Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees


Gold or platinum

Subclass of:

424 - Drug, bio-affecting and body treating compositions

424600000 - INORGANIC ACTIVE INGREDIENT CONTAINING

424617000 - Heavy metal or compound thereof

Patent class list (only not empty are listed)

Deeper subclasses:

Entries
DocumentTitleDate
20090011049Methylation Markers for Prognosis and Treatment of Cancers - Genes for thirteen DNA damage repair or DNA damage response enzymes can be epigenetically silenced in cancers. The silencing of nucleic acids encoding a DNA repair or DNA damage response enzyme can be used prognostically and for selecting treatments that are well tailored for an individual patient. Combinations of these markers can also be used to provide prognostic information. Kits for testing epigenetic silencing can be used to determine a prognosis or a therapeutic regimen.01-08-2009
20110195133DERMCIDIN-DERIVED PEPTIDES FOR LUNG CANCER DIAGNOSTICS - Methods for diagnosis of non-small cell lung cancers by detection of endogenous peptides in exhaled breath condensate (EBC) are provided. Diagnostic peptides derived from dermcidin (DCD) are provided. A specific dermcidin-derived peptide E-R11, having the sequence ENAGEDPGLAR, is provided. E-R11 peptide levels in EBC, as measured by mass spectrometry (MS), are highly diagnostic of non-small cell lung cancers. A method for inhibiting growth of lung cancer cells by inhibiting DCD expression by RNA interference also is provided.08-11-2011
20100159030METHODS FOR DETECTING AND MODULATING THE SENSITIVITY OF TUMOR CELLS TO ANTI-MITOTIC AGENTS AND FOR MODULATING TURMORGENICITY - Provided herein is a method of screening a tumour cell for resistance to a tubulin-binding agent, the method comprising detecting the expression of any one or more of class II, class III and class IVb β-tubulin by the tumour cell, wherein the expression of any one or more of class II, class III and class IVb β-tubulin indicates that the tumour cell has resistance or potential resistance to the tubulin-binding agent. Also provided are methods of modulating the sensitivity of a tumour cell. Also provided is a method of modulating the tumorigenesis of a tumour cell.06-24-2010
20120177749FAMILY OF PFKFB3 INHIBITORS WITH ANTI-NEOPLASTIC ACTIVITIES - A methods and compounds for inhibiting 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3 (PFKFB3) are described. Also described are methods of inhibiting cell proliferation, treating cancer, and screening compounds to determine their ability to inhibit PFKFB3.07-12-2012
20120183629LOW VISCOSITY LIQUID POLYMERIC DELIVERY SYSTEM - Low viscosity biodegradable polymer solutions of a liquid biodegradable polymer and biocompatible solvent and methods of using the compositions to form a biodegradable liquid polymer implant are provided.07-19-2012
20120244230POLYVALENT POLYNUCLEOTIDE NANOPARTICLE CONJUGATES AS DELIVERY VEHICLES FOR A CHEMOTHERAPEUTIC AGENT - The present invention is directed to compositions and methods of delivering a chemotherapeutic agent via a polynueleotide-functionalized nanoparticle (PN-NP).09-27-2012
20130078319DETECTION OF OVARIAN CANCER - Among other things, the present disclosure provides a method including the steps of: obtaining a uterine sample; and detecting and/or characterizing in the uterine sample an ovarian cancer biomarker (e.g., CA125).03-28-2013
20130034616COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present invention relates to pyrrolopyrazines compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors.02-07-2013
20130084345INDIBULIN THERAPY - The invention provides combination therapy, wherein one or more other therapeutic agents are administered with indibulin or a pharmaceutically acceptable salt thereof and the combination is synergistic. Another aspect of the invention relates to the treatment of cancer with indibulin as a single agent. Another aspect of the invention relates to dosing regimen for administration of oral dosage forms of indibulin.04-04-2013
20120207856MSH3 Expression Status Determines the Responsiveness of Cancer Cells to the Chemotherapeutic Treatment with PARP Inhibitors and Platinum Drugs - Methods for treating a patient at risk for or diagnosed with colorectal cancer are disclosed herein. The method of the present invention determines the overall expression of MSH3 in cells suspected of being colorectal cancer cells from the patient and predicting the efficacy of therapy with a genotoxic anti-neoplastic agent for treating the patient, wherein a decrease in the overall expression of MSH3 in the patient cells when compared to the expression of MSH3 in normal colorectal cells indicates a predisposition to responsiveness to genotoxic anti-neoplastic agent therapy, wherein the therapy comprises administering an effective amount of the genotoxic anti-neoplastic agent therapy to patients.08-16-2012
20130039996POTENTIATION OF CANCER CHEMOTHERAPY BY 7-(2, 5- DIHYDRO- 4-IMIDAZO [1, 2-A] PYRIDINE-3-YL-2,5-DIOXO-IH-PYRROL-3-YL)-9-FLUORO-1,2,3,4 TETRAHYDRO -2-(1-PIPERIDINYL-CARBONYL)-PYRROLO [3,2,1-JK] [1,4] BENZODIAZEPINE - An improved method for treating gastric cancer, ovarian cancer, non-small cell lung cancer, or colorectal cancer in a patient is described, as well as pharmaceutical compositions useful for the method and a process for preparing said compositions.02-14-2013
20100112090NITROGENATED FUSED RING DERIVATIVE, PHARMACEUTICAL COMPOSITION COMPRISING THE SAME, AND USE OF THE SAME FOR MEDICAL PURPOSES - [Purpose] The present invention provides compounds useful as agents for the prevention or treatment of a sex hormone-dependent disease or the like.05-06-2010
20100112089PEPTIDE COMPOUND AND USE THEREOF - The present invention provides a method for the prophylaxis or treatment of cancer in a mammal, comprising administering a therapeutically effective amount of CBP501, a prodrug thereof or a pharmaceutically acceptable salt thereof to the mammal, wherein CBP501, a prodrug thereof or a pharmaceutically acceptable salt thereof is administered simultaneously with or before administration of a nucleic acid damaging agent.05-06-2010
20130209579THERAPEUTIC COMBINATION FOR THE TREATMENT OF CANCER - This invention relates to therapeutic combinations comprising a platinum-based anti-neoplastic agent, such as cisplatin, and an extract from a species of the genus 08-15-2013
20100104662COMPOSITION AND METHODS FOR MODULATING CELL PROLIFERATION AND CELL DEATH - Described herein are compositions and methods for modulation of p53-dependent cell death and cell proliferation. The compositions are microRNAs and associated nucleic acids.04-29-2010
20100104661DISCONTINUOUS METHODS OF TREATING CANCER - Disclosed are methods of treating taxane sensitive tumors (i.e., cancers treatable with taxanes) using a taxane and the discontinuous dosing of lonafarnib.04-29-2010
20100104660COMPOSITION AND METHOD FOR TREATING TUMOR - Methods for treating neoplasm, tumors and cancers, using one or more tumor treating drug carriers, haptens and anticancer drugs, alone or in combination with other antineoplastic agents or treatments, are provided. Also provided are compositions, and kits containing the composition for affecting the therapy.04-29-2010
20100104659BENZOPYRANOPYRAZOLES - Compounds of a certain formula I, in which Ra, Rb and Rc have the meanings indicated in the description, are effective compounds with anti-proliferative and/or apoptosis inducing activity.04-29-2010
20130045286PYRROLOPYRIDINES AS KINASE INHIBITORS - Compounds of Formula I are useful for inhibition of CHK1 and/or CHK2. Methods of using compounds of Formula I and stereoisomers and pharmaceutically acceptable salts thereof, for in vitro, in situ, and in vivo diagnosis, prevention or treatment of such disorders in mammalian cells, or associated pathological conditions are disclosed.02-21-2013
20100092579MEDICAMENT FOR TREATING LUNG CANCER - Lung cancer can be treated effectively by combination of amrubicin or a pharmaceutically acceptable salt thereof with cisplatin.04-15-2010
20100330200COMBINATION OF A RETINOID AND A PLATINUM ANTICANCER AGENT - A combination comprising an atypical retinoid compound, preferably E-4-(3-(1-adamantyl)-4-hydroxyphenyl)cinnamic acid and an anticancer drug of the platinum family, preferably cisuplatin, together with a pharmaceutical composition comprising it and a kit for its administration in unitary or in coordinated sequential form. The kit preferably comprises a first formulation of E-4-(3-(1-adamantyl)-4-hydroxyphenyl)cinnamic acid dissolved in a mixture of ethanol and cremophor, and susupended in a saline solution, and a second formulation of cisuplatin in saline solution. The combination is used for the preparation of a medicament to inhibit tumor growth and tumor migration, in particular for the treatment of ovarian tumor and/or carcinoma.12-30-2010
20130028989MATERIALS AND METHOD FOR INHIBITING REPLICATION PROTEIN A AND USES THEREOF - Targeting uncontrolled cell proliferation and resistance to DNA damaging chemotherapeutics with at least one reagent has significant potential in cancer treatment. Replication Protein A, the eukaryotic single-strand (ss) DNA binding protein, is essential for genomic maintenance and stability via roles in both DNA replication and repair. Reported herein are small molecules that inhibits the in vitro, in vivo, and cellular ssDNA binding activity of RPA, thereby disrupting the eukaryotic cell cycle, inducing cytotoxicity and increasing the efficacy of chemotherapeutic agents damage DNA, and/or disrupt its replication and/or function. These results provide new insights into the mechanism of RPA-ssDNA interactions in chromosome maintenance and stability. This represents a molecularly targeted eukaryotic DNA binding inhibitor and demonstrates the utility of targeting a protein-DNA interaction as a means of studying the cell cycle and providing a therapeutic strategy for cancer treatment.01-31-2013
20130089626Treating Cancer with ATR Inhibitors - This invention relates to methods and compositions for treating pancreatic cancer. More specifically, this invention relates to treating pancreatic cancer with certain ATR inhibitors in combination with gemcitabine and/or radiation therapy. This invention also relates to methods and compositions for treating non-small cell lung cancer. More specifically, this invention relates to treating non-small cell lung cancer with an ATR inhibitor in combination with cisplatin or carboplatin, etoposide, and ionizing radiation.04-11-2013
20130089627METHOD FOR TREATING A CANCER CAUSED BY CANCER STEM CELLS - This invention provides a method for treating a cancer caused by cancer stem cells in a subject in need thereof, comprising administering to the subject an effective amount of 04-11-2013
20130089624Compounds Useful as Inhibitors of ATR Kinase - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors.04-11-2013
20130089625Compounds Useful as Inhibitors of ATR Kinase - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; solid forms of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors.04-11-2013
20100136136JAK-2 Modulators and Methods of Use - This invention relates to the field of protein tyrosine kinases and inhibitors thereof. In particular, the invention relates to inhibitors of JAK-2, pharmaceutical compositions of the compounds for inhibiting JAK-2, methods of inhibiting JAK-2 in a cell, comprising contacting a cell in which inhibition of JAK-2 is desired with a compound or pharmaceutical composition comprising a compound according to the invention. The also comprises methods of treating a disease or condition that involves JAK-2 comprising administering to a patient a pharmaceutical composition comprising a compound according to the invention.06-03-2010
20100136139CANCER MARKER AND THERAPEUTIC AGENT FOR CANCER - A novel cancer marker is provided. A method for detecting cancer using a level of BMCC1 gene expression as an indication is provided, in which the cancer is selected from the group consisting of prostate cancer, lung cancer, gastric cancer, bladder cancer, and uterine cancer.06-03-2010
20090304817Glycosylation Variants of Ricin-Like Proteins - The present invention provides glycosylation variants of recombinant proteins and nucleic acids that encode such recombinant proteins, which are useful as therapeutics against cancer, and viral, parasitic and fungal infections. The proteins and nucleic acids have A and B chains of ricin-like toxin linked by a linker sequence that is specifically cleaved and activated by proteases specific to disease-associated pathogens or cells. The invention also relates to methods of inhibiting or destroying cells affected by a disease, methods of treating a mammal with a disease, and pharmaceutical compositions using the recombinant proteins and nucleic acids of the invention.12-10-2009
20090110753Enzyme-cleavable prodrug compounds - The prodrug of the invention is a modified form of a therapeutic agent and comprises a therapeutic agent, an oligopeptide, a stabilizing group and, optionally, a linker group. The prodrug is cleavable by the enzyme Thimet oligopeptidase, or TOP. Also disclosed are methods of designing prodrugs by utilizing TOP-cleavable sequences within the conjugate and methods of treating patients with prodrugs of the invention.04-30-2009
20130136804Crystal Forms of Kinase Inhibitors - N-(4-{4-amino-7-[1-(2-hydroxyethyl)-1H-pyrazol-4-yl]thieno[3,2-c]pyridin-3-yl}phenyl)-N′-(3-fluorophenyl)urea free base and crystallines form thereof are suitable pharmaceutical ingredients for pharmaceutical compositions useful in the treatment of disease, for example, cancer.05-30-2013
20090092684SMALL MOLECULE ANTAGONISTS OF BCL-2 FAMILY PROTEINS - The present invention relates to naturally occurring and chemically synthesized small molecule antagonists of Bcl-2 family proteins. In particular, the present invention provides gossypol compounds (e.g., isomers, enantiomers, racemic compounds, metabolites, derivatives, pharmaceutically acceptable salts, in combination with acids or bases, and the like) and methods of using these compounds as antagonists of the anti-apoptotic effects of Bcl-2 family member proteins (e.g., Bcl-2, Bcl-X04-09-2009
20130059015Human Cancer micro-RNA Expression Profiles Predictive of Chemo-Response - Disclosed are identified and successfully targeted microRNAs (miRNAs) associated with human cancer cell line response to a range of anti-cancer agents. The strategy of integrating in vitro miRNA expression and drug sensitivity data not only aid in the characterization of determinants of cytotoxic response, but also in the identification of novel therapeutic targets.03-07-2013
20110014303METHOD FOR THE TREATMENT OF CANCER - The invention is based on the surprising finding that treatment with a chemotherapeutic agent such as 5-fluorouracil (5-FU) and an autophagy inducer effectively inhibit the continued growth of, and prevent the recovery following drug withdrawal, of cancer cells. In vivo, drug resistance from a failure to adequately engage in apoptotic programmed cell death leads to a recurrence of cancer and tumours can remain dormant for periods of time before re-emerging as drug resistant metastases. It has been hypothesised that autophagy (Type II cell death) may help cancer cells survive in response to growth limiting conditions, such as nutrient depletion, hypoxia, absence of growth factor, or presence of cytotoxic drug. LiCl is a known autophagy inducer and accelerates cell survival to autophagic programmed cell death.01-20-2011
20110014302USE OF TRANSPLATIN TO PREVENT HEARING LOSS - Methods and compositions for treating and preventing toxic side effects of platinum-based chemotherapy agents are disclosed, in which transplatin is administered to a subject. Transplatin is shown to have protective effects against cisplatin-induced ototoxicity, nephotoxicity and neurotoxicity. Anti-inflammatory activity of transplatin is demonstrated and methods and compositions for treating and preventing inflammatory pain are described.01-20-2011
20090269422METHODS FOR CONTROLLING ANGIOGENESIS AND CELL PROLIFERATION - The present invention relates generally to methods of inhibiting angiogenesis in a patient by administering an effective angiogenesis-inhibiting amount of a thrombin inhibitor, and to the treatment of disease states that result from uncontrolled cell proliferation by administering a thrombin inhibitor alone or co-administering a thrombin inhibitor with an anticancer or cytotoxic agent. Specifically, the thrombin inhibitors used in the methods of the present invention are hirudins.10-29-2009
20090269421COATING MATERIAL - It is an object of the present invention to provide a coating material for a biomedical material surface which can control cell adhesiveness/non-cell adhesiveness and improve the biocompatibility of a material surface. The present invention provides a coating material for a surface of a biomedical material, which comprises a recombinant gelatin.10-29-2009
20130064901GENE EXPRESSION PROFILING FOR CLASSIFYING AND TREATING GASTRIC CANCER - The invention relates to methods for diagnosis and prognosis of gastric cancer. The approach described herein can distinguish intestinal-type gastric cancer (G-INT) from diffuse-type gastric cancer (G-DIF). The genomic expression signatures of G-INT and G-DIF define two major sets of genes. A diagnosis of gastric cancer G-INT and G-DIF can be made on the basis of the expression levels of these genes. This can lead to a better prognosis and treatment of gastric cancer.03-14-2013
20130064902PHOSPHAPLATINS AND THEIR USE FOR TREATMENT OF CANCERS - Stable monomeric phosphaplatins, namely, (pyrophosphato)platinum(II) or platinum(IV) complexes containing a cis-cyclohexanediamine ligand or enantiomerically enriched or enantiopure trans-cyclohexanediamine ligands, and synthesis of these complexes, are provided. Efficacies and toxicities of the phosphaplatin compounds are determined toward a variety of cancers, including sensitive and resistant ovarian cancers, head and neck, and colon cancers. Compositions comprising the platinum complexes, and methods for treatment of proliferative diseases or disorders by means of the complexes or the compositions comprising them are disclosed.03-14-2013
20100323034METHOD FOR DETERMINATION OF SENSITIVITY TO ANTI-CANCER AGENT - Provided are an marker for determining sensitivity to an anticancer agent capable of distinguishing a therapeutic response of an individual patient and a novel means for a cancer therapy using the marker. The marker for determining sensitivity to an anticancer agent contains a calcium-binding protein S100A7, S100A8, or S100A10.12-23-2010
20120195978CAPCNA PEPTIDE THERAPEUTICS FOR CANCER - Administration of compositions comprising cell-permeable caPCNA-derived peptides and their variants reduces the proliferation of cancer cells and also augments cytotoxic effects of chemotherapeutics. The compositions are effective in cells harboring mutations in DNA repair proteins.08-02-2012
20090232907Compositions and methods for treatment of esophageal cancer - Novel ureyl-substituted naphthalimide derivatives, pharmaceutically acceptable salts thereof and solvates thereof, are useful for making pharmaceutical compositions for the treatment of cell proliferative diseases such as cancer. The invention also provides methods of treating specific types of cancer such as prostate, esophageal, glioblastoma, gliosarcoma, NSCLC, head and neck, and breast with the compounds described herein alone and in combination with antineoplastic agents.09-17-2009
20090232906Treatment methods and compositions for lung cancer, adenocarcinoma, and other medical conditions - The present invention discloses and claims: (i) compositions, methods, and kits which lead to an increase in patient survival time in cancer patients receiving chemotherapy; (ii) compositions and methods which cause cytotoxic or apoptotic potentiation of the anti-cancer activity of chemotherapeutic agents; (iii) compositions and methods for maintaining or stimulating hematological function in patients in need thereof, including those patients suffering from cancer; (iv) compositions and methods for maintaining or stimulating erythropoietin function or synthesis in patients in need thereof, including those patients suffering from cancer; (v) compositions and methods for mitigating or preventing anemia in patients in need thereof, including those patients suffering from cancer; (vi) compositions and methods for maintaining or stimulating pluripotent, multipotent, and unipotent normal stem cell function or synthesis in patients in need thereof, including those patients suffering from cancer; (vii) compositions and methods which promote the arrest or retardation of tumor progression in those cancer patients receiving chemotherapy; (viii) compositions and methods for increasing patient survival and/or delaying tumor progression while maintaining or improving the quality of life in a cancer patient receiving chemotherapy; (ix) novel methods of the administration of taxane and/or platinum medicaments and a Formula (I) compound of the present invention to a cancer patient; and (x) kits to achieve one or more of the aforementioned physiological effects in a patient in need thereof, including those patients suffering from cancer.09-17-2009
20100062079POLYMORPHISMS PREDICTIVE OF PLATINUM-COORDINATING COMPLEX INDUCED OTOTOXICITY - Provided are methods, nucleic acids, and arrays for assessing the susceptibility of a subject to the development of ototoxicity in response to receiving one or more platinum-coordinating compounds, the method including determining the presence or absence of one or more polymorphisms, wherein the presence or absence of one or more such polymorphisms is indicative of susceptibility to the development of ototoxicity.03-11-2010
20120114766SUBSTITUTED CHROMAN DERIVATIVES, MEDICAMENTS AND USE IN THERAPY - Novel substituted chroman derivatives and intermediate compounds, compositions containing same, methods for their preparation and uses thereof as therapeutic agents particularly as anti-cancer and chemotherapeutic selective agents are described.05-10-2012
20120114765ANTI-NEOPLASTIC COMPOUNDS, COMPOSITIONS AND METHODS - Disclosed are novel compounds which are useful as therapeutics, especially in anti-neoplastic therapy and in other therapeutic regimes where cysteine protease inhibition is implicated.05-10-2012
20120237615PHARMACEUTICAL COMPOSITIONS OF O-NITRO COMPOUNDS - The present invention provides O-nitro compounds, pharmaceutical compositions of O-nitro compounds and methods of using O-nitro compounds and/or pharmaceutical compositions thereof to treat or prevent diseases or disorders characterized by abnormal cell proliferation, such as cancer, inflammation, cardiovascular disease and autoimmune disease.09-20-2012
20120237614PEPTIDE ABLE TO DISRUPT THE PROTEIN COMPLEX BETWEEN THE HIS273 MUTADED P53 PROTEIN AND THE ONCOSUPPRESSIVE P73 PROTEIN IN TUMOR CELLS AND THERAPEUTIC USES THEREOF - The present invention concerns a SIMP peptide (Short-interfering mutant p53 peptides) suitable to disrupt the protein complexes within tumour cells resulting from m-p53 and p73 proteins selectively in tumours wherein m-p53 contains His273 mutation.09-20-2012
20130164387NOVEL MANNOPYRANOSIDE DERIVATIVES WITH ANTICANCER ACTIVITY - The present invention relates to mannopyranoside-derived compounds and to the use thereof as medicaments, in particular in the treatment of cancer diseases, and also to the method for preparing same and to pharmaceutical compositions comprising such compounds. Medical devices surface-treated with mannopyranoside-derived compounds according to the invention also form part of the invention.06-27-2013
20110027390Methods for Reducing Cisplatin Nephrotoxicity - The present invention provides compositions and methods to reduce renal damage caused by nephrotoxic drugs such as cisplatin. The invention provides compositions comprising a substituted cyclodextrin, cisplatin and a pharmaceutically acceptable carrier, where the cyclodextrin is present in an amount effective for substantially inhibiting the nephrotoxic effect of the cisplatin.02-03-2011
20110142961METHODS AND REAGENTS FOR PREDICTING CLINICAL OUTCOME AND CUSTOMIZING CHEMOTHERAPY IN LUNG CANCER PATIENTS - The invention relates to methods for the prediction of the clinical outcome of a patient suffering from cancer based on the relative expression levels of BRCA1 and RAP80 genes. The invention also relates to anticancer combination therapies comprising a platinum-based chemotherapeutic agent and an inhibitor of RAP80.06-16-2011
20110280963COMBINATION THERAPY FOR THE TREATMENT OF CANCER - The present invention provides methods of sensitizing lung cancer cells to cisplatin and inhibiting the growth of lung cancer tumors by employing a modified eIF-4E antisense oligonucleotide and cisplatin in combination.11-17-2011
20110129550CANCER TREATMENT METHOD - Invented is a method of treating cancer or a pre-cancerous syndrome in a mammal, including a human, in need thereof which comprises the administration of an effective amount of a non-peptide thrombopoietin (TPO) receptor agonist or TPO cell cycle activator and a chemotherapeutic agent to such mammal, suitably a human.06-02-2011
20120231090MOLECULAR BIOMARKER SET FOR EARLY DETECTION OF OVARIAN CANCER - Embodiments of the present invention concern methods and compositions related to detection of ovarian cancer, including detection of the stage of ovarian cancer, in some cases. In particular, the invention encompasses use of expression of TFAP2A and in some embodiments CA125 and/or E2F5 to identify ovarian cancer, including detecting mRNA and/or protein levels of the respective gene products. Kits for detection of ovarian cancer are also described.09-13-2012
20090136595ANTI-WRINKLE COSMETIC COMPOSITION - The present invention relates to a composition for treating skin comprising an acylated short chain bioactive peptide and fulvic acid, and optionally colloidal gold. The invention further relates to a method for topically administering the composition in an amount therapeutically effective to reduce wrinkles by building the dermal fibroblast matrix. The invention further relates to a method of treating wrinkled skin by topically administering the composition to an individual in need of such treatment.05-28-2009
20110300234Methods of Treating Tumor Cells Using RHCC Protein, Fragment or Variant - Methods of treating tumor cells in an individual comprise administering to the individual a drug having anti-tumor effect, wherein the drug is delivered into the tumor cells via Right-Handed Coiled-Coil (RHCC) protein or a fragment or variant thereof. The drug may, for example, be a metal-containing compound, a protein or peptide drug, and/or an organic hydrophobic compound.12-08-2011
20100028460IMPROVEMENTS IN RELATION TO CANCER THERAPY - The present invention relates to an improved assay for identifying compounds that may be of use in conjunction with cancer chemotherapeutic agents and anti-proliferative agents, to improve efficacy of such agents and/or render effective compounds with relatively little therapeutic activity. There is also provided a class of compounds of formula (I) and retinoids identified by said assay which may be used in a combination therapy, with current and novel agents, to treat cancers and other diseases associated with abnormal host cell proliferation, such as psoriasis.02-04-2010
20100183742PHOSPHORAMIDATE ALKYLATOR PRODRUGS FOR THE TREATMENT OF CANCER - Compositions containing, and, methods administering, TH302, are useful in treatment of cancer and other hyper-proliferative diseases.07-22-2010
20110287110COMBINATION CANCER TREATMENT - Described herein are methods of inhibiting the proliferation of cancer cells and methods of treating cancer, by administering a combination of a copper chelator and a platinum-based chemotherapeutic.11-24-2011
20110287111SUBSTITUTED 6-(2-AMINOBENZYLAMINO)PURINE DERIVATIVES, THEIR USE AS MEDICAMENTS AND PREPARATIONS CONTAINING THESE COMPOUNDS - The invention relates to new substituted 6-(2-aminobenzylamino)purines, represented by the general formula I, which can be used in CDK inhibition, in particular, in the treatment of viral infections and diseases involving cell proliferation. The invention further includes pharmaceutical preparations containing substituted 6-(2-aminobenzylamino)purines.11-24-2011
20110293745AURORA KINASE INHIBITORS - The present invention provides Compound 1, solid forms thereof, compositions thereof, as Aurora kinase inhibitor for use as an oncology agent. The present invention also provides synthetic methods of preparing Compound 1 and intermediates thereto.12-01-2011
20110293744BENZOXAZOLE INHIBITORS OF POLY(ADP-RIBOSE)POLYMERASE - Inhibitors of poly(ADP-ribose)polymerase having a structure of Formula (I), ways to make them and methods of treating patients using them are disclosed.12-01-2011
20100183743BENZTHIAZOLE INHIBITORS OF POLY(ADP-RIBOSE)POLYMERASE - Inhibitors of poly(ADP-ribose)polymerase having a structure of Formula (I), ways to make them and methods of treating patients using them are disclosed.07-22-2010
20090123567BISBENZISOSELENAZOLONYL DERIVATIVES HAVING ANTINEOPLASTIC, ANTI-INFLAMMATORY AND ANTITHROMBOTIC ACTIVITIES AS WELL AS THEIR USE - The present invention relates to new bisbenzisoselenazolonyl derivatives of the following general formula (I), wherein R is C05-14-2009
20110262561Protoilludance Norsesquiterpenoid Esters and Uses Thereof - Disclosed herein are novel protoilludane norsesquiterpenoid ester compounds isolated from mycelium of 10-27-2011
20090311345NATURAL ORIENTAL MEDICINAL COMPOSITION FOR THE PROMOTION OF HAIR GROWTH AND METHOD OF PREPARING THE SAME - A natural oriental medicinal composition for the promotion of hair growth is provided. The oriental medicinal composition includes a black bean extract, a tangerine extract, a potato extract, a pine needle extract and a quartzite powder. Since the oriental medicinal composition includes crude drugs extracted from natural substances that can prevent hair loss, it is effective for hair growth and has ensured biostability. Particularly, the oriental medicinal composition allows newborn hair to grow in the form of stiff hair.12-17-2009
20100129471ISO CA-4 AND ANALOGUES THEREOF AS POTENT CYTOTOXIC AGENTS INHIBITING TUBULINE POLYMERIZATION - The invention relates to a compound of the formula (I) in which: R05-27-2010
20090311344Dosing Regimen - The present invention provides a method for treating hematological disorders such as anemia and thrombocytopenia, whereby a TPO mimetic peptide compound is administered using a specified dosing regimen. The dosing regimen involves the administration of the TPO mimetic peptide compound within a specified time frame surrounding administration of a chemotherapeutic agent. The dosing regimen also involves monitoring subject response in order to determine future course of treatment.12-17-2009
20090311343Thiazole Compounds, and Compositions and Methods Using Same - The present invention provides, in part, compounds and compositions including a thiazole moiety, that may be useful, for example, for treating cancers, for example kidney cancer.12-17-2009
20120034318DIAGNOSTIC METHOD USING PALB2 - The present invention provides a method for detecting mutations in the PALB2 gene in pancreatic cancer patients and in individuals having a family history of pancreatic cancer. Methods are also provided for diagnosing a predisposition to pancreatic cancer, for predicting a patient's response to pancreatic cancer therapies, and for treating pancreatic cancer, based on presence of a PALB2 mutation or abberant PALB2 gene expression in a patient.02-09-2012
20120034317Prediction of Response to Platinum-Based Therapy - Method for determining whether a mammalian subject having a cancer belongs to a first or a second group, wherein subjects of the first group are more likely to respond to a platinum-based therapy than subjects of the second group, comprising the steps of: evaluating the amount of RBM3 protein or RBM3 mRNA present in at least part of a sample earlier obtained from said subject, and determining a sample value corresponding to said amount; comparing the sample value with a reference value; and, if said sample value is higher than said reference value, concluding that said subject belongs to a first group; and if said sample value is lower than or equal to said reference value, concluding that said subject belongs to a second group. There is further provided means useful in the establishment of a treatment prediction.02-09-2012
20090285908METHOD OF TREATING ENDOTHELIAL INJURY - The use of human erythropoietin (EPO) to prevent or treat endothelial injury due to chemotherapy, radiation therapy, mechanical trauma, or to a disease state which damages the endothelium (such as inflammation, heart disease or cancer) is described. The use of EPO in conjunction with the administration of chemotherapeutic agents is described.11-19-2009
20120107417Effective Antitumor Treatments - ET-743 is used in the preparation of a medicament for an effective treatment of a tumour by combination therapy employing ET-743 with another drug.05-03-2012
20090263504METHODS AND COMPOSITIONS FOR PROMOTING ACTIVITY OF ANTI-CANCER THERAPIES - The present invention relates to a method of inhibiting growth of a cancerous cell. The method includes the step of exposing the cancerous cell to an anti-cancer therapy and an effective amount of a steroid saponin.10-22-2009
20110171323METHODS AND KITS TO PREDICT PROGNOSTIC AND THERAPEUTIC OUTCOME IN SMALL CELL LUNG CANCER - Disclosed herein are methods used in the identification of cancer patients likely or unlikely to respond to systemic chemotherapy, methods of treating cancer patients based upon the identification, and kits that facilitate the identification. The methods and kits involve detecting the expression of specific microRNA.07-14-2011
20090274773ANTIPROLIFERATIVE COMBINATION COMPRISING CYC-682 AND A CYTOTOXIC AGENT - A first aspect of the invention relates to a combination comprising 2′-cyano-2′-deoxy-N4-palmitoyl-1-beta-D-arabi-nofuranosyl-cytosine, or a metabolite thereof, or a pharmaceutically acceptable salt thereof, and a cytotoxic agent selected from (a) a vinca alkaloid; (b) a taxane; (c) a cytosine analogue; (d) an anthracycline; and (e) a platinum antineoplastic agent. A second aspect of the invention relates to a pharmaceutical product comprising the above combination as a combined preparation for simultaneous, sequential or separate use in therapy. A third aspect of the invention relates to a method for treating a proliferative disorder, said method comprising simultaneously, sequentially or separately administering the above combination.11-05-2009
20110076343Multiple Myeloma Treatments - Methods for treating cancer by using compound PM00104, in particular, for treating multiple myeloma are provided.03-31-2011
20090104285Methods and Compositions for Use in Treating Cancer - The invention provides methods and compositions for use in treating diseases associated with excessive cellular proliferation, such as cancer.04-23-2009
20080213399Combination Therapies Using Hdac Inhibitors - The present invention pertains to a method for treating cancer, such as lung cancer, multiple myeloma, lymphoma, and epithelial ovarian cancer, comprising the administration to a patient in need thereof a first amount or dose of a histone deacetylase (HDAC) inhibitor, such as PXD-101, and a second amount or dose of another chemotherapeutic agent, such as dexamethasone or 5-fluorouracil, or an epidermal growth factor receptor (EGFR) inhibitor, such as TarcevaÚ, wherein the first and second amounts or doses together comprise a therapeutically effective amount.09-04-2008
20100129470METHOD OF TREATING BRAIN CANCER - Disclosed is (4-Methoxy-phenyl)-methyl-(2-methyl-quinazolin-4-yl)-amine hydrochloride effective as a cytotoxic agent. (4-Methoxy-phenyl)-methyl-(2-methyl-quinazolin-4-yl)-amine hydrochloride is useful in the treatment of a variety of clinical conditions in which uncontrolled growth and spread of abnormal cells occurs, and in particular to its use in treating brain cancer.05-27-2010
20120294957TREATMENT OF LUNG CANCER - Disclosed are methods of treating lung cancer by administering to a human in need thereof effective amounts of FTS, or various analogs thereof, or a pharmaceutically acceptable salt thereof, optionally, in combination with a chemotherapeutic agent. Chemotherapeutic agents, and combinations thereof, for use with FTS, its analogs, or its salts are also disclosed.11-22-2012
20120294956INHIBITION OF DYNAMIN RELATED PROTEIN 1 TO PROMOTE CELL DEATH - The present invention relates to compositions and methods for reducing cell proliferation and/or promoting cell death by inhibiting Drp1. It is based, at least in part, on the discoveries that (i) Drp1 disruption-induced mitochondrial hyperfusion is functionally linked to the cell cycle regulation apparatus, so that Drp1 inhibition results in a disruption of the cell cycle and DNA aberrancies; (ii) inhibition of both Drp1 and ATR are synthetic lethal causing increased DNA damage and apoptotic cell death; and (iii) even in resistant cell lines, Drp1 inhibitor (e.g., mdivi-1) together with a second antiproliferative agent (e.g., cisplatin or carboplatin) act synergistically to promote apoptosis. Accordingly, the present invention provides for novel anticancer strategies.11-22-2012
20080286381Anti-tumor drug, medicament, composition, and use thereof - An active polypeptide includes the amino acid sequence of SEQ ID NO:3, or having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of SEQ ID NO:3, or fragments thereof having at least 20 contiguous amino acids, or peptides having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of the fragments, provided that the polypeptide is not SEQ ID NO:2.11-20-2008
20080311223INJECTABLE POLYMER-LIPID BLEND FOR LOCALIZED DRUG DELIVERY - An injectable polymer-lipid blend is provided as a localized drug delivery system for a pharmaceutically active agent. The blend may be prepared from a chitosan-based material, fatty acid and phospholipid. The chitosan-based material may be a water soluble chitosan derivative. The fatty acid may be a fatty acid or a fatty aldehyde, such as laurinaldehyde, having an acyl chain length of C8-C16. The rheological properties of the blend relates to the ratio of the components and to the acyl chain length of the fatty acid. The injectable system is well suited for the delayed release of pharmaceutically active agents in the treatment of cancer and other diseases requiring localized drug delivery.12-18-2008
20080241274Indibulin therapy - The invention provides combination therapy, wherein one or more other therapeutic agents are administered with indibulin or a pharmaceutically acceptable salt thereof and the combination is synergistic. Another aspect of the invention relates to the treatment of cancer with indibulin as a single agent. Another aspect of the invention relates to dosing regimen for administration of oral dosage forms of indibulin.10-02-2008
20090004293Phosphorous Containing Compounds Including Triphenylmethylphosphonate Esters for the Treatment of Melanoma and Other Cancers - Compounds and related methods for synthesis, and the use of compounds and combination therapies for the treatment of cancer and modulation of apoptosis in cells are disclosed. Particularly disclosed are phosphonate esters. Compounds, methods of making the compounds, medicaments and method of manufacture of medicaments and therapeutic methods with applications against cancer including breast cancer, melanoma, colon cancer, leukemia and lymphoma, and other cancer cells are described.01-01-2009
20080268068Sparc Promoter Mutations Associated with Drug Resistance, and Methods, Oligonucleotides, Cells and Arrays Associated Therewith - The invention provides oligonucleotide or peptide nucleic acids, peptide nucleic acids, arrays, cells, methods and kits for determining the presence or absence of a SPARC promoter mutation indicative of a cancer's resistance or sensitivity to a therapeutic regimen. The method generally comprises determining presence or absence of a SPARC promoter mutation for a subject's cancer. The invention also provides for methods of identifying potential subjects having a resistant cancer for selection to administer an alternative therapy regimen. The invention also provides for methods of treating such subjects with a therapeutic regimen based on the subject's genotype.10-30-2008
20120141606SIGMA LIGANDS FOR THE PREVENTION OR TREATMENT OF PAIN INDUCED BY CHEMOTHERAPY - The invention refers to the use of a sigma ligand of formula (I) to prevent or treat pain induced by a chemotherapeutic agent, especially pain induced by taxanes, vinca alkaloids or platinum-containing chemotherapeutic drugs.06-07-2012
20090162454Compositions and Methods for Effecting NAD+ Levels Using A Nicotinamide Phosphoribosyl Tranferase Inhibitor - The present invention relates to methods for decreasing cellular DNA repair in a target patient; decreasing cellular NAD06-25-2009
20120070512Substituted 6-(2-hydroxybenzylamino)purine Derivatives, Their Use as Medicaments and Compositions Containing These Derivatives - The invention relates to substituted 6-(2-hydroxybenzylamino)purines of general formula I, to their activity as cyclin-dependent kinases 2, 5, 7 and 9 inhibitors and to their use as medicaments, particularly in the treatment of disorders involving cell proliferation or inflammation. The invention further includes pharmaceutical compositions containing the substituted 6-(2-hydroxybenzylamino)purines.03-22-2012
20090136596P38 INHIBITORS AND METHODS OF USE THEREOF - This invention relates to inhibitors of p38 and methods of utilizing the inhibitors and pharmaceutical compositions thereof in the treatment and prevention of various disorders mediated by p38.05-28-2009
20090258089Chemo- and Radiation-sensitization of Cancer by Antisense TRPM-2 Oligodeoxynucleotides - Administration of antisense oligodeoxynucleotides (ODN) targeted against the testosterone-repressed prostate message-2 (TRPM-2) gene can reduce the amount of TRPM-2 in renal cell cancer (RCC) cells and other cancer cells, and as a result enhance chemosensitivity of these cells to chemotherapy agents and radiation. Thus, for example, the sensitivity of renal cell cancer cells to a chemotherapeutic agent can be increased by exposing renal cell cancer cells to a chemotherapeutic agent and an agent which reduces the amount of TRPM-2 in the renal cell cancer cells. This provides an improved method for treatment of renal cell cancer, which is generally resistant to treatment with known chemotherapy agents.10-15-2009
20080317870Compositions and Mehtods for Treating and Preventing Cancer Using Analogs of Vitamin D - Disclosed are compositions and methods used to treat and/or prevent cancer and metabolic diseases, such as psoriasis. In one aspect, the present invention pertains to the use of cross-linking analogs of vitamin D and its metabolites employed for the treatment of prostate cancer.12-25-2008
20090324741INJECTABLE POLYMER-LIPID BLEND - An injectable polymer-lipid blend is provided. The blend may provide a localized drug delivery system for a pharmaceutically active agent. The blend may be prepared from a chitosan-based material, fatty acid and phospholipid. The chitosan-based material may be a water soluble chitosan derivative. The fatty acid may be a fatty acid or a fatty aldehyde, such as laurinaldehyde, having an acyl chain length of C8-C16. The rheological properties of the blend relates to the ratio of the components and to the acyl chain length of the fatty acid. The injectable system is well suited for the delayed release of pharmaceutically active agents in the treatment of cancer and other diseases requiring localized drug delivery.12-31-2009
20130122111METHOD FOR TREATMENT OF ADVANCED SOLID TUMORS - The present invention relates to the use of Volasertib or a salt thereof or a hydrate thereof in combination with Cisplatin or Carboplatin or a salt thereof or a hydrate thereof for treating patients suffering from advanced and/or metastatic solid tumours.05-16-2013
20090324743PULMONARY DRUG DELIVERY - The present invention relates to formulations for delivery of drugs to the respiratory tract, especially the lungs, as well as improved methods of treating subjects suffering or predisposed to suffering from lung conditions/diseases. The invention is particularly directed to lung cancer treatment using, for example, cytotoxic platinum-based drugs.12-31-2009
20090324742Peham dendrimers as excipients - The present invention concerns poly(etherhydroxylamine) PEHAM dendritic polymers wherein they function as excipients for the enhancement of water solubility of poorly water soluble (hydrophobic) Active Materials or enhancement of oil solubility of poorly oil soluble (hydrophilic) Active Materials. These dendritic polymers can have Active Materials associated with them by one or more of the following: (a) by adsorption onto the surface or (b) encapsulation into the interior of the dendritic polymers or (c) a mixture of both where these interactions are driven by one or more of the following (i) electrostatic attraction, (ii) hydrogen bonding between dendritic polymers and Active Material and (iii) hydrophobic or hydrophilic interactions or mixtures of these interactions. Additionally, these associated Active Materials can be associated with dendritic polymers through chemical bonding to the surface or to internal functionalities (IF) of PEHAM dendritic polymers or both. Such bonding is done either directly between PEHAM dendritic polymers and Active Material molecules or via a linker that can have a hydrolysable bond to the Active Material. In addition, a chemical entity with strong interaction to the Active Material and dendritic polymers can be associated with the dendritic polymer prior to adsorption or encapsulation of the Active Material or together with the Active Material.12-31-2009
20130122112Derivatized Hyperbranched Polyglycerols - Herein are provided derivatized hyperbranched polyglycerols (“dHPGs”). The dHPG comprises a core comprising a hyperbranched polyglycerol derivatized with C05-16-2013
20130122113ANTITUMORAL COMBINATION COMPRISING OMBRABULIN, A TAXANE DERIVATIVE AND A PLATINUM DERIVATIVE - The invention concerns an antitumoral combination comprising ombrabulin, a taxane derivative and a platinum derivative and its use in the treatment of advanced solid tumors.05-16-2013
20130122114METHODS AND COMPOSITIONS FOR INHIBITING THE NUCLEAR FACTOR KAPPAB PATHWAY - The current invention provides therapeutic methods which include inhibition of nuclear factor κb pathway in a cell based on the discovery of an active fraction of a plant extract termed NUP or a composition which includes NUP. NUP is used in treating and managing different diseases such as cancer, inflammation, and virus infections.05-16-2013
20090022814CANCER TREATMENT METHOD - Invented is a method of treating cancer in a mammal, including a human, in need thereof which comprises the administration of an effective amount of a TPO cell cycle activator and a chemotherapeutic agent to such mammal.01-22-2009
20090004294PERSONAL LUBRICANT FORMULATIONS COMPRISING COLLOIDAL METALS AND METHODS OF USE - Lubricant compositions and methods are disclosed for aiding and enhancing massage or sexual activity, treating and preventing sexually transmitted diseases, and preventing pregnancy by administering a colloidal metal containing composition. Colloidal metal containing compositions that include metal flakes, sperm-function inhibitors, antimicrobial agents, analgesics, plant extracts, anti-oxidizing agents, and anti-inflammatory agents are also provided and may advantageously be used to in the methods of the invention.01-01-2009
20090208590Analogs of Benzoquinone-Containing Ansamycins and Methods of Use Thereof - The present invention provides analogs of benzoquinone-containing ansamycins and uses thereof for treating and modulating disorders associated with hyperproliferation, such as cancer. The present invention provides analogs of benzoquinone-containing ansamycins where the benzoquinone is reduced to a hydroquinone and trapped by reaction with a suitable acid, preferably ones that increase the solubility and air stability of the resulting 17-ammonium hydroquinone ansamycin analog.08-20-2009
20120195977AURIC ACID ASSISTED SILICON NANOPARTICLE FORMATION METHOD - Embodiments of the invention provide, among other things, a method of preparing nanoparticles including silicon nanoparticles. A mixture is prepared that includes auric acid (HAuCl08-02-2012
20100151050Method for evaluation of compound using RSK1 - A method for evaluation of a compound comprising the steps of introducing an RSK1 gene into a cell to prepare a cell capable of expressing RSK1, contacting a compound to be evaluated with the cell, and detecting the specific binding of the compound to RSK1; and a compound given by the method. The compound can be used as a potentiator of cisplatin. The method enables to find a gene which acts specifically on a cell of cancer induced by the abnormality in p53 or enhanced MAPK pathway and to evaluate a compound by using the gene.06-17-2010
20090117204BENZOISOSELENAZOLE DERIVATIVES WITH ANTI-INFLAMMATION, ANTIVIRUS AND ANTITHROMBOSIS ACTIVITY AND THEIR USE - The present invention relates to new bisbenzisoselenazolonyl derivatives of the following general formulae (I), (II) or (III) and their pharmaceutically acceptable salts. The inventive derivatives have antineoplastic, anti-inflammatory and antithrombotic activities.05-07-2009
20110104306NOVEL COMPOSITIONS AND METHODS FOR THE IDENTIFICATION, ASSESSMENT, PREVENTION AND THERAPY OF HUMAN CANCERS - The present invention is directed to the identification of markers that can be used to determine whether tumors are sensitive or resistant to a therapeutic agent. The present invention is also directed to the identification of therapeutic targets. The invention features a number of “sensitivity markers.” These are markers that are expressed in most or all cell lines that are sensitive to treatment with an agent and which are not expressed (or are expressed at a rather low level) in cells that are resistant to treatment with that agent. The invention also features a number of “resistance markers.” These are markers that are expressed in most or all cell lines that are resistant to treatment with an agent and which are not expressed (or are expressed at a rather low level) in cells that are sensitive to treatment with that agent. The invention also features marker sets that can predict patients that are likely to respond or not to respond to an agent.05-05-2011
20100260868METHOD OF TREATMENT USING CHECKPOINT KINASE 1 INHIBITORS - Methods of treating cancer by administering a DNA damaging agent and a CHK1 Inhibitor on a dosing regimen are provided.10-14-2010
20110059187PEPTIDE DICER SUBSTRATE AGENTS AND METHODS FOR THEIR SPECIFIC INHIBITION OF GENE EXPRESSION - This invention relates to compounds, compositions, and methods useful for reducing a target RNA and protein levels via use of Dicer substrate siRNA (DsiRNA)-peptide conjugates.03-10-2011
20100215772AMINOPYRIMIDINES USEFUL AS KINASE INHIBITORS - The present invention relates to compounds useful as inhibitors of Aurora protein kinases. The invention also provides pharmaceutically acceptable compositions comprising those compounds and methods of using the compounds and compositions in the treatment of various disease, conditions, and disorders. The invention also provides processes for preparing compounds of the invention.08-26-2010
20100239688COMBINATION OF ANTI-ANGIOGENIC SUBSTANCE AND ANTI-TUMOR PLATINUM COMPLEX - The problems of the present invention are to find a pharmaceutical composition and a method for treating cancer that exhibit excellent anti-tumor effect. Excellent anti-tumor effect is achieved when 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide or an analogous compound thereof, a pharmacologically acceptable salt thereof or a solvate thereof is used in combination with an anti-tumor platinum complex.09-23-2010
20120141605PYRAZOLOANTHRONE AND DERIVATIVES THEREOF FOR TREATMENT OF CANCER AND EXCESS ANDROGEN STATES - Provided herein are pyrazoloanthrones or functional derivatives or analogues thereof to activate MIS receptor-mediated downstream effects in a cell. In particular, methods are provided to prevent and treat cancer that expresses MIS receptor type II (MISRII) by administering to a subject at least one pyrazoloanthrone or a functional derivative or analogue thereof. Also provided herein are methods to lower plasma androgen levels in a subject, and/or for the treatment of a subject with a disease characterized by excess androgen, whereby the subject is administered at least one pyrazoloanthrone or a functional derivative or analogue thereof. Also provided are methods to decrease the dose of a chemotherapeutic agent by administering the chemotherapeutic agent with a pyrazoloanthrone or a functional derivative or analogue thereof that lowers the effective dose of the chemotherapeutic agent.06-07-2012
20100136137THERAPEUTIC COMBINATION OF A PANHER/VEGFR2 KINASE INHIBITOR AND A PLATINUM COMPOUND - This invention relates to a synergistic therapeutic combination of anti-cancer compounds which comprises a) a panHER/VEGFR2 kinase inhibitor, and b) a platinum compound, and optionally at least one pharmaceutically acceptable carrier for simultaneous, separate or sequential use. The invention also relates to treating certain cancers utilizing the combination of the invention.06-03-2010
20100136138TREATMENT OF LUNG CANCER - Disclosed are methods of treating lung cancer by administering to a human in need thereof effective amounts of FTS, or various analogs thereof, or a pharmaceutically acceptable salt thereof, optionally, in combination with a chemotherapeutic agent. Chemotherapeutic agents, and combinations thereof, for use with FTS, its analogs, or its salts are also disclosed.06-03-2010
20120141603METHODS AND COMPOSITIONS FOR LUNG CANCER PROGNOSIS - Disclosed herein are methods and materials for prognosing survival of lung cancer patients, the methods comprising the detection of gains and losses of minimal common regions and/or genes associated with prognosis and benefit of chemotherapy.06-07-2012
20120141604NOVEL COMPOSITIONS AND METHODS FOR THE IDENTIFICATION, ASSESSMENT, PREVENTION AND THERAPY OF HUMAN CANCERS - The present invention is directed to the identification of markers that can be used to determine whether tumors are sensitive or resistant to a therapeutic agent. The present invention is also directed to the identification of therapeutic targets. The invention features a number of “sensitivity markers.” These are markers that are expressed in most or all cell lines that are sensitive to treatment with an agent and which are not expressed (or are expressed at a rather low level) in cells that are resistant to treatment with that agent. The invention also features a number of “resistance markers.” These are markers that are expressed in most or all cell lines that are resistant to treatment with an agent and which are not expressed (or are expressed at a rather low level) in cells that are sensitive to treatment with that agent. The invention also features marker sets that can predict patients that are likely to respond or not to respond to an agent.06-07-2012
20090074885Reversible Hydrophobic Modification of Drugs for Improved Delivery to Cells - Described are drug formulations that increase regional delivery of the drugs to cells. Methods for reversibly increasing the hydrophobicity of a drug through hydrolytically labile attachment of a hydrophobic moiety and methods for delivering the modified drug to cells are described. Hydrophobic modification increases drug delivery, while lability minimizes entry of the drug into non-target cells.03-19-2009
20090074884FAMILY OF PFKFB3 INHIBITORS WITH ANTI-NEOPLASTIC ACTIVITIES - A methods and compounds for inhibiting 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3 (PFKFB3) are described. Also described are methods of inhibiting cell proliferation, treating cancer, and screening compounds to determine their ability to inhibit PFKFB3.03-19-2009
20110117211Method of Treating or Preventing Tissue Deterioration, Injury or Damage Due to Disease of Mucosa - An immunomodulatory compound is utilized to treat mucosa disease.05-19-2011
20100303929Compounds and methods for treating cancer - The present invention provides a method of treating cancer involving administering an insulin-like growth factor-1 receptor (IGF-1 receptor) agonist and an anti-cancer chemotherapeutic agent. Also provided are compounds for treating cancer comprising an IGF-1-receptor ligand coupled to an anti-cancer chemotherapeutic agent. Also provided are compounds for treating cancer comprising an insulin-receptor ligand coupled to an anti-cancer chemotherapeutic agent.12-02-2010
20090068286METHOD OF TREATING CANCER BY ADMINISTRATION OF 5-SUBSTITUTED NUCLEOSIDES - The invention relates to methods of administration of at least one overexpression inhibitor of DNA repair genes and/or oncogenes (e.g., (E)-5-(2-bromovinyl)-2′-deoxyuridine (BVDU), or a prodrug, or salt thereof) to increase the cytotoxic effect of a cytostatic or cytotoxic chemotherapeutic agent during and/or after chemotherapy, e.g., in the treatment of cancer.03-12-2009
20110129549TRICYCLIC BENZO[5,6]CYCLOHEPTA[1,2-B]PYRIDINE DERIVATIVES AND USES THEREOF - This invention relates to deuterated lonafamib and pharmaceutically acceptable salts. This invention also provides compositions comprising a compound of this invention and the use of such compositions in methods of treating diseases and conditions that are beneficially treated by administering Lonafamib as an inhibitor of the enzyme farnesyl transferase; an inducer of cellular apoptosis (programmed cell death); and an inhibitor of cellular transduction pathways.06-02-2011
20110111057Methods and Compounds Useful to Induce Apoptosis in Cancer Cells - The present invention provides a method for treating cancer in a mammal comprising contacting the cancer cells with a compound which is a apogossypol, derivative.05-12-2011
20110111058METHODS FOR INCREASING THE STABILIZATION OF HYPOXIA INDUCIBLE FACTOR-1 ALPHA - Disclosed herein are methods for controlling the activity of hypoxia-inducible transcription factor 1-alpha (HIF-1α) and diseases, conditions, or syndromes related thereto, inter alia, Peripheral Vascular Disease (PVD), Coronary Artery Disease (CAD), heart failure, ischemia, and anemia. Further disclosed are pharmaceutical compositions comprising HIF-1α prolyl hydroxylase inhibitors useful in treating diseases, conditions, and/or syndromes related thereto the activity of HIF-1α.05-12-2011
20110008465SESQUITERPENE FORMULATIONS, KITS AND METHODS OF USE THEREOF - A pharmaceutical composition comprising a water insoluble sesquiterpene, one or more antioxidants and one or more solubilizers selected from the group consisting of an oil, PEG400, a derivative of castor oil and ethylene oxide, and polysorbate 80, and methods of use thereof.01-13-2011
20090035394USE OF DNA-PK INHIBITION TO SENSITISE ATM DEFICIENT CANCERS TO DNA-DAMAGING CANCER THERAPIES - This invention relates to the finding that inhibition of the catalytic subunit of DNA protein kinase (DNA-PKcs) increases the sensitivity of cancer cells that display an ATM deficient phenotype to DNA damaging therapies, such as irradiation or chemotherapy. Methods of treating cancers displaying an ATM deficient phenotype and methods of determining the susceptibility of a patient to such methods are provided.02-05-2009
20100173013TREATMENT OF NEOPLASTIC DISORDERS USING COMBINATION THERAPIES - The present application is generally directed to compounds, compositions and methods of combination therapy for the treatment of neoplastic disorders.07-08-2010
20110038952GAMBOGIC ACID GLYCOSIDE DERIVATIVES AND ANALOGS, THEIR PREPARATION METHODS AND APPLICATIONS - This invention relates with the gambogic acid glycoside derivatives and analogs of formula I:02-17-2011
20110038951ANTI-TUMOR DRUG, MEDICAMENT, COMPOSITION, AND USE THEREOF - The present invention relates to an active polypeptide including the amino acid sequence of SEQ ID NO:3, or having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of SEQ ID NO:3, or fragments thereof having at least 21 contiguous amino acids, or peptides having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of the fragments, provided that the polypeptide is not SEQ ID NO:2, variants and antigenic fragments thereof, SEQ ID NO 16 or SEQ ID NO 17.02-17-2011
20110086113CANNABINOIDS IN COMBINATION WITH NON-CANNABINOID CHEMOTHERAPEUTIC AGENTS (E.G. SERM OR ALKYLATING AGENTS) - The invention relates to the use of one or more cannabinoids, particularly THC and/or CBD in combination with a non-cannabinoid chemotherapeutic agent in the manufacture of a medicament for use in the treatment of cancer. In particular the cancer to be treated is a brain tumour, more particularly a glioma, more particularly still a glioblastoma multiforme (GBM). The non-cannabinoid chemotherapeutic agent may be a selective estrogen receptor modulator or an alkylating agent.04-14-2011
20110151023COMBINATION THERAPY WITH PARP INHIBITORS - The present invention describes benzimidazole derivatives of Formula (I) which constitute potent PARP inhibitors in combination with radiotherapy or in combination with other chemotherapeutic agents.06-23-2011
20100015249Antitumor agent containing 6'-amidino-2'-naphthyl 4-guanidinobenzoate or salt thereof - It is an object of the present invention to provide novel antitumor agents which have a high therapeutic index while causing neither serious adverse effects nor drug resistance, both of which are the problems associated with existing antitumor agents. In particular, it is an object of the present invention to provide novel agents and therapies which are effective for pancreas cancer, for which no effective therapies and chemotherapeutic agents exist at this stage, and are also capable of inhibiting cancer metastasis and cancer filtration. The antitumor agents, more specifically the therapeutic agents for pancreas cancer and the cancer metastasis inhibitors, of the present invention contain as an active ingredient 6′-amidino-2′-naphthyl 4-guanidinobenzoate or a salt thereof or more specifically the mesylate thereof known as nafamostat mesilate (generic name; also referred to as “Futhan,” “FUT,” and “FUT175.”). Moreover, in another mode of the present invention, the above mentioned FUT is administered in combination with existing anticancer/antitumor agents, particularly preferably in combination with gemcitabine hydrochloride.01-21-2010
20100062077PYRROLO[1,2-A]IMIDAZOLEDIONE EFFECTIVE IN THE TREATMENT OF PERIPHERAL NEUROTOXICITY INDUCED BY CHEMOTHERAPEUTIC AGENTS - The use of a compound of formula (I), is disclosed in treating and/or preventing 5 chemotherapy-induced peripheral neurotoxicity (CIPN). The invention includes pharmaceutical compositions wherein the compound of formula (I) is present in a mixture with anticancer agents. An improved anticancer treatment with reduced CIPN-related side effects is also provided.03-11-2010
20110104305COMPOUNDS AND METHODS FOR THIOL-CONTAINING COMPOUND EFFLUX AND CANCER TREATMENT - Methods for therapy of cystic fibrosis and other conditions such as cancer are provided. The methods comprise one or more agents capable of increasing thiol-containing compound transport via a transporter system (i.e. ABC transporters such as MDR-1 or MRP-2) in cells. Other embodiments include the use of agents to modulate transport of thiol-containing compounds within the cell. Therapeutic methods involve the administration of such agents to a patient afflicted with cystic fibrosis, cancer and/or another condition responsive to stimulation of thiol-containing compound transport.05-05-2011
20110104304O-Methylated Rapamycin Derivatives For Alleviation And Inhibition Of Lymphoproliferative Disorders - The present invention relates to methods of alleviating and inhibiting a lymphoproliferative disorder in a mammal, the method comprising administering one or more rapamycin derivatives (including rapamycin) to the mammal. Further, the invention provides a method for identifying agents which are useful for alleviating and inhibiting a lymphoproliferative disorders, as well as a method for identifying agents which are capable of inhibiting metastasis of lymphatic tumors in a mammal.05-05-2011
20090214669Combination anticancer therapy and pharmaceutical compositions therefore - This invention relates to anticancer therapy and more precisely to the immunological control of cancer.08-27-2009
20110086111POLYMERIC SYSTEMS FOR THE DELIVERY OF ANTICANCER DRUGS - The present invention relates to compositions for the treatment of cancerous tissues in warm-blooded animals containing one or two anticancer agents attached to polymeric carriers having monomer units derived from one or more of N-(2-carboxypropyl)methacrylamide (2-CPMA), N-(3-carboxypropyl)methacrylamide (3-CPMA), N-(2-aminopropyl)methacrylamide (2-APMA) and/or N-(3-aminopropyl)methacrylamide (3-APMA) are also included. Anticancer agents in compositions can be attached to said polymeric carrier by side-chains which can be susceptible to hydrolysis by lysosomal enzymes intracellularly. Compositions can also include a targeting ligand attached to the polymeric carrier, optionally through a second linker.04-14-2011
20110086110Analogs of Benzoquinone-Containing Ansamycins and Methods of Use Thereof - The present invention provides analogs of benzoquinone-containing ansamycins and uses thereof for treating and modulating disorders associated with hyperproliferation, such as cancer. The present invention provides analogs of benzoquinone-containing ansamycins where the benzoquinone is reduced to a hydroquinone and trapped by reaction with a suitable acid, preferably ones that increase the solubility and air stability of the resulting 17-ammonium hydroquinone ansamycin analog.04-14-2011
20110070317PYRROLOPYRIDINES AS KINASE INHIBITORS - Compounds of Formula (I) are useful for inhibition of CHK1 and/or CHK2. Methods of using compounds of Formula (I) and stereoisomers and pharmaceutically acceptable salts thereof, for in vitro, in situ, and in vivo diagnosis, prevention or treatment of such disorders in mammalian cells, or associated pathological conditions are disclosed.03-24-2011
20100297262PHARMACEUTICALLY ACTIVE COMPOSITIONS COMPRISING OXIDATIVE STRESS MODULATORS (OSM), NEW CHEMICAL ENTITIES, COMPOSITIONS AND USES - Described herein are pharmaceutical compositions and medicaments, and methods of using such pharmaceutical compositions and medicaments in the treatment of inflammation and cancer.11-25-2010
20110256240Combination Therapy - The present invention relates to a method for the production of an antiangiogenic and/or vascular permeability reducing effect in a warm-blooded animal such as a human which is optionally being treated with ionising radiation, particularly a method for the treatment of a cancer, particularly a cancer involving a solid tumour, which comprises the administration of AZD2171 in combination with a platinum anti-tumour agent; to a pharmaceutical composition comprising AZD2171 and a platinum anti-tumour agent; to a combination product comprising AZD2171 and a platinum anti-tumour agent for use in a method of treatment of a human or animal body by therapy; to a kit comprising AZD2171 and a platinum anti-tumour agent; to the use of AZD2171 and a platinum anti-tumour agent in the manufacture of a medicament for use in the production of an antiangiogenic and/or vascular permeability reducing effect in a warm-blooded animal such as a human which is optionally being treated with ionising radiation.10-20-2011
20100062078PHARMACEUTICAL COMPOSITION FOR TREATING CANCER AND THE SIGNALING PATHWAY THEREOF - A pharmaceutical composition, composed of protoapigenone (formula I), for treating gynecological cancers, prostate cancer, urinary bladder cancer and hepatocarcinoma is provided. Protoapigenone has cytotoxicity on these cancers, and arrests the cell cycle at S and G2/M phases. In addition, protoapigenone regulates cell signaling pathways, such as caspase-3, PARP, p-38 MAPK and JNK½, to induce apoptosis. Protoapigenone significantly inhibits the xenograft tumor growth on nude mice, without major side effects. Co-treatment o protoapigenone of protoapigenone and cisplatin shows synergistic cytotoxicity of MDAH-2774 ovarian cancer cells.03-11-2010
20100003346COMBINATION METHODS OF TREATING CANCER - The present invention relates to compositions and methods for treating cancer, by administering a combination comprising a jasmonate derivative (e.g., methyl jasmonate or a compound of any of formulae I through VII or any of the jasmonate derivatives exemplified by such formulae) and at least one other agent selected from a chemotherapeutic agent (e.g., a nitroso-urea, a platinum compound, a taxane derivative, an antitumor antibiotic) and an inhibitor of glycolysis (e.g., 2-deoxy-D-glucose). The jasmonate derivative and the at least one other agent together provide a therapeutic effect, which is preferably synergistic (cooperative).01-07-2010
20120171306THERAPEUTIC TREATMENT OF CANCER AND DYSPLASIA OF THE CERVIX OR VAGINA USING ESTROGEN ANTAGONISTS - A method for treatment of cervical or vaginal cancer and their associated dysplasia, including the steps of identifying a human cervical or vaginal cancer and/or dysplasia patient, administering an effective amount of an estrogen antagonist therapy to the patient, wherein the amount is effective to reduce cancer and dysplasia symptoms, and observing a reduction of cancer and dysplasia symptoms in the patient.07-05-2012
20120171305Response Prediction in Cancer Treatment Involving p53 Adapted Cancer Therapy - Methods for predicting negative consequences of a treatment of a patient with a therapy comprising determining the genetic status of the patient's tumor with respect to p53 by determining in a sample of body fluid or a tissue sample of the patient containing tumor cells or cell-free tumor DNA whether the whole p53 gene is present in native form or whether the p53 gene has one or more mutations. In further embodiments the patient is predicted to be a patient who will suffer negative consequences of a therapy interfering with the cell cycle if the whole p53 gene is present in native form and a patient who will suffer negative consequences of a therapy inducing p53 dependent apoptosis if the p53 gene has one or more mutations. Methods of treatment are also contemplated.07-05-2012
20090317490SUBSTITUTED CHROMAN DERIVATIVES, MEDICAMENTS AND USE IN THERAPY - Novel substituted chroman derivatives and intermediate compounds, compositions containing same, methods for their preparation and uses thereof as therapeutic agents particularly as anti-cancer and chemotherapeutic selective agents are described.12-24-2009
20090317489Combination Comprising an Iron Chelator and an Anti-Neoplastic Agent and Use Thereof - The present invention relates to a combination comprising a a substituted 3,5-diphenyl-1,2,4-triazole, e.g. 4-[3,5-bis(2-hydroxyphenyl)-[1,2,4]triazol-1-yl]benzoic acid and at least one anti-neoplastic agent and to the use of said combination for the preparation of a medicament for the treatment of proliferative diseases.12-24-2009
20090142413Targeted short-lived drug delivery - An aspect of the disclosure includes a system for delivering therapeutic agents. In an embodiment, the system includes an implantable medical device comprising at least one reservoir that holds at least one therapeutic agent. Additionally the device includes a delivery mechanism that provides non-systemic in vivo delivery of the at least one therapeutic agent to a local area of an animal in a therapeutically-effective concentration, wherein the therapeutically-effective concentration is in excess of a concentration that would produce a toxic effect when administered systemically to the animal. Furthermore, the at least one therapeutic agent has short half-life. A further aspect of the disclosure includes a method of delivering a therapeutic agent in vivo at non-systemic high doses to a localized area of an animal.06-04-2009
20110256241METHODS AND COMPOSITIONS FOR THE TREATMENT OF CANCER - The invention relates to compositions comprising an acid ceramidase inhibitor and a choline kinase inhibitor as well as to the uses thereof for the treatment of cancer. The invention also relates to methods for the selection of an individualised therapy of a cancer patient based on the detection of the acid ceramidase levels. Moreover, the invention also relates to compositions comprising a choline kinase inhibitor and a chemotherapeutic agent and uses thereof for the treatment of cancer. Finally, the invention also relates to compositions comprising a choline kinase inhibitor and a death receptor ligand and uses thereof for the treatment of cancer.10-20-2011
20100310674NOVEL COMPOSITION FOR TREATING THE SIDE EFFECTS OF ANTICANCER TREATMENTS - The invention relates to novel compositions, particularly pharmaceutical, comprising, as active ingredients, at least one cytotoxic agent and at least one cholest-4-en-3-one oxime derivative.12-09-2010
20080254145Anti-tumor drug, medicament, composition, and use thereof - The present invention relates to an active polypeptide comprising the amino acid sequence of SEQ ID NO:3, or having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of SEQ ID NO:3, or fragments thereof having at least 21 contiguous amino acids, or peptides having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of the fragments, provided that the polypeptide is not SEQ ID NO:2.10-16-2008
20110165265TRAIL VARIANTS FOR TREATING CANCER - The present invention relates to the use of a mutant TRAIL protein to treat various cancers in mammals. The invention provides a variant TRAIL protein, which has superior selectivity for the death receptor 5, for treating a mammal diagnosed with cancer.07-07-2011
20110165264USE OF CILASTATIN TO REDUCE NEPHROTATOXICITY OF VARIOUS COMPOUNDS - Use of cilastatin to reduce the nephrotoxicity of different compounds. The invention refers to use of cilastatin to prepare a medicinal product to reduce the nephrotoxicity of a nephrotoxic compound that enters the cells of the proximal tubule through cholesterol rafts. The invention is based on the discovery that a great number of nephrotoxic compounds, including drugs, enter the cells of the proximal tubule through the cholesterol rafts, and that cilastatin is able to interfere with this transport mechanism, decreasing the nephrotoxicity of such compounds to a variable extent. The nephroprotective effect is common to compounds of different chemical nature and solubility and is specific for the kidney, causing no interference with the effects of nephrotoxic drugs having their targets in other organs. Therefore, administration of cilastatin allows for decreasing the nephrotoxic effects of different drugs without reducing their therapeutic effects.07-07-2011
20110020470METHODS AND COMPOSITIONS FOR TREATING CANCER - In one aspect the present invention provides methods for treating cancer in a mammal, including the step of administering to a mammal suffering from a cancer an amount of ebselen that is sufficient to inhibit the growth of the cancer. In another aspect, the present invention provides methods for enhancing the chemotherapeutic effect of a platinum-containing chemotherapeutic agent administered to a mammal suffering from cancer.01-27-2011
20110020469AMINOPYRIMIDINES USEFUL AS KINASE INHIBITORS - The present invention relates to compounds useful as inhibitors of Aurora protein kinases. The invention also provides pharmaceutically acceptable compositions comprising those compounds and methods of using the compounds and compositions in the treatment of various disease, conditions, and disorders. The invention also provides processes for preparing compounds of the invention.01-27-2011
20110027389Low Viscosity Liquid Polymeric Delivery System - Low viscosity biodegradable polymer solutions of a liquid biodegradable polymer and biocompatible solvent and methods of using the compositions to form a biodegradable liquid polymer implant are provided.02-03-2011
20110135755Combination therapies for treating neoplastic disease - A method for treating neoplastic disease in a patient is described, which comprises administering to the patient: an antineoplastic platinum (II) complex; a physiologically acceptable source of assimilable copper; a physiologically acceptable source of assimilable manganese; a source of salicylic acid or a physiologically acceptable derivative thereof; and vitamin C.06-09-2011
20110097423Gene Prognosis Predictor Signature for Colorectal Carcinoma - The present invention is drawn to methods of assessing colorectal cancer prognosis by examining the expression of particular genes disregulated in this disease state. Subjects exhibiting disregulation in one or more of these genes will have a higher risk of cancer recurrence and death.04-28-2011
20100068302METHODS AND COMPOSITIONS FOR THE TREATMENT OF CANCER - The invention relates to compositions comprising an acid ceramidase inhibitor and a choline kinase inhibitor as well as to the uses thereof for the treatment of cancer. The invention also relates to methods for the selection of an individualised therapy of a cancer patient based on the detection of the acid ceramidase levels. Moreover, the invention also relates to compositions comprising a choline kinase inhibitor and an alkylating agent and uses thereof for the treatment of cancer. Finally, the invention also relates to compositions comprising a choline kinase inhibitor and an alkylating agent or a death receptor ligand and uses thereof for the treatment of cancer.03-18-2010
20100068303TREATMENT OF CANCER WITH BIO AND CHEMOTHERAPY - This invention relates to compositions and methods utilizing a chemotherapeutic drug and 6-bromoindirubin3′-oxime (BIO) for the treatment of cancer, including glioblastoma multiforme. The present invention demonstrates that BIO works synergistically with chemotherapeutic drugs to increase the cytotoxic effects of these drugs in glioma cells.03-18-2010
20110189305TREATMENT OF LUNG CANCER - An immunomodulatory compound is administered to treat, prevent, inhibit, or reduce lung cancer in a subject.08-04-2011
20100151051ANTI-TUMOR DRUG, MEDICAMENT, COMPOSITION, AND USE THEREOF - An active polypeptide comprising the amino acid sequence of SEQ ID NO:4, having an anti-tumour activity, and compositions and methods including the active polypeptide.06-17-2010
20100028461Gamma-butyrolactone compound and pharmaceutical composition thereof - A γ-butyrolactone compound as shown in Formula (I) and pharmaceutical composition thereof:02-04-2010
20110052723USE OF COMPOUNDS BINDING TO THE SIGMA RECEPTOR LIGANDS FOR THE TREATMENT OF NEUROPATHIC PAIN DEVELOPING AS A CONSEQUENCE OF CHEMOTHERAPY - The present invention refers to the use of compounds binding to the sigma receptor for the treatment or prevention of neuropathic pain resulting from chemotherapy.03-03-2011
20080233208USE OF ERIANIN IN PREPARING PHARMACEUTICAL FOR TREATING TUMORS - This invention relates to a use of the compound of formula (I), Erianin, in preparing pharmaceutical for treating tumors09-25-2008
20100215771USE OF SODIUM CHANNEL BLOCKERS FOR THE TREATMENT OF NEUROPATHIC PAIN DEVELOPING AS A CONSEQUENCE OF CHEMOTHERAPY - The present invention refers to the use of sodium channel blockers such as tetrodotoxin or saxitoxin, its analogues/derivatives as well as their acceptable salts, for the production of a medicament for the treatment of neuropathic pain resulting from chemotherapy.08-26-2010
20110117212THERAPEUTIC COMBINATION COMPRISING AN AURORA KINASE INHIBITOR AND AN ANTINEOPLASTIC AGENT - The present invention provides a therapeutic combination comprising (a) compound 1 of formula (A) as set forth in the specification and (b) one or more antineoplastic agents selected from the group consisting of platinum derivatives, antimetabolite agents, topoisomerase I inhibitors and antimicrotubule agents, wherein the active ingredients are present in each case in free form or in the form of a pharmaceutically acceptable salt or any hydrate thereof.05-19-2011
20090238896COMPOSITIONS AND METHODS FOR DIAGNOSING AND TREATING MELANOMA - Described herein are compositions and methods for the diagnosis, prognosis, prevention and treatment of melanoma or melanoma associated symptoms. The compositions are microRNA molecules associated with melanoma, as well as various nucleic acid molecules relating thereto or derived therefrom.09-24-2009
20110135756COMPOSITIONS AND METHODS FOR PROTECTING SENSORY HAIR CELLS - The invention provides compounds, compositions and methods that can be used for the attenuation of damage to sensory hair cells and symptoms thereof. More particularly, the invention identifies drugs that can be used to protect sensory hair cells from ototoxic medications, noise-induced damage and age-related loss.06-09-2011
20100323033CANCER SENSITIZER COMPRISING CHLOROGENIC ACID - The present invention relates to a cancer sensitizer comprising chlorogenic acid or a derivative thereof. In particular, the present invention relates to a cancer sensitizer comprising chlorogenic acid or a derivative thereof, which can make cancer cells sensitive to anticancer agents to increase the therapeutic effect of anticancer agents. In addition, the present invention relates to a composition for inhibiting the chemo-resistance of cancer cells, comprising chlorogenic acid or a derivative thereof in combination with a pharmaceutically acceptable carrier, an anticancer composition comprising an anticancer agent in addition to the composition, and a method for disrupting the chemo-resistance of cancer cells, comprising administration of the cancer sensitizer.12-23-2010
20090098218Tetracyclic Lactame Derivatives - The present invention describes tetracyclic compounds of formula (IA) or (IB),04-16-2009
20110305777DIMERIC IAP ANTAGONISTS - Smac mimetics that inhibit IAPs.12-15-2011
20100129469USE OF DIMIRACETAM IN THE TREATMENT OF CHRONIC PAIN - The use of dimiracetam in the treatment of chronic pain is disclosed. At doses higher than those previously disclosed in relation with its cognition enhancing activity (i.e. amelioration of learning and memory), dimiracetam was able to completely revert hyperalgesia or allodynia associated with several animal models of chronic pain. Dimiracetam showed high activity in iatrogenic neuropathies associated with antiviral and chemotherapeutic drug treatments and in painful conditions caused by osteoarthritis. In addition, dimiracetam was devoid of toxicity even at doses 10-fold higher than the highest therapeutic dose. The possibility of treating such debilitating pathologies with a highly effective and essentially non-toxic compound is therefore disclosed.05-27-2010
20110111056PEPTIDE DICER SUBSTRATE AGENTS AND METHODS FOR THEIR SPECIFIC INHIBITION OF GENE EXPRESSION - This invention relates to compounds, compositions, and methods useful for reducing a target RNA and protein levels via use of Dicer substrate siRNA (DsiRNA)-peptide conjugates.05-12-2011
20110111059Compositions Comprising Quinazoline Derivatives, Preparation Methods and Uses Thereof - The present invention provides a pharmaceutical composition, useful for the treatment of diseases characterized by abnormal PTKs activity of erbB family in a mammal, comprising pharmaceutically acceptable salts of N-{4-[3-chloro-4-(3-fluoro-benzyloxy)phenylamino]quinazolin-6-yl}-acrylamide, optionally a pharmaceutically applicable carrier or diluent, and a stabilizer having a dispersing and/or protective effect on the active ingredient. The present invention further provides a pharmaceutical formulation comprising said composition, methods for preparation of said composition and said formulation, as well as use of said composition and said formulation for treating diseases characterized by abnormal PTKs activity of erbB family in a mammal.05-12-2011
20120040021METHODS AND COMPOSITIONS FOR THE TREATMENT OF CANCER - The invention relates to compositions comprising an acid ceramidase inhibitor and a choline kinase inhibitor as well as to the uses thereof for the treatment of cancer. The invention also relates to methods for the selection of an individualised therapy of a cancer patient based on the detection of the acid ceramidase levels. Moreover, the invention also relates to compositions comprising a choline kinase inhibitor and an alkylating agent and uses thereof for the treatment of cancer. Finally, the invention also relates to compositions comprising a choline kinase inhibitor and an alkylating agent or a death receptor ligand and uses thereof for the treatment of cancer.02-16-2012
20120040020COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present disclosure relates to pyrazine compounds of formula I:02-16-2012
20120177748COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present invention relates to pyridine compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors.07-12-2012
20110064828TREATMENT OF METASTATIC TUMORS AND OTHER CONDITIONS - The present invention generally relates to pharmacology and, in particular, to the treatment of tumors and other conditions. In some aspects, the invention is directed to the treatment of subjects having tumors or cancers that are metastatic. Surprisingly, it has been found that certain compositions comprising oxidized glutathione-based compounds are able to effectively treat such cancers by inhibiting cell migration and/or invasion processes, and thus, inhibiting tumor cell metastases. Without being bound by any theory, it is believed that such compositions are effective since the compositions are able to suppress the activation of critical signaling pathways within cells that are used for cell migration, such as the ErbB2 and/or phosphoinositide-3 kinase (PI3K) pathways, including the downstream RhoA and AKT pathways. Such pathways are regulated by ERp5, which is a protein disulfide isomerase regulated using certain redox pathways, and those redox pathways are unusually sensitive to treatment using oxidized glutathione-based compounds. Thus, the composition of the instant invention, in some embodiments, are surprisingly effective at preventing tumor metastases. While other references have disclosed the treatment of cancers using oxidized glutathione-based compounds, no reference has suggested that signaling pathways used for cell migration, invasion and metastasis, such as the ErbB2, PI3K, RhoA, and AKT pathways, are highly susceptible to treatment by altering the redox state of the cell, e.g., by oxidized glutathione-based compounds. Accordingly, the use of such compositions to treat tumor metastases is surprising and could not be predicted given the teachings of the prior art.03-17-2011
20110318429Uses of an Immunomodulatory Protein (GMI) from Ganoderma Microsporum - The invention provides a method for inhibiting EGF receptor activity comprising contacting an EGF receptor with an immunomodulatory protein (GMI) from 12-29-2011
20120045524COMBINATION THERAPY WITH PARP INHIBITORS - The present invention describes benzimidazole derivatives of Formula (I) which constitute potent PARP inhibitors in combination with radiotherapy or in combination with other chemotherapeutic agents.02-23-2012
20120045523COMBINATION OF A TLR3 LIGAND AND A CHEMOTHERAPY AGENT WHICH ACTS ON THE INTRINSIC "APOPTOSIS" PATHWAY IN THE TREATMENT OF CANCER - The present invention relates to a drug comprising separately or together (i) a TLR3 ligand and (ii) a chemotherapeutic agent that acts on the intrinsic apoptotic pathway, for simultaneous or sequential administration in the treatment of cancer, wherein the chemotherapeutic agent is selected from topoisomerase II inhibitors, platinum-derived alkylating agents and PI3 kinase inhibitors.02-23-2012
20120171304Stabilized Aptamers To Platelet Derived Growth Factor And Their Use As Oncology Therapeutics - Materials and methods are provided for producing and using aptamers useful as oncology therapeutics capable of binding to PDGF, PDGF isoforms, PDGF receptor, VEGF, and VEGF receptor or any combination thereof with great affinity and specificity. The compositions of the present invention are particularly useful in solid tumor therapy and can be used alone or in combination with known cytotoxic agents for the treatment of solid tumors. Also disclosed are aptamers having one or more CpG motifs embedded therein or appended thereto.07-05-2012
20120003327METHOD OF REDUCING MULTI-DRUG RESISTANCE USING INOSITOL TRIPYROPHOSPHATE - Inositol trisphosphate (ITPP) causes normalization of tumor vasculature and is a particularly effective cancer therapy when a second chemotherapeutic agent is administered following partial vascularization. ITPP also treats, alone or in combination, multi-drug resistant cancers. ITPP can also be used to reduce the amount of a second chemotherapeutic drug required for anticancer activity. In addition, ITPP enhances immune response and treats hyperproliferative disorders.01-05-2012
20100143499DIMERIC IAP INHIBITORS - Compounds, compositions, and methods of using such compounds to modulate apoptosis including IAP antagonists are provided herein. Compositions including mimetics of the invention and, optionally, secondary agents, may be used to treat proliferative disorders such as, cancer and autoimmune diseases.06-10-2010
20110091577DRUG RELEASE COATINGS ON CALCUIM PHOSPHATE AND USES THEREOF - The invention provides implantable drug releasing materials comprising a calcium phosphate composition, a biodegradable polymer adsorbed onto the calcium phosphate composition, wherein the polymer comprises acidic amino acid residues, and a drug adsorbed onto or reacted with the polymer. The invention is further directed to dental and bone implants and implantable medical devices comprising the implantable drug releasing material, methods for preparing the implantable drug releasing material, and methods for delivering the implantable drug releasing material to bone or teeth.04-21-2011
20120207857Compositions and Methods for Potentiation of Cancer Agents - The present invention includes compositions and method to improve the therapeutic index of anti-cancer agents using a novel anti-cancer agent and a modulator or potentiator thereof08-16-2012
20120207855CEPHALOTAXINE ALKALOID COMPOSITIONS AND USES THEREOF - A method of treatment of a host with a cellular proliferative disease, comprising contacting the host with a cephalotaxine and an antiproliferative agent, each in an amount sufficient to modulate said cellular proliferative disease, is described. In some embodiments, the cephalotaxine comprises homoharringtonine (cephalotaxine, 4-methyl-2-hydroxy-2-(4-hydroxy-4-methyl pentyl)butanediocate ester). Antiproliferative agents of the invention comprise alkylating agents, intercalating agents, metal coordination complexes, pyrimidine nucleosides, purine nucleosides, inhibitors of nucleic acid associated enzymes and proteins, and agents affecting structural proteins and cytoplasmic enzymes.08-16-2012
20120009277METHOD FOR SELECTION OF NOVEL ANTI-CANCER HERBS USING CHEMINFORMATIC TOOLS - The various embodiments herein provide a new method of selecting novel anti-cancer herbs using cheminformatics tools. The method involves collecting the herbs having synergistic activity with anti-cancer compounds and categorizing the herbs as synergistic plants (SP). The bioactive compounds are selected from the SP and categorized into synergistic compounds collection (SCC). A similarity search is performed using the selected bioactive compounds through available databases to select similar compounds that are categorized as similar synergistic compounds (SSC). A herbal source for the SSC is searched and categorized as similar herbal synergistic compounds (SHSC). The novelty of the SHSC in cancer treatment is confirmed. The novel herbs are categorized as novel candidate herbs (NCH). The synergistic activity of the resulted herbs (NCH) is confirmed by performing in vitro bioassay.01-12-2012
20100196511AXL INHIBITORS FOR USE IN COMBINATION THERAPY FOR PREVENTING, TREATING OR MANAGING METASTATIC CANCER - This invention is directed to methods of preventing, treating or managing cancer, preferably metastatic cancer, in a patient. The methods comprise administering an effective amount of an Axl inhibitor in combination with the administration of an effective amount of one or more chemotherapeutic agents.08-05-2010
20120058204USE OF OVER EXPRESSION OF CYSTATHIONINE GAMMA LYASE AS A PROGNOSTIC, DIAGNOSTIC AND THERAPEUTIC TARGET FOR CANCER - The present invention relates to a method of identifying an expression level of cystathionine gamma lyase (CTH) in a sample from a subject. The present invention further discloses a method of diagnosing a subject with cancer having risk of resistance to a platinum-based drug. The present invention also discloses a method for improving efficacy of a platinum-based drug in a subject suffering a cancer.03-08-2012
20120058202Means and Method for Ovarian Cancer Prognosis - There is provided a method for determining whether a mammalian subject having an ovarian cancer belongs to a first or a second group, wherein the prognosis of subjects of the first group is better than the prognosis of subjects of the second group, comprising the steps of: a) evaluating an amount of RBM3 protein in at least part of a sample earlier obtained from the subject and determining a sample value corresponding to the evaluated amount; b) comparing said sample value with a predetermined refer-ence value; and if said sample value is higher than said ref-erence value, c1) concluding that the subject belongs to the first group; and if said sample value is lower than or equal to said reference value, c2) concluding that the sub-ject belongs to the second group. Related peptides, affinity ligands, uses and further methods are also provided.03-08-2012
20120156310METHOD FOR PREDICTION OF THERAPEUTIC EFFECT OF CHEMOTHERAPY EMPLOYING EXPRESSION LEVEL OF DIHYDROPYRIMIDINE DEHYDROGENASE GENE AS MEASURE - The present invention provides an antitumor agent comprising cisplatin and a combination drug of tegafur/gimeracil/oteracil potassium that ensures an excellent life-prolongation effect in advanced gastric cancer patients that is superior to that of the standard therapy in Europe and the U.S. using an agent that contains 5-FU and does not contain a dihydropyrimidine dehydrogenase inhibitor, by way of selecting the patients based on dihydropyrimidine dehydrogenase.06-21-2012
20120156312Compositions for Inhibiting Growth of Cancer Stem Cells - The present invention is a biomarker of chemotherapeutic drug-resistant cancer stem cells and a method of inhibiting the growth of drug-resistant cancer stem cells. In one embodiment the cancer stem cells are testicular cancer germ cells. In another embodiment the present invention is a method of overcoming drug resistance in cancer treatment where the combination of low dose decitabine and administration of a chemotherapeutic drug to which cancer cells were resistant results in successful cancer treatment.06-21-2012
20120064175HSP90 Inhibitors for Treating Non-Small Cell Lung Cancer in Wild-Type EGFR and/or KRAS Patients - Provided is a method for treating non-small cell lung cancer with wild-type EGFR gene and/or KRAS gene by administering to a subject in need thereof, an effective amount of a triazolone compound according to the following formula:03-15-2012
20110076342CANCER PEPTIDE THERAPEUTICS - Cell-permeable caPCNA-derived peptides and their variants serve as therapeutic compositions to reduce the proliferation of cancerous cells and also augment cytotoxic effects of chemotherapeutics.03-31-2011
20120156311COMBINATION THERAPY FOR CANCER COMPRISING A PLATINUM-BASED ANTINEOPLASTIC AGENT AND A BIOCOMPATIBLE ELECTRON DONOR - The combination of a biocompatible electron donor and a platinum-based antineoplastic agent exhibits improved efficacy in treating cancer This improved activity appears to be the result of electron transfer from the aforementioned donor compound to the platinum-based antineoplastic agent As the electron donor alone has no chemotherapeutic utility in treating cancer, the resulting combinations appear to be synergistic in nature In select preferred embodiments, the biocompatible electron donor is an amine (such as N,N,N′,N′-tetramethyl-p-phenylene diamine or indocyanine green), a phenolic compound (such as a flavanol or catechin), or a quinone (such as an aromatic quinone), while the antineoplastic is cisplatin.06-21-2012
20110086112PHARMACEUTICAL FORMULATIONS COMPRISING SALTS OF A PROTEIN KINASE INHIBITOR AND METHODS OF USING SAME - The present invention relates to pharmaceutical formulations comprising the protein kinase inhibitor, MP470, and methods of using same in treating conditions involving undesirable cell proliferation, such as cancer.04-14-2011
20100092578PROTEIN KINASE C IOTA - The invention involves PKC04-15-2010
20090324744Effective Antitumor Treatments - ET-743 is used in the preparation of a medicament for an effective treatment of a tumour by combination therapy employing ET-743 with another drug.12-31-2009
20090130229Antitumor uses of compound - The use of an arylidene 2-indolinone derivative for treating tumors involving Met, PDGF-R, FGF-RI, FGF-R3 or Kit tyrosine kinases, or a Ret oncoprotein which includes a MEN2-associated mutation is disclosed.05-21-2009
20090130228PHARMACEUTICAL COMBINATION FOR THE TREATMENT AND OR CHEMOSENSIBILIZATION OF REFRACTORY TUMORS TO ANTICANCER DRUGS - This invention is related to a pharmaceutical combination that contains a Casein kinase 2 (CK2) peptide inhibitor (termed P15) along with the standard chemotherapeutic drugs used in cancer treatment and which are administered together, separated or sequentially. The chemothearapeutic drugs include cisplatin, taxol, alkaloids from Vinca, 5-fluorouracil, doxorubicin, cyclophosphamide, etoposide, mitomicin C, imatinib, iressa and velcade (vortezomib). The synergism between the P15 peptide and the anticancer drugs achieves an efficient concentration of each cytostatic drug in the combination which is from 10- to 100-fold lower than that for each cytostatic drug alone. The pharmaceutical combination described in this invention exhibits lower toxicity compared to that reported by the anticancer therapeutics and therefore, it represents a crucial advantage for its use in cancer therapy. Furthermore, the sequential administration of this pharmaceutical combination through the pretreatment with the P15 peptide leads to the chemo sensibilization of refractory tumors to the anticancer therapeutics.05-21-2009
20100203164Therapeutic Treatment of Cancer and Dysplasia of the Cervix or Vagina Using Estrogen Antagonists - A method for treatment of cervical or vaginal cancer and their associated dysplasia, including the steps of identifying a human cervical or vaginal cancer and/or dysplasia patient, administering an effective amount of an estrogen antagonist therapy to the patient, wherein the amount is effective to reduce cancer and dysplasia symptoms, and observing a reduction of cancer and dysplasia symptoms in the patient.08-12-2010
20120128793IMPLANTABLE OR INSERTABLE MEDICAL DEVICE RESISTANT TO MICROBIAL GROWTH AND BIOFILM FORMATION - Disclosed are implantable or insertable medical devices that provide resistance to microbial growth on and in the environment of the device and resistance to microbial adhesion and biofilm formation on the device. In particular, the invention discloses implantable or insertable medical devices that comprise at least one biocompatible matrix polymer region, an antimicrobial agent for providing resistance to microbial growth and a microbial adhesion/biofilm synthesis inhibitor for inhibiting the attachment of microbes and the synthesis and accumulation of biofilm on the surface of the medical device. Also disclosed are methods of manufacturing such devices under conditions that substantially prevent preferential partitioning of any of said bioactive agents to a surface of the biocompatible matrix polymer and substantially prevent chemical modification of said bioactive agents05-24-2012
20100209537Metal complexes with anticancer activity - This inventive subject matter relates to novel transitional metal complexes of Quinoxalines, methods for making such compounds, and methods for using such compounds for treating diseases and disorders mediated by kinase activity.08-19-2010
20100310675AMINOPYRIMIDINES USEFUL AS KINASE INHIBITORS - The present invention relates to compounds useful as inhibitors of protein kinases. The invention also provides pharmaceutically acceptable compositions comprising those compounds and methods of using the compounds and compositions in the treatment of various disease, conditions, and disorders. The invention also provides processes for preparing compounds of the invention.12-09-2010
20100203163INJECTABLE POLYMER-LIPID BLEND FOR LOCALIZED DRUG DELIVERY - An injectable polymer-lipid blend is provided as a localized drug delivery system for a pharmaceutically active agent. The blend may be prepared from a chitosan-based material, fatty acid and phospholipid. The chitosan-based material may be a water soluble chitosan derivative. The fatty acid may be a fatty acid or a fatty aldehyde, such as laurinaldehyde, having an acyl chain length of C8-C16. The rheological properties of the blend relates to the ratio of the components and to the acyl chain length of the fatty acid. The injectable system is well suited for the delayed release of pharmaceutically active agents in the treatment of cancer and other diseases requiring localized drug delivery08-12-2010
20120135089E3 LIGASE INHIBITORS - The present invention provides, e.g., compounds having the structure of formula (I): The present invention also provides pharmaceutical compositions that include such compounds, and methods for modulating murine double minute 2 protein (Mdm2) E3 ligase activity, particularly the Mdm2-MdmX hetero-complex E3 ligase activity, using such compounds.05-31-2012
20100196510COMPOSITION AND TREATMENT - Disclosed are compositions for the treatment of neuropathy and in particular peripheral neuropathy. The compounds include low molecular weight glycosaminoglycans. The peripheral neuropathy may be due to cancer treatment drugs.08-05-2010
20120213867RAF INHIBITORS FOR THE TREATMENT OF THYROID CANCER - The invention relates to the use of an Raf inhibitor for the manufacture of pharmaceutical compositions for the treatment of thyroid cancer, more specifically papillary thyroid cancer (PTC); the use of a Raf inhibitor in the treatment of thyroid cancer, more specifically PTC; a method of treating warm-blooded animals including mammals, especially humans, suffering from thyroid cancer, more specifically PTC, by administering to a said animal in need of such treatment a dose effective against said disease of an Raf inhibitor. The invention also relates to the use of a Raf inhibitor in combination with a platin compound for the treatment of thyroid cancer, more specifically papillary thyroid cancer.08-23-2012
20120076871METHOD FOR DETECTING, QUANTIFYING AND MAPPING DAMAGE AND/OR REPAIR OF DNA STRANDS - Methods and products for detecting in vitro the presence of damage on DNA or the presence of a biological response to damage on DNA at the molecular level. Molecular Combing or other nucleic acid stretching methods are employed together with compounds reacting with DNA, probes binding DNA, or nucleic acid monomers, especially labeled nucleic acid monomers.03-29-2012
20100047369ANTI-TUMOR DRUG, MEDICAMENT, COMPOSITION, AND USE THEREOF - An active polypeptide comprising the amino acid sequence of SEQ ID NO: 3, or having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of SEQ ID NO: 3, or fragments thereof having at least 21 contiguous amino acids, or peptides having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of the fragments, provided that the polypeptide is not SEQ ID NO: 2. A method for inhibiting cancer and/or tumour growth comprising administering to a subject in need thereof an effective amount of the active polypeptide.02-25-2010
20100047368Compositions and methods for the treatment or prevention of chemoresistant neoplasia - The invention generally features compositions and methods useful for the treatment and diagnosis of a neoplasia in a subject. In particular, the invention provides therapeutic compositions that decrease the expression of an Nfr2 nucleic acid molecule or polypeptide for the treatment of a neoplasia, such as a chemoresistant neoplasia, in a subject.02-25-2010
20100009013METHOD OF DETERMINING A CHEMOTHERAPEUTIC REGIMEN FOR NON-SMALL-CELL LUNG CANCER BASED ON BRCA1 EXPRESSION - The present invention relates to a screening method for classifying patients and for selecting an effective chemotherapy for the treatment of a patient suffering from non-small-cell lung cancer (NSCLC), based on the use of his levels of BRCA1 expression to predict the outcome of chemotherapy.01-14-2010
20100285149NOVEL TETRAHYDROPYRIDOTHIOPHENES - Compounds of a certain formula I, in which Ra and Rb have the meanings indicated in the description, are novel effective compounds with anti-proliferative and apoptosis inducing activity.11-11-2010
20090214670 Rhcc peptide and uses thereof - The present invention relates to different uses of an RHCC peptide and/or a fragment thereof. Said RHCC peptide and/or fragment thereof enables an uptake and association of a drug and/or a substance into a cavity of said peptide and/or fragment, for the delivery and release of such a substance and/or drug to a target site of interest, or for removal of a substance from a fluid or a non-fluid matter, such as from a bodily tissue or a bodily fluid. An RHCC peptide and/or a fragment thereof, may also in one context be used in the production of nanoparticles, or as a catalyst in a chemical reaction. In a preferred aspect, said RHCC peptide and/or fragment thereof, comprises a drug delivery system for the delivery of a drug to a site of interest in a living body.08-27-2009
20120082736Small-molecule TNF modulator to reduce the side effects of chemotherapy and radiotherapy - Cancer patients treated by chemotherapy and/or radiotherapy often suffer serious side effects. Currently, there is only one FDA approved and used as both a chemoprotector and a radioprotector, amifostine, which is associated with significant problems. Disclosed in the present invention are novel methods of using UTL-5g as both a chemoprotector and radioprotector for treating cancer patients in addition to other related methods.04-05-2012
20120189713MONOMERS AND PHASE-SEPARATED BIOCOMPATIBLE POLYMER COMPOSITIONS PREPARED THEREFROM FOR MEDICAL USES - The invention relates to novel monomers of Formula (I) useful for preparation of phase-separated biocompatible polymers or polymer compositions. These polymers or polymer compositions may be bioresorbable and/or biodegradable and have desirable mechanical properties, such as fracture and/or fatigue toughness, which have not been a primary design criteria for such polymers previously. The polymers or polymer compositions are useful in a variety of medical applications, such as in the fabrication of medical devices. Therefore, methods for preparing these polymers or polymer compositions and medical devices are also encompassed by this disclosure.07-26-2012
20120258181ANTICANCER COMBINATION OF ARTEMISININ-BASED DRUGS AND OTHER CHEMOTHERAPEUTIC AGENTS - The present invention relates to combinations between artemisinin-based potent anti-malarial agents, selected from the group consisting of ART, DHA and ARM, and a further chemotherapeutic drug selected from the group consisting of a camptothecin derivative, or a PARP-1 inhibitor, or an intercalating DNA agent, or an alkylating agent. Such combinations, showed medium to strong synergism in various models of cancer, in particular in NSCL.10-11-2012
20120258180PARP INHIBITORS FOR THE TREATMENT OF CIPN - The present invention relates to the method of treating chemotherapy-induced neuropathy in a subject in need thereof with the use of a poly(ADP-ribose)polymerase (PARP) inhibitor.10-11-2012
20090047365Novel Concomitant Use of Sulfonamide Compound with Anti-Cancer Agent - The present invention relates to a pharmaceutical composition, a kit, a method of treating cancer and/or a method of inhibiting angiogenesis comprising a sulfonamide compound in combination with a platinum complex, a DNA-topoisomerase I inhibitor, an antimetabolite, a microtubule inhibitor or an antibiotic.02-19-2009
20110123644MACROCYCLIC COMPOUNDS AND METHODS OF TREATMENT - The instant invention describes macrocyclic compounds having therapeutic activity, and methods of treating disorders such as cancer, tumors and cell proliferation related disorders, and HDAC mediated disorders.05-26-2011
20120263802Use of Quinazoline Derivative ZD6474 Combined With Platinum Compounds and Optionally Ionising Radiation in the Treatment of Diseases Associated With Angiogenesis and/or Increased Vascular Permeability - The present invention relates to a method for the production of an antiangiogenic and/or vascular permeability reducing effect in a warm-blooded animal which is optionally being treated with ionising radiation, which comprises the administration of ZD6474 in combination with a platinum anti-tumour agent; to a pharmaceutical composition comprising ZD6474 and a platinum anti-tumour agent; to a combination product comprising ZD6474 and a platinum anti-tumour agent for use in a method of treatment of a human or animal body by therapy; and to a kit comprising ZD6474 and a platinum anti-tumour agent.10-18-2012
20120328714EARLY DETECTION AND TREATMENT OF LUNG CANCER - This document provides methods and materials involved in the early detection of lung cancer (e.g., small cell lung cancer). For example, this document provides methods and materials for assessing nucleic acid obtained from a blood sample of a human for a CpG methylation site profile that, at least in part, indicates that the human has lung cancer (e.g., small cell lung cancer).12-27-2012
20110045102Cancer chemotherapy compositions comprising PI3K pathway modulators and triptolide - The present invention provides compositions and methods for inhibiting growth of and/or killing cancer cells. The compositions include: an inhibitor of the PI3K signal transduction pathway, and additional agents, such as Triptolide.02-24-2011
20120269902Thiazole Compounds, and Compositions and Methods Using Same - The present invention provides, in part, compounds and compositions including a thiazole moiety, that may be useful, for example, for treating cancers, for example kidney cancer.10-25-2012
20120269903NOVEL MANNOPYRANOSIDE DERIVATIVES WITH ANTICANCER ACTIVITY - The present invention relates to mannopyranoside-derived compounds and to the use thereof as medicaments, in particular in the treatment of cancer diseases, and also to the method for preparing same and to pharmaceutical compositions comprising such compounds. Medical devices surface-treated with mannopyranoside-derived compounds according to the invention also form part of the invention.10-25-2012
20120269901Methods and Compounds Useful to Induce Apoptosis in Cancer Cells - The present invention provides a method for treating cancer in a mammal comprising contacting the cancer cells with a compound which is a apogossypol, derivative.10-25-2012
20110236507INHIBITION OF DNA POLYMERASES TO AUGMENT CHEMOTHERAPEUTIC AND ANTIMICROBIAL AGENTS - Disclosed herein is the identification of human DNA polymerase κ (pol κ) as the polymerase that mediates repair of DNA containing interstrand cros slinks (ICLs). The mechanism of action of a number of chemotherapeutic and antimicrobial agents is the induction of ICLs. Thus, provided herein is a method of enhancing the efficacy of a chemotherapeutic or antimicrobial agent in a subject, including selecting a subject in need of treatment with an ICL-inducing agent and administering to the subject an ICL-inducing agent and a therapeutically effective amount of an inhibitor of pol κ. Subjects in need of treatment with an ICL-inducing agent, include, for example, subjects diagnosed with a hyperproliferative disease, an autoimmune disease or an infectious disease. Also provided is a composition for treating a hyperproliferative disease, an autoimmune disease or an infectious disease, comprising an ICL-inducing agent and an amount of an inhibitor of pol κ sufficient to enhance the efficacy of the ICL-inducing agent. Further provided is a method of identifying a DNA polymerase inhibitor.09-29-2011
20110236506PHARMACEUTICAL ASSOCIATION CONTAINING LIPOIC ACID AND HYDROXYCITRIC ACID AS ACTIVE INGREDIENTS - Pharmaceutical combination containing lipoic acid and hydroxycitric acid as active ingredients. The present invention relates to a novel pharmaceutical combination and to the use thereof for producing a medicament having an antitumor activity. According to the invention, this combination comprises, as active ingredients: lipoic acid or one of the pharmaceutically acceptable salts thereof; and hydroxycitric acid or one of the pharmaceutically acceptable salts thereof. Said active ingredients being formulated together or separately for a conjugated, simultaneous or separate use.09-29-2011
20100233293PHOSPHAPLATINS AND THEIR USE IN THE TREATMENT OF CANCERS RESISTANT TO CISPLATIN AND CARBOPLATIN - The present invention provides phosphaplatins, stable isolated monomeric phosphato complexes of platinum (II) and (IV), and methods of use thereof for treating cancers, including cisplatin- and carboplatin-resistant cancers. Unlike cisplatin, these complexes do not readily undergo hydrolysis and are quite soluble and stable in aqueous solutions. Moreover, these complexes—unlike cisplatin, carboplatin, and related platinum-based anti-cancer agents—do not bind DNA. Rather, data suggests that phosphaplatins trigger overexpression of fas and fas-related transcription factors and some proapoptotic genes such as Bak and Bax. Nevertheless, the complexes exhibit tremendous cytotoxicity towards cancer cells. Thus, the present invention provides novel platinum anticancer agents that have a different molecular target than those in the art.09-16-2010
20120087992miRNAS AS THERAPEUTIC TARGETS IN CANCER - Methods for modulating expression of a component of a cell, comprising contacting the cell with a nucleic acid comprising an miR-140 nucleic acid sequence in an amount sufficient to modulate the cellular component are provided. Overexpression of miR-140 inhibits cell proliferation in both U-2 OS (wt-p53) and HCT 116 (wt-p53) cell lines. Cells transfected with miR-140 are more resistant to chemotherapeutic agent methotrexate, mi-140 expression is related to HDAC4 protein expression. The claimed methods reduce the protein expression level of HDAC4 without degrading the target mRNA.04-12-2012
20110287112PROSTATE CANCER PROGRESSION INHIBITOR AND PROGRESSION INHIBITION METHOD - A prostate cancer progression inhibitor comprises 4-(4-cyano-2-{[2-(4-fluoro-1-naphthyl)propanoyl]amino}phenyl)butyric acid, a salt thereof, a solvate thereof, or a prodrug thereof. 4-(4-Cyano-2-{[2-(4-fluoro-1-naphthyl)propanoyl]amino}phenyl)butyric acid is useful as a prostate cancer progression inhibitor because this butyric acid has, for example, a growth inhibiting effect and a hormone responsiveness recovering effect on prostate cancer that has acquired hormone resistance.11-24-2011
20100215773Use of Quinazoline Derivative ZD6474 Combined With Platinum Compounds and Optionally Ionising Radiation in the Treatment of Diseases Associated With Angiogenesis and/or Increased Vascular Permeability - The present invention relates to a method for the production of an antiangiogenic and/or vascular permeability reducing effect in a warm-blooded animal such as a human which is optionally being treated with ionising radiation, particularly a method for the treatment of a cancer, particularly a cancer involving a solid tumour, which comprises the administration of ZD6474 in combination with a platinum anti-tumour agent; to a pharmaceutical composition comprising ZD6474 and a platinum anti-tumour agent; to a combination product comprising ZD6474 and a platinum anti-tumour agent for use in a method of treatment of a human or animal body by therapy; to a kit comprising ZD6474 and a platinum anti-tumour agent; to the use of ZD6474 and a platinum anti-tumour agent in the manufacture of a medicament for use in the production of all antiangiogenic and/or vascular permeability reducing effect in a warm-blooded animal such as a human which is optionally being treated with ionising radiation.08-26-2010
20120100227KINASE PROTEIN BINDING INHIBITORS - The invention relates to protein binding inhibitor compounds and methods of identifying and using them. The invention further relates to pharmaceutical compositions and methods for treating a variety of diseases and disorders, including cell proliferative disorders, especially cancer.04-26-2012
20100203162Method of preparing (+)-1,4-dihydro-7-[(3S,4S)-3-methoxy-4-(methylamino)-1-pyrrolidinyl]-4-ox- o-1-(2-thiazolyl)-1,8-naphthyridine-3-carboxylic acid - Methods of preparing (+)-1,4-dihydro-7-[(3S,4S)-3-methoxy-4-(methylamino)-1-pyrrolidinyl]-4-oxo-1-(2-thiazolyl)-1,8-naphthyridine-3-carboxylic acid are disclosed. Also provided are pharmaceutical compositions comprising (+)-1,4-dihydro-7-[(3S,4S)-3-methoxy-4-(methylamino)-1-pyrrolidinyl]-4-oxo-1-(2-thiazolyl)-1,8-naphthyridine-3-carboxylic acid, and methods of treatment using such compositions.08-12-2010
20100203161STERILISATION AND CONSERVATION OF LIQUIDS - The invention relates to products, containing a solid biocide and a composite material (08-12-2010
20100196509Methods for Diagnosis and Treatment of Endometrial Cancer - The present invention discloses methods of using endothelial membrane protein 2 (EMP2) as a biomarker for stratification of endometrial premalignancy, diagnosing, staging and imaging of endometrial neoplasia. Further, methods for identifying pharmaceutical/therapeutic modalities are described, including compositions which modulate glycolipid-enriched lipid raft microdomains (GEMs).08-05-2010
20130011496CANCER TESTIS ANTIGENS AS BIOMARKERS IN NON-SMALL CELL LUNG CANCER - A cancer testis antigen biomarker useful to determine whether a non- small cell lung cancer tumor is likely to respond to neoadjuvant chemotherapy is provided. Methods of using the biomarker in the diagnosis, treatment and prognosis of non-small cell lung cancer also are provided. 01-10-2013
20130011497METHOD OF TREATMENT AND SCREENING METHOD - A method for the treatment of a proliferative disease comprising providing a E2F-1 protein which is arginine-methylation defective or administering a substance which reduces the expression and/or activity of PRMT5. The invention also provides antibodies, screening methods and kits.01-10-2013
20100166884POTENTIATION OF CANCER CHEMOTHERAPY BY 7-(2, 5- DIHYDRO- 4-IMIDAZO [1, 2-A] PYRIDINE-3-YL-2,5-DIOXO-IH-PYRROL-3-YL)-9-FLUORO-1,2,3,4 TETRAHYDRO -2-(1-PIPERIDINYL-CARBONYL)-PYRROLO [3,2,1-JK] [1,4] BENZODIAZEPINE - A method for treating gastric cancer, ovarian cancer, non-small cell lung cancer, or colorectal cancer in a patient is described, as well as pharmaceutical compositions comprising 7-(2,5-dihydro-4-imidazo[1,2-a]pyridine-3-yl-2,5-dioxo-IH-pyrrol-3-yl)-9-fluoro-1,2,3,4-tetrahydro-2-(1-piperidinyl-carbonyl)-pyrrolo[3,2,1-jk][1,4]benzodiazepine, useful for the method and a process for preparing said compositions.07-01-2010
20130017273COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present invention relates to pyrrolopyrazines compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors.01-17-2013
20130017272METHOD FOR TREATING NON-SMALL CELL LUNG CANCER - A method of treating a human patient afflicted with lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of a taxane and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′ deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with cell lung cancer.01-17-2013
20110159114COMBINATION COMPRISING AN IRON CHELATOR AND AN ANTI-NEOPLASTIC AGENT AND USE THEREOF - The present invention relates to a combination comprising a a substituted 3,5-diphenyl-1,2,4-triazole, e.g. 4-[3,5-bis(2-hydroxyphenyl)-[1,2,4]triazol-1-yl]benzoic acid and at least one anti-neoplastic agent and to the use of said combination for the preparation of a medicament for the treatment of proliferative diseases.06-30-2011
20110159113HYPERBRANCHED POLYESTER AND A METHOD OF SYNTHESIZING A HYPERBRANCHED POLYESTER - The various embodiments herein provide a hyper branched polyester and a method of synthesizing the same. The embodiments herein also provide a method of encapsulating a drug into the void spaces of the polymer to act as a drug delivery system. The hyper branched polyester mer comprises an acidic moiety and an alcoholic moiety. The acidic moiety is citric acid monohydrate. The alcoholic moiety is glycerol. The acidic moiety and the alcoholic moiety are randomly arranged in the hyperbranched polymer. The method comprises of heating the mixture of citric acid and glycerol at temperatures of 90 to 150° C. by constant stirring for different time periods. In the method of encapsulation, the drug solution is drop-wise added to polymer solution at 37° C. by constant stirring for 24 h.06-30-2011
20110159112Recombinant alpha-fetoprotein and compositions thereof - Disclosed are pharmaceutical and synergistic compositions comprising human recombinant alpha-fetoprotein expressed in eucaryotic cells for preparation of therapeutic agents for use in oncology, immunotherapy, stem cell therapy and cosmetology and also for the diagnosis of cancer and embryonic pathologies.06-30-2011
20110159111PHARMACEUTICAL COMBINATIONS - The invention provides combinations of an ancillary compound of the formula (0): and a compound of the formula (I′): Also provided are crystalline forms of the constituent compounds, methods for making them and their uses in treating cancers.06-30-2011
20130022688Use of Amisulpride as an Anti-Emetic - Amisulpride is used in the therapy of nausea, vomiting or retches. The therapy may utilize a novel injectable formulation, in unit dosage form, comprising less than 50 mg amisulpride.01-24-2013
20130022689Use of Amisulpride as an Anti-Emetic - Amisulpride is used in the therapy of nausea, vomiting or retches. The therapy may utilize a novel injectable formulation, in unit dosage form, comprising less than 50 mg amisulpride.01-24-2013
20080248134Oral compositions, use and combinations of N-[2-(dimethylamino)ethyl]-2,6 dimethyl-1-oxo-1,2-dihydrobenzo[b]-1,6-naphthyridine-4-carboxamide and closely related analogues thereof - This invention relates to compositions including a compound of Formula I10-09-2008
20100086622METHOD OF TREATING OR PREVENTING TISSUE DETERIORATION, INJURY OR DAMAGE DUE TO DISEASE OF MUCOSA - An immunomodulatory compound is utilized to treat mucosa disease.04-08-2010
20080226747PHARMACEUTICAL FORMULATIONS COMPRISING SALTS OF A PROTEIN KINASE INHIBITOR AND METHODS OF USING SAME - The present invention relates to pharmaceutical formulations comprising the protein kinase inhibitor, MP470, and methods of using same in treating conditions involving undesirable cell proliferation, such as cancer.09-18-2008
20130177660POTENTIATOR OF ACTIVITY OF ANTI-CANCER AGENT AND USE THEREOF, AND BIOMARKER FOR PREDICTION OF PROGNOSIS IN CANCER PATIENT AND USE THEREOF - Disclosed is a means for improving the clinical outcomes of cancer therapy. Specifically disclosed is an activity potentiator comprising a compound capable of inhibiting the expression of RFP (RET finger protein) gene or the activity of RFP as an active ingredient. The activity of an anti-cancer agent having an oxidative stress inducing ability can be potentiated by using the anti-cancer agent in combination with the activity potentiator. Further specifically disclosed are a biomarker useful for the recognition of prognosis in a cancer patient and use of the biomarker.07-11-2013
20080220093METHODS FOR PRODUCTION OF THE OXIDIZED GLUTATHIONE COMPOSITE WITH CIS-DIAMMINEDICHLOROPLATINUM AND PHARMACEUTICAL COMPOSITIONS BASED THEREOF REGULATING METABOLISM, PROLIFERATION, DIFFERENTIATION AND APOPTOTIC MECHANISMS FOR NORMAL AND TRANSFORMED CELLS - The present invention relates to a composite for the treatment of a variety of medical conditions, the composite comprising an oxidized gluthathione-based compound, which has a disulfide bond, and a metal material, in particular where the metal is either platinum or palladium. The oxidized glutathione-based compound and metal material can be present in a ratio of 3000 to 1 and preferably 1000 to 1. The oxidized glutathione-based compound can be oxidized glutathione itself or salts or derivatives. A feature of the invention is that the composite has a more stabilized disulfide bond than the oxidized glutathione-based compound itself. Methods for preparing the composite are provided, such methods being beneficial in that the composite is provided in high yields and at high purity. Methods for treating various medical conditions with the composites of the present invention are also disclosed.09-11-2008
20080220092Biosynchronous transdermal drug delivery for longevity, anti-aging, fatigue management, obesity, weight loss, weight management, delivery of nutraceuticals, and the treatment of hyperglycemia, alzheimer's disease, sleep disorders, parkinson's disease, aids, epilepsy, attention deficit disorder, nicotine addiction, cancer, headache and pain control, asthma, angina, hypertension, depression, cold, flu and the like - Systems and methods for longevity, anti-aging, fatigue management, obesity, weight loss, weight management, delivery of nutraceuticals, and treating hyperglycemia, Alzheimer's disease, sleep disorders, Parkinson's disease, Attention Deficit Disorder and nicotine addiction involve synchronizing and tailoring the administration of nutraceuticals, medications and other substances (for example, stimulants) in accordance with the body's natural circadian rhythms, meal times and other factors. Improved control of blood glucose levels, extended alertness, and weight control, and counteracting of disease symptoms when they are at their worst are possible. An automated, pre-programmable transdermal administration system is used to provide pulsed doses of medications, pharmaceuticals, hormones, neuropeptides, anorexigens, pro-drugs, stimulants, plant extracts, botanicals, nutraceuticals, cosmeceuticals, phytochemicals, phytonutrients, enzymes, antioxidants, essential oils, fatty acids, minerals, vitamins, amino acids, coenzymes, or other physiological active ingredient or precursor. The system can utilize a pump, pressurized reservoir, a system for removing depleted carrier solution, or other modulated dispensing actuator, in conjunction with porous membranes or micro-fabricated structures.09-11-2008
20120251630REMISSION THERAPY OF CANCER WITH ISOFLAVONOIDS - Provided herein is a method of reducing incidences of cancer recurrence. The method involves administering to an individual in cancer remission an isoflavonoid. In specific instances, the treated individual is in remission from epithelial cancer, such as ovarian cancer or breast cancer.10-04-2012
20130095193COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors.04-18-2013
20130115313Compounds Useful as Inhibitors of ATR Kinase - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors.05-09-2013
20130115312Compounds Useful as Inhibitors of ATR Kinase - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors.05-09-2013
20130115309METHODS FOR IDENTIFYING AND USING INHIBITORS OF CASEIN KINASE 1 EPSILON ISOFORM FOR INHIBITING THE GROWTH AND/OR PROLIFERATION OF MYC-DRIVEN TUMOR CELLS - In one aspect, the invention provides a method for inhibiting the growth and/or proliferation of a myc-driven tumor cell comprising the step of contacting the tumor cells with a CSNK1ε inhibitor. In another aspect, the invention provides a method of treating a subject suffering from a tumor comprising myc-driven tumor cells, comprising administering to the subject an amount of a composition comprising a CSNK1ε inhibitor effective to inhibit the growth and/or proliferation of the tumor cells.05-09-2013
20130115311Compounds Useful as Inhibitors of ATR Kinase - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors.05-09-2013
20130115310Compounds Useful as Inhibitors of ATR Kinase - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors.05-09-2013
20130115314Compounds Useful as Inhibitors of ATR Kinase - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors.05-09-2013
20130171268METHODS AND COMPOSITIONS FOR TREATMENT OF MITOCHONDRIAL TOXICITY - The present invention relates to compositions and methods for prophylactic and/or therapeutic treatment of conditions related to mitochondrial function. In various aspects, the present invention comprises administering one or more compounds selected from the group consisting of epicatechin, an epicatechin derivative, catechin, a catechin derivative, nicorandil, and a nicorandil derivative in an amount effective to ameliorate mitochondrial toxicity caused by administration of a chemical, food, or drug.07-04-2013
20130101680RADIOTHERAPY ENHANCER - The present invention relates to a method of treating pancreatic cancer in a subject in need thereof by administering an effective amount of a composition containing (A) tegafur and (B) gimeracil in conjunction with radiotherapy.04-25-2013
20130101679CHOLESTANOL DERIVATIVE FOR COMBINED USE - The invention provides a cancer chemotherapeutic agent which has fewer side effects and excellent efficacy. The cancer chemotherapeutic agent of the invention includes a cholestanol derivative represented by formula (1):04-25-2013
20130122110ANTI-HUMAN UROTHELIAL CARCINOMA OF SUPERCRITICAL CARBON DIOXIDE EXTRACT OF CINNAMOMUM SUBAVENIUM, AND THE PREPARATION PROCESS AND USES - What is disclosed in the invention is a preparation method of a supercritical 05-16-2013
20130129840COMBINATION THERAPY USING A RUTHENIUM COMPLEX - A combination therapy is disclosed for treating cancer. The method comprises administering to a cancer patient a therapeutically effective amount of trans-[tetrachlorobis(1H-indazole)ruthenate(III)] or a pharmaceutically acceptable salt thereof, and administering to the patient a therapeutically effective amount of one or more other anti-cancer agents as disclosed herein.05-23-2013
20130129841THERAPEUTIC COMBINATION COMPRISING A PARP-1 INHIBITOR AND AN ANTI-NEOPLASTIC AGENT - The present invention provides a therapeutic combination comprising (a) a compound of formula (I) as set forth in the specification and (b) one or more antineoplastic agents selected from the group consisting of an alkylating or alkylating-like agent, an antimetabolite agent, a topoisomerase I inhibitor, a topoisomerase II inhibitor, an antimitotic agent and radiation wherein the active ingredients are present in each case in free form or in the form of a pharmaceutically acceptable salt or any hydrate thereof.05-23-2013
20130142887USE OF HISTONE ACETYLTRANSFERASE INHIBITORS AS NOVEL ANTI-CANCER THERAPIES - The present invention provides methods for treating cancer comprising inhibiting the activity of p300/CBP histone acetyltransferase (HAT). Also provided are p300/CBP HAT inhibitors for treating a subject having cancer. In addition, the present invention includes biomarkers for p300/CBP HAT inhibition, which are used to i) monitor the effectiveness of cancer therapy, and ii) identify anti-cancer agents for use in combination therapy.06-06-2013
20090214671Personalizing Cancer Chemotherapy Based on Methylation and Germ-Line Mutational Analysis of BRCA-1 - The present invention relates to a method for personalized diagnosing, prognosing, and treating of diseases, such as cancer, and in particular to a method for the personalized treatment of breast and/or ovarian cancer, based on a methylation and germ-line mutational analysis of the gene BRCA-1.08-27-2009
20130149392METHOD OF TREATING NON-SMALL CELL LUNG CANCER WITH BIS-(THIOHYDRAZIDE)AMIDE COMPOUNDS - The present invention is a method for treating non-small cell lung cancer in a subject in need thereof, comprising administering to the subject an effective amount of a bis(thiohydrazideamide) compound of formula (I):06-13-2013
20130149393MEDICAL COMPOSITIONS CONTAINING LIQUORICE EXTRACTS WITH SYNERGISTIC EFFECT - The invention provides drug compositions with synergistic effects, which includes alcohol-soluble and water-insoluble liquorices extracts and at least one kind of anti-tumor or glucose-and-lipid-lowering drug/eatable substance, and can be used to treat tumor or lower blood glucose and lipid. Besides, the invention also provides pharmaceutical preparation, pharmaceutical application, therapeutic and preparation methods, etc. related to this drug compositon.06-13-2013
20100291236OSMIUM COMPOUNDS - The present invention relates to osmium compounds of formula (I), their preparation and use in methods of treatment, particularly for cancer treatment.11-18-2010
20110311652Novel Saponin Compounds, Methods of Preparation Thereof, Use Thereof and Pharmaceutical Compositions - This invention relates to novel saponin compounds of formula II wherein MBz denotes p-methoxybenzoyl, and R is selected from the group comprising C12-22-2011
20110311651CARDENOLIDES FOR THE TREATMENT OF OCULAR CANCER - The instant invention provides methods of using a class of compounds known as cardenolides in the treatment of proliferative diseases such as cancer. In particular, the instant invention provides methods of treating ocular cancer {e.g., retinoblastoma) using intraarterial infusion to administer cardenolides locally to the eye of a subject with an ocular cancer.12-22-2011
20110318430TUMOR THERAPY WITH ANTITUMOR AGENTS IN COMBINATION WITH SINDBIS VIRUS-BASED VECTORS - A method for treating malignant tumors with Sindbis viral based vectors in combination with antitumor agents and pharmaceutical formulations for use in such treatment.12-29-2011
20120015050METHODS AND MATERIALS FOR ASSESSING LOSS OF HETEROZYGOSITY - This document provides methods and materials involved in assessing samples (e.g., cancer cells) for the presence of a loss of heterozygosity (LOH) signature. For example, methods and materials for determining whether or not a cell (e.g., a cancer cell) contains an LOH signature are provided. Materials and methods for identifying cells (e.g., cancer cells) having a deficiency in homology directed repair (HDR) as well as materials and methods for identifying cancer patients likely to respond to a particular cancer treatment regimen also are provided.01-19-2012
20120015049MICRORNA BIOMARKER IN CANCER - This invention provides compositions and methods for predicting and improving a chemotherapy response to treat an ovarian cancer. In one embodiment, the invention provides compositions and methods for detecting the expression level of Let-7i microRNA to predict a chemotherapy response. In another embodiment, the invention provides compositions and methods for enhancing the expression level of Let-7i microRNA to improve a chemotherapy response.01-19-2012
20120027874COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present invention relates to pyrazine and pyridine compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors.02-02-2012
20120027873COMBINATION OF A CHEMOTHERAPEUTIC AGENT AND AN INHIBITOR OF THE TGF-BETA SYSTEM - Pharmaceutical composition comprising a chemotherapeutic agent and a TGF-beta antisense oligonucleotide, wherein the antisense oligonucleotide reduces the sensitivity and IC02-02-2012
20130196000COMBINATION THERAPY INCLUDING ISOPHOSPHORAMIDE MUSTARD, ANALOGS, OR SALTS THEREOF - In one aspect, a method for treating a subject having a hyperproliferative disorder is disclosed, including administering to the subject a composition including: IPM, an IPM analog, or a pharmaceutically acceptable salt thereof in the dosage from about 70 mg/m08-01-2013
20120058203METHODS FOR TREATING CANCER AND OTHER PATHOLOGICAL PROLIFERATING DISORDERS BY INHIBITING MITOSIS USING PYRROLO[2,3-D]PYRIMIDINES - The present invention provides methods for treating cancer and other pathological proliferating conditions by inhibiting mitosis using at least one pyrrolo[2,3-03-08-2012
20130202716Treatment of Cancer Using Hypoxia Activated Prodrugs - Cancer can be treated by administration of a hypoxia-activated prodrug, such as TH-302, alone or in combination with other anticancer agents and/or radiation therapy. In combination therapy, the hypoxia-activated prodrug and another anti-cancer agent or radiation therapy may be administered within the same 24-hour period, and administration of the hypoxia-activated prodrug may be completed prior to beginning administration of the other anticancer agent or radiation therapy.08-08-2013
20130202717MATERIALS AND METHODS FOR DIAGNOSING AND PREDICTING THE COURSE OF PROSTATE CANCER - Expression of Forkhead-box protein A1 (FOXA1), a transcription factor important for the normal development of the prostate gland is thought to be controlled by steroid hormones and GATA-3. Expression of FOXA1, GATA-3 and androgen receptor (AR) was retrospectively analyzed by immunohistochemistry (IHC) in a series of 80 primary tumors and 28 metastatic prostate cancers including 15 matched paired samples. High nuclear FOXA1 expression was seen in 19% of primary tumors and 89% of metastatic tumors (p<0.0001). FOXA1 expression correlated positively with tumor size, extra-prostatic extension, angiolymphatic invasion, AR and metastasis but did not correlate with age, tumor stage, Gleason score, presence of PIN or multifocality, seminal vesicle or perineural invasion and status of surgical excision margins. Expression of GATA-3 was not seen in either normal epithelium or tumor. High FOXA1 expression is associated with development of metastatic prostate cancer. Accordingly, FOXA1 expression can be used to classify patients at higher risk for metastases.08-08-2013
20130202718MONITORING IMMUNOGLOBULIN HEAVY CHAIN EVOLUTION IN B-CELL ACUTE LYMPHOBLASTIC LEUKEMIA - The invention is directed to methods of monitoring B-cell lymphoid proliferative disorders, such as B-cell acute lymphoblastic leukemias, by measuring the presence, absence and/or levels of correlating, or index, clonotypes and related clonotypes that have evolved therefrom, for example, as part of the disease condition. In one aspect, such methods are implemented by generating sequencing-based clonotype profiles and determining frequencies of correlating, or index, clonotypes present, including new clonotypes that have evolved therefrom, particularly, in the case of B-cell ALL, by VH substitution. The invention also includes use of such monitoring information to modify treatment status of a patient.08-08-2013
20130209578Combinatory Cancer Treatment - The present invention relates to a pharmaceutical composition for treating a neoplasm, a preneoplasm, a proliferative disorder and/or a precancerous lesion, the use of such compositions for the treatment of the listed conditions, and methods of treating the listed conditions. The composition of the present invention comprises an inhibitor of eIF4E, a methltransferase inhibitor, and a pharmaceutically acceptable carrier.08-15-2013

Patent applications in class Gold or platinum