Patent application title: NOVEL 7Beta-HYDROXYSTEROID DEHYDROGENASE MUTANTS AND PROCESS FOR THE PREPARATION OF URSODEOXYCHOLIC ACID
Inventors:
IPC8 Class: AC12N904FI
USPC Class:
1 1
Class name:
Publication date: 2021-05-13
Patent application number: 20210139862
Abstract:
In various aspects and embodiments, the invention provides a nucleic acid
molecule comprising a nucleotide sequence encoding a
7.beta.-hydroxysteroid dehydrogenase (7.beta.-HSDH) mutant that catalyzes
at least the stereospecific enzymatic reduction of a 7-ketosteroid to the
corresponding 7-hydroxysteroid, wherein the mutant has, compared to the
wildtype 7.beta.-HSDH of SEQ ID NO:2, a decreased substrate inhibition
and/or an altered cofactor usage, and the mutant has, in comparison with
the wildtype 7.beta.-HSDH of SEQ ID NO:2, 1 to 15 amino acid additions,
substitutions, deletions and/or inversions in the sequence motif VMVGRRE
corresponding to positions 36 to 42 of SEQ ID NO:2.Claims:
1. A nucleic acid molecule comprising a nucleotide sequence encoding a
7.beta.-hydroxysteroid dehydrogenase (7.beta.-HSDH) mutant that catalyzes
at least the stereospecific enzymatic reduction of a 7-ketosteroid to the
corresponding 7-hydroxysteroid, wherein the mutant has, compared to the
wildtype 7.beta.-HSDH of SEQ ID NO:2, a decreased substrate inhibition
and/or an altered cofactor usage, and the mutant has, in comparison with
the wildtype 7.beta.-HSDH of SEQ ID NO:2, 1 to 15 amino acid additions,
substitutions, deletions and/or inversions in the sequence motif VMVGRRE
corresponding to positions 36 to 42 of SEQ ID NO:2.
2. The nucleic acid molecule of claim 1, wherein the mutant has at least one mutation in the sequence motif VMVGRRE according to position 36 to 42 of SEQ ID NO:2 and at least 90% sequence identity to SEQ ID NO:2.
3. A recombinant microorganism comprising at least one nucleic acid sequence coding for the mutant of claim 1, at least one corresponding expression cassette, or at least one corresponding vector.
4. A process for enzymatic or microbial synthesis of 7.beta.-hydroxysteroids, comprising reacting the corresponding 7-ketosteroid in the presence of a 7.beta.-HSDH mutant of claim 1 or in the presence of a recombinant microorganism expressing said mutant, wherein at least one reduction product is formed.
5. The process of claim 4, wherein reduction takes place in the presence of NADPH and/or NADH.
6. The process of claim 5, further comprising: a) regenerating spent NADPH by coupling with an NADPH-regenerating enzyme selected from the group consisting of NADPH dehydrogenases, alcohol dehydrogenases (ADH), NADPH-regenerating formate dehydrogenases (FDH) and NADPH-regenerating glucose dehydrogenases (GDH; and/or b) regenerating spent NADH by coupling with an NADH-regenerating enzyme selected from the group consisting of NADH-dehydrogenases, NADH-regenerating formate dehydrogenases (FDH), NADH-regenerating alcohol dehydrogenases (ADH), NADH-regenerating glucose-6-phosphate-dehydrogenases (G6PDH), NADH-regenerating phosphite dehydrogenases (PtDH) and NADH-regenerating glucose dehydrogenases (GDH).
7. The process of claim 6, wherein the NADPH-regenerating enzyme is selected from the group consisting of mutants of an NAD.sup.+-dependent formate dehydrogenase (FDH) that at least catalyze the enzymatic oxidation of formic acid to CO.sub.2, wherein the mutants, compared to the nonmutated enzyme accept NADP.sup.+ as cofactor.
8. The process of claim 7, wherein the NADP.sup.+-accepting FDH mutant has at least one mutation in the amino acid sequence of an FDH from Mycobacterium vaccae N10 according to SEQ ID NO:36 or an amino acid sequence derived therefrom with at least 90% sequence identity to SEQ ID NO:36.
9. The process of claim 7, wherein the NADP.sup.+-accepting mutant has at least one mutation in the sequence motif TDRHRL according to position 221 to 226 of SEQ ID NO:36 or in the corresponding sequence motif of an amino acid sequence derived therefrom with at least 90% sequence identity to SEQ ID NO:36.
10. A nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of nucleic acid sequences that: a) simultaneously encode an FDH mutant of an NAD.sup.+-dependent formate dehydrogenase (FDH) that at least catalyzes the enzymatic oxidation of formic acid to CO.sub.2, wherein the mutant, compared to the nonmutated enzyme, accepts NADP.sup.+ as cofactor and the 7.beta.-HSDH wildtype; b) simultaneously encode an FDH mutant of an NAD.sup.+-dependent formate dehydrogenase (FDH) that at least catalyzes the enzymatic oxidation of formic acid to CO.sub.2, wherein the mutant, compared to the nonmutated enzyme, accepts NADP.sup.+ as cofactor and the nonmutated 7.beta.-HSDH wild type and optional a 3.alpha.-HSDH; c) encode a fusion protein comprising an FDH mutant selected from the group consisting of mutants of an NAD dependent formate dehydrogenase (FDH) that at least catalyze the enzymatic oxidation of formic acid to CO.sub.2, wherein the mutant, compared to the nonmutated enzyme, accepts NADP.sup.+ as cofactor and a 7.beta.-HSDH mutant encoded by the nucleic acid of claim 1; d) encode a fusion protein comprising an FDH mutant selected from the group consisting of mutants of an NAD.sup.+-dependent formate dehydrogenase (FDH) that at least catalyze the enzymatic oxidation of formic acid to CO.sub.2, wherein the mutant, compared to the nonmutated enzyme, accepts NADP.sup.+ as cofactor and a nonmutated 7.beta.-HSDH; e) simultaneously encode an FDH wild type and a 7.beta.-HSDH mutant encoded by the nucleic acid of claim 1; f) encode a fusion protein, comprising the FDH wild type and a 7.beta.-HSDH mutant encoded by the nucleic acid of claim in 1; g) simultaneously encode a GDH and a 7.beta.-HSDH wild type; h) coding for a fusion protein, comprising a GDH and a 7.beta.-HSDH wild type; i) simultaneously coding for a GDH and a 7.beta.-HSDH mutant encoded by the nucleic acid of claim 1; and j) coding for a fusion protein, comprising a GDH, a 7.beta.-HSDH mutant encoded by the nucleic acid of claim 1.
11. A recombinant microorganism comprising at least one nucleic acid molecule of claim 10.
12. A recombinant microorganism that simultaneously expresses: a) the 7.beta.-HSDH mutant encoded by the nucleic acid of claim 1, an NADP.sup.+-accepting FDH mutant and/or the corresponding FDH wild type; or b) that simultaneously expresses a 7.beta.-HSDH mutant and a GDH.
13. The recombinant microorganism of claim 12, wherein the FDH mutant is selected from the group consisting of mutants of an NAD.sup.+-dependent formate dehydrogenase (FDH) that at least catalyze the enzymatic oxidation of formic acid to CO.sub.2, wherein the mutant, compared to the nonmutated enzyme, accepts NADP.sup.+ as cofactor; and wherein the FDH wild type is an FDH from Mycobacterium vaccae N10 according to SEQ ID NO:36 or an FDH derived therefrom with at least 90% sequence identity to SEQ ID NO:36.
14. A process for preparing ursodeoxycholic acid (UDCA) of formula (1) ##STR00029## in which R stands for alkyl, NR.sup.1R.sup.2, H, an alkali metal ion or N(R.sup.3).sub.4.sub.+, in which the residues R.sup.3 may be identical or different and stand for H or alkyl, wherein the process comprises: a) reducing dehydrocholic acid (DHCA) of formula (3) ##STR00030## in which R has the meanings given above, in the presence of at least one 7.beta.-HSDH mutant of claim 1 and in the presence of at least one 3.alpha.-HSDH; to the corresponding 12-keto-ursodeoxycholic acid (12-keto UDCA) of formula (4) ##STR00031## in which R has the meanings given above; and chemically reducing the 12-keto-UDCA of formula (4) to UDCA.
15. A process for preparing ursodeoxycholic acid (UDCA) of formula (1); wherein R stands for alkyl, NR.sup.1R.sup.2, H, an alkali metal ion or N(R.sup.3).sub.4.sub.+, in which the residues R.sup.3 may be identical or different and stand for H or alkyl, wherein the process comprises: reducing dehydrocholic acid (DHCA) of formula (3) in which R has the meanings given above, in the presence of at least one 7.beta.-HSDH mutant of claim 1 and in the presence of a recombinant organism comprising a nucleic acid molecule comprising at least one nucleic acid sequence selected from the group consisting of nucleic acid sequences that: a) simultaneously encode an FDH mutant of an NAD.sup.+-dependent formate dehydrogenase (FDH) that at least catalyzes the enzymatic oxidation of formic acid to CO.sub.2, wherein the mutant, compared to the nonmutated enzyme, accepts NADP.sup.+ as cofactor and the 7.beta.-HSDH wildtype; b) simultaneously encode an FDH mutant of an NAD.sup.+-dependent formate dehydrogenase (FDH) that at least catalyzes the enzymatic oxidation of formic acid to CO.sub.2, wherein the mutant, compared to the nonmutated enzyme, accepts NADP.sup.+ as cofactor and the nonmutated 7.beta.-HSDH wild type and optional a 3.alpha.-HSDH; c) encode a fusion protein comprising an FDH mutant selected from the group consisting of mutants of an NAD dependent formate dehydrogenase (FDH) that at least catalyze the enzymatic oxidation of formic acid to CO.sub.2, wherein the mutant, compared to the nonmutated enzyme, accepts NADP.sup.+ as cofactor and a 7.beta.-HSDH mutant encoded by the nucleic acid of claim 1; d) encode a fusion protein comprising an FDH mutant selected from the group consisting of mutants of an NAD.sup.+-dependent formate dehydrogenase (FDH) that at least catalyze the enzymatic oxidation of formic acid to CO.sub.2, wherein the mutant, compared to the nonmutated enzyme, accepts NADP.sup.+ as cofactor and a nonmutated 7.beta.-HSDH; e) simultaneously encode an FDH wild type and a 7.beta.-HSDH mutant encoded by the nucleic acid of claim 1; f) encode a fusion protein, comprising the FDH wild type and a 7.beta.-HSDH mutant encoded by the nucleic acid of claim 1; g) simultaneously encode a GDH and a 7.beta.-HSDH wild type; h) coding for a fusion protein, comprising a GDH and a 7.beta.-HSDH wild type; i) simultaneously coding for a GDH and a 7.beta.-HSDH mutant encoded by the nucleic acid of claim 1; and j) coding for a fusion protein, comprising a GDH, a 7.beta.-HSDH mutant encoded by the nucleic acid of claim 1; to the corresponding 12-keto-ursodeoxycholic acid (12-keto UDCA) of formula (4) in which R has the meanings given above; and chemically reducing the 12-keto-UDCA of formula (4) to U DCA.
16. A process for preparing ursodeoxycholic acid (UDCA) of formula (1); wherein R stands for alkyl, NR.sup.1R.sup.2, H, an alkali metal ion or N(R.sup.3).sub.4.sub.+, in which the residues R.sup.3 may be identical or different and stand for H or alkyl, wherein the process comprises: reducing dehydrocholic acid (DHCA) of formula (3) in which R has the meanings given above, in the presence of at least one 7.beta.-HSDH mutant of claim 1 and in the presence of at least once nucleic acid sequence of claim 12; to the corresponding 12-keto-ursodeoxycholic acid (12-keto UDCA) of formula (4) ##STR00032## in which R has the meanings given above; and chemically reducing the 12-keto-UDCA of formula (4) to UDCA.
17. The nucleic acid molecule of claim 1, wherein the mutant has decreased substrate inhibition for a 7-ketosteroid substrate.
18. The process of claim 6, further comprising isolating at least one reduction product from the reaction mixture.
19. The process of claim 7, wherein the process takes place with the consumption of NADPH and/or NAD.
20. The process of claim 8, wherein the NADH-regenerating enzyme is expressed in a recombinant microorganism.
21. The nucleic acid molecule of claim 1, wherein the mutant has at least one mutation in the sequence motif VMVGRRE according to position 36 to 42 of SEQ ID NO:2 and at least 90% or 95% sequence identity to SEQ ID NO:2.
22. The recombinant microorganism of claim 5, further comprising a coding sequence for an additional enzyme.
23. The recombinant microorganism of claim 22, wherein the additional enzyme is selected from the group consisting of hydroxysteroid dehydrogenases and dehydrogenases suitable for cofactor regeneration.
24. The recombinant microorganism of claim 23, wherein the hydroxysteroid dehydrogenase is 3.alpha.-hydroxysteroid dehydrogenase (3.alpha.-HSDH).
25. The process of claim 8, wherein the NADPH-regenerating enzyme is expressed by a recombinant microorganism.
26. The nucleic acid molecule of claim 10, wherein the nucleic acid sequences further encode a 3.alpha.-hydroxysteroid dehydrogenase (3.alpha.-HSDH).
27. The recombinant organism of claim 12, that further simultaneously expresses a 3.alpha.-hydroxysteroid dehydrogenase (3.alpha.-HSDH).
28. The recombinant organism of claim 13, that further simultaneously expresses a 3.alpha.-hydroxysteroid dehydrogenase (3.alpha.-HSDH).
29. The process of claim 15, further comprising, prior to step a), chemically oxidizing a cholic acid (CA) of formula (2) ##STR00033## in which R has the meanings given above to dehydrocholic acid (DHCA) of formula (3) ##STR00034## in which R has the meanings given above.
30. The process of claim 15, wherein step a) is carried out in the presence of and with the consumption of NADH and/or NADPH.
31. The process of claim 15, further comprising purifying the ursodeoxycholic acid (UDCA) of formula (1).
32. A nucleic acid molecule comprising a nucleotide sequence encoding a 7.beta.-HSDH mutant, which catalyzes at least the stereospecific enzymatic reduction of a 7-ketosteroid to the corresponding 7-hydroxysteroid, wherein the mutant has at least 90% sequence identity to SEQ ID NO:2 and at least one mutation in the sequence motif VMVGRRE corresponding to positions 36 to 42 of SEQ ID NO:2, wherein the mutation is selected from the group consisting of: a) the single mutation G39X.sub.1; b) the single mutation R40X.sub.2; c) the double mutation G39X.sub.1 R40X.sub.2 d) the double mutation R40X.sub.2 R41X.sub.3; e) the double mutation G39X.sub.1 R41X.sub.3; and f) the triple mutation G39X.sub.1 R40X.sub.2 R41X.sub.3; wherein each of X1, X2 and X3 can be the same or different and stands for mutated amino acid residues.
33. A recombinant microorganism comprising at least one nucleic acid sequence coding for the mutant of claim 32, at least one corresponding expression cassette, or at least one corresponding vector.
34. A recombinant microorganism that simultaneously expresses: a) 7.beta.-HSDH (wild type), an NADP.sup.+-accepting FDH mutant and/or the corresponding FDH wild type; or b) which is capable of simultaneous expression of 7.beta.HSDH (wild type)and a GDH.
Description:
[0001] This application is a divisional under 35 U.S.C. .sctn. 121 of U.S.
Ser. No. 15/093,570, filed Apr. 7, 2016, which is a continuation under 35
U.S.C. .sctn. 120 of U.S. Ser. No. 13/993,235, filed Nov. 19, 2013, now
abandoned, which is the U.S. national phase pursuant to under 35 U.S.C.
.sctn. 371 of PCT international application No. PCT/EP2011/073141, filed
Dec. 16, 2011, which claims priority to EP patent application No.
10015726, filed December 16, 2012. The entire contents of each of the
aforementioned patent applications are incorporated herein by this
reference.
[0002] The invention relates to novel .beta.-hydroxysteroid dehydrogenase mutants, to the sequences that code for these enzyme mutants, to processes for the preparation of the enzyme mutants and use thereof in enzymatic reactions of cholic acid compounds, and especially in the preparation of ursodeoxycholic acid (UDCA); the invention also relates to novel processes for the synthesis of UDCA using the enzyme mutants; and to the preparation of UDCA using recombinant, multiply-modified microorganisms.
SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Aug. 11, 2016, is named 054410_00062(CON)_SL.txt and is 218,431 bytes in size.
BACKGROUND OF THE INVENTION:
[0004] The active substances ursodeoxycholic acid (UDCA) and the related diastereomer chenodeoxycholic acid (CDCA), among others, have been used for many years for the drug treatment of gallstone disease. The two compounds differ only in the configuration of the hydroxyl group on carbon atom 7 (UDCA: .beta.-configuration, CDCA: .alpha.-configuration). Various processes are described in the prior art for the preparation of UDCA, which are carried out purely chemically or consist of a combination of chemical and enzymatic process steps. The starting point is in each case cholic acid (CA) or CDCA prepared from cholic acid.
[0005] Thus, the classical chemical method for UDCA preparation can be represented schematically as follows:
##STR00001##
[0006] A serious disadvantage is, among other things, the following: as the chemical oxidation is not selective, the carboxyl group and the 3.alpha. and 7.alpha.-hydroxyl group must be protected by esterification.
[0007] An alternative chemical/enzymatic process based on the use of the enzyme 12.alpha.-hydroxysteroid dehydrogenase (12.alpha.-HSDH) can be represented as follows and is for example described in PCT/EP2009/002190 of the present applicant.
##STR00002##
[0008] The 12.alpha.-HSDH oxidizes CA selectively to 12-keto-CDCA. The two protection steps required according to the classical chemical method are then omitted.
[0009] Furthermore, Monti, D., et al., (One-Pot Multienzymatic Synthesis of 12-Ketoursodeoxycholic Acid: Subtle Cofactor Specificities Rule the Reaction Equilibria of Five Biocatalysts Working in a Row. Advanced Synthesis & Catalysis, 2009) describe an alternative enzymatic-chemical process, which can be represented schematically as follows:
##STR00003##
[0010] The CA is first oxidized from 7.alpha.-HSDH from Bacteroides fragilis ATCC 25285 (Zhu, D., et al., Enzymatic enantioselective reduction of -ketoesters by a thermostable 7 -hydroxysteroid dehydrogenase from Bacteroides fragilis. Tetrahedron, 2006. 62(18): p. 4535-4539) and 12.alpha.-HSDH to 7,12-diketo-LCA. These two enzymes are each NADH-dependent. After reduction by 7.beta.-HSDH (NADPH-dependent) from Clostridium absonum ATCC 27555 (DSM 599) (MacDonald, I. A. and P. D. Roach, Bile induction of 7 alpha- and 7 beta-hydroxysteroid dehydrogenases in Clostridium absonum. Biochim Biophys Acta, 1981. 665(2): p. 262-9), 12-keto-UDCA is formed. The end product is obtained by Wolff-Kishner reduction. This method has the drawback that owing to the position of the equilibrium of the catalyzed reaction, a complete reaction is not possible, and that for the first step of the reaction it is necessary to use two different enzymes, which makes the process more expensive. For cofactor regeneration, lactate dehydrogenase (LDH; for regeneration of NAD.sup.+) and glucose dehydrogenase (GIcDH or GDH, for regeneration of NADPH) are used. A disadvantage with the cofactor regeneration used there is that the resultant co-product can only be removed from the reaction mixture with great difficulty, so that the reaction equilibrium cannot be influenced positively, which results in incomplete reaction of the educt.
[0011] A 7.beta.-HSDH from the strain Collinsella aerofaciens ATCC 25986 (DSM 3979; formerly Eubacterium aerofaciens) was described in the year 1982 by Hirano and Masuda (Hirano, S. and N. Masuda, Characterization of NADP-dependent 7 beta-hydroxysteroid dehydrogenases from Peptostreptococcus productus and Eubacterium aerofaciens. Appl Environ Microbiol, 1982. 43(5): p. 1057-63). Sequence information for this enzyme was not disclosed. The molecular weight determined by gel filtration was 45 000 Da (cf. Hirano, page 1059, left column). Furthermore, for the enzyme there, the reduction of the 7-oxo group to the 7.beta.-hydroxyl group was not observed (cf. Hirano, page 1061, Discussion 1st paragraph). A person skilled in the art can therefore see that the enzyme described by Hirano et al. is not suitable for catalysis of the reduction of dehydrocholic acid (DHCA) in position 7 to 3,12-diketo-7.beta.-CA. The applicant's earlier international patent application PCT/EP2010/068576 describes a novel 7.beta.-HSDH from Collinsella aerofaciens ATCC 25986, which among other things has a molecular weight (in SDS-gel electrophoresis) of about 28-32 kDa, a molecular weight (in gel filtration, in nondenaturing conditions, such as in particular without SDS) from about 53 to 60 kDa, and the capacity for stereoselective reduction of the 7-carbonyl group of 7-keto-LCA to a 7.beta.-hydroxyl group.
[0012] In addition, in PCT/EP2010/068576, a process is provided for the preparation of UDCA, which can be represented schematically as follows:
##STR00004##
[0013] In this case the oxidation of CA takes place simply, by a classical chemical route. DHCA is reduced by the pair of enzymes 7.beta.-HSDH and 3.alpha.-HSDH individually in succession or in one pot to 12-keto-UDCA. Combined with Wolff-Kishner reduction, UDCA can therefore be synthesized from CA in just three steps. 7.beta.-HSDH is dependent on the cofactor NADPH, whereas 3.alpha.-HSDH requires the cofactor NADH. The availability of pairs of enzymes with dependence on the same cofactor or extended dependence (e.g. on the cofactors NADH and NADPH) would be advantageous, because this could simplify cofactor regeneration.
[0014] The problem to be solved by the invention is to provide further improved 7.beta.-HSDHs. In particular, enzyme mutants should be provided, which can be used even more advantageously for enzymatic or microbial preparation of UDCA via the stereospecific reduction of DHCA in 7-position to 3,12-diketo-7.beta.-CA, and in particular have reduced substrate inhibition and/or have altered cofactor usage (increased, altered specificity or extended dependence).
[0015] Another problem is to provide novel enzymatic and microbial synthesis routes, which in particular are also characterized by simplified cofactor regeneration in the reductive preparation of UDCA via DHCA.
SUMMARY OF THE INVENTION
[0016] The above problems were solved, surprisingly, by the production and characterization of mutants of a novel regio- and stereospecific 7.beta.-HSDH from aerobic bacteria of the genus Collinsella, especially of the strain Collinsella aerofaciens and use thereof in the reaction of cholic acid compounds, especially in the preparation of UDCA.
[0017] Furthermore, the above problem was solved by providing a biocatalytic (microbial or enzymatic) process, comprising the enzymatic conversion of DHCA via two partial reductive steps catalyzed by 7.beta.-HSDH or 3.alpha.-HSDH, which can take place simultaneously or with a time delay in any order, to 12-keto-UDCA and cofactor regeneration using dehydrogenases, such as in particular formate dehydrogenase (FDH) enzymes or glucose dehydrogenase (GDH) enzymes, which regenerate the spent cofactor from the two partial reductive steps.
DESCRIPTION OF THE FIGURES
[0018] FIG. 1A shows the amino acid sequence of 7.beta.-HSDH from Collinsella aerofaciens and FIG. 1B shows the coding nucleic acid sequence for the amino acid sequence of FIG. 1A; FIG. 1C shows the amino acid sequence of 3.alpha.-HSDH from Comanomonas testosteroni and FIG. 1D shows the coding nucleic acid sequence for the amino acid sequence of FIG. 1C; FIG. 1E shows the amino acid sequence of 3.alpha.-HSDH from Rattus norvegicus and FIG. 1F shows the coding nucleic acid sequence for the amino acid sequence of FIG. 1E; FIG. 1G shows the coding nucleic acid sequence of the FDH mutant D221G and FIG. 1H shows the amino acid sequence for the nucleic acid sequence of FIG. 1G.
[0019] FIG. 2 shows the SDS-gel of a purified 7.beta.-HSDH prepared according to the invention, with, on lane 1: cell raw extract; lane 2: purified protein; lane M: Page Rouler.TM., molecular weight marker (Fermentas, Germany).
[0020] FIG. 3A, FIG. 3B, FIG. 3C and FIG. 3D shows the construction schemes of (A) pET21a(+),pET22b(+), pCOLA (Mod) and pET28a(+), respectively.
[0021] FIG. 4A and FIG. 4B show the construction schemes of pET21a(+) FDH D221G and pET21a(+) FDH 7.beta.-HSDH, respectively.
[0022] FIG. 5 shows the construction scheme of pCOLA(mod) 3.dbd.-HSDH.
[0023] FIGS. 6A and 6B show an activity comparison for 7.beta.-HSDH wild type and the 7.beta.-HSDH mutants G39A and G39S; specifically. FIG. 6A is a plot of the specific enzyme activity versus different substrate concentrations used at constant cofactor concentration of 100 .mu.M. FIG. 6B is a plot of enzyme activity versus different cofactor concentrations used at constant substrate concentration of 0.3 mM.
[0024] FIG. 7 shows the HPLC chromatogram of the biotransformation of DHCS with 7.beta.-HSDH and 3.alpha.-HSDH in the whole-cell process. It shows the HPLC chromatogram of the whole-cell conversion of the strain E. coli BL21 (DE3) hdhA.sup.- KanR.sup.+ pET21a(+) FDH 7.beta.-HSDH pCOLA(mod) 3.alpha.-HSDH. The starting conditions selected were 50 mM substrate, 400 mM cosubstrate, pH 6.0. Sampling was carried out after 48 h. The peaks of 12-keto-UDCA (1), an unknown by-product (2), 3,12-diketo-UDCA (3), 7,12-diketo-UDCA (4) and DHCA (5) can be seen.
[0025] FIG. 8 shows the construction scheme of the triple vector pET21a(+) FDH 7beta (G39A) that bears the coding sequences for FDH D221G, 7.beta.-HSDH G39A and 3.alpha.-HSDH.
[0026] FIG. 9 shows the course of whole-cell biotransformation of DHCA. The proportionate peak areas (according to HPLC analysis) of 12-keto-UDCA, 3,12-diketo-UDCA, 7,12-diketo-UDCA and DHCA are shown as a function of time.
[0027] FIG. 10 shows a sequence comparison between the 7.beta.-HSDH wild type and selected mutants. The sequences designated as "7beta-HSDH wild type", "7beta-HSDH G39D", "7beta-HSDH G39D R40L", "7beta-HSDH G39D R40I" and "7beta-HSDH G39D R40V" correspond to SEQ ID NO:2, SEQ ID NO:37, SEQ ID NO:38 and SEQ ID NO:39.
[0028] FIG. 11 shows an enzyme-kinetic investigation of 7.beta.-HSDH and the mutants thereof. The specific enzyme activity is plotted versus different substrate concentrations used (DHCA concentration) at a constant cofactor concentration of 0.1 mM NADPH or 0.5 mM NADH.
[0029] FIG. 12 shows a schematic representation of a two-step enzymatic reduction of dehydrocholic acid to 12-keto-ursodeoxycholic acid according to the invention, wherein an NADH-dependent 7.beta.-HSDH is used and a formate dehydrogenase (FDH) is used for cofactor regeneration.
[0030] FIG. 13 shows a schematic representation of the principle of construction of the vectors pFr7(D), pFr7(DI), pFr7(DL) and pFr7(DV) that were used for the expression of various NADH-dependent mutants of 7.beta.-HSDH.
[0031] FIG. 14 shows the proportions of bile salts in biotransformation batches using NADH-dependent 7.beta.-HSDH mutants. Results after 24 h process time and using 100 mM substrate (DHCA) are shown.
[0032] FIG. 15 shows a schematic representation of the vector pFr3T7(D).
[0033] FIG. 16 shows the result of a whole-cell biotransformation with the strain E. coli BL49 pFr3T7(D), which comprises the NADH-dependent 7.beta.-HSDH (G39D), an NADH-dependent 3.alpha.-HSDH and an NADH-dependent FDH. The biotransformations were carried out in the following conditions: 20 mL reaction volume, 17.7 g/I.sub.BTM cells, 100 mM DHCA, 500 mM ammonium formate, 26% glycerol, 50 mM MgCl.sub.2, 50 mM KPi buffer (pH 6.5). During the first 5 hours the pH was adjusted manually with formic acid to the initial value at hourly intervals.
[0034] FIG. 17A shows a schematic representation of vector pF(G)r7(A)r3which corresponds to the vector shown in FIG. 8) and FIG. 17B shows a schematic representation of vector pF(G)r7(S)r3.
[0035] FIG. 18 shows a schematic representation of the two-step enzymatic reduction of dehydrocholic acid to 12-keto-ursodeoxycholic acid, wherein an NADPH-dependent 7.beta.-HSDH is used and a formate dehydrogenase (FDH) mutant, which regenerates both NADPH- and NADH, is used for cofactor regeneration.
[0036] FIG. 19 shows a time-resolved variation of the biotransformation with the strain E. coli BL49 pF(G)r7(A)r3 at the liter scale. The batch contained 70 mM DHCA, 17.7 g/I.sub.BTM of the stored biocatalyst, 500 mM sodium formate, 26% (v/v) glycerol, 50 mM MgCl.sub.2, in 50 mM KPi buffer (pH 6.5). Using pH adjustment, the pH was maintained at pH 6.5 throughout the biotransformation.
[0037] FIG. 20 shows a schematic representation of the vector p3T7(A)rG.
[0038] FIG. 21 shows a schematic representation of the vector p7(A)T3rG.
[0039] FIG. 22A and FIG. 22B show a time-resolved variation of the biotransformation with the strain E. coli BL49 p7(A)T3rG, which comprises a GDH for cofactor regeneration. The batch contained 100 mM DHCA, 17.7 g/I.sub.BTM of the stored biocatalyst, 500 mM glucose, 10 mM MgCl.sub.2, in 50 mM KPi buffer (pH 7) without (FIG. 22A) and with 0.1 mM NAD (FIG. 22B). The pH was adjusted manually with potassium hydroxide solution to the initial value.
[0040] FIG. 23A shows a schematic representation of vector pF(G)r7(A) and FIG. 23B shows a schematic representation of vector pFr3.
[0041] FIG. 24 shows a schematic representation of the two-step enzymatic reduction of dehydrocholic acid to 12-keto-ursodeoxycholic acid using two different whole-cell biocatalysts. Reactions A and D are catalyzed by a 7.beta.-HSDH containing whole-cell biocatalyst, and reactions B and C are catalyzed by a 3.alpha.-HSDH containing whole-cell biocatalyst. In the course of the two-step reaction, the intermediate 3,12-diketo-ursodeoxycholic acid must pass from the 7.beta.-HSDH containing whole-cell biocatalyst into the 3.alpha.-HSDH containing whole-cell biocatalyst, and the intermediate 7,12-diketo-ursodeoxycholic acid must pass from the 3.alpha.-HSDH containing whole-cell biocatalysts into the 7.beta.-HSDH containing whole-cell biocatalyst.
[0042] FIG. 25 shows the proportions of bile salts of biotransformation batches after 24 h when using 70 mM substrate (DHCA). The batches are shown when using different proportions of the two biocatalyst strains E. coli BL49 pF(G)r7(A) and E. coli BL49 pFr3.
[0043] FIG. 26 shows a time-resolved variation of biotransformation with the biocatalysts E. coli BL49 pF(G)r7(A) and E. coli BL49 pFr3 liter scale. The batch contained 90 mM DHCA, 8.85 g/I.sub.BTM E. coli BL49 pF(G)r7(A) and 8.85 g/I.sub.BTM E. coli BL49 pFr3, 500 mM ammonium formate, 26% (v/v) glycerol, 50 mM MgCl.sub.2, in 50 mM KPi buffer (pH 6.5). Using pH adjustment, the pH was maintained with formic acid at pH 6.5 throughout the biotransformation.
SPECIAL EMBODIMENTS OF THE INVENTION
[0044] The invention relates in particular to the following special embodiments:
[0045] 1. A 7.beta.-hydroxysteroid dehydrogenase (7.beta.-HSDH) mutant, which catalyzes at least the stereospecific enzymatic reduction of a 7-ketosteroid to the corresponding 7-hydroxysteroid, wherein the mutant has a decreased substrate inhibition (especially for the 7-ketosteroid substrate) compared to the unmutated enzyme, such as in particular an enzyme comprising SEQ ID NO:2 and/or at least the sequence motif VMVGRRE according to position 36 to 42 thereof; and/or an altered cofactor usage (e.g. increased, altered specificity with respect to a cofactor (especially NADH or NADPH) or an extended dependence, i.e. usage of an additional cofactor not used previously).
[0046] 2. Mutant according to embodiment 1, which does not display any substrate inhibition or which has a K.sub.i value for the 7-ketosteroid substrate, especially for dehydrocholic acid (DHCA), in the range from >10 mM, e.g. at 11 to 200 mM, 12 to 150 mM, 15 to 100 mM.
[0047] 3. Mutant according to one of the preceding embodiments, wherein the specific activity (U/mg) in the presence of the cofactor NADPH, compared to the unmutated enzyme, is raised or lowered by at least 1, 5 or 10%, but especially at least 1-fold, especially 2- to 10-fold; or essentially is absent and is replaced by the usage of NADH, or has an extended usage of NADPH and HADH.
[0048] 4. A 7.beta.-hydroxysteroid dehydrogenase (7.beta.-HSDH) mutant, which catalyzes at least the stereospecific enzymatic reduction of a 7-ketosteroid to the corresponding 7-hydroxysteroid, optionally according to one of the preceding embodiments, wherein the mutant has at least one mutation in the amino acid sequence according to SEQ ID NO:2 or an amino acid sequence derived therefrom with at least 60% sequence identity, e.g. at least 65, 70, 75, 80, 85, or 90, e.g. at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.5% to this sequence.
[0049] 5. A 7.beta.-hydroxysteroid dehydrogenase (7.beta.-HSDH) mutant, which catalyzes at least the stereospecific enzymatic reduction of a 7-ketosteroid to the corresponding 7-hydroxysteroid, optionally according to one of the preceding embodiments, wherein the mutant has at least one mutation in the sequence motif VMVGRRE according to position 36 to 42 of SEQ ID NO:2 or in the corresponding sequence motif of an amino acid sequence derived therefrom with at least 60% sequence identity, e.g. at least 65, 70, 75, 80, 85, or 90, e.g. at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.5% to this sequence.
[0050] 6. Mutant according to embodiment 4 or 5, selected from
[0051] a) the single mutants G39X.sub.1 and R40X.sub.2,
[0052] b) the double mutants (G39X.sub.1, R40X.sub.2), (R40X.sub.2, R41X.sub.3) and (G39X.sub.1, R41X.sub.3) or
[0053] c) the triple mutant (G39X.sub.1, R40X.sub.2, R41X.sub.3), (in each case relative to SEQ ID NO:2) wherein X.sub.1, X.sub.2 and X.sub.3 in each case independently of one another stand for any amino acid, especially any, especially natural, amino acid, different from G or R, that decreases substrate inhibition and/or modifies cofactor usage or cofactor dependence; or
[0054] d) the corresponding single, double or triple mutants of an amino acid sequence derived from SEQ ID NO:2 with at least 60% sequence identity, e.g. at least 65, 70, 75, 80, 85, or 90, e.g. at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.5% to this sequence. Examples of suitable single mutants comprise: G39A, G39S, G39D, G39V, G39T, G39P, G39N, G39E, G39Q, G39H, G39R, G39K and G39W, and R40D, R40E, R40I, R40V, R40L, R40G, R40A.
[0055] Examples of suitable double mutants comprise:
[0056] double combinations of the above G39X.sub.1 and R40X.sub.2 mutants, wherein X.sub.1 stands in particular for D or E and/or X.sub.2 can be any amino acid, especially proteinogenic amino acid, such as in particular an amino acid with aliphatic side chain, for example (G39D,R40I), (G39D,R40L), (G39D,R40V); and the analogous double mutants with G39E instead of G39D; and double combinations of the above G39X.sub.1 mutants or R40X.sub.2 mutants with R41X.sub.3 mutants, in which X.sub.3 is any amino acid, especially an, especially natural, amino acid, that decreases substrate inhibition and/or that modifies cofactor usage or cofactor dependence, different from R, for example of the type (G39X.sub.1,R41X.sub.3) or (R40X.sub.2,R41X.sub.3), e.g. with X.sub.1=D or E; X.sub.2=I, L or V; X.sub.3=N, I, L or V) for example (R40D,R41I); (R40D,R41L); (R40D,R41V); (R40I,R41I); (R40V,R41I), (R40L,R41I).
[0057] Examples of suitable triple mutants comprise any triple combinations of the above single mutants G39X.sub.1, R40X.sub.2 and R41X.sub.3; wherein X.sub.1, X.sub.2 and X.sub.3 are as defined above; but especially wherein X.sub.1 stands for D, or E and/or X.sub.2 and X.sub.3 stand independently of one another for any amino acid, especially a proteinogenic amino acid, such as in particular triple mutants of the type (G39X.sub.1=D or E; R40X.sub.2=I, L or V; R41X.sub.3=N, I, L or V), for example (G39D,R40I,R41N).
[0058] Optionally the mutants of embodiments 1 to 6 can have, additionally or alternatively, especially additionally, at least one further substitution, for example 1, 2, 3 or 4 substitutions in the positions K44, R53, K61 and R64. In this case these residues can be replaced, independently of one another, with any amino acid, especially a proteinogenic amino acid, especially a substitution such that the resultant mutant has a decreased substrate inhibition (especially for the 7-ketosteroid substrate); and/or has an altered cofactor usage or cofactor dependence (e.g. increased, altered specificity with respect to a cofactor or an extended dependence, i.e. usage of an additional cofactor not used previously) as defined herein.
[0059] 7. Nucleic acid sequence coding for a 7.beta.-HSDH mutant according to one of the preceding embodiments.
[0060] 8. Expression cassette, comprising a nucleic acid sequence according to embodiment 7 under the genetic control of at least one regulatory nucleic acid sequence, and optionally coding sequences for at least one (for example 1, 2 or 3) further enzyme, selected from hydroxysteroid dehydrogenases, especially 3.alpha.-HSDH, and dehydrogenases suitable for cofactor regeneration, for example FDH, GDH, ADH, G-6-PDH, PDH. In particular the enzymes contained in an expression cassette can use different, but preferably the same pairs of cofactors, for example the pair of cofactors NAD.sup.+/NADH or NADP.sup.+/NADPH.
[0061] 9. Vector comprising at least one expression cassette according to embodiment 8.
[0062] 10. Recombinant microorganism, bearing at least one nucleic acid sequence according to embodiment 7 or at least one expression cassette according to embodiment 8 or bearing at least one vector according to embodiment 9 and additionally, optionally, bearing the coding sequence for a 3.alpha.-hydroxysteroid dehydrogenase (3.alpha.-HSDH).
[0063] 11. Process for the enzymatic or microbial synthesis of 7.beta.-hydroxysteroids, wherein the corresponding 7-ketosteroid is reacted in the presence of a 7.beta.-HSDH mutant according to the definition in one of the embodiments 1 to 6 or in the presence of a recombinant microorganism expressing this mutant according to embodiment 10, and at least one resultant reduction product is optionally isolated from the reaction mixture.
[0064] 12. The process according to embodiment 11, wherein the ketosteroid to be reduced is selected from
[0065] a) dehydrocholic acid (DHCA),
[0066] b) 7-keto-lithocholic acid (7-keto-LCA),
[0067] c) 7,12-diketo-lithocholic acid (7,12-diketo-LCA) and
[0068] d) derivatives thereof, such as in particular a salt, amide or alkyl ester of the acid.
[0069] 13. The process according to one of the embodiments 11 and 12, wherein the reduction takes place in the presence of (and with the consumption of) NADPH and/or NADH.
[0070] 14. A process for enzymatic or microbial oxidation of 7.beta.-hydroxysteroids, wherein the hydroxysteroid is reacted in the presence of a 7.beta.-HSDH mutant according to the definition in one of the embodiments 1 to 6 or in the presence of a microorganism expressing this mutant according to embodiment 10, and a resultant oxidation product is optionally isolated from the reaction mixture.
[0071] 15. The process according to embodiment 14, wherein the 7.beta.-hydroxysteroid is 3,12-diketo-7.beta.-CA or a derivative thereof, such as in particular a salt, amide or alkyl ester.
[0072] 16. The process according to one of the embodiments 14 and 15, wherein the oxidation takes place in the presence of (and with the consumption of) NADP.sup.+ and/or NAD.sup.+.
[0073] 17. The process according to one of the embodiments 13 and 16, wherein the spent redox equivalents are regenerated chemically, electrochemically or enzymatically, especially in situ.
[0074] 18. The process according to embodiment 17, wherein spent NADPH is regenerated by coupling with an NADPH-regenerating enzyme, wherein this is selected in particular from NADPH dehydrogenases, alcohol dehydrogenases (ADH), and NADPH regenerating formate dehydrogenases (FDH), and glucose dehydrogenase (GDH)-, glucose-6-phosphate dehydrogenase (G-6-PDH), or phosphite dehydrogenases (PtDH), wherein the NADPH-regenerating enzyme is optionally expressed by a recombinant microorganism; or wherein spent NADH is regenerated by coupling with an NADH-regenerating enzyme, wherein this is selected in particular from NADH dehydrogenases, NADH regenerating formate dehydrogenases (FDH), NADH regenerating alcohol dehydrogenases (ADH), NADH regenerating glucose-6-phosphate dehydrogenases (G6PDH), NADH regenerating phosphite dehydrogenases (PtDH) and NADH regenerating glucose dehydrogenases (GDH), wherein the NADH-regenerating enzyme is optionally expressed in a recombinant microorganism.
[0075] Expression of the cofactor-regenerating enzyme in a recombinant microorganism is preferred.
[0076] 19. The process according to embodiment 18, wherein the NADPH-regenerating enzyme is selected from natural or recombinant, isolated or enriched
[0077] a) alcohol dehydrogenases (EC 1.1.1.2) and
[0078] b) functional equivalents derived therefrom.
[0079] 20. The process according to embodiment 18, wherein the NADPH-regenerating enzyme is selected from mutants of an NAD.sup.+-dependent formate dehydrogenase (FDH), which in particular catalyzes at least the enzymatic oxidation of formic acid to CO.sub.2, wherein the mutant accepts, compared to the unmutated enzyme, exclusively or additionally, especially additionally, NADP.sup.+ as cofactor; or
[0080] wherein the NADH-regenerating enzyme is selected from an NAD.sup.+-dependent FDH or an NAD.sup.+-dependent GDH, such as in particular an FDH from Mycobacterium vaccae N10, according to SEQ ID NO:36 and a GDH from Bacillus subtilis according to SEQ ID NO:48 (which regenerates NADPH and/or NADH) or a modified form thereof in each case functionally equivalent (with respect to cofactor regeneration) to the two stated enzymes.
[0081] 21. The process according to embodiment 20, wherein the FDH mutant reduces NADP.sup.+ with a specific activity to NADPH, which corresponds to about 0.1 to 1000%, such as 1 to 100%, 5 to 80% or 10 to 50%, of the specific activity of the unmutated (wild-type) enzyme for the reduction of NAD.sup.+ to NADH.
[0082] 22. The process according to one of the embodiments 20 and 21, wherein the NADP.sup.+-accepting FDH mutant has at least one mutation in the amino acid sequence of an FDH from Mycobacterium vaccae N10 according to SEQ ID NO:36 or an amino acid sequence derived therefrom with at least 60% sequence identity, e.g. at least 65, 70, 75, 80, 85, or 90, e.g. at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.5% to this sequence.
[0083] 23. The process according to one of the embodiments 20 to 22, wherein the NADP.sup.+-accepting mutant has at least one mutation in the sequence motif TDRHRL according to position 221 to 226 of SEQ ID NO:36 or in the corresponding sequence motif of an amino acid sequence derived therefrom with at least 60% sequence identity, e.g. at least 65, 70, 75, 80, 85, or 90, e.g. at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.5% to this sequence.
[0084] Non-limiting examples of possibly suitable FDH mutants comprise mutations in the positions D222 and/or R223 of SEQ ID NO:36. As examples we may mention D222X with X=G, A, K or N; and R223X with X=H or Y, and combinations of mutations in position 222 and 223.
[0085] 24. The process according to one of the embodiments 20 to 23, wherein the NADP.sup.+-accepting mutant is selected from the single mutant D222G according to SEQ ID NO:36 (herein also more often designated as "D221G" mutant (with counting, starting from Ala in position 2 of SEQ ID NO:36 as first amino acid) or the corresponding single mutants of an amino acid sequence derived therefrom with at least 60% sequence identity, e.g. at least 65, 70, 75, 80, 85, or 90, e.g. at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.5% to this sequence. As concrete examples, we may mention FDH mutants according to SEQ ID NO: 15, 19 and 35.
[0086] Further suitable FDH enzymes are accessible starting from the wild-type enzymes that can be isolated e.g. from Candida boidinii or Pseudomonas sp, and insertion of at least one functional mutation corresponding to the above mutations for altering the cofactor specificity. Moreover, there have been numerous studies in the prior art for improving various FDH properties, such as chemical or thermal stability or catalytic activity. These are summarized e.g. in Tishkov et al., Biomolecular Engineering 23 (2006), 89-110. Thus, single or multiple point mutations described there can be combined, for example for increasing enzyme stability, with the mutations described according to the invention for modified cofactor usage.
[0087] 25. A nucleic acid sequence, selected from nucleic acid sequences a) simultaneously coding for an FDH mutant according to one of the embodiments 22 to 24 and a 7.beta.-HSDH mutant according to one of the embodiments 1 to 6 and optionally a 3.alpha.-HSDH; or b) simultaneously coding for an FDH mutant according to one of the embodiments 22 to 24 and an unmutated 7.beta.-HSDH and optionally a 3.alpha.-HSDH; or c) coding for a fusion protein comprising an FDH mutant according to one of the embodiments 22 to 24 and a 7.beta.-HSDH mutant according to one of the embodiments 1 to 6 and optionally a 3.alpha.-HSDH; or d) coding for a fusion protein comprising an FDH mutant according to one of the embodiments 22 to 24 and an unmutated 7.beta.-HSDH and optionally a 3.alpha.-HSDH, e) simultaneously coding for FDH wild type and a 7.beta.-HSDH mutant according to one of the embodiments 1 to 6 and optionally a 3.alpha.-HSDH; or f) coding for a fusion protein, comprising the FDH wild type, a 7.beta.-HSDH mutant according to one of the embodiments 1 to 6 and optionally a 3.alpha.-HSDH; g) simultaneously coding for a GDH, a 7.beta.-HSDH wild type and optionally a 3.alpha.-HSDH; h) coding for a fusion protein, comprising a GDH, a 7.beta.-HSDH wild type and optionally a 3.alpha.-HSDH; i) simultaneously coding for a GDH, a 7.beta.-HSDH mutant according to one of the embodiments 1 to 6 and optionally a 3.alpha.-HSDH; and k) coding for a fusion protein, comprising a GDH, a 7.beta.-HSDH mutant according to one of the embodiments 1 to 6 and optionally a 3.alpha.-HSDH;
[0088] wherein the coding sequences can be contained, independently of one another, singly or multiply in the construct, for example in 2, 3, 4, 5, or 6 to 10 copies. Through selection of the appropriate copy number, optionally occurring activity differences in the individual expression products can be compensated.
[0089] 26. Expression cassette, comprising a nucleic acid sequence according to embodiment 25 under the genetic control of at least one regulatory nucleic acid sequence, wherein the coding sequences, independently of one another, can be contained singly or multiply in the construct, for example in 2, 3, 4, 5, or 6 to 10 copies. Through selection of the appropriate copy number, optionally occurring activity differences in the individual expression products can be compensated.
[0090] 27. A vector comprising at least one expression cassette according to embodiment 26, wherein the coding sequences, independently of one another, can be contained singly or multiply in the vector construct, for example in 2, 3, 4, 5, or 6 to 10 copies. Through selection of the appropriate copy number, optionally occurring activity differences in the individual expression products can be compensated.
[0091] 28. A recombinant microorganism bearing at least one nucleic acid sequence according to embodiment 25 or at least one expression cassette according to embodiment 27 or bearing at least one vector according to embodiment 28.
[0092] 29. A recombinant microorganism that is capable of simultaneous expression of 7.beta.-HSDH (wild type), an NAD.sup.+-accepting FDH mutant and/or the corresponding FDH wild type and optionally of 3.alpha.-HSDH; or which is capable of simultaneous expression of 7.beta.-HSDH (wild type), a GDH described herein and optionally a 3.alpha.-HSDH described herein.
[0093] 30. A recombinant microorganism that is capable of simultaneous expression of a 7.beta.-HSDH mutant, an NADP.sup.+-accepting FDH mutant and/or the corresponding FDH wild type and optionally of 3.alpha.-HSDH; or which is capable of simultaneous expression of a 7.beta.-HSDH mutant, a GDH described herein and optionally a 3.alpha.-HSDH described herein.
[0094] 31. The recombinant microorganism according to embodiment 30, wherein the 7.beta.-HSDH mutant is a mutant according to one of the embodiments 1 to 6.
[0095] 32. The recombinant microorganism according to embodiment 29 or 30, wherein the FDH mutant is a mutant according to the definition in one of the embodiments 20 to 24; and wherein the FDH wild type is an FDH from Mycobacterium vaccae N10 according to SEQ ID NO:36 or an FDH derived therefrom with at least 60% sequence identity, e.g. at least 65, 70, 75, 80, 85, or 90, e.g. at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.5% to this sequence.
[0096] 33. The recombinant microorganism according to embodiment 29 or 30, wherein the 3.alpha.-HSDH is an enzyme comprising an amino acid sequence according to SEQ ID NO: 6 or 8 or 22 or an amino acid sequence derived therefrom with at least 60% sequence identity, e.g. at least 65, 70, 75, 80, 85, or 90, e.g. at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.5% to this sequence.
[0097] 34. The recombinant microorganism according to one of the embodiments 29 to 33, bearing the coding sequences for 7.beta.-HSDH, FDH and 3.alpha.-HSDH on one or more (different) expression constructs. The invention therefore relates to recombinant microorganisms, which are modified (for example transformed) with a single-plasmid system, bearing the coding sequences for 7.beta.-HSDH or mutants thereof, FDH or mutants thereof and 3.alpha.-HSDH or mutants thereof in one or more copies, for example in 2, 3, 4, 5, or 6 to 10 copies. The invention therefore also relates to recombinant microorganisms, which are modified (for example transformed) with a single-plasmid system, bearing the coding sequences for 7.beta.-HSDH or mutants thereof, GDH or mutants thereof and 3.alpha.-HSDH or mutants thereof in one or more copies, for example in 2, 3, 4, 5 or 6 to 10 copies. The enzymes (7.beta.-HSDH, FDH and 3.alpha.-HSDH or mutants thereof) can, however, also be contained on 2 or 3 separate, mutually compatible plasmids in one or more copies. Suitable basis vectors for preparing single-plasmid systems and multicopy plasmids are known by a person skilled in the art. As examples we may mention, for single-plasmid system, e.g. pET21a and for multicopy plasmids e.g. the duet vectors marketed by the company Novagen, such as pACYCDuet-1, pETDuet-1, pCDFDuet-1, pRSFDuet-1 and pCOLADuet-1. Vectors of this kind, their compatibility with other vectors and microbial host strains are given e.g. in the "User Protocol TB340 Rev. E0305" of the company Novagen.
[0098] The optimal combination of enzymes for the generation of plasmid systems can be undertaken by a person skilled in the art without undue effort, taking into account the teaching of the present invention. Thus, a person skilled in the art can, for example, depending on the cofactor specificity of the 7.beta.-HSDH enzyme used in each case, select the most suitable enzyme for cofactor regeneration, selected from the aforementioned dehydrogenases, especially FDH, GDH and the respective mutants thereof.
[0099] Furthermore, there is the possibility of distributing the enzymes selected for the reaction on two or more plasmids and, with the resultant plasmids, producing two or more different recombinant microorganisms, which are then used together for the biocatalytic reaction according to the invention. The particular enzyme combination used for preparing the plasmid can in particular also be applied specifying comparable cofactor usage. For example, a first microorganism can be modified with a plasmid, which bears the coding sequence for an NADPH-dependent 7.beta.-HSDH mutant and an FDH mutant regenerating this cofactor according to the present invention, or which bears the coding sequence for an NADPH-dependent 7.beta.-HSDH mutant and NADPH-regenerating GDH, or the coding sequence for an NADH-dependent 7.beta.-HSDH and an NADH-regenerating FDH and/or GDH. A second microorganism can, in contrast, be modified with a plasmid that bears the coding sequence for an NADH-dependent 3.alpha.-HSDH and the coding sequence for an NADH-regenerating FDH wild type and/or for an NADH-regenerating GDH. Both microorganisms can then be used simultaneously for the biocatalytic reaction according to the invention.
[0100] The use of two separate biocatalysts (recombinant microorganisms) can offer two essential advantages over the use of only one biocatalyst, in which all synthesis enzymes are expressed:
[0101] a) The two biocatalysts can be genetically modified and optimized separately from one another. In particular it is possible to use different cofactor regeneration enzymes, which are either optimized for NADH regeneration or for NADPH regeneration.
[0102] b) For the biocatalysis, the biocatalysts can be used in different proportions. This permits intervention in the individual reaction rates of the multienzyme process during biocatalysis, even after all biocatalysts have already been prepared.
[0103] Surprisingly, it was also possible to show, in the context of the present invention, that the additional membrane transport steps of the substances that are to react, made necessary by the use of two biocatalysts, have little or no effect on the reaction rates, so that these presumed negative aspects are outweighed by the advantages of the two-cell system.
[0104] 35. A process for the preparation of ursodeoxycholic acid (UDCA) of formula (1)
##STR00005##
[0104] in which
[0105] R stands for alkyl, NR.sup.1R.sup.2, H, an alkali metal ion or N(R.sup.3).sub.4.sub.+, in which the residues R.sup.3 may be identical or different and stand for H or alkyl, wherein
[0106] a) optionally a cholic acid (CA) of formula (2)
##STR00006##
[0106] in which R has the meanings given above, is oxidized chemically to the dehydrocholic acid (DHCA) of formula (3)
##STR00007##
in which R has the meanings given above;
[0107] b) DHCA is reduced in the presence of at least one 7.beta.-HSDH mutant (present as isolated enzyme or expressed by a corresponding recombinant microorganism) according to the definition in one of the embodiments 1 to 6 and in the presence of at least one 3.alpha.-hydroxysteroid dehydrogenase (3.alpha.-HSDH) (present as isolated enzyme or expressed by a corresponding recombinant microorganism) to the corresponding 12-keto-ursodeoxycholic acid (12-keto UDCA) of formula (5)
##STR00008##
[0107] in which R has the meanings given above, (in the presence of and with consumption of NADH and/or NADPH) and then
[0108] d) 12-keto-UDCA of formula (5) is reduced chemically to UDCA; and
[0109] e) the reaction product is optionally further purified.
[0110] Process step b) can be configured differently. Either both enzymes (7.beta.-HSDH mutant and 3.alpha.-HSDH) can be present simultaneously (e.g. one-pot reaction with both isolated enzymes or one or more corresponding recombinant microorganisms are present, which express both enzymes), or the partial reactions can take place in any order (first the 7.beta.-HSDH-mutant-catalyzed reduction and then the 3.alpha.-HSDH-catalyzed reduction; or first the 3.alpha.-HSDH-catalyzed reduction and then the 7.beta.-HSDH mutant-catalyzed reduction).
[0111] A process variant for the preparation of UDCA of formula (1) could therefore be for example as follows:
[0112] a) optionally a cholic acid (CA) of formula (2) is oxidized chemically;
[0113] b) DHCA is reduced in the presence of at least one 7.beta.-HSDH mutant (present as isolated enzyme or expressed by a corresponding recombinant microorganism) according to the definition in one of the embodiments 1 to 6 to the 3,12-diketo-7.beta.-cholanic acid (3,12-diketo-7.beta.-CA) of formula (4)
##STR00009##
[0113] (in the presence of and with consumption of NADPH and/or NADH),
[0114] c) 3,12-diketo-7.beta.-CA is reduced in the presence of at least one 3.alpha.-hydroxysteroid dehydrogenase (3.alpha.-HSDH) (present as isolated enzyme or expressed by a corresponding recombinant microorganism) to the corresponding 12-keto-ursodeoxycholic acid (12-keto UDCA) of formula (5)
##STR00010##
[0114] in which R has the meanings given above, (in the presence of and with consumption of NADH and/or NADPH, depending on the 3.alpha.-HSDH used) and then
[0115] d) 12-keto-UDCA of formula (5) is reduced chemically to UDCA; and
[0116] e) the reaction product is optionally further purified.
[0117] 36. The process according to embodiment 35, wherein steps b) and c) are carried out in the presence of one or more recombinant microorganisms described herein, such as at least one microorganism according to embodiment 10.
[0118] 37. The process according to embodiment 35 or 36, wherein steps b) and/or c) are coupled to identical or different cofactor regeneration systems (present as isolated enzyme or expressed by a corresponding recombinant microorganism).
[0119] 38. The process according to embodiment 37, wherein step b) is coupled to a cofactor regeneration system, in which NADPH is regenerated by an NADP.sup.+-accepting FDH mutant according to the definition in one of the embodiments 20 to 24 with consumption of formic acid or a salt thereof; or is coupled to a cofactor regeneration system, in which NADPH is regenerated by an ADH with consumption of isopropanol; or is coupled to a cofactor regeneration system in which NADPH is regenerated by a GDH with consumption of glucose; or is coupled to a cofactor regeneration system in which spent NADH is regenerated by an NADH regenerating GDH, ADH or FDH.
[0120] 39. The process according to embodiment 37 or 38, wherein step c) is coupled to a cofactor regeneration step, in which NADPH is regenerated by an NADP.sup.+-accepting FDH mutant according to the definition in one of the embodiments 20 to 24 with consumption of formic acid or a salt thereof; or wherein step c) is coupled to a cofactor regeneration step in which NADH is regenerated by an NADH-regenerating FDH mutant according to the definition in one of the embodiments 20 to 24 or by the unmutated FDH with consumption of formic acid or a salt thereof or by an NADH-regenerating GDH with consumption of glucose.
[0121] 40. A process for microbial preparation of ursodeoxycholic acid (UDCA) of formula (1)
##STR00011##
[0121] in which
[0122] R stands for alkyl, NR.sup.1R.sup.2, H, an alkali metal ion or N(R.sup.3).sub.4.sub.+, in which the residues R.sup.3 may be identical or different and stand for H or alkyl, wherein
[0123] a) optionally a cholic acid (CA) of formula (2)
##STR00012##
[0123] in which R has the meanings given above, is oxidized chemically to the dehydrocholic acid (DHCA) of formula (3)
##STR00013##
in which R has the meanings given above;
[0124] b) DHCA is reduced in the presence of at least one 7.beta.-HSDH and in the presence of at least one 3.alpha.-HSDH to the corresponding 12-keto-ursodeoxycholic acid (12-keto UDCA) of formula (5)
##STR00014##
[0124] in which R has the meanings given above, (in the presence of and with consumption of NADH and/or NADPH) and then
[0125] c) 12-keto-UDCA of formula (5) is reduced chemically to UDCA; and
[0126] d) the reaction product is optionally further purified; wherein the reactions of step b) take place microbially, i.e. in the presence of whole cells of one or more different recombinant microorganisms according to one of the embodiments 28 or 29 to 34, wherein the microorganism or microorganisms carry the enzymes necessary for the reaction and cofactor regeneration in a manner described in more detail herein, or else using at least one nucleic acid sequence according to embodiment 25.
[0127] For example, DHCA can be reduced in the presence of at least one 7.beta.-HSDH or mutant thereof to 3,12-diketo-7.beta.-cholanic acid (3,12-diketo-7.beta.-CA) of formula (4)
##STR00015##
(in the presence of and with consumption of NADPH), and 3,12-diketo-7.beta.-CA can be reduced in the presence of at least one 3.alpha.-hydroxysteroid dehydrogenase (3.alpha.-HSDH) or mutant thereof to the corresponding 12-keto-ursodeoxycholic acid (12-keto UDCA) of formula (5)
##STR00016##
in which R has the meanings given above, (in the presence of and with consumption of NADH and/or NADPH).
[0128] Furthermore, however, a reaction sequence is also conceivable, comprising the reduction of DHCA first with 3.alpha.-HSDH and the subsequent reduction of the resultant reaction product with 7.beta.-HSDH, as well as both reaction sequences taking place simultaneously, on the basis of the simultaneous presence of both HSDHs.
[0129] 41. The process according to embodiment 40, wherein one or more, in particular one, recombinant microorganism according to one of the embodiments 29 to 34 is used, which for example simultaneously expresses at least one 7.beta.-HSDH mutant according to one of the embodiments 1 to 6, at least one NADP.sup.+-accepting FDH mutant according to one of the embodiments 20 to 24 and at least one 3.alpha.-HSDH, such as in particular according to SEQ ID NO: 6, 8 or 22 or mutants thereof in a sequence identity of at least about 60%; or which simultaneously expresses at least one 7.beta.-HSDH mutant according to one of the embodiments 1 to 6, at least one GDH and at least one 3.alpha.-HSDH, such as in particular according to SEQ ID NO: 6, 8 or 22 or mutants thereof in a sequence identity of at least about 60%.
[0130] 42. A bioreactor for carrying out a process according to one of the embodiments 35 to 41, in particular containing at least one of the enzymes (7.beta.-HSDH, FDH, and/or 3.alpha.-HSDH or mutants thereof; or 7.beta.-HSDH, GDH and/or 3.alpha.-HSDH or mutants thereof) or a recombinant microorganism recombinantly expressing at least one of these enzymes, especially in immobilized form.
[0131] The present invention is not limited to the concrete embodiments described herein. Rather, a person skilled in the art will be enabled, through the teaching of the present invention, to provide further configurations of the invention without undue effort. He can, for example, also purposefully generate further enzyme mutants and screen and optimize these for the desired property profile (improved cofactor dependence and/or stability, reduced substrate inhibition); or isolate further suitable wild-type enzymes (7.beta.- and 3.alpha.-HSDHs, FDHs, GDHs ADHs etc.) and use them according to the invention. Furthermore, for example depending on the property profile (especially cofactor dependence) of the HSDHs used, such as in particular 7.beta.-HSDH and 3.alpha.-HSDH or mutants thereof, he can select suitable dehydrogenases usable for cofactor regeneration (GDH, FHD, ADH etc.) and mutants thereof, and distribute the selected enzymes to one or more expression constructs or vectors and therefore if necessary produce one or more recombinant microorganisms, which then make an optimized whole-cell-based method of production possible.
Further Configurations of the Invention
[0132] 1. General Definitions and Abbreviations Used
[0133] Unless stated otherwise, the term "7.beta.-HSDH" denotes a dehydrogenase enzyme, which catalyzes at least the stereospecific and/or regiospecific reduction of DHCA or 7,12-diketo-3.alpha.-CA (7,12-diketo-LCA) to 3,12-diketo-7.beta.-CA or 12-keto-UDCA in particular with stoichiometric consumption of NADPH, and optionally the corresponding reverse reaction. The enzyme can be a native or recombinantly produced enzyme. The enzyme can basically be mixed with cellular, for example protein impurities, but preferably is in pure form. Suitable methods of detection are described for example in the experimental section given below or are known from the literature (e.g. Characterization of NADP-dependent 7 beta-hydroxysteroid dehydrogenases from Peptostreptococcus productus and Eubacterium aerofaciens. S Hirano and N Masuda. Appl Environ Microbiol. 1982). Enzymes with this activity are classified under the EC number 1.1.1.201.
[0134] Unless stated otherwise, the term "3.alpha.-HSDH" denotes a dehydrogenase enzyme that catalyzes at least the stereospecific and/or regiospecific reduction of 3,12-diketo-7.beta.-CA or DHCA to 12-keto-UDCA or 7,12-diketo-3.alpha.-CA (7,12-diketo-LCA), in particular with stoichiometric consumption of NADH and/or NADPH, and optionally the corresponding reverse reaction. Suitable methods of detection are described for example in the experimental section given below or are known from the literature. Suitable enzymes are obtainable e.g. from Comanomonas testosteroni (e.g. ATCC11996). An NADPH-dependent 3.alpha.-HSDH is known for example from rodents and can also be used. (Cloning and sequencing of the cDNA for rat liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase, J E Pawlowski, M Huizinga and T M Penning, May 15, 1991, The Journal of Biological Chemistry, 266, 8820-8825). Enzymes with this activity are classified under EC number 1.1.1.50.
[0135] Unless stated otherwise, the term "GDH" denotes a dehydrogenase enzyme that catalyzes at least the oxidation of .beta.-D-glucose to D-glucono-1,5-lactone with stoichiometric consumption of NAD.sup.+ and/or NADP.sup.+ and optionally the corresponding reverse reaction. Suitable enzymes are obtainable e.g. from Bacillus subtilis or Bacillus megaterium. Enzymes with this activity are classified under EC number 1.1.1.47. Unless stated otherwise, the term "FDH" denotes a dehydrogenase enzyme that catalyzes at least the oxidation of formic acid (or corresponding formate salts) to carbon dioxide with stoichiometric consumption of NAD.sup.+ and/or NADP.sup.+, and optionally the corresponding reverse reaction. Suitable methods of detection are for example described in the experimental section given below or are known from the literature. Suitable enzymes are obtainable e.g. from Candida boidinii, Pseudomonas sp, or Mycobacterium vaccae. Enzymes with this activity are classified under EC number 1.2.1.2.
[0136] A "pure form" or a "pure" or "substantially pure" enzyme is to be understood according to the invention as an enzyme with a degree of purity above 80, preferably above 90, especially above 95, and quite particularly above 99 wt%, relative to the total protein content, determined by means of usual methods of detecting proteins, for example the biuret method or protein detection according to Lowry et al. (cf. description in R. K. Scopes, Protein Purification, Springer Verlag, New York, Heidelberg, Berlin (1982)).
[0137] A "redox equivalent" means a low-molecular organic compound usable as electron donor or electron acceptor, for example nicotinamide derivatives such as NAD.sup.+ and NADH.sup.+ or their reduced forms NADH and NADPH respectively. "Redox equivalent" and "cofactor" are used as synonyms in the context of the present invention. Thus, a "cofactor" in the sense of the invention can also be described as "redox-capable cofactor", i.e. as a cofactor that can be present in a reduced and an oxidized form.
[0138] A "spent" cofactor is to be understood as the reduced or oxidized form of the cofactor, which in the course of a specified reduction or oxidation reaction of a substrate is transformed into the corresponding oxidized or reduced form. By regeneration, the oxidized or reduced cofactor form that is formed in the reaction is converted back to the reduced or oxidized starting form, so that it is available again for the reaction of the substrate.
[0139] An "altered cofactor usage" is to be understood in the context of the present invention as a qualitative or quantitative change compared to a reference. In particular, an altered cofactor usage can be observed by undertaking amino acid sequence mutations. This change can then be determined compared to the unmutated starting enzyme. Moreover, the activity with respect to a particular cofactor can be increased or reduced by undertaking a mutation or can be prevented completely. An altered cofactor usage also comprises, however, changes such that instead of a specificity for an individual cofactor, now at least one further second cofactor, different from the first cofactor, is usable (i.e. there is an extended cofactor usage). Conversely, however, a capacity for usage of two different cofactors that was originally present can be altered so that specificity is only increased for one of these cofactors or only reduced for one of these cofactors or is completely eliminated. For example, an enzyme that is dependent on the cofactor NAD (NADH) can now, owing to a change of the cofactor usage, be dependent both on NAD (NADH) and the cofactor NADP (NADPH) or the original dependence on NAD (NADH) can be completely transformed to a dependence on NADP (NADPH) and vice versa.
[0140] The terms "NAD.sup.+/NADH dependence" or "NADP.sup.+/ADPH dependence", unless stated otherwise, are to be interpreted widely according to the invention. These terms comprise both "specific" dependences, i.e. exclusively dependence on NAD.sup.+/NADH or NADP.sup.+/NADPH, as well as the dependence of the enzymes used according to the invention on both cofactors, i.e.
[0141] dependence on NAD.sup.+/NADH and NADP.sup.+/NADPH.
[0142] This applies correspondingly to the terms "NAD.sup.+/NADH-accepting" or "NADP.sup.+/NADPH-accepting".
[0143] The terms "NAD.sup.+/NADH-regenerating" or "NADP.sup.+/NADPH-regenerating", unless stated otherwise, are to be interpreted widely according to the invention. These terms comprise both "specific" i.e. exclusive capacity for regenerating spent cofactor NAD.sup.+/NADH or NADP.sup.+/NADPH, and the capacity for regenerating both cofactors, i.e. NAD.sup.+/NADH and NADP.sup.+/NADPH.
[0144] "Proteinogenic" amino acids comprise in particular (single-letter code): G, A, V, L, I, F, P, M, W, S, T, C, Y, N, Q, D, E, K, R and H. "Immobilization" means, according to the invention, the covalent or noncovalent binding of a biocatalyst used according to the invention, for example a 7.beta.-HSDH on a solid, i.e. essentially insoluble in the surrounding liquid medium, carrier material. According to the invention, whole cells, such as the recombinant microorganisms used according to the invention, can correspondingly also be immobilized by means of such carriers.
[0145] A "substrate inhibition reduced in comparison with the unmutated enzyme" means that the substrate inhibition observed with the unmutated enzyme for a particular substrate is no longer observed, i.e. essentially is no longer measurable, or only occurs at higher substrate concentration, i.e. the K.sub.i value is increased.
[0146] "Cholic acid compound" means compounds according to the invention with the carbon skeleton structure, especially the steroid structure of cholic acid and the presence of keto and/or hydroxy or acyloxy groups in ring position 7 and optionally ring positions 3 and/or 12.
[0147] A compound of a special type, for example a "cholic acid compound" or an "ursodeoxycholic acid compound" in particular also means derivatives of the underlying starting compound (for example cholic acid or ursodeoxycholic acid).
[0148] Said derivatives comprise "salts", for example alkali metal salts such as lithium, sodium and potassium salts of the compounds; and ammonium salts, wherein an ammonium salt comprises the NH.sub.4.sub.+ salt or those ammonium salts in which at least one hydrogen atom can be replaced with a C.sub.1-C.sub.6-alkyl residue. Typical alkyl residues are, in particular, C.sub.1-C.sub.4-alkyl residues, such as methyl, ethyl, n- or i-propyl-, n-, sec- or tert-butyl, and n-pentyl and n-hexyl and the singly or multiply branched analogs thereof.
[0149] "Alkyl esters" of compounds according to the invention are, in particular, lower alkyl esters, for example C.sub.1-C.sub.6-alkyl esters. As nonlimiting examples, we may mention methyl, ethyl, n- or i-propyl, n-, sec- or tert-butyl esters, or longer-chain esters, for example n-pentyl and n-hexyl esters and the singly or multiply branched analogs thereof.
[0150] "Amides" are, in particular, reaction products of acids according to the invention with ammonia or primary or secondary monoamines. Such amines are for example mono- or di-C.sub.1-C.sub.6-alkyl monoamines, wherein the alkyl residues can optionally be further substituted independently of one another, for example with carboxyl, hydroxyl, halogen (such as F, Cl, Br, I), nitro and sulfonate groups.
[0151] "Acyl groups" according to the invention are, in particular, nonaromatic groups with 2 to 4 carbon atoms, for example acetyl, propionyl and butyryl, and aromatic groups with an optionally substituted mononuclear aromatic ring, wherein suitable substituents are selected for example from hydroxyl, halogen (such as F, Cl, Br, I), nitro and C.sub.1-C.sub.6-alkyl groups, for example benzoyl or toluoyl.
[0152] The hydroxysteroid compounds used or prepared according to the invention, for example cholic acid, ursodeoxycholic acid, 12-keto-chenodeoxycholic acid, chenodeoxycholic acid and 7-keto-lithocholic acid, can be used in stereoisomerically pure form or in a mixture with other stereoisomers in the process according to the invention or obtained therefrom. Preferably, however, the compounds used or prepared are used or isolated in substantially stereoisomerically pure form.
[0153] The following table gives the structural formulas, chemical names and the abbreviations used for important chemical compounds:
TABLE-US-00001 Formula Abbreviation Chemical name ##STR00017## CA Cholic acid ##STR00018## DHCA Dehydrocholic acid ##STR00019## 3,12-diketo-7.beta.-CA 3,12-Diketo-7.beta.- cholanic acid ##STR00020## 12Keto-UDCA 12Keto-ursodeoxy- cholic acid ##STR00021## UDCA Ursodeoxycholic acid ##STR00022## CA methyl ester Cholic acid methyl ester ##STR00023## 3,7-diacetyl-CA- methyl ester 3,7-Diacetyl-cholic acid methyl ester* ##STR00024## 12-keto-3,7-diacetyl- CA methyl ester 12-Keto-3,7-diacetyl cholanic acid methyl ester* ##STR00025## CDCA Chenodeoxycholic acid ##STR00026## 7-Keto-LCA 7-Keto-lithocholic acid ##STR00027## 7,12-Diketo-LCA 7,12-Diketo-litho- cholic acid ##STR00028## 12-Keto-CDCA 12-Keto-chenodeoxy- cholic acid
[0154] 2. Proteins
[0155] The present invention is not limited to the concretely disclosed proteins or enzymes with 7.beta.-HSDH, FDH, GDH or 3.alpha.-HSDH activity or mutants thereof, but rather also extends to functional equivalents thereof.
[0156] "Functional equivalents" or analogs of the concretely disclosed enzymes are, in the context of the present invention, polypeptides that are different from them, but still possess the desired biological activity, for example 7.beta. HSDH activity.
[0157] For example, "functional equivalents" are to be understood as enzymes that have, in the test used for 7.beta.-HSDH, FDH, GDH or 3.alpha.-HSDH activity, an activity that is higher or lower by at least 1%, e.g. at least 10% or 20%, e.g. at least 50% or 75% or 90% than that of a starting enzyme, comprising an amino acid sequence defined herein.
[0158] Functional equivalents are in addition preferably stable in the pH range from 4 to 11 and advantageously possess an optimal pH in a pH range from 6 to 10, such as in particular 8.5 to 9.5, and an optimal temperature in the range from 15.degree. C. to 80.degree. C. or 20.degree. C. to 70.degree. C., for example about 45 to 60.degree. C. or about 50 to 55.degree. C.
[0159] The 7.beta.-HSDH activity can be detected using various known tests. Without being restricted to this, we may mention a test using a reference substrate, e.g. CA or DHCA, under standardized conditions, as defined in the experimental section.
[0160] Tests for determining the FDH, GDH or 3.alpha.-HSDH activity are also known per se.
[0161] "Functional equivalents" according to the invention also means, in particular, "mutants", which have in at least one sequence position of the aforementioned amino acid sequences an amino acid other than that concretely stated, but nevertheless possess one of the aforementioned biological activities. "Functional equivalents" therefore comprise the mutants obtainable by one or more, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15, amino acid additions, substitutions, deletions and/or inversions, wherein the stated changes can occur in any sequence position, provided they lead to a mutant with the property profile according to the invention. Functional equivalence in particular also obtains when the patterns of reactivity between mutant and unaltered polypeptide coincide qualitatively, i.e. for example the same substrates are converted at different rates. Examples of suitable amino acid substitutions are presented in the following table:
TABLE-US-00002 Original residue Examples of substitution Ala Ser Arg Lys Asn Gln; His Asp Glu Cys Ser Gln Asn Glu Asp Gly Pro His Asn; Gln Ile Leu; Val Leu Ile; Val Lys Arg; Gln; Glu Met Leu; Ile Phe Met; Leu; Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp; Phe Val Ile; Leu
[0162] "Functional equivalents" in the above sense are also "precursors" of the polypeptides described and "functional derivatives" and "salts" of the polypeptides.
[0163] "Precursors" are natural or synthetic precursors of the polypeptides with or without the desired biological activity.
[0164] The expression "salts" means both salts of carboxyl groups and acid addition salts of amino groups of the protein molecules according to the invention. Salts of carboxyl groups can be prepared in a manner known per se and comprise inorganic salts, for example sodium, calcium, ammonium, iron and zinc salts, and salts with organic bases, for example amines, such as triethanolamine, arginine, lysine, piperidine and the like. Acid addition salts, for example salts with mineral acids, such as hydrochloric acid or sulfuric acid and salts with organic acids, such as acetic acid and oxalic acid, are also an object of the invention.
[0165] "Functional derivatives" of polypeptides according to the invention can also be prepared on functional amino acid side groups or on their N- or C-terminal end using known techniques. Such derivatives comprise for example aliphatic esters of carboxylic acid groups, amides of carboxylic acid groups, obtainable by reaction with ammonia or with a primary or secondary amine; N-acyl derivatives of free amino groups, prepared by reaction with acyl groups; or O-acyl derivatives of free hydroxyl groups, prepared by reaction with acyl groups.
[0166] "Functional equivalents" naturally also comprise polypeptides that are obtainable from other organisms, and naturally occurring variants. For example, by sequence comparison, homologous sequence regions can be found and equivalent enzymes can be determined based on the concrete instructions of the invention.
[0167] "Functional equivalents" also comprise fragments, preferably individual domains or sequence motifs, of the polypeptides according to the invention, which for example have the desired biological function.
[0168] "Functional equivalents" are in addition fusion proteins that have one of the aforementioned polypeptide sequences or functional equivalents derived therefrom and at least one further, functionally different therefrom, heterologous sequence in functional N- or C-terminal linkage (i.e. without mutual substantial functional impairment of the fusion protein parts). Nonlimiting examples of said heterologous sequences are e.g. signal peptides, histidine anchors or enzymes.
[0169] "Functional equivalents" that are also included according to the invention are homologs of the concretely disclosed proteins. These possess at least 60%, preferably at least 75%, especially at least 85%, for example 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99%, homology (or identity) to one of the concretely disclosed amino acid sequences, calculated according to the algorithm of Pearson and Lipman, Proc. Natl. Acad. Sci. (USA) 85(8), 1988, 2444-2448. A percentage homology or identity of a homologous polypeptide according to the invention means, in particular, percentage identity of the amino acid residues relative to the total length of one of the amino acid sequences concretely described herein. The percentage identity values can also be determined on the basis of BLAST alignments, the blastp (protein-protein BLAST) algorithm, or using the Clustal settings given below.
[0170] In the case of a possible protein glycosylation, "functional equivalents" according to the invention comprise proteins of the type designated above in deglycosylated or glycosylated form and modified forms obtainable by altering the glycosylation pattern.
[0171] Homologs of the proteins or polypeptides according to the invention can be produced by mutagenesis, e.g. by point mutation, lengthening or shortening of the protein.
[0172] Homologs of the proteins according to the invention can be identified by screening combinatorial libraries of mutants, for example shortened mutants. For example, a variegated database of protein variants can be produced by combinatorial mutagenesis at the nucleic acid level, for example by enzymatic ligation of a mixture of synthetic oligonucleotides. There are a great many methods that can be used for preparing libraries of potential homologs from a degenerated oligonucleotide sequence. The chemical synthesis of a degenerated gene sequence can be carried out in an automatic DNA synthesizer, and the synthetic gene can then be ligated into a suitable expression vector. The use of a degenerated set of genes makes it possible to provide all sequences in one mixture, which encode the desired set of potential protein sequences. Methods of synthesis of degenerated oligonucleotides are known by a person skilled in the art (e.g. Narang, S. A. (1983) Tetrahedron 39: 3; Itakura et al. (1984) Annu. Rev. Biochem. 53: 323; Itakura et al., (1984) Science 198: 1056; Ike et al. (1983) Nucleic Acids Res. 11: 477).
[0173] Several techniques are known in the prior art for screening gene products of combinatorial libraries, that have been produced by point mutations or shortening, and for screening cDNA libraries for gene products with a selected property. These techniques can be adapted to the rapid screening of gene banks that have been produced by combinatorial mutagenesis of homologs according to the invention. The techniques used most often for screening large gene banks, which are based on a high-throughput analysis, comprise cloning the gene bank into replicatable expression vectors, transforming suitable cells with the resultant vector bank and expressing the combinatorial genes under conditions in which detection of the desired activity facilitates the isolation of the vector that encodes the gene whose product was detected. Recursive ensemble mutagenesis (REM), a technique that increases the frequency of functional mutants in the banks, can be used in combination with the screening tests, in order to identify homologs (Arkin and Yourvan (1992) PNAS 89: 7811-7815; Delgrave et al. (1993) Protein Engineering 6(3): 327-331).
[0174] The invention further comprises the use of the 7.beta.-HSDH wild type from Collinsella aerofaciens ATCC 25986, as described in the applicant's earlier international patent application PCT/EP2010/068576, which is expressly referred to hereby.
[0175] This 7.beta.-HSDH obtainable from Collinsella aerofaciens DSM 3979 is in particular characterized by at least one other of the following properties, for example 2, 3, 4, 5, 6 or 7 or all such properties:
[0176] a) molecular weight (SDS-gel electrophoresis): about 28-32 kDa, especially about 29 to 31 kDa or about 30 kDa;
[0177] b) molecular weight (gel filtration, in nondenaturing conditions, such as in particular without SDS): about 53 to 60 kDa, especially about 55 to 57 kDa, such as 56.1 kDa. This proves the dimeric nature of the 7.beta.-HSDH from Collinsella aerofaciens DSM 3979;
[0178] c) stereoselective reduction of the 7-carbonyl group of 7-keto-LCA to a 7.beta.-hydroxyl group;
[0179] d) optimal pH for the oxidation of UDCA in the range from pH 8.5 to 10.5, especially 9 to 10;
[0180] e) optimal pH for the reduction of DHCA and 7-keto-LCA in the range from pH 3.5 to 6.5, especially at pH 4 to 6;
[0181] f) at least one kinetic parameter from the following table for at least one of the substrates/cofactors mentioned there; in the range of .+-.20%, especially .+-.10%, .+-.5%, .+-.3%, .+-.2% or .+-.1% around the value stated concretely in each case in the following table.
TABLE-US-00003 K.sub.M V.sub.max k.sub.cat (.mu.M) (U/mg protein).sup.b) (1 .mu.mol/(.mu.mol .times. min)) NADP.sup.+ 5.32 30.58 944.95 NADPH 4.50 33.44 1033.44 UDCA 6.23 38.17 1179.39 7-Keto-LCA 5.20 30.77 950.77 DHCA 9.23 28.33 875.35 NAD.sup.+ --.sup.a) -- Traces NADH -- -- Traces .sup.a)could not be determined, owing to the very low activity .sup.b)1 U = 1 .mu.mol/min
[0182] g) phylogenetic sequence similarity of the prokaryotic 7.beta.-HSDH from Collinsella aerofaciens DSM 3979, related to the animal 11.beta.-HSDH subgroup, comprising Cavia porcellus, Homo sapiens and Mus musculus.
[0183] For example, this 7.beta.-HSDH shows the following properties or combinations of properties: a); b); a) and b); a) and/or b) and c); a) and/or b) and c) and d); a) and/or b) and c) and d) and e); a) and/or b) and c) and d) and e) and f).
[0184] A 7.beta.-HSDH of this kind or a functional equivalent derived therefrom is moreover characterized by
[0185] a) the stereospecific reduction of a 7-ketosteroid to the corresponding 7.beta.-hydroxysteroid, and/or
[0186] b) the regiospecific hydroxylation of a ketosteroid comprising a keto group in 7-position and at least one further keto group on the steroid skeleton to the corresponding 7.beta.-hydroxysteroid, such as in particular catalyzed by dehydrocholic acid (DHCA) in 7-position to the corresponding 3,12-diketo-7.beta.-cholanic acid, and e.g. is NADPH-dependent.
[0187] Said 7.beta.-HSDH has in particular an amino acid sequence according to SEQ ID NO:2 (accession No.: ZP_01773061) or a sequence derived therefrom with a degree of identity of at least 60%, e.g. at least 65, 70, 75, 80, 85, or 90, e.g. at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 99.5% to this sequence; optionally additionally characterized by one of the following properties or combinations of properties: a); b); a) and b); a) and/or b) and c); a) and/or b) and c) and d); a) and/or b) and c) and d) and e); a) and/or b) and c) and d) and e) and f) according to the above definition.
[0188] 3. Nucleic Acids and Constructs
[0189] 3. 1 Nucleic Acids
[0190] The invention also relates to nucleic acid sequences that code for an enzyme with 7.beta.-HSDH, FDH, GDH and/or 3.alpha.-HSDH activity and the mutants thereof.
[0191] The present invention also relates to nucleic acids with a specified degree of identity to the concrete sequences described herein.
[0192] "Identity" between two nucleic acids means the identity of the nucleotides over the total nucleic acid length in each case, especially the identity that is calculated by comparison by means of the Vector NTI Suite 7.1 software of the company Informax (USA) employing the Clustal method (Higgins D G, Sharp P M. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 April; 5(2): 151-1) setting the following parameters:
Multiple alignment Parameters:
TABLE-US-00004 Gap opening penalty 10 Gap extension penalty 10 Gap separation penalty range 8 Gap separation penalty off % identity for alignment delay 40 Residue specific gaps off Hydrophilic residue gap off Transition weighting 0 Pairwise alignment parameters: FAST algorithm on K-tuple size 1 Gap penalty 3 Window size 5 Number of best diagonals 5
[0193] As an alternative, the identity can also be determined according to Chenna, Ramu, Sugawara, Hideaki, Koike, Tadashi, Lopez, Rodrigo, Gibson, Toby J, Higgins, Desmond G, Thompson, Julie D. Multiple sequence alignment with the Clustal series of programs. (2003) Nucleic Acids Res 31 (13): 3497-500, according to internet address: http://www.ebi.ac.uk/Tools/clustalw/index.html# and with the following parameters:
TABLE-US-00005 DNA gap open penalty 15.0 DNA gap extension penalty 6.66 DNA matrix Identity Protein gap open penalty 10.0 D Protein gap extension penalty 0.2 Protein matrix Gonnet Protein/DNA ENDGAP -1 Protein/DNA GAPDIST 4
[0194] All nucleic acid sequences mentioned herein (single- and double-stranded DNA and RNA sequences, for example cDNA and mRNA) can be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can be carried out for example in a known manner by the phosphoroamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). The adding on of synthetic oligonucleotides and filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions and general cloning techniques are described in Sambrook et al. (1989), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press.
[0195] The invention also relates to nucleic acid sequences (single- and double-stranded DNA and RNA sequences, for example cDNA and mRNA) coding for one of the above polypeptides and functional equivalents thereof, which are accessible for example using artificial nucleotide analogs.
[0196] The invention relates both to isolated nucleic acid molecules, which code for polypeptides or proteins according to the invention or biologically active segments thereof, and to nucleic acid fragments that can be used e.g. as hybridization probes or primers for identification or amplification of coding nucleic acids according to the invention.
[0197] The nucleic acid molecules according to the invention can moreover contain untranslated sequences from the 3'- and/or 5'-end of the coding gene region.
[0198] The invention further comprises the nucleic acid molecules complementary to the concretely described nucleotide sequences, or a segment thereof.
[0199] The nucleotide sequences according to the invention make it possible to produce probes and primers that can be used for identification and/or cloning of homologous sequences in other cell types and organisms. These probes or primers usually comprise a nucleotide sequence region, which hybridizes under "stringent" conditions (see below) to at least about 12, preferably at least about 25, for example about 40, 50 or 75 successive nucleotides of a sense strand of a nucleic acid sequence according to the invention or a corresponding antisense strand.
[0200] An "isolated" nucleic acid molecule is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid and can moreover be essentially free from other cellular material or culture medium, when it is produced by recombinant techniques, or free from chemical precursors or other chemicals, when it is synthesized chemically.
[0201] A nucleic acid molecule according to the invention can be isolated using standard techniques of molecular biology and the sequence information provided according to the invention. For example, cDNA can be isolated from a suitable cDNA library, using one of the concretely disclosed complete sequences or a segment thereof as hybridization probe and standard hybridization techniques (as described for example in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989). Moreover, a nucleic acid molecule, comprising one of the disclosed sequences or a segment thereof, can be isolated by polymerase chain reaction, using the oligonucleotide primers that are prepared on the basis of this sequence. The nucleic acid thus amplified can be cloned into a suitable vector and can be characterized by DNA sequence analysis. The oligonucleotides according to the invention can also be produced by standard synthesis techniques, e.g. with an automatic DNA synthesizer.
[0202] Nucleic acid sequences according to the invention or derivatives thereof, homologs or parts of these sequences can be isolated for example with usual hybridization methods or PCR technology from other bacteria, e.g. via genomic or cDNA libraries. These DNA sequences hybridize under standard conditions to the sequences according to the invention.
[0203] "Hybridize" means the capacity of a polynucleotide or oligonucleotide for binding to an almost complementary sequence under standard conditions, whereas under these conditions nonspecific bindings do not occur between noncomplementary partners. For this, the sequences can be complementary to 90-100%. The property of complementary sequences of being able to bind specifically to one another is utilized for example in Northern or Southern blotting or in primer binding in PCR or RT-PCR.
[0204] Advantageously, short oligonucleotides of the conserved regions are used for hybridization. It is also possible, however, to use longer fragments of the nucleic acids according to the invention or the complete sequences for hybridization. These standard conditions vary depending on the nucleic acid used (oligonucleotide, longer fragment or complete sequence) or depending on which type of nucleic acid, DNA or RNA, is used for the hybridization. Thus, for example, the melting points for DNA:DNA hybrids are approx. 10.degree. C. lower than those of DNA:RNA hybrids of the same length.
[0205] Standard conditions mean for example, depending on the nucleic acid, temperatures between 42 and 58.degree. C. in an aqueous buffer solution with a concentration between 0.1 and 5.times.SSC (1.times.SSC=0.15 M NaCl, 15 mM sodium citrate, pH 7.2) or additionally in the presence of 50% formamide such as for example 42.degree. C. in 5.times.SSC, 50% formamide. Advantageously the hybridization conditions for DNA:DNA hybrids are 0.1.times.SSC and temperatures between about 20.degree. C. and 45.degree. C., preferably between about 30.degree. C. and 45.degree. C. For DNA:RNA hybrids the hybridization conditions are advantageously 0.1 x SSC and temperatures between about 30.degree. C. and 55.degree. C., preferably between about 45.degree. C. and 55.degree. C. These temperatures stated for the hybridization are for example calculated melting point values for a nucleic acid with a length of approx. 100 nucleotides and a G+C content of 50% in the absence of formamide. The experimental conditions for DNA hybridization are described in relevant genetics textbooks, for example Sambrook et al.,"Molecular Cloning", Cold Spring Harbor Laboratory, 1989, and can be calculated from formulas known by a person skilled in the art for example depending on the length of the nucleic acids, the type of hybrids or the G+C content. A person skilled in the art can find further information on hybridization from the following textbooks: Ausubel et al. (eds), 1985, Current Protocols in Molecular Biology, John Wiley & Sons, New York; Hames and Higgins (eds), 1985, Nucleic Acids Hybridization: A Practical Approach, IRL Press at Oxford University Press, Oxford; Brown (ed), 1991, Essential Molecular Biology: A Practical Approach, IRL Press at Oxford University Press, Oxford.
[0206] "Hybridization" can in particular take place under stringent conditions. These hybridization conditions are described for example in Sambrook, J., Fritsch, E. F., Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd edition, Cold Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
[0207] "Stringent" hybridization conditions are understood in particular as: incubation at 42.degree. C. overnight in a solution consisting of 50% formamide, 5.times.SSC (750 mM NaCI, 75 mM trisodium citrate), 50 mM sodium phosphate (pH7.6), 5.times. Denhardt solution, 10% dextran sulfate and 20 g/ml denatured, sheared salmon sperm DNA, followed by a filter washing step with 0.1.times.SSC at 65.degree. C.
[0208] The invention also relates to derivatives of the concretely disclosed or derivable nucleic acid sequences. Thus, further nucleic acid sequences according to the invention can be derived e.g. from
[0209] SEQ ID NO:1, 5, 7, 14, 19, 34 or 47 and differ from them by addition, substitution, insertion or deletion of individual or several nucleotides, but furthermore code for polypeptides with the desired property profile.
[0210] The invention also covers those nucleic acid sequences that comprise so-called silent mutations or are altered corresponding to the codon usage of a special original or host organism, compared to a concretely stated sequence, as well as naturally occurring variants, for example splice variants or allele variants, thereof.
[0211] The invention also relates to sequences obtainable by conservative nucleotide substitutions (i.e. the amino acid in question is replaced with an amino acid of the same charge, size, polarity and/or solubility).
[0212] The invention also relates to the molecules derived by sequence polymorphisms from the concretely disclosed nucleic acids. These genetic polymorphisms can exist between individuals within a population owing to natural variation. These natural variations usually bring about a variance from 1 to 5% in the nucleotide sequence of a gene.
[0213] Derivatives of the nucleic acid sequence according to the invention with the sequence SEQ ID NO:1, 5, 7, 14, 19, 34 or 47 mean for example allele variants that have at least 60% homology at the derived amino acid level, preferably at least 80% homology, quite especially preferably at least 90% homology over the total sequence region (regarding homology at the amino acid level, reference may be made to the above information for the polypeptides). The homologies can advantageously be higher on partial regions of the sequences.
[0214] Furthermore, derivatives are also to be understood as homologs of the nucleic acid sequences according to the invention, especially of SEQ ID NO:1, 5, 7, 14, 19, 34 or 47, for example fungal or bacterial homologs, shortened sequences, single-stranded DNA or RNA of the coding and noncoding DNA sequence. For example, homologs to SEQ ID NO:1, 5, 7, 14, 19, 34 or 47 possess, at DNA level, a homology of at least 40%, preferably of at least 60%, especially preferably of at least 70%, quite especially preferably of at least 80% over the whole DNA region given in SEQ ID NO:1, 5, 7, 14, 19, 34 or 47.
[0215] In addition, derivatives are to be understood for example as fusions with promoters. The promoters that precede the stated nucleotide sequences can be altered by at least one nucleotide exchange, at least one insertion, inversion and/or deletion, but without the functionality or effectiveness of the promoters being impaired. Moreover, the effectiveness of the promoters can be increased by altering their sequence or they can be exchanged completely with more effective promoters even of organisms of a different species.
[0216] Furthermore, methods for producing functional mutants are known by a person skilled in the art.
[0217] Depending on the technology used, a person skilled in the art can insert completely random or even more targeted mutations in genes or also noncoding nucleic acid regions (which are for example important for the regulation of expression) and then prepare gene banks. The methods of molecular biology required for this are known by a person skilled in the art and for example are described in Sambrook and Russell, Molecular Cloning. 3rd edition, Cold Spring
[0218] Harbor Laboratory Press 2001.
[0219] Methods for modifying genes and therefore for modifying the protein that these encode have long been familiar to a person skilled in the art, such as for example site-directed mutagenesis, giving targeted exchange of individual or several nucleotides of a gene (Trower MK (Publ.) 1996; In vitro mutagenesis protocols. Humana Press, New Jersey),
[0220] saturation mutagenesis, in which a codon for any amino acid can be exchanged or added at any site of a gene (Kegler-Ebo D M, Docktor C M, DiMaio D (1994) Nucleic Acids Res 22: 1593; Barettino D, Feigenbutz M, Valcarel R, Stunnenberg H G (1994) Nucleic Acids Res 22: 541; Barik S (1995) Mol Biotechnol 3: 1),
[0221] the error-prone polymerase chain reaction (error-prone PCR), in which nucleotide sequences are mutated by incorrectly functioning DNA polymerases (Eckert K A, Kunkel T A (1990) Nucleic Acids Res 18: 3739);
[0222] the passaging of genes in mutator strains, in which, for example owing to defective DNA-repair mechanisms, there is an increased mutation rate of nucleotide sequences (Greener A, Callahan M, Jerpseth B (1996) An efficient random mutagenesis technique using an E. coli mutator strain. In: Trower MK (Publ.) In vitro mutagenesis protocols. Humana Press, New Jersey), or
[0223] DNA shuffling, in which a pool of closely related genes is formed and digested and the fragments are used as template for a polymerase chain reaction, in which through repeated strand separation and bringing together again, finally mosaic genes of full length are produced (Stemmer W P C (1994) Nature 370: 389; Stemmer W P C (1994) Proc Natl Acad Sci USA 91: 10747).
[0224] Using so-called directed evolution (described inter alia in Reetz M T and Jaeger K-E (1999), Topics Curr Chem 200: 31; Zhao H, Moore J C, Volkov A A, Arnold F H (1999), Methods for optimizing industrial enzymes by directed evolution, In: Demain A L, Davies J E (Publ.) Manual of industrial microbiology and biotechnology. American Society for Microbiology), a person skilled in the art can produce functional mutants in a targeted manner and on a large scale. In a first step, firstly gene banks of the respective proteins are produced, for example using the methods given above. The gene banks are expressed in a suitable manner, for example by bacteria or by phage-display systems.
[0225] The relevant genes of host organisms that express functional mutants with properties that largely correspond to the desired properties can be submitted to another round of mutation. The steps of mutation and of selection or screening can be repeated iteratively until the functional mutants present have the desired properties to a sufficient degree. With this iterative procedure, a limited number of mutations, for example 1 to 5 mutations, can be performed in steps and assessed and selected for their influence on the relevant enzyme property. The selected mutant can then be submitted to another mutation step in the same way. As a result, the number of individual mutants to be investigated can be reduced significantly.
[0226] The results according to the invention provide important information regarding structure and sequence of the enzymes in question, which is necessary for targeted generation of further enzymes with desired modified properties. In particular, so-called "hot spots" can be defined, i.e. sequence segments that are potentially suitable for modifying an enzyme property by introducing targeted mutations.
[0227] 3.2 Constructs
[0228] The invention further relates to expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for at least one polypeptide according to the invention; and vectors, comprising at least one of these expression constructs.
[0229] "Expression unit" means, according to the invention, a nucleic acid with expression activity, which comprises a promoter, as defined herein, and, after functional linking with a nucleic acid to be expressed or a gene, regulates the expression, i.e. the transcription and the translation of this nucleic acid or of this gene. Therefore the term "regulatory nucleic acid sequence" is also used in this context. In addition to the promoter, other regulatory elements, for example enhancers, can be present.
[0230] "Expression cassette" or "expression construct" means, according to the invention, an expression unit that is functionally linked to the nucleic acid to be expressed or the gene to be expressed. In contrast to an expression unit, an expression cassette therefore comprises not only nucleic acid sequences that regulate transcription and translation, but also the nucleic acid sequences that should be expressed as protein as a result of the transcription and translation.
[0231] The terms "expression" or "overexpression" describe, in the context of the invention, the production or increase in the intracellular activity of one or more enzymes in a microorganism, which are encoded by the corresponding DNA. For this, for example a gene can be inserted in an organism, a gene that is present can be replaced with another gene, the copy number of the gene or genes can be increased, a strong promoter can be used or a gene can be used that codes for a corresponding enzyme with a high activity, and these measures can optionally be combined.
[0232] Preferably said constructs according to the invention comprise a promoter 5'-upstream of the respective coding sequence and 3'-downstream a terminator sequence and optionally further usual regulatory elements, in each case operatively linked with the coding sequence.
[0233] "Promoter", a "nucleic acid with promoter activity" or a "promoter sequence" mean, according to the invention, a nucleic acid, which in functional linkage with a nucleic acid to be transcribed, regulates the transcription of said nucleic acid.
[0234] "Functional" or "operational" linkage means in this context for example the sequential arrangement of one of the nucleic acids with promoter activity and a nucleic acid sequence to be transcribed and optionally further regulatory elements, for example nucleic acid sequences that ensure the transcription of nucleic acids, and for example a terminator, in such a way that each of the regulatory elements can fulfill its function in the transcription of the nucleic acid sequence. This does not necessarily require a direct linkage in the chemical sense. Genetic control sequences, for example enhancer sequences, can exert their function on the target sequence even from more remote positions or even from other DNA molecules. Arrangements are preferred in which the nucleic acid sequence to be transcribed is positioned behind the promoter sequence (i.e. at the 3'-end), so that the two sequences are linked together covalently. The distance between the promoter sequence and the nucleic acid sequence that is to undergo transgene expression can be less than 200 base pairs, or less than 100 base pairs or less than 50 base pairs.
[0235] In addition to promoters and terminators, examples of other regulatory elements that may be mentioned are targeting sequences, enhancers, polyadenylation signals, selectable markers, amplification signals, replication origins and the like. Suitable regulatory sequences are described for example in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990).
[0236] Nucleic acid constructs according to the invention comprise, in particular, sequence SEQ ID NO:1, 5, 7, 14, 19, 34 or 47 or derivatives and homologs thereof, and the nucleic acid sequences that can be derived therefrom, which can advantageously be linked operationally or functionally with one or more regulatory signals for controlling, e.g. increasing, gene expression.
[0237] In addition to these regulatory sequences, the natural regulation of these sequences can still be present before the actual structural genes and optionally can have been genetically modified, so that the natural regulation is switched off and expression of the genes is increased. However, the nucleic acid construct can also be of simpler construction, i.e. no additional regulatory signals have been inserted before the coding sequence and the natural promoter with its regulation has not been removed. Instead, the natural regulatory sequence is mutated so that regulation no longer occurs and gene expression is increased.
[0238] A preferred nucleic acid construct advantageously also contains one or more of the aforementioned "enhancer" sequences, functionally linked to the promoter, which make increased expression of the nucleic acid sequence possible. Additional advantageous sequences can also be inserted at the 3'-end of the DNA sequences, such as further regulatory elements or terminators. The construct can contain one or more copies of the nucleic acids according to the invention. The construct can also contain further markers, such as antibiotic resistances or auxotrophic complementation genes, optionally for selection of the construct.
[0239] Examples of suitable regulatory sequences are contained in promoters such as cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, lacl.sup.q-, T7, T5, T3, gal, trc, ara, rhaP (rhaP.sub.BAD)SP6, lambda-P.sub.R or in the lambda-P.sub.L promoter, which advantageously find application in Gram-negative bacteria. Further advantageous regulatory sequences are contained for example in the Gram-positive promoters amy and SPO2, in the yeast or fungus promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH. Artificial promoters can also be used for regulation.
[0240] For expression in a host organism, the nucleic acid construct is advantageously inserted into a vector, for example a plasmid or a phage, which makes optimal expression of the genes in the host possible. Apart from plasmids and phages, vectors are also to be understood as all other vectors known by a person skilled in the art, e.g. viruses, such as SV40, CMV, baculovirus and adenovirus, transposons, IS elements, phasmids, cosmids, and linear or circular DNA. These vectors can be replicated autonomously in the host organism or can be replicated chromosomally. These vectors represent another configuration of the invention.
[0241] Suitable plasmids are for example pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III.sup.113-B1, .lamda.gt11 or pBdCl in E. coli, pIJ101, pIJ364, pIJ702 or pIJ361 in Streptomyces, pUB110, pC194 or pBD214 in Bacillus, pSA77 or pAJ667 in Corynebacterium, pALS1, pIL2 or pBB116 in fungi, 2alphaM, pAG-1, YEp6, YEp13 or pEMBLYe23 in yeasts or pLGV23, pGHlac+, pBIN19, pAK2004 or pDH51 in plants. The aforementioned plasmids represent a small selection of the possible plasmids. Further plasmids are well known by a person skilled in the art and can for example be found in the book Cloning Vectors (eds. Pouwels P. H. et al. Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018).
[0242] In another configuration of the vector, the vector containing the nucleic acid construct according to the invention or the nucleic acid according to the invention can also advantageously be inserted in the form of a linear DNA into the microorganisms and can be integrated by heterologous or homologous recombination into the genome of the host organism. This linear DNA can consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid according to the invention.
[0243] For optimal expression of heterologous genes in organisms, it is advantageous to modify the nucleic acid sequences according to the specific "codon usage" used in the organism. The "codon usage" can easily be determined on the basis of computer evaluations of other known genes of the organism in question.
[0244] An expression cassette according to the invention is prepared by fusion of a suitable promoter with a suitable coding nucleotide sequence and a terminator or polyadenylation signal. For this, usual recombination and cloning techniques are used, such as are described for example in T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1989) and in T. J. Silhavy, M. L. Berman and L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1984) and in Ausubel, F. M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
[0245] For expression in a suitable host organism, the recombinant nucleic acid construct or gene construct is advantageously inserted into a host-specific vector, which makes optimal expression of the genes in the host possible. Vectors are well known by a person skilled in the art and can be found for example in "Cloning Vectors" (Pouwels P. H. et al., Publ., Elsevier, Amsterdam-New York-Oxford, 1985).
[0246] 4. Microorganisms
[0247] Depending on context, the term "microorganism" means the starting (wild-type) microorganism or a genetically modified, recombinant microorganism, or both.
[0248] Using the vectors according to the invention, recombinant microorganisms can be produced, which for example have been transformed with at least one vector according to the invention and can be used for producing the polypeptides according to the invention. Advantageously, the recombinant constructs according to the invention described above are introduced into a suitable host system and expressed. Preferably, common cloning and transfection methods known by a person skilled in the art are used, for example coprecipitation, protoplast fusion, electroporation, retroviral transfection and the like, to bring about expression of the stated nucleic acids in the respective expression system. Suitable systems are described for example in Current Protocols in Molecular Biology, F. Ausubel et al., Publ., Wiley Interscience, New York 1997, or Sambrook et al. Molecular Cloning: A Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. A review of bacterial expression systems for the heterologous expression of proteins is also provided for example by Terpe, K. Appl. Microbiol. Biotechnol. (2006) 72: 211-222.
[0249] In principle, all prokaryotic or eukaryotic organisms may come into consideration as recombinant host organisms for the nucleic acid according to the invention or the nucleic acid construct. Advantageously, microorganisms such as bacteria, fungi or yeasts are used as host organisms. Advantageously, Gram-positive or Gram-negative bacteria are used, preferably bacteria of the families Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, especially preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium, Clostridium or Rhodococcus. The genus and species Escherichia coli is quite especially preferred. Further advantageous bacteria can be found, moreover, in the group of alpha-proteobacteria, beta-proteobacteria or gamma-proteobacteria.
[0250] The host organism or the host organisms according to the invention preferably contain at least one of the nucleic acid sequences, nucleic acid constructs or vectors described in this invention, which code for an enzyme with 7.beta.-HSDH activity according to the above definition.
[0251] The organisms used in the process according to the invention are grown or cultured in a manner known by a person skilled in the art, depending on the host organism. Microorganisms are as a rule grown in a liquid medium, which contains a carbon source generally in the form of sugars, a nitrogen source generally in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese, magnesium salts and optionally vitamins, at temperatures between 0.degree. C. and 100.degree. C., preferably between 10.degree. C. and 60.degree. C. with oxygen aeration. The pH of the liquid nutrient medium can be maintained at a fixed value, i.e. during growing it may or may not be regulated. Culture can be batchwise, semi-batchwise or continuous. Nutrients can be supplied at the start of fermentation or can be replenished semi-continuously or continuously.
[0252] 5. Preparation of UDCA Step 1: Chemical Reaction from CA to DHCA
[0253] The hydroxy groups of CA are oxidized with chromic acid or chromates in acidic solution (e.g. H.sub.2SO.sub.4) to carbonyl groups in a manner known per se by the classical chemical route. DHCA is formed.
Step 2: Enzymatic or Microbial Conversion of DHCA to 12-Keto-UDCA
[0254] In aqueous solution, DHCA is reduced by 3.alpha.-HSDH and 7.beta.-HSDH or mutants thereof specifically to 12-keto-UDCA in the presence of NADPH or NADH. The cofactor NADPH or NADH can be regenerated by an ADH or FDH or GDH or mutants thereof from isopropanol or sodium formate or glucose. The reaction goes under mild conditions. For example, the reaction can be carried out at pH=6 to 9, especially about pH=8 and at about 10 to 30, 15 to 25 or about 23.degree. C.
[0255] In the case of a microbial reaction step, recombinant microorganisms that express the necessary enzyme activity/activities can be cultured in the presence of the substrate to be converted (DHCA) anaerobically or aerobically in suitable liquid media. Suitable cultivation conditions are known per se by a person skilled in the art. They comprise reactions in the pH range of for example 5 to 10 or 6 to 9, at temperatures in the range from 10 to 60 or 15 to 45 or 25 to 40 or 37.degree. C. Suitable media comprise for example the LB and TB media described below. The reaction can take place for example batchwise or continuously or in other usual process variants (as described above). The reaction time can for example range from minutes to several hours or days, and can be e.g. 1 h to 48 h. Optionally, if enzyme activity is not expressed continuously, this can be induced by adding a suitable inductor, after reaching a target cell density, e.g. of about OD.sub.600=0.5 to 1.0.
[0256] Further possible suitable modifications of the microbial production process with respect to fermentation mode, additions to the medium, enzyme immobilization and isolation of the valuable substances can also be found in the following section concerning "Production of the enzymes or mutants".
Step 3: Chemical Conversion of 12-Keto-UDCA to UDCA
[0257] The 12-carbonyl group of 12-keto-UDCA is removed by means of Wolff-Kishner reduction in a manner known per se, with formation of UDCA from 12-keto-UDCA. In the reaction, first the carbonyl group is reacted with hydrazine to hydrazone. Then the hydrazone is heated in the presence of a base (e.g. KOH) to 200.degree. C., with cleavage of nitrogen and formation of UDCA.
[0258] 6. Recombinant Production of the Enzymes and Mutants
[0259] The invention further relates to processes for recombinant production of polypeptides according to the invention or functional, biologically active fragments thereof, wherein a polypeptide-producing microorganism is cultured, optionally expression of the polypeptides is induced and the latter are isolated from the culture. The polypeptides can also be produced on an industrial scale in this way, if this is desirable.
[0260] The microorganisms produced according to the invention can be cultured continuously or discontinuously in the batch method (batch culture) or in the fed batch or repeated fed batch method. A summary of known cultivation methods can be found in Chmiel's textbook (Bioproze technik 1. Einfuhrung in die Bioverfahrenstechnik [Bioprocess technology 1. Introduction to bioprocess engineering] (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (Bioreaktoren and periphere Einrichtungen [Bioreactors and peripheral equipment]) (Vieweg Verlag, Brunswick/Wiesbaden, 1994)).
[0261] The culture medium to be used must suitably fulfill the requirements of the respective strains. Descriptions of culture media for various microorganisms are given in the manual "Manual of Methods for General Bacteriology" of the American Society for Bacteriology (Washington D.C., USA, 1981).
[0262] These media usable according to the invention usually comprise one or more carbon sources, nitrogen sources, inorganic salts, vitamins and/or trace elements.
[0263] Preferred carbon sources are sugars, such as mono-, di- or polysaccharides. Very good carbon sources are for example glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose. Sugars can also be added to the media via complex compounds, such as molasses, or other by-products of sugar refining. It may also be advantageous to add mixtures of various carbon sources. Other possible carbon sources are oils and fats such as soybean oil, sunflower oil, peanut oil and coconut oil, fatty acids such as palmitic acid, stearic acid or linoleic acid, alcohols such as glycerol, methanol or ethanol and organic acids such as acetic acid or lactic acid.
[0264] Nitrogen sources are usually organic or inorganic nitrogen compounds or materials that contain these compounds. Examples of nitrogen sources comprise ammonia gas or ammonium salts, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate or ammonium nitrate, nitrates, urea, amino acids or complex nitrogen sources, such as corn-steep liquor, soybean flour, soybean protein, yeast extract, meat extract and others. The nitrogen sources can be used individually or as a mixture.
[0265] Inorganic salt compounds that can be contained in the media comprise the chloride, phosphorus or sulfate salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron.
[0266] The sulfur source used can be inorganic sulfur compounds such as sulfates, sulfites, dithionites, tetrathionates, thiosulfates, sulfides but also organic sulfur compounds, such as mercaptans and thiols.
[0267] The phosphorus source used can be phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts.
[0268] Chelating agents can be added to the medium in order to keep the metal ions in solution. Especially suitable chelating agents comprise dihydroxyphenols, such as catechol or protocatechuate, or organic acids, such as citric acid.
[0269] The fermentation media used according to the invention usually also contain other growth factors, such as vitamins or growth promoters, which include for example biotin, riboflavin, thiamine, folic acid, nicotinic acid, panthothenate and pyridoxine. Growth factors and salts are often derived from complex components of the media, such as yeast extract, molasses, corn-steep liquor and the like. Moreover, suitable precursors can be added to the culture medium. The exact composition of compounds in the medium is strongly dependent on the particular experiment and is decided individually for each specific case. Information on media optimization can be found in the textbook "Applied Microbiol. Physiology, A Practical Approach" (Publ. P. M. Rhodes, P. F. Stanbury, IRL Press (1997) p. 53-73, ISBN 0 19 963577 3). Growth media can also be obtained from commercial suppliers, such as Standard 1 (Merck) or BHI (brain heart infusion, DIFCO) and the like.
[0270] All components of the media are sterilized, either with heat (20 min at 1.5 bar and 121.degree. C.) or by sterile filtration. The components can either be sterilized together or separately if necessary. All components of the media can be present at the start of culture or can optionally be added continuously or batchwise.
[0271] The culture temperature is normally between 15.degree. C. and 45.degree. C., preferably at 25.degree. C. to 40.degree. C. and can be kept constant or varied during the experiment. The pH of the medium should be in the range from 5 to 8.5, preferably around 7.0. The culture pH can be controlled during culture by adding basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or ammonia water or acid compounds such as phosphoric acid or sulfuric acid. To control foaming it is possible to use antifoaming agents, such as fatty acid polyglycol esters. For maintaining the stability of plasmids, suitable selectively acting substances, such as antibiotics, can be added to the medium. To maintain aerobic conditions, oxygen or oxygen-containing gas mixtures, such as ambient air, are fed into the culture. The culture temperature is normally at 20.degree. C. to 45.degree. C. Culture is continued until a maximum of the desired product has formed. This target is normally reached within 10 hours to 160 hours.
[0272] The fermentation broth is then processed further. Depending on the requirements, the biomass is removed from the fermentation broth completely or partially by separation techniques, such as centrifugation, filtration, decanting or a combination of these methods or can be left in it completely.
[0273] If the polypeptides are not secreted into the culture medium, the cells can also be disrupted and the product can be obtained from the lysate by known methods of protein isolation. The cells can optionally be disrupted with high-frequency ultrasound, by high pressure, for example in a French press, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, using homogenizers or by a combination of several of the methods listed.
[0274] The polypeptides can be purified by known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, and with other usual methods such as ultrafiltration, crystallization, salting-out, dialysis and native gel electrophoresis. Suitable methods are described for example in Cooper, F. G., Biochemische Arbeitsmethoden [Methods of Biochemical Processing], Verlag Walter de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.
[0275] For isolating the recombinant protein, it may be advantageous to use vector systems or oligonucleotides that lengthen the cDNA with defined nucleotide sequences and therefore code for modified polypeptides or fusion proteins, which for example serve for easier purification. Suitable modifications of this kind are for example so-called "tags" functioning as anchors, for example the modification known as hexa-histidine anchors, or epitopes that can be recognized as antigens by antibodies (described for example in Harlow, E. and Lane, D., 1988, Antibodies: A Laboratory Manual. Cold Spring Harbor (N.Y.) Press). These anchors can serve for attaching the proteins to a solid carrier, for example a polymer matrix, which can for example be packed in a chromatography column, or can be used on a microtiter plate or on some other support.
[0276] At the same time, these anchors can also be used for recognizing the proteins. For recognition of the proteins, in addition usual markers, such as fluorescent dyes, enzyme markers, which form a detectable reaction product after reaction with a substrate, or radioactive markers, can be used, alone or in combination with the anchors for derivatization of the proteins.
[0277] 7. Enzyme Immobilization
[0278] In the method described herein, the enzymes according to the invention can be used free or immobilized. An immobilized enzyme is to be understood as an enzyme that is fixed to an inert support. Suitable support materials and the enzymes immobilized thereon are known from EP-A-1149849, EP-A-1 069 183 and DE-OS 100193773 and from the literature references cited therein. Regarding this, full reference is made to the disclosure of these documents.
[0279] Suitable support materials include for example clays, clay minerals, such as kaolinite, diatomaceous earth, perlite, silicon dioxide, aluminum oxide, sodium carbonate, calcium carbonate, cellulose powder, anion exchanger materials, synthetic polymers, such as polystyrene, acrylic resins, phenol-formaldehyde resins, polyurethanes and polyolefins, such as polyethylene and polypropylene. For preparing the supported enzymes, the support materials are usually used in a finely-divided, particulate form, with porous forms being preferred. The particle size of the support material is usually not more than 5 mm, especially not more than 2 mm (particle-size distribution curve). Similarly, when using dehydrogenase as whole-cell catalyst, a free or immobilized form can be selected. Support materials are for example Ca-alginate, and carrageenan. Enzymes as well as cells can also be crosslinked directly with glutaraldehyde (crosslinking to CLEAs). Corresponding and further methods of immobilization are described for example in J. Lalonde and A. Margolin "Immobilization of Enzymes" and in K. Drauz and H. Waldmann, Enzyme Catalysis in Organic Synthesis 2002, Vol.III, 991-1032, Wiley-VCH, Weinheim.
Experimental Section:
[0280] Unless stated otherwise, the cloning steps carried out in the context of the present invention, for example restriction cleavage, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids onto nitrocellulose and nylon membranes, linkage of DNA fragments, transformation of microorganisms, culturing of microorganisms, multiplication of phages and sequence analysis of recombinant DNA are carried out as described in Sambrook et al. (1989) op. cit.
A. GENERAL INFORMATION
Materials:
[0281] The genomic DNA of Collinsella aerofaciens DSM 3979 (ATCC 25986, former designation Eubacterium aerofaciens) was obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ). UDCA and 7-keto-LCA are starting compounds that are known per se and are described in the literature. All other chemicals were obtained from Sigma-Aldrich and Fluka (Germany). All restriction endonucleases, T4 DNA ligase, Taq DNA polymerase, Phusion DNA polymerase and isopropyl-.beta.-D-1-thiogalactopyranoside (IPTG) were obtained from Fermentas (Germany).
Media:
[0282] LB medium, containing tryptone 10 g, yeast extract 5 g, NaCl 10 g per liter of medium
[0283] TB medium, containing tryptone 12 g, yeast extract 24 g, 4 mL glycerol, 10% TB buffer (11.55 g KH.sub.2PO.sub.4, 62.7 g K.sub.2HPO.sub.4, H.sub.2O to 500 mL) per liter of medium
[0284] Minimal medium, modified according to Wilms et al., BIOTECHNOLOGY AND BIOENGINEERING, 2001 VOL. 73, No. 2, 95-103
Expression Vectors and Vector Constructs
[0285] For the expression of recombinant proteins, the following expression vectors that are known per were used:
[0286] pET21a(+), (cf. FIG. 3a)
[0287] pET22b(+) (cf. FIG. 3b)
[0288] pET28a(+) (cf. FIG. 3d) and
[0289] pCOLADuet-1 (in each case Novagen, Madison, Wis., USA).
[0290] The vectors pET21a(+) and pET22b(+) each possess a multiple cloning site (MCS), in each case under the control of a T7-promoter with downstream lac-operator and the subsequent ribosomal binding site (rbs). In the C-terminal region of the expression domain there is in each case a T7-terminator. Both plasmids have a ColE1-replicon (pBR322-replicon), an ampicillin resistance gene (bla), an f1-origin and a gene coding for the lac-inhibitor (lacl).
[0291] In addition, the pET21a(+)-plasmid has a T7Tag in the N-terminal region of the MCS and an optional HisTag C-terminally of the MCS. The pET22b(+)-plasmid has, in the N-terminal region of the MCS, a pelB signal sequence and a HisTag C-terminally of the MCS.
[0292] The pCOLADuet-1 vector has two MCSs, each of which is under the control of a T7-promoter with downstream lac-operator and subsequent ribosomal binding site (rbs). C-terminally of the two MCSs there is a T7-terminator. Moreover, this vector has a gene that codes for the lac-inhibitor and a COLA-replicon (CoIA-replicon).
[0293] A modified variant of the commercially available pCOLADuet-1 vector was used in the present work. In this modified plasmid variant (designated pCOLA(mod); cf. FIG. 3c)) the kanamycin resistance gene of the original vector was replaced with a chloramphenicol resistance gene. In addition, an Ncol restriction site was removed from the chloramphenicol resistance gene by site-directed point mutagenesis. In the N-terminal region of the first MCS there is a HisTag, whereas C-terminally of the second MCS there is an STag.
[0294] The CoIE1-replicons of the pET-plasmids and the COLA-replicon of the pCOLA-plasmid are mutually compatible. This permits simultaneous stable insertion of a pET-plasmid and of a pCOLA-plasmid in Escherichia coli. In this way, combinations of various genes can be cloned into Escherichia coli, without their being located on the same operon. Owing to the different copy numbers of pET-vectors (.about.40) and pCOLA-vectors (20-40), it is moreover possible to influence the expression level of cotransformed genes.
[0295] The following vector constructs were used
[0296] pET22b(+) 7.beta.-HSDH: a pET22b(+) vector into which the 7.beta.-HSDH from Collinsella aerofaciens ATCC 25986 had been cloned via the Nde I and Hind III cleavage sites in the usual way.
[0297] pET22b(+) 3.alpha.-HSDH: a pET22b(+) vector into which the 3.alpha.-HSDH from Comamonas testosteroni had been cloned via the Nde I and EcoR I cleavage sites in the usual way (Oppermann et al., J Biochem, 1996, 241(3): 744-749).
[0298] pET21a(+) FDH D221G (cf. FIG. 4a): a pET21a(+) vector into which the formate dehydrogenase from Mycobacterium vaccae N10 had been cloned via the Nde I and EcoR I cleavage sites. With site-directed mutagenesis, the aspartate residue (D) at position 221 (without taking into account methionine in position 1) or position 222 (counting from methionine in position 1; cf. SEQ ID NO: 15, 19, 35) of formate dehydrogenase was replaced with a glycine residue (cf. production example 4, below). Formate dehydrogenase carries, at position 1202 of the nucleotide sequence, a single base deletion, which leads to exchange of the last amino acid valine for an alanine. Simultaneously, this base deletion leads to switching-off of the stop codon and to activation of the HisTag that was originally outside of the reading frame (cf. SEQ ID NO: 34 and 35).
[0299] pET21a(+) 7.beta.-HSDH: a pET21a(+) vector, into which the 7.beta.-HSDH from Collinsella aerofaciens ATCC 25986 had been cloned via the Nde I and Xho I cleavage sites in the usual way
[0300] pET21a(+) FDH D221G 7.beta.-HSDH (cf. FIG. 4b)
[0301] pET21a(+) FDH 7.beta.-HSDH(G39A) 3.alpha.-HSDH (cf. FIG. 8)
[0302] pCOLA(mod) 3.alpha.-HSDH (cf. FIG. 5)
Microorganisms
TABLE-US-00006
[0303] Strain Genotype Escherichia coli DH5.alpha. F.sup.- endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG .PHI.80dlacZ.DELTA.M15 .DELTA.(lacZYA- argF)U169, hsdR17(r.sub.K.sup.- m.sub.K+), .lamda.- Escherichia coli F.sup.- ompT gal dcm lon hsdS.sub.B(r.sub.B.sup.-m.sub.B.sup.-) .lamda.(DE3 BL21(DE3) [lacl lacUV5-T7 gene 1 ind1 sam7 nin5]) Escherichia coli BL21 F.sup.- ompT gal dcm lon hsdS.sub.B(r.sub.B.sup.-m.sub.B.sup.-) .lamda.(DE3 (DE3) hdhA.sup.- KanR.sup.+ [lacl lacUV5-T7 gene 1 ind1 sam7 nin5]) (7.alpha.-HSDH knock-out hdhA.sup.- KanR.sup.+ strain) (cf. production example 5)
[0304] The Escherichia coli strain DH5a (Novagen, Madison, Wis., USA) was multiplied at 37.degree. C. in LB medium containing suitable antibiotics.
[0305] The Escherichia coli strain BL21(DE3) (Novagen, Madison, Wis., USA) was multiplied at 37.degree. C. in LB medium containing suitable antibiotics and after induction at OD.sub.600=0.8 with 0.5 mM IPTG was held at 25.degree. C. and 140 rpm.
Methods
[0306] 1. Standard Conditions for Determination of 7.beta.-HSDH Activity
[0307] The reaction mixture contains a total volume of 1 ml:
TABLE-US-00007 880 .mu.l 50 mM potassium phosphate buffer, pH 8.0 10 .mu.l 10 mM UDCA (dissolved in water, pH 8) 10 .mu.l enzyme solution (in buffer as above, in the range from 1 to 10 U/ml) 100 .mu.l 1 mM NADP+ ( in buffer as above)
The increase in extinction at 340 nm is measured and the activity is calculated as enzyme unit (U, i.e. .mu.mol/min) using the molar extinction coefficient of 6.22 mM.sup.-1.times.cm.sup.-1.
[0308] Standard conditions for determination of 7.beta.-HSDH activity according to production example 7
[0309] The reaction mixture contains a total volume of 1 ml
TABLE-US-00008 870 .mu.l 50 mM potassium phosphate (KPi) buffer, pH 8.0 100 .mu.l 100 mM DHCA (dissolved in 50 mM KPi, pH 8) 10 .mu.l enzyme solution (in buffer as above, in the range from 2 to 6 U/ml) 20 .mu.l 12.5 mM NADPH (dissolved in ddH.sub.2O)
[0310] The increase in extinction at 340 nm is measured and the activity is calculated as enzyme unit (U, i.e. .mu.mol/min) using the molar extinction coefficient of 6.22 mM.sup.-1.times.cm.sup.-1.
[0311] 2. Determination of Protein by BCA Assay
[0312] The samples were mixed with BCA reagent (from Interchim) and incubated at 37.degree. C. for 45 min. The protein content was determined at 562 nm against a calibration curve (BSA) in the concentration range of the assay used.
[0313] 3. Thin-Layer Chromatography
[0314] 5 to 10 .mu.g of sample was applied to a TLC Film Silica Gel 60 (Merck). Authentic substances were applied as reference. One end of the TLC film was dipped in solvent until the top of the mobile phase was reached. The TLC film was dried and was developed with phosphomolybdic acid.
[0315] 4. Molecular Biology Procedures:
[0316] Molecular biology operations are carried out, unless stated otherwise, on the basis of established methods, e.g. described in:
[0317] Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990).
B. EXAMPLES
Production Example 1
Identification of 7.beta.-HSDH Activity
[0318] The genomic DNA sequence of Collinsella aerofaciens ATCC 25986 was published in the year 2007 by "Washington University Genome Sequencing Center" for the "human gut microbiome project" at GenBank. HSDHs belong to the "short-chain dehydrogenases". As the biochemical function of the "short-chain dehydrogenases" from Collinsella aerofaciens ATCC 25986 had not been annotated in GenBank, 9 candidates were cloned into vector pET22b+, and then expressed in E. coli BL21(DE3).
[0319] For this, 7.beta.-HSDH coding sequences were PCR-amplified. The PCR products were obtained using the genomic DNA of Collinsella aerofaciens ATCC 25986 (DSM 3979) as template and the primers 5'-gggaattcCATATGAACCTGAGGGAGAAGTA-3' (SEQ ID NO:3) and 5'-cccAAGCTTCTAGTCGCGGTAGAACGA-3' (SEQ ID NO:4). The Ndel and HindIII cleavage sites in the primer sequences are underlined. The PCR product was purified using the PCR-Purification-Kit (Qiagen) and then cut with the enzymes Ndel and HindIII. The corresponding vector was also cut with Ndel and HindIII. The products were applied to agarose gel, separated, cut out and purified. The cut PCR product and the cut vector were ligated by means of T4-ligase. The ligant was transformed into E. coli DH5a. The resultant vector (contains the gene of 7.beta.-HSDH) was confirmed by sequencing and transformed into E. coli BL21(DE3) and induced with IPTG and expressed.
[0320] Expression was carried out in 50 ml LB medium. For preparation of a preculture, a colony on LB-agar plate in 5 ml LB medium (contains corresponding antibiotics) was picked and incubated overnight at 37.degree. C. and 160 rpm. The 50 ml LB medium (contains corresponding antibiotics) was inoculated with 500 .mu.l of preculture. The culture was incubated at 37.degree. C. and 160 rpm. Up to OD600 approx. 0.8, expression was induced by adding 0.5 mM IPTG. After 6 h or overnight, the cells were centrifuged off. The pellets were resuspended in 6 ml potassium phosphate buffer (50 mM, pH 8, contains 0.1 mM PMSF) and disrupted with ultrasound. The cell debris was removed by centrifugation.
[0321] For identification of 7.beta.-HSDH activity, the activity was investigated by a photometric method. In a 1 ml cuvette, enzyme and 0.1 mM of test substance (UDCA) were mixed in potassium phosphate buffer (50 mM, pH8). After adding NADPH(NADH) or NADP+(NAD+), the degradation or formation of NAD(P)H was measured. One enzyme out of the 9 candidates shows activity (60 U/ml) against UDCA in the presence of NADP+, but no activity against CA. The NADPH-dependent 7.beta.-HSDH activity of this enzyme was identified.
[0322] In the photometric investigation, 7.beta.-HSDH showed activity of 60 U/ml against UDCA, activity of 35 U/ml against 7-keto-LCA and activity of 119 U/ml against DHCA in the presence of NADP.sup.+ or NADPH. The activity against CA is not detectable.
[0323] The gene that codes for 7.beta.-HSDH was subcloned into pET28a+ with His-Tag, to permit rapid purification. This 7.beta.-HSDH with His-Tag was actively expressed in E. coli BL21(DE3) as described above. Purification was carried out with a Talon column. The column was first equilibrated with potassium phosphate buffer (50 mM, pH 8, with 300 mM NaCl). After loading of the cell lysate, the column was washed with potassium phosphate buffer (50 mM, pH 8, with 300 mM NaCl). The 7.beta.-HSDH was eluted with potassium phosphate buffer (50 mM, pH 8, with 300 mM NaCl and 200 mM imidazole). The imidazole in the eluate was removed by dialysis. The yield in purification was 76% with purity of approx. 90%.
Production Example 2
Preparative-Scale Cloning, Expression and Purification of 7.beta.-HSDH from Collinsella Aerofaciens ATCC 25986 and further Characterization of the Enzyme
[0324] 2.1 Cloning and Production of an Expression Construct
[0325] The gene coding for 7.beta.-HSDH was once again amplified from the genomic DNA by PCR and using primers, as described above for production example 1:
[0326] The PCR product was once again purified as described above and digested with the restriction endonucleases Ndel and HindIII. The digested PCR product was purified again and cloned into the pET-28a(+) vector using the T4-ligase, to produce an expression vector. The resultant expression construct was then transformed into E. coli DH5.alpha. cells. The protein to be expected should have 20 amino acid residues comprising a signal peptide and an N-terminal 6.times. His-Tag and a thrombin cleavage site. The sequence of the inserted DNA was verified by sequencing.
[0327] 2.2 Overexpression and Purification of 7.beta.-HSDH
[0328] E. coli BL21(DE3) was transformed with the expression construct. For this, the E. coli BL21(DE3) strain containing the expression construct was multiplied in LB medium (2.times.400 ml in 2-liter shaking bottles) containing 30 .mu.g/ml kanamycin. The cells were harvested by centrifugation (10.000.times.g, 15 min, 4.degree. C.). The pellet was resuspended in 20 ml phosphate buffer (50 mM, pH 8, containing 0.1 mM PMSF). The cells were disrupted by ultrasound treatment for 1 minute with constant cooling (40 W power, 40% working interval and 1 min pause) using Sonifier 250 ultrasonic equipment (Branson, Germany). Lysis was repeated three times. The cell extract was centrifuged (22.000.times.g, 20 min, 4.degree. C.). The supernatant was loaded on a Talon column (Clontech, USA), equilibrated with loading buffer (50 mM potassium phosphate, 300 mM NaCl, pH 8). The procedure was carried out at 24.degree. C. Unbound material was washed away by washing the column with loading buffer (3 column volumes). Weakly binding protein was removed by washing with washing buffer (20 mM imidazole in the loading buffer; 3 column volumes). The His-Tag-7.beta.-HSDH protein was eluted with elution buffer (200 mM imidazole in the loading buffer). The eluate was dialyzed overnight in a dialysis tube with a molecular exclusion limit of 5 kDa (Sigma, USA) in 2 liters of potassium phosphate buffer (50 mM, pH 8) at 4.degree. C. Finally the sample was transferred to a new tube and stored at -20.degree. C. for further analysis. The protein concentration was determined using a BCA Test Kit (Thermo, USA) according to the manufacturer's instructions. In addition the sample was analyzed by 12.5% SDS-PAGE and staining with Coomassie Brilliant Blue. The purity of the protein was determined densitometrically using Scion Image Beta 4.0.2 (Scion, USA).
[0329] 2.3 Gel Filtration
[0330] Gel filtration was carried out on a Pharmacia AKTA protein purification system, in order to determine the molecular weight of 7.beta.-HSDH. The purified enzyme was applied on a Sephadex G-200 column, which had been equilibrated beforehand with 50 mM Tris-HCl (pH 8), containing 200 mM sodium chloride. The protein was eluted with the same buffer at a flow rate of 1 ml/min. The molecular weight of 7.beta.-HSDH was determined by comparing its elution volume with that of protein standards (serum albumin (66 kDa), .alpha.-amylase from Aspergillus oryzae (52 kDa), pig pancreas trypsin (24 kDa) and hen's egg lysozyme (14.4 kDa)).
[0331] 2.4 Enzyme Assay and Kinetic Analysis
[0332] The reaction mixture for the enzyme assay contained, in a total volume of 1 ml, 50 .mu.mol potassium phosphate (pH 8), 0.1 .mu.mol NAD(P)H or NAD(P).sup.+, substrates and protein. The reaction mixture was contained in cuvettes with a light path length of 1 cm. The 7.beta.-HSDH activity was determined by recording the variation in NAD(P)H concentration against the extinction at 340 nm using a spectrophotometer (Ultraspec 3000, Pharmacia Biotech, Great Britain). The enzyme activities were determined as enzyme units (U, i.e. .mu.mol/min) using the molar extinction coefficient of 6.22 mM.sup.-1.times.cm.sup.-1 at 25.degree. C. Several different measurements were performed with the variables substrate, coenzyme, concentration, pH, buffer and incubation temperature. The kinetic constants were determined using standard methods.
[0333] 2.5 Biotransformation of 7-Keto-Lithocholic Acid by 7.beta.-HSDH
[0334] The transformation of 7-keto-LCA by 7.beta.-HSDH was carried out in order to verify the biochemical function of 7.beta.-HSDH. 0.4 g 7-keto-LCA was suspended in 10 ml potassium phosphate buffer (50 mM, pH 8) and the pH was adjusted to pH 8 by adding 2 M sodium hydroxide. 0.2 ml isopropanol, 100 U 7.beta.-HSDH and 80 U alcohol dehydrogenase (ADH-TE) from Thermoanaerobacter ethanolicus (kindly donated by Dr. K. Momoi, ITB University, Stuttgart) and 1 .mu.mol NADP.sup.+ were added. The same buffer was added, to give a total reaction volume of 20 ml. The reaction mixture was incubated at 24.degree. C. and stirred for 24 hours. During this, NADPH was regenerated with ADH via oxidation of 2-propanol. The product was acidified with 1 ml of 2 M hydrochloric acid and was extracted 5.times. with 5 ml ethyl acetate. The organic solution was then distilled.
[0335] 2.6 Determination of Chromatographic Product
[0336] An HPLC analysis was carried out on a column of the Purospher0 STAR RP-18 type (Hitbar.RTM. RT 125-4 Pre-Packed Column, Purospher0 STAR RP-18 endcapped, Merck, Germany), provided with a precolumn of the LiChroCART.RTM. STAR RP18 type (endcapped, Merck, Germany) on an HPLC system LC20AD (Shimadzu, Japan) at a flow rate of 1 ml/min. The mobile phase consisted of two eluents. Eluent A contained acetonitrile and eluent B contained distilled water (pH 2.6, adjusted with orthophosphoric acid, 85%). The following gradient was used: A 35% (8 min)--35%-43% (1% min.sup.-1)--43%-70% (1% min.sup.-1)--70% (5 min)--70%-35% (17.5% min.sup.-1)--35% (5 min); eluent A 65% (8 min)--65%-57% (1% min.sup.-1)--57%-30% (1% min.sup.-1)--30% (5 min)--30%-65% (17.5% min.sup.-1)--65% (5 min). 20 .mu.l samples (1 mg/ml) were analyzed. Authentic UDCA, 7-keto-LCA and CDCA were used at the same concentration as standards. Recording was carried out by UV detection at 200 nm.
[0337] 2.7 Sequence Alignment and Phylogenetic Analysis
[0338] Multiple sequence alignments were produced using the Clustal X-Software (Thompson et al., 1997, Nucleic Acid Research 25: 4876-82) and modified using the Jalview software (Clamp et al., 2004, Bioinformatics 20: 426-7). The phylogenetic tree was produced using the program TreeView 1.6.6 (Roderic 2001, http://taxonomy.zoology.gla.ac.uk/rod/rod.html).
[0339] 2.8 Test Results:
[0340] 2.8.1 Identification of 7.beta.-HSDH activity in a preparative biotransformation
[0341] To confirm the function of the enzyme, a biotransformation of 7-keto-LCA was carried out at the 10-ml scale, wherein the isolated enzyme was used in combination with ADH for regeneration of NADPH using 2-propanol, as already described. The HPLC analysis showed that UDCA was the only reaction product produced by the enzyme (90% conversion). CDCA (retention time 19.4 min) was not detected in the reaction mixture. The result shows that the enzyme is an NADPH-dependent 7.beta.-HSDH and is capable of selective reduction of the 7-carbonyl group of 7-keto-LCA to a 7.beta.-hydroxyl group.
[0342] Retention time UDCA: 15.5 min
[0343] Retention time 7-keto-LCA: 18.3 min
[0344] 2.8.2. Purification and Gel Filtration
[0345] After cloning the 7.beta.-HSDH gene from Collinsella aerofaciens DSM 3979 into the expression vector pET28a(+) and subsequent overexpression, a fusion protein provided with a His-Tag on the N-terminus was obtained with a 7.beta.-HSDH yield of 332.5 mg (5828 U) per liter of culture. The 7.beta.-HSDH provided with the His-Tag was purified in one step by immobilized metal ion affinity chromatography (purity >90%, yield 76%, cf. FIG. 2.). The main bands of lanes 1 and 2 represent the expected expression product at 30 kDa, which corresponds to the predicted molecular weight derived from the amino acid sequence of the gene. However, a molecular weight of 56.1 kDa is found for 7.beta.-HSDH by gel filtration. This proves the dimeric nature of the 7.beta.-HSDH from Collinsella aerofaciens DSM 3979.
[0346] 2.8.3. Sequence Alignments
[0347] The amino acid sequence of the 7.beta.-HSDH used according to the invention was compared with known HSDH sequences (alignment not shown). The observed sequence similarity indicates that the enzyme according to the invention belongs to the family of short-chain dehydrogenases (SDR). It is known that SDRs have very low homology and sequence identity (Jornvall, H., B. Persson, M. Krook, S. Atrian, R. Gonzalez-Duarte, J. Jeffery, and D. Ghosh. 1995. Short-chain dehydrogenases/reductases (SDR). Biochemistry 34: 6003-13 and Persson, B., M. Krook, and H. Jornvall. 1991. Characteristics of short-chain alcohol dehydrogenases and related enzymes. Eur J Biochem 200: 537-43). However, the sequence alignment clearly shows the conserved domains in the SDR primary structure. The N-terminal motif Gly-X-X-X-Gly-X-Gly (corresponding to Gly-41, Gly-45 and Gly-47, numbering corresponding to the alignment) corresponds to the characteristic dinucleotide binding motif of the SDR superfamily. Furthermore, three strongly conserved residues Ser-177, Tri-190 and Lys-194 are observed, which correspond to the catalytic triad of the SDR enzymes.
[0348] 2.8.4. Phylogenetic Analysis
[0349] 7.alpha.-HSDHs from Clostridium sordellii, Brucella melitensis and Escherichia coli belong to the same subgroup. The two 3.alpha.-HSDHs show a more pronounced similarity than other HSDHs. Interestingly, the prokaryotic 7.beta.-HSDH is related to the animal 11.beta.-HSDH subgroup, comprising Cavia porcellus, Homo sapiens and Mus musculus.
[0350] 2.8.5. Kinetic constants
[0351] Kinetic equilibrium analyses were carried out, in order to determine the absolute values for V.sub.max and K.sub.M for UDCA, 7-keto-LCA, DHCA, NADP.sup.+ and NADPH by Lineweaver-Burk plots. The following table presents all kinetic data for the substrates and coenzymes tested, which were obtained from substrate saturation curves and reciprocal plots. The V.sub.max, K.sub.M and k.sub.cat values for all substrates and coenzymes are in the same region, whereas the K.sub.M value for DHCA was significantly higher than with the other substrates, possibly caused by the low solubility in water. The enzyme is NADPH-dependent and kinetic constants could not be determined for NAD.sup.+ and NADH owing to the very low activity.
[0352] Summary of kinetic constants for 7.beta.-HSDH from Collinsella aerofaciens DSM 3979.
TABLE-US-00009 K.sub.M V.sub.max k.sub.cat (.mu.M) (U/mg protein).sup.b) (1 .mu.mol/(.mu.mol .times. min)) NADP.sup.+ 5.32 30.58 944.95 NADPH 4.50 33.44 1033.44 UDCA 6.23 38.17 1179.39 7-Keto-LCA 5.20 30.77 950.77 DHCA 9.23 28.33 875.35 NAD.sup.+ --.sup.a) -- Traces NADH --.sup. -- Traces .sup.a)could not be determined owing to the very low activity .sup.b)1 U = 1 .mu.mol/min
[0353] 2.8.6. Optimal pH
[0354] In addition, the 7.beta.-HSDH activity was determined with purified enzyme for various substrates as a function of the pH. For the oxidation of UDCA with 7.beta.-HSDH, an optimal activity was observed in the range from pH 9 to 10 with gradual decline on the acidic side. In contrast, for the reduction of DHCA and 7-keto-LCA by 7.beta.-HSDH, there was an optimal activity in the range from pH 4 to 6 with a sharp decline on the acidic side and a gradual decline on the alkaline side. Different buffers only have a slight influence on the activity of 7.beta.-HSDH at identical pH.
[0355] 2.8.7. Thermal Stability
[0356] The NADP-dependent 7.beta.-HSDH used according to the invention shows the following stability behavior: after 400 min the activity at 30.degree. C. was about 30% lower than at 23.degree. C. At 30.degree. C., the enzyme was completely inactivated after 1500 min, whereas at 23.degree. C. and 1500 min the residual activity was 20%. No significant activity loss was observed during storage at -20.degree. C. in potassium phosphate buffer (50 mM, pH 8) over a period of some months after repeated freezing and thawing.
Production Example 3
Production of 7.beta.-HSDH Mutants and Characterization Thereof
[0357] Position 39 of the amino acid sequence (comprising start methionine) (cf. SEQ ID NO:2) was mutated.
[0358] 3.1 Primers
[0359] The mutagenesis primers stated below were used for the site-directed mutagenesis of 7.beta.-HSDH. The primers were selected based on the 7.beta.-HSDH gene sequence, so that they bring about the desired amino acid exchange. It was borne in mind that the base to be mutated is localized centrally in the primer, and that the melting points of the primer pairs are in the same region.
[0360] The primer pair 7beta_mut_G39A_fwd and 7beta_mut G39_ A rev was used for preparing the G39A mutant. The primer pair 7beta_mut_G39S_fwd and 7beta_mut_G39S_rev was used for preparing the G39S mutant.
TABLE-US-00010 Glycine .fwdarw. Alanine Forward: SEQ ID NO: 9) 7beta_mut_G39A_fwd: CGTCGTCATGGTCGCCCGTCGCGAGG. Reverse: SEQ ID NO: 10) 7beta_mut_G39A_rev: CCTCGCGACGGGCGACCATGACGACG. Glycine .fwdarw. Serine Forward: SEQ ID NO: 11) 7beta_mut_G39S_fwd: CGTCGTCATGGTCAGCCGTCGCGAGG. Reverse: SEQ ID NO: 12) 7beta_mut_G39S_rev: CCTCGCGACGGCTGACCATGACGACG.
3.2 PCR Program
[0361] In the reaction, first a 2-min initial denaturation step was carried out at 98.degree. C. Then 25 cycles of denaturation (30 s at 98.degree. C.), primer hybridization (2.5 min at 58.degree. C.) and elongation (6 min at 72.degree. C.) were carried out. As the last step, a final elongation of 15 min was carried out at 72.degree. C. before the polymerase chain reaction was stopped by cooling to 4.degree. C.
[0362] 3.3 PCR Assay
TABLE-US-00011
[0362] HF buffer (5x) 4 .mu.l dNTP-mix (10 mM) 0.4 .mu.l Forward primer (10 .mu.M) 2 .mu.l Reverse primer (10 .mu.M) 2 .mu.l Template 1 .mu.l Phusion polymerase (2 U .mu.L.sup.-1) 0.2 .mu.l DMSO 1 .mu.l ddH.sub.2O 9.4 .mu.l 20 .mu.l
A pET22b vector with 7.beta.-HSDH was used as template.
[0363] 3.4 Procedure
[0364] To allow targeted exchange of amino acids in protein sequences, the DNA sequence of the corresponding gene is submitted to site-directed mutation. For this, mutually complementary primers are used, which bear the desired mutation in their sequence. N6-adenine-methylated, double-stranded plasmid DNA, which bears the gene to be mutated, serves as template. N6-adenine-methylated plasmid DNA is isolated from dam.sup.+ E. coli strain such as for example E. coli DH5.
[0365] The polymerase chain reaction is carried out as described above. The primers are lengthened complementarily to the template, so that plasmids with the desired mutation are formed, which have a strand break. Unlike other PCR reactions, in this case the increase in DNA yield is only linear, as newly formed DNA molecules cannot serve as template for the PCR reaction.
[0366] On completion of the PCR reaction, the parental, N6-adenine-methylated DNA is digested by the restriction enzyme Dpnl. This enzyme has the particular feature that it restricts nonspecifically N6-adenine-methylated DNA, but not the newly formed, nonmethylated DNA. Restriction was carried out by adding 1 .mu.L Dpnl to the PCR reaction mixture and incubating for 1 h at 37.degree. C.
[0367] 10 .mu.l of this preparation was used for the transformation of 200 .mu.l of chemically-competent DH5.alpha. cells. After plasmid isolation, successful mutation was confirmed by sequencing.
[0368] 3.5 Characterization
[0369] For each of the mutants and for the wild-type enzyme, kinetic measurements were carried out in the microtiter plate photometer, recording the conversion rates of the enzymes both with constant substrate concentrations with variation of cofactor concentrations and vice versa. To determine the specific enzyme activity, the enzyme concentrations in the cell lysate were determined by densitometry.
[0370] To determine the dependence of the substrate conversion rate on the substrate concentration, a cofactor concentration of 100 .mu.M NADPH relative to the reaction volume was used, while the substrate concentration was varied over a range from 7 .mu.M to 10 mM dehydrocholic acid with 31 different concentrations (in each case relative to the reaction mixture).
[0371] To determine the dependence of the substrate conversion rate on the cofactor concentration, a substrate concentration of 0.3 mM dehydrocholic acid relative to the reaction volume was used, whereas the cofactor concentration was varied over a range from 25 .mu.M to 100 .mu.M NADPH with 8 different concentrations of the wild-type protein or over a range from 6 .mu.M to 100 .mu.M NADPH with 16 different concentrations for both mutants (in each case relative to the reaction mixture). In these measurement series, the reaction rate was determined by linear regression over the first 4 measurements (0 s-18 s).
[0372] The data obtained were evaluated with IGOR Pro. From the plots of substrate or cofactor concentration against the specific enzyme activity, the typical curve of Michaelis-Menten kinetics can be seen for the measurement series at constant substrate concentration and variation of cofactor concentration. From the plots of the measurement series with constant cofactor concentration and variation of substrate concentration, however, typical curves of Michaelis-Menten kinetics with substrate inhibition can be seen (cf. FIG. 6). For this reason, the classical Michaelis-Menten model was used for evaluating the measurement series at constant substrate concentration and variation of cosubstrate concentration, and the Michaelis-Menten model with substrate inhibition was used for the measurement series with constant cosubstrate concentration and variation of substrate concentration.
[0373] v.sub.max, K.sub.m and K.sub.i were determined by nonlinear regression.
[0373] v = v max c S K m + ( 1 + c S K i ) .times. c S ##EQU00001##
[0374] v specific enzyme activity, U mg.sup.-1=.mu.mol min.sup.-1 mg.sup.-1
[0375] v.sub.max maximum specific enzyme activity, U mg.sup.-1=.mu.mol min.sup.-1 mg.sup.-1
[0376] c.sub.s substrate or cofactor concentration, mol L.sup.-1
[0377] K.sub.m semisaturation concentration, mol L.sup.-1
[0378] K.sub.i inhibition constant, mol L.sup.-1
[0379] The parameters found are shown in the table.
TABLE-US-00012 TABLE Parameters found for the three different 78-HSDH variants K.sub.m, DCS, K.sub.i, DCS, K.sub.m, NADPH, V.sub.max, .mu.M mM .mu.M U/mg 7.beta.-HSDH WT 31 .+-. 5 8.6 .+-. 1.5 46 .+-. 7 14.6 .+-. 1.0 7.beta.-HSDH G39A 33 .+-. 6 17 .+-. 4 16.4 .+-. 1.9 21.0 .+-. 1.1 7.beta.-HSDH G39S 75 .+-. 9 80 .+-. 50 13.1 .+-. 2.9 20.7 .+-. 1.0
[0380] On examining the measured data, it is clear that 7.beta.-HSDH displays substrate inhibition via dehydrocholic acid, which is strongest for the wild-type protein and weakest with the G39S mutant. Especially in the case of this last-mentioned protein, it may be asked whether substrate inhibition occurs at all, as indicated by the high K.sub.i and its large error. The semisaturation concentrations for dehydrocholic acid are in the two-digit micromolar range. Whereas these do not differ significantly for the wild-type protein and the G39A mutant, at 31.+-.5 .mu.M and 33.+-.6 .mu.M respectively, for the G39S mutant this value, at 75.+-.9 .mu.M, is roughly double the value for the other two enzymes. In the case of the semisaturation concentrations for NADPH, lower values are found for the mutant enzymes than for the wild-type enzyme (46.+-.7 .mu.M in the wild-type versus 16.4.+-.1.9 .mu.M for the G39A mutant and 13.1.+-.2.9 .mu.M for the G39S mutant).
[0381] For both mutants, the values for v.sub.max are roughly 1.5 times the value of the wild-type protein (21.0.+-.1.1 U/mg for the G39A mutant and 20.1.+-.1.0 U/mg for the G38S mutant versus 14.6.+-.1.0 U/mg for the wild-type protein). In contrast to the classical Michaelis-Menten model, however, for the Michaelis-Menten model with substrate inhibition the v.sub.max values are not to be regarded as maximum attainable specific enzyme activities, since with increasing substrate concentration the specific enzyme activities do not approach v.sub.max asymptotically, but decrease again. The maximum attainable enzyme activities, i.e. the specific enzyme activities at the maxima of the kinetic curves, are .about.13 U/mg for the wild-type protein and .about.19 U/mg (G39A) and .about.20 U/mg(G39S) for the mutant proteins. The enzyme activities that can be reached at the substrate concentrations used for whole-cell biotransformation are more interesting than the maximum attainable enzyme activities. As an example, these are to be compared for the substrate concentration of 10 mM dehydrocholic acid, and are .about.6.7 U/mg for the wild-type protein, .about.13 U/mg for the G39A mutant and .about.18 U/mg for the G39S mutant. At 10 mM substrate concentration, the G39A mutant would accordingly be twice as active as the wild-type protein, and the G39S mutant would even have about 3 times its activity. These differences should be even more pronounced at higher substrate concentrations, as the wild-type protein displays stronger substrate inhibition than the G39A mutant, and the G39A mutant is in its turn more strongly substrate-inhibited than the G39S mutant.
Production Example 4
Production and Characterization of the FDH D221G Mutant
[0382] 4.1 Cloning pET21a(+) FDH
[0383] 4.1.1 PCR Amplification of Mycobacterium Vaccae Formate Dehydrogenase
[0384] The template used for the amplification is genomic DNA of Mycobacterium vaccae, which was obtained from the German Collection of Microorganisms and Cell Cultures (Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, DMSZ), Brunswick. The primers for the amplification were
TABLE-US-00013 (SEQ ID NO: 23) fdh_for (5'-CGATCATATGGCAAAGGTCCTGTGCGTTC-3') and (SEQ ID NO: 24) fdh_rev (5'-GCTAGAATTCTCAGCCGCCTTCTTGAACT-3'),
obtained from Eurofins MWG GmbH, Ebersberg. The recognition sites for the restriction enzymes are underlined. The rev-primer contains the EcoRl cleavage site and the for-primer contains the Ndel cleavage site.
[0385] The PCR assays and PCR programs are shown in the following table.
TABLE-US-00014 TABLE PCR assay for the amplification of formate dehydrogenase from Mycobacterium vaccae Component Volume [.mu.l] 10.times. Taq buffer (with Mg.sup.2+) 5 dNTPs (10 mM) 1 Fdh_for (100 .mu.M) 0.5 Fdh_rev (100 .mu.M) 0.5 Template DNA (.gtoreq.100 ng/.mu.L) 1 Taq DNA polymerase (5 U/mL) 0.5 Distilled water 41.5
TABLE-US-00015 TABLE PCR program for the amplification of formate dehydrogenase from Mycobacterium vaccae Cycle Segment number Denaturation Annealing Elongation 1 1 94.degree. C., 2 min 2 5 94.degree. C., 30 s 55.6.degree. C., 30 s 72.degree. C., 75 s 3 25 94.degree. C., 30 s 58.6.degree. C., 30 s 72.degree. C., 75 s 4 1 72.degree. C., 75 s
[0386] 4.1.2 Restriction digestion of pET21a(+) and FDH PCR Product
[0387] 5 .mu.l 10.times. NEBuffer EcoRI, 2.5 .mu.l Ndel (20 U/mL) and 2.5 .mu.l EcoRI (20 U/mL) (in each case New England Biolabs, Frankfurt) were added to 1-5 .mu.g of DNA (pET21a(+) or FDH PCR product) dissolved in water, and made up to 50 .mu.l total volume with distilled water. The preparations were in each case incubated for 1 h at 37.degree. C. Then the cut DNA fragments were applied to 1% agarose gel (1% (w/v) agarose, 0.05% (v/v) ethidium bromide) and the DNA fragments were separated electrophoretically for 55 minutes at 120 V. Then the bands of the correct size (1.2 kb for the FDH-gene, 5.4 kb for the pET21a(+)-plasmid) were cut out of the agarose gel with a scalpel and were isolated using the QIAquick Gel Extraction Kit (QIAGEN, Hilden) according to the manufacturer's protocol
[0388] 4.1.3 Ligation of Cut pET21a(+) and FDH
[0389] 1 .mu.l T4 ligase (3 U/.mu.L) and 1 .mu.l 10.times. ligase buffer (in each case New England Biolabs, Frankfurt) were added to 100 ng of cut vector DNA and 111 ng of cut FDH DNA and made up to a total volume of 10 .mu.l with distilled water. The ligation preparation was incubated overnight at 4.degree. C.
[0390] 4.1.4 Transformation of the Ligation Preparation into Chemically Competent E. Coli DH5.alpha.
[0391] At the end of the ligation step, the 10 .mu.L ligation preparation is added to 200 .mu.l of chemically competent E. coli DH5.alpha. prepared according to the standard protocol. Next there is a 30-min incubation step on ice, followed by heat shock at 42.degree. C. (90 seconds). Then 600 .mu.l of sterile LB medium is added to the transformation preparation and the cells are incubated at 200 rpm and 37.degree. C. in a shaking incubator for 45 minutes. In the next step, the preparation is centrifuged at 3000 rpm for 60 seconds in a benchtop centrifuge, 700 .mu.l of the supernatant is discarded, the cells are resuspended in the remaining supernatant and plated out on an LB-agar plate with 100 mg/l ampicillin. The agar plate is then incubated overnight at 37.degree. C.
[0392] 4.2. Production of pET21a(+) FDH D221G
[0393] The production of an FDH mutant, which can regenerate not only NADH, but also NADHP, will be explained in more detail with the mutant D221G.
[0394] Aspartate (D) 221 is an amino acid with a negatively-charged large side chain, which is located directly next to the arginine (R) residue, by which NADP.sup.+ is to be bound. This can lead to repulsion of the phosphate group in the NADP.sup.+, which is also negatively charged. The aspartate is therefore replaced with the small uncharged amino acid residue glycine (G).
[0395] 4.2.1 Primers Used
TABLE-US-00016
[0395] mt1: (SEQ ID NO: 30) 5'- C CTG CAC TAC ACC GGC CGT CAC CGC CTG C-3' NI_fdh_R: (SEQ ID NO: 31) 5' -GCTCGAATTCTCAGACCGCCTTC--3'
[0396] 4.2.2 Procedure
[0397] First a set of two complementary megaprimers was produced using the mt-primer and the primer NI_fdh_R.
[0398] Plasmid pET21a(+)FDH was used as template. The PCR program used is shown in the following table:
TABLE-US-00017 TABLE Megaprimer PCR program Segment Cycle number Denaturation Annealing Elongation 1 1 94.degree. C., 2 min 2 30 94.degree. C., 30 s 60.degree. C., 30 s 72.degree. C., 40 s 3 1 72.degree. C., 5 min
[0399] By combining primer mt1 with the primer NI_fdh_R, the length of the megaprimer becomes 650 bp. With this PCR product of the first PCR, gel electrophoresis and isolation of the desired band from the gel are carried out. A second PCR is carried out as whole plasmid PCR with the megaprimers as primers and the plasmid DNA (pETfdh) as template. The reaction mixture and the temperature scheme for the whole plasmid PCR are shown in the following tables. The 2.times. EZClone enzyme mix, the EZClone solution 1, the 1.1 kb marker and the Dpnl were obtained from the GeneMorph II EZClone Domain Mutagenesis Kit (Stratagene).
TABLE-US-00018 TABLE Preparation for a MEGA WHOP PCR (total volume 50 .mu.L) Component Megaprimer 250 ng (~2.5 .mu.L from a standard-PCR) Template (pETfdh) 50 ng 2.times. EZClone enzyme mix 25 .mu.L EZClone solution 1 3 .mu.L distilled water to 50 .mu.L
[0400] The first step in the PCR program (68.degree. C., 5 min) is for removing the bases appended nonspecifically by the Taq-polymerase by the 3'->5' exonuclease activity of the polymerase used in the MEGA WHOP PCR.
TABLE-US-00019 TABLE MEGA WHOP PCR program Segment Cycle number Denaturation Annealing Elongation 1 1 68.degree. C., 5 min 2 1 95.degree. C., 1 min 3 25 95.degree. C., 50 s 60.degree. C., 50 s 68.degree. C., 13 min
[0401] The PCR product is a double-stranded plasmid with single-strand breaks, which are only closed in E. coli. 10 U Dpnl were added to the 50 .mu.L PCR product and the preparation was incubated at 37.degree. C. for two hours. Dpnl only degrades methylated DNA, i.e. the template DNA used, but not the megaprimer or the synthesized plasmid. The template plasmid must be produced with a dam.sup.+ strain (such as DH10B or JM109), to obtain methylated starting DNA.
[0402] 4.3 Expression and Isolation of the Mutant D221G
[0403] First an LB preculture was inoculated from frozen stored material or with a colony from an agar plate and the preculture was incubated overnight. Incubation was carried out at 37.degree. C. and 250 rpm. The OD of the preculture was determined and the culture was inoculated to an OD of 0.1. On reaching an OD of 0.5-1 (after about 2.5 h), it was induced with IPTG (final concentration 1 mM). The cells were harvested three hours after induction.
[0404] The cells were disrupted mechanically with glass beads. For this, 0.5 mL of glass beads were added to 0.5 mL of cell sample in a 1.5-mL reaction vessel and the reaction vessel was shaken for 3 min at maximum frequency (30 s.sup.-1) in a Retsch vibratory mill. After cell maceration, the glass beads were centrifuged off (2 min, 13000 rpm). Before and after maceration, the culture was put on ice, to minimize protein denaturation through heating of the sample in the vibratory mill. This maceration protocol is optimized for the use of samples frozen at -20.degree. C.
[0405] 4.4 Characterization of the Mutant D221G
[0406] Summary of kinetic constants of FDH at pH 6, 7 and 8.
TABLE-US-00020 Specific K.sub.M K.sub.M activity (mM) (mM) Enzyme pH Substrate Cofactor (U .times. mg.sup.-1) substrate cofactor FDH 6 Sodium formate NAD.sup.+ 4.6 46.86 0.83 6 Sodium formate NADP.sup.+ 1 0.3 7 Sodium formate NAD.sup.+ 5.1 45.56 0.61 7 Sodium formate NADP.sup.+ 1.2 0.51 8 Sodium formate NAD.sup.+ 4.7 59.26 0.52 8 Sodium formate NADP.sup.+ 1 1.01
[0407] The data prove that the mutant produced can utilize both NAD.sup.+ and NADP.sup.+ as cofactor.
Production Example 5
Production of an E. Coil 7.alpha.-HSDH Knockout Mutant (E. Coil BL21 (DE3) HdhA.sup.-KanR.sup.+)
[0408] The target is deletion of the disturbing 7.alpha.-HSDH activity in the expression strain E. coli BL21 (DE3).
[0409] With the method described below, an antibiotic resistance gene is inserted in the target gene of 7.alpha.-HSDH, so that the target gene is switched off.
[0410] 5.1 Sequence Information for 7.alpha.-HSDH from E. Coil BL21(DE3)
[0411] Amino acid sequence: (SEQ ID NO:26)
[0412] Nucleotide sequence (SEQ ID NO:25)
[0413] Accession: NC_012971 REGION: 1642470..1643237
[0414] 5.2 Primers Used
[0415] The following primers were prepared for switching off the 7.alpha.-HSDH from E. coli BL21(DE3):
TABLE-US-00021 Primer for the retargeting of the LI.LtrB intron: 467|468a-IBS (SEQ ID NO: 27) AAAAAAGCTTATAATTATCCTTATAGGACGTCATGGTGCGCCCAGATAGG GTG 467|468a-EBS1d (SEQ ID NO: 28) CAGATTGTACAAATGTGGTGATAACAGATAAGTCGTCATGTTTAACTTAC CTTTCTTTGT 467|468a-EBS2 (SEQ ID NO: 29) TGAACGCAAGTTTCTAATTTCGGTTTCCTATCGATAGAGGAAAGTGTCT Insertion Location 467|468a GCAGCTTTAGATGATGCATAGGAAGTCATG - intron - TTTATATTTTTATTT
[0416] 5.3 Preparation of the Knockout Mutant
[0417] The knockout mutant was prepared using the kit TargeTron.TM. Gene Knockout System from Sigma Aldrich according to the manufacturer's instructions. The QIAquick PCR Purification Kit from Qiagen was used for purifying the PCR product according to step B.6. of the
[0418] TargeTron.TM. Gene Knockout System.
[0419] Ligation of the HindIII/BsrGI-digested intron PCR product into the linearized pACD4K-C vector was carried out as follows: the reaction was carried out overnight at 16.degree. C.
20.mu.l preparation:
TABLE-US-00022 2 .mu.l pACD4K-C linear vector (40 ng) 6 .mu.l HindIII/BsrGI-digested intron PCR product 2 .mu.l ATP (10 mM) 2 .mu.l ligase buffer (10.times.) (Fermentas) 2 .mu.l T4-ligase (Fermentas) 6 .mu.l H.sub.2O
[0420] 5 .mu.l of ligation reaction solution was added to 200 .mu.l of chemically-competent cells of E. coli BL21 (DE3) and incubated on ice for 20 min. Further transformation was carried out as described by the manufacturer.
[0421] The transformation preparations were plated out on LB-agar plates, containing 33 .mu.g/mL kanamycin. Kanamycin-resistant cells were picked and these were in each case inoculated over several nights in 5 ml LB overnight cultures (in each case with 5 .mu.l of a kanamycin solution (33 mg/mI)). Finally a 200 ml LB culture (with 200 .mu.l kanamycin solution (33 mg/mL)) was inoculated with an overnight culture and was incubated for 5 h at 37.degree. C. and 180 rpm in a shaking incubator. Then the temperature was raised to 42.degree. C. for 1 hour. This culture was used for inoculating a 5 mL LB overnight culture (in each case with 5 .mu.l of a kanamycin solution (33 mg/mL)). After incubation overnight at 37.degree. C. and 180 rpm, the culture was streaked on an LB-agar plate with 33 .mu.g/mL kanamycin. After overnight incubation at 37.degree. C., colonies were picked and streaked on LB-agar plate with 33 .mu.g/mL kanamycin and 34 .mu.g/mL chloramphenicol.
[0422] After overnight incubation at 37.degree. C., chloramphenicol-sensitive mutants were found. This is necessary in order to confirm the loss of the plasmid that is carried by the inducible knockout system and is no longer required after successful knockout.
[0423] 5.4. Detection of the Knockout
[0424] The 7.alpha.-HSDH gene was amplified by colony PCR with the primers 7alpha-ko-check_fwd (5'-TTAATTGAGCTCCTGTACCCCACCACC -3') SEQ ID NO:32 and 7alpha-ko-check_rev (5'-GTGTTTAATTCTGACAACCTGAGACTCGAC-3') SEQ ID NO:33. The resultant fragment had a length of approx. 2.5-3 kb and was sequenced with the primer 7alpha-ko-check_fwd. The sequencing showed that the DNA sequence of 7.alpha.-HSDH is interrupted by an insert from the pACD4K vector, resulting in knockout of 7.alpha.-HSDH (sequencing data not shown).
Reaction Example 1
Enzymatic Conversion of 7-Keto-LCA by 7.beta.-HSDH
[0425] For verification of the biochemical function of 7.beta.-HSDH, conversion of 7-keto-LCA by 7.beta.-HSDH was carried out. The 20 ml reaction mixture contains 50 mM 7-keto-LCA (approx. 0.4 g), 5 U/ml 7.beta.-HSDH and 0.05 mM NADP.sup.+. 4 U/ml ADH and 1% isopropanol were used for regeneration of NADPH (see Scheme 1). The reaction was carried out in a fume cupboard at pH8 and 24.degree. C. with stirring. As acetone evaporates more quickly than isopropanol, the reaction is shifted toward formation of UDCA. Further 1% isopropanol was added after 24 h, 48 h and 72 h. The product was analyzed by TLC (silica gel 60, Merck, solvent petroleum ether and ethyl acetate 1:10, vol:vol). In TLC, the product was compared with authentic references 7-keto-LCA, UDCA and CDCA. The TLC analysis shows that UDCA was formed from 7-keto-LCA by the 7.beta.-HSDH. The enantiomer CDCA is not detectable in TLC.
Reaction Example 2
Enzymatic Production of 3,12-Diketo-7.beta.-CA from DHCA by 7.beta.-HSDH
[0426] To verify the usability of 7.beta.-HSDH for preparing 12-keto-UDCA from DHCA, conversion of DHCA by 7.beta.-HSDH was carried out. The 50 ml of reaction mixture contain 50 mM DHCA (1 g), 5 U/ml 7.beta.-HSDH and 0.05 mM NADP.sup.+. 4 U/ml ADH and 1% isopropanol were used for regeneration of NADPH (see Scheme 2). The reaction was carried out in a fume cupboard at pH8 and 24.degree. C. with stirring. As acetone evaporates more quickly than isopropanol, the reaction is shifted toward formation of 3,12-diketo-7.beta.-CA. In order to achieve complete conversion, further 1% isopropanol was added after 24 h, 48 h and 72 h. The intermediate 3,12-diketo-7.beta.-CA was analyzed by TLC. The educt DHCA was no longer detectable in TLC (silica gel 60, Merck; solvent chloroform:methanol:acetic acid 10:1:0.08 vol:vol:vol).
Reaction Example 3
Enzymatic Conversion of 3,12-diketo-7.beta.-CA to 12-Keto-UDCA
[0427] The intermediate 3,12-diketo-7.beta.-CA (produced according to reaction example 2) was transformed further by 3.alpha.-HSDH (SEQ ID NO:5 and 6) from Comamonas testosteroni (Mobus, E. and E. Maser, Molecular Cloning, overexpression, and characterization of steroid-inducible 3alpha-hydroxysteroid dehydrogenase/carbonyl reductase from Comamonas testosteroni. A novel member of the short-chain dehydrogenase/reductase superfamily. J Biol Chem, 1998. 273(47): p. 30888-96) to 12-keto-UDCA. This 3.alpha.-HSDH requires cofactor NADH, which was regenerated by the FDH (see FIG. 3). 4U/ml 3.alpha.-HSDH, 1 U/ml FDH (NADH-dependent, Codexis), 200 mM sodium formate and 0.05 mM NAD.sup.+ were added to the reaction mixture. After 40 h the product was acidified with 2 M HCl to pH2 and extracted with 6.times.10 ml ethyl acetate. After evaporation, 1.07 g of product was obtained. The product 12-keto-UDCA was analyzed and confirmed by TLC and NMR. 3alph.alpha.-HSDH was prepared as for the preparation of 7.beta.-HSDH, but with the plasmid pET22b+, and was used without further purification.
Reaction Example 4
Chemical Reaction of CA to DHCA
[0428] 1320 L of glacial acetic acid is put in a 2000 L stirred vessel and 110 kg (260 mol) of cholic acid (CA) is dissolved therein. 422 L of sodium hypochloride solution (2.3 molar) is added to this solution at 20 to 40.degree. C. and the reaction solution is then stirred for at least a further 1 hour for completion of the reaction. Dehydrocholic acid (DHCA) is isolated by centrifugation at a yield of 100 kg (90%).
Reaction Example 5
Chemical Reaction of 12-Keto-UDCA to UDCA
[0429] 105 g (0.258 mol) of 12-keto-UDCA is dissolved in 384 ml triethylene glycol, 52.2 g (1.304 mol) sodium hydroxide and 75.95 ml (1.563 mol) hydrazine hydrate and heated slowly to 180.degree. C. There is formation of hydrazone, which starting from 160.degree. C. is transformed with splitting off of nitrogen to UDCA. The reaction mixture is held at 180.degree. C. for 8 hours for completing the reaction. The reaction mixture is cooled to below 100.degree. C., and 1500 ml water is added. Then the UDCA is precipitated by acidifying with hydrochloric acid. The product is obtained at a yield of 96.2 g to 99.2 g (up to 95%-98%).
Reaction Example 6
Enzymatic Conversion of DHCA to 12-Keto-UDCA by 7.beta.-HSDH, FHD D221G and 3.alpha.-HSDH
[0430] The purpose of this example is to investigate whether a two-step enzymatic conversion of DHCA to 12-keto-UDCA with simultaneous cofactor regeneration with an FDH mutant used according to the invention is possible. As the FDH mutant D221G used accepts both NADP+and NAD.sup.+ as cofactor, for the NADH-dependent 3.alpha.-HSDH it is not necessary for the reaction mixture to contain any additional cofactor regeneration system.
[0431] Examples of two partial reactions are illustrated graphically below. FDH* designates the mutant FDH D221G.
[0432] For this, the enzymes 7.beta.-HSDH from Collinsella aerofaciens, 3.alpha.-HSDH from Comamonas testosteroni and the FDH mutant D221G derived from FDH from Mycobacterium vaccae were expressed separately from one another in a modified E. coli expression strain and were used for the reaction. The E. coli strain used for expression was modified so that it does not express any 7.alpha.-HSDH enzyme activity. This side activity, widely occurring in E. coli, can lead, in reactions of the present type (stereospecific conversion of the 7-keto group), to undesirable side reactions and therefore to contamination of the reaction product to be produced.
[0433] In the next experiment, the knock-out strain E. coli BL21(DE3).DELTA.7.alpha.-HSDH was used, which is described in the applicant's earlier European patent application EP 10164003.5. Reference is expressly made hereby to the disclosure of this patent application.
[0434] 6.1 Plasmids Used
[0435] Plasmids for the expression of 7.beta.-HSDH, 3.alpha.-HSDH and FHD D221G:
[0436] pET28a(+)-7.beta.-HSDH,
[0437] pET22b(+)-3.alpha.-HSDH and
[0438] pET21a(+)-FDH-D221G.
[0439] 6.2 Bacterial Strains and Culture Conditions:
[0440] The aforementioned knock-out strain E. coli BL21(DE3).DELTA.7.alpha.-HSDH was cultured at 37.degree. C. in LB medium containing the necessary antibiotics. After induction with 0.5 mM IPTG on reaching OD.sub.600=0.8, incubation was continued at 140 rpm for a period of 12 hours at 25.degree. C.
[0441] 6.3 Enzyme Overexpression and Purification
[0442] Overexpression of 7.beta.-HSDH, 3.alpha.-HSDH and the FDH mutant D221G in E. coli BL21(DE3).DELTA.7.alpha.-HSDH and enzyme purification were carried out in the same conditions as described above in production example 2 for the overexpression and purification of 7.beta.-HSDH in E. coli BL21 (DE3). The yields per liter of culture medium (shaken flask at OD.sub.600.about.6) were as follows:
[0443] 7.beta.-HSDH: 3883U (for DHCA and NADPH)
[0444] 3.alpha.-HSDH: 6853 U (for DHCA and NADH)
[0445] FDH mutant: 47 U (for sodium formate and NAD.sup.+).
[0446] Content and purity of the proteins were determined by SDS-PAGE and densitometer scanning using Scion Image Beta 4.0.2 (Scion, USA).
[0447] 6.4 Preparative-Scale Enzymatic Synthesis of 12-Keto-UDCA
[0448] 800 ml of a reaction mixture containing 7.beta.-HSDH (2.4 U.times.ml.sup.-1), 3.alpha.-HSDH (2.4 U.times.ml.sup.-1), FDH D221G (0.325 U.times.ml.sup.-1), NADP.sup.+ (10 .mu.M), NAD.sup.+ (10 .mu.M), sodium formate (250 mM), DHCA (10 mM, 3.2 g) and potassium phosphate buffer (50 mM, pH 6) was stirred at 24.degree. C. All three enzymes that were employed in this experiment were used as cell raw extracts without an additional purification step. After 12 hours the reaction was stopped by removing the enzymes by ultrafiltration using a membrane with a pore size of 10 kDa (Millipore, USA). The product in the filtrate was purified by acidifying with hydrochloric acid to pH 2 followed by paper filtration. After drying the product at 60.degree. C. overnight, 2.9 g of the desired product was obtained.
[0449] The product was analyzed by HPLC and NMR.
[0450] Analysis data (partial):
[0451] .sup.1H NMR (deuterated DMSO, 500 MHz) .delta.=3.92 (2H, m, H-3.alpha. and H-7.beta.) and
[0452] .sup.1H NMR (deuterated DMSO, 125 MHz) .delta.=69.38 (CH, 3-C); .delta.=69.09 (CH, 7-C); .delta.=213.86 (C, 12-C)
[0453] Yield: 90.6%
[0454] Purity: 99%
Reaction Example 7
Whole-Cell Biotransformation of DHCA to 12-Keto-UDCA by Coexpression of FDH D221G, 7.beta.-HSDH and 3.alpha.-HSDH in the Two-Plasmid System
[0455] The aim was to investigate whether a two-step whole-cell reduction of dehydrocholic acid (DHCA) to 12-keto-ursodeoxycholic acid (12-keto-UDCA) (cf. scheme according to reaction example 6, above) is possible.
[0456] For this, the knockout strain E. coli BL21 (DE3) hdhA.sup.- KanR.sup.+ pET21a(+) FDH 7.beta.-HSDH pCOLA(mod) 3.alpha.-HSDH prepared above was used, in which, in addition to the 7.beta.-HSDH and the mutant FDH D221G, a 3.alpha.-HSDH from Comamonas testosteroni is expressed recombinantly. As the FDH mutant used accepts both NADP.sup.+ and NAD.sup.+ as cofactor, for the NADH-dependent 3.alpha.-HSDH it was not necessary to insert any additional cofactor regeneration system into the biotransformation strain.
[0457] 7.1 Strain Used:
[0458] Escherichia coli BL21 (DE3) hdhA.sup.- KanR.sup.+
[0459] 7.2 Molecular Biology Procedures Used
[0460] 7.2.1 Polymerase Chain Reaction
[0461] The polymerase chain reaction (PCR) was used for cloning the 7.beta.-HSDH. The plasmid pET22b(+) 7.beta.-HSDH served as template for amplification of the 7.beta.-HSDH.
[0462] PCR reactions were carried out in 500 .mu.L PCR tubes with 20 .mu.L reaction volume. The reactions were carried out in a Thermocycler from the company Eppendorf. For amplification of 7.beta.-HSDH, in each case 4 .mu.L HF-buffer, 1 .mu.L template DNA, 1 .mu.L each of forward and reverse primer (10 .mu.M), 0.4 .mu.L of deoxynucleotide triphosphate solution (10 mM) and 0.2 .mu.L of Phusion DNA polymerase (2 U/.mu.L) were added. The volume of the preparation was adjusted to 20 .mu.L with RNase-free water.
[0463] For the reaction, first a 2-min initial denaturation step was carried out at 98.degree. C. Then 34 cycles of denaturation (30 s at 98.degree. C.), primer hybridization (2 min at 48.degree. C.) and elongation (2 min at 72.degree. C.) were carried out. As a last step, final elongation of 10 min was carried out at 72.degree. C. before stopping the polymerase chain reaction by cooling to 4.degree. C.
[0464] 7.2.2 Purification of DNA Fragments by Gel Extraction
[0465] For purification of DNA fragments, first they were separated by agarose gel electrophoresis. The corresponding bands were made visible with UV light, identified based on their size and cut out of the gel with a scalpel. Extraction was carried out with the QlAquick Gel Extraction Kit according to the manufacturer's protocol. 30-50 .mu.L H.sub.2O was used for elution of the purified DNA.
[0466] 7.2.3 Restriction with Endonucleases
[0467] The restriction reactions were carried out in a total volume of 20-50 .mu.L. For this, 10-20 U of the respective restriction enzymes was added to the DNA to be cut. In addition, the reaction buffer recommended by the manufacturer was used and optionally 0.5 .mu.L of bovine serum albumin (BSA, 10 mg/mL) was added, based on the manufacturer's recommendation.
[0468] Restriction digestion was carried out for 2 h at 37.degree. C. Then the restricted fragments were purified either by gel extraction (vector digestion products) or using the QIAquick PCR Purification Kit (digested PCR products).
[0469] 7.2.4 Purification of DNA Fragments using the QIAquick PCR Purification Kit
[0470] In order to purify restricted PCR fragments, DNA was purified using the QIAquick PCR Purification Kit. Purification was carried out according to the manufacturer's instructions, using 30-50 .mu.L H.sub.2O for elution of the purified DNA.
[0471] 7.2.5 Ligation of DNA Fragments
[0472] For cloning restricted DNA fragments into expression vectors, both DNA molecules were cut with the same restriction enzymes. By using two different enzymes, on the one hand religation of the vector can be prevented, and on the other hand the insert can be incorporated in a defined orientation. The enzyme used was T4-DNA-ligase, which catalyzes the formation of a phosphodiester bond between a free 5'-phosphate group and a free 3'-OH end of a deoxyribonucleic acid.
[0473] For cloning the expression constructs, in each case 4 .mu.L of a gene-coding, purified DNA fragment with restricted ends was added to 12 .mu.L of a restricted, purified vector. Then 2 .mu.L 10.times. ligase buffer, 1 .mu.L adenosine triphosphate (ATP, 1 mM) and 1 .mu.L T4-DNA-ligase (400 U/.mu.L) were added. The reactions continued overnight at 16.degree. C.
[0474] 7.3 Vector Constructs Used
[0475] 7.3.1 pET21a(+) FDH 7.beta.-HSDH
[0476] For this vector construct, 7.beta.-HSDH was cloned into pET21a(+) FDH, so that the 7beta-HSDH coding gene is located downstream of the FDH. For this purpose, a stop codon had to be inserted in the FDH at the 5'-end. Compared with the original sequence (Lys-Lys-Ala-Val-stop), in this construct the C-terminal valine residue was replaced with an alanine residue and a further three amino acids were appended, resulting in the following C-terminal sequence: Lys-Lys-Ala-Ala-Gly-Asn-Ser-stop. Moreover, for increased translation, an additional ribosomal binding site was inserted in 7.beta.-HSDH between FDH and 7beta-HSDH.
[0477] The primers 7beta_fwd_EcoRI and S_7beta_rev_HindIII were used for PCR amplification of 7.beta.-HSDH.
TABLE-US-00023 7beta_fwd_EcoRI (SEQ ID NO:13): 5'-GCGAATTCGTGAAAGGAGATATACATGAACCTGAGGGAGAAGTACG G-3' S 7beta_rev_HindIII (SEQ ID NO: 3): 5'-CCCAAGCTTCTAGTCGCGGTAGAACGA-3'
The hybridizing sequence regions (bold), restriction sites (bold underlined), ribosomal binding sites (underlined), and filling nucleotides (italics) are shown. In the primer 7beta_fwd_EcoRI, additionally a stop codon (double underlined) and a nucleotide for reading frame shift (bold) were added.
[0478] Cloning was carried out via the EcoRI and HindIII cleavage sites.
[0479] 7.3.2 pCOLA(Mod) 3.alpha.-HSDH
[0480] In order to be able to reduce dehydrocholic acid in two steps to 12-keto-ursodeoxycholic acid, in addition to the cofactor regeneration system FDH, the enzymes 7.beta.-HSDH and 3.alpha.-HSDH must also be present in a cell. To make this possible, the vector construct pCOLA(mod) 3.alpha.-HSDH, a modified derivative of the pCOLA-duet vector, was prepared, which is cotransformable with pET-vectors.
[0481] For this purpose, the 3.alpha.-HSDH coding gene was cut out via the Ndel and Blpl cleavage sites from the vector pET22b(+) 3.alpha.-HSDH and, via the same cleavage sites, cloned into MCS2 of the pCOLA(mod) vector. After sequencing, it was found that at position 45 of the DNA sequence, a guanine was replaced with a cytosine, but this results in a silent mutation. However, this mutation has no effect on the amino acid sequence; therefore this is a so-called silent mutation.
[0482] Both vectors were cotransformed into the aforementioned strain, as described below. The genes are IPTG-inducible.
[0483] 7.4 Heat-Shock Transformation of E. Coil Cells
[0484] For this purpose, 200 .mu.L of chemically-competent E. coli BL21 (DE3) hdhA.sup.- KanR.sup.+ or DH5.alpha. were thawed and 1 .mu.L DNA was added. These were first incubated on ice for 45 min. Then the cells were submitted to heat shock for 45 s at 42.degree. C. Then 600 .mu.L of LB medium was added to the cells and they were shaken at 37.degree. C. and 200 rpm, so that they could develop the desired antibiotic resistance. Next the cells were centrifuged in a benchtop centrifuge at 3000 rpm for 2 min, after which 150 .mu.L of the supernatant was discarded. The cells were resuspended in the remaining supernatant and plated out on LB-agar plates with the corresponding antibiotic. Then the plates were incubated overnight at 37.degree. C. In the case of cotransformation of two different plasmids, as is necessary for creating the strain that contains the plasmids pCOLA(mod) 3.alpha.-HSDH and pET21a(+) FDH 7.beta.-HSDH, in each case 2 .mu.L of the plasmids to be inserted was added to 50 .mu.L of chemically-competent E. coli BL21 (DE3) hdhA.sup.- KanR.sup.+. After transformation, the cells were added to preculture tubes with 5 mL of LB medium with the corresponding antibiotic and were incubated at 37.degree. C. on the preculture shaker for 16-48 h at 200 rpm, until growth of bacteria in the preculture tube was detected. Next, 5 .mu.L of the bacterial suspension was plated out on LB-agar plates with the corresponding antibiotic and was incubated overnight at 37.degree. C.
[0485] 7.5 Cultivation of the Strain in the Shaken Flask:
[0486] For expression of recombinant proteins, the corresponding E. coli BL21 (DE3) hdhA.sup.- KanR.sup.+ comprising the two expression plasmids was incubated overnight at 37.degree. C. and 200 rpm in 5 mL of LB medium with addition of the corresponding antibiotic. Then 200 mL of TB medium with addition of the corresponding antibiotic was inoculated with this preculture and incubated at 37.degree. C., 250 rpm. On reaching OD600 of 0.6-0.8, expression of the recombinant protein was induced with 1 mM isopropyl-.beta.-D-thiogalactopyranoside (IPTG) and the culture was incubated at 25.degree. C., 160 rpm for a further 21 h.
[0487] 7.6 Carrying Out Whole-Cell Biotransformation and Test Result
[0488] The reactions were carried out in suspension in 2 mL reaction volume at pH 6.0, using a cell density of OD.sub.600=20. 25 mM or 50 mM dehydrocholic acid was selected as the substrate concentration, and the cosubstrate concentration used was 400 mM. The tests were carried out at 25.degree. C. with exclusion of air. Samples were taken after 48 h.
[0489] In the case of the reaction mixture with 25 mM, substrate is no longer detectable, whereas for the reaction mixture with 50 mM dehydrocholic acid, a substrate peak is detectable, but its peak area is below the limit of 1 .mu.g/mL substrate in the sample for which the HPLC method is calibrated. The same applies to the peaks of 3,12-diketo-ursodeoxycholic acid. The largest peak in the chromatograms is that of the product 12-keto-ursodeoxycholic acid.
[0490] Thus, it can be shown, surprisingly, that a two-step whole-cell reduction of dehydrocholic acid to 3-keto-ursodeoxycholic acid is possible.
[0491] The chromatograms of the HPLC measurement are shown in FIG. 7.
[0492] The HPLC analysis was carried out as follows: The chromatography column used was the reverse-phase chromatography column Hi-bar Purospher 125-4 RP-18e (5 .mu.m) from the company Merck, Darmstadt. In this case a nonpolar phase serves as stationary phase, whereas a polar phase forms the mobile phase. The method of gradient elution was used for the HPLC analysis. An increasing proportion of acetonitrile is added to the eluent, phosphoric acid water, (pH 2.6), and the acidification of the solvent causes a uniform degree of protonation of the analytes to be investigated. After elution of all components, the chromatography column is equilibrated with the starting ratio of the two solvents. Gradient elution was carried out by first pumping a solvent mixture with a constant composition of 65% (v/v) of phosphoric acid water and 35% (v/v) of acetonitrile through the HPLC column for 3 min. From minute 3 to 7.5, the proportion of acetonitrile is increased linearly to 39% (v/v). Between minute 7.5 and 10 there is another linear increase of the proportion of acetonitrile to 40% (v/v). For elution of all sample components, the proportion of acetonitrile is increased between minute 10 and 11 also linearly to 70% (v/v) and held constantly at this value for a further two minutes. After that, the proportion of acetonitrile is reduced from minute 13 to 15 back to the initial value of 35% and the column is equilibrated with this solvent composition for 3 min. The flow is set at 1.000 mL/min for the total duration. Eluted analytes are detected by a UV-detector at a wavelength of 200 nm.
Reaction Example 8
Whole-Cell Biotransformation of DHCA to 12-Keto-UDCA by Coexpression of FDH D221G, 7.beta.-HSDH and 3.alpha.-HSDH in the Single-Plasmid System
[0493] The aim was to investigate whether a two-step whole-cell reduction of dehydrocholic acid to 12-keto-ursodeoxycholic acid in a cellular single-plasmid system is possible.
[0494] 8.1 Plasmids Used:
TABLE-US-00024
[0494] SEQ ID Designation Sequence NO 3alpha_fwd_ 5'-CCCAAGCTTAAGGAGATATACATGTCCATCA 16 HindIII TCGTGATAAGCG-3' 3alpha_rev_ 5'-ATAAGAATGCGGCCGCTCAGAACTGTGTCGG 17 NotI GCG-3' 7beta_mut_ 5'-CGTCGTCATGGTCGCCCGTCGCGAGG-3 9 G39A_fwd 7beta_mut_ 5'-CCTCGCGACGGGCGACCATGACGACG-3' 10 G39A_rev
[0495] Restriction sites are underlined; ribosomal binding sites are bold.
[0496] 8.2 Production of the Vector:
[0497] The plasmid construct pET21a(+) FDH 7.beta.-HSDH(G39A) 3.alpha.-HSDH (FIG. 8) is prepared as follows: Starting from the plasmid pET21a(+) FDH 7.beta.-HSDH the wild-type 3.alpha.-HSDH (C. testosteroni; SEQ ID NO: 5,6) was cloned in after 7.beta.-HSDH via the HindIII and Notl cleavage sites. For amplification of 3.alpha.-HSDH, the primers 3alpha_fwd_HindIII and 3alpha_rev_Notl were used, with the plasmid pET22b(+) 3.alpha.-HSDH serving as template for this. Then the G39A mutation was inserted into 7.beta.-HSDH by site-directed mutagenesis according to the QuikChange protocol. The mutagenesis primers 7beta_mut_G39A_fwd and 7beta_mut_G39A_rev were used.
[0498] 8.3 Reaction:
[0499] The plasmid prepared was transformed into E. coli BL21 (DE3) hdhA.sup.- KanR.sup.+. With the resultant strain E. coli BL21 (DE3) hdhA.sup.- KanR.sup.+ pET21a(+) FDH 7.beta.-HSDH(G39A) 3.alpha.-HSDH, whole-cell reactions were carried out under the following conditions at the 150-mL scale: cell density OD 30, 50 mM DHCA, 750 mM sodium formate, suspended in 50 mM potassium phosphate buffer (pH 6.5) as cell and substrate suspension. The reactions were carried out for 3.5 h at 25.degree. C. The results of the HPLC analysis (for procedure see reaction example 7, above) are shown in FIG. 9.
Production Example 6
Production of Further 7.beta.-HSDS Mutants and Characterization Thereof
[0500] One possibility for generating an NADH-specific 7.beta.-HSDH consists of modifying the available enzyme by various techniques of mutagenesis. Therefore, using site-directed mutagenesis, individual amino acids of 7.beta.-HSDH were to be substituted with others, which cause change of the cofactor specificity of 7.beta.-HSDH from NADPH to NADH, so that advantageously NADP can be replaced with the less expensive NAD.
[0501] 6.1 Primers
[0502] Altogether, the 7.beta.-HSDH mutants G39D, G39D/R40L, G39D/R40I and G39D/R40V were produced. The G39D mutant is produced by Quickchange mutagenesis, and the other mutants are produced by the PCR method of Sanchis et al. (Sanchis J, Fernandez L, Carballeira J D, Drone J, Gumulya Y, Hobenreich H, Kahakeaw D, Kille S, Lohmer R, Peyralans J J, Podtetenieff J, Prasad S, Soni P, Taglieber A, Wu S, Zilly F E, Reetz M T. Improved PCR method for the creation of saturation mutagenesis libraries in directed evolution: application to difficult-to-amplify templates. Appl Microbiol Biotechnol. 2008 Nov; 81(2): 387-97). A sequence comparison of the wild type and of the mutants produced is shown in FIG. 10. The following primers were used for the mutagenesis, with the bases shown in italics coding in each case for the exchanged amino acid:
TABLE-US-00025 G39D 7beta mut G39D fwd (SEQ ID NO: 41): CGTCGTCATGGTCGACCGTCGCGAGG 7beta mut G39D rev (SEQ ID NO: 42): CCTCGCGACGGTCGACCATGACGACG G39D R40L 7beta mut G39D R40L fwd (SEQ ID NO: 43): CGTCGTCATGGTCGACCTGCGCGAGG 3alphamut_AntiMid_rev (SEQ ID NO: 44): CCGCCGCATCCATACCGCCAGTTGTTTACCC G39D R40I 7beta mut G39D R40I fwd (SEQ ID NO: 45): CGTCGTCATGGTCGACATTCGCGAGG 3alphamut_AntiMid_rev (SEQ ID NO: 44): CCGCCGCATCCATACCGCCAGTTGTTTACCC G39D R40V 7beta mut G39D R40V fwd (SEQ ID NO: 46): CGTCGTCATGGTCGACGTTCGCGAGG 3alphamut_AntiMid_rev (SEQ ID NO: 44): CCGCCGCATCCATACCGCCAGTTGTTTACCC
[0503] 6.2 Enzyme-Kinetic Investigation of the 7.beta.-HSDH Mutants
[0504] The mutants prepared are evaluated by means of enzyme-kinetic investigations, the results of which are shown as graphs in FIG. 11. 0.1 mM NADPH is used as cofactor for investigating the unmodified 7.beta.-HSDH, but 0.5 mM NADH is used for investigating the 7.beta.-HSDH mutants. The need to increase the cofactor concentration in the enzyme-kinetic investigation of the 7.beta.-HSDH mutants is due to the increased semisaturation concentrations for the cofactor NADH in the mutants. From the plots of substrate concentration versus specific enzyme activity, the characteristic curves of Michaelis-Menten kinetics can be seen for the 7.beta.-HSDH mutants, whereas the curve of Michaelis-Menten kinetics with substrate inhibition can be seen from the plot for the unmodified wild-type 7.beta.-HSDH. Accordingly, the classical Michaelis-Menten model (equation 1) was used for evaluating the measurement series of the 7.beta.-HSDH mutants and the Michaelis-Menten model with substrate inhibition was used for the measurement series of the unmodified wild-type 7.beta.-HSDH (equation 2).
Equation 1 (Michaelis-Menten Equation)
[0505] EA X = v max c s K m + c s ##EQU00002##
[0506] EA.sub.x: specific enzyme activity, U mg.sup.-1=.mu.mol min.sup.-1 mg.sup.-1
[0507] v.sub.max: maximum specific enzyme activity, U mg.sup.-1=.mu.mol min.sup.-1 mg.sup.-1
[0508] c.sub.s: substrate or cofactor concentration, mol L.sup.-1
[0509] K.sub.m: semisaturation concentration, mol L.sup.-1 Equation 2 (Michaelis-Menten Equation with Substrate Inhibition)
[0509] EA X = v max c s K m + ( 1 + c s K i ) .times. c s ##EQU00003##
[0510] EA.sub.x: specific enzyme activity, U mg.sup.-1=.mu.mol min.sup.-1 mg.sup.-1
[0511] v.sub.max: maximum specific enzyme activity, U mg.sup.-1=.mu.mol min.sup.-1 mg.sup.-1
[0512] c.sub.s: substrate or cofactor concentration, mol L.sup.-1
[0513] K.sub.m: semisaturation concentration, mol L.sup.-1
[0514] K.sub.i: inhibition constant, mol L.sup.-1
[0515] The following table gives enzyme-kinetic parameters of the unmodified wild-type 7.beta.-HSDH and the mutants thereof with altered cofactor specificity. NADPH is used as cofactor for the wild type, whereas NADH is used as cofactor for the mutants.
TABLE-US-00026 K.sub.m, K.sub.i, v.sub.max, DHCA, .mu.M DHCA, .mu.M U mg - 1 Wild type 31 .+-. 5 8600 .+-. 1500 14.6 .+-. 1.0 G39D 660 .+-. 120 n.d. 2.90 .+-. 0.16 G39D R40I 920 .+-. 170 n.d. 4.64 .+-. 0.27 G39D R40V 880 .+-. 20 n.d. 2.69 .+-. 0.12 G39D R40L 560 .+-. 80 n.d. 1.60 .+-. 0.07
Production Example 7
Production of Further 7.beta.-HSDS Mutants and Characterization Thereof
[0516] Further 7.beta.-HSDS mutants were produced in a preparation parallel to production example 6.
[0517] 7.1 Primers
[0518] The mutagenesis primers shown below were used for the site-directed mutagenesis of 7.beta.-HSDH. The primers were selected on the basis of the 7.beta.-HSDH gene sequence, so that they bring about the desired amino acid exchange. It was noted that the base to be mutated is localized centrally in the primer, and that the melting points of the primer pairs are located in the same region.
[0519] The following primer pairs were used for preparing the mutants:
TABLE-US-00027 TABLE Primers used for the site-directed mutagenesis of 7.beta.-HSDH Designation Position Primer 5' .fwdarw. 3' Sequence G39D_for G39D forward GTCGTCATGGTCGACCGTCGCGAGGAG G39D_rev reverse CTCCTCGCGACGGTCGACCATGACGAC G39D/R40I_for G39D/R40I forward GTCATGGTCGACATTCGCGAGGAG G39D/R40I_rev reverse CTCCTCGCGAATGTCGACCATGAC R40D_for R40I forward GTCATGGTCGGCGATCGCGAGGAGAAG R40D_ rev reverse CTTCTCCTCGCGATCGCCGACCATGAC R40D/R41I_for R40D/R41I forward GTCATGGTCGGCGATATCGAGGAGAAGCTG R40D/R41I_rev reverse CAGCTTCTCCTCGATATCGCCGACCATGAC DIN_for G39D/R40I/R41N forward ATGGTCGACATTAACGAGGAGAAGCTG DIN_rev reverse CAGCTTCTCCTCGTTAATGTCGACCAT
[0520] 7.2 PCR Program
[0521] In the reaction, first there was a 2-min initial denaturation step at 98.degree. C. This was followed by 23 cycles of denaturation (30 s at 98.degree. C.), primer hybridization (1 min at 60-68.degree. C.) and elongation (3.5 min at 72.degree. C.). As the last step, a final elongation was carried out for 10 min at 72.degree. C. before the polymerase chain reaction was stopped by cooling to 4.degree. C.
[0522] 7.3 PCR Assay
TABLE-US-00028
[0522] TABLE PCR assay for the production of the different 7.beta.-HSDH variants HF buffer (5.times.) 10 .mu.l dNTP mix (10 mM) 1.0 .mu.l Forward primer (10 pmol/.mu.l) 5 .mu.l Reverse primer (10 pmol/.mu.l) 5 .mu.l Template 1.5 .mu.l Phusion polymerase 0.5 .mu.l DMSO 2.5 .mu.l ddH.sub.2O 24.5 .mu.l 50 .mu.l
[0523] A pET21a vector with the 7.beta.-HSDH (wild type) was used as template.
[0524] 7.4 Procedure
[0525] For targeted exchange of amino acids in protein sequences, the DNA sequence of the corresponding gene is submitted to site-directed mutation. For this, mutually complementary primers are used, which carry the desired mutation in their sequence. N6-adenine-methylated, double-stranded plasmid DNA, which carries the gene to be mutated, serves as template. N6-adenine-methylated plasmid DNA is isolated from dam.sup.+ E. coli strain, for example E. coli DH5.
[0526] The polymerase chain reaction is carried out as described above. The primers are lengthened complementarily to the template, so that plasmids with the desired mutation are formed, which have a strand break. In contrast to other PCR reactions, the increase in DNA yield is in this case only linear, as newly formed DNA molecules cannot serve as template for the PCR reaction.
[0527] On completion of the PCR reaction, the PCR product was purified using a PCR-Purification-Kit (Analytik Jena) and the parental, N6-adenine-methylated DNA was digested with the restriction enzyme Dpnl. This enzyme has the particular characteristic that it restricts N6-adenine-methylated DNA nonspecifically, but not the newly formed, nonmethylated DNA. Restriction was carried out by adding 1 .mu.L Dpnl to the PCR reaction mixture and incubating for 2 h or overnight at 37.degree. C.
[0528] 5 .mu.l of this preparation were used for the transformation of 100 .mu.l of chemically-competent DH5.alpha. cells. After plasmid isolation, successful mutation was confirmed by sequencing.
[0529] 7.5 Characterization The mutation was introduced into 7.beta.-HSDH by site-directed mutagenesis according to the QuikChange protocol. The mutagenesis primers from the table shown in Section 7.1 were used.
[0530] Using the assays given in the "Methods" section for photometric measurement of activity, the activity of the mutated enzymes was measured in the presence of NADPH or NADH. The activities found are presented in the following table.
TABLE-US-00029 TABLE Activity found for the different 7.beta.-HSDH variants Volumetric activity Specific activity Mutants [U/ml] [U/mg] produced NADPH NADH NADPH NADH G39D 119 2 5.1 0.1 G39D/R40I 0 21 0 0.8 R40D 0 3 0 0.1 R40D/R41I 0 3 0 0.2 G39D/R40I/R41N 0 6 0 0.3 7.beta.-HSDH (WT) 134 0 5.6 0
Reaction Example 9
Using NADH-Dependent 7.beta.-HSDH in the Whole-Cell Reduction of Dehydrocholic Acid to 3,12-Diketo-UDCA
[0531] The use of NADH-dependent 7.beta.-HSDH, produced in production example 6, in the whole-cell biocatalytic conversion of DHCA to 3,12-diketo-UDCA is demonstrated below. To improve comprehension, a review of possible reaction pathways and reaction products is shown in FIG. 12.
[0532] In the present case, the 7.beta.-HSDH mutants together with an NADH-dependent formate dehydrogenase from Mycobacterium vaccae were inserted in an expression vector. The vector into which 7.beta.-HSDH (G39D) is inserted bears the designation pFr7(D), corresponding to SEQ ID NO:49; the vector into which 7.beta.-HSDH (G39D R40L) is inserted bears the designation pFr7(DL), corresponding to SEQ ID NO:50; the vector into which 7.beta.-HSDH (G39D R40I) is inserted bears the designation pFr7(DI), corresponding to SEQ ID NO:51, and the vector into which 7.beta.-HSDH (G39D R40V) is inserted bears the designation pFr7(DV), corresponding to SEQ ID NO:52. A general plasmid map of these vectors is shown in FIG. 13.
[0533] These vectors were transformed into the strain E. coli BL49 (identical to E. coli BL21(DE3) hdhA.sup.- KanR.sup.+). From these strains, firstly 5 mL overnight cultures were grown in LB medium with 100 mg L.sup.-1 ampicillin. In each case 1 mL of these overnight cultures was transferred on the next day into 200 mL of TB medium in shaken flasks with 100 mg L.sup.-1 ampicillin. These cultures were cultured at 37.degree. C. and 250 rpm in the shaking incubator, until an OD of 0.6-0.8 was reached. Then induction was carried out with 1 mM isopropyl-.beta.-D-thiogalactopyranoside (IPTG). The subsequent expression phase was carried out for 21 h at 25.degree. C. and 160 rpm. The cells were harvested by 10-minute centrifugation at 3220 g.
[0534] Whole-cell biotransformation reactions were set up with the cells produced in this way. The concentrations of the substrate DHCA and of the product 3,12-diketo-UDCA in the reaction mixture at various time points was determined by high-performance liquid chromatography (H PLC).
[0535] The reaction mixtures for the biotransformations contained 17.7 g L.sup.-1.sub.BTM whole-cell biocatalysts, 100 mM substrate (DHCA), 500 mM sodium formate and are suspended in 50 mM potassium formate buffer (pH 6.5). The process took place at the 20 mL scale as a batch process without pH monitoring. The concentrations of product and substrate after 24 h are shown in FIG. 14. It can be seen that all mutants are suitable for the whole-cell biocatalytic conversion of DHCA to 3,12-diketo-UDCA.
Reaction Example 10
Using NADH-Dependent 7.beta.-HSDH in the Two-Step Whole-Cell Reduction of Dehydrocholic Acid to 12-Keto-UDCA
[0536] The use of NADH-dependent 7.beta.-HSDH in the two-step whole-cell biocatalytic conversion of DHCA to 12-diketo-UDCA is to be demonstrated below. The mutants 7.beta.-HSDH (G39D) together with an NADH-dependent formate dehydrogenase from Mycobacterium vaccae and an NADH-dependent 3.alpha.-HSDH from Comamonas testosteroni were inserted into an expression vector. The use of 7.beta.-HSDH (G39D) is shown as an example for all NADH-dependent 7.beta.-HSDHs. The vector bears the designation pFr3T7(D) and is shown schematically in FIG. 15.
[0537] These vectors were transformed into the strain E. coli BL49 (identical to E. coli BL21(DE3) hdhA.sup.- KanR.sup.+); the resultant strain bears the designation E. coli BL49 pFr3T7(D). This strain was cultured in the 7 L bioreactor at a working volume of 4 L in the defined minimal medium. A brief initial phase at 37.degree. C. was followed by a substrate-limited exponential growth phase at 30.degree. C. On reaching an optical density of 25-30, protein expression of the cells was induced by adding 0.5 mM IPTG. Expression was then carried out for 24 h at 20.degree. C. The cells (32.0 g L.sup.-1.sub.BTM) were harvested by centrifugation, resuspended in potassium phosphate buffer (pH 6.5) and stored according to the standard protocol at -20.degree. C.
[0538] Biotransformation was set up at the 20-mL scale in the following reaction conditions: 100 mM DHCA, 17.7 g L.sup.-1.sub.BTM of the stored biocatalyst, 500 mM ammonium formate, 26% glycerol, 50 mM MgCl.sub.2, suspended in 50 mM KPi buffer (pH 6.5). Using manual pH adjustment, the pH was maintained during the first 5 hours of the biotransformation process at pH 6.5. The bile salt concentrations are shown as a function of time in FIG. 16. After 24 h, 92% of the product 12-keto-UDCA had formed. The conversion of DHCA to 3,12-diketo-UDCA and the conversion of 7,12-diketo-UDCA to 12-keto-UDCA show that all the reactions of 7.beta.-HSDH shown in FIG. 12 are in fact catalyzed by 7.beta.-HSDH (G39D).
Reaction Example 11
Two-Step Reduction of Dehydrocholic Acid in a Single-Cell System
[0539] One route for the synthesis of ursodesoxycholic acid comprises the chemical oxidation of cholic acid to dehydrocholic acid with subsequent asymmetric enzymatic reductions of the 3-carbonyl group to the 3.alpha.-hydroxyl group and of the 7-carbonyl group to the 7.beta.-hydroxyl group followed by chemical removal of the 12-carbonyl group.
[0540] For this synthesis route, the enzymes 7.beta.-hydroxysteroid dehydrogenase (7.beta.-HSDH) and 3.alpha.-hydroxysteroid dehydrogenase (3.alpha.-HSDH) are required for catalysis of the enzymatic reduction reactions. In the reaction, in addition cofactors (NADH or NADPH) are consumed stoichiometrically, and in an economic process these must be regenerated. Enzymatic regeneration possibilities are often preferred for this. Suitable enzymes include formate dehydrogenases (FDH), glucose dehydrogenases (GDH), glucose-6-phosphate dehydrogenases (G6PDH), alcohol dehydrogenases (ADH) or phosphite dehydrogenases (PtDH).
[0541] In contrast to the use of isolated enzymes, in whole-cell biocatalysis, with the necessary enzymes within a host organism, typically a unicellular microorganism, it is not possible to add individual enzymes in individual amounts to the reaction medium. In this case the enzyme activities must be balanced by modifying the expression level of all participating enzymes either by cultivation methods or by genetic modification of the whole-cell biocatalyst.
[0542] In the present example, vectors were used according to the invention, which contain all three genes for 7.beta.-HSDH, 3.alpha.-HSDH and FDH. The vectors are constructed so that the expression level of the three genes in the designated host strain, especially whole-cell biocatalyst strains based on Escherichia coli BL21(DE3), are adapted in such a way that all three enzymes have enzyme activities that are as similar as possible.
[0543] The three genes required in the whole-cell reduction of dehydrocholic acid to 12-keto-ursodeoxycholic acid are located on one and the same vector. These are genes that code for the following enzymes: an NADPH-dependent 7.beta.-HSDH from Collinsella aerofaciens, an NADH-dependent 3.alpha.-HSDH from Comamonas testosteroni, a mutated FDH from Mycobacterium vaccae that is both NAD- and NADP-dependent. The expression levels of these three genes are balanced by the genetic construct, so that optimal whole-cell biocatalysis can be carried out. In the present example the 7.beta.-HSDH mutants G39A and G39S were inserted instead of an unmodified wild-type enzyme into a vector for the whole-cell biocatalysis. The vectors bear the designations pF(G)r7(A)r3 and pF(G)r7(S)r3 and are shown in FIGS. 17a and b. FIG. 18 shows a schematic representation of the possible reaction pathways and reaction products.
[0544] These vectors according to the invention were transformed into Escherichia coli production strains. These strains represent the whole-cell biocatalyst. The host strain used is a modified E. coli BL21(DE3) with the designation E. coli BL49. However, the host organism is not restricted to this host strain. The E. coli BL49 transformed with pF(G)r7(A)r3 bears the designation E. coli BL49 pF(G)r7(A)r3, and the E. coli BL49 transformed with pF(G)r7(S)r3 bears the designation E. coli BL49 pF(G)r7(S)r3.
[0545] 11.1 Two-Step Whole-Cell Reduction of Dehydrocholic Acid at the 20-mL Scale
[0546] The biocatalysts were compared by whole-cell biotransformation at the 20-mL scale. For this, first a 5 mL overnight culture was grown in LB medium with 100 mg L-1 ampicillin. On the next day, 1 mL of this overnight culture was transferred into 200 mL of TB medium in a shaken flask with 100 mg of L-1 ampicillin. These cultures were cultured at 37.degree. C. and 250 rpm in the shaking incubator, until an OD of 0.6-0.8 was reached. Then induction was carried out with 1 mM isopropyl-.beta.-D-thiogalactopyranoside (IPTG). The subsequent expression phase was carried out for 21 h at 25.degree. C. and 160 rpm. The cells were harvested by 10-minute centrifugation at 3220 g.
[0547] Whole-cell biotransformation reactions were set up with the cells produced in this way. The amount of the product (12-keto-UDCA) formed in the reaction mixture was decisive for assessment of the cells. The concentrations of the substrate DHCA, of the intermediates 3,12-diketo-UDCA and 7,12-diketo-UDCA and of the product 12-keto-UDCA in the reaction mixture were determined by high-performance liquid chromatography (HPLC).
[0548] The reaction mixtures for the biotransformations contained 11.8 g L.sup.-1.sub.BTM whole-cell biocatalysts, 100 mM substrate (DHCA), 500 mM sodium formate and were suspended in 50 mM potassium formate buffer (pH 6.5). The process was carried out at the 20 mL scale as a batch process without pH monitoring. The following table gives the results of the whole-cell biotransformation described above after a process time of 5 h. The two new strains E. coli BL49 pF(G)r7(S)r3 and E. coli BL49 pF(G)r7(A)r3 are compared with a reference strain E. coli BL49 pF(G)r7 pC3. With the reference strain E. coli BL49 pF(G)r7 pC3 only 5.7 .+-.1.0% of product (12-keto-UDCA) was formed, whereas with the new biocatalysts 38.4 .+-.8.2% 12-keto-UDCA was formed with the strain E. coli BL49 pF(G)r7(S)r3 and 47.7.+-.2.1% 12-keto-UDCA with the strain E. coli BL49 pF(G)r7(A)r3. Therefore the product concentration in the reaction mixture had increased relative to the reference strain by a factor of 6.7 (E. coli BL49 pF(G)r7(S)r3) and by a factor of 8.4 (E. coli BL49 pF(G)r7(A)r3).
[0549] Accordingly, the following table shows proportions of bile salts in biotransformation batches after 5 h when using 100 mM substrate (DHCA). The batches with the two new biocatalyst strains E. coli BL49 pF(G)r7(A)r3 and E. coli BL49 pF(G)r7(S)r3 are shown in comparison with the strain E. coli BL49 pF(G)r7 pC3 according to the prior art:
TABLE-US-00030 Proportions of bile salts, % 12-keto- 3,12-diketo- 7,12-diketo- UDCA UDCA UDCA DHCA E. coli BL49 5.7 .+-. 1.0% 9.2 .+-. 0.2% 40.5 .+-. 1.9% 44.6 .+-. 3.1% pF(G)r7 pC3 E. coli BL49 47.7 .+-. 2.1% 2.4 .+-. 0.5% 48.9 .+-. 1.6% 1.0 .+-. 0.0% pF(G)r7(A)r3 E. coli BL49 38.4 .+-. 8.2% 2.7 .+-. 2.7% 57.4 .+-. 4.4% 1.5 .+-. 1.8% pF(G)r7(S)r3
[0550] 11.2 Two-Step Whole-Cell Reduction of Dehydrocholic Acid at the 1 L Scale
[0551] Through process control, product formation with the biocatalyst E. coli BL49 pF(G)r7(A)r3 was increased relative to the milliliter scale. For this, the biocatalyst was cultured in the 7 L bioreactor at a working volume of 4 L in the defined minimal medium. After a brief initial phase at 37.degree. C., there was a substrate-limited exponential growth phase at 30.degree. C. On reaching an optical density of 25-30, protein expression of the cells was induced by adding 0.5 mM IPTG. Expression was then carried out for 10 h at 25.degree. C., before the cells were harvested by centrifugation and were stored at -20.degree. C.
[0552] The biotransformation was set up in a 1 L bioreactor in the following reaction conditions: 70 mM DHCA, 17.7 g L.sup.-1.sub.BTM of the stored biocatalyst, 500 mM sodium formate, 26% (v/v) glycerol, 50 mM MgCl.sub.2, suspended in 50 mM KPi buffer (pH 6.5). Using pH adjustment, the pH was maintained at pH 6.5 throughout the biotransformation. The variation of the bile salt concentrations as a function of time is shown in FIG. 19. After 21 h, 99.4% of product (12-keto-UDCA) had formed and only 0.6% of the by-product 3,12-diketo-UDCA was detectable.
Reaction Example 12
Two-Step Reduction of Dehydrocholic Acid in a Single-Cell System using a Glucose Dehydrogenase for Cofactor Regeneration
[0553] In this example, in addition to an NADPH-dependent 7.beta.-HSDH from Collinsella aerofaciens (mutant G39A) and an NADH-dependent 3.alpha.-HSDH from Comamonas testosteroni, a GDH from Bacillus subtilis that is both NAD- and NADP-dependent for the cofactor regeneration is expressed in a whole-cell biocatalyst (single-cell system) for the two-step reduction of DHCA to 12-keto-UDCA. The nucleic acid sequence and the associated amino acid sequence of this GDH are given as SEQ ID NO:47 and SEQ ID NO:48 respectively.
[0554] The vectors used for this bear the designations p3T7(A)rG and p7(A)T3rG and are shown in FIG. 20 and FIG. 21 respectively.
[0555] The vectors according to the invention were transformed into Escherichia coli production strains. These strains represent the whole-cell biocatalyst. The host strain used is a modified E. coli BL21(DE3) with the designation E. coli BL49 (identical to E. coli BL21(DE3) hdhA.sup.- KanR.sup.+). However, the host organism is not restricted to this host strain. The E. coli BL49 transformed with p7(A)T3rG bears the designation E. coli BL49 p7(A)T3rG, and the E. coli BL49 transformed with p3T7(A)rG bears the designation E. coli BL49 p3T7(A)rG.
[0556] With the newly produced biocatalysts, using a total of 17.7 g/L BTM biocatalysts, 100 mM DHCA can be converted to an extent of 98% to 12-keto-UDCA.
[0557] 12.1 Two-Step Whole-Cell Reduction of Dehydrocholic Acid at the 20-mL Scale
[0558] The biocatalysts were compared by whole-cell biotransformation at the 20-mL scale. Cultivation and determination of the concentration of the substrate DHCA, of the intermediates 3,12-diketo-UDCA and 7,12-diketo-UDCA and of the product 12-keto-UDCA in the reaction mixture were carried out as described in reaction example 11.1.
[0559] The reaction mixtures for the biotransformations contained 11.8 g/L BTM whole-cell biocatalysts, 100 mM substrate (DHCA), 500 mM glucose and were suspended in 50 mM potassium formate buffer (pH 7.3). The process took place at the 20 mL scale as a batch process without pH monitoring. Perforation of the biocatalysts was not necessary. The following table shows the results of the whole-cell biotransformation described above after a process time of 24 h, showing the results of the whole-cell biotransformation with the two strains E. coli BL49 p7(A)T3rG and E. coli BL49 p3T7(A)rG. With the new biocatalysts, using 11.8 g L.sup.-1.sub.BTM biocatalyst, within 24 h 100 mM dehydrocholic acid (DHCA) can be converted to an extent of 46% (E. coli BL49 p3T7(A)rG) or 68% (E. coli BL49 p7(A)T3rG) to 12-keto-ursodeoxycholic acid (12-keto-UDCA). The following table shows proportions of bile salts in biotransformation batches after 24 h, using 100 mM substrate (DHCA) (batches with the two new biocatalyst strains E. coli BL49 p3T7(A)rG and E. coli BL49 p7(A)T3rG):
TABLE-US-00031 Proportions of bile salts, % 12-keto- 3,12-diketo- 7,12-diketo- UDCA UDCA UDCA DHCA E. coli BL49 46 .+-. 6% 7 .+-. 1% 7 .+-. 1% 40.0 .+-. 2% p3T7(A)rG E. coli BL49 68 .+-. 19% 15 .+-. 3% 1 .+-. 1% 12 .+-. 10% p7(A)T3rG
[0560] 12.2 Two-Step Whole-Cell Reduction of Dehydrocholic Acid with Cells of the Strain E. coli BL49 p7(A)T3rG Cultured in the Bioreactor at the 20-mL Scale
[0561] The strain E. coli BL49 p7(A)T3rG was cultured in the 7 L bioreactor at a working volume of 4 L in the defined minimal medium. After a brief initial phase at 37.degree. C. there was a substrate-limited exponential growth phase at 30.degree. C. On reaching an optical density of 25-30, protein expression of the cells was induced by adding 0.5 mM IPTG. Expression was then carried out for 24 h at 20.degree. C. The cells (46.7 g/L BTM) were harvested by centrifugation, resuspended in potassium phosphate buffer (pH 6.5) and stored according to the standard protocol at -20.degree. C. At the time of harvesting, the enzyme activities were: 16.4 U/mL 7.beta.-HSDH, 3.6 U/mL 3.alpha.-HSDH, 44.9 U/mL GDH (NADP), 18.1 U/mL GDH (NAD).
[0562] Biotransformation was set up at the 20-mL scale in the following reaction conditions: 100 mM DHCA, 17.7 g/L BTM of the stored biocatalyst, 500 mM glucose, 10 mM MgCl.sub.2, suspended in 50 mM KPi buffer (pH 7). Using manual pH adjustment, the pH was maintained throughout the biotransformation at pH 7. The reactions were carried out either without cofactor addition or with addition of 0.1 mM NAD. The variation of the bile salt concentrations as a function of time is shown in FIG. 22. After 2 h, with and without addition of NAD, in each case .gtoreq.98% of product (12-keto-UDCA) was formed.
[0563] Using altogether 17.7 g/L BTM biocatalysts, 100 mM DHCA were converted to an extent of 98% to 12-keto-UDCA.
Reaction Example 13
Two-Step Reduction of Dehydrocholic Acid with Parallel use of Two Different Whole-Cell Biocatalysts
[0564] In this example, two whole-cell biocatalysts were used instead of one whole-cell biocatalyst. For this purpose, an NADP-specific FDH from Mycobacterium vaccae and an NADPH-specific 7.beta.-HSDH from Collinsella aerofaciens were expressed in one of these biocatalysts, whereas an NAD-dependent FDH from Mycobacterium vaccae and an NADH-dependent 3.alpha.-HSDH from Comamonas testosteroni were expressed in the other biocatalyst.
[0565] In the present example, concretely the vector pF(G)r7(A), which comprises genes for an NADP-specific FDH from Mycobacterium vaccae and for an NADPH-specific 7.beta.-HSDH from Collinsella aerofaciens, and the vector pFr3, which comprises genes for an NAD-dependent FDH from Mycobacterium vaccae and for an NADH-dependent 3.alpha.-HSDH from Comamonas testosteroni, were used. The vectors pF(G)r7(A) and pFr3 are shown in FIG. 23a and b. FIG. 24 shows a reaction scheme with possible routes and products. However, the invention is not restricted to these two stated vectors, but can comprise all conceivable vectors that comprise genes for a 7.beta.-HSDH and a suitable cofactor regeneration enzyme in combination with vectors that comprise genes for a 3.alpha.-HSDH and a suitable cofactor regeneration enzyme.
[0566] 13.1 Whole-Cell Reduction of DHCA using two Biocatalysts in Different Mixture Ratios
[0567] The whole-cell reduction of DHCA to 12-keto-UDCA with different mixture ratios of the biocatalysts E. coli BL49 pF(G)r7(A) and E. coli BL49 pFr3 is shown in the following example. In this case, a total amount of biocatalyst of 17.7 g L.sup.-1.sub.BTM was used in each case for three batches. However, different proportions of the two biocatalysts were used in the batches. These are
[0568] 8.85 g L.sup.-1.sub.BTM E. coli BL49 pF(G)r7(A) and 8.85 g L.sup.-1.sub.BTM E. coli BL49 pFr3
[0569] 10.33 g L.sup.-1.sub.BTM E. coli BL49 pF(G)r7(A) and 7.38 g L.sup.-1.sub.BTM E. coli BL49 pFr3
[0570] 11.80 g L.sup.-1.sub.BTM E. coli BL49 pF(G)r7(A) and 5.90 g L.sup.-1.sub.BTM E. coli BL49 pFr3 These biocatalysis reactions were carried out at a working volume of 20 mL. Further constituents of the batches were: 70 mM DHCA, 500 mL sodium formate, 26% glycerol, 50 mM MgCl.sub.2, suspended in 50 mL potassium phosphate buffer (pH 6.5). The reactions were carried out for 24 h. The proportions of bile salts after 24 h are shown in FIG. 25.
[0571] In the preparation with 8.85 g L.sup.-1.sub.BTM E. coli BL49 pF(G)r7(A) and 8.85 g L.sup.-1.sub.BTM E. coli BL49 pFr3, 79% 12-keto-UDCA, 4% 3,12-diketo-U DCA and 17% 7,12-diketo-UDCA are formed, in the preparation with 10.33 g L.sup.-1.sub.BTM E. coli BL49 pF(G)r7(A) and 7.38 g L.sup.-1.sub.BTM E. coli BL49 pFr3, 87% 12-keto-UDCA, 9% 3,12-diketo-UDCA and 4% 7,12-diketo-UDCA are formed and in the preparation with 11.80 g L.sup.-1.sub.BTM E. coli BL49 pF(G)r7(A) and 5.90 g L.sup.-1.sub.BTM E. coli BL49 pFr3, 71% 12-keto-UDCA and 29% 3,12-diketo-UDCA are formed. It can be seen from the proportions of the intermediates formed that in the case of the preparation with 8.85 g L.sup.-1.sub.BTM E. coli BL49 pF(G)r7(A) and 8.85 g L.sup.-1.sub.BTME. coli BL49 pFr3 the reaction of 3.alpha.-HSDH takes place at an increased rate, as in this case a high proportion of the intermediate 7,12-diketo-UDCA is formed, whereas in the case of the preparation of 11.80 g L.sup.-1.sub.BTM E. coli BL49 pF(G)r7(A) and 5.90 g L.sup.-1.sub.BTM E. coli BL49 pFr3 the reaction of 7.beta.-HSDH takes place at an increased rate and accordingly a high proportion of the intermediate 3,12-diketo-UDCA is formed. In the preparation with 10.33 g L.sup.-1.sub.BTM E. coli BL49 pF(G)r7(A) and 7.38 g L.sup.-1.sub.BTME. coli BL49 pFr3, the reactions of 7.beta.-HSDH and of 3.alpha.-HSDH are adjusted so that both occur at a roughly equal rate, as can be seen from the almost uniform formations of intermediates. As a result, the highest proportion of the product 12-keto-UDCA (87%) can be formed with this preparation.
[0572] This example shows that the rate of the individual reaction steps can be influenced by adjusting the proportions of the biocatalysts used.
[0573] 13.1 Whole-Cell Reduction of DHCA using Two Biocatalysts at the 1 L Scale
[0574] Through process control, using the biocatalysts E. coli BL49 pF(G)r7(A) and E. coli BL49 pFr3, product formation could be increased relative to the milliliter scale. The biotransformation was set up in a 1 L bioreactor in the following reaction conditions: 90 mM DHCA, with 8.85 g L.sup.-1.sub.BTM E. coli BL49 pF(G)r7(A) and 8.85 g L.sup.-1.sub.BTM E. coli BL49 pFr3, 500 mM ammonium formate, 26% (v/v) glycerol, 50 mM MgCl.sub.2, suspended in 50 mM KPi buffer (pH 6.5). Using pH adjustment with formic acid, the pH was maintained at pH 6.5 throughout the biotransformation. The variation of the bile salt concentrations as a function of time is shown in FIG. 26. After 20 h, 99.4% product (12-keto-UDCA) had formed, and only a total of 0.6% of the intermediates 3,12-diketo-UDCA and 7,12-diketo-UDCA was detectable.
[0575] Using the biocatalysts according to the invention, with the use of a total of 17.7 g L.sup.-1.sub.BTM biocatalysts, 90 mM DHCA could be converted to an extent of 99.5% to 12-keto-UDCA.
Assignment of SEQ ID NOs:
TABLE-US-00032
[0576] SEQ ID NO: Description Type 1 7.beta.-HSDH NS 2 7.beta.-HSDH AS 3 Primer S 7beta_rev_HindIII NS 4 Primer NS 5 3.alpha.-HSDH (C. testosteroni) NS 6 3.alpha.-HSDH (C. testosteroni) AS 7 3.alpha.-HSDH (R. norvegicus) NS 8 3.alpha.-HSDH (R. norvegicus) AS 9 Primer 7beta_mut_G39A_fwd NS 10 Primer 7beta_mut_G39A_rev NS 11 Primer 7beta_mut_G39S_fwd NS 12 Primer 7beta_mut_G39S_rev NS 13 Primer 7beta_fwd_EcoRI NS 14 FDH D221G NS 15 FDH D221G AS 16 Primer 3alpha _fwd_HindIII NS 17 Primer 3alpha_rev_NotI NS 18 pET22a FDH D221G 7.beta.-HSDH NS 19 FDH D221G AS 20 7beta-HSDH AS 21 pCOLA(mod) 3.alpha.-HSDH NS 22 3.alpha.-HSDH AS 23 Primer fdh_for NS 24 Primer fdh_rev NS 25 7.alpha.-HSDH NS 26 7.alpha.-HSDH AS 27 Primer 467|468a-IBS NS 28 Primer 467|468a-EBS1d NS 29 Primer 467|468a-EBS2 NS 30 Primer mt1 NS 31 Primer NI_fdh_R NS 32 Primer 7alpha-ko-check_fwd NS 33 Primer 7a1pha-ko-check_rev NS 34 FDH D221G with deletion and His-Tag NS 35 FDH D221G with deletion and His-Tag AS 36 FDH wild type, M. vaccae AS 37 7.beta.-HSDH G39D AS 38 7.beta.-HSDH G39D/R40L AS 39 7.beta.-HSDH G39D/R40I AS 40 7.beta.-HSDH G39D/R40V AS 41 Primer for G39D (7beta mut G39D fwd) NS 42 Primer for G39D (7beta mut G39D rev) NS 43 Primer for G39D R40L (7beta mut G39D R40L fwd) NS 44 Primer 3alphamut_AntiMid_rev NS 45 Primer for G39D R40I (7beta mut G39D R40I fwd) NS 46 Primer 7beta mut G39D R40V fwd NS 47 GDH, B. subtilis NS 48 GDH B. subtilis AS 49 Vector pFr7(D) NS 50 Vector pFr7(DL) NS 51 Vector pFr7(DI) NS 52 Vector pFr7(DV) NS 53 PCR Primer "G39D_for" NS 54 PCR Primer "G39D_rev" NS 55 PCR Primer "G39D/R40I_for" NS 56 PCR Primer "G39D/R40I_rev" NS 57 PCR Primer "R40D_for" NS 58 PCR Primer "R40D_rev" NS 59 PCR Primer "R40D/R41I_for" NS 60 PCR Primer "R40D/R41I_rev" NS 61 PCR Primer "DIN _for" NS 62 PCR Primer "DIN_rev" NS 63 Plasmid pFr3T7(D), Fig. 15 NS 64 Plasmid pF(G)r7(A)r3, Fig. 17a NS 65 Plasmid pF(G)r7(S)r3, Fig. 17b NS 66 Plasmid p3T7(A)rG, Fig. 20 NS 67 Plasmid p7(A)T3rG, Fig. 21 NS 68 Plasmid pF(G)r7(A), Fig. 23a NS 69 Plasmid pFr3, Fig. 23b NS AS = amino acid sequence NS = nucleic acid sequence
Reference is made expressly to the disclosure of the documents mentioned herein.
Sequence CWU
1
1
691792DNACollinsella aerofaciensCDS(1)..(789) 1atg aac ctg agg gag aag tac
ggt gag tgg ggc ctg atc ctg ggc gcg 48Met Asn Leu Arg Glu Lys Tyr
Gly Glu Trp Gly Leu Ile Leu Gly Ala1 5 10
15acc gag ggc gtc ggc aag gcg ttc tgc gag aag atc gcc
gcc ggc ggc 96Thr Glu Gly Val Gly Lys Ala Phe Cys Glu Lys Ile Ala
Ala Gly Gly 20 25 30atg aac
gtc gtc atg gtc ggc cgt cgc gag gag aag ctg aac gtg ctc 144Met Asn
Val Val Met Val Gly Arg Arg Glu Glu Lys Leu Asn Val Leu 35
40 45gca ggc gag atc cgc gag acc tac ggc gtg
gag acc aag gtc gtg cgc 192Ala Gly Glu Ile Arg Glu Thr Tyr Gly Val
Glu Thr Lys Val Val Arg 50 55 60gcc
gac ttt agc cag ccc ggc gct gcc gag acc gtc ttc gcc gcg acc 240Ala
Asp Phe Ser Gln Pro Gly Ala Ala Glu Thr Val Phe Ala Ala Thr65
70 75 80gag ggc ctg gac atg ggc
ttc atg agc tac gtg gcc tgc ctg cac agc 288Glu Gly Leu Asp Met Gly
Phe Met Ser Tyr Val Ala Cys Leu His Ser 85
90 95ttc ggt aag atc cag gac acc ccc tgg gag aag cac
gag gcc atg atc 336Phe Gly Lys Ile Gln Asp Thr Pro Trp Glu Lys His
Glu Ala Met Ile 100 105 110aac
gtc aac gtc gtg acc ttc ctc aag tgc ttc cac cac tac atg cgg 384Asn
Val Asn Val Val Thr Phe Leu Lys Cys Phe His His Tyr Met Arg 115
120 125atc ttt gcc gcc cag gac cgc ggc gcc
gtg atc aac gtc tcg tcg atg 432Ile Phe Ala Ala Gln Asp Arg Gly Ala
Val Ile Asn Val Ser Ser Met 130 135
140acc ggc atc agc tcc agc ccc tgg aac ggc cag tac ggc gcg ggc aag
480Thr Gly Ile Ser Ser Ser Pro Trp Asn Gly Gln Tyr Gly Ala Gly Lys145
150 155 160gcc ttc atc ctc
aag atg acc gag gcc gtg gcc tgc gag tgc gag ggc 528Ala Phe Ile Leu
Lys Met Thr Glu Ala Val Ala Cys Glu Cys Glu Gly 165
170 175acc ggc gtc gac gtc gag gtc atc acc ctc
ggc acc acc cta acc ccc 576Thr Gly Val Asp Val Glu Val Ile Thr Leu
Gly Thr Thr Leu Thr Pro 180 185
190agc ctg ctg tcc aac ctc ccc ggc ggc ccg cag ggc gag gcc gtc atg
624Ser Leu Leu Ser Asn Leu Pro Gly Gly Pro Gln Gly Glu Ala Val Met
195 200 205aag atc gcc ctc acc ccc gag
gag tgc gtt gac gag gcc ttt gag aag 672Lys Ile Ala Leu Thr Pro Glu
Glu Cys Val Asp Glu Ala Phe Glu Lys 210 215
220ctg ggt aag gag ctc tcc gtc atc gcc ggc cag cgc aac aag gac tcc
720Leu Gly Lys Glu Leu Ser Val Ile Ala Gly Gln Arg Asn Lys Asp Ser225
230 235 240gtc cac gac tgg
aag gca aac cac acc gag gac gag tac atc cgc tac 768Val His Asp Trp
Lys Ala Asn His Thr Glu Asp Glu Tyr Ile Arg Tyr 245
250 255atg ggg tcg ttc tac cgc gac tag
792Met Gly Ser Phe Tyr Arg Asp
2602263PRTCollinsella aerofaciens 2Met Asn Leu Arg Glu Lys Tyr Gly Glu
Trp Gly Leu Ile Leu Gly Ala1 5 10
15Thr Glu Gly Val Gly Lys Ala Phe Cys Glu Lys Ile Ala Ala Gly
Gly 20 25 30Met Asn Val Val
Met Val Gly Arg Arg Glu Glu Lys Leu Asn Val Leu 35
40 45Ala Gly Glu Ile Arg Glu Thr Tyr Gly Val Glu Thr
Lys Val Val Arg 50 55 60Ala Asp Phe
Ser Gln Pro Gly Ala Ala Glu Thr Val Phe Ala Ala Thr65 70
75 80Glu Gly Leu Asp Met Gly Phe Met
Ser Tyr Val Ala Cys Leu His Ser 85 90
95Phe Gly Lys Ile Gln Asp Thr Pro Trp Glu Lys His Glu Ala
Met Ile 100 105 110Asn Val Asn
Val Val Thr Phe Leu Lys Cys Phe His His Tyr Met Arg 115
120 125Ile Phe Ala Ala Gln Asp Arg Gly Ala Val Ile
Asn Val Ser Ser Met 130 135 140Thr Gly
Ile Ser Ser Ser Pro Trp Asn Gly Gln Tyr Gly Ala Gly Lys145
150 155 160Ala Phe Ile Leu Lys Met Thr
Glu Ala Val Ala Cys Glu Cys Glu Gly 165
170 175Thr Gly Val Asp Val Glu Val Ile Thr Leu Gly Thr
Thr Leu Thr Pro 180 185 190Ser
Leu Leu Ser Asn Leu Pro Gly Gly Pro Gln Gly Glu Ala Val Met 195
200 205Lys Ile Ala Leu Thr Pro Glu Glu Cys
Val Asp Glu Ala Phe Glu Lys 210 215
220Leu Gly Lys Glu Leu Ser Val Ile Ala Gly Gln Arg Asn Lys Asp Ser225
230 235 240Val His Asp Trp
Lys Ala Asn His Thr Glu Asp Glu Tyr Ile Arg Tyr 245
250 255Met Gly Ser Phe Tyr Arg Asp
260331DNAArtificial SequenceDescription of Artificial Sequence Synthetic
PCR primer 3gggaattcca tatgaacctg agggagaagt a
31427DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 4cccaagcttc tagtcgcggt agaacga
275774DNAComamonas testosteroniCDS(1)..(771) 5atg
tcc atc atc gtg ata agc ggc tgc gcc acc ggc att ggt gcc gct 48Met
Ser Ile Ile Val Ile Ser Gly Cys Ala Thr Gly Ile Gly Ala Ala1
5 10 15acg cgc aag gtc ctg gag gcg
gcc ggt cac cag atc gta ggc atc gat 96Thr Arg Lys Val Leu Glu Ala
Ala Gly His Gln Ile Val Gly Ile Asp 20 25
30ata cgc gat gcg gaa gtg att gcc gat ctc tcg acg gcc gaa
ggt cga 144Ile Arg Asp Ala Glu Val Ile Ala Asp Leu Ser Thr Ala Glu
Gly Arg 35 40 45aag cag gcg att
gcc gat gta ctg gcg aag tgc agc aag ggc atg gac 192Lys Gln Ala Ile
Ala Asp Val Leu Ala Lys Cys Ser Lys Gly Met Asp 50 55
60ggc ctg gtg ctg tgc gcc ggc ctg gga ccg cag acc aag
gtg ctt ggc 240Gly Leu Val Leu Cys Ala Gly Leu Gly Pro Gln Thr Lys
Val Leu Gly65 70 75
80aat gtg gtt tcg gtc aat tat ttt ggc gcg acc gag ctg atg gat gcc
288Asn Val Val Ser Val Asn Tyr Phe Gly Ala Thr Glu Leu Met Asp Ala
85 90 95ttt ttg cca gcg ctg aaa
aaa ggc cat cag ccc gca gcc gtc gtc atc 336Phe Leu Pro Ala Leu Lys
Lys Gly His Gln Pro Ala Ala Val Val Ile 100
105 110tcg tcc gtg gct tcc gcg cat ctg gct ttt gac aag
aac cca ctg gcg 384Ser Ser Val Ala Ser Ala His Leu Ala Phe Asp Lys
Asn Pro Leu Ala 115 120 125ctg gca
ctg gaa gcc ggc gag gaa gcc aag gcc cgc gcc att gtc gaa 432Leu Ala
Leu Glu Ala Gly Glu Glu Ala Lys Ala Arg Ala Ile Val Glu 130
135 140cat gcg gga gag cag ggc gga aat ctg gcc tat
gcg ggc agc aag aat 480His Ala Gly Glu Gln Gly Gly Asn Leu Ala Tyr
Ala Gly Ser Lys Asn145 150 155
160gct ttg acg gtg gct gtg cgc aaa cgc gcc gcc gcc tgg ggc gag gct
528Ala Leu Thr Val Ala Val Arg Lys Arg Ala Ala Ala Trp Gly Glu Ala
165 170 175ggc gtg cgc ctg aac
acc atc gcc ccc ggt gca acc gag act ccc ttg 576Gly Val Arg Leu Asn
Thr Ile Ala Pro Gly Ala Thr Glu Thr Pro Leu 180
185 190ctg cag gcg ggc ctg cag gac ccg cgc tat ggc gaa
tcc att gcc aag 624Leu Gln Ala Gly Leu Gln Asp Pro Arg Tyr Gly Glu
Ser Ile Ala Lys 195 200 205ttc gtt
cct ccc atg ggc cgc cgt gcc gag ccg tcc gag atg gcg tcg 672Phe Val
Pro Pro Met Gly Arg Arg Ala Glu Pro Ser Glu Met Ala Ser 210
215 220gtc atc gcc ttt ttg atg agc ccg gcc gca agc
tat gtg cat ggc gcg 720Val Ile Ala Phe Leu Met Ser Pro Ala Ala Ser
Tyr Val His Gly Ala225 230 235
240cag atc gtc att gat ggc ggc att gat gcg gtg atg cgc ccg aca cag
768Gln Ile Val Ile Asp Gly Gly Ile Asp Ala Val Met Arg Pro Thr Gln
245 250 255ttc tga
774Phe6257PRTComamonas
testosteroni 6Met Ser Ile Ile Val Ile Ser Gly Cys Ala Thr Gly Ile Gly Ala
Ala1 5 10 15Thr Arg Lys
Val Leu Glu Ala Ala Gly His Gln Ile Val Gly Ile Asp 20
25 30Ile Arg Asp Ala Glu Val Ile Ala Asp Leu
Ser Thr Ala Glu Gly Arg 35 40
45Lys Gln Ala Ile Ala Asp Val Leu Ala Lys Cys Ser Lys Gly Met Asp 50
55 60Gly Leu Val Leu Cys Ala Gly Leu Gly
Pro Gln Thr Lys Val Leu Gly65 70 75
80Asn Val Val Ser Val Asn Tyr Phe Gly Ala Thr Glu Leu Met
Asp Ala 85 90 95Phe Leu
Pro Ala Leu Lys Lys Gly His Gln Pro Ala Ala Val Val Ile 100
105 110Ser Ser Val Ala Ser Ala His Leu Ala
Phe Asp Lys Asn Pro Leu Ala 115 120
125Leu Ala Leu Glu Ala Gly Glu Glu Ala Lys Ala Arg Ala Ile Val Glu
130 135 140His Ala Gly Glu Gln Gly Gly
Asn Leu Ala Tyr Ala Gly Ser Lys Asn145 150
155 160Ala Leu Thr Val Ala Val Arg Lys Arg Ala Ala Ala
Trp Gly Glu Ala 165 170
175Gly Val Arg Leu Asn Thr Ile Ala Pro Gly Ala Thr Glu Thr Pro Leu
180 185 190Leu Gln Ala Gly Leu Gln
Asp Pro Arg Tyr Gly Glu Ser Ile Ala Lys 195 200
205Phe Val Pro Pro Met Gly Arg Arg Ala Glu Pro Ser Glu Met
Ala Ser 210 215 220Val Ile Ala Phe Leu
Met Ser Pro Ala Ala Ser Tyr Val His Gly Ala225 230
235 240Gln Ile Val Ile Asp Gly Gly Ile Asp Ala
Val Met Arg Pro Thr Gln 245 250
255Phe7969DNARattus norvegicusCDS(1)..(966) 7atg gat tcc ata tct ctg
cgt gta gca cta aat gat ggt aac ttc att 48Met Asp Ser Ile Ser Leu
Arg Val Ala Leu Asn Asp Gly Asn Phe Ile1 5
10 15cct gta ctg ggg ttt gga acc act gtg cct gag aag
gtt gct aag gat 96Pro Val Leu Gly Phe Gly Thr Thr Val Pro Glu Lys
Val Ala Lys Asp 20 25 30gaa
gtt atc aag gct act aaa ata gct ata gat aat gga ttc cgc cat 144Glu
Val Ile Lys Ala Thr Lys Ile Ala Ile Asp Asn Gly Phe Arg His 35
40 45ttt gac tct gct tat ttg tac gaa gta
gaa gag gaa gtg ggc caa gcc 192Phe Asp Ser Ala Tyr Leu Tyr Glu Val
Glu Glu Glu Val Gly Gln Ala 50 55
60att aga agc aag att gaa gac ggc act gtg aag aga gaa gat ata ttc
240Ile Arg Ser Lys Ile Glu Asp Gly Thr Val Lys Arg Glu Asp Ile Phe65
70 75 80tat act tca aag ctt
tgg agc act ttc cat aga cca gag ctg gtc cga 288Tyr Thr Ser Lys Leu
Trp Ser Thr Phe His Arg Pro Glu Leu Val Arg 85
90 95act tgc ttg gaa aag aca ctg aaa agc act caa
ctg gac tat gtg gat 336Thr Cys Leu Glu Lys Thr Leu Lys Ser Thr Gln
Leu Asp Tyr Val Asp 100 105
110ctt tat att att cat ttc cca atg gct ttg cag cct gga gat ata ttt
384Leu Tyr Ile Ile His Phe Pro Met Ala Leu Gln Pro Gly Asp Ile Phe
115 120 125ttc cca cga gat gag cat gga
aaa cta ttg ttt gaa aca gtg gat atc 432Phe Pro Arg Asp Glu His Gly
Lys Leu Leu Phe Glu Thr Val Asp Ile 130 135
140tgt gac aca tgg gag gcc atg gaa aag tgt aag gat gca gga ttg gcc
480Cys Asp Thr Trp Glu Ala Met Glu Lys Cys Lys Asp Ala Gly Leu Ala145
150 155 160aag tct att ggg
gtg tcc aac ttt aac tgc agg cag ctg gag agg att 528Lys Ser Ile Gly
Val Ser Asn Phe Asn Cys Arg Gln Leu Glu Arg Ile 165
170 175ctg aat aag cca ggg ctc aaa tac aag cct
gtg tgc aac cag gtg gaa 576Leu Asn Lys Pro Gly Leu Lys Tyr Lys Pro
Val Cys Asn Gln Val Glu 180 185
190tgt cac ctt tat ctc aac cag agc aaa atg ctg gac tat tgt aag tca
624Cys His Leu Tyr Leu Asn Gln Ser Lys Met Leu Asp Tyr Cys Lys Ser
195 200 205aaa gac atc att ctg gtt tcc
tac tgc acg ctg gga agt tca cga gac 672Lys Asp Ile Ile Leu Val Ser
Tyr Cys Thr Leu Gly Ser Ser Arg Asp 210 215
220aaa aca tgg gtg gat cag aaa agt cca gtt ctc cta gat gat cca gtt
720Lys Thr Trp Val Asp Gln Lys Ser Pro Val Leu Leu Asp Asp Pro Val225
230 235 240ctt tgt gcc ata
gca aag aag tac aag caa acc cca gcc cta gtt gcc 768Leu Cys Ala Ile
Ala Lys Lys Tyr Lys Gln Thr Pro Ala Leu Val Ala 245
250 255ctt cgc tac cag ctg cag cgt ggg gtt gtg
ccc ctg atc agg agt ttc 816Leu Arg Tyr Gln Leu Gln Arg Gly Val Val
Pro Leu Ile Arg Ser Phe 260 265
270aac gcg aag cgg atc aaa gag cta aca cag gtt ttt gaa ttc cag ttg
864Asn Ala Lys Arg Ile Lys Glu Leu Thr Gln Val Phe Glu Phe Gln Leu
275 280 285gct tca gag gac atg aaa gcc
ctg gat ggc ttg aac aga aat ttc aga 912Ala Ser Glu Asp Met Lys Ala
Leu Asp Gly Leu Asn Arg Asn Phe Arg 290 295
300tac aac aat gca aaa tat ttt gat gac cat ccc aat cat cca ttt act
960Tyr Asn Asn Ala Lys Tyr Phe Asp Asp His Pro Asn His Pro Phe Thr305
310 315 320gat gaa tag
969Asp
Glu8322PRTRattus norvegicus 8Met Asp Ser Ile Ser Leu Arg Val Ala Leu Asn
Asp Gly Asn Phe Ile1 5 10
15Pro Val Leu Gly Phe Gly Thr Thr Val Pro Glu Lys Val Ala Lys Asp
20 25 30Glu Val Ile Lys Ala Thr Lys
Ile Ala Ile Asp Asn Gly Phe Arg His 35 40
45Phe Asp Ser Ala Tyr Leu Tyr Glu Val Glu Glu Glu Val Gly Gln
Ala 50 55 60Ile Arg Ser Lys Ile Glu
Asp Gly Thr Val Lys Arg Glu Asp Ile Phe65 70
75 80Tyr Thr Ser Lys Leu Trp Ser Thr Phe His Arg
Pro Glu Leu Val Arg 85 90
95Thr Cys Leu Glu Lys Thr Leu Lys Ser Thr Gln Leu Asp Tyr Val Asp
100 105 110Leu Tyr Ile Ile His Phe
Pro Met Ala Leu Gln Pro Gly Asp Ile Phe 115 120
125Phe Pro Arg Asp Glu His Gly Lys Leu Leu Phe Glu Thr Val
Asp Ile 130 135 140Cys Asp Thr Trp Glu
Ala Met Glu Lys Cys Lys Asp Ala Gly Leu Ala145 150
155 160Lys Ser Ile Gly Val Ser Asn Phe Asn Cys
Arg Gln Leu Glu Arg Ile 165 170
175Leu Asn Lys Pro Gly Leu Lys Tyr Lys Pro Val Cys Asn Gln Val Glu
180 185 190Cys His Leu Tyr Leu
Asn Gln Ser Lys Met Leu Asp Tyr Cys Lys Ser 195
200 205Lys Asp Ile Ile Leu Val Ser Tyr Cys Thr Leu Gly
Ser Ser Arg Asp 210 215 220Lys Thr Trp
Val Asp Gln Lys Ser Pro Val Leu Leu Asp Asp Pro Val225
230 235 240Leu Cys Ala Ile Ala Lys Lys
Tyr Lys Gln Thr Pro Ala Leu Val Ala 245
250 255Leu Arg Tyr Gln Leu Gln Arg Gly Val Val Pro Leu
Ile Arg Ser Phe 260 265 270Asn
Ala Lys Arg Ile Lys Glu Leu Thr Gln Val Phe Glu Phe Gln Leu 275
280 285Ala Ser Glu Asp Met Lys Ala Leu Asp
Gly Leu Asn Arg Asn Phe Arg 290 295
300Tyr Asn Asn Ala Lys Tyr Phe Asp Asp His Pro Asn His Pro Phe Thr305
310 315 320Asp
Glu926DNAArtificial SequenceDescription of Artificial Sequence Synthetic
PCR primer 9cgtcgtcatg gtcgcccgtc gcgagg
261026DNAArtificial SequenceDescription of Artificial
Sequence Synthetic PCR primer 10cctcgcgacg ggcgaccatg acgacg
261126DNAArtificial SequenceDescription
of Artificial Sequence Synthetic PCR primer 11cgtcgtcatg gtcagccgtc
gcgagg 261226DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
12cctcgcgacg gctgaccatg acgacg
261347DNAArtificial SequenceDescription of Artificial Sequence Synthetic
PCR primer 13gcgaattcgt gaaaggagat atacatgaac ctgagggaga agtacgg
47141206DNAArtificial SequenceDescription of Artificial
Sequence Synthetic formate dehydrogenase mutant
polynucleotideCDS(1)..(1203) 14atg gca aag gtc ctg tgc gtt ctt tac gat
gat ccg gtc gac ggc tac 48Met Ala Lys Val Leu Cys Val Leu Tyr Asp
Asp Pro Val Asp Gly Tyr1 5 10
15ccg aag acc tat gcc cgc gac gat ctt ccg aag atc gac cac tat ccg
96Pro Lys Thr Tyr Ala Arg Asp Asp Leu Pro Lys Ile Asp His Tyr Pro
20 25 30ggc ggc cag atc ttg ccg
acg ccg aag gcc atc gac ttc acg ccc ggg 144Gly Gly Gln Ile Leu Pro
Thr Pro Lys Ala Ile Asp Phe Thr Pro Gly 35 40
45cag ttg ctc ggc tcc gtc tcc ggc gag ctc ggc ctg cgc gaa
tat ctc 192Gln Leu Leu Gly Ser Val Ser Gly Glu Leu Gly Leu Arg Glu
Tyr Leu 50 55 60gaa tcc aac ggc cac
acc ctg gtc gtg acc tcc gac aag gac ggc ccc 240Glu Ser Asn Gly His
Thr Leu Val Val Thr Ser Asp Lys Asp Gly Pro65 70
75 80gac tcg gtg ttc gag cgc gag ctg gtc gat
gcg gat gtc gtc atc tcc 288Asp Ser Val Phe Glu Arg Glu Leu Val Asp
Ala Asp Val Val Ile Ser 85 90
95cag ccc ttc tgg ccg gcc tat ctg acg ccc gag cgc atc gcc aag gcc
336Gln Pro Phe Trp Pro Ala Tyr Leu Thr Pro Glu Arg Ile Ala Lys Ala
100 105 110aag aac ctg aag ctc gcg
ctc acc gcc ggc atc ggt tcc gac cac gtc 384Lys Asn Leu Lys Leu Ala
Leu Thr Ala Gly Ile Gly Ser Asp His Val 115 120
125gat ctt cag tcg gct atc gac cgc aac gtc acc gtg gcg gaa
gtc acc 432Asp Leu Gln Ser Ala Ile Asp Arg Asn Val Thr Val Ala Glu
Val Thr 130 135 140tac tgc aac tcg atc
agc gtc gcc gag cat gtg gtg atg atg atc ctg 480Tyr Cys Asn Ser Ile
Ser Val Ala Glu His Val Val Met Met Ile Leu145 150
155 160tcg ctg gtg cgc aac tat ctg ccc tcg cac
gaa tgg gcg cgg aag ggc 528Ser Leu Val Arg Asn Tyr Leu Pro Ser His
Glu Trp Ala Arg Lys Gly 165 170
175ggc tgg aac atc gcc gac tgc gtc tcc cac gcc tac gac ctc gag gcg
576Gly Trp Asn Ile Ala Asp Cys Val Ser His Ala Tyr Asp Leu Glu Ala
180 185 190atg cat gtc ggc acc gtg
gcc gcc ggc cgc atc ggt ctc gcg gtg ctg 624Met His Val Gly Thr Val
Ala Ala Gly Arg Ile Gly Leu Ala Val Leu 195 200
205cgc cgt ctg gcg ccg ttc gac gtg cac ctg cac tac acc ggc
cgt cac 672Arg Arg Leu Ala Pro Phe Asp Val His Leu His Tyr Thr Gly
Arg His 210 215 220cgc ctg ccg gaa tcg
gtc gag aag gag ctc aac ctc acc tgg cac gcg 720Arg Leu Pro Glu Ser
Val Glu Lys Glu Leu Asn Leu Thr Trp His Ala225 230
235 240acc cgc gag gac atg tat ccg gtt tgc gac
gtg gtg acg ctg aac tgc 768Thr Arg Glu Asp Met Tyr Pro Val Cys Asp
Val Val Thr Leu Asn Cys 245 250
255ccg ctg cac ccc gaa acc gag cac atg atc aat gac gag acg ctg aag
816Pro Leu His Pro Glu Thr Glu His Met Ile Asn Asp Glu Thr Leu Lys
260 265 270ctg ttc aag cgt ggc gcc
tac atc gtc aac acc gcc cgc ggc aag ctg 864Leu Phe Lys Arg Gly Ala
Tyr Ile Val Asn Thr Ala Arg Gly Lys Leu 275 280
285tgc gac cgc gat gcc gtg gca cgt gcg ctc gaa tcc ggc cgg
ctg gcc 912Cys Asp Arg Asp Ala Val Ala Arg Ala Leu Glu Ser Gly Arg
Leu Ala 290 295 300ggc tat gcc ggc gac
gtg tgg ttc ccg cag ccg gcg ccg aag gac cac 960Gly Tyr Ala Gly Asp
Val Trp Phe Pro Gln Pro Ala Pro Lys Asp His305 310
315 320ccc tgg cgg acg atg ccc tat aac ggc atg
acc ccg cac atc tcc ggc 1008Pro Trp Arg Thr Met Pro Tyr Asn Gly Met
Thr Pro His Ile Ser Gly 325 330
335acc acg ctg acc gcg cag gcg cgt tat gcg gcg ggc acc cgc gag atc
1056Thr Thr Leu Thr Ala Gln Ala Arg Tyr Ala Ala Gly Thr Arg Glu Ile
340 345 350ctg gag tgc ttc ttc gag
ggc cgt ccg atc cgc gac gaa tac ctc atc 1104Leu Glu Cys Phe Phe Glu
Gly Arg Pro Ile Arg Asp Glu Tyr Leu Ile 355 360
365gtg cag ggc ggc gct ctt gcc ggc acc ggc gcg cat tcc tac
tcg aag 1152Val Gln Gly Gly Ala Leu Ala Gly Thr Gly Ala His Ser Tyr
Ser Lys 370 375 380ggc aat gcc acc ggc
ggt tcg gaa gag gcc gcc aag ttc aag aag gcg 1200Gly Asn Ala Thr Gly
Gly Ser Glu Glu Ala Ala Lys Phe Lys Lys Ala385 390
395 400gtc tga
1206Val15401PRTArtificial SequenceDescription
of Artificial Sequence Synthetic construct polypeptide 15Met Ala Lys
Val Leu Cys Val Leu Tyr Asp Asp Pro Val Asp Gly Tyr1 5
10 15Pro Lys Thr Tyr Ala Arg Asp Asp Leu
Pro Lys Ile Asp His Tyr Pro 20 25
30Gly Gly Gln Ile Leu Pro Thr Pro Lys Ala Ile Asp Phe Thr Pro Gly
35 40 45Gln Leu Leu Gly Ser Val Ser
Gly Glu Leu Gly Leu Arg Glu Tyr Leu 50 55
60Glu Ser Asn Gly His Thr Leu Val Val Thr Ser Asp Lys Asp Gly Pro65
70 75 80Asp Ser Val Phe
Glu Arg Glu Leu Val Asp Ala Asp Val Val Ile Ser 85
90 95Gln Pro Phe Trp Pro Ala Tyr Leu Thr Pro
Glu Arg Ile Ala Lys Ala 100 105
110Lys Asn Leu Lys Leu Ala Leu Thr Ala Gly Ile Gly Ser Asp His Val
115 120 125Asp Leu Gln Ser Ala Ile Asp
Arg Asn Val Thr Val Ala Glu Val Thr 130 135
140Tyr Cys Asn Ser Ile Ser Val Ala Glu His Val Val Met Met Ile
Leu145 150 155 160Ser Leu
Val Arg Asn Tyr Leu Pro Ser His Glu Trp Ala Arg Lys Gly
165 170 175Gly Trp Asn Ile Ala Asp Cys
Val Ser His Ala Tyr Asp Leu Glu Ala 180 185
190Met His Val Gly Thr Val Ala Ala Gly Arg Ile Gly Leu Ala
Val Leu 195 200 205Arg Arg Leu Ala
Pro Phe Asp Val His Leu His Tyr Thr Gly Arg His 210
215 220Arg Leu Pro Glu Ser Val Glu Lys Glu Leu Asn Leu
Thr Trp His Ala225 230 235
240Thr Arg Glu Asp Met Tyr Pro Val Cys Asp Val Val Thr Leu Asn Cys
245 250 255Pro Leu His Pro Glu
Thr Glu His Met Ile Asn Asp Glu Thr Leu Lys 260
265 270Leu Phe Lys Arg Gly Ala Tyr Ile Val Asn Thr Ala
Arg Gly Lys Leu 275 280 285Cys Asp
Arg Asp Ala Val Ala Arg Ala Leu Glu Ser Gly Arg Leu Ala 290
295 300Gly Tyr Ala Gly Asp Val Trp Phe Pro Gln Pro
Ala Pro Lys Asp His305 310 315
320Pro Trp Arg Thr Met Pro Tyr Asn Gly Met Thr Pro His Ile Ser Gly
325 330 335Thr Thr Leu Thr
Ala Gln Ala Arg Tyr Ala Ala Gly Thr Arg Glu Ile 340
345 350Leu Glu Cys Phe Phe Glu Gly Arg Pro Ile Arg
Asp Glu Tyr Leu Ile 355 360 365Val
Gln Gly Gly Ala Leu Ala Gly Thr Gly Ala His Ser Tyr Ser Lys 370
375 380Gly Asn Ala Thr Gly Gly Ser Glu Glu Ala
Ala Lys Phe Lys Lys Ala385 390 395
400Val1643DNAArtificial SequenceDescription of Artificial
Sequence Synthetic PCR primer 16cccaagctta aggagatata catgtccatc
atcgtgataa gcg 431734DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
17ataagaatgc ggccgctcag aactgtgtcg ggcg
34187404DNAArtificial SequenceDescription of Artificial Sequence
Synthetic plasmid pET21a FDH D221G 7beta-HSDH
polypeptideCDS(5208)..(6422)FDH D221GCDS(6435)..(7226)7beta-HSDH
18tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg
60cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc
120ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg
180gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc
240acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt
300ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc
360ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta
420acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt
480tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta
540tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat
600gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt
660ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg
720agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga
780agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg
840tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt
900tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg
960cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg
1020aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga
1080tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc
1140tgcagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc
1200ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc
1260ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg
1320cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac
1380gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc
1440actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt
1500aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac
1560caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa
1620aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc
1680accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt
1740aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg
1800ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc
1860agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt
1920accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga
1980gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct
2040tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg
2100cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca
2160cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa
2220cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt
2280ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga
2340taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga
2400gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatatgg
2460tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagtatac actccgctat
2520cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct
2580gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct
2640gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct
2700catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt
2760tgagtttctc cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg
2820ttttttcctg tttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa
2880tgataccgat gaaacgagag aggatgctca cgatacgggt tactgatgat gaacatgccc
2940ggttactgga acgttgtgag ggtaaacaac tggcggtatg gatgcggcgg gaccagagaa
3000aaatcactca gggtcaatgc cagcgcttcg ttaatacaga tgtaggtgtt ccacagggta
3060gccagcagca tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg
3120tttccagact ttacgaaaca cggaaaccga agaccattca tgttgttgct caggtcgcag
3180acgttttgca gcagcagtcg cttcacgttc gctcgcgtat cggtgattca ttctgctaac
3240cagtaaggca accccgccag cctagccggg tcctcaacga caggagcacg atcatgcgca
3300cccgtggggc cgccatgccg gcgataatgg cctgcttctc gccgaaacgt ttggtggcgg
3360gaccagtgac gaaggcttga gcgagggcgt gcaagattcc gaataccgca agcgacaggc
3420cgatcatcgt cgcgctccag cgaaagcggt cctcgccgaa aatgacccag agcgctgccg
3480gcacctgtcc tacgagttgc atgataaaga agacagtcat aagtgcggcg acgatagtca
3540tgccccgcgc ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcgag
3600atcccggtgc ctaatgagtg agctaactta cattaattgc gttgcgctca ctgcccgctt
3660tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag
3720gcggtttgcg tattgggcgc cagggtggtt tttcttttca ccagtgagac gggcaacagc
3780tgattgccct tcaccgcctg gccctgagag agttgcagca agcggtccac gctggtttgc
3840cccagcaggc gaaaatcctg tttgatggtg gttaacggcg ggatataaca tgagctgtct
3900tcggtatcgt cgtatcccac taccgagata tccgcaccaa cgcgcagccc ggactcggta
3960atggcgcgca ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg
4020atgccctcat tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct
4080tcccgttccg ctatcggctg aatttgattg cgagtgagat atttatgcca gccagccaga
4140cgcagacgcg ccgagacaga acttaatggg cccgctaaca gcgcgatttg ctggtgaccc
4200aatgcgacca gatgctccac gcccagtcgc gtaccgtctt catgggagaa aataatactg
4260ttgatgggtg tctggtcaga gacatcaaga aataacgccg gaacattagt gcaggcagct
4320tccacagcaa tggcatcctg gtcatccagc ggatagttaa tgatcagccc actgacgcgt
4380tgcgcgagaa gattgtgcac cgccgcttta caggcttcga cgccgcttcg ttctaccatc
4440gacaccacca cgctggcacc cagttgatcg gcgcgagatt taatcgccgc gacaatttgc
4500gacggcgcgt gcagggccag actggaggtg gcaacgccaa tcagcaacga ctgtttgccc
4560gccagttgtt gtgccacgcg gttgggaatg taattcagct ccgccatcgc cgcttccact
4620ttttcccgcg ttttcgcaga aacgtggctg gcctggttca ccacgcggga aacggtctga
4680taagagacac cggcatactc tgcgacatcg tataacgtta ctggtttcac attcaccacc
4740ctgaattgac tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcgccattcg
4800atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga agcagcccag
4860tagtaggttg aggccgttga gcaccgccgc cgcaaggaat ggtgcatgca aggagatggc
4920gcccaacagt cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat
4980gagcccgaag tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc
5040aaccgcacct gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatcgagat
5100ctcgatcccg cgaaattaat acgactcact ataggggaat tgtgagcgga taacaattcc
5160cctctagaaa taattttgtt taactttaag aaggagatat acatatg atg gca aag
5216 Met Ala Lys
1gtc ctg tgc gtt ctt tac gat
gat ccg gtc gac ggc tac ccg aag acc 5264Val Leu Cys Val Leu Tyr Asp
Asp Pro Val Asp Gly Tyr Pro Lys Thr 5 10
15tat gcc cgc gac gat ctt ccg aag atc gac cac tat ccg ggc ggc cag
5312Tyr Ala Arg Asp Asp Leu Pro Lys Ile Asp His Tyr Pro Gly Gly Gln20
25 30 35atc ttg ccg acg
ccg aag gcc atc gac ttc acg ccc ggg cag ttg ctc 5360Ile Leu Pro Thr
Pro Lys Ala Ile Asp Phe Thr Pro Gly Gln Leu Leu 40
45 50ggc tcc gtc tcc ggc gag ctc ggc ctg cgc
gaa tat ctc gaa tcc aac 5408Gly Ser Val Ser Gly Glu Leu Gly Leu Arg
Glu Tyr Leu Glu Ser Asn 55 60
65ggc cac acc ctg gtc gtg acc tcc gac aag gac ggc ccc gac tcg gtg
5456Gly His Thr Leu Val Val Thr Ser Asp Lys Asp Gly Pro Asp Ser Val
70 75 80ttc gag cgc gag ctg gtc gat
gcg gat gtc gtc atc tcc cag ccc ttc 5504Phe Glu Arg Glu Leu Val Asp
Ala Asp Val Val Ile Ser Gln Pro Phe 85 90
95tgg ccg gcc tat ctg acg ccc gag cgc atc gcc aag gcc aag aac ctg
5552Trp Pro Ala Tyr Leu Thr Pro Glu Arg Ile Ala Lys Ala Lys Asn Leu100
105 110 115aag ctc gcg ctc
acc gcc ggc atc ggt tcc gac cac gtc gat ctt cag 5600Lys Leu Ala Leu
Thr Ala Gly Ile Gly Ser Asp His Val Asp Leu Gln 120
125 130tcg gct atc gac cgc aac gtc acc gtg gcg
gaa gtc acc tac tgc aac 5648Ser Ala Ile Asp Arg Asn Val Thr Val Ala
Glu Val Thr Tyr Cys Asn 135 140
145tcg atc agc gtc gcc gag cat gtg gtg atg atg atc ctg tcg ctg gtg
5696Ser Ile Ser Val Ala Glu His Val Val Met Met Ile Leu Ser Leu Val
150 155 160cgc aac tat ctg ccc tcg cac
gaa tgg gcg cgg aag ggc ggc tgg aac 5744Arg Asn Tyr Leu Pro Ser His
Glu Trp Ala Arg Lys Gly Gly Trp Asn 165 170
175atc gcc gac tgc gtc tcc cac gcc tac gac ctc gag gcg atg cat gtc
5792Ile Ala Asp Cys Val Ser His Ala Tyr Asp Leu Glu Ala Met His Val180
185 190 195ggc acc gtg gcc
gcc ggc cgc atc ggt ctc gcg gtg ctg cgc cgt ctg 5840Gly Thr Val Ala
Ala Gly Arg Ile Gly Leu Ala Val Leu Arg Arg Leu 200
205 210gcg ccg ttc gac gtg cac ctg cac tac acc
ggc cgt cac cgc ctg ccg 5888Ala Pro Phe Asp Val His Leu His Tyr Thr
Gly Arg His Arg Leu Pro 215 220
225gaa tcg gtc gag aag gag ctc aac ctc acc tgg cac gcg acc cgc gag
5936Glu Ser Val Glu Lys Glu Leu Asn Leu Thr Trp His Ala Thr Arg Glu
230 235 240gac atg tat ccg gtt tgc gac
gtg gtg acg ctg aac tgc ccg ctg cac 5984Asp Met Tyr Pro Val Cys Asp
Val Val Thr Leu Asn Cys Pro Leu His 245 250
255ccc gaa acc gag cac atg atc aat gac gag acg ctg aag ctg ttc aag
6032Pro Glu Thr Glu His Met Ile Asn Asp Glu Thr Leu Lys Leu Phe Lys260
265 270 275cgt ggc gcc tac
atc gtc aac acc gcc cgc ggc aag ctg tgc gac cgc 6080Arg Gly Ala Tyr
Ile Val Asn Thr Ala Arg Gly Lys Leu Cys Asp Arg 280
285 290gat gcc gtg gca cgt gcg ctc gaa tcc ggc
cgg ctg gcc ggc tat gcc 6128Asp Ala Val Ala Arg Ala Leu Glu Ser Gly
Arg Leu Ala Gly Tyr Ala 295 300
305ggc gac gtg tgg ttc ccg cag ccg gcg ccg aag gac cac ccc tgg cgg
6176Gly Asp Val Trp Phe Pro Gln Pro Ala Pro Lys Asp His Pro Trp Arg
310 315 320acg atg ccc tat aac ggc atg
acc ccg cac atc tcc ggc acc acg ctg 6224Thr Met Pro Tyr Asn Gly Met
Thr Pro His Ile Ser Gly Thr Thr Leu 325 330
335acc gcg cag gcg cgt tat gcg gcg ggc acc cgc gag atc ctg gag tgc
6272Thr Ala Gln Ala Arg Tyr Ala Ala Gly Thr Arg Glu Ile Leu Glu Cys340
345 350 355ttc ttc gag ggc
cgt ccg atc cgc gac gaa tac ctc atc gtg cag ggc 6320Phe Phe Glu Gly
Arg Pro Ile Arg Asp Glu Tyr Leu Ile Val Gln Gly 360
365 370ggc gct ctt gcc ggc acc ggc gcg cat tcc
tac tcg aag ggc aat gcc 6368Gly Ala Leu Ala Gly Thr Gly Ala His Ser
Tyr Ser Lys Gly Asn Ala 375 380
385acc ggc ggt tcg gaa gag gcc gcc aag ttc aag aag gcg gct gag aat
6416Thr Gly Gly Ser Glu Glu Ala Ala Lys Phe Lys Lys Ala Ala Glu Asn
390 395 400tcg tga aaggagatat ac atg aac
ctg agg gag aag tac ggt gag tgg ggc 6467Ser Met Asn
Leu Arg Glu Lys Tyr Gly Glu Trp Gly 405
410 415ctg atc ctg ggc gcg acc gag ggc gtc ggc aag gcg
ttc tgc gag aag 6515Leu Ile Leu Gly Ala Thr Glu Gly Val Gly Lys Ala
Phe Cys Glu Lys 420 425
430atc gcc gcc ggc ggc atg aac gtc gtc atg gtc ggc cgt cgc gag gag
6563Ile Ala Ala Gly Gly Met Asn Val Val Met Val Gly Arg Arg Glu Glu
435 440 445aag ctg aac gtg ctc gca
ggc gag atc cgc gag acc tac ggc gtg gag 6611Lys Leu Asn Val Leu Ala
Gly Glu Ile Arg Glu Thr Tyr Gly Val Glu 450 455
460acc aag gtc gtg cgc gcc gac ttt agc cag ccc ggc gct gcc
gag acc 6659Thr Lys Val Val Arg Ala Asp Phe Ser Gln Pro Gly Ala Ala
Glu Thr 465 470 475gtc ttc gcc gcg acc
gag ggc ctg gac atg ggc ttc atg agc tac gtg 6707Val Phe Ala Ala Thr
Glu Gly Leu Asp Met Gly Phe Met Ser Tyr Val480 485
490 495gcc tgc ctg cac agc ttc ggt aag atc cag
gac acc ccc tgg gag aag 6755Ala Cys Leu His Ser Phe Gly Lys Ile Gln
Asp Thr Pro Trp Glu Lys 500 505
510cac gag gcc atg atc aac gtc aac gtc gtg acc ttc ctc aag tgc ttc
6803His Glu Ala Met Ile Asn Val Asn Val Val Thr Phe Leu Lys Cys Phe
515 520 525cac cac tac atg cgg atc
ttt gcc gcc cag gac cgc ggc gcc gtg atc 6851His His Tyr Met Arg Ile
Phe Ala Ala Gln Asp Arg Gly Ala Val Ile 530 535
540aac gtc tcg tcg atg acc ggc atc agc tcc agc ccc tgg aac
ggc cag 6899Asn Val Ser Ser Met Thr Gly Ile Ser Ser Ser Pro Trp Asn
Gly Gln 545 550 555tac ggc gcg ggc aag
gcc ttc atc ctc aag atg acc gag gcc gtg gcc 6947Tyr Gly Ala Gly Lys
Ala Phe Ile Leu Lys Met Thr Glu Ala Val Ala560 565
570 575tgc gag tgc gag ggc acc ggc gtc gac gtc
gag gtc atc acc ctc ggc 6995Cys Glu Cys Glu Gly Thr Gly Val Asp Val
Glu Val Ile Thr Leu Gly 580 585
590acc acc cta acc ccc agc ctg ctg tcc aac ctc ccc ggc ggc ccg cag
7043Thr Thr Leu Thr Pro Ser Leu Leu Ser Asn Leu Pro Gly Gly Pro Gln
595 600 605ggc gag gcc gtc atg aag
atc gcc ctc acc ccc gag gag tgc gtt gac 7091Gly Glu Ala Val Met Lys
Ile Ala Leu Thr Pro Glu Glu Cys Val Asp 610 615
620gag gcc ttt gag aag ctg ggt aag gag ctc tcc gtc atc gcc
ggc cag 7139Glu Ala Phe Glu Lys Leu Gly Lys Glu Leu Ser Val Ile Ala
Gly Gln 625 630 635cgc aac aag gac tcc
gtc cac gac tgg aag gca aac cac acc gag gac 7187Arg Asn Lys Asp Ser
Val His Asp Trp Lys Ala Asn His Thr Glu Asp640 645
650 655gag tac atc cgc tac atg ggg tcg ttc tac
cgc gac tag aagcttgcgg 7236Glu Tyr Ile Arg Tyr Met Gly Ser Phe Tyr
Arg Asp 660 665ccgcactcga gcaccaccac
caccaccact gagatccggc tgctaacaaa gcccgaaagg 7296aagctgagtt ggctgctgcc
accgctgagc aataactagc ataacccctt ggggcctcta 7356aacgggtctt gaggggtttt
ttgctgaaag gaggaactat atccggat 740419404PRTArtificial
SequenceDescription of Artificial Sequence Synthetic construct
polypeptide 19Met Ala Lys Val Leu Cys Val Leu Tyr Asp Asp Pro Val Asp Gly
Tyr1 5 10 15Pro Lys Thr
Tyr Ala Arg Asp Asp Leu Pro Lys Ile Asp His Tyr Pro 20
25 30Gly Gly Gln Ile Leu Pro Thr Pro Lys Ala
Ile Asp Phe Thr Pro Gly 35 40
45Gln Leu Leu Gly Ser Val Ser Gly Glu Leu Gly Leu Arg Glu Tyr Leu 50
55 60Glu Ser Asn Gly His Thr Leu Val Val
Thr Ser Asp Lys Asp Gly Pro65 70 75
80Asp Ser Val Phe Glu Arg Glu Leu Val Asp Ala Asp Val Val
Ile Ser 85 90 95Gln Pro
Phe Trp Pro Ala Tyr Leu Thr Pro Glu Arg Ile Ala Lys Ala 100
105 110Lys Asn Leu Lys Leu Ala Leu Thr Ala
Gly Ile Gly Ser Asp His Val 115 120
125Asp Leu Gln Ser Ala Ile Asp Arg Asn Val Thr Val Ala Glu Val Thr
130 135 140Tyr Cys Asn Ser Ile Ser Val
Ala Glu His Val Val Met Met Ile Leu145 150
155 160Ser Leu Val Arg Asn Tyr Leu Pro Ser His Glu Trp
Ala Arg Lys Gly 165 170
175Gly Trp Asn Ile Ala Asp Cys Val Ser His Ala Tyr Asp Leu Glu Ala
180 185 190Met His Val Gly Thr Val
Ala Ala Gly Arg Ile Gly Leu Ala Val Leu 195 200
205Arg Arg Leu Ala Pro Phe Asp Val His Leu His Tyr Thr Gly
Arg His 210 215 220Arg Leu Pro Glu Ser
Val Glu Lys Glu Leu Asn Leu Thr Trp His Ala225 230
235 240Thr Arg Glu Asp Met Tyr Pro Val Cys Asp
Val Val Thr Leu Asn Cys 245 250
255Pro Leu His Pro Glu Thr Glu His Met Ile Asn Asp Glu Thr Leu Lys
260 265 270Leu Phe Lys Arg Gly
Ala Tyr Ile Val Asn Thr Ala Arg Gly Lys Leu 275
280 285Cys Asp Arg Asp Ala Val Ala Arg Ala Leu Glu Ser
Gly Arg Leu Ala 290 295 300Gly Tyr Ala
Gly Asp Val Trp Phe Pro Gln Pro Ala Pro Lys Asp His305
310 315 320Pro Trp Arg Thr Met Pro Tyr
Asn Gly Met Thr Pro His Ile Ser Gly 325
330 335Thr Thr Leu Thr Ala Gln Ala Arg Tyr Ala Ala Gly
Thr Arg Glu Ile 340 345 350Leu
Glu Cys Phe Phe Glu Gly Arg Pro Ile Arg Asp Glu Tyr Leu Ile 355
360 365Val Gln Gly Gly Ala Leu Ala Gly Thr
Gly Ala His Ser Tyr Ser Lys 370 375
380Gly Asn Ala Thr Gly Gly Ser Glu Glu Ala Ala Lys Phe Lys Lys Ala385
390 395 400Ala Glu Asn
Ser20263PRTArtificial SequenceDescription of Artificial Sequence
Synthetic construct polypeptide 20Met Asn Leu Arg Glu Lys Tyr Gly
Glu Trp Gly Leu Ile Leu Gly Ala1 5 10
15Thr Glu Gly Val Gly Lys Ala Phe Cys Glu Lys Ile Ala Ala
Gly Gly 20 25 30Met Asn Val
Val Met Val Gly Arg Arg Glu Glu Lys Leu Asn Val Leu 35
40 45Ala Gly Glu Ile Arg Glu Thr Tyr Gly Val Glu
Thr Lys Val Val Arg 50 55 60Ala Asp
Phe Ser Gln Pro Gly Ala Ala Glu Thr Val Phe Ala Ala Thr65
70 75 80Glu Gly Leu Asp Met Gly Phe
Met Ser Tyr Val Ala Cys Leu His Ser 85 90
95Phe Gly Lys Ile Gln Asp Thr Pro Trp Glu Lys His Glu
Ala Met Ile 100 105 110Asn Val
Asn Val Val Thr Phe Leu Lys Cys Phe His His Tyr Met Arg 115
120 125Ile Phe Ala Ala Gln Asp Arg Gly Ala Val
Ile Asn Val Ser Ser Met 130 135 140Thr
Gly Ile Ser Ser Ser Pro Trp Asn Gly Gln Tyr Gly Ala Gly Lys145
150 155 160Ala Phe Ile Leu Lys Met
Thr Glu Ala Val Ala Cys Glu Cys Glu Gly 165
170 175Thr Gly Val Asp Val Glu Val Ile Thr Leu Gly Thr
Thr Leu Thr Pro 180 185 190Ser
Leu Leu Ser Asn Leu Pro Gly Gly Pro Gln Gly Glu Ala Val Met 195
200 205Lys Ile Ala Leu Thr Pro Glu Glu Cys
Val Asp Glu Ala Phe Glu Lys 210 215
220Leu Gly Lys Glu Leu Ser Val Ile Ala Gly Gln Arg Asn Lys Asp Ser225
230 235 240Val His Asp Trp
Lys Ala Asn His Thr Glu Asp Glu Tyr Ile Arg Tyr 245
250 255Met Gly Ser Phe Tyr Arg Asp
260214302DNAArtificial SequenceDescription of Artificial Sequence
Synthetic plasmid pCOLA(mod) 3alpha-HSDH
polynucleotideCDS(303)..(1076)3alpha-HSDH 21ggggaattgt gagcggataa
caattcccct gtagaaataa ttttgtttaa ctttaataag 60gagatatacc atgggcagca
gccatcacca tcatcaccac agccaggatc cgaattcgag 120ctcggcgcgc ctgcaggtcg
acaagcttgc ggccgcataa tgcttaagtc gaacagaaag 180taatcgtatt gtacacggcc
gcataatcga aattaatacg actcactata ggggaattgt 240gagcggataa caattcccca
tcttagtata ttagttaagt ataagaagga gatatacata 300tg atg tcc atc atc gtg
ata agc ggc tgc gcc acc ggc att ggt gcc 347 Met Ser Ile Ile Val
Ile Ser Gly Cys Ala Thr Gly Ile Gly Ala 1 5
10 15gct acg cgc aag gtc ctg gag gcg gcc ggt cac cag
atc gta ggc atc 395Ala Thr Arg Lys Val Leu Glu Ala Ala Gly His Gln
Ile Val Gly Ile 20 25
30gat ata cgc gat gcg gaa gtg att gcc gat ctc tcg acg gcc gaa ggt
443Asp Ile Arg Asp Ala Glu Val Ile Ala Asp Leu Ser Thr Ala Glu Gly
35 40 45cga aag cag gcg att gcc gat
gta ctg gcg aag tgc agc aag ggc atg 491Arg Lys Gln Ala Ile Ala Asp
Val Leu Ala Lys Cys Ser Lys Gly Met 50 55
60gac ggc ctg gtg ctg tgc gcc ggc ctg gga ccg cag acc aag gtg
ctt 539Asp Gly Leu Val Leu Cys Ala Gly Leu Gly Pro Gln Thr Lys Val
Leu 65 70 75ggc aat gtg gtt tcg gtc
aat tat ttt ggc gcg acc gag ctg atg gat 587Gly Asn Val Val Ser Val
Asn Tyr Phe Gly Ala Thr Glu Leu Met Asp80 85
90 95gcc ttt ttg cca gcg ctg aaa aaa ggc cat cag
ccc gca gcc gtc gtc 635Ala Phe Leu Pro Ala Leu Lys Lys Gly His Gln
Pro Ala Ala Val Val 100 105
110atc tcg tcc gtg gct tcc gcg cat ctg gct ttt gac aag aac cca ctg
683Ile Ser Ser Val Ala Ser Ala His Leu Ala Phe Asp Lys Asn Pro Leu
115 120 125gcg ctg gca ctg gaa gcc
ggc gag gaa gcc aag gcc cgc gcc att gtc 731Ala Leu Ala Leu Glu Ala
Gly Glu Glu Ala Lys Ala Arg Ala Ile Val 130 135
140gaa cat gcg gga gag cag ggc gga aat ctg gcc tat gcg ggc
agc aag 779Glu His Ala Gly Glu Gln Gly Gly Asn Leu Ala Tyr Ala Gly
Ser Lys 145 150 155aat gct ttg acg gtg
gct gtg cgc aaa cgc gcc gcc gcc tgg ggc gag 827Asn Ala Leu Thr Val
Ala Val Arg Lys Arg Ala Ala Ala Trp Gly Glu160 165
170 175gct ggc gtg cgc ctg aac acc atc gcc ccc
ggt gca acc gag act ccc 875Ala Gly Val Arg Leu Asn Thr Ile Ala Pro
Gly Ala Thr Glu Thr Pro 180 185
190ttg ctg cag gcg ggc ctg cag gac ccg cgc tat ggc gaa tcc att gcc
923Leu Leu Gln Ala Gly Leu Gln Asp Pro Arg Tyr Gly Glu Ser Ile Ala
195 200 205aag ttc gtt cct ccc atg
ggc cgc cgt gcc gag ccg tcc gag atg gcg 971Lys Phe Val Pro Pro Met
Gly Arg Arg Ala Glu Pro Ser Glu Met Ala 210 215
220tcg gtc atc gcc ttt ttg atg agc ccg gcc gca agc tat gtg
cat ggc 1019Ser Val Ile Ala Phe Leu Met Ser Pro Ala Ala Ser Tyr Val
His Gly 225 230 235gcg cag atc gtc att
gat ggc ggc att gat gcg gtg atg cgc ccg aca 1067Ala Gln Ile Val Ile
Asp Gly Gly Ile Asp Ala Val Met Arg Pro Thr240 245
250 255cag ttc tga gaattcgagc tccgtcgaca
agcttgcggc cgcactcgag 1116Gln Phecaccaccacc accaccactg
agatccggct gctaacaaag cccgaaagga agctgagttg 1176gctgctgcca ccgctgagca
ataactagca taaccccttg gggcctctaa acgggtcttg 1236aggggttttt tgctgaaacc
tcaggcattt gagaagcaca cggtcacact gcttccggta 1296gtcaataaac cggtaaacca
gcaatagaca taagcggcta tttaacgacc ctgccctgaa 1356ccgacgacaa gctgacgacc
gggtctccgc aagtggcact tttcggggaa atgtgcgcgg 1416aacccctatt tgtttatttt
tctaaataca ttcaaatatg tatccgctca tgaattaatt 1476cttacgcccc gccctgccac
tcatcgcagt actgttgtaa ttcattaagc attctgccga 1536catggaagcc atcacagacg
gcatgatgaa cctgaatcgc cagcggcatc agcaccttgt 1596cgccttgcgt ataatatttg
cctatggtga aaacgggggc gaagaagttg tccatattgg 1656ccacgtttaa atcaaaactg
gtgaaactca cccagggatt ggctgagacg aaaaacatat 1716tctcaataaa ccctttaggg
aaataggcca ggttttcacc gtaacacgcc acatcttgcg 1776aatatatgtg tagaaactgc
cggaaatcgt cgtggtattc actccagagc gatgaaaacg 1836tttcagtttg ctcatggaaa
acggtgtaac aagggtgaac actatcccat atcaccagct 1896caccgtcttt cattgccata
cggaattccg gatgagcatt catcaggcgg gcaagaatgt 1956gaataaaggc cggataaaac
ttgtgcttat ttttctttac ggtctttaaa aaggccgtaa 2016tatccagctg aacggtctgg
ttataggtac attgagcaac tgactgaaat gcctcaaaat 2076gttctttacg atgccattgg
gatatatcaa cggtggtata tccagtgatt tttttctcca 2136tactcttcct ttttcaatat
tattgaagca tttatcaggg ttattgtctc atgagcggat 2196acatatttga atgtatttag
aaaaataaac aaataggcat gctagcgcag aaacgtccta 2256gaagatgcca ggaggatact
tagcagagag acaataaggc cggagcgaag ccgtttttcc 2316ataggctccg cccccctgac
gaacatcacg aaatctgacg ctcaaatcag tggtggcgaa 2376acccgacagg actataaaga
taccaggcgt ttccccctga tggctccctc ttgcgctctc 2436ctgttcccgt cctgcggcgt
ccgtgttgtg gtggaggctt tacccaaatc accacgtccc 2496gttccgtgta gacagttcgc
tccaagctgg gctgtgtgca agaacccccc gttcagcccg 2556actgctgcgc cttatccggt
aactatcatc ttgagtccaa cccggaaaga cacgacaaaa 2616cgccactggc agcagccatt
ggtaactgag aattagtgga tttagatatc gagagtcttg 2676aagtggtggc ctaacagagg
ctacactgaa aggacagtat ttggtatctg cgctccacta 2736aagccagtta ccaggttaag
cagttcccca actgacttaa ccttcgatca aaccgcctcc 2796ccaggcggtt ttttcgttta
cagagcagga gattacgacg atcgtaaaag gatctcaaga 2856agatccttta cggattcccg
acaccatcac tctagatttc agtgcaattt atctcttcaa 2916atgtagcacc tgaagtcagc
cccatacgat ataagttgta attctcatgt tagtcatgcc 2976ccgcgcccac cggaaggagc
tgactgggtt gaaggctctc aagggcatcg gtcgagatcc 3036cggtgcctaa tgagtgagct
aacttacatt aattgcgttg cgctcactgc ccgctttcca 3096gtcgggaaac ctgtcgtgcc
agctgcatta atgaatcggc caacgcgcgg ggagaggcgg 3156tttgcgtatt gggcgccagg
gtggtttttc ttttcaccag tgagacgggc aacagctgat 3216tgcccttcac cgcctggccc
tgagagagtt gcagcaagcg gtccacgctg gtttgcccca 3276gcaggcgaaa atcctgtttg
atggtggtta acggcgggat ataacatgag ctgtcttcgg 3336tatcgtcgta tcccactacc
gagatgtccg caccaacgcg cagcccggac tcggtaatgg 3396cgcgcattgc gcccagcgcc
atctgatcgt tggcaaccag catcgcagtg ggaacgatgc 3456cctcattcag catttgcatg
gtttgttgaa aaccggacat ggcactccag tcgccttccc 3516gttccgctat cggctgaatt
tgattgcgag tgagatattt atgccagcca gccagacgca 3576gacgcgccga gacagaactt
aatgggcccg ctaacagcgc gatttgctgg tgacccaatg 3636cgaccagatg ctccacgccc
agtcgcgtac cgtcttcatg ggagaaaata atactgttga 3696tgggtgtctg gtcagagaca
tcaagaaata acgccggaac attagtgcag gcagcttcca 3756cagcaatggc atcctggtca
tccagcggat agttaatgat cagcccactg acgcgttgcg 3816cgagaagatt gtgcaccgcc
gctttacagg cttcgacgcc gcttcgttct accatcgaca 3876ccaccacgct ggcacccagt
tgatcggcgc gagatttaat cgccgcgaca atttgcgacg 3936gcgcgtgcag ggccagactg
gaggtggcaa cgccaatcag caacgactgt ttgcccgcca 3996gttgttgtgc cacgcggttg
ggaatgtaat tcagctccgc catcgccgct tccacttttt 4056cccgcgtttt cgcagaaacg
tggctggcct ggttcaccac gcgggaaacg gtctgataag 4116agacaccggc atactctgcg
acatcgtata acgttactgg tttcacattc accaccctga 4176attgactctc ttccgggcgc
tatcatgcca taccgcgaaa ggttttgcgc cattcgatgg 4236tgtccgggat ctcgacgctc
tcccttatgc gactcctgca ttaggaaatt aatacgactc 4296actata
430222257PRTArtificial
SequenceDescription of Artificial Sequence Synthetic construct
polypeptide 22Met Ser Ile Ile Val Ile Ser Gly Cys Ala Thr Gly Ile Gly Ala
Ala1 5 10 15Thr Arg Lys
Val Leu Glu Ala Ala Gly His Gln Ile Val Gly Ile Asp 20
25 30Ile Arg Asp Ala Glu Val Ile Ala Asp Leu
Ser Thr Ala Glu Gly Arg 35 40
45Lys Gln Ala Ile Ala Asp Val Leu Ala Lys Cys Ser Lys Gly Met Asp 50
55 60Gly Leu Val Leu Cys Ala Gly Leu Gly
Pro Gln Thr Lys Val Leu Gly65 70 75
80Asn Val Val Ser Val Asn Tyr Phe Gly Ala Thr Glu Leu Met
Asp Ala 85 90 95Phe Leu
Pro Ala Leu Lys Lys Gly His Gln Pro Ala Ala Val Val Ile 100
105 110Ser Ser Val Ala Ser Ala His Leu Ala
Phe Asp Lys Asn Pro Leu Ala 115 120
125Leu Ala Leu Glu Ala Gly Glu Glu Ala Lys Ala Arg Ala Ile Val Glu
130 135 140His Ala Gly Glu Gln Gly Gly
Asn Leu Ala Tyr Ala Gly Ser Lys Asn145 150
155 160Ala Leu Thr Val Ala Val Arg Lys Arg Ala Ala Ala
Trp Gly Glu Ala 165 170
175Gly Val Arg Leu Asn Thr Ile Ala Pro Gly Ala Thr Glu Thr Pro Leu
180 185 190Leu Gln Ala Gly Leu Gln
Asp Pro Arg Tyr Gly Glu Ser Ile Ala Lys 195 200
205Phe Val Pro Pro Met Gly Arg Arg Ala Glu Pro Ser Glu Met
Ala Ser 210 215 220Val Ile Ala Phe Leu
Met Ser Pro Ala Ala Ser Tyr Val His Gly Ala225 230
235 240Gln Ile Val Ile Asp Gly Gly Ile Asp Ala
Val Met Arg Pro Thr Gln 245 250
255Phe2329DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 23cgatcatatg gcaaaggtcc tgtgcgttc
292429DNAArtificial SequenceDescription of
Artificial Sequence Synthetic PCR primer 24gctagaattc tcagccgcct
tcttgaact 2925768DNAEscherichia
coliCDS(1)..(765) 25gtg ttt aat tct gac aac ctg aga ctc gac gga aaa tgc
gcc atc atc 48Val Phe Asn Ser Asp Asn Leu Arg Leu Asp Gly Lys Cys
Ala Ile Ile1 5 10 15aca
ggt gcg ggt gca ggt att ggt aaa gaa atc gcc att aca ttc gcg 96Thr
Gly Ala Gly Ala Gly Ile Gly Lys Glu Ile Ala Ile Thr Phe Ala 20
25 30aca gct ggc gca tct gtg gtg gtc
agt gat att aac gcc gac gca gct 144Thr Ala Gly Ala Ser Val Val Val
Ser Asp Ile Asn Ala Asp Ala Ala 35 40
45aac cat gtt gta gac gaa att caa caa ctg ggt ggt cag gca ttt gcc
192Asn His Val Val Asp Glu Ile Gln Gln Leu Gly Gly Gln Ala Phe Ala
50 55 60tgc cgt tgt gat att act tcc gaa
cag gaa ctc tct gca ctg gca gac 240Cys Arg Cys Asp Ile Thr Ser Glu
Gln Glu Leu Ser Ala Leu Ala Asp65 70 75
80ttt gct atc agt aag ctg ggt aaa gtt gat att ctg gtt
aac aac gcc 288Phe Ala Ile Ser Lys Leu Gly Lys Val Asp Ile Leu Val
Asn Asn Ala 85 90 95ggt
ggc ggt gga cct aaa ccg ttt gat atg cca atg gcg gat ttt cgc 336Gly
Gly Gly Gly Pro Lys Pro Phe Asp Met Pro Met Ala Asp Phe Arg
100 105 110cgt gct tat gaa ctg aat gtg
ttt tct ttt ttc cat ctg tca caa ctt 384Arg Ala Tyr Glu Leu Asn Val
Phe Ser Phe Phe His Leu Ser Gln Leu 115 120
125gtt gcg cca gaa atg gaa aaa aat ggc ggt ggc gtt att ctg acc
atc 432Val Ala Pro Glu Met Glu Lys Asn Gly Gly Gly Val Ile Leu Thr
Ile 130 135 140act tct atg gcg gca gaa
aat aaa aat ata aac atg act tcc tat gca 480Thr Ser Met Ala Ala Glu
Asn Lys Asn Ile Asn Met Thr Ser Tyr Ala145 150
155 160tca tct aaa gct gcg gcc agt cat ctg gtc aga
aat atg gcg ttt gac 528Ser Ser Lys Ala Ala Ala Ser His Leu Val Arg
Asn Met Ala Phe Asp 165 170
175cta ggt gaa aaa aat att cgg gta aat ggc att gcg ccg ggg gca ata
576Leu Gly Glu Lys Asn Ile Arg Val Asn Gly Ile Ala Pro Gly Ala Ile
180 185 190tta acc gat gcc ctg aaa
tcc gtt att aca cca gaa att gaa caa aaa 624Leu Thr Asp Ala Leu Lys
Ser Val Ile Thr Pro Glu Ile Glu Gln Lys 195 200
205atg tta cag cac acg ccg atc aga cgt ctg ggc caa ccg caa
gat att 672Met Leu Gln His Thr Pro Ile Arg Arg Leu Gly Gln Pro Gln
Asp Ile 210 215 220gct aac gca gcg ctg
ttc ctt tgc tcg cct gct gcg agc tgg gta agc 720Ala Asn Ala Ala Leu
Phe Leu Cys Ser Pro Ala Ala Ser Trp Val Ser225 230
235 240gga caa att ctc acc gtc tcc ggt ggt ggg
gta cag gag ctc aat taa 768Gly Gln Ile Leu Thr Val Ser Gly Gly Gly
Val Gln Glu Leu Asn 245 250
25526255PRTEscherichia coli 26Val Phe Asn Ser Asp Asn Leu Arg Leu Asp
Gly Lys Cys Ala Ile Ile1 5 10
15Thr Gly Ala Gly Ala Gly Ile Gly Lys Glu Ile Ala Ile Thr Phe Ala
20 25 30Thr Ala Gly Ala Ser Val
Val Val Ser Asp Ile Asn Ala Asp Ala Ala 35 40
45Asn His Val Val Asp Glu Ile Gln Gln Leu Gly Gly Gln Ala
Phe Ala 50 55 60Cys Arg Cys Asp Ile
Thr Ser Glu Gln Glu Leu Ser Ala Leu Ala Asp65 70
75 80Phe Ala Ile Ser Lys Leu Gly Lys Val Asp
Ile Leu Val Asn Asn Ala 85 90
95Gly Gly Gly Gly Pro Lys Pro Phe Asp Met Pro Met Ala Asp Phe Arg
100 105 110Arg Ala Tyr Glu Leu
Asn Val Phe Ser Phe Phe His Leu Ser Gln Leu 115
120 125Val Ala Pro Glu Met Glu Lys Asn Gly Gly Gly Val
Ile Leu Thr Ile 130 135 140Thr Ser Met
Ala Ala Glu Asn Lys Asn Ile Asn Met Thr Ser Tyr Ala145
150 155 160Ser Ser Lys Ala Ala Ala Ser
His Leu Val Arg Asn Met Ala Phe Asp 165
170 175Leu Gly Glu Lys Asn Ile Arg Val Asn Gly Ile Ala
Pro Gly Ala Ile 180 185 190Leu
Thr Asp Ala Leu Lys Ser Val Ile Thr Pro Glu Ile Glu Gln Lys 195
200 205Met Leu Gln His Thr Pro Ile Arg Arg
Leu Gly Gln Pro Gln Asp Ile 210 215
220Ala Asn Ala Ala Leu Phe Leu Cys Ser Pro Ala Ala Ser Trp Val Ser225
230 235 240Gly Gln Ile Leu
Thr Val Ser Gly Gly Gly Val Gln Glu Leu Asn 245
250 2552753DNAArtificial SequenceDescription of
Artificial Sequence Synthetic PCR primer 27aaaaaagctt ataattatcc
ttataggacg tcatggtgcg cccagatagg gtg 532860DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
28cagattgtac aaatgtggtg ataacagata agtcgtcatg tttaacttac ctttctttgt
602949DNAArtificial SequenceDescription of Artificial Sequence Synthetic
PCR primer 29tgaacgcaag tttctaattt cggtttccta tcgatagagg aaagtgtct
493029DNAArtificial SequenceDescription of Artificial
Sequence Synthetic PCR primer 30cctgcactac accggccgtc accgcctgc
293123DNAArtificial SequenceDescription
of Artificial Sequence Synthetic PCR primer 31gctcgaattc tcagaccgcc
ttc 233227DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
32ttaattgagc tcctgtaccc caccacc
273330DNAArtificial SequenceDescription of Artificial Sequence Synthetic
PCR primer 33gtgtttaatt ctgacaacct gagactcgac
30341266DNAArtificial SequenceDescription of Artificial
Sequence Synthetic FDH D221G mutant with His-tag
polynucleotideCDS(1)..(1263) 34atg gca aag gtc ctg tgc gtt ctt tac gat
gat ccg gtc gac ggc tac 48Met Ala Lys Val Leu Cys Val Leu Tyr Asp
Asp Pro Val Asp Gly Tyr1 5 10
15ccg aag acc tat gcc cgc gac gat ctt ccg aag atc gac cac tat ccg
96Pro Lys Thr Tyr Ala Arg Asp Asp Leu Pro Lys Ile Asp His Tyr Pro
20 25 30ggc ggc cag atc ttg ccg
acg ccg aag gcc atc gac ttc acg ccc ggg 144Gly Gly Gln Ile Leu Pro
Thr Pro Lys Ala Ile Asp Phe Thr Pro Gly 35 40
45cag ttg ctc ggc tcc gtc tcc ggc gag ctc ggc ctg cgc gaa
tat ctc 192Gln Leu Leu Gly Ser Val Ser Gly Glu Leu Gly Leu Arg Glu
Tyr Leu 50 55 60gaa tcc aac ggc cac
acc ctg gtc gtg acc tcc gac aag gac ggc ccc 240Glu Ser Asn Gly His
Thr Leu Val Val Thr Ser Asp Lys Asp Gly Pro65 70
75 80gac tcg gtg ttc gag cgc gag ctg gtc gat
gcg gat gtc gtc atc tcc 288Asp Ser Val Phe Glu Arg Glu Leu Val Asp
Ala Asp Val Val Ile Ser 85 90
95cag ccc ttc tgg ccg gcc tat ctg acg ccc gag cgc atc gcc aag gcc
336Gln Pro Phe Trp Pro Ala Tyr Leu Thr Pro Glu Arg Ile Ala Lys Ala
100 105 110aag aac ctg aag ctc gcg
ctc acc gcc ggc atc ggt tcc gac cac gtc 384Lys Asn Leu Lys Leu Ala
Leu Thr Ala Gly Ile Gly Ser Asp His Val 115 120
125gat ctt cag tcg gct atc gac cgc aac gtc acc gtg gcg gaa
gtc acc 432Asp Leu Gln Ser Ala Ile Asp Arg Asn Val Thr Val Ala Glu
Val Thr 130 135 140tac tgc aac tcg atc
agc gtc gcc gag cat gtg gtg atg atg atc ctg 480Tyr Cys Asn Ser Ile
Ser Val Ala Glu His Val Val Met Met Ile Leu145 150
155 160tcg ctg gtg cgc aac tat ctg ccc tcg cac
gaa tgg gcg cgg aag ggc 528Ser Leu Val Arg Asn Tyr Leu Pro Ser His
Glu Trp Ala Arg Lys Gly 165 170
175ggc tgg aac atc gcc gac tgc gtc tcc cac gcc tac gac ctc gag gcg
576Gly Trp Asn Ile Ala Asp Cys Val Ser His Ala Tyr Asp Leu Glu Ala
180 185 190atg cat gtc ggc acc gtg
gcc gcc ggc cgc atc ggt ctc gcg gtg ctg 624Met His Val Gly Thr Val
Ala Ala Gly Arg Ile Gly Leu Ala Val Leu 195 200
205cgc cgt ctg gcg ccg ttc gac gtg cac ctg cac tac acc ggc
cgt cac 672Arg Arg Leu Ala Pro Phe Asp Val His Leu His Tyr Thr Gly
Arg His 210 215 220cgc ctg ccg gaa tcg
gtc gag aag gag ctc aac ctc acc tgg cac gcg 720Arg Leu Pro Glu Ser
Val Glu Lys Glu Leu Asn Leu Thr Trp His Ala225 230
235 240acc cgc gag gac atg tat ccg gtt tgc gac
gtg gtg acg ctg aac tgc 768Thr Arg Glu Asp Met Tyr Pro Val Cys Asp
Val Val Thr Leu Asn Cys 245 250
255ccg ctg cac ccc gaa acc gag cac atg atc aat gac gag acg ctg aag
816Pro Leu His Pro Glu Thr Glu His Met Ile Asn Asp Glu Thr Leu Lys
260 265 270ctg ttc aag cgt ggc gcc
tac atc gtc aac acc gcc cgc ggc aag ctg 864Leu Phe Lys Arg Gly Ala
Tyr Ile Val Asn Thr Ala Arg Gly Lys Leu 275 280
285tgc gac cgc gat gcc gtg gca cgt gcg ctc gaa tcc ggc cgg
ctg gcc 912Cys Asp Arg Asp Ala Val Ala Arg Ala Leu Glu Ser Gly Arg
Leu Ala 290 295 300ggc tat gcc ggc gac
gtg tgg ttc ccg cag ccg gcg ccg aag gac cac 960Gly Tyr Ala Gly Asp
Val Trp Phe Pro Gln Pro Ala Pro Lys Asp His305 310
315 320ccc tgg cgg acg atg ccc tat aac ggc atg
acc ccg cac atc tcc ggc 1008Pro Trp Arg Thr Met Pro Tyr Asn Gly Met
Thr Pro His Ile Ser Gly 325 330
335acc acg ctg acc gcg cag gcg cgt tat gcg gcg ggc acc cgc gag atc
1056Thr Thr Leu Thr Ala Gln Ala Arg Tyr Ala Ala Gly Thr Arg Glu Ile
340 345 350ctg gag tgc ttc ttc gag
ggc cgt ccg atc cgc gac gaa tac ctc atc 1104Leu Glu Cys Phe Phe Glu
Gly Arg Pro Ile Arg Asp Glu Tyr Leu Ile 355 360
365gtg cag ggc ggc gct ctt gcc ggc acc ggc gcg cat tcc tac
tcg aag 1152Val Gln Gly Gly Ala Leu Ala Gly Thr Gly Ala His Ser Tyr
Ser Lys 370 375 380ggc aat gcc acc ggc
ggt tcg gaa gag gcc gcc aag ttc aag aag gcg 1200Gly Asn Ala Thr Gly
Gly Ser Glu Glu Ala Ala Lys Phe Lys Lys Ala385 390
395 400gct gag aat tcg agc tcc gtc gac aag ctt
gcg gcc gca ctc gag cac 1248Ala Glu Asn Ser Ser Ser Val Asp Lys Leu
Ala Ala Ala Leu Glu His 405 410
415cac cac cac cac cac tga
1266His His His His His 42035421PRTArtificial
SequenceDescription of Artificial Sequence Synthetic construct
polypeptide 35Met Ala Lys Val Leu Cys Val Leu Tyr Asp Asp Pro Val Asp Gly
Tyr1 5 10 15Pro Lys Thr
Tyr Ala Arg Asp Asp Leu Pro Lys Ile Asp His Tyr Pro 20
25 30Gly Gly Gln Ile Leu Pro Thr Pro Lys Ala
Ile Asp Phe Thr Pro Gly 35 40
45Gln Leu Leu Gly Ser Val Ser Gly Glu Leu Gly Leu Arg Glu Tyr Leu 50
55 60Glu Ser Asn Gly His Thr Leu Val Val
Thr Ser Asp Lys Asp Gly Pro65 70 75
80Asp Ser Val Phe Glu Arg Glu Leu Val Asp Ala Asp Val Val
Ile Ser 85 90 95Gln Pro
Phe Trp Pro Ala Tyr Leu Thr Pro Glu Arg Ile Ala Lys Ala 100
105 110Lys Asn Leu Lys Leu Ala Leu Thr Ala
Gly Ile Gly Ser Asp His Val 115 120
125Asp Leu Gln Ser Ala Ile Asp Arg Asn Val Thr Val Ala Glu Val Thr
130 135 140Tyr Cys Asn Ser Ile Ser Val
Ala Glu His Val Val Met Met Ile Leu145 150
155 160Ser Leu Val Arg Asn Tyr Leu Pro Ser His Glu Trp
Ala Arg Lys Gly 165 170
175Gly Trp Asn Ile Ala Asp Cys Val Ser His Ala Tyr Asp Leu Glu Ala
180 185 190Met His Val Gly Thr Val
Ala Ala Gly Arg Ile Gly Leu Ala Val Leu 195 200
205Arg Arg Leu Ala Pro Phe Asp Val His Leu His Tyr Thr Gly
Arg His 210 215 220Arg Leu Pro Glu Ser
Val Glu Lys Glu Leu Asn Leu Thr Trp His Ala225 230
235 240Thr Arg Glu Asp Met Tyr Pro Val Cys Asp
Val Val Thr Leu Asn Cys 245 250
255Pro Leu His Pro Glu Thr Glu His Met Ile Asn Asp Glu Thr Leu Lys
260 265 270Leu Phe Lys Arg Gly
Ala Tyr Ile Val Asn Thr Ala Arg Gly Lys Leu 275
280 285Cys Asp Arg Asp Ala Val Ala Arg Ala Leu Glu Ser
Gly Arg Leu Ala 290 295 300Gly Tyr Ala
Gly Asp Val Trp Phe Pro Gln Pro Ala Pro Lys Asp His305
310 315 320Pro Trp Arg Thr Met Pro Tyr
Asn Gly Met Thr Pro His Ile Ser Gly 325
330 335Thr Thr Leu Thr Ala Gln Ala Arg Tyr Ala Ala Gly
Thr Arg Glu Ile 340 345 350Leu
Glu Cys Phe Phe Glu Gly Arg Pro Ile Arg Asp Glu Tyr Leu Ile 355
360 365Val Gln Gly Gly Ala Leu Ala Gly Thr
Gly Ala His Ser Tyr Ser Lys 370 375
380Gly Asn Ala Thr Gly Gly Ser Glu Glu Ala Ala Lys Phe Lys Lys Ala385
390 395 400Ala Glu Asn Ser
Ser Ser Val Asp Lys Leu Ala Ala Ala Leu Glu His 405
410 415His His His His His
42036401PRTMycobacterium vaccae 36Met Ala Lys Val Leu Cys Val Leu Tyr Asp
Asp Pro Val Asp Gly Tyr1 5 10
15Pro Lys Thr Tyr Ala Arg Asp Asp Leu Pro Lys Ile Asp His Tyr Pro
20 25 30Gly Gly Gln Ile Leu Pro
Thr Pro Lys Ala Ile Asp Phe Thr Pro Gly 35 40
45Gln Leu Leu Gly Ser Val Ser Gly Glu Leu Gly Leu Arg Glu
Tyr Leu 50 55 60Glu Ser Asn Gly His
Thr Leu Val Val Thr Ser Asp Lys Asp Gly Pro65 70
75 80Asp Ser Val Phe Glu Arg Glu Leu Val Asp
Ala Asp Val Val Ile Ser 85 90
95Gln Pro Phe Trp Pro Ala Tyr Leu Thr Pro Glu Arg Ile Ala Lys Ala
100 105 110Lys Asn Leu Lys Leu
Ala Leu Thr Ala Gly Ile Gly Ser Asp His Val 115
120 125Asp Leu Gln Ser Ala Ile Asp Arg Asn Val Thr Val
Ala Glu Val Thr 130 135 140Tyr Cys Asn
Ser Ile Ser Val Ala Glu His Val Val Met Met Ile Leu145
150 155 160Ser Leu Val Arg Asn Tyr Leu
Pro Ser His Glu Trp Ala Arg Lys Gly 165
170 175Gly Trp Asn Ile Ala Asp Cys Val Ser His Ala Tyr
Asp Leu Glu Ala 180 185 190Met
His Val Gly Thr Val Ala Ala Gly Arg Ile Gly Leu Ala Val Leu 195
200 205Arg Arg Leu Ala Pro Phe Asp Val His
Leu His Tyr Thr Asp Arg His 210 215
220Arg Leu Pro Glu Ser Val Glu Lys Glu Leu Asn Leu Thr Trp His Ala225
230 235 240Thr Arg Glu Asp
Met Tyr Pro Val Cys Asp Val Val Thr Leu Asn Cys 245
250 255Pro Leu His Pro Glu Thr Glu His Met Ile
Asn Asp Glu Thr Leu Lys 260 265
270Leu Phe Lys Arg Gly Ala Tyr Ile Val Asn Thr Ala Arg Gly Lys Leu
275 280 285Cys Asp Arg Asp Ala Val Ala
Arg Ala Leu Glu Ser Gly Arg Leu Ala 290 295
300Gly Tyr Ala Gly Asp Val Trp Phe Pro Gln Pro Ala Pro Lys Asp
His305 310 315 320Pro Trp
Arg Thr Met Pro Tyr Asn Gly Met Thr Pro His Ile Ser Gly
325 330 335Thr Thr Leu Thr Ala Gln Ala
Arg Tyr Ala Ala Gly Thr Arg Glu Ile 340 345
350Leu Glu Cys Phe Phe Glu Gly Arg Pro Ile Arg Asp Glu Tyr
Leu Ile 355 360 365Val Gln Gly Gly
Ala Leu Ala Gly Thr Gly Ala His Ser Tyr Ser Lys 370
375 380Gly Asn Ala Thr Gly Gly Ser Glu Glu Ala Ala Lys
Phe Lys Lys Ala385 390 395
400Val37263PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide derived from Collinsella aerofaciens (G39D)
37Met Asn Leu Arg Glu Lys Tyr Gly Glu Trp Gly Leu Ile Leu Gly Ala1
5 10 15Thr Glu Gly Val Gly Lys
Ala Phe Cys Glu Lys Ile Ala Ala Gly Gly 20 25
30Met Asn Val Val Met Val Asp Arg Arg Glu Glu Lys Leu
Asn Val Leu 35 40 45Ala Gly Glu
Ile Arg Glu Thr Tyr Gly Val Glu Thr Lys Val Val Arg 50
55 60Ala Asp Phe Ser Gln Pro Gly Ala Ala Glu Thr Val
Phe Ala Ala Thr65 70 75
80Glu Gly Leu Asp Met Gly Phe Met Ser Tyr Val Ala Cys Leu His Ser
85 90 95Phe Gly Lys Ile Gln Asp
Thr Pro Trp Glu Lys His Glu Ala Met Ile 100
105 110Asn Val Asn Val Val Thr Phe Leu Lys Cys Phe His
His Tyr Met Arg 115 120 125Ile Phe
Ala Ala Gln Asp Arg Gly Ala Val Ile Asn Val Ser Ser Met 130
135 140Thr Gly Ile Ser Ser Ser Pro Trp Asn Gly Gln
Tyr Gly Ala Gly Lys145 150 155
160Ala Phe Ile Leu Lys Met Thr Glu Ala Val Ala Cys Glu Cys Glu Gly
165 170 175Thr Gly Val Asp
Val Glu Val Ile Thr Leu Gly Thr Thr Leu Thr Pro 180
185 190Ser Leu Leu Ser Asn Leu Pro Gly Gly Pro Gln
Gly Glu Ala Val Met 195 200 205Lys
Ile Ala Leu Thr Pro Glu Glu Cys Val Asp Glu Ala Phe Glu Lys 210
215 220Leu Gly Lys Glu Leu Ser Val Ile Ala Gly
Gln Arg Asn Lys Asp Ser225 230 235
240Val His Asp Trp Lys Ala Asn His Thr Glu Asp Glu Tyr Ile Arg
Tyr 245 250 255Met Gly Ser
Phe Tyr Arg Asp 26038263PRTArtificial SequenceDescription of
Artificial Sequence Synthetic polypeptide derived from Collinsella
aerofaciens (G39D R40L) 38Met Asn Leu Arg Glu Lys Tyr Gly Glu Trp Gly Leu
Ile Leu Gly Ala1 5 10
15Thr Glu Gly Val Gly Lys Ala Phe Cys Glu Lys Ile Ala Ala Gly Gly
20 25 30Met Asn Val Val Met Val Asp
Leu Arg Glu Glu Lys Leu Asn Val Leu 35 40
45Ala Gly Glu Ile Arg Glu Thr Tyr Gly Val Glu Thr Lys Val Val
Arg 50 55 60Ala Asp Phe Ser Gln Pro
Gly Ala Ala Glu Thr Val Phe Ala Ala Thr65 70
75 80Glu Gly Leu Asp Met Gly Phe Met Ser Tyr Val
Ala Cys Leu His Ser 85 90
95Phe Gly Lys Ile Gln Asp Thr Pro Trp Glu Lys His Glu Ala Met Ile
100 105 110Asn Val Asn Val Val Thr
Phe Leu Lys Cys Phe His His Tyr Met Arg 115 120
125Ile Phe Ala Ala Gln Asp Arg Gly Ala Val Ile Asn Val Ser
Ser Met 130 135 140Thr Gly Ile Ser Ser
Ser Pro Trp Asn Gly Gln Tyr Gly Ala Gly Lys145 150
155 160Ala Phe Ile Leu Lys Met Thr Glu Ala Val
Ala Cys Glu Cys Glu Gly 165 170
175Thr Gly Val Asp Val Glu Val Ile Thr Leu Gly Thr Thr Leu Thr Pro
180 185 190Ser Leu Leu Ser Asn
Leu Pro Gly Gly Pro Gln Gly Glu Ala Val Met 195
200 205Lys Ile Ala Leu Thr Pro Glu Glu Cys Val Asp Glu
Ala Phe Glu Lys 210 215 220Leu Gly Lys
Glu Leu Ser Val Ile Ala Gly Gln Arg Asn Lys Asp Ser225
230 235 240Val His Asp Trp Lys Ala Asn
His Thr Glu Asp Glu Tyr Ile Arg Tyr 245
250 255Met Gly Ser Phe Tyr Arg Asp
26039263PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide derived from Collinsella aerofaciens (G39D
R40I) 39Met Asn Leu Arg Glu Lys Tyr Gly Glu Trp Gly Leu Ile Leu Gly Ala1
5 10 15Thr Glu Gly Val
Gly Lys Ala Phe Cys Glu Lys Ile Ala Ala Gly Gly 20
25 30Met Asn Val Val Met Val Asp Ile Arg Glu Glu
Lys Leu Asn Val Leu 35 40 45Ala
Gly Glu Ile Arg Glu Thr Tyr Gly Val Glu Thr Lys Val Val Arg 50
55 60Ala Asp Phe Ser Gln Pro Gly Ala Ala Glu
Thr Val Phe Ala Ala Thr65 70 75
80Glu Gly Leu Asp Met Gly Phe Met Ser Tyr Val Ala Cys Leu His
Ser 85 90 95Phe Gly Lys
Ile Gln Asp Thr Pro Trp Glu Lys His Glu Ala Met Ile 100
105 110Asn Val Asn Val Val Thr Phe Leu Lys Cys
Phe His His Tyr Met Arg 115 120
125Ile Phe Ala Ala Gln Asp Arg Gly Ala Val Ile Asn Val Ser Ser Met 130
135 140Thr Gly Ile Ser Ser Ser Pro Trp
Asn Gly Gln Tyr Gly Ala Gly Lys145 150
155 160Ala Phe Ile Leu Lys Met Thr Glu Ala Val Ala Cys
Glu Cys Glu Gly 165 170
175Thr Gly Val Asp Val Glu Val Ile Thr Leu Gly Thr Thr Leu Thr Pro
180 185 190Ser Leu Leu Ser Asn Leu
Pro Gly Gly Pro Gln Gly Glu Ala Val Met 195 200
205Lys Ile Ala Leu Thr Pro Glu Glu Cys Val Asp Glu Ala Phe
Glu Lys 210 215 220Leu Gly Lys Glu Leu
Ser Val Ile Ala Gly Gln Arg Asn Lys Asp Ser225 230
235 240Val His Asp Trp Lys Ala Asn His Thr Glu
Asp Glu Tyr Ile Arg Tyr 245 250
255Met Gly Ser Phe Tyr Arg Asp 26040263PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
derived from Collinsella aerofaciens 40Met Asn Leu Arg Glu Lys Tyr Gly
Glu Trp Gly Leu Ile Leu Gly Ala1 5 10
15Thr Glu Gly Val Gly Lys Ala Phe Cys Glu Lys Ile Ala Ala
Gly Gly 20 25 30Met Asn Val
Val Met Val Asp Val Arg Glu Glu Lys Leu Asn Val Leu 35
40 45Ala Gly Glu Ile Arg Glu Thr Tyr Gly Val Glu
Thr Lys Val Val Arg 50 55 60Ala Asp
Phe Ser Gln Pro Gly Ala Ala Glu Thr Val Phe Ala Ala Thr65
70 75 80Glu Gly Leu Asp Met Gly Phe
Met Ser Tyr Val Ala Cys Leu His Ser 85 90
95Phe Gly Lys Ile Gln Asp Thr Pro Trp Glu Lys His Glu
Ala Met Ile 100 105 110Asn Val
Asn Val Val Thr Phe Leu Lys Cys Phe His His Tyr Met Arg 115
120 125Ile Phe Ala Ala Gln Asp Arg Gly Ala Val
Ile Asn Val Ser Ser Met 130 135 140Thr
Gly Ile Ser Ser Ser Pro Trp Asn Gly Gln Tyr Gly Ala Gly Lys145
150 155 160Ala Phe Ile Leu Lys Met
Thr Glu Ala Val Ala Cys Glu Cys Glu Gly 165
170 175Thr Gly Val Asp Val Glu Val Ile Thr Leu Gly Thr
Thr Leu Thr Pro 180 185 190Ser
Leu Leu Ser Asn Leu Pro Gly Gly Pro Gln Gly Glu Ala Val Met 195
200 205Lys Ile Ala Leu Thr Pro Glu Glu Cys
Val Asp Glu Ala Phe Glu Lys 210 215
220Leu Gly Lys Glu Leu Ser Val Ile Ala Gly Gln Arg Asn Lys Asp Ser225
230 235 240Val His Asp Trp
Lys Ala Asn His Thr Glu Asp Glu Tyr Ile Arg Tyr 245
250 255Met Gly Ser Phe Tyr Arg Asp
2604126DNAArtificial SequenceDescription of Artificial Sequence Synthetic
PCR primer 41cgtcgtcatg gtcgaccgtc gcgagg
264226DNAArtificial SequenceDescription of Artificial
Sequence Synthetic PCR primer 42cctcgcgacg gtcgaccatg acgacg
264326DNAArtificial SequenceDescription
of Artificial Sequence Synthetic PCR primer 43cgtcgtcatg gtcgacctgc
gcgagg 264431DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
44ccgccgcatc cataccgcca gttgtttacc c
314526DNAArtificial SequenceDescription of Artificial Sequence Synthetic
PCR primer 45cgtcgtcatg gtcgacattc gcgagg
264626DNAArtificial SequenceDescription of Artificial
Sequence Synthetic PCR primer 46cgtcgtcatg gtcgacgttc gcgagg
2647786DNABacillus subtilis 47atgtatccgg
atttaaaagg aaaagtcgtc gctattacag gagctgcttc agggctcgga 60aaggcgatgg
ccattcgctt cggcaaggag caggcaaaag tggttatcaa ctattatagt 120aataaacaag
atccgaacga ggtaaaagaa gaggtcatca aggcgggcgg tgaagctgtt 180gtcgtccaag
gagatgtcac gaaagaggaa gatgtaaaaa atatcgtgca aacggcaatt 240aaggagttcg
gcacactcga tattatgatt aataatgccg gtcttgaaaa tcctgtgcca 300tctcacgaaa
tgccgctcaa ggattgggat aaagtcatcg gcacgaactt aacgggtgcc 360tttttaggaa
gccgtgaagc gattaaatat ttcgtagaaa acgatatcaa gggaaatgtc 420attaacatgt
ccagtgtgca cgaagtgatt ccttggccgt tatttgtcca ctatgcggca 480agtaaaggcg
ggataaagct gatgacagaa acattagcgt tggaatacgc gccgaagggc 540attcgcgtca
ataatattgg gccaggtgcg atcaacacgc caatcaatgc tgaaaaattc 600gctgacccta
aacagaaagc tgatgtagaa agcatgattc caatgggata tatcggcgaa 660ccggaggaga
tcgccgcagt agcagcctgg cttgcttcga aggaagccag ctacgtcaca 720ggcatcacgt
tattcgcgga cggcggtatg acacaatatc cttcattcca ggcaggccgc 780ggttaa
78648261PRTBacillus subtilis 48Met Tyr Pro Asp Leu Lys Gly Lys Val Val
Ala Ile Thr Gly Ala Ala1 5 10
15Ser Gly Leu Gly Lys Ala Met Ala Ile Arg Phe Gly Lys Glu Gln Ala
20 25 30Lys Val Val Ile Asn Tyr
Tyr Ser Asn Lys Gln Asp Pro Asn Glu Val 35 40
45Lys Glu Glu Val Ile Lys Ala Gly Gly Glu Ala Val Val Val
Gln Gly 50 55 60Asp Val Thr Lys Glu
Glu Asp Val Lys Asn Ile Val Gln Thr Ala Ile65 70
75 80Lys Glu Phe Gly Thr Leu Asp Ile Met Ile
Asn Asn Ala Gly Leu Glu 85 90
95Asn Pro Val Pro Ser His Glu Met Pro Leu Lys Asp Trp Asp Lys Val
100 105 110Ile Gly Thr Asn Leu
Thr Gly Ala Phe Leu Gly Ser Arg Glu Ala Ile 115
120 125Lys Tyr Phe Val Glu Asn Asp Ile Lys Gly Asn Val
Ile Asn Met Ser 130 135 140Ser Val His
Glu Val Ile Pro Trp Pro Leu Phe Val His Tyr Ala Ala145
150 155 160Ser Lys Gly Gly Ile Lys Leu
Met Thr Glu Thr Leu Ala Leu Glu Tyr 165
170 175Ala Pro Lys Gly Ile Arg Val Asn Asn Ile Gly Pro
Gly Ala Ile Asn 180 185 190Thr
Pro Ile Asn Ala Glu Lys Phe Ala Asp Pro Lys Gln Lys Ala Asp 195
200 205Val Glu Ser Met Ile Pro Met Gly Tyr
Ile Gly Glu Pro Glu Glu Ile 210 215
220Ala Ala Val Ala Ala Trp Leu Ala Ser Lys Glu Ala Ser Tyr Val Thr225
230 235 240Gly Ile Thr Leu
Phe Ala Asp Gly Gly Met Thr Gln Tyr Pro Ser Phe 245
250 255Gln Ala Gly Arg Gly
260497404DNAArtificial SequenceDescription of Artificial Sequence
Synthetic vector pFr7(D) polynucleotide 49atccggatat agttcctcct
ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60ggggttatgc tagttattgc
tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120tgttagcagc cggatctcag
tggtggtggt ggtggtgctc gagtgcggcc gcaagcttct 180agtcgcggta gaacgacccc
atgtagcgga tgtactcgtc ctcggtgtgg tttgccttcc 240agtcgtggac ggagtccttg
ttgcgctggc cggcgatgac ggagagctcc ttacccagct 300tctcaaaggc ctcgtcaacg
cactcctcgg gggtgagggc gatcttcatg acggcctcgc 360cctgcgggcc gccggggagg
ttggacagca ggctgggggt tagggtggtg ccgagggtga 420tgacctcgac gtcgacgccg
gtgccctcgc actcgcaggc cacggcctcg gtcatcttga 480ggatgaaggc cttgcccgcg
ccgtactggc cgttccaggg gctggagctg atgccggtca 540tcgacgagac gttgatcacg
gcgccgcggt cctgggcggc aaagatccgc atgtagtggt 600ggaagcactt gaggaaggtc
acgacgttga cgttgatcat ggcctcgtgc ttctcccagg 660gggtgtcctg gatcttaccg
aagctgtgca ggcaggccac gtagctcatg aagcccatgt 720ccaggccctc ggtcgcggcg
aagacggtct cggcagcgcc gggctggcta aagtcggcgc 780gcacgacctt ggtctccacg
ccgtaggtct cgcggatctc gcctgcgagc acgttcagct 840tctcctcgcg acggtcgacc
atgacgacgt tcatgccgcc ggcggcgatc ttctcgcaga 900acgccttgcc gacgccctcg
gtcgcgccca ggatcaggcc ccactcaccg tacttctccc 960tcaggttcat gtatatctcc
tttcacgaat tctcagccgc cttcttgaac ttggcggcct 1020cttccgaacc gccggtggca
ttgcccttcg agtaggaatg cgcgccggtg ccggcaagag 1080cgccgccctg cacgatgagg
tattcgtcgc ggatcggacg gccctcgaag aagcactcca 1140ggatctcgcg ggtgcccgcc
gcataacgcg cctgcgcggt cagcgtggtg ccggagatgt 1200gcggggtcat gccgttatag
ggcatcgtcc gccaggggtg gtccttcggc gccggctgcg 1260ggaaccacac gtcgccggca
tagccggcca gccggccgga ttcgagcgca cgtgccacgg 1320catcgcggtc gcacagcttg
ccgcgggcgg tgttgacgat gtaggcgcca cgcttgaaca 1380gcttcagcgt ctcgtcattg
atcatgtgct cggtttcggg gtgcagcggg cagttcagcg 1440tcaccacgtc gcaaaccgga
tacatgtcct cgcgggtcgc gtgccaggtg aggttgagct 1500ccttctcgac cgattccggc
aggcggtgac ggccggtgta gtgcaggtgc acgtcgaacg 1560gcgccagacg gcgcagcacc
gcgagaccga tgcggccggc ggccacggtg ccgacatgca 1620tcgcctcgag gtcgtaggcg
tgggagacgc agtcggcgat gttccagccg cccttccgcg 1680cccattcgtg cgagggcaga
tagttgcgca ccagcgacag gatcatcatc accacatgct 1740cggcgacgct gatcgagttg
cagtaggtga cttccgccac ggtgacgttg cggtcgatag 1800ccgactgaag atcgacgtgg
tcggaaccga tgccggcggt gagcgcgagc ttcaggttct 1860tggccttggc gatgcgctcg
ggcgtcagat aggccggcca gaagggctgg gagatgacga 1920catccgcatc gaccagctcg
cgctcgaaca ccgagtcggg gccgtccttg tcggaggtca 1980cgaccagggt gtggccgttg
gattcgagat attcgcgcag gccgagctcg ccggagacgg 2040agccgagcaa ctgcccgggc
gtgaagtcga tggccttcgg cgtcggcaag atctggccgc 2100ccggatagtg gtcgatcttc
ggaagatcgt cgcgggcata ggtcttcggg tagccgtcga 2160ccggatcatc gtaaagaacg
cacaggacct ttgccatcat atgtatatct ccttcttaaa 2220gttaaacaaa attatttcta
gaggggaatt gttatccgct cacaattccc ctatagtgag 2280tcgtattaat ttcgcgggat
cgagatctcg atcctctacg ccggacgcat cgtggccggc 2340atcaccggcg ccacaggtgc
ggttgctggc gcctatatcg ccgacatcac cgatggggaa 2400gatcgggctc gccacttcgg
gctcatgagc gcttgtttcg gcgtgggtat ggtggcaggc 2460cccgtggccg ggggactgtt
gggcgccatc tccttgcatg caccattcct tgcggcggcg 2520gtgctcaacg gcctcaacct
actactgggc tgcttcctaa tgcaggagtc gcataaggga 2580gagcgtcgag atcccggaca
ccatcgaatg gcgcaaaacc tttcgcggta tggcatgata 2640gcgcccggaa gagagtcaat
tcagggtggt gaatgtgaaa ccagtaacgt tatacgatgt 2700cgcagagtat gccggtgtct
cttatcagac cgtttcccgc gtggtgaacc aggccagcca 2760cgtttctgcg aaaacgcggg
aaaaagtgga agcggcgatg gcggagctga attacattcc 2820caaccgcgtg gcacaacaac
tggcgggcaa acagtcgttg ctgattggcg ttgccacctc 2880cagtctggcc ctgcacgcgc
cgtcgcaaat tgtcgcggcg attaaatctc gcgccgatca 2940actgggtgcc agcgtggtgg
tgtcgatggt agaacgaagc ggcgtcgaag cctgtaaagc 3000ggcggtgcac aatcttctcg
cgcaacgcgt cagtgggctg atcattaact atccgctgga 3060tgaccaggat gccattgctg
tggaagctgc ctgcactaat gttccggcgt tatttcttga 3120tgtctctgac cagacaccca
tcaacagtat tattttctcc catgaagacg gtacgcgact 3180gggcgtggag catctggtcg
cattgggtca ccagcaaatc gcgctgttag cgggcccatt 3240aagttctgtc tcggcgcgtc
tgcgtctggc tggctggcat aaatatctca ctcgcaatca 3300aattcagccg atagcggaac
gggaaggcga ctggagtgcc atgtccggtt ttcaacaaac 3360catgcaaatg ctgaatgagg
gcatcgttcc cactgcgatg ctggttgcca acgatcagat 3420ggcgctgggc gcaatgcgcg
ccattaccga gtccgggctg cgcgttggtg cggatatctc 3480ggtagtggga tacgacgata
ccgaagacag ctcatgttat atcccgccgt taaccaccat 3540caaacaggat tttcgcctgc
tggggcaaac cagcgtggac cgcttgctgc aactctctca 3600gggccaggcg gtgaagggca
atcagctgtt gcccgtctca ctggtgaaaa gaaaaaccac 3660cctggcgccc aatacgcaaa
ccgcctctcc ccgcgcgttg gccgattcat taatgcagct 3720ggcacgacag gtttcccgac
tggaaagcgg gcagtgagcg caacgcaatt aatgtaagtt 3780agctcactca ttaggcaccg
ggatctcgac cgatgccctt gagagccttc aacccagtca 3840gctccttccg gtgggcgcgg
ggcatgacta tcgtcgccgc acttatgact gtcttcttta 3900tcatgcaact cgtaggacag
gtgccggcag cgctctgggt cattttcggc gaggaccgct 3960ttcgctggag cgcgacgatg
atcggcctgt cgcttgcggt attcggaatc ttgcacgccc 4020tcgctcaagc cttcgtcact
ggtcccgcca ccaaacgttt cggcgagaag caggccatta 4080tcgccggcat ggcggcccca
cgggtgcgca tgatcgtgct cctgtcgttg aggacccggc 4140taggctggcg gggttgcctt
actggttagc agaatgaatc accgatacgc gagcgaacgt 4200gaagcgactg ctgctgcaaa
acgtctgcga cctgagcaac aacatgaatg gtcttcggtt 4260tccgtgtttc gtaaagtctg
gaaacgcgga agtcagcgcc ctgcaccatt atgttccgga 4320tctgcatcgc aggatgctgc
tggctaccct gtggaacacc tacatctgta ttaacgaagc 4380gctggcattg accctgagtg
atttttctct ggtcccgccg catccatacc gccagttgtt 4440taccctcaca acgttccagt
aaccgggcat gttcatcatc agtaacccgt atcgtgagca 4500tcctctctcg tttcatcggt
atcattaccc ccatgaacag aaatccccct tacacggagg 4560catcagtgac caaacaggaa
aaaaccgccc ttaacatggc ccgctttatc agaagccaga 4620cattaacgct tctggagaaa
ctcaacgagc tggacgcgga tgaacaggca gacatctgtg 4680aatcgcttca cgaccacgct
gatgagcttt accgcagctg cctcgcgcgt ttcggtgatg 4740acggtgaaaa cctctgacac
atgcagctcc cggagacggt cacagcttgt ctgtaagcgg 4800atgccgggag cagacaagcc
cgtcagggcg cgtcagcggg tgttggcggg tgtcggggcg 4860cagccatgac ccagtcacgt
agcgatagcg gagtgtatac tggcttaact atgcggcatc 4920agagcagatt gtactgagag
tgcaccatat atgcggtgtg aaataccgca cagatgcgta 4980aggagaaaat accgcatcag
gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 5040gtcgttcggc tgcggcgagc
ggtatcagct cactcaaagg cggtaatacg gttatccaca 5100gaatcagggg ataacgcagg
aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 5160cgtaaaaagg ccgcgttgct
ggcgtttttc cataggctcc gcccccctga cgagcatcac 5220aaaaatcgac gctcaagtca
gaggtggcga aacccgacag gactataaag ataccaggcg 5280tttccccctg gaagctccct
cgtgcgctct cctgttccga ccctgccgct taccggatac 5340ctgtccgcct ttctcccttc
gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 5400ctcagttcgg tgtaggtcgt
tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 5460cccgaccgct gcgccttatc
cggtaactat cgtcttgagt ccaacccggt aagacacgac 5520ttatcgccac tggcagcagc
cactggtaac aggattagca gagcgaggta tgtaggcggt 5580gctacagagt tcttgaagtg
gtggcctaac tacggctaca ctagaaggac agtatttggt 5640atctgcgctc tgctgaagcc
agttaccttc ggaaaaagag ttggtagctc ttgatccggc 5700aaacaaacca ccgctggtag
cggtggtttt tttgtttgca agcagcagat tacgcgcaga 5760aaaaaaggat ctcaagaaga
tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 5820gaaaactcac gttaagggat
tttggtcatg agattatcaa aaaggatctt cacctagatc 5880cttttaaatt aaaaatgaag
ttttaaatca atctaaagta tatatgagta aacttggtct 5940gacagttacc aatgcttaat
cagtgaggca cctatctcag cgatctgtct atttcgttca 6000tccatagttg cctgactccc
cgtcgtgtag ataactacga tacgggaggg cttaccatct 6060ggccccagtg ctgcaatgat
accgcgagac ccacgctcac cggctccaga tttatcagca 6120ataaaccagc cagccggaag
ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc 6180atccagtcta ttaattgttg
ccgggaagct agagtaagta gttcgccagt taatagtttg 6240cgcaacgttg ttgccattgc
tgcaggcatc gtggtgtcac gctcgtcgtt tggtatggct 6300tcattcagct ccggttccca
acgatcaagg cgagttacat gatcccccat gttgtgcaaa 6360aaagcggtta gctccttcgg
tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta 6420tcactcatgg ttatggcagc
actgcataat tctcttactg tcatgccatc cgtaagatgc 6480ttttctgtga ctggtgagta
ctcaaccaag tcattctgag aatagtgtat gcggcgaccg 6540agttgctctt gcccggcgtc
aatacgggat aataccgcgc cacatagcag aactttaaaa 6600gtgctcatca ttggaaaacg
ttcttcgggg cgaaaactct caaggatctt accgctgttg 6660agatccagtt cgatgtaacc
cactcgtgca cccaactgat cttcagcatc ttttactttc 6720accagcgttt ctgggtgagc
aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg 6780gcgacacgga aatgttgaat
actcatactc ttcctttttc aatattattg aagcatttat 6840cagggttatt gtctcatgag
cggatacata tttgaatgta tttagaaaaa taaacaaata 6900ggggttccgc gcacatttcc
ccgaaaagtg ccacctgaaa ttgtaaacgt taatattttg 6960ttaaaattcg cgttaaattt
ttgttaaatc agctcatttt ttaaccaata ggccgaaatc 7020ggcaaaatcc cttataaatc
aaaagaatag accgagatag ggttgagtgt tgttccagtt 7080tggaacaaga gtccactatt
aaagaacgtg gactccaacg tcaaagggcg aaaaaccgtc 7140tatcagggcg atggcccact
acgtgaacca tcaccctaat caagtttttt ggggtcgagg 7200tgccgtaaag cactaaatcg
gaaccctaaa gggagccccc gatttagagc ttgacgggga 7260aagccggcga acgtggcgag
aaaggaaggg aagaaagcga aaggagcggg cgctagggcg 7320ctggcaagtg tagcggtcac
gctgcgcgta accaccacac ccgccgcgct taatgcgccg 7380ctacagggcg cgtcccattc
gcca 7404507404DNAArtificial
SequenceDescription of Artificial Sequence Synthetic vector pFr7(DL)
polynucleotide 50atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta
gaggccccaa 60ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc
tttcgggctt 120tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc
gcaagcttct 180agtcgcggta gaacgacccc atgtagcgga tgtactcgtc ctcggtgtgg
tttgccttcc 240agtcgtggac ggagtccttg ttgcgctggc cggcgatgac ggagagctcc
ttacccagct 300tctcaaaggc ctcgtcaacg cactcctcgg gggtgagggc gatcttcatg
acggcctcgc 360cctgcgggcc gccggggagg ttggacagca ggctgggggt tagggtggtg
ccgagggtga 420tgacctcgac gtcgacgccg gtgccctcgc actcgcaggc cacggcctcg
gtcatcttga 480ggatgaaggc cttgcccgcg ccgtactggc cgttccaggg gctggagctg
atgccggtca 540tcgacgagac gttgatcacg gcgccgcggt cctgggcggc aaagatccgc
atgtagtggt 600ggaagcactt gaggaaggtc acgacgttga cgttgatcat ggcctcgtgc
ttctcccagg 660gggtgtcctg gatcttaccg aagctgtgca ggcaggccac gtagctcatg
aagcccatgt 720ccaggccctc ggtcgcggcg aagacggtct cggcagcgcc gggctggcta
aagtcggcgc 780gcacgacctt ggtctccacg ccgtaggtct cgcggatctc gcctgcgagc
acgttcagct 840tctcctcgcg caggtcgacc atgacgacgt tcatgccgcc ggcggcgatc
ttctcgcaga 900acgccttgcc gacgccctcg gtcgcgccca ggatcaggcc ccactcaccg
tacttctccc 960tcaggttcat gtatatctcc tttcacgaat tctcagccgc cttcttgaac
ttggcggcct 1020cttccgaacc gccggtggca ttgcccttcg agtaggaatg cgcgccggtg
ccggcaagag 1080cgccgccctg cacgatgagg tattcgtcgc ggatcggacg gccctcgaag
aagcactcca 1140ggatctcgcg ggtgcccgcc gcataacgcg cctgcgcggt cagcgtggtg
ccggagatgt 1200gcggggtcat gccgttatag ggcatcgtcc gccaggggtg gtccttcggc
gccggctgcg 1260ggaaccacac gtcgccggca tagccggcca gccggccgga ttcgagcgca
cgtgccacgg 1320catcgcggtc gcacagcttg ccgcgggcgg tgttgacgat gtaggcgcca
cgcttgaaca 1380gcttcagcgt ctcgtcattg atcatgtgct cggtttcggg gtgcagcggg
cagttcagcg 1440tcaccacgtc gcaaaccgga tacatgtcct cgcgggtcgc gtgccaggtg
aggttgagct 1500ccttctcgac cgattccggc aggcggtgac ggccggtgta gtgcaggtgc
acgtcgaacg 1560gcgccagacg gcgcagcacc gcgagaccga tgcggccggc ggccacggtg
ccgacatgca 1620tcgcctcgag gtcgtaggcg tgggagacgc agtcggcgat gttccagccg
cccttccgcg 1680cccattcgtg cgagggcaga tagttgcgca ccagcgacag gatcatcatc
accacatgct 1740cggcgacgct gatcgagttg cagtaggtga cttccgccac ggtgacgttg
cggtcgatag 1800ccgactgaag atcgacgtgg tcggaaccga tgccggcggt gagcgcgagc
ttcaggttct 1860tggccttggc gatgcgctcg ggcgtcagat aggccggcca gaagggctgg
gagatgacga 1920catccgcatc gaccagctcg cgctcgaaca ccgagtcggg gccgtccttg
tcggaggtca 1980cgaccagggt gtggccgttg gattcgagat attcgcgcag gccgagctcg
ccggagacgg 2040agccgagcaa ctgcccgggc gtgaagtcga tggccttcgg cgtcggcaag
atctggccgc 2100ccggatagtg gtcgatcttc ggaagatcgt cgcgggcata ggtcttcggg
tagccgtcga 2160ccggatcatc gtaaagaacg cacaggacct ttgccatcat atgtatatct
ccttcttaaa 2220gttaaacaaa attatttcta gaggggaatt gttatccgct cacaattccc
ctatagtgag 2280tcgtattaat ttcgcgggat cgagatctcg atcctctacg ccggacgcat
cgtggccggc 2340atcaccggcg ccacaggtgc ggttgctggc gcctatatcg ccgacatcac
cgatggggaa 2400gatcgggctc gccacttcgg gctcatgagc gcttgtttcg gcgtgggtat
ggtggcaggc 2460cccgtggccg ggggactgtt gggcgccatc tccttgcatg caccattcct
tgcggcggcg 2520gtgctcaacg gcctcaacct actactgggc tgcttcctaa tgcaggagtc
gcataaggga 2580gagcgtcgag atcccggaca ccatcgaatg gcgcaaaacc tttcgcggta
tggcatgata 2640gcgcccggaa gagagtcaat tcagggtggt gaatgtgaaa ccagtaacgt
tatacgatgt 2700cgcagagtat gccggtgtct cttatcagac cgtttcccgc gtggtgaacc
aggccagcca 2760cgtttctgcg aaaacgcggg aaaaagtgga agcggcgatg gcggagctga
attacattcc 2820caaccgcgtg gcacaacaac tggcgggcaa acagtcgttg ctgattggcg
ttgccacctc 2880cagtctggcc ctgcacgcgc cgtcgcaaat tgtcgcggcg attaaatctc
gcgccgatca 2940actgggtgcc agcgtggtgg tgtcgatggt agaacgaagc ggcgtcgaag
cctgtaaagc 3000ggcggtgcac aatcttctcg cgcaacgcgt cagtgggctg atcattaact
atccgctgga 3060tgaccaggat gccattgctg tggaagctgc ctgcactaat gttccggcgt
tatttcttga 3120tgtctctgac cagacaccca tcaacagtat tattttctcc catgaagacg
gtacgcgact 3180gggcgtggag catctggtcg cattgggtca ccagcaaatc gcgctgttag
cgggcccatt 3240aagttctgtc tcggcgcgtc tgcgtctggc tggctggcat aaatatctca
ctcgcaatca 3300aattcagccg atagcggaac gggaaggcga ctggagtgcc atgtccggtt
ttcaacaaac 3360catgcaaatg ctgaatgagg gcatcgttcc cactgcgatg ctggttgcca
acgatcagat 3420ggcgctgggc gcaatgcgcg ccattaccga gtccgggctg cgcgttggtg
cggatatctc 3480ggtagtggga tacgacgata ccgaagacag ctcatgttat atcccgccgt
taaccaccat 3540caaacaggat tttcgcctgc tggggcaaac cagcgtggac cgcttgctgc
aactctctca 3600gggccaggcg gtgaagggca atcagctgtt gcccgtctca ctggtgaaaa
gaaaaaccac 3660cctggcgccc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat
taatgcagct 3720ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt
aatgtaagtt 3780agctcactca ttaggcaccg ggatctcgac cgatgccctt gagagccttc
aacccagtca 3840gctccttccg gtgggcgcgg ggcatgacta tcgtcgccgc acttatgact
gtcttcttta 3900tcatgcaact cgtaggacag gtgccggcag cgctctgggt cattttcggc
gaggaccgct 3960ttcgctggag cgcgacgatg atcggcctgt cgcttgcggt attcggaatc
ttgcacgccc 4020tcgctcaagc cttcgtcact ggtcccgcca ccaaacgttt cggcgagaag
caggccatta 4080tcgccggcat ggcggcccca cgggtgcgca tgatcgtgct cctgtcgttg
aggacccggc 4140taggctggcg gggttgcctt actggttagc agaatgaatc accgatacgc
gagcgaacgt 4200gaagcgactg ctgctgcaaa acgtctgcga cctgagcaac aacatgaatg
gtcttcggtt 4260tccgtgtttc gtaaagtctg gaaacgcgga agtcagcgcc ctgcaccatt
atgttccgga 4320tctgcatcgc aggatgctgc tggctaccct gtggaacacc tacatctgta
ttaacgaagc 4380gctggcattg accctgagtg atttttctct ggtcccgccg catccatacc
gccagttgtt 4440taccctcaca acgttccagt aaccgggcat gttcatcatc agtaacccgt
atcgtgagca 4500tcctctctcg tttcatcggt atcattaccc ccatgaacag aaatccccct
tacacggagg 4560catcagtgac caaacaggaa aaaaccgccc ttaacatggc ccgctttatc
agaagccaga 4620cattaacgct tctggagaaa ctcaacgagc tggacgcgga tgaacaggca
gacatctgtg 4680aatcgcttca cgaccacgct gatgagcttt accgcagctg cctcgcgcgt
ttcggtgatg 4740acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt
ctgtaagcgg 4800atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg
tgtcggggcg 4860cagccatgac ccagtcacgt agcgatagcg gagtgtatac tggcttaact
atgcggcatc 4920agagcagatt gtactgagag tgcaccatat atgcggtgtg aaataccgca
cagatgcgta 4980aggagaaaat accgcatcag gcgctcttcc gcttcctcgc tcactgactc
gctgcgctcg 5040gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg
gttatccaca 5100gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa
ggccaggaac 5160cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga
cgagcatcac 5220aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag
ataccaggcg 5280tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct
taccggatac 5340ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg
ctgtaggtat 5400ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc
ccccgttcag 5460cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt
aagacacgac 5520ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta
tgtaggcggt 5580gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac
agtatttggt 5640atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc
ttgatccggc 5700aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat
tacgcgcaga 5760aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc
tcagtggaac 5820gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt
cacctagatc 5880cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta
aacttggtct 5940gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct
atttcgttca 6000tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg
cttaccatct 6060ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga
tttatcagca 6120ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt
atccgcctcc 6180atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt
taatagtttg 6240cgcaacgttg ttgccattgc tgcaggcatc gtggtgtcac gctcgtcgtt
tggtatggct 6300tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat
gttgtgcaaa 6360aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc
cgcagtgtta 6420tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc
cgtaagatgc 6480ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat
gcggcgaccg 6540agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag
aactttaaaa 6600gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt
accgctgttg 6660agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc
ttttactttc 6720accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa
gggaataagg 6780gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg
aagcatttat 6840cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa
taaacaaata 6900ggggttccgc gcacatttcc ccgaaaagtg ccacctgaaa ttgtaaacgt
taatattttg 6960ttaaaattcg cgttaaattt ttgttaaatc agctcatttt ttaaccaata
ggccgaaatc 7020ggcaaaatcc cttataaatc aaaagaatag accgagatag ggttgagtgt
tgttccagtt 7080tggaacaaga gtccactatt aaagaacgtg gactccaacg tcaaagggcg
aaaaaccgtc 7140tatcagggcg atggcccact acgtgaacca tcaccctaat caagtttttt
ggggtcgagg 7200tgccgtaaag cactaaatcg gaaccctaaa gggagccccc gatttagagc
ttgacgggga 7260aagccggcga acgtggcgag aaaggaaggg aagaaagcga aaggagcggg
cgctagggcg 7320ctggcaagtg tagcggtcac gctgcgcgta accaccacac ccgccgcgct
taatgcgccg 7380ctacagggcg cgtcccattc gcca
7404517404DNAArtificial SequenceDescription of Artificial
Sequence Synthetic vector pFr7(DI) polynucleotide 51atccggatat
agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60ggggttatgc
tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120tgttagcagc
cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttct 180agtcgcggta
gaacgacccc atgtagcgga tgtactcgtc ctcggtgtgg tttgccttcc 240agtcgtggac
ggagtccttg ttgcgctggc cggcgatgac ggagagctcc ttacccagct 300tctcaaaggc
ctcgtcaacg cactcctcgg gggtgagggc gatcttcatg acggcctcgc 360cctgcgggcc
gccggggagg ttggacagca ggctgggggt tagggtggtg ccgagggtga 420tgacctcgac
gtcgacgccg gtgccctcgc actcgcaggc cacggcctcg gtcatcttga 480ggatgaaggc
cttgcccgcg ccgtactggc cgttccaggg gctggagctg atgccggtca 540tcgacgagac
gttgatcacg gcgccgcggt cctgggcggc aaagatccgc atgtagtggt 600ggaagcactt
gaggaaggtc acgacgttga cgttgatcat ggcctcgtgc ttctcccagg 660gggtgtcctg
gatcttaccg aagctgtgca ggcaggccac gtagctcatg aagcccatgt 720ccaggccctc
ggtcgcggcg aagacggtct cggcagcgcc gggctggcta aagtcggcgc 780gcacgacctt
ggtctccacg ccgtaggtct cgcggatctc gcctgcgagc acgttcagct 840tctcctcgcg
aatgtcgacc atgacgacgt tcatgccgcc ggcggcgatc ttctcgcaga 900acgccttgcc
gacgccctcg gtcgcgccca ggatcaggcc ccactcaccg tacttctccc 960tcaggttcat
gtatatctcc tttcacgaat tctcagccgc cttcttgaac ttggcggcct 1020cttccgaacc
gccggtggca ttgcccttcg agtaggaatg cgcgccggtg ccggcaagag 1080cgccgccctg
cacgatgagg tattcgtcgc ggatcggacg gccctcgaag aagcactcca 1140ggatctcgcg
ggtgcccgcc gcataacgcg cctgcgcggt cagcgtggtg ccggagatgt 1200gcggggtcat
gccgttatag ggcatcgtcc gccaggggtg gtccttcggc gccggctgcg 1260ggaaccacac
gtcgccggca tagccggcca gccggccgga ttcgagcgca cgtgccacgg 1320catcgcggtc
gcacagcttg ccgcgggcgg tgttgacgat gtaggcgcca cgcttgaaca 1380gcttcagcgt
ctcgtcattg atcatgtgct cggtttcggg gtgcagcggg cagttcagcg 1440tcaccacgtc
gcaaaccgga tacatgtcct cgcgggtcgc gtgccaggtg aggttgagct 1500ccttctcgac
cgattccggc aggcggtgac ggccggtgta gtgcaggtgc acgtcgaacg 1560gcgccagacg
gcgcagcacc gcgagaccga tgcggccggc ggccacggtg ccgacatgca 1620tcgcctcgag
gtcgtaggcg tgggagacgc agtcggcgat gttccagccg cccttccgcg 1680cccattcgtg
cgagggcaga tagttgcgca ccagcgacag gatcatcatc accacatgct 1740cggcgacgct
gatcgagttg cagtaggtga cttccgccac ggtgacgttg cggtcgatag 1800ccgactgaag
atcgacgtgg tcggaaccga tgccggcggt gagcgcgagc ttcaggttct 1860tggccttggc
gatgcgctcg ggcgtcagat aggccggcca gaagggctgg gagatgacga 1920catccgcatc
gaccagctcg cgctcgaaca ccgagtcggg gccgtccttg tcggaggtca 1980cgaccagggt
gtggccgttg gattcgagat attcgcgcag gccgagctcg ccggagacgg 2040agccgagcaa
ctgcccgggc gtgaagtcga tggccttcgg cgtcggcaag atctggccgc 2100ccggatagtg
gtcgatcttc ggaagatcgt cgcgggcata ggtcttcggg tagccgtcga 2160ccggatcatc
gtaaagaacg cacaggacct ttgccatcat atgtatatct ccttcttaaa 2220gttaaacaaa
attatttcta gaggggaatt gttatccgct cacaattccc ctatagtgag 2280tcgtattaat
ttcgcgggat cgagatctcg atcctctacg ccggacgcat cgtggccggc 2340atcaccggcg
ccacaggtgc ggttgctggc gcctatatcg ccgacatcac cgatggggaa 2400gatcgggctc
gccacttcgg gctcatgagc gcttgtttcg gcgtgggtat ggtggcaggc 2460cccgtggccg
ggggactgtt gggcgccatc tccttgcatg caccattcct tgcggcggcg 2520gtgctcaacg
gcctcaacct actactgggc tgcttcctaa tgcaggagtc gcataaggga 2580gagcgtcgag
atcccggaca ccatcgaatg gcgcaaaacc tttcgcggta tggcatgata 2640gcgcccggaa
gagagtcaat tcagggtggt gaatgtgaaa ccagtaacgt tatacgatgt 2700cgcagagtat
gccggtgtct cttatcagac cgtttcccgc gtggtgaacc aggccagcca 2760cgtttctgcg
aaaacgcggg aaaaagtgga agcggcgatg gcggagctga attacattcc 2820caaccgcgtg
gcacaacaac tggcgggcaa acagtcgttg ctgattggcg ttgccacctc 2880cagtctggcc
ctgcacgcgc cgtcgcaaat tgtcgcggcg attaaatctc gcgccgatca 2940actgggtgcc
agcgtggtgg tgtcgatggt agaacgaagc ggcgtcgaag cctgtaaagc 3000ggcggtgcac
aatcttctcg cgcaacgcgt cagtgggctg atcattaact atccgctgga 3060tgaccaggat
gccattgctg tggaagctgc ctgcactaat gttccggcgt tatttcttga 3120tgtctctgac
cagacaccca tcaacagtat tattttctcc catgaagacg gtacgcgact 3180gggcgtggag
catctggtcg cattgggtca ccagcaaatc gcgctgttag cgggcccatt 3240aagttctgtc
tcggcgcgtc tgcgtctggc tggctggcat aaatatctca ctcgcaatca 3300aattcagccg
atagcggaac gggaaggcga ctggagtgcc atgtccggtt ttcaacaaac 3360catgcaaatg
ctgaatgagg gcatcgttcc cactgcgatg ctggttgcca acgatcagat 3420ggcgctgggc
gcaatgcgcg ccattaccga gtccgggctg cgcgttggtg cggatatctc 3480ggtagtggga
tacgacgata ccgaagacag ctcatgttat atcccgccgt taaccaccat 3540caaacaggat
tttcgcctgc tggggcaaac cagcgtggac cgcttgctgc aactctctca 3600gggccaggcg
gtgaagggca atcagctgtt gcccgtctca ctggtgaaaa gaaaaaccac 3660cctggcgccc
aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat taatgcagct 3720ggcacgacag
gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt aatgtaagtt 3780agctcactca
ttaggcaccg ggatctcgac cgatgccctt gagagccttc aacccagtca 3840gctccttccg
gtgggcgcgg ggcatgacta tcgtcgccgc acttatgact gtcttcttta 3900tcatgcaact
cgtaggacag gtgccggcag cgctctgggt cattttcggc gaggaccgct 3960ttcgctggag
cgcgacgatg atcggcctgt cgcttgcggt attcggaatc ttgcacgccc 4020tcgctcaagc
cttcgtcact ggtcccgcca ccaaacgttt cggcgagaag caggccatta 4080tcgccggcat
ggcggcccca cgggtgcgca tgatcgtgct cctgtcgttg aggacccggc 4140taggctggcg
gggttgcctt actggttagc agaatgaatc accgatacgc gagcgaacgt 4200gaagcgactg
ctgctgcaaa acgtctgcga cctgagcaac aacatgaatg gtcttcggtt 4260tccgtgtttc
gtaaagtctg gaaacgcgga agtcagcgcc ctgcaccatt atgttccgga 4320tctgcatcgc
aggatgctgc tggctaccct gtggaacacc tacatctgta ttaacgaagc 4380gctggcattg
accctgagtg atttttctct ggtcccgccg catccatacc gccagttgtt 4440taccctcaca
acgttccagt aaccgggcat gttcatcatc agtaacccgt atcgtgagca 4500tcctctctcg
tttcatcggt atcattaccc ccatgaacag aaatccccct tacacggagg 4560catcagtgac
caaacaggaa aaaaccgccc ttaacatggc ccgctttatc agaagccaga 4620cattaacgct
tctggagaaa ctcaacgagc tggacgcgga tgaacaggca gacatctgtg 4680aatcgcttca
cgaccacgct gatgagcttt accgcagctg cctcgcgcgt ttcggtgatg 4740acggtgaaaa
cctctgacac atgcagctcc cggagacggt cacagcttgt ctgtaagcgg 4800atgccgggag
cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg tgtcggggcg 4860cagccatgac
ccagtcacgt agcgatagcg gagtgtatac tggcttaact atgcggcatc 4920agagcagatt
gtactgagag tgcaccatat atgcggtgtg aaataccgca cagatgcgta 4980aggagaaaat
accgcatcag gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 5040gtcgttcggc
tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca 5100gaatcagggg
ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 5160cgtaaaaagg
ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 5220aaaaatcgac
gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 5280tttccccctg
gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 5340ctgtccgcct
ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 5400ctcagttcgg
tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 5460cccgaccgct
gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 5520ttatcgccac
tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 5580gctacagagt
tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt 5640atctgcgctc
tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 5700aaacaaacca
ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 5760aaaaaaggat
ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 5820gaaaactcac
gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc 5880cttttaaatt
aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct 5940gacagttacc
aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca 6000tccatagttg
cctgactccc cgtcgtgtag ataactacga tacgggaggg cttaccatct 6060ggccccagtg
ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca 6120ataaaccagc
cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc 6180atccagtcta
ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg 6240cgcaacgttg
ttgccattgc tgcaggcatc gtggtgtcac gctcgtcgtt tggtatggct 6300tcattcagct
ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa 6360aaagcggtta
gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta 6420tcactcatgg
ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc 6480ttttctgtga
ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg 6540agttgctctt
gcccggcgtc aatacgggat aataccgcgc cacatagcag aactttaaaa 6600gtgctcatca
ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg 6660agatccagtt
cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc 6720accagcgttt
ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg 6780gcgacacgga
aatgttgaat actcatactc ttcctttttc aatattattg aagcatttat 6840cagggttatt
gtctcatgag cggatacata tttgaatgta tttagaaaaa taaacaaata 6900ggggttccgc
gcacatttcc ccgaaaagtg ccacctgaaa ttgtaaacgt taatattttg 6960ttaaaattcg
cgttaaattt ttgttaaatc agctcatttt ttaaccaata ggccgaaatc 7020ggcaaaatcc
cttataaatc aaaagaatag accgagatag ggttgagtgt tgttccagtt 7080tggaacaaga
gtccactatt aaagaacgtg gactccaacg tcaaagggcg aaaaaccgtc 7140tatcagggcg
atggcccact acgtgaacca tcaccctaat caagtttttt ggggtcgagg 7200tgccgtaaag
cactaaatcg gaaccctaaa gggagccccc gatttagagc ttgacgggga 7260aagccggcga
acgtggcgag aaaggaaggg aagaaagcga aaggagcggg cgctagggcg 7320ctggcaagtg
tagcggtcac gctgcgcgta accaccacac ccgccgcgct taatgcgccg 7380ctacagggcg
cgtcccattc gcca
7404527404DNAArtificial SequenceDescription of Artificial Sequence
Synthetic vector pFr7(DV) polynucleotide 52atccggatat agttcctcct
ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60ggggttatgc tagttattgc
tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120tgttagcagc cggatctcag
tggtggtggt ggtggtgctc gagtgcggcc gcaagcttct 180agtcgcggta gaacgacccc
atgtagcgga tgtactcgtc ctcggtgtgg tttgccttcc 240agtcgtggac ggagtccttg
ttgcgctggc cggcgatgac ggagagctcc ttacccagct 300tctcaaaggc ctcgtcaacg
cactcctcgg gggtgagggc gatcttcatg acggcctcgc 360cctgcgggcc gccggggagg
ttggacagca ggctgggggt tagggtggtg ccgagggtga 420tgacctcgac gtcgacgccg
gtgccctcgc actcgcaggc cacggcctcg gtcatcttga 480ggatgaaggc cttgcccgcg
ccgtactggc cgttccaggg gctggagctg atgccggtca 540tcgacgagac gttgatcacg
gcgccgcggt cctgggcggc aaagatccgc atgtagtggt 600ggaagcactt gaggaaggtc
acgacgttga cgttgatcat ggcctcgtgc ttctcccagg 660gggtgtcctg gatcttaccg
aagctgtgca ggcaggccac gtagctcatg aagcccatgt 720ccaggccctc ggtcgcggcg
aagacggtct cggcagcgcc gggctggcta aagtcggcgc 780gcacgacctt ggtctccacg
ccgtaggtct cgcggatctc gcctgcgagc acgttcagct 840tctcctcgcg aacgtcgacc
atgacgacgt tcatgccgcc ggcggcgatc ttctcgcaga 900acgccttgcc gacgccctcg
gtcgcgccca ggatcaggcc ccactcaccg tacttctccc 960tcaggttcat gtatatctcc
tttcacgaat tctcagccgc cttcttgaac ttggcggcct 1020cttccgaacc gccggtggca
ttgcccttcg agtaggaatg cgcgccggtg ccggcaagag 1080cgccgccctg cacgatgagg
tattcgtcgc ggatcggacg gccctcgaag aagcactcca 1140ggatctcgcg ggtgcccgcc
gcataacgcg cctgcgcggt cagcgtggtg ccggagatgt 1200gcggggtcat gccgttatag
ggcatcgtcc gccaggggtg gtccttcggc gccggctgcg 1260ggaaccacac gtcgccggca
tagccggcca gccggccgga ttcgagcgca cgtgccacgg 1320catcgcggtc gcacagcttg
ccgcgggcgg tgttgacgat gtaggcgcca cgcttgaaca 1380gcttcagcgt ctcgtcattg
atcatgtgct cggtttcggg gtgcagcggg cagttcagcg 1440tcaccacgtc gcaaaccgga
tacatgtcct cgcgggtcgc gtgccaggtg aggttgagct 1500ccttctcgac cgattccggc
aggcggtgac ggccggtgta gtgcaggtgc acgtcgaacg 1560gcgccagacg gcgcagcacc
gcgagaccga tgcggccggc ggccacggtg ccgacatgca 1620tcgcctcgag gtcgtaggcg
tgggagacgc agtcggcgat gttccagccg cccttccgcg 1680cccattcgtg cgagggcaga
tagttgcgca ccagcgacag gatcatcatc accacatgct 1740cggcgacgct gatcgagttg
cagtaggtga cttccgccac ggtgacgttg cggtcgatag 1800ccgactgaag atcgacgtgg
tcggaaccga tgccggcggt gagcgcgagc ttcaggttct 1860tggccttggc gatgcgctcg
ggcgtcagat aggccggcca gaagggctgg gagatgacga 1920catccgcatc gaccagctcg
cgctcgaaca ccgagtcggg gccgtccttg tcggaggtca 1980cgaccagggt gtggccgttg
gattcgagat attcgcgcag gccgagctcg ccggagacgg 2040agccgagcaa ctgcccgggc
gtgaagtcga tggccttcgg cgtcggcaag atctggccgc 2100ccggatagtg gtcgatcttc
ggaagatcgt cgcgggcata ggtcttcggg tagccgtcga 2160ccggatcatc gtaaagaacg
cacaggacct ttgccatcat atgtatatct ccttcttaaa 2220gttaaacaaa attatttcta
gaggggaatt gttatccgct cacaattccc ctatagtgag 2280tcgtattaat ttcgcgggat
cgagatctcg atcctctacg ccggacgcat cgtggccggc 2340atcaccggcg ccacaggtgc
ggttgctggc gcctatatcg ccgacatcac cgatggggaa 2400gatcgggctc gccacttcgg
gctcatgagc gcttgtttcg gcgtgggtat ggtggcaggc 2460cccgtggccg ggggactgtt
gggcgccatc tccttgcatg caccattcct tgcggcggcg 2520gtgctcaacg gcctcaacct
actactgggc tgcttcctaa tgcaggagtc gcataaggga 2580gagcgtcgag atcccggaca
ccatcgaatg gcgcaaaacc tttcgcggta tggcatgata 2640gcgcccggaa gagagtcaat
tcagggtggt gaatgtgaaa ccagtaacgt tatacgatgt 2700cgcagagtat gccggtgtct
cttatcagac cgtttcccgc gtggtgaacc aggccagcca 2760cgtttctgcg aaaacgcggg
aaaaagtgga agcggcgatg gcggagctga attacattcc 2820caaccgcgtg gcacaacaac
tggcgggcaa acagtcgttg ctgattggcg ttgccacctc 2880cagtctggcc ctgcacgcgc
cgtcgcaaat tgtcgcggcg attaaatctc gcgccgatca 2940actgggtgcc agcgtggtgg
tgtcgatggt agaacgaagc ggcgtcgaag cctgtaaagc 3000ggcggtgcac aatcttctcg
cgcaacgcgt cagtgggctg atcattaact atccgctgga 3060tgaccaggat gccattgctg
tggaagctgc ctgcactaat gttccggcgt tatttcttga 3120tgtctctgac cagacaccca
tcaacagtat tattttctcc catgaagacg gtacgcgact 3180gggcgtggag catctggtcg
cattgggtca ccagcaaatc gcgctgttag cgggcccatt 3240aagttctgtc tcggcgcgtc
tgcgtctggc tggctggcat aaatatctca ctcgcaatca 3300aattcagccg atagcggaac
gggaaggcga ctggagtgcc atgtccggtt ttcaacaaac 3360catgcaaatg ctgaatgagg
gcatcgttcc cactgcgatg ctggttgcca acgatcagat 3420ggcgctgggc gcaatgcgcg
ccattaccga gtccgggctg cgcgttggtg cggatatctc 3480ggtagtggga tacgacgata
ccgaagacag ctcatgttat atcccgccgt taaccaccat 3540caaacaggat tttcgcctgc
tggggcaaac cagcgtggac cgcttgctgc aactctctca 3600gggccaggcg gtgaagggca
atcagctgtt gcccgtctca ctggtgaaaa gaaaaaccac 3660cctggcgccc aatacgcaaa
ccgcctctcc ccgcgcgttg gccgattcat taatgcagct 3720ggcacgacag gtttcccgac
tggaaagcgg gcagtgagcg caacgcaatt aatgtaagtt 3780agctcactca ttaggcaccg
ggatctcgac cgatgccctt gagagccttc aacccagtca 3840gctccttccg gtgggcgcgg
ggcatgacta tcgtcgccgc acttatgact gtcttcttta 3900tcatgcaact cgtaggacag
gtgccggcag cgctctgggt cattttcggc gaggaccgct 3960ttcgctggag cgcgacgatg
atcggcctgt cgcttgcggt attcggaatc ttgcacgccc 4020tcgctcaagc cttcgtcact
ggtcccgcca ccaaacgttt cggcgagaag caggccatta 4080tcgccggcat ggcggcccca
cgggtgcgca tgatcgtgct cctgtcgttg aggacccggc 4140taggctggcg gggttgcctt
actggttagc agaatgaatc accgatacgc gagcgaacgt 4200gaagcgactg ctgctgcaaa
acgtctgcga cctgagcaac aacatgaatg gtcttcggtt 4260tccgtgtttc gtaaagtctg
gaaacgcgga agtcagcgcc ctgcaccatt atgttccgga 4320tctgcatcgc aggatgctgc
tggctaccct gtggaacacc tacatctgta ttaacgaagc 4380gctggcattg accctgagtg
atttttctct ggtcccgccg catccatacc gccagttgtt 4440taccctcaca acgttccagt
aaccgggcat gttcatcatc agtaacccgt atcgtgagca 4500tcctctctcg tttcatcggt
atcattaccc ccatgaacag aaatccccct tacacggagg 4560catcagtgac caaacaggaa
aaaaccgccc ttaacatggc ccgctttatc agaagccaga 4620cattaacgct tctggagaaa
ctcaacgagc tggacgcgga tgaacaggca gacatctgtg 4680aatcgcttca cgaccacgct
gatgagcttt accgcagctg cctcgcgcgt ttcggtgatg 4740acggtgaaaa cctctgacac
atgcagctcc cggagacggt cacagcttgt ctgtaagcgg 4800atgccgggag cagacaagcc
cgtcagggcg cgtcagcggg tgttggcggg tgtcggggcg 4860cagccatgac ccagtcacgt
agcgatagcg gagtgtatac tggcttaact atgcggcatc 4920agagcagatt gtactgagag
tgcaccatat atgcggtgtg aaataccgca cagatgcgta 4980aggagaaaat accgcatcag
gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 5040gtcgttcggc tgcggcgagc
ggtatcagct cactcaaagg cggtaatacg gttatccaca 5100gaatcagggg ataacgcagg
aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 5160cgtaaaaagg ccgcgttgct
ggcgtttttc cataggctcc gcccccctga cgagcatcac 5220aaaaatcgac gctcaagtca
gaggtggcga aacccgacag gactataaag ataccaggcg 5280tttccccctg gaagctccct
cgtgcgctct cctgttccga ccctgccgct taccggatac 5340ctgtccgcct ttctcccttc
gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 5400ctcagttcgg tgtaggtcgt
tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 5460cccgaccgct gcgccttatc
cggtaactat cgtcttgagt ccaacccggt aagacacgac 5520ttatcgccac tggcagcagc
cactggtaac aggattagca gagcgaggta tgtaggcggt 5580gctacagagt tcttgaagtg
gtggcctaac tacggctaca ctagaaggac agtatttggt 5640atctgcgctc tgctgaagcc
agttaccttc ggaaaaagag ttggtagctc ttgatccggc 5700aaacaaacca ccgctggtag
cggtggtttt tttgtttgca agcagcagat tacgcgcaga 5760aaaaaaggat ctcaagaaga
tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 5820gaaaactcac gttaagggat
tttggtcatg agattatcaa aaaggatctt cacctagatc 5880cttttaaatt aaaaatgaag
ttttaaatca atctaaagta tatatgagta aacttggtct 5940gacagttacc aatgcttaat
cagtgaggca cctatctcag cgatctgtct atttcgttca 6000tccatagttg cctgactccc
cgtcgtgtag ataactacga tacgggaggg cttaccatct 6060ggccccagtg ctgcaatgat
accgcgagac ccacgctcac cggctccaga tttatcagca 6120ataaaccagc cagccggaag
ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc 6180atccagtcta ttaattgttg
ccgggaagct agagtaagta gttcgccagt taatagtttg 6240cgcaacgttg ttgccattgc
tgcaggcatc gtggtgtcac gctcgtcgtt tggtatggct 6300tcattcagct ccggttccca
acgatcaagg cgagttacat gatcccccat gttgtgcaaa 6360aaagcggtta gctccttcgg
tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta 6420tcactcatgg ttatggcagc
actgcataat tctcttactg tcatgccatc cgtaagatgc 6480ttttctgtga ctggtgagta
ctcaaccaag tcattctgag aatagtgtat gcggcgaccg 6540agttgctctt gcccggcgtc
aatacgggat aataccgcgc cacatagcag aactttaaaa 6600gtgctcatca ttggaaaacg
ttcttcgggg cgaaaactct caaggatctt accgctgttg 6660agatccagtt cgatgtaacc
cactcgtgca cccaactgat cttcagcatc ttttactttc 6720accagcgttt ctgggtgagc
aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg 6780gcgacacgga aatgttgaat
actcatactc ttcctttttc aatattattg aagcatttat 6840cagggttatt gtctcatgag
cggatacata tttgaatgta tttagaaaaa taaacaaata 6900ggggttccgc gcacatttcc
ccgaaaagtg ccacctgaaa ttgtaaacgt taatattttg 6960ttaaaattcg cgttaaattt
ttgttaaatc agctcatttt ttaaccaata ggccgaaatc 7020ggcaaaatcc cttataaatc
aaaagaatag accgagatag ggttgagtgt tgttccagtt 7080tggaacaaga gtccactatt
aaagaacgtg gactccaacg tcaaagggcg aaaaaccgtc 7140tatcagggcg atggcccact
acgtgaacca tcaccctaat caagtttttt ggggtcgagg 7200tgccgtaaag cactaaatcg
gaaccctaaa gggagccccc gatttagagc ttgacgggga 7260aagccggcga acgtggcgag
aaaggaaggg aagaaagcga aaggagcggg cgctagggcg 7320ctggcaagtg tagcggtcac
gctgcgcgta accaccacac ccgccgcgct taatgcgccg 7380ctacagggcg cgtcccattc
gcca 74045327DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
"G39D for" 53gtcgtcatgg tcgaccgtcg cgaggag
275427DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer "G39D_rev" 54ctcctcgcga cggtcgacca tgacgac
275524DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
"G39D/R40I_for" 55gtcatggtcg acattcgcga ggag
245624DNAArtificial SequenceDescription of Artificial
Sequence Synthetic PCR primer "G39D/R40I_rev" 56ctcctcgcga
atgtcgacca tgac
245727DNAArtificial SequenceDescription of Artificial Sequence Synthetic
PCR primer "R40D_for" 57gtcatggtcg gcgatcgcga ggagaag
275827DNAArtificial SequenceDescription of
Artificial Sequence Synthetic PCR primer "R40D_rev" 58cttctcctcg
cgatcgccga ccatgac
275930DNAArtificial SequenceDescription of Artificial Sequence Synthetic
PCR primer "R40D/R41I_for" 59gtcatggtcg gcgatatcga ggagaagctg
306030DNAArtificial SequenceDescription of
Artificial Sequence Synthetic PCR primer "R40D/R41I_rev"
60cagcttctcc tcgatatcgc cgaccatgac
306127DNAArtificial SequenceDescription of Artificial Sequence Synthetic
PCR primer "DIN_for" 61atggtcgaca ttaacgagga gaagctg
276227DNAArtificial SequenceDescription of
Artificial Sequence Synthetic PCR primer "DIN_rev" 62cagcttctcc
tcgttaatgt cgaccat
27638321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic plasmid pFr3T7(D) polynucleotide 63atccggatat agttcctcct
ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60ggggttatgc tagttattgc
tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120tgttagcagc cggatctcag
tggtggtggt ggtggtgctc gagtgcggcc gcctagtcgc 180ggtagaacga ccccatgtag
cggatgtact cgtcctcggt gtggtttgcc ttccagtcgt 240ggacggagtc cttgttgcgc
tggccggcga tgacggagag ctccttaccc agcttctcaa 300aggcctcgtc aacgcactcc
tcgggggtga gggcgatctt catgacggcc tcgccctgcg 360ggccgccggg gaggttggac
agcaggctgg gggttagggt ggtgccgagg gtgatgacct 420cgacgtcgac gccggtgccc
tcgcactcgc aggccacggc ctcggtcatc ttgaggatga 480aggccttgcc cgcgccgtac
tggccgttcc aggggctgga gctgatgccg gtcatcgacg 540agacgttgat cacggcgccg
cggtcctggg cggcaaagat ccgcatgtag tggtggaagc 600acttgaggaa ggtcacgacg
ttgacgttga tcatggcctc gtgcttctcc cagggggtgt 660cctggatctt accgaagctg
tgcaggcagg ccacgtagct catgaagccc atgtccaggc 720cctcggtcgc ggcgaagacg
gtctcggcag cgccgggctg gctaaagtcg gcgcgcacga 780ccttggtctc cacgccgtag
gtctcgcgga tctcgcctgc gagcacgttc agcttctcct 840cgcgacggtc gaccatgacg
acgttcatgc cgccggcggc gatcttctcg cagaacgcct 900tgccgacgcc ctcggtcgcg
cccaggatca ggccccactc accgtacttc tccctcaggt 960tcatatgtat atctccttct
tatacttaac taatatacta agatggggaa ttgttatccg 1020ctcacaattc ccctatagtg
agtcgtatta atttcgatta tgcggccgtg tacaatacga 1080ttactttctg ttcgacttaa
gcattataag ctttcagaac tgtgtcgggc gcatcaccgc 1140atcaatgccg ccatcaatga
cgatctgcgc gccatgcaca tagcttgcgg ccgggctcat 1200caaaaaggcg atgaccgacg
ccatctcgga cggctcggca cggcggccca tgggaggaac 1260gaacttggca atggattcgc
catagcgcgg gtcctgcagg cccgcctgca gcaagggagt 1320ctcggttgca ccgggggcga
tggtgttcag gcgcacgcca gcctcgcccc aggcggcggc 1380gcgtttgcgc acagccaccg
tcaaagcatt cttgctgccc gcataggcca gatttccgcc 1440ctgctctccc gcatgttcga
caatggcgcg ggccttggct tcctcgccgg cttccagtgc 1500cagcgccagt gggttcttgt
caaaagccag atgcgcggaa gccacggacg agatgacgac 1560ggctgcgggc tgatggcctt
ttttcagcgc tggcaaaaag gcatccatca gctcggtcgc 1620gccaaaataa ttgaccgaaa
ccacattgcc aagcaccttg gtctgcggtc ccaggccggc 1680gcacagcacc aggccgtcca
tgcccttgct gcacttcgcc agtacatcgg caatcgcctg 1740ctttcgacct tcggccgtcg
agagatcggc aatcacttcc gcatcgcgta tatcgatgcc 1800tacgatctgg tgaccggccg
cctccaggac cttgcgcgta gccgcaccaa tgccggtggc 1860gcagccgctt atcacgatga
tggacatgta tatctccttt cacgaattct cagccgcctt 1920cttgaacttg gcggcctctt
ccgaaccgcc ggtggcattg cccttcgagt aggaatgcgc 1980gccggtgccg gcaagagcgc
cgccctgcac gatgaggtat tcgtcgcgga tcggacggcc 2040ctcgaagaag cactccagga
tctcgcgggt gcccgccgca taacgcgcct gcgcggtcag 2100cgtggtgccg gagatgtgcg
gggtcatgcc gttatagggc atcgtccgcc aggggtggtc 2160cttcggcgcc ggctgcggga
accacacgtc gccggcatag ccggccagcc ggccggattc 2220gagcgcacgt gccacggcat
cgcggtcgca cagcttgccg cgggcggtgt tgacgatgta 2280ggcgccacgc ttgaacagct
tcagcgtctc gtcattgatc atgtgctcgg tttcggggtg 2340cagcgggcag ttcagcgtca
ccacgtcgca aaccggatac atgtcctcgc gggtcgcgtg 2400ccaggtgagg ttgagctcct
tctcgaccga ttccggcagg cggtgacggt cggtgtagtg 2460caggtgcacg tcgaacggcg
ccagacggcg cagcaccgcg agaccgatgc ggccggcggc 2520cacggtgccg acatgcatcg
cctcgaggtc gtaggcgtgg gagacgcagt cggcgatgtt 2580ccagccgccc ttccgcgccc
attcgtgcga gggcagatag ttgcgcacca gcgacaggat 2640catcatcacc acatgctcgg
cgacgctgat cgagttgcag taggtgactt ccgccacggt 2700gacgttgcgg tcgatagccg
actgaagatc gacgtggtcg gaaccgatgc cggcggtgag 2760cgcgagcttc aggttcttgg
ccttggcgat gcgctcgggc gtcagatagg ccggccagaa 2820gggctgggag atgacgacat
ccgcatcgac cagctcgcgc tcgaacaccg agtcggggcc 2880gtccttgtcg gaggtcacga
ccagggtgtg gccgttggat tcgagatatt cgcgcaggcc 2940gagctcgccg gagacggagc
cgagcaactg cccgggcgtg aagtcgatgg ccttcggcgt 3000cggcaagatc tggccgcccg
gatagtggtc gatcttcgga agatcgtcgc gggcataggt 3060cttcgggtag ccgtcgaccg
gatcatcgta aagaacgcac aggacctttg ccatcatatg 3120tatatctcct tcttaaagtt
aaacaaaatt atttctagag gggaattgtt atccgctcac 3180aattccccta tagtgagtcg
tattaatttc gcgggatcga gatctcgatc ctctacgccg 3240gacgcatcgt ggccggcatc
accggcgcca caggtgcggt tgctggcgcc tatatcgccg 3300acatcaccga tggggaagat
cgggctcgcc acttcgggct catgagcgct tgtttcggcg 3360tgggtatggt ggcaggcccc
gtggccgggg gactgttggg cgccatctcc ttgcatgcac 3420cattccttgc ggcggcggtg
ctcaacggcc tcaacctact actgggctgc ttcctaatgc 3480aggagtcgca taagggagag
cgtcgagatc ccggacacca tcgaatggcg caaaaccttt 3540cgcggtatgg catgatagcg
cccggaagag agtcaattca gggtggtgaa tgtgaaacca 3600gtaacgttat acgatgtcgc
agagtatgcc ggtgtctctt atcagaccgt ttcccgcgtg 3660gtgaaccagg ccagccacgt
ttctgcgaaa acgcgggaaa aagtggaagc ggcgatggcg 3720gagctgaatt acattcccaa
ccgcgtggca caacaactgg cgggcaaaca gtcgttgctg 3780attggcgttg ccacctccag
tctggccctg cacgcgccgt cgcaaattgt cgcggcgatt 3840aaatctcgcg ccgatcaact
gggtgccagc gtggtggtgt cgatggtaga acgaagcggc 3900gtcgaagcct gtaaagcggc
ggtgcacaat cttctcgcgc aacgcgtcag tgggctgatc 3960attaactatc cgctggatga
ccaggatgcc attgctgtgg aagctgcctg cactaatgtt 4020ccggcgttat ttcttgatgt
ctctgaccag acacccatca acagtattat tttctcccat 4080gaagacggta cgcgactggg
cgtggagcat ctggtcgcat tgggtcacca gcaaatcgcg 4140ctgttagcgg gcccattaag
ttctgtctcg gcgcgtctgc gtctggctgg ctggcataaa 4200tatctcactc gcaatcaaat
tcagccgata gcggaacggg aaggcgactg gagtgccatg 4260tccggttttc aacaaaccat
gcaaatgctg aatgagggca tcgttcccac tgcgatgctg 4320gttgccaacg atcagatggc
gctgggcgca atgcgcgcca ttaccgagtc cgggctgcgc 4380gttggtgcgg atatctcggt
agtgggatac gacgataccg aagacagctc atgttatatc 4440ccgccgttaa ccaccatcaa
acaggatttt cgcctgctgg ggcaaaccag cgtggaccgc 4500ttgctgcaac tctctcaggg
ccaggcggtg aagggcaatc agctgttgcc cgtctcactg 4560gtgaaaagaa aaaccaccct
ggcgcccaat acgcaaaccg cctctccccg cgcgttggcc 4620gattcattaa tgcagctggc
acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa 4680cgcaattaat gtaagttagc
tcactcatta ggcaccggga tctcgaccga tgcccttgag 4740agccttcaac ccagtcagct
ccttccggtg ggcgcggggc atgactatcg tcgccgcact 4800tatgactgtc ttctttatca
tgcaactcgt aggacaggtg ccggcagcgc tctgggtcat 4860tttcggcgag gaccgctttc
gctggagcgc gacgatgatc ggcctgtcgc ttgcggtatt 4920cggaatcttg cacgccctcg
ctcaagcctt cgtcactggt cccgccacca aacgtttcgg 4980cgagaagcag gccattatcg
ccggcatggc ggccccacgg gtgcgcatga tcgtgctcct 5040gtcgttgagg acccggctag
gctggcgggg ttgccttact ggttagcaga atgaatcacc 5100gatacgcgag cgaacgtgaa
gcgactgctg ctgcaaaacg tctgcgacct gagcaacaac 5160atgaatggtc ttcggtttcc
gtgtttcgta aagtctggaa acgcggaagt cagcgccctg 5220caccattatg ttccggatct
gcatcgcagg atgctgctgg ctaccctgtg gaacacctac 5280atctgtatta acgaagcgct
ggcattgacc ctgagtgatt tttctctggt cccgccgcat 5340ccataccgcc agttgtttac
cctcacaacg ttccagtaac cgggcatgtt catcatcagt 5400aacccgtatc gtgagcatcc
tctctcgttt catcggtatc attaccccca tgaacagaaa 5460tcccccttac acggaggcat
cagtgaccaa acaggaaaaa accgccctta acatggcccg 5520ctttatcaga agccagacat
taacgcttct ggagaaactc aacgagctgg acgcggatga 5580acaggcagac atctgtgaat
cgcttcacga ccacgctgat gagctttacc gcagctgcct 5640cgcgcgtttc ggtgatgacg
gtgaaaacct ctgacacatg cagctcccgg agacggtcac 5700agcttgtctg taagcggatg
ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt 5760tggcgggtgt cggggcgcag
ccatgaccca gtcacgtagc gatagcggag tgtatactgg 5820cttaactatg cggcatcaga
gcagattgta ctgagagtgc accatatatg cggtgtgaaa 5880taccgcacag atgcgtaagg
agaaaatacc gcatcaggcg ctcttccgct tcctcgctca 5940ctgactcgct gcgctcggtc
gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg 6000taatacggtt atccacagaa
tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc 6060agcaaaaggc caggaaccgt
aaaaaggccg cgttgctggc gtttttccat aggctccgcc 6120cccctgacga gcatcacaaa
aatcgacgct caagtcagag gtggcgaaac ccgacaggac 6180tataaagata ccaggcgttt
ccccctggaa gctccctcgt gcgctctcct gttccgaccc 6240tgccgcttac cggatacctg
tccgcctttc tcccttcggg aagcgtggcg ctttctcata 6300gctcacgctg taggtatctc
agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc 6360acgaaccccc cgttcagccc
gaccgctgcg ccttatccgg taactatcgt cttgagtcca 6420acccggtaag acacgactta
tcgccactgg cagcagccac tggtaacagg attagcagag 6480cgaggtatgt aggcggtgct
acagagttct tgaagtggtg gcctaactac ggctacacta 6540gaaggacagt atttggtatc
tgcgctctgc tgaagccagt taccttcgga aaaagagttg 6600gtagctcttg atccggcaaa
caaaccaccg ctggtagcgg tggttttttt gtttgcaagc 6660agcagattac gcgcagaaaa
aaaggatctc aagaagatcc tttgatcttt tctacggggt 6720ctgacgctca gtggaacgaa
aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa 6780ggatcttcac ctagatcctt
ttaaattaaa aatgaagttt taaatcaatc taaagtatat 6840atgagtaaac ttggtctgac
agttaccaat gcttaatcag tgaggcacct atctcagcga 6900tctgtctatt tcgttcatcc
atagttgcct gactccccgt cgtgtagata actacgatac 6960gggagggctt accatctggc
cccagtgctg caatgatacc gcgagaccca cgctcaccgg 7020ctccagattt atcagcaata
aaccagccag ccggaagggc cgagcgcaga agtggtcctg 7080caactttatc cgcctccatc
cagtctatta attgttgccg ggaagctaga gtaagtagtt 7140cgccagttaa tagtttgcgc
aacgttgttg ccattgctgc aggcatcgtg gtgtcacgct 7200cgtcgtttgg tatggcttca
ttcagctccg gttcccaacg atcaaggcga gttacatgat 7260cccccatgtt gtgcaaaaaa
gcggttagct ccttcggtcc tccgatcgtt gtcagaagta 7320agttggccgc agtgttatca
ctcatggtta tggcagcact gcataattct cttactgtca 7380tgccatccgt aagatgcttt
tctgtgactg gtgagtactc aaccaagtca ttctgagaat 7440agtgtatgcg gcgaccgagt
tgctcttgcc cggcgtcaat acgggataat accgcgccac 7500atagcagaac tttaaaagtg
ctcatcattg gaaaacgttc ttcggggcga aaactctcaa 7560ggatcttacc gctgttgaga
tccagttcga tgtaacccac tcgtgcaccc aactgatctt 7620cagcatcttt tactttcacc
agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg 7680caaaaaaggg aataagggcg
acacggaaat gttgaatact catactcttc ctttttcaat 7740attattgaag catttatcag
ggttattgtc tcatgagcgg atacatattt gaatgtattt 7800agaaaaataa acaaataggg
gttccgcgca catttccccg aaaagtgcca cctgaaattg 7860taaacgttaa tattttgtta
aaattcgcgt taaatttttg ttaaatcagc tcatttttta 7920accaataggc cgaaatcggc
aaaatccctt ataaatcaaa agaatagacc gagatagggt 7980tgagtgttgt tccagtttgg
aacaagagtc cactattaaa gaacgtggac tccaacgtca 8040aagggcgaaa aaccgtctat
cagggcgatg gcccactacg tgaaccatca ccctaatcaa 8100gttttttggg gtcgaggtgc
cgtaaagcac taaatcggaa ccctaaaggg agcccccgat 8160ttagagcttg acggggaaag
ccggcgaacg tggcgagaaa ggaagggaag aaagcgaaag 8220gagcgggcgc tagggcgctg
gcaagtgtag cggtcacgct gcgcgtaacc accacacccg 8280ccgcgcttaa tgcgccgcta
cagggcgcgt cccattcgcc a 8321648190DNAArtificial
SequenceDescription of Artificial Sequence Synthetic pF(G)r7(A)r3
polynucleotide 64atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta
gaggccccaa 60ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc
tttcgggctt 120tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc
gctcagaact 180gtgtcgggcg catcaccgca tcaatgccgc catcaatgac gatctgcgcg
ccatgcacat 240agcttgcggc cgggctcatc aaaaaggcga tgaccgacgc catctcggac
ggctcggcac 300ggcggcccat gggaggaacg aacttggcaa tggattcgcc atagcgcggg
tcctgcaggc 360ccgcctgcag caagggagtc tcggttgcac cgggggcgat ggtgttcagg
cgcacgccag 420cctcgcccca ggcggcggcg cgtttgcgca cagccaccgt caaagcattc
ttgctgcccg 480cataggccag atttccgccc tgctctcccg catgttcgac aatggcgcgg
gccttggctt 540cctcgccggc ttccagtgcc agcgccagtg ggttcttgtc aaaagccaga
tgcgcggaag 600ccacggacga gatgacgacg gctgcgggct gatggccttt tttcagcgct
ggcaaaaagg 660catccatcag ctcggtcgcg ccaaaataat tgaccgaaac cacattgcca
agcaccttgg 720tctgcggtcc caggccggcg cacagcacca ggccgtccat gcccttgctg
cacttcgcca 780gtacatcggc aatcgcctgc tttcgacctt cggccgtcga gagatcggca
atcacttccg 840catcgcgtat atcgatgcct acgatctggt gaccggccgc ctccaggacc
ttgcgcgtag 900cggcaccaat gccggtggcg cagccgctta tcacgatgat ggacatgtat
atctccttaa 960gcttctagtc gcggtagaac gaccccatgt agcggatgta ctcgtcctcg
gtgtggtttg 1020ccttccagtc gtggacggag tccttgttgc gctggccggc gatgacggag
agctccttac 1080ccagcttctc aaaggcctcg tcaacgcact cctcgggggt gagggcgatc
ttcatgacgg 1140cctcgccctg cgggccgccg gggaggttgg acagcaggct gggggttagg
gtggtgccga 1200gggtgatgac ctcgacgtcg acgccggtgc cctcgcactc gcaggccacg
gcctcggtca 1260tcttgaggat gaaggccttg cccgcgccgt actggccgtt ccaggggctg
gagctgatgc 1320cggtcatcga cgagacgttg atcacggcgc cgcggtcctg ggcggcaaag
atccgcatgt 1380agtggtggaa gcacttgagg aaggtcacga cgttgacgtt gatcatggcc
tcgtgcttct 1440cccagggggt gtcctggatc ttaccgaagc tgtgcaggca ggccacgtag
ctcatgaagc 1500ccatgtccag gccctcggtc gcggcgaaga cggtctcggc agcgccgggc
tggctaaagt 1560cggcgcgcac gaccttggtc tccacgccgt aggtctcgcg gatctcgcct
gcgagcacgt 1620tcagcttctc ctcgcgacgg gcgaccatga cgacgttcat gccgccggcg
gcgatcttct 1680cgcagaacgc cttgccgacg ccctcggtcg cgcccaggat caggccccac
tcaccgtact 1740tctccctcag gttcatgtat atctcctttc acgaattctc agccgccttc
ttgaacttgg 1800cggcctcttc cgaaccgccg gtggcattgc ccttcgagta ggaatgcgcg
ccggtgccgg 1860caagagcgcc gccctgcacg atgaggtatt cgtcgcggat cggacggccc
tcgaagaagc 1920actccaggat ctcgcgggtg cccgccgcat aacgcgcctg cgcggtcagc
gtggtgccgg 1980agatgtgcgg ggtcatgccg ttatagggca tcgtccgcca ggggtggtcc
ttcggcgccg 2040gctgcgggaa ccacacgtcg ccggcatagc cggccagccg gccggattcg
agcgcacgtg 2100ccacggcatc gcggtcgcac agcttgccgc gggcggtgtt gacgatgtag
gcgccacgct 2160tgaacagctt cagcgtctcg tcattgatca tgtgctcggt ttcggggtgc
agcgggcagt 2220tcagcgtcac cacgtcgcaa accggataca tgtcctcgcg ggtcgcgtgc
caggtgaggt 2280tgagctcctt ctcgaccgat tccggcaggc ggtgacggcc ggtgtagtgc
aggtgcacgt 2340cgaacggcgc cagacggcgc agcaccgcga gaccgatgcg gccggcggcc
acggtgccga 2400catgcatcgc ctcgaggtcg taggcgtggg agacgcagtc ggcgatgttc
cagccgccct 2460tccgcgccca ttcgtgcgag ggcagatagt tgcgcaccag cgacaggatc
atcatcacca 2520catgctcggc gacgctgatc gagttgcagt aggtgacttc cgccacggtg
acgttgcggt 2580cgatagccga ctgaagatcg acgtggtcgg aaccgatgcc ggcggtgagc
gcgagcttca 2640ggttcttggc cttggcgatg cgctcgggcg tcagataggc cggccagaag
ggctgggaga 2700tgacgacatc cgcatcgacc agctcgcgct cgaacaccga gtcggggccg
tccttgtcgg 2760aggtcacgac cagggtgtgg ccgttggatt cgagatattc gcgcaggccg
agctcgccgg 2820agacggagcc gagcaactgc ccgggcgtga agtcgatggc cttcggcgtc
ggcaagatct 2880ggccgcccgg atagtggtcg atcttcggaa gatcgtcgcg ggcataggtc
ttcgggtagc 2940cgtcgaccgg atcatcgtaa agaacgcaca ggacctttgc catcatatgt
atatctcctt 3000cttaaagtta aacaaaatta tttctagagg ggaattgtta tccgctcaca
attcccctat 3060agtgagtcgt attaatttcg cgggatcgag atctcgatcc tctacgccgg
acgcatcgtg 3120gccggcatca ccggcgccac aggtgcggtt gctggcgcct atatcgccga
catcaccgat 3180ggggaagatc gggctcgcca cttcgggctc atgagcgctt gtttcggcgt
gggtatggtg 3240gcaggccccg tggccggggg actgttgggc gccatctcct tgcatgcacc
attccttgcg 3300gcggcggtgc tcaacggcct caacctacta ctgggctgct tcctaatgca
ggagtcgcat 3360aagggagagc gtcgagatcc cggacaccat cgaatggcgc aaaacctttc
gcggtatggc 3420atgatagcgc ccggaagaga gtcaattcag ggtggtgaat gtgaaaccag
taacgttata 3480cgatgtcgca gagtatgccg gtgtctctta tcagaccgtt tcccgcgtgg
tgaaccaggc 3540cagccacgtt tctgcgaaaa cgcgggaaaa agtggaagcg gcgatggcgg
agctgaatta 3600cattcccaac cgcgtggcac aacaactggc gggcaaacag tcgttgctga
ttggcgttgc 3660cacctccagt ctggccctgc acgcgccgtc gcaaattgtc gcggcgatta
aatctcgcgc 3720cgatcaactg ggtgccagcg tggtggtgtc gatggtagaa cgaagcggcg
tcgaagcctg 3780taaagcggcg gtgcacaatc ttctcgcgca acgcgtcagt gggctgatca
ttaactatcc 3840gctggatgac caggatgcca ttgctgtgga agctgcctgc actaatgttc
cggcgttatt 3900tcttgatgtc tctgaccaga cacccatcaa cagtattatt ttctcccatg
aagacggtac 3960gcgactgggc gtggagcatc tggtcgcatt gggtcaccag caaatcgcgc
tgttagcggg 4020cccattaagt tctgtctcgg cgcgtctgcg tctggctggc tggcataaat
atctcactcg 4080caatcaaatt cagccgatag cggaacggga aggcgactgg agtgccatgt
ccggttttca 4140acaaaccatg caaatgctga atgagggcat cgttcccact gcgatgctgg
ttgccaacga 4200tcagatggcg ctgggcgcaa tgcgcgccat taccgagtcc gggctgcgcg
ttggtgcgga 4260tatctcggta gtgggatacg acgataccga agacagctca tgttatatcc
cgccgttaac 4320caccatcaaa caggattttc gcctgctggg gcaaaccagc gtggaccgct
tgctgcaact 4380ctctcagggc caggcggtga agggcaatca gctgttgccc gtctcactgg
tgaaaagaaa 4440aaccaccctg gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg
attcattaat 4500gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac
gcaattaatg 4560taagttagct cactcattag gcaccgggat ctcgaccgat gcccttgaga
gccttcaacc 4620cagtcagctc cttccggtgg gcgcggggca tgactatcgt cgccgcactt
atgactgtct 4680tctttatcat gcaactcgta ggacaggtgc cggcagcgct ctgggtcatt
ttcggcgagg 4740accgctttcg ctggagcgcg acgatgatcg gcctgtcgct tgcggtattc
ggaatcttgc 4800acgccctcgc tcaagccttc gtcactggtc ccgccaccaa acgtttcggc
gagaagcagg 4860ccattatcgc cggcatggcg gccccacggg tgcgcatgat cgtgctcctg
tcgttgagga 4920cccggctagg ctggcggggt tgccttactg gttagcagaa tgaatcaccg
atacgcgagc 4980gaacgtgaag cgactgctgc tgcaaaacgt ctgcgacctg agcaacaaca
tgaatggtct 5040tcggtttccg tgtttcgtaa agtctggaaa cgcggaagtc agcgccctgc
accattatgt 5100tccggatctg catcgcagga tgctgctggc taccctgtgg aacacctaca
tctgtattaa 5160cgaagcgctg gcattgaccc tgagtgattt ttctctggtc ccgccgcatc
cataccgcca 5220gttgtttacc ctcacaacgt tccagtaacc gggcatgttc atcatcagta
acccgtatcg 5280tgagcatcct ctctcgtttc atcggtatca ttacccccat gaacagaaat
cccccttaca 5340cggaggcatc agtgaccaaa caggaaaaaa ccgcccttaa catggcccgc
tttatcagaa 5400gccagacatt aacgcttctg gagaaactca acgagctgga cgcggatgaa
caggcagaca 5460tctgtgaatc gcttcacgac cacgctgatg agctttaccg cagctgcctc
gcgcgtttcg 5520gtgatgacgg tgaaaacctc tgacacatgc agctcccgga gacggtcaca
gcttgtctgt 5580aagcggatgc cgggagcaga caagcccgtc agggcgcgtc agcgggtgtt
ggcgggtgtc 5640ggggcgcagc catgacccag tcacgtagcg atagcggagt gtatactggc
ttaactatgc 5700ggcatcagag cagattgtac tgagagtgca ccatatatgc ggtgtgaaat
accgcacaga 5760tgcgtaagga gaaaataccg catcaggcgc tcttccgctt cctcgctcac
tgactcgctg 5820cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt
aatacggtta 5880tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca
gcaaaaggcc 5940aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc
ccctgacgag 6000catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact
ataaagatac 6060caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct
gccgcttacc 6120ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag
ctcacgctgt 6180aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca
cgaacccccc 6240gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa
cccggtaaga 6300cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc
gaggtatgta 6360ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag
aaggacagta 6420tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg
tagctcttga 6480tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca
gcagattacg 6540cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc
tgacgctcag 6600tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag
gatcttcacc 6660tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata
tgagtaaact 6720tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat
ctgtctattt 6780cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacg
ggagggctta 6840ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc
tccagattta 6900tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc
aactttatcc 6960gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc
gccagttaat 7020agtttgcgca acgttgttgc cattgctgca ggcatcgtgg tgtcacgctc
gtcgtttggt 7080atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc
ccccatgttg 7140tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa
gttggccgca 7200gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat
gccatccgta 7260agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata
gtgtatgcgg 7320cgaccgagtt gctcttgccc ggcgtcaata cgggataata ccgcgccaca
tagcagaact 7380ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag
gatcttaccg 7440ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc
agcatctttt 7500actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc
aaaaaaggga 7560ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata
ttattgaagc 7620atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta
gaaaaataaa 7680caaatagggg ttccgcgcac atttccccga aaagtgccac ctgaaattgt
aaacgttaat 7740attttgttaa aattcgcgtt aaatttttgt taaatcagct cattttttaa
ccaataggcc 7800gaaatcggca aaatccctta taaatcaaaa gaatagaccg agatagggtt
gagtgttgtt 7860ccagtttgga acaagagtcc actattaaag aacgtggact ccaacgtcaa
agggcgaaaa 7920accgtctatc agggcgatgg cccactacgt gaaccatcac cctaatcaag
ttttttgggg 7980tcgaggtgcc gtaaagcact aaatcggaac cctaaaggga gcccccgatt
tagagcttga 8040cggggaaagc cggcgaacgt ggcgagaaag gaagggaaga aagcgaaagg
agcgggcgct 8100agggcgctgg caagtgtagc ggtcacgctg cgcgtaacca ccacacccgc
cgcgcttaat 8160gcgccgctac agggcgcgtc ccattcgcca
8190658190DNAArtificial SequenceDescription of Artificial
Sequence Synthetic pF(G)r7(S)r3 polynucleotide 65atccggatat
agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60ggggttatgc
tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120tgttagcagc
cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gctcagaact 180gtgtcgggcg
catcaccgca tcaatgccgc catcaatgac gatctgcgcg ccatgcacat 240agcttgcggc
cgggctcatc aaaaaggcga tgaccgacgc catctcggac ggctcggcac 300ggcggcccat
gggaggaacg aacttggcaa tggattcgcc atagcgcggg tcctgcaggc 360ccgcctgcag
caagggagtc tcggttgcac cgggggcgat ggtgttcagg cgcacgccag 420cctcgcccca
ggcggcggcg cgtttgcgca cagccaccgt caaagcattc ttgctgcccg 480cataggccag
atttccgccc tgctctcccg catgttcgac aatggcgcgg gccttggctt 540cctcgccggc
ttccagtgcc agcgccagtg ggttcttgtc aaaagccaga tgcgcggaag 600ccacggacga
gatgacgacg gctgcgggct gatggccttt tttcagcgct ggcaaaaagg 660catccatcag
ctcggtcgcg ccaaaataat tgaccgaaac cacattgcca agcaccttgg 720tctgcggtcc
caggccggcg cacagcacca ggccgtccat gcccttgctg cacttcgcca 780gtacatcggc
aatcgcctgc tttcgacctt cggccgtcga gagatcggca atcacttccg 840catcgcgtat
atcgatgcct acgatctggt gaccggccgc ctccaggacc ttgcgcgtag 900cggcaccaat
gccggtggcg cagccgctta tcacgatgat ggacatgtat atctccttaa 960gcttctagtc
gcggtagaac gaccccatgt agcggatgta ctcgtcctcg gtgtggtttg 1020ccttccagtc
gtggacggag tccttgttgc gctggccggc gatgacggag agctccttac 1080ccagcttctc
aaaggcctcg tcaacgcact cctcgggggt gagggcgatc ttcatgacgg 1140cctcgccctg
cgggccgccg gggaggttgg acagcaggct gggggttagg gtggtgccga 1200gggtgatgac
ctcgacgtcg acgccggtgc cctcgcactc gcaggccacg gcctcggtca 1260tcttgaggat
gaaggccttg cccgcgccgt actggccgtt ccaggggctg gagctgatgc 1320cggtcatcga
cgagacgttg atcacggcgc cgcggtcctg ggcggcaaag atccgcatgt 1380agtggtggaa
gcacttgagg aaggtcacga cgttgacgtt gatcatggcc tcgtgcttct 1440cccagggggt
gtcctggatc ttaccgaagc tgtgcaggca ggccacgtag ctcatgaagc 1500ccatgtccag
gccctcggtc gcggcgaaga cggtctcggc agcgccgggc tggctaaagt 1560cggcgcgcac
gaccttggtc tccacgccgt aggtctcgcg gatctcgcct gcgagcacgt 1620tcagcttctc
ctcgcgacgg ctgaccatga cgacgttcat gccgccggcg gcgatcttct 1680cgcagaacgc
cttgccgacg ccctcggtcg cgcccaggat caggccccac tcaccgtact 1740tctccctcag
gttcatgtat atctcctttc acgaattctc agccgccttc ttgaacttgg 1800cggcctcttc
cgaaccgccg gtggcattgc ccttcgagta ggaatgcgcg ccggtgccgg 1860caagagcgcc
gccctgcacg atgaggtatt cgtcgcggat cggacggccc tcgaagaagc 1920actccaggat
ctcgcgggtg cccgccgcat aacgcgcctg cgcggtcagc gtggtgccgg 1980agatgtgcgg
ggtcatgccg ttatagggca tcgtccgcca ggggtggtcc ttcggcgccg 2040gctgcgggaa
ccacacgtcg ccggcatagc cggccagccg gccggattcg agcgcacgtg 2100ccacggcatc
gcggtcgcac agcttgccgc gggcggtgtt gacgatgtag gcgccacgct 2160tgaacagctt
cagcgtctcg tcattgatca tgtgctcggt ttcggggtgc agcgggcagt 2220tcagcgtcac
cacgtcgcaa accggataca tgtcctcgcg ggtcgcgtgc caggtgaggt 2280tgagctcctt
ctcgaccgat tccggcaggc ggtgacggcc ggtgtagtgc aggtgcacgt 2340cgaacggcgc
cagacggcgc agcaccgcga gaccgatgcg gccggcggcc acggtgccga 2400catgcatcgc
ctcgaggtcg taggcgtggg agacgcagtc ggcgatgttc cagccgccct 2460tccgcgccca
ttcgtgcgag ggcagatagt tgcgcaccag cgacaggatc atcatcacca 2520catgctcggc
gacgctgatc gagttgcagt aggtgacttc cgccacggtg acgttgcggt 2580cgatagccga
ctgaagatcg acgtggtcgg aaccgatgcc ggcggtgagc gcgagcttca 2640ggttcttggc
cttggcgatg cgctcgggcg tcagataggc cggccagaag ggctgggaga 2700tgacgacatc
cgcatcgacc agctcgcgct cgaacaccga gtcggggccg tccttgtcgg 2760aggtcacgac
cagggtgtgg ccgttggatt cgagatattc gcgcaggccg agctcgccgg 2820agacggagcc
gagcaactgc ccgggcgtga agtcgatggc cttcggcgtc ggcaagatct 2880ggccgcccgg
atagtggtcg atcttcggaa gatcgtcgcg ggcataggtc ttcgggtagc 2940cgtcgaccgg
atcatcgtaa agaacgcaca ggacctttgc catcatatgt atatctcctt 3000cttaaagtta
aacaaaatta tttctagagg ggaattgtta tccgctcaca attcccctat 3060agtgagtcgt
attaatttcg cgggatcgag atctcgatcc tctacgccgg acgcatcgtg 3120gccggcatca
ccggcgccac aggtgcggtt gctggcgcct atatcgccga catcaccgat 3180ggggaagatc
gggctcgcca cttcgggctc atgagcgctt gtttcggcgt gggtatggtg 3240gcaggccccg
tggccggggg actgttgggc gccatctcct tgcatgcacc attccttgcg 3300gcggcggtgc
tcaacggcct caacctacta ctgggctgct tcctaatgca ggagtcgcat 3360aagggagagc
gtcgagatcc cggacaccat cgaatggcgc aaaacctttc gcggtatggc 3420atgatagcgc
ccggaagaga gtcaattcag ggtggtgaat gtgaaaccag taacgttata 3480cgatgtcgca
gagtatgccg gtgtctctta tcagaccgtt tcccgcgtgg tgaaccaggc 3540cagccacgtt
tctgcgaaaa cgcgggaaaa agtggaagcg gcgatggcgg agctgaatta 3600cattcccaac
cgcgtggcac aacaactggc gggcaaacag tcgttgctga ttggcgttgc 3660cacctccagt
ctggccctgc acgcgccgtc gcaaattgtc gcggcgatta aatctcgcgc 3720cgatcaactg
ggtgccagcg tggtggtgtc gatggtagaa cgaagcggcg tcgaagcctg 3780taaagcggcg
gtgcacaatc ttctcgcgca acgcgtcagt gggctgatca ttaactatcc 3840gctggatgac
caggatgcca ttgctgtgga agctgcctgc actaatgttc cggcgttatt 3900tcttgatgtc
tctgaccaga cacccatcaa cagtattatt ttctcccatg aagacggtac 3960gcgactgggc
gtggagcatc tggtcgcatt gggtcaccag caaatcgcgc tgttagcggg 4020cccattaagt
tctgtctcgg cgcgtctgcg tctggctggc tggcataaat atctcactcg 4080caatcaaatt
cagccgatag cggaacggga aggcgactgg agtgccatgt ccggttttca 4140acaaaccatg
caaatgctga atgagggcat cgttcccact gcgatgctgg ttgccaacga 4200tcagatggcg
ctgggcgcaa tgcgcgccat taccgagtcc gggctgcgcg ttggtgcgga 4260tatctcggta
gtgggatacg acgataccga agacagctca tgttatatcc cgccgttaac 4320caccatcaaa
caggattttc gcctgctggg gcaaaccagc gtggaccgct tgctgcaact 4380ctctcagggc
caggcggtga agggcaatca gctgttgccc gtctcactgg tgaaaagaaa 4440aaccaccctg
gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat 4500gcagctggca
cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg 4560taagttagct
cactcattag gcaccgggat ctcgaccgat gcccttgaga gccttcaacc 4620cagtcagctc
cttccggtgg gcgcggggca tgactatcgt cgccgcactt atgactgtct 4680tctttatcat
gcaactcgta ggacaggtgc cggcagcgct ctgggtcatt ttcggcgagg 4740accgctttcg
ctggagcgcg acgatgatcg gcctgtcgct tgcggtattc ggaatcttgc 4800acgccctcgc
tcaagccttc gtcactggtc ccgccaccaa acgtttcggc gagaagcagg 4860ccattatcgc
cggcatggcg gccccacggg tgcgcatgat cgtgctcctg tcgttgagga 4920cccggctagg
ctggcggggt tgccttactg gttagcagaa tgaatcaccg atacgcgagc 4980gaacgtgaag
cgactgctgc tgcaaaacgt ctgcgacctg agcaacaaca tgaatggtct 5040tcggtttccg
tgtttcgtaa agtctggaaa cgcggaagtc agcgccctgc accattatgt 5100tccggatctg
catcgcagga tgctgctggc taccctgtgg aacacctaca tctgtattaa 5160cgaagcgctg
gcattgaccc tgagtgattt ttctctggtc ccgccgcatc cataccgcca 5220gttgtttacc
ctcacaacgt tccagtaacc gggcatgttc atcatcagta acccgtatcg 5280tgagcatcct
ctctcgtttc atcggtatca ttacccccat gaacagaaat cccccttaca 5340cggaggcatc
agtgaccaaa caggaaaaaa ccgcccttaa catggcccgc tttatcagaa 5400gccagacatt
aacgcttctg gagaaactca acgagctgga cgcggatgaa caggcagaca 5460tctgtgaatc
gcttcacgac cacgctgatg agctttaccg cagctgcctc gcgcgtttcg 5520gtgatgacgg
tgaaaacctc tgacacatgc agctcccgga gacggtcaca gcttgtctgt 5580aagcggatgc
cgggagcaga caagcccgtc agggcgcgtc agcgggtgtt ggcgggtgtc 5640ggggcgcagc
catgacccag tcacgtagcg atagcggagt gtatactggc ttaactatgc 5700ggcatcagag
cagattgtac tgagagtgca ccatatatgc ggtgtgaaat accgcacaga 5760tgcgtaagga
gaaaataccg catcaggcgc tcttccgctt cctcgctcac tgactcgctg 5820cgctcggtcg
ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta 5880tccacagaat
caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc 5940aggaaccgta
aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag 6000catcacaaaa
atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac 6060caggcgtttc
cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc 6120ggatacctgt
ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt 6180aggtatctca
gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc 6240gttcagcccg
accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga 6300cacgacttat
cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta 6360ggcggtgcta
cagagttctt gaagtggtgg cctaactacg gctacactag aaggacagta 6420tttggtatct
gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga 6480tccggcaaac
aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg 6540cgcagaaaaa
aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag 6600tggaacgaaa
actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc 6660tagatccttt
taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact 6720tggtctgaca
gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt 6780cgttcatcca
tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta 6840ccatctggcc
ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta 6900tcagcaataa
accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc 6960gcctccatcc
agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat 7020agtttgcgca
acgttgttgc cattgctgca ggcatcgtgg tgtcacgctc gtcgtttggt 7080atggcttcat
tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg 7140tgcaaaaaag
cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca 7200gtgttatcac
tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta 7260agatgctttt
ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg 7320cgaccgagtt
gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact 7380ttaaaagtgc
tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg 7440ctgttgagat
ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt 7500actttcacca
gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga 7560ataagggcga
cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc 7620atttatcagg
gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa 7680caaatagggg
ttccgcgcac atttccccga aaagtgccac ctgaaattgt aaacgttaat 7740attttgttaa
aattcgcgtt aaatttttgt taaatcagct cattttttaa ccaataggcc 7800gaaatcggca
aaatccctta taaatcaaaa gaatagaccg agatagggtt gagtgttgtt 7860ccagtttgga
acaagagtcc actattaaag aacgtggact ccaacgtcaa agggcgaaaa 7920accgtctatc
agggcgatgg cccactacgt gaaccatcac cctaatcaag ttttttgggg 7980tcgaggtgcc
gtaaagcact aaatcggaac cctaaaggga gcccccgatt tagagcttga 8040cggggaaagc
cggcgaacgt ggcgagaaag gaagggaaga aagcgaaagg agcgggcgct 8100agggcgctgg
caagtgtagc ggtcacgctg cgcgtaacca ccacacccgc cgcgcttaat 8160gcgccgctac
agggcgcgtc ccattcgcca
8190667910DNAArtificial SequenceDescription of Artificial Sequence
Synthetic p3T7(A)rG polynucleotide 66atccggatat agttcctcct
ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60ggggttatgc tagttattgc
tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120tgttagcagc cggatctcag
tggtggtggt ggtggtgctc gagttaaccg cggcctgcct 180ggaatgaagg atattgtgtc
ataccgccgt ccgcgaataa cgtgatgcct gtgacgtagc 240tggcttcctt cgaagcaagc
caggctgcta ctgcggcgat ctcctccggt tcgccgatat 300atcccattgg aatcatgctt
tctacatcag ctttctgttt agggtcagcg aatttttcag 360cattgattgg cgtgttgatc
gcacctggcc caatattatt gacgcgaatg cccttcggcg 420cgtattccaa cgctaatgtt
tctgtcatca gctttatccc gcctttactt gccgcatagt 480ggacaaataa cggccaagga
atcacttcgt gcacactgga catgttaatg acatttccct 540tgatatcgtt ttctacgaaa
tatttaatcg cttcacggct tcctaaaaag gcacccgtta 600agttcgtgcc gatgacttta
tcccaatcct tgagcggcat ttcgtgagat ggcacaggat 660tttcaagacc ggcattatta
atcataatat cgagtgtgcc gaactcctta attgccgttt 720gcacgatatt ttttacatct
tcctctttcg tgacatctcc ttggacgaca acagcttcac 780cgcccgcctt gatgacctct
tcttttacct cgttcggatc ttgtttatta ctataatagt 840tgataaccac ttttgcctgc
tccttgccga agcgaatggc catcgccttt ccgagccctg 900aagcagctcc tgtaatagcg
acgacttttc cttttaaatc cggatacatg tatatctcct 960tgcggccgcc tagtcgcggt
agaacgaccc catgtagcgg atgtactcgt cctcggtgtg 1020gtttgccttc cagtcgtgga
cggagtcctt gttgcgctgg ccggcgatga cggagagctc 1080cttacccagc ttctcaaagg
cctcgtcaac gcactcctcg ggggtgaggg cgatcttcat 1140gacggcctcg ccctgcgggc
cgccggggag gttggacagc aggctggggg ttagggtggt 1200gccgagggtg atgacctcga
cgtcgacgcc ggtgccctcg cactcgcagg ccacggcctc 1260ggtcatcttg aggatgaagg
ccttgcccgc gccgtactgg ccgttccagg ggctggagct 1320gatgccggtc atcgacgaga
cgttgatcac ggcgccgcgg tcctgggcgg caaagatccg 1380catgtagtgg tggaagcact
tgaggaaggt cacgacgttg acgttgatca tggcctcgtg 1440cttctcccag ggggtgtcct
ggatcttacc gaagctgtgc aggcaggcca cgtagctcat 1500gaagcccatg tccaggccct
cggtcgcggc gaagacggtc tcggcagcgc cgggctggct 1560aaagtcggcg cgcacgacct
tggtctccac gccgtaggtc tcgcggatct cgcctgcgag 1620cacgttcagc ttctcctcgc
gacgggcgac catgacgacg ttcatgccgc cggcggcgat 1680cttctcgcag aacgccttgc
cgacgccctc ggtcgcgccc aggatcaggc cccactcacc 1740gtacttctcc ctcaggttca
tatgtatatc tccttcttat acttaactaa tatactaaga 1800tggggaattg ttatccgctc
acaattcccc tatagtgagt cgtattaatt tcgattatgc 1860ggccgtgtac aatacgatta
ctttctgttc gacttaagca ttataagctt gtcgacggag 1920ctcgaattct cagaactgtg
tcgggcgcat caccgcatca atgccgccat caatgacgat 1980ctgcgcgcca tgcacatagc
ttgcggccgg gctcatcaaa aaggcgatga ccgacgccat 2040ctcggacggc tcggcacggc
ggcccatggg aggaacgaac ttggcaatgg attcgccata 2100gcgcgggtcc tgcaggcccg
cctgcagcaa gggagtctcg gttgcaccgg gggcgatggt 2160gttcaggcgc acgccagcct
cgccccaggc ggcggcgcgt ttgcgcacag ccaccgtcaa 2220agcattcttg ctgcccgcat
aggccagatt tccgccctgc tctcccgcat gttcgacaat 2280ggcgcgggcc ttggcttcct
cgccggcttc cagtgccagc gccagtgggt tcttgtcaaa 2340agccagatgc gcggaagcca
cggacgagat gacgacggct gcgggctgat ggcctttttt 2400cagcgctggc aaaaaggcat
ccatcagctc ggtcgcgcca aaataattga ccgaaaccac 2460attgccaagc accttggtct
gcggtcccag gccggcgcac agcaccaggc cgtccatgcc 2520cttgctgcac ttcgccagta
catcggcaat cgcctgcttt cgaccttcgg ccgtcgagag 2580atcggcaatc acttccgcat
cgcgtatatc gatgcctacg atctggtgac cggccgcctc 2640caggaccttg cgcgtagccg
caccaatgcc ggtggcgcag ccgcttatca cgatgatgga 2700catcatatgt atatctcctt
cttaaagtta aacaaaatta tttctagagg ggaattgtta 2760tccgctcaca attcccctat
agtgagtcgt attaatttcg cgggatcgag atctcgatcc 2820tctacgccgg acgcatcgtg
gccggcatca ccggcgccac aggtgcggtt gctggcgcct 2880atatcgccga catcaccgat
ggggaagatc gggctcgcca cttcgggctc atgagcgctt 2940gtttcggcgt gggtatggtg
gcaggccccg tggccggggg actgttgggc gccatctcct 3000tgcatgcacc attccttgcg
gcggcggtgc tcaacggcct caacctacta ctgggctgct 3060tcctaatgca ggagtcgcat
aagggagagc gtcgagatcc cggacaccat cgaatggcgc 3120aaaacctttc gcggtatggc
atgatagcgc ccggaagaga gtcaattcag ggtggtgaat 3180gtgaaaccag taacgttata
cgatgtcgca gagtatgccg gtgtctctta tcagaccgtt 3240tcccgcgtgg tgaaccaggc
cagccacgtt tctgcgaaaa cgcgggaaaa agtggaagcg 3300gcgatggcgg agctgaatta
cattcccaac cgcgtggcac aacaactggc gggcaaacag 3360tcgttgctga ttggcgttgc
cacctccagt ctggccctgc acgcgccgtc gcaaattgtc 3420gcggcgatta aatctcgcgc
cgatcaactg ggtgccagcg tggtggtgtc gatggtagaa 3480cgaagcggcg tcgaagcctg
taaagcggcg gtgcacaatc ttctcgcgca acgcgtcagt 3540gggctgatca ttaactatcc
gctggatgac caggatgcca ttgctgtgga agctgcctgc 3600actaatgttc cggcgttatt
tcttgatgtc tctgaccaga cacccatcaa cagtattatt 3660ttctcccatg aagacggtac
gcgactgggc gtggagcatc tggtcgcatt gggtcaccag 3720caaatcgcgc tgttagcggg
cccattaagt tctgtctcgg cgcgtctgcg tctggctggc 3780tggcataaat atctcactcg
caatcaaatt cagccgatag cggaacggga aggcgactgg 3840agtgccatgt ccggttttca
acaaaccatg caaatgctga atgagggcat cgttcccact 3900gcgatgctgg ttgccaacga
tcagatggcg ctgggcgcaa tgcgcgccat taccgagtcc 3960gggctgcgcg ttggtgcgga
tatctcggta gtgggatacg acgataccga agacagctca 4020tgttatatcc cgccgttaac
caccatcaaa caggattttc gcctgctggg gcaaaccagc 4080gtggaccgct tgctgcaact
ctctcagggc caggcggtga agggcaatca gctgttgccc 4140gtctcactgg tgaaaagaaa
aaccaccctg gcgcccaata cgcaaaccgc ctctccccgc 4200gcgttggccg attcattaat
gcagctggca cgacaggttt cccgactgga aagcgggcag 4260tgagcgcaac gcaattaatg
taagttagct cactcattag gcaccgggat ctcgaccgat 4320gcccttgaga gccttcaacc
cagtcagctc cttccggtgg gcgcggggca tgactatcgt 4380cgccgcactt atgactgtct
tctttatcat gcaactcgta ggacaggtgc cggcagcgct 4440ctgggtcatt ttcggcgagg
accgctttcg ctggagcgcg acgatgatcg gcctgtcgct 4500tgcggtattc ggaatcttgc
acgccctcgc tcaagccttc gtcactggtc ccgccaccaa 4560acgtttcggc gagaagcagg
ccattatcgc cggcatggcg gccccacggg tgcgcatgat 4620cgtgctcctg tcgttgagga
cccggctagg ctggcggggt tgccttactg gttagcagaa 4680tgaatcaccg atacgcgagc
gaacgtgaag cgactgctgc tgcaaaacgt ctgcgacctg 4740agcaacaaca tgaatggtct
tcggtttccg tgtttcgtaa agtctggaaa cgcggaagtc 4800agcgccctgc accattatgt
tccggatctg catcgcagga tgctgctggc taccctgtgg 4860aacacctaca tctgtattaa
cgaagcgctg gcattgaccc tgagtgattt ttctctggtc 4920ccgccgcatc cataccgcca
gttgtttacc ctcacaacgt tccagtaacc gggcatgttc 4980atcatcagta acccgtatcg
tgagcatcct ctctcgtttc atcggtatca ttacccccat 5040gaacagaaat cccccttaca
cggaggcatc agtgaccaaa caggaaaaaa ccgcccttaa 5100catggcccgc tttatcagaa
gccagacatt aacgcttctg gagaaactca acgagctgga 5160cgcggatgaa caggcagaca
tctgtgaatc gcttcacgac cacgctgatg agctttaccg 5220cagctgcctc gcgcgtttcg
gtgatgacgg tgaaaacctc tgacacatgc agctcccgga 5280gacggtcaca gcttgtctgt
aagcggatgc cgggagcaga caagcccgtc agggcgcgtc 5340agcgggtgtt ggcgggtgtc
ggggcgcagc catgacccag tcacgtagcg atagcggagt 5400gtatactggc ttaactatgc
ggcatcagag cagattgtac tgagagtgca ccatatatgc 5460ggtgtgaaat accgcacaga
tgcgtaagga gaaaataccg catcaggcgc tcttccgctt 5520cctcgctcac tgactcgctg
cgctcggtcg ttcggctgcg gcgagcggta tcagctcact 5580caaaggcggt aatacggtta
tccacagaat caggggataa cgcaggaaag aacatgtgag 5640caaaaggcca gcaaaaggcc
aggaaccgta aaaaggccgc gttgctggcg tttttccata 5700ggctccgccc ccctgacgag
catcacaaaa atcgacgctc aagtcagagg tggcgaaacc 5760cgacaggact ataaagatac
caggcgtttc cccctggaag ctccctcgtg cgctctcctg 5820ttccgaccct gccgcttacc
ggatacctgt ccgcctttct cccttcggga agcgtggcgc 5880tttctcatag ctcacgctgt
aggtatctca gttcggtgta ggtcgttcgc tccaagctgg 5940gctgtgtgca cgaacccccc
gttcagcccg accgctgcgc cttatccggt aactatcgtc 6000ttgagtccaa cccggtaaga
cacgacttat cgccactggc agcagccact ggtaacagga 6060ttagcagagc gaggtatgta
ggcggtgcta cagagttctt gaagtggtgg cctaactacg 6120gctacactag aaggacagta
tttggtatct gcgctctgct gaagccagtt accttcggaa 6180aaagagttgg tagctcttga
tccggcaaac aaaccaccgc tggtagcggt ggtttttttg 6240tttgcaagca gcagattacg
cgcagaaaaa aaggatctca agaagatcct ttgatctttt 6300ctacggggtc tgacgctcag
tggaacgaaa actcacgtta agggattttg gtcatgagat 6360tatcaaaaag gatcttcacc
tagatccttt taaattaaaa atgaagtttt aaatcaatct 6420aaagtatata tgagtaaact
tggtctgaca gttaccaatg cttaatcagt gaggcaccta 6480tctcagcgat ctgtctattt
cgttcatcca tagttgcctg actccccgtc gtgtagataa 6540ctacgatacg ggagggctta
ccatctggcc ccagtgctgc aatgataccg cgagacccac 6600gctcaccggc tccagattta
tcagcaataa accagccagc cggaagggcc gagcgcagaa 6660gtggtcctgc aactttatcc
gcctccatcc agtctattaa ttgttgccgg gaagctagag 6720taagtagttc gccagttaat
agtttgcgca acgttgttgc cattgctgca ggcatcgtgg 6780tgtcacgctc gtcgtttggt
atggcttcat tcagctccgg ttcccaacga tcaaggcgag 6840ttacatgatc ccccatgttg
tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg 6900tcagaagtaa gttggccgca
gtgttatcac tcatggttat ggcagcactg cataattctc 6960ttactgtcat gccatccgta
agatgctttt ctgtgactgg tgagtactca accaagtcat 7020tctgagaata gtgtatgcgg
cgaccgagtt gctcttgccc ggcgtcaata cgggataata 7080ccgcgccaca tagcagaact
ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa 7140aactctcaag gatcttaccg
ctgttgagat ccagttcgat gtaacccact cgtgcaccca 7200actgatcttc agcatctttt
actttcacca gcgtttctgg gtgagcaaaa acaggaaggc 7260aaaatgccgc aaaaaaggga
ataagggcga cacggaaatg ttgaatactc atactcttcc 7320tttttcaata ttattgaagc
atttatcagg gttattgtct catgagcgga tacatatttg 7380aatgtattta gaaaaataaa
caaatagggg ttccgcgcac atttccccga aaagtgccac 7440ctgaaattgt aaacgttaat
attttgttaa aattcgcgtt aaatttttgt taaatcagct 7500cattttttaa ccaataggcc
gaaatcggca aaatccctta taaatcaaaa gaatagaccg 7560agatagggtt gagtgttgtt
ccagtttgga acaagagtcc actattaaag aacgtggact 7620ccaacgtcaa agggcgaaaa
accgtctatc agggcgatgg cccactacgt gaaccatcac 7680cctaatcaag ttttttgggg
tcgaggtgcc gtaaagcact aaatcggaac cctaaaggga 7740gcccccgatt tagagcttga
cggggaaagc cggcgaacgt ggcgagaaag gaagggaaga 7800aagcgaaagg agcgggcgct
agggcgctgg caagtgtagc ggtcacgctg cgcgtaacca 7860ccacacccgc cgcgcttaat
gcgccgctac agggcgcgtc ccattcgcca 7910677891DNAArtificial
SequenceDescription of Artificial Sequence Synthetic p7(A)T3rG
polynucleotide 67atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta
gaggccccaa 60ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc
tttcgggctt 120tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagttaaccg
cggcctgcct 180ggaatgaagg atattgtgtc ataccgccgt ccgcgaataa cgtgatgcct
gtgacgtagc 240tggcttcctt cgaagcaagc caggctgcta ctgcggcgat ctcctccggt
tcgccgatat 300atcccattgg aatcatgctt tctacatcag ctttctgttt agggtcagcg
aatttttcag 360cattgattgg cgtgttgatc gcacctggcc caatattatt gacgcgaatg
cccttcggcg 420cgtattccaa cgctaatgtt tctgtcatca gctttatccc gcctttactt
gccgcatagt 480ggacaaataa cggccaagga atcacttcgt gcacactgga catgttaatg
acatttccct 540tgatatcgtt ttctacgaaa tatttaatcg cttcacggct tcctaaaaag
gcacccgtta 600agttcgtgcc gatgacttta tcccaatcct tgagcggcat ttcgtgagat
ggcacaggat 660tttcaagacc ggcattatta atcataatat cgagtgtgcc gaactcctta
attgccgttt 720gcacgatatt ttttacatct tcctctttcg tgacatctcc ttggacgaca
acagcttcac 780cgcccgcctt gatgacctct tcttttacct cgttcggatc ttgtttatta
ctataatagt 840tgataaccac ttttgcctgc tccttgccga agcgaatggc catcgccttt
ccgagccctg 900aagcagctcc tgtaatagcg acgacttttc cttttaaatc cggatacatg
tatatctcct 960tgcggccgct cagaactgtg tcgggcgcat caccgcatca atgccgccat
caatgacgat 1020ctgcgcgcca tgcacatagc ttgcggccgg gctcatcaaa aaggcgatga
ccgacgccat 1080ctcggacggc tcggcacggc ggcccatggg aggaacgaac ttggcaatgg
attcgccata 1140gcgcgggtcc tgcaggcccg cctgcagcaa gggagtctcg gttgcaccgg
gggcgatggt 1200gttcaggcgc acgccagcct cgccccaggc ggcggcgcgt ttgcgcacag
ccaccgtcaa 1260agcattcttg ctgcccgcat aggccagatt tccgccctgc tctcccgcat
gttcgacaat 1320ggcgcgggcc ttggcttcct cgccggcttc cagtgccagc gccagtgggt
tcttgtcaaa 1380agccagatgc gcggaagcca cggacgagat gacgacggct gcgggctgat
ggcctttttt 1440cagcgctggc aaaaaggcat ccatcagctc ggtcgcgcca aaataattga
ccgaaaccac 1500attgccaagc accttggtct gcggtcccag gccggcgcac agcaccaggc
cgtccatgcc 1560cttgctgcac ttcgccagta catcggcaat cgcctgcttt cgaccttcgg
ccgtcgagag 1620atcggcaatc acttccgcat cgcgtatatc gatgcctacg atctggtgac
cggccgcctc 1680caggaccttg cgcgtagcgg caccaatgcc ggtggcgcag ccgcttatca
cgatgatgga 1740catcatatgt atatctcctt cttatactta actaatatac taagatgggg
aattgttatc 1800cgctcacaat tcccctatag tgagtcgtat taatttcgat tatgcggccg
tgtacaatac 1860gattactttc tgttcgactt aagcattata agcttctagt cgcggtagaa
cgaccccatg 1920tagcggatgt actcgtcctc ggtgtggttt gccttccagt cgtggacgga
gtccttgttg 1980cgctggccgg cgatgacgga gagctcctta cccagcttct caaaggcctc
gtcaacgcac 2040tcctcggggg tgagggcgat cttcatgacg gcctcgccct gcgggccgcc
ggggaggttg 2100gacagcaggc tgggggttag ggtggtgccg agggtgatga cctcgacgtc
gacgccggtg 2160ccctcgcact cgcaggccac ggcctcggtc atcttgagga tgaaggcctt
gcccgcgccg 2220tactggccgt tccaggggct ggagctgatg ccggtcatcg acgagacgtt
gatcacggcg 2280ccgcggtcct gggcggcaaa gatccgcatg tagtggtgga agcacttgag
gaaggtcacg 2340acgttgacgt tgatcatggc ctcgtgcttc tcccaggggg tgtcctggat
cttaccgaag 2400ctgtgcaggc aggccacgta gctcatgaag cccatgtcca ggccctcggt
cgcggcgaag 2460acggtctcgg cagcgccggg ctggctaaag tcggcgcgca cgaccttggt
ctccacgccg 2520taggtctcgc ggatctcgcc tgcgagcacg ttcagcttct cctcgcgacg
ggcgaccatg 2580acgacgttca tgccgccggc ggcgatcttc tcgcagaacg ccttgccgac
gccctcggtc 2640gcgcccagga tcaggcccca ctcaccgtac ttctccctca ggttcatatg
tatatctcct 2700tcttaaagtt aaacaaaatt atttctagag gggaattgtt atccgctcac
aattccccta 2760tagtgagtcg tattaatttc gcgggatcga gatctcgatc ctctacgccg
gacgcatcgt 2820ggccggcatc accggcgcca caggtgcggt tgctggcgcc tatatcgccg
acatcaccga 2880tggggaagat cgggctcgcc acttcgggct catgagcgct tgtttcggcg
tgggtatggt 2940ggcaggcccc gtggccgggg gactgttggg cgccatctcc ttgcatgcac
cattccttgc 3000ggcggcggtg ctcaacggcc tcaacctact actgggctgc ttcctaatgc
aggagtcgca 3060taagggagag cgtcgagatc ccggacacca tcgaatggcg caaaaccttt
cgcggtatgg 3120catgatagcg cccggaagag agtcaattca gggtggtgaa tgtgaaacca
gtaacgttat 3180acgatgtcgc agagtatgcc ggtgtctctt atcagaccgt ttcccgcgtg
gtgaaccagg 3240ccagccacgt ttctgcgaaa acgcgggaaa aagtggaagc ggcgatggcg
gagctgaatt 3300acattcccaa ccgcgtggca caacaactgg cgggcaaaca gtcgttgctg
attggcgttg 3360ccacctccag tctggccctg cacgcgccgt cgcaaattgt cgcggcgatt
aaatctcgcg 3420ccgatcaact gggtgccagc gtggtggtgt cgatggtaga acgaagcggc
gtcgaagcct 3480gtaaagcggc ggtgcacaat cttctcgcgc aacgcgtcag tgggctgatc
attaactatc 3540cgctggatga ccaggatgcc attgctgtgg aagctgcctg cactaatgtt
ccggcgttat 3600ttcttgatgt ctctgaccag acacccatca acagtattat tttctcccat
gaagacggta 3660cgcgactggg cgtggagcat ctggtcgcat tgggtcacca gcaaatcgcg
ctgttagcgg 3720gcccattaag ttctgtctcg gcgcgtctgc gtctggctgg ctggcataaa
tatctcactc 3780gcaatcaaat tcagccgata gcggaacggg aaggcgactg gagtgccatg
tccggttttc 3840aacaaaccat gcaaatgctg aatgagggca tcgttcccac tgcgatgctg
gttgccaacg 3900atcagatggc gctgggcgca atgcgcgcca ttaccgagtc cgggctgcgc
gttggtgcgg 3960atatctcggt agtgggatac gacgataccg aagacagctc atgttatatc
ccgccgttaa 4020ccaccatcaa acaggatttt cgcctgctgg ggcaaaccag cgtggaccgc
ttgctgcaac 4080tctctcaggg ccaggcggtg aagggcaatc agctgttgcc cgtctcactg
gtgaaaagaa 4140aaaccaccct ggcgcccaat acgcaaaccg cctctccccg cgcgttggcc
gattcattaa 4200tgcagctggc acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa
cgcaattaat 4260gtaagttagc tcactcatta ggcaccggga tctcgaccga tgcccttgag
agccttcaac 4320ccagtcagct ccttccggtg ggcgcggggc atgactatcg tcgccgcact
tatgactgtc 4380ttctttatca tgcaactcgt aggacaggtg ccggcagcgc tctgggtcat
tttcggcgag 4440gaccgctttc gctggagcgc gacgatgatc ggcctgtcgc ttgcggtatt
cggaatcttg 4500cacgccctcg ctcaagcctt cgtcactggt cccgccacca aacgtttcgg
cgagaagcag 4560gccattatcg ccggcatggc ggccccacgg gtgcgcatga tcgtgctcct
gtcgttgagg 4620acccggctag gctggcgggg ttgccttact ggttagcaga atgaatcacc
gatacgcgag 4680cgaacgtgaa gcgactgctg ctgcaaaacg tctgcgacct gagcaacaac
atgaatggtc 4740ttcggtttcc gtgtttcgta aagtctggaa acgcggaagt cagcgccctg
caccattatg 4800ttccggatct gcatcgcagg atgctgctgg ctaccctgtg gaacacctac
atctgtatta 4860acgaagcgct ggcattgacc ctgagtgatt tttctctggt cccgccgcat
ccataccgcc 4920agttgtttac cctcacaacg ttccagtaac cgggcatgtt catcatcagt
aacccgtatc 4980gtgagcatcc tctctcgttt catcggtatc attaccccca tgaacagaaa
tcccccttac 5040acggaggcat cagtgaccaa acaggaaaaa accgccctta acatggcccg
ctttatcaga 5100agccagacat taacgcttct ggagaaactc aacgagctgg acgcggatga
acaggcagac 5160atctgtgaat cgcttcacga ccacgctgat gagctttacc gcagctgcct
cgcgcgtttc 5220ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg agacggtcac
agcttgtctg 5280taagcggatg ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt
tggcgggtgt 5340cggggcgcag ccatgaccca gtcacgtagc gatagcggag tgtatactgg
cttaactatg 5400cggcatcaga gcagattgta ctgagagtgc accatatatg cggtgtgaaa
taccgcacag 5460atgcgtaagg agaaaatacc gcatcaggcg ctcttccgct tcctcgctca
ctgactcgct 5520gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg
taatacggtt 5580atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc
agcaaaaggc 5640caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc
cccctgacga 5700gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac
tataaagata 5760ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc
tgccgcttac 5820cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata
gctcacgctg 5880taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc
acgaaccccc 5940cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca
acccggtaag 6000acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag
cgaggtatgt 6060aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta
gaaggacagt 6120atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg
gtagctcttg 6180atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc
agcagattac 6240gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt
ctgacgctca 6300gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa
ggatcttcac 6360ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat
atgagtaaac 6420ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga
tctgtctatt 6480tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac
gggagggctt 6540accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg
ctccagattt 6600atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg
caactttatc 6660cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt
cgccagttaa 6720tagtttgcgc aacgttgttg ccattgctgc aggcatcgtg gtgtcacgct
cgtcgtttgg 6780tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat
cccccatgtt 6840gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta
agttggccgc 6900agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca
tgccatccgt 6960aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat
agtgtatgcg 7020gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac
atagcagaac 7080tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa
ggatcttacc 7140gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt
cagcatcttt 7200tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg
caaaaaaggg 7260aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat
attattgaag 7320catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt
agaaaaataa 7380acaaataggg gttccgcgca catttccccg aaaagtgcca cctgaaattg
taaacgttaa 7440tattttgtta aaattcgcgt taaatttttg ttaaatcagc tcatttttta
accaataggc 7500cgaaatcggc aaaatccctt ataaatcaaa agaatagacc gagatagggt
tgagtgttgt 7560tccagtttgg aacaagagtc cactattaaa gaacgtggac tccaacgtca
aagggcgaaa 7620aaccgtctat cagggcgatg gcccactacg tgaaccatca ccctaatcaa
gttttttggg 7680gtcgaggtgc cgtaaagcac taaatcggaa ccctaaaggg agcccccgat
ttagagcttg 7740acggggaaag ccggcgaacg tggcgagaaa ggaagggaag aaagcgaaag
gagcgggcgc 7800tagggcgctg gcaagtgtag cggtcacgct gcgcgtaacc accacacccg
ccgcgcttaa 7860tgcgccgcta cagggcgcgt cccattcgcc a
7891687404DNAArtificial SequenceDescription of Artificial
Sequence Synthetic pF(G)r7(A) polynucleotide 68atccggatat agttcctcct
ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60ggggttatgc tagttattgc
tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120tgttagcagc cggatctcag
tggtggtggt ggtggtgctc gagtgcggcc gcaagcttct 180agtcgcggta gaacgacccc
atgtagcgga tgtactcgtc ctcggtgtgg tttgccttcc 240agtcgtggac ggagtccttg
ttgcgctggc cggcgatgac ggagagctcc ttacccagct 300tctcaaaggc ctcgtcaacg
cactcctcgg gggtgagggc gatcttcatg acggcctcgc 360cctgcgggcc gccggggagg
ttggacagca ggctgggggt tagggtggtg ccgagggtga 420tgacctcgac gtcgacgccg
gtgccctcgc actcgcaggc cacggcctcg gtcatcttga 480ggatgaaggc cttgcccgcg
ccgtactggc cgttccaggg gctggagctg atgccggtca 540tcgacgagac gttgatcacg
gcgccgcggt cctgggcggc aaagatccgc atgtagtggt 600ggaagcactt gaggaaggtc
acgacgttga cgttgatcat ggcctcgtgc ttctcccagg 660gggtgtcctg gatcttaccg
aagctgtgca ggcaggccac gtagctcatg aagcccatgt 720ccaggccctc ggtcgcggcg
aagacggtct cggcagcgcc gggctggcta aagtcggcgc 780gcacgacctt ggtctccacg
ccgtaggtct cgcggatctc gcctgcgagc acgttcagct 840tctcctcgcg acgggcgacc
atgacgacgt tcatgccgcc ggcggcgatc ttctcgcaga 900acgccttgcc gacgccctcg
gtcgcgccca ggatcaggcc ccactcaccg tacttctccc 960tcaggttcat gtatatctcc
tttcacgaat tctcagccgc cttcttgaac ttggcggcct 1020cttccgaacc gccggtggca
ttgcccttcg agtaggaatg cgcgccggtg ccggcaagag 1080cgccgccctg cacgatgagg
tattcgtcgc ggatcggacg gccctcgaag aagcactcca 1140ggatctcgcg ggtgcccgcc
gcataacgcg cctgcgcggt cagcgtggtg ccggagatgt 1200gcggggtcat gccgttatag
ggcatcgtcc gccaggggtg gtccttcggc gccggctgcg 1260ggaaccacac gtcgccggca
tagccggcca gccggccgga ttcgagcgca cgtgccacgg 1320catcgcggtc gcacagcttg
ccgcgggcgg tgttgacgat gtaggcgcca cgcttgaaca 1380gcttcagcgt ctcgtcattg
atcatgtgct cggtttcggg gtgcagcggg cagttcagcg 1440tcaccacgtc gcaaaccgga
tacatgtcct cgcgggtcgc gtgccaggtg aggttgagct 1500ccttctcgac cgattccggc
aggcggtgac ggccggtgta gtgcaggtgc acgtcgaacg 1560gcgccagacg gcgcagcacc
gcgagaccga tgcggccggc ggccacggtg ccgacatgca 1620tcgcctcgag gtcgtaggcg
tgggagacgc agtcggcgat gttccagccg cccttccgcg 1680cccattcgtg cgagggcaga
tagttgcgca ccagcgacag gatcatcatc accacatgct 1740cggcgacgct gatcgagttg
cagtaggtga cttccgccac ggtgacgttg cggtcgatag 1800ccgactgaag atcgacgtgg
tcggaaccga tgccggcggt gagcgcgagc ttcaggttct 1860tggccttggc gatgcgctcg
ggcgtcagat aggccggcca gaagggctgg gagatgacga 1920catccgcatc gaccagctcg
cgctcgaaca ccgagtcggg gccgtccttg tcggaggtca 1980cgaccagggt gtggccgttg
gattcgagat attcgcgcag gccgagctcg ccggagacgg 2040agccgagcaa ctgcccgggc
gtgaagtcga tggccttcgg cgtcggcaag atctggccgc 2100ccggatagtg gtcgatcttc
ggaagatcgt cgcgggcata ggtcttcggg tagccgtcga 2160ccggatcatc gtaaagaacg
cacaggacct ttgccatcat atgtatatct ccttcttaaa 2220gttaaacaaa attatttcta
gaggggaatt gttatccgct cacaattccc ctatagtgag 2280tcgtattaat ttcgcgggat
cgagatctcg atcctctacg ccggacgcat cgtggccggc 2340atcaccggcg ccacaggtgc
ggttgctggc gcctatatcg ccgacatcac cgatggggaa 2400gatcgggctc gccacttcgg
gctcatgagc gcttgtttcg gcgtgggtat ggtggcaggc 2460cccgtggccg ggggactgtt
gggcgccatc tccttgcatg caccattcct tgcggcggcg 2520gtgctcaacg gcctcaacct
actactgggc tgcttcctaa tgcaggagtc gcataaggga 2580gagcgtcgag atcccggaca
ccatcgaatg gcgcaaaacc tttcgcggta tggcatgata 2640gcgcccggaa gagagtcaat
tcagggtggt gaatgtgaaa ccagtaacgt tatacgatgt 2700cgcagagtat gccggtgtct
cttatcagac cgtttcccgc gtggtgaacc aggccagcca 2760cgtttctgcg aaaacgcggg
aaaaagtgga agcggcgatg gcggagctga attacattcc 2820caaccgcgtg gcacaacaac
tggcgggcaa acagtcgttg ctgattggcg ttgccacctc 2880cagtctggcc ctgcacgcgc
cgtcgcaaat tgtcgcggcg attaaatctc gcgccgatca 2940actgggtgcc agcgtggtgg
tgtcgatggt agaacgaagc ggcgtcgaag cctgtaaagc 3000ggcggtgcac aatcttctcg
cgcaacgcgt cagtgggctg atcattaact atccgctgga 3060tgaccaggat gccattgctg
tggaagctgc ctgcactaat gttccggcgt tatttcttga 3120tgtctctgac cagacaccca
tcaacagtat tattttctcc catgaagacg gtacgcgact 3180gggcgtggag catctggtcg
cattgggtca ccagcaaatc gcgctgttag cgggcccatt 3240aagttctgtc tcggcgcgtc
tgcgtctggc tggctggcat aaatatctca ctcgcaatca 3300aattcagccg atagcggaac
gggaaggcga ctggagtgcc atgtccggtt ttcaacaaac 3360catgcaaatg ctgaatgagg
gcatcgttcc cactgcgatg ctggttgcca acgatcagat 3420ggcgctgggc gcaatgcgcg
ccattaccga gtccgggctg cgcgttggtg cggatatctc 3480ggtagtggga tacgacgata
ccgaagacag ctcatgttat atcccgccgt taaccaccat 3540caaacaggat tttcgcctgc
tggggcaaac cagcgtggac cgcttgctgc aactctctca 3600gggccaggcg gtgaagggca
atcagctgtt gcccgtctca ctggtgaaaa gaaaaaccac 3660cctggcgccc aatacgcaaa
ccgcctctcc ccgcgcgttg gccgattcat taatgcagct 3720ggcacgacag gtttcccgac
tggaaagcgg gcagtgagcg caacgcaatt aatgtaagtt 3780agctcactca ttaggcaccg
ggatctcgac cgatgccctt gagagccttc aacccagtca 3840gctccttccg gtgggcgcgg
ggcatgacta tcgtcgccgc acttatgact gtcttcttta 3900tcatgcaact cgtaggacag
gtgccggcag cgctctgggt cattttcggc gaggaccgct 3960ttcgctggag cgcgacgatg
atcggcctgt cgcttgcggt attcggaatc ttgcacgccc 4020tcgctcaagc cttcgtcact
ggtcccgcca ccaaacgttt cggcgagaag caggccatta 4080tcgccggcat ggcggcccca
cgggtgcgca tgatcgtgct cctgtcgttg aggacccggc 4140taggctggcg gggttgcctt
actggttagc agaatgaatc accgatacgc gagcgaacgt 4200gaagcgactg ctgctgcaaa
acgtctgcga cctgagcaac aacatgaatg gtcttcggtt 4260tccgtgtttc gtaaagtctg
gaaacgcgga agtcagcgcc ctgcaccatt atgttccgga 4320tctgcatcgc aggatgctgc
tggctaccct gtggaacacc tacatctgta ttaacgaagc 4380gctggcattg accctgagtg
atttttctct ggtcccgccg catccatacc gccagttgtt 4440taccctcaca acgttccagt
aaccgggcat gttcatcatc agtaacccgt atcgtgagca 4500tcctctctcg tttcatcggt
atcattaccc ccatgaacag aaatccccct tacacggagg 4560catcagtgac caaacaggaa
aaaaccgccc ttaacatggc ccgctttatc agaagccaga 4620cattaacgct tctggagaaa
ctcaacgagc tggacgcgga tgaacaggca gacatctgtg 4680aatcgcttca cgaccacgct
gatgagcttt accgcagctg cctcgcgcgt ttcggtgatg 4740acggtgaaaa cctctgacac
atgcagctcc cggagacggt cacagcttgt ctgtaagcgg 4800atgccgggag cagacaagcc
cgtcagggcg cgtcagcggg tgttggcggg tgtcggggcg 4860cagccatgac ccagtcacgt
agcgatagcg gagtgtatac tggcttaact atgcggcatc 4920agagcagatt gtactgagag
tgcaccatat atgcggtgtg aaataccgca cagatgcgta 4980aggagaaaat accgcatcag
gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 5040gtcgttcggc tgcggcgagc
ggtatcagct cactcaaagg cggtaatacg gttatccaca 5100gaatcagggg ataacgcagg
aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 5160cgtaaaaagg ccgcgttgct
ggcgtttttc cataggctcc gcccccctga cgagcatcac 5220aaaaatcgac gctcaagtca
gaggtggcga aacccgacag gactataaag ataccaggcg 5280tttccccctg gaagctccct
cgtgcgctct cctgttccga ccctgccgct taccggatac 5340ctgtccgcct ttctcccttc
gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 5400ctcagttcgg tgtaggtcgt
tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 5460cccgaccgct gcgccttatc
cggtaactat cgtcttgagt ccaacccggt aagacacgac 5520ttatcgccac tggcagcagc
cactggtaac aggattagca gagcgaggta tgtaggcggt 5580gctacagagt tcttgaagtg
gtggcctaac tacggctaca ctagaaggac agtatttggt 5640atctgcgctc tgctgaagcc
agttaccttc ggaaaaagag ttggtagctc ttgatccggc 5700aaacaaacca ccgctggtag
cggtggtttt tttgtttgca agcagcagat tacgcgcaga 5760aaaaaaggat ctcaagaaga
tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 5820gaaaactcac gttaagggat
tttggtcatg agattatcaa aaaggatctt cacctagatc 5880cttttaaatt aaaaatgaag
ttttaaatca atctaaagta tatatgagta aacttggtct 5940gacagttacc aatgcttaat
cagtgaggca cctatctcag cgatctgtct atttcgttca 6000tccatagttg cctgactccc
cgtcgtgtag ataactacga tacgggaggg cttaccatct 6060ggccccagtg ctgcaatgat
accgcgagac ccacgctcac cggctccaga tttatcagca 6120ataaaccagc cagccggaag
ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc 6180atccagtcta ttaattgttg
ccgggaagct agagtaagta gttcgccagt taatagtttg 6240cgcaacgttg ttgccattgc
tgcaggcatc gtggtgtcac gctcgtcgtt tggtatggct 6300tcattcagct ccggttccca
acgatcaagg cgagttacat gatcccccat gttgtgcaaa 6360aaagcggtta gctccttcgg
tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta 6420tcactcatgg ttatggcagc
actgcataat tctcttactg tcatgccatc cgtaagatgc 6480ttttctgtga ctggtgagta
ctcaaccaag tcattctgag aatagtgtat gcggcgaccg 6540agttgctctt gcccggcgtc
aatacgggat aataccgcgc cacatagcag aactttaaaa 6600gtgctcatca ttggaaaacg
ttcttcgggg cgaaaactct caaggatctt accgctgttg 6660agatccagtt cgatgtaacc
cactcgtgca cccaactgat cttcagcatc ttttactttc 6720accagcgttt ctgggtgagc
aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg 6780gcgacacgga aatgttgaat
actcatactc ttcctttttc aatattattg aagcatttat 6840cagggttatt gtctcatgag
cggatacata tttgaatgta tttagaaaaa taaacaaata 6900ggggttccgc gcacatttcc
ccgaaaagtg ccacctgaaa ttgtaaacgt taatattttg 6960ttaaaattcg cgttaaattt
ttgttaaatc agctcatttt ttaaccaata ggccgaaatc 7020ggcaaaatcc cttataaatc
aaaagaatag accgagatag ggttgagtgt tgttccagtt 7080tggaacaaga gtccactatt
aaagaacgtg gactccaacg tcaaagggcg aaaaaccgtc 7140tatcagggcg atggcccact
acgtgaacca tcaccctaat caagtttttt ggggtcgagg 7200tgccgtaaag cactaaatcg
gaaccctaaa gggagccccc gatttagagc ttgacgggga 7260aagccggcga acgtggcgag
aaaggaaggg aagaaagcga aaggagcggg cgctagggcg 7320ctggcaagtg tagcggtcac
gctgcgcgta accaccacac ccgccgcgct taatgcgccg 7380ctacagggcg cgtcccattc
gcca 7404697386DNAArtificial
SequenceDescription of Artificial Sequence Synthetic pFr3
polynucleotide 69atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta
gaggccccaa 60ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc
tttcgggctt 120tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc
gcaagctttc 180agaactgtgt cgggcgcatc accgcatcaa tgccgccatc aatgacgatc
tgcgcgccat 240gcacatagct tgcggccggg ctcatcaaaa aggcgatgac cgacgccatc
tcggacggct 300cggcacggcg gcccatggga ggaacgaact tggcaatgga ttcgccatag
cgcgggtcct 360gcaggcccgc ctgcagcaag ggagtctcgg ttgcaccggg ggcgatggtg
ttcaggcgca 420cgccagcctc gccccaggcg gcggcgcgtt tgcgcacagc caccgtcaaa
gcattcttgc 480tgcccgcata ggccagattt ccgccctgct ctcccgcatg ttcgacaatg
gcgcgggcct 540tggcttcctc gccggcttcc agtgccagcg ccagtgggtt cttgtcaaaa
gccagatgcg 600cggaagccac ggacgagatg acgacggctg cgggctgatg gccttttttc
agcgctggca 660aaaaggcatc catcagctcg gtcgcgccaa aataattgac cgaaaccaca
ttgccaagca 720ccttggtctg cggtcccagg ccggcgcaca gcaccaggcc gtccatgccc
ttgctgcact 780tcgccagtac atcggcaatc gcctgctttc gaccttcggc cgtcgagaga
tcggcaatca 840cttccgcatc gcgtatatcg atgcctacga tctggtgacc ggccgcctcc
aggaccttgc 900gcgtagccgc accaatgccg gtggcgcagc cgcttatcac gatgatggac
atgtatatct 960cctttcacga attctcagcc gccttcttga acttggcggc ctcttccgaa
ccgccggtgg 1020cattgccctt cgagtaggaa tgcgcgccgg tgccggcaag agcgccgccc
tgcacgatga 1080ggtattcgtc gcggatcgga cggccctcga agaagcactc caggatctcg
cgggtgcccg 1140ccgcataacg cgcctgcgcg gtcagcgtgg tgccggagat gtgcggggtc
atgccgttat 1200agggcatcgt ccgccagggg tggtccttcg gcgccggctg cgggaaccac
acgtcgccgg 1260catagccggc cagccggccg gattcgagcg cacgtgccac ggcatcgcgg
tcgcacagct 1320tgccgcgggc ggtgttgacg atgtaggcgc cacgcttgaa cagcttcagc
gtctcgtcat 1380tgatcatgtg ctcggtttcg gggtgcagcg ggcagttcag cgtcaccacg
tcgcaaaccg 1440gatacatgtc ctcgcgggtc gcgtgccagg tgaggttgag ctccttctcg
accgattccg 1500gcaggcggtg acggtcggtg tagtgcaggt gcacgtcgaa cggcgccaga
cggcgcagca 1560ccgcgagacc gatgcggccg gcggccacgg tgccgacatg catcgcctcg
aggtcgtagg 1620cgtgggagac gcagtcggcg atgttccagc cgcccttccg cgcccattcg
tgcgagggca 1680gatagttgcg caccagcgac aggatcatca tcaccacatg ctcggcgacg
ctgatcgagt 1740tgcagtaggt gacttccgcc acggtgacgt tgcggtcgat agccgactga
agatcgacgt 1800ggtcggaacc gatgccggcg gtgagcgcga gcttcaggtt cttggccttg
gcgatgcgct 1860cgggcgtcag ataggccggc cagaagggct gggagatgac gacatccgca
tcgaccagct 1920cgcgctcgaa caccgagtcg gggccgtcct tgtcggaggt cacgaccagg
gtgtggccgt 1980tggattcgag atattcgcgc aggccgagct cgccggagac ggagccgagc
aactgcccgg 2040gcgtgaagtc gatggccttc ggcgtcggca agatctggcc gcccggatag
tggtcgatct 2100tcggaagatc gtcgcgggca taggtcttcg ggtagccgtc gaccggatca
tcgtaaagaa 2160cgcacaggac ctttgccatc atatgtatat ctccttctta aagttaaaca
aaattatttc 2220tagaggggaa ttgttatccg ctcacaattc ccctatagtg agtcgtatta
atttcgcggg 2280atcgagatct cgatcctcta cgccggacgc atcgtggccg gcatcaccgg
cgccacaggt 2340gcggttgctg gcgcctatat cgccgacatc accgatgggg aagatcgggc
tcgccacttc 2400gggctcatga gcgcttgttt cggcgtgggt atggtggcag gccccgtggc
cgggggactg 2460ttgggcgcca tctccttgca tgcaccattc cttgcggcgg cggtgctcaa
cggcctcaac 2520ctactactgg gctgcttcct aatgcaggag tcgcataagg gagagcgtcg
agatcccgga 2580caccatcgaa tggcgcaaaa cctttcgcgg tatggcatga tagcgcccgg
aagagagtca 2640attcagggtg gtgaatgtga aaccagtaac gttatacgat gtcgcagagt
atgccggtgt 2700ctcttatcag accgtttccc gcgtggtgaa ccaggccagc cacgtttctg
cgaaaacgcg 2760ggaaaaagtg gaagcggcga tggcggagct gaattacatt cccaaccgcg
tggcacaaca 2820actggcgggc aaacagtcgt tgctgattgg cgttgccacc tccagtctgg
ccctgcacgc 2880gccgtcgcaa attgtcgcgg cgattaaatc tcgcgccgat caactgggtg
ccagcgtggt 2940ggtgtcgatg gtagaacgaa gcggcgtcga agcctgtaaa gcggcggtgc
acaatcttct 3000cgcgcaacgc gtcagtgggc tgatcattaa ctatccgctg gatgaccagg
atgccattgc 3060tgtggaagct gcctgcacta atgttccggc gttatttctt gatgtctctg
accagacacc 3120catcaacagt attattttct cccatgaaga cggtacgcga ctgggcgtgg
agcatctggt 3180cgcattgggt caccagcaaa tcgcgctgtt agcgggccca ttaagttctg
tctcggcgcg 3240tctgcgtctg gctggctggc ataaatatct cactcgcaat caaattcagc
cgatagcgga 3300acgggaaggc gactggagtg ccatgtccgg ttttcaacaa accatgcaaa
tgctgaatga 3360gggcatcgtt cccactgcga tgctggttgc caacgatcag atggcgctgg
gcgcaatgcg 3420cgccattacc gagtccgggc tgcgcgttgg tgcggatatc tcggtagtgg
gatacgacga 3480taccgaagac agctcatgtt atatcccgcc gttaaccacc atcaaacagg
attttcgcct 3540gctggggcaa accagcgtgg accgcttgct gcaactctct cagggccagg
cggtgaaggg 3600caatcagctg ttgcccgtct cactggtgaa aagaaaaacc accctggcgc
ccaatacgca 3660aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac
aggtttcccg 3720actggaaagc gggcagtgag cgcaacgcaa ttaatgtaag ttagctcact
cattaggcac 3780cgggatctcg accgatgccc ttgagagcct tcaacccagt cagctccttc
cggtgggcgc 3840ggggcatgac tatcgtcgcc gcacttatga ctgtcttctt tatcatgcaa
ctcgtaggac 3900aggtgccggc agcgctctgg gtcattttcg gcgaggaccg ctttcgctgg
agcgcgacga 3960tgatcggcct gtcgcttgcg gtattcggaa tcttgcacgc cctcgctcaa
gccttcgtca 4020ctggtcccgc caccaaacgt ttcggcgaga agcaggccat tatcgccggc
atggcggccc 4080cacgggtgcg catgatcgtg ctcctgtcgt tgaggacccg gctaggctgg
cggggttgcc 4140ttactggtta gcagaatgaa tcaccgatac gcgagcgaac gtgaagcgac
tgctgctgca 4200aaacgtctgc gacctgagca acaacatgaa tggtcttcgg tttccgtgtt
tcgtaaagtc 4260tggaaacgcg gaagtcagcg ccctgcacca ttatgttccg gatctgcatc
gcaggatgct 4320gctggctacc ctgtggaaca cctacatctg tattaacgaa gcgctggcat
tgaccctgag 4380tgatttttct ctggtcccgc cgcatccata ccgccagttg tttaccctca
caacgttcca 4440gtaaccgggc atgttcatca tcagtaaccc gtatcgtgag catcctctct
cgtttcatcg 4500gtatcattac ccccatgaac agaaatcccc cttacacgga ggcatcagtg
accaaacagg 4560aaaaaaccgc ccttaacatg gcccgcttta tcagaagcca gacattaacg
cttctggaga 4620aactcaacga gctggacgcg gatgaacagg cagacatctg tgaatcgctt
cacgaccacg 4680ctgatgagct ttaccgcagc tgcctcgcgc gtttcggtga tgacggtgaa
aacctctgac 4740acatgcagct cccggagacg gtcacagctt gtctgtaagc ggatgccggg
agcagacaag 4800cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg cgcagccatg
acccagtcac 4860gtagcgatag cggagtgtat actggcttaa ctatgcggca tcagagcaga
ttgtactgag 4920agtgcaccat atatgcggtg tgaaataccg cacagatgcg taaggagaaa
ataccgcatc 4980aggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg
gctgcggcga 5040gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg
ggataacgca 5100ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa
ggccgcgttg 5160ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg
acgctcaagt 5220cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc
tggaagctcc 5280ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc
ctttctccct 5340tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc
ggtgtaggtc 5400gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg
ctgcgcctta 5460tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc
actggcagca 5520gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga
gttcttgaag 5580tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc
tctgctgaag 5640ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac
caccgctggt 5700agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg
atctcaagaa 5760gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc
acgttaaggg 5820attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa
ttaaaaatga 5880agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta
ccaatgctta 5940atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt
tgcctgactc 6000cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag
tgctgcaatg 6060ataccgcgag acccacgctc accggctcca gatttatcag caataaacca
gccagccgga 6120agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc
tattaattgt 6180tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt
tgttgccatt 6240gctgcaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag
ctccggttcc 6300caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt
tagctccttc 6360ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat
ggttatggca 6420gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt
gactggtgag 6480tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc
ttgcccggcg 6540tcaatacggg ataataccgc gccacatagc agaactttaa aagtgctcat
cattggaaaa 6600cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag
ttcgatgtaa 6660cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt
ttctgggtga 6720gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg
gaaatgttga 6780atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta
ttgtctcatg 6840agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc
gcgcacattt 6900ccccgaaaag tgccacctga aattgtaaac gttaatattt tgttaaaatt
cgcgttaaat 6960ttttgttaaa tcagctcatt ttttaaccaa taggccgaaa tcggcaaaat
cccttataaa 7020tcaaaagaat agaccgagat agggttgagt gttgttccag tttggaacaa
gagtccacta 7080ttaaagaacg tggactccaa cgtcaaaggg cgaaaaaccg tctatcaggg
cgatggccca 7140ctacgtgaac catcacccta atcaagtttt ttggggtcga ggtgccgtaa
agcactaaat 7200cggaacccta aagggagccc ccgatttaga gcttgacggg gaaagccggc
gaacgtggcg 7260agaaaggaag ggaagaaagc gaaaggagcg ggcgctaggg cgctggcaag
tgtagcggtc 7320acgctgcgcg taaccaccac acccgccgcg cttaatgcgc cgctacaggg
cgcgtcccat 7380tcgcca
7386
User Contributions:
Comment about this patent or add new information about this topic: