. Column 2 shows the control reaction. In columns 3 to 6, .gamma.-linolenic acid, stearidonic acid, arachidonic acid and eicosapentaenoic acid were fed (250 .mu.M of each fatty acid). Fatty acids 1 2 3 4 5 6 16:0 17.9 20.6 17.8 16.7 18.8 18.8 16:1.sup..DELTA.9 41.7 18.7 27.0 33.2 24.0 31.3 18:0 7.0 7.7 6.4 6.6 5.2 6.0 18:1.sup..DELTA.9 33.3 16.8 24.2 31.8 25.5 26.4 18:2.sup..DELTA.9, 12 -- 36.1 -- -- -- -- 18:3.sup..DELTA.6, 9, 12 -- -- 6.1 -- -- 18:4.sup..DELTA.6, 9, 12, 15 -- -- -- 1.7 -- 20:2.sup..DELTA.11, 14 -- 0 -- -- -- 20:3.sup..DELTA.8, 11, 14 -- -- 18.5 -- -- 20:4.sup..DELTA.8, 11, 14, 17 -- -- -- 10.0 -- 20:4.sup..DELTA.5, 8, 11, 14 -- -- -- -- 22.5 22:4.sup..DELTA.7, 10, 13, 16 -- -- -- -- 0 20:5.sup..DELTA.5, 8, 11, 14, 17 -- -- -- -- -- 17.4 22:5.sup..DELTA.7, 10, 13, 16, 19 -- -- -- -- -- 0 % conversion rate 0 0 75 85 0 0
Example 24
Cloning an Expression Plasmid for Heterologous Expression of Pi-omega3Des (SEQ ID NO: 87) in Yeasts
[0473] For heterologous expression in yeasts, the Pi-omega3Des clone (SEQ ID NO: 87) was cloned into the yeast expression vector pYES3 via PCR with suitable Pi-omega3Des-specific primers. Only the open reading frame, of the gene, which encoded the Pi-omega3Des protein was amplified; it was provided with two cleavage sites for cloning into the expression vector pYES3:
TABLE-US-00019 (SEQ ID NO: 149) Forward Primer: 5'-TAAGCTTACATGGCGACGAAGGAGG (SEQ ID NO: 150) Reverse Primer: 5'-TGGATCCACTTACGTGGACTTGGT
Composition of the PCR Mix (50 .mu.l):
[0474] 5.00 .mu.l template cDNA
[0475] 5.00 .mu.l 10.times. buffer (Advantage polymerase)+25 mM MgCl.sub.2
[0476] 5.00 .mu.l 2 mM dNTP
[0477] 1.25 .mu.l of each primer (10 pmol/.mu.l of the 5'-ATG and of the 3'-stop primer)
[0478] 0.50 .mu.l Advantage polymerase
[0479] The Advantage polymerase from Clontech was employed.
PCR Reaction Conditions:
[0480] Annealing temperature: 1 minute at 55.degree. C.
[0481] Denaturation temperature: 1 minute at 94.degree. C.
[0482] Elongation temperature: 2 minutes at 72.degree. C.
[0483] Number of cycles: 35
[0484] The PCR product was incubated for 2 hours at 37.degree. C. with the restriction enzymes HindIII and BamHI. The yeast expression vector pYES3 (Invitrogen) was incubated in the same manner. Thereafter, the 1104 bp PCR product and the vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The DNA was purified by means of Qiagen gel purification kit following the manufacturer's instructions. Thereafter, vector and desaturase cDNA were ligated. The Rapid Ligation kit from Roche was used for this purpose. The resulting plasmid pYES3-Pi-omega3Des were verified by sequencing and transformed into the Saccharomyces strain INVSc1 (Invitrogen) by electroporation (1500 V). As a control, pYES3 was transformed in parallel. Thereafter, the yeasts were plated onto minimal dropout tryptophan medium supplemented with 2% glucose. Cells which were capable of growth without tryptophan in the medium thus comprised the corresponding plasmids pYES3, pYES3-Pi-omega3Des. After the selection, in each case two transformants were chosen for the further functional expression.
Example 25
Cloning Expression Plasmids for the Purposes of Seed-Specific Expression in Plants
[0485] To transform plants, a further transformation vector based on pSUN-USP was generated.
[0486] To this end, NotI cleavage sites were introduced at the 5' and 3' ends of the coding sequence, using the following primer pair:
TABLE-US-00020 PSUN-Pi-omega3Des (SEQ ID NO: 147) Reverse: 3'-GCGGCCGCTTACGTGGACTTGGTC (SEQ ID NO: 148) Forward: 5'-GCGGCCGCatGGCGACGAAGGAGG
Composition of the PCR Mix (50 .mu.l):
[0487] 5.00 .mu.l template cDNA
[0488] 5.00 .mu.l 10.times. buffer (Advantage polymerase)+25 mM MgCl.sub.2
[0489] 5.00 .mu.l 2 mM dNTP
[0490] 1.25 .mu.l of each primer (10 .mu.mol/.mu.l)
[0491] 0.50 .mu.l Advantage polymerase
[0492] The Advantage polymerase from Clontech was employed.
PCR Reaction Conditions:
[0493] Annealing temperature: 1 minute at 55.degree. C.
[0494] Denaturation temperature: 1 minute at 94.degree. C.
[0495] Elongation temperature: 2 minutes at 72.degree. C.
[0496] Number of cycles: 35
[0497] The PCR products were incubated for 4 hours at 37.degree. C. with the restriction enzyme NotI. The plant expression vector pSUN300-USP was incubated in the same manner. Thereafter, the PCR products and the 7624 bp vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The DNA was purified by means of Qiagen gel purification kit following the manufacturer's instructions. Thereafter, vector and PCR products were ligated. The Rapid Ligation kit from Roche was used for this purpose. The resulting plasmid pSUN-Piomega3Des was verified by sequencing.
Example 26
Expression of Pi-omega3Des (SEQ ID NO: 87) in Yeasts
[0498] Yeasts which had been transformed with the plasmid pYES3 or pYES3-Pi-omega3Des as described in Example 24 were analyzed as follows:
[0499] The yeast cells from the main cultures were harvested by centrifugation (100.times.g, 5 min, 20.degree. C.) and washed with 100 mM NaHCO.sub.3, pH 8.0 to remove residual medium and fatty acids. Fatty acid methyl esters (FAMEs) were prepared from the yeast cell sediments by acid methanolysis. To this end, the cell sediments were incubated with 2 ml of 1N methanolic sulfuric acid and 2% (v/v) dimethoxypropane for 1 hour at 80.degree. C. The FAMEs were extracted by extracting twice with petroleum ether (PE). To remove underivatized fatty acids, the organic phases were washed in each case once with 2 ml of 100 mM NaHCO.sub.3, pH 8.0 and 2 ml of distilled water. Thereafter, the PE phases were dried with Na.sub.2SO.sub.4, evaporated under argon and taken up in 100 .mu.l of PE. The samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 .mu.m, Agilent) in a Hewlett-Packard 6850 gas chromatograph equipped with flame ionization detector. The conditions for the GLC analysis were as follows: the oven temperature was programmed from 50.degree. C. to 250.degree. C. with a rate of 5.degree. C./min and finally 10 minutes at 250.degree. C. (holding).
[0500] The signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma). The methodology is described for example in Napier and Michaelson, 2001, Lipids. 36(8):761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52(360):1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388(2):293-298 and Michaelson et al., 1998, FEBS Letters. 439(3):215-218.
Example 27
Functional Characterization of Pi-omega3Des (SEQ ID NO: 87)
[0501] The substrate specificity of Pi-omega3Des (SEQ ID NO: 87) was determined after expression and after feeding various fatty acids (FIGS. 12 to 18). The substrates fed can be detected in large amounts in all of the transgenic yeasts, proving the uptake of these fatty acids into the yeasts. The transgenic yeasts revealed the synthesis of novel fatty acids, the products of the Pi-omega3Des reaction. This means that the gene Pi-omega3Des was expressed functionally
[0502] FIG. 12 shows the desaturation of linoleic acid (18:2 .omega.-6-fatty acid) to .alpha.-linolenic acid (18:3 .omega.-3-fatty acid) by Pi-omega3Des (SEQ ID NO: 87). The fatty acid methyl esters were synthesized by subjecting intact cells which had been transformed with the blank vector pYES2 (FIG. 12 A) or the vector pYes3-Pi-omega3Des (FIG. 12 B) to acid methanolysis. The yeasts were grown in minimal medium in the presence of C18:2.sup..DELTA.9,12-fatty acid (300 .mu.M). Thereafter, the FAMEs were analyzed via GLC.
[0503] FIG. 13 shows the desaturation of .gamma.-linolenic acid (18:3 .omega.-6-fatty acid) to stearidonic acid (18:4 .omega.-3-fatty acid) by Pi-omega3Des (SEQ ID NO: 87).
[0504] The fatty acid methyl esters were synthesized by subjecting intact cells which had been transformed with the blank vector pYES2 (FIG. 13 A) or the vector pYes3-Pi-omega3Des (FIG. 13 B) to acid methanolysis. The yeasts were grown in minimal medium in the presence of .gamma.-C18:3.sup..DELTA.6,9,12-fatty acid (300 .mu.M). Thereafter, the FAMEs were analyzed via GLC.
[0505] FIG. 14 shows the desaturation of C20:2-.omega.-6-fatty acid to C20:3-.omega.-3-fatty acid by Pi-omega3Des (SEQ ID NO: 87). The fatty acid methyl esters were synthesized by subjecting intact cells which had been transformed with the blank vector pYES2 (FIG. 14 A) or the vector pYes3-Pi-omega3Des (FIG. 14 B) to acid methanolysis. The yeasts were grown in minimal medium in the presence of C20:2.sup..DELTA.11,14-fatty acid (300 .mu.M). Thereafter, the FAMEs were analyzed via GLC.
[0506] FIG. 15 shows the desaturation of C20:3-.omega.-6-fatty acid to C20:4-.omega.-3-fatty acid by Pi-omega3Des (SEQ ID NO: 87). The fatty acid methyl esters were synthesized by subjecting intact cells which had been transformed with the blank vector pYES2 (FIG. 15 A) or the vector pYes3-Pi-omega3Des (FIG. 15 B) to acid methanolysis. The yeasts were grown in minimal medium in the presence of C20:3.sup..DELTA.8,11,14-fatty acid (300 .mu.M). Thereafter, the FAMEs were analyzed via GLC.
[0507] FIG. 16 shows the desaturation of arachidonic acid (C20:4-.omega.-6-fatty acid) to eicosapentaenoic acid (C20:5-.omega.-3-fatty acid) by Pi-omega3Des (SEQ ID NO: 87).
[0508] The fatty acid methyl esters were synthesized by subjecting intact cells which had been transformed with the blank vector pYES2 (FIG. 16 A) or the vector pYes3-Pi-omega3Des (FIG. 16 B) to acid methanolysis. The yeasts were grown in minimal medium in the presence of C20:4.sup..DELTA.5,8,11,14-fatty acid (300 .mu.M). Thereafter, the FAMEs were analyzed via GLC.
[0509] FIG. 17 shows the desaturation of docosatetraenoic acid (C22:4-.omega.-6-fatty acid) to docosapentaenoic acid (C22:5-.omega.-3-fatty acid) by Pi-omega3Des (SEQ ID NO: 87). The fatty acid methyl esters were synthesized by subjecting intact cells which had been transformed with the blank vector pYES2 (FIG. 17 A) or the vector pYes3-Pi-omega3Des (FIG. 17 B) to acid methanolysis. The yeasts were grown in minimal medium in the presence of C22:4.sup..DELTA.7,10,13,16-fatty acid (300 .mu.M). Thereafter, the FAMEs were analyzed via GLC.
[0510] The substrate specificity of Pi-omega3Des (SEQ ID NO: 87) toward various fatty acids can be seen from FIG. 18. The yeasts which had been transformed with the vector pYes3-Pi-omega3Des were grown in minimal medium in the presence of the fatty acids stated. The fatty acid methyl esters were synthesized by subjecting intact cells to acid methanolysis. Thereafter, the FAMEs were analyzed via GLC. Each value represents a mean of three measurements. The conversion rates (% desaturation) were calculated using the formula: [product]/[product]+[substrate]*100.
[0511] As described in Example 9, Pi-omega3Des (SEQ ID NO: 87) can also be used for generating transgenic plants. The lipids can then be extracted from the seeds of these plants as described in Example 6.
Example 28
Cloning Desaturase Genes from Ostreococcus tauri
[0512] The search for conserved regions in the protein sequences with the aid of conserved motifs (His boxes, Domergue et al. 2002, Eur. J. Biochem. 269, 4105-4113) allowed the identification of five sequences with corresponding motifs in an Ostreococcus tauri sequence database (genomic sequences). The sequences are the following:
TABLE-US-00021 Name of gene SEQ ID Amino acids Homology OtD4 SEQ ID NO: 95 536 .DELTA.4-desaturase OtD5.1 SEQ ID NO: 91 201 .DELTA.5-desaturase OtD5.2 SEQ ID NO: 93 237 .DELTA.5-desaturase OtD6.1 SEQ ID NO: 89 457 .DELTA.6-desaturase OtFad2 SEQ ID NO: 107 361 .DELTA.12-desaturase
[0513] The alignments for finding homologies of the individual genes were carried out using the tBLASTn algorithm (Altschul et al., J. Mol. Biol. 1990, 215: 403-410).
Cloning was Carried Out as Follows:
[0514] 40 ml of an Ostreococcus tauri culture in the stationary phase were spun down and the pellet was resuspended in 100 .mu.l of double-distilled water and stored at -20.degree. C. The relevant genomic DNAs were amplified based on the PCR method. The corresponding primer pairs were selected in such a way that they contained the yeast consensus sequence for highly efficient translation (Kozak, Cell 1986, 44:283-292) next to the start codon. The amplification of the OtDes-DNAs was carried out using in each case 1 .mu.l of defrosted cells, 200 .mu.M dNTPs, 2.5 U Taq polymerase and 100 pmol of each primer in a total volume of 50 .mu.l. The conditions for the PCR were as follows: first denaturation at 95.degree. C. for 5 minutes, followed by 30 cycles at 94.degree. C. for 30 seconds, 55.degree. C. for 1 minute and 72.degree. C. for 2 minutes, and a final elongation step at 72.degree. C. for 10 minutes.
[0515] The following primers were employed for the PCR:
TABLE-US-00022 OtDes6.1 Forward: (SEQ ID NO: 145) 5'ggtaccacataatgtgcgtggagacggaaaataacg3' OtDes6.1 Reverse: (SEQ ID NO: 146) 5'ctcgagttacgccgtctttccggagtgttggcc3'
Example 29
Cloning of Expression Plasmids for Heterologous Expression in Yeasts
[0516] To characterize the function of the desaturase OtDes6.1 (=.DELTA.6-desaturase; SEQ ID NO: 89) from Ostreococcus tauri, the open reading frame of the DNA upstream of the galactose-inducible GAL1 promoter of pYES2.1/V5-His-TOPO (Invitrogen) was cloned, giving rise to the corresponding pYES2.1-OtDes6.1 clone. In a similar manner, further Ostreococcus desaturase genes can be cloned.
[0517] The Saccharomyces cerevisiae strain 334 was transformed with the vector pYES2.1-OtDes6.1 by electroporation (1500 V). A yeast which was transformed with the blank vector pYES2 was used as control. The transformed yeasts were selected on complete minimal dropout uracil medium (CMdum) agar plates supplemented with 2% glucose. After the selection, in each case three transformants were selected for the further functional expression.
[0518] To express the OtDes6.1 desaturase (SEQ ID NO: 89), precultures consisting of in each case 5 ml of CMdum dropout uracil liquid medium supplemented with 2% (w/v) raffinose were initially inoculated with the selected transformants and incubated for 2 days at 30.degree. C. and 200 rpm. Then, 5 ml of CMdum (dropout uracil) liquid medium supplemented with 2% of raffinose and 300 .mu.M various fatty acids were inoculated with the precultures to an OD.sub.600 of 0.05. Expression was induced by the addition of 2% (w/v) of galactose. The cultures were incubated for a further 96 hours at 20.degree. C.
Example 30
Cloning of Expression Plasmids for the Seed-Specific Expression in Plants
[0519] A further transformation vector based on pSUN-USP is generated for the transformation of plants. To this end, NotI cleavage sites are introduced at the 5' and 3' ends of the coding sequences, using PCR. The corresponding primer sequences are derived from the 5' and 3 regions of the desaturases.
Composition of the PCR Mix (50 .mu.l):
[0520] 5.00 .mu.l template cDNA
[0521] 5.00 .mu.l 10.times. buffer (Advantage polymerase)+25 mM MgCl.sub.2
[0522] 5.00 .mu.l 2 mM dNTP
[0523] 1.25 .mu.l of each primer (10 .mu.mol/.mu.l)
[0524] 0.50 .mu.l Advantage polymerase
[0525] The Advantage polymerase from Clontech was employed.
PCR Reaction Conditions:
[0526] Annealing temperature: 1 min 55.degree. C.
[0527] Denaturation temperature: 1 min 94.degree. C.
[0528] Elongation temperature: 2 min 72.degree. C.
[0529] Number of cycles: 35
[0530] The PCR products were incubated with the restriction enzyme NotI for 16 hours at 37.degree. C. The plant expression vector pSUN300-USP was incubated in the same manner. Thereafter, the PCR products and the vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The DNA was purified by means of the Qiagen Gel Purification Kit following the manufacturer's instructions. Thereafter, vector and PCR products were ligated. The Rapid Ligation Kit from Roche was used for this purpose. The resulting plasmids were verified by sequencing.
[0531] pSUN300 is a derivative of plasmid pPZP (Hajdukiewicz, P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25:989-994). pSUN-USP originated from pSUN300, by inserting a USP promoter into pSUN300 in the form of an EcoRI fragment. The polyadenylation signal is that of the Ostreococcus gene from the A. tumefaciens Ti plasmid (ocs-Terminator, Genbank Accession V00088) (De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montagu, M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl. Genet. 1 (6), 499-511 (1982)). The USP promoter corresponds to nucleotides 1 to 684 (Genbank Accession X56240), where part of the noncoding region of the USP gene is present in the promoter. The promoter fragment which is 684 base pairs in size was amplified by a PCR reaction and standard methods with the aid of a synthesized primer and by means of a commercially available T7 standard primer (Stratagene). (Primer sequence: 5'-GTCGACCCGCGGACTAGTGGGCCCTCTAGACCCGGGGGATCC GGATCTGCTGGCTATGAA-3', SEQ ID NO: 144).
[0532] The PCR fragment was recut with EcoRI/SalI and inserted into the vector pSUN300 with OCS terminator. This gave rise to the plasmid with the name pSUN-USP. The construct was used for the transformation of Arabidopsis thaliana, oilseed rape, tobacco and linseed.
Example 31
Expression of OtDes6.1 (SEQ ID NO: 89) in Yeasts
[0533] Yeasts which had been transformed with the plasmids pYES2 and pYES2-OtDes6.1 as described in Example 4 were analyzed as follows:
[0534] The yeast cells from the main cultures were harvested by centrifugation (100.times.g, 5 min, 20.degree. C.) and washed with 100 mM NaHCO.sub.3, pH 8.0 to remove residual medium and fatty acids. Starting with the yeast cell sediments, fatty acid methyl esters (FAMEs) were prepared by acid methanolysis. To this end, the cell sediments were incubated for one hour at 80.degree. C. together with 2 ml of 1 N methanolic sulfuric acid and 2% (v/v) of dimethoxypropane. The FAMEs were extracted twice with petroleum ether (PE). To remove nonderivatized fatty acids, the organic phases were washed in each case once with 2 ml of 100 mM NaHCO.sub.3, pH 8.0 and 2 ml of distilled water. Thereafter, the PE phases were dried with Na.sub.2SO.sub.4, evaporated under argon and taken up in 100 .mu.l of PE. The samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 .mu.m, Agilent) in a Hewlett-Packard 6850 gas chromatograph equipped with flame ionization detector. The conditions for the GLC analysis were as follows: the oven temperature was programmed from 50.degree. C. to 250.degree. C. with a rate of 5.degree. C./min and finally 10 min at 250.degree. C. (holding).
[0535] The signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma). The methodology is described for example in Napier and Michaelson, 2001, Lipids. 36(8):761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52(360):1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388(2):293-298 and Michaelson et al., 1998, FEBS Letters. 439(3):215-218.
Example 32
Functional Characterization of Ostreococcus Desaturases
[0536] The substrate specificity of desaturases can be determined after expression in yeast (see Examples cloning of desaturase genes, yeast expression) by feeding, using various yeasts. Descriptions for the determination of the individual activities can be found in WO 93/11245 for .DELTA.15-desaturases, WO 94/11516 for .DELTA.12-desaturases, WO 93/06712, U.S. Pat. No. 5,614,393, U.S. Pat. No. 5,614,393, WO 96/21022, WO 0021557 and WO 99/27111 for .DELTA.6-desaturases, Qiu et al. 2001, J. Biol. Chem. 276, 31561-31566 for .DELTA.4-desaturases, Hong et al. 2002, Lipids 37, 863-868 for .DELTA.5-desaturases.
[0537] Table 9 shows the substrate specificity of the desaturase OtDes6.1 (SEQ ID NO: 89) with regard to various fatty acids. The substrate specificity of OtDes6.1 (SEQ ID NO: 89) was determined after expression and after feeding various fatty acids. The substrates fed can be detected in large amounts in all of the transgenic yeasts. The transgenic yeasts revealed the synthesis of novel fatty acids, the products of the OtDes6.1 reaction (FIG. 20). This means that the gene OtDes6.1 was expressed functionally.
[0538] The yeasts which had been transformed with the vector pYES2-OtDes6.1 were grown in minimal medium in the presence of the stated fatty acids. The fatty acid methyl esters were synthesized by subjecting intact cells to acid methanolysis. Thereafter, the FAMEs were analyzed via GLC. Each value represents the mean (n=3).+-.standard deviation. The activity corresponds to the conversion rate calculated using the formula [substrate/(substrate+product)*100].
[0539] Table 9 shows that OtDes6.1 (SEQ ID NO: 89) has substrate specificity for linoleic and linolenic acid (18:2 and 18:3), since these fatty acids result in the highest activities. In contrast, the activity for oleic acid (18:1) and palmitoleic acid (16:1) is markedly less pronounced. The preferred conversion of linoleic and linolenic acid demonstrates the suitability of this desaturase for the production of polyunsaturated fatty acids.
TABLE-US-00023 Substrates Activity in % 16:1.sup..DELTA.9 5.6 18:1.sup..DELTA.9 13.1 18:2.sup..DELTA.9,12 68.7 18:3.sup..DELTA.9,12,15 64.6
[0540] FIG. 20 shows the conversion of linoleic acid by OtDes6.1 (SEC) ID NO: 89). The FAMEs were analyzed via gas chromatography. The substrate fed (C18:2) is converted into .gamma.-C18:3. Both starting material and product formed are indicated by arrows.
[0541] FIG. 21 shows the conversion of linoleic acid (=LA) and .alpha.-linolenic acid (=ALA) in the presence of OtDes6.1 (SEC) ID NO: 89) to give .gamma.-linolenic acid (=GLA) and stearidonic acid (=STA), respectively (FIGS. 21 A and C). Furthermore, FIG. 21 shows the conversion of linoleic acid (=LA) and .alpha.-linolenic acid (=ALA) in the presence of the .DELTA.6-desaturase OtDes6.1 (SEC) ID NO: 89) together with the .DELTA.6-elongase PSE1 from Physcomitrella patens (Zank et al. 2002, Plant J. 31:255-268) and the .DELTA.5-desaturase PtD5 from Phaeodactylum tricornutum (Domergue et al. 2002, Eur. J. Biochem. 269, 4105-4113) to give dihomo-.gamma.-linolenic acid (=DHGLA) and arachidonic acid (=ARA, FIG. 21 B) and to give dihomostearidonic acid (=DHSTA) and eicosapentaenoic acid (=EPA, FIG. 21 D), respectively. FIG. 21 shows clearly that the reaction products GLA and STA of the .DELTA.6-desaturase OtDes6.1 (SEC) ID NO: 89) in the presence of the .DELTA.6-elongase PSE1 are elongated almost quantitatively to give DHGLA and DHSTA, respectively. The subsequent desaturation by the .DELTA.5-desaturase PtD5 to give ARA and EPA, respectively, is also problem-free. Approximately 25-30% of the elongase product is desaturated (FIGS. 21 B and D).
TABLE-US-00024 TABLE 10 hereinbelow gives an overview of Ostreococcus desaturases which have been cloned: Ostreococcus tauri desaturases Name bp aa Homology Cyt. B5 His box1 His box2 His box3 OtD4 1611 536 .DELTA.4-desaturase HPGG HCANH WRYHHQVSHH QVEHHLFP OtD5.1 606 201 .DELTA.5-desaturase -- -- -- QVVHHLFP OtD5.2 714 237 .DELTA.5-desaturase -- -- WRYHHMVSHH QIEHHLPF OtD6.1 1443 480 .DELTA.6-desaturase HPGG HEGGH WNSMHNKHH QVIHHLFP OtFAD2 1086 361 .DELTA.12-desaturase -- HECGH WQRSHAVHH HVAHH
Example 33
Cloning of Desaturase Genes from Thalassiosira pseudonana
[0542] The search for conserved regions in the protein sequences with the aid of conserved motifs (His boxes, see motifs) allowed the identification of six sequences with corresponding motifs in a Thalassiosira pseudonana sequence database (genomic sequences). The sequences are the following:
TABLE-US-00025 Name of gene SEQ ID Amino acids Homology TpD4 SEQ ID NO: 103 503 .DELTA.-4-desaturase TpD5-1 SEQ ID NO: 99 476 .DELTA.-5-desaturase TpD5-2 SEQ ID NO: 101 482 .DELTA.-5-desaturase TpD6 SEQ ID NO: 97 484 .DELTA.-6-desaturase TpFAD2 SEQ ID NO: 109 434 .DELTA.-12-desaturase TpO3 SEQ ID NO: 105 418 .omega.-3-desaturase
Cloning was Carried Out as Follows:
[0543] 40 ml of a Thalassiosira pseudonana culture in the stationary phase were spun down and the pellet was resuspended in 100 .mu.l of double-distilled water and stored at -20.degree. C. The relevant genomic DNAs were amplified based on the PCR method. The corresponding primer pairs were selected in such a way that they contained the yeast consensus sequence for highly efficient translation (Kozak, Cell 1986, 44:283-292) next to the start codon. The amplification of the TpDes-DNAs was carried out using in each case 1 .mu.l of defrosted cells, 200 .mu.M dNTPs, 2.5 U Taq polymerase and 100 pmol of each primer in a total volume of 50 .mu.l. The conditions for the PCR were as follows: first denaturation at 95.degree. C. for 5 minutes, followed by 30 cycles at 94.degree. C. for 30 seconds, 55.degree. C. for 1 minute and 72.degree. C. for 2 minutes, and a final elongation step at 72.degree. C. for 10 minutes.
Example 34
Cloning of Expression Plasmids for the Heterologous Expression in Yeasts
[0544] To characterize the function of the Thalassiosira pseudonana desaturases, the open reading frame of the DNA in question is cloned downstream of the galactose-inducible GAL1 promoter of pYES2.1/V5-His-TOPO (Invitrogen), giving rise to the corresponding pYES2.1 clones.
[0545] The Saccharomyces cerevisiae strain 334 is transformed with the vectors pYES2.1-TpDesaturasen by electroporation (1500 V). A yeast which is transformed with the blank vector pYES2 is used for control purposes. The transformed yeasts are selected on complete minimal medium (CMdum) agar plates supplemented with 2% glucose, but lacking uracil. After the selection, in each case three transformants are chosen for the further functional expression.
[0546] To express the Tp desaturases, precultures of in each case 5 ml CMdum liquid medium supplemented with 2% (w/v) raffinose, but lacking uracil, are first inoculated with the transformants chosen and incubated for 2 days at 30.degree. C., 200 rpm.
[0547] Then, 5 ml of CMdum liquid medium (without uracil) supplemented with 2% of raffinose and 300 .mu.M of various fatty acids are inoculated with the precultures OD.sub.600 of 0.05. Expression is induced by addition of 2% (w/v) galactose. The cultures are incubated for a further 96 h at 20.degree. C.
Example 35
Cloning of Expression Plasmids for the Seed-Specific Expression in Plants
[0548] A further transformation vector based on pSUN-USP is generated for the transformation of plants. To this end, NotI cleavage sites are introduced at the 5' and 3' ends of the coding sequences, using PCR. The corresponding primer sequences are derived from the 5' and 3 regions of the desaturases.
Composition of the PCR Mix (50 .mu.l):
[0549] 5.00 .mu.l template cDNA
[0550] 5.00 .mu.l 10.times. buffer (Advantage polymerase)+25 mM MgCl.sub.2
[0551] 5.00 .mu.l 2 mM dNTP
[0552] 1.25 .mu.l of each primer (10 .mu.mol/.mu.l)
[0553] 0.50 .mu.l Advantage polymerase
[0554] The Advantage polymerase from Clontech was employed.
PCR Reaction Conditions:
[0555] Annealing temperature: 1 min 55.degree. C.
[0556] Denaturation temperature: 1 min 94.degree. C.
[0557] Elongation temperature: 2 min 72.degree. C.
[0558] Number of cycles: 35
[0559] The PCR products were incubated with the restriction enzyme NotI for 16 hours at 37.degree. C. The plant expression vector pSUN300-USP was incubated in the same manner. Thereafter, the PCR products and the vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The DNA was purified by means of the Qiagen Gel Purification Kit following the manufacturer's instructions. Thereafter, vector and PCR products were ligated. The Rapid Ligation Kit from Roche was used for this purpose. The resulting plasmids were verified by sequencing.
[0560] pSUN300 is a derivative of plasmid pPZP (Hajdukiewicz, P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25:989-994). pSUN-USP originated from pSUN300, by inserting a USP promoter into pSUN300 in the form of an EcoRI fragment. The polyadenylation signal is the OCS gene from the A. tumefaciens Ti plasmid (ocs-Terminator, Genbank Accession V00088) (De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montagu, M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl. Genet. 1 (6), 499-511 (1982)). The USP promoter corresponds to nucleotides 1 to 684 (Genbank Accession X56240), where part of the noncoding region of the USP gene is present in the promoter. The promoter fragment which is 684 base pairs in size was amplified by a PCR reaction and standard methods with the aid of a synthesized primer and by means of a commercially available T7 standard primer (Stratagene). (Primer sequence: 5'-GTCGACCCGCGGACTAGTGGGCCCTCTAGACCCGGGGGATCC GGATCTGCTGGCTATGAA-3'; SEQ ID NO: 143).
[0561] The PCR fragment was recut with EcoRI/SalI and inserted into the vector pSUN300 with OCS terminator. This gave rise to the plasmid with the name pSUN-USP. The construct was used for the transformation of Arabidopsis thaliana, oilseed rape, tobacco and linseed.
Example 36
Expression of Tp Desaturases in Yeasts
[0562] Yeasts which had been transformed with the plasmids pYES2 and pYES2-Tp desaturases as described in Example 4 were analyzed as follows:
[0563] The yeast cells from the main cultures were harvested by centrifugation (100.times.g, 5 min, 20.degree. C.) and washed with 100 mM NaHCO.sub.3, pH 8.0 to remove residual medium and fatty acids. Starting with the yeast cell sediments, fatty acid methyl esters (FAMEs) were prepared by acid methanolysis. To this end, the cell sediments were incubated for one hour at 80.degree. C. together with 2 ml of 1 N methanolic sulfuric acid and 2% (v/v) of dimethoxypropane. The FAMEs were extracted twice with petroleum ether (PE). To remove nonderivatized fatty acids, the organic phases were washed in each case once with 2 ml of 100 mM NaHCO.sub.3, pH 8.0 and 2 ml of distilled water. Thereafter, the PE phases were dried with Na.sub.2SO.sub.4, evaporated under argon and taken up in 100 .mu.l of PE. The samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 .mu.m, Agilent) in a Hewlett-Packard 6850 gas chromatograph equipped with flame ionization detector. The conditions for the GLC analysis were as follows: the oven temperature was programmed from 50.degree. C. to 250.degree. C. with a rate of 5.degree. C./min and finally 10 min at 250.degree. C. (holding).
[0564] The signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma). The methodology is described for example in Napier and Michaelson, 2001, Lipids. 36(8):761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52(360):1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388(2):293-298 and Michaelson et al., 1998, FEBS Letters. 439(3):215-218.
Example 37
Functional Characterization of Thalassiosira pseudonana Desaturases
[0565] The substrate specificity of desaturases can be determined after expression in yeast (see Examples cloning of desaturase genes, yeast expression) by feeding, using various yeasts. Descriptions for the determination of the individual activities can be found in WO 93/11245 for .DELTA.15-desaturases, WO 94/11516 for .DELTA.12-desaturases, WO 93/06712, U.S. Pat. No. 5,614,393, U.S. Pat. No. 5,614,393, WO 96/21022, WO 0021557 and WO 99/27111 for .DELTA.6-desaturases, Qiu et al. 2001, J. Biol. Chem. 276, 31561-31566 for .DELTA.4-desaturases, Hong et al. 2002, Lipids 37, 863-868 for .DELTA.5-desaturases.
[0566] The activity of the individual desaturases is calculated from the conversion rate using the formula [substrate/(substrate+product)*100].
[0567] Tables 11 and 12 which follow give an overview over the cloned Thalassiosira pseudonana desaturases
TABLE-US-00026 TABLE 11 Length and characteristics of the cloned Thalassiosira desaturases. Desaturase cDNA (bp) Protein (aa) Cyt. B5 His box1 His box2 His box3 TpD4 1512 503 HPGG HDGNH WELQHMLGHH QIEHHLFP TpD5-1 1431 476 HPGG HDANH WMAQHWTHH QVEHHLFP TpD5-2 1443 482 HPGG HDANH WLAQHWTHH QVEHHLFP TpD6 1449 484 HPGG HDFLH WKNKHNGHH QVDHHLFP TpFAD2 1305 434 -- HECGH HAKHH HVAHHLFH (d12) TpO3 1257 419 -- HDAGH WLFMVTYLQHH HVVHHLF
TABLE-US-00027 TABLE 12 Length, exons, homology and identities of the cloned desaturases. GDNA Des. (bp) Exon 1 Exon 2 First Blast Hit Hom./Iden. TpD4 2633 496-1314 1571-2260 Thrautochitrium D4-des 56%/43% TpD5-1 2630 490-800 900-2019 Phaeodactylum D5-des 74%/62% TpD5-2 2643 532-765 854-2068 Phaeodactylum D5-des 72%/61% TpD6 2371 379-480 630-1982 Phaeodactylum D6-des 83%/69% TpFAD2 2667 728-2032 -- Phaeodactylum FAD2 76%/61% TpO3 2402 403-988 1073-1743 Chaenorhabdidis Fad2 49%/28%
[0568] The .DELTA.12-desaturase genes from Ostreococcus and Thalassiosira can also be cloned in analogy to the abovementioned examples.
Example 38
Cloning of Elongase Genes from Xenopus laevis and Ciona intestinalis
[0569] By searching for conserved regions (see consensus sequences, SEQ ID NO: 115 and SEQ ID NO: 116) in the protein sequences of the gene databases (Genbank) with the aid of the elongase genes with .DELTA.5-elongase activity or .DELTA.6-elongase activity which are detailed in the present application, it was possible to identify and isolate further elongase sequences from other organisms. Using suitable motifs, it was possible to identify further sequences from in each case X. laevis and C. intestinalis, respectively. The sequences were the following:
TABLE-US-00028 Name of gene Organism Genbank No. SEQ ID NO: Amino acids ELO(XI) Xenopus BC044967 117 303 laevis ELO(Ci) Ciona AK112719 119 290 intestinalis
[0570] The X. laevis cDNA clone was obtained from the NIH (National Institute of Health) [Genetic and genomic tools for Xenopus research: The NIH Xenopus initiative, Dev. Dyn. 225 (4), 384-391 (2002)].
[0571] The C. intestinalis cDNA clone was obtained from the University of Kyoto [Satou, Y., Yamada, L., Mochizuki, Y., Takatori, N., Kawashima, T., Sasaki, A., Hamaguchi, M., Awazu, S., Yagi, K., Sasakura, Y., Nakayama, A., Ishikawa, H., Inaba, K. and Satoh, N. "A cDNA resource from the basal chordate Ciona intestinalis" JOURNAL Genesis 33 (4), 153-154 (2002)].
Example 39
Cloning of Expression Plasmids for the Heterologous Expression in Yeasts
[0572] The elongase DNAs were amplified with in each case 1 .mu.l cDNA, 200 .mu.M dNTPs, 2,5 U Advantage polymerase and 100 pmol of each primer in a total volume of 50 .mu.l. The PCR conditions were as follows: first denaturation at 95.degree. C. for 5 minutes, followed by 30 cycles at 94.degree. C. for 30 seconds, 55.degree. C. for 1 minute and 72.degree. C. for 2 minutes, and a last elongation step at 72.degree. C. for 10 minutes.
[0573] The following oligonucleotides were used for the PCR reaction for cloning the sequence for the heterologous expression in yeasts:
TABLE-US-00029 Name of gene, and SEQ ID NO: Primer sequence ELO(XI) F: 5'- AGGATCCATGGCCTTCAAGGAGCTCA SEQ ID NO: 121 CATC SEQ ID NO: 122 R: 5'- CCTCGAGTCAATGGTTTTTGCTTTTC AATGCACCG ELO(Ci), F: 5'- TAAGCTTATGGACGTACTTCATCGT SEQ ID NO: 123 SEQ ID NO: 124 R: 5'- TCAGATCTTTAATCGGTTTTACCATT *F = forward primer, R = reverse primer
[0574] The PCR products were incubated for 30 minutes at 21.degree. C. with the yeast expression vector pYES2.1-TOPO (Invitrogen) following the manufacturer's instructions. The PCR product was ligated into the vector by means of a T-overhang and the activity of a topoisomerase (Invitrogen). After the incubation, E. coli DH5.alpha. cells are transformed. Suitable clones were identified by PCR, the plasmid DNA was isolated by means of the Qiagen DNAeasy kit and verified by sequencing. The correct sequence was then transformed into the Saccharomyces strain INVSc1 (Invitrogen) by electroporation (1500 V). As a control, the blank vector pYES2.1 was transformed in parallel. Thereafter, the yeasts were plated of minimal dropout uracil medium supplemented with 2% glucose. Cells which were capable of growing in the medium without uracil thus comprise the corresponding plasmids pYES2.1, pYES2.1-ELO(XI) and pYES2.1-ELO(Ci). After the selection, in each case two transformants were chosen for the further functional expression.
Example 40
Cloning Expression Plasmids for the Purposes of Seed-Specific Expression in Plants
[0575] To transform plants, a further transformation vector based on pSUN-USP was generated. To this end, NotI cleavage sites were introduced at the 5' and 3' ends of the coding sequence, using the following primer pair:
TABLE-US-00030 pSUN-ELO(XI) (SEQ ID NO: 125) Forward: 5'-GCGGCCGCACCATGGCCTTCAAGGAGCTCACATC (SEQ ID NO: 126) Reverse: 3'-GCGGCCGCCTTCAATGGTTTTTGCTTTTCAATGCACCG pSUN-ELO(Ci) (SEQ ID NO: 127) Forward: 5'-GCGGCCGCACCATGGACGTACTTCATCGT (SEQ ID NO: 128) Reverse: 3'-GCGGCCGCTTTAATCGGTTTTACCATT
Composition of the PCR Mix (50 .mu.l):
[0576] 5.00 .mu.l template cDNA
[0577] 5.00 .mu.l 10.times. buffer (Advantage polymerase)+25 mM MgCl2
[0578] 5.00 .mu.l 2 mM dNTP
[0579] 1.25 .mu.l per primer (10 .mu.mol/.mu.l)
[0580] 0.50 .mu.l Advantage polymerase
[0581] The Advantage polymerase from Clontech was employed.
PCR Reaction Conditions:
[0582] Annealing temperature: 1 minute at 55.degree. C.
[0583] Denaturation temperature: 1 minute at 94.degree. C.
[0584] Elongation temperature: 2 minutes at 72.degree. C.
[0585] Number of cycles: 35
[0586] The PCR products were incubated for 16 hours at 37.degree. C. with the restriction enzyme NotI. The plant expression vector pSUN300-USP was incubated in the same manner. Thereafter, the PCR products and the 7624 bp vector were separated by agarose gel electrophoresis and the corresponding, DNA fragments were excised. The DNA was purified by means of Qiagen gel purification kit following the manufacturer's instructions. Thereafter, vector and PCR products were ligated. The Rapid Ligation kit from Roche was used for this purpose. The resulting plasmids pSUN-ELO(XI) and pSUN-ELO(Ci) were verified by sequencing.
[0587] pSUN300 is a derivative of plasmid pPZP (Hajdukiewicz, P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25:989-994). pSUN-USP originated from pSUN300, by inserting a USP promoter as EcoRI fragment into pSUN300. The polyadenylation signal is that of the octopine synthase gene from the A. tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montagu, M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl. Genet. 1 (6), 499-511 (1982). Der USP promoter corresponds to the nucleotides 1-684 (Genbank Accession X56240), where part of the noncoding region of the USP gene is present in the promoter. The promoter fragment which is 684 base pairs in size was amplified by means of commercially available T7 standard primers (Stratagene) and with the aid of a synthesized primer via a PCR reaction following standard methods
TABLE-US-00031 Primer sequence: (SEQ ID NO: 129) 5'-GTCGACCCGCGGACTAGTGGGCCCTCTAGACCCGGGGGATCCGGATC TGCTGGCTATGAA-3'.
[0588] The PCR fragment was cut again with EcoRI/SalI and introduced into the vector pSUN300 with OCS terminator. This gave rise to the plasmid with the name pSUN-USP. The construct was used for the transformation of Arabidopsis thaliana, oilseed rape, tobacco and linseed.
[0589] The lipid extraction from yeasts and seeds was as described in Example 6.
Example 41
Expression of ELO(XI) (SEQ ID NO: 117) and ELO(Ci) (SEQ ID NO: 119) in Yeasts
[0590] Yeasts which had been transformed with the plasmids pYES2, pYES2-ELO(XI) and pYES2-ELO(Ci) as described in Example 4 were analyzed as follows:
[0591] The yeast cells from the main cultures were harvested by centrifugation (100.times.g, 5 min, 20.degree. C.) and washed with 100 mM NaHCO.sub.3, pH 8.0 to remove residual medium and fatty acids. Starting with the yeast cell sediments, fatty acid methyl esters (FAMEs) were prepared by acid methanolysis. To this end, the cell sediments were incubated for one hour at 80.degree. C. together with 2 ml of 1 N methanolic sulfuric acid and 2% (v/v) of dimethoxypropane. The FAMEs were extracted twice with petroleum ether (PE). To remove nonderivatized fatty acids, the organic phases were washed in each case once with 2 ml of 100 mM NaHCO.sub.3, pH 8.0 and 2 ml of distilled water. Thereafter, the PE phases were dried with Na.sub.2SO.sub.4, evaporated under argon and taken up in 100 .mu.l of PE. The samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 .mu.m, Agilent) in a Hewlett-Packard 6850 gas chromatograph equipped with flame ionization detector. The conditions for the GLC analysis were as follows: the oven temperature was programmed from 50.degree. C. to 250.degree. C. with a rate of 5.degree. C./min and finally 10 min at 250.degree. C. (holding).
[0592] The signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma). The methodology is described for example in Napier and Michaelson, 2001, Lipids. 36(8):761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52(360):1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388(2):293-298 and Michaelson et al., 1998, FEBS Letters. 439(3):215-218.
Example 42
Functional Characterization of ELO(XI) (SEQ ID NO: 117) and ELO(Ci) (SEQ ID NO: 119)
[0593] The substrate specificity of ELO(XI) was determined after expression and after feeding various fatty acids (FIG. 22). The substrates fed can be detected in large amounts in all of the transgenic yeasts. The transgenic yeasts revealed the synthesis of novel fatty acids, the products of the ELO(XI) reaction. This means that the gene ELO(XI) was expressed functionally.
[0594] Table 13 shows that ELO(XI) has a broad substrate specificity. Both C18- and C20-fatty acids are elongated, a preference of .DELTA.5- and .DELTA.6-desaturated fatty acids being observed.
[0595] The yeasts which had been transformed with the vector pYES2-ELO(XI) were grown in minimal medium in the presence of the fatty acids stated. The fatty acid methyl esters were synthesized by subjecting intact cells to acid methanolysis. Thereafter, the FAMEs were analyzed via GLC.
TABLE-US-00032 TABLE 13 Expression of ELO(XI) in yeast. The conversion rate of various starting materials (fed at in each case 250 .mu.M) is shown. Conversion of the starting materials by Starting materials ELO(XI) in % 16:0 3 16:1.sup..DELTA.9 0 18:0 2 18:1.sup..DELTA.9 0 18:2.sup..DELTA.9,12 3 18:3.sup..DELTA.6,9,12 12 18:3.sup..DELTA.5,9,12 13 18:3.sup..DELTA.9,12,15 3 18:4.sup..DELTA.6,9,12,15 20 20:3.sup..DELTA.8,11,14 5 20:3.sup..DELTA.11,14,17 13 20:4.sup..DELTA.5,8,11,14 15 20:5.sup..DELTA.5,8,11,14,17 10 22:4.sup..DELTA.7,10,13,16 0 22:6.sup..DELTA.4,7,10,13,16,19 0
[0596] The substrate specificity of ELO(Ci) was determined after expression and after feeding various fatty acids (FIG. 23). The substrates fed can be detected in large amounts in all of the transgenic yeasts. The transgenic yeasts revealed the synthesis of novel fatty acids, the products of the ELO(Ci) reaction. This means that the gene ELO(Ci) was expressed functionally
TABLE-US-00033 TABLE 14 Expression of ELO(Ci) in yeast. The conversion rate of various starting materials (fed at in each case 250 .mu.M) is shown. Conversion of the starting materials by Starting materials ELO(Ci) in % 16:0 0 16:1.sup..DELTA.9 0 18:0 0 18:1.sup..DELTA.9 0 18:.sup.2.DELTA.9,12 23 18:3.sup..DELTA.6,9,12 10 18:3.sup..DELTA.5,9,12 38 18:3.sup..DELTA.9,12,15 25 18:4.sup..DELTA.6,9,12,15 3 20:3.sup..DELTA.8,11,4 10 20:3.sup..DELTA.11,14,17 8 20:4.DELTA.5,8,11,14 10 20:5.DELTA.5,8,11,14,17 15 22:4.DELTA.7,10,13,16 0 22:6.DELTA.4,7,10,13,16,19 0
[0597] Table 14 shows that ELO(Ci) has a broad substrate specificity. Both C18- and C20-fatty acids are elongated, a preference of .DELTA.5- and .DELTA.6-desaturated fatty acids being observed.
[0598] The yeasts which had been transformed with the vector pYES2-ELO(Ci) were grown in minimal medium in the presence of the fatty acids stated. The fatty acid methyl esters were synthesized by subjecting intact cells to acid methanolysis. Thereafter, the FAMEs were analyzed via GLC.
Example 43
Cloning of Genes from Ostreococcus tauri
[0599] By searching for conserved regions in the protein sequences with the aid of the elongase genes with .DELTA.5-elongase activity or .DELTA.6-elongase activity, which are described herein, it was possible to identify in each case two sequences with corresponding motifs in an Ostreococcus tauri sequence database (genomic sequences). The sequences were the following:
TABLE-US-00034 Name of gene SEQ ID Amino acids OtELO1 (.DELTA.5-elongase) SEQ ID NO: 67 300 OtELO1.2 (.DELTA.5-elongase) SEQ ID NO: 113 300 OtELO2 (.DELTA.6-elongase) SEQ ID NO: 81 292 OtELO2.1 (.DELTA.6-elongase) SEQ ID NO: 111 292
[0600] OtElo1 (SEQ ID NO: 67) and OtElo1.2 (SEQ ID NO: 113) show the highest degree of similarity to an elongate from Danio rerio (GenBank AAN77156; approx. 26% identity), while OtElo2 (SEQ ID NO: 81) and OtElo2.1 (SEQ ID NO: 111) show the highest similarity with the Physcomitrella Elo (PSE) [approx. 36% identity] (alignments were carried out using the tBLASTn algorithm (Altschul et al., J. Mol. Biol. 1990, 215: 403-410).
[0601] The elongases were cloned as follows:
[0602] 40 ml of an Ostreococcus tauri culture in the stationary phase were spun down, resuspended in 100 .mu.l of double-distilled water and stored at -20.degree. C. Based on the PCR method, the respective genomic DNAs were amplified. The respective primer pairs were chosen in such a way that they bore the yeast consensus sequence for highly efficient translation (Kozak, Cell 1986, 44:283-292) adjacent to the start codon. The OtElo DNAs were amplified in each case using 1 .mu.l of defrosted cells, 200 .mu.M dNTPs, 2.5 U Taq polymerase and 100 pmol of each primer in a total volume of 50 .mu.l. The PCR conditions were as follows: first denaturation at 95.degree. C. for 5 minutes, followed by 30 cycles at 94.degree. C. for 30 seconds, 55.degree. C. for 1 minute and 72.degree. C. for 2 minutes, and a last elongation step at 72.degree. C. for 10 minutes.
Example 44
Cloning of Expression Plasmids for the Heterologous Expression Yeasts
[0603] To characterize the function of the Ostreococcus tauri elongases, the open reading frame of the DNA in question is cloned downstream of the galactose-inducible GAL1 promoter of pYES2.1/V5-His-TOPO (Invitrogen), giving rise to the corresponding pOTE1, pOTE1.2, pOTE2 and pOTE2.1 clones.
[0604] The Saccharomyces cerevisiae strain 334 is transformed with the vectors pOTE1, pOTE1.2, pOT22 and pOTE2.1, respectively by electroporation (1500 V). A yeast which is transformed with the blank vector pYES2 is used for control purposes. The transformed yeasts are selected on complete minimal medium (CMdum) agar plates supplemented with 2% glucose, but lacking uracil. After the selection, in each case three transformants are chosen for the further functional expression.
[0605] To express the Ot elongases, precultures of in each case 5 ml CMdum liquid medium supplemented with 2% (w/v) raffinose, but lacking uracil, are first inoculated with the transformants chosen and incubated for 2 days at 30.degree. C., 200 rpm.
[0606] Then, 5 ml of CMdum liquid medium (without uracil) supplemented with 2% of raffinose and 300 .mu.M of various fatty acids are inoculated with the precultures OD.sub.600 of 0.05. Expression is induced by addition of 2% (w/v) galactose. The cultures are incubated for a further 96 h at 20.degree. C.
Example 45
Cloning of Expression Plasmids for the Seed-Specific Expression in Plants
[0607] A further transformation vector based on pSUN-USP is generated for the transformation of plants. To this end, NotI cleavage sites are introduced at the 5' and 3' ends of the coding sequences, using PCR. The corresponding primer sequences are derived from the 5' and 3 regions of OtElo1 (SEQ ID NO: 67), OtElo1.2 (SEQ ID NO: 113), OtElo2 (SEQ ID NO: 69) and OtElo2.1 (SEQ ID NO: 111).
Composition of the PCR Mix (50 .mu.l):
[0608] 5.00 .mu.l template cDNA
[0609] 5.00 .mu.l 10.times. buffer (Advantage polymerase)+25 mM MgCl.sub.2
[0610] 5.00 .mu.l 2 mM dNTP
[0611] 1.25 .mu.l of each primer (10 .mu.mol/.mu.l)
[0612] 0.50 .mu.l Advantage polymerase
[0613] The Advantage polymerase from Clontech was employed.
PCR Reaction Conditions:
[0614] Annealing temperature: 1 min 55.degree. C.
[0615] Denaturation temperature: 1 min 94.degree. C.
[0616] Elongation temperature: 2 min 72.degree. C.
[0617] Number of cycles: 35
[0618] The PCR products were incubated with the restriction enzyme NotI for 16 hours at 37.degree. C. The plant expression vector pSUN300-USP was incubated in the same manner. Thereafter, the PCR products and the vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The DNA was purified by means of the Qiagen Gel Purification Kit following the manufacturer's instructions. Thereafter, vector and PCR products were ligated. The Rapid Ligation Kit from Roche was used for this purpose. The resulting plasmids were verified by pSUN-OtEllO1, pSUN-OtELO1.2, pSUN-OtELO2 and pSUN-OtELO2.2 sequencing.
[0619] pSUN300 is a derivative of plasmid pPZP (Hajdukiewicz, P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25:989-994). pSUN-USP originated from pSUN300, by inserting a USP promoter into pSUN300 in the form of an EcoRI fragment. The polyadenylation signal is that of the Ostreococcus gene from the A. tumefaciens Ti plasmid (ocs-Terminator, Genbank Accession V00088) (De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montagu, M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl. Genet. 1 (6), 499-511 (1982). The USP promoter corresponds to nucleotides 1 to 684 (Genbank Accession X56240), where part of the noncoding region of the USP gene is present in the promoter. The promoter fragment which is 684 base pairs in size was amplified by a PCR reaction and standard methods with the aid of a synthesized primer and by means of a commercially available T7 standard primer (Stratagene).
TABLE-US-00035 (SEQ ID NO: 130) (Primer sequence: 5'-GTCGACCCGCGGACTAGTGGGCCCTCTAGACCCGGGGGATCC GGATCTGCTGGCTATGAA-3').
[0620] The PCR fragment was recut with EcoRI/SalI and inserted into the vector pSUN300 with OCS terminator. This gave rise to the plasmid with the name pSUN-USP. The construct was used for the transformation of Arabidopsis thaliana, oilseed rape, tobacco and linseed.
Example 46
OtElo1 (SEQ ID NO: 67), OtElo1.2 (SEQ ID NO: 113), OtElo2 (SEQ ID NO: 69) and OtELO2.1 (SEQ ID NO: 111) in Yeasts
[0621] Yeasts which had been transformed with the plasmids pYES3, pYES3-OtELO1, pYES3-OtELO1.2, pYES3-OtELO2 and pYES3-OtELO2.2 as described in Example 15 were analyzed as follows:
[0622] The yeast cells from the main cultures were harvested by centrifugation (100.times.g, 5 min, 20.degree. C.) and washed with 100 mM NaHCO.sub.3, pH 8.0 to remove residual medium and fatty acids. Starting with the yeast cell sediments, fatty acid methyl esters (FAMEs) were prepared by acid methanolysis. To this end, the cell sediments were incubated for one hour at 80.degree. C. together with 2 ml of 1 N methanolic sulfuric acid and 2% (v/v) of dimethoxypropane. The FAMEs were extracted twice with petroleum ether (PE). To remove nonderivatized fatty acids, the organic phases were washed in each case once with 2 ml of 100 mM NaHCO.sub.3, pH 8.0 and 2 ml of distilled water. Thereafter, the PE phases were dried with Na.sub.2SO.sub.4, evaporated under argon and taken up in 100 .mu.l of PE. The samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 .mu.m, Agilent) in a Hewlett-Packard 6850 gas chromatograph equipped with flame ionization detector. The conditions for the GLC analysis were as follows: the oven temperature was programmed from 50.degree. C. to 250.degree. C. with a rate of 5.degree. C./min and finally 10 min at 250.degree. C. (holding).
[0623] The signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma). The methodology is described for example in Napier and Michaelson, 2001, Lipids. 36(8):761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52(360):1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388(2):293-298 and Michaelson et al., 1998, FEBS Letters. 439(3):215-218.
Example 47
Functional Characterization of OtElo1 (SEQ ID NO: 67), OtElo1.2 (SEQ ID NO: 113), OtElo2 (SEQ ID NO: 69) and OtElo2.1 (SEQ ID NO: 111)
[0624] The substrate specificity of OtElo1 (SEQ ID NO: 67) was determined after expression and after feeding various fatty acids (Tab. 15). The substrates fed can be detected in large amounts in all of the transgenic yeasts. The transgenic yeasts revealed the synthesis of novel fatty acids, the products of the OtElo1 reaction. This means that the gene OtElo1 was expressed functionally.
[0625] Table 15 shows that OtElo1 (SEQ ID NO: 67) and OtElo1.2 (SEQ ID NO: 113) have a narrow substrate specificity. OtElo1 (SEQ ID NO: 67) and OtElo1.2 (SEQ ID NO: 113) were only capable of elongating the C20-fatty acids eicosapentaenoic acid (FIG. 24A, 24B) and arachidonic acid (FIG. 25A, 25B), but preferred eicosapentaenoic acid, which is .omega.-3-desaturated.
[0626] Table 15 shows the substrate specificity of the elongase OtElo1 (SEQ ID NO: 67) and OtElo1.2 (SEQ ID NO: 113) for C20-polyunsaturated fatty acids with a double bond in the .DELTA.5 position in comparison with various fatty acids.
[0627] The yeasts which had been transformed with the vector pOTE1 and pOTE1.2, respectively, were grown in minimal medium in the presence of the fatty acids stated. The fatty acid methyl esters were synthesized by subjecting intact cells to acid methanolysis. Thereafter, the FAMEs were analyzed via GLC.
[0628] The substrate specificity of OtElo2 (SEQ ID NO: 67) and OtElo2.1 (SEQ ID NO: 111) was determined after expression and after feeding various fatty acids (Tab. 16). The substrates fed can be detected in large amounts in all of the transgenic yeasts. The transgenic yeasts revealed the synthesis of novel fatty acids, the products of the OtElo2 reaction. This means that the genes OtElo2 and OtElo2.1 were expressed functionally.
TABLE-US-00036 TABLE 15 Conversion rate (in %) Conversion rate (in %) Fatty acid substrate OtElo1 OtElo1.2 16:0.sup.| -- -- 16:1.sup.| .DELTA.9 -- -- 18:0.sup.| -- -- 18:1.sup.| .DELTA.9 -- -- 18:1.sup..DELTA.11 -- -- 18:2.sup..DELTA.9,12 -- -- 18:3.sup.| .DELTA.6,9,12 -- -- 18:3.sup.| .DELTA.5,9,12 -- -- 20:3.sup..DELTA.8,11,14 -- -- 20:4.sup..DELTA.5,| 8,11,14 10.8 .+-. 0.6 38.0 20:5.sup..DELTA.5,| 8,11,14,17 46.8 .+-. 3.6 68.6 22:4.sup..DELTA.7,| 10,13,16 -- -- 22:6.sup.| .DELTA.4,7,10,13,16,19 -- --
[0629] Table 16 shows the substrate specificity of the elongase OtElo2 (SEQ ID NO: 81) and OtElo2.1 (SEQ ID NO: 111) for various fatty acids. The activity of OtElo2.1 (SEQ ID NO: 111) is markedly higher.
[0630] The yeasts which had been transformed with the vector pOTE2 and pOTE2.1, respectively, were grown in minimal medium in the presence of the fatty acids stated. The fatty acid methyl esters were synthesized by subjecting intact cells to acid methanolysis. Thereafter, the FAMEs were analyzed via GLC.
[0631] The enzymatic activity which is shown in Table 16 demonstrates clearly that OtElo2 (SEQ ID NO: 81), or OtElo2.1 (SEQ ID NO: 111), is a .DELTA.6-elongase.
TABLE-US-00037 TABLE 16 Conversion rate (in %) Conversion rate (in %) Fatty acid substrate OtElo2 OtELO2.1 16:0 -- -- 16:1.sup.| .DELTA.9 -- -- 16:3.sup.| .DELTA.7,10,13 -- -- 18:0.sup.| -- -- 18:1.sup.| .DELTA.6 -- -- 18:1.sup.| .DELTA.9 -- -- 18:1.sup.| .DELTA.11 -- -- 18:2.sup.| .DELTA.9,12 -- -- 18:3.sup..DELTA.6,9,12 15.3 55.7 18:3.sup.| .DELTA.5,9,12 -- -- 18:4.sup.|.DELTA.6,9,12,15 21.1 70.4 20:2.sup..DELTA.11,14 -- -- 20:3.sup..DELTA.8,11,14 -- -- 20:4.sup..DELTA.5,| 8,11,14 -- -- 20:5.sup..DELTA.5,| 8,11,14,17 -- -- 22:4.sup..DELTA.7,| 10,13,16 -- -- 22:5.sup..DELTA.7,| 10,13,16,19 -- -- 22:6.sup.| .DELTA.4,7,10,13,16,19 -- --
[0632] FIG. 24 A-D shows the elongation of eicosapentaenoic acid by OtElo1 (B; SEQ ID NO: 67) and OtElo1.2 (D; SEQ ID NO: 113), respectively. The controls (A, C) do not show the elongation product (22:503).
[0633] FIG. 25 A-D shows the elongation of arachidonic acid by OtElo1 (B; SEQ ID NO: 67) and OtElo1.2 (D; SEQ ID NO: 113), respectively. The controls (A, C) do not show the elongation product (22:406).
Example 48
Cloning of Elongase Genes from Euglena gracilis and Arabidopsis thaliana
[0634] By searching for conserved regions in the protein sequences with the aid of the elongase genes with .DELTA.5-elongase activity or .DELTA.6-elongase activity, which are detailed in the application, it was possible to identify sequences from Arabidopsis thaliana and Euglena gracilis, respectively, with corresponding motifs in sequence databases (Genbank, Euglena EST library). The sequences are the following:
TABLE-US-00038 Name of gene SEQ ID Amino acids EGY1019 (E. gracilis) SEQ ID NO: 131 262 EGY2019 (E. gracilis) SEQ ID NO: 133 262 At3g06460 (A. thaliana) SEQ ID NO: 135 298 At3g06470 (A. thaliana) SEQ ID NO: 137 278
[0635] The Euglena gracilis elongases were cloned as follows:
[0636] The Euglena gracilis strain 1224-5/25 was obtained from the Sammlung fur Algenkulturen Gottingen [Gottingen collection of algal cultures] (SAG). For the isolation, the strain was grown in medium II (Calvayrac R and Douce R, FEBS Letters 7:259-262, 1970) for 4 days at 23.degree. C. with a light/dark interval of 8 h/16 h (light intensity 35 mol s-1 m-2).
[0637] Total RNA of a four-day-old Euglena culture was isolated with the aid of the RNAeasy kit from Qiagen (Valencia, Calif., US). Poly-A+ RNA (mRNA) was isolated from the total RNA with the aid of oligo-dt-cellulose (Sambrook et al., 1989). The RNA was subjected to reverse transcription using the Reverse Transcription System kit from Promega, and the cDNA synthesized was cloned into the vector lambda ZAP (lambda ZAP Gold, Stratagene). The cDNA was depackaged in accordance with the manufacturer's instructions to give plasmid DNA, and clones were part-sequenced for random sequencing. mRNA was isolated from the total RNA with the aid of the PolyATract isolation system (Promega). The mRNA was subjected to reverse transcription using the Marathon cDNA amplification kit (BD Biosciences), and the adapters were ligated in accordance with the manufacturer's instructions. The cDNA library was then used for the PCR for cloning expression plasmids by means of 5' and 3'-RACE (rapid amplification of cDNA ends).
[0638] The Arabidopsis thaliana elongases were cloned as follows:
[0639] Starting from the genomic DNA, primers for the two genes were derived in each case at the 5' and 3' end of the open reading frame.
[0640] The method of Chrigwin et al., (1979) was used for isolating total RNA from A. Thaliana. Leaves of 21-day-old plants were comminuted with a pestle and mortar in liquid nitrogen, treated with disruption buffer and incubated for 15 minutes at 37.degree. C. After centrifugation (10 min, 4.degree. C., 12 000.times.g), the RNA in the supernatant was precipitated with 0.02 volume of 3 M sodium acetate pH 5.0 and 0.75 volume of ethanol at -20.degree. C. for 5 hours. Then, after a further centrifugation step, the RNA was taken up in 1 ml of TES per g of starting material, extracted once with one volume of phenol/chloroform and once with one volume of chloroform, and the RNA was precipitated with 2.5 M LiCl. After the subsequent centrifugation and washing with 80% ethanol, the RNA was resuspended in water. The cDNA was synthesized as described by Sambrook et al. 1989, and RT-PCR was carried out with the derived primers. The PCR products were cloned into the vector pYES2.1-TOPO (Invitrogen) following the manufacturer's instructions.
Example 49
Cloning of Expression Plasmids for the Heterologous Expression in Yeasts
[0641] To characterize the function of the A. thaliana desaturases, the open reading frame of the DNA in question is cloned downstream of the galactose-inducible GAL1 promoter of pYES2.1/V5-His-TOPO (Invitrogen), giving rise to the corresponding pAt60 and pAt70 clones.
[0642] The Saccharomyces cerevisiae strain 334 is transformed with the vectors pAt60 and pAt70, respectively by electroporation (1500 V). A yeast which is transformed with the blank vector pYES2.1 is used for control purposes. The transformed yeasts are selected on complete minimal medium (CMdum) agar plates supplemented with 2% glucose, but lacking uracil. After the selection, in each case three transformants are chosen for the further functional expression.
[0643] To express the At elongases, precultures of in each case 5 ml of CMdum liquid medium supplemented with 2% (w/v) raffinose, but without uracil, were inoculated with the selected transformants and incubated for 2 hours at 30.degree. C., 200 rpm.
[0644] 5 ml of CMdum liquid medium (without uracil) supplemented with 2% of raffinose and 300 .mu.M various fatty acids were then inoculated with the precultures to an OD.sub.600 of 0.05. Expression was induced by the addition of 2% (w/v) galactose. The cultures were incubated for a further 96 hours at 20.degree. C.
Example 50
Expression of pAt60 and pAt70 in Yeasts
[0645] Yeasts which had been transformed with the plasmids pYES2.1, pAt60 and pAt70, respectively, as described in Example 5 were analyzed as follows:
[0646] The yeast cells from the main cultures were harvested by centrifugation (100.times.g, 5 min, 20.degree. C.) and washed with 100 mM NaHCO.sub.3, pH 8.0 to remove residual medium and fatty acids. Starting with the yeast cell sediments, fatty acid methyl esters (FAMEs) were prepared by acid methanolysis. To this end, the cell sediments were incubated for one hour at 80.degree. C. together with 2 ml of 1 N methanolic sulfuric acid and 2% (v/v) of dimethoxypropane. The FAMEs were extracted twice with petroleum ether (PE). To remove nonderivatized fatty acids, the organic phases were washed in each case once with 2 ml of 100 mM NaHCO.sub.3, pH 8.0 and 2 ml of distilled water. Thereafter, the PE phases were dried with Na.sub.2SO.sub.4, evaporated under argon and taken up in 100 .mu.l of PE. The samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 .mu.m, Agilent) in a Hewlett-Packard 6850 gas chromatograph equipped with flame ionization detector. The conditions for the GLC analysis were as follows: the oven temperature was programmed from 50.degree. C. to 250.degree. C. with a rate of 5.degree. C./min and finally 10 min at 250.degree. C. (holding).
[0647] The signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma). The methodology is described for example in Napier and Michaelson, 2001, Lipids. 36(8):761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52(360):1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388(2):293-298 and Michaelson et al., 1998, FEBS Letters. 439(3):215-218.
Example 51
Functional Characterization of pAt60 and pAt70
[0648] The substrate specificity of the elongases At3g06460 (SEQ ID NO: 135) and At3g06470 (SEQ ID NO: 137), respectively, was determined followed expression and feeding of various fatty acids (Tab. 17, FIG. 26). The substrates fed can be detected in all of the transgenic yeasts. The transgenic yeasts showed the synthesis of new fatty acids, the products of the genes At3g06460 and At3g06470, respectively. This means that these genes were expressed functionally.
TABLE-US-00039 TABLE 17 Elongation of EPA by the elongasen At3g06460 and At3g06470, respectively. Analysis of the yeast extracts after feeding with 250 uM EPA. Gene Fatty acid fed C20:5n-3 content C22:5n-3 content At3g06460 EPA (C20:5n-3) 20.8 0.6 At3g06460 EPA (C20:5n-3) 25.4 1.1 Conversion rate of EPA At3g06460: 3.0% At3g06470: 4.1%
[0649] FIG. 26 shows the elongation of 20:5n-3 by the elongases At3g06470.
Example 52
Cloning of an Elongase from Phaeodactylum tricornutum
[0650] Starting from conserved regions in the protein sequences with the aid of the elongase genes with .DELTA.6-elongase activity detailed in the application, degenerate primers were generated and these primers were used for screening a Phaeodactylum cDNA library by means of PCR. The following primer sequences were employed:
TABLE-US-00040 Name of Sequence Corresponding primer 5'-3' orientation amino acids Phaelo AA(C/T)CTUCTUTGGCTUTT(C/T) NLLWLFY forward1 TA (SEQ ID NO. 185) Phaelo GA(C/T)TGUAC(A/G)AA(NG)AA FAQFFVQS reverse1 (C/T)TGUGC(A/G)AA (SEQ ID NO. 186)
[0651] Nucleotide bases in brackets mean that a mixture of oligonucleotides with in each case one or the other nucleotide base is present.
Preparation of the Phaeodactylum cDNA Library:
[0652] A 2 l culture of P. tricornutum UTEX 646 was grown in f/2 medium (Guillard, R. R. L. 1975.
[0653] Culture of phytoplankton for feeding marine invertebrates. In Culture of Marine Invertebrate Animals (Eds. Smith, W. L. and Chanley, M. H.), Plenum Press, New York, pp 29-60) for 14 days at a light intensity of 35 E/cm.sup.2. After centrifugation, frozen cells were ground to a fine powder in the presence of liquid nitrogen and resuspended in 2 ml of homogenization buffer (0.33 M sorbitol 0.3 M, NaCl, 10 mM EDTA, 10 mM EGTA, 2% SDS, 2% mercaptoethanol in 0.2 M Tris-Cl pH 8.5). After addition of 4 ml of phenol and 2 ml of chloroform, the mixture was shaken vigorously for 15 minutes at 45-50.degree. C. It was subsequently centrifuged (10 min.times.10 000 g), and the aqueous phase was extracted stepwise using chloroform. Nucleic acids were then precipitated by addition of 1/20 volume of 4 M sodium hydrogencarbonate solution and centrifuged. The pellet was taken up in 80 mM Tris-borate pH 7.0 and 1 mM EDTA, and the RNA was precipitated with 8 M lithium chloride. After centrifugation and washing with 70% ethanol, the RNA pellet was taken up in RNase-free water. Poly(A)-RNA was isolated with Dynabeads (Dynal, Oslo, Norway) following the manufacturer's instructions, and the first-strain cDNA synthesis was carried out using MLV-Rtase from Roche (Mannheim). The second-strand synthesis was then carried out by means of DNA polymerase I and Klenow fragment, followed by RNase H digestion. The cDNA was treated with T4 DNA polymerase, and EcoRI/XhoI adaptors (Pharmacia, Freiburg) were subsequently attached by means of T4 ligase. After XhoI digestion, phosphorylation and gel separation, fragments greater than 300 bp were ligated into the phage lambda ZAP Express following the manufacturer's instructions (Stratagene, Amsterdam, The Netherlands). After mass excision of the cDNA library and plasmid recovery, the plasmid library was transformed into E. coli DH10B cells and employed for PCR screening.
[0654] Using the abovementioned degenerate primers, it was possible to generate the PCR fragment with the SEQ ID NO: 187.
[0655] This fragment was labeled with digoxigenin (Roche, Mannheim) and used as probe for screening the phage library.
[0656] Using the sequence SEQ ID NO: 187, it was possible to obtain the gene sequence SEQ ID NO: 183, which constitutes the full-length RNA molecule of the Phaeodactylum .DELTA.6-elongase:
Example 53
Cloning of Expression Plasmids for the Heterologous Expression in Yeasts
[0657] The primer pairs in question were chosen in such a way that they bore the yeast consensus sequence for highly efficient translation (Kozak, Cell 1986, 44:283-292) next to the start codon. The PtELO6 DNA was amplified with in each case 1 .mu.l of cDNA, 200 .mu.M dNTPs, 2.5 U of Advantage polymerase and 100 pmol of each primer in a total volume of 50 .mu.l. The PCR conditions were as follows: first denaturation of 95.degree. C. for 5 minutes, followed by 30 cycles at 94.degree. C. for 30 seconds, 55.degree. C. for 1 minute and 72.degree. C. for 2 minutes, and a last elongation step at 72.degree. C. for 10 minutes.
[0658] The following oligonucleotides were used for the PCR reaction for cloning the sequence for the heterologous expression in yeasts:
TABLE-US-00041 Name of gene, and SEQ ID NO: Primer sequence PtELO6 F: 5'-GCGGCCGCACATAATGATGGTACCTT (SEQ ID NO: 183) CAAG (SEQ ID NO: 188) R: 3'- GAAGACAGCTTAATAGACTAGT (SEQ ID NO: 189) *F = forward primer, R = reverse primer
[0659] The PCR products were incubated for 30 minutes at 21.degree. C. with the yeast expression vector pYES2.1-TOPO (Invitrogen) following the manufacturer's instructions. The PCR product (see SEQ ID NO: 192) was ligated into the vector by means of a T-overhang and the activity of a topoisomerase (Invitrogen). After the incubation, E. coli DH5.alpha. cells were transformed. Suitable clones were identified by PCR, the plasmid DNA was isolated by means of the Qiagen DNAeasy kit and verified by sequencing. The correct sequence was then transformed into the Saccharomyces strain INVSc1 (Invitrogen) by electroporation (1500 V). As a control, the blank vector pYES2.1 was transformed in parallel. Thereafter, the yeasts were plated of minimal dropout uracil medium supplemented with 2% glucose. Cells which were capable of growing in the medium without uracil thus comprise the corresponding plasmids pYES2.1 and pYES2.1-PtELO6. After the selection, in each case two transformants were chosen for the further functional expression.
Example 54
Cloning Expression Plasmids for the Purposes of Seed-Specific Expression in Plants
[0660] To transform plants, a further transformation vector based on pSUN-USP was generated. To this end, NotI cleavage sites were introduced at the 5' and 3' ends of the coding sequence, using the following primer pair:
TABLE-US-00042 PSUN-PtELO6 (SEQ ID NO: 190) Forward: 5'-GCGGCCGCACCATGATGGTACCTTCAAGTTA (SEQ ID NO: 191) Reverse: 3'-GAAGACAGCTTAATAGGCGGCCGC
Composition of the PCR Mix (50 .mu.l):
[0661] 5.00 .mu.l template cDNA
[0662] 5.00 .mu.l 10.times. buffer (Advantage polymerase)+25 mM MgCl2
[0663] 5.00 .mu.l 2 mM dNTP
[0664] 1.25 .mu.l per primer (10 .mu.mol/.mu.l)
[0665] 0.50 .mu.l Advantage polymerase
[0666] The Advantage polymerase from Clontech was employed.
PCR Reaction Conditions:
[0667] Annealing temperature: 1 minute at 55.degree. C.
[0668] Denaturation temperature: 1 minute at 94.degree. C.
[0669] Elongation temperature: 2 minutes at 72.degree. C.
[0670] Number of cycles: 35
[0671] The PCR products were incubated for 16 hours at 37.degree. C. with the restriction enzyme NotI. The plant expression vector pSUN300-USP was incubated in the same manner. Thereafter, the PCR products and the 7624 bp vector were separated by agarose gel electrophoresis and the corresponding, DNA fragments were excised. The DNA was purified by means of Qiagen gel purification kit following the manufacturer's instructions. Thereafter, vector and PCR products were ligated. The Rapid Ligation kit from Roche was used for this purpose. The resulting plasmid pSUN-PtELO was verified by sequencing.
[0672] pSUN300 is a derivative of plasmid pPZP (Hajdukiewicz, P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25:989-994). pSUN-USP originated from pSUN300, by inserting a USP promoter as EcoRI fragment into pSUN300. The polyadenylation signal is that of the octopine synthase gene from the A. tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montagu, M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl. Genet. 1 (6), 499-511 (1982). Der USP promoter corresponds to the nucleotides 1-684 (Genbank Accession X56240), where part of the noncoding region of the USP gene is present in the promoter. The promoter fragment which is 684 base pairs in size was amplified by means of commercially available T7 standard primers (Stratagene) and with the aid of a synthesized primer via a PCR reaction following standard methods.
TABLE-US-00043 (Primer sequence: 5'-GTCGACCCGCGGACTAGTGGGCCCTCTAG ACCCGGGGGATCCGGATCTGCTGGCTATGAA-3'; SEQ ID NO: 151).
[0673] The PCR fragment was cut again with EcoRI/SalI and introduced into the vector pSUN300 with OCS terminator. This gave rise to the plasmid with the name pSUN-USP. The construct was used for the transformation of Arabidopsis thaliana, oilseed rape, tobacco and linseed.
[0674] The lipid extraction from yeasts and seeds was as described in Example 6.
Example 55
Expression of PtElo in Yeasts
[0675] Yeasts which had been transformed with the plasmids pYES2 and pYES2-PtELO6 as described in Example 4 were analyzed as follows:
[0676] The yeast cells from the main cultures were harvested by centrifugation (100.times.g, 5 min, 20.degree. C.) and washed with 100 mM NaHCO.sub.3, pH 8.0 to remove residual medium and fatty acids. Starting with the yeast cell sediments, fatty acid methyl esters (FAMEs) were prepared by acid methanolysis. To this end, the cell sediments were incubated for one hour at 80.degree. C. together with 2 ml of 1 N methanolic sulfuric acid and 2% (v/v) of dimethoxypropane. The FAMEs were extracted twice with petroleum ether (PE). To remove nonderivatized fatty acids, the organic phases were washed in each case once with 2 ml of 100 mM NaHCO.sub.3, pH 8.0 and 2 ml of distilled water. Thereafter, the PE phases were dried with Na.sub.2SO.sub.4, evaporated under argon and taken up in 100 .mu.l of PE. The samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 .mu.m, Agilent) in a Hewlett-Packard 6850 gas chromatograph equipped with flame ionization detector. The conditions for the GLC analysis were as follows: the oven temperature was programmed from 50.degree. C. to 250.degree. C. with a rate of 5.degree. C./min and finally 10 min at 250.degree. C. (holding). The signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma). The methodology is described for example in Napier and Michaelson, 2001, Lipids. 36(8):761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52(360):1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388(2):293-298 and Michaelson et al., 1998, FEBS Letters. 439(3):215-218.
Example 56
Functional Characterization of PtELO6 (SEQ ID NO: 183)
[0677] FIG. 29 shows the conversion of C18:3.sup..DELTA.6,9,12 and C18:4.sup..DELTA.6,9,12,15. The substrates are elongated by in each case two carbon atoms; the fatty acids C20:3.sup..DELTA.8,11,14 and C20:4.sup..DELTA.8,11,14,17 are formed, respectively. The substrate specificity of PtELO6 was determined after expression and feeding various fatty acids (FIG. 30). Large amounts of the substrates fed can be detected in all of the transgenic yeasts. The transgenic yeasts show the synthesis of new fatty acids, the products of the PtElo6 reaction. This means that the gene PtELO6 has been expressed functionally.
[0678] Table 18 shows that PtElo6 has a narrow substrate specificity. PtELO6 was only able to elongate the C18-fatty acids linoleic acid, linolenic acid, .gamma.-linolenic acid and stearidonic acid, but preferred stearidonic acid, which is .omega.3-desaturated (see also FIG. 30).
[0679] Feeding experiment: fatty acids (in bold) were added at in each case 250 .mu.m. The formation of the underlying fatty acids is new.
TABLE-US-00044 TABLE 18 Substrate specificity of PtElo6 (SEQ ID NO: 183) Fatty acid fed: +18:2 +18:3 +18:3 +18:4 16:0 16.2 18.2 15.2 20 04:48 16:1 50.6 20.5 22.8 33.5 34.2 18:0 5.4 6.3 6.2 5.2 12.4 18:1 27.7 14.6 19.6 19.3 16.7 18:2 40 18:3 32.9 18:3 12.3 18:4 4.5 20:2 0.4 20:3 3.4 20:3 9.7 20:4 14.5 % Elongation 0.0 0.99 9.37 44.09 76.32
[0680] The following fatty acids were fed, but not converted:
[0681] 18:1.sup..DELTA.6, 18:1.sup..DELTA.9, 18:1.sup..DELTA.11
[0682] 20:2.sup..DELTA.11,14, 20:3.sup..DELTA.11,14,17, 20:3.sup..DELTA.8,11,14, 20:4.sup..DELTA.5,8,11,14, 20:5.sup..DELTA.5,8,11,14,17
[0683] 22:4.sup..DELTA.7,10,13,16
[0684] The yeasts which had been transformed with the vector pYES2-PtELO6 were grown in minimal medium in the presence of the fatty acids stated. The fatty acid methyl esters were synthesized by subjecting intact cells to acid methanolysis. Thereafter, the FAMEs were analyzed via GLC. In this way, the results which were shown in FIGS. 29 and 30 and in Table 16 were obtained.
EQUIVALENTS
[0685] Many equivalents of the specific embodiments according to the invention described herein can be identified or found by the skilled worker resorting simply to routine experiments. These equivalents are intended to be within the scope of the patent claims.
Sequence CWU
1
1
19211266DNAEuglena gracilisCDS(1)..(1266)delta8-desaturase 1atg aag tca
aag cgc caa gcg ctt ccc ctt aca att gat gga aca aca 48Met Lys Ser
Lys Arg Gln Ala Leu Pro Leu Thr Ile Asp Gly Thr Thr 1
5 10 15 tat gat gtg tct
gcc tgg gtc aat ttc cac cct ggt ggt gcg gaa att 96Tyr Asp Val Ser
Ala Trp Val Asn Phe His Pro Gly Gly Ala Glu Ile 20
25 30 ata gag aat tac caa
gga agg gat gcc act gat gcc ttc atg gtt atg 144Ile Glu Asn Tyr Gln
Gly Arg Asp Ala Thr Asp Ala Phe Met Val Met 35
40 45 cac tct caa gaa gcc ttc
gac aag ctc aag cgc atg ccc aaa atc aat 192His Ser Gln Glu Ala Phe
Asp Lys Leu Lys Arg Met Pro Lys Ile Asn 50
55 60 ccc agt tct gag ttg cca
ccc cag gct gca gtg aat gaa gct caa gag 240Pro Ser Ser Glu Leu Pro
Pro Gln Ala Ala Val Asn Glu Ala Gln Glu 65 70
75 80 gat ttc cgg aag ctc cga gaa
gag ttg atc gca act ggc atg ttt gat 288Asp Phe Arg Lys Leu Arg Glu
Glu Leu Ile Ala Thr Gly Met Phe Asp 85
90 95 gcc tcc ccc ctc tgg tac tca tac
aaa atc agc acc aca ctg ggc ctt 336Ala Ser Pro Leu Trp Tyr Ser Tyr
Lys Ile Ser Thr Thr Leu Gly Leu 100
105 110 gga gtg ctg ggt tat ttc ctg atg
gtt cag tat cag atg tat ttc att 384Gly Val Leu Gly Tyr Phe Leu Met
Val Gln Tyr Gln Met Tyr Phe Ile 115 120
125 ggg gca gtg ttg ctt ggg atg cac tat
caa cag atg ggc tgg ctt tct 432Gly Ala Val Leu Leu Gly Met His Tyr
Gln Gln Met Gly Trp Leu Ser 130 135
140 cat gac att tgc cac cac cag act ttc aag
aac cgg aac tgg aac aac 480His Asp Ile Cys His His Gln Thr Phe Lys
Asn Arg Asn Trp Asn Asn 145 150
155 160 ctc gtg gga ctg gta ttt ggc aat ggt ctg
caa ggt ttt tcc gtg aca 528Leu Val Gly Leu Val Phe Gly Asn Gly Leu
Gln Gly Phe Ser Val Thr 165 170
175 tgc tgg aag gac aga cac aat gca cat cat tcg
gca acc aat gtt caa 576Cys Trp Lys Asp Arg His Asn Ala His His Ser
Ala Thr Asn Val Gln 180 185
190 ggg cac gac cct gat att gac aac ctc ccc ctc tta
gcc tgg tct gag 624Gly His Asp Pro Asp Ile Asp Asn Leu Pro Leu Leu
Ala Trp Ser Glu 195 200
205 gat gac gtc aca cgg gcg tca ccg att tcc cgc aag
ctc att cag ttc 672Asp Asp Val Thr Arg Ala Ser Pro Ile Ser Arg Lys
Leu Ile Gln Phe 210 215 220
cag cag tat tat ttc ttg gtc atc tgt atc ttg ttg cgg
ttc att tgg 720Gln Gln Tyr Tyr Phe Leu Val Ile Cys Ile Leu Leu Arg
Phe Ile Trp 225 230 235
240 tgt ttc cag agc gtg ttg acc gtg cgc agt ctg aag gac aga
gat aac 768Cys Phe Gln Ser Val Leu Thr Val Arg Ser Leu Lys Asp Arg
Asp Asn 245 250
255 caa ttc tat cgc tct cag tat aag aag gag gcc att ggc ctc
gcc ctg 816Gln Phe Tyr Arg Ser Gln Tyr Lys Lys Glu Ala Ile Gly Leu
Ala Leu 260 265 270
cat tgg aca ttg aag gcc ctg ttc cac tta ttc ttt atg ccc agc
atc 864His Trp Thr Leu Lys Ala Leu Phe His Leu Phe Phe Met Pro Ser
Ile 275 280 285
ctc aca tcg ctg ttg gta ttt ttc gtt tcg gag ctg gtt ggc ggc ttc
912Leu Thr Ser Leu Leu Val Phe Phe Val Ser Glu Leu Val Gly Gly Phe
290 295 300
ggc att gcg atc gtg gtg ttc atg aac cac tac cca ctg gag aag atc
960Gly Ile Ala Ile Val Val Phe Met Asn His Tyr Pro Leu Glu Lys Ile
305 310 315 320
ggg gac tcg gtc tgg gat ggc cat gga ttc tcg gtt ggc cag atc cat
1008Gly Asp Ser Val Trp Asp Gly His Gly Phe Ser Val Gly Gln Ile His
325 330 335
gag acc atg aac att cgg cga ggg att atc aca gat tgg ttt ttc gga
1056Glu Thr Met Asn Ile Arg Arg Gly Ile Ile Thr Asp Trp Phe Phe Gly
340 345 350
ggc ttg aac tac cag atc gag cac cat ttg tgg ccg acc ctc cct cgc
1104Gly Leu Asn Tyr Gln Ile Glu His His Leu Trp Pro Thr Leu Pro Arg
355 360 365
cac aac ctg aca gcg gtt agc tac cag gtg gaa cag ctg tgc cag aag
1152His Asn Leu Thr Ala Val Ser Tyr Gln Val Glu Gln Leu Cys Gln Lys
370 375 380
cac aac ctg ccg tat cgg aac ccg ctg ccc cat gaa ggg ttg gtc atc
1200His Asn Leu Pro Tyr Arg Asn Pro Leu Pro His Glu Gly Leu Val Ile
385 390 395 400
ctg ctg cgc tat ctg gcg gtg ttc gcc cgg atg gcg gag aag caa ccc
1248Leu Leu Arg Tyr Leu Ala Val Phe Ala Arg Met Ala Glu Lys Gln Pro
405 410 415
gcg ggg aag gct cta taa
1266Ala Gly Lys Ala Leu
420
2421PRTEuglena gracilis 2Met Lys Ser Lys Arg Gln Ala Leu Pro Leu Thr Ile
Asp Gly Thr Thr 1 5 10
15 Tyr Asp Val Ser Ala Trp Val Asn Phe His Pro Gly Gly Ala Glu Ile
20 25 30 Ile Glu Asn
Tyr Gln Gly Arg Asp Ala Thr Asp Ala Phe Met Val Met 35
40 45 His Ser Gln Glu Ala Phe Asp Lys
Leu Lys Arg Met Pro Lys Ile Asn 50 55
60 Pro Ser Ser Glu Leu Pro Pro Gln Ala Ala Val Asn Glu
Ala Gln Glu 65 70 75
80 Asp Phe Arg Lys Leu Arg Glu Glu Leu Ile Ala Thr Gly Met Phe Asp
85 90 95 Ala Ser Pro Leu
Trp Tyr Ser Tyr Lys Ile Ser Thr Thr Leu Gly Leu 100
105 110 Gly Val Leu Gly Tyr Phe Leu Met Val
Gln Tyr Gln Met Tyr Phe Ile 115 120
125 Gly Ala Val Leu Leu Gly Met His Tyr Gln Gln Met Gly Trp
Leu Ser 130 135 140
His Asp Ile Cys His His Gln Thr Phe Lys Asn Arg Asn Trp Asn Asn 145
150 155 160 Leu Val Gly Leu Val
Phe Gly Asn Gly Leu Gln Gly Phe Ser Val Thr 165
170 175 Cys Trp Lys Asp Arg His Asn Ala His His
Ser Ala Thr Asn Val Gln 180 185
190 Gly His Asp Pro Asp Ile Asp Asn Leu Pro Leu Leu Ala Trp Ser
Glu 195 200 205 Asp
Asp Val Thr Arg Ala Ser Pro Ile Ser Arg Lys Leu Ile Gln Phe 210
215 220 Gln Gln Tyr Tyr Phe
Leu Val Ile Cys Ile Leu Leu Arg Phe Ile Trp 225 230
235 240 Cys Phe Gln Ser Val Leu Thr Val Arg Ser
Leu Lys Asp Arg Asp Asn 245 250
255 Gln Phe Tyr Arg Ser Gln Tyr Lys Lys Glu Ala Ile Gly Leu Ala
Leu 260 265 270 His
Trp Thr Leu Lys Ala Leu Phe His Leu Phe Phe Met Pro Ser Ile 275
280 285 Leu Thr Ser Leu Leu Val
Phe Phe Val Ser Glu Leu Val Gly Gly Phe 290 295
300 Gly Ile Ala Ile Val Val Phe Met Asn His Tyr
Pro Leu Glu Lys Ile 305 310 315
320 Gly Asp Ser Val Trp Asp Gly His Gly Phe Ser Val Gly Gln Ile His
325 330 335 Glu Thr
Met Asn Ile Arg Arg Gly Ile Ile Thr Asp Trp Phe Phe Gly 340
345 350 Gly Leu Asn Tyr Gln Ile Glu
His His Leu Trp Pro Thr Leu Pro Arg 355 360
365 His Asn Leu Thr Ala Val Ser Tyr Gln Val Glu Gln
Leu Cys Gln Lys 370 375 380
His Asn Leu Pro Tyr Arg Asn Pro Leu Pro His Glu Gly Leu Val Ile 385
390 395 400 Leu Leu Arg
Tyr Leu Ala Val Phe Ala Arg Met Ala Glu Lys Gln Pro 405
410 415 Ala Gly Lys Ala Leu
420 3777DNAIsochrysis galbanaCDS(1)..(777)delta9-elongase 3atg gcc
ctc gca aac gac gcg gga gag cgc atc tgg gcg gct gtg acc 48Met Ala
Leu Ala Asn Asp Ala Gly Glu Arg Ile Trp Ala Ala Val Thr 1
5 10 15 gac ccg gaa
atc ctc att ggc acc ttc tcg tac ttg cta ctc aaa ccg 96Asp Pro Glu
Ile Leu Ile Gly Thr Phe Ser Tyr Leu Leu Leu Lys Pro
20 25 30 ctg ctc cgc
aat tcc ggg ctg gtg gat gag aag aag ggc gca tac agg 144Leu Leu Arg
Asn Ser Gly Leu Val Asp Glu Lys Lys Gly Ala Tyr Arg 35
40 45 acg tcc atg atc
tgg tac aac gtt ctg ctg gcg ctc ttc tct gcg ctg 192Thr Ser Met Ile
Trp Tyr Asn Val Leu Leu Ala Leu Phe Ser Ala Leu 50
55 60 agc ttc tac gtg acg
gcg acc gcc ctc ggc tgg gac tat ggt acg ggc 240Ser Phe Tyr Val Thr
Ala Thr Ala Leu Gly Trp Asp Tyr Gly Thr Gly 65
70 75 80 gcg tgg ctg cgc agg
caa acc ggc gac aca ccg cag ccg ctc ttc cag 288Ala Trp Leu Arg Arg
Gln Thr Gly Asp Thr Pro Gln Pro Leu Phe Gln 85
90 95 tgc ccg tcc ccg gtt tgg
gac tcg aag ctc ttc aca tgg acc gcc aag 336Cys Pro Ser Pro Val Trp
Asp Ser Lys Leu Phe Thr Trp Thr Ala Lys 100
105 110 gca ttc tat tac tcc aag tac
gtg gag tac ctc gac acg gcc tgg ctg 384Ala Phe Tyr Tyr Ser Lys Tyr
Val Glu Tyr Leu Asp Thr Ala Trp Leu 115
120 125 agg gtc tcc ttt ctc cag gcc
ttc cac cac ttt ggc gcg ccg tgg gat 432Arg Val Ser Phe Leu Gln Ala
Phe His His Phe Gly Ala Pro Trp Asp 130 135
140 gtg tac ctc ggc att cgg ctg cac
aac gag ggc gta tgg atc ttc atg 480Val Tyr Leu Gly Ile Arg Leu His
Asn Glu Gly Val Trp Ile Phe Met 145 150
155 160 ttt ttc aac tcg ttc att cac acc atc
atg tac acc tac tac ggc ctc 528Phe Phe Asn Ser Phe Ile His Thr Ile
Met Tyr Thr Tyr Tyr Gly Leu 165
170 175 acc gcc gcc ggg tat aag ttc aag gcc
aag ccg ctc atc acc gcg atg 576Thr Ala Ala Gly Tyr Lys Phe Lys Ala
Lys Pro Leu Ile Thr Ala Met 180 185
190 cag atc tgc cag ttc gtg ggc ggc ttc ctg
ttg gtc tgg gac tac atc 624Gln Ile Cys Gln Phe Val Gly Gly Phe Leu
Leu Val Trp Asp Tyr Ile 195 200
205 aac gtc ccc tgc ttc aac tcg gac aaa ggg aag
ttg ttc agc tgg gct 672Asn Val Pro Cys Phe Asn Ser Asp Lys Gly Lys
Leu Phe Ser Trp Ala 210 215
220 ttc aac tat gca tac gtc ggc tcg gtc ttc ttg
ctc ttc tgc cac ttt 720Phe Asn Tyr Ala Tyr Val Gly Ser Val Phe Leu
Leu Phe Cys His Phe 225 230 235
240 ttc tac cag gac aac ttg gca acg aag aaa tcg gcc
aag gcg ggc aag 768Phe Tyr Gln Asp Asn Leu Ala Thr Lys Lys Ser Ala
Lys Ala Gly Lys 245 250
255 cag ctc tag
777Gln Leu
4258PRT Isochrysis galbana 4 Met Ala Leu Ala
Asn Asp Ala Gly Glu Arg Ile Trp Ala Ala Val Thr 1 5
10 15 Asp Pro Glu Ile Leu Ile Gly Thr Phe
Ser Tyr Leu Leu Leu Lys Pro 20 25
30 Leu Leu Arg Asn Ser Gly Leu Val Asp Glu Lys Lys Gly Ala
Tyr Arg 35 40 45
Thr Ser Met Ile Trp Tyr Asn Val Leu Leu Ala Leu Phe Ser Ala Leu 50
55 60 Ser Phe Tyr Val Thr
Ala Thr Ala Leu Gly Trp Asp Tyr Gly Thr Gly 65 70
75 80 Ala Trp Leu Arg Arg Gln Thr Gly Asp Thr
Pro Gln Pro Leu Phe Gln 85 90
95 Cys Pro Ser Pro Val Trp Asp Ser Lys Leu Phe Thr Trp Thr Ala
Lys 100 105 110 Ala
Phe Tyr Tyr Ser Lys Tyr Val Glu Tyr Leu Asp Thr Ala Trp Leu 115
120 125 Arg Val Ser Phe Leu Gln
Ala Phe His His Phe Gly Ala Pro Trp Asp 130 135
140 Val Tyr Leu Gly Ile Arg Leu His Asn Glu Gly
Val Trp Ile Phe Met 145 150 155
160 Phe Phe Asn Ser Phe Ile His Thr Ile Met Tyr Thr Tyr Tyr Gly Leu
165 170 175 Thr Ala
Ala Gly Tyr Lys Phe Lys Ala Lys Pro Leu Ile Thr Ala Met 180
185 190 Gln Ile Cys Gln Phe Val Gly
Gly Phe Leu Leu Val Trp Asp Tyr Ile 195 200
205 Asn Val Pro Cys Phe Asn Ser Asp Lys Gly Lys Leu
Phe Ser Trp Ala 210 215 220
Phe Asn Tyr Ala Tyr Val Gly Ser Val Phe Leu Leu Phe Cys His Phe
225 230 235 240 Phe Tyr
Gln Asp Asn Leu Ala Thr Lys Lys Ser Ala Lys Ala Gly Lys
245 250 255 Gln Leu
51410DNAPhaeodactylum tricornutumCDS(1)..(1410)delta5-desaturase 5atg gct
ccg gat gcg gat aag ctt cga caa cgc cag acg act gcg gta 48Met Ala
Pro Asp Ala Asp Lys Leu Arg Gln Arg Gln Thr Thr Ala Val 1
5 10 15 gcg aag cac
aat gct gct acc ata tcg acg cag gaa cgc ctt tgc agt 96Ala Lys His
Asn Ala Ala Thr Ile Ser Thr Gln Glu Arg Leu Cys Ser
20 25 30 ctg tct tcg
ctc aaa ggc gaa gaa gtc tgc atc gac gga atc atc tat 144Leu Ser Ser
Leu Lys Gly Glu Glu Val Cys Ile Asp Gly Ile Ile Tyr 35
40 45 gac ctc caa tca
ttc gat cat ccc ggg ggt gaa acg atc aaa atg ttt 192Asp Leu Gln Ser
Phe Asp His Pro Gly Gly Glu Thr Ile Lys Met Phe 50
55 60 ggt ggc aac gat gtc
act gta cag tac aag atg att cac ccg tac cat 240Gly Gly Asn Asp Val
Thr Val Gln Tyr Lys Met Ile His Pro Tyr His 65
70 75 80 acc gag aag cat ttg
gaa aag atg aag cgt gtc ggc aag gtg acg gat 288Thr Glu Lys His Leu
Glu Lys Met Lys Arg Val Gly Lys Val Thr Asp 85
90 95 ttc gtc tgc gag tac aag
ttc gat acc gaa ttt gaa cgc gaa atc aaa 336Phe Val Cys Glu Tyr Lys
Phe Asp Thr Glu Phe Glu Arg Glu Ile Lys 100
105 110 cga gaa gtc ttc aag att gtg
cga cga ggc aag gat ttc ggt act ttg 384Arg Glu Val Phe Lys Ile Val
Arg Arg Gly Lys Asp Phe Gly Thr Leu 115
120 125 gga tgg ttc ttc cgt gcg ttt
tgc tac att gcc att ttc ttc tac ctg 432Gly Trp Phe Phe Arg Ala Phe
Cys Tyr Ile Ala Ile Phe Phe Tyr Leu 130 135
140 cag tac cat tgg gtc acc acg gga
acc tct tgg ctg ctg gcc gtg gcc 480Gln Tyr His Trp Val Thr Thr Gly
Thr Ser Trp Leu Leu Ala Val Ala 145 150
155 160 tac gga atc tcc caa gcg atg att ggc
atg aat gtc cag cac gat gcc 528Tyr Gly Ile Ser Gln Ala Met Ile Gly
Met Asn Val Gln His Asp Ala 165
170 175 aac cac ggg gcc acc tcc aag cgt ccc
tgg gtc aac gac atg cta ggc 576Asn His Gly Ala Thr Ser Lys Arg Pro
Trp Val Asn Asp Met Leu Gly 180 185
190 ctc ggt gcg gat ttt att ggt ggt tcc aag
tgg ctc tgg cag gaa caa 624Leu Gly Ala Asp Phe Ile Gly Gly Ser Lys
Trp Leu Trp Gln Glu Gln 195 200
205 cac tgg acc cac cac gct tac acc aat cac gcc
gag atg gat ccc gat 672His Trp Thr His His Ala Tyr Thr Asn His Ala
Glu Met Asp Pro Asp 210 215
220 agc ttt ggt gcc gaa cca atg ctc cta ttc aac
gac tat ccc ttg gat 720Ser Phe Gly Ala Glu Pro Met Leu Leu Phe Asn
Asp Tyr Pro Leu Asp 225 230 235
240 cat ccc gct cgt acc tgg cta cat cgc ttt caa gca
ttc ttt tac atg 768His Pro Ala Arg Thr Trp Leu His Arg Phe Gln Ala
Phe Phe Tyr Met 245 250
255 ccc gtc ttg gct gga tac tgg ttg tcc gct gtc ttc aat
cca caa att 816Pro Val Leu Ala Gly Tyr Trp Leu Ser Ala Val Phe Asn
Pro Gln Ile 260 265
270 ctt gac ctc cag caa cgc ggc gca ctt tcc gtc ggt atc
cgt ctc gac 864Leu Asp Leu Gln Gln Arg Gly Ala Leu Ser Val Gly Ile
Arg Leu Asp 275 280 285
aac gct ttc att cac tcg cga cgc aag tat gcg gtt ttc tgg
cgg gct 912Asn Ala Phe Ile His Ser Arg Arg Lys Tyr Ala Val Phe Trp
Arg Ala 290 295 300
gtg tac att gcg gtg aac gtg att gct ccg ttt tac aca aac tcc
ggc 960Val Tyr Ile Ala Val Asn Val Ile Ala Pro Phe Tyr Thr Asn Ser
Gly 305 310 315
320 ctc gaa tgg tcc tgg cgt gtc ttt gga aac atc atg ctc atg ggt
gtg 1008Leu Glu Trp Ser Trp Arg Val Phe Gly Asn Ile Met Leu Met Gly
Val 325 330 335
gcg gaa tcg ctc gcg ctg gcg gtc ctg ttt tcg ttg tcg cac aat ttc
1056Ala Glu Ser Leu Ala Leu Ala Val Leu Phe Ser Leu Ser His Asn Phe
340 345 350
gaa tcc gcg gat cgc gat ccg acc gcc cca ctg aaa aag acg gga gaa
1104Glu Ser Ala Asp Arg Asp Pro Thr Ala Pro Leu Lys Lys Thr Gly Glu
355 360 365
cca gtc gac tgg ttc aag aca cag gtc gaa act tcc tgc act tac ggt
1152Pro Val Asp Trp Phe Lys Thr Gln Val Glu Thr Ser Cys Thr Tyr Gly
370 375 380
gga ttc ctt tcc ggt tgc ttc acg gga ggt ctc aac ttt cag gtt gaa
1200Gly Phe Leu Ser Gly Cys Phe Thr Gly Gly Leu Asn Phe Gln Val Glu
385 390 395 400
cac cac ttg ttc cca cgc atg agc agc gct tgg tat ccc tac att gcc
1248His His Leu Phe Pro Arg Met Ser Ser Ala Trp Tyr Pro Tyr Ile Ala
405 410 415
ccc aag gtc cgc gaa att tgc gcc aaa cac ggc gtc cac tac gcc tac
1296Pro Lys Val Arg Glu Ile Cys Ala Lys His Gly Val His Tyr Ala Tyr
420 425 430
tac ccg tgg atc cac caa aac ttt ctc tcc acc gtc cgc tac atg cac
1344Tyr Pro Trp Ile His Gln Asn Phe Leu Ser Thr Val Arg Tyr Met His
435 440 445
gcg gcc ggg acc ggt gcc aac tgg cgc cag atg gcc aga gaa aat ccc
1392Ala Ala Gly Thr Gly Ala Asn Trp Arg Gln Met Ala Arg Glu Asn Pro
450 455 460
ttg acc gga cgg gcg taa
1410Leu Thr Gly Arg Ala
465
6469PRTPhaeodactylum tricornutum 6Met Ala Pro Asp Ala Asp Lys Leu Arg Gln
Arg Gln Thr Thr Ala Val 1 5 10
15 Ala Lys His Asn Ala Ala Thr Ile Ser Thr Gln Glu Arg Leu Cys
Ser 20 25 30 Leu
Ser Ser Leu Lys Gly Glu Glu Val Cys Ile Asp Gly Ile Ile Tyr 35
40 45 Asp Leu Gln Ser Phe Asp
His Pro Gly Gly Glu Thr Ile Lys Met Phe 50 55
60 Gly Gly Asn Asp Val Thr Val Gln Tyr Lys Met
Ile His Pro Tyr His 65 70 75
80 Thr Glu Lys His Leu Glu Lys Met Lys Arg Val Gly Lys Val Thr Asp
85 90 95 Phe Val
Cys Glu Tyr Lys Phe Asp Thr Glu Phe Glu Arg Glu Ile Lys 100
105 110 Arg Glu Val Phe Lys Ile Val
Arg Arg Gly Lys Asp Phe Gly Thr Leu 115 120
125 Gly Trp Phe Phe Arg Ala Phe Cys Tyr Ile Ala Ile
Phe Phe Tyr Leu 130 135 140
Gln Tyr His Trp Val Thr Thr Gly Thr Ser Trp Leu Leu Ala Val Ala 145
150 155 160 Tyr Gly Ile
Ser Gln Ala Met Ile Gly Met Asn Val Gln His Asp Ala 165
170 175 Asn His Gly Ala Thr Ser Lys Arg
Pro Trp Val Asn Asp Met Leu Gly 180 185
190 Leu Gly Ala Asp Phe Ile Gly Gly Ser Lys Trp Leu Trp
Gln Glu Gln 195 200 205
His Trp Thr His His Ala Tyr Thr Asn His Ala Glu Met Asp Pro Asp 210
215 220 Ser Phe Gly Ala
Glu Pro Met Leu Leu Phe Asn Asp Tyr Pro Leu Asp 225 230
235 240 His Pro Ala Arg Thr Trp Leu His Arg
Phe Gln Ala Phe Phe Tyr Met 245 250
255 Pro Val Leu Ala Gly Tyr Trp Leu Ser Ala Val Phe Asn Pro
Gln Ile 260 265 270
Leu Asp Leu Gln Gln Arg Gly Ala Leu Ser Val Gly Ile Arg Leu Asp
275 280 285 Asn Ala Phe Ile
His Ser Arg Arg Lys Tyr Ala Val Phe Trp Arg Ala 290
295 300 Val Tyr Ile Ala Val Asn Val Ile
Ala Pro Phe Tyr Thr Asn Ser Gly 305 310
315 320 Leu Glu Trp Ser Trp Arg Val Phe Gly Asn Ile Met
Leu Met Gly Val 325 330
335 Ala Glu Ser Leu Ala Leu Ala Val Leu Phe Ser Leu Ser His Asn Phe
340 345 350 Glu Ser Ala
Asp Arg Asp Pro Thr Ala Pro Leu Lys Lys Thr Gly Glu 355
360 365 Pro Val Asp Trp Phe Lys Thr Gln
Val Glu Thr Ser Cys Thr Tyr Gly 370 375
380 Gly Phe Leu Ser Gly Cys Phe Thr Gly Gly Leu Asn Phe
Gln Val Glu 385 390 395
400 His His Leu Phe Pro Arg Met Ser Ser Ala Trp Tyr Pro Tyr Ile Ala
405 410 415 Pro Lys Val Arg
Glu Ile Cys Ala Lys His Gly Val His Tyr Ala Tyr 420
425 430 Tyr Pro Trp Ile His Gln Asn Phe Leu
Ser Thr Val Arg Tyr Met His 435 440
445 Ala Ala Gly Thr Gly Ala Asn Trp Arg Gln Met Ala Arg Glu
Asn Pro 450 455 460
Leu Thr Gly Arg Ala 465 71344DNACeratodon
purpureusCDS(1)..(1344)delta5-desaturase 7atg gta tta cga gag caa gag cat
gag cca ttc ttc att aaa att gat 48Met Val Leu Arg Glu Gln Glu His
Glu Pro Phe Phe Ile Lys Ile Asp 1 5
10 15 gga aaa tgg tgt caa att gac gat gct
gtc ctg aga tca cat cca ggt 96Gly Lys Trp Cys Gln Ile Asp Asp Ala
Val Leu Arg Ser His Pro Gly 20 25
30 ggt agt gca att act acc tat aaa aat atg
gat gcc act acc gta ttc 144Gly Ser Ala Ile Thr Thr Tyr Lys Asn Met
Asp Ala Thr Thr Val Phe 35 40
45 cac aca ttc cat act ggt tct aaa gaa gcg tat
caa tgg ctg aca gaa 192His Thr Phe His Thr Gly Ser Lys Glu Ala Tyr
Gln Trp Leu Thr Glu 50 55
60 ttg aaa aaa gag tgc cct aca caa gaa cca gag
atc cca gat att aag 240Leu Lys Lys Glu Cys Pro Thr Gln Glu Pro Glu
Ile Pro Asp Ile Lys 65 70 75
80 gat gac cca atc aaa gga att gat gat gtg aac atg
gga act ttc aat 288Asp Asp Pro Ile Lys Gly Ile Asp Asp Val Asn Met
Gly Thr Phe Asn 85 90
95 att tct gag aaa cga tct gcc caa ata aat aaa agt ttc
act gat cta 336Ile Ser Glu Lys Arg Ser Ala Gln Ile Asn Lys Ser Phe
Thr Asp Leu 100 105
110 cgt atg cga gtt cgt gca gaa gga ctt atg gat gga tct
cct ttg ttc 384Arg Met Arg Val Arg Ala Glu Gly Leu Met Asp Gly Ser
Pro Leu Phe 115 120 125
tac att aga aaa att ctt gaa aca atc ttc aca att ctt ttt
gca ttc 432Tyr Ile Arg Lys Ile Leu Glu Thr Ile Phe Thr Ile Leu Phe
Ala Phe 130 135 140
tac ctt caa tac cac aca tat tat ctt cca tca gct att cta atg
gga 480Tyr Leu Gln Tyr His Thr Tyr Tyr Leu Pro Ser Ala Ile Leu Met
Gly 145 150 155
160 gtt gcg tgg caa caa ttg gga tgg tta atc cat gaa ttc gca cat
cat 528Val Ala Trp Gln Gln Leu Gly Trp Leu Ile His Glu Phe Ala His
His 165 170 175
cag ttg ttc aaa aac aga tac tac aat gat ttg gcc agc tat ttc gtt
576Gln Leu Phe Lys Asn Arg Tyr Tyr Asn Asp Leu Ala Ser Tyr Phe Val
180 185 190
gga aac ttt tta caa gga ttc tca tct ggt ggt tgg aaa gag cag cac
624Gly Asn Phe Leu Gln Gly Phe Ser Ser Gly Gly Trp Lys Glu Gln His
195 200 205
aat gtg cat cac gca gcc aca aat gtt gtt gga cga gac gga gat ctt
672Asn Val His His Ala Ala Thr Asn Val Val Gly Arg Asp Gly Asp Leu
210 215 220
gat tta gtc cca ttc tat gct aca gtg gca gaa cat ctc aac aat tat
720Asp Leu Val Pro Phe Tyr Ala Thr Val Ala Glu His Leu Asn Asn Tyr
225 230 235 240
tct cag gat tca tgg gtt atg act cta ttc aga tgg caa cat gtt cat
768Ser Gln Asp Ser Trp Val Met Thr Leu Phe Arg Trp Gln His Val His
245 250 255
tgg aca ttc atg tta cca ttc ctc cgt ctc tcg tgg ctt ctt cag tca
816Trp Thr Phe Met Leu Pro Phe Leu Arg Leu Ser Trp Leu Leu Gln Ser
260 265 270
atc att ttt gtt agt cag atg cca act cat tat tat gac tat tac aga
864Ile Ile Phe Val Ser Gln Met Pro Thr His Tyr Tyr Asp Tyr Tyr Arg
275 280 285
aat act gcg att tat gaa cag gtt ggt ctc tct ttg cac tgg gct tgg
912Asn Thr Ala Ile Tyr Glu Gln Val Gly Leu Ser Leu His Trp Ala Trp
290 295 300
tca ttg ggt caa ttg tat ttc cta ccc gat tgg tca act aga ata atg
960Ser Leu Gly Gln Leu Tyr Phe Leu Pro Asp Trp Ser Thr Arg Ile Met
305 310 315 320
ttc ttc ctt gtt tct cat ctt gtt gga ggt ttc ctg ctc tct cat gta
1008Phe Phe Leu Val Ser His Leu Val Gly Gly Phe Leu Leu Ser His Val
325 330 335
gtt act ttc aat cat tat tca gtg gag aag ttt gca ttg agc tcg aac
1056Val Thr Phe Asn His Tyr Ser Val Glu Lys Phe Ala Leu Ser Ser Asn
340 345 350
atc atg tca aat tac gct tgt ctt caa atc atg acc aca aga aat atg
1104Ile Met Ser Asn Tyr Ala Cys Leu Gln Ile Met Thr Thr Arg Asn Met
355 360 365
aga cct gga aga ttc att gac tgg ctt tgg gga ggt ctt aac tat cag
1152Arg Pro Gly Arg Phe Ile Asp Trp Leu Trp Gly Gly Leu Asn Tyr Gln
370 375 380
att gag cac cat ctt ttc cca acg atg cca cga cac aac ttg aac act
1200Ile Glu His His Leu Phe Pro Thr Met Pro Arg His Asn Leu Asn Thr
385 390 395 400
gtt atg cca ctt gtt aag gag ttt gca gca gca aat ggt tta cca tac
1248Val Met Pro Leu Val Lys Glu Phe Ala Ala Ala Asn Gly Leu Pro Tyr
405 410 415
atg gtc gac gat tat ttc aca gga ttc tgg ctt gaa att gag caa ttc
1296Met Val Asp Asp Tyr Phe Thr Gly Phe Trp Leu Glu Ile Glu Gln Phe
420 425 430
cga aat att gca aat gtt gct gct aaa ttg act aaa aag att gcc tag
1344Arg Asn Ile Ala Asn Val Ala Ala Lys Leu Thr Lys Lys Ile Ala
435 440 445
8447PRTCeratodon purpureus 8Met Val Leu Arg Glu Gln Glu His Glu Pro Phe
Phe Ile Lys Ile Asp 1 5 10
15 Gly Lys Trp Cys Gln Ile Asp Asp Ala Val Leu Arg Ser His Pro Gly
20 25 30 Gly Ser
Ala Ile Thr Thr Tyr Lys Asn Met Asp Ala Thr Thr Val Phe 35
40 45 His Thr Phe His Thr Gly Ser
Lys Glu Ala Tyr Gln Trp Leu Thr Glu 50 55
60 Leu Lys Lys Glu Cys Pro Thr Gln Glu Pro Glu Ile
Pro Asp Ile Lys 65 70 75
80 Asp Asp Pro Ile Lys Gly Ile Asp Asp Val Asn Met Gly Thr Phe Asn
85 90 95 Ile Ser Glu
Lys Arg Ser Ala Gln Ile Asn Lys Ser Phe Thr Asp Leu 100
105 110 Arg Met Arg Val Arg Ala Glu Gly
Leu Met Asp Gly Ser Pro Leu Phe 115 120
125 Tyr Ile Arg Lys Ile Leu Glu Thr Ile Phe Thr Ile Leu
Phe Ala Phe 130 135 140
Tyr Leu Gln Tyr His Thr Tyr Tyr Leu Pro Ser Ala Ile Leu Met Gly 145
150 155 160 Val Ala Trp Gln
Gln Leu Gly Trp Leu Ile His Glu Phe Ala His His 165
170 175 Gln Leu Phe Lys Asn Arg Tyr Tyr Asn
Asp Leu Ala Ser Tyr Phe Val 180 185
190 Gly Asn Phe Leu Gln Gly Phe Ser Ser Gly Gly Trp Lys Glu
Gln His 195 200 205
Asn Val His His Ala Ala Thr Asn Val Val Gly Arg Asp Gly Asp Leu 210
215 220 Asp Leu Val Pro
Phe Tyr Ala Thr Val Ala Glu His Leu Asn Asn Tyr 225 230
235 240 Ser Gln Asp Ser Trp Val Met Thr Leu
Phe Arg Trp Gln His Val His 245 250
255 Trp Thr Phe Met Leu Pro Phe Leu Arg Leu Ser Trp Leu Leu
Gln Ser 260 265 270
Ile Ile Phe Val Ser Gln Met Pro Thr His Tyr Tyr Asp Tyr Tyr Arg
275 280 285 Asn Thr Ala Ile
Tyr Glu Gln Val Gly Leu Ser Leu His Trp Ala Trp 290
295 300 Ser Leu Gly Gln Leu Tyr Phe Leu
Pro Asp Trp Ser Thr Arg Ile Met 305 310
315 320 Phe Phe Leu Val Ser His Leu Val Gly Gly Phe Leu
Leu Ser His Val 325 330
335 Val Thr Phe Asn His Tyr Ser Val Glu Lys Phe Ala Leu Ser Ser Asn
340 345 350 Ile Met Ser
Asn Tyr Ala Cys Leu Gln Ile Met Thr Thr Arg Asn Met 355
360 365 Arg Pro Gly Arg Phe Ile Asp Trp
Leu Trp Gly Gly Leu Asn Tyr Gln 370 375
380 Ile Glu His His Leu Phe Pro Thr Met Pro Arg His Asn
Leu Asn Thr 385 390 395
400 Val Met Pro Leu Val Lys Glu Phe Ala Ala Ala Asn Gly Leu Pro Tyr
405 410 415 Met Val Asp Asp
Tyr Phe Thr Gly Phe Trp Leu Glu Ile Glu Gln Phe 420
425 430 Arg Asn Ile Ala Asn Val Ala Ala Lys
Leu Thr Lys Lys Ile Ala 435 440
445 91443DNAPhyscomitrella patensCDS(1)..(1443)delta5-desaturase
9atg gcg ccc cac tct gcg gat act gct ggg ctc gtg cct tct gac gaa
48Met Ala Pro His Ser Ala Asp Thr Ala Gly Leu Val Pro Ser Asp Glu
1 5 10 15
ttg agg cta cga acg tcg aat tca aag ggt ccc gaa caa gag caa act
96Leu Arg Leu Arg Thr Ser Asn Ser Lys Gly Pro Glu Gln Glu Gln Thr
20 25 30
ttg aag aag tac acc ctt gaa gat gtc agc cgc cac aac acc cca gca
144Leu Lys Lys Tyr Thr Leu Glu Asp Val Ser Arg His Asn Thr Pro Ala
35 40 45
gat tgt tgg ttg gtg ata tgg ggc aaa gtc tac gat gtc aca agc tgg
192Asp Cys Trp Leu Val Ile Trp Gly Lys Val Tyr Asp Val Thr Ser Trp
50 55 60
att ccc aat cat ccg ggg ggc agt ctc atc cac gta aaa gca ggg cag
240Ile Pro Asn His Pro Gly Gly Ser Leu Ile His Val Lys Ala Gly Gln
65 70 75 80
gat tcc act cag ctt ttc gat tcc tat cac ccc ctt tat gtc agg aaa
288Asp Ser Thr Gln Leu Phe Asp Ser Tyr His Pro Leu Tyr Val Arg Lys
85 90 95
atg ctc gcg aag tac tgt att ggg gaa tta gta ccg tct gct ggt gat
336Met Leu Ala Lys Tyr Cys Ile Gly Glu Leu Val Pro Ser Ala Gly Asp
100 105 110
gac aag ttt aag aaa gca act ctg gag tat gca gat gcc gaa aat gaa
384Asp Lys Phe Lys Lys Ala Thr Leu Glu Tyr Ala Asp Ala Glu Asn Glu
115 120 125
gat ttc tat ttg gtt gtg aag caa cga gtt gaa tct tat ttc aag agt
432Asp Phe Tyr Leu Val Val Lys Gln Arg Val Glu Ser Tyr Phe Lys Ser
130 135 140
aac aag ata aac ccc caa att cat cca cat atg atc ctg aag tca ttg
480Asn Lys Ile Asn Pro Gln Ile His Pro His Met Ile Leu Lys Ser Leu
145 150 155 160
ttc att ctt ggg gga tat ttc gcc agt tac tat tta gcg ttc ttc tgg
528Phe Ile Leu Gly Gly Tyr Phe Ala Ser Tyr Tyr Leu Ala Phe Phe Trp
165 170 175
tct tca agt gtc ctt gtt tct ttg ttt ttc gca ttg tgg atg ggg ttc
576Ser Ser Ser Val Leu Val Ser Leu Phe Phe Ala Leu Trp Met Gly Phe
180 185 190
ttc gca gcg gaa gtc ggc gtg tcg att caa cat gat gga aat cat ggt
624Phe Ala Ala Glu Val Gly Val Ser Ile Gln His Asp Gly Asn His Gly
195 200 205
tca tac act aaa tgg cgt ggc ttt gga tat atc atg gga gcc tcc cta
672Ser Tyr Thr Lys Trp Arg Gly Phe Gly Tyr Ile Met Gly Ala Ser Leu
210 215 220
gat cta gtc gga gcc agt agc ttc atg tgg aga cag caa cac gtt gtg
720Asp Leu Val Gly Ala Ser Ser Phe Met Trp Arg Gln Gln His Val Val
225 230 235 240
gga cat cac tcg ttt aca aat gtg gac aac tac gat cct gat att cgt
768Gly His His Ser Phe Thr Asn Val Asp Asn Tyr Asp Pro Asp Ile Arg
245 250 255
gtg aaa gat cca gat gtc agg agg gtt gcg acc aca caa cca aga caa
816Val Lys Asp Pro Asp Val Arg Arg Val Ala Thr Thr Gln Pro Arg Gln
260 265 270
tgg tat cat gcg tat cag cat atc tac ctg gca gta tta tat gga act
864Trp Tyr His Ala Tyr Gln His Ile Tyr Leu Ala Val Leu Tyr Gly Thr
275 280 285
cta gct ctt aag agt att ttt cta gat gat ttc ctt gcg tac ttc aca
912Leu Ala Leu Lys Ser Ile Phe Leu Asp Asp Phe Leu Ala Tyr Phe Thr
290 295 300
gga tca att ggc cct gtc aag gtg gcg aaa atg acc ccc ctg gag ttc
960Gly Ser Ile Gly Pro Val Lys Val Ala Lys Met Thr Pro Leu Glu Phe
305 310 315 320
aac atc ttc ttt cag gga aag ctg cta tat gcg ttc tac atg ttc gtg
1008Asn Ile Phe Phe Gln Gly Lys Leu Leu Tyr Ala Phe Tyr Met Phe Val
325 330 335
ttg cca tct gtg tac ggt gtt cac tcc gga gga act ttc ttg gca cta
1056Leu Pro Ser Val Tyr Gly Val His Ser Gly Gly Thr Phe Leu Ala Leu
340 345 350
tat gtg gct tct cag ctc att aca ggt tgg atg tta gct ttt ctt ttt
1104Tyr Val Ala Ser Gln Leu Ile Thr Gly Trp Met Leu Ala Phe Leu Phe
355 360 365
caa gta gca cat gtc gtg gat gat gtt gca ttt cct aca cca gaa ggt
1152Gln Val Ala His Val Val Asp Asp Val Ala Phe Pro Thr Pro Glu Gly
370 375 380
ggg aag gtg aag gga gga tgg gct gca atg cag gtt gca aca act acg
1200Gly Lys Val Lys Gly Gly Trp Ala Ala Met Gln Val Ala Thr Thr Thr
385 390 395 400
gat ttc agt cca cgc tca tgg ttc tgg ggt cat gtc tct gga gga tta
1248Asp Phe Ser Pro Arg Ser Trp Phe Trp Gly His Val Ser Gly Gly Leu
405 410 415
aac aac caa att gag cat cat ctg ttt cca gga gtg tgc cat gtt cat
1296Asn Asn Gln Ile Glu His His Leu Phe Pro Gly Val Cys His Val His
420 425 430
tat cca gcc att cag cct att gtc gag aag acg tgc aag gaa ttc gat
1344Tyr Pro Ala Ile Gln Pro Ile Val Glu Lys Thr Cys Lys Glu Phe Asp
435 440 445
gtg cct tat gta gcc tac cca act ttt tgg act gcg ttg aga gcc cac
1392Val Pro Tyr Val Ala Tyr Pro Thr Phe Trp Thr Ala Leu Arg Ala His
450 455 460
ttt gcg cat ttg aaa aag gtt gga ttg aca gag ttt cgg ctc gat ggc
1440Phe Ala His Leu Lys Lys Val Gly Leu Thr Glu Phe Arg Leu Asp Gly
465 470 475 480
tga
144310480PRTPhyscomitrella patens 10Met Ala Pro His Ser Ala Asp Thr Ala
Gly Leu Val Pro Ser Asp Glu 1 5 10
15 Leu Arg Leu Arg Thr Ser Asn Ser Lys Gly Pro Glu Gln Glu
Gln Thr 20 25 30
Leu Lys Lys Tyr Thr Leu Glu Asp Val Ser Arg His Asn Thr Pro Ala
35 40 45 Asp Cys Trp Leu
Val Ile Trp Gly Lys Val Tyr Asp Val Thr Ser Trp 50
55 60 Ile Pro Asn His Pro Gly Gly Ser
Leu Ile His Val Lys Ala Gly Gln 65 70
75 80 Asp Ser Thr Gln Leu Phe Asp Ser Tyr His Pro Leu
Tyr Val Arg Lys 85 90
95 Met Leu Ala Lys Tyr Cys Ile Gly Glu Leu Val Pro Ser Ala Gly Asp
100 105 110 Asp Lys Phe
Lys Lys Ala Thr Leu Glu Tyr Ala Asp Ala Glu Asn Glu 115
120 125 Asp Phe Tyr Leu Val Val Lys Gln
Arg Val Glu Ser Tyr Phe Lys Ser 130 135
140 Asn Lys Ile Asn Pro Gln Ile His Pro His Met Ile Leu
Lys Ser Leu 145 150 155
160 Phe Ile Leu Gly Gly Tyr Phe Ala Ser Tyr Tyr Leu Ala Phe Phe Trp
165 170 175 Ser Ser Ser Val
Leu Val Ser Leu Phe Phe Ala Leu Trp Met Gly Phe 180
185 190 Phe Ala Ala Glu Val Gly Val Ser Ile
Gln His Asp Gly Asn His Gly 195 200
205 Ser Tyr Thr Lys Trp Arg Gly Phe Gly Tyr Ile Met Gly Ala
Ser Leu 210 215 220
Asp Leu Val Gly Ala Ser Ser Phe Met Trp Arg Gln Gln His Val Val 225
230 235 240 Gly His His Ser Phe
Thr Asn Val Asp Asn Tyr Asp Pro Asp Ile Arg 245
250 255 Val Lys Asp Pro Asp Val Arg Arg Val Ala
Thr Thr Gln Pro Arg Gln 260 265
270 Trp Tyr His Ala Tyr Gln His Ile Tyr Leu Ala Val Leu Tyr Gly
Thr 275 280 285 Leu
Ala Leu Lys Ser Ile Phe Leu Asp Asp Phe Leu Ala Tyr Phe Thr 290
295 300 Gly Ser Ile Gly Pro Val
Lys Val Ala Lys Met Thr Pro Leu Glu Phe 305 310
315 320 Asn Ile Phe Phe Gln Gly Lys Leu Leu Tyr Ala
Phe Tyr Met Phe Val 325 330
335 Leu Pro Ser Val Tyr Gly Val His Ser Gly Gly Thr Phe Leu Ala Leu
340 345 350 Tyr Val
Ala Ser Gln Leu Ile Thr Gly Trp Met Leu Ala Phe Leu Phe 355
360 365 Gln Val Ala His Val Val Asp
Asp Val Ala Phe Pro Thr Pro Glu Gly 370 375
380 Gly Lys Val Lys Gly Gly Trp Ala Ala Met Gln Val
Ala Thr Thr Thr 385 390 395
400 Asp Phe Ser Pro Arg Ser Trp Phe Trp Gly His Val Ser Gly Gly Leu
405 410 415 Asn Asn Gln
Ile Glu His His Leu Phe Pro Gly Val Cys His Val His 420
425 430 Tyr Pro Ala Ile Gln Pro Ile Val
Glu Lys Thr Cys Lys Glu Phe Asp 435 440
445 Val Pro Tyr Val Ala Tyr Pro Thr Phe Trp Thr Ala Leu
Arg Ala His 450 455 460
Phe Ala His Leu Lys Lys Val Gly Leu Thr Glu Phe Arg Leu Asp Gly 465
470 475 480
111320DNAThraustrochytriumCDS(1)..(1320) 11atg ggc aag ggc agc gag ggc
cgc agc gcg gcg cgc gag atg acg gcc 48Met Gly Lys Gly Ser Glu Gly
Arg Ser Ala Ala Arg Glu Met Thr Ala 1 5
10 15 gag gcg aac ggc gac aag cgg aaa
acg att ctg atc gag ggc gtc ctg 96Glu Ala Asn Gly Asp Lys Arg Lys
Thr Ile Leu Ile Glu Gly Val Leu 20
25 30 tac gac gcg acg aac ttt aag cac
ccg ggc ggt tcg atc atc aac ttc 144Tyr Asp Ala Thr Asn Phe Lys His
Pro Gly Gly Ser Ile Ile Asn Phe 35 40
45 ttg acc gag ggc gag gcc ggc gtg gac
gcg acg cag gcg tac cgc gag 192Leu Thr Glu Gly Glu Ala Gly Val Asp
Ala Thr Gln Ala Tyr Arg Glu 50 55
60 ttt cat cag cgg tcc ggc aag gcc gac aag
tac ctc aag tcg ctg ccg 240Phe His Gln Arg Ser Gly Lys Ala Asp Lys
Tyr Leu Lys Ser Leu Pro 65 70
75 80 aag ctg gat gcg tcc aag gtg gag tcg cgg
ttc tcg gcc aaa gag cag 288Lys Leu Asp Ala Ser Lys Val Glu Ser Arg
Phe Ser Ala Lys Glu Gln 85 90
95 gcg cgg cgc gac gcc atg acg cgc gac tac gcg
gcc ttt cgc gag gag 336Ala Arg Arg Asp Ala Met Thr Arg Asp Tyr Ala
Ala Phe Arg Glu Glu 100 105
110 ctc gtc gcc gag ggg tac ttt gac ccg tcg atc ccg
cac atg att tac 384Leu Val Ala Glu Gly Tyr Phe Asp Pro Ser Ile Pro
His Met Ile Tyr 115 120
125 cgc gtc gtg gag atc gtg gcg ctc ttc gcg ctc tcg
ttc tgg ctc atg 432Arg Val Val Glu Ile Val Ala Leu Phe Ala Leu Ser
Phe Trp Leu Met 130 135 140
tcc aag gcc tcg ccc acc tcg ctc gtg ctg ggc gtg gtg
atg aac ggc 480Ser Lys Ala Ser Pro Thr Ser Leu Val Leu Gly Val Val
Met Asn Gly 145 150 155
160 att gcg cag ggc cgc tgc ggc tgg gtc atg cac gag atg ggc
cac ggg 528Ile Ala Gln Gly Arg Cys Gly Trp Val Met His Glu Met Gly
His Gly 165 170
175 tcg ttc acg ggc gtc atc tgg ctc gac gac cgg atg tgc gag
ttc ttc 576Ser Phe Thr Gly Val Ile Trp Leu Asp Asp Arg Met Cys Glu
Phe Phe 180 185 190
tac ggc gtc ggc tgc ggc atg agc ggg cac tac tgg aag aac cag
cac 624Tyr Gly Val Gly Cys Gly Met Ser Gly His Tyr Trp Lys Asn Gln
His 195 200 205
agc aag cac cac gcc gcg ccc aac cgc ctc gag cac gat gtc gat ctc
672Ser Lys His His Ala Ala Pro Asn Arg Leu Glu His Asp Val Asp Leu
210 215 220
aac acg ctg ccc ctg gtc gcc ttt aac gag cgc gtc gtg cgc aag gtc
720Asn Thr Leu Pro Leu Val Ala Phe Asn Glu Arg Val Val Arg Lys Val
225 230 235 240
aag ccg gga tcg ctg ctg gcg ctc tgg ctg cgc gtg cag gcg tac ctc
768Lys Pro Gly Ser Leu Leu Ala Leu Trp Leu Arg Val Gln Ala Tyr Leu
245 250 255
ttt gcg ccc gtc tcg tgc ctg ctc atc ggc ctt ggc tgg acg ctc tac
816Phe Ala Pro Val Ser Cys Leu Leu Ile Gly Leu Gly Trp Thr Leu Tyr
260 265 270
ctg cac ccg cgc tac atg ctg cgc acc aag cgg cac atg gag ttc gtc
864Leu His Pro Arg Tyr Met Leu Arg Thr Lys Arg His Met Glu Phe Val
275 280 285
tgg atc ttc gcg cgc tac att ggc tgg ttc tcg ctc atg ggc gct ctc
912Trp Ile Phe Ala Arg Tyr Ile Gly Trp Phe Ser Leu Met Gly Ala Leu
290 295 300
ggc tac tcg ccg ggc acc tcg gtc ggg atg tac ctg tgc tcg ttc ggc
960Gly Tyr Ser Pro Gly Thr Ser Val Gly Met Tyr Leu Cys Ser Phe Gly
305 310 315 320
ctc ggc tgc att tac att ttc ctg cag ttc gcc gtc agc cac acg cac
1008Leu Gly Cys Ile Tyr Ile Phe Leu Gln Phe Ala Val Ser His Thr His
325 330 335
ctg ccg gtg acc aac ccg gag gac cag ctg cac tgg ctc gag tac gcg
1056Leu Pro Val Thr Asn Pro Glu Asp Gln Leu His Trp Leu Glu Tyr Ala
340 345 350
gcc gac cac acg gtg aac att agc acc aag tcc tgg ctc gtc acg tgg
1104Ala Asp His Thr Val Asn Ile Ser Thr Lys Ser Trp Leu Val Thr Trp
355 360 365
tgg atg tcg aac ctg aac ttt cag atc gag cac cac ctc ttc ccc acg
1152Trp Met Ser Asn Leu Asn Phe Gln Ile Glu His His Leu Phe Pro Thr
370 375 380
gcg ccg cag ttc cgc ttc aag gaa atc agt cct cgc gtc gag gcc ctc
1200Ala Pro Gln Phe Arg Phe Lys Glu Ile Ser Pro Arg Val Glu Ala Leu
385 390 395 400
ttc aag cgc cac aac ctc ccg tac tac gac ctg ccc tac acg agc gcg
1248Phe Lys Arg His Asn Leu Pro Tyr Tyr Asp Leu Pro Tyr Thr Ser Ala
405 410 415
gtc tcg acc acc ttt gcc aat ctt tat tcc gtc ggc cac tcg gtc ggc
1296Val Ser Thr Thr Phe Ala Asn Leu Tyr Ser Val Gly His Ser Val Gly
420 425 430
gcc gac acc aag aag cag gac tga
1320Ala Asp Thr Lys Lys Gln Asp
435
12439PRTThraustrochytrium 12Met Gly Lys Gly Ser Glu Gly Arg Ser Ala Ala
Arg Glu Met Thr Ala 1 5 10
15 Glu Ala Asn Gly Asp Lys Arg Lys Thr Ile Leu Ile Glu Gly Val Leu
20 25 30 Tyr Asp
Ala Thr Asn Phe Lys His Pro Gly Gly Ser Ile Ile Asn Phe 35
40 45 Leu Thr Glu Gly Glu Ala Gly
Val Asp Ala Thr Gln Ala Tyr Arg Glu 50 55
60 Phe His Gln Arg Ser Gly Lys Ala Asp Lys Tyr Leu
Lys Ser Leu Pro 65 70 75
80 Lys Leu Asp Ala Ser Lys Val Glu Ser Arg Phe Ser Ala Lys Glu Gln
85 90 95 Ala Arg Arg
Asp Ala Met Thr Arg Asp Tyr Ala Ala Phe Arg Glu Glu 100
105 110 Leu Val Ala Glu Gly Tyr Phe Asp
Pro Ser Ile Pro His Met Ile Tyr 115 120
125 Arg Val Val Glu Ile Val Ala Leu Phe Ala Leu Ser Phe
Trp Leu Met 130 135 140
Ser Lys Ala Ser Pro Thr Ser Leu Val Leu Gly Val Val Met Asn Gly 145
150 155 160 Ile Ala Gln Gly
Arg Cys Gly Trp Val Met His Glu Met Gly His Gly 165
170 175 Ser Phe Thr Gly Val Ile Trp Leu Asp
Asp Arg Met Cys Glu Phe Phe 180 185
190 Tyr Gly Val Gly Cys Gly Met Ser Gly His Tyr Trp Lys Asn
Gln His 195 200 205
Ser Lys His His Ala Ala Pro Asn Arg Leu Glu His Asp Val Asp Leu 210
215 220 Asn Thr Leu Pro
Leu Val Ala Phe Asn Glu Arg Val Val Arg Lys Val 225 230
235 240 Lys Pro Gly Ser Leu Leu Ala Leu Trp
Leu Arg Val Gln Ala Tyr Leu 245 250
255 Phe Ala Pro Val Ser Cys Leu Leu Ile Gly Leu Gly Trp Thr
Leu Tyr 260 265 270
Leu His Pro Arg Tyr Met Leu Arg Thr Lys Arg His Met Glu Phe Val
275 280 285 Trp Ile Phe Ala
Arg Tyr Ile Gly Trp Phe Ser Leu Met Gly Ala Leu 290
295 300 Gly Tyr Ser Pro Gly Thr Ser Val
Gly Met Tyr Leu Cys Ser Phe Gly 305 310
315 320 Leu Gly Cys Ile Tyr Ile Phe Leu Gln Phe Ala Val
Ser His Thr His 325 330
335 Leu Pro Val Thr Asn Pro Glu Asp Gln Leu His Trp Leu Glu Tyr Ala
340 345 350 Ala Asp His
Thr Val Asn Ile Ser Thr Lys Ser Trp Leu Val Thr Trp 355
360 365 Trp Met Ser Asn Leu Asn Phe Gln
Ile Glu His His Leu Phe Pro Thr 370 375
380 Ala Pro Gln Phe Arg Phe Lys Glu Ile Ser Pro Arg Val
Glu Ala Leu 385 390 395
400 Phe Lys Arg His Asn Leu Pro Tyr Tyr Asp Leu Pro Tyr Thr Ser Ala
405 410 415 Val Ser Thr Thr
Phe Ala Asn Leu Tyr Ser Val Gly His Ser Val Gly 420
425 430 Ala Asp Thr Lys Lys Gln Asp
435 131341DNAMortierella
alpinaCDS(1)..(1341)delta5-desaturase 13atg gga acg gac caa gga aaa acc
ttc acc tgg gaa gag ctg gcg gcc 48Met Gly Thr Asp Gln Gly Lys Thr
Phe Thr Trp Glu Glu Leu Ala Ala 1 5
10 15 cat aac acc aag gac gac cta ctc ttg
gcc atc cgc ggc agg gtg tac 96His Asn Thr Lys Asp Asp Leu Leu Leu
Ala Ile Arg Gly Arg Val Tyr 20 25
30 gat gtc aca aag ttc ttg agc cgc cat cct
ggt gga gtg gac act ctc 144Asp Val Thr Lys Phe Leu Ser Arg His Pro
Gly Gly Val Asp Thr Leu 35 40
45 ctg ctc gga gct ggc cga gat gtt act ccg gtc
ttt gag atg tat cac 192Leu Leu Gly Ala Gly Arg Asp Val Thr Pro Val
Phe Glu Met Tyr His 50 55
60 gcg ttt ggg gct gca gat gcc att atg aag aag
tac tat gtc ggt aca 240Ala Phe Gly Ala Ala Asp Ala Ile Met Lys Lys
Tyr Tyr Val Gly Thr 65 70 75
80 ctg gtc tcg aat gag ctg ccc atc ttc ccg gag cca
acg gtg ttc cac 288Leu Val Ser Asn Glu Leu Pro Ile Phe Pro Glu Pro
Thr Val Phe His 85 90
95 aaa acc atc aag acg aga gtc gag ggc tac ttt acg gat
cgg aac att 336Lys Thr Ile Lys Thr Arg Val Glu Gly Tyr Phe Thr Asp
Arg Asn Ile 100 105
110 gat ccc aag aat aga cca gag atc tgg gga cga tac gct
ctt atc ttt 384Asp Pro Lys Asn Arg Pro Glu Ile Trp Gly Arg Tyr Ala
Leu Ile Phe 115 120 125
gga tcc ttg atc gct tcc tac tac gcg cag ctc ttt gtg cct
ttc gtt 432Gly Ser Leu Ile Ala Ser Tyr Tyr Ala Gln Leu Phe Val Pro
Phe Val 130 135 140
gtc gaa cgc aca tgg ctt cag gtg gtg ttt gca atc atc atg gga
ttt 480Val Glu Arg Thr Trp Leu Gln Val Val Phe Ala Ile Ile Met Gly
Phe 145 150 155
160 gcg tgc gca caa gtc gga ctc aac cct ctt cat gat gcg tct cac
ttt 528Ala Cys Ala Gln Val Gly Leu Asn Pro Leu His Asp Ala Ser His
Phe 165 170 175
tca gtg acc cac aac ccc act gtc tgg aag att ctg gga gcc acg cac
576Ser Val Thr His Asn Pro Thr Val Trp Lys Ile Leu Gly Ala Thr His
180 185 190
gac ttt ttc aac gga gca tcg tac ctg gtg tgg atg tac caa cat atg
624Asp Phe Phe Asn Gly Ala Ser Tyr Leu Val Trp Met Tyr Gln His Met
195 200 205
ctc ggc cat cac ccc tac acc aac att gct gga gca gat ccc gac gtg
672Leu Gly His His Pro Tyr Thr Asn Ile Ala Gly Ala Asp Pro Asp Val
210 215 220
tcg acg tct gag ccc gat gtt cgt cgt atc aag ccc aac caa aag tgg
720Ser Thr Ser Glu Pro Asp Val Arg Arg Ile Lys Pro Asn Gln Lys Trp
225 230 235 240
ttt gtc aac cac atc aac cag cac atg ttt gtt cct ttc ctg tac gga
768Phe Val Asn His Ile Asn Gln His Met Phe Val Pro Phe Leu Tyr Gly
245 250 255
ctg ctg gcg ttc aag gtg cgc att cag gac atc aac att ttg tac ttt
816Leu Leu Ala Phe Lys Val Arg Ile Gln Asp Ile Asn Ile Leu Tyr Phe
260 265 270
gtc aag acc aat gac gct att cgt gtc aat ccc atc tcg aca tgg cac
864Val Lys Thr Asn Asp Ala Ile Arg Val Asn Pro Ile Ser Thr Trp His
275 280 285
act gtg atg ttc tgg ggc ggc aag gct ttc ttt gtc tgg tat cgc ctg
912Thr Val Met Phe Trp Gly Gly Lys Ala Phe Phe Val Trp Tyr Arg Leu
290 295 300
att gtt ccc ctg cag tat ctg ccc ctg ggc aag gtg ctg ctc ttg ttc
960Ile Val Pro Leu Gln Tyr Leu Pro Leu Gly Lys Val Leu Leu Leu Phe
305 310 315 320
acg gtc gcg gac atg gtg tcg tct tac tgg ctg gcg ctg acc ttc cag
1008Thr Val Ala Asp Met Val Ser Ser Tyr Trp Leu Ala Leu Thr Phe Gln
325 330 335
gcg aac cac gtt gtt gag gaa gtt cag tgg ccg ttg cct gac gag aac
1056Ala Asn His Val Val Glu Glu Val Gln Trp Pro Leu Pro Asp Glu Asn
340 345 350
ggg atc atc caa aag gac tgg gca gct atg cag gtc gag act acg cag
1104Gly Ile Ile Gln Lys Asp Trp Ala Ala Met Gln Val Glu Thr Thr Gln
355 360 365
gat tac gca cac gat tcg cac ctc tgg acc agc atc act ggc agc ttg
1152Asp Tyr Ala His Asp Ser His Leu Trp Thr Ser Ile Thr Gly Ser Leu
370 375 380
aac tac cag gct gtg cac cat ctg ttc ccc aac gtg tcg cag cac cat
1200Asn Tyr Gln Ala Val His His Leu Phe Pro Asn Val Ser Gln His His
385 390 395 400
tat ccc gat att ctg gcc atc atc aag aac acc tgc agc gag tac aag
1248Tyr Pro Asp Ile Leu Ala Ile Ile Lys Asn Thr Cys Ser Glu Tyr Lys
405 410 415
gtt cca tac ctt gtc aag gat acg ttt tgg caa gca ttt gct tca cat
1296Val Pro Tyr Leu Val Lys Asp Thr Phe Trp Gln Ala Phe Ala Ser His
420 425 430
ttg gag cac ttg cgt gtt ctt gga ctc cgt ccc aag gaa gag tag
1341Leu Glu His Leu Arg Val Leu Gly Leu Arg Pro Lys Glu Glu
435 440 445
14446PRTMortierella alpina 14Met Gly Thr Asp Gln Gly Lys Thr Phe Thr Trp
Glu Glu Leu Ala Ala 1 5 10
15 His Asn Thr Lys Asp Asp Leu Leu Leu Ala Ile Arg Gly Arg Val Tyr
20 25 30 Asp Val
Thr Lys Phe Leu Ser Arg His Pro Gly Gly Val Asp Thr Leu 35
40 45 Leu Leu Gly Ala Gly Arg Asp
Val Thr Pro Val Phe Glu Met Tyr His 50 55
60 Ala Phe Gly Ala Ala Asp Ala Ile Met Lys Lys Tyr
Tyr Val Gly Thr 65 70 75
80 Leu Val Ser Asn Glu Leu Pro Ile Phe Pro Glu Pro Thr Val Phe His
85 90 95 Lys Thr Ile
Lys Thr Arg Val Glu Gly Tyr Phe Thr Asp Arg Asn Ile 100
105 110 Asp Pro Lys Asn Arg Pro Glu Ile
Trp Gly Arg Tyr Ala Leu Ile Phe 115 120
125 Gly Ser Leu Ile Ala Ser Tyr Tyr Ala Gln Leu Phe Val
Pro Phe Val 130 135 140
Val Glu Arg Thr Trp Leu Gln Val Val Phe Ala Ile Ile Met Gly Phe 145
150 155 160 Ala Cys Ala Gln
Val Gly Leu Asn Pro Leu His Asp Ala Ser His Phe 165
170 175 Ser Val Thr His Asn Pro Thr Val Trp
Lys Ile Leu Gly Ala Thr His 180 185
190 Asp Phe Phe Asn Gly Ala Ser Tyr Leu Val Trp Met Tyr Gln
His Met 195 200 205
Leu Gly His His Pro Tyr Thr Asn Ile Ala Gly Ala Asp Pro Asp Val 210
215 220 Ser Thr Ser Glu
Pro Asp Val Arg Arg Ile Lys Pro Asn Gln Lys Trp 225 230
235 240 Phe Val Asn His Ile Asn Gln His Met
Phe Val Pro Phe Leu Tyr Gly 245 250
255 Leu Leu Ala Phe Lys Val Arg Ile Gln Asp Ile Asn Ile Leu
Tyr Phe 260 265 270
Val Lys Thr Asn Asp Ala Ile Arg Val Asn Pro Ile Ser Thr Trp His
275 280 285 Thr Val Met Phe
Trp Gly Gly Lys Ala Phe Phe Val Trp Tyr Arg Leu 290
295 300 Ile Val Pro Leu Gln Tyr Leu Pro
Leu Gly Lys Val Leu Leu Leu Phe 305 310
315 320 Thr Val Ala Asp Met Val Ser Ser Tyr Trp Leu Ala
Leu Thr Phe Gln 325 330
335 Ala Asn His Val Val Glu Glu Val Gln Trp Pro Leu Pro Asp Glu Asn
340 345 350 Gly Ile Ile
Gln Lys Asp Trp Ala Ala Met Gln Val Glu Thr Thr Gln 355
360 365 Asp Tyr Ala His Asp Ser His Leu
Trp Thr Ser Ile Thr Gly Ser Leu 370 375
380 Asn Tyr Gln Ala Val His His Leu Phe Pro Asn Val Ser
Gln His His 385 390 395
400 Tyr Pro Asp Ile Leu Ala Ile Ile Lys Asn Thr Cys Ser Glu Tyr Lys
405 410 415 Val Pro Tyr Leu
Val Lys Asp Thr Phe Trp Gln Ala Phe Ala Ser His 420
425 430 Leu Glu His Leu Arg Val Leu Gly Leu
Arg Pro Lys Glu Glu 435 440 445
151344DNACaenorhabditis elegansCDS(1)..(1344)delta5-desaturase 15atg
gta tta cga gag caa gag cat gag cca ttc ttc att aaa att gat 48Met
Val Leu Arg Glu Gln Glu His Glu Pro Phe Phe Ile Lys Ile Asp 1
5 10 15 gga aaa
tgg tgt caa att gac gat gct gtc ctg aga tca cat cca ggt 96Gly Lys
Trp Cys Gln Ile Asp Asp Ala Val Leu Arg Ser His Pro Gly
20 25 30 ggt agt gca
att act acc tat aaa aat atg gat gcc act acc gta ttc 144Gly Ser Ala
Ile Thr Thr Tyr Lys Asn Met Asp Ala Thr Thr Val Phe 35
40 45 cac aca ttc cat
act ggt tct aaa gaa gcg tat caa tgg ctg aca gaa 192His Thr Phe His
Thr Gly Ser Lys Glu Ala Tyr Gln Trp Leu Thr Glu 50
55 60 ttg aaa aaa gag tgc
cct aca caa gaa cca gag atc cca gat att aag 240Leu Lys Lys Glu Cys
Pro Thr Gln Glu Pro Glu Ile Pro Asp Ile Lys 65
70 75 80 gat gac cca atc aaa
gga att gat gat gtg aac atg gga act ttc aat 288Asp Asp Pro Ile Lys
Gly Ile Asp Asp Val Asn Met Gly Thr Phe Asn 85
90 95 att tct gag aaa cga tct
gcc caa ata aat aaa agt ttc act gat cta 336Ile Ser Glu Lys Arg Ser
Ala Gln Ile Asn Lys Ser Phe Thr Asp Leu 100
105 110 cgt atg cga gtt cgt gca gaa
gga ctt atg gat gga tct cct ttg ttc 384Arg Met Arg Val Arg Ala Glu
Gly Leu Met Asp Gly Ser Pro Leu Phe 115
120 125 tac att aga aaa att ctt gaa
aca atc ttc aca att ctt ttt gca ttc 432Tyr Ile Arg Lys Ile Leu Glu
Thr Ile Phe Thr Ile Leu Phe Ala Phe 130 135
140 tac ctt caa tac cac aca tat tat
ctt cca tca gct att cta atg gga 480Tyr Leu Gln Tyr His Thr Tyr Tyr
Leu Pro Ser Ala Ile Leu Met Gly 145 150
155 160 gtt gcg tgg caa caa ttg gga tgg tta
atc cat gaa ttc gca cat cat 528Val Ala Trp Gln Gln Leu Gly Trp Leu
Ile His Glu Phe Ala His His 165
170 175 cag ttg ttc aaa aac aga tac tac aat
gat ttg gcc agc tat ttc gtt 576Gln Leu Phe Lys Asn Arg Tyr Tyr Asn
Asp Leu Ala Ser Tyr Phe Val 180 185
190 gga aac ttt tta caa gga ttc tca tct ggt
ggt tgg aaa gag cag cac 624Gly Asn Phe Leu Gln Gly Phe Ser Ser Gly
Gly Trp Lys Glu Gln His 195 200
205 aat gtg cat cac gca gcc aca aat gtt gtt gga
cga gac gga gat ctt 672Asn Val His His Ala Ala Thr Asn Val Val Gly
Arg Asp Gly Asp Leu 210 215
220 gat tta gtc cca ttc tat gct aca gtg gca gaa
cat ctc aac aat tat 720Asp Leu Val Pro Phe Tyr Ala Thr Val Ala Glu
His Leu Asn Asn Tyr 225 230 235
240 tct cag gat tca tgg gtt atg act cta ttc aga tgg
caa cat gtt cat 768Ser Gln Asp Ser Trp Val Met Thr Leu Phe Arg Trp
Gln His Val His 245 250
255 tgg aca ttc atg tta cca ttc ctc cgt ctc tcg tgg ctt
ctt cag tca 816Trp Thr Phe Met Leu Pro Phe Leu Arg Leu Ser Trp Leu
Leu Gln Ser 260 265
270 atc att ttt gtt agt cag atg cca act cat tat tat gac
tat tac aga 864Ile Ile Phe Val Ser Gln Met Pro Thr His Tyr Tyr Asp
Tyr Tyr Arg 275 280 285
aat act gcg att tat gaa cag gtt ggt ctc tct ttg cac tgg
gct tgg 912Asn Thr Ala Ile Tyr Glu Gln Val Gly Leu Ser Leu His Trp
Ala Trp 290 295 300
tca ttg ggt caa ttg tat ttc cta ccc gat tgg tca act aga ata
atg 960Ser Leu Gly Gln Leu Tyr Phe Leu Pro Asp Trp Ser Thr Arg Ile
Met 305 310 315
320 ttc ttc ctt gtt tct cat ctt gtt gga ggt ttc ctg ctc tct cat
gta 1008Phe Phe Leu Val Ser His Leu Val Gly Gly Phe Leu Leu Ser His
Val 325 330 335
gtt act ttc aat cat tat tca gtg gag aag ttt gca ttg agc tcg aac
1056Val Thr Phe Asn His Tyr Ser Val Glu Lys Phe Ala Leu Ser Ser Asn
340 345 350
atc atg tca aat tac gct tgt ctt caa atc atg acc aca aga aat atg
1104Ile Met Ser Asn Tyr Ala Cys Leu Gln Ile Met Thr Thr Arg Asn Met
355 360 365
aga cct gga aga ttc att gac tgg ctt tgg gga ggt ctt aac tat cag
1152Arg Pro Gly Arg Phe Ile Asp Trp Leu Trp Gly Gly Leu Asn Tyr Gln
370 375 380
att gag cac cat ctt ttc cca acg atg cca cga cac aac ttg aac act
1200Ile Glu His His Leu Phe Pro Thr Met Pro Arg His Asn Leu Asn Thr
385 390 395 400
gtt atg cca ctt gtt aag gag ttt gca gca gca aat ggt tta cca tac
1248Val Met Pro Leu Val Lys Glu Phe Ala Ala Ala Asn Gly Leu Pro Tyr
405 410 415
atg gtc gac gat tat ttc aca gga ttc tgg ctt gaa att gag caa ttc
1296Met Val Asp Asp Tyr Phe Thr Gly Phe Trp Leu Glu Ile Glu Gln Phe
420 425 430
cga aat att gca aat gtt gct gct aaa ttg act aaa aag att gcc tag
1344Arg Asn Ile Ala Asn Val Ala Ala Lys Leu Thr Lys Lys Ile Ala
435 440 445
16447PRTCaenorhabditis elegans 16Met Val Leu Arg Glu Gln Glu His Glu Pro
Phe Phe Ile Lys Ile Asp 1 5 10
15 Gly Lys Trp Cys Gln Ile Asp Asp Ala Val Leu Arg Ser His Pro
Gly 20 25 30 Gly
Ser Ala Ile Thr Thr Tyr Lys Asn Met Asp Ala Thr Thr Val Phe 35
40 45 His Thr Phe His Thr Gly
Ser Lys Glu Ala Tyr Gln Trp Leu Thr Glu 50 55
60 Leu Lys Lys Glu Cys Pro Thr Gln Glu Pro Glu
Ile Pro Asp Ile Lys 65 70 75
80 Asp Asp Pro Ile Lys Gly Ile Asp Asp Val Asn Met Gly Thr Phe Asn
85 90 95 Ile Ser
Glu Lys Arg Ser Ala Gln Ile Asn Lys Ser Phe Thr Asp Leu 100
105 110 Arg Met Arg Val Arg Ala Glu
Gly Leu Met Asp Gly Ser Pro Leu Phe 115 120
125 Tyr Ile Arg Lys Ile Leu Glu Thr Ile Phe Thr Ile
Leu Phe Ala Phe 130 135 140
Tyr Leu Gln Tyr His Thr Tyr Tyr Leu Pro Ser Ala Ile Leu Met Gly 145
150 155 160 Val Ala Trp
Gln Gln Leu Gly Trp Leu Ile His Glu Phe Ala His His 165
170 175 Gln Leu Phe Lys Asn Arg Tyr Tyr
Asn Asp Leu Ala Ser Tyr Phe Val 180 185
190 Gly Asn Phe Leu Gln Gly Phe Ser Ser Gly Gly Trp Lys
Glu Gln His 195 200 205
Asn Val His His Ala Ala Thr Asn Val Val Gly Arg Asp Gly Asp Leu 210
215 220 Asp Leu Val Pro
Phe Tyr Ala Thr Val Ala Glu His Leu Asn Asn Tyr 225 230
235 240 Ser Gln Asp Ser Trp Val Met Thr Leu
Phe Arg Trp Gln His Val His 245 250
255 Trp Thr Phe Met Leu Pro Phe Leu Arg Leu Ser Trp Leu Leu
Gln Ser 260 265 270
Ile Ile Phe Val Ser Gln Met Pro Thr His Tyr Tyr Asp Tyr Tyr Arg
275 280 285 Asn Thr Ala Ile
Tyr Glu Gln Val Gly Leu Ser Leu His Trp Ala Trp 290
295 300 Ser Leu Gly Gln Leu Tyr Phe Leu
Pro Asp Trp Ser Thr Arg Ile Met 305 310
315 320 Phe Phe Leu Val Ser His Leu Val Gly Gly Phe Leu
Leu Ser His Val 325 330
335 Val Thr Phe Asn His Tyr Ser Val Glu Lys Phe Ala Leu Ser Ser Asn
340 345 350 Ile Met Ser
Asn Tyr Ala Cys Leu Gln Ile Met Thr Thr Arg Asn Met 355
360 365 Arg Pro Gly Arg Phe Ile Asp Trp
Leu Trp Gly Gly Leu Asn Tyr Gln 370 375
380 Ile Glu His His Leu Phe Pro Thr Met Pro Arg His Asn
Leu Asn Thr 385 390 395
400 Val Met Pro Leu Val Lys Glu Phe Ala Ala Ala Asn Gly Leu Pro Tyr
405 410 415 Met Val Asp Asp
Tyr Phe Thr Gly Phe Trp Leu Glu Ile Glu Gln Phe 420
425 430 Arg Asn Ile Ala Asn Val Ala Ala Lys
Leu Thr Lys Lys Ile Ala 435 440
445 171683DNABorago officinalisCDS(42)..(1388)delta6-desaturase
17tatctgccta ccctcccaaa gagagtagtc atttttcatc a atg gct gct caa atc
56 Met Ala Ala Gln Ile
1 5
aag aaa tac att acc tca gat gaa ctc aag aac cac gat aaa ccc gga
104Lys Lys Tyr Ile Thr Ser Asp Glu Leu Lys Asn His Asp Lys Pro Gly
10 15 20
gat cta tgg atc tcg att caa ggg aaa gcc tat gat gtt tcg gat tgg
152Asp Leu Trp Ile Ser Ile Gln Gly Lys Ala Tyr Asp Val Ser Asp Trp
25 30 35
gtg aaa gac cat cca ggt ggc agc ttt ccc ttg aag agt ctt gct ggt
200Val Lys Asp His Pro Gly Gly Ser Phe Pro Leu Lys Ser Leu Ala Gly
40 45 50
caa gag gta act gat gca ttt gtt gca ttc cat cct gcc tct aca tgg
248Gln Glu Val Thr Asp Ala Phe Val Ala Phe His Pro Ala Ser Thr Trp
55 60 65
aag aat ctt gat aag ttt ttc act ggg tat tat ctt aaa gat tac tct
296Lys Asn Leu Asp Lys Phe Phe Thr Gly Tyr Tyr Leu Lys Asp Tyr Ser
70 75 80 85
gtt tct gag gtt tct aaa gat tat agg aag ctt gtg ttt gag ttt tct
344Val Ser Glu Val Ser Lys Asp Tyr Arg Lys Leu Val Phe Glu Phe Ser
90 95 100
aaa atg ggt ttg tat gac aaa aaa ggt cat att atg ttt gca act ttg
392Lys Met Gly Leu Tyr Asp Lys Lys Gly His Ile Met Phe Ala Thr Leu
105 110 115
tgc ttt ata gca atg ctg ttt gct atg agt gtt tat ggg gtt ttg ttt
440Cys Phe Ile Ala Met Leu Phe Ala Met Ser Val Tyr Gly Val Leu Phe
120 125 130
tgt gag ggt gtt ttg gta cat ttg ttt tct ggg tgt ttg atg ggg ttt
488Cys Glu Gly Val Leu Val His Leu Phe Ser Gly Cys Leu Met Gly Phe
135 140 145
ctt tgg att cag agt ggt tgg att gga cat gat gct ggg cat tat atg
536Leu Trp Ile Gln Ser Gly Trp Ile Gly His Asp Ala Gly His Tyr Met
150 155 160 165
gta gtg tct gat tca agg ctt aat aag ttt atg ggt att ttt gct gca
584Val Val Ser Asp Ser Arg Leu Asn Lys Phe Met Gly Ile Phe Ala Ala
170 175 180
aat tgt ctt tca gga ata agt att ggt tgg tgg aaa tgg aac cat aat
632Asn Cys Leu Ser Gly Ile Ser Ile Gly Trp Trp Lys Trp Asn His Asn
185 190 195
gca cat cac att gcc tgt aat agc ctt gaa tat gac cct gat tta caa
680Ala His His Ile Ala Cys Asn Ser Leu Glu Tyr Asp Pro Asp Leu Gln
200 205 210
tat ata cca ttc ctt gtt gtg tct tcc aag ttt ttt ggt tca ctc acc
728Tyr Ile Pro Phe Leu Val Val Ser Ser Lys Phe Phe Gly Ser Leu Thr
215 220 225
tct cat ttc tat gag aaa agg ttg act ttt gac tct tta tca aga ttc
776Ser His Phe Tyr Glu Lys Arg Leu Thr Phe Asp Ser Leu Ser Arg Phe
230 235 240 245
ttt gta agt tat caa cat tgg aca ttt tac cct att atg tgt gct gct
824Phe Val Ser Tyr Gln His Trp Thr Phe Tyr Pro Ile Met Cys Ala Ala
250 255 260
agg ctc aat atg tat gta caa tct ctc ata atg ttg ttg acc aag aga
872Arg Leu Asn Met Tyr Val Gln Ser Leu Ile Met Leu Leu Thr Lys Arg
265 270 275
aat gtg tcc tat cga gct cag gaa ctc ttg gga tgc cta gtg ttc tcg
920Asn Val Ser Tyr Arg Ala Gln Glu Leu Leu Gly Cys Leu Val Phe Ser
280 285 290
att tgg tac ccg ttg ctt gtt tct tgt ttg cct aat tgg ggt gaa aga
968Ile Trp Tyr Pro Leu Leu Val Ser Cys Leu Pro Asn Trp Gly Glu Arg
295 300 305
att atg ttt gtt att gca agt tta tca gtg act gga atg caa caa gtt
1016Ile Met Phe Val Ile Ala Ser Leu Ser Val Thr Gly Met Gln Gln Val
310 315 320 325
cag ttc tcc ttg aac cac ttc tct tca agt gtt tat gtt gga aag cct
1064Gln Phe Ser Leu Asn His Phe Ser Ser Ser Val Tyr Val Gly Lys Pro
330 335 340
aaa ggg aat aat tgg ttt gag aaa caa acg gat ggg aca ctt gac att
1112Lys Gly Asn Asn Trp Phe Glu Lys Gln Thr Asp Gly Thr Leu Asp Ile
345 350 355
tct tgt cct cct tgg atg gat tgg ttt cat ggt gga ttg caa ttc caa
1160Ser Cys Pro Pro Trp Met Asp Trp Phe His Gly Gly Leu Gln Phe Gln
360 365 370
att gag cat cat ttg ttt ccc aag atg cct aga tgc aac ctt agg aaa
1208Ile Glu His His Leu Phe Pro Lys Met Pro Arg Cys Asn Leu Arg Lys
375 380 385
atc tcg ccc tac gtg atc gag tta tgc aag aaa cat aat ttg cct tac
1256Ile Ser Pro Tyr Val Ile Glu Leu Cys Lys Lys His Asn Leu Pro Tyr
390 395 400 405
aat tat gca tct ttc tcc aag gcc aat gaa atg aca ctc aga aca ttg
1304Asn Tyr Ala Ser Phe Ser Lys Ala Asn Glu Met Thr Leu Arg Thr Leu
410 415 420
agg aac aca gca ttg cag gct agg gat ata acc aag ccg ctc ccg aag
1352Arg Asn Thr Ala Leu Gln Ala Arg Asp Ile Thr Lys Pro Leu Pro Lys
425 430 435
aat ttg gta tgg gaa gct ctt cac act cat ggt taa aattaccctt
1398Asn Leu Val Trp Glu Ala Leu His Thr His Gly
440 445
agttcatgta ataatttgag attatgtatc tcctatgttt gtgtcttgtc ttggttctac
1458ttgttggagt cattgcaact tgtcttttat ggtttattag atgtttttta atatatttta
1518gaggttttgc tttcatctcc attattgatg aataaggagt tgcatattgt caattgttgt
1578gctcaatatc tgatattttg gaatgtactt tgtaccactg tgttttcagt tgaagctcat
1638gtgtacttct atagactttg tttaaatggt tatgtcatgt tattt
168318448PRTBorago officinalis 18Met Ala Ala Gln Ile Lys Lys Tyr Ile Thr
Ser Asp Glu Leu Lys Asn 1 5 10
15 His Asp Lys Pro Gly Asp Leu Trp Ile Ser Ile Gln Gly Lys Ala
Tyr 20 25 30 Asp
Val Ser Asp Trp Val Lys Asp His Pro Gly Gly Ser Phe Pro Leu 35
40 45 Lys Ser Leu Ala Gly Gln
Glu Val Thr Asp Ala Phe Val Ala Phe His 50 55
60 Pro Ala Ser Thr Trp Lys Asn Leu Asp Lys Phe
Phe Thr Gly Tyr Tyr 65 70 75
80 Leu Lys Asp Tyr Ser Val Ser Glu Val Ser Lys Asp Tyr Arg Lys Leu
85 90 95 Val Phe
Glu Phe Ser Lys Met Gly Leu Tyr Asp Lys Lys Gly His Ile 100
105 110 Met Phe Ala Thr Leu Cys Phe
Ile Ala Met Leu Phe Ala Met Ser Val 115 120
125 Tyr Gly Val Leu Phe Cys Glu Gly Val Leu Val His
Leu Phe Ser Gly 130 135 140
Cys Leu Met Gly Phe Leu Trp Ile Gln Ser Gly Trp Ile Gly His Asp 145
150 155 160 Ala Gly His
Tyr Met Val Val Ser Asp Ser Arg Leu Asn Lys Phe Met 165
170 175 Gly Ile Phe Ala Ala Asn Cys Leu
Ser Gly Ile Ser Ile Gly Trp Trp 180 185
190 Lys Trp Asn His Asn Ala His His Ile Ala Cys Asn Ser
Leu Glu Tyr 195 200 205
Asp Pro Asp Leu Gln Tyr Ile Pro Phe Leu Val Val Ser Ser Lys Phe 210
215 220 Phe Gly Ser Leu
Thr Ser His Phe Tyr Glu Lys Arg Leu Thr Phe Asp 225 230
235 240 Ser Leu Ser Arg Phe Phe Val Ser Tyr
Gln His Trp Thr Phe Tyr Pro 245 250
255 Ile Met Cys Ala Ala Arg Leu Asn Met Tyr Val Gln Ser Leu
Ile Met 260 265 270
Leu Leu Thr Lys Arg Asn Val Ser Tyr Arg Ala Gln Glu Leu Leu Gly
275 280 285 Cys Leu Val Phe
Ser Ile Trp Tyr Pro Leu Leu Val Ser Cys Leu Pro 290
295 300 Asn Trp Gly Glu Arg Ile Met Phe
Val Ile Ala Ser Leu Ser Val Thr 305 310
315 320 Gly Met Gln Gln Val Gln Phe Ser Leu Asn His Phe
Ser Ser Ser Val 325 330
335 Tyr Val Gly Lys Pro Lys Gly Asn Asn Trp Phe Glu Lys Gln Thr Asp
340 345 350 Gly Thr Leu
Asp Ile Ser Cys Pro Pro Trp Met Asp Trp Phe His Gly 355
360 365 Gly Leu Gln Phe Gln Ile Glu His
His Leu Phe Pro Lys Met Pro Arg 370 375
380 Cys Asn Leu Arg Lys Ile Ser Pro Tyr Val Ile Glu Leu
Cys Lys Lys 385 390 395
400 His Asn Leu Pro Tyr Asn Tyr Ala Ser Phe Ser Lys Ala Asn Glu Met
405 410 415 Thr Leu Arg Thr
Leu Arg Asn Thr Ala Leu Gln Ala Arg Asp Ile Thr 420
425 430 Lys Pro Leu Pro Lys Asn Leu Val Trp
Glu Ala Leu His Thr His Gly 435 440
445 191563DNACeratodon
purpureusCDS(1)..(1563)delta6-desaturase 19atg gtg tcc cag ggc ggc ggt
ctc tcg cag ggt tcc att gaa gaa aac 48Met Val Ser Gln Gly Gly Gly
Leu Ser Gln Gly Ser Ile Glu Glu Asn 1 5
10 15 att gac gtt gag cac ttg gca acg
atg ccc ctc gtc agt gac ttc cta 96Ile Asp Val Glu His Leu Ala Thr
Met Pro Leu Val Ser Asp Phe Leu 20
25 30 aat gtc ctg gga acg act ttg ggc
cag tgg agt ctt tcc act aca ttc 144Asn Val Leu Gly Thr Thr Leu Gly
Gln Trp Ser Leu Ser Thr Thr Phe 35 40
45 gct ttc aag agg ctc acg act aag aaa
cac agt tcg gac atc tcg gtg 192Ala Phe Lys Arg Leu Thr Thr Lys Lys
His Ser Ser Asp Ile Ser Val 50 55
60 gag gca caa aaa gaa tcg gtt gcg cgg ggg
cca gtt gag aat att tct 240Glu Ala Gln Lys Glu Ser Val Ala Arg Gly
Pro Val Glu Asn Ile Ser 65 70
75 80 caa tcg gtt gcg cag ccc atc agg cgg agg
tgg gtg cag gat aaa aag 288Gln Ser Val Ala Gln Pro Ile Arg Arg Arg
Trp Val Gln Asp Lys Lys 85 90
95 ccg gtt act tac agc ctg aag gat gta gct tcg
cac gat atg ccc cag 336Pro Val Thr Tyr Ser Leu Lys Asp Val Ala Ser
His Asp Met Pro Gln 100 105
110 gac tgc tgg att ata atc aaa gag aag gtg tat gat
gtg agc acc ttc 384Asp Cys Trp Ile Ile Ile Lys Glu Lys Val Tyr Asp
Val Ser Thr Phe 115 120
125 gct gag cag cac cct gga ggc acg gtt atc aac acc
tac ttc gga cga 432Ala Glu Gln His Pro Gly Gly Thr Val Ile Asn Thr
Tyr Phe Gly Arg 130 135 140
gac gcc aca gat gtt ttc tct act ttc cac gca tcc acc
tca tgg aag 480Asp Ala Thr Asp Val Phe Ser Thr Phe His Ala Ser Thr
Ser Trp Lys 145 150 155
160 att ctt cag aat ttc tac atc ggg aac ctt gtt agg gag gag
ccg act 528Ile Leu Gln Asn Phe Tyr Ile Gly Asn Leu Val Arg Glu Glu
Pro Thr 165 170
175 ttg gag ctg ctg aag gag tac aga gag ttg aga gcc ctt ttc
ttg aga 576Leu Glu Leu Leu Lys Glu Tyr Arg Glu Leu Arg Ala Leu Phe
Leu Arg 180 185 190
gaa cag ctt ttc aag agt tcc aaa tcc tac tac ctt ttc aag act
ctc 624Glu Gln Leu Phe Lys Ser Ser Lys Ser Tyr Tyr Leu Phe Lys Thr
Leu 195 200 205
ata aat gtt tcc att gtt gcc aca agc att gcg ata atc agt ctg tac
672Ile Asn Val Ser Ile Val Ala Thr Ser Ile Ala Ile Ile Ser Leu Tyr
210 215 220
aag tct tac cgg gcg gtt ctg tta tca gcc agt ttg atg ggc ttg ttt
720Lys Ser Tyr Arg Ala Val Leu Leu Ser Ala Ser Leu Met Gly Leu Phe
225 230 235 240
att caa cag tgc gga tgg ttg tct cac gat ttt cta cac cat cag gta
768Ile Gln Gln Cys Gly Trp Leu Ser His Asp Phe Leu His His Gln Val
245 250 255
ttt gag aca cgc tgg ctc aat gac gtt gtt ggc tat gtg gtc ggc aac
816Phe Glu Thr Arg Trp Leu Asn Asp Val Val Gly Tyr Val Val Gly Asn
260 265 270
gtt gtt ctg gga ttc agt gtc tcg tgg tgg aag acc aag cac aac ctg
864Val Val Leu Gly Phe Ser Val Ser Trp Trp Lys Thr Lys His Asn Leu
275 280 285
cat cat gct gct ccg aat gaa tgc gac caa aag tac aca ccg att gat
912His His Ala Ala Pro Asn Glu Cys Asp Gln Lys Tyr Thr Pro Ile Asp
290 295 300
gag gat att gat act ctc ccc atc att gct tgg agt aaa gat ctc ttg
960Glu Asp Ile Asp Thr Leu Pro Ile Ile Ala Trp Ser Lys Asp Leu Leu
305 310 315 320
gcc act gtt gag agc aag acc atg ttg cga gtt ctt cag tac cag cac
1008Ala Thr Val Glu Ser Lys Thr Met Leu Arg Val Leu Gln Tyr Gln His
325 330 335
cta ttc ttt ttg gtt ctt ttg acg ttt gcc cgg gcg agt tgg cta ttt
1056Leu Phe Phe Leu Val Leu Leu Thr Phe Ala Arg Ala Ser Trp Leu Phe
340 345 350
tgg agc gcg gcc ttc act ctc agg ccc gag ttg acc ctt ggc gag aag
1104Trp Ser Ala Ala Phe Thr Leu Arg Pro Glu Leu Thr Leu Gly Glu Lys
355 360 365
ctt ttg gag agg gga acg atg gct ttg cac tac att tgg ttt aat agt
1152Leu Leu Glu Arg Gly Thr Met Ala Leu His Tyr Ile Trp Phe Asn Ser
370 375 380
gtt gcg ttt tat ctg ctc ccc gga tgg aaa cca gtt gta tgg atg gtg
1200Val Ala Phe Tyr Leu Leu Pro Gly Trp Lys Pro Val Val Trp Met Val
385 390 395 400
gtc agc gag ctc atg tct ggt ttc ctg ctg gga tac gta ttt gta ctc
1248Val Ser Glu Leu Met Ser Gly Phe Leu Leu Gly Tyr Val Phe Val Leu
405 410 415
agt cac aat gga atg gag gtg tac aat acg tca aag gac ttc gtg aat
1296Ser His Asn Gly Met Glu Val Tyr Asn Thr Ser Lys Asp Phe Val Asn
420 425 430
gcc cag att gca tcg act cgc gac atc aaa gca ggg gtg ttt aat gat
1344Ala Gln Ile Ala Ser Thr Arg Asp Ile Lys Ala Gly Val Phe Asn Asp
435 440 445
tgg ttc acc gga ggt ctc aac aga cag att gag cat cat cta ttt cca
1392Trp Phe Thr Gly Gly Leu Asn Arg Gln Ile Glu His His Leu Phe Pro
450 455 460
acg atg ccc agg cac aac ctt aat aaa att tct cct cac gtg gag act
1440Thr Met Pro Arg His Asn Leu Asn Lys Ile Ser Pro His Val Glu Thr
465 470 475 480
ttg tgc aag aag cat gga ctg gtc tac gaa gac gtg agc atg gct tcg
1488Leu Cys Lys Lys His Gly Leu Val Tyr Glu Asp Val Ser Met Ala Ser
485 490 495
ggc act tac cgg gtt ttg aaa aca ctt aag gac gtt gcc gat gct gct
1536Gly Thr Tyr Arg Val Leu Lys Thr Leu Lys Asp Val Ala Asp Ala Ala
500 505 510
tca cac cag cag ctt gct gcg agt tga
1563Ser His Gln Gln Leu Ala Ala Ser
515 520
20520PRTCeratodon purpureus 20Met Val Ser Gln Gly Gly Gly Leu Ser Gln Gly
Ser Ile Glu Glu Asn 1 5 10
15 Ile Asp Val Glu His Leu Ala Thr Met Pro Leu Val Ser Asp Phe Leu
20 25 30 Asn Val
Leu Gly Thr Thr Leu Gly Gln Trp Ser Leu Ser Thr Thr Phe 35
40 45 Ala Phe Lys Arg Leu Thr Thr
Lys Lys His Ser Ser Asp Ile Ser Val 50 55
60 Glu Ala Gln Lys Glu Ser Val Ala Arg Gly Pro Val
Glu Asn Ile Ser 65 70 75
80 Gln Ser Val Ala Gln Pro Ile Arg Arg Arg Trp Val Gln Asp Lys Lys
85 90 95 Pro Val Thr
Tyr Ser Leu Lys Asp Val Ala Ser His Asp Met Pro Gln 100
105 110 Asp Cys Trp Ile Ile Ile Lys Glu
Lys Val Tyr Asp Val Ser Thr Phe 115 120
125 Ala Glu Gln His Pro Gly Gly Thr Val Ile Asn Thr Tyr
Phe Gly Arg 130 135 140
Asp Ala Thr Asp Val Phe Ser Thr Phe His Ala Ser Thr Ser Trp Lys 145
150 155 160 Ile Leu Gln Asn
Phe Tyr Ile Gly Asn Leu Val Arg Glu Glu Pro Thr 165
170 175 Leu Glu Leu Leu Lys Glu Tyr Arg Glu
Leu Arg Ala Leu Phe Leu Arg 180 185
190 Glu Gln Leu Phe Lys Ser Ser Lys Ser Tyr Tyr Leu Phe Lys
Thr Leu 195 200 205
Ile Asn Val Ser Ile Val Ala Thr Ser Ile Ala Ile Ile Ser Leu Tyr 210
215 220 Lys Ser Tyr Arg
Ala Val Leu Leu Ser Ala Ser Leu Met Gly Leu Phe 225 230
235 240 Ile Gln Gln Cys Gly Trp Leu Ser His
Asp Phe Leu His His Gln Val 245 250
255 Phe Glu Thr Arg Trp Leu Asn Asp Val Val Gly Tyr Val Val
Gly Asn 260 265 270
Val Val Leu Gly Phe Ser Val Ser Trp Trp Lys Thr Lys His Asn Leu
275 280 285 His His Ala Ala
Pro Asn Glu Cys Asp Gln Lys Tyr Thr Pro Ile Asp 290
295 300 Glu Asp Ile Asp Thr Leu Pro Ile
Ile Ala Trp Ser Lys Asp Leu Leu 305 310
315 320 Ala Thr Val Glu Ser Lys Thr Met Leu Arg Val Leu
Gln Tyr Gln His 325 330
335 Leu Phe Phe Leu Val Leu Leu Thr Phe Ala Arg Ala Ser Trp Leu Phe
340 345 350 Trp Ser Ala
Ala Phe Thr Leu Arg Pro Glu Leu Thr Leu Gly Glu Lys 355
360 365 Leu Leu Glu Arg Gly Thr Met Ala
Leu His Tyr Ile Trp Phe Asn Ser 370 375
380 Val Ala Phe Tyr Leu Leu Pro Gly Trp Lys Pro Val Val
Trp Met Val 385 390 395
400 Val Ser Glu Leu Met Ser Gly Phe Leu Leu Gly Tyr Val Phe Val Leu
405 410 415 Ser His Asn Gly
Met Glu Val Tyr Asn Thr Ser Lys Asp Phe Val Asn 420
425 430 Ala Gln Ile Ala Ser Thr Arg Asp Ile
Lys Ala Gly Val Phe Asn Asp 435 440
445 Trp Phe Thr Gly Gly Leu Asn Arg Gln Ile Glu His His Leu
Phe Pro 450 455 460
Thr Met Pro Arg His Asn Leu Asn Lys Ile Ser Pro His Val Glu Thr 465
470 475 480 Leu Cys Lys Lys His
Gly Leu Val Tyr Glu Asp Val Ser Met Ala Ser 485
490 495 Gly Thr Tyr Arg Val Leu Lys Thr Leu Lys
Asp Val Ala Asp Ala Ala 500 505
510 Ser His Gln Gln Leu Ala Ala Ser 515
520 211434DNAPhaeodactylum tricornutumCDS(1)..(1434)delta6-desaturase
21atg ggc aaa gga ggg gac gct cgg gcc tcg aag ggc tca acg gcg gct
48Met Gly Lys Gly Gly Asp Ala Arg Ala Ser Lys Gly Ser Thr Ala Ala
1 5 10 15
cgc aag atc agt tgg cag gaa gtc aag acc cac gcg tct ccg gag gac
96Arg Lys Ile Ser Trp Gln Glu Val Lys Thr His Ala Ser Pro Glu Asp
20 25 30
gcc tgg atc att cac tcc aat aag gtc tac gac gtg tcc aac tgg cac
144Ala Trp Ile Ile His Ser Asn Lys Val Tyr Asp Val Ser Asn Trp His
35 40 45
gaa cat ccc gga ggc gcc gtc att ttc acg cac gcc ggt gac gac atg
192Glu His Pro Gly Gly Ala Val Ile Phe Thr His Ala Gly Asp Asp Met
50 55 60
acg gac att ttc gct gcc ttt cac gca ccc gga tcg cag tcg ctc atg
240Thr Asp Ile Phe Ala Ala Phe His Ala Pro Gly Ser Gln Ser Leu Met
65 70 75 80
aag aag ttc tac att ggc gaa ttg ctc ccg gaa acc acc ggc aag gag
288Lys Lys Phe Tyr Ile Gly Glu Leu Leu Pro Glu Thr Thr Gly Lys Glu
85 90 95
ccg cag caa atc gcc ttt gaa aag ggc tac cgc gat ctg cgc tcc aaa
336Pro Gln Gln Ile Ala Phe Glu Lys Gly Tyr Arg Asp Leu Arg Ser Lys
100 105 110
ctc atc atg atg ggc atg ttc aag tcc aac aag tgg ttc tac gtc tac
384Leu Ile Met Met Gly Met Phe Lys Ser Asn Lys Trp Phe Tyr Val Tyr
115 120 125
aag tgc ctc agc aac atg gcc att tgg gcc gcc gcc tgt gct ctc gtc
432Lys Cys Leu Ser Asn Met Ala Ile Trp Ala Ala Ala Cys Ala Leu Val
130 135 140
ttt tac tcg gac cgc ttc tgg gta cac ctg gcc agc gcc gtc atg ctg
480Phe Tyr Ser Asp Arg Phe Trp Val His Leu Ala Ser Ala Val Met Leu
145 150 155 160
gga aca ttc ttt cag cag tcg gga tgg ttg gca cac gac ttt ctg cac
528Gly Thr Phe Phe Gln Gln Ser Gly Trp Leu Ala His Asp Phe Leu His
165 170 175
cac cag gtc ttc acc aag cgc aag cac ggg gat ctc gga gga ctc ttt
576His Gln Val Phe Thr Lys Arg Lys His Gly Asp Leu Gly Gly Leu Phe
180 185 190
tgg ggg aac ctc atg cag ggt tac tcc gta cag tgg tgg aaa aac aag
624Trp Gly Asn Leu Met Gln Gly Tyr Ser Val Gln Trp Trp Lys Asn Lys
195 200 205
cac aac gga cac cac gcc gtc ccc aac ctc cac tgc tcc tcc gca gtc
672His Asn Gly His His Ala Val Pro Asn Leu His Cys Ser Ser Ala Val
210 215 220
gcg caa gat ggg gac ccg gac atc gat acc atg ccc ctt ctc gcc tgg
720Ala Gln Asp Gly Asp Pro Asp Ile Asp Thr Met Pro Leu Leu Ala Trp
225 230 235 240
tcc gtc cag caa gcc cag tct tac cgg gaa ctc caa gcc gac gga aag
768Ser Val Gln Gln Ala Gln Ser Tyr Arg Glu Leu Gln Ala Asp Gly Lys
245 250 255
gat tcg ggt ttg gtc aag ttc atg atc cgt aac caa tcc tac ttt tac
816Asp Ser Gly Leu Val Lys Phe Met Ile Arg Asn Gln Ser Tyr Phe Tyr
260 265 270
ttt ccc atc ttg ttg ctc gcc cgc ctg tcg tgg ttg aac gag tcc ttc
864Phe Pro Ile Leu Leu Leu Ala Arg Leu Ser Trp Leu Asn Glu Ser Phe
275 280 285
aag tgc gcc ttt ggg ctt gga gct gcg tcg gag aac gct gct ctc gaa
912Lys Cys Ala Phe Gly Leu Gly Ala Ala Ser Glu Asn Ala Ala Leu Glu
290 295 300
ctc aag gcc aag ggt ctt cag tac ccc ctt ttg gaa aag gct ggc atc
960Leu Lys Ala Lys Gly Leu Gln Tyr Pro Leu Leu Glu Lys Ala Gly Ile
305 310 315 320
ctg ctg cac tac gct tgg atg ctt aca gtt tcg tcc ggc ttt gga cgc
1008Leu Leu His Tyr Ala Trp Met Leu Thr Val Ser Ser Gly Phe Gly Arg
325 330 335
ttc tcg ttc gcg tac acc gca ttt tac ttt cta acc gcg acc gcg tcc
1056Phe Ser Phe Ala Tyr Thr Ala Phe Tyr Phe Leu Thr Ala Thr Ala Ser
340 345 350
tgt gga ttc ttg ctc gcc att gtc ttt ggc ctc ggc cac aac ggc atg
1104Cys Gly Phe Leu Leu Ala Ile Val Phe Gly Leu Gly His Asn Gly Met
355 360 365
gcc acc tac aat gcc gac gcc cgt ccg gac ttc tgg aag ctc caa gtc
1152Ala Thr Tyr Asn Ala Asp Ala Arg Pro Asp Phe Trp Lys Leu Gln Val
370 375 380
acc acg act cgc aac gtc acg ggc gga cac ggt ttc ccc caa gcc ttt
1200Thr Thr Thr Arg Asn Val Thr Gly Gly His Gly Phe Pro Gln Ala Phe
385 390 395 400
gtc gac tgg ttc tgt ggt ggc ctc cag tac caa gtc gac cac cac tta
1248Val Asp Trp Phe Cys Gly Gly Leu Gln Tyr Gln Val Asp His His Leu
405 410 415
ttc ccc agc ctg ccc cga cac aat ctg gcc aag aca cac gca ctg gtc
1296Phe Pro Ser Leu Pro Arg His Asn Leu Ala Lys Thr His Ala Leu Val
420 425 430
gaa tcg ttc tgc aag gag tgg ggt gtc cag tac cac gaa gcc gac ctt
1344Glu Ser Phe Cys Lys Glu Trp Gly Val Gln Tyr His Glu Ala Asp Leu
435 440 445
gtg gac ggg acc atg gaa gtc ttg cac cat ttg ggc agc gtg gcc ggc
1392Val Asp Gly Thr Met Glu Val Leu His His Leu Gly Ser Val Ala Gly
450 455 460
gaa ttc gtc gtg gat ttt gta cgc gat gga ccc gcc atg taa
1434Glu Phe Val Val Asp Phe Val Arg Asp Gly Pro Ala Met
465 470 475
22477PRTPhaeodactylum tricornutum 22Met Gly Lys Gly Gly Asp Ala Arg Ala
Ser Lys Gly Ser Thr Ala Ala 1 5 10
15 Arg Lys Ile Ser Trp Gln Glu Val Lys Thr His Ala Ser Pro
Glu Asp 20 25 30
Ala Trp Ile Ile His Ser Asn Lys Val Tyr Asp Val Ser Asn Trp His
35 40 45 Glu His Pro Gly
Gly Ala Val Ile Phe Thr His Ala Gly Asp Asp Met 50
55 60 Thr Asp Ile Phe Ala Ala Phe His
Ala Pro Gly Ser Gln Ser Leu Met 65 70
75 80 Lys Lys Phe Tyr Ile Gly Glu Leu Leu Pro Glu Thr
Thr Gly Lys Glu 85 90
95 Pro Gln Gln Ile Ala Phe Glu Lys Gly Tyr Arg Asp Leu Arg Ser Lys
100 105 110 Leu Ile Met
Met Gly Met Phe Lys Ser Asn Lys Trp Phe Tyr Val Tyr 115
120 125 Lys Cys Leu Ser Asn Met Ala Ile
Trp Ala Ala Ala Cys Ala Leu Val 130 135
140 Phe Tyr Ser Asp Arg Phe Trp Val His Leu Ala Ser Ala
Val Met Leu 145 150 155
160 Gly Thr Phe Phe Gln Gln Ser Gly Trp Leu Ala His Asp Phe Leu His
165 170 175 His Gln Val Phe
Thr Lys Arg Lys His Gly Asp Leu Gly Gly Leu Phe 180
185 190 Trp Gly Asn Leu Met Gln Gly Tyr Ser
Val Gln Trp Trp Lys Asn Lys 195 200
205 His Asn Gly His His Ala Val Pro Asn Leu His Cys Ser Ser
Ala Val 210 215 220
Ala Gln Asp Gly Asp Pro Asp Ile Asp Thr Met Pro Leu Leu Ala Trp 225
230 235 240 Ser Val Gln Gln Ala
Gln Ser Tyr Arg Glu Leu Gln Ala Asp Gly Lys 245
250 255 Asp Ser Gly Leu Val Lys Phe Met Ile Arg
Asn Gln Ser Tyr Phe Tyr 260 265
270 Phe Pro Ile Leu Leu Leu Ala Arg Leu Ser Trp Leu Asn Glu Ser
Phe 275 280 285 Lys
Cys Ala Phe Gly Leu Gly Ala Ala Ser Glu Asn Ala Ala Leu Glu 290
295 300 Leu Lys Ala Lys Gly Leu
Gln Tyr Pro Leu Leu Glu Lys Ala Gly Ile 305 310
315 320 Leu Leu His Tyr Ala Trp Met Leu Thr Val Ser
Ser Gly Phe Gly Arg 325 330
335 Phe Ser Phe Ala Tyr Thr Ala Phe Tyr Phe Leu Thr Ala Thr Ala Ser
340 345 350 Cys Gly
Phe Leu Leu Ala Ile Val Phe Gly Leu Gly His Asn Gly Met 355
360 365 Ala Thr Tyr Asn Ala Asp Ala
Arg Pro Asp Phe Trp Lys Leu Gln Val 370 375
380 Thr Thr Thr Arg Asn Val Thr Gly Gly His Gly Phe
Pro Gln Ala Phe 385 390 395
400 Val Asp Trp Phe Cys Gly Gly Leu Gln Tyr Gln Val Asp His His Leu
405 410 415 Phe Pro Ser
Leu Pro Arg His Asn Leu Ala Lys Thr His Ala Leu Val 420
425 430 Glu Ser Phe Cys Lys Glu Trp Gly
Val Gln Tyr His Glu Ala Asp Leu 435 440
445 Val Asp Gly Thr Met Glu Val Leu His His Leu Gly Ser
Val Ala Gly 450 455 460
Glu Phe Val Val Asp Phe Val Arg Asp Gly Pro Ala Met 465
470 475 231578DNAPhyscomitrella
patensCDS(1)..(1578)delta6-desaturase 23atg gta ttc gcg ggc ggt gga ctt
cag cag ggc tct ctc gaa gaa aac 48Met Val Phe Ala Gly Gly Gly Leu
Gln Gln Gly Ser Leu Glu Glu Asn 1 5
10 15 atc gac gtc gag cac att gcc agt atg
tct ctc ttc agc gac ttc ttc 96Ile Asp Val Glu His Ile Ala Ser Met
Ser Leu Phe Ser Asp Phe Phe 20 25
30 agt tat gtg tct tca act gtt ggt tcg tgg
agc gta cac agt ata caa 144Ser Tyr Val Ser Ser Thr Val Gly Ser Trp
Ser Val His Ser Ile Gln 35 40
45 cct ttg aag cgc ctg acg agt aag aag cgt gtt
tcg gaa agc gct gcc 192Pro Leu Lys Arg Leu Thr Ser Lys Lys Arg Val
Ser Glu Ser Ala Ala 50 55
60 gtg caa tgt ata tca gct gaa gtt cag aga aat
tcg agt acc cag gga 240Val Gln Cys Ile Ser Ala Glu Val Gln Arg Asn
Ser Ser Thr Gln Gly 65 70 75
80 act gcg gag gca ctc gca gaa tca gtc gtg aag ccc
acg aga cga agg 288Thr Ala Glu Ala Leu Ala Glu Ser Val Val Lys Pro
Thr Arg Arg Arg 85 90
95 tca tct cag tgg aag aag tcg aca cac ccc cta tca gaa
gta gca gta 336Ser Ser Gln Trp Lys Lys Ser Thr His Pro Leu Ser Glu
Val Ala Val 100 105
110 cac aac aag cca agc gat tgc tgg att gtt gta aaa aac
aag gtg tat 384His Asn Lys Pro Ser Asp Cys Trp Ile Val Val Lys Asn
Lys Val Tyr 115 120 125
gat gtt tcc aat ttt gcg gac gag cat ccc gga gga tca gtt
att agt 432Asp Val Ser Asn Phe Ala Asp Glu His Pro Gly Gly Ser Val
Ile Ser 130 135 140
act tat ttt gga cga gac ggc aca gat gtt ttc tct agt ttt cat
gca 480Thr Tyr Phe Gly Arg Asp Gly Thr Asp Val Phe Ser Ser Phe His
Ala 145 150 155
160 gct tct aca tgg aaa att ctt caa gac ttt tac att ggt gac gtg
gag 528Ala Ser Thr Trp Lys Ile Leu Gln Asp Phe Tyr Ile Gly Asp Val
Glu 165 170 175
agg gtg gag ccg act cca gag ctg ctg aaa gat ttc cga gaa atg aga
576Arg Val Glu Pro Thr Pro Glu Leu Leu Lys Asp Phe Arg Glu Met Arg
180 185 190
gct ctt ttc ctg agg gag caa ctt ttc aaa agt tcg aaa ttg tac tat
624Ala Leu Phe Leu Arg Glu Gln Leu Phe Lys Ser Ser Lys Leu Tyr Tyr
195 200 205
gtt atg aag ctg ctc acg aat gtt gct att ttt gct gcg agc att gca
672Val Met Lys Leu Leu Thr Asn Val Ala Ile Phe Ala Ala Ser Ile Ala
210 215 220
ata ata tgt tgg agc aag act att tca gcg gtt ttg gct tca gct tgt
720Ile Ile Cys Trp Ser Lys Thr Ile Ser Ala Val Leu Ala Ser Ala Cys
225 230 235 240
atg atg gct ctg tgt ttc caa cag tgc gga tgg cta tcc cat gat ttt
768Met Met Ala Leu Cys Phe Gln Gln Cys Gly Trp Leu Ser His Asp Phe
245 250 255
ctc cac aat cag gtg ttt gag aca cgc tgg ctt aat gaa gtt gtc ggg
816Leu His Asn Gln Val Phe Glu Thr Arg Trp Leu Asn Glu Val Val Gly
260 265 270
tat gtg atc ggc aac gcc gtt ctg ggg ttt agt aca ggg tgg tgg aag
864Tyr Val Ile Gly Asn Ala Val Leu Gly Phe Ser Thr Gly Trp Trp Lys
275 280 285
gag aag cat aac ctt cat cat gct gct cca aat gaa tgc gat cag act
912Glu Lys His Asn Leu His His Ala Ala Pro Asn Glu Cys Asp Gln Thr
290 295 300
tac caa cca att gat gaa gat att gat act ctc ccc ctc att gcc tgg
960Tyr Gln Pro Ile Asp Glu Asp Ile Asp Thr Leu Pro Leu Ile Ala Trp
305 310 315 320
agc aag gac ata ctg gcc aca gtt gag aat aag aca ttc ttg cga atc
1008Ser Lys Asp Ile Leu Ala Thr Val Glu Asn Lys Thr Phe Leu Arg Ile
325 330 335
ctc caa tac cag cat ctg ttc ttc atg ggt ctg tta ttt ttc gcc cgt
1056Leu Gln Tyr Gln His Leu Phe Phe Met Gly Leu Leu Phe Phe Ala Arg
340 345 350
ggt agt tgg ctc ttt tgg agc tgg aga tat acc tct aca gca gtg ctc
1104Gly Ser Trp Leu Phe Trp Ser Trp Arg Tyr Thr Ser Thr Ala Val Leu
355 360 365
tca cct gtc gac agg ttg ttg gag aag gga act gtt ctg ttt cac tac
1152Ser Pro Val Asp Arg Leu Leu Glu Lys Gly Thr Val Leu Phe His Tyr
370 375 380
ttt tgg ttc gtc ggg aca gcg tgc tat ctt ctc cct ggt tgg aag cca
1200Phe Trp Phe Val Gly Thr Ala Cys Tyr Leu Leu Pro Gly Trp Lys Pro
385 390 395 400
tta gta tgg atg gcg gtg act gag ctc atg tcc ggc atg ctg ctg ggc
1248Leu Val Trp Met Ala Val Thr Glu Leu Met Ser Gly Met Leu Leu Gly
405 410 415
ttt gta ttt gta ctt agc cac aat ggg atg gag gtt tat aat tcg tct
1296Phe Val Phe Val Leu Ser His Asn Gly Met Glu Val Tyr Asn Ser Ser
420 425 430
aaa gaa ttc gtg agt gca cag atc gta tcc aca cgg gat atc aaa gga
1344Lys Glu Phe Val Ser Ala Gln Ile Val Ser Thr Arg Asp Ile Lys Gly
435 440 445
aac ata ttc aac gac tgg ttc act ggt ggc ctt aac agg caa ata gag
1392Asn Ile Phe Asn Asp Trp Phe Thr Gly Gly Leu Asn Arg Gln Ile Glu
450 455 460
cat cat ctt ttc cca aca atg ccc agg cat aat tta aac aaa ata gca
1440His His Leu Phe Pro Thr Met Pro Arg His Asn Leu Asn Lys Ile Ala
465 470 475 480
cct aga gtg gag gtg ttc tgt aag aaa cac ggt ctg gtg tac gaa gac
1488Pro Arg Val Glu Val Phe Cys Lys Lys His Gly Leu Val Tyr Glu Asp
485 490 495
gta tct att gct acc ggc act tgc aag gtt ttg aaa gca ttg aag gaa
1536Val Ser Ile Ala Thr Gly Thr Cys Lys Val Leu Lys Ala Leu Lys Glu
500 505 510
gtc gcg gag gct gcg gca gag cag cat gct acc acc agt taa
1578Val Ala Glu Ala Ala Ala Glu Gln His Ala Thr Thr Ser
515 520 525
24525PRTPhyscomitrella patens 24Met Val Phe Ala Gly Gly Gly Leu Gln Gln
Gly Ser Leu Glu Glu Asn 1 5 10
15 Ile Asp Val Glu His Ile Ala Ser Met Ser Leu Phe Ser Asp Phe
Phe 20 25 30 Ser
Tyr Val Ser Ser Thr Val Gly Ser Trp Ser Val His Ser Ile Gln 35
40 45 Pro Leu Lys Arg Leu Thr
Ser Lys Lys Arg Val Ser Glu Ser Ala Ala 50 55
60 Val Gln Cys Ile Ser Ala Glu Val Gln Arg Asn
Ser Ser Thr Gln Gly 65 70 75
80 Thr Ala Glu Ala Leu Ala Glu Ser Val Val Lys Pro Thr Arg Arg Arg
85 90 95 Ser Ser
Gln Trp Lys Lys Ser Thr His Pro Leu Ser Glu Val Ala Val 100
105 110 His Asn Lys Pro Ser Asp Cys
Trp Ile Val Val Lys Asn Lys Val Tyr 115 120
125 Asp Val Ser Asn Phe Ala Asp Glu His Pro Gly Gly
Ser Val Ile Ser 130 135 140
Thr Tyr Phe Gly Arg Asp Gly Thr Asp Val Phe Ser Ser Phe His Ala 145
150 155 160 Ala Ser Thr
Trp Lys Ile Leu Gln Asp Phe Tyr Ile Gly Asp Val Glu 165
170 175 Arg Val Glu Pro Thr Pro Glu Leu
Leu Lys Asp Phe Arg Glu Met Arg 180 185
190 Ala Leu Phe Leu Arg Glu Gln Leu Phe Lys Ser Ser Lys
Leu Tyr Tyr 195 200 205
Val Met Lys Leu Leu Thr Asn Val Ala Ile Phe Ala Ala Ser Ile Ala 210
215 220 Ile Ile Cys Trp
Ser Lys Thr Ile Ser Ala Val Leu Ala Ser Ala Cys 225 230
235 240 Met Met Ala Leu Cys Phe Gln Gln Cys
Gly Trp Leu Ser His Asp Phe 245 250
255 Leu His Asn Gln Val Phe Glu Thr Arg Trp Leu Asn Glu Val
Val Gly 260 265 270
Tyr Val Ile Gly Asn Ala Val Leu Gly Phe Ser Thr Gly Trp Trp Lys
275 280 285 Glu Lys His Asn
Leu His His Ala Ala Pro Asn Glu Cys Asp Gln Thr 290
295 300 Tyr Gln Pro Ile Asp Glu Asp Ile
Asp Thr Leu Pro Leu Ile Ala Trp 305 310
315 320 Ser Lys Asp Ile Leu Ala Thr Val Glu Asn Lys Thr
Phe Leu Arg Ile 325 330
335 Leu Gln Tyr Gln His Leu Phe Phe Met Gly Leu Leu Phe Phe Ala Arg
340 345 350 Gly Ser Trp
Leu Phe Trp Ser Trp Arg Tyr Thr Ser Thr Ala Val Leu 355
360 365 Ser Pro Val Asp Arg Leu Leu Glu
Lys Gly Thr Val Leu Phe His Tyr 370 375
380 Phe Trp Phe Val Gly Thr Ala Cys Tyr Leu Leu Pro Gly
Trp Lys Pro 385 390 395
400 Leu Val Trp Met Ala Val Thr Glu Leu Met Ser Gly Met Leu Leu Gly
405 410 415 Phe Val Phe Val
Leu Ser His Asn Gly Met Glu Val Tyr Asn Ser Ser 420
425 430 Lys Glu Phe Val Ser Ala Gln Ile Val
Ser Thr Arg Asp Ile Lys Gly 435 440
445 Asn Ile Phe Asn Asp Trp Phe Thr Gly Gly Leu Asn Arg Gln
Ile Glu 450 455 460
His His Leu Phe Pro Thr Met Pro Arg His Asn Leu Asn Lys Ile Ala 465
470 475 480 Pro Arg Val Glu Val
Phe Cys Lys Lys His Gly Leu Val Tyr Glu Asp 485
490 495 Val Ser Ile Ala Thr Gly Thr Cys Lys Val
Leu Lys Ala Leu Lys Glu 500 505
510 Val Ala Glu Ala Ala Ala Glu Gln His Ala Thr Thr Ser
515 520 525 251332DNACaenorhabditis
elegansCDS(1)..(1332)delta6-desaturase 25atg gtc gtc gac aag aat gcc tcc
ggg ctt cga atg aag gtc gat ggc 48Met Val Val Asp Lys Asn Ala Ser
Gly Leu Arg Met Lys Val Asp Gly 1 5
10 15 aaa tgg ctc tac ctt agc gag gaa ttg
gtg aag aaa cat cca gga gga 96Lys Trp Leu Tyr Leu Ser Glu Glu Leu
Val Lys Lys His Pro Gly Gly 20 25
30 gct gtt att gaa caa tat aga aat tcg gat
gct act cat att ttc cac 144Ala Val Ile Glu Gln Tyr Arg Asn Ser Asp
Ala Thr His Ile Phe His 35 40
45 gct ttc cac gaa gga tct tct cag gct tat aag
caa ctt gac ctt ctg 192Ala Phe His Glu Gly Ser Ser Gln Ala Tyr Lys
Gln Leu Asp Leu Leu 50 55
60 aaa aag cac gga gag cac gat gaa ttc ctt gag
aaa caa ttg gaa aag 240Lys Lys His Gly Glu His Asp Glu Phe Leu Glu
Lys Gln Leu Glu Lys 65 70 75
80 aga ctt gac aaa gtt gat atc aat gta tca gca tat
gat gtc agt gtt 288Arg Leu Asp Lys Val Asp Ile Asn Val Ser Ala Tyr
Asp Val Ser Val 85 90
95 gca caa gaa aag aaa atg gtt gaa tca ttc gaa aaa cta
cga cag aag 336Ala Gln Glu Lys Lys Met Val Glu Ser Phe Glu Lys Leu
Arg Gln Lys 100 105
110 ctt cat gat gat gga tta atg aaa gca aat gaa aca tat
ttc ctg ttt 384Leu His Asp Asp Gly Leu Met Lys Ala Asn Glu Thr Tyr
Phe Leu Phe 115 120 125
aaa gcg att tca aca ctt tca att atg gca ttt gca ttt tat
ctt cag 432Lys Ala Ile Ser Thr Leu Ser Ile Met Ala Phe Ala Phe Tyr
Leu Gln 130 135 140
tat ctt gga tgg tat att act tct gca tgt tta tta gca ctt gca
tgg 480Tyr Leu Gly Trp Tyr Ile Thr Ser Ala Cys Leu Leu Ala Leu Ala
Trp 145 150 155
160 caa caa ttc gga tgg tta aca cat gag ttc tgc cat caa cag cca
aca 528Gln Gln Phe Gly Trp Leu Thr His Glu Phe Cys His Gln Gln Pro
Thr 165 170 175
aag aac aga cct ttg aat gat act att tct ttg ttc ttt ggt aat ttc
576Lys Asn Arg Pro Leu Asn Asp Thr Ile Ser Leu Phe Phe Gly Asn Phe
180 185 190
tta caa gga ttt tca aga gat tgg tgg aag gac aag cat aac act cat
624Leu Gln Gly Phe Ser Arg Asp Trp Trp Lys Asp Lys His Asn Thr His
195 200 205
cac gct gcc aca aat gta att gat cat gac ggt gat atc gac ttg gca
672His Ala Ala Thr Asn Val Ile Asp His Asp Gly Asp Ile Asp Leu Ala
210 215 220
cca ctt ttc gca ttt att cca gga gat ttg tgc aag tat aag gcc agc
720Pro Leu Phe Ala Phe Ile Pro Gly Asp Leu Cys Lys Tyr Lys Ala Ser
225 230 235 240
ttt gaa aaa gca att ctc aag att gta cca tat caa cat ctc tat ttc
768Phe Glu Lys Ala Ile Leu Lys Ile Val Pro Tyr Gln His Leu Tyr Phe
245 250 255
acc gca atg ctt cca atg ctc cgt ttc tca tgg act ggt cag tca gtt
816Thr Ala Met Leu Pro Met Leu Arg Phe Ser Trp Thr Gly Gln Ser Val
260 265 270
caa tgg gta ttc aaa gag aat caa atg gag tac aag gtc tat caa aga
864Gln Trp Val Phe Lys Glu Asn Gln Met Glu Tyr Lys Val Tyr Gln Arg
275 280 285
aat gca ttc tgg gag caa gca aca att gtt gga cat tgg gct tgg gta
912Asn Ala Phe Trp Glu Gln Ala Thr Ile Val Gly His Trp Ala Trp Val
290 295 300
ttc tat caa ttg ttc tta tta cca aca tgg cca ctt cgg gtt gct tat
960Phe Tyr Gln Leu Phe Leu Leu Pro Thr Trp Pro Leu Arg Val Ala Tyr
305 310 315 320
ttc att att tca caa atg gga gga ggc ctt ttg att gct cac gta gtc
1008Phe Ile Ile Ser Gln Met Gly Gly Gly Leu Leu Ile Ala His Val Val
325 330 335
act ttc aac cat aac tct gtt gat aag tat cca gcc aat tct cga att
1056Thr Phe Asn His Asn Ser Val Asp Lys Tyr Pro Ala Asn Ser Arg Ile
340 345 350
tta aac aac ttc gcc gct ctt caa att ttg acc aca cgc aac atg act
1104Leu Asn Asn Phe Ala Ala Leu Gln Ile Leu Thr Thr Arg Asn Met Thr
355 360 365
cca tct cca ttc att gat tgg ctt tgg ggt gga ctc aat tat cag atc
1152Pro Ser Pro Phe Ile Asp Trp Leu Trp Gly Gly Leu Asn Tyr Gln Ile
370 375 380
gag cac cac ttg ttc cca aca atg cca cgt tgc aat ctg aat gct tgc
1200Glu His His Leu Phe Pro Thr Met Pro Arg Cys Asn Leu Asn Ala Cys
385 390 395 400
gtg aaa tat gtg aaa gaa tgg tgc aaa gag aat aat ctt cct tac ctc
1248Val Lys Tyr Val Lys Glu Trp Cys Lys Glu Asn Asn Leu Pro Tyr Leu
405 410 415
gtc gat gac tac ttt gac gga tat gca atg aat ttg caa caa ttg aaa
1296Val Asp Asp Tyr Phe Asp Gly Tyr Ala Met Asn Leu Gln Gln Leu Lys
420 425 430
aat atg gct gag cac att caa gct aaa gct gcc taa
1332Asn Met Ala Glu His Ile Gln Ala Lys Ala Ala
435 440
26443PRTCaenorhabditis elegans 26Met Val Val Asp Lys Asn Ala Ser Gly Leu
Arg Met Lys Val Asp Gly 1 5 10
15 Lys Trp Leu Tyr Leu Ser Glu Glu Leu Val Lys Lys His Pro Gly
Gly 20 25 30 Ala
Val Ile Glu Gln Tyr Arg Asn Ser Asp Ala Thr His Ile Phe His 35
40 45 Ala Phe His Glu Gly Ser
Ser Gln Ala Tyr Lys Gln Leu Asp Leu Leu 50 55
60 Lys Lys His Gly Glu His Asp Glu Phe Leu Glu
Lys Gln Leu Glu Lys 65 70 75
80 Arg Leu Asp Lys Val Asp Ile Asn Val Ser Ala Tyr Asp Val Ser Val
85 90 95 Ala Gln
Glu Lys Lys Met Val Glu Ser Phe Glu Lys Leu Arg Gln Lys 100
105 110 Leu His Asp Asp Gly Leu Met
Lys Ala Asn Glu Thr Tyr Phe Leu Phe 115 120
125 Lys Ala Ile Ser Thr Leu Ser Ile Met Ala Phe Ala
Phe Tyr Leu Gln 130 135 140
Tyr Leu Gly Trp Tyr Ile Thr Ser Ala Cys Leu Leu Ala Leu Ala Trp 145
150 155 160 Gln Gln Phe
Gly Trp Leu Thr His Glu Phe Cys His Gln Gln Pro Thr 165
170 175 Lys Asn Arg Pro Leu Asn Asp Thr
Ile Ser Leu Phe Phe Gly Asn Phe 180 185
190 Leu Gln Gly Phe Ser Arg Asp Trp Trp Lys Asp Lys His
Asn Thr His 195 200 205
His Ala Ala Thr Asn Val Ile Asp His Asp Gly Asp Ile Asp Leu Ala 210
215 220 Pro Leu Phe Ala
Phe Ile Pro Gly Asp Leu Cys Lys Tyr Lys Ala Ser 225 230
235 240 Phe Glu Lys Ala Ile Leu Lys Ile Val
Pro Tyr Gln His Leu Tyr Phe 245 250
255 Thr Ala Met Leu Pro Met Leu Arg Phe Ser Trp Thr Gly Gln
Ser Val 260 265 270
Gln Trp Val Phe Lys Glu Asn Gln Met Glu Tyr Lys Val Tyr Gln Arg
275 280 285 Asn Ala Phe Trp
Glu Gln Ala Thr Ile Val Gly His Trp Ala Trp Val 290
295 300 Phe Tyr Gln Leu Phe Leu Leu Pro
Thr Trp Pro Leu Arg Val Ala Tyr 305 310
315 320 Phe Ile Ile Ser Gln Met Gly Gly Gly Leu Leu Ile
Ala His Val Val 325 330
335 Thr Phe Asn His Asn Ser Val Asp Lys Tyr Pro Ala Asn Ser Arg Ile
340 345 350 Leu Asn Asn
Phe Ala Ala Leu Gln Ile Leu Thr Thr Arg Asn Met Thr 355
360 365 Pro Ser Pro Phe Ile Asp Trp Leu
Trp Gly Gly Leu Asn Tyr Gln Ile 370 375
380 Glu His His Leu Phe Pro Thr Met Pro Arg Cys Asn Leu
Asn Ala Cys 385 390 395
400 Val Lys Tyr Val Lys Glu Trp Cys Lys Glu Asn Asn Leu Pro Tyr Leu
405 410 415 Val Asp Asp Tyr
Phe Asp Gly Tyr Ala Met Asn Leu Gln Gln Leu Lys 420
425 430 Asn Met Ala Glu His Ile Gln Ala Lys
Ala Ala 435 440
27873DNAPhyscomitrella patensCDS(1)..(873)delta6-elongase 27atg gag gtc
gtg gag aga ttc tac ggt gag ttg gat ggg aag gtc tcg 48Met Glu Val
Val Glu Arg Phe Tyr Gly Glu Leu Asp Gly Lys Val Ser 1
5 10 15 cag ggc gtg aat
gca ttg ctg ggt agt ttt ggg gtg gag ttg acg gat 96Gln Gly Val Asn
Ala Leu Leu Gly Ser Phe Gly Val Glu Leu Thr Asp 20
25 30 acg ccc act acc aaa
ggc ttg ccc ctc gtt gac agt ccc aca ccc atc 144Thr Pro Thr Thr Lys
Gly Leu Pro Leu Val Asp Ser Pro Thr Pro Ile 35
40 45 gtc ctc ggt gtt tct gta
tac ttg act att gtc att gga ggg ctt ttg 192Val Leu Gly Val Ser Val
Tyr Leu Thr Ile Val Ile Gly Gly Leu Leu 50
55 60 tgg ata aag gcc agg gat
ctg aaa ccg cgc gcc tcg gag cca ttt ttg 240Trp Ile Lys Ala Arg Asp
Leu Lys Pro Arg Ala Ser Glu Pro Phe Leu 65 70
75 80 ctc caa gct ttg gtg ctt gtg
cac aac ctg ttc tgt ttt gcg ctc agt 288Leu Gln Ala Leu Val Leu Val
His Asn Leu Phe Cys Phe Ala Leu Ser 85
90 95 ctg tat atg tgc gtg ggc atc gct
tat cag gct att acc tgg cgg tac 336Leu Tyr Met Cys Val Gly Ile Ala
Tyr Gln Ala Ile Thr Trp Arg Tyr 100
105 110 tct ctc tgg ggc aat gca tac aat
cct aaa cat aaa gag atg gcg att 384Ser Leu Trp Gly Asn Ala Tyr Asn
Pro Lys His Lys Glu Met Ala Ile 115 120
125 ctg gta tac ttg ttc tac atg tct aag
tac gtg gaa ttc atg gat acc 432Leu Val Tyr Leu Phe Tyr Met Ser Lys
Tyr Val Glu Phe Met Asp Thr 130 135
140 gtt atc atg ata ctg aag cgc agc acc agg
caa ata agc ttc ctc cac 480Val Ile Met Ile Leu Lys Arg Ser Thr Arg
Gln Ile Ser Phe Leu His 145 150
155 160 gtt tat cat cat tct tca att tcc ctc att
tgg tgg gct att gct cat 528Val Tyr His His Ser Ser Ile Ser Leu Ile
Trp Trp Ala Ile Ala His 165 170
175 cac gct cct ggc ggt gaa gca tat tgg tct gcg
gct ctg aac tca gga 576His Ala Pro Gly Gly Glu Ala Tyr Trp Ser Ala
Ala Leu Asn Ser Gly 180 185
190 gtg cat gtt ctc atg tat gcg tat tac ttc ttg gct
gcc tgc ctt cga 624Val His Val Leu Met Tyr Ala Tyr Tyr Phe Leu Ala
Ala Cys Leu Arg 195 200
205 agt agc cca aag tta aaa aat aag tac ctt ttt tgg
ggc agg tac ttg 672Ser Ser Pro Lys Leu Lys Asn Lys Tyr Leu Phe Trp
Gly Arg Tyr Leu 210 215 220
aca caa ttc caa atg ttc cag ttt atg ctg aac tta gtg
cag gct tac 720Thr Gln Phe Gln Met Phe Gln Phe Met Leu Asn Leu Val
Gln Ala Tyr 225 230 235
240 tac gac atg aaa acg aat gcg cca tat cca caa tgg ctg atc
aag att 768Tyr Asp Met Lys Thr Asn Ala Pro Tyr Pro Gln Trp Leu Ile
Lys Ile 245 250
255 ttg ttc tac tac atg atc tcg ttg ctg ttt ctt ttc ggc aat
ttt tac 816Leu Phe Tyr Tyr Met Ile Ser Leu Leu Phe Leu Phe Gly Asn
Phe Tyr 260 265 270
gta caa aaa tac atc aaa ccc tct gac gga aag caa aag gga gct
aaa 864Val Gln Lys Tyr Ile Lys Pro Ser Asp Gly Lys Gln Lys Gly Ala
Lys 275 280 285
act gag tga
873Thr Glu
290
28290PRTPhyscomitrella patens 28Met Glu Val Val Glu Arg Phe Tyr Gly
Glu Leu Asp Gly Lys Val Ser 1 5 10
15 Gln Gly Val Asn Ala Leu Leu Gly Ser Phe Gly Val Glu Leu
Thr Asp 20 25 30
Thr Pro Thr Thr Lys Gly Leu Pro Leu Val Asp Ser Pro Thr Pro Ile
35 40 45 Val Leu Gly Val
Ser Val Tyr Leu Thr Ile Val Ile Gly Gly Leu Leu 50
55 60 Trp Ile Lys Ala Arg Asp Leu Lys
Pro Arg Ala Ser Glu Pro Phe Leu 65 70
75 80 Leu Gln Ala Leu Val Leu Val His Asn Leu Phe Cys
Phe Ala Leu Ser 85 90
95 Leu Tyr Met Cys Val Gly Ile Ala Tyr Gln Ala Ile Thr Trp Arg Tyr
100 105 110 Ser Leu Trp
Gly Asn Ala Tyr Asn Pro Lys His Lys Glu Met Ala Ile 115
120 125 Leu Val Tyr Leu Phe Tyr Met Ser
Lys Tyr Val Glu Phe Met Asp Thr 130 135
140 Val Ile Met Ile Leu Lys Arg Ser Thr Arg Gln Ile Ser
Phe Leu His 145 150 155
160 Val Tyr His His Ser Ser Ile Ser Leu Ile Trp Trp Ala Ile Ala His
165 170 175 His Ala Pro Gly
Gly Glu Ala Tyr Trp Ser Ala Ala Leu Asn Ser Gly 180
185 190 Val His Val Leu Met Tyr Ala Tyr Tyr
Phe Leu Ala Ala Cys Leu Arg 195 200
205 Ser Ser Pro Lys Leu Lys Asn Lys Tyr Leu Phe Trp Gly Arg
Tyr Leu 210 215 220
Thr Gln Phe Gln Met Phe Gln Phe Met Leu Asn Leu Val Gln Ala Tyr 225
230 235 240 Tyr Asp Met Lys Thr
Asn Ala Pro Tyr Pro Gln Trp Leu Ile Lys Ile 245
250 255 Leu Phe Tyr Tyr Met Ile Ser Leu Leu Phe
Leu Phe Gly Asn Phe Tyr 260 265
270 Val Gln Lys Tyr Ile Lys Pro Ser Asp Gly Lys Gln Lys Gly Ala
Lys 275 280 285 Thr
Glu 290 291049DNAThraustochytriumCDS(43)..(858)delta6-elongase
29gaattcggca cgagagcgcg cggagcggag acctcggccg cg atg atg gag ccg
54 Met Met Glu Pro
1
ctc gac agg tac agg gcg ctg gcg gag ctc gcc gcg agg tac gcc agc
102Leu Asp Arg Tyr Arg Ala Leu Ala Glu Leu Ala Ala Arg Tyr Ala Ser
5 10 15 20
tcg gcg gcc ttc aag tgg caa gtc acg tac gac gcc aag gac agc ttc
150Ser Ala Ala Phe Lys Trp Gln Val Thr Tyr Asp Ala Lys Asp Ser Phe
25 30 35
gtc ggg ccc ctg gga atc cgg gag ccg ctc ggg ctc ctg gtg ggc tcc
198Val Gly Pro Leu Gly Ile Arg Glu Pro Leu Gly Leu Leu Val Gly Ser
40 45 50
gtg gtc ctc tac ctg agc ctg ctg gcc gtg gtc tac gcg ctg cgg aac
246Val Val Leu Tyr Leu Ser Leu Leu Ala Val Val Tyr Ala Leu Arg Asn
55 60 65
tac ctt ggc ggc ctc atg gcg ctc cgc agc gtg cat aac ctc ggg ctc
294Tyr Leu Gly Gly Leu Met Ala Leu Arg Ser Val His Asn Leu Gly Leu
70 75 80
tgc ctc ttc tcg ggc gcc gtg tgg atc tac acg agc tac ctc atg atc
342Cys Leu Phe Ser Gly Ala Val Trp Ile Tyr Thr Ser Tyr Leu Met Ile
85 90 95 100
cag gat ggg cac ttt cgc agc ctc gag gcg gca acg tgc gag ccg ctc
390Gln Asp Gly His Phe Arg Ser Leu Glu Ala Ala Thr Cys Glu Pro Leu
105 110 115
aag cat ccg cac ttc cag ctc atc agc ttg ctc ttt gcg ctg tcc aag
438Lys His Pro His Phe Gln Leu Ile Ser Leu Leu Phe Ala Leu Ser Lys
120 125 130
atc tgg gag tgg ttc gac acg gtg ctc ctc atc gtc aag ggc aac aag
486Ile Trp Glu Trp Phe Asp Thr Val Leu Leu Ile Val Lys Gly Asn Lys
135 140 145
ctc cgc ttc ctg cac gtc ttg cac cac gcc acg acc ttt tgg ctc tac
534Leu Arg Phe Leu His Val Leu His His Ala Thr Thr Phe Trp Leu Tyr
150 155 160
gcc atc gac cac atc ttt ctc tcg tcc atc aag tac ggc gtc gcg gtc
582Ala Ile Asp His Ile Phe Leu Ser Ser Ile Lys Tyr Gly Val Ala Val
165 170 175 180
aat gct ttc atc cac acc gtc atg tac gcg cac tac ttc cgc cca ttc
630Asn Ala Phe Ile His Thr Val Met Tyr Ala His Tyr Phe Arg Pro Phe
185 190 195
ccg aag ggc ttg cgc ccg ctt att acg cag ttg cag atc gtc cag ttc
678Pro Lys Gly Leu Arg Pro Leu Ile Thr Gln Leu Gln Ile Val Gln Phe
200 205 210
att ttc agc atc ggc atc cat acc gcc att tac tgg cac tac gac tgc
726Ile Phe Ser Ile Gly Ile His Thr Ala Ile Tyr Trp His Tyr Asp Cys
215 220 225
gag ccg ctc gtg cat acc cac ttt tgg gaa tac gtc acg ccc tac ctt
774Glu Pro Leu Val His Thr His Phe Trp Glu Tyr Val Thr Pro Tyr Leu
230 235 240
ttc gtc gtg ccc ttc ctc atc ctc ttt ttc aat ttt tac ctg cag cag
822Phe Val Val Pro Phe Leu Ile Leu Phe Phe Asn Phe Tyr Leu Gln Gln
245 250 255 260
tac gtc ctc gcg ccc gca aaa acc aag aag gca tag ccacgtaaca
868Tyr Val Leu Ala Pro Ala Lys Thr Lys Lys Ala
265 270
gtagaccagc agcgccgagg acgcgtgccg cgttatcgcg aagcacgaaa taaagaagat
928catttgattc aacgaggcta cttgcggcca cgagaaaaaa aaaaaaaaaa aaaaaaaaaa
988aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
1048c
104930271PRTThraustochytrium 30Met Met Glu Pro Leu Asp Arg Tyr Arg Ala
Leu Ala Glu Leu Ala Ala 1 5 10
15 Arg Tyr Ala Ser Ser Ala Ala Phe Lys Trp Gln Val Thr Tyr Asp
Ala 20 25 30 Lys
Asp Ser Phe Val Gly Pro Leu Gly Ile Arg Glu Pro Leu Gly Leu 35
40 45 Leu Val Gly Ser Val Val
Leu Tyr Leu Ser Leu Leu Ala Val Val Tyr 50 55
60 Ala Leu Arg Asn Tyr Leu Gly Gly Leu Met Ala
Leu Arg Ser Val His 65 70 75
80 Asn Leu Gly Leu Cys Leu Phe Ser Gly Ala Val Trp Ile Tyr Thr Ser
85 90 95 Tyr Leu
Met Ile Gln Asp Gly His Phe Arg Ser Leu Glu Ala Ala Thr 100
105 110 Cys Glu Pro Leu Lys His Pro
His Phe Gln Leu Ile Ser Leu Leu Phe 115 120
125 Ala Leu Ser Lys Ile Trp Glu Trp Phe Asp Thr Val
Leu Leu Ile Val 130 135 140
Lys Gly Asn Lys Leu Arg Phe Leu His Val Leu His His Ala Thr Thr 145
150 155 160 Phe Trp Leu
Tyr Ala Ile Asp His Ile Phe Leu Ser Ser Ile Lys Tyr 165
170 175 Gly Val Ala Val Asn Ala Phe Ile
His Thr Val Met Tyr Ala His Tyr 180 185
190 Phe Arg Pro Phe Pro Lys Gly Leu Arg Pro Leu Ile Thr
Gln Leu Gln 195 200 205
Ile Val Gln Phe Ile Phe Ser Ile Gly Ile His Thr Ala Ile Tyr Trp 210
215 220 His Tyr Asp Cys
Glu Pro Leu Val His Thr His Phe Trp Glu Tyr Val 225 230
235 240 Thr Pro Tyr Leu Phe Val Val Pro Phe
Leu Ile Leu Phe Phe Asn Phe 245 250
255 Tyr Leu Gln Gln Tyr Val Leu Ala Pro Ala Lys Thr Lys Lys
Ala 260 265 270
31837DNAPhytophthora infestansCDS(1)..(837)delta6-elongase 31atg tcg act
gag cta ctg cag agc tac tac gcg tgg gcc aac gcc acg 48Met Ser Thr
Glu Leu Leu Gln Ser Tyr Tyr Ala Trp Ala Asn Ala Thr 1
5 10 15 gag gcc aag ctg
ctg gac tgg gtc gac cct gag ggc ggc tgg aag gtg 96Glu Ala Lys Leu
Leu Asp Trp Val Asp Pro Glu Gly Gly Trp Lys Val 20
25 30 cat cct atg gca gac
tac ccc cta gcc aac ttc tcc agc gtc tac gcc 144His Pro Met Ala Asp
Tyr Pro Leu Ala Asn Phe Ser Ser Val Tyr Ala 35
40 45 atc tgc gtc gga tac ttg
ctc ttc gta atc ttc ggc acg gcc ctg atg 192Ile Cys Val Gly Tyr Leu
Leu Phe Val Ile Phe Gly Thr Ala Leu Met 50
55 60 aaa atg gga gtc ccc gcc
atc aag acc agt cca tta cag ttt gtg tac 240Lys Met Gly Val Pro Ala
Ile Lys Thr Ser Pro Leu Gln Phe Val Tyr 65 70
75 80 aac ccc atc caa gtc att gcc
tgc tct tat atg tgc gtg gag gcc gcc 288Asn Pro Ile Gln Val Ile Ala
Cys Ser Tyr Met Cys Val Glu Ala Ala 85
90 95 atc cag gcc tac cgc aac ggc tac
acc gcc gcc ccg tgc aac gcc ttt 336Ile Gln Ala Tyr Arg Asn Gly Tyr
Thr Ala Ala Pro Cys Asn Ala Phe 100
105 110 aag tcc gac gac ccc gtc atg ggc
aac gtt ctg tac ctc ttc tat ctc 384Lys Ser Asp Asp Pro Val Met Gly
Asn Val Leu Tyr Leu Phe Tyr Leu 115 120
125 tcc aag atg ctc gac ctg tgc gac aca
gtc ttc att atc cta gga aag 432Ser Lys Met Leu Asp Leu Cys Asp Thr
Val Phe Ile Ile Leu Gly Lys 130 135
140 aag tgg aaa cag ctt tcc atc ttg cac gtg
tac cac cac ctt acc gtg 480Lys Trp Lys Gln Leu Ser Ile Leu His Val
Tyr His His Leu Thr Val 145 150
155 160 ctt ttc gtc tac tat gtg acg ttc cgc gcc
gct cag gac ggg gac tca 528Leu Phe Val Tyr Tyr Val Thr Phe Arg Ala
Ala Gln Asp Gly Asp Ser 165 170
175 tat gct acc atc gtg ctc aac ggc ttc gtg cac
acc atc atg tac act 576Tyr Ala Thr Ile Val Leu Asn Gly Phe Val His
Thr Ile Met Tyr Thr 180 185
190 tac tac ttc gtc agc gcc cac acg cgc aac att tgg
tgg aag aag tac 624Tyr Tyr Phe Val Ser Ala His Thr Arg Asn Ile Trp
Trp Lys Lys Tyr 195 200
205 ctc acg cgc att cag ctt atc cag ttc gtg acc atg
aac gtg cag ggc 672Leu Thr Arg Ile Gln Leu Ile Gln Phe Val Thr Met
Asn Val Gln Gly 210 215 220
tac ctg acc tac tct cga cag tgc cca ggc atg cct cct
aag gtg ccg 720Tyr Leu Thr Tyr Ser Arg Gln Cys Pro Gly Met Pro Pro
Lys Val Pro 225 230 235
240 ctc atg tac ctt gtg tac gtg cag tca ctc ttc tgg ctc ttc
atg aat 768Leu Met Tyr Leu Val Tyr Val Gln Ser Leu Phe Trp Leu Phe
Met Asn 245 250
255 ttc tac att cgc gcg tac gtg ttc ggc ccc aag aaa ccg gcc
gtg gag 816Phe Tyr Ile Arg Ala Tyr Val Phe Gly Pro Lys Lys Pro Ala
Val Glu 260 265 270
gaa tcg aag aag aag ttg taa
837Glu Ser Lys Lys Lys Leu
275
32278PRTPhytophthora infestans 32Met Ser Thr Glu Leu Leu Gln Ser
Tyr Tyr Ala Trp Ala Asn Ala Thr 1 5 10
15 Glu Ala Lys Leu Leu Asp Trp Val Asp Pro Glu Gly Gly
Trp Lys Val 20 25 30
His Pro Met Ala Asp Tyr Pro Leu Ala Asn Phe Ser Ser Val Tyr Ala
35 40 45 Ile Cys Val Gly
Tyr Leu Leu Phe Val Ile Phe Gly Thr Ala Leu Met 50
55 60 Lys Met Gly Val Pro Ala Ile Lys
Thr Ser Pro Leu Gln Phe Val Tyr 65 70
75 80 Asn Pro Ile Gln Val Ile Ala Cys Ser Tyr Met Cys
Val Glu Ala Ala 85 90
95 Ile Gln Ala Tyr Arg Asn Gly Tyr Thr Ala Ala Pro Cys Asn Ala Phe
100 105 110 Lys Ser Asp
Asp Pro Val Met Gly Asn Val Leu Tyr Leu Phe Tyr Leu 115
120 125 Ser Lys Met Leu Asp Leu Cys Asp
Thr Val Phe Ile Ile Leu Gly Lys 130 135
140 Lys Trp Lys Gln Leu Ser Ile Leu His Val Tyr His His
Leu Thr Val 145 150 155
160 Leu Phe Val Tyr Tyr Val Thr Phe Arg Ala Ala Gln Asp Gly Asp Ser
165 170 175 Tyr Ala Thr Ile
Val Leu Asn Gly Phe Val His Thr Ile Met Tyr Thr 180
185 190 Tyr Tyr Phe Val Ser Ala His Thr Arg
Asn Ile Trp Trp Lys Lys Tyr 195 200
205 Leu Thr Arg Ile Gln Leu Ile Gln Phe Val Thr Met Asn Val
Gln Gly 210 215 220
Tyr Leu Thr Tyr Ser Arg Gln Cys Pro Gly Met Pro Pro Lys Val Pro 225
230 235 240 Leu Met Tyr Leu Val
Tyr Val Gln Ser Leu Phe Trp Leu Phe Met Asn 245
250 255 Phe Tyr Ile Arg Ala Tyr Val Phe Gly Pro
Lys Lys Pro Ala Val Glu 260 265
270 Glu Ser Lys Lys Lys Leu 275
33954DNAMortierella alpinaCDS(1)..(954)delta6-elongase 33atg gcc gcc gca
atc ttg gac aag gtc aac ttc ggc att gat cag ccc 48Met Ala Ala Ala
Ile Leu Asp Lys Val Asn Phe Gly Ile Asp Gln Pro 1 5
10 15 ttc gga atc aag ctc
gac acc tac ttt gct cag gcc tat gaa ctc gtc 96Phe Gly Ile Lys Leu
Asp Thr Tyr Phe Ala Gln Ala Tyr Glu Leu Val 20
25 30 acc gga aag tcc atc gac
tcc ttc gtc ttc cag gag ggc gtc acg cct 144Thr Gly Lys Ser Ile Asp
Ser Phe Val Phe Gln Glu Gly Val Thr Pro 35
40 45 ctc tcg acc cag aga gag gtc
gcc atg tgg act atc act tac ttc gtc 192Leu Ser Thr Gln Arg Glu Val
Ala Met Trp Thr Ile Thr Tyr Phe Val 50 55
60 gtc atc ttt ggt ggt cgc cag atc
atg aag agc cag gac gcc ttc aag 240Val Ile Phe Gly Gly Arg Gln Ile
Met Lys Ser Gln Asp Ala Phe Lys 65 70
75 80 ctc aag ccc ctc ttc atc ctc cac aac
ttc ctc ctg acg atc gcg tcc 288Leu Lys Pro Leu Phe Ile Leu His Asn
Phe Leu Leu Thr Ile Ala Ser 85
90 95 gga tcg ctg ttg ctc ctg ttc atc gag
aac ctg gtc ccc atc ctc gcc 336Gly Ser Leu Leu Leu Leu Phe Ile Glu
Asn Leu Val Pro Ile Leu Ala 100 105
110 aga aac gga ctt ttc tac gcc atc tgc gac
gac ggt gcc tgg acc cag 384Arg Asn Gly Leu Phe Tyr Ala Ile Cys Asp
Asp Gly Ala Trp Thr Gln 115 120
125 cgc ctc gag ctc ctc tac tac ctc aac tac ctg
gtc aag tac tgg gag 432Arg Leu Glu Leu Leu Tyr Tyr Leu Asn Tyr Leu
Val Lys Tyr Trp Glu 130 135
140 ttg gcc gac acc gtc ttt ttg gtc ctc aag aag
aag cct ctt gag ttc 480Leu Ala Asp Thr Val Phe Leu Val Leu Lys Lys
Lys Pro Leu Glu Phe 145 150 155
160 ctg cac tac ttc cac cac tcg atg acc atg gtt ctc
tgc ttt gtc cag 528Leu His Tyr Phe His His Ser Met Thr Met Val Leu
Cys Phe Val Gln 165 170
175 ctt gga gga tac act tca gtg tcc tgg gtc cct att acc
ctc aac ttg 576Leu Gly Gly Tyr Thr Ser Val Ser Trp Val Pro Ile Thr
Leu Asn Leu 180 185
190 act gtc cac gtc ttc atg tac tac tac tac atg cgc tcc
gct gcc ggt 624Thr Val His Val Phe Met Tyr Tyr Tyr Tyr Met Arg Ser
Ala Ala Gly 195 200 205
gtt cgc atc tgg tgg aag cag tac ttg acc act ctc cag atc
gtc cag 672Val Arg Ile Trp Trp Lys Gln Tyr Leu Thr Thr Leu Gln Ile
Val Gln 210 215 220
ttc gtt ctt gac ctc gga ttc atc tac ttc tgc gcc tac acc tac
ttc 720Phe Val Leu Asp Leu Gly Phe Ile Tyr Phe Cys Ala Tyr Thr Tyr
Phe 225 230 235
240 gcc ttc acc tac ttc ccc tgg gct ccc aac gtc ggc aag tgc gcc
ggt 768Ala Phe Thr Tyr Phe Pro Trp Ala Pro Asn Val Gly Lys Cys Ala
Gly 245 250 255
acc gag ggt gct gct ctc ttt ggc tgc gga ctc ctc tcc agc tat ctc
816Thr Glu Gly Ala Ala Leu Phe Gly Cys Gly Leu Leu Ser Ser Tyr Leu
260 265 270
ttg ctc ttt atc aac ttc tac cgc att acc tac aat gcc aag gcc aag
864Leu Leu Phe Ile Asn Phe Tyr Arg Ile Thr Tyr Asn Ala Lys Ala Lys
275 280 285
gca gcc aag gag cgt gga agc aac ttt acc ccc aag act gtc aag tcc
912Ala Ala Lys Glu Arg Gly Ser Asn Phe Thr Pro Lys Thr Val Lys Ser
290 295 300
ggc gga tcg ccc aag aag ccc tcc aag agc aag cac atc taa
954Gly Gly Ser Pro Lys Lys Pro Ser Lys Ser Lys His Ile
305 310 315
34317PRTMortierella alpina 34Met Ala Ala Ala Ile Leu Asp Lys Val Asn Phe
Gly Ile Asp Gln Pro 1 5 10
15 Phe Gly Ile Lys Leu Asp Thr Tyr Phe Ala Gln Ala Tyr Glu Leu Val
20 25 30 Thr Gly
Lys Ser Ile Asp Ser Phe Val Phe Gln Glu Gly Val Thr Pro 35
40 45 Leu Ser Thr Gln Arg Glu Val
Ala Met Trp Thr Ile Thr Tyr Phe Val 50 55
60 Val Ile Phe Gly Gly Arg Gln Ile Met Lys Ser Gln
Asp Ala Phe Lys 65 70 75
80 Leu Lys Pro Leu Phe Ile Leu His Asn Phe Leu Leu Thr Ile Ala Ser
85 90 95 Gly Ser Leu
Leu Leu Leu Phe Ile Glu Asn Leu Val Pro Ile Leu Ala 100
105 110 Arg Asn Gly Leu Phe Tyr Ala Ile
Cys Asp Asp Gly Ala Trp Thr Gln 115 120
125 Arg Leu Glu Leu Leu Tyr Tyr Leu Asn Tyr Leu Val Lys
Tyr Trp Glu 130 135 140
Leu Ala Asp Thr Val Phe Leu Val Leu Lys Lys Lys Pro Leu Glu Phe 145
150 155 160 Leu His Tyr Phe
His His Ser Met Thr Met Val Leu Cys Phe Val Gln 165
170 175 Leu Gly Gly Tyr Thr Ser Val Ser Trp
Val Pro Ile Thr Leu Asn Leu 180 185
190 Thr Val His Val Phe Met Tyr Tyr Tyr Tyr Met Arg Ser Ala
Ala Gly 195 200 205
Val Arg Ile Trp Trp Lys Gln Tyr Leu Thr Thr Leu Gln Ile Val Gln 210
215 220 Phe Val Leu Asp Leu
Gly Phe Ile Tyr Phe Cys Ala Tyr Thr Tyr Phe 225 230
235 240 Ala Phe Thr Tyr Phe Pro Trp Ala Pro Asn
Val Gly Lys Cys Ala Gly 245 250
255 Thr Glu Gly Ala Ala Leu Phe Gly Cys Gly Leu Leu Ser Ser Tyr
Leu 260 265 270 Leu
Leu Phe Ile Asn Phe Tyr Arg Ile Thr Tyr Asn Ala Lys Ala Lys 275
280 285 Ala Ala Lys Glu Arg Gly
Ser Asn Phe Thr Pro Lys Thr Val Lys Ser 290 295
300 Gly Gly Ser Pro Lys Lys Pro Ser Lys Ser Lys
His Ile 305 310 315
35957DNAMortierella alpinaCDS(1)..(957)delta6-elongase 35atg gag tcg att
gcg cca ttc ctc cca tca aag atg ccg caa gat ctg 48Met Glu Ser Ile
Ala Pro Phe Leu Pro Ser Lys Met Pro Gln Asp Leu 1 5
10 15 ttt atg gac ctt gcc
acc gct atc ggt gtc cgg gcc gcg ccc tat gtc 96Phe Met Asp Leu Ala
Thr Ala Ile Gly Val Arg Ala Ala Pro Tyr Val 20
25 30 gat cct ctc gag gcc gcg
ctg gtg gcc cag gcc gag aag tac atc ccc 144Asp Pro Leu Glu Ala Ala
Leu Val Ala Gln Ala Glu Lys Tyr Ile Pro 35
40 45 acg att gtc cat cac acg cgt
ggg ttc ctg gtc gcg gtg gag tcg cct 192Thr Ile Val His His Thr Arg
Gly Phe Leu Val Ala Val Glu Ser Pro 50 55
60 ttg gcc cgt gag ctg ccg ttg atg
aac ccg ttc cac gtg ctg ttg atc 240Leu Ala Arg Glu Leu Pro Leu Met
Asn Pro Phe His Val Leu Leu Ile 65 70
75 80 gtg ctc gct tat ttg gtc acg gtc ttt
gtg ggc atg cag atc atg aag 288Val Leu Ala Tyr Leu Val Thr Val Phe
Val Gly Met Gln Ile Met Lys 85
90 95 aac ttt gag cgg ttc gag gtc aag acg
ttt tcg ctc ctg cac aac ttt 336Asn Phe Glu Arg Phe Glu Val Lys Thr
Phe Ser Leu Leu His Asn Phe 100 105
110 tgt ctg gtc tcg atc agc gcc tac atg tgc
ggt ggg atc ctg tac gag 384Cys Leu Val Ser Ile Ser Ala Tyr Met Cys
Gly Gly Ile Leu Tyr Glu 115 120
125 gct tat cag gcc aac tat gga ctg ttt gag aac
gct gct gat cat acc 432Ala Tyr Gln Ala Asn Tyr Gly Leu Phe Glu Asn
Ala Ala Asp His Thr 130 135
140 ttc aag ggt ctt cct atg gcc aag atg atc tgg
ctc ttc tac ttc tcc 480Phe Lys Gly Leu Pro Met Ala Lys Met Ile Trp
Leu Phe Tyr Phe Ser 145 150 155
160 aag atc atg gag ttt gtc gac acc atg atc atg gtc
ctc aag aag aac 528Lys Ile Met Glu Phe Val Asp Thr Met Ile Met Val
Leu Lys Lys Asn 165 170
175 aac cgc cag atc tcc ttc ttg cac gtt tac cac cac agc
tcc atc ttc 576Asn Arg Gln Ile Ser Phe Leu His Val Tyr His His Ser
Ser Ile Phe 180 185
190 acc atc tgg tgg ttg gtc acc ttt gtt gca ccc aac ggt
gaa gcc tac 624Thr Ile Trp Trp Leu Val Thr Phe Val Ala Pro Asn Gly
Glu Ala Tyr 195 200 205
ttc tct gct gcg ttg aac tcg ttc atc cat gtg atc atg tac
ggc tac 672Phe Ser Ala Ala Leu Asn Ser Phe Ile His Val Ile Met Tyr
Gly Tyr 210 215 220
tac ttc ttg tcg gcc ttg ggc ttc aag cag gtg tcg ttc atc aag
ttc 720Tyr Phe Leu Ser Ala Leu Gly Phe Lys Gln Val Ser Phe Ile Lys
Phe 225 230 235
240 tac atc acg cgc tcg cag atg aca cag ttc tgc atg atg tcg gtc
cag 768Tyr Ile Thr Arg Ser Gln Met Thr Gln Phe Cys Met Met Ser Val
Gln 245 250 255
tct tcc tgg gac atg tac gcc atg aag gtc ctt ggc cgc ccc gga tac
816Ser Ser Trp Asp Met Tyr Ala Met Lys Val Leu Gly Arg Pro Gly Tyr
260 265 270
ccc ttc ttc atc acg gct ctg ctt tgg ttc tac atg tgg acc atg ctc
864Pro Phe Phe Ile Thr Ala Leu Leu Trp Phe Tyr Met Trp Thr Met Leu
275 280 285
ggt ctc ttc tac aac ttt tac aga aag aac gcc aag ttg gcc aag cag
912Gly Leu Phe Tyr Asn Phe Tyr Arg Lys Asn Ala Lys Leu Ala Lys Gln
290 295 300
gcc aag gcc gac gct gcc aag gag aag gca agg aag ttg cag taa
957Ala Lys Ala Asp Ala Ala Lys Glu Lys Ala Arg Lys Leu Gln
305 310 315
36318PRTMortierella alpina 36Met Glu Ser Ile Ala Pro Phe Leu Pro Ser Lys
Met Pro Gln Asp Leu 1 5 10
15 Phe Met Asp Leu Ala Thr Ala Ile Gly Val Arg Ala Ala Pro Tyr Val
20 25 30 Asp Pro
Leu Glu Ala Ala Leu Val Ala Gln Ala Glu Lys Tyr Ile Pro 35
40 45 Thr Ile Val His His Thr Arg
Gly Phe Leu Val Ala Val Glu Ser Pro 50 55
60 Leu Ala Arg Glu Leu Pro Leu Met Asn Pro Phe His
Val Leu Leu Ile 65 70 75
80 Val Leu Ala Tyr Leu Val Thr Val Phe Val Gly Met Gln Ile Met Lys
85 90 95 Asn Phe Glu
Arg Phe Glu Val Lys Thr Phe Ser Leu Leu His Asn Phe 100
105 110 Cys Leu Val Ser Ile Ser Ala Tyr
Met Cys Gly Gly Ile Leu Tyr Glu 115 120
125 Ala Tyr Gln Ala Asn Tyr Gly Leu Phe Glu Asn Ala Ala
Asp His Thr 130 135 140
Phe Lys Gly Leu Pro Met Ala Lys Met Ile Trp Leu Phe Tyr Phe Ser 145
150 155 160 Lys Ile Met Glu
Phe Val Asp Thr Met Ile Met Val Leu Lys Lys Asn 165
170 175 Asn Arg Gln Ile Ser Phe Leu His Val
Tyr His His Ser Ser Ile Phe 180 185
190 Thr Ile Trp Trp Leu Val Thr Phe Val Ala Pro Asn Gly Glu
Ala Tyr 195 200 205
Phe Ser Ala Ala Leu Asn Ser Phe Ile His Val Ile Met Tyr Gly Tyr 210
215 220 Tyr Phe Leu Ser Ala
Leu Gly Phe Lys Gln Val Ser Phe Ile Lys Phe 225 230
235 240 Tyr Ile Thr Arg Ser Gln Met Thr Gln Phe
Cys Met Met Ser Val Gln 245 250
255 Ser Ser Trp Asp Met Tyr Ala Met Lys Val Leu Gly Arg Pro Gly
Tyr 260 265 270 Pro
Phe Phe Ile Thr Ala Leu Leu Trp Phe Tyr Met Trp Thr Met Leu 275
280 285 Gly Leu Phe Tyr Asn Phe
Tyr Arg Lys Asn Ala Lys Leu Ala Lys Gln 290 295
300 Ala Lys Ala Asp Ala Ala Lys Glu Lys Ala Arg
Lys Leu Gln 305 310 315
37867DNACaenorhabditis elegansCDS(1)..(867)delta6-elongase 37atg gct cag
cat ccg ctc gtt caa cgg ctt ctc gat gtc aaa ttc gac 48Met Ala Gln
His Pro Leu Val Gln Arg Leu Leu Asp Val Lys Phe Asp 1
5 10 15 acg aaa cga ttt
gtg gct att gct act cat ggg cca aag aat ttc cct 96Thr Lys Arg Phe
Val Ala Ile Ala Thr His Gly Pro Lys Asn Phe Pro 20
25 30 gac gca gaa ggt cgc
aag ttc ttt gct gat cac ttt gat gtt act att 144Asp Ala Glu Gly Arg
Lys Phe Phe Ala Asp His Phe Asp Val Thr Ile 35
40 45 cag gct tca atc ctg tac
atg gtc gtt gtg ttc gga aca aaa tgg ttc 192Gln Ala Ser Ile Leu Tyr
Met Val Val Val Phe Gly Thr Lys Trp Phe 50
55 60 atg cgt aat cgt caa cca
ttc caa ttg act att cca ctc aac atc tgg 240Met Arg Asn Arg Gln Pro
Phe Gln Leu Thr Ile Pro Leu Asn Ile Trp 65 70
75 80 aat ttc atc ctc gcc gca ttt
tcc atc gca gga gct gtc aaa atg acc 288Asn Phe Ile Leu Ala Ala Phe
Ser Ile Ala Gly Ala Val Lys Met Thr 85
90 95 cca gag ttc ttt gga acc att gcc
aac aaa gga att gtc gca tcc tac 336Pro Glu Phe Phe Gly Thr Ile Ala
Asn Lys Gly Ile Val Ala Ser Tyr 100
105 110 tgc aaa gtg ttt gat ttc acg aaa
gga gag aat gga tac tgg gtg tgg 384Cys Lys Val Phe Asp Phe Thr Lys
Gly Glu Asn Gly Tyr Trp Val Trp 115 120
125 ctc ttc atg gct tcc aaa ctt ttc gaa
ctt gtt gac acc atc ttc ttg 432Leu Phe Met Ala Ser Lys Leu Phe Glu
Leu Val Asp Thr Ile Phe Leu 130 135
140 gtt ctc cgt aaa cgt cca ctc atg ttc ctt
cac tgg tat cac cat att 480Val Leu Arg Lys Arg Pro Leu Met Phe Leu
His Trp Tyr His His Ile 145 150
155 160 ctc acc atg atc tac gcc tgg tac tct cat
cca ttg acc cca gga ttc 528Leu Thr Met Ile Tyr Ala Trp Tyr Ser His
Pro Leu Thr Pro Gly Phe 165 170
175 aac aga tac gga att tat ctt aac ttt gtc gtc
cac gcc ttc atg tac 576Asn Arg Tyr Gly Ile Tyr Leu Asn Phe Val Val
His Ala Phe Met Tyr 180 185
190 tct tac tac ttc ctt cgc tcg atg aag att cgc gtg
cca gga ttc atc 624Ser Tyr Tyr Phe Leu Arg Ser Met Lys Ile Arg Val
Pro Gly Phe Ile 195 200
205 gcc caa gct atc aca tct ctt caa atc gtt caa ttc
atc atc tct tgc 672Ala Gln Ala Ile Thr Ser Leu Gln Ile Val Gln Phe
Ile Ile Ser Cys 210 215 220
gcc gtt ctt gct cat ctt ggt tat ctc atg cac ttc
acc aat gcc aac 720Ala Val Leu Ala His Leu Gly Tyr Leu Met His Phe
Thr Asn Ala Asn 225 230 235
240 tgt gat ttc gag cca tca gta ttc aag ctc gca gtt ttc
atg gac aca 768Cys Asp Phe Glu Pro Ser Val Phe Lys Leu Ala Val Phe
Met Asp Thr 245 250
255 aca tac ttg gct ctt ttc gtc aac ttc ttc ctc caa tca tat
gtt ctc 816Thr Tyr Leu Ala Leu Phe Val Asn Phe Phe Leu Gln Ser Tyr
Val Leu 260 265 270
cgc gga gga aaa gac aag tac aag gca gtg cca aag aag aag aac
aac 864Arg Gly Gly Lys Asp Lys Tyr Lys Ala Val Pro Lys Lys Lys Asn
Asn 275 280 285
taa
86738288PRTCaenorhabditis elegans 38Met Ala Gln His Pro Leu Val Gln
Arg Leu Leu Asp Val Lys Phe Asp 1 5 10
15 Thr Lys Arg Phe Val Ala Ile Ala Thr His Gly Pro Lys
Asn Phe Pro 20 25 30
Asp Ala Glu Gly Arg Lys Phe Phe Ala Asp His Phe Asp Val Thr Ile
35 40 45 Gln Ala Ser Ile
Leu Tyr Met Val Val Val Phe Gly Thr Lys Trp Phe 50
55 60 Met Arg Asn Arg Gln Pro Phe Gln
Leu Thr Ile Pro Leu Asn Ile Trp 65 70
75 80 Asn Phe Ile Leu Ala Ala Phe Ser Ile Ala Gly Ala
Val Lys Met Thr 85 90
95 Pro Glu Phe Phe Gly Thr Ile Ala Asn Lys Gly Ile Val Ala Ser Tyr
100 105 110 Cys Lys Val
Phe Asp Phe Thr Lys Gly Glu Asn Gly Tyr Trp Val Trp 115
120 125 Leu Phe Met Ala Ser Lys Leu Phe
Glu Leu Val Asp Thr Ile Phe Leu 130 135
140 Val Leu Arg Lys Arg Pro Leu Met Phe Leu His Trp Tyr
His His Ile 145 150 155
160 Leu Thr Met Ile Tyr Ala Trp Tyr Ser His Pro Leu Thr Pro Gly Phe
165 170 175 Asn Arg Tyr Gly
Ile Tyr Leu Asn Phe Val Val His Ala Phe Met Tyr 180
185 190 Ser Tyr Tyr Phe Leu Arg Ser Met Lys
Ile Arg Val Pro Gly Phe Ile 195 200
205 Ala Gln Ala Ile Thr Ser Leu Gln Ile Val Gln Phe Ile Ile
Ser Cys 210 215 220
Ala Val Leu Ala His Leu Gly Tyr Leu Met His Phe Thr Asn Ala Asn 225
230 235 240 Cys Asp Phe Glu Pro
Ser Val Phe Lys Leu Ala Val Phe Met Asp Thr 245
250 255 Thr Tyr Leu Ala Leu Phe Val Asn Phe Phe
Leu Gln Ser Tyr Val Leu 260 265
270 Arg Gly Gly Lys Asp Lys Tyr Lys Ala Val Pro Lys Lys Lys Asn
Asn 275 280 285
391626DNAEuglena gracilisCDS(1)..(1626)delta4-desaturase 39atg ttg gtg
ctg ttt ggc aat ttc tat gtc aag caa tac tcc caa aag 48Met Leu Val
Leu Phe Gly Asn Phe Tyr Val Lys Gln Tyr Ser Gln Lys 1
5 10 15 aac ggc aag ccg
gag aac gga gcc acc cct gag aac gga gcg aag ccg 96Asn Gly Lys Pro
Glu Asn Gly Ala Thr Pro Glu Asn Gly Ala Lys Pro 20
25 30 caa cct tgc gag aac
ggc acg gtg gaa aag cga gag aat gac acc gcc 144Gln Pro Cys Glu Asn
Gly Thr Val Glu Lys Arg Glu Asn Asp Thr Ala 35
40 45 aac gtt cgg ccc acc cgt
cca gct gga ccc ccg ccg gcc acg tac tac 192Asn Val Arg Pro Thr Arg
Pro Ala Gly Pro Pro Pro Ala Thr Tyr Tyr 50
55 60 gac tcc ctg gca gtg tcg
ggg cag ggc aag gag cgg ctg ttc acc acc 240Asp Ser Leu Ala Val Ser
Gly Gln Gly Lys Glu Arg Leu Phe Thr Thr 65 70
75 80 gat gag gtg agg cgg cac atc
ctc ccc acc gat ggc tgg ctg acg tgc 288Asp Glu Val Arg Arg His Ile
Leu Pro Thr Asp Gly Trp Leu Thr Cys 85
90 95 cac gaa gga gtc tac gat gtc act
gat ttc ctt gcc aag cac cct ggt 336His Glu Gly Val Tyr Asp Val Thr
Asp Phe Leu Ala Lys His Pro Gly 100
105 110 ggc ggt gtc atc acg ctg ggc ctt
gga agg gac tgc aca atc ctc atc 384Gly Gly Val Ile Thr Leu Gly Leu
Gly Arg Asp Cys Thr Ile Leu Ile 115 120
125 gag tca tac cac cct gct ggg cgc ccg
gac aag gtg atg gag aag tac 432Glu Ser Tyr His Pro Ala Gly Arg Pro
Asp Lys Val Met Glu Lys Tyr 130 135
140 cgc att ggt acg ctg cag gac ccc aag acg
ttc tat gct tgg gga gag 480Arg Ile Gly Thr Leu Gln Asp Pro Lys Thr
Phe Tyr Ala Trp Gly Glu 145 150
155 160 tcc gat ttc tac cct gag ttg aag cgc cgg
gcc ctt gca agg ctg aag 528Ser Asp Phe Tyr Pro Glu Leu Lys Arg Arg
Ala Leu Ala Arg Leu Lys 165 170
175 gag gct ggt cag gcg cgg cgc ggc ggc ctt ggg
gtg aag gcc ctc ctg 576Glu Ala Gly Gln Ala Arg Arg Gly Gly Leu Gly
Val Lys Ala Leu Leu 180 185
190 gtg ctc acc ctc ttc ttc gtg tcg tgg tac atg tgg
gtg gcc cac aag 624Val Leu Thr Leu Phe Phe Val Ser Trp Tyr Met Trp
Val Ala His Lys 195 200
205 tcc ttc ctc tgg gcc gcc gtc tgg ggc ttc gcc ggc
tcc cac gtc ggg 672Ser Phe Leu Trp Ala Ala Val Trp Gly Phe Ala Gly
Ser His Val Gly 210 215 220
ctg agc atc cag cac gat ggc aac cac ggc gcg ttc agc
cgc aac aca 720Leu Ser Ile Gln His Asp Gly Asn His Gly Ala Phe Ser
Arg Asn Thr 225 230 235
240 ctg gtg aac cgc ctg gcg ggg tgg ggc atg gac ttg atc ggc
gcg tcg 768Leu Val Asn Arg Leu Ala Gly Trp Gly Met Asp Leu Ile Gly
Ala Ser 245 250
255 tcc acg gtg tgg gag tac cag cac gtc atc ggc cac cac cag
tac acc 816Ser Thr Val Trp Glu Tyr Gln His Val Ile Gly His His Gln
Tyr Thr 260 265 270
aac ctc gtg tcg gac acg cta ttc agt ctg cct gag aac gat ccg
gac 864Asn Leu Val Ser Asp Thr Leu Phe Ser Leu Pro Glu Asn Asp Pro
Asp 275 280 285
gtc ttc tcc agc tac ccg ctg atg cgc atg cac ccg gat acg gcg tgg
912Val Phe Ser Ser Tyr Pro Leu Met Arg Met His Pro Asp Thr Ala Trp
290 295 300
cag ccg cac cac cgc ttc cag cac ctg ttc gcg ttc cca ctg ttc gcc
960Gln Pro His His Arg Phe Gln His Leu Phe Ala Phe Pro Leu Phe Ala
305 310 315 320
ctg atg aca atc agc aag gtg ctg acc agc gat ttc gct gtc tgc ctc
1008Leu Met Thr Ile Ser Lys Val Leu Thr Ser Asp Phe Ala Val Cys Leu
325 330 335
agc atg aag aag ggg tcc atc gac tgc tcc tcc agg ctc gtc cca ctg
1056Ser Met Lys Lys Gly Ser Ile Asp Cys Ser Ser Arg Leu Val Pro Leu
340 345 350
gag ggg cag ctg ctg ttc tgg ggg gcc aag ctg gcg aac ttc ctg ttg
1104Glu Gly Gln Leu Leu Phe Trp Gly Ala Lys Leu Ala Asn Phe Leu Leu
355 360 365
cag att gtg ttg cca tgc tac ctc cac ggg aca gct atg ggc ctg gcc
1152Gln Ile Val Leu Pro Cys Tyr Leu His Gly Thr Ala Met Gly Leu Ala
370 375 380
ctc ttc tct gtt gct cac ctt gtg tcg ggg gag tac ctc gcg atc tgc
1200Leu Phe Ser Val Ala His Leu Val Ser Gly Glu Tyr Leu Ala Ile Cys
385 390 395 400
ttc atc atc aac cac atc agc gag tct tgt gag ttt atg aat aca agc
1248Phe Ile Ile Asn His Ile Ser Glu Ser Cys Glu Phe Met Asn Thr Ser
405 410 415
ttt caa acc gcc gcc cgg agg aca gag atg ctt cag gca gca cat cag
1296Phe Gln Thr Ala Ala Arg Arg Thr Glu Met Leu Gln Ala Ala His Gln
420 425 430
gca gcg gag gcc aag aag gtg aag ccc acc cct cca ccg aac gat tgg
1344Ala Ala Glu Ala Lys Lys Val Lys Pro Thr Pro Pro Pro Asn Asp Trp
435 440 445
gct gtg aca cag gtc caa tgc tgc gtg aat tgg aga tca ggt ggc gtg
1392Ala Val Thr Gln Val Gln Cys Cys Val Asn Trp Arg Ser Gly Gly Val
450 455 460
ttg gcc aat cac ctc tct gga ggc ttg aac cac cag atc gag cat cat
1440Leu Ala Asn His Leu Ser Gly Gly Leu Asn His Gln Ile Glu His His
465 470 475 480
ctg ttc ccc agc atc tcg cat gcc aac tac ccc acc atc gcc cct gtt
1488Leu Phe Pro Ser Ile Ser His Ala Asn Tyr Pro Thr Ile Ala Pro Val
485 490 495
gtg aag gag gtg tgc gag gag tac ggg ttg ccg tac aag aat tac gtc
1536Val Lys Glu Val Cys Glu Glu Tyr Gly Leu Pro Tyr Lys Asn Tyr Val
500 505 510
acg ttc tgg gat gca gtc tgt ggc atg gtt cag cac ctc cgg ttg atg
1584Thr Phe Trp Asp Ala Val Cys Gly Met Val Gln His Leu Arg Leu Met
515 520 525
ggt gct cca ccg gtg cca acg aac ggg gac aaa aag tca taa
1626Gly Ala Pro Pro Val Pro Thr Asn Gly Asp Lys Lys Ser
530 535 540
40541PRTEuglena gracilis 40Met Leu Val Leu Phe Gly Asn Phe Tyr Val Lys
Gln Tyr Ser Gln Lys 1 5 10
15 Asn Gly Lys Pro Glu Asn Gly Ala Thr Pro Glu Asn Gly Ala Lys Pro
20 25 30 Gln Pro
Cys Glu Asn Gly Thr Val Glu Lys Arg Glu Asn Asp Thr Ala 35
40 45 Asn Val Arg Pro Thr Arg Pro
Ala Gly Pro Pro Pro Ala Thr Tyr Tyr 50 55
60 Asp Ser Leu Ala Val Ser Gly Gln Gly Lys Glu Arg
Leu Phe Thr Thr 65 70 75
80 Asp Glu Val Arg Arg His Ile Leu Pro Thr Asp Gly Trp Leu Thr Cys
85 90 95 His Glu Gly
Val Tyr Asp Val Thr Asp Phe Leu Ala Lys His Pro Gly 100
105 110 Gly Gly Val Ile Thr Leu Gly Leu
Gly Arg Asp Cys Thr Ile Leu Ile 115 120
125 Glu Ser Tyr His Pro Ala Gly Arg Pro Asp Lys Val Met
Glu Lys Tyr 130 135 140
Arg Ile Gly Thr Leu Gln Asp Pro Lys Thr Phe Tyr Ala Trp Gly Glu 145
150 155 160 Ser Asp Phe Tyr
Pro Glu Leu Lys Arg Arg Ala Leu Ala Arg Leu Lys 165
170 175 Glu Ala Gly Gln Ala Arg Arg Gly Gly
Leu Gly Val Lys Ala Leu Leu 180 185
190 Val Leu Thr Leu Phe Phe Val Ser Trp Tyr Met Trp Val Ala
His Lys 195 200 205
Ser Phe Leu Trp Ala Ala Val Trp Gly Phe Ala Gly Ser His Val Gly 210
215 220 Leu Ser Ile Gln His
Asp Gly Asn His Gly Ala Phe Ser Arg Asn Thr 225 230
235 240 Leu Val Asn Arg Leu Ala Gly Trp Gly Met
Asp Leu Ile Gly Ala Ser 245 250
255 Ser Thr Val Trp Glu Tyr Gln His Val Ile Gly His His Gln Tyr
Thr 260 265 270 Asn
Leu Val Ser Asp Thr Leu Phe Ser Leu Pro Glu Asn Asp Pro Asp 275
280 285 Val Phe Ser Ser Tyr Pro
Leu Met Arg Met His Pro Asp Thr Ala Trp 290 295
300 Gln Pro His His Arg Phe Gln His Leu Phe Ala
Phe Pro Leu Phe Ala 305 310 315
320 Leu Met Thr Ile Ser Lys Val Leu Thr Ser Asp Phe Ala Val Cys Leu
325 330 335 Ser Met
Lys Lys Gly Ser Ile Asp Cys Ser Ser Arg Leu Val Pro Leu 340
345 350 Glu Gly Gln Leu Leu Phe Trp
Gly Ala Lys Leu Ala Asn Phe Leu Leu 355 360
365 Gln Ile Val Leu Pro Cys Tyr Leu His Gly Thr Ala
Met Gly Leu Ala 370 375 380
Leu Phe Ser Val Ala His Leu Val Ser Gly Glu Tyr Leu Ala Ile Cys 385
390 395 400 Phe Ile Ile
Asn His Ile Ser Glu Ser Cys Glu Phe Met Asn Thr Ser 405
410 415 Phe Gln Thr Ala Ala Arg Arg Thr
Glu Met Leu Gln Ala Ala His Gln 420 425
430 Ala Ala Glu Ala Lys Lys Val Lys Pro Thr Pro Pro Pro
Asn Asp Trp 435 440 445
Ala Val Thr Gln Val Gln Cys Cys Val Asn Trp Arg Ser Gly Gly Val 450
455 460 Leu Ala Asn His
Leu Ser Gly Gly Leu Asn His Gln Ile Glu His His 465 470
475 480 Leu Phe Pro Ser Ile Ser His Ala Asn
Tyr Pro Thr Ile Ala Pro Val 485 490
495 Val Lys Glu Val Cys Glu Glu Tyr Gly Leu Pro Tyr Lys Asn
Tyr Val 500 505 510
Thr Phe Trp Asp Ala Val Cys Gly Met Val Gln His Leu Arg Leu Met
515 520 525 Gly Ala Pro Pro
Val Pro Thr Asn Gly Asp Lys Lys Ser 530 535
540 411548DNAThraustochytriumCDS(1)..(1548)delta4-desaturase
41atg acg gtc ggg ttt gac gaa acg gtg act atg gac acg gtc cgc aac
48Met Thr Val Gly Phe Asp Glu Thr Val Thr Met Asp Thr Val Arg Asn
1 5 10 15
cac aac atg ccg gac gac gcc tgg tgc gcg atc cac ggc acc gtg tac
96His Asn Met Pro Asp Asp Ala Trp Cys Ala Ile His Gly Thr Val Tyr
20 25 30
gac atc acc aag ttc agc aag gtg cac ccc ggc ggg gac atc atc atg
144Asp Ile Thr Lys Phe Ser Lys Val His Pro Gly Gly Asp Ile Ile Met
35 40 45
ctg gcc gct ggc aag gag gcc acc atc ctg ttc gag acc tac cac atc
192Leu Ala Ala Gly Lys Glu Ala Thr Ile Leu Phe Glu Thr Tyr His Ile
50 55 60
aag ggc gtc ccg gac gcg gtg ctg cgc aag tac aag gtc ggc aag ctc
240Lys Gly Val Pro Asp Ala Val Leu Arg Lys Tyr Lys Val Gly Lys Leu
65 70 75 80
ccc cag ggc aag aag ggc gaa acg agc cac atg ccc acc ggg ctc gac
288Pro Gln Gly Lys Lys Gly Glu Thr Ser His Met Pro Thr Gly Leu Asp
85 90 95
tcg gcc tcc tac tac tcg tgg gac agc gag ttt tac agg gtg ctc cgc
336Ser Ala Ser Tyr Tyr Ser Trp Asp Ser Glu Phe Tyr Arg Val Leu Arg
100 105 110
gag cgc gtc gcc aag aag ctg gcc gag ccc ggc ctc atg cag cgc gcg
384Glu Arg Val Ala Lys Lys Leu Ala Glu Pro Gly Leu Met Gln Arg Ala
115 120 125
cgc atg gag ctc tgg gcc aag gcg atc ttc ctc ctg gca ggt ttc tgg
432Arg Met Glu Leu Trp Ala Lys Ala Ile Phe Leu Leu Ala Gly Phe Trp
130 135 140
ggc tcc ctt tac gcc atg tgc gtg cta gac ccg cac ggc ggt gcc atg
480Gly Ser Leu Tyr Ala Met Cys Val Leu Asp Pro His Gly Gly Ala Met
145 150 155 160
gta gcc gcc gtt acg ctc ggc gtg ttc gct gcc ttt gtc gga act tgc
528Val Ala Ala Val Thr Leu Gly Val Phe Ala Ala Phe Val Gly Thr Cys
165 170 175
atc cag cac gac ggc agc cac ggc gcc ttc tcc aag tcg cga ttc atg
576Ile Gln His Asp Gly Ser His Gly Ala Phe Ser Lys Ser Arg Phe Met
180 185 190
aac aag gcg gcg ggc tgg acc ctc gac atg atc ggc gcg agt gcg atg
624Asn Lys Ala Ala Gly Trp Thr Leu Asp Met Ile Gly Ala Ser Ala Met
195 200 205
acc tgg gag atg cag cac gtt ctt ggc cac cac ccg tac acc aac ctc
672Thr Trp Glu Met Gln His Val Leu Gly His His Pro Tyr Thr Asn Leu
210 215 220
atc gag atg gag aac ggt ttg gcc aag gtc aag ggc gcc gac gtc gac
720Ile Glu Met Glu Asn Gly Leu Ala Lys Val Lys Gly Ala Asp Val Asp
225 230 235 240
ccg aag aag gtc gac cag gag agc gac ccg gac gtc ttc agt acg tac
768Pro Lys Lys Val Asp Gln Glu Ser Asp Pro Asp Val Phe Ser Thr Tyr
245 250 255
ccg atg ctt cgc ctg cac ccg tgg cac cgc cag cgg ttt tac cac aag
816Pro Met Leu Arg Leu His Pro Trp His Arg Gln Arg Phe Tyr His Lys
260 265 270
ttc cag cac ctg tac gcc ccg ttt atc ttt ggg tct atg acg att aac
864Phe Gln His Leu Tyr Ala Pro Phe Ile Phe Gly Ser Met Thr Ile Asn
275 280 285
aag gtg att tcc cag gat gtc ggg gtt gtg ctg cgc aag cgc ctg ttc
912Lys Val Ile Ser Gln Asp Val Gly Val Val Leu Arg Lys Arg Leu Phe
290 295 300
cag atc gac gcc aac tgc cgg tat ggc agc ccc tgg tac gtg gcc cgc
960Gln Ile Asp Ala Asn Cys Arg Tyr Gly Ser Pro Trp Tyr Val Ala Arg
305 310 315 320
ttc tgg atc atg aag ctc ctc acc acg ctc tac atg gtg gcg ctt ccc
1008Phe Trp Ile Met Lys Leu Leu Thr Thr Leu Tyr Met Val Ala Leu Pro
325 330 335
atg tac atg cag ggg cct gct cag ggc ttg aag ctt ttc ttc atg gcc
1056Met Tyr Met Gln Gly Pro Ala Gln Gly Leu Lys Leu Phe Phe Met Ala
340 345 350
cac ttc acc tgc gga gag gtc ctc gcc acc atg ttt att gtc aac cac
1104His Phe Thr Cys Gly Glu Val Leu Ala Thr Met Phe Ile Val Asn His
355 360 365
atc atc gag ggc gtc agc tac gct tcc aag gac gcg gtc aag ggc gtc
1152Ile Ile Glu Gly Val Ser Tyr Ala Ser Lys Asp Ala Val Lys Gly Val
370 375 380
atg gct ccg ccg cgc act gtg cac ggt gtc acc ccg atg cag gtg acg
1200Met Ala Pro Pro Arg Thr Val His Gly Val Thr Pro Met Gln Val Thr
385 390 395 400
caa aag gcg ctc agt gcg gcc gag tcg gcc aag tcg gac gcc gac aag
1248Gln Lys Ala Leu Ser Ala Ala Glu Ser Ala Lys Ser Asp Ala Asp Lys
405 410 415
acg acc atg atc ccc ctc aac gac tgg gcc gct gtg cag tgc cag acc
1296Thr Thr Met Ile Pro Leu Asn Asp Trp Ala Ala Val Gln Cys Gln Thr
420 425 430
tct gtg aac tgg gct gtc ggg tcg tgg ttt tgg aac cac ttt tcg ggc
1344Ser Val Asn Trp Ala Val Gly Ser Trp Phe Trp Asn His Phe Ser Gly
435 440 445
ggc ctc aac cac cag att gag cac cac tgc ttc ccc caa aac ccc cac
1392Gly Leu Asn His Gln Ile Glu His His Cys Phe Pro Gln Asn Pro His
450 455 460
acg gtc aac gtc tac atc tcg ggc atc gtc aag gag acc tgc gaa gaa
1440Thr Val Asn Val Tyr Ile Ser Gly Ile Val Lys Glu Thr Cys Glu Glu
465 470 475 480
tac ggc gtg ccg tac cag gct gag atc agc ctc ttc tct gcc tat ttc
1488Tyr Gly Val Pro Tyr Gln Ala Glu Ile Ser Leu Phe Ser Ala Tyr Phe
485 490 495
aag atg ctg tcg cac ctc cgc acg ctc ggc aac gag gac ctc acg gcc
1536Lys Met Leu Ser His Leu Arg Thr Leu Gly Asn Glu Asp Leu Thr Ala
500 505 510
tgg tcc acg tga
1548Trp Ser Thr
515
42515PRTThraustochytrium 42Met Thr Val Gly Phe Asp Glu Thr Val Thr Met
Asp Thr Val Arg Asn 1 5 10
15 His Asn Met Pro Asp Asp Ala Trp Cys Ala Ile His Gly Thr Val Tyr
20 25 30 Asp Ile
Thr Lys Phe Ser Lys Val His Pro Gly Gly Asp Ile Ile Met 35
40 45 Leu Ala Ala Gly Lys Glu Ala
Thr Ile Leu Phe Glu Thr Tyr His Ile 50 55
60 Lys Gly Val Pro Asp Ala Val Leu Arg Lys Tyr Lys
Val Gly Lys Leu 65 70 75
80 Pro Gln Gly Lys Lys Gly Glu Thr Ser His Met Pro Thr Gly Leu Asp
85 90 95 Ser Ala Ser
Tyr Tyr Ser Trp Asp Ser Glu Phe Tyr Arg Val Leu Arg 100
105 110 Glu Arg Val Ala Lys Lys Leu Ala
Glu Pro Gly Leu Met Gln Arg Ala 115 120
125 Arg Met Glu Leu Trp Ala Lys Ala Ile Phe Leu Leu Ala
Gly Phe Trp 130 135 140
Gly Ser Leu Tyr Ala Met Cys Val Leu Asp Pro His Gly Gly Ala Met 145
150 155 160 Val Ala Ala Val
Thr Leu Gly Val Phe Ala Ala Phe Val Gly Thr Cys 165
170 175 Ile Gln His Asp Gly Ser His Gly Ala
Phe Ser Lys Ser Arg Phe Met 180 185
190 Asn Lys Ala Ala Gly Trp Thr Leu Asp Met Ile Gly Ala Ser
Ala Met 195 200 205
Thr Trp Glu Met Gln His Val Leu Gly His His Pro Tyr Thr Asn Leu 210
215 220 Ile Glu Met Glu Asn
Gly Leu Ala Lys Val Lys Gly Ala Asp Val Asp 225 230
235 240 Pro Lys Lys Val Asp Gln Glu Ser Asp Pro
Asp Val Phe Ser Thr Tyr 245 250
255 Pro Met Leu Arg Leu His Pro Trp His Arg Gln Arg Phe Tyr His
Lys 260 265 270 Phe
Gln His Leu Tyr Ala Pro Phe Ile Phe Gly Ser Met Thr Ile Asn 275
280 285 Lys Val Ile Ser Gln Asp
Val Gly Val Val Leu Arg Lys Arg Leu Phe 290 295
300 Gln Ile Asp Ala Asn Cys Arg Tyr Gly Ser Pro
Trp Tyr Val Ala Arg 305 310 315
320 Phe Trp Ile Met Lys Leu Leu Thr Thr Leu Tyr Met Val Ala Leu Pro
325 330 335 Met Tyr
Met Gln Gly Pro Ala Gln Gly Leu Lys Leu Phe Phe Met Ala 340
345 350 His Phe Thr Cys Gly Glu Val
Leu Ala Thr Met Phe Ile Val Asn His 355 360
365 Ile Ile Glu Gly Val Ser Tyr Ala Ser Lys Asp Ala
Val Lys Gly Val 370 375 380
Met Ala Pro Pro Arg Thr Val His Gly Val Thr Pro Met Gln Val Thr 385
390 395 400 Gln Lys Ala
Leu Ser Ala Ala Glu Ser Ala Lys Ser Asp Ala Asp Lys 405
410 415 Thr Thr Met Ile Pro Leu Asn Asp
Trp Ala Ala Val Gln Cys Gln Thr 420 425
430 Ser Val Asn Trp Ala Val Gly Ser Trp Phe Trp Asn His
Phe Ser Gly 435 440 445
Gly Leu Asn His Gln Ile Glu His His Cys Phe Pro Gln Asn Pro His 450
455 460 Thr Val Asn Val
Tyr Ile Ser Gly Ile Val Lys Glu Thr Cys Glu Glu 465 470
475 480 Tyr Gly Val Pro Tyr Gln Ala Glu Ile
Ser Leu Phe Ser Ala Tyr Phe 485 490
495 Lys Met Leu Ser His Leu Arg Thr Leu Gly Asn Glu Asp Leu
Thr Ala 500 505 510
Trp Ser Thr 515 43960DNAThalassiosira
pseudonanaCDS(1)..(960)delta5-elongase 43atg gtg ttg tac aat gtg gcg caa
gtg ctg ctc aat ggg tgg acg gtg 48Met Val Leu Tyr Asn Val Ala Gln
Val Leu Leu Asn Gly Trp Thr Val 1 5
10 15 tat gcg att gtg gat gcg gtg atg aat
aga gac cat ccg ttt att gga 96Tyr Ala Ile Val Asp Ala Val Met Asn
Arg Asp His Pro Phe Ile Gly 20 25
30 agt aga agt ttg gtt ggg gcg gcg ttg cat
agt ggg agc tcg tat gcg 144Ser Arg Ser Leu Val Gly Ala Ala Leu His
Ser Gly Ser Ser Tyr Ala 35 40
45 gtg tgg gtt cat tat tgt gat aag tat ttg gag
ttc ttt gat acg tat 192Val Trp Val His Tyr Cys Asp Lys Tyr Leu Glu
Phe Phe Asp Thr Tyr 50 55
60 ttt atg gtg ttg agg ggg aaa atg gac cag atg
gta ctt ggt gaa gtt 240Phe Met Val Leu Arg Gly Lys Met Asp Gln Met
Val Leu Gly Glu Val 65 70 75
80 ggt ggc agt gtg tgg tgt ggc gtt gga tat atg gat
atg gag aag atg 288Gly Gly Ser Val Trp Cys Gly Val Gly Tyr Met Asp
Met Glu Lys Met 85 90
95 ata cta ctc agc ttt gga gtg cat cgg tct gct cag gga
acg ggg aag 336Ile Leu Leu Ser Phe Gly Val His Arg Ser Ala Gln Gly
Thr Gly Lys 100 105
110 gct ttc acc aac aac gtt acc aat cca cat ctc acg ctt
cca cct cat 384Ala Phe Thr Asn Asn Val Thr Asn Pro His Leu Thr Leu
Pro Pro His 115 120 125
tct aca aaa aca aaa aaa cag gtc tcc ttc ctc cac atc tac
cac cac 432Ser Thr Lys Thr Lys Lys Gln Val Ser Phe Leu His Ile Tyr
His His 130 135 140
acg acc ata gcg tgg gca tgg tgg atc gcc ctc cgc ttc tcc ccc
ggt 480Thr Thr Ile Ala Trp Ala Trp Trp Ile Ala Leu Arg Phe Ser Pro
Gly 145 150 155
160 gga gac att tac ttc ggg gca ctc ctc aac tcc atc atc cac gtc
ctc 528Gly Asp Ile Tyr Phe Gly Ala Leu Leu Asn Ser Ile Ile His Val
Leu 165 170 175
atg tat tcc tac tac gcc ctt gcc cta ctc aag gtc agt tgt cca tgg
576Met Tyr Ser Tyr Tyr Ala Leu Ala Leu Leu Lys Val Ser Cys Pro Trp
180 185 190
aaa cga tac ctg act caa gct caa tta ttg caa ttc aca agt gtg gtg
624Lys Arg Tyr Leu Thr Gln Ala Gln Leu Leu Gln Phe Thr Ser Val Val
195 200 205
gtt tat acg ggg tgt acg ggt tat act cat tac tat cat acg aag cat
672Val Tyr Thr Gly Cys Thr Gly Tyr Thr His Tyr Tyr His Thr Lys His
210 215 220
gga gcg gat gag aca cag cct agt tta gga acg tat tat ttc tgt tgt
720Gly Ala Asp Glu Thr Gln Pro Ser Leu Gly Thr Tyr Tyr Phe Cys Cys
225 230 235 240
gga gtg cag gtg ttt gag atg gtt agt ttg ttt gta ctc ttt tcc atc
768Gly Val Gln Val Phe Glu Met Val Ser Leu Phe Val Leu Phe Ser Ile
245 250 255
ttt tat aaa cga tcc tat tcg aag aag aac aag tca gga gga aag gat
816Phe Tyr Lys Arg Ser Tyr Ser Lys Lys Asn Lys Ser Gly Gly Lys Asp
260 265 270
agc aag aag aat gat gat ggg aat aat gag gat caa tgt cac aag gct
864Ser Lys Lys Asn Asp Asp Gly Asn Asn Glu Asp Gln Cys His Lys Ala
275 280 285
atg aag gat ata tcg gag ggt gcg aag gag gtt gtg ggg cat gca gcg
912Met Lys Asp Ile Ser Glu Gly Ala Lys Glu Val Val Gly His Ala Ala
290 295 300
aag gat gct gga aag ttg gtg gct acg aga gta agg tgt aag gtg taa
960Lys Asp Ala Gly Lys Leu Val Ala Thr Arg Val Arg Cys Lys Val
305 310 315
44319PRTThalassiosira pseudonana 44Met Val Leu Tyr Asn Val Ala Gln Val
Leu Leu Asn Gly Trp Thr Val 1 5 10
15 Tyr Ala Ile Val Asp Ala Val Met Asn Arg Asp His Pro
Phe Ile Gly 20 25 30
Ser Arg Ser Leu Val Gly Ala Ala Leu His Ser Gly Ser Ser Tyr Ala
35 40 45 Val Trp Val His
Tyr Cys Asp Lys Tyr Leu Glu Phe Phe Asp Thr Tyr 50
55 60 Phe Met Val Leu Arg Gly Lys Met
Asp Gln Met Val Leu Gly Glu Val 65 70
75 80 Gly Gly Ser Val Trp Cys Gly Val Gly Tyr Met Asp
Met Glu Lys Met 85 90
95 Ile Leu Leu Ser Phe Gly Val His Arg Ser Ala Gln Gly Thr Gly Lys
100 105 110 Ala Phe Thr
Asn Asn Val Thr Asn Pro His Leu Thr Leu Pro Pro His 115
120 125 Ser Thr Lys Thr Lys Lys Gln Val
Ser Phe Leu His Ile Tyr His His 130 135
140 Thr Thr Ile Ala Trp Ala Trp Trp Ile Ala Leu Arg Phe
Ser Pro Gly 145 150 155
160 Gly Asp Ile Tyr Phe Gly Ala Leu Leu Asn Ser Ile Ile His Val Leu
165 170 175 Met Tyr Ser Tyr
Tyr Ala Leu Ala Leu Leu Lys Val Ser Cys Pro Trp 180
185 190 Lys Arg Tyr Leu Thr Gln Ala Gln Leu
Leu Gln Phe Thr Ser Val Val 195 200
205 Val Tyr Thr Gly Cys Thr Gly Tyr Thr His Tyr Tyr His Thr
Lys His 210 215 220
Gly Ala Asp Glu Thr Gln Pro Ser Leu Gly Thr Tyr Tyr Phe Cys Cys 225
230 235 240 Gly Val Gln Val Phe
Glu Met Val Ser Leu Phe Val Leu Phe Ser Ile 245
250 255 Phe Tyr Lys Arg Ser Tyr Ser Lys Lys Asn
Lys Ser Gly Gly Lys Asp 260 265
270 Ser Lys Lys Asn Asp Asp Gly Asn Asn Glu Asp Gln Cys His Lys
Ala 275 280 285 Met
Lys Asp Ile Ser Glu Gly Ala Lys Glu Val Val Gly His Ala Ala 290
295 300 Lys Asp Ala Gly Lys Leu
Val Ala Thr Arg Val Arg Cys Lys Val 305 310
315 45819DNAThalassiosira
pseudonanaCDS(1)..(819)delta5-elongase 45atg gac gcc tac aac gct gca atg
gat aag atc ggt gcc gcc atc atc 48Met Asp Ala Tyr Asn Ala Ala Met
Asp Lys Ile Gly Ala Ala Ile Ile 1 5
10 15 gat tgg tct gat ccc gat gga aag ttc
cgt gcc gat aga gag gac tgg 96Asp Trp Ser Asp Pro Asp Gly Lys Phe
Arg Ala Asp Arg Glu Asp Trp 20 25
30 tgg ctc tgc gac ttc cgt agc gcc atc acc
atc gcc ctc atc tac atc 144Trp Leu Cys Asp Phe Arg Ser Ala Ile Thr
Ile Ala Leu Ile Tyr Ile 35 40
45 gcc ttc gtc atc ctc ggt tcc gcc gtc atg caa
tcc ctc ccc gca atg 192Ala Phe Val Ile Leu Gly Ser Ala Val Met Gln
Ser Leu Pro Ala Met 50 55
60 gat ccc tac ccc atc aaa ttc ctc tac aac gtc
tcc caa atc ttc ctt 240Asp Pro Tyr Pro Ile Lys Phe Leu Tyr Asn Val
Ser Gln Ile Phe Leu 65 70 75
80 tgt gcc tac atg act gtc gag gcg gga ttt ttg gcc
tac cgc aat gga 288Cys Ala Tyr Met Thr Val Glu Ala Gly Phe Leu Ala
Tyr Arg Asn Gly 85 90
95 tat acc gtc atg cct tgc aat cat ttc aat gtg aat gat
cct ccc gtg 336Tyr Thr Val Met Pro Cys Asn His Phe Asn Val Asn Asp
Pro Pro Val 100 105
110 gcg aat ctt ctt tgg ttg ttt tat att tcc aag gtg tgg
gac ttt tgg 384Ala Asn Leu Leu Trp Leu Phe Tyr Ile Ser Lys Val Trp
Asp Phe Trp 115 120 125
gat acc att ttc att gtg ttg ggg aag aag tgg cgt caa tta
tct ttc 432Asp Thr Ile Phe Ile Val Leu Gly Lys Lys Trp Arg Gln Leu
Ser Phe 130 135 140
ttg cat gta tac cat cac acc acc atc ttt cta ttc tat tgg ctg
aat 480Leu His Val Tyr His His Thr Thr Ile Phe Leu Phe Tyr Trp Leu
Asn 145 150 155
160 gcc aat gtc ttg tac gat ggt gac atc ttc ctt acc atc ttg ctc
aat 528Ala Asn Val Leu Tyr Asp Gly Asp Ile Phe Leu Thr Ile Leu Leu
Asn 165 170 175
gga ttc atc cac acg gtg atg tac acg tat tac ttc atc tgt atg cat
576Gly Phe Ile His Thr Val Met Tyr Thr Tyr Tyr Phe Ile Cys Met His
180 185 190
acc aaa gat tcc aag acg ggc aag agt ctt cct ata tgg tgg aag tcg
624Thr Lys Asp Ser Lys Thr Gly Lys Ser Leu Pro Ile Trp Trp Lys Ser
195 200 205
agt ttg acg gcg ttt cag ttg ttg caa ttc act atc atg atg agt cag
672Ser Leu Thr Ala Phe Gln Leu Leu Gln Phe Thr Ile Met Met Ser Gln
210 215 220
gct acc tac ctt gtc ttc cac ggg tgt gat aag gtg tcg ctt cgt atc
720Ala Thr Tyr Leu Val Phe His Gly Cys Asp Lys Val Ser Leu Arg Ile
225 230 235 240
acg att gtg tac ttt gtg tcc ctt ttg agt ttg ttc ttc ctt ttt gct
768Thr Ile Val Tyr Phe Val Ser Leu Leu Ser Leu Phe Phe Leu Phe Ala
245 250 255
cag ttc ttt gtg caa tca tac atg gca ccc aaa aag aag aag agt gct
816Gln Phe Phe Val Gln Ser Tyr Met Ala Pro Lys Lys Lys Lys Ser Ala
260 265 270
tag 819
46272PRTThalassiosira pseudonana 46Met Asp Ala Tyr Asn Ala Ala Met Asp
Lys Ile Gly Ala Ala Ile Ile1 5 10
15 Asp Trp Ser Asp Pro Asp Gly Lys Phe Arg Ala Asp Arg Glu
Asp Trp 20 25 30
Trp Leu Cys Asp Phe Arg Ser Ala Ile Thr Ile Ala Leu Ile Tyr Ile
35 40 45 Ala Phe Val Ile
Leu Gly Ser Ala Val Met Gln Ser Leu Pro Ala Met 50
55 60 Asp Pro Tyr Pro Ile Lys Phe Leu
Tyr Asn Val Ser Gln Ile Phe Leu 65 70
75 80 Cys Ala Tyr Met Thr Val Glu Ala Gly Phe Leu Ala
Tyr Arg Asn Gly 85 90
95 Tyr Thr Val Met Pro Cys Asn His Phe Asn Val Asn Asp Pro Pro Val
100 105 110 Ala Asn Leu
Leu Trp Leu Phe Tyr Ile Ser Lys Val Trp Asp Phe Trp 115
120 125 Asp Thr Ile Phe Ile Val Leu Gly
Lys Lys Trp Arg Gln Leu Ser Phe 130 135
140 Leu His Val Tyr His His Thr Thr Ile Phe Leu Phe Tyr
Trp Leu Asn 145 150 155
160 Ala Asn Val Leu Tyr Asp Gly Asp Ile Phe Leu Thr Ile Leu Leu Asn
165 170 175 Gly Phe Ile His
Thr Val Met Tyr Thr Tyr Tyr Phe Ile Cys Met His 180
185 190 Thr Lys Asp Ser Lys Thr Gly Lys Ser
Leu Pro Ile Trp Trp Lys Ser 195 200
205 Ser Leu Thr Ala Phe Gln Leu Leu Gln Phe Thr Ile Met Met
Ser Gln 210 215 220
Ala Thr Tyr Leu Val Phe His Gly Cys Asp Lys Val Ser Leu Arg Ile 225
230 235 240 Thr Ile Val Tyr Phe
Val Ser Leu Leu Ser Leu Phe Phe Leu Phe Ala 245
250 255 Gln Phe Phe Val Gln Ser Tyr Met Ala Pro
Lys Lys Lys Lys Ser Ala 260 265
270 47936DNACrypthecodinium cohniiCDS(1)..(936)delta5-elongase
47atg tct gcc ttc atg act ctc cca cag gct ctc tcc gat gtg acc tcg
48Met Ser Ala Phe Met Thr Leu Pro Gln Ala Leu Ser Asp Val Thr Ser
1 5 10 15
gcc ttg gtc acg ctg gga aag gat gtc tcc agc cct tca gct ttt caa
96Ala Leu Val Thr Leu Gly Lys Asp Val Ser Ser Pro Ser Ala Phe Gln
20 25 30
gct gtc act ggc ttc tgc agg gag cag tgg ggg att ccg aca gta ttc
144Ala Val Thr Gly Phe Cys Arg Glu Gln Trp Gly Ile Pro Thr Val Phe
35 40 45
tgc ctg ggc tac ttg gcc atg gtc tac gcg gcc aga aga ccc ctc ccg
192Cys Leu Gly Tyr Leu Ala Met Val Tyr Ala Ala Arg Arg Pro Leu Pro
50 55 60
cag cac ggc tac atg gtt gcg gtg gac cgt tgc ttc gct gct tgg aac
240Gln His Gly Tyr Met Val Ala Val Asp Arg Cys Phe Ala Ala Trp Asn
65 70 75 80
ttg gct ctc tct gtc ttc agc act tgg ggc ttc tac cac atg gct gtc
288Leu Ala Leu Ser Val Phe Ser Thr Trp Gly Phe Tyr His Met Ala Val
85 90 95
ggg ctc tac aac atg aca gag acg agg ggc ttg caa ttc acc atc tgc
336Gly Leu Tyr Asn Met Thr Glu Thr Arg Gly Leu Gln Phe Thr Ile Cys
100 105 110
ggt tcg act ggg gag ctc gtg cag aac ctt cag act ggc cca acc gct
384Gly Ser Thr Gly Glu Leu Val Gln Asn Leu Gln Thr Gly Pro Thr Ala
115 120 125
ctg gcg ctc tgc ctc ttc tgc ttc agc aag atc ccc gag ttg atg gac
432Leu Ala Leu Cys Leu Phe Cys Phe Ser Lys Ile Pro Glu Leu Met Asp
130 135 140
acg gtg ttt ctc atc ctg aag gcc aag aag gtc cgc ttc ttg cag tgg
480Thr Val Phe Leu Ile Leu Lys Ala Lys Lys Val Arg Phe Leu Gln Trp
145 150 155 160
tac cac cat gcc aca gtc atg ctc ttc tgt tgg ctc gcc ctc gcg acg
528Tyr His His Ala Thr Val Met Leu Phe Cys Trp Leu Ala Leu Ala Thr
165 170 175
gag tac act cct ggc ttg tgg ttt gcg gcg acg aac tac ttc gtg cac
576Glu Tyr Thr Pro Gly Leu Trp Phe Ala Ala Thr Asn Tyr Phe Val His
180 185 190
tcc atc atg tac atg tac ttc ttc ctc atg acc ttc aag tcg gcc gcg
624Ser Ile Met Tyr Met Tyr Phe Phe Leu Met Thr Phe Lys Ser Ala Ala
195 200 205
aag gtg gtg aag ccc atc gcc cct ctc atc aca gtt atc cag att gct
672Lys Val Val Lys Pro Ile Ala Pro Leu Ile Thr Val Ile Gln Ile Ala
210 215 220
cag atg gtc tgg ggc ctc atc gtc aac ggc atc gcc atc acc acc ttc
720Gln Met Val Trp Gly Leu Ile Val Asn Gly Ile Ala Ile Thr Thr Phe
225 230 235 240
ttc acg act ggt gcc tgc cag atc cag tct gtg act gtg tat tcg gcc
768Phe Thr Thr Gly Ala Cys Gln Ile Gln Ser Val Thr Val Tyr Ser Ala
245 250 255
atc atc atg tac gct tcg tac ttc tac ctg ttc tcc cag ctc ttc ttc
816Ile Ile Met Tyr Ala Ser Tyr Phe Tyr Leu Phe Ser Gln Leu Phe Phe
260 265 270
gag gcc cat ggt gcc gct ggc aag aac aag aag aag ttg acc cgc gag
864Glu Ala His Gly Ala Ala Gly Lys Asn Lys Lys Lys Leu Thr Arg Glu
275 280 285
ctc tct cga aaa atc tcg gag gct ctc ctg aac acc ggt gac gag gtt
912Leu Ser Arg Lys Ile Ser Glu Ala Leu Leu Asn Thr Gly Asp Glu Val
290 295 300
tcc aag cac ctg aag gtg aat tga
936Ser Lys His Leu Lys Val Asn
305 310
48311PRTCrypthecodinium cohnii 48Met Ser Ala Phe Met Thr Leu Pro Gln Ala
Leu Ser Asp Val Thr Ser 1 5 10
15 Ala Leu Val Thr Leu Gly Lys Asp Val Ser Ser Pro Ser Ala
Phe Gln 20 25 30
Ala Val Thr Gly Phe Cys Arg Glu Gln Trp Gly Ile Pro Thr Val Phe
35 40 45 Cys Leu Gly Tyr
Leu Ala Met Val Tyr Ala Ala Arg Arg Pro Leu Pro 50
55 60 Gln His Gly Tyr Met Val Ala Val
Asp Arg Cys Phe Ala Ala Trp Asn 65 70
75 80 Leu Ala Leu Ser Val Phe Ser Thr Trp Gly Phe Tyr
His Met Ala Val 85 90
95 Gly Leu Tyr Asn Met Thr Glu Thr Arg Gly Leu Gln Phe Thr Ile Cys
100 105 110 Gly Ser Thr
Gly Glu Leu Val Gln Asn Leu Gln Thr Gly Pro Thr Ala 115
120 125 Leu Ala Leu Cys Leu Phe Cys Phe
Ser Lys Ile Pro Glu Leu Met Asp 130 135
140 Thr Val Phe Leu Ile Leu Lys Ala Lys Lys Val Arg Phe
Leu Gln Trp 145 150 155
160 Tyr His His Ala Thr Val Met Leu Phe Cys Trp Leu Ala Leu Ala Thr
165 170 175 Glu Tyr Thr Pro
Gly Leu Trp Phe Ala Ala Thr Asn Tyr Phe Val His 180
185 190 Ser Ile Met Tyr Met Tyr Phe Phe Leu
Met Thr Phe Lys Ser Ala Ala 195 200
205 Lys Val Val Lys Pro Ile Ala Pro Leu Ile Thr Val Ile Gln
Ile Ala 210 215 220
Gln Met Val Trp Gly Leu Ile Val Asn Gly Ile Ala Ile Thr Thr Phe 225
230 235 240 Phe Thr Thr Gly Ala
Cys Gln Ile Gln Ser Val Thr Val Tyr Ser Ala 245
250 255 Ile Ile Met Tyr Ala Ser Tyr Phe Tyr Leu
Phe Ser Gln Leu Phe Phe 260 265
270 Glu Ala His Gly Ala Ala Gly Lys Asn Lys Lys Lys Leu Thr Arg
Glu 275 280 285 Leu
Ser Arg Lys Ile Ser Glu Ala Leu Leu Asn Thr Gly Asp Glu Val 290
295 300 Ser Lys His Leu Lys Val
Asn 305 310 49927DNACrypthecodinium
cohniiCDS(1)..(927)delta5-elongase 49atg gct tcc tac caa caa gca ttc tcc
gaa ttg gct aga gct ttg tcc 48Met Ala Ser Tyr Gln Gln Ala Phe Ser
Glu Leu Ala Arg Ala Leu Ser 1 5
10 15 act ttg aac cac gac ttc tcc agc gtc
gag cca ttc aaa gtc gtg acg 96Thr Leu Asn His Asp Phe Ser Ser Val
Glu Pro Phe Lys Val Val Thr 20 25
30 cag ttc tgc agg gac cag tgg gcg atc ccg
aca gtc ttt tgc atc ggt 144Gln Phe Cys Arg Asp Gln Trp Ala Ile Pro
Thr Val Phe Cys Ile Gly 35 40
45 tac ttg gca atg gtc tac gcc acg cga aga cct
atc gcg aag cac ccc 192Tyr Leu Ala Met Val Tyr Ala Thr Arg Arg Pro
Ile Ala Lys His Pro 50 55
60 tac atg tct ctc gtg gat cgc tgc ttt gcg gcc
tgg aac ttg ggc ctc 240Tyr Met Ser Leu Val Asp Arg Cys Phe Ala Ala
Trp Asn Leu Gly Leu 65 70 75
80 tcg ctc ttc agt tgc tgg ggc ttc tac cac atg gca
gtg gga ctc tcc 288Ser Leu Phe Ser Cys Trp Gly Phe Tyr His Met Ala
Val Gly Leu Ser 85 90
95 cac acc act tgg aat ttc ggg ctc cag ttc acc atc tgc
ggc agc acc 336His Thr Thr Trp Asn Phe Gly Leu Gln Phe Thr Ile Cys
Gly Ser Thr 100 105
110 acg gag ctt gtg aat ggc ttc cag aag ggc ccg gcg gcc
ctc gcc ctc 384Thr Glu Leu Val Asn Gly Phe Gln Lys Gly Pro Ala Ala
Leu Ala Leu 115 120 125
atc ctg ttc tgc ttc tcc aag atc ccg gag ttg ggc gac acc
gtc ttc 432Ile Leu Phe Cys Phe Ser Lys Ile Pro Glu Leu Gly Asp Thr
Val Phe 130 135 140
ttg atc ttg aag gga aag aag gtc cgc ttc ttg cag tgg tac cac
cac 480Leu Ile Leu Lys Gly Lys Lys Val Arg Phe Leu Gln Trp Tyr His
His 145 150 155
160 acg acc gtg atg ctc ttc tgt tgg atg gcc ttg gcg act gag tac
act 528Thr Thr Val Met Leu Phe Cys Trp Met Ala Leu Ala Thr Glu Tyr
Thr 165 170 175
cct gga ttg tgg ttc gcg gcc acg aac tac ttc gtg cac tcc atc atg
576Pro Gly Leu Trp Phe Ala Ala Thr Asn Tyr Phe Val His Ser Ile Met
180 185 190
tac atg tac ttc ttc ctc atg acc ttc aag acg gcc gcc ggc atc atc
624Tyr Met Tyr Phe Phe Leu Met Thr Phe Lys Thr Ala Ala Gly Ile Ile
195 200 205
aag ccc atc gcg cct ctc atc acc atc atc cag atc tcc cag atg gtc
672Lys Pro Ile Ala Pro Leu Ile Thr Ile Ile Gln Ile Ser Gln Met Val
210 215 220
tgg ggc ttg gtc gtg aac gcc atc gcc gtc ggc acc ttc ttc acc aca
720Trp Gly Leu Val Val Asn Ala Ile Ala Val Gly Thr Phe Phe Thr Thr
225 230 235 240
ggc aac tgc cag atc cag gca gtg aca gtc tac tcc gcc atc gtg atg
768Gly Asn Cys Gln Ile Gln Ala Val Thr Val Tyr Ser Ala Ile Val Met
245 250 255
tac gcc tcc tac ttc tac ctc ttc ggc cag ctc ttc ttc gag gcc cag
816Tyr Ala Ser Tyr Phe Tyr Leu Phe Gly Gln Leu Phe Phe Glu Ala Gln
260 265 270
ggt tcg gct gga aag gac aag aag aag ttg gcc cga gag ctg agc cga
864Gly Ser Ala Gly Lys Asp Lys Lys Lys Leu Ala Arg Glu Leu Ser Arg
275 280 285
aag gtc tcg cgg gct ctc aca gca acg ggc gaa gag gtg tcg aag cac
912Lys Val Ser Arg Ala Leu Thr Ala Thr Gly Glu Glu Val Ser Lys His
290 295 300
atg aag gtg aat tga
927Met Lys Val Asn
305
50308PRTCrypthecodinium cohnii 50Met Ala Ser Tyr Gln Gln Ala Phe Ser Glu
Leu Ala Arg Ala Leu Ser 1 5 10
15 Thr Leu Asn His Asp Phe Ser Ser Val Glu Pro Phe Lys Val
Val Thr 20 25 30
Gln Phe Cys Arg Asp Gln Trp Ala Ile Pro Thr Val Phe Cys Ile Gly
35 40 45 Tyr Leu Ala Met
Val Tyr Ala Thr Arg Arg Pro Ile Ala Lys His Pro 50
55 60 Tyr Met Ser Leu Val Asp Arg Cys
Phe Ala Ala Trp Asn Leu Gly Leu 65 70
75 80 Ser Leu Phe Ser Cys Trp Gly Phe Tyr His Met Ala
Val Gly Leu Ser 85 90
95 His Thr Thr Trp Asn Phe Gly Leu Gln Phe Thr Ile Cys Gly Ser Thr
100 105 110 Thr Glu Leu
Val Asn Gly Phe Gln Lys Gly Pro Ala Ala Leu Ala Leu 115
120 125 Ile Leu Phe Cys Phe Ser Lys Ile
Pro Glu Leu Gly Asp Thr Val Phe 130 135
140 Leu Ile Leu Lys Gly Lys Lys Val Arg Phe Leu Gln Trp
Tyr His His 145 150 155
160 Thr Thr Val Met Leu Phe Cys Trp Met Ala Leu Ala Thr Glu Tyr Thr
165 170 175 Pro Gly Leu Trp
Phe Ala Ala Thr Asn Tyr Phe Val His Ser Ile Met 180
185 190 Tyr Met Tyr Phe Phe Leu Met Thr Phe
Lys Thr Ala Ala Gly Ile Ile 195 200
205 Lys Pro Ile Ala Pro Leu Ile Thr Ile Ile Gln Ile Ser Gln
Met Val 210 215 220
Trp Gly Leu Val Val Asn Ala Ile Ala Val Gly Thr Phe Phe Thr Thr 225
230 235 240 Gly Asn Cys Gln Ile
Gln Ala Val Thr Val Tyr Ser Ala Ile Val Met 245
250 255 Tyr Ala Ser Tyr Phe Tyr Leu Phe Gly Gln
Leu Phe Phe Glu Ala Gln 260 265
270 Gly Ser Ala Gly Lys Asp Lys Lys Lys Leu Ala Arg Glu Leu Ser
Arg 275 280 285 Lys
Val Ser Arg Ala Leu Thr Ala Thr Gly Glu Glu Val Ser Lys His 290
295 300 Met Lys Val Asn 305
51795DNAOncorhynchus mykissCDS(1)..(795)delta5-elongase 51atg gct
tca aca tgg caa agc gtt cag tcc atg cgc cag tgg att tta 48Met Ala
Ser Thr Trp Gln Ser Val Gln Ser Met Arg Gln Trp Ile Leu 1
5 10 15 gag aat gga
gat aaa agg aca gac cca tgg cta ctg gtc tac tcc cct 96Glu Asn Gly
Asp Lys Arg Thr Asp Pro Trp Leu Leu Val Tyr Ser Pro
20 25 30 atg cca gtg
gcc att ata ttc ctc ctc tat ctt ggt gtg gtc tgg gct 144Met Pro Val
Ala Ile Ile Phe Leu Leu Tyr Leu Gly Val Val Trp Ala 35
40 45 ggg ccc aag ctg
atg aaa cgc agg gaa cca gtt gat ctc aag gct gta 192Gly Pro Lys Leu
Met Lys Arg Arg Glu Pro Val Asp Leu Lys Ala Val 50
55 60 ctc att gtc tac aac
ttc gcc atg gtc tgc ctg tct gtc tac atg ttc 240Leu Ile Val Tyr Asn
Phe Ala Met Val Cys Leu Ser Val Tyr Met Phe 65
70 75 80 cat gag ttc ttg gtc
acg tcc ttg ctg tct aac tac agt tac ctg tgt 288His Glu Phe Leu Val
Thr Ser Leu Leu Ser Asn Tyr Ser Tyr Leu Cys 85
90 95 caa cct gtg gat tac agc
act agt cca ctg gcg atg agg atg gcc aaa 336Gln Pro Val Asp Tyr Ser
Thr Ser Pro Leu Ala Met Arg Met Ala Lys 100
105 110 gta tgc tgg tgg ttt ttc ttc
tcc aag gtc ata gaa ttg gct gac acg 384Val Cys Trp Trp Phe Phe Phe
Ser Lys Val Ile Glu Leu Ala Asp Thr 115
120 125 gtg ttc ttc atc ctg agg aag
aag aac agt cag ctg act ttc ctg cat 432Val Phe Phe Ile Leu Arg Lys
Lys Asn Ser Gln Leu Thr Phe Leu His 130 135
140 gtc tat cac cat ggc acc atg atc
ttc aac tgg tgg gca ggg gtc aag 480Val Tyr His His Gly Thr Met Ile
Phe Asn Trp Trp Ala Gly Val Lys 145 150
155 160 tat ctg gct gga ggc caa tcg ttc ttc
atc ggc ctg ctc aat acc ttt 528Tyr Leu Ala Gly Gly Gln Ser Phe Phe
Ile Gly Leu Leu Asn Thr Phe 165
170 175 gtg cac atc gtg atg tac tct tac tac
gga ctg gct gcc ctg ggg cct 576Val His Ile Val Met Tyr Ser Tyr Tyr
Gly Leu Ala Ala Leu Gly Pro 180 185
190 cac acg cag aag tac tta tgg tgg aag cgc
tat ctg acc tca ctg cag 624His Thr Gln Lys Tyr Leu Trp Trp Lys Arg
Tyr Leu Thr Ser Leu Gln 195 200
205 ctg ctc cag ttt gtc ctg ttg acc act cac act
ggc tac aac ctc ttc 672Leu Leu Gln Phe Val Leu Leu Thr Thr His Thr
Gly Tyr Asn Leu Phe 210 215
220 act gag tgt gac ttc ccg gac tcc atg aac gct
gtg gtg ttt gcc tac 720Thr Glu Cys Asp Phe Pro Asp Ser Met Asn Ala
Val Val Phe Ala Tyr 225 230 235
240 tgt gtc agt ctc att gct ctc ttc agc aac ttc tac
tat cag agc tac 768Cys Val Ser Leu Ile Ala Leu Phe Ser Asn Phe Tyr
Tyr Gln Ser Tyr 245 250
255 ctc aac agg aag agc aag aag aca taa
795Leu Asn Arg Lys Ser Lys Lys Thr
260
52264PRTOncorhynchus mykiss 52Met Ala Ser Thr Trp Gln Ser
Val Gln Ser Met Arg Gln Trp Ile Leu 1 5
10 15 Glu Asn Gly Asp Lys Arg Thr Asp Pro Trp Leu
Leu Val Tyr Ser Pro 20 25
30 Met Pro Val Ala Ile Ile Phe Leu Leu Tyr Leu Gly Val Val Trp
Ala 35 40 45
Gly Pro Lys Leu Met Lys Arg Arg Glu Pro Val Asp Leu Lys Ala Val 50
55 60 Leu Ile Val Tyr
Asn Phe Ala Met Val Cys Leu Ser Val Tyr Met Phe 65 70
75 80 His Glu Phe Leu Val Thr Ser Leu
Leu Ser Asn Tyr Ser Tyr Leu Cys 85 90
95 Gln Pro Val Asp Tyr Ser Thr Ser Pro Leu Ala Met Arg
Met Ala Lys 100 105 110
Val Cys Trp Trp Phe Phe Phe Ser Lys Val Ile Glu Leu Ala Asp Thr
115 120 125 Val Phe Phe Ile
Leu Arg Lys Lys Asn Ser Gln Leu Thr Phe Leu His 130
135 140 Val Tyr His His Gly Thr Met Ile
Phe Asn Trp Trp Ala Gly Val Lys 145 150
155 160 Tyr Leu Ala Gly Gly Gln Ser Phe Phe Ile Gly Leu
Leu Asn Thr Phe 165 170
175 Val His Ile Val Met Tyr Ser Tyr Tyr Gly Leu Ala Ala Leu Gly Pro
180 185 190 His Thr Gln
Lys Tyr Leu Trp Trp Lys Arg Tyr Leu Thr Ser Leu Gln 195
200 205 Leu Leu Gln Phe Val Leu Leu Thr
Thr His Thr Gly Tyr Asn Leu Phe 210 215
220 Thr Glu Cys Asp Phe Pro Asp Ser Met Asn Ala Val Val
Phe Ala Tyr 225 230 235
240 Cys Val Ser Leu Ile Ala Leu Phe Ser Asn Phe Tyr Tyr Gln Ser Tyr
245 250 255 Leu Asn Arg Lys
Ser Lys Lys Thr 260 53885DNAOncorhynchus
mykissCDS(1)..(885)delta5-elongase 53atg gag act ttt aat tat aaa cta aac
atg tac ata gac tca tgg atg 48Met Glu Thr Phe Asn Tyr Lys Leu Asn
Met Tyr Ile Asp Ser Trp Met 1 5
10 15 ggt ccc aga gat gag cgg gta cag gga
tgg ctg ctt ctg gac aac tac 96Gly Pro Arg Asp Glu Arg Val Gln Gly
Trp Leu Leu Leu Asp Asn Tyr 20 25
30 cct cca acc ttt gca cta aca gtc atg tac
ctg ctg atc gta tgg atg 144Pro Pro Thr Phe Ala Leu Thr Val Met Tyr
Leu Leu Ile Val Trp Met 35 40
45 ggg ccc aag tac atg aga cac aga cag ccg gtg
tct tgc cgg ggt ctc 192Gly Pro Lys Tyr Met Arg His Arg Gln Pro Val
Ser Cys Arg Gly Leu 50 55
60 ctc ttg gtc tac aat ctg ggc ctc acg atc ttg
tcc ttc tat atg ttc 240Leu Leu Val Tyr Asn Leu Gly Leu Thr Ile Leu
Ser Phe Tyr Met Phe 65 70 75
80 tat gag atg gtg tct gct gtg tgg cac ggg gat tat
aac ttc ttt tgc 288Tyr Glu Met Val Ser Ala Val Trp His Gly Asp Tyr
Asn Phe Phe Cys 85 90
95 caa gac aca cac agt gca gga gaa acc gat acc aag atc
ata aat gtg 336Gln Asp Thr His Ser Ala Gly Glu Thr Asp Thr Lys Ile
Ile Asn Val 100 105
110 ctg tgg tgg tac tac ttc tcc aag ctc ata gag ttt atg
gat acc ttc 384Leu Trp Trp Tyr Tyr Phe Ser Lys Leu Ile Glu Phe Met
Asp Thr Phe 115 120 125
ttc ttc atc ctg cgg aag aac aac cat caa atc acg ttt ctg
cac atc 432Phe Phe Ile Leu Arg Lys Asn Asn His Gln Ile Thr Phe Leu
His Ile 130 135 140
tac cac cat gct agc atg ctc aac atc tgg tgg ttc gtc atg aac
tgg 480Tyr His His Ala Ser Met Leu Asn Ile Trp Trp Phe Val Met Asn
Trp 145 150 155
160 gtg ccc tgt ggt cac tcc tac ttt ggt gcc tcc ctg aac agc ttc
atc 528Val Pro Cys Gly His Ser Tyr Phe Gly Ala Ser Leu Asn Ser Phe
Ile 165 170 175
cat gtc ctg atg tac tct tac tat ggg ctc tct gct gtc ccg gcc ttg
576His Val Leu Met Tyr Ser Tyr Tyr Gly Leu Ser Ala Val Pro Ala Leu
180 185 190
cgg ccc tat cta tgg tgg aag aaa tac atc aca caa gta cag ctg att
624Arg Pro Tyr Leu Trp Trp Lys Lys Tyr Ile Thr Gln Val Gln Leu Ile
195 200 205
cag ttc ttt ttg acc atg tcc cag acg ata tgt gca gtc att tgg cca
672Gln Phe Phe Leu Thr Met Ser Gln Thr Ile Cys Ala Val Ile Trp Pro
210 215 220
tgt gat ttc ccc aga ggg tgg ctg tat ttc cag ata ttc tat gtc atc
720Cys Asp Phe Pro Arg Gly Trp Leu Tyr Phe Gln Ile Phe Tyr Val Ile
225 230 235 240
aca ctt att gcc ctt ttc tca aac ttc tac att cag act tac aag aaa
768Thr Leu Ile Ala Leu Phe Ser Asn Phe Tyr Ile Gln Thr Tyr Lys Lys
245 250 255
cac ctt gtt tca caa aag aag gag tat cat cag aat ggc tct gtt gct
816His Leu Val Ser Gln Lys Lys Glu Tyr His Gln Asn Gly Ser Val Ala
260 265 270
tca ttg aat ggc cat gtg aat ggg gtg aca ccc acg gaa acc att aca
864Ser Leu Asn Gly His Val Asn Gly Val Thr Pro Thr Glu Thr Ile Thr
275 280 285
cac agg aaa gtg agg ggg gac
885His Arg Lys Val Arg Gly Asp
290 295
54295PRTOncorhynchus mykiss 54Met Glu Thr Phe Asn Tyr Lys Leu Asn Met Tyr
Ile Asp Ser Trp Met 1 5 10
15 Gly Pro Arg Asp Glu Arg Val Gln Gly Trp Leu Leu Leu Asp Asn
Tyr 20 25 30 Pro
Pro Thr Phe Ala Leu Thr Val Met Tyr Leu Leu Ile Val Trp Met 35
40 45 Gly Pro Lys Tyr Met Arg
His Arg Gln Pro Val Ser Cys Arg Gly Leu 50 55
60 Leu Leu Val Tyr Asn Leu Gly Leu Thr Ile Leu
Ser Phe Tyr Met Phe 65 70 75
80 Tyr Glu Met Val Ser Ala Val Trp His Gly Asp Tyr Asn Phe Phe Cys
85 90 95 Gln Asp
Thr His Ser Ala Gly Glu Thr Asp Thr Lys Ile Ile Asn Val 100
105 110 Leu Trp Trp Tyr Tyr Phe Ser
Lys Leu Ile Glu Phe Met Asp Thr Phe 115 120
125 Phe Phe Ile Leu Arg Lys Asn Asn His Gln Ile Thr
Phe Leu His Ile 130 135 140
Tyr His His Ala Ser Met Leu Asn Ile Trp Trp Phe Val Met Asn Trp 145
150 155 160 Val Pro Cys
Gly His Ser Tyr Phe Gly Ala Ser Leu Asn Ser Phe Ile 165
170 175 His Val Leu Met Tyr Ser Tyr Tyr
Gly Leu Ser Ala Val Pro Ala Leu 180 185
190 Arg Pro Tyr Leu Trp Trp Lys Lys Tyr Ile Thr Gln Val
Gln Leu Ile 195 200 205
Gln Phe Phe Leu Thr Met Ser Gln Thr Ile Cys Ala Val Ile Trp Pro 210
215 220 Cys Asp Phe Pro
Arg Gly Trp Leu Tyr Phe Gln Ile Phe Tyr Val Ile 225 230
235 240 Thr Leu Ile Ala Leu Phe Ser Asn Phe
Tyr Ile Gln Thr Tyr Lys Lys 245 250
255 His Leu Val Ser Gln Lys Lys Glu Tyr His Gln Asn Gly Ser
Val Ala 260 265 270
Ser Leu Asn Gly His Val Asn Gly Val Thr Pro Thr Glu Thr Ile Thr
275 280 285 His Arg Lys Val
Arg Gly Asp 290 295 556753DNAOncorhynchus
mykissCDS(513)..(1397)delta5-elongase 55acggattaga agccgccgag cgggtgacag
ccctccgaag gaagactctc ctccgtgcgt 60cctcgtcctc accggtcgcg ttcctgaaac
gcagatgtgc ctcgcgccgc actgctccga 120acaataaaga ttctacaata ctagctttta
tggttatgaa gaggaaaaat tggcagtaac 180ctggccccac aaaccttcaa atgaacgaat
caaattaaca accataggat gataatgcga 240ttagtttttt agccttattt ctggggtaat
taatcagcga agcgatgatt tttgatctat 300taacagatat ataaatgcaa aaactgcatt
aaccacttta actaatactt tcaacatttt 360cggtttgtat tacttcttat tcaaatgtaa
taaaagtatc aacaaaaaat tgttaatata 420cctctatact ttaacgtcaa ggagaaaaaa
ccccggatcg gactactagc agctgtaata 480cgactcacta tagggaatat taagcttaca
ta atg gag act ttt aat tat aaa 533
Met Glu Thr Phe Asn Tyr Lys
1 5 cta aac atg tac ata gac tca tgg atg
ggt ccc aga gat gag cgg gta 581Leu Asn Met Tyr Ile Asp Ser Trp Met
Gly Pro Arg Asp Glu Arg Val 10 15
20 cag gga tgg ctg ctt ctg gac aac tac cct
cca acc ttt gca cta aca 629Gln Gly Trp Leu Leu Leu Asp Asn Tyr Pro
Pro Thr Phe Ala Leu Thr 25 30
35 gtc atg tac ctg ctg atc gta tgg atg ggg ccc
aag tac atg aga cac 677Val Met Tyr Leu Leu Ile Val Trp Met Gly Pro
Lys Tyr Met Arg His 40 45 50
55 aga cag ccg gtg tct tgc cgg ggt ctc ctc ttg gtc
tac aat ctg ggc 725Arg Gln Pro Val Ser Cys Arg Gly Leu Leu Leu Val
Tyr Asn Leu Gly 60 65
70 ctc acg atc ttg tcc ttc tat atg ttc tat gag atg gtg
tct gct gtg 773Leu Thr Ile Leu Ser Phe Tyr Met Phe Tyr Glu Met Val
Ser Ala Val 75 80
85 tgg cac ggg gat tat aac ttc ttt tgc caa gac aca cac
agt gca gga 821Trp His Gly Asp Tyr Asn Phe Phe Cys Gln Asp Thr His
Ser Ala Gly 90 95 100
gaa acc gat acc aag atc ata aat gtg ctg tgg tgg tac tac
ttc tcc 869Glu Thr Asp Thr Lys Ile Ile Asn Val Leu Trp Trp Tyr Tyr
Phe Ser 105 110 115
aag ctc ata gag ttt atg gat acc ttc ttc ttc atc ctg cgg aag
aac 917Lys Leu Ile Glu Phe Met Asp Thr Phe Phe Phe Ile Leu Arg Lys
Asn 120 125 130
135 aac cat caa atc acg ttt ctg cac atc tac cac cat gct agc atg
ctc 965Asn His Gln Ile Thr Phe Leu His Ile Tyr His His Ala Ser Met
Leu 140 145 150
aac atc tgg tgg ttc gtc atg aac tgg gtg ccc tgt ggt cac tcc tac
1013Asn Ile Trp Trp Phe Val Met Asn Trp Val Pro Cys Gly His Ser Tyr
155 160 165
ttt ggt gcc tcc ctg aac agc ttc atc cat gtc ctg atg tac tct tac
1061Phe Gly Ala Ser Leu Asn Ser Phe Ile His Val Leu Met Tyr Ser Tyr
170 175 180
tat ggg ctc tct gct gtc ccg gcc ttg cgg ccc tat cta tgg tgg aag
1109Tyr Gly Leu Ser Ala Val Pro Ala Leu Arg Pro Tyr Leu Trp Trp Lys
185 190 195
aaa tac atc aca caa gta cag ctg att cag ttc ttt ttg acc atg tcc
1157Lys Tyr Ile Thr Gln Val Gln Leu Ile Gln Phe Phe Leu Thr Met Ser
200 205 210 215
cag acg ata tgt gca gtc att tgg cca tgt gat ttc ccc aga ggg tgg
1205Gln Thr Ile Cys Ala Val Ile Trp Pro Cys Asp Phe Pro Arg Gly Trp
220 225 230
ctg tat ttc cag ata ttc tat gtc atc aca ctt att gcc ctt ttc tca
1253Leu Tyr Phe Gln Ile Phe Tyr Val Ile Thr Leu Ile Ala Leu Phe Ser
235 240 245
aac ttc tac att cag act tac aag aaa cac ctt gtt tca caa aag aag
1301Asn Phe Tyr Ile Gln Thr Tyr Lys Lys His Leu Val Ser Gln Lys Lys
250 255 260
gag tat cat cag aat ggc tct gtt gct tca ttg aat ggc cat gtg aat
1349Glu Tyr His Gln Asn Gly Ser Val Ala Ser Leu Asn Gly His Val Asn
265 270 275
ggg gtg aca ccc acg gaa acc att aca cac agg aaa gtg agg ggg gac
1397Gly Val Thr Pro Thr Glu Thr Ile Thr His Arg Lys Val Arg Gly Asp
280 285 290 295
tgaaggatcc actagtaacg gccgccagtg tgctggaatt ctgcagatat ccagcacagt
1457ggcggccgct cgagtctaga gggcccttcg aaggtaagcc tatccctaac cctctcctcg
1517gtctcgattc tacgcgtacc ggtcatcatc accatcacca ttgagtttaa acccgctgat
1577cctagagggc cgcatcatgt aattagttat gtcacgctta cattcacgcc ctccccccac
1637atccgctcta accgaaaagg aaggagttag acaacctgaa gtctaggtcc ctatttattt
1697ttttatagtt atgttagtat taagaacgtt atttatattt caaatttttc ttttttttct
1757gtacagacgc gtgtacgcat gtaacattat actgaaaacc ttgcttgaga aggttttggg
1817acgctcgaag gctttaattt gcaagctgcg gccctgcatt aatgaatcgg ccaacgcgcg
1877gggagaggcg gtttgcgtat tgggcgctct tccgcttcct cgctcactga ctcgctgcgc
1937tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc
1997acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca aaagcccagg
2057aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat
2117cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag
2177gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga
2237tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg
2297tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt
2357cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac
2417gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc
2477ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt
2537ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc
2597ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc
2657agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg
2717aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag
2777atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg
2837tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt
2897tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga gcgcttacca
2957tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca
3017gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc
3077tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt
3137ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg
3197gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc
3257aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg
3317ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga
3377tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga
3437ccgagttgct cttgcccggc gtcaacacgg gataataccg cgccacatag cagaacttta
3497aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg
3557ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact
3617ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata
3677agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt
3737tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa aaataaacaa
3797ataggggttc cgcgcacatt tccccgaaaa gtgccacctg acgtctaaga aaccattatt
3857atcatgacat taacctataa aaataggcgt atcacgaggc cctttcgtct tcaagaaatt
3917cggtcgaaaa aagaaaagga gagggccaag agggagggca ttggtgacta ttgagcacgt
3977gagtatacgt gattaagcac acaaaggcag cttggagtat gtctgttatt aatttcacag
4037gtagttctgg tccattggtg aaagtttgcg gcttgcagag cacagaggcc gcagaatgtg
4097ctctagattc cgatgctgac ttgctgggta ttatatgtgt gcccaataga aagagaacaa
4157ttgacccggt tattgcaagg aaaatttcaa gtcttgtaaa agcatataaa aatagttcag
4217gcactccgaa atacttggtt ggcgtgtttc gtaatcaacc taaggaggat gttttggctc
4277tggtcaatga ttacggcatt gatatcgtcc aactgcacgg agatgagtcg tggcaagaat
4337accaagagtt cctcggtttg ccagttatta aaagactcgt atttccaaaa gactgcaaca
4397tactactcag tgcagcttca cagaaacctc attcgtttat tcccttgttt gattcagaag
4457caggtgggac aggtgaactt ttggattgga actcgatttc tgactgggtt ggaaggcaag
4517agagccccga gagcttacat tttatgttag ctggtggact gacgccagaa aatgttggtg
4577atgcgcttag attaaatggc gttattggtg ttgatgtaag cggaggtgtg gagacaaatg
4637gtgtaaaaga ctctaacaaa atagcaaatt tcgtcaaaaa tgctaagaaa taggttatta
4697ctgagtagta tttatttaag tattgtttgt gcacttgccc tagcttatcg atgataagct
4757gtcaaagatg agaattaatt ccacggacta tagactatac tagatactcc gtctactgta
4817cgatacactt ccgctcaggt ccttgtcctt taacgaggcc ttaccactct tttgttactc
4877tattgatcca gctcagcaaa ggcagtgtga tctaagattc tatcttcgcg atgtagtaaa
4937actagctaga ccgagaaaga gactagaaat gcaaaaggca cttctacaat ggctgccatc
4997attattatcc gatgtgacgc tgcagcttct caatgatatt cgaatacgct ttgaggagat
5057acagcctaat atccgacaaa ctgttttaca gatttacgat cgtacttgtt acccatcatt
5117gaattttgaa catccgaacc tgggagtttt ccctgaaaca gatagtatat ttgaacctgt
5177ataataatat atagtctagc gctttacgga agacaatgta tgtatttcgg ttcctggaga
5237aactattgca tctattgcat aggtaatctt gcacgtcgca tccccggttc attttctgcg
5297tttccatctt gcacttcaat agcatatctt tgttaacgaa gcatctgtgc ttcattttgt
5357agaacaaaaa tgcaacgcga gagcgctaat ttttcaaaca aagaatctga gctgcatttt
5417tacagaacag aaatgcaacg cgaaagcgct attttaccaa cgaagaatct gtgcttcatt
5477tttgtaaaac aaaaatgcaa cgcgacgaga gcgctaattt ttcaaacaaa gaatctgagc
5537tgcattttta cagaacagaa atgcaacgcg agagcgctat tttaccaaca aagaatctat
5597acttcttttt tgttctacaa aaatgcatcc cgagagcgct atttttctaa caaagcatct
5657tagattactt tttttctcct ttgtgcgctc tataatgcag tctcttgata actttttgca
5717ctgtaggtcc gttaaggtta gaagaaggct actttggtgt ctattttctc ttccataaaa
5777aaagcctgac tccacttccc gcgtttactg attactagcg aagctgcggg tgcatttttt
5837caagataaag gcatccccga ttatattcta taccgatgtg gattgcgcat actttgtgaa
5897cagaaagtga tagcgttgat gattcttcat tggtcagaaa attatgaacg gtttcttcta
5957ttttgtctct atatactacg tataggaaat gtttacattt tcgtattgtt ttcgattcac
6017tctatgaata gttcttacta caattttttt gtctaaagag taatactaga gataaacata
6077aaaaatgtag aggtcgagtt tagatgcaag ttcaaggagc gaaaggtgga tgggtaggtt
6137atatagggat atagcacaga gatatatagc aaagagatac ttttgagcaa tgtttgtgga
6197agcggtattc gcaatgggaa gctccacccc ggttgataat cagaaaagcc ccaaaaacag
6257gaagattgta taagcaaata tttaaattgt aaacgttaat attttgttaa aattcgcgtt
6317aaatttttgt taaatcagct cattttttaa cgaatagccc gaaatcggca aaatccctta
6377taaatcaaaa gaatagaccg agatagggtt gagtgttgtt ccagtttcca acaagagtcc
6437actattaaag aacgtggact ccaacgtcaa agggcgaaaa agggtctatc agggcgatgg
6497cccactacgt gaaccatcac cctaatcaag ttttttgggg tcgaggtgcc gtaaagcagt
6557aaatcggaag ggtaaacgga tgcccccatt tagagcttga cggggaaagc cggcgaacgt
6617ggcgagaaag gaagggaaga aagcgaaagg agcgggggct agggcggtgg gaagtgtagg
6677ggtcacgctg ggcgtaacca ccacacccgc cgcgcttaat ggggcgctac agggcgcgtg
6737gggatgatcc actagt
675356295PRTOncorhynchus mykiss 56Met Glu Thr Phe Asn Tyr Lys Leu Asn Met
Tyr Ile Asp Ser Trp Met 1 5 10
15 Gly Pro Arg Asp Glu Arg Val Gln Gly Trp Leu Leu Leu Asp Asn
Tyr 20 25 30 Pro
Pro Thr Phe Ala Leu Thr Val Met Tyr Leu Leu Ile Val Trp Met 35
40 45 Gly Pro Lys Tyr Met Arg
His Arg Gln Pro Val Ser Cys Arg Gly Leu 50 55
60 Leu Leu Val Tyr Asn Leu Gly Leu Thr Ile Leu
Ser Phe Tyr Met Phe 65 70 75
80 Tyr Glu Met Val Ser Ala Val Trp His Gly Asp Tyr Asn Phe Phe Cys
85 90 95 Gln Asp
Thr His Ser Ala Gly Glu Thr Asp Thr Lys Ile Ile Asn Val 100
105 110 Leu Trp Trp Tyr Tyr Phe Ser
Lys Leu Ile Glu Phe Met Asp Thr Phe 115 120
125 Phe Phe Ile Leu Arg Lys Asn Asn His Gln Ile Thr
Phe Leu His Ile 130 135 140
Tyr His His Ala Ser Met Leu Asn Ile Trp Trp Phe Val Met Asn Trp 145
150 155 160 Val Pro Cys
Gly His Ser Tyr Phe Gly Ala Ser Leu Asn Ser Phe Ile 165
170 175 His Val Leu Met Tyr Ser Tyr Tyr
Gly Leu Ser Ala Val Pro Ala Leu 180 185
190 Arg Pro Tyr Leu Trp Trp Lys Lys Tyr Ile Thr Gln Val
Gln Leu Ile 195 200 205
Gln Phe Phe Leu Thr Met Ser Gln Thr Ile Cys Ala Val Ile Trp Pro 210
215 220 Cys Asp Phe Pro
Arg Gly Trp Leu Tyr Phe Gln Ile Phe Tyr Val Ile 225 230
235 240 Thr Leu Ile Ala Leu Phe Ser Asn Phe
Tyr Ile Gln Thr Tyr Lys Lys 245 250
255 His Leu Val Ser Gln Lys Lys Glu Tyr His Gln Asn Gly Ser
Val Ala 260 265 270
Ser Leu Asn Gly His Val Asn Gly Val Thr Pro Thr Glu Thr Ile Thr
275 280 285 His Arg Lys Val
Arg Gly Asp 290 295 576645DNAOncorhynchus
mykissCDS(513)..(1304)delta5-elongase 57acggattaga agccgccgag cgggtgacag
ccctccgaag gaagactctc ctccgtgcgt 60cctcgtcctc accggtcgcg ttcctgaaac
gcagatgtgc ctcgcgccgc actgctccga 120acaataaaga ttctacaata ctagctttta
tggttatgaa gaggaaaaat tggcagtaac 180ctggccccac aaaccttcaa atgaacgaat
caaattaaca accataggat gataatgcga 240ttagtttttt agccttattt ctggggtaat
taatcagcga agcgatgatt tttgatctat 300taacagatat ataaatgcaa aaactgcatt
aaccacttta actaatactt tcaacatttt 360cggtttgtat tacttcttat tcaaatgtaa
taaaagtatc aacaaaaaat tgttaatata 420cctctatact ttaacgtcaa ggagaaaaaa
ccccggatcg gactactagc agctgtaata 480cgactcacta tagggaatat taagcttaca
ta atg gct tca aca tgg caa agc 533
Met Ala Ser Thr Trp Gln Ser
1 5 gtt cag tcc atg cgc cag tgg att tta
gag aat gga gat aaa agg aca 581Val Gln Ser Met Arg Gln Trp Ile Leu
Glu Asn Gly Asp Lys Arg Thr 10 15
20 gac cca tgg cta ctg gtc tac tcc cct atg
cca gtg gcc att ata ttc 629Asp Pro Trp Leu Leu Val Tyr Ser Pro Met
Pro Val Ala Ile Ile Phe 25 30
35 ctc ctc tat ctt ggt gtg gtc tgg gct ggg ccc
aag ctg atg aaa cgc 677Leu Leu Tyr Leu Gly Val Val Trp Ala Gly Pro
Lys Leu Met Lys Arg 40 45 50
55 agg gaa cca gtt gat ctc aag gct gta ctc att gtc
tac aac ttc gcc 725Arg Glu Pro Val Asp Leu Lys Ala Val Leu Ile Val
Tyr Asn Phe Ala 60 65
70 atg gtc tgc ctg tct gtc tac atg ttc cat gag ttc ttg
gtc acg tcc 773Met Val Cys Leu Ser Val Tyr Met Phe His Glu Phe Leu
Val Thr Ser 75 80
85 ttg ctg tct aac tac agt tac ctg tgt caa cct gtg gat
tac agc act 821Leu Leu Ser Asn Tyr Ser Tyr Leu Cys Gln Pro Val Asp
Tyr Ser Thr 90 95 100
agt cca ctg gcg atg agg atg gcc aaa gta tgc tgg tgg ttt
ttc ttc 869Ser Pro Leu Ala Met Arg Met Ala Lys Val Cys Trp Trp Phe
Phe Phe 105 110 115
tcc aag gtc ata gaa ttg gct gac acg gtg ttc ttc atc ctg agg
aag 917Ser Lys Val Ile Glu Leu Ala Asp Thr Val Phe Phe Ile Leu Arg
Lys 120 125 130
135 aag aac agt cag ctg act ttc ctg cat gtc tat cac cat ggc acc
atg 965Lys Asn Ser Gln Leu Thr Phe Leu His Val Tyr His His Gly Thr
Met 140 145 150
atc ttc aac tgg tgg gca ggg gtc aag tat ctg gct gga ggc caa tcg
1013Ile Phe Asn Trp Trp Ala Gly Val Lys Tyr Leu Ala Gly Gly Gln Ser
155 160 165
ttc ttc atc ggc ctg ctc aat acc ttt gtg cac atc gtg atg tac tct
1061Phe Phe Ile Gly Leu Leu Asn Thr Phe Val His Ile Val Met Tyr Ser
170 175 180
tac tac gga ctg gct gcc ctg ggg cct cac acg cag aag tac tta tgg
1109Tyr Tyr Gly Leu Ala Ala Leu Gly Pro His Thr Gln Lys Tyr Leu Trp
185 190 195
tgg aag cgc tat ctg acc tca ctg cag ctg ctc cag ttt gtc ctg ttg
1157Trp Lys Arg Tyr Leu Thr Ser Leu Gln Leu Leu Gln Phe Val Leu Leu
200 205 210 215
acc act cac act ggc tac aac ctc ttc act gag tgt gac ttc ccg gac
1205Thr Thr His Thr Gly Tyr Asn Leu Phe Thr Glu Cys Asp Phe Pro Asp
220 225 230
tcc atg aac gct gtg gtg ttt gcc tac tgt gtc agt ctc att gct ctc
1253Ser Met Asn Ala Val Val Phe Ala Tyr Cys Val Ser Leu Ile Ala Leu
235 240 245
ttc agc aac ttc tac tat cag agc tac ctc aac agg aag agc aag aag
1301Phe Ser Asn Phe Tyr Tyr Gln Ser Tyr Leu Asn Arg Lys Ser Lys Lys
250 255 260
aca taaggatcca ctagtaacgg ccgccagtgt gctggaattc tgcagatatc
1354Thr catcacactg gcggccgctc gagcatgcat ctagagggcc gcatcatgta attagttatg
1414tcacgcttac attcacgccc tccccccaca tccgctctaa ccgaaaagga aggagttaga
1474caacctgaag tctaggtccc tatttatttt tttatagtta tgttagtatt aagaacgtta
1534tttatatttc aaatttttct tttttttctg tacagacgcg tgtacgcatg taacattata
1594ctgaaaacct tgcttgagaa ggttttggga cgctcgaagg ctttaatttg cggccctgca
1654ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgct cttccgcttc
1714ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc
1774aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc
1834aaaaggccag caaaagccca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag
1894gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc
1954gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt
2014tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct
2074ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg
2134ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct
2194tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat
2254tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg
2314ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa
2374aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt
2434ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc
2494tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt
2554atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta
2614aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat
2674ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg tgtagataac
2734tacgatacgg gagcgcttac catctggccc cagtgctgca atgataccgc gagacccacg
2794ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag
2854tggtcctgca actttatccg cctccattca gtctattaat tgttgccggg aagctagagt
2914aagtagttcg ccagttaata gtttgcgcaa cgttgttggc attgctacag gcatcgtggt
2974gtcactctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat caaggcgagt
3034tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt
3094cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc ataattctct
3154tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa ccaagtcatt
3214ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac gggataatag
3274tgtatcacat agcagaactt taaaagtgct catcattgga aaacgttctt cggggcgaaa
3334actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc gtgcacccaa
3394ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa caggaaggca
3454aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca tactcttcct
3514ttttcaatgg gtaataactg atataattaa attgaagctc taatttgtga gtttagtata
3574catgcattta cttataatac agttttttag ttttgctggc cgcatcttct caaatatgct
3634tcccagcctg cttttctgta acgttcaccc tctaccttag catcccttcc ctttgcaaat
3694agtcctcttc caacaataat aatgtcagat cctgtagaga ccacatcatc cacggttcta
3754tactgttgac ccaatgcgtc tcccttgtca tctaaaccca caccgggtgt cataatcaac
3814caatcgtaac cttcatctct tccacccatg tctctttgag caataaagcc gataacaaaa
3874tctttgtcgc tcttcgcaat gtcaacagta cccttagtat attctccagt agatagggag
3934cccttgcatg acaattctgc taacatcaaa aggcctctag gttcctttgt tacttcttct
3994gccgcctgct tcaaaccgct aacaatacct gggcccacca caccgtgtgc attcgtaatg
4054tctgcccatt ctgctattct gtatacaccc gcagagtact gcaatttgac tgtattacca
4114atgtcagcaa attttctgtc ttcgaagagt aaaaaattgt acttggcgga taatgccttt
4174agcggcttaa ctgtgccctc catggaaaaa tcagtcaaga tatccacatg tgtttttagt
4234aaacaaattt tgggacctaa tgcttcaact aactccagta attccttggt ggtacgaaca
4294tccaatgaag cacacaagtt tgtttgcttt tcgtgcatga tattaaatag cttggcagca
4354acaggactag gatgagtagc agcacgttcc ttatatgtag ctttcgacat gatttatctt
4414cgtttcctgc aggtttttgt tctgtgcagt tgggttaaga atactgggca atttcatgtt
4474tcttcaacac tacatatgcg tatatatacc aatctaagtc tgtgctcctt ccttcgttct
4534tccttctgtt cggagattac cgaatcaaaa aaatttcaaa gaaaccgaaa tcaaaaaaaa
4594gaataaaaaa aaaatgatga attgaattga aaagctagct tatcgatgat aagctgtcaa
4654agatgagaat taattccacg gactatagac tatactagat actccgtcta ctgtacgata
4714cacttccgct caggtccttg tcctttaacg aggccttacc actcttttgt tactctattg
4774atccagctca gcaaaggcag tgtgatctaa gattctatct tcgcgatgta gtaaaactag
4834ctagaccgag aaagagacta gaaatgcaaa aggcacttct acaatggctg ccatcattat
4894tatccgatgt gacgctgcag cttctcaatg atattcgaat acgctttgag gagatacagc
4954ctaatatccg acaaactgtt ttacagattt acgatcgtac ttgttaccca tcattgaatt
5014ttgaacatcc gaacctggga gttttccctg aaacagatag tatatttgaa cctgtataat
5074aatatatagt ctagcgcttt acggaagaca atgtatgtat ttcggttcct ggagaaacta
5134ttgcatctat tgcataggta atcttgcacg tcgcatcccc ggttcatttt ctgcgtttcc
5194atcttgcact tcaatagcat atctttgtta acgaagcatc tgtgcttcat tttgtagaac
5254aaaaatgcaa cgcgagagcg ctaatttttc aaacaaagaa tctgagctgc atttttacag
5314aacagaaatg caacgcgaaa gcgctatttt accaacgaag aatctgtgct tcatttttgt
5374aaaacaaaaa tgcaacgcga cgagagcgct aatttttcaa acaaagaatc tgagctgcat
5434ttttacagaa cagaaatgca acgcgagagc gctattttac caacaaagaa tctatacttc
5494ttttttgttc tacaaaaatg catcccgaga gcgctatttt tctaacaaag catcttagat
5554tacttttttt ctcctttgtg cgctctataa tgcagtctct tgataacttt ttgcactgta
5614ggtccgttaa ggttagaaga aggctacttt ggtgtctatt ttctcttcca taaaaaaagc
5674ctgactccac ttcccgcgtt tactgattac tagcgaagct gcgggtgcat tttttcaaga
5734taaaggcatc cccgattata ttctataccg atgtggattg cgcatacttt gtgaacagaa
5794agtgatagcg ttgatgattc ttcattggtc agaaaattat gaacggtttc ttctattttg
5854tctctatata ctacgtatag gaaatgttta cattttcgta ttgttttcga ttcactctat
5914gaatagttct tactacaatt tttttgtcta aagagtaata ctagagataa acataaaaaa
5974tgtagaggtc gagtttagat gcaagttcaa ggagcgaaag gtggatgggt aggttatata
6034gggatatagc acagagatat atagcaaaga gatacttttg agcaatgttt gtggaagcgg
6094tattcgcaat gggaagctcc accccggttg ataatcagaa aagccccaaa aacaggaaga
6154ttgtataagc aaatatttaa attgtaaacg ttaatatttt gttaaaattc gcgttaaatt
6214tttgttaaat cagctcattt tttaacgaat agcccgaaat cggcaaaatc ccttataaat
6274caaaagaata gaccgagata gggttgagtg ttgttccagt ttccaacaag agtccactat
6334taaagaacgt ggactccaac gtcaaagggc gaaaaagggt ctatcagggc gatggcccac
6394tacgtgaacc atcaccctaa tcaagttttt tggggtcgag gtgccgtaaa gcagtaaatc
6454ggaagggtaa acggatgccc ccatttagag cttgacgggg aaagccggcg aacgtggcga
6514gaaaggaagg gaagaaagcg aaaggagcgg gggctagggc ggtgggaagt gtaggggtca
6574cgctgggcgt aaccaccaca cccgccgcgc ttaatggggc gctacagggc gcgtggggat
6634gatccactag t
664558264PRTOncorhynchus mykiss 58Met Ala Ser Thr Trp Gln Ser Val Gln Ser
Met Arg Gln Trp Ile Leu 1 5 10
15 Glu Asn Gly Asp Lys Arg Thr Asp Pro Trp Leu Leu Val Tyr Ser
Pro 20 25 30 Met
Pro Val Ala Ile Ile Phe Leu Leu Tyr Leu Gly Val Val Trp Ala 35
40 45 Gly Pro Lys Leu Met Lys
Arg Arg Glu Pro Val Asp Leu Lys Ala Val 50 55
60 Leu Ile Val Tyr Asn Phe Ala Met Val Cys Leu
Ser Val Tyr Met Phe 65 70 75
80 His Glu Phe Leu Val Thr Ser Leu Leu Ser Asn Tyr Ser Tyr Leu Cys
85 90 95 Gln Pro
Val Asp Tyr Ser Thr Ser Pro Leu Ala Met Arg Met Ala Lys 100
105 110 Val Cys Trp Trp Phe Phe Phe
Ser Lys Val Ile Glu Leu Ala Asp Thr 115 120
125 Val Phe Phe Ile Leu Arg Lys Lys Asn Ser Gln Leu
Thr Phe Leu His 130 135 140
Val Tyr His His Gly Thr Met Ile Phe Asn Trp Trp Ala Gly Val Lys 145
150 155 160 Tyr Leu Ala
Gly Gly Gln Ser Phe Phe Ile Gly Leu Leu Asn Thr Phe 165
170 175 Val His Ile Val Met Tyr Ser Tyr
Tyr Gly Leu Ala Ala Leu Gly Pro 180 185
190 His Thr Gln Lys Tyr Leu Trp Trp Lys Arg Tyr Leu Thr
Ser Leu Gln 195 200 205
Leu Leu Gln Phe Val Leu Leu Thr Thr His Thr Gly Tyr Asn Leu Phe 210
215 220 Thr Glu Cys Asp
Phe Pro Asp Ser Met Asn Ala Val Val Phe Ala Tyr 225 230
235 240 Cys Val Ser Leu Ile Ala Leu Phe Ser
Asn Phe Tyr Tyr Gln Ser Tyr 245 250
255 Leu Asn Arg Lys Ser Lys Lys Thr 260
59 1077DNAThalassiosira
pseudonanaCDS(1)..(1077)delta5-elongase 59atg tgc tca tca ccg ccg tca caa
tcc aaa aca aca tcc ctc cta gca 48Met Cys Ser Ser Pro Pro Ser Gln
Ser Lys Thr Thr Ser Leu Leu Ala 1 5
10 15 cgg tac acc acc gcc gcc ctc ctc ctc
ctc acc ctc aca aca tgg tgc 96Arg Tyr Thr Thr Ala Ala Leu Leu Leu
Leu Thr Leu Thr Thr Trp Cys 20 25
30 cac ttc gcc ttc cca gcc gcc acc gcc aca
ccc ggc ctc acc gcc gaa 144His Phe Ala Phe Pro Ala Ala Thr Ala Thr
Pro Gly Leu Thr Ala Glu 35 40
45 atg cac tcc tac aaa gtc cca ctc ggt ctc acc
gta ttc tac ctg ctg 192Met His Ser Tyr Lys Val Pro Leu Gly Leu Thr
Val Phe Tyr Leu Leu 50 55
60 agt cta ccg tca cta aag tac gtt acg gac aac
tac ctt gcc aaa aag 240Ser Leu Pro Ser Leu Lys Tyr Val Thr Asp Asn
Tyr Leu Ala Lys Lys 65 70 75
80 tat gat atg aag tca ctc cta acg gaa tca atg gtg
ttg tac aat gtg 288Tyr Asp Met Lys Ser Leu Leu Thr Glu Ser Met Val
Leu Tyr Asn Val 85 90
95 gcg caa gtg ctg ctc aat ggg tgg acg gtg tat gcg att
gtg gat gcg 336Ala Gln Val Leu Leu Asn Gly Trp Thr Val Tyr Ala Ile
Val Asp Ala 100 105
110 gtg atg aat aga gac cat ccg ttt att gga agt aga agt
ttg gtt ggg 384Val Met Asn Arg Asp His Pro Phe Ile Gly Ser Arg Ser
Leu Val Gly 115 120 125
gcg gcg ttg cat agt ggg agc tcg tat gcg gtg tgg gtt cat
tat tgt 432Ala Ala Leu His Ser Gly Ser Ser Tyr Ala Val Trp Val His
Tyr Cys 130 135 140
gat aag tat ttg gag ttc ttt gat acg tat ttt atg gtg ttg agg
ggg 480Asp Lys Tyr Leu Glu Phe Phe Asp Thr Tyr Phe Met Val Leu Arg
Gly 145 150 155
160 aaa atg gac cag gtc tcc ttc ctc cac atc tac cac cac acg acc
ata 528Lys Met Asp Gln Val Ser Phe Leu His Ile Tyr His His Thr Thr
Ile 165 170 175
gcg tgg gca tgg tgg atc gcc ctc cgc ttc tcc ccc ggt gga gac att
576Ala Trp Ala Trp Trp Ile Ala Leu Arg Phe Ser Pro Gly Gly Asp Ile
180 185 190
tac ttc ggg gca ctc ctc aac tcc atc atc cac gtc ctc atg tat tcc
624Tyr Phe Gly Ala Leu Leu Asn Ser Ile Ile His Val Leu Met Tyr Ser
195 200 205
tac tac gcc ctt gcc cta ctc aag gtc agt tgt cca tgg aaa cga tac
672Tyr Tyr Ala Leu Ala Leu Leu Lys Val Ser Cys Pro Trp Lys Arg Tyr
210 215 220
ctg act caa gct caa tta ttg caa ttc aca agt gtg gtg gtt tat acg
720Leu Thr Gln Ala Gln Leu Leu Gln Phe Thr Ser Val Val Val Tyr Thr
225 230 235 240
ggg tgt acg ggt tat act cat tac tat cat acg aag cat gga gcg gat
768Gly Cys Thr Gly Tyr Thr His Tyr Tyr His Thr Lys His Gly Ala Asp
245 250 255
gag aca cag cct agt tta gga acg tat tat ttc tgt tgt gga gtg cag
816Glu Thr Gln Pro Ser Leu Gly Thr Tyr Tyr Phe Cys Cys Gly Val Gln
260 265 270
gtg ttt gag atg gtt agt ttg ttt gta ctc ttt tcc atc ttt tat aaa
864Val Phe Glu Met Val Ser Leu Phe Val Leu Phe Ser Ile Phe Tyr Lys
275 280 285
cga tcc tat tcg aag aag aac aag tca gga gga aag gat agc aag aag
912Arg Ser Tyr Ser Lys Lys Asn Lys Ser Gly Gly Lys Asp Ser Lys Lys
290 295 300
aat gat gat ggg aat aat gag gat caa tgt cac aag gct atg aag gat
960Asn Asp Asp Gly Asn Asn Glu Asp Gln Cys His Lys Ala Met Lys Asp
305 310 315 320
ata tcg gag ggt gcg aag gag gtt gtg ggg cat gca gcg aag gat gct
1008Ile Ser Glu Gly Ala Lys Glu Val Val Gly His Ala Ala Lys Asp Ala
325 330 335
gga aag ttg gtg gct acg gcg agt aag gct gta aag agg aag gga act
1056Gly Lys Leu Val Ala Thr Ala Ser Lys Ala Val Lys Arg Lys Gly Thr
340 345 350
cgt gtt act ggt gcc atg tag
1077Arg Val Thr Gly Ala Met
355
60358PRTThalassiosira pseudonana 60Met Cys Ser Ser Pro Pro Ser Gln Ser
Lys Thr Thr Ser Leu Leu Ala 1 5 10
15 Arg Tyr Thr Thr Ala Ala Leu Leu Leu Leu Thr Leu Thr Thr
Trp Cys 20 25 30
His Phe Ala Phe Pro Ala Ala Thr Ala Thr Pro Gly Leu Thr Ala Glu
35 40 45 Met His Ser Tyr
Lys Val Pro Leu Gly Leu Thr Val Phe Tyr Leu Leu 50
55 60 Ser Leu Pro Ser Leu Lys Tyr Val
Thr Asp Asn Tyr Leu Ala Lys Lys 65 70
75 80 Tyr Asp Met Lys Ser Leu Leu Thr Glu Ser Met Val
Leu Tyr Asn Val 85 90
95 Ala Gln Val Leu Leu Asn Gly Trp Thr Val Tyr Ala Ile Val Asp Ala
100 105 110 Val Met Asn
Arg Asp His Pro Phe Ile Gly Ser Arg Ser Leu Val Gly 115
120 125 Ala Ala Leu His Ser Gly Ser Ser
Tyr Ala Val Trp Val His Tyr Cys 130 135
140 Asp Lys Tyr Leu Glu Phe Phe Asp Thr Tyr Phe Met Val
Leu Arg Gly 145 150 155
160 Lys Met Asp Gln Val Ser Phe Leu His Ile Tyr His His Thr Thr Ile
165 170 175 Ala Trp Ala Trp
Trp Ile Ala Leu Arg Phe Ser Pro Gly Gly Asp Ile 180
185 190 Tyr Phe Gly Ala Leu Leu Asn Ser Ile
Ile His Val Leu Met Tyr Ser 195 200
205 Tyr Tyr Ala Leu Ala Leu Leu Lys Val Ser Cys Pro Trp Lys
Arg Tyr 210 215 220
Leu Thr Gln Ala Gln Leu Leu Gln Phe Thr Ser Val Val Val Tyr Thr 225
230 235 240 Gly Cys Thr Gly Tyr
Thr His Tyr Tyr His Thr Lys His Gly Ala Asp 245
250 255 Glu Thr Gln Pro Ser Leu Gly Thr Tyr Tyr
Phe Cys Cys Gly Val Gln 260 265
270 Val Phe Glu Met Val Ser Leu Phe Val Leu Phe Ser Ile Phe Tyr
Lys 275 280 285 Arg
Ser Tyr Ser Lys Lys Asn Lys Ser Gly Gly Lys Asp Ser Lys Lys 290
295 300 Asn Asp Asp Gly Asn Asn
Glu Asp Gln Cys His Lys Ala Met Lys Asp 305 310
315 320 Ile Ser Glu Gly Ala Lys Glu Val Val Gly His
Ala Ala Lys Asp Ala 325 330
335 Gly Lys Leu Val Ala Thr Ala Ser Lys Ala Val Lys Arg Lys Gly Thr
340 345 350 Arg Val
Thr Gly Ala Met 355 61933DNAThalassiosira
pseudonanaCDS(1)..(933)delta5-elongase 61atg cac tcc tac aaa gtc cca ctc
ggt ctc acc gta ttc tac ctg ctg 48Met His Ser Tyr Lys Val Pro Leu
Gly Leu Thr Val Phe Tyr Leu Leu 1 5
10 15 agt cta ccg tca cta aag tac gtt acg
gac aac tac ctt gcc aaa aag 96Ser Leu Pro Ser Leu Lys Tyr Val Thr
Asp Asn Tyr Leu Ala Lys Lys 20 25
30 tat gat atg aag tca ctc cta acg gaa tca
atg gtg ttg tac aat gtg 144Tyr Asp Met Lys Ser Leu Leu Thr Glu Ser
Met Val Leu Tyr Asn Val 35 40
45 gcg caa gtg ctg ctc aat ggg tgg acg gtg tat
gcg att gtg gat gcg 192Ala Gln Val Leu Leu Asn Gly Trp Thr Val Tyr
Ala Ile Val Asp Ala 50 55
60 gtg atg aat aga gac cat ccg ttt att gga agt
aga agt ttg gtt ggg 240Val Met Asn Arg Asp His Pro Phe Ile Gly Ser
Arg Ser Leu Val Gly 65 70 75
80 gcg gcg ttg cat agt ggg agc tcg tat gcg gtg tgg
gtt cat tat tgt 288Ala Ala Leu His Ser Gly Ser Ser Tyr Ala Val Trp
Val His Tyr Cys 85 90
95 gat aag tat ttg gag ttc ttt gat acg tat ttt atg gtg
ttg agg ggg 336Asp Lys Tyr Leu Glu Phe Phe Asp Thr Tyr Phe Met Val
Leu Arg Gly 100 105
110 aaa atg gac cag gtc tcc ttc ctc cac atc tac cac cac
acg acc ata 384Lys Met Asp Gln Val Ser Phe Leu His Ile Tyr His His
Thr Thr Ile 115 120 125
gcg tgg gca tgg tgg atc gcc ctc cgc ttc tcc ccc ggt gga
gac att 432Ala Trp Ala Trp Trp Ile Ala Leu Arg Phe Ser Pro Gly Gly
Asp Ile 130 135 140
tac ttc ggg gca ctc ctc aac tcc atc atc cac gtc ctc atg tat
tcc 480Tyr Phe Gly Ala Leu Leu Asn Ser Ile Ile His Val Leu Met Tyr
Ser 145 150 155
160 tac tac gcc ctt gcc cta ctc aag gtc agt tgt cca tgg aaa cga
tac 528Tyr Tyr Ala Leu Ala Leu Leu Lys Val Ser Cys Pro Trp Lys Arg
Tyr 165 170 175
ctg act caa gct caa tta ttg caa ttc aca agt gtg gtg gtt tat acg
576Leu Thr Gln Ala Gln Leu Leu Gln Phe Thr Ser Val Val Val Tyr Thr
180 185 190
ggg tgt acg ggt tat act cat tac tat cat acg aag cat gga gcg gat
624Gly Cys Thr Gly Tyr Thr His Tyr Tyr His Thr Lys His Gly Ala Asp
195 200 205
gag aca cag cct agt tta gga acg tat tat ttc tgt tgt gga gtg cag
672Glu Thr Gln Pro Ser Leu Gly Thr Tyr Tyr Phe Cys Cys Gly Val Gln
210 215 220
gtg ttt gag atg gtt agt ttg ttt gta ctc ttt tcc atc ttt tat aaa
720Val Phe Glu Met Val Ser Leu Phe Val Leu Phe Ser Ile Phe Tyr Lys
225 230 235 240
cga tcc tat tcg aag aag aac aag tca gga gga aag gat agc aag aag
768Arg Ser Tyr Ser Lys Lys Asn Lys Ser Gly Gly Lys Asp Ser Lys Lys
245 250 255
aat gat gat ggg aat aat gag gat caa tgt cac aag gct atg aag gat
816Asn Asp Asp Gly Asn Asn Glu Asp Gln Cys His Lys Ala Met Lys Asp
260 265 270
ata tcg gag ggt gcg aag gag gtt gtg ggg cat gca gcg aag gat gct
864Ile Ser Glu Gly Ala Lys Glu Val Val Gly His Ala Ala Lys Asp Ala
275 280 285
gga aag ttg gtg gct acg gcg agt aag gct gta aag agg aag gga act
912Gly Lys Leu Val Ala Thr Ala Ser Lys Ala Val Lys Arg Lys Gly Thr
290 295 300
cgt gtt act ggt gcc atg tag
933Arg Val Thr Gly Ala Met
305 310
62310PRTThalassiosira pseudonana 62Met His Ser Tyr Lys Val Pro Leu Gly
Leu Thr Val Phe Tyr Leu Leu 1 5 10
15 Ser Leu Pro Ser Leu Lys Tyr Val Thr Asp Asn Tyr Leu Ala
Lys Lys 20 25 30
Tyr Asp Met Lys Ser Leu Leu Thr Glu Ser Met Val Leu Tyr Asn Val
35 40 45 Ala Gln Val Leu
Leu Asn Gly Trp Thr Val Tyr Ala Ile Val Asp Ala 50
55 60 Val Met Asn Arg Asp His Pro Phe
Ile Gly Ser Arg Ser Leu Val Gly 65 70
75 80 Ala Ala Leu His Ser Gly Ser Ser Tyr Ala Val Trp
Val His Tyr Cys 85 90
95 Asp Lys Tyr Leu Glu Phe Phe Asp Thr Tyr Phe Met Val Leu Arg Gly
100 105 110 Lys Met Asp
Gln Val Ser Phe Leu His Ile Tyr His His Thr Thr Ile 115
120 125 Ala Trp Ala Trp Trp Ile Ala Leu
Arg Phe Ser Pro Gly Gly Asp Ile 130 135
140 Tyr Phe Gly Ala Leu Leu Asn Ser Ile Ile His Val Leu
Met Tyr Ser 145 150 155
160 Tyr Tyr Ala Leu Ala Leu Leu Lys Val Ser Cys Pro Trp Lys Arg Tyr
165 170 175 Leu Thr Gln Ala
Gln Leu Leu Gln Phe Thr Ser Val Val Val Tyr Thr 180
185 190 Gly Cys Thr Gly Tyr Thr His Tyr Tyr
His Thr Lys His Gly Ala Asp 195 200
205 Glu Thr Gln Pro Ser Leu Gly Thr Tyr Tyr Phe Cys Cys Gly
Val Gln 210 215 220
Val Phe Glu Met Val Ser Leu Phe Val Leu Phe Ser Ile Phe Tyr Lys 225
230 235 240 Arg Ser Tyr Ser Lys
Lys Asn Lys Ser Gly Gly Lys Asp Ser Lys Lys 245
250 255 Asn Asp Asp Gly Asn Asn Glu Asp Gln Cys
His Lys Ala Met Lys Asp 260 265
270 Ile Ser Glu Gly Ala Lys Glu Val Val Gly His Ala Ala Lys Asp
Ala 275 280 285 Gly
Lys Leu Val Ala Thr Ala Ser Lys Ala Val Lys Arg Lys Gly Thr 290
295 300 Arg Val Thr Gly Ala Met
305 310 63933DNAThalassiosira
pseudonanaCDS(1)..(933)delta5-elongase 63atg cac tcc tac aaa gtc cca ctc
ggt ctc acc gta ttc tac ctg ctg 48Met His Ser Tyr Lys Val Pro Leu
Gly Leu Thr Val Phe Tyr Leu Leu 1 5
10 15 agt cta ccg tca cta aag tac gtt acg
gac aac tac ctt gcc aaa aag 96Ser Leu Pro Ser Leu Lys Tyr Val Thr
Asp Asn Tyr Leu Ala Lys Lys 20 25
30 tat gat atg aag tca ctc cta acg gaa tca
atg gtg ttg tac aat gtg 144Tyr Asp Met Lys Ser Leu Leu Thr Glu Ser
Met Val Leu Tyr Asn Val 35 40
45 gcg caa gtg ctg ctc aat ggg tgg acg gtg tat
gcg att gtg gat gcg 192Ala Gln Val Leu Leu Asn Gly Trp Thr Val Tyr
Ala Ile Val Asp Ala 50 55
60 gtg atg aat aga gac cat ccg ttt att gga agt
aga agt ttg gtt ggg 240Val Met Asn Arg Asp His Pro Phe Ile Gly Ser
Arg Ser Leu Val Gly 65 70 75
80 gcg gcg ttg cat agt ggg agc tcg tat gcg gtg tgg
gtt cat tat tgt 288Ala Ala Leu His Ser Gly Ser Ser Tyr Ala Val Trp
Val His Tyr Cys 85 90
95 gat aag tat ttg gag ttc ttt gat acg tat ttt atg gtg
ttg agg ggg 336Asp Lys Tyr Leu Glu Phe Phe Asp Thr Tyr Phe Met Val
Leu Arg Gly 100 105
110 aaa atg gac cag gtc tcc ttc ctc cac atc tac cac cac
acg acc ata 384Lys Met Asp Gln Val Ser Phe Leu His Ile Tyr His His
Thr Thr Ile 115 120 125
gcg tgg gca tgg tgg atc gcc ctc cgc ttc tcc ccc ggt gga
gac att 432Ala Trp Ala Trp Trp Ile Ala Leu Arg Phe Ser Pro Gly Gly
Asp Ile 130 135 140
tac ttc ggg gca ctc ctc aac tcc atc atc cac gtc ctc atg tat
tcc 480Tyr Phe Gly Ala Leu Leu Asn Ser Ile Ile His Val Leu Met Tyr
Ser 145 150 155
160 tac tac gcc ctt gcc cta ctc aag gtc agt tgt cca tgg aaa cga
tac 528Tyr Tyr Ala Leu Ala Leu Leu Lys Val Ser Cys Pro Trp Lys Arg
Tyr 165 170 175
ctg act caa gct caa tta ttg caa ttc aca agt gtg gtg gtt tat acg
576Leu Thr Gln Ala Gln Leu Leu Gln Phe Thr Ser Val Val Val Tyr Thr
180 185 190
ggg tgt acg ggt tat act cat tac tat cat acg aag cat gga gcg gat
624Gly Cys Thr Gly Tyr Thr His Tyr Tyr His Thr Lys His Gly Ala Asp
195 200 205
gag aca cag cct agt tta gga acg tat tat ttc tgt tgt gga gtg cag
672Glu Thr Gln Pro Ser Leu Gly Thr Tyr Tyr Phe Cys Cys Gly Val Gln
210 215 220
gtg ttt gag atg gtt agt ttg ttt gta ctc ttt tcc atc ttt tat aaa
720Val Phe Glu Met Val Ser Leu Phe Val Leu Phe Ser Ile Phe Tyr Lys
225 230 235 240
cga tcc tat tcg aag aag aac aag tca gga gga aag gat agc aag aag
768Arg Ser Tyr Ser Lys Lys Asn Lys Ser Gly Gly Lys Asp Ser Lys Lys
245 250 255
aat gat gat ggg aat aat gag gat caa tgt cac aag gct atg aag gat
816Asn Asp Asp Gly Asn Asn Glu Asp Gln Cys His Lys Ala Met Lys Asp
260 265 270
ata tcg gag ggt gcg aag gag gtt gtg ggg cat gca gcg aag gat gct
864Ile Ser Glu Gly Ala Lys Glu Val Val Gly His Ala Ala Lys Asp Ala
275 280 285
gga aag ttg gtg gct acg gcg agt aag gct gta aag agg aag gga act
912Gly Lys Leu Val Ala Thr Ala Ser Lys Ala Val Lys Arg Lys Gly Thr
290 295 300
cgt gtt act ggt gcc atg tag
933Arg Val Thr Gly Ala Met
305 310
64310PRTThalassiosira pseudonana 64Met His Ser Tyr Lys Val Pro Leu Gly
Leu Thr Val Phe Tyr Leu Leu 1 5 10
15 Ser Leu Pro Ser Leu Lys Tyr Val Thr Asp Asn Tyr Leu Ala
Lys Lys 20 25 30
Tyr Asp Met Lys Ser Leu Leu Thr Glu Ser Met Val Leu Tyr Asn Val
35 40 45 Ala Gln Val Leu
Leu Asn Gly Trp Thr Val Tyr Ala Ile Val Asp Ala 50
55 60 Val Met Asn Arg Asp His Pro Phe
Ile Gly Ser Arg Ser Leu Val Gly 65 70
75 80 Ala Ala Leu His Ser Gly Ser Ser Tyr Ala Val Trp
Val His Tyr Cys 85 90
95 Asp Lys Tyr Leu Glu Phe Phe Asp Thr Tyr Phe Met Val Leu Arg Gly
100 105 110 Lys Met Asp
Gln Val Ser Phe Leu His Ile Tyr His His Thr Thr Ile 115
120 125 Ala Trp Ala Trp Trp Ile Ala Leu
Arg Phe Ser Pro Gly Gly Asp Ile 130 135
140 Tyr Phe Gly Ala Leu Leu Asn Ser Ile Ile His Val Leu
Met Tyr Ser 145 150 155
160 Tyr Tyr Ala Leu Ala Leu Leu Lys Val Ser Cys Pro Trp Lys Arg Tyr
165 170 175 Leu Thr Gln Ala
Gln Leu Leu Gln Phe Thr Ser Val Val Val Tyr Thr 180
185 190 Gly Cys Thr Gly Tyr Thr His Tyr Tyr
His Thr Lys His Gly Ala Asp 195 200
205 Glu Thr Gln Pro Ser Leu Gly Thr Tyr Tyr Phe Cys Cys Gly
Val Gln 210 215 220
Val Phe Glu Met Val Ser Leu Phe Val Leu Phe Ser Ile Phe Tyr Lys 225
230 235 240 Arg Ser Tyr Ser Lys
Lys Asn Lys Ser Gly Gly Lys Asp Ser Lys Lys 245
250 255 Asn Asp Asp Gly Asn Asn Glu Asp Gln Cys
His Lys Ala Met Lys Asp 260 265
270 Ile Ser Glu Gly Ala Lys Glu Val Val Gly His Ala Ala Lys Asp
Ala 275 280 285 Gly
Lys Leu Val Ala Thr Ala Ser Lys Ala Val Lys Arg Lys Gly Thr 290
295 300 Arg Val Thr Gly Ala Met
305 310 65825DNAThraustochytrium
aureumCDS(1)..(825)delta5-elongase 65atg acg agc aac atg agc gcg tgg ggc
gtc gcc gtc gac cag acg cag 48Met Thr Ser Asn Met Ser Ala Trp Gly
Val Ala Val Asp Gln Thr Gln 1 5
10 15 cag gtc gtc gac cag atc atg ggc ggc
gcc gag ccg tac aag ctg aca 96Gln Val Val Asp Gln Ile Met Gly Gly
Ala Glu Pro Tyr Lys Leu Thr 20 25
30 gaa ggg cgc atg acg aac gtc gag acg atg
ctg gcg atc gag tgc ggc 144Glu Gly Arg Met Thr Asn Val Glu Thr Met
Leu Ala Ile Glu Cys Gly 35 40
45 tac gcc gcc atg ctg ctg ttc ctg acc ccg atc
atg aag cag gcc gag 192Tyr Ala Ala Met Leu Leu Phe Leu Thr Pro Ile
Met Lys Gln Ala Glu 50 55
60 aag ccc ttc gag ctc aag tcc ttc aag ctc gcc
cac aac ctg ttc ctg 240Lys Pro Phe Glu Leu Lys Ser Phe Lys Leu Ala
His Asn Leu Phe Leu 65 70 75
80 ttc gtc ctg tcc gcc tac atg tgc ctc gag acc gtc
cgc cag gcc tac 288Phe Val Leu Ser Ala Tyr Met Cys Leu Glu Thr Val
Arg Gln Ala Tyr 85 90
95 ctt gcg ggc tac tcg gtg ttc ggc aac gac atg gag aag
ggc agc gag 336Leu Ala Gly Tyr Ser Val Phe Gly Asn Asp Met Glu Lys
Gly Ser Glu 100 105
110 ccg cac gcg cac ggc atg gcc caa atc gtg tgg atc ttt
tac gtg tcc 384Pro His Ala His Gly Met Ala Gln Ile Val Trp Ile Phe
Tyr Val Ser 115 120 125
aag gcg tac gag ttc gtg gac acg ctg atc atg atc ctg tgc
aaa aag 432Lys Ala Tyr Glu Phe Val Asp Thr Leu Ile Met Ile Leu Cys
Lys Lys 130 135 140
ttc aac cag gtc tcc gtc ctg cac gtg tac cac cac gcc acc atc
ttt 480Phe Asn Gln Val Ser Val Leu His Val Tyr His His Ala Thr Ile
Phe 145 150 155
160 gct atc tgg ttt atg atc gcc aag tac gcc ccg ggc ggc gac gca
tac 528Ala Ile Trp Phe Met Ile Ala Lys Tyr Ala Pro Gly Gly Asp Ala
Tyr 165 170 175
ttt agc gtc atc ctg aac tcg ttc gtg cac acc gtc atg tac gcg tac
576Phe Ser Val Ile Leu Asn Ser Phe Val His Thr Val Met Tyr Ala Tyr
180 185 190
tac ttc ttc tcg tcg cag ggc ttc ggg ttc gtc aag ccg atc aag ccg
624Tyr Phe Phe Ser Ser Gln Gly Phe Gly Phe Val Lys Pro Ile Lys Pro
195 200 205
tac atc acc tcg ctg cag atg acg cag ttc atg gcg atg ctc gtg cag
672Tyr Ile Thr Ser Leu Gln Met Thr Gln Phe Met Ala Met Leu Val Gln
210 215 220
tcg ctg tac gac tac ctt tac ccg tgc gac tac ccg cag ggg ctc gtc
720Ser Leu Tyr Asp Tyr Leu Tyr Pro Cys Asp Tyr Pro Gln Gly Leu Val
225 230 235 240
aag ctc ctc ggc gtg tac atg ctc acc ctg ctt gcg ctc ttc ggc aac
768Lys Leu Leu Gly Val Tyr Met Leu Thr Leu Leu Ala Leu Phe Gly Asn
245 250 255
ttt ttc gtg cag agc tac ctc aag aag tcg aac aag ccc aag gcc aag
816Phe Phe Val Gln Ser Tyr Leu Lys Lys Ser Asn Lys Pro Lys Ala Lys
260 265 270
tcg gcc taa
825Ser Ala
66274PRT Thraustochytrium aureum 66Met Thr Ser Asn Met Ser Ala
Trp Gly Val Ala Val Asp Gln Thr Gln 1 5
10 15 Gln Val Val Asp Gln Ile Met Gly Gly Ala Glu
Pro Tyr Lys Leu Thr 20 25
30 Glu Gly Arg Met Thr Asn Val Glu Thr Met Leu Ala Ile Glu Cys
Gly 35 40 45 Tyr
Ala Ala Met Leu Leu Phe Leu Thr Pro Ile Met Lys Gln Ala Glu 50
55 60 Lys Pro Phe Glu Leu Lys
Ser Phe Lys Leu Ala His Asn Leu Phe Leu 65 70
75 80 Phe Val Leu Ser Ala Tyr Met Cys Leu Glu Thr
Val Arg Gln Ala Tyr 85 90
95 Leu Ala Gly Tyr Ser Val Phe Gly Asn Asp Met Glu Lys Gly Ser Glu
100 105 110 Pro His
Ala His Gly Met Ala Gln Ile Val Trp Ile Phe Tyr Val Ser 115
120 125 Lys Ala Tyr Glu Phe Val Asp
Thr Leu Ile Met Ile Leu Cys Lys Lys 130 135
140 Phe Asn Gln Val Ser Val Leu His Val Tyr His His
Ala Thr Ile Phe 145 150 155
160 Ala Ile Trp Phe Met Ile Ala Lys Tyr Ala Pro Gly Gly Asp Ala Tyr
165 170 175 Phe Ser Val
Ile Leu Asn Ser Phe Val His Thr Val Met Tyr Ala Tyr 180
185 190 Tyr Phe Phe Ser Ser Gln Gly Phe
Gly Phe Val Lys Pro Ile Lys Pro 195 200
205 Tyr Ile Thr Ser Leu Gln Met Thr Gln Phe Met Ala Met
Leu Val Gln 210 215 220
Ser Leu Tyr Asp Tyr Leu Tyr Pro Cys Asp Tyr Pro Gln Gly Leu Val 225
230 235 240 Lys Leu Leu Gly
Val Tyr Met Leu Thr Leu Leu Ala Leu Phe Gly Asn 245
250 255 Phe Phe Val Gln Ser Tyr Leu Lys Lys
Ser Asn Lys Pro Lys Ala Lys 260 265
270 Ser Ala 67903DNAOstreococcus
tauriCDS(1)..(903)delta5-elongase 67atg agc gcc tcc ggt gcg ctg ctg ccc
gcg atc gcg ttc gcc gcg tac 48Met Ser Ala Ser Gly Ala Leu Leu Pro
Ala Ile Ala Phe Ala Ala Tyr 1 5
10 15 gcg tac gcg acg tac gcc tac gcc ttt
gag tgg tcg cac gcg aat ggc 96Ala Tyr Ala Thr Tyr Ala Tyr Ala Phe
Glu Trp Ser His Ala Asn Gly 20 25
30 atc gac aac gtc gac gcg cgc gag tgg atc
ggt gcg ctg tcg ttg agg 144Ile Asp Asn Val Asp Ala Arg Glu Trp Ile
Gly Ala Leu Ser Leu Arg 35 40
45 ctc ccg gcg atc gcg acg acg atg tac ctg ttg
ttc tgc ctg gtc gga 192Leu Pro Ala Ile Ala Thr Thr Met Tyr Leu Leu
Phe Cys Leu Val Gly 50 55
60 ccg agg ttg atg gcg aag cgc gag gcg ttc gac
ccg aag ggg ttc atg 240Pro Arg Leu Met Ala Lys Arg Glu Ala Phe Asp
Pro Lys Gly Phe Met 65 70 75
80 ctg gcg tac aat gcg tat cag acg gcg ttc aac gtc
gtc gtg ctc ggg 288Leu Ala Tyr Asn Ala Tyr Gln Thr Ala Phe Asn Val
Val Val Leu Gly 85 90
95 atg ttc gcg cga gag atc tcg ggg ctg ggg cag ccc gtg
tgg ggg tca 336Met Phe Ala Arg Glu Ile Ser Gly Leu Gly Gln Pro Val
Trp Gly Ser 100 105
110 acc atg ccg tgg agc gat aga aaa tcg ttt aag atc ctc
ctc ggg gtg 384Thr Met Pro Trp Ser Asp Arg Lys Ser Phe Lys Ile Leu
Leu Gly Val 115 120 125
tgg ttg cac tac aac aac caa tat ttg gag cta ttg gac act
gtg ttc 432Trp Leu His Tyr Asn Asn Gln Tyr Leu Glu Leu Leu Asp Thr
Val Phe 130 135 140
atg gtt gcg cgc aag aag acg aag cag ttg agc ttc ttg cac gtt
tat 480Met Val Ala Arg Lys Lys Thr Lys Gln Leu Ser Phe Leu His Val
Tyr 145 150 155
160 cat cac gcc ctg ttg atc tgg gcg tgg tgg ttg gtg tgt cac ttg
atg 528His His Ala Leu Leu Ile Trp Ala Trp Trp Leu Val Cys His Leu
Met 165 170 175
gcc acg aac gat tgt atc gat gcc tac ttc ggc gcg gcg tgc aac tcg
576Ala Thr Asn Asp Cys Ile Asp Ala Tyr Phe Gly Ala Ala Cys Asn Ser
180 185 190
ttc att cac atc gtg atg tac tcg tat tat ctc atg tcg gcg ctc ggc
624Phe Ile His Ile Val Met Tyr Ser Tyr Tyr Leu Met Ser Ala Leu Gly
195 200 205
att cga tgc ccg tgg aag cga tac atc acc cag gct caa atg ctc caa
672Ile Arg Cys Pro Trp Lys Arg Tyr Ile Thr Gln Ala Gln Met Leu Gln
210 215 220
ttc gtc att gtc ttc gcg cac gcc gtg ttc gtg ctg cgt cag aag cac
720Phe Val Ile Val Phe Ala His Ala Val Phe Val Leu Arg Gln Lys His
225 230 235 240
tgc ccg gtc acc ctt cct tgg gcg caa atg ttc gtc atg acg aac atg
768Cys Pro Val Thr Leu Pro Trp Ala Gln Met Phe Val Met Thr Asn Met
245 250 255
ctc gtg ctc ttc ggg aac ttc tac ctc aag gcg tac tcg aac aag tcg
816Leu Val Leu Phe Gly Asn Phe Tyr Leu Lys Ala Tyr Ser Asn Lys Ser
260 265 270
cgc ggc gac ggc gcg agt tcc gtg aaa cca gcc gag acc acg cgc gcg
864Arg Gly Asp Gly Ala Ser Ser Val Lys Pro Ala Glu Thr Thr Arg Ala
275 280 285
ccc agc gtg cga cgc acg cga tct cga aaa att gac taa
903Pro Ser Val Arg Arg Thr Arg Ser Arg Lys Ile Asp
290 295 300
68300PRTOstreococcus tauri 68Met Ser Ala Ser Gly Ala Leu Leu Pro Ala Ile
Ala Phe Ala Ala Tyr 1 5 10
15 Ala Tyr Ala Thr Tyr Ala Tyr Ala Phe Glu Trp Ser His Ala Asn Gly
20 25 30 Ile Asp
Asn Val Asp Ala Arg Glu Trp Ile Gly Ala Leu Ser Leu Arg 35
40 45 Leu Pro Ala Ile Ala Thr Thr
Met Tyr Leu Leu Phe Cys Leu Val Gly 50 55
60 Pro Arg Leu Met Ala Lys Arg Glu Ala Phe Asp Pro
Lys Gly Phe Met 65 70 75
80 Leu Ala Tyr Asn Ala Tyr Gln Thr Ala Phe Asn Val Val Val Leu Gly
85 90 95 Met Phe Ala
Arg Glu Ile Ser Gly Leu Gly Gln Pro Val Trp Gly Ser 100
105 110 Thr Met Pro Trp Ser Asp Arg Lys
Ser Phe Lys Ile Leu Leu Gly Val 115 120
125 Trp Leu His Tyr Asn Asn Gln Tyr Leu Glu Leu Leu Asp
Thr Val Phe 130 135 140
Met Val Ala Arg Lys Lys Thr Lys Gln Leu Ser Phe Leu His Val Tyr 145
150 155 160 His His Ala Leu
Leu Ile Trp Ala Trp Trp Leu Val Cys His Leu Met 165
170 175 Ala Thr Asn Asp Cys Ile Asp Ala Tyr
Phe Gly Ala Ala Cys Asn Ser 180 185
190 Phe Ile His Ile Val Met Tyr Ser Tyr Tyr Leu Met Ser Ala
Leu Gly 195 200 205
Ile Arg Cys Pro Trp Lys Arg Tyr Ile Thr Gln Ala Gln Met Leu Gln 210
215 220 Phe Val Ile Val Phe
Ala His Ala Val Phe Val Leu Arg Gln Lys His 225 230
235 240 Cys Pro Val Thr Leu Pro Trp Ala Gln Met
Phe Val Met Thr Asn Met 245 250
255 Leu Val Leu Phe Gly Asn Phe Tyr Leu Lys Ala Tyr Ser Asn Lys
Ser 260 265 270 Arg
Gly Asp Gly Ala Ser Ser Val Lys Pro Ala Glu Thr Thr Arg Ala 275
280 285 Pro Ser Val Arg Arg Thr
Arg Ser Arg Lys Ile Asp 290 295 300
69879DNAOstreococcus tauriCDS(1)..(879)delta6-elongase 69atg agt ggc tta
cgt gca ccc aac ttt tta cac aga ttc tgg aca aag 48Met Ser Gly Leu
Arg Ala Pro Asn Phe Leu His Arg Phe Trp Thr Lys 1 5
10 15 tgg gac tac gcg att
tcc aaa gtc gtc ttc acg tgt gcc gac agt ttt 96Trp Asp Tyr Ala Ile
Ser Lys Val Val Phe Thr Cys Ala Asp Ser Phe 20
25 30 cag tgg gac atc ggg cca
gtg agt tcg agt acg gcg cat tta ccc gcc 144Gln Trp Asp Ile Gly Pro
Val Ser Ser Ser Thr Ala His Leu Pro Ala 35
40 45 att gaa tcc cct acc cca ctg
gtg act agc ctc ttg ttc tac tta gtc 192Ile Glu Ser Pro Thr Pro Leu
Val Thr Ser Leu Leu Phe Tyr Leu Val 50 55
60 aca gtt ttc ttg tgg tat ggt cgt
tta acc agg agt tca gac aag aaa 240Thr Val Phe Leu Trp Tyr Gly Arg
Leu Thr Arg Ser Ser Asp Lys Lys 65 70
75 80 att aga gag cct acg tgg tta aga aga
ttc ata ata tgt cat aat gcg 288Ile Arg Glu Pro Thr Trp Leu Arg Arg
Phe Ile Ile Cys His Asn Ala 85
90 95 ttc ttg ata gtc ctc agt ctt tac atg
tgc ctt ggt tgt gtg gcc caa 336Phe Leu Ile Val Leu Ser Leu Tyr Met
Cys Leu Gly Cys Val Ala Gln 100 105
110 gcg tat cag aat gga tat act tta tgg ggt
aat gaa ttc aag gcc acg 384Ala Tyr Gln Asn Gly Tyr Thr Leu Trp Gly
Asn Glu Phe Lys Ala Thr 115 120
125 gaa act cag ctt gct ctc tac att tac att ttt
tac gta agt aaa ata 432Glu Thr Gln Leu Ala Leu Tyr Ile Tyr Ile Phe
Tyr Val Ser Lys Ile 130 135
140 tac gag ttt gta gat act tac att atg ctt ctc
aag aat aac ttg cgg 480Tyr Glu Phe Val Asp Thr Tyr Ile Met Leu Leu
Lys Asn Asn Leu Arg 145 150 155
160 caa gta agt ttc cta cac att tat cac cac agc acg
att tcc ttt att 528Gln Val Ser Phe Leu His Ile Tyr His His Ser Thr
Ile Ser Phe Ile 165 170
175 tgg tgg atc att gct cgg agg gct ccg ggt ggt gat gct
tac ttc agc 576Trp Trp Ile Ile Ala Arg Arg Ala Pro Gly Gly Asp Ala
Tyr Phe Ser 180 185
190 gcg gcc ttg aac tca tgg gta cac gtg tgc atg tac acc
tat tat cta 624Ala Ala Leu Asn Ser Trp Val His Val Cys Met Tyr Thr
Tyr Tyr Leu 195 200 205
tta tca acc ctt att gga aaa gaa gat cct aag cgt tcc aac
tac ctt 672Leu Ser Thr Leu Ile Gly Lys Glu Asp Pro Lys Arg Ser Asn
Tyr Leu 210 215 220
tgg tgg ggt cgc cac cta acg caa atg cag atg ctt cag ttt ttc
ttc 720Trp Trp Gly Arg His Leu Thr Gln Met Gln Met Leu Gln Phe Phe
Phe 225 230 235
240 aac gta ctt caa gcg ttg tac tgc gct tcg ttc tct acg tat ccc
aag 768Asn Val Leu Gln Ala Leu Tyr Cys Ala Ser Phe Ser Thr Tyr Pro
Lys 245 250 255
ttt ttg tcc aaa att ctg ctc gtc tat atg atg agc ctt ctc ggc ttg
816Phe Leu Ser Lys Ile Leu Leu Val Tyr Met Met Ser Leu Leu Gly Leu
260 265 270
ttt ggg cat ttc tac tat tcc aag cac ata gca gca gct aag ctc cag
864Phe Gly His Phe Tyr Tyr Ser Lys His Ile Ala Ala Ala Lys Leu Gln
275 280 285
aaa aaa cag cag tga
879Lys Lys Gln Gln
290
70292PRTOstreococcus tauri 70Met Ser Gly Leu Arg Ala Pro Asn Phe Leu His
Arg Phe Trp Thr Lys 1 5 10
15 Trp Asp Tyr Ala Ile Ser Lys Val Val Phe Thr Cys Ala Asp Ser Phe
20 25 30 Gln Trp
Asp Ile Gly Pro Val Ser Ser Ser Thr Ala His Leu Pro Ala 35
40 45 Ile Glu Ser Pro Thr Pro Leu
Val Thr Ser Leu Leu Phe Tyr Leu Val 50 55
60 Thr Val Phe Leu Trp Tyr Gly Arg Leu Thr Arg Ser
Ser Asp Lys Lys 65 70 75
80 Ile Arg Glu Pro Thr Trp Leu Arg Arg Phe Ile Ile Cys His Asn Ala
85 90 95 Phe Leu Ile
Val Leu Ser Leu Tyr Met Cys Leu Gly Cys Val Ala Gln 100
105 110 Ala Tyr Gln Asn Gly Tyr Thr Leu
Trp Gly Asn Glu Phe Lys Ala Thr 115 120
125 Glu Thr Gln Leu Ala Leu Tyr Ile Tyr Ile Phe Tyr Val
Ser Lys Ile 130 135 140
Tyr Glu Phe Val Asp Thr Tyr Ile Met Leu Leu Lys Asn Asn Leu Arg 145
150 155 160 Gln Val Ser Phe
Leu His Ile Tyr His His Ser Thr Ile Ser Phe Ile 165
170 175 Trp Trp Ile Ile Ala Arg Arg Ala Pro
Gly Gly Asp Ala Tyr Phe Ser 180 185
190 Ala Ala Leu Asn Ser Trp Val His Val Cys Met Tyr Thr Tyr
Tyr Leu 195 200 205
Leu Ser Thr Leu Ile Gly Lys Glu Asp Pro Lys Arg Ser Asn Tyr Leu 210
215 220 Trp Trp Gly Arg His
Leu Thr Gln Met Gln Met Leu Gln Phe Phe Phe 225 230
235 240 Asn Val Leu Gln Ala Leu Tyr Cys Ala Ser
Phe Ser Thr Tyr Pro Lys 245 250
255 Phe Leu Ser Lys Ile Leu Leu Val Tyr Met Met Ser Leu Leu Gly
Leu 260 265 270 Phe
Gly His Phe Tyr Tyr Ser Lys His Ile Ala Ala Ala Lys Leu Gln 275
280 285 Lys Lys Gln Gln 290
711362DNAPrimula farinosaCDS(1)..(1362)delta6-desaturase 71atg
gct aac aaa tct cca cca aac ccc aaa aca ggt tac ata acc agc 48Met
Ala Asn Lys Ser Pro Pro Asn Pro Lys Thr Gly Tyr Ile Thr Ser 1
5 10 15 tca gac
ctg aaa tcc cac aac aag gca ggt gac cta tgg ata tca atc 96Ser Asp
Leu Lys Ser His Asn Lys Ala Gly Asp Leu Trp Ile Ser Ile
20 25 30 cac ggc caa
gtc tac gac gtg tcc tct tgg gcc gcc ctt cat ccg ggg 144His Gly Gln
Val Tyr Asp Val Ser Ser Trp Ala Ala Leu His Pro Gly 35
40 45 ggc act gcc cct
ctc atg gcc ctt gca gga cac gac gtg acc gat gct 192Gly Thr Ala Pro
Leu Met Ala Leu Ala Gly His Asp Val Thr Asp Ala 50
55 60 ttc ctc gcg tac cat
ccc cct tcc act gcc cgt ctc ctc cct cct ctc 240Phe Leu Ala Tyr His
Pro Pro Ser Thr Ala Arg Leu Leu Pro Pro Leu 65
70 75 80 tct acc aac ctc ctt
ctt caa aac cac tcc gtc tcc ccc acc tcc tca 288Ser Thr Asn Leu Leu
Leu Gln Asn His Ser Val Ser Pro Thr Ser Ser 85
90 95 gac tac cgc aaa ctc ctc
gac aac ttc cat aaa cat ggc ctt ttc cgc 336Asp Tyr Arg Lys Leu Leu
Asp Asn Phe His Lys His Gly Leu Phe Arg 100
105 110 gcc agg ggc cac act gct tac
gcc acc ttc gtc ttc atg ata gcg atg 384Ala Arg Gly His Thr Ala Tyr
Ala Thr Phe Val Phe Met Ile Ala Met 115
120 125 ttt cta atg agc gtg act gga
gtc ctt tgc agc gac agt gcg tgg gtc 432Phe Leu Met Ser Val Thr Gly
Val Leu Cys Ser Asp Ser Ala Trp Val 130 135
140 cat ttg gct agc ggc gga gca atg
ggg ttc gcc tgg atc caa tgc gga 480His Leu Ala Ser Gly Gly Ala Met
Gly Phe Ala Trp Ile Gln Cys Gly 145 150
155 160 tgg ata ggt cac gac tct ggg cat tac
cgg att atg tct gac agg aaa 528Trp Ile Gly His Asp Ser Gly His Tyr
Arg Ile Met Ser Asp Arg Lys 165
170 175 tgg aac tgg ttc gcg caa atc cta agc
aca aac tgc ctc cag ggg att 576Trp Asn Trp Phe Ala Gln Ile Leu Ser
Thr Asn Cys Leu Gln Gly Ile 180 185
190 agt atc ggg tgg tgg aag tgg aac cat aat
gcg cac cac atc gct tgc 624Ser Ile Gly Trp Trp Lys Trp Asn His Asn
Ala His His Ile Ala Cys 195 200
205 aat agc ctg gat tac gac ccc gac ctc cag tat
atc cct ttg ctc gtc 672Asn Ser Leu Asp Tyr Asp Pro Asp Leu Gln Tyr
Ile Pro Leu Leu Val 210 215
220 gtc tcc ccc aag ttc ttc aac tcc ctt act tct
cgt ttc tac gac aag 720Val Ser Pro Lys Phe Phe Asn Ser Leu Thr Ser
Arg Phe Tyr Asp Lys 225 230 235
240 aag ctg aac ttc gac ggc gtg tcg agg ttt ctg gtt
tgc tac cag cac 768Lys Leu Asn Phe Asp Gly Val Ser Arg Phe Leu Val
Cys Tyr Gln His 245 250
255 tgg acg ttt tat ccg gtc atg tgt gtc gct agg ctg aac
atg ctc gcg 816Trp Thr Phe Tyr Pro Val Met Cys Val Ala Arg Leu Asn
Met Leu Ala 260 265
270 cag tca ttt ata acg ctt ttc tcg agt agg gag gtg tgc
cat agg gcg 864Gln Ser Phe Ile Thr Leu Phe Ser Ser Arg Glu Val Cys
His Arg Ala 275 280 285
caa gag gtt ttc gga ctt gcc gtg ttt tgg gtt tgg ttt ccg
ctt tta 912Gln Glu Val Phe Gly Leu Ala Val Phe Trp Val Trp Phe Pro
Leu Leu 290 295 300
ctt tct tgt tta cct aat tgg ggc gag agg att atg ttt ttg ctt
gcg 960Leu Ser Cys Leu Pro Asn Trp Gly Glu Arg Ile Met Phe Leu Leu
Ala 305 310 315
320 agc tat tcc gtt acg ggg ata caa cac gtg cag ttc agc ttg aac
cat 1008Ser Tyr Ser Val Thr Gly Ile Gln His Val Gln Phe Ser Leu Asn
His 325 330 335
ttt tct tcg gac gtc tat gtg ggc ccg cca gta ggt aat gac tgg ttc
1056Phe Ser Ser Asp Val Tyr Val Gly Pro Pro Val Gly Asn Asp Trp Phe
340 345 350
aag aaa cag act gcc ggg aca ctt aac ata tcg tgc ccg gcg tgg atg
1104Lys Lys Gln Thr Ala Gly Thr Leu Asn Ile Ser Cys Pro Ala Trp Met
355 360 365
gat tgg ttc cat ggc ggg tta cag ttt cag gtc gag cac cac ttg ttt
1152Asp Trp Phe His Gly Gly Leu Gln Phe Gln Val Glu His His Leu Phe
370 375 380
ccg cgg atg cct agg ggt cag ttt agg aag att tct cct ttt gtg agg
1200Pro Arg Met Pro Arg Gly Gln Phe Arg Lys Ile Ser Pro Phe Val Arg
385 390 395 400
gat ttg tgt aag aaa cac aac ttg cct tac aat atc gcg tct ttt act
1248Asp Leu Cys Lys Lys His Asn Leu Pro Tyr Asn Ile Ala Ser Phe Thr
405 410 415
aaa gcg aat gtg ttt acg ctt aag acg ctg aga aat acg gcc att gag
1296Lys Ala Asn Val Phe Thr Leu Lys Thr Leu Arg Asn Thr Ala Ile Glu
420 425 430
gct cgg gac ctc tct aat ccg ctc cca aag aat atg gtg tgg gaa gct
1344Ala Arg Asp Leu Ser Asn Pro Leu Pro Lys Asn Met Val Trp Glu Ala
435 440 445
ctt aaa act ctc ggg tga
1362Leu Lys Thr Leu Gly
450
72453PRTPrimula farinosa 72Met Ala Asn Lys Ser Pro Pro Asn Pro Lys Thr
Gly Tyr Ile Thr Ser 1 5 10
15 Ser Asp Leu Lys Ser His Asn Lys Ala Gly Asp Leu Trp Ile Ser Ile
20 25 30 His Gly
Gln Val Tyr Asp Val Ser Ser Trp Ala Ala Leu His Pro Gly 35
40 45 Gly Thr Ala Pro Leu Met Ala
Leu Ala Gly His Asp Val Thr Asp Ala 50 55
60 Phe Leu Ala Tyr His Pro Pro Ser Thr Ala Arg Leu
Leu Pro Pro Leu 65 70 75
80 Ser Thr Asn Leu Leu Leu Gln Asn His Ser Val Ser Pro Thr Ser Ser
85 90 95 Asp Tyr Arg
Lys Leu Leu Asp Asn Phe His Lys His Gly Leu Phe Arg 100
105 110 Ala Arg Gly His Thr Ala Tyr Ala
Thr Phe Val Phe Met Ile Ala Met 115 120
125 Phe Leu Met Ser Val Thr Gly Val Leu Cys Ser Asp Ser
Ala Trp Val 130 135 140
His Leu Ala Ser Gly Gly Ala Met Gly Phe Ala Trp Ile Gln Cys Gly 145
150 155 160 Trp Ile Gly His
Asp Ser Gly His Tyr Arg Ile Met Ser Asp Arg Lys 165
170 175 Trp Asn Trp Phe Ala Gln Ile Leu Ser
Thr Asn Cys Leu Gln Gly Ile 180 185
190 Ser Ile Gly Trp Trp Lys Trp Asn His Asn Ala His His Ile
Ala Cys 195 200 205
Asn Ser Leu Asp Tyr Asp Pro Asp Leu Gln Tyr Ile Pro Leu Leu Val 210
215 220 Val Ser Pro Lys Phe
Phe Asn Ser Leu Thr Ser Arg Phe Tyr Asp Lys 225 230
235 240 Lys Leu Asn Phe Asp Gly Val Ser Arg Phe
Leu Val Cys Tyr Gln His 245 250
255 Trp Thr Phe Tyr Pro Val Met Cys Val Ala Arg Leu Asn Met Leu
Ala 260 265 270 Gln
Ser Phe Ile Thr Leu Phe Ser Ser Arg Glu Val Cys His Arg Ala 275
280 285 Gln Glu Val Phe Gly Leu
Ala Val Phe Trp Val Trp Phe Pro Leu Leu 290 295
300 Leu Ser Cys Leu Pro Asn Trp Gly Glu Arg Ile
Met Phe Leu Leu Ala 305 310 315
320 Ser Tyr Ser Val Thr Gly Ile Gln His Val Gln Phe Ser Leu Asn His
325 330 335 Phe Ser
Ser Asp Val Tyr Val Gly Pro Pro Val Gly Asn Asp Trp Phe 340
345 350 Lys Lys Gln Thr Ala Gly Thr
Leu Asn Ile Ser Cys Pro Ala Trp Met 355 360
365 Asp Trp Phe His Gly Gly Leu Gln Phe Gln Val Glu
His His Leu Phe 370 375 380
Pro Arg Met Pro Arg Gly Gln Phe Arg Lys Ile Ser Pro Phe Val Arg 385
390 395 400 Asp Leu Cys
Lys Lys His Asn Leu Pro Tyr Asn Ile Ala Ser Phe Thr 405
410 415 Lys Ala Asn Val Phe Thr Leu Lys
Thr Leu Arg Asn Thr Ala Ile Glu 420 425
430 Ala Arg Asp Leu Ser Asn Pro Leu Pro Lys Asn Met Val
Trp Glu Ala 435 440 445
Leu Lys Thr Leu Gly 450 731362DNAPrimula
vialiiCDS(1)..(1362)delta6-desaturase 73atg gct aac aaa tct cca cca aac
ccc aaa aca ggt tac att acc agc 48Met Ala Asn Lys Ser Pro Pro Asn
Pro Lys Thr Gly Tyr Ile Thr Ser 1 5
10 15 tca gac ctg aaa ggg cac aac aaa gca
gga gac cta tgg ata tca atc 96Ser Asp Leu Lys Gly His Asn Lys Ala
Gly Asp Leu Trp Ile Ser Ile 20 25
30 cac ggg gag gta tac gac gtg tcc tcg tgg
gcc ggc ctt cac ccg ggg 144His Gly Glu Val Tyr Asp Val Ser Ser Trp
Ala Gly Leu His Pro Gly 35 40
45 ggc agt gcc ccc ctc atg gcc ctc gca gga cac
gac gta acc gac gct 192Gly Ser Ala Pro Leu Met Ala Leu Ala Gly His
Asp Val Thr Asp Ala 50 55
60 ttt cta gcg tat cat cct cct tct acc gcc cgc
ctc ctc cct ccc ctc 240Phe Leu Ala Tyr His Pro Pro Ser Thr Ala Arg
Leu Leu Pro Pro Leu 65 70 75
80 tcc acc aac ctc ctc ctt caa aac cac tcc gtc tcc
ccc acc tcc tct 288Ser Thr Asn Leu Leu Leu Gln Asn His Ser Val Ser
Pro Thr Ser Ser 85 90
95 gac tac cgc aaa ctc ctc cac aac ttc cat aaa att ggt
atg ttc cgc 336Asp Tyr Arg Lys Leu Leu His Asn Phe His Lys Ile Gly
Met Phe Arg 100 105
110 gcc agg ggc cac act gct tac gcc acc ttc gtc atc atg
ata gtg atg 384Ala Arg Gly His Thr Ala Tyr Ala Thr Phe Val Ile Met
Ile Val Met 115 120 125
ttt cta acg agc gtg acc gga gtc ctt tgc agc gac agt gcg
tgg gtc 432Phe Leu Thr Ser Val Thr Gly Val Leu Cys Ser Asp Ser Ala
Trp Val 130 135 140
cat ctg gct agc ggc gca gca atg ggg ttc gcc tgg atc cag tgc
gga 480His Leu Ala Ser Gly Ala Ala Met Gly Phe Ala Trp Ile Gln Cys
Gly 145 150 155
160 tgg ata ggt cac gac tct ggg cat tac cgg att atg tct gac agg
aaa 528Trp Ile Gly His Asp Ser Gly His Tyr Arg Ile Met Ser Asp Arg
Lys 165 170 175
tgg aac tgg ttc gcg cag gtc ctg agc aca aac tgc ctc cag ggg atc
576Trp Asn Trp Phe Ala Gln Val Leu Ser Thr Asn Cys Leu Gln Gly Ile
180 185 190
agt atc ggg tgg tgg aag tgg aac cat aac gcc cac cac att gct tgc
624Ser Ile Gly Trp Trp Lys Trp Asn His Asn Ala His His Ile Ala Cys
195 200 205
aat agc ctg gac tac gac ccc gac ctc cag tat atc cct ttg ctc gtg
672Asn Ser Leu Asp Tyr Asp Pro Asp Leu Gln Tyr Ile Pro Leu Leu Val
210 215 220
gtc tcc ccc aag ttc ttc aac tcc ctt act tct cgt ttc tac gac aag
720Val Ser Pro Lys Phe Phe Asn Ser Leu Thr Ser Arg Phe Tyr Asp Lys
225 230 235 240
aag ctg aat ttc gac ggc gtg tca agg ttt ctg gtt tgc tac cag cac
768Lys Leu Asn Phe Asp Gly Val Ser Arg Phe Leu Val Cys Tyr Gln His
245 250 255
tgg acg ttt tat cca gtc atg tgt gtc gct agg cta aac atg atc gca
816Trp Thr Phe Tyr Pro Val Met Cys Val Ala Arg Leu Asn Met Ile Ala
260 265 270
cag tcg ttt ata acg ctt ttc tcg agc agg gag gtg ggt cat agg gcg
864Gln Ser Phe Ile Thr Leu Phe Ser Ser Arg Glu Val Gly His Arg Ala
275 280 285
caa gag att ttc gga ctt gct gtg ttt tgg gtt tgg ttt ccg ctc ctg
912Gln Glu Ile Phe Gly Leu Ala Val Phe Trp Val Trp Phe Pro Leu Leu
290 295 300
ctc tct tgc tta cct aat tgg agc gag agg att atg ttt ctg cta gcg
960Leu Ser Cys Leu Pro Asn Trp Ser Glu Arg Ile Met Phe Leu Leu Ala
305 310 315 320
agc tat tcc gtt acg ggg ata cag cac gtg cag ttc agc ttg aac cat
1008Ser Tyr Ser Val Thr Gly Ile Gln His Val Gln Phe Ser Leu Asn His
325 330 335
ttt tct tcg gac gtc tac gtg ggc ccg cca gta gct aac gac tgg ttc
1056Phe Ser Ser Asp Val Tyr Val Gly Pro Pro Val Ala Asn Asp Trp Phe
340 345 350
aag aaa cag act gct ggg aca ctt aac ata tcg tgc ccg gcg tgg atg
1104Lys Lys Gln Thr Ala Gly Thr Leu Asn Ile Ser Cys Pro Ala Trp Met
355 360 365
gac tgg ttc cat ggc ggg ttg cag ttt cag gtc gag cac cac ttg ttt
1152Asp Trp Phe His Gly Gly Leu Gln Phe Gln Val Glu His His Leu Phe
370 375 380
ccg cgg atg cct agg ggt cag ttt agg aag att tct cct ttt gtg agg
1200Pro Arg Met Pro Arg Gly Gln Phe Arg Lys Ile Ser Pro Phe Val Arg
385 390 395 400
gat ttg tgt aag aaa cac aac ttg cct tac aat atc gcg tct ttt act
1248Asp Leu Cys Lys Lys His Asn Leu Pro Tyr Asn Ile Ala Ser Phe Thr
405 410 415
aaa gca aac gtg ttg acg ctt aag acg ctg aga aat acg gcc att gag
1296Lys Ala Asn Val Leu Thr Leu Lys Thr Leu Arg Asn Thr Ala Ile Glu
420 425 430
gct cgg gac ctc tct aat ccg acc cca aag aat atg gtg tgg gaa gcc
1344Ala Arg Asp Leu Ser Asn Pro Thr Pro Lys Asn Met Val Trp Glu Ala
435 440 445
gtc cac aca cac ggc tag
1362Val His Thr His Gly
450
74453PRTPrimula vialii 74Met Ala Asn Lys Ser Pro Pro Asn Pro Lys Thr Gly
Tyr Ile Thr Ser 1 5 10
15 Ser Asp Leu Lys Gly His Asn Lys Ala Gly Asp Leu Trp Ile Ser Ile
20 25 30 His Gly Glu
Val Tyr Asp Val Ser Ser Trp Ala Gly Leu His Pro Gly 35
40 45 Gly Ser Ala Pro Leu Met Ala Leu
Ala Gly His Asp Val Thr Asp Ala 50 55
60 Phe Leu Ala Tyr His Pro Pro Ser Thr Ala Arg Leu Leu
Pro Pro Leu 65 70 75
80 Ser Thr Asn Leu Leu Leu Gln Asn His Ser Val Ser Pro Thr Ser Ser
85 90 95 Asp Tyr Arg Lys
Leu Leu His Asn Phe His Lys Ile Gly Met Phe Arg 100
105 110 Ala Arg Gly His Thr Ala Tyr Ala Thr
Phe Val Ile Met Ile Val Met 115 120
125 Phe Leu Thr Ser Val Thr Gly Val Leu Cys Ser Asp Ser Ala
Trp Val 130 135 140
His Leu Ala Ser Gly Ala Ala Met Gly Phe Ala Trp Ile Gln Cys Gly 145
150 155 160 Trp Ile Gly His Asp
Ser Gly His Tyr Arg Ile Met Ser Asp Arg Lys 165
170 175 Trp Asn Trp Phe Ala Gln Val Leu Ser Thr
Asn Cys Leu Gln Gly Ile 180 185
190 Ser Ile Gly Trp Trp Lys Trp Asn His Asn Ala His His Ile Ala
Cys 195 200 205 Asn
Ser Leu Asp Tyr Asp Pro Asp Leu Gln Tyr Ile Pro Leu Leu Val 210
215 220 Val Ser Pro Lys Phe Phe
Asn Ser Leu Thr Ser Arg Phe Tyr Asp Lys 225 230
235 240 Lys Leu Asn Phe Asp Gly Val Ser Arg Phe Leu
Val Cys Tyr Gln His 245 250
255 Trp Thr Phe Tyr Pro Val Met Cys Val Ala Arg Leu Asn Met Ile Ala
260 265 270 Gln Ser
Phe Ile Thr Leu Phe Ser Ser Arg Glu Val Gly His Arg Ala 275
280 285 Gln Glu Ile Phe Gly Leu Ala
Val Phe Trp Val Trp Phe Pro Leu Leu 290 295
300 Leu Ser Cys Leu Pro Asn Trp Ser Glu Arg Ile Met
Phe Leu Leu Ala 305 310 315
320 Ser Tyr Ser Val Thr Gly Ile Gln His Val Gln Phe Ser Leu Asn His
325 330 335 Phe Ser Ser
Asp Val Tyr Val Gly Pro Pro Val Ala Asn Asp Trp Phe 340
345 350 Lys Lys Gln Thr Ala Gly Thr Leu
Asn Ile Ser Cys Pro Ala Trp Met 355 360
365 Asp Trp Phe His Gly Gly Leu Gln Phe Gln Val Glu His
His Leu Phe 370 375 380
Pro Arg Met Pro Arg Gly Gln Phe Arg Lys Ile Ser Pro Phe Val Arg 385
390 395 400 Asp Leu Cys Lys
Lys His Asn Leu Pro Tyr Asn Ile Ala Ser Phe Thr 405
410 415 Lys Ala Asn Val Leu Thr Leu Lys Thr
Leu Arg Asn Thr Ala Ile Glu 420 425
430 Ala Arg Asp Leu Ser Asn Pro Thr Pro Lys Asn Met Val Trp
Glu Ala 435 440 445
Val His Thr His Gly 450 75903DNAOstreococcus
tauriCDS(1)..(903)delta5-elongase 75atg agc gcc tcc ggt gcg ctg ctg ccc
gcg atc gcg tcc gcc gcg tac 48Met Ser Ala Ser Gly Ala Leu Leu Pro
Ala Ile Ala Ser Ala Ala Tyr 1 5
10 15 gcg tac gcg acg tac gcc tac gcc ttt
gag tgg tcg cac gcg aat ggc 96Ala Tyr Ala Thr Tyr Ala Tyr Ala Phe
Glu Trp Ser His Ala Asn Gly 20 25
30 atc gac aac gtc gac gcg cgc gag tgg atc
ggt gcg ctg tcg ttg agg 144Ile Asp Asn Val Asp Ala Arg Glu Trp Ile
Gly Ala Leu Ser Leu Arg 35 40
45 ctc ccg gcg atc gcg acg acg atg tac ctg ttg
ttc tgc ctg gtc gga 192Leu Pro Ala Ile Ala Thr Thr Met Tyr Leu Leu
Phe Cys Leu Val Gly 50 55
60 ccg agg ttg atg gcg aag cgc gag gcg ttc gac
ccg aag ggg ttc atg 240Pro Arg Leu Met Ala Lys Arg Glu Ala Phe Asp
Pro Lys Gly Phe Met 65 70 75
80 ctg gcg tac aat gcg tat cag acg gcg ttc aac gtc
gtc gtg ctc ggg 288Leu Ala Tyr Asn Ala Tyr Gln Thr Ala Phe Asn Val
Val Val Leu Gly 85 90
95 atg ttc gcg cga gag atc tcg ggg ctg ggg cag ccc gtg
tgg ggg tca 336Met Phe Ala Arg Glu Ile Ser Gly Leu Gly Gln Pro Val
Trp Gly Ser 100 105
110 acc atg ccg tgg agc gat aga aaa tcg ttt aag atc ctc
ctc ggg gtg 384Thr Met Pro Trp Ser Asp Arg Lys Ser Phe Lys Ile Leu
Leu Gly Val 115 120 125
tgg ttg cac tac aac aac aaa tat ttg gag cta ttg gac act
gtg ttc 432Trp Leu His Tyr Asn Asn Lys Tyr Leu Glu Leu Leu Asp Thr
Val Phe 130 135 140
atg gtt gcg cgc aag aag acg aag cag ttg agc ttc ttg cac gtt
tat 480Met Val Ala Arg Lys Lys Thr Lys Gln Leu Ser Phe Leu His Val
Tyr 145 150 155
160 cat cac gcc ctg ttg atc tgg gcg tgg tgg ttg gtg tgt cac ttg
atg 528His His Ala Leu Leu Ile Trp Ala Trp Trp Leu Val Cys His Leu
Met 165 170 175
gcc acg aac gat tgt atc gat gcc tac ttc ggc gcg gcg tgc aac tcg
576Ala Thr Asn Asp Cys Ile Asp Ala Tyr Phe Gly Ala Ala Cys Asn Ser
180 185 190
ttc att cac atc gtg atg tac tcg tat tat ctc atg tcg gcg ctc ggc
624Phe Ile His Ile Val Met Tyr Ser Tyr Tyr Leu Met Ser Ala Leu Gly
195 200 205
att cga tgc ccg tgg aag cga tac atc acc cag gct caa atg ctc caa
672Ile Arg Cys Pro Trp Lys Arg Tyr Ile Thr Gln Ala Gln Met Leu Gln
210 215 220
ttc gtc att gtc ttc gcg cac gcc gtg ttc gtg ctg cgt cag aag cac
720Phe Val Ile Val Phe Ala His Ala Val Phe Val Leu Arg Gln Lys His
225 230 235 240
tgc ccg gtc acc ctt cct tgg gcg caa atg ttc gtc atg acg aac atg
768Cys Pro Val Thr Leu Pro Trp Ala Gln Met Phe Val Met Thr Asn Met
245 250 255
ctc gtg ctc ttc ggg aac ttc tac ctc aag gcg tac tcg aac aag tcg
816Leu Val Leu Phe Gly Asn Phe Tyr Leu Lys Ala Tyr Ser Asn Lys Ser
260 265 270
cgc ggc gac ggc gcg agt tcc gtg aaa cca gcc gag acc acg cgc gcg
864Arg Gly Asp Gly Ala Ser Ser Val Lys Pro Ala Glu Thr Thr Arg Ala
275 280 285
ccc agc gtg cga cgc acg cga tct cga aaa att gac taa
903Pro Ser Val Arg Arg Thr Arg Ser Arg Lys Ile Asp
290 295 300
76300PRTOstreococcus tauri 76Met Ser Ala Ser Gly Ala Leu Leu Pro Ala Ile
Ala Ser Ala Ala Tyr 1 5 10
15 Ala Tyr Ala Thr Tyr Ala Tyr Ala Phe Glu Trp Ser His Ala Asn Gly
20 25 30 Ile Asp
Asn Val Asp Ala Arg Glu Trp Ile Gly Ala Leu Ser Leu Arg 35
40 45 Leu Pro Ala Ile Ala Thr Thr
Met Tyr Leu Leu Phe Cys Leu Val Gly 50 55
60 Pro Arg Leu Met Ala Lys Arg Glu Ala Phe Asp Pro
Lys Gly Phe Met 65 70 75
80 Leu Ala Tyr Asn Ala Tyr Gln Thr Ala Phe Asn Val Val Val Leu Gly
85 90 95 Met Phe Ala
Arg Glu Ile Ser Gly Leu Gly Gln Pro Val Trp Gly Ser 100
105 110 Thr Met Pro Trp Ser Asp Arg Lys
Ser Phe Lys Ile Leu Leu Gly Val 115 120
125 Trp Leu His Tyr Asn Asn Lys Tyr Leu Glu Leu Leu Asp
Thr Val Phe 130 135 140
Met Val Ala Arg Lys Lys Thr Lys Gln Leu Ser Phe Leu His Val Tyr 145
150 155 160 His His Ala Leu
Leu Ile Trp Ala Trp Trp Leu Val Cys His Leu Met 165
170 175 Ala Thr Asn Asp Cys Ile Asp Ala Tyr
Phe Gly Ala Ala Cys Asn Ser 180 185
190 Phe Ile His Ile Val Met Tyr Ser Tyr Tyr Leu Met Ser Ala
Leu Gly 195 200 205
Ile Arg Cys Pro Trp Lys Arg Tyr Ile Thr Gln Ala Gln Met Leu Gln 210
215 220 Phe Val Ile Val Phe
Ala His Ala Val Phe Val Leu Arg Gln Lys His 225 230
235 240 Cys Pro Val Thr Leu Pro Trp Ala Gln Met
Phe Val Met Thr Asn Met 245 250
255 Leu Val Leu Phe Gly Asn Phe Tyr Leu Lys Ala Tyr Ser Asn Lys
Ser 260 265 270 Arg
Gly Asp Gly Ala Ser Ser Val Lys Pro Ala Glu Thr Thr Arg Ala 275
280 285 Pro Ser Val Arg Arg Thr
Arg Ser Arg Lys Ile Asp 290 295 300
77903DNAOstreococcus tauriCDS(1)..(903)delta5-elongase 77atg agc gcc tcc
ggt gcg ctg ctg ccc gcg atc gcg ttc gcc gcg tac 48Met Ser Ala Ser
Gly Ala Leu Leu Pro Ala Ile Ala Phe Ala Ala Tyr 1 5
10 15 gcg tac gcg acg tac
gcc tac gcc ttt gag tgg tcg cac gcg aat ggc 96Ala Tyr Ala Thr Tyr
Ala Tyr Ala Phe Glu Trp Ser His Ala Asn Gly 20
25 30 atc gac aac gtc gac gcg
cgc gag tgg atc ggt gcg ctg tcg ttg agg 144Ile Asp Asn Val Asp Ala
Arg Glu Trp Ile Gly Ala Leu Ser Leu Arg 35
40 45 ctc ccg gcg atc gcg acg
acg atg tac ctg ttg ttc tgc ctg gtc gga 192Leu Pro Ala Ile Ala Thr
Thr Met Tyr Leu Leu Phe Cys Leu Val Gly 50
55 60 ccg agg ttg atg gcg aag
cgc gag gcg ttc gac ccg aag ggg ttc atg 240Pro Arg Leu Met Ala Lys
Arg Glu Ala Phe Asp Pro Lys Gly Phe Met 65 70
75 80 ctg gcg tac aat gcg tat cag
acg gcg ttc aac gtc gtc gtg ctc ggg 288Leu Ala Tyr Asn Ala Tyr Gln
Thr Ala Phe Asn Val Val Val Leu Gly 85
90 95 atg ttc gcg cga gag atc tcg ggg
ctg ggg cag ccc gtg tgg ggg tca 336Met Phe Ala Arg Glu Ile Ser Gly
Leu Gly Gln Pro Val Trp Gly Ser 100
105 110 acc atg ccg tgg agc gat aga aaa
tcg ttt aag atc ctc ctc ggg gtg 384Thr Met Pro Trp Ser Asp Arg Lys
Ser Phe Lys Ile Leu Leu Gly Val 115 120
125 tgg ttg cac tac aac aac aaa tat ttg
gag cta ttg gac act gtg ttc 432Trp Leu His Tyr Asn Asn Lys Tyr Leu
Glu Leu Leu Asp Thr Val Phe 130 135
140 atg gtt gcg cgc aag aag acg aag cag ttg
agc ttc ttg cac gtt tat 480Met Val Ala Arg Lys Lys Thr Lys Gln Leu
Ser Phe Leu His Val Tyr 145 150
155 160 cat cac gcc ctg ttg atc tgg gcg tgg tgg
ttg gtg tgt cac ttg atg 528His His Ala Leu Leu Ile Trp Ala Trp Trp
Leu Val Cys His Leu Met 165 170
175 gcc acg aac gat tgt atc gat gcc tac ttc ggc
gcg gcg tgc aac tcg 576Ala Thr Asn Asp Cys Ile Asp Ala Tyr Phe Gly
Ala Ala Cys Asn Ser 180 185
190 ttc att cac atc gtg atg tac tcg tat tat ctc atg
tcg gcg ctc ggc 624Phe Ile His Ile Val Met Tyr Ser Tyr Tyr Leu Met
Ser Ala Leu Gly 195 200
205 att cga tgc ccg tgg aag cga tac atc acc cag gct
caa atg ctc caa 672Ile Arg Cys Pro Trp Lys Arg Tyr Ile Thr Gln Ala
Gln Met Leu Gln 210 215 220
ttc gtc att gtc ttc gcg cac gcc gtg ttc gtg ctg cgt
cag aag cac 720Phe Val Ile Val Phe Ala His Ala Val Phe Val Leu Arg
Gln Lys His 225 230 235
240 tgc ccg gtc acc ctt cct tgg gcg caa atg ttc gtc atg acg
aac atg 768Cys Pro Val Thr Leu Pro Trp Ala Gln Met Phe Val Met Thr
Asn Met 245 250
255 ctc gtg ctc ttc ggg aac ttc tac ctc aag gcg tac tcg aac
aag tcg 816Leu Val Leu Phe Gly Asn Phe Tyr Leu Lys Ala Tyr Ser Asn
Lys Ser 260 265 270
cgc ggc gac ggc gcg agt tcc gtg aaa cca gcc gag acc acg cgc
gcg 864Arg Gly Asp Gly Ala Ser Ser Val Lys Pro Ala Glu Thr Thr Arg
Ala 275 280 285
ccc agc gtg cga cgc acg cga tct cga aaa att gac taa
903Pro Ser Val Arg Arg Thr Arg Ser Arg Lys Ile Asp
290 295 300
78300PRTOstreococcus tauri 78Met Ser Ala Ser Gly Ala Leu Leu Pro Ala
Ile Ala Phe Ala Ala Tyr 1 5 10
15 Ala Tyr Ala Thr Tyr Ala Tyr Ala Phe Glu Trp Ser His Ala Asn
Gly 20 25 30 Ile
Asp Asn Val Asp Ala Arg Glu Trp Ile Gly Ala Leu Ser Leu Arg 35
40 45 Leu Pro Ala Ile Ala Thr
Thr Met Tyr Leu Leu Phe Cys Leu Val Gly 50 55
60 Pro Arg Leu Met Ala Lys Arg Glu Ala Phe Asp
Pro Lys Gly Phe Met 65 70 75
80 Leu Ala Tyr Asn Ala Tyr Gln Thr Ala Phe Asn Val Val Val Leu Gly
85 90 95 Met Phe
Ala Arg Glu Ile Ser Gly Leu Gly Gln Pro Val Trp Gly Ser 100
105 110 Thr Met Pro Trp Ser Asp Arg
Lys Ser Phe Lys Ile Leu Leu Gly Val 115 120
125 Trp Leu His Tyr Asn Asn Lys Tyr Leu Glu Leu Leu
Asp Thr Val Phe 130 135 140
Met Val Ala Arg Lys Lys Thr Lys Gln Leu Ser Phe Leu His Val Tyr 145
150 155 160 His His Ala
Leu Leu Ile Trp Ala Trp Trp Leu Val Cys His Leu Met 165
170 175 Ala Thr Asn Asp Cys Ile Asp Ala
Tyr Phe Gly Ala Ala Cys Asn Ser 180 185
190 Phe Ile His Ile Val Met Tyr Ser Tyr Tyr Leu Met Ser
Ala Leu Gly 195 200 205
Ile Arg Cys Pro Trp Lys Arg Tyr Ile Thr Gln Ala Gln Met Leu Gln 210
215 220 Phe Val Ile Val
Phe Ala His Ala Val Phe Val Leu Arg Gln Lys His 225 230
235 240 Cys Pro Val Thr Leu Pro Trp Ala Gln
Met Phe Val Met Thr Asn Met 245 250
255 Leu Val Leu Phe Gly Asn Phe Tyr Leu Lys Ala Tyr Ser Asn
Lys Ser 260 265 270
Arg Gly Asp Gly Ala Ser Ser Val Lys Pro Ala Glu Thr Thr Arg Ala
275 280 285 Pro Ser Val Arg
Arg Thr Arg Ser Arg Lys Ile Asp 290 295
300 79903DNAOstreococcus tauriCDS(1)..(903)delta5-elongase 79atg agc
gcc tcc ggt gcg ctg ctg ccc gcg atc gcg tcc gcc gcg tac 48Met Ser
Ala Ser Gly Ala Leu Leu Pro Ala Ile Ala Ser Ala Ala Tyr 1
5 10 15 gcg tac gcg
acg tac gcc tac gcc ttt gag tgg tcg cac gcg aat ggc 96Ala Tyr Ala
Thr Tyr Ala Tyr Ala Phe Glu Trp Ser His Ala Asn Gly
20 25 30 atc gac aac
gtc gac gcg cgc gag tgg atc ggt gcg ctg tcg ttg agg 144Ile Asp Asn
Val Asp Ala Arg Glu Trp Ile Gly Ala Leu Ser Leu Arg 35
40 45 ctc ccg gcg atc
gcg acg acg atg tac ctg ttg ttc tgc ctg gtc gga 192Leu Pro Ala Ile
Ala Thr Thr Met Tyr Leu Leu Phe Cys Leu Val Gly 50
55 60 ccg agg ttg atg gcg
aag cgc gag gcg ttc gac ccg aag ggg ttc atg 240Pro Arg Leu Met Ala
Lys Arg Glu Ala Phe Asp Pro Lys Gly Phe Met 65
70 75 80 ctg gcg tac aat gcg
tat cag acg gcg ttc aac gtc gtc gtg ctc ggg 288Leu Ala Tyr Asn Ala
Tyr Gln Thr Ala Phe Asn Val Val Val Leu Gly 85
90 95 atg ttc gcg cga gag atc
tcg ggg ctg ggg cag ccc gtg tgg ggg tca 336Met Phe Ala Arg Glu Ile
Ser Gly Leu Gly Gln Pro Val Trp Gly Ser 100
105 110 acc atg ccg tgg agc gat aga
aaa tcg ttt aag atc ctc ctc ggg gtg 384Thr Met Pro Trp Ser Asp Arg
Lys Ser Phe Lys Ile Leu Leu Gly Val 115
120 125 tgg ttg cac tac aac aac caa
tat ttg gag cta ttg gac act gtg ttc 432Trp Leu His Tyr Asn Asn Gln
Tyr Leu Glu Leu Leu Asp Thr Val Phe 130 135
140 atg gtt gcg cgc aag aag acg aag
cag ttg agc ttc ttg cac gtt tat 480Met Val Ala Arg Lys Lys Thr Lys
Gln Leu Ser Phe Leu His Val Tyr 145 150
155 160 cat cac gcc ctg ttg atc tgg gcg tgg
tgg ttg gtg tgt cac ttg atg 528His His Ala Leu Leu Ile Trp Ala Trp
Trp Leu Val Cys His Leu Met 165
170 175 gcc acg aac gat tgt atc gat gcc tac
ttc ggc gcg gcg tgc aac tcg 576Ala Thr Asn Asp Cys Ile Asp Ala Tyr
Phe Gly Ala Ala Cys Asn Ser 180 185
190 ttc att cac atc gtg atg tac tcg tat tat
ctc atg tcg gcg ctc ggc 624Phe Ile His Ile Val Met Tyr Ser Tyr Tyr
Leu Met Ser Ala Leu Gly 195 200
205 att cga tgc ccg tgg aag cga tac atc acc cag
gct caa atg ctc caa 672Ile Arg Cys Pro Trp Lys Arg Tyr Ile Thr Gln
Ala Gln Met Leu Gln 210 215
220 ttc gtc att gtc ttc gcg cac gcc gtg ttc gtg
ctg cgt cag aag cac 720Phe Val Ile Val Phe Ala His Ala Val Phe Val
Leu Arg Gln Lys His 225 230 235
240 tgc ccg gtc acc ctt cct tgg gcg caa atg ttc gtc
atg acg aac atg 768Cys Pro Val Thr Leu Pro Trp Ala Gln Met Phe Val
Met Thr Asn Met 245 250
255 ctc gtg ctc ttc ggg aac ttc tac ctc aag gcg tac tcg
aac aag tcg 816Leu Val Leu Phe Gly Asn Phe Tyr Leu Lys Ala Tyr Ser
Asn Lys Ser 260 265
270 cgc ggc gac ggc gcg agt tcc gtg aaa cca gcc gag acc
acg cgc gcg 864Arg Gly Asp Gly Ala Ser Ser Val Lys Pro Ala Glu Thr
Thr Arg Ala 275 280 285
ccc agc gtg cga cgc acg cga tct cga aaa att gac taa
903Pro Ser Val Arg Arg Thr Arg Ser Arg Lys Ile Asp
290 295 300
80300PRTOstreococcus tauri 80Met Ser Ala Ser Gly Ala Leu Leu
Pro Ala Ile Ala Ser Ala Ala Tyr 1 5 10
15 Ala Tyr Ala Thr Tyr Ala Tyr Ala Phe Glu Trp Ser His
Ala Asn Gly 20 25 30
Ile Asp Asn Val Asp Ala Arg Glu Trp Ile Gly Ala Leu Ser Leu Arg
35 40 45 Leu Pro Ala Ile
Ala Thr Thr Met Tyr Leu Leu Phe Cys Leu Val Gly 50
55 60 Pro Arg Leu Met Ala Lys Arg Glu
Ala Phe Asp Pro Lys Gly Phe Met 65 70
75 80 Leu Ala Tyr Asn Ala Tyr Gln Thr Ala Phe Asn Val
Val Val Leu Gly 85 90
95 Met Phe Ala Arg Glu Ile Ser Gly Leu Gly Gln Pro Val Trp Gly Ser
100 105 110 Thr Met Pro
Trp Ser Asp Arg Lys Ser Phe Lys Ile Leu Leu Gly Val 115
120 125 Trp Leu His Tyr Asn Asn Gln Tyr
Leu Glu Leu Leu Asp Thr Val Phe 130 135
140 Met Val Ala Arg Lys Lys Thr Lys Gln Leu Ser Phe Leu
His Val Tyr 145 150 155
160 His His Ala Leu Leu Ile Trp Ala Trp Trp Leu Val Cys His Leu Met
165 170 175 Ala Thr Asn Asp
Cys Ile Asp Ala Tyr Phe Gly Ala Ala Cys Asn Ser 180
185 190 Phe Ile His Ile Val Met Tyr Ser Tyr
Tyr Leu Met Ser Ala Leu Gly 195 200
205 Ile Arg Cys Pro Trp Lys Arg Tyr Ile Thr Gln Ala Gln Met
Leu Gln 210 215 220
Phe Val Ile Val Phe Ala His Ala Val Phe Val Leu Arg Gln Lys His 225
230 235 240 Cys Pro Val Thr Leu
Pro Trp Ala Gln Met Phe Val Met Thr Asn Met 245
250 255 Leu Val Leu Phe Gly Asn Phe Tyr Leu Lys
Ala Tyr Ser Asn Lys Ser 260 265
270 Arg Gly Asp Gly Ala Ser Ser Val Lys Pro Ala Glu Thr Thr Arg
Ala 275 280 285 Pro
Ser Val Arg Arg Thr Arg Ser Arg Lys Ile Asp 290 295
300 81879DNAOstreococcus tauriCDS(1)..(879)delta6-elongase
81atg agt ggc tta cgt gca ccc aac ttt tta cac aga ttc tgg aca aag
48Met Ser Gly Leu Arg Ala Pro Asn Phe Leu His Arg Phe Trp Thr Lys
1 5 10 15
tgg gac tac gcg att tcc aaa gtc gtc ttc acg tgt gcc gac agt ttt
96Trp Asp Tyr Ala Ile Ser Lys Val Val Phe Thr Cys Ala Asp Ser Phe
20 25 30
cag tgg gac atc ggg cca gtg agt tcg agt acg gcg cat tta ccc gcc
144Gln Trp Asp Ile Gly Pro Val Ser Ser Ser Thr Ala His Leu Pro Ala
35 40 45
att gaa tcc cct acc cca ctg gtg act agc ctc ttg ttc tac tta gtc
192Ile Glu Ser Pro Thr Pro Leu Val Thr Ser Leu Leu Phe Tyr Leu Val
50 55 60
aca gtt ttc ttg tgg tat ggt cgt tta acc agg agt tca gac aag aaa
240Thr Val Phe Leu Trp Tyr Gly Arg Leu Thr Arg Ser Ser Asp Lys Lys
65 70 75 80
att aga gag cct acg tgg tta aga aga ttc ata ata tgt cat aat gcg
288Ile Arg Glu Pro Thr Trp Leu Arg Arg Phe Ile Ile Cys His Asn Ala
85 90 95
ttc ttg ata gtc ctc agt ctt tac atg tgc ctt ggt tgt gtg gcc caa
336Phe Leu Ile Val Leu Ser Leu Tyr Met Cys Leu Gly Cys Val Ala Gln
100 105 110
gcg tat cag aat gga tat act tta tgg ggt aat gaa ttc aag gcc acg
384Ala Tyr Gln Asn Gly Tyr Thr Leu Trp Gly Asn Glu Phe Lys Ala Thr
115 120 125
gaa act cag ctt gct ctc tac att tac att ttt tac gta agt aaa ata
432Glu Thr Gln Leu Ala Leu Tyr Ile Tyr Ile Phe Tyr Val Ser Lys Ile
130 135 140
tac gag ttt gta gat act tac att atg ctt ctc aag aat aac ttg cgg
480Tyr Glu Phe Val Asp Thr Tyr Ile Met Leu Leu Lys Asn Asn Leu Arg
145 150 155 160
caa gta aga ttc cta cac act tat cac cac agc acg att tcc ttt att
528Gln Val Arg Phe Leu His Thr Tyr His His Ser Thr Ile Ser Phe Ile
165 170 175
tgg tgg atc att gct cgg agg gct ccg ggt ggt gat gct tac ttc agc
576Trp Trp Ile Ile Ala Arg Arg Ala Pro Gly Gly Asp Ala Tyr Phe Ser
180 185 190
gcg gcc ttg aac tca tgg gta cac gtg tgc atg tac acc tat tat cta
624Ala Ala Leu Asn Ser Trp Val His Val Cys Met Tyr Thr Tyr Tyr Leu
195 200 205
tta tca acc ctt att gga aaa gaa gat cct aag cgt tcc aac tac ctt
672Leu Ser Thr Leu Ile Gly Lys Glu Asp Pro Lys Arg Ser Asn Tyr Leu
210 215 220
tgg tgg ggt cgc cac cta acg caa atg cag atg ctt cag ttt ttc ttc
720Trp Trp Gly Arg His Leu Thr Gln Met Gln Met Leu Gln Phe Phe Phe
225 230 235 240
aac gta ctt caa gcg ttg tac tgc gct tcg ttc tct acg tat ccc aag
768Asn Val Leu Gln Ala Leu Tyr Cys Ala Ser Phe Ser Thr Tyr Pro Lys
245 250 255
ttt ttg tcc aaa att ctg ctc gtc tat atg atg agc ctt ctc ggc ttg
816Phe Leu Ser Lys Ile Leu Leu Val Tyr Met Met Ser Leu Leu Gly Leu
260 265 270
ttt ggg cat ttc tac tat tcc aag cac ata gca gca gct aag ctc cag
864Phe Gly His Phe Tyr Tyr Ser Lys His Ile Ala Ala Ala Lys Leu Gln
275 280 285
aaa aaa cag cag tga
879Lys Lys Gln Gln
290
82292PRTOstreococcus tauri 82Met Ser Gly Leu Arg Ala Pro Asn Phe Leu His
Arg Phe Trp Thr Lys 1 5 10
15 Trp Asp Tyr Ala Ile Ser Lys Val Val Phe Thr Cys Ala Asp Ser Phe
20 25 30 Gln Trp
Asp Ile Gly Pro Val Ser Ser Ser Thr Ala His Leu Pro Ala 35
40 45 Ile Glu Ser Pro Thr Pro Leu
Val Thr Ser Leu Leu Phe Tyr Leu Val 50 55
60 Thr Val Phe Leu Trp Tyr Gly Arg Leu Thr Arg Ser
Ser Asp Lys Lys 65 70 75
80 Ile Arg Glu Pro Thr Trp Leu Arg Arg Phe Ile Ile Cys His Asn Ala
85 90 95 Phe Leu Ile
Val Leu Ser Leu Tyr Met Cys Leu Gly Cys Val Ala Gln 100
105 110 Ala Tyr Gln Asn Gly Tyr Thr Leu
Trp Gly Asn Glu Phe Lys Ala Thr 115 120
125 Glu Thr Gln Leu Ala Leu Tyr Ile Tyr Ile Phe Tyr Val
Ser Lys Ile 130 135 140
Tyr Glu Phe Val Asp Thr Tyr Ile Met Leu Leu Lys Asn Asn Leu Arg 145
150 155 160 Gln Val Arg Phe
Leu His Thr Tyr His His Ser Thr Ile Ser Phe Ile 165
170 175 Trp Trp Ile Ile Ala Arg Arg Ala Pro
Gly Gly Asp Ala Tyr Phe Ser 180 185
190 Ala Ala Leu Asn Ser Trp Val His Val Cys Met Tyr Thr Tyr
Tyr Leu 195 200 205
Leu Ser Thr Leu Ile Gly Lys Glu Asp Pro Lys Arg Ser Asn Tyr Leu 210
215 220 Trp Trp Gly Arg His
Leu Thr Gln Met Gln Met Leu Gln Phe Phe Phe 225 230
235 240 Asn Val Leu Gln Ala Leu Tyr Cys Ala Ser
Phe Ser Thr Tyr Pro Lys 245 250
255 Phe Leu Ser Lys Ile Leu Leu Val Tyr Met Met Ser Leu Leu Gly
Leu 260 265 270 Phe
Gly His Phe Tyr Tyr Ser Lys His Ile Ala Ala Ala Lys Leu Gln 275
280 285 Lys Lys Gln Gln 290
83831DNAThraustochytrium sp.CDS(1)..(831)delta5-elongase 83atg
gac gtc gtc gag cag caa tgg cgc cgc ttc gtg gac gcc gtg gac 48Met
Asp Val Val Glu Gln Gln Trp Arg Arg Phe Val Asp Ala Val Asp 1
5 10 15 aac gga
atc gtg gag ttc atg gag cat gag aag ccc aac aag ctg aac 96Asn Gly
Ile Val Glu Phe Met Glu His Glu Lys Pro Asn Lys Leu Asn
20 25 30 gag ggc aag
ctc ttc acc tcg acc gag gag atg atg gcg ctt atc gtc 144Glu Gly Lys
Leu Phe Thr Ser Thr Glu Glu Met Met Ala Leu Ile Val 35
40 45 ggc tac ctg gcg
ttc gtg gtc ctc ggg tcc gcc ttc atg aag gcc ttt 192Gly Tyr Leu Ala
Phe Val Val Leu Gly Ser Ala Phe Met Lys Ala Phe 50
55 60 gtc gat aag cct ttc
gag ctc aag ttc ctc aag ctc gtg cac aac atc 240Val Asp Lys Pro Phe
Glu Leu Lys Phe Leu Lys Leu Val His Asn Ile 65
70 75 80 ttc ctc acc ggt ctg
tcc atg tac atg gcc acc gag tgc gcg cgc cag 288Phe Leu Thr Gly Leu
Ser Met Tyr Met Ala Thr Glu Cys Ala Arg Gln 85
90 95 gca tac ctc ggc ggc tac
aag ctc ttt ggc aac ccg atg gag aag ggc 336Ala Tyr Leu Gly Gly Tyr
Lys Leu Phe Gly Asn Pro Met Glu Lys Gly 100
105 110 acc gag tcg cac gcc ccg ggc
atg gcc aac atc atc tac atc ttc tac 384Thr Glu Ser His Ala Pro Gly
Met Ala Asn Ile Ile Tyr Ile Phe Tyr 115
120 125 gtg agc aag ttc ctc gaa ttc
ctc gac acc gtc ttc atg atc ctc ggc 432Val Ser Lys Phe Leu Glu Phe
Leu Asp Thr Val Phe Met Ile Leu Gly 130 135
140 aag aag tgg aag cag ctc agc ttt
ctc cac gtc tac cac cac gcg agc 480Lys Lys Trp Lys Gln Leu Ser Phe
Leu His Val Tyr His His Ala Ser 145 150
155 160 atc agc ttc atc tgg ggc atc atc gcc
cgc ttc gcg ccc ggt ggc gac 528Ile Ser Phe Ile Trp Gly Ile Ile Ala
Arg Phe Ala Pro Gly Gly Asp 165
170 175 gcc tac ttc tct acc atc ctc aac agc
agc gtg cat gtc gtg ctc tac 576Ala Tyr Phe Ser Thr Ile Leu Asn Ser
Ser Val His Val Val Leu Tyr 180 185
190 ggc tac tac gcc tcg acc acc ctc ggc tac
acc ttc atg cgc ccg ctg 624Gly Tyr Tyr Ala Ser Thr Thr Leu Gly Tyr
Thr Phe Met Arg Pro Leu 195 200
205 cgc ccg tac att acc acc att cag ctc acg cag
ttc atg gcc atg gtc 672Arg Pro Tyr Ile Thr Thr Ile Gln Leu Thr Gln
Phe Met Ala Met Val 210 215
220 gtc cag tcc gtc tat gac tac tac aac ccc tgc
gac tac ccg cag ccc 720Val Gln Ser Val Tyr Asp Tyr Tyr Asn Pro Cys
Asp Tyr Pro Gln Pro 225 230 235
240 ctc gtc aag ctg ctc ttc tgg tac atg ctc acc atg
ctc ggc ctc ttc 768Leu Val Lys Leu Leu Phe Trp Tyr Met Leu Thr Met
Leu Gly Leu Phe 245 250
255 ggc aac ttc ttc gtg cag cag tac ctc aag ccc aag gcg
ccc aag aag 816Gly Asn Phe Phe Val Gln Gln Tyr Leu Lys Pro Lys Ala
Pro Lys Lys 260 265
270 cag aag acc atc taa
831Gln Lys Thr Ile
275
84276PRTThraustochytrium sp. 84Met Asp Val Val Glu Gln Gln
Trp Arg Arg Phe Val Asp Ala Val Asp 1 5
10 15 Asn Gly Ile Val Glu Phe Met Glu His Glu Lys
Pro Asn Lys Leu Asn 20 25
30 Glu Gly Lys Leu Phe Thr Ser Thr Glu Glu Met Met Ala Leu Ile
Val 35 40 45 Gly
Tyr Leu Ala Phe Val Val Leu Gly Ser Ala Phe Met Lys Ala Phe 50
55 60 Val Asp Lys Pro Phe Glu
Leu Lys Phe Leu Lys Leu Val His Asn Ile 65 70
75 80 Phe Leu Thr Gly Leu Ser Met Tyr Met Ala Thr
Glu Cys Ala Arg Gln 85 90
95 Ala Tyr Leu Gly Gly Tyr Lys Leu Phe Gly Asn Pro Met Glu Lys Gly
100 105 110 Thr Glu
Ser His Ala Pro Gly Met Ala Asn Ile Ile Tyr Ile Phe Tyr 115
120 125 Val Ser Lys Phe Leu Glu Phe
Leu Asp Thr Val Phe Met Ile Leu Gly 130 135
140 Lys Lys Trp Lys Gln Leu Ser Phe Leu His Val Tyr
His His Ala Ser 145 150 155
160 Ile Ser Phe Ile Trp Gly Ile Ile Ala Arg Phe Ala Pro Gly Gly Asp
165 170 175 Ala Tyr Phe
Ser Thr Ile Leu Asn Ser Ser Val His Val Val Leu Tyr 180
185 190 Gly Tyr Tyr Ala Ser Thr Thr Leu
Gly Tyr Thr Phe Met Arg Pro Leu 195 200
205 Arg Pro Tyr Ile Thr Thr Ile Gln Leu Thr Gln Phe Met
Ala Met Val 210 215 220
Val Gln Ser Val Tyr Asp Tyr Tyr Asn Pro Cys Asp Tyr Pro Gln Pro 225
230 235 240 Leu Val Lys Leu
Leu Phe Trp Tyr Met Leu Thr Met Leu Gly Leu Phe 245
250 255 Gly Asn Phe Phe Val Gln Gln Tyr Leu
Lys Pro Lys Ala Pro Lys Lys 260 265
270 Gln Lys Thr Ile 275 851077DNAThalassiosira
pseudonanaCDS(1)..(1077)delta5-elongase 85atg tgc tca cca ccg ccg tca caa
tcc aaa aca aca tcc ctc cta gca 48Met Cys Ser Pro Pro Pro Ser Gln
Ser Lys Thr Thr Ser Leu Leu Ala 1 5
10 15 cgg tac acc acc gcc gcc ctc ctc ctc
ctc acc ctc aca acg tgg tgc 96Arg Tyr Thr Thr Ala Ala Leu Leu Leu
Leu Thr Leu Thr Thr Trp Cys 20 25
30 cac ttc gcc ttc cca gcc gcc acc gcc aca
ccc ggc ctc acc gcc gaa 144His Phe Ala Phe Pro Ala Ala Thr Ala Thr
Pro Gly Leu Thr Ala Glu 35 40
45 atg cac tcc tac aaa gtc cca ctc ggt ctc acc
gta ttc tac ctg ctg 192Met His Ser Tyr Lys Val Pro Leu Gly Leu Thr
Val Phe Tyr Leu Leu 50 55
60 agt cta ccg tca cta aag tac gtt acg gac aac
tac ctt gcc aaa aag 240Ser Leu Pro Ser Leu Lys Tyr Val Thr Asp Asn
Tyr Leu Ala Lys Lys 65 70 75
80 tat gat atg aag tca ctc ctg acg gaa tca atg gtg
ttg tac aat gtg 288Tyr Asp Met Lys Ser Leu Leu Thr Glu Ser Met Val
Leu Tyr Asn Val 85 90
95 gcg caa gtg ctg ctc aat ggg tgg acg gtg tat gcg att
gtg gat gcg 336Ala Gln Val Leu Leu Asn Gly Trp Thr Val Tyr Ala Ile
Val Asp Ala 100 105
110 gtg atg aat aga gac cat cct ttt att gga agt aga agt
ttg gtt ggg 384Val Met Asn Arg Asp His Pro Phe Ile Gly Ser Arg Ser
Leu Val Gly 115 120 125
gcg gcg ttg cat agt ggg agc tcg tat gcg gtg tgg gtt cat
tat tgt 432Ala Ala Leu His Ser Gly Ser Ser Tyr Ala Val Trp Val His
Tyr Cys 130 135 140
gat aag tat ttg gag ttc ttt gat acg tat ttt atg gtg ttg agg
ggg 480Asp Lys Tyr Leu Glu Phe Phe Asp Thr Tyr Phe Met Val Leu Arg
Gly 145 150 155
160 aaa atg gac cag gtc tcc ttc ctc cac atc tac cac cac acg acc
ata 528Lys Met Asp Gln Val Ser Phe Leu His Ile Tyr His His Thr Thr
Ile 165 170 175
gcg tgg gca tgg tgg atc gcc ctc cgc ttc tcc ccc ggc gga gac att
576Ala Trp Ala Trp Trp Ile Ala Leu Arg Phe Ser Pro Gly Gly Asp Ile
180 185 190
tac ttc ggg gca ctc ctc aac tcc atc atc cac gtc ctc atg tat tcc
624Tyr Phe Gly Ala Leu Leu Asn Ser Ile Ile His Val Leu Met Tyr Ser
195 200 205
tac tac gcc ctt gcc cta ctc aag gtc agt tgt cca tgg aaa cga tac
672Tyr Tyr Ala Leu Ala Leu Leu Lys Val Ser Cys Pro Trp Lys Arg Tyr
210 215 220
ttg act caa gct caa tta ttg caa ttc aca agt gtg gtg gtt tat acg
720Leu Thr Gln Ala Gln Leu Leu Gln Phe Thr Ser Val Val Val Tyr Thr
225 230 235 240
ggg tgt acg ggt tat act cat tac tat cat acg aag cat gga gcg gat
768Gly Cys Thr Gly Tyr Thr His Tyr Tyr His Thr Lys His Gly Ala Asp
245 250 255
gag aca cag cct agt tta gga acg tat tat ttc tgt tgt gga gtg cag
816Glu Thr Gln Pro Ser Leu Gly Thr Tyr Tyr Phe Cys Cys Gly Val Gln
260 265 270
gtg ttt gag atg gtt agt ttg ttt gta ctc ttt tcc atc ttt tat aaa
864Val Phe Glu Met Val Ser Leu Phe Val Leu Phe Ser Ile Phe Tyr Lys
275 280 285
cga tcc tat tcg aag aag aac aag tca gga gga aag gat agc aag aag
912Arg Ser Tyr Ser Lys Lys Asn Lys Ser Gly Gly Lys Asp Ser Lys Lys
290 295 300
aat gat gat ggg aat aat gag gat caa tgt cac aag gct atg aag gat
960Asn Asp Asp Gly Asn Asn Glu Asp Gln Cys His Lys Ala Met Lys Asp
305 310 315 320
ata tcg gag ggt gcg aag gag gtt gtg ggg cat gca gcg aag gat gct
1008Ile Ser Glu Gly Ala Lys Glu Val Val Gly His Ala Ala Lys Asp Ala
325 330 335
gga aag ttg gtg gct acg gcg agt aag gct gta aag agg aag gga act
1056Gly Lys Leu Val Ala Thr Ala Ser Lys Ala Val Lys Arg Lys Gly Thr
340 345 350
cgt gtt act ggt gcc atg tag
1077Arg Val Thr Gly Ala Met
355
86358PRTThalassiosira pseudonana 86Met Cys Ser Pro Pro Pro Ser Gln Ser
Lys Thr Thr Ser Leu Leu Ala 1 5 10
15 Arg Tyr Thr Thr Ala Ala Leu Leu Leu Leu Thr Leu Thr Thr
Trp Cys 20 25 30
His Phe Ala Phe Pro Ala Ala Thr Ala Thr Pro Gly Leu Thr Ala Glu
35 40 45 Met His Ser Tyr
Lys Val Pro Leu Gly Leu Thr Val Phe Tyr Leu Leu 50
55 60 Ser Leu Pro Ser Leu Lys Tyr Val
Thr Asp Asn Tyr Leu Ala Lys Lys 65 70
75 80 Tyr Asp Met Lys Ser Leu Leu Thr Glu Ser Met Val
Leu Tyr Asn Val 85 90
95 Ala Gln Val Leu Leu Asn Gly Trp Thr Val Tyr Ala Ile Val Asp Ala
100 105 110 Val Met Asn
Arg Asp His Pro Phe Ile Gly Ser Arg Ser Leu Val Gly 115
120 125 Ala Ala Leu His Ser Gly Ser Ser
Tyr Ala Val Trp Val His Tyr Cys 130 135
140 Asp Lys Tyr Leu Glu Phe Phe Asp Thr Tyr Phe Met Val
Leu Arg Gly 145 150 155
160 Lys Met Asp Gln Val Ser Phe Leu His Ile Tyr His His Thr Thr Ile
165 170 175 Ala Trp Ala Trp
Trp Ile Ala Leu Arg Phe Ser Pro Gly Gly Asp Ile 180
185 190 Tyr Phe Gly Ala Leu Leu Asn Ser Ile
Ile His Val Leu Met Tyr Ser 195 200
205 Tyr Tyr Ala Leu Ala Leu Leu Lys Val Ser Cys Pro Trp Lys
Arg Tyr 210 215 220
Leu Thr Gln Ala Gln Leu Leu Gln Phe Thr Ser Val Val Val Tyr Thr 225
230 235 240 Gly Cys Thr Gly Tyr
Thr His Tyr Tyr His Thr Lys His Gly Ala Asp 245
250 255 Glu Thr Gln Pro Ser Leu Gly Thr Tyr Tyr
Phe Cys Cys Gly Val Gln 260 265
270 Val Phe Glu Met Val Ser Leu Phe Val Leu Phe Ser Ile Phe Tyr
Lys 275 280 285 Arg
Ser Tyr Ser Lys Lys Asn Lys Ser Gly Gly Lys Asp Ser Lys Lys 290
295 300 Asn Asp Asp Gly Asn Asn
Glu Asp Gln Cys His Lys Ala Met Lys Asp 305 310
315 320 Ile Ser Glu Gly Ala Lys Glu Val Val Gly His
Ala Ala Lys Asp Ala 325 330
335 Gly Lys Leu Val Ala Thr Ala Ser Lys Ala Val Lys Arg Lys Gly Thr
340 345 350 Arg Val
Thr Gly Ala Met 355 871086DNAPhytophthora
infestansCDS(1)..(1086)omega3-desaturase 87atg gcg acg aag gag gcg tat
gtg ttc ccc act ctg acg gag atc aag 48Met Ala Thr Lys Glu Ala Tyr
Val Phe Pro Thr Leu Thr Glu Ile Lys 1 5
10 15 cgg tcg cta cct aaa gac tgt ttc
gag gct tcg gtg cct ctg tcg ctc 96Arg Ser Leu Pro Lys Asp Cys Phe
Glu Ala Ser Val Pro Leu Ser Leu 20
25 30 tac tac acc gtg cgt tgt ctg gtg
atc gcg gtg gct cta acc ttc ggt 144Tyr Tyr Thr Val Arg Cys Leu Val
Ile Ala Val Ala Leu Thr Phe Gly 35 40
45 ctc aac tac gct cgc gct ctg ccc gag
gtc gag agc ttc tgg gct ctg 192Leu Asn Tyr Ala Arg Ala Leu Pro Glu
Val Glu Ser Phe Trp Ala Leu 50 55
60 gac gcc gca ctc tgc acg ggc tac atc ttg
ctg cag ggc atc gtg ttc 240Asp Ala Ala Leu Cys Thr Gly Tyr Ile Leu
Leu Gln Gly Ile Val Phe 65 70
75 80 tgg ggc ttc ttc acg gtg ggc cac gat gcc
ggc cac ggc gcc ttc tcg 288Trp Gly Phe Phe Thr Val Gly His Asp Ala
Gly His Gly Ala Phe Ser 85 90
95 cgc tac cac ctg ctt aac ttc gtg gtg ggc act
ttc atg cac tcg ctc 336Arg Tyr His Leu Leu Asn Phe Val Val Gly Thr
Phe Met His Ser Leu 100 105
110 atc ctc acg ccc ttc gag tcg tgg aag ctc acg cac
cgt cac cac cac 384Ile Leu Thr Pro Phe Glu Ser Trp Lys Leu Thr His
Arg His His His 115 120
125 aag aac acg ggc aac att gac cgt gac gag gtc ttc
tac ccg caa cgc 432Lys Asn Thr Gly Asn Ile Asp Arg Asp Glu Val Phe
Tyr Pro Gln Arg 130 135 140
aag gcc gac gac cac ccg ctg tct cgc aac ctg att ctg
gcg ctc ggg 480Lys Ala Asp Asp His Pro Leu Ser Arg Asn Leu Ile Leu
Ala Leu Gly 145 150 155
160 gca gcg tgg ctc gcc tat ttg gtc gag ggc ttc cct cct cgt
aag gtc 528Ala Ala Trp Leu Ala Tyr Leu Val Glu Gly Phe Pro Pro Arg
Lys Val 165 170
175 aac cac ttc aac ccg ttc gag cct ctg ttc gtg cgt cag gtg
tca gct 576Asn His Phe Asn Pro Phe Glu Pro Leu Phe Val Arg Gln Val
Ser Ala 180 185 190
gtg gta atc tct ctt ctc gcc cac ttc ttc gtg gcc gga ctc tcc
atc 624Val Val Ile Ser Leu Leu Ala His Phe Phe Val Ala Gly Leu Ser
Ile 195 200 205
tat ctg agc ctc cag ctg ggc ctt aag acg atg gca atc tac tac tat
672Tyr Leu Ser Leu Gln Leu Gly Leu Lys Thr Met Ala Ile Tyr Tyr Tyr
210 215 220
gga cct gtt ttt gtg ttc ggc agc atg ctg gtc att acc acc ttc cta
720Gly Pro Val Phe Val Phe Gly Ser Met Leu Val Ile Thr Thr Phe Leu
225 230 235 240
cac cac aat gat gag gag acc cca tgg tac gcc gac tcg gag tgg acg
768His His Asn Asp Glu Glu Thr Pro Trp Tyr Ala Asp Ser Glu Trp Thr
245 250 255
tac gtc aag ggc aac ctc tcg tcc gtg gac cga tcg tac ggc gcg ctc
816Tyr Val Lys Gly Asn Leu Ser Ser Val Asp Arg Ser Tyr Gly Ala Leu
260 265 270
att gac aac ctg agc cac aac atc ggc acg cac cag atc cac cac ctt
864Ile Asp Asn Leu Ser His Asn Ile Gly Thr His Gln Ile His His Leu
275 280 285
ttc cct atc att ccg cac tac aaa ctc aag aaa gcc act gcg gcc ttc
912Phe Pro Ile Ile Pro His Tyr Lys Leu Lys Lys Ala Thr Ala Ala Phe
290 295 300
cac cag gct ttc cct gag ctc gtg cgc aag agc gac gag cca att atc
960His Gln Ala Phe Pro Glu Leu Val Arg Lys Ser Asp Glu Pro Ile Ile
305 310 315 320
aag gct ttc ttc cgg gtt gga cgt ctc tac gca aac tac ggc gtt gtg
1008Lys Ala Phe Phe Arg Val Gly Arg Leu Tyr Ala Asn Tyr Gly Val Val
325 330 335
gac cag gag gcg aag ctc ttc acg cta aag gaa gcc aag gcg gcg acc
1056Asp Gln Glu Ala Lys Leu Phe Thr Leu Lys Glu Ala Lys Ala Ala Thr
340 345 350
gag gcg gcg gcc aag acc aag tcc acg taa
1086Glu Ala Ala Ala Lys Thr Lys Ser Thr
355 360
88361PRTPhytophthora infestans 88Met Ala Thr Lys Glu Ala Tyr Val Phe Pro
Thr Leu Thr Glu Ile Lys 1 5 10
15 Arg Ser Leu Pro Lys Asp Cys Phe Glu Ala Ser Val Pro Leu Ser
Leu 20 25 30 Tyr
Tyr Thr Val Arg Cys Leu Val Ile Ala Val Ala Leu Thr Phe Gly 35
40 45 Leu Asn Tyr Ala Arg Ala
Leu Pro Glu Val Glu Ser Phe Trp Ala Leu 50 55
60 Asp Ala Ala Leu Cys Thr Gly Tyr Ile Leu Leu
Gln Gly Ile Val Phe 65 70 75
80 Trp Gly Phe Phe Thr Val Gly His Asp Ala Gly His Gly Ala Phe Ser
85 90 95 Arg Tyr
His Leu Leu Asn Phe Val Val Gly Thr Phe Met His Ser Leu 100
105 110 Ile Leu Thr Pro Phe Glu Ser
Trp Lys Leu Thr His Arg His His His 115 120
125 Lys Asn Thr Gly Asn Ile Asp Arg Asp Glu Val Phe
Tyr Pro Gln Arg 130 135 140
Lys Ala Asp Asp His Pro Leu Ser Arg Asn Leu Ile Leu Ala Leu Gly 145
150 155 160 Ala Ala Trp
Leu Ala Tyr Leu Val Glu Gly Phe Pro Pro Arg Lys Val 165
170 175 Asn His Phe Asn Pro Phe Glu Pro
Leu Phe Val Arg Gln Val Ser Ala 180 185
190 Val Val Ile Ser Leu Leu Ala His Phe Phe Val Ala Gly
Leu Ser Ile 195 200 205
Tyr Leu Ser Leu Gln Leu Gly Leu Lys Thr Met Ala Ile Tyr Tyr Tyr 210
215 220 Gly Pro Val Phe
Val Phe Gly Ser Met Leu Val Ile Thr Thr Phe Leu 225 230
235 240 His His Asn Asp Glu Glu Thr Pro Trp
Tyr Ala Asp Ser Glu Trp Thr 245 250
255 Tyr Val Lys Gly Asn Leu Ser Ser Val Asp Arg Ser Tyr Gly
Ala Leu 260 265 270
Ile Asp Asn Leu Ser His Asn Ile Gly Thr His Gln Ile His His Leu
275 280 285 Phe Pro Ile Ile
Pro His Tyr Lys Leu Lys Lys Ala Thr Ala Ala Phe 290
295 300 His Gln Ala Phe Pro Glu Leu Val
Arg Lys Ser Asp Glu Pro Ile Ile 305 310
315 320 Lys Ala Phe Phe Arg Val Gly Arg Leu Tyr Ala Asn
Tyr Gly Val Val 325 330
335 Asp Gln Glu Ala Lys Leu Phe Thr Leu Lys Glu Ala Lys Ala Ala Thr
340 345 350 Glu Ala Ala
Ala Lys Thr Lys Ser Thr 355 360
891371DNAOstreococcus tauriCDS(1)..(1371)delta6-desaturase 89atg tgc gtg
gag acg gaa aat aac gat ggg atc ccc acg gtg gag atc 48Met Cys Val
Glu Thr Glu Asn Asn Asp Gly Ile Pro Thr Val Glu Ile 1
5 10 15 gcg ttc gac ggt
gag cgc gag cgg gcg gag gca aac gtg aag ctg tcc 96Ala Phe Asp Gly
Glu Arg Glu Arg Ala Glu Ala Asn Val Lys Leu Ser 20
25 30 gcg gag aag atg gag
ccg gcg gcg ctg gcg aag acg ttc gcg agg cgg 144Ala Glu Lys Met Glu
Pro Ala Ala Leu Ala Lys Thr Phe Ala Arg Arg 35
40 45 tac gtc gtg atc gag ggg
gtg gag tac gat gtg acg gat ttt aag cac 192Tyr Val Val Ile Glu Gly
Val Glu Tyr Asp Val Thr Asp Phe Lys His 50
55 60 ccg gga gga acg gtt att
ttc tat gcg ttg tca aac acc ggg gcg gac 240Pro Gly Gly Thr Val Ile
Phe Tyr Ala Leu Ser Asn Thr Gly Ala Asp 65 70
75 80 gcg acg gaa gcg ttc aag gag
ttt cat cat cgg tcg aga aag gcg agg 288Ala Thr Glu Ala Phe Lys Glu
Phe His His Arg Ser Arg Lys Ala Arg 85
90 95 aaa gcc ttg gcg gcg ctc ccg tct
cga ccg gcc aag acg gcc aag gtg 336Lys Ala Leu Ala Ala Leu Pro Ser
Arg Pro Ala Lys Thr Ala Lys Val 100
105 110 gac gac gcg gag atg ctc caa gat
ttc gcc aag tgg cgg aaa gaa ttg 384Asp Asp Ala Glu Met Leu Gln Asp
Phe Ala Lys Trp Arg Lys Glu Leu 115 120
125 gag aga gat gga ttc ttc aag ccc tct
ccg gcg cac gtg gcg tat cgc 432Glu Arg Asp Gly Phe Phe Lys Pro Ser
Pro Ala His Val Ala Tyr Arg 130 135
140 ttc gcc gag ctc gcg gcg atg tac gct ctc
ggg acg tac ctg atg tac 480Phe Ala Glu Leu Ala Ala Met Tyr Ala Leu
Gly Thr Tyr Leu Met Tyr 145 150
155 160 gct cga tac gtc gtc tcc tcg gtg ctc gtg
tac gct tgc ttt ttc ggc 528Ala Arg Tyr Val Val Ser Ser Val Leu Val
Tyr Ala Cys Phe Phe Gly 165 170
175 gcc cga tgc ggt tgg gtg cag cac gag ggc gga
cac agc tcg ctg acg 576Ala Arg Cys Gly Trp Val Gln His Glu Gly Gly
His Ser Ser Leu Thr 180 185
190 ggc aac att tgg tgg gac aag cgc atc cag gcc ttc
aca gcc ggg ttc 624Gly Asn Ile Trp Trp Asp Lys Arg Ile Gln Ala Phe
Thr Ala Gly Phe 195 200
205 ggt ctc gcc ggt agc ggc gac atg tgg aac tcg atg
cac aac aag cat 672Gly Leu Ala Gly Ser Gly Asp Met Trp Asn Ser Met
His Asn Lys His 210 215 220
cac gcg acg cct caa aag gtt cgt cac gac atg gat ctg
gac acc acc 720His Ala Thr Pro Gln Lys Val Arg His Asp Met Asp Leu
Asp Thr Thr 225 230 235
240 ccc gcg gtg gcg ttc ttc aac acc gcg gtg gaa gac aat cgt
ccc cgt 768Pro Ala Val Ala Phe Phe Asn Thr Ala Val Glu Asp Asn Arg
Pro Arg 245 250
255 ggc ttt agc aag tac tgg ttg cgc ctt cag gcg tgg acc ttc
atc ccc 816Gly Phe Ser Lys Tyr Trp Leu Arg Leu Gln Ala Trp Thr Phe
Ile Pro 260 265 270
gtg acg tcc ggc ttg gtg ctc ctt ttc tgg atg ttt ttc ctc cac
ccc 864Val Thr Ser Gly Leu Val Leu Leu Phe Trp Met Phe Phe Leu His
Pro 275 280 285
tcc aag gct ttg aag ggt ggc aag tac gaa gag ttg gtg tgg atg ctc
912Ser Lys Ala Leu Lys Gly Gly Lys Tyr Glu Glu Leu Val Trp Met Leu
290 295 300
gcc gcg cac gtc atc cgc acg tgg acg atc aag gcg gtg acc gga ttc
960Ala Ala His Val Ile Arg Thr Trp Thr Ile Lys Ala Val Thr Gly Phe
305 310 315 320
acc gcg atg cag tcc tac ggc tta ttt ttg gcg acg agc tgg gtg agc
1008Thr Ala Met Gln Ser Tyr Gly Leu Phe Leu Ala Thr Ser Trp Val Ser
325 330 335
ggc tgc tat ctg ttt gca cac ttc tcc acg tcg cac acg cac ctg gat
1056Gly Cys Tyr Leu Phe Ala His Phe Ser Thr Ser His Thr His Leu Asp
340 345 350
gtg gtg ccc gcg gac gag cat ctc tcc tgg gtt cga tac gcc gtc gat
1104Val Val Pro Ala Asp Glu His Leu Ser Trp Val Arg Tyr Ala Val Asp
355 360 365
cac acg atc gac atc gat ccg agt caa ggt tgg gtg aac tgg ttg atg
1152His Thr Ile Asp Ile Asp Pro Ser Gln Gly Trp Val Asn Trp Leu Met
370 375 380
ggc tac ctc aac tgc caa gtc atc cac cac ctc ttt ccg agc atg ccg
1200Gly Tyr Leu Asn Cys Gln Val Ile His His Leu Phe Pro Ser Met Pro
385 390 395 400
cag ttc cgc cag ccc gag gta tct cgc cgc ttc gtc gcc ttt gcg aaa
1248Gln Phe Arg Gln Pro Glu Val Ser Arg Arg Phe Val Ala Phe Ala Lys
405 410 415
aag tgg aac ctc aac tac aag gtc atg acc tac gcc ggt gcg tgg aag
1296Lys Trp Asn Leu Asn Tyr Lys Val Met Thr Tyr Ala Gly Ala Trp Lys
420 425 430
gca acg ctc gga aac ctc gac aac gtg ggt aag cac tac tac gtg cac
1344Ala Thr Leu Gly Asn Leu Asp Asn Val Gly Lys His Tyr Tyr Val His
435 440 445
ggc caa cac tcc gga aag acg gcg taa
1371Gly Gln His Ser Gly Lys Thr Ala
450 455
90456PRTOstreococcus tauri 90Met Cys Val Glu Thr Glu Asn Asn Asp Gly Ile
Pro Thr Val Glu Ile 1 5 10
15 Ala Phe Asp Gly Glu Arg Glu Arg Ala Glu Ala Asn Val Lys Leu Ser
20 25 30 Ala Glu
Lys Met Glu Pro Ala Ala Leu Ala Lys Thr Phe Ala Arg Arg 35
40 45 Tyr Val Val Ile Glu Gly Val
Glu Tyr Asp Val Thr Asp Phe Lys His 50 55
60 Pro Gly Gly Thr Val Ile Phe Tyr Ala Leu Ser Asn
Thr Gly Ala Asp 65 70 75
80 Ala Thr Glu Ala Phe Lys Glu Phe His His Arg Ser Arg Lys Ala Arg
85 90 95 Lys Ala Leu
Ala Ala Leu Pro Ser Arg Pro Ala Lys Thr Ala Lys Val 100
105 110 Asp Asp Ala Glu Met Leu Gln Asp
Phe Ala Lys Trp Arg Lys Glu Leu 115 120
125 Glu Arg Asp Gly Phe Phe Lys Pro Ser Pro Ala His Val
Ala Tyr Arg 130 135 140
Phe Ala Glu Leu Ala Ala Met Tyr Ala Leu Gly Thr Tyr Leu Met Tyr 145
150 155 160 Ala Arg Tyr Val
Val Ser Ser Val Leu Val Tyr Ala Cys Phe Phe Gly 165
170 175 Ala Arg Cys Gly Trp Val Gln His Glu
Gly Gly His Ser Ser Leu Thr 180 185
190 Gly Asn Ile Trp Trp Asp Lys Arg Ile Gln Ala Phe Thr Ala
Gly Phe 195 200 205
Gly Leu Ala Gly Ser Gly Asp Met Trp Asn Ser Met His Asn Lys His 210
215 220 His Ala Thr Pro Gln
Lys Val Arg His Asp Met Asp Leu Asp Thr Thr 225 230
235 240 Pro Ala Val Ala Phe Phe Asn Thr Ala Val
Glu Asp Asn Arg Pro Arg 245 250
255 Gly Phe Ser Lys Tyr Trp Leu Arg Leu Gln Ala Trp Thr Phe Ile
Pro 260 265 270 Val
Thr Ser Gly Leu Val Leu Leu Phe Trp Met Phe Phe Leu His Pro 275
280 285 Ser Lys Ala Leu Lys Gly
Gly Lys Tyr Glu Glu Leu Val Trp Met Leu 290 295
300 Ala Ala His Val Ile Arg Thr Trp Thr Ile Lys
Ala Val Thr Gly Phe 305 310 315
320 Thr Ala Met Gln Ser Tyr Gly Leu Phe Leu Ala Thr Ser Trp Val Ser
325 330 335 Gly Cys
Tyr Leu Phe Ala His Phe Ser Thr Ser His Thr His Leu Asp 340
345 350 Val Val Pro Ala Asp Glu His
Leu Ser Trp Val Arg Tyr Ala Val Asp 355 360
365 His Thr Ile Asp Ile Asp Pro Ser Gln Gly Trp Val
Asn Trp Leu Met 370 375 380
Gly Tyr Leu Asn Cys Gln Val Ile His His Leu Phe Pro Ser Met Pro 385
390 395 400 Gln Phe Arg
Gln Pro Glu Val Ser Arg Arg Phe Val Ala Phe Ala Lys 405
410 415 Lys Trp Asn Leu Asn Tyr Lys Val
Met Thr Tyr Ala Gly Ala Trp Lys 420 425
430 Ala Thr Leu Gly Asn Leu Asp Asn Val Gly Lys His Tyr
Tyr Val His 435 440 445
Gly Gln His Ser Gly Lys Thr Ala 450 455
91606DNAOstreococcus tauriCDS(1)..(606)delta5-desaturase 91atg tac ggt
ttg cta tcg ctc aag tcg tgc ttc gtc gac gat ttc aac 48Met Tyr Gly
Leu Leu Ser Leu Lys Ser Cys Phe Val Asp Asp Phe Asn 1
5 10 15 gcc tac ttc tcc
gga cgc atc ggc tgg gtc aag gtg atg aag ttc acc 96Ala Tyr Phe Ser
Gly Arg Ile Gly Trp Val Lys Val Met Lys Phe Thr 20
25 30 cgc ggc gag gcg atc
gca ttt tgg ggc acc aag ctc ttg tgg gcc gcg 144Arg Gly Glu Ala Ile
Ala Phe Trp Gly Thr Lys Leu Leu Trp Ala Ala 35
40 45 tat tac ctc gcg ttg ccg
cta aag atg tcg cat cgg ccg ctc gga gaa 192Tyr Tyr Leu Ala Leu Pro
Leu Lys Met Ser His Arg Pro Leu Gly Glu 50
55 60 ctc ctc gca ctc tgg gcc
gtc acc gag ttc gtc acc gga tgg ctg ttg 240Leu Leu Ala Leu Trp Ala
Val Thr Glu Phe Val Thr Gly Trp Leu Leu 65 70
75 80 gcg ttc atg ttc caa gtc gcc
cac gtc gtc ggc gag gtt cac ttc ttc 288Ala Phe Met Phe Gln Val Ala
His Val Val Gly Glu Val His Phe Phe 85
90 95 acc ctc gac gcg aag aac cgc gtg
aac ttg gga tgg gga gag gca cag 336Thr Leu Asp Ala Lys Asn Arg Val
Asn Leu Gly Trp Gly Glu Ala Gln 100
105 110 ctc atg tcg agc gcg gat ttc gcc
cac gga tcc aag ttt tgg acg cac 384Leu Met Ser Ser Ala Asp Phe Ala
His Gly Ser Lys Phe Trp Thr His 115 120
125 ttc tcc gga ggc tta aac tac caa gtc
gtc cac cat ctc ttc ccg ggc 432Phe Ser Gly Gly Leu Asn Tyr Gln Val
Val His His Leu Phe Pro Gly 130 135
140 gtc tgc cac gtg cac tat ccc gcg ctc gcg
cca att att aag gcg gca 480Val Cys His Val His Tyr Pro Ala Leu Ala
Pro Ile Ile Lys Ala Ala 145 150
155 160 gct gag aag cac ggc ctc cac tac cag att
tac ccc acg ttt tgg tcc 528Ala Glu Lys His Gly Leu His Tyr Gln Ile
Tyr Pro Thr Phe Trp Ser 165 170
175 gcc ctg cgc gcg cac ttc cgg cac ctc gcc aac
gtc ggc cgc gcc gcg 576Ala Leu Arg Ala His Phe Arg His Leu Ala Asn
Val Gly Arg Ala Ala 180 185
190 tac gta ccg tcc ctc caa acc gtc gga tga
606Tyr Val Pro Ser Leu Gln Thr Val Gly
195 200
92201PRTOstreococcus tauri 92Met Tyr Gly Leu Leu Ser
Leu Lys Ser Cys Phe Val Asp Asp Phe Asn 1 5
10 15 Ala Tyr Phe Ser Gly Arg Ile Gly Trp Val Lys
Val Met Lys Phe Thr 20 25
30 Arg Gly Glu Ala Ile Ala Phe Trp Gly Thr Lys Leu Leu Trp Ala
Ala 35 40 45 Tyr
Tyr Leu Ala Leu Pro Leu Lys Met Ser His Arg Pro Leu Gly Glu 50
55 60 Leu Leu Ala Leu Trp Ala
Val Thr Glu Phe Val Thr Gly Trp Leu Leu 65 70
75 80 Ala Phe Met Phe Gln Val Ala His Val Val Gly
Glu Val His Phe Phe 85 90
95 Thr Leu Asp Ala Lys Asn Arg Val Asn Leu Gly Trp Gly Glu Ala Gln
100 105 110 Leu Met
Ser Ser Ala Asp Phe Ala His Gly Ser Lys Phe Trp Thr His 115
120 125 Phe Ser Gly Gly Leu Asn Tyr
Gln Val Val His His Leu Phe Pro Gly 130 135
140 Val Cys His Val His Tyr Pro Ala Leu Ala Pro Ile
Ile Lys Ala Ala 145 150 155
160 Ala Glu Lys His Gly Leu His Tyr Gln Ile Tyr Pro Thr Phe Trp Ser
165 170 175 Ala Leu Arg
Ala His Phe Arg His Leu Ala Asn Val Gly Arg Ala Ala 180
185 190 Tyr Val Pro Ser Leu Gln Thr Val
Gly 195 200 93714DNAOstreococcus
tauriCDS(1)..(714)delta5-desaturase 93atg gtg agc cat cac tcg tac tgt aac
gac gcg gat ttg gat cag gat 48Met Val Ser His His Ser Tyr Cys Asn
Asp Ala Asp Leu Asp Gln Asp 1 5
10 15 gtg tac acc gca ctg ccg ctc ctg cgc
ctg gac ccg tct cag gag ttg 96Val Tyr Thr Ala Leu Pro Leu Leu Arg
Leu Asp Pro Ser Gln Glu Leu 20 25
30 aag tgg ttt cat cga tac cag gcg ttt tac
gcc ccg ctc atg tgg ccg 144Lys Trp Phe His Arg Tyr Gln Ala Phe Tyr
Ala Pro Leu Met Trp Pro 35 40
45 ttt ttg tgg ctc gcg gcg cag ttt ggc gac gcg
cag aac atc ctg atc 192Phe Leu Trp Leu Ala Ala Gln Phe Gly Asp Ala
Gln Asn Ile Leu Ile 50 55
60 gac cga gcg tcg ccg ggc gtc gcg tac aag gga
ttg atg gcg aac gag 240Asp Arg Ala Ser Pro Gly Val Ala Tyr Lys Gly
Leu Met Ala Asn Glu 65 70 75
80 gtc gcg ctg tac gtt ctc ggt aag gtt tta cac ttt
ggt ctt ctc ctc 288Val Ala Leu Tyr Val Leu Gly Lys Val Leu His Phe
Gly Leu Leu Leu 85 90
95 ggc gtt cct gcg tac ttg cac gga ttg tcc aac gcg atc
gtt cca ttc 336Gly Val Pro Ala Tyr Leu His Gly Leu Ser Asn Ala Ile
Val Pro Phe 100 105
110 ttg gcg tac ggc gca ttc ggc tcc ttc gtc ctg tgc tgg
ttc ttc atc 384Leu Ala Tyr Gly Ala Phe Gly Ser Phe Val Leu Cys Trp
Phe Phe Ile 115 120 125
gtc agc cat aac ctc gaa gcg ctg aca ccc gtt aac ctt aac
aag tcc 432Val Ser His Asn Leu Glu Ala Leu Thr Pro Val Asn Leu Asn
Lys Ser 130 135 140
acg aag aac gac tgg ggg gcg tgg cag atc gag aca tcg gcg tct
tgg 480Thr Lys Asn Asp Trp Gly Ala Trp Gln Ile Glu Thr Ser Ala Ser
Trp 145 150 155
160 ggc aac gcg ttc tgg agc ttc ttc tct gga ggt ctg aac ctg caa
atc 528Gly Asn Ala Phe Trp Ser Phe Phe Ser Gly Gly Leu Asn Leu Gln
Ile 165 170 175
gag cac cac ctc ttc ccg ggc atg gcg cac aac ctg tac ccg aag atg
576Glu His His Leu Phe Pro Gly Met Ala His Asn Leu Tyr Pro Lys Met
180 185 190
gtg ccg atc atc aag gac gag tgt gcg aaa gcg ggc gtt cgc tac acc
624Val Pro Ile Ile Lys Asp Glu Cys Ala Lys Ala Gly Val Arg Tyr Thr
195 200 205
ggt tac ggt ggc tac acc ggc ctg ctc ccg atc acc cgc gac atg ttc
672Gly Tyr Gly Gly Tyr Thr Gly Leu Leu Pro Ile Thr Arg Asp Met Phe
210 215 220
tcc tac ctc cat aag tgt ggc cga acg gcg aaa cta gcc taa
714Ser Tyr Leu His Lys Cys Gly Arg Thr Ala Lys Leu Ala
225 230 235
94237PRTOstreococcus tauri 94Met Val Ser His His Ser Tyr Cys Asn Asp Ala
Asp Leu Asp Gln Asp 1 5 10
15 Val Tyr Thr Ala Leu Pro Leu Leu Arg Leu Asp Pro Ser Gln Glu Leu
20 25 30 Lys Trp
Phe His Arg Tyr Gln Ala Phe Tyr Ala Pro Leu Met Trp Pro 35
40 45 Phe Leu Trp Leu Ala Ala Gln
Phe Gly Asp Ala Gln Asn Ile Leu Ile 50 55
60 Asp Arg Ala Ser Pro Gly Val Ala Tyr Lys Gly Leu
Met Ala Asn Glu 65 70 75
80 Val Ala Leu Tyr Val Leu Gly Lys Val Leu His Phe Gly Leu Leu Leu
85 90 95 Gly Val Pro
Ala Tyr Leu His Gly Leu Ser Asn Ala Ile Val Pro Phe 100
105 110 Leu Ala Tyr Gly Ala Phe Gly Ser
Phe Val Leu Cys Trp Phe Phe Ile 115 120
125 Val Ser His Asn Leu Glu Ala Leu Thr Pro Val Asn Leu
Asn Lys Ser 130 135 140
Thr Lys Asn Asp Trp Gly Ala Trp Gln Ile Glu Thr Ser Ala Ser Trp 145
150 155 160 Gly Asn Ala Phe
Trp Ser Phe Phe Ser Gly Gly Leu Asn Leu Gln Ile 165
170 175 Glu His His Leu Phe Pro Gly Met Ala
His Asn Leu Tyr Pro Lys Met 180 185
190 Val Pro Ile Ile Lys Asp Glu Cys Ala Lys Ala Gly Val Arg
Tyr Thr 195 200 205
Gly Tyr Gly Gly Tyr Thr Gly Leu Leu Pro Ile Thr Arg Asp Met Phe 210
215 220 Ser Tyr Leu His Lys
Cys Gly Arg Thr Ala Lys Leu Ala 225 230
235 95 1611DNAOstreococcus tauriCDS(1)..(1611)
delta4-desaturase 95atg tac ctc gga cgc ggc cgt ctc gag agc ggg acg acg
cga ggg atg 48Met Tyr Leu Gly Arg Gly Arg Leu Glu Ser Gly Thr Thr
Arg Gly Met 1 5 10
15 atg cgg acg cac gcg cgg cga ccg tcg acg acg tcg aat ccg
tgc gcg 96Met Arg Thr His Ala Arg Arg Pro Ser Thr Thr Ser Asn Pro
Cys Ala 20 25 30
cgg tca cgc gtg cgt aag acg acg gag cga tcg ctc gcg cga gtg
cga 144Arg Ser Arg Val Arg Lys Thr Thr Glu Arg Ser Leu Ala Arg Val
Arg 35 40 45
cga tcg acg agt gag aag gga agc gcg ctc gtg ctc gag cga gag agc
192Arg Ser Thr Ser Glu Lys Gly Ser Ala Leu Val Leu Glu Arg Glu Ser
50 55 60
gaa cgg gag aag gag gag gga ggg aaa gcg cga gcg gag gga ttg cga
240Glu Arg Glu Lys Glu Glu Gly Gly Lys Ala Arg Ala Glu Gly Leu Arg
65 70 75 80
ttc caa cgc ccg gac gtc gcc gcg ccg ggg gga gcg gat cct tgg aac
288Phe Gln Arg Pro Asp Val Ala Ala Pro Gly Gly Ala Asp Pro Trp Asn
85 90 95
gac gag aag tgg aca aag acc aag tgg acg gta ttc aga gac gtc gcg
336Asp Glu Lys Trp Thr Lys Thr Lys Trp Thr Val Phe Arg Asp Val Ala
100 105 110
tac gat ctc gat cct ttc ttc gct cga cac ccc gga gga gac tgg ctc
384Tyr Asp Leu Asp Pro Phe Phe Ala Arg His Pro Gly Gly Asp Trp Leu
115 120 125
ctg aac ttg gcc gtg gga cga gac tgc acc gcg ctc atc gaa tcc tat
432Leu Asn Leu Ala Val Gly Arg Asp Cys Thr Ala Leu Ile Glu Ser Tyr
130 135 140
cac ttg cga cca gag gtg gcg acg gct cgt ttc aga atg ctg ccc aaa
480His Leu Arg Pro Glu Val Ala Thr Ala Arg Phe Arg Met Leu Pro Lys
145 150 155 160
ctc gag gat ttt ccc gtc gag gcc gtg ccc aag tcc ccg aga ccg aac
528Leu Glu Asp Phe Pro Val Glu Ala Val Pro Lys Ser Pro Arg Pro Asn
165 170 175
gat tcg ccg tta tac aac aac att cgc aac cga gtc cgc gaa gag ctc
576Asp Ser Pro Leu Tyr Asn Asn Ile Arg Asn Arg Val Arg Glu Glu Leu
180 185 190
ttc cca gag gag gga aag aat atg cac aga cag ggc ggc gac cac ggc
624Phe Pro Glu Glu Gly Lys Asn Met His Arg Gln Gly Gly Asp His Gly
195 200 205
gac ggt gac gat tct ggg ttt cgc cgc ctt ttg ctt atg ccg tgt acc
672Asp Gly Asp Asp Ser Gly Phe Arg Arg Leu Leu Leu Met Pro Cys Thr
210 215 220
tat tcc ctt ccg ggg gtt cct ttc cgg ctg cct cct cgg gtc tcg cgg
720Tyr Ser Leu Pro Gly Val Pro Phe Arg Leu Pro Pro Arg Val Ser Arg
225 230 235 240
ggg cgt gga ttg gtc tca cga ttc agg cac tgc gcc aac cac ggc gcg
768Gly Arg Gly Leu Val Ser Arg Phe Arg His Cys Ala Asn His Gly Ala
245 250 255
atg tct cct tcg ccg gcc gtt aac ggc gtc ctc ggt ttg acg aac gat
816Met Ser Pro Ser Pro Ala Val Asn Gly Val Leu Gly Leu Thr Asn Asp
260 265 270
ctc atc ggc ggc tcg tcc ttg atg tgg aga tat cac cac caa gtc agc
864Leu Ile Gly Gly Ser Ser Leu Met Trp Arg Tyr His His Gln Val Ser
275 280 285
cac cac att cat tgc aac gac aac gcc atg gat caa gac gtg tac acg
912His His Ile His Cys Asn Asp Asn Ala Met Asp Gln Asp Val Tyr Thr
290 295 300
gcg atg cca tta ttg cgt ttc gac gct cgc cgg ccc aag tcc tgg tac
960Ala Met Pro Leu Leu Arg Phe Asp Ala Arg Arg Pro Lys Ser Trp Tyr
305 310 315 320
cat cgc ttc cag cag tgg tac atg ttt tta gcg ttc ccg ttg ttg cag
1008His Arg Phe Gln Gln Trp Tyr Met Phe Leu Ala Phe Pro Leu Leu Gln
325 330 335
gtt gcc ttc caa gtc gga gac att gcc gca ctg ttc acg cgt gat acc
1056Val Ala Phe Gln Val Gly Asp Ile Ala Ala Leu Phe Thr Arg Asp Thr
340 345 350
gaa ggc gct aag ctt cac ggg gcg acg acg tgg gag ctt acc acg gtt
1104Glu Gly Ala Lys Leu His Gly Ala Thr Thr Trp Glu Leu Thr Thr Val
355 360 365
gtc ctc ggt aag att gtg cac ttc ggt ctt ttg ttg ggg ccg ttg atg
1152Val Leu Gly Lys Ile Val His Phe Gly Leu Leu Leu Gly Pro Leu Met
370 375 380
aac cac gcg gtg agt tct gtt ttg ctg ggg atc gtc ggt ttc atg gcg
1200Asn His Ala Val Ser Ser Val Leu Leu Gly Ile Val Gly Phe Met Ala
385 390 395 400
tgc caa ggt ata gtt ctg gcg tgc acg ttt gct gtg agt cac aat gtc
1248Cys Gln Gly Ile Val Leu Ala Cys Thr Phe Ala Val Ser His Asn Val
405 410 415
gcg gag gcg aag ata cct gag gac acc gga gga gaa gcc tgg gag aga
1296Ala Glu Ala Lys Ile Pro Glu Asp Thr Gly Gly Glu Ala Trp Glu Arg
420 425 430
gat tgg ggt gtc cag cag ttg gtg act agc gcc gac tgg ggt gga aag
1344Asp Trp Gly Val Gln Gln Leu Val Thr Ser Ala Asp Trp Gly Gly Lys
435 440 445
ata ggt aac ttc ttc acg ggt ggc ctc aac ttg caa gtt gag cac cac
1392Ile Gly Asn Phe Phe Thr Gly Gly Leu Asn Leu Gln Val Glu His His
450 455 460
ttg ttt ccg gcg att tgc ttc gtc cac tac ccg gac atc gcg aag atc
1440Leu Phe Pro Ala Ile Cys Phe Val His Tyr Pro Asp Ile Ala Lys Ile
465 470 475 480
gtg aag gaa gaa gcg gcc aag ctc aac atc cct tac gcg tct tac agg
1488Val Lys Glu Glu Ala Ala Lys Leu Asn Ile Pro Tyr Ala Ser Tyr Arg
485 490 495
act ctt cct ggt att ttc gtc caa ttc tgg aga ttt atg aag gac atg
1536Thr Leu Pro Gly Ile Phe Val Gln Phe Trp Arg Phe Met Lys Asp Met
500 505 510
ggc acg gct gag caa att ggt gaa gtt cca ttg ccg aag att ccc aac
1584Gly Thr Ala Glu Gln Ile Gly Glu Val Pro Leu Pro Lys Ile Pro Asn
515 520 525
ccg cag ctc gcg ccg aag ctc gct tag
1611Pro Gln Leu Ala Pro Lys Leu Ala
530 535
96536PRTOstreococcus tauri 96Met Tyr Leu Gly Arg Gly Arg Leu Glu Ser Gly
Thr Thr Arg Gly Met 1 5 10
15 Met Arg Thr His Ala Arg Arg Pro Ser Thr Thr Ser Asn Pro Cys Ala
20 25 30 Arg Ser
Arg Val Arg Lys Thr Thr Glu Arg Ser Leu Ala Arg Val Arg 35
40 45 Arg Ser Thr Ser Glu Lys Gly
Ser Ala Leu Val Leu Glu Arg Glu Ser 50 55
60 Glu Arg Glu Lys Glu Glu Gly Gly Lys Ala Arg Ala
Glu Gly Leu Arg 65 70 75
80 Phe Gln Arg Pro Asp Val Ala Ala Pro Gly Gly Ala Asp Pro Trp Asn
85 90 95 Asp Glu Lys
Trp Thr Lys Thr Lys Trp Thr Val Phe Arg Asp Val Ala 100
105 110 Tyr Asp Leu Asp Pro Phe Phe Ala
Arg His Pro Gly Gly Asp Trp Leu 115 120
125 Leu Asn Leu Ala Val Gly Arg Asp Cys Thr Ala Leu Ile
Glu Ser Tyr 130 135 140
His Leu Arg Pro Glu Val Ala Thr Ala Arg Phe Arg Met Leu Pro Lys 145
150 155 160 Leu Glu Asp Phe
Pro Val Glu Ala Val Pro Lys Ser Pro Arg Pro Asn 165
170 175 Asp Ser Pro Leu Tyr Asn Asn Ile Arg
Asn Arg Val Arg Glu Glu Leu 180 185
190 Phe Pro Glu Glu Gly Lys Asn Met His Arg Gln Gly Gly Asp
His Gly 195 200 205
Asp Gly Asp Asp Ser Gly Phe Arg Arg Leu Leu Leu Met Pro Cys Thr 210
215 220 Tyr Ser Leu Pro Gly
Val Pro Phe Arg Leu Pro Pro Arg Val Ser Arg 225 230
235 240 Gly Arg Gly Leu Val Ser Arg Phe Arg His
Cys Ala Asn His Gly Ala 245 250
255 Met Ser Pro Ser Pro Ala Val Asn Gly Val Leu Gly Leu Thr Asn
Asp 260 265 270 Leu
Ile Gly Gly Ser Ser Leu Met Trp Arg Tyr His His Gln Val Ser 275
280 285 His His Ile His Cys Asn
Asp Asn Ala Met Asp Gln Asp Val Tyr Thr 290 295
300 Ala Met Pro Leu Leu Arg Phe Asp Ala Arg Arg
Pro Lys Ser Trp Tyr 305 310 315
320 His Arg Phe Gln Gln Trp Tyr Met Phe Leu Ala Phe Pro Leu Leu Gln
325 330 335 Val Ala
Phe Gln Val Gly Asp Ile Ala Ala Leu Phe Thr Arg Asp Thr 340
345 350 Glu Gly Ala Lys Leu His Gly
Ala Thr Thr Trp Glu Leu Thr Thr Val 355 360
365 Val Leu Gly Lys Ile Val His Phe Gly Leu Leu Leu
Gly Pro Leu Met 370 375 380
Asn His Ala Val Ser Ser Val Leu Leu Gly Ile Val Gly Phe Met Ala 385
390 395 400 Cys Gln Gly
Ile Val Leu Ala Cys Thr Phe Ala Val Ser His Asn Val 405
410 415 Ala Glu Ala Lys Ile Pro Glu Asp
Thr Gly Gly Glu Ala Trp Glu Arg 420 425
430 Asp Trp Gly Val Gln Gln Leu Val Thr Ser Ala Asp Trp
Gly Gly Lys 435 440 445
Ile Gly Asn Phe Phe Thr Gly Gly Leu Asn Leu Gln Val Glu His His 450
455 460 Leu Phe Pro Ala
Ile Cys Phe Val His Tyr Pro Asp Ile Ala Lys Ile 465 470
475 480 Val Lys Glu Glu Ala Ala Lys Leu Asn
Ile Pro Tyr Ala Ser Tyr Arg 485 490
495 Thr Leu Pro Gly Ile Phe Val Gln Phe Trp Arg Phe Met Lys
Asp Met 500 505 510
Gly Thr Ala Glu Gln Ile Gly Glu Val Pro Leu Pro Lys Ile Pro Asn
515 520 525 Pro Gln Leu Ala
Pro Lys Leu Ala 530 535 971455DNAThalassiosira
pseudonanaCDS(1)..(1455)delta6-desaturase 97atg gga aaa gga gga gac gca
gcc gca gct acc aag cgt agt gga gca 48Met Gly Lys Gly Gly Asp Ala
Ala Ala Ala Thr Lys Arg Ser Gly Ala 1 5
10 15 ttg aaa ttg gcg gag aag ccg cag
aag tac act tgg cag gag gtg aag 96Leu Lys Leu Ala Glu Lys Pro Gln
Lys Tyr Thr Trp Gln Glu Val Lys 20
25 30 aag cac atc acc ccc gac gat gcc
tgg gta gtc cac caa aac aaa gtc 144Lys His Ile Thr Pro Asp Asp Ala
Trp Val Val His Gln Asn Lys Val 35 40
45 tac gac gtc tcc aac tgg tac gac cac
ccc ggt gga gcc gtg gtg ttc 192Tyr Asp Val Ser Asn Trp Tyr Asp His
Pro Gly Gly Ala Val Val Phe 50 55
60 acc cac gcc gga gac gac atg acg gac atc
ttc gcc gcc ttc cac gcc 240Thr His Ala Gly Asp Asp Met Thr Asp Ile
Phe Ala Ala Phe His Ala 65 70
75 80 caa ggc tct cag gcc atg atg aag aag ttt
tac att gga gat ttg att 288Gln Gly Ser Gln Ala Met Met Lys Lys Phe
Tyr Ile Gly Asp Leu Ile 85 90
95 ccg gag agt gtg gag cat aag gat caa aga cag
ttg gat ttc gag aag 336Pro Glu Ser Val Glu His Lys Asp Gln Arg Gln
Leu Asp Phe Glu Lys 100 105
110 gga tat cgt gat tta cgg gcc aag ctt gtc atg atg
ggg atg ttc aag 384Gly Tyr Arg Asp Leu Arg Ala Lys Leu Val Met Met
Gly Met Phe Lys 115 120
125 tcg agt aag atg tat tat gca tac aag tgc tcg ttc
aat atg tgc atg 432Ser Ser Lys Met Tyr Tyr Ala Tyr Lys Cys Ser Phe
Asn Met Cys Met 130 135 140
tgg ttg gtg gcg gtg gcc atg gtg tac tac tcg gac agt
ttg gca atg 480Trp Leu Val Ala Val Ala Met Val Tyr Tyr Ser Asp Ser
Leu Ala Met 145 150 155
160 cac att gga tcg gct ctc ttg ttg gga ttg ttc tgg cag cag
tgt gga 528His Ile Gly Ser Ala Leu Leu Leu Gly Leu Phe Trp Gln Gln
Cys Gly 165 170
175 tgg ctt gcg cac gac ttt ctt cac cac caa gtc ttt aag caa
cga aag 576Trp Leu Ala His Asp Phe Leu His His Gln Val Phe Lys Gln
Arg Lys 180 185 190
tac gga gat ctc gtt ggc atc ttt tgg gga gat ctc atg cag ggg
ttc 624Tyr Gly Asp Leu Val Gly Ile Phe Trp Gly Asp Leu Met Gln Gly
Phe 195 200 205
tcg atg cag tgg tgg aag aac aag cac aat ggc cac cat gct gtt ccc
672Ser Met Gln Trp Trp Lys Asn Lys His Asn Gly His His Ala Val Pro
210 215 220
aac ttg cac aac tct tcc ttg gac agt cag gat ggt gat ccc gat att
720Asn Leu His Asn Ser Ser Leu Asp Ser Gln Asp Gly Asp Pro Asp Ile
225 230 235 240
gat acc atg cca ctc ctt gct tgg agt ctc aag cag gct cag agt ttc
768Asp Thr Met Pro Leu Leu Ala Trp Ser Leu Lys Gln Ala Gln Ser Phe
245 250 255
aga gag atc aat aag gga aag gac agt acc ttc gtc aag tac gct atc
816Arg Glu Ile Asn Lys Gly Lys Asp Ser Thr Phe Val Lys Tyr Ala Ile
260 265 270
aaa ttc cag gca ttc aca tac ttc ccc atc ctc ctc ttg gct cgc atc
864Lys Phe Gln Ala Phe Thr Tyr Phe Pro Ile Leu Leu Leu Ala Arg Ile
275 280 285
tct tgg ttg aat gaa tcc ttc aaa act gca ttc gga ctc gga gct gcc
912Ser Trp Leu Asn Glu Ser Phe Lys Thr Ala Phe Gly Leu Gly Ala Ala
290 295 300
tcg gag aat gcc aag ttg gag ttg gag aag cgt gga ctt cag tac cca
960Ser Glu Asn Ala Lys Leu Glu Leu Glu Lys Arg Gly Leu Gln Tyr Pro
305 310 315 320
ctt ttg gag aag ctt gga atc acc ctt cat tac act tgg atg ttc gtc
1008Leu Leu Glu Lys Leu Gly Ile Thr Leu His Tyr Thr Trp Met Phe Val
325 330 335
ctc tct tcc gga ttt gga agg tgg tct ctt cca tat tcc atc atg tat
1056Leu Ser Ser Gly Phe Gly Arg Trp Ser Leu Pro Tyr Ser Ile Met Tyr
340 345 350
ttc ttc act gcc aca tgc tcc tcg gga ctt ttc ctc gca ttg gtc ttt
1104Phe Phe Thr Ala Thr Cys Ser Ser Gly Leu Phe Leu Ala Leu Val Phe
355 360 365
gga ttg gga cac aac ggt atg tca gtg tac gat gcc acc acc cga cct
1152Gly Leu Gly His Asn Gly Met Ser Val Tyr Asp Ala Thr Thr Arg Pro
370 375 380
gac ttc tgg caa ctc caa gtc acc act aca cgt aac atc att ggt gga
1200Asp Phe Trp Gln Leu Gln Val Thr Thr Thr Arg Asn Ile Ile Gly Gly
385 390 395 400
cac ggc att ccc caa ttc ttt gtg gat tgg ttc tgc ggt gga ttg caa
1248His Gly Ile Pro Gln Phe Phe Val Asp Trp Phe Cys Gly Gly Leu Gln
405 410 415
tac caa gtg gat cac cac ctc ttc ccc atg atg cct aga aac aat atc
1296Tyr Gln Val Asp His His Leu Phe Pro Met Met Pro Arg Asn Asn Ile
420 425 430
gcg aaa tgc cac aag ctt gtg gag tca ttc tgt aag gag tgg ggt gtg
1344Ala Lys Cys His Lys Leu Val Glu Ser Phe Cys Lys Glu Trp Gly Val
435 440 445
aag tac cat gag gcc gat atg tgg gat ggt acc gtg gaa gtg ttg caa
1392Lys Tyr His Glu Ala Asp Met Trp Asp Gly Thr Val Glu Val Leu Gln
450 455 460
cat ctc tcc aag gtg tcg gat gat ttc ctt gtg gag atg gtg aag gat
1440His Leu Ser Lys Val Ser Asp Asp Phe Leu Val Glu Met Val Lys Asp
465 470 475 480
ttc cct gcc atg taa
1455Phe Pro Ala Met
98484PRTThalassiosira pseudonana 98Met Gly Lys Gly Gly Asp Ala Ala Ala
Ala Thr Lys Arg Ser Gly Ala 1 5 10
15 Leu Lys Leu Ala Glu Lys Pro Gln Lys Tyr Thr Trp Gln Glu
Val Lys 20 25 30
Lys His Ile Thr Pro Asp Asp Ala Trp Val Val His Gln Asn Lys Val
35 40 45 Tyr Asp Val Ser
Asn Trp Tyr Asp His Pro Gly Gly Ala Val Val Phe 50
55 60 Thr His Ala Gly Asp Asp Met Thr
Asp Ile Phe Ala Ala Phe His Ala 65 70
75 80 Gln Gly Ser Gln Ala Met Met Lys Lys Phe Tyr Ile
Gly Asp Leu Ile 85 90
95 Pro Glu Ser Val Glu His Lys Asp Gln Arg Gln Leu Asp Phe Glu Lys
100 105 110 Gly Tyr Arg
Asp Leu Arg Ala Lys Leu Val Met Met Gly Met Phe Lys 115
120 125 Ser Ser Lys Met Tyr Tyr Ala Tyr
Lys Cys Ser Phe Asn Met Cys Met 130 135
140 Trp Leu Val Ala Val Ala Met Val Tyr Tyr Ser Asp Ser
Leu Ala Met 145 150 155
160 His Ile Gly Ser Ala Leu Leu Leu Gly Leu Phe Trp Gln Gln Cys Gly
165 170 175 Trp Leu Ala His
Asp Phe Leu His His Gln Val Phe Lys Gln Arg Lys 180
185 190 Tyr Gly Asp Leu Val Gly Ile Phe Trp
Gly Asp Leu Met Gln Gly Phe 195 200
205 Ser Met Gln Trp Trp Lys Asn Lys His Asn Gly His His Ala
Val Pro 210 215 220
Asn Leu His Asn Ser Ser Leu Asp Ser Gln Asp Gly Asp Pro Asp Ile 225
230 235 240 Asp Thr Met Pro Leu
Leu Ala Trp Ser Leu Lys Gln Ala Gln Ser Phe 245
250 255 Arg Glu Ile Asn Lys Gly Lys Asp Ser Thr
Phe Val Lys Tyr Ala Ile 260 265
270 Lys Phe Gln Ala Phe Thr Tyr Phe Pro Ile Leu Leu Leu Ala Arg
Ile 275 280 285 Ser
Trp Leu Asn Glu Ser Phe Lys Thr Ala Phe Gly Leu Gly Ala Ala 290
295 300 Ser Glu Asn Ala Lys Leu
Glu Leu Glu Lys Arg Gly Leu Gln Tyr Pro 305 310
315 320 Leu Leu Glu Lys Leu Gly Ile Thr Leu His Tyr
Thr Trp Met Phe Val 325 330
335 Leu Ser Ser Gly Phe Gly Arg Trp Ser Leu Pro Tyr Ser Ile Met Tyr
340 345 350 Phe Phe
Thr Ala Thr Cys Ser Ser Gly Leu Phe Leu Ala Leu Val Phe 355
360 365 Gly Leu Gly His Asn Gly Met
Ser Val Tyr Asp Ala Thr Thr Arg Pro 370 375
380 Asp Phe Trp Gln Leu Gln Val Thr Thr Thr Arg Asn
Ile Ile Gly Gly 385 390 395
400 His Gly Ile Pro Gln Phe Phe Val Asp Trp Phe Cys Gly Gly Leu Gln
405 410 415 Tyr Gln Val
Asp His His Leu Phe Pro Met Met Pro Arg Asn Asn Ile 420
425 430 Ala Lys Cys His Lys Leu Val Glu
Ser Phe Cys Lys Glu Trp Gly Val 435 440
445 Lys Tyr His Glu Ala Asp Met Trp Asp Gly Thr Val Glu
Val Leu Gln 450 455 460
His Leu Ser Lys Val Ser Asp Asp Phe Leu Val Glu Met Val Lys Asp 465
470 475 480 Phe Pro Ala Met
991431DNAThalassiosira pseudonanaCDS(1)..(1431)delta5-desaturase 99atg
ccc ccc aac gcc gat atc tcc cgc atc cgc aac cgc atc ccc acc 48Met
Pro Pro Asn Ala Asp Ile Ser Arg Ile Arg Asn Arg Ile Pro Thr 1
5 10 15 aaa aca
ggt acc gtt gcc tct gcc gac aac aac gac ccc gcc acc caa 96Lys Thr
Gly Thr Val Ala Ser Ala Asp Asn Asn Asp Pro Ala Thr Gln
20 25 30 tcc gtc cga
acc ctc aaa tct ctc aag ggc aac gag gtc gtc atc aac 144Ser Val Arg
Thr Leu Lys Ser Leu Lys Gly Asn Glu Val Val Ile Asn 35
40 45 ggc aca att tat
gac att gct gac ttt gtc cat cct gga gga gag gtt 192Gly Thr Ile Tyr
Asp Ile Ala Asp Phe Val His Pro Gly Gly Glu Val 50
55 60 gtc aag ttc ttt ggt
ggg aat gat gtt act att cag tat aat atg att 240Val Lys Phe Phe Gly
Gly Asn Asp Val Thr Ile Gln Tyr Asn Met Ile 65
70 75 80 cat ccg tat cat acg
ggg aaa cat ctg gag aag atg aag gct gtt gga 288His Pro Tyr His Thr
Gly Lys His Leu Glu Lys Met Lys Ala Val Gly 85
90 95 aag gtt gta gat tgg cag
tcg gac tac aag ttc gac acc ccc ttt gaa 336Lys Val Val Asp Trp Gln
Ser Asp Tyr Lys Phe Asp Thr Pro Phe Glu 100
105 110 cga gag atc aaa tca gaa gtg
ttc aag atc gta cgt cgc ggg cgt gag 384Arg Glu Ile Lys Ser Glu Val
Phe Lys Ile Val Arg Arg Gly Arg Glu 115
120 125 ttc ggc aca aca ggc tac ttc
ctc cgt gcc ttt ttc tac atc gct ctc 432Phe Gly Thr Thr Gly Tyr Phe
Leu Arg Ala Phe Phe Tyr Ile Ala Leu 130 135
140 ttc ttc acc atg caa tac act ttc
gcc aca tgc acc acc ttc acc acc 480Phe Phe Thr Met Gln Tyr Thr Phe
Ala Thr Cys Thr Thr Phe Thr Thr 145 150
155 160 tac gat cac tgg tat cag agt ggt gta
ttc atc gca att gtg ttt ggt 528Tyr Asp His Trp Tyr Gln Ser Gly Val
Phe Ile Ala Ile Val Phe Gly 165
170 175 att tca cag gca ttc att ggg ttg aat
gtc cag cac gat gcc aat cac 576Ile Ser Gln Ala Phe Ile Gly Leu Asn
Val Gln His Asp Ala Asn His 180 185
190 gga gct gcc agt aag cgt ccc tgg gtg aat
gac ttg ttg gga ttt gga 624Gly Ala Ala Ser Lys Arg Pro Trp Val Asn
Asp Leu Leu Gly Phe Gly 195 200
205 acg gat ttg att gga tct aac aaa tgg aat tgg
atg gca cag cat tgg 672Thr Asp Leu Ile Gly Ser Asn Lys Trp Asn Trp
Met Ala Gln His Trp 210 215
220 act cat cac gct tac act aac cat agt gag aag
gat ccc gat agc ttc 720Thr His His Ala Tyr Thr Asn His Ser Glu Lys
Asp Pro Asp Ser Phe 225 230 235
240 agc tcg gaa cct atg ttt gca ttc aat gac tat ccc
att gga cac ccg 768Ser Ser Glu Pro Met Phe Ala Phe Asn Asp Tyr Pro
Ile Gly His Pro 245 250
255 aag aga aag tgg tgg cat agg ttc cag gga ggg tac ttc
ctc ttc atg 816Lys Arg Lys Trp Trp His Arg Phe Gln Gly Gly Tyr Phe
Leu Phe Met 260 265
270 ctt gga ctt tac tgg ctc tcg act gta ttc aat ccg caa
ttc att gat 864Leu Gly Leu Tyr Trp Leu Ser Thr Val Phe Asn Pro Gln
Phe Ile Asp 275 280 285
ctt cgt caa cgt ggg gct cag tac gtc gga att caa atg gag
aat gat 912Leu Arg Gln Arg Gly Ala Gln Tyr Val Gly Ile Gln Met Glu
Asn Asp 290 295 300
ttc att gtc aag agg agg aag tac gcc gtt gca ttg agg atg atg
tac 960Phe Ile Val Lys Arg Arg Lys Tyr Ala Val Ala Leu Arg Met Met
Tyr 305 310 315
320 att tac ttg aac att gtc agc ccc ttc atg aac aat ggt ttg agc
tgg 1008Ile Tyr Leu Asn Ile Val Ser Pro Phe Met Asn Asn Gly Leu Ser
Trp 325 330 335
tct acc ttt gga atc atc atg ttg atg gga atc agc gag agt ctc act
1056Ser Thr Phe Gly Ile Ile Met Leu Met Gly Ile Ser Glu Ser Leu Thr
340 345 350
ctc agt gtg ctc ttc tcg ttg tct cac aac ttc atc aat tcg gat cgt
1104Leu Ser Val Leu Phe Ser Leu Ser His Asn Phe Ile Asn Ser Asp Arg
355 360 365
gat cct acg gct gac ttc aaa aag acc gga gaa caa gtg tgc tgg ttc
1152Asp Pro Thr Ala Asp Phe Lys Lys Thr Gly Glu Gln Val Cys Trp Phe
370 375 380
aag tcg cag gtg gag act tcg tct acc tat ggg ggt ttt att tcc gga
1200Lys Ser Gln Val Glu Thr Ser Ser Thr Tyr Gly Gly Phe Ile Ser Gly
385 390 395 400
tgt ctt acg gga gga ctc aac ttt cag gtg gaa cat cat ctc ttt ccc
1248Cys Leu Thr Gly Gly Leu Asn Phe Gln Val Glu His His Leu Phe Pro
405 410 415
cgt atg agc agt gct tgg tat cct tac att gca cct acg gtt cgt gag
1296Arg Met Ser Ser Ala Trp Tyr Pro Tyr Ile Ala Pro Thr Val Arg Glu
420 425 430
gtt tgc aag aag cac ggg gtg aac tac gct tat tat cct tgg att ggg
1344Val Cys Lys Lys His Gly Val Asn Tyr Ala Tyr Tyr Pro Trp Ile Gly
435 440 445
cag aat ttg gta tca aca ttc aaa tac atg cat cgc gct ggt agt gga
1392Gln Asn Leu Val Ser Thr Phe Lys Tyr Met His Arg Ala Gly Ser Gly
450 455 460
gcc aac tgg gag ctc aag ccg ttg tct gga agt gcc taa
1431Ala Asn Trp Glu Leu Lys Pro Leu Ser Gly Ser Ala
465 470 475
100476PRTThalassiosira pseudonana 100Met Pro Pro Asn Ala Asp Ile Ser Arg
Ile Arg Asn Arg Ile Pro Thr 1 5 10
15 Lys Thr Gly Thr Val Ala Ser Ala Asp Asn Asn Asp Pro Ala
Thr Gln 20 25 30
Ser Val Arg Thr Leu Lys Ser Leu Lys Gly Asn Glu Val Val Ile Asn
35 40 45 Gly Thr Ile Tyr
Asp Ile Ala Asp Phe Val His Pro Gly Gly Glu Val 50
55 60 Val Lys Phe Phe Gly Gly Asn Asp
Val Thr Ile Gln Tyr Asn Met Ile 65 70
75 80 His Pro Tyr His Thr Gly Lys His Leu Glu Lys Met
Lys Ala Val Gly 85 90
95 Lys Val Val Asp Trp Gln Ser Asp Tyr Lys Phe Asp Thr Pro Phe Glu
100 105 110 Arg Glu Ile
Lys Ser Glu Val Phe Lys Ile Val Arg Arg Gly Arg Glu 115
120 125 Phe Gly Thr Thr Gly Tyr Phe Leu
Arg Ala Phe Phe Tyr Ile Ala Leu 130 135
140 Phe Phe Thr Met Gln Tyr Thr Phe Ala Thr Cys Thr Thr
Phe Thr Thr 145 150 155
160 Tyr Asp His Trp Tyr Gln Ser Gly Val Phe Ile Ala Ile Val Phe Gly
165 170 175 Ile Ser Gln Ala
Phe Ile Gly Leu Asn Val Gln His Asp Ala Asn His 180
185 190 Gly Ala Ala Ser Lys Arg Pro Trp Val
Asn Asp Leu Leu Gly Phe Gly 195 200
205 Thr Asp Leu Ile Gly Ser Asn Lys Trp Asn Trp Met Ala Gln
His Trp 210 215 220
Thr His His Ala Tyr Thr Asn His Ser Glu Lys Asp Pro Asp Ser Phe 225
230 235 240 Ser Ser Glu Pro Met
Phe Ala Phe Asn Asp Tyr Pro Ile Gly His Pro 245
250 255 Lys Arg Lys Trp Trp His Arg Phe Gln Gly
Gly Tyr Phe Leu Phe Met 260 265
270 Leu Gly Leu Tyr Trp Leu Ser Thr Val Phe Asn Pro Gln Phe Ile
Asp 275 280 285 Leu
Arg Gln Arg Gly Ala Gln Tyr Val Gly Ile Gln Met Glu Asn Asp 290
295 300 Phe Ile Val Lys Arg Arg
Lys Tyr Ala Val Ala Leu Arg Met Met Tyr 305 310
315 320 Ile Tyr Leu Asn Ile Val Ser Pro Phe Met Asn
Asn Gly Leu Ser Trp 325 330
335 Ser Thr Phe Gly Ile Ile Met Leu Met Gly Ile Ser Glu Ser Leu Thr
340 345 350 Leu Ser
Val Leu Phe Ser Leu Ser His Asn Phe Ile Asn Ser Asp Arg 355
360 365 Asp Pro Thr Ala Asp Phe Lys
Lys Thr Gly Glu Gln Val Cys Trp Phe 370 375
380 Lys Ser Gln Val Glu Thr Ser Ser Thr Tyr Gly Gly
Phe Ile Ser Gly 385 390 395
400 Cys Leu Thr Gly Gly Leu Asn Phe Gln Val Glu His His Leu Phe Pro
405 410 415 Arg Met Ser
Ser Ala Trp Tyr Pro Tyr Ile Ala Pro Thr Val Arg Glu 420
425 430 Val Cys Lys Lys His Gly Val Asn
Tyr Ala Tyr Tyr Pro Trp Ile Gly 435 440
445 Gln Asn Leu Val Ser Thr Phe Lys Tyr Met His Arg Ala
Gly Ser Gly 450 455 460
Ala Asn Trp Glu Leu Lys Pro Leu Ser Gly Ser Ala 465 470
475 1011449DNAThalassiosira
pseudonanaCDS(1)..(1449)delta5-desaturase 101atg cca ccc aac gcc gag gtc
aaa aac ctc cgt tca cgt tcc atc cca 48Met Pro Pro Asn Ala Glu Val
Lys Asn Leu Arg Ser Arg Ser Ile Pro 1 5
10 15 acg aag aag tcc agt tca tcg tca
tcc acc gcg aac gac gat ccg gct 96Thr Lys Lys Ser Ser Ser Ser Ser
Ser Thr Ala Asn Asp Asp Pro Ala 20
25 30 acc caa tcc acc tca cct gtg aac
cga acc ctc aag tct ttg aat gga 144Thr Gln Ser Thr Ser Pro Val Asn
Arg Thr Leu Lys Ser Leu Asn Gly 35 40
45 aac gaa ata gct att gac ggt gtc atc
tat gat att gat ggc ttt gtc 192Asn Glu Ile Ala Ile Asp Gly Val Ile
Tyr Asp Ile Asp Gly Phe Val 50 55
60 cat cct gga gga gag gtt att agc ttc ttt
gga ggc aac gat gtg act 240His Pro Gly Gly Glu Val Ile Ser Phe Phe
Gly Gly Asn Asp Val Thr 65 70
75 80 gta cag tac aaa atg att cat ccg tat cat
aat agt aag cat ctc gag 288Val Gln Tyr Lys Met Ile His Pro Tyr His
Asn Ser Lys His Leu Glu 85 90
95 aag atg aga gcc gtt gga aag att gca gac tac
tcc aca gag tac aag 336Lys Met Arg Ala Val Gly Lys Ile Ala Asp Tyr
Ser Thr Glu Tyr Lys 100 105
110 ttc gac aca ccc ttt gaa cga gag atc aaa tcc gaa
gtg ttc aaa atc 384Phe Asp Thr Pro Phe Glu Arg Glu Ile Lys Ser Glu
Val Phe Lys Ile 115 120
125 gtc cgt cga gga cgt gaa ttc ggt aca aca gga tat
ttc ctc cgt gcc 432Val Arg Arg Gly Arg Glu Phe Gly Thr Thr Gly Tyr
Phe Leu Arg Ala 130 135 140
ttc ttc tac att gct ctc ttc ttc acc atg caa tac acc
ttc gcc aca 480Phe Phe Tyr Ile Ala Leu Phe Phe Thr Met Gln Tyr Thr
Phe Ala Thr 145 150 155
160 tgc act acc ttc acc acc tac gat cat tgg tat caa agt ggt
gta ttc 528Cys Thr Thr Phe Thr Thr Tyr Asp His Trp Tyr Gln Ser Gly
Val Phe 165 170
175 atc gcc att gtg ttt ggt atc tca caa gct ttc att ggg ttg
aat gta 576Ile Ala Ile Val Phe Gly Ile Ser Gln Ala Phe Ile Gly Leu
Asn Val 180 185 190
caa cat gat gcc aat cac gga gct gct agc aaa cga cct tgg gtg
aat 624Gln His Asp Ala Asn His Gly Ala Ala Ser Lys Arg Pro Trp Val
Asn 195 200 205
gat ctc ctt gga tct gga gct gat ctc atc ggt gga tgc aaa tgg aac
672Asp Leu Leu Gly Ser Gly Ala Asp Leu Ile Gly Gly Cys Lys Trp Asn
210 215 220
tgg ttg gct cag cat tgg act cat cat gcg tat acc aat cac gct gat
720Trp Leu Ala Gln His Trp Thr His His Ala Tyr Thr Asn His Ala Asp
225 230 235 240
aaa gat cct gat agc ttt agt tcc gag ccg gtc ttc aac ttt aac gat
768Lys Asp Pro Asp Ser Phe Ser Ser Glu Pro Val Phe Asn Phe Asn Asp
245 250 255
tat ccc att ggt cac ccc aaa aga aag tgg tgg cat agg ttc caa ggg
816Tyr Pro Ile Gly His Pro Lys Arg Lys Trp Trp His Arg Phe Gln Gly
260 265 270
ctc tac ttc cta atc atg ctg agt ttc tat tgg gta tcg atg gta ttc
864Leu Tyr Phe Leu Ile Met Leu Ser Phe Tyr Trp Val Ser Met Val Phe
275 280 285
aac cca caa gtt atc gac ctc cgt cat gct gga gct gcc tac gtt gga
912Asn Pro Gln Val Ile Asp Leu Arg His Ala Gly Ala Ala Tyr Val Gly
290 295 300
ttt cag atg gag aac gac ttt atc gtc aaa cgg aga aag tat gca atg
960Phe Gln Met Glu Asn Asp Phe Ile Val Lys Arg Arg Lys Tyr Ala Met
305 310 315 320
gca ctt cgt gca atg tac ttc tat ttc aac atc tat tgt ccg att gtc
1008Ala Leu Arg Ala Met Tyr Phe Tyr Phe Asn Ile Tyr Cys Pro Ile Val
325 330 335
aac aat gga ttg act tgg tcg aca gtt gga atc atc ctc tta atg gga
1056Asn Asn Gly Leu Thr Trp Ser Thr Val Gly Ile Ile Leu Leu Met Gly
340 345 350
gtt agc gaa agc ttc atg ctc tcc ggt cta ttc gta ctc tca cac aac
1104Val Ser Glu Ser Phe Met Leu Ser Gly Leu Phe Val Leu Ser His Asn
355 360 365
ttt gaa aat tcc gaa cgt gat cct acc tct gag tat cgc aag act ggt
1152Phe Glu Asn Ser Glu Arg Asp Pro Thr Ser Glu Tyr Arg Lys Thr Gly
370 375 380
gag caa gta tgt tgg ttc aag tct caa gtg gag act tct tct acc tac
1200Glu Gln Val Cys Trp Phe Lys Ser Gln Val Glu Thr Ser Ser Thr Tyr
385 390 395 400
gga ggt atc gtt gct ggg tgt ctc act ggt gga ctc aac ttt caa gtg
1248Gly Gly Ile Val Ala Gly Cys Leu Thr Gly Gly Leu Asn Phe Gln Val
405 410 415
gag cat cat ttg ttc ccg agg atg agc agt gct tgg tat cct ttc atc
1296Glu His His Leu Phe Pro Arg Met Ser Ser Ala Trp Tyr Pro Phe Ile
420 425 430
gcg ccg aag gtt aga gag att tgt aag aag cat gga gtt aga tac gct
1344Ala Pro Lys Val Arg Glu Ile Cys Lys Lys His Gly Val Arg Tyr Ala
435 440 445
tac tat ccg tac atc tgg cag aac ttg cat tct acc gtg agt tac atg
1392Tyr Tyr Pro Tyr Ile Trp Gln Asn Leu His Ser Thr Val Ser Tyr Met
450 455 460
cat ggg acg gga acg gga gct aga tgg gag ctt cag ccg ttg tct gga
1440His Gly Thr Gly Thr Gly Ala Arg Trp Glu Leu Gln Pro Leu Ser Gly
465 470 475 480
agg gcg tag
1449Arg Ala
102482PRTThalassiosira pseudonana 102Met Pro Pro Asn Ala Glu Val Lys
Asn Leu Arg Ser Arg Ser Ile Pro 1 5 10
15 Thr Lys Lys Ser Ser Ser Ser Ser Ser Thr Ala Asn Asp
Asp Pro Ala 20 25 30
Thr Gln Ser Thr Ser Pro Val Asn Arg Thr Leu Lys Ser Leu Asn Gly
35 40 45 Asn Glu Ile Ala
Ile Asp Gly Val Ile Tyr Asp Ile Asp Gly Phe Val 50
55 60 His Pro Gly Gly Glu Val Ile Ser
Phe Phe Gly Gly Asn Asp Val Thr 65 70
75 80 Val Gln Tyr Lys Met Ile His Pro Tyr His Asn Ser
Lys His Leu Glu 85 90
95 Lys Met Arg Ala Val Gly Lys Ile Ala Asp Tyr Ser Thr Glu Tyr Lys
100 105 110 Phe Asp Thr
Pro Phe Glu Arg Glu Ile Lys Ser Glu Val Phe Lys Ile 115
120 125 Val Arg Arg Gly Arg Glu Phe Gly
Thr Thr Gly Tyr Phe Leu Arg Ala 130 135
140 Phe Phe Tyr Ile Ala Leu Phe Phe Thr Met Gln Tyr Thr
Phe Ala Thr 145 150 155
160 Cys Thr Thr Phe Thr Thr Tyr Asp His Trp Tyr Gln Ser Gly Val Phe
165 170 175 Ile Ala Ile Val
Phe Gly Ile Ser Gln Ala Phe Ile Gly Leu Asn Val 180
185 190 Gln His Asp Ala Asn His Gly Ala Ala
Ser Lys Arg Pro Trp Val Asn 195 200
205 Asp Leu Leu Gly Ser Gly Ala Asp Leu Ile Gly Gly Cys Lys
Trp Asn 210 215 220
Trp Leu Ala Gln His Trp Thr His His Ala Tyr Thr Asn His Ala Asp 225
230 235 240 Lys Asp Pro Asp Ser
Phe Ser Ser Glu Pro Val Phe Asn Phe Asn Asp 245
250 255 Tyr Pro Ile Gly His Pro Lys Arg Lys Trp
Trp His Arg Phe Gln Gly 260 265
270 Leu Tyr Phe Leu Ile Met Leu Ser Phe Tyr Trp Val Ser Met Val
Phe 275 280 285 Asn
Pro Gln Val Ile Asp Leu Arg His Ala Gly Ala Ala Tyr Val Gly 290
295 300 Phe Gln Met Glu Asn Asp
Phe Ile Val Lys Arg Arg Lys Tyr Ala Met 305 310
315 320 Ala Leu Arg Ala Met Tyr Phe Tyr Phe Asn Ile
Tyr Cys Pro Ile Val 325 330
335 Asn Asn Gly Leu Thr Trp Ser Thr Val Gly Ile Ile Leu Leu Met Gly
340 345 350 Val Ser
Glu Ser Phe Met Leu Ser Gly Leu Phe Val Leu Ser His Asn 355
360 365 Phe Glu Asn Ser Glu Arg Asp
Pro Thr Ser Glu Tyr Arg Lys Thr Gly 370 375
380 Glu Gln Val Cys Trp Phe Lys Ser Gln Val Glu Thr
Ser Ser Thr Tyr 385 390 395
400 Gly Gly Ile Val Ala Gly Cys Leu Thr Gly Gly Leu Asn Phe Gln Val
405 410 415 Glu His His
Leu Phe Pro Arg Met Ser Ser Ala Trp Tyr Pro Phe Ile 420
425 430 Ala Pro Lys Val Arg Glu Ile Cys
Lys Lys His Gly Val Arg Tyr Ala 435 440
445 Tyr Tyr Pro Tyr Ile Trp Gln Asn Leu His Ser Thr Val
Ser Tyr Met 450 455 460
His Gly Thr Gly Thr Gly Ala Arg Trp Glu Leu Gln Pro Leu Ser Gly 465
470 475 480 Arg Ala
1031512DNAThalassiosira pseudonanaCDS(1)..(1512)delta4-desaturase 103atg
tgc aac ggc aac ctc cca gca tcc acc gca cag ctc aag tcc acc 48Met
Cys Asn Gly Asn Leu Pro Ala Ser Thr Ala Gln Leu Lys Ser Thr 1
5 10 15 tcg aag
ccc cag cag caa cat gag cat cgc acc atc tcc aag tcc gag 96Ser Lys
Pro Gln Gln Gln His Glu His Arg Thr Ile Ser Lys Ser Glu
20 25 30 ctc gcc caa
cac aac acg ccc aaa tca gca tgg tgt gcc gtc cac tcc 144Leu Ala Gln
His Asn Thr Pro Lys Ser Ala Trp Cys Ala Val His Ser 35
40 45 act ccc gcc acc
gac cca tcc cac tcc aac aac aaa caa cac gca cac 192Thr Pro Ala Thr
Asp Pro Ser His Ser Asn Asn Lys Gln His Ala His 50
55 60 cta gtc ctc gac att
acc gac ttt gcg tcc cgc cat cca ggg gga gac 240Leu Val Leu Asp Ile
Thr Asp Phe Ala Ser Arg His Pro Gly Gly Asp 65
70 75 80 ctc atc ctc ctc gct
tcc ggc aaa gac gcc tcg gtg ctg ttt gaa aca 288Leu Ile Leu Leu Ala
Ser Gly Lys Asp Ala Ser Val Leu Phe Glu Thr 85
90 95 tac cat cca cgt gga gtt
ccg acg tct ctc att caa aag ctg cag att 336Tyr His Pro Arg Gly Val
Pro Thr Ser Leu Ile Gln Lys Leu Gln Ile 100
105 110 gga gtg atg gag gag gag gcg
ttt cgg gat tcg ttt tac agt tgg act 384Gly Val Met Glu Glu Glu Ala
Phe Arg Asp Ser Phe Tyr Ser Trp Thr 115
120 125 gat tct gac ttt tat act gtg
ttg aag agg agg gtt gtg gag cgg ttg 432Asp Ser Asp Phe Tyr Thr Val
Leu Lys Arg Arg Val Val Glu Arg Leu 130 135
140 gag gag agg ggg ttg gac agg agg
gga tcg aaa gag att tgg atc aag 480Glu Glu Arg Gly Leu Asp Arg Arg
Gly Ser Lys Glu Ile Trp Ile Lys 145 150
155 160 gct ttg ttc ttg ttg gtt gga ttt tgg
tac tgt ttg tac aag atg tat 528Ala Leu Phe Leu Leu Val Gly Phe Trp
Tyr Cys Leu Tyr Lys Met Tyr 165
170 175 act acg tcg gat atc gat cag tac ggt
att gcc att gcc tat tct att 576Thr Thr Ser Asp Ile Asp Gln Tyr Gly
Ile Ala Ile Ala Tyr Ser Ile 180 185
190 gga atg gga acc ttt gcg gca ttc atc ggc
acg tgt att caa cac gat 624Gly Met Gly Thr Phe Ala Ala Phe Ile Gly
Thr Cys Ile Gln His Asp 195 200
205 gga aat cac ggt gca ttc gct cag aac aag tta
ctc aac aag ttg gct 672Gly Asn His Gly Ala Phe Ala Gln Asn Lys Leu
Leu Asn Lys Leu Ala 210 215
220 ggg tgg acg ttg gat atg att ggt gcg agt gcg
ttt acg tgg gag ctt 720Gly Trp Thr Leu Asp Met Ile Gly Ala Ser Ala
Phe Thr Trp Glu Leu 225 230 235
240 cag cac atg ctg ggg cat cat cca tat acg aat gtg
ttg gat ggg gtg 768Gln His Met Leu Gly His His Pro Tyr Thr Asn Val
Leu Asp Gly Val 245 250
255 gag gag gag agg aag gag agg ggg gag gat gtt gct ttg
gaa gaa aag 816Glu Glu Glu Arg Lys Glu Arg Gly Glu Asp Val Ala Leu
Glu Glu Lys 260 265
270 gat cag gat ttt gaa gtt gcc aca tcc gga cga tta tat
cat att gat 864Asp Gln Asp Phe Glu Val Ala Thr Ser Gly Arg Leu Tyr
His Ile Asp 275 280 285
gcc aat gta cgt tat ggt tcg gta tgg aat gtc atg agg ttt
tgg gct 912Ala Asn Val Arg Tyr Gly Ser Val Trp Asn Val Met Arg Phe
Trp Ala 290 295 300
atg aag gtc att acg atg gga tat atg atg gga tta cca atc tac
ttt 960Met Lys Val Ile Thr Met Gly Tyr Met Met Gly Leu Pro Ile Tyr
Phe 305 310 315
320 cat gga gta ctg agg gga gtt gga ttg ttt gtt att ggg cat ttg
gcg 1008His Gly Val Leu Arg Gly Val Gly Leu Phe Val Ile Gly His Leu
Ala 325 330 335
tgt gga gag ttg ttg gcg acg atg ttt att gtg aat cac gtc att gag
1056Cys Gly Glu Leu Leu Ala Thr Met Phe Ile Val Asn His Val Ile Glu
340 345 350
ggt gtg agt tat gga acg aag gat ttg gtt ggt ggt gcg agt cat gta
1104Gly Val Ser Tyr Gly Thr Lys Asp Leu Val Gly Gly Ala Ser His Val
355 360 365
gat gag aag aag att gtc aag cca acg act gta ttg gga gat aca cca
1152Asp Glu Lys Lys Ile Val Lys Pro Thr Thr Val Leu Gly Asp Thr Pro
370 375 380
atg gta aag act cgc gag gag gca ttg aaa agc aac agc aat aac aac
1200Met Val Lys Thr Arg Glu Glu Ala Leu Lys Ser Asn Ser Asn Asn Asn
385 390 395 400
aag aag aag gga gag aag aac tcg gta cca tcc gtt cca ttc aac gac
1248Lys Lys Lys Gly Glu Lys Asn Ser Val Pro Ser Val Pro Phe Asn Asp
405 410 415
tgg gca gca gtc caa tgc cag acc tcc gtg aat tgg tct cca ggc tca
1296Trp Ala Ala Val Gln Cys Gln Thr Ser Val Asn Trp Ser Pro Gly Ser
420 425 430
tgg ttc tgg aat cac ttt tct ggg gga ctc tct cat cag att gag cat
1344Trp Phe Trp Asn His Phe Ser Gly Gly Leu Ser His Gln Ile Glu His
435 440 445
cac ttg ttc ccc agc att tgt cat aca aac tac tgt cat atc cag gat
1392His Leu Phe Pro Ser Ile Cys His Thr Asn Tyr Cys His Ile Gln Asp
450 455 460
gtt gtg gag agt acg tgt gct gag tac gga gtt ccg tat cag agt gag
1440Val Val Glu Ser Thr Cys Ala Glu Tyr Gly Val Pro Tyr Gln Ser Glu
465 470 475 480
agt aat ttg ttt gtt gct tat gga aag atg att agt cat ttg aag ttt
1488Ser Asn Leu Phe Val Ala Tyr Gly Lys Met Ile Ser His Leu Lys Phe
485 490 495
ttg ggt aaa gcc aag tgt gag tag
1512Leu Gly Lys Ala Lys Cys Glu
500
104503PRTThalassiosira pseudonana 104Met Cys Asn Gly Asn Leu Pro Ala Ser
Thr Ala Gln Leu Lys Ser Thr 1 5 10
15 Ser Lys Pro Gln Gln Gln His Glu His Arg Thr Ile Ser Lys
Ser Glu 20 25 30
Leu Ala Gln His Asn Thr Pro Lys Ser Ala Trp Cys Ala Val His Ser
35 40 45 Thr Pro Ala Thr
Asp Pro Ser His Ser Asn Asn Lys Gln His Ala His 50
55 60 Leu Val Leu Asp Ile Thr Asp Phe
Ala Ser Arg His Pro Gly Gly Asp 65 70
75 80 Leu Ile Leu Leu Ala Ser Gly Lys Asp Ala Ser Val
Leu Phe Glu Thr 85 90
95 Tyr His Pro Arg Gly Val Pro Thr Ser Leu Ile Gln Lys Leu Gln Ile
100 105 110 Gly Val Met
Glu Glu Glu Ala Phe Arg Asp Ser Phe Tyr Ser Trp Thr 115
120 125 Asp Ser Asp Phe Tyr Thr Val Leu
Lys Arg Arg Val Val Glu Arg Leu 130 135
140 Glu Glu Arg Gly Leu Asp Arg Arg Gly Ser Lys Glu Ile
Trp Ile Lys 145 150 155
160 Ala Leu Phe Leu Leu Val Gly Phe Trp Tyr Cys Leu Tyr Lys Met Tyr
165 170 175 Thr Thr Ser Asp
Ile Asp Gln Tyr Gly Ile Ala Ile Ala Tyr Ser Ile 180
185 190 Gly Met Gly Thr Phe Ala Ala Phe Ile
Gly Thr Cys Ile Gln His Asp 195 200
205 Gly Asn His Gly Ala Phe Ala Gln Asn Lys Leu Leu Asn Lys
Leu Ala 210 215 220
Gly Trp Thr Leu Asp Met Ile Gly Ala Ser Ala Phe Thr Trp Glu Leu 225
230 235 240 Gln His Met Leu Gly
His His Pro Tyr Thr Asn Val Leu Asp Gly Val 245
250 255 Glu Glu Glu Arg Lys Glu Arg Gly Glu Asp
Val Ala Leu Glu Glu Lys 260 265
270 Asp Gln Asp Phe Glu Val Ala Thr Ser Gly Arg Leu Tyr His Ile
Asp 275 280 285 Ala
Asn Val Arg Tyr Gly Ser Val Trp Asn Val Met Arg Phe Trp Ala 290
295 300 Met Lys Val Ile Thr Met
Gly Tyr Met Met Gly Leu Pro Ile Tyr Phe 305 310
315 320 His Gly Val Leu Arg Gly Val Gly Leu Phe Val
Ile Gly His Leu Ala 325 330
335 Cys Gly Glu Leu Leu Ala Thr Met Phe Ile Val Asn His Val Ile Glu
340 345 350 Gly Val
Ser Tyr Gly Thr Lys Asp Leu Val Gly Gly Ala Ser His Val 355
360 365 Asp Glu Lys Lys Ile Val Lys
Pro Thr Thr Val Leu Gly Asp Thr Pro 370 375
380 Met Val Lys Thr Arg Glu Glu Ala Leu Lys Ser Asn
Ser Asn Asn Asn 385 390 395
400 Lys Lys Lys Gly Glu Lys Asn Ser Val Pro Ser Val Pro Phe Asn Asp
405 410 415 Trp Ala Ala
Val Gln Cys Gln Thr Ser Val Asn Trp Ser Pro Gly Ser 420
425 430 Trp Phe Trp Asn His Phe Ser Gly
Gly Leu Ser His Gln Ile Glu His 435 440
445 His Leu Phe Pro Ser Ile Cys His Thr Asn Tyr Cys His
Ile Gln Asp 450 455 460
Val Val Glu Ser Thr Cys Ala Glu Tyr Gly Val Pro Tyr Gln Ser Glu 465
470 475 480 Ser Asn Leu Phe
Val Ala Tyr Gly Lys Met Ile Ser His Leu Lys Phe 485
490 495 Leu Gly Lys Ala Lys Cys Glu
500 1051257DNAThalassiosira
pseudonanaCDS(1)..(1257)omega3-desaturase 105atg tac aga tta aca tcc acc
ttc ctc atc gca ttg gca ttc tcc tcc 48Met Tyr Arg Leu Thr Ser Thr
Phe Leu Ile Ala Leu Ala Phe Ser Ser 1 5
10 15 tcc atc aat gcc ttc tct cca caa
cgg cca cca cgt act atc acc aaa 96Ser Ile Asn Ala Phe Ser Pro Gln
Arg Pro Pro Arg Thr Ile Thr Lys 20
25 30 agt aaa gtc caa agc acc gtg cta
ccc ata ccg acc aag gat gat ctg 144Ser Lys Val Gln Ser Thr Val Leu
Pro Ile Pro Thr Lys Asp Asp Leu 35 40
45 aac ttt ctc caa cca caa ctc gat gag
aat gat ctc tac ctc gac gat 192Asn Phe Leu Gln Pro Gln Leu Asp Glu
Asn Asp Leu Tyr Leu Asp Asp 50 55
60 gtc aac act cca cca aga gca ggt acc atc
atg aag atg ttg ccg aag 240Val Asn Thr Pro Pro Arg Ala Gly Thr Ile
Met Lys Met Leu Pro Lys 65 70
75 80 gaa acg ttc aac att gat aca gca act tca
ttg ggt tac ttt ggt atg 288Glu Thr Phe Asn Ile Asp Thr Ala Thr Ser
Leu Gly Tyr Phe Gly Met 85 90
95 gat atg gca gcg gtt gta tcg tcc atg acg ttg
cta aat gct att gta 336Asp Met Ala Ala Val Val Ser Ser Met Thr Leu
Leu Asn Ala Ile Val 100 105
110 act tcg gat cag tac cat gct ctt cca ctt cct ctc
caa gca gca aca 384Thr Ser Asp Gln Tyr His Ala Leu Pro Leu Pro Leu
Gln Ala Ala Thr 115 120
125 gtg att ccc ttt cag cta ttg gct ggg ttc gcc atg
tgg tgt atg tgg 432Val Ile Pro Phe Gln Leu Leu Ala Gly Phe Ala Met
Trp Cys Met Trp 130 135 140
tgc att gga cac gat gct gga cat tct act gtt tcg aag
aca aag tgg 480Cys Ile Gly His Asp Ala Gly His Ser Thr Val Ser Lys
Thr Lys Trp 145 150 155
160 atc aac cga gtc gtt ggt gaa gtg gct cat tct gtt gtt tgt
ctc acg 528Ile Asn Arg Val Val Gly Glu Val Ala His Ser Val Val Cys
Leu Thr 165 170
175 ccg ttc gtg cct tgg cag atg tcg cat agg aaa cac cat ttg
aat cac 576Pro Phe Val Pro Trp Gln Met Ser His Arg Lys His His Leu
Asn His 180 185 190
aat cat att gaa aag gac tac tct cat aag tgg tac agt cgc gac
gag 624Asn His Ile Glu Lys Asp Tyr Ser His Lys Trp Tyr Ser Arg Asp
Glu 195 200 205
ttt gat gat atc cca caa ctc tat aag aca ttt ggc tac aac cca aga
672Phe Asp Asp Ile Pro Gln Leu Tyr Lys Thr Phe Gly Tyr Asn Pro Arg
210 215 220
atg atg caa ctt cca ttc ctc tac ttc atg tat ctt gca ttg gga att
720Met Met Gln Leu Pro Phe Leu Tyr Phe Met Tyr Leu Ala Leu Gly Ile
225 230 235 240
cca gat ggt ggg cat gtt gtg ttc tac gga aga atg tgg gaa gga gtg
768Pro Asp Gly Gly His Val Val Phe Tyr Gly Arg Met Trp Glu Gly Val
245 250 255
tca ttg cag aag aag ttt gat gct gct att tct gtg gcc gta tca tgt
816Ser Leu Gln Lys Lys Phe Asp Ala Ala Ile Ser Val Ala Val Ser Cys
260 265 270
gca act gct gga tcg ctt tgg atg aat atg ggt aca gca gac ttc acg
864Ala Thr Ala Gly Ser Leu Trp Met Asn Met Gly Thr Ala Asp Phe Thr
275 280 285
gtg gta tgc atg gtt cct tgg cta gtt cta tcg tgg tgg ctc ttc atg
912Val Val Cys Met Val Pro Trp Leu Val Leu Ser Trp Trp Leu Phe Met
290 295 300
gta aca tac ctt cag cat cat tca gaa gac gga aag cta tac act gat
960Val Thr Tyr Leu Gln His His Ser Glu Asp Gly Lys Leu Tyr Thr Asp
305 310 315 320
gaa acg ttt aca ttt gaa aag gga gcc ttc gag acc gtg gat cgt tcg
1008Glu Thr Phe Thr Phe Glu Lys Gly Ala Phe Glu Thr Val Asp Arg Ser
325 330 335
tac ggc aag ttg atc aac cga atg tcg cat cac atg atg gac ggt cac
1056Tyr Gly Lys Leu Ile Asn Arg Met Ser His His Met Met Asp Gly His
340 345 350
gtg gtg cac cac ttg ttc ttt gaa cgt gta cct cac tac aga tta gag
1104Val Val His His Leu Phe Phe Glu Arg Val Pro His Tyr Arg Leu Glu
355 360 365
gca gct acc gaa gct ctt gtg aaa gga atg gat gaa acg gga cag aaa
1152Ala Ala Thr Glu Ala Leu Val Lys Gly Met Asp Glu Thr Gly Gln Lys
370 375 380
cat ttg tac aaa tac att gat act cct gat ttc aat gcc gag att gtc
1200His Leu Tyr Lys Tyr Ile Asp Thr Pro Asp Phe Asn Ala Glu Ile Val
385 390 395 400
aac gga ttt cgc gac aat tgg ttc ctt gtt gaa gag gag aac atc aaa
1248Asn Gly Phe Arg Asp Asn Trp Phe Leu Val Glu Glu Glu Asn Ile Lys
405 410 415
agg gag tag
1257Arg Glu
106418PRT Thalassiosira pseudonana 106 Met Tyr Arg Leu Thr Ser
Thr Phe Leu Ile Ala Leu Ala Phe Ser Ser 1 5
10 15 Ser Ile Asn Ala Phe Ser Pro Gln Arg Pro Pro
Arg Thr Ile Thr Lys 20 25
30 Ser Lys Val Gln Ser Thr Val Leu Pro Ile Pro Thr Lys Asp Asp
Leu 35 40 45 Asn
Phe Leu Gln Pro Gln Leu Asp Glu Asn Asp Leu Tyr Leu Asp Asp 50
55 60 Val Asn Thr Pro Pro Arg
Ala Gly Thr Ile Met Lys Met Leu Pro Lys 65 70
75 80 Glu Thr Phe Asn Ile Asp Thr Ala Thr Ser Leu
Gly Tyr Phe Gly Met 85 90
95 Asp Met Ala Ala Val Val Ser Ser Met Thr Leu Leu Asn Ala Ile Val
100 105 110 Thr Ser
Asp Gln Tyr His Ala Leu Pro Leu Pro Leu Gln Ala Ala Thr 115
120 125 Val Ile Pro Phe Gln Leu Leu
Ala Gly Phe Ala Met Trp Cys Met Trp 130 135
140 Cys Ile Gly His Asp Ala Gly His Ser Thr Val Ser
Lys Thr Lys Trp 145 150 155
160 Ile Asn Arg Val Val Gly Glu Val Ala His Ser Val Val Cys Leu Thr
165 170 175 Pro Phe Val
Pro Trp Gln Met Ser His Arg Lys His His Leu Asn His 180
185 190 Asn His Ile Glu Lys Asp Tyr Ser
His Lys Trp Tyr Ser Arg Asp Glu 195 200
205 Phe Asp Asp Ile Pro Gln Leu Tyr Lys Thr Phe Gly Tyr
Asn Pro Arg 210 215 220
Met Met Gln Leu Pro Phe Leu Tyr Phe Met Tyr Leu Ala Leu Gly Ile 225
230 235 240 Pro Asp Gly Gly
His Val Val Phe Tyr Gly Arg Met Trp Glu Gly Val 245
250 255 Ser Leu Gln Lys Lys Phe Asp Ala Ala
Ile Ser Val Ala Val Ser Cys 260 265
270 Ala Thr Ala Gly Ser Leu Trp Met Asn Met Gly Thr Ala Asp
Phe Thr 275 280 285
Val Val Cys Met Val Pro Trp Leu Val Leu Ser Trp Trp Leu Phe Met 290
295 300 Val Thr Tyr Leu Gln
His His Ser Glu Asp Gly Lys Leu Tyr Thr Asp 305 310
315 320 Glu Thr Phe Thr Phe Glu Lys Gly Ala Phe
Glu Thr Val Asp Arg Ser 325 330
335 Tyr Gly Lys Leu Ile Asn Arg Met Ser His His Met Met Asp Gly
His 340 345 350 Val
Val His His Leu Phe Phe Glu Arg Val Pro His Tyr Arg Leu Glu 355
360 365 Ala Ala Thr Glu Ala Leu
Val Lys Gly Met Asp Glu Thr Gly Gln Lys 370 375
380 His Leu Tyr Lys Tyr Ile Asp Thr Pro Asp Phe
Asn Ala Glu Ile Val 385 390 395
400 Asn Gly Phe Arg Asp Asn Trp Phe Leu Val Glu Glu Glu Asn Ile Lys
405 410 415 Arg Glu
1071086DNAOstreococcus tauriCDS(1)..(1086)delta12-desaturase 107atg cag
gag ggg gtg cga aac att ccg aac gag tgc ttt gag acg gga 48Met Gln
Glu Gly Val Arg Asn Ile Pro Asn Glu Cys Phe Glu Thr Gly 1
5 10 15 cat ctt gaa
aga ccc tgg cgt tcc ggc cgg tgt ggg cgc gat ccc ggt 96His Leu Glu
Arg Pro Trp Arg Ser Gly Arg Cys Gly Arg Asp Pro Gly
20 25 30 tcg aat tgg
ggc gct ggc ttc cgc ttt ttt tcg ctc aag ggg ttt tgg 144Ser Asn Trp
Gly Ala Gly Phe Arg Phe Phe Ser Leu Lys Gly Phe Trp 35
40 45 tgg ccg gcg tgg
tgg gcg tac gcg ttc gtg acg ggg acg gcg gcc act 192Trp Pro Ala Trp
Trp Ala Tyr Ala Phe Val Thr Gly Thr Ala Ala Thr 50
55 60 ggg tgt tgg gtc gcc
gcg cac gag tgc ggg cac ggc gcg ttc agc gat 240Gly Cys Trp Val Ala
Ala His Glu Cys Gly His Gly Ala Phe Ser Asp 65
70 75 80 aac aag acg ttg caa
gat gcg gtt gga tac gtg ttg cac tcg ttg ctc 288Asn Lys Thr Leu Gln
Asp Ala Val Gly Tyr Val Leu His Ser Leu Leu 85
90 95 ttg gtg ccg tac ttt tct
tgg cag cga tca cac gcg gtg cat cac tcg 336Leu Val Pro Tyr Phe Ser
Trp Gln Arg Ser His Ala Val His His Ser 100
105 110 agg acg aat cac gtt ctt gag
ggc gag acg cac gtg ccg gcg cgc ttg 384Arg Thr Asn His Val Leu Glu
Gly Glu Thr His Val Pro Ala Arg Leu 115
120 125 ggg acg gaa gac gcc aac gtc
gtg ttc aag ctt cgc gaa ttg atc ggt 432Gly Thr Glu Asp Ala Asn Val
Val Phe Lys Leu Arg Glu Leu Ile Gly 130 135
140 gaa ggg ccg ttc acg ttt ttc aac
ctc gtc ggc gtc ttc gcg ctc gga 480Glu Gly Pro Phe Thr Phe Phe Asn
Leu Val Gly Val Phe Ala Leu Gly 145 150
155 160 tgg ccg att tac ttg ctc acc ggc gcg
agc ggc gga ccg gtg cgc ggt 528Trp Pro Ile Tyr Leu Leu Thr Gly Ala
Ser Gly Gly Pro Val Arg Gly 165
170 175 aac acg aac cac ttc tta ccc ttc atg
ggc gag aaa ggt aag cac gcg 576Asn Thr Asn His Phe Leu Pro Phe Met
Gly Glu Lys Gly Lys His Ala 180 185
190 ctg ttc ccg ggt aag tgg gcg aag aag gtg
tgg cag tct gac atc ggc 624Leu Phe Pro Gly Lys Trp Ala Lys Lys Val
Trp Gln Ser Asp Ile Gly 195 200
205 gtt gtt gcc gtc ctg ggc gcg ctc gcg gct tgg
gcg gcg cac agc ggg 672Val Val Ala Val Leu Gly Ala Leu Ala Ala Trp
Ala Ala His Ser Gly 210 215
220 att gcc aca gtg atg gca ctc tac gtc ggc ccg
tac atg gtg acc aac 720Ile Ala Thr Val Met Ala Leu Tyr Val Gly Pro
Tyr Met Val Thr Asn 225 230 235
240 ttt tgg ctc gtc ttg tac acg tgg tta cag cac acc
gac gtt gac gtg 768Phe Trp Leu Val Leu Tyr Thr Trp Leu Gln His Thr
Asp Val Asp Val 245 250
255 ccg cac ttc gag ggc gac gat tgg aac ttg gtc aag ggg
gca ttc atg 816Pro His Phe Glu Gly Asp Asp Trp Asn Leu Val Lys Gly
Ala Phe Met 260 265
270 acg atc gat cgc ccg tac ggc cca gtt ttt gat ttc ttg
cac cac cgc 864Thr Ile Asp Arg Pro Tyr Gly Pro Val Phe Asp Phe Leu
His His Arg 275 280 285
atc ggc agc acg cac gtc gcg cac cac atc aac aca cca ttc
ccg cat 912Ile Gly Ser Thr His Val Ala His His Ile Asn Thr Pro Phe
Pro His 290 295 300
tac aag gct caa atg gcg acg gat gcg cta aag gag gcg tat ccc
gac 960Tyr Lys Ala Gln Met Ala Thr Asp Ala Leu Lys Glu Ala Tyr Pro
Asp 305 310 315
320 ctc tac ctt tac gat cca act ccg atc gcg acc gct acg tgg cgc
gtg 1008Leu Tyr Leu Tyr Asp Pro Thr Pro Ile Ala Thr Ala Thr Trp Arg
Val 325 330 335
ggg agc aag tgc atc gcc gtc gtg aag aag gga gac gaa tgg gtg ttc
1056Gly Ser Lys Cys Ile Ala Val Val Lys Lys Gly Asp Glu Trp Val Phe
340 345 350
acg gat aag caa ctc ccg gtc gcg gcg tga
1086Thr Asp Lys Gln Leu Pro Val Ala Ala
355 360
108361PRTOstreococcus tauri 108Met Gln Glu Gly Val Arg Asn Ile Pro Asn
Glu Cys Phe Glu Thr Gly 1 5 10
15 His Leu Glu Arg Pro Trp Arg Ser Gly Arg Cys Gly Arg Asp Pro
Gly 20 25 30 Ser
Asn Trp Gly Ala Gly Phe Arg Phe Phe Ser Leu Lys Gly Phe Trp 35
40 45 Trp Pro Ala Trp Trp Ala
Tyr Ala Phe Val Thr Gly Thr Ala Ala Thr 50 55
60 Gly Cys Trp Val Ala Ala His Glu Cys Gly His
Gly Ala Phe Ser Asp 65 70 75
80 Asn Lys Thr Leu Gln Asp Ala Val Gly Tyr Val Leu His Ser Leu Leu
85 90 95 Leu Val
Pro Tyr Phe Ser Trp Gln Arg Ser His Ala Val His His Ser 100
105 110 Arg Thr Asn His Val Leu Glu
Gly Glu Thr His Val Pro Ala Arg Leu 115 120
125 Gly Thr Glu Asp Ala Asn Val Val Phe Lys Leu Arg
Glu Leu Ile Gly 130 135 140
Glu Gly Pro Phe Thr Phe Phe Asn Leu Val Gly Val Phe Ala Leu Gly 145
150 155 160 Trp Pro Ile
Tyr Leu Leu Thr Gly Ala Ser Gly Gly Pro Val Arg Gly 165
170 175 Asn Thr Asn His Phe Leu Pro Phe
Met Gly Glu Lys Gly Lys His Ala 180 185
190 Leu Phe Pro Gly Lys Trp Ala Lys Lys Val Trp Gln Ser
Asp Ile Gly 195 200 205
Val Val Ala Val Leu Gly Ala Leu Ala Ala Trp Ala Ala His Ser Gly 210
215 220 Ile Ala Thr Val
Met Ala Leu Tyr Val Gly Pro Tyr Met Val Thr Asn 225 230
235 240 Phe Trp Leu Val Leu Tyr Thr Trp Leu
Gln His Thr Asp Val Asp Val 245 250
255 Pro His Phe Glu Gly Asp Asp Trp Asn Leu Val Lys Gly Ala
Phe Met 260 265 270
Thr Ile Asp Arg Pro Tyr Gly Pro Val Phe Asp Phe Leu His His Arg
275 280 285 Ile Gly Ser Thr
His Val Ala His His Ile Asn Thr Pro Phe Pro His 290
295 300 Tyr Lys Ala Gln Met Ala Thr Asp
Ala Leu Lys Glu Ala Tyr Pro Asp 305 310
315 320 Leu Tyr Leu Tyr Asp Pro Thr Pro Ile Ala Thr Ala
Thr Trp Arg Val 325 330
335 Gly Ser Lys Cys Ile Ala Val Val Lys Lys Gly Asp Glu Trp Val Phe
340 345 350 Thr Asp Lys
Gln Leu Pro Val Ala Ala 355 360
1091305DNAThalassiosira pseudonanaCDS(1)..(1305)delta12-desaturase 109atg
gga aag gga gga aga tca gta acc cgc gct caa aca gca gaa aag 48Met
Gly Lys Gly Gly Arg Ser Val Thr Arg Ala Gln Thr Ala Glu Lys 1
5 10 15 tca gca
cac acc atc caa acc ttc acc gac ggc cga tgg gtc tcc ccc 96Ser Ala
His Thr Ile Gln Thr Phe Thr Asp Gly Arg Trp Val Ser Pro
20 25 30 tac aac ccc
ctc gca aaa gat gca cct gaa ctc ccc tcc aag ggt gaa 144Tyr Asn Pro
Leu Ala Lys Asp Ala Pro Glu Leu Pro Ser Lys Gly Glu 35
40 45 atc aag gcg gtc
atc ccc aaa gag tgc ttc gaa cga agc tac ctc cac 192Ile Lys Ala Val
Ile Pro Lys Glu Cys Phe Glu Arg Ser Tyr Leu His 50
55 60 tcc atg tac ttc gtc
ctc cgt gac acc gtc atg gcc gtg gcc tgc gcc 240Ser Met Tyr Phe Val
Leu Arg Asp Thr Val Met Ala Val Ala Cys Ala 65
70 75 80 tac atc gcc cac tca
acg ctc tcc acc gat att ccc tcc gag tta ctg 288Tyr Ile Ala His Ser
Thr Leu Ser Thr Asp Ile Pro Ser Glu Leu Leu 85
90 95 agc gtg gac gca ctc aaa
tgg ttc ctc gga tgg aac acc tac gcc ttt 336Ser Val Asp Ala Leu Lys
Trp Phe Leu Gly Trp Asn Thr Tyr Ala Phe 100
105 110 tgg atg ggg tgc att ctc acc
gga cac tgg gtc cta gcc cat gaa tgt 384Trp Met Gly Cys Ile Leu Thr
Gly His Trp Val Leu Ala His Glu Cys 115
120 125 gga cat ggt gca ttc tct ccc
tct cag acg ttt aat gac ttt tgg ggg 432Gly His Gly Ala Phe Ser Pro
Ser Gln Thr Phe Asn Asp Phe Trp Gly 130 135
140 ttc att atg cat cag gcg gtg ttg
gtt ccg tat ttc gcc tgg cag tac 480Phe Ile Met His Gln Ala Val Leu
Val Pro Tyr Phe Ala Trp Gln Tyr 145 150
155 160 tct cat gcg aag cat cat cga cgt acc
aac aac att atg gat ggg gag 528Ser His Ala Lys His His Arg Arg Thr
Asn Asn Ile Met Asp Gly Glu 165
170 175 agc cat gtg ccc aat atc gcc aag gaa
atg gga ttg aac gag aag aat 576Ser His Val Pro Asn Ile Ala Lys Glu
Met Gly Leu Asn Glu Lys Asn 180 185
190 gag cgc agt gga gga tat gcc gcc att cat
gag gct att gga gat gga 624Glu Arg Ser Gly Gly Tyr Ala Ala Ile His
Glu Ala Ile Gly Asp Gly 195 200
205 ccc ttt gcg atg ttt caa atc ttt gct cac ttg
gtg atc ggg tgg cct 672Pro Phe Ala Met Phe Gln Ile Phe Ala His Leu
Val Ile Gly Trp Pro 210 215
220 att tac ttg atg gga ttt gct tcc act gga cgt
ctc ggt cag gat ggg 720Ile Tyr Leu Met Gly Phe Ala Ser Thr Gly Arg
Leu Gly Gln Asp Gly 225 230 235
240 aag gaa ctt cag gct gga gag atc atc gac cat tac
cgt cct tgg agt 768Lys Glu Leu Gln Ala Gly Glu Ile Ile Asp His Tyr
Arg Pro Trp Ser 245 250
255 aag atg ttc ccc acc aag ttg cga ttc aaa att gct ctt
tcg aca ctt 816Lys Met Phe Pro Thr Lys Leu Arg Phe Lys Ile Ala Leu
Ser Thr Leu 260 265
270 gga gtg att gcc gcc tgg gtt ggg ttg tac ttt gct gca
caa gag tat 864Gly Val Ile Ala Ala Trp Val Gly Leu Tyr Phe Ala Ala
Gln Glu Tyr 275 280 285
gga gtc ttg ccc gtg gtt ctt tgg tac att ggc cca ctc atg
tgg aat 912Gly Val Leu Pro Val Val Leu Trp Tyr Ile Gly Pro Leu Met
Trp Asn 290 295 300
cag gcg tgg ctt gtg ctc tac act tgg ctt cag cac aat gat ccc
tcc 960Gln Ala Trp Leu Val Leu Tyr Thr Trp Leu Gln His Asn Asp Pro
Ser 305 310 315
320 gtg cct caa tat gga agt gac gaa tgg aca tgg gtc aag gga gct
ttg 1008Val Pro Gln Tyr Gly Ser Asp Glu Trp Thr Trp Val Lys Gly Ala
Leu 325 330 335
tcg acg att gat cgc ccg tat ggt atc ttt gac ttc ttc cat cac aag
1056Ser Thr Ile Asp Arg Pro Tyr Gly Ile Phe Asp Phe Phe His His Lys
340 345 350
att gga agc act cac gta gct cat cat ttg ttc cac gag atg cca ttt
1104Ile Gly Ser Thr His Val Ala His His Leu Phe His Glu Met Pro Phe
355 360 365
tac aag gcg gat gtg gct act gcg tcg atc aag ggt ttc ttg gag ccg
1152Tyr Lys Ala Asp Val Ala Thr Ala Ser Ile Lys Gly Phe Leu Glu Pro
370 375 380
aag gga ctt tac aac tat gat cca acg cct tgg tat gtg gcc atg tgg
1200Lys Gly Leu Tyr Asn Tyr Asp Pro Thr Pro Trp Tyr Val Ala Met Trp
385 390 395 400
agg gtg gcc aag act tgt cat tat att gag gat gtg gat gga gtt cag
1248Arg Val Ala Lys Thr Cys His Tyr Ile Glu Asp Val Asp Gly Val Gln
405 410 415
tat tat aag agt ttg gag gat gtg cct ttg aag aag gat gcc aag aag
1296Tyr Tyr Lys Ser Leu Glu Asp Val Pro Leu Lys Lys Asp Ala Lys Lys
420 425 430
tct gat tag
1305Ser Asp
110434PRT Thalassiosira pseudonana 110Met Gly Lys Gly Gly Arg Ser
Val Thr Arg Ala Gln Thr Ala Glu Lys 1 5
10 15 Ser Ala His Thr Ile Gln Thr Phe Thr Asp Gly
Arg Trp Val Ser Pro 20 25
30 Tyr Asn Pro Leu Ala Lys Asp Ala Pro Glu Leu Pro Ser Lys Gly
Glu 35 40 45 Ile
Lys Ala Val Ile Pro Lys Glu Cys Phe Glu Arg Ser Tyr Leu His 50
55 60 Ser Met Tyr Phe Val Leu
Arg Asp Thr Val Met Ala Val Ala Cys Ala 65 70
75 80 Tyr Ile Ala His Ser Thr Leu Ser Thr Asp Ile
Pro Ser Glu Leu Leu 85 90
95 Ser Val Asp Ala Leu Lys Trp Phe Leu Gly Trp Asn Thr Tyr Ala Phe
100 105 110 Trp Met
Gly Cys Ile Leu Thr Gly His Trp Val Leu Ala His Glu Cys 115
120 125 Gly His Gly Ala Phe Ser Pro
Ser Gln Thr Phe Asn Asp Phe Trp Gly 130 135
140 Phe Ile Met His Gln Ala Val Leu Val Pro Tyr Phe
Ala Trp Gln Tyr 145 150 155
160 Ser His Ala Lys His His Arg Arg Thr Asn Asn Ile Met Asp Gly Glu
165 170 175 Ser His Val
Pro Asn Ile Ala Lys Glu Met Gly Leu Asn Glu Lys Asn 180
185 190 Glu Arg Ser Gly Gly Tyr Ala Ala
Ile His Glu Ala Ile Gly Asp Gly 195 200
205 Pro Phe Ala Met Phe Gln Ile Phe Ala His Leu Val Ile
Gly Trp Pro 210 215 220
Ile Tyr Leu Met Gly Phe Ala Ser Thr Gly Arg Leu Gly Gln Asp Gly 225
230 235 240 Lys Glu Leu Gln
Ala Gly Glu Ile Ile Asp His Tyr Arg Pro Trp Ser 245
250 255 Lys Met Phe Pro Thr Lys Leu Arg Phe
Lys Ile Ala Leu Ser Thr Leu 260 265
270 Gly Val Ile Ala Ala Trp Val Gly Leu Tyr Phe Ala Ala Gln
Glu Tyr 275 280 285
Gly Val Leu Pro Val Val Leu Trp Tyr Ile Gly Pro Leu Met Trp Asn 290
295 300 Gln Ala Trp Leu Val
Leu Tyr Thr Trp Leu Gln His Asn Asp Pro Ser 305 310
315 320 Val Pro Gln Tyr Gly Ser Asp Glu Trp Thr
Trp Val Lys Gly Ala Leu 325 330
335 Ser Thr Ile Asp Arg Pro Tyr Gly Ile Phe Asp Phe Phe His His
Lys 340 345 350 Ile
Gly Ser Thr His Val Ala His His Leu Phe His Glu Met Pro Phe 355
360 365 Tyr Lys Ala Asp Val Ala
Thr Ala Ser Ile Lys Gly Phe Leu Glu Pro 370 375
380 Lys Gly Leu Tyr Asn Tyr Asp Pro Thr Pro Trp
Tyr Val Ala Met Trp 385 390 395
400 Arg Val Ala Lys Thr Cys His Tyr Ile Glu Asp Val Asp Gly Val Gln
405 410 415 Tyr Tyr
Lys Ser Leu Glu Asp Val Pro Leu Lys Lys Asp Ala Lys Lys 420
425 430 Ser Asp
111879DNAOstreococcus tauriCDS(1)..(879)delta6-elongase 111atg agt ggc
tta cgt gca ccc aac ttt tta cac aga ttc tgg aca aag 48Met Ser Gly
Leu Arg Ala Pro Asn Phe Leu His Arg Phe Trp Thr Lys 1
5 10 15 tgg gac tac gcg
att tcc aaa gtc gtc ttc acg tgt gcc gac agt ttt 96Trp Asp Tyr Ala
Ile Ser Lys Val Val Phe Thr Cys Ala Asp Ser Phe 20
25 30 cag tgg gac atc ggg
cca gtg agt tcg agt acg gcg cat tta ccc gcc 144Gln Trp Asp Ile Gly
Pro Val Ser Ser Ser Thr Ala His Leu Pro Ala 35
40 45 att gaa tcc cct acc cca
ctg gtg act agc ctc ttg ttc tac tta gtc 192Ile Glu Ser Pro Thr Pro
Leu Val Thr Ser Leu Leu Phe Tyr Leu Val 50
55 60 aca gtt ttc ttg tgg tat
ggt cgt tta acc agg agt tca gac aag aaa 240Thr Val Phe Leu Trp Tyr
Gly Arg Leu Thr Arg Ser Ser Asp Lys Lys 65 70
75 80 att aga gag cct acg tgg tta
aga aga ttc ata ata tgt cat aat gcg 288Ile Arg Glu Pro Thr Trp Leu
Arg Arg Phe Ile Ile Cys His Asn Ala 85
90 95 ttc ttg ata gtc ctc agt ctt tac
atg tgc ctt ggt tgt gtg gcc caa 336Phe Leu Ile Val Leu Ser Leu Tyr
Met Cys Leu Gly Cys Val Ala Gln 100
105 110 gcg tat cag aat gga tat act tta
tgg ggt aat gaa ttc aag gcc acg 384Ala Tyr Gln Asn Gly Tyr Thr Leu
Trp Gly Asn Glu Phe Lys Ala Thr 115 120
125 gaa act cag ctt gct ctc tac att tac
att ttt tac gta agt aaa ata 432Glu Thr Gln Leu Ala Leu Tyr Ile Tyr
Ile Phe Tyr Val Ser Lys Ile 130 135
140 tac gag ttt gta gat act tac att atg ctt
ctc aag aat aac ttg cgg 480Tyr Glu Phe Val Asp Thr Tyr Ile Met Leu
Leu Lys Asn Asn Leu Arg 145 150
155 160 caa gta agt ttc cta cac att tat cac cac
agc acg att tcc ttt att 528Gln Val Ser Phe Leu His Ile Tyr His His
Ser Thr Ile Ser Phe Ile 165 170
175 tgg tgg atc att gct cgg agg gct ccg ggt ggt
gat gct tac ttc agc 576Trp Trp Ile Ile Ala Arg Arg Ala Pro Gly Gly
Asp Ala Tyr Phe Ser 180 185
190 gcg gcc ttg aac tca tgg gta cac gtg tgc atg tac
acc tat tat cta 624Ala Ala Leu Asn Ser Trp Val His Val Cys Met Tyr
Thr Tyr Tyr Leu 195 200
205 tta tca acc ctt att gga aaa gaa gat cct aag cgt
tcc aac tac ctt 672Leu Ser Thr Leu Ile Gly Lys Glu Asp Pro Lys Arg
Ser Asn Tyr Leu 210 215 220
tgg tgg ggt cgc cac cta acg caa atg cag atg ctt cag
ttt ttc ttc 720Trp Trp Gly Arg His Leu Thr Gln Met Gln Met Leu Gln
Phe Phe Phe 225 230 235
240 aac gta ctt caa gcg ttg tac tgc gct tcg ttc tct acg tat
ccc aag 768Asn Val Leu Gln Ala Leu Tyr Cys Ala Ser Phe Ser Thr Tyr
Pro Lys 245 250
255 ttt ttg tcc aaa att ctg ctc gtc tat atg atg agc ctt ctc
ggc ttg 816Phe Leu Ser Lys Ile Leu Leu Val Tyr Met Met Ser Leu Leu
Gly Leu 260 265 270
ttt ggg cat ttc tac tat tcc aag cac ata gca gca gct aag ctc
cag 864Phe Gly His Phe Tyr Tyr Ser Lys His Ile Ala Ala Ala Lys Leu
Gln 275 280 285
aaa aaa cag cag tga
879Lys Lys Gln Gln
290
112292PRTOstreococcus tauri 112Met Ser Gly Leu Arg Ala Pro Asn Phe
Leu His Arg Phe Trp Thr Lys 1 5 10
15 Trp Asp Tyr Ala Ile Ser Lys Val Val Phe Thr Cys Ala Asp
Ser Phe 20 25 30
Gln Trp Asp Ile Gly Pro Val Ser Ser Ser Thr Ala His Leu Pro Ala
35 40 45 Ile Glu Ser Pro
Thr Pro Leu Val Thr Ser Leu Leu Phe Tyr Leu Val 50
55 60 Thr Val Phe Leu Trp Tyr Gly Arg
Leu Thr Arg Ser Ser Asp Lys Lys 65 70
75 80 Ile Arg Glu Pro Thr Trp Leu Arg Arg Phe Ile Ile
Cys His Asn Ala 85 90
95 Phe Leu Ile Val Leu Ser Leu Tyr Met Cys Leu Gly Cys Val Ala Gln
100 105 110 Ala Tyr Gln
Asn Gly Tyr Thr Leu Trp Gly Asn Glu Phe Lys Ala Thr 115
120 125 Glu Thr Gln Leu Ala Leu Tyr Ile
Tyr Ile Phe Tyr Val Ser Lys Ile 130 135
140 Tyr Glu Phe Val Asp Thr Tyr Ile Met Leu Leu Lys Asn
Asn Leu Arg 145 150 155
160 Gln Val Ser Phe Leu His Ile Tyr His His Ser Thr Ile Ser Phe Ile
165 170 175 Trp Trp Ile Ile
Ala Arg Arg Ala Pro Gly Gly Asp Ala Tyr Phe Ser 180
185 190 Ala Ala Leu Asn Ser Trp Val His Val
Cys Met Tyr Thr Tyr Tyr Leu 195 200
205 Leu Ser Thr Leu Ile Gly Lys Glu Asp Pro Lys Arg Ser Asn
Tyr Leu 210 215 220
Trp Trp Gly Arg His Leu Thr Gln Met Gln Met Leu Gln Phe Phe Phe 225
230 235 240 Asn Val Leu Gln Ala
Leu Tyr Cys Ala Ser Phe Ser Thr Tyr Pro Lys 245
250 255 Phe Leu Ser Lys Ile Leu Leu Val Tyr Met
Met Ser Leu Leu Gly Leu 260 265
270 Phe Gly His Phe Tyr Tyr Ser Lys His Ile Ala Ala Ala Lys Leu
Gln 275 280 285 Lys
Lys Gln Gln 290 113903DNAOstreococcus
tauriCDS(1)..(903)delta5-elongase 113atg agc gcc tcc ggt gcg ctg ctg ccc
gcg atc gcg ttc gcc gcg tac 48Met Ser Ala Ser Gly Ala Leu Leu Pro
Ala Ile Ala Phe Ala Ala Tyr 1 5
10 15 gcg tac gcg acg tac gcc tac gcc ttt
gag tgg tcg cac gcg aat ggc 96Ala Tyr Ala Thr Tyr Ala Tyr Ala Phe
Glu Trp Ser His Ala Asn Gly 20 25
30 atc gac aac gtc gac gcg cgc gag tgg atc
ggt gcg ctg tcg ttg agg 144Ile Asp Asn Val Asp Ala Arg Glu Trp Ile
Gly Ala Leu Ser Leu Arg 35 40
45 ctc ccg gcg atc gcg acg acg atg tac ctg ttg
ttc tgc ctg gtc gga 192Leu Pro Ala Ile Ala Thr Thr Met Tyr Leu Leu
Phe Cys Leu Val Gly 50 55
60 ccg agg ttg atg gcg aag cgc gag gcg ttc gac
ccg aag ggg ttc atg 240Pro Arg Leu Met Ala Lys Arg Glu Ala Phe Asp
Pro Lys Gly Phe Met 65 70 75
80 ctg gcg tac aat gcg tat cag acg gcg ttc aac gtc
gtc gtg ctc ggg 288Leu Ala Tyr Asn Ala Tyr Gln Thr Ala Phe Asn Val
Val Val Leu Gly 85 90
95 atg ttc gcg cga gag atc tcg ggg ctg ggg cag ccc gtg
tgg ggg tca 336Met Phe Ala Arg Glu Ile Ser Gly Leu Gly Gln Pro Val
Trp Gly Ser 100 105
110 acc atg ccg tgg agc gat aga aaa tcg ttt aag atc ctc
ctc ggg gtg 384Thr Met Pro Trp Ser Asp Arg Lys Ser Phe Lys Ile Leu
Leu Gly Val 115 120 125
tgg ttg cac tac aac aac aaa tat ttg gag cta ttg gac act
gtg ttc 432Trp Leu His Tyr Asn Asn Lys Tyr Leu Glu Leu Leu Asp Thr
Val Phe 130 135 140
atg gtt gcg cgc aag aag acg aag cag ttg agc ttc ttg cac gtt
tat 480Met Val Ala Arg Lys Lys Thr Lys Gln Leu Ser Phe Leu His Val
Tyr 145 150 155
160 cat cac gcc ctg ttg atc tgg gcg tgg tgg ttg gtg tgt cac ttg
atg 528His His Ala Leu Leu Ile Trp Ala Trp Trp Leu Val Cys His Leu
Met 165 170 175
gcc acg aac gat tgt atc gat gcc tac ttc ggc gcg gcg tgc aac tcg
576Ala Thr Asn Asp Cys Ile Asp Ala Tyr Phe Gly Ala Ala Cys Asn Ser
180 185 190
ttc att cac atc gtg atg tac tcg tat tat ctc atg tcg gcg ctc ggc
624Phe Ile His Ile Val Met Tyr Ser Tyr Tyr Leu Met Ser Ala Leu Gly
195 200 205
att cga tgc ccg tgg aag cga tac atc acc cag gct caa atg ctc caa
672Ile Arg Cys Pro Trp Lys Arg Tyr Ile Thr Gln Ala Gln Met Leu Gln
210 215 220
ttc gtc att gtc ttc gcg cac gcc gtg ttc gtg ctg cgt cag aag cac
720Phe Val Ile Val Phe Ala His Ala Val Phe Val Leu Arg Gln Lys His
225 230 235 240
tgc ccg gtc acc ctt cct tgg gcg caa atg ttc gtc atg acg aac atg
768Cys Pro Val Thr Leu Pro Trp Ala Gln Met Phe Val Met Thr Asn Met
245 250 255
ctc gtg ctc ttc ggg aac ttc tac ctc aag gcg tac tcg aac aag tcg
816Leu Val Leu Phe Gly Asn Phe Tyr Leu Lys Ala Tyr Ser Asn Lys Ser
260 265 270
cgc ggc gac ggc gcg agt tcc gtg aaa cca gcc gag acc acg cgc gcg
864Arg Gly Asp Gly Ala Ser Ser Val Lys Pro Ala Glu Thr Thr Arg Ala
275 280 285
ccc agc gtg cga cgc acg cga tct cga aaa att gac taa
903Pro Ser Val Arg Arg Thr Arg Ser Arg Lys Ile Asp
290 295 300
114300PRTOstreococcus tauri 114Met Ser Ala Ser Gly Ala Leu Leu Pro Ala
Ile Ala Phe Ala Ala Tyr 1 5 10
15 Ala Tyr Ala Thr Tyr Ala Tyr Ala Phe Glu Trp Ser His Ala Asn
Gly 20 25 30 Ile
Asp Asn Val Asp Ala Arg Glu Trp Ile Gly Ala Leu Ser Leu Arg 35
40 45 Leu Pro Ala Ile Ala Thr
Thr Met Tyr Leu Leu Phe Cys Leu Val Gly 50 55
60 Pro Arg Leu Met Ala Lys Arg Glu Ala Phe Asp
Pro Lys Gly Phe Met 65 70 75
80 Leu Ala Tyr Asn Ala Tyr Gln Thr Ala Phe Asn Val Val Val Leu Gly
85 90 95 Met Phe
Ala Arg Glu Ile Ser Gly Leu Gly Gln Pro Val Trp Gly Ser 100
105 110 Thr Met Pro Trp Ser Asp Arg
Lys Ser Phe Lys Ile Leu Leu Gly Val 115 120
125 Trp Leu His Tyr Asn Asn Lys Tyr Leu Glu Leu Leu
Asp Thr Val Phe 130 135 140
Met Val Ala Arg Lys Lys Thr Lys Gln Leu Ser Phe Leu His Val Tyr 145
150 155 160 His His Ala
Leu Leu Ile Trp Ala Trp Trp Leu Val Cys His Leu Met 165
170 175 Ala Thr Asn Asp Cys Ile Asp Ala
Tyr Phe Gly Ala Ala Cys Asn Ser 180 185
190 Phe Ile His Ile Val Met Tyr Ser Tyr Tyr Leu Met Ser
Ala Leu Gly 195 200 205
Ile Arg Cys Pro Trp Lys Arg Tyr Ile Thr Gln Ala Gln Met Leu Gln 210
215 220 Phe Val Ile Val
Phe Ala His Ala Val Phe Val Leu Arg Gln Lys His 225 230
235 240 Cys Pro Val Thr Leu Pro Trp Ala Gln
Met Phe Val Met Thr Asn Met 245 250
255 Leu Val Leu Phe Gly Asn Phe Tyr Leu Lys Ala Tyr Ser Asn
Lys Ser 260 265 270
Arg Gly Asp Gly Ala Ser Ser Val Lys Pro Ala Glu Thr Thr Arg Ala
275 280 285 Pro Ser Val Arg
Arg Thr Arg Ser Arg Lys Ile Asp 290 295
300 11513PRTUnknownConsensus sequence 115Asn Xaa Xaa Xaa His Xaa Xaa
Met Tyr Xaa Tyr Tyr Xaa 1 5 10
11610PRTUnknownConsensus sequence 116His His Xaa Xaa Xaa Xaa Trp Ala
Trp Trp 1 5 10 117909DNAXenopus
laevisCDS(1)..(909)delta5-elongase 117atg gcc ttc aag gag ctc aca tca agg
gca gtg ctc ctg tat gat gaa 48Met Ala Phe Lys Glu Leu Thr Ser Arg
Ala Val Leu Leu Tyr Asp Glu 1 5
10 15 tgg att aaa gat gct gat cct agg gtt
gaa gac tgg cca ctc atg tcc 96Trp Ile Lys Asp Ala Asp Pro Arg Val
Glu Asp Trp Pro Leu Met Ser 20 25
30 tct cct atc cta caa acc atc atc atc ggc
gct tac atc tac ttt gtc 144Ser Pro Ile Leu Gln Thr Ile Ile Ile Gly
Ala Tyr Ile Tyr Phe Val 35 40
45 aca tca ttg ggc cca agg atc atg gag aac agg
aag ccg ttt gct ctg 192Thr Ser Leu Gly Pro Arg Ile Met Glu Asn Arg
Lys Pro Phe Ala Leu 50 55
60 aag gag atc atg gca tgt tac aac tta ttc atg
gtt ctg ttt tct gtg 240Lys Glu Ile Met Ala Cys Tyr Asn Leu Phe Met
Val Leu Phe Ser Val 65 70 75
80 tac atg tgc tat gag ttt ctc atg tcg ggc tgg gct
act gga tat tcc 288Tyr Met Cys Tyr Glu Phe Leu Met Ser Gly Trp Ala
Thr Gly Tyr Ser 85 90
95 ttt aga tgt gac att gtt gac tac tct cag tca cct cag
gcg tta cgg 336Phe Arg Cys Asp Ile Val Asp Tyr Ser Gln Ser Pro Gln
Ala Leu Arg 100 105
110 atg gcc tgg acc tgc tgg ctc ttc tat ttt tca aag ttc
att gaa tta 384Met Ala Trp Thr Cys Trp Leu Phe Tyr Phe Ser Lys Phe
Ile Glu Leu 115 120 125
tta gac act gtt ttc ttt gtg ctg cgt aag aag aac agc cag
att aca 432Leu Asp Thr Val Phe Phe Val Leu Arg Lys Lys Asn Ser Gln
Ile Thr 130 135 140
ttc ctg cac gtc tat cac cac tcc att atg cct tgg acg tgg tgg
ttt 480Phe Leu His Val Tyr His His Ser Ile Met Pro Trp Thr Trp Trp
Phe 145 150 155
160 gga gtc aaa ttt gct cca ggt ggt ttg ggc aca ttc cat gca ctg
gtg 528Gly Val Lys Phe Ala Pro Gly Gly Leu Gly Thr Phe His Ala Leu
Val 165 170 175
aac tgt gtg gtc cat gtt atc atg tac agc tac tac ggc ctg tca gcc
576Asn Cys Val Val His Val Ile Met Tyr Ser Tyr Tyr Gly Leu Ser Ala
180 185 190
ttg ggg cct gcc tac cag aag tac ctg tgg tgg aaa aag tac atg acg
624Leu Gly Pro Ala Tyr Gln Lys Tyr Leu Trp Trp Lys Lys Tyr Met Thr
195 200 205
tct atc caa ctg acc cag ttc ttg atg gtt act ttt cac atc ggc cag
672Ser Ile Gln Leu Thr Gln Phe Leu Met Val Thr Phe His Ile Gly Gln
210 215 220
ttc ttc ttc atg gag aat tgc ccg tac cag tat ccc gtc ttc ttg tat
720Phe Phe Phe Met Glu Asn Cys Pro Tyr Gln Tyr Pro Val Phe Leu Tyr
225 230 235 240
gtc att tgg ctg tac ggg ttc gtt ttc tta atc ttg ttc ctc aac ttc
768Val Ile Trp Leu Tyr Gly Phe Val Phe Leu Ile Leu Phe Leu Asn Phe
245 250 255
tgg ttc cac gct tac atc aaa gga cag agg ctg ccg aaa gcc gtc caa
816Trp Phe His Ala Tyr Ile Lys Gly Gln Arg Leu Pro Lys Ala Val Gln
260 265 270
aat ggc cac tgc aag aac aac aac aac caa gaa aac act tgg tgc aag
864Asn Gly His Cys Lys Asn Asn Asn Asn Gln Glu Asn Thr Trp Cys Lys
275 280 285
aac aaa aac cag aaa aac ggt gca ttg aaa agc aaa aac cat tga
909Asn Lys Asn Gln Lys Asn Gly Ala Leu Lys Ser Lys Asn His
290 295 300
118302PRTXenopus laevis 118Met Ala Phe Lys Glu Leu Thr Ser Arg Ala Val
Leu Leu Tyr Asp Glu 1 5 10
15 Trp Ile Lys Asp Ala Asp Pro Arg Val Glu Asp Trp Pro Leu Met Ser
20 25 30 Ser Pro
Ile Leu Gln Thr Ile Ile Ile Gly Ala Tyr Ile Tyr Phe Val 35
40 45 Thr Ser Leu Gly Pro Arg Ile
Met Glu Asn Arg Lys Pro Phe Ala Leu 50 55
60 Lys Glu Ile Met Ala Cys Tyr Asn Leu Phe Met Val
Leu Phe Ser Val 65 70 75
80 Tyr Met Cys Tyr Glu Phe Leu Met Ser Gly Trp Ala Thr Gly Tyr Ser
85 90 95 Phe Arg Cys
Asp Ile Val Asp Tyr Ser Gln Ser Pro Gln Ala Leu Arg 100
105 110 Met Ala Trp Thr Cys Trp Leu Phe
Tyr Phe Ser Lys Phe Ile Glu Leu 115 120
125 Leu Asp Thr Val Phe Phe Val Leu Arg Lys Lys Asn Ser
Gln Ile Thr 130 135 140
Phe Leu His Val Tyr His His Ser Ile Met Pro Trp Thr Trp Trp Phe 145
150 155 160 Gly Val Lys Phe
Ala Pro Gly Gly Leu Gly Thr Phe His Ala Leu Val 165
170 175 Asn Cys Val Val His Val Ile Met Tyr
Ser Tyr Tyr Gly Leu Ser Ala 180 185
190 Leu Gly Pro Ala Tyr Gln Lys Tyr Leu Trp Trp Lys Lys Tyr
Met Thr 195 200 205
Ser Ile Gln Leu Thr Gln Phe Leu Met Val Thr Phe His Ile Gly Gln 210
215 220 Phe Phe Phe Met Glu
Asn Cys Pro Tyr Gln Tyr Pro Val Phe Leu Tyr 225 230
235 240 Val Ile Trp Leu Tyr Gly Phe Val Phe Leu
Ile Leu Phe Leu Asn Phe 245 250
255 Trp Phe His Ala Tyr Ile Lys Gly Gln Arg Leu Pro Lys Ala Val
Gln 260 265 270 Asn
Gly His Cys Lys Asn Asn Asn Asn Gln Glu Asn Thr Trp Cys Lys 275
280 285 Asn Lys Asn Gln Lys Asn
Gly Ala Leu Lys Ser Lys Asn His 290 295
300 119870DNACiona intestinalisCDS(1)..(870)delta5-elongase
119atg gac gta ctt cat cgt ttc tta gga ttc tac gaa tgg acg ctg act
48Met Asp Val Leu His Arg Phe Leu Gly Phe Tyr Glu Trp Thr Leu Thr
1 5 10 15
ttc gcg gac ccc cga gtg gca aaa tgg cct tta ata gaa aac ccc ctt
96Phe Ala Asp Pro Arg Val Ala Lys Trp Pro Leu Ile Glu Asn Pro Leu
20 25 30
cct aca att gct att gtg ttg ctg tac ctg gcg ttt gtt ctg tat att
144Pro Thr Ile Ala Ile Val Leu Leu Tyr Leu Ala Phe Val Leu Tyr Ile
35 40 45
ggg ccg cgt ttt atg cga aaa aga gca cca gtt gac ttt ggt tta ttc
192Gly Pro Arg Phe Met Arg Lys Arg Ala Pro Val Asp Phe Gly Leu Phe
50 55 60
ctc cct gga tat aac ttt gct ttg gtt gca tta aat tat tat atc ctg
240Leu Pro Gly Tyr Asn Phe Ala Leu Val Ala Leu Asn Tyr Tyr Ile Leu
65 70 75 80
caa gaa gtg gtc act ggg agt tat ggg gct ggg tat gat ttg gtt tgc
288Gln Glu Val Val Thr Gly Ser Tyr Gly Ala Gly Tyr Asp Leu Val Cys
85 90 95
aca cca ctt cga agt gat tcc tac gat ccc aat gaa atg aag gtt gca
336Thr Pro Leu Arg Ser Asp Ser Tyr Asp Pro Asn Glu Met Lys Val Ala
100 105 110
aac gct gta tgg tgg tat tat gta tcc aag ata ata gag ttg ttt gat
384Asn Ala Val Trp Trp Tyr Tyr Val Ser Lys Ile Ile Glu Leu Phe Asp
115 120 125
act gtg ttg ttc act cta cgc aaa cga gac cga caa gta act ttc ctt
432Thr Val Leu Phe Thr Leu Arg Lys Arg Asp Arg Gln Val Thr Phe Leu
130 135 140
cat gtt tat cac cat tct acc atg ccc ctg ttg tgg tgg att ggg gca
480His Val Tyr His His Ser Thr Met Pro Leu Leu Trp Trp Ile Gly Ala
145 150 155 160
aag tgg gtg cct ggt ggg caa tca ttt gtt ggc atc ata ctg aac tcc
528Lys Trp Val Pro Gly Gly Gln Ser Phe Val Gly Ile Ile Leu Asn Ser
165 170 175
agt gtt cat gtt atc atg tat acg tac tat gga ttg tca gcc ttg ggg
576Ser Val His Val Ile Met Tyr Thr Tyr Tyr Gly Leu Ser Ala Leu Gly
180 185 190
cct cac atg cag aag ttt cta tgg tgg aag aaa tat atc aca atg ttg
624Pro His Met Gln Lys Phe Leu Trp Trp Lys Lys Tyr Ile Thr Met Leu
195 200 205
caa ctg gtt caa ttt gtt ctt gcc atc tac cat act gct cga tca ttg
672Gln Leu Val Gln Phe Val Leu Ala Ile Tyr His Thr Ala Arg Ser Leu
210 215 220
tac gtt aaa tgt ccc tcg cct gtt tgg atg cac tgg gca ctt atc ttg
720Tyr Val Lys Cys Pro Ser Pro Val Trp Met His Trp Ala Leu Ile Leu
225 230 235 240
tac gct ttc tca ttc att ttg ctt ttc tca aac ttc tac atg cat gcc
768Tyr Ala Phe Ser Phe Ile Leu Leu Phe Ser Asn Phe Tyr Met His Ala
245 250 255
tat atc aag aaa tca aga aaa ggg aaa gag aat ggc agt cga gga aaa
816Tyr Ile Lys Lys Ser Arg Lys Gly Lys Glu Asn Gly Ser Arg Gly Lys
260 265 270
ggt ggt gta agt aat gga aag gaa aag ctg cac gct aat ggt aaa acc
864Gly Gly Val Ser Asn Gly Lys Glu Lys Leu His Ala Asn Gly Lys Thr
275 280 285
gat taa
870Asp
120289PRTCiona intestinalis 120Met Asp Val Leu His Arg Phe Leu Gly Phe
Tyr Glu Trp Thr Leu Thr 1 5 10
15 Phe Ala Asp Pro Arg Val Ala Lys Trp Pro Leu Ile Glu Asn Pro
Leu 20 25 30 Pro
Thr Ile Ala Ile Val Leu Leu Tyr Leu Ala Phe Val Leu Tyr Ile 35
40 45 Gly Pro Arg Phe Met Arg
Lys Arg Ala Pro Val Asp Phe Gly Leu Phe 50 55
60 Leu Pro Gly Tyr Asn Phe Ala Leu Val Ala Leu
Asn Tyr Tyr Ile Leu 65 70 75
80 Gln Glu Val Val Thr Gly Ser Tyr Gly Ala Gly Tyr Asp Leu Val Cys
85 90 95 Thr Pro
Leu Arg Ser Asp Ser Tyr Asp Pro Asn Glu Met Lys Val Ala 100
105 110 Asn Ala Val Trp Trp Tyr Tyr
Val Ser Lys Ile Ile Glu Leu Phe Asp 115 120
125 Thr Val Leu Phe Thr Leu Arg Lys Arg Asp Arg Gln
Val Thr Phe Leu 130 135 140
His Val Tyr His His Ser Thr Met Pro Leu Leu Trp Trp Ile Gly Ala 145
150 155 160 Lys Trp Val
Pro Gly Gly Gln Ser Phe Val Gly Ile Ile Leu Asn Ser 165
170 175 Ser Val His Val Ile Met Tyr Thr
Tyr Tyr Gly Leu Ser Ala Leu Gly 180 185
190 Pro His Met Gln Lys Phe Leu Trp Trp Lys Lys Tyr Ile
Thr Met Leu 195 200 205
Gln Leu Val Gln Phe Val Leu Ala Ile Tyr His Thr Ala Arg Ser Leu 210
215 220 Tyr Val Lys Cys
Pro Ser Pro Val Trp Met His Trp Ala Leu Ile Leu 225 230
235 240 Tyr Ala Phe Ser Phe Ile Leu Leu Phe
Ser Asn Phe Tyr Met His Ala 245 250
255 Tyr Ile Lys Lys Ser Arg Lys Gly Lys Glu Asn Gly Ser Arg
Gly Lys 260 265 270
Gly Gly Val Ser Asn Gly Lys Glu Lys Leu His Ala Asn Gly Lys Thr
275 280 285 Asp
12130DNAUnknownmisc_feature(1)..(30)Primer 121aggatccatg gccttcaagg
agctcacatc
3012235DNAUnknownmisc_feature(1)..(35)Primer 122cctcgagtca atggtttttg
cttttcaatg caccg
3512325DNAUnknownmisc_feature(1)..(25)Primer 123taagcttatg gacgtacttc
atcgt
2512426DNAUnknownmisc_feature(1)..(26)Primer 124tcagatcttt aatcggtttt
accatt
2612534DNAUnknownmisc_feature(1)..(34)Primer 125gcggccgcac catggccttc
aaggagctca catc
3412638DNAUnknownmisc_feature(1)..(38)Primer 126gcggccgcct tcaatggttt
ttgcttttca atgcaccg
3812729DNAUnknownmisc_feature(1)..(29)Primer 127gcggccgcac catggacgta
cttcatcgt
2912827DNAUnknownmisc_feature(1)..(27)Primer 128gcggccgctt taatcggttt
taccatt
2712960DNAUnknownmisc_feature(1)..(60)Primer 129gtcgacccgc ggactagtgg
gccctctaga cccgggggat ccggatctgc tggctatgaa
6013060DNAUnknownmisc_feature(1)..(60)Primer 130gtcgacccgc ggactagtgg
gccctctaga cccgggggat ccggatctgc tggctatgaa 60131789DNAEuglena
gracilisCDS(1)..(789)delta5-elongase 131atg ctg ggg gcc atc gcg gac gtc
gtg ctc cgg ggg ccc gcc gca ttc 48Met Leu Gly Ala Ile Ala Asp Val
Val Leu Arg Gly Pro Ala Ala Phe 1 5
10 15 cac tgg gac cct gcc acc acc ccg ctc
gca tcg atc gtc agc ccc tgt 96His Trp Asp Pro Ala Thr Thr Pro Leu
Ala Ser Ile Val Ser Pro Cys 20 25
30 gtg gcc tcc gtg gcg tac ctg ggg gcc atc
ggg ctg ctg aag cgc cgc 144Val Ala Ser Val Ala Tyr Leu Gly Ala Ile
Gly Leu Leu Lys Arg Arg 35 40
45 act gga ccg gag gtc cgc tcc aag ccc ttc gag
ctg cta cac aac ggg 192Thr Gly Pro Glu Val Arg Ser Lys Pro Phe Glu
Leu Leu His Asn Gly 50 55
60 ctg ctg gtg ggc tgg tcc ctc gtg gtg ctg ctc
ggg acg ctg tac ggc 240Leu Leu Val Gly Trp Ser Leu Val Val Leu Leu
Gly Thr Leu Tyr Gly 65 70 75
80 gcg ttc cag cgc gtg cag gag gac ggc cgg ggg gtg
cag gcc ctc ctg 288Ala Phe Gln Arg Val Gln Glu Asp Gly Arg Gly Val
Gln Ala Leu Leu 85 90
95 tgc acc cag cgg cca cca tct cag atc tgg gac ggc ccg
gtg ggg tac 336Cys Thr Gln Arg Pro Pro Ser Gln Ile Trp Asp Gly Pro
Val Gly Tyr 100 105
110 ttc acg tac ctc ttc tac ctc gcg aag tac tgg gag ctg
gcg gac act 384Phe Thr Tyr Leu Phe Tyr Leu Ala Lys Tyr Trp Glu Leu
Ala Asp Thr 115 120 125
gtc atc ctc gcc ctc cgc cag aag ccc acc atc ccc ctc cac
gtc tac 432Val Ile Leu Ala Leu Arg Gln Lys Pro Thr Ile Pro Leu His
Val Tyr 130 135 140
cat cac gcc gtc atg ctg ttc atc gtg tgg tcg tgg ttc gcg cac
ccc 480His His Ala Val Met Leu Phe Ile Val Trp Ser Trp Phe Ala His
Pro 145 150 155
160 tgg ctc gag ggg agc tgg tgg tgc tcc ctg gtc aac tct ttc atc
cac 528Trp Leu Glu Gly Ser Trp Trp Cys Ser Leu Val Asn Ser Phe Ile
His 165 170 175
acg gtg atg tac tcg tac tac acc ctg acg gtg gtt ggc atc aac cct
576Thr Val Met Tyr Ser Tyr Tyr Thr Leu Thr Val Val Gly Ile Asn Pro
180 185 190
tgg tgg aag aag tgg atg acc acc atg cag atc atc cag ttc atc acg
624Trp Trp Lys Lys Trp Met Thr Thr Met Gln Ile Ile Gln Phe Ile Thr
195 200 205
ggc tgc gtg tac gtc atg gcg ttc ttc ggc cta tat tat gcc ggg gcg
672Gly Cys Val Tyr Val Met Ala Phe Phe Gly Leu Tyr Tyr Ala Gly Ala
210 215 220
ggc tgc acc tcc aac gtg tac act gcc tgg ttc tcg atg ggg gtc aac
720Gly Cys Thr Ser Asn Val Tyr Thr Ala Trp Phe Ser Met Gly Val Asn
225 230 235 240
ctc agc ttt ctg tgg ctc ttc gct ctt ttc ttc cgc cgg tca tac agc
768Leu Ser Phe Leu Trp Leu Phe Ala Leu Phe Phe Arg Arg Ser Tyr Ser
245 250 255
aaa cct agc cgg aag gag tag
789Lys Pro Ser Arg Lys Glu
260
132262PRTEuglena gracilis 132Met Leu Gly Ala Ile Ala Asp Val Val Leu Arg
Gly Pro Ala Ala Phe 1 5 10
15 His Trp Asp Pro Ala Thr Thr Pro Leu Ala Ser Ile Val Ser Pro Cys
20 25 30 Val Ala
Ser Val Ala Tyr Leu Gly Ala Ile Gly Leu Leu Lys Arg Arg 35
40 45 Thr Gly Pro Glu Val Arg Ser
Lys Pro Phe Glu Leu Leu His Asn Gly 50 55
60 Leu Leu Val Gly Trp Ser Leu Val Val Leu Leu Gly
Thr Leu Tyr Gly 65 70 75
80 Ala Phe Gln Arg Val Gln Glu Asp Gly Arg Gly Val Gln Ala Leu Leu
85 90 95 Cys Thr Gln
Arg Pro Pro Ser Gln Ile Trp Asp Gly Pro Val Gly Tyr 100
105 110 Phe Thr Tyr Leu Phe Tyr Leu Ala
Lys Tyr Trp Glu Leu Ala Asp Thr 115 120
125 Val Ile Leu Ala Leu Arg Gln Lys Pro Thr Ile Pro Leu
His Val Tyr 130 135 140
His His Ala Val Met Leu Phe Ile Val Trp Ser Trp Phe Ala His Pro 145
150 155 160 Trp Leu Glu Gly
Ser Trp Trp Cys Ser Leu Val Asn Ser Phe Ile His 165
170 175 Thr Val Met Tyr Ser Tyr Tyr Thr Leu
Thr Val Val Gly Ile Asn Pro 180 185
190 Trp Trp Lys Lys Trp Met Thr Thr Met Gln Ile Ile Gln Phe
Ile Thr 195 200 205
Gly Cys Val Tyr Val Met Ala Phe Phe Gly Leu Tyr Tyr Ala Gly Ala 210
215 220 Gly Cys Thr Ser Asn
Val Tyr Thr Ala Trp Phe Ser Met Gly Val Asn 225 230
235 240 Leu Ser Phe Leu Trp Leu Phe Ala Leu Phe
Phe Arg Arg Ser Tyr Ser 245 250
255 Lys Pro Ser Arg Lys Glu 260
133789DNAEuglena gracilisCDS(1)..(789)delta5-elongase 133atg ctg ggg gcc
atc gcg gac gtc gtg ctc cgg ggg ccc gcc gca ttc 48Met Leu Gly Ala
Ile Ala Asp Val Val Leu Arg Gly Pro Ala Ala Phe 1 5
10 15 cac tgg gac cct gcc
acc acc ccg ctc gca tcg atc gtc agc ccc tgt 96His Trp Asp Pro Ala
Thr Thr Pro Leu Ala Ser Ile Val Ser Pro Cys 20
25 30 gtg gcc tcc gtg gcg tac
ctg ggg gcc atc ggg ctg ctg aag cgc cgc 144Val Ala Ser Val Ala Tyr
Leu Gly Ala Ile Gly Leu Leu Lys Arg Arg 35
40 45 act gga ccg gag gtc cgc tcc
aag ccc ttc gag ctg cta cac aac ggg 192Thr Gly Pro Glu Val Arg Ser
Lys Pro Phe Glu Leu Leu His Asn Gly 50 55
60 ctg ctg gtg ggc tgg tcc ctc gtg
gtg ctg ctc ggg acg ctg tac ggc 240Leu Leu Val Gly Trp Ser Leu Val
Val Leu Leu Gly Thr Leu Tyr Gly 65 70
75 80 gcg tac cag cgc gtg cag gag gac ggc
cgg ggg gtg cag gcc ctg ctg 288Ala Tyr Gln Arg Val Gln Glu Asp Gly
Arg Gly Val Gln Ala Leu Leu 85
90 95 tgc acc cag cgg cca cca tct cag atc
tgg gac ggc ccg gtg ggg tac 336Cys Thr Gln Arg Pro Pro Ser Gln Ile
Trp Asp Gly Pro Val Gly Tyr 100 105
110 ttc acg tac ctt ttc tac ctc gcg aag tac
tgg gag ctg gtg gac act 384Phe Thr Tyr Leu Phe Tyr Leu Ala Lys Tyr
Trp Glu Leu Val Asp Thr 115 120
125 gtc atc ctc gcc ctc cgc cag aag ccc acc atc
ccc ctc cac gtc tac 432Val Ile Leu Ala Leu Arg Gln Lys Pro Thr Ile
Pro Leu His Val Tyr 130 135
140 cat cac gcc gtc atg ctg ttc att gtg tgg tcg
tgg ttc gcg cac ccc 480His His Ala Val Met Leu Phe Ile Val Trp Ser
Trp Phe Ala His Pro 145 150 155
160 tgg ctc gag ggg agc tgg tgg tgc tcc ctg gtc aac
tct ttc atc cac 528Trp Leu Glu Gly Ser Trp Trp Cys Ser Leu Val Asn
Ser Phe Ile His 165 170
175 acg gtg atg tac tcg tat tac acc ctg acg gtg gtt ggc
atc aac cct 576Thr Val Met Tyr Ser Tyr Tyr Thr Leu Thr Val Val Gly
Ile Asn Pro 180 185
190 tgg tgg aag aag tgg atg acc acc atg cag atc atc cag
ttc atc acg 624Trp Trp Lys Lys Trp Met Thr Thr Met Gln Ile Ile Gln
Phe Ile Thr 195 200 205
ggc tgc gtg tac gtc acg gcg ttc ttc ggc cta tac tat gcc
ggg gcg 672Gly Cys Val Tyr Val Thr Ala Phe Phe Gly Leu Tyr Tyr Ala
Gly Ala 210 215 220
ggc tgc acc tcc aac gtg tac act gcc tgg ttc tcg atg ggg gtc
aac 720Gly Cys Thr Ser Asn Val Tyr Thr Ala Trp Phe Ser Met Gly Val
Asn 225 230 235
240 ctc agc ttt ctg tgg ctc ttc gct ctt ttc ttc cgc cgg tcg tac
agc 768Leu Ser Phe Leu Trp Leu Phe Ala Leu Phe Phe Arg Arg Ser Tyr
Ser 245 250 255
aaa cct agc cgg aag gag tag
789Lys Pro Ser Arg Lys Glu
260
134262PRTEuglena gracilis 134Met Leu Gly Ala Ile Ala Asp Val Val Leu
Arg Gly Pro Ala Ala Phe 1 5 10
15 His Trp Asp Pro Ala Thr Thr Pro Leu Ala Ser Ile Val Ser Pro
Cys 20 25 30 Val
Ala Ser Val Ala Tyr Leu Gly Ala Ile Gly Leu Leu Lys Arg Arg 35
40 45 Thr Gly Pro Glu Val Arg
Ser Lys Pro Phe Glu Leu Leu His Asn Gly 50 55
60 Leu Leu Val Gly Trp Ser Leu Val Val Leu Leu
Gly Thr Leu Tyr Gly 65 70 75
80 Ala Tyr Gln Arg Val Gln Glu Asp Gly Arg Gly Val Gln Ala Leu Leu
85 90 95 Cys Thr
Gln Arg Pro Pro Ser Gln Ile Trp Asp Gly Pro Val Gly Tyr 100
105 110 Phe Thr Tyr Leu Phe Tyr Leu
Ala Lys Tyr Trp Glu Leu Val Asp Thr 115 120
125 Val Ile Leu Ala Leu Arg Gln Lys Pro Thr Ile Pro
Leu His Val Tyr 130 135 140
His His Ala Val Met Leu Phe Ile Val Trp Ser Trp Phe Ala His Pro 145
150 155 160 Trp Leu Glu
Gly Ser Trp Trp Cys Ser Leu Val Asn Ser Phe Ile His 165
170 175 Thr Val Met Tyr Ser Tyr Tyr Thr
Leu Thr Val Val Gly Ile Asn Pro 180 185
190 Trp Trp Lys Lys Trp Met Thr Thr Met Gln Ile Ile Gln
Phe Ile Thr 195 200 205
Gly Cys Val Tyr Val Thr Ala Phe Phe Gly Leu Tyr Tyr Ala Gly Ala 210
215 220 Gly Cys Thr Ser
Asn Val Tyr Thr Ala Trp Phe Ser Met Gly Val Asn 225 230
235 240 Leu Ser Phe Leu Trp Leu Phe Ala Leu
Phe Phe Arg Arg Ser Tyr Ser 245 250
255 Lys Pro Ser Arg Lys Glu 260
135897DNAArabidopsis thalianaCDS(1)..(897)delta5-elongase 135atg gca tct
gtt tac tcc acc cta acc tac tgg ctc gtc cac cac ccc 48Met Ala Ser
Val Tyr Ser Thr Leu Thr Tyr Trp Leu Val His His Pro 1
5 10 15 tac att gcc aac
ttc acg tgg acc gaa ggt gaa aca cta ggc tcc acc 96Tyr Ile Ala Asn
Phe Thr Trp Thr Glu Gly Glu Thr Leu Gly Ser Thr 20
25 30 gtt ttc ttt gtc ttt
gtc gtc gtc tcc ctt tac ctc tcc gcc aca ttc 144Val Phe Phe Val Phe
Val Val Val Ser Leu Tyr Leu Ser Ala Thr Phe 35
40 45 ctc ctc cga tac acc gtc
gat tca ctc ccc aca ctc ggt ccc cgc att 192Leu Leu Arg Tyr Thr Val
Asp Ser Leu Pro Thr Leu Gly Pro Arg Ile 50
55 60 ctc aaa cca atc aca gcc
gtt cac agc ctc att ctc ttc ctc ctc tcc 240Leu Lys Pro Ile Thr Ala
Val His Ser Leu Ile Leu Phe Leu Leu Ser 65 70
75 80 tta acc atg gcc gtt ggt tgc
act ctc tcc cta atc tct tcc tcg gac 288Leu Thr Met Ala Val Gly Cys
Thr Leu Ser Leu Ile Ser Ser Ser Asp 85
90 95 ccg aag gcg cgt ctc ttc gac gcc
gtt tgt ttc ccc ctc gac gtg aaa 336Pro Lys Ala Arg Leu Phe Asp Ala
Val Cys Phe Pro Leu Asp Val Lys 100
105 110 cct aag gga ccg ctt ttc ttt tgg
gct caa gtc ttt tac ctc tcg aag 384Pro Lys Gly Pro Leu Phe Phe Trp
Ala Gln Val Phe Tyr Leu Ser Lys 115 120
125 atc ctt gag ttc gta gac aca ctt ctc
atc ata ctc aac aaa tca atc 432Ile Leu Glu Phe Val Asp Thr Leu Leu
Ile Ile Leu Asn Lys Ser Ile 130 135
140 caa cgg ctc tcg ttc ctc cac gtc tac cac
cac gca acg gtt gtg att 480Gln Arg Leu Ser Phe Leu His Val Tyr His
His Ala Thr Val Val Ile 145 150
155 160 ttg tgc tac ctc tgg tta cga aca cgt caa
tcg atg ttt cct gtt ggg 528Leu Cys Tyr Leu Trp Leu Arg Thr Arg Gln
Ser Met Phe Pro Val Gly 165 170
175 ctc gtg ttg aac tcg acg gtc cat gtg att atg
tac ggg tac tat ttc 576Leu Val Leu Asn Ser Thr Val His Val Ile Met
Tyr Gly Tyr Tyr Phe 180 185
190 ctc tgc gct atc gga tcg agg ccc aag tgg aag aag
ttg gtg acg aat 624Leu Cys Ala Ile Gly Ser Arg Pro Lys Trp Lys Lys
Leu Val Thr Asn 195 200
205 ttt caa atg gtt cag ttt gct ttc ggc atg ggg tta
gga gcc gct tgg 672Phe Gln Met Val Gln Phe Ala Phe Gly Met Gly Leu
Gly Ala Ala Trp 210 215 220
atg ctc cca gag cat tat ttc ggg tcg ggt tgc gcc ggg
att tgg aca 720Met Leu Pro Glu His Tyr Phe Gly Ser Gly Cys Ala Gly
Ile Trp Thr 225 230 235
240 gtt tat ttc aat ggt gtg ttt act gct tct cta ttg gct ctc
ttc tac 768Val Tyr Phe Asn Gly Val Phe Thr Ala Ser Leu Leu Ala Leu
Phe Tyr 245 250
255 aac ttc cac tcc aag aac tat gag aag act aca acg tcg cct
ttg tat 816Asn Phe His Ser Lys Asn Tyr Glu Lys Thr Thr Thr Ser Pro
Leu Tyr 260 265 270
aag atc gaa tcc ttt ata ttt att cac gga gag agg tgg gca aat
aaa 864Lys Ile Glu Ser Phe Ile Phe Ile His Gly Glu Arg Trp Ala Asn
Lys 275 280 285
gcg att aca tta ttt tcc aag aaa aac gat taa
897Ala Ile Thr Leu Phe Ser Lys Lys Asn Asp
290 295
136298PRTArabidopsis thaliana 136Met Ala Ser Val Tyr Ser Thr Leu Thr
Tyr Trp Leu Val His His Pro 1 5 10
15 Tyr Ile Ala Asn Phe Thr Trp Thr Glu Gly Glu Thr Leu Gly
Ser Thr 20 25 30
Val Phe Phe Val Phe Val Val Val Ser Leu Tyr Leu Ser Ala Thr Phe
35 40 45 Leu Leu Arg Tyr
Thr Val Asp Ser Leu Pro Thr Leu Gly Pro Arg Ile 50
55 60 Leu Lys Pro Ile Thr Ala Val His
Ser Leu Ile Leu Phe Leu Leu Ser 65 70
75 80 Leu Thr Met Ala Val Gly Cys Thr Leu Ser Leu Ile
Ser Ser Ser Asp 85 90
95 Pro Lys Ala Arg Leu Phe Asp Ala Val Cys Phe Pro Leu Asp Val Lys
100 105 110 Pro Lys Gly
Pro Leu Phe Phe Trp Ala Gln Val Phe Tyr Leu Ser Lys 115
120 125 Ile Leu Glu Phe Val Asp Thr Leu
Leu Ile Ile Leu Asn Lys Ser Ile 130 135
140 Gln Arg Leu Ser Phe Leu His Val Tyr His His Ala Thr
Val Val Ile 145 150 155
160 Leu Cys Tyr Leu Trp Leu Arg Thr Arg Gln Ser Met Phe Pro Val Gly
165 170 175 Leu Val Leu Asn
Ser Thr Val His Val Ile Met Tyr Gly Tyr Tyr Phe 180
185 190 Leu Cys Ala Ile Gly Ser Arg Pro Lys
Trp Lys Lys Leu Val Thr Asn 195 200
205 Phe Gln Met Val Gln Phe Ala Phe Gly Met Gly Leu Gly Ala
Ala Trp 210 215 220
Met Leu Pro Glu His Tyr Phe Gly Ser Gly Cys Ala Gly Ile Trp Thr 225
230 235 240 Val Tyr Phe Asn Gly
Val Phe Thr Ala Ser Leu Leu Ala Leu Phe Tyr 245
250 255 Asn Phe His Ser Lys Asn Tyr Glu Lys Thr
Thr Thr Ser Pro Leu Tyr 260 265
270 Lys Ile Glu Ser Phe Ile Phe Ile His Gly Glu Arg Trp Ala Asn
Lys 275 280 285 Ala
Ile Thr Leu Phe Ser Lys Lys Asn Asp 290 295
137837DNAArabidopsis thalianaCDS(1)..(837)delta5-elongase 137atg gca
tca att tac tcc tct tta acc tac tgg ctc gtt aac cac ccc 48Met Ala
Ser Ile Tyr Ser Ser Leu Thr Tyr Trp Leu Val Asn His Pro 1
5 10 15 tac atc tcc
aat ttt act tgg atc gaa ggt gaa acc cta ggc tcc acc 96Tyr Ile Ser
Asn Phe Thr Trp Ile Glu Gly Glu Thr Leu Gly Ser Thr
20 25 30 gtc ttt ttc
gta tcc gtc gta gtc tcc gtt tac ctc tcc gcc acg ttc 144Val Phe Phe
Val Ser Val Val Val Ser Val Tyr Leu Ser Ala Thr Phe 35
40 45 ctc ctc cga tcc
gcc atc gat tca ctc cca tca ctc agt cca cgt atc 192Leu Leu Arg Ser
Ala Ile Asp Ser Leu Pro Ser Leu Ser Pro Arg Ile 50
55 60 ctc aaa ccg atc aca
gcc gtc cac agc cta atc ctc tgt ctc ctc tcc 240Leu Lys Pro Ile Thr
Ala Val His Ser Leu Ile Leu Cys Leu Leu Ser 65
70 75 80 tta gtc atg gcc gtc
ggt tgc act ctc tca ata acc tca tct cac gcg 288Leu Val Met Ala Val
Gly Cys Thr Leu Ser Ile Thr Ser Ser His Ala 85
90 95 tct tca gat ccg atg gcg
cgt ttc ctt cac gcg att tgc ttt ccc gtc 336Ser Ser Asp Pro Met Ala
Arg Phe Leu His Ala Ile Cys Phe Pro Val 100
105 110 gac gtt aaa cct aac gga ccg
ctt ttc ttc tgg gct caa gtc ttc tac 384Asp Val Lys Pro Asn Gly Pro
Leu Phe Phe Trp Ala Gln Val Phe Tyr 115
120 125 ctc tcg aag atc ctc gag ttc
gga gac acg atc ctc atc ata ctc ggc 432Leu Ser Lys Ile Leu Glu Phe
Gly Asp Thr Ile Leu Ile Ile Leu Gly 130 135
140 aaa tca atc caa cgg cta tcc ttc
ctc cac gtg tac cac cac gcg acg 480Lys Ser Ile Gln Arg Leu Ser Phe
Leu His Val Tyr His His Ala Thr 145 150
155 160 gtt gtg gtc atg tgt tat ctc tgg ctc
cga act cgc caa tcg atg ttt 528Val Val Val Met Cys Tyr Leu Trp Leu
Arg Thr Arg Gln Ser Met Phe 165
170 175 ccg att gcg ctc gtg acg aat tcg acg
gta cac gtc atc atg tac ggt 576Pro Ile Ala Leu Val Thr Asn Ser Thr
Val His Val Ile Met Tyr Gly 180 185
190 tac tac ttc ctc tgc gcc gtt gga tcg agg
ccc aag tgg aag aga ttg 624Tyr Tyr Phe Leu Cys Ala Val Gly Ser Arg
Pro Lys Trp Lys Arg Leu 195 200
205 gtg acg gat tgt cag att gtt cag ttt gtt ttc
agt ttc ggg tta tcc 672Val Thr Asp Cys Gln Ile Val Gln Phe Val Phe
Ser Phe Gly Leu Ser 210 215
220 ggt tgg atg ctc cga gag cac tta ttc ggg tcg
ggt tgc acc ggg att 720Gly Trp Met Leu Arg Glu His Leu Phe Gly Ser
Gly Cys Thr Gly Ile 225 230 235
240 tgg gga tgg tgt ttc aac gct gca ttt aat gct tct
ctt ttg gct ctc 768Trp Gly Trp Cys Phe Asn Ala Ala Phe Asn Ala Ser
Leu Leu Ala Leu 245 250
255 ttt tcc aac ttc cat tca aag aat tat gtc aag aag cca
acg aga gag 816Phe Ser Asn Phe His Ser Lys Asn Tyr Val Lys Lys Pro
Thr Arg Glu 260 265
270 gat ggc aaa aaa agc gat tag
837Asp Gly Lys Lys Ser Asp
275
138278PRTArabidopsis thaliana 138Met Ala Ser Ile Tyr Ser
Ser Leu Thr Tyr Trp Leu Val Asn His Pro 1 5
10 15 Tyr Ile Ser Asn Phe Thr Trp Ile Glu Gly Glu
Thr Leu Gly Ser Thr 20 25
30 Val Phe Phe Val Ser Val Val Val Ser Val Tyr Leu Ser Ala Thr
Phe 35 40 45 Leu
Leu Arg Ser Ala Ile Asp Ser Leu Pro Ser Leu Ser Pro Arg Ile 50
55 60 Leu Lys Pro Ile Thr Ala
Val His Ser Leu Ile Leu Cys Leu Leu Ser 65 70
75 80 Leu Val Met Ala Val Gly Cys Thr Leu Ser Ile
Thr Ser Ser His Ala 85 90
95 Ser Ser Asp Pro Met Ala Arg Phe Leu His Ala Ile Cys Phe Pro Val
100 105 110 Asp Val
Lys Pro Asn Gly Pro Leu Phe Phe Trp Ala Gln Val Phe Tyr 115
120 125 Leu Ser Lys Ile Leu Glu Phe
Gly Asp Thr Ile Leu Ile Ile Leu Gly 130 135
140 Lys Ser Ile Gln Arg Leu Ser Phe Leu His Val Tyr
His His Ala Thr 145 150 155
160 Val Val Val Met Cys Tyr Leu Trp Leu Arg Thr Arg Gln Ser Met Phe
165 170 175 Pro Ile Ala
Leu Val Thr Asn Ser Thr Val His Val Ile Met Tyr Gly 180
185 190 Tyr Tyr Phe Leu Cys Ala Val Gly
Ser Arg Pro Lys Trp Lys Arg Leu 195 200
205 Val Thr Asp Cys Gln Ile Val Gln Phe Val Phe Ser Phe
Gly Leu Ser 210 215 220
Gly Trp Met Leu Arg Glu His Leu Phe Gly Ser Gly Cys Thr Gly Ile 225
230 235 240 Trp Gly Trp Cys
Phe Asn Ala Ala Phe Asn Ala Ser Leu Leu Ala Leu 245
250 255 Phe Ser Asn Phe His Ser Lys Asn Tyr
Val Lys Lys Pro Thr Arg Glu 260 265
270 Asp Gly Lys Lys Ser Asp 275
1396PRTUnknownConsensus sequence 139Leu His Xaa Xaa His His 1
5 1408PRTUnknownConsensus sequence 140Thr Xaa Xaa Gln Xaa Xaa Gln
Phe 1 5 1416PRTUnknownConsensus sequence
141Asp Thr Xaa Phe Met Val 1 5
1428PRTUnknownConsensus sequence 142Thr Gln Ala Gln Xaa Xaa Gln Phe 1
5 14360DNAUnknownmisc_feature(1)..(60)Primer
143gtcgacccgc ggactagtgg gccctctaga cccgggggat ccggatctgc tggctatgaa
6014460DNAUnknownmisc_feature(1)..(60)Primer 144gtcgacccgc ggactagtgg
gccctctaga cccgggggat ccggatctgc tggctatgaa
6014536DNAUnknownmisc_feature(1)..(36)Primer 145ggtaccacat aatgtgcgtg
gagacggaaa ataacg
3614633DNAUnknownmisc_feature(1)..(33)Primer 146ctcgagttac gccgtctttc
cggagtgttg gcc
3314724DNAUnknownmisc_feature(1)..(24)Primer 147gcggccgctt acgtggactt
ggtc
2414824DNAUnknownmisc_feature(1)..(24)Primer 148gcggccgcat ggcgacgaag
gagg
2414925DNAUnknownmisc_feature(1)..(25)Primer 149taagcttaca tggcgacgaa
ggagg
2515024DNAUnknownmisc_feature(1)..(24)Primer 150tggatccact tacgtggact
tggt
2415160DNAUnknownmisc_feature(1)..(60)Primer 151gtcgacccgc ggactagtgg
gccctctaga cccgggggat ccggatctgc tggctatgaa
6015231DNAUnknownmisc_feature(1)..(31)Primer 152gcggccgcac catgtgctca
ccaccgccgt c
3115326DNAUnknownmisc_feature(1)..(26)Primer 153gcggccgcct acatggcacc
agtaac
2615431DNAUnknownmisc_feature(1)..(31)Primer 154gcggccgcac catgtgctca
tcaccgccgt c
3115526DNAUnknownmisc_feature(1)..(26)Primer 155gcggccgcct acatggcacc
agtaac
2615631DNAUnknownmisc_feature(1)..(31)Primer 156gcggccgcac catggacgcc
tacaacgctg c
3115727DNAUnknownmisc_feature(1)..(27)Primer 157gcggccgcct aagcactctt
cttcttt
2715823DNAUnknownmisc_feature(1)..(23)Primer 158accatgtgct caccaccgcc gtc
2315918DNAUnknownmisc_feature(1)..(18)Primer 159ctacatggca ccagtaac
1816023DNAUnknownmisc_feature(1)..(23)Primer 160accatgtgct catcaccgcc gtc
2316118DNAUnknownmisc_feature(1)..(18)Primer 161ctacatggca ccagtaac
1816223DNAUnknownmisc_feature(1)..(23)Primer 162accatggacg cctacaacgc tgc
2316319DNAUnknownmisc_feature(1)..(19)Primer 163ctaagcactc ttcttcttt
1916460DNAUnknownmisc_feature(1)..(60)Primer 164gtcgacccgc ggactagtgg
gccctctaga cccgggggat ccggatctgc tggctatgaa
6016560DNAUnknownmisc_feature(1)..(60)Primer 165gtcgacccgc ggactagtgg
gccctctaga cccgggggat ccggatctgc tggctatgaa
6016629DNAUnknownmisc_feature(1)..(29)Primer 166gcggccgcat aatgacgagc
aacatgagc
2916729DNAUnknownmisc_feature(1)..(29)Primer 167gcggccgctt aggccgactt
ggccttggg
2916834DNAUnknownmisc_feature(1)..(34)Primer 168gcggccgcac catggacgtc
gtcgagcagc aatg
3416936DNAUnknownmisc_feature(1)..(36)Primer 169gcggccgctt agatggtctt
ctgcttcttg ggcgcc
3617023DNAUnknownmisc_feature(1)..(23)Primer 170gacataatga cgagcaacat gag
2317125DNAUnknownmisc_feature(1)..(25)Primer 171cggcttaggc cgacttggcc
ttggg
2517230DNAUnknownmisc_feature(1)..(30)Primer 172agacataatg gacgtcgtcg
agcagcaatg
3017328DNAUnknownmisc_feature(1)..(28)Primer 173ttagatggtc ttctgcttct
tgggcgcc
2817460DNAUnknownmisc_feature(1)..(60)Primer 174gtcgacccgc ggactagtgg
gccctctaga cccgggggat ccggatctgc tggctatgaa
6017529DNAUnknownmisc_feature(1)..(29)Primer 175gcggccgcat aatggcttca
acatggcaa
2917632DNAUnknownmisc_feature(1)..(32)Primer 176gcggccgctt atgtcttctt
gctcttcctg tt
3217726DNAUnknownmisc_feature(1)..(26)Primer 177gcggccgcat aatggagact
tttaat
2617828DNAUnknownmisc_feature(1)..(28)Primer 178gcggccgctc agtcccccct
cactttcc
2817929DNAUnknownmisc_feature(1)..(29)Primer 179aagcttacat aatggcttca
acatggcaa
2918030DNAUnknownmisc_feature(1)..(30)Primer 180ggatccttat gtcttcttgc
tcttcctgtt
3018126DNAUnknownmisc_feature(1)..(26)Primer 181aagcttacat aatggagact
tttaat
2618227DNAUnknownmisc_feature(1)..(27)Primer 182ggatccttca gtcccccctc
actttcc 27183993DNAPhaeodactylum
tricornutumCDS(103)..(939)delta6-elongase 183ggtcttttgt ggtagctatc
gtcatcacac gcaggtcgtt gctcactatc gtgatccgta 60tattgaccgt gcacttgtgt
aaaacagaga tatttcaaga gt atg atg gta cct 114
Met Met Val Pro
1 tca agt tat gac gag tat atc
gtc atg gtc aac gac ctt ggc gac tct 162Ser Ser Tyr Asp Glu Tyr Ile
Val Met Val Asn Asp Leu Gly Asp Ser 5 10
15 20 att ctg agc tgg gcc gac cct gat
cac tat cgt gga cat acc gag gga 210Ile Leu Ser Trp Ala Asp Pro Asp
His Tyr Arg Gly His Thr Glu Gly 25
30 35 tgg gag ttc act gac ttt tct gct gct
ttt agc att gcc gtc gcg tac 258Trp Glu Phe Thr Asp Phe Ser Ala Ala
Phe Ser Ile Ala Val Ala Tyr 40 45
50 ctc ctg ttt gtc ttt gtt gga tct ctc att
atg agt atg gga gtc ccc 306Leu Leu Phe Val Phe Val Gly Ser Leu Ile
Met Ser Met Gly Val Pro 55 60
65 gca att gac cct tat ccg ctc aag ttt gtc tac
aat gtt tca cag att 354Ala Ile Asp Pro Tyr Pro Leu Lys Phe Val Tyr
Asn Val Ser Gln Ile 70 75
80 atg ctt tgt gct tac atg acc att gaa gcc agt
ctt cta gct tat cgt 402Met Leu Cys Ala Tyr Met Thr Ile Glu Ala Ser
Leu Leu Ala Tyr Arg 85 90 95
100 aac ggc tac aca ttc tgg cct tgc aac gat tgg gac
ttt gaa aag ccg 450Asn Gly Tyr Thr Phe Trp Pro Cys Asn Asp Trp Asp
Phe Glu Lys Pro 105 110
115 cct atc gct aag ctc ctc tgg ctc ttt tac gtt tcc aaa
att tgg gat 498Pro Ile Ala Lys Leu Leu Trp Leu Phe Tyr Val Ser Lys
Ile Trp Asp 120 125
130 ttt tgg gac acc atc ttt att gtt ctc ggg aag aag tgg
cgt caa ctt 546Phe Trp Asp Thr Ile Phe Ile Val Leu Gly Lys Lys Trp
Arg Gln Leu 135 140 145
tcc ttc ctg cac gtc tac cat cac acc acc atc ttt ctc ttc
tac tgg 594Ser Phe Leu His Val Tyr His His Thr Thr Ile Phe Leu Phe
Tyr Trp 150 155 160
ttg aat gca cat gta aac ttt gat ggt gat att ttc ctc acc atc
gtc 642Leu Asn Ala His Val Asn Phe Asp Gly Asp Ile Phe Leu Thr Ile
Val 165 170 175
180 ttg aac ggt ttc atc cac acc gtc atg tac acg tac tac ttc att
tgc 690Leu Asn Gly Phe Ile His Thr Val Met Tyr Thr Tyr Tyr Phe Ile
Cys 185 190 195
atg cac acc aag gtc cca gag acc ggc aaa tcc ttg ccc att tgg tgg
738Met His Thr Lys Val Pro Glu Thr Gly Lys Ser Leu Pro Ile Trp Trp
200 205 210
aaa tct agt ttg aca agc atg cag ctg gtg cag ttc atc acg atg atg
786Lys Ser Ser Leu Thr Ser Met Gln Leu Val Gln Phe Ile Thr Met Met
215 220 225
acg cag gct atc atg atc ttg tac aag ggc tgt gct gct ccc cat agc
834Thr Gln Ala Ile Met Ile Leu Tyr Lys Gly Cys Ala Ala Pro His Ser
230 235 240
cgg gtg gtg aca tcg tac ttg gtt tac att ttg tcg ctc ttt att ttg
882Arg Val Val Thr Ser Tyr Leu Val Tyr Ile Leu Ser Leu Phe Ile Leu
245 250 255 260
ttc gcc cag ttc ttt gtc agc tca tac ctc aag ccg aag aag aag aag
930Phe Ala Gln Phe Phe Val Ser Ser Tyr Leu Lys Pro Lys Lys Lys Lys
265 270 275
aca gct taa gcgaaatttg ggtctacgtt aaaacaatta cgttacaaaa
979Thr Ala aaaaaaaaaa aaaa
993184278PRTPhaeodactylum tricornutum 184Met Met Val Pro Ser Ser
Tyr Asp Glu Tyr Ile Val Met Val Asn Asp 1 5
10 15 Leu Gly Asp Ser Ile Leu Ser Trp Ala Asp Pro
Asp His Tyr Arg Gly 20 25
30 His Thr Glu Gly Trp Glu Phe Thr Asp Phe Ser Ala Ala Phe Ser
Ile 35 40 45 Ala
Val Ala Tyr Leu Leu Phe Val Phe Val Gly Ser Leu Ile Met Ser 50
55 60 Met Gly Val Pro Ala Ile
Asp Pro Tyr Pro Leu Lys Phe Val Tyr Asn 65 70
75 80 Val Ser Gln Ile Met Leu Cys Ala Tyr Met Thr
Ile Glu Ala Ser Leu 85 90
95 Leu Ala Tyr Arg Asn Gly Tyr Thr Phe Trp Pro Cys Asn Asp Trp Asp
100 105 110 Phe Glu
Lys Pro Pro Ile Ala Lys Leu Leu Trp Leu Phe Tyr Val Ser 115
120 125 Lys Ile Trp Asp Phe Trp Asp
Thr Ile Phe Ile Val Leu Gly Lys Lys 130 135
140 Trp Arg Gln Leu Ser Phe Leu His Val Tyr His His
Thr Thr Ile Phe 145 150 155
160 Leu Phe Tyr Trp Leu Asn Ala His Val Asn Phe Asp Gly Asp Ile Phe
165 170 175 Leu Thr Ile
Val Leu Asn Gly Phe Ile His Thr Val Met Tyr Thr Tyr 180
185 190 Tyr Phe Ile Cys Met His Thr Lys
Val Pro Glu Thr Gly Lys Ser Leu 195 200
205 Pro Ile Trp Trp Lys Ser Ser Leu Thr Ser Met Gln Leu
Val Gln Phe 210 215 220
Ile Thr Met Met Thr Gln Ala Ile Met Ile Leu Tyr Lys Gly Cys Ala 225
230 235 240 Ala Pro His Ser
Arg Val Val Thr Ser Tyr Leu Val Tyr Ile Leu Ser 245
250 255 Leu Phe Ile Leu Phe Ala Gln Phe Phe
Val Ser Ser Tyr Leu Lys Pro 260 265
270 Lys Lys Lys Lys Thr Ala 275
18520DNAUnknownmisc_feature(1)..(20)N at positions 3 and 18 is C or T.
185aanctuctut ggctuttnta
2018623DNAUnknownmisc_feature(1)..(23)N at positions 3 and 15 is C or T.
N at position 9, 12 and 21 is A or G. 186gantguacna anaantgugc naa
23187446DNAUnknownmisc_feature(1)..(446)PCR-Fragment 187aagctcctct
ggctctttta cgtttccaaa atttgggatt tttgggacac catctttatt 60gttctcggga
agaagtggcg tcaactttcc ttcctgcacg tctaccatca caccaccatc 120tttctcttct
actggttgaa tgcacatgta aactttgatg gtgatatttt cctcaccatc 180gtcttgaacg
gtttcatcca caccgtcatg tacacgtact acttcatttg catgcacacc 240aaggtcccag
agaccggcaa atccttgccc atttggtgga aatctagttt gacaagcatg 300cagctggtgc
agttcatcac gatgatgacg caggctatca tgatcttgta caagggctgt 360gctgctcccc
atagccgggt ggtgacatcg tacttggttt acattttgtc gctctttatt 420ttgttcgccc
agttctttgt cagctc
44618830DNAUnknownmisc_feature(1)..(30)Primer 188gcggccgcac ataatgatgg
taccttcaag
3018922DNAUnknownmisc_feature(1)..(22)Primer 189gaagacagct taatagacta gt
2219031DNAUnknownmisc_feature(1)..(31)Primer 190gcggccgcac catgatggta
ccttcaagtt a
3119124DNAUnknownmisc_feature(1)..(24)Primer 191gaagacagct taataggcgg
ccgc
24192859DNAUnknownmisc_feature(1)..(859)PCR product 192gcggccgcac
ataatgatgg taccttcaag ttatgacgag tatatcgtca tggtcaacga 60ccttggcgac
tctattctga gctgggccga ccctgatcac tatcgtggac ataccgaggg 120atgggagttc
actgactttt ctgctgcttt tagcattgcc gtcgcgtacc tcctgtttgt 180ctttgttgga
tctctcatta tgagtatggg agtccccgca attgaccctt atccgctcaa 240gtttgtctac
aatgtttcac agattatgct ttgtgcttac atgaccattg aagccagtct 300tctagcttat
cgtaacggct acacattctg gccttgcaac gattgggact ttgaaaagcc 360gcctatcgct
aagctcctct ggctctttta cgtttccaaa atttgggatt tttgggacac 420catctttatt
gttctcggga agaagtggcg tcaactttcc ttcctgcacg tctaccatca 480caccaccatc
tttctcttct actggttgaa tgcacatgta aactttgatg gtgatatttt 540cctcaccatc
gtcttgaacg gtttcatcca caccgtcatg tacacgtact acttcatttg 600catgcacacc
aaggtcccag agaccggcaa atccttgccc atttggtgga aatctagttt 660gacaagcatg
cagctggtgc agttcatcac gatgatgacg caggctatca tgatcttgta 720caagggctgt
gctgctcccc atagccgggt ggtgacatcg tacttggttt acattttgtc 780gctctttatt
ttgttcgccc agttctttgt cagctcatac ctcaagccga agaagaagaa 840gacagcttaa
tagactagt 859
User Contributions:
Comment about this patent or add new information about this topic: