Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees


Amino acid sequence disclosed in whole or in part; or conjugate, complex, or fusion protein or fusion polypeptide including the same

Subclass of:

424 - Drug, bio-affecting and body treating compositions

424184100 - ANTIGEN, EPITOPE, OR OTHER IMMUNOSPECIFIC IMMUNOEFFECTOR (E.G., IMMUNOSPECIFIC VACCINE, IMMUNOSPECIFIC STIMULATOR OF CELL-MEDIATED IMMUNITY, IMMUNOSPECIFIC TOLEROGEN, IMMUNOSPECIFIC IMMUNOSUPPRESSOR, ETC.)

Patent class list (only not empty are listed)

Deeper subclasses:

Class / Patent application numberDescriptionNumber of patent applications / Date published
424186100 Disclosed amino acid sequence derived from virus 381
424190100 Disclosed amino acid sequence derived from bacterium (e.g., Mycoplasma, Anaplasma, etc.) 347
424191100 Disclosed amino acid sequence derived from parasitic organism (e.g., Dirofilaria, Eimeria, Trichinella, etc.) 61
Entries
DocumentTitleDate
20090214581EPITOPE PEPTIDES DERIVED FROM VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR 1 AND VACCINES CONTAINING THESE PEPTIDES - The present invention provides immunogenic peptides comprising the amino acid sequence of SEQ ID NO: 1, 2, 13, 32, and peptides comprising the above-mentioned amino acid sequences in which 1, 2, or several amino acids are substituted or added, and having cytotoxic T cell inducibility, and also provides drugs for treating or preventing tumors comprising these peptides. The peptides of this invention can be used as vaccines.08-27-2009
20100119533Polynucleotides and Polypeptides Identified by IVIAT Screening and Methods of Use05-13-2010
20090123489NOVEL IMMUNOTHERAPY AGAINST NEURONAL AND BRAIN TUMORS - The present invention relates to peptides, nucleic acids and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumor-associated cytotoxic T cell (CTL) peptide epitopes, alone or in combination with other tumor-associated peptides that serve as active pharmaceutical ingredients of vaccine compositions that stimulate anti-tumor immune responses. The present invention relates to 11 novel peptide sequences and their variants derived from HLA class I and class II molecules of human tumor cells that can be used in vaccine compositions for eliciting anti-tumor immune responses.05-14-2009
20090123488Compositions and methods for the treatment and prophylaxis of Alzheimer's disease - A self-adjuvanting immunogenic composition comprising an immunogen comprising a lipopeptide cap (R2), a universal T helper sequence (R1) and an immunodominant Aβ B cell epitope. The immunogen also comprises one or more linker sequences and/or polar charged amino acid sequences. The B cell epitope of each immunogen has an amino acid sequence located within the first 17 amino acids of SEQ ID NO: 1. The lipopeptide is a dipalmitoyl-S-glyceryl-cysteine or a tripalmitoyl-S-glyceryl cysteine or N-acetyl (dipalmitoyl-S-glyceryl cysteine), each with an optional neutral amino acid linker. Optional polar sequences of at least four charged polar amino acids enhance solubility of the immunogen and are located at the carboxy terminal end of R2, optionally flanked by neutral linker amino acids, or elsewhere in the immunogen. Such compositions, at surprisingly low dosages of less than 10 mg per subject, can induce anti-Aβ peptide antibodies with GMTs of 50,000 or greater than 1,000,000 when employed to immunize a mammalian subject, without any extrinsic adjuvant.05-14-2009
20090196882METHODS OF PRODUCING ANTIBODIES TO ZALPHA11 CYTOKINE RECEPTORS - Novel polypeptide combinations, polynucleotides encoding the polypeptides, and related compositions and methods are disclosed for soluble zalpha11 receptors that may be used as novel cytokine antagonists, and within methods for detecting ligands that stimulate the proliferation and/or development of hematopoietic, lymphoid and myeloid cells in vitro and in vivo. Ligand-binding receptor polypeptides can also be used to block zalpha11 Ligand activity in vitro and in vivo, and may be used in conjunction with zalpha11 Ligand and other cytokines to selectively stimulate the immune system. The present invention also includes methods for producing the protein, uses therefor and antibodies thereto.08-06-2009
20100062012Negative Genetic Regulation of Cancer Cell Renewal in Synergy with Notch- or Numb-Specific Immunotherapy - We disclose a method of treating a cancer in a patient by immunizing the patient against a peptide derived from a protein selected from the group consisting of Notch 1, Notch2, Notch3, and Notch4. We further disclose a composition containing a peptide as described above and a pharmaceutically-acceptable carrier. In addition, we disclose a method of treating a cancer in a patient by immunizing the patient against a peptide derived from a protein selected from the group consisting of Numb1, Numb2, Numb3, and Numb4. We also disclose a composition containing a peptide as described above and a pharmaceutically-acceptable carrier. Further, we disclose a method of treating a cancer in a patient by administering to the patient a composition comprising an antibody against a peptide derived from a protein selected from the group consisting of Notch 1, Notch2, Notch3, Notch4, Numb1, Numb2, Numb3, and Numb4.03-11-2010
20080267988Myelin specific IgE unencumbered by corresponding blocking antibodies as a causative factor in multiple sclerosis - Optimization and validation of a serum test confirms symptomatic autoimmune diseases e.g. multiple sclerosis (MS) or rheumatoid arthritis, and identifies early, silent diseases. The methods involve testing of subject sera for the presence of epitope-specific serum IgE and also non-IgE antibodies. The tests are immunoassays wherein serum autoantibodies complex with peptides structurally mimicking humoral, autoimmune epitopes on, for example, myelin basic protein (MBP), myelin oligodendrocyte glycoprotein (MOG) and proteolipid protein (PLP) for MS. Each peptide: (1) is 5-6 amino acids long; (2) structurally and functionally mimics the surface region of its parent protein; and (3) offers a correct fit for the antigen binding site of a single specific autoantibody. Relapse prediction tests and therapies employ the peptides.10-30-2008
20090017052Methods of determining lethality of pathogens and malignancies involving replikin peak genes - The present invention provides methods of identifying lethal, virulent and rapidly replicating viruses, organisms, and malignancies comprising comparing Replikin concentrations among different viruses, organisms, or malignancies. The present invention further provides isolated Replikin Peak Genes associated with increased lethality, virulence and rapid replication, for diagnostic, therapeutic and predictive purposes.01-15-2009
20110195083CYCLIC V3 PEPTIDES FOR ANTI HIV-1 VACCINE - Isolated cyclic polypeptides useful as vaccinations for the treatment/prevention of HIV are disclosed. An exemplary peptide comprises at least 18 consecutive amino acids of a V3 domain of gp120, starting at position 303 and ending at position 322, the positioning being according to a numbering of the V3 domain of gp120 in a HXB2 strain, wherein amino acids at position 303 and 322 are bonded. Vaccines comprising same and methods of treating AIDS using same are also disclosed.08-11-2011
20110195082Multimeric Complexes of Antigens and an Adjuvant - The invention relates to a product which comprises a C4bp domain of a non-mammalian origin, particularly SEQ ID NO:1, SEQ ID NO:23 or SEQ ID NO:37, or a variant thereof, and an antigen. The product is desirably in the form of a fusion protein. The chicken C4bp domain of SEQ ID NO:1 and SEQ ID NO:23 is also described. Antigens include monomeric antigens such as malarial and influenza antigens. The C4bp domain provides for assembly of multimeric complexes of the antigen, or mixtures thereof. The complexes are useful as vaccines.08-11-2011
20110195080Compositions and Methods for Enhanced Somatostatin Immunogenicity in the Treatment of Growth Hormone and Insulin-Like Growth Factor One Deficiency - Compositions and methods are provided for treatment growth hormone and/or insulin-like growth factor 1 deficiency in a patient in need of such treatment. Compositions and methods include novel vaccines that provide immunogenicity for somatostatin and result in the increased release of endogenously produced growth hormone and/or insulin-like growth factor 1.08-11-2011
20090191232Combination therapy for the treatment of tumors - The present invention relates to a combination therapy method for treating gastrin-dependent tumors. The method comprises the immunization of a patient with an anti-gastrin 17 immunogenic composition in combination with the administration of chemotherapeutic agents such as 5-fluorouracil and leucovorin.07-30-2009
20090191231PREVENTION AND TREATMENT OF AMYLOIDOGENIC DISEASE - The invention provides improved agents and methods for treatment of diseases associated with amyloid deposits of Aβ in the brain of a patient. Such methods entail administering agents that induce a beneficial immunogenic response against the amyloid deposit. The methods are useful for prophylactic and therapeutic treatment of Alzheimer's disease. Preferred agents including N-terminal fragments of Aβ and antibodies binding to the same.07-30-2009
20090191230CASCADE - The invention provides the use of an enzyme and a prodrug in the manufacture of a medicament for use in inducing an anti-tumour immune response in a human patient.07-30-2009
20100158934NUCLEIC ACID AND CORRESPONDING PROTEIN ENTITLED 161P2F10B USEFUL IN TREATMENT AND DETECTION OF CANCER - A novel gene 0161P2F10B (also designated 161P2F10B) and its encoded protein, and variants thereof, are described wherein 161P2F10B exhibits tissue specific expression in normal adult tissue, and is aberrantly expressed in the cancers listed in Table I. Consequently, 161P2F10B provides a diagnostic, prognostic, prophylactic and/or therapeutic target for cancer. The 161P2F10B gene or fragment thereof, or its encoded protein, or variants thereof, or a fragment thereof, can be used to elicit a humoral or cellular immune response; antibodies or T cells reactive with 161P2F10B can be used in active or passive immunization.06-24-2010
20100158929NOVEL FORMULATIONS OF TUMOUR-ASSOCIATED PEPTIDES BINDING TO HUMAN LEUKOCYTE ANTIGEN (HLA) CLASS I OR CLASS II MOLECULES FOR VACCINE - The present invention relates to novel formulations of tumour-associated peptides binding to human leukocyte antigen (HLA) class I or II molecules as vaccines for the use in immunotherapeutic methods. In particular, the present invention relates to formulations for the immunotherapy of cancer, in particular renal and brain cancer, in particular glioma, especially glioblastoma cancer. The present invention furthermore relates to vaccine compositions for eliciting anti-tumour immune responses.06-24-2010
20100047265ACTIVE ANTIANGIOGENIC THERAPY - Application of oligonucleotide and polypeptide sequences of molecules of the family of the vascular permeability factor (VPF), their receptors, and co-receptors, as well as their modifications, in the active immunotherapy of pathologic entities in which course is associated to the increase of angiogenesis.02-25-2010
20120177673IMMUNITY-INDUCING AGENT - An immunity-inducing agent comprising as an effective ingredient(s) a polypeptide(s) selected from the polypeptides: (a) a polypeptide consisting essentially of not less than 7 consecutive amino acids in any one of the amino acid sequences shown in SEQ ID NOs:2, 4, 6, 8, 10, 12 and 44 in SEQUENCE LISTING; (b) a polypeptide having a sequence identity of not less than 90% with the polypeptide (a) and consisting essentially of not less than 7 amino acids; and (c) a polypeptide comprising the polypeptide (a) or (b) as a partial sequence thereof; which polypeptide(s) has/have an immunity-inducing activity/activities, or as an effective ingredient(s) a recombinant vector(s) which comprise(s) a polynucleotide(s) encoding the polypeptide(s) and is/are capable of expressing the polypeptide(s) in vivo, is useful as a therapeutic and/or prophylactic agent for cancer, and/or the like.07-12-2012
20130078266Immunosuppression By Blocking T Cell Co-Stimulation Signal 2 (B7/CD28 Interaction) - The invention provides methods for inhibiting T-cell mediated rejection of a xenotransplanted organ by blocking the delivery of co-stimulatory signal 2 (the B7/CD28 interaction) prevent the activation of xenoreactive T-cells in the recipient. In a first aspect, co-stimulation is prevented by administration to the organ recipient of a soluble form of CTLA-4 from the xenogeneic donor organism. In a second aspect, co-stimulation is antagonised by expressing a ligand for CTLA-4 on the xenogeneic donor cells. In a third aspect, co-stimulation is prevented by expressing recipient organism MHC class II on the surface of the cells of the xenogeneic donor organ.03-28-2013
20130078268VACCINE COMPOSITIONS AND METHODS OF USE THEREOF - The present invention relates to vaccine composition and methods for eliciting a protective immune response in animals against an endogenous peptide of the formula pGlu-Pro-Pro-Gly-Gly-Ser-Lys-Val-Ile-Leu-Phe, the composition comprising an immunizing effective amount of said peptide or conjugates thereof. Further, the invention relates to methods of treating cancer, cardiovascular diseases, and increasing life span in an animal, the methods comprising a step of administering to the animal of the vaccine composition of the invention.03-28-2013
20100119534MULTICOMPONENT IMMUNOGENIC COMPOSITION FOR THE PREVENTION OF BETA-HEMOLYTIC STREPTOCOCCAL (BHS) DISEASE - A number of β-hemolytic streptococci polynucleotides and polypeptides, particularly 05-13-2010
20100119532Composition comprising the N-terminal region of histone H2B of Leishmania - use thereof for inducing an immune response - The invention concerns an immunogenic composition comprising: i) an antigenic polypeptide consisting of a fragment of the protein histone H2B of 05-13-2010
20100074913Oral-intestinal vaccines against diseases caused by enteropathogenic organisms using antigens encapsulated within biodegradable-biocompatible microspheres - This invention is directed to oral-intestinal vaccines and their use against diseases caused by enteropathogenic organisms using antigens encapsulated within biodegradable-biocompatible microspheres.03-25-2010
20100074912HILA-A24-BINDING KEF-DERIVED PEPTIDE - An object of the invention is to provide a peptide derived from a glioma-associated antigen being useful for the specific immunotherapy for glioma patients. The invention provides a KIF-derived peptide which is capable of binding to an HLA-A24 molecule and recognized by the cellular immune system, and a pharmaceutical composition comprising said peptide for the treatment or prevention of glioma.03-25-2010
20120244177PHARMACEUTICAL COMPOSITION FOR TREATMENT OF DRY EYE SYNDROME - The invention provides novel pharmaceutical compositions for the treatment of keratoconjunctivitis sicca comprising liquid vehicles which include one or more semifluorinated alkanes. The compositions incorporate an active ingredient selected from the group of macrolide immunosuppressants. They can be administered topically into the eye. The invention further provides kits comprising such compositions.09-27-2012
20120244176PROTEIN HAVING IMMUNOGENICITY OF CEDAR POLLEN, POLYNUCLEOTIDE ENCODING THE PROTEIN, AND USE THEREOF - It is an object of the present invention to provide a protein that can successfully treats almost all patients with cedar pollinosis and can be ingested as a food. That is, the present invention provides a protein comprising an amino acid sequence represented by SEQ ID NO:1 or comprising an amino acid sequence having a mutation(s) in said amino acid sequence, and having an immunogenicity of a cedar pollen; a polynucleotide encoding said protein; a vector comprising said polynucleotide; a transformant comprising said polynucleotide or said vector; and intended uses of said protein, said polynucleotide, and said transformant.09-27-2012
20120244175TUMOR SPECIFIC ANIMAL PROTEINS - CASB7439 polypeptides and polynucleotides, immunogenic compositions comprising them and methods for producing such polypeptides by recombinant techniques are disclosed. Also disclosed are methods for utilizing CASB7439 polypeptides and polynucleotides in diagnostics, and vaccines for prophylactic and therapeutic treatment of cancers, particularly colorectal cancers, autoimmune diseases, and related conditions.09-27-2012
20120244174TREATMENT OF TAUOPATHIES - The invention is directed to methods of treatment of Alzheimer's disease and other tauopathies, via the administration of antibodies having specificity to abnormal forms of tau protein, the antibodies showing no binding and/or reactivity to a normal tau protein and being administered under conditions and in amounts effective to prevent or treat Alzheimer's disease or other tauopathies. In certain embodiments, the antibodies are selective for soluble truncated tau protein truncated at (i) its C-terminus after the glutamic acid residue Glu391, or (ii) at the aspartic acid residue Asp421, or (iii) at its N-terminus at the aspartic acid residue Asp13, or (iv) a combination of (i)-(iii). Further aspects of the invention are directed to the administration of an immunogen comprising an abnormal tau, preferably a soluble truncated tau.09-27-2012
20130078270HER-2 PEPTIDES AND VACCINES - The present invention provides (a) isolated immunogenic HER-2 peptides capable of inducing immune responses against human HER-2 receptor; (b) isolated nucleic acid molecules encoding an isolated immunogenic HER-2 peptide; (c) plasmid constructs comprising a nucleic acid molecule encoding an isolated immunogenic HER-2 peptide; (d) vaccine compositions comprising an isolated immunogenic HER-2 peptide (e) vaccine compositions comprising an isolated nucleic acid molecule encoding an isolated immunogenic HER-2 peptide; and (f) methods of treating or preventing cancer, inhibiting abnormal cell proliferation, or eliciting an immune response against HER-2 protein in a mammal using (1) an isolated immunogenic HER-2 peptide, (2) nucleic acid molecule encoding an isolated immunogenic HER-2 peptide, or (3) a composition comprising an isolated immunogenic HER-2 peptide, or composition comprising a nucleic acid molecule encoding an isolated immunogenic HER-2 peptide.03-28-2013
20090010952PHARMACEUTICAL COMPOUND FOR EFFECTING LOCALIZED, NON-SYSTEMIC AND SYSTEMIC, IMMUNOGENIC TREATMENT OF CANCER USING CRT OR ERP57 TRANSLOCATION - Anthracyclines-treated tumor cells are particularly effective in eliciting an anti-cancer immune response, where the rDNA-damaging agents, such as etoposide and mitomycin C do not induce immunogenic cell death. Anthracyclines induce the rapid, pre-apoptotic translocation of calreticulin (CRT) and/or ERP57 to the cell surface. Knock down of CRT and/or ERP57 suppressed the phagocytosis of anthracyclines-treated tumor cells by dendritic cells and abolished their immunogenicity in mammals, such as mice. The anthracyclines-induced CRT and/or ERP57 translocation was mimicked by inhibition of the protein phosphatase1/GADD34 complex. Administration of recombinant colreticulin, and not recombinant ERP57, or inhibitors of protein phosphatase1/GADD34 restored the immunogenicity of cell death elicited by etoposide and mitomycin C, and enhanced their antitumor effects in vivo. These data identify calreticulin and/or ERP57 as a key feature determining anti-cancer immune responses and delineate a possible strategy for immunogenic chemotherapy.01-08-2009
20130084303PEPTIDES SHARED AMONG LETHAL CANCERS AND THERAPEUTIC COMPOSITIONS COMPRISING SAID PEPTIDES - The present invention provides cancer peptides related to rapid replication and shared among different histological cancer types. The peptides are provided in compositions for interfering with replication in cancer, in preventive and therapeutic vaccines, and in diagnostic applications. The compositions for interfering with replication in cancer are useful for preventing and treating different histological types of cancer including ectodermic, endodermic, and mesodermic cancers as well as cancers arising in association with HIV.04-04-2013
20130034575METHOD FOR IDENTIFICATION, ISOLATION AND PRODUCTION OF ANTIGENS TO A SPECIFIC PATHOGEN - Described is a method for identification, isolation and production of hyperimmune serum-reactive antigens from a specific pathogen, a tumor, an allergen or a tissue or host prone to auto-immunity, said antigens being suited for use in a vaccine for a given type of animal or for humans, which is characterized by the following steps: providing an antibody preparation, providing at least one expression library, identifying antigens which bind, screening the identified antigens, identifying the hyperimmune serum-reactive antigen portion of said identified antigens and which hyperimmune serum-reactive antigens bind to a relevant portion of said individual antibody optionally isolating said hyperimmune serum-reactive antigens and producing said hyperimmune serum-reactive antigens by chemical or recombinant methods.02-07-2013
20130034573VACCINE COMPOSITIONS - The present disclosure relates to vaccine compositions, particularly KLH-peptide conjugates, and methods of making such compositions. The present disclosure further relates to methods of reducing abnormal cell growth using the composistions described herein.02-07-2013
20130034574MODIFIED MELK PEPTIDES AND VACCINES CONTAINING THE SAME - Isolated peptides composed of the amino acid sequence of the modified MELK epitope peptide or immunologically active fragments thereof that bind to HLA antigens and have higher cytotoxic T lymphocyte (CTL) inducibility than that of the wild type MELK epitope peptide and thus are suitable for use in the context of cancer immunotherapy or endometriosis immunotherapy, more particularly cancer or endometriosis vaccines are described herein. The present invention further provides peptides that include one, two, or several amino acid insertions, substitutions or additions to the aforementioned peptides or fragments, but yet retain the requisite cytotoxic T cell inducibility. Further provided are nucleic acids encoding any of these aforementioned peptides as well as pharmaceutical substances and compositions including any of the aforementioned peptides or nucleic acids. The peptides, nucleic acids, pharmaceutical substances and compositions of this invention find particular utility in the treatment of cancers, tumors, and endometriosis.02-07-2013
20130078267Epitopes Related To Coeliac Disease - The invention herein disclosed is related to epitopes useful in methods of diagnosing, treating, and preventing coeliac disease. Therapeutic compositions which comprise at least one epitope are provided.03-28-2013
20130039934TREATMENT OF IGE-MEDIATED DISEASE - The methods and compositions described herein are based, in part, on the discovery of a polypeptide of soluble CD23 (sCD23) that binds and sequesters IgE. Thus, the sCD23 peptides, polypeptides and derivatives described herein are useful for treating conditions or disorders involving increased IgE levels such as e.g., allergy, anaphylaxis, inflammation, lymphoma, and certain cancers.02-14-2013
20130039936IMMUNOGENIC POTE PEPTIDES AND METHODS OF USE - POTE has recently been identified as a tumor antigen expressed in a variety of human cancers, including colon, ovarian, breast, prostate, lung and pancreatic cancer. Described herein are immunogenic POTE polypeptides, including modified POTE polypeptides, that bind MHC class I molecules. The immunogenic POTE polypeptides are capable of inducing an immune response against POTE-expressing tumor cells. Thus, provided herein is a method of eliciting an immune response in a subject, such as a subject having a type of cancer that expresses POTE.02-14-2013
20130039935INDUCTION OF TUMOR IMMUNITY BY VARIANTS OF FOLATE BINDING PROTEIN - The present invention is directed to variants of antigens comprising folate binding protein epitopes as a composition associated with providing immunity against a tumor in an individual. The variant is effective in inducing cytotoxic T-lymphocytes but preferably not to the extent that they become sensitive to silencing by elimination, such as by apoptosis, or by anergy, as in unresponsiveness.02-14-2013
20100111990Polypeptide Recognized by Anti HIV-1 GP41 Antibodies Isolated from Highly HIV-1 Exposed, Non Infected Women - The invention relates to a polypeptide recognized by anti HIV-1 gp41 antibodies isolated from Highly Exposed, non Infected Women, and epitopic fragments and conjugate thereof. Method of inducing antibodies neutralizing HIV-1 against HIV-1 is also contemplated.05-06-2010
20100111987COMPOSITIONS AND METHODS FOR PREVENTION OR TREATMENT OF NEOPLASTIC DISEASE IN A MAMMALIAN SUBJECT - Compositions and methods are provided for preventing or treating neoplastic disease in a mammalian subject. A composition is provided which comprises an enriched immune cell population reactive to a human endogenous retrovirus type E antigen on a tumor cell. A method of treating a neoplastic disease in a mammalian subject is provided which comprises administering to a mammalian subject a composition comprising an enriched immune cell population reactive to a human endogenous retrovirus type E antigen, in an amount effective to reduce or eliminate the neoplastic disease or to prevent its occurrence or recurrence.05-06-2010
20100111986WT1 HLA Class II-Binding Peptides and Compositions and Methods Comprising Same - This invention provides WT1 peptides and methods of treating, reducing the incidence of, and inducing immune responses against a WT1-expressing cancer, comprising same.05-06-2010
20100111989RSV F-PROTEIN AND ITS USE - The present invention relates to a nucleic acid molecule, which codes for the F-protein of the respiratory syncytial virus (RSV) or a fragment thereof, for the expression in a human cell environment of codon optimized variants of said nucleic acid molecule, vectors and compositions comprising said nucleic acid molecules and the use thereof as vaccines and polypeptides coded by the nucleic acid molecules and method for the production thereof.05-06-2010
20090142364Method for finding novel peptide immunostimulatory adjuvants, compositions and methods of use - The invention describes production of an adjuvant with biological activities related to N-acetylglucosaminyl-β1-4-N-acetylmuramyl-alanyl-D-isoglutamine (GMDP), a commonly used enhancer of the immune response. It was found in the present invention that the drawbacks of GMDP can be avoided by replacing it with a peptide that does not have any direct structural relationship with GMDP.06-04-2009
20100111991NUCLEIC ACID AND CORRESPONDING PROTEIN ENTITLED 193P1E1B USEFUL IN TREATMENT AND DETECTION OF CANCER - A novel gene (designated 193P1E1B) and its encoded protein, and variants thereof, are described wherein 193P1E1B exhibits tissue specific expression in normal adult tissue, and is aberrantly expressed in the cancers listed in Table I. Consequently, 193P1E1B provides a diagnostic, prognostic, prophylactic and/or therapeutic target for cancer. The 193P1E1B gene or fragment thereof, or its encoded protein, or variants thereof, or a fragment thereof, can be used to elicit a humoral or cellular immune response; antibodies or T cells reactive with 191P1E1B can be used in active or passive immunization.05-06-2010
20100104592HEPATITIS C VIRUS CODON OPTIMIZED NON-STRUCTURAL NS3/4A FUSION GENE - Aspects of the present invention relate to the discovery of a novel hepatitis C virus (HCV) isolate. Embodiments include HCV peptides, nucleic acids encoding said HCV peptides, antibodies directed to said peptides, compositions containing said nucleic acids and peptides, as well as methods of making and using the aforementioned compositions including, but not limited to, diagnostics and medicaments for the treatment and prevention of HCV infection.04-29-2010
20100104591POLYPEPTIDES FOR INDUCING A PROTECTIVE IMMUNE RESPONSE AGAINST STAPHYLOCOCCUS EPIDERMIDIS - The present invention features polypeptides comprising an amino acid sequence structurally related to SEQ ID NO: 04-29-2010
20090155293MODIFIED DEFENSINS AND THEIR USE - This disclosure provides modified antimicrobial agents, for example modified defensin polypeptides. In one embodiment, compositions including a modified arginine residue, such as an ADP-ribosylated and/or ribosylated alpha defensin polypeptide, are provided. Also provided are methods of modulating an immune response using the modified defensin polypeptides. In one embodiment, a method is provided for modulating an antimicrobial activity. In another embodiment, a method if provided for inhibiting a cytotoxic activity. Also disclosed are methods for treating diseases in a subject that are associated with an immune response, such as inflammatory and pulmonary diseases, using the disclosed modified defensin polypeptides.06-18-2009
20090155292COMPOSITIONS AND METHODS FOR THE PREVENTION AND TREATMENT OF AUTOIMMUNE CONDITIONS - The methods include selectively reducing or expanding T cells according to the antigenic specificity of the T cells. Therefore, the present invention can be used to reduce or eliminate pathogenic T cells that recognize autoantigens, such as beta cell specific T cells. As such, the present invention can be used to prevent, treat or ameliorate autoimmune diseases such as IDDM. Furthermore, the present invention can be used to expand desirable T cells, such as anti-pathogenic T cells to prevent, treat and/or ameliorate autoimmune diseases.06-18-2009
20100040641PEPTIDE VACCINES FOR CANCERS EXPRESSING TUMOR-ASSOCIATED ANTIGENS - The present invention provides peptides having an amino acid sequence as set forth in SEQ ID NO: 19, 22, 30, 34, 344, 358, 41, 44, 46, 48, 78, 376, 379, 80, 100, 101, 110, 111, 387, 112, 394, 114, 116, 117, 121, 395, 133, 135, 137, 426, 143, 147, 148, 149, 150, 152, 153, 154, 156, 160, 161, 162, 163, 166, 174, 178, 186, 194, 196, 202, 210, 213, 214, 217, 223, 227, 228, 233, 254, 271, 272 or 288, as well as peptides having the above-mentioned amino acid sequences in which 1, 2, or several (e.g., up to 5) amino acids are substituted, deleted, or added, provided the peptides possess cytotoxic T cell inducibility. The present invention also provides drugs for treating or preventing a disease associated with over-expression of the CDH3, EPHA4, ECT2, HIG2, INHBB, KIF20A, KNTC2, TTK and/or URLC10, e.g. cancers containing as an active ingredient one or more of these peptides. The peptides of the present invention find further utility as vaccines.02-18-2010
20100040640Expression, purification and uses of a plasmodium falciparum liver stage antigen 1 polypeptide - In this application is described the expression and purification of a recombinant 02-18-2010
20100143392Gastric inhibitory polypeptide (GIP) antigen arrays and uses thereof - The present invention is in the fields of medicine, public health, immunology, molecular biology and virology. The present invention provides, inter alia, a composition comprising a virus-like particle (VLP) and at least one antigen, wherein said antigen is a GIP protein or a GIP fragment linked to the VLP respectively.06-10-2010
20120164165ZONA PELLUCIDA BINDING PEPTIDES, EXPRESSION VECTORS, COMPOSITIONS, AND METHODS FOR SPECIES-SPECIFIC IMMUNOCONTRACEPTION OF ANIMALS - Disclosed are methods, compositions, zona pellucida binding peptides and polypeptides, and expression vectors for use in species-specific immunocontraception of animals. The disclosed compositions may include immunogenic compositions or vaccines.06-28-2012
20130028923KDR PEPTIDES AND VACCINES COMPRISING THE SAME - The present invention provides nonapeptides selected from peptides comprising the amino acid sequence of SEQ ID NO:2, 3, 5, 8, 11, or 12; nonapeptides or decapeptides selected from peptides comprising the amino acid sequence of SEQ ID NO:29, 30, 33, 34, 40, or 46; and peptides with cytotoxic T cell inducibility, in which one, two, or several amino acids are substituted or added to the above-mentioned amino acid sequences, as well as pharmaceuticals for treating or preventing tumors, where the pharmaceuticals comprise these peptides. The peptides of this invention can be used as vaccines.01-31-2013
20130028922CITRULLINE PEPTIDES DERIVED FROM FIBRIN AND RECOGNIZED BY RHEUMATOID ARTHRITIS SPECIFIC AUTOANTIBODIES, AND THE USE THEREOF - The invention relates to novel citrulline peptides derived from fibrin α and β chains which are recognizable by specific citrulline antiprotein autoantibodies (AAPC) of a rheumatoid arthritis (PR) and to the use thereof for detecting the presence of said specific PR AAPC in a biological sample.01-31-2013
20090317415HPV VACCINE COMPRISING PEPTIDES FROM HOST CELL PROTEINS - The present invention relates to an immunogenic composition for a human papillomavirus (HPV) vaccine that comprises BAX peptides from BAX host cell proteins and more particularly, a vaccine including those peptides that is directed against cancers that are associated with HPV infections, such as cervical cancer, head and neck cancer and skin cancers. The BAX peptides comprise fragments of BAX host cell proteins that have been targeted for degradation by HPV proteins, such as E6 and E7 and are presented on the surface of HPV infected cells in relatively large amounts. These peptides can be recognised by CTL and elicit an immune response, and are therefore ideal tumour-specific markers. The invention also relates to novel peptide: peptide complexes such as BAX peptide/HLA complexes and their use in a tumour-specific vaccine.12-24-2009
20090311278Novel teleost derived antimicrobial polypeptides - The invention is directed to an isolated polypeptide which (a) is obtainable from a teleost; (b) has antimicrobial activity; (c) binds to oligoguanosine and/or CpG (SEQ ID NO:7); (d) comprises 58 strongly basic amino acids selected from the group consisting of K and R; (e) comprises 50 hydrophobic amino acids selected from the group consisting of A, I, L, F, W and V; (f) comprises 50 polar amino acids selected from the group consisting of N, C, Q, S, T and Y and (g) contains 11 lysine-rich motifs and antimicrobial fragments thereof as well as methods for preparing said polypeptides, compositions and libraries comprising said polypeptide(s) and uses of said polypeptide(s), particularly in treating microbial infections. The invention is further directed to a nucleic acid(s) encoding said polypeptide, microarrays comprising said nucleic acid(s) and uses for said nucleic acid(s). Furthermore, the invention is directed to an antibody which birds to the polypeptide of the present invention and uses for said antibodies.12-17-2009
20100129385IMMUNOGENIC MOLECULES - The present invention relates generally to the field of immunology and more particularly to molecules capable of stimulating a cellular immune response. More particularly, the present invention provides self-adjuvanting immunogenic molecules capable of stimulating an immune response to epitopes of a polypeptide irrespective of a subjects HLA type. The present invention further contemplates methods for the production and use of the self-adjuvanting immunogenic molecules and compositions comprising same useful in the vaccination of subjects against specific polypeptides.05-27-2010
20090304728TEM8 GENE, EXPRESSION FORMS AND DIAGNOSTIC AND THERAPEUTIC USES THEREOF - The present invention relates to the modulation of a gene known as “tumor endothelial marker 8 (TEM8)” and refers to the differential levels with which the gene is expressed, in its variants, in cells exhibiting angiogenic and migratory properties such as dendritic cells and metastatic tumor cells. The present invention further relates to the use of gene and polypeptide sequences of TEM8 as instruments of diagnosis and prognosis of pathological inflammatory angiogenesis and of the metastatic potential of tumor cells. The invention further relates to the use of the same gene and polypeptide sequences as direct therapeutic instruments, and to the use in immunogenic compositions or in vaccines apt to induce an immune response against cells overexpressing TEM8 gene products. Furthermore, the present invention relates to screening methods for identifying agonists and antagonists of TEM8 activity in any polynucleotide and/or polypeptide variant thereof to be used in prevention or therapy treatments. Lastly TEM8 expression profiles in in vitro expanded DCs from cancer patients intercepts responsiveness to cancer immunotherapy.12-10-2009
20090304727HYPOALLERGENIC CHIMERIC PROTEINS BELONGING TO THE LIPID TRANSFER FAMILY OF PARIETARIA JUDAICA FOR USE IN THE TREATMENT OF ALLERGIES - The present invention relates to recombinant DNA molecules which encode chimeric polypeptides of differing allergens of 12-10-2009
20090304726VIRAL DISPLAY VEHICLES FOR TREATING MULTIPLE SCLEROSIS - Provided are viral display vehicles which display multiple sclerosis associated antigens on the surface thereof for induction of immune tolerance to autoantigens such as MOG. Also provided are methods and pharmaceutical compositions for treating multiple sclerosis using the viral display vehicles of the present invention.12-10-2009
20090304725Vaccine and Antigen Mimotopes Against Cancerous Diseases Associated with the Carcinoembryonic Antigen CEA - The present invention relates to a vaccine against cancerous diseases associated with the carcinoembryonic antigen CEA.12-10-2009
20090304724Compositions and Methods for Stimulating Gastrointestinal Motility - The present invention relates to a method of treating a transient impairment of the motility of the gastrointestinal system resulting from postoperative ileus in a patient wherein said method includes the step of administering a therapeutically effective amount of a peptidyl analog of ghrelin to said patient.12-10-2009
20090041794Identification of Hla-A2-Presented T-Cell Epitopes Derived from the Oncofoetal Antigen-Immature Laminin Receptor Protein and Uses Thereof - The present invention relates to the immunotherapB of cancer, in particular several tumor entities including hematological malignancies. The present invention relates to tumor-associated T-helper cell peptide epitopes, alone or in combination with other tumor-associated peptides, that serve as active pharmaceutical ingredients of vaccine compositions that stimulate anti-tumor immune responses. In particular, the present invention relates to two novel peptide sequences derived from HLA class I or II molecules of human oncofoetal antigen immature laminin receptor (OFA/iLR), which can be used in vaccine compositions for eliciting anti-tumor immune responses.02-12-2009
20130071417N-DOMAIN OF CARCINOEMBRYONIC ANTIGEN AND COMPOSITIONS, METHODS AND USES THEREOF - The present disclosure provides immunogenic compositions comprising the N-domain of carcinoembryonic antigen (CEA). These compositions are useful for inducing or enhancing an immune response, for inhibiting tumor cell growth and for treating cancer.03-21-2013
20130071416IMMUNOGENIC PROTEINS AND COMPOSITIONS FOR THE TREATMENT AND PREVENTION OF STREPTOCOCCUS AGALACTIAE - The invention provides proteins and compositions for the treatment and prevention of 03-21-2013
20130058966ANTI-PDEF ANTIBODIES AND USES THEREOF - The present invention relates to an isolated antibody or antigen-binding fragment thereof that specifically binds with high affinity to at least a portion of a segment of human prostate-derived Ets transcription factor (PDEF). The anti-PDEF antibody of the present invention is effective in prognostic and diagnostic assays for detecting PDEF with immunohistochemistry. The present invention also relates to methods of making the anti-PDEF antibody disclosed herein. The present invention further relates to vaccines against cancers associated with positive expression of PDEF, as well as methods for treating those cancers. Vectors, diagnostic kits, and hybridomas are also disclosed.03-07-2013
20130058965INJECTABLE FORMULATIONS FOR PARENTERAL ADMINISTRATION - Disclosed herein are uses, methods, and processes for preparing or manufacturing a lyophilized cake that comprises a water-insoluble agent, wherein the cake is capable of being disintegrated in a parenterally acceptable solvent to form a syringeable liquid suspension of fine particles of the water-insoluble active agent that is suitable for pharmaceutical uses. Lyophilized cakes prepared according to the methods disclosed herein and kits containing such lyophilized cakes are also disclosed. Further disclosed herein are methods and processes for preparing a syringeable liquid suspension of fine particles of the water-insoluble active agent that is suitable for pharmaceutical uses.03-07-2013
20110038885CHEMOKINE ANALOGS - The present invention is directed to peptide analogs of chemokine, the pharmaceutically acceptable salts thereof, to methods of using such analogs to treat mammals and to pharmaceutical compositions useful therefor comprising said analogs.02-17-2011
20110014218IXODES SCAPULARIS SALIVARY PROTEINS AND METHODS OF USE FOR MODULATION OF THE ALTERNATIVE COMPLEMENT PATHWAY - salivary proteins, including 01-20-2011
20090297542Adp-ribosylating toxin from listeria monocytogenes - An ADP-ribosylating toxin from 12-03-2009
20090280138PEPTIDE - The present invention relates to peptide epitopes of 5T4 antigen and their use in immunotherapy. In particular, the present invention relates to any one of the peptide epitopes as described herein as well as their use in diagnosis and therapy of cancer.11-12-2009
20090269363METHOD FOR SCREENING PEPTIDES FOR USE IN IMMUNOTHERAPY - Identifying subdominant/cryptic epitopes (I) that are presented by a HLA (human leukocyte antigen) Class I molecule, is new. Identifying subdominant/cryptic epitopes (I) that are presented by a HLA (human leukocyte antigen) Class I molecule comprising selecting at least one peptide (II) of 8-11 amino acids (aa), potentially representing an epitope for Class I presentation, from a protein against which a cytotoxic T cell (CTL) response is to be raised. (II) corresponds to a non-immunogenic peptide with low affinity for Class I molecules. Variants (IIa) of (II) are prepared in which the N-terminal aa is replaced by Tyr and their immunogenicity detected by identifying those that generate a CTL response against target cells expressing the parent protein. Peptide sequences from which active (IIa) are derived are then identified. Independent claims are also included for the following: (1) immunogenic peptide epitopes (IIa) derived from (I) identified this way; and (2) nucleic acid (III) that encodes chimeric polypeptides (IV) containing one or more, same or different, copies of (IIa).10-29-2009
20090269362Method for Controlling Immunodominance - Methods for controlling immunodominance are described. These methods are carried out by altering the kinetic stability of a complex between a class II Major Histocompatibility Complex (MHC) molecule and the epitope for which immunodominance is to be altered. Alterations that increase the kinetic stability of the epitope: class II MHC complex confer immunodominance upon the epitope. Methods are also described for stimulating an immune response in an organism to a specific epitope by administering to the organism a form of that epitope which has been altered to be immunodominant.10-29-2009
20090074800Cancer antigen and use thereof - An object of the present invention to provide: a human pancreatic cancer antigen and/or a human colon cancer antigen that can be applied to the diagnosis and/or treatment of various types of cancers or tumors including pancreatic cancer and colon cancer as representative examples; a gene encoding the same; an anti-cancer vaccine using the same; or the like. The present invention provides a cancer antigen comprising a protein having the amino acid sequence shown in SEQ ID NO: 1; a peptide comprising a portion of said protein and having immune-stimulating activity; an anti-cancer vaccine comprising said peptide; a DNA having the nucleotide sequence shown in SEQ ID NO: 2, or its complementary sequence or a part or full length of these sequence; an anti-cancer vaccine comprising said DNA; and use thereof.03-19-2009
20090074799ANTIBODIES TO CLASS II CYTOKINE RECEPTOR-7 - Antibodies to novel receptor polypeptides, polynucleotides encoding the polypeptides, and related compositions and methods are disclosed. The polypeptides comprise an extracellular domain of a cell-surface receptor that is expressed in kidneys, pancreas, prostate, adrenal cortex and nervous tissue. The polypeptides may be used within methods for detecting ligands that promote the proliferation and/or differentiation of these organs.03-19-2009
20130064842Compositions and Methods for Detection of Antibodies Specific for Anaplasma phagocytophilum (Aph) and Anaplasma platys (Apl) - The invention provides methods and compositions for the detection and treatment of 03-14-2013
20130064840HJURP PEPTIDES AND VACCINES INCLUDING THE SAME - Isolated peptides derived from SEQ ID NO: 50 and fragments thereof that bind to an HLA antigen and induce cytotoxic T lymphocytes (CTL) and thus are suitable for use in the context of cancer immunotherapy, more particularly cancer vaccines are described herein. The inventive peptides encompasses both the above mentioned amino acid sequences and modified versions thereof, in which one, two, or several amino acids sequences substituted, deleted, added or inserted, provided such modified versions retain the requisite cytotoxic T cell inducibility of the original sequence. Further provided are nucleic acids encoding any of the aforementioned peptides as well as pharmaceutical agents, substances and/or compositions that include or incorporate any of the aforementioned peptides or nucleic acids. The peptides, nucleic acids, pharmaceutical agents, substances and compositions of this invention find particular utility in the treatment of cancers and tumors, including, for example, AML, bladder cancer, breast cancer, cervical cancer, cholangiocellular carcinoma, CML, colorectal cancer, esophagus cancer, Diffused-type gastric cancer, liver cancer, NSCLC, lymphoma, osteosarcoma, ovarian cancer, pancreatic cancer, prostate cancer, renal carcinoma, SCLC, soft tissue tumor and testicular tumor.03-14-2013
20130064841IMMUNOGENIC COMPOSITIONS AGAINST HUMAN PROGASTRIN PEPTIDES - Immunogens against human extended-progastrin species comprise (A) a mimetic peptide comprised of (i) the amino acid sequence of a progastrin or a N- and/or C-terminal processed species of a progastrin joined to (ii) a 7 amino-acid spacer coupled to (B) an immunogenic carrier. Illustrative of the mimetic peptide/spacer combination are a 21 amino-acid peptide (SEQ ID NO.: 1) and other, related polypeptides (SEQ ID NOs.: 2-5). Pharmaceutical compositions containing such an immunogen display improved immunological properties, including the induction of effective antibody levels shortly after the administration of an initial course of immunogen. Levels of antibody thus elicited stay elevated for several months and readily elevate to higher levels upon subsequent boosting by a single injection of immunogen.03-14-2013
20090263411Compositions, splice variants and methods relating to ovarian specific genes and proteins - The present invention relates to newly identified nucleic acid molecules and polypeptides present in normal and neoplastic ovarian cells, including fragments, variants and derivatives of the nucleic acids and polypeptides. The present invention also relates to antibodies to the polypeptides of the invention, as well as agonists and antagonists of the polypeptides of the invention. The invention also relates to compositions containing the nucleic acid molecules, polypeptides, antibodies, agonists and antagonists of the invention and methods for the use of these compositions. These uses include identifying, diagnosing, monitoring, staging, imaging and treating ovarian cancer and non-cancerous disease states in ovarian, identifying ovarian tissue, monitoring and identifying and/or designing agonists and antagonists of polypeptides of the invention. The uses also include gene therapy, production of transgenic animals and cells, and production of engineered ovarian tissue for treatment and research.10-22-2009
20090246215Amyloid beta1-6 antigen arrays - The present invention is related to the fields of molecular biology, virology, immunology and medicine. The invention provides a composition comprising an ordered and repetitive antigen or antigenic determinant array, and in particular an Aβ1-6 peptide-VLP-composition. More specifically, the invention provides a composition comprising a virus-like particle and at least one Aβ1-6 peptide bound thereto. The invention also provides a process for producing the conjugates and the ordered and repetitive arrays, respectively. The compositions of the invention are useful in the production of vaccines for the treatment of Alzheimer's disease and as a pharmaccine to prevent or cure Alzheimer's disease and to efficiently induce immune responses, in particular antibody responses. Furthermore, the compositions of the invention are particularly useful to efficiently induce self-specific immune responses within the indicated context.10-01-2009
20090238840Therapeutic vaccine - The present invention is related to methods and compositions for the therapeutic and diagnostic use in the treatment of diseases and disorders which are caused by or associated with amyloid or amyloid-like proteins including amyloidosis.09-24-2009
20090232839MELANOMA ASSOCIATED PEPTIDE ANALOGUES AND VACCINES AGAINST MELANOMA - The present invention is concerned with cancer treatment and diagnosis, especially with melanoma associated peptide analogues with improved immunogenicity, epitopes thereof, vaccines against melanoma, tumor infiltrating T lymphocytes recognizing the antigen and diagnostics for the detection of melanoma and for the monitoring of vaccination. The peptides according to the invention can be exploited to elicit native epitope-reactive Cm. Usage of the peptides with improved immunogenicity may contribute to the development of CTL-epitope based vaccines in viral disease and cancer.09-17-2009
20090232838Ligands of melanocortin receptors - The present invention is directed to a compound according to formula, (R09-17-2009
20090232837ANTI TUMORAL IMMUNOGENIC PEPTIDES AND VACCINE THEREOF - The invention relates to novel, Frizzled-like, immunogenic peptides, useful for the stimulation of an immune response against various cancer types, particularly colon rectal carcinoma.09-17-2009
20080286293PROMISCUOUS PAP CD4 T CELL EPITOPES - The present invention relates to the discovery of novel T cell epitopes of the human prostatic acid phosphatase (PAP) protein that is promiscuous for at least 15 different HLA-DR alleles. The invention also relates to compositions that contain one of the novel epitopes or a fusion peptide of such an epitope and a heterologous polypeptide. Further disclosed herein is the use of the epitopes or their fusion peptides, and compositions containing the epitopes or their fusion peptides.11-20-2008
20120114681USE OF SPECIFIC PEPTIDES IN THE PREPARATION OF A MEDICAMENT FOR THE TREATMENT OF MONOCLONAL GAMMOPATHY OF UNDETERMINED SIGNIFICANCE (MGUS) OR OF SMOLDERING MULTIPLE MYELOMA (SMM) - The present invention relates to the use of a peptide comprising or essentially consisting of a sequence motif as shown in SEQ ID NO: 1 for the preparation of a medicament for the treatment of Monoclonal Gammopathy of Undetermined Significance (MGUS) or of Smoldering Multiple Myeloma (SMM). Moreover, the present invention relates to the use of an activated T-cell specifically recognizing the peptide of the present invention or an antigen presenting cell which specifically presents a peptide epitope of the present invention for the preparation of a medicament for the treatment of Monoclonal Gammopathy of Undetermined Significance (MGUS) or of Smoldering Multiple Myeloma (SMM). The present invention also relates to a method for the ex vivo manufacture of an activated T-cell of the present invention comprising the steps of: a) obtaining T-cells from a sample of a subject suffering from MGUS or SMM, b) contacting said T-cells with a peptide of the present invention, and c) collecting the activated T-cells. The present invention relates further to a method for the ex vivo manufacture of an antigen presenting cell of the present invention comprising the steps of: a) obtaining immature antigen presenting cells from a sample of a subject suffering from MGUS or SMM, b) contacting said immature antigen presenting cells with a peptide of the present invention, and c) collecting the mature antigen presenting cells.05-10-2012
20090028886Carrier conjugates of gnrh-peptides - The present invention is related to the fields of molecular biology, virology, immunology and medicine. The invention provides a composition comprising a virus like particle (VLP) and at least one GnRH peptide or fragment or variant thereof linked thereto.01-29-2009
20090028885CITRULLINE PEPTIDES DERIVED FROM FIBRIN AND RECOGNIZED BY RHEUMATOID ARTHRITIS SPECIFIC AUTOANTIBODIES, AND THE USE THEREOF - The invention relates to novel citrulline peptides derived from fibrin α and β chains which are recognisable by specific citrulline antiprotein autoantibodies (AAPC) of a rheumatoid arthritis (PR) and to the use thereof for detecting the presence of said specific PR AAPC in a biological sample.01-29-2009
20090010953PEPTIDES OF A MELANOMA ANTIGEN AND THEIR USE IN DIAGNOSTIC, PROPHYLACTIC, AND THERAPEUTIC METHODS - Immunogenic peptides of a melanoma antigen recognized by T cells, designated gp100, bioassays using the peptides to diagnose, assess or prognose a mammal afflicted with cancer, more specifically melanoma or metastatic melanoma, and use of the proteins and peptides as immunogens to inhibit, prevent or treat melanoma.01-08-2009
20090010951Epitope/Peptide Recognized By Hla-A2402-Restricted Ep/Cam-Specific Ctl And Use Of The Same - A peptide consisting essentially of the amino acid sequence represented by SEQ ID NO:1; a peptide consisting essentially of the amino acid sequence represented by SEQ ID NO:2; or a mutant peptide consisting essentially of an amino acid sequence derived from the amino acid sequence represented by SEQ ID NO:1 or 2 by addition, deletion or substitution of one or more amino acids, the peptide being capable of forming a complex with an HLA-A2402 molecule to be recognized by HLA-A2402-restricted cytotoxic T lymphocytes or induce such lymphocytes. Such a peptide is useful as a cancer vaccine for epithelial cancer patients having HLA-A2402.01-08-2009
20100086562Use of Platelet Glycopeptide IIIA Epitopes in the Treatment of Immune Thrombocytopenic Purpura - The present invention relates to a composition for treating diseases associated with autoantibodies specific for platelet proteins, in particular autoimmune thrombocytopenic purpura. The composition, comprising an epitope of a platelet protein, treats diseases by tolerisation.04-08-2010
20130164314CANCER PEPTIDE VACCINE - A composition for treating cancer, comprising 6 to 13 peptides derived from tumor antigens, wherein the composition is used in the manner that antibodies to the respective peptides in the peripheral blood of a patient are measured and peptides to which antibodies are positive are selected and administered to the patient, and a peptide selection method.06-27-2013
20110142866PEPTIDE ANALOGUES AND CONJUGATES THEREOF - One aspect of the invention relates to a peptide comprising the amino acid sequence of formula (I),06-16-2011
20080305123Functional Epitopes of Streptococcus Pneumoniae PsaA Antigen and Uses Thereof - Provided is a P4 peptide, which contains functional epitopes of the PsaA protein of 12-11-2008
20080305122Ii-Key/antigenic epitope hybrid peptide vaccines - Disclosed is a nucleic acid molecule comprising a first expressible sequence encoding a protein of interest or polypeptide of interest which contains an MHC Class II-presented epitope. In addition, the nucleic acid molecule comprises a second expressible nucleic acid sequence encoding an antigen presentation enhancing hybrid polypeptide. The antigen presentation enhancing hybrid polypeptide includes the following elements: i) an N-terminal element consisting essentially of 4-16 residues of the mammalian Ii-Key peptide LRMKLPKPPKPVSKMR (SEQ ID NO: 1) and non-N-terminal deletion modifications thereof that retain antigen presentation enhancing activity; ii) a C-terminal element comprising an MHC Class II-presented epitope in the form of a polypeptide or peptidomimetic structure which binds to the antigenic peptide binding site of an MHC class II molecule, the MHC Class II-presented epitope being contained in the protein of interest of step a); and iii) an intervening peptidyl structure linking the N-terminal and C-terminal elements of the hybrid, the peptidyl structure having a length of about 20 amino acids or less.12-11-2008
20080305120Immunogenic Compositions Comprising Hmgb 1 Polypeptides - The present invention relates to novel immunogenic compositions (e.g., vaccines), the production of such immunogenic compositions and methods of using such compositions. More specially, this invention provides unique immunogenic molecules comprising an HMGB1 polypeptide (e.g., an HMGB1 B-box polypeptide) and an antigen. Even more specifically, this invention provides novel fusion proteins comprising an isolated HMGB1 polypeptide and an antigen such that administration of these fusion proteins provides the two signals required for native T-cell activation.12-11-2008
20120237534HYR1 AS A TARGET FOR ACTIVE AND PASSIVE IMMUNIZATION AGAINST CANDIDA - The invention features HYR1 as a vaccine target and as a prophylactic strategy for combating disseminated candidiasis.09-20-2012
20130164313DNA SEQUENCE, AND RECOMBINANT PREPARATION OF GROUP 4 MAJOR ALLERGENS FROM CEREALS - The present invention relates to the provision of DNA sequences of group 4 major allergens from cereals. The invention also encompasses fragments, new combinations of partial sequences and point mutants having a hypoallergenic action. The recombinant DNA molecules and the derived polypeptides, fragments, new combinations of partial sequences and variants can be utilised for the therapy of pollen-allergic diseases. The proteins prepared by recombinant methods can be employed for in vitro and in vivo diagnosis of pollen allergies.06-27-2013
20120269835PROCESS FOR THE PRODUCTION OF IMMUNOGENIC COMPOSITIONS - The present invention relates to a process for producing immunogenic polypeptides, comprising reducing disulfide bonds and blocking the resulting free thiol group with a blocking agent. The immunogenic peptides comprise a fragment of MAGE A3.10-25-2012
20110033488AGENTS AND METHODS FOR TREATMENT OF ANXIETY DISORDERS - Peptides derived from CNS-specific antigens, altered peptide ligands (APL) analogues of said peptides, T cells activated by such peptides, poly-YE, and any combination of said agents are useful for prevention, treatment and/or alleviation of anxiety disorders, particularly post-traumatic stress disorder, and for restoring BDNF levels in the brain of an individual after reduction of BDNF expression induced by stress.02-10-2011
20100285045Novel Neurotrophic Factor Protein and Uses Thereof - The present invention discloses a novel neurotrophic factor protein, MANF2 and a genetic sequence encoding the same. The molecule will be useful in the development of a range of therapeutics and diagnostics useful in the treatment, prophylaxis and/or diagnosis of MANF2 dependent conditions. The molecule of the present invention is also a useful effector of primary and central neurons, especially dopaminergic neurons at the central nervous system and growth factor genes.11-11-2010
20110070253TUMOUR-ASSOCIATED PEPTIDES BINDING TO MHC MOLECULES - The invention relates to a tumour-associated peptide with an amino acid sequence that is selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 101 of the attached sequence protocol, wherein the peptide has the ability to bind to a molecule of the human major-histocompatibility-complex (MHC) class-I. In addition, the invention relates to the use of the peptides and the nucleic acids encoding for the peptides for the production of a medicament, and for the treatment of tumorous diseases and/or adenomatous diseases. Furthermore, a pharmaceutical composition is described that has at least one of the peptides.03-24-2011
20100047264Immunogenic Affinity-Conjugated Antigen Systems Based on Papaya Mosaic Virus and Uses Thereof - An affinity-conjugated antigen system (ACAS) comprising one or more antigens conjugated via a plurality of affinity moieties to a papaya mosaic virus (PapMV) or virus-like particle (VLP) derived from the coat protein of PapMV is provided. The affinity moieties are molecules or compounds that are capable of specifically binding to the antigen(s) of interest and which can be attached, for example by chemical or genetic means, to the coat protein of the PapMV or PapMV VLP. The ACAS can optionally further comprise one or more additional antigens, which may be the same as, or different to, the conjugated antigen(s) comprised by the ACAS. Also provided are immunogenic compositions, including vaccines, comprising an ACAS. The immunogenic compositions are useful in the treatment, including prevention, of various diseases and disorders for which a humoral and/or cellular response in the animal is required.02-25-2010
20110027300Identification of a novel cysteine-rich cell penetrating peptide - The present invention relates to a nucleic acid molecule encoding a peptide capable of being internalized into a cell, wherein said nucleic acid molecule consists of (a) a nucleic acid molecule encoding a peptide having the amino acid sequence of SEQ ID NO: 2; (b) a nucleic acid molecule having the DNA sequence of SEQ ID NO: 1, wherein T is U if the nucleic acid molecule is RNA; or (d) a nucleic acid molecule encoding a peptide having at least 80% sequence identity with that of SEQ ID NO: 2, wherein at least at two positions selected from the group consisting of positions 1, 7 and 8 of SEQ ID NO: 2 a cysteine is present and wherein at least at four positions selected from the groups consisting of position 2, 4, 6, 9 or 10 of SEQ ID NO: 2 an arginine or a lysine is present. The present invention also relates to a peptide encoded by the nucleic acid of the invention, a fusion molecule comprising the peptide of the invention and a composition comprising the peptide or the fusion molecule of the invention. Furthermore, the present invention relates to a method of detecting the internalization behaviour of a fusion molecule of the invention, the composition of the invention for treating and/or preventing a condition selected from cancer, enzyme deficiency diseases, infarcts, cerebral ischemia, diabetes, inflammatory diseases, infections such as bacterial, viral or fungal infections, autoimmune diseases such as systemic lupus erythematodes (SLE) or rheumatoid arthritis, diseases with amyloid-like fibrils such as Alzheimer's disease (AD) and Parkinson's disease (PD) or certain forms of myopathy.02-03-2011
20110280897POLYPEPTIDES AND USES THEREOF - The invention provides a polypeptide having a sequence comprising from 10 to 24 consecutive amino acids from residues 215-233 of the sequence of human cyclin B1 protein or homolog thereof, as well as a nucleic acid molecule encoding the polypeptide, and compositions thereof. The invention also provides a method for using such polypeptides, nucleic acid molecules, or combinations thereof for treatment or prophylaxis of cancer in patients.11-17-2011
20110280898INHBB EPITOPE PEPTIDES AND VACCINES CONTAINING THE SAME - Peptide vaccines against cancer are described herein. In particular, the present invention describes epitope peptides derived from INHBB that elicit CTLs. The present invention also provides established CTLs that specifically recognize HLA-A02 positive target cells pulsed with the peptides. Antigen-presenting cells and exosomes that present any of the peptides, as well as methods for inducing antigen-presenting cells are also provided. The present invention further provides pharmaceutical compositions containing the INHBB polypeptides or polynucleotides encoding thereof, as well as exosomes and antigen-presenting cells as active ingredients. Furthermore, the present invention provides methods for the treatment and/or prophylaxis of cancers, and/or prevention of postoperative recurrence thereof, as well as methods for inducing CTLs, methods for inducing anti-tumor immunity, using the INHBB polypeptides, polynucleotides encoding the polypeptides, exosomes or antigen-presenting cells presenting the polypeptides, or the pharmaceutical agents of the present invention.11-17-2011
20110280896METHODS AND COMPOSITIONS FOR TUMOR VACCINATION AND THERAPY - The present invention relates to peptide vaccines, pharmaceutical compositions thereof, and associated methodologies that promote the immune-mediated regression of tumors expressing an onconeural antigen, e.g. a cdr-2 antigen, HuD antigen. The cancer peptide vaccines of the present invention are antigenic peptides capable of being faithfully presented on the MHC I complex of a target cell or antigen presenting cell. This external cellular presentation of these peptides promotes a specific cytotoxic T lymphocyte (CTL)-mediated immune response against tumor cells expressing these proteins, thereby, inducing immunological reactivity.11-17-2011
20110142864Tumor-associated Peptides Binding Promiscuously to Human Leukocyte Antigen (HLA) Class II Molecules - The present invention relates to immunotherapeutic methods, and molecules and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumour-associated T-helper cell peptide epitopes, alone or in combination with other tumour-associated peptides, that serve as active pharmaceutical ingredients of vaccine compositions which stimulate anti-tumour immune responses. In particular, the present invention relates to 49 novel peptide sequences derived from HLA class II molecules of human tumour cell lines which can be used in vaccine compositions for eliciting anti-tumour immune responses.06-16-2011
20110142868Peptidylarginine Deiminase (PAD) Inhibitors - The invention relates to PAD inhibitors that are suitable to be used as a medicament against an autoimmune disease such as RA.06-16-2011
20110091493VACCINE COMPOSITIONS AND USES THEREOF - The present invention relates to vaccine compositions and uses thereof. Embodiments of the present invention provide oral bacterial (e.g., probiotic lactic acid bacteria) vaccine delivery systems comprising an antigen and a dendritic cell-targeting peptide. Such compositions target vaccines to dendritic cells, resulting in a high level of humoral and acquired immunity, including both mucosal and systemic immunity. Such delivery systems find use in the specific delivery of a wide variety of oral vaccines to subjects.04-21-2011
20100255017PURIFIED HEMOCYANIN OBTAINED FROM FISSURELLA LATIMARGINATA, FISSURELLA CUMINGI OR FISSURELLA MAXIMA; SUBUNIT OF PURIFIED HEMOCYANIN; USE OF HEMOCYANIN, ITS SUBUNIT OR IMMUNOGENIC FRAGMENTS AND COMPOSITIONS CONTAINING THE SAME - The invention relates to purified hemocyanins, subunits or immunogenic fragments thereof, wherein the hemocyanins are purified from a hemolymph of 10-07-2010
20100021488HMGN POLYPEPTIDES AS IMMUNE ENHANCERS AND HMGN ANTAGONISTS AS IMMUNE SUPPRESSANTS - A method of enhancing an antigen-specific immune response in a host comprising administering to the host an HMGN polypeptide comprising at least one of HMGN1, HMGN3a, HMGN3b, HMGN4, Nsbpl, or a functional fragment thereof, in an amount effective to enhance an antigen-specific immune response; as well as a pharmaceutical composition comprising an HMGN polypeptide comprising at least one of HMGN1, HMGN3a, HMGN3b, HMGN4, Nsbpl, or a functional fragment thereof, and an antigen, or nucleic acids encoding such molecules; and related methods and compositions.01-28-2010
20130039933STING (STIMULATOR OF INTERFERON GENES), A REGULATOR OF INNATE IMMUNE RESPONSES - Novel molecules termed STING which include nucleic acids, polynucleotides, oligonucleotides, peptides, mutants, variants and active fragments thereof, modulate innate and adaptive immunity in a subject. STING compositions are useful for the treatment of an immune-related disorder, including treating and preventing infection by modulating immunity.02-14-2013
20130022630METHOD FOR TREATING AMYLOID DISEASE - The invention relates to methods for treating human amyloid disease by administration of modified Aβ peptide immunogens.01-24-2013
20120288514PEPTIDE VACCINES FOR CANCERS EXPRESSING MPHOSPH1 OR DEPDC1 POLYPEPTIDES - The present invention provides peptides having an amino acid sequence as set forth in SEQ ID NO: 7, 8, 9, 10, 11, 12, 192, 195, 197, 209, 225, 226, 228, 230, 240, 241, 243, 244, 249, 253, 254 or 255, as well as peptides having the above-mentioned amino acid sequences in which 1, 2, or several amino acids are substituted, deleted, or added, wherein the peptides possess cytotoxic T cell inducibility. The present invention also provides drugs for treating or preventing a disease associated with the over-expression of MPHOSPH1 and/or DEPDC1, e.g. cancers, containing these peptides as an active ingredient. The peptides of the present invention can also be used as vaccines.11-15-2012
20120003252ISOFORMS OF HUMAN SOMATOSTATIN RECEPTOR TYPE 5 PRODUCED BY ALTERNATIVE PROCESSING AND OLIGO-NUCLEOTIDE PAIRS FOR DETECTION THEREOF BY PCR - The present invention concerns two human nucleic acids comprising sequences which code two novel isoforms of human somatostatin receptor type 5 produced by alternative adjustment, called sst5B and sst5C and with possible uses in tumoral processes. Additionally, the invention concerns oligonucleotide pairs used for the differential detection of said isoforms by means of the PCR technique in different tissues.01-05-2012
20120107334METHOD FOR ENHANCING IMMUNE RESPONSE WITH PEPTIDE - An object of the present invention is to provide a safe and effective method for enhancing an immune response and a medicament for preventing or treating Alzheimer disease comprising amyloid β peptide that induces an enhanced immune response. An amyloid β peptide or a portion thereof with addition or insertion of cysteine and a method for enhancing an immune response using the peptide or a method for enhancing an immune response using the peptide together with an adjuvant. A medicament for preventing or treating Alzheimer disease comprising an amyloid β peptide or a portion thereof that induces an enhanced immune response. A DNA vaccine, that may have the same effect, comprising the gene encoding an amyloid peptide or a portion thereof that induces an enhanced immune response with addition or insertion of cysteine.05-03-2012
20100221271Nucleic Acid and Amino Acid Sequences, and Vaccine for the Control of Ectoparasite Infestations in Fish - The present invention is related with the isolation and cloning of a new gene, the production of the protein encoded by this gene by using recombinant systems, and the use of this antigen in a vaccine formulation as a purified protein and/or naked DNA, to induce an immune response in aquatic organisms against different ectoparasite species, including the known as sea lice, and pathogens associated with these infestations. The vaccine preparations, administered by oral route, immersion bath or injection, demonstrated its efficacy by producing IgM humoral immune response and reducing the number of parasites per fish in the vaccinated fishes.09-02-2010
20090202576PEPTIDE VACCINES FOR LUNG CANCERS EXPRESSING TTK, URLC10 OR KOC1 POLYPEPTIDES - The present invention provides peptides comprising the amino acid sequence of SEQ ID NO: 8, 67, 89, as well as peptides comprising the above-mentioned amino acid sequences in which 1, 2, or several amino acids are substituted, deleted, or added, and having cytotoxic T cell inducibility. The present invention also provides drugs for treating or preventing tumors comprising these peptides. The peptides of the present invention can also be used as vaccines.08-13-2009
20110287043MELANOMA ANTIGENS AND THEIR USE IN DIAGNOSTIC AND THERAPEUTIC METHODS - The present invention provides an isolated or purified immunogenic peptide comprising 8-15 contiguous amino acids of gp100 (SEQ ID NO: 121) and related nucleic acids, expression vectors, host cells, populations of cells, and methods of use. The invention further provides immunogenic peptides derived from gp100 which have been modified to enhance their immunogenicity and related nucleic acids, expression vectors, host cells, populations of cells, and methods of use.11-24-2011
20110287042A-Beta Immunogenic Peptide Carrier Conjugates and Methods of Producing Same - The present invention is directed to methods of producing conjugates of Aβ peptide immunogens with protein/polypeptide carrier molecules, which are useful as immunogens, wherein peptide immunogens are conjugated to protein carriers via activated functional groups on amino acid residues of the carrier or of the optionally attached linker molecule, and wherein any unconjugated reactive functional groups on amino acid residues are inactivated via capping, thus retaining the immunological functionality of the carrier molecule, but reducing the propensity for undesirable reactions that could render the conjugate less safe or effective. Furthermore, the invention also relates to such immunogenic products and immunogenic compositions containing such immunogenic products made by such methods.11-24-2011
20110287041Aldehyde Tags, Uses Thereof in Site-Specific Protein Modification - The invention features compositions and methods for site-specific modification of proteins by incorporation of an aldehyde tag. Enzymatic modification at a sulfatase motif of the aldehyde tag through action of a formylglycine generating enzyme (FGE) generates a formylglycine (FGly) residue. The aldehyde moiety of FGly residue can be exploited as a chemical handle for site-specific attachment of a moiety of interest to a polypeptide.11-24-2011
20110287040MATERIALS AND METHODS FOR TREATMENT OF INFLAMMATION - The subject invention pertains to peptides and salts thereof that are useful as anti-inflammatory agents and to compositions containing such peptides and salts as active ingredients. Specifically exemplified herein are endomorphin-1 peptide (EM-1), analogs and salts thereof, and uses for modulation of calcitonin gene-related peptide (CGRP) production and/or substance P (SP) and for treatment of inflammation, particularly neurogenic inflammation.11-24-2011
20090142366Yeast-Based Vaccines As Immunotherapy - Compositions and methods for treating and/or preventing a variety of diseases and conditions that are amenable to immunotherapy and, in one particular embodiment, compositions and methods for treating and/or preventing cancer in an animal are described. Specifically improvements related to the use of a yeast-based vaccine comprising a yeast vehicle and an antigen that is selected to elicit an antigen-specific cellular and humoral immune response in an animal, for use in prophylactic and/or therapeutic vaccination and the prevention and/or treatment of a variety of diseases and conditions are disclosed.06-04-2009
20120231026METHODS AND COMPOSITIONS FOR TUMOR VACCINATION AND THERAPY - The present invention relates to peptide vaccines, pharmaceutical compositions thereof, and associated methodologies that promote the immune-mediated regression of tumors expressing an onconeural antigen, e.g. a cdr-2 antigen, HuD antigen. The cancer peptide vaccines of the present invention are antigenic peptides capable of being faithfully presented on the MHC I complex of a target cell or antigen presenting cell. This external cellular presentation of these peptides promotes a specific cytotoxic T lymphocyte (CTL)-mediated immune response against tumor cells expressing these proteins, thereby, inducing immunological reactivity.09-13-2012
20100028373PEPTIDE VACCINES FOR CANCERS EXPRESSING MPHOSPH1 OR DEPDC1 POLYPEPTIDES - The present invention provides peptides having an amino acid sequence as set forth in SEQ ID NO: 7, 8, 9, 10, 11, 12, 192, 195, 197, 209, 225, 226, 228, 230, 240, 241, 243, 244, 249, 253, 254 or 255, as well as peptides having the above-mentioned amino acid sequences in which 1, 2, or several amino acids are substituted, deleted, or added, wherein the peptides possess cytotoxic T cell inducibility. The present invention also provides drugs for treating or preventing a disease associated with the over-expression of MPHOSPH1 and/or DEPDC1, e.g. cancers, containing these peptides as an active ingredient. The peptides of the present invention can also be used as vaccines.02-04-2010
20110165185IMMUNOGENIC PEPTIDES - The invention provides relatively short immunogenic peptides derived from CD19 and CD20 antigens, and biologically active variants thereof, which elicit an immune response. Nucleic acids encoding the immunogenic peptides and antibodies specific for the peptides are also provided. The immunogenic peptides can be included in pharmaceutical compositions, such as cancer vaccines, and used for the treatment of cancer.07-07-2011
20130216565VACCINES BASED ON PEPTIDES OF THE COMPLEMENT PROTEIN C5A - The present invention relates to a vaccine comprising at least one peptide consisting of amino acid sequence LRAN-ISHKDMQLGR (SEQ ID No. 1) or a peptide fragment thereof (SEQ ID No. 2-13) coupled or fused to a carrier protein comprising at least one T cell epitope, wherein said peptide fragment comprises at least 7 amino acid residues and the amino acid sequence KDMQLGR (SEQ ID No: 7) or KDMQLG (SEQ ID No: 23) under the provision that the peptide fragment does not consist of amino acid sequences HKDMQLGR (SEQ ID No: 16) and HKDMQLG (SEQ ID No: 22).08-22-2013
20110293646PAN-DR Binding Polypeptides and Uses Thereof - The present invention provides novel artificial oligopeptides capable of binding HLA Class II molecules encoded by several alleles. The oligopeptides include the sequence AX12-01-2011
20100285046Nontoxic ricin mutant compositions and methods - Disclosed are nontoxic ricin mutants and uses in connection with vaccines and cancer therapy.11-11-2010
20110293647IMMUNOGENIC LHRH COMPOSITIONS AND METHODS RELATING THERETO - The present invention relates generally to an immunogenic LHRH composition and more particularly to an immunogenic LHRH composition comprising a LHRH C-terminal fragment of at least five amino acids. The present invention is useful, inter alia, as a prophylactic and/or therapeutic agent for the modification of fertility and behaviour patterns of animals, the achievement of livestock production gains such as increasing growth, decreasing feed conversion ratios or the control of unwanted organoleptic characteristics or the treatment of disorders of the reproductive organs.12-01-2011
20110293645WDRPUH EPITOPE PEPTIDES AND VACCINES CONTAINING THE SAME - The present invention provides peptides containing the amino acid sequence of SEQ ID NOs: 1, 2, 3, 4, 16, 17, 30, 31, 34, 36, 37, 40, 41, 45, 49, 55, 57 and 61, as well as peptides containing the above-mentioned amino acid sequences in which 1, 2, or several amino acid(s) are substituted, deleted, inserted or added, but still have cytotoxic T cell inducibility. The present invention also provides drugs for treating or preventing tumors, which drugs containing these peptides. The peptides of the present invention can also be used as vaccines.12-01-2011
20110293648SSX-2 PEPTIDES PRESENTED BY HLA CLASS II MOLECULES - The invention describes HLA class II binding peptides encoded by the SSX-2 tumor associated gene, as well as nucleic acids encoding such peptides and antibodies relating to the peptides. The peptides stimulate the activity and proliferation of CD412-01-2011
20100166787VACCINES AND METHODS FOR USING THE SAME - Improved anti-HIV immunogens and nucleic acid molecules that encode them are disclosed, Immunogens disclosed include those having consensus sequences for HIV Subtype A Envelope protein, those having consensus sequences for HIV Subtype B Envelope protein, those having consensus sequences for HIV Subtype C Envelope protein, those having consensus sequences for HIV Subtype D Envelope protein, those having consensus sequences for HIV Subtype B consensus Nef-Rev protein, and those having consensus sequences form HIV Gag protein subtypes A, B, C and D. Improved anti-HPV immunogens and nucleic acid molecules that encode them; improved anti-HCV immunogens and nucleic acid molecules that encode them; improved hTERT immunogens and nucleic acid molecules that encode them; and improved anti-Influenza immunogens and nucleic acid molecules that encode them are disclosed. Pharmaceutical composition, recombinant vaccines comprising and live attenuated pathogens are disclosed as well methods of inducing an immune response in an individual against HIV, HPV, HCV, hTERT and Influenza are disclosed.07-01-2010
20100166786A MYCOBACTERIUM TUBERCULOSIS FUSION PROTEIN AND USES THEREOF - The present invention is related to a 07-01-2010
20110008377FELINE CD80, FELINE CD86, FELINE CD28, AND FELINE CTLA-4 NUCLEIC ACID AND POLYPEPTIDES - The present invention provides isolated and purified DNA encoding feline CD80 (B7-1) ligand, feline CD86 (B7-2) ligand, feline CD28 receptor, or feline CTLA-4 (CD152) receptor, as well as vectors comprising nucleic acid encoding feline CD80, feline CD86, feline CD28, or feline CTLA-4. The present invention provides a host cells transformed with CD80-encoding vectors, CD86-encoding vectors, CD28-encoding vectors, or CTLA-4-encoding vectors. The invention provides polypeptides encoded by the nucleic acid of feline CD80, feline CD86, feline CD28, or feline CTLA-4. The present invention provides a vaccine comprising an effective amount of polypeptides encoded by the nucleic acid of feline CD80, feline CD86, feline CD28, or feline CTLA-4. The present invention also provides vaccines which further comprise immunogens derived from pathogens. The invention provides for vaccines capable of enhancing an immune response. The invention also provides for vaccines capable of suppressing and immune response.01-13-2011
20100136037Chloramphenicol Acetyl Transferase (CAT)-Defective Somatostatin Fusion Protein And Uses Thereof - Chimeric somatostatin-based polypeptides, polynucleotides used to encode the polypeptides, the methods for isolating and producing the polypeptides and the uses thereof are provided. In addition, low cost adjuvants for enhanced immunogenic response are provided. Vaccinations that include both chimeric somatostatin-based polypeptides and novel adjuvants are included, useful in facilitating farm animal productivity.06-03-2010
20090297545IMMUNOMODULATORY DAIRY PEPTIDES AND USES THEREOF - The present invention provide a new method for modulating the immune system of a subject in need thereof by administering a dairy-derived peptide to the subject, particularly a β-lactoglubulin-derived peptide (β-Lg peptide). According to one aspect, the modulation of the immune system is the modulation of a Th1 response. According to another aspect, the modulation of the immune system is the modulation of a Th2 response.12-03-2009
20090311281NOVEL METHOD FOR DOWN-REGULATION OF AMYLOID - Disclosed are novel methods for combating diseases characterized by deposition of amyloid. The methods generally rely on immunization against amyloidogenic proteins (proteins contributing to formation of amyloid) such as beta amyloid (Aβ). Immunization is preferably effected by administration of analogues of autologous amyloidogenic polypeptides, said analogues being capable of inducing antibody production against the autologous amyloidogenic polypeptides. Especially preferred as an immunogen is autologous Aβ which has been modified by introduction of one single or a few foreign, immunodominant and promiscuous T-cell epitopes while substantially preserving the majority of Aβ's B-cell epitopes. Also disclosed are nucleic acid vaccination against amyloidogenic polypeptides and vaccination using live vaccines as well as methods and means useful for the vaccination. Such methods and means include methods for identification of useful immunogenic analogues of the amyloidogenic proteins, methods for the preparation of analogues and pharmaceutical formulations, as well as nucleic acid fragments, vectors, transformed cells, polypeptides and pharmaceutical formulations.12-17-2009
20090311280NOVEL TNF RECEPTOR REGULATORY DOMAIN - Herpesvirus entry mediator (HVEM) is a member of the tumor necrosis factor receptor superfamily (TNFRSF) and acts as a molecular switch that modulates T cell activation by propagating positive signals from the TNF related ligand, LIGHT (p30, TNFSF14), or inhibitory signals through the immunoglobulin superfamily member, B and T lymphocyte attenuator (BTLA). A novel binding site for BTLA is disclosed, located in cysteine-rich domain-1 of HVEM. BTLA binding site on HVEM overlaps with the binding site for the Herpes Simplex virus-1 envelope glycoprotein D (gD), but is distinct from where LIGHT binds, yet gD inhibits the binding of both ligands. A BTLA activating protein present in human cytomegalovirus is identified as UL144. UL144 binds BTLA, but not LIGHT, and inhibits T cell proliferation.12-17-2009
20080274128HEAT SHOCK PROTEIN-BASED VACCINES AND IMMUNOTHERAPIES - The present invention relates to methods and compositions for inducing an immune response in a subject, wherein the subject is administered an effective amount of at least one heat shock protein in combination with one or more defined target antigens. These methods and compositions may be used in the treatment of infectious eases and cancers.11-06-2008
20100008940PEPTIDE ANALOGS CAPABLE OF ENHANCING STIMULATION OF A GLIOMA-SPECIFIC CTL RESPONSE - The invention provides a peptide derived from the interleukin-13 receptor α2, which serves as a HLA-A2-restricted cytotoxic T lymphocyte (CTL) epitope. The invention can be used as a vaccine for glioma and can be formulated into compositions for medical or veterinary use. In addition, the invention provides the use of a peptide derived from the Eph family of tyrosine kinase receptors which can be also used as a vaccine for glioma and can be formulated into compositions for medical or veterinary use.01-14-2010
20100034842Compositions Employing Alternative Reading Frame Polypeptides for the Treatment of Cancer and Infectious Disease - Provided are alternative reading frame (ARF) polypeptides as well as antigen presenting cell (APC) and dendritic cell (DC) based compositions that comprise ARF polypeptides. ARF polypeptides and ARF polypeptide-based compositions are useful in the treatment of cancer and infectious disease.02-11-2010
20100034840COMPOSITIONS AND METHODS FOR ELICITING AN IMMUNE RESPONSE TO ESCAPE MUTANTS OF TARGETED THERAPIES - Provided herein are cells, vectors and viruses in association with a mutant polypeptide that has emerged in response to a therapeutic or prophylactic agent; compositions comprising such cells, vectors and viruses and methods for their use in eliciting an immune response to the mutant polypeptide. In some examples, the immune response is a cellular immune response.02-11-2010
20100034841ANTIGENIC POLYPEPTIDE USABLE AS THERAPEUTIC AGENT FOR MALIGNANT NEOPLASM - This invention provides a new tumor antigen having an epitope that induces a Th1 cell (a CD4-positive T cell specific to MAGE-A4), and a method of application thereof.02-11-2010
20110217325T CELL EPITOPES OF THE CYN D 1 ALLERGEN FROM BERMUDA GRASS POLLEN - The present invention relates generally to molecules such as peptides, polypeptides and proteins which interact immunologically with T lymphocytes in subjects having Bermuda grass allergy and genetic sequences encoding same. These molecules are preferentially immunointeractive with T cells in subjects having a Bermuda grass pollen allergy. The molecules of the present invention are useful in the development of diagnostic, therapeutic and prophylactic agents for conditions characterised by an aberrant, inappropriate or otherwise unwanted immune response to Bermuda grass pollen or derivative or homologue thereof.09-08-2011
20110217324INHIBITORS OF ANTIGEN PRESENTATION BY MHC CLASS II MOLECULES AND METHODS OF USE THEREOF - Provided herein are novel compounds, pharmaceutical compositions containing such compounds and methods for their use. In particular, the compounds described herein are useful for the treatment or prevention of diseases associated with T cell proliferation such as autoimmune diseases and disorders.09-08-2011
20090098151ALS-SPECIFIC PEPTIDE COMPOSITION - The invention relates to a composition for eliciting an immune response in an animal to produce an antibody that binds selectively to an amyotrophic lateral sclerosis (ALS)-specific epitope.04-16-2009
20090098150Anti-acetylated huntingtin antibodies and uses therof - This invention includes, in part, methods of preparing acetylated Huntingtin (Htt) polypeptides, acetylated Htt polypeptide antigens, and antibodies that specifically recognize acetylated epitopes on Htt polypeptides. The invention also relates, in part, to the preparation and use of antibodies that specifically recognize and bind to acetylated epitopes on acetylated Htt polypeptides when an acetylated residue on the Htt polypeptide is a lysine that corresponds to K444 residue of full-length, wild-type Htt polypeptide. In some aspects, the invention includes hybridoma cell lines that produce antibodies that specifically bind acetylated Htt polypeptide and also includes antibodies and antigen-binding fragments thereof produced using polypeptides of the invention.04-16-2009
20090117139LUTZOMYIA LONGIPALPIS POLYPEPTIDES AND METHODS OF USE - Substantially purified salivary 05-07-2009
20090162388Fish Vaccine - The present invention relates to veterinary immunology, namely to the immunological response of fish to a virus. More specifically, the invention provides an epitope of salmonid alphaviruses which epitope is capable of inducing a virus neutralising immune response. In particular the invention relates to a polypeptide comprising a certain amino acid sequence, a protein comprising such polypeptide, to a carrier comprising such protein, and to a method of producing antibodies. Further the invention relates to a nucleic acid encoding such polypeptide or such protein, and to a carrier comprising such a nucleic acid. Also, the invention relates to a vaccine and a diagnostic kit comprising such a polypeptide, protein, carrier, or nucleic acid.06-25-2009
20110195081FOXM1 PEPTIDE AND MEDICINAL AGENT COMPRISING THE SAME - An objective of the present invention is to provide a means for enabling cancer immunotherapy that targets approximately 30% of various cancer patients that highly express forkhead box M1 (FOXM1) among the Japanese, by identifying FOXM1-derived peptides that can activate cancer cell-damaging human killer T cells by binding to HLA-A2. The present invention provides a peptide of (A) or (B) below: 08-11-2011
20100111988SMALL PEPTIDE FOR ANTI-ANGIOGENESIS AND USE THEREOF - The present invention relates to a small peptide for anti-angiogenesis and use thereof, in particular, to a small peptide useful for treating angiogenesis diseases; a polynucleotide coding the peptide; a vector and a cell comprising the polynucleotide; a pharmaceutical composition comprising the small peptide, the fused peptide or the fused protein, the polynucleotide, the vector and/or the cell. The small peptide, the fused peptide or the fused protein, the polynucleotide, the vector, the cell and/or the pharmaceutical composition can be used for treatment of associated diseases such as tumor by anti-angiogenesis.05-06-2010
20090142362Peptide-based vaccine compositions to endogenous cholesteryl ester transfer protein (CETP) - Improved vaccine compositions and methods of use thereof are described that elicit production of antibodies in an individual to the individual's own endogenous cholesteryl ester transfer protein (CETP).06-04-2009
20080311142CANCER VACCINES AND VACCINATION METHODS - Methods and compositions for treating cancers (e.g., neural cancers) by dendritic cell vaccination are provided herein.12-18-2008
20090142363CYTOTOXIC T-CELL EPITOPE PEPTIDE AND USE THEREOF - The successful identification of epitope peptides specific to adenovirus belonging to subgroup B and epitope peptides exhibiting specificity to all adenoviruses using hexon proteins which exhibit the highest homology among genes of adenoviruses of various subgroups is herein described. The peptides have a function capable of efficiently inducing adenovirus-specific cytotoxic T cells (CTLs). Thus, the peptides disclosed herein find utility as vaccines for active immunization. Furthermore, CTLs induced by such peptides find utility as passive immunotherapeutic agents.06-04-2009
20090311279Colorectal Cancer Antigen - A point mutation at position 399 in a commonly expressed gene, designated as COA-1 herein, is diagnostic of colorectal cancer and is capable of eliciting at all mediated immune response.12-17-2009
20100215676KDR PEPTIDES AND VACCINES COMPRISING THE SAME - The present invention provides nonapeptides selected from peptides comprising the amino acid sequence of SEQ ID NO:2, 3, 5, 8, 11, or 12; nonapeptides or decapeptides selected from peptides comprising the amino acid sequence of SEQ ID NO:29, 30, 33, 34, 40, or 46; and peptides with cytotoxic T cell inducibility, in which one, two, or several amino acids are substituted or added to the above-mentioned amino acid sequences, as well as pharmaceuticals for treating or preventing tumors, where the pharmaceuticals comprise these peptides. The peptides of this invention can be used as vaccines.08-26-2010
20090087446COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY - Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.04-02-2009
20110200627ANTI-CD147 ANTIBODIES, METHODS AND USES - The present invention provides antibodies immunospecific for human CD 147 capable of blocking bioactivity of CD 147 associated with malignant disease such as the stimulation of MMPs from fibroblast cells by tumor cells, the release of VEGF, and the promotion of angiogenesis. The antibodies of the present invention of are useful in treating malignant disease and those diseases in which CD 147 activity is plays a pathogenic role, such as diseases of the eye, lung, and cardiovascular system.08-18-2011
20110200629TUMOR ANTIGEN PEPTIDE AND USE THEREOF - Disclosed is a peptide consisting of the identical amino acid sequence or a substantially identical amino acid sequence to the amino acid sequence depicted in SEQ ID NO:4, wherein the peptide binds to an HLA antigen and is recognized by cytotoxic T cells. The peptide of the present invention can be used in vivo or in vitro as an agent for inducing CTL, that is, cancer vaccine, and exerts therapeutic or ameliorating effects on tumors such as osteosarcoma, renal cancer, and others. The peptide of the present invention is also useful as a tumor marker directed to tumors such as sarcoma, renal cancer, and others.08-18-2011
20130078269AMYLOID BETA PEPTIDES, ASSEMBLIES THEREOF, AND RELATED METHODS - The present invention provides amyloid β peptide assemblies composed of at least three amyloid β peptide subunits, wherein at least one of the amyloid β peptide subunits is an amyloid β peptide analog. The invention further relates to metal complexes of amyloid β peptide assemblies and the use of amyloid β peptide assemblies as vaccines and in the identification of agents that modulate assembly of the amyloid β peptide subunits.03-28-2013
20120107337NOVEL FORMULATIONS OF TUMOUR-ASSOCIATED PEPTIDES BINDING TO HUMAN LEUKOCYTE ANTIGEN (HLA) CLASS I OR CLASS II MOLECULES FOR VACCINES - The present invention relates to novel formulations of tumour-associated peptides binding to human leukocyte antigen (HLA) class I or II molecules as vaccines for the use in immunotherapeutic methods. In particular, the present invention relates to formulations for the immunotherapy of cancer, in particular renal and brain cancer, in particular glioma, especially glioblastoma cancer. The present invention furthermore relates to vaccine compositions for eliciting anti-tumour immune responses.05-03-2012
20120107336MODIFIED DEFENSINS AND THEIR USE - This disclosure provides modified antimicrobial agents, for example modified defensin polypeptides. Compositions including a modified arginine residue, such as an ADP-ribosylated and/or ribosylated alpha defensin polypeptide, are provided. Also provided are methods of modulating an immune response using the modified defensin polypeptides. Methods are provided for modulating an antimicrobial activity and for inhibiting a cytotoxic activity. Also disclosed are methods for treating diseases in a subject that are associated with an immune response, such as inflammatory and pulmonary diseases, using the disclosed modified defensin polypeptides.05-03-2012
20090263410USE OF TGF-B1 INHIBITOR PEPTIDES IN THE PREPARATION OF AN IMMUNE RESPONSE MODULATING AGENT - The present invention relates to the use of a peptide inhibiting TGF-β1 selected from: peptide p144 whose sequence corresponds to SEQ ID NO: 1, peptide p17 whose sequence corresponds to SEQ ID NO: 2, a peptide which has at least 90% homology therewith, or fragments of the above, in the preparation of an immune response modulating agent.10-22-2009
20090263409CANCER ANTIGEN PEPTIDE FORMULATIONS - Cancer antigen peptides derived from WT 1 which have an in vivo efficacy, particularly a clinical usefulness, and cancer vaccines as dosage forms suitable for said cancer antigen peptides, are provided.10-22-2009
20090142365COMPOSITIONS AND METHODS FOR USING CA9 PROTEIN TO STIMULATE AN IMMUNE RESPONSE - Provided are methods for stimulating an immune response to an antigen by administering a composition to an individual in an amount effective to stimulate an immune response to the antigen. The stimulated immune response to the antigen is greater than the immune response stimulated by the antigen in the absence of CA9 protein. The compositions provided contain a complex that includes an antigen and an isolated CA9 protein.06-04-2009
20100272742NOVEL SERPENTINE TRANSMEMBRANE ANTIGENS EXPRESSED IN HUMAN CANCERS AND USES THEREOF - Described is a novel family of cell surface serpentine transmembrane antigens. Two of the proteins in this family are exclusively or predominantly expressed in the prostate, as well as in prostate cancer, and thus members of this family have been termed “STEAP” (Six Transmembrane Epithelial Antigens of the Prostate). Four particular human STEAPs are described and characterized herein. The prototype member of the STEAP family, STEAP-1, appears to be a type IIIa membrane protein expressed predominantly in prostate cells in normal human tissues. Structurally, STEAP-1 is a 339 amino acid protein characterized by a molecular topology of six transmembrane domains and intracellular N- and C-termini, suggesting that it folds in a “serpentine” manner into three extracellular and two intracellular loops. STEAP-1 protein expression is maintained at high levels across various stages of prostate cancer. Moreover, STEAP-1 is highly over-expressed in certain other human cancers.10-28-2010
20100226933HYPOALLERGENIC PROTEINS - The present invention relates to a method for identifying a hypoallergenic derivative of a wild-type allergen comprising: determining the three-dimensional structure of a wild-type allergen; introducing at least one point mutation into said wild-type allergen, thereby obtaining a mutated allergen; identifying a hypoallergenic derivative of said wild-type allergen by detecting a destabilisation or change of the three-dimensional structure of the mutated allergen compared to the wild-type allergen by determining energy differences between the wild-type allergen and the mutant allergen expressed as a Z-score.09-09-2010
20090202577CASB618 Polynucleotides and Polypeptides and Their Use - CASB618 polypeptides and polynucleotides and methods for producing such polypeptides by recombinant techniques are disclosed. Also disclosed are methods for utilizing CASB618 polypeptides and polynucleotides in diagnostics, and vaccines for prophylactic and therapeutic treatment of cancers, particularly ovarian and colon cancers, autoimmune diseases, and related conditions.08-13-2009
20110200628Chimeric Proteins that Induce Effects Directed Against Viruses - The present invention is related to the obtaining of chimeric chains coding for proteins capable of inducing, in the recipient, a serotype-specific and protective humoral immune response against the infection by the Dengue virus, thus eliminating the effects of the serotype-nonespecific viral immunoenhancement that causes hemorrhagies and clinical complications described for this kind of pathology. These chimeric chains of nucleic acids are composed by the specific combination of fragments belonging to the gene of a mutated protein from 08-18-2011
20110200626IQGAP3 EPITOPE PEPTIDES AND VACCINES CONTAINING THE SAME - Peptide vaccines against cancer are described herein. In particular, the present invention describes epitope peptides derived from IQGAP3 that elicit CTLs. The present invention also provides established CTLs that specifically recognize HLA-A24 or HLA-A02 positive target cells pulsed with the peptides. Antigen-presenting cells and exosomes that present any of the peptides, as well as methods for inducing antigen-presenting cells are also provided. The present invention further provides pharmaceutical agents containing the IQGAP3 polypeptides or polynucleotides encoding thereof, as well as exosomes and antigen-presenting cells as active ingredients. Furthermore, the present invention provides methods for treating and/or prophylaxis of (i.e., preventing) cancers (tumors), and/or prevention of postoperative recurrence thereof, as well as methods for inducing CTLs, methods for inducing anti-tumor immunity, using the IQGAP3 polypeptides, polynucleotides encoding the polypeptides, exosomes or antigen-presenting cells presenting the polypeptides, or the pharmaceutical agents of the present invention. The cancers to be targeted include, but are not limited to, renal, esophageal, gastric, lung, breast, bladder and pancreatic cancer.08-18-2011
20090274714TUMOUR-ASSOCIATED PEPTIDES BINDING TO HUMAN LEUKOCYTE ANTIGEN (HLA) CLASS I OR II MOLECULES AND RELATED ANTI-CANCER VACCINE - The present invention relates to immunotherapeutic methods, and molecules and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumour-associated T-helper cell peptide epitopes, alone or in combination with other tumour-associated peptides, that serve as active pharmaceutical ingredients of vaccine compositions which stimulate anti-tumour immune responses. In particular, the present invention relates to two novel peptide sequences derived from HLA class II molecules of human tumour cell lines, which can be used in vaccine compositions for eliciting anti-tumour immune responses.11-05-2009
20080206267Inactivation Of Genes Of The Mep Pathway - The invention relates to cells and organisms as well as to methods for producing said cells and organisms, according to which intermediates of the mevalonate-independent pathway for isoprenoid biosynthesis (MEP pathway) are enriched by deleting or inactivating genes. The derivatives can also be enriched by using enzyme inhibitors. The enriched intermediates may be used as substrates in enzyme activity tests. The inventive cells and organisms and the enriched intermediates can further be used in the production of medicaments.08-28-2008
20110171243COMPOUNDS FOR TREATING AMYLOIDOSES - The present invention relates to the use of mimotopes in the treatment of β-Amyloidoses including but not limited to Alzheimer's disease, whereby said mimotopes are able to induce the in vivo formation of antibodies directed to non truncated Aβ1-40/42, and N-terminally truncated forms AβpE3-40/42, Aβ3-40/42, Aβ11-40/42, AβpE11-40/42 and Aβ14-40/42 without interfering with physiological functions of APP signalling.07-14-2011
20090274716LAGE-1 TUMOR ASSOCIATED NUCLEIC ACIDS - The invention describes the LAGE-1 tumor associated gene, including fragments, allelic variants and splice variants thereof. Also included are polypeptides and fragments thereof encoded by such genes, and antibodies relating thereto. Methods and products also are provided for diagnosing and treating conditions characterized by expression of a LAGE-1 gene product.11-05-2009
20090104215Methods and compositions for modulating tumor cell activity - Antibodies which target clusterin, a protein involved in the epithelial-to-mesenchymal transition of carcinoma cells, are identified and characterized. The antibodies may be used to modulate tumour cell activity through binding to clusterin.04-23-2009
20090104214Synthetic peptides containing the motif "YWWLXP" as anthrax toxin antidotes - Specific inhibitors, in Multiple Antigen Peptide form, which inhibit the interaction between protective antigen and lethal factor and neutralize anthrax toxin in vivo. Anti protective antigen peptides were selected from a phage library by competitive panning with lethal factor. Selected 12mer peptides were synthesized in tetra-branched form and systematically modified to achieve peptides with higher affinity and inhibitory efficiency.04-23-2009
20090285843EPITOPE SEQUENCES - Disclosed herein are polypeptides, including epitopes, clusters, and antigens. Also disclosed are compositions that include said polypeptides and methods for their use.11-19-2009
20100291125ETA-1 GENE AND METHODS FOR USE - The present application relates to osteopontin (Eta-1) polypeptides, nucleic acids that encode Eta-1, antibodies that specifically bind to Eta-1, and methods for enhancing an immune response in an animal.11-18-2010
20100278850Isolated nucleic acid molecules encoding cancer associated antigens, the antigens per se, and uses thereof - The invention relates to newly identified cancer associated antigens. It has been discovered that each of these molecules provokes antibodies when expressed by a subject. The ramifications of this observation are also a part of this invention.11-04-2010
20090291097IL-17 homologous polypeptides and therapeutic uses thereof - The present invention is directed to novel polypeptides having sequence identity with IL-17, IL-17 receptors and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention. Further provided herein are methods for treating degenerative cartilaginous disorders and other inflammatory diseases.11-26-2009
20100291122METHOD FOR ENHANCING IMMUNE RESPONSE WITH PEPTIDE - An object of the present invention is to provide a safe and effective method for enhancing an immune response and a medicament for preventing or treating Alzheimer disease comprising amyloid β peptide that induces an enhanced immune response. An amyloid β peptide or a portion thereof with addition or insertion of cysteine and a method for enhancing an immune response using the peptide or a method for enhancing an immune response using the peptide together with an adjuvant. A medicament for preventing or treating Alzheimer disease comprising an amyloid β peptide or a portion thereof that induces an enhanced immune response. A DNA vaccine, that may have the same effect, comprising the gene encoding an amyloid β peptide or a portion thereof that induces an enhanced immune response with addition or insertion of cysteine.11-18-2010
20090169573T-Cell Stimulatory Peptides From The Melanoma-Associated Chondroitin Sulfate Proteoglycan And Their Use - The present invention relates to melanoma-associated chondroitin sulfate proteoglycan (MCSP) epitopes recognized by T cells, especially by CD407-02-2009
20120269839HMGN POLYPEPTIDES AS IMMUNE ENHANCERS AND HMGN ANTAGONISTS AS IMMUNE SUPPRESSANTS - A method of enhancing an antigen-specific immune response in a host comprising administering to the host an HMGN polypeptide comprising at least one of HMGN1, HMGN3a, HMGN3b, HMGN4, Nsbp1, or a functional fragment thereof, in an amount effective to enhance an antigen-specific immune response; as well as a pharmaceutical composition comprising an HMGN polypeptide comprising at least one of HMGN1, HMGN3a, HMGN3b, HMGN4, Nsbp1, or a functional fragment thereof, and an antigen, or nucleic acids encoding such molecules; and related methods and compositions.10-25-2012
20120269838CARRIER CONJUGATES OF IL-23-PEPTIDES AND THEIR INDUCED ANTIBODIES - The present invention relates to a pharmaceutical composition comprising as active substance, at least one compound comprising, or consisting of, a polypeptide which comprises, or consists of, at least 11 contiguous amino acids selected from X10-25-2012
20120269837SUBSTANCE BINDING HUMAN IgG Fc RECEPTOR IIb (FcgammaRIIb) - This invention relates to novel immunogens carrying conformationally discriminating epitopes (CDEs) and to immunization methods for producing antibodies that specifically recognize proteins with very closely related homologues. In particular, the invention relates to antibodies which are specific for either FcγRIIb and FcγRIIa.10-25-2012
20090297544NOVEL TUMOR ANTIGEN PROTEIN SART-3 AND TUMOR ANTIGEN PEPTIDES THEREOF - A novel tumor antigen protein and gene therefor, tumor antigen peptides derived from said tumor antigen protein or derivatives thereof as well as medicaments, prophylactics, or diagnostics for tumors using such tumor substances in vitro or in vitro are provided.12-03-2009
20090297543Nucleophosmin protein (npm) mutants, corresponding gene sequences and uses thereof - The invention relates to new nucleophosmin protein (NPM) mutants, corresponding gene sequences and relative uses thereof for diagnosis, monitoring of minimal residual disease; prognostic evaluation and therapy of the acute myeloid leukaemia (AML).12-03-2009
20080213292Soluble And Stabilized Trimeric Form Of Gp41 Polypeptides - The present invention concerns a modified polypeptide containing at least an immunodominant region and the connecting loop between N- and C-helices of gp41 ectodomain of HIV-1, wherein the connecting loop includes at least a linker fragment having: —a size convenient for keeping the native conformation of the interaction between N- and C-helices, and—an hydrophily sufficient to provide a soluble and stable trimeric form to said modified polypeptide.09-04-2008
20100062013CANCER ANTIGEN PEPTIDES DERIVED FROM WT1 - The present invention relates to HLA-A26-binding cancer antigen peptides derived from WT1, polynucleotides encoding said peptide, CTL-inducers, and cancer vaccine comprising said peptide or polynucleotide.03-11-2010
20110268755Survivin Peptides For Autoimmune Therapies - Compositions and methods for stimulating an immune response against cells that express survivin are provided. The method is suitable for prophylaxis and/or therapy of autoimmune disorders. The method involves administering to an individual a composition that contains a survivin peptide mimic that has a cysteine to methionine alteration at amino acid position 57 of wild type survivin. Fragments of the peptides can also be used.11-03-2011
20100278848TUMOR ANTIGEN BFY3 FOR PREVENTION AND/OR TREATMENT OF CANCER - The present invention relates to a nucleic acid encoding a polypeptide and the use of the nucleic acid or polypeptide in preventing and/or treating cancer. In particular, the invention relates to improved vectors for the insertion and expression of foreign genes encoding tumor antigens for use in immunotherapeutic treatment of cancer.11-04-2010
20120294877EPITOPE PEPTIDES DERIVED FROM VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR 1 AND VACCINES CONTAINING THESE PEPTIDES - The present invention provides immunogenic peptides comprising the amino acid sequence of SEQ ID NO: 1, 2, 13, 32, and peptides comprising the above-mentioned amino acid sequences in which 1, 2, or several amino acids are substituted or added, and having cytotoxic T cell inducibility, and also provides drugs for treating or preventing tumors comprising these peptides. The peptides of this invention can be used as vaccines.11-22-2012
20090004212Tumour vaccines for MUC1-positive carcinomas - Embodiments of the invention provide tumour vaccines, especially for activation of glycopeptide-specific cytotoxic T-cells by MHC class I pathway, comprising at least one peptide of 8-11 amino acids derived from the region SAPDTRPAPGST of the human epithelial mucin MUC1 containing the immunodominant PDTRPAP region and which is glycosylated on threonine of the immunodominant PDTRPAP region and start with SAP, APD or PDT at it's N-terminus.01-01-2009
20090004211METHOD FOR EFFECTING LOCALIZED, NON-SYSTEMIC AND SYSTEMIC, IMMUNOGENIC TREATMENT OF CANCER USING ERP57 TRANSLOCATION - Anthrocyclines-treated tumor cells are particularly effective in eliciting an anti-cancer immune response, where the rDNA-damaging agents, such as etoposide and mitomycin C do not induce immunogenic cell death. Anthracyclines induce the rapid, pre-apoptotic translocation of ERP57 to the cell surface. Knock down of ERP57 inhibit the translocation of CRT, suppressed the phagocytosis of anthracyclines-treated tumor cells by dendritic cells and abolished their immunogenicity in mammals, such as mice. In contrast, the blockade of ERP57 with blocking antibody had no effect on phagocytosis of anthracyclines-treated tumor cells by dendritic cells and their immunogenicity in mammals, such as mice. The anthracyclines-induced ERP57 translocation was mimicked by inhibition of the protein phosphatase1/GADD34 complex. Administration of recombinant ERP57 did not restore the immunogenicity of cell death elicited by etoposide and mitomycin C, or enhanced their antitumor effects in vivo, in contrast to the administration of recombinant CRT. These data identify the presence of ERP57 crucial for the translocation of CRT and to induce immunogenic cell death which will activate a anti-cancer immune responses.01-01-2009
20090169574Heteroclitic analogs and related methods - Heteroclitic analogs of Class I epitopes are prepared by providing conservative or semi-conservative amino acid substitutions at positions 3 and/or 5 and/or 7 of these epitopes. The analogs are useful in eliciting immune responses with respect to the corresponding wildtype epitopes.07-02-2009
20100136036UNCONVENTIONAL ANTIGEN TRANSLATED BY A NOVEL INTERNAL RIBOSOME ENTRY SITE ELICITS ANTITUMOR HUMORAL IMMUNE REACTIONS - The invention provides a novel antigen, MPD6, which belongs to the group of cryptic antigens without conventional genomic structure and is encoded by a cryptic open reading frame located in the 3′ untranslated region (3′UTR) of myotrophin mRNA. MPD6 elicits IgG antibody responses in a subset of PV patients, as well as patients with chronic myelogenous leukemia and prostate cancer. The translation of MPD6 was mediated by a novel internal ribosome entry site (IRES) upstream of the MPD6 reading frame. Furthermore, the MPD6-IRES mediated translation, but not myotrophin-MPD6 transcription, was significantly upregulated in response to IFN-α stimulation. These findings demonstrate that a novel IRES-mediated mechanism is responsible for the translation of unconventional self-antigen MPD6 in responsive to IFN-α stimulation. The eliciting anti-tumor immune response against unconventional antigen MPD6 in patients with myeloproliferative diseases indicates MPD6 as a target of novel immunotherapy.06-03-2010
20080241177Idiotypic vaccine - The present invention relates to idiotypic vaccine compositions for use in inducing immunity to p53. The invention preferably relates to a vaccine composition comprising a pharmaceutically acceptable carrier and at least one peptide, wherein the at least one peptide is selected from the group consisting of X10-02-2008
20080241178NOVEL HUMAN GENE FUNCTIONALLY RELATED TO DYSLEXIA - The present invention describes a novel human gene, DYXC1, which is functionally related to dyslexia. DYXC1 gene encodes a 420-amino acid residue protein. DYXC1 is expressed in several tissues, including the brain, and is localized in the nucleus. In addition, four single nucleotide polymorphisms (SNPs) in DYXC1 mRNA have been characterized in this invention. The invention provides diagnostic methods and materials for analysing allelic variation in DYSC1 gene. This invention also provides polypeptides encoded by DYXC1 gene and antibodies binding to said polypeptides.10-02-2008
20110206709T-CELL ANTIGEN PEPTIDE FROM ALLERGEN FOR STIMULATION OF IL-10 PRODUCTION - A first or second polypeptide for use in a method of treating or preventing a disorder by tolerisation, wherein said method comprises administration of the first and second polypeptide; and wherein both first and second polypeptides: i) are of 7 to 30 amino acids in length; ii) comprise at least one MHC Class Il-binding T cell epitope; and iii) are a fragment of a protein allergen or a homologous variant of said fragment; wherein said first polypeptide induces the release of an amount of IL-10 that is greater than the amount of IL-10 released in response to the whole protein allergen from which the first polypeptide derives; wherein said disorder is characterised by an inappropriate immune response to the protein allergen from which the second polypeptide derives.08-25-2011
20090311282NEUTRALIZING GDF8 EPITOPE-BASED GROWTH ENHANCING VACCINE - The invention provides new, specific antigenic peptides from the protein GDF8. The invention also provides fusion proteins comprising the new peptides, immunogens and vaccines based on the new peptides and/or fusion proteins, antibodies that specifically bind to the new peptides of GDF8, and methods of treating animals in order to modulate the activity of GDF8, employing vaccines or antibodies according to the invention.12-17-2009
20100129387PHARMACEUTICAL COMPOSITION CONTAINING THE NMB0606 PROTEIN - The present invention is related to field of medicine, particularly to the development of pharmaceutical formulation containing NMB0606 protein. Formulation described in this invention is able to confer protection against different diseases caused or not by pathogenic agents. NMB0606 protein was identified as a 05-27-2010
20100129390DKK1 AS A UNIVERSAL TUMOR VACCINE FOR IMMUNOTHERAPY OF CANCERS - DKK1 compositions comprising a DKK1 protein, DKK1 peptide, DKK1 DNA, DKK1-specific CTLs and Th1 cells and associated methods for treating cancer and cancer-mediated disorders in a human or animal subject in need of such treatment by administering a DKK1 composition to prevent or treat cancer are disclosed herein. The DKK1 compositions can be used alone, or in combination with other treatments, for the treatment of various cancers including ovarian, breast, colonic, brain, lung, prostate, pancreatic, lymphoma, esophageal carcinomas and melanoma.05-27-2010
20090169575PROTEINS - The present invention provides methods and compositions for screening, diagnosis and prognosis of colorectal cancer, for monitoring the effectiveness of colorectal cancer treatment, and for drug development.07-02-2009
20080274130Rabies Virus Vector Systems and Compositions and Methods Thereof - Rabies Virus compositions and methods are provided. The full-length sequence of Rabies Virus strain Evelyn-Rokitnicki-Abelseth (ERA) is disclosed. A reverse genetics system for producing recombinant ERA virus and derivatives thereof is provided, along with compositions including ERA and/or ERA derivative strain viruses, nucleic acids and/or proteins. In some instances, the compositions are immunogenic compositions useful for the pre- or post-exposure treatment of Rabies Virus.11-06-2008
20080274129Hla-A2 Tumor Associated Antigen Peptides and Compositions - A peptide or composition comprising at least one HLA-A2 epitope or analog from CEA, HER2/neu, MAGE2, MAGE3, or p53.11-06-2008
20080279875USE OF A PCV2 IMMUNOGENIC COMPOSITION FOR LESSENING CLINICAL SYMPTOMS IN PIGS - The present invention relates to the use of an immunogenic composition that comprises a porcine circovirus type 2 (PCV2) antigen for treatment of several clinical manifestations (diseases). Preferably, the clinical manifestations are associated with a PCV2 infection. Preferably, they include lymphadenopathy, lymphoid depletion and/or multinucleated/giant histiocytes. Moreover, the clinical symptoms include lymphadenopathy in combination with one or a multiple of the following symptoms in pigs: (1) interstitial pneumonia with interlobular edema, (2) cutaneous pallor or icterus, (3) mottled atrophic livers, (4) gastric ulcers, (5) nephritis and (6) reproductive disorders, e.g. abortion, stillbirths, mummies, etc. Furthermore the clinical symptoms include Pia like lesions, normally known to be associated with Lawsonia intracellularis infections.11-13-2008
20080279872Immunotherapeutic methods targeted toward stratum corneum chymotryptic enzyme - The present invention discloses the protease stratum corneum chymotrytic enzyme (SCCE) is specifically over-expressed in ovarian and other malignancies. A number of SCCE peptides can induce immune responses to SCCE, thereby demonstrating the potential of these peptides in monitoring and the development of immunotherapies for ovarian and other malignancies.11-13-2008
20080233138Coccidiosis Poultry Vaccine - This invention relates to novel 09-25-2008
20080292650THERAPEUTIC AND DIAGNOSTIC PEPTIDES - This invention generally relates to peptides useful for medical diagnosis and treatment of pathogenic disorders. More specifically, the invention relates to immunostimulatory peptides which can stimulate the production of therapeutically beneficial cytokines and, in combination with antibodies against human pathogens such as the immunodeficiency virus (HIV), inhibit replication of such pathogens. The peptides interact synergistically with pathogen-directed antibodies without producing or sustaining serious side-effects such as inflammation, and provide the potential for treatment modalities that are non-specific with respect to pathogen and cell type. Therefore, the peptides of the present invention have wide applicability with respect to medical treatment of pathogen-mediated infections, and the potential to enhance well-being.11-27-2008
20080206268HA-1 epitopes and uses thereof - Peptide sequences constituting T-cell epitopes of minor Histocompatibility antigen, HA-1. HA-1 is associated with Graft versus Host Disease. The peptides and their derivatives find many uses, for instance, in bone marrow transplantation, organ transplantation and in treatment of leukemia and non-hematopoietic tumors. The peptide and/or its derivatives can be incorporated in vaccines, in pharmaceutical formulations and they can be used in diagnostic test kits. HA-1 is expressed by non-hematopoietic tumor cells. While absent in normal epithelial cells, tumor cells and tumor cell lines, particularly from epithelial origin, express HA-1 and are recognized by HA-1 cytotoxic T-cells. The invention provides means and methods for HA-1 specific immunotherapy for HA-1-positive patients with non-hematopoietic tumor cells.08-28-2008
20090004213COMBINATION THERAPY USING ACTIVE IMMUNOTHERAPY - The present invention relates to methods of treating cancer in a mammal comprising administering to the mammal a combination therapy comprising a vaccine and a multi-kinase inhibitor, wherein the vaccine comprises an isolated tumor associated peptide having the ability to bind to a molecule of the human major histocompatibility complex (MHC) class-I or class-II. Preferably the multi-kinase inhibitor is sunitinib malate and/or sorafenib tosylate or a pharmaceutically acceptable salt thereof.01-01-2009
20100209445MUTANT DOUBLE CYCLIZED RECEPTOR PEPTIDES INHIBITING BETA1-ADRENOCEPTOR ANTIBODIES - The present invention relates to novel β-AR homologous cyclopeptide-mutants comprising only two cysteine residues able to form an intramolecular linkage, to linear peptides that can form these cyclopeptide-mutants and to nucleic acid molecules encoding these cyclopeptide-mutants and linear peptides. Moreover, vectors and recombinant host cells comprising said nucleic acid molecule and a method for producing the disclosed cyclopeptide-mutants are provided. Further provided is a composition comprising the peptides, nucleic acid molecules, vectors or host cells of the invention. The present invention also relates to therapeutic and diagnostic means, methods and uses taking advantage of the peptides of the invention and to means, methods and uses for detecting anti-β-adrenergic receptor antibodies like anti-βradrenergic receptor antibodies.08-19-2010
20100209444MAGE3 Polypeptides - The present invention relates to novel MAGE3 polypeptides, including a fragment of MAGE3 fused to an immunological fusion partner, and compositions thereof.08-19-2010
20100209443Vaccine for the Prevention of Breast Cancer Relapse - The invention features methods to induce and maintain a protective cytotoxic T-lymphocyte response to a peptide of the HER2/neu oncogene, E75, with the effect of inducing and maintaining protective or therapeutic immunity against breast cancer in a patient in clinical remission. The methods comprise administering to the patient an effective amount of a vaccine composition comprising a pharmaceutically acceptable carrier, an adjuvant such as recombinant human GM-CSF, and the E75 peptide at an optimized dose and schedule. The methods further comprise administering an annual or semi-annual booster vaccine dose due to declining E75-specific T cell immunity. The invention also features vaccine compositions for use in the methods.08-19-2010
20110268756MODIFIED AMYLOID BETA PEPTIDE - An object of the invention is to provide a peptide based on a sequence of an amyloid β peptide that may allow for induction of enhanced immune response and is safe and efficacious for prophylaxis and treatment of Alzheimer disease. An amyloid β peptide or a portion thereof with addition or insertion of cysteine or a cysteine analogue, and a method for enhancing immune response to amyloid β using said peptide, a medicament for prophylaxis and treatment of Alzheimer disease using said amyloid β peptide that induces an enhanced immune response, and a DNA vaccine comprising a gene coding for an amyloid β peptide or a sequence derived from an amyloid β peptide with addition or insertion of cysteine or a cysteine analogue, as expected to be similarly efficacious.11-03-2011
20100062011Peptide Vaccine for Inducing the Production of Anti-Amyloid -Peptide Antibody - An object of the present invention is to provide a peptide vaccine for preventing and/or treating diseases caused by amyloid β-peptide, such as Alzheimer's disease. The present invention solves the above object by providing a peptide vaccine constructed by inserting a peptide having an amino acid sequence of a cell attachment motif of a cell adhesive molecule to a peptide which consists of a peptide having an amino acid sequence of multiagretope type T-cell epitope, which has been generated immunological memory, or a peptide including the same; an linker peptide; and a peptide having an amino acid sequence of a B cell epitope which is a specific region of amyloid β-peptide or a peptide including the same.03-11-2010
20090130133IMMUNOGENIC POLYPEPTIDE COMPOSED OF TUMOR ANTIGEN-DERIVED OPTIMIZED CRYPTIC PEPTIDES, AND USES THEREOF - The present invention pertains to the field of anti-cancer vaccines. More particularly, the invention concerns an optimized polypeptide, which comprises three cryptic tumor peptides with enhanced immunogenicity and comprises the amino acids sequence YLQVNSLQTVYLEYRQVPVYLEEITGYL, for use in an anti-cancer vaccine. Nucleic acids encoding such a polypeptide, as well as complexes and dendritic cells engineered with this polypeptide or a nucleic acid encoding it, are also part of the invention.05-21-2009
20090092626Compositions and methods for the treatment and prophylaxis of multiple strains and subtypes of HIV-1 - A self-adjuvanting immunogenic composition comprising multiple immunogens, each immunogen comprising a lipopeptide cap, a universal T helper sequence and an immunodominant HIV-1 Tat B cell epitope. The immunogen also comprises one or more linker sequences and/or polar charged amino acid sequences. The HIV-1 Tat B cell epitope of each immunogen has an amino acid sequence of V-D-P-Xaa7-L-Xaa9-P-W-Xaa12-Xaa13-Xaa14-Xaa15-Xaa16-amide SEQ ID NO: 1, in which the amino acid positions at Xaa7, Xaa9 and Xaa12 are selected from specific amino acid residues choices and in which the amino acid positions at Xaa13-Xaa16 may be absent or specific amino acid residue choices. The lipopeptide is a dipalmitoyl-S-glyceryl-cysteine or a tripalmitoyl-S-glyceryl cysteine or N-acetyl (dipalmitoyl-S-glyceryl cysteine), each with an optional neutral amino acid linker. Optional polar sequences of at least four charged polar amino acids enhance solubility of the immunogen and are located at the carboxy terminal end of the lipopeptide cap, optionally flanked by neutral linker amino acids, or elsewhere in the immunogen. In the composition, each immunogen differs from another immunogen by an amino acid variation at amino acid position Xaa7, Xaa9 or Xaa12 of the immunodominant HIV-1 Tat epitope. Such compositions can induce anti-HIV-1 Tat antibodies with geometric mean titers of greater than 1,000,000 on multiple HIV-1 Tat variants, when employed to immunize a subject, without any extrinsic adjuvant.04-09-2009
20090136529Compositions And Methods For Treatment, Research And Therapeutic Applications For Malaria - The present invention provides anti-05-28-2009
20090136527Retro-inverso gonadotropin-releasing hormone peptide and vaccine composition - The invention describes a retro-inverso (RI) gonadotropin-releasing hormone (GnRH) peptide which is capable of eliciting an immune response directed against GnRH, the peptide having the amino acid sequence GPRLGYSWHX, wherein the amino acids are D-amino acids and X is any amino acid. More particularly, X is E, Q, P or G, and even more particularly, X is E or Q. Thus, a preferred amino acid sequence for the peptide is GPRLGYSWHE. The peptide may optionally include one or more additional D-amino acids at its N- or C-terminus, for example a cysteine residue or a series of linker amino acids, such as a plurality of glycine amino acid residues. Thus, a second preferred amino acid sequence for the peptide is GPRLGYSWHEC, which includes a cysteine residue at the C-terminus for conjugation purposes. The invention also describes a vaccine composition for use in controlling fertility, heat, contraception and/or treating sex hormone-related diseases, and a method for controlling and or treating fertility and sex hormone-related diseases.05-28-2009
20120093846PROTEIN FOR THE IMMUNOCASTRATION FOR MAMMALS - Fusion protein for immunocastration (Sequences 1a and 1b) that comprises the primary amino acid sequence of the gonadotrophin-liberating protein fused to a theoretical sequence:04-19-2012
20090136528NOVEL IMMUNOGENIC EPITOPE FOR IMMUNOTHERAPY - The present invention relates to peptides, nucleic acids and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumour-associated T-helper cell peptide epitopes, alone or in combination with other tumour-associated peptides that serve as active pharmaceutical ingredients of vaccine compositions which stimulate anti-tumour immune responses. The present invention relates to novel peptide sequences and their variants derived from HLA class I and class II molecules of human tumour cells which can be used in vaccine compositions for eliciting anti-tumour immune responses.05-28-2009
20090136530Influenza Hemagglutinin and Neuraminidase Variants - Polypeptides, polynucleotides, methods, compositions, and vaccines comprising (avian pandemic) influenza hemagglutinin and neuraminidase variants are provided.05-28-2009
20090186042IDENTIFICATION AND USE OF NOVOPEPTIDES FOR THE TREATMENT OF CANCER - Disclosed are compositions relating to novopeptides identified by the presence of frameshift mutations in tumor genes previously not identified as being oncogenic. The disclosed peptides can be used in the disclosed methods for the treatment of cancer.07-23-2009
20090186044TYPE IV COLLAGEN-LIKE IMMUNOREACTIVE PEPTIDE - A type IV collagen-like immunoreactive peptide and an antibody thereof which are useful for detecting nephritis, a method for selecting a type IV collagen-like immunoreactive peptide, a method for screening an immunoreactive antibody and an immunoreactive peptide, a nephritis model, a method for detecting chronic nephritis, a vaccine, and a therapeutic agent for nephritis are provided.07-23-2009
20090060930Enhanced immunogenicity of tumor associated antigens by addition of alphaGal epitopes - The invention relates to methods and compositions for causing the selective targeting and killing of tumor cells. The present invention describes prophylactic or therapeutic cancer vaccines based on purified TAA proteins or TAA-derived synthetic peptides altered by chemical, enzymatic or chemo-enzymatic methods to introduce αGal epitopes or αGal glycomimetic epitopes, in order to allow for enhanced opsonization of the antigen by natural anti-αGal antibodies to stimulate TAA capture and presentation, thereby inducing a humoral and cellular immune response to the TAA expressed by a tumor. The animal's immune system thus is stimulated to produce tumor specific cytotoxic cells and antibodies which will attack and kill tumor cells present in the animal.03-05-2009
20090252753IMMUNOMODULATION FOR AUTOIMMUNE TYPE-2 DIABETES - The present invention regards methods and formulations for the treatment of diabetes and the prevention of autoimmune diabetes. The invention includes the administration of human recombinant GAD65 protein in a pharmaceutically acceptable adjuvant.10-08-2009
20090252752KDR PEPTIDES AND VACCINES COMPRISING THE SAME - The present invention provides nonapeptides selected from peptides comprising the amino acid sequence of SEQ ID NO:2, 3, 5, 8, 11, or 12; nonapeptides or decapeptides selected from peptides comprising the amino acid sequence of SEQ ID NO:29, 30, 33, 34, 40, or 46; and peptides with cytotoxic T cell inducibility, in which one, two, or several amino acids are substituted or added to the above-mentioned amino acid sequences, as well as pharmaceuticals for treating or preventing tumors, where the pharmaceuticals comprise these peptides. The peptides of this invention can be used as vaccines.10-08-2009
20080317772COMPOUNDS AND METHODS FOR TREATMENT AND DIAGNOSIS OF CHLAMYDIAL INFECTION - Compounds and methods for the diagnosis and treatment of Chlamydial infection are disclosed. The compounds provided include polypeptides that contain at least one antigenic portion of a 12-25-2008
20130122028NOVEL VACCINE THAT TARGETS TUMOR VESSELS AS AN EFFICIENT TOOL IN TUMOR THERAPY - The invention relates to a composition for the treatment of various cancers. The composition is a vaccine containing sequences of EDB, EDA, annexin A1, endosialin, C domain of tenascin C or magic roundabout (MR) or fragments thereof as single or in a combination coupled to one or several heterologous foreign carrier molecules. The vaccine will produce antibodies that are directed against self proteins which are preferentially expressed in and around tumor vessels. The vaccine is preferably administrated together with an adjuvant.05-16-2013
20130122029CANCER VACCINE - The present invention is directed to provide a cancer vaccine used for preventing and treating cancers. Provided are a peptide consisting of a sequence of SEQ ID No. 1 (KMHIRSHTL) or SEQ ID No. 2 (RTFSRMSLL) and capable of efficiently inducing cancer immunity, an antigen-presenting cell presenting this peptide on its cell surface, a T cell induced by this antigen-presenting cell as well as a cancer vaccine containing these peptides, an expression vector capable of expressing either of these peptides, the antigen-presenting cell presenting either of these peptides or the T cell induced by the antigen-presenting cell, and a method of treating and preventing cancers using the cancer vaccine.05-16-2013
20130122030S. EPIDERMIDIS ANTIGENS - Hyperimmune serum reactive antigens and fragments thereof are disclosed. In addition, methods for isolating such antigens and specific uses thereof, including the treatment of 05-16-2013
20130122031HMGB1-DERIVED PEPTIDES ENHANCE IMMUNE RESPONSE TO ANTIGENS - The invention provides an immunostimulatory peptide containing the amino acid sequence SAFFLFCSE and uses thereof.05-16-2013
20110142867IMMUNOTHERAPEUTIC METHODS AND SYSTEMS - Methods for desensitising an individual to a selected polypeptide antigen are provided. The methods entail administration of T cell epitope containing peptides from a polypeptide antigen in such a way as to establish a tolergeneic environment, that is, a state of hyporesponsiveness to the peptides. The selected polypeptide antigen is then administered such that the state of hyporesponsiveness and co-administration of the selected antigen are sufficient to desensitise the individual to the polypeptide antigen. Also provided are therapeutic systems useful in the methods of the invention, and the use of polypeptide antigens and peptides in the manufacture of medicaments in the methods of the invention.06-16-2011
20090087445Method for the Redox Potential-Dependent Detection of Target Molecules by Interacting Polypeptides - The invention primarily relates to an amino acid sequence EKKEQKEKEK KEQEIKKKFK LTGPIQVIHL AKACCDVKGG KNELSFKQGE QIEIIRITDN PEGKWLGRTA RGSYGYIKTT AVEIDYDSLK LKKD (=SEQ ID NO 1), a protein recognition domain comprising said amino acid sequence, the use of said amino acid sequence or protein recognition domain for identifying redox-dependent protein-protein or protein-lipid interactions, and to a method for the redox potential dependent detection of target molecules; the invention also relates to the use of said amino acid sequence as a marker for measuring the redox potential in cells.04-02-2009
20090053255Anti-arthropod vector vaccines, methods of selecting and uses thereof - The present invention provides methods of selecting and uses of anti-arthropod vector vaccines to prevent Leishmaniasis. The present invention also provides compositions for vaccines to prevent Leishmaniasis.02-26-2009
20090053254RECOMBINANT HUMAN ALPHA-FETOPROTEIN AS AN IMMUNOSUPPRESSIVE AGENT - Disclosed are methods of inhibiting autoreactive immune cell proliferation in a mammal, involving administering to the mammal a therapeutically effective amount of recombinant human alpha-fetoprotein or an immune cell anti-proliferative fragment or analog thereof.02-26-2009
20100297160High Molecular Weight Amyloid Beta As a Carrier for the Oral Delivery of Vaccine Antigens - Compositions and methods are provided for stabilizing polypeptide antigens such as amyloid-beta (Aβ) to produce vaccines for oral delivery. One embodiment provides an immunogenic polypeptide complex of Aβ11-25-2010
20090081246METHOD FOR ISOLATING HEPATITIS C VIRUS PEPTIDES - Described are methods for isolating Hepatitis C Virus peptides (HPs) that have a binding capacity to a MHC/HLA molecule or a complex comprising the HCV-peptide and the MHC/HLA molecule. In one aspect, these methods include providing a pool of HCV-peptide, said pool containing HCV-peptides which bind to said MHC/HLA molecule and HCV-peptides which do not bind to said MHC/HLA molecule, contacting said MHC/HLA molecule with said pool of HCV-peptides whereby a HCV-peptide which has a binding capacity to said MHC/HLA molecule binds to said MHC/HLA molecule and a complex comprising said HCV-peptide and said MHC/HLA molecule is formed, detecting and optionally separating said complex from the HCV-peptide which do not bind to said MHC/HLA molecule and optionally isolating and characterizing the HCV-peptide from said complex. Also described are immunogenic compositions that stimulate a specific T cell response to hepatitis C virus when administered to a subject in an effective amount.03-26-2009
20110142865Tumor-associated Peptides Binding Promiscuously to Human Leukocyte Antigen (HLA) Class II Molecules - The present invention relates to immunotherapeutic methods, and molecules and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumour-associated T-helper cell peptide epitopes, alone or in combination with other tumour-associated peptides, that serve as active pharmaceutical ingredients of vaccine compositions which stimulate anti-tumour immune responses. In particular, the present invention relates to 49 novel peptide sequences derived from HLA class II molecules of human tumour cell lines which can be used in vaccine compositions for eliciting anti-tumour immune responses.06-16-2011
20110229506METHOD FOR CANCER IMMUNOTHERAPY - A novel compound of the formula (1):09-22-2011
20120288513Means for the inhibition of anti-beta1-adrenergic receptor antibodies - Embodiments of the present invention provide for novel peptides of use for detection and/or inhibition of anti-β1-adrenergic receptor antibodies. Certain embodiments concern uses of cyclic and/or linear peptides. In other embodiments, the present invention relates to novel peptides of use in diagnostic and/or pharmaceutical compositions. Some embodiments concern diagnosing and/or treating cardiac conditions. Cardiac conditions of the instant invention can concern infectious heart disease, non-infectious heart disease, ischemic heart disease, non-ischemic heart disease, inflammatory heart disease, myocarditis, cardiac dilatation, idiopathic cardiomyopathy, idiopathic dilated cardiomyopathy, immune-cardiomyopathy, heart failure, and any cardiac arrhythmia condition.11-15-2012
20110229505Methods for the diagnosis and treatment of cancer based on AVL9 - The present invention relates to methods for the diagnosis and treatment of cancer in mammals, in particular gastric cancer, based on the new target AVL9. The present invention thus relates to diagnostic methods and related components to be used in such methods. Furthermore, the present invention relates to the treatment of cancer in mammals, in particular gastric cancer, based on AVL9 as a target. Specifically, the present invention relates to the immunotherapy of cancer using AVL9 tumor-associated cytotoxic T cell (CTL) peptide epitopes, alone or in combination with other tumor-associated peptides, and respective pharmaceutical compositions, in particular vaccine compositions.09-22-2011
20110229504Novel immunotherapy against several tumors including gastrointestinal and gastric cancer - The present invention relates to peptides, nucleic acids and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumor-associated cytotoxic T cell (CTL) peptide epitopes, alone or in combination with other tumor-associated peptides that serve as active pharmaceutical ingredients of vaccine compositions that stimulate anti-tumor immune responses. The present invention relates to 95 novel peptide sequences and their variants derived from HLA class I molecules of human tumor cells that can be used in vaccine compositions for eliciting anti-tumor immune responses.09-22-2011
20110229503Vaccination against malignant melanoma using bcg and/or vaccinia - The present invention relates to a vaccination which reduces the risk to contract melanoma to about half to third and moreover, within a five year period post diagnosis of malignant melanoma the risk to die is reduced to about half as compared to the non-vaccinated individuals.09-22-2011
20080233139COMPOSITIONS AND METHODS FOR THE THERAPY AND DIAGNOSIS OF PROSTATE CANCER - Compositions and methods for the therapy and diagnosis of cancer, particularly prostate cancer, are disclosed. Illustrative compositions comprise one or more prostate-specific polypeptides, immunogenic portions thereof, polynucleotides that encode such polypeptides, antigen presenting cell that expresses such polypeptides, and T cells that are specific for cells expressing such polypeptides. The disclosed compositions are useful, for example, in the diagnosis, prevention and/or treatment of diseases, particularly prostate cancer.09-25-2008
20090004214Cd4+ Survivin Epitopes and Uses Thereof - The invention concerns CD4+ T survivin epitopes and their vaccine and diagnostic uses.01-01-2009
20090220532Agents and methods based on the use of the eda domian of fibronectin - This invention relates to the use of a polypeptide in the production of an immunostimulatory agent, said polypeptide comprising a sequence corresponding to the EDA domain of fibronectin, a fragment of the EDA domain which can bind to TLR4 or a variant of said EDA domain or a fragment which can bind to TLR4 and which has a homology of more than 70% with any form or natural fragment of the EDA domain. The invention also relates to the production methods and applications of said agent.09-03-2009
20090220533Novel T-Helper Antigenic Determinant (THD) Peptides - The invention relates to a chimeric peptide, which can bind to at least one allelic form of the HLA-DR molecule. The invention also relates to a pharmaceutical composition containing said peptide, as well as to the different uses of same.09-03-2009
20080260762HLA binding motifs and peptides and their uses - The present invention provides the means and methods for selecting immunogenic peptides and the immunogenic peptide compositions capable of specifically binding glycoproteins encoded by HLA alleles and inducing T cell activation in T cells restricted by the allele. The peptides are useful to elicit an immune response against a desired antigen.10-23-2008
20080260761Compositions, Splice Variants and Methods Relating to Cancer Specific Genes and Proteins - The present invention relates to newly identified nucleic acid molecules and polypeptides present in normal and neoplastic ovarian cells, including fragments, variants and derivatives of the nucleic acids and polypeptides. The present invention also relates to antibodies to the polypeptides of the invention, as well as agonists and antagonists of the polypeptides of the invention. The invention also relates to compositions containing the nucleic acid molecules, polypeptides, antibodies, agonists and antagonists of the invention and methods for the use of these compositions. These uses include identifying, diagnosing, monitoring, staging, imaging and treating ovarian cancer and non-cancerous disease states in ovarian, identifying ovarian tissue, monitoring and identifying and/or designing agonists and antagonists of polypeptides of the invention. The uses also include gene therapy, production of transgenic animals and cells, and production of engineered ovarian tissue for treatment and research.10-23-2008
20080260760Prostate-Specific Antigen-Derived Mhc Class H-Restricted Peptides and Their Use in Vaccines to Treat or Prevent Prostate Cancer - The present invention relates to immunogenic peptides derived from human prostate cancer antigen (PSA-derived peptides) and their use as vaccines to treat or prevent prostate cancer. The invention is also related to dendritic cells from a patient having prostate cancer, which dendritic cells have been exposed to one or more PSA-derived peptides, and their use to treat or prevent prostate cancer in the patient. The invention is also directed to T-cells from a patient which cells are specific for PSA-activated peptide(s), and their uses to treat or prevent prostate cancer.10-23-2008
20090258031IMMUNOSUPPRESSIVE POLYPEPTIDES AND NUCLEIC ACIDS - The invention provides immunosuppressive polypeptides and nucleic acids encoding such polypeptides. In one aspect, the invention provides mutant CTLA-4 polypeptides and nucleic acids encoding mutant CTLA-4 polypeptides. Compositions and methods for utilizing such polypeptides and nucleic acids are also provided.10-15-2009
20090130129Melanoma-associated endogenous retrovirus (MERV) derived peptide sequences and their therapeutic/diagnostic use - The present invention provides antigenic polypeptides derived from the melanoma-associated endogenous retrovirus (MERV). These antigens are useful compounds for the detection of cancerous cells and melanoma-diagnosis as well as melanoma-prognosis. Furthermore these antigenic polypeptides of the present invention form the basis for anti-cancer vaccines.05-21-2009
20120034252COMPOSITIONS AND METHODS FOR INDUCING AN IMMUNE RESPONSE - The present invention provides compositions and methods for inducing an immune response in a subject. In particular, the present invention provides compositions comprising immunostimulatory ligands (ISL) and methods of inducing an immune response in a subject therewith. Compositions and methods of the present invention find use in, among other things, clinical (e.g. therapeutic and preventative medicine (e.g., vaccination)) and research applications.02-09-2012
20120141516COMPOSITIONS AND METHODS FOR INDUCING AN IMMUNE RESPONSE - The present invention provides compositions and methods for inducing an immune response in a subject. In particular, the present invention provides compositions comprising immunostimulatory ligands (ISL) and methods of inducing an immune response in a subject therewith. Compositions and methods of the present invention find use in, among other things, clinical (e.g. therapeutic and preventative medicine (e.g., vaccination)) and research applications.06-07-2012
20100183645ACTIVE OR PASSIVE IMMUNIZATION AGAINST PROAPOPTOTIC NEUROTROPHINS FOR THE TREATMENT AND/OR PREVENTION OF NEURODEGENERATIVE DISEASES - The present invention relates to novel methods for combating cell degeneration or dysfunction resulting from neuroinflammatory conditions. The invention especially relates to the use, in the preparation of a medicament for the treatment of neurodegenerative disease associated with neuroinflammation, of an immunogenic compound which is capable of inducing an immune response against a proapoptotic neurotrophin, or an effective amount of a hapten combined with appropriate carriers and/or adjuvants to render the resulting combination capable of inducing an immune response against a proapoptotic neurotrophin. Also disclosed are compositions for the active or passive immunization against neuronal or glial cell apoptosis caused by neuroinflammation as well as methods and means useful for said active or passive immunization.07-22-2010
20090117138VACCINE FOR A THERAPEUTIC OR A PROPHYLACTIC TREATMENT OF MYASTHENIA GRAVIS - Complementary peptide having at least a sequence complementary to a major immunogenic region of an acetylcholine receptor involved in myasthenia gravis, characterized in that the complementary peptide has at least a sequence SEQ. ID. NO1 with a tryptophan in position 8, carrying at least one optionally substituted hydrocarbon group. Therapeutic composition comprising the Complementary peptide according to the invention and use thereof for manufacturing a vaccine to be used in a therapeutic or prophylactic treatment of myasthenia gravis in mammals.05-07-2009
20090117137PEPTIDE EPITOPES OF APOLIPOPROTEIN B - The present invention relates to antibodies raised against fragments of apolipoprotein B, in particular defined peptides thereof, for immunization or therapeutic treatment of mammals, including humans, against ischemic cardiovascular diseases, using one or more of said antibodies.05-07-2009
20090117136Recombinant allergen - Dander from the domestic cat (05-07-2009
20100183646MAGE-A3/HPV 16 PEPTIDE VACCINES FOR HEAD AND NECK CANCER - The present invention relates to Trojan antigens, and immunogenic compositions comprising the Trojan antigens. The present invention also relates to methods of generating an immune response in a subject using the Trojan antigens or immunogenic compositions. The present invention further relates to methods of treating squamous cell carcinoma of the head and neck (SCCHN) using the Trojan antigens and immunogenic compositions of the present invention.07-22-2010
20100303843RECOMBINANT ALLERGEN WITH REDUCED lgE BINDING BUT UNDIMINISHED T-CELL ANTIGENICITY - The present invention relates generally to reagents useful in the immunotherapeutic or immunoprophylactic treatment of allergic diseases. More particularly, the present invention provides modified allergens exhibiting reduced IgE interactivity including reduced IgE production-stimulatory activity, while retaining T-cell antigenicity, which are useful in the immunomodulation of type I allergic disease conditions. The present invention further contemplates a method of immunomodulation of allergic diseases such as type I allergic disease conditions by the administration of modified allergens exhibiting reduced IgE interactivity while retaining T-cell antigenicity.12-02-2010
20100015169Tumor Antigens - Tumor antigen peptides that induce CTL from peripheral blood mononuclear cells of a patient with prostate cancer in an HLA-A2-restricted or an HLA-A24-restricted manner were identified based on the amino acid sequences of PSA, PSM, and PSCA, which are proteins known as markers of prostate cancer. Also disclosed is a peptide having a function as a tumor antigen that is recognized by HLA-A2-restricted CTL or HLA-A24-restricted CTL, an antibody against the peptide, a compound having interaction with the peptide, an agent for inducing CTL that includes the peptide, a pharmaceutical composition that includes one or more thereof, a method for identifying a compound that has interaction with the peptide, a method for inducing CTL using the peptide, a method for measuring the peptide and the antibody, as well as a reagent kit used for the identification method or the measurement method.01-21-2010
20100221273TREATMENT OF VIRAL INFECTIONS - The present invention concerns polypeptides derived from a tandem repeat of apoE09-02-2010
20100255020METHOD FOR INDUCING CYTOTOXIC T-CELLS, CYTOTOXIC T-CELL INDUCERS, AND PHARMACEUTICAL COMPOSITIONS AND VACCINES EMPLOYING THEM - A method for inducing cytotoxic T-cells is provided that includes binding to an HLA molecule on the surface of a cell that is a target of a cytotoxic T-cell, a peptide containing one or more types of amino acid sequence selected from the group consisting of SEQ ID NOS: 1, 2, and 3 and composed of not less than 8 and not more than 11 amino acid residues, or a peptide derived from a precursor thereof.10-07-2010
20130216563Immunogenic Polypeptides Encoded by MAGE Minigenes and Uses Thereof - The invention discloses immunogenic polypeptides comprising several MAGE-specific antigen epitopes selected from different (i.e. discrete) members of the MAGE protein family, nucleic acids coding therefor, recombinant viruses and/or cells comprising said nucleic acids, and compositions thereof. Methods for eliciting or inducing MAGE-specific immune responses utilizing the aforementioned immunogenic agents are also disclosed.08-22-2013
20130216564Immunogenic Epitopes, Peptidomimetics, And Anti-Peptide Antibodies, And Methods of Their Use - Provided herein are compositions and methods for the treatment of cancers. The compositions comprise at least one VEGF peptide mimic, HER-2 epitope, immunogenic VEGF peptides, and HER-2 immunogenic epitopes. The peptides and epitopes may be linear, cyclized, retro-inverso, or a combination of such forms. Also provided herein are antibodies raised to VEGF peptide mimics, HER-2 epitopes, immunogenic VEGF peptides, and HER-2 immunogenic epitopes.08-22-2013
20100239599Vaccine Peptide Combinations Against Cat Allergy - The present invention relates to compositions comprising peptides for preventing or treating allergy to cats, and in particular to optimal combinations of peptides.09-23-2010
20120141517NOVEL IMMUNOTHERAPY AGAINST SEVERAL TUMORS INCLUDING NEURONAL AND BRAIN TUMORS - The present invention relates to peptides, nucleic acids and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumor-associated cytotoxic T cell (CTL) peptide epitopes, alone or in combination with other tumor-associated peptides that serve as active pharmaceutical ingredients of vaccine compositions that stimulate anti-tumor immune responses. The present invention relates to 30 peptide sequences and their variants derived from HLA class I and class II molecules of human tumor cells that can be used in vaccine compositions for eliciting anti-tumor immune responses.06-07-2012
20120141515Ig-pCONSENSUS GENE VACCINATION PROTECTS FROM ANTIBODY-DEPENDENT IMMUNE PATHOLOGY IN AUTOIMMUNE DISEASE - The disclosure provides methods and compositions useful for treating autoimmune diseases and disorders. For example, the disclosure demonstrates that hypergammaglobulinemia and subsequent accelerated kidney disease can be suppressed by Ig minigene-induced CD806-07-2012
20120195918METHOD OF TREATING CANCER WITH AN HLA-A*3303-RESTRICTED WT1 PEPTIDE AND PHARMACEUTICAL COMPOSITION COMPRISING THE SAME - Disclosed are: a peptide comprising an amino acid sequence composed of contiguous nine amino acid residues derived from a WT1 protein, wherein an amino acid residue at position 2 in the amino acid sequence is selected from the group consisting of Ala, Ile, Leu, Val, Phe, Tyr, Ser and Asp and an amino acid residue at position 9 in the amino acid sequence is Arg; a polynucleotide encoding the peptide; a pharmaceutical composition comprising the peptide; and others.08-02-2012
20090074801HYPOALLERGENIC ALLERGY VACCINES BASED ON THE TIMOTHY GRASS POLLEN ALLERGEN PHL P 7 - The present invention pertains to polypeptides derived from the timothy grass pollen allergen Phl p 7. The polypeptides display reduced allergen activity and are useful as allergy vaccines for the treatment of sensitized allergic patients and for prophylactic vaccination.03-19-2009
20100055119PEPTIDES SEQUENCES AND COMPOSITIONS - Provided is a polypeptide having no more than 100 amino acids, which polypeptide comprises one or more sequences having at least 60% homology with any of SEQ ID 1-4, or comprises two or more epitopes having 7 amino acids or more, each epitope having at least 60% homology with a sub-sequence of any of SEQ ID 1-4 that has the same length as the epitope:03-04-2010
20100221272IMMUNOMODULATORY COMPOSITIONS AND METHODS FOR TREATING DISEASE WITH MODIFIED HOST DEFENSE PEPTIDES - Compositions and methods are provided for modulating an immune response in a vertebrate subject. Compositions and methods can comprise administering a modified host defense peptide to the vertebrate subject in an amount effective to activate the immune response in the vertebrate subject, wherein the modified host defense peptide is inverted in amino acid sequence from an amino terminus to a carboxy terminus or modified to one or more D-amino acids, or both modifications, when compared to a host defense peptide. Compositions and methods are provided which comprise administering a modified host defense peptide to the vertebrate subject in an amount effective to modify an immune response in the vertebrate subject.09-02-2010
20100196407TICK GALECTIN - A novel galectin, a polynucleotide encoding the same, a vector and a transformant comprising the polynucleotide, an antibody against the galectin, and a screening method for screening a substance capable of modifying the galectin, are disclosed. According to the galectin, polynucleotide, or vector, it is possible, for example, to exterminate ticks, or to treat or prevent tick-borne infections such as rickettsiosis, filariasis, Q fever, African recurrent fever, or viral encephalitis.08-05-2010
20090274715TICK CHITINASE - A novel chitinase, a polynucleotide encoding the same, a vector and a transformant comprising the polynucleotide, an antibody against the chitinase, and a screening method for screening a substance capable of modifying the chitinase, are disclosed. According to the chitinase, polynucleotide, or vector, it is possible, for example, to exterminate ticks, or to treat or prevent tick-borne infections such as piroplasmosis, Q fever, or viral encephalitis.11-05-2009
20090324629CHLORAMPHENICOL ACETYL TRANSFERASE (CAT)-DEFECTIVE SOMATOSTATIN FUSION PROTEIN AND USES THEREOF - Chimeric somatostatin-based polypeptides, polynucleotides used to encode the polypeptides, the methods for isolating and producing the polypeptides and the uses thereof are provided. In addition, low cost adjuvants for enhanced immunogenic response are provided. Vaccinations that include both chimeric somatostatin-based polypeptides and novel adjuvants are included, useful in facilitating farm animal productivity.12-31-2009
20080279876USE OF A PCV2 IMMUNOGENIC COMPOSITION FOR LESSENING CLINICAL SYMPTOMS IN PIGS - The present invention relates to the use of an immunogenic composition that comprises a porcine circovirus type 2 (PCV2) antigen for treatment of several clinical manifestations (diseases). Preferably, the clinical manifestations are associated with a PCV2 infection. Preferably, they include lymphadenopathy, lymphoid depletion and/or multinucleated/giant histiocytes. Moreover, the clinical symptoms include lymphadenopathy in combination with one or a multiple of the following symptoms in pigs: (1) interstitial pneumonia with interlobular edema, (2) cutaneous pallor or icterus, (3) mottled atrophic livers, (4) gastric ulcers, (5) nephritis and (6) reproductive disorders, e.g. abortion, stillbirths, mummies, etc. Furthermore the clinical symptoms include Pia like lesions, normally known to be associated with Lawsonia intracellularis infections.11-13-2008
20090186043Method and compositions for preventing and treating streptococcus pneumoniae infection - A method of preventing and/or treating 07-23-2009
20080305121Agents for Regulating the Activity of Interferon-Producing Cells - The present invention provides agents for regulating the activity of interferon-producing cells (IPCs), which comprise as active ingredients antibodies that bind to BST2 and/or to its homologues, and methods for regulating IPC activity that use these antibodies. According to the present invention, the ability of IPCs to produce interferons (IFNs) and the number of cells can be directly regulated. The present invention also provides uses of BST2 and/or its homologues as markers for IPC activation. Compounds that regulate IPC activation can be screened using the markers for IPC activation.12-11-2008
20110129488IMMUNOTHERAPY COMPOSITIONS FOR THE TREATMENT AND PREVENTION OF AMYLOIDOSIS - The invention relates to immunogenic peptide sequences and antibodies against said immunogenic agents for treating, preventing and/or diagnosing in human and non-human mammals a disease which is characterized by amyloid deposition, including involutive depression, confusional syndrome, dysthymia and cognitive Dysfunction Syndrome (CDS) in non-human mammals and different amyloidosis, including Alzheimer's disease in humans. Moreover, the invention provides diagnostic methods for the above diseases using the antibodies of the invention.06-02-2011
20100297159THOMSEN-FRIEDENREICH DISACCHARIDE MODIFIED IMMUNOGEN (TFD), PREPARATION PROCEDURE, COMPOSITIONS COMPRISING IT, USES, AND TREATMENT METHODS - Modified Thomsen-Friedenreich disaccharide (TFD) immunogen, preparation procedure, compositions containing it, uses, and treatment methods. More specifically, the present invention refers to a immunogen obtained by modifying TFD, and comprising the general formula D-TFD-Lys(n)-C, wherein D is a hydrophobic terminal residue, TFD is disaccharide Galβ3GalNAcα; Lys(n) is a lysine connector, and n is an integer between 1 and 5, and C is a carrier. In a preferred embodiment, the modified invention immunogen comprises the general formula BzlαTFD-Lys5-KLHs, wherein Bzl is benzyl, TFD is disaccharide Galβ3GalNAcα; Lys5 is penta-lysine, and KLHs is succinilated Keyhole limpets hemocyanin.11-25-2010
20130129759PEPTIDE VACCINES FOR CANCERS EXPRESSING MPHOSPH1 OR DEPDC1 POLYPEPTIDES - The present invention provides peptides having an amino acid sequence as set forth in SEQ ID NO: 7, 8, 9, 10, 11, 12, 192, 195, 197, 209, 225, 226, 228, 230, 240, 241, 243, 244, 249, 253, 254 or 255, as well as peptides having the above-mentioned amino acid sequences in which 1, 2, or several amino acids are substituted, deleted, or added, wherein the peptides possess cytotoxic T cell inducibility. The present invention also provides drugs for treating or preventing a disease associated with the over-expression of MPHOSPH1 and/or DEPDC1, e.g. cancers, containing these peptides as an active ingredient. The peptides of the present invention can also be used as vaccines.05-23-2013
20130129760Polypeptides - A polypeptide comprising the sequence of SEQ. ID NO. 2, 3, 4, 7 or 8. The polypeptide may have the sequence of an immunogenic fragment thereof comprising at least eight amino acids, wherein the immunogenic fragment is not one of SEQ. ID NOS. 6 or 11 to 16. The polypeptide may have a sequence having at least 80% sequence identity to the aforementioned polypeptide or immunogenic fragment. The polypeptide is less than 100 amino acids in length and does not comprise the sequence of any of SEQ. ID NOS. 10, 46, 56, 57 or 59 to 62 and does not consist of the sequence of SEQ ID NO. 58. The polypeptide is useful in the treatment or prophylaxis of cancer.05-23-2013
20100297158ANTICANCER VACCINE AND DIAGNOSTIC METHODS AND REAGENTS - The invention provides a method for vaccinating a patient against a malignancy comprising introducing a protein or peptide comprising of all or an immunogenic fragment of a cyclin protein into the patient. The invention further provides a method of identifying tumor antigens.11-25-2010
20100297157VACCINE THERAPY FOR CHOROIDAL NEOVASCULARIZATION - The present inventors administered a peptide derived from VEGFR-2, which is known as one of the proteins involved in neovascularization, to model mice (A2/Kb transgenic mice) expressing human HLA-A*0201, and tested whether or not the peptide has vaccine effect. As a result, the present inventors successfully discovered that vaccination using this peptide as an antigen is effective for inhibition of choroid neovascularization, and thereby completed the present invention. More specifically, the present invention provides vaccines for treatment and/or prevention of diseases caused by choroid neovascularization (neovascular maculopathy), which contain a VEGFR-2-derived peptide as an active ingredient.11-25-2010
20110117116NUCLEIC ACIDS ENCODING A HOUSE DUST MITE ALLERGEN, DER P III, AND USES THEREFOR - Isolated nucleic acids encoding an allergen of 05-19-2011
20100303845NOVEL GENE EXPRESSED IN PROSTATE CANCER - A novel testis-specific gene expressed in human prostate cancer, designated 22P4F11, is described. Analysis of 22P4F11 mRNA expression in normal prostate, prostate tumor xenografts, and a variety of normal tissues indicates that the expression of this gene is testis specific in normal tissues. The 22P4F11 gene is also expressed in human prostate tumors, in some cases at high levels. A full length cDNA encoding 22P4F11 is provided. The 22P4F11 transcript and/or protein may represent a useful diagnostic marker and/or therapeutic target for prostate cancer.12-02-2010
20120244173Compositions and Methods for Enhancing Antigen-Specific Immune Responses - Methods for treating or preventing recurrence of hyper proliferating diseases, e.g., cancer, are described. A method may comprise priming a mammal by administering to the mammal an effective amount of a nucleic acid composition encoding an antigen or a biologically active homo log thereof and boosting the mammal by administering to the mammal an effective amount of an oncolytic virus comprising a nucleic acid encoding the antigen or the biologically active homolog thereof.09-27-2012
20090214580Peptide mixtures with immunomodulatory activity - The present invention is related to complex peptide mixtures with immunomodulatory effects and methods for their use. The invention is further directed toward treatments of diseases through the modulation of the immune system with complex peptide mixtures. The invention is also directed to methods for improving the characteristics of complex peptide mixtures.08-27-2009
20100310590HYPOALLERGENIC VARIANTS OF THE MAJOR ALLERGEN FROM BETULA VERRUCOSA POLLEN - The invention provides hypoallergenic variants of Bet v 2 major allergen from 12-09-2010
20100172923Protein Composition for Inducing an Immune Response in a Vertebrate Comprising a Plurality of Protein Variants Covering the Heterogeneity of a Single Antigen, AMA1 - The present invention relates to a protein composition suitable for inducing an immune response in a vertebrate comprising 2 to 10 protein variants of a single antigen, which is the APICAL MEMBRANE ANTIGEN 1 (PfAMA1 OR AMA1) of a 07-08-2010
20110110964IMMUNOGENIC PEPTIDES AND THEIR USE IN TRANSPLANTATION - The present invention relates to the use of immunogenic peptides comprising a T-cell epitope derived from an allograft antigen and a redox motif such as C—(X)2-[CST] or [CST]-(X)2-C in the prevention and/or treatment of allograft rejection and in the manufacture of medicaments therefore.05-12-2011
20110129487PLASMIC PRODUCTION AND EXPRESSION OF RECOMBINANT PROTEINS IN CELLS GROWN WITHOUT ANTIBIOTICS - The invention relates to a mutated cell such as a bacteria or yeast in which the thyA gene coding thymidylate synthase includes a nonsense codon, preferably the amber codon, said nonsense codon replacing a codon coding an amino acid and inducing the interruption of thyA gene translation and the auxotrophy of the cell for the thymidine. Advantageously, the endA gene coding the endonuclease 1 and/or the recA gene coding the recombinase is inactivated in said mutated cell. The invention also relates to an expression plasmid including a transgene and a sequence of a suppressing ARM structural gene containing an anticodon that can be paired with the nonsense codon of the thyA gene and is specific of an amino acid capable of restoring the translation of the mutated thyA gene and thereby obtaining a protein of the wild or mutated type having a thymidylate synthase activity. The invention also relates to a method for the multiplication of the expression plasmid.06-02-2011
20090068211IMMUNOGENICALLY-ENHANCED POLYPEPTIDES AND RELATED METHODS - Described herein are immunogenically-enhanced polypeptides, such as KSHV LANA1 polypeptides, related methods of eliciting an immune response to the polypeptides and related nucleotide sequences. Also described herein are novel polypeptides capable of inhibiting degradation and/or retarding synthesis of a protein when attached to or incorporated within that protein along with related methods and nucleotide sequences.03-12-2009
20110243972PROSTATE STEM CELL ANTIGEN VACCINES AND USES THEREOF - This invention relates to the identification of prostate stem cell antigen (PSCA) as a target of clinically relevant antitumor immune responses. The invention provides vaccines comprising PSCA, or fragments thereof, which are useful in inducing antitumor immune responses, including PSCA specific CD8+ T cell responses. Methods of using the compositions to treat cancer are also provided. The invention further provides methods of identifying compounds useful in antitumor vaccines and methods of assessing the responses of patients to cancer immunotherapy.10-06-2011
20100183642NOVEL MULTIMERIC CD40 LIGANDS, METHOD FOR PREPARING SAME AND USE THEREOF FOR PREPARING DRUGS - The invention concerns a compound of formula (I), wherein Y represents a macrocycle whereof the cycle comprises 9 to 36 atoms, and is functionalized by three amine or COOH functions; R07-22-2010
20110110965COMPOSITIONS THAT INDUCE T CELL HELP - The present invention relates, at least in part, to compositions, and related methods, comprising MHC II binding peptides. In one embodiment, the MHC II binding peptides comprise a peptide having at least 70% identity to a natural HLA-DP binding peptide, HLA-DQ binding peptide, or HLA-DR binding peptide.05-12-2011
20110110963GENE ENCODING LABYRINTHIN, A MARKER FOR CANCER - A cDNA molecule that encodes a protein designated Labyrinthin (Lab) isolated and its nucleotide sequence is determined. The protein, or peptides derived from the protein, are markers useful to define novel classes of cancers. Diagnostic assays for these cancers use antibodies to Lab or nucleotide probes that hybridize with the lab gene or a fragment therefrom. Vaccines useful either to prevent recurrence of cancers in subjects who test positive for Lab (or lab), or to prevent initial occurrence of cancer, use proteins or peptides derived from Lab. Expression of Lab via immunogenic assays is used to monitor effects of cancer treatments. Antisense molecules against lab are used in treatments. Sense molecules of lab are used to restore lost lab function in diseased normal cells, for example, gland cells.05-12-2011
20100021487VACCINES AND METHODS FOR CONTROLLING ADIPOSITY - The invention features immunoconjugates for impeding weight gain and treating obesity in a subject. The immuno-conjugates comprise particular ghrelin polypeptides and a suitable carrier moiety.01-28-2010
20110033487VACCINES AND DIAGNOSTICS FOR THE EHRLICHIOSES - The present invention concerns VLPT immunoreactive compositions for 02-10-2011
20110117115Method and vaccine comprising copolymer 1 for treatment of psychiatric disorders - Copolymer 1, a Copolymer 1-related peptide, a Copolymer 1-related polypeptide, and T cells activated therewith are useful in methods and compositions for treatment of psychiatric disorders, diseases and conditions.05-19-2011
20110243975TRANSFORMED SOYBEAN PLANT WHICH ACCUMULATES VACCINE, AND USE THEREOF - A transformed soybean plant having a gene encoding a modified seed storage protein introduced therein, obtained by inserting a gene encoding an Alzheimer's disease vaccine to a variable region(s) of a gene encoding a wild-type seed storage protein, is produced, and said vaccine is produced and accumulated in the seeds thereof.10-06-2011
20110243974NOVEL TUMOR ANTIGEN PROTEIN SART-3 AND TUMOR ANTIGEN PEPTIDES THEREOF - A novel tumor antigen protein and gene therefor, tumor antigen peptides derived from said tumor antigen protein or derivatives thereof as well as medicaments, prophylactics, or diagnostics for tumors using such tumor substances in vitro or in vitro are provided.10-06-2011
20110086056Methods for the early diagnosis of ovarian cancer - The present invention discloses the protease hepsin is specifically over-expressed in ovarian and other malignancies. A number of hepsin peptides can induce immune responses to hepsin, thereby demonstrating the potential of these peptides in monitoring and the development of immunotherapies for ovarian and other malignancies. There is also provided a hepsin protein variant that is useful as a marker for ovarian cancer cells, prostate cancer cells or kidney cancer cells.04-14-2011
20090220534METHODS FOR IDENTIFYING T-CELL EPITOPES ASSOCIATED WITH IMPAIRED PEPTIDE PROCESSING AND APPLICATIONS OF THE IDENTIFIED EPITOPES - The current invention provides methods for the identification of antigens and/or epitopes that are differentially displayed on TAP deficient or TAP impaired cells and are not detectably displayed on normal or TAP proficient cells. The identification and applications of these differentially presented antigens, which in this specification are referred to as TEIPP, T cell Epitopes associated with Impaired Peptide Processing, is a prime object of this invention. The invention also provides peptides comprising a TEIPP epitope obtained from the methods of the invention, which may be applied in medicaments and methods of treatment raising a T cell response against TAP deficient tumor cells or virally infected cells.09-03-2009
20100221274METHOD OF ADMINISTERING A THYMOSIN ALPHA 1 PEPTIDE - A Thymosin alpha 1 (TA1) peptide is administered to a patient in need of immune stimulation so as to substantially continuously maintain an immune stimulating-effective amount of the TA1 peptide in the patient. The administration method may be by continuous infusion.09-02-2010
20110212115MELK EPITOPE PEPTIDES AND VACCINES CONTAINING THE SAME - According to the present invention, peptides having the amino acid sequence of SEQ ID NOs: 14, 21, 23, 27, 36, 46, 57, 60 and 62 were demonstrated to have cytotoxic T lymphocyte (CTL) inducibility. Therefore, the present invention provides a peptide having the amino acid sequence selected from among SEQ ID NOs: 14, 21, 23, 27, 36, 46, 57, 60 and 62. The peptide can include one, two, or several amino acid substitutions, deletions, insertions, or additions so long as its CTL inducibility is retained. Furthermore, the present invention provides pharmaceutical agents for the treatment and/or prophylaxis of cancers, and/or prevention of postoperative recurrence thereof, which contain any of these peptides. Pharmaceutical agents of this invention include vaccines.09-01-2011
20110086057OX40R Binding Agents - The present invention discloses peptides isolated from the extracellular domain of OX40 Ligand (OX40L) capable of binding OX40 Receptor (OX40R) and inhibiting OX40R-OX40L interaction. Such peptides, fusion proteins comprising them, as well as peptides and other molecules designed on their sequences, can be used as OX40R binding agents competing with natural OX40L for blocking OX40R-mediated cell signaling in the prophylaxis and/or treatment of diseases related to activated T cells.04-14-2011
20110243973HIG2 AND URLC10 EPITOPE PEPTIDE AND VACCINES CONTAINING THE SAME - The present invention provides a pharmaceutical agent or composition containing one or more peptides having the amino acid sequence of SEQ ID NO: 1 or 2, or one or more polynucleotides encoding such a peptide formulated for the treatment and/or prevention of cancer in a subject whose HLA-A antigen is HLA-A0206. Furthermore, the present invention provides a method of inducing CTL and antigen-presenting cells using such peptides, polynucleotides or pharmaceutical agents.10-06-2011
20130156799CONTIGUOUS OVERLAPPING PEPTIDES FOR TREATMENT OF BIRCH POLLEN ALLERGY - Contiguous overlapping peptides (COPs) for the treatment of allergic patients by Specific Immunotherapy (SIT) are provided from the sequence of the major allergen of birch pollen Bet v 1. Such peptides while providing all potential T cell epitopes are devoid of the 3D structure of the original allergen, therefore reducing their ability to bind IgE.06-20-2013
20100047263PEPTIDES PROTECTIVE AGAINST S. PNEUMONIAE AND COMPOSITIONS, METHODS AND USES RELATING THERETO - The present invention relates to a protective peptide or a functionally active variant of the protective peptide; a composition comprising at least two proteins selected from the group consisting of i) a first type of protective peptide or functionally active variant thereof, ii) a second type of protective peptide or functionally active variant thereof and iii) a supportive peptide or a functionally active variant thereof; one or more nucleic acid(s) encoding the protective peptide or functionally active variant thereof or the at least two proteins comprised in the composition; a pharmaceutical composition comprising the protective peptide or functionally active variant thereof, the composition, or the nucleic acid(s); a method of producing an antibody using the protective peptide or functionally active variant thereof or the composition; the use of the protective peptide or functionally active variant thereof and/or the composition and/or the nucleic acid(s) for the manufacture of a medicament for the immunization or treatment of a subject; a method of diagnosing a 02-25-2010
20100055118Peptidic Growth Hormone Secretagogues Analog Compounds and Preparations Thereof - Peptidic chemical compounds obtained by in silico molecular modelling, having a structure that enables them to perform the same functions of peptidic growth hormone secretagogues. The invention also comprises the preparations containing such compounds and the use in medicines, food additives, nutritional supplements or other formulations of human or animal use.03-04-2010
20100055120PROSTATE STEM CELL ANTIGEN (PSCA) VARIANTS AND SUBSEQUENCES THEREOF - PSCA and its encoded protein, and variants thereof, are described wherein PSCA exhibits tissue specific expression in normal adult tissue, and is aberrantly expressed in the cancers listed in Table I. Consequently, PSCA provides a diagnostic, prognostic, propylactic and/or therapeutic target for cancer. The PSCA gene or fragment thereof, or its encoded protein, or variants thereof, or a fragment thereof, can be used to elicit a humoral or cellular immune response; antibodies or T cells reactive with PSCA can be used in active or passive immunization.03-04-2010
20090028887COMPOUNDS AND METHODS FOR TREATMENT AND DIAGNOSIS OF CHLAMYDIAL INFECTION - Compounds and methods for the diagnosis and treatment of Chlamydial infection are disclosed. The compounds provided include polypeptides that contain at least one antigenic portion of a 01-29-2009
20100129389METHODS OF MODULATING HVEM, BTLA AND CD160 CIS COMPLEX RESPONSE OR SIGNALING ACTIVITY WITH SOLUBLE LIGHT POLYPEPTIDE SEQUENCES - The invention provides HVEM cis complexes which include, for example, HVEM/BTLA, HVEM/CD160 and HVEM/gD cis complexes. The invention provides ligands and agents that bind to HVEM cis complexes, such as antibodies. The invention further provides methods of use of the HVEM cis complexes, and the ligands and agents (e.g., LIGHT polypeptide sequence) that bind to the HVEM cis complexes.05-27-2010
20100129388PROTECTIVE PROTEINS OF S. AGALACTIAE, COMBINATIONS THEREOF AND METHODS OF USING THE SAME - The invention relates to a composition comprising at least two protective proteins against 05-27-2010
20110150910METHODS OF INDUCING AN IMMUNE RESPONSE - Novel genes designated and set forth in FIG. 06-23-2011
20110076297Peptides for Inducing Heterosubtypic Influenza T Cell Responses - The present invention provides compositions and methods for generation of an anti-influenza immune response. In particular, conserved T cell epitopes within matrix protein and nucleoprotein components of influenza virus have been identified and further screened for those structures that will bind either or both of HLA I and II molecules. Methods for vaccinating subjects with formulations of such peptides for the treatment or prevention of influenza infaction also are described.03-31-2011
20120201841POLYPEPTIDES AND POLYNUCLEOTIDES FOR ENHANCING IMMUNE REACTIVITY TO HER-2 PROTEIN - Compositions for stimulating the immune system and for treating malignancies associated with overexpression of the HER-2 protein are provided. Such compositions include immunogenic epitopes of the HER-2 proteins and chimeric and multivalent peptides which comprise such epitopes. The present invention also relates to polynucleotides which encode the chimeric peptides. Also provided are pharmaceutical compositions comprising such immunogenic compositions. Methods for stimulating an immune response to HER-2 protein are provided. Methods for treating breast cancer, ovarian cancer, prostate cancer, colon cancer and lung cancer are provided.08-09-2012
20100303844MODIFICATION OF INTRINSICALLY DISORDERED SEQUENCES FOR THE PREPARATION OF VACCINES - The intrinsically disordered sequences—or “intrinsically disorded sequences” or IDSeq—proteins should be flexible to ensure a controlled interaction between proteins. In the development of the diseases, IDSeq are modified and polymerized. The invention describes the method of preparation of the drugs against cancers, the degenerative diseases and the infectious illness, by the induction of an immune reaction against IDSeq modified in a covalent way (IDSeqC) and polymerized (pIDSeqC), and leading to a new network of protein signaling, named here “misfoldome”, causing the diseases. The invention describes the preparation of vaccines by the use of polymers of IDSeqC. Peptides of the pIDSeqC are prepared in vitro, and introduced into a living organism to induce an immunological response, which eliminates the “misfoldome” and cures the diseases. The method is employed for the preparation of active or passive vaccines. The technology is adapted to detect, prevent or cure the diseases associated with ageing such as the degenerative diseases, cancers, and infections.12-02-2010
20100255018POLYNUCLEOTIDES AND POLYPEPTIDES INVOLVED IN GESTATIONAL MALARIA, AND BIOLOGICAL APPLICATIONS - The present invention relates to novel antigens involved in gestational malaria, and more particularly to polynucleotide and polypeptide sequences, conjugates, cloning vectors including said sequences for the preparation of immunogenic compositions and vaccines, antibodies, and to the use thereof for treating gestational malaria. The invention also relates to diagnostic methods and kits.10-07-2010
20120171232IN VIVO EFFICACY OF NY-ESO-1 PLUS ADJUVANT - The invention relates to the discovery that administration of NY-ESO-1 protein, in combination with a saponin based adjuvant leads to an unexpectedly strong immune response against NY-ESO-1 expressing cells. Preferably, the combination is administered intramuscularly.07-05-2012
20120201843CYP1B1 NUCLEIC ACIDS AND METHODS OF USE - The present invention provides nucleic acids containing transcriptional units that encode CYP1B1 polypeptides or portions thereof, wherein the transcriptional units lack sequences found in the untranslated region (UTR) of naturally occurring forms of the CYP1B1 transcript. The nucleic acids of the invention lack translational repressor elements and thus provide for a system of enhanced translation of the CYP1B1 polypeptide or portions thereof. Also disclosed are methods of administering nucleic acids to a mammal and use in the treatment of proliferative disorders or cancer.08-09-2012
20090022747B7-H3 AND B7-H4, NOVEL IMMUNOREGULATORY MOLECULES - The invention provides novel B7-H3 and B7-H4 polypeptides useful for co-stimulating T cells, isolated nucleic acid molecules encoding them, vectors containing the nucleic acid molecules, and cells containing the vectors. Also included are methods of making and using these co-stimulatory polypeptides.01-22-2009
20120201840EphA2 T-Cell Epitopes and Uses Therefor - EphA2 T-cell epitope are provided herein. The epitopes include peptides corresponding to specific fragments of human EphA2 protein containing one or more T-cell epitopes, and conservative derivatives thereof. The EphA2 T-cell epitopes are useful in an assay, such as an ELISPOT assay, that may be used to determine and/or quantify a patient's immune responsiveness to EphA2. The epitopes also are useful in methods of modulating a patient's immune reactivity to EphA2, which has substantial utility as a treatment for cancers that overexpress EphA2, such as renal cell carcinoma (RCC). The EphA2 epitopes also can be used to vaccinate a patient against EphA2, by in vivo or ex vivo methods.08-09-2012
20090324628COMPOUNDS USEFUL IN THE DIAGNOSIS AND TREATMENT OF MALARIA - The present invention relates to nucleic acid molecules related to the PFD1235w/MAL7P1.1, PF11_0008, and PF13_0003 gene families as well as amino acid sequences encoded by such nucleic acid molecules with respect to their role in mediating adhesion of infected red blood cells to endothelial cells, which is characteristic for the pathogenesis of severe malaria (SM). Accordingly, the invention provides pharmaceutical compositions and vaccines, hereunder nucleotide-based vaccines comprising compounds that are related to VAR4, VAR5, and/or VAR6 polypeptides and PFD1235w/MAL7P1.1 PF11_0008, and/or PF13_0003 nucleic acid molecules. The invention further relates to the use of these compounds as medicaments and for the manufacture of compositions, such as immunogenic compositions. In addition, the invention relates to methods of treatment and prevention of severe malaria wherein these methods are based on the nucleic acid molecules and polypeptides of the invention. As these compounds can also be used as biotechnological tools the invention provides in vitro diagnostic methods and kits comprising reagents and IgGs/antibodies designated to the use in such methods. The invention also relates to methods of identifying agents capable of modulating the VAR4, VAR5, and/or VAR6 dependent adhesion to endothelial cells and agent capable of interacting with VAR4, VAR5, and/or VAR6. Finally, a method for identifying polypeptides, which will induce a specific IgG/antibody response upon administration to a subject is provided by the invention.12-31-2009
20090317414CANCER VACCINE COMPRISING A MUCIN 1 (MUC1) T CELL EPITOPE-DERIVED PEPTIDE - A cancer vaccine, and a composition for the ex vivo priming of dendritic cells, is disclosed which comprises a MUC1 T cell epitope-derived peptide or peptide analogue capable of provoking a cytotoxic T cell immune response. Particular MUC1 T cell epitope-derived peptides disclosed include TTAPPVHGL, STAPPVHGL, STAPPAHGL, TTAPPAHGV and SAPDTYPAL.12-24-2009
20090317412Induction of an immune response against streptococcus pneumoniae polyaccharides - The present invention provides conjugates of pan DR binding peptides with 12-24-2009
20090317413DETECTION OF HUMAN PLATELET ANTIGEN (HPA) ANTIBODIES - This invention relates to recombinant GPIIIa molecules that lack the ligand binding βA domain and bind to HPA-1 antibodies in monomeric form. These GPIIIa molecules can be recombinantly expressed at high levels and may be useful, for example, in the detection of HPA-1 antibodies. Such detection may be useful, for example, in the diagnosis and therapy of HPA antibody disorders such as Neonatal Alloimmune Immune Thrombocytpenia (NAIT), Post Transfusion Purpura (PTP) and Platelet Refractoriness (PR).12-24-2009
20110150909Yeast-Based Vaccines As Immunotherapy - Compositions and methods for treating and/or preventing a variety of diseases and conditions that are amenable to immunotherapy and, in one particular embodiment, compositions and methods for treating and/or preventing cancer in an animal are described. Specifically improvements related to the use of a yeast-based vaccine comprising a yeast vehicle and an antigen that is selected to elicit an antigen-specific cellular and humoral immune response in an animal, for use in prophylactic and/or therapeutic vaccination and the prevention and/or treatment of a variety of diseases and conditions are disclosed.06-23-2011
20120201842PREVENTION AND TREATMENT OF SYNUCLEINOPATHIC AND AMYLOIDOGENIC DISEASE - The invention provides improved agents and methods for treatment of diseases associated with synucleinopathic diseases, including Lewy bodies of alpha-synuclein in the brain of a patient. Such methods entail administering agents that induce a beneficial immunogenic response against the Lewy body. The methods are particularly useful prophylactic and therapeutic treatment of Parkinson's disease.08-09-2012
20090148466Process for the Preparation of Hypoallergenic Mosaic Antigens - A process for the preparation of an hypoallergenic mosaic antigen derived from an allergen is disclosed whereby a) in a first step the allergen is split into at least two parts and the IgE reactivity of each part is determined and b) in a second step those parts of the allergen which have no detectable IgE reaction are combined to a mosaic antigen which comprises the amino acids of the allergen but the order of the amino acids of the mosaic antigen is different from that of the naturally occurring allergen.06-11-2009
20080279874COMPOSITIONS AND METHODS FOR MODULATION OF PLK1 KINASE ACTIVITY - Described are compositions and methods for activating a Plk1 protein as well as phospho-specific anti-Myt1 antibodies that can be used to detect phosphorylation of Myt1. Activated Plk1 protein, phospho-specific anti-Myt1 antibodies, and/or Plk1 substrates can be used in screening assays to identify compounds that modulate the ability of Plk1 to phosphorylate and/or bind to a Plk1 substrate.11-13-2008
20080279873ACTIVE IMMUNIZATION TO GENERATE ANTIBODIES TO SOLUBLE A-BETA - The invention provides methods useful for effecting prophylaxis or treatment of Alzheimer's disease. Such methods entail administering A-beta fragments from a central or C-terminal regions of A-beta. Such fragments can induce a polyclonal mixture of antibodies that specifically bind to soluble A-beta without binding to plaques. The antibodies can inhibit formation of amyloid deposits of A-beta in the brain of a patient from soluble Aβ thus preventing or treating the disease. Fragment A-beta 15-24 and subfragments of 5-10 contiguous amino acids thereof are preferred immunogens due to their capacity to generate a high titer of antibodies.11-13-2008
20080267986Therapeutic vaccine - The present invention is related to methods and compositions for the therapeutic and diagnostic use in the treatment of diseases and disorders which are caused by or associated with amyloid or amyloid-like proteins including amyloidosis.10-30-2008
20110177109ANTIGENIC TAU PEPTIDES AND USES THEREOF - The present disclosure relates to novel immunogens and compositions comprising an antigenic tau peptide, preferably linked to an immunogenic carrier for use in the treatment of tau-related neurological disorders. The disclosure further relates to methods for production of these immunogens and compositions and their use in medicine.07-21-2011
20080311141CANCER VACCINES AND VACCINATION METHODS - Methods and compositions for treating cancers (e.g., neural cancers) by dendritic cell vaccination are provided herein.12-18-2008
20110256163IDENTIFICATION, OPTIMIZATION AND USE OF CRYPTIC HLA-B7 EPITOPES FOR IMMUNOTHERAPY - The present invention relates to the field of peptide immunotherapy. In particular, the invention pertains to a method for identifying a HLA-B*0702-restricted cryptic epitope in an antigen, and to a method for increasing its immunogenicity. The invention also provides novel methods and materials for efficiently treating patients having an HLA-B*0702 phenotype.10-20-2011
20080267987Recombinant MHC Molecules Useful For Manipulation Of Antigen-Specific T-Cells - Two-domain MHC polypeptides useful for manipulation of antigen-specific T-cells are disclosed. These polypeptides include MHC class II-based molecules that comprise covalently linked β1 and α1 domains, and MHC class I-based molecules that comprise covalently linked α1 and α2 domains. These polypeptides may also include covalently linked antigenic determinants, toxic moieties, and/or detectable labels. The disclosed polypeptides can be used to target antigen-specific T-cells, and are useful, among other things, to detect and purify antigen-specific T-cells, to induce or activate T-cells, and to treat conditions mediated by antigen-specific T-cells.10-30-2008
20080267985Variants of Group 1 Allergens from Poaceae Having Reduced Allergenicity and Maintained T-Cell Reactivity - The present invention relates to the preparation and use of variants of the group 1 allergens of the Poaceae (sweet grasses) which are characterised by reduced IgE reactivity compared with the known wild-type allergens and at the same time by substantially maintained reactivity with T-lymphocytes. These hypoallergenic allergen variants can be employed for the specific immunotherapy (hyposensitisation) of patients having grass pollen allergy or for the preventive immunotherapy of grass pollen allergies.10-30-2008
20110165184CDH3 PEPTIDE AND MEDICINAL AGENT COMPRISING THE SAME - The present invention provides a peptide of the following (A) or (B): 07-07-2011
20110020380Human Tumor Necrosis Factor TR18 and Methods Based Thereon - The present invention relates to TR18 polypeptides. In particular, isolated nucleic acid molecules are provided encoding human TR18 protein. TR18 polypeptides are also provided as are vectors, host cells and recombinant methods for producing the same. The invention further relates to screening methods for identifying agonists and antagonists of TR18 activity. The invention further relates to methods of treating, preventing, prognosing, or diagnosing an autoimmune disease or condition associated with an autoimmune disease, comprising administering to a patient an effective amount of polypeptides of the invention.01-27-2011
20110027301EX-VIVO PRIMING FOR GENERATING CYTOTOXIC T LYMPHOCYTES SPECIFIC FOR NON-TUMOR ANTIGENS TO TREAT AUTOIMMUNE AND ALLERGIC DISEASE - Cytotoxic T lymphocytes (CTLs) specific for antigenic peptides derived from IgE molecule can be generated in vitro by stimulating resting naive CD8 T cells with IgE peptides presented by artificial antigen presenting cells. The IgE specific CTLs lyse the target cells loaded with IgE peptides in vitro and inhibit antigen specific IgE response in vivo. In addition, adoptive transfer of the IgE specific CTL to an asthmatic mouse model can inhibit the development of lung inflammation and airway hypersensitivity. IgE specific CTL provides a treatment for allergic asthma and other IgE-mediated allergic diseases. Antigenic peptides identified from non-tumor self-antigens induce specific cytotoxic T lymphocyte (CTL) in vitro. The CTL induced by peptides identified from CD40L can kill activated CD4 T cells. In vitro generated CTL specific for CD40L inhibit CD4-dependent antibody responses of all isotypes in vivo. In contrast, CTL induced by antigenic peptides derived from IgE specifically inhibit IgE responses, and adoptive transfer of CD40L-specific CTL to NOD mice at early age delay the development of diabetes in NOD mice. In vitro generated CTL specific for non-tumor self-antigens expressed on activated CD4 T cells regulate immune responses in vivo.02-03-2011
20110027303PARTIAL PEPTIDE OF SURVIVIN PRESENTED ON MHC CLASS II MOLECULE AND USE THEROF - The object aims to provide: a novel tumor antigen; a novel therapeutic agent useful in a method for treating a malignant neoplasm by utilizing the tumor antigen; and a tumor antigen which can be used as the therapeutic agent. Thus, disclosed are: a novel tumor antigen which has an epitope capable of inducing a Th1 cell which is a CD4-positive T cell specific to Survivin; and use of the tumor antigen. Specifically disclosed is a polypeptide which comprises an amino acid sequence depicted in SEQ ID NO:17 or the like and has an activity to cause the production of a cytokine by a Th cell that is a cell specific to Survivin. The peptide can induce a Th cell that is specific to Survivin and can cause the production of a cytokine by the Sur/Th cell when the peptide is incubated together with an antigen-presenting cell and a CD4-positive T cell.02-03-2011
20110027302PEPTIDE VACCINES FOR LUNG CANCERS EXPRESSING TTK, URLC10 OR KOC1 POLYPEPTIDES - The present invention provides peptides comprising the amino acid sequence of SEQ ID NO: 8, 67, 89, as well as peptides comprising the above-mentioned amino acid sequences in which 1, 2, or several amino acids are substituted, deleted, or added, and having cytotoxic T cell inducibility. The present invention also provides drugs for treating or preventing tumors comprising these peptides. The peptides of the present invention can also be used as vaccines.02-03-2011
20110027299MELANOMA ANTIGENS AND THEIR USE IN DIAGNOSTIC AND THERAPEUTIC METHODS - The present invention provides an isolated or purified immunogenic peptide comprising 8-15 contiguous amino acids of gp100 (SEQ ID NO: 121) and related nucleic acids, expression vectors, host cells, populations of cells, and methods of use. The invention further provides immunogenic peptides derived from gp100 which have been modified to enhance their immunogenicity and related nucleic acids, expression vectors, host cells, populations of cells, and methods of use.02-03-2011
20110027298MICROBIAL DELIVERY SYSTEM - The present invention provides methods and compositions for treating or preventing allergic responses, particularly anaphylactic allergic responses, in subjects who are allergic to allergens or susceptible to allergies. Methods of the present invention utilize administration of microorganisms to subjects, where the microorganisms produce allergens and protect the subjects from exposure to the allergens until phagocytosed by antigen-presenting cells. Particularly preferred microorganisms are gram-negative bacteria, gram-positive bacteria, and yeast. Particularly preferred allergens are proteins found in foods, venoms, drugs and latex that elicit allergic reactions and anaphylactic allergic reactions in individuals who are allergic to the proteins or are susceptible to allergies to the proteins. The proteins may also be modified to reduce the ability of the proteins to bind and crosslink IgE antibodies and thereby reduce the risk of eliciting anaphylaxis without affecting T-cell mediated Th1-type immunity.02-03-2011
20100330112VACCINES AGAINST HERPES SIMPLEX VIRUS TYPE 2: COMPOSITIONS AND METHODS FOR ELICITING AN IMMUNE RESPONSE - Herpes Simplex Virus-2 (HSV-2) infection is a major health concern. The present disclosure provides, inter alia, certain highly effective vaccines and immunogenic compositions against HSV-2. The antigens can be used therapeutically or prophylactically.12-30-2010
20100330111INCREASE OF IMMUNE RESPONSE AND TARGETING BY ANTIGENS AND/OR DRUG LINKAGE - The present invention relates to compounds consisting of glycolipids covalently bound to an antigen or a drug via a linker. The said compounds are able to induce a stronger immune response than a composition comprising separated glycolipids and antigen. The said compounds are also able to target drug to CD1d restricted cells.12-30-2010
20110256164VACCINE FOR THE PREVENTION OF BREAST CANCER RECURRENCE - Provided are methods to induce and maintain a protective cytotoxic T-lymphocyte response to a peptide of the HER/neu oncogene, GP2, with the effect of inducing and maintaining protective or therapeutic immunity against breast cancer in a patient in clinical remission, including patients having low to intermediate levels of HER2/neu expression. The methods comprise administering to the patient an effective amount of a vaccine composition comprising a pharmaceutically acceptable carrier, an adjuvant such as GM-CSF, and the GP2 peptide. The methods may further comprise administering a periodic booster vaccine dose as needed due to declining GP2-specific T cell immunity. Also provided are vaccine compositions for use in the methods.10-20-2011
20110135675MELANOMA ASSOCIATED PEPTIDE ANALOGUES AND VACCINES AGAINST MELANOMA - The present invention is concerned with cancer treatment and diagnosis, especially with melanoma associated peptide analogues with improved immunogenicity, epitopes thereof; vaccines against melanoma, tumor infiltrating T lymphocytes recognizing the antigen and diagnostics for the detection of melanoma and for the monitoring of vaccination. The peptides according to the invention can be exploited to elicit native epitope-reactive Cm. Usage of the peptides with improved immunogenicity may contribute to the development of CTL-epitope based vaccines in viral disease and cancer.06-09-2011
20110135674Markers of XMRV Infection and Uses Thereof - The present invention relates generally to assays for the detection of Xenotropic Murine Leukemia Virus-related Retrovirus (“XMRV”) and diseases associated with XMRV infection. Additionally, the invention relates to specific XMRV antigens capable of inducing an immunogenic response as well as XMRV-related nucleic acids having significant diagnostic, screening, and therapeutic utilities.06-09-2011
20110135672HLA-G COMPOSITIONS AND METHODS OF USE THEREOF - It has been discovered that HLA-G dimers are potent ligands of ILT2 and ILT4 on immune cells and enhance signal transduction through ILT2 and ILT4. Enhanced signal transduction through ILT-2, ILT-4 or both down-regulates the biological activity of T cells and dendritic cells. HLA-G compositions including HLA-G dimers are provided that are useful for modulating activity of immune cells. Preferred compositions include microparticles having HLA-G dimers on the surface of the microparticles. The microparticles optionally include a targeting moiety to target the microparticles to specific immune cells. In a preferred embodiment the microparticles are targeted to T cells or dendritic cells expressing ILT2 or both ILT2 and ILT4, respectively. The HLA-G dimer can include any HLA-G protein that is capable of forming a dimer. Preferred HLA-G proteins include HLA-G1 and HLA-G5. In certain embodiments the microparticles include dimers of HLA-G1 and HLA-G5.06-09-2011
20110262471RAB6KIFL/KIF20A EPITOPE PEPTIDE AND VACCINES CONTAINING THE SAME - The present invention provides oligopeptides comprising the amino acid sequence selected from the group consisting of SEQ ID NOs: 3, 4 and 5. The present invention also provides a pharmaceutical composition containing the amino acid sequence of selected from the group consisting of SEQ ID NOs: 3, 4 and 5 formulated for the treatment or prevention of cancer in a subject. Furthermore, the present invention provides a method of inducing immune response using such oligopeptides and pharmaceutical agents.10-27-2011
20110262469MALARIA VACCINE BASED ON FRAGMENTS AND COMBINATION OF FRAGMENTS OF THE CS PROTEIN OF PLASMODIUM VIVAX - The invention relates to a recombinant or synthetic polypeptide characterised in that it includes at least three consecutive repetitions of nonapeptide A N G A G X1 Q X2 X3, in which X1 is selected from D and N, X2 is selected from P and A and X2 is selected from G and A. The inventive polypeptide also preferably includes at least two (2) consecutive repetitions of sequence GDRADGQPA and in an even more preferable embodiment the polypeptide includes an amino-terminal region, a C-terminal region and/or the ptt30 fragment. The invention also relates to malaria vaccines characterised in that they include said peptides.10-27-2011
20110052616Biological materials and uses thereof - The present invention concerns a peptide molecule or a nucleic acid molecule, for use in medicine and, in particular, for use in preventing or treating a non-cancerous condition or relieving pain in a patient. The invention also relates to a pharmaceutical composition comprising the peptide or nucleic acid molecule of the invention and methods of treatment thereof.03-03-2011
20110052615TUMOUR-SPECIFIC ANIMAL PROTEINS - CASB7439 polypeptides and polynucleotides, immunogenic compositions comprising them and methods for producing such polypeptides by recombinant techniques are disclosed. Also disclosed are methods for utilizing CASB7439 polypeptides and polynucleotides in diagnostics, and vaccines for prophylactic and therapeutic treatment of cancers, particularly colorectal cancers, autoimmune diseases, and related conditions.03-03-2011
20110052614STAT3 EPITOPE PEPTIDES - The present invention provides peptides comprising the amino acid sequence of SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 16, 17, 19, 20, 21, 22, 26, 27, 29, 30, 59, 61, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74, 75, 77, 83, 94, 96, 97, 98 or 103, and peptides comprising one of the above-mentioned amino acid sequences with substitution or addition of one, two, or several amino acids, and having cytotoxic T cell inducibility, and also provides drugs comprising these peptides. The peptides of this invention can be used as vaccines.03-03-2011
20100183644Tumour-Associated Peptides that Bind to MHC Molecules - The invention relates to a tumor-associated peptide containing an amino sequence, which is selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:79 of the enclosed listing. The peptide has the ability to bind to a molecule of the human major histocompatibility complex (MHC) class-I. The invention also relates to the use of the peptides for manufacture of a medicament and for treating tumorous diseases. The invention further relates to a pharmaceutical composition, which comprises at least one of the peptides.07-22-2010
20110086055HER2 PEPTIDES - Compositions, methods, and vaccines that may stimulate the immune system and that may be used for treating malignancies associated with overexpression of the HER-2 protein are provided. Such compositions include epitopes of the HER-2 proteins.04-14-2011
20090297546AVIAN-DERIVED ANTIBODY CAPABLE OF BINDING SPECIFICALLY TO HUMAN HMGB1, IMMUNOLOGICAL DETERMINATION METHOD FOR HUMAN HMGB1, AND IMMUNOLOGICAL DETERMINATION REAGENT FOR HUMAN HMGB1 - An object of the present invention is to provide an anti-human HMGB1 antibody having high capability of binding to human high mobility group box protein-12-03-2009
20120121627PEPTIDES FOR ACTIVE ANTI-CYTOKINE IMMUNIZATION - Peptide of a size comprised between 5 and 40 amino acids, originating from a cytokine, in which at least one of its amino acids comprises at least one of its atoms separated by a distance d of less than 5 angströms from an atom of the receptor corresponding to said cytokine, the spacing d being evaluated on the basis of structural data, derivatives, immunogenic compounds comprising them, use of a peptide or peptide derivative or immunogenic compound for the preparation of a curative or preventative medicament intended for the treatment or prevention of diseases linked to an excess or to the presence of cytokines or for the treatment of an auto-immune disease and pharmaceutical compositions which contain at least one abovementioned peptide or peptide derivative or immunogenic compound as active ingredient.05-17-2012
20110097351COMPOUNDS FOR TREATING BETA-AMYLOIDOSES - The present invention relates to the use of mimotopes in the treatment of diseases associated with β-amyloid formation and/or aggregation (β-Amyloidoses) including Alzheimer's disease, whereby said mimotopes are able to induce the in vivo formation of antibodies directed to Aβ1-40/42, AβpE3-40/42, Aβ3-40/42 and Aβ11-40/42.04-28-2011
20100166790PREVENTIVE CANCER VACCINE BASED ON BROTHER OF REGULATOR OF IMPRINTED SITES MOLECULE (BORIS) - Polynucleotides encoding a nonfunctional mutant form of the Brother of Regulator of Imprinted Sites (BORIS) molecule, nonfunctional mutated BORIS protein, polypeptide or peptide and modified protein forms of BORIS are described. These molecules are used as a therapeutic vaccine against cancer.07-01-2010
20100166789PROTEINS FOR USE IN DIAGNOSING AND TREATING INFECTION AND DISEASE - The present invention describes compositions of thymus derived peptides and uses therefore in diagnostic methods and for the treatment of diseases associated with reduced T helper cell counts, diseases such as infection, e.g., HIV infection and other viral infections, parasitic, and bacterial infection, AIDS, ARC, multiple sclerosis, chronic fatigue syndrome, rheumatoid arthritis, Alzheimer's disease, asthma, allergy, dermatitis, type 1 diabetes mellitus, colitis, inflammatory bowel disease/irritable bowel syndrome, Crohn's disease, Psoriasis, Chronic obstructive pulmonary disease, Systemic lupus erythematosus, transplant rejection and cancer.07-01-2010
20100166788IMMUNOGENS FROM UROPATHOGENIC ESCHERICHIA COLI - Disclosed herein are various polypeptides that can be included in immunogenic compositions specific for pathogenic 07-01-2010
20100203070Contiguous Overlapping Peptides for Treatment of Birch Pollen Allergy - Contiguous overlapping peptides (COPs) for the treatment of allergic patients by Specific Immunotherapy (SIT) are provided from the sequence of the major allergen of birch pollen Bet v 1. Such peptides while providing all potential T cell epitopes are devoid of the 3D structure of the original allergen, therefore reducing their ability to bind IgE.08-12-2010
20100158932Antibodies directed against prothrombin fragment F1+2, the preparation and use thereof - The invention relates to antibodies directed against F06-24-2010
20100158933IGE CH3 PEPTIDE VACCINE - The present invention relates to the provision of novel immunogens comprising an antigenic IgE peptide preferably linked to an immunogenic carrier for the prevention, treatment or alleviation of IgE-mediated disorders. The invention further relates to methods for production of these medicaments, immunogenic compositions and pharmaceutical compositing thereof and their use in medicine.06-24-2010
20100158930HPV ANTIGEN FUSION PROTEIN VACCINE COMPOSITIONS AND USES THEREOF - The present invention provides a fusion protein comprising an immunostimulatory polypeptide and a mutant E7 protein of a human papilloma virus. The present invention also provides a gene encoding the fusion protein, expression vectors containing the gene, a pharmaceutical composition comprising the fusion protein, a method for treating or preventing a human papilloma virus related disease by using the fusion protein and uses of the fusion protein in the preparation of a medicament for the treatment or prevention of the human papilloma virus related disease.06-24-2010
20100196408METASTATIC COLORECTAL CANCER VACCINE - The invention relates to prophylactic and therapeutic vaccines for protecting individuals against metastatic colorectal cancer and for treating individuals who are suffering from metastatic colorectal cancer.08-05-2010
20100068217EPITOPE-TRANSPLANT SCAFFOLDS AND THEIR USE - Computational protocols for the design of epitope-protein scaffolds which elicit selected neutralizing antibodies are disclosed, and related compositions and uses.03-18-2010
20090208518IMMUNOGENIC PEPTIDES FOR THE TREATMENT OF PROSTATE AND BREAST CANCER - Immunogenic T-cell receptor gamma Alternate Reading Frame Protein (TARP) polypeptides are disclosed herein. These immunogenic TARP polypeptides include nine consecutive amino acids of the amino acid sequence set forth as SEQ ID NO: 9 and do not comprise amino acids 1-26 or amino acids 38-58 of SEQ ID NO: 1. Several specific, non-limiting examples of these polypeptides are set forth as SEQ ID NOs: 3-7. Nucleic acids encoding these polypeptides, and host cells transfected with these nucleic acids, are also disclosed. Methods of using these polypeptides, and polynucleotides encoding these polypeptides, for the treatment of breast and prostate cancer are also disclosed.08-20-2009
20090175893Albumin-Fused Anti-Angiogenesis Peptides - The invention relates to proteins comprising angiogenesis inhibiting peptides, such as endostatin peptides (including, but not limited to, fragments and variants thereof), which exhibit anti-retroviral activity, fused or conjugated to albumin (including, but not limited to fragments or variants of albumin). These fusion proteins are herein collectively referred to as “albumin fusion proteins of the invention.” These fusion proteins are herein collectively referred to as “albumin fusion proteins of the invention.” These fusion proteins exhibit extended shelf-life and/or extended or therapeutic activity in solution. The invention encompasses therapeutic albumin fusion proteins, compositions, pharmaceutical compositions, formulations and kits. The invention also encompasses nucleic acid molecules encoding the albumin fusion proteins of the invention, as well as vectors containing these nucleic acids, host cells transformed with these nucleic acids and vectors, and methods of making the albumin fusion proteins of the invention using these nucleic acids, vectors, and/or host cells. The invention also relates to compositions and methods for inhibiting proliferation of vascular endothelial cells and tumor angiogenesis induced cell fusion. The invention further relates to compositions and methods preventing growth of, or promoting regression of, primary tumors and metastases; and for treating cancer, diabetic retinopathy, progressive macular degeneration or rheumatoid arthritis.07-09-2009
20090175892Polynucleotides encoding MHC class I-restricted hTERT epitopes, analogues thereof or polyepitopes - This invention relates to the field of anticancer therapy, and to the identification of immunogenic peptides derived from the human telomerase reverse transcriptase (hTERT). The present invention relates to polynucleotides encoding hTERT epitopes restricted to MHC class I molecule, analogues thereof and polyepitopes containing such epitopes and/or analogues. Are also included in the present invention, vector and cell comprising such polynucleotides. The present invention also concerns composition comprising hTERT polypeptides, corresponding polynucleotides, vectors and cells, for use in the treatment and/or prevention of cancer.07-09-2009
20100189730VACCINES FOR HUMAN PAPILLOMA VIRUS AND METHODS FOR USING THE SAME - Improved anti-HPV immunogens and nucleic acid molecules that encode them are disclosed. Immunogens disclosed include those having consensus HPV 18 E6 and E7. Pharmaceutical composition, recombinant vaccines comprising and live attenuated vaccines are disclosed as well methods of inducing an immune response in an individual against HPV are disclosed.07-29-2010
20110189215Vaccine Comprising Protein NMB0964 From Neisseria Meningitidis - The present invention relates to immunogenic compositions comprising neisserial blebs with upregulated levels of the NMB0964 antigens such that bacterial antibodies are generated against said antigen. Methods are also provided to upregulate expression through removal of the zinc repression mechanism of the cell or promoter or through removal of zinc from the culture medium.08-04-2011
20110189214CDCA1 EPITOPE PEPTIDES AND VACCINES CONTAINING THE SAME - Peptide vaccines against cancer are described herein. In particular, the present invention describes epitope peptides derived from CDCA1 that elicit CTLs. The present invention also provides established CTLs that specifically recognize HLA-A24 positive target cells pulsed with the peptides. Antigen-presenting cells and exosomes that present any of the peptides, as well as methods for inducing antigen-presenting cells are also provided. The present invention further provides pharmaceutical agents containing the CDCA1 polypeptides or polynucleotides encoding thereof, as well as exosomes and antigen-presenting cells as active ingredients. Furthermore, the present invention provides methods for treating and/or prophylaxis of (i.e., preventing) cancers (tumors), and/or prevention of postoperative recurrence thereof, as well as methods for inducing CTLs, methods for inducing anti-tumor immunity, using the CDCA1 polypeptides, polynucleotides encoding the polypeptides, exosomes or antigen-presenting cells presenting the polypeptides, or the pharmaceutical agents of the present invention. The cancers to be targeted include, but are not limited to, breast cancer, bladder cancer, esophageal cancer, small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC).08-04-2011
20110189213MYBL2 EPITOPE PEPTIDES AND VACCINES CONTAINING THE SAME - Peptide vaccines against cancer are described herein. In particular, the present invention describes epitope peptides derived from MYBL2 that elicit CTLs. The present invention also provides established CTLs that specifically recognize HLA-A24 positive target cells pulsed with the peptides. Antigen-presenting cells and exosomes that present any of the peptides, as well as methods for inducing antigen-presenting cells are also provided. The present invention further provides pharmaceutical agents containing the MYBL2 polypeptides or polynucleotides encoding thereof, as well as exosomes and antigen-presenting cells as active ingredients. Furthermore, the present invention provides methods for treating and/or prophylaxis of (i.e., preventing) cancers (tumors), and/or prevention of postoperative recurrence thereof, as well as methods for inducing CTLs, methods for inducing anti-tumor immunity, using the MYBL2 polypeptides, polynucleotides encoding the polypeptides, exosomes or antigen-presenting cells presenting the polypeptides, or the pharmaceutical agents of the present invention. The cancers to be targeted include, but are not limited to, testicular tumor, pancreatic cancer, bladder cancer, non-small cell lung cancer, small cell lung cancer and esophageal cancer.08-04-2011
20110135673EPITOPE PROTECTION ASSAY - The invention relates to an epitope protection assay for use in diagnosis, prognosis and therapeutic intervention in diseases, for example, involving polypeptide aggregation, such as prion infections. The methods of the invention first block accessible polypeptide target epitope with a blocking agent. After denaturation of the polypeptide, a detecting agent is used to detect protein with target epitope that was inaccessible during contact with the blocking agent. The invention also relates to novel amyotrophic lateral sclerosis-specific epitopes and their uses to make antibodies, and to the novel antibodies and uses thereof.06-09-2011
20120064102PEPTIDE INDUCING XAGE-1B-SPECIFIC IMMUNE REACTION AND UTILIZATION OF SAME - The object of the present invention is to clarify functions of XAGE-1b and to develop a vaccine therapy for cancer based on XAGE-1b. Humoral immunity or cellular immunity is induced against XAGE-1b in lung cancer, by use of a peptide comprising an amino acid sequence of any one of (a) through (e) or by use of a peptide comprising an amino acid sequence of any one of (f) through (k).03-15-2012
20100028374C-TYPE LECTIN TRANSMEMBRANE ANTIGEN EXPRESSED IN HUMAN PROSTATE CANCER AND USES THEROF - A novel gene (designated PC-LECTIN) that is highly overexpressed in prostate cancer and its encoded protein is described. PC-LECTIN in normal human tissues is restricted to testis, but is highly expressed in prostate cancer. Consequently, PC-LECTIN provides a diagnostic and/or therapeutic target for prostate cancer.02-04-2010
20120308590IMP-3 OLIGOPEPTIDES AND VACCINES INCLUDING THE SAME - Oligopeptides having cytotoxic T cell inducibility and suitable for use in the context of cancer immunotherapy, more particularly cancer vaccines are described herein. Notable examples include oligopeptides having the amino acid sequence of SEQ ID NO: 1, 3, 5 or 6, wherein 1, 2, or several amino acids are optionally substituted, deleted, inserted or added so long as they retain the cytotoxic T cell inducibility of the original oligopeptides. Pharmaceutical formulations or “drugs” related to such oligopeptides suitable for treating or preventing cancers or tumors, as well as the post-operative recurrence thereof, are also described.12-06-2012
20120308591TMEM22 PEPTIDES AND VACCINES INCLUDING THE SAME - Isolated peptides composed of the amino acid sequence of SEQ ID NO: 33 or fragments thereof that bind to HLA antigens and have cytotoxic T lymphocyte (CTL) inducibility and thus are suitable for use in the context of cancer immunotherapy, more particularly cancer vaccines are described herein. The present invention further provides peptides that include one, two, or several amino acid insertions, substitutions or additions to the aforementioned peptides or fragments, but yet retain the requisite cytotoxic T cell inducibility. Further provided are nucleic acids encoding any of these aforementioned peptides as well as pharmaceutical agents, substances and compositions including any of the aforementioned peptides or nucleic acids. The peptides, nucleic acids, pharmaceutical agents, substances and compositions of this invention find particular utility in the treatment of cancers and tumors.12-06-2012
20100021489Nucleic acid molecules, polypeptides, antibodies and compositions for treating and detecting influenza virus infection - Polynucleotides and polypeptides which participate in influenza virus infection of cells and nucleic acid molecules, which include a polynucleotide sequence capable of specifically binding the polypeptides of the present invention. Also provided are methods of using such nucleic acid molecules, polynucleotides and antibodies directed thereagainst for diagnosing, treating and preventing influenza virus infection.01-28-2010
20100021485COMBINATION THERAPY METHOD AND FORMULATION - This invention concerns a pharmaceutical formulation and method for treating autoimmune disorders. The formulation and method provide for a combination therapy regimen wherein two separate substances are administered to a patient having or predisposed to having the disorder. The two components comprise at least one immunomodulatory peptide and a chloroquine derivative. The combination of the two components can be administered together or separately.01-28-2010
20100021486TSLP VACCINE FOR THE TREATMENT OF TH2 MEDIATED INFLAMMATORY CONDITIONS - The invention relates to compositions for the treatment of TH2 mediated inflammatory conditions. The compositions are vaccines comprising a non-primate TSLP or fragments thereof to be used as a vaccine to treat humans with excessive mediated inflammatory conditions. For the treatment of TH2 mediate inflammatory conditions in other non-human mammals the TSLP of the species to be vaccinated is being used as antigen.01-28-2010
20100158931NOVEL IMMUNOTHERAPY AGAINST SEVERAL TUMORS INCLUDING NEURONAL AND BRAIN TUMORS - The present invention relates to peptides, nucleic acids and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumor-associated cytotoxic T cell (CTL) peptide epitopes, alone or in combination with other tumor-associated peptides that serve as active pharmaceutical ingredients of vaccine compositions that stimulate anti-tumor immune responses. The present invention relates to 30 peptide sequences and their variants derived from HLA class I and class II molecules of human tumor cells that can be used in vaccine compositions for eliciting anti-tumor immune responses.06-24-2010
20110117117NOVEL IMMUNOGENIC EPITOPES FOR IMMUNOTHERAPY - The present invention relates to peptides, nucleic acids and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumour-associated T-helper cell peptide epitopes, alone or in combination with other tumour-associated peptides that serve as active pharmaceutical ingredients of vaccine compositions which stimulate anti-tumour immune responses. The present invention relates to novel peptide sequences and their variants derived from HLA class I and class II molecules of human tumour cells which can be used in vaccine compositions for eliciting anti-tumour immune responses.05-19-2011
20090074802IMMUNOMODULATING OLIGOPEPTIDES - The invention provides immunomodulating peptides of the general formula X—P—Y, preferably I—P—Y, and/or oligopeptides comprising this amino acid sequence and/or conjugates with these peptides. Also provided are pharmaceutical compositions with these peptides and conjugates.03-19-2009
20090186041ANTI-TSG101 ANTIBODIES AND THEIR USES FOR TREATMENT OF VIRAL INFECTIONS - The present invention provides antibodies that bind to the C-terminal region of TSG101. The invention also provides methods of using the TSG101 antibodies for the treatment of viral infections, including HIV and Ebola virus infection.07-23-2009
20090162389Methods for inducing a natural killer (NK) cell-mediated immune response and for increasing NK cell activity - The present invention relates to the discovery of novel methods of inducing a natural killer (NK) cell-mediated immune response and increasing NK activity in a mammal for the treatment of tumors and virus infections. The method comprises the steps of isolating peripheral blood mononuclear cells (PBMCs) from the subject, exposing the PBMCs in vitro to protein conjugate comprising granulocyte macrophage colony stimulating factor (GM-CSF) covalently linked to a soluble peptide antigen, under conditions effective to activate the PBMCs, and administering the activated PBMCs to the subject. The invention also relates to a method of detecting in a subject a cytotoxic NK cell-meditated immune response or NK cell activity in vitro by CD336 expression and/or lysis of the K562 tumor line. The invention further relates to a method for determining whether a subject has had a therapeutically effective response to a protein conjugate by assessing the NK activity of activated PBMCs from the subject.06-25-2009
20110070252MAGE-A3/HPV 16 PEPTIDE VACCINES FOR HEAD AND NECK CANCER - The present invention relates to Trojan antigens, and immunogenic compositions comprising the Trojan antigens. The present invention also relates to methods of generating an immune response in a subject using the Trojan antigens or immunogenic compositions. The present invention further relates to methods of treating squamous cell carcinoma of the head and neck (SCCHN) using the Trojan antigens and immunogenic compositions of the present invention.03-24-2011
20110070251CANCER VACCINE COMPOSITION - A cancer vaccine composition for human leukocyte antigen (HLA)-A*0206-positive persons, comprising a protein product of the tumor suppressor gene WT1 or a partial peptide thereof.03-24-2011
20110305720PEPTIDE ADJUVANTS - Adjuvant compositions comprising specific 5 mer polypeptides in combination with antigen delivery systems and/or immunostimulatory molecules, such as immunostimulatory nucleic acid sequences, for enhancing the immune response of a coadministered antigen, are described.12-15-2011
20120148613MULTIVALENT ENTRAIN-AND-AMPLIFY IMMUNOTHERAPEUTICS FOR CARCINOMA - The present invention provides a method of treating a cell proliferative disease such as cancer by providing to a subject in need thereof an immunogenic composition comprising plasmid and peptide(s) or analogues thereof. In embodiments of the present invention there is provided methods and compositions for inducing, entraining, and/or amplifying the immune response to MHC class-I restricted epitopes of carcinoma antigens to generate an effective anti-cancer immune response.06-14-2012
20120148612GRASS PEPTIDES FOR VACCINE - The present invention relates to compositions comprising peptides for preventing or treating allergy to house dust mites, and in particular to optimal combinations of peptides for preventing or treating said allergy.06-14-2012
20100129386Composotions And Methods For The Identification And Treatment Of Immune-Mediated Inflammatory Diseases - Compositions and methods for the therapy and diagnosis of immune-mediated inflammatory diseases, including inflammatory bowel disease (IBD), Crohn's disease and ulcerative colitis, are disclosed. Illustrative compositions comprise one or more bacterial polypeptides, immunogenic portions thereof, polynucleotides that encode such polypeptides, antigen presenting cell that expresses such polypeptides, and T cells that are specific for cells expressing such polypeptides. The disclosed compositions are useful, for example, in the diagnosis, prevention or treatment of immune-mediated inflammatory disease.05-27-2010
20100266623SYNTHETIC, SELF ADJUVANTING VACCINES - The present invention relates generally to the field of immunotherapy, and more particularly to immunomedicaments in the form of lipopeptides which induce an antibody response to drugs of dependence, and uses thereof in the treatment and prevention of drug addiction.10-21-2010
20100015168IMMUNOGENIC COMPOSITIONS FOR STREPTOCOCCUS AGALACTIAE - The invention relates to immunogenic polypeptides derived from epitopes in a Streptococcus agalactiae (“GBS”) protein GBS 80 and their use as prophylactic, diagnostic and therapeutic compositions. The invention also provides nucleic acids encoding the immunogenic polypeptides. Also provided are vectors useful for making such immunogenic polypeptides and host cells transformed with such vectors. In particular, the invention relates to a group immunogenic polypeptides derived from GBS 80. The compositions may include one or more of the immunogenic polypeptides either alone or with other antigenic components. For example, the immunogenic polypeptides may be combined with other GBS antigens to provide therapeutic compositions with broader range. In addition, the immunogenic polypeptides may also include flanking portions of the GBS 80 protein.01-21-2010
20100278849PROSTATIC ACID PHOSPHATASE ANTIGENS - The invention relates to peptides from Prostatic Acid Phosphatase (PAP), especially those identified as PAP.135 and PAP.161. The nucleic acid molecules encoding the peptides, antibodies against the peptides, and the use of such peptides, nucleic acids and antibodies in immunotherapy, vaccines and assays are also included in the scope of the invention.11-04-2010
20130011422Tumor Antigens for the Prevention and/or Treatment of Cancer - The present invention relates to a nucleic acid encoding a polypeptide and the use of the nucleic acid or polypeptide in preventing and/or treating cancer. In particular, the invention relates to improved vectors for the insertion and expression of foreign genes encoding tumor antigens for use in immunotherapeutic treatment of cancer.01-10-2013
20080317771Anti-Clusterin Oligoclonal Antibodies for Diagnosis and Prediction of the Aggressiveness of Tumours, Diagnostic Method and Related Kits - The invention concerns anti-clusterin oligoclonal antibodies able to recognize and bind in a selective and specific way antigenic epitopes of clusterin isoforms to be used in tumours diagnosis and in the prediction of their malignancy grade, diagnostic method and related kits.12-25-2008
20080220007EHRLICHIA CANIS GENES AND VACCINES - This invention provides the sequence of 5,299 nucleotides from the 09-11-2008
20090004210Method for Preventing and Treating Alzheimer's Disease - The invention relates to the use of a compound comprising the following amino acid sequence X01-01-2009
20110064756NOVEL SEQUENCES OF BRACHYSPIRA, IMMUNOGENIC COMPOUNDS, METHODS FOR PREPARATION AND USE THEREOF - Novel polynucleotide and amino acids of 03-17-2011
20110318374SPANX-B POLYPEPTIDES AND THEIR USE - It is disclosed herein that SPANX-B is uniquely expressed in a number of human tumors and that SPANX-B is an immunogenic antigen that is recognized by human T cells inducing helper CD412-29-2011
20120301492COMPOSITIONS AND METHODS FOR WT1 SPECIFIC IMMUNOTHERAPY - Compositions and methods for the therapy of malignant diseases, such as leukemia and cancer, are disclosed. The compositions comprise one or more of a WT1 polynucleotide, a WT1 polypeptide, an antigen-presenting cell presenting a WT1 polypeptide, an antibody that specifically binds to a WT1 polypeptide; or a T cell that specifically reacts with a WT1 polypeptide. Such compositions may be used, for example, for the prevention and treatment of metastatic diseases.11-29-2012
20110318372INDOLEAMINE 2,3-DIOXYGENASE BASED IMMUNOTHERAPY - The present invention relates to the field of prophylaxis and therapy of cancer. In particular there is provided a protein Indoleamine 2,3-dioxygenase (IDO) or peptide fragments here of that are capable of eliciting anti-cancer immune responses. Specifically, the invention relates to the use of DO or peptides derived here from or IDO specific T-cells for treatment of cancer. The invention thus relates to an anti-cancer vaccine which optionally may be used in combination with other immunotherapies and to IDO specific T-cells adoptively transferred or induced in vivo by vaccination as a treatment of cancer. It is an aspect of the invention that the medicaments herein provided may be used in combination with cancer chemotherapy treatment. A further aspect relates to the prophylaxis and therapy of infections by the same means as described above. The use of IDO and immunogenic peptide fragments hereof in cancer and infection treatment, diagnosis and prognosis is also provided.12-29-2011
20130011423METALLOPROTEINASE OLIGOPEPTIDES AND THEIR THERAPEUTIC USE - The invention discloses identification and therapeutic use of matrix metalloproteinase oligopeptides, SEQID 5-SEQID 21. These oligopeptides are bound to antibodies to create an immune response in the subject mammal against the matrix metalloproteinases of various diseases. This is a means of therapeutic intervention against the disease spread created by the matrix metalloproteinases. Further use of these oligopeptide-antibody responses can be extended to any and all diseases that use the matrix metalloproteinases to aid in their pathogenicity.01-10-2013
20120114682PEPTIDES FOR BINDING FIBRINOGEN AND FIBRIN - Compositions and methods for targeting substances to fibrinogen, fibrin monomers, or fibrin polymers are provided. These compositions and methods generally involve the use of fibrin knob peptides that bind fibrin(ogen), which can be used to detect fibrin(ogen) and modulate fibrin polymerization and fibrinolysis.05-10-2012
20120003254Breast Cancer Vaccine - Compositions and methods for immunization against human breast cancer are disclosed. A breast cancer vaccine comprises an immunogenic polypeptide comprising human α-lactalbumin.01-05-2012
20120003253C1ORF59 PEPTIDES AND VACCINES INCLUDING THE SAME - The present invention provides isolated peptides having the amino acid sequence of SEQ ID NO: 43 or immunologically active fragments thereof, which bind to HLA antigen and have cytotoxic T lymphocyte (CTL) inducibility. The present invention further provides peptides which include one, two, or several amino acid insertions, substitution or addition to the aforementioned peptides or fragments, but still have the cytotoxic T cell inducibility. Further provided are nucleic acids encoding any of these aforementioned peptides as well as pharmaceutical agents and compositions including any of the aforementioned peptides or nucleic acids. The peptides, nucleic acids, pharmaceutical agents and compositions of this invention may be used for treating cancer or tumor.01-05-2012
20090028888Cancer Antigen Mage-A9 and Uses Thereof - The present invention relates to the detection of MAGE-A9 in a biological sample and to the diagnosis, prevention and treatment of MAGE-A9-associated aberrant cell growth, through the targeting of the MAGE-A9 polypeptide and/or polynucleotide. Diagnosis is accomplished by examining or monitoring cells for perturbations in MAGE-A9 expression. Prevention and treatment are accomplished by administering to a subject MAGE-A9 as a protein or a fragment thereof or under form of a DNA expression vector, as well as by administering to a subject a MAGE-A9 gene product-binding agent. Compositions and commercial kits are also provided.01-29-2009
20120207775Immunogenic Epitopes as Targets for Universal Cancer Vaccines - The present invention provides a peptide having an amino acid sequence as set forth in SEQ ID NOs: 1 through 95 and any combination thereof. The peptide or combination of peptides possess OCT4 specific inducibility. The peptide or combination of peptides can further be used as a vaccine.08-16-2012
20120009209ENRICHMENT AND PURIFICATION OF INFECTIOUS PRION PROTEINS - Peptide sequences that specifically bind infectious prion protein for the generation of antibodies and therapeutic agents are disclosed herein.01-12-2012
20120009210HYPALLERGENIC MOSAIC ANTIGENS AND METHODS OF MAKING SAME - Hypoallergenic mosaic antigens assembled from naturally-occurring allergens are disclosed herein. Also disclosed are methods of making such hypoallergenic mosaic antigens, particularly those derived from plant allergens such as timothy grass pollen (Phl p 1 and Phl p 2) and birch pollen (Bet v 1). In a particularly preferred embodiment, the method of making the hypoallergenic mosaic antigen involves the steps of (a) cleaving a naturally-occurring allergen into at least two, preferably at least three non-overlapping peptide fragments and (b) recombining the peptide fragments such that the mosaic antigen includes all or substantially all of the amino acids of the original naturally-occurring allergen, though in a different order.01-12-2012
20090324630FUSION MULTIVIRAL CHIMERIC ANTIGEN - Novel recombinant vectors encoding viral antigens within a single vector or construct are disclosed. The vectors may be used to initiate immunological responses to antigens and to combat opportunistic and other infections. Viral antigens include those derived from CMV, EBV, adenovirus (Ad), Influenza A, herpes simplex, varicella, polyoma virus and respiratory viruses. A recombinant vector or construct may encode two antigenic peptides, three antigenic peptides (“TriVi”), or more than three antigenic peptides. Methods of making and other methods of using the novel recombinant vectors or constructs are also disclosed.12-31-2009
20090081247Immune adjuvant comprising ATP - This invention relates to an immunoadjuvant, which has an excellent antibody production enhancing function and is highly safe, and a vaccine composition comprising the immunoadjuvant. More specifically, the present invention relates to an immunoadjuvant comprising ATP or its pharmaceutically acceptable salt, its solvate, or its derivative having a physiological function as an active ingredient, and a vaccine composition comprising the immunoadjuvant.03-26-2009
20120045466IDENTIFICATION OF ANTIGENIC PEPTIDES FROM MULTIPLE MYELOMA CELLS - Multiple myeloma (MM) is a clonal B cell malignancy and remains essentially incurable by conventional anti-tumor therapy. Patients with MM have a median survival of only three years. MM is characterized by proliferation and accumulation of mature plasma cells in the bone marrow (BM) leading to bone destruction, BM failure, anemia, and reduced immune function. The identification of MHC Class I, HLA-A2, associated peptides presented on multiple myeloma cells is an important step in developing immunotherapies for MM. Presented here are methods for creating activated T lymphocytes that are cytotoxic to both peptide loaded T2 target cells and multiple myeloma cell lines.02-23-2012
20120045465CANCER ANTIGEN HELPER PEPTIDE - The present invention relates to a WT1 peptide which has an amino acid sequence consisting of contiguous amino acids derived from a WT1 protein and induces WT1-specific helper T cells by binding to an MHC class II molecule, a pharmaceutical composition comprising them and the like.02-23-2012
20120045464CRYPTOSPORIDIUM PARVUM ANTIGENS, ANTIBODIES THERETO AND DIAGNOSTIC AND THERAPEUTIC COMPOSITIONS THEREOF - Cloning and expression of genes encoding 02-23-2012
20120014979USE OF BCL6 INHIBITORS FOR TREATING AUTOIMMUNE DISEASES - The present invention provides a method of treatment of an autoimmune disease, comprising administering an effective amount of a BCL6 inhibitor to an individual in need thereof.01-19-2012
20120014978COMPOSITIONS WITH REDUCED DIMER FORMATION - The present invention relates to the use of a non-reducing carbohydrate or carbohydrate derivative and at least one agent which inhibits dimer formation in a freeze-dried composition comprising at least one peptide that contains a free cysteine residue, to provide a freeze-dried composition with improved long-term storage stability.01-19-2012
20120014977NOVEL ALTERNATIVE SPLICING VARIANT OF OATP1B3 mRNA - [PROBLEM TO BE SOLVED] An object of the present invention is to provide a novel tumor marker and use thereof. In more detail, the present invention provides a novel tumor marker, a method for measuring said tumor marker and a measurement kit, a method for detecting cancer using the same, a kit for detecting cancer, a method for screening a preventive and/or therapeutic agent for cancer, as well as a medicament such as cancer vaccine.01-19-2012
20080279871Immunogenic composition - The invention provides compositions and methods related to human telomerase reverse transcriptase (hTRT), the catalytic protein subunit of human telomerase. The polynucleotides and polypeptides of the invention are useful for diagnosis, prognosis and treatment of human diseases, for changing the proliferative capacity of cells and organisms, and for identification and screening of compounds and treatments useful for treatment of diseases such as cancers.11-13-2008
20090087447Novel HCV non-structural polypeptide - Polypeptides comprising a mutant non-structural Hepatitis C virus useful in diagnostic and/or immunogenic compositions are disclosed, in which the mutant is an N-terminal mutation that functionally disrupts the catalytic domain of NS3. Polynucleotides encoding these polypeptides, host cells transformed with polynucleotides and methods of using the polypeptides and polynucleotides are also disclosed.04-02-2009
20090214582METHODS FOR IDENTIFYING AN EPITOPE OF A POLYPEPTIDE, CHLAMYDIAL ANTIGENIC POLYPEPTIDES IDENTIFIED THEREBY, AND METHODS OF USE THEREOF - The present invention provides a method of classifying an epitope displayed by a polypeptide; a method of determining the presence of an epitope on a polypeptide encoded by a test nucleotide sequence; and a method of generating a nucleotide sequence encoding a polypeptide that exhibits a selected epitope. The present invention provides antigenic polypeptides that display selected epitope(s); chimeric macromolecules comprising such polypeptides; and compositions comprising the antigenic polypeptides or chimeric macromolecules. The present invention further provides methods of inducing an immune response to a 08-27-2009
20120058135Identification and characterization of racemases, definition of protein signatures, and a test for detecting D-amino acid and for screening molecules capable of inhibiting the activity of racemase, especially proline racemase - This invention relates to the identification and characterization of racemases and definition of protein signatures of these racemases. More particularly, this invention relates to the identification of nucleic acid molecules encoding a peptide consisting of a motif characteristic of the protein signatures, and to the peptides consisting of these motifs and more specifically SEQ ID NOS: 1-4. This invention also relates to antibodies specific for the peptides and to immune complexes of these antibodies with the peptides. Further, the invention relates to methods and kits for detecting racemases using the nucleic acid molecules of the invention, as well as the peptides consisting of the motifs and antibodies to these peptides.03-08-2012
20120177674COMPOSITIONS COMPRISING FUNGAL IMMUNOMODULATORY PROTEIN AND USE THEREOF - This invention relates to a method for stimulation or an activation of immunological function directed to activate natural killer cells and macrophages or increase production of serum antibody in a patient in need of such stimulation or activation, comprising administering an isolated and/or purified polypeptide of a fungal immunomodulatory protein. This invention also relates to a method for suppressing proliferation of a cancer cell and a method for suppressing a tumor cell mobility, comprising providing to the tumor cell a purified polypeptide of a fungal immunomodulatory protein.07-12-2012
20120177672THERAPEUTIC PEPTIDES, POLYPEPTIDES AND NUCLEIC ACID SEQUENCES - Described are isolated peptides (GLGGGDLSV, SLNESQIKI, LMLPAVLQA and FTAEQLQRL) derived from portions of the Engrailed-2 (EN2) protein. Also described is their use in therapy, in particular in relation to the prevention and treatment of cancer.07-12-2012
20120177671HLA-G ALPHA 1 MULTIMERS AND PHARMACEUTICAL USES THEREOF - The present invention relates to alpha 1 multimers and the uses thereof. The invention also relates to methods of producing such multimers, pharmaceutical compositions comprising the same, as well as their uses for treating various diseases including organ/tissue rejection.07-12-2012
20120156232CANCER VACCINES AND VACCINATION METHODS - Methods and compositions for treating cancers (e.g., neural cancers) by dendritic cell vaccination are provided herein.06-21-2012
20100203069Antisense Respiratory Syncytial Virus Vaccine and Therapy - A method is provided for immunizing against pulmonary inflammation and airway hyperresponsiveness associated with infantile RSV infection. This method includes administering an antisense oligonucletide to a subject in need thereof.08-12-2010
20110020379Cobalamin Assay - The present invention provides a specific binding partner for holoTC having a specificity for holoTC over apoTC of at least 40-fold and an assay method for assaying for holoTC in a sample, the method comprising contacting the sample with a specific binding partner for holoTC and detecting the resultant conjugates.01-27-2011
20120156233VACCINE THERAPY FOR CHOROIDAL NEOVASCULARIZATION - The present invention provides novel pharmaceutical agents and methods for treating or preventing diseases caused by neovascularization in human choroid (neovascular maculopathy). The present invention provides pharmaceutical compositions and vaccines for treating and/or preventing diseases caused by neovascularization in human choroid (neovascular maculopathy), comprising at least one type each of a peptide comprising an amino acid sequence derived from a VEGFR-1 protein and having an activity of inducing cytotoxic T cells, and a peptide comprising an amino acid sequence derived from a VEGFR-2 protein and having an activity of inducing cytotoxic T cells.06-21-2012
20120156231FOXM1 PEPTIDES AND VACCINES CONTAINING THE SAME - The present invention provides isolated peptides having the amino acid sequence of SEQ ID NO: 34 or fragments thereof, which bind to HLA antigen and induce cytotoxic T lymphocyte (CTL). The present invention further provides peptides which include one, two, or several amino acid insertions, substitution or addition to the aforementioned peptides or fragments, but still have the cytotoxic T cell inducibility. Further provided are nucleic acids encoding any of these aforementioned peptides as well as pharmaceutical substances or compositions including any of the aforementioned peptides or nucleic acids. The peptides, nucleic acids, pharmaceutical substances or compositions of the present invention may be used for treating cancer or tumor.06-21-2012
20120282286PEPTIDE VACCINES FOR CANCERS EXPRESSING MPHOSPH1 OR DEPDC1 POLYPEPTIDES - The present invention provides peptides having an amino acid sequence as set forth in SEQ ID NO: 7, 8, 9, 10, 11, 12, 192, 195, 197, 209, 225, 226, 228, 230, 240, 241, 243, 244, 249, 253, 254 or 255, as well as peptides having the above-mentioned amino acid sequences in which 1, 2, or several amino acids are substituted, deleted, or added, wherein the peptides possess cytotoxic T cell inducibility. The present invention also provides drugs for treating or preventing a disease associated with the over-expression of MPHOSPH1 and/or DEPDC1, e.g. cancers, containing these peptides as an active ingredient. The peptides of the present invention can also be used as vaccines.11-08-2012
20090181044Novel Flavivirus antigens - The invention provides polynucleotides and polypeptides encoded therefrom having advantageous properties, including an ability to induce an immune response to flaviviruses. The polypeptides and polynucleotides of the invention are useful in methods of inducing immune response against flaviviruses, including dengue viruses. Compositions and methods for utilizing polynucleotides and polypeptides of the invention are also provided.07-16-2009
20120156234MEANS FOR TREATING SYNUCLEINOPATHIES - The present invention relates to peptides or polypeptides for producing medicaments for preventing and/or treating synucleinopathies.06-21-2012
20120107335Synthetic Oligopeptides Designed From Mite Cysteine Proteases and Methods for the Production of - The invention refers to the design, synthesis and evaluation of 6 synthetic oligopeptides, that have not been previously described, designed from the T and B epitopes of allergens of group I of intradomiciliary mites of the species 05-03-2012
20120107333VANGL1 PEPTIDES AND VACCINES INCLUDING THE SAME - The present invention provides isolated peptides or the fragments derived from SEQ ID NO: 35, which bind to an HLA antigen and induce cytotoxic T lymphocytes (CTL). The peptides may include one of the above mentioned amino acid sequences with substitution, deletion, or addition of one, two, or several amino acids sequences. The present invention also provides pharmaceutical compositions including these peptides. The peptides of this invention can be used for treating cancer.05-03-2012
20110091494PEPTIDES PROTECTIVE AGAINST S. PNEUMONIAE AND COMPOSITIONS, METHODS AND USES RELATING THERETO - The present invention relates to a protective peptide of 04-21-2011
20110091492ESCHERICHIA COLI IMMUNOGENS WITH IMPROVED SOLUBILITY - Variants of the pathogenic 04-21-2011
20110091491HIV-1 GP41 NEUTRALIZATION DOMAIN AND USE THEREOF - The invention relates to a region of the HIV-I gp41 protein that contains, at least in part, an epitope that allows potent neutralization of resistant virus particles. This site is present in the C-terminal heptad repeat region of gp41 (HR2), and adjacent to, but distinct from the MPER. Vaccines containing this region as well as monoclonal antibodies which specifically bind to this region and neutralize an HIV-I primary isolate are also provided as is a method for stimulating the formation of antibodies that neutralize infection by an HIV isolate.04-21-2011
20110091490NOVEL VACCINE FOR DOG - This invention provides vaccines against canine distemper virus infections, canine adenovirus type 2 infections, and canine parvovirus infections that can be orally administered. The invention also provides the attenuated canine distemper virus strain obtained by adapting the canine distemper virus 95-54 strains in cultured cells to attenuate the same, the attenuated canine adenovirus type 2 strain obtained by adapting the canine adenovirus type 2 F1 strain in cultured cells to attenuate the same, and an attenuated canine parvovirus strain obtained by adapting the canine parvovirus F3 strain in cultured cells to attenuate the same.04-21-2011
20110091489SURVIVIN PEPTIDE VACCINE - The present invention relates to a therapeutic vaccine comprising one or more survivin polypeptide fragments. The vaccine can be used for prophylactic, ameliorating and/or curative treatment of e.g. cancer diseases. The invention further relates to methods of combination treatment.04-21-2011
20100255019Ii-KEY/HER-2/NEU HYBRID CANCER VACCINE - Provided are methods and compositions for treating cancer in humans, the cancer being characterized by expression of Her-2/neu. The methods involve vaccinating a patient with an Ii-Key/MHC class II hybrid construct and thereby stimulating an immune response to the native Her-2/neu protein. The construct may be in the form of an Ii-Key hybrid peptide or a nucleic acid encoding an Ii-Key hybrid peptide. Methods are described wherein the cancer being treated is breast cancer. Also claimed is a pharmaceutical composition comprising an Ii-Key/MHC class II hybrid construct with and without an adjuvant. The adjuvant can include GM-CSF. The Ii-Key hybrid construct includes the LRMK [SEQ ID NO.: 2] residues of Ii-Key protein and an MHC Class II epitope of a protein or portion thereof which is used in the vaccine or a DNA encoding the same hybrid peptide.10-07-2010
20100291127TUMOR ASSOCIATED ANTIGEN PEPTIDES AND USE OF SAME AS ANTI-TUMOR VACCINES - The present invention relates to tumor associated antigen (TAA) peptides and to use of same, of polynucleotides encoding same and of cells presenting same as anti-tumor vaccines. More particularly, the present invention relates to tumor associated antigen peptides derived from Uroplakin Ia, Ib, II and III, Prostate specific antigen (PSA), Prostate acid phosphatase (PAP) and Prostate specific membrane antigen (PSMA), BA-46 (Lactadherin), Mucin (MUC-1), and Teratocarcinoma-derived growth factor (CRIPTO-1) and the use of same as anti-tumor vaccines to prevent or cure bladder, prostate, breast or other cancers, carcinomas in particular. Most particularly, the present invention relates to tumor associated antigen peptides which are presentable to the immune system by HLA-A2 molecules.11-18-2010
20100291126PROTEIN SHOWING ENHANCED EXPRESSION IN CANCER CELLS - A novel gene (designated 101P3A11 or PHOR-1) and its encoded protein, and variants thereof, are described wherein 101P3A11 exhibits tissue specific expression in normal adult tissue, and is aberrantly expressed in the cancers listed in Table I. Consequently, 101P3A11 provides a diagnostic, prognostic, prophylactic and/or therapeutic target for cancer. The 101P3A11 gene or fragment thereof, or its encoded protein, or variants thereof, or a fragment thereof, can be used to elicit a humoral or cellular immune response; antibodies or T cells reactive with 101P3A11 can be used in active or passive immunization.11-18-2010
20100291124Extracellular serine protease - The present invention provides a DNA encoding a novel extracellular serine protease termed Tumor Antigen Derived Gene-14 (TADG-14) which is overexpressed in ovarian, breast and colon carcinoma samples. Also provided are vector and host cells capable of expressing the DNA of the present invention, as well as the uses of the DNA and protein of the present invention. Also provided is a TADG-14 protein variant that has a potential role for detecting and targeting of ovarian carcinomas.11-18-2010
20100291123T Cell Receptor CDR3 Sequences and Methods for Detection - The present invention relates generally to the field of treating autoimmune diseases, such as multiple sclerosis (MS), rheumatoid arthritis (RA) and others. Methods of treating and monitoring an autoimmune disease by utilizing T-cell receptors peptides are disclosed. Nucleic acid and peptide sequences of T-cell receptors found in a population of MS patients are also disclosed.11-18-2010
20110104190MODIFIED BETA-LACTOGLOBULINS FOR IMMUNOTHERAPY OF MILK ALLERGY - The present invention is related to field of allergic (hypersensitivity) diseases and provides a method for producing modified allergenic polypeptides for use in immunotherapies. In the method of the invention, said allergenic polypeptides are modified so that they are not capable to form transient dimers. The invention also provides modified β-lactoglobulins for use in immunotherapy of milk allergy.05-05-2011
20120121625PEPTIDE - The present invention provides peptides at least partly derivable from FVIII which are capable of binding to an MHC class II molecule without further antigen processing and being recognised by a factor VIII specific T cell. In particular, the present invention provides a peptide comprising or consisting of the sequence EDNIMVTFRNQASR. The present invention also relates to the use of such a peptide for the prevention or suppression of inhibitor antibody formation in haemophilia A and/or acquired haemophilia.05-17-2012
20100092500NOVEL IMMUNOGENIC LIPOPEPTIDES COMPRISING T-HELPER AND B-CELL EPITOPES - The present invention provides synthetic immunogenic lipopeptide molecules comprising co-linear T-helper and B cell epitopes, and methods for their production and use in the generation of primary and secondary immune responses, and for the vaccination of animal subjects against particular antigens. More particularly, the present invention provides highly soluble lipopeptides wherein the lipid moiety is attached to the terminal side-chain group of an internal lysine or lysine analog, preferably to the terminal side-chain group of an internal diamino acid residue. Preferably the internal lysine or lysine analog is positioned between the T-helper epitope and the B cell epitope or within the T-helper epitope.04-15-2010
20100092501FOXP3 PEPTIDE VACCINE - The present invention provides Foxp3 peptides comprising the amino acid sequence of SEQ ID NOs: 3-5, 7-9, 12, 15-19, 22, 24, 27-30, 37, 67 or 74, and Foxp3 peptides comprising the above-mentioned amino acid sequences in which 1, 2, or several amino acids are substituted or added, and having cytotoxic T cell inducibility, and also provides drugs for regulating regulatory T cells comprising these Foxp3 peptides. The Foxp3 peptides of this invention find use as vaccines.04-15-2010
20100092499Alpha Thymosin Peptides as Cancer Vaccine Adjuvants - A pharmaceutical combination and method for enhancing cancer vaccine effectiveness in a subject, utilize an immune response-triggering cancer vaccine capable of eliciting an immune system response in a subject; and a vaccine effectiveness-enhancing amount of an alpha thymosin peptide, which enhances the immune system response in the subject, wherein the cancer vaccine and the alpha thymosin peptide can be administered separately or together.04-15-2010
20120121626Chimeric VEGF Peptides - Compositions for and methods of treating patients with malignancies associated with overexpression of VEGF, particularly ovarian cancer are provided herein. The compositions include but are not limited to certain VEGF epitopes, multivalent peptides comprising the epitopes, and chimeric peptides comprising one or more of the epitopes and a T cell epitope.05-17-2012
20120164164MULTIMERIC POLYPEPTIDES OF HLA-G INCLUDING ALPHA1-ALPHA3 MONOMERS AND PHARMACEUTICAL USES THEREOF - Multimeric polypeptides and pharmaceutical uses thereof; multimers comprising alpha3 and alpha1 peptides of an HLA-G antigen and methods of producing such multimers, pharmaceutical compositions comprising the same, as well as their uses for treating various diseases including organ/tissue rejection. Said multimers comprise at least two monomers, each of said monomers being selected in the group consisting of a peptide P2 of formula P1-X3 or X2-X3, wherein P1 is of formula X1-X2, wherein X1 represents a peptidic linker including a cysteine amino acid and X2 represents an alpha1 domain (or alpha1 peptide) of HLA-G and X3 represents an alpha3 domain of HLA-G.06-28-2012
20120164163CDC45L PEPTIDES AND VACCINES INCLUDING THE SAME - The present invention provides isolated peptides or the fragments derived from SEQ ID NO: 18, which bind to an HLA antigen and induce cytotoxic T lymphocytes (CTL). The peptides may include one of the above mentioned amino acid sequences with substitution, deletion, or addition of one, two, or several amino acids sequences. The present invention also provides pharmaceutical compositions including these peptides. The peptides of the present invention can be used for treating cancer.06-28-2012
20100247558PEPTIDES INDUCING A CD4i CONFORMATION IN HIV gp120 WHILE RETAINING VACANT CD4 BINDING SITE - A novel peptides are complexed with HIV-I envelope protein gp120, and causes the protein to assume a CD4i conformation but without occluding the CD4 binding-site of gp120. This peptide-gp120 complex is immunogenic and, upon immunization of subjects, induces broadly-neutralizing antibodies directed to the CD4 binding site of gp120. The peptide preferably consists of a sequence of 8-20 amino acid residues which comprises (a) a core sequence Arg-Xaa09-30-2010
20090130131Antigen-Drug Vehicle Enabling Switch From Selective Production of IgA Antibody to Production of Both of IgA and IgG Antibodies and Transnasal/Mucosal Vaccine Using the Same - In the aim of practical utilization of a safe and effective transnasal/inactivated/mucosal vaccine and establishment of a technology for imparting capacity of producing both of IgA and IgG antibodies to a conventional inactivated vaccine, toxoid; allergen, or the like, a means for prevention and treatment of allergy, and the like, it is intended to provide an antigen-drug vehicle (AD vehicle) enabling transnasal, transmucosal, and transdermal administrations, an inactivated vaccine simultaneously inducing a mucosal immunity and humoral immunity by using the AD vehicle, a production method of the inactivated vaccine, an AD vehicle enabling a switch from induction of selective production of IgA antibody to induction of both of IgA and IgG antibodies, and a transnasal vaccine, a mucosal vaccine, a therapeutic/prophylactic agent for allergy, and the like using the AD vehicle.05-21-2009
20090130130MUTANT ALLERGEN(S) - There is provided an isolated polypeptide, derivative, isoform and/or fragment thereof, wherein the polypeptide is a mutant of a Group 5 allergen. There are also provided pharmaceutical compositions(s) and vaccine(s) for the treatment of subjects allergic to at least one Group 5 allergen.05-21-2009
20090130132Anti-caveolin-1 polyclonal antibody, and antigen peptide sequence and method for preparing the same - The present invention provides a highly specific anti-Caveolin-1 polyclonal antibody, which is prepared by the following steps: (1) providing an antigen comprising a fragment of Caveolin-1 peptide sequence SEQ ID NO: 1; and (2) subcutaneously injecting said antigen into a rabbit to produce the anti-Caveolin-1 polyclonal antibody. The present invention also provides an antigen and a method used for preparing the anti-Caveolin-1 polyclonal antibody, and a kit used for detecting Caveolin-1 in a specimen.05-21-2009
20120128706IMMUNE ADJUVANT COMPRISING ATP - This invention relates to an immunoadjuvant, which has an excellent antibody production enhancing function and is highly safe, and a vaccine composition comprising the immunoadjuvant. More specifically, the present invention relates to an immunoadjuvant comprising ATP or its pharmaceutically acceptable salt, its solvate, or its derivative having a physiological function as an active ingredient, and a vaccine composition comprising the immunoadjuvant.05-24-2012
20120128705C6ORF167 PEPTIDES AND VACCINES CONTAINING THE SAME - Peptide vaccines against cancer are described herein. In particular, epitope peptides derived from the C6orf167 gene that elicit CTLs are provided. Antigen-presenting cells and isolated CTLs that target such peptides, as well as methods for inducing the antigen-presenting cell, or CTL are also provided. The present invention further provides pharmaceutical compositions containing peptides derived from C6orf167 or polynucleotides encoding the polypeptides as active ingredients. Furthermore, the present invention provides methods for the treatment and/or prophylaxis of (i.e., preventing) cancers (tumors), and/or the prevention of postoperative recurrence thereof, as well as methods for inducing CTLs, methods for inducing anti-tumor immunity, using the peptides derived from C6orf167, polynucleotides encoding the peptides, or antigen-presenting cells presenting the peptides, or the pharmaceutical compositions of the present invention.05-24-2012
20120128704REPERTOIRE OF ALLO-RESTRICTED PEPTIDE-SPECIFIC T CELL RECEPTOR SEQUENCES AND USE THEREOF - The present invention is directed to a kit-of-parts or composition containing nucleic acid sequences coding for high-avidity, allo-restricted TCR, wherein the TCR are independently directed against the tyrosinase antigen, the melan-A antigen and the survivin antigen. The invention is further directed to a kit-of-parts or composition containing at least three groups of transgenic lymphocytes transformed with vectors coding for TCR against said antigens. Furthermore, the present invention provides a pharmaceutical composition and its use in the treatment of diseases involving malignant cells expressing said tumor-associated antigens. The invention further relates to a nucleic acid molecule coding for a TCR that recognizes the survivin antigen, a TCR encoded thereby and a T cell expressing said TCR. Further, the invention discloses a vector, a cell and a pharmaceutical composition encoding/containing same and their use in the treatment of diseases involving malignant cells expressing survivin.05-24-2012
20120213809VAULT COMPLEXES FOR CYTOKINE DELIVERY - The invention relates to compositions of vault complexes containing recombinant cytokine fusion proteins that include a cytokine and a vault targeting domain, and methods of using the vault complexes to deliver the cytokines to a cell or subject, and methods for using the compositions to treat cancer, such as lung cancer.08-23-2012
20110182922PEPTIDES OF IL1 BETA AND TNF ALPHA AND METHOD OF TREATMENT USING SAME - The present invention relates to peptides derived from the proinflammatory cytokines, interleukin-1β (IL1β) and tumor necrosis factor α (TNFα), and their use in human or veterinary therapy, such as to generally treat diseases linked to the overproduction of IL1β or TNFα as well as acute or chronic inflammatory diseases, rheumatoid arthritis, septic shock, autoimmune diabetes, graft rejection in the host, etc.07-28-2011
20110182921REGULATORY T CELL EPITOPES, COMPOSITIONS AND USES THEREOF - The invention is directed to T cell epitopes wherein said epitopes comprises a peptide or polypeptide chain comprising at least a portion of an immunoglobulin constant or variable region. The invention also relates to methods of using and methods of making the epitopes of the invention.07-28-2011
20120135019FVIII PEPTIDES FOR IMMUNE TOLERANCE INDUCTION AND IMMUNODIAGNOSTICS - The present invention is related to peptides that can be used to reduce the immune response against FVIII or to induce tolerance to human FVIII in patients with, e.g., hemophilia A. Furthermore, the peptides can be used for immunodiagnostic purposes to detect FVIII-specific CD405-31-2012
20120219574ANTIGEN SURROGATES IN AUTOIMMUNE DISEASE - The present invention provides for the identification of an antigen surrogate to the native antigens for the autoimmune disease pemphigus vulgaris. Ligands are discovered using large random peptoid or cyclic peptoid libraries that are screened against known antibodies to autoimmune diseases. The ligands may be useful as drugs in the treatment of such diseases and can also be used in combination with the concomitant removal of T-cells associated with autoimmune disorders.08-30-2012
20120135020TTK PEPTIDES AND VACCINES INCLUDING THE SAME - Peptide vaccines against cancer are described herein. In particular, epitope peptides derived from the TTK gene that elicit CTLs are provided. Antigen-presenting cells and isolated CTLs that target such peptides, as well as methods for inducing the antigen-presenting cell, or CTL are also provided. The present invention further provides pharmaceutical compositions containing as active ingredients peptides derived from TTK or polynucleotides encoding the peptides. Furthermore, the present invention provides methods for the treatment and/or prophylaxis (i.e., prevention) of cancers (tumors), and/or the prevention of postoperative recurrence thereof, as well as methods for inducing CTLs, methods for inducing anti-tumor immunity, using the peptides derived from TTK, polynucleotides encoding the peptides, or antigen-presenting cells presenting the peptides, or the pharmaceutical compositions of the present invention.05-31-2012
20120135018ERG MONOCLONAL ANTIBODIES - Monoclonal antibodies, or antigen-binding fragments thereof, that bind to ERG, and more specifically, to an epitope formed by amino acids 42-66 of ERG3 are disclosed. The monoclonal antibodies can be non-human antibodies (e.g., rabbit or mouse) or humanized monoclonal antibodies having the CDR regions derived from those non-human antibodies. In other embodiments, the monoclonal antibodies are chimeric, having the light and heavy chain variable regions of a non-human ERG anti-body. Methods of using the antibodies to detect ERG, or fusion proteins comprising all or part of an ERG polypeptide, such as an ERG polypeptide encoded by a TMPRSS2/ERG, SLC45A3/ERG, or NDRG1/ERG fusion transcript, are also provided, including methods of detecting ERG or ERG fusion events in a clinical setting. The antibodies can also be used to inhibit the activity of ERG or fusion proteins comprising all or part of an ERG polypeptide, such as an ERG polypeptide encoded by a TMPRSS2/ERG, SLC45A3/ERG, or NDRG1/ERG fusion transcript and to treat malignancies associated with overexpression of ERG or an ERG fusion event, such as prostate cancer, Ewing's sarcoma, acute myeloid leukemia, acute T-lymphoblastic leukemia, endothelial cancer, and colon cancer.05-31-2012
20100172922Expression and Purification of HIP/PAP and Uses Therefor - The present invention relates to methods of compositions comprising RegIII and HIP/PAP proteins, including the use of such proteins as diagnostic and therapeutic targets.07-08-2010
20120219575Peptide Sequences and Compositions - Provided is a polypeptide having no more than 100 amino acids, which polypeptide comprises one or more sequences having at least 60% homology with any of SEQ ID 1-6, or comprises two or more epitopes having 7 amino acids or more, each epitope having at least 60% homology with a sub-sequence of any of SEQ ID 1-6 that has the same length as the epitope:08-30-2012
20120219573DISULFIDE-LINKED POLYETHYLENEGLYCOL/PEPTIDE CONJUGATES FOR THE TRANSFECTION OF NUCLEIC ACIDS - The present invention is directed to an inventive polymeric carrier molecule according to generic formula (I) and variations thereof, which allows for efficient transfection of nucleic acids into cells in vivo and in vitro, a polymeric carrier cargo complex formed by a nucleic acid and the inventive polymeric carrier molecule, but also to methods of preparation of this inventive polymeric carrier molecule and of the inventive polymeric carrier cargo complex. The present invention also provides methods of application and use of this inventive polymeric carrier molecule and the inventive polymeric carrier cargo complex as a medicament, for the treatment of various diseases, and in the preparation of a pharmaceutical composition for the treatment of such diseases.08-30-2012
20120251563MODULATION OF IMMUNE RESPONSE BY NON-PEPTIDE BINDING STRESS RESPONSE POLYPEPTIDES - A recombinant stress response polypeptide that lacks an antigen binding domain, and methods for using the recombinant stress response polypeptide to elicit an immune response, for example an anti-tumor response, in a subject.10-04-2012
20120171234Novel Biologically Active Peptides and their New Uses - Novel peptides are disclosed with their use as a pharmaceutical composition. A method is also disclosed for making pharmaceutical compositions and treatment of an individual.07-05-2012
20120171233PEPTIDE INHIBITORS FOR MEDIATING STRESS RESPONSES - The present invention relates to peptides capable of inhibiting cellular and immune stress responses in a eukaryotic cell. The invention provides compositions and methods for the treatment of human degenerative diseases and inflammation, utilizing these peptides.07-05-2012
20120171231USE OF NUTRITIONAL COMPOSITIONS INCLUDING LACTOFERRIN IN STIMULATING IMMUNE CELLS - The present disclosure relates to the use of nutritional compositions including lactoferrin produced by a non-human source in stimulating innate immune cells, such as macrophages, neutrophils, and dendritic cells.07-05-2012
20120076809METHOD TO INHIBIT THE BIOLOGICAL ACTIVITY OF CALCINEURIN WITH SELECTIVE PEPTIDES - The invention relates to the biotechnology sector involving the area of human health. More specifically, the invention is based on the surprising usefulness of peptides LxVPc1, c3 and c4 as efficient selective inhibitors of the calcineurin signalling pathway (CN)-NFAT and the phosphate activity of CN. Said compounds are useful immunosuppressors and serve as a base for the preparation of therapeutic compositions for the prophylactics and treatment of human diseases associated with T-lymphocyte activation, including, but not limited to, autoimmune diseases, inflammation and allergy or transplant rejections. In addition, said peptides and the associated biological and genetic material can form useful tools for the development of tests that can be used to find compounds that have a selective antagonist activity in relation to CN.03-29-2012
20120076808COMBINED ANTIGEN AND DNA VACCINE FOR PREVENTING AND TREATING AUTOIMMUNE DISEASES - The present invention relates to treating and preventing symptoms of an allergy, asthma, an autoimmune disease, and transplant rejection using a combination vaccine containing an antigen and a DNA encoding the antigen.03-29-2012
20120076807PLASMIDS WITH IMMUNOLOGICAL ACTION - Recombinant plasmids usable for the transfection of eukaryotic and prokaryotic cells are described; such plasmids have a length comprised between 7 and 12 kbases and comprise a sequence encoding the heavy chain of an immunoglobulin; in particular, they may be used: 03-29-2012
20120076806Chloramphenicol Acetyl Transferase (CAT)-Defective Somatostatin Fusion Protein And Uses Thereof - Chimeric somatostatin-based polypeptides, polynucleotides used to encode the polypeptides, the methods for isolating and producing the polypeptides and the uses thereof are provided. In addition, low cost adjuvants for enhanced immunogenic response are provided. Vaccinations that include both chimeric somatostatin-based polypeptides and novel adjuvants are included, useful in facilitating farm animal productivity.03-29-2012
20100047262NOVEL METHOD FOR DOWN-REGULATION OF AMYLOID - Disclosed are novel methods and compositions for combating diseases characterized by deposition of amyloid. The methods generally rely on immunization against amyloid precursor protein (APP) or beta amyloid (Aβ). Immunization is preferably effected by administration of analogues of autologous APP or Aβ, said analogues being capable of inducing antibody production against the autologous amyloidogenic polypeptides. Especially preferred as an immunogen is autologous Aβ which has been modified by introduction of one single or a few foreign, immunodominant and promiscuous T-cell epitopes. Such methods and means include methods for the preparation of analogues and pharmaceutical formulations, as well as nucleic acid fragments, vectors, transformed cells, polypeptides and pharmaceutical formulations.02-25-2010
20100278851CTL INDUCER COMPOSITION - The present invention provides a CTL inducer composition which comprises one or more peptides selected from the group consisting of the peptides of SEQ ID NOS: 1 to 27 in the Sequence Listing, and can be used for the treatment or prevention of cancer or a hepatitis C virus-related disease in two or more patient groups selected from the group consisting of an HLA-A2 positive patient group, an HLA-A24 positive patient group, an HLA-A26 positive patient group, and an HLA-A3 supertype positive patient group.11-04-2010
20120177670Somatic Stem Cells - A method of treating a cellular proliferative disorder with cancer antigen-activated dendritic cells that are derived from a population of somatic stem cells. Also disclosed are methods of treating tissue damages and degenerative diseases with a population of somatic stem cells.07-12-2012
20120177669PHOSPHOPEPTIDES AS MELANOMA VACCINES - We characterized a total of 175 HLA-DR-associated phosphopeptides using sequential affinity isolation, biochemical enrichment, mass spectrometric sequencing and comparative analysis. Many were derived from source proteins which may have roles in cancer development, growth and metastasis. Most were expressed exclusively by either melanomas or transformed B cells, suggesting the potential to define cell type-specific phosphatome “fingerprints”. We generated HLA-DRβ1*0101-restricted CD407-12-2012
20100303842PEPTIDE ANALOGUES - Some embodiments relate to analogs of peptides corresponding to class I MHC-restricted T cell epitopes and methods for their generation. These analogs can contain amino acid substitutions at residues that directly interact with MHC molecules, and can confer improved, modified or useful immunologic properties. Additionally, classes of analogs, in which the various substitutions comprise the non-standard residues norleucine and/or norvaline, are disclosed.12-02-2010
20090060931PHARMACEUTICAL COMPOSITION FOR TREATING OR PREVENTING OVARIAN CANCER - The invention relates to therapeutic and prophylactic treatment of ovarian cancer and metastases thereof. More specifically, the invention relates to immunogenic polypeptides comprising at least a portion of an ovarian tissue cell-associated protein or immunologically active variants thereof and to nucleic acids encoding such polypeptides and to the use thereof in immunotherapeutic methods of treatment. Said immunogenic polypeptides are provided by the zona pellucida (ZP) glycoproteins. ZP glycoproteins and fragments thereof that can induce a CD803-05-2009
20090060929Transfection complexes - The invention provides a peptide having at least 3 amino acids comprising an amino acid sequence selected from03-05-2009
20120082692Identification, Optimization and Use of Cryptic HLA-A24 Epitopes for Immunotherapy - The present invention pertains to methods for identifying a HLA-A*2402-restricted cryptic epitope in an antigen, and for increasing its immunogenicity, in order to obtain HLA-A*2402-restricted epitopes able to trigger an immune response against HLA-A*2402-restricted cryptic epitopes. Isolated peptides consisting of cryptic or optimized HLA-A*2402-restricted epitopes are provided.04-05-2012
20120263741VARIANTS OF THE MAJOR ALLERGEN PHL P 1 FROM TIMOTHY GRASS - The invention relates to pharmaceutically important variants of the major allergen Phl p 1 from timothy grass, characterised in that a preparation, hitherto not possible, of monomeric molecules which are soluble and stable in physiological media can be carried out with the aid of prokaryotic expression systems and subsequent purification thereof.10-18-2012
20090017051Allergy vaccines and their preparation - The present invention relates to a pharmaceutical composition containing a peptide and a pharmaceutically acceptable carrier or diluent wherein the peptide has a length of 8 to 50 amino acids, at least three preferably consecutive amino acids of the peptide are identical to at least three amino acids which appear in close vicinity on the molecular surface of an allergenic protein, and said at least three amino acids are solvent-exposed amino acids in the allergenic protein. The invention also concerns a method for the preparation of the pharmaceutical composition.01-15-2009
20110123558Peptide with Reduced Dimer Formation - The present invention relates to peptides which are formulated or engineered to prevent or reduce the formation of dimers.05-26-2011
20120231025Vaccine Having a Peptide Adjuvant for Eliciting a Specific Immune Response to Treat Viral Infection and Other Conditions - This invention provides a family of immunogenic compositions and vaccines, each containing a target antigen or antigen mixture, and an oligopeptide adjuvant, exemplified by the tripeptide Ile-Glu-Trp. The adjuvant has a low side effect profile, and may be especially effective in generating a rapid and specific Th1 or cellular immune response where the antigen is poorly immunogenic, or the patient is elderly or immunocompromised. In some circumstances, effectiveness of the vaccine can be substantially enhanced by administering follow-on injections of the tripeptide alone. The vaccine has been used to generate an enhanced response to multiple strains of influenza simultaneously, and is suitable for preventing or treating other infectious and disease conditions.09-13-2012
20120263742Combination of Protein Forms for Hornfly Vaccination - Thrombostasin is an anti-clotting protein found in saliva of 10-18-2012
20110002954RHOC-BASED IMMUNOTHERAPY - The present invention relates generally to the field of prophylaxis and therapy of metastatic cancer. In particular there is provided a protein; Ras Homology gene family, member C (RhoC) or peptide fragments thereof that are capable of eliciting anti-cancer immune responses. Specifically, the invention relates to use of RhoC or peptides derived thereof or RhoC specific T-cells for treatment of metastatic cancer. Hence, the invention in one aspect relates to RhoC specific T-cells adoptively transferred or induced in vivo by vaccination as a treatment of cancer. Also the use of RhoC and immunogenic peptide fragments hereof in cancer treatment, diagnosis and prognosis is provided.01-06-2011
20120321649Peptide Vaccines for Cancers Expressing Tumor-Associated Antigens - The present invention provides peptides having an amino acid sequence as set forth in SEQ ID NO: 19, 22, 30, 34, 344, 358, 41, 44, 46, 48, 78, 376, 379, 80, 100, 101, 110, 111, 387, 112, 394, 114, 116, 117, 121, 395, 133, 135, 137, 426, 143, 147, 148, 149, 150, 152, 153, 154, 156, 160, 161, 162, 163, 166, 174, 178, 186, 194, 196, 202, 210, 213, 214, 217, 223, 227, 228, 233, 254, 271, 272 or 288, as well as peptides having the above-mentioned amino acid sequences in which 1, 2, or several (e.g., up to 5) amino acids are substituted, deleted, or added, provided the peptides possess cytotoxic T cell inducibility. The present invention also provides drugs for treating or preventing a disease associated with over-expression of the CDH3, EPHA4, ECT2, HIG2, INHBB, KIF20A, KNTC2, TTK and/or URLC10, e.g. cancers containing as an active ingredient one or more of these peptides. The peptides of the present invention find further utility as vaccines.12-20-2012
20120321650COMPOSITION FOR THE TREATMENT OF ATHEROSCLEROSIS - Epitopes derived from a protein present in an atherosclerotic plaque, such as apolipoprotein B-100, are presented. The epitopes can be used in a method of treating atherosclerosis by continuous subcutaneous or transcutaneous administration of a therapeutically effective amount of the epitope to a subject. Administering the epitope to the subject can induce a specific regulatory immune response, such as a Treg response. A composition or patch containing the epitope and adapted for the prophylactic or therapeutic treatment of a subject are also presented.12-20-2012
20120328638MYBL2 PEPTIDES AND VACCINES CONTAINING THE SAME - Peptide vaccines against cancer are described herein. In particular, epitope peptides derived from the MYBL2 gene that bind to HLA antigen and have cytotoxic T lymphocyte (CTL) inducibility, more particularly peptides having the amino acid sequence of SEQ ID NO: 5 and fragments thereof, are provided. The present invention further extends to peptides that include one, two, or several amino acid insertions, substitutions or additions to the aforementioned peptides or fragments, provided they retain cytotoxic T cell inducibility. Also provided as nucleic acids encoding any of the aforementioned peptides, antigen-presenting cells and isolated CTLs that target such peptides, and pharmaceutical agents and compositions including any of the aforementioned peptides, nucleic acids, and APCs as active ingredients. The components of the present invention have particular utility in connection with the treatment and/or prophylaxis (i.e., prevention) of cancers (tumors), and/or the prevention of a postoperative recurrence thereof.12-27-2012
20120328640METHODS AND COMPOSITIONS FOR THE TREATMENT AND PREVENTION OF CANCER - The instant invention provides compositions for the treatment of cancer. Specifically, the invention provides polypeptides and nucleic acid molecules comprising tumor-associated embryonic antigens, e.g., OFA-iLRP, and chemoattractant ligands, e.g., a proinflammatory chemokine such as MIP3α/CCL20 or β-defensin mDF2β. The invention further provides cancer vaccines and methods for treating subjects having, or at risk of developing, cancer.12-27-2012
20120328639IMMUNOGENIC LHRH COMPOSITIONS AND METHODS RELATING THERETO - The present invention relates generally to an immunogenic LHRH composition and more particularly to an immunogenic LHRH composition comprising a LHRH C-terminal fragment of at least five amino acids. The present invention is useful, inter alia, as a prophylactic and/or therapeutic agent for the modification of fertility and behaviour patterns of animals, the achievement of livestock production gains such as increasing growth, decreasing feed conversion ratios or the control of unwanted organoleptic characteristics or the treatment of disorders of the reproductive organs.12-27-2012
20120328637METHODS AND COMPOSITIONS FOR MODULATING THE ACTIVITY OF THE INTERLEUKIN-35 RECEPTOR COMPLEX - The receptor for Interleukin 35 (IL-35) is provided. The Interleukin 35 Receptor (IL-35R) comprises a heterodimeric complex of the Interluekin12Rβ2 receptor and the gp130 receptor. Various compositions comprising the IL-35R complex, along with polynucleotides encoding the same and kits and methods for the detection of the same the same are provided. Methods of modulating the activity of IL-35R or modulating effector T cell functions are also provided. Such methods employ various IL-35R antagonists and agonists that modulate the activity of the IL-35R complex and, in some embodiments, modulate effector T cell function. Further provided are methods for screening for IL-35R binding agents and for IL-35R modulating agents. Various methods of treatment are further provided.12-27-2012
20120328636KDR PEPTIDES AND VACCINES COMPRISING THE SAME - The present invention provides nonapeptides selected from peptides comprising the amino acid sequence of SEQ ID NO:2, 3, 5, 8, 11, or 12; nonapeptides or decapeptides selected from peptides comprising the amino acid sequence of SEQ ID NO:29, 30, 33, 34, 40, or 46; and peptides with cytotoxic T cell inducibility, in which one, two, or several amino acids are substituted or added to the above-mentioned amino acid sequences, as well as pharmaceuticals for treating or preventing tumors, where the pharmaceuticals comprise these peptides. The peptides of this invention can be used as vaccines.12-27-2012
20110045010ANTI-LPS FACTOR FROM PARIETARIA JUDAICA AND METHODS OF USE THEREOF - The present invention falls within the field of molecular biology, and in particular it refers to peptides, polypeptides, protein molecules, uses, methods, processes, systems and compositions for minimizing the presence of molecules in a material and/or interfering with effects associated to such molecules. In particular, the present invention can appear in the form of anti-septic shock pharmacological composition and systems of purification from bacterial endotoxins.02-24-2011
20110045009Cell Permeable Peptide - The number of peptides having an ability to bind to a cell or penetrate into a cell is narrowed down by being selectively enriched from a random peptide library with a diversity of not less than one hundred millions of peptides using a phage surface display technique, and then cytoplasmic transfer is evaluated by using protein synthesis inhibition as an indicator by adding to a cell, a fusion body of the selectively enriched peptide and a protein synthesis inhibitory factor (PSIF) that cannot solely penetrate into the cell.02-24-2011
20120321652PEPTIDES FOR ACTIVE ANTI-CYTOKINE IMMUNIZATION - Peptide of a size comprised between 5 and 40 amino acids, originating from a cytokine, in which at least one of its amino acids comprises at least one of its atoms separated by a distance d of less than 5 angströms from an atom of the receptor corresponding to said cytokine, the spacing d being evaluated on the basis of structural data, derivatives, immunogenic compounds comprising them, use of a peptide or peptide derivative or immunogenic compound for the preparation of a curative or preventative medicament intended for the treatment or prevention of diseases linked to an excess or to the presence of cytokines or for the treatment of an auto-immune disease and pharmaceutical compositions which contain at least one abovementioned peptide or peptide derivative or immunogenic compound as active ingredient.12-20-2012
20120269834IMMUNOGLOBULIN CLEAVAGE FRAGMENT VACCINE COMPOSITIONS - The invention relates to methods and reagents for the preparation and use of a therapeutic immunospecific for IgG breakdown products retaining antigen binding but having lost effector functions. The reagents of the invention may be used as immunogens for the purpose of prophylactic or therapeutic vaccination of a human subject.10-25-2012
20120269836Vaccine - Vaccine comprising a peptide bound to a pharmaceutically acceptable carrier, said peptide having the amino acid sequence10-25-2012
20110236406IMMUNOGENIC COMPOSITIONS COMPRISING HMGB1 POLYPEPTIDES - The present invention relates to novel immunogenic compositions (e.g., vaccines), the production of such immunogenic compositions and methods of using such compositions. More specifically, this invention provides unique immunogenic molecules comprising an HMGB1 polypeptide (e.g., an HMGB1 B-box polypeptide) and an antigen. Even more specifically, this invention provides novel fusion proteins comprising an isolated HMGB1 polypeptide and an antigen such that administration of these fusion proteins provides the two signals required for native T-cell activation.09-29-2011
20100233199MODULATORS OF HYPERSENSITIVITY REACTIONS - The present invention relates to a peptide for modulating an immune response, said peptide comprising an amino acid sequence corresponding to at least a portion of one of a Src homology 3 (SH3) domain, a Src homology 2 (SH2) domain, or a pleckstrin homology (PH) domain.09-16-2010
20110250219EPITOPE PEPTIDES DERIVED FROM VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR 1 AND VACCINES CONTAINING THESE PEPTIDES - The present invention provides immunogenic peptides comprising the amino acid sequence of SEQ ID NO: 1, 2, 13, 32, and peptides comprising the above-mentioned amino acid sequences in which 1, 2, or several amino acids are substituted or added, and having cytotoxic T cell inducibility, and also provides drugs for treating or preventing tumors comprising these peptides. The peptides of this invention can be used as vaccines.10-13-2011
20120321651Anti-IGE Vaccines - The present invention provides compositions and methods for the use of antigenic peptides derived from the Fc portion of the epsilon heavy chain of an IgE molecule as vaccines for the treatment and prevention of IgE-mediated allergic disorders. In particular, the invention provides compositions, methods for the treatment and prevention of IgE-mediated allergic disorders comprising an immunogenic amount of one or more antigenic peptides derived from the CH3 domain or junction of Ch-3/CH4 domain of an IgE molecule and methods for the evaluation of IgE mediated allergies in dogs.12-20-2012
20120087935SERINE RICH PEPTIDES HAVING ANTIOXIDATIVE STRESS PROPERTIES - The present invention relates to novel serine rich peptides capable of exhibiting antioxidative properties and that can be used to protect a cell, tissues, organs or a multi-cellular organism, such as animals, against oxidative stress. In aspects of the invention, the peptides may be derived from egg yolk proteins utilizing only generally recognized as safe (GRAS) compounds. The invention also relates to cosmetics, functional foods, food supplements or pharmaceutical formulations comprising the peptides of the present invention having antioxidative properties. The cosmetics, functional food or pharmaceutical products are particularly suitable for the care of the skin in protecting against oxidative stress and ageing phenomena.04-12-2012
20120282285MASP ISOFORMS AS INHIBITORS OF COMPLEMENT ACTIVATION - The present invention relates to novel ficolin-associated polypeptides, and polypeptides derived from these ficolin-associated polypeptides for the use in the treatment of conditions associated with inflammation, apoptosis, autoimmunity, coagulation, thrombotic or coagulopathic related diseases, as well as the use as biomarkers. The present invention further relates to anti-bodies recognising such novel ficolin-associated polypeptides, and polypeptides derived thereof, nucleic acid molecules encoding such polypeptides, vectors and host cells used in the production of the polypeptides.11-08-2012
20100215678Ras Mutation and Compositions and Methods Related Thereto - Disclosed are newly discovered Ras mutations and combinations of mutations, proteins and peptides and fusion proteins containing these mutations, nucleic acid molecules encoding such proteins, peptides, and fusion proteins, and a variety of tools and diagnostic, therapeutic, and screening methods associated with the use of such mutations.08-26-2010
20100215677PDZ DOMAIN INTERACTIONS AND LIPID RAFTS - Methods for modulating immune cell signaling are provided. In general such methods involve modulating an interaction between a PDZ protein and a PDZ ligand protein whose interaction affects the composition and/or distribution of lipid rafts in an immune cell. Modulators that enhance or inhibit such interactions are also disclosed, as well as methods of screening for such modulators.08-26-2010
20100215675REPLIKIN-BASED COMPOUNDS FOR PREVENTION AND TREATMENT OF INFLUENZA AND METHODS OF DIFFERENTIATING INFECTIVITY AND LETHALITY IN INFLUENZA - The present invention provides methods of differentiating the infectivity and lethality of isolates of influenza virus and provides compounds for diagnosing, preventing, and treating outbreaks of influenza virus including compounds for diagnosing, preventing, and treating across different strains of influenza virus.08-26-2010
20120100167ALLERGEN PEPTIDE FRAGMENTS AND USE THEREOF FOR TREATMENT OF DUST MITE ALLERGIES - The present invention relates generally to in vivo methods and compositions designed for allergen specific immunotherapy. The compositions include contiguous overlapping peptide fragments which together form an entire amino acid sequence of an allergen.04-26-2012
20120100166Ang-2 Binding Complexes and Uses Thereof - Complexes containing one or more modular recognition domains (MRDs) and MRDs attached to scaffolds including antibodies are described. The manufacture of these complexes are the use of these complexes to treat and diagnose diseases and disorders are also described.04-26-2012
20120100165DRUG TRANSPORTER, AND ADJUVANT AND VACCINE EACH UTILIZING SAME - An objective of the invention is to provide a drug delivery vehicle capable of allowing a vaccine or adjuvant to reach a target cell or tissue efficiently while being capable of improving the immunogenicity of the vaccine or capable of enhancing the immunostimulating effect of the adjuvant as well as a vaccine or adjuvant utilizing the same. Said drug delivery vehicle contains a multimeric protein having a coiled coil structure and a ligand molecule to a receptor of an immune cell.04-26-2012
20100183643Cancer vaccines containing epitopes of oncofetal antigen - Disclosed are fragments of oncofetal antigen, otherwise known as immature laminin receptor protein that specifically stimulate one T cell subclass. The fragments may be formulated into compositions for potentiating T cell-mediated responses in mammalian cancer patients. They also have therapeutic uses in vitro.07-22-2010
20130011424POLYEPITOPE CONSTRUCTS AND METHODS FOR THEIR PREPARATION AND USE - The invention relates to immunogenic polyepitope constructs containing CTL and/or Th epitopes and optimized spacer sequences which improve processing and presentation of the epitopes leading to induction of high level of both CD4+ and CD8+ specific T-cell responses and specific types of cytokines, and high level of protection and therapeutic activity.01-10-2013
20130017213PEPTIDE ANALOGUES - Some embodiments relate to analogs of peptides corresponding to class I MHC-restricted T cell epitopes and methods for their generation. These analogs can contain amino acid substitutions at residues that directly interact with MHC molecules, and can confer improved, modified or useful immunologic properties. Additionally, classes of analogs, in which the various substitutions comprise the non-standard residues norleucine and/or norvaline, are disclosed.01-17-2013
20130171178Immunogenic Peptides of Xage-1 - XAGE-1 is a gene expressed in a number of important human cancers, including prostate cancer, lung cancer, breast cancer, ovarian cancer, glioblastoma, pancreatic cancer, and melanoma. It has now been discovered that peptides of fifty or fewer amino acids comprising the sequence X07-04-2013
20110135676NOVEL ANTIVIRAL PEPTIDE AGAINST AVIAN INFLUENZA VIRUS H9N2 - The present invention relates to recombinant phages carrying fusion peptides that bind to avian influenza virus (AIV). Such phages are useful as diagnostic reagents to replace anti-AIV antibodies because the phages are capable of competing with the latter antibodies for binding sites on the virus. Synthetic peptides with the sequence CNDFRSKTC, either in linear or cyclic conformations, or fusion phages bearing the above said peptides inhibited AIV propagation in embryonated egg as well as in MDCK cell lines. Therefore they may be used as'therapeutic agents to control, to treat and to eradicate bird flu caused by avian influenza virus.06-09-2011
20110159023PD-1 ANTAGONISTS AND METHODS FOR TREATING INFECTIOUS DISEASE - Methods and compositions for treating an infection or disease that results from (1) failure to elicit rapid T cell mediated responses, (2) induction of T cell exhaustion, T cell anergy or both, or (3) failure to activate monocytes, macrophages, dendritic cells and/or other APCs, for example, as required to kill intracellular pathogens. The method and compositions solve the problem of undesired T cell inhibition by binding to and blocking PD-1 to prevent or reduce inhibitory signal transduction, or by binding to ligands of PD-1 such as PD-L1, thereby preventing (in whole or in part) the ligand from binding to PD-1 to deliver an inhibitory signal. The immune response can be modulated by providing antagonists which bind with different affinity (i.e., more or less as required), by varying the dosage of agent which is administered, by intermittent dosing over a regime, and combinations thereof, that provides for dissociation of agent from the molecule to which it is bound prior to being administered again (similar to what occurs with antigen elicitation using priming and boosting). In some cases it may be particularly desirable to stimulate the immune system, then remove the stimulation.06-30-2011
20110159022Immunogenic Peptides Derived from the Midkine Protein, as an Anticancer Vaccine - A peptide derived from the Midkine protein, comprising at least one CD406-30-2011
20110159021XBP1, CD138, AND CS1 PEPTIDES - The disclosure features, inter alia, immunogenic XBP1-, CD138-, and CS1-derived peptides (and pharmaceutical compositions thereof). The peptides can be used in a variety of methods such as methods for inducing an immune response, methods for producing an antibody, and methods for treating a cancer (e.g., a plasma cell disorder such as multiple myeloma or Waldenstrom's macroglobulinemia). The peptides can also be included in MHC molecule multimer compositions and used in, e.g., methods for detecting a T cell in a population of cells.06-30-2011
20110159020Transcription Factor for Killer Cell Activation, Differentiation and Uses Thereof - The present invention provides methods for altering activation and/or differentiation of Killer cells comprising altering the expression of a Homologue Of Blimp-1 In T-cells (Hobit) species in said Killer-cells. The invention further provides methods and means for increasing or decreasing expression of a Hobit species in Killer cells, and provides isolated and/or recombinant nucleic acid and uses of said isolated and/or recombinant nucleic acid.06-30-2011
20080254051Use of Native Peptides and Their Optimized Derivatives For Vaccination - The present invention pertains to the field of vaccination, and more particularly to the fields of antitumor and antiviral vaccination. The invention relates to the use of a native peptide in a medicinal composition, for selecting and/or boosting part of a CTL immune response which has been initiated by an optimized immunogenic peptide derived from said native peptide. The invention also concerns vaccination kits which comprise several doses of optimized peptides and of their cognate native peptides.10-16-2008
20080254050Antiangiogenic active immunotherapy - Application of oligonucleotide and polypeptide sequences of molecules of the family of the vascular permeability factor (VPF), their receptors, and co-receptors, as well as their modifications, in the active immunotherapy of pathologic entities in which course is associated to the increase of angiogenesis.10-16-2008
20130171179RECOMBINANT T-CELL RECEPTOR LIGANDS WITH COVALENTLY BOUND PEPTIDES - Disclosed herein are stable complexes including an MHC class I or MHC class II recombinant T cell receptor ligand RTL polypeptide covalently linked to an antigenic determinant by a disulfide bond. Also disclosed are methods of making such compositions and methods of use, for example to treat or inhibit a disorder, for example, an autoimmune disorder.07-04-2013
20130171180DERIVATIVES OF GLYCO-CF2-SERINE AND GLYCO-CF2-THREONINE - The present invention relates to compounds of formula (I): or a pharmaceutically acceptable salt thereof, a tautomer, a stereoisomer or a mixture of stereoisomers in any proportion, in particular a mixture of enantiomers, and particularly a racemate mixture, as well as to their process of preparation, their use in the peptide synthesis, said peptide and the use of said peptide.07-04-2013
20080233140Therapeutic Applications of Activation of Human Antigen-Presenting Cells Through Dectin-1 - The present invention includes compositions and methods for binding Dectin-1 on immune cells with anti-Dectin-1-specific antibodies or fragment thereof capable of activating the immune cells.09-25-2008
20080233137Compounds that Block the C5a Receptor and Their Use in Therapy - The present invention relates to compounds that are able to prevent intramolecular contact of the N-terminal residues 10 to 18 of human C5aR with the extracellular loops thereof. More specifically the invention relates to compounds that are able to bind the aspartates in positions 10, 15 and 18 and the glycine in position 12 of the human C5aR. Such compounds are preferably of the general formula X09-25-2008
20080233136Biologically Active Peptides - Thirty substantially pure and biologically active peptides are disclosed. Nucleic acids that have sequences coding for the biologically active peptides and pharmaceutical formulations produced therefrom are also disclosed.09-25-2008
20100086563Compositions and Methods for Detection of Antibodies Specific for Anaplasma phagocytophilum (Aph) and Anaplasma platys (Apl) - The invention provides methods and compositions for the detection and treatment of 04-08-2010
20080226665EphA2 T-cell epitopes and uses therefor - EphA2 T-cell epitope are provided herein. The epitopes include peptides corresponding to specific fragments of human EphA2 protein containing one or more T-cell epitopes, and conservative derivatives thereof. The EphA2 T-cell epitopes are useful in an assay, such as an ELISPOT assay, that may be used to determine and/or quantify a patient's immune responsiveness to EphA2. The epitopes also are useful in methods of modulating a patient's immune reactivity to EphA2, which has substantial utility as a treatment for cancers that overexpress EphA2, such as renal cell carcinoma (RCC). The EphA2 epitopes also can be used to vaccinate a patient against EphA2, by in vivo or ex vivo methods.09-18-2008
20080226664Colon cancer antigen panel - The invention provides methods, compositions and kits for inducing and/or enhancing an immune response in a subject. The invention in some aspects includes polypeptide and nucleic acid molecules that induce and/or enhance an immune response. In some aspects of the invention, the polypeptide and/or nucleic acid molecules of the invention are useful to induce and/or enhance an immune response in a subject who has or is suspected of having cancer.09-18-2008
20110262470IMMUNOREGULATORY STRUCTURES FROM NORMALLY OCCURRING PROTEINS - The present invention relates to isolated protein sequences that correspond to cell binding peptides, fragments, neo-structures and/or neo-epitopes of a normally occurring serum protein present in human tissue, wherein the peptide, fragment, neo-structure and/or neo-epitope has an immunoregulatory activity and is the result of either an enhanced proteolytic activity and/or conformational changes in a tissue, or a malignant tumour. In the present patent application, a common structure of several of these peptides, fragments, neo-structures and/or neo-epitopes, having immunoregulatory activity by binding to receptors on immune cells, has been identified. The present invention further also relates to monoclonal and/or polyclonal antibodies directed to a cell binding fragment of a normally occurring serum protein present in human tissue, as described above.10-27-2011
20120093845NEIL3 PEPTIDES AND VACCINES INCLUDING THE SAME - The present invention provides isolated peptides or the fragments derived from SEQ ID NO: 45, which bind to an HLA antigen and induce cytotoxic T lymphocytes (CTL). The peptides may include the above mentioned amino acid sequence with substitution deletion, or addition of one, two, or several amino acids sequences. The invention also provides pharmaceutical compositions including these peptides. The peptides of this invention can be used for diagnosing or treating cancer.04-19-2012
20130095129TREATMENT OF IMMUNE DISEASE BY MUCOSAL DELIVERY OF ANTIGENS USING GENETICALLY MODIFIED LACTOBACILLUS - The present invention relates to the treatment of autoimmune and allergic diseases by mucosal delivery by micro-organism, in particular 04-18-2013
20130095128ECT2 PEPTIDES AND VACCINES INCLUDING THE SAME - Isolated peptides derived from SEQ ID NO: 42 and fragments thereof that bind to an HLA antigen and induce cytotoxic T lymphocytes (CTL) and thus are suitable for use in the context of cancer immunotherapy, more particularly cancer vaccines, are described herein. The inventive peptides encompass both the afore-mentioned amino acid sequences and modified versions thereof, in which one, two, or several amino acids are substituted, deleted, inserted or added, provided such modified versions retain the requisite HLA binding and/or CTL inducibility of the original sequences. Further provided are nucleic acids encoding any of the aforementioned peptides as well as pharmaceutical agents, substances and/or compositions that include or incorporate any of the aforementioned peptides or nucleic acids. The peptides, nucleic acids, pharmaceutical agents, substances and compositions of this invention find particular utility in the treatment of cancers and tumors, including, for example, bladder cancer, breast cancer, cervical cancer, cholangiocellular carcinoma, CML, colorectal cancer, esophageal cancer, NSCLC, lymphoma, pancreatic cancer, prostate cancer, renal carcinoma and SCLC.04-18-2013
20130115233METHODS FOR DESIGNING AND SYNTHESIZING DIRECTED SEQUENCE POLYMER COMPOSITIONS VIA THE DIRECTED EXPANSION OF EPITOPE PERMEABILITY - The instant invention comprises a process for the solid phase synthesis of directed epitope peptide mixtures useful in the modulation of unwanted immune responses, such process defined by a set of rules regarding the identity and the frequency of occurrence of amino acids that substitute a base or native amino add of a known epitope. The resulting composition is a mixture of related peptides for therapeutic use.05-09-2013
20130101611CITRULLINATION OF HUMAN PEPTIDYLARGININE DEIMINASE 4 (PAD-4) REGULATES ITS FUNCTION AND IMMUNOGENICITY - The present invention provides peptidylarginine deiminase 4 (PAD-4) polypeptides comprising one or more citrullinated Arginine sites. In one embodiment, a PAD-4 polypeptide comprises a citrulline residue at the following sites: Arg-205, Arg-212, Arg-218, Arg-372, Arg-374, Arg-383, Arg-394, Arg-495, Arg-536, and Arg-544. The present invention also provides methods for detecting the presence of autoantibodies to citrullinated PAD-4. The methods of the present invention may also be used to qualify Rheumatoid Arthritis status in a subject. In other embodiments, the present invention provides methods for inducing tolerance to citrullinated PAD-4.04-25-2013
20130142817MICROBIAL DELIVERY SYSTEM - The present invention provides methods and compositions for treating or preventing allergic responses, particularly anaphylactic allergic responses, in subjects who are allergic to allergens or susceptible to allergies. Methods of the present invention utilize administration of microorganisms to subjects, where the microorganisms produce allergens and protect the subjects from exposure to the allergens until phagocytosed by antigen-presenting cells. Particularly preferred microorganisms are gram-negative bacteria, gram-positive bacteria, and yeast. Particularly preferred allergens are proteins found in foods, venoms, drugs and latex that elicit allergic reactions and anaphylactic allergic reactions in individuals who are allergic to the proteins or are susceptible to allergies to the proteins. The proteins may also be modified to reduce the ability of the proteins to bind and crosslink IgE antibodies and thereby reduce the risk of eliciting anaphylaxis without affecting T-cell mediated Th1-type immunity.06-06-2013
20110217326METHOD FOR DIAGNOSING AND/OR TREATING TUMOR - An object of the present invention is to provide methods for diagnosing and/or treating tumors using HERV-H env gene or HERV-H env protein. Specifically, tumors are diagnosed by detecting expression of HERV-H env gene; and agents for detecting the expression are used as diagnosing agents. Further, tumors are treated by inhibiting function of HERV-H env gene; and agents for inhibiting the function are used as antitumor agents. Furthermore, tumors are treated by administering a peptide having a certain sequence of HERV-H env protein and the like; and the peptide is used as a cancer vaccine.09-08-2011
20130156798PEPTIDE COMPOSITION - There is provided a method for selecting a tolerogenic peptide by selecting a peptide which is capable of binding to an MHC class I or II molecule without further processing. There is also provided a peptide selected by such a method and its use in a pharmaceutical composition and a method to treat and/or prevent a disease. The present invention also relates to a composition which comprises the following myelin basic protein peptides: MBP 30-44; MBP 83-99; MBP 131-145; and MBP 140-154. The composition may be used to treat a disease, in particular multiple sclerosis and/or optical neuritis and the invention also relates to such uses and methods.06-20-2013
20110212116IMMUNOGENIC PEPTIDES AND USES THEREOF - The present invention provides immunogenic peptides (and functional variants thereof) and their uses. The peptides comprise at least one PASD1-derived epitope. PASD1 is a cancer-testis antigen expressed in cancers, such as acute myeloid leukaemia (AML). Peptides of the invention are capable of inducing immune responses. The peptides are useful as vaccines.09-01-2011
20080199486GRP94-BASED COMPOSITIONS AND METHODS OF USE THEREOF - Mini chaperones and methods of use thereof for the treatment of cancer and other disorders are provided. Also provided are tools to facilitate screening therapeutic agents which have selective binding affinity for GRP94.08-21-2008
20090041793Immunostimulatory Compositions and Uses Thereof - The present invention provides novel immuno-stimulatory polypeptides, and methods for their use and identification.02-12-2009
20120276127TREATMENT OF RETINAL DISORDERS WITH RECOMBINANT T CELL RECEPTOR LIGAND (RTL) - Methods are provided for the treatment of a retinal disorder or optic neuritis in a subject. In some embodiments, the methods include administering a therapeutically effective amount of an MHC molecule including covalently linked first, second, and third domains; wherein the first domain is an MHC class II β1 domain and the second domain is an MHC class II α1 domain, wherein the amino terminus of the α1 domain is covalently linked to the carboxy terminus of the β1 domain; or wherein the first domain is an MHC class I α1 domain and the second domain is an MHC class I α2 domain, wherein the amino terminus of the α2 domain is covalently linked to the carboxy terminus of the α1 domain; and wherein the third domain is covalently linked to the first domain and comprises a retinal antigen or an antigen of the central or peripheral nervous system.11-01-2012
20100291121Tumour-Specific Animal Proteins - CASB7439 polypeptides and polynucleotides, immunogenic compositions comprising them and methods for producing such polypeptides by recombinant techniques are disclosed. Also disclosed are methods for utilizing CASB7439 polypeptides and polynucleotides in diagnostics, and vaccines for prophylactic and therapeutic treatment of cancers, particularly colorectal, breast, and lung cancers, autoimmune diseases, and related conditions.11-18-2010
20100291120PEPTIDES REGULATING THE SURFACE EXPRESSION OF THE T CELL RECEPTOR - The present invention is related to a peptide comprising an amino acid sequence according to SEQ. ID. No 1.11-18-2010
20100316661HIV-1 Envelope Glycoprotein Oligomer and Methods of Use - This invention relates to fusion polypeptides comprised of a trimerization domain fused to a non-membrane bound, non-cleaved gp160 polypeptide derived from the R2 HIV-1 Env glycoprotein and to compositions comprising the fusion polypeptides. This invention further relates to oligomers of the fusion polypeptides. This invention also relates to nucleic acids encoding the fusion polypeptides. This invention also relates to diagnostic and therapeutic methods using the fusion polypeptides. Further, this invention relates to the induction of cross-reactive neutralizing antibodies against HIV-1, and to immunogenic compositions for the prevention and treatment of infection by HIV-1.12-16-2010
20110274709T-Cell Immunogens Derived from Anti-Viral Proteins and Methods of Using Same - Isolated polypeptides related to endogenous anti-viral polypeptides; and compositions, including immunogenic compositions, comprising a subject isolated polypeptide are disclosed herein. A subject isolated polypeptide comprises an amino acid sequence having substantial amino acid sequence identity to a contiguous stretch of amino acids of one or more endogenous anti-viral polypeptides, wherein the endogenous anti-viral polypeptides are polypeptides subject to proteolytic degradation as a result of the activity of one or more viral proteins. Also provided are diagnostic and treatment methods using the subject isolated polypeptides and compositions.11-10-2011
20110274708SHORT-FORM HUMAN MD-2 AS A NEGATIVE REGULATOR OF TOLL-LIKE RECEPTOR 4 SIGNALING - The present invention is based on a novel, alternatively spliced human isoform of MD-2 (MD-2s). In addition, the present invention relates to modified MD-2 proteins, wherein one or more tyrosine residues have been mutated to phenylalanine. In various embodiments, the invention relates to methods and kits for preventing, reducing the likelihood of developing and/or treating various conditions using MD-2s. The invention also describes methods of determining the risk of a subject to various conditions.11-10-2011
20130183326METHODS AND COMPOSITIONS FOR MODULATING THE ACTIVITY OF THE INTERLEUKIN-35 RECEPTOR COMPLEX - The receptor for Interleukin 35 (IL-35) is provided. The Interleukin 35 Receptor (IL-35R) comprises a heterodimeric complex of the Interluekin12Rβ2 receptor and the gp130 receptor. Various compositions comprising the IL-35R complex, along with polynucleotides encoding the same and kits and methods for the detection of the same the same are provided. Methods of modulating the activity of IL-35R or modulating effector T cell functions are also provided. Such methods employ various IL-35R antagonists and agonists that modulate the activity of the IL-35R complex and, in some embodiments, modulate effector T cell function. Further provided are methods for screening for IL-35R binding agents and for IL-35R modulating agents. Various methods of treatment are further provided.07-18-2013
20130183327COMPOSITIONS INCLUDING I-DOMAIN ANTIGEN CONJUGATE COMPOUNDS AND METHODS FOR TREATMENT OF AUTOIMMUNE DISORDERS - The present disclosure provides IDAC compounds capable of presenting two or more signal 1 moieties to a host immune system and methods of using the IDAC compounds to treat or prevent autoimmune disorders in a subject. The present disclosure provides compounds including a modified I-domain peptide having two or more modified lysine residues and two or more signal 1 moieities conjugated to the modified lysine residues of the I-domain peptide and methods of using an making the compounds.07-18-2013
20130183328CANCER VACCINES AND VACCINATION METHODS - Methods and compositions for treating cancers (e.g., neural cancers) by dendritic cell vaccination are provided herein.07-18-2013
20090269364HER-2/NEU MULTI-PEPTIDE VACCINE - The present invention relates to a multi-peptide-multiepitop-vaccine against cancerous diseases associated with HER-2/neu oncogene, i.e. the vaccine comprises a specific combination of peptides presenting different amino acids sequences as occur in the extracellular domain of HER-2/neu protein.10-29-2009
20110293644COMPOSITIONS AND METHODS FOR TREATMENT OF CELIAC DISEASE - The invention provides agents and vaccines for treating and diagnosing celiac disease. In particular, the present invention provides a combination of three peptides that are useful for treating and diagnosing celiac disease in a large proportion of patients.12-01-2011
20110300167CXCR5 RECEPTOR COMPOUNDS - The invention relates generally to compounds which are allosteric modulators (e.g., negative and positive allosteric modulators, allosteric agonists, and ago-allosteric modulators) of the G protein coupled receptor CXCR5. The CXCR5 receptor compounds are derived from the intracellular loops and domains of the CXCR5 receptor. The invention also relates to the use of these CXCR5 receptor compounds and pharmaceutical compositions comprising the CXCR5 receptor compounds in the treatment of diseases and conditions associated with CXCR5 receptor modulation such as autoimmune diseases including lupus, HIV and rheumatoid arthritis, Primary Sjogren's Syndrome, chronic lymphocytic leukemia, Burkitt Lymphoma, colon and breast cancer tumor metastasis, Multiple Sclerosis and compromised immune function.12-08-2011
20110311567Immunogenically-Enhanced Polypeptides and Related Methods - Described herein are immunogenically-enhanced polypeptides, such as KSHV LANA1 polypeptides, related methods of eliciting an immune response to the polypeptides and related nucleotide sequences. Also described herein are novel polypeptides capable of inhibiting degradation and/or retarding synthesis of a protein when attached to or incorporated within that protein along with related methods and nucleotide sequences.12-22-2011
20110311566METHODS AND MATERIALS FOR GENERATING T CELLS - The document provides to methods and materials for generating T cells (e.g., antigen-specific CD412-22-2011
20110311565Phage Constructs, Sequences and Antigenic Compositions for Immunocontraception of Animals - Disclosed are methods, compositions, zona pellucida binding peptides and polypeptides, and expression vectors for use in species-specific immunocontraception of animals, which include landscape bacteriophage. The disclosed compositions may include immunogenic compositions or vaccines.12-22-2011
20110311564Method for Producing Intermediates for the Production of Novel Macrocycles that are Inhibitors of the Proteasomic Degradation of p27, such as Argyrin and Derivatives Thereof, and Uses of Said Macrocycles - The present invention relates to the use of particular macrocycles that are inhibitors of the proteasomic degradation of p27, in particular argyrin and derivatives thereof, for a treatment in a variety of conditions, such as the induction of immunotolerance, autoimmune diseases, bacterial infections, and proliferative diseases, such as cancers.12-22-2011
20110311563Synthetic Antigenic Peptides and Lipopeptides Derived from Mycobacterium Avium Subsp. Paratubuerculosis - The current invention relates to the diagnosis and treatment of diseases resulting from infections by 12-22-2011
20130189290VACCINE FOR THE PREVENTION OF BREAST CANCER RELAPSE - The invention features methods to induce and maintain a protective cytotoxic T-lymphocyte response to a peptide of the HER2/neu oncogene, E75, with the effect of inducing and maintaining protective or therapeutic immunity against breast cancer in a patient in clinical remission. The methods comprise administering to the patient an effective amount of a vaccine composition comprising a pharmaceutically acceptable carrier, an adjuvant such as recombinant human GM-CSF, and the E75 peptide at an optimized dose and schedule. The methods further comprise administering an annual or semi-annual booster vaccine dose due to declining E75-specific T cell immunity. The invention also features vaccine compositions for use in the methods.07-25-2013
20130189291Peptide Vaccines For Cancers Expressing Tumor-Associated Antigens - The present invention provides peptides having an amino acid sequence as set forth in SEQ ID NO: 19, 22, 30, 34, 344, 358, 41, 44, 46, 48, 78, 376, 379, 80, 100, 101, 110, 111, 387, 112, 394, 114, 116, 117, 121, 395, 133, 135, 137, 426, 143, 147, 148, 149, 150, 152, 153, 154, 156, 160, 161, 162, 163, 166, 174, 178, 186, 194, 196, 202, 210, 213, 214, 217, 223, 227, 228, 233, 254, 271, 272 or 288, as well as peptides having the above-mentioned amino acid sequences in which 1, 2, or several (e.g., up to 5) amino acids are substituted, deleted, or added, provided the peptides possess cytotoxic T cell inducibility. The present invention also provides drugs for treating or preventing a disease associated with over-expression of the CDH3, EPHA4, ECT2, HIG2, INHBB, KIF20A, KNTC2, TTK and/or URLC10, e.g. cancers containing as an active ingredient one or more of these peptides. The peptides of the present invention find further utility as vaccines.07-25-2013
20130189292Immunomodulatory methods and systems for treatment and/or prevention of atherosclerosis and related proteins, peptides and compositions - Immunostimulatory methods and systems for treating or preventing atherosclerosis and/or a condition associated thereto in an individual and related compounds and compositions.07-25-2013
20130189289VACCINE FOR TREATMENT OF TAUTOPATHY - This invention relates to a vaccine for preventing or treating tautopathy, comprising a vector, as an active ingredient, comprising a nucleic acid encoding a mutant tau protein linked to a secretion signal sequence, wherein the vaccine is capable of inducing an antibody against an (optionally phosphorylated) tau protein in a subject in a more sustained manner compared with a case where the mutant tau protein is administered directly.07-25-2013
20110318375Immunomodulatory Therapeutic Agents - A group of peptides has been isolated from the serum of domesticated mammals and then identified through the use of mass spectrometry. These peptides are byproducts of fibrinogen activation and the complement cascade. The peptides of greatest activity are the activated forms of fibrinopeptide A and fibrinopeptide B {activated by the removal of the terminal Arginine), and an immunomodulatory fragment of Complement Component 3. These form of fibrinopeptides A and B have remarkable immunomodulatory ability, enhancing recognition of foreign substances including infectious agents of all types, decreasing the inflammatory response, preventing the deposition of extravascular fibrin, stimulating the resorption of fibrin that has already been deposited, enhancing the body's ability to recognize and eliminate neoplastic cells, decreasing symptoms of allergic reaction including allergic rhinitis and anaphylaxis, decrease the formation and deposit of autoantibody complexes, ameliorate the symptoms of chronic neurologic disease, and decrease the symptoms of chronic pain syndromes.12-29-2011
20110318373IMMUNOSUPPRESSION MODULATING COMPOUNDS - The present invention provides immunosuppression compounds capable of inhibiting the programmed cell death 1 (PD1) signalling pathway. The present invention further provides peptide based compositions for treatment of cancer or treatment of infections via immunopotentiation caused by inhibition of immunosuppressive signaling induced by PD-1, PD-L1, or PD-L2 and therapies using them, immunopotentiative substrates included as the active ingredient. Further, the invention provides an application of the compositions containing the peptide moieties for preventive and/or therapeutic agents for cancer, cancer metastasis, immunodeficiency, an infectious disease or the like and an application of peptide moieties as a testing or diagnostic agent or a research agent for such a disease.12-29-2011
20120014980VACCINES COMPRISING TB10.4 - Vaccination with the combination of Ag85B-TB10.4 and IC31® adjuvant generated a high amount of polyfunctional CD401-19-2012
20120020991PRODOMAIN MODULATORS OF ADAM 10 - The presently disclosed subject matter discloses isolated ADAM 10 modulating peptides and related compounds useful for studying the biological functions of ADAM 10 and for the treatment of diseases such as cancer, neurological disorders, asthma, and allergic responses, and disorders characterized at least in part by the presence of one or more of inflammation, excess cell proliferation, angiogenesis, and excess soluble CD23. In one aspect, the presently disclosed subject matter provides isolated mouse and human ADAM 10 prodomain comprising the sequence set forth in SEQ ID NOs 1-8, or a sequence having at least 95% homology to any of SEQ ID NOs 1-8 and having the functionality of modulating ADAM 10 activity.01-26-2012
20120020990ISOLATED MAMMALIAN MONOCYTE CELL GENES; RELATED REAGENTS - Nucleic acids encoding various monocyte cell proteins from a primate, reagents related thereto, including specific antibodies, and purified proteins are described. Methods of using said reagents and related diagnostic kits are also provided.01-26-2012
20130195902RECOMBINANT ALLERGEN - Dander from the domestic cat (08-01-2013
20130195901SSX-2 PEPTIDE ANALOGS - Some embodiments relate to analogs of peptides corresponding to class I MHC-restricted T cell epitopes and methods for their generation. These analogs can contain amino acid substitutions at residues that directly interact with MHC molecules, and can confer improved, modified or useful immunologic properties. Additionally classes of analogs, in which the various substitutions comprise the non-standard residues norleucine and/or norvaline, are disclosed.08-01-2013
20130195903COMPOSITIONS FOR USE IN THE TREATMENT OF CHRONIC OBSTRUCTIVE PULMONARY DISEASES AND ASTHMA - The present invention provides compounds and methods for treating or preventing pulmonary diseases include COPD and asthma. In particular, the present invention provides for compounds comprising type V collagen, or tolerizing fragments thereof, for the treatment of COPD and asthma.08-01-2013
20120034251PHARMACEUTICAL COMPOSITION FOR TREATING OR PREVENTING CANCER BY INDUCING DENDRITIC CELL-LIKE DIFFERENTIATION FROM MONOCYTES TO IMPROVE ANTICANCER IMMUNE ACTIVITY - According to the present invention, a composition for inducing or activating dendritic cell-like cells so as to treat or prevent cancer by immunotherapy is provided.02-09-2012
20080260759Novel Mite Allergen - A safe and efficient recombinant mite allergen is provided as a therapeutic agent or a diagnostic agent for mite allergic diseases, which contains no anaphylaxis-inducing impurities. The following recombinant protein (a) or (b) is provided: (a) a protein comprising the amino acid sequence represented by SEQ ID NO: 2 or 35; or (b) a protein comprising an amino acid sequence derived from the amino acid sequence represented by SEQ ID NO: 2 or 35 by deletion, substitution, or addition of one or several amino acids and having mite allergen activity.10-23-2008
20130202633DETERMINATION OF IMMUNOGENIC PEPTIDES IN LYSOSOMAL ENZYMES AND INDUCTION OF ORAL TOLERANCE - Disclosed are methods and compositions for determining immunodominant peptides of target enzymes used in enzyme replacement therapy for lysosomal storage disorders. More specifically disclosed are immunodominant peptides for N-acetylgalactosamine-6-sulfatase (GALNS). Also disclosed are methods of inducing oral tolerance towards a target enzyme through oral administration of immunodominant peptides prior to commencing enzyme replacement therapy. More specifically disclosed is a method of inducing oral tolerance for GALNS, by orally administering specific immunodominant peptides for GALNS; in subjects suffering from mucopolysaccharidosis type IVA prior to commencing enzyme replacement therapy using GALNS.08-08-2013
20130202632MINIMAL MOTIFS OF LINEAR B-CELL EPITOPES IN L1 PROTEIN FROM HUMAN PAPILLOMAVIRUS TYPE 58 AND THEIR APPLICATIONS - Minimal Motifs of linear B-cell epitopes in L1 structure protein from human papillomavirus type 58 (HPV 58) and their applications are disclosed. Eighteen linear epitope motifs and their extended 8-mer peptides in the L1 protein from HPV 58 are described, which can be used as antigens separately or in combination to specifically detect the serum from subjects with HPV 58 infection, or to develop preventive or therapeutic multi-epitope peptide vaccines against HPV 58 by inducing humoral immunity. Of the eighteen B-cell epitope motifs, ten of them are 100% conservative and one is highly conservative among many homologous proteins of high-risk HPVs. They can be used as candidate “universal” epitopes to develop preventive or therapeutic HPV vaccines. The amino acid sequences of the epitope motifs and the 8-mer peptide formula of the invention are shown below in SEQ ID No. 1-2, 2B, 3, 3B, 4-18, 18B, 19, 19B, and 20-32.08-08-2013
20090047300BLOOD-BRAIN BARRIER EPITOPES AND USES THEREOF - The invention features a method of identifying an agent and generating an antibody that can cross the blood bram barrier, through the use of novel antigen isoforms of transmembrane domain protein 30A (TMEM30A) This is useful in establishing mechanisms of transmigration across the blood-bram barrier. These antigens are enriched in bram endothelium compared to other endothelial cells and may have better selectivity and capacity for bram delivery compared to transferrin and insulin receptors One antigen is TMEM30A.02-19-2009
20130095127METHODS OF INHIBITING INFLAMMATION AND INFLAMMATORY DISEASES USING Gal-3BP (BTBD17B, LGALS3BP, GALECTIN-3 BINDING PROTEIN, MAC-2 BINDING PROTEIN) - The invention provides Galectin-3 binding protein (Gal-3BP, BTBD17B) polypeptides, Gal-3BP compositions, and methods of use, and uses, for example, in treatment, diagnostic, detection and prognostic methods, such as treatment of an undesirable or aberrant immune response, immune disorder, inflammatory response, or inflammation, and treatment of an autoimmune response, disorder or disease.04-18-2013
20120082691HLA-BINDING PEPTIDES DERIVED FROM PROSTATE-ASSOCIATED ANTIGENIC MOLECULES AND METHODS OF USE THEREOF - Methods and compositions for immunotherapeutic treatment of prostate cancer are disclosed. Patients are treated with compositions comprising HLA-binding peptides derived from prostate-associated antigenic molecules, either with or without immunological adjuvants.04-05-2012
20120093844ANTIMICROBIAL PEPTIDES BASED ON CMAP27 - The invention concerns derivatives of CMAP27, which have a good antimicrobial activity and a low haemolytic activity as compared to the wild-type CMAP27 peptide. These derivatives can be used for antibiotic therapy or in a bacteriocidal composition. Further comprised in the invention is the use of CMAP27 and/or its derivatives as adjuvant.04-19-2012
20120093843TEM8 PEPTIDES AND VACCINES COMPRISING THE SAME - According to the present invention, peptides comprising the amino acid sequence of SEQ ID NO: 3, 4, 9, 23, 25, 30, 60, 63 or 68 were demonstrated to have cytotoxic T lymphocyte (CTL) inducibility. Therefore, the present invention provides a peptide having the amino acid sequence selected from the group of SEQ ID NOs: 3, 4, 9, 23, 25, 30, 60, 63 and 68. The peptide can include one, two, or several amino acid substitutions or addition so long as its CTL inducibility is retained. Furthermore, the present invention provides pharmaceutical agents for treating and/or prophylaxis of tumors, and/or prevention of postoperative recurrence thereof, which comprises any of these peptides. The pharmaceutical agents of this invention include vaccines.04-19-2012
20130209498Methods to activate or block the HLA-E/Qa-1 restricted CD8+ T cell regulatory pathway to treat immunological disease - Methods are provided for inhibiting or enhancing down-regulation of an antigen-activated HLA-E08-15-2013