Coley Pharmaceutical GmbH Patent applications |
Patent application number | Title | Published |
20140163213 | CpG Oligonucleotide Analogs Containing Hydrophobic T Analogs with Enhanced Immunostimulatory Activity - The invention relates to oligonucleotides including at least one lipophilic substituted nucleotide analog and a pyrimidine-purine dinucleotide. The invention also relates to pharmaceutical compositions and methods of use thereof. | 06-12-2014 |
20140135487 | IMMUNOSTIMULATORY G, U-CONTAINING OLIGORIBONUCLEOTIDES - Compositions and methods relating to immunostimulatory RNA oligomers are provided. The immunostimulatory RNA molecules are believed to represent natural ligands of one or more Toll-like receptors, including Toll-like receptor 7 (TLR7) and Toll-like receptor 8 (TLR8). The compositions and methods are useful for stimulating immune activation. Methods useful for screening candidate immunostimulatory compounds are also provided. | 05-15-2014 |
20120258140 | RNA SEQUENCE MOTIFS IN THE CONTEXT OF DEFINED INTERNUCLEOTIDE LINKAGES INDUCING SPECIFIC IMMUNE MODULATORY PROFILES - Immunostimulatory polymers that contain certain sequence-dependent immunostimulatory RNA motifs and methods for the use of such immunostimulatory polymers and compositions containing such polymers are provided according to the invention. The sequence-dependent immunostimulatory RNA motifs and the polymers incorporating such motifs are potent and selective inducers of TLR7 and the TLR7-associated cytokine IFN-α. | 10-11-2012 |
20120219571 | COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY - Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines. | 08-30-2012 |
20120121648 | RNA SEQUENCE MOTIFS IN THE CONTEXT OF DEFINED INTERNUCLEOTIDE LINKAGES INDUCING SPECIFIC IMMUNE MODULATORY PROFILES - Immunostimulatory polymers that contain certain sequence-dependent immunostimulatory RNA motifs and methods for the use of such immunostimulatory polymers and compositions containing such polymers are provided according to the invention. The sequence-dependent immunostimulatory RNA motifs and the polymers incorporating such motifs are potent and selective inducers of TLR7 and the TLR7-associated cytokine IFN-α. | 05-17-2012 |
20110300164 | IMMUNOSTIMULATORY DNA:RNA OLIGONUCLEOTIDES - Immunostimulatory sequence-specific RNA oligonucleotides corresponding to 3′ terminal sequences of single-stranded minus-sense RNA genomic RNAs are provided. Also provided are compositions and methods relating to an immunostimulatory 4-mer RNA motif provided as 5′-C/U-U-G/U-U-3′. Incorporation of this short RNA motif is sufficient to confer new and altered immunostimulatory properties in new and existing oligonucleotides, including CpG oligodeoxynucleotides. Also provided are methods for use of the immunostimulatory RNA oligonucleotides and DNA:RNA chimeric oligonucleotides of the invention to induce an immune response in vitro and in vivo, as well as to treat allergy, asthma, infection, and cancer in a subject. Single-stranded oligoribonucleotides of the invention are believed to signal through a Toll-like receptor (TLR) chosen from TLR9, TLR8, TLR7, and TLR3. The oligoribonucleotides can also be used in a method to screen for TLR antagonists. | 12-08-2011 |
20110206719 | IMMUNOSTIMULATORY OLIGORIBONUCLEOTIDES - The invention provides immunostimulatory compositions and use of those compounds in the preparation of medicaments for the treatment of disease as well as in vitro uses. In particular, the compositions of the invention include immunostimulatory oligoribonucleotides that incorporate a sequence-dependent immunostimulatory sequence motif. Specific modifications involving phosphate linkages, nucleotide analogs, adducts, and combinations thereof are provided. Compositions of the invention, which optionally can include an antigen, can be used alone or together with other treatments to stimulate or enhance an immune response. Also provided are compositions and methods useful for treating a subject having an infection, a cancer, an allergic condition, asthma, airway remodeling, or immunodeficiency. Immunostimulatory oligoribonucleotides of the invention are believed to stimulate Toll-like receptor 8 (TLR8). | 08-25-2011 |
20110135605 | METHODS AND PRODUCTS RELATED TO TREATMENT AND PREVENTION OF HEPATITIS C VIRUS INFECTION - The invention provides methods for identifying and treating subjects having hepatitis C infections. In some instances, the subjects are those that are non-responsive to non-CpG therapy. Preferably, the subjects are treated with C class CpG immunostimulatory nucleic acids having semi-soft backbone. | 06-09-2011 |
20110033421 | METHODS RELATED TO IMMUNOSTIMULATORY NUCLEIC ACID-INDUCED INTERFERON - Methods and compositions are provided for extending the clinical utility of IFN-α in the treatment of a variety of viral and proliferative disorders. Among other aspects, the invention provides methods which increase the efficacy of IFN-α treatment and reduce IFN-α treatment-related side effects. In addition, methods are provided for supporting the survival and for activating natural interferon producing cells (IPCs) in vitro without exogenous IL-3 or GM-CSF. The invention is based on the discovery that certain CpG and non-CpG ISNAs promote survival and stimulation of IPCs. | 02-10-2011 |
20100316659 | IMMUNOSTIMULATORY OLIGORIBONUCLEOTIDES - The invention provides immunostimulatory compositions and use of those compounds in the preparation of medicaments for the treatment of disease as well as in vitro uses. In particular, the compositions of the invention include immunostimulatory oligoribonucleotides that incorporate a sequence-dependent immunostimulatory sequence motif. Specific modifications involving phosphate linkages, nucleotide analogs, adducts, and combinations thereof are provided. Compositions of the invention, which optionally can include an antigen, can be used alone or together with other treatments to stimulate or enhance an immune response. Also provided are compositions and methods useful for treating a subject having an infection, a cancer, an allergic condition, asthma, airway remodeling, or immunodeficiency. Immunostimulatory oligoribonucleotides of the invention are believed to stimulate Toll-like receptor 8 (TLR8). | 12-16-2010 |
20100272785 | RNA SEQUENCE MOTIFS IN THE CONTEXT OF DEFINED INTERNUCLEOTIDE LINKAGES INDUCING SPECIFIC IMMUNE MODULATORY PROFILES - Immunostimulatory polymers that contain certain sequence-dependent immunostimulatory RNA motifs and methods for the use of such immunostimulatory polymers and compositions containing such polymers are provided according to the invention. The sequence-dependent immunostimulatory RNA motifs and the polymers incorporating such motifs are potent and selective inducers of TLR7 and the TLR7-associated cytokine IFN-α. | 10-28-2010 |
20100189772 | Compositions of TLR ligands and antivirals - The invention relates to methods and products for the treatment of viral infection using a combination of anti-viral agents and TLR ligands. The invention also relates to screening assays, associated products, kits, and in vitro methods. | 07-29-2010 |
20100183639 | NUCLEIC ACID-LIPOPHILIC CONJUGATES - The invention relates to a nucleic acid-lipophilic conjugates and methods for modulating an immune response using the conjugates. The lipophilic moiety associated with an immunostimulatory nucleic acid. | 07-22-2010 |
20100144846 | Oligoribonucleotides and uses thereof - The invention relates to immunostimulatory RNA oligonucleotides (ORN). In particular the ORN have an immunostimulatory ORN motif directly or indirectly flanked by a 3′ poly G motif and optionally a 5′ poly-G motif. The invention also relates to methods including therapeutic methods and screening methods and related kits for use of the ORN. | 06-10-2010 |
20090306177 | Modulation of Immunostimulatory Properties of Short Interfering Ribonucleic Acid (Sirna) by Nucleotide Modification - Double-stranded short interfering ribonucleic acid (siRNA) are modified to reduce or eliminate their immunostimulatory effect without significantly affecting their gene silencing effect. Modified siRNA include one or more 2′ sugar modifications and, optionally, internucleotide linkages on the sense strand. Compositions containing the modified siRNA and methods of making and using the modified siRNA are disclosed. New and previously characterized siRNA can be synthesized to incorporate modifications according to the invention. | 12-10-2009 |
20090214578 | Immunostimulatory Single-Stranded Ribonucleic Acid with Phosphodiester Backbone - Immunostimulatory single-stranded oligoribonucleotides (ssORN) with phosphodiester backbones induce TLR7-independent and MyD88-dependent immune activation. These immunostimulatory ssORN are useful to induce a ThI-like immune response in a subject, to induce an antigen-specific immune response in a subject, and to treat a subject having a cancer, an infectious disease, an allergic condition, or asthma. | 08-27-2009 |
20090191188 | IMMUNOSTIMULATORY NUCLEIC ACIDS - The invention relates to immunostimulatory nucleic acid compositions and methods of using the compositions. The T-rich nucleic acids contain poly T sequences and/or have greater than 25% T nucleotide residues. The TG nucleic acids have TG dinucleotides. The C-rich nucleic acids have at least one poly-C region and/ore greater than 50% c nucleotides. These immunostimulatory nucleic acids function in a similar manner to nucleic acids containing CpG motifs. The invention also encompasses preferred CpG nucleic acids. | 07-30-2009 |
20090137519 | SEMI-SOFT C-CLASS IMMUNOSTIMULATORY OLIGONUCLEOTIDES - The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C. | 05-28-2009 |
20090087446 | COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY - Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines. | 04-02-2009 |
20090060927 | Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination - The present invention relates to pharmaceutical compositions comprising at least one fragment of a polynucleotide, preferably at least one antigen, and optionally a pharmaceutically acceptable carrier and/or diluent. In accordance with the present invention was found that the introduction of the pharmaceutical composition into vertebrates will achieve regulation of growth, induction of cellular transcription and translation, protein synthesis, protein expression or protein secretion. The pharmaceutical compositions are useful in vaccination protocols but also in any other therapeutic situation in which immunomodulation is of benefit, such as sub-optimal immune responses, reaction to pathogens, tolerance or autoimmunity. | 03-05-2009 |
20080226649 | CPG-like nucleic acids and methods of use thereof - Immunostimulatory compositions described as CpG-like nucleic acids are provided, including nucleic acids having immunostimulatory characteristics of CpG nucleic acid, despite certain substitutions of C, G, or C and G of the CpG dinucleotide. The substitutions can include, among others, exchange of methylated C for C, inosine for G, and ZpY for CpG, where Z is cytosine or dSpacer and Y is inosine, 2-aminopurine, nebularine, or dSpacer. Also provided are methods for inducing an immune response in a subject using the CpG-like nucleic acids. The methods are useful in the treatment of a subject that has or is at risk of developing an infectious disease, allergy, asthma, cancer, anemia, thrombocytopenia, or neutropenia. | 09-18-2008 |