Patent application title: NOVEL GENES AND PROTEINS OF BRACHYSPIRA HYODYSENTERIAE AND USES THEREOF
Inventors:
Matthew Bellgard (Attadale, AU)
David J. Hampson (Bedfordale, AU)
Tom La (Parkwood, AU)
IPC8 Class: AC07K1420FI
USPC Class:
4241901
Class name: Antigen, epitope, or other immunospecific immunoeffector (e.g., immunospecific vaccine, immunospecific stimulator of cell-mediated immunity, immunospecific tolerogen, immunospecific immunosuppressor, etc.) amino acid sequence disclosed in whole or in part; or conjugate, complex, or fusion protein or fusion polypeptide including the same disclosed amino acid sequence derived from bacterium (e.g., mycoplasma, anaplasma, etc.)
Publication date: 2016-02-25
Patent application number: 20160052974
Abstract:
Novel polynucleotide and amino acids of Brachyspira hyodysenteriae are
described. These sequences are useful for diagnosis of B. hyodysenteriae
disease in animals and as a therapeutic treatment or prophylactic
treatment of B. hyodysenteriae disease in animals. These sequences may
also be useful for diagnostic and therapeutic and/or prophylactic
treatment of diseases in animals caused by other Brachyspira species,
including B. intermedia, B. suantatina, B. alvinipulli, B. aalborgi, B.
innocens, B. murdochii, and B. pilosicoli.Claims:
1. An isolated polypeptide comprising the full length of an amino acid
sequence selected from the group consisting of SEQ ID NO: 22, 32, and 64
with a heterologous polypeptide that permits the detection, isolation,
solubilization, or stabilization of the isolated polypeptide.
2-5. (canceled)
6. An immunogenic composition comprising the polypeptide of claim 1.
7-30. (canceled)
31. A method of generating an immune response to Brachyspira infection in an animal comprising administering to said animal the polypeptide of claim 1.
32-44. (canceled)
45. An isolated polypeptide comprising a sequence that is at least 70% homologous to a polypeptide with an amino acid sequence selected from the group consisting of SEQ ID NO: 22, 32, and 64 and a heterologous polypeptide that permits the detection, isolation, solubilization, or stabilization of the isolated polypeptide.
46. An isolated polypeptide comprising a sequence that is at least 80% homologous to a polypeptide with an amino acid sequence selected from the group consisting of SEQ ID NO: 22, 32, and 64 and a heterologous polypeptide that permits the detection, isolation, solubilization, or stabilization of the isolated polypeptide.
47. An isolated polypeptide comprising a sequence that is at least 90% homologous to a polypeptide with an amino acid sequence selected from the group consisting of SEQ ID NO: 22, 32, and 64 and a heterologous polypeptide that permits the detection, isolation, solubilization, or stabilization of the isolated polypeptide.
48. An immunogenic composition comprising the polypeptide of claim 45.
49. A method of generating an immune response to Brachyspira infection in an animal comprising administering to said animal the polypeptide of claim 45.
50. An immunogenic composition comprising the polypeptide of claim 46.
51. A method of generating an immune response to Brachyspira infection in an animal comprising administering to said animal the polypeptide of claim 46.
52. An immunogenic composition comprising the polypeptide of claim 47.
53. A method of generating an immune response to Brachyspira infection in an animal comprising administering to said animal the polypeptide of claim 47.
Description:
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of U.S. application Ser. No. 12/672,054, filed Jul. 22, 2010, which is a National Stage of International Application No. PCT/EP2007/058049, filed Aug. 3, 2007, both of which are expressly incorporated herein by reference in their entirety.
STATEMENT REGARDING SEQUENCE LISTING
[0002] The sequence listing associated with this application is provided in text format in lieu of a paper copy and is hereby incorporated by reference into the specification. The name of the text file containing the sequence listing is 53179 SEQ_LIST.txt. The text file is 192 KB, was created on Mar. 27, 2015, and is being submitted via EFS-Web with the filing of the specification.
FIELD OF INVENTION
[0003] This invention relates to novel genes in Brachyspira hyodysenteriae and the proteins encoded therein. This invention further relates to use of these novel genes and proteins for diagnosis of B. hyodysenteriae disease, vaccines against B. hyodysenteriae and for screening for compounds that kill B. hyodysenteriae or block the pathogenic effects of B. hyodysenteriae. These sequences may also be useful for diagnostic and therapeutic and/or prophylactic treatment of diseases in animals caused by other Brachyspira species, including B. suanatina, B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. pilosicoli.
BACKGROUND OF INVENTION
[0004] Swine dysentery is a significant endemic disease of pigs in Australia and worldwide. Swine dysentery is a contagious mucohaemorrhagic diarrhoeal disease, characterised by extensive inflammation and necrosis of the epithelial surface of the large intestine. Economic losses due to swine dysentery result mainly from growth retardation, costs of medication and mortality. The causative agent of swine dysentery was first identified as an anaerobic spirochaete (Treponema hyodysenteriae) in 1971, and was recently reassigned to the genus Brachyspira as B. hyodysenteriae. Where swine dysentery is established in a piggery, the disease spectrum can vary from being mild, transient or unapparent, to being severe and even fatal. Medication strategies on individual piggeries may mask clinical signs and on some piggeries the disease may go unnoticed, or may only be suspected. Whether or not obvious disease occurs, B. hyodysenteriae may persist in infected pigs, or in other reservoir hosts such as rodents, or in the environment. All these sources pose potential for transmission of the disease to uninfected herds. Commercial poultry may also be colonized by B. hyodysenteriae, although it is not clear how commonly this occurs under field conditions.
[0005] Colonization by B. hyodysenteriae elicits a strong immunological response against the spirochaete, hence indirect evidence of exposure to the spirochaete can be obtained by measuring circulating antibody titres in the blood of infected animals. These antibody titres have been reported to be maintained at low levels, even in animals that have recovered from swine dysentery. Serological tests for detection of antibodies therefore have considerable potential for detecting subclinical infections and recovered carrier pigs that have undetectable numbers of spirochaetes in their large intestines. These tests would be particularly valuable in an easy to use kit form, such as an enzyme-linked immunosorbent assay. A variety of techniques have been developed to demonstrate the presence of circulating antibodies against B. hyodysenteriae, including indirect fluorescent antibody tests, hemagglutination tests, microtitration agglutination tests, complement fixation tests, and ELISA using either lipopolysaccharide or whole sonicated spirochaetes as antigen. All these tests have suffered from problems of specificity, as related non-pathogenic intestinal spirochaetes can induce cross-reactive antibodies. These tests are useful for detecting herds where there is obvious disease and high circulating antibody titres, but they are problematic for identifying sub-clinically infected herds and individual infected pigs. Consequently, to date, no completely sensitive and specific assays are available for the detection of antibodies against B. hyodysenteriae. The lack of suitable diagnostic tests has hampered control of swine dysentery.
[0006] A number of methods are employed to control swine dysentery, varying from the prophylactic use of antimicrobial agents, to complete destocking of infected herds and prevention of re-entry of infected carrier pigs. All these options are expensive and, if they are to be fully effective, they require the use of sophisticated diagnostic tests to monitor progress. Currently, detection of swine dysentery in herds with sub-clinical infections, and individual healthy carrier animals, remains a major problem and is hampering implementation of effective control measures. A definitive diagnosis of swine dysentery traditionally has required the isolation and identification of B. hyodysenteriae from the faeces or mucosa of diseased pigs. Major problems involved include the slow growth and fastidious nutritional requirements of these anaerobic bacteria and confusion due to the presence of morphologically similar spirochaetes in the normal flora of the pig intestine. A significant improvement in the diagnosis of individual affected pigs was achieved with the development of polymerase chain reaction (PCR) assays for the detection of spirochaetes from faeces. Unfortunately in practical applications the limit of detection of PCRs rendered it unable to detect carrier animals with subclinical infections. As a consequence of these diagnostic problems, there is a clear need to develop a simple and effective diagnostic tool capable of detecting B. hyodysenteriae infection at the herd and individual pig level.
[0007] A strong immunological response is induced against the spirochaete following colonization with B. hyodysenteriae, and pigs recovered from swine dysentery are protected from re-infection. Despite this, attempts to develop vaccines to control swine dysentery have met with very limited success, either because they have provided inadequate protection on a herd basis, or they have been too costly and difficult to produce to make them commercially viable. Bacterin vaccines provide some level of protection, but they tend to be lipopolysaccharide serogroup-specific, which then requires the use of multivalent bacterins. Furthermore they are difficult and costly to produce on a large scale because of the fastidious anaerobic growth requirements of the spirochaete.
[0008] Several attempts have been made to develop attenuated live vaccines for swine dysentery. This approach has the disadvantage that attenuated strains show reduced colonization, and hence cause reduced immune stimulation. There also is reluctance on the part of producers and veterinarians to use live vaccines for swine dysentery because of the possibility of reversion to virulence, especially as very little is known about genetic regulation and organization in B. hyodysenteriae.
[0009] The use of recombinant subunit vaccines is an attractive alternative, since the products would be well-defined (essential for registration purposes), and relatively easy to produce on a large scale. To date the first reported use of a recombinant protein from B. hyodysenteriae as a vaccine candidate (a 38-kilodalton flagellar protein) failed to prevent colonization in pigs. This failure is likely to relate specifically to the particular recombinant protein used, as well as to other more down-stream issues of delivery systems and routes, dose rates, choice of adjuvants etc. (Gabe, J. D., Chang, R. J., Slomiany, R., Andrews, W. H. and McCaman, M. T., (1995) "Isolation of Extracytoplasmic Proteins From Serpulina hyodysenteriae B204 and Molecular Cloning of the flaB1 Gene Encoding A 38-Kilodalton Flagellar Protein," Infection and Immunity 63:142-148). The first reported partially protective recombinant B. hyodysenteriae protein used for vaccination was a 29.7 kDa outer membrane lipoprotein (Bhlp29.7, also referred to as BmpB and BlpA) which had homology with the methionine-binding lipoproteins of various pathogenic bacteria. The use of the his-tagged recombinant Bhlp29.7 protein for vaccination of pigs, followed by experimental challenge with B. hyodysenteriae, resulted in 17-40% of vaccinated pigs developing disease compared to 50-70% of the unvaccinated control pigs developing disease. Since the incidence of disease for the Bhlp29.7 vaccinated pigs was significantly (P=0.047) less than for the control pigs, Bhlp29.7 appeared to have potential as a swine dysentery vaccine component (La, T., Phillips, N.D., Reichel, M. P. and Hampson, D. J. (2004), "Protection of Pigs From Swine Dysentery by Vaccination With Recombinant BmpB, A 29.7 kDa Outer-Membrane Lipoprotein of Brachyspira hyodysenteriae," Veterinary Microbiology 102:97-109). A number of other attempts have been made to identify outer envelope proteins from B. hyodysenteriae that could be used as recombinant vaccine components, but again no successful vaccine has yet been made. A much more global approach to the identification of potentially useful immunogenic recombinant proteins from B. hyodysenteriae is needed.
[0010] To date, only one study using DNA for vaccination has been reported. In this study, the B. hyodysenteriae finA gene, encoding a putative ferritin, was cloned into an E. coli plasmid and the plasmid DNA used to coat gold beads for ballistic vaccination. A murine model for swine dysentery was used to determine the protective nature of vaccination with DNA and/or recombinant protein. Vaccination with recombinant protein induced a good systemic response against ferritin. However, vaccination with DNA induced only a detectable systemic response. Vaccination with DNA followed a boost with recombinant protein induced a systemic immune response to ferritin only after boosting with protein. However, none of the vaccination regimes tested was able to provide the mice with protection against B. hyodysenteriae colonization and the associated lesions. Interestingly, vaccination of the mice with DNA alone resulted in significant exacerbation of disease (Davis, A. J., Smith, S. C., and Moore, R. J. (2005), "The Brachyspira hyodysenteriae ftnA Gene: DNA Vaccination and Real-Time PCR Quantification of Bacteria in a Mouse Model of Disease," Current Microbiology 50:285-291).
BRIEF SUMMARY OF INVENTION
[0011] It is an object of this invention to have novel genes from B. hyodysenteriae and the proteins encoded by those genes. It is a further object of this invention that the novel genes and the proteins encoded by those genes can be used for therapeutic and diagnostic purposes. One can use the genes and/or the proteins in a vaccine against B. hyodysenteriae and to diagnose B. hyodysenteriae infections.
[0012] It is an object of this invention to have novel B. hyodysenteriae genes having the nucleotide sequence contained in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65. It is also an object of this invention to have nucleotide sequences that are identical to SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65 where the percentage identity can be at least 95%, 90%, 85%, 80%, 75% and 70% (and every integer from 100 to 70). This invention also includes a DNA vaccine or DNA immunogenic composition containing the nucleotide sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65 and sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% identical (and every integer from 100 to 70) to these sequences. This invention further includes a diagnostic assay containing DNA having the nucleotide sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65 and sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% identical (and every integer from 100 to 70) to these sequences.
[0013] It is also an object of this invention to have plasmids containing DNA having the sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65; prokaryotic and/or eukaryotic expression vectors containing DNA having the sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65; and a cell containing the plasmids which contain DNA having the sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65.
[0014] It is an object of this invention to have novel B. hyodysenteriae proteins having the amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66. It is another object of this invention to have proteins that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66. It is also an object of this invention for a vaccine or immunogenic composition to contain the proteins having the amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66, or amino acid sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66. It is a further aspect of this invention to have a diagnostic kit containing one or more proteins having a sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66 or that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66.
[0015] It is another aspect of this invention to have nucleotide sequences which encode the proteins having the amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66, and encode the amino acid sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66. The invention also covers plasmids, eukaryotic and prokaryotic expression vectors, and DNA vaccines which contain DNA having a sequence which encodes a protein having the amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66, and encode amino acid sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66. Cells which contain these plasmids and expression vectors are included in this invention.
[0016] This invention includes monoclonal antibodies that bind to proteins having an amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66 or bind to proteins that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66. Diagnostic kits containing the monoclonal antibodies that bind to proteins having an amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66 or bind to proteins that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66 are included in this invention. These diagnostic kits can detect the presence of B. hyodysenteriae in an animal. The animal is preferably any mammal and bird; more preferably, chicken, goose, duck, turkey, parakeet, dog, cat, hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig, monkey, and human.
[0017] The invention also contemplates the method of preventing or treating an infection of B. hyodysenteriae in an animal by administering to an animal a DNA vaccine containing one or more nucleotide sequences listed in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65 or sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% identical (and every integer from 100 to 70) to these sequences. This invention also covers a method of preventing or treating an infection of B. hyodysenteriae in an animal by administering to an animal a vaccine containing one or more proteins having the amino acid sequence containing in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66 or sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to these sequences. The animal is preferably any mammal and bird; more preferably, chicken, goose, duck, turkey, parakeet, dog, cat, hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig, monkey, and human.
[0018] The invention also contemplates the method of generating an immune response in an animal by administering to an animal an immunogenic composition containing one or more nucleotide sequences listed in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65 or sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% identical (and every integer from 100 to 70) to these sequences. This invention also covers a method of generating an immune response in an animal by administering to an animal an immunogenic composition containing one or more proteins having the amino acid sequence containing in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66 or sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to these sequences. The animal is preferably any mammal and bird; more preferably, chicken, goose, duck, turkey, parakeet, dog, cat, hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig, monkey, and human.
DETAILED SUMMARY OF INVENTION
[0019] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
[0020] The term "amino acid" is intended to embrace all molecules, whether natural or synthetic, which include both an amino functionality and an acid functionality and are capable of being included in a polymer of naturally-occurring amino acids. Exemplary amino acids include naturally-occurring amino acids; analogs, derivatives and congeners thereof; amino acid analogs having variant side chains; and all stereoisomers of any of the foregoing.
[0021] An animal can be any mammal or bird. Examples of mammals include dog, cat, hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig, monkey, and human. Examples of birds include chicken, goose, duck, turkey, and parakeet.
[0022] The term "conserved residue" refers to an amino acid that is a member of a group of amino acids having certain common properties. The term "conservative amino acid substitution" refers to the substitution (conceptually or otherwise) of an amino acid from one such group with a different amino acid from the same group. A functional way to define common properties between individual amino acids is to analyze the normalized frequencies of amino acid changes between corresponding proteins of homologous organisms (Schulz, G. E. and R. H. Schinner., "Principles of Protein Structure," Springer-Verlag). According to such analyzes, groups of amino acids may be defined where amino acids within a group exchange preferentially with each other, and therefore resemble each other most in their impact on the overall protein structure (Schulz, G. E. and R. H. Schirmer, "Principles of Protein Structure," Springer-Verlag). Examples of amino acid groups defined in this manner include: (i) a positively-charged group containing Lys, Arg and His, (ii) a negatively-charged group containing Glu and Asp, (iii) an aromatic group containing Phe, Tyr and Trp, (iv) a nitrogen ring group containing His and Trp, (v) a large aliphatic nonpolar group containing Val, Leu and De, (vi) a slightly polar group containing Met and Cys, (vii) a small-residue group containing Ser, Thr, Asp, Asn, Gly, Ala, Glu, Gln and Pro, (viii) an aliphatic group containing Val, Leu, De, Met and Cys, and (ix) a small, hydroxyl group containing Ser and Thr.
[0023] A "fusion protein" or "fusion polypeptide" refers to a chimeric protein as that term is known in the art and may be constructed using methods known in the art. In many examples of fusion proteins, there are two different polypeptide sequences, and in certain cases, there may be more. The polynucleotide sequences encoding the fusion protein may be operably linked in frame so that the fusion protein may be translated correctly. A fusion protein may include polypeptide sequences from the same species or from different species. In various embodiments, the fusion polypeptide may contain one or more amino acid sequences linked to a first polypeptide. In the case where more than one amino acid sequence is fused to a first polypeptide, the fusion sequences may be multiple copies of the same sequence, or alternatively, may be different amino acid sequences. The fusion polypeptides may be fused to the N-terminus, the C-terminus, or the N- and C-terminus of the first polypeptide. Exemplary fusion proteins include polypeptides containing a glutathione S-transferase tag (GST-tag), histidine tag (His-tag), an immunoglobulin domain or an immunoglobulin binding domain.
[0024] The term "isolated polypeptide" refers to a polypeptide, in certain embodiments prepared from recombinant DNA or RNA, or of synthetic origin or natural origin, or some combination thereof, which (1) is not associated with proteins that it is normally found with in nature, (2) is separated from the cell in which it normally occurs, (3) is free of other proteins from the same cellular source, (4) is expressed by a cell from a different species, or (5) does not occur in nature. It is possible for an isolated polypeptide to exist, but not qualify as a purified polypeptide.
[0025] The terms "isolated nucleic acid" and "isolated polynucleotide" refer to a polynucleotide whether genomic DNA, cDNA, mRNA, tRNA, rRNA, iRNA, or a polynucleotide obtained from a cellular organelle (such as mitochondria and chloroplast), or whether from synthetic origin, which (1) is not associated with the cell in which the "isolated nucleic acid" is found in nature, or (2) is operably linked to a polynucleotide to which it is not linked in nature. It is possible for an isolated polynucleotide to exist, but not qualify as a purified polynucleotide.
[0026] The terms "nucleic acid" and "polynucleotide" refer to a polymeric form of nucleotides, either ribonucleotides or deoxyribonucleotides or a modified form of either type of nucleotide. The terms should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs and, as applicable to the embodiment being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides.
[0027] The terms "nucleic acid of the invention" and "polynucleotide of the invention" refer to a nucleic acid encoding a polypeptide of the invention. A polynucleotide of the invention may comprise all, or a portion of, a subject nucleic acid sequence; a nucleotide sequence at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identical to a subject nucleic acid sequence (and every integer between 60 and 100); a nucleotide sequence that hybridizes under stringent conditions to a subject nucleic acid sequence; nucleotide sequences encoding polypeptides that are functionally equivalent to polypeptides of the invention; nucleotide sequences encoding polypeptides at least about 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99% homologous or identical with a subject amino acid sequence (and every integer between 60 and 100); nucleotide sequences encoding polypeptides having an activity of a polypeptide of the invention and having at least about 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99% or more homology or identity with a subject amino acid sequence (and every integer between 60 and 100); nucleotide sequences that differ by 1 to about 2, 3, 5, 7, 10, 15, 20, 30, 50, 75 or more nucleotide substitutions, additions or deletions, such as allelic variants, of a subject nucleic acid sequence; nucleic acids derived from and evolutionarily related to a subject nucleic acid sequence; and complements of and nucleotide sequences resulting from the degeneracy of the genetic code, for all of the foregoing and other nucleic acids of the invention. Nucleic acids of the invention also include homologs, e.g., orthologs and paralogs, of a subject nucleic acid sequence and also variants of a subject nucleic acid sequence which have been codon optimized for expression in a particular organism (e.g., host cell).
[0028] The term "operably linked," when describing the relationship between two nucleic acid regions, refers to a juxtaposition wherein the regions are in a relationship permitting them to function in their intended manner. For example, a control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences, such as when the appropriate molecules (e.g., inducers and polymerases) are bound to the control or regulatory sequence(s).
[0029] The term "polypeptide" and the terms "protein" and "peptide" which are used interchangeably herein, refer to a polymer of amino acids. Exemplary polypeptides include gene products, naturally-occurring proteins, homologs, orthologs, paralogs, fragments, and other equivalents, variants and analogs of the foregoing.
[0030] The terms "polypeptide fragment" or "fragment," when used in reference to a reference polypeptide, refer to a polypeptide in which amino acid residues are deleted as compared to the reference polypeptide itself, but where the remaining amino acid sequence is usually identical to the corresponding positions in the reference polypeptide. Such deletions may occur at the amino-terminus or carboxy-terminus of the reference polypeptide, or alternatively both. Fragments typically are at least 5, 6, 8, or 10 amino acids long, at least 14 amino acids long, at least 20, 30, 40, or 50 amino acids long, at least 75 amino acids long, or at least 100, 150, 200, 300, 500 or more amino acids long.
[0031] A fragment can retain one or more of the biological activities of the reference polypeptide. In certain embodiments, a fragment may comprise a domain having the desired biological activity, and optionally additional amino acids on one or both sides of the domain, which additional amino acids may number from 5, 10, 15, 20, 30, 40, 50, or up to 100 or more residues. Further, fragments can include a sub-fragment of a specific region, which sub-fragment retains a function of the region from which it is derived. In another embodiment, a fragment may have immunogenic properties.
[0032] The term "polypeptide of the invention" refers to a polypeptide containing a subject amino acid sequence, or an equivalent or fragment thereof. Polypeptides of the invention include polypeptides containing all or a portion of a subject amino acid sequence; a subject amino acid sequence with 1 to about 2, 3, 5, 7, 10, 15, 20, 30, 50, 75 or more conservative amino acid substitutions; an amino acid sequence that is at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% homologous to a subject amino acid sequence (and every integer between 60 and 100); and functional fragments thereof. Polypeptides of the invention also include homologs, e.g., orthologs and paralogs, of a subject amino acid sequence.
[0033] It is also possible to modify the structure of the polypeptides of the invention for such purposes as enhancing therapeutic or prophylactic efficacy, or stability (e.g., ex vivo shelf life, resistance to proteolytic degradation in vivo, etc.). Such modified polypeptides, when designed to retain at least one activity of the naturally-occurring form of the protein, are considered "functional equivalents" of the polypeptides described in more detail herein. Such modified polypeptides may be produced, for instance, by amino acid substitution, deletion, or addition, which substitutions may consist in whole or in part by conservative amino acid substitutions.
[0034] For instance, it is reasonable to expect that an isolated conservative amino acid substitution, such as replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine, will not have a major effect on the biological activity of the resulting molecule. Whether a change in the amino acid sequence of a polypeptide results in a functional homolog may be readily determined by assessing the ability of the variant polypeptide to produce a response similar to that of the wild-type protein. Polypeptides in which more than one replacement has taken place may readily be tested in the same manner.
[0035] The term "purified" refers to an object species that is the predominant species present (i.e., on a molar basis it is more abundant than any other individual species in the composition). A "purified fraction" is a composition wherein the object species is at least about 50 percent (on a molar basis) of all species present. In making the determination of the purity of a species in solution or dispersion, the solvent or matrix in which the species is dissolved or dispersed is usually not included in such determination; instead, only the species (including the one of interest) dissolved or dispersed are taken into account. Generally, a purified composition will have one species that is more than about 80% of all species present in the composition, more than about 85%, 90%, 95%, 99% or more of all species present. The object species may be purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition is essentially a single species. A skilled artisan may purify a polypeptide of the invention using standard techniques for protein purification in light of the teachings herein. Purity of a polypeptide may be determined by a number of methods known to those of skill in the art, including for example, amino-terminal amino acid sequence analysis, gel electrophoresis, mass-spectrometry analysis and the methods described herein.
[0036] The terms "recombinant protein" or "recombinant polypeptide" refer to a polypeptide which is produced by recombinant DNA techniques. An example of such techniques includes the case when DNA encoding the expressed protein is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the protein or polypeptide encoded by the DNA.
[0037] The term "regulatory sequence" is a generic term used throughout the specification to refer to polynucleotide sequences, such as initiation signals, enhancers, regulators and promoters, that are necessary or desirable to affect the expression of coding and non-coding sequences to which they are operably linked. Exemplary regulatory sequences are described in Goeddel, "Gene Expression Technology: Methods in Enzymology," Academic Press, San Diego, Calif. (1990), and include, for example, the early and late promoters of SV40, adenovirus or cytomegalovirus immediate early promoter, the lac system, the trp system, the TAC or TRC system, T7 promoter whose expression is directed by T7 RNA polymerase, the major operator and promoter regions of phage lambda, the control regions for fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase (e.g., PhoS), the promoters of the yeast α-mating factors, the polyhedron promoter of the baculovirus system and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof. The nature and use of such control sequences may differ depending upon the host organism. In prokaryotes, such regulatory sequences generally include promoter, ribosomal binding site, and transcription termination sequences. The term "regulatory sequence" is intended to include, at a minimum, components whose presence may influence expression, and may also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences. In certain embodiments, transcription of a polynucleotide sequence is under the control of a promoter sequence (or other regulatory sequence) which controls the expression of the polynucleotide in a cell-type in which expression is intended. It will also be understood that the polynucleotide can be under the control of regulatory sequences which are the same or different from those sequences which control expression of the naturally-occurring form of the polynucleotide.
[0038] The term "sequence homology" refers to the proportion of base matches between two nucleic acid sequences or the proportion of amino acid matches between two amino acid sequences. When sequence homology is expressed as a percentage, e.g., 50%, the percentage denotes the proportion of matches over the length of sequence from a desired sequence that is compared to some other sequence. Gaps (in either of the two sequences) are permitted to maximize matching; gap lengths of 15 bases or less are usually used, 6 bases or less are used more frequently, with 2 bases or less used even more frequently. The term "sequence identity" means that sequences are identical (i.e., on a nucleotide-by-nucleotide basis for nucleic acids or amino acid-by-amino acid basis for polypeptides) over a window of comparison. The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the comparison window, determining the number of positions at which the identical amino acids or nucleotides occur in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percentage of sequence identity. Methods to calculate sequence identity are known to those of skill in the art and described in further detail below.
[0039] The term "soluble" as used herein with reference to a polypeptide of the invention or other protein, means that upon expression in cell culture, at least some portion of the polypeptide or protein expressed remains in the cytoplasmic fraction of the cell and does not fractionate with the cellular debris upon lysis and centrifugation of the lysate. Solubility of a polypeptide may be increased by a variety of art recognized methods, including fusion to a heterologous amino acid sequence, deletion of amino acid residues, amino acid substitution (e.g., enriching the sequence with amino acid residues having hydrophilic side chains), and chemical modification (e.g., addition of hydrophilic groups).
[0040] The solubility of polypeptides may be measured using a variety of art recognized techniques, including dynamic light scattering to determine aggregation state, UV absorption, centrifugation to separate aggregated from non-aggregated material, and SDS gel electrophoresis (e.g., the amount of protein in the soluble fraction is compared to the amount of protein in the soluble and insoluble fractions combined). When expressed in a host cell, the polypeptides of the invention may be at least about 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more soluble, e.g., at least about 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the total amount of protein expressed in the cell is found in the cytoplasmic fraction. In certain embodiments, a one liter culture of cells expressing a polypeptide of the invention will produce at least about 0.1, 0.2, 0.5, 1, 2, 5, 10, 20, 30, 40, or 50 milligrams of more of soluble protein. In an exemplary embodiment, a polypeptide of the invention is at least about 10% soluble and will produce at least about 1 milligram of protein from a one liter cell culture.
[0041] The term "specifically hybridizes" refers to detectable and specific nucleic acid binding. Polynucleotides, oligonucleotides and nucleic acids of the invention selectively hybridize to nucleic acid strands under hybridization and wash conditions that minimize appreciable amounts of detectable binding to nonspecific nucleic acids. Stringent conditions may be used to achieve selective hybridization conditions as known in the art and discussed herein. Generally, the nucleic acid sequence identity between the polynucleotides, oligonucleotides, and nucleic acids of the invention and a nucleic acid sequence of interest will be at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99% or more (and every integer between 30 and 100). In certain instances, hybridization and washing conditions are performed under stringent conditions according to conventional hybridization procedures and as described further herein.
[0042] The terms "stringent conditions" or "stringent hybridization conditions" refer to conditions which promote specific hybridization between two complementary polynucleotide strands so as to form a duplex. Stringent conditions may be selected to be about 5° C. lower than the thermal melting point (Tm) for a given polynucleotide duplex at a defined ionic strength and pH. The length of the complementary polynucleotide strands and their GC content will determine the Tm of the duplex, and thus the hybridization conditions necessary for obtaining a desired specificity of hybridization. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a polynucleotide sequence hybridizes to a perfectly matched complementary strand. In certain cases it may be desirable to increase the stringency of the hybridization conditions to be about equal to the Tm for a particular duplex.
[0043] A variety of techniques for estimating the Tm are available. Typically, G-C base pairs in a duplex are estimated to contribute about 3° C. to the Tm, while A-T base pairs are estimated to contribute about 2° C., up to a theoretical maximum of about 80-100° C.
[0044] However, more sophisticated models of Tm are available in which G-C stacking interactions, solvent effects, the desired assay temperature and the like are taken into account. For example, probes can be designed to have a dissociation temperature (Td) of approximately 60° C., using the formula: Td=(((3×#GC)+(2×#AT))×37)-562)/#bp)-5; where #GC, #AT, and #bp are the number of guanine-cytosine base pairs, the number of adenine-thymine base pairs, and the number of total base pairs, respectively, involved in the formation of the duplex.
[0045] Hybridization may be carried out in 5×SSC, 4×SSC, 3×SSC, 2×SSC, 1×SSC or 0.2×SSC for at least about 1 hour, 2 hours, 5 hours, 12 hours, or 24 hours. The temperature of the hybridization may be increased to adjust the stringency of the reaction, for example, from about 25° C. (room temperature), to about 45° C., 50° C., 55° C., 60° C., or 65° C. The hybridization reaction may also include another agent affecting the stringency, for example, hybridization conducted in the presence of 50% formamide increases the stringency of hybridization at a defined temperature.
[0046] The hybridization reaction may be followed by a single wash step, or two or more wash steps, which may be at the same or a different salinity and temperature. For example, the temperature of the wash may be increased to adjust the stringency from about 25° C. (room temperature), to about 45° C., 50° C., 55° C., 60° C., 65° C. or higher. The wash step may be conducted in the presence of a detergent, e.g., 0.1% or 0.2% SDS. For example, hybridization may be followed by two wash steps at 65° C. each for about 20 minutes in 2×SSC, 0.1% SDS, and optionally two additional wash steps at 65° C. each for about 20 minutes in 0.2×SSC, 0.1% SDS.
[0047] Exemplary stringent hybridization conditions include overnight hybridization at 65° C. in a solution containing 50% formamide, 10×Denhardt (0.2% Ficoll, 0.2% polyvinylpyrrolidone, 0.2% bovine serum albumin) and 200 μg/ml of denatured carrier DNA, e.g., sheared salmon sperm DNA, followed by two wash steps at 65° C. each for about 20 minutes in 2×SSC, 0.1% SDS, and two wash steps at 65° C. each for about 20 minutes in 0.2×SSC, 0.1% SDS.
[0048] Hybridization may consist of hybridizing two nucleic acids in solution, or a nucleic acid in solution to a nucleic acid attached to a solid support, e.g., a filter. When one nucleic acid is on a solid support, a prehybridization step may be conducted prior to hybridization. Prehybridization may be carried out for at least about 1 hour, 3 hours or 10 hours in the same solution and at the same temperature as the hybridization solution (without the complementary polynucleotide strand).
[0049] Appropriate stringency conditions are known to those skilled in the art or may be determined experimentally by the skilled artisan. See, for example, Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-12.3.6; Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; S. Agrawal (ed.) Methods in Molecular Biology, Volume 20; Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology--Hybridization With Nucleic Acid Probes, e.g., part I chapter 2, "Overview of Principles of Hybridization and the Strategy of Nucleic Acid Probe Assays", Elsevier, New York; and Tibanyenda, N. et al., Eur. J. Biochem. 139:19 (1984) and Ebel, S. et al., Biochem. 31:12083 (1992).
[0050] The term "vector" refers to a nucleic acid capable of transporting another nucleic acid to which it has been linked. One type of vector which may be used in accord with the invention is an episome, i.e., a nucleic acid capable of extra-chromosomal replication. Other vectors include those capable of autonomous replication and expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer to circular double stranded DNA molecules which, in their vector form are not bound to the chromosome. In the present specification, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
[0051] The nucleic acids of the invention may be used as diagnostic reagents to detect the presence or absence of the target DNA or RNA sequences to which they specifically bind, such as for determining the level of expression of a nucleic acid of the invention. In one aspect, the present invention contemplates a method for detecting the presence of a nucleic acid of the invention or a portion thereof in a sample, the method of the steps of: (a) providing an oligonucleotide at least eight nucleotides in length, the oligonucleotide being complementary to a portion of a nucleic acid of the invention; (b) contacting the oligonucleotide with a sample containing at least one nucleic acid under conditions that permit hybridization of the oligonucleotide with a nucleic acid of the invention or a portion thereof; and (c) detecting hybridization of the oligonucleotide to a nucleic acid in the sample, thereby detecting the presence of a nucleic acid of the invention or a portion thereof in the sample. In another aspect, the present invention contemplates a method for detecting the presence of a nucleic acid of the invention or a portion thereof in a sample, by: (a) providing a pair of single stranded oligonucleotides, each of which is at least eight nucleotides in length, complementary to sequences of a nucleic acid of the invention, and wherein the sequences to which the oligonucleotides are complementary are at least ten nucleotides apart; (b) contacting the oligonucleotides with a sample containing at least one nucleic acid under hybridization conditions; (c) amplifying the nucleotide sequence between the two oligonucleotide primers; and (d) detecting the presence of the amplified sequence, thereby detecting the presence of a nucleic acid of the invention or a portion thereof in the sample.
[0052] In another aspect of the invention, the polynucleotide of the invention is provided in an expression vector containing a nucleotide sequence encoding a polypeptide of the invention and operably linked to at least one regulatory sequence. It should be understood that the design of the expression vector may depend on such factors as the choice of the host cell to be transformed and/or the type of protein desired to be expressed. The vector's copy number, the ability to control that copy number, and the expression of any other protein encoded by the vector, such as antibiotic markers, should be considered.
[0053] An expression vector containing the polynucleotide of the invention can then be used as a pharmaceutical agent to treat an animal infected with B. hyodysenteriae or as a vaccine (also a pharmaceutical agent) to prevent an animal from being infected with B. hyodysenteriae, or to reduce the symptoms and course of the disease if the animal does become infected. One manner of using an expression vector as a pharmaceutical agent is to administer a nucleic acid vaccine to the animal at risk of being infected or to the animal after being infected. Nucleic acid vaccine technology is well-described in the art. Some descriptions can be found in U.S. Pat. No. 6,562,376 (Hooper et al.); U.S. Pat. No. 5,589,466 (Feigner, et al.); U.S. Pat. No. 6,673,776 (Feigner, et al.); and U.S. Pat. No. 6,710,035 (Feigner, et al.). Nucleic acid vaccines can be injected into muscle or intradermally, can be electroporated into the animal (see WO 01/23537, King et al.; and WO 01/68889, Malone et al.), via lipid compositions (see U.S. Pat. No. 5,703,055, Feigner, et al.), or other mechanisms known in the art.
[0054] Expression vectors can also be transfected into bacteria which can be administered to the target animal to induce an immune response to the protein encoded by the nucleotides of this invention contained on the expression vector. The expression vector can contain eukaryotic expression sequences such that the nucleotides of this invention are transcribed and translated in the host animal. Alternatively, the expression vector can be transcribed in the bacteria and then translated in the host animal. The bacteria used as a carrier of the expression vector should be attenuated, but still invasive. One can use Shigella spp., Salmonella spp., Escherichia spp., and Aeromonas spp., just to name a few, that have been attenuated, but still invasive. Examples of these methods can be found in U.S. Pat. No. 5,824,538 (Branstrom et al.); U.S. Pat. No. 5,877,159 (Powell, et al.); U.S. Pat. No. 6,150,170 (Powell, et al.); U.S. Pat. No. 6,500,419 (Hone, et al.); and U.S. Pat. No. 6,682,729 (Powell, et al.).
[0055] Alternatively, the polynucleotides of this invention can be placed in certain viruses which act a vector. Viral vectors can either express the proteins of this invention on the surface of the virus, or carry polynucleotides of this invention into an animal cell where the polynucleotide is transcribed and translated into a protein. The animal infected with the viral vectors can develop an immune response to the proteins encoded by the polynucleotides of this invention. Thereby, one can alleviate or prevent an infection by B. hyodysenteriae in the animal which received the viral vectors. Examples of viral vectors can be found U.S. Pat. No. 5,283,191 (Morgan et al.); U.S. Pat. No. 5,554,525 (Sondermeijer et al.) and U.S. Pat. No. 5,712,118 (Murphy).
[0056] The polynucleotide of the invention may be used to cause expression and over-expression of a polypeptide of the invention in cells propagated in culture, e.g., to produce proteins or polypeptides, including fusion proteins or polypeptides.
[0057] This invention pertains to a host cell transfected with a recombinant gene in order to express a polypeptide of the invention. The host cell may be any prokaryotic or eukaryotic cell. For example, a polypeptide of the invention may be expressed in bacterial cells, such as E. coli, insect cells (baculovirus), yeast, plant, or mammalian cells. In those instances, when the host cell is human, it may or may not be in a live subject. Other suitable host cells are known to those skilled in the art. Additionally, the host cell may be supplemented with tRNA molecules not typically found in the host so as to optimize expression of the polypeptide. Alternatively, the nucleotide sequence may be altered to optimize expression in the host cell, yet the protein produced would have high homology to the originally encoded protein. Other methods suitable for maximizing expression of the polypeptide will be known to those in the art.
[0058] The present invention further pertains to methods of producing the polypeptides of the invention. For example, a host cell transfected with an expression vector encoding a polypeptide of the invention may be cultured under appropriate conditions to allow expression of the polypeptide to occur. The polypeptide may be secreted and isolated from a mixture of cells and medium containing the polypeptide. Alternatively, the polypeptide may be retained cytoplasmically and the cells harvested, lysed and the protein isolated.
[0059] A cell culture includes host cells, media and other byproducts. Suitable media for cell culture are well-known in the art. The polypeptide may be isolated from cell culture medium, host cells, or both using techniques known in the art for purifying proteins, including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies specific for particular epitopes of a polypeptide of the invention.
[0060] Thus, a nucleotide sequence encoding all or a selected portion of polypeptide of the invention may be used to produce a recombinant form of the protein via microbial or eukaryotic cellular processes. Ligating the sequence into a polynucleotide construct, such as an expression vector, and transforming or transfecting into hosts, either eukaryotic (yeast, avian, insect or mammalian) or prokaryotic (bacterial cells) are standard procedures. Similar procedures, or modifications thereof, may be employed to prepare recombinant polypeptides of the invention by microbial means or tissue-culture technology.
[0061] Suitable vectors for the expression of a polypeptide of the invention include plasmids of the types: pTrcHis-derived plasmids, pET-derived plasmids, pBR322-derived plasmids, pEMBL-derived plasmids, pEX-derived plasmids, pBTac-derived plasmids and pUC-derived plasmids for expression in prokaryotic cells, such as E. coli. The various methods employed in the preparation of the plasmids and transformation of host organisms are well-known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells, as well as general recombinant procedures, see Molecular Cloning, A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press, 1989) Chapters 16 and 17.
[0062] Coding sequences for a polypeptide of interest may be incorporated as a part of a fusion gene including a nucleotide sequence encoding a different polypeptide. The present invention contemplates an isolated polynucleotide containing a nucleic acid of the invention and at least one heterologous sequence encoding a heterologous peptide linked in frame to the nucleotide sequence of the nucleic acid of the invention so as to encode a fusion protein containing the heterologous polypeptide. The heterologous polypeptide may be fused to (a) the C-terminus of the polypeptide of the invention, (b) the N-terminus of the polypeptide of the invention, or (c) the C-terminus and the N-terminus of the polypeptide of the invention. In certain instances, the heterologous sequence encodes a polypeptide permitting the detection, isolation, solubilization and/or stabilization of the polypeptide to which it is fused. In still other embodiments, the heterologous sequence encodes a polypeptide such as a poly His tag, myc, HA, GST, protein A, protein G, calmodulin-binding peptide, thioredoxin, maltose-binding protein, poly arginine, poly His-Asp, FLAG, a portion of an immunoglobulin protein, and a transcytosis peptide.
[0063] Fusion expression systems can be useful when it is desirable to produce an immunogenic fragment of a polypeptide of the invention. For example, the VP6 capsid protein of rotavirus may be used as an immunologic carrier protein for portions of polypeptide, either in the monomeric form or in the form of a viral particle. The nucleic acid sequences corresponding to the portion of a polypeptide of the invention to which antibodies are to be raised may be incorporated into a fusion gene construct which includes coding sequences for a late vaccinia virus structural protein to produce a set of recombinant viruses expressing fusion proteins comprising a portion of the protein as part of the virion. The Hepatitis B surface antigen may also be utilized in this role as well. Similarly, chimeric constructs coding for fusion proteins containing a portion of a polypeptide of the invention and the poliovirus capsid protein may be created to enhance immunogenicity (see, for example, EP Publication NO: 0259149; and Evans et al., (1989) Nature 339:385; Huang et al., (1988) J. Virol. 62:3855; and Schlienger et al., (1992) J. Virol. 66:2).
[0064] Fusion proteins may facilitate the expression and/or purification of proteins. For example, a polypeptide of the invention may be generated as a glutathione-S-transferase (GST) fusion protein. Such GST fusion proteins may be used to simplify purification of a polypeptide of the invention, such as through the use of glutathione-derivatized matrices (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al., (N.Y.: John Wiley & Sons, 1991)). In another embodiment, a fusion gene coding for a purification leader sequence, such as a poly-(His)/enterokinase cleavage site sequence at the N-terminus of the desired portion of the recombinant protein, may allow purification of the expressed fusion protein by affinity chromatography using a Ni2+ metal resin. The purification leader sequence may then be subsequently removed by treatment with enterokinase to provide the purified protein (e.g., see Hochuli et al., (1987) J. Chromatography 411:177; and Janknecht et al., PNAS USA 88:8972).
[0065] Techniques for making fusion genes are well-known. Essentially, the joining of various DNA fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene may be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments may be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which may subsequently be annealed to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al., John Wiley & Sons: 1992).
[0066] In other embodiments, the invention provides for nucleic acids of the invention immobilized onto a solid surface, including, plates, microtiter plates, slides, beads, particles, spheres, films, strands, precipitates, gels, sheets, tubing, containers, capillaries, pads, slices, etc. The nucleic acids of the invention may be immobilized onto a chip as part of an array. The array may contain one or more polynucleotides of the invention as described herein. In one embodiment, the chip contains one or more polynucleotides of the invention as part of an array of polynucleotide sequences from the same pathogenic species as such polynucleotide(s).
[0067] In a preferred form of the invention there is provided isolated B. hyodysenteriae polypeptides as herein described, and also the polynucleotide sequences encoding these polypeptides. More desirably the B. hyodysenteriae polypeptides are provided in substantially purified form.
[0068] Preferred polypeptides of the invention will have one or more biological properties (e.g., in vivo, in vitro or immunological properties) of the native full-length polypeptide. Non-functional polypeptides are also included within the scope of the invention because they may be useful, for example, as antagonists of the functional polypeptides. The biological properties of analogues, fragments, or derivatives relative to wild type may be determined, for example, by means of biological assays.
[0069] Polypeptides, including analogues, fragments and derivatives, can be prepared synthetically (e.g., using the well-known techniques of solid phase or solution phase peptide synthesis). Preferably, solid phase synthetic techniques are employed. Alternatively, the polypeptides of the invention can be prepared using well-known genetic engineering techniques, as described infra. In yet another embodiment, the polypeptides can be purified (e.g., by immunoaffinity purification) from a biological fluid, such as but not limited to plasma, faeces, serum, or urine from animals, including, but not limited to, pig, chicken, goose, duck, turkey, parakeet, human, monkey, dog, cat, horse, hamster, gerbil, rabbit, ferret, horse, cattle, and sheep. An animal can be any mammal or bird.
[0070] The B. hyodysenteriae polypeptide analogues include those polypeptides having the amino acid sequence, wherein one or more of the amino acids are substituted with another amino acid which substitutions do not substantially alter the biological activity of the molecule.
[0071] According to the invention, the polypeptides of the invention produced recombinantly or by chemical synthesis and fragments or other derivatives or analogues thereof, including fusion proteins, may be used as an immunogen to generate antibodies that recognize the polypeptides.
[0072] A molecule is "antigenic" when it is capable of specifically interacting with an antigen recognition molecule of the immune system, such as an immunoglobulin (antibody) or T cell antigen receptor. An antigenic amino acid sequence contains at least about 5, and preferably at least about 10, amino acids. An antigenic portion of a molecule can be the portion that is immunodominant for antibody or T cell receptor recognition, or it can be a portion used to generate an antibody to the molecule by conjugating the antigenic portion to a carrier molecule for immunization. A molecule that is antigenic need not be itself immunogenic, i.e., capable of eliciting an immune response without a carrier.
[0073] An "antibody" is any immunoglobulin, including antibodies and fragments thereof, that binds a specific epitope. The term encompasses polyclonal, monoclonal, and chimeric antibodies, the last mentioned described in further detail in U.S. Pat. Nos. 4,816,397 and 4,816,567, as well as antigen binding portions of antibodies, including Fab, F(ab')2 and F(v) (including single chain antibodies). Accordingly, the phrase "antibody molecule" in its various grammatical forms as used herein contemplates both an intact immunoglobulin molecule and an immunologically active portion of an immunoglobulin molecule containing the antibody combining site. An "antibody combining site" is that structural portion of an antibody molecule comprised of heavy and light chain variable and hypervariable regions that specifically binds an antigen.
[0074] Exemplary antibody molecules are intact immunoglobulin molecules, substantially intact immunoglobulin molecules and those portions of an immunoglobulin molecule that contain the paratope, including those portions known in the art as Fab, Fab', F(ab')2 and F(v), which portions are preferred for use in the therapeutic methods described herein.
[0075] Fab and F(ab')2 portions of antibody molecules are prepared by the proteolytic reaction of papain and pepsin, respectively, on substantially intact antibody molecules by methods that are well-known. See for example, U.S. Pat. No. 4,342,566 to Theofilopolous el al. Fab' antibody molecule portions are also well-known and are produced from F(ab')2 portions followed by reduction with mercaptoethanol of the disulfide bonds linking the two heavy chain portions, and followed by alkylation of the resulting protein mercaptan with a reagent such as iodoacetamide. An antibody containing intact antibody molecules is preferred herein.
[0076] The phrase "monoclonal antibody" in its various grammatical forms refers to an antibody having only one species of antibody combining site capable of immunoreacting with a particular antigen. A monoclonal antibody thus typically displays a single binding affinity for any antigen with which it immunoreacts. A monoclonal antibody may therefore contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different antigen; e.g., a bispecific (chimeric) monoclonal antibody.
[0077] The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. An adjuvant can serve as a tissue depot that slowly releases the antigen and also as a lymphoid system activator that non-specifically enhances the immune response (Hood et al., in Immunology, p. 384, Second Ed., Benjamin/Cummings, Menlo Park, Calif. (1984)). Often, a primary challenge with an antigen alone, in the absence of an adjuvant, is it will fail to elicit a humoral or cellular immune response. Adjuvants include, but are not limited to, complete Freund's adjuvant, incomplete Freund's adjuvant, saponin, mineral gels such as aluminium hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum. Preferably, the adjuvant is pharmaceutically acceptable.
[0078] Various procedures known in the art may be used for the production of polyclonal antibodies to the polypeptides of the invention. For the production of antibody, various host animals can be immunised by injection with the polypeptide of the invention, including, but not limited to rabbits, mice, rats, sheep, goats, etc. In one embodiment, a polypeptide of the invention can be conjugated to an immunogenic carrier, e.g., bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH). Various adjuvants may be used to increase the immunological response, depending on the host species, including, but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
[0079] For preparation of monoclonal antibodies directed toward a polypeptide of the invention, any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used. These include, but are not limited to the hybridoma technique originally developed by Kohler et al., (1975) Nature, 256:495-497, the trioma technique, the human B-cell hybridoma technique (Kozbor et al., (1983) Immunology Today, 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., (1985) in Monoclonal Antibodies and Cancer Therapy, pp. 77-96, Alan R. Liss, Inc.). Immortal, antibody-producing cell lines can be created by techniques other than fusion, such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. See, e.g., U.S. Pat. Nos. 4,341,761; 4,399,121; 4,427,783; 4,444,887; 4,451,570; 4,466,917; 4,472,500; 4,491,632; and 4,493,890.
[0080] In an additional embodiment of the invention, monoclonal antibodies can be produced in germ-free animals utilizing recent technology. According to the invention, chicken or swine antibodies may be used and can be obtained by using chicken or swine hybridomas or by transforming B cells with EBV virus in vitro. In fact, according to the invention, techniques developed for the production of "chimeric antibodies" (Morrison et al., (1984) J. Bacteriol. 159-870; Neuberger et al., (1984) Nature 312:604-608; Takeda et al., (1985) Nature 314:452-454) by splicing the genes from a mouse antibody molecule specific for a polypeptide of the invention together with genes from an antibody molecule of appropriate biological activity can be used; such antibodies are within the scope of this invention. Such chimeric antibodies are preferred for use in therapy of intestinal diseases or disorders (described infra), since the antibodies are much less likely than xenogenic antibodies to induce an immune response, in particular an allergic response, themselves.
[0081] According to the invention, techniques described for the production of single chain antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce single chain antibodies specific for a polypeptide of the invention. An additional embodiment of the invention utilizes the techniques described for the construction of Fab expression libraries (Huse et al., (1989) Science 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for a polypeptide of the invention.
[0082] Antibody fragments, which contain the idiotype of the antibody molecule, can be generated by known techniques. For example, such fragments include, but are not limited to: the F(ab')2 fragment which can be produced by pepsin digestion of the antibody molecule, the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragment, and the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent.
[0083] In the production of antibodies, screening for the desired antibody can be accomplished by techniques known in the art, e.g., radioimmunoassay, ELISA, "sandwich" immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), Western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, immunoelectrophoresis assays, etc. In one embodiment, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labeled. Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention. For example, to select antibodies that recognize a specific epitope of a polypeptide of the invention, one may assay generated hybridomas for a product that binds to a fragment of a polypeptide of the invention containing such epitope.
[0084] The invention also covers diagnostic and prognostic methods to detect the presence of B. hyodysenteriae using a polypeptide of the invention and/or antibodies which bind to the polypeptide of the invention and kits useful for diagnosis and prognosis of B. hyodysenteriae infections.
[0085] Diagnostic and prognostic methods will generally be conducted using a biological sample obtained from an animal, such as chicken or swine. A "sample" refers to an animal's tissue or fluid suspected of containing a Brachyspira species, such as B. hyodysenteriae, or its polynucleotides or its polypeptides. Examples of such tissue or fluids include, but are not limited to plasma, serum, fecal material, urine, lung, heart, skeletal muscle, stomach, intestines, and in vitro cell culture constituents.
[0086] The invention provides methods for detecting the presence of a polypeptide of the invention in a sample, with the following steps: (a) contacting a sample suspected of containing a polypeptide of the invention with an antibody (preferably bound to a solid support) that specifically binds to the polypeptide of the invention under conditions which allow for the formation of reaction complexes comprising the antibody and the polypeptide of the invention; and (b) detecting the formation of reaction complexes comprising the antibody and polypeptide of the invention in the sample, wherein detection of the formation of reaction complexes indicates the presence of the polypeptide of the invention in the sample.
[0087] Preferably, the antibody used in this method is derived from an affinity-purified polyclonal antibody, and more preferably a monoclonal antibody. In addition, it is preferable for the antibody molecules used herein be in the form of Fab, Fab', F(ab')2 or F(v) portions or whole antibody molecules.
[0088] Particularly preferred methods for detecting B. hyodysenteriae based on the above method include enzyme linked immunosorbent assays, radioimmunoassays, immunoradiometric assays and immunoenzymatic assays, including sandwich assays using monoclonal and/or polyclonal antibodies.
[0089] Three such procedures that are especially useful utilize either polypeptide of the invention (or a fragment thereof) labeled with a detectable label, antibody Ab1 labeled with a detectable label, or antibody Ab2 labeled with a detectable label. The procedures may be summarized by the following equations wherein the asterisk indicates that the particle is labeled and "AA" stands for the polypeptide of the invention:
AA*+Ab1=AA*Ab1 A.
AA+Ab*1=AA Ab1* B.
AA+Ab1+Ab2*=Ab1AA Ab2* C.
[0090] The procedures and their application are all familiar to those skilled in the art and accordingly may be utilized within the scope of the present invention. The "competitive" procedure, Procedure A, is described in U.S. Pat. Nos. 3,654,090 and 3,850,752. Procedure B is representative of well-known competitive assay techniques. Procedure C, the "sandwich" procedure, is described in U.S. patent Nos. RE 31,006 and 4,016,043. Still other procedures are known, such as the "double antibody" or "DASP" procedure, and can be used.
[0091] In each instance, the polypeptide of the invention forms complexes with one or more antibody(ies) or binding partners and one member of the complex is labeled with a detectable label. The fact that a complex has formed and, if desired, the amount thereof, can be determined by known methods applicable to the detection of labels.
[0092] It will be seen from the above, that a characteristic property of Ab2 is that it will react with Ab1. This reaction is because Ab1, raised in one mammalian species, has been used in another species as an antigen to raise the antibody, Ab2. For example, Ab2 may be raised in goats using rabbit antibodies as antigens. Ab2 therefore would be anti-rabbit antibody raised in goats. For purposes of this description and claims, Ab1 will be referred to as a primary antibody, and Ab2 will be referred to as a secondary or anti-Abp antibody.
[0093] The labels most commonly employed for these studies are radioactive elements, enzymes, chemicals that fluoresce when exposed to ultraviolet light, and others. Examples of fluorescent materials capable of being utilized as labels include fluorescein, rhodamine and auramine. A particular detecting material is anti-rabbit antibody prepared in goats and conjugated with fluorescein through an isothiocyanate. Examples of preferred isotope include 3H, 14C, 32P, 35S, 36O, 51Cr, 57Co, 58Co, 59Fe, 90Y, 125I, 131I, and 186Re. The radioactive label can be detected by any of the currently available counting procedures. While many enzymes can be used, examples of preferred enzymes are peroxidase, β-glucuronidase, β-D-glucosidase, β-D-galactosidase, urease, glucose oxidase plus peroxidase and alkaline phosphatase. Enzymes are conjugated to the selected particle by reaction with bridging molecules such as carbodiimides, diisocyanates, glutaraldehyde and the like. Enzyme labels can be detected by any of the presently utilized colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques. U.S. Pat. Nos. 3,654,090, 3,850,752, and 4,016,043 are referred to by way of example for their disclosure of alternate labeling material and methods.
[0094] The invention also provides a method of detecting antibodies to a polypeptide of the invention in biological samples, using the following steps: (a) providing a polypeptide of the invention or a fragment thereof; (b) incubating a biological sample with said polypeptide of the invention under conditions which allow for the formation of an antibody-antigen complex; and (c) determining whether an antibody-antigen complex with the polypeptide of the invention is formed.
[0095] In another embodiment of the invention there are provided in vitro methods for evaluating the level of antibodies to a polypeptide of the invention in a biological sample using the following steps: (a) detecting the formation of reaction complexes in a biological sample according to the method noted above; and (b) evaluating the amount of reaction complexes formed, which amount of reaction complexes corresponds to the level of polypeptide of the invention in the biological sample.
[0096] Further there are provided in vitro methods for monitoring therapeutic treatment of a disease associated with B. hyodysenteriae in an animal host by evaluating, as described above, the levels of antibodies to a polypeptide of the invention in a series of biological samples obtained at different time points from an animal host undergoing such therapeutic treatment.
[0097] The present invention further provides methods for detecting the presence or absence of B. hyodysenteriae in a biological sample by: (a) bringing the biological sample into contact with a polynucleotide probe or primer of polynucleotide of the invention under suitable hybridizing conditions; and (b) detecting any duplex formed between the probe or primer and nucleic acid in the sample.
[0098] According to one embodiment of the invention, detection of B. hyodysenteriae may be accomplished by directly amplifying polynucleotide sequences from a biological sample, using known techniques and then detecting the presence of polynucleotide of the invention sequences.
[0099] In one form of the invention, the target nucleic acid sequence is amplified by PCR and then detected using any of the specific methods mentioned above. Other useful diagnostic techniques for detecting the presence of polynucleotide sequences include, but are not limited to: 1) allele-specific PCR; 2) single stranded conformation analysis; 3) denaturing gradient gel electrophoresis; 4) RNase protection assays; 5) the use of proteins which recognize nucleotide mismatches, such as the E. coli mutS protein; 6) allele-specific oligonucleotides; and 7) fluorescent in situ hybridisation.
[0100] In addition to the above methods polynucleotide sequences may be detected using conventional probe technology. When probes are used to detect the presence of the desired polynucleotide sequences, the biological sample to be analyzed, such as blood or serum, may be treated, if desired, to extract the nucleic acids. The sample polynucleotide sequences may be prepared in various ways to facilitate detection of the target sequence; e.g. denaturation, restriction digestion, electrophoresis or dot blotting. The targeted region of the sample polynucleotide sequence usually must be at least partially single-stranded to form hybrids with the targeting sequence of the probe. If the sequence is naturally single-stranded, denaturation will not be required. However, if the sequence is double-stranded, the sequence will probably need to be denatured. Denaturation can be carried out by various techniques known in the art.
[0101] Sample polynucleotide sequences and probes are incubated under conditions that promote stable hybrid formation of the target sequence in the probe with the putative desired polynucleotide sequence in the sample. Preferably, high stringency conditions are used in order to prevent false positives.
[0102] Detection, if any, of the resulting hybrid is usually accomplished by the use of labeled probes. Alternatively, the probe may be unlabeled, but may be detectable by specific binding with a ligand that is labeled, either directly or indirectly. Suitable labels and methods for labeling probes and ligands are known in the art, and include, for example, radioactive labels which may be incorporated by known methods (e.g., nick translation, random priming or kinasing), biotin, fluorescent groups, chemiluminescent groups (e.g., dioxetanes, particularly triggered dioxetanes), enzymes, antibodies and the like. Variations of this basic scheme are known in the art, and include those variations that facilitate separation of the hybrids to be detected from extraneous materials and/or that amplify the signal from the labeled moiety.
[0103] It is also contemplated within the scope of this invention that the nucleic acid probe assays of this invention may employ a cocktail of nucleic acid probes capable of detecting the desired polynucleotide sequences of this invention. Thus, in one example to detect the presence of polynucleotide sequences of this invention in a cell sample, more than one probe complementary to a polynucleotide sequences is employed and in particular the number of different probes is alternatively 2, 3, or 5 different nucleic acid probe sequences.
[0104] The polynucleotide sequences described herein (preferably in the form of probes) may also be immobilized to a solid phase support for the detection of Brachyspira species, including, but not limited to B. hyodysenteriae, B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. pilosicoli. Alternatively the polynucleotide sequences described herein will form part of a library of DNA molecules that may be used to detect simultaneously a number of different genes from Brachyspira species, such as B. hyodysenteriae. In a further alternate form of the invention, polynucleotide sequences described herein together with other polynucleotide sequences (such as from other bacteria or viruses) may be immobilized on a solid support in such a manner permitting identification of the presence of a Brachyspira species, such as B. hyodysenteriae and/or any of the other polynucleotide sequences bound onto the solid support.
[0105] Techniques for producing immobilized libraries of DNA molecules have been described in the art. Generally, most prior art methods describe the synthesis of single-stranded nucleic acid molecule libraries, using for example masking techniques to build up various permutations of sequences at the various discrete positions on the solid substrate. U.S. Pat. No. 5,837,832 describes an improved method for producing DNA arrays immobilized to silicon substrates based on very large scale integration technology. In particular, U.S. Pat. No. 5,837,832 describes a strategy called "tiling" to synthesize specific sets of probes at spatially defined locations on a substrate that may be used to produce the immobilized DNA libraries of the present invention. U.S. Pat. No. 5,837,832 also provides references for earlier techniques that may also be used. Thus, polynucleotide sequence probes may be synthesized in situ on the surface of the substrate.
[0106] Alternatively, single-stranded molecules may be synthesized off the solid substrate and each pre-formed sequence applied to a discrete position on the solid substrate. For example, polynucleotide sequences may be printed directly onto the substrate using robotic devices equipped with either pins or pizo electric devices.
[0107] The library sequences are typically immobilized onto or in discrete regions of a solid substrate. The substrate may be porous to allow immobilization within the substrate or substantially non-porous, in which case the library sequences are typically immobilized on the surface of the substrate. The solid substrate may be made of any material to which polypeptides can bind, either directly or indirectly. Examples of suitable solid substrates include flat glass, silicon wafers, mica, ceramics and organic polymers such as plastics, including polystyrene and polymethacrylate. It may also be possible to use semi-permeable membranes such as nitrocellulose or nylon membranes, which are widely available. The semi-permeable membranes may be mounted on a more robust solid surface such as glass. The surfaces may optionally be coated with a layer of metal, such as gold, platinum or other transition metal.
[0108] Preferably, the solid substrate is generally a material having a rigid or semi-rigid surface. In preferred embodiments, at least one surface of the substrate will be substantially flat, although in some embodiments it may be desirable to physically separate synthesis regions for different polymers with, for example, raised regions or etched trenches. It is also preferred that the solid substrate is suitable for the high density application of DNA sequences in discrete areas of typically from 50 to 100 μm, giving a density of 10000 to 40000 dots/cm-2.
[0109] The solid substrate is conveniently divided up into sections. This may be achieved by techniques such as photoetching, or by the application of hydrophobic inks, for example teflon-based inks (Cel-line, USA).
[0110] Discrete positions in which each different member of the library is located may have any convenient shape, e.g., circular, rectangular, elliptical, wedge-shaped, etc.
[0111] Attachment of the polynucleotide sequences to the substrate may be by covalent or non-covalent means. The polynucleotide sequences may be attached to the substrate via a layer of molecules to which the library sequences bind. For example, the polynucleotide sequences may be labeled with biotin and the substrate coated with avidin and/or streptavidin. A convenient feature of using biotinylated polynucleotide sequences is that the efficiency of coupling to the solid substrate can be determined easily. Since the polynucleotide sequences may bind only poorly to some solid substrates, it is often necessary to provide a chemical interface between the solid substrate (such as in the case of glass) and the nucleic acid sequences. Examples of suitable chemical interfaces include hexaethylene glycol. Another example is the use of polylysine coated glass, the polylysine then being chemically modified using standard procedures to introduce an affinity ligand. Other methods for attaching molecules to the surfaces of solid substrates by the use of coupling agents are known in the art (see, for example, WO98/49557).
[0112] Binding of complementary polynucleotide sequences to the immobilized nucleic acid library may be determined by a variety of means such as changes in the optical characteristics of the bound polynucleotide sequence (i.e. by the use of ethidium bromide) or by the use of labeled nucleic acids, such as polypeptides labeled with fluorophores. Other detection techniques that do not require the use of labels include optical techniques such as optoacoustics, reflectometry, ellipsometry and surface plasmon resonance (see WO97/49989).
[0113] Thus, the present invention provides a solid substrate having immobilized thereon at least one polynucleotide of the present invention, preferably two or more different polynucleotide sequences of the present invention.
[0114] The present invention also can be used as a prophylactic or therapeutic which may be utilized for the purpose of stimulating humoral and cell mediated responses in animals, such as chickens and swine, thereby providing protection against colonization with Brachyspira species, including, but not limited to B. hyodysenteriae, B. suanatina, B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. pilosicoli. Natural infection with a Brachyspira species, such as B. hyodysenteriae, induces circulating antibody titres against the proteins described herein. Therefore, the amino acid sequences described herein or parts thereof, have the potential to form the basis of a systemically or orally administered prophylactic or therapeutic to provide protection against intestinal spirochaetosis.
[0115] Accordingly, in one embodiment the present invention provides the amino acid sequences described herein or fragments thereof or antibodies that bind the amino acid sequences or the polynucleotide sequences described herein in a therapeutically effective amount admixed with a pharmaceutically acceptable carrier, diluent, or excipient.
[0116] The phrase "therapeutically effective amount" is used herein to mean an amount sufficient to reduce by at least about 15%, preferably by at least 50%, more preferably by at least 90%, and most preferably prevent, a clinically significant deficit in the activity, function and response of the animal host. Alternatively, a therapeutically effective amount is sufficient to cause an improvement in a clinically significant condition in the animal host.
[0117] The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similarly untoward reaction, such as gastric upset and the like, when administered to an animal. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in Martin, Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, Pa., (1990).
[0118] In a more specific form of the invention there are provided pharmaceutical compositions comprising therapeutically effective amounts of the amino acid sequences described herein or an analogue, fragment or derivative product thereof or antibodies thereto together with pharmaceutically acceptable diluents, preservatives, solubilizes, emulsifiers, adjuvants and/or carriers. Such compositions include diluents of various buffer content (e.g., Tris-HCl, acetate, phosphate), pH and ionic strength and additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol). The material may be incorporated into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc., or into liposomes. Hylauronic acid may also be used. Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the present proteins and derivatives. See, e.g., Martin, Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, Pa. 18042) pages 1435-1712, that are herein incorporated by reference. The compositions may be prepared in liquid form, or may be in dried powder, such as lyophilised form.
[0119] Alternatively, the polynucleotides of the invention can be optimized for expression in plants (e.g., corn). The plant may be transformed with plasmids containing the optimized polynucleotides. Then the plant is grown, and the proteins of the invention are expressed in the plant, or the plant-optimized version is expressed. The plant is later harvested, and the section of the plant containing the proteins of the invention is processed into feed for the animal. This animal feed will impart immunity against B. hyodysenteriae when eaten by the animal. Examples of prior art detailing these methods can be found in U.S. Pat. No. 5,914,123 (Arntzen, et al.); U.S. Pat. No. 6,034,298 (Lam, et al.); and U.S. Pat. No. 6,136,320 (Arntzen, et al.).
[0120] It will be appreciated that pharmaceutical compositions provided accordingly to the invention may be administered by any means known in the art. Preferably, the pharmaceutical compositions for administration are administered by injection, orally, or by the pulmonary, or nasal route. The amino acid sequences described herein or antibodies derived therefrom are more preferably delivered by intravenous, intraarterial, intraperitoneal, intramuscular, or subcutaneous routes of administration. Alternatively, the amino acid sequence described herein or antibodies derived therefrom, properly formulated, can be administered by nasal or oral administration.
[0121] Also encompassed by the present invention is the use of polynucleotide sequences of the invention, as well as antisense and ribozyme polynucleotide sequences hybridisable to a polynucleotide sequence encoding an amino acid sequence according to the invention, for manufacture of a medicament for modulation of a disease associated with B. hyodysenteriae.
[0122] Polynucleotide sequences encoding antisense constructs or ribozymes for use in therapeutic methods are desirably administered directly as a naked nucleic acid construct. Uptake of naked nucleic acid constructs by bacterial cells is enhanced by several known transfection techniques, for example those including the use of transfection agents. Examples of these agents include cationic agents (for example calcium phosphate and DEAE-dextran) and lipofectants. Typically, nucleic acid constructs are mixed with the transfection agent to produce a composition.
[0123] Alternatively, the antisense construct or ribozymes may be combined with a pharmaceutically acceptable carrier or diluented to produce a pharmaceutical composition. Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline. The composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular, oral or transdermal administration. The routes of administration described are intended only as a guide since a skilled practitioner will be able to determine readily the optimum route of administration and any dosage for any particular animal and condition.
[0124] The invention also includes kits for screening animals suspected of being infected with a Brachyspira species, such as B. hyodysenteriae, or to confirm that an animal is infected with a Brachyspira species, such as B. hyodysenteriae. In a further embodiment of this invention, kits suitable for use by a specialist may be prepared to determine the presence or absence of Brachyspira species, including, but not limited to B. hyodysenteriae, B. suanatina, B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. pilosicoli in suspected infected animals or to quantitatively measure a Brachyspira species, including, but not limited to B. hyodysenteriae, B. suanatina, B. intermedia, B. alvinipulli, B. aalborgi and B. pilosicoli infection. In accordance with the testing techniques discussed above, such kits can contain at least a labeled version of one of the amino acid sequences described herein or its binding partner, for instance an antibody specific thereto, and directions depending upon the method selected, e.g., "competitive," "sandwich," "DASP" and the like. Alternatively, such kits can contain at least a polynucleotide sequence complementary to a portion of one of the polynucleotide sequences described herein together with instructions for its use. The kits may also contain peripheral reagents such as buffers, stabilizers, etc.
[0125] Accordingly, a test kit for the demonstration of the presence of a Brachyspira species, including, but not limited to B. hyodysenteriae, B. suanatina, B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. pilosicoli, may contain the following:
[0126] (a) a predetermined amount of at least one labeled immunochemically reactive component obtained by the direct or indirect attachment of one of the amino acid sequences described herein or a specific binding partner thereto, to a detectable label;
[0127] (b) other reagents; and
[0128] (c) directions for use of said kit.
[0129] More specifically, the diagnostic test kit may contain:
[0130] (a) a known amount of one of the amino acid sequences described herein as described above (or a binding partner) generally bound to a solid phase to form an immunosorbent, or in the alternative, bound to a suitable tag, or there are a plural of such end products, etc;
[0131] (b) if necessary, other reagents; and
[0132] (c) directions for use of said test kit.
[0133] In a further variation, the test kit may contain:
[0134] (a) a labeled component which has been obtained by coupling one of the amino acid sequences described herein to a detectable label;
[0135] (b) one or more additional immunochemical reagents of which at least one reagent is a ligand or an immobilized ligand, which ligand is selected from the group consisting of:
[0136] (i) a ligand capable of binding with the labeled component (a);
[0137] (ii) a ligand capable of binding with a binding partner of the labeled component (a);
[0138] (iii) a ligand capable of binding with at least one of the component(s) to be determined; or
[0139] (iv) a ligand capable of binding with at least one of the binding partners of at least one of the component(s) to be determined; and
[0140] (c) directions for the performance of a protocol for the detection and/or determination of one or more components of an immunochemical reaction between one of the amino acid sequences described herein and a specific binding partner thereto.
[0141] Preparation of Genomic Library
[0142] A genomic library is prepared using an Australian porcine field isolate of B. hyodysenteriae (strain WA 1). This strain has been well-characterised and shown to be virulent following experimental challenge of pigs. The cetyltrimethylammonium bromide (CTAB) method is used to prepare high quality chromosomal DNA suitable for preparation of genomic DNA libraries. B. hyodysenteriae is grown in 100 ml anaerobic trypticase soy broth culture to a cell density of 109 cells/ml. The cells are harvested at 4,000×g for 10 minutes, and the cell pellet resuspended in 9.5 ml TE buffer. SDS is added to a final concentration of 0.5% (w/v), and the cells lysed at 37° C. for 1 hour with 100 μg of Proteinase K. NaCl is added to a final concentration of 0.7 M and 1.5 ml CTAB/NaCl solution (10% w/v CTAB, 0.7 M NaCl) is added before incubating the solution at 65° C. for 20 minutes. The lysate is extracted with an equal volume of chloroform/isoamyl alcohol, and the tube is centrifuged at 6,000×g for 10 minutes to separate the phases. The aqueous phase is transferred to a fresh tube and 0.6 volumes of isopropanol are added to precipitate the high molecular weight DNA. The precipitated DNA is collected using a hooked glass rod and transferred to a tube containing 1 ml of 70% (v/v) ethanol. The tube is centrifuged at 10,000×g and the pelleted DNA redissolved in 4 ml TE buffer overnight. A cesium chloride gradient containing 1.05 g/ml CsCl and 0.5 mg/ml ethidium bromide is prepared using the redissolved DNA solution. The gradient is transferred to 4 ml sealable centrifuge tubes and centrifuged at 70,000×g overnight at 15° C. The separated DNA is visualized under an ultraviolet light, and the high molecular weight DNA is withdrawn from the gradient using a 15-g needle. The ethidium bromide is removed from the DNA by sequential extraction with CsCl-saturated isopropanol. The purified chromosomal DNA is dialysed against 2 litres TE buffer and precipitated with isopropanol. The resuspended genomic DNA is sheared using a GeneMachines Hydroshear (Genomic Solutions, Ann Arbor, Mich.), and the sheared DNA is filled in using Klenow DNA polymerase to generate blunt-end fragments. One hundred ng of the blunt-end DNA fragments is ligated with 25 ng of pSMART VC vector (Lucigen, Meddleton, Wis.) using CloneSmart DNA ligase. The ligated DNA is then electroporated into E. coli electrocompetent cells. A small insert (2-3 kb) library and medium insert (3-10 kb) library is constructed into the low copy version of the pSMART VC vector.
[0143] Genomic Sequencing
[0144] After the genomic library is obtained, individual clones of E. coli containing the pSMART VC vector are picked. The plasmid DNA is purified and sequenced. The purified plasmids are subjected to automated direct sequencing of the pSMART VC vector using the forward and reverse primers specific for the pSMART VC vector. Each sequencing reaction is performed in a 10 μl volume consisting of 200 ng of plasmid DNA, 2 pmol of primer, and 4 μl of the ABI PRISM® BigDye Terminator Cycle Sequencing Ready Reaction Mix (PE Applied Biosystems, Foster City, Calif.). Cycling conditions involve a 2 minute denaturing step at 96° C., followed by 25 cycles of denaturation at 96° C. for 10 seconds, and a combined primer annealing and extension step at 60° C. for 4 minutes. Residual dye terminators are removed from the sequencing products by precipitation with 95% (v/v) ethanol containing 85 mM sodium acetate (pH 5.2), 3 mM EDTA (pH 8), and vacuum dried. The plasmids are sequenced in duplicate using each primer. Sequencing products are analyzed using an ABI 373A DNA Sequencer (PE Applied Biosystems).
[0145] Annotation
[0146] Partial genome sequences for B. hyodysenteriae are assembled and annotated using a range of public domain bioinformatics tools to analyze and re-analyze the sequences as part of a quality assurance procedure on data analysis. Open reading frames (ORFs) are predicted using a variety of programs including GeneMark, GLIMMER, ORPHEUS, SELFID and GetORF. Putative ORFs are examined for homology (DNA and protein) with existing international databases using searches including BLAST and FASTA. All the predicted ORFs are analyzed to determine their cellular localization using programs including PSI-BLAST, FASTA, MOTIFS, FINDPATTERNS, PHD, SIGNALP and PSORT. Databases including Interpro, Prosite, ProDom, Pfam and Blocks are used to predict surface associated proteins such as transmembrane domains, leader peptides, homologies to known surface proteins, lipoprotein signature, outer membrane anchoring motifs and host cell binding domains. Phylogenetic and other molecular evolution analysis is conducted with the identified genes and with other species to assist in the assignment of function. The in silico analysis of both partially sequenced genomes produces a comprehensive list of all the predicted ORFs present in the sequence data available. Each ORF is interrogated for descriptive information, such as predicted molecular weight, isoelectric point, hydrophobicity, and subcellular localization to enable correlation with the in vitro properties of the native gene product. Predicted genes which encode proteins similar to surface localized components and/or virulence factors in other pathogenic bacteria are selected as potential vaccine targets.
[0147] Bioinformatics Results
[0148] The shotgun sequencing of the B. hyodysenteriae genome results in 94.6% (3028.6 kb out of a predicted 3200 kb) of the genome being sequenced. The B. hyodysenteriae sequence is comprised of 294 contigs with an average contig size of 10.3 kb. For B. hyodysenteriae, 2,593 open-reading frames (ORFs) are predicted from the 294 contigs. Comparison of the predicted ORFs with genes present in the nucleic acid and protein databases indicate that approximately 70% of the ORFs have homology with genes contained in the public databases. The remaining 30% of the predicted ORFs have no known identity.
[0149] Vaccine Candidates
[0150] To help reduce the number of ORFs that would be tested as a vaccine candidate, ORF's showing reasonable homology (E-value less than e-15) with outer surface proteins, secreted proteins, and possible virulence factors present in public databases are selected as potential vaccine candidates. Of the 2,593 ORFs obtained in the genomic shotgun sequencing, many passed this test, but the results of 33 genes are presented here. Table 1 shows 33 genes selected as potential vaccine targets and their similarity with other known amino acid sequences obtained from SWISS-PROT database. It is noted that the percent identity of amino acids does not raise above 58% while the percent similarity or homology of amino acids remains less than 71%, thus indicating that these ORFs are unique.
TABLE-US-00001 TABLE 1 Identity Similarity Identity of Protein With Highest (amino (amino Accession Gene Homology acids) acids) Number NAV- Variable surface protein (VspD) of 106/223 136/223 O68157 H54 Brachysvira hyodysenteriae (47%) (60%) NAV- Flagellar protein B of Leptospira 58/213 108/213 Q72SJ3 H55 interrogans (27%) (50%) NAV- Myosin-like major antigen 288/1509 609/1509 P21249 H56 (19%) (40%) NAV- Lytic murein transglycosylate 97/318 158/318 Q6F7W9 H57 (possibly outer membrane-bound) (25%) (41%) NAV- Outer membrane protein of 57/175 90/175 P96127 H58 Treponema pallidum (32%) (51%) NAV- Myosin-like major antigen 204/1012 432/1012 P21249 H59 (20%) (42%) NAV- Outer membrane protein and related 46/139 68/139 COG2885 H60 peptidoglycan-associated lipoprotein (33%) (48%) NAV- Putative lipoprotein of Treponema 336/805 483/805 Q73NT0 H61 denticola (41%) (60%) NAV- NlpA lipoprotein of Streptococcus 92/269 151/269 Q303L3 H62 suis (34%) (56%) NAV- NlpA lipoprotein of Streptococcus 106/312 167/312 Q303L3 H63 suis (33%) (53%) NAV- NlpA lipoprotein of Streptococcus 112/337 198/337 Q303L3 H64 suis (33%) (58%) NAV- Putative secreted protein of 50/127 68/127 Q849M9 H65 Streptomyces violaceoruber (39%) (53%) NAV- Toxin (YoeB) of Escherichia coli 42/85 60/85 P69349 H66 (58%) (76%) NAV- Outer membrane protein (TolC) 80/350 171/350 Q2Z054 H67 (20%) (39%) NAV- Probable hemolysin-related protein 121/415 204/415 Q3ZYX1 H68 of Dehalococcoides sp. (29%) (49%) NAV- Outer surface protein of Bacillus 193/357 256/357 Q4MWS0 H69 cereus (54%) (71%) NAV- Membrane associated lipoprotein of 146/417 203/417 Q2SRL9 H70 Vibrio vulnificus (35%) (48%) NAV- Surface layer protein of 72/201 112/201 Q8TJE3 H71 Methanosarcina barkeri (36%) (49%) NAV- Lytic murein transglycosylate 51/141 6/141 P44049 H72 (possibly outer membrane-bound) (36%) (53%) NAV- Toxin (YoeB) of Escherichia coli 42/84 62/84 P69349 H73 (50%) (73%) NAV- Outer membrane protein/protective 210/833 339/833 COG4775 H74 (25%) (40%) NAV- variable surface protein (VspH) of 29% 43% AAK14803.1 H22 Brachyspira hyodysenteriae (133/454) (199/454) NAV- membrane associated lipoprotein of 43% 60% AAF27178.1 H23 Mycoplasma mycoides (114/263) (159/263) NAV- Outer membrane lipoprotein of 32% 53% ZP00300921.1 H24 Geobacter metallireducens (46/142) (76/142) NAV- surface antigen (BspA) of 38% 55% AAC82625.1 H30 Bacteroides forsythus (83/216) (120/216) NAV- hemolytic protein (H1pA) of Nostoc 35% 56% NP488469.1 H32 sp. (49/137) (77/137) NAV- hemolytic protein of Prevotella 54% 70% AAC05836.1 H33 intermedia (64/117) (83/117) NAV- virulence-mediating protein (VirC) of 36% 63% NP800579.1 H37 Vibrio varahaemolyticus (58/159) (101/159) NAV- lytic murein transglycosylase 26% 41% ZP00146104.1 H40 (contains LysM/invasin domains) (120/449) (185/449) NAV- surface antigen BspA of Bacteroides 41% 57% AAC82625.1 H41 forsythus (84/201) (115/201) NAV- Hemolysins and related proteins of 35% 56% ZP00162711.2 H43 Anabaena variabilis (150/425) (242/425) NAV- outer membrane porin of Leptospira 20% 41% YP001419.1 H44 interrogans (79/393) (163/393) NAV- virulence factor (MviN) protein of 32% 49% NP952225.1 H45 Geobacter sulfurreducens (153/469) (231/469)
[0151] The DNA and amino acid sequences of NAV-H54 are found in SEQ ID NOs: 1 and 2, respectively. The DNA and amino acid sequences of NAV-H55 are found in SEQ ID NOs: 3 and 4, respectively. The DNA and amino acid sequences of NAV-H56 are found in SEQ ID NOs: 5 and 6, respectively. The DNA and amino acid sequences of NAV-H57 are found in SEQ ID NOs: 7 and 8, respectively. The DNA and amino acid sequences of NAV-H58 are found in SEQ ID NOs: 9 and 10, respectively. The DNA and amino acid sequences of NAV-H59 are found in SEQ ID NOs: 11 and 12, respectively. The DNA and amino acid sequences of NAV-H60 are found in SEQ ID NOs: 13 and 14, respectively. The DNA and amino acid sequences of NAV-H61 are found in SEQ ID NOs: 15 and 16, respectively. The DNA and amino acid sequences of NAV-H62 are found in SEQ ID NOs: 17 and 18, respectively. The DNA and amino acid sequences of NAV-H63 are found in SEQ ID NOs: 19 and 20, respectively. The DNA and amino acid sequences of NAV-H64 are found in SEQ ID NOs: 21 and 22, respectively. The DNA and amino acid sequences of NAV-H65 are found in SEQ ID NOs: 23 and 24, respectively. The DNA and amino acid sequences of NAV-H66 are found in SEQ ID NOs: 25 and 26, respectively. The DNA and amino acid sequences of NAV-H67 are found in SEQ ID NOs: 27 and 28, respectively. The DNA and amino acid sequences of NAV-H68 are found in SEQ ID NOs: 29 and 30, respectively. The DNA and amino acid sequences of NAV-H69 are found in SEQ ID NOs: 31 and 32, respectively. The DNA and amino acid sequences of NAV-H70 are found in SEQ ID NOs: 33 and 34, respectively. The DNA and amino acid sequences of NAV-H71 are found in SEQ ID NOs: 35 and 36, respectively. The DNA and amino acid sequences of NAV-H72 are found in SEQ ID NOs: 37 and 38, respectively. The DNA and amino acid sequences of NAV-H73 are found in SEQ ID NOs: 39 and 40, respectively. The DNA and amino acid sequences of NAV-H74 are found in SEQ ID NOs: 41 and 42, respectively.
[0152] The DNA and amino acid sequences of NAV-H22 are found in SEQ ID NOs: 43 and 44, respectively. The DNA and amino acid sequences of NAV-H23 are found in SEQ ID NOs: 45 and 46, respectively. The DNA and amino acid sequences of NAV-H24 are found in SEQ ID NOs: 47 and 48, respectively. The DNA and amino acid sequences of NAV-H30 are found in SEQ ID NOs: 49 and 50, respectively. The DNA and amino acid sequences of NAV-H32 are found in SEQ ID NOs: 51 and 52, respectively. The DNA and amino acid sequences of NAV-H33 are found in SEQ ID NOs: 53 and 54, respectively. The DNA and amino acid sequences of NAV-H37 are found in SEQ ID NOs: 55 and 56, respectively. The DNA and amino acid sequences of NAV-H40 are found in SEQ ID NOs: 57 and 58, respectively. The DNA and amino acid sequences of NAV-H41 are found in SEQ ID NOs: 59 and 60, respectively. The DNA and amino acid sequences of NAV-H43 are found in SEQ ID NOs: 61 and 62, respectively. The DNA and amino acid sequences of NAV-H44 are found in SEQ ID NOs: 63 and 64, respectively. The DNA and amino acid sequences of NAV-H45 are found in SEQ ID NOs: 65 and 66, respectively.
[0153] To further reduce the number of ORFs that would be tested as a vaccine candidate, gene products predicted by the in silico analysis to be localised in the cytoplasm or inner membrane of the spirochaete are abandoned. As a result, twenty one of the thirty three genes presented in Table 1 are further analyzed. These include NAV-H58, NAV-H60, NAV-H62, NAV-H64, NAV-H66, NAV-H67, NAV-H69, NAV-H71, NAV-H73, NAV-H22, NAV-H23, NAV-H24, NAV-H30, NAV-H32, NAV-H33, NAV-H37, NAV-H40, NAV-H41, NAV-1143, NAV-H44, and NAV-H45.
[0154] Analysis of Gene Distribution Using Polymerase Chain Reaction (PCR)
[0155] One or two primer pairs which anneal to different regions of the target gene encoding region are designed and optimised for PCR detection. Individual primers are designed using Oligo Explorer 1.2 and primer sets with calculated melting temperatures of approximately 55-60° C. are selected. These primer sets are also selected to generate PCR products greater than 200 bp. A medium-stringency primer annealing temperature of 50° C. is selected for the distribution analysis PCR. The medium-stringency conditions would allow potential minor mismatched sequences (because of strain differences) occurring at the primer binding sites to not affect primer binding. Distribution analysis of the twenty one B. hyodysenteriae target genes are performed on 23 strains of B. hyodysenteriae, including two strains which have been shown to be avirulent. PCR analysis is performed in a 25 μl total volume using Taq DNA polymerase (Biotech International, Thurmont, Md.). The amplification mixture consists of 1×PCR buffer (containing 1.5 mM of MgCl2), 1 U of Taq DNA polymerase, 0.2 mM of each dNTP (Amersham Pharmacia Biotech, Piscataway, N.J.), 0.5 μM of the primer pair, and 1 μl purified chromosomal template DNA. Cycling conditions involve an initial template denaturation step of 5 minutes at 94° C., follow by 35 cycles of denaturation at 94° C. for 30 seconds, annealing at 50° C. for 15 seconds, and primer extension at 68° C. for 4 minutes. The PCR products are subjected to electrophoresis in 1% (w/v) agarose gels in 1×TAE buffer (40 mM Tris-acetate, 1 mM EDTA), staining with a 1 μg/ml ethidium bromide solution and viewing over UV light.
[0156] The primers used for eighteen genes (out of twenty one) are indicated in Table 2. Of these eighteen genes, three of them (NAV-H23, NAV-H41 and NAV-H71) are present in 83% of the B. hyodysenteriae strains tested; three of them (NAV-H24, NAV-H30 and NAV-H73) are present in 87% of the strains tested, seven of them (NAV-H22, NAV-H32, NAV-H33, NAV-H37, NAV-H43, NAV-H64 and NAV-H69) are present in 91% of the strains tested, and three of them (NAV-H40, NAV-H44, and NAV-H45) are present in 100% of the strains tested. The remaining three genes are present in less than 80% of the B. hyodysenteriae strains tested. The poor distribution of these genes makes them less useful as a vaccine subunit. For this reason, further analysis of these genes has been abandoned.
TABLE-US-00002 TABLE 2 Primer Gene name Primer Sequence (5'-3') NAV-H22 H22-F4 AAACGTTTATATTTTATTTTATC (SEQ ID NO: 67) H22-R1308 AAACTTCCAAGTGATACC (SEQ ID NO: 68) NAV-H23 H23-F4 AAATATAAACCTACAAGCAG (SEQ ID NO: 69) H23-R2366 AATATTTCAGTTAATCTAAAATC (SEQ ID NO: 70) NAV-H24 H24-F19 ACTTTAATCTTTGTATTAATTTTG (SEQ ID NO: 71) H24-R729 TTGTTTTAATTTGATAATATCAG (SEQ ID NO: 72) NAV-H30 H30-F4 AAAAAAATTATTTTATTAATATTTATATT (SEQ ID NO: 73) H30-R969 TTCTCTTATAATCTTTACAGTTG (SEQ ID NO: 74) NAV-H32 H32-F4 CATATTTCTGGTGATTCTC (SEQ ID NO: 75) H32-R564 TTTTTTGATAAATAAGTTTITTATTTG (SEQ ID NO: 76) NAV-H33 H33-F4 TTTAATACTCCTATATTATTAATTATTT (SEQ ID NO: 77) H33-R396 AAGGAGAATCACCAGAAA (SEQ ID NO: 78) NAV-H37 H37-F4 AATGATATTATTAAAGTGATAAA (SEQ ID NO: 79) H37-R825 AAAATCTAATATAACGGATT (SEQ ID NO: 80) NAV-H40 H40-F16 AAATATGCTTCCATTATAGG (SEQ ID NO: 81) H40-R1815 ACTTTTAGGAAGAAGTTTAAC (SEQ ID NO: 82) NAV-H41 1441-F19 TATATTTTCATTATATATTTATTAG (SEQ ID NO: 83) H41-R1067 CTAGGCATAGATTTTCCA (SEQ ID NO: 84) NAV-H43 H43-F46 TTTGCCATGTCGGAAATTGCAG (SEQ ID NO: 85) H43-R1236 TATTCTAGCACCGTCCATATC (SEQ ID NO: 86) NAV-H44 H44-F43 GTATGTTTATATGCTCAGGATAC (SEQ ID NO: 87) H44-R2931 AACAGCAGCACTATCTTGTAA (SEQ ID NO: 88) H44-F80 CAGCAGCAACAAATAATACTACTG (SEQ ID NO: 89) H44-R929 TGAATATAAACACCTTCTCTCAAAG (SEQ ID NO: 90) NAV-H45 H45-F52 AAAATGTCATTGGTAACTACTGTAAG (SEQ ID NO: 91) H45-R1595 CTTGATAATCTGCCTTTAAACATAC (SEQ ID NO: 92) NAV-H62 H62-F69 ATGTGAGGAAAAAACAGAAAG (SEQ ID NO: 93) H62-R866 TCATTACCAGAAAACCATACTC (SEQ ID NO: 94) NAV-H64 H64-F69 AGGAAATAAAGCTCCTGCTGCTTCAGC (SEQ ID NO: 95) H64-R253 GCATAGCAGCAACTTCAGAAGGTCCA (SEQ ID NO: 96) NAV-H66 H66-F114 CTTATTAATTGGTATAGGAAAACC (SEQ ID NO: 97) H66-R200 AATCTATGTTCTTGATTTATTAGCC (SEQ ID NO: 98) NAV-H69 H69-F546 AGAAGCTACTTTTGGACCTTGGCCTGT (SEQ ID NO: 99) H69-R662 ACACAGTCAACACCAAGAGC (SEQ ID NO: 100) NAV-H71 H71-F568 AAACAGCAGACTAGCTGGTG (SEQ ID NO: 101) H71-R773 TGACCATTACTTACACCGGATACCCCA (SEQ ID NO: 102) H71-F37 TTAATGACTATATCGCTTTCATACACTTT C (SEQ ID NO: 103) H71-R1241 TCAATTCTTCCAGACATAAAATCAGTAAG (SEQ ID NO: 104) NAV-H73 H73-F37 TATATAGAGTGGGTATCAGAAG (SEQ ID NO: 105) H73-R254 TCATAATGGTATTTACAAGA TG (SEQ ID NO: 106)
[0157] pTrcHis Plasmid Extraction
[0158] Escherichia coli JM 109 clones harboring the pTrcHis plasmid (Invitrogen, Carlsbad, Calif.) are streaked out from glycerol stock storage onto Luria-Bertani (LB) agar plates supplemented with 100 mg/l ampicillin and incubated at 37° C. for 16 hours. A single colony is used to inoculate 10 ml of LB broth supplemented with 100 mg/l ampicillin, and the broth culture is incubated at 37° C. for 12 hours with shaking. The entire overnight culture is centrifuged at 5,000×g for 10 minutes, and the plasmid contained in the cells is extracted using the QIAprep Spin Miniprep Kit (Qiagen, Doncaster VIC). The pelleted cells are resuspended with 250 μl cell resuspension buffer P1 and then are lysed with the addition of 250 μl cell lysis buffer P2. The lysed cells are neutralized with 350 μl neutralization buffer N3, and the precipitated cell debris is pelleted by centrifugation at 20,000×g for 10 minutes. The supernatant is transferred to a spin column and centrifuged at 10,000×g for 1 minute. After discarding the flow-through, 500 μl wash buffer PE is applied to the column and centrifuged as before. The flow-through is discarded, and the column is dried by centrifugation at 20,000×g for 3 minutes. The plasmid DNA is eluted from the column with 100 μl elution buffer EB. The purified plasmid is quantified using a Dynaquant DNA fluorometer (Hoefer, San Francisco, Calif.), and the DNA concentration is adjusted to 100 μg/ml by dilution with TE buffer. The purified pTrcHis plasmid is stored at -20° C.
[0159] Vector Preparation
[0160] Two μg of the purified pTrcHis plasmid is digested at 37° C. for 1-4 hours in a total volume of 50 μl containing 5 U of two restriction enzymes in 100 mM Tris-HCl (pH 7.5), 50 mM NaCl, 10 mM MgCl2, 1 mM DTT, and 100 μg/ml BSA. The particular pair of restriction enzymes used depends on the sequence of the primers and the sequence of the ORF; the goal being to use primers that would not cut the ORFs. The restricted vector is verified by electrophoresing 1 μl of the digestion reaction through a 1% (w/v) agarose gel in 1×TAE buffer at 90V for 1 hour. The electrophoresed DNA is stained with 1 μg/ml ethidium bromide and is viewed over ultraviolet (UV) light.
[0161] Linearised pTrcHis vector is purified using the UltraClean PCR Clean-up Kit (Mo Bio Laboratories, Carlsbad, Calif.). Briefly, the restriction reaction (50 μl) is mixed with 250 μl SpinBind buffer B1, and the entire volume is added to a spin-column. After centrifugation at 8,000×g for 1 minute, the flow-through is discarded and 300 μl SpinClean buffer B2 is added to the column. The column is centrifuged as before, and the flow-through is discarded before drying the column at 20,000×g for 0.3 minutes. The purified vector is eluted from the column with 50 μl TE buffer. Purified linear vector is quantified using a fluorometer, and the DNA concentration is adjusted to 50 μg/ml by dilution with TE buffer. The purified restricted vector is stored at -20° C.
[0162] Primer Design for Insert Preparation
[0163] Primer pairs are designed to amplify as much of the coding region of the target gene as possible using genomic DNA as the starting point. All primers sequences include terminal restriction enzyme sites to enable cohesive-end ligation of the resultant amplicon into the linearised pTrcHis vector. The primers are tested using Amplify 1.2 (University of Wisconsin, Madison, Wis.) and the theoretical amplicon sequence is inserted into the appropriate position in the pTrcHis vector sequence. Deduced translation of the chimeric pTrcHis expression cassette is performed using Vector NTI version 6 (InforMax) to confirm that the gene inserts would be in the correct reading frame. Table 3 also provides the gene size, the protein size, the predicted molecular weight of the native protein in daltons and the predicted pI of the protein. It is noted that the histidine-fusion of the recombinant protein adds approximately 4 kDa to the native protein's predicted molecular weight.
TABLE-US-00003 TABLE 3 Gene size Protein size Predicted MW of Gene (bp) (aa) native protein (Da) Predicted pI NAV-H40 1815 605 97,733 9.4853 NAV-H41 1068 356 39,870 5.2168 NAV-H44 2940 980 113,722 5.1864 NAV-H62 1014 338 37642 4.3944 NAV-H64 1011 337 36468 4.4953 NAV-H66 264 88 10629 9.3027 NAV-H69 1080 360 41525 5.7123 NAV-H73 258 86 10527 9.5920
[0164] Amplification of the Gene Inserts
[0165] Using genomic DNA, all target gene inserts are amplified by PCR in a 100 μl total volume using Taq DNA polymerase (Biotech International) and Pfu DNA polymerase (Promega, Madison, Wis.). The amplification mixture consists of 1×PCR buffer (containing 1.5 mM of MgCl2), 1 U of Taq DNA polymerase, 0.01 U Pfu DNA polymerase, 0.2 mM of each dNTP (Amersham Pharmacia Biotech), 0.5 μM of the appropriate primer pair and 1 μl of purified chromosomal DNA. The chromosomal DNA is prepared from the same B. hyodysenteriae strain used for genome sequencing. Cycling conditions involve an initial template denaturation step of 5 minutes at 94° C., followed by 35 cycles of denaturation at 94° C. for 30 seconds, annealing at 50° C. for 15 seconds, and primer extension at 68° C. for 4 minutes. The PCR products are subjected to electrophoresis in 1% (w/v) agarose gels in 1×TAE buffer, are stained with a 1 μg/ml ethidium bromide solution and are viewed over UV light. After verifying the presence of the correct size PCR product, the PCR reaction is purified using the UltraClean PCR Clean-up Kit (Mo Bio Laboratories, Carlsbad, Calif.). The PCR reaction (100 μl is mixed with 500 μl SpinBind buffer B1, and the entire volume is added to a spin-column. After centrifugation at 8,000×g for 1 minute, the flow-through is discarded, and 300 SpinClean buffer B2 is added to the column. The column is centrifuged as before and the flow-through is discarded before drying the column at 20,000×g for 3 minutes. The purified vector is eluted from the column with 100 μl TE buffer.
[0166] Restriction Enzyme Digestion of the Gene Inserts
[0167] Thirty μl of the purified PCR product are digested in a 50 μl total volume with 1 U of each restriction enzyme compatible with the terminal restriction endonuclease recognition site determined by the cloning oligonucleotide primer. The restriction reaction consists of 100 mM Tris-HCl (pH 7.5), 50 mM NaCl, 10 mM MgCl2, 1 mM DTT and 100 μg/ml BSA with 1 U of each restriction enzyme at 37° C. for 1-4 hours. The digested insert DNA are purified using the UltraClean PCR Clean-up Kit (see above). Purified digested insert DNA are quantified using the fluorometer, and the DNA concentration is adjusted to 20 μg/ml by dilution with TE buffer. The purified restricted insert DNA are used immediately for vector ligation.
[0168] Ligation of the Gene Inserts into the pTrcHis Vector
[0169] Ligation reactions are all performed in a total volume of 204 One hundred ng of linearised pTrcHis is incubated with 20 ng of restricted insert at 16° C. for 16 hours in 30 mM Tris-HCl (pH 7.8), 10 mM MgCl2, 10 mM DTT and 1 mM ATP containing I U of T4 DNA ligase (Promega). An identical ligation reaction containing no insert DNA is also included as a vector re-circularisation negative control. The appropriate restriction enzyme is used for each reaction.
[0170] Transformation of pTrcHis Ligations into E. Coli Cells
[0171] Competent E. coli JM109 (Promega) cells are thawed from -80° C. storage on ice and then 50 μl of the cells are transferred into ice-cold 1.5 ml microfuge tubes containing 5 μl of the overnight ligation reactions (equivalent to 25 ng of pTrcHis vector). The tubes are mixed by gently tapping the bottom of each tube on the bench and left on ice for 30 minutes. The cells are then heat-shocked by placing the tubes into a 42° C. water bath for 45 seconds before returning the tube to ice for 2 minutes. The transformed cells are recovered in 1 ml LB broth for 1 hour at 37° C. with gentle mixing. The recovered cells are harvested at 2,500×g for 5 minutes, and the cells are resuspended in 50 μl of fresh LB broth. The entire 50 μl of resuspended cells are spread evenly onto a LB agar plate containing 100 mg/l ampicillin using a sterile glass rod. Plates are incubated at 37° C. for 16 hours.
[0172] Detection of Recombinant pTrcHis Constructs in E. Coli by PCR
[0173] Twelve single transformant colonies for each construct are streaked onto fresh LB agar plates containing 100 mg/l ampicillin and incubated at 37° C. for 16 hours. A single colony from each transformation event is resuspended in 50 μl of TE buffer and is boiled for 1 minute. Two μl of boiled cells are used as template for PCR. The amplification mixture consists of 1×PCR buffer (containing 1.5 mM of MgCl2), 1 U of Taq DNA polymerase, 0.2 mM of each dNTP, 0.5 μM of the pTrcHis-F primer (5'-CAATTTATCAGACAATCTGTGTG-3' SEQ ID NO: 107) and 0.5 μM of the pTrcHis-R primer (5'-TGCCTGGCAGTTCCCTACTCTCG-3' SEQ ID NO: 108). Cycling conditions involve an initial template denaturation step of 5 minutes at 94° C., followed by 35 cycles of denaturation at 94° C. for 30 seconds, annealing at 60° C. for 15 seconds, and a primer extension at 72° C. for 1 minute. The PCR products are subjected to electrophoresis in 1% (w/v) agarose gels in 1×TAE buffer, are stained with a 1 μg/ml ethidium bromide solution and are viewed over UV light. Cloning of the various inserts into the pTrcHis expression vector produces recombinant constructs of various sizes.
[0174] Pilot Expression of Recombinant his-Tagged Proteins
[0175] Five to ten isolated colonies of recombinant pTrcHis construct in E. coli JM109 are inoculated into 3 ml LB broth in a 5 ml tube containing 100 mg/l ampicillin and 1 mM IPTG and incubated at 37° C. for 16 hours with shaking. The cells are harvested by centrifugation at 5,000×g for 10 minutes at 4° C. The supernatant is discarded, and each pellet is resuspended with 10 μl Ni-NTA denaturing lysis buffer (100 mM NaH2PO4, 10 mM Tris-HCl, 8 M urea, pH 8.0). After vortexing the tube for 1 minute, the cellular debris is pelleted by centrifugation at 10,000×g for 10 minute at 4° C. The supernatant is transferred to a new tube and stored at -20° C. until analysis.
[0176] Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE)
[0177] SDS-PAGE analysis of protein is performed using a discontinuous Tris-glycine buffer system. Thirty μl of protein sample are mixed with 10 μl of 4× sample treatment buffer (250 mM Tris-HCl (pH 6.0), 8% (w/v) SDS, 200 mM DTT, 40% (v/v) glycerol and 0.04% (w/v) bromophenol blue). Samples are boiled for 5 minutes immediately prior to loading 10 μl of the sample into wells in the gel. The gel comprises a stacking gel (125 mM Tris-HCl ph 6.8, 4% w/v acylamide, 0.15% w/v bis-acrylamide and 0.1% w/v SDS) and a separating gel (375 mM Tris-HCl ph 8.8, 12% w/v acylamide, 0.31% w/v bis-acrylamide and 0.1% w/v SDS). These gels are polymerised by the addition of 0.1% (v/v) TEMED and 0.05% (w/v) freshly prepared ammonium sulphate solution and cast into the mini-Protean dual slab cell (Bio-Rad, Hercules, Calif.). Samples are run at 150 V at room temperature (RT) until the bromophenol blue dye reaches the bottom of the gel. Pre-stained molecular weight standards are electrophoresed in parallel with the samples in order to allow molecular weight estimations. After electrophoresis, the gel is immediately stained using Coomassie Brilliant Blue G250 (Bio-Rad) or is subjected to electro-transfer onto nitrocellulose membrane for Western blotting.
[0178] Western Blot Analysis
[0179] Electrophoretic transfer of separated proteins from the SDS-PAGE gel to nitrocellulose membrane is performed using the Towbin transfer buffer system. After electrophoresis, the gel is equilibrated in transfer buffer (25 mM Tris, 192 mM glycine, 20% v/v methanol, pH 8.3) for 15 minutes. The proteins in the gel are electro-transferred to nitrocellulose membrane (Protran, Schleicher and Schuell BioScience, Inc., Keene, N.H.) using the mini-Protean transblot apparatus (Bio-Rad) at 30 V overnight at 4° C. The freshly transferred nitrocellulose membrane containing the separated proteins is blocked with 10 ml of tris-buffered saline (TBS) containing 5% (w/v) skim milk powder for 1 hour at room temperature. The membrane is washed with TBS containing 0.1% (v/v) Tween 20 (TBST) and then is incubated with 10 mL mouse anti-his antibody (diluted 5,000-fold with TBST) for 1 hour at room temperature. After washing three times for 5 minutes with TBST, the membrane is incubated with 10 mL goat anti-mouse IgG (whole molecule)-AP diluted 5,000-fold in TBST for 1 hour at RT. The membrane is developed using the Alkaline Phosphatase Substrate Kit (Bio-Rad). The development reaction is stopped by washing the membrane with distilled water. The membrane is then dried and scanned for presentation.
[0180] Verification of Reading Frame of the Recombinant pTrcHis Constructs by Direct Sequence Analysis
[0181] Two transformant clones for each construct which produced the correct sized PCR products are inoculated into 10 ml LB broth containing 100 mg/l ampicillin and incubated at 37° C. for 12 hours with shaking. The entire overnight cultures are centrifuged at 5,000×g for 10 minutes, and the plasmid contained in the cells are extracted using the QIAprep Spin Miniprep Kit as described previously. The purified plasmid is quantified using a fluorometer. Both purified plasmids are subjected to automated direct sequencing of the pTrcHis expression cassette using the pTrcHis-F and pTrcHis-R primers. Each sequencing reaction is performed in a 10 μl volume consisting of 200 ng of plasmid DNA, 2 pmol of primer, and 4 μl of the ABI PRISM® BigDye Terminator Cycle Sequencing Ready Reaction Mix (PE Applied Biosystems, Foster City, Calif.). Cycling conditions involve a two-minute denaturing step at 96° C., followed by 25 cycles of denaturation at 96° C. for 10 seconds, and a combined primer annealing and extension step at 60° C. for four minutes. Residual dye terminators are removed from the sequencing products by precipitation with 95% (v/v) ethanol containing 85 mM sodium acetate (pH 5.2), 3 mM EDTA (pH 8), and vacuum dried. The plasmids are sequenced in duplicate using each primer. Sequencing products are analyzed using an ABI 373A DNA Sequencer (PE Applied Biosystems). Nucleotide sequencing of the pTrcHis is performed to verify that the expression cassette is in the correct reading frame for each constructs.
[0182] Expression and Purification of Recombinant his-Tagged Proteins
[0183] A single colony of the recombinant pTrcHis construct in E. coli JM 109 is inoculated into 50 ml LB broth in a 250 ml conical flask containing 100 mg/l ampicillin and incubated at 37° C. for 16 hours with shaking. A 21 conical flask containing 11 of LB broth supplemented with 100 mg/l ampicillin is inoculated with 10 ml of the overnight culture and incubated at 37° C. until the optical density of the cells at 600 nm is 0.5 (approximately 3-4 hours). The culture is then induced by adding IPTG to a final concentration of 1 mM, and the cells are returned to 37° C. with shaking. After 5 hours of induction, the culture is transferred to 250 ml centrifuge bottles, and the bottles are centrifuged at 5,000×g for 20 minutes at 4° C. The supernatant is discarded, and each pellet is resuspended with 8 ml Ni-NTA denaturing lysis buffer (100 mM NaH2PO4, 10 mM Tris-HCl, 8 M urea, pH 8.0). The resuspended cells are stored at -20° C. overnight.
[0184] The cell suspension is removed from -20° C. storage and thawed on ice. The cell lysate is then sonicated on ice three times for 30 seconds with one minute incubation on ice between sonication rounds. The lysed cells are cleared by centrifugation at 20,000×g for ten minutes at 4° C., and the supernatant is transferred to a 15 ml column containing a 0.5 ml bed volume of Ni-NTA agarose resin (Qiagen). The recombinant His6-tagged protein is allowed to bind to the resin for one hour at 4° C. with end-over-end mixing. The resin is then washed with 30 ml of Ni-NTA denaturing wash buffer (100 mM NaH2PO4, 10 mM Tris-HCl, 8 M urea, pH 6.3) before elution with 12 ml of Ni-NTA denaturing elution buffer (100 mM NaH2PO4, 10 mM Tris-HCl, 8 M urea, pH 4.5). Four 3 ml fractions of the eluate are collected and stored at 4° C. Thirty μl of each eluate is treated with 10 μl of 4× sample treatment buffer and boiled for five minutes. The samples are subjected to SDS-PAGE and stained with Coomassie Brilliant Blue G250 (Bio-Rad). The stained gel is equilibrated in distilled water for one hour and dried between two sheets of cellulose overnight at RT.
[0185] Expression of the selected recombinant E. coli clones is performed in medium-scale to generate sufficient recombinant protein for vaccination of mice (see below).
[0186] Dialysis and Lyophilisation of the Purified Recombinant His-Tagged Protein
[0187] The eluted proteins are pooled and transferred into a hydrated dialysis tube (Spectrum Laboratories, Inc., Los Angeles, Calif.) with a molecular weight cut-off (MWCO) of 3,500 Da. A 200 l aliquot of the pooled eluate is taken and quantified using a commercial Protein Assay (Bio-Rad). The proteins are dialysed against 21 of distilled water at 4° C. with stirring. The dialysis buffer is changed eight times at 12-hourly intervals. The dialysed proteins are transferred from the dialysis tube into a 50 ml centrifuge tubes (40 ml maximum volume), and the tubes are placed at -80° C. overnight. Tubes are placed into a MAXI freeze-drier (Heto-Holten, Allerod, Denmark) and lyophilised to dryness. The lyophilised proteins are then re-hydrated with PBS to a calculated concentration of 2 mg/ml and stored at -20° C. Following dialysis and lyophilisation, stable recombinant antigen is successfully produced.
[0188] Eight of the 18 genes are successfully cloned into the E. coli Expression System and recombinant protein can be expressed stabily from these clones.
[0189] Serology Using Purified Recombinant Protein
[0190] Twenty μg of purified recombinant protein is loaded into a 7 cm IEF well, electrophoresed through a 10% (w/v) SDS-PAGE gel, and electro-transferred to nitrocellulose membrane. The membrane is blocked with TBS-skim milk (5% w/v) and assembled into the multi-screen apparatus (Bio-Rad). The wells are incubated with 100 of diluted pig serum (100-fold) for one hour at room temperature. The pig serum is obtained from high health status pigs (n=3), experimentally challenged pigs showing clinical SD (n=5), naturally infected seroconverting pigs (n=5), and pigs recovered from natural infection (n=4). The membrane then is removed from the apparatus and washed three times with TBST (0.1% v/v) before incubating with 10 ml of goat anti-swine IgG (whole molecule)-AP (5,000-fold) for 1 hour at RT. The membrane is washed three times with TBST before color development using an Alkaline Phosphatase Substrate Kit (Bio-Rad). The membrane is washed with tap water when sufficient development has occurred, dried and scanned for presentation.
[0191] The reactivity of the pig serum obtained from animal of differing health status is shown in the table below. All proteins are recognized by 100% of the panel of serum thus indicating that the genes are expressed in vivo and that they are able to induce a systemic immune response following exposure to the spirochaete.
TABLE-US-00004 TABLE 4 Gene distribution and serologic reactivity of the eight successfully expressed B. hyodysenteriae vaccine candidates. The gene distribution was analyzed by PCR using a panel of 23 different strains. Serology was performed using 19 serum samples from five different categories of disease. Gene Distribution (%) Serology (%) NAV-H40 100 100% NAV-H41 83 100% NAV-H44 100 100% NAV-H62 96 100% NAV-H64 91 100% NAV-H66 96 100% NAV-H69 91 100% NAV-H73 87 100%
[0192] Vaccination of Mice Using the Purified Recombinant his-Tagged Proteins
[0193] For each of the purified recombinant his-tagged proteins, ten mice are systemically and orally immunized to determine whether the recombinant protein would be immunogenic. The recombinant protein is emulsified with 30% (v/v) water in oil adjuvant and injected intramuscularly into the quadraceps muscle of ten mice (Balb/cJ: five weeks old males). All mice receive 100 μg of protein in a total volume of 100 μl. Three weeks after the first vaccination, all mice receive a second intramuscular vaccination identical to the first vaccination. All mice are killed two weeks after the second vaccination. Sera are obtained from the heart at post-mortem and tested in Western blot analysis for antibodies against cellular extracts of B. hyodysenteriae.
[0194] Western Blot Analysis
[0195] Twenty μg of purified recombinant protein is loaded into a 7 cm IEF well, electrophoresed through a 10% (w/v) SDS-PAGE gel, and electro-transferred to nitrocellulose membrane. The membrane is blocked with TBS-skim milk (5% w/v) and assembled into the multi-screen apparatus (Bio-Rad). The wells are incubated with 100 μl of diluted mouse serum (100-fold) for 1 hour at room temperature. The membrane is removed from the apparatus and washed three times with TBST (0.1% v/v) before incubating with 10 ml of goat anti-mouse IgG (whole molecule)-AP (5,000-fold) for one hour at room temperature. The membrane is washed three times with TBST before color development using an Alkaline Phosphatase Substrate Kit (Bio-Rad). The membrane is washed with tap water when sufficient development has occurred, dried and scanned for presentation.
[0196] Western blot analysis shows a significant increase in antibody reactivity in the mice towards the recombinant vaccine antigens following vaccination. All the mice recognize recombinant proteins which are similar in molecular weight to that of the coomassie blue stained purified recombinant proteins. These experiments provide evidence that the recombinant proteins are immunogenic when used to vaccinate mice and that the vaccination protocol employed can induce specific circulating antibody titres against the antigen. The results indicate that the recombinant proteins can be useful in an effective vaccine for animal species from being colonised by B. hyodysenteriae.
[0197] Vaccination of Pigs Using the Purified Recombinant his-Tagged Proteins
[0198] For each of the purified recombinant his-tagged proteins, ten sero-negative pigs are injected intramuscularly with 1 mg of the particular antigen in 1 ml vaccine volume. The antigen is emulsified with an equal volume of a water-in-oil adjuvant. The pigs are vaccinated at three weeks of age and again at six weeks of age. A second group of ten sero-negative pigs is used as negative controls and are left unvaccinated. All pigs are challenged with 100 ml of an active B. hyodysenteriae culture (˜109 cells/ml) at eight weeks of age, and the pigs are observed for clinical signed of swine dysentery during the experiment (up to six weeks post-challenge) and at post-morten examination.
[0199] Diagnostic Kit
[0200] Serum is obtained from pigs in a piggery with known infection of B. hyodysenteriae, from pigs known to have not been infected with B. hyodysenteriae, and from pigs in piggery with unknown infection with B. hyodysenteriae. Twenty μg of purified recombinant protein is loaded into a 7 cm IEF well, electrophoresed through a 10% (w/v) SDS-PAGE gel, and electro-transferred to nitrocellulose membrane. The membrane is blocked with TBS-skim milk (5% w/v) and assembled into the multi-screen apparatus (Bio-Rad). The wells are incubated with 100 μl of diluted pig serum (100-fold) for one hour at room temperature. The membrane then is removed from the apparatus and washed three times with TBST (0.1% v/v) before incubating with 10 ml of goat anti-swine IgG (whole molecule)-AP (5,000-fold) for one hour at room temperature. The membrane is washed three times with TBST before color development using an Alkaline Phosphatase Substrate Kit (Bio-Rad). The membrane is washed with tap water when sufficient development has occurred, dried and scanned for presentation. One can determine if pigs are infected with B. hyodysenteriae by comparing the results to the positive and negative control.
[0201] While this invention has been described with a reference to specific embodiments, it will be obvious to those of ordinary skill in the art that variations in these methods and compositions may be used and that it is intended that the invention may be practiced otherwise than as specifically described herein. Accordingly this invention includes all modifications encompassed within the spirit and scope of the invention as defined by the claims.
Sequence CWU
1
1
941600DNABrachyspira hyodysenteriae 1atgggtatta gtttagatcc tcaaatcaga
tactatacag gaatagattt gctcaatcaa 60gtaagattaa tagttaaata tggtatgaat
caaactaaaa ctgcatcaga aacatataca 120gcttcttctt ttggttttga tttcagatta
tatttcggag ctatggttgg aaatgttact 180cttaatcctt tcatcaaagt aacttatgat
acttctttag gtgctaaagg taaatctact 240ggaagttatg aagtattatc agacagtgtt
gttattccta caacaactgc agctgattta 300cttgatagag aaacttatac tttatctata
cttcctactt tagctttaga ggcaagcagt 360gatgtagttt ctctttattt agagcctgga
ttaggttatt ctatttatga tgatggtaga 420aaaggttcta aacttaatca ttctttagct
tggtcagctt atgcagaact ttatattact 480cctgttgaag atttagaatg gtattttgag
atggatgtaa ataatgaggg aggagttcct 540attagctttg catctactac aggtattact
tggtacttgc cttctttcgg agcagcagag 6002200PRTBrachyspira hyodysenteriae
2Met Gly Ile Ser Leu Asp Pro Gln Ile Arg Tyr Tyr Thr Gly Ile Asp1
5 10 15 Leu Leu Asn Gln Val
Arg Leu Ile Val Lys Tyr Gly Met Asn Gln Thr 20
25 30 Lys Thr Ala Ser Glu Thr Tyr Thr Ala Ser
Ser Phe Gly Phe Asp Phe 35 40 45
Arg Leu Tyr Phe Gly Ala Met Val Gly Asn Val Thr Leu Asn Pro
Phe 50 55 60 Ile
Lys Val Thr Tyr Asp Thr Ser Leu Gly Ala Lys Gly Lys Ser Thr65
70 75 80 Gly Ser Tyr Glu Val Leu
Ser Asp Ser Val Val Ile Pro Thr Thr Thr 85
90 95 Ala Ala Asp Leu Leu Asp Arg Glu Thr Tyr Thr
Leu Ser Ile Leu Pro 100 105
110 Thr Leu Ala Leu Glu Ala Ser Ser Asp Val Val Ser Leu Tyr Leu
Glu 115 120 125 Pro
Gly Leu Gly Tyr Ser Ile Tyr Asp Asp Gly Arg Lys Gly Ser Lys 130
135 140 Leu Asn His Ser Leu Ala
Trp Ser Ala Tyr Ala Glu Leu Tyr Ile Thr145 150
155 160 Pro Val Glu Asp Leu Glu Trp Tyr Phe Glu Met
Asp Val Asn Asn Glu 165 170
175 Gly Gly Val Pro Ile Ser Phe Ala Ser Thr Thr Gly Ile Thr Trp Tyr
180 185 190 Leu Pro Ser
Phe Gly Ala Ala Glu 195 200 3717DNABrachyspira
hyodysenteriae 3atgaaactac aaataggaat tttaactata gtaaatttaa tagcatttat
accactatta 60tatatgtttg atatatttgg tgttgttaat tattatactt taatgcgtaa
taaaatagca 120cctaatgtac cgggtttttt aacaagattc actcaaaaac ctagagtaga
agatatgact 180cttttggcta gagaagatct taataaaatg agagaatcat tcaatttaag
agaaaaagat 240ttgcaggctc aggaatcttt aatagcaagc agagcaatag aattgaacac
tcaatctgaa 300ttgatagaac aagacagaca aaatctttta aatgcttggt ctaattatca
agctactatg 360gatgaatctt ctcagtatca attagtatta actgaccttg ctaataaaat
caatagtatg 420cctcctcaaa gctctgtggc attacttaat cagttagctg ctaatggttc
tgatgactta 480atcatagatg tattattaga aatggactct atagctgctg ctgaaggaag
aaacagtact 540acttcttacc ttttaagctt aatggatccg aatgttgctg ctagaatatt
agaaaaatat 600gaagcaagat ctaatcctgg aaataataca gtaccttctt cacctaatga
cttccctaat 660tatatgcctg ataataatga cgctatgtta aatgaaggca taatggatat
gggagca 7174239PRTBrachyspira hyodysenteriae 4Met Lys Leu Gln Ile
Gly Ile Leu Thr Ile Val Asn Leu Ile Ala Phe1 5
10 15 Ile Pro Leu Leu Tyr Met Phe Asp Ile Phe
Gly Val Val Asn Tyr Tyr 20 25
30 Thr Leu Met Arg Asn Lys Ile Ala Pro Asn Val Pro Gly Phe Leu
Thr 35 40 45 Arg
Phe Thr Gln Lys Pro Arg Val Glu Asp Met Thr Leu Leu Ala Arg 50
55 60 Glu Asp Leu Asn Lys Met
Arg Glu Ser Phe Asn Leu Arg Glu Lys Asp65 70
75 80 Leu Gln Ala Gln Glu Ser Leu Ile Ala Ser Arg
Ala Ile Glu Leu Asn 85 90
95 Thr Gln Ser Glu Leu Ile Glu Gln Asp Arg Gln Asn Leu Leu Asn Ala
100 105 110 Trp Ser Asn
Tyr Gln Ala Thr Met Asp Glu Ser Ser Gln Tyr Gln Leu 115
120 125 Val Leu Thr Asp Leu Ala Asn Lys
Ile Asn Ser Met Pro Pro Gln Ser 130 135
140 Ser Val Ala Leu Leu Asn Gln Leu Ala Ala Asn Gly Ser
Asp Asp Leu145 150 155
160 Ile Ile Asp Val Leu Leu Glu Met Asp Ser Ile Ala Ala Ala Glu Gly
165 170 175 Arg Asn Ser Thr
Thr Ser Tyr Leu Leu Ser Leu Met Asp Pro Asn Val 180
185 190 Ala Ala Arg Ile Leu Glu Lys Tyr Glu
Ala Arg Ser Asn Pro Gly Asn 195 200
205 Asn Thr Val Pro Ser Ser Pro Asn Asp Phe Pro Asn Tyr Met
Pro Asp 210 215 220
Asn Asn Asp Ala Met Leu Asn Glu Gly Ile Met Asp Met Gly Ala225
230 235 54671DNABrachyspira
hyodysenteriae 5atgtcagatg ttgatgtatt gttaaaagat gaagttaaag ctctatcaag
cagattatca 60gattttgaag agagaataaa agatgatata gtaagagatt tagatgaata
ttctatagaa 120ttaaataatc ttactgataa tgtaggaaaa ttaaattcaa gaatagatga
tgttaaatca 180caaatagaag atagcattaa taaatcttct gaattggaaa ctcttatttc
tagtgaaaaa 240gaagaattag ataataaact atctactatt aaggatgagt tagtatctaa
gtctgaaaat 300gatgatacta tagagaaatt attcactcaa gaaaaagaaa aattaaatga
acttttcaat 360caaataaaag atgataataa agagttcaga tatagattag agaaacgtgt
tgcttatttt 420gaggacactt ggtcagacag cagcagattg aaaaatattt tctcaactga
tataagagaa 480caattggata atatcagaaa tgataatgag attaaatttg aaaattctat
aaattatttg 540aaagataaag tagaatctat agataatgat atatctaatt ggaaagaaaa
cactgttgat 600gaattagtta aacaattagg tgaagctaga gaaagcatat ctaattattt
gaatgattca 660gagataaaag gaaaagaatt agtagataat cttttatcta aaatagatga
aaaagaaaat 720agcatgtatc agactttaga agataaagag aagaacatgt atcaaacttt
agatgataaa 780gaaaagagta tgtatcaaac tctagatgat agagcaagaa acatgtataa
atctttagat 840gaaaaagaaa agtctatata tgaaatctta gataataaag tacaggaaat
agaaagcaga 900ttatctctta ttgattctaa attgaatgat gatataactt ctaacttaga
aaatctatat 960gatatgctaa atgaagcagt agctaaatat gatgaagaga taaaaaatat
tgagcattat 1020agattagatg agaataataa gattttagat gatattgata atgtaggaaa
agaaataaga 1080tcttcttatg aaaattattc taagcttata gaagaggttt ataataattc
tcttaattca 1140ttaaaagatt attctaattc tattaaagat gagatagaaa aatcaagaga
agaaacagaa 1200gaaagacact tgtctagtga gagagaatat attgatgagt atttgaaagg
atattcagaa 1260aaattagaat ctcaagtatc tgataagata aatatattga atgatgctaa
aactgattta 1320gataatatgt taaaatcttc ttttgatgat ttagaagcaa gatttaatga
atctatgact 1380aagtttgaag aatcttcaaa taacagagta ttcaaaactt tacaagatat
agagaaaaaa 1440gctgatgatg taatttatgg aaacaattat atctacaaga tagaagataa
agtaaaagac 1500ttctatggta aaatagatac taaactactt cattttgctg atagatatga
tactttagag 1560aaaaagatat atgatttaga gagcaatcaa aattatatat tcagactcga
agataaaatt 1620agagatttga atgaaaagct agatgataga ataacaaatg ttaatgaaag
atatgataat 1680ttaagaaaat cttttgatga taaatttgtt catatagaaa gtgctgtatt
gaataatgag 1740caagttcaga aattgagaga tgatttcatt attttcaaag atgatgtatt
gaaagctaat 1800agagataata taccagagct attcaataaa gaaaaagaaa aatttgaaga
gttatttaat 1860tcgttcgcta atgatataat atctaaatta gatacttcta atgctaatat
agaagagttc 1920aaaaatacta tgtatgatga aaagaattct atattagaaa atatggaatc
atttagatat 1980gagttagatg aattaaagaa caatgattct attgaagctt tagaagctga
gaaagctaga 2040ttagaagata ctttcaattc tttcagagaa gaatttgaaa gactttatga
tttggaaagt 2100gaagtttata atttgaaaag taatttagat ggtgttgatt ctaatttaag
aagcgatgtt 2160gataaattat ttgatgaagt ttctgagttt aaatatgctt tagaagaaaa
aatagatatt 2220ttagaagata atacagtttc tagagattta tttgatgatg acagagaaaa
attatattct 2280ttatatgatg aacttgaagc aggaaataaa gactttaaag atttaatgga
taagagaata 2340agttattttg aagatacttg gtctgatcct aataaggctt taaaacttta
tgaaaatgct 2400ttaacacctg aagtagataa tttgaaatct gaaatacttt ctaatgtaaa
agatcaagta 2460aatgaaatag aaaagaactt atctgtttgg aaagatgata atttgtctct
tcttttagag 2520caattaaaag aggctaaaga aaatatcgat aactttatag aaagttctaa
agacaagaag 2580aatggtatta ttgccaaaat gatatcttct ataaaagagg aaatattagg
caaagaaagt 2640gagataaata ctcgtcttga agaaaaactt tcttctgtta atgaaagaat
tgctgattta 2700gaaaatagat taacttctga tgttagcaga tttaataata tgatatctga
agcagttgat 2760aaatatgaag atgagcttaa gaatatagaa tcttatagat tagaagaaaa
tgaatctata 2820atgagaaatt tggaagatat tggaagaaat ataatttcaa attatgataa
ttattctaaa 2880atgctagatt ctgtttatga gaataataaa aatgctttag atgagtattc
aaacagctta 2940agaatagaaa tagaaaaagc tagagttgat actaataaag gttatataga
tgaatatttg 3000agtgaatatt cttctaaagt agaggctgat ataaaagaaa gactagaaga
gcttgagaaa 3060aataaatata atttagatgt tatgataaat gattcattta ataatttgaa
tcaaagtatt 3120aataatgcag tatctaaaat gatagaagat tctgattcta aattaagaga
tgttatagat 3180aatttagaag ttcagataaa tgatcttata gctaataaag aagaagaaat
agttagcaga 3240atatcagctt atgaaacaga tctaaaaaat gaacagtatt cttcacttga
agatattaaa 3300aatgagttat taggtcttta taatgagttt aaagagaatg ttaattatga
taatttgaaa 3360gatatatctg aaaaattaga tagtatagaa acttcattgt tagaagttaa
tactcaatta 3420gaaaataaag ctaaagatat ttctgataga atagatttag aaaaagaaga
attatatgct 3480tctgttaata aattgtcttc agaatttgaa gatttcaaat caaatataga
tgacagattc 3540aaaactcaag taagcgattt tgtatctaat aatgagcata tattatcact
ctttggtgaa 3600tatagtgaga aaatttcttc tgtaactaat atattggaag acatagaaaa
tgttaaagta 3660tctttaattg aagaaataaa taaagtaaaa gaagaaatag ataataaata
ttcaagtctt 3720actaaagatt ttgataaatc aatagatgat ataaaagatg ctgtattaga
taagaataat 3780atacttcaat attatataaa tgaaaaagaa ttgttatgga aagagattga
tgctttgaaa 3840gctacttttg cttcaatgaa agataatata ttgaatgcta atgaagcagt
tgctaaatat 3900gctccttcta tcattgatag tgagaaagtt cgtatacagt ctgttataga
cgatgtattt 3960gaaactttaa gtgctaaaat aaataataat gaagacagta tttctaattt
agaatcttct 4020ttctctgaat ataaatctct tatatcagat gctatagacg gatttaaaga
tgaaatttct 4080tctataagaa atagtaataa ctatgatgat ttaattgaag agagaaatag
attggaagaa 4140tcatttaatt ctcttaaaga tgatttctca aaaatagaag atttggaaaa
agatttacat 4200cttgttaaag ctaagttaaa aggtgatgac agcagcttga ttgatgaagt
tatgagactt 4260tctgatgagc ttgaaatctt gaaagataat gtatcaaata tgaataatac
agataataat 4320gtaaatgata ataatgatat tgatgctatt tatgaagatt tcaaacagtt
aaatgaaagt 4380ttagaatcat tcaaagaaac tgttattcct caattatcta cttttagtaa
attggaagat 4440aagatatcag aaaatagaga ggaaatctat aaatatatca atagtataat
gtattcttta 4500cctgaagctt atataagcag agaagagata tctaatttag aaaataaatt
atatgatata 4560tttaataact tcaatgacgg catagtatct ataaagaatg atttagtttt
ctatatagag 4620aaagacacta aagatttcaa agatagaata gaaaagaaga atagagttct t
467161557PRTBrachyspira hyodysenteriae 6Met Ser Asp Val Asp
Val Leu Leu Lys Asp Glu Val Lys Ala Leu Ser1 5
10 15 Ser Arg Leu Ser Asp Phe Glu Glu Arg Ile
Lys Asp Asp Ile Val Arg 20 25
30 Asp Leu Asp Glu Tyr Ser Ile Glu Leu Asn Asn Leu Thr Asp Asn
Val 35 40 45 Gly
Lys Leu Asn Ser Arg Ile Asp Asp Val Lys Ser Gln Ile Glu Asp 50
55 60 Ser Ile Asn Lys Ser Ser
Glu Leu Glu Thr Leu Ile Ser Ser Glu Lys65 70
75 80 Glu Glu Leu Asp Asn Lys Leu Ser Thr Ile Lys
Asp Glu Leu Val Ser 85 90
95 Lys Ser Glu Asn Asp Asp Thr Ile Glu Lys Leu Phe Thr Gln Glu Lys
100 105 110 Glu Lys Leu
Asn Glu Leu Phe Asn Gln Ile Lys Asp Asp Asn Lys Glu 115
120 125 Phe Arg Tyr Arg Leu Glu Lys Arg
Val Ala Tyr Phe Glu Asp Thr Trp 130 135
140 Ser Asp Ser Ser Arg Leu Lys Asn Ile Phe Ser Thr Asp
Ile Arg Glu145 150 155
160 Gln Leu Asp Asn Ile Arg Asn Asp Asn Glu Ile Lys Phe Glu Asn Ser
165 170 175 Ile Asn Tyr Leu
Lys Asp Lys Val Glu Ser Ile Asp Asn Asp Ile Ser 180
185 190 Asn Trp Lys Glu Asn Thr Val Asp Glu
Leu Val Lys Gln Leu Gly Glu 195 200
205 Ala Arg Glu Ser Ile Ser Asn Tyr Leu Asn Asp Ser Glu Ile
Lys Gly 210 215 220
Lys Glu Leu Val Asp Asn Leu Leu Ser Lys Ile Asp Glu Lys Glu Asn225
230 235 240 Ser Met Tyr Gln Thr
Leu Glu Asp Lys Glu Lys Asn Met Tyr Gln Thr 245
250 255 Leu Asp Asp Lys Glu Lys Ser Met Tyr Gln
Thr Leu Asp Asp Arg Ala 260 265
270 Arg Asn Met Tyr Lys Ser Leu Asp Glu Lys Glu Lys Ser Ile Tyr
Glu 275 280 285 Ile
Leu Asp Asn Lys Val Gln Glu Ile Glu Ser Arg Leu Ser Leu Ile 290
295 300 Asp Ser Lys Leu Asn Asp
Asp Ile Thr Ser Asn Leu Glu Asn Leu Tyr305 310
315 320 Asp Met Leu Asn Glu Ala Val Ala Lys Tyr Asp
Glu Glu Ile Lys Asn 325 330
335 Ile Glu His Tyr Arg Leu Asp Glu Asn Asn Lys Ile Leu Asp Asp Ile
340 345 350 Asp Asn Val
Gly Lys Glu Ile Arg Ser Ser Tyr Glu Asn Tyr Ser Lys 355
360 365 Leu Ile Glu Glu Val Tyr Asn Asn
Ser Leu Asn Ser Leu Lys Asp Tyr 370 375
380 Ser Asn Ser Ile Lys Asp Glu Ile Glu Lys Ser Arg Glu
Glu Thr Glu385 390 395
400 Glu Arg His Leu Ser Ser Glu Arg Glu Tyr Ile Asp Glu Tyr Leu Lys
405 410 415 Gly Tyr Ser Glu
Lys Leu Glu Ser Gln Val Ser Asp Lys Ile Asn Ile 420
425 430 Leu Asn Asp Ala Lys Thr Asp Leu Asp
Asn Met Leu Lys Ser Ser Phe 435 440
445 Asp Asp Leu Glu Ala Arg Phe Asn Glu Ser Met Thr Lys Phe
Glu Glu 450 455 460
Ser Ser Asn Asn Arg Val Phe Lys Thr Leu Gln Asp Ile Glu Lys Lys465
470 475 480 Ala Asp Asp Val Ile
Tyr Gly Asn Asn Tyr Ile Tyr Lys Ile Glu Asp 485
490 495 Lys Val Lys Asp Phe Tyr Gly Lys Ile Asp
Thr Lys Leu Leu His Phe 500 505
510 Ala Asp Arg Tyr Asp Thr Leu Glu Lys Lys Ile Tyr Asp Leu Glu
Ser 515 520 525 Asn
Gln Asn Tyr Ile Phe Arg Leu Glu Asp Lys Ile Arg Asp Leu Asn 530
535 540 Glu Lys Leu Asp Asp Arg
Ile Thr Asn Val Asn Glu Arg Tyr Asp Asn545 550
555 560 Leu Arg Lys Ser Phe Asp Asp Lys Phe Val His
Ile Glu Ser Ala Val 565 570
575 Leu Asn Asn Glu Gln Val Gln Lys Leu Arg Asp Asp Phe Ile Ile Phe
580 585 590 Lys Asp Asp
Val Leu Lys Ala Asn Arg Asp Asn Ile Pro Glu Leu Phe 595
600 605 Asn Lys Glu Lys Glu Lys Phe Glu
Glu Leu Phe Asn Ser Phe Ala Asn 610 615
620 Asp Ile Ile Ser Lys Leu Asp Thr Ser Asn Ala Asn Ile
Glu Glu Phe625 630 635
640 Lys Asn Thr Met Tyr Asp Glu Lys Asn Ser Ile Leu Glu Asn Met Glu
645 650 655 Ser Phe Arg Tyr
Glu Leu Asp Glu Leu Lys Asn Asn Asp Ser Ile Glu 660
665 670 Ala Leu Glu Ala Glu Lys Ala Arg Leu
Glu Asp Thr Phe Asn Ser Phe 675 680
685 Arg Glu Glu Phe Glu Arg Leu Tyr Asp Leu Glu Ser Glu Val
Tyr Asn 690 695 700
Leu Lys Ser Asn Leu Asp Gly Val Asp Ser Asn Leu Arg Ser Asp Val705
710 715 720 Asp Lys Leu Phe Asp
Glu Val Ser Glu Phe Lys Tyr Ala Leu Glu Glu 725
730 735 Lys Ile Asp Ile Leu Glu Asp Asn Thr Val
Ser Arg Asp Leu Phe Asp 740 745
750 Asp Asp Arg Glu Lys Leu Tyr Ser Leu Tyr Asp Glu Leu Glu Ala
Gly 755 760 765 Asn
Lys Asp Phe Lys Asp Leu Met Asp Lys Arg Ile Ser Tyr Phe Glu 770
775 780 Asp Thr Trp Ser Asp Pro
Asn Lys Ala Leu Lys Leu Tyr Glu Asn Ala785 790
795 800 Leu Thr Pro Glu Val Asp Asn Leu Lys Ser Glu
Ile Leu Ser Asn Val 805 810
815 Lys Asp Gln Val Asn Glu Ile Glu Lys Asn Leu Ser Val Trp Lys Asp
820 825 830 Asp Asn Leu
Ser Leu Leu Leu Glu Gln Leu Lys Glu Ala Lys Glu Asn 835
840 845 Ile Asp Asn Phe Ile Glu Ser Ser
Lys Asp Lys Lys Asn Gly Ile Ile 850 855
860 Ala Lys Met Ile Ser Ser Ile Lys Glu Glu Ile Leu Gly
Lys Glu Ser865 870 875
880 Glu Ile Asn Thr Arg Leu Glu Glu Lys Leu Ser Ser Val Asn Glu Arg
885 890 895 Ile Ala Asp Leu
Glu Asn Arg Leu Thr Ser Asp Val Ser Arg Phe Asn 900
905 910 Asn Met Ile Ser Glu Ala Val Asp Lys
Tyr Glu Asp Glu Leu Lys Asn 915 920
925 Ile Glu Ser Tyr Arg Leu Glu Glu Asn Glu Ser Ile Met Arg
Asn Leu 930 935 940
Glu Asp Ile Gly Arg Asn Ile Ile Ser Asn Tyr Asp Asn Tyr Ser Lys945
950 955 960 Met Leu Asp Ser Val
Tyr Glu Asn Asn Lys Asn Ala Leu Asp Glu Tyr 965
970 975 Ser Asn Ser Leu Arg Ile Glu Ile Glu Lys
Ala Arg Val Asp Thr Asn 980 985
990 Lys Gly Tyr Ile Asp Glu Tyr Leu Ser Glu Tyr Ser Ser Lys Val
Glu 995 1000 1005 Ala
Asp Ile Lys Glu Arg Leu Glu Glu Leu Glu Lys Asn Lys Tyr Asn 1010
1015 1020 Leu Asp Val Met Ile Asn
Asp Ser Phe Asn Asn Leu Asn Gln Ser Ile1025 1030
1035 1040Asn Asn Ala Val Ser Lys Met Ile Glu Asp Ser
Asp Ser Lys Leu Arg 1045 1050
1055 Asp Val Ile Asp Asn Leu Glu Val Gln Ile Asn Asp Leu Ile Ala Asn
1060 1065 1070 Lys Glu Glu
Glu Ile Val Ser Arg Ile Ser Ala Tyr Glu Thr Asp Leu 1075
1080 1085 Lys Asn Glu Gln Tyr Ser Ser Leu
Glu Asp Ile Lys Asn Glu Leu Leu 1090 1095
1100 Gly Leu Tyr Asn Glu Phe Lys Glu Asn Val Asn Tyr Asp
Asn Leu Lys1105 1110 1115
1120Asp Ile Ser Glu Lys Leu Asp Ser Ile Glu Thr Ser Leu Leu Glu Val
1125 1130 1135 Asn Thr Gln Leu
Glu Asn Lys Ala Lys Asp Ile Ser Asp Arg Ile Asp 1140
1145 1150 Leu Glu Lys Glu Glu Leu Tyr Ala Ser
Val Asn Lys Leu Ser Ser Glu 1155 1160
1165 Phe Glu Asp Phe Lys Ser Asn Ile Asp Asp Arg Phe Lys Thr
Gln Val 1170 1175 1180
Ser Asp Phe Val Ser Asn Asn Glu His Ile Leu Ser Leu Phe Gly Glu1185
1190 1195 1200Tyr Ser Glu Lys Ile
Ser Ser Val Thr Asn Ile Leu Glu Asp Ile Glu 1205
1210 1215 Asn Val Lys Val Ser Leu Ile Glu Glu Ile
Asn Lys Val Lys Glu Glu 1220 1225
1230 Ile Asp Asn Lys Tyr Ser Ser Leu Thr Lys Asp Phe Asp Lys Ser
Ile 1235 1240 1245 Asp
Asp Ile Lys Asp Ala Val Leu Asp Lys Asn Asn Ile Leu Gln Tyr 1250
1255 1260 Tyr Ile Asn Glu Lys Glu
Leu Leu Trp Lys Glu Ile Asp Ala Leu Lys1265 1270
1275 1280Ala Thr Phe Ala Ser Met Lys Asp Asn Ile Leu
Asn Ala Asn Glu Ala 1285 1290
1295 Val Ala Lys Tyr Ala Pro Ser Ile Ile Asp Ser Glu Lys Val Arg Ile
1300 1305 1310 Gln Ser Val
Ile Asp Asp Val Phe Glu Thr Leu Ser Ala Lys Ile Asn 1315
1320 1325 Asn Asn Glu Asp Ser Ile Ser Asn
Leu Glu Ser Ser Phe Ser Glu Tyr 1330 1335
1340 Lys Ser Leu Ile Ser Asp Ala Ile Asp Gly Phe Lys Asp
Glu Ile Ser1345 1350 1355
1360Ser Ile Arg Asn Ser Asn Asn Tyr Asp Asp Leu Ile Glu Glu Arg Asn
1365 1370 1375 Arg Leu Glu Glu
Ser Phe Asn Ser Leu Lys Asp Asp Phe Ser Lys Ile 1380
1385 1390 Glu Asp Leu Glu Lys Asp Leu His Leu
Val Lys Ala Lys Leu Lys Gly 1395 1400
1405 Asp Asp Ser Ser Leu Ile Asp Glu Val Met Arg Leu Ser Asp
Glu Leu 1410 1415 1420
Glu Ile Leu Lys Asp Asn Val Ser Asn Met Asn Asn Thr Asp Asn Asn1425
1430 1435 1440Val Asn Asp Asn Asn
Asp Ile Asp Ala Ile Tyr Glu Asp Phe Lys Gln 1445
1450 1455 Leu Asn Glu Ser Leu Glu Ser Phe Lys Glu
Thr Val Ile Pro Gln Leu 1460 1465
1470 Ser Thr Phe Ser Lys Leu Glu Asp Lys Ile Ser Glu Asn Arg Glu
Glu 1475 1480 1485 Ile
Tyr Lys Tyr Ile Asn Ser Ile Met Tyr Ser Leu Pro Glu Ala Tyr 1490
1495 1500 Ile Ser Arg Glu Glu Ile
Ser Asn Leu Glu Asn Lys Leu Tyr Asp Ile1505 1510
1515 1520Phe Asn Asn Phe Asn Asp Gly Ile Val Ser Ile
Lys Asn Asp Leu Val 1525 1530
1535 Phe Tyr Ile Glu Lys Asp Thr Lys Asp Phe Lys Asp Arg Ile Glu Lys
1540 1545 1550 Lys Asn Arg
Val Leu 1555 72256DNABrachyspira hyodysenteriae 7atgaaaaata
ctattttaaa aatttttaat aaaagagttt taatatttac actttgtttt 60gaaatcattg
ttattgtaat gacatccatg ttgggtgctc aggatatatc attacaaaag 120aatattatat
caaaaaataa aatcaattat ggtacggcat tagaacttca taatagagga 180aaatatttag
aggcttataa tcaatttaca aatatcatga atacagaaga tgatatgatc 240attagagatt
atactatata ttacggagct aaaagtgctt tgctaactaa tatgtataat 300gaagcaatag
atttatatgc cttactaatg aaagaatatc cgcgttcatc attatatcct 360tatgcagagc
aatataaggc tctttctgag ttttatagag atgattatcc tataagcaat 420ttttttaatg
gtaaatctca aaaatggatt aaagaatttg ttggaataag agctttaaga 480gatactgatg
ataccaataa ggctagaatg atagcttatg aacttttaaa cagattcgga 540ttaagcgaag
ctgctatata ttataataat aatttccctg aagatatttc atcttttcca 600aataatttaa
aatttaaaac agcaaccata ctttatgaag caggatatag aaaagcatct 660ttaaagcatt
ttcagtattt atatgataat aatgcttata aagcaagttc tacatattat 720atggctagaa
ttaaacagaa gtctggagac agaagagatg ctgcggcttt attcgatgag 780tatttatcaa
atcttaacaa taaatctcat agaagattag gtctttacta ttctgcagat 840aattataata
gattaaaaaa ttatgaaaaa tcaatagaac tttataatac ttttttgaaa 900gaatatccta
gagatgatta tgttcctaga atatataata gttttgttac tttgagtttg 960aatagaaata
atttagttca ggcaaaaact tatcttacta atgtaatgaa gagatttcct 1020aaaagcagat
atacagagct tgcattaaaa tcatatttaa gaaaggcatt caaattaaat 1080aataaaacag
aaacttattt tgctactaag gctttagaag caagatatcc tagtttcaga 1140catgattttg
cattatcttg gaatatgtgg actgctgaag agtttggaga tattgaaaaa 1200agagatgaat
atttaatgaa aacacttctt acaagtaaaa gccattattt tataaaaggt 1260gctttgagtc
ttgccaataa tgaaatgata gctaatgttc agcttagcaa tacttattat 1320ttaaatgaag
ctaaaagata ttatgctgat tctaatttta ctaaatctat gcagatgctt 1380aataagatac
aatttttaaa ttatattgct acaggtaaag aagataatat aacaagagag 1440gctagggcat
tggctaaaaa tattcttatg cataatagat ttgtaaaaga tttatacgct 1500aatagaagcg
aggatgattt atttaatgaa ttatcacttc agactagaag agaagttaat 1560aaagcaataa
tattatacta ttatggcgat tatgataatg catatactga attcgataaa 1620atatttaaaa
agacacaggt aacatatcct ttattttatt ttgctgaaaa aatatttaaa 1680gattcaggaa
atacaaaaag gcttatacaa gtatcagcaa atataggaaa atattttgga 1740tatccttaca
gtgataatgt tgatttgctt cctgatgagt ttagaaagag agtttatcct 1800agatattttg
atgaatatgt tgtacctgaa gctaaatatt ataaaataga gcctgctttt 1860gtatatgcta
taatgcgtga agaaagttta tttgatccta aagctaaatc ttgggttgga 1920gctatgggac
ttatgcagtt aatgcctaca acagcagcag ctgaaaataa aaaggcaaga 1980tatagatata
atcctttaga tttaacagat cctaagcaga atattaattt aggagtttct 2040catttaggct
ggttattcag cagtcaaaag gctagcaatt atatattagt agcagcaagt 2100tataatgcag
gttcaggacg cggaagaaga tggaaagcag agtatggtac taataatatg 2160tatcgtacag
gaagattcat tgatattgaa gaaactgaat attatgtaga gagagttatt 2220aaaagctatg
aatattacag caagtattat aaggac
22568752PRTBrachyspira hyodysenteriae 8Met Lys Asn Thr Ile Leu Lys Ile
Phe Asn Lys Arg Val Leu Ile Phe1 5 10
15 Thr Leu Cys Phe Glu Ile Ile Val Ile Val Met Thr Ser
Met Leu Gly 20 25 30
Ala Gln Asp Ile Ser Leu Gln Lys Asn Ile Ile Ser Lys Asn Lys Ile
35 40 45 Asn Tyr Gly Thr
Ala Leu Glu Leu His Asn Arg Gly Lys Tyr Leu Glu 50 55
60 Ala Tyr Asn Gln Phe Thr Asn Ile Met
Asn Thr Glu Asp Asp Met Ile65 70 75
80 Ile Arg Asp Tyr Thr Ile Tyr Tyr Gly Ala Lys Ser Ala Leu
Leu Thr 85 90 95
Asn Met Tyr Asn Glu Ala Ile Asp Leu Tyr Ala Leu Leu Met Lys Glu
100 105 110 Tyr Pro Arg Ser Ser
Leu Tyr Pro Tyr Ala Glu Gln Tyr Lys Ala Leu 115
120 125 Ser Glu Phe Tyr Arg Asp Asp Tyr Pro
Ile Ser Asn Phe Phe Asn Gly 130 135
140 Lys Ser Gln Lys Trp Ile Lys Glu Phe Val Gly Ile Arg
Ala Leu Arg145 150 155
160 Asp Thr Asp Asp Thr Asn Lys Ala Arg Met Ile Ala Tyr Glu Leu Leu
165 170 175 Asn Arg Phe Gly
Leu Ser Glu Ala Ala Ile Tyr Tyr Asn Asn Asn Phe 180
185 190 Pro Glu Asp Ile Ser Ser Phe Pro Asn
Asn Leu Lys Phe Lys Thr Ala 195 200
205 Thr Ile Leu Tyr Glu Ala Gly Tyr Arg Lys Ala Ser Leu Lys
His Phe 210 215 220
Gln Tyr Leu Tyr Asp Asn Asn Ala Tyr Lys Ala Ser Ser Thr Tyr Tyr225
230 235 240 Met Ala Arg Ile Lys
Gln Lys Ser Gly Asp Arg Arg Asp Ala Ala Ala 245
250 255 Leu Phe Asp Glu Tyr Leu Ser Asn Leu Asn
Asn Lys Ser His Arg Arg 260 265
270 Leu Gly Leu Tyr Tyr Ser Ala Asp Asn Tyr Asn Arg Leu Lys Asn
Tyr 275 280 285 Glu
Lys Ser Ile Glu Leu Tyr Asn Thr Phe Leu Lys Glu Tyr Pro Arg 290
295 300 Asp Asp Tyr Val Pro Arg
Ile Tyr Asn Ser Phe Val Thr Leu Ser Leu305 310
315 320 Asn Arg Asn Asn Leu Val Gln Ala Lys Thr Tyr
Leu Thr Asn Val Met 325 330
335 Lys Arg Phe Pro Lys Ser Arg Tyr Thr Glu Leu Ala Leu Lys Ser Tyr
340 345 350 Leu Arg Lys
Ala Phe Lys Leu Asn Asn Lys Thr Glu Thr Tyr Phe Ala 355
360 365 Thr Lys Ala Leu Glu Ala Arg Tyr
Pro Ser Phe Arg His Asp Phe Ala 370 375
380 Leu Ser Trp Asn Met Trp Thr Ala Glu Glu Phe Gly Asp
Ile Glu Lys385 390 395
400 Arg Asp Glu Tyr Leu Met Lys Thr Leu Leu Thr Ser Lys Ser His Tyr
405 410 415 Phe Ile Lys Gly
Ala Leu Ser Leu Ala Asn Asn Glu Met Ile Ala Asn 420
425 430 Val Gln Leu Ser Asn Thr Tyr Tyr Leu
Asn Glu Ala Lys Arg Tyr Tyr 435 440
445 Ala Asp Ser Asn Phe Thr Lys Ser Met Gln Met Leu Asn Lys
Ile Gln 450 455 460
Phe Leu Asn Tyr Ile Ala Thr Gly Lys Glu Asp Asn Ile Thr Arg Glu465
470 475 480 Ala Arg Ala Leu Ala
Lys Asn Ile Leu Met His Asn Arg Phe Val Lys 485
490 495 Asp Leu Tyr Ala Asn Arg Ser Glu Asp Asp
Leu Phe Asn Glu Leu Ser 500 505
510 Leu Gln Thr Arg Arg Glu Val Asn Lys Ala Ile Ile Leu Tyr Tyr
Tyr 515 520 525 Gly
Asp Tyr Asp Asn Ala Tyr Thr Glu Phe Asp Lys Ile Phe Lys Lys 530
535 540 Thr Gln Val Thr Tyr Pro
Leu Phe Tyr Phe Ala Glu Lys Ile Phe Lys545 550
555 560 Asp Ser Gly Asn Thr Lys Arg Leu Ile Gln Val
Ser Ala Asn Ile Gly 565 570
575 Lys Tyr Phe Gly Tyr Pro Tyr Ser Asp Asn Val Asp Leu Leu Pro Asp
580 585 590 Glu Phe Arg
Lys Arg Val Tyr Pro Arg Tyr Phe Asp Glu Tyr Val Val 595
600 605 Pro Glu Ala Lys Tyr Tyr Lys Ile
Glu Pro Ala Phe Val Tyr Ala Ile 610 615
620 Met Arg Glu Glu Ser Leu Phe Asp Pro Lys Ala Lys Ser
Trp Val Gly625 630 635
640 Ala Met Gly Leu Met Gln Leu Met Pro Thr Thr Ala Ala Ala Glu Asn
645 650 655 Lys Lys Ala Arg
Tyr Arg Tyr Asn Pro Leu Asp Leu Thr Asp Pro Lys 660
665 670 Gln Asn Ile Asn Leu Gly Val Ser His
Leu Gly Trp Leu Phe Ser Ser 675 680
685 Gln Lys Ala Ser Asn Tyr Ile Leu Val Ala Ala Ser Tyr Asn
Ala Gly 690 695 700
Ser Gly Arg Gly Arg Arg Trp Lys Ala Glu Tyr Gly Thr Asn Asn Met705
710 715 720 Tyr Arg Thr Gly Arg
Phe Ile Asp Ile Glu Glu Thr Glu Tyr Tyr Val 725
730 735 Glu Arg Val Ile Lys Ser Tyr Glu Tyr Tyr
Ser Lys Tyr Tyr Lys Asp 740 745
750 9723DNABrachyspira hyodysenteriae 9atggaaacta gattgcttta
caactttgaa acattagacg aatggcaacc aatatcaaat 60gccagccgct ttatgtttag
aggtgataga acaaatgaaa atggtgttgt aatgaaatat 120cctaatatga gattgttcgc
tacaaaacca tatggtatgg gtaaccaaag ttataattca 180actaattcat tatcagtaag
tgtttctttt ttcagaaaat cttataactt ctttgattta 240gttccaacag tacaaaaaat
cataccaggt aaagctcaaa cttttgatgt ttgggtatgg 300ggtggtaatt atgactatac
tatggaaatg atatttgaag attatcgtgg ttatacttat 360acattacctt taggatctat
aagatatata ggttggagaa atatgagtac agcagtgcca 420tctttcattc ctcaagaaga
gccttatgtt cctagagcta aaggtttaag atttatgaat 480ttccgtttct ggtcatcacc
agaggaaaga gcagataact ttgtagtttt attggattac 540ttccaaacag taacagatac
attcagagaa gcttatgacg gatctgatat tgaaactaca 600ttaggtcagg aagttggcgg
aagatcttct gaacaatata cagaaggcgg agctaaagta 660gtaggtgaag acggcggtaa
cgctggagct gctactacag aacagccaca agaagcgcaa 720caa
72310241PRTBrachyspira
hyodysenteriae 10Met Glu Thr Arg Leu Leu Tyr Asn Phe Glu Thr Leu Asp Glu
Trp Gln1 5 10 15
Pro Ile Ser Asn Ala Ser Arg Phe Met Phe Arg Gly Asp Arg Thr Asn
20 25 30 Glu Asn Gly Val Val
Met Lys Tyr Pro Asn Met Arg Leu Phe Ala Thr 35 40
45 Lys Pro Tyr Gly Met Gly Asn Gln Ser Tyr
Asn Ser Thr Asn Ser Leu 50 55 60
Ser Val Ser Val Ser Phe Phe Arg Lys Ser Tyr Asn Phe Phe Asp
Leu65 70 75 80 Val
Pro Thr Val Gln Lys Ile Ile Pro Gly Lys Ala Gln Thr Phe Asp
85 90 95 Val Trp Val Trp Gly Gly
Asn Tyr Asp Tyr Thr Met Glu Met Ile Phe 100
105 110 Glu Asp Tyr Arg Gly Tyr Thr Tyr Thr Leu
Pro Leu Gly Ser Ile Arg 115 120
125 Tyr Ile Gly Trp Arg Asn Met Ser Thr Ala Val Pro Ser Phe
Ile Pro 130 135 140
Gln Glu Glu Pro Tyr Val Pro Arg Ala Lys Gly Leu Arg Phe Met Asn145
150 155 160 Phe Arg Phe Trp Ser
Ser Pro Glu Glu Arg Ala Asp Asn Phe Val Val 165
170 175 Leu Leu Asp Tyr Phe Gln Thr Val Thr Asp
Thr Phe Arg Glu Ala Tyr 180 185
190 Asp Gly Ser Asp Ile Glu Thr Thr Leu Gly Gln Glu Val Gly Gly
Arg 195 200 205 Ser
Ser Glu Gln Tyr Thr Glu Gly Gly Ala Lys Val Val Gly Glu Asp 210
215 220 Gly Gly Asn Ala Gly Ala
Ala Thr Thr Glu Gln Pro Gln Glu Ala Gln225 230
235 240 Gln113129DNABrachyspira hyodysenteriae
11atgattgaag aagaaagaag acaggttgct gaaatgtttg aaagcataca aaatgattct
60atagatactg atttgagata tcttacagat tcattcagag atgatatcat aaaagtattt
120gaagaatcta atgatgagtt cagaaaacgt gtagaagcta gaatagttca ttttgaagat
180gcttatgctt cacctgatag aataaaagaa ttctataaag atgctatact ttctgaagtg
240gacagcttga gaagtgatgc agaacagata cttatagatt taaatgataa ggtagaaaat
300gcaaaagaac agatagaagt attagaaaat gatagagtaa aagacataat caataaaata
360gatgaagcag aaaatgatat taattcttta ataaatacta taaaagctaa tattaaagaa
420caagaaaatg agcttagaat gttgagccaa tctcagaaac atatatctca ggaagtagag
480actgttcgca gagagagaga agctcttatg gatatggtta aaaactctga tataaatata
540agaaacaagc ttgacagttt aacaagtgct gtatcagaag ctgcagagat tgcttcatct
600aagatagctg aaaaagaagc agcattcagc agtaaagtta aagaagctga agaatatatt
660aattcattgt ctgatagaat tacattagaa aataacagtg ctttagataa agctagagaa
720gatattaata atttagttgc ttctttcaat gaatcagtta taaaagagac taatgatttg
780gcacctcata taactaatac agttcagaat ttcattaata atgaaatgaa aaaatttgat
840aaattctcag atgttagaag tgctatagaa ggcattgaga atgatattaa taacaagata
900actgaagcat tcaataatat gaacaaagaa cttgaagata atattgttga atttagaaag
960aaaatagata catatcagga agagtttatc agtgaattaa agatgtctgt aaatgtagag
1020ggtgaaaaag ctgttgatga aattaagtct ttacataatg atgaagttgc taaattaaaa
1080gagatgtatt taactactga aaaattctat acagatagac aagagaaaaa ccatgaagac
1140ttctcaaaat tatttgaaga aacttataaa gactataatg aaaaaataga atcattatat
1200gctcaattag atgatactaa acttcaaata agtacttctg ttgaagatgt tgttgctgat
1260ttgaagcagg ctttaagcat aaaagatgag ttcttaactt cagttgaaaa taataaagaa
1320aaacttgaag ctgttgaaga gcaaatgaat aatttacaga atgaatttgc tccttcagta
1380gaaaaattga aagacataat agaagaaaag gcattagaat tacaagagaa aatcaatgaa
1440tactctcaag atatagaact tcaaggagat aagttcaatt ctagattgga agagttatct
1500aataatgcta aatctactat agaagataag gtaactgaat ttgattctat aatagaaaat
1560atttctaata aaatggatac tttattagaa gaaaagaatt cagagttcga tgcattaaaa
1620gcacattatg aaggactttc agaatcattg acagcattga aagatactat atcagaagca
1680gttaatgaaa gaatagaaga agcaaatagc attatagagg aaaatgttca gactatagaa
1740gaatcagcta atgaaaaata tgaaaaatac atagcaagac ttaattctaa tttagaacaa
1800acattgtctc ttttaatgaa cgatgctaaa gaacatatac agaaagctaa agatgaaata
1860attaaagctc atactgataa tttagatgag tatgatcaga gaattacaaa tatgaaagat
1920attgtttcag ctttagaaga agatataact aaatattctt ctgagataga tgcaagactt
1980gaaagtatta atttaagcta tgatgaaaaa acaaatgtta tacttaaaga ttttgaaaat
2040agaactgatg atttgaaatt gaaattaaat gatgcatctg aatctattga caaaatgctt
2100gatttaaaaa ctaatgatat ttctttagag tatgaggcta tgaaatcaaa aatagatgat
2160atagctaaag atatagaaaa atacatgaat actgttaaag tatttgataa tgctaaagaa
2220atggcagatt ctataagaga tgacgtttct aagttgaatg ctttggttga ggatactaaa
2280gctacaacaa ttgaaatgaa taagactatg tccgaatttg atagcttaaa gaaaatgcat
2340caggaaatat taggatatgc agaaagtctt aaaaaggaaa aagacagctt gaaagatact
2400caggaaaaag taaatatgtt aatggaaatg tctggtgaaa ttcaagagag attcgttaat
2460atagcagaaa ataatgctat gatagagcat gctgaggaag gaatacaggt tgttatagat
2520atagcatctc aaatagaaaa taaactttca ttcattaagg ataaggaaga gtatgcagat
2580gatatattac agcaaataag aaaagctgaa gtagaaaccg aaactatttt agaaagagta
2640gatagtataa aagaagctat ggttgaagtt gaagatacta gaaagaactt tatggataag
2700atttattctt tagaaagaga tatggctaaa atagataaga atgataaaaa agttcagttg
2760tttatttcta aattagaaga gataaatgat ataatagatg ccatacagga tcaaagagaa
2820aatcttgttc gtatgaagaa tcagtatgat gattatgata agaacatagt taagaatttg
2880gaaagagctg aatattttgt aagatattta gagactttac tagataatgc tgataaatat
2940atgtctgata aaggttctaa gacttctaaa aaaggaacag ctgctaaaat agatagtaag
3000aaagaagagt ttataattag aatgtataaa gaaggttgga aaccagatga gatagttaaa
3060aatagttcat attcaagaga tgaagttgaa agaactataa aagcatggaa agataagcaa
3120tccagagga
3129121043PRTBrachyspira hyodysenteriae 12Met Ile Glu Glu Glu Arg Arg Gln
Val Ala Glu Met Phe Glu Ser Ile1 5 10
15 Gln Asn Asp Ser Ile Asp Thr Asp Leu Arg Tyr Leu Thr
Asp Ser Phe 20 25 30
Arg Asp Asp Ile Ile Lys Val Phe Glu Glu Ser Asn Asp Glu Phe Arg
35 40 45 Lys Arg Val Glu
Ala Arg Ile Val His Phe Glu Asp Ala Tyr Ala Ser 50 55
60 Pro Asp Arg Ile Lys Glu Phe Tyr Lys
Asp Ala Ile Leu Ser Glu Val65 70 75
80 Asp Ser Leu Arg Ser Asp Ala Glu Gln Ile Leu Ile Asp Leu
Asn Asp 85 90 95
Lys Val Glu Asn Ala Lys Glu Gln Ile Glu Val Leu Glu Asn Asp Arg
100 105 110 Val Lys Asp Ile Ile
Asn Lys Ile Asp Glu Ala Glu Asn Asp Ile Asn 115
120 125 Ser Leu Ile Asn Thr Ile Lys Ala Asn
Ile Lys Glu Gln Glu Asn Glu 130 135
140 Leu Arg Met Leu Ser Gln Ser Gln Lys His Ile Ser Gln
Glu Val Glu145 150 155
160 Thr Val Arg Arg Glu Arg Glu Ala Leu Met Asp Met Val Lys Asn Ser
165 170 175 Asp Ile Asn Ile
Arg Asn Lys Leu Asp Ser Leu Thr Ser Ala Val Ser 180
185 190 Glu Ala Ala Glu Ile Ala Ser Ser Lys
Ile Ala Glu Lys Glu Ala Ala 195 200
205 Phe Ser Ser Lys Val Lys Glu Ala Glu Glu Tyr Ile Asn Ser
Leu Ser 210 215 220
Asp Arg Ile Thr Leu Glu Asn Asn Ser Ala Leu Asp Lys Ala Arg Glu225
230 235 240 Asp Ile Asn Asn Leu
Val Ala Ser Phe Asn Glu Ser Val Ile Lys Glu 245
250 255 Thr Asn Asp Leu Ala Pro His Ile Thr Asn
Thr Val Gln Asn Phe Ile 260 265
270 Asn Asn Glu Met Lys Lys Phe Asp Lys Phe Ser Asp Val Arg Ser
Ala 275 280 285 Ile
Glu Gly Ile Glu Asn Asp Ile Asn Asn Lys Ile Thr Glu Ala Phe 290
295 300 Asn Asn Met Asn Lys Glu
Leu Glu Asp Asn Ile Val Glu Phe Arg Lys305 310
315 320 Lys Ile Asp Thr Tyr Gln Glu Glu Phe Ile Ser
Glu Leu Lys Met Ser 325 330
335 Val Asn Val Glu Gly Glu Lys Ala Val Asp Glu Ile Lys Ser Leu His
340 345 350 Asn Asp Glu
Val Ala Lys Leu Lys Glu Met Tyr Leu Thr Thr Glu Lys 355
360 365 Phe Tyr Thr Asp Arg Gln Glu Lys
Asn His Glu Asp Phe Ser Lys Leu 370 375
380 Phe Glu Glu Thr Tyr Lys Asp Tyr Asn Glu Lys Ile Glu
Ser Leu Tyr385 390 395
400 Ala Gln Leu Asp Asp Thr Lys Leu Gln Ile Ser Thr Ser Val Glu Asp
405 410 415 Val Val Ala Asp
Leu Lys Gln Ala Leu Ser Ile Lys Asp Glu Phe Leu 420
425 430 Thr Ser Val Glu Asn Asn Lys Glu Lys
Leu Glu Ala Val Glu Glu Gln 435 440
445 Met Asn Asn Leu Gln Asn Glu Phe Ala Pro Ser Val Glu Lys
Leu Lys 450 455 460
Asp Ile Ile Glu Glu Lys Ala Leu Glu Leu Gln Glu Lys Ile Asn Glu465
470 475 480 Tyr Ser Gln Asp Ile
Glu Leu Gln Gly Asp Lys Phe Asn Ser Arg Leu 485
490 495 Glu Glu Leu Ser Asn Asn Ala Lys Ser Thr
Ile Glu Asp Lys Val Thr 500 505
510 Glu Phe Asp Ser Ile Ile Glu Asn Ile Ser Asn Lys Met Asp Thr
Leu 515 520 525 Leu
Glu Glu Lys Asn Ser Glu Phe Asp Ala Leu Lys Ala His Tyr Glu 530
535 540 Gly Leu Ser Glu Ser Leu
Thr Ala Leu Lys Asp Thr Ile Ser Glu Ala545 550
555 560 Val Asn Glu Arg Ile Glu Glu Ala Asn Ser Ile
Ile Glu Glu Asn Val 565 570
575 Gln Thr Ile Glu Glu Ser Ala Asn Glu Lys Tyr Glu Lys Tyr Ile Ala
580 585 590 Arg Leu Asn
Ser Asn Leu Glu Gln Thr Leu Ser Leu Leu Met Asn Asp 595
600 605 Ala Lys Glu His Ile Gln Lys Ala
Lys Asp Glu Ile Ile Lys Ala His 610 615
620 Thr Asp Asn Leu Asp Glu Tyr Asp Gln Arg Ile Thr Asn
Met Lys Asp625 630 635
640 Ile Val Ser Ala Leu Glu Glu Asp Ile Thr Lys Tyr Ser Ser Glu Ile
645 650 655 Asp Ala Arg Leu
Glu Ser Ile Asn Leu Ser Tyr Asp Glu Lys Thr Asn 660
665 670 Val Ile Leu Lys Asp Phe Glu Asn Arg
Thr Asp Asp Leu Lys Leu Lys 675 680
685 Leu Asn Asp Ala Ser Glu Ser Ile Asp Lys Met Leu Asp Leu
Lys Thr 690 695 700
Asn Asp Ile Ser Leu Glu Tyr Glu Ala Met Lys Ser Lys Ile Asp Asp705
710 715 720 Ile Ala Lys Asp Ile
Glu Lys Tyr Met Asn Thr Val Lys Val Phe Asp 725
730 735 Asn Ala Lys Glu Met Ala Asp Ser Ile Arg
Asp Asp Val Ser Lys Leu 740 745
750 Asn Ala Leu Val Glu Asp Thr Lys Ala Thr Thr Ile Glu Met Asn
Lys 755 760 765 Thr
Met Ser Glu Phe Asp Ser Leu Lys Lys Met His Gln Glu Ile Leu 770
775 780 Gly Tyr Ala Glu Ser Leu
Lys Lys Glu Lys Asp Ser Leu Lys Asp Thr785 790
795 800 Gln Glu Lys Val Asn Met Leu Met Glu Met Ser
Gly Glu Ile Gln Glu 805 810
815 Arg Phe Val Asn Ile Ala Glu Asn Asn Ala Met Ile Glu His Ala Glu
820 825 830 Glu Gly Ile
Gln Val Val Ile Asp Ile Ala Ser Gln Ile Glu Asn Lys 835
840 845 Leu Ser Phe Ile Lys Asp Lys Glu
Glu Tyr Ala Asp Asp Ile Leu Gln 850 855
860 Gln Ile Arg Lys Ala Glu Val Glu Thr Glu Thr Ile Leu
Glu Arg Val865 870 875
880 Asp Ser Ile Lys Glu Ala Met Val Glu Val Glu Asp Thr Arg Lys Asn
885 890 895 Phe Met Asp Lys
Ile Tyr Ser Leu Glu Arg Asp Met Ala Lys Ile Asp 900
905 910 Lys Asn Asp Lys Lys Val Gln Leu Phe
Ile Ser Lys Leu Glu Glu Ile 915 920
925 Asn Asp Ile Ile Asp Ala Ile Gln Asp Gln Arg Glu Asn Leu
Val Arg 930 935 940
Met Lys Asn Gln Tyr Asp Asp Tyr Asp Lys Asn Ile Val Lys Asn Leu945
950 955 960 Glu Arg Ala Glu Tyr
Phe Val Arg Tyr Leu Glu Thr Leu Leu Asp Asn 965
970 975 Ala Asp Lys Tyr Met Ser Asp Lys Gly Ser
Lys Thr Ser Lys Lys Gly 980 985
990 Thr Ala Ala Lys Ile Asp Ser Lys Lys Glu Glu Phe Ile Ile Arg
Met 995 1000 1005 Tyr
Lys Glu Gly Trp Lys Pro Asp Glu Ile Val Lys Asn Ser Ser Tyr 1010
1015 1020 Ser Arg Asp Glu Val Glu
Arg Thr Ile Lys Ala Trp Lys Asp Lys Gln1025 1030
1035 1040Ser Arg Gly13729DNABrachyspira
hyodysenteriae 13atgataaaaa aaattttaac tttaatcttt gtattaattt tggcagcttc
atgttctact 60aatgataaac atgttgtagt attagctttt agtaaacagc ttcatgctgt
actttataat 120gataatagtc agtctacaaa aacagcatca aaaacatata tacaaaaaga
tgatattaca 180actgtagcag atcctataaa agaaaaaaaa gaatatacaa atactcaagc
acaagtaagt 240aaaaaagcag aagaaaaaaa agaagaactt acaaataacg atgctttaga
agaagaaaaa 300cctcaagtta taaagcaaac tgaggttata cagaaagatg ataatgagat
tcttcttact 360gcaaatataa tatcttttga ttttgattct tatgaattaa aaaatgaata
taatgaaggg 420atagatgaaa tttgcaaata tttaaataat aatcgagata ttaatctaat
aatagaagga 480catagcgaca gtatagggga ctcaaattat aatatatatt tatctgaaaa
cagagcaaaa 540gcgatatttg ataaattagt agataaagga atagataaag atagacttag
atatatagga 600tatggctcta ctcattcatc tgagtataat gataaagaca gaaaatgcca
atttgttata 660ataaataatt cagatgaaga gcaggaatac aaaaaagaaa acgaaactga
tattatcaaa 720ttaaaacaa
72914243PRTBrachyspira hyodysenteriae 14Met Ile Lys Lys Ile
Leu Thr Leu Ile Phe Val Leu Ile Leu Ala Ala1 5
10 15 Ser Cys Ser Thr Asn Asp Lys His Val Val
Val Leu Ala Phe Ser Lys 20 25
30 Gln Leu His Ala Val Leu Tyr Asn Asp Asn Ser Gln Ser Thr Lys
Thr 35 40 45 Ala
Ser Lys Thr Tyr Ile Gln Lys Asp Asp Ile Thr Thr Val Ala Asp 50
55 60 Pro Ile Lys Glu Lys Lys
Glu Tyr Thr Asn Thr Gln Ala Gln Val Ser65 70
75 80 Lys Lys Ala Glu Glu Lys Lys Glu Glu Leu Thr
Asn Asn Asp Ala Leu 85 90
95 Glu Glu Glu Lys Pro Gln Val Ile Lys Gln Thr Glu Val Ile Gln Lys
100 105 110 Asp Asp Asn
Glu Ile Leu Leu Thr Ala Asn Ile Ile Ser Phe Asp Phe 115
120 125 Asp Ser Tyr Glu Leu Lys Asn Glu
Tyr Asn Glu Gly Ile Asp Glu Ile 130 135
140 Cys Lys Tyr Leu Asn Asn Asn Arg Asp Ile Asn Leu Ile
Ile Glu Gly145 150 155
160 His Ser Asp Ser Ile Gly Asp Ser Asn Tyr Asn Ile Tyr Leu Ser Glu
165 170 175 Asn Arg Ala Lys
Ala Ile Phe Asp Lys Leu Val Asp Lys Gly Ile Asp 180
185 190 Lys Asp Arg Leu Arg Tyr Ile Gly Tyr
Gly Ser Thr His Ser Ser Glu 195 200
205 Tyr Asn Asp Lys Asp Arg Lys Cys Gln Phe Val Ile Ile Asn
Asn Ser 210 215 220
Asp Glu Glu Gln Glu Tyr Lys Lys Glu Asn Glu Thr Asp Ile Ile Lys225
230 235 240 Leu Lys
Gln152475DNABrachyspira hyodysenteriae 15atgaaattga ataataaagt tttatataaa
ttcccaatat taatactgtt tataatatta 60ttatcatgtt ctaatagtca ggaagaaata
gagcaaaaag aaatagacag aggcggagca 120ttaatagata aaataatata tgaagtaaga
acagatatga caatagctat taaagatgtg 180gcagacggca gagcagattt aatggcaagc
ggaatagacg gaagtacata tttatcatta 240ggcgaaagtg atttagagaa acttgatact
tatgcagtac cttcaggttc atggtcatta 300ttgtttaatc ccgtaccaaa taaagctcca
tacacagtta caacaagaga cggaaaaact 360cattttaatc ctctagctat aaaagaagta
agatttgcta tgaacttctt aattgataga 420aaaaagcttg ttgatgaaat tttaagaggg
gcaggacagc cttcatttac acaagcaaca 480ccggggcagc cgggtactta tagatataat
cttatacctt caaaaatggg tatgacagaa 540aacggtaatc aggaaaaagc tcttaatgat
ataaataaag ctatggaaaa agctgctaat 600ttaccagaga atagaggaaa attagtaaaa
gaaaatggat ggtggaaata taatggagaa 660gtagtaacta ttaaatttgt tataagagtt
gatgatccta caggaagact tccagctggt 720aatgcaatat ctgatttaat agaaaaaaca
ggaataaaag ttgagaaatt attgtatgac 780agaaataaat ctactcaagt tgtatacggt
tcagacccaa aagattatga atggaatatt 840ataacagagg cttggggagc aggtgctact
cgtgcttggt gggatgttac attaagacag 900atgtatgtaa gggaaggcaa ttatatgcct
ggtgctaatg tatctgagtt ttggaattat 960gataataaag aagcttcaag aataagcgac
aagaattcaa atggctggtt tttgactgcc 1020gatgaatatt ggaatggtaa tatgcgtttg
caggagattg gacttgaaga tgctgtcaga 1080atatatttaa attctcagac tcagtttttt
gtagcgaata aagaaagatt caatagaaga 1140atgctttacg gagtaggtga cggggttaat
gattggtcta taagaagtgc tgatataaaa 1200ccaaatagaa atggtgaaaa agtattaaga
gttcttcagc attctgccca aggttcatta 1260tttataagtc cttgggatcc tgtaggagta
ggaggatttt ctgatgccta ttctgctata 1320atgataggac cttgttctga tgcaggtgct
acatttgaat cgccttccac tgctaagaca 1380gaattcatac ttggtgaagc tgacaccaac
agtttagaaa taggagtgag agcaggaaat 1440aatggaatac ctgttggtac tgttaatgtt
cctcaaaatg caataatgta taatccttat 1500actcagaaat gggaagaggg tttaacagtt
aaagttaatg ataaaggcga attagtttac 1560acaaaatcgg ataatcttac tgcttatgtg
aaatgtgatt ttaagcctag aagttttaaa 1620tggcatcatg gcatagattc atctttggtt
gatttgatgt atggaagcgt attcattgct 1680aatataataa caaagactaa tgaaaacgat
aaatattatg attctgctat ggctggaaga 1740tatctttctg ctatggacgg agctgtagga
agcattataa atgaggacgg aagttttact 1800ttatacggaa attattattg gcctatggat
atggacagac aaattgctgt tgctgctgta 1860agtcctaaaa taggcaatcc taatagaaat
actgttattc ctttcgagat aaatgaagct 1920ataatgaaaa ttgttcttga aggctctaaa
tctggaaatg tttatactat ttcacaggat 1980cagtctttaa cttccataga tgttaaaaat
cctacatgtg tatcagatat aaaagaaaaa 2040ttaatagaaa tgcgtgattc tcagtatata
cctgctggaa tagaagattt tataactaaa 2100gaagatgcag taaagagata tcaagctgcc
attgatttta tagataaata cggacatgct 2160tatatatcaa atggtccttt ctttatttca
agaatagatt caaaggcaaa ttatatagaa 2220ttaacagctt ttaaagatta tagctatact
gctgattatt ggatagatag attatctacc 2280aaaatgagca gaatagaaga tattgatatg
cctgctatag caaacagaaa caatgatatg 2340aatatagata tttatgtttc ttcatataat
tatcctgaca atgcattaga aatgccagat 2400cctaatacaa cagtaaaagt attacttcaa
ttacaaatgg agggcgaaaa agaatataat 2460gcagttttta gaaaa
247516825PRTBrachyspira hyodysenteriae
16Met Lys Leu Asn Asn Lys Val Leu Tyr Lys Phe Pro Ile Leu Ile Leu1
5 10 15 Phe Ile Ile Leu
Leu Ser Cys Ser Asn Ser Gln Glu Glu Ile Glu Gln 20
25 30 Lys Glu Ile Asp Arg Gly Gly Ala Leu
Ile Asp Lys Ile Ile Tyr Glu 35 40
45 Val Arg Thr Asp Met Thr Ile Ala Ile Lys Asp Val Ala Asp
Gly Arg 50 55 60
Ala Asp Leu Met Ala Ser Gly Ile Asp Gly Ser Thr Tyr Leu Ser Leu65
70 75 80 Gly Glu Ser Asp Leu
Glu Lys Leu Asp Thr Tyr Ala Val Pro Ser Gly 85
90 95 Ser Trp Ser Leu Leu Phe Asn Pro Val Pro
Asn Lys Ala Pro Tyr Thr 100 105
110 Val Thr Thr Arg Asp Gly Lys Thr His Phe Asn Pro Leu Ala Ile
Lys 115 120 125 Glu
Val Arg Phe Ala Met Asn Phe Leu Ile Asp Arg Lys Lys Leu Val 130
135 140 Asp Glu Ile Leu Arg Gly
Ala Gly Gln Pro Ser Phe Thr Gln Ala Thr145 150
155 160 Pro Gly Gln Pro Gly Thr Tyr Arg Tyr Asn Leu
Ile Pro Ser Lys Met 165 170
175 Gly Met Thr Glu Asn Gly Asn Gln Glu Lys Ala Leu Asn Asp Ile Asn
180 185 190 Lys Ala Met
Glu Lys Ala Ala Asn Leu Pro Glu Asn Arg Gly Lys Leu 195
200 205 Val Lys Glu Asn Gly Trp Trp Lys
Tyr Asn Gly Glu Val Val Thr Ile 210 215
220 Lys Phe Val Ile Arg Val Asp Asp Pro Thr Gly Arg Leu
Pro Ala Gly225 230 235
240 Asn Ala Ile Ser Asp Leu Ile Glu Lys Thr Gly Ile Lys Val Glu Lys
245 250 255 Leu Leu Tyr Asp
Arg Asn Lys Ser Thr Gln Val Val Tyr Gly Ser Asp 260
265 270 Pro Lys Asp Tyr Glu Trp Asn Ile Ile
Thr Glu Ala Trp Gly Ala Gly 275 280
285 Ala Thr Arg Ala Trp Trp Asp Val Thr Leu Arg Gln Met Tyr
Val Arg 290 295 300
Glu Gly Asn Tyr Met Pro Gly Ala Asn Val Ser Glu Phe Trp Asn Tyr305
310 315 320 Asp Asn Lys Glu Ala
Ser Arg Ile Ser Asp Lys Asn Ser Asn Gly Trp 325
330 335 Phe Leu Thr Ala Asp Glu Tyr Trp Asn Gly
Asn Met Arg Leu Gln Glu 340 345
350 Ile Gly Leu Glu Asp Ala Val Arg Ile Tyr Leu Asn Ser Gln Thr
Gln 355 360 365 Phe
Phe Val Ala Asn Lys Glu Arg Phe Asn Arg Arg Met Leu Tyr Gly 370
375 380 Val Gly Asp Gly Val Asn
Asp Trp Ser Ile Arg Ser Ala Asp Ile Lys385 390
395 400 Pro Asn Arg Asn Gly Glu Lys Val Leu Arg Val
Leu Gln His Ser Ala 405 410
415 Gln Gly Ser Leu Phe Ile Ser Pro Trp Asp Pro Val Gly Val Gly Gly
420 425 430 Phe Ser Asp
Ala Tyr Ser Ala Ile Met Ile Gly Pro Cys Ser Asp Ala 435
440 445 Gly Ala Thr Phe Glu Ser Pro Ser
Thr Ala Lys Thr Glu Phe Ile Leu 450 455
460 Gly Glu Ala Asp Thr Asn Ser Leu Glu Ile Gly Val Arg
Ala Gly Asn465 470 475
480 Asn Gly Ile Pro Val Gly Thr Val Asn Val Pro Gln Asn Ala Ile Met
485 490 495 Tyr Asn Pro Tyr
Thr Gln Lys Trp Glu Glu Gly Leu Thr Val Lys Val 500
505 510 Asn Asp Lys Gly Glu Leu Val Tyr Thr
Lys Ser Asp Asn Leu Thr Ala 515 520
525 Tyr Val Lys Cys Asp Phe Lys Pro Arg Ser Phe Lys Trp His
His Gly 530 535 540
Ile Asp Ser Ser Leu Val Asp Leu Met Tyr Gly Ser Val Phe Ile Ala545
550 555 560 Asn Ile Ile Thr Lys
Thr Asn Glu Asn Asp Lys Tyr Tyr Asp Ser Ala 565
570 575 Met Ala Gly Arg Tyr Leu Ser Ala Met Asp
Gly Ala Val Gly Ser Ile 580 585
590 Ile Asn Glu Asp Gly Ser Phe Thr Leu Tyr Gly Asn Tyr Tyr Trp
Pro 595 600 605 Met
Asp Met Asp Arg Gln Ile Ala Val Ala Ala Val Ser Pro Lys Ile 610
615 620 Gly Asn Pro Asn Arg Asn
Thr Val Ile Pro Phe Glu Ile Asn Glu Ala625 630
635 640 Ile Met Lys Ile Val Leu Glu Gly Ser Lys Ser
Gly Asn Val Tyr Thr 645 650
655 Ile Ser Gln Asp Gln Ser Leu Thr Ser Ile Asp Val Lys Asn Pro Thr
660 665 670 Cys Val Ser
Asp Ile Lys Glu Lys Leu Ile Glu Met Arg Asp Ser Gln 675
680 685 Tyr Ile Pro Ala Gly Ile Glu Asp
Phe Ile Thr Lys Glu Asp Ala Val 690 695
700 Lys Arg Tyr Gln Ala Ala Ile Asp Phe Ile Asp Lys Tyr
Gly His Ala705 710 715
720 Tyr Ile Ser Asn Gly Pro Phe Phe Ile Ser Arg Ile Asp Ser Lys Ala
725 730 735 Asn Tyr Ile Glu
Leu Thr Ala Phe Lys Asp Tyr Ser Tyr Thr Ala Asp 740
745 750 Tyr Trp Ile Asp Arg Leu Ser Thr Lys
Met Ser Arg Ile Glu Asp Ile 755 760
765 Asp Met Pro Ala Ile Ala Asn Arg Asn Asn Asp Met Asn Ile
Asp Ile 770 775 780
Tyr Val Ser Ser Tyr Asn Tyr Pro Asp Asn Ala Leu Glu Met Pro Asp785
790 795 800 Pro Asn Thr Thr Val
Lys Val Leu Leu Gln Leu Gln Met Glu Gly Glu 805
810 815 Lys Glu Tyr Asn Ala Val Phe Arg Lys
820 825 171014DNABrachyspira hyodysenteriae
17gtggtctgca atatgaataa gaagaacatt atattattat tatctattat tatgatgctg
60attgtatcat gtgaggaaaa aacagaaagt actgtgacaa tacaaaaata tccaataaga
120gttggatata tgccagattt ttctggaagt tctgctgttg ctatagcaaa agaaaagggt
180tattttgatg aagaaaattt agatgttaca ttggttgagt ttttagatgg tccttctgaa
240gtagaggaga tgcttttaaa aaatttagaa tttgcttata taggacatgg tgcacatgct
300ttagctattg aaggtaaagt taatgtatta tttcctaatg gtttaagcag atctgaacaa
360attatagtaa gaaatgcttc tcaaatagaa tctattaaag atttaagagg taaaaaagtt
420ggaacacaat taggaacttc ttcagaaatt ttactttatt tggctcttca gtcattaggt
480attaaagcag aagaagtaga tattataaat atggatggaa atactatagt atcatctata
540gctgatggta ctattgatgc tgcttcagtg caagctccat atacttttga aatattaaat
600aatactgaaa acaatgtaaa gtctatagct acaactgttg attattctga tgtaggttct
660tttcctagca gctggatagt tacaccttct tatcaaagta ataatacaga tatagttaat
720agattttcaa gagctatact taaagctatg gactatagac aacttaatat gagtgaagct
780gtgcaattgg ttgctaacat gaatagtaaa acagttgaag aagttgattt agaaagagaa
840acaggagtat ggttttctgg taatgagata aagcaagcat atattaatgg tgatgctggt
900aaatggtata aaacacagca gaatatattt atttatacta aaactattac aaataatatt
960gatattaata attatgtgca gttaaaatac atggttgata atgtatttaa tgaa
101418338PRTBrachyspira hyodysenteriae 18Val Val Cys Asn Met Asn Lys Lys
Asn Ile Ile Leu Leu Leu Ser Ile1 5 10
15 Ile Met Met Leu Ile Val Ser Cys Glu Glu Lys Thr Glu
Ser Thr Val 20 25 30
Thr Ile Gln Lys Tyr Pro Ile Arg Val Gly Tyr Met Pro Asp Phe Ser
35 40 45 Gly Ser Ser Ala
Val Ala Ile Ala Lys Glu Lys Gly Tyr Phe Asp Glu 50 55
60 Glu Asn Leu Asp Val Thr Leu Val Glu
Phe Leu Asp Gly Pro Ser Glu65 70 75
80 Val Glu Glu Met Leu Leu Lys Asn Leu Glu Phe Ala Tyr Ile
Gly His 85 90 95
Gly Ala His Ala Leu Ala Ile Glu Gly Lys Val Asn Val Leu Phe Pro
100 105 110 Asn Gly Leu Ser Arg
Ser Glu Gln Ile Ile Val Arg Asn Ala Ser Gln 115
120 125 Ile Glu Ser Ile Lys Asp Leu Arg Gly
Lys Lys Val Gly Thr Gln Leu 130 135
140 Gly Thr Ser Ser Glu Ile Leu Leu Tyr Leu Ala Leu Gln
Ser Leu Gly145 150 155
160 Ile Lys Ala Glu Glu Val Asp Ile Ile Asn Met Asp Gly Asn Thr Ile
165 170 175 Val Ser Ser Ile
Ala Asp Gly Thr Ile Asp Ala Ala Ser Val Gln Ala 180
185 190 Pro Tyr Thr Phe Glu Ile Leu Asn Asn
Thr Glu Asn Asn Val Lys Ser 195 200
205 Ile Ala Thr Thr Val Asp Tyr Ser Asp Val Gly Ser Phe Pro
Ser Ser 210 215 220
Trp Ile Val Thr Pro Ser Tyr Gln Ser Asn Asn Thr Asp Ile Val Asn225
230 235 240 Arg Phe Ser Arg Ala
Ile Leu Lys Ala Met Asp Tyr Arg Gln Leu Asn 245
250 255 Met Ser Glu Ala Val Gln Leu Val Ala Asn
Met Asn Ser Lys Thr Val 260 265
270 Glu Glu Val Asp Leu Glu Arg Glu Thr Gly Val Trp Phe Ser Gly
Asn 275 280 285 Glu
Ile Lys Gln Ala Tyr Ile Asn Gly Asp Ala Gly Lys Trp Tyr Lys 290
295 300 Thr Gln Gln Asn Ile Phe
Ile Tyr Thr Lys Thr Ile Thr Asn Asn Ile305 310
315 320 Asp Ile Asn Asn Tyr Val Gln Leu Lys Tyr Met
Val Asp Asn Val Phe 325 330
335 Asn Glu 19981DNABrachyspira hyodysenteriae 19atgaaaaaag
ttttattagc tgtaacattt atttttatat ttagtttttt aatatcatgc 60ggtaagaaaa
caaatgaaaa tgcaggtaaa ataagagtag catatcaccc aaatgtagga 120ggagcttctg
caataattac aggtatacag cagaattatt ttaaagatga aggtttggat 180atagaacttg
ttaaatttac aagcggacct acagaaatag cagctatggt ttcaggagat 240atacaaatag
gttatatagg ttttggagca catacattgg cagcagaagg aaaagttcaa 300ataatagcta
ctgacggaat agctgttgta gaaggtatta gaacattaaa aacttcaggc 360ataaactctg
ttgaaaaatt aaaaggcaga agtttaataa ctcaattagg tacatcagga 420gaaactatta
tagatcaggt attagcagga acaggagtta ataaaacaga tataaatata 480cttaatgctg
aagtttcaag tgctgttgca tcattcttgg ctaataaagt tgatgctata 540tctgtatggc
ctccttatac tgttgaaata gataatagaa ttggtataga gaatttgtat 600attataaaac
ctcaggatgt aggagttgat tctactgcaa gctggatagt aactcctaac 660tatttggaag
ctaatactga tacagttata aaattcacaa gagcattata taaatcaatg 720gattatagaa
aatcacattt agatgaagct attacaaatg tatcaaatct tataggttta 780gatatagcta
cagtttcaca agagaaatac agttctgact ggatggattc tcaaacaatg 840aaaagcagaa
taaatgacgg aagcataagt aatatttata aaaaacaaat agactatttt 900gtacagaata
atagattaaa ttctgagcct gttcctgtag acaaatatgt aagaatcgac 960attatagaaa
aagcattaaa t
98120327PRTBrachyspira hyodysenteriae 20Met Lys Lys Val Leu Leu Ala Val
Thr Phe Ile Phe Ile Phe Ser Phe1 5 10
15 Leu Ile Ser Cys Gly Lys Lys Thr Asn Glu Asn Ala Gly
Lys Ile Arg 20 25 30
Val Ala Tyr His Pro Asn Val Gly Gly Ala Ser Ala Ile Ile Thr Gly
35 40 45 Ile Gln Gln Asn
Tyr Phe Lys Asp Glu Gly Leu Asp Ile Glu Leu Val 50 55
60 Lys Phe Thr Ser Gly Pro Thr Glu Ile
Ala Ala Met Val Ser Gly Asp65 70 75
80 Ile Gln Ile Gly Tyr Ile Gly Phe Gly Ala His Thr Leu Ala
Ala Glu 85 90 95
Gly Lys Val Gln Ile Ile Ala Thr Asp Gly Ile Ala Val Val Glu Gly
100 105 110 Ile Arg Thr Leu Lys
Thr Ser Gly Ile Asn Ser Val Glu Lys Leu Lys 115
120 125 Gly Arg Ser Leu Ile Thr Gln Leu Gly
Thr Ser Gly Glu Thr Ile Ile 130 135
140 Asp Gln Val Leu Ala Gly Thr Gly Val Asn Lys Thr Asp
Ile Asn Ile145 150 155
160 Leu Asn Ala Glu Val Ser Ser Ala Val Ala Ser Phe Leu Ala Asn Lys
165 170 175 Val Asp Ala Ile
Ser Val Trp Pro Pro Tyr Thr Val Glu Ile Asp Asn 180
185 190 Arg Ile Gly Ile Glu Asn Leu Tyr Ile
Ile Lys Pro Gln Asp Val Gly 195 200
205 Val Asp Ser Thr Ala Ser Trp Ile Val Thr Pro Asn Tyr Leu
Glu Ala 210 215 220
Asn Thr Asp Thr Val Ile Lys Phe Thr Arg Ala Leu Tyr Lys Ser Met225
230 235 240 Asp Tyr Arg Lys Ser
His Leu Asp Glu Ala Ile Thr Asn Val Ser Asn 245
250 255 Leu Ile Gly Leu Asp Ile Ala Thr Val Ser
Gln Glu Lys Tyr Ser Ser 260 265
270 Asp Trp Met Asp Ser Gln Thr Met Lys Ser Arg Ile Asn Asp Gly
Ser 275 280 285 Ile
Ser Asn Ile Tyr Lys Lys Gln Ile Asp Tyr Phe Val Gln Asn Asn 290
295 300 Arg Leu Asn Ser Glu Pro
Val Pro Val Asp Lys Tyr Val Arg Ile Asp305 310
315 320 Ile Ile Glu Lys Ala Leu Asn
325 211011DNABrachyspira hyodysenteriae 21atgaaaaaaa ctatgtttat
ttctatttta tcaatggcag tgatatcttt aataatatcc 60tgttcaggag gaaataaagc
tcctgctgct tcagcagatg gtacacttga taaaataaga 120gttgcttatc ttgcagattt
tgcaggaact tcttctgttg ctatagctca ggaaaaaggt 180ttttttaaag aagaaaattt
agatgttgaa ttagttaaat ttttaaatgg accttctgaa 240gttgctgcta tgctctctgg
agatatacaa tttgcatata taggacatgg tgcacattct 300ctagctattc aaggtaaagt
taatgtatta tttcctaatg gtttaggtaa atctgaagaa 360attatagttg gtaaatgggc
caatgttaat gatttagcag gattaaaagg aaaaactata 420ggtactcagc ttggtacttc
tggagatata gtattggata ttgcattaag aaaagttgga 480ctttccaaag aagatgttaa
tgttgtcaat atggatgtaa gcggaatagt atcttctatg 540attggtaaaa aagtagatgc
agtttcttta tgggctcctt atacttttga aataactaaa 600cagcttggag atgaagctgt
tgtaattgct tctattacaa attatttaga tgaagctgta 660tttcctagca gttggatagt
tactcctgat tatcaaaata ataatcaaga catagtgaat 720agattctcta aagctatatt
taaagctatg gattatagaa gtgagaatat ggatgaggct 780gttgaaattg tagctaaatt
aaatggaact cctgttgatt ctgttgcttt agaaaaagaa 840actgctatat ggcttagttc
ttctgatata aaaaattctt atactgatgg aacagctgct 900aaatggtatc aagctcagca
gaaaatattt ttaaactcag aagtagttac tgaagaagta 960gatgttaata attatgtaca
gataaattat ataattgata atgtgcttaa a 101122337PRTBrachyspira
hyodysenteriae 22Met Lys Lys Thr Met Phe Ile Ser Ile Leu Ser Met Ala Val
Ile Ser1 5 10 15
Leu Ile Ile Ser Cys Ser Gly Gly Asn Lys Ala Pro Ala Ala Ser Ala
20 25 30 Asp Gly Thr Leu Asp
Lys Ile Arg Val Ala Tyr Leu Ala Asp Phe Ala 35 40
45 Gly Thr Ser Ser Val Ala Ile Ala Gln Glu
Lys Gly Phe Phe Lys Glu 50 55 60
Glu Asn Leu Asp Val Glu Leu Val Lys Phe Leu Asn Gly Pro Ser
Glu65 70 75 80 Val
Ala Ala Met Leu Ser Gly Asp Ile Gln Phe Ala Tyr Ile Gly His
85 90 95 Gly Ala His Ser Leu Ala
Ile Gln Gly Lys Val Asn Val Leu Phe Pro 100
105 110 Asn Gly Leu Gly Lys Ser Glu Glu Ile Ile
Val Gly Lys Trp Ala Asn 115 120
125 Val Asn Asp Leu Ala Gly Leu Lys Gly Lys Thr Ile Gly Thr
Gln Leu 130 135 140
Gly Thr Ser Gly Asp Ile Val Leu Asp Ile Ala Leu Arg Lys Val Gly145
150 155 160 Leu Ser Lys Glu Asp
Val Asn Val Val Asn Met Asp Val Ser Gly Ile 165
170 175 Val Ser Ser Met Ile Gly Lys Lys Val Asp
Ala Val Ser Leu Trp Ala 180 185
190 Pro Tyr Thr Phe Glu Ile Thr Lys Gln Leu Gly Asp Glu Ala Val
Val 195 200 205 Ile
Ala Ser Ile Thr Asn Tyr Leu Asp Glu Ala Val Phe Pro Ser Ser 210
215 220 Trp Ile Val Thr Pro Asp
Tyr Gln Asn Asn Asn Gln Asp Ile Val Asn225 230
235 240 Arg Phe Ser Lys Ala Ile Phe Lys Ala Met Asp
Tyr Arg Ser Glu Asn 245 250
255 Met Asp Glu Ala Val Glu Ile Val Ala Lys Leu Asn Gly Thr Pro Val
260 265 270 Asp Ser Val
Ala Leu Glu Lys Glu Thr Ala Ile Trp Leu Ser Ser Ser 275
280 285 Asp Ile Lys Asn Ser Tyr Thr Asp
Gly Thr Ala Ala Lys Trp Tyr Gln 290 295
300 Ala Gln Gln Lys Ile Phe Leu Asn Ser Glu Val Val Thr
Glu Glu Val305 310 315
320 Asp Val Asn Asn Tyr Val Gln Ile Asn Tyr Ile Ile Asp Asn Val Leu
325 330 335 Lys
23615DNABrachyspira hyodysenteriae 23atggcaagaa gaaaaaagaa aaaatcatct
cctttattaa tactatttat tttattaata 60gcagcaggat actattatta taataatata
tataataaaa aagaaatatc aaaaacagaa 120aagcccaaaa aagaaactat tacaagatac
aatagagatg attggggaga ttgggctgat 180gaagataatg acggacttaa tacaaggcat
gaggtattag caagagcatc attagtaaaa 240cctgtaatat ctaataacag agtaatatca
ggaaaatggt atgataagtt tacaggaaaa 300tattttacta atgcaaaaga tttagatata
gatcatttag tgcctttaaa aaatgcacat 360atcagcggtg ctagtaattg gagtaaagaa
aagaaaaatg aatactacaa ttatatgaaa 420aacgaaaatc atttggtagc tgtatcaaaa
ggtgcaaatc gttctaaagg tgataaatcc 480ccggtagaat ggctccctcc taatgaagaa
tatcaatgcg aatatgtaag agaatggtat 540aaaatcaaaa ccgattgggg gcttacaata
gaagaaggtt ttgatgaagt ttcaaacaga 600gtatgcaaag gaaaa
61524205PRTBrachyspira hyodysenteriae
24Met Ala Arg Arg Lys Lys Lys Lys Ser Ser Pro Leu Leu Ile Leu Phe1
5 10 15 Ile Leu Leu Ile
Ala Ala Gly Tyr Tyr Tyr Tyr Asn Asn Ile Tyr Asn 20
25 30 Lys Lys Glu Ile Ser Lys Thr Glu Lys
Pro Lys Lys Glu Thr Ile Thr 35 40
45 Arg Tyr Asn Arg Asp Asp Trp Gly Asp Trp Ala Asp Glu Asp
Asn Asp 50 55 60
Gly Leu Asn Thr Arg His Glu Val Leu Ala Arg Ala Ser Leu Val Lys65
70 75 80 Pro Val Ile Ser Asn
Asn Arg Val Ile Ser Gly Lys Trp Tyr Asp Lys 85
90 95 Phe Thr Gly Lys Tyr Phe Thr Asn Ala Lys
Asp Leu Asp Ile Asp His 100 105
110 Leu Val Pro Leu Lys Asn Ala His Ile Ser Gly Ala Ser Asn Trp
Ser 115 120 125 Lys
Glu Lys Lys Asn Glu Tyr Tyr Asn Tyr Met Lys Asn Glu Asn His 130
135 140 Leu Val Ala Val Ser Lys
Gly Ala Asn Arg Ser Lys Gly Asp Lys Ser145 150
155 160 Pro Val Glu Trp Leu Pro Pro Asn Glu Glu Tyr
Gln Cys Glu Tyr Val 165 170
175 Arg Glu Trp Tyr Lys Ile Lys Thr Asp Trp Gly Leu Thr Ile Glu Glu
180 185 190 Gly Phe Asp
Glu Val Ser Asn Arg Val Cys Lys Gly Lys 195 200
205 25264DNABrachyspira hyodysenteriae 25atgaataaaa
ttttttatga taaagcttgg gaagattatc tttattttca aaagaatgac 60aaaaaaatat
tacagaaaat taatgatttt ataaaagata tagaaagaaa tggcttatta 120attggtatag
gaaaaccaga gagattaaaa ggtgagttaa acggattgta ttcaaggcta 180ataaatcaag
aacatagatt agtatattat attgaagata ataatttatt tatagttgga 240tgtaaaacac
attataaaaa taat
2642688PRTBrachyspira hyodysenteriae 26Met Asn Lys Ile Phe Tyr Asp Lys
Ala Trp Glu Asp Tyr Leu Tyr Phe1 5 10
15 Gln Lys Asn Asp Lys Lys Ile Leu Gln Lys Ile Asn Asp
Phe Ile Lys 20 25 30
Asp Ile Glu Arg Asn Gly Leu Leu Ile Gly Ile Gly Lys Pro Glu Arg
35 40 45 Leu Lys Gly Glu
Leu Asn Gly Leu Tyr Ser Arg Leu Ile Asn Gln Glu 50 55
60 His Arg Leu Val Tyr Tyr Ile Glu Asp
Asn Asn Leu Phe Ile Val Gly65 70 75
80 Cys Lys Thr His Tyr Lys Asn Asn 85
271503DNABrachyspira hyodysenteriae 27gtgttaagga aattgatata
tattattttt ttgcattcaa ttctttttaa tttttttatt 60tttgcacaaa ctaatgaatc
agctatatta aattacactc aatatatgga aagaataaaa 120tccataatac cagaaatgaa
attaactgca tctcaagaaa gcaatgccta taataattta 180acaaaagcaa aaagctccgg
agacgttaaa tttgatttgc aggctggtgc tataggaatg 240caaagccatt ttgatgaata
caatttttta gcaacatcag attttaatta taatgggttt 300agaataggtg caggattcag
cggacttgta ccatactctg gaactagatg gtctgtagaa 360attaaacatg acagtttttt
cggcgacttt aatacaggag atatttcatt accggttgat 420acgcctctag gtagaataaa
tggaaaactt ccaaatttaa gtactaatga ttttaaatac 480tattatccaa gcataaaaat
tcaaatagct cagcctattt taagggattt ttttggtaaa 540ttggatagat accctataaa
agatgcagaa tatcagctta ccatagcaaa attaaaaaga 600ataatagacg acaacagcgt
attaacatct tatcagaaaa tttattatca atggataatg 660gcaagaaaat taatagattt
atatgatgat atgataagag aagcaagaag ttttgaaaat 720caagtataca gaagatatac
aagcggagtt atagataatg actcatatca gaatgcaaaa 780agacaaacat taaaatatat
agaagcaaga gataaatctg aattaatgct taaaaaaata 840atgagaaata ttcaattctt
tatacctgaa gaaaatatac agccaaatga agatgattgg 900aatcagacat tagaaacctc
tataaatgct aaaatagata tagtaccatt tttagaaagt 960gctcagggac aaatggctta
tcaattaaaa ttaagaagcg aatatgctat ttcagtaatg 1020aaaaataatg ctctgcctga
tttatctata gtaggaagcg tatcattatc aagtttagat 1080gacagcggat attttaaatc
tttttctacc atgactaatg ttgattattt tgtagggctt 1140atgttttcct accccatagg
cggacgtgat gctaaagcta aaatggaaga tgcttatgct 1200gctttgaatg ctgttacggc
tgattttgat agggtgaaca gagattttga cgttcagata 1260ggtacttatt atgatgagtt
tgaggcatac aaaaaaatgc tagaaaataa aaaattggaa 1320gttaatgcta tagtatcaag
aataaatacg caaaatgcta aattcagaca aggaagactc 1380cctatagatg aaataataaa
tgcaaggctt gatttagcac aggcaagagc agaacttctt 1440aatttgcagt atttaataat
aagcactgtt atggattata attctctggt gctgcttaac 1500aat
150328501PRTBrachyspira
hyodysenteriae 28Val Leu Arg Lys Leu Ile Tyr Ile Ile Phe Leu His Ser Ile
Leu Phe1 5 10 15
Asn Phe Phe Ile Phe Ala Gln Thr Asn Glu Ser Ala Ile Leu Asn Tyr
20 25 30 Thr Gln Tyr Met Glu
Arg Ile Lys Ser Ile Ile Pro Glu Met Lys Leu 35 40
45 Thr Ala Ser Gln Glu Ser Asn Ala Tyr Asn
Asn Leu Thr Lys Ala Lys 50 55 60
Ser Ser Gly Asp Val Lys Phe Asp Leu Gln Ala Gly Ala Ile Gly
Met65 70 75 80 Gln
Ser His Phe Asp Glu Tyr Asn Phe Leu Ala Thr Ser Asp Phe Asn
85 90 95 Tyr Asn Gly Phe Arg Ile
Gly Ala Gly Phe Ser Gly Leu Val Pro Tyr 100
105 110 Ser Gly Thr Arg Trp Ser Val Glu Ile Lys
His Asp Ser Phe Phe Gly 115 120
125 Asp Phe Asn Thr Gly Asp Ile Ser Leu Pro Val Asp Thr Pro
Leu Gly 130 135 140
Arg Ile Asn Gly Lys Leu Pro Asn Leu Ser Thr Asn Asp Phe Lys Tyr145
150 155 160 Tyr Tyr Pro Ser Ile
Lys Ile Gln Ile Ala Gln Pro Ile Leu Arg Asp 165
170 175 Phe Phe Gly Lys Leu Asp Arg Tyr Pro Ile
Lys Asp Ala Glu Tyr Gln 180 185
190 Leu Thr Ile Ala Lys Leu Lys Arg Ile Ile Asp Asp Asn Ser Val
Leu 195 200 205 Thr
Ser Tyr Gln Lys Ile Tyr Tyr Gln Trp Ile Met Ala Arg Lys Leu 210
215 220 Ile Asp Leu Tyr Asp Asp
Met Ile Arg Glu Ala Arg Ser Phe Glu Asn225 230
235 240 Gln Val Tyr Arg Arg Tyr Thr Ser Gly Val Ile
Asp Asn Asp Ser Tyr 245 250
255 Gln Asn Ala Lys Arg Gln Thr Leu Lys Tyr Ile Glu Ala Arg Asp Lys
260 265 270 Ser Glu Leu
Met Leu Lys Lys Ile Met Arg Asn Ile Gln Phe Phe Ile 275
280 285 Pro Glu Glu Asn Ile Gln Pro Asn
Glu Asp Asp Trp Asn Gln Thr Leu 290 295
300 Glu Thr Ser Ile Asn Ala Lys Ile Asp Ile Val Pro Phe
Leu Glu Ser305 310 315
320 Ala Gln Gly Gln Met Ala Tyr Gln Leu Lys Leu Arg Ser Glu Tyr Ala
325 330 335 Ile Ser Val Met
Lys Asn Asn Ala Leu Pro Asp Leu Ser Ile Val Gly 340
345 350 Ser Val Ser Leu Ser Ser Leu Asp Asp
Ser Gly Tyr Phe Lys Ser Phe 355 360
365 Ser Thr Met Thr Asn Val Asp Tyr Phe Val Gly Leu Met Phe
Ser Tyr 370 375 380
Pro Ile Gly Gly Arg Asp Ala Lys Ala Lys Met Glu Asp Ala Tyr Ala385
390 395 400 Ala Leu Asn Ala Val
Thr Ala Asp Phe Asp Arg Val Asn Arg Asp Phe 405
410 415 Asp Val Gln Ile Gly Thr Tyr Tyr Asp Glu
Phe Glu Ala Tyr Lys Lys 420 425
430 Met Leu Glu Asn Lys Lys Leu Glu Val Asn Ala Ile Val Ser Arg
Ile 435 440 445 Asn
Thr Gln Asn Ala Lys Phe Arg Gln Gly Arg Leu Pro Ile Asp Glu 450
455 460 Ile Ile Asn Ala Arg Leu
Asp Leu Ala Gln Ala Arg Ala Glu Leu Leu465 470
475 480 Asn Leu Gln Tyr Leu Ile Ile Ser Thr Val Met
Asp Tyr Asn Ser Leu 485 490
495 Val Leu Leu Asn Asn 500 291386DNABrachyspira
hyodysenteriae 29atggaaatac tactagttta tttatttgaa atatttataa ttattattct
tattatgctc 60tctgctttat tttctggaag tgagactgca tatacatcta ttgatgatgt
tactttaatg 120cgtttggtca gagagaaaaa aatcaaagaa gaagataaaa aatattggga
aaagtcaagt 180tctatgatac ctaccctact tgttggtaat aacatagtta atatatcagc
aagttccatt 240ataactgtat ttgctgtaag gcttgctgac attctgccgc atgtatcaac
aaatgtgatg 300gttacaatat caactgccac aataacaata cttattatta tattcggaga
aatacttcct 360aaagtcttaa tgagagttaa tgctgaaaaa atgatgcctt atcttctata
ttttatgaag 420ttttgtcatt ttatattcaa gcctataact ttcttaatgg ataaagtaac
tacttttata 480atgaattatt ttgtacctaa aagattaaga gatgctgaaa aaagaagtgc
tttatcaagt 540atggaagata tcactactat aatacatttg gggcataaag aaggaataat
aaaagaatat 600acacatgaaa tgcttacagg agtaatagat tttagaaata aaactgtaga
agagataatg 660acgccccgtg ttgatatggt atgtattgaa gctgaaacag atgtaaatga
aataataaaa 720cttactgtag aatcaggact ttcaagattt cctgtttatg aggaaacagt
agatcatata 780ataggtatat tccatacaag agctttattt aaagaatatg ttaaaggcgg
cggaaagatg 840aacaaagtaa aaaagaaagc aatagattat ataatgcttc cctactttgt
acctgaaact 900aaaactataa gcagcttatt tagtgatatg caaaagaaaa aacttcagat
ggtaattact 960attgatgaat acggcggaac tgccggactt gttactatgg aagatataat
agaagagata 1020atgggtgata tagaagatga aagtgataaa aaagaagctg atgtaataag
atttaaggga 1080aaaagaatta taataaatgg aaatgcttct atagaagatg tcaacaaaac
tttaaaatta 1140gaattagagc atgaagaata tcaaactata gcaggatatg ttattgatat
gcttgatcat 1200atacctgaaa caaatgagag attcatatta aaaggatata gggtaagaat
aatgaaagtt 1260gaagacagaa gaatagttga aatggaattt actcctataa aatttgcaag
aacaaatgaa 1320agtgataata ttgatataca agagacatct gattcagaaa aaaatgattt
agaaatttta 1380aatgaa
138630462PRTBrachyspira hyodysenteriae 30Met Glu Ile Leu Leu
Val Tyr Leu Phe Glu Ile Phe Ile Ile Ile Ile1 5
10 15 Leu Ile Met Leu Ser Ala Leu Phe Ser Gly
Ser Glu Thr Ala Tyr Thr 20 25
30 Ser Ile Asp Asp Val Thr Leu Met Arg Leu Val Arg Glu Lys Lys
Ile 35 40 45 Lys
Glu Glu Asp Lys Lys Tyr Trp Glu Lys Ser Ser Ser Met Ile Pro 50
55 60 Thr Leu Leu Val Gly Asn
Asn Ile Val Asn Ile Ser Ala Ser Ser Ile65 70
75 80 Ile Thr Val Phe Ala Val Arg Leu Ala Asp Ile
Leu Pro His Val Ser 85 90
95 Thr Asn Val Met Val Thr Ile Ser Thr Ala Thr Ile Thr Ile Leu Ile
100 105 110 Ile Ile Phe
Gly Glu Ile Leu Pro Lys Val Leu Met Arg Val Asn Ala 115
120 125 Glu Lys Met Met Pro Tyr Leu Leu
Tyr Phe Met Lys Phe Cys His Phe 130 135
140 Ile Phe Lys Pro Ile Thr Phe Leu Met Asp Lys Val Thr
Thr Phe Ile145 150 155
160 Met Asn Tyr Phe Val Pro Lys Arg Leu Arg Asp Ala Glu Lys Arg Ser
165 170 175 Ala Leu Ser Ser
Met Glu Asp Ile Thr Thr Ile Ile His Leu Gly His 180
185 190 Lys Glu Gly Ile Ile Lys Glu Tyr Thr
His Glu Met Leu Thr Gly Val 195 200
205 Ile Asp Phe Arg Asn Lys Thr Val Glu Glu Ile Met Thr Pro
Arg Val 210 215 220
Asp Met Val Cys Ile Glu Ala Glu Thr Asp Val Asn Glu Ile Ile Lys225
230 235 240 Leu Thr Val Glu Ser
Gly Leu Ser Arg Phe Pro Val Tyr Glu Glu Thr 245
250 255 Val Asp His Ile Ile Gly Ile Phe His Thr
Arg Ala Leu Phe Lys Glu 260 265
270 Tyr Val Lys Gly Gly Gly Lys Met Asn Lys Val Lys Lys Lys Ala
Ile 275 280 285 Asp
Tyr Ile Met Leu Pro Tyr Phe Val Pro Glu Thr Lys Thr Ile Ser 290
295 300 Ser Leu Phe Ser Asp Met
Gln Lys Lys Lys Leu Gln Met Val Ile Thr305 310
315 320 Ile Asp Glu Tyr Gly Gly Thr Ala Gly Leu Val
Thr Met Glu Asp Ile 325 330
335 Ile Glu Glu Ile Met Gly Asp Ile Glu Asp Glu Ser Asp Lys Lys Glu
340 345 350 Ala Asp Val
Ile Arg Phe Lys Gly Lys Arg Ile Ile Ile Asn Gly Asn 355
360 365 Ala Ser Ile Glu Asp Val Asn Lys
Thr Leu Lys Leu Glu Leu Glu His 370 375
380 Glu Glu Tyr Gln Thr Ile Ala Gly Tyr Val Ile Asp Met
Leu Asp His385 390 395
400 Ile Pro Glu Thr Asn Glu Arg Phe Ile Leu Lys Gly Tyr Arg Val Arg
405 410 415 Ile Met Lys Val
Glu Asp Arg Arg Ile Val Glu Met Glu Phe Thr Pro 420
425 430 Ile Lys Phe Ala Arg Thr Asn Glu Ser
Asp Asn Ile Asp Ile Gln Glu 435 440
445 Thr Ser Asp Ser Glu Lys Asn Asp Leu Glu Ile Leu Asn Glu
450 455 460
311080DNABrachyspira hyodysenteriae 31atgaaagagt taggaatatc catttacccc
tttcactcaa aaatggaaga taataaatat 60tatatagatt tggcttctaa atacggattc
gcaagatgtt ttatgtgtct gctttcagtt 120gatagatcta aagatgaaat aataaatgaa
ttttcaacta taataaatta tgctaaagaa 180aaaggtataa aaactacttt agatatatct
ccggctgtat tcaaacattt ggatatagat 240tataaaaatc ttgacttttt tcataaattg
ggagcttggg gcgtaagatt agatttaggg 300tttacaggta atgaagaaag tttaatgaca
tataacgaat atgatttgaa aatagaatta 360aatatgagca atgatacaga ttatcttgat
aatataatga aatattatcc taatactgat 420aatttgatag gctgttataa tttctatcct
catgcatata caggactaga cagaacactt 480tttaaaagca gcatgaaacg ttttaaaaaa
tattctataa gttcatctgc atttgttaat 540gccaaagaag ctacttttgg accttggcct
gtaagcgatg gtatttgcac attggaagaa 600catagagata tgcctataga tgcacaggct
atggaattat ttgctcttgg tgttgactgt 660gttttcattg ctaactgtta tgcagatgaa
aatactttta aaacattata taatatggat 720aaaagattaa taacttttaa agtagaatta
gttgattcta ttcctaaaga agaaaagagt 780atagtattag atatgcttca tcaaaacaga
ttagatgctt ctgctgatgt tataagatct 840tcagatacaa gagcaaaata taagggacat
aatttcaaaa tatttaatgc tgtttccgat 900ataaaaagag gagatatatt aatagattca
tcagaatacg gcagttatac cggagaaatg 960cagatagctt tgaaagattt aaaaaatacc
ggaagaacta atgtagtagg cagaattaaa 1020gatgaatatt tatttctgct agattatata
agtccggcta aaagatttat tataagagaa 108032360PRTBrachyspira hyodysenteriae
32Met Lys Glu Leu Gly Ile Ser Ile Tyr Pro Phe His Ser Lys Met Glu1
5 10 15 Asp Asn Lys Tyr
Tyr Ile Asp Leu Ala Ser Lys Tyr Gly Phe Ala Arg 20
25 30 Cys Phe Met Cys Leu Leu Ser Val Asp
Arg Ser Lys Asp Glu Ile Ile 35 40
45 Asn Glu Phe Ser Thr Ile Ile Asn Tyr Ala Lys Glu Lys Gly
Ile Lys 50 55 60
Thr Thr Leu Asp Ile Ser Pro Ala Val Phe Lys His Leu Asp Ile Asp65
70 75 80 Tyr Lys Asn Leu Asp
Phe Phe His Lys Leu Gly Ala Trp Gly Val Arg 85
90 95 Leu Asp Leu Gly Phe Thr Gly Asn Glu Glu
Ser Leu Met Thr Tyr Asn 100 105
110 Glu Tyr Asp Leu Lys Ile Glu Leu Asn Met Ser Asn Asp Thr Asp
Tyr 115 120 125 Leu
Asp Asn Ile Met Lys Tyr Tyr Pro Asn Thr Asp Asn Leu Ile Gly 130
135 140 Cys Tyr Asn Phe Tyr Pro
His Ala Tyr Thr Gly Leu Asp Arg Thr Leu145 150
155 160 Phe Lys Ser Ser Met Lys Arg Phe Lys Lys Tyr
Ser Ile Ser Ser Ser 165 170
175 Ala Phe Val Asn Ala Lys Glu Ala Thr Phe Gly Pro Trp Pro Val Ser
180 185 190 Asp Gly Ile
Cys Thr Leu Glu Glu His Arg Asp Met Pro Ile Asp Ala 195
200 205 Gln Ala Met Glu Leu Phe Ala Leu
Gly Val Asp Cys Val Phe Ile Ala 210 215
220 Asn Cys Tyr Ala Asp Glu Asn Thr Phe Lys Thr Leu Tyr
Asn Met Asp225 230 235
240 Lys Arg Leu Ile Thr Phe Lys Val Glu Leu Val Asp Ser Ile Pro Lys
245 250 255 Glu Glu Lys Ser
Ile Val Leu Asp Met Leu His Gln Asn Arg Leu Asp 260
265 270 Ala Ser Ala Asp Val Ile Arg Ser Ser
Asp Thr Arg Ala Lys Tyr Lys 275 280
285 Gly His Asn Phe Lys Ile Phe Asn Ala Val Ser Asp Ile Lys
Arg Gly 290 295 300
Asp Ile Leu Ile Asp Ser Ser Glu Tyr Gly Ser Tyr Thr Gly Glu Met305
310 315 320 Gln Ile Ala Leu Lys
Asp Leu Lys Asn Thr Gly Arg Thr Asn Val Val 325
330 335 Gly Arg Ile Lys Asp Glu Tyr Leu Phe Leu
Leu Asp Tyr Ile Ser Pro 340 345
350 Ala Lys Arg Phe Ile Ile Arg Glu 355
360 332574DNABrachyspira hyodysenteriae 33ttgatgaaga aatacaagcc
tgaaacaaaa caagaattag aacaattggt atatactgac 60ggaataaaac tctatgatgt
agatacgagt cttataacag atatgagcga gctttttcat 120aacagcacca gaaaagattt
tgaaggcata gaagattggg acgtttctaa tgttgaggat 180atgtcctata tgtttgccca
tatgagttat gatagttatg aaaaccgttc taaagctaag 240tttaatcata atcttaataa
ttggaatgta tctaaagtta agcatatgag ttttatgttt 300tattattgtc aggattttaa
tcagccttta gataaatggg acgtttctaa tgttcaggat 360acatttagaa tgtttgataa
ttgtaaaaaa ttcaatcagc ctttaaatag ctggaatgta 420tctaatgtaa caaatatgag
cggtatgttt caggtagcag aaagtttcaa tcagccttta 480gacaagtggg acgtttcaaa
agttacaact atgagggcta tgtttaatta tgctaaagct 540tttaatcaag atataagtaa
ttggaatgtt agtaaagttg aagatatggg ttatatgttt 600agtatatgcg ttaattttaa
tcagcctatt aatgattggg acgtatctaa agtaaaaact 660atggaaggta tgtttagaag
tgcttttaaa ttcaatcagc ctttagataa atggaatact 720tcaaaggttg aaaatatgaa
tcagatgttt aatgaggctt taaaatttaa tcagccttta 780aatagctgga atgtttccaa
tgtaaaaact atggaatgta tgtttcgcgg tactgaagct 840tttaatcagc ctttggataa
atgggataca aaaaaattaa aaacaatgtt tggaatgttt 900gactttgctg aaggttataa
tagttttgac tcattagcaa actgggattt aaataaagta 960tcagaaatga gtaatttatg
ttttaaaagg tatgaagaac ttcctttaag aattaaagca 1020tatcttcagg cattttatgg
ttcttataaa gattatttaa ctgttacaaa agataatgtc 1080aaagaaatat atgatcttat
ttcaaaagac acaaataaaa aagttttgtc atttaaaaag 1140agattagaaa gcgagtttag
tgaggaactt tcatctgtta cagataatta taatttcaaa 1200tctatagaag aagcagaaaa
gtatgttgaa aataattata ataaaaaaga tgataagaaa 1260gttagcttta taaatgatta
taaagttttg ataaaagata aatcaagaga agttgaaaat 1320aaagttttaa aatatatata
tttggaatat ttgctcctta aaagagatgt taaaaaatta 1380gtgcagattg ataatatagt
taatttactt gataaagaat catttataaa atttattaaa 1440aatgtttatg atgaaactaa
taaagaaaca gccgctttta tttatggcat atacggagga 1500gatgaggcag taaaaaatat
atataaaaaa gaaaaagaca ctaaactttc actattaata 1560attaaattaa atatagaaag
taaatatgca cttagaatat tatatgaaat atattcaaat 1620acaaaaaaat ctgaagttag
ttatgaagct gataaattga ttgatgaagt aatggaaaaa 1680atggatatta gttataatga
attccaatta agatattcat ctgatttagg atttaattct 1740aaaggtgaaa aagaattgaa
taaagattat aaattaattt tgaatagcga ttattctttg 1800agtctttttg atataaaaaa
taataaggaa cttaaaaaag cccctcaaaa tcttaatgaa 1860gatttaaaag aagaaataac
aaaattaaga aaagaaattc cttattttat gaaaaacact 1920gcttctcttt tagctgtttt
attagcaagc ggtgaaaaat acagttatga tttattcaaa 1980gagattttta ttgataatgc
cattatgaat agatttgctt catctttaat atggaatcta 2040tatgacaaag attctaattt
tataacaact ttcagatatt caggcgatgg aagttattca 2100aactgtgaag atgaagaagt
aaaaattaat gataatagtt ttgtaagttt agcaagccct 2160gtggaaatgg atgatgaaac
tatagataaa tggagaaaac agcttgaaga ttatgagata 2220gcacagccaa taagtcaatt
aactgtcata aaattagata aagataattt gaaaagcgaa 2280gtagaaaaaa tagataattt
agaaatagct tatggtactt tcaaggcttt cggtgaaaga 2340tatgaaatgt atagcgagta
tataggttat gatgttgtta aaagttattc attagaatca 2400aagaacggag acactttcac
tatagacgct gatgttaatt caaaaactga ttttcatgac 2460agagtaaaaa ttaatattaa
ttttgataat gaaaatggtg aggaagtaag taaaagattt 2520atttatactt tgttagtatt
aatgatttgg gattttagat taacagattt attt 257434858PRTBrachyspira
hyodysenteriae 34Leu Met Lys Lys Tyr Lys Pro Glu Thr Lys Gln Glu Leu Glu
Gln Leu1 5 10 15
Val Tyr Thr Asp Gly Ile Lys Leu Tyr Asp Val Asp Thr Ser Leu Ile
20 25 30 Thr Asp Met Ser Glu
Leu Phe His Asn Ser Thr Arg Lys Asp Phe Glu 35 40
45 Gly Ile Glu Asp Trp Asp Val Ser Asn Val
Glu Asp Met Ser Tyr Met 50 55 60
Phe Ala His Met Ser Tyr Asp Ser Tyr Glu Asn Arg Ser Lys Ala
Lys65 70 75 80 Phe
Asn His Asn Leu Asn Asn Trp Asn Val Ser Lys Val Lys His Met
85 90 95 Ser Phe Met Phe Tyr Tyr
Cys Gln Asp Phe Asn Gln Pro Leu Asp Lys 100
105 110 Trp Asp Val Ser Asn Val Gln Asp Thr Phe
Arg Met Phe Asp Asn Cys 115 120
125 Lys Lys Phe Asn Gln Pro Leu Asn Ser Trp Asn Val Ser Asn
Val Thr 130 135 140
Asn Met Ser Gly Met Phe Gln Val Ala Glu Ser Phe Asn Gln Pro Leu145
150 155 160 Asp Lys Trp Asp Val
Ser Lys Val Thr Thr Met Arg Ala Met Phe Asn 165
170 175 Tyr Ala Lys Ala Phe Asn Gln Asp Ile Ser
Asn Trp Asn Val Ser Lys 180 185
190 Val Glu Asp Met Gly Tyr Met Phe Ser Ile Cys Val Asn Phe Asn
Gln 195 200 205 Pro
Ile Asn Asp Trp Asp Val Ser Lys Val Lys Thr Met Glu Gly Met 210
215 220 Phe Arg Ser Ala Phe Lys
Phe Asn Gln Pro Leu Asp Lys Trp Asn Thr225 230
235 240 Ser Lys Val Glu Asn Met Asn Gln Met Phe Asn
Glu Ala Leu Lys Phe 245 250
255 Asn Gln Pro Leu Asn Ser Trp Asn Val Ser Asn Val Lys Thr Met Glu
260 265 270 Cys Met Phe
Arg Gly Thr Glu Ala Phe Asn Gln Pro Leu Asp Lys Trp 275
280 285 Asp Thr Lys Lys Leu Lys Thr Met
Phe Gly Met Phe Asp Phe Ala Glu 290 295
300 Gly Tyr Asn Ser Phe Asp Ser Leu Ala Asn Trp Asp Leu
Asn Lys Val305 310 315
320 Ser Glu Met Ser Asn Leu Cys Phe Lys Arg Tyr Glu Glu Leu Pro Leu
325 330 335 Arg Ile Lys Ala
Tyr Leu Gln Ala Phe Tyr Gly Ser Tyr Lys Asp Tyr 340
345 350 Leu Thr Val Thr Lys Asp Asn Val Lys
Glu Ile Tyr Asp Leu Ile Ser 355 360
365 Lys Asp Thr Asn Lys Lys Val Leu Ser Phe Lys Lys Arg Leu
Glu Ser 370 375 380
Glu Phe Ser Glu Glu Leu Ser Ser Val Thr Asp Asn Tyr Asn Phe Lys385
390 395 400 Ser Ile Glu Glu Ala
Glu Lys Tyr Val Glu Asn Asn Tyr Asn Lys Lys 405
410 415 Asp Asp Lys Lys Val Ser Phe Ile Asn Asp
Tyr Lys Val Leu Ile Lys 420 425
430 Asp Lys Ser Arg Glu Val Glu Asn Lys Val Leu Lys Tyr Ile Tyr
Leu 435 440 445 Glu
Tyr Leu Leu Leu Lys Arg Asp Val Lys Lys Leu Val Gln Ile Asp 450
455 460 Asn Ile Val Asn Leu Leu
Asp Lys Glu Ser Phe Ile Lys Phe Ile Lys465 470
475 480 Asn Val Tyr Asp Glu Thr Asn Lys Glu Thr Ala
Ala Phe Ile Tyr Gly 485 490
495 Ile Tyr Gly Gly Asp Glu Ala Val Lys Asn Ile Tyr Lys Lys Glu Lys
500 505 510 Asp Thr Lys
Leu Ser Leu Leu Ile Ile Lys Leu Asn Ile Glu Ser Lys 515
520 525 Tyr Ala Leu Arg Ile Leu Tyr Glu
Ile Tyr Ser Asn Thr Lys Lys Ser 530 535
540 Glu Val Ser Tyr Glu Ala Asp Lys Leu Ile Asp Glu Val
Met Glu Lys545 550 555
560 Met Asp Ile Ser Tyr Asn Glu Phe Gln Leu Arg Tyr Ser Ser Asp Leu
565 570 575 Gly Phe Asn Ser
Lys Gly Glu Lys Glu Leu Asn Lys Asp Tyr Lys Leu 580
585 590 Ile Leu Asn Ser Asp Tyr Ser Leu Ser
Leu Phe Asp Ile Lys Asn Asn 595 600
605 Lys Glu Leu Lys Lys Ala Pro Gln Asn Leu Asn Glu Asp Leu
Lys Glu 610 615 620
Glu Ile Thr Lys Leu Arg Lys Glu Ile Pro Tyr Phe Met Lys Asn Thr625
630 635 640 Ala Ser Leu Leu Ala
Val Leu Leu Ala Ser Gly Glu Lys Tyr Ser Tyr 645
650 655 Asp Leu Phe Lys Glu Ile Phe Ile Asp Asn
Ala Ile Met Asn Arg Phe 660 665
670 Ala Ser Ser Leu Ile Trp Asn Leu Tyr Asp Lys Asp Ser Asn Phe
Ile 675 680 685 Thr
Thr Phe Arg Tyr Ser Gly Asp Gly Ser Tyr Ser Asn Cys Glu Asp 690
695 700 Glu Glu Val Lys Ile Asn
Asp Asn Ser Phe Val Ser Leu Ala Ser Pro705 710
715 720 Val Glu Met Asp Asp Glu Thr Ile Asp Lys Trp
Arg Lys Gln Leu Glu 725 730
735 Asp Tyr Glu Ile Ala Gln Pro Ile Ser Gln Leu Thr Val Ile Lys Leu
740 745 750 Asp Lys Asp
Asn Leu Lys Ser Glu Val Glu Lys Ile Asp Asn Leu Glu 755
760 765 Ile Ala Tyr Gly Thr Phe Lys Ala
Phe Gly Glu Arg Tyr Glu Met Tyr 770 775
780 Ser Glu Tyr Ile Gly Tyr Asp Val Val Lys Ser Tyr Ser
Leu Glu Ser785 790 795
800 Lys Asn Gly Asp Thr Phe Thr Ile Asp Ala Asp Val Asn Ser Lys Thr
805 810 815 Asp Phe His Asp
Arg Val Lys Ile Asn Ile Asn Phe Asp Asn Glu Asn 820
825 830 Gly Glu Glu Val Ser Lys Arg Phe Ile
Tyr Thr Leu Leu Val Leu Met 835 840
845 Ile Trp Asp Phe Arg Leu Thr Asp Leu Phe 850
855 352100DNABrachyspira hyodysenteriae 35atgagaataa
aacttctagc ggttatagta ttatttttaa tgactatatc gctttcatac 60actttcgaca
aaactccgta ttatgtaaac acagaaactt atgactcata cagagagtta 120ttgagagggg
tgcattatta taatcaggaa agatatgatg catccatagc tagttttaga 180aactctctta
atacaaatcc tactgataag ttcataagat attggtatag taagtcttta 240tacaaagccg
gatatatgtc cttagctatt aatgaatggc ttaatattac gagaatgggt 300tatgaagatc
ctataatact ttctaaaatt aataaatatg attctgcaaa tgttaatgaa 360gagagagaaa
atattttgag taattttatt tatttgaaag cattctctac aaatcttaat 420tttagaaaaa
atattaatca gcctatacaa ataaaagtaa tgtctgatgg aagtttatat 480gttttggatt
atagtgattc ttcattaaag aaatttgata ttaatggaaa tctaataggt 540aaaatatccc
atggaaaaag attagaaaaa cagcagacta gctggtggag aaatttactt 600cagtttgcag
caaaagttta tccttatgaa aaattagaaa atcctagagg ttttgatata 660gatgcaaacg
gatatatata tatagccaat actaaaaaag ataaaatatt aaaatatgat 720gctaatcata
attatattac aaatattggg gtatccggtg taagtaatgg tcagcttctt 780ggaccttcat
ctgttgctgt tgatagagaa ggaaatttat atgtttctga tacaggaaat 840aatagaatag
ttatatttga tatagaagga aatttcttat atagttttgg aaaacttggt 900gaaaataatg
gagagttctt ttctcctgcg ggcatagcgg ttgatgacaa atatatttat 960gttgctgata
tgggtaataa aagaatacag caatttgatt tgagcggaaa ttatattcag 1020agtataaagc
ataatttatt taatgagcct agaggtttat cttttgctaa agatggaaat 1080ctttatatag
ctgatggaag taaggttttt tattataata tagctgaatc agattttaca 1140atatttaata
attccgaaag atatacagta actcctactt ctattgctga gggacctgat 1200ggaaatatat
atcttactga ttttatgtct ggaagaattg atgtatatac tagaaaagaa 1260gaatattacg
ctaatttaga tgtatttgta gacagagaat atttaaatag attccctgtt 1320gttgtagctt
ctgttacagt gagagataga gctatgaacc ctgtagttgg attaactcct 1380gaaaatttct
ttgttacaga gaatgcaggt gttgctcata aagttggttt ttatgatgct 1440cctgaattgc
atgaatatag attcgtgtat ttaatagaag atagtcttgc tgctaaacct 1500tatgagagca
gaattaaaga agagattagt aattttacta tgagcttaac taataatgat 1560gaagttttag
ttatacatta taatgatcag gtttacaagt ctgataatta tgatgctaga 1620aatttaagaa
tacttgaaaa tgctaatgct ttccatttta caggcggaat atctgctttg 1680gatgatgctt
attatgaagc tataagactt tcaggaaata gttttaagaa aactgctatt 1740atacattttt
cagtaactag tcctgacgac agagtatttg atatgatgaa ctttaatgat 1800gtagcaagtt
ttgctaaaaa caatgcagtt tcattaaacc aagtttatat cggtacaaat 1860aaatctaatt
atttcttaga tttaatgact gagaatactt acggttatat tatagatgct 1920gattattcta
taaattatac tgctgagctt aatagaatga aaaatataaa ttttggaaga 1980tatttcatat
actataacag ttttagaaat ttagctcagt caggacagtt tagggctttg 2040aatgttaagg
ttcaatatag agatatgtat ggtgaagaag aagttggtta tgtagtgcca
210036700PRTBrachyspira hyodysenteriae 36Met Arg Ile Lys Leu Leu Ala Val
Ile Val Leu Phe Leu Met Thr Ile1 5 10
15 Ser Leu Ser Tyr Thr Phe Asp Lys Thr Pro Tyr Tyr Val
Asn Thr Glu 20 25 30
Thr Tyr Asp Ser Tyr Arg Glu Leu Leu Arg Gly Val His Tyr Tyr Asn
35 40 45 Gln Glu Arg Tyr
Asp Ala Ser Ile Ala Ser Phe Arg Asn Ser Leu Asn 50 55
60 Thr Asn Pro Thr Asp Lys Phe Ile Arg
Tyr Trp Tyr Ser Lys Ser Leu65 70 75
80 Tyr Lys Ala Gly Tyr Met Ser Leu Ala Ile Asn Glu Trp Leu
Asn Ile 85 90 95
Thr Arg Met Gly Tyr Glu Asp Pro Ile Ile Leu Ser Lys Ile Asn Lys
100 105 110 Tyr Asp Ser Ala Asn
Val Asn Glu Glu Arg Glu Asn Ile Leu Ser Asn 115
120 125 Phe Ile Tyr Leu Lys Ala Phe Ser Thr
Asn Leu Asn Phe Arg Lys Asn 130 135
140 Ile Asn Gln Pro Ile Gln Ile Lys Val Met Ser Asp Gly
Ser Leu Tyr145 150 155
160 Val Leu Asp Tyr Ser Asp Ser Ser Leu Lys Lys Phe Asp Ile Asn Gly
165 170 175 Asn Leu Ile Gly
Lys Ile Ser His Gly Lys Arg Leu Glu Lys Gln Gln 180
185 190 Thr Ser Trp Trp Arg Asn Leu Leu Gln
Phe Ala Ala Lys Val Tyr Pro 195 200
205 Tyr Glu Lys Leu Glu Asn Pro Arg Gly Phe Asp Ile Asp Ala
Asn Gly 210 215 220
Tyr Ile Tyr Ile Ala Asn Thr Lys Lys Asp Lys Ile Leu Lys Tyr Asp225
230 235 240 Ala Asn His Asn Tyr
Ile Thr Asn Ile Gly Val Ser Gly Val Ser Asn 245
250 255 Gly Gln Leu Leu Gly Pro Ser Ser Val Ala
Val Asp Arg Glu Gly Asn 260 265
270 Leu Tyr Val Ser Asp Thr Gly Asn Asn Arg Ile Val Ile Phe Asp
Ile 275 280 285 Glu
Gly Asn Phe Leu Tyr Ser Phe Gly Lys Leu Gly Glu Asn Asn Gly 290
295 300 Glu Phe Phe Ser Pro Ala
Gly Ile Ala Val Asp Asp Lys Tyr Ile Tyr305 310
315 320 Val Ala Asp Met Gly Asn Lys Arg Ile Gln Gln
Phe Asp Leu Ser Gly 325 330
335 Asn Tyr Ile Gln Ser Ile Lys His Asn Leu Phe Asn Glu Pro Arg Gly
340 345 350 Leu Ser Phe
Ala Lys Asp Gly Asn Leu Tyr Ile Ala Asp Gly Ser Lys 355
360 365 Val Phe Tyr Tyr Asn Ile Ala Glu
Ser Asp Phe Thr Ile Phe Asn Asn 370 375
380 Ser Glu Arg Tyr Thr Val Thr Pro Thr Ser Ile Ala Glu
Gly Pro Asp385 390 395
400 Gly Asn Ile Tyr Leu Thr Asp Phe Met Ser Gly Arg Ile Asp Val Tyr
405 410 415 Thr Arg Lys Glu
Glu Tyr Tyr Ala Asn Leu Asp Val Phe Val Asp Arg 420
425 430 Glu Tyr Leu Asn Arg Phe Pro Val Val
Val Ala Ser Val Thr Val Arg 435 440
445 Asp Arg Ala Met Asn Pro Val Val Gly Leu Thr Pro Glu Asn
Phe Phe 450 455 460
Val Thr Glu Asn Ala Gly Val Ala His Lys Val Gly Phe Tyr Asp Ala465
470 475 480 Pro Glu Leu His Glu
Tyr Arg Phe Val Tyr Leu Ile Glu Asp Ser Leu 485
490 495 Ala Ala Lys Pro Tyr Glu Ser Arg Ile Lys
Glu Glu Ile Ser Asn Phe 500 505
510 Thr Met Ser Leu Thr Asn Asn Asp Glu Val Leu Val Ile His Tyr
Asn 515 520 525 Asp
Gln Val Tyr Lys Ser Asp Asn Tyr Asp Ala Arg Asn Leu Arg Ile 530
535 540 Leu Glu Asn Ala Asn Ala
Phe His Phe Thr Gly Gly Ile Ser Ala Leu545 550
555 560 Asp Asp Ala Tyr Tyr Glu Ala Ile Arg Leu Ser
Gly Asn Ser Phe Lys 565 570
575 Lys Thr Ala Ile Ile His Phe Ser Val Thr Ser Pro Asp Asp Arg Val
580 585 590 Phe Asp Met
Met Asn Phe Asn Asp Val Ala Ser Phe Ala Lys Asn Asn 595
600 605 Ala Val Ser Leu Asn Gln Val Tyr
Ile Gly Thr Asn Lys Ser Asn Tyr 610 615
620 Phe Leu Asp Leu Met Thr Glu Asn Thr Tyr Gly Tyr Ile
Ile Asp Ala625 630 635
640 Asp Tyr Ser Ile Asn Tyr Thr Ala Glu Leu Asn Arg Met Lys Asn Ile
645 650 655 Asn Phe Gly Arg
Tyr Phe Ile Tyr Tyr Asn Ser Phe Arg Asn Leu Ala 660
665 670 Gln Ser Gly Gln Phe Arg Ala Leu Asn
Val Lys Val Gln Tyr Arg Asp 675 680
685 Met Tyr Gly Glu Glu Glu Val Gly Tyr Val Val Pro 690
695 700 37711DNABrachyspira hyodysenteriae
37atgatagaat caatacaaag aatacatgcc agaataggcg agattcagga tacttttaat
60aaattaggtt ttgctcctat taatactcag attcctacta aaccttttgc tgaacattta
120aatgaagcta tggcagaaaa caaagtcaat aatattgatg gttctatagt taatgataca
180aataaaaagt tagataatgg aaaagtaatt aatggagata cttcttctga tgctttcaaa
240ggaaatatat catttggtgt ttatgatagt aatacaaata attttgctaa agctataaat
300gcttataaaa aagcttcagt agaaagtttc cctactaaat atgatgatat aattaaagag
360gcagcagaga aatattcttt gcctgaaaat ttaataaaag cggttataaa gcaggaatca
420aactatgtgc ctaatgctgt aagtcataaa ggtgctgttg gtttgatgca gataatgccg
480caaacaggtg ttggcttagg tattactgat acagaaatgc ttaaagatcc atacactaat
540ataatggctg gaagcagata tttatcacag atgttaaaca gatatgatgg aagacttgat
600ttatctttat ctgcttataa tgccggacct gctttggtag acagattaca gagaatccct
660aatatagagg aaactcaaaa ctatgttaaa aacattatag gatatataaa g
71138237PRTBrachyspira hyodysenteriae 38Met Ile Glu Ser Ile Gln Arg Ile
His Ala Arg Ile Gly Glu Ile Gln1 5 10
15 Asp Thr Phe Asn Lys Leu Gly Phe Ala Pro Ile Asn Thr
Gln Ile Pro 20 25 30
Thr Lys Pro Phe Ala Glu His Leu Asn Glu Ala Met Ala Glu Asn Lys
35 40 45 Val Asn Asn Ile
Asp Gly Ser Ile Val Asn Asp Thr Asn Lys Lys Leu 50 55
60 Asp Asn Gly Lys Val Ile Asn Gly Asp
Thr Ser Ser Asp Ala Phe Lys65 70 75
80 Gly Asn Ile Ser Phe Gly Val Tyr Asp Ser Asn Thr Asn Asn
Phe Ala 85 90 95
Lys Ala Ile Asn Ala Tyr Lys Lys Ala Ser Val Glu Ser Phe Pro Thr
100 105 110 Lys Tyr Asp Asp Ile
Ile Lys Glu Ala Ala Glu Lys Tyr Ser Leu Pro 115
120 125 Glu Asn Leu Ile Lys Ala Val Ile Lys
Gln Glu Ser Asn Tyr Val Pro 130 135
140 Asn Ala Val Ser His Lys Gly Ala Val Gly Leu Met Gln
Ile Met Pro145 150 155
160 Gln Thr Gly Val Gly Leu Gly Ile Thr Asp Thr Glu Met Leu Lys Asp
165 170 175 Pro Tyr Thr Asn
Ile Met Ala Gly Ser Arg Tyr Leu Ser Gln Met Leu 180
185 190 Asn Arg Tyr Asp Gly Arg Leu Asp Leu
Ser Leu Ser Ala Tyr Asn Ala 195 200
205 Gly Pro Ala Leu Val Asp Arg Leu Gln Arg Ile Pro Asn Ile
Glu Glu 210 215 220
Thr Gln Asn Tyr Val Lys Asn Ile Ile Gly Tyr Ile Lys225
230 235 39258DNABrachyspira hyodysenteriae
39atgaaaatag tttttaatga aagagcttgg caggaatata tagagtgggt atcagaagat
60aaaaaaatag taaaaaaaat taacgacttg attaaagata taataagaaa tccttgtgat
120ggaataggaa aagcagaaaa attaaaatat gataaaaaag atctttactc tagaagaata
180aataaagaac atagattagt atatcatata gaaaataatc aattaataat aacatcttgt
240aaataccatt atgataag
2584086PRTBrachyspira hyodysenteriae 40Met Lys Ile Val Phe Asn Glu Arg
Ala Trp Gln Glu Tyr Ile Glu Trp1 5 10
15 Val Ser Glu Asp Lys Lys Ile Val Lys Lys Ile Asn Asp
Leu Ile Lys 20 25 30
Asp Ile Ile Arg Asn Pro Cys Asp Gly Ile Gly Lys Ala Glu Lys Leu
35 40 45 Lys Tyr Asp Lys
Lys Asp Leu Tyr Ser Arg Arg Ile Asn Lys Glu His 50 55
60 Arg Leu Val Tyr His Ile Glu Asn Asn
Gln Leu Ile Ile Thr Ser Cys65 70 75
80 Lys Tyr His Tyr Asp Lys 85
412646DNABrachyspira hyodysenteriae 41gtggagattt tagtgaattt tattaagaaa
aattgtatta ttttattttc atttctttta 60cttgctgcag ctttattaat atctgcagag
agtgactttg aaaatttaca aacagcaaga 120aatatagctg tatatgaagg gcttacaata
aaccgtatag atgttacagg tgaagtaagg 180cttacaaagg aacaaataat aaacaatttt
cctataaaag ccggcagtaa atttcaaaga 240acagaaataa atgcagccat aaaaaaacta
tttgatacgc agttattcga tagagtggca 300atagatgcaa acagagaaga tgacggagta
gttttaaata ttgtagtagc tgaaagattc 360ataataaaag atatagaata tataggaaat
aaaagattaa gcagaacagc acttaatgat 420gccgtaaaac caattatgaa agcaggtgat
ccttatatac ctcagaaatt aaatgatgct 480gttaatgcta taataacaaa ttatcaagat
aaaggatatt tgaaagctta tgttgagcct 540aaagtaatag aaaataaaga tacttctgat
gttttaatac aaatgaacat agtagaaggt 600aatgaagtta aggttgctaa tataagattc
catggtaata cacattttac tgataatgaa 660cttaaaagac agatgtcaac aaaagaaaat
ggatttatga ctcttggaaa atttaatgag 720tttacatttg atggagacaa agataaaatt
gttaaatact atgcagatag aggttactat 780agagccaaag ttgataatgt aaagttcaca
tatcaatgga gaaatcctga aataaaaaat 840gaacaggatt taataataga tatatatgtt
acagagggag ataaatatta tttcggagat 900ataggattta aaggaaactt tataatacct
tctgaaaata tacaaaaaga tataaaatca 960aaaaaaggtg ctttatataa ttacacatat
catatggcag actatcaggg tatacaaaat 1020aaatattctg aaagaggtta tatattcaga
caagttatac ctgtaattac agtaaatgaa 1080gaaaataaaa tagtaaatat aatgtatgat
attgttgaaa atgataaagt gcatatagaa 1140aatattacta tagcaggaaa tacaaaaact
aaagattttg ttatagaaag atatatagat 1200ataaaacccg gagaagtatt caatactgca
aaaatacaaa gagttcaaga gagattatat 1260aatactcaat tctttgataa tattaattta
ggagtaaaac ctggttctgc tgaaggactt 1320atggaattaa atttaagtgt aactgaagga
agaacagcta tggtatcagg aggaggcggt 1380ttctccactg gttccggatt taaggtattt
gcttctatta gagaaaataa cttcttagga 1440agaggattgc agttaggatt aagcggagaa
tttggagagc agcagaaacg tatagctgtt 1500aactttgctg agccttattt acttaatctg
cctatatatt tgggtgtgga tttatcatac 1560ttcaatgaag gtgtaaacac tggttatcaa
ataggaaccg atggtaattt tggtatacct 1620aaatactcat actatactag acatggtttt
gaaggtatag taagactagg ttattacttt 1680gctgattatt attctacatt cataacattt
gataccatag tacagcagta tcagcaatgg 1740catgaccaag gagctactgc tgccggtcct
aattatgttc ttagtgatat aaaaaaatat 1800ttaactcata gagttaataa aaaagatgga
tcattccaaa gatgggaaag tgattggttt 1860acaacattca ttgtttcata ttctttactt
agagatagca gaaacgatta tttgaaccct 1920actagaggaa gtttcttgag aggtatggta
gatttctatt ttggacacac ccagcttaca 1980agattgagtg ctacaggatt cttggctgta
cctgctacag aatggctgtc atttgcattc 2040tatggagaat taggacaaat aattgctact
cctggacttg ctttgcaaaa tgatgctgat 2100gttctttatt atcttaaccc atttgaagat
gtaaggggat gggatacttc caaatatact 2160atatttaaga aaaacagagg attatcaact
tatgatatgt taggagccaa cggttcagac 2220ggtaaaccta ctactgactc ttggagttac
ggtagagcaa aagtaagatt ctttgctgaa 2280cttcgtatac ctataatacc taaaactctt
ggattcgtta ctttccttga tgcaggacaa 2340ttatggatgc catacagtac aggttggaat
caggacggag atgctcattc atatccttct 2400caatttatga atattaaaga tatatttgat
ccttctcaat atatatattc tgtaggaata 2460ggattcagac ttacaatacc tatattcaat
ataagattct atattgctaa aagattcgtt 2520tacaataaag aagatgttgg atttggtaaa
ggatttcaag attttgaagg agatactttc 2580actcctcttg gtgcttggtt cggaagagga
tggggaattg catttactat gaaccaccca 2640ttctat
264642882PRTBrachyspira hyodysenteriae
42Val Glu Ile Leu Val Asn Phe Ile Lys Lys Asn Cys Ile Ile Leu Phe1
5 10 15 Ser Phe Leu Leu
Leu Ala Ala Ala Leu Leu Ile Ser Ala Glu Ser Asp 20
25 30 Phe Glu Asn Leu Gln Thr Ala Arg Asn
Ile Ala Val Tyr Glu Gly Leu 35 40
45 Thr Ile Asn Arg Ile Asp Val Thr Gly Glu Val Arg Leu Thr
Lys Glu 50 55 60
Gln Ile Ile Asn Asn Phe Pro Ile Lys Ala Gly Ser Lys Phe Gln Arg65
70 75 80 Thr Glu Ile Asn Ala
Ala Ile Lys Lys Leu Phe Asp Thr Gln Leu Phe 85
90 95 Asp Arg Val Ala Ile Asp Ala Asn Arg Glu
Asp Asp Gly Val Val Leu 100 105
110 Asn Ile Val Val Ala Glu Arg Phe Ile Ile Lys Asp Ile Glu Tyr
Ile 115 120 125 Gly
Asn Lys Arg Leu Ser Arg Thr Ala Leu Asn Asp Ala Val Lys Pro 130
135 140 Ile Met Lys Ala Gly Asp
Pro Tyr Ile Pro Gln Lys Leu Asn Asp Ala145 150
155 160 Val Asn Ala Ile Ile Thr Asn Tyr Gln Asp Lys
Gly Tyr Leu Lys Ala 165 170
175 Tyr Val Glu Pro Lys Val Ile Glu Asn Lys Asp Thr Ser Asp Val Leu
180 185 190 Ile Gln Met
Asn Ile Val Glu Gly Asn Glu Val Lys Val Ala Asn Ile 195
200 205 Arg Phe His Gly Asn Thr His Phe
Thr Asp Asn Glu Leu Lys Arg Gln 210 215
220 Met Ser Thr Lys Glu Asn Gly Phe Met Thr Leu Gly Lys
Phe Asn Glu225 230 235
240 Phe Thr Phe Asp Gly Asp Lys Asp Lys Ile Val Lys Tyr Tyr Ala Asp
245 250 255 Arg Gly Tyr Tyr
Arg Ala Lys Val Asp Asn Val Lys Phe Thr Tyr Gln 260
265 270 Trp Arg Asn Pro Glu Ile Lys Asn Glu
Gln Asp Leu Ile Ile Asp Ile 275 280
285 Tyr Val Thr Glu Gly Asp Lys Tyr Tyr Phe Gly Asp Ile Gly
Phe Lys 290 295 300
Gly Asn Phe Ile Ile Pro Ser Glu Asn Ile Gln Lys Asp Ile Lys Ser305
310 315 320 Lys Lys Gly Ala Leu
Tyr Asn Tyr Thr Tyr His Met Ala Asp Tyr Gln 325
330 335 Gly Ile Gln Asn Lys Tyr Ser Glu Arg Gly
Tyr Ile Phe Arg Gln Val 340 345
350 Ile Pro Val Ile Thr Val Asn Glu Glu Asn Lys Ile Val Asn Ile
Met 355 360 365 Tyr
Asp Ile Val Glu Asn Asp Lys Val His Ile Glu Asn Ile Thr Ile 370
375 380 Ala Gly Asn Thr Lys Thr
Lys Asp Phe Val Ile Glu Arg Tyr Ile Asp385 390
395 400 Ile Lys Pro Gly Glu Val Phe Asn Thr Ala Lys
Ile Gln Arg Val Gln 405 410
415 Glu Arg Leu Tyr Asn Thr Gln Phe Phe Asp Asn Ile Asn Leu Gly Val
420 425 430 Lys Pro Gly
Ser Ala Glu Gly Leu Met Glu Leu Asn Leu Ser Val Thr 435
440 445 Glu Gly Arg Thr Ala Met Val Ser
Gly Gly Gly Gly Phe Ser Thr Gly 450 455
460 Ser Gly Phe Lys Val Phe Ala Ser Ile Arg Glu Asn Asn
Phe Leu Gly465 470 475
480 Arg Gly Leu Gln Leu Gly Leu Ser Gly Glu Phe Gly Glu Gln Gln Lys
485 490 495 Arg Ile Ala Val
Asn Phe Ala Glu Pro Tyr Leu Leu Asn Leu Pro Ile 500
505 510 Tyr Leu Gly Val Asp Leu Ser Tyr Phe
Asn Glu Gly Val Asn Thr Gly 515 520
525 Tyr Gln Ile Gly Thr Asp Gly Asn Phe Gly Ile Pro Lys Tyr
Ser Tyr 530 535 540
Tyr Thr Arg His Gly Phe Glu Gly Ile Val Arg Leu Gly Tyr Tyr Phe545
550 555 560 Ala Asp Tyr Tyr Ser
Thr Phe Ile Thr Phe Asp Thr Ile Val Gln Gln 565
570 575 Tyr Gln Gln Trp His Asp Gln Gly Ala Thr
Ala Ala Gly Pro Asn Tyr 580 585
590 Val Leu Ser Asp Ile Lys Lys Tyr Leu Thr His Arg Val Asn Lys
Lys 595 600 605 Asp
Gly Ser Phe Gln Arg Trp Glu Ser Asp Trp Phe Thr Thr Phe Ile 610
615 620 Val Ser Tyr Ser Leu Leu
Arg Asp Ser Arg Asn Asp Tyr Leu Asn Pro625 630
635 640 Thr Arg Gly Ser Phe Leu Arg Gly Met Val Asp
Phe Tyr Phe Gly His 645 650
655 Thr Gln Leu Thr Arg Leu Ser Ala Thr Gly Phe Leu Ala Val Pro Ala
660 665 670 Thr Glu Trp
Leu Ser Phe Ala Phe Tyr Gly Glu Leu Gly Gln Ile Ile 675
680 685 Ala Thr Pro Gly Leu Ala Leu Gln
Asn Asp Ala Asp Val Leu Tyr Tyr 690 695
700 Leu Asn Pro Phe Glu Asp Val Arg Gly Trp Asp Thr Ser
Lys Tyr Thr705 710 715
720 Ile Phe Lys Lys Asn Arg Gly Leu Ser Thr Tyr Asp Met Leu Gly Ala
725 730 735 Asn Gly Ser Asp
Gly Lys Pro Thr Thr Asp Ser Trp Ser Tyr Gly Arg 740
745 750 Ala Lys Val Arg Phe Phe Ala Glu Leu
Arg Ile Pro Ile Ile Pro Lys 755 760
765 Thr Leu Gly Phe Val Thr Phe Leu Asp Ala Gly Gln Leu Trp
Met Pro 770 775 780
Tyr Ser Thr Gly Trp Asn Gln Asp Gly Asp Ala His Ser Tyr Pro Ser785
790 795 800 Gln Phe Met Asn Ile
Lys Asp Ile Phe Asp Pro Ser Gln Tyr Ile Tyr 805
810 815 Ser Val Gly Ile Gly Phe Arg Leu Thr Ile
Pro Ile Phe Asn Ile Arg 820 825
830 Phe Tyr Ile Ala Lys Arg Phe Val Tyr Asn Lys Glu Asp Val Gly
Phe 835 840 845 Gly
Lys Gly Phe Gln Asp Phe Glu Gly Asp Thr Phe Thr Pro Leu Gly 850
855 860 Ala Trp Phe Gly Arg Gly
Trp Gly Ile Ala Phe Thr Met Asn His Pro865 870
875 880 Phe Tyr431308DNABrachyspira hyodysenteriae
43atgaaacgtt tatattttat tttatcagct ttattaataa ctgcttatag tgcatttagt
60tatactgttg tagaagattt caatgatttt ttagttgatg aaaatcaatt aagaataagg
120cttgacagat tcggagtatt ggcaggaaca gagaatttaa gatttatggt tggagtatca
180ggagaaactg caggagtatt gcttgataat ttagacagag gtactaaagg aggaataaat
240acattcagac cggcagcaat agcaggattt ggatataaaa cagaaagttt tggtataggt
300gtaggttatc agtttaaata tatatcagga agctggcagt cgcatactcc tataataaca
360gcaacagctt tgaatgataa cttgagaatc aatgtacctg ttacaatagg agtaggaagc
420ggaaatgtta atgacggaga tatagcagtt tcaacagata ctagaataga atattataca
480ggaaacaata tattcagcag aataagagtt aatcttaaat atggtatgta tagattaaaa
540gctaatgaaa gcagaagcgg agatttgaca ggaagcggaa atataaatat gggtactgta
600agtggaactg taggcgagaa tggtaaatat ggatttctta aagatactac agcacattct
660ataggaatag atgtaagagg ttattttata gcggcaacag atcctgtatt agtagagcct
720cagataagag tattatatca aggttctata gcggatttta caggtacttc atataaagta
780acaacaccca ctggaactaa agaaggagga gcaggattcg gactctataa tatagatgct
840tcaaatccta taggtgcttt ttcaataggt gatacaggtt caatacaatc agtgccttat
900tatgatttta ctgctcataa tataatgttt acaggtgaag gagcttcaat agagatagga
960ggtacagaat attatcttac aaagccgcag tttttaggaa tatccgttcc tgtggggttt
1020actgctgaaa gtgagtttat tacattgtat ttggagcctg ctttatcatt ctctatgatt
1080acaggaggaa ttaattctta tgcaagcagt gctaagcctg taagaatacc gcctttattt
1140tattcggttg gatatttggt atatggagaa ttatatataa ctcctaaacc taatttagaa
1200tggtattttg aggctcagat tggaagtgct acaactattg atagtatagg agatagtaaa
1260cagggaggtt tagctttcaa tggaagtacc ggtatcactt ggaagttt
130844436PRTBrachyspira hyodysenteriae 44Met Lys Arg Leu Tyr Phe Ile Leu
Ser Ala Leu Leu Ile Thr Ala Tyr1 5 10
15 Ser Ala Phe Ser Tyr Thr Val Val Glu Asp Phe Asn Asp
Phe Leu Val 20 25 30
Asp Glu Asn Gln Leu Arg Ile Arg Leu Asp Arg Phe Gly Val Leu Ala
35 40 45 Gly Thr Glu Asn
Leu Arg Phe Met Val Gly Val Ser Gly Glu Thr Ala 50 55
60 Gly Val Leu Leu Asp Asn Leu Asp Arg
Gly Thr Lys Gly Gly Ile Asn65 70 75
80 Thr Phe Arg Pro Ala Ala Ile Ala Gly Phe Gly Tyr Lys Thr
Glu Ser 85 90 95
Phe Gly Ile Gly Val Gly Tyr Gln Phe Lys Tyr Ile Ser Gly Ser Trp
100 105 110 Gln Ser His Thr Pro
Ile Ile Thr Ala Thr Ala Leu Asn Asp Asn Leu 115
120 125 Arg Ile Asn Val Pro Val Thr Ile Gly
Val Gly Ser Gly Asn Val Asn 130 135
140 Asp Gly Asp Ile Ala Val Ser Thr Asp Thr Arg Ile Glu
Tyr Tyr Thr145 150 155
160 Gly Asn Asn Ile Phe Ser Arg Ile Arg Val Asn Leu Lys Tyr Gly Met
165 170 175 Tyr Arg Leu Lys
Ala Asn Glu Ser Arg Ser Gly Asp Leu Thr Gly Ser 180
185 190 Gly Asn Ile Asn Met Gly Thr Val Ser
Gly Thr Val Gly Glu Asn Gly 195 200
205 Lys Tyr Gly Phe Leu Lys Asp Thr Thr Ala His Ser Ile Gly
Ile Asp 210 215 220
Val Arg Gly Tyr Phe Ile Ala Ala Thr Asp Pro Val Leu Val Glu Pro225
230 235 240 Gln Ile Arg Val Leu
Tyr Gln Gly Ser Ile Ala Asp Phe Thr Gly Thr 245
250 255 Ser Tyr Lys Val Thr Thr Pro Thr Gly Thr
Lys Glu Gly Gly Ala Gly 260 265
270 Phe Gly Leu Tyr Asn Ile Asp Ala Ser Asn Pro Ile Gly Ala Phe
Ser 275 280 285 Ile
Gly Asp Thr Gly Ser Ile Gln Ser Val Pro Tyr Tyr Asp Phe Thr 290
295 300 Ala His Asn Ile Met Phe
Thr Gly Glu Gly Ala Ser Ile Glu Ile Gly305 310
315 320 Gly Thr Glu Tyr Tyr Leu Thr Lys Pro Gln Phe
Leu Gly Ile Ser Val 325 330
335 Pro Val Gly Phe Thr Ala Glu Ser Glu Phe Ile Thr Leu Tyr Leu Glu
340 345 350 Pro Ala Leu
Ser Phe Ser Met Ile Thr Gly Gly Ile Asn Ser Tyr Ala 355
360 365 Ser Ser Ala Lys Pro Val Arg Ile
Pro Pro Leu Phe Tyr Ser Val Gly 370 375
380 Tyr Leu Val Tyr Gly Glu Leu Tyr Ile Thr Pro Lys Pro
Asn Leu Glu385 390 395
400 Trp Tyr Phe Glu Ala Gln Ile Gly Ser Ala Thr Thr Ile Asp Ser Ile
405 410 415 Gly Asp Ser Lys
Gln Gly Gly Leu Ala Phe Asn Gly Ser Thr Gly Ile 420
425 430 Thr Trp Lys Phe 435
452367DNABrachyspira hyodysenteriae 45atgaaatata aacctacaag caggaaagaa
ttaaaagatt tagtaacaga tgaaagtatt 60tatttgggtg atattgatac tagcttaata
actgatatgt caaacttatt tgattttttt 120aatagagata attatgacgg tatagaaaat
tgggatactt ctaatgtaga aaatatggct 180ggtatgtttt ctgctaatag gaattttaat
aaagatatta gtaaatggaa tgtatctaaa 240gtgaaaaata cagcttatat gtttttcttg
gctgaaaaat ttaatcagcc tttgaatgat 300tgggacgtta gtaatgtaat aaatatgaat
agcatgttta tgaatgctaa aagttttaat 360cagcctatta ataattggaa tgtaagtaaa
gttcaaagta tgagcaatat gtttaatcgt 420gccgaaagtt ttaatcaaaa tataaatgat
tggaatgtaa gtaatgtaga aaatatgaat 480catatgtttt catctgccta taaattcaat
cagcctttat ttaaatggga tacttctaaa 540gtaaaagaga tggctggtat gttttcatta
gcttatgcat ttaatcagcc tcttaacaat 600tggaatgtaa gcaatgttac taatatgagg
tgcatgttta tgtttgcaag agattttaat 660aagcctatta ataattggaa tacaaaaaaa
ttaaaagatg caggaagtat gttctcaaat 720acatcggcat tcaatcagaa tttagatgat
tggaatattg ataatctttc agatatgagt 780aattttaata aagattctaa attagaatta
acatttaaat tcaaaattta tttatatgct 840ttaactttag aaaaagaaga aaaaaataat
ttacatgatt ttataaaaaa caatgtaaaa 900aagatatatg aaattataga aaatcataaa
aacaagaagg ttaatcttct taaaagatat 960ttaataaata atttttatag tgaattaaaa
gaattaatac cagattatat tgaaagtttt 1020aatagcatag aagaagttta taattatata
gacaaaaatt ataataaaaa agatgataaa 1080aaagtaaaat ttatagatga tataaaaatt
gaaaatatag ataaaagaat aataaaatat 1140atttacttat catatttaga attaaaaaga
gaagcctaca gaataaagca aatagattat 1200attataaatt taattgataa aaaatctttt
ataaatgcaa ttaaaacgat atacacaagc 1260accaataaag aaacatctct aattatgtac
ggaatatacg gaggagatga ggcattaaga 1320gagatttaca aaaaagaaaa agattcaaaa
ttatgtttac ttgtattttc tatcaataaa 1380aacagtaaat atgctattaa tatgctttat
aatgtattta agaaaagtaa aaaatatgaa 1440gtaaaagaga cagcagaaaa aattattgag
gatatagcaa aagaaaataa tttgagcgtt 1500tatgaatttg gattaaaaac tataccaaat
tttggattca atataaacgg tgaaaaaata 1560ataaataata atcaatataa aataattttg
aaaaacgatt atactataga gttttttgat 1620atcaaagaaa ataaaatatt aaagcaaata
cctaaatatt ttgataatag taccaaagaa 1680gaaattaaat atataaaaac agaaattcca
aatattataa aaaatcaaag cagaaattta 1740ataaaaattt tattaacagg taaaaagtac
tatttcaatt tttttaaaga aatatttatt 1800gataatccaa taatgaataa atttgcaatt
aatttagttt ggaatttatt tgatgaaaat 1860aacaatttta taacgacatt taggtattca
ggcgacggaa gttatacaaa ctacgatgat 1920aatacagtga atataaatga taattatttt
gtaagtttat caagccctat agaaatggaa 1980gaaaaaatta tatcaaaatg gaaaaaacat
cttgaagatt atgaattatc acagcctata 2040atgcagttta caaatataaa aataaataat
ttagaagaag cattaaaaaa attagaaaat 2100atagaaataa gctacggtac aataaaagca
ttttctcaaa agtatgatat gaatactgaa 2160tgtaaaagct attacgaaat taacggatat
tcatttgaag actcatacaa taatcaagat 2220ttttatataa gaacaaaaat tatcaatact
gaaaccaatt ataatgataa aataaaaatt 2280aatatagagt ttaacaatgc tagcaacaga
tttatatata cttggcttat acttttaata 2340tgggatttta gattaactga aatattt
236746789PRTBrachyspira hyodysenteriae
46Met Lys Tyr Lys Pro Thr Ser Arg Lys Glu Leu Lys Asp Leu Val Thr1
5 10 15 Asp Glu Ser Ile
Tyr Leu Gly Asp Ile Asp Thr Ser Leu Ile Thr Asp 20
25 30 Met Ser Asn Leu Phe Asp Phe Phe Asn
Arg Asp Asn Tyr Asp Gly Ile 35 40
45 Glu Asn Trp Asp Thr Ser Asn Val Glu Asn Met Ala Gly Met
Phe Ser 50 55 60
Ala Asn Arg Asn Phe Asn Lys Asp Ile Ser Lys Trp Asn Val Ser Lys65
70 75 80 Val Lys Asn Thr Ala
Tyr Met Phe Phe Leu Ala Glu Lys Phe Asn Gln 85
90 95 Pro Leu Asn Asp Trp Asp Val Ser Asn Val
Ile Asn Met Asn Ser Met 100 105
110 Phe Met Asn Ala Lys Ser Phe Asn Gln Pro Ile Asn Asn Trp Asn
Val 115 120 125 Ser
Lys Val Gln Ser Met Ser Asn Met Phe Asn Arg Ala Glu Ser Phe 130
135 140 Asn Gln Asn Ile Asn Asp
Trp Asn Val Ser Asn Val Glu Asn Met Asn145 150
155 160 His Met Phe Ser Ser Ala Tyr Lys Phe Asn Gln
Pro Leu Phe Lys Trp 165 170
175 Asp Thr Ser Lys Val Lys Glu Met Ala Gly Met Phe Ser Leu Ala Tyr
180 185 190 Ala Phe Asn
Gln Pro Leu Asn Asn Trp Asn Val Ser Asn Val Thr Asn 195
200 205 Met Arg Cys Met Phe Met Phe Ala
Arg Asp Phe Asn Lys Pro Ile Asn 210 215
220 Asn Trp Asn Thr Lys Lys Leu Lys Asp Ala Gly Ser Met
Phe Ser Asn225 230 235
240 Thr Ser Ala Phe Asn Gln Asn Leu Asp Asp Trp Asn Ile Asp Asn Leu
245 250 255 Ser Asp Met Ser
Asn Phe Asn Lys Asp Ser Lys Leu Glu Leu Thr Phe 260
265 270 Lys Phe Lys Ile Tyr Leu Tyr Ala Leu
Thr Leu Glu Lys Glu Glu Lys 275 280
285 Asn Asn Leu His Asp Phe Ile Lys Asn Asn Val Lys Lys Ile
Tyr Glu 290 295 300
Ile Ile Glu Asn His Lys Asn Lys Lys Val Asn Leu Leu Lys Arg Tyr305
310 315 320 Leu Ile Asn Asn Phe
Tyr Ser Glu Leu Lys Glu Leu Ile Pro Asp Tyr 325
330 335 Ile Glu Ser Phe Asn Ser Ile Glu Glu Val
Tyr Asn Tyr Ile Asp Lys 340 345
350 Asn Tyr Asn Lys Lys Asp Asp Lys Lys Val Lys Phe Ile Asp Asp
Ile 355 360 365 Lys
Ile Glu Asn Ile Asp Lys Arg Ile Ile Lys Tyr Ile Tyr Leu Ser 370
375 380 Tyr Leu Glu Leu Lys Arg
Glu Ala Tyr Arg Ile Lys Gln Ile Asp Tyr385 390
395 400 Ile Ile Asn Leu Ile Asp Lys Lys Ser Phe Ile
Asn Ala Ile Lys Thr 405 410
415 Ile Tyr Thr Ser Thr Asn Lys Glu Thr Ser Leu Ile Met Tyr Gly Ile
420 425 430 Tyr Gly Gly
Asp Glu Ala Leu Arg Glu Ile Tyr Lys Lys Glu Lys Asp 435
440 445 Ser Lys Leu Cys Leu Leu Val Phe
Ser Ile Asn Lys Asn Ser Lys Tyr 450 455
460 Ala Ile Asn Met Leu Tyr Asn Val Phe Lys Lys Ser Lys
Lys Tyr Glu465 470 475
480 Val Lys Glu Thr Ala Glu Lys Ile Ile Glu Asp Ile Ala Lys Glu Asn
485 490 495 Asn Leu Ser Val
Tyr Glu Phe Gly Leu Lys Thr Ile Pro Asn Phe Gly 500
505 510 Phe Asn Ile Asn Gly Glu Lys Ile Ile
Asn Asn Asn Gln Tyr Lys Ile 515 520
525 Ile Leu Lys Asn Asp Tyr Thr Ile Glu Phe Phe Asp Ile Lys
Glu Asn 530 535 540
Lys Ile Leu Lys Gln Ile Pro Lys Tyr Phe Asp Asn Ser Thr Lys Glu545
550 555 560 Glu Ile Lys Tyr Ile
Lys Thr Glu Ile Pro Asn Ile Ile Lys Asn Gln 565
570 575 Ser Arg Asn Leu Ile Lys Ile Leu Leu Thr
Gly Lys Lys Tyr Tyr Phe 580 585
590 Asn Phe Phe Lys Glu Ile Phe Ile Asp Asn Pro Ile Met Asn Lys
Phe 595 600 605 Ala
Ile Asn Leu Val Trp Asn Leu Phe Asp Glu Asn Asn Asn Phe Ile 610
615 620 Thr Thr Phe Arg Tyr Ser
Gly Asp Gly Ser Tyr Thr Asn Tyr Asp Asp625 630
635 640 Asn Thr Val Asn Ile Asn Asp Asn Tyr Phe Val
Ser Leu Ser Ser Pro 645 650
655 Ile Glu Met Glu Glu Lys Ile Ile Ser Lys Trp Lys Lys His Leu Glu
660 665 670 Asp Tyr Glu
Leu Ser Gln Pro Ile Met Gln Phe Thr Asn Ile Lys Ile 675
680 685 Asn Asn Leu Glu Glu Ala Leu Lys
Lys Leu Glu Asn Ile Glu Ile Ser 690 695
700 Tyr Gly Thr Ile Lys Ala Phe Ser Gln Lys Tyr Asp Met
Asn Thr Glu705 710 715
720 Cys Lys Ser Tyr Tyr Glu Ile Asn Gly Tyr Ser Phe Glu Asp Ser Tyr
725 730 735 Asn Asn Gln Asp
Phe Tyr Ile Arg Thr Lys Ile Ile Asn Thr Glu Thr 740
745 750 Asn Tyr Asn Asp Lys Ile Lys Ile Asn
Ile Glu Phe Asn Asn Ala Ser 755 760
765 Asn Arg Phe Ile Tyr Thr Trp Leu Ile Leu Leu Ile Trp Asp
Phe Arg 770 775 780
Leu Thr Glu Ile Phe785 47729DNABrachyspira hyodysenteriae
47atgataaaaa aaattttaac tttaatcttt gtattaattt tggcagcttc atgttctact
60aatgataaac atgttgtagt attagctttt agtaaacagc ttcatgctgt actttataat
120gataatagtc agtctacaaa aacagcatca aaaacatata tacaaaaaga tgatattaca
180actgtagcag atcctataaa agaaaaaaaa gaatatacaa atactcaagc acaagtaagt
240aaaaaagcag aagaaaaaaa agaagaactt acaaataacg atgctttaga agaagaaaaa
300cctcaagtta taaagcaaac tgaggttata cagaaagatg ataatgagat tcttcttact
360gcaaatataa tatcttttga ttttgattct tatgaattaa aaaatgaata taatgaaggg
420atagatgaaa tttgcaaata tttaaataat aatcgagata ttaatctaat aatagaagga
480catagcgaca gtatagggga ctcaaattat aatatatatt tatctgaaaa cagagcaaaa
540gcgatatttg ataaattagt agataaagga atagataaag atagacttag atatatagga
600tatggctcta ctcattcatc tgagtataat gataaagaca gaaaatgcca atttgttata
660ataaataatt cagatgaaga gcaggaatac aaaaaagaaa acgaaactga tattatcaaa
720ttaaaacaa
72948243PRTBrachyspira hyodysenteriae 48Met Ile Lys Lys Ile Leu Thr Leu
Ile Phe Val Leu Ile Leu Ala Ala1 5 10
15 Ser Cys Ser Thr Asn Asp Lys His Val Val Val Leu Ala
Phe Ser Lys 20 25 30
Gln Leu His Ala Val Leu Tyr Asn Asp Asn Ser Gln Ser Thr Lys Thr
35 40 45 Ala Ser Lys Thr
Tyr Ile Gln Lys Asp Asp Ile Thr Thr Val Ala Asp 50 55
60 Pro Ile Lys Glu Lys Lys Glu Tyr Thr
Asn Thr Gln Ala Gln Val Ser65 70 75
80 Lys Lys Ala Glu Glu Lys Lys Glu Glu Leu Thr Asn Asn Asp
Ala Leu 85 90 95
Glu Glu Glu Lys Pro Gln Val Ile Lys Gln Thr Glu Val Ile Gln Lys
100 105 110 Asp Asp Asn Glu Ile
Leu Leu Thr Ala Asn Ile Ile Ser Phe Asp Phe 115
120 125 Asp Ser Tyr Glu Leu Lys Asn Glu Tyr
Asn Glu Gly Ile Asp Glu Ile 130 135
140 Cys Lys Tyr Leu Asn Asn Asn Arg Asp Ile Asn Leu Ile
Ile Glu Gly145 150 155
160 His Ser Asp Ser Ile Gly Asp Ser Asn Tyr Asn Ile Tyr Leu Ser Glu
165 170 175 Asn Arg Ala Lys
Ala Ile Phe Asp Lys Leu Val Asp Lys Gly Ile Asp 180
185 190 Lys Asp Arg Leu Arg Tyr Ile Gly Tyr
Gly Ser Thr His Ser Ser Glu 195 200
205 Tyr Asn Asp Lys Asp Arg Lys Cys Gln Phe Val Ile Ile Asn
Asn Ser 210 215 220
Asp Glu Glu Gln Glu Tyr Lys Lys Glu Asn Glu Thr Asp Ile Ile Lys225
230 235 240 Leu Lys
Gln49969DNABrachyspira hyodysenteriae 49atgaaaaaaa ttattttatt aatatttata
ttattaaata tatcatgcag aaatatcatt 60acaatagcag aaaataaaaa aaatatagat
aatgtaaata atgtacatat agaagaaaat 120gaatacttat atgctcttga aatagataaa
gccaatcctc aaaatatgga agaagcatta 180aaaagatatg cagcagatca taatggaaaa
tataaattaa tattcacagg tacatcaaca 240aaaaaatatg atgtttggac ttcaataagt
caaatgcttg aagatatttc tttaaaaaac 300ataaaaatag aaatatcgat tgtaaatgta
atttttccaa atggtaaaat acctgatttt 360ttatttggag gaaatgctgt aaataaatca
atagtaaaaa taacatttcc aaatagcata 420actgaaatag gcgaatacag tattttttgt
ccagaattaa cggaaataac acttccaagt 480aatttaagaa caataggcag aagaggatta
ataggatgcg aaagtttaaa aatactgaaa 540cttcctaatt cattaaaaac aataggagaa
ttatcattaa atggatgcgg atttgccagt 600attgtaattc ctgattctgt aacttctata
ggtaaaagtg cttttgccga ttgtgagaat 660ttagtaaata taaaattacc aaataattta
gaaacaatac ctgatagtat gcttgaaagc 720tgcggatcca ttaatacaat aactatacca
gcatctgtaa aaaaaataga aaattctgta 780tttttttact gcaaaaactt tgaaaacatt
agatttttaa atggtaatct tcaatcaatg 840acagtaggaa aagatatatt tgcaggctgc
cctttaaaaa atgtttatat acctaaaaac 900agcagtgcat cagatgaaga atggagaaat
actttaggca ttaaatcaac tgtaaagatt 960ataagagaa
96950323PRTBrachyspira hyodysenteriae
50Met Lys Lys Ile Ile Leu Leu Ile Phe Ile Leu Leu Asn Ile Ser Cys1
5 10 15 Arg Asn Ile Ile
Thr Ile Ala Glu Asn Lys Lys Asn Ile Asp Asn Val 20
25 30 Asn Asn Val His Ile Glu Glu Asn Glu
Tyr Leu Tyr Ala Leu Glu Ile 35 40
45 Asp Lys Ala Asn Pro Gln Asn Met Glu Glu Ala Leu Lys Arg
Tyr Ala 50 55 60
Ala Asp His Asn Gly Lys Tyr Lys Leu Ile Phe Thr Gly Thr Ser Thr65
70 75 80 Lys Lys Tyr Asp Val
Trp Thr Ser Ile Ser Gln Met Leu Glu Asp Ile 85
90 95 Ser Leu Lys Asn Ile Lys Ile Glu Ile Ser
Ile Val Asn Val Ile Phe 100 105
110 Pro Asn Gly Lys Ile Pro Asp Phe Leu Phe Gly Gly Asn Ala Val
Asn 115 120 125 Lys
Ser Ile Val Lys Ile Thr Phe Pro Asn Ser Ile Thr Glu Ile Gly 130
135 140 Glu Tyr Ser Ile Phe Cys
Pro Glu Leu Thr Glu Ile Thr Leu Pro Ser145 150
155 160 Asn Leu Arg Thr Ile Gly Arg Arg Gly Leu Ile
Gly Cys Glu Ser Leu 165 170
175 Lys Ile Leu Lys Leu Pro Asn Ser Leu Lys Thr Ile Gly Glu Leu Ser
180 185 190 Leu Asn Gly
Cys Gly Phe Ala Ser Ile Val Ile Pro Asp Ser Val Thr 195
200 205 Ser Ile Gly Lys Ser Ala Phe Ala
Asp Cys Glu Asn Leu Val Asn Ile 210 215
220 Lys Leu Pro Asn Asn Leu Glu Thr Ile Pro Asp Ser Met
Leu Glu Ser225 230 235
240 Cys Gly Ser Ile Asn Thr Ile Thr Ile Pro Ala Ser Val Lys Lys Ile
245 250 255 Glu Asn Ser Val
Phe Phe Tyr Cys Lys Asn Phe Glu Asn Ile Arg Phe 260
265 270 Leu Asn Gly Asn Leu Gln Ser Met Thr
Val Gly Lys Asp Ile Phe Ala 275 280
285 Gly Cys Pro Leu Lys Asn Val Tyr Ile Pro Lys Asn Ser Ser
Ala Ser 290 295 300
Asp Glu Glu Trp Arg Asn Thr Leu Gly Ile Lys Ser Thr Val Lys Ile305
310 315 320 Ile Arg
Glu51564DNABrachyspira hyodysenteriae 51atgcatattt ctggtgattc tcctttagat
aggaaagttg gagatgctag ttattatttt 60gctactgttc aacattgctg ggggtgggct
acttggaaaa gagcttggaa atattttgat 120gtaactatgg aaagtataaa ttttgaagat
gtaaaaaaaa caattagaaa aagatacaaa 180gattttaata taaaagatta ctggcaaaga
tggtttccta gaataaaaaa agagcattct 240tctgtatggg attatcaatg gacttactgt
attatctcaa aaaatggaat atgcattaat 300ccaagtataa atttaacttc taatatagga
tttggagaag attctaccca cactacaaat 360gaaaatgatg aaaatataaa tagtaaaaca
taccctatgg atactgaaaa tattattcat 420cctaaagaaa taaaatgtga tgaaagagct
gattttgaaa tagctattaa aagatttaat 480ataaaacctt tctctttaac atctaatata
accagagaag ttaaaagaat tataaaacaa 540ataaaaaact tatttatcaa aaaa
56452188PRTBrachyspira hyodysenteriae
52Met His Ile Ser Gly Asp Ser Pro Leu Asp Arg Lys Val Gly Asp Ala1
5 10 15 Ser Tyr Tyr Phe
Ala Thr Val Gln His Cys Trp Gly Trp Ala Thr Trp 20
25 30 Lys Arg Ala Trp Lys Tyr Phe Asp Val
Thr Met Glu Ser Ile Asn Phe 35 40
45 Glu Asp Val Lys Lys Thr Ile Arg Lys Arg Tyr Lys Asp Phe
Asn Ile 50 55 60
Lys Asp Tyr Trp Gln Arg Trp Phe Pro Arg Ile Lys Lys Glu His Ser65
70 75 80 Ser Val Trp Asp Tyr
Gln Trp Thr Tyr Cys Ile Ile Ser Lys Asn Gly 85
90 95 Ile Cys Ile Asn Pro Ser Ile Asn Leu Thr
Ser Asn Ile Gly Phe Gly 100 105
110 Glu Asp Ser Thr His Thr Thr Asn Glu Asn Asp Glu Asn Ile Asn
Ser 115 120 125 Lys
Thr Tyr Pro Met Asp Thr Glu Asn Ile Ile His Pro Lys Glu Ile 130
135 140 Lys Cys Asp Glu Arg Ala
Asp Phe Glu Ile Ala Ile Lys Arg Phe Asn145 150
155 160 Ile Lys Pro Phe Ser Leu Thr Ser Asn Ile Thr
Arg Glu Val Lys Arg 165 170
175 Ile Ile Lys Gln Ile Lys Asn Leu Phe Ile Lys Lys 180
185 53396DNABrachyspira hyodysenteriae
53atgtttaata ctcctatatt attaattatt tttaaaagaa aatatactgc attaaaagtt
60ttagatacaa taagaaatgt aaaacccaaa aaattatata tagcagctga tggctggaga
120aatgaagaag aaaaaacaaa atgtattgat acaagagaag ctgtattaga agctgtagat
180tgggaatgcg aagtaaaaac tttatttcaa gataaaaatt taggatgctg ttatggtcct
240gtaaatgctg taaattggtt atttgaaaat gaagaacaag gaataatact tgaagatgat
300gttatagctg aaacttcttt ttttattatt gcgagaaatt acttaactat tataaagata
360atgaaaaaat tatgcatatt tctggtgatt ctcctt
39654132PRTBrachyspira hyodysenteriae 54Met Phe Asn Thr Pro Ile Leu Leu
Ile Ile Phe Lys Arg Lys Tyr Thr1 5 10
15 Ala Leu Lys Val Leu Asp Thr Ile Arg Asn Val Lys Pro
Lys Lys Leu 20 25 30
Tyr Ile Ala Ala Asp Gly Trp Arg Asn Glu Glu Glu Lys Thr Lys Cys
35 40 45 Ile Asp Thr Arg
Glu Ala Val Leu Glu Ala Val Asp Trp Glu Cys Glu 50 55
60 Val Lys Thr Leu Phe Gln Asp Lys Asn
Leu Gly Cys Cys Tyr Gly Pro65 70 75
80 Val Asn Ala Val Asn Trp Leu Phe Glu Asn Glu Glu Gln Gly
Ile Ile 85 90 95
Leu Glu Asp Asp Val Ile Ala Glu Thr Ser Phe Phe Ile Ile Ala Arg
100 105 110 Asn Tyr Leu Thr Ile
Ile Lys Ile Met Lys Lys Leu Cys Ile Phe Leu 115
120 125 Val Ile Leu Leu 130
55825DNABrachyspira hyodysenteriae 55atgaatgata ttattaaagt gataaatata
ttaaacgata taccagaacc tttttctgta 60gatggaataa taaaaacttt tgaagcaagc
tctaaagatt ttataaaaag ttttgctgtt 120tatttttata aggaaggcag tgaagaagca
agattatggt atacatctaa aaataaatta 180gttattaatg ataaaaaaaa taatagagaa
tatactctat ttgccagagg taataaattt 240ggttatataa tagttaatgc agataaaaat
aaagatgaaa tggaagtact tattaattat 300ctatcaataa tattatatag tgaaaaactt
tcatttttgg caaatagaga caaacttaca 360ggtttataca atcgcggata tataataaaa
tatttgcagg agaaagaaac tacaaatgaa 420atatattcta tagtaatagt agatttagat
aaattcaaac attataatga tacttacgga 480cataatatag gagatcatgt attaaaatta
atttcaaagg taatgaaaga ttctttaaaa 540aatataaaat ataaatctgt attggcaaga
tatggaggag aagaatttat tatagtaatt 600gatgttaata ataaaaatga tctttttaat
gctatggaag aaataagaaa ctcaataata 660gaaactgatt tatctacaga agaatattct
ctaaaagcaa cagcatcttt aggaggtgct 720ataaaagagg aaaatacaac tttaagaact
tttataaata aagcagatca atcattatat 780aatgccaaag aaacaggaag aaataaatcc
gttatattag atttt 82556275PRTBrachyspira hyodysenteriae
56Met Asn Asp Ile Ile Lys Val Ile Asn Ile Leu Asn Asp Ile Pro Glu1
5 10 15 Pro Phe Ser Val
Asp Gly Ile Ile Lys Thr Phe Glu Ala Ser Ser Lys 20
25 30 Asp Phe Ile Lys Ser Phe Ala Val Tyr
Phe Tyr Lys Glu Gly Ser Glu 35 40
45 Glu Ala Arg Leu Trp Tyr Thr Ser Lys Asn Lys Leu Val Ile
Asn Asp 50 55 60
Lys Lys Asn Asn Arg Glu Tyr Thr Leu Phe Ala Arg Gly Asn Lys Phe65
70 75 80 Gly Tyr Ile Ile Val
Asn Ala Asp Lys Asn Lys Asp Glu Met Glu Val 85
90 95 Leu Ile Asn Tyr Leu Ser Ile Ile Leu Tyr
Ser Glu Lys Leu Ser Phe 100 105
110 Leu Ala Asn Arg Asp Lys Leu Thr Gly Leu Tyr Asn Arg Gly Tyr
Ile 115 120 125 Ile
Lys Tyr Leu Gln Glu Lys Glu Thr Thr Asn Glu Ile Tyr Ser Ile 130
135 140 Val Ile Val Asp Leu Asp
Lys Phe Lys His Tyr Asn Asp Thr Tyr Gly145 150
155 160 His Asn Ile Gly Asp His Val Leu Lys Leu Ile
Ser Lys Val Met Lys 165 170
175 Asp Ser Leu Lys Asn Ile Lys Tyr Lys Ser Val Leu Ala Arg Tyr Gly
180 185 190 Gly Glu Glu
Phe Ile Ile Val Ile Asp Val Asn Asn Lys Asn Asp Leu 195
200 205 Phe Asn Ala Met Glu Glu Ile Arg
Asn Ser Ile Ile Glu Thr Asp Leu 210 215
220 Ser Thr Glu Glu Tyr Ser Leu Lys Ala Thr Ala Ser Leu
Gly Gly Ala225 230 235
240 Ile Lys Glu Glu Asn Thr Thr Leu Arg Thr Phe Ile Asn Lys Ala Asp
245 250 255 Gln Ser Leu Tyr
Asn Ala Lys Glu Thr Gly Arg Asn Lys Ser Val Ile 260
265 270 Leu Asp Phe 275
571815DNABrachyspira hyodysenteriae 57atgaaaaata tttttaaata tgcttccatt
ataggatgca cttttgcctc gcttaatttt 60gcggctgatt atatagatta taaagtaaaa
aacggcgata ctttatttgg aatagctttc 120gctcatgata tgagtgcaaa tgaattttta
aaagttaata atataaaaga tcctgataaa 180tataatctta gagtaggaga aactttaaaa
gtaaaagata aaggttatac tcttgtatat 240gactctgata ataaagtttt cggcttgaaa
ggagaagaag gaaactcata caaagattat 300aaagtaaaaa acggggatac tttatttggt
atagcatttg cccatggaat gactgctaat 360gaatttctag ctataaataa tattaaagat
gccaataaat ataatcttag agtaggacaa 420actcttaaag tagcaaataa tcaaaaagaa
aataatgctt cttcaaataa tataaataat 480agtgataata cagaaaatta tgatacttat
aaagtgcaaa gcggtgatac tttatacgga 540atagctttct ctcatggtat gacagcaagc
gaatttttaa agattaataa tatagatgat 600cctgataaat ataaactata tgtaggtaaa
actatgtatg ttaaatcatc taaaaaagaa 660aataatttaa acacaaataa tgaaaaagat
acaggaaaag aaatagaata ctatactgta 720aaaagcggcg ataccttata cggaatagct
tttcaaaatg atattagcgt aaatgatttt 780ctaagaatta acaatataga tgatccttta
aaatacaaat taagaacagg cgaaaaatta 840aaaatatatg caagagaaaa tgcctcaaat
acacaaagca aaactataaa aacatataga 900gtaaaaaacg gagatactct tggagagata
gcattaagaa attctatgtc tttgaaagat 960cttcttcaat taaataatct aaaaaataat
tatgtgctta aagtaggaga tactttaaaa 1020atatatgata atattaatat aacaagttct
tcaacatcaa caacatacag aactttggaa 1080aattataaag taaaaagcgg tgatacttta
agcggaatag ctctagcaag aggaatggat 1140ctagtagaat tatactccat aaataatata
aatgacaaat atattttgaa agttggagat 1200aatcttaaag tatatgctaa ccctaaaaaa
acaactactt tagtaatatc aaattataaa 1260gttcaaagcg gagatagttt atactcaata
gcaaaaaaac ataaaatgga tttaagagat 1320ttaatgcagc ttaataatat aaaaaatgct
aatgaatata aattatatgt cggcgccaat 1380ctaaaagtaa aaacagcaaa aatggtgcct
tattctttta atgatgattc tatattacct 1440gacagctctt ttatatggcc ttataaagga
ataataattt caggatatgg agtagcttct 1500gataaacttg caaacagagg tgtgaatata
ttaggagatg taggagacaa agttgtagct 1560tctgatgacg gaatcgtaga atatgctgat
aatataagag gattcggtac tgttataata 1620cttaaacata aaaacggata taatacttct
tatgctcatc tttctaagat aaatgttaaa 1680cttggagata tagtaaagaa aggagattat
ataggagaca ttggcgatac tggtatgata 1740gatagaagcg aactatattt taagatttct
tatcagggaa gatcaataga tcctgttaaa 1800cttcttccta aaagt
181558605PRTBrachyspira hyodysenteriae
58Met Lys Asn Ile Phe Lys Tyr Ala Ser Ile Ile Gly Cys Thr Phe Ala1
5 10 15 Ser Leu Asn Phe
Ala Ala Asp Tyr Ile Asp Tyr Lys Val Lys Asn Gly 20
25 30 Asp Thr Leu Phe Gly Ile Ala Phe Ala
His Asp Met Ser Ala Asn Glu 35 40
45 Phe Leu Lys Val Asn Asn Ile Lys Asp Pro Asp Lys Tyr Asn
Leu Arg 50 55 60
Val Gly Glu Thr Leu Lys Val Lys Asp Lys Gly Tyr Thr Leu Val Tyr65
70 75 80 Asp Ser Asp Asn Lys
Val Phe Gly Leu Lys Gly Glu Glu Gly Asn Ser 85
90 95 Tyr Lys Asp Tyr Lys Val Lys Asn Gly Asp
Thr Leu Phe Gly Ile Ala 100 105
110 Phe Ala His Gly Met Thr Ala Asn Glu Phe Leu Ala Ile Asn Asn
Ile 115 120 125 Lys
Asp Ala Asn Lys Tyr Asn Leu Arg Val Gly Gln Thr Leu Lys Val 130
135 140 Ala Asn Asn Gln Lys Glu
Asn Asn Ala Ser Ser Asn Asn Ile Asn Asn145 150
155 160 Ser Asp Asn Thr Glu Asn Tyr Asp Thr Tyr Lys
Val Gln Ser Gly Asp 165 170
175 Thr Leu Tyr Gly Ile Ala Phe Ser His Gly Met Thr Ala Ser Glu Phe
180 185 190 Leu Lys Ile
Asn Asn Ile Asp Asp Pro Asp Lys Tyr Lys Leu Tyr Val 195
200 205 Gly Lys Thr Met Tyr Val Lys Ser
Ser Lys Lys Glu Asn Asn Leu Asn 210 215
220 Thr Asn Asn Glu Lys Asp Thr Gly Lys Glu Ile Glu Tyr
Tyr Thr Val225 230 235
240 Lys Ser Gly Asp Thr Leu Tyr Gly Ile Ala Phe Gln Asn Asp Ile Ser
245 250 255 Val Asn Asp Phe
Leu Arg Ile Asn Asn Ile Asp Asp Pro Leu Lys Tyr 260
265 270 Lys Leu Arg Thr Gly Glu Lys Leu Lys
Ile Tyr Ala Arg Glu Asn Ala 275 280
285 Ser Asn Thr Gln Ser Lys Thr Ile Lys Thr Tyr Arg Val Lys
Asn Gly 290 295 300
Asp Thr Leu Gly Glu Ile Ala Leu Arg Asn Ser Met Ser Leu Lys Asp305
310 315 320 Leu Leu Gln Leu Asn
Asn Leu Lys Asn Asn Tyr Val Leu Lys Val Gly 325
330 335 Asp Thr Leu Lys Ile Tyr Asp Asn Ile Asn
Ile Thr Ser Ser Ser Thr 340 345
350 Ser Thr Thr Tyr Arg Thr Leu Glu Asn Tyr Lys Val Lys Ser Gly
Asp 355 360 365 Thr
Leu Ser Gly Ile Ala Leu Ala Arg Gly Met Asp Leu Val Glu Leu 370
375 380 Tyr Ser Ile Asn Asn Ile
Asn Asp Lys Tyr Ile Leu Lys Val Gly Asp385 390
395 400 Asn Leu Lys Val Tyr Ala Asn Pro Lys Lys Thr
Thr Thr Leu Val Ile 405 410
415 Ser Asn Tyr Lys Val Gln Ser Gly Asp Ser Leu Tyr Ser Ile Ala Lys
420 425 430 Lys His Lys
Met Asp Leu Arg Asp Leu Met Gln Leu Asn Asn Ile Lys 435
440 445 Asn Ala Asn Glu Tyr Lys Leu Tyr
Val Gly Ala Asn Leu Lys Val Lys 450 455
460 Thr Ala Lys Met Val Pro Tyr Ser Phe Asn Asp Asp Ser
Ile Leu Pro465 470 475
480 Asp Ser Ser Phe Ile Trp Pro Tyr Lys Gly Ile Ile Ile Ser Gly Tyr
485 490 495 Gly Val Ala Ser
Asp Lys Leu Ala Asn Arg Gly Val Asn Ile Leu Gly 500
505 510 Asp Val Gly Asp Lys Val Val Ala Ser
Asp Asp Gly Ile Val Glu Tyr 515 520
525 Ala Asp Asn Ile Arg Gly Phe Gly Thr Val Ile Ile Leu Lys
His Lys 530 535 540
Asn Gly Tyr Asn Thr Ser Tyr Ala His Leu Ser Lys Ile Asn Val Lys545
550 555 560 Leu Gly Asp Ile Val
Lys Lys Gly Asp Tyr Ile Gly Asp Ile Gly Asp 565
570 575 Thr Gly Met Ile Asp Arg Ser Glu Leu Tyr
Phe Lys Ile Ser Tyr Gln 580 585
590 Gly Arg Ser Ile Asp Pro Val Lys Leu Leu Pro Lys Ser
595 600 605 591068DNABrachyspira
hyodysenteriae 59atgattagaa atattaaata tattttcatt atatatttat tagctatttc
ctgctctaat 60tatagagtta ctgatccatt ctccattcaa aataatagta ataataacat
aagcattata 120cctgaatatg tagatgctca atatttcatc aaagcagatt acactgaaca
gcaaatagaa 180gaaataatga ataaatattt ccagaatttt ggagaatata taatattttt
aaatgatact 240aaagataata tagataaaaa taaaacaata gaaacaataa ataaagtagt
taataaacct 300gcttatttac ataacggagc tgctgttgat ttaagcagaa ctgatataac
agaaatagca 360caaagtgcat ttaatgcaaa taaaaattta atagaagtta agcttcctaa
ctcattaaaa 420actataaatt catcagcatt tcaatcatgc gaaagattaa aatatataaa
tctagtaagc 480tctataaccg atatacaatc tgctgcattt caagactgta tgtctttaga
aattattaat 540ataacatcaa aagtaaaaac tatagctaat aatgcattta aaaattgtgt
tactttaaga 600gaagtaatac ttcctgaagg attaacttca atagcagatg gagcattcaa
ttactgtaca 660tcattagaat caattaattt tccatcaact ttacaaacta taggcacagc
agcattttac 720agctgtaaat cattaaaaag tataaaatta aatcaaggat taactaccat
aaatgataat 780gcttttaatc tttgctcatc attaacagct ataagcttac ctaatagtat
aacaagcctt 840ttaaatcctt cagaaggtaa ggttttttct gattgtaaaa tgcttaaaaa
tgttgaatat 900cttgatacag atcccgtaaa aatacttaaa gaaaatgata cattcagagg
ttcacctgta 960accgatttat accttcctaa tgtggcagaa gatcctaaaa atggaagctg
ggataatttt 1020ttaggtgttg cttggacaac tattcattat ggaaaatcta tgcctagg
106860356PRTBrachyspira hyodysenteriae 60Met Ile Arg Asn Ile
Lys Tyr Ile Phe Ile Ile Tyr Leu Leu Ala Ile1 5
10 15 Ser Cys Ser Asn Tyr Arg Val Thr Asp Pro
Phe Ser Ile Gln Asn Asn 20 25
30 Ser Asn Asn Asn Ile Ser Ile Ile Pro Glu Tyr Val Asp Ala Gln
Tyr 35 40 45 Phe
Ile Lys Ala Asp Tyr Thr Glu Gln Gln Ile Glu Glu Ile Met Asn 50
55 60 Lys Tyr Phe Gln Asn Phe
Gly Glu Tyr Ile Ile Phe Leu Asn Asp Thr65 70
75 80 Lys Asp Asn Ile Asp Lys Asn Lys Thr Ile Glu
Thr Ile Asn Lys Val 85 90
95 Val Asn Lys Pro Ala Tyr Leu His Asn Gly Ala Ala Val Asp Leu Ser
100 105 110 Arg Thr Asp
Ile Thr Glu Ile Ala Gln Ser Ala Phe Asn Ala Asn Lys 115
120 125 Asn Leu Ile Glu Val Lys Leu Pro
Asn Ser Leu Lys Thr Ile Asn Ser 130 135
140 Ser Ala Phe Gln Ser Cys Glu Arg Leu Lys Tyr Ile Asn
Leu Val Ser145 150 155
160 Ser Ile Thr Asp Ile Gln Ser Ala Ala Phe Gln Asp Cys Met Ser Leu
165 170 175 Glu Ile Ile Asn
Ile Thr Ser Lys Val Lys Thr Ile Ala Asn Asn Ala 180
185 190 Phe Lys Asn Cys Val Thr Leu Arg Glu
Val Ile Leu Pro Glu Gly Leu 195 200
205 Thr Ser Ile Ala Asp Gly Ala Phe Asn Tyr Cys Thr Ser Leu
Glu Ser 210 215 220
Ile Asn Phe Pro Ser Thr Leu Gln Thr Ile Gly Thr Ala Ala Phe Tyr225
230 235 240 Ser Cys Lys Ser Leu
Lys Ser Ile Lys Leu Asn Gln Gly Leu Thr Thr 245
250 255 Ile Asn Asp Asn Ala Phe Asn Leu Cys Ser
Ser Leu Thr Ala Ile Ser 260 265
270 Leu Pro Asn Ser Ile Thr Ser Leu Leu Asn Pro Ser Glu Gly Lys
Val 275 280 285 Phe
Ser Asp Cys Lys Met Leu Lys Asn Val Glu Tyr Leu Asp Thr Asp 290
295 300 Pro Val Lys Ile Leu Lys
Glu Asn Asp Thr Phe Arg Gly Ser Pro Val305 310
315 320 Thr Asp Leu Tyr Leu Pro Asn Val Ala Glu Asp
Pro Lys Asn Gly Ser 325 330
335 Trp Asp Asn Phe Leu Gly Val Ala Trp Thr Thr Ile His Tyr Gly Lys
340 345 350 Ser Met Pro
Arg 355 611296DNABrachyspira hyodysenteriae 61atggatataa
ttataataat agtgttaata cttttaaatg gtatttttgc catgtcggaa 60attgcagtaa
tttctgctag aaaatcttct cttatgaaag acagcaaaga aggaaataaa 120ggtgcaaaga
ctgcattagc tttagcagat aatcctgaca aatttttatc tacaatacaa 180ataggtataa
ctttaatagg tatattaaca ggtatttact caggcgatac agttgccaaa 240gaagtttcaa
atttacttgt aaaaataaat gtaccattaa attatgcttc tttaatagct 300caggtattgg
tggtagcatt ggtaacatat cttacattga tattcggaga gcttgtgcct 360aaaagaatag
gaatggtaat gcctgaaaga atagcaaaag tggttgcagc tcctatgaca 420atacttgcaa
agataggtgc tccttttgtg tggatattat caaatagcgc attgcttgtt 480tcaagagttt
tgggtataaa agatgataaa agtcctgtta ctgaagagga aataaaatct 540atgatagaag
agggcagaca agggggagaa gttaaggaga tagaacagaa tattatagag 600agggctttct
ttttgggaga tagaaaaata gaatctataa tgacacatag aaatgatatg 660gtatttttag
atataaatat gagtaatgat gagataaaaa agatagtatc aaaacattct 720ttttctgctt
atcctgttgt tgataaaaat ttggataata ttgtaggagt tgtaagagta 780actgatatat
tcgataaatt aaatacttca aaggctaaaa tagaaaagtt tgtgaagaaa 840gctaattact
ttcataacaa tatggaagtt tatttggttc ttgaagagat gaaaaagaat 900aatactaaaa
taggtcttgt atcagatgag tttgggaata tagacggaat gattactcaa 960agcgatatat
tcgaggcttt agtgggttct gtaacagaag gaaaagacag taaggatatt 1020agaaagagaa
agagcggaag ttggtttgta gatggtcaat gtcctatgta tgatttctta 1080gagtattttg
aaatagaaga tgaaaatgct tctaataatt ataatactat aagcggtttg 1140attttagaat
tattacagca tgtacctagt gaaggagaat ctttagaatg gaagaattta 1200aatttagaag
ttgttgatat ggacggtgct agaatagata aggttatagt aaataaaata 1260gaaaaaactg
atgaaaagaa tgattcagac actgaa
129662432PRTBrachyspira hyodysenteriae 62Met Asp Ile Ile Ile Ile Ile Val
Leu Ile Leu Leu Asn Gly Ile Phe1 5 10
15 Ala Met Ser Glu Ile Ala Val Ile Ser Ala Arg Lys Ser
Ser Leu Met 20 25 30
Lys Asp Ser Lys Glu Gly Asn Lys Gly Ala Lys Thr Ala Leu Ala Leu
35 40 45 Ala Asp Asn Pro
Asp Lys Phe Leu Ser Thr Ile Gln Ile Gly Ile Thr 50 55
60 Leu Ile Gly Ile Leu Thr Gly Ile Tyr
Ser Gly Asp Thr Val Ala Lys65 70 75
80 Glu Val Ser Asn Leu Leu Val Lys Ile Asn Val Pro Leu Asn
Tyr Ala 85 90 95
Ser Leu Ile Ala Gln Val Leu Val Val Ala Leu Val Thr Tyr Leu Thr
100 105 110 Leu Ile Phe Gly Glu
Leu Val Pro Lys Arg Ile Gly Met Val Met Pro 115
120 125 Glu Arg Ile Ala Lys Val Val Ala Ala
Pro Met Thr Ile Leu Ala Lys 130 135
140 Ile Gly Ala Pro Phe Val Trp Ile Leu Ser Asn Ser Ala
Leu Leu Val145 150 155
160 Ser Arg Val Leu Gly Ile Lys Asp Asp Lys Ser Pro Val Thr Glu Glu
165 170 175 Glu Ile Lys Ser
Met Ile Glu Glu Gly Arg Gln Gly Gly Glu Val Lys 180
185 190 Glu Ile Glu Gln Asn Ile Ile Glu Arg
Ala Phe Phe Leu Gly Asp Arg 195 200
205 Lys Ile Glu Ser Ile Met Thr His Arg Asn Asp Met Val Phe
Leu Asp 210 215 220
Ile Asn Met Ser Asn Asp Glu Ile Lys Lys Ile Val Ser Lys His Ser225
230 235 240 Phe Ser Ala Tyr Pro
Val Val Asp Lys Asn Leu Asp Asn Ile Val Gly 245
250 255 Val Val Arg Val Thr Asp Ile Phe Asp Lys
Leu Asn Thr Ser Lys Ala 260 265
270 Lys Ile Glu Lys Phe Val Lys Lys Ala Asn Tyr Phe His Asn Asn
Met 275 280 285 Glu
Val Tyr Leu Val Leu Glu Glu Met Lys Lys Asn Asn Thr Lys Ile 290
295 300 Gly Leu Val Ser Asp Glu
Phe Gly Asn Ile Asp Gly Met Ile Thr Gln305 310
315 320 Ser Asp Ile Phe Glu Ala Leu Val Gly Ser Val
Thr Glu Gly Lys Asp 325 330
335 Ser Lys Asp Ile Arg Lys Arg Lys Ser Gly Ser Trp Phe Val Asp Gly
340 345 350 Gln Cys Pro
Met Tyr Asp Phe Leu Glu Tyr Phe Glu Ile Glu Asp Glu 355
360 365 Asn Ala Ser Asn Asn Tyr Asn Thr
Ile Ser Gly Leu Ile Leu Glu Leu 370 375
380 Leu Gln His Val Pro Ser Glu Gly Glu Ser Leu Glu Trp
Lys Asn Leu385 390 395
400 Asn Leu Glu Val Val Asp Met Asp Gly Ala Arg Ile Asp Lys Val Ile
405 410 415 Val Asn Lys Ile
Glu Lys Thr Asp Glu Lys Asn Asp Ser Asp Thr Glu 420
425 430 632940DNABrachyspira hyodysenteriae
63atgcgaatct ttatcttgtt attatttaca ttgattttta atgtatgttt atatgctcag
60gatactaatg taaataatac agcagcaaca aataatacta ctgcagcaac caataatgta
120ggcgaaagtg caataatgca gataaataga tttgatgcta aaagaaatcc tgtatcattt
180attaatttag ttaattttac accatattat gtattgcagg aatatgctag ggttaataat
240atagaaattt atccctatga tactgaaagt acattaagag caagaatcat tgaaagacaa
300gtaaatataa aacaggaagt tattaataat aaagatgaaa tacgcgaagt agcaagaaca
360actataaata gaggcggtgc tcaggtagaa cttataggtg cagattttgc tgaaagatat
420accatagatg aagcaggtga agagcttata tcattatatg gtaatgttac catgaaaatg
480tataataata cattagttgc tgataaggtt gtttatagct taaaaacagg agaagttttt
540gcttcaggaa atttaactgt agcatctgaa ggaagtactt tcaaaggtga atggtttatg
600cttaatagag aaagtaaaag aggcatacta ttcggcggaa atacgaaatt catgagtttt
660acagttgaag ggcgtataat taaatttaat gaccaagatt tttttgctga aaacagcagt
720gtgagttttt cacgtcttac tcctatagcg catgattttt tagcgagtag agtttatctt
780tgggatacta aaaagatgat ggttttcaat agtatctata gggtaggaag acagcctgta
840ttttattttc cattatttat acagaataat tttggtactg gtataatatc ttcttttggg
900cagtctttga gagaaggtgt ttatattcaa aattataaga tatttaattt atatggtgtg
960cagcataaga taagattcga tgcctatcag aaattaggtt ttttattagg agatgaaata
1020aggtatacaa gtcagtatca ggatttagca cttgatgcta tgtttgcttt tggaaggcag
1080tattatttat ttgattccta tattacttca agtgtaggat ttggtacaag gtatgttaac
1140tattttggat caggtgaagg cggaaagttt gtaccaagat ataaatttca atatgatcat
1200accattcaat tatataatag tcaaaatata aatagttata ttacaggaaa gttaaattta
1260aatagcgact tatatttcag atctgatttt tacaatcaaa gaggacagtt tgatatatta
1320acatttttta catcacttac aggaaatttg caggacatag gagattctta tcctgaaaat
1380tatattgaaa attctgttta tcttaataat aatatttacg gacttaattt aaaagttggt
1440gcagaatggg atttagaatc tgttagaaat atatcggttg atgttaatac taatttcgac
1500tattatatgc ctaaaccata taaacttgta cttccttctg tagaagctag ttacaattct
1560atatttggaa atgagacatc ttattacttt ccaaatctta acattaacta taatttaaga
1620gctaattata atcatactat aaattataag acttctgaag gtattgcttt ttataacaat
1680cctatgcttg actcacaatt aaatgataaa cttgctgaaa gagataatct taatttacat
1740ggtgatatat caagagcttt tactaatgat tttttaagat ttgtacctag ctttaatatg
1800gaatactcat atcaaaatag tatagatcct aaagcagaag atttgattta tgataaagat
1860aatacttact ttggtatagg cacaggaatg aatttttcta tgtttttacc ttacagtata
1920ttgccatatg atttcacaag atattttgaa cctactgtta gatgggatac aacatataca
1980ttgggatata gatttaaaga aaaatacatt gatacagatt ataaagattc tcaattcggt
2040gaatttaata atcatagctt tacaactaga ttttctatgg gcggaaccgg atacagctta
2100ttttatttgc ctgatttgaa tctcaatatg gaaacattta taactacagg ttatgatttt
2160atacctagtt ataattcaga aacaagaact tatcaagttg aattttctac aaataaaatg
2220cttacaactg aagtaggtgc ttcagcaaga cttttatata atcaatctta tgtttcttat
2280gatataacta gaaatttatt aggaactaat ttaacagcaa atagaataaa tgcatatttt
2340cactttccta tacctttagg taaaattaca gattggattt taataaaaaa caataaaaga
2400cctttctttg atggtatagt taatgatttt aatttatatt ttggttttgc ctttactcat
2460gattttataa attatagata taatactacc gcatttacat ttggtataga gcttcaggtt
2520ttggaacaat ggaaatttag aatagcaact actagtgcaa atgagaatgc atatagatat
2580ataaaatctt atgcagaaaa agaaaatcaa acttgggtta atcctttttg ggatatcata
2640aattcattca atttctctga cagtaaaaaa agaactgaaa gtttatttaa attaaaatct
2700atagaagcta gtgtttggca tgaattagac ggatggcaga ttcaggctac atttgctgta
2760agaccttcta ctctcccttc tgatattact tcaggttcag taaaaggagt ttattggaac
2820aaggagtttt ggattgaatt tactcttaca gactttccta atgttggatt gcctaagaaa
2880gaatataatc ttaatagtac tattaccgat ttacaagata gtgctgctgt tactactcca
294064980PRTBrachyspira hyodysenteriae 64Met Arg Ile Phe Ile Leu Leu Leu
Phe Thr Leu Ile Phe Asn Val Cys1 5 10
15 Leu Tyr Ala Gln Asp Thr Asn Val Asn Asn Thr Ala Ala
Thr Asn Asn 20 25 30
Thr Thr Ala Ala Thr Asn Asn Val Gly Glu Ser Ala Ile Met Gln Ile
35 40 45 Asn Arg Phe Asp
Ala Lys Arg Asn Pro Val Ser Phe Ile Asn Leu Val 50 55
60 Asn Phe Thr Pro Tyr Tyr Val Leu Gln
Glu Tyr Ala Arg Val Asn Asn65 70 75
80 Ile Glu Ile Tyr Pro Tyr Asp Thr Glu Ser Thr Leu Arg Ala
Arg Ile 85 90 95
Ile Glu Arg Gln Val Asn Ile Lys Gln Glu Val Ile Asn Asn Lys Asp
100 105 110 Glu Ile Arg Glu Val
Ala Arg Thr Thr Ile Asn Arg Gly Gly Ala Gln 115
120 125 Val Glu Leu Ile Gly Ala Asp Phe Ala
Glu Arg Tyr Thr Ile Asp Glu 130 135
140 Ala Gly Glu Glu Leu Ile Ser Leu Tyr Gly Asn Val Thr
Met Lys Met145 150 155
160 Tyr Asn Asn Thr Leu Val Ala Asp Lys Val Val Tyr Ser Leu Lys Thr
165 170 175 Gly Glu Val Phe
Ala Ser Gly Asn Leu Thr Val Ala Ser Glu Gly Ser 180
185 190 Thr Phe Lys Gly Glu Trp Phe Met Leu
Asn Arg Glu Ser Lys Arg Gly 195 200
205 Ile Leu Phe Gly Gly Asn Thr Lys Phe Met Ser Phe Thr Val
Glu Gly 210 215 220
Arg Ile Ile Lys Phe Asn Asp Gln Asp Phe Phe Ala Glu Asn Ser Ser225
230 235 240 Val Ser Phe Ser Arg
Leu Thr Pro Ile Ala His Asp Phe Leu Ala Ser 245
250 255 Arg Val Tyr Leu Trp Asp Thr Lys Lys Met
Met Val Phe Asn Ser Ile 260 265
270 Tyr Arg Val Gly Arg Gln Pro Val Phe Tyr Phe Pro Leu Phe Ile
Gln 275 280 285 Asn
Asn Phe Gly Thr Gly Ile Ile Ser Ser Phe Gly Gln Ser Leu Arg 290
295 300 Glu Gly Val Tyr Ile Gln
Asn Tyr Lys Ile Phe Asn Leu Tyr Gly Val305 310
315 320 Gln His Lys Ile Arg Phe Asp Ala Tyr Gln Lys
Leu Gly Phe Leu Leu 325 330
335 Gly Asp Glu Ile Arg Tyr Thr Ser Gln Tyr Gln Asp Leu Ala Leu Asp
340 345 350 Ala Met Phe
Ala Phe Gly Arg Gln Tyr Tyr Leu Phe Asp Ser Tyr Ile 355
360 365 Thr Ser Ser Val Gly Phe Gly Thr
Arg Tyr Val Asn Tyr Phe Gly Ser 370 375
380 Gly Glu Gly Gly Lys Phe Val Pro Arg Tyr Lys Phe Gln
Tyr Asp His385 390 395
400 Thr Ile Gln Leu Tyr Asn Ser Gln Asn Ile Asn Ser Tyr Ile Thr Gly
405 410 415 Lys Leu Asn Leu
Asn Ser Asp Leu Tyr Phe Arg Ser Asp Phe Tyr Asn 420
425 430 Gln Arg Gly Gln Phe Asp Ile Leu Thr
Phe Phe Thr Ser Leu Thr Gly 435 440
445 Asn Leu Gln Asp Ile Gly Asp Ser Tyr Pro Glu Asn Tyr Ile
Glu Asn 450 455 460
Ser Val Tyr Leu Asn Asn Asn Ile Tyr Gly Leu Asn Leu Lys Val Gly465
470 475 480 Ala Glu Trp Asp Leu
Glu Ser Val Arg Asn Ile Ser Val Asp Val Asn 485
490 495 Thr Asn Phe Asp Tyr Tyr Met Pro Lys Pro
Tyr Lys Leu Val Leu Pro 500 505
510 Ser Val Glu Ala Ser Tyr Asn Ser Ile Phe Gly Asn Glu Thr Ser
Tyr 515 520 525 Tyr
Phe Pro Asn Leu Asn Ile Asn Tyr Asn Leu Arg Ala Asn Tyr Asn 530
535 540 His Thr Ile Asn Tyr Lys
Thr Ser Glu Gly Ile Ala Phe Tyr Asn Asn545 550
555 560 Pro Met Leu Asp Ser Gln Leu Asn Asp Lys Leu
Ala Glu Arg Asp Asn 565 570
575 Leu Asn Leu His Gly Asp Ile Ser Arg Ala Phe Thr Asn Asp Phe Leu
580 585 590 Arg Phe Val
Pro Ser Phe Asn Met Glu Tyr Ser Tyr Gln Asn Ser Ile 595
600 605 Asp Pro Lys Ala Glu Asp Leu Ile
Tyr Asp Lys Asp Asn Thr Tyr Phe 610 615
620 Gly Ile Gly Thr Gly Met Asn Phe Ser Met Phe Leu Pro
Tyr Ser Ile625 630 635
640 Leu Pro Tyr Asp Phe Thr Arg Tyr Phe Glu Pro Thr Val Arg Trp Asp
645 650 655 Thr Thr Tyr Thr
Leu Gly Tyr Arg Phe Lys Glu Lys Tyr Ile Asp Thr 660
665 670 Asp Tyr Lys Asp Ser Gln Phe Gly Glu
Phe Asn Asn His Ser Phe Thr 675 680
685 Thr Arg Phe Ser Met Gly Gly Thr Gly Tyr Ser Leu Phe Tyr
Leu Pro 690 695 700
Asp Leu Asn Leu Asn Met Glu Thr Phe Ile Thr Thr Gly Tyr Asp Phe705
710 715 720 Ile Pro Ser Tyr Asn
Ser Glu Thr Arg Thr Tyr Gln Val Glu Phe Ser 725
730 735 Thr Asn Lys Met Leu Thr Thr Glu Val Gly
Ala Ser Ala Arg Leu Leu 740 745
750 Tyr Asn Gln Ser Tyr Val Ser Tyr Asp Ile Thr Arg Asn Leu Leu
Gly 755 760 765 Thr
Asn Leu Thr Ala Asn Arg Ile Asn Ala Tyr Phe His Phe Pro Ile 770
775 780 Pro Leu Gly Lys Ile Thr
Asp Trp Ile Leu Ile Lys Asn Asn Lys Arg785 790
795 800 Pro Phe Phe Asp Gly Ile Val Asn Asp Phe Asn
Leu Tyr Phe Gly Phe 805 810
815 Ala Phe Thr His Asp Phe Ile Asn Tyr Arg Tyr Asn Thr Thr Ala Phe
820 825 830 Thr Phe Gly
Ile Glu Leu Gln Val Leu Glu Gln Trp Lys Phe Arg Ile 835
840 845 Ala Thr Thr Ser Ala Asn Glu Asn
Ala Tyr Arg Tyr Ile Lys Ser Tyr 850 855
860 Ala Glu Lys Glu Asn Gln Thr Trp Val Asn Pro Phe Trp
Asp Ile Ile865 870 875
880 Asn Ser Phe Asn Phe Ser Asp Ser Lys Lys Arg Thr Glu Ser Leu Phe
885 890 895 Lys Leu Lys Ser
Ile Glu Ala Ser Val Trp His Glu Leu Asp Gly Trp 900
905 910 Gln Ile Gln Ala Thr Phe Ala Val Arg
Pro Ser Thr Leu Pro Ser Asp 915 920
925 Ile Thr Ser Gly Ser Val Lys Gly Val Tyr Trp Asn Lys Glu
Phe Trp 930 935 940
Ile Glu Phe Thr Leu Thr Asp Phe Pro Asn Val Gly Leu Pro Lys Lys945
950 955 960 Glu Tyr Asn Leu Asn
Ser Thr Ile Thr Asp Leu Gln Asp Ser Ala Ala 965
970 975 Val Thr Thr Pro 980
651611DNABrachyspira hyodysenteriae 65atgtcagaga ataaaacagt aagtaaagaa
aagatagcta aatcatcatt aaaaatgtca 60ttggtaacta ctgtaagcag agtattcgga
cttgtaagag atcaaataca ggcggctttg 120cttggtacta cattcatagc agatgctttt
gcaataggat ttatacttcc aaatttattg 180aggcgattat ttgctgaagg caatatggtt
gcaagcttta tacctgtatt tacagagctt 240gaaaaagaaa aaggtattga agaatcaaag
aaatttttta gggcagtttt tacattattg 300ggattaatac ttatagtagt tgtaggcatc
ggaataataa tatctccttt gcttgtaaaa 360atactttata aatctgcaca taataatata
gaagcactta atttggcatc ggatctatca 420agaataatgt ttccttatct tctatttata
tctttggcag ctttgatgca gggcgtactt 480aatataagag gctattattc aatatcagct
gcaagtccta tacttttaaa tactgtaatt 540atatctatgg ctttgttctt taaattcttt
ttacctaatt tttttaataa tatggcttat 600gtatttgcat ttgctgtgct gcttggtgga
ttcgtacagt ttgcctatca aatgcctttt 660gtacataaac aaggttttag tttcaagcct
tattttcatt ttaaagaacc ctatgtcata 720aagatgataa aattatttgc tcctggtatt
ttcggagcta gtatatatca gataaatttg 780cttgtttcta ctgcatttgc tggagctatt
ggagagggca gggtttcagc tgttactttt 840gctactagaa tacatgaatt tgttttgggc
gtttttgctg tgagtgtggc aactgttatg 900cttcctactt taagtaaatt aatagctgat
aataaaaaag atgaagctgt tgaaaattta 960ggatattctt taaggcttgt tgctttagtt
actattcctg ctactttcgg atttgtggta 1020cttggcagag aaattgtaag aatgatattt
gaatatggag ctttttcttc aaaatctaca 1080tatttagtat cgagtgcttt aagatattta
tccatatcct tattctttgt ggcaagctat 1140agaatacttg tacagtcatt ttatgctatg
aaagatatga aaactcctgt atatgtggca 1200ttttttacct ttattattaa tgctgttagt
aattatttat gtgtttatat atttaaattc 1260gatattatag gaatatctat atcaagtgtt
gttgcaaata ttgtatcttt ttgtatacta 1320tatatattgc ttataaagag aatggcagtg
aaatcgataa taaataaaaa aattgaggtt 1380gtaaagacat tggctgctag tttatttatg
gctgcttctg tctatggaat gaaatattat 1440ttattataca gcaatgccga ttctaggata
atttttataa ttaaagtatt tatagtgata 1500ttattaggag ttgttgttta ttctataatg
aacattatat taagaaatga tgattttgtt 1560tcctttatta gtatgtttaa aggcagatta
tcaagaaagt ttctgaaaaa a 161166537PRTBrachyspira hyodysenteriae
66Met Ser Glu Asn Lys Thr Val Ser Lys Glu Lys Ile Ala Lys Ser Ser1
5 10 15 Leu Lys Met Ser
Leu Val Thr Thr Val Ser Arg Val Phe Gly Leu Val 20
25 30 Arg Asp Gln Ile Gln Ala Ala Leu Leu
Gly Thr Thr Phe Ile Ala Asp 35 40
45 Ala Phe Ala Ile Gly Phe Ile Leu Pro Asn Leu Leu Arg Arg
Leu Phe 50 55 60
Ala Glu Gly Asn Met Val Ala Ser Phe Ile Pro Val Phe Thr Glu Leu65
70 75 80 Glu Lys Glu Lys Gly
Ile Glu Glu Ser Lys Lys Phe Phe Arg Ala Val 85
90 95 Phe Thr Leu Leu Gly Leu Ile Leu Ile Val
Val Val Gly Ile Gly Ile 100 105
110 Ile Ile Ser Pro Leu Leu Val Lys Ile Leu Tyr Lys Ser Ala His
Asn 115 120 125 Asn
Ile Glu Ala Leu Asn Leu Ala Ser Asp Leu Ser Arg Ile Met Phe 130
135 140 Pro Tyr Leu Leu Phe Ile
Ser Leu Ala Ala Leu Met Gln Gly Val Leu145 150
155 160 Asn Ile Arg Gly Tyr Tyr Ser Ile Ser Ala Ala
Ser Pro Ile Leu Leu 165 170
175 Asn Thr Val Ile Ile Ser Met Ala Leu Phe Phe Lys Phe Phe Leu Pro
180 185 190 Asn Phe Phe
Asn Asn Met Ala Tyr Val Phe Ala Phe Ala Val Leu Leu 195
200 205 Gly Gly Phe Val Gln Phe Ala Tyr
Gln Met Pro Phe Val His Lys Gln 210 215
220 Gly Phe Ser Phe Lys Pro Tyr Phe His Phe Lys Glu Pro
Tyr Val Ile225 230 235
240 Lys Met Ile Lys Leu Phe Ala Pro Gly Ile Phe Gly Ala Ser Ile Tyr
245 250 255 Gln Ile Asn Leu
Leu Val Ser Thr Ala Phe Ala Gly Ala Ile Gly Glu 260
265 270 Gly Arg Val Ser Ala Val Thr Phe Ala
Thr Arg Ile His Glu Phe Val 275 280
285 Leu Gly Val Phe Ala Val Ser Val Ala Thr Val Met Leu Pro
Thr Leu 290 295 300
Ser Lys Leu Ile Ala Asp Asn Lys Lys Asp Glu Ala Val Glu Asn Leu305
310 315 320 Gly Tyr Ser Leu Arg
Leu Val Ala Leu Val Thr Ile Pro Ala Thr Phe 325
330 335 Gly Phe Val Val Leu Gly Arg Glu Ile Val
Arg Met Ile Phe Glu Tyr 340 345
350 Gly Ala Phe Ser Ser Lys Ser Thr Tyr Leu Val Ser Ser Ala Leu
Arg 355 360 365 Tyr
Leu Ser Ile Ser Leu Phe Phe Val Ala Ser Tyr Arg Ile Leu Val 370
375 380 Gln Ser Phe Tyr Ala Met
Lys Asp Met Lys Thr Pro Val Tyr Val Ala385 390
395 400 Phe Phe Thr Phe Ile Ile Asn Ala Val Ser Asn
Tyr Leu Cys Val Tyr 405 410
415 Ile Phe Lys Phe Asp Ile Ile Gly Ile Ser Ile Ser Ser Val Val Ala
420 425 430 Asn Ile Val
Ser Phe Cys Ile Leu Tyr Ile Leu Leu Ile Lys Arg Met 435
440 445 Ala Val Lys Ser Ile Ile Asn Lys
Lys Ile Glu Val Val Lys Thr Leu 450 455
460 Ala Ala Ser Leu Phe Met Ala Ala Ser Val Tyr Gly Met
Lys Tyr Tyr465 470 475
480 Leu Leu Tyr Ser Asn Ala Asp Ser Arg Ile Ile Phe Ile Ile Lys Val
485 490 495 Phe Ile Val Ile
Leu Leu Gly Val Val Val Tyr Ser Ile Met Asn Ile 500
505 510 Ile Leu Arg Asn Asp Asp Phe Val Ser
Phe Ile Ser Met Phe Lys Gly 515 520
525 Arg Leu Ser Arg Lys Phe Leu Lys Lys 530
535 6723DNABrachyspira hyodysenteriae 67aaacgtttat attttatttt
atc 236818DNABrachyspira
hyodysenteriae 68aaacttccaa gtgatacc
186920DNABrachyspira hyodysenteriae 69aaatataaac ctacaagcag
207023DNABrachyspira
hyodysenteriae 70aatatttcag ttaatctaaa atc
237124DNABrachyspira hyodysenteriae 71actttaatct ttgtattaat
tttg 247223DNABrachyspira
hyodysenteriae 72ttgttttaat ttgataatat cag
237329DNABrachyspira hyodysenteriae 73aaaaaaatta ttttattaat
atttatatt 297423DNABrachyspira
hyodysenteriae 74ttctcttata atctttacag ttg
237519DNABrachyspira hyodysenteriae 75catatttctg gtgattctc
197627DNABrachyspira
hyodysenteriae 76ttttttgata aataagtttt ttatttg
277728DNABrachyspira hyodysenteriae 77tttaatactc ctatattatt
aattattt 287818DNABrachyspira
hyodysenteriae 78aaggagaatc accagaaa
187923DNABrachyspira hyodysenteriae 79aatgatatta ttaaagtgat
aaa 238020DNABrachyspira
hyodysenteriae 80aaaatctaat ataacggatt
208120DNABrachyspira hyodysenteriae 81aaatatgctt ccattatagg
208221DNABrachyspira
hyodysenteriae 82acttttagga agaagtttaa c
218325DNABrachyspira hyodysenteriae 83tatattttca ttatatattt
attag 258418DNABrachyspira
hyodysenteriae 84ctaggcatag attttcca
188528DNABrachyspira hyodysenteriae 85gatataatta taataatagt
gttaatac 288619DNABrachyspira
hyodysenteriae 86ttcagtgtct gaatcattc
198723DNABrachyspira hyodysenteriae 87gtatgtttat atgctcagga
tac 238821DNABrachyspira
hyodysenteriae 88aacagcagca ctatcttgta a
218924DNABrachyspira hyodysenteriae 89cagcagcaac aaataatact
actg 249025DNABrachyspira
hyodysenteriae 90tgaatataaa caccttctct caaag
259126DNABrachyspira hyodysenteriae 91aaaatgtcat tggtaactac
tgtaag 269225DNABrachyspira
hyodysenteriae 92cttgataatc tgcctttaaa catac
259323DNAArtificial SequencepTrcHis-F primer 93caatttatca
gacaatctgt gtg
239423DNAArtificial SequencepTrcHis-R primer 94tgcctggcag ttccctactc tcg
23
User Contributions:
Comment about this patent or add new information about this topic: