| PFIZER INC. Patent applications |
| Patent application number | Title | Published |
| 20120122901 | PYRROLO[2,3-D]PYRIMIDINE COMPOUNDS - Described herein is pyrrolo{2,3-d}pyrimidine compounds, their use as Janus Kinase (JAK) inhibitors, pharmaceutical compositions containing this compounds, and methods for the preparation of these compounds. | 05-17-2012 |
| 20120108588 | NOVEL 3-AMIDO-PYRROLO[3,4-C]PYRAZOLE-5(1H, 4H,6H) CARBALDEHYDE DERIVATIVES - The present invention relates to compounds and pharmaceutically acceptable salts of Formula (I): | 05-03-2012 |
| 20120107351 | In Ovo Vaccination of Campylobacter in Avian Species - The present invention provides a method of inducing an immune response against | 05-03-2012 |
| 20120095062 | TRICYCLIC COMPOUNDS, COMPOSITIONS, AND METHODS - The present invention is directed to compounds of Formula I: | 04-19-2012 |
| 20120093813 | ANTI NOTCH-1 ANTIBODIES - This invention is directed toward monoclonal antibodies that bind specifically to Notch1. In one embodiment, the antibodies binds to at least a first epitope and a second epitope, wherein the first epitope resides with the LinA domain of the Notch1 negative regulatory region (NRR), and the second epitope resides within the HD-C domain of the Notch1 NRR. | 04-19-2012 |
| 20120088802 | TRICYCLIC COMPOUNDS, COMPOSITIONS AND METHODS - The present invention is directed to compounds of Formula I: | 04-12-2012 |
| 20120088746 | AMIDE DERIVATIVES AS ION-CHANNEL LIGANDS AND PHARMACEUTICAL COMPOSITIONS AND METHODS OF USING THE SAME - Compounds are disclosed that have a formula represented by the following: Formula (I). The compounds may be prepared as pharmaceutical compositions, and may be used for the prevention and treatment of a variety of conditions in mammals including humans, including by way of non-limiting example, pain, inflammation, traumatic injury, and others. | 04-12-2012 |
| 20120087978 | DOSAGE FORMS OF APIXABAN - The present invention relates to a Factor Xa inhibitor dosage form comprising apixaban in a solubility-improved form wherein the dosage form provides controlled release of apixaban and methods for preventing or treating venous thromboembolisms, deep vein thrombosis and acute coronary syndrome with said dosage form. | 04-12-2012 |
| 20120077765 | ISOXAZOLINE OXIMES AS ANTIPARASITIC AGENTS - This invention recites naphthyl isoxazoline oxime derivatives of Formula (1) | 03-29-2012 |
| 20120045442 | HUMAN MONOCLONAL ANTIBODIES TO CTLA-4 - In accordance with the present invention, there are provided fully human monoclonal antibodies against human cytotoxic T-lymphocyte antigen 4 (CTLA-4). Nucelotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly contiguous heavy and light chain sequences spanning the complementarity determining regions (CDRs), specifically from within FR1 and/or CDR1 through CDR3 and/or within FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein. | 02-23-2012 |
| 20120039908 | Control of Protein Glycosylation and Compositions and Methods Relating Thereto - The invention relates to novel methods for controlling the glycosylation of a protein and the protein produced thereby. An exemplary method of the invention comprises producing a protein comprising a decreased level of glycosylation, e.g., the protein comprises fewer glycans or fewer saccharides at the glycosylation site, by culturing a host cell expressing the protein in the presence of a glycosylation inhibitor. In an exemplary method of the invention, the biological characteristics of the protein are altered by the decreased level of glycosylation, e.g., the binding of the protein with its target ligand is modified. | 02-16-2012 |
| 20120035209 | Hydroxy Substituted 1H-Imidazopyridines and Methods - Hydroxy substituted 1H-imidazo[4,5-c]pyridin-4-amines, with a hydroxy substituent at the 2-position, pharmaceutical compositions containing these compounds, methods of making the compounds, intermediates, and methods of use of these compounds as immunomodulators for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases are disclosed. | 02-09-2012 |
| 20120035194 | SUBSTITUTED 2-AMINO-FUSED HETEROCYCLIC COMPOUNDS - The present invention relates to compounds of formula (I), | 02-09-2012 |
| 20120021001 | MARKED BOVINE VIRAL DIARRHEA VIRUS VACCINES - The present invention is directed to a bovine viral diarrhea virus comprising at least one helicase domain amino acid mutation wherein the mutation in the NS3 domain results in a loss of recognition by a monoclonal antibody raised against wild-type NS3 but wherein viral RNA replication and the generation of infectious virus is retained. The present invention is useful, for example, to produce a marked bovine viral diarrhea virus vaccine or to differentiate between vaccinated and infected or unvaccinated animals. | 01-26-2012 |
| 20120020995 | PARAPOXVIRUS VECTORS - The present invention relates to recombinant parapoxviruses comprising heterologous DNA derived from a canine distemper virus, to the preparation of such constructs, and to their use in immunogenic compositions and vaccines. It further relates to the use of recombinant parapoxviruses for diagnostics. | 01-26-2012 |
| 20120015435 | PCSK9 ANTAGONISTS - The present invention provides antagonizing antibodies, antigen-binding portions thereof, and aptamers that bind to proprotein convertase subtilisin kexin type 9 (PCSK9). Also provided are antibodies directed to peptides, in which the antibodies bind to PCSK9. The invention further provides a method of obtaining such antibodies and antibody-encoding nucleic acid. The invention further relates to therapeutic methods for use of these antibodies and antigen-binding portions thereof to reduce LDL-cholesterol levels and/or for the treatment and/or prevention of cardiovascular disease, including treatment of hypercholesterolemia. | 01-19-2012 |
| 20120014951 | PCSK9 ANTAGONISTS - The present invention provides antagonizing antibodies, antigen-binding portions thereof, and aptamers that bind to proprotein convertase subtilisin kexin type 9 (PCSK9). Also provided are antibodies directed to peptides, in which the antibodies bind to PCSK9. The invention further provides a method of obtaining such antibodies and antibody-encoding nucleic acid. The invention further relates to therapeutic methods for use of these antibodies and antigen-binding portions thereof to reduce LDL-cholesterol levels and/or for the treatment and/or prevention of cardiovascular disease, including treatment of hypercholesterolemia. | 01-19-2012 |
| 20120005767 | ANTIBODIES TO INSULIN-LIKE GROWTH FACTOR I RECEPTOR - The present invention relates to antibodies and antigen-binding portions thereof that specifically bind to insulin-like growth factor I receptor (IGF-IR), which is preferably human IGF-IR. The invention also relates to human anti-IGF-IR antibodies, including chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulin molecules derived from anti-IGF-IR antibodies and nucleic acid molecules encoding such molecules. The present invention also relates to methods of making anti-IGF-IR antibodies, pharmaceutical compositions comprising these antibodies and methods of using the antibodies and compositions thereof for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-IGF-IR antibodies. The invention also relates to gene therapy methods and transgenic animals comprising nucleic acid molecules of the present invention. | 01-05-2012 |
| 20120003179 | ANTI-CTLA-4 AND CPG-MOTIF-CONTAINING SYNTHETIC OLIGODEOXYNUCLEOTIDE COMBINATION THERAPY FOR CANCER TREATMENT - The invention relates to administration of an anti-CTLA-4 antibody, particularly human antibodies to human CTLA-4, such as those having amino acid sequences of antibodies 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, 12.9.1.1, and MDX-010, in combination with an immunostimulatory nucleotide, i.e., CpG ODN PF3512676, for treatment of cancer. The invention relates to administering a combination of an anti-CTLA-4 antibody and CpG ODN PF3512676 as neoadjuvant, adjuvant, first-line, second-line, and third-line therapy of cancer, whether localized or metastasized, and at any point(s) along the disease continuum (e.g., at any stage of the cancer). | 01-05-2012 |
| 20110301358 | Novel Forms of [R-(R*,R*)]-2-(4-fluorophenyl)-beta,delta-Dihydroxy-5-(1-Methylethyl)-3-P- henyl-4-[(Phenylmino)Carbonyl]-1H-Pyrrole-1-Heptanoic Acid Calcium Salt (2:1) - Novel forms of [R—(R*,R*)]-2-(4-fluorophenyl)-β,δ-dihydroxy-5-(1-methylethyl)-3-phenyl-4-[(phenylamino)carbonyl]-1H-pyrrole-1-heptanoic acid hemi calcium salt designated Form XX, Form XXI, Form XXII, Form XXIII, Form XXIV, Form XXVV, Form XXVI, Form XXVII, Form XXVIII, Form XXIX, and Form XXX, characterized by their X-ray powder diffraction, solid-state NMR, and/or Raman spectroscopy are described, as well as methods for the preparation and pharmaceutical composition of the same, which are useful as agents for treating hyperlipidemia, hypercholesterolemia, osteoporosis, benign prostatic hyperplasia (BPII) and Alzheimer's disease. | 12-08-2011 |
| 20110294826 | PYRROLO[2,3-D]PYRIMIDINE COMPOUNDS - Described herein are pyrrolo[2,3-d]pyrimidine compounds, their use as Janus Kinase (JAK) inhibitors, pharmaceutical compositions containing these compounds, and methods for their preparation. | 12-01-2011 |
| 20110294751 | HIGH DOSAGE DORAMECTIN FORMULATION - Veterinary compositions which provide a high-dose of doramectin or a high-dose veterinary combination composition which comprises doramectin and one or more other antiparasitic agents is disclosed. The compositions provide both antiparasitic efficacy and a significantly reduced withhold time. | 12-01-2011 |
| 20110293647 | IMMUNOGENIC LHRH COMPOSITIONS AND METHODS RELATING THERETO - The present invention relates generally to an immunogenic LHRH composition and more particularly to an immunogenic LHRH composition comprising a LHRH C-terminal fragment of at least five amino acids. The present invention is useful, inter alia, as a prophylactic and/or therapeutic agent for the modification of fertility and behaviour patterns of animals, the achievement of livestock production gains such as increasing growth, decreasing feed conversion ratios or the control of unwanted organoleptic characteristics or the treatment of disorders of the reproductive organs. | 12-01-2011 |
| 20110288297 | Pyrrolo[2,3-d]Pyrimidine Derivatives; Their Intermediates and Synthesis - This invention relates to methods and intermediates useful for the synthesis of pyrrolo[2,3-d]pyrimidine compounds. Specifically novel synthetic methods and intermediates for the synthesis of 3-{(3R,4R)-4-methyl-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-amino}-piperidin- | 11-24-2011 |
| 20110287051 | PARAPOXVIRUS VECTORS - The present invention relates to recombinant | 11-24-2011 |
| 20110274696 | ANTIBODIES TO CCR2 - Provided are antibodies including human antibodies and antigen-binding portions thereof that specifically bind to CCR2, specifically human CCR2, and that may function to inhibit CCR2. Anti-CCR2 antibodies include those which bind to the first and/or second extracellular loops of CCR2. Also provided are human anti-CCR2 antibodies and antigen-binding portions thereof. Isolated heavy and light chain immunoglobulins derived from human anti-CCR2 antibodies and nucleic acid molecules encoding such immunoglobulins are provided. Methods of making human anti-CCR2 antibodies or antigen-binding portions, compositions comprising these antibodies or antigen-binding portions, methods of using the antibodies and antigen-binding portions, and compositions for diagnosis and treatment are provided. Also provided are gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-CCR2 antibodies or antigen binding portions thereof | 11-10-2011 |
| 20110251247 | SUBSTITUTED ISOXAZOLINE DERIVATIVES - This invention recites substituted isoxazoline derivatives of Formula (1) | 10-13-2011 |
| 20110229489 | Antibodies with pH Dependent Antigen Binding - The present invention relates to antibodies with pH dependent binding to its antigen such that the affinity for antigen binding at physiological pH (i.e., pH 7.4) is greater than at endosomal pH (i.e., pH 6.0 or 5.5). In other words, the K | 09-22-2011 |
| 20110224231 | Novel Lactams as Beta Secretase Inhibitors - Compounds and pharmaceutically acceptable salts of the compounds are disclosed, wherein the compounds have the structure of Formula (I) as defined in the specification. Corresponding pharmaceutical compositions, methods of treatment methods of synthesis, and intermediates are also disclosed. | 09-15-2011 |
| 20110190199 | Combination Therapy for Tuberculosis - The present invention relates to methods of treating tuberculosis, including multi-drug resistant varieties and latent tuberculosis. More particularly, the present invention relates to a method of treating tuberculosis in a mammal comprising administering to said mammal in need thereof an effective amount of a compound of formula (I), (S)—N-[[3-[3-fluoro-4-(4-thiomorpholinyl)phenyl]-2-oxo-5-oxazolidinyl]methyl]acetamide, or a pharmaceutically acceptable salt thereof in combination with at least two agents useful in the treatment of tuberculosis. The present invention also relates to a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula (I) or a pharmaceutically acceptable salt or solvate thereof, (ii) a therapeutically effective amount of at least one agent useful in the treatment of tuberculosis and (iii) one or more pharmaceutically acceptable carriers or vehicles. | 08-04-2011 |
| 20110184652 | METHODS OF GENERATING GENETIC PREDICTORS EMPLOYING DNA MARKERS AND QUANTITATIVE TRAIT DATA - A genetic trait predictor is generated by blending individual molecular estimates with estimates of at least one genetic value derived from quantitative trait measure. The individual molecular estimates may include molecular trait estimates or molecular trait variance. The individual molecular estimates may be determined by applying individual deoxyribonucleic acid (DNA) markers, DNA marker panels, specific parameter estimates and specific parameter variance thereof, and a genotype of a test sample. Quantitative trait measure may include estimated breeding data, raw trait data, and breed composition data. The genetic predictor is accurate and stable under a wide range of conditions and relatively immune to errors in parameter estimation. | 07-28-2011 |
| 20110178042 | Hydroxamic Acid Derivatives Useful as Antibacterial Agents - The invention relates to a compound of formula (I): or a pharmaceutically acceptable salt thereof, thereof, wherein: G is a group of formula (II); and pharmaceutically acceptable salts, prodrugs, hydrates, or solvates, thereof, wherein A, B. L | 07-21-2011 |
| 20110165170 | OSTEOPONTIN ANTIBODIES - The present disclosure provides isolated antibodies, particularly human antibodies, or antigen binding portions thereof, that bind to osteopontin with high affinity. Nucleic acid molecules encoding the antibodies of the disclosure, expression vectors, host cells and methods for expressing the antibodies of the disclosure are also provided. | 07-07-2011 |
| 20110144084 | 6 SUBSTITUTED 2- HETEROCYCLYLAMINO PYRAZINE COMPOUNDS AS CHK-1 INHIBITORS - The present invention is directed to compounds of formula (I), | 06-16-2011 |
| 20110136765 | Pyrrolo[2,3-D]Pyrimidine Compounds - Described herein are pyrrolo[2,3-d]pyrimidine compounds, their use as Janus Kinase (JAK) inhibitors, pharmaceutical compositions containing these compounds, and methods for their preparation. | 06-09-2011 |
| 20110105600 | SYNERGISTIC COMPOSITION OF (-)-HYDROXYCITRIC ACID WITH MONOTERPENE AND A METHOD TO ENHANCE SATIETY - The present disclosure provides synergistic composition comprising (−)-hydroxycitric acid, its salts, amides and esters in conjunction with monoterpenes for enhancing satiety. The disclosure is also related to the use of synergistic composition in food and pharmaceutical compositions. The present disclosure helps in controlling obesity by enhancing satiety. | 05-05-2011 |
| 20110064758 | INFECTIOUS CLONES OF TORQUE TENO VIRUS - The present invention is directed to novel nucleotide and amino acid sequences of Torque teno virus (“TTV”), including novel genotypes thereof, all of which are useful in the preparation of vaccines for treating and preventing diseases in swine and other animals. Vaccines provided according to the practice of the invention are effective against multiple swine TTV genotypes and isolates. Diagnostic and therapeutic polyclonal and monoclonal antibodies are also a feature of the present invention, as are infectious clones useful in the propagation of the virus and in the preparation of vaccines. Particularly important aspects of the invention include vaccines that provide TTV ORF1 protein, or peptide fragments thereof, as antigen. | 03-17-2011 |
| 20110064726 | ANTI IgE ANTIBODIES - The present invention relates to novel human antibodies specifically directed against human immunoglobulin E (anti-IgE). The present invention also relates to pharmaceutical compositions and methods for treating asthma, in particular allergic asthma, as well as other IgE-mediated disorders including allergic rhinitis and food allergies. | 03-17-2011 |
| 20110053982 | ETHER BENZYLIDENE PIPERIDINE 5-MEMBERED ARYL CARBOXAMIDE COMPOUNDS USEFUL AS FAAH INHIBITORS - The present invention relates to compounds of the Formula (I), and pharmaceutically acceptable salts thereof, and their use in the treatment of FAAH-mediated diseases or condition. | 03-03-2011 |
| 20110053949 | 4-[3-(ARYLOXY)BENZYLIDENE]-3-METHYL PIPERIDINE ARYL CARBOXAMIDE COMPOUNDS USEFUL AS FAAH INHIBITORS - The present invention relates to compounds of Formula (I), wherein Ar is optionally substituted phenyl or heteroaryl and X, Y and Z are independently N or CH; or a pharmaceutically acceptable salt thereof; processes for the preparation of the compounds; intermediates used in the preparation of the compounds; compositions containing the compounds; and uses of the compounds in treating diseases or conditions associated with fatty acid amide hydrolase (FAAH) activity. | 03-03-2011 |
| 20110052619 | METHODS OF VACCINE ADMINISTRATION, NEW FELINE CALICIVIRUSES, AND TREATMENTS FOR IMMUNIZING ANIMALS AGAINST FELINE PARAOVIRUS AND FELINE HERPES VIRUS - The present invention relates to a vaccine for immunizing a cat against feline viruses. The present invention also relates to a nucleic acid clone that encodes the capsid protein of the isolated feline calicivirus. The present invention further relates to a live or killed vaccine comprising the isolated feline calicivirus, a subunit vaccine comprising the capsid protein of the isolated feline calicivirus, a nucleic acid vaccine comprising a nucleic acid clone of the isolated feline calicivirus, and a recombinant virus vector vaccine comprising nucleic acid encoding the capsid protein of the isolated feline calicivirus. The present invention also relates to a method for identifying a feline calicivirus useful for producing a vaccine composition and for assays for diagnosing cats infected with feline calicivirus. Also disclosed is a method of immunizing animals, especially cats, against disease, in particular against feline calicivirus (FCV). The method includes administering to a cat therapeutically effective amounts of first and second FCV vaccines. The first vaccine is administered orally or parenterally (e.g., subcutaneously, intramuscularly, and the like). The second vaccine is administered orally or oronasally N days following administration of the first vaccine, wherein N is an integer from 3 to 120, inclusive. A third vaccine administration may also be given. The present invention also describes methods and materials for treating and immunizing animals with vaccine, and in particular cats against both FPV or Feline Parvovirus, which has also been called Panleukopenia or FPL and against another disease, FHV or Feline Herpes Virus, which has also been called Feline Rhinotracheitis Virus. | 03-03-2011 |
| 20110028390 | Pyrazolospiroketone Acetyl-CoA Carboxylase Inhibitors - The invention provides compounds of Formula (1) or a pharmaceutically acceptable salt of said compound, wherein R | 02-03-2011 |
| 20110020909 | Methods Of Culturing Lawsonia Intracellularis - The present invention relates generally to the growth of | 01-27-2011 |
| 20110009435 | HETERO BICYCLIC CARBOXAMIDE DERIVATIVES AND THEIR PHARMACEUTICAL USE AND COMPOSITIONS - The present invention relates to compounds of Formula I | 01-13-2011 |
| 20110008328 | METHOD FOR CONTROLLING GLUCOSE UPTAKE AND INSULIN SENSITIVITY - The invention provides methods for treating diabetes and related disorders, such as metabolic syndromes (which includes insulin resistance), by administering an inhibitor of osteopontin (OPN), which includes an antibody, antibody fragment, siRNA, and aptamer. Also disclosed are methods for increasing glucose uptake by cells in a subject, by administering an inhibitor of OPN. | 01-13-2011 |
| 20100292205 | Pyrimidone Compounds As GSK-3 Inhibitors - The invention pertains to pyrimidone compounds that serve as effective GSK-3 inhibitors. The invention further relates to pharmaceutical compositions and methods comprising such pyrimidone compounds; and the use of such compounds for treating certain disorders. | 11-18-2010 |
| 20100291076 | ANTIBODIES SPECIFIC FOR DKK-1 AND THEIR USES - The present invention provides antibodies and fragments thereof that bind to Dkk-1 and, in particular, to humanized antibodies and fragments thereof that bind to Dkk-1 and, even more particularly to fully humanized antibodies and immunologically functional fragments that bind to Dkk-1. Also provided are antibodies and fragments thereof which compete with the binding of an anti-mouse Dkk-1 monoclonal antibody for binding to Dkk-1 | 11-18-2010 |
| 20100286214 | TRICYCLIC COMPOUNDS, COMPOSITIONS AND METHODS - The present invention is directed to compounds of Formula I: | 11-11-2010 |
| 20100285057 | HEAT TREATED BACTERINS, AND EMULSION VACCINES PREPARED FROM SUCH HEAT TREATED BACTERINS - Heat treated bacterins, a method of producing heat treated bacterins, and porcine emulsion vaccines prepared from such heat treated bacterins are disclosed. | 11-11-2010 |
| 20100273794 | Benzimidazolone Compounds Having 5-HT4 Receptor Agonistic Activity - This invention provides a compound of the formula (I): | 10-28-2010 |
| 20100266629 | Cattle Reproductive Disease Vaccines - The present invention relates to combination vaccines and methods for treating or preventing diseases or disorders in an animal caused by infection by Bovine Viral Diarrhea Virus (BVDV) Types 1 and 2, Bovine Herpes Virus Type-1 (BHV-1), Bovine Respiratory Syncytial Virus (BRSV), Parainfluenza Virus (PI | 10-21-2010 |
| 20100255538 | ANTIBODIES TO INSULIN-LIKE GROWTH FACTOR I RECEPTOR - The present invention relates to antibodies and antigen-binding portions thereof that specifically bind to insulin-like growth factor I receptor (IGF-IR), which is preferably human IGF-IR. The invention also relates to human anti-IGF-IR antibodies, including chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulin molecules derived from anti-IGF-IR antibodies and nucleic acid molecules encoding such molecules. The present invention also relates to methods of making anti-IGF-IR antibodies, pharmaceutical compositions comprising these antibodies and methods of using the antibodies and compositions thereof for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-IGF-IR antibodies. The invention also relates to gene therapy methods and transgenic animals comprising nucleic acid molecules of the present invention. | 10-07-2010 |
| 20100234314 | IDARUBICIN FOR THE TREATMENT OF LYMPHOMA IN A DOG - The present invention relates to a method of treating a lymphoma in a dog comprising administering to a dog in need of such treatment a therapeutically effective amount of idarubicin or a pharmaceutically acceptable salt thereof. | 09-16-2010 |
| 20100227829 | MOTILIDE POLYMORPHS - The invention provides polymorphs of a motilide having a structure represented by formula Ia | 09-09-2010 |
| 20100215654 | Methods of treating Osteoarthritis with IL-6 Antagonists - The present invention provides for methods of treating osteoarthritis with IL-6 antagonists such as IL-6 antibodies. | 08-26-2010 |
| 20100197624 | ANTHELMINTIC COMBINATION - A method is provided for the treatment of parasitic infestations in mammals, comprising the step of simultaneously or sequentially administering to the mammal effective amounts of (a) 2-desoxoparaherquamide; and (b) abamectin. Also provided is an anthelmintic composition comprising 2-desoxoparaherquamide and abamectin. | 08-05-2010 |
| 20100197005 | HUMAN MONOCLONAL ANTIBODIES TO ACTIVIN RECEPTOR-LIKE KINASE-1 - The present invention relates to antibodies including human antibodies and antigen-binding portions thereof that bind to the extracellular domain (ECD) of activin receptor-like kinase-1 (ALK-1) and that function to abrogate the ALK-1/TGF-beta-1/Smad1 signaling pathway. The invention also relates to heavy and light chain immunoglobulins derived from human anti-ALK-1 antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of making human anti-ALK-1 antibodies, compositions comprising these antibodies and methods of using the antibodies and compositions. The invention also relates to transgenic animals or plants comprising nucleic acid molecules of the present invention. | 08-05-2010 |
| 20100184737 | IMIDAZOLE COMPOUNDS FOR THE TREATMENT OF NEUROLOGICAL DISORDERS - The present invention relates to compounds of Formula I | 07-22-2010 |
| 20100168107 | IMIDAZOLE COMPOUNDS FOR THE TREATMENT OF NEURODEGENERATIVE DISORDERS - The present invention relates to compounds of the Formula I | 07-01-2010 |
| 20100137279 | 4-METHYLPYRIDOPYRIMIDINONE COMPOUNDS - The present invention is directed to novel 4-methylpyridopyrimidinone compounds of Formula (I), | 06-03-2010 |
| 20100136055 | CHIMERIC PESTIVIRUSES - The present invention relates to chimeric pestiviruses having utility as immunogenic compositions and vaccines. Also described herein are methods and kits for treating or preventing the spread of bovine viral diarrhea virus infection, as well as methods and kits for differentiating between vaccinated and wild-type infected animals. | 06-03-2010 |
| 20100113361 | ANTI-IGE VACCINES - The present invention provides compositions and methods for the use of antigenic peptides derived from the Fc portion of the epsilon heavy chain of an IgE molecule as vaccines for the treatment and prevention of IgE-mediated allergic disorders. In particular, the invention provides compositions, methods for the treatment and prevention of IgE-mediated allergic disorders comprising an immunogenic amount of one or more antigenic peptides derived from the CH3 domain or junction of Ch-3/CH4 domain of an IgE molecule and methods for the evaluation of IgE mediated allergies in dogs. | 05-06-2010 |
| 20100105649 | VETERINARY COMPOSITIONS FOR TREATING MASTITIS - The present invention relates to a veterinary composition for the prophylaxis and treatment of mastitis in mammals, preferably cows. The formulations of the present invention comprise two parts that are optionally administered to the animal as a blended formulation or two separate formulations. The first part is a seal formulation comprising a gel base and a non-toxic heavy metal salt in the base. The second part of the formulation is an oil-based product preferably containing an antibiotic in an oil-based formulation. The oil-based formulation may also optionally contain any other pharmaceutically active agent for the treatment or prophylaxis of disease in cattle. | 04-29-2010 |
| 20100098694 | ANTIBODIES TO CD40 - The present invention relates to antibodies and antigen-binding portions thereof that specifically bind to CD40, preferably human CD40, and that function as CD40 agonists. The invention also relates to human anti-CD40 antibodies and antigen-binding portions thereof. The invention also relates to antibodies that are chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulins derived from human anti-CD40 antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of making human anti-CD40 antibodies, compositions comprising these antibodies and methods of using the antibodies and compositions for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-CD40 antibodies. The invention also relates to transgenic animals comprising nucleic acid molecules of the present invention. | 04-22-2010 |
| 20100075996 | PYRROLO[2,3-D]PYRIMIDINE COMPOUNDS - Described herein is pyrrolo{2,3-d}pyrimidine compounds, their use as Janus Kinase (JAK) inhibitors, pharmaceutical compositions containing this compounds, and methods for the preparation of these compounds. | 03-25-2010 |
| 20100075956 | N-(1-ARYLPYRAZOL-4L)SULFONAMIDES AND THEIR USE AS PARASITICIDES - The invention relates to a sulfonamide compound of formula (I) or a pharmaceutically, veterinarily or agriculturally acceptable salt or solvate thereof, where the groups R | 03-25-2010 |
| 20100069444 | PHENATHRENONE COMPOUNDS, COMPOSITONS AND METHODS - The present invention is directed to compounds of Formula I: | 03-18-2010 |
| 20100068199 | PCSK9 ANTAGONISTS - The present invention provides antagonizing antibodies, antigen-binding portions thereof, and aptamers that bind to proprotein convertase subtilisin kexin type 9 (PCSK9). Also provided are antibodies directed to peptides, in which the antibodies bind to PCSK9. The invention further provides a method of obtaining such antibodies and antibody-encoding nucleic acid. The invention further relates to therapeutic methods for use of these antibodies and antigen-binding portions thereof to reduce LDL-cholesterol levels and/or for the treatment and/or prevention of cardiovascular disease, including treatment of hypercholesterolemia. | 03-18-2010 |
| 20100056571 | NOVEL PYRAZOLE COMPOUNDS AS TRANSFORMING GROWTH FACTOR (TGF) INHIBITORS - Novel pyrazole compounds, including derivatives thereof, to intermediates for their preparation, to pharmaceutical compositions containing them and to their medicinal use are described. The compounds of the present invention are potent inhibitors of transforming growth factor (“TGF”)- | 03-04-2010 |
| 20100055751 | KETOREDUCTASE POLYPEPTIDES AND USES THEREOF - The present disclosure provides engineered ketoreductase enzymes having improved properties as compared to a naturally occurring wild-type ketoreductase enzyme including the capability of stereo specifically reducing (R)-2-methylpentanal to (R)-2-methylpentanol. Also provided are polynucleotides encoding the engineered ketoreductase enzymes, host cells capable of expressing the engineered ketoreductase enzymes, and methods of using the engineered ketoreductase enzymes to produce (R)-2-methylpentanol and related compounds. | 03-04-2010 |
| 20100052221 | Apparatus and Method for Removing Molded Articles from Their Molds - The present invention relates to a method and apparatus for removing a plurality of molded articles from respective molds each having an external molding surface oriented according to a mold axis (X), said molds ( | 03-04-2010 |
| 20100041712 | SUBSTITUTED IMIDAZOLE COMBINATIONS - This invention relates to a composition comprising a combination of a) an alpha substituted 2-benzyl substituted imidazole and b) a 1-N-arylpyrazole, and optionally c) an insect growth regulator, and their use as a parasiticide in mammals. | 02-18-2010 |
| 20100040629 | Antibodies to c-Met - The present invention relates to antibodies including human antibodies and antigen-binding portions thereof that specifically bind to c-Met, preferably human c-Met, and that function to inhibit c-Met. The invention also relates to human anti-c-Met antibodies and antigen-binding portions thereof. The invention also relates to antibodies that are chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulins derived from human anti-c-Met antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of making human anti-c-Met antibodies, compositions comprising these antibodies and methods of using the antibodies and compositions for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-c-Met antibodies. The invention also relates to transgenic animals or plants comprising nucleic acid molecules of the present invention. | 02-18-2010 |
| 20100028379 | METHODS OF VACCINE ADMINISTRATION - This invention relates to a method of treating a dog for canine diseases comprising administering to the dog therapeutically effective amounts of a vaccine, wherein the vaccine comprises viral antigens, a bacterin, or both, and wherein the vaccine is administered subcutaneously or orally according to the schedules provided herein. | 02-04-2010 |
| 20100003331 | SUSTAINED RELEASE DOSAGE FORMS OF ZIPRASIDONE - A sustained release solid oral dosage form for treatment of a psychotic disorder, for example schizophrenia, in a mammal is provided, which oral dosage form comprises ziprasidone in an amount effective in treating said psychotic disorder and a pharmaceutically acceptable carrier. | 01-07-2010 |
| 20090324641 | NOVEL ADJUVANT COMPOSITIONS - This invention relates to adjuvant formulations comprising various combinations of triterpenoids, sterols, immunomodulators, polymers, and Th2 stimulators; methods for making the adjuvant compositions; and the use of the adjuvant formulations in immunogenic and vaccine compositions with different antigens. This invention further relates to the use of the formulations in the treatment of animals. | 12-31-2009 |
| 20090318297 | Antibody Ultrahumanization by Predicted Mature CDR Blasting and Cohort Library Generation and Screening - Methods and compositions directed to improved universal antibody libraries that rationally exploit human diversity information contained within reference antibody libraries, such as universal antibody libraries, are disclosed. The disclosed processes involve use of a query CDR sequence to guide incorporation of human antibody diversity present within the reference library into cohort libraries of the invention. Methods for making and screening such cohort libraries for isolating therapeutics suitable for treating disease are also disclosed. | 12-24-2009 |
| 20090314691 | METHOD AND APPARATUS FOR MONITORING THE PERFORMANCE OF AUTOMATED EGG REMOVAL - Methods and apparatus are provided that automatically determine whether or not eggs designated for removal from an egg carrier have been removed by an egg removal apparatus. Light is emitted along a path above and across an egg carrier as an egg picker moves to pick up an egg. The length of time that the light path is blocked when the egg picker is moved is measured and used to determine whether or not the egg has been removed from the carrier. Another apparatus and method is provided for detecting a malfunctioning egg picker. A detection device detects a number of eggs in the egg carrier. A control device monitors the egg picker and the detection device. The control device calculates the number of eggs in the egg carrier for determining when the number of eggs varies a predetermined amount from an egg count number for the egg carrier. | 12-24-2009 |
| 20090286875 | ISOCYSTENE DERIVATIVES FOR THE TREATMENT OF PAIN - The present invention relates to compounds of formula (I): wherein R | 11-19-2009 |
| 20090275481 | Anchored Transferrin Fusion Protein Libraries - Fusion proteins comprising a transferrin moiety, a stalk moiety, and cell wall linking member and peptide libraries thereof are disclosed. The present invention includes a method of screening peptide libraries displayed in fusion proteins expressed by host cells. The fusion proteins of the present invention include transferrin fusion proteins capable of expression in yeast. | 11-05-2009 |
| 20090232848 | METHODS FOR CULTIVATING LAWSONIA INTRACELLULARIS - This invention relates to methods for cultivating | 09-17-2009 |
| 20090215891 | S-[2-[(1-lminoethy)Amino]Ethyl]-2-Methyl-L-Cysteine Maleate Hydrochloride Crystalline Salt - A novel mixed salt of S-[2-[(1-Iminoethyl)amino]ethyl]-2-methyl-L-cysteine is disclosed. The novel mixed salt, S-[2-[(1-Iminoethyl)amino]ethyl]-2-methyl-L-cysteine maleate hydrochloride, may be produced to form crystals that may be arranged as generally orderly packed agglomerates, which are particularly useful in making pharmaceutical compositions. Such pharmaceutical compositions are also described, as well as methods to make crystalline S-[2-[(1-Iminoethyl)amino]ethyl]-2-methyl-L-cysteine maleate hydrochloride, and methods of treating conditions characterized by an overexpression on nitric oxide from the inducible isoform of nitric oxide synthase using the S-[2-[(1-Iminoethyl)amino]ethyl]-2-methyl-L-cysteine maleate hydrochloride. | 08-27-2009 |
| 20090209577 | Novel Triazolopyridine Compounds - This invention is directed generally to triazolopyridine compounds that generally inhibit p38 kinase, TNF, and/or cyclooxygenase activity. Such triazolopyridine include compounds generally corresponding in structure to the following formula: | 08-20-2009 |
| 20090186924 | SUBSTITUTED ARYLPYRAZOLES - This invention relates to a range of 1-aryl-4-cyclopropylpyrazoles in which the cyclopropyl ring is substituted at the angular position, and pharmaceutically acceptable salts and solvates thereof, to compositions comprising such compounds, processes to their synthesis and their use as parasiticides. | 07-23-2009 |
| 20090170897 | Method of Treating Neuropathic Pain - The invention relates to the use of a CRTH2 receptor antagonist in the manufacture of a medicament for the treatment of neuropathic pain and to a method of treating neuropathic pain using an antagonist of CRTH2 receptor. | 07-02-2009 |
| 20090169563 | Antibodies to CD40 - The present invention relates to antibodies and antigen-binding portions thereof that specifically bind to CD40, preferably human CD40, and that function as CD40 agonists. The invention also relates to human anti-CD40 antibodies and antigen-binding portions thereof. The invention also relates to antibodies that are chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulins derived from human anti-CD40 antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of making human anti-CD40 antibodies, compositions comprising these antibodies and methods of using the antibodies and compositions for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-CD40 antibodies. The invention also relates to transgenic animals comprising nucleic acid molecules of the present invention. | 07-02-2009 |
| 20090162397 | HEAT TREATED BACTERINS, AND EMULSION VACCINES PREPARED FROM SUCH HEAT TREATED BACTERINS - Heat treated bacterins, a method of producing heat treated bacterins, and porcine emulsion vaccines prepared from such heat treated bacterins are disclosed. | 06-25-2009 |
| 20090137637 | Tetrazolyl-Methylene Amino Acid Derivatives - This invention relates to a compound of Formula (I) or a pharmaceutically acceptable salt thereof; a pharmaceutical composition; a method of treating a disease mediated by an MMP-13 enzyme in a mammal; and a therapeutic combination containing at least two pharmaceutically active components, wherein R | 05-28-2009 |
| 20090137553 | Thiazepine Oxazolidinones as Antibacterial Agents - The present invention relates to a new class of oxazolidinone derivatives, to their use as antibacterial agents, to pharmaceutical compositions containing these compounds and to methods for their preparation. | 05-28-2009 |
| 20090131433 | HISTAMINE-3 RECEPTOR ANTAGONISTS - This invention is directed to a compound of the formula Ia or Ib, as defined herein, or a pharmaceutically acceptable salt thereof; a pharmaceutical composition containing a compound of formula I, a method of treatment of a disorder or condition that may be treated by antagonizing histamine H3 receptors, the method comprising administering to a mammal in need of such treatment a compound of formula I as described above, and a method of treatment of a disorder or condition selected from the group consisting of depression, mood disorders, schizophrenia, anxiety disorders, Alzheimer's disease, attention-deficit disorder (ADD), attention-deficit hyperactivity disorder (ADHD), psychotic disorders, sleep disorders, obesity, dizziness, epilepsy, motion sickness, respiratory diseases, allergy, allergy-induced airway responses, allergic rhinitis, nasal congestion, allergic congestion, congestion, hypotension, cardiovascular disease, diseases of the GI tract, hyper and hypo motility and acidic secretion of the gastro-intestinal tract, the method comprising administering to a mammal in need of such treatment a compound of formula I as described above. | 05-21-2009 |
| 20090130715 | Antibodies to CD40 - The present invention relates to antibodies and antigen-binding portions thereof that specifically bind to CD40, preferably human CD40, and that function as CD40 agonists. The invention also relates to human anti-CD40 antibodies and antigen-binding portions thereof. The invention also relates to antibodies that are chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulins derived from human anti-CD40 antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of making human anti-CD40 antibodies, compositions comprising these antibodies and methods of using the antibodies and compositions for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-CD40 antibodies. The invention also relates to transgenic animals comprising nucleic acid molecules of the present invention. | 05-21-2009 |
| 20090124635 | CHEMICAL COMPOUNDS - The present invention provides compounds of formula (I) wherein R | 05-14-2009 |
| 20090123952 | Method of Measuring Amyloid-Beta Peptides - The present invention relates to methods for measuring Aβ peptides in a sample, particularly a sample of blood, such as whole blood and plasma, and to methods of determining whether a compound alters the amount of Aβ produced by a cell or animal. | 05-14-2009 |
| 20090117132 | Anti-Ctla-4 Antibody and Cpg-Motif-Containing Synthetic Oligodeoxynucleotide Combination Therapy for Cancer Treatment - The invention relates to administration of an anti-CTLA-4 antibody, particularly human antibodies to human CTLA-4, such as those having amino acid sequences of antibodies 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, 12.9.1.1, and MDX-010, in combination with an immunostimulatory nucleotide, i.e, CpG ODN PF3512676, for treatment of cancer. The invention relates to administering a combination of an anti-CTLA-4 antibody and CpG ODN PF3512676 as neoadjuvant, adjuvant, first-line, second-line, and third-line therapy of cancer, whether localized or metastasized, and at any point(s) along the disease continuum (e.g, at any stage of the cancer). | 05-07-2009 |
| 20090110681 | Anti-M-CSF Antibody Compositions - The present invention provides for compositions of anti-M-CSF antibodies comprising a chelating agent and/or histidine. Also provided are methods of treating M-CSF-mediated disorders with pharmaceutical formulations of anti-M-CSF anti-bodies, including inflammatory diseases and neoplasia disorders. | 04-30-2009 |
| 20090087446 | COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY - Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines. | 04-02-2009 |
| 20090082295 | COMBINATIONS AND METHODS OF USING AN IMMUNOMODULATORY OLIGODEOXYNUCLEOTIDE - The present invention relates to combination therapies for the treatment of cancer. The combination of agents include oligonucleotides and one or more chemotherapeutic agents. | 03-26-2009 |
| 20090048306 | PYRIDINE DERIVATIVES - The present invention relates to compounds of the formula (I): | 02-19-2009 |
| 20090048254 | SALTS AND POLYMORPHS OF A VEGF-R INHIBITOR - The invention relates to salts and free base forms of N,2-dimethyl-6-[7-(2-morpholinoethoxy)quinolin-4-yloxy]benzofuran-3-carboxamide. The invention further relates to pharmaceutical compositions of these salts and free base forms and methods of treating disorders such as cancer using such compositions. | 02-19-2009 |
| 20090042886 | Benzamide Inhibitors of the P2X7 Receptor - The present invention provides benzamide inhibitors of the P2X | 02-12-2009 |
| 20090005354 | New Amino Derivatives and Their Use as Pharmaceuticals - The present invention provides for compounds of formula (I): | 01-01-2009 |
| 20080318967 | Hair Growth Promoting Agents - The present invention is directed to crystalline forms of 6-[[(3S,4R)-3,4-dihydro-3-hydroxy-6-[(3-hydroxyphenyl)sulfonyl]-2,2,3-trimethyl-2H-1-benzopyran-4-yl]oxy]-2-methyl-3(2H)-pyridazinone, formulations containing at least one of these crystalline forms and their use to promote hair growth. | 12-25-2008 |
| 20080312294 | Tricyclic Compounds, Compositions, and Methods - The present invention is directed to compounds of Formula I: | 12-18-2008 |
| 20080311151 | Vaccine For Periodontal Disease - The present invention relates to novel bacterial isolates identified by their 16S rRNA DNA, that cause periodontal disease in companion animals, polynucleotide sequences contained therein, polypeptides encoded by such polynucleotide sequences and vaccines comprising such bacteria, polynucleotides, or polypeptides. Also provided are methods for treating and preventing periodontal disease and kits for detecting and treating periodontal disease kits for detecting and preventing periodontal disease. In addition, methods for assessing the efficacy of a vaccine against periodontal diseases in an animal are provided. | 12-18-2008 |
| 20080306123 | NOVEL COMPOUNDS - A compound of Formula (I) | 12-11-2008 |
| 20080300249 | Isothiazole Derivatives Useful as Anticancer Agents - The present invention relates to compounds of the formula 1 | 12-04-2008 |
| 20080293746 | COMBINATIONS COMPRISING PREGABALIN - The invention relates to a combination of pregabalin and 1-(2-ethoxyethyl)-5-[ethyl(methyl)amino]-N-mesyl-7-[(4-methyl-2-pyridyl)amino]-1H-pyrazolo[4,3-d]pyrimidine-3-carboxamide, to pharmaceutical compositions containing the combination, and to the use of the combination in the treatment of pain. | 11-27-2008 |
| 20080286302 | Safe Mutant Viral Vaccines - The present invention provides safe vaccines and methods of preparing such vaccines. The vaccines of the present invention contain at least two live mutant viruses of the same family or nucleic acid molecules encoding such viruses, wherein each of the two viruses or the encoding nucleic acids contains a mutation that confers a desirable phenotype and the mutations in the viruses reside in the same genomic site such that the mutant viruses cannot recombine with each other to eliminate the mutations. | 11-20-2008 |
| 20080275235 | NOVEL FUSED HETEROAROMATIC COMPOUNDS AS TRANSFORMING GROWTH FACTOR (TGF) INHIBITORS - Novel fused heteroaromatic compounds, including derivatives thereof, to intermediates for their preparation, to pharmaceutical compositions containing them and to their medicinal use are described. The compounds of the present invention are potent inhibitors of transforming growth factor (“TGF”)- | 11-06-2008 |
| 20080275101 | Solid Salt Forms Of A Pyrrole Substituted 2-Indolinone - The present invention relates to solid salt forms of the 3-pyrrole substituted 2-indolinone compound 5-[5-fluoro-2-oxo-1,2-dihydro-indol-(3Z)-ylidenemethyl]-2,4-dimethyl-1H-pyrrole-3-carboxylic acid (2-pyrrolidin-1-yl-ethyl)-amide. It also relates to polymorphs of the phosphate salt of the amide. The invention further relates to the use of the salts and polymorphs in the treatment of protein kinase related disorders. | 11-06-2008 |
| 20080274192 | Pharmaceutical Compositions Comprising an Amorphous Form of a Vegf-R-Inhibitor - A pharmaceutical composition comprising the compound 6-[2-(methylcarbamoyl)phenylsulfanyl]-3-E-[2-(pyridin-2-yl)ethenyl]indazole, or a pharmaceutically acceptable salt or solvate thereof, in an amorphous form. | 11-06-2008 |
| 20080269264 | Crystalline Forms of 3-[5-Chloro-4-[(2,4-Difluorobenzyl) Oxy]-6-Oxopyrimidin-1(6H)-Yl]-N-(2-Hydroxyethyl)-4-Methylbenzamide - Crystalline forms of the p38 kinase inhibitor 3-[5-chloro-4-[(2,4-difluorobenzyl)oxy]-6-oxopyrimidin-1(6H)-yl]-N-(2-hydroxyethyl)-4-methylbenzamide is provided. Also provided are combinations and pharmaceutical compositions comprising the crystalline forms, and methods for the prophylaxis and/or treatment of a p38 kinase-mediated condition comprising administering to a subject a therapeutically effective amount of the crystalline forms. | 10-30-2008 |
| 20080262074 | Salt Forms of [R-(R*,R*)]-2-(4-Fluorophenyl)-Beta,Delta-Dihydroxy-5-(1-Methylethyl)-3-(Phenyl-4-[(Phenylamino)Carbonyl]-1H-Pyrrole-1-Heptanoic Acid - Novel salt forms of [R—(R*,R*)]-2-(4-fluorophenyl)-β,δ-dihydroxy-5-(1-methylethyl)-3-phenyl-4-[(phenylamino)carbonyl]-1H-pyrrole-1-heptanoic acid or solvates or hydrates thereof, as well as crystalline salts characterized by their X-ray powder diffraction pattern are described, as well as methods for the preparation and pharmaceutical composition of the same, which are useful as agents for treating hyperlipidemia, hypercholesterolemia, osteoporosis, benign prostatic hyperplasia, and Alzheimer's Disease. | 10-23-2008 |
| 20080261984 | Use of S,S-Reboxetine in the Treatment of Pain - Use of (S,S)- or racemic reboxetine or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for the treatment of a pain condition selected from neuropathic pain, nociceptive pain, cancer pain, back pain, inflammatory pain, musculo-skeletal disorders, visceral pain, pain from strains/sprains, post-operative pain, posttraumatic pain, burns, renal colic, acute pain, central nervous system trauma, head pain, and orofacial pain, is disclosed. Use of (S,S)-reboxetine or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for the treatment of pain in a patient refractory to an alpha-2-delta ligand, and use of (S,S)- or racemic reboxetine or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for use as a mental performance or mood enhancer, are also disclosed. | 10-23-2008 |
| 20080233122 | Human monoclonal antibodies to CTLA-4 - In accordance with the present invention, there are provided fully human monoclonal antibodies against human cytotoxic T-lymphocyte antigen 4 (CTLA-4). Nucelotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly contiguous heavy and light chain sequences spanning the complementarity determining regions (CDRs), specifically from within FR1 and/or CDR1 through CDR3 and/or within FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein. | 09-25-2008 |
| 20080233116 | Human monoclonal antibodies to CTLA-4 - In accordance with the present invention, there are provided fully human monoclonal antibodies against human cytotoxic T-lymphocyte antigen 4 (CTLA-4). Nucleotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly contiguous heavy and light chain sequences spanning the complementarity determining regions (CDRs), specifically from within FR1 and/or CDR1 through CDR3 and/or within FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein. | 09-25-2008 |
| 20080226670 | CANINE COMBINATION VACCINES - This invention relates to vaccines and methods for protecting dogs against disease caused by | 09-18-2008 |
| 20080206257 | Combined treatment with keratinocyte growth factor and epidermal growth factor inhibitor - The present invention relates to compositions and methods for treating the epithelial toxicity caused by administering to a human cancer patient an epidermal growth factor receptor (EGFR) inhibitor. The pharmaceutical composition preferably comprises an EGFR inhibitor and a keratinocyte growth factor (KGF) in a pharmaceutically-acceptable carrier. The method of treatment comprises co-administering to the patient a therapeutically effective amount of KGF with the EGFR inhibitor. | 08-28-2008 |
| 20080199527 | Enteric Coated Azithromycin Multiparticulates - A pharmaceutical composition is disclosed which comprises multiparticulates wherein said multiparticulates further comprise an azithromycin core and an enteric coating disposed upon said azithromycin core. | 08-21-2008 |