Teva Pharmaceutical Industries Ltd. Patent applications |
Patent application number | Title | Published |
20160082001 | TREATMENT OF MULTIPLE SCLEROSIS WITH LAQUINIMOD - The subject invention provides for methods of reducing the relapse rate and/or reducing the accumulation of physical disability in a relapsing-remitting multiple sclerosis human patient, the method comprising orally administering to the patient a daily dose of 0.6 mg laquinimod. | 03-24-2016 |
20160074380 | Treatment Of Neurodegenerative Diseases With Combination Of Laquinimod And Fingolimod - This invention provides a method of treating a subject afflicted with a neurodegenerative disease comprising periodic administration of an amount of laquinimod and an amount of fingolimod, wherein the amounts when taken together are effective to treat the subject. Also provided are packages and pharmaceutical compositions comprising laquinimod and fingolimod for treating a subject afflicted with a neurodegenerative disease. Also provided is a pharmaceutical composition comprising laquinimod for use as an add-on therapy or in combination with fingolimod, and a pharmaceutical composition comprising fingolimod for use as an add-on therapy or in combination with laquinimod, for treating said subject. | 03-17-2016 |
20160074378 | LAQUINIMOD FOR THE TREATMENT OF RELAPSING-REMITTING MULTIPLE SCLEROSIS (RRMS) PATIENTS WITH A HIGH DISABILITY STATUS - This invention provides a method for treating or for reducing ambulatory deterioration in a human patient diagnosed to be afflicted with relapsing-remitting multiple sclerosis (RRMS) and having a high baseline disability score according to the Kurtzke Expanded Disability Status Scale (EDSS), comprising periodically administering to only the patient diagnosed with RRMS and having a high baseline disability score an amount of laquinimod effective to treat the patient or to reduce ambulatory deterioration. This invention further provides pharmaceutical compositions and packages comprising an effective amount of laquinimod for treating a human patient diagnosed to be afflicted with RRMS and having a high baseline disability score according to the EDSS. | 03-17-2016 |
20160046582 | CRYSTALS OF LAQUINIMOD SODIUM AND IMPROVED PROCESS FOR THE MANUFACTURE THEREOF - The subject invention provides a mixture of Crystalline Laquinimod sodium particles, wherein (i) ≧90% of the total amount by volume of the laquinimod sodium particles have a size of ≦40 μm or (ii) ≧50% of the total amount by volume of the laquinimod sodium particles have a size of ≦15 μm and wherein: a) the mixture has a bulk density of 0.2-0.4 g/mL; b) the mixture has a tapped density of 0.40-0.7 g/mL; c) an amount of heavy metal in the mixture is no more than 20 ppm relative to the amount by weight of laquinimod sodium; d) an amount of MCQ in the mixture is no more than 0.15% relative to the amount of laquinimod sodium as measured by HPLC; e) an amount of MCQCA in the mixture is no more than 0.15% relative to the amount of laquinimod sodium as measured by HPLC; or f) an amount of MCQME in the mixture is no more than 0.12% relative to the amount of laquinimod sodium as measured by HPLC. The subject invention also provides a pharmaceutical composition comprising an amount of laquinimod and at least one of BH-3-HKAQ, MCQ, MCQCA, MCQME, NEA, and MCQEE. The subject invention also provides processes for preparing BH-3-HLAQ, MCQ, MCQCA, MCQEE, and compounds prepared by said processes. Further provided is a process for testing whether a sample of laquinimod contains an undesirable impurity. Further provided is a process for preparing a validated pharmaceutical composition comprising laquinimod, for preparing a pharmaceutical composition comprising laquinimod, or for distributing a validated batch of a pharmaceutical composition comprising laquinimod, for validating a batch of a pharmaceutical product containing laquinimod and a pharmaceutically acceptable carrier for distribution, and for preparing a packaged pharmaceutical composition comprising laquinimod, each comprising determining the amount of at least one of BH-3-HLAO, MCQ, MCQCA, MCQME02-18-2016 | |
20160038532 | Treatment of Multiple Sclerosis With Combination of Laquinimod and Glatiramer Acetate - This invention provides a method of treating a patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the patient laquinimod an add-on therapy to or in combination with glatiramer acetate. This invention also provides a package and a pharmaceutical composition comprising laquinimod and glatiramer acetate for treating a patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides laquinimod for use as an add-on therapy or in combination with glatiramer acetate in treating a patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention further provides use of laquinimod and glatiramer acetate in the preparation of a combination for treating a patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome. | 02-11-2016 |
20160038435 | TRANSDERMAL FORMULATIONS OF LAQUINIMOD - This invention provides a transdermal patch comprising a) a backing layer; b) a liner; c) optionally, a highly porous membrane; and d) a pharmaceutical composition comprising: (i) optionally, a pressure sensitive adhesive in an amount of up to about 95 wt % of the pharmaceutical composition, (ii) laquinimod in an amount of about 0.1-20 wt % of the pharmaceutical composition, and (iii) optionally, one or more permeation enhancers in a total amount of up to about 70 wt % of the pharmaceutical composition. This invention also provides a method for delivering laquinimod across the skin of the subject and for treating a human subject afflicted with a form of multiple sclerosis comprising administering to the skin of the subject a transdermal patch as described herein. This invention further provides a transdermal patch as described herein for use in treating a human subject afflicted with a form of multiple sclerosis. | 02-11-2016 |
20160025707 | PROCESS FOR THE MEASUREMENT OF THE POTENCY OF GLATIRAMER ACETATE - The subject invention provides a process for measuring the relative potency of a test batch of glatiramer acetate. In addition, the subject invention provides a process for preparing a batch of glatiramer acetate as acceptable for pharmaceutical use. | 01-28-2016 |
20160022811 | RITUXIMAB INDUCTION THERAPY FOLLOWED BY GLATIRAMER ACETATE THERAPY - The present invention provides a method of treating a subject afflicted with a form of multiple sclerosis or presenting a clinically isolated syndrome comprising periodic administration of an amount of an anti-CD20 antibody at least twice to the subject followed by periodic administration of an amount of glatiramer acetate to the subject, wherein the amounts are effective to treat the subject. | 01-28-2016 |
20160015789 | FORMULATIONS OF AN ALBUMIN hGH FUSION PROTEIN - A stable liquid pharmaceutical composition comprising an albumin-human growth hormone (hGH) fusion protein whose amino acid sequence is set forth as SEQ ID NO: 1 and a buffer, wherein the stable liquid pharmaceutical composition has a pH range of 5.5-6.5. | 01-21-2016 |
20160000775 | USE OF HIGH DOSE LAQUINIMOD FOR TREATING MULTIPLE SCLEROSIS - Disclosed herein are methods of treating a human patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome, methods for treating a human subject by providing neuroprotection to the human subject, and methods of treating a human patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome by increasing the time to confirmed disease progression, increasing the time to confirmed relapse or reducing brain atrophy in the human patient, comprising orally administering to the human patient or subject a daily dose of about 1.2 mg laquinimod or a pharmaceutically acceptable salt thereof. The subject invention also provides a pharmaceutical oral unit dosage form of about 1.2 mg laquinimod or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier for use in treating a human patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome, for use in treating a human subject by providing neuroprotection to the human subject, or for use treating a human patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome by increasing the time to confirmed disease progression, increasing the time to confirmed relapse or reducing brain atrophy in the human patient. | 01-07-2016 |
20160000774 | TREATMENT OF MULTIPLE SCLEROSIS WITH COMBINATION OF LAQUINIMOD AND DIMETHYL FUMARATE - This invention provides a method of treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the subject laquinimod as an add-on therapy to or in combination with DMF. This invention also provides a package comprising laquinimod and DMF for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides laquinimod for use as an add-on therapy or in combination with DMF in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides a pharmaceutical composition comprising laquinimod and DMF for use in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention further provides use of laquinimod and DMF in the preparation of a combination for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. | 01-07-2016 |
20150374677 | ANALOGS OF PRIDOPIDINE, THEIR PREPARATION AND USE - This invention provides an isolated compound having the structure: | 12-31-2015 |
20150359788 | USE OF LAQUINIMOD FOR TREATING CROHN'S DISEASE PATIENTS WHO FAILED FIRST-LINE ANTI-TNF THERAPY - This application provides for a method of treating a human patient afflicted with anti-TNFα refractory Crohn's disease, of treating a human patient afflicted with non-fibrostenotic Crohn's disease, and of treating a human patient whose Crohn's disease had not been surgically treated, the method comprising periodically administering to the patient an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the patient. This application also provides for a method of inducing or maintaining clinical remission in a human patient afflicted with Crohn's disease comprising periodically administering to the patient an amount of laquinimod effective to induce or maintain clinical remission in the patient, which amount of laquinimod is less than 0.5 mg/day. | 12-17-2015 |
20150328277 | ORAL TRANSMUCOSAL DELIVERY OF GLATIRAMER ACETATE - The present invention provides an oral patch comprising:
| 11-19-2015 |
20150306088 | LAQUINIMOD FOR THE TREATMENT OF RELAPSING-REMITTING MULTIPLE SCLEROSIS (RRMS) PATIENTS WITH A HIGH DISABILITY STATUS - This invention provides a method for treating or for reducing ambulatory deterioration in a human patient diagnosed to be afflicted with relapsing-remitting multiple sclerosis (RRMS) and having a high baseline disability score according to the Kurtzke Expanded Disability Status Scale (EDSS), comprising periodically administering to only the patient diagnosed with RRMS and having a high baseline disability score an amount of laquinimod effective to treat the patient or to reduce ambulatory deterioration. This invention further provides pharmaceutical compositions and packages comprising an effective amount of laquinimod for treating a human patient diagnosed to be afflicted with RRMS and having a high baseline disability score according to the EDSS. | 10-29-2015 |
20150290133 | FORMULATIONS OF 6-MERCAPTOPURINE - The present invention provides improved formulations of 6-mercaptopurine that exhibit better bioavailability and faster dissolution than previous formulations. | 10-15-2015 |
20150275302 | DETERMINATION OF SINGLE NUCLEOTIDE POLYMORPHISMS USEFUL TO PREDICT RESPONSE FOR RASAGILINE - This application provides a method for treating a human subject afflicted with Parkinson's disease (PD) with a pharmaceutical composition comprising rasagiline or a pharmaceutically acceptable salt of rasagiline, and a pharmaceutically acceptable carrier, comprising the steps of:
| 10-01-2015 |
20150265592 | USE OF HIGH DOSE LAQUINIMOD FOR TREATING MULTIPLE SCLEROSIS - Disclosed herein are methods of treating a human patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome, methods for treating a human subject by providing neuroprotection to the human subject, and methods of treating a human patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome by increasing the time to confirmed disease progression, increasing the time to confirmed relapse or reducing brain atrophy in the human patient, comprising orally administering to the human patient or subject a daily dose of about 1.2 mg laquinimod or a pharmaceutically acceptable salt thereof. The subject invention also provides a pharmaceutical oral unit dosage form of about 1.2 mg laquinimod or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier for use in treating a human patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome, for use in treating a human subject by providing neuroprotection to the human subject, or for use treating a human patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome by increasing the time to confirmed disease progression, increasing the time to confirmed relapse or reducing brain atrophy in the human patient. | 09-24-2015 |
20150241446 | CYTOKINE BIOMARKERS AS PREDICTIVE BIOMARKERS OF CLINICAL RESPONSE FOR GLATIRAMER ACETATE - A method for treating a human subject afflicted with multiple sclerosis or a single clinical attack consistent with multiple sclerosis with a pharmaceutical composition comprising glatiramer acetate and a pharmaceutically acceptable carrier, comprising the steps of determining whether the human subject is a glatiramer acetate responder by evaluating a biomarker selected from the group consisting of IL-17 concentration, TNF-α concentration, IL-2 concentration and IFN-γ concentration, or a combination thereof, in the blood of the human subject and administering the pharmaceutical composition comprising glatiramer acetate and a pharmaceutically acceptable carrier to the human subject only if the human subject is identified as a glatiramer acetate responder. | 08-27-2015 |
20150209346 | COMBINATION OF LAQUINIMOD AND PRIDOPIDINE FOR TREATING NEURODEGENERATIVE DISORDERS, IN PARTICULAR HUNTINGTON'S DISEASE - This invention provides a method of treating a patient afflicted with a neurodegenerative disorder, e.g., Huntington's disease (HD), comprising administering to the patient laquinimod as an add-on therapy to or in combination with pridopidine. This invention also provides a package and a pharmaceutical composition comprising laquinimod and pridopidine for treating a patient afflicted with a neurodegenerative disorder, e.g., HD. This invention also provides laquinimod for use as an add-on therapy or in combination with pridopidine in treating a patient afflicted with a neurodegenerative disorder, e.g., HD. This invention further provides use of laquinimod and pridopidine in the preparation of a combination for treating a patient afflicted with a neurodegenerative disorder, e.g., HD. | 07-30-2015 |
20150202268 | Recombinant Human Albumin-Human Granulocyte Colony Stimulating Factor for the Prevention of Neutropenia - Disclosed are compositions and methods for treating, preventing and ameliorating conditions and diseases characterized by a lowered white blood cell count. The methods and compositions described herein include a fusion polypeptide formed from human serum albumin protein (“HSA”) and human granulocyte-colony stimulating factor (“G-CSF”). | 07-23-2015 |
20150174118 | USE OF LAQUINIMOD TO DELAY HUNTINGTON'S DISEASE PROGRESSION - The subject invention provides methods of treating or delaying disease progression in a subject afflicted with Huntington's disease (HD) comprising administering to the subject 0.5-1.5 mg/day laquinimod. The subject invention also provides packages, therapeutic packages and pharmaceutical compositions, comprising one or more unit doses of 0.5-1.5 mg laquinimod for treating or delaying disease progression in a subject afflicted with HD. Also disclosed is use of laquinimod in the manufacture of a medicament comprising one or more unit doses of 0.5-1.5 mg laquinimod for use in treating or delaying disease progression in a subject afflicted HD. | 06-25-2015 |
20150141458 | Treatment of Glaucoma Using Laquinimod - The subject invention provides a method of treating a subject afflicted with glaucoma, suffering from retinal ganglion cell (RGC) loss or damage, or elevated intraocular pressure (IOP), or of reducing RGC loss or damage, or reducing IOP in a subject, comprising administering to the subject an amount of laquinimod effective to treat the subject, to reduce RGC loss or damage, or to reduce IOP in the subject. Provide also is a pharmaceutical composition, a package and a therapeutic package for treating a subject afflicted with glaucoma. | 05-21-2015 |
20150119420 | Treatment of Multiple Sclerosis With Combination of Laquinimod and Dimethyl Fumarate - This invention provides a method of treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the subject laquinimod as an add-on therapy to or in combination with DMF. This invention also provides a package comprising laquinimod and DMF for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides laquinimod for use as an add-on therapy or in combination with DMF in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides a pharmaceutical composition comprising laquinimod and DMF for use in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention further provides use of laquinimod and DMF in the preparation of a combination for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. | 04-30-2015 |
20150110733 | GENETIC MARKERS PREDICTIVE OF RESPONSE TO GLATIRAMER ACETATE - The present invention provides a method for treating a human subject afflicted with multiple sclerosis or a single clinical attack consistent with multiple sclerosis with a pharmaceutical composition comprising glatiramer acetate and a pharmaceutically acceptable carrier, comprising the steps of:
| 04-23-2015 |
20150094488 | PROCESS FOR THE MEASUREMENT OF THE POTENCY OF GLATIRAMER ACETATE - The subject invention provides a process for measuring the relative potency of a test batch of glatiramer acetate. In addition, the subject invention provides a process for preparing a batch of glatiramer acetate as acceptable for pharmaceutical use. | 04-02-2015 |
20150094332 | Laquinimod Combination Therapy For Treatment Of Multiple Sclerosis - The subject invention provides a method for treating a subject afflicted with a form of multiple sclerosis (MS) or presenting a clinically isolated syndrome (CIS) comprising periodically administering to the subject an amount of laquinimod and an amount of a compound of formula (I): | 04-02-2015 |
20150086549 | TREATMENT OF LUPUS ARTHRITIS USING LAQUINIMOD - This invention provides a method of treating a subject afflicted with active lupus arthritis comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the subject. This invention also provides laquinimod or pharmaceutically acceptable salt thereof for use in treating a subject afflicted with active lupus arthritis. This invention further provides a pharmaceutical composition comprising an amount of laquinimod or pharmaceutically acceptable salt thereof for use in treating a subject afflicted with lupus arthritis. | 03-26-2015 |
20150080441 | USE OF RASAGILINE FOR THE TREATMENT OF RESTLESS LEGS SYNDROME - Disclosed are methods for the treatment of Restless Legs Syndrome comprising administering an amount of R(+)-N-propargyl-1-aminoindan or a pharmaceutically acceptable salt thereof. | 03-19-2015 |
20150056281 | Treatment of Multiple Sclerosis With Combination of Laquinimod and Interferon-Beta - This invention provides a method of treating a patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the patient laquinimod as an add-on therapy to or in combination with interferon-β. This invention also provides a package and a pharmaceutical composition comprising laquinimod and interferon-β for treating a patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides laquinimod for use as an add-on therapy or in combination with interferon-β in treating a patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention further provides use of laquinimod and interferon-β in the preparation of a combination for treating a patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome. | 02-26-2015 |
20150045445 | 3-KETO-N-PROPARGYL-1-AMINOINDAN - The subject invention provides a pharmaceutical composition containing N-propargyl-1(R)-aminoindan or a pharmaceutically acceptable salt thereof, and a compound of 3-keto-N-propargyl-1-aminoindan or a salt thereof. | 02-12-2015 |
20150045306 | DETERMINATION OF SINGLE NUCLEOTIDE POLYMORPHISMS USEFUL TO PREDICT RESPONSE FOR GLATIRAMER ACETATE - This invention provides a method for treating a human subject afflicted with multiple sclerosis or a single clinical attack consistent with multiple sclerosis with a pharmaceutical composition comprising glatiramer acetate and a pharmaceutically acceptable carrier, comprising the steps of 1) identifying whether the human subject is a predicted responder to glatiramer acetate by determining the genotype of the subject at one or more single nucleotide polymorphisms (SNPs) selected from the group consisting of the SNPs in Group 1; and 2) administering the pharmaceutical composition comprising glatiramer acetate and a pharmaceutically acceptable carrier to the subject only if the subject is identified as a predicted responder to glatiramer acetate. | 02-12-2015 |
20150038744 | Crystalline Solid Rasagiline Base - The subject invention provides crystalline R(+)-N-propargyl-1-aminoindan, pharmaceutical compositions and methods of manufacture thereof. | 02-05-2015 |
20150038508 | TREATMENT OF LUPUS NEPHRITIS USING LAQUINIMOD - This invention provides a method of treating a subject afflicted with active lupus nephritis comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the subject. This invention also provides laquinimod or pharmaceutically acceptable salt thereof for use in treating a subject afflicted with active lupus nephritis. This invention further provides a pharmaceutical composition comprising an amount of laquinimod or pharmaceutically acceptable salt thereof for use in treating a subject afflicted with active lupus nephritis. | 02-05-2015 |
20150037318 | TREATMENT OF MULTIPLE SCLEROSIS WITH COMBINATION OF LAQUINIMOD AND FLUPIRTINE - This invention provides a method of treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the subject laquinimod as an add-on therapy to or in combination with flupirtine. This invention also provides a package and a pharmaceutical composition comprising laquinimod and flupirtine for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides laquinimod for use as an add-on therapy or in combination with flupirtine in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention further provides use of laquinimod and flupirtine in the preparation of a combination for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. | 02-05-2015 |
20150037263 | TREATMENT OF MULTIPLE SCLEROSIS WITH COMBINATION OF LAQUINIMOD AND FINGOLIMOD - This invention provides a method of treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the subject laquinimod as an add-on therapy to or in combination with fingolimod. This invention also provides a package and a pharmaceutical composition comprising laquinimod and fingolimod for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides laquinimod for use as an add-on therapy or in combination with fingolimod in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention further provides use of laquinimod and fingolimod in the preparation of a combination for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. | 02-05-2015 |
20150031774 | RASAGILINE ORALLY DISINTEGRATING COMPOSITIONS - This invention provides a solid pharmaceutical composition comprising rasagiline or a pharmaceutically acceptable salt of rasagiline, and particles having a non-filamentous microstructure of at least two sugar alcohols. This invention also provides a solid pharmaceutical composition comprising rasagiline or a pharmaceutically acceptable salt of rasagiline, a mixture of a disintegrant, a flow agent and particles having a non-filamentous microstructure of at least two sugar alcohols, a supplemental sugar alcohol, a supplemental flow agent, and a supplemental disintegrant. This invention further provides a method of treating a subject afflicted with Parkinson's disease comprising administering to the subject a therapeutically effective amount of the solid pharmaceutical composition, thereby treating the subject. Finally, this invention provides a process of making such solid pharmaceutical compositions. | 01-29-2015 |
20140370105 | TREATMENT OF INFLAMMATORY BOWEL DISEASE WITH 6-MERCAPTOPURINE - Methods of administering a delayed release 6-mercaptopurine pharmaceutical composition to patients suffering from inflammatory bowel disease which provide for release of the 6-mercaptopurine after passage of the pharmaceutical composition through the stomach are disclosed. The methods result in significant clinical improvement despite leading to very little systemic absorption of 6-mercaptopurine and also result in very few undesirable side effects. | 12-18-2014 |
20140364506 | DEUTERIUM ENRICHED RASAGILINE - The subject invention provides deuterated rasagiline, its salts and uses. | 12-11-2014 |
20140343096 | DEUTERATED N-ETHYL-N-PHENYL-1,2-DIHYDRO-4-HYDROXY-5-CHLORO-1-METHYL-2-OXOQ- UINOLINE-3-CARBOXAMIDE, SALTS AND USES THEREOF - The subject invention provides deuterated N-ethyl-N-phenyl-1,2-dihydro-4-hydroxy-5-chloro-1-methyl-2-oxoquinoline-3-carboxamide, its salts and uses. | 11-20-2014 |
20140322158 | METHODS OF TREATING A SUBJECT AFFLICTED WITH AN AUTOIMMUNE DISEASE USING PREDICTIVE BIOMARKERS OF CLINICAL RESPONSE TO GLATIRAMER ACETATE THERAPY IN MULTIPLE SCLEROSIS - A method for treating a subject afflicted with an autoimmune disease with a pharmaceutical composition comprising glatiramer acetate and a pharmaceutically acceptable carrier, comprising the steps of administering a therapeutic amount of the pharmaceutical composition to the subject, determining whether the subject is a glatiramer acetate responder or a glatiramer acetate hypo-/non-responder by measuring the value of a biomarker selected from the group consisting of IL-10 concentration, IL-17 concentration, IL-18 concentration, TNF-α concentration, BDNF concentration, caspase-1 concentration, IL-10/IL-18 ratio and IL-10/IL-17 ratio in the blood of the subject, and comparing the measured value to a reference value for the biomarker to identify the subject as a glatiramer acetate responder or a glatiramer acetate hypo-/non-responder, and continuing the administration if the subject is identified as a glatiramer acetate responder, or modifying treatment of the subject if the subject is identified as a glatiramer acetate hypo-/non-responder. | 10-30-2014 |
20140294899 | CYTOKINE BIOMARKERS AS PREDICTIVE BIOMARKERS OF CLINICAL RESPONSE FOR GLATIRAMER ACETATE - A method for treating a human subject afflicted with multiple sclerosis or a single clinical attack consistent with multiple sclerosis with a pharmaceutical composition comprising glatiramer acetate and a pharmaceutically acceptable carrier, comprising the steps of determining whether the human subject is a glatiramer acetate responder by evaluating a biomarker selected from the group consisting of IL-17 concentration, TNF-α concentration, IL-2 concentration and IFN-γ concentration, or a combination thereof, in the blood of the human subject and administering the pharmaceutical composition comprising glatiramer acetate and a pharmaceutically acceptable carrier to the human subject only if the human subject is identified as a glatiramer acetate responder. | 10-02-2014 |
20140275215 | ANTI-CLUSTERIN MONOTHERAPY FOR CANCER TREATMENT - The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19. | 09-18-2014 |
20140275214 | CUSTIRSEN TREATMENT WITH REDUCED TOXICITY - The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′ deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg. The present invention also provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of myeloma. | 09-18-2014 |
20140272100 | PROCESSES FOR COATING A CARRIER WITH MICROPARTICLES - Processes for coating a carrier with microparticles of a drug are described. For example, a coated carrier can be obtained in a one-stage process that entails evaporating a solvent from microdroplets of a solution containing an API to obtain dry microparticles, which are then coated on the carrier. | 09-18-2014 |
20140271878 | CRYSTALS OF LAQUINIMOD SODIUM AND IMPROVED PROCESS FOR THE MANUFACTURE THEREOF - The subject invention provides a mixture of crystalline laquinimod sodium particles, wherein (i) 90% or more of the total amount by volume of the laquinimod sodium particles have a size of 40 microns or less or (ii) 50% or more of the total amount by volume of the laquinimod sodium particles have a size of 15 microns or less, and wherein:
| 09-18-2014 |
20140271630 | RITUXIMAB INDUCTION THERAPY FOLLOWED BY GLATIRAMER ACETATE THERAPY - The present invention provides a method of treating a subject afflicted with a form of multiple sclerosis or presenting a clinically isolated syndrome comprising periodic administration of an amount of rituximab at least twice to the subject followed by periodic administration of an amount of glatiramer acetate to the subject, wherein the amounts are effective to treat the subject. The present invention also provides a method of treating a subject afflicted with an immune disease, comprising periodic administration of an amount of rituximab at least twice to the subject followed by periodic administration of an amount of glatiramer acetate to the subject wherein the amounts are effective to treat the subject, and wherein the immune disease is an autoimmune disease, an arthritic condition, a demyelinating disease, an inflammatory disease, multiple sclerosis, relapsing-remitting multiple sclerosis, diabetes mellitus, psoriasis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, or systemic lupus erythematosus. | 09-18-2014 |
20140271538 | Recombinant Human Albumin-Human Granulocyte Colony Stimulating Factor for the Prevention of Neutropenia in Pediatric Patients - Disclosed are methods and compositions for treating, preventing and ameliorating conditions and diseases characterized by a lowered white blood cell count, including neutropenia, in human patients that are less than 18 years old. The methods and compositions described herein include a fusion polypeptide comprising human serum albumin protein (“HSA”) and human granulocyte-colony stimulating factor (“G-CSF”). | 09-18-2014 |
20140271532 | COMBINATION THERAPY WITH GLATIRAMER ACETATE AND RASAGILINE FOR THE TREATMENT OF MULTIPLE SCLEROSIS - The subject invention provides a method of treating a subject afflicted with a form of multiple sclerosis comprising periodically administering to the subject an amount of glatiramer acetate and an amount of rasagiline or the pharmaceutically acceptable salt thereof, wherein the amounts when taken together are effective to alleviate a symptom of the form of multiple sclerosis in the subject so as to thereby treat the subject. The subject invention also provides a package comprising glatiramer acetate, rasagiline or the pharmaceutically acceptable salt thereof and instructions for use of the together to alleviate a symptom of a form of multiple sclerosis in a subject. The subject invention further provides a pharmaceutical combination comprising separate dosage forms of an amount of glatiramer acetate and an amount of rasagiline or the pharmaceutically acceptable salt thereof, which combination is useful to alleviate a symptom of a form of multiple sclerosis in a subject. | 09-18-2014 |
20140256755 | Raltegravir Salts And Crystalline Forms Thereof - The present invention includes new salts of Raltegravir and crystalline forms thereof, pharmaceutical compositions containing the salts or crystalline forms, methods of using the salts or crystalline forms or the compositions to treat HIV infection or to prepare medicament for treating HIV infection, and a process for preparing Raltegravir potassium. | 09-11-2014 |
20140243418 | RASAGILINE FOR PARKINSON'S DISEASE MODIFICATION - A method for modifying Parkinson's disease by periodically administering a pharmaceutical composition comprising a therapeutically effective amount of rasagiline or a pharmaceutically acceptable salt of rasagiline to the patient, thereby modifying the disease. The method includes reducing the rate of progression; delaying the need for symptomatic anti-Parkinsonian therapy; reducing the risk of a Parkinson's disease patient requiring symptomatic anti-Parkinsonian therapy; and reducing the functional decline. | 08-28-2014 |
20140235670 | TREATMENT OF PROGRESSIVE FORMS OF MULTIPLE SCLEROSIS WITH LAQUINIMOD - This invention provides a method for treating a human subject afflicted with a progressive form of multiple sclerosis, comprising periodically administering to the human subject an amount of laquinimod effective to treat the human subject. This invention also provides laquinimod for use in treating a human subject afflicted with a progressive form of multiple sclerosis. This invention further provides pharmaceutical compositions and packages comprising an effective amount of laquinimod for treating a progressive form of multiple sclerosis. | 08-21-2014 |
20140200243 | TREATMENT OF CROHN'S DISEASE WITH LAQUINIMOD - This application provides for a method of treating a subject suffering from Crohn's disease, the method comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the subject. This application provides for use of laquinimod in the manufacture of a medicament for treating a subject suffering from Crohn's disease. This application also provides for a pharmaceutical composition comprising laquinimod for use in treating a subject suffering from Crohn's disease. | 07-17-2014 |
20140199286 | LYOPHILIZATION PROCESS - The present invention provides a process for producing a lyophilized pharmaceutical composition containing a protein. The present invention further provides a product produced by the process. The present invention further provides a process for producing an injectable pharmaceutical composition. The present invention further provides a method of treating a patient with a therapeutic protein composition. | 07-17-2014 |
20140199283 | FORMULATIONS OF ALBU-BCHE, PREPARATION AND USES THEREOF - The present invention provides an aqueous pharmaceutical composition comprising the fusion protein whose amino acid sequence is set forth as SEQ ID No:1 and an aqueous solution comprising 40 to 60 mM sodium phosphate. The present invention further provides a lyophilized pharmaceutical composition, an reconstituted solution, a sealed package comprising the lyophilized pharmaceutical composition, and a vial comprising the lyophilized pharmaceutical or the reconstituted solution. The present invention also provides a method of producing the lyophilized pharmaceutical composition and the sealed package. The present invention also provides a method of treating a human having cocaine seeking behavior, and methods of using the aqueous pharmaceutical composition and lyophilized pharmaceutical composition. | 07-17-2014 |
20140194510 | DISPERSIONS OF RASAGILINE CITRATE - The subject invention provides a solid dispersion of rasagiline citrate, a composition and a process for the manufacture thereof. | 07-10-2014 |
20140193827 | CHARACTERIZING A GLATIRAMER ACETATE RELATED DRUG PRODUCT - The present invention provides a process for characterizing a glatiramer acetate related drug substance or drug product comprising the steps of:
| 07-10-2014 |
20140186514 | DELAYED RELEASE RASAGILINE FORMULATION - Disclosed are formulations which are designed to delay release of rasagiline while maintaining specific pharmacokinetic properties. | 07-03-2014 |
20140171647 | CRYSTALS OF LAQUINIMOD SODIUM, AND PROCESS FOR THE MANUFACTURE THEREOF - Disclosed is a process for the preparation of laquinimod sodium which removes the impurities after the salt formation step, thus resulting in crystals of higher purity as well as crystals having improved crystalline characteristics. | 06-19-2014 |
20140162954 | FUSION OF HUMAN GROWTH HORMONE AND ALBUMIN FORMULATION AND USES THEREOF - The present invention provides a method of treating a human patient in need of growth hormone therapy by periodically administering to the human patient for more than two weeks an effective amount of a composition comprising a pharmaceutically acceptable carrier and a fusion protein whose amino acid sequence is set forth as SEQ ID NO:1, so as to thereby treat the human patient. The present invention also provides a method of treating a human patient in need of growth hormone therapy by administering to the human patient, in a clinically effective regimen, a clinically effective dose of a composition comprising a pharmaceutically acceptable carrier and a fusion protein whose amino acid sequence is set forth as SEQ ID NO:1, wherein the clinically effective dose and clinically effective regimen are selected by a series of steps. | 06-12-2014 |
20140161888 | FORMULATIONS OF 6-MERCAPTOPURINE - The present invention provides improved formulations of 6-mercaptopurine that exhibit better bioavailability and faster dissolution than previous formulations. | 06-12-2014 |
20140128430 | AMINE SALTS OF LAQUINIMOD - The subject invention provides a Laquinimod amine salt, which is laquinimod meglumine, laquinimod choline hydroxide, laquinimod L-lysine or laquinimod monoethanolamine. | 05-08-2014 |
20140107208 | BIOMARKERS PREDICTIVE FOR CLINICAL RESPONSE FOR GLATIRAMER ACETATE - The present invention provides a method for treating a human subject afflicted with multiple sclerosis or a single clinical attack consistent with multiple sclerosis with a pharmaceutical composition comprising glatiramer acetate and a pharmaceutically acceptable carrier, comprising the steps of:
| 04-17-2014 |
20140107154 | LAQUINIMOD FOR REDUCING THALAMIC DAMAGE IN MULTIPLE SCLEROSIS - This invention provides methods for inhibiting or reducing thalamic damage in a subject comprising administering to the subject an amount of laquinimod, wherein the subject is a human patient afflicted with a form of multiple sclerosis or presenting a clinically isolated syndrome who has been determined to have thalamic damage at baseline, a subject afflicted with a disease or disorder other than a form of multiple sclerosis or a clinically isolated syndrome, or a subject not afflicted with a form of multiple sclerosis or a presenting clinically isolated syndrome, and laquinimod and laquinimod pharmaceutical compositions for use thereof. This invention also provides methods for inhibiting or reducing tremor or spasticity in a subject afflicted by tremor or spasticity, comprising administering to the subject an amount of laquinimod, and laquinimod and laquinimod pharmaceutical compositions for use thereof. | 04-17-2014 |
20140105850 | TREATMENT OF MULTIPLE SCLEROSIS WITH LAQUINIMOD - The subject invention provides for methods of reducing the relapse rate and/or reducing the accumulation of physical disability in a relapsing-remitting multiple sclerosis human patient, the method comprising orally administering to the patient a daily dose of 0.6 mg laquinimod. | 04-17-2014 |
20140094604 | NEW INTERMEDIATES AND PROCESSES FOR PREPARING TICAGRELOR - The present invention is related to new intermediates and processes for preparing Ticagrelor disclosed in this patent application. | 04-03-2014 |
20140088145 | COMBINATION OF RASAGILINE AND PRIDOPIDINE FOR TREATING NEURODEGENERATIVE DISORDERS, IN PARTICULAR HUNTINGTON'S DISEASE - This invention provides a method of treating a patient afflicted with a neurodegenerative disorder, e.g., Huntington's disease, comprising administering to the patient rasagiline as an add-on therapy to or in combination with pridopidine. This invention also provides a package and a pharmaceutical composition comprising rasagiline and pridopidine for treating a patient afflicted with a neurodegenerative disorder. This invention also provides rasagiline for use as an add-on therapy or in combination with pridopidine in treating a patient afflicted with a neurodegenerative disorder. This invention further provides use of rasagiline and pridopidine in the preparation of a combination for treating a patient afflicted with a neurodegenerative disorder. | 03-27-2014 |
20140088140 | COMBINATION OF LAQUINIMOD AND PRIDOPIDINE FOR TREATING NEURODEGENERATIVE DISORDERS, IN PARTICULAR HUNTINGTON'S DISEASE - This invention provides a method of treating a patient afflicted with a neurodegenerative disorder, e.g., Huntington's disease (HD), comprising administering to the patient laquinimod as an add-on therapy to or in combination with pridopidine. This invention also provides a package and a pharmaceutical composition comprising laquinimod and pridopidine for treating a patient afflicted with a neurodegenerative disorder, e.g., HD. This invention also provides laquinimod for use as an add-on therapy or in combination with pridopidine in treating a patient afflicted with a neurodegenerative disorder, e.g., HD. This invention further provides use of laquinimod and pridopidine in the preparation of a combination for treating a patient afflicted with a neurodegenerative disorder, e.g., HD. | 03-27-2014 |
20140065126 | BChE ALBUMIN FUSIONS FOR THE TREATMENT OF COCAINE ABUSE - A method of attenuating a biological effect of cocaine exposure in a primate. Such method includes administering to the primate an amount of a BChE-albumin fusion protein comprising the amino acid substitutions A227S, S315G, A356W, and Y360G, wherein the amount of the fusion protein is effective to cause attenuation of the biological effect of cocaine exposure in the primate. | 03-06-2014 |
20140057883 | TREATMENT OF CROHN'S DISEASE WITH LAQUINIMOD - This application provides for a method of treating a subject suffering from Crohn's disease, the method comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the subject. This application provides for use of laquinimod in the manufacture of a medicament for treating a subject suffering from Crohn's disease. This application also provides for a pharmaceutical composition comprising laquinimod for use in treating a subject suffering from Crohn's disease. | 02-27-2014 |
20140051767 | PARENTERAL FORMULATIONS OF RASAGILINE - This application provides a method of preferentially inhibiting monoamine oxidase A (MAOA) in the brain of a subject relative to in the intestine of the subject comprising parenterally administering to the subject a controlled release formulation comprising a therapeutically effective amount of rasagiline or a pharmaceutically acceptable salt thereof. | 02-20-2014 |
20140051723 | DEUTERATED N-ETHYL-N-PHENYL-1,2-DIHYDRO-4-HYDROXY-5-CHLORO-1-METHYL-2-OXOQ- UINOLINE-3-CARBOXAMIDE, SALTS AND USES THEREOF - The subject invention provides deuterated N-ethyl-N-phenyl-1,2-dihydro-4-hydroxy-5-chloro-1-methyl-2-oxoquinoline-3-carboxamide, its salts and uses. | 02-20-2014 |
20140050784 | PHARMACEUTICAL COMPOSITIONS OF MEMANTINE - The present invention relates to oral dosage forms comprising Memantine or a pharmaceutically acceptable salt thereof, pharmaceutical formulations comprising the oral dosage forms, and methods for treating mild, moderate or severe Alzheimer's dementia, or neuropathic pain comprising the oral dosage forms and formulations. | 02-20-2014 |
20140045887 | LAQUINIMOD FOR TREATMENT OF CANNABINOID RECEPTOR TYPE 1(CB1) MEDIATED DISORDERS - This invention provides a method of treating a human subject suffering from a CB1 receptor related disorder comprising periodically administering to the subject an effective amount of laquinimod or pharmaceutically acceptable salt thereof in an amount effective to treat the subject. | 02-13-2014 |
20140045886 | LAQUINIMOD FOR TREATMENT OF GABA MEDIATED DISORDERS - This invention provides a method of treating a subject suffering from a GABA related disorder comprising periodically administering to the subject an effective amount of laquinimod or pharmaceutically acceptable salt thereof in an amount effective to treat the subject. | 02-13-2014 |
20140032243 | DOSE COUNTER AND RECORDING METHOD - A dose counter for a metered dose inhaler includes a force sensor, an electronic controller, a memory for storing data indicative of a remaining number of doses and an electronic display device coupled to the controller for displaying the remaining number of doses. The dose counter is attached or integrated into a base of a canister containing medicament such that force applied to the base of the canister is registered by the force sensor, the controller being configured to measure force applied to the dose counter when depressing the canister and being responsive to measured force to decrement the remaining number of doses stored in the memory and shown on the display device. | 01-30-2014 |
20140024678 | STABLE LAQUINIMOD PREPARATIONS - The subject invention provides a pharmaceutical composition comprising N-ethyl-N-phenyl-1,2,-dihydro-4-hydroxy-5- chloro-1-methyl-2-oxoquinoline-3-carboxamide or the salt thereof; a pharmaceutically acceptable carrier; and not more than 0.5% w/w relative to N-ethyl-N-phenyl-1,2,-dihydro-4 -hydroxy-5-chloro-1-methyl-2-oxoquinoline-3-carboxamide of 2-Chloro-6-(1-ethyl-N-methyl-2-oxoindoline-3-carboxamido) benzoic acid, 1H,3H-spiro[5-chloro- | 01-23-2014 |
20140018386 | LAQUINIMOD FORMULATIONS WITHOUT ALKALIZING AGENT - The subject invention provides a stable pharmaceutical composition comprising a therapeutically effective amount of laquinimod, an amount of a filler, and an amount of a lubricant, wherein the stable pharmaceutical composition is free of an alkalizing agent or an oxidation reducing agent. Also provided are processes for making the stable pharmaceutical composition and sealed packages comprising the stable pharmaceutical composition. Also provided is a method for treating a subject afflicted with a form of multiple sclerosis (MS) or for alleviating a symptom of MS in a subject afflicted with a form of MS comprising administering to the subject a stable pharmaceutical composition as described herein. Also provided is use of a stable pharmaceutical composition as described herein for treating a subject afflicted with a form of MS or for alleviating a symptom of MS in a subject afflicted with a form of multiple MS. | 01-16-2014 |
20140017226 | TREATMENT OF MULTIPLE SCLEROSIS WITH COMBINATION OF LAQUINIMOD AND FAMPRIDINE - This invention provides a method of treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the subject fampridine as an add-on therapy to or in combination with laquinimod. This invention also provides a package comprising laquinimod and fampridine for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides fampridine for use as an add-on therapy or in combination with laquinimod in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides a pharmaceutical composition comprising laquinimod and fampridine for use in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention further provides use of laquinimod and fampridine in the preparation of a combination for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. | 01-16-2014 |
20130345293 | METHODS FOR TREATING MULTIPLE SCLEROSIS USING ANTISENSE OLIGONUCLEOTIDES - A method for treating a patient suffering from multiple sclerosis, particularly a relapsing form of multiple sclerosis, comprising periodically administering a pharmaceutical composition comprising a therapeutically effective amount of OLIGONUCLEOTIDE 1 to the patient, thereby treating the patient. | 12-26-2013 |
20130345256 | N-ETHYL-4-HYDROXYL-1-METHYL-5-(METHYL(2,3,4,5,6-PENTAHYDROXYHEXYL)AMINO)-2- -OXO-N-PHENYL-1,2-DIHYDROQUINOLINE-3-CARBOXAMIDE - The subject invention provides pharmaceutical compositions containing laquinimod or a pharmaceutically acceptable salt thereof, an isolated compound of N-ethyl-4-hydroxyl-1-methyl-5-(methyl(2,3,4,5,6-pentahydroxyhexyl)amino)-2-oxo-N-phenyl-1,2-dihydroquinoline-3-carboxamide or a salt thereof, compositions containing N-ethyl-4-hydroxyl-1-methyl-5-(methyl(2,3,4,5,6-pentahydroxyhexyl)amino)-2-oxo-N-phenyl-1,2-dihydroquinoline-3-carboxamide and methods of preparing the same. | 12-26-2013 |
20130344146 | DRY FORMULATIONS OF ARIPIPRAZOLE - The invention encompasses dry compression pharmaceutical compositions of aripiprazole, methods of making tablets from the compositions, and tablets of the dry compression pharmaceutical composition. | 12-26-2013 |
20130324574 | TREATMENT OF OCULAR INFLAMMATORY DISEASES USING LAQUINIMOD - Disclosed is a method for treating an ocular inflammatory disease (OID), e.g., uveitis or conjunctivitis, comprising periodic administration of a therapeutically effective amount of laquinimod or a pharmaceutically acceptable salt thereof. Also provided is a pharmaceutical composition comprising laquinimod or a pharmaceutically acceptable salt thereof for use in treating a subject suffering from an OID, uveitis, bacterial conjunctivitis, viral conjunctivitis, an inflammation of the orbital tissue, the lacrimal apparatus, the eyelid, the cornea, the retina or the optic pathway. This application also provides a method for treating a subject suffering from an autoimmune disease-associated ocular inflammation comprising periodic ocular administration to the subject a therapeutically effective amount of laquinimod or a pharmaceutically acceptable salt, and an ocular pharmaceutical composition comprising laquinimod or a pharmaceutically acceptable salt thereof for use in treating an autoimmune disease-associated ocular inflammation. | 12-05-2013 |
20130310440 | METHOD FOR TREATING NON-SMALL CELL LUNG CANCER - The present invention provides methods for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of docetaxel; and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer. The present invention also provides compositions and combinations, packages, and uses thereof for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer. | 11-21-2013 |
20130303569 | USE OF HIGH DOSE LAQUINIMOD FOR TREATING MULTIPLE SCLEROSIS - Disclosed herein are methods of treating a human patient afflicted with multiple sclerosis (MS) or presenting a clinically isolated syndrome (CIS), for treating a human subject by providing neuroprotection, and of treating a human patient afflicted with MS or presenting a CIS by increasing the time to confirmed disease progression and/or confirmed relapse or reducing brain atrophy, comprising orally administering a daily dose of about 1.2 mg laquinimod or a pharmaceutically acceptable salt thereof. Also disclosed is a pharmaceutical oral unit dosage form of about 1.2 mg laquinimod or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier for use in treating a human patient afflicted with MS or presenting a CIS, in treating a human subject by providing neuroprotection, or in treating a human patient afflicted with MS or presenting a CIS by increasing the time to confirmed disease progression and/or confirmed relapse or reducing brain atrophy. | 11-14-2013 |
20130298907 | INHALERS AND HOUSING CAPS FOR INHALERS - An inhaler for inhalation into the airway of a user, the inhaler having a housing at least partially defining a flow passageway extending through the inhaler from an air inlet to an outlet, the inhaler including a valve for selectively restricting the flow passageway. | 11-14-2013 |
20130272996 | TREATMENT OF MULTIPLE SCLEROSIS WITH LAQUINIMOD - The subject invention provides for methods of reducing the relapse rate and/or reducing the accumulation of physical disability in a relapsing-remitting multiple sclerosis human patient, the method comprising orally administering to the patient a daily dose of 0.6 mg laquinimod. | 10-17-2013 |
20130259856 | TREATMENT OF MULTIPLE SCLEROSIS WITH COMBINATION OF LAQUINIMOD AND DIMETHYL FUMARATE - This invention provides a method of treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the subject laquinimod as an add-on therapy to or in combination with DMF. This invention also provides a package comprising laquinimod and DMF for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides laquinimod for use as an add-on therapy or in combination with DMF in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides a pharmaceutical composition comprising laquinimod and DMF for use in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention further provides use of laquinimod and DMF in the preparation of a combination for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. | 10-03-2013 |
20130217724 | N-ETHYL-N-PHENYL-1,2-DIHYDRO-4,5-DI-HYDROXY-1-METHYL-2-OXO-3-QUINOLINECARB- OXAMIDE, PREPARATION AND USES THEREOF - The subject invention provides a pharmaceutical composition containing laquinimod or a pharmaceutically acceptable salt thereof, and a compound of N-ethyl-N-phenyl-1,2-dihydro-4,5-di-hydroxy-1-methyl-2-oxo-3-quinolinecarboxamide or a salt thereof. | 08-22-2013 |
20130203807 | USE OF LAQUINIMOD FOR TREATING CROHN'S DISEASE PATIENTS WHO FAILED FIRST-LINE ANTI-TNF THERAPY - This application provides for a method of treating a human patient afflicted with anti-TNFα refractory Crohn's disease, of treating a human patient afflicted with non-fibrostenotic Crohn's disease, and of treating a human patient whose Crohn's disease had not been surgically treated, the method comprising periodically administering to the patient an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the patient. This application also provides for a method of inducing or maintaining clinical remission in a human patient afflicted with Crohn's disease comprising periodically administering to the patient an amount of laquinimod effective to induce or maintain clinical remission in the patient, which amount of laquinimod is less than 0.5 mg/day. | 08-08-2013 |
20130184310 | TREATMENT OF LUPUS ARTHRITIS USING LAQUINIMOD - This invention provides a method of treating a subject afflicted with active lupus arthritis comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the subject. This invention also provides laquinimod or pharmaceutically acceptable salt thereof for use in treating a subject afflicted with active lupus arthritis. This invention further provides a pharmaceutical composition comprising an amount of laquinimod or pharmaceutically acceptable salt thereof for use in treating a subject afflicted with lupus arthritis. | 07-18-2013 |
20130172364 | PROPARGYL-TRIFLUOROMETHOXY-AMINOBENZOTHIAZOLE DERIVATIVES, THEIR PREPARATION AND USE - Disclosed are novel derivatives of propargyl-trifluoromethoxy-amino-benzothiazole which are effective in treating neurologic disorders, including Parkinson's disease and multiple sclerosis. | 07-04-2013 |
20130165387 | LOW FREQUENCY GLATIRAMER ACETATE THERAPY - A method of alleviating a symptom of relapsing-remitting multiple sclerosis in a human patient suffering from relapsing-remitting multiple sclerosis or a patient who has experienced a first clinical episode and is determined to be at high risk of developing clinically definite multiple sclerosis comprising administering to the human patient three subcutaneous injections of a therapeutically effective dose of glatiramer acetate over a period of seven days with at least one day between every subcutaneous injection so as to thereby alleviate the symptom of the patient. | 06-27-2013 |
20130158059 | NILOTINIB SALTS AND CRYSTALLINE FORMS THEREOF - Nilotinib salts and crystalline forms thereof have been prepared and characterized. | 06-20-2013 |
20130129669 | Stable Formulations of Recombinant Human Albumin-Human Granulocyte Colony Stimulating Factor - Described herein are compositions and methods for treating, preventing and ameliorating diseases and conditions characterized by a lower than normal white blood cell count, such as leukopenia and neutropenia. The compositions and methods include recombinant human albumin-human granulocyte colony stimulating factor. Pharmaceutical formulations including the recombinant fusion protein, and methods of making such formulations are also described. | 05-23-2013 |
20130123189 | DETERMINATION OF SINGLE NUCLEOTIDE POLYMORPHISMS USEFUL TO PREDICT RESPONSE FOR GLATIRAMER ACETATE - This invention provides a method for treating a human subject afflicted with multiple sclerosis or a single clinical attack consistent with multiple sclerosis with a pharmaceutical composition comprising glatiramer acetate and a pharmaceutically acceptable carrier, comprising the steps of:
| 05-16-2013 |
20130096304 | NILOTINIB HCL CRYSTALLINE FORMS - Crystalline forms of Nilotinib HCl are described. | 04-18-2013 |
20130096158 | Treatment Of Multiple Sclerosis With Combination Of Laquinimod And Fingolimod - This invention provides a method of treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the subject laquinimod as an add-on therapy to or in combination with fingolimod. This invention also provides a package and a pharmaceutical composition comprising laquinimod and fingolimod for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides laquinimod for use as an add-on therapy or in combination with fingolimod in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention further provides use of laquinimod and fingolimod in the preparation of a combination for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. | 04-18-2013 |
20130089612 | R(+)-N-FORMYL-PROPARGYL-AMINOINDAN - The subject invention provides R(+)-N-formyl-propargyl-aminoindan and a composition containing N-propargyl-1(R)-aminoindan or a pharmaceutically acceptable salt thereof, and a compound of R(+)-N-formyl-propargyl-aminoindan. | 04-11-2013 |
20130089611 | RASAGILINE CITRAMIDE - The subject invention provides rasagiline citramide and a composition containing N-propargyl-1(R)-aminoindan or a pharmaceutically acceptable salt thereof, and a compound of rasagiline citramide or a salt thereof. | 04-11-2013 |
20130089610 | R(+)-N-METHYL-PROPARGYL-AMINOINDAN - The subject invention provides R(+)-N-methyl-propargyl-aminoindan or a pharmaceutically acceptable salt thereof and a composition containing R(+)-N-propargyl-1(R)-aminoindan or a pharmaceutically acceptable salt thereof, and a compound of R(+)-N-methyl-propargyl-aminoindan or a salt thereof. | 04-11-2013 |
20130023485 | PARENTERAL FORMULATIONS OF PEPTIDES FOR THE TREATMENT OF SYSTEMATIC LUPUS ERYTHEMATOSUS - The subject invention provides a pharmaceutical composition comprising: an aqueous carrier; from 0.1 mg/ml to 20 mg/ml of a pharmaceutically acceptable salt of a) a peptide comprising at least 12 and at most 30 consecutive amino acids, b) a peptide comprising consecutive amino acids having the sequence shown by any of SEQ ID NOS. 8-17, c) a peptide comprising consecutive amino acids having a sequence of any of a) and b), or at least two sequences in (a), or d) a peptide comprising consecutive amino acids having a sequence comprising at least two identical sequences included in (a); and a solubility enhancer; and wherein the composition has a pH between 4 and 9, and a method of alleviating symptoms of SLE in a human by administering an effective amount of the composition. | 01-24-2013 |
20120316175 | SOLID STATE FORMS OF SITAGLIPTIN SALTS - Solid state forms of Sitagliptin salts, processes for preparing the solid state forms, and pharmaceutical compositions thereof, are provided. | 12-13-2012 |
20120309671 | PROCESS FOR THE MEASUREMENT OF THE POTENCY OF GLATIRAMER ACETATE - The subject invention provides a process for measuring the relative potency of a test batch of glatiramer acetate. In addition, the subject invention provides a process for preparing a batch of glatiramer acetate as acceptable for pharmaceutical use. | 12-06-2012 |
20120302600 | STABLE LAQUINIMOD PREPARATIONS - The invention relates to a pharmaceutical composition comprising a pharmaceutically acceptable salt of N-ethyl-N-phenyl-1,2,-dihydro-4-hydroxy-5-chloro-1-methyl-2-oxoquinoline-3-carboxamide, N-methylglucamine, and a pharmaceutically acceptable carrier. | 11-29-2012 |
20120220663 | SOLID FORMS OF ALISKIREN HEMIFUMARATE AND PROCESSES FOR PREPARATION THEREOF - The present invention provides polymorphic forms of aliskiren hemifumarate, and processes for preparation thereof and for the preparation of the amorphous form of aliskiren hemifumarate. The present invention also provides pharmaceutical compositions comprising the aliskiren hemifumarate crystalline forms T1, T3 or T4, T5, T6, T7, T8 and at least one pharmaceutically acceptable excipient, and the use of these pharmaceutical compositions in the treatment of hypertension. | 08-30-2012 |
20120177706 | STABLE COMBINATIONS OF AMLODIPINE BESYLATE AND BENAZEPRIL HYDROCHLORIDE - The present invention provides a pharmaceutical composition comprising benazepril and amlodipine wherein the benazepril and the amlodipine are not physically separated from one another, and methods for making the same. | 07-12-2012 |
20120095264 | SOLID STATES OF ALISKIREN FREE BASE - The present invention describes a solid state of aliskiren free base, and process for the preparation thereof. | 04-19-2012 |
20120003249 | IMMUNO-MOLECULES CONTAINING VIRAL PROTEINS, COMPOSITIONS THEREOF AND METHODS OF USING - An immuno-molecule which comprises a soluble human MHC class I effector domain; and an antibody targeting domain which is linked to the soluble human MHC class I effector domain, methods of making same and uses thereof. | 01-05-2012 |
20110150874 | FUSION PROTEINS, USES THEREOF AND PROCESSES FOR PRODUCING SAME - This invention provides fusion proteins comprising consecutive amino acids which beginning at the amino terminus of the protein correspond to consecutive amino acids present in (i) a cytomegalovirus human MHC-restricted peptide, (ii) a first peptide linker, (iii) a human β-2 microglobulin, (iv) a second peptide linker, (v) a HLA-A2 chain of a human MHC class I molecule, (vi) a third peptide linker, (vii) a variable region from a heavy chain of a scFv fragment of an antibody, and (viii) a variable region from a light chain of such scFv fragment, wherein the consecutive amino acids which correspond to (vii) and (viii) are bound together directly by a peptide bond or by consecutive amino acids which correspond to a fourth peptide linker, wherein the antibody from which the scFv fragment is derived specifically binds to mesothelin. This invention provides nucleic acid constructs encoding same, processes for producing same, compositions, and uses thereof. | 06-23-2011 |
20110118477 | SUNITINIB AND SALTS THEREOF AND THEIR POLYMORPHS - Process for the preparation of sunitinib malate form I via sunitinib acetate and polymorphs of said intermediate. | 05-19-2011 |
20110086102 | DELAYED RELEASE COMPOSITIONS - The present invention provides delayed release pharmaceutical compositions comprising an active pharmaceutical ingredient, e.g. mycophenolate sodium, and an enteric polymer, and methods for preparing the same. Preferably, the pharmaceutical compositions do not contain a coating. | 04-14-2011 |
20100317702 | CRYSTALLINE FORM OF FEBUXOSTAT - New forms of Febuxostat have been prepared and characterized. These forms are useful, for example, in the chronic management of hyperuricemia in patients with gout. | 12-16-2010 |
20100249140 | SOLID STATE FORMS OF SITAGLIPTIN SALTS - Solid state forms of Sitagliptin salts, processes for preparing the solid state forms, and pharmaceutical compositions thereof, are provided. | 09-30-2010 |
20100216831 | DESLORATADINE CRYSTALLINE FORMS MIXTURES HAVING A LOW LEVEL OF RESIDUAL SOLVENTS - Provided are desloratadine mixtures, comprising a low level of residual solvents and processes for the preparation thereof. | 08-26-2010 |
20100190812 | NILOTINIB HCL CRYSTALLINE FORMS - Crystalline forms of Nilotinib HCl are described. | 07-29-2010 |
20100189878 | PROCESSES FOR COATING A CARRIER WITH MICROPARTICLES - Processes for coating a carrier with microparticles of a drug are described. For example, a coated carrier can be obtained in a one-stage process that entails evaporating a solvent from microdroplets of a solution containing an API to obtain dry microparticles, which are then coated on the carrier. | 07-29-2010 |
20100168247 | SOLID COMPOSITES OF A CALCIUM RECEPTOR-ACTIVE COMPOUND - The invention encompasses solid composites of the calcium receptor-active compounds, processes for preparing the solid composites, immediate and controlled-release pharmaceutical formulations comprising the solid composites, and methods of treatment therewith. | 07-01-2010 |
20100160666 | PREPARATION OF GABAPENTIN ENACARBIL INTERMEDIATE - Allyl 1 {[(α-isobutanoyloxyethoxy)carbonyl]aminomethyl}-1-cyclohexane acetate can be prepared by combining allyl 1-aminomethyl-1-cyclohexane acetate hydrochloride, a polar organic solvent, chloroethyl chloroformate, and an amine base or an inorganic base selected from a group consisting of carbonate and bicarbonate to provide a reaction mixture; and adding isobutyric acid to the reaction mixture. The product can be purified and/or converted to gabapentin enacarbil. | 06-24-2010 |
20100160665 | PROCESSES FOR THE PREPARATION AND PURIFICATION OF GABAPENTIN ENACARBIL - Gabapentin enacarbil was prepared and purified from intermediates such as 1-haloalkyl carbamate or carbonate and diacid acetal skeleton. For example, a 1-haloalkyl carbonate or carbamate was prepared by combining a C | 06-24-2010 |
20100160646 | PROCESSES FOR PREPARING SUNITINIB AND SALTS THEREOF - Methods for preparing sunitinib or salts thereof are described using novel intermediates and chemical pathways. One such intermediate is: | 06-24-2010 |
20100158959 | Stable Combinations of Amlodipine Besylate and Benazepril Hydrochloride - The present invention provides a pharmaceutical composition comprising benazepril and amlodipine wherein the benazepril and the amlodipine are in physical contact with one another, and methods for making the same. | 06-24-2010 |
20100099687 | TADALAFIL SOLID COMPOSITES - This invention relates to oral pharmaceutical compositions suitable for making pharmaceutical formulations for oral administration that provide for the rapid dissolution of the phosphodiesterase 5 inhibitor tadalafil. In particular, the pharmaceutical compositions comprise solid composites of tadalafil exhibiting high solubility and rate of dissolution. The invention further relates to methods of preparing these pharmaceutical formulations and the use of such pharmaceutical formulations for treating diseases associated with PDE5 inhibitors. | 04-22-2010 |
20100076195 | PURIFICATION OF MONTELUKAST - The present invention provides methods of purifying montelukast, a new isolated impurity of montelukast, method for its isolation, and method of using montelukast impurity as a reference marker and a reference standard. | 03-25-2010 |
20100056583 | Polymorphic forms of rosiglitazone hydrobromide and processes for their preparation - The present invention provides crystalline forms of Rosiglitazone hydrobromide, methods of their preparation, as well as pharmaceutical compositions comprising these crystalline forms. | 03-04-2010 |
20100029943 | METHODS FOR PREPARING ESZOPICLONE CRYSTALLINE FORM A, SUBSTANTIALLY PURE ESZOPICLONE AND OPTICALLY ENRICHED ESZOPICLONE - The present invention provides methods for preparing eszopiclone Form A, substantially chemically pure eszopiclone, or eszopiclone with low level(s) of residual solvent(s). The present invention also provides eszopiclone with low level(s) of residual solvent(s). The present invention also provides a process for optical enrichment of eszopiclone free base. For instance, one of the embodiments of the invention is directed to a method of preparing eszopiclone Form A, wherein the method comprises crystallizing eszopiclone free base from a solvent selected from the group consisting of isopropanol (IPA), methyl isobutyl ketone (MIBK), acetone, n-butanol, i-butanolisobutanol, 2-butanol, tetrahydrofuran (THF), dimethyl carbonate, methanol, ethanol, ethyl lactate, dimethylformamide (DMF), carbon tetrachloride, toluene, iso-butyl acetate and mixtures thereof. | 02-04-2010 |
20100016590 | NILOTINIB INTERMEDIATES AND PREPARATION THEREOF - Intermediates of Nilotinib were prepared, including, for example, 3-(trifluoromethyl-5-(4-methyl-1H-imidazole-1-yl)-benzeneamine; 3-(4-(pyridin-3-yl)pyrimidin-2-ylamino) -4-methylbenzoyl halogen dihydrochloride; and N-(3-Bromo-5-trifluoromethylphenyl)-4-methyl-3-[[4-(3-pyridinyl)-2-pyrimidinyl]amino]benzamide. Nilotinib.3HCl and its crystalline forms are also described. | 01-21-2010 |
20100004485 | GABAPENTIN ENACARBIL SALTS AND PROCESSES FOR THEIR PREPARATION - The preparation and use of calcium, barium, magnesium and copper salts of gabapentin enacarbil are described. | 01-07-2010 |
20090318728 | PROCESSES FOR PREPARING PRODRUGS OF GABAPENTIN AND INTERMEDIATES THEREOF - Gabapentin prodrugs and intermediates thereof are described. | 12-24-2009 |
20090311322 | ATORVASTATIN FORMULATION - Provided are atorvastatin compositions which reduce the effect of food on the bioavailability of atorvastatin and methods for making such compositions. Also provided are methods of reducing low density lipoprotein by administering the compositions of the invention. | 12-17-2009 |
20090292025 | Novel crystalline forms of armodafinil and preparation thereof - The invention encompasses crystalline forms of armodafinil, processes for preparing the crystalline forms, and pharmaceutical formulation. | 11-26-2009 |
20090247767 | PROCESSES FOR PREPARING SUNITINIB AND SALTS THEREOF - Methods for preparing sunitinib or salts thereof are described using novel intermediates and chemical pathways. One such intermediate is: | 10-01-2009 |
20090240054 | Rosuvastatin calcium with a low salt content - Provided is rosuvastatin calcium with a low salt by product content and processes for preparing such rosuvastatin calcium. | 09-24-2009 |
20090188305 | Reference standard for characterization of rosuvastatin - Provided are rosuvastatin degradation products and their use as a reference standard (including reference marker) for analysis of rosuvastatin. | 07-30-2009 |
20090082398 | CRYSTALLINE FORMS OF FEXOFENADINE HYDROCHLORIDE AND PROCESSES FOR THEIR PREPARATION - Provided are crystalline forms of fexofenadine hydrochloride and processes for their preparation. | 03-26-2009 |
20080319191 | Crystalline form IV of linezolid - The present invention provides a novel crystalline form of linezolid referred to herein as Form IV as well as methods for the preparation and use of Form IV. The present invention provides pharmaceutical compositions that comprise therapeutically effective amounts of Form IV that can be used to treat patients suffering from gram-positive bacterial infections. Various processes for making crystalline linezolid Form IV are disclosed. | 12-25-2008 |
20080269505 | Processes for preparing darifenacin hydrobromide - The invention encompasses processes for the preparation of darifenacin hydrobromide. | 10-30-2008 |
20080269504 | Pure darifenacin hydrobromide substantially free of oxidized darifenacin and salts thereof and processes for the preparation thereof - Provided are darifenacin hydrobromide free of oxidized darifenacin, and processes for the preparation thereof. | 10-30-2008 |
20080269503 | Processes for preparing darifenacin hydrobromide - The invention encompasses processes for the preparation of darifenacin hydrobromide. | 10-30-2008 |
20080269202 | Novel 2,3-benzodiazepine derivatives and their use as antipsychotic agents - Disclosed are novel 2,3-benzodiazepine derivatives and methods of making the same. | 10-30-2008 |
20080200720 | PROCESS FOR THE SYNTHESIS OF ENANTIOMERIC INDANYLAMINE DERIVATIVES - A process for manufacturing (R)-propynylaminoindans, and alternatively, a process for manufacturing (S)-propynylaminoindans. The chiral propynylaminoindans include alkoxy or alkylcarbamates derivatives. The process comprises transfer or pressure hydrogenation in the presence of an optically active catalyst to reduce 1-indanones. The chiral product, either (S)- or (R)-indanols undergo nucleophilic substitution to produce the named product. In an additional aspect, the invention relates to novel intermediates and compounds, namely, substituted indanones, substituted (S)-indanols and substituted (R)-indanols. | 08-21-2008 |