Coley Pharmaceutical Group, Inc. Patent applications |
Patent application number | Title | Published |
20150086610 | IMMUNOSTIMULATORY OLIGONUCLEOTIDES - The invention relates to immunostimulatory oligonucleotides and methods of using immunostimulatory oligonucleotides to induce an antigen-specific immune response. The invention further relates to a vaccine that comprises an immunostimulatory oligonucleotide and an antigen, and comprises a pharmaceutically acceptable carrier. The immunostimulatory oligonucleotides of the invention, in some embodiments, include one or more modified linkage(s). | 03-26-2015 |
20140099337 | Pneumococcal Vaccine and Uses Thereof - The present invention relates to new pneumococcal vaccines. The invention also relates to vaccination of subjects, in particular immunocompromised subjects, against pneumoccocal infections using said novel pneumococcal vaccines. | 04-10-2014 |
20130084306 | VACCINES COMPRISING CHOLESTEROL AND CPG AS SOLE ADJUVANT-CARRIER MOLECULES - Described are vaccines having one or more antigens cholesterol and CpG. Aspects of the invention relate to the use of the vaccines of the invention for the treatment and/or prevention of human and animal disorders. | 04-04-2013 |
20120219571 | COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY - Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines. | 08-30-2012 |
20120003179 | ANTI-CTLA-4 AND CPG-MOTIF-CONTAINING SYNTHETIC OLIGODEOXYNUCLEOTIDE COMBINATION THERAPY FOR CANCER TREATMENT - The invention relates to administration of an anti-CTLA-4 antibody, particularly human antibodies to human CTLA-4, such as those having amino acid sequences of antibodies 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, 12.9.1.1, and MDX-010, in combination with an immunostimulatory nucleotide, i.e., CpG ODN PF3512676, for treatment of cancer. The invention relates to administering a combination of an anti-CTLA-4 antibody and CpG ODN PF3512676 as neoadjuvant, adjuvant, first-line, second-line, and third-line therapy of cancer, whether localized or metastasized, and at any point(s) along the disease continuum (e.g., at any stage of the cancer). | 01-05-2012 |
20110300164 | IMMUNOSTIMULATORY DNA:RNA OLIGONUCLEOTIDES - Immunostimulatory sequence-specific RNA oligonucleotides corresponding to 3′ terminal sequences of single-stranded minus-sense RNA genomic RNAs are provided. Also provided are compositions and methods relating to an immunostimulatory 4-mer RNA motif provided as 5′-C/U-U-G/U-U-3′. Incorporation of this short RNA motif is sufficient to confer new and altered immunostimulatory properties in new and existing oligonucleotides, including CpG oligodeoxynucleotides. Also provided are methods for use of the immunostimulatory RNA oligonucleotides and DNA:RNA chimeric oligonucleotides of the invention to induce an immune response in vitro and in vivo, as well as to treat allergy, asthma, infection, and cancer in a subject. Single-stranded oligoribonucleotides of the invention are believed to signal through a Toll-like receptor (TLR) chosen from TLR9, TLR8, TLR7, and TLR3. The oligoribonucleotides can also be used in a method to screen for TLR antagonists. | 12-08-2011 |
20110269965 | Ring Closing and Related Methods and Intermediates - Methods and intermediates useful for making compounds of the formula: and the preparation of compounds of Formula I, preferably including the formation of intermediate compounds of the formula: | 11-03-2011 |
20110206719 | IMMUNOSTIMULATORY OLIGORIBONUCLEOTIDES - The invention provides immunostimulatory compositions and use of those compounds in the preparation of medicaments for the treatment of disease as well as in vitro uses. In particular, the compositions of the invention include immunostimulatory oligoribonucleotides that incorporate a sequence-dependent immunostimulatory sequence motif. Specific modifications involving phosphate linkages, nucleotide analogs, adducts, and combinations thereof are provided. Compositions of the invention, which optionally can include an antigen, can be used alone or together with other treatments to stimulate or enhance an immune response. Also provided are compositions and methods useful for treating a subject having an infection, a cancer, an allergic condition, asthma, airway remodeling, or immunodeficiency. Immunostimulatory oligoribonucleotides of the invention are believed to stimulate Toll-like receptor 8 (TLR8). | 08-25-2011 |
20110135605 | METHODS AND PRODUCTS RELATED TO TREATMENT AND PREVENTION OF HEPATITIS C VIRUS INFECTION - The invention provides methods for identifying and treating subjects having hepatitis C infections. In some instances, the subjects are those that are non-responsive to non-CpG therapy. Preferably, the subjects are treated with C class CpG immunostimulatory nucleic acids having semi-soft backbone. | 06-09-2011 |
20110070575 | Immunomodulatory Compositions, Combinations and Methods - The invention provides immunomodulatory compositions, immunomodulatory combinations, and methods of modulating TLR7-mediated biological activity. Generally, the immunomodulatory compositions include an immunomodulatory oligonucleotide in an amount effective to reduce TLR7-mediated biological activity. In some cases, an immunomodulatory combination can further include an IRM compound. In some of these embodiments, the IRM compound can be a TLR7/8 agonist. Generally, the Imethods include contacting immune cells with an immunomodulatory composition in an amount effective to reduce TLR7-mediated biological activity. | 03-24-2011 |
20110033421 | METHODS RELATED TO IMMUNOSTIMULATORY NUCLEIC ACID-INDUCED INTERFERON - Methods and compositions are provided for extending the clinical utility of IFN-α in the treatment of a variety of viral and proliferative disorders. Among other aspects, the invention provides methods which increase the efficacy of IFN-α treatment and reduce IFN-α treatment-related side effects. In addition, methods are provided for supporting the survival and for activating natural interferon producing cells (IPCs) in vitro without exogenous IL-3 or GM-CSF. The invention is based on the discovery that certain CpG and non-CpG ISNAs promote survival and stimulation of IPCs. | 02-10-2011 |
20100317684 | Amide and Carbamate Derivatives of N-{2-[4-Amino-2- (Ethoxymethyl)-1H-Imidazo[4,5-c]Quinolin-1-Yl]-1,1-Dimethylethyl} Methanesulfonamide and Methods - Amide and carbamate derivatives N-{2-[4-amino-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinolin- | 12-16-2010 |
20100316659 | IMMUNOSTIMULATORY OLIGORIBONUCLEOTIDES - The invention provides immunostimulatory compositions and use of those compounds in the preparation of medicaments for the treatment of disease as well as in vitro uses. In particular, the compositions of the invention include immunostimulatory oligoribonucleotides that incorporate a sequence-dependent immunostimulatory sequence motif. Specific modifications involving phosphate linkages, nucleotide analogs, adducts, and combinations thereof are provided. Compositions of the invention, which optionally can include an antigen, can be used alone or together with other treatments to stimulate or enhance an immune response. Also provided are compositions and methods useful for treating a subject having an infection, a cancer, an allergic condition, asthma, airway remodeling, or immunodeficiency. Immunostimulatory oligoribonucleotides of the invention are believed to stimulate Toll-like receptor 8 (TLR8). | 12-16-2010 |
20100240693 | Oxime and Hydroxylamine Substituted Thiazolo [4,5-C] Ring Compounds and Methods | 09-23-2010 |
20100189772 | Compositions of TLR ligands and antivirals - The invention relates to methods and products for the treatment of viral infection using a combination of anti-viral agents and TLR ligands. The invention also relates to screening assays, associated products, kits, and in vitro methods. | 07-29-2010 |
20100183639 | NUCLEIC ACID-LIPOPHILIC CONJUGATES - The invention relates to a nucleic acid-lipophilic conjugates and methods for modulating an immune response using the conjugates. The lipophilic moiety associated with an immunostimulatory nucleic acid. | 07-22-2010 |
20100069427 | Oxime and Hydroxylamine Substituted Imidazo[4,5-c] Ring Compounds and Methods - Imidazo[4,5-c] ring compounds, (e.g. imidazo[4,5-c]pyridines, imidazo[4,5-c]quinolines, 6,7,8,9-tetrahydro imidazo[4,5-c]quinolines, imidazo[4,5-c]naphthyridine, and 6,7,8,9-tetrahydro imidazo[4,5-c]naphthyridine compounds) having an oxime or hydroxylamine substituent at the 2-position, pharmaceutical compositions containing the compounds, intermediates, and methods of making and methods of use of these compounds as immunomodulators, for modulating cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases are disclosed. | 03-18-2010 |
20090311277 | NUCLEIC ACID COMPOSITIONS FOR STIMULATING IMMUNE RESPONSES - The invention provides an immunostimulatory nucleic acid comprising CpG motifs, and methods of use thereof in stimulating immunity. | 12-17-2009 |
20090253695 | Hydroxyalkyl Substituted Imidazonaphthyridines - Certain imidazonaphthyridines with a hydroxymethyl or hydroxyethyl substituent at the 2-position, pharmaceutical compositions containing the compounds, intermediates, methods of making and methods of use of these compounds as immunomodulators, for preferentially inducing IFN-α biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases are disclosed. | 10-08-2009 |
20090176821 | Amide and Carbamate Derivatives of Alkyl Substituted N-[4-(4-Amino-1H-Imidazo[4,5-C] Quinolin-1-YL)Butyl]Methanesulfonamides and Methods - Amide and carbamate derivatives of N-[4-(4-amino-1H-imidazo[4,5-c]quinolin-1-yl)butyl]methanesulfonamides with an ethyl, methyl, or n-propyl substituent at the 2-position, pharmaceutical compositions containing these compounds, methods of making the compounds, and methods of use of these compounds in modulating the immune system, for inducing cytokine biosyn-thesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed. | 07-09-2009 |
20090163533 | 1-Substituted Pyrazolo (3,4-C) Ring Compounds as Modulators of Cytokine Biosynthesis for the Treatment of Viral Infections and Neoplastic Diseases - Pyrazolo[3,4-c] ring compounds of Formula (I), e.g., pyrazolo[3,4-c]pyridines, pyrazolo[3,4-c]quinolines, 6,7,8,9-tetrahydro pyrazolo[3,4-c]quinolines, and pyrazolo[3,4-c]naphthyridines, substituted at the 1-position, pharmaceutical compositions containing the compounds, intermediates, methods of making and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases are disclosed. | 06-25-2009 |
20090163532 | Aqueous Gel Formulations Containing Immune Response Modifiers - Aqueous gel formulations, including an immune response modifier (IRM), such as those chosen from imidazoquinoline amines, tetrahydroimidazoquinoline amines, imidazopyridine amines, 6,7-fused cycloalkylimidazopyridine amines, 1,2-bridged imidazoquinoline amines, imidazonaphthyridine amines, imidazotetrahydronaphthyridine amines, oxazoloquinoline amines, thiazoloquinoline amines, oxazolopyridine amines, thiazolopyridine amines, oxazolonaphthyridine amines, thiazolonaphthyridine amines, pyrazolopyridine amines, pyrazoloquinoline amines, tetrahydropyrazoloquinoline amines, pyrazolonaphthyridine amines, tetrahydropyrazolonaphthyridine amines, and 1H-imidazo dimers fused to pyridine amines, quinoline amines, tetrahydroquinoline amines, naphthyridine amines, or tetrahydronaphthyridine amines, are provided. Methods of use and kits are also provided. | 06-25-2009 |
20090142362 | Peptide-based vaccine compositions to endogenous cholesteryl ester transfer protein (CETP) - Improved vaccine compositions and methods of use thereof are described that elicit production of antibodies in an individual to the individual's own endogenous cholesteryl ester transfer protein (CETP). | 06-04-2009 |
20090137519 | SEMI-SOFT C-CLASS IMMUNOSTIMULATORY OLIGONUCLEOTIDES - The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C. | 05-28-2009 |
20090124611 | Pyrazolopyridine-1,4-Diamines and Analogs Thereof - Pyrazolopyridine-1,4-diamines and analogs thereof, e.g., pyrazolo[3,4-c]pyridine-1,4-diamines, pyrazolo[3,4-c]quinoline-1,4-diamines, 6,7,8,9-tetrahydro pyrazolo[3,4-c]quinoline-1,4-diamines, and pyrazolo[3,4-c]naphthyridine-1,4-di-amines, pharmaceutical compositions containing the compounds, intermediates, methods of making these compounds, and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases are disclosed. | 05-14-2009 |
20090117132 | Anti-Ctla-4 Antibody and Cpg-Motif-Containing Synthetic Oligodeoxynucleotide Combination Therapy for Cancer Treatment - The invention relates to administration of an anti-CTLA-4 antibody, particularly human antibodies to human CTLA-4, such as those having amino acid sequences of antibodies 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, 12.9.1.1, and MDX-010, in combination with an immunostimulatory nucleotide, i.e, CpG ODN PF3512676, for treatment of cancer. The invention relates to administering a combination of an anti-CTLA-4 antibody and CpG ODN PF3512676 as neoadjuvant, adjuvant, first-line, second-line, and third-line therapy of cancer, whether localized or metastasized, and at any point(s) along the disease continuum (e.g, at any stage of the cancer). | 05-07-2009 |
20090105295 | HYDROXYLAMINE SUBSTITUTED IMIDAZOQUINOLINES - Imidazo ring compounds (e.g., imidazoquinolines, 6,7,8,9-tetrahydroimidazoquinolines, imidazonaphthyridines, and imidazopyridines) with a hydroxylamine substituent at the 2-position, pharmaceutical compositions containing the compounds, intermediates, and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases are disclosed. | 04-23-2009 |
20090087446 | COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY - Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines. | 04-02-2009 |
20090075980 | Pyrazolopyridines and Analogs Thereof - Pyrazolopyridin-4-amines, pyrazoloquinolin-4-amines, pyrazolonaphthyridin-4-amines, 6,7,8,9-tetrahydropyrazoloquinolin-4-amines, and prodrugs thereof, pharmaceutical compositions containing the compounds, intermediates, methods of making, and methods of use of these compounds as immunomodulators, for inducing or inhibiting cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases, are disclosed. | 03-19-2009 |
20090069314 | Hydroxyalkyl Substituted Imidazoquinoline Compounds and Methods - Certain imidazoquinolines with a hydroxymethyl or hydroxyethyl substituent at the 2-position, and an aryl or heteroaryl substituent at the 7-position, pharmaceutical compositions containing the compounds, intermediates, methods of making and methods of use of these compounds as immunomodulators, for preferentially inducing IFN-α biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases are disclosed. | 03-12-2009 |
20090069299 | Pyrazolo[3,4-c]Quinolines, Pyrazolo[3,4-c]Naphthyridines, Analogs Thereof, and Methods - Pyrazolo[3,4-c]quinolines, pyrazolo[4,5-c]naphthyridines, and analogs thereof, eg., 6,7,8,9-tetrahydro pyrazolo[3,4-c]quinolines, and, pharmaceutical compositions containing the compounds, intermediates, methods of making these compounds, and methods of use of these compounds as immunomodulators, for inhibiting cytokine biosynthesis in animals and in the therapeutic or prophylactic treatment of diseases by inhibiting cytokine biosynthesis are disclosed. | 03-12-2009 |
20090062328 | Oxime and Hydroxylamine Substituted Imidazo[4,5-c] Ring Compounds and Methods - Imidazo[4,5-c] ring compounds, (e.g. imidazo[4,5-c]pyridines, imidazo[4,5-c]quinolines, 6,7,8,9-tetrahydro imidazo[4,5-c]quinolines, imidazo[4,5-c]naphthyridine, and 6,7,8,9-tetrahydro imidazo[4,5-c]naphthyridine compounds) having an oxime or hydroxylamine substituent at the 2-position, pharmaceutical compositions containing the compounds, intermediates, and methods of making and methods of use of these compounds as immunomodulators, for modulating cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases are disclosed. | 03-05-2009 |
20090030031 | Method of Preferentially Inducing the Biosynthesis of Interferon - A method of preferentially inducing IFN-α biosynthesis in an animal comprising administering certain imidazo[4,5-c] ring compounds with a hydroxymethyl or hydroxyethyl substituent at the 2-position or pharmaceutical compositions containing the compounds, intermediates, methods of making, and methods of using these compounds a immunomodulators for treatment of diseases including viral and neoplastic diseases comprising preferentially inducing IFN-α biosynthesis in an animal are disclosed. | 01-29-2009 |
20090017076 | TREATMENT FOR CD5+ B CELL LYMPHOMA - The present invention provides methods for increasing expression of cell surface molecules of CD5 | 01-15-2009 |
20080318998 | Alkyloxy Substituted Thiazoloquinolines and Thiazolonaphthyridines - Thiazoloquinolines and thiazolonaphthyridines with an alkoxy substituent at the 6, 7, 8, or 9-position, pharmaceutical compositions containing the compounds, intermediates, methods of making and methods of use of these compounds as immunomodulators, for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases are disclosed. | 12-25-2008 |
20080312434 | PROCESS FOR IMIDAZO [4,5-C] PYRIDIN-4-AMINES - A process and intermediates for preparing 1H-imidazo[4,5-c]pyridin-4-amines are disclosed. The process includes providing a 7H-imidazo[4,5-c]tetrazolo[1,5-a]pyridine and converting a 7H-imidazo[4,5-c]tetrazolo[1,5-a]pyridine to a 1H-imidazo[4,5-c]pyridin-4-amine. | 12-18-2008 |
20080306252 | SULFONAMIDO ETHER SUBSTITUTED IMIDAZOQUINOLINES - Imidazoquinoline and tetrahydroimidazoquinoline compounds that contain ether and sulfonamide or sulfamide functionality at the 1-position are useful as immune response modifiers. The compounds and compositions of the invention can induce the biosynthesis of various cytokines and are useful in the treatment of a variety of conditions including viral diseases and neoplastic diseases. | 12-11-2008 |
20080269192 | Chiral Fused [1,2]Imidazo[4,5-C] Ring Compounds - Fused [1,2]imidazo[4,5-c] ring compounds (e.g., imidazo[4,5-c]quinolines, 6,7,8,9-tetrahydroimidazo[4,5-c]quinolines, imidazo[4,5-c]naphthyridines, and 6,7,8,9-tetrahydroimidazo[4,5-c]naphthyridines) with a —CH(—X | 10-30-2008 |
20080207674 | Immune Response Modifier Formulations And Methods - An aqueous parenteral pharmaceutical formulation of the IRM drug compound N-[4-(4-amino-2-ethyl-1H-imidazo[4,5-c]quinolin-1-yl)butyl]methanesulfonamide dissolved in water, buffer selected from citric acid, acetic acid, lactic acid, succinic acid, and tartaric acid, and optionally a tonicity adjuster, preferably selected from sorbitol and mannitol, wherein the pH is no greater than 6 and the formulation is sterile and preferably substantially free of sodium chloride. | 08-28-2008 |