Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees


03rd week of 2013 patent applcation highlights part 30
Patent application numberTitlePublished
20130017205Inhibition of AXL Signaling in Anti-Metastatic Therapy - Compositions and methods are provided for alleviating cancer in a mammal by administering a therapeutic dose of a pharmaceutical composition that inhibits activity of AXL protein activity, for example by competitive or non-competitive inhibition of the binding interaction between AXL and its ligand GAS6.2013-01-17
20130017206MCAM MODULATION AND USES THEREOF - Methods, uses, agents and compositions useful for the diagnosis, prevention and/or treatment of inflammatory conditions, such as neuroinflammatory conditions such as multiple sclerosis, and for the identification and selection of inflammatory cytokine-secreting T cell or a precursor thereof, based on the expression and/or modulation of melanoma cell adhesion molecule (MCAM) are disclosed.2013-01-17
20130017207CHEMOTHERAPEUTIC METHODS AND COMPOSITIONS - Disclosed herein are methods and compositions for enhancing the cell-killing activity of anti-neoplastic agents by inhibiting the activity of a lysyl oxidase-type enzyme. Also disclosed are methods for screening for chemotherapeutic agents, and for molecules that enhance the activity of chemotherapeutic agents, using cells grown on an extracellular matrix.2013-01-17
20130017208Anti-IL-6 Antibodies, Compositions, Methods and Uses - An anti-IL-6 antibody, including isolated nucleic acids that encode at least one anti-IL-6 antibody, vectors, host cells, transgenic animals or plants, and methods of making and using thereof have applications in diagnostic and/or therapeutic compositions, methods and devices.2013-01-17
20130017209A-BETA BINDING POLYPEPTIDES - The invention relates to biparatopic A-beta binding polypeptides and, more specifically, to biparatopic A-beta binding polypeptides comprising at least two immunoglobulin single variable domains binding to different epitopes of A-beta. The invention also relates to specific sequences of such polypeptides, methods of their production, and methods of using them, including methods of treatment of diseases such as Alzheimer's Disease.2013-01-17
20130017210DISPLAY OF ANTIBODY FRAGMENTS ON VIRUS-LIKE PARTICLES OF RNA BACTERIOPHAGES - The invention enables the display of antibody single-chain variable fragments (scFv's on virus-like particles (VLPs) of bacteriophages such as MS2. The VLPs encapsidate mRNA encoding the coat protein from which it assembles, enabling the recovery by reverse transcription and PGR of affinity-selected sequences from scFv libraries. Related virus-like particles, method for constructing a library of scFv-VLPs, drug delivery vehicles comprising one or more pharmaceutically-active ingredients, biomedical imaging agents, assays, and kits are also provided.2013-01-17
20130017211USE OF BETA-1,3 (4)-ENDOGLUCANOHYDROLASE, BETA-1,3 (4)-GLUCAN, DIATOMACEOUS EARTH, MINERAL CLAY AND GLUCOMANNAN TO AUGMENT IMMUNE FUNCTION - A method for the augmentation of immune function is described. The invention comprises a combination of β-1,3 (4)-endoglucanohydrolase, β-1,3 (4)-glucan, diatomaceous earth, mineral clay and glucomannan, which is fed to or consumed by mammalian or avian species in amounts sufficient to augment immune function. The invention described may be admixed with feeds or foods, incorporated into pelleted feeds or foods or administered orally to mammalian and avian species.2013-01-17
20130017212THERAPEUTIC USE OF THE 2m PROTEINAANM Mersel; MarcelAACI MontpellierAACO FRAAGP Mersel; Marcel Montpellier FRAANM Rakotoarivelo; ClovisAACI MontpellierAACO FRAAGP Rakotoarivelo; Clovis Montpellier FR - The use of beta2-microglobulin (β2m) as active ingredient, in particular in pharmaceutical compositions intended for the treatment of autoimmune diseases.2013-01-17
20130017213PEPTIDE ANALOGUES - Some embodiments relate to analogs of peptides corresponding to class I MHC-restricted T cell epitopes and methods for their generation. These analogs can contain amino acid substitutions at residues that directly interact with MHC molecules, and can confer improved, modified or useful immunologic properties. Additionally, classes of analogs, in which the various substitutions comprise the non-standard residues norleucine and/or norvaline, are disclosed.2013-01-17
20130017214BACTEREMIA-ASSOCIATED ANTIGEN FROM STAPHYLOCOCCUS AUREUSAANM Edgeworth; JonathanAACI LondonAACO GBAAGP Edgeworth; Jonathan London GB - The BAA antigen of 2013-01-17
20130017215SECRETED CAMPYLOBACTER FLAGELLA COREGULATED PROTEINS AS IMMUNOGENS - The invention relates to an immunogenic composition composed of secreted polypeptides derived from 2013-01-17
20130017216Modified Influenza Virus For Monitoring And Improving Vaccine Efficiency - The immunogenicity of the influenza virus hemagglutinin (HA) molecule may be increased by substitutions of amino acids in the HA sequence. The substitution of specific HA residues, such as asparagine at position 223 of H5 HA, increase the sensitivity of the hemagglutinin inhibition (HI) assay by altering receptor specificity and/or antibody-antigen binding. HA molecules containing such substitutions will be useful in the development of diagnostic reference viruses and improved influenza vaccines.2013-01-17
20130017217CODON-OPTIMIZED POLYNUCLEOTIDE-BASED VACCINES AGAINST HUMAN CYTOMEGALOVIRUS INFECTION - The invention relates to plasmids operably encoding HCMV antigens, in which the naturally-occurring coding regions for the HCMV antigens have been modified for improved translation in human or other mammalian cells through codon optimization. HCMV antigens, which are useful in the invention include, but are not limited to pp65, glycoprotein B (gB), IE1, and fragments, variants or derivatives of any of these antigens. In certain embodiments, sequences have been deleted, e.g., the Arg435-Lys438 putative kinase in pp65 and the membrane anchor and endocellular domains in gB. The invention is further directed to methods of inducing an immune response to HCMV in a mammal, for example, a human, comprising delivering a plasmid encoding a codon-optimized HCMV antigen as described above. The invention is also directed to pharmaceutical compositions comprising plasmids encoding a codon-optimized HCMV antigen as described above, and further comprising adjuvants, excipients, or immune modulators.2013-01-17
20130017218LIVE BACTERIAL VACCINE SAFETY - The present invention provides for a method of reducing the reactogenicity of live attentuated bacterial vaccines by deleting at least a portion (e.g., the TLR-5 stimulating domain of a flagellin protein) of at least one of the bacterial genes that encodes a flagellin from the bacterium genome. These vaccines are directed against enteric or non-enteric flagellin-producing bacteria. A particular embodiment provides for a live attenuated cholera vaccine having reduced reactogenicity.2013-01-17
20130017219PURIFICATION OF BACTERIAL VESICLESAANM Di Cioccio; VitoAACI Rapolano TermeAACO ITAAGP Di Cioccio; Vito Rapolano Terme ITAANM Colucci; Anna MariaAACI Martina FrancaAACO ITAAGP Colucci; Anna Maria Martina Franca ITAANM Saul; Allan JamesAACI Castellina in ChiantlAACO ITAAGP Saul; Allan James Castellina in Chiantl IT - A two stage size filtration process is used to purify immunogenic bacterial vesicles. A first step separates the vesicles from intact bacteria based on their different sizes, with the smaller vesicles passing into the filtrate (permeate). A second step then uses a finer filter to remove smaller contaminants, with the vesicles remaining in the retentate. This two stage process is extremely simple to operate but has been shown to give vesicles of high purity.2013-01-17
20130017220GEL VACCINE DELIVERY SYSTEM FOR TREATING POULTRY - Safe and effective gel-bead vaccines for treating domesticated birds for diseases caused by cyst-forming protozoa, especially for coccidiosis.2013-01-17
20130017221PRIMERS FOR DETECTING PLASMODIUM - The present invention provides an easy and rapid method for detecting/identifying the presence or absence of specific 2013-01-17
20130017222HUMAN PROSTATE CELL LINES IN CANCER TREATMENT - The invention provides methods and compositions for the treatment of primary, metastatic, and residual cancer in mammals, and more particularly, the use of materials such as whole cells and derivatives and portions thereof to stimulate the immune system to attack cancer.2013-01-17
20130017223METHODS AND COMPOSITIONS FOR DELIVERY OF NUCLEIC ACIDS - A lipid particle can include a plurality of cationic lipids, such as a first cationic lipid and a second cationic lipid. The first cationic lipid can be selected on the basis of a first property and the second cationic can be selected on the basis of a second property. The first and second properties are complementary. The attributes of the lipid particle can reflect the selected properties of the cationic lipids, and the complementary nature of those properties.2013-01-17
20130017224Nucleic Acid Molecules Encoding Rantes, and Compositions Comprising and Methods of Using the Same - Nucleic acid molecules comprising a nucleotide sequence encoding RANTES and fragments and variants thereof are disclosed. Additionally, nucleic acid molecules and compositions comprising the nucleotide sequence encoding RANTES and fragments and variants thereof in combination with nucleic acid sequences encoding immunogens are provided. Recombinant viral vectors comprising the nucleotide sequence encoding RANTES and fragments and variants thereof with or without a nucleic acid sequence encoding immunogens are also provided as are live attenuated pathogens comprising a nucleotide sequence encoding RANTES and fragments and variants thereof. Methods of modulating immune responses and of inducing an immune response against an immunogen are also disclosed.2013-01-17
20130017225NATURAL PLANT PRODUCTS FOR CONTROL OF CANCER METASTASIS - The invention provides compositions comprising soluble extracts or isolated polypeptides from the edible roots of the plant 2013-01-17
20130017226TNF-A and TWEAK Dual Antagonist for the Prophylaxis and Treatment of Autoimmune DiseasesAANM Park; Young WooAACI DaejeonAACO KRAAGP Park; Young Woo Daejeon KRAANM Jo; Ki WonAACI Gyeonggi-doAACO KRAAGP Jo; Ki Won Gyeonggi-do KRAANM Yoo; Srok HoAACI DaejeonAACO KRAAGP Yoo; Srok Ho Daejeon KRAANM Yu; JungAACI DaejeonAACO KRAAGP Yu; Jung Daejeon KRAANM Kim; Dong JiAACI DaejeonAACO KRAAGP Kim; Dong Ji Daejeon KRAANM Yoon; Sun-HaAACI DaejeonAACO KRAAGP Yoon; Sun-Ha Daejeon KRAANM Song; Eun JungAACI DaejeonAACO KRAAGP Song; Eun Jung Daejeon KRAANM Lee; Eun KyungAACI Gyeonggi-doAACO KRAAGP Lee; Eun Kyung Gyeonggi-do KRAANM Oh; Jin MiAACI Gyeonggi-doAACO KRAAGP Oh; Jin Mi Gyeonggi-do KRAANM Cho; Kyu WonAACI SeoulAACO KRAAGP Cho; Kyu Won Seoul KRAANM Cho; Mi LaAACI SeoulAACO KRAAGP Cho; Mi La Seoul KRAANM Kim; Ho YounAACI SeoulAACO KRAAGP Kim; Ho Youn Seoul KRAANM Park; Mi KyungAACI Gyeonggi-doAACO KRAAGP Park; Mi Kyung Gyeonggi-do KRAANM Oh; Hye JwaAACI SeoulAACO KRAAGP Oh; Hye Jwa Seoul KRAANM Park; Jin SilAACI SeoulAACO KRAAGP Park; Jin Sil Seoul KRAANM Woo; Yun JuAACI SeoulAACO KRAAGP Woo; Yun Ju Seoul KRAANM Byun; Jae KyeongAACI Chungcheongbuk-doAACO KRAAGP Byun; Jae Kyeong Chungcheongbuk-do KRAANM Ryu; Jun GeolAACI Gangwon-doAACO KRAAGP Ryu; Jun Geol Gangwon-do KR - The present invention relates to TNFR2-TWEAKR fusion protein, more precisely to TNFR2-TWEAKR fusion protein acting as a double-antagonist to TNF-α and TWEAK, known as major causes of autoimmune arthritis which is one of autoimmune diseases. When the composition comprising TNFR2-TWEAKR fusion protein was treated to Th17 cells, the secretion of the inflammatory cytokine IL-17 was reduced but the secretion of the anti-inflammatory cytokine IL-10 generated in Treg cells was increased. Such effect of TNFR2-TWEAKR fusion protein was far greater than that of a single protein such as TNFR2-Fc or TWEAK-Fc. The TNFR2-TWEAKR fusion protein of the present invention has not only excellent treatment effect on arthritis in CIA mouse model not also excellent treatment effect on autoimmune rheumatoid arthritis by increasing the expression of Treg, the immune suppressive cells. Therefore, the TNFR2-TWEAKR fusion protein of the present invention can be effectively used as an active ingredient for the composition for the prevention and treatment of autoimmune disease.2013-01-17
20130017227WOUND HEALING COMPOSITIONS AND ASSOCIATED METHODSAANM Lambert, JR.; Cary JakeAACI Winter HavenAAST FLAACO USAAGP Lambert, JR.; Cary Jake Winter Haven FL USAANM Slaughter; ThomasAACI LakelandAAST FLAACO USAAGP Slaughter; Thomas Lakeland FL US - In one embodiment, the present disclosure provides a composition including an aqueous solution comprising about 1% to about 50% weight/volume poloxamer having the general formula HO(C2013-01-17
20130017228METHODS AND COMPOSITIONS FOR BONE FORMATION - A method and system to induce bone growth by locally delivering bone morphogenetic proteins (BMPs) to the target location for a prolonged period without invasive procedures are disclosed. The new bone growth is induced by delivering cells producing BMPs from transduced viral vectors to the target cite. In various embodiments, the cells are encapsulated in hydrogel microspheres that are non-degradable or degradable by enzymes produced during the bone formation process. Various embodiments may be used to induce spinal fusion or repair critical bone defects.2013-01-17
20130017229ACTIVE SCAFFOLDS FOR ON-DEMAND DRUG AND CELL DELIVERY - The invention provides a composition whose porosity, pore size, pore connectivity, swelling agent concentration, and/or specific volume undergoes a change from a first value to a second value in response to an electromagnetic signal, the composition having a matrix material in which is distributed a magnetic material.2013-01-17
20130017230JELLY-FORM PREPARATION AND METHOD FOR PRODUCING JELLY-FORM PREPARATIONAANM SHISHIDO; TakuyaAACI Ibaraki-shiAACO JPAAGP SHISHIDO; Takuya Ibaraki-shi JPAANM Asari; DaisukeAACI Ibaraki-shiAACO JPAAGP Asari; Daisuke Ibaraki-shi JPAANM Hori; MitsuhikoAACI Ibaraki-shiAACO JPAAGP Hori; Mitsuhiko Ibaraki-shi JP - Provided is a jelly preparation which enables easy intraoral dissolution thereof, easy adjustment of the dissolution time, and stable containment of a drug therein. The jelly preparation of the present invention is a jelly preparation including water, a gelatin, a drug, and a trivalent metal ion.2013-01-17
20130017231Composition for Forming a Temporary Intestinal Occlusion in a Mammal - The invention relates to a composition for forming a temporary intestinal occlusion in a mammal, said composition being flowable and solidifiable to form a solid plug at a predetermined site in the intestine, the structure of said plug being changeable to allow for a subsequent, at least partial removal of the occlusion, said composition being or comprising a flowable solution, suspension, or dispersion in a solvent or mixed solvent, characterized in that said composition comprises the following: a) a suspension of a solid in water or an aqueous mixed solvent, the suspension having a water content which exceeds the flow limit of the suspension by an amount X; b) a dehydrating agent in an amount which is sufficient to bind the amount X of water, so that, as a consequence of dehydration, the flow limit of the suspension is exceeded; and c) a means for passivating said dehydrating agent.2013-01-17
20130017232SYNTHETIC BONE GRAFTS - The disclosure provides Bone-mimetic mineral/polymer composite materials useful for formation of artificial bone grafts and for bone tissue engineering. The disclosure provides a hydrogels, cryogels and macroporous compositions modified with varying lengths of anionic pendant side chains (CH2013-01-17
20130017233Tricalcium Phosphate Coarse Particle Compositions and Methods for Making the Same - Methods for preparing a tricalcium phosphate coarse particle composition are provided. Aspects of the methods include converting an initial tricalcium phosphate particulate composition to hydroxyapatite, sintering the resultant hydroxyapatite to produce a second tricalcium phosphate composition and then mechanically manipulating the second tricalcium phosphate composition to produce a tricalcium phosphate coarse particle composition. The subject methods and compositions produced thereby find use in a variety of applications.2013-01-17
20130017234IMPLANT MODIFIED WITH NON-HYDROXYLATED VITAMIN D PRECURSORS - An implant to be used as medical or dental implant, comprising a metallic or polymeric base which is covered by the vitamin D precursor cholecalciferol. The implant can be obtained by direct covering of the polymeric or metallic base with a solution comprising cholecalciferol or also covering the base with the 7-dehydrocholesterol (7-DHC), and subsequently irradiated with UV light to induce the formation of cholecalciferol. Optionally, the coating of the implant may include an antioxidant such as vitamin E. This implant enhances osseointegration in compromised patients by means of the endogenous synthesis and activity of vitamin D in hard and mineralized tissue regeneration. Furthermore, a method to obtain these implants which comprises coating the surface of the implant directly with cholecalciferol or with a specific concentration of 7-DHC and irradiated with UV light to induce the formation of cholecalciferol.2013-01-17
20130017235ORALLY ADMINISTERED AGENT AND AN ORALLY ADMINISTERED AGENT/SUPPORTING SUBSTRATE COMPLEX - With an object of providing an orally administered agent (in particular a film-shaped orally administered agent) with which the ease and safety of taking the agent are improved, to attain this object, in an orally administered agent 2013-01-17
20130017236Toothpaste or tooth gel containing silver nano particles coated with silver oxideAANM Holladay; Robert JohnsonAACI Saratoga SpringsAAST UTAACO USAAGP Holladay; Robert Johnson Saratoga Springs UT US - Toothpaste or tooth gel containing silver nano particles coated with silver oxide as the active ingredient.2013-01-17
20130017237ANTIPLAQUE ORAL CARE COMPOSITIONS - The invention provides oral compositions including a safe and effective amount of a compound represented by the formula (I):2013-01-17
20130017238ORAL CARE COMPOSITIONAANM Porter; VendaAACI PiscatawayAAST NJAACO USAAGP Porter; Venda Piscataway NJ USAANM Morgan; AndreAACI RobbinsvilleAAST NJAACO USAAGP Morgan; Andre Robbinsville NJ USAANM Prencipe; MichaelAACI West WindsorAAST NJAACO USAAGP Prencipe; Michael West Windsor NJ USAANM Mello; SaritaAACI SomersetAAST NJAACO USAAGP Mello; Sarita Somerset NJ US - Disclosed are oral care compositions, for example dentifrice compositions, comprising an orally acceptable vehicle, metal oxide particles having an average particle size of no greater than a dentin tubule and a polymeric adherent material for adhering the metal oxide particles in the dentin tubule. The metal oxide particles have a median particle size of 5 microns or less, and may comprise zinc oxide.2013-01-17
20130017239LIPID NANOPARTICLE CAPSULESAANM Viladot Petit; Josep LLuisAACI BarcelonaAACO ESAAGP Viladot Petit; Josep LLuis Barcelona ESAANM Delgado Gonzalez; RaquelAACI Gava BarcelonaAACO ESAAGP Delgado Gonzalez; Raquel Gava Barcelona ESAANM Fernandez Botello; AlfonsoAACI MalagaAACO ESAAGP Fernandez Botello; Alfonso Malaga ES - A delivery system for active ingredients which comprises lipid nanoparticles, such as solid lipid nanoparticles (SLN) or nanostructured lipid carriers (NLC), polymerically coated, and their use in the preparation of pharmaceutical, cosmetic and/or alimentary compositions.2013-01-17
20130017240ORAL CARE COMPOSITIONAANM Porter; VendaAACI PiscatawayAAST NJAACO USAAGP Porter; Venda Piscataway NJ USAANM Morgan; AndreAACI RobbinsvilleAAST NJAACO USAAGP Morgan; Andre Robbinsville NJ USAANM Prencipe; MichaelAACI West WindsorAAST NJAACO USAAGP Prencipe; Michael West Windsor NJ US - Disclosed are oral care compositions, for example dentifrice compositions, comprising an oral care composition comprising an orally acceptable vehicle, metal oxide particles having an average particle size of no greater than a dentin tubule and at least one amino acid capable of chelating the metal oxide. The composition may comprise a polymeric adherent material for adhering the metal oxide particles in the dentin tubule. The metal oxide particles have a median particle size of 5 microns or less, and may comprise zinc oxide.2013-01-17
20130017241Encapsulated Chlorine Dioxide Generator - An encapsulated chlorine dioxide generator is provided. The encapsulated generator includes a core particle that includes a metal chlorite and a solid acid. The encapsulated generator also includes a protective layer that is disposed about at least a portion of the core particle. The protective layer includes a copolymer of polyvinyl alcohol and a polyalkylene glycol. The encapsulated generator is formed in a method including the steps of forming the core particle and disposing the protective layer about the core particle. The encapsulated generator is also used in a method of cleaning an environment. The method of cleaning the environment includes the steps of providing the encapsulated generator and forming chlorine dioxide from the encapsulated chlorine dioxide generator to clean the environment.2013-01-17
20130017242ARTICLES AND METHODS FOR APPLYING ANTIMICROBIAL PROTECTIONAANM Richardson; NathanAACI NoblesvilleAAST INAACO USAAGP Richardson; Nathan Noblesville IN USAANM Parker; DaveAACI NoblesvilleAAST INAACO USAAGP Parker; Dave Noblesville IN USAANM Kennedy; ScottAACI AndersonAAST INAACO USAAGP Kennedy; Scott Anderson IN US - Among other things, there is disclosed an improved wet wipe or similar substrate for applying an antibacterial/antibiotic layer to surfaces or other items. A wipe substrate is impregnated with a solution in water of organo-functional silane-based molecule, such as 3-(trihydroxysilyl) propyldimethyloctadecyl ammonium chloride and/or octadecyldimethyl trimethoxysilylpropyl ammonium chloride. Packages of multiple wipes for a consumer's pocket, home, business or other uses are also discussed.2013-01-17
20130017243SUSTAINED-RELEASE RESERVOIR IMPLANTS FOR INTRACAMERAL DRUG DELIVERY - The present invention provides a sustained release implant for intraocular use to treat elevated intraocular pressure, which implant is configured for intracameral or anterior vitreal administration to a patient with elevated intraocular pressure (IOP), said implant comprising a core of an antihypertensive agent surrounded by a polymer, which limits the rate of passage of the antihypertensive agent from the implant into the eye of said patient and said implant provides a linear rate of release of therapeutically effective amounts of said anti-hypertensive agent into the eye for a period of time of between 14 days and 365 days.2013-01-17
20130017244Sustained release intraocular implants and related methods - Biocompatible intraocular implants include a steroid and a polymer associated with each other to facilitate release of the steroid into an eye for a period of time greater than about two months. The steroid may be associated with a biodegradable polymer matrix, such as a matrix of a two biodegradable polymers. Or, the steroid may be associated with a polymeric coating having one or more openings effective to permit the steroid to be released into an external environment. The implants may be placed in an eye to treat one or more ocular conditions. The steroid is released from the implant for more than about two months, and may be release for more than several years.2013-01-17
20130017245SOLID PREPARATIONAANM Takano; YouichiAACI Itabashi-kuAACO JPAAGP Takano; Youichi Itabashi-ku JP - The present invention relates to a solid preparation having an easily controllable elution property of a drug, and a method for improving dissolution of a drug.2013-01-17
20130017246Switchable AdhesivesAANM Tunius; MatsAACI GoteborgAACO SEAAGP Tunius; Mats Goteborg SE - The present invention provides switchable adhesives comprising a mixture, in proportions by weight, of 20% to 98% of an adhesive, 2% to 80% of curable molecules and 0.05% to 10% of photoinitiator in which the weight proportion of the adhesive is calculated on the basis of its dry weight and wherein the adhesive includes an internal cross-linker for cross-linking the adhesive during drying to provide a cohesive strength of between 5 and 100 N/12.7×12.7 mm measured according to FINAT test method No. 18. Preferably, the adhesive and curable molecules are mutually soluble when dry, or the curable molecules and adhesive may be uniformly dispersed in each other. Preferably the amount of adhesive in the mixture is in the range 40% to 98% by weight, more preferably 60% to 95% by weight, even more preferably 70% to 85% by weight. Preferably the proportion of curable molecules in the mixture ranges from 2% to 60% by weight, more preferably 5% to 40% by weight, even more preferably 15% to 30 by weight. Preferably, the photoinitiator is present in the mixture in the proportions 0.5% to 5% by weight, more preferably 1% to 3% by weight. Such switchable adhesives are useful in medical dressings and other removable sheet products, and may be simply prepared by stirring the adhesive, the curable molecules and the photoinitiator together at room temperature.2013-01-17
20130017247TREATMENT AND/OR PREVENTION OF ORAL ALLERGIC SYMPTOMS CAUSED BY ORAL CONTACT WITH FRUITS AND/OR VEGETABLES - Treatment or prevention of oral allergy syndrome, or other allergy-related oral inflammatory processes using a topical preparation of at least one of a mast cell stabilizer and an antihistamine is disclosed. For example, the topical administration of Cromolyn Sodium prior to ingestion of raw fruits and raw vegetables may be used to prevent oral allergy symptoms. The topical administration can be performed by use of a solution, a powder, an aerosol, a tablet, a chewable tablet, a gel, a melting strip, a mouth rinse, a mouth swab, or a piece of candy, and may be combined with carrier molecules and/or mucoadhesive molecules to enhance efficacy.2013-01-17
20130017248Cationic Liposomes And Method of Use - Highly efficient cationic liposomes are provided as a system for the delivery to cells of agents or compounds, such as, compounds capable of silencing a target protein and enzyme stubstrates. The cationic liposomes can be used in methods of detecting the inhibition activity or apparent activity of a target protein in a cell, and methods of identifying a protein associated with a pathway, such as, a signal transduction pathway in a cell.2013-01-17
20130017249COMPOUNDS FOR TARGETING DRUG DELIVERY AND ENHANCING siRNA ACTIVITY - Here described are compounds consisting of the structure2013-01-17
20130017250Methods For High Density Lipoprotein Cholesterol Regulation - It was discovered that insulin binding to insulin receptors signals the upregulation of expression of the liver enzyme deiodinase 1 (Dio1), which in turn activates the ApoA-1 promoter, thereby thereby increasing ApoA-1 expression (primarily in the liver), that in turn raises the levels of plasma ApoA-1, the major and necessary protein in HDLC. Certain embodiments of the invention are directed to methods for increasing circulating HDLC levels in an animal by administering therapeutically effective amounts of Dio1, or by increasing the level of Dio1 through gene therapy.2013-01-17
20130017251Antibody Specific for Apolipoprotein and Methods of Use Thereof - The present disclosure provides synthetic antibodies specific for an epitope present on an apolipoprotein E polypeptide. The antibodies are useful in various treatment, diagnostic, and monitoring applications, which are also provided.2013-01-17
20130017252Method for Selectively Inhibiting the Activity of ACAT1 in the Treatment of Alzheimer's Disease - The present invention features methods for decreasing the size and density of amyloid plaques, decreasing cognitive decline associated with amyloid pathology, and treating Alzheimer's disease by selectively inhibiting the activity of Acyl-CoA:Cholesterol Acyltransferase 1, but not Acyl-CoA:Cholesterol Acyltransferase 2.2013-01-17
20130017253Inducing Cellular Immune Responses to Human Papillomavirus Using Peptide and Nucleic Acid Compositions - This invention uses our knowledge of the mechanisms by which antigen is recognized by T cells to identify and prepare human papillomavirus (HPV) epitopes, and to develop epitope-based vaccines directed towards HPV. More specifically, this application communicates our discovery of pharmaceutical compositions and methods of use in the prevention and treatment of HPV infection.2013-01-17
20130017254PHARMACEUTICAL FORMULATION CONTAINING PHENYTOIN SODIUM AND MAGNESIUM STEARATE - The present invention relates to a novel pharmaceutical formulation comprising phenytoin sodium, a high amount of magnesium stearate, and a low level of a hydrophilic polymer such as a methocel, and a method of preparing the same by blending.2013-01-17
20130017255Tamper Resistant Dosage Form Comprising an Adsorbent and an Adverse Agent - Pharmaceutical compositions and dosage forms comprising an adsorbent, and an adverse agent, such as an opioid antagonist. In one embodiment, at least a portion of the adverse agent is on the surface or within the micropore structure of an adsorbent material. The pharmaceutical compositions and dosage forms comprising the adsorbent and the adverse agent are useful for preventing or discouraging tampering, abuse, misuse or diversion of a dosage form containing an active pharmaceutical agent, such as an opioid. The present invention also relates to methods for treating a patient with such a dosage form, as well as kits containing such a dosage form with instructions for using the dosage form to treat a patient. The present invention further relates to process for preparing such pharmaceutical compositions and dosage forms.2013-01-17
20130017256METHODS OF TREATING HYPERTRIGLYCERIDEMIA - In various embodiments, the present invention provides methods of treating and/or preventing cardiovascular-related disease and, in particular, a method of blood lipid therapy comprising administering to a subject in need thereof a pharmaceutical composition comprising eicosapentaenoic acid or a derivative thereof.2013-01-17
20130017257DRY POWDER FORMULATION CONTAINING TIOTROPIUM FOR INHALATION - The present invention is related to a dry powder formulation containing tiotropium to be administered via inhalation, the use of said formulation in the treatment of respiratory diseases especially asthma and COPD (Chronic obstructive pulmonary disease), and the production process of said formulation.2013-01-17
20130017258SELF-MICROEMULSIFYING MITOTANE COMPOSITIONAANM Battung; FlorianAACI ParisAACO FRAAGP Battung; Florian Paris FRAANM Hassan; EmadAACI Hunt ValleyAAST MDAACO USAAGP Hassan; Emad Hunt Valley MD USAANM Sansoe; LionelAACI BruxellesAACO BEAAGP Sansoe; Lionel Bruxelles BE - The invention relates to a self-microemulsifying drug delivery system (“SMEDDS”) of mitotane, with enhanced bioavailability. More particularly the invention provides a mitotane oily formulation comprising propylene glycol monocaprylate (10 to 30% w/w), propylene glycol dicaprate (20 to 60% w/w) and polyoxyethylenesorbitanne monooleate (10 to 30% w/w).2013-01-17
20130017259Compositions and Methods for Treatment of Symptoms in Parkinson's Disease Patients - The invention provides dosage forms and methods utilizing nicotine to treat symptoms of a neurologic disorder. In some embodiments, the invention provides compositions for treatment of gait and balance problems associated with Parkinson's Disease.2013-01-17
20130017260ORAL PHARMACEUTICAL FORMULATIONS FOR THE TREATMENT OF HUMAN CANITIES - The present application relates generally to oral pharmaceutical formulations for the treatment of human canities.2013-01-17
20130017261USE OF LACTOBACILLUS FOR TREATMENT OF VIRUS INFECTIONS - The present invention relates to the use of at least one strain of probiotic bacteria selected from 2013-01-17
20130017262IMMEDIATE/DELAYED DRUG DELIVERYAANM Mullen; AlexanderAACI GlasgowAACO GBAAGP Mullen; Alexander Glasgow GBAANM Stevens; HowardAACI GlasgowAACO GBAAGP Stevens; Howard Glasgow GBAANM Eccleston; SarahAACI GlasgowAACO GBAAGP Eccleston; Sarah Glasgow GB - In one aspect, the present invention is concerned with a treatment where it is desired that an active agent is designed to be released immediately following administration and again at a time point some time after administration of the active agent. The present invention is particularly suited to administering an agent which may be released before sleep and whilst a subject is sleeping. As well as treating certain conditions by a particular regime, the invention also provides novel formulations for an immediate, followed by a delayed release of drug.2013-01-17
20130017263GASTRIC ACID SECRETION INHIBITING COMPOSITION - An oral pharmaceutical dosage form comprises pharmacologically effective amounts of an acid-susceptible proton pump inhibitor and an H2 receptor antagonist in combination with at least on pharmacologically acceptable excipient which causes a delayed release and/or an extended release of the proton pump inhibitor. The H2 receptor antagonist is included in the dosage form in such a way that it is rapidly released after administration. This dosage form is suitable for the treatment of conditions associated with an excessive secretion of gastric acid and provides a suitable combination of a rapid onset and a long-lasting duration of the effect. The invention also relates to a method for manufacturing such a dosage form and to a method for the treatment of conditions associated with the secretion of gastric acid.2013-01-17
20130017264ALGINATE TUBE DRUG DELIVERY SYSTEM AND METHOD THEREFORAANM KHANDARE; Jayant J.AACI MumbaiAACO INAAGP KHANDARE; Jayant J. Mumbai INAANM Boldhane; Sanjay P.AACI MumbaiAACO INAAGP Boldhane; Sanjay P. Mumbai IN - A drug delivery system which comprises alginate tube that is prepared by coating a substrate with alginate gel. One or more therapeutic drugs may also be present in the alginate gel or in the cavity of the tube. The activity of the alginate drug delivery system is highly adjustable so that the release may be controlled as required. The rate at which the system releases the drug and the concentration of the drug released can be adjusted by varying; the number of layers of the alginate tubes, the number of open or closed ends of the tubes, or the number of tube layers containing the drug.2013-01-17
20130017265PARTICLES FOR MULTIPLE AGENT DELIVERY - Delivery compositions are provided that include two or more active agents, wherein at least one active agent is conjugated to a polymer. The delivery compositions allow for controlled release of multiple active agents, including active agents with varying solubility, charge, and/or molecular weight.2013-01-17
20130017266Radiation Therapy AgentAANM Ogino; ChiakiAACI Kobe-shiAACO JPAAGP Ogino; Chiaki Kobe-shi JPAANM Tanaka; TsutomuAACI Kobe-shiAACO JPAAGP Tanaka; Tsutomu Kobe-shi JPAANM Sasaki; RyoheiAACI Kobe-shiAACO JPAAGP Sasaki; Ryohei Kobe-shi JPAANM Kondo; AkihikoAACI Kobe-shiAACO JPAAGP Kondo; Akihiko Kobe-shi JP - Provided is a radiotherapeutic agent, including a composite particle, which is obtained by binding a molecule that specifically recognizes a target to a substrate particle including titanium peroxide, and which generates reactive oxygen through irradiation with a radiation. Further, because the radiotherapeutic agent contains the molecule that specifically recognizes a target, the radiotherapeutic agent has a function of accumulating in the target. The radiotherapeutic agent is capable of enhancing effects of radiotherapy, and is capable of reducing side effects on a living body to efficiently attack the target.2013-01-17
20130017267METHOD OF MAKING PARTICLES FOR USE IN A PHARMACEUTICAL COMPOSITION - The invention relates to a method for making composite active particles for use in a pharmaceutical composition for pulmonary administration, the method comprising a milling step in which particles of active material are milled in the presence of particles of an additive material which is suitable for the promotion of the dispersal of the composite active particles upon actuation of an inhaler. The invention also relates to compositions for inhalation prepared by the method.2013-01-17
20130017268PROSTAGLANDIN AND PROSTAMIDE DRUG DELIVERY SYSTEMS AND INTRAOCULAR THERAPEUTIC USES THEREOF - Biocompatible, bioerodible implants and microspheres include latanoprost and a biodegradable polymer effective, when placed intraocular (such as into the subtenon space) to treat glaucoma.2013-01-17
20130017269Diane's manna - This is a potent drug with narcotic benefits made from distinctly and uniquely combined and processed interchangeable seed and seed derivatives that are so potent that it removes or alleviates depression, mood disorders, Attention Disorder symptoms, thought disorder, mental illness, pain, right lip retardation symptoms, physical problems, Lymph Node cancer and many other illness symptoms. It removes bumps in the neck within a week or two. It is interchangeable in most aspects. It can be combined and processed with Pharmaceuticals and medicines to create new drugs. These Pharmaceuticals are now long lasting. I prefer the daily dose, but this drug can last months. It is extremely strong or potent and can be made weak to make your little Attention deficit child normal. It is an incredible mood stabilizer and reduces psychosis. Use it for cancer patient and for people with pain issues. It works.2013-01-17
20130017270FENTON REACTION CATALYST USING COFFEE GROUNDS OR TEA DREGS AS RAW MATERIALAANM Morikawa; Claudio KendiAACI Tsu-shiAACO JPAAGP Morikawa; Claudio Kendi Tsu-shi JPAANM Shinohara; MakotoAACI Tsu-shiAACO JPAAGP Shinohara; Makoto Tsu-shi JP - A Fenton reaction catalyst including a reaction product as an active component, in which the reaction product is obtained by using roasted and ground coffee beans (in particular, coffee grounds) or tea leaves (in particular, tea dregs) as feedstocks for supplying a component having a reduction effect, and mixing the feedstocks for supplying the component having a reduction effect with an iron-supplying source containing divalent or trivalent iron in the presence of water. The Fenton reaction catalyst can be used to generate hydroxy radicals from hydrogen peroxide. The Fenton reaction catalyst can maintain iron in a divalent state for a long period of time.2013-01-17
20130017271Micronized copper-containing compositions useful to mitigate residues on wood surfaces - Disclosed is a wood preservative composition comprising micronized copper and copper-amine complex, wherein the copper component of the copper amine complex is from about 5% to about 50% by weight, based upon the total weight of copper in the composition. The copper amine complex serves to avoid wood surface “chalking” that is otherwise attributable to the presence of micronized copper in copper-based slurries used to treat wood products. In addition, the copper-amine complex enhances the antimicrobial efficacy of the composition when used in wood treatment applications by facilitating cell wall penetration of the treated wood.2013-01-17
20130017272METHOD FOR TREATING NON-SMALL CELL LUNG CANCER - A method of treating a human patient afflicted with lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of a taxane and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′ deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with cell lung cancer.2013-01-17
20130017273COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present invention relates to pyrrolopyrazines compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors.2013-01-17
20130017274LOW DOSE LITHIUM IN THE TREATMENT OR PROPHYLAXIS OF PARKINSON'S DISEASE - In various embodiments methods of delaying the onset of and/or mitigating the severity of one or more symptoms of Parkinson's disease in a mammal are provided. In certain embodiments the methods involve administering to a mammal diagnosed as having or as at risk for Parkinson's disease a chronic low dose of lithium (e.g., a subtherapeutic dose). In certain embodiments the low dose lithium is administered in conjunction with another agent (e.g., L-DOPA).2013-01-17
20130017275HERBAL MEDICINAL COMPOSITION AND EXTRACT THEREOF FOR INHIBITING GROWTH OF CANCER CELLS - The present invention relates to herbal medicinal compositions and extracts thereof for inhibiting growth of cancer cells. One of the examples described in the present invention comprises Forsythiae fructus, Menthae Herba, Gardeniae Fructus, Scutellariae Radix, Lophatheri Folium, Glycyrrhizae Radix, Rhei Rhizoma, Na2013-01-17
20130017276Composition, and Method of Using the Composition, Effective for Minimizing the Harmful Effects Associated with Individuals Suffering from Alcohol Intoxication - The present invention relates to a composition, and methods of using the composition, for minimizing the harmful effects associated with alcohol consumption. The composition includes a plurality of ingredients, which when combined, have the unexpected effect of increasing one or more metabolic pathways in the individual. As the metabolic rate is increased, alcohol is burned off, or utilized as energy source, and occurs at a considerably much faster rate than under normal physiological means. It is believed that the composition may have an effect on the brain causing it to increase metabolic rates. By administering the composition to an inebriated individual, the rate at which a person sobers up, occurs at a faster rate than would occur under normal physiological time frames.2013-01-17
20130017277CONVERSION OF NITROGEN DIOXIDE (NO2) TO NITRIC OXIDE (NO) - Inhalation of low levels of nitric oxide can rapidly and safely decrease pulmonary hypertension in mammals. A nitric oxide delivery system that converts nitrogen dioxide to nitric oxide employs a surface-active material, such as silica gel, coated with an aqueous solution of antioxidant, such as ascorbic acid.2013-01-17
20130017278COMPOSITION AND METHOD FOR IMPROVING BRAIN FUNCTION - A composition and method for improving and maintaining brain function wherein the composition comprises an effective amount of coconut oil and an effective amount of medium-chain triglycerides. The medium-chain triglycerides and coconut oil may be mixed in a ratio of between 90% medium-chain triglycerides to 10% coconut oil and 40% medium-chain triglycerides to 60% coconut oil. The method comprises administering to a person, an effective amount of coconut oil and an effective amount of medium-chain triglycerides. The composition may be administered in a food item.2013-01-17
20130017279FORMULATIONS FOR TREATMENT OF SKIN DISORDERS - The Present Invention teaches herbal formulations based on a non-aqueous extract of wrightia tinctoria and an extract of cocos nucifera, which, when applied topically and used as directed in therapeutically effective amounts, have been clinically proven to be safe and effective for people needing treatment for skin conditions such as reducing or regressing dermal tortuosity, reducing spongiform pustules, and reversing and regressing stratum granulosum in keratinization disorders. The formulations can take the form of an ointment, an oil, a soap, or a shampoo.2013-01-17
20130017280COMPOSITION FOR ACCELERATING CHANGE IN MUSCLE TYPEAANM Cho; Si YoungAACI SeoulAACO KRAAGP Cho; Si Young Seoul KRAANM Lee; Ji HaeAACI Gyeonggi-doAACO KRAAGP Lee; Ji Hae Gyeonggi-do KRAANM Bae; Il HongAACI Gyeonggi-doAACO KRAAGP Bae; Il Hong Gyeonggi-do KRAANM Song; Min JeongAACI Gyeonggi-doAACO KRAAGP Song; Min Jeong Gyeonggi-do KRAANM Yeo; Hyeon JuAACI SeoulAACO KRAAGP Yeo; Hyeon Ju Seoul KRAANM Seo; Dae BangAACI Gyeonggi-doAACO KRAAGP Seo; Dae Bang Gyeonggi-do KRAANM Kim; Wan GiAACI Gyeonggi-doAACO KRAAGP Kim; Wan Gi Gyeonggi-do KRAANM Lee; Sang JunAACI Gyeonggi-doAACO KRAAGP Lee; Sang Jun Gyeonggi-do KR - The present invention provides a composition for accelerating a change in muscle type, increasing the amount of muscle, strengthening muscle, enhancing athletic abilities, reducing lipids, suppressing the accumulation of lipids, lowering blood sugar, controlling body weight or lowering body weight, containing a PPAR-δ promoter, an AMPK promoter and a PGC1-α promoter as an active ingredient2013-01-17
20130017281Natural Composition for Killing Parasites on a Companion Animal - The present invention relates to a method for killing parasites that includes topically applying onto a companion animal a composition including a natural, non-synthetic active ingredient. The composition may be applied to the animal in various forms, such as a spot-on, shampoo, an on animal spray, or an on animal powder. The present invention further relates to a topical composition for killing a parasite that includes at least one natural active ingredient.2013-01-17
20130017282Pain Relieving Composition - A pain relieving composition that includes an anesthetic in the range of 0.5%-7.0% by weight (“w/w”), an anti-inflammatory agent in the range of 1.0%-11.0% w/w, a moisturizing agent in the range of 0.5%-12.0% w/w, a humectant in the range of 0.5%-13.0% w/w, a penetration enhancing agent in the range of 0.5%-7.0%, and a carrier solvent in the range of 40.0%-97.0% w/w to be used before and/or after procedures which cause damage to human skin.2013-01-17
20130017283COMPOSITIONS AND METHODS FOR MODULATING METABOLIC PATHWAYS - Compositions and methods useful for inducing an increase in fatty acid oxidation or mitochondrial biogenesis, reducing weight gain, inducing weight loss, or increasing Sirt1, Sirt3, or AMPK activity are provided herein. Such compositions can contain synergizing amounts of a sirtuin-pathway activators, including but not limited to resveratrol, in combination with beta-hydroxymethylbutyrate (HMB), keto isocaproic acid (KIC), leucine, or combinations of HMB, KIC and leucine.2013-01-17
20130017284COMPOSITIONS AND METHODS FOR MODULATING METABOLIC PATHWAYS - Compositions and methods useful for inducing an increase in fatty acid oxidation or mitochondrial biogenesis, reducing weight gain, inducing weight loss, or increasing Sirt1, Sirt3, or AMPK activity are provided herein. Such compositions can contain synergizing amounts of a sirtuin-pathway activators, including but not limited to resveratrol, in combination with beta-hydroxymethylbutyrate (HMB), keto isocaproic acid (KIC), leucine, or combinations of HMB, KIC and leucine.2013-01-17
20130017285Compositions and Methods for Treating Hair Loss - Provided are compositions containing a unique combination of vitamin B1, vitamin B6, vitamin B12, folic acid, magnesium glycinate, ferric glycinate, L cysteine, biotin, 2013-01-17
20130017286POMEGRANATE BASED SKIN PROTECTANT AND TOPICAL APPLICATION - A cosmetic composition is provided having ingredients that may prevent signs or conditions of aging and/or damage in skin, improve the aesthetic appearance of skin, and promote recovery from environmental stresses. The composition includes natural ingredients, including pomegranate juice concentrate; pomegranate extract; pomegranate seed oil; and at least one pharmaceutically or cosmetically acceptable vehicle.2013-01-17
20130017287TIRE VULCANIZERAANM Shintani; KojiAACI TokyoAACO JPAAGP Shintani; Koji Tokyo JP - To provide a tire vulcanizer capable of solving problems of an electrical heating platen, which relate to the deformation at the time of tire vulcanization and to the replacement of the platen. The tire vulcanizer vulcanizes and molds a green tire placed in an outer mold by heating the green tire from the outer side and the inner side of the green tire, and is featured by including an electric platen (2013-01-17
20130017288Mold-Tool Assembly having Nozzle Assemblies to Provide Resins Molded Adjacently - A mold-tool assembly (2013-01-17
20130017289DEVICE FOR CUTTING PLASTIC PRODUCTS PROVIDED IN A CONTINUOUS PLASTIC BAND FOR USE IN THE MEDICAL SECTORAANM Kieburg; HeinzAACI BerlinAACO DEAAGP Kieburg; Heinz Berlin DEAANM Franzke; ReinerAACI BerlinAACO DEAAGP Franzke; Reiner Berlin DE - Devices for cutting interconnected plastic products for use in the medical sector provided in a continuous band of plastic, comprising a laser, a laser control system and an optical acquisition and data processing unit are disclosed. Devices for the manufacture of plastic products, such as fillable or filled plastic containers for use in the medical sector, comprising a device for cutting interconnected plastic products provided in a continuous band of plastic as well as a process for cutting interconnected plastic products provided in a continuous band of plastic are disclosed. The optical acquisition unit may determine positional data for the interconnected plastic products provided in the band. From the positional data a cutting pattern may be calculated and transmitted to the laser control system. According to this cutting pattern, the position, intensity and focal point of the laser may be controlled by the laser control system, which may comprise a focusing optic, a deflection means and a beam-forming means.2013-01-17
20130017290FILM OPENING MECHANISMAANM Sawamura; TakujiAACI Sakai-shiAACO JPAAGP Sawamura; Takuji Sakai-shi JP - A film opening mechanism in which, regardless of whether a tubular film is long or short, a deviation in timing of delivery of the tubular film from a mandrel does not occur, and the tubular film does not become wrinkled. The film opening mechanism includes a mandrel for causing the tubular film to be opened into a predetermined state by fitting it thereon; a film transport unit composed of an upstream-side feed belt unit and a downstream-side feed belt unit, each having a feed belt which nips the tubular film fitted on the mandrel in cooperation with the mandrel to transport the tubular film toward a lower side of the mandrel; and attraction means for attracting the mandrel and the feed belt to each other by means of a magnetic attractive force.2013-01-17
20130017291COMPLETELY DISPOSABLE COOKING APPARATUS FOR FILLING AND DECORATING OF FOODS - A completely disposable cooking apparatus used for preparing, filling assembling and decorating of foods, that is a one-piece disposable construction, comprising an elongated bag with a soft side wall, an open first end through which food material can be inserted into the bag and a second end that is closed by a tapered discharge orifice (also sometimes referred to as a nozzle or a tip). The orifice has a first end in contact with the second end of the bag and a distal end away from the bag. The cross-sectional area of the orifice at the first end is greater than the cross-sectional area of the orifice at the distal end. The orifice is made of a material so that it is capable of being cut at any point along its longitudinal axis to yield an exit opening or hole with a desired size.2013-01-17
20130017292MULTICAROTENOID BEADLETS AND RELATED METHOD - A controlled release beadlet that sequentially releases carotenoids over time within the gastrointestinal tract of a subject, as well as a method of administering the carotenoids. The beadlet provides a specific ratio of carotenoids which release from the beadlet at preselected times during passage through the gastrointestinal tract. The method includes releasing the carotenoids in preselected ratios at specific time intervals in the gastrointestinal tract to mitigate competition between the carotenoids for their uptake, and/or to potentially maximize the uptake of individual carotenoids within a mixed carotenoid formulation.2013-01-17
20130017293Nutritional Composition To Promote Healthy Development And Growth - A nutritional composition for improving the immunological function of a subject, including a lipid or fat; a protein source; about 5 to about 100 mg/100 kcal of a source of long chain polyunsaturated fatty acids which comprises docosahexanoic acid; and about 0.1 to about 1 mg/100 kcal of a prebiotic composition, wherein the prebiotic composition comprises at least 20% of an oligosaccharide which has a fermentation rate which is demonstrably slower than that of galacto-oligosaccharide.2013-01-17
20130017294METHOD TO PRODUCE FRIED VEGETABLE PRODUCTSAANM Streekstra; HugoAACI AmsterdamAACO NLAAGP Streekstra; Hugo Amsterdam NL - The invention relates to a method for the preparation of fried vegetable products. In particular, it relates to a method for the preparation of fried vegetable products which have been subjected to an asparagine-reducing enzyme. The method comprises reducing the amount of enzyme product formed on the surface of the enzyme-treated vegetable material due to the action of the asparagine-reducing enzyme. If the amount of enzyme product is reduced before frying, this will contribute to the colour and the quality of the frying oil and of products subsequently fried in the oil and, thus, will minimize the loss of quality of the frying oil. The invention also relates to use of an asparagine-reducing enzyme preparation for preserving the colour of the frying oil.2013-01-17
20130017295Compositions containing non-polar compounds - Provided herein are compositions and methods for preparing foods and beverages that contain additives, such as nutraceuticals, pharmaceuticals, and supplements, such as essential fatty acids, including omega-3 fatty acids, omega-6 fatty acids, conjugated fatty acids, and other fatty acids; phytochemicals, including phytosterols; other oils; and coenzymes, including Coenzyme Q10, and other oil-based additives.2013-01-17
20130017296SYSTEMS AND METHODS FOR PROCESSING EGGS AND OTHER OBJECTS - A method for marking an egg shell wherein a laser beam is directed onto the egg shell so as to discolor an outer layer of the egg shell without etching substantially into layers of the egg shell underneath the outer layer. The laser delivers a spot with a power density below about 2000 watts/sq. in. and a depth of an etching of the egg caused by the laser marking process does not exceed about 25 microns. InkJet printing may be added to the laser marking process or used instead of laser marking. Eggs may be marked in-carton, on a packer conveyor or on an apparatus fed by a packer conveyor, with eggs uniformly oriented in the package prior to (and after) printing. Marking is done in-carton, on-conveyor whether the marking is by laser, by ink, or both.2013-01-17
20130017297COMPLETELY DISPOSABLE COOKING APPARATUS FOR FILLING AND DECORATING OF FOODSAANM Grimes; Brenda MarieAACI EsteroAAST FLAACO USAAGP Grimes; Brenda Marie Estero FL USAANM Grimes; Charles WilsonAACI DarienAAST CTAACO USAAGP Grimes; Charles Wilson Darien CT US - A completely disposable cooking apparatus used for filling and decorating of foods, that is a one-piece disposable construction, comprising a one-piece, funnel-shaped bag with a soft side wall, having an open first end at the “top” or wider end of the funnel through which food material can be inserted into the bag and a closed second end at the “bottom” or narrow end of the funnel, with an integral, malleable, conical shaped, discharge orifice (also sometimes referred to as a nozzle or a tip). The orifice has serrations or ridges extending inwardly from the internal wall of the orifice, running longitudinally or parallel to the cone axis for all or a part of the length of the orifice. The orifice can either be initially closed or manufactured with a small opening or hole. The orifice is made of a material so that it is capable of being cut at any point along its longitudinal axis to yield an exit opening or hole with a desired size. Regardless of the point of cut, i.e., regardless of the size of the hole or opening, the inwardly extending serrations or ridges that remain after the cut insure that the material is “treated” as it is expelled from the bag through the orifice. While the orifice is capable of “treating” the material as it is discharged from the bag, the orifice is also either: (a) elastic or flexible enough in order to allow the hole or opening in the orifice to expand to pass “clogs” or “lumps” and then return to its original shape; or (b) supple or deformable enough in order to allow the orifice to be compressed or collapsed “upstream” of the hole or opening so that the “clogs” or “lumps” can be broken up and then passed through the hole or opening when the orifice returns to its original shape.2013-01-17
20130017298ASSURING FOOD SAFETY USING NANO-STRUCTURE BASED SPECTRAL SENSING - A method for inspecting an edible oil includes obtaining a first Raman spectrum from an edible oil sample, discovering an unhealthy, unsanitary, unsafe, or adulterated content in the edible oil sample in part by the intensity level of the fluorescence background in the first Raman spectrum, introducing the edible oil sample to nano-scale surface structures to allow molecules of the edible oil sample to be adsorbed to the nano-scale surface structures, illuminating the edible oil sample and the nano-scale surface structures by a laser beam, obtaining a second Raman spectrum from light scattered by molecules of the edible oil sample adsorbed to the nano-scale surface structures, and identifying the unhealthy, unsanitary, or unsafe content in the edible oil sample using one or more first spectral signatures in the second Raman spectrum.2013-01-17
20130017299STABLE DISPERSION OF STEROLS IN AQUEOUS SOLUTIONS COMPRISING AN OIL - A stable dispersion and a process of preparing a stable dispersion of one or more sterols in an aqueous solution are disclosed. An oil component is used as a carrier and is mixed with the one or more sterols in suspension to facilitate dispersion of the sterol in the aqueous solution. The aqueous solution may be an alcoholic solution. Freezing the stable dispersion of one or more sterols in the aqueous solution provides for a ready-to-pour frozen slush beverage.2013-01-17
20130017300Method of Preparing an Oat-Containing Dairy Beverage - A process for preparing an oat and milk beverage includes processing taking place under chilled conditions. Moreover, the oat product used in accordance with aspects of this invention is hydrolyzed oat flour.2013-01-17
20130017301METHOD AND COMPOSITION FOR INHIBITION OF MICROBIAL GROWTH IN AQUEOUS FOOD TRANSPORT AND PROCESS STREAMS - The present invention relates to compositions including peroxyacetic acid and peroxyoctanoic acid and methods for preventing microbial growth in aqueous streams including the step of applying a composition of the invention to the stream. The compositions and methods can control microbial growth in aqueous streams used for transporting or processing food products.2013-01-17
20130017302COFFEE BAGS SPECIFIC FOR COFFEE MAKERS DELAY BREW FUNCTIONAANM Todd; Jake A.AACI SeattleAAST WAAACO USAAGP Todd; Jake A. Seattle WA US - Methods are disclosed for bags of coffee, specifically designed for coffee machines delay brew function.2013-01-17
20130017303APPARATUS AND PRODUCTS FOR PRODUCING BEVERAGES, AND METHODS FOR MAKING AND USING SAMEAANM VU; ROBERT BAOAACI HoustonAAST TXAACO USAAGP VU; ROBERT BAO Houston TX US - A brewing container for use with brewing machines, the container including a distribution outlet for dispersing the injected water in at least 3 directions away from vertical within the cartridge.2013-01-17
20130017304CARBONATING DEVICE, RELATED DISCHARGE ASSEMBLY, RELATED CAP ASSEMBLY, AND METHOD OF CARBONATING A VESSELAANM Gormley; David MichaelAACI BournemouthAACO GBAAGP Gormley; David Michael Bournemouth GBAANM Durant; MarcusAACI HonitonAACO GBAAGP Durant; Marcus Honiton GB - A carbonating device for carbonating an opened vessel including an inlet valve for receiving pressurised gas, an exit valve for expelling gas into a vessel to be carbonated, a trigger for opening the inlet valve, a trigger pressure regulator arranged to close the inlet valve, a discharge assembly, and a cap assembly, the discharge assembly coupled to and de-coupled from the cap and including a port for discharging gas to the cap, the discharge port being opened and closed by a valve and a pressure regulator arranged to automatically close the discharge valve in response to a pressure level.2013-01-17