Patent application number | Description | Published |
20090167050 | SOFT TOP CLOTH WITH STYLING EDGE - The object of providing a technical function edge and a styling edge is solved by the cloth for a soft top according to the invention which is designed to be stretchable over at least one solid element, wherein the solid element comprises at least one offsetting or indentation, and wherein the cloth overstretching the solid element is deformed by suitable clamping devices such that the cloth substantially follows the contour of the offsetting or indentation in the region of the offsetting or indentation. | 07-02-2009 |
20130038092 | Vehicle Roller Blind Arrangement, Subassembly with a Vehicle Roller Blind Arrangement, and Roof Arrangement - A vehicle roller blind arrangement, with a roller blind web that can be wound or unwound in an extension direction, a band-shaped guide element that extends along the extension direction and is guidable in a guide rail, which can be coupled fixedly to a vehicle, in such a manner that said guide element extends parallel to the roller blind web, and a band element that extends along the extension direction and is arranged between the roller blind web and the guide element and, on a first longitudinal side, is coupled fixedly to the roller blind web and, on a second longitudinal side, is coupled fixedly to the guide element. The band element has a T-shaped or Y-shaped cross section, is formed of a different material from the roller blind web, and has a smaller material thickness than the roller blind web. In addition, the invention relates to correspondingly configured subassemblies and roof arrangements. | 02-14-2013 |
Patent application number | Description | Published |
20100197867 | BINDING AGENTS HAVING HIGH OH NUMBER AND CLEAR PAINT COMPOSITION COMPRISING SAID AGENTS AND HAVING GOOD OPTICAL CHARACTERISTICS AND GOOD SCRATCH AND CHEMICAL RESISTANCE - Disclosed are hydroxyl-functional binders having an OH number greater than or equal to 180 mg KOH/g as determined in accordance with DIN 53240 and a solubility parameter SP=10, and to clearcoat compositions comprising said binders. Also disclosed are processes for preparing the disclosed hydroxyl-functional binders, methods of making coated automotive substrates by applying the disclosed clearcoat compositions to automotive substrates, and to coated substrates made therefrom. | 08-05-2010 |
20100273975 | POLYOLS BASED ON MODIFIED AMINO RESINS, THEIR PREPARATION AND - Disclosed herein is a polyol (A) based on modified amino resins, prepared by reacting: an amino resin (B) comprising three acetalized or etherified N-methylol groups of the general formula (I)>N—CHR—OR | 10-28-2010 |
20110245406 | COATING COMPOSITIONS AND COATINGS PRODUCED FROM THEM WITH HIGH SCRATCH RESISTANCE, WEATHERING STABILITY, AND GOOD OPTICAL PROPERTIES - The invention relates to coating compositions comprising
| 10-06-2011 |
20110263789 | CLEAR PAINT COMPOSITIONS COMPRISING HYPERBRANCHED, DENDRITIC, HYDROXYL- FUNCTIONAL POLYESTERS - Disclosed is a hyperbranched, dendritic, hydroxyl-functional polyester comprising an OH number greater than or equal to 180 mg KOH/g as measured via DIN 53240 and to clearcoat compositions comprising said polyesters. Also disclosed are processes for preparing the disclosed polyester, methods of making coated automotive substrates by applying the disclosed clearcoat compositions to automotive substrates, and to coated substrates made therefrom. | 10-27-2011 |
20140378587 | Clearcoat Coating Composition, Method For Production And Use - Described is a clearcoat coating composition, its use, and a process for preparing the clearcoat coating composition. The clearcoat coating composition comprises (A) at least one polyester having an OH number of 80-250 mg KOH/g, comprising (A1) 10 to 20 mol % of at least one acyclic, aliphatic, branched polyol having two hydroxyl groups, (A2) 5 to 15 mol % of at least one acyclic, aliphatic, branched polyol having three hydroxyl groups, (A3) 10 to 20 mol % of at least one acyclic, aliphatic, branched polyol having four hydroxyl groups, (A4) 25 to 40 mol % of at least one cycloaliphatic 1,2-dicarboxylic acid and/or the anhydride of this dicarboxylic acid, and (A5) 20 to 35 mol % of isononanoic acid, wherein the molar fractions are based in each case on the total molar fraction of the compounds (A1) to (A5) and wherein this total molar fraction accounts for at least 70 mol % of the compounds present in the polyester (A); (B) at least one butanol-etherified melamine-formaldehyde resin having a crosslinking onset temperature between 65° C.-100° C. lower than the crosslinking onset temperature of hexamethoxymethylmelamine; (C) at least one butanol-etherified melamine-formaldehyde resin having a crosslinking onset temperature between 30° C.-60° C. lower than the crosslinking onset temperature of hexamethoxymethylmelamine; (D) at least one organic urea compound as rheological assistant; and (E) at least one acid catalyst. | 12-25-2014 |
Patent application number | Description | Published |
20090280179 | Resorbable Calcium Phosphate Based Biopolymer-Cross-Linked Bone Replacement Material - A resorbable bone replacement material made of calcium phosphate particles of different phases which are embedded in an inventive-specific cross-linked collagen matrix. The goal is to form a non-brittle, bone replacement moulded body having a positive fit, i.e. having a shape which is anatomic and/or corresponds to the defect, which perfectly fills the bone defect and can be resorbed thereby. Said goal is achieved by producing the bone replacement material made of a mixture of calcium phosphate particles which is embedded in an inventive cross-linked collagen matrix. In particular, the collagen cross-linking is achieved by a Laccase-induced peptide cross-linking and suitable bridge molecules. Essentially substituted dihydroxyarmotes and/or substrates of the lignolytic polyphenoloxidases, such as Laccases, are suitable as bridge molecules. Also, monocyclic ortho-dihydroxyaromates, monocyclic para-dihydroxyaromates, bicyclic monohydroxyaromates, polycyclic monohydroxyaromates, bicyclic dihydroxyaromates, polycyclic dihydroxyaromates, bicyclic trihydroxyaromates, polycyclic trihydroxyaromates, or mixtures thereof are used. The inventive hydroxyaromates are not part of a polymer chain as opposed to the known conchal adhesive. | 11-12-2009 |
20090318584 | Adhesive for Medical Applications and Means for Haemostasis - The invention relates to a kit comprising the following individual components: (a) polymers comprising at least one free amino group, (b) bridge molecules selected from the group consisting of monocyclic ortho-dihydroxyaromates, mono-cyclic para-dihydroxyaromates, bicyclic monohydrxyaromates, polycyclic monohydroxyaromates, bicyclic dihydroxyaromates, polycyclic dihydroxyaromates, bicyclic trihydroxyaromates, polycyclic trihydroxyaromates, and mixtures thereof, and (c) polyphenoloxidases, in particular, lignolytic polyphenoloxidases, whereby the individual components b) and c) are not in contact. | 12-24-2009 |
20110040086 | Novel Beta-Lactam Antibiotics, Methods for Their Production, and Their Use - The invention relates to novel antimicrobial agents that are based on β-lactam derivatives and are produced by reacting previously known β-lactam derivatives with polyphenol oxidase substrates under the influence of free radicals and by forming salts of any β-lactam derivatives with polyhexamethylene biguanide hydrogen carbonate. Said novel compounds are suitable as an antibiotic. | 02-17-2011 |
20110150943 | ADHESIVE FOR MEDICAL APPLICATIONS AND MEANS FOR HAEMOSTASIS - The invention relates to adhesives for medical applications and methods of their preparation and use. | 06-23-2011 |
Patent application number | Description | Published |
20090239879 | N-OXIDES OF N-PHENYL-2-PYRIMIDINE-AMINE DERIVATIVES - The invention relates to N-phenyl-2-pyrimidine-amine derivatives derivatives in which at least one nitrogen atom carries an oxygen atom to form the corresponding N-oxides, to processes for the preparation thereof, to pharmaceutical compositions comprising those compounds, and to the use thereof in the preparation of pharmaceutical compositions for the therapeutic treatment of warm-blooded animals, including humans. | 09-24-2009 |
20100222362 | N-OXIDES OF N-PHENYL-2-PYRAMIDINE-AMINE DERIVATIVES - The invention relates to N-phenyl-2-pyrimidine-amine derivatives derivatives in which at least one nitrogen atom carries an oxygen atom to form the corresponding N-oxides, to processes for the preparation thereof, to pharmaceutical compositions comprising those compounds, and to the use thereof in the preparation of pharmaceutical compositions for the therapeutic treatment of warm-blooded animals, including humans. | 09-02-2010 |
20110294820 | N-Oxides of n-Phenyl-2-pyrimidine-amine Derivatives - The invention relates to N-phenyl-2-pyrimidine-amine derivatives derivatives in which at least one nitrogen atom carries an oxygen atom to form the corresponding N-oxides, to processes for the preparation thereof, to pharmaceutical compositions comprising those compounds, and to the use thereof in the preparation of pharmaceutical compositions for the therapeutic treatment of warm-blooded animals, including humans. | 12-01-2011 |
20140323494 | N-OXIDES OF N-PHENYL-2-PYRIMIDINE-AMINE DERIVATIVES - The invention relates to N-phenyl-2-pyrimidine-amine derivatives in which at least one nitrogen atom carries an oxygen atom to form the corresponding N-oxides, to processes for the preparation thereof, to pharmaceutical compositions comprising those compounds, and to the use thereof in the preparation of pharmaceutical compositions for the therapeutic treatment of warm-blooded animals, including humans. | 10-30-2014 |
Patent application number | Description | Published |
20090087446 | COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY - Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines. | 04-02-2009 |
20090137519 | SEMI-SOFT C-CLASS IMMUNOSTIMULATORY OLIGONUCLEOTIDES - The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C. | 05-28-2009 |
20110201672 | SEMI-SOFT C-CLASS IMMUNOSTIMULATORY OLIGONUCLEOTIDES - The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C. | 08-18-2011 |
20120219571 | COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY - Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines. | 08-30-2012 |
Patent application number | Description | Published |
20090112554 | Test Bench, Method, and Computer Program Product for Performing a Test Case on an Integrated Circuit - The disclosure relates to a test bench, method, and computer program product for performing a test case on an integrated circuit. The test bench may comprise a simulation environment representing an environment for implementing the integrated circuit and a reference model of the integrated circuit, wherein the reference model may be prepared for running within the simulation environment. The test bench may further comprise a device for running a simulation on the reference model within the simulation environment. The reference model may be based on an original reference model provided for a formal verification. | 04-30-2009 |
20140019780 | ACTIVE POWER DISSIPATION DETECTION BASED ON ERRONOUS CLOCK GATING EQUATIONS - A method detects active power dissipation in an integrated circuit. The method includes receiving a hardware design for the integrated circuit having one or more clock domains, wherein the hardware design comprises a local clock buffer for a clock domain, wherein the local clock buffer is configured to receive a clock signal and an actuation signal. The method includes adding instrumentation logic to the design for the clock domain, wherein the instrumentation logic is configured to compare a first value of the actuation signal determined at a beginning point of a test period to a second value of the actuation signal determined at a time when the clock domain is in an idle condition. The method includes detecting the clock domain includes unintended active power dissipation, in response to the first value of the actuation signal not being equal to the second value of the actuation signal. | 01-16-2014 |
20140136815 | VERIFICATION OF A VECTOR EXECUTION UNIT DESIGN - A method for verification of a vector execution unit design. The method includes issuing an instruction into a first instance and a second instance of a vector execution unit. The method includes issuing a random operand into a first lane of the first instance of the vector execution unit and into a second lane of the second instance of the vector execution unit. The method further includes receiving results from execution of the instruction and the random operand in both the first and the second instance of the vector execution unit and comparing the received results. | 05-15-2014 |
20140156969 | VERIFICATION OF A VECTOR EXECUTION UNIT DESIGN - A method for verification of a vector execution unit design. The method includes issuing an instruction into a first instance and a second instance of a vector execution unit. The method includes issuing a random operand into a first lane of the first instance of the vector execution unit and into a second lane of the second instance of the vector execution unit. The method further includes receiving results from execution of the instruction and the random operand in both the first and the second instance of the vector execution unit and comparing the received results. | 06-05-2014 |
20140195785 | FORMAL VERIFICATION OF A LOGIC DESIGN - A method is provided for verification of a logic design for a processor execution unit which includes an instruction pipeline with one or more pipeline stages. The method includes: creating a design under test using at least a first and a second instance of the logic design; initializing the instruction pipeline using the first instance of the design under test with the same value in each instruction pipeline stage and the second instance with random values in its pipeline stages; selecting an instruction of the processor execution unit out of a plurality of instructions and simultaneously issuing the instruction to each instance of the design under test; providing a comparison between the outputs of the instruction pipeline executing the instruction for each instance; and if the instruction is verifiable by formal model checking, approving the correctness of the logic design if the comparison result is true. | 07-10-2014 |
Patent application number | Description | Published |
20100160476 | FLAME-RETARDANT ADDITIVES - The present invention relates to a curable preparation, containing an epoxy resin system, an initiator, and at least one flame-retardant agent, selected from a compound of the formula KA, wherein K=mono, di, oligo, and/or polphosphonium cation, and A=low-coordinating anion, and to the sue of the compounds of the general formula KA as a flame-retardant agent for resins systems. | 06-24-2010 |
20100285309 | PRIMER COMPOSITIONS FOR ADHESIVE BONDING SYSTEMS AND COATINGS - The present invention relates to aqueous-based primer composition, comprising at least one thermosetting, self-emulsifying epoxy resin composition; at least one thermosetting, non-self-emulsifying resin composition; water; and at least one curative. | 11-11-2010 |
20120156386 | ANIONIC WETTING AGENTS FOR STABILIZING SELF-DEPOSITING COMPOSITIONS COMPRISING OXIDIC PIGMENTS - The present invention relates to an acidic aqueous particulate composition containing, in addition to iron(III) ions, fluoride ions and at least one water-insoluble, dispersed organic binder, a water-insoluble, dispersed oxide pigment with elevated resistance to agglomeration for the autophoretic deposition of organic-inorganic hybrid layers onto metal surfaces, the composition additionally containing at least one anionic wetting agent which comprises functional groups selected from sulfonates, phosphonates and/or carboxylates. The invention furthermore comprises the use of such a composition for the autodeposition of a film-forming organic-inorganic hybrid coating onto metal surfaces which are at least in part selected from surfaces, the main constituents of which are iron, zinc and/or aluminum. | 06-21-2012 |
Patent application number | Description | Published |
20090261962 | Tire Sensor Module and Method for its Manufacture - A tire sensor module having a circuit carrier, on or in which at least one sensor element is attached for measuring a measured variable, an antenna for transmitting sensor signals to a receiving unit of the vehicle, and a housing, in whose housing inner chamber the circuit carrier is received, the antenna being provided in the housing material of the housing or on a housing side of the housing. | 10-22-2009 |
20110229375 | Microfluidic System for Purposes of Analysis and Diagnosis and Corresponding Method for Producing a Microfluidic System - A microfluidic system for purposes of analysis and diagnosis is made up of layers arranged substantially one above the other. The microfluidic system includes at least a first and a second conducting-through layer, which respectively comprise at least one channel for a fluid to be conducted through in the respective conducting-through layer. The microfluidic system further includes at least one chip layer, which comprises at least one active, micromechanical element, the active, micromechanical element being in operative connection with at least one of the channels, and the chip layer being arranged between the first and the second conducting-through layer, and the channels being fluidically connected to one another. A corresponding production method is disclosed in addition to the microfluid system. | 09-22-2011 |
20110291301 | Method for Producing Semiconductor Components, and Corresponding Semiconductor Component - A method for producing semiconductor components and a component obtainable by such a method is disclosed. The method comprises the following steps: fixing a conductive film on a carrier; adhesively bonding semiconductor chips onto the conductive film using an adhesive layer, wherein active surfaces of the semiconductor chips, the active surfaces having connection contacts, are situated on that side of the chips which faces the film; overmolding the chips adhesively bonded onto the conductive film with a molding compound; and releasing the conductive film with the overmolded chips from the carrier. In this case, the adhesive layer is structured in such a way that at least connection contacts of the semiconductor chips are free of the adhesive layer and are kept free of the molding compound. | 12-01-2011 |
20120024396 | Method for Producing a Microfluidic System - A method for producing a microfluidic system, containing at least one microfluidic component having at least one microfluidically active surface is disclosed. The method includes providing a microfluidic composite substrate having a connection side, comprising at least one microfluidic component introduced into a polymer composition, wherein the microfluidically active surface of said component forms a part of the connection side of the microfluidic composite substrate. The method further includes providing a mating substrate having a connection side for connection to the microfluidic composite substrate. Also, the method includes providing microfluidic structures at least on the connection side of the composite substrate and/or on the connection side of the mating substrate at least for the purpose of forming a microfluidic channel structure in the microfluidic system. In addition, the method includes connecting the microfluidic composite substrate and the mating substrate by their connection sides to form a microfluidic channel structure. | 02-02-2012 |
20120091544 | COMPONENT HAVING A MICROMECHANICAL MICROPHONE STRUCTURE, AND METHOD FOR ITS PRODUCTION - A component having a robust, but acoustically sensitive microphone structure is provided and a simple and cost-effective method for its production. This microphone structure includes an acoustically active diaphragm, which functions as deflectable electrode of a microphone capacitor, a stationary, acoustically permeable counter element, which functions as counter electrode of the microphone capacitor, and an arrangement for detecting and analyzing the capacitance changes of the microphone capacitor. The diaphragm is realized in a diaphragm layer above the semiconductor substrate of the component and covers a sound opening in the substrate rear. The counter element is developed in a further layer above the diaphragm. This further layer generally extends across the entire component surface and compensates level differences, so that the entire component surface is largely planar according to this additional layer. This allows a foil to be applied on the layer configuration of the microphone structures exposed in the wafer composite, which makes it possible to dice up the components in a standard sawing process. | 04-19-2012 |
20120181639 | COMPONENT AND METHOD FOR THE MANUFACTURE THEREOF - A cost-effective and space-saving component that includes a MEMS element and an access channel to the membrane structure of the MEMS element. | 07-19-2012 |
20120212925 | Component support and assembly having a mems component on such a component support - A component support allows cost-effective, space-saving and low-stress packaging of MEMS components having a sensitive structure. The component support is suited, in particular, for MEMS components, which are mounted in the cavity of a housing and are intended to be electrically contacted. The component support is produced as a composite part in the form of a hollow body open on one side, the composite part being made essentially of a three-dimensionally shaped carrier foil flexible in its shaping, and an encasing material. The encasing material is molded onto one side of the carrier foil, so that the carrier foil is situated on the inner wall of the component support. At least one mounting surface for at least one component is formed on the inner wall having the carrier foil. The carrier foil is also provided with contact surfaces and insulated conductive paths for electrically contacting the at least one component. | 08-23-2012 |
20120235256 | COMPONENT - A wafer-level-based packaging concept for MEMS components having at least one diaphragm structure formed in the component front side is described, according to which an interposer is connected to the front side of the MEMS component, which has at least one passage aperture as an access opening to the diaphragm structure of the MEMS component and which is provided with electrical through contacts so that the MEMS component is electrically contactable via the interposer. The cross-sectional area of the at least one passage aperture in the interposer is to be designed as significantly smaller than the lateral extension of the diaphragm structure of the MEMS component. The at least one passage aperture opens into a cavity between the diaphragm structure and the interposer. | 09-20-2012 |
20130094684 | MICROMECHANICAL FUNCTIONAL APPARATUS, PARTICULARLY A LOUDSPEAKER APPARATUS, AND APPROPRIATE METHOD OF MANUFACTURE - A micromechanical functional apparatus, particularly a loudspeaker apparatus, includes a substrate, at least one circuit chip mounted on the substrate, and an enveloping package in which the circuit chip is packaged. The functional apparatus further includes a micromechanical functional arrangement, particularly a loudspeaker arrangement having a plurality of micromechanical loudspeakers, which is mounted on the enveloping package. A covering device is mounted above the micromechanical functional arrangement, particularly the loudspeaker arrangement, opposite the enveloping package. A method is implemented to manufacture the micromechanical functional apparatus. | 04-18-2013 |
20130126991 | MICROMECHANICAL FUNCTIONAL APPARATUS, PARTICULARLY A LOUDSPEAKER APPARATUS, AND APPROPRIATE METHOD OF MANUFACTURE - A micromechanical functional apparatus, particularly a loudspeaker apparatus, includes a substrate having a top and an underside and at least one circuit chip mounted on the underside in a first cavity. The apparatus further includes a micromechanical functional arrangement, particularly a loudspeaker arrangement, having a plurality of micromechanical loudspeakers mounted on the top in a second cavity. A covering device is mounted above the micromechanical functional arrangement on the top. An appropriate method is implemented to manufacture the micromechanical functional apparatus. | 05-23-2013 |
20130126992 | MEMS Chip Package and Method for Manufacturing an MEMS Chip Package - A MEMS chip package includes a first chip, a second chip, a first coupling element, and a first redistribution layer. The first chip has a first chip surface and a second chip surface, which is opposite the first chip surface. The second chip has a first chip surface and a second chip surface, which is opposite the first chip surface. The first coupling element couples the first chip surface of the second chip to the first chip surface of the first chip, so that a first cavity is defined between the first chip and the second chip. The first redistribution layer is mounted on the second chip surface of the second chip and is configured to provide contact with a substrate. | 05-23-2013 |
20130228937 | Micromechanical Sound Transducer Arrangement and a Corresponding Production Method - A micromechanical sound transducer arrangement includes an electrical printed circuit board having a front side and a rear side. A micromechanical sound transducer structure is applied to the front side using the flip-chip method. The printed circuit board defines an opening for emitting soundwaves in the region of the micromechanical sound transducer structure. | 09-05-2013 |
20130256919 | MULTIFUNCTION SENSOR AS POP MICROWAVE PCB - A method for producing a component with at least one micro-structured or nano-structured element includes applying at least one micro-structured or nano-structured element to a carrier. The element has at least one area configure to make contact and the element is applied to the carrier such that the at least one area adjoins the carrier. The element is enveloped in an enveloping compound and the element-enveloping compound composite is detached from the carrier. A first layer comprising electrically conductive areas is applied to the side of the element-enveloping compound composite that previously adjoined the carrier. At least one passage is introduced into the enveloping compound. A conductor layer is applied to the surface of the passage and at least to a section of the layer comprising the first electrically conductive areas to generate a through contact, which enables space-saving contacting. A component is formed from the method. | 10-03-2013 |
Patent application number | Description | Published |
20090053465 | SCRATCH RESISTANT, REFLECTION REDUCING SURFACE HAVING ANTI-FOGGING PROPERTIES - An optical element or component having excellent anti-fog effects as well as excellent scratch resistance and/or reflection reducing effects and optionally also hydrophobic and/or oleophobic properties, and a method for producing such an optical element or component. The element or component includes, in the following order, a glass substrate, a water-absorbing first layer, and a second layer selected from (i) an anti-reflecting coating; a mirror coating and a hard layer; (ii) a compound and/or combination of a hard layers and anti-reflecting coatings; and (iii) a compound and/or combination of hard layers and mirror coating. Blind holes or bores are introduced into the second layer and the water-absorbing first layer with the holes opening out from the second layer and extending completely through the second layer, and at least partially through the water-absorbing first layer. | 02-26-2009 |
20090261063 | Method for Producing a Nanostructure on a Plastic Surface - A nanostructure is produced at a surface of a substrate composed of a plastic by means of a plasma etching process. A thin layer is applied to the plastic substrate and the plasma etching process is subsequently carried out. | 10-22-2009 |
20100033819 | Optical Element with an Anti-Fog Layer and Method for its Production - An optical element is provided with a fog reducing polymer layer. A reflection reducing nanostructure is formed on the surface of the fog reducing polymer layer. | 02-11-2010 |
20100062175 | Method for Manufacturing an Optical Waveguide Layer - A method for manufacturing an optical waveguide layer includes a substrate that is prepared, onto which a first part-layer is first grown. Subsequently, a second part-layer of the waveguide layer, consisting of the same material as the first part-layer, is grown on the first part-layer. The second part-layer is bombarded with ions as it grows. The method permits manufacturing optical waveguide layers on temperature-sensitive polymer substrates. | 03-11-2010 |
20110051246 | Reflection-Reducing Interference Layer System and Method for Producing It - A reflection-reducing interference layer system is disclosed, which has at least three alternating layers having different refractive indices. At least one nanostructured layer comprising an organic material or an organic-inorganic hybrid material is applied to the alternating layers. With the interference layer system, it is possible to obtain very low reflection over a wide wavelength and incident angle range. | 03-03-2011 |
20130182329 | Plastic Substrate having a Porous Layer and Method for Producing the Porous Layer - A plastic substrate has a porous layer on a surface. The porous layer is formed at least partially from a material of the plastic substrate and has pores. The proportion by volume of pores is greater in a first region of the porous layer than in a second region of the porous layer. The second region follows the first region, as seen proceeding from the plastic substrate. The porous layer can be produced by a plasma process that simultaneously effects structuring of the plastic substrate by ion bombardment and coating of the plastic substrate. | 07-18-2013 |
20140072721 | Method for Modifying a Surface of a Substrate using Ion Bombardment - A process is described for modification of a surface of a substrate by ion bombardment, in which the ions are produced by means of a magnetic field-assisted glow discharge in a process gas. The magnetic field-assisted glow discharge is produced by means of a magnetron having an electrode and at least one magnet for production of the magnetic field. The process gas has at least one electronegative constituent, such that negative ions are produced in the magnetic field-assisted glow discharge, and the negative ions which are produced at the surface of the electrode are accelerated in the direction of the substrate by an electrical voltage applied to the electrode. | 03-13-2014 |
20140374377 | Method for Producing an Antireflection Coating - A method for producing an antireflection coating on a substrate is specified. A first nanostructure in a first material is formed using by means of a first plasma etching process. The first material is the material of the substrate or the material of a layer made of a first organic material applied onto the substrate. A layer made of a second material is applied onto the first nanostructure, the second material is an organic material. A second nanostructure is formed in the layer made of the second material using a second plasma etching process. The second material has a higher etching rate than the first material when carrying out the second plasma etching process. | 12-25-2014 |
Patent application number | Description | Published |
20110081303 | TEETH CLEANING COMPOUND CONTAINING MENTHOL WITH REDUCED BITTER SENSATION - The present invention primarily concerns teeth cleaning compounds containing menthol for use with a toothbrush, preferably tooth pastes, tooth crèmes, tooth cleaning gels or tooth powders. Such a tooth cleaning compound according to the invention contains menthol and a quantity, for masking the bitterness of the menthol, of menthane carboxylic acid-N-(4-methoxyphenyl)-amide (WS-12) of the following formula (Ia), in particular of the following formula (Ib), i.e. L-menthane carboxylic acid-N-(4-methoxyphenyl)-amide. | 04-07-2011 |
20120128744 | MIXTURE CONTAINING MENTHOL - The present invention relates to d,l-menthol and optionally additionally l-menthol-containing mixtures, which are liquid at normal pressure and a temperature of 20° C. or higher. The present invention further relates to products that comprise such a mixture or that are preparable by mixing or contacting such a mixture with further ingredients, and novel processes for preparing menthol-containing products. | 05-24-2012 |
20120263659 | USE OF PHYSIOLOGICAL COOLING ACTIVE INGREDIENTS, AND AGENTS CONTAINING SUCH ACTIVE INGREDIENTS - The invention relates to a TRPM8 modulator for achieving a cooling effect on the skin or a mucous membrane. | 10-18-2012 |
20150086491 | USE OF PHYSIOLOGICAL COOLING ACTIVE INGREDIENTS, AND AGENTS CONTAINING SUCH ACTIVE INGREDIENTS - The invention relates to a TRPM8 modulator for achieving a cooling effect on the skin or a mucous membrane. | 03-26-2015 |
Patent application number | Description | Published |
20100129388 | PROTECTIVE PROTEINS OF S. AGALACTIAE, COMBINATIONS THEREOF AND METHODS OF USING THE SAME - The invention relates to a composition comprising at least two protective proteins against | 05-27-2010 |
20100260790 | S. Pneumoniae Antigens - The present invention discloses isolated nucleic acid molecules encoding a hyperimmune serum reactive antigen or a fragment thereof as well as hyperimmune serum reactive antigens or fragments thereof from | 10-14-2010 |
20110236410 | KLEBSIELLA ANTIGENS - The present invention relates to isolated nucleic acid molecules which encode an antigen, a vector which comprises such nucleic acid molecule, and a host cell comprising such vector. Furthermore, the invention provides antigens from a | 09-29-2011 |
20130011403 | KLEBSIELLA ANTIGENS - The present invention relates to an isolated nucleic acid molecule encoding an antigen, a vector comprising such nucleic acid molecule and a host cell comprising such vector. Furthermore, the invention provides antigens from | 01-10-2013 |
20130101613 | PROTECTIVE PROTEINS OF S. AGALACTIAE, COMBINATIONS THEREOF AND METHODS OF USING THE SAME - The invention relates to a composition comprising at least two protective proteins against | 04-25-2013 |
20130136761 | S. PNEUMONIAE ANTIGENS - The present invention discloses isolated nucleic acid molecules encoding a hyperimmune serum reactive antigen or a fragment thereof as well as hyperimmune serum reactive antigens or fragments thereof from | 05-30-2013 |
20130230526 | KLEBSIELLA ANTIGENS - The present invention relates to an isolated nucleic acid molecule encoding an antigen, a vector comprising such nucleic acid molecule and a host cell comprising such vector. Furthermore, the invention provides antigens from | 09-05-2013 |
20140212448 | KLEBSIELLA ANTIGENS - The present invention relates to an isolated nucleic acid molecule encoding an antigen, a vector comprising such nucleic acid molecule and a host cell comprising such vector. Furthermore, the invention provides antigens from | 07-31-2014 |
Patent application number | Description | Published |
20090118286 | Heterobicyclic Acrylamides - Use of heterobicyclic acrylamides of the formula (I) | 05-07-2009 |
20100113276 | USE OF N2-PHENYLAMIDINES AS HERBICIDES - The use of N | 05-06-2010 |
20110287108 | PESTICIDE COMPOSITION COMPRISING A TETRAZOLYLOXIME DERIVATIVE AND A FUNGICIDE OR AN INSECTICIDE ACTIVE SUBSTANCE - The present invention relates to a pesticide composition intended for protecting plants, crops or seeds against fungal diseases or insect damages, and the corresponding methods of protection by application of the said composition. More precisely, the subject of the present invention is a pesticide composition based on a tetrazolyloxime derivative and a fungicide or an insecticide active substance or compound. | 11-24-2011 |
20120065164 | FUNGICIDE PYRAZOLE CARBOXAMIDES DERIVATES - The present invention relates to pyrazole carboxamides derivatives of formula (1) wherein Y represents CR | 03-15-2012 |
20130131119 | N-[(HET)ARYLETHYL)] PYRAZOLE(THIO)CARBOXAMIDES AND THEIR HETEROSUBSTITUTED ANALOGUES - The present invention relates to fungicidal N-[(het)arylethyl)] pyrazolecarboxamide or thiocarboxamide and their heterosubstituted analogues, their process of preparation and intermediate compounds for their preparation, their use as fungicides, particularly in the form of fungicidal compositions and methods for the control of phytopathogenic fungi of plants using these compounds or their compositions. | 05-23-2013 |
20130203708 | ACTIVE SUBSTANCE COMBINATIONS THAT HAVE NEMATICIDAL, INSECTICIDAL, AND FUNGICIDAL PROPERTIES AND ARE BASED ON TRIFLUOROBUTENYL COMPOUNDS - Disclosed are novel active substance combinations comprising specific heterocyclic trifluorobutenyls and previously known fungicidal agents. Said active substance combinations have a very good synergistic fungicidal, nematicidal, insecticidal, and/or acaricidal effect. | 08-08-2013 |
Patent application number | Description | Published |
20090259083 | METHOD OF REGENERATING RUTHENIUM CATALYSTS FOR THE HYDROGENATION OF BENZENE - The present patent application describes a method of regenerating a ruthenium catalyst for the hydrogenation of benzene, which comprises flushing the catalyst with inert gas in a regeneration step until the original activity or part of the original activity has been attained. | 10-15-2009 |
20110130607 | REACTOR FOR CARRYING OUT AUTOTHERMAL GAS-PHASE DEHYDROGENATIONS - A reactor ( | 06-02-2011 |
20110152576 | PROCESS FOR PREPARING CYCLIC KETONES - The present invention relates to a process for preparing at least one monocyclic ketone having from 4 to 20 carbon atoms by reacting a mixture G | 06-23-2011 |
20120157719 | TUBE BUNDLE REACTOR FOR UNCATALYZED OR HOMOGENEOUSLY CATALYZED REACTIONS - The invention relates to a tube bundle reactor with a flat feed hood. Alternatively, the release hood may also have a flat design. The flat design reduces the heat of reaction which arises in the hood in the case of reaction types which take place not only in the tube bundle (uncatalyzed reactions and reactions with homogeneously distributed catalyst). This greatly suppresses undesired reactions which already take place in the hood owing to accumulated heat, which achieves a higher selectivity in the case of thermally sensitive reactions. In addition, the thermal distribution within the hoods can be controlled precisely. | 06-21-2012 |
20120157737 | REACTOR FOR CARRYING OUT AN AUTOTHERMAL GAS-PHASE DEHYDROGENATION - A reactor includes an essentially horizontal cylinder for carrying out an autothermal gas-phase dehydrogenation of a hydrocarbon-comprising gas stream using an oxygen-comprising gas stream to give a reaction gas mixture over a heterogeneous catalyst configured as monolith. The interior of the reactor is divided by a detachable, cylindrical or prismatic housing, which is arranged in the longitudinal direction of the reactor and is gastight in the circumferential direction, into an inner region having one or more catalytically active zones, each having a packing composed of monoliths stacked on top of one another, next to one another and behind one another and before each catalytically active zone in each case a mixing zone having solid internals are provided and into an outer region, which is supplied with an inert gas, arranged coaxially to the inner region. A heat exchanger is connected to the housing at one end of the reactor. | 06-21-2012 |
20120277473 | OXIDATIVE DEHYDROGENATION OF METHANOL TO FORMALDEHYDE OVER SILVER-CONTAINING KNITS - In a process for producing C | 11-01-2012 |
20130035529 | CONTINUOUS PROCESS FOR CARRYING OUT AUTOTHERMAL GAS-PHASE DEHYDROGENATIONS - The invention relates to a process for the autothermal gas-phase dehydrogenation of a hydrocarbon-comprising gas stream by means of an oxygen-comprising gas stream over a heterogeneous catalyst configured as a monolith to give a reaction gas mixture and regeneration of the catalyst in a reactor in the form of a cylinder or prism, wherein the reactor is operated alternately in the production mode of the autothermal gas-phase dehydrogenation and in the regeneration mode. | 02-07-2013 |
20130035531 | REACTOR FOR CARRYING OUT AN AUTOTHERMAL GAS-PHASE DEHYDROGENATION - A reactor in the form of a cylinder or prism wherein
| 02-07-2013 |
Patent application number | Description | Published |
20080216652 | PROCESS AND DEVICE FOR SEPARATING HYDROGEN FROM GAS FLOWS HAVING AN OXYGEN CONSTITUENT - A process and a device for separating hydrogen from a gas flow having an oxygen constituent, comprised primarily of hydrogen, nitrogen, oxygen, carbon dioxide, carbon monoxide, methane and/or other hydrocarbons, is disclosed. The gas flow is compressed in a multi-stage compression process and then cooled to room temperature by a heat exchanger. After a pre-adsorber, the gas flow is fed to a catalytic process for removing the oxygen. The catalytic reaction for removing the oxygen takes place exothermically. The gas flow is then cooled to room temperature via another heat exchanger and fed to a pressure swing adsorption process for hydrogen separation. The hydrogen is separated there from the residual gas. | 09-11-2008 |
20080311015 | PROCESS AND DEVICE FOR SEPARATING HYDROGEN FROM GAS FLOWS BY A PRESSURE SWING ADSORPTION PROCESS - A process for separating hydrogen from a gas flow having an oxygen constituent and including predominantly hydrogen, nitrogen, oxygen, carbon dioxide, carbon monoxide, methane and/or other hydrocarbons, as well as a device for conducting the process, is disclosed. The gas flow undergoes a process to thermally convert oxygen prior to the pressure swing adsorption process. | 12-18-2008 |
20120014855 | APPARATUS AND PROCESS FOR DECOMPOSING DINITROGEN MONOXIDE IN AN ADIABATIC FIXED BED REACTOR - The invention relates to an apparatus and to a process for decomposing dinitrogen monoxide. The apparatus comprises a gas inlet | 01-19-2012 |
20120063982 | PROCESS AND DEVICE FOR DECOMPOSING LAUGHING GAS - The laughing-gas-containing gas ( | 03-15-2012 |
Patent application number | Description | Published |
20110130437 | SALT FORMS OF A 6-FLUORO-1,2-DIHYDRO-2-OXO-3H-INDOL-3-YLIDENE DERIVATIVE, PROCESS FOR THEIR MANUFACTURE AND PHARMACEUTICAL COMPOSITIONS CONTAINING SAME - The present invention relates to salt forms of the compound 4-[(Z)-[[4-[(dimethylaminoJmethyllphenyllaminolCe-fluoro-1,2-dihydro2-oxo-3H-indol-3-ylidene)methyl]-benzenepropanoic acid which are suitable for pharmaceutical development and to a process for their manufacture. | 06-02-2011 |
20110262369 | CRYSTALLINE, ENANTIOMERICALLY PURE SALT FORM OF A BETA-AGONIST, AND THE USE THEREOF AS A DRUG - The invention relates to a crystalline, enantiomerically pure hydrochloride salt of N-(5-{2-[3-(4,4-diethyl-2-oxo-4H-benzo[d][1,3]oxazin-1-yl)-1,1-dimethyl-propylamino]-1-hydroxy-ethyl}-2-hydroxy-phenyl)-methane sulfonamide, preferably N-(5-{(R)-2-[3-(4,4-diethyl-2-oxo-4H-benzo[d][1,3]oxazin-1-yl)-1,1-dimethyl-propylamino]-1-hydroxy-ethyl}-2-hydroxy-phenyl)-methane sulfonamide, and the effect thereof as a long-term betamimetic agent, alone or combined with at least one other active ingredient, in the treatment of respiratory diseases. | 10-27-2011 |
20120058994 | NOVEL COMPOUNDS - The invention relates to the novel salts AB of the base A with a physiologically acceptable acid B which is selected from the group consisting of hydrochloric acid, hydrobromic acid, sulfuric acid, fumaric acid and silcylic acid and the polymorphic compounds, the corresponding solvates and hydrates thereof. | 03-08-2012 |