Entries |
Document | Title | Date |
20080199484 | Use Of Cox-2 Inhibitor to Prevent T-Cell Anergy Induced By Dendritic Cell Therapy - The present invention relates to a method and combination therapy useful in the treatment of cancer. More specifically, the invention relates to the use of COX-2 inhibitors in combination with a therapeutic dendritic cell vaccine for treating cancer. The COX-2 inhibitors of the present invention are believed to inhibit the enzymatic activity of prostaglandineE | 08-21-2008 |
20080199485 | Method for enhancing T cell response - Embodiments of the invention disclosed herein relate to methods and compositions for exponentially increasing antigenic stimulation of class I MHC CD8 | 08-21-2008 |
20080206264 | Constrained Hiv V3 Loop Peptides as Novel Immunogens and Receptor Antagonists - The present invention provides constrained peptides and other organic molecules, that mimic the three dimensional characteristics of the HIV-1 V3 loop peptide when bound by a highly potent human neutralizing monoclonal antibody specific for a V3 conformational epitope, which structure is determined by NMR. Methods for screening for, and designing such molecules are disclosed. These molecules are useful as immunogens for inducing broadly-neutralizing antibodies against HIV-1 as well as antagonists for inhibiting the binding of HIV-1 to the relevant co-receptors, and may therefore be used in method of preventing or treating HIV-1 infection and disease. | 08-28-2008 |
20080206265 | SYNERGISTIC TREATMENT OF CANCER USING IMMUNOMERS IN CONJUNCTION WITH CHEMOTHERAPEUTIC AGENTS - The invention relates to the therapeutic use of immunostimulatory oligonucleotides and/or immunomers in combination with chemotherapeutic agents to provide a synergistic therapeutic effect. | 08-28-2008 |
20080206266 | Carbohydrate Ligands Specific For MHC Molecules - The present invention provides a substantially purified carbohydrate ligand that specifically binds to a leczyme. The invention also provides methods to identify a carbohydrate ligand that specifically binds to a leczyme or a leczyme that specifically binds to a carbohydrate ligand. The invention further provides methods to identify a peptide that binds to the carbohydrate ligand binding site of a leczyme. | 08-28-2008 |
20080213290 | Hepatitis C virus codon optimized non-structural NS3/4A fusion gene - Aspects of the present invention relate to the discovery of a novel hepatitis C virus (HCV) isolate. Embodiments include HCV peptides, nucleic acids encoding said HCV peptides, antibodies directed to said peptides, compositions containing said nucleic acids and peptides, as well as methods of making and using the aforementioned compositions including, but not limited to, diagnostics and medicaments for the treatment and prevention of HCV infection. | 09-04-2008 |
20080213291 | Malaria vaccines - The invention provides isolated placental | 09-04-2008 |
20080220006 | Method for Modulating Inflammatory Responses - The present invention is a method for inhibiting T | 09-11-2008 |
20080226660 | Optimized Expression of Hpv 58 L1 in Yeast - Synthetic DNA molecules encoding the HPV 52 L1 protein are provided. Specifically, the present invention provides polynucleotides encoding HPV 52 L1 protein, wherein said polynucleotides are codon-optimized for high level expression in a yeast cell. In alternative embodiments of the invention, the nucleotide sequence of the synthetic molecule is altered to eliminate transcription termination signals that are recognized by yeast. The synthetic molecules may be used to produce HPV 52 virus-like particles (VLPs), and to produce vaccines and pharmaceutical compositions comprising the HPV 52 VLPs. The vaccines of the present invention provide effective immunoprophylaxis against papillomavirus infection through neutralizing antibody and cell-mediated immunity and may also be useful for treatment of existing HPV infections. | 09-18-2008 |
20080226661 | Phage Screening Assay - The present invention relates to a method for identifying an agent for potential use in a vaccine. The present invention also provides agents identified by this method for use in a vaccine. The present further describes peptides of the pathogen | 09-18-2008 |
20080226662 | Dendritic cell co-stimulatory molecules - A novel costimulatory protein molecule, B7-DC, which is a member of the B7 family, is described as is DNA coding therefor and expression vectors comprising this DNA. B7-DC protein, fragments, fusion polypeptides/proteins and other functional derivatives, and transformed cells expressing B7-DC are useful in vaccine compositions and methods. Compositions and methods are disclosed for inducing potent T cell mediated responses that can be harnessed for anti-tumor and anti-viral immunity. | 09-18-2008 |
20080226663 | Pine Cone Extracts and Uses Thereof - A method of producing a pine cone extract and the pine cone extract produced there from, wherein the pine cone extract is useful in increasing the effects of nucleic acid vaccines and medicaments; and useful in the production of phenotypically immature and/or mature dendritic and/or fibrocyte cells. | 09-18-2008 |
20080241171 | Stem Cell Populations and Methods of Use - Populations of stem cells and methods for their isolation and use are provided. These stem cell populations comprise aldehyde dehydrogenase positive (ALDH | 10-02-2008 |
20080241172 | Mutated Cholinesterase Sequences, Corresponding Nucleic Acids And Their Uses - The present invention relates to the use of a peptide sequence to form oligomers, especially tetramers, of cholinesterases, said peptide sequence comprising: a peptide corresponding to SEQ ID NO: 4, wherein any one of amino acids of position 12 to position 19 of SEQ ID NO; 4 is replaced by a cysteine, any homologous sequence of said peptide, or any sequence derived from said peptide, or any fragment of one of the sequences defined above, on the condition that is possesses the property of forming oligomers of cholinesterases. | 10-02-2008 |
20080241173 | Nucleic acid encoding receptor type protein kinase - To provide a nucleic acid encoding a receptor protein kinase, wherein the nucleic acid has tandem duplication in a nucleotide sequence of a juxtamembrane and is useful for diagnosis of leukemia; a polypeptide encoded by the nucleic acid; an antibody capable of specifically binding to a region encoded by the nucleic acid having tandem duplication occurring in a nucleotide sequence of a juxtamembrane; a nucleic acid capable of specifically binding to the nucleic acid having tandem duplication occurring in a nucleotide sequence of a juxtamembrane; a method for detection of the nucleic acid encoding a receptor protein kinase; and a kit therefor. A nucleic acid encoding a receptor protein kinase, wherein the nucleic acid has tandem duplication in a nucleotide sequence of a juxtamembrane; a polypeptide encoded by the nucleic acid; an antibody capable of specifically binding to the portion of the polypeptide; a nucleic acid capable of specifically binding to the nucleic acid; a method for detection of the nucleic acid; and a kit for detection. | 10-02-2008 |
20080241174 | Production And Therapeutic Uses Of Th1-Like Regulatory T Cells - A unique CD4 | 10-02-2008 |
20080241175 | Dendritic Cell Co-Stimulatory Molecules - A novel costimulatory protein molecule, B7-DC, which is a member of the B7 family, is described as is DNA coding therefor and expression vectors comprising this DNA. B7-DC protein, fragments, fusion polypeptides/proteins and other functional derivatives, and transformed cells expressing B7-DC are useful in vaccine compositions and methods. Compositions and methods are disclosed for inducing potent T cell mediated responses that can be harnessed for anti-tumor and anti-viral immunity. | 10-02-2008 |
20080241176 | METHOD FOR RAPID GENERATION OF MATURE DENDRITIC CELLS - Novel methods of rapidly generating dendrtic cells are disclosed herein. The methods include contacting a dendritic cell precursor with a D ODN to generate a mature dendritic cell. In one specific, non-limiting example, the method includes contacting the dendritic cell precursor or the mature dendritic cell with an antigen. The methods are of use both in vitro and in vivo. | 10-02-2008 |
20080248054 | Regulation of Mink in Thymocytes and T Lymphocytes - The invention relates to compositions and methods used to assess and alter the expression and activity of MINK in cells of the immune system, particularly thymocytes and T lymphocytes. The methods and compositions are used in a variety of clinical applications including vaccination, treatment of cancer, infectious disease, allergy, and transplantation. Screening methods are provided to identify inhibitors of MINK and susceptibility to effects of under- or over-expression of MINK. | 10-09-2008 |
20080248055 | Immunomodulation by a therapeutic medication intended for treatment of diabetes and prevention of autoimmune diabetes - The present invention regards methods and formulations for the treatment of diabetes and the prevention of autoimmune diabetes. The invention includes the administration of human recombinant GAD65 protein in a pharmaceutically acceptable adjuvant. | 10-09-2008 |
20080254046 | Method for the Delivery of Exogenous Antigens into the Mhc Class I Presentation Pathway of Cells - The present invention relates to an in vitro method that allows for delivery of exogenous antigens into the MHC class I presentation pathway of antigen-presenting cells (APCs), comprising the following steps: (a) preparation of suitable APCs; (b) determination of suitable specific method parameters for APCs, comprising (1) bringing the cells in contact with a haemolysin such as listeriolysin (LLO) and a marker substance; (2) measuring of marker substance inflow into the cells; and (3) optionally, modifying said specific parameters; and (c) delivery of exogenous antigens into the APCs, by applying the specific parameters calculated in step (b) and bringing the cells in contact with a haemolysin and the antigen of interest. | 10-16-2008 |
20080254047 | Activation of Human Antigen-Presenting Cells Through CLEC-6 - The present invention includes compositions and methods for using novel anti-CLEC-6 antibodies and fragments thereof for modulating the activity of immune cells. | 10-16-2008 |
20080254048 | HE4 MONOCLONAL ANTIBODIES AND METHODS FOR THEIR USE - Compositions and methods for diagnosing ovarian cancer in a patient and for identifying patients with an increased likelihood of having ovarian cancer are provided. The compositions include novel monoclonal antibodies, and variants and fragments thereof, that specifically bind to HE4. Monoclonal antibodies having the binding characteristics of an HE4 antibody of the invention are further provided. Hybridoma cell lines that produce an HE4 monoclonal antibody of the invention are also disclosed herein. The compositions find use in diagnostic methods as well as in screening methods for identifying patients having an increased likelihood of having ovarian cancer. Kits comprising one or more of the disclosed HE4 monoclonal antibodies and for practicing the methods of the invention are further provided. Polypeptides comprising the amino acid sequence for an HE4 epitope and methods of using these polypeptides in the production of antibodies are also encompassed by the present invention. | 10-16-2008 |
20080254049 | Composition for Treatment of Colds and Associated Symptoms - A homeopathically designed composition comprising zinc and dilute amounts of | 10-16-2008 |
20080260758 | UNIVERSAL GM-CSF EXPRESSING BYSTANDER HUMAN K562 CELL LINE - The present invention provides a universal immunomodulatory cytokine-expressing bystander cell line, a composition comprising such a cell line and a cancer antigen, a method of making such a cell line, and a method of using such a composition. | 10-23-2008 |
20080267982 | Methods Kits and Compositions for the Developement and Use of Monoclonal Antibodies Specific to Anbtigens of Low Immunogenicity - The invention relates to the development and use of monoclonal antibodies specific to antigens traditionally of low immunogenicity. The present invention provides methods of producing monoclonal antibodies by chemically conjugating the antigen of interest to a carrier molecule that enables the immune system to respond to immunization with the conjugated antigen. The invention also provides particular compositions of conjugated antigens as well as of monoclonal antibodies specific for those conjugated antigens. The present invention also provides kits for use in detecting disease conditions using the monoclonal antibodies. | 10-30-2008 |
20080267983 | Peptide Inhibitors for Mediating Stress Responses - The present invention relates to peptides capable of inhibiting cellular and immune stress responses in a eukaryotic cell. The invention provides compositions and methods for the treatment of human degenerative diseases and inflammation, utilizing peptides recognized by monoclonal anti-DNA antibodies, the peptides having anti-apoptotic and anti-inflammatory activity. The invention further provides antibody molecules and uses thereof for the isolation of such peptides. | 10-30-2008 |
20080267984 | Activation of Human Antigen-Presenting Cells Through Dendritic Cell Lectin-Like Oxidized LDL Receptor-1 (LOX-1) - The present invention includes compositions and methods for targeting the LOX-1 receptor on immune cells and uses for the anti-LOX-1 antibodies. | 10-30-2008 |
20080274125 | Human Stem Cell Lines Derived From Es Cells and Uses for Production of Vaccines and Recombinant Proteins - The present invention concerns the field of biology and virology. In particular, the invention concerns a method for obtaining human cell lines, in particular human stem cells derived from human embryonic stem cells, the method comprising separation from the serum, the feeder layer and at least one growth factor. The cell lines are capable of proliferating indefinitely in a basic culture medium. The invention also concerns the use of the cells derived from such cell lines for virus replication, and more particularly for producing human or veterinary vaccines, as well as for producing recombinant proteins of therapeutic interest. | 11-06-2008 |
20080274126 | Oral Vaccines for Fish - The invention relates to the development, composition and production of mucosal (oral) vaccines for fish. More specifically, the invention relates to protein complexes for the delivery of antigens to and across mucosal surfaces of fish for the induction of an immune response, and to the production of said complexes in a host cell, preferably plants. Provided is the use of a protein complex comprising an antigen of interest fused to the B-subunit of | 11-06-2008 |
20080274127 | AMINO ACID SUPPLEMENTATION FOR A HEALTHY MICROBIOTA ECOSYSTEM - The present invention pertains to a nutritional composition for reconstituting an optimal healthy microbiota ecosystem in humans or animals. In particular, the present invention relates to an ingestible carrier containing specific amino acids designed to favor the growth of bacteria favorable to individuals health or for reducing the risk of developing deleterious events. The invention also pertains to the use of specific amino acids for reconstituting an optimal healthy microbiota ecosystem in humans or animals, in particular in infants, critically ill patients, in the case of chronic diseases or any stresses impacting the gut and in elderly people. | 11-06-2008 |
20080279869 | METHOD FOR REDUCING NEURONAL DEGENERATION BY ADMINISTERING CNS-DERIVED PEPTIDES OR ACTIVATED T CELLS - Compositions are provided for promoting nerve regeneration or reducing or inhibiting degeneration in the CNS or PNS to ameliorate the effects of injury or disease. The composition includes an active ingredient selected from:(a) a peptide obtained by modification of a self-peptide derived from a CNS-specific antigen, which modification consists in the replacement of one or more amino acid residues of the self-peptide by different amino acid residues, such modified CNS peptide still being capable of recognizing the T-cell receptor recognized by the self-peptide but with less affinity; (b) a nucleotide sequence encoding such a peptide; (c) T cells activated by such peptide; and (d) any combination of (a)-(c). The peptide is preferably obtained by modification of the self-peptide p87-99 of MBP, more preferably, by replacing lysine 91 with glycine (G91) or alanine (A91) or by replacing proline 96 with alanine (A96). | 11-13-2008 |
20080279870 | ALK protein tyrosine kinase, cells and methods embodying and using same - The present invention provides for a transgenic animal model that constitutively expresses a protein encoded by the NPM-ALK gene in lymphoid tissue, and exhibits enhanced and accelerated development of a T cell lymphoproliferative disorder or B cell plasma cell tumor, together with the identification of cells transduced with the ALK tyrosine kinase gene or fusion proteins thereof, and methods for using this animal model and cells for screening compounds or treatments for antitumor activity. In preferred embodiments, the animal is a transgenic mouse that expresses a human NPM-ALK gene operably linked to human regulatory sequences, and the cells of the mouse have at least one copy of the NPM-ALK transgene, whereby the mouse constitutively expresses a protein encoded by the NPM-ALK transgene. The animals and cells of the invention are useful in the study of NPM-ALK-dependent lymphomagenesis and plasma cell tumors and in the development of treatments for these conditions. | 11-13-2008 |
20080286292 | MOLECULAR VACCINE LINKING INTERCELLULAR SPREADING PROTEIN TO AN ANTIGEN - Superior molecular vaccines comprise nucleic acids, including naked DNA and replicon RNA, that encode a fusion polypeptide that includes an antigenic peptide or polypeptide against which an immune response is desired. Fused to the antigenic peptide is an intercellular spreading protein, in particular a herpes virus protein VP22 or a homologue or functional derivative thereof. Preferred spreading proteins are VP22 from HSV-1 and Marek's disease virus. The nucleic acid can encode any antigenic epitope of interest, preferably an epitope that is processed and presented by MHC class I proteins. Antigens of pathogenic organisms and cells such as tumor cells are preferred. Vaccines comprising HPV-16 E7 oncoprotein are exemplified. Also disclosed are methods of using the vaccines to induce heightened T cell mediated immunity, in particular by cytotoxic T lymphocytes, leading to protection from or treatment of a tumor. | 11-20-2008 |
20080292647 | MELANOMA ANTIGENS AND THEIR USE IN DIAGNOSTIC AND THERAPEUTIC METHODS - The present invention provides a nucleic acid sequence encoding a melanoma antigen recognized by T lymphocytes, designated MART-1. This invention further relates to bioassays using the nucleic acid sequence, protein or antibodies of this invention to diagnose, assess or prognoses a mammal afflicted with melanoma or metastata melanoma. This invention also provides immunogenic peptides derived from the MART-1 melanoma antigen and a second melanoma antigen designated gp100. This invention further provides immunogenic peptides derived from the MART-1 melanoma antigen or gp100 antigen which have been modified to enhance their immunogenicity. The proteins and peptides provided can serve as an immunogen or vaccine to prevent or treat melanoma. | 11-27-2008 |
20080292648 | SYNTHETIC AGONISTS OF TLR9 - The invention provides novel oligonucleotide-based compounds that individually provide distinct immune response profiles through their interactions as agonists with TLR9. The TLR9 agonists according to the invention are characterized by specific and unique chemical modifications, which provide their distinctive immune response activation profiles. | 11-27-2008 |
20080292649 | COMPOSITION FOR IMPROVING MEMBRANE COMPOSITION AND FUNCTIONING OF CELLS - It has now been found that after administration to a diseased person or person that is at risk for developing such disease of a neutraceutical or pharmaceutical composition that comprises
| 11-27-2008 |
20080311137 | Carcinoembryonic Antigen Fusions and Uses Thereof - Polynucleotides encoding carcinoembryonic antigen (CEA) fusion proteins are provided, the CEA fusion proteins comprising a CEA protein, or functional variant thereof, fused to a substantial portion of an immunoenhancing element. The polynucleotides of the present invention can elicit an immune response in a mammal, which, in preferred embodiments, is stronger than the immune response elicited by a wild-type CEA. The gene encoding CEA is commonly associated with the development of human carcinomas. The present invention provides compositions and methods to elicit or enhance immunity to the protein product expressed by the CEA tumor-associated antigen, wherein aberrant CEA expression is associated with a carcinoma or its development. This invention specifically provides adenoviral vector and plasmid constructs carrying polynucleotides encoding CEA fusion proteins and discloses their use in vaccines and pharmaceutical compositions for preventing and treating cancer. | 12-18-2008 |
20080311138 | Adjuvant Activity of Gastrointestinal Peptides - Gastrointestinal peptides (GPs) have been found to function as vaccine adjuvants, and in particular as mucosal adjuvants. The invention provides an immunogenic composition comprising: (a) a GP adjuvant; and (b) an antigen. The composition is preferably suitable for mucosal administration e.g. intranasal administration. | 12-18-2008 |
20080311139 | Plant Produced Vaccine for Amebiasis - Disclosed herein are methods of making a vaccine against | 12-18-2008 |
20080311140 | Antigen specific immunosuppression by dendritic cell therapy - The invention includes genetically modified dendritic cells expressing at least two immunosuppressive molecules. The genetically modified dendritic cells have the ability to induce tolerance. Enhanced tolerogenicity is useful for prolonging survival of a foreign transplant and for treatment of autoimmune diseases. | 12-18-2008 |
20080317769 | Vaccine Composition Comprising Alpha-Galactosylceramide as an Adjuvant For Intranasal Administration - The present invention related to a vaccine composition comprising alpha-galactosylceramide (αGalCer) as an adjuvant for the intranasal administration. The present inventors administered αGalCer together with a tumor cell antigen or a virus antigen to the nasal cavity of a mouse and then confirmed that the αGalCer effectively induced not only humoral immunity but also cell-mediated immunity. Thus, the αGalCer can be effectively used as an adjuvant for a vaccine by the intranasal administration for the prevention and treatment of virus infection and cancer. | 12-25-2008 |
20080317770 | INDUCTION OF IMMUNOLOGICAL TOLERANCE - A method of creating tolerance to transplanted cells, tissue, or organs without the need for continuous immunosuppression. A tolerizing dose of a cell or tissue within a membrane structure is implanted into a patient. Once the patient becomes tolerant to the cell or tissue, a tissue or organ is implanted which will no longer be recognized as foreign matter. The method makes animal organs, practical for human use, prevents autoimmune destruction as well as immune rejection. It has applications in treatment and prevention of many mammalian diseases. | 12-25-2008 |
20090004208 | Method for designing hypoallergenic molecules for use in allergy desensitization with lessened chance of anaphylaxis, or as vaccines against allergic reactions - A unique method is disclosed for identifying and replacing surface amino acid residues of a protein allergen that reduces the antigenicity of its dominant IgE epitopes. The method is useful in the design of hypoallergenic molecules for use in allergy desensitization with lessened chance of anaphylaxis, or as vaccines against allergic reactions. | 01-01-2009 |
20090004209 | 4'-O- substituted isoindoline derivatives and compositions comprising and methods of using the same - Provided are 4′-O substituted isoindoline compounds, and pharmaceutically acceptable salts, solvates, clathrates, stereoisomers, and prodrugs thereof. Methods of use, and pharmaceutical compositions of these compounds are disclosed. | 01-01-2009 |
20090010946 | Novel Stromal Cell-Derived Factor-1 Polypeptides, Polynucleotides, Modulators Thereof and Methods of Use - Disclosed herein is a newly identified SDF-1 splice variant molecule, its polypeptide sequence, and the polynucleotides encoding the polypeptide sequence, and active fragments thereof. Also provided is a procedure for producing such polypeptides by recombinant techniques employing, for example, vectors and host cells. Also disclosed are methods for utilizing such polypeptides and modulators thereof for the treatment of diseases, including cancer, immune diseases, infectious diseases, and ischemic diseases. | 01-08-2009 |
20090010947 | Red Microalgae Expressing Exogenous Polypeptides And Methods Of Generating And Utilizing Same - A method of transforming red microalgae is provided. The method is effected by: (i) culturing red microalgae cells under predetermined light/dilution conditions to thereby generate competent red microalgae cells; and (ii) introducing at least one exogenous polynucleotide into said competent red microalgae cells, thereby transforming the red microalgae. | 01-08-2009 |
20090010948 | ANTI-TUMOR VACCINES DELIVERED BY DENDRITIC CELLS DEVOID OF INTERLEUKIN-10 - It has been discovered that reducing, inhibiting or preventing the expression of immunosuppressive cytokines or tolergenic agents in antigen presenting cells improves the ability of the antigen presenting cell to promote an immune response. One embodiment provides a genetically engineered antigen presenting cell that has reduced or no expression of IL-10. Preferred antigen presenting cells are dendritic cells. Expression of IL-10 can be inhibited or blocked by genetically engineering the antigen presenting cell to express inhibitory nucleic acids that inhibit or prevent the expression mRNA encoding immunosuppressive cytokines. Inhibitory nucleic acids include siRNA, antisense RNA, antisense DNA, microRNA, and enzymatic nucleic acids that target mRNA encoding immunosuppressive cytokines. Immunosuppressive cytokines include, but are not limited to IL-10, TGF-β, IL-27, IL-35, or combinations thereof. Tolerogenic agents include but are not limited to indoleamine 2,3-dioxygenase. | 01-08-2009 |
20090010949 | POLYSIALIC ACID DERIVATIVES, METHODS OF PRODUCTION, AND USES IN ENHANCING CANCER ANTIGEN PRODUCTION AND TARGETING - The present invention relates to compositions and methods of their production and use, including use in increasing de-N-acetyl sialic acid antigen of a mammalian cell and methods that exploit the increase in deNAc sialic acid antigen on such cells. | 01-08-2009 |
20090010950 | EX-VIVO ISOLATED CD25+CD4+ T CELLS WITH IMMUNOSUPPRESSIVE ACTIVITY AND USES THEREOF - Ex-vivo isolated human CD25 | 01-08-2009 |
20090017047 | Preparation for the Prevention and Treatment of Stress Conditions as Well as Functional and Organic Disorders of the Nervous System and Metabolic Disorders - Disclosed is a preparation for preventing and treating stress conditions as well as functional and organic disorders of the nervous system and metabolic disorders, to be used by people suffering from actinic dermatitis, against sunburn, as a regenerative agent for damaged cells/cell systems, and for the well-being of humans and animals. Also disclosed are methods for isolating cell components from Aloe barbadensis miller, producing energized/magnetized microparticles and nanoparticles, and using cell components. Previously known substances that arm used for the indications mentioned above are expensive to produce or have insufficient effective properties. Preparations containing glycine, especially in a gel formulation, are easy to produce while being surprisingly advantageous for the most various applications. As a result of the excellent properties of glycine, the inventive preparations are easy to implement for external and/or internal uses, providing effective prophylaxis and possibilities for beating the different affected body zones or improving the perceived state. | 01-15-2009 |
20090017048 | Novel Brachyspira hyodysenteriae vaccine - The present invention relates to nucleic acid sequences encoding a 61 kD and a 20 kD | 01-15-2009 |
20090017049 | BetaGBP, compositions comprising betaGBP, and related methods and uses thereof - The invention relates to β-galactoside binding protein (βGBP) and compositions, including pharmaceutical compositions, comprising βGBP for use in therapy and related applications. In particular, the invention relates to use of βGBP and the manufacture of medicaments for the treatment or prevention of conditions in which disease associated cell division occurs, wherein the cells which result from said disease associated cell division comprise a cell in respect of which the effect of βGBP is not inhibition of growth. The invention also relates to methods of inducing apoptosis, methods of treating or preventing conditions in which disease associated cell division occurs and methods of assessing the suitability of βGBP as a therapeutic agent. | 01-15-2009 |
20090017050 | EGFR ANTIGEN-BINDING MOLECULES AND USES THEREOF - Disclosed herein are antigen-binding molecules, such as antibodies, that specifically recognize a portion of the EGFR C-terminal (intracellular) regulatory domain that interacts with one or more regulatory molecules (such as Suppressor of Cytokine Signaling (“SOCS”) proteins). In certain normal or neoplastic cells and/or tissues, this region is inaccessible to the disclosed antigen-binding molecules. Thus, such antigen-binding molecules are useful at least to interrogate the regulated state of EGFR, predict the response of a cancer patient to EGFR inhibitor therapies, and/or predict the aggressiveness of neoplasms. | 01-15-2009 |
20090022746 | Complexes for transferring nucleic acids into cells - The invention relates to complexes of cationic polymers and nucleic acids, to the use of such complexes for introducing nucleic acids into cells and organisms, to the use of the complexes as pharmaceuticals, and to novel polymers which can be used to prepare the complexes. | 01-22-2009 |
20090035324 | NOVEL PYRIMIDINECARBOXAMIDE DERIVATIVES - This disclosure relates to novel HIV integrase inhibitors their derivatives, pharmaceutically acceptable salts, solvates, and hydrates thereof. This disclosure also provides compositions comprising a compound of this disclosure and the use of such compositions in methods of treating HIV infections. | 02-05-2009 |
20090041792 | Dendritic cells, uses therefor, and vaccines and methods comprising the same - Provided is a method of cross-priming CD8+ T cells to antigens using Dendritic Cells cultured in the presence of a type I Interferon and GM-CSF, and vaccines and methods of vaccination comprising said Dendritic Cells. | 02-12-2009 |
20090047297 | MICROFLUID SYSTEM FOR THE ISOLATION OF BILOGICAL PARTICLES USING IMMUNOMAGNETIC SEPARATION - The present invention relates to a device and to a method for the isolation of biological particles. This device has a throughflow channel | 02-19-2009 |
20090047298 | IMMUNE SYSTEM STIMULANT AND PROCESS OF MANUFACTURING THE SAME - An immune system stimulant for stimulating the production of antibodies against a pathogen comprises said pathogen attenuated by exposure to hydroxyl radicals. The invention also provides a process for the manufacture of an immune system stimulant. | 02-19-2009 |
20090047299 | MODIFIED ALPHA-GALACTOSYL CERAMIDES FOR STAINING AND STIMULATING NATURAL KILLER T CELLS - Modified glycolipid compounds are provided. Also disclosed are methods for activating an NKT cell, methods of stimulating an immune response in a subject, and methods suitable for labeling NKT cells. | 02-19-2009 |
20090053249 | Specific Inhibition of Autoimmunity and Diseases Associated With Autoantigens - The present invention provides compositions and methods for specifically inhibiting host immune responses against autoantigens. In particular, compositions and methods combining CD8 polypeptide expression with autoantigen expression or presentation are described for specifically inhibiting the humoral and cellular components of the host immune response to autoantigens. | 02-26-2009 |
20090053250 | Immune Modulating Oligonucleotides in Connection with Chemotherapeutic Measures - The invention relates to the use of immune modulators on the basis of DNA in the form of covalently closed nucleic acid molecules comprising immune stimulatory sequence motifs, for the production of a pharmaceutical for the therapeutic treatment of tumor diseases in combination with chemotherapeutic drugs. | 02-26-2009 |
20090053251 | Dendritic Cell Compositions and Methods - Methods are provided for the production of dendritic cells from monocytes that have been incubated at a temperature of 1° C.-34° C. for a period of approximately 6 to 96 hours from the time they are isolated from a subject. After the incubation period, the monocytes can then be induced to differentiate into dendritic cells. Mature dendritic cells made by the methods of the invention have increased levels of one or more of CD80, CD83, CD86, MHC class I molecules, or MHC class II molecules as compared to mature dendritic cells prepared from monocytes that have not been held at 1° C.-34° C. for at least 6 hours from the time they were isolated from a subject. Dendritic cells made by the methods of the invention are useful for the preparation of vaccines and for the stimulation of T cells. | 02-26-2009 |
20090053252 | BIMER OR AN OLIGOMER OF A DIMER, TRIMER, QUATROMER OR PENTAMER OF RECOMBINANT FUSION PROTEINS - The invention relates to oligomers of a dimer, trimer, quatromer or pentamer of recombinant fusion proteins. Said oligomers are characterized in that the recombinant fusion proteins have at least one component A and at least one component B, whereby component A contains a protein or a protein segment with a biological function, in particular with a ligand function for antibodies, for soluble or membranous signal molecules, for receptors or an antibody, or an antibody segment, and component B contains a protein or a protein segment which dimerizes or oligomerizes the dimer, trimer, quatromer or pentamer of the recombinant fusion protein, without the action of third-party molecules. The invention also relates to the use of dimers or oligomers of this type for producing a medicament, to the fusion proteins which cluster in dimers or oligomers and to their DNA sequence and expression vectors or host cells comprising this DNA sequence. | 02-26-2009 |
20090053253 | Process for the measurement of the potency of glatiramer acetate - The subject invention provides a process for measuring the relative potency of a test batch of glatiramer acetate. In addition, the subject invention provides a process for preparing a batch of glatiramer acetate as acceptable for pharmaceutical use. | 02-26-2009 |
20090060927 | Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination - The present invention relates to pharmaceutical compositions comprising at least one fragment of a polynucleotide, preferably at least one antigen, and optionally a pharmaceutically acceptable carrier and/or diluent. In accordance with the present invention was found that the introduction of the pharmaceutical composition into vertebrates will achieve regulation of growth, induction of cellular transcription and translation, protein synthesis, protein expression or protein secretion. The pharmaceutical compositions are useful in vaccination protocols but also in any other therapeutic situation in which immunomodulation is of benefit, such as sub-optimal immune responses, reaction to pathogens, tolerance or autoimmunity. | 03-05-2009 |
20090060928 | Topical Toll Like Receptor Ligands as Vaccine Adjuvants - The present invention provides a method for increasing immunological response to a vaccine, comprising administering the vaccine subcutaneously to a patient in need thereof; anti administering a topical composition containing an amount of a toll like receptor ligand effective to increase immune response of the patient to the vaccine. | 03-05-2009 |
20090068207 | Compositions Containing Beta 2-Glycoprotein I-Derived Peptides for the Prevention and/or Treatment of Vascular Disease - Methods and compositions employing beta | 03-12-2009 |
20090068208 | LONG TERM DISEASE MODIFICATION USING IMMUNOSTIMULATORY OLIGONUCLEOTIDES - The invention provides methods for treating asthma by using multiple rounds of administration of ISS over a period of time to confer long term disease modification. | 03-12-2009 |
20090068209 | Cytotoxic Lymphocyte - The present invention relates to a T lymphocyte having an activity to induce a T lymphocyte recognizing an antigen and a technique to use the T lymphocyte. | 03-12-2009 |
20090068210 | IMMUNOTHERAPY FOR HEMATOLOGICAL MALIGNANCIES - Methods and compositions for treating, preventing and/or managing various hematological malignancies are disclosed. Specific methods and compositions relate to use of tumor cells engineered to express antigen presenting molecules which present antigens recognized by iNKT cells and eliciting antitumor immune response from iNKT cells using such tumor cells, optionally in combination with an immunomodulatory compound. | 03-12-2009 |
20090074796 | Pde5 inhibitor compositions and methods for immunotherapy - The invention features methods and compositions featuring a PDE5 inhibitor for treating or preventing immunological-mediated disease in a subject. | 03-19-2009 |
20090074797 | NOVEL GENE UPREGULATED IN CANCERS OF THE PROSTATE - The present invention relates to a novel protein designated 20P2H8 which shares homology with several heterogeneous nuclear ribonucleoproteins (hnRNPs). A full length approximately 3600 bp 20P2H8 cDNA (SEQ ID NO: 1, encoding a 517 amino acid open reading frame (SEQ ID NO: 2), is provided herein. | 03-19-2009 |
20090074798 | System and method for the production of recombinant glycosylated proteins in a prokaryotic host - A system and a method for the production of recombinant N-glycosylated target proteins. The system comprises a prokaryotic organism (e.g. | 03-19-2009 |
20090081243 | Agents and methods for diagnosing stress - The present invention discloses molecules and assays for qualitatively or quantitatively determining the effect of stress on the immune system, the susceptibility to developing disease or illness through immune system dysfunction as a result of stress, and for monitoring the ability of an animal to cope with stress. The invention is useful inter alia in measuring response to immunomodulatory therapies, and monitoring the immune response to natural disease under stressful conditions. | 03-26-2009 |
20090081244 | Dry Formulation for Transcutaneous Immunization - A transcutaneous immunization system delivers antigen to immune cells through the skin, and induces an immune response in an animal or human. For example, skin-active adjuvant (e.g., an ADP-ribosylating exotoxin) can be used to induce an antigen-specific immune response (e.g., humoral and/or cellular effectors) after transcutaneous application of a dry formulation containing antigen and adjuvant to skin of the animal or human. The dry formulation may be a powder or a unit-dose patch. Use of adjuvant is not required if the antigen is sufficiently antigenic. Transcutaneous immunization may be induced with or without penetration enhancement | 03-26-2009 |
20090081245 | ASSAYS FOR DEVELOPMENT OF BORIS MUTANTS SUITABLE FOR VACCINE DEVELOPMENT AND SMALL MOLECULE INHIBITORS OF WILD-TYPE BORIS - Disclosed are methods and compositions for developing mutants of the Brother of the Regulator of Imprinted Sites (BORIS) suitable for immunotherapeutic purposes. Said methods involve the mutagenesis and/or deletion of various sequences within wild-type BORIS protein with the objected aim of constructing nucleic acids and proteins encoded by said nucleic acids capable of eliciting immune responses while concurrently lacking oncogenicity. Methods of screening of small molecule inhibitors of wild-type BORIS activity are also provided. | 03-26-2009 |
20090087444 | PHARMACEUTICAL COMPOSITION COMPRISING POLYSACCHARIDES FROM ANGELICA GIGAS NAKAI FOR ACTIVATION OF DENDRITIC CELLS - The present invention relates to a pharmaceutical composition for activating dendritic cells having polysaccharides from | 04-02-2009 |
20090092623 | Promoter - The present invention provides a novel polynucleotide vectors and their use in the production of biological material in host cells, and also in medical therapy or polynucleotide vaccination. The novel vectors of the present invention comprise a promoter normally associated with the US3 gene of Human Cytomegalovirus (HCMV). | 04-09-2009 |
20090092624 | Antiinfective Flavononol Compounds and Methods of Use Thereof - The present invention relates in part to antiinfective flavononol compounds represented by formula I: | 04-09-2009 |
20090092625 | PARATHYROID HORMONE RECEPTOR ACTIVATION AND HEMATOPOIETIC PROGENITOR CELL EXPANSION - The invention relates to methods for manipulating hematopoietic progenitor cells and related products In one aspect the invention relates to the use of agents that activate a PTH/PTHrP receptor to enhance the growth and maintenance of hematopoietic progenitor cells in vivo and in vitro, to enhance mobilization of hematopoietic stem cells, to improve the efficiency of targeting cells to the bone marrow, and/or to modulate hematopoietic progenitor cell function. | 04-09-2009 |
20090098149 | TRANSGENIC ALGAE FOR DELIVERING ANTIGENS TO AN ANIMAL - Delivery systems and methods are provided for delivering a biologically active protein to a host animal. The systems and methods provided include obtaining an algal cell transformed by an expression vector, the expression vector comprising a nucleotide sequence coding for the biologically active protein, operably linked to a promoter. In one illustrated embodiment, the biologically active protein is an antigenic epitope and upon administration to the animal the algal cell induces an immune response in the host animal. | 04-16-2009 |
20090104211 | Treatment of atherosclerosis - The invention relates to a method and a device for commissioning articles from a first number of pick-up sections ( | 04-23-2009 |
20090104212 | METHODS AND SYSTEMS FOR TREATING CELL PROLIFERATION DISORDERS USING TWO-PHOTON SIMULTANEOUS ABSORPTION - A method for treating a cell proliferation disorder in a subject, comprising:
| 04-23-2009 |
20090104213 | Vaccine for House Dust Mite Allergen Using Naked DNA - Vaccination with the DNA encoding T-cell epitopes to the house dust mite | 04-23-2009 |
20090110689 | IMMUNOSUPPRESSION COMPOUND AND TREATMENT METHOD - A method and compound for suppressing an immune response in a mammalian subject, for the treatment or prevention of an autoimmune condition or transplantation rejection are disclosed. The compound is an antisense oligonucleotide analog compound having a targeting sequence complementary to a preprocessed CTLA-4 mRNA region identified by SEQ ID NO: 22 in SEQ ID NO: 1, spanning the splice junction between intron 1 and exon 2 of the preprocessed mRNA of the subject. The compound is effective, when administered to a subject, to form within host cells, a heteroduplex structure (i) composed of the preprocessed CTLA-4 mRNA and the oligonucleotide compound, (ii) characterized by a Tm of dissociation of at least 45° C., and (iii) resulting in an increased ratio of processed mRNA encoding ligand-independent CTLA-4 to processed mRNA encoding full-length CTLA-4. | 04-30-2009 |
20090123486 | Vaccine Composition Comprising An Antigen And A Peptide Having Adjuvant Properties - The invention relates to a vaccine which comprises at least one antigen and a peptide comprising a sequence R | 05-14-2009 |
20090123487 | Precursors and enzymes associated with post translational modification of proteins implicated in isoform generation of PCNA - The current invention provides a method for detecting the presence of a genomic or proteomic precursor(s) within a sample, wherein the precursor(s) provide an indication of the presence or the capability of expression modulation of various other proteins which may, either directly or indirectly, provide an indication, promote, and/or be responsible for the post translational modification of the PCNA. | 05-14-2009 |
20090130126 | DNA EXPRESSION VECTORS - The invention relates to DNA vectors containing a transcription regulatory sequence derived from Human Cytomegalovirus major immediate early gene that includes exon 1, but not intron A. Vectors, host cells, pharmaceutical and vaccine compositions comprising such host cells and vectors are contemplated. | 05-21-2009 |
20090130127 | Adjuvant or Pharmaceutical Preparation for Transdermal or Transmucousal Administration - An adjuvant for transdermal or transmucosal administration which comprises at least one substance selected from an aliphatic alcohol, a free fatty acid and a fatty acid derivative but does not contain a substance represented by the following formula: wherein R | 05-21-2009 |
20090130128 | Antiinfective Proanthocyanidin Compounds and Methods of Use Thereof - One aspect of the invention relates to novel proanthocyandin compounds that are useful as antiinfective agents. In one embodiment, the invention relates to a pure and isolated compound of formula I or II: | 05-21-2009 |
20090148465 | MUTANTS OF THE P4 PROTEIN OF NONTYPABLE HAEMOPHILUS INFLUENZAE WITH REDUCED ENZYMATIC ACTIVITY - A P4 variant protein that has reduced enzymatic activity and that induces antibody to wild-type P4 protein and/or has good bactericidal activity against non-typable | 06-11-2009 |
20090155291 | METHOD OF INCREASING IMMUNOLOGICAL EFFECT - A method of increasing immunological effect in a patient by administering an effective amount of a primary cell derived biologic to the patient, inducing immune production, blocking immune destruction, and increasing immunological effect in the patient. Methods of treating an immune target, treating a tumor, immune prophylaxis, and preventing tumor escape. | 06-18-2009 |
20090162383 | Method for designing vaccines against constantly mutating pathogens - A unique method is disclosed for identifying and replacing surface amino acid residues of a protein antigen that reduces the antigenicity of the putative immunodominant epitopes of the antigen and makes all the accessible regions of the molecule essentially antigenically equivalent, so that the antibody response will be directed against more parts of the molecule and not mainly against the erstwhile immunodominant epitopes. The method will simultaneously change the antigenicity of the molecule and preserve its structure. The method is useful in the design of molecules useful for immunization, for example, as vaccines, or for the generation of therapeutic antibodies, against constantly mutating pathogens. It is also useful in the design of molecules useful for immunization against pathogens that had been intentionally mutated so as to render those pathogens able to infect erstwhile immune individuals. | 06-25-2009 |
20090162384 | Consensus/ancestral immunogens - The present invention relates, in general, to an immunogen and, in particular, to an immunogen for inducing antibodies that neutralize a wide spectrum of HIV primary isolates and/or to an immunogen that induces a T cell immune response. The invention also relates to a method of inducing anti-HIV antibodies, and/or to a method of inducing a T cell immune response, using such an immunogen. The invention further relates to nucleic acid sequences encoding the present immunogens. | 06-25-2009 |
20090162385 | Compositions for and methods of enhancing the immune response to antigens - Compositions comprising the compound of formula are provided herein. Also provided are methods of enhancing an immune response of a subject to an antigen by administering the antigen and the composition. The enhanced immune response may be an humoral immune response, a CD4+ T cell response, a CD8+ T cell response or result in activation of antigen presenting cells. Methods of enhancing the immune response by intramuscular administration of an antigen and the composition including the compound of formula I are also provided. | 06-25-2009 |
20090162386 | CHONDROCYTE THERAPEUTIC DELIVERY SYSTEM - Systems and methods for modifying the environment of target cell using genetically altered chondrocytes are provided. The genetically engineered chondrocytes can be used to express a therapeutic agent in a subject, including in an environment typically associated with chondrocytes and in an environment not typically associated with chondrocytes. | 06-25-2009 |
20090162387 | PREVENTIVE AND THERAPEUTIC VACCINE FOR ALZHEIMER'S DISEASE - A method for producing therapeutic vaccine which consist of NMDA-NRI subunit expressed in insect cells to produce recombinant protein which was encapsulated in PLGA or poly(lactide-co-glycolic acid) micro particles by solvent exchange and used for oral immunization. Excitotoxicity (i.e., a process in which an excessive amount of extracellular glutamate overexcites glutamate receptors and harms neurons) is the common cause involved in a number of neurodegenerative disorders such as Alzheimer, Parkinson Huntington, Amyloid lateral sclerosis (ALS) and neurological conditions such as stroke, traumatic brain injury, Epilepsy. Thus the experimental model for stroke has been developed for the study of powerful N-methyl-d-aspartic acid (NMDA) NRI subunits, their protective and therapeutic potential for treatment of the neurodegenerative disorder Alzheimer's in animals and its practicability for therapy in humans. | 06-25-2009 |
20090169571 | SELECTED MA MOTIFS TO INCLUDE CELL DEATH AND/OR APOPTOSIS - The present application is directed to the use of dsRNA and/or ssRNA for the purpose of inducing apoptosis or cell death in proliferating cells. Specifically, low molecular weight and high molecular weight dsRNA and ssRNA are shown to induce apoptosis and/or cell death in proliferating cells, to arrest proliferation of transformed cells or tumor cells and to cause rapid induction of the cytokine TNF-alpha and/or also induce production of IL-12 which directs a Th-1 response. | 07-02-2009 |
20090169572 | METHODS FOR DAMAGING CELLS USING EFFECTOR FUNCTIONS OF ANTI-CDH3 ANTIBODIES - The present invention relates to the use of cytotoxicity based on the effector function of anti-CDH3 antibodies. Specifically, the present invention provides methods and pharmaceutical compositions that comprise an anti-CDH3 antibody as an active ingredient for damaging CDH3-expressing cells using antibody effector function. Since CDH3 is strongly expressed in pancreatic, lung, colon, prostate, breast, gastric or liver cancer cells, the present invention is useful in pancreatic, lung, colon, prostate, breast, gastric or liver cancer therapies. | 07-02-2009 |
20090175889 | HIV VACCINE - The invention provides a polynucleotide encoding an envelope protein comprising gp120 of human immunodeficiency virus-1 (HIV-1) having a mutation at amino acid residues 197-199 whereby a single N-linked glycan is removed. In a typical embodiment, the mutation replaces the asparagine (N) at residue 197 with another amino acid, such as glutamine (Q), creating an N197Q mutation. Because the N197 glycan is highly conserved among HIV-1 subtypes, this approach is applicable across HIV-1 isolates. The invention provides polypeptides, polynucleotides encoding the polypeptides, vectors, and recombinant viruses containing the polynucleotides, antigen-presenting cells (APCs) presenting the polypeptides, immune cells directed against HIV, and pharmaceutical compositions. The invention additionally provides methods, including methods for preventing and treating infection, for killing infected cells, for inhibiting viral replication, for enhancing secretion of antiviral and/or immunomodulatory lymphokines, and for enhancing production of neutralizing antibody. | 07-09-2009 |
20090175890 | USE OF IMMATURE DENDRITIC CELLS TO SILENCE ANTIGEN SPECIFIC CD8+ T CELL FUNCTION - This invention provides methods for silencing a pre-existing immune response in a mammal, as for example, in the setting of autoimmune diseases. The method comprises administering to a mammal immature dendritic cells which have been contacted in vitro with an antigen, or to target the antigen to immature dendritic cells in vivo, in order to silence and/or suppress a pre-existing CD8+ T cell immune response and induce IL-10 producing CD8+ T cells in said mammal. This invention further relates to methods for propagating immature dendritic cells, for maintaining immaturity by modification ex vivo, and uses thereof, including generation of regulatory T cells for passive immunotherapy. The present invention also relates to compositions and kits comprising immature dendritic cells and antigens. | 07-09-2009 |
20090175891 | Preventive And Therapeutic Vaccine For Huntington's Disease - A method for producing therapeutic vaccine which consist of NMDA-NRI subunit expressed in insect cells to produce recombinant protein which was encapsulated in PLGA or poly(lactide-co-glycolic acid) microparticles by solvent exchange and used for oral immunization. Excitotoxicity (i.e., a process in which an excessive amount of extracellular glutamate overexcites glutamate receptors and harms neurons) is the common cause involved in a number of neurodegenerative disorders such as Alzheimer's, Parkinson's, Huntington's, Amyloid lateral sclerosis (ALS) and neurological conditions such as stroke, traumatic brain injury, Epilepsy. Thus the experimental model for stroke has been developed for the study of powerful N-methyl-d-aspartic acid (NMDA) NRI subunits, their protective and therapeutic potential for treatment of the neurodegenerative disorder Huntington's in animals and its practicability for therapy in humans. | 07-09-2009 |
20090181043 | Method for Producing Human Anti-Thymocyte Immunoglobulins - Methods for producing improved anti-human thymocyte immunoglobulins from specific-pathogen-free animals are provided, without the need for an adsorption step on human tissues and the consequent drawbacks of such a step. | 07-16-2009 |
20090191226 | ADJUVANT FORMULATION COMPRISING A SUBMICRON OIL DROPLET EMULSION - An adjuvant composition, comprising a metabolizable oil and an emulsifying agent, wherein the oil and the detergent are present in the form of an oil-in-water emulsion having oil droplets substantially all of which are less than 1 micron in diameter. In preferred embodiments, the emulsifying agent is also an immunostimulating agent, such as a lipophilic muramyl peptide. Alternatively, an immunostimulating agent separate from the emulsifying agent can be used. | 07-30-2009 |
20090191227 | Compositions and Methods for Enhancing Immune Responses to Vaccines - The disclosure provides adjuvants, immunogenic compositions, and methods useful for vaccination and immune response. In particular, the disclosure provides a class of adjuvants comprising cationic lipid:co-lipid mixtures and methods for delivering formulated compositions. | 07-30-2009 |
20090191228 | Immunogenic compositions capable of activating T-cells - Provided is means and methods for producing and/or selecting immunogenic compositions capable of activating a T-cell and/or a T-cell response, comprising providing the composition with at least one cross-beta structure and testing at least one immunogenic property. | 07-30-2009 |
20090191229 | ADJUVANCY AND IMMUNE POTENTIATING PROPERTIES OF NATURAL PRODUCTS OF ONCHOCERCA VOLVULUS - The present disclosure relates to a method for inducing an antigen-specific immune response to an antigen in a mammal in need thereof, or potentiating an immune response, by administering to the mammal an effective amount of an isolated Ov-ASP, or at least one subunit of Ov-ASP. | 07-30-2009 |
20090196881 | DNA vaccine against north american spring viremia of carp virus - In this application is described a novel DNA vaccine for Spring viremia of carp virus. The candidate vaccine a SVCV glycoprotein (G) gene from the North Carolina isolate. The DNA vaccine provides protection in vaccinated fish against challenge with the SVCV. | 08-06-2009 |
20090202574 | METHODS OF IMMUNE OR HAEMATOLOGICAL ENHANCEMENT, INHIBITING TUMOUR FORMATION OR GROWTH, AND TREATING OR PREVENTING CANCER - The present invention relates to administration of metal ion-saturated lactoferrin, preferably bovine lactoferrin, preferably iron-saturated bovine lactoferrin, or a metal ion-saturated functional variant or fragment thereof to inhibit tumour formation or growth, maintain or improve one or both of the white blood cell count and red blood cell count, stimulate the immune system and treat or prevent cancer. The methods and medicinal uses of the invention may be carried out by employing dietary (as foods or food supplements), nutraceutical or pharmaceutical compositions. Compositions useful in the methods of the invention are also provided. | 08-13-2009 |
20090202575 | IMMUNOSTIMULATORY NUCLEIC ACID MOLECULES - Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed. | 08-13-2009 |
20090208515 | VACCINE COMPOSITION - The present invention relates to virus vectors comprising oligonucleotides encoding HIV polypeptides, more particularly wherein the virus vector is an adenovirus. In particular, such adenoviruses are non-human primate adenoviruses such as simian adenoviruses, more particularly chimpanzee adenoviruses. In particular the invention relates to adenovirus vectors which comprise HIV polynucleotide sequences which encode multiple different HIV antigens, for example two or three or more HIV antigens. The invention further relates to methods of preparing the virus vectors, to the virus vectors produced by the methods and to the use of the vectors in medicine especially prophylactic or therapeutic vaccination. | 08-20-2009 |
20090208516 | PROMOTER FOR INTRODUCING A GENE INTO A LYMPHOCYTE OR BLOOD CELL AND APPLICATION THEREOF - It is intended to provide a promoter for inducing expression selectively and strongly in an immunocompetent cell and/or a blood cell such as a lymphocyte. In the invention, the object was achieved by finding that HHV6 MIE promoter, HHV7 MIE promoter and HHV7 U95 promoter unexpectedly induce a specific expression in an immunocompetent cell and/or a blood cell such as a T lymphocyte. By utilizing the promoters, a selective delivery of a DNA vaccine or the like can be realized. | 08-20-2009 |
20090208517 | Preparation Of Antigen-Presenting Human Gamma-Delta T Cells And Use In Immunotherapy - The invention relates to a method for the preparation of efficient antigen-presenting human γδ T cells, to the γδ T cells prepared by such a method, and to their use in immunotherapy, vaccination, vaccine development and diagnostics. Similar to dendritic cells (DCs) in potency and efficacy, these human γδ T cells process antigens and present antigenic peptides to αβ T cells and induce antigen-specific responses (proliferation and differentiation) in naïve αβ T cells. γδ T cells are easily purified from peripheral blood, acquire “maturation” status (expression of essential adhesion, co-stimulatory and major histocompatibility complex molecules) within 1 day of in vitro culture under stimulation and induce strong primary and secondary T helper cell responses. The γδ T cells may be used in a method of treatment of tumors or chronic or recurrent infectious diseases, in identification of novel tumor or pathogen-derived antigens, and in the diagnosis of the immune competence of a patient. | 08-20-2009 |
20090214577 | Plasmids coding for p185neu protein sequence variants and therapeutic uses thereof - DNA plasmids containing sequences coding for different fragments of 185 | 08-27-2009 |
20090214578 | Immunostimulatory Single-Stranded Ribonucleic Acid with Phosphodiester Backbone - Immunostimulatory single-stranded oligoribonucleotides (ssORN) with phosphodiester backbones induce TLR7-independent and MyD88-dependent immune activation. These immunostimulatory ssORN are useful to induce a ThI-like immune response in a subject, to induce an antigen-specific immune response in a subject, and to treat a subject having a cancer, an infectious disease, an allergic condition, or asthma. | 08-27-2009 |
20090214579 | PROMOTER FOR INTRODUCING A GENE INTO A LYMPHOCYTE OR BLOOD CELL AND APPLICATION THEREOF - It is intended to provide a promoter for inducing expression selectively and strongly in an immunocompetent cell and/or a blood cell such as a lymphocyte. In the invention, the object was achieved by finding that HHV6 MIE promoter, HHV7 MIE promoter and HHV7 U95 promoter unexpectedly induce a specific expression in an immunocompetent cell and/or a blood cell such as a T lymphocyte. By utilizing the promoters, a selective delivery of a DNA vaccine or the like can be realized. | 08-27-2009 |
20090220530 | DEFECTIVE RIBOSOMAL PRODUCTS IN BLEBS (DRIBBLES) AND METHODS OF USE TO STIMULATE AN IMMUNE RESPONSE - Methods are disclosed for producing defective ribosomal products (DRiPs) in blebs (DRibbles) by contacting cells with a proteasome inhibitor, and in some examples also an autophagy inducer, thereby producing treated cells. DRibbles can be used to load antigen presenting cells (APCs), thereby allowing the APCs to present the DRiPs and antigenic fragments thereof. Immunogenic compositions that include treated cells, isolated DRibbles, or DRibble-loaded APCs are also disclosed. Methods are also provided for using treated cells, isolated DRibbles, or DRibble-loaded APCs to stimulate an immune response, for example in a subject. For example, DRibbles obtained from a tumor cell can be used to stimulate an immune response against the same type of tumor cells in the subject. In another example, DRibbles obtained from a pathogen-infected cell or cell engineered to express one or more antigens of a pathogen can be used to stimulate an immune response against the pathogen in the subject. | 09-03-2009 |
20090220531 | Composition of which Chief Ingredient is Polysaccharides Having an Immunoregulatory Function - An object is to establish a method of preparation of novel polysaccharides from a cassis polysaccharide (CAPS), wherein the novel polysaccharides exhibit a higher immunoregulatory effect per unit amount, have a low viscosity, and can be handled readily during the method of preparation a final product. Another object is to provide health foods and drinks having high safety and an excellent immunoregulatory effect at a low cost by utilizing a juice, processed juice or a purified product. The present invention relates to a composition of which chief ingredient is novel polysaccharides, having an average molecular weight falling within a range of 10,000 to 40,000; which is obtained by partially digestion of CAPS with enzyme, and an immunoregulatory foods and drinks utilizing the composition. | 09-03-2009 |
20090226469 | Shiga Toxoid Chimeric Proteins - A chimeric Shiga toxoid according to the invention contains an enzymatically-inactivated StxA subunit and a native StxB subunit. This hybrid Shiga toxoid induces the production of broadly cross-reactive species of antibodies against Shiga toxin following immunization. The StxA subunit is modified so that it is enzymatically inactive. The invention thus encompasses the Shiga toxoid or fragments thereof and the nucleic acid sequence of the Shiga toxoid or fragments thereof. The invention further encompasses the production of a Shiga toxoid, the production of antibodies using the Shiga toxoid and methods of productions, and an immunogenic composition containing the Shiga toxoid. | 09-10-2009 |
20090232834 | Methods and Agents to Treat Autoimmune Diseases - A therapeutic method for preventing, suppressing, or treating an autoimmune disease is described. This method involves administering to a patient suffering from an autoimmune disease an effective amount of a composition containing an allogeneic or autologous leucocyte cell population derived from a healthy donor. The composition is administered by subcutaneous injection and induces an immunological response in recipient patients sufficient to reduce incidence, prevalence, frequency, or severity of the autoimmune disease. | 09-17-2009 |
20090232835 | Composition for delivery of hematopoietic growth factor - A hematopoietic growth factor delivery composition includes a hematopoietic growth factor, a liquid vehicle, a first biocompatible polymer and a second biocompatible polymer. The composition exhibits reverse-thermal viscosity behavior, due to interaction between the first biocompatible polymer and the liquid vehicle. The second biocompatible polymer helps to protect the first biocompatible polymer from being dissolved in vivo following administration to a host. | 09-17-2009 |
20090232836 | Vaccine Compositions for Inducing Immune Responses Against Components of Drusen - Disclosed are compositions and methods for treating or preventing the formation of drusen in a patient in need thereof. The compositions include an effective amount of at least one polypeptide present in drusen, or an immunogenic fragment or variant thereof that induces an immune response against the polypeptide, together with a pharmaceutical carrier, excipient, or diluent. The compositions are suitable as vaccines for treating or preventing drusen and diseases associated with drusen. | 09-17-2009 |
20090238839 | Somatic Transgene Immunization and Related Methods - The invention provides a method for stimulating an immune response by administering to a lymphoid tissue a nucleic acid molecule comprising an expression element operationally linked to a nucleic acid sequence encoding one or more heterologous epitopes. The heterologous epitope can be inserted into a complementarity-determining region of an immunoglobulin molecule. The invention also provides a nucleic acid molecule comprising a hematopoietic expression element operationally linked to a nucleic acid sequence encoding a heterologous polypeptide. The invention additionally provides a method of treating a condition by administering a nucleic acid molecule comprising a hematopoietic cell expression element operationally linked to a nucleic acid sequence encoding a heterologous polypeptide, wherein the nucleic acid molecule is targeted to a hematopoietic cell. | 09-24-2009 |
20090246212 | DEVELOPMENT OF METHOD FOR SCREENING FOR DRUG CAPABLE OF IMPROVING PRODUCTION OF REGULATORY T CELLS AND METHOD FOR PRODUCING REGULATORY T CELLS USING IMMUNOSUPPRESSIVE MACROLIDE ANTIBIOTIC - The present invention provides a screening method for a compound capable of inducing regulatory T cells, comprising the following steps: | 10-01-2009 |
20090246213 | VACCINE COMPRISING A POLYNUCLEOTIDE ENCODING AN ANTIGEN RECOGNIZED BY A CD4+ HELPER T-CELL AND A POLYNUCLEOTIDE ENCODING A TUMOR SPECIFIC OR ASSOCIATED ANTIGEN RECOGNIZED BY A CD8+ CTL - The present invention relates to a DNA vaccine for developing tumor-specific immunity. Specifically, the invention relates to a DNA vaccine comprising antigens recognized by CD4 | 10-01-2009 |
20090246214 | FUSION PROTEINS CONTAINING RECOMBINANT CYTOTOXIC RNASES - Recombinant immunotoxins containing a cytotoxic RNAse fused to an antibody or antibody fragment may be produced in mammalian cell culture. Surprisingly, immunotoxins containing a cytotoxic RNAse fused to the N-terminus of one antibody variable domain can be prepared and retain the ability to specifically bind antigen. The immunotoxins may be used in a variety of therapeutic methods for treating diseases or syndromes associated with unwanted or inappropriate cell proliferation or activation. | 10-01-2009 |
20090252751 | Immune adjuvant comprising ubiquinone - This invention relates to an immunoadjuvant, which has an excellent antibody production enhancing function and is highly safe, and a vaccine composition comprising the immunoadjuvant. More specifically, the present invention relates to an immunoadjuvant comprising a ubiquinone represented by formula (I), and a vaccine composition comprising the ubiquinone represented by formula (I): | 10-08-2009 |
20090258030 | Materials and Methods for Improving Livestock Productivity - The subject invention provides methods for improving livestock health. In specific embodiments, the invention provides methods for accelerating and/or augmenting livestock growth; improving immunity; and enhancing fertility in livestock. To do so, the present invention provides materials and methods for administering a cysteamine compound to livestock. | 10-15-2009 |
20090263405 | CpG OLIGONUCLEOTIDE PRODRUGS, COMPOSITIONS THEREOF AND ASSOCIATED THERAPEUTIC METHODS - The present invention provides a CpG oligonucleotide prodrug that includes a thermolabile substituent on at least one nucleotide thereof. The present invention also provides compositions that include a carrier and a therapeutically effective amount of at least one CpG oligonucleotide prodrug. The present invention further provides therapeutic methods of using such thermolabile CpG oligonucleotide prodrugs and compositions thereof. The present invention further provides a method of inhibiting tetrad formation in a CpG oligonucleotide by functionalizing the CpG oligonucleotide with one or more thermolabile substituents. | 10-22-2009 |
20090263406 | JY-1 Regulation Of Granulosa Cell Function And Early Embryonic Development In Cattle - The present invention provides compositions and methods for regulating fertility in mammals. In general, the invention relates to a novel protein produced by oocytes named JY-1, and nucleic acids encoding the JY-1 protein, for controlling folliculogenesis and early embryonic development, particularly in monoovulatory species. In particular, the present invention provides nucleic acid and amino acid sequences encoding JY-1, vectors for the expression of JY-1, host cells expressing JY-1, RNAi probes for reducing levels of JY-1 message, and antibodies to JY-1. Specifically, developing and mature oocytes express JY-1 in vivo, while granulosa cells treated in vitro with recombinant JY-1 (rJY-1) protein reduced cell proliferation while increasing progesterone synthesis and estradiol production. Further, reducing JY-1 protein in developing embryos in vitro using inhibitory siRNA constructs corresponded with arrested blastocyte maturation. | 10-22-2009 |
20090263407 | Cationic Lipids and Uses Thereof - Cationic lipids, cationic lipid based drug delivery systems, ways to make them and methods of treating diseases using them are disclosed. | 10-22-2009 |
20090263408 | FORMULATION AND PRESENTATION OF MEDICAMENTS - A medicament package ( | 10-22-2009 |
20090280135 | Recombinant MHC molecules useful for manipulation of antigen-specific T-cells - Two-domain MHC polypeptides are useful for modulating activities of antigen-specific T-cells, including for modulating pathogenic potential and effects of antigen-specific T-cells. Exemplary MHC class II-based recombinant T-cell ligands (RTLs) of the invention include covalently linked β1 and α1 domains, and MHC class I-based molecules that comprise covalently linked α1 and α2 domains. These polypeptides may also include covalently linked antigenic determinants, toxic moieties, and/or detectable labels. The disclosed polypeptides can be used to target antigen-specific T-cells, and are useful, among other things, to detect and purify antigen-specific T-cells, to induce or activate T-cells, to modulate T-cell activity, including by regulatory switching of T-cell cytokine and adhesion molecule expression, to treat conditions mediated by antigen-specific T-cells, to treat or prevent autoimmune or neurodegenerative diseases, to protect axons, and to prevent or reverse demyelination. | 11-12-2009 |
20090280136 | IMMUNIZATION OF FISH WITH PLANT-EXPRESSED RECOMBINANT PROTEINS - Plants are produced that express an amino acid sequence that, when administered to a fish, produce an antigenic or immune response in the fish. The amino acid sequence in one embodiment is an antigen from an organism that causes pathology in fish. The plant tissue may be fed to the fish, or mixed with other materials and fed to fish, or extracted and administered to the fish. | 11-12-2009 |
20090280137 | Methods, Compositions, and Sequences of ZP-Binding Peptides for Immunocontraception of Dogs and Other Animals - Disclosed are methods, compositions, and zona pellucida binding peptides and polypeptides for use in immunocontraception of canines and other animals. The disclosed compositions may include pharmaceutical compositions. | 11-12-2009 |
20090285842 | IMMUNE PRIVILEGED AND MODULATORY PROGENITOR CELLS - Described herein is a method for modulating an immune reaction between lymphocytes and a body recognized by the lymphocytes as foreign. The method exploits the immunomodulating activity of a new class of progenitor cells termed HUCPVCs derived from the perivascular region of human umbilical cord. The method can also employ soluble factors exuded by cultured HUCPVCs. The method is useful to treat immune disorders including graft versus host disease, autoimmune disorders, and the like. | 11-19-2009 |
20090291094 | ANTIBODIES AND PROCESSES FOR PREPARING THE SAME - Provided herein are various processes for the improved production of antibody producing organisms, antibody producing tissues, antibody producing cells and antibodies. In certain embodiments, provided herein are methods for rapidly producing antibody producing organisms, tissues, cells and antibodies derived from humans, organisms, plants or cells that are genetically altered to over-express certain proteins. | 11-26-2009 |
20090291095 | NANOEMULSION ADJUVANTS - The present invention provides methods and compositions for the stimulation of immune responses. In particular, the present invention provides nanoemulsion compositions and methods of using the same for the induction of immune responses (e.g., innate and adaptive immune responses (e.g., for generation of host immunity against an environmental pathogen)). Compositions and methods of the present invention find use in, among other things, clinical (e.g. therapeutic and preventative medicine (e.g., vaccination)) and research applications. | 11-26-2009 |
20090291096 | Methods and Apparatus for Selectively Processing Eggs Having Identified Characteristics - Methods and apparatus for processing eggs based upon a characteristic such as gender are provided. Material is extracted from each of a plurality of live eggs, the extracted material is assayed to identify eggs having the characteristic, and then eggs identified as having the characteristic are processed accordingly. | 11-26-2009 |
20090297539 | PROCESS FOR PRODUCTION OF REGULATORY T CELL - The present invention provides a method of producing a regulatory T cell, which includes culturing a peripheral CD25 | 12-03-2009 |
20090297540 | Induction of Indoleamine 2,3-Dioxygenase in Dendritic Cells by TLR Ligands and Uses thereof - The induction of indoleamine 2,3-dioxygenase (IDO) in an IDO-competent subset of dendritic cells by TLR ligands, including TLR9 ligands, and various uses thereof are presented. | 12-03-2009 |
20090297541 | MATURATION OF DENDRITIC CELLS - The invention relates to immunotherapy using dendritic cells (DCs). More specifically, it relates to methods for the maturation of DCs, a mature DC population and clinical uses thereof. Provided is a method for the ex vivo maturation of DCs, comprising providing immature DCs and contacting the immature DCs with an effective concentration of a non-toxic TLR4 agonist, such as Monophosphoryl lipid A (MPLA) or Diphosphoryl lipid A (DPLA), and an interferon gamma (IFNg) receptor agonist, under culture conditions suitable for maturation of the immature DCs to form a mature DC population. Also provided is an isolated population of mature DCs, preferably human mature DCs, and the use thereof in immunotherapy. | 12-03-2009 |
20090304722 | CHLAMYDIA TRACHOMATIS ANTIGENS FOR VACCINE AND DIAGNOSTIC USE - The present invention is related to antigens from | 12-10-2009 |
20090304723 | Mono-and disaccharide derivatives - The present invention relates to a novel family of monosaccharide derivatives and disaccharide derivatives and to a method of preparation thereof. A mono- and disaccharide derivatives according to the invention comprises at least one fatty acid ester and may further comprise one or more anionic groups and are useful for, inter alia, medical, pharmaceutical, cosmetic and food applications. | 12-10-2009 |
20090311276 | NANOLIPOPROTEIN PARTICLES AND RELATED COMPOSITIONS, METHODS AND SYSTEMS - Functionalized nanolipoprotein particle presenting an anchor substrate compound for binding with a corresponding anchor compound presented on a target molecule, and related compositions methods and systems. | 12-17-2009 |
20090311277 | NUCLEIC ACID COMPOSITIONS FOR STIMULATING IMMUNE RESPONSES - The invention provides an immunostimulatory nucleic acid comprising CpG motifs, and methods of use thereof in stimulating immunity. | 12-17-2009 |
20090317409 | Antibodies for ubiquitinated proteins - The invention relates to particular ubiquitination epitopes, antibodies that specifically recognize and bind to ubiquitinated proteins and peptides (particularly after the ubiquitin is removed by proteolytic cleavage) and to methods of using these epitopes and antibodies. | 12-24-2009 |
20090317410 | USE OF ZWITTERIONIC POLYSACCHARIDES FOR THE SPECIFIC MODULATION OF IMMUNE PROCESSES - The invention relates to three-dimensional molecular structure determination of polymers, three-dimensional computer molecular modeling, rational drug design, and immunomodulatory polymers. In particular the invention is directed to immunomodulatory polymers, as well as to methods for designing, selecting, and screening therapeutic agents having immunomodulatory activity. | 12-24-2009 |
20090317411 | COMPOSITIONS FOR INDUCING IMMUNE RESPONSES SPECIFIC TO GLOBO H AND SSEA3 AND USES THEREOF IN CANCER TREATMENT - An immune composition containing Globo H or its fragment (e.g., SSEA3) and an adjuvant, e.g., α-GalCer, for eliciting immune responses against Globo H or its fragment and uses thereof in cancer treatment. Also disclosed is a method of treating cancer by inhibiting the activity of one of FUT1 and FUT2, both of which involve in Globo H biosynthesis. | 12-24-2009 |
20090324623 | Two-component genome flavivirus and uses thereof - The present invention discloses a two-component genome flavivirus and a method for propagating such virus. Since the genetic material of this flavivirus is distributed between two genomes, the flavivirus is deficient in replication, incapable of causing disease but capable of inducing an immune response. Nevertheless, the design of the replication deficient flavivirus discussed herein allows propagation of these flaviviruses at industrial level. | 12-31-2009 |
20090324624 | Chitin micro-particles as an adjuvant - A composition and method for the preparation of micro-particles of chitin (a naturally occurring polymer of N-acetyl-D-glucosamine), the characterization of chitin micro-particles as an immune adjuvant and the use of chitin micro-particles to enhance protective immunity against intracellular infectious agents and diseases as well as to inhibit allergic responses and diseases. | 12-31-2009 |
20090324625 | Heterocyclic Aromatic Compounds Useful As Growth Hormone Secretagogues - Novel heterocyclic aromatic compounds are provided that are useful in stimulating endogenous production or release of growth hormone, said compounds having the general structure of formula I | 12-31-2009 |
20090324626 | ISOLATED SNARE YKT6 GENOMIC POLYNUCLEOTIDE FRAGMENTS FROM CHOMOSOME 7 AND THEIR USES - The invention is directed to isolated genomic polynucleotide fragments that encode human SNARE YKT6, human glucokinase, human adipocyte enhancer binding protein (AEBP1) and DNA directed 50kD regulatory subunit (POLD2), vectors and hosts containing these fragments and fragments hybridizing to noncoding regions as well as antisense oligonucleotides to these fragments. The invention is further directed to methods of using these fragments to obtain SNARE YKT6, human glucokinase, AEBP1 protein and POLD2 and to diagnose, treat, prevent and/or ameliorate a pathological disorder. | 12-31-2009 |
20090324627 | ISOLATED DNA DIRECTED 50kD REGULATORY SUBUNIT (POLD2) GENOMIC POLYNUCLEOTIDE FRAGMENTS FROM CHOMOSOME 7 AND THEIR USES - The invention is directed to isolated genomic polynucleotide fragments that encode human SNARE YKT6, human glucokinase, human adipocyte enhancer binding protein (AEBP1) and DNA directed 50 kD regulatory subunit (POLD2), vectors and hosts containing these fragments and fragments hybridizing to noncoding regions as well as antisense oligonucleotides to these fragments. The invention is further directed to methods of using these fragments to obtain SNARE YKT6, human glucokinase, AEBP1 protein and POLD2 and to diagnose, treat, prevent and/or ameliorate a pathological disorder. | 12-31-2009 |
20100003268 | Therapy of Malignant Neoplasias - The present invention provides a 3-iodo-L-phenylalanine or 4-iodo-L-phenylalanine for the preparation of a pharmaceutical composition for the treatment of malignant neoplasia. Moreover, the invention provides a method for the treatment of malignant neoplasia, the method comprising the steps of administering 3-iodo-L-phenylalanine or 4-iodo-L-phenylalanine to a subject in need thereof and a pharmaceutical composition comprising 3-iodo-L-phenylalanine or 4-iodo-L-phenylalanine. | 01-07-2010 |
20100003269 | METHODS AND USES OF CAULIFLOWER AND COLLARD FOR RECOMBINANT PROTEIN PRODUCTION - The present invention relates to a method for the generation of transgenic | 01-07-2010 |
20100003270 | WHOLE BLOOD CULTURES COMPRISING STIMULATED IMMUNE CELLS, AND USE THEREOF AS MEDICAMENTS - The present invention relates to a whole-blood culture containing specific immunocompetent killer cells that are activated against tumor cells, viruses, bacteria and/or allergens, whereby the whole-blood culture consists of whole-blood and a culture medium at a ratio of 3:1 to 4:1, whereby the culture medium has an oxygen excess of at least 100% or more and contains a water-soluble emulsification product comprising a mixture of phospholipids, vitamin E, and low-molecular proteoglycans with a molecular weight of 1,200 to 12,000 Dalton, and whereby dead tumor cells or fragments thereof and/or viral and/or bacterial antigens and/or allergens have been added to the whole-blood culture [to serve] as antigen in the specific recognition process for production of the activated killer cells (stimulation). The invention also relates to a method for producing the culture, as well as stimulants for the whole-blood culture and a method for the selection thereof. | 01-07-2010 |
20100003271 | NITRIC OXIDE INCREASES SWITCHING OF T CELLS INTO T REGULATORY CELLS - An ex vivo method of expanding a population of regulatory T-cells includes culturing a starting population of cells containing CD4 | 01-07-2010 |
20100003272 | Method for Expanding Monocytes - The invention relates to an ex vivo method for expanding monocytes, macrophages or dendritic cells, which method comprises inhibiting the expression or the activity of MafB and c-Maf in monocytes, macrophages or dendritic cells; and expanding the cells in the presence of at least one cytokine or an agonist of cytokine receptor signaling. | 01-07-2010 |
20100008939 | UNPROCESSED ROLLING CIRCLE AMPLIFICATION PRODUCT - Methods and compositions using unprocessed (i.e., not deliberately or intentionally cleaved, circularized, or supercoiled) rolling circle amplification (RCA) product. | 01-14-2010 |
20100015167 | COMPOSITIONS AND METHODS FOR IDENTIFYING AND TARGETING CANCER CELLS OF ALIMENTARY CANAL ORIGIN - Screening and diagnostic reagents, kits and methods for metastatic colorectal cancer or primary and/or metastatic stomach or esophageal cancer are disclosed. Compounds, compositions and methods of treating patients with metastatic colorectal cancer or stomach or esophageal cancer and for imaging metastatic colorectal cancer or stomach or esophageal tumors in vivo are disclosed. Compositions and methods for delivering active compounds such as drugs, gene therapeutics and antisense compounds to metastatic colorectal cancer or stomach or esophageal cells are disclosed. Vaccines compositions and methods of for treating and preventing metastatic colorectal cancer or primary and/or metastatic stomach or esophageal cancer are disclosed. | 01-21-2010 |
20100021484 | Compositions, Methods and Kits Relating to Poxvirus Subunit Vaccines - The invention is directed to a poxvirus vaccine comprising a soluble truncated poxvirus envelope protein. The invention is also directed to a vaccine comprising a nucleic acid encoding such proteins. Also included is an antibody which specifically binds to the proteins and nucleic acid encoding the same, as well as methods of preventing and treating a poxvirus infection using the afore-mentioned vaccine, antibody, protein, and nucleic acid encoding them. | 01-28-2010 |
20100028371 | Preparation of recombinant rotavirus proteins in milk of transgenic non-human mammals - The present invention relates to a non-human transgenic mammal whose genome comprises: i) a first transgene comprising a mammary gland specific transcriptional control region operably linked to cDNA encoding a rotavirus protein selected from VP2, VP4, VP6 and VP7 and wherein said cDNA comprises a secretion signal sequence; ii) at least a second transgene comprising a mammary gland specific transcriptional control region operably linked to cDNA encoding another said rotavirus protein and wherein said cDNA comprises a secretion signal sequence; and wherein said rotavirus proteins are secreted separately and auto-assembled in milk in rotavirus like particles (VLP) or aggregates of said rotavirus proteins. | 02-04-2010 |
20100028372 | STABILIZATION OF AQUEOUS COMPOSITIONS OF PROTEINS WITH DISPLACEMENT BUFFERS - An aqueous composition having increased protein stability is obtained by: a. determining a pH at which the protein has stability at the desired temperature; b. adding to the composition at least one displacement buffer wherein the displacement buffer has a pKa that is at least 1 unit greater or less than the pH of step (a); and c. adjusting the pH of the composition to the pH of step (a); wherein the aqueous composition does not comprise a conventional buffer at a concentration greater than about 2 mM and wherein the conventional buffer has a pKa that is within 1 unit of the pH of step (a). | 02-04-2010 |
20100034838 | Transdermal Administration of Active Agents for Systemic Effect - The present invention relates to compositions for transdermal administration of a therapeutic agent for providing a systemic therapeutic effect. In particular, the invention relates to spreadable compositions, or compositions which may be solid at a temperature of about 25° C. or less and have a softening point of not higher than 35° C., wherein transdermal administration of the therapeutic agent may be either rapid or sustained. | 02-11-2010 |
20100034839 | METHODS FOR TREATING VIRAL DISORDERS - The invention relates to topical formulations of CLIP inhibitors as well as methods for modulating the immune function through targeting of CLIP molecules. The result is wide range of new therapeutic regimens for treating, inhibiting the development of, or otherwise dealing with viral infection, such as HIV infection, and AIDS. | 02-11-2010 |
20100040638 | SMOKING CESSATION KIT AND METHOD - Described are smoking cessation devices and kits for determining an advantageous time for a subject to quit smoking, and/or for extending the duration of smoking abstinence, based on serum levels of anti-nicotine antibodies. Related methods are also described. | 02-18-2010 |
20100040639 | METHODS OF INDUCING IL-10 PRODUCTION - The invention provides a method of inducing IL-10 production. | 02-18-2010 |
20100047260 | Methods and Compositions Relating To a Vaccine Against Prostate Cancer - An object of the invention is to provide methods and compositions relating to a vaccine against prostate cancer which includes a non-human-primate PSA for administration to humans to provide an immune response against human PSA. More generally, an object of the invention is to provide methods and compositions relating to using a non-human primate xenogeneic antigen (e.g. protein) in a human, wherein, with respect to the non-human primate xenogeneic antigen that is used, there are relatively few interspecies differences between the non-human primate xenogeneic antigen and the human self antigen in order to induce an optimal immune response in the human to its native self antigen. | 02-25-2010 |
20100047261 | BASE-MODIFIED RNA FOR INCREASING THE EXPRESSION OF A PROTEIN - The present application describes a base-modified RNA and the use thereof for increasing the expression of a protein and for the preparation of a pharmaceutical composition, especially a vaccine, for the treatment of tumours and cancer diseases, heart and circulatory diseases, infectious diseases, autoimmune diseases or monogenetic diseases, for example in gene therapy. The present invention further describes an in vitro transcription method, in vitro methods for increasing the expression of a protein using the base-modified RNA, and an in vivo method. | 02-25-2010 |
20100055116 | Methods and Compositions for Targeting c-Rel - The present invention relates to compositions and methods for targeting c-Rel. In particular, the present invention provides compositions and methods for treating cancers, inflammatory diseases, autoimmune diseases, and transplant rejection by inhibiting c-Rel activity and for regulating c-Rel for research and drug screening applications. | 03-04-2010 |
20100055117 | ALLORESTRICTED PEPTIDE-SPECIFIC T CELLS - The present invention is directed to a T cell receptor (TCR) recognizing antigenic peptides derived from tumor-associated antigen FMNL1/KW13 and being capable of inducing peptide specific killing of a target cell. The present invention is further directed to one antigenic peptides derived from tumor-associated antigen FMNL1/KW13, to an antigen specific T cell, comprising said TCR, to a nucleic acid coding for said TCR and to the use of the antigen specific T cells for the manufacture of a medicament for the treatment of malignancies characterized by overexpression of FMNL1/KW13. | 03-04-2010 |
20100062009 | NOVEL STROMAL CELL-DERIVED FACTOR-1 POLYPEPTIDES, POLYNUCLEOTIDES, MODULATORS THEREOF AND METHODS OF USE - Disclosed herein is a newly identified SDF-1 splice variant molecule, its polypeptide sequence, and the polynucleotides encoding the polypeptide sequence, and active fragments thereof. Also provided is a procedure for producing such polypeptides by recombinant techniques employing, for example, vectors and host cells. Also disclosed are methods for utilizing such polypeptides and modulators thereof for the treatment of diseases, including cancer, immune diseases, infectious diseases, and ischemic diseases. | 03-11-2010 |
20100062010 | NOVEL PEPTIDE COMPOUND - A novel compound of the formula (1): | 03-11-2010 |
20100068216 | Method and Compositions for Stimulation of an Immune Response to gp100 using a Xenogeneic gp100 Antigen - Tolerance of the immune system for endogenous gp100 can be overcome and an immune response stimulated by administration of xenogeneic or xenoexpressed gp100 antigen. For example, mouse gp100, or antigenically-effective portions thereof, can be used to stimulate an immune response to the corresponding differentiation antigen in a human subject. Administration of xenogeneic antigens in accordance with the invention results in an effective immunity against gp100 expressed by the cancer in the treated individual, thus providing a therapeutic approach to the treatment of cancers expressing gp100, such as melanoma. | 03-18-2010 |
20100074911 | VACCINE NEBULIZERS - The invention provides a method of selecting or optimising a nebuliser device to be used to deliver a vaccine comprising selecting a nebuliser capable of producing a plurality of vaccine particles having the following particle droplet size distribution:
| 03-25-2010 |
20100080816 | TOLEROGENIC POPULATIONS OF DENDRITIC CELLS - Tolerogenic populations of dendritic cells are provided, where the dendritic cells are characterized by expression of select tissue-specific homing receptors including the chemokine receptors CCR9; or CMKLR1; or the integrin CD103. The dendritic cells may be conventional/myeloid or plasmacytoid dendritic cells. The cells may be isolated from lymphoid tissue, from blood, or from in vitro culture, e.g. bone marrow culture, etc. Methods are provided for their identification, isolation and targeting in immunotherapeutic interventions in suppressing inflammatory disorders including autoimmunity, transplantation responses and allergic diseases. In some embodiments dendritic cell populations are fixed to render them immunosuppressive, thus allowing the cells to be typed and banked for future use. | 04-01-2010 |
20100086560 | CHEMOKINES AS ADJUVANTS OF IMMUNE RESPONSE - Dendritic cells play a critical role in antigen-specific immune responses. Materials and Methods are provided for treating disease states, including cancer, infectious diseases, autoimmune diseases, transplantation, and allergy by facilitating or inhibiting the migration or activation of a specific subset of antigen-presenting dendritic cells known as plasmacytoid dendritic cells (pDC). In particular, methods for treating disease states are provided comprising administration of chemokine receptor agonists and antagonists, alone or in combination with a disease-associated antigen, with or without an activating agent. | 04-08-2010 |
20100086561 | Th1 vaccination priming for active immunotherapy - The present invention includes vaccine compositions and methods for using these vaccine compositions in active immunotherapy. The vaccine compositions include allogeneic activated Th1 memory cells. The compositions can also include one or more disease-related antigens. The methods include administering the vaccine compositions to provide a Th1 footprint in normal individuals or patients susceptible to disease or having minimal residual disease. | 04-08-2010 |
20100092497 | METHODS OF IMMUNE OR HAEMATOLOGICAL ENHANCEMENT, INHIBITING TUMOUR FORMATION OR GROWTH, AND TREATING OR PREVENTING CANCER - Use of lactoferrin or metal ion lactoferrin, preferably iron lactoferrin, preferably bovine lactoferrin, preferably iron bovine lactoferrin, or a metal ion functional variant or functional fragment thereof and at least one anti-tumour food factor selected from soy protein and vitamin D inhibits tumour formation or growth, maintains or improves one or both of the white blood cell count and red blood cell count, stimulates the immune system, and/or treats or prevents cancer. Dietary (foods or food supplements), nutraceutical or pharmaceutical compositions may be used. | 04-15-2010 |
20100092498 | Anti-Tumour Vaccine Derived from Normal Chemically Modified Cells - A composition for inducing an immune response in a mammal, comprises lymphoid cells in which expression of tumor antigens has been chemically induced. The tumor antigens are induced in proliferating normal lymphoid cells, especially during the log phase of proliferation. The proliferation of the normal lymphoid cells is stimulated by normal mature dendritic cells. Most conveniently, the lymphoid cells are lymphocytes, especially peripheral blood lymphocytes. The tumor antigens are typically cancer/testis antigens, which may be chemically induced by DNA demethylation. Cancer/testis antigens are expressed in a wide range of tumors, so the composition is able to raise an immune response that is effective against a wide range of tumors, despite the fact that it is derived from normal cells. The composition may be used for preparation of an anti-tumor vaccine for prophylactic or therapeutic use. The composition may also be used for ex vivo activation of cytotoxic T lymphocytes, followed by expansion of the cytotoxic T lymphocyte population by normal dendritic cells, for cancer treatment by adoptive T cell immunotherapy. | 04-15-2010 |
20100104590 | ALPHA-GALACTOSYLCERAMIDE DERIVATIVES, PHARMACEUTICALLY ACCEPTABLE SALTS THEREOF, PREPARATION METHOD AND PHARMACEUTICAL COMPOSITION FOR THE IMMUNE ADJUVANT CONTAINING THE SAME AS AN ACTIVE INGREDIENT - Disclosed are novel α-galactosylceramide derivatives, pharmaceutically acceptable salts thereof, preparation methods thereof, and pharmaceutical compositions for use in an immune adjuvant containing the same as an active ingredient. The derivatives, in which the amide moiety of α-GalCer is bioisosterically replaced with a triazole moiety, direct cytokine secretion toward IL-4 rather than IFN-γ and thus can be used as a therapeutic for autoimmune diseases regulated by IL-4, such as type 1 diabetes and multiple sclerosis. | 04-29-2010 |
20100111980 | BINDING PARTNERS OF ANTIBODIES SPECIFIC FOR DENDRITIC CELL ANTIGENS - The present invention relates to the field of diagnostics, therapeutics and immunological reagents. More particularly, the present invention provides binding partners of antibodies specific for dendritic cell (DC) antigens. The present invention further provides diagnostic and/or therapeutic agent based on the binding partners or antibodies specific for the binding partners. | 05-06-2010 |
20100111981 | SYNTHETIC MONODISPERSE HEMOZOIN CRYSTALS PREPARATION AND USES THEREOF - A synthetic monodisperse hemozoin crystals preparation, compositions and methods of preparation thereof, are described. Also described are uses thereof, including use as an adjuvant, use in an immunogenic or vaccine composition, use for enhancing or inducing immunogenicity, and corresponding prevention or treatment of disease or infection. | 05-06-2010 |
20100111982 | RHEUMATOID ARTHRITIS T CELL VACCINE - Described herein is an activated synovial autoreactive T cell and compositions thereof. Methods or preparing T cell compositions that may be used for treating rheumatoid arthritis are also described. | 05-06-2010 |
20100111983 | Method for Using Lowstrength Electric Field Network (LSEN) and Immunosuppressive Strategies to Mediate Immune Responses - Application to an allograft or xenograft of a low strength electric field network (LSEN) together with an immuno-suppressive drug, gene and siRNA or other gene-based therapy is used to mediate the immune responses within an donor organ, tissue or cells, to prevent the acute and chronic rejection and to induce true tolerance, The gene(s) is locally transferred ex vivo in the time interval between harvest and implantation of allografts or xenografts before the implantation to introduce the long-term over expression of immunosuppressive and/or modulative molecules, or for down regulating alloreactive molecules in the donor organ, tissue or cells only and not in the recipient's whole body system. | 05-06-2010 |
20100111984 | NANOSPHERES ENCAPSULATING BIOACTIVE MATERIAL AND METHOD FOR FORMULATION OF NANOSPHERES - A method for forming microspheres containing bioactive material, comprising dissolving a polymer matrix, such as albumin or beta-cyclodextrin, in an aqueous medium in a first vessel; contacting the dissolved polymer matrix with a crosslinking agent, such as glutaraldehyde, to crosslink the polymer matrix and the crosslinking agent; neutralizing with sodium bisulfate any excess crosslinking agent remaining after crosslinking is substantially complete; solubilizing in a second vessel a bioactive material in an aqueous solution; mixing the solubilized bioactive material together with the neutralized crosslinked polymer matrix in solution to form a mixture; and, spray drying the mixture to produce nanospheres, whereby substantial bioactivity of the biomaterial is retained upon cellular uptake. | 05-06-2010 |
20100111985 | VACCINE COMPOSITIONS AND METHODS OF USE - Described are a method and a composition for delivery of a protein to an antigen presenting cell. The composition is composed of a polypeptide component, a buffering component and a particle to be phagocytized. In one embodiment, the antigen presenting cell is aa macrophage or a dendritic cell and the particle to be phagocytized is from a natural source, such as from a microbial source. The composition itself, or cells pretreated with the composition, are useful for strategies in vaccine development. | 05-06-2010 |
20100119530 | Regulation of TLR Signaling by Complement - This invention provides methods of inducing the production of pro-inflammatory cytokines by activating Toll like Receptor (TLR) and the complement system. This invention further provides vaccines that contain compounds that activate a Toll like Receptor (TLR) and the complement system. | 05-13-2010 |
20100119531 | NUTRICEUTICAL GELS - A nutriceutical food product includes a solid matrix and a liquid combined into a gel. The nutriceutical food product may include an immune modulator, such as transfer factor and/or a nanofraction immune modulator. A fruit component may be included in the nutriceutical food product. The fruit component may include at least one oligoproanthocyanidin-containing fruit, such as acai. | 05-13-2010 |
20100136034 | NOVEL MULTIMERIC MOLECULES, A PROCESS FOR PREPARING THE SAME AND THE USE THEREOF FOR MANUFACTURING MEDICINAL DRUGS - The invention relates to a compound of the formula (I): | 06-03-2010 |
20100136035 | METHOD FOR MODULATING ATHEROSCLEROSIS - Immunoreactivity to collagen V is associated with development of atherosclerosis. Methods disclosed herein for modulating atherosclerosis and reducing an effect thereof, involve inducing immunological tolerance to collagen V. Methods for evaluating a risk of an individual to develop atherosclerosis and methods for diagnosing atherosclerosis are disclosed herein. | 06-03-2010 |
20100143389 | IMMUNOMODULATING AGENT IN GUT - An object of the present invention is to provide an immunomodulating agent in gut that can be ingested continuously in daily diet without adverse side effect. The object is attained by providing an immunomodulating agent in gut comprising a cyclic tetrasaccharide as an effective ingredient. | 06-10-2010 |
20100143390 | POLYPEPTIDES FOR INDUCING A PROTECTIVE IMMUNE RESPONSE AGAINST STAPHYLOCOCCUS EPIDERMIDIS - The present invention features polypeptides comprising an amino acid sequence structurally related to SEQ ID NO: 1 and uses of such polypeptides. SEQ ID NO: 1 is a truncated derivative of a full-length | 06-10-2010 |
20100143391 | HAPTEN COMPOUNDS AND COMPOSITIONS AND USES THEREOF - The invention generally relates to hapten compounds comprising either (+)methamphetamine or (+)amphetamine conjugated to a linker. Generally speaking, hapten compounds of the invention may be used to elicit an immune response to one or more of (+)methamphetamine, (+)amphetamine, or (+)MDMA. | 06-10-2010 |
20100166780 | CpG Oligonucleotide Analogs Containing Hydrophobic T Analogs with Enhanced Immunostimulatory Activity - The invention relates to oligonucleotides including at least one lipophilic substituted nucleotide analog and a pyrimidine-purine dinucleotide. The invention also relates to pharmaceutical compositions and methods of use thereof. | 07-01-2010 |
20100166781 | HAT ACETYLATION PROMOTERS AND USES OF COMPOSITIONS THEREOF IN PROMOTING IMMUNOGENICITY - The invention provides processes and compositions for enhancing the immunogenicity of TAP-1 expression-deficient cells by increasing the presentation of MHC Class I surface molecules for detection by cytotoxic T-lymphocyte cells through increased TAP-1 expression, which comprises administering to the TAP-1 expression-deficient cells a TAP-1 expression increasing amount of a bio-acceptable substance that promotes transcription of TAP-1 gene in the cells to cause enhanced MHC Class I surface expression of the cells. The bio-acceptable substance may be a histone H3 deacetylase inhibitor, such as trichostatin A, a transcriptional co-activator having intrinsic histone acetyl transferase activity or a histone acetyl transferase comprising at least one member of the CBP/p300 protein family. The process and compositions increase the immunogenicity of the target cells to enhance their destruction by cytotoxic lymphocytes. | 07-01-2010 |
20100166782 | CLIP INHIBITORS AND METHODS OF MODULATING IMMUNE FUNCTION - The invention relates to methods for modulating the immune function through targeting of CLIP molecules. The result is wide range of new therapeutic regimens for treating, inhibiting the development of, or otherwise dealing with, a multitude of illnesses and conditions, including autoimmune disease, allergic disease transplant and cell graft rejection, cancer, bacterial infection, HIV infection, and AIDS. | 07-01-2010 |
20100166783 | METHOD - Gene expression profiles, microarrays comprising nucleic acid sequences representing gene expression profiles, and new diagnostic kits and methods are provided. The gene expression profiles, microarrays, and new diagnostic kits and methods find use in the treatment of specific populations of cancer patients suffering from MAGE expressing tumours, the populations characterised by their gene expression profile. | 07-01-2010 |
20100166784 | METHOD AND COMPOSITIONS FOR MODULATING TH17 CELL DEVELOPMENT - The invention encompasses methods and compositions for modulating Th17 development. | 07-01-2010 |
20100166785 | ADJUVANTS - Disclosed are lipopeptides or lipoproteins, related compositions, and related methods. | 07-01-2010 |
20100178299 | METHODS AND COMPOSITIONS FOR IMPROVING IMMUNE RESPONSES - The present invention relates to compositions and methods for enhancing an immune response, for example to a vaccine, by combining the administration of oxygen (O | 07-15-2010 |
20100183637 | FUSION MOLECULE BASED ON NOVEL TAA VARIANT - This invention provides novel carbonic anhydrase (CAIX) nucleic acid and peptide sequences, as well as related methods and compositions, including anti-cancer immunogenic agent(s) (e.g. vaccines and chimeric molecules) that elicit an immune response specifically directed against cancer cells expressing a CAIX antigenic marker. The novel CAIX variant and related compositions are useful in a wide variety of treatment modalities including, but not limited to protein vaccination, DNA vaccination, and adoptive immunotherapy. | 07-22-2010 |
20100183638 | RESTRICTIVE AGONIST OF TOLL-LIKE RECEPTOR 3 (TLR3) - A mismatched double-stranded ribonucleic acid, which is an agonist for Toll-like receptor 3 (TLR3), is used in vitro or in vivo as one or more of antiviral agent, antiproliferative agent, and immunostimulant. Methods of medical treat-ment and processes for manufacturing medicaments are provided. | 07-22-2010 |
20100183639 | NUCLEIC ACID-LIPOPHILIC CONJUGATES - The invention relates to a nucleic acid-lipophilic conjugates and methods for modulating an immune response using the conjugates. The lipophilic moiety associated with an immunostimulatory nucleic acid. | 07-22-2010 |
20100183640 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF FIBROTIC CONDITIONS AND IMPAIRED LUNG FUNCTION AND TO ENHANCE LYMPHOCYTE PRODUCTION - The present invention provides methods and compositions to treat fibrotic conditions, to increase lymphocyte production in vivo, and to improve and/or normalize lung function, pulmonary compliance, blood oxygenation, and blood pH to inhibit inflammatory processes to stimulate or inhibit pro-inflammatory and immune cells, and to inhibit migration of vascular endothelial cells. The invention contemplates the administration of human uteroglobin, native or recombinant, as a means of achieving these ends. Specifically, it has been found that uteroglobin inhibits cell adhesion to fibronectin, increases lymphocyte production in vivo, and improves and/or normalizes lung function, pulmonary compliance, blood oxygenation, and blood pH, and inhibits inflammatory process. In addition it has been found that uteroglobin can stimulate or inhibit pro-inflammatory and immune cells and inhibitor migration of vascular endothelial cells. | 07-22-2010 |
20100189728 | Generation of Antigen Specific T Cells - The present invention is directed to a method of generating antigen specific T cells. Furthermore, the invention is directed to antigen specific T cells, isolated transgenic TCR's, pharmaceutical compositions containing same and their use in adoptive cell therapy. This invention in particular pertains to the use of cells co-expressing allogeneic MHC molecules and antigens to induce peptide-specific T cells from non-selected allogeneic T cell repertoires. | 07-29-2010 |
20100189729 | RNA-CODED ANTIBODY - The present application describes an antibody-coding, non-modified or modified RNA and the use thereof for expression of this antibody, for the preparation of a pharmaceutical composition, in particular a passive vaccine, for treatment of tumours and cancer diseases, cardiovascular diseases, infectious diseases, auto-immune diseases, virus diseases and monogenetic diseases, e.g. also in gene therapy. The present invention furthermore describes an in vitro transcription method, in vitro methods for expression of this antibody using the RNA according to the invention and an in vivo method. | 07-29-2010 |
20100196406 | AGENTS FOR THE TREATMENT OF INFLAMMATORY DISEASES AND METHODS OF USING SAME - A method of treating an autoimmune disease such as Multiple Sclerosis is disclosed. The method comprises administering to a subject a therapeutically effective amount of CXCL11. Polypeptides and pharmaceutical compositions for treating same are also disclosed. | 08-05-2010 |
20100203067 | METHODS AND COMPOSITIONS FOR GENERATING AN IMMUNE RESPONSE BY INDUCING CD40 AND PATTERN RECOGNITION RECEPTOR ADAPTERS - Provided are methods for activating an antigen-presenting cell and eliciting an immune response by inducing an inducible pattern recognition receptor adapter, or adapter fragment, and CD40 activity. Also provided are nucleic acid compositions comprising sequences coding for chimeric proteins that include an inducible CD40 peptide and an inducible pattern recognition receptor adapter or adapter fragment. | 08-12-2010 |
20100203068 | METHODS OF SWITCHING THE PHENOTYPE OF T CELLS BY TRANSGENIC LINEAGE FACTOR FOXP3 - In one aspect the invention relates to a method of switching the phenotype of a target cell, said method comprising inducing lineage factor activity in said cell via a transgene. In another aspect, the invention relates to a method of switching the phenotype of a target cell, said method comprising introducing to said cell a genetic element capable of inducibly generating lineage factor activity, and inducing lineage factor activity in said cell. The invention also relates to methods of suppressing immune responses and methods of treating subjects. | 08-12-2010 |
20100209442 | DEGLYCOSYLATED AND DESIALIDATED LONG PENTRAXIN PTX3 - Deglycosylated long pentraxin PTX3 and desialidated long pentraxin PTX3 are disclosed, as well as processes for their preparation, pharmacological compositions containing them, and their use for the preparation of a medicament for the treatment of diseases in which the use of the long pentraxin PTX is indicated, particularly infectious and inflammatory diseases and female fertility disorders. These proteins are endowed with therapeutic activity superior to that of glycosylated pentraxin. | 08-19-2010 |
20100215672 | Preparation process and utilization of Poncirus compositions having anti-allergic and antianaphylactic properties - A composition which comprises extracts of a plant of the genus Poncirus. The composition effectively treats allergic conditions, atopic conditions, anaphylactic conditions, and autoimmune conditions. | 08-26-2010 |
20100215673 | Method for treating inflammation and controlled-release material capable of providing same - The present invention relates to methods for treating inflammation associated with bone, joint or connective tissue and an implantable controlled-release material capable of providing these anti-inflammatory activities. In particular, the present invention relates to a method for reducing inflammation in a subject's tissue comprising the step of implanting a material comprising allogenic bone gel into or adjacent to said tissue, wherein said allogenic bone gel reduces the inflammation. | 08-26-2010 |
20100215674 | ENHANCING THE T-CELLS STIMULATORY CAPACITY OF HUMAN ANTIGEN PRESENTING CELLS AND THEIR USE IN VACCINATION - With the current invention, we provide new methods of enhancing the T-cell stimulatory capacity of human dendritic cells (DCs) and their use in cancer vaccination. The method comprises the introduction of different molecular adjuvants to human DCs through transfection with at least two mRNA or DNA molecules encoding markers selected from the group of: CD40L, CD70, constitutively active TLR4 (caTLR4), IL-12p70, EL-selectin, CCR7 and/or 4-1 BBL; or in combination with inhibition of SOCS, A20, PD-L1 and/or STAT3 expression, for example through siRNA transfection. We could show a clear increase in the immunostimulatory capacity of DCs obtained in this way, enabling them to elicit an unexpectedly high T-cell immune response in vitro. Introduction of at least two of the above molecules, in combination with a tumor-specific antigen enables the DCs to elicit a significant host-mediated T-cell immune response in vivo against the tumor antigen and thus makes them very attractive in the manufacturing of anti-cancer vaccines. | 08-26-2010 |
20100221268 | T CELL IMMUNOMODULATION BY PLACENTA CELL PREPARATIONS - A Method for obtaining amniotic mesenchymal tissue cells (AMTC) and/or chorionic mesenchymal tissue cells (CMTC) comprises a) isolating amniotic membrane and/or chorionic membrane from human placenta and/or separating amniotic and chorionic membrane, a) washing the membrane of step a) to remove contaminants b) cutting the membrane of step b) c) incubating the membrane fragments of step c) in a medium containing dispase for 5 to 15 minutes at 33 to 42° C. d) incubating the composition of step d) in a resting solution for 5 to 15 minute at room temperature e) repeating steps d) and e) 0 to 6 times f) if chorionic membrane is involved peeling the stromal layer from the trophoblastic layer of the chorionic membrane of step e or f) g) digesting the fragments obtained in step e), f), or g) respectively, with collagenase for 1 to 5 hours at 33 to 42° C. h) collecting AMTCs and/or CMTCs from the suspension obtained in step h). | 09-02-2010 |
20100221269 | SYNTHETIC LIPID A DERIVATIVE - The invention provides functionalized monosaccharides and disaccharides suitable for use in synthesizing a lipid A derivative, as well as methods for synthesizing and using a synthetic lipid A derivative. | 09-02-2010 |
20100221270 | THERAPEUTIC TRANSPLANTATION USING DEVELOPING, HUMAN OR PORCINE, RENAL OR HEPATIC, GRAFTS - A method of treating a renal, hepatic or enzyme-deficiency disorder in a subject in need thereof is disclosed. The method is effected by transplanting into the subject tissue derived from a human or porcine, kidney or liver, the kidney or liver being at a selected gestational stage. | 09-02-2010 |
20100226931 | Compounds for immunopotentiation - Methods of stimulating an immune response and treating patients responsive thereto with 3,4-di(1H-indol-3-yl)-1H-pyrrole-2,5-diones, staurosporine analogs, derivatized pyridazines, chromen-4-ones, indolinones, quinazolines, nucleoside analogs, and other small molecules are disclosed. In a preferred embodiment benzopyrimidine derivatives such as ZD-6474, MLN-518, lapatinib, gefitinib or erlotinib are used. | 09-09-2010 |
20100226932 | Adjuvant and Vaccine Compositions - Abstract Compositions comprising an emulsion and aluminum salt nano-/micro-particles surface stabilized with at least one surfactant are useful as immunological adjuvants. The emulsion of these compositions comprises at least one oil; at least one surfactant; a plurality of surfactant vesicles; optionally at least one sterol; and an aqueous phase. The present invention also provides vaccines comprising one or more antigens combined with the emulsion and surface stabilized aluminum salt particles of the present invention, or one or more antigens combined with non-ionic surfactant vesicles. | 09-09-2010 |
20100233192 | Manufacturing Method of Activated Lymphocytes for Immunotherapy - Disclosed is a method for preparing activated lymphocytes, which comprises isolating lymphocytes from peripheral blood and proliferating and activating the isolated lymphocytes in vitro. According to the disclosed method, highly effective toxic cells can be prepared in large amounts by culturing human peripheral lymphocytes in the presence of an anti-CD3 antibody, IFN-γ and IL-2. The activated lymphocytes proliferated according to the disclosed preparation method comprise both CD3-CD56+ (natural killer cell marker) cells that are the main components of LAK cells, and CD3+CD56+ cells that are the main components of CIK cells, and can be cultured in large amounts. Thus, the lymphocyte cells can show a significantly higher anticancer effect compared to when the LAK cells and the CIK cells are used alone. | 09-16-2010 |
20100233193 | SYSTEMIC ADMINISTRATION OF NAC FOR VACCINATION PROPHYLAXIS - The invention is for the combination and related methods of N-acetyl-cysteine oral, inhaled, or intravenous, or glutathione inhaled or intravenous, generally in combination with antibiotic and /or antiviral therapy to ameliorate the toxic effects of infection with materials used in Bioterror incidents such as | 09-16-2010 |
20100233194 | TREATMENT OF NEOVASCULAR OCULAR DISEASE STATES - Compositions and regime or regimen for inhibiting unwanted ocular angiogenesis include the treatment of ocular neovascularization by administration of anti-angiogenesis agents, e.g., agents that inhibit VEGF, in combination with a second ocular therapy. | 09-16-2010 |
20100233195 | COMPOSITIONS AND METHODS FOR THE DISPLAY OF PROTEINS ON THE SURFACE OF BACTERIA AND THEIR DERIVED VESICLES AND USES THEREOF - The present invention relates to compositions and methods for displaying proteins and polypeptides on the surface of cells and cellular vesicles. Methods and compositions for drug and vaccine delivery using cell surface display systems of the present invention are also disclosed. | 09-16-2010 |
20100233196 | METHOD FOR PREPARING A VACCINE COMPOSITION COMPRISING AT LEAST ONE ANTIGEN AND AT LEAST ONE ADJUVANT - Method for preparing a vaccine, comprising—a step a) of preparing an adjuvant composition by dispersing, in a physiologically acceptable aqueous solution, at least one inverse latex or a powder of polymer resulting from the atomization of said inverse latex; —a step b) of mixing the composition obtained in step a) into an antigenic medium, intended to form a vaccine composition. | 09-16-2010 |
20100233197 | METHOD FOR GENERATING TOLEROGENIC DENDRITIC CELLS EMPLOYING DECREASED TEMPERATURE - The invention relates in certain embodiments to a method for generating tolerogenic dendritic cells by employing temperatures below 37° C. and phenotype-modifying agents during the development of progenitor cells and immature dendritic cells. In some embodiments the invention relates to populations of dendritic cells and their use. | 09-16-2010 |
20100233198 | USE OF OLIGOSACCHARIDES CONTAINING N-ACETYLLACTOSAMINE FOR MATURATION OF IMMUNE RESPONSES IN NEONATES - This invention relates to the use of an oligosaccharide selected from the group consisting of lacto-N-tetraose, lacto-N-neotetraose, lacto-N-hexaose, lacto-N-neohexaose, para-lacto-N-hexaose, para-lacto-N-neohexaose, lacto-N-octaose, lacto-N-neooctaose, iso-lacto-N-octaose, para-lacto-N-octaose and lacto-N-decaose in the manufacture of a medicament for infants or a therapeutic nutritional composition for infants for modulating immune responses in a neonatal infant. The invention extends to the use of such an oligosaccharide for modulating the immune system of a neonatal infant to promote the development in the first few weeks of the life of the infant of a beneficial intestinal microbiota comparable with that found in breast fed infants and for reducing the risk of subsequent development of allergy in the infant. | 09-16-2010 |
20100247556 | METHOD FOR ACTIVATION OF HELPER T CELL AND COMPOSITION FOR USE IN THE METHOD - Disclosed are: a method for activating a helper T cell, which comprises the step of adding a WT1 peptide to an antigen-presenting cell to activate the helper T cell, wherein the WT1 peptide is capable of binding to any one selected from an HLA-DRB1*1501 molecule, an HLA-DPB1*0901 molecule and an HLA-DPB1*0501 molecule; a composition for use in the method; a therapeutic and/or prophylactic method for cancer by activating a helper T cell; a pharmaceutical composition for use in the therapeutic and/or prophylactic method; and others. | 09-30-2010 |
20100247557 | Immunostimulant Composition Comprising At Least One Toll-Like Receptor 7 Or Toll-Like Receptor 8 Agonist And A Toll-Like Receptor 4 Agonist - The invention relates to an immunostimulant composition comprising at least one Toll-like receptor 7 or Toll-like receptor 8 agonist and a receptor 4 agonist. The inventive composition can also comprise a vaccine antigen. | 09-30-2010 |
20100255015 | PHARMACEUTICALS COMPOSITIONS COMPRISING ACTINOMYCETE GLYCEROL ACYL DERIVATIVES ANTIGENS, THEIR PROCESS OF EXTRACTION, AND THEIR USE AGAINST TUBERCULOSIS - The present invention relates to the therapeutic use of actinomycete glycerol monomycolate derivatives as antigens, their process of extraction, and their use in the treatment or the prophylaxis of tuberculosis. | 10-07-2010 |
20100255016 | Absorbable crystalline polyether-ester-urethane-based bioactive luminal liner compositions - Bioactive hydroforming luminal liner compositions are formed of an absorbable crystalline amphiphilic polyether-ester-urethane dissolved in a liquid derivative of a polyether glycol that undergoes transformation into a tissue-adhering, resilient interior cover or liner for the controlled release of its bioactive payload at clinically compromised conduits in humans as in the case of bacteria- and yeast-infected vaginal canals, esophagi, and arteries following angioplasty. | 10-07-2010 |
20100260788 | Immune Stimulatory Oligoribonucleotide Analogs Containing Modified Oligophosphate Moieties - Immunostimulatory oligoribonucleotides (ORN) featuring 5′-triphosphates and various 5′-triphosphate analogs are provided. Also provided are physiologically acceptable salts of the immunostimulatory ORN and pharmaceutical compositions containing the immunostimulatory ORN of the invention. ORN of the invention are useful as adjuvants and can be combined with an antigen to promote an antigen-specific immune response. ORN of the invention are also particularly useful for promoting a Th1-type immune response. Also provided are methods of use of the compounds and pharmaceutical compositions of the invention to enhance an immune response in a subject, as well to treat a number of conditions including cancer, infection, allergy, and asthma, and to vaccinate a subject against an antigen. | 10-14-2010 |
20100266621 | METHODS AND SYSTEMS FOR TREATING CELL PROLIFERATION DISORDERS WITH PSORALEN DERIVATIVES - Psoralen compounds of Formula (I): | 10-21-2010 |
20100266622 | PREVENTION AND TREATMENT OF OCULAR SIDE EFFECTS WITH A CYCLOSPORIN - Therapeutic methods are disclosed herein. | 10-21-2010 |
20100272741 | IMMUNITY TO FOLATE RECEPTORS - This document provides methods and materials related to assessing immunity to folate receptors. For example, methods and materials for assessing FRα immunity in a mammal are provided. This document also provides methods and materials related to stimulating immunity to folate receptors. | 10-28-2010 |
20100278846 | NASAL-ADMINISTERED VACCINES USING MULTI-SCREENED NALT-TARGETING AND PHAGOCYTIC POLYPEPTIDE TRANSPORT SEQUENCES - Multiple sequential screening tests have been performed on phage display libraries, and polypeptide sequences have been identified that potently drive both: (i) intake into mucosal immune cells, including NALT cells in the nose and throat; and, (ii) phagocytic intake and processing by antigen-presenting cells, such as macrophages. Such polypeptide sequences can be used as potent “target and deliver” components in vaccines that can be administered nasally, or to other mucous membranes. Such vaccines can be made very rapidly and in huge quantities, from bacteriophages that will also carry antigenic sequences in their coat proteins, or other immunoactive components. Alternately, such “target and deliver” polypeptides can be incorporated into vaccines derived from eukaryotic viruses or cellular pathogens. Enhancements also are disclosed, such as agents that can activate one or more types of toll-like receptors, to increase immunes responses and guide them in desired directions. | 11-04-2010 |
20100278847 | MUTUALLY SUPPRESSIVE GENE/INHIBITOR COMBINATIONS FOR NON-ANTIBIOTIC SELECTION OF RECOMBINANT STRAINS - This invention relates to vector sequences that express growth inhibitory levels of essential genes used in combination with inhibitors that target the same gene. An example given is the use of the gene encoding the fatty acid biosynthesis enzyme enoyl-ACP reductase used in combination with the antimicrobial triclosan. The expression level of the enoyl-ACP reductase is sufficient to suppress the toxic effects of triclosan and the triclosan is used at levels that are sufficient to suppress the toxic effects of the enoyl-ACP reductase. The invention provides methods to enhance the growth and survival of genetically modified organisms and to increase the production and expression of plasmid vectors in the presence of triclosan, relative to methods that rely on antibiotics and antibiotic resistance markers. Also, the invention provides methods to limit the spread of genetically modified organisms. The vectors and methods are useful to avoid the use of antibiotics and antibiotic markers, to contain genetically modified organisms and to increase the production of recombinant material or metabolites from host organisms. | 11-04-2010 |
20100285040 | Methods of enhancing immune response using electroporation-assisted vaccination and boosting - Disclosed are methods of enhancing immune responses. Such methods involve the administration of vaccine compositions to different tissues to elicit an enhanced immune response. The enhanced response arises from the vaccination and boosting route of administration in two separate patient tissues, for example, by first administering a priming vaccination into skin and later administering a boost vaccination in muscle. In each case, priming and boosting, the administration of the vaccine composition is preferably carried out using contemporaneous electroporation-assisted delivery of the antigenic agent. | 11-11-2010 |
20100285041 | Class A Oligonucleotides with Immunostimulatory Potency - The invention provides an immunostimulatory nucleic acid comprising CpG motifs, and methods of use thereof in stimulating immunity. | 11-11-2010 |
20100285042 | METHODS OF ENHANCING ADJUVATICITY OF VACCINE COMPOSITIONS - The immunogenicity of vaccines is enhanced by co-administering a synthetic glycolipid, designated PBS-57, with the vaccine. PBS-57 has the ability to stimulate both a cell-mediated and humoral immune response. Co-administration of PBS-57 with a vaccine may be used in methods to stimulate one or more of a humoral immune response, a CD4+ T cell response, and a CD8+ cytotoxic T cell response. | 11-11-2010 |
20100285043 | MITE ANTIGENIC RICE - An objective of the present invention is to provide methods for accumulating in rice seeds a partial peptide of a mite antigen protein comprising several T cell epitopes, or a mite antigen peptide that has been modified to not form a conformation to be recognized as an antigen, and plants which have accumulated these peptides. | 11-11-2010 |
20100285044 | METHOD AND COMPOSITIONS FOR TREATMENT OF CANCERS - A method to treat cancer uses ultrapheresis, refined to remove compounds of less than 120,000 daltons molecular weight, followed by administration of replacement fluid, to stimulate the patient's immune system to attack solid tumors. In the preferred embodiment, the patient is ultrapheresed using a capillary tube ultrafilter having a pore size of 0.02 to 0.05 microns, with a molecular weight cutoff of 120,000 daltons, sufficient to filter one blood volume. The preferred replacement fluid is ultrapheresed normal plasma. The patient is preferably treated daily for three weeks, diagnostic tests conducted to verify that there has been shrinkage of the tumors, then the treatment regime is repeated. The treatment is preferably combined with an alternative therapy, for example, treatment with an anti-angiogenic compound, one or more cytokines such as TNF, gamma interferon, or IL-2, or a procoagulant compound. The treatment increases endogenous, local levels of cytokines, such as TNF. This provides a basis for an improved effect when combined with any treatment that enhances cytokine activity against the tumors, for example, treatments using alkylating agents, doxyrubicin, carboplatinum, cisplatinum, and taxol. Alternatively, the ultrapheresis treatment can be combined with local chemotherapy, systemic chemotherapy, and/or radiation. | 11-11-2010 |
20100291115 | PHARMACEUTICAL COMPOSITION FOR THE SUBLINGUAL ADMINISTRATION OF VACCINES, METHOD FOR THE PREPARATION OF THE SAME AND USES THEREOF - The subject of the present invention is a pharmaceutical composition for the sublingual administration of vaccines, a method for its preparation and the use thereof for modulating the absorption rate and substantially improving its effectiveness and safety. Said sublingual composition is applicable both to immunizing vaccines, which are employed against infections, and to desensitising vaccines, which have allergies as therapeutic indication. | 11-18-2010 |
20100291116 | MICROPARTICLE COMPRISING CROSS-LINKED POLYMER - Microparticle comprising a cross-linked polymer comprising (a) a cross-linker comprising two or more radically polymerizable groups, preferably selected from the group consisting of alkenes, sulfhydryl (SH), thioic, unsaturated esters, unsaturated urethanes, unsaturated ethers, and unsaturated amides; (b) a monofunctional reactive diluent comprising maximum one unsaturated C—C bond represented by the formula R | 11-18-2010 |
20100291117 | METHOD FOR EX-VIVO EXPANSION OF REGULATORY T CELLS WITH ENHANCED SUPPRESSIVE FUNCTION FOR CLINICAL APPLICATION IN IMMUNE MEDIATED DISEASES - The invention provides methods for the ex-vivo expansion of CD4+CD25+ Tregs. The invention provides a method for producing ex vivo expanded Tregs that may be used to inhibit unwanted human immune responses against self-antigens or allergens. Additionally, the ex vivo expanded Tregs may provide treatment for inflammatory/automimmune diseases. | 11-18-2010 |
20100291118 | Class of Gamma Delta T Cells Activators and Use Thereof - The present invention relates to a new class of compounds having γδ T cells activating properties of Formula (I), | 11-18-2010 |
20100297154 | CD40 ligand-enhanced cells and methods of modulating an immune response to an antigen - The invention provides for a method of vaccinating a mammal to a selected antigen, wherein the method comprises administering to a mammal a vaccine composition comprising a CD40 ligand-enhanced cell, wherein the CD40 ligand-enhanced cell comprises a selected antigen and is admixed with an engineered ligand for CD40. | 11-25-2010 |
20100297155 | PHOSPHAZENE HYDROGELS WITH CHEMICAL CORSS-LINK, PREPARATION METHOD THEREOF AND USE THEREOF - A phosphazene-based polymer hydrogel with a chemical cross-linkings formed by radiating ultraviolet (UV) and/or mixing with cross-linking agent and/or enzyme, a method of preparing the same, and a hydrogel forming a chemical cross-linking by radiating ultraviolet and/or mixing with a cross-linking agent and/or an enzyme; where the hydrigel shows a sol-gel behavior and has an excellent solidity by containing the phosphazene-based polymer that is capable of cross-linking at a certain concentration, are provided. | 11-25-2010 |
20100297156 | ANALOGUES OF PHOSPHATIDYLINOSITOL MANNOSIDES - The invention relates to compounds which are immunomodulatory compounds and, in particular, can induce IL-12 secretion. The invention also relates to compositions containing the compounds, precursors, and prodrugs of these compounds, use of these compounds as adjuvants in combination with vaccines, and use of these compounds for treatment of diseases or conditions relating to infection, atopic disorders, or cancer. | 11-25-2010 |
20100303837 | CARBOHYDRATE SPECIFIC CELLULAR IMMUNITY INDUCING MICROORGANISMS AND FRACTIONS THEREOF - The present invention relates to the field of prevention and treatment of disorders associated with the occurrence of certain carbohydrate epitopes. The present invention relates to the prevention and treatment of carbohydrate epitope positive tumors. The invention relates to formulations and methods for the induction of an effective carbohydrate specific cellular immune response. | 12-02-2010 |
20100303838 | VECTORS FOR MULTIPLE GENE EXPRESSION - The present invention provides a vector for expressing at least a first and a second nucleic acid molecules which exhibit a percentage of homology of approximately 80% or greater than 80% over a portion of 40 or more continuous nucleotides and wherein said first nucleic acid molecule and/or said second nucleic acid molecule is modified so as to reduce said percentage of homology to less than 75%. The present invention also relates to substantially isolated nucleic acid molecules comprising a nucleotide sequence as defined in any of SEQ ID NO: 9-15 and 66-69. It also provides a host cell and a pharmaceutical composition comprising such a nucleic acid molecule or vector as well as their use for therapeutic or preventive purposes. | 12-02-2010 |
20100303839 | METHODS AND COMPOSITIONS FOR TREATMENT OF CANCER USING ONCOLYTIC RSV ACTIVITY - The present invention relates generally to methods and compositions employing the oncolytic activity of respiratory syncytial virus (RSV) to treat cancer and other neoplastic disorders. | 12-02-2010 |
20100303840 | USE OF CREATINE OR CREATINE ANALOGS FOR THE TREATMENT OF DISEASES OF THE NERVOUS SYSTEM - The present invention relates to the use of creatine compounds including creatine, creatine phosphate or analogs of creatine, such as cyclocreatine, for treating diseases of the nervous system. Creatine compounds can be used as therapeutically effective agents against a variety of diseases of the nervous system such as diabetic and toxic neuropathies, peripheral nervous system diseases, Alzheimer's disease, Parkinson's disease, stroke, Huntington's disease, amyotropic lateral sclerosis, motor neuron disease, traumatic nerve injury, multiple sclerosis, dysmyelination and demyelination disorders, and mitochondrial diseases. The creatine compounds which can be used in the present method include (1) creatine, creatine phosphate and analogs of these compounds which can act as substrates or substrate analogs for creatine kinase; (2) bisubstrate inhibitors of creatine kinase comprising covalently linked structural analogs of adenosine triphosphate (ATP) and creatine; (3) creatine analogs which can act as reversible or irreversible inhibitors of creatine kinase; and (4) N-phosphorocreatine analogs bearing non-transferable moieties which mimic the N-phosphoryl group. | 12-02-2010 |
20100303841 | ADJUVANT - The subject invention provides new adjuvant therapy. | 12-02-2010 |
20100310585 | THE USE OF MONOMYCOLYL GLYCEROL (MMG) AS AN ADJUVANT - Here we identify MMG and its alpha- and ketomycolic acid derivatives as highly bioactive lipids derived from | 12-09-2010 |
20100310586 | IDIOTYPIC VACCINE - The invention concerns the use of recombinant clonotypic immunoglobulins (Ig) as a vaccine in the treatment of HCV-related and non HCV-related lymphoproliferations, in particular the use of recombinant proteins with immunogenic properties derived from protein segments VK3-20 and VK3-15 of Ig light chains derived from patients with lymphoproliferations. | 12-09-2010 |
20100310587 | IMMUNOMODULATORY COMPOSITIONS - Methods useful, for example, in identifying plant compositions that have immunomodulatory activity. Also disclosed is an Asteraceae plant immunomodulatory composition useful for increasing an immune response, e.g., IFN γ or IL-2 transcription. | 12-09-2010 |
20100310588 | REGULATORY T CELLS SUPPRESS AUTOIMMUNITY - The invention provides methods for producing an autoantigen-specific regulatory T cell enriched composition, and resultant compositions and methods for use. | 12-09-2010 |
20100310589 | SWINE VACCINATION SYSTEM - A system for vaccinating swine according to one embodiment includes a housing having an open first end and an open opposite second end. The housing has a pair of side walls that are angled and non-parallel to one another such that at the second end only a single piglet can exit at one time. The system also includes a vaccination station for individually vaccinating piglets. The vaccination station is located between the pair of side walls in a region thereof that is sized to only permit one piglet to stand between the side walls. The vaccination station includes at least one sensor that detects the presence of the one piglet within the vaccination station and at least one spray nozzle positioned within the vaccination station such that a vaccine dose discharged therefrom is directed upwardly into facial areas of the piglet effectively. | 12-09-2010 |
20100316657 | Synthetic Archaeal Glycolipid Adjuvants - Archaeal lipid adjuvants are synthesized by chemically coupling various carbohydrates or anionic polar groups to the free hydroxyl(s) of archaeal lipid cores. Chemically stable lipid cores such as saturated archaeol and caldarchaeol are obtained from appropriate Archaea. Archaeosome lipid vesicles are formulated from the synthetic lipids selected to serve as antigen carriers that target antigen-presenting cells and promote an appropriate immune response to the antigen. | 12-16-2010 |
20100316658 | METHOD FOR PRODUCING AN ANTITUMORAL VACCINE BASED ON SURFACE ENDOTHELIAL CELL ANTIGENS - Accordingly to the method of the preparing of the tumor vaccine with the use of endothelial cells, live endothelial cells are treated with a protease at mild (non-deadly for cells) conditions, the splitted surface antigens are collected, the treatment of live endothelial cells is repeated after intervals which are necessary for the recovery of the surface antigens by the cells, surface antigens are accumulated until their necessary quantity is reached, the quality of the vaccine is controlled thereafter. The technical result obtained with the use of this invention consists in the enhancement of the efficiency of oncological disease treatment due to the damage of the tumor vessels caused by overcoming of the immune tolerance of organism to the endothelial cells (EC) of tumor vessels. Here one means the overcoming of immune tolerance namely to activated EC, which allows to damage mainly to the tumor vessels by the immune system. | 12-16-2010 |
20100316659 | IMMUNOSTIMULATORY OLIGORIBONUCLEOTIDES - The invention provides immunostimulatory compositions and use of those compounds in the preparation of medicaments for the treatment of disease as well as in vitro uses. In particular, the compositions of the invention include immunostimulatory oligoribonucleotides that incorporate a sequence-dependent immunostimulatory sequence motif. Specific modifications involving phosphate linkages, nucleotide analogs, adducts, and combinations thereof are provided. Compositions of the invention, which optionally can include an antigen, can be used alone or together with other treatments to stimulate or enhance an immune response. Also provided are compositions and methods useful for treating a subject having an infection, a cancer, an allergic condition, asthma, airway remodeling, or immunodeficiency. Immunostimulatory oligoribonucleotides of the invention are believed to stimulate Toll-like receptor 8 (TLR8). | 12-16-2010 |
20100316660 | EDIBLE PRODUCT HAVING AN IMMUNOSTIMULATING EFFECT - There is provided an edible product having an immunostimulating effect, said product comprising polysaccharides obtainable from the Alliaceae family of the perennial flowering plants. Also provided is a process for preparing such an edible product and composition comprising from 0.0001 to 25% by weight of polysaccharides obtainable from the Alliaceae family and having an immunostimulating effect | 12-16-2010 |
20100322951 | Replication-proficient dsRNA capsids and uses thereof - Compositions and methods useful in the production of proteins in vitro and in vivo are provided. In particular, this invention provides bionanoparticles comprised of replication-proficient, double-stranded RNA (dsRNA) capsids which are capable of transfecting, for example, target bacterial, yeast, plant and mammalian cells, and causing expression of genes of interest in said transfected cells. The bionanoparticles comprised of replication-proficient, dsRNA capsids are also capable of expressing genes of interest in vitro. The genes of interest can encode proteins that are useful, for example, as research reagents, therapeutics and vaccines. Also described are methods that enable the construction of bionanoparticles comprised of replication-proficient dsRNA capsids and methods for transfecting cells with said bionanoparticles and expressing said genes of interest in transfected cells and in vitro. | 12-23-2010 |
20100322952 | COMPOSITIONS FOR AND METHODS OF ENHANCING THE IMMUNE RESPONSE TO ANTIGENS - Compositions comprising the compound of formula are provided herein. Also provided are methods of enhancing an immune response of a subject to an antigen by administering the antigen and the composition. The enhanced immune response may be an humoral immune response, a CD4+T cell response, a CD8+T cell response or result in activation of antigen presenting cells. Methods of enhancing the immune response by intramuscular administration of an antigen and the composition including the compound of formula I are also provided. | 12-23-2010 |
20100330109 | INHIBITORS OF SERINE PROTEASES, PARTICULARLY HCV NS3-NS4A PROTEASE - The present invention relates to compounds of formula I: | 12-30-2010 |
20100330110 | THERAPEUTIC AND DIAGNOSTIC USES OF ANTIBODY SPECIFICITY PROFILES - This invention provides a method for determining the antibody specificity profile in an individual. This specificity profile reveals the individual's immune response to multiple antigens and/or epitopes of autoantigens, allergens, graft antigens, etc. The antibody specificity profile is determined through the binding of patient samples comprising antibodies to the arrays. The array can comprises antigens and epitopes. The invention also provides the means and methods for determining antigen or epitope specificity profiles that can be used in the development of either generic and individualized diagnosis and treatment for immune related diseases, including autoimmune disease, allergy and graft rejection. | 12-30-2010 |
20110002948 | IDENTIFICATION OF A NUCLEIC ACID MOLECULE - This invention relates to the identification of a nucleic acid molecule. In particular, this invention relates to a method of using an oligonucleotide designed to a variable region of a nucleic acid molecule to identify A nucleic acid molecule. | 01-06-2011 |
20110002949 | VACCINE FOR THE TREATMENT OF ALZHEIMER'S DISEASE - The invention provides a method for the treatment of a patient having a more severe form of Alzheimer's disease (AD), where the severe form of AD is characterized by pathogenic deposits of amyloid beta peptide (Aβ), comprising the administration of an immunogenic fragment of Aβ capable of inducing an immune response in the form of antibodies to specific to the pathogenic deposits of Aβ and, in particular, to neurotoxic forms of Aβ including N-terminally truncated forms of Aβ. The invention further provides a method for selecting a suitable immunogenic fragment of Aβ for the treatment of a more severe form of AD. | 01-06-2011 |
20110002950 | PIG EDEMA DISEASE VACCINE - A technology for producing a pig edema disease vaccine at low cost and at high efficiency is developed. Specifically, a gene of a pig edema disease toxin protein (Stx2e protein) is efficiently expressed in plant cells to produce a plant vaccine for pig edema disease at low cost. An Stx2e protein including a secretory signal peptide derived from a plant added at an amino terminus is expressed in cells of a plant such as | 01-06-2011 |
20110002951 | Modified Leukotoxin Gene and Protein - The present invention provides nucleic acid sequences encoding a modified leukotoxin protein, wherein the modification comprises the removal of nucleic acid sequences encoding amino acids within hydrophobic transmembrane domains of full length leukotoxin protein, preferably from | 01-06-2011 |
20110002952 | FUSED HETEROARYL MODULATORS OF GLUCOCORTICOID RECEPTOR, AP-1, AND/OR NF-kappaB ACTIVITY AND USE THEREOF - Novel non-steroidal compounds are provided which are useful in treating diseases or disorders associated with modulation of the glucocorticoid receptor, AP-1, and/or NF-κB activity, including metabolic and inflammatory and immune diseases or disorders, having the structure of formula (I): an enantiomer, diastereomer, or tautomer thereof, or a prodrug ester thereof, or a pharmaceutically-acceptable salt thereof, in which: Z is heterocyclo or heteroaryl; -A is a 5- to 8-membered carbocyclic ring or a 5- to 8-membered heterocyclic ring; B1 and B2 rings are pyridyl rings, wherein the B1 and B | 01-06-2011 |
20110002953 | USE OF IMMIDAZOQUINOLINAMINES AS ADJUVANTS IN DNA VACCINATION - The present invention relates to the use of a 1H-imidazo[4,5-c]quinolin-4-amine derivative as an adjuvant for use with nucleic acid vaccination. | 01-06-2011 |
20110008376 | IMMUNOGENIC COMPOSITIONS CAPABLE OF ACTIVATING T-CELLS - The invention provides means and methods for producing and/or selecting immunogenic compositions capable of activating a T-cell and/or a T-cell response, comprising providing said composition with at least one crossbeta structure and testing at least one immunogenic property. | 01-13-2011 |
20110014217 | CARBON NANOTUBE COMPOSITIONS AND METHODS OF USE THEREOF - Carbon nanotube (CNT)-based compositions for activating cellular immune responses are provided. The CNTs function as high surface area scaffolds for the attachment of T cell ligands and/or antigens. The CNT compositions function as artificial antigen-presenting cells (aAPCs) or as modular vaccines. The disclosed CNT aAPCs are efficient at activating T cells and may be used to activate T cells ex vivo or in vivo for adoptive or active immunotherapy. | 01-20-2011 |
20110020374 | EXPRESSION SYSTEM FOR MODULATING AN IMMUNE RESPONSE - The present invention discloses methods and compositions for modulating the quality of an immune response to a target antigen in a mammal, which response results from the expression of a polynucleotide that encodes at least a portion of the target antigen, wherein the quality is modulated by replacing at least one codon of the polynucleotide with a synonymous codon that has a higher or lower preference of usage by the mammal to confer the immune response than the codon it replaces. | 01-27-2011 |
20110020375 | STROMAL CELL-DERIVED FACTOR-1 POLYPEPTIDES, POLYNUCLEOTIDES, MODULATORS THEREOF AND METHODS OF USE - Disclosed herein is a newly identified SDF-1 splice variant molecule, its polypeptide sequence, and the polynucleotides encoding the polypeptide sequence, and active fragments thereof. Also provided is a procedure for producing such polypeptides by recombinant techniques employing, for example, vectors and host cells. Also disclosed are methods for utilizing such polypeptides and modulators thereof for the treatment of diseases, including cancer, immune diseases, infectious diseases, and ischemic diseases. | 01-27-2011 |
20110020376 | AMINOPYRIMIDINES USEFUL AS INHIBITORS OF PROTEIN KINASES - The present invention relates to compounds useful as inhibitors of protein kinases. The invention also provides pharmaceutically acceptable compositions comprising those compounds and methods of using the compounds and compositions in the treatment of various disease, conditions, and disorders. The invention also provides processes for preparing compounds of the invention. | 01-27-2011 |
20110020377 | AMINOPYRIMIDINES USEFUL AS INHIBITORS OF PROTEIN KINASES - The present invention relates to compounds useful as inhibitors of protein kinases. The invention also provides pharmaceutically acceptable compositions comprising those compounds and methods of using the compounds and compositions in the treatment of various disease, conditions, and disorders. The invention also provides processes for preparing compounds of the invention. | 01-27-2011 |
20110020378 | SELF-ASSEMBLING PEPTIDE NANOPARTICLES USEFUL AS VACCINES - Self-assembling peptide nanoparticles (SAPN) incorporating T-cell epitopes and/or B-cell epitopes are described. The nanoparticles of the invention consist of aggregates of a continuous peptidic chain comprising two oligomerization domains connected by a linker segment wherein one or both oligomerization domains incorporate T-cell epitopes and/or B-cell epitopes within their peptide sequence. These nanoparticles are useful as vaccines and adjuvants. | 01-27-2011 |
20110033484 | LprG AS A CHAPERONE OF IMMUNE ADJUVANTS - An adjuvant combination that stimulates immune activation or response includes a hydrophobic immune adjuvant and a pathogen derived lipoprotein that chaperones the hydrophobic immune adjuvant to an immune receptor. | 02-10-2011 |
20110033485 | ANALOGUES OF GLYCOLIPIDS USEFUL AS IMMUNOADJUVANTS - The invention provides analogs of alpha-galactosyl ceramide that increase the immune response elicited by various antigens. It also provides methods of using such compounds to increase the effectiveness of vaccines. | 02-10-2011 |
20110033486 | GENE EXPRESSION MARKERS FOR CROHN'S DISEASE - The present invention relates to methods of gene expression profiling for inflammatory bowel disease pathogenesis, in which the differential expression in a test sample from a mammalian subject of one or more IBD markers relative to a control is determined, wherein the differential expression in the test sample is indicative of an IBD in the mammalian subject from which the test sample was obtained. | 02-10-2011 |
20110038881 | PROGNOSTIC ASSAY FOR DETERMINING T CELL RESPONSE TO HLA ANTIGENS AND USE THEREOF IN FIELD OF TISSUE TRANSPLANTATION - The invention provides an in vitro method of determining whether an individual is at risk of, or undergoing, graft damage or rejection of immune origin and/or damage of immune origin to non-graft tissue using polypeptides derived from a major histocompatibility complex (MHC) class I human leukocyte antigen (HLA), such as HLA-A2, and derivatives or analogues thereof. | 02-17-2011 |
20110038882 | Methods for Treating Allergic Disease - A method for treating or alleviating allergic disease in a mammal in need thereof having administering to the mammal a therapeutically effective amount of a pharmaceutical composition having phycocyanin is provided. A method for modulating balance between Th1 and Th2 immune response in a mammal in need thereof, having administering to the mammal an effective amount of phycocyanin, wherein immune response of the mammal is skewed toward the Th1 immune response is also provided. Phycocyanin from | 02-17-2011 |
20110038883 | HE4 MONOCLONAL ANTIBODIES AND METHODS FOR THEIR USE - Compositions and methods for diagnosing ovarian cancer in a patient and for identifying patients with an increased likelihood of having ovarian cancer are provided. The compositions include novel monoclonal antibodies, and variants and fragments thereof, that specifically bind to HE4. Monoclonal antibodies having the binding characteristics of an HE4 antibody of the invention are further provided. Hybridoma cell lines that produce an HE4 monoclonal antibody of the invention are also disclosed herein. The compositions find use in diagnostic methods as well as in screening methods for identifying patients having an increased likelihood of having ovarian cancer. Kits comprising one or more of the disclosed HE4 monoclonal antibodies and for practicing the methods of the invention are further provided. Polypeptides comprising the amino acid sequence for an HE4 epitope and methods of using these polypeptides in the production of antibodies are also encompassed by the present invention. | 02-17-2011 |
20110038884 | IMMUNOPOTENTIATING AGENT COMPRISING EP1 AGONIST - An EP1 agonist has an immunopotentiating effect mediated by cytotoxic T lymphocyte activation and/or natural killer cell activation, and is thus useful for the prevention and/or treatment of cancers, microbial infectious diseases and the like. | 02-17-2011 |
20110052612 | SPIROPIPERIDINE COMPOUND AND MEDICINAL USE THEREOF - The present invention relates to a CXCR3 antagonist comprising a compound represented by formula (I) (wherein all the symbols have the same meaning as defined in the description), | 03-03-2011 |
20110052613 | METHOD FOR THE TREATMENT OF NEUROLOGICAL DISORDERS BY ENHANCING THE ACTIVITY OF BETA-GLUCOCEREBROSIDASE - Provided is a method of increasing the stability of wild-type β-glucocerebrosidase. Also provided are methods of treating and/or preventing an individual having a neurological disease in which increased expression or activity of β-glucocerebrosidase in the central nervous system would be beneficial. This method comprises administering an effective amount of a pharmacologic chaperone for β-glucocerebrosidase, with the proviso that the individual does not have a mutation in the gene encoding β-glucocerebrosidase. Further provided are β-glucocerebrosidase inhibitors which have been identified as specific pharmacologic chaperones and which have been shown to increase activity of β-glucocerebrosidase in vivo in the central nervous system. | 03-03-2011 |
20110059116 | LASER-BASED VACCINE ADJUVANTS - The invention is directed to a vaccine for generating an enhanced immune response in a subject previously exposed to non-destructive laser radiation, as compared to an immune response in a subject previously non-exposed to non-destructive laser radiation. The invention is also directed to use of a composition comprising a vaccine for use in combination with non-destructive laser radiation for generating an enhanced immune response from a subject, as compared to an immune response without the use of laser radiation. The laser exposure acts as an adjuvant for the vaccine, increasing the efficacy and/or potency of the vaccine. | 03-10-2011 |
20110059117 | Liquid Compositions Capable of Foaming and Including Active Agents, and Methods for Making or Developing Same - A liquid composition suitable for topical use comprising is provided that includes a phospholipid foaming agent and at least one solvent; and a pharmaceutically acceptable active agent; wherein the liquid composition is capable of mechanically foaming without an additional propellant; and wherein upon mechanical foaming of 250 ml of the liquid composition results in a foam with a foam volume of at least about 400 ml and a foam stability wherein at least about 50% of the foam volume is still present after about 5 minutes at 25° C., as determined using a SITA foam measurement. Also provided herein are methods of making disclosed compositions and methods of use. | 03-10-2011 |
20110059118 | INHIBITORS OF JAK - The present invention relates to the use of novel compounds of Formula I, | 03-10-2011 |
20110064755 | METHODS FOR PRODUCING BLOCK COPOLYMER/AMPHIPHILIC PARTICLES - The invention relates to a method for manufacturing cell delivery particles, pharmaceutical component-particle dispersions, compositions comprising cell delivery particles and pharmaceutical compositions comprising pharmaceutical component-particle dispersions. The method comprises homogenization of mixtures comprising amphiphilic components and a block copolymer to form stable particles. The invention is also directed to cell delivery particles and pharmaceutical component-particle dispersions produced by the claimed methods and compositions comprising same. In certain embodiments, the cell delivery particles may further comprise co-lipids. The invention further relates to methods of generating an immune response, treating or preventing a disease or condition, or delivering a biologically active molecule to cells in vitro comprising administration of the pharmaceutical compositions described herein. | 03-17-2011 |
20110070250 | Therapeutical Composition Containing Dentritic Cells and use Thereof - The present invention relates to a method for the preparation of a therapeutical composition, in particular, the present invention relates to a method for treating dendritic cells with a combination of at least one interferon gamma receptor agonist and at least one toll like receptor 2 and/or TLR 6 agonist and using these pretreated dendritic cells for the preparation of a therapeutical composition. Moreover, the present invention relates to a therapeutical composition containing dendritic cells and the use thereof for the treatment of various diseases and disorders. | 03-24-2011 |
20110076288 | Compositions for and Methods of Identifying Antigens - Replicable libraries having discrete members in defined locations for screening for antigens to a pathogenic organism are provided. Also provided are methods for using such libraries as well as a specific antigen, CT788, which induces T-cell activation during a | 03-31-2011 |
20110076289 | Transgenic animal model of neurodegenerative disorders - The present invention provides a transgenic animal model of Alzheimer's Disease designated TgCRND8 as well as a method for making such model, which allows for the characterization of the etiology of the disease as well as for provide a system for the development and testing of potential treatments. | 03-31-2011 |
20110076290 | DENDRITIC CELL VACCINES FOR ASPARAGINYL-BETA-HYDROXYLASE EXPRESSING TUMORS - A vaccine containing AAH-loaded mature dendritic cells for treatment of AAH-expressing tumors in mammalian subjects. A method of producing primed dendritic cells is carried out by contacting isolated dendritic cells with an antigen such as AAH. Following the antigen-contacting step, the dendritic cells are contacted with a combination of cytokines such as GM-CSF and IFN-γ. | 03-31-2011 |
20110076291 | BENZOXEPIN PI3K INHIBITOR COMPOUNDS AND METHODS OF USE - Benzoxepin compounds of Formula I, and including stereoisomers, geometric isomers, tautomers, solvates, metabolites and pharmaceutically acceptable salts thereof, wherein: Z | 03-31-2011 |
20110076292 | BENZOXAZEPIN PI3K INHIBITOR COMPOUNDS AND METHODS OF USE - Benzoxazepin compounds of Formula I, including stereoisomers, geometric isomers, tautomers, solvates, metabolites and pharmaceutically acceptable salts thereof, wherein: Z | 03-31-2011 |
20110076293 | TRIPTOLIDE DERIVATIVES FOR MODULATION OF APOPTOSIS AND IMMUNOSUPPRESSION - Variously substituted carbonate and carbamate derivatives of triptolide compounds have good aqueous solubility and convert to biologically active compounds in vivo, at a rate which can be modulated by varying the substitution on the prodrug. The prodrugs are useful as immunosuppressive, anti-inflammatory and anticancer agents. | 03-31-2011 |
20110076294 | Mixed Cell Populations For Tissue Repair And Separation Technique For Cell Processing - The present invention provides a fluid exchange cell culture technique and tissue repair cells (TRCs) made by these methods, as well as methods using these cells. The method includes a new wash step which increases the tissue repair properties of the TRCs of the invention. This wash step allows for the production of TRC populations with greater tissue repair and anti-inflammatory capabilities. Embodiments of the present invention include a post-culture process for cultured cells that preferably includes the steps of: a wash process for removing unwanted residual culture components, a volume reduction process, and a harvesting process to remove cultured cells. Preferably, all these steps are performed within a aseptically closed cell culture chamber by implementing a separation method that minimizes mechanical disruption of the cells and is simple to automate. The harvested cells may then be concentrated to a final volume for the intended use. In such embodiments, the final composition is a substantially purified and concentrated cell mixture suspended in a physiologic solution suitable for immediate use in humans without further washing, volume reduction, or processing. Embodiments are also applicable to harvesting (and/or washing) particles within a liquid or solution within a chamber. | 03-31-2011 |
20110076295 | LACTOFERRIN IN THE TREATMENT OF MALIGNANT NEOPLASMS AND OTHER HYPERPROLIFERATIVE DISEASES - The present invention relates to methods of treating a hyperproliferative disease by administering a composition of lactoferrin alone or in combination with standard anti-cancer therapies. | 03-31-2011 |
20110076296 | TLR3 Agonist Compositions - The present invention relates generally to the fields of medicine. More specifically, the present invention relates to improved TLR3 agonists. The present invention provides novel dsRNA such as polyAU composition useful in the treatment of TLR3 related diseases, uses and preparations thereof. | 03-31-2011 |
20110081363 | COMPOSITIONS AND METHODS FOR BIOLOGICAL SAMPLE STORAGE - Compositions and methods are disclosed for substantially dry storage at ambient or elevated temperatures of biological samples such as nucleic acids, proteins and cells in a form from which the samples can be substantially recovered, using a dissolvable or dissociable dry storage matrix comprising a borate composition and a stabilizer as disclosed, such as any of a number of zwitterionic stabilizers. | 04-07-2011 |
20110081364 | PYRROLOPYRAZINES AND PYRAZOLOPYRAZINES USEFUL AS INHIBITORS OF PROTEIN KINASES - The present invention relates to compounds useful as inhibitors of Aurora protein kinase. The invention also provides pharmaceutically acceptable compositions comprising said compounds and methods of using the compositions in the treatment of various disease, conditions, or disorders. The invention also provides processes for preparing compounds of the inventions. | 04-07-2011 |
20110081365 | COMPOUNDS AND COMPOSITIONS AS TLR ACTIVITY MODULATORS - The invention provides a novel class of compounds, pharmaceutical compositions comprising such compounds and methods of using such compounds to treat or prevent diseases or disorders associated with Toll-Like Receptors, including TLR7 and TLR8. In one aspect, the compounds are useful as adjuvants for enhancing the effectiveness of a vaccine (formula I) wherein: X | 04-07-2011 |
20110081366 | IMMUNOSTIMULATORY NUCLEIC ACID MOLECULES - Nucleic acid sequences containing unmethylated CpG dinucleotides that modulate an immune response including stimulating a Th1 pattern of immune activation, cytokine production, NK lytic activity, and B cell proliferation are disclosed. The sequences are also useful as a synthetic adjuvant. | 04-07-2011 |
20110081367 | INFLUENZA SEQUENCES - We provide a nucleic acid sequence as shown in Table D1 or Table D2, or a variant, homologue, derivative or fragment thereof. A combination of two or more sequences is also provided. The nucleic acid sequence or combination may be used for detection of influenza or discrimination between strains of influenza. | 04-07-2011 |
20110086051 | SYSTEM AND METHOD FOR MONITORING AND OPTIMIZING IMMUNE STATUS IN TRANSPLANT RECIPIENTS - This invention provides a system and method for an assay used in determining appropriate immunosuppressant levels relative to organ transplant in which PBMC is separated from whole blood by Ficoll®. An aliquot of PBMC is used for phenotyping of cells. CD4, CD8, memory and naïve subsets, B-cells regulatory T-cells and other cell markers (e.g. CD31) are examined. After an aliquot of PBMC is taken, CD4 cells are isolated. DNA is isolated from the cells. CD4 cells can be used for TREC at the defined time points. The TREC assay can be performed via a validated protocol. TREC levels are then measured using a quantitative RT-PCR for single jointed TREC. Alternatively, or additionally, TREC-correlated cell markers (e.g. CD31) can be analyzed. Approximately 100,000 cells, or 2 micrograms, of DNA are desired for TREC analysis. Normal control cells are run in parallel. A kit for performing the assay, including instructions and various components can be provided for practitioners. | 04-14-2011 |
20110086052 | ACTIVATION OF INNATE AND ADAPTIVE IMMUNE RESPONSES BY A GINSENG EXTRACT - The invention is directed to ginseng fractions and methods for activating innate and adaptive immune responses to prevent, treat or ameliorate a condition in a subject by administering to the subject an effective amount of a ginseng traction, a pharmaceutical composition comprising the fraction in combination with another medicament or with one or more pharmaceutically acceptable carriers, or a food item comprising the fraction. The fraction may be made from | 04-14-2011 |
20110086053 | Glycolipids And Analogues Thereof As Antigens For NKT Cells - This invention relates to immunogenic compounds which serve as ligands for NKT (natural killer T) cells and to methods of use thereof in modulating immune responses. | 04-14-2011 |
20110086054 | YEAST STRAIN FOR THE PRODUCTION OF PROTEINS WITH TERMINAL ALPHA-1,3-LINKED GALACTOSE - Lower eukaryotic host cells have been engineered to produce glycoprotein having at least one terminal α-galactosyl epitope. The glycoproteins are useful for the production of highly antigenic glycoprotein compositions with advantages for the production of vaccines. | 04-14-2011 |
20110091488 | WATER-SWELLABLE POLYMERS - A pharmaceutical controlled release composition in solid dosage form is provided which comprises (I) a water-swellable linear polymer obtainable by reacting together: (a) a dried polyethylene oxide; (b) a dried C | 04-21-2011 |
20110097346 | Dendritic Cells - The present invention relates to dendritic cell loaded with at least one nucleic acid molecule encoding a tumor associated antigen protein or fragment thereof and at least one tumor associated antigen protein or fragment thereof. | 04-28-2011 |
20110097347 | Niacin compositions for reduction of amyloid beta peptide 42 (abeta 42) production and for treatment of alzheimer's disease (ad) - The present invention discloses (1) phenolic ester hybrids of niacin with m-methoxy-p-hydroxy phenyl compounds like eugenol, vanillin, apocynin, ferulic acid, isoferulic acid and eugenol epoxide and (2) cocrystals of hybrids as above, particularly cocrystal of niacin-eugenol hybrid with cocrystal former like eugenol and oxalic acid (3) novel pharmaceutical compositions comprising a combination of niacin and one or more small molecule/potentiating agent like eugenol, curcumin, cinnamic acid, meclofenamic acid, and their use in the treatment of a disorder or a disease caused by excess production of amyloid beta peptide-42 (Aβ42), its deposition, accumulation, and plaque formation including Alzheimer's Disease, dementia and mild cognitive impairment as well as other neurodegenerative diseases such as Parkinson's Disease and ischemic stroke. | 04-28-2011 |
20110097348 | Protein Formulation - A composition comprises a biological molecule that is susceptible to aggregation, dimerisation or hydrolysis, wherein the ionic strength is less than 40 mM. | 04-28-2011 |
20110097349 | PHOSPHOINOSITIDE 3-KINASE INHIBITOR COMPOUNDS AND METHODS OF USE - Compounds of Formulas Ia-d where X is S or O, mor is a morpholine group, and R | 04-28-2011 |
20110097350 | METHODS EMPLOYING AND COMPOSITIONS CONTAINING DEFINED OXIDIZED PHOSPHOLIPIDS FOR PREVENTION AND TREATMENT OF ATHEROSCLEROSIS - Novel synthetic forms of etherified oxidized phospholipids and methods of utilizing same for preventing and treating atherosclerosis and other related disorders, as well as inflammatory disorders, immune mediated diseases, autoimmune diseases and proliferative disorders, are provided. In addition, methods of synthesizing etherified and esterified oxidized phospholipids and of using same for preventing and treating atherosclerosis and other related disorders are also provided. | 04-28-2011 |
20110104186 | Small molecule immunopotentiators and assays for their detection - The invention provides immunostimulatory compositions comprising a small molecule immuno-potentiator (SMIP) compound and methods of administration thereof. Also provided are methods of administering a SMIP compound in an effective amount to enhance the immune response of a subject to an antigen. Further provided are novel compositions and methods of administering SMIP compounds alone or in combination with another agent for the treatment of cancer, infectious diseases and/or allergies/asthma. In a further aspect, the invention relates generally to methods of screening for small molecule immuno-modulatory compositions. | 05-05-2011 |
20110104187 | METHOD OF TREATING GLYGOGEN STORAGE DISEASE - The present invention relates, in general, to Glycogen Storage Disease and, in particular, to a method of treating Glycogen Storage Disease-type-III and to compounds and compositions suitable for use in such a method. | 05-05-2011 |
20110104188 | NOVEL GLYCOLIPID AND USE THEREOF - The invention provides a glycolipid effective for cancer treatment and the like and a synthetic intermediate therefor, as well as a medicament containing the glycolipid and the like. The glycolipid is represented by the formula (1) or a salt thereof | 05-05-2011 |
20110104189 | COMPOSITIONS OBTAINED FROM CHLORELLA EXTRACT HAVING IMMUNOMODULATING PROPERTIES - The disclosed subject matter, in one aspect, relates to compounds and compositions {e.g., polysaccharides and polysaccharide complexes) and methods for providing and using such compounds and compositions. Disclosed are compositions comprising a polysaccharide or polysaccharide complex obtained from | 05-05-2011 |
20110110960 | Mannose-6-phosphate receptor mediated gene transfer into muscle cells - The invention relates to glycoside-compound conjugates for use in antisense strategies and/or gene therapy. The conjugates comprise a glycoside linked to a compound, in which the glycoside is a ligand capable of binding to a mannose-6-phosphate receptor of a muscle cell. For example the cells are muscle cells of a Duchenne Muscular Dystrophy (DMD) patient and the conjugate comprises an antisense oligonucleotide which causes exon skipping and induces or restores the synthesis of dystrophin or variants thereof. | 05-12-2011 |
20110110961 | PROLYL HYDROXYLASE INHIBITORS - Disclosed herein are prolyl hydroxylase inhibitors that can stabilize hypoxia inducible factor-1 alpha (HIF-1α), as well as hypoxia inducible factor-2 (HIF-2). Also disclosed herein are pharmaceutical compositions comprising one or more of the disclosed compounds. Yet further disclosed are methods for stimulating the cellular immune response in a mammal such as increasing phagocytosis, for example, prolonging the life of phagocytes, inter alia, kerotyiocytes, neutrophils. As such the disclosed compounds provide methods for treating diseases that relate to the body's immune response. | 05-12-2011 |
20110110962 | Novel Immunoadjuvant Flagellin-Based Compounds and Use Thereof - The present invention relates to novel peptide compounds derived from flagellin originating from | 05-12-2011 |
20110123555 | PREPARATION AND UTILITY OF CCR5 INHIBITORS - Disclosed herein are substituted 8-azabicyclo[3.2.1]octane-based anti-infective agents of Formula I, processes of preparation thereof, pharmaceutical compositions thereof, and methods of use thereof. | 05-26-2011 |
20110123556 | IMMUNOGEN PRIORITIZATION FOR VACCINE DESIGN - The present invention provides a method of prioritizing vaccine immunogens, using human iNKT-cell and B-cells, that enables screening of large numbers of immunogens simultaneously in-vitro for diseases and any other vaccine related application, that may then be further tested and improved upon in iterative application of the present technology and other methods of analyzing immunogens. The present invention encompasses the preparation and purification of immunogenic compositions which are formulated into the vaccines of the present invention. | 05-26-2011 |
20110123557 | ANTI-HMGA1 MONOCLONAL ANTIBODIES, PROCESS FOR THEIR PREPARATION AND THEIR USE FOR THE QUANTITATIVE DETERMINATION OF HMGA1 - This invention concerns a panel of monoclonal antibodies against the High Mobility Group A 1 protein (HMGA1) and a process for preparing them, as well as the use of said antibodies for the quantitative determination of HMGA1 in biological fluids or in protein Iy sates deriving from lymphocyte cells. This invention also concerns a diagnostic kit for assessing risk factors related to the expression of the HMGA1 proteins. | 05-26-2011 |
20110129485 | Modified Galectin-2 and Uses Thereof - An isolated modified galectin-2 protein comprising a mutation and/or modification which improves one or more properties of said isolated modified galectin-2 are provided. More particularly, the mutation of galectin-2 is substitution of cysteine 57, preferably with a methionine residue. Modification of an isolated galectin-2 includes a modification of cysteine 75. Modification includes chemical modification by PEGylation or alkylation. Also provided are isolated nucleic acid, genetic constructs comprising said isolated nucleic acids, antibodies, compositions and methods of modulating an immune response that may be useful in therapeutic and/or prophylactic treatment of disease, disorders or considers which involve an immune response is mediated by one or more cytokines or other soluble immunomodulators and/or the immune response is mediated by one or more cells of the immune system. | 06-02-2011 |
20110129486 | METHODS OF TREATING INFLAMMATORY COLON DISEASES - A method of treating ulcerative colitis or Crohn's disease in a subject in need thereof is disclosed. The method comprising administering to the subject a therapeutically effective amount of adherent cells from a placenta or adipose tissue, thereby treating the ulcerative colitis or Crohn's disease. | 06-02-2011 |
20110135668 | COMPOUNDS AND COMPOSITIONS AS PROTEIN KINASE INHIBITORS - The invention provides novel pyrimidine derivatives and pharmaceutical compositions thereof, and methods for using such compounds. For example, the pyrimidine derivatives of the invention may be used to treat, ameliorate or prevent a condition which responds to inhibition of anaplastic lymphoma kinase (ALK) activity, c-ros oncogene (ROS), insulin-like growth factor (IGF-1R), and/or insulin receptor (InsR) or a combination thereof. | 06-09-2011 |
20110135669 | SYNTHETIC AGONISTS OF TLR9 - The invention provides novel oligonucleotide-based compounds that individually provide distinct immune response profiles through their interactions as agonists with TLR9. The TLR9 agonists according to the invention are characterized by specific and unique chemical modifications, which provide their distinctive immune response activation profiles. | 06-09-2011 |
20110135670 | PURINE DERIVATIVES FOR USE IN THE TREATMENT OF ALLERGIC, INFLAMMATORY AND INFECTIOUS DISEASES - The present invention relates to compounds of formula (I): | 06-09-2011 |
20110135671 | PURINE DERIVATIVES FOR USE IN THE TREATMENT OF ALLERGIC, INFLAMMATORY AND INFECTIOUS DISEASES - The present invention relates to compounds of formula (I): | 06-09-2011 |
20110142862 | TRANSGENIC MICE HAVING A HUMAN MAJOR HISTOCOMPATIBILITY COMPLEX (MHC) PHENOTYPE, EXPERIMENTAL USES AND APPLICATIONS - The present invention relates to transgenic mice and isolated transgenic mouse cells, the mice and mouse cells comprising a disrupted H2 class I gene, a disrupted H2 class II gene, a functional HLA class I transgene, and a functional HLA class II transgene. In embodiments, the transgenic mouse or mouse cells are deficient for both H2 class I and class II molecules, wherein the transgenic mouse comprises a functional HLA class I transgene and a functional HLA class II transgene. In embodiments, the transgenic mouse or mouse cell has the genotype HLA-A2 | 06-16-2011 |
20110142863 | FLOW THROUGH PURIFICATION PROCESSES FOR LARGE BIOMOLECULES - The present invention relates, at least in part, to novel and improved flow-through purification processes for separating large biomolecules, such as, for example, encapsulated viruses, virus-like particles and conjugate vaccines from one or more contaminants in a sample, where the process employs the use of at least one population of a solid porous particle which comprises a minimized external surface area per unit volume of the particles and an internal surface area per unit volume which is not decreased by more than 25% relative to a population of a similar particle which does not have a minimized external surface area. | 06-16-2011 |
20110159019 | 2,4-DIAMINOPYRIMIDINE COMPOUND - Provided is a compound which is useful as an active ingredient for a pharmaceutical having a PKCθ inhibition activity, particularly a pharmaceutical composition for inhibiting acute rejection occurring in transplantation. The present inventors have conducted extensive studies on a compound having a PKCθ inhibition activity, and as a result, they have found that a compound having a structure such as aralkyl and the like on an amino group at the 2-position and also having a structure such as an adamantylalkyl group and the like on an amino group at the 4-position of 2,4-diaminopyrimidine, or a salt thereof has an excellent PKCθ inhibition activity, thereby completing the present invention. The 2,4-diaminopyrimidine compound of the present invention can be used as a PKCθ inhibitor or an inhibitor of acute rejection occurring in transplantation. | 06-30-2011 |
20110165183 | PIPERIDINE DERIVATIVES AS JAK3 INHIBITORS - The invention provides a compound of formula (I): wherein W is a bicyclic heteroaromatic group; or a salt thereof. The compounds and salts thereof have beneficial therapeutic properties (e.g. immunosuppressant properties). | 07-07-2011 |
20110177105 | Novel Selective Inhibitors of Ubiquitin Specific Protease 7, the Pharmaceutical Compositions Thereof and Their Therapeutic Applications - The present invention concerns the discovery of new selective inhibitors of ubiquitin specific proteases, their process of preparation and their therapeutic use. | 07-21-2011 |
20110177106 | Novel Therapeutic Methods for Treating Inflammation and Immune System Disorders - The subject invention provides novel and advantageous materials and methods for treating neuroinflammation, neurodegenerative disease, and cerebrovascular disease by modulating TNF-α and/or nitric oxide production. Specifically exemplified herein is the therapeutic use of senkyunolide A (Sen A) and Z-ligustilide (Z-Lig), compounds isolated from traditional Chinese medicinal material | 07-21-2011 |
20110177107 | PREDICTING AND REDUCING ALLOIMMUNOGENICITY OF PROTEIN THERAPEUTICS - Methods of predicting the immunogenicity of a therapeutic protein in a subject are provided and the use of this method in selecting a protein for replacement therapy having the fewest immunogenic epitopes. The method is demonstrated by reference to ADAMTS13. Isolated allelic variants of ADAMTS13 that contribute to the variability in risk for both arterial and venous thrombotic disease development are provided. The allelic variants are identified as single nucleotide polymorphisms (ns-SNPs) in the ADAMTS13 gene, which result in haplotypes identified as H1 to H14. A method for improving outcomes of transfusions/transplant products is also provided by selection of haplotype matched therapeutics. | 07-21-2011 |
20110177108 | LIPID COMPOUNDS FOR SUPRESSION OF TUMORIGENESIS - The present invention provides compounds, or pharmaceutically acceptable salts or analogs thereof, which exhibit anti-tumor activity. The present invention also includes methods for inhibiting the growth of cancer cells by contacting an effective amount of a compound of the present invention with the cancer cells in vitro or in vivo. | 07-21-2011 |
20110189210 | METHOD OF INHIBITING REMNANT LIPOPROTEIN PRODUCTION - The present invention aims at provision of a method for inhibiting remnant lipoprotein production and a remnant lipoprotein production inhibitor, which includes administering a compound having a CETP inhibitory activity to an administration subject. The remnant lipoprotein production inhibitor of the present invention contains a compound having a CETP inhibitory activity as an active ingredient. | 08-04-2011 |
20110189211 | STEM CELL POPULATIONS AND METHODS OF USE - The present invention relates to populations of stem cells, methods for isolating these stem cell populations, and methods repairing, regenerating, and reconstituting tissues using the these stem cell populations. The invention additionally relates to methods of screening agents that promote growth, engraftment, or differentiation of stem cells. | 08-04-2011 |
20110189212 | OXIDIZED LIPIDS AND USES THEREOF IN THE TREATMENT OF INFLAMMATORY DISEASES AND DISORDERS - Novel synthetic oxidized lipids and methods utilizing oxidized lipids for treating and preventing an inflammation associated with an endogenous oxidized lipid are provided. | 08-04-2011 |
20110195078 | TAT-BASED IMMUNOMODULATORY COMPOSITIONS AND METHODS FOR THEIR DISCOVERY AND USE - A method for identifying new immunomodulatory chemical entities (NICE) comprising reacting a candidate NICE with a Tat SH3 binding domain, identifying the bound candidate NICE and determining whether the candidate NICE induces monocytes to differentiate into dendritic cells (DC) or regulatory macrophages (AReg). In particular, the present invention relates to identifying NICE that are either immunostimulatory or immunosuppressive. | 08-11-2011 |
20110195079 | IMMUNIZATION PROTOCOL FOR DIRECTED EXPANSION AND MATURATION - A first antigen is administered to a subject to select progenitor B cells that are suitable for subsequent production of a desirable affinity-matured antibody, and then a second antigen is administered to stimulate the expansion of B cells that produce that affinity-matured antibody. An immunization protocol is used in which two different antigens are administered (usually in series, but in some embodiment simultaneously), where the first antigen elicits an efficient germline antibody response and the second antigen elicits an efficient and desired affinity-matured antibody response. | 08-11-2011 |
20110200625 | PHARMACEUTICAL COMPOSITION - A nonirritant, thickened pharmaceutical composition comprising a drug which is normally solid and which has anti-angiogenesis properties and/or immunosuppressant properties, a normally solid dermal penetration-facilitator for the drug, a solvent which is capable of dissolving the drug and the facilitator; and a thickening agent. | 08-18-2011 |
20110206706 | VACCINE AND METHOD FOR TREATMENT OF NEURODEGENERATIVE DISEASES - Methods and compositions are provided for treatment of neurodegenerative diseases in which there is accumulation of misfolded and/or aggregated proteins, excluding prion diseases. In particular, the invention relates to treatment of the neurodegenerative diseases Huntington's disease (HD), Alzheimer's disease (AD) or Parkinson's disease (PD), by administration of an agent selected from the group consisting of (i) Copolymer 1, (ii) a Copolymer 1-related peptide, (iii) a Copolymer 1-related polypeptide, and (iv) T cells activated with (i), (ii) or (iii). | 08-25-2011 |
20110206707 | Method for stimulating a host immune system - A method of manipulating allogeneic cells for use in allogeneic cell therapy protocols is described. The method provides a composition of highly activated allogeneic T-cells which are infused into immunocompetent cancer patients to elicit a novel anti-tumor immune mechanism called the “Mirror Effect”. In contrast to current allogeneic cell therapy protocols where T-cells in the graft mediate the beneficial graft vs. tumor (GVT) and detrimental graft vs. host (GVH) effects, the allogeneic cells of the present invention stimulate host T-cells to mediate the “mirror” of these effects. The mirror of the GVT effect is the host vs. tumor (HVT) effect. The “mirror” of the GVH effect is the host vs. graft (HVG) effect. The effectiveness and widespread application of the anti-tumor GVT effect is limited by the severe toxicity of the GVH effect. In the present invention, the anti-tumor HVT effect occurs in conjunction with a non-toxic HVG rejection effect. The highly activated allogeneic cells of the invention can be used in methods to stimulate host immunity. The method includes a complete HLA mis-matched setting in patients that have not had a prior bone marrow transplant or received chemotherapy and/or radiation conditioning regimens. | 08-25-2011 |
20110206708 | Method for stimulating a therapeutic immune effect in a patient - A method of manipulating allogeneic cells for use in allogeneic cell therapy protocols is described. The method provides a composition of highly activated allogeneic T-cells which are infused into immunocompetent cancer patients to elicit a novel anti-tumor immune mechanism called the “Mirror Effect”. In contrast to current allogeneic cell therapy protocols where T-cells in the graft mediate the beneficial graft vs. tumor (GVT) and detrimental graft vs. host (GVH) effects, the allogeneic cells of the present invention stimulate host T-cells to mediate the “mirror” of these effects. The mirror of the GVT effect is the host vs. tumor (HVT) effect. The “mirror” of the GVH effect is the host vs. graft (HVG) effect. The effectiveness and widespread application of the anti-tumor GVT effect is limited by the severe toxicity of the GVH effect. In the present invention, the anti-tumor HVT effect occurs in conjunction with a non-toxic HVG rejection effect. The highly activated allogeneic cells of the invention can be used to stimulate host immunity in a complete HLA mis-matched setting in patients that have not had a prior bone marrow transplant or received chemotherapy and/or radiation conditioning regimens. | 08-25-2011 |
20110217322 | Automated Vaccination Method and System - The automated vaccination system enables an operator to effectively vaccinate large numbers of poultry by motivating the poultry to congregate, and then spraying a vaccination solution in the area of the congregated poultry. In the preferred embodiment, drinking water is withheld from the poultry. The drinking water is then restored so that the poultry congregate around the drinking line. As the poultry gather around the drinking line, a spray bar sprays vaccination solution around the poultry so that the poultry inhale the vaccination solution and are successfully vaccinated. | 09-08-2011 |
20110217323 | IMIDAZOQUINOLINE COMPOUNDS - The invention provides novel compositions comprising imidazoquinoline compounds. Also provided are methods of administering the compositions in an effective amount to enhance the immune response of a subject. Further provided are novel compositions and methods of administering the compositions in combination with (an) other agent(s). | 09-08-2011 |
20110229498 | COMPOSITIONS AND METHODS FOR MODULATING AN IMMUNE RESPONSE - The invention generally features compositions and methods for modulating an immune response. In particular embodiments, such compositions and methods modulate regulatory T cell suppressive activity. | 09-22-2011 |
20110229499 | METHOD FOR TREATMENT OF VASCULAR HYPERPERMEABILITY - A method for treating or preventing hemorrhagic shock comprising administering a composition comprising stem cells or a soluble factor produced by stem cells, such as stem cell factor (SCF) to a subject. For example, stem cells for use according to the invention can express elevated levels of an anti-apoptotic protein. | 09-22-2011 |
20110229500 | PURINE DERIVATIVES FOR USE IN THE TREATMENT OF ALLERGIC, INFLAMMATORY AND INFECTIOUS DISEASES - The present invention relates to compounds of formula (I): | 09-22-2011 |
20110229501 | ORGANIC COMPOUNDS - The present invention relates to crystalline forms and hydrates of 2-Amino-2-[2-(4-C | 09-22-2011 |
20110229502 | Ablative immunotherapy - The invention disclosed herein relates generally to immunotherapy and, more specifically, to the use of immunotherapy for treating tumors and pathogen infected tissues by first priming patients with allogeneic cells designed to be rejected by a Th1 mediated mechanism, then inducing necrosis or apoptosis in a tumor or pathogen infected lesion by methods such as cryotherapy, irreversible electroporation, chemotherapy, radiation therapy, ultrasound therapy, ethanol chemoablation, microwave thermal ablation, radiofrequency energy or a combination thereof applied against at least a portion of the tumor or pathogen infected tissue, and then delivering one or more doses of allogeneic cells (e.g., Th1 cells) within or proximate to the tumor or pathogen-infected tissue in the primed patient. The present invention provides an immunotherapeutic strategy to develop de-novo systemic (adaptive) immunity to a tumor or pathogen. | 09-22-2011 |
20110236404 | Methods for Protein Expression in Mammalian Cells in Serum-Free Medium - Disclosed are compositions and methods for increasing the longevity of a cell culture and permitting the increased production of proteins, preferably recombinant proteins, such as antibodies, peptides, enzymes, growth factors, interleukins, interferons, hormones, and vaccines. Cells transfected with an apoptosis-inhibiting gene or vector, such as a triple mutant Bcl-2 gene, can survive longer in culture, resulting in extension of the state and yield of protein biosynthesis. Such transfected cells exhibit maximal cell densities that equal or exceed the maximal density achieved by the parent cell lines. Transfected cells can also be pre-adapted for growth in serum-free medium, greatly decreasing the time required to obtain protein production in serum-free medium. In certain methods, the pre-adapted cells can be used for protein production following transfection under serum-free conditions. In preferred embodiments, the cells of use are SpESF or SpESF-X cells. | 09-29-2011 |
20110236405 | COAGULATION FACTOR MODULATION FOR CONTROLLING TRANSPLANT ORGAN SIZE - A method of modulating transplant organ size in a subject in need thereof is disclosed. The method comprising: (a) administering to the subject an agent capable of modulating an activity or expression of a coagulation factor or an effector thereof; and (b) transplanting the organ into the subject; thereby modulating the transplant organ size in the subject. | 09-29-2011 |
20110243968 | THERAPEUTIC APPLICATIONS OF P53 ISOFORMS IN REGENERATIVE MEDICINE, AGING AND CANCER - The present invention provides methods and compositions for modulating cell senescence and cell proliferation using isoforms of the p53 tumor suppressor protein. The methods and compositions of the invention find use in inhibiting cancer cell growth or in generating populations of cells for tissue regeneration through the modulation of cell senescence and proliferation. | 10-06-2011 |
20110243969 | PRODUCTION OF SQUALENE FROM HYPER-PRODUCING YEASTS - A method for preparing purified yeast is disclosed, where the squalene source is a yeast that hyper-produces squalene. The squalene is useful for pharmaceutical purposes. For instance, it can be used to prepare an oil-in-water emulsion, and the emulsion is particularly suitable for use as an immunological adjuvant. | 10-06-2011 |
20110243970 | COMPOSITION FOR INHIBITION OF TRANSPLANT REJECTION CONTAINING THE CORDYCEPS MYCELLIA EXTRACT AS AN ACTIVE INGREDIENT - Disclosed is a composition for the inhibition of transplant rejection and the treatment of skin diseases, comprising a cordyceps mycellia extract as an active ingredient. The cordyceps mycellia extract significantly suppresses the production of antibodies to transplants without side effects, such as weight change. Based on natural material, the composition is non-toxic and harmless to the human body and thus can be used as an immunosuppressant for organ transplantation. Also, it stops oozing from sores and is useful in the treatment of skin diseases, including atopy, allergic reactions, decubitus ulcers, pemphigus and smallpox. | 10-06-2011 |
20110243971 | Vaccines - The invention relates to a vaccine composition comprising an antigen, an immunologically active saponin fraction and a sterol. | 10-06-2011 |
20110250217 | METHODS AND COMPOSITIONS FOR ELICITING AN AMYLOID-SELECTIVE IMMUNE RESPONSE - The present invention involves methods and compositions for treating, preventing, and diagnosing amyloid-associated diseases and conditions, as well as methods and compositions for making antigens that elicit antibodies which selectively or specifically bind amyloid prefibrillar oligomers or protofibrillar aggregates over monomers or fibrils of the same amyloid. | 10-13-2011 |
20110250218 | Disease-Associated Antigens and Methods of Use Thereof - The present disclosure provides synthetic antibodies specific for a disease-associated antigen, and methods of using the antibodies in disease therapy. The present disclosure further provides diagnostic assays involving detecting the presence and/or level in biological sample of an antibody specific for a disease-associated antigen. | 10-13-2011 |
20110256158 | NOVEL USE OF AN IL-12 RECEPTOR SPLICE VARIANT AND MOLECULAR ASSAY TO QUANTIFY EXPRESSION THEREOF - The present invention describes compositions for both diagnostic and therapeutic applications. In one embodiment, the present invention contemplates a vaccine formulation comprising an antigen and IL12Rβ1 isoform 2. In some embodiments, this invention relates to a method of quantifying the ratio of IL12Rβ1 transcript and a splice variant thereof in a sample, including but not limited to at the cDNA level. In other embodiments, this invention relates to a method of augmenting an immune response by administering, inhibiting and/or inducing IL12Rβ1 isoform 2. | 10-20-2011 |
20110256159 | ADHERENT CELLS FROM PLACENTA TISSUE AND USE THEREOF IN THERAPY - A method of culturing adherent cells from a placenta or adipose tissue is disclosed. The method comprising culturing the adherent cells from the placenta or adipose tissue under 3 dimensional (3D) culturing conditions which allow cell expansion, the conditions comprising perfusion. | 10-20-2011 |
20110256160 | ADHERENT CELLS FROM PLACENTA TISSUE AND USE THEREOF IN THERAPY - A method of culturing adherent cells from a placenta or adipose tissue is disclosed. The method comprising culturing the adherent cells from the placenta or adipose tissue under 2 dimensional (2D) culturing conditions which allow cell expansion, the conditions comprising continuous passaging of the cells for at least 4 passages. | 10-20-2011 |
20110256161 | METHODS FOR ENHANCING IMMUNE RESPONSE - This disclosure demonstrates a novel therapy immunological approach using polyamine-based therapy (PBT) for relieving tumor-induced suppression of the patient's immune system. The demonstration of the pharmacological release from the naturally occurring polyamine-mediated immune suppression offers profound impact on the immunotherapy of cancer together with a variety of diseases caused by the disease-causing vector's ability to evade an immune reaction. This therapeutic approach is equally applicable to disease states whereby immune system suppression by polyamines has been demonstrated including; bacterial infections, parasitic infections including malaria and typanosomiasis, viral infections, peptic ulcers and gastric cancer due to | 10-20-2011 |
20110256162 | PLASMIDS CODING FOR P185NEU PROTEIN SEQUENCE VARIANTS AND THERAPEUTIC USES THEREOF - DNA plasmids containing sequences coding for different fragments of 185 | 10-20-2011 |
20110262467 | Novel Artificial Antigen Presenting Cells and Uses Therefor - The invention relates to novel artificial antigen presenting cells (aAPCs). The aAPC comprises at least one stimulatory ligand and at least one co-stimulatory ligand where the ligands each specifically bind with a cognate molecule on a T cell of interest, thereby mediating expansion of the T cell. The aAPC of the invention can further comprise additional molecules useful for expanding a T cell of interest. The aAPC of the invention can be used as an “off the shelf” APC that can be readily designed to expand a T cell of interest. Also, the aAPC of the invention can be used identify the stimulatory, co-stimulatory, and any other factors that mediate growth and expansion of a T cell of interest. Thus, the present invention provides powerful tools for development of novel therapeutics where activation and expansion of a T cell can provide a benefit. | 10-27-2011 |
20110262468 | Method for Monitoring Vaccine Response Using Single Cell Network Profiling - The present invention provides methods for determining safety and efficacy of a vaccine by monitoring cellular pathways prior to and after vaccine treatment using single cell network profiling | 10-27-2011 |
20110268752 | Inducible Regulatory T-Cell Generation for Hematopoietic Transplants - The present invention provides methods and compositions for converting non-Tregs into Tregs. The converted Tregs are referred to as inducible Tregs (iTregs). The iTregs are useful for preventing, suppressing, blocking or inhibiting an immune response. For example the iTregs are useful for preventing rejection of a transplanted tissue in a human or other animal host, or protecting against graft vs host disease. The iTregs can also be used to treat autoimmune diseases. | 11-03-2011 |
20110268753 | PROCESS FOR REGULATING IMMUNE RESPONSE - The discovery of FcγRIIc expression on B-cells allows several new methods of prediction or regulation of immune responses. A process of altering an immune response in a subject is provided by altering the expression level or activity of FcγRIIc on a cell. The relative ratio of activating FcγRIIc to inhibitory FcγRIIb levels in an immune cell allows prediction of the presence or absence of immune disease or abnormality such as rheumatoid arthritis or systemic lupus erythematosus. Inventive processes are provided whereby the relative levels of activating to inhibitory receptor expression in a subject is compared to an established inventive classification system to predict an immune response to a therapeutic, the presence or absence of disease, or the magnitude, duration, or timing of an immune response in the subject. | 11-03-2011 |
20110268754 | IMMUNOTHERAPY WITH IN VITRO-SELECTED ANTIGEN-SPECIFIC LYMPHOCYTES AFTER NONMYELOABLATIVE LYMPHODEPLETING CHEMOTHERAPY - A method of promoting the regression of a cancer in a mammal comprising: (i) administering to the mammal nonmyeloablative lymphodepleting chemotherapy, and (ii) subsequently administering: (a) autologous T-cells, which have been previously isolated, selected for highly avid recognition of an antigen of the cancer, the regression of which is to be promoted, and rapidly expanded in vitro only once, and, either concomitantly with the autologous T-cells or subsequently to the autologous T-cells, by the same route or a different route, a T-cell growth factor that promotes the growth and activation of the autologous T-cells, or (b) autologous T-cells, which have been previously isolated, selected for highly avid recognition of an antigen of the cancer, the regression of which is to be promoted, modified to express a T-cell growth factor that promotes the growth and activation of the autologous T-cells, and rapidly expanded in vitro only once, whereupon the regression of the cancer in the mammal is promoted. | 11-03-2011 |
20110274706 | NUCLEIC ACID DELIVERY VEHICLE AND USES THEREOF - A nucleic acid-delivery vehicle for delivering nucleic acids to target cells is provided. The nucleic acid-delivery vehicle comprises a plurality of nanoparticles; and a plurality of nucleic acids. The nanoparticles further comprises one or more signal peptides attached to the nanoparticles. The nanoparticles and the nucleic acids are agglomerated to form a nucleic acid-granulation particle having a dimension of at least 20 nm. Methods of making the nucleic acid-delivery vehicle and kits comprising nucleic acid-delivery vehicle are also provided. | 11-10-2011 |
20110274707 | COMPOSITION FOR IMPROVING INFLAMMATORY DISEASE USING ABH ANTIGENS - The present invention relates to a composition for improving inflammatory disease, and more specifically to a composition for improving inflammatory disease able to improve inflammatory reactions and the barrier function of epithelial tissue such as the skin, to enhance aging resistance and skin elasticity and to prevent or treat aging. The present invention makes it possible to control inflammatory reactions by modulating the expression and modulating the activity of ABH antigens, and thus the composition of the present invention can be employed as a development marker for therapeutic agents designed to soothe or treat or help in the treatment of disease caused by inflammatory reaction in body tissue and notably the skin expressed by ABH antigens, and can be used in the development of external preparations and cosmetics containing external preparations designed for the purposes such as restoration of normal function and moisturization, wrinkle enhancement, whitening and elasticity recovery in skin through modulation of differentiation of keratinocytes and the skin barrier function. | 11-10-2011 |
20110280893 | SYNTHETIC LIPID A DERIVATIVE - The invention provides functionalized monosaccharides and disaccharides suitable for use in synthesizing a lipid A derivative, as well as methods for synthesizing and using a synthetic lipid A derivative. | 11-17-2011 |
20110280894 | HER2/NEU SPECIFIC T CELL RECEPTORS - The present invention is directed to T cell receptors (TCR) recognizing antigenic peptides derived from Her2/neu, in particular peptide 369, and being capable of inducing peptide specific killing of a target cell overexpressing HER2/neu. The present invention is further directed to an antigen specific T cell, comprising said TCR, to a nucleic acid coding for said TCR and to the use of the antigen specific T cells for the manufacture of a medicament for the treatment of malignancies characterized by overexpression of HER2/neu. The present invention is further disclosing a method of generating antigen specific T cells. | 11-17-2011 |
20110280895 | IMMUNOTHERAPEUTIC METHOD USING ALLO-CELLS WHICH CO-EXPRESS CD1d AND TARGET ANTIGEN - The present invention provides a means to be used for a new immunotherapy of cancer or infection utilizing activation of dendritic cell (DC) by innate immunity, namely, a method of preparing a cell co-expressing a target antigen and CD1d and having an ability to activate immunity against the target antigen, comprising the following steps (a) and (b): | 11-17-2011 |
20110287037 | MICROORGANISMS AS CARRIERS OF NUCLEOTIDE SEQUENCES CODING FOR ANTIGENS AND PROTEIN TOXINS, PROCESS OF MANUFACTURING AND USES THEREOF - The invention relates to a microorganism as a carrier of nucleotide sequences coding for antigens and protein toxins comprising the following components: (I) at least one nucleotide sequence coding for at least one complete or partial antigen of at least one wild-type or mutated protein; and (II) at least one nucleotide sequence coding for at least one protein toxin and/or at least one protein toxin subunit; and (III) a) at least one nucleotide sequence coding for at least one transport system which enables the expression of the expression products of component (I) and component (II) on the outer surface of the microorganism and/or enables the secretion of the expression products of component (I) and component (II); and/or coding for at least one signal sequence which enables the secretion of the expression products of component (I) and component (II); and/or (III) b) optionally, at least one nucleotide sequence coding for at least one protein for lysing the microorganism in the cytosol of mammalian cells and for intracellularly releasing plasmids or expression vectors, which are contained in the lysed microorganism; and (IV) at least one nucleotide sequence for at least one activation sequence for the expression of one or more of components (I) to (III), wherein said activation sequence can be activated in the microorganism and/or is tissue cell-specific, tumor cell-specific, macrophage-specific, dendrite-specific, lymphocyte-specific, function-specific or non-cell-specific”; wherein any of components (I) to (IV) can be present either once or several times and either identical or different. Also disclosed are a process of manufacturing thereof, corresponding plasmids or expression vectors and uses of the microorganism as a medicament. | 11-24-2011 |
20110287038 | METHOD FOR TREATING SOLID TUMORS - Provided herein are methods for treating a solid tumor in a subject in need thereof by activating an immune response against a tumor antigen. Also provided are methods for treating a solid tumor in a subject in need thereof by activating antigen-presenting cells and eliciting an immune response against a tumor antigen. Also provided herein are optimized therapeutic treatments of solid tumors, which comprise determining the presence, absence or amount of a biomarker after the therapy has been administered, and determining whether a subsequent dose of the therapy should be maintained, increased, or decreased based on the biomarker assessment. | 11-24-2011 |
20110287039 | EXPRESSION SYSTEM FOR MODULATING AN IMMUNE RESPONSE - The present invention discloses methods and compositions for modulating the quality of an immune response to a target antigen in a mammal, which response results from the expression of a polynucleotide that encodes at least a portion of the target antigen, wherein the quality is modulated by replacing at least one codon of the polynucleotide with a synonymous codon that has a higher or lower preference of usage by the mammal to confer the immune response than the codon it replaces. | 11-24-2011 |
20110293640 | Cholinesterase Inhibitors for Treating Inflammation - A method of treating a subject with a cytokine-mediated inflammatory disorder comprising administering to the subject an effective amount of a pharmaceutically acceptable cholinesterase inhibitor, provided that the inhibitor is not galantamine. | 12-01-2011 |
20110293641 | A VACCINIA VIRUS PROTEIN A46 PEPTIDE AND USE THEREOF - A peptide for inhibiting Toll-like receptor 4 (TLR4) signalling comprising the amino acid sequence of SEQ ID NO. 4, SEQ ID NO 55, SEQ ID NO 68, SEQ ID NO. 69, SEQ ID NO 70, SEQ ID NO 71, SEQ ID NO 72, SEQ ID NO 79, SEQ ID NO 82, SEQ ID NO 85, SEQ ID NO 88, SEQ ID NO 91, SEQ ID NO 94, SEQ ID NO 97, SEQ ID NO 100, SEQ ID NO 103, SEQ ID NO 106, SEQ ID NO 109, SEQ ID NO 112, or SEQ ID NO 115. The peptide may comprise a delivery sequence such as a cationic peptide. | 12-01-2011 |
20110293642 | Modulation of Splenocytes in Cell Therapy - The invention provides methods for treating pathological conditions associated with an undesirable inflammatory component. The invention is generally directed to reducing inflammation by administering cells that have one or more of the following effects in an injured subject: interact with splenocytes, preserve splenic mass, increase proliferation of CD4 | 12-01-2011 |
20110293643 | COMPOUNDS AND METHODS FOR INHIBITING MMP2 AND MMP9 - The present invention relates to specific inhibitors of MMP2 and MMP9 and their use in immunosuppression. | 12-01-2011 |
20110300164 | IMMUNOSTIMULATORY DNA:RNA OLIGONUCLEOTIDES - Immunostimulatory sequence-specific RNA oligonucleotides corresponding to 3′ terminal sequences of single-stranded minus-sense RNA genomic RNAs are provided. Also provided are compositions and methods relating to an immunostimulatory 4-mer RNA motif provided as 5′-C/U-U-G/U-U-3′. Incorporation of this short RNA motif is sufficient to confer new and altered immunostimulatory properties in new and existing oligonucleotides, including CpG oligodeoxynucleotides. Also provided are methods for use of the immunostimulatory RNA oligonucleotides and DNA:RNA chimeric oligonucleotides of the invention to induce an immune response in vitro and in vivo, as well as to treat allergy, asthma, infection, and cancer in a subject. Single-stranded oligoribonucleotides of the invention are believed to signal through a Toll-like receptor (TLR) chosen from TLR9, TLR8, TLR7, and TLR3. The oligoribonucleotides can also be used in a method to screen for TLR antagonists. | 12-08-2011 |
20110300165 | SUBSTITUTED ISOXAZOLE COMPOUNDS - Disclosed are compounds of Formula (I) | 12-08-2011 |
20110300166 | Vaccine Compositions for Inducing Immune Responses Against Components of Drusen - Disclosed are compositions and methods for treating or preventing the formation of drusen in a patient in need thereof. The compositions include an effective amount of at least one polypeptide present in drusen, or an immunogenic fragment or variant thereof that induces an immune response against the polypeptide, together with a pharmaceutical carrier, excipient, or diluent. The compositions are suitable as vaccines for treating or preventing drusen and diseases associated with drusen. | 12-08-2011 |
20110305717 | CULTURED MYELOID DENDRITIC CELLS ISOLATED FROM PEYER'S PATCHES AND USES THEREOF - Cultured lysozyme-secreting myeloid dendritic cells isolated from the subepithelial dome of Peyer's patches in the small intestine are provided. The myeloid dendritic cells are used in screening methods to identify agents which interact with myeloid dendritic cells, for example, antigens, allergens, antimicrobial agents, or agents that modulate the activity of myeloid dendritic cells. The cells are also used to identify agents which bind to and/or are taken up by myeloid dendritic cells, and which can act as delivery vehicles for delivering substances of interest to myeloid dendritic cells in vivo. | 12-15-2011 |
20110305718 | Recombinant Protein Body-Inducing Polypeptides - Polypeptide sequences for inducing recombinant protein bodies are described. The sequences comprise a polyproline II (PPII) structure and/or a proline-rich sequence between two cysteine residues on either end. Recombinant protein bodies are useful for protein production because they allow for simple and efficient purification of high quantities of recombinant protein. In addition, other methods of using recombinant protein bodies, for example, in vaccination and food products, are also described. | 12-15-2011 |
20110305719 | Inhibition of Pro-Inflammatory Cytokine Induced Response - Method and compositions for reducing the inflammation after cytokine exposure of an islet cell transplant without affecting the viability and potency are disclosed herein. The present invention describes a composition comprising Withaferin A (WA), a steroidal lactone derived from | 12-15-2011 |
20110311559 | METHOD OF IDENTIFYING CD4+ CD25+ T-CELLS ACTIVATED TO AN ANTIGEN WHICH EXPRESS CD8 - The invention relates to a method of identifying CD4 | 12-22-2011 |
20110311560 | Methods and Compositions Relating to CCR5 Antagonist, IFN-Gamma and IL-13 Induced Inflammation - The present invention includes compositions and methods for the treatment of Th1 and/or Th2 mediated inflammatory diseases, relating to inhibiting CCR5. This is because the present invention demonstrates, for the first time, that expression of IFN-γ, IL-13, and CCR5, mediates and/or is associated with Th1 and/or Th2 inflammatory diseases and that inhibiting CCR5 treats, and even prevents, the diseases. Thus, the invention relates to the novel discovery that inhibiting CCR5 treats and prevents Th1 and/or Th2 mediated inflammatory disease. | 12-22-2011 |
20110311561 | NON-NATURAL MIC PROTEINS - This invention describes soluble, monovalent, non-natural protein molecules that can activate NK cells and certain T-cells to attack specific cellular target cells by attaching the NKG2D-binding portions of monovalent MICA or MICB protein, i.e. their α1-α2 platform domain, to the intended target cell specifically. The α1-α2 domain is contiguous with a heterologous α3 domain that has been genetically modified to bind directly or indirectly to the extracellular aspect of the target cell, thereby serving as the targeting domain. The genetic modification to create a non-natural and non-terminal targeting motif within the α3 domain can include a portion of an antibody, another protein molecule or portion thereof, a peptide, or a non-natural, modified α3 domain of a MIC protein. | 12-22-2011 |
20110311562 | Glycolipid Mixture with Anti-Inflammatory Activity Obtained from Oscillatoria Planktothrix - It was observed that a highly purified preparation of polar glycolipids extracted from cells of the cyanobacterium | 12-22-2011 |
20120003250 | PHARMACEUTICAL COMPOSITION WITH IMMUNOMODULATING FUNCTION - A pharmaceutical composition with an immunomodulating function is provided, including an extract of | 01-05-2012 |
20120003251 | ENHANCED IMMUNOGENICITY OF TUMOR ASSOCIATED ANTIGENS BY ADDITION OF ALPHAGAL EPITOPES - The invention relates to methods and compositions for causing the selective targeting and killing of tumor cells. The present invention describes prophylactic or therapeutic cancer vaccines based on purified TAA proteins or TAA-derived synthetic peptides altered by chemical, enzymatic or chemo-enzymatic methods to introduce αGal epi topes or αGal glycomimetic epitopes, in order to allow for enhanced opsonization of the antigen by natural anti-αGal antibodies to stimulate TAA capture and presentation, thereby inducing a humoral and cellular immune response to the TAA expressed by a tumor. The animal's immune system thus is stimulated to produce tumor specific cytotoxic cells and antibodies which will attack and kill tumor cells present in the animal. | 01-05-2012 |
20120009206 | NOVEL DOUBLE-STRANDED RIBONUCLEIC ACIDS WITH RUGGED PHYSICO-CHEMICAL STRUCTURE AND HIGHLY SPECIFIC BIOLOGIC ACTIVITY - A novel form of Rugged dsRNA with a unique composition and physical characteristics was identified with high specificity of binding to TLR3, which conveys an important range of therapeutic opportunities. Unlike the previous known antiviral Ampligen® (poly I, poly C12,U) the new and improved form (poly I, poly C | 01-12-2012 |
20120009207 | Complete human monoclonal IgG4lambda specific for CTLA-4 and uses thereof for detection of soluble CTLA-4 and isolation of regulatory cells - The present invention provides a CTLA-4 non-blocking agent of a complete human antibody nature, thus is non-immunogenic in a human. The immunoassay method using such a non-blocking agent measures the CTLA-4 content in a sample of a human subject. The present invention further provides a novel method for isolating human regulatory T cells. The resultant enriched and depleted cellular populations are useful in treating or ameliorating of human diseases. | 01-12-2012 |
20120009208 | USE OF MEMBRANE ATTACK COMPLEX (MAC) AND IMMUNE COMPLEXES (ICs) TO ACTIVATE T-CELLS AND THE GENERATION OF REGULATORY T CELLS - The invention describes the use of antigen-antibody complexes also known in the field as immune complexes to activate T cells and their potential to differentiate them into effector T cells for use in therapy. It also describes a process to achieve benefit from disrupting this T cell activation mediated by antigen-antibody complex and sublytic MAC of the complement system. | 01-12-2012 |
20120014976 | COMPOSITIONS AND METHODS FOR ENHANCING IMMUNE RESPONSES TO VACCINES - The disclosure provides adjuvants, immunogenic compositions, and methods useful for vaccination and immune response. In particular, the disclosure provides a class of adjuvants comprising cationic lipid:co-lipid mixtures and methods for delivering formulated compositions. | 01-19-2012 |
20120027786 | GENETICALLY PROGRAMMABLE PATHOGEN SENSE AND DESTROY - Aspects of the invention relate to compositions and methods for using recombinant cells to sense and destroy specific pathogens. | 02-02-2012 |
20120027787 | PLANT DERIVED SEED EXTRACT RICH IN ESSENTIAL FATTY ACIDS DERIVED FROM PERILLA SEED: COMPOSITION OF MATTER, MANUFACTURING PROCESS AND USE - A composition of matter comprises a shelf stable, super critical, CO | 02-02-2012 |
20120034248 | NOVEL AGONISTS OF TOLL-LIKE RECEPTOR 3 AND METHODS OF THEIR USE - TLR3 agonist compounds, compositions and methods are provided for stimulating the activity of TLR3. The compositions comprise oligonucleotide-based compounds that bind to and activate TLR3. The compositions may also comprise oligonucleotide-based compounds that bind to and activate TLR3 in combination with other therapeutic and/or prophylactic compounds and/or compositions. Methods of using these compounds and compositions for stimulation of TLR3 activity and for prevention or treatment of diseases wherein modulation of TLR3 activity would be beneficial are provided. | 02-09-2012 |
20120034249 | Methods for Treating Progressive Multifocal Leukoencephalopathy (PML) - The present invention relates generally to the treatment of PML by infusion of activated and expanded autologous lymphocytes. | 02-09-2012 |
20120034250 | CONDENSED PYRROLOPYRIDINE DERIVATIVE | 02-09-2012 |
20120039917 | IMMUNOMODULATING ACTIVITIES - Composition of isoflavonoids and chromanols and use of them as immunomodulators and as inhibitors of T-cell or T-lymphocyte proliferation. Treatment of disorders involving abnormal proliferation or activity of T cells. Formula (I) where A is hydrogen or optionally substituted phenyl and R1 represents hydroxy, alkoxy, halo or an ester and R2-R8 represent hydogen, hydroxy, alkyl etc. | 02-16-2012 |
20120039918 | Composition for Enhancing Immunity Containing Plant Stem Cell Line Derived from Cambium of Panax Ginseng Including Wild Ginseng or Ginseng as an Active Ingredient - The present invention relates to a composition for enhancing immunity, comprising one or more of the following: a homogenous cell line, and a lysate, an extract and a culture medium thereof as an active ingredient. The homogenous cell line, the lysate, the extract and the culture thereof according to the present invention, which are derived from a natural product, minimize adverse side effects of prior immune enhancing agents and safe for the human body. Further, they effectively increase the activity of NK cells responsible for innate immunity, as well as increase the proliferation rate of lymph node cells when the cells were re-exposed to an antigen in a specific immune reaction to enhance acquired immunity, and thus are useful as an immune enhancing agent. In particular, the homogenous cell line, the lysate, the extract, and the culture thereof according to the present invention also effectively increase the number of hone marrow cells, thus are not only used as an adjuvant in an immune reaction, but also used in the prevention and treatment of anemia through hematopoiesis. | 02-16-2012 |
20120039919 | DIABETES DIAGNOSTIC, PROPHYLACTIC, AND THERAPEUTIC COMPOSITIONS AND METHODS - As described below, the present invention features compositions and methods featuring Pdx-1 polypeptides and fragments thereof for the diagnosis, prevention and treatment of diabetes. | 02-16-2012 |
20120039920 | HYDROPHOBIC MONOMERS, HYDROPHOBICALLY-DERIVATIZED SUPPORTS, AND METHODS OF MAKING AND USING THE SAME - A composition is disclosed comprising a hydrophobic monomer having the structure: CH | 02-16-2012 |
20120045460 | METHODS AND COMPOSITIONS FOR TREATMENT OF GRAFT REJECTION AND PROMOTION OF GRAFT SURVIVAL - Embodiments of the present invention illustrate methods of treating and preventing transplantation and side effects associated with transplantation. In certain embodiments, compositions and methods relate to inhibition of graft rejection and promotion of graft survival. Thus, the invention relates to modulation of cellular activities, including graft rejection, promotion of graft survival, graft versus host rejection, islet cell preservation and conditions commonly associated with graft rejection. Other embodiments relate to the inhibitory compounds comprising naturally occurring and man-made inhibitors of serine protease and inducers of other alpha1-antitrypsin activities. | 02-23-2012 |
20120045461 | Compositions and Methods for Inducing an Immune Response in a Mammal and Methods of Avoiding an Immune Response to Oligonucleotide Agents Such as Short Interfering RNAs - Tis invention provides oligonucleotide agents that modulate an immune response by stimulating IFN production and methods of using such agents for therapeutic treatments of mammals. | 02-23-2012 |
20120045462 | Inflammation Inhibiting Compounds - The present invention relates to the use of compounds selected from the group consisting of Lys-(D)Pro-Thr, N-acyl Lys-(D)Pro-Thr, C-amide Lys-(D)Pro-Thr, and C-esters of Lys-(D)Pro-Thr; or a pharmaceutically acceptable salt of said compound fort he treatment of inflammatory disorders. The invention also relates to the use of αMSH for inducing tolerance. | 02-23-2012 |
20120058132 | Treatment of glycogen storage disease type II - Methods of treating glycogen storage disease type II, by administering acid α-glucosidase, are described, as are compositions for use in treatment of glycogen storage disease type II. | 03-08-2012 |
20120058133 | INHIBITION OF TRNA SYNTHETASES AND THERAPEUTIC APPLICATIONS THEREOF - The present invention provides novel methods for modulating Th 17-mediated immune responses using aminoacyl tRNA synthetase inhibitors. Inhibition of aminoacyl tRNA synthetase inhibitors activates an amino acid starvation response (AAR) and can produce beneficial therapeutic effects. In some embodiments, aminoacyl tRNA synthetase inhibitors are used to treat disorders such as autoimmune diseases, graft rejection, infections, fibrosis, and inflammatory diseases. | 03-08-2012 |
20120058134 | METHOD FOR FERMENTATION AND CULTIVATION, FERMENTED PLANT EXTRACT, FERMENTED PLANT EXTRACT POWDER, AND COMPOSITION CONTAINING THE EXTRACT OF FERMENTED PLANT - For the purpose of providing a method of safely and inexpensively producing a fermented plant extract containing an immunopotentiator at a high concentration, the method for fermentation and culture of the present invention ferments a plant component such as wheat flour using | 03-08-2012 |
20120064099 | COMPOUNDS THAT INHIBIT NFKB AND BACE1 ACTIVITY - The present invention relates to compounds with activity as BACE1 and NFκB modulators, and methods for treating, preventing, or ameliorating neurodegenerative diseases, such as Alzheimer's disease. The present invention is also directed to the treatment of diseases related to dysfunction of cell proliferation, the immune system and/or inflammation using such compounds or pharmaceutical compositions containing such candidate compounds. | 03-15-2012 |
20120064100 | BIOMARKERS AND USES THEREOF - The present invention provides markers of regulatory T (Treg) cells, preferably, cell surface markers of Treg cells and uses of those markers or compounds that bind thereto to identify or isolate Treg cells or to diagnose/prognose/treat/prevent Treg-mediated conditions. The present invention also provides methods for identification and/or isolation of Treg cell subpopulations and such isolated subpopulations of Treg cells. | 03-15-2012 |
20120064101 | Compounds and Methods Useful for Detection and Treatment of Cancer - The present invention relates to compounds and methods useful for the detection and treatment of disorders associated with frameshift mutations in coding microsatellite regions. The compounds and methods are applicable in cancers, especially of DNA mismatch repair deficient (MMR) sporadic tumours and HNPCC associated tumours. The compounds are useful for detection of disorders and in therapy such as immuno-therapy. The diagnostic methods relate to diagnosis and prognostic assessment of disorders associated with frameshift polypeptides originating from frameshift mutations in coding microsatellite regions of genes based on the detection of immunological entities directed against said frameshift polypeptides in body fluids. With respect to the treatment of cancer, the invention pertains to methods which use immuno therapy with combinatorial mixtures of tumour specific frameshift peptides to elicit a cytotoxic T-cell response specifically directed against tumour cells for prevention and curative treatment of cancers and precancers. | 03-15-2012 |
20120070452 | IMMUNOADJUVANT COMPOSITION AND USE THEREOF - Disclosed is a composition comprising, as an active ingredient, at least one selected from the group consisting of a Zc3h12a gene inhibitor and a Zc3h12a protein inhibitor. This composition can be used as an immunoadjuvant. | 03-22-2012 |
20120070453 | Methods for Preparing and Delivering Adjuvant Compositions - Methods are provided for preparing and delivering an adjuvant for vaccines including lecithin and a polymer. The polymer is preferably polyacrylic acid-based and the delivery method involves administering a vaccine, including an antigen and the adjuvant, to a mucosal surface. | 03-22-2012 |
20120076805 | Methods and Compositions for the Generation and Maintenance of Regulatory T Cells - Methods and compositions for generating and maintaining induced regulatory T cells (iTregs) are provided. Methods and compositions for treating an autoimmune disorder, organ transplant rejection, graft versus host disease or allergic or hypersensitivity and inflammation are also provided. | 03-29-2012 |
20120082687 | Use of cell adhesion inhibitor for the mobilization of antigen presenting cells and immune cells in a cell mixture (AIM) from the peripheral blood and methods of use - Disclosed is a method to recover an antigen presenting cells (APCs) and immune cells rich mixture (AIM) from peripheral blood mononuclear cells (PBMC) mobilized with one or more cell adhesion inhibitors for the preparation of an AIM vaccine or an AIM adoptive immunotherapy preparation. In addition, AIM mobilization can be enhanced by priming, simultaneously or in sequence, one or more of a combination of different chemical compounds, cytokines, hormones, growth factors, etc. The interaction of chemokines and chemokine receptors enable tumor cells attachment or in close proximity to antigen presenting cells and immune cells which possess similar receptors in a micro niche environment. Severing the chemokine/chemokine receptor linkage by a cell adhesion inhibitor will release these specifically primed cell mixtures into the peripheral blood. The collection of these cells from the peripheral blood has never been described and is the basis of this invention. AIM cells can either be used alone or better still, be induced into more target specific preparations with additions, modifications and incubation, pre or post cell adhesion inhibitors mobilization, with vaccines, different target specific antigens, peptides, chemotherapeutic agents, oncolytic viral therapeutic agents, cytokines, co-stimulatory molecules, anti-regulatory T cell therapeutic agents, anti-CTLA4, anti-PD1 molecules and other methodologies of immunological enhancement known to the art. The AIM vaccine or AIM adoptive immunotherapy preparation can then be used, but not limited to, the treatment of cancer and other diseases. | 04-05-2012 |
20120082688 | In Vitro Generation of Myeloid Derived Suppressor Cells - The invention relates to methods of isolating, culturing, and differentiating myeloid derived suppressor cells (MD-SCs) from embryonic stem (ES) cells and hematopoietic stem cells (HSCs). In certain embodiments, the invention relates to methods and compositions for producing MDSCs from ES cells and HSCs using a combination of factors including macrophage colony-stimulating factor (M-CSF). | 04-05-2012 |
20120082689 | Method of treatment an oncological disease - Method of cancer treatment with direct contact between proteins secreted by cancer tumor and patient's blood T-lymphocytes including the stage of weakening during some time humoral system of immunity by medical preparation, in particular by immunodepressant against this system, without weakening cellular system of immunity. | 04-05-2012 |
20120082690 | CHAPERONIN 10 IMMUNOSUPPRESSION - The invention is directed to the use of cpn10 in transplantation and particularly to treatment and/or prevention of graft versus host disease. The invention provides a method of administration of cpn10 to a donor and/or recipient animal or cells, tissues or organs derived from the donor, although in a particularly advantageous form treatment of both the donor and recipient animal. The method may further include the administration to the donor and/or recipient animal at least one other immunosuppressive agent to prevent or alleviate graft versus host disease. | 04-05-2012 |
20120087932 | DIAGNOSTIC TEST FOR VIRUS - Unique Avian Nephritis Virus (ANV) nucleic acid sequences have been determined. Primers and probes have been developed using the isolated nucleic acid sequences and a reverse transcription PCR has been developed to detect the presence of ANV in commercial flocks. Furthermore, use of the nucleic acid sequences and amino acids sequences encoded therefrom and antibodies to said amino acids is discussed. | 04-12-2012 |
20120087933 | ENHANCED MSC PREPARATIONS - The present invention provides preparations of MSCs with important therapeutic potential. The MSC cells are non-primary cells with an antigen profile comprising less than about 1.25% CD45+ cells (or less than about 0.75% CD45+), at least about 95% CD105+ cells, and at least about 95% CD166+ cells. Optionally, MSCs of the present preparations are isogenic and can be expanded ex vivo and cryopreserved and thawed, yet maintain a stable and uniform phenotype. Methods are taught here of expanding these MSCs to produce a clinical scale therapeutic preparations and medical uses thereof. | 04-12-2012 |
20120087934 | COADMINISTRATION OF ALPHA-FETOPROTEIN AND AN IMMUNOMODULATORY AGENT TO TREAT MULTIPLE SCLEROSIS - The present invention features methods for treating multiple sclerosis by administering an alpha-fetoprotein polypeptide (or a biologically active fragment, derivative, or analog thereof) and one or more immunomodulatory agents to a patient in need thereof. Also disclosed are compositions and kits that contain an alpha-fetoprotein polypeptide (or a biologically active fragment, derivative, or analog thereof) and one or more immunomodulatory agents. | 04-12-2012 |
20120093841 | Her2 DNA Vaccine as Adjunct Treatment for Cancers in Companion Animals - The application discloses therapeutic vaccines based upon the “pING” DNA plasmid vector expressing the gene encoding the rat Her2 protein. Vaccines according to the instant disclosure are used as an adjunct treatment for surgery, radiation and/or chemotherapy for dogs and cats with cancers that over express the Her2 antigen, and prolong the post-surgical disease free interval and/or survival time. Also included are therapeutically effective methods of immunization using said vaccines. | 04-19-2012 |
20120093842 | CHIMERIC RECEPTOR GENES AND CELLS TRANSFORMED THEREWITH - Chimeric receptor genes suitable for endowing lymphocytes with antibody-type specificity include a first gene segment encoding a single-chain Fv domain of a specific antibody and a second gene segment encoding all or part of the transmembrane and cytoplasmic domains, and optionally the extracellular domain, of an immune cell-triggering molecule. The chimeric receptor gene, when transfected to immune cells, expresses the antibody-recognition site and the immune cell-triggering moiety into one continuous chain. The transformed lymphocytes are useful in therapeutic treatment methods. | 04-19-2012 |
20120100162 | Cyclophosphamide in Combination with Immune Therapeutics - The present invention relates to methods of treating a cancer and in particular, a B-cell derived cancer, using a lymphocytotoxic but hematopoeitic cell sparing high-dose pulsed amount of an oxazaphosphorine drug, either alone, or in combination with immune therapeutics such as, for example, monoclonal antibodies that selectively bind B-cell specific antigens. | 04-26-2012 |
20120100163 | SUPPRESSION OF A TYPE 1 HYPERSENSITIVITY IMMUNE RESPONSE WITH AN UNRELATED ANTIGEN - The present invention relates to antigens and methods for the suppression of a hypersensitivity immune response via bystander suppression with an antigen unrelated to the allergen triggering a hypersensitivity immune response such as an allergic response in an individual. Treatment regiments covering the administering the unrelated antigen to the oral cavity (e.g. sublingual mucosa) combined with the administration of the unrelated antigen to either the respiratory tract, gastro-intestinal tract or skin in a simultaneous, contemporaneous, separate or sequential manner is provided. | 04-26-2012 |
20120100164 | SUPPRESSION OF A HYPERSENSITIVITY IMMUNE RESPONSE WITH UNRELATED ANTIGEN DERIVED FROM ALLERGEN SOURCE MATERIAL - The present invention relates to the treatment of a hypersensitivity immune response, such as allergic rhinitis or asthma, via bystander suppression by use of an antigen unrelated to the allergen triggering the hypersensitivity immune response in an individual to be treated, wherein the antigen is obtainable from the source material comprising the “triggering” allergen. | 04-26-2012 |
20120114674 | Molecular Antigen Array - The present invention is related to the fields of molecular biology, virology, immunology and medicine. The invention provides a composition comprising an ordered and repetitive antigen or antigenic determinant array. The invention also provides a process for producing an antigen or antigenic determinant in an ordered and repetitive array. The ordered and repetitive antigen or antigenic determinant is useful in the production of vaccines for the treatment of infectious diseases, the treatment of allergies and as a pharmaccine to prevent or cure cancer and to efficiently induce self-specific immune responses, in particular antibody responses. | 05-10-2012 |
20120114675 | FOXP3+ NATURAL KILLER T-CELLS AND THE TREATMENT OF IMMUNE RELATED DISEASES - In one aspect, the invention provides isolated populations of cells comprising Foxp3+ natural killer T-cells, methods of generating Foxp3+ natural killer T-cells and methods for suppressing the immune response in specific organs, including the liver and the lungs. | 05-10-2012 |
20120114676 | METHODS OF TREATING CANCER WITH PHENFORMIN - Methods of using phenformin to treat certain types of cancers are described. | 05-10-2012 |
20120114677 | MODIFIED NICOTINIC COMPOUNDS AND RELATED METHODS - Provided herein are compounds and related composition and methods that may be used to raise an antibody response to nicotinic compounds, in some embodiments. | 05-10-2012 |
20120114678 | TREATMENT FOR NEPHRITIS - This invention relates to methods for treatment of nephritis. This invention further provides a method of treating with nephritis comprising administering to the subject an amount of herbal pharmaceutical composition thereof effective to treat the subject. Move particularly, this invention provides an herbal pharmaceutical composition comprising Rhizoma | 05-10-2012 |
20120114679 | PEPTIDES EFFECTIVE IN THE TREATMENT OF TUMORS AND OTHER CONDITIONS REQUIRING THE REMOVAL OR DESTRUCTION OF CELLS - The embodiments include methods of treating conditions requiring removal or destruction of cellular elements, such as benign or malignant tumors in humans, using compounds based on small peptides. The method includes, but is not limited to, administering the compounds intramuscularly, orally, intravenously, intrathecally, intratumorally, intranasally, topically, transdermally, etc., either alone or conjugated to a carrier. | 05-10-2012 |
20120114680 | Dendritic Cell Compositions and Methods - Methods are provided for the production of dendritic cells from monocytes that have been incubated at a temperature of 1° C.-34° C. for a period of approximately 6 to 96 hours from the time they are isolated from a subject. After the incubation period, the monocytes can then be induced to differentiate into dendritic cells. Mature dendritic cells made by the methods of the invention have increased levels of one or more of CD80, CD83, CD86, MHC class I molecules, or MHC class II molecules as compared to mature dendritic cells prepared from monocytes that have not been held at 1° C.-34° C. for at least 6 hours from the time they were isolated from a subject. Dendritic cells made by the methods of the invention are useful for the preparation of vaccines and for the stimulation of T cells. | 05-10-2012 |
20120121616 | IMMUNE BALANCE-REGULATING AGENT - Disclosed is a novel use of superheated stream-treated material. Disclosed is an immune balance-regulating agent comprising a superheated steam-treated product of crown daisy ( | 05-17-2012 |
20120121617 | PROMOTERS FOR RECOMBINANT VIRAL EXPRESSION - The invention relates to a promoter selected from a group of nucleic acids consisting of (a) a nucleic acid having the nucleotide sequence of SEQ ID NO:1; (b) a nucleic acid having a nucleotide sequence derived from SEQ ID NO:1, wherein not more than 10 nucleotides have been added, deleted, substituted and/or inverted from the nucleic acid of SEQ ID NO:1; and (c) a nucleic acid sequence having at least 70% identity with the nucleic acid of (a); wherein the promoter has a length of up to and including 27 nucleotides and wherein the promoter according to options (b) and (c) exhibits at least the 70% of the promoter activity of SEQ ID NO:1 as measured by the amount of recombinant protein produced. | 05-17-2012 |
20120121618 | Predicting And Treating Prostate Cancer - The disclosure features methods and compositions for determining whether a male subject has, or is at an increased risk of developing, an aggressive form of prostate cancer. The disclosure also features methods for adjusting a treatment regimen (e.g., discontinuing a therapy comprising an antioxidant) or administering a therapy that does not contain an antioxidant for a male subject in view of one or both of an MnSOD2 genotype status and an elevated level of an antioxidant in a biological sample obtained from the male subject. Also featured are methods for reducing superoxide levels in a subject based on one or both of an MnSOD2 genotype status and an elevated level of an antioxidant in a biological sample obtained from the male subject. | 05-17-2012 |
20120121619 | CYTOKINE BIOMARKERS AS PREDICTIVE BIOMARKERS OF CLINICAL RESPONSE FOR GLATIRAMER ACETATE - A method for treating a human subject afflicted with multiple sclerosis or a single clinical attack consistent with multiple sclerosis with a pharmaceutical composition comprising glatiramer acetate and a pharmaceutically acceptable carrier, comprising the steps of determining whether the human subject is a glatiramer acetate responder by evaluating a biomarker selected from the group consisting of IL-17 concentration, TNF-α concentration, IL-2 concentration and IFN-γ concentration, or a combination thereof, in the blood of the human subject and administering the pharmaceutical composition comprising glatiramer acetate and a pharmaceutically acceptable carrier to the human subject only if the human subject is identified as a glatiramer acetate responder. | 05-17-2012 |
20120121620 | ANTI-ESTROGEN AND IMMUNE MODULATOR COMBINATIONS FOR TREATING BREAST CANCER - Compositions for treating cancers of mucosal tissues including breast, prostate, ovary, colon are disclosed which include various combinations of new or conventional anti-estrogen compounds, aromatase inhibitors, immune modulators, immune inhibitors, immune inhibitor mimicking compounds and steroid or thyroid hormones. Methods of predicting susceptibility of a cancer of mucosal origin to treatment with a composition containing an immune inhibitor or an immune inhibitor mimicking compound are also disclosed. Preferred methods include identifying in a specimen of cancer cells the presence of a Poly-Ig (Fe) receptor or Poly-Ig-like (Fc) receptor capable of binding to an immune inhibitor or an immune inhibitor mimicking compound and of mediating immune inhibition of cancer cell growth. | 05-17-2012 |
20120121621 | SYNERGISTIC PREBIOTIC COMPOSITIONS - The invention relates to synergistic compositions comprising prebiotic components selected from fructose polymers GF | 05-17-2012 |
20120121622 | BIODEGRADABLE IMMUNOMODULATORY FORMULATIONS AND METHODS FOR USE THEREOF - The invention provides new compositions and methods for immunomodulation of individuals. Immunomodulation is accomplished by administration of immunomodulatory polynucleotide/microcarrier (IMP/MC) complexes. The IMP/MC complexes may be covalently or non-covalently bound, and feature a polynucleotide comprising at least one immunostimulatory sequence bound to a biodegradable microcarrier or nanocarrier. | 05-17-2012 |
20120121623 | NOVEL ANTIPATHOGENIC PEPTIDES - The present invention relates to monomeric and multimeric peptidic compounds which have antipathogenic, in particular antiviral or/and antibacterial activity. In a preferred aspect, the peptide compounds of the invention have an activity in respect of a broad spectrum of viruses, both DNA and RNA viruses, irrespective of whether they possess virus envelope or not. Further, the present invention refers to compositions comprising said peptidic compounds for medical use, i.e. for the treatment or prevention of pathogenic, in particular viral or/and bacterial infections. | 05-17-2012 |
20120121624 | HEPATITIS C VIRUS NS3 PROTEASE INHIBITORS - The present invention relates to macrocyclic compounds of Formula (I) that are useful as inhibitors of the hepatitis C virus (HCV) NS3 protease, their synthesis, and their use for treating or preventing HCV infections. | 05-17-2012 |
20120128701 | COMPOSITIONS AND METHODS FOR THE REMOVAL OF BIOFILMS - Methods of breaking down a biofilm or inhibiting, preventing or treating a microbial infection that produces a biofilm are disclosed, which involves administration of a polypeptide that has one or more HMG-box domains to a subject suffering from the infection or having the biofilm. By competing with microbial proteins that bind to DNA scaffold in the biofilm, these polypeptides destabilize the biofilm leading to destruction and removal of the biofilm by the immune system. | 05-24-2012 |
20120128702 | NOVEL BIOMARKERS FOR A PREDICTION OF THE OUTCOME OF AN IMMUNOTHERAPY AGAINST CANCER - The present invention relates to methods for predicting the effect of an immunotherapy against cancer in a patient based on new biomarkers. The present invention furthermore relates to a prognosis regarding the outcome based on said biomarkers. The present invention furthermore relates to panels of biomarkers for use in the above methods. | 05-24-2012 |
20120128703 | Aminopterin Dosage Forms and Methods for Inflammatory Disorders - There is disclosed dosage forms and methods for treating a patient with an inflammatory disorder with a therapeutically effective amount of aminopterin, or a pharmaceutically acceptable salt thereof, that achieve efficacy without concomitant toxicity. Specifically, there is disclosed a method for treating an inflammatory disorder in a patient with uninterrupted doses of aminopterin. | 05-24-2012 |
20120135013 | CD45 and Methods and Compounds Related Thereto - Disclosed herein are compounds, compositions and methods for preventing, reducing or inhibiting an amount of protein tyrosine phosphatase receptor type C (CD45) expressed or activity of CD45 in a cell or a subject. Also disclosed are methods for preventing, inhibiting or treating an infection in a cell or a subject immunizing a subject or enhancing a subject's immune response against an infection preventing, reducing or inhibiting the susceptibility of a cell or a subject to an infection or subsequent pathogenesis and morbidity due to the infection and preventing, reducing, and inhibiting apoptosis caused by or resulting from a biological agent in a cell or a subject which comprises preventing, reducing or inhibiting an amount of protein tyrosine phosphatase receptor type C (CD45) expressed or activity of CD45 in the cell or the subject. | 05-31-2012 |
20120135014 | SINGLE NUCLEOTIDE POLYMORPHISMS (SNP) AND ASSOCIATION WITH RESISTANCE TO IMMUNE TOLERANCE INDUCTION - This application discloses methods, systems and kits for correlating the presence or absence of certain nucleic acid sequences within a population with the ability to create immune tolerance in that same population. Tolerance can be induced by solo or repeated administration of antigen, including soluble antigens administered either intravenously or sublingually. This application also discloses methods for detecting variants. In addition the application addresses the use or avoidance of non steroidal anti inflammatory drugs in therapy. | 05-31-2012 |
20120135015 | Induction of Pancreatic Stem Cells by Transient Overexpression of Reprogramming Factors and PDX1 Selection - Methods for generating pancreatic stem cells from a pancreatic tissue of 24-week old mice by transient overexpression of reprogramming factors combined with Pdx1 selection is described herein. The generated cells were designated as iPaS (induced pancreatic stem) cells and exhibit the same morphology as the pancreatic stem cells previously established from young donors without genetic manipulation and express genetic markers of endoderm and pancreatic progenitors. Transplantation of the iPaS cells into nude mice resulted in no teratoma formation. Moreover, iPaS cells were able to differentiate into insulin-producing cells more efficiently than ES cells. In addition, the technology of transient overexpression of reprogramming factors and tissue-specific selection of the present invention may also be useful for the generation of other tissue-specific stem cells. | 05-31-2012 |
20120135016 | INDUCTION OF NEUROGENESIS AND STEM CELL THERAPY IN COMBINATION WITH COPOLYMER 1 - A method for inducing and enhancing neurogenesis and/or oligodendrogenesis from endogenous as well as from exogenously administered stem cells comprises administering to an individual in need thereof an agent selected from the group consisting of Copolymer 1, a Copolymer 1-related polypeptide, a Copolymer 1-related peptide, and activated T cells which have been activated by Copolymer 1, a Copolymer 1-related polypeptide, or a Copolymer 1-related peptide. The method is particularly useful for stem cell therapy in combination with the agent. | 05-31-2012 |
20120135017 | STABLE DRY POWDER COMPOSITION COMPRISING BIOLOGICALLY ACTIVE MICROORGANISMS AND/OR BIOACTIVE MATERIALS AND METHODS OF MAKING - The present invention relates to embedding live or dead microorganisms and/or bioactive materials in a protective dry formulation matrix, wherein the formulation includes the bioactive microorganism or material, a formulation stabilizer agent, and a protective agent. The formulation is prepared by dispersing all the solid components in a solution, with or without a vacuum, and cooling the solution to a temperature above its freezing temperature. The methods include a primary drying step of the formulation at a desired temperature and time period, and an accelerated secondary drying step under maximum vacuum and elevated temperature, to achieve a final desirable water activity of the dry material. | 05-31-2012 |
20120141512 | METHOD OF INCREASING IMMUNOLOGICAL EFFECT - A method of increasing immunological effect in a patient by administering an effective amount of a primary cell derived biologic to the patient, inducing immune production, blocking immune destruction, and increasing immunological effect in the patient. Methods of treating an immune target, treating a tumor, immune prophylaxis, and preventing tumor escape. | 06-07-2012 |
20120141513 | DEUTERATED FINGOLIMOD - This invention relates to novel compounds that are deuterated derivatives of fingolimod and pharmaceutically acceptable salts thereof. This invention also provides compositions comprising one or more compounds of this invention and a carrier and the use of the disclosed compounds and compositions in methods of treating diseases and conditions that are beneficially treated by administering a lysophospholipid edg1 (S1P1) receptor agonist, such as fingolimod. | 06-07-2012 |
20120141514 | USE OF A CHEMICALLY-STABILIZED CHLORITE SOLUTION FOR INHIBITING AN ANTIGEN-SPECIFIC IMMUNE RESPONSE - Methods of using a stabilized chlorite solution to inhibit antigen-specific immune responses are disclosed. The stabilized chlorite solution, when administered to a mammal in need thereof, can prevent the presentation of antigens by antigen presenting cells. The stabilized chlorite solution therefore is useful in treating, inter alia, auto-immune diseases, treating diseases caused by an inappropriate immune response, treating lymphoproliferative disease and in inhibiting rejection in transplant patients. | 06-07-2012 |
20120148611 | Cyclophosphamide in Combination with Anti-Idiotypic Vaccines - The present invention relates to methods of treating a cancer and in particular, a B-cell derived cancer, using a lymphocytotoxic but hematopoeitic cell sparing high-dose pulsed amount of an oxazaphosphorine drug in combination with immune therapeutics such as, for example, an autologous idiotypic vaccine and monoclonal antibodies that selectively bind B-cell specific antigens. | 06-14-2012 |
20120156228 | Methods, Kits, and Compositions for Generating New Hair Follicles and Growing Hair - The invention features methods, kits, and compositions for generating new hair follicles and growing hair on a subject. | 06-21-2012 |
20120156229 | QUICKLY SOLUBLE ORAL FILM DOSAGE CONTAINING STEVIOSIDES AS A UNPLEASANT TASTE MASKING AGENT - Disclosed is a quickly soluble oral film dosage for masking a nasty taste, in particular, a quickly soluble oral film dosage comprising a stevioside based sweetener and a high potency sweetener in a ratio by weight (w/w) of 1:3 to 3:1, which may efficiently mask a bitter or nasty taste of a medicine and may be quickly dissolved in a mouth without water, thereby improving an aftertaste thereof thus enhancing dosage acceptability of a patient. | 06-21-2012 |
20120156230 | TREATMENT OF SPINAL CORD INJURY AND TRAUMATIC BRAIN INJURY USING PLACENTAL STEM CELLS - Provided herein are methods of treatment of individuals having an injury to the central nervous system, such as a spinal cord injury or a traumatic brain injury, using placental stem cells and placental multipotent stem cells described herein, and populations of such placental cells. | 06-21-2012 |
20120164162 | METHODS IN CELL CULTURES, AND RELATED INVENTIONS, EMPLOYING CERTAIN ADDITIVES - A method for the manufacture of products by biotechnological methods in bacterial cell culture is disclosed as well as products obtained, the use of certain additives to the media used in the manufacture of said products in bacterial cell culture media, and the use of said additives in reducing the detrimental effects of radicals in the manufacture of the products, as well as aspects related to these invention embodiments. The manufacturing process or method comprises adding one or more radical scavenging and/or antioxidative additive preferably selected from the group consisting of sterically hindered nitroxyls, sterically hindered hydroxylamines, sterically hindered hydroxylamine salt compounds, sterically hindered amino compounds and sterically hindered N-hydrocarbyloxyamines, benzofuranone compounds, as obligatory component(s) to the medium used during biosynthesis. | 06-28-2012 |
20120171228 | ANTI-CANCER REGIMEN - The invention comprises the administration of an amount of honokiol (HNK) and Modified Citrus Pectin (MCP) or similar pectin or alginate in amounts synergistic to inhibit cancer. The inhibition can be of the formation of cancer, the progression of a cancer already formed, or the transformation of a primary cancer to a metastatic one. HNK and MCP appear to be synergistic across their effective ranges, and the synergy may be due in part to the binding of galectin-3 on the surface of tumor cells by MCP, which better presents the cell for the cytotoxic effects of HNK. Compositions of matter which combine the two agents, HNK and MCP, in synergistic amounts intended for daily administration are also contemplated. The administration of MCP and HNK may be combined with the administration of conventional anti-cancer therapeutics. | 07-05-2012 |
20120171229 | SYNTHETIC NANOCARRIERS WITH REACTIVE GROUPS THAT RELEASE BIOLOGICALLY ACTIVE AGENTS - This invention relates to compositions, and related compounds and methods, of conjugates of synthetic nanocarriers, or components thereof, and biologically active agents, such as immunomodulatory agents, antigens, anticancer agents or antiviral agents. The biologically active agents are released from the synthetic nanocarriers in the presence of a reducing agent or by reaction with a thiol. | 07-05-2012 |
20120171230 | ORAL VACCINES PRODUCED AND ADMINISTERED USING EDIBLE MICRO-ORGANISM - The anti-pathogen vaccine of the present invention is produced in recombinant bacteria and/or transgenic plants and then administered through standard vaccine introduction method or through the oral administration. A DNA sequence encoding for the expression of an antigen of a pathogen is isolated and ligated to a promoter which can regulate the production of the surface antigen in a bacterial or transgenic plant. Preferably, a foreign gene is expressed in a portion of the plant or bacteria, and all or part of the antigen expressing plant or bacteria used for vaccine administration. In a preferred procedure, the vaccine is administered through the consumption of the edible plant as food, or the bacteria administered orally. The present invention also provides a method of using genetically modified microorganisms generally recognized to be edible and/or harmless to animals or humans when ingested, such as lactic acid bacteria, including | 07-05-2012 |
20120177668 | IMMUNOMODULATING COMPOSITIONS COMPRISING INTERLEUKIN 13 INHIBITORS AND USES THEREFOR - This invention relates generally to compositions and methods for modulating immune responses. More particularly, the present invention relates to the co-expression, co-location or co-presentation on host cells (e.g. antigen-presenting cells, leukocytes, etc) of an inhibitor of IL-13 function and an immune stimulator that stimulates an immune response to a target antigen in compositions and methods for stimulating protective or therapeutic immune responses to the target antigen. The compositions and methods of the present invention are particularly useful in the prophylaxis and/or treatment of a range of diseases or conditions including pathogenic infections and cancers. | 07-12-2012 |
20120183568 | BIOASSAY FOR THE EARLY DETECTION OF AUTOIMMUNE DISEASES - Provided are methods for aiding in diagnosing autoimmune diseases in a mammal, comprising contacting a biological sample that is not a tear sample from the mammal with an antibody that specifically binds to a first polypeptide selected from the group Ctss, Ctsh, Ctsr, Ctsw, Ctsz, Ifng, IL-6ra, IL-10, IL-10ra, IL-15, Tnfa, Apo-F, or Lcn-2 or a second polypeptide selected from the group lactoperoxidase, lactoferrin or lysozyme under conditions favoring the formation of an antibody-polypeptide complex, and determining the amount of complex formed, wherein an increased formation of antibody-first-polypeptide complex or a decreased formation of antibody-second-polypeptide complex as compared to a suitable control, indicates a likely positive diagnosis of an autoimmune disease for the mammal, thereby aiding in the diagnosis. Methods of treating the autoimmune diseases are also provided. | 07-19-2012 |
20120189646 | NOVEL COMPOUNDS - Disclosed herein are a compound of formula (I) and pharmaceutically acceptable salts thereof, processes for preparing the same, pharmaceutical compositions containing the same, and methods of using the same. | 07-26-2012 |
20120195917 | Vaccine Composition Comprising 5'-CAP Modified RNA - The present invention relates to modification of RNA with 5′-cap analogs in order to improve the stability and increase the expression of said RNA, in particular in immature antigen presenting cells. The present invention provides a vaccine composition comprising said stabilized RNA, immature antigen presenting cells comprising said stabilized RNA, and methods for stimulating and/or activating immune effector cells and for inducing an immune response in an individual using said stabilized RNA. | 08-02-2012 |
20120201839 | ALLERGY TREATMENT USING ACID TREATED AQUEOUS WHEY PROTEIN EXTRACT - The invention relates to manufacture of whey protein extracts, to infant formula and to reducing or preventing food allergy. The whey protein extract is produced from a whey protein-containing composition by contacting a whey protein-containing composition with an aqueous solution to form a sample including a soluble protein-containing component and an insoluble component; recovering the soluble protein-containing component from the sample; and acidifying the soluble protein-containing component, thereby producing the whey protein extract. Extracts produced by the method of the invention may be used in infant formula, as a dietary supplement or foodstuff. | 08-09-2012 |
20120207773 | MATERIALS AND METHODS FOR THE DEVELOPMENT OF AN ANTIGEN-SPECIFIC IMMUNE NON-RESPONSIVENESS STATE - The present invention provides materials and methods for making a subject non-responsive to an antigen. Methods of the invention may comprise contacting the subject with the antigen and a compound that induces anergy. In some embodiments, the antigen may be an autoimmune antigen, examples of which include, but are not limited to acetylcholine receptor for myasthenia gravis, glutamic acid decarboxylase for type I diabetes mellitus and rheumatoid factor in rheumatoid arthritis, hi some embodiments, the present invention provides a method of transplanting an organ, tissue, or cells into a subject (e.g., a mammal such as a human). | 08-16-2012 |
20120207774 | Immunization of fish with plant-expressed recombinant proteins - Plants are produced that express an amino acid sequence that, when administered to a fish, produce an antigenic or immune response in the fish. The amino acid sequence in one embodiment is an antigen from an organism that causes pathology in fish. The plant tissue may be fed to the fish, or mixed with other materials and fed to fish, or extracted and administered to the fish. | 08-16-2012 |
20120213806 | NEPRILYSIN INHIBITORS - In one aspect, the invention relates to compounds having the formula: | 08-23-2012 |
20120213807 | NEPRILYSIN INHIBITORS - In one aspect, the invention relates to compounds having the formula: | 08-23-2012 |
20120213808 | CARBONIC ANHYDRASE I SERVING AS NOVEL ANTIGEN TO BE USED FOR TREATMENT OF AUTOIMMUNE DISEASES - The purpose of the present invention is to provide a method for treating autoimmune diseases. Disclosed is a method or the like for the treatment of autoimmune diseases, which utilizes an antigen-specific tolerogenic antigen presenting cell. Specifically disclosed are: a method for producing an antigen-specific tolerogenic antigen presenting cell, which is characterized by using carbonic anhydrase I; an immunogenic antigen presenting cell which is specific to carbonic anhydrase I; and a method or the like for the treatment of autoimmune diseases (especially inflammatory bowel diseases), which is characterized by using a tolerogenic antigen presenting cell which is specific to carbonic anhydrase I. | 08-23-2012 |
20120219571 | COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY - Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines. | 08-30-2012 |
20120219572 | Spheroidal Aggregates of Mesenchymal Stem Cells - The present invention encompasses methods and compositions for reducing inflammation in a mammal. The invention includes a population of mesenchimal stromal cells that possess anti-inflammatory, anti-apoptolic, immune modulatory, and anti-tumorigenic properties. | 08-30-2012 |
20120251560 | CONJUGATED LIPOMERS AND USES THEREOF - The present invention provides inventive conjugated polyethyleneimine (PEI) polymers and conjugated aza-macrocycles (collectively referred to herein as “conjugated lipomers” or “lipomers”) containing one or more groups of the formula (iii): | 10-04-2012 |
20120251561 | ADMINISTRATION OF DENDRITIC CELLS PARTIALLY MATURED IN VITRO FOR THE TREATMENT OF TUMORS - The present invention provides populations of cells comprising partially matured dendritic cells that can be used for administration individuals having a tumor. Partially matured dendritic cells, those contacted with a dendritic cell maturation agent for about 1 to about 10 hours, or more, efficiently take up and process tumor antigens in the area of the tumor site, complete maturation, and can subsequently migrate to the lymph nodes of a treated individual. Once in the lymph node the now fully mature antigen presenting dendritic cells secrete the appropriate cytokines (e.g., TNFα and IL-12) and contact T cells inducing a substantial anti-tumor immune response. | 10-04-2012 |
20120251562 | Inhibitors of the PP1/GADD34 Complex for the Treatment of a Condition Requiring an Immunosuppressive Activity - The present invention relates to the general field of the treatment and prevention of diseases involving an inflammatory condition, namely sepsis or infectious or viral diseases as well as diseases requiring for the of treatment an immunosuppressive activity namely autoimmune diseases and graft rejection. In particular, the invention relates to an inhibitor of the activity or the formation of the PP1/GADD34 complex for the treatment of a condition requiring an immunosuppressive activity or an anti-inflammatory activity. | 10-04-2012 |
20120258125 | METHOD TO IDENTIFY A NOVEL CLASS OF IMMUNOLOGIC ADJUVANTS - Methods of identifying an adjuvant capable of activating dendritic cells including measuring expression level genes in skin of an animal prior to exposure to a test compound, wherein the genes are known to be upregulated or downregulated in the skin of the animal in response to topical application of dibutyl phthalate (DBP) to skin of said animal; exposing skin of an animal of the same species to the test compound; measuring expression level of the genes in the skin of the animal after exposure to the test compound; and comparing expression level of the genes measured before and after exposure to the test compound, wherein an increase or decrease in expression level of the genes following exposure to the test compound indicates that the test compound is capable of activating dendritic cells. Also included are compositions that induce dendritic cell migration and modulate expression level of genes in skin cells. | 10-11-2012 |
20120263740 | APTAMER-TARGETED SIRNA TO INHIBIT NONSENSE MEDIATED DECAY - Compositions for inducing or enhancing antigenicity of a target cell by modulating the non-sense mediated decay pathway in the target cell. The compositions comprise one or more aplamers providing specificity and delivery of an oligonucleotide to the target, These compositions have broad applicability in the treatment of many diseases. | 10-18-2012 |
20120269832 | Mature Dendritic Cell Compositions and Methods of Culturing Same - This invention provides novel CD40L polypeptides and nucleic acids, as well as antigen presenting cells and vaccines comprising such CD40L polypeptides and/or nucleic acids, and related methods for preparing the antigen presenting cells and vaccines. The antigen presenting cells and vaccines are useful for enhancing an immune response. The invention provides a method for preparing mature dendritic cells (DCs), comprising the sequential steps of: (a) signaling isolated immature dendritic cells (iDCs) with a first signal comprising an interferon gamma receptor (IFN-?R) agonist and/or a tumor necrosis factor alpha receptor (TNF-?R) agonist to produce signaled dendritic cells; and (b) signaling said signaled dendritic cells with a second transient signal comprising an effective amount of a CD40 agonist to produce CCR7+ mature dendritic cells. Also provided by this invention are enriched populations of dendritic cells prepared by the methods of the invention. Such dendritic cells have enhanced immunostimulatory properties and increased IL-12 secretion and/or decreased IL-10 secretion. CD40 signaling can be initiated by one or more of polypeptide translated from an exogenous polynucleotide encoding CD40L (e.g., mRNA or DNA), an agonistic antibody to CD40 receptor or by CD40 ligand polypeptide. The enriched populations can be further modified by the administration of an immunogen to the DC. The DC will take up and process the immunogen on its cell surface. | 10-25-2012 |
20120269833 | ALLORESTRICTED PEPTIDE-SPECIFIC T CELLS - The present invention is directed to a T cell receptor (TCR) recognizing antigenic peptides derived from tumor-associated antigen FMNL | 10-25-2012 |
20120276126 | LACTOFERRIN IN THE TREATMENT OF MALIGNANT NEOPLASMS AND OTHER HYPERPROLIFERATIVE DISEASES - The present invention relates to methods of treating a hyperproliferative disease by administering a composition of lactoferrin alone or in combination with standard anti-cancer therapies. | 11-01-2012 |
20120282283 | PRODUCTION OF CLOSED LINEAR DNA - An in vitro process for the production of closed linear deoxyribonucleic acid (DNA) comprises (a) contacting a DNA template comprising at least one protelomerase target sequence with at least one DNA polymerase in the presence of one or more primers under conditions promoting amplification of said template; and (b) contacting amplified DNA produced in (a) with at least one protelomerase under conditions promoting production of closed linear DNA. A kit provides components necessary in the process. | 11-08-2012 |
20120282284 | METHODS AND COMPOSITIONS FOR PRODUCING ANTIGENIC RESPONSES - The present inventions relates to methods of producing an antigenic response in which an antigen is contacted to an antigen-presenting cell, wherein the improvement comprises contacting the antigen-presenting cell with an A | 11-08-2012 |
20120294875 | NON-IMMUNOGLOBULIN ANTIGEN BINDING SCAFFOLDS FOR INHIBITING ANGIOGENESIS AND TUMOR GROWTH - In certain embodiments, this present invention provides polypeptide or nucleotide non-immunoglobulin antigen binding scaffold compositions, and methods for inhibiting Ephrin B2 or EphB4 activity. In other embodiments, the present invention provides methods and compositions for treating cancer or for treating angiogenesis-associated diseases. | 11-22-2012 |
20120294876 | VACCINE AND HEALTH-RELATED APPLICATIONS FOR RUMINANT BREATH MONITORING SYSTEM - A method for managing health of ruminants or other animals. The method includes providing a feed dispenser for feeding ruminants nutrient supplements, and the feed dispenser includes a gas analyzer where a ruminant places its head. The method includes determining a particular ruminant has accessed the feed dispenser such as by reading an identifier from an RFID ear tag and operating the feed dispenser to provide a ration of methane-controlling nutrient supplement. The method may include using the identifier to determine that the animal should be vaccinated such as based on their age and no record of prior vaccination. The method includes dispensing a dose of a nasal vaccine into the feed dispenser near the animal's nostrils. The method may include discharging a diagnostic agent such as propane or carbon monoxide and processing data collected to diagnose the animal as having a disease or condition such as a lung-related sickness. | 11-22-2012 |
20120301491 | Use of Modified Extracellular Matrix Proteins in Diagnosis and Treatment of Atherosclerosis - The present invention relates to the use of fibronectin, tenascin, collagens type I, III, VI and/or VIII modified by aldehyde or by glycosylation in ELISA for detection of antibodies in plasma and serum to diagnose atherosclerosis as well as the use of induction of tolerance and active as well as passive immunization against glycosylated or aldehydemodified fibronectin, tenascin, collagen type I, III, VI and/or VIII for prevention and treatment of atherosclerosis. | 11-29-2012 |
20120308585 | METHODS AND COMPOSITIONS FOR USE IN CELLULAR THERAPIES - The present invention provides methods for the intralymphatic administration of cellular therapies. Further aspects of the invention provide compositions, kits and uses thereof related to such methods. | 12-06-2012 |
20120308586 | COMPOSITION BASED ON EXTRA VIRGIN OLIVE OILS - This invention relates to a composition based on a mixture of different olive oils, preferably virgin and extra virgin olive oils, from ecological farms, and to the use thereof in the treatment or prevention of different disorders in humans and animals. Moreover, this invention also relates to a dermatological/dermocosmetic preparation that comprises the composition of this invention and to the use of this dermatological/dermocosmetic preparation in the treatment of skin disorders in humans and animals. Underlying these systemic and/or skin disorders, there are metabolic and immunoinflammatory-oxidative alterations, which may be positively modified by the systemic (oral) or topical (cutaneous) use of the composition of this invention. The special physical-chemical structure of the composition allows for a better digestive and cutaneous arrangement. | 12-06-2012 |
20120308587 | NEPRILYSIN INHIBITORS - In one aspect, the invention relates to compounds having the formula: | 12-06-2012 |
20120308588 | NEPRILYSIN INHIBITORS - In one aspect, the invention relates to compounds having the formula: | 12-06-2012 |
20120308589 | SINOMENINE DERIVATIVES, SYNTHETIC METHODS AND USES THEREOF - The invention relates to sinomenine derivatives, methods for their synthesis and their applications. The sinomenine derivatives include oxidation derivatives, and C-10 substituted sinomenine derivatives. Based on the readily oxidizable phenol group on sinomenine structure, using oxidation, oxidative dearomatization, or conjugated addition aromatization, one can introduce C-10 substitutions to synthesize the sinomenine derivatives. The sinomenine derivatives of the invention have the following structures: | 12-06-2012 |
20120315289 | Non-polysaccharide constituent of genus Dendrobium, usage for the non-polysaccharide constituent of genus Dendrobium and extracting method thereof - The present invention discloses a non-polysaccharide constituent for positively regulating the immune system in the therapy of allergic diseases. The non-polysaccharide constituent is extracted from genus Dendrobium by incubating in alcohol and extracting using solvents with different polarity. | 12-13-2012 |
20120315290 | INHIBITORS OF LL-37 MEDIATED IMMUNE REACTIVITY TO SELF NUCLEIC ACIDS - Methods and compositions for treating disease are provided. More particularly, methods and compositions of inhibiting pathogenic interferon production are prevented, which may be useful in the treatment of various diseases. In other embodiments, therapeutic compounds and methods for the treatment of autoimmune diseases and chronic inflammatory diseases and/or cancer are provided. One such method is a method for inhibiting pathogenic interferon production or inhibiting activation of plasmacytoid dendritic cells or treating an autoimmune or chronic inflammatory disease, which comprises inhibiting one or more of LL-37 and hCAP18. | 12-13-2012 |
20120315291 | PURINE DERIVATIVES AND THEIR PHARMACEUTICAL USES - The present invention relates to compounds of formula (I): | 12-13-2012 |
20120321648 | USE OF ISLET GLUCOSE-6-PHOSPHATASE RELATED PROTEIN AS A DIAGNOSTIC TOOL AND THERAPEUTIC TARGET FOR AUTOIMMUNE DIABETES - A method and compositions for detecting autoimmunity to islet glucose-6-phosphatase related protein (IGRP). Detection of IGRP autoantibodies alone, and in combination with other molecules such as the 65-kDa form of glutamate decarboxylase (GAD | 12-20-2012 |
20120328635 | CHAPERONIN 10 VARIANTS - The invention relates generally to chaperonin 10 N-terminal variants. More specifically, the invention relates to chaperonin 10 N-terminal variants with enhanced immunomodulatory capacity and/or enhanced binding affinity for pathogen-associated molecular patterns (PAMPs) and/or damage-associated molecular patterns (DAMPs). | 12-27-2012 |
20130004525 | INACTIVATING PATHOGENS WITH OXIDIZING AGENTS FOR VACCINE PRODUCTION - The present disclosure provides methods for producing a vaccine composition containing a pathogen that is rendered noninfectious by exposure to hydrogen peroxide. The methods disclosed herein are suitable for the preparation of vaccines for a wide variety of pathogens, including viruses, bacteria and parasites. The disclosure also provides vaccine compositions (medicaments) containing a pathogen inactivated by exposure to hydrogen peroxide. Methods for eliciting an immune response in a subject by administering vaccine compositions containing a hydrogen peroxide inactivated pathogen are also provided. | 01-03-2013 |
20130004526 | Utilization of Dialkylfumarates - The present invention relates to the use of certain dialkyl fumarates for the preparation of pharmaceutical preparations for use in transplantation medicine or for the therapy of autoimmune diseases and said compositions in the form of micro-tablets or pellets. For this purpose, the dialkyl fumarates may also he used in combination with conventional preparations used in transplantation medicine and immunosuppressive agents, especially cyclosporines. | 01-03-2013 |
20130011420 | ANTISENSE ANTIVIRAL COMPOUNDS AND METHODS FOR TREATING A FILOVIRUS INFECTION - The present invention provides antisense antiviral compounds, compositions, and methods of their use and production, mainly for inhibiting the replication of viruses of the Filoviridae family, including Ebola and Marburg viruses. The compounds, compositions, and methods also relate to the treatment of viral infections in mammals including primates by Ebola and Marburg viruses. The antisense antiviral compounds include phosphorodiamidate morpholino oligonucleotides (PMOplus) having a nuclease resistant backbone, about 15-40 nucleotide bases, at least two but typically no more than half piperazine-containing intersubunit linkages, and a targeting sequence that is targeted against the AUG start site region of Ebola virus VP35, Ebola virus VP24, Marburg virus VP24, or Marburg virus NP, including combinations and mixtures thereof | 01-10-2013 |
20130011421 | TRITERPENE SAPONINS, METHODS OF SYNTHESIS, AND USES THEREOF - The present invention relates to triterpene glycoside saponin-derived adjuvants, syntheses thereof, intermediates thereto, and uses thereof. QS-7 is a potent immuno-adjuvant that is significantly less toxic than QS-21, a related saponin that is currently the favored adjuvant in anticancer and antiviral vaccines. Tedious isolation and purification protocols have hindered the clinical development of QS-7. A novel semi-synthetic method is provided wherein a hydrolyzed prosapogenin mixture is used to synthesize QS-7, QS-21, and related analogs, greatly facilitating access to QS-7 and QS-21 analogs for preclinical and clinical evaluation. | 01-10-2013 |
20130017211 | USE OF BETA-1,3 (4)-ENDOGLUCANOHYDROLASE, BETA-1,3 (4)-GLUCAN, DIATOMACEOUS EARTH, MINERAL CLAY AND GLUCOMANNAN TO AUGMENT IMMUNE FUNCTION - A method for the augmentation of immune function is described. The invention comprises a combination of β-1,3 (4)-endoglucanohydrolase, β-1,3 (4)-glucan, diatomaceous earth, mineral clay and glucomannan, which is fed to or consumed by mammalian or avian species in amounts sufficient to augment immune function. The invention described may be admixed with feeds or foods, incorporated into pelleted feeds or foods or administered orally to mammalian and avian species. | 01-17-2013 |
20130017212 | THERAPEUTIC USE OF THE 2m PROTEINAANM Mersel; MarcelAACI MontpellierAACO FRAAGP Mersel; Marcel Montpellier FRAANM Rakotoarivelo; ClovisAACI MontpellierAACO FRAAGP Rakotoarivelo; Clovis Montpellier FR - The use of beta2-microglobulin (β2m) as active ingredient, in particular in pharmaceutical compositions intended for the treatment of autoimmune diseases. | 01-17-2013 |
20130022628 | ACYL PSEUDOPEPTIDES WHICH CARRY A FUNCTIONALIZED AUXILIARY ARM - The present invention is directed in particular to dipeptide-like compounds derived from functionally substituted amino acids, having fatty acid chains bound thereto through amidification of the amine functional groups of said dipeptide-like compounds, one end portion of which bears an accessory functional side chain spacer, with the other end portion being an acid group either in neutral or charged state. | 01-24-2013 |
20130022629 | Modulators of Immunoinhibitory Receptor PD-1, and Methods of Use Thereof - Disclosed are an assay to identify modulators of the PD-1:PD-L pathway and PD-1:PD-L pathway modulators, e.g., compounds and pharmaceutical compositions thereof. Methods for treating diseases influenced by modulation of the PD-1:PD-L pathway such as, for example, autoimmune diseases, inflammatory disorders, allergies, transplant rejection, cancer, immune deficiency, and other immune system-related disorders, are also disclosed. | 01-24-2013 |
20130028921 | COMPOSITION COMPRISING COUMESTROL OR A BEAN EXTRACT CONTAINING COUMESTROL - The present invention relates to a composition which comprises as an active ingredient coumestrol or a bean extract containing coumestrol, whereby adipocyte differentiation is inhibited, the immune system of the body is improved, toxic substances are purged, and neurodegenerative disorders are prevented or improved. | 01-31-2013 |
20130039932 | QUICKLY SOLUBLE ORAL FILM DOSAGE CONTAINING STEVIOSIDES AS A UNPLEASANT TASTE MASKING AGENT - Disclosed is a quickly soluble oral film dosage for masking a nasty taste, in particular, a quickly soluble oral film dosage comprising a stevioside based sweetener and a high potency sweetener in a ratio by weight (w/w) of 1:3 to 3:1, which may efficiently mask a bitter or nasty taste of a medicine and may be quickly dissolved in a mouth without water, thereby improving an aftertaste thereof thus enhancing dosage acceptability of a patient. | 02-14-2013 |
20130045221 | T-CELL RECEPTOR CAPABLE OF RECOGNISING AN ANTIGEN FROM CYTOMEGALOVIRUS - The present invention provides a T-cell receptor (TCR) which binds to a peptide from the cytomegalovirus (CMV) phosphoprotein pp65 having the amino acid sequence NLVPMVATV (SEQ ID No. 1) when presented by a major histocompatability complex (MHC) molecule. The present invention also provides a nucleotide sequence encoding such a TCR, a vector comprising such a nucleotide sequence and its use to produce a CMV-specific T-cell. The present invention also provides the use of CMV-specific T-cell for cellular immunotherapy. | 02-21-2013 |
20130045222 | COMPOSITIONS AND METHODS FOR ENHANCING IMMUNE RESPONSES TO VACCINES - The disclosure provides adjuvants, immunogenic compositions, and methods useful for vaccination and immune response. In particular, the disclosure provides a class of adjuvants comprising cationic lipid:co-lipid mixtures and methods for delivering formulated compositions. | 02-21-2013 |
20130045223 | METHODS AND COMPOSITIONS TO PROTECT AQUATIC INVERTEBRATES FROM DISEASE - Compositions and methods of protecting aquatic invertebrates from disease is shown. In one embodiment, dsRNA or antisense RNA to a nucleic acid molecule of the disease-causing microorganism is prepared and delivered to the animal. In another embodiment, a nucleic acid molecule of the disease-causing microorganism is delivered to the animal. In another embodiment, the RNA or nucleic acid molecule is delivered to the animal by replicon particle. In a further embodiment, the protective molecule is delivered to the digestive tract of the animal. Protection from disease is obtained. | 02-21-2013 |
20130045224 | IMMUNOSTIMULATORY COMPOSITIONS AND METHODS OF USE THEREOF - Immunostimulatory compositions and methods of use are described to either enhance or diminish the immune stimulation effects of a honey or honey isolate by recognition of the presence of type II arabinogalactan compounds and utilising this knowledge to tailor the concentration of such compounds thereby adjusting the immune stimulation effects. | 02-21-2013 |
20130052211 | VACCINES WITH ONCOFETAL ANTIGEN/ILRP-LOADED AUTOLOGOUS DENDRITIC CELLS AND USES THEREOF - Disclosed are compositions containing isolated monocyte-derived mature dendritic cells loaded with OFA/iLRP, or a fragment thereof that selectively stimulates T cytotoxic lymphocytes, and a carrier, vaccine compositions containing effective dosage amounts of the dendritic cells, methods of making the vaccines, and methods of cancer treatment or therapy that entail administration of the vaccines to cancer patients. | 02-28-2013 |
20130052212 | Method for allogeneic cell therapy - A method of manipulating allogeneic cells for use in allogeneic cell therapy providing a composition of highly activated allogeneic T-cells which are infused into immunocompetent cancer patients to elicit a novel anti-tumor immune mechanism, or “Mirror Effect”. In contrast to current allogeneic cell therapy protocols where T-cells in the graft mediate the beneficial graft vs. tumor (GVT) and detrimental graft vs. host (GVH) effects, the allogeneic cells of the present invention stimulate host T-cells to mediate the “mirror” of these effects. The mirror of the GVT effect is the host vs. tumor (HVT) effect. The “mirror” of the GVH effect is the host vs. graft (HVG) effect. The anti-tumor HVT effect occurs in conjunction with a non-toxic HVG rejection effect. The highly activated allogeneic cells of the invention can be used to stimulate host immunity in a complete HLA mis-matched setting in a patient. | 02-28-2013 |
20130058963 | INDUCED TOLEROGENIC DENDRITIC CELLS FOR GENERATING CD8+ REGULATORY T CELLS - Disclosed are antigen-specific induced tolerogenic dendritic cells (itDCs) that generate CD8+ regulatory T cells, as well as related compositions and methods. | 03-07-2013 |
20130058964 | METHODS FOR ACTIVATING T CELLS AND MODULATING AN IMMUNE RESPONSE - The present invention is directed to a method for promoting differentiation, activation and proliferation of human T helper lymphocytes such as those that express IL17 and IL22 (Th-IL17+ and Th-IL22+ T cells) and provides methods for decreasing T cell activation or T cell biological activity, inhibiting an immune response and treating autoimmune diseases by increasing the biological activity of or administering a transcription factor such as a Krüppel-like factor or a forkhead box factor, and pharmaceutical compositions effective for these methods. Also, the present invention provides methods for increasing T cell activation or T cell biological activity, stimulating an immune response and treating diseases such as cancers and infections by decreasing the biological activity of or administering an inhibitor of a transcription factor such as a Krüppel-like factor or a forkhead box factor and pharmaceutical compositions effective for these methods. | 03-07-2013 |
20130064839 | METHOD OF RAPIDLY PRODUCING IMPROVED VACCINES FOR ANIMALS - A method of quickly producing a vaccine for a biotype of pathogenic microorganism is described, where a nucleic acid molecule or fragment thereof is obtained from a biological sample from an animal exposed to the microorganism, a protective molecule is prepared based on the nucleic acid molecule of interest or fragment thereof, and administered to an animal which has been or is as risk of being exposed to the microorganism. A protective response to the biotype of the microorganism is obtained in the animal. | 03-14-2013 |
20130071415 | Heterocyclic Compounds as Janus Kinase Inhibitors - The invention provides compounds of formula I: | 03-21-2013 |
20130078265 | LASER-BASED VACCINE ADJUVANTS - The invention is directed to a vaccine for generating an enhanced immune response in a subject previously exposed to non-destructive laser radiation, as compared to an immune response in a subject previously non-exposed to non-destructive laser radiation. The invention is also directed to use of a composition comprising a vaccine for use in combination with non-destructive laser radiation for generating an enhanced immune response from a subject, as compared to an immune response without the use of laser radiation. The laser exposure acts as an adjuvant for the vaccine, increasing the efficacy and/or potency of the vaccine. | 03-28-2013 |
20130089564 | Therapeutic Uses of Glandular Kallikrein - Provided is an immunosuppressive peptide of 40 kDa molecular weight, isolated from the submandibular glands (SMG*) of rats, having the capacity to suppress immune reactions upon parenteral administration to rats and mice. The peptide was identified as glandular kallikrein (K1) by partial sequencing and by enzymatic activity. Also provided are methods and compositions for Using K1 peptides in the treatment of autoimmune diseases. | 04-11-2013 |
20130089565 | IMMUNE PRIVILEGED AND MODULATORY PROGENITOR CELLS - Described herein is a method for modulating an immune reaction between lymphocytes and a body recognized by the lymphocytes as foreign. The method exploits the immunomodulating activity of a new class of progenitor cells termed HUCPVCs derived from the perivascular region of human umbilical cord. The method can also emply soluble factors exuded by cultured HUCPVCs. The method is useful to treat immune disorders including graft versus host disease, autoimmune disorders, and the like. | 04-11-2013 |
20130089566 | VACCINE PREVENTING AND/OR TREATING AUTOIMMUNE DISEASES - The present invention discloses a vaccine preventing and/or treating autoimmune diseases. Its active component is: the mixture consisting of a protein antigen causing an autoimmune disease or the epitope polypeptides thereof, and the recombinant eukaryotic vector with the coding genes of an autoantigen or the epitope polypeptides thereof inserted into multiple cloning sites. The autoantigen is insulin, glutamic acid decarboxylase or heat shock protein, myelin oligodendrocyte glycoprotein, two myelin antigens, zona pellucida 3, myoglobulin, type II collagen, thyroglobulin, cell membrane surface antigen, type II colloid antigen, acetylcholine receptor, thyrocyte cell surface antigen, salivary gland duct antigen, thyroglobulin, superantigen, or interphotoreceptor retinoid binding protein. The vaccine can inhibit the proliferation of T cells of immune animals and humans, induce the occurrence of immune suppression, as well as prevent and/or treat autoimmune diseases effectively. | 04-11-2013 |
20130095124 | COMPOSITIONS FOR TRANSFECTION OF BIOMOLECULES INTO CELLS - The present invention is directed to new compositions that are described for the simultaneous, controlled dose delivery of a variety of biomolecules into phagocytic cells. Such a composition is a biologically active composition comprising: (1) at least one of the following biologically active components: (a) a nucleic acid or a derivative thereof; (b) a nucleoside, nucleotide, or a derivative of a nucleoside or nucleotide; (c) a peptide, protein, or a derivative of a peptide or protein; (d) a lipopolysaccharide or a derivative thereof; (e) a peptidoglycan or a derivative thereof; (f) a carbohydrate or a derivative thereof; (g) a lipid or a derivative thereof; (h) a lipopeptide or a derivative thereof; (i) a metal ion; (j) a thiol; (k) an antibiotic or a derivative thereof; (I) a vitamin or a derivative thereof; (m) a bioflavonoid or a derivative thereof; (n) an antioxidant or a derivative thereof; (o) an immune response modifier; (p) an antibody; (q) a biologically active nonmetal; (r) histamine or an antihistamine; and (s) a kinase inhibitor; and (2) at least one carrier effective to deliver the composition to a phagocytic cell such that the biologically active component is taken up by the phagocytic cell and influences its biological activity. | 04-18-2013 |
20130095125 | PALATINOSE FOR ENHANCING DIETARY SUPPLEMENT AND PHARMACEUTICAL DELIVERY - The present invention is directed to a dietary supplement comprising palatinose or a derivative thereof. The dietary supplement may be a nutritional product, a sports performance product, a weight loss product or a meal replacement product. The present invention is also directed to a method of increasing the absorption of a compound into the bloodstream, cells and tissue comprising administering palatinose, or a derivative thereof, in combination with the compound. | 04-18-2013 |
20130095126 | USE OF SUBSTITUTED HETEROCYCLIC COMPOUNDS TO CONTROL SEA LICE ON FISH - The present invention relates to the use of compounds of formula | 04-18-2013 |
20130101609 | IRRADIATED BIODEGRADABLE POLYMER MICROPARTICLES - In one aspect, the present invention provides sterile microparticle compositions comprising biodegradable microparticles, which comprise at least one biodegradable polymer. In other aspects, the present invention provides methods of making and using such compositions as well as articles of manufacture and kits containing the same. | 04-25-2013 |
20130101610 | Therapeutic Uses of CD137 in Treating Autoimmune Disease - A method for treating or preventing a T-cell-mediated autoimmune disease is provided herein, the method including administering to a mammal in need thereof a therapeutically effective amount of soluble CD137 or CD137 | 04-25-2013 |
20130115232 | Methods for detecting graft-versus-host disease - The disclosure relates to the development of methods for detecting or predicting graft-versus-host disease (GVHD) and for detecting or predicting response to treatment for GVHD. More particularly, the disclosure provides new biomarkers and combinations of biomarkers for detecting or predicting gastrointestinal GI GVHD and for predicting and analyzing response to treatment for acute GVHD. | 05-09-2013 |
20130122025 | METHOD OF RAPIDLY PRODUCING IMPROVED VACCINES FOR ANIMALS - A method of quickly producing a vaccine for a biotype of pathogenic microorganism is described, where a nucleic acid molecule or fragment thereof is obtained from a biological sample from an animal exposed to the microorganism, a protective molecule is prepared based on the nucleic acid molecule of interest or fragment thereof, and administered to an animal which has been or is as risk of being exposed to the microorganism. A protective response to the biotype of the microorganism is obtained in the animal. | 05-16-2013 |
20130122026 | DNA VACCINE FOR ALZHEIMER'S DISEASE - The present invention aims to provide a DNA vaccine for Alzheimer's disease. | 05-16-2013 |
20130122027 | NEOEPITOPE DETECTION OF DISEASE USING PROTEIN ARRAYS - A biosensor for use in detecting the presence of diseases, the biosensor comprising a detector for detecting a presence of at least one marker indicative of a specific disease. A method of determining efficacy of a pharmaceutical for treating a disease or staging disease by administering a pharmaceutical to a sample containing markers for a disease, detecting the amount of at least one marker of the disease in the sample, and analyzing the amount of the marker in the sample, whereby the amount of marker correlates to pharmaceutical efficacy or disease stage. Markers for gynecological disease. An immuno-imaging agent comprising labeled antibodies, whereby the labeled antibodies are isolated and reactive to proteins overexpressed in vivo. Informatics software for analyzing the arrays, the software including analyzing means for analyzing the arrays. | 05-16-2013 |
20130129754 | NUCLEIC ACID COMPRISING OR CODING FOR A HISTONE STEM-LOOP AND A POLY(A) SEQUENCE OR A POLYADENYLATION SIGNAL FOR INCREASING THE EXPRESSION OF AN ENCODED PROTEIN - The present application describes a coding nucleic acid sequence, particularly a messenger RNA (mRNA), comprising or coding for a histone stem-loop and a poly(A) sequence or a polyadenylation signal and the use thereof for increasing the expression of an encoded protein. It also discloses its use for the preparation of a pharmaceutical composition, especially a vaccine e.g. for the use in the treatment of tumours and cancer diseases, cardiovascular diseases, infectious diseases, autoimmune diseases or genetic diseases, or in gene therapy. The present invention further describes an in vitro transcription method, in vitro methods for increasing the expression of a protein using the nucleic acid comprising or coding for a histone stem-loop and a poly(A) sequence or a polyadenylation signal and an ex vivo and in vivo method. | 05-23-2013 |
20130129755 | METHOD OF PRODUCING RECOMBINANT PROTEINS WITH MANNOSE-TERMINATED N-GLYCANS - We describe a method of expressing a recombinant protein comprising mannose-terminated N-glycans from a host cell, the method comprising: (a) introducing a nucleic acid encoding a recombinant protein into a Chinese Hamster Ovary (CHO) cell comprising a mutation in the GnT 1 gene (GenBank Accession Number AF343963) leading to loss of GnT 1 function; and (c) expressing the recombinant protein from the host cell, in which the expressed recombinant protein comprises a mannose-terminated glycan structure, and in which the method does not include a step of introducing functional GnT-1 into the host cell. The method may be used for producing recombinant glucocerebrosidase with a mannose-terminated glycan structure, suitable for treatment or prevention of Gaucher's Disease. | 05-23-2013 |
20130129756 | NOVEL IMMUNOADJUVANT COMPOUNDS AND USES THEREOF - The present invention relates to a cyclic beta glucan compound for use as an immuno adjuvant and vaccine composition comprising thereof. These novel adjuvant compounds represent in particular a new class of dendritic cell activating molecules. | 05-23-2013 |
20130129757 | METHODS AND SYSTEMS FOR TREATING CELL PROLIFERATION DISORDERS WITH PSORALEN DERIVATIVES - Psoralen compounds of Formula (I): | 05-23-2013 |
20130129758 | NOVEL CATIONIC AMPHIPHILES WITH MANNOSE-MIMICKING HEAD-GROUPS AND A PROCESS FOR THE PREPARATION THEREOF - The present invention discloses novel cationic amphiphiles containing mannose-mimicking shikimic and quinic acid head-groups and a process for preparing cationic amphiphiles with mannose-mimicking polar head-groups such as, shikimic and quinic acids. The findings described herein also demonstrate that compounds of the present invention can target model DNA vaccines to antigen presenting cells (APCs) such as macrophages and dendritic cells (DCs), via mannose receptors expressed on the cell surface of APCs. The cationic amphiphiles disclosed herein show enhanced cellular and humoral immune response compared to their mannosyl counterpart in dendritic cell (DC, the most professional APC) based genetic immunization in mice. Cationic amphiphiles with mannose-mimicking quinic and shikimic acid head-groups described in the present invention are likely to find future applications in the field of genetic immunization. | 05-23-2013 |
20130136757 | METHODS OF TREATING CANCER USING A COMBINATION OF AN IMMUNOMODULATORY COMPOUND AND AN ARTEMISININ OR A DERIVATIVE THEREOF - Provided herein are methods for treating cancers by administering immunomodulatory compounds in combination with artemisinin or a derivative thereof. In particular, methods for treating cancers by administering lenalidomide in combination with artemisinin or a derivative thereof are provided. | 05-30-2013 |
20130136758 | Immunostimulating Polyphosphazene Compounds - Polyphosphazene polymers having immunomodulating activity, and the biomedical use of such polyphosphazene polymers, in conjunction with an antigen or an immunogen are disclosed. | 05-30-2013 |
20130142814 | IMMUNOSTIMULATORY SEQUENCE OLIGONUCLEOTIDES AND METHODS OF USING THE SAME - The invention provides immunomodulatory polynucleotides and methods for immunomodulation of individuals using the immunomodulatory polynucleotides. | 06-06-2013 |
20130142815 | ALPHA-METHYL-TRYPTOPHAN AS AN INHIBITOR OF INDOLEAMINE DIOXYGENASE - The present invention demonstrates for the first time that alpha-methyl-tryptophan is an inhibitor of the enzyme indoleamine diooxygenase (IDO). The present invention includes the use of alpha-methyl-tryptophan in methods of modulating immune responses and treating cancer and infections. | 06-06-2013 |
20130142816 | COMPOSITIONS AND METHODS FOR ENHANCING FERTILITY - Methods of promoting reproductive health in an animal, including humans, by administering an effective amount of a composition containing at least one transfer factor are provided. | 06-06-2013 |
20130149321 | CANDIDATES AGAINST INFECTION - The present invention relates to the use of plasminogen/plasmin and its derivatives as agents for enhancing host defense against infection or other infectious diseases. The invention also relates to a method for screening of compounds which enhance host defense against infection by evaluating the host defense against bacterial arthritis and spontaneous otitis media in an animal model. | 06-13-2013 |
20130149322 | PROCESS FOR EXTRACTING MATERIALS FROM BIOLOGICAL MATERIAL - The invention is directed to a process for extracting materials from biological material, which process is characterized in that the naturally occurring biological material is treated with an extractant consisting of a deep eutectic solvent of natural origin or a an ionic liquid of natural origin to produce a biological extract of natural origin dissolved in the said solvent or ionic liquid. | 06-13-2013 |
20130156797 | Method for Preserving Alum Adjuvants and Alum-Adjuvanted Vaccines - A method for preserving an aluminium-salt adjuvant during freezing or drying comprising freezing or drying an aqueous suspension or solution comprising: (a) an aluminium salt adjuvant; (b) a compound of formula (I) or a physiologically acceptable salt or ester thereof or a compound of formula (II) or a physiologically acceptable salt or ester thereof; and (c) optionally, one or more sugars. | 06-20-2013 |
20130164311 | COMPOSITION, PREPARATION, AND USE OF DENSE CHITOSAN MEMBRANE MATERIALS - A composition of exceptionally dense chitosan and a novel method for producing the dense chitosan structure have been described. The novel production method employs coincident compression and vacuum on a neutralized chitosan polymer that results in an exceptionally dense chitosan film or membrane material. The dense chitosan film or membrane composition possesses multiple physical and clinically appealing qualities for a variety of medical applications on or in animals, mammals, or humans. | 06-27-2013 |
20130164312 | METHODS AND MATERIALS FOR THE GENERATION OF REGULATORY T CELLS - Methods are disclosed for the generation of immunosuppressive regulatory T cells. The methods can include contacting a population of CD4+CD25− T cells with a T cell receptor (TCR)/CD3 activator, a TCR co-stimulator activator, and rapamycin. Kits for the generation of immunosuppressive regulatory T cells, methods of use, and cell populations are also disclosed. | 06-27-2013 |
20130171177 | Therapeutic Use of Neural Stem Cells - The present invention provides an isolated cell obtainable from the CTX0E03 neural stem cell line for use in the treatment of a disorder associated with elevated levels of pro-inflammatory cytokines, wherein the disorder is selected from unipolar and bipolar depression, schizophrenia, obsessive compulsive disorder, autism and autistic syndrome disorders. | 07-04-2013 |
20130177581 | Compositions and Methods Related to mRNA Translational Enhancer Elements - Provided are mRNA translational enhancer elements (TEEs), e.g., SEQ ID NOs:1-35. Also provided are translational enhancer polynucleotides that comprise one or more of the specific TEEs exemplified herein or their variants, homologs or functional derivatives. Further provided are expression vectors comprising such TEEs or translational enhancer polynucleotides, as well as host cells and expression systems that harbor such vectors. | 07-11-2013 |
20130183324 | IMMUNOGENS FOR TREATMENT OF NEOPLASTIC AND INFECTIOUS DISEASE - The present invention relates to prophylactic and therapeutic methods of immunization against neoplastic and infectious diseases. The invention provides a method for identification of novel immunogens and compositions of such immunogens that are useful for eliciting immune responses against antigens associated with neoplastic or infectious diseases. | 07-18-2013 |
20130183325 | MUCOADHESIVE XYLOGLUCAN-CONTAINING FORMULATIONS USEFUL IN MEDICAL DEVICES AND IN PHARMACEUTICAL FORMULATIONS - Object of the invention are mucoadhesive and controlled release formulations consisting of aqueous solutions containing 0.05% to 5% by weight of a natural purified polymer having xyloglucan structure and 10% to 70% by weight of glycerol. These formulations are suitable for the application on human mucous membranes, such as nasal, oral and vaginal mucous membranes, as moisturizing and softening agents or as pharmaceutical release system. Further objects of the invention are pharmaceutical formulations and medical devices suitable for the application to human mucous membranes, containing the mucoadhesive and controlled release formulations together with active ingredients and excipients. | 07-18-2013 |
20130189288 | ADJUVANT COMPOSITIONS AND METHODS OF USE - This disclosure provides adjuvant compositions that are capable of modulating the immune response in a subject. These adjuvant compositions may also be used enhance the immunogenicity of antigens. Also provided are methods of making the adjuvant compositions as well as methods of using the adjuvant compositions. | 07-25-2013 |
20130195898 | MICROEMULSIONS WITH ADSORBED MACROMOLECULES AND MICROPARTICLES - Microparticles with adsorbent surfaces, methods of making such microparticles, and uses thereof, are disclosed. The microparticles comprise a polymer, such as a poly(α-hydroxy acid), a polyhydroxy butyric acid, a polycaprolactone, a polyorthoester, a polyanhydride, and the like, and are formed using cationic, anionic, or nonionic detergents. The surface of the microparticles efficiently adsorb biologically active macromolecules, such as DNA, polypeptides, antigens, and adjuvants. Also provided are compositions of an oil droplet emulsion having a metabolizable oil and an emulsifying agent. Immunogenic compositions having an immunostimulating amount of an antigenic substance, and an immunostimulating amount of an adjuvant composition are also provided. Methods of stimulating an immune response, methods of immunizing a host animal against a viral, bacterial, or parasitic infection, and methods of increasing a Th1 immune response in a host animal by administering to the animal an immunogenic composition of the microparticles, and/or microemulsions of the invention, are also provided. | 08-01-2013 |
20130195899 | THERAPEUTIC IMMUNE MODULATION BY STEM CELL SECRETED EXOSOMES - Disclosed are methods, compositions of matter, and protocols useful for the induction of a therapeutic immune modulatory response through administration of exosomes derived from a stem cell source. In one embodiment, said stem cell source is endometrial regenerative cells. Specifically, in one embodiment stem cell derived exosomes are used as a method of treating an autoimmune condition such as rheumatoid arthritis, multiple sclerosis, or systemic lupus erythromatosis. | 08-01-2013 |
20130195900 | IDENTIFICATION OF T CELL TARGET ANTIGENS - The present invention relates to a method of identifying a target antigen of T cells comprising (a) contacting (aa) cells expressing (i) a functional T cell receptor complex comprising predefined matching T cell receptor α and β chains; and (ii) a read-out system for T cell activation; with (ab) antigen-presenting cells carrying (iii) peptide libraries encoded by randomised nucleic acid sequences; and (iv) MHC molecules recognised by the T cell receptor of (i); (b) assessing T cell activation using said read-out system; (c) isolating antigen-presenting cells that are in contact with the cells in which the read-out system indicates T cell activation; (d) identifying the target antigen or the nucleic acid molecule encoding said target antigen. | 08-01-2013 |
20130202627 | USE OF FLAGELLINS FROM THE GENUS MARINOBACTER AS VACCINATION ADJUVANTS - Use of flagellins from the genus | 08-08-2013 |
20130202628 | PRODUCTION AND THERAPEUTIC USES OF TH1-LIKE REGULATORY T CELLS - A unique CD4 | 08-08-2013 |
20130202629 | USES OF PHOSPHOLIPID CONJUGATES OF SYNTHETIC TLR7 AGONISTS - The invention provides uses for phospholipid conjugates of TLR agonists, for instance in vaccines, and to prevent, inhibit or treat a variety of disorders including inflammation, cancer and pathogen, e.g., microbe, infection. | 08-08-2013 |
20130202630 | COMPOSITIONS AND METHODS FOR ENHANCING IMMUNE RESPONSES TO VACCINES - The disclosure provides adjuvants, immunogenic compositions, and methods useful for vaccination and immune response. In particular, the disclosure provides a class of adjuvants comprising cationic lipid:co-lipid mixtures and methods for delivering formulated compositions. | 08-08-2013 |
20130202631 | COMPOSITION FOR PREVENTING OR TREATING LIVER DISEASES, CONTAINING PLANT STEM CELL LINES DERIVED FROM THE CAMBIUM OF PANAX GINSENG INCLUDING MOUNTAIN GINSENG OR GINSENG AS ACTIVE INGREDIENT - The present invention relates to a composition for preventing or treating liver diseases, which contains, as an active ingredient, any one or more of a homogeneous cell line derived from the cambium of | 08-08-2013 |
20130209497 | WHOLE EGG PROTEIN PEPTIDES, PREPARATION METHOD AND USE THEREOF - Provided are whole egg protein peptides and the preparation method thereof, wherein the whole egg protein peptides are obtained by adopting compound proteases composed of pawpaw protease, fig protease and pineapple protease to enzymatically hydrolyze the whole egg protein powder. The whole egg protein peptides can be used for manufacture of products for enhancing immunity. | 08-15-2013 |
20130216562 | PRODUCTION OF CLOSED LINEAR DNA USING A PALINDROMIC SEQUENCE - A primer for the amplification of a DNA template comprising a protelomerase target sequence, particularly for production of closed linear DNA, which primer is capable of specifically binding to a palindromic sequence within a protelomerase target sequence and priming amplification in both directions. | 08-22-2013 |
20130224230 | THERAPEUTIC USES OF GLANDULAR KALLIKREIN - The present invention relates to pharmaceutical compositions comprising glandular kallikrein in combination with myelin basic protein or copaxone for use in the treatment of multiple sclerosis. The present invention further relates to a method of suppressing autoimmune responses in a patient afflicted with or suffering at least one clinical sign of multiple sclerosis, comprising administering to said patient a therapeutically effective amount of glandular kallikrein in combination with a therapeutically effective amount of myelin basic protein or copaxone. | 08-29-2013 |
20130236480 | TRANSGLUTAMINASE 2 INHIBITORS FOR USE IN THE PREVENTION OR TREATMENT OF RAPIDLY PROGRESSIVE GLOMERULONEPHRITIS - The present invention relates to TG2 inhibitors for use in the prevention or treatment of rapidly progressive glomerulonephritis and to pharmaceutical compositions thereof. | 09-12-2013 |
20130236481 | HETEROCYCLE -ARYL COMPOUNDS FOR INFLAMMATION AND IMMUNE-RELATED USES - The invention relates to compounds that are useful as immunosuppressive agents and for treating and preventing inflammatory conditions, allergic disorders, and immune disorders. | 09-12-2013 |
20130236482 | AUGMENTATION OF TITER FOR VACCINATION IN ANIMALS - The disclosure relates to a composition added to animal feed used in combination with a vaccine to enhance the effectiveness of the vaccine. Amongst other effects, the composition raises the titer of antibodies to the vaccine. | 09-12-2013 |
20130236483 | FGF MODULATION OF IN VIVO ANTIBODY PRODUCTION AND HUMORAL IMMUNITY - The invention provides methods for increasing or decreasing antibody production in vivo by inhibiting or promoting the activity of fibroblast growth factor-2 (FGF2) respectively. | 09-12-2013 |
20130243797 | COMPOSITION COMPRISING HYDROLYSED PROTEINS AND OLIGISACCHARIDES FOR TREATING SKIN DISEASES - The invention discloses a composition comprising at least one N-acetyl lactosamine, at least one sialylated oligosaccharide and at least one fucosylated oligosaccharide, and a hydrolysate comprising partially and/or extensively hydrolysed proteins, for use in the prevention and/or treatment of skin conditions and skin diseases. Preferably said composition is a starter infant formula. Said skin disease is in particular atopic dermatitis. | 09-19-2013 |
20130273081 | VACCINATION AGAINST PCSKK 9 FOR LOWERING CHOLESTEROL - The present invention relates to pharmaceutical compositions comprising PCSK9 DNA or PCSK9 proteins or PC-SK9 peptides and CpG adjuvant; this composition is used to lower cholesterol levels specifically LDL cholesterol levels. | 10-17-2013 |
20130273082 | TRISACCHARIDE DERIVATES, AND THEIR USE AS ADJUVANTS - The present invention relates to the use of trisaccharide derivates comprising a substituted trisaccharide core, which trisaccharide core is fully substituted with fatty acid ester groups, and optionally one or more anionic groups as adjuvants, to the trisaccharide derivates as such, to a method for preparing such trisaccharides, to trisaccharides obtained with such method, to adjuvant compositions comprising such trisaccharide derivates and to a vaccine or kit comprising such adjuvant compositions. | 10-17-2013 |
20130273083 | System for Immunotherapy Targeting Tumor Propagation and Progression - Finding biologically relevant cancer markers is key to developing an effective treatment. Once specific antigens have been identified that are present on the cell population responsible for propagating tumors, T cells can be genetically altered to target these antigens and then used for personalized T cell therapy. A method to identify and select peptide antigens that effectively associate with and are presented by host HLA surface molecules originating from tumor cells responsible for the persistence and propagation of a cancer has been developed. The system of using these data to produce T cells engineered to express T cell receptors recognizing the peptide antigens is used in the production of a personalized adoptive T cell therapy for cancer that eliminates the cells capable of tumor propagation and cancer progression. The system is especially useful in the production of cancer treatments to achieve complete durable remission of cancers of epithelial origin. | 10-17-2013 |
20130273084 | USE OF A DNA EXPRESSION CONSTRUCT - The present invention relates to the use of a DNA expression construct comprising a dumbbell-shaped circular strand of deoxyribonucleic acids and provides such a construct with a double-stranded stem and single-stranded loops located at both ends of the stem, wherein the stem comprises complementary deoxyribonucleic acids of the circular strand with a promotor sequence, a coding sequence and a termination signal to be administered by jet injection for the treatment of cancer. | 10-17-2013 |
20130280283 | COMBINATION OF VACCINATION AND INHIBITION OF MHC CLASS I RESTRICTED ANTIGEN PRESENTATION - The present invention relates to a vaccine/inhibitor combination comprising as a vaccine at least one antigen and as an inhibitor at least one inhibitor of the major histocompatibility complex (MHC) class I restricted antigen presentation. The present invention furthermore relates to a method of vaccination of a mammal using the inventive vaccine/inhibitor combination. The present invention also provides kit of parts comprising the inventive vaccine/inhibitor combination, preferably in different parts of the kit, e.g. for prior, concurrent or subsequent administration of the different parts. Additionally the invention relates to a pharmaceutical composition comprising the inventive vaccine/inhibitor combination to further improve the immune response against tumour cells and infected cells having lost the capability of MHC class I restricted antigen presentation. | 10-24-2013 |
20130280284 | MODULATION OF ANTIGEN IMMUNOGENICITY BY DELETING EPITOPES RECOGNIZED BY NKT CELLS - The invention describes a method and compounds for the prevention of immune responses towards allofactors, towards viral vectors used for gene therapy and gene vaccination, towards proteins to which subjects are naturally exposed, towards genetically-modified organisms and towards undesirable effects related to vaccine administration for allergic or infectious diseases. | 10-24-2013 |
20130287803 | NOVEL USES OF VEGFXXXB - The invention provides VEGF | 10-31-2013 |
20130295122 | ELASTIN DIGEST COMPOSITIONS AND METHODS UTILIZING SAME - The present invention provides compositions for the therapeutic and/or cosmetic treatment of Elastin comprising tissues. Therapeutic and cosmetic compositions comprising an elastin digest stimulate the endogenous production of Elastin and appear to enhance the elasticity of the skin and provide an external supply of peptide precursors of Elastin that penetrate into the tissue to which it is applied. The present invention describes compositions containing an elastin digest derived from proteolytic digestion of insoluble elastin derived from mammalian ligaments with a protein digesting composition, such as proteinase K. The elastin digest is a mixture of elastin peptides wherein the elastin peptide mixture comprises peptides of the sequence GXXPG, wherein X represents one of the natural amino acids. The elastin digest of the present invention may also comprise epitopes of cytokines, growth factors and di-peptides. Methods of using these elastin digest comprising compositions for treating tissues in need of increased elasticity and or Elastin are described. | 11-07-2013 |
20130302360 | MUCOSAL ADJUVANT COMPOSITION - Problem to be Solved: The present invention provides a novel mucosal adjuvant. | 11-14-2013 |
20130309258 | Methods for Treatment of Cancer - The present invention provides compositions and methods for treating cancer in a human. The invention includes relates to administering a genetically modified T cell to express a CAR wherein the CAR comprises an antigen binding domain, a transmembrane domain, a costimulatory signaling region, and a CD3 zeta signaling domain. | 11-21-2013 |
20130315938 | Delivering polypeptides to phagocytes - The current invention is a particle comprising an assembly of lipid-enveloped core polypeptides and transmembrane polypeptides. The transmembrane polypeptides comprise sequences that bind to phagocytes through indirect or direct binding by surface receptors. The result of transmembrane polypeptide binding is engulfment by the phagocyte to low-pH compartments. The low pH triggers a conformational change in transmembrane polypeptides whereby lipids of particles and phagocytes are fused and the contents of the particle, including a polypeptide to be delivered to the cell, are released into the phagocyte. | 11-28-2013 |
20130315939 | Use of Cytokines and Mitogens to Inhibit Pathological Immune Responses - The invention is generally related to methods of treating autoimmune diseases, including both antibody-mediated and cell-mediated disorders. | 11-28-2013 |
20130315940 | TREATMENT OF LIVER CANCER - The present invention derives from the finding that increased levels of Toll related receptor 9 (TLR9) and Toll related receptor 7 (TLR7) are associated with liver cancer and in particular hepatocellular carcinoma. Accordingly, the invention provides TLR9 and TLR7 antagonists for use in a method of treating liver cancer. The invention provides other strategies such as modulation of endosomal signalling by using compounds such as chloroquine to prevent or treat such liver cancer. The invention also provides agents capable of inducing an immune response against TLR9 and TLR7 for use in a method of treating liver cancer. The presence of TLR9 and TLR7 expression may be indicative of the presence of liver cancer and the amount of TLR9 and TLR7 expression may be indicative of the rate of growth or spreading of the cancer. | 11-28-2013 |
20130323269 | METHODS AND COMPOSITIONS FOR DELIVERY OF ACTIVE AGENTS - A lipid particle can include a cationic lipid. The cationic lipid can include one or more hydrophobic tails, which can include one or more sites of unsaturation. The sites of unsaturation can include cycloalkyl groups, e.g., cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl groups. The lipid particle is suitable for delivering an active agent. | 12-05-2013 |
20130323270 | CYCLOSPORINE EMULSION - The present invention relates to a cyclosporine emulsion containing: i) a cyclosporine ii) a natural oil (long chain triglyceride) iii) a phosphatidylcholine, iv) glycerol, v) a pharmaceutically tolerable alkali salt of a free fatty acid, vi) a medium chain triglyceride-oil vii) optionally, hydrochloric acid or sodium hydroxide for pH adjustment viii) water. | 12-05-2013 |
20130323271 | NITRIC OXIDE DONOR NEPRILYSIN INHIBITORS - In one aspect, the invention relates to compounds having the formula: | 12-05-2013 |
20130330363 | METHOD OF VACCINATION - The present invention provides a method of expressing an antigenic molecule or a part thereof on the surface of an antigen-presenting cell, said method comprising introducing a molecule into the cell cytosol by photochemical internalisation, wherein said molecule, or a part thereof, is subsequently presented on the surface of said cell. Methods of vaccination comprising this method, together with compositions comprising said cells and uses involving said cells expressing antigenic molecules are also provided. | 12-12-2013 |
20130330364 | THERAPEUTIC FORMULATIONS - The present invention concerns therapeutic formulations containing active agents, such bioactive cell populations, and methods of making and using the same. | 12-12-2013 |
20130330365 | NEPRILYSIN INHIBITORS - In one aspect, the invention relates to compounds having the formula X: | 12-12-2013 |
20130330366 | NEPRILYSIN INHIBITORS - In one aspect, the invention relates to compounds having the formula XII: | 12-12-2013 |
20130336996 | NOVEL COMPOSITIONS OF TLR7 AND/OR TLR8 AGONISTS CONJUGATED TO LIPIDS - A conjugated compound of formula Q-Z—R | 12-19-2013 |
20130336997 | PHOSPHORYLATED DENDRIMERS AS ANTIINFLAMMATORY DRUGS - Dendrimers with monophosphonic or bisphosphonic terminations for the treatment of inflammatory diseases. | 12-19-2013 |
20130344095 | METHOD OF USING CD1D OVER-EXPRESSION IN HUMAN DENDRITIC CELLS TO ENHANCE CD8+ T CELL-BASED AND INVARIANT NATURAL KILLER T CELL-BASED ANTITUMOR IMMUNITY - The manipulation of human dendritic cells (DCs) to induce potent anti-tumor immunity remains an essential subject of study. Here we report that the overexpression of CD1d in human DCs can enhance the priming of naïve CD8+ T cells against tumor antigen. We showed that CD1d can be overexpressed in the human DCs using baculoviral vector carrying the CD1d gene. This CD1d-overexpression is functional as demonstrated by the increased expansion of invariant natural killer T (iNKT) cells while using these modified DCs to present α-galactosylceramide (α-GC). Pulsed with tumor antigenic peptide, these CD1d-overexpressing human DCs showed enhanced capability to prime naïve CD8+ T cells. CD1d-overexpressing human DCs also induced a pro-inflammatory cytokine profile that may favor the priming. Moreover, this CD1d-overexpression strategy can be extrapolated to monocyte-derived human DCs. Therefore, our study suggest that overexpression of CD1d in human DCs may provide a novel strategy to enhance DC immunogenicity and the possible translation into human cancer immunotherapy. | 12-26-2013 |
20140004133 | TREATMENT METHOD FOR RELAPSING-REMITTING MULTIPLE SCLEROSIS | 01-02-2014 |
20140004134 | NF-KB SIGNALING PATHWAY-MANIPULATED DENDRITIC CELLS | 01-02-2014 |
20140010830 | Non-Coding Immunomodulatory DNA Construct - The present invention relates to a nucleic acid molecule and its use for the modulation of the immune system. It provides a DNA construct for immunomodulation comprising at least one nucleotide in L-conformation. | 01-09-2014 |
20140023667 | PYRROLIDINE-FUSED THIADIAZINE DIOXIDE COMPOUNDS AS BACE INHIBITORS, COMPOSITIONS, AND THEIR USE - In its many embodiments, the present invention provides certain iminothiadiazine dioxide compounds, including compounds Formula (I): and tautomers and stereoisomers thereof, and pharmaceutically acceptable salts of said compounds, said tautomeros and said stereoisomers, wherein each of W, Z, R | 01-23-2014 |
20140023668 | C5-C6 OXACYCLIC-FUSED THIADIAZINE DIOXIDE COMPOUNDS AS BACE INHIBITORS, COMPOSITIONS, AND THEIR USE - In its many embodiments, the present invention provides certain iminothiadiazine dioxide compounds, including compounds Formula: (I) and tautomers and stereoisomers thereof, and pharmaceutically acceptable salts of said compounds, said tautomeros and said stereoisomers, wherein each of ring A, ring B, ring C, R | 01-23-2014 |
20140023669 | USE OF A HYPOALLERGENIC CEREAL COMPOSITION FOR INDUCING SPECIFIC ORAL TOLERANCE - A partial hydrolysate of cereal protein for use in inducing specific oral tolerance in a young mammal with allergy to said cereal protein, wherein the hydrolysate has a degree of hydrolysis between 9 and 18%, is disclosed. | 01-23-2014 |
20140037657 | INHIBITION OF TUMOR GROWTH - The present invention provides a cytotoxic 7 to 25 mer peptide with three or more cationic residues which has one or more non-genetic bulky and lipophilic amino acids, as well as esters, amides, salts and cyclic derivatives thereof as well as methods of preparing the peptides, pharmaceutical compositions containing them and their use as medicaments, particularly as antibacterions or antitumoral agents. In a preferred aspect, the invention provides the use of said peptides in a method of inducing adaptive immunity against tumor growth or establishment in a subject, as well as the use of other lytic agents in a method of inducing adaptive immunity in a subject. | 02-06-2014 |
20140037658 | Diagnosis and Treatment of Alzheimer's Disease - Methods are provided for the prevention, treatment and diagnosis of Alzheimer's disease, based on the glycosylation pattern of amyloid-beta peptides in body fluids and tissues. | 02-06-2014 |
20140037659 | SNX9 AS A NOVEL BIOMARKER FOR CHRONIC INFLAMMATION AND ASSOCIATED IMMUNOSUPPRESION AND A NEW REGULATOR OF T CELL RECEPTOR EXPRESSION AND FUNCTION - The present invention relates to diagnostic and prognostic methods and kits for assessing chronic inflammation and associated immune-suppression. More particularly, the invention relates to the use of SNX9 (sorting nexin 9 protein) as a biomarker for chronic inflammation and associated immune-suppression, specifically, in subjects suffering from chronic inflammatory conditions. The invention further provides a prognostic tool for detecting regression or recurrence of the diseases and a powerful tool for assessing efficacy of a treatment. The present invention further provides SNX9 as an immunomodulator and therefore relates to methods for treating immune-related disorders by modulating SNX9 expression. | 02-06-2014 |
20140050747 | Trace Elements - The invention discloses a trace element solution, which comprises at least one metal selected from the group comprising selenium, copper, zinc, manganese and chromium; and at least one component selected from the group comprising a vitamin, a vaccine, a growth stimulant, a dewormer, iron dextran, an antibiotic and a synchronisation preparation. The synchronisation preparation is a combination of injectable hormonal preparations, inplantable hormonal preparations, intravaginal hormonal preparation and other slow release hormonal preparation. The antibiotics include oral, injectable and implantable theurapeutic remedies. The vaccine includes antigens and a combination of antigens and adjuvents. The growth stimulants include zeranol, estradiol, testosterone, progesterone and trenbolone acetate. The dewormer includes macrocydic lactones, leramizoles, benzimidazoles and salicylanilides. The macrocydic lactones include doramectin, ivermectin, abamectin and moxidectin. | 02-20-2014 |
20140050748 | MUTANT CD83 PROMOTER AND USE THEREOF - The present invention provides a mutant CD83 promoter comprising the promoter/enhancer regions of human CD83 promoter and being dendritic cell-specific, and the use thereof, specifically for the treatment or prevention of diseases or medical conditions related to malignancy, autoimmunity or prevention of transplant rejections. | 02-20-2014 |
20140056927 | LIPOTHEICHOIC ACID FROM LACTIC ACID BACTERIA AND ITS USE TO MODULATE IMMUNE RESPONSES MEDIATED BY GRAM-NEGATIVE BACTERIA, POTENTIAL PATHOGENIC GRAM-POSITIVE BACTERIA - The invention relates to a composition for modulating the immune responses induced by Gram negative bacteria, potential pathogenic Gram positive bacteria and/or their derivatives, comprising lipoteichoic acid from lactic acid bacteria as an active ingredient. It also relates to the use of a lipoteichoic acid from lactic acid bacteria as an active ingredient and/or lactic acid bacteria producing it and/or its supernatant of culture, in the manufacture of a medicament, an oral or topical product for cosmetic, dermatological or opthalmological applications, a food or petfood composition for modulating bacterial colonisaion, immune responses and decreasing the inflammatory processes, associated with bacterially mediated disease and infection in the gastrointestinal tract, bone, skin, eye, ear, lung and rectal cavity. The invention also relates to lipoteichoic acid selected thereof. | 02-27-2014 |
20140056928 | NOVEL COMPOUNDS - Compounds of formula (I) and salts thereof: | 02-27-2014 |
20140056929 | IMMUNOMODULATION BY CONTROLLING INTERFERON-GAMMA LEVELS WITH THE LONG NON-CODING RNA NeST - Compositions and methods of modulating an immune response by controlling levels of interferon-gamma (IFN-γ) production by leukocytes are disclosed. Adjustment of IFN-γ levels is achieved by increasing or decreasing the activity of NeST (nettoie | 02-27-2014 |
20140056930 | USING POMEGRANATE EXTRACTS FOR INCREASING PROSTATE SPECIFIC ANTIGEN DOUBLING TIME - A method of increasing a prostate specific antigen (PSA) doubling time in treating a patient. A subject with rising serum PSA is selected. A composition is administered to the subject comprising a therapeutically effective amount of a pomegranate extract comprising a higher content of high molecular weight polyphenol compared to pomegranate juice from arils. The therapeutically effective amount increases a prostate specific antigen doubling time. The pomegranate extract is formed from an insoluble byproduct component obtained by placing pomegranate solids in an aqueous solution, heating the aqueous solution to between about 60° F. to about 210° F., adding at least one enzyme to the aqueous solution, and removing residual insoluble solid materials from the aqueous solution. | 02-27-2014 |
20140056931 | GENETIC ADJUVANTS FOR IMMUNOTHERAPY - The present invention pertains to methods and pharmaceutical compositions for modulating an immune response. The method of the present invention involves administration of an effective amount of nucleic acid molecules encoding interleukin-12 (IL-12), interferon-gamma (IFN-γ), or a combination thereof, to a patient in need of such treatment. The pharmaceutical compositions of the invention contain nucleic acid molecules encoding IL-12 and/or IFN-γ and an operably-linked promoter sequence. In another aspect, the present invention concerns expression vectors containing a nucleotide sequence encoding IL-12 and IFN-γ, and an operably-linked promoter sequence. In another aspect, the present invention concerns cells genetically modified with a nucleotide sequence encoding IL-12 and IFN-γ. | 02-27-2014 |
20140065173 | TUMOR LYSATE LOADED PARTICLES - Dendritic cells containing tumor lysate loaded particles are prepared. The dendritic cells present tumor antigens to elicit the Major Histocompatibility Complex class I pathway and can be used as a vaccine to treat cancer, including ocular melanoma. | 03-06-2014 |
20140065174 | PHARMACEUTICAL COMPOSITION FOR ENHANCHING IMMUNITY, AND EXTRACT OF PORIA - A pharmaceutical composition is used to enhance immunity of the human body. The composition contains potent components of lanostane compounds. A method is devised to obtain an extract from metabolite, sclerotium, or fermentation product of | 03-06-2014 |
20140072588 | ABSORPTION OF THERAPEUTIC AGENTS ACROSS MUCOSAL MEMBRANES OR THE SKIN - Absorption of a therapeutic agent across a mucosal membrane or the skin can be enhanced using an absorption enhancer comprising a hydroxy fatty acid ester of polyethylene glycol. | 03-13-2014 |
20140079723 | Therapeutic Compositions and Associated Methods - Methods and materials for treating various diseases and medical conditions with meso-biliverdin compositions. In addition methods and materials for producing meso-biliverdin are provided where the methods include reacting phycocyanobilin with an amphoteric compound in a solvent to yield meso-biliverdin are provided. | 03-20-2014 |
20140079724 | NOVEL IMMUNE SYSTEM MODULATORS - The present invention relates to a compound of Formula I: or a pharmaceutically acceptable salt thereof, wherein the symbols are as defined in the specification; a pharmaceutical composition comprising the same; and a method for treating or preventing autoimmunity disease using the same. | 03-20-2014 |
20140099333 | PYRROLIDINONE DERIVATIVES AS GPR119 MODULATORS FOR THE TREATMENT OF DIABETES, OBESITY, DYSLIPIDEMIA AND RELATED DISORDERS - The present invention relates to pyrrolidinone derivatives. The pyrrolidinone derivatives are GPR119 modulators and useful for the prevention and/or treatment of diabetes, obesity, dyslipidemia and related disorders. The invention furthermore relates to the use of pyrrolidinone derivatives as active ingredients in pharmaceuticals, and pharmaceutical compositions comprising them. | 04-10-2014 |
20140112945 | NOVEL PHTHALAZINONE-PYRROLOPYRIMIDINECARBOXAMIDE DERIVATIVES - The compounds of formula (1) | 04-24-2014 |
20140112946 | DEUTERIUM-ENRICHED 4-HYDROXY-5-METHOXY-N,1-DIMETHYL-2-OXO-N-[(4-TRIFLUORO-METHYL)PHENYL]-1,2- -DIHYDROQUINOLINE-3-CARBOXAMIDE - Deuterium-enriched 4-hydroxy-5-methoxy-N,1-dimethyl-2-oxo-N-[(4-trifluoromethyl)-phenyl]-1,2-dihydroquinoline-3-carboxamide, having a deuterium enrichment in the amide-N methyl group of at least 70%; or a salt thereof with a pharmaceutically acceptable organic or inorganic cation; and a method of preparing said compounds. The compounds are useful in therapy, e.g. for the treatment of a malignant hyperproliferative disorder or an autoimmune disease. | 04-24-2014 |
20140120121 | MEDICINAL TREATMENT OF ATOPIC INFLAMMATORY DISEASES - The methods disclosed herein relate to the treatment of atopic inflammatory disorders, such as dermal or pulmonary atopic inflammatory disorders, in humans, by administering a therapeutically effective amount of ractopamine. | 05-01-2014 |
20140120122 | METHOD FOR MONITORING VACCINE RESPONSE USING SINGLE CELL NETWORK PROFILING - The present invention provides methods for determining safety and efficacy of a vaccine by monitoring cellular pathways prior to and after vaccine treatment using single cell network profiling | 05-01-2014 |
20140134194 | HBV EPITOPE REACTIVE EXOGENOUS T CELL RECEPTOR (TCR) AND USES THEREOF - There is provided at least one isolated cell comprising at least one HBV epitope-reactive exogenous T cell receptor and/or fragment thereof, and methods for producing them. In particular, there is provided polynucleotides, constructs and vectors encoding at least one HBV epitope-reactive exogenous T cell receptor for use in the treatment of Hepatitis B Virus (HBV) and Hepatocellular Carcinoma (HCC). The invention further provides kits and methods of detection of HBV and HCC. | 05-15-2014 |
20140134195 | BETA-2 MICROGLOBULIN-DEFICIENT CELLS - The invention provides isolated primate cells preferably human cells that comprise a genetically engineered disruption in a beta-2 microglobulin (B2M) gene, which results in deficiency in MHC class I expression and function. Also provided are the method of using the cells for transplantation and treating a disease condition. | 05-15-2014 |
20140134196 | VACCINE AND METHOD FOR TREATMENT OF NEURODEGENERATIVE DISEASES - Methods and compositions are provided for treatment of neurodegenerative diseases in which there is accumulation of misfolded and/or aggregated proteins, excluding prion diseases. In particular, the invention relates to treatment of the neurodegenerative diseases Huntington's disease (HD), Alzheimer's disease (AD) or Parkinson's disease (PD), by administration of an agent selected from the group consisting of (i) Copolymer 1, (ii) a Copolymer 1-related peptide, (iii) a Copolymer 1-related polypeptide, and (iv) T cells activated with (i), (ii) or (iii). | 05-15-2014 |
20140141026 | GENERATION OF ANTIGEN SPECIFIC T CELLS - The present invention is directed to a method of generating antigen specific T cells. Furthermore, the invention is directed to antigen specific T cells, isolated transgenic TCR's, pharmaceutical compositions containing same and their use in adoptive cell therapy. This invention in particular pertains to the use of cells co-expressing allogeneic MHC molecules and antigens to induce peptide-specific T cells from non-selected allogeneic T cell repertoires. | 05-22-2014 |
20140154274 | METHODS AND COMPOSITIONS FOR USE IN INTRALYMPHATIC CELLULAR THERAPIES - The present invention provides medical uses and methods for the intralymphatic administration of cellular therapies. Further aspects of the invention provide compositions, kits and uses for the intralymphatic administration of cellular therapies. | 06-05-2014 |
20140154275 | GENE EXPRESSION MARKERS FOR CROHN'S DISEASE - The present invention relates to methods of gene expression profiling for inflammatory bowel disease pathogenesis, in which the differential expression in a test sample from a mammalian subject of one or more IBD markers relative to a control is determined, wherein the differential expression in the test sample is indicative of an IBD in the mammalian subject from which the test sample was obtained. | 06-05-2014 |
20140154276 | Mesenchymal Stem Cells and Uses Therefor - Methods of treating autoimmune diseases, allergic responses, cancer, or inflammatory diseases in an animal, promoting would healing, repairing epithelial damage and promoting angiogenesis in an organ or tissue of an animal by administering to the animal mesenchymal stem cells in an effective amount. | 06-05-2014 |
20140154277 | Pharmaceutical Compositions Comprising Soluble CD137 - A method for treating or preventing a T-cell-mediated autoimmune disease is provided herein, the method including administering to a mammal in need thereof a therapeutically effective amount of soluble CD137 or CD137 | 06-05-2014 |
20140154278 | Method for allogeneic cell therapy - A method of manipulating allogeneic cells for use in allogeneic cell therapy providing a composition of highly activated allogeneic T-cells which are infused into immunocompetent cancer patients to elicit a novel anti-tumor immune mechanism, or “Mirror Effect”. In contrast to current allogeneic cell therapy protocols where T-cells in the graft mediate the beneficial graft vs. tumor (GVT) and detrimental graft vs. host (GVH) effects, the allogeneic cells of the present invention stimulate host T-cells to mediate the “mirror” of these effects. The mirror of the GVT effect is the host vs. tumor (HVT) effect. The “mirror” of the GVH effect is the host vs. graft (HVG) effect The anti-tumor HVT effect occurs in conjunction with a non-toxic HVG rejection effect. The highly activated allogeneic cells of the invention can be used to stimulate host immunity in a complete HLA mis-matched setting in a patient. | 06-05-2014 |
20140161830 | AMINE-CONTAINING LIPIDOIDS AND USES THEREOF - Provided herein are lipidoids that may be prepared from the conjugate addition of alkylamines to acrylates. In some embodiments, provided lipidoids are biodegradable and may be used in a variety of drug delivery systems. Given the amino moiety of the lipidoids, they are well-suited for the delivery of polynucleotides, in addition to other agents. Nanoparticles containing the inventive lipidoids and polynucleotides have been prepared and have been shown to be effective in delivering siRNA. | 06-12-2014 |
20140170173 | METHOD OF INDUCING IMMUNE TOLERANCE COMPRISING ADMINISTERING CARBONIC ANHYDRASE I - The purpose of the present invention is to provide a method for treating autoimmune diseases. Disclosed is a method or the like for the treatment of autoimmune diseases, which utilizes an antigen-specific tolerogenic antigen presenting cell. Specifically disclosed are: a method for producing an antigen-specific tolerogenic antigen presenting cell, which is characterized by using carbonic anhydrase I; an immunogenic antigen presenting cell which is specific to carbonic anhydrase I; and a method or the like for the treatment of autoimmune diseases (especially inflammatory bowel diseases), which is characterized by using a tolerogenic antigen presenting cell which is specific to carbonic anhydrase I. | 06-19-2014 |
20140170174 | POLYCHLORINATED BIPHENYLS AND SQUALENE-CONTAINING ADJUVANTS - When using squalene in a vaccine adjuvant, there is a possibility of contamination with polychlorinated biphenyls (PCBs). Environmental exposure to PCBs may adversely affect children's immune responses to routine vaccinations. Thus the invention uses squalene with low or no PCB contamination, particularly when derived from shark liver. | 06-19-2014 |
20140170175 | NOVEL LIPIDS AND COMPOSITIONS FOR INTRACELLULAR DELIVERY OF BIOLOGICALLY ACTIVE COMPOUNDS - The present invention provides novel amino-lipids, compositions comprising such amino-lipids and methods of producing them. In addition, lipid nanoparticles comprising the novel amino-lipids and a biologically active compound are provided, as well as methods of production and their use for intracellular drug delivery. | 06-19-2014 |
20140170176 | TREATMENT METHOD FOR RELAPSING-REMITTING MULTIPLE SCLEROSIS - Disclosed is a method for treating relapsing-remitting multiple sclerosis in a patient by administering to the patient autologous, ex vivo-expanded CD4 | 06-19-2014 |
20140170177 | Food Supplement Having High Immunological Value, Based On A Protein Matrix - The invention relates to a food supplement having high immunological value, based on a protein matrix, i.e. a food compound with high immunological value, based on the mixture of four protein sources: i. biotechnologically improved bovine colostrum; ii. egg albumin; iii. soy protein isolate; and, iv. concentrated whey protein. | 06-19-2014 |
20140186378 | GLYCOLIPIDS AND ANALOGUES THEREOF AS ANTIGENS FOR NKT CELLS - This invention relates to immunogenic compounds which serve as ligands for NKT (natural killer T) cells and to methods of use thereof in modulating immune responses. | 07-03-2014 |
20140193439 | VACCINES AND IMMUNOTHERAPEUTICS COMPRISING IL-15 RECEPTOR ALPHA AND/OR NUCLEIC ACID MOLECULES ENCODING THE SAME, AND METHODS FOR USING THE SAME - Compositions, recombinant vaccines and live alternated pathogens comprising one or more isolated nucleic acid molecules that encode an immunogen in combination with an isolated nucleic acid molecule that encodes IL-15Ra or a functional fragment thereof are disclosed. Methods of inducing an immune response in an individual against an immunogen, using such compositions are disclosed. | 07-10-2014 |
20140193440 | MARKERS OF ALZHEIMERS DISEASE - An inflammatory process is suggested to be involved in the pathogenesis of Alzheimer's disease (AD), a neurodegenerative disorder characterized by the presence of neuritic plaques within the cerebral cortex that are mainly composed of a small insoluble protein of 40-42 aminoacids (amyloid protein). Amyloid-specific Interleukin-10 (IL-10) generation is found to be selectively and significantly reduced in AD patients (p=0.023). The genotype associated with high IL-10 production is extremely infrequent in AD individuals (2% vs. 28%). The presence of low/intermediate-IL-10-producing genotypes (GCC/ATA; ATA/ATA) was associated with an earlier age at disease onset and (ACC/ACC; ACC/ATA) with an accelerated rate of disease progression/severity and with amyloid-specific impairment of IL-10 production. This relationship is independent of ApoE gene polymorphism. These results support the use of anti-inflammatory compounds in the therapy of this disease. | 07-10-2014 |
20140199332 | METHOD OF TREATING CANCER WITH AN HLA-A*3303-RESTRICTED WT1 PEPTIDE AND PHARMACEUTICAL COMPOSITION COMPRISING THE SAME - Disclosed are: a peptide comprising an amino acid sequence composed of contiguous nine amino acid residues derived from a WT1 protein, wherein an amino acid residue at position 2 in the amino acid sequence is selected from the group consisting of Ala, Ile, Leu, Val, Phe, Tyr, Ser and Asp and an amino acid residue at position 9 in the amino acid sequence is Arg; a polynucleotide encoding the peptide; a pharmaceutical composition comprising the peptide; and a method of treating cancer using the peptide. | 07-17-2014 |
20140205618 | HUMAN FERTILITY ENHANCEMENT WITH CORTISOL REDUCTION FOOD - A method of using a medical food to increase human fertility. This medical food consists of transfer factor, lactic acid generating bacteria, and glucans in appropriate combinations. The medical food, administered correctly, reduces cortisol levels. Progesterone increases as cortisol decreases, and progesterone is needed to support pregnancy and ovulation. Dosage amounts are adjusted for client weight. Typically, consumption of the medical food begins several days before planned conception. | 07-24-2014 |
20140212441 | PHARMACEUTICAL COMPOSITION FOR INFLAMMATORY DISEASES, ALLERGIC DISEASES AND AUTOIMMUNE DISEASES - The present invention relates to methods and pharmaceutical compositions for immunosuppression by using the fatty acid derivative represented by formula (I). The present invention further relates to methods and pharmaceutical compositions for treating inflammatory diseases, allergic diseases and autoimmune diseases by using said fatty acid derivative. | 07-31-2014 |
20140212442 | IMMUNOMODULATORS AND IMMUNOMODULATOR CONJUGATES - The invention provides compounds of formula I: wherein R1-R3, Ra, and Rb have any of the values defined herein, and salts thereof. The compounds have immunomodulatory properties. | 07-31-2014 |
20140220048 | APOPTOTIC CELL-MEDIATED TRANSFECTION OF MAMMALIAN CELLS WITH INTERFERING RNA - Mammalian host cells for use in a cell-mediated tranfection process, which contain an RNAi molecule and an expression vector for a pro-apoptotic protein. The method includes inducing apoptotic cell (AC) death in mammalian cells that contain an RNAi molecule capable of downregulating a chosen target gene. Living cells expressing the target gene are then exposed to the ACs. The ACs are processed by the living cells, and the RNAi molecule in the ACs downregulates the expression of the target gene in living cells. | 08-07-2014 |
20140220049 | MICRORNA INHIBITION FOR THE TREATMENT OF INFLAMMATION AND MYELOPROLIFERATIVE DISORDERS - The present disclosure relates to the finding that microRNA-155 plays a role in inflammation, hematopoiesis and myeloproliferation, and that dysregulation of microRNA-155 expression is associated with particular myeloproliferative disorders. Disclosed herein are methods and compositions for diagnosing an treating disorders, including inflammation and myeloproliferation, modulating the levels of expression of one or more genes selected from the group consisting of Cutl1, Arntl, Picalm, Jarid2, PU.1, Csflr, HIFlα, Sla, Cepbβ, and Bach1, and the like. | 08-07-2014 |
20140220050 | NOVEL IMMUNOMODULATOR AND ANTI-INFLAMMATORY COMPOUNDS - The present invention provides dihydroorotate dehydrogenase inhibitors, methods of preparing them, pharmaceutical compositions containing them and methods of treatment, prevention and/or amelioration of diseases or disorders wherein the inhibition of Dihydroorotate dehydrogenase is known to show beneficial effect. | 08-07-2014 |
20140220051 | METHODS OF MODULATING HVEM, BTLA AND CD160 CIS COMPLEX RESPONSE OR SIGNALING ACTIVITY WITH SOLUBLE LIGHT POLYPEPTIDE SEQUENCES - The invention provides HVEM cis complexes which include, for example, HVEM/BTLA, HVEM/CD160 and HVEM/gD cis complexes. The invention provides ligands and agents that bind to HVEM cis complexes, such as antibodies. The invention further provides methods of use of the HVEM cis complexes, and the ligands and agents (e.g., LIGHT polypeptide sequence) that bind to the HVEM cis complexes. | 08-07-2014 |
20140220052 | COMPOSITIONS AND METHODS FOR WOUND HEALING, AND FOR RECRUITMENT AND ACTIVATION OF MACROPHAGES IN INJURED TISSUES AND IN IMPLANTED BIOMATERIALS USED FOR TISSUE ENGINEERING - The present invention is related to the field of wound healing or tissue regeneration due to disease (i.e., for example, cardiovascular diseases, osetoarthritic diseases, or diabetes) and to healing of internal injuries. In particular, the present invention provides compositions and methods comprising molecules and nanoparticles with linked α-gal epitopes for induction of recruitment and activation of macrophages localized within or surrounding damaged and/or injured tissue. The recruited macrophages further recruit stem cells into the injured tissues. The recruited macrophages and stem cells promote the repair and regeneration of the treated injured tissue. In some embodiments, the present invention provides treatments for tissue repair in normal subjects and in subjects having impaired healing capabilities, such as diabetic and aged subjects. In some embodiments, the present invention provides treatments for injured tissues such as brain, peripheral nerve, heart muscle, skeletal muscle, lung, cartilage, bone, gastrointestinal tract and dysfunctional endocrine tissues. The invention further provides methods and compositions comprising molecules and nanoparticles with linked α-gal epitopes for inducing recruitment and activation of macrophages into biomaterial implants for improving the conversion of such implants into functional tissues and organs within treated patients. | 08-07-2014 |
20140220053 | MICROVESICLES ISOLATED FROM MESENCHYMAL STEM CELLS FOR USE AS IMMUNOSUPPRESSIVE AGENTS - The present invention concerns microvesicles isolated from mesenchymal stem cells as immunosuppressive agents for treatment of inflammatory and immune pathologies. | 08-07-2014 |
20140234347 | METHODS OF USING BIOMARKERS FOR PREDICTING THE OUTCOME OF AN IMMUNOTHERAPY AGAINST CANCER - The present invention relates to methods for predicting the effect of an immunotherapy against cancer in a patient based on new biomarkers. The present invention furthermore relates to a prognosis regarding the outcome based on said biomarkers. The present invention furthermore relates to panels of biomarkers for use in the above methods. | 08-21-2014 |
20140234348 | Universal Immune Receptor Expressed by T Cells for the Targeting of Diverse and Multiple Antigens - The invention provides compositions and methods for adoptive T cell therapy in treating a variety of disorders including cancer, infections, and autoimmune disorders. In one embodiment, the invention provides a universal immune receptor (UnivIR) that comprises an extracellular label binding domain, a transmembrane domain, and a cytoplasmic domain or otherwise an intracellular domain. | 08-21-2014 |
20140234349 | NANOPARTICLES, PROCESS FOR PREPARATION AND USE THEREOF AS CARRIER FOR AMPHIPATIC AND HYDROPHOBIC MOLECULES IN FIELDS OF MEDICINE INCLUDING CANCER TREATMENT AND FOOD RELATED COMPOUNDS - The present invention regards nanoparticles comprising a sterol and a component derived from | 08-21-2014 |
20140242098 | DRUG DISPENSING AND DOSING METHOD AND DEVICE - Flexible film or strip dosing device and method for various therapeutic applications are disclosed. The device includes at least one film or strip and a packaging container for the film or strip. The film or strip normally include a polymer base with or without a therapeutic agent admixed with the polymer base. The film or strip is printed with doses, marks or calibrated lines to indicate different length of the film and therefore the different doses of the therapeutic agents. The packaging container or dispenser can have marks or calibrated lines similar to a ruler which measures the length of film and therefore the different doses of therapeutic agents. The packaging container may have a built-in cutter to conveniently cut the film or strips as needed for flexible dosing of therapeutic agents. | 08-28-2014 |
20140242099 | COMPOUNDS FOR INFLAMMATION AND IMMUNE-RELATED USES - The invention relates to certain compounds or pharmaceutically acceptable salts, solvates, clathrates, or prodrugs thereof, that are useful as immunosuppressive agents and for treating and preventing inflammatory conditions, allergic disorders, and immune disorders. | 08-28-2014 |
20140248297 | PREDICTORS OF RESPONSE TO IMMUNOTHERAPY - The invention is directed to a method to predict individuals who are likely to respond to immunotherapy by detecting enhanced levels of antibodies in the plasma or serum wherein the antibodies are characteristic of the response or non-response of pretested populations of subjects. | 09-04-2014 |
20140248298 | BIORESORABLE POLYMER MATRICES AND METHODS OF MAKING AND USING THE SAME - Bioactive agents are delivered to a body site in need of the same by providing a first aliquot portion of a reaction mixture which includes an aldehydic polymer solution, and a second aliquot portion of a reaction which includes a cross-linking hydrazide and a bioactive agent. The first and second aliquot portions may be mixed (e.g., by expelling such portions from respective syringe barrels) to form the reaction mixture thereof. The thus formed reaction mixture may then be installed at the body site whereby the reaction mixture is allowed to solidify in situ within about 1 to 10 minutes into a reaction product comprised of a hydrazide cross-linked oxidized aldehydic polymer matrix with the bioactive agent entrapped therein. | 09-04-2014 |
20140248299 | VINYL-PHENYL DERIVATIVES FOR INFLAMMATION AND IMMUNE-RELATED USES - The invention relates to compounds of structural formula (Ia): | 09-04-2014 |
20140255433 | PDE5 INHIBITOR COMPOSITIONS AND METHODS FOR IMMUNOTHERAPY - The invention features methods and compositions featuring a PDE5 inhibitor for treating or preventing immunological-mediated disease in a subject. | 09-11-2014 |
20140286971 | SINGLE NUCLEOTIDE POLYMORPHISMS (SNP) AND ASSOCIATION WITH RESISTANCE TO IMMUNE TOLERANCE INDUCTION - This application discloses methods, systems and kits for correlating the presence or absence of certain nucleic acid sequences within a population with the ability to create immune tolerance in that same population. Tolerance can be induced by solo or repeated administration of antigen, including soluble antigens administered either intravenously or sublingually. This application also discloses methods for detecting variants. In addition the application addresses the use or avoidance of non steroidal anti inflammatory drugs in therapy. | 09-25-2014 |
20140294869 | IMMUNE TOLERANCE INDUCER - An object of the present invention is to provide a drug and a method for effectively inducing donor-specific immune tolerance in a recipient in transplantation therapy. A complex of an siRNA for a costimulatory factor and schizophyllan is delivered to a Dectin-1 expressing cell which specifically recognizes schizophyllan to regulate the function of the Dectin-1 expressing cell, and therefore can induce immunosuppression effect as well as induce immune tolerance effectively. | 10-02-2014 |
20140294870 | Autoimmune and Inflammatory Disorder Therapy - Compounds that bind to phosphatidylinositol-4-kinase IIIβ (PI4KIIIβ) and inhibit the binding of PI4KIIIβ to its substrate and/or inhibit PI4KIIIβ activity may be used in the treatment and/or prevention of an autoimmune or inflammatory disorder, or organ or cell transplant rejection. A new assay for identifying compounds for use in treating and/or preventing those pathological conditions, which comprises measuring the inhibition of PI4KIIIβ activity, is also disclosed. | 10-02-2014 |
20140294871 | AMINO ACID SEQUENCES FOR CONTROLLING PATHOGENS - The present invention relates to antimicrobial peptides, isolated and purified from extracts of tilapia ( | 10-02-2014 |
20140294872 | METHODS OF PREPARING LYOPHILIZED SPHERICAL-SHAPED PELLETS OF BIOLOGICAL MATERIALS - Methods for preparing lyophilized pellets of biological materials are described. The pellets have a substantially spherical shape and are prepared by freezing droplets of a liquid composition of a desired biological material on a flat, solid surface, in particular, a surface that does not have any cavities, followed by lyophilizing the frozen droplets. These methods are useful for preparing lyophilized pellets having a high concentration of a desired biological material, in particular a therapeutic protein or vaccine, and which have a faster reconstitution time than lyophilized powder cakes prepared in vials. | 10-02-2014 |
20140294873 | SMALL MOLECULE SCREEN FOR INHIBITORS OF NFAT: AP-1: DNA INTERACTIONS - The invention provides a screening assay for selecting inhibitors of NFAT:Transcription factor interactions. The invention also provides compositions and methods for inhibiting immune response in a subject. | 10-02-2014 |
20140294874 | APOAEQUORIN FOR REDUCING NEURONAL INJURY DUE TO ISCHEMIA - The present invention provides apoaequorin-based compositions and methods for preconditioning neurons in a subject to reduce neuronal injury due to brain ischemia. Methods include the step of administering apoaequorin to neurons in a subject, wherein the apoaequorin initiates a change in cytokine expression levels resulting in a reduction of neuronal injury due to brain ischemia as compared to neurons not administered the apoaequorin. Various formulations, including injectable dosages, are described. | 10-02-2014 |
20140302067 | PERSIMMON LEAF-DERIVED POLYSACCHARIDE FRACTION HAVING IMMUNE FUNCTION-ENHANCING ACTIVITY AND METHOD PRODUCING THE SAME - A persimmon leaf-derived polysaccharide fraction, a preparation method thereof, and use thereof, the persimmon leaf-derived polysaccharide fraction including, based on the total weight of the polysaccharide fraction, 70-90 wt % of neutral sugar and 10-30 wt % of uronic acid. | 10-09-2014 |
20140302068 | MicroRNA Biomarkers for Diagnosing Parkinson's Disease - The identification, development and validation of plasma-based circulating microRNA (miRNAs) biomarkers useful in determining if a subject has Parkinson's disease (PD), is at increased risk of developing PD, or has PD that is progressing or is in remission are presented. | 10-09-2014 |
20140302069 | MODULATORS OF C3A RECEPTORS - Heterocyclic compounds that modulate C3a receptors and their use in the treatment or prevention of inflammatory diseases, infectious diseases, cancers, metabolic disorders, obesity, type 2 diabetes, metabolic syndrome and associated cardiovascular diseases are described. The use of the compounds in stimulating or suppressing an immune response is also described together with pharmaceutical compositions comprising the compounds or their pharmaceutically acceptable salts. | 10-09-2014 |
20140308303 | METHOD FOR SELECTING A CANDIDATE DRUG COMPOUND - The disclosure relates to the field of candidate drug testing and drug development. A method is provided for providing a compound composed of at least one molecule attached via at least two linkages to a molecular scaffold, the method comprising providing a scaffold comprising at least a first and a second reactive group; providing at least one molecule capable of reacting with the at least first and second reactive group; contacting the scaffold with at least one molecule to form at least two linkages between the scaffold and the at least one molecule in a coupling reaction, wherein the formation of a linkage accelerates the formation of a consecutive linkage, preferably wherein the coupling reaction is performed in solution, more preferably in an aqueous solution. Furthermore, a method is provided for selecting a candidate drug compound comprising providing a library of compounds hereof and determining the binding of a target molecule to the compounds. | 10-16-2014 |
20140308304 | LIPIDS FOR THE DELIVERY OF ACTIVE AGENTS - The present invention relates to novel cationic lipids that can be used in combination with other lipid components such as cholesterol and PEG-lipids to form lipid nanoparticles with oligonucleotides, to facilitate the cellular uptake and endosomal escape, and to knockdown target mRNA both in vitro and in vivo. The invention also relates to lipid particles comprising a neutral lipid, a lipid capable of reducing aggregation, a cationic lipid of the present invention, and optionally, a sterol. The lipid particle may further include a therapeutic agent such as a nucleic acid. | 10-16-2014 |
20140314795 | METHOD AND COMPOSITIONS FOR CELLULAR IMMUNOTHERAPY - The present invention provides methods and compositions to confer and/or augment immune responses mediated by cellular immunotherapy, such as by adoptively transferring genetically modified tumor specific CD8+ T cells in the presence of tumor-specific, subset specific genetically modified CD4+ T cells, wherein the CD4+ T cells confer and/or augment a CD8+ T cells ability to sustain anti-tumor reactivity and increase and/or maximize tumor-specific proliferation of the tumor-specific CD8+ T cells of interest. Pharmaceutical formulations produced by the method, and methods of using the same, are also described. | 10-23-2014 |
20140314796 | MARKER FOR NEUROMYELITIS OPTICA - The present invention provides for methods and materials for diagnosing and treating neuromyelitis optica (NMO). | 10-23-2014 |
20140314797 | YEAST STRAIN FOR THE PRODUCTION OF PROTEINS WITH TERMINAL ALPHA-1,3-LINKED GALACTOSE - Lower eukaryotic host cells have been engineered to produce glycoprotein having at least one terminal α-galactosyl epitope. The glycoproteins are useful for the production of highly antigenic glycoprotein compositions with advantages for the production of vaccines. | 10-23-2014 |
20140314798 | METHOD TO MEASURE INFLAMMATION IN THE CONJUNCTIVA OF PATIENTS WITH TEAR DYSFUNCTION - The present invention concerns methods and compositions for treatment and determination of the presence or likelihood of an individual to have an ocular surface inflammation. In specific embodiments, a sample from the individual is assayed for the expression level of three or more genes, including IL-6, MMP3, MMP9, IFNy, SPRR-IA, HLA-DRA, MUC5AC, K7, and IL17A. Treatment is provided to an individual with ocular surface inflammation based upon the gene analysis. | 10-23-2014 |
20140322249 | DNA VACCINES AGAINST TUMOR GROWTH AND METHODS OF USE THEREOF - A DNA vaccine suitable for eliciting an immune response against cancer cells comprises a DNA construct operably encoding a cancer-associated Inhibitor of Apoptosis-family protein and an immunoactive gene product, such as a cytokine or a ligand for a natural killer cell surface receptor, in a pharmaceutically acceptable carrier. A preferred cytokine is CCL21. Preferred ligands for a natural killer cell surface receptor include human MICA, human MICB, human ULBP1, human ULBP2, and human ULBP3. The cancer-associated Inhibitor of Apoptosis (IAP)-family protein is preferably a survivin protein or livin protein. Method of inhibiting tumor growth by administering the vaccine of the invention to a mammal is also described. | 10-30-2014 |
20140328867 | MICROWAVE VACUUM-DRYING OF ORGANIC MATERIALS - An apparatus ( | 11-06-2014 |
20140335110 | LASER-BASED VACCINE ADJUVANTS - The invention is directed to a vaccine for generating an enhanced immune response in a subject previously exposed to non-destructive laser radiation, as compared to an immune response in a subject previously non-exposed to non-destructive laser radiation. The invention is also directed to use of a composition comprising a vaccine for use in combination with non-destructive laser radiation for generating an enhanced immune response from a subject, as compared to an immune response without the use of laser radiation. The laser exposure acts as an adjuvant for the vaccine, increasing the efficacy and/or potency of the vaccine. | 11-13-2014 |
20140335111 | VACCINES AND IMMUNOTHERAPEUTICS USING IL-28 AND COMPOSITIONS AND METHODS OF USING THE SAME - Compositions, recombinant vaccines and live attenuated pathogens comprising one or more isolated nucleic acid molecules that encode an immunogen in combination with an isolated nucleic acid molecule that encodes IL-28 or a functional fragment thereof are disclosed. Methods of inducing an immune response in an individual against an immunogen, using such compositions are disclosed. | 11-13-2014 |
20140335112 | NOVEL DOUBLE-STRANDED RIBONUCLEIC ACIDS WITH RUGGED PHYSICO-CHEMICAL STRUCTURE AND HIGHLY SPECIFIC BIOLOGIC ACTIVITY - A novel form of Rugged dsRNA with a unique composition and physical characteristics was identified with high specificity of binding to TLR3, which conveys an important range of therapeutic opportunities. Unlike the previous known antiviral Ampligen® (poly I, poly C12,U) the new and improved form (poly I, poly C | 11-13-2014 |
20140341932 | Novel pepetides - The present invention relates to novel peptides derivable from the polypeptide chaperonin 60.1 and to their use in medicine, such as for the prevention and/or treatment of inflammatory conditions. | 11-20-2014 |
20140341933 | USE OF PDL1 EXPRESSING CELLS TO CONVERT T CELLS INTO REGULATORY T CELLS - The present invention provides methods and compositions for converting a T cell into a cell that exhibits at least one regulatory T cell phenotype. The converted T cell is generated by contacting a T cell with a cell that is modified to comprise an agent capable of activating PD1 signaling in a T cell. The converted T cell is useful for preventing, suppressing, blocking or inhibiting an immune response. For example the converted T cell is useful for preventing rejection of a transplanted tissue in a human or other animal host, or protecting against graft versus host disease. The converted T cell can also be used to treat autoimmune diseases. | 11-20-2014 |
20140341934 | PROCESS FOR EXTRACTING MATERIALS FROM BIOLOGICAL MATERIAL - The invention is directed to a process for extracting materials from biological material, which process is characterized in that the naturally occurring biological material is treated with an extractant consisting of a deep eutectic solvent of natural origin or a an ionic liquid of natural origin to produce a biological extract of natural origin dissolved in the said solvent or ionic liquid. | 11-20-2014 |
20140348861 | SYNTHETIC PEPTIDES AND RANDOM COPOLYMERS FOR THE TREATMENT OF AUTOIMMUNE DISORDERS - Synthetic peptides and peptide copolymers for amelioration of autoimmune neurological syndrome, inflammatory and/or demyelinating conditions such as encephalomyletis are provided herein. The synthetic peptides and peptide copolymers as disclosed are obtained by substitution of at least one alpha amino acid by beta amino acid and/or β3-homo amino acid. | 11-27-2014 |
20140356386 | IMMUNIZATION PROTOCOL FOR DIRECTED EXPANSION AND MATURATION - A first antigen is administered to a subject to select progenitor B cells that are suitable for subsequent production of a desirable affinity-matured antibody, and then a second antigen is administered to stimulate the expansion of B cells that produce that affinity-matured antibody. An immunization protocol is used in which two different antigens are administered (usually in series, but in some embodiment simultaneously), where the first antigen elicits an efficient germline antibody response and the second antigen elicits an efficient and desired affinity-matured antibody response. | 12-04-2014 |
20140356387 | METHOD FOR INDUCING IMMUNE TOLERANCE THROUGH TARGETTED GENE EXPRESSION - A method of inducing immune tolerance against a protein of interest comprising the steps of (a) transducing hematopoietic stem cells with a gene for the protein of interest wherein the gene is operably connected to a platelet specific promoter, and (b) transplanting the transfected cells of step (a) into to a subject, wherein the protein is expressed, and wherein the subject develops immune tolerance against the protein. | 12-04-2014 |
20140363456 | TUMOR-SPECIFIC GM-CSF CYTOKINE RESPONSE AS PREDICTOR OF CANCER VACCINE EFFECTIVENESS - The present invention relates to methods of treating cancer with a cancer vaccine using granulocyte-macrophage colony-stimulating factor (GM-CSF) as a biomarker; methods of prognosticating an outcome of cancer treatment with a cancer vaccine using GM-CSF as a biomarker; methods for qualifying subjects for cancer vaccination using GM-CSF as a biomarker; methods for comparing the efficacy of two or more cancer vaccine treatments based on GM-CSF response; and kits for the effective treatment of cancer. | 12-11-2014 |
20140363457 | 2-THIO-1,3,4-OXADIAZOLES AZETIDINE DERIVATIVES AS SPHINGOSINE-1 PHOSPHATE RECEPTORS MODULATORS - The present invention relates to 2-thio-1,3,4-oxadiazoles azetidine derivatives, processes for preparing them, pharmaceutical compositions containing them and their use as pharmaceuticals as modulators of sphingosine-1-phosphate receptors. | 12-11-2014 |
20140370038 | CD4+ CD25+ T-CELLS ACTIVATED TO A SPECIFIC ANTIGEN - The invention relates to a method of assessing whether a subject includes CD4+,CD25+ T cells that have been activated to a specific antigen. The method includes the steps of obtaining from the subject a sample of lymphocytes including CD4+,CD25+ T cells, incubating at least one portion of the sample of lymphocytes so as to promote, distinction of CD4+,CD25+ T cells that have been activated to the specific antigen from those CD4+,CD25+ T cells that have not been activated to the specific antigen, and thereafter determining whether CD4+,CD25+ T cells activated to the specific antigen are present in the sample. The invention further relates to methods of growing CD4+, CD25+ T cells that have been activated to a specific antigen in vitro and to methods of increasing tolerance in a subject using the CD4+, CD25+ T cells that have been grown in vitro. | 12-18-2014 |
20140377291 | GLYCOSPHINGOLIPIDS FOR USE IN MODULATING IMMUNE RESPONSES - Provided herein are sphingolipid compounds that are useful for activating natural killer T cells. Also provided are methods for treating or preventing a disease or disorder that is treatable by activating the immune system by stimulating natural killer T cells. The compounds are therefore useful for treating or reducing the likelihood of occurrence of an immune diseases and disorders, such as autoimmune diseases or disorders. The compounds may also be used for treating or reducing the likelihood of occurrence of a microbial infection or for treating or reducing the likelihood of occurrence of a cancer in a subject by administering the sphingolipid compounds described herein. | 12-25-2014 |
20140377292 | MODULATORS OF INDOLEAMINE 2,3-DIOXYGENASE AND METHODS OF USING THE SAME - The present invention is directed to modulators of indoleamine 2,3-dioxygenase (IDO), as well as compositions and pharmaceutical methods thereof. | 12-25-2014 |
20140377293 | METHODS FOR TREATING NEWLY DIAGNOSED MULTIPLE MYELOMA WITH 3-(4-AMINO-1-OXO-1,3-DIHYDRO-ISOINDOL-2-YL)-PIPERIDINE-2,6-DIONE IN COMBINATION WITH DEXAMETHASONE - Methods of treating, preventing and/or managing cancer as well as and diseases and disorders associated with, or characterized by, undesired angiogenesis are disclosed. Specific methods encompass the administration of an immunomodulatory compound alone or in combination with a second active ingredient. The invention further relates to methods of reducing or avoiding adverse side effects associated with chemotherapy, radiation therapy, hormonal therapy, biological therapy or immunotherapy which comprise the administration of an immunomodulatory compound. Pharmaceutical compositions, single unit dosage forms, and kits suitable for use in methods of the invention are also disclosed. | 12-25-2014 |
20150017190 | USE OF EPITOPES INDUCING SPECIFIC TOLERANCE FOR THE PREVENTION OF TISSUE REJECTION - The present invention relates to a composition for use in the prevention of the rejection of skin tissue, comprising an effective amount of a peptide comprising an epitope of an antigen selected from the group of the polypeptides type XVII collagen, VII collagen, integrin alpha 6, integrin beta 4, chains of laminin, chains of laminin 322, type IV collagen, plectin, plakoglobin, bullous pemphigoid antigen 1, periplakin, envoplakin, desmoglein 1, desmoglein 3, a desmocollin and human bullous pemphigoid antigen 2 (hBPAG2) wherein said epitope induces immunological tolerance against its underlying polypeptide, and/or a nucleic acid for expressing a peptide comprising an epitope of said antigen as well as a gene therapy based on the composition, in the context of autoimmune blistering diseases, such as bullous pemphigoid or genetic skin diseases such as epidermolysisbullosa. | 01-15-2015 |
20150017191 | ADJUVANT FORMULATIONS COMPRISING TLR4 AGONISTS AND METHODS OF USING THE SAME - Formulations and methods, including vaccines and pharmaceutical compositions for inducing or enhancing an immune response are disclosed. The formulations generally comprise a TLR4 agonist and a metabolizable oil at a concentration of about 0.01%-1% v/v, wherein the hydrophobic:lipophilic balance (HLB) of the emulsion is greater than about 9. | 01-15-2015 |
20150023990 | ALKOXY SUBSTITUTED IMIDAZOQUINOLINES - Imidazoquinoline compounds with an alkoxy substituent at the 6, 7, 8, or 9-position, pharmaceutical compositions containing the compounds, intermediates, methods of making, and methods of use of these compounds as immunomodulators, for inducing or inhibiting cytokine biosynthesis in animals and in the treatment of diseases including viral, and neoplastic, are disclosed. | 01-22-2015 |
20150030619 | Activation and Expansion of T Cell Subsets Using Biocompatible Solid Substrates with Tunable Rigidity - The present invention provides compositions and methods for activation and expansion of T cells using a biocompatible solid substrate with tunable rigidity. Rigidity of a substrate is an important parameter that can be used to control the overall expansion and differentiation of T cells. | 01-29-2015 |
20150037361 | COMPOSITIONS AND METHODS TO TREAT THE BIHORMONAL DISORDER IN DIABETES - The described invention provides methods and compositions for treating diabetes and hyperglycemia in a mammal comprising administering to the mammal a therapeutic amount of a glucagon depleting compound. Also provided are methods and compositions for eliciting a bihormonal response in a mammal comprising administering to the mammal a therapeutic amount of a glucagon depleting compound. The glucagon depleting compound is effective to normalize glucagon, insulin, glucose, glycated hemoglobin (HgAlC) and C peptide in a mammal suffering from diabetes. | 02-05-2015 |
20150044239 | Compositions and Methods for Diagnosing, Preventing and Treating Intracranial Aneurysms - The present invention relates to compositions and methods for diagnosing, preventing and treating intracranial aneurysm. | 02-12-2015 |
20150044240 | P53 VACCINES FOR THE TREATMENT OF CANCERS - The present invention relates to immunotherapy methods for treating hyperproliferative disease in humans, particularly to hyperproliferative disease that is refractory to therapy. More specifically, the invention is directed, in one embodiment, to methods for treating a subject with a hyperproliferative disease in which the expression of a self gene is upregulated in therapy-resistant hyperproliferative cells. In another embodiment, an adenoviral expression construct comprising a self gene under the control of a promoter operable in eukaryotic cells is administered to the therapy-resistant hyperproliferative cells. The present invention thus provides immunotherapies for treating therapy-resistant hyperproliferative disease by attenuating the natural immune system's CTL response against hyperproliferative cells or overexpressing mutant p53 antigens, for example. | 02-12-2015 |
20150044241 | CONTRACEPTIVE VACCINES FOR MAMMALS - The invention provides a contraceptive vaccine for a female recipient of a target species of mammals including a composition of at least one of a plurality of granulosa cells and a plurality of ovarian stromal cells in combination with an adjuvant; wherein the cells are grown from a tissue sample of the cells obtained from at least one female donor of the target species which is not the same individual as the female recipient. The invention also provides a method of producing the contraceptive vaccine as well as a method of treating a female recipient with the contraceptive vaccine to prevent pregnancy. | 02-12-2015 |
20150044242 | Adjuvant and Vaccine Compositions - Methods are provided for preparing and delivering an adjuvant for vaccines including lecithin, polymer and one or more additives. The polymer is preferably polyacrylic acid-based. The additive is preferably one or more of a glycoside and a sterol. The method of preparation includes hydrating lecithin and a polymer in saline or water and mixing the lecithin and polymer to form the adjuvant. Additives can be included prior to or after hydration of the lecithin and polymer. | 02-12-2015 |
20150050295 | NOVEL LIPIDS AND COMPOSITIONS FOR INTRACELLULAR DELIVERY OF BIOLOGICALLY ACTIVE COMPOUNDS - The present invention provides novel amino-lipids, compositions comprising such amino-lipids and methods of producing them. In addition, lipid nanoparticles comprising the novel amino-lipids and a biologically active compound are provided, as well as methods of production and their use for intracellular drug delivery. | 02-19-2015 |
20150050296 | METHODS AND COMPOSITIONS FOR INHIBITION OF INNATE IMMUNE RESPONSES AND AUTOIMMUNITY - The invention provides immunoregulatory polynucleotides and methods for immunoregulation of individuals using the immunoregulatory polynucleotides. | 02-19-2015 |
20150050297 | USE OF A GLYCOSYLATED-MODIFIED TETRAFUNCTIONAL NON-IONIC AMPHIPHILIC BLOCK COPOLYMER AS IMMUNE ADJUVANT - The present invention relates to a use of at least one glycosylated tetrafunctional amphiphilic block copolymer, as immune adjuvant. | 02-19-2015 |
20150050298 | ISOLATION AND USE OF HUMAN LYMPHOID ORGAN-DERIVED SUPPRESSIVE STROMAL CELLS - A method for suppressing an immune response is provided. The method involves administration of isolated lymphoid tissue-derived suppressive stromal cells (LSSC) to a subject in need of such treatment in an amount effective to suppress the immune response in the subject. The invention also involves a method to isolate LSSC by digesting lymphoid tissue fragments using a combination of an enzyme mix and agitation and then collecting the LSSC. Pharmaceutical preparations comprising LSSC are also provided. | 02-19-2015 |
20150050299 | METHODS FOR ENHANCING IMMUNE RESPONSE - This disclosure demonstrates a novel therapy immunological approach using polyamine-based therapy (PBT) for relieving tumor-induced suppression of the patient's immune system. The demonstration of the pharmacological release from the naturally occurring polyamine-mediated immune suppression offers profound impact on the immunotherapy of cancer together with a variety of diseases caused by the disease-causing vector's ability to evade an immune reaction. This therapeutic approach is equally applicable to disease states whereby immune system suppression by polyamines has been demonstrated including; bacterial infections, parasitic infections including malaria and typanosomiasis, viral infections, peptic ulcers and gastric cancer due to | 02-19-2015 |
20150056224 | COMPOSITIONS AND METHODS FOR ACTIVATING STIMULATOR OF INTERFERON GENE-DEPENDENT SIGNALLING - The present invention provides highly active cyclic-di-nucleotide (CDN) immune stimulators that activate DCs via a recently discovered cytoplasmic receptor known as STING (Stimulator of Interferon Genes). In particular, the CDNs of the present invention are provided in the form of a composition comprising one or more cyclic purine dinucleotides induce STING-dependent type I interferon production, wherein the cyclic purine dinucleotides present in the composition are substantially pure 2′,5′,2′,5′ and 2′,5′,3′,5′ CDNs, and preferably Rp,Rp stereosiomers thereof. | 02-26-2015 |
20150056225 | HLA Class II Deficient Cells, HLA Class I Deficient Cells Capable of Expressing HLA Class II Proteins, and Uses Thereof - The invention provides isolated primate cells preferably human cells that comprise a genetically engineered disruption in a human leukocyte antigen (HLA) class II-related gene, which results in deficiency in MHC class II expression and function. This invention also provides isolated cells further comprising a genetically engineered disruption in a beta-2 microglobulin (B2M) gene, which results in HLA class I/class II deficiency. Also provided are the method of using the cells for transplantation and treating a disease condition. | 02-26-2015 |
20150056226 | IMMUNOTHERAPEUTIC AGENT - The present invention is directed to adoptive immunotherapy using a lymphocyte in which an antigen-specific receptor and a bioactive material gene such as an IL-2 gene or a water-soluble TGF-beta receptor gene are transferred. The bioactive material is intensively secreted to, for example, a local site of a tumor, thereby reducing systemic side effects as much as possible, and the survival time of the lymphocyte is increased, thereby further improving the effect of the adoptive immunotherapy. | 02-26-2015 |
20150056227 | PRIMING OF AN IMMUNE RESPONSE - The present invention relates to a technology and method of priming of an immune response using invariant chain linked antigen, when these are used to prime a subsequent booster immunization using any suitable vacci. | 02-26-2015 |
20150064206 | COMPOSITIONS FOR TREATING UVEITIS - Compositions including human Treg cells directed to an eye-associated antigen and methods for treating uveitis. | 03-05-2015 |
20150079117 | Paramyxovirus Immunogens and Related Materials and Methods - The present invention includes methyltransferase (MTase)-defective recombinant viruses as live vaccine candidates for human metapneumovirus (hMPV), human respiratory syncytial virus (hRSV), and human parainfluenza virus type 3 (PIV3). Here the inventors provide the technical description for generating MTase-defective paramyxoviruses useful as immunogens, as well Cas related materials and methods. | 03-19-2015 |
20150079118 | MicroRNA Treatment for Asthma - This invention relates to a composition for modifying the activity of microRNA-mediated regulation of mRNA in a cell, wherein the composition comprises: two or more compounds capable of blocking two or more microRNA molecules from binding to the same target mRNA, wherein the two or more microRNA molecules are different in sequence or structure relative to each other. In particular, compositions for use in the treatment of asthma and methods of prevention or treatment of asthma. | 03-19-2015 |
20150093400 | PEPTIDES FOR MANAGEMENT OF LACTATION - The present invention provides novel short peptides that are highly effective in inducing involution in a mammary gland of a lactating mammal and cessation of milk production by the gland. The invention further provides pharmaceutical composition comprising the peptides and methods of use thereof including for treating microbial infection in a mammary gland. | 04-02-2015 |
20150098954 | Compositions and Methods Related to CRISPR Targeting - Disclosed herein include embodiments related to addition, deletion, or modification of DNA, RNA, or protein in a subject. In an embodiment, the DNA, RNA, or protein is endogenous. In an embodiment, the DNA, RNA, or protein is exogenous. Further embodiments relate to computerized systems for assisting in the disclosed methods. | 04-09-2015 |
20150104470 | IMMUNE MODULATION BY PERI-LYMPHATIC OR INTRA-LYMPHATIC CELL THERAPY - Disclosed are compositions of matter, methods of treatment, and protocols useful for therapeutic immune modulation using cell therapy administered perilymphatically or intralymphatically. In one particular embodiment, the invention provides means of treating an autoimmune condition by perilymphatic administration of a mesenchymal stem cell population. Said mesenchymal stem cell populations may be derived from umbilical cord tissues such as the Wharton's Jelly, amniotic membranes, or amniotic stem cells. In another particular embodiment Sertoli cells may be utilized as immune modulatory cells for the practice of the invention. | 04-16-2015 |
20150104471 | UNIVERSAL DONOR-DERIVED TOLEROGENIC CELLS FOR INDUCING NON-SYNGENEIC TRANSPLANTATION TOLERANCE - The present invention provides a method of treating a disease in a subject in need thereof via non-syngeneic graft administration without or with reduced concomitant graft rejection. The method comprises administering to the subject a therapeutically effective graft being non-syngeneic with the subject, and a dose of tolerogenic cells being non-syngeneic with both the subject and the graft for preventing or reducing graft rejection in the subject, thereby treating the disease in the subject | 04-16-2015 |
20150118257 | Methods and Compositions for Manipulating the Immune System - Methods and compositions, e.g., therapeutic agents, are provided for modulating gene and/or protein expression of Forkhead Box protein 1 (Foxp1), particularly Foxp1A and Foxp1D, in CD4+ T cells. Such modulation permits manipulation of the B cell response and antibody production and activity, without depleting the number, production or activity of the T cells. In one aspect, methods and compositions for increasing or up regulating the nucleic acid and/or protein expression of Foxp1A, Foxp1D or a combination thereof in the subject's cells in vivo, inhibits or suppresses B cell response and antibody production or activity thereof in the subject. This aspect is useful for treating diseases characterized by excessive B cell response or antibody production or activity, such as autoimmune disorders | 04-30-2015 |
20150118258 | Fluorinated Bridged Spiro[2.4]Heptane Derivatives as ALX Receptor Agonists - The present invention relates to fluorinated bridged spiro[2.4]heptane derivatives of formula (I), | 04-30-2015 |
20150125475 | IMMUNOLOGICALLY USEFUL ARGININE SALTS - The invention is in the field of salt forms of an immunopotentiator compound and their formulation for in vivo use. In particular the invention relates to arginine salts. | 05-07-2015 |
20150132325 | NOVEL COMPOSITIONS AND USES THEREFOR - The invention is directed to the use of (i) a first antigen corresponding to a target antigen of interest, together with (ii) a second antigen, corresponding to a modified form of the target antigen, whose rate of intracellular proteolytic degradation is increased, enhanced or otherwise elevated relative to the first antigen, in compositions and methods for inducing both humoral and cellular immunity in an individual. The ability to provide compositions, which are capable of inducing both host-protective antibody and cell-mediated immune responses, facilitates the generation of immunogenic compositions capable of combating, inter alia, conditions that have long latency periods and, therefore, benefit from the dual approach of prophylaxis and therapy in one delivery. | 05-14-2015 |
20150132326 | IMMUNOSUPPRESSIVE BLOOD CELLS AND METHODS OF PRODUCING THE SAME - The present invention refers to a method of producing immunosuppressive blood cells that can be used for the treatment of autoimmune diseases, in particular multiple sclerosis, organ graft rejection and graft-versus-host disease. | 05-14-2015 |
20150132327 | NOVEL PYRAZOLE DERIVATIVE - It has been desired to develop a pharmaceutical composition, which is used in agents for preventing and/or treating various diseases related to PDE10 (e.g. mental disorder and neurodegenerative disorder). The present invention provides: compounds having PDE10 inhibitory effect, in particular, compounds having a 4-heteroarylpyrazole-5-carboxylic acid amide structure represented by the following formula (I), or their pharmaceutically acceptable salts, or their solvates; pharmaceutical compositions comprising, as active ingredients, the compounds, or their pharmaceutically acceptable salts, or their solvates; and medical use of the compounds, or their pharmaceutically acceptable salts, or their solvates. | 05-14-2015 |
20150290197 | THERAPEUTIC USES OF SELECTED PYRROLOPYRIMIDINE COMPOUNDS WITH ANTI-MER TYROSINE KINASE ACTIVITY - Uses of pyrrolopyrimidines with anti-Mer tyrosine kinase activity as anti-infective agents, immunostimulatory and immunomodulatory agents, anti-cancer agents (including against MerTK−/− tumors and ITD and TKD mutant forms of Acute Myeloid Leukemia (AML)), and as adjunctive agents in combination with chemotherapeutic, radiation or other standard of care for neoplasms. | 10-15-2015 |
20150290244 | USE OF CART19 TO DEPLETE NORMAL B CELLS TO INDUCE TOLERANCE - The present invention provides compositions and methods for inducing tolerance in a human. The invention includes administering a genetically modified T cell expressing a CAR wherein the CAR comprises an antigen binding domain, a transmembrane domain, a costimulatory signaling region, and a CD3 zeta signaling domain. | 10-15-2015 |
20150299776 | Identification of a Person having Risk for Atherosclerosis and Associated Disease by the Person's Gut Microbiome and the Prevention of such Diseases - The present invention provides the use of metagenomics to identify a compositional or functional alteration of the gut metagenome related to atherosclerosis or atherosclerotic associated disease. Also provided are methods to identify a person having risk for atherosclerosis and associated diseases by determining the presence of specific bacterial groups or species and also metabolic functions in the person's gut microbiota and to use such information to develop a prevention or treatment strategy. | 10-22-2015 |
20150306195 | HEMOGLOBIN RECEPTOR AS NOVEL VACCINE FOR LEISHMANIASIS - The present invention in general relates Hemoglobin receptor or its part as a novel vaccine candidate against Leishmaniasis. Specifically, the present invention envisages HbR DNA for eliciting immune response in a mammal against Leishmaniasis. Additional aspect of the present invention is related to a vaccine composition for inducing immune response against Leishmaniasis in mammals. In a preferred aspect, the present invention relates to use of HbR-polypeptide as marker for diagnosis of | 10-29-2015 |
20150307938 | METHOD TO IDENTIFY A NOVEL CLASS OF IMMUNOLOGIC ADJUVANTS - Methods of identifying an adjuvant capable of activating dendritic cells including measuring expression level genes in skin of an animal prior to exposure to a test compound, wherein the genes are known to be upregulated or downregulated in the skin of the animal in response to topical application of dibutyl phthalate (DBP) to skin of said animal; exposing skin of an animal of the same species to the test compound; measuring expression level of the genes in the skin of the animal after exposure to the test compound; and comparing expression level of the genes measured before and after exposure to the test compound, wherein an increase or decrease in expression level of the genes following exposure to the test compound indicates that the test compound is capable of activating dendritic cells. Also included are compositions that induce dendritic cell migration and modulate expression level of genes in skin cells. | 10-29-2015 |
20150314036 | WOUND HEALING DEVICE - A plasma coating device for treating a wound comprises a plasma chamber having: one or more electrodes, a gas supply inlet, a plasma outlet exposed to ambient pressure, and an ignition system operatively connected to the electrodes for providing a non-thermal equilibrium plasma within the plasma chamber. An aerosol delivery system is operable to introduce a bioresorbable material as an aerosol into the plasma, to produce a coating on the wound surface. | 11-05-2015 |
20150320870 | TOLEROGENIC SYNTHETIC NANOCARRIERS FOR INDUCING REGULATORY B CELLS - Disclosed are synthetic nanocarrier methods, and related compositions, comprising B cell and/or MHC Class II-restricted epitopes and immunosuppressants in order to generate tolerogenic immune responses, such as the generation of antigen-specific regulatory B cells. | 11-12-2015 |
20150322517 | AGENTS AND METHODS FOR DIAGNOSING STRESS - The present invention discloses molecules and assays for qualitatively or quantitatively determining the effect of stress on the immune system, the susceptibility to developing disease or illness through immune system dysfunction as a result of stress, and for monitoring the ability of an animal to cope with stress. The invention is useful inter alia in measuring response to immunomodulatory therapies, and monitoring the immune response to natural disease under stressful conditions. | 11-12-2015 |
20150337000 | Mannose-Receptor Selective Lysinylated Cationic Amphiphiles and a Process for Preparation Thereof - The present invention relates to the mannose-receptor selective lysinylated cationic amphiphile and a process for preparation thereof. The compounds of the present invention can target DNA vaccines to antigen presenting cells (APCs) such as macrophages and dendritic cells (DCs), via mannose receptors expressed on the cell surface of APCs. The cationic amphiphiles disclosed herein show enhanced cellular and humoral immune response compared to their mannosyl counterparts in genetic immunization in mice. The present invention discloses that immunization with electrostatic complexes (lipoplexes) of DNA vaccines encoding melanoma antigens (gp100 and tyrosinase) and liposome of the presently described novel lysinylated cationic amphiphiles with mannose-mimicking shikimoyl head-groups provides long-lasting (100 days post melanoma tumor challenge) protective immunity in all immunized mice. Cationic amphiphiles with mannose-mimicking shikimoyl head-groups described in the present invention are likely to find future applications in the field of genetic immunization. | 11-26-2015 |
20150337361 | Non-Invasive Diagnosis of Graft Rejection in Organ Transplant Patients - The invention provides methods, devices, compositions and kits for diagnosing or predicting transplant status or outcome in a subject who has received a transplant. | 11-26-2015 |
20150342980 | METHODS AND COMPOSITIONS FOR MODULATING AN IMMUNE RESPONSE WITH IMMUNOGENIC OLIGONUCLEOTIDES - This document relates to compositions and methods for modulating an immune response. For example, compositions of immunostimulatory CpG oligonucleotides derived from retroviral genomes are provided. | 12-03-2015 |
20150342993 | COMPOSITIONS AND METHODS FOR IMMUNOTHERAPY - The present invention provides immunoresponsive cells, including T cells, cytotoxic T cells, regulatory T cells, and Natural Killer (NK) cells, expressing at least one of an antigen recognizing receptor and one of a chimeric costimulatory receptor. Methods of using the immunoresponsive cell include those for the treatment of neoplasia and other pathologies where an increase in an antigen-specific immune response is desired. | 12-03-2015 |
20150343039 | DISEASE THERAPY USING A TOLEROGENIC PHARMACEUTICAL PREPARATION - The present invention concerns pharmaceutical preparations to treat diseases characterized by a pathological immune response, methods of treatments using such preparations and processes for preparing said pharmaceutical preparations. | 12-03-2015 |
20150343056 | PHARMACEUTICAL TARGETING OF A MAMMALIAN CYCLIC DI-NUCLEOTIDE SIGNALING PATHWAY - Cyclic-GMP-AMP synthase (cGAS) and cyclic-GMP-AMP (cGAMP), including 2′3-cGAMP, 2′2-cGAMP, 3′2′-cGAMP and 3′3′-GAMP, are used in pharmaceutical formulations (including vaccine adjuvants), drug screens, therapies and diagnostics. | 12-03-2015 |
20150352199 | Dendritic Cells - The present invention relates to dendritic cell loaded with at least one nucleic acid molecule encoding a tumor associated antigen protein or fragment thereof and at least one tumor associated antigen protein or fragment thereof. | 12-10-2015 |
20150355183 | NEOEPITOPE DETECTION OF DISEASE USING PROTEIN ARRAYS - A biosensor for use in detecting the presence of diseases, the biosensor comprising a detector for detecting a presence of at least one marker indicative of a specific disease. A method of determining efficacy of a pharmaceutical for treating a disease or staging disease by administering a pharmaceutical to a sample containing markers for a disease, detecting the amount of at least one marker of the disease in the sample, and analyzing the amount of the marker in the sample, whereby the amount of marker correlates to pharmaceutical efficacy or disease stage. Markers for gynecological disease. An immuno-imaging agent comprising labeled antibodies, whereby the labeled antibodies are isolated and reactive to proteins overexpressed in vivo. Informatics software for analyzing the arrays, the software including analyzing means for analyzing the arrays. | 12-10-2015 |
20150366910 | NATURAL KILLER CELLS FROM PLACENTA - Provided herein are placental perfusate, placental perfusate cells, placenta-derived intermediate natural killer cells, combined natural killer cells from placenta and umbilical cord blood, and combinations thereof. Also provided herein are compositions comprising the same, and methods of using placental perfusate, placental perfusate cells, placenta-derived intermediate natural killer cells, and combined natural killer cells and combinations thereof, to suppress the growth or proliferation of tumor cells, cancer cells, and the like, and to treat individuals having tumor cells. Also provided herein are methods of treating an individual having a tumor or graft-versus-host disease with placental perfusate, placental perfusate-derived cells, natural killer cells from placenta, e.g., from placental perfusate, and/or combined natural killer cells comprising natural killer cells from placenta, e.g., from placental perfusate, and umbilical cord blood. | 12-24-2015 |
20150368283 | D-FAGOMINE FOR THE CONTROL OF INFLAMMATORY PROCESSES RELATED TO AN OVERACTIVATION OF THE HUMORAL IMMUNE RESPONSE - The present invention belongs to the field of nutraceuticals or functional agents with immunostimulating capacity for triggering mechanisms of the innate immune response at a mucosal level. More specifically, it refers to the use of the compound | 12-24-2015 |
20150368307 | LENTIVIRAL VECTOR BASED IMMUNOLOGICAL COMPOUNDS AGAINST MALARIA - The invention relates to lentiviral vector particles pseudotyped with a determined heterologous viral envelope protein or viral envelope proteins originating from a RNA virus and which comprise in its genome at least one recombinant polynucleotide encoding at least one polypeptide(s) carrying epitope(s) of an antigen of a | 12-24-2015 |
20150368641 | Methods to screen compounds for regulating USF1 activity and methods and compounds to treat cardiometabolic and lipid pathologies - The deficiency of Usf1 confers a remarkable number of clinically relevant beneficial metabolic effects in mice via activation of brown adipose tissue. The Usf1 deficient mice have high serum HDL-cholesterol and low triglyceride levels, a beneficial lipid profile opposite to that of human metabolic syndrome. The elevated HDL-C is associated with enhanced cholesterol efflux, and low triglycerides with decreased hepatic VLDL production and elevated triglyceride clearance. Despite their elevated food intake and lower physical activity, the Usf1 deficient mice are protected against diet-induced obesity. Their concomitant increase in energy expenditure is related to the activation of brown adipose tissue. The protective effects of Usf1 deficiency against obesity, insulin resistance, fatty liver, dyslipidemia, vascular inflammation, and atherosclerosis coupled with brown adipose tissue activation are demonstrated. Inhibition or silencing of USF1 is suggested as a therapeutic target to treat various human diseases. | 12-24-2015 |
20150368672 | NUCLEOTIDE VACCINE - The present invention relates to a vaccine comprising a nucleic acid construct such as a DNA construct especially a nucleic acid construct comprising sequences encoding invariant chain operatively linked to antigenic protein or peptide encoding sequences. The vaccine stimulates an immune response, especially an immune response in an MHC-I dependent, but CD4 | 12-24-2015 |
20150374638 | ORAL PHARMACEUTICAL COMPOSITION - An oral composition comprising minicapsules wherein the minicapsules comprise one or more therapeutic or prophylactic substances in a liquid, semi-liquid, or solid core. The minicapsules have release profiles to release the substance in an active form at one or more sites along the gastro-intestinal tract to maximise absorption and/or therapeutic efficiency. | 12-31-2015 |
20150374806 | LOCAL ENGINEERING OF THE LYMPH NODE ENVIRONMENT TO PROMOTE IMMUNE TOLERANCE - A method of inducing specific immune tolerance to myelin in an individual is provided. The method includes introducing directly into a lymph node of the individual an effective amount of a composition that contains a myelin antigen, a biodegradable material and at least one tolerogenic agent. The method is suitable for reducing the severity of symptoms of multiple sclerosis in individuals who suffer from primary-progressive multiple sclerosis (PPMS), and can halt or even reverse PPMS progression. | 12-31-2015 |
20150377882 | METHOD OF THERAPY - Numerous diseases have been linked to the production of regulator cells. The present invention relates to the observation that the immune system is cycling in these diseases. Based on these observations, the present invention provides methods for treating diseases such as cancer and a HIV infection. The present invention also relates to methods of determining when a therapy to treat a disease characterized by the production of regulator cells should be administered to a patient. | 12-31-2015 |
20160000777 | METHODS OF USING HISTAMINE RECEPTOR AGONISTS AND ANTAGONISTS - This invention relates to a transdermal drug formulation that includes a pharmaceutically suitable carrier; an effective amount of a therapeutic agent; and a histamine type 4 receptor (“H4R”) agonist, as well as a transdermal vaccine formulation that includes a pharmaceutically suitable carrier; an effective amount of an antigen or antigen-encoding nucleic acid molecule present in the carrier, and optionally one or more adjuvants; and an H4R agonist. The present invention also relates to transdermal delivery device including such formulations and methods of administering such formulations. The present invention also relates to methods of enhancing epithelial barrier formation in a patient involving administering to the patient at a site of epithelial disruption an amount of a formulation that comprises an H4R antagonist. The present invention also relates to a method of inhibiting pathogen infection or local spread of infection in the epithelia using an H4R antagonist, an H1R antagonist, or a combination thereof. | 01-07-2016 |
20160008811 | Methods and Systems for Enhanced Microfluidic Processing | 01-14-2016 |
20160015807 | POLYSACCHARIDE FRACTION ORIGINATING IN PERSIMMON LEAF WITH IMMUNOSTIMULATING ACTIVATION AND ANTITUMOR ACTIVATION AND METHOD FOR MANUFACTURING SAME - A persimmon leaf-derived polysaccharide fraction consisting of 60-80 wt % of neutral sugar and 18-39 wt % of uronic acid, and 0.5-10 wt % of 3-deoxy-D-manno-2-octulosonic acid (KDO) analogs, the wt % based on the total weight of the polysaccharide fraction. | 01-21-2016 |
20160016918 | NEPRILYSIN INHIBITORS - In one aspect, the invention relates to compounds having the formula: | 01-21-2016 |
20160024508 | METHOD FOR IDENTIFYING BIOLOGICALLY ACTIVE OLIGONUCLEOTIDES CAPABLE OF MODULATING THE IMMUNE SYSTEM - The present invention relates to methods of identifying oligonucleotides capable of modulating the immune system in a mammalian subject, comprising analysis of which tertiary structural type said oligonucleotide adopts, in phosphate-buffered saline solution. Further, the invention provides oligonucleotides identifiable by the methods of the invention and to their use in methods of treating diseases, such as inflammatory diseases, autoimmune diseases, infectious diseases, neurodegenerative diseases and cancer. | 01-28-2016 |
20160030483 | MATERIALS AND METHODS FOR TREATING ALLERGIC AND INFLAMMATORY CONDITIONS - The subject invention provides for the utilization of bone-marrow derived stem cells in the treatment of allergic and inflammatory diseases. In one embodiment, the invention provides for treatment of asthma. Bone-marrow derived stem cells can be used for decreasing inflammation and alter the course of immune response in the lung. | 02-04-2016 |
20160032245 | Compositions and Methods for Modulating an Immune Response - The invention provides methods of modulating follicular regulatory T (TFR) cell-mediated immune responses, follicular helper T (TFH) cell-mediated immune responses or both, and the use of those methods in the treatment of diseases or conditions mediated by TFR or TFH cells. The invention also provides novel methods for identifying TFR and TFH cells in a population of cells. The invention also provides compositions comprising TFR cells that have enhanced suppressive activity as compared wild type TFR cells. The invention also provides compositions comprising T follicular regulatory (TFR) cells isolated from the peripheral blood of a subject wherein the composition is enriched for TFR cells. Methods of making and using the compositions of the invention to modulate an immune response are also provided. | 02-04-2016 |
20160038570 | PREDICTING AND REDUCING ALLOIMMUNOGENICITY OF PROTEIN THERAPEUTICS - Methods of predicting the immunogenicity of a therapeutic protein in a subject are provided and the use of this method in selecting a protein for replacement therapy having the fewest immunogenic epitopes. The method is demonstrated by reference to ADAMTS13. Isolated allelic variants of ADAMTS13 that contribute to the variability in risk for both arterial and venous thrombotic disease development are provided. The allelic variants are identified as single nucleotide polymorphisms (ns-SNPs) in the ADAMTS13 gene, which result in haplotypes identified as H1 to H14. A method for improving outcomes of transfusions/transplant products is also provided by selection of haplotype matched therapeutics. | 02-11-2016 |
20160045618 | Methods And Compositions For Treatment Of Interferon-Resistant Tumors - The present invention provides a method for the treatment of interferon resistant bladder tumors through the use of a non-replicating agent which induces human cells to express interferon species. In particular it is noted that inducing interferon expression in the patient's body possesses properties not associated with recombinant produced, intravenously-administered interferon proteins. The present invention further provides compositions useful in the treatment of bladder cancer resistant to treatment with intravenous interferon polypeptide, by using a non-replicating agent which induces human cells to express interferon species, e.g., an antigenic, replication-deficient virus optionally carrying an interferon transgene. | 02-18-2016 |
20160046950 | A CANCER VACCINE FOR DOGS - The present invention provides an immunogenic composition comprising a nucleic acid that comprises a sequence encoding a dog telomerase deprived of telomerase catalytic activity, or a fragment thereof. | 02-18-2016 |
20160051669 | COMPOSITIONS AND METHODS FOR SELECTIVELY MODULATING TREGS - It has been discovered that PIK3δ (PIK3delta) selectively modulates the activation and proliferation of natural Tregs. Methods of modulating immune responses by modulating PIK3δ bioavailability or biological activity are provided. | 02-25-2016 |
20160067228 | METHODS AND COMPOSITIONS FOR ATTENUATING ANTI-VIRAL TRANSFER VECTOR IMMUNE RESPONSES - Provided herein are methods and related compositions for administering viral transfer vectors and antigen-presenting cell targeted immunosuppressants. | 03-10-2016 |
20160068585 | COMPOSITIONS AND METHODS FOR TREATMENT OF TYPE 1 DIABETES - The present invention provides compositions and methods for treating insulin-dependent diabetes mellitus in a subject comprising administration of a self-vector encoding and expressing human proinsulin. | 03-10-2016 |
20160068809 | USE OF ZEBURALINE FOR THE TREATMENT OF AUTOIMMUNE DISEASES OR IMMUNE REJECTION OF TRANSPLANTS - The invention relates to the use of 1-(β-D-Ribofuranosyl)-1,2-dihydropyrimidin-2-one derivative or mimetic or an analogue, derivatives, metabolites, variants or salts thereof for the manufacturing of a medicament to increase the amount of Indoleamine 2,3-dioxygenase (IDO) production in order to induce immunological tolerance as well as a method of treating a mammal in need thereof. | 03-10-2016 |
20160074372 | METHODS AND COMPOSITIONS FOR ATTENUATING EXON SKIPPING ANTI-VIRAL TRANSFER VECTOR IMMUNE RESPONSES - Provided herein are methods and related compositions for administering viral transfer vectors and antigen-presenting cell targeted immunosuppressants. | 03-17-2016 |
20160075711 | COMPOUNDS FOR THE INHIBITION OF INDOLEAMINE-2,3-DIOXYGENASE - The present invention relates to compounds, and pharmaceutically acceptable compositions thereof, useful as antagonists of IDO, and for the treatment of IDO-related disorders. | 03-17-2016 |
20160082103 | COMPOSITIONS AND METHODS FOR TREATING VIRAL INFECTIONS THROUGH STIMULATED INNATE IMMUNITY IN COMBINATION WITH ANTIVIRAL COMPOUNDS - Embodiments are directed to compositions and methods for treating viral infections. | 03-24-2016 |
20160095900 | Human fertility enhancement with cortisol reduction food - A method of using a fertility enhancement food to improve human fertility. This fertility enhancement food consists of transfer factor, lactic acid generating bacteria, and/or glucans in appropriate combinations. The fertility food, administered correctly, reduces cortisol levels. High cortisol interferes with conception and stable pregnancies. Dosage amounts are adjusted for client weight. Consumption frequency may be adjusted in response to cortisol measurements. Typically, consumption of the fertility food begins seven or more days before planned conception. | 04-07-2016 |
20160100561 | NON-HUMAN ANIMALS WITH MODIFIED IMMUNOGLOBULIN HEAVY CHAIN SEQUENCES - Non-human animals, e.g., mammals, e.g., mice or rats, are provided comprising an immunoglobulin heavy chain locus that comprises a rearranged human immunoglobulin heavy chain variable region nucleotide sequence. The rearranged human immunoglobulin heavy chain variable region nucleotide sequence may be operably linked to a heavy or light chain constant region nucleic acid sequence. Also described are genetically modified non-human animals comprising an immunoglobulin light chain locus comprising one or more but less than the wild type number of human immunoglobulin light chain variable region gene segments, which may be operably linked to a light chain constant region nucleic acid sequence. Also provided are methods for obtaining nucleic acid sequences that encode immunoglobulin light chain variable domains capable of binding an antigen in the absence of a heavy chain. | 04-14-2016 |
20160102132 | MONOMERIC RECOMBINANT MHC MOLECULES USEFUL FOR MANIPULATION OF ANTIGEN-SPECIFIC T-CELLS - The present invention provides, in particular embodiments, for modified recombinant T cell receptor (TCR) ligands (RTLs) comprising a MHC class I or MHC class II component. The modified RTLs have redesigned surface features that preclude or reduce aggregation, wherein the modified molecules retain the ability to bind Ag-peptides, target antigen-specific T cells, inhibit T cell proliferation in an Ag-specific manner and have utility to treat, inter alia, autoimmune disease and other conditions mediated by antigen-specific T cells in vivo. | 04-14-2016 |
20160106710 | WOUND HEALING VIA AUTOLOGOUS STEM CELL MOBILIZATION - The present invention relates to the field of wound healing. More specifically, the present invention provides methods and compositions useful for improved wound healing via autologous stem cell mobilization. In one embodiment, a method for improving wound healing in a patient comprises administering to the patient a therapeutically effective amount of a stem cell mobilizer and a low dose of an immunosuppressive agent. | 04-21-2016 |
20160120960 | ADENO-ASSOCIATED VIRUS MEDIATED GENE TRANSFER TO THE CENTRAL NERVOUS SYSTEM - A method to prevent, inhibit or treat one or more symptoms associated with a disease of the central nervous system by intrathecally, intracerebroventricularly or endovascularly administering a rAAV encoding a gene product associated with the disease, e.g., a mammal in which the gene product is absent or present at a reduced level relative to a mammal without the disease. | 05-05-2016 |
20160136197 | Pharmaceutical Compositions Comprising a GPG Oligodeoxynucleotide and Cyclic Di-GMP - The present invention relates to pharmaceutical compositions comprising an immunostimulatory amount of at least two immunopotentiators, wherein a first immunopotentiator is a non-methylated cytidyl guanosyl oligodeoxynucleotide (CpG ODN) and a second immunopotentiator is 3′,5′-cyclic diguanylic acid (c-di-GMP), and a pharmaceutically acceptable carrier. The invention also relates to the use of such pharmaceutical compositions for the induction of an immune response against tumor-specific antigens. Also the invention relates to their use in in situ tumor-destruction therapy and to such pharmaceutical compositions for use in the treatment of a mammal suffering from cancer. | 05-19-2016 |
20160151465 | METHODS FOR INDUCING PARTIAL APOPTOSIS USING CASPASE POLYPEPTIDES | 06-02-2016 |
20160151471 | INDUCIBLE REGULATORY T-CELL GENERATION FOR HEMATOPOIETIC TRANSPLANTS | 06-02-2016 |
20160158285 | HUMAN APPLICATION OF ENGINEERED CHIMERIC ANTIGEN RECEPTOR (CAR) T-CELLS - The present invention concerns methods and compositions for immunotherapy employing a modified T cell comprising a chimeric antigen receptor (CAR). In particular aspects, CAR-expressing T-cells are producing using electroporation in conjunction with a transposon-based integration system to produce a population of CAR-expressing cells that require minimal ex vivo expansion or that can be directly administered to patients for disease (e.g., cancer) treatment. | 06-09-2016 |
20160158328 | Method for allogeneic cell therapy - A method of manipulating allogeneic cells for use in allogeneic cell therapy providing a composition of highly activated allogeneic T-cells which are infused into immunocompetent cancer patients to elicit a novel anti-tumor immune mechanism, or “Mirror Effect”. In contrast to current allogeneic cell therapy protocols where T-cells in the graft mediate the beneficial graft vs. tumor (GVT) and detrimental graft vs. host (GVH) effects, the allogeneic cells of the present invention stimulate host T-cells to mediate the “mirror” of these effects. The mirror of the GVT effect is the host vs. tumor (HVT) effect. The “mirror” of the GVH effect is the host vs. graft (HVG) effect The anti-tumor HVT effect occurs in conjunction with a non-toxic HVG rejection effect. The highly activated allogeneic cells of the invention can be used to stimulate host immunity in a complete HLA mis-matched setting in a patient. | 06-09-2016 |
20160166668 | COMPOSITION AND VACCINE FOR TREATING PROSTATE CANCER | 06-16-2016 |
20160166681 | TOLL-LIKE RECEPTOR AGONISTS | 06-16-2016 |
20160175364 | TROPHOBLAST DERIVED MICROPARTICLES FOR TREATING ISCHEMIC TISSUE AND WOUNDS | 06-23-2016 |
20160184442 | PHARMACEUTICAL COMPOSITIONS FOR TRANSDERMAL DELIVERY OF ACTIVE AGENTS - The present invention relates to novel compositions that are effective for delivering active pharmaceutical agents transdermally. The compositions comprise a mixture of water, propylene glycol, phenoxyethanol, heavy paraffin oil, soft white paraffin, cetostearyl alcohol, and macrogol cetostearyl ether and demonstrate improved delivery of active agents when formulated together. | 06-30-2016 |
20160186178 | SPHERICAL NUCLEIC ACID-BASED CONSTRUCTS AS IMMUNOSTIMULATORY AGENTS FOR PROPHYLACTIC AND THERAPEUTIC USE - Aspects of the invention relate to spherical nucleic acid-based constructs and related methods and compositions thereof. The compositions of the invention are useful for activating agonists of nucleic acid interacting complexes, such as TLRs, stimulating an immune response, and treating diseases such as infectious disease, cancer, allergies, allergic diseases, and autoimmune disease | 06-30-2016 |
20160193174 | COMPOSITION CONTAINING MONOACETYLDIGLYCERIDE COMPOUND AS ACTIVE INGREDIENT FOR PREVENTING OR TREATING ATOPIC DERMATITIS | 07-07-2016 |
20160199485 | NOVEL LIPIDS AND COMPOSITIONS FOR THE DELIVERY OF THERAPEUTICS | 07-14-2016 |
20160250248 | METHOD FOR GENERATION OF BROADLY NEUTRALIZING ANTI-PATHOGEN ANTIBODIES | 09-01-2016 |
20160250258 | MODIFIED HEMATOPOIETIC STEM/PROGENITOR AND NON-T EFFECTOR CELLS, AND USES THEREOF | 09-01-2016 |
20160250321 | NUCLEIC ACIDS COMPRISING FORMULA (NuGlXmGnNv)a AND DERIVATIVES THEREOF AS IMMUNOSTIMULATING AGENT/ADJUVANT | 09-01-2016 |
20160250354 | METHODS AND COMPOSITIONS FOR DELIVERY OF ACTIVE AGENTS | 09-01-2016 |
20170231916 | COMPACTED SOLID DOSAGE FORM | 08-17-2017 |
20170233430 | Novel Compounds | 08-17-2017 |
20190142962 | RECEPTOR TARGETING CONSTRUCTS AND USES THEREOF | 05-16-2019 |
20220133872 | A MONOPHOSPHORYL LIPID-A LIPOSOME BASED CANCER VACCINE - A vaccine composition for enhancing in a subject to whom the composition is administered, a production of antibodies against a disialoganglioside GD3 and/or GD2 is provided in one embodiment. The composition includes, in an embodiment, a liposome including an effective amount of disialoganglioside GD3 and/or GD2 to stimulate or enhance antibody production in the subject; and an effective amount of an adjuvant comprising monophosphory 1 lipid A (MPL). In one example, the vaccine composition may be administered to the subject in conjunction with a chemotherapy. | 05-05-2022 |