Patent application title: ENGINEERED YEAST FOR CELLULOSIC ETHANOL PRODUCTION
Inventors:
Wilfred Chen (Rowland Heights, CA, US)
Shen-Long Tsai (Riverside, CA, US)
IPC8 Class: AC12N942FI
USPC Class:
Class name:
Publication date: 2015-09-17
Patent application number: 20150259658
Abstract:
The disclosure provides designer cellulosomes for efficient hydrolysis of
cellulosic material and more particularly for the generating of ethanol.Claims:
1. A recombinant yeast cell comprising: a heterologous polynucleotide
that encodes a secreted polypeptide comprising a dockerin domain, a
scaffoldin polypeptide, one or more cellulose binding domains (CBD) and a
plurality of divergent-heterologous cohesion domains.
2. The recombinant yeast cell of claim 1, wherein the polypeptide comprises from N- to C-terminus: the dockerin polypeptide, the plurality of divergent-heterologous cohesion domains and the CBD.
3. The recombinant yeast cell of claim 1, wherein the dockerin domain is from B. cellulosolvens or C. acetobutylicum.
4. A recombinant yeast cell comprising: a heterologous polynucleotide encoding a polypeptide comprising a surface anchor antigen (AGA) domain, a scaffoldin domain and at least one cohesion domain.
5. The recombinant yeast cell of claim 4, wherein the AGA domain is AGA1 or AGA2.
Description:
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of patent application Ser. No. 13/129,301, filed Aug. 29, 2011, which is a U.S. National Stage Application filed under 35 U.S.C. §371 and claims priority to International Application Serial No. PCT/US09/64491, filed Nov. 14, 2009, which claims priority under 35 U.S.C. §119 from Provisional Application Ser. No. 61/115,068, filed Nov. 15, 2008, the disclosures of which are incorporated herein by reference.
TECHNICAL FIELD
[0002] The disclosure provides designer cellulosomes. The disclosure also provides methods for efficient hydrolysis of cellulosic material and more particularly for the generating of ethanol.
BACKGROUND
[0003] Several billion gallons of renewable fuel must be produced by 2012 with most of that produced as biofuel using renewable biomass. In particular, bioethanol from renewable sources provides an attractive form of alternative energy. It has been estimated that the amount of ethanol needed as transportation fuel will reach 7.5 billion gallons. However, the total capacity of ethanol production in this country is only about 4.2 billion gallons, significantly lower than the required amount.
SUMMARY
[0004] The disclosure provides a synthetic yeast consortium for direct fermentation of cellulose to ethanol with productivity, yield and final concentration close to that from glucose fermentation. The engineering strategy described herein uses the efficiency of hydrolysis and synergy among multi-cellulases. To emulate the success of a natural cellulose hydrolysis mechanism, a complex cellulosome structure is assembled on a yeast cell surface using a constructed yeast consortium, which enables the ethanol-producing strains to utilize cellulose and concomitantly ferment it to ethanol. More importantly, by organizing these cellulases in an ordered structure, enhanced synergy increases the hydrolysis, and thereby the production of ethanol.
[0005] The disclosure provides a culture comprising: a first recombinant yeast strain comprising an anchoring scaffoldin (anScaff); a second recombinant yeast strain comprising an adaptor scaffoldins comprising a plurality of cohesin domains and at least one cellulose binding domain (CBD); and at least one recombinant yeast strain comprising a plurality of secreted dockerin-tagged cellulases. In one embodiment, the yeast strains are cultured under conditions wherein the anchoring scaffoldin, the adaptor scaffoldin comprising the cohesion domains and the plurality of dockerin-tagged cellulases associated to generate an engineered cellulosome. In yet another embodiment, the cellulases are selected from endoglucanases, exoglucanases, β-glucosidase, and xylanase. In a further embodiment, the dockerin-tagged cellulase is engineered to comprise a leader sequence for secretion of the dockerin-tagged cellulase.
[0006] The disclosure provides a recombinant yeast strain comprising a heterologous polynucleotide encoding an anchoring scaffoldin.
[0007] The disclosure also provides a recombinant yeast strain comprising a heterologous polynucleotide encoding an adaptor scaffoldin comprising a plurality of cohesin domains and at least one cellulose binding domain (CBD).
[0008] The disclosure provides a recombinant yeast strain comprising at least one heterologous polynucleotide encoding a secreted dockerin-tagged cellulase.
[0009] The disclosure provides a culture comprising a recombinant yeast strain at least two yeast strains comprising a portion of a functional cellulosome, wherein upon co-culture a functional cellulosome is generated.
[0010] The disclosure also provides a yeast culture comprising at least two recombinant strains of yeast wherein the culture produces a designer cellulosome, and wherein the yeast culture catabolizes cellulosic material to produce a biofuel.
[0011] The disclosure also provides a method of producing a biofuel comprising: culturing the yeast of any as described above in a fermentation broth comprising a cellulosic material, wherein the microorganism produces the biofuel metabolite.
[0012] The disclosure further provides a method of designing a cellulosome comprising identifying the cellulosic substrate, identifying at least one enzyme useful for degradation of the cellulosic material, recombinantly engineering a dockerin peptide to the enzyme, cloning a polynucleotide encoding the dockerin-linked enzyme into a microorganism, culturing the microorganism in a culture of at least one additional microorganism expressing a scaffoldin having a plurality of cohesion domains and a cellulosic binding domain, wherein the cohesion and dockerin a compatible and culturing the microorganisms to express the scaffoldin and dockerin-linked enzymes.
[0013] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
DESCRIPTION OF DRAWINGS
[0014] FIG. 1A-B shows functional assembly of minicellulosomes on the yeast cell surface. A trifunctional scaffoldin (Scaf-ctf) consisting of an internal CBD flanked by three divergent cohesin (C) domains from C. thermocellum (t), C. cellulolyticum (c), and R. flavefaciens (f) was displayed on the yeast cell surface. Three different cellulases (E1, E2, and E3) fused with the corresponding dockerin domain (either Dt, Dc, or Df) were expressed in E. coli. Cell lysates containing these cellulases were mixed with yeast cells displaying Scaf-ctf for the functional assembly of the minicellulosome.
[0015] FIG. 2A-D shows phase-contrast and immunofluorescence micrographs of yeast cells displaying minicellulosomes. (A) Cells displaying either scaffoldin Scaf-c, Sacf-ct, or Sacf-ctf. Functional assembly of three dockerin-tagged cellulases (CelE-Dc [Ec], CelA-Dt [At], or CelG-Df [Gf]) on cells displaying (B) Sacf-ctf, (C) Sacf-ct, or (D) Scaf-c. Cells were probed with either anti-c-Myc or anti-c-His6 serum and fluorescently stained with a goat anti-mouse IgG conjugated with Alexa Fluor 488. Cells displaying only the scaffoldins were used as controls.
[0016] FIG. 3 shows fluorescence intensity of cells either displaying scaffoldin Sacf-ctf or with different combinations of dockerin-tagged cellulases (At [A], Ec [E], and Gf [G]) docked on the displayed Sacf-ctf. Cells were probed with either anti-c-Myc or anti-c-His6 serum and fluorescently stained with goat anti-mouse IgG conjugated with Alexa Fluor 488. Whole-cell fluorescence was determined with a fluorescence microplate reader. Cells displaying only Scaf-ctf were used as controls. RFU, relative fluorescence units.
[0017] FIG. 4 shows a graph of whole-cell hydrolysis of CMC by different cellulase pairs (CelE-Dc [Ec], CelA-Dt [At], or CelG-Df [Gf]) docked on the displayed Scaf-ctf protein. Cells displaying only Scaf-ctf were used as controls.
[0018] FIG. 5A-D show graphs of cellulosome activity. Production of glucose (A) and reducing sugars (B) from the hydrolysis of PASC by free enzymes and by surface-displayed cellulosomes. Reactions were conducted either with different cellulase pairs (CelE-Dc [Ec], CelA-Dt [At], or _-glucosidase-Df [BglA]) docked on the displayed Scaf-ctf protein or with the corresponding purified cellulases. Cells displaying only Scaf-ctf were used as controls. (C) Activity associated with cells and (D) activity in the medium at different initial OD ratios.
[0019] FIG. 6A-B shows time profiles of ethanol production (A) and cellulose hydrolysis (B) from PASC by control strain EBY100 plus free enzymes and yeast cells displaying functional cellulosomes. Fermentations were conducted either with different cellulase pairs (CelE-Dc [Ec], CelA-Dt [At], or β-glucosidase-Df [BglA]) docked on cells displaying Scaf-ctf or with control strain EBY100 plus the corresponding purified cellulases. Cells displaying only Scaf-ctf were used as controls. The individual enzyme amounts were the same in all cases.
[0020] FIG. 7 shows a synthetic consortium for the display of complex cellulosomes.
DETAILED DESCRIPTION
[0021] As used herein and in the appended claims, the singular forms "a," "and," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a probe" includes a plurality of such probes and reference to "the primer" includes reference to one or more primers and equivalents thereof known to those skilled in the art, and so forth.
[0022] Also, the use of "or" means "and/or" unless stated otherwise. Similarly, "comprise," "comprises," "comprising" "include," "includes," and "including" are interchangeable and not intended to be limiting.
[0023] It is to be further understood that where descriptions of various embodiments use the term "comprising," those skilled in the art would understand that in some specific instances, an embodiment can be alternatively described using language "consisting essentially of" or "consisting of."
[0024] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although any methods and reagents similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods and materials are now described.
[0025] All publications mentioned herein are incorporated herein by reference in full for the purpose of describing and disclosing the methodologies, which are described in the publications, which might be used in connection with the description herein. The publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure.
[0026] Biomass represents an inexpensive feedstock for sustainable bioethanol production. Among the three biological events that occur during the conversion of cellulose to ethanol, i.e., enzyme production, polysaccharide hydrolysis, and sugar fermentation, cellulose hydrolysis is widely recognized as the key step in making bioconversion economically competitive. In addition, it is believed that a significant cost reduction can be achieved when two or more steps are combined, such as in CBP. To achieve this goal, the disclosure provides methods and cellular compositions comprising a functional assembly of a minicellulosome on a yeast cell surface. The minicellulosome was engineered to render the ethanologenic microbe cellulolytic.
[0027] In one embodiment, the disclosure achieves the method and composition by first engineering a chimeric minicellulosome containing three dockerin cohesion pairs from different species on the yeast cell surface. Immunofluorescence microscopy showed the successful translocation of the miniscaffoldin on the yeast cell surface, and the functionality of the cohesin domains was retained by observing the successful assembly of the corresponding dockerin-tagged cellulases. Since the specificity of the dockerin-cohesin pairs is preserved, it is possible to direct any enzymatic subunit to a specified position within a modular scaffoldin by tagging with the designated dockerin.
[0028] The disclosure further demonstrates a synergistic effect on cellulose hydrolysis compared with that of free enzymes.
[0029] In the compositions and methods of the disclosure the displayed minicellulosome retained this key characteristic. Interestingly, the level of synergy increased with an increasing number of cellulases docked on the cell surface. This synergistic effect was preserved even when a new minicellulosome comprising a β-glucosidase (BglA), an endoglucanase (At), and an exoglucanase (Ec) was assembled on the yeast cell surface.
[0030] The disclosure further demonstrates that the methods and compositions of the disclosure are useful at ethanol production. Cellulose hydrolysis and ethanol production were tested with both free enzymes and a displayed minicellulosome. Independent of the number of cellulases incorporated in the minicellulosome, similar levels of enhancement of cellulose hydrolysis, as well as ethanol production, were detected. The ethanol production achieved, in particular, was more than 2.6-fold higher than that of the culture in which all three cellulases were added as free enzymes. This, when combined with an ethanol yield close to 95% of the theoretical maximum, makes this an efficient process for direct fermentation of cellulose to ethanol.
[0031] Current production processes for using crops such as sugar cane and cornstarch for bioethanol production are well established. However, since the cost of raw materials can be as high as 40% of the overall process, utilization of a cheaper substrate would render bioethanol more competitive with fossil fuel (Zaldivar et al., 2001). Among the different forms of biomass, lignocellulosic biomass is particularly well-suited for energy applications because of its large-scale availability, low cost and environmentally benign production (Lynd et al, 1999). This natural and abundant polymer is found as agricultural waste (wheat straw, corn stalks, soybean residues), industrial waste (pulp and paper industry), forestry residues, and municipal solid waste. Many energy production and utilization cycles based on cellulosic biomass have near-zero greenhouse gas emissions on a life-cycle basis (Lynd et al, 2005).
[0032] The primary obstacle impeding the more widespread production of energy from biomass is the absence of a low-cost technology for overcoming the recalcitrance of these materials (Lynd et al, 2008). For cellulose to be amenable to fermentation, it needs to undergo several treatments to release its monomeric sugars (Zaldivar et al, 2001). Two main steps are: (1) pre-treatments that remove lignin and exposes cellulose for enzymatic degradation, and (2) an enzymatic treatment to generate glucose from cellulose before fermentation. The high cost of cellulases needed for cellulose hydrolysis is one of the major obstacles in the quest for an economically feasible cellulose-based bioethanol process (McBride et al., 2005).
[0033] Although the cost of bioethanol production can become more competitive by combining the hydrolysis and fermentation steps in simultaneous saccharification and cofermentation (SSCF) of both hexoses and pentoses, it has been shown that the overall cost can be even further reduced by 4-fold using a one-step "consolidated" bioprocessing (CBP) of lignocellulose to bioethanol, where cellulase production, cellulose hydrolysis and sugar fermentation can be mediated by a single microorganism or microbial consortium. An ideal microorganism for CBP should possess the capability of simultaneous cellulose saccharification and ethanol fermentation. One attractive candidate is Saccharomyces cerevisiae, which is widely used for industrial ethanol production due to its high ethanol productivity and high inherent ethanol tolerance.
[0034] However, due to energetic limitations under anaerobic conditions, only a limited amount of cellulases can often be secreted, resulting in relatively low rates of cellulose hydrolysis. It is believed that, for a process to be viable economically, it must have productivity greater than 1 g/l/hr (Zaldivar et al, 2001). For example, where cellulases are displayed on yeast surface the productivity (0.075 g/l/hr) was more than one order of magnitude lower than strains fermenting glucose.
[0035] Unfortunately, substantial improvement in cellulose hydrolysis may not come from simply increasing the amount of enzymes secreted to the medium or displayed on the surface, which is obviously limited under anaerobic conditions. The key to improving hydrolysis is, perhaps, to increase the catalytic efficiency by maximizing the synergy with limited amount of enzymes. Recently, it has been demonstrated that the use of ternary cellulose-enzyme-microbe complexes yields much higher rates of cellulose hydrolysis than using binary cellulose-enzyme complexes (Lu et al., 2006). This enzyme-microbe synergy requires the presence of metabolically active Clostridium thermocellum displaying cellulosome and appears to be a surface phenomenon involving microbial adhesion onto the cellulose. The 2 to 4-fold synergistic effect observed is significant in decreasing the cost for cellulose hydrolysis.
[0036] An understanding of the role of cellulosomes can be viewed as two distinct mechanisms to tackle the recalcitrant cellulose. Aerobic microbes (such as Trichoderma reesei) produce copious amounts of soluble hydrolytic enzymes that synergistically breakdown cellulosic materials (Wilson, 2004; Bayer et al., 2000). In contrast, anaerobic organisms, due to energetic constraints, can only produce a limited amount of enzymes. Therefore, in response, anaerobic organism have become more efficient and have developed an elaborately structured enzyme complex, called a cellulosome, to maximize catalytic efficiency (Bayer et al., 2004; Doi and Kosugi, 2004; Demain et al., 2005). This self-assembled system brings multiple enzymes in close proximity to the substrate, and provides a structure that ensures high local concentration and the correct ratio and orders of the enzymes, thereby maximizing synergy. Consequently, it has a much higher catalytic efficiency than soluble enzymes present in a non-organized fashion. A study showed that the structure endowed an enzyme activity increase of up to 50 times (Johnson et al., 1982).
[0037] Cellulosomes are self-assembled multi-enzyme complexes presented on the anaerobes' cell surface and are dedicated to cellulose depolymerization. The major component of these macromolecule complexes is a structural scaffoldin consists of at least one cellulose binding domain (CBD) and repeating cohesin domains, which are docked individually with a cellulase tagged with a dockerin domain (FIG. 1). The CBD serves as a targeting agent to direct the catalytic domains to the cellulose substrates. The specific protein-protein, or complementary cohesin-dockerin interaction, provides the mechanism for position-specific self-assembly. Within a given species, the dockerin component appears to bind to all of the cohesins with similar affinity, thus suggesting a random incorporation of the enzymes in the cellulosome. The relative abundance of the catalytic subunits in the cellulosomes is assumed to reflect the level of expression of the corresponding genes as such as in the case of C. cellulolyticum using a genetic approach. These cohesin and dockerin modules are species-specific and do not cross interact (Carvalho et al., 2005; Pages et al., 1997). However, recently studies confirmed the presence of other Type II and Type III cohesin/dockerin pairs within a given species in additional to the original Type I mentioned above. These additional pairs are structurally very different and have been shown to possess different specificities to the Type I cohesin/dockerin pairs (Haimovitz et al., 2008).
[0038] The multi-enzyme complex attaches both to the cell envelope and to the substrate, mediating the proximity of the cells to the cellulose (Schwarz, 2001). The ability for substrate-targeting is one of the reasons for increased catalytic efficiency. In addition, the production of cellulosome has a number of advantages over soluble enzymes, for hydrolysis of cellulose:
[0039] 1. Synergism is optimized due to the proximity of enzyme components,
[0040] 2. Non-productive adsorption is avoided by the optimal spacing of components,
[0041] 3. Competitiveness in binding to a limited number of binding sites is avoided by binding the whole cellulosome complex to a single site through a strong binding domain with low specificity,
[0042] 4. A halt in hydrolysis on depletion of one structural type of cellulose at the site of adsorption is avoided by the presence of other enzymes with different specificity.
[0043] The disclosure provides a recombinant yeast expressing cellulosomal structures. Bioenergetic benefits and synergy are achieved when the cellulosomal structures are displayed onto a microorganism having the ability to ferment biomass to ethanol such as yeast (e.g. S. cerevisiae). The recombinant organisms of the disclosure are useful for bioethanol production as fewer enzymes are needed. Additionally, since glucosidase is typically subjected to product inhibition, presence of active glucose-metabolizing cells should further increase the overall hydrolysis rate. The disclosure provides engineered yeast comprising a consortium capable of displaying the highly efficient cellulose-degrading cellulosome structures for one-step CBP of cellulosic materials.
[0044] The functional presentation of various cellulose-binding domains and catalytic subunits in a cellulosome provides improved cellulose hydrolysis over free enzymes as a consequence of the synergistic action among the different components. Because of the modular nature of the cellulosomal subunits the disclosure provides artificial cellulosomes useful in generating biofuels from aerobic organisms at efficiency similar to anaerobic organisms. For example, the disclosure demonstrates that usefulness of a recombinant CBD in yeast using a trifunctional chimeric scaffoldin containing cohesins from a plurality of species. The trifunctional chimeric scaffoldin was constructed and each type of cohesion module was shown to bind specifically to the corresponding dockerin-borne cellulolytic enzymes in vitro. The resulting 6-fold improvement in cellulose hydrolysis over similar free enzymes demonstrates that the "designer cellulosome" of the disclosure can be similarly exploited for whole-cell hydrolysis of cellulose and ethanol production when expressed by yeast (e.g., S. cerevisiae). The disclosure demonstrates that by displaying a mini-scaffoldin onto the yeast surface a designer cellulosome was obtain. In one embodiment, the resulting yeast cells when tagged with three different dockerin-tagged cellulases were shown to degrade cellulose up to 3-fold faster.
[0045] In yet another embodiment, the disclosure provides a yeast consortium composed of strains with a surface-display anchoring scaffoldin, strains secreting an adapting scaffoldin, and strains secreting dockerin-tagged cellulases (FIG. 2) for the functional presentation of the complex cellulosome structures.
[0046] The disclosure demonstrates a synthetic yeast consortium for functional presentation of the complex cellulosome structures and to demonstrate the ability for enhanced ethanol production from cellulose. The disclosure provides recombinant yeast for ethanol production comprising a plurality of cohesions and dockerin polypeptides. Currently, the sequences of more than one hundred different cohesions and dockerins from a dozen cellulosome-producing bacteria are known (Hamiovitz et al., 2008). In one embodiment, the disclosure provides the use of 2, 3, 4, 5, 6, 7, or 8 different cohesin/dockerin pairs for the cellulosome assembly.
[0047] The disclosure provides a synthetic yeast consortium for direct fermentation of cellulose to ethanol with productivity, yield and final concentration close to that from glucose fermentation. The engineering strategy described herein uses the efficiency of hydrolysis and synergy among multi-cellulases, rather than focusing on the amount of enzymes produced or used. To emulate the success of a natural cellulose hydrolysis mechanism, a complex cellulosome structure is assembled on a yeast cell surface using a constructed yeast consortium, which enables the ethanol-producing strains to utilize cellulose and concomitantly ferment it to ethanol. More importantly, by organizing these cellulases in an ordered structure, the enhanced synergy will increase the hydrolysis, and thereby the production of ethanol.
[0048] In one embodiment, the disclosure provides a yeast consortium for surface assembly of a mini-cellulosome structure comprising 2, 3 or more cellulases and demonstrates the feasibility of using the consortium for direct ethanol production from cellulose. In another embodiment, the disclosure provides recombinant yeast for surface-display of one or more of the anchoring scaffoldin, the adaptor scaffoldin, and the dockerin-tagged cellulases.
[0049] In one embodiment, the yeast consortium provides a cellulosome comprising a CelA from Orpinomyces sp strain PC-2 (see, e.g., Ljungdahl, 2008; Chen et al., 2006, which are incorporated herein by reference), CelC from Orpinomyces sp strain PC-2, CelB, CelD, XynA, and 1 B-glucosidase (Voorhorst, 1995). Sequences for the various dockerins, cohesions and cellulases used in the methods and compositions of the disclosure are readily identifiable by one of skill in the art with reference to readily available databases (e.g., GenBank).
[0050] In one embodiment, a strain of yeast can be genetically engineered by recombinant DNA techniques to express a polynucleotide comprising one or more structural component for producing a cellulosome, a polynucleotide comprising a structural element linked to a cellulose degrading enzyme (e.g., a cellulase), or a combination of any polynucleotide encoding a cellulosome structural polypeptide or enzyme. Where a single yeast or microorganism does not express a full complement of structural and enzyme polypeptide for production of a complete cellulosome, a combination of two or more recombinant yeast (e.g., a consortium) can be used wherein the two or more recombinant yeast express portions of a cellulosome that upon combination generate a full cellulosome capable of degrading a cellulose material.
[0051] For example, in one embodiment, a yeast can be recombinantly engineered to express a trifunctional scaffoldin comprising an internal CBD flanked by three divergent cohesin domains. A first strain recombinant yeast will comprise a plasmid or vector containing one or more (e.g., continuous or separated by linking domains) polynucleotide(s) encoding the CBD flanked by the three divergent cohesin domains. The polynucleotide sequences for a large number of cohesin domains and their corresponding dockerin domains are known in the art. For example, a search of GenBank will identify numerous sequences for cohesin polynucleotide and polypeptides.
[0052] A second yeast strain can be recombinantly engineered to contain a plasmid or vector comprising sequence encoding one or more dockerin domains linked to a cellulose degrading enzyme. Upon co-culture each strain expresses the corresponding structural or structural-enzymatic polypeptides. The respective dockerin and cohesin domains bind to one another and form a mini-cellulosome. Again, dockerins and enzymes useful in the methods and compositions of the disclosure are recognized in the art and the corresponding sequences are readily identifiable to one of skill in the art performing a simple search on GenBank. For example, the disclosure provides dockerin-enzyme fusion constructs comprising SEQ ID NOs: 5-7. It will be recognized that variants of each of the enzyme domains of the fusion construct may be used, variants of each of the dockerin domains may be used. For example, polypeptides having 80%-99% identity to SEQ ID NO:6 or 8 (or 80-99% [85%, 90%, 95%, 97%, 98% etc.] identity to the respective enzyme or dockerin domains of the construct) can be used in the methods and compositions of the disclosure so long as the dockerin domain is capable of binding to its respective cohesin domain and the enzyme domain is capable of degrading a cellulose material. Methods for determining percent identity are well known in the art.
[0053] A variety of tools are available for the introduction and expression of genes in yeast (such as S. cerevisiae), including established vector series (Gietz and Sugino, 1988; Sikorski and Hieter, 1989) and simultaneous or sequential gene integration vectors for the insertion of multiple genes (Wang and Da Silva, 1996; Parekh et al., 1996; Lee and Da Silva, 1997; Lee and Da Silva, 2007).
[0054] Plasmids designed to enable combinatorial plasmid-based testing and seamless transition to genomic integration for fine-tuning of gene number and stable long-term expression can be used. This allows rapid and stable strain construction relative to previous methods. The set of 16 plasmids combines four different marker genes (flanked by loxP sites), two different promoters, and two different replication origins (2μ, CEN/ARS). The autonomous vectors allow initial testing of gene combinations on high and/or low copy plasmids. For insertion into the chromosomes, expression polylinker sites adjacent to the selectable markers facilitate polymerase chain reaction amplification of the test gene and selectable marker using primers with outside ends in the desired genomic target sequences. Using this strategy, genes have been successfully inserted into a set of unique locations in the genome with known expression level. The loxP-mediated excision of the selection marker (Sauer, 1987) allows simultaneous marker excision after a group of genes has been integrated, this set of vectors enables both rapid construction and testing of strains, and development of stable engineered strains for use in any complex medium.
[0055] For example, using the methods described herein an engineered consortium for cellulose hydrolysis by intercellular complementation is provided and useable in any given ecosystem. The disclosure demonstrates the feasibility of using a yeast consortium for the surface-display of a mini-cellulosome for efficient cellulose hydrolysis. The disclosure demonstrates the correct assembly of secreted At onto the Scaff#3 in a co-culture system. To enable surface display of scaffoldins without galactose induction, expression of the surface anchor AGA1 (FIG. 1) is placed under a constitutive PGK promoter and the 2 copies of the gene cassette integrated.
[0056] Various enzymes can be used for to degrade the cellulose material. For example, it has been shown that β-glucosidase is useful for complete degradation of cellulose to glucose. Therefore a well known β-glucosidase BglA from C. thermocelum was tagged with the dockerin domain (Bf), produced in E. coli and incorporated into the cellulosome structures. The result demonstrates the enhancement effect on glucose liberation by assembling BglA into the mini-cellulosome. Therefore, for the initial demonstration, a mini-cellulosome containing an endoglucanase (At), an exoglucanase (Ec) and BglA are assembled. Secretion of At into the medium using the secretion leader sequence MFα1 was used; a similar strategy is employed for the secretion of Ec and Bf. Secretion of the structure-enzyme can be confirmed using various methods in the art. For example, secretion of Ec and Bf into the medium can be confirmed by Western blotting using a FLAG tag on Ec and a S-tag on Bf. After confirming secretion, the activity of the secreted fusion constructs can be assayed. For example, cellulase activity can be determined using Avicel or cellobiose as the substrate. Finally, cells secreting either Ec and Bf are co-cultured with cells displaying Scaff#3 and the correct assembly of the cellulases onto the cell surface can be confirmed by immunofluorescence microscopy and the ability to hydrolyze Avicel or cellobiose. After confirming the assembly of individual secreted cellulases, the feasibility of assembling the complete mini-cellulosome is performed. To begin with, a co-culture of different yeast strains are tested in SDC medium. The correct assembly of all three cellulases is confirmed by immunofluoresence using a unique tag presented on each one.
[0057] In yet another embodiment, a single yeast strain capable of secreting all Ec, At and Bf and a strain displaying Scaff#3 is provided by taking advantage of the rapid sequential integration approach. This method also allows precise regulation of expression by controlling the integrated gene copy number (1 to 5). A small-scale shake-flash cultures are used for varying the initially inoculation cell density from a ratio of 10 to 0.1. The specific culturing conditions that result in the highest number of fluorescence cells with all three tags can then be used. The ability of the consortium to hydrolyze Avicel and the corresponding ethanol production can be measured using standard techniques. For example, cells are grown aerobically in SD medium using glucose as the carbon source. The resuspended cells are then used in anaerobic fermentation (SDC medium) using Avicel or phosphoric acid swollen cellulose (PASC) as the carbon source. Samples of the culture can then be obtain for monitoring the expression level, reducing sugar, intermediates, and cell growth. The ratio of the two different cell populations can be modified to maximize synergy. A coordinated gene expression system leads to the detection of only glucose, whereas accumulation of other products indicate the level of secreted enzymes (or cell population) should be adjusted. For example, if cellobiose is found to accumulate, it indicates that the glucosidase activity is too low relative to the other enzymes and the problem could be easily solved with this strategy by simply increasing the gene dosage for the secreted glucosidase.
[0058] To achieve the cellulosome structure as shown in FIG. 7, five additional cohesin/dockerin pairs can be used. Since most of them are species specific, three additional cohesion/dockerin pairs from B. cellulosolvens (bc), Ace. celluloyticus (ac), and C. acetobutylicum (cc) can be used. In addition, Type II cohesion/dockerin pairs from Clostridium thermocelum (T) and Clostridium celluloyticum (C) are used in conjunction with the Type I pairs (c, t, and f). A feature of the design is the common display of an anchoring scaffoldin, which will enable the surface-display of the complex cellulosome onto all cells except for the strain designed to secrete the adaptor scaffoldins. Since the dockerins used on the cellulolytic enzymes have no cross affinity with the cohesions on the anchoring scaffoldin, no interaction or interference with the translocation machinery is expected. As a result, the resulting consortium will be comprised of cells displaying a functional cellulosome with virtually no carbon source wasted.
[0059] To construct the synthetic consortium, different strains are generated. First, a yeast strain designed to display an anchoring scaffoldin (anScaff) containing the cohesin domains from bc and cc is provided. Synthetic oligos coding for two cohesin domains are synthesized and used for plasmid construction. These two domains are joined by a 10 amino acid linker containing GS repeats flanked by a FLAG tag and displayed on the yeast surface using the same GPI anchor. To add the adapter scaffoldins onto the displayed anScaff, a yeast strain designed to secrete two separate adaptor scaffoldins is provided. The first adaptor scaffoldin (adScaff#1) comprises an N-terminus be dockerin flanked by three cohesin domains (t, f, c), one CBD domain, and a C-myc tag. The second adaptor scaffoldin (adScaff#2) comprises an N-terminus cc dockerin flanked by three cohesin domains (ac, type II t and type II c), one CBD domain, and a S-tag. Finally, two different strains are provided to secrete three different dockerin-tagged cellulases each (2 endoglucanases, 2 exoglucanases, one β-glucosidase, and one xylanase) secreted using the MFβ1 leader sequence. A His6 tag is added to each cellulase. In this configuration, the consortium will comprise four strains and three will have the complex cellulosome displayed on the surface.
[0060] In addition to At, Ec, and BglA used above, other enzymes from anaerobic fungi that form cellulosome can be used to demonstrate the complex cellulosome structure. This choice is based on the finding that enzymes from these anaerobic fungi have specific activities much higher than enzymes from other sources (Ljungdahl, 2008). Additionally, several of these enzymes were successfully over-expressed in S. cerevisiae (Ljungdahl, 2008; Chen et al., 2006), suggesting over expression of enzymes may not be a significant obstacle. Furthermore, since these enzymes are cellulosomal, the structural feature and folding mechanism are likely compatible to the designed structure as compared to other non-cellulosomal enzymes. For example, a cellulosome of the disclosure can comprise CelA and CelC from Orpinomyces sp strain PC-2, are both GH family 6 enzymes, possessing both endo and exoglucanase activities; two family 5 cellulases, CelB and CelD, both endoglucanases, are cloned and fused with an appropriate dockerin; the catalytic domain of XynA, a family GH11 xylanase with extremely high activity, is used as the fifth enzyme and a family 1 β-glucosidase from Piromyces sp Strain E2 is used as a sixth enzyme.
[0061] All of these strains are constructed using the rapid and stable multi-gene integration systems described above; 1 to 5 copies of each gene cassette are integrated in order to optimize the required expression. Expression is under the control of the PGK promoter based on its constitutive nature and the high-level of protein expression. The number of anScaff molecules displayed on the cell surface will be determined by measuring the fluorescence intensity of the cell pellet suspended in PBS buffer (pH 7.0) using a fluorometer. A standard curve can be prepared by using known amounts of Alexa Fluor 546-conjugated goat anti-mouse IgG. The number of anscaff displayed will be calculated using (RFU×0.945×107)/1×107 as reported previously. Similarly, the secretion level for the two anScaffs and the different cellulases can be determined. The secretion of anScaff in the medium can be confirmed first by incubating the medium with Avicel for 1 h. After incubation, Avicel is separated by centrifugation and the bound protein after washing three times with PBS buffer is analyzed by SDS-PAGE and Western blot against either the S-tag or C-myc tag. The amount of cellulases produced is analyzed by SDS-PAGE and enzyme assays using procedures that are already in place. After confirming expression, the four different strains are co-cultured and the correct assembly of the adaptor scaffoldins and cellulases onto the cell surface confirmed by immunofluorescence microscopy and the ability to hydrolyze Avicel. Xylanse activity can be measured as described by Bailey et al., 1992).
[0062] The disclosure demonstrates a synthetic consortium for surface-display of a complex cellulosome by combining cells displaying the anchoring and adaptor scaffoldins with cells secreting the dockerin-borne cellulases. The modular nature of the cellulosome and great diversity of cellulases, and the availability of gene fusion technology provide almost unlimited number of combinations of enzymes and ways to incorporate them into artificial cellulosome as designed to optimize their activities to approach or even surpass the natural cellulosome. It has been shown by Fierobe et al. (2002; 2005) that cellulosomes containing different cellulases have significantly different abilities for cellulose hydrolysis; even the same cellulases fused to different dockerins can result in cellulosomes with substantially different hydrolysis efficiencies (up to 2-3 fold), suggesting the order of enzymes on the cellulosome can directly impact the overall activity. In an effort to create the most efficient combination for cellulose hydrolysis, dockerin replacement among the enzymes can be revised and modulated. All possible dockerin combinations will be created and the resulting activity of the cellulosomes can be compared for hydrolysis. Overlap-extension PCR can be used for replacements of the dockerins. Briefly the reverse primers for the region coding for the C-terminal part of the catalytic domain of each cellulase can be overlapped with the forward primers for the region coding for the N-terminal part of the dockerin domain. After several runs of denature, aligning, and extension in PCR the resultant overlapping fragments will be mixed and combined fragment will be synthesized by using external primers. DNS method as described herein can be used for evaluating the efficiencies of the different cellulosome complexes and their synergy effects as well as glucose liberation.
[0063] After optimizing the activity of the cellulosome, the ability of the consortium to hydrolyze Avicel and the corresponding ethanol production can be analyzed. Initially, growth rates of each individual strain are determined to check for any substantial difference in cell growth. Samples are taken periodically for monitoring the expression level, reducing sugar, intermediates, and cell growth. One can coordinate the four different cell populations so that maximum synergy can be obtained and no enzyme represents a limiting step. This can be ensured by using cellulose hydrolysis and following the hydrolysis products by a carbohydrate analysis method established on a Dionex High-pH Ion-Exchange Chromatograph System with electrochemical detector, which detects oligosaccharides (cellobiose, glucose and the like), allowing one to pinpoint limiting enzyme activities (if any) (endo/exo glucanases or β-glucosidase). A coordinated gene expression system leads to the detection of only glucose, whereas accumulations of other products indicate the level of secreted enzymes (or cell population) should be adjusted by varying the gene copy number.
[0064] The engineered strains can be evaluated for cellulose hydrolysis and ethanol production under different conditions such as resting and growth conditions in SDC medium. Both small and large-scale (shaker flask/one liter bioreactor) studies can be performed. In resting cell experiments, cells are grown aerobically using glucose as the carbon source. Cells are then washed and used in cellulose anaerobic hydrolysis. Enzyme activity, the integrity of cellulosome, hydrolysis products, glucose, ethanol will be monitored using methods described herein. In studies carried out in a fermentor, a mild agitation can be used to promote mixing of solid cellulose material with cells. Once optimized industrial yeast fermentation process may be used. Different cellulose concentrations can also be used. The rate of glucose generation will be estimated from the experiments and compared to those without cellulosome on the cell surface (but with comparable enzyme expression levels). In studies under growing conditions, the cells will be provided cellulose as the sole carbon source, and other nutrients necessary for growth. Anaerobic conditions are maintained. Cell biomass, enzyme activities, cellulosome integrity, any possible accumulated hydrolysis products including glucose, and ethanol are measured.
[0065] The disclosure provides yeast strains for direct fermentation of cellulose to ethanol, eliminating the need for use of purified cellulases. The methods and compositions of the disclosure provide abundant, low-cost, agriculture residue to be used as raw material for ethanol production. The increased production of ethanol not only reduces pollution to the environment but also the need for imported petroleum as transportation fuel. Collectively, the benefits from the invention include at least efficient, economical, and environmentally friendly conversion of biomass.
[0066] Current biofuel production processes are exclusively based upon the soluble enzyme approach, the less efficient model utilized by aerobic microbes. The construction of cellulosomes on the cell surface as described herein departs from the current model of enzymatic hydrolysis. A difference lies in the extent of synergism. While the secretion or co-display of cellulases (without the cellulosome structure) permits a synergistic use of these enzymes to some extent, both follow the model of aerobic organisms in cellulose hydrolysis. As exemplified by Trichoderma. reesei, this model requires the production of abundant enzymes without needing to maximize the efficiency and synergism. Since ethanol production is carried out anaerobically, the limited amount of enzyme production makes the high coordination of different enzyme components necessary to maximize the synergy and efficiency.
[0067] As used herein, the term "microorganism" includes prokaryotic and eukaryotic microbial species from the Domains Archaea, Bacteria and Eucarya, the latter including yeast and filamentous fungi, protozoa, algae, or higher Protista. The terms "microbial cells" and "microbes" are used interchangeably with the term microorganism.
[0068] As used herein, the term "polynucleotide" refers to a polymer of nucleic acid bases such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides.
[0069] The term "carbon source" generally refers to a substrate or compound suitable to be used as a source of carbon for bacterial or simple eukaryotic cell growth. Carbon sources may be in various forms, including, but not limited to polymers, carbohydrates such as cellulosic material including cellulooligosaccharides and lignocellulose, acids, alcohols, aldehydes, ketones, amino acids, peptides, etc. These include, for example, various monosaccharides such as glucose, oligosaccharides, polysaccharides, saturated or unsaturated fatty acids, succinate, lactate, acetate, ethanol, and the like, or mixtures thereof.
[0070] The term "substrate" or "suitable substrate" refers to any substance or compound that is converted or meant to be converted into another compound by the action of an enzyme. The term includes not only a single compound, but also combinations of compounds, such as solutions, mixtures and other materials which contain at least one substrate, or derivatives thereof. Further, the term "substrate" encompasses not only compounds that provide a carbon source suitable for use as a starting material, but also intermediate and end product metabolites used in a pathway associated with a engineered microorganism as described herein. A "biomass derived sugar" includes, but is not limited to, molecules such as glucose, sucrose, mannose, xylose, and arabinose. Exemplary substrate sources include alfalfa, corn stover, crop residues, debarking waste, forage grasses, forest residues, municipal solid waste, paper mill residue, pomace, sawdust, spent grains, spent hops, switchgrass, and wood chips.
[0071] As used herein, the terms "gene" and "recombinant gene" refer to an exogenous nucleic acid sequence which is transcribed and (optionally) translated. Thus, a recombinant gene can comprise an open reading frame encoding a polypeptide. In such instances, the sequence encoding the polypeptide may also be referred to as an "open reading frame".
[0072] "Transcriptional regulatory sequence" is a generic term used throughout the specification to refer to DNA sequences, such as initiation signals, enhancers, and promoters, which induce or control transcription of a gene or genes with which they are operably linked.
[0073] "Operably linked" means that a gene and transcriptional regulatory sequence(s) are connected in such a way as to permit expression of the gene in a manner dependent upon factors interacting with the regulatory sequence(s).
[0074] "Exogenous" means a polynucleotide or a peptide that has been inserted into a host cell. An exogenous molecule can result from the cloning of a native gene from a host cell and the reinsertion of that sequence back into the host cell. In most instances, exogenous sequences are sequences that are derived synthetically, or from cells that are distinct from the host cell.
[0075] The terms "host cells" and "recombinant host cells" are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
[0076] As used herein, a "reporter gene" is a gene whose expression may be assayed; reporter genes may encode any protein that provides a phenotypic marker, for example: a protein that is necessary for cell growth or a toxic protein leading to cell death, e.g., a protein which confers antibiotic resistance or complements an auxotrophic phenotype; a protein detectable by a colorimetric/fluorometric assay leading to the presence or absence of color/fluorescence; or a protein providing a surface antigen for which specific antibodies/ligands are available.
[0077] The term "biosynthetic pathway", also referred to as "metabolic pathway", refers to a set of anabolic or catabolic biochemical reactions for converting (transmuting) one chemical species into another. Gene products belong to the same "metabolic pathway" if they, in parallel or in series, act on the same substrate, produce the same product, or act on or produce a metabolic intermediate (i.e., metabolite) between the same substrate and metabolite end product.
[0078] As used herein, the term "metabolic pathway" includes catabolic pathways and anabolic pathways both natural and engineered i.e. synthetic. Anabolic pathways involve constructing a larger molecule from smaller molecules, a process requiring energy. Catabolic pathways involve breaking down of larger molecules, often releasing energy. An anabolic pathway is referred to herein as "a biosynthetic pathway."
[0079] Biofuel is any fuel that derives from biomass--organisms, such as plants, fermentation waste, or metabolic by-products, such as manure from cows. It is a renewable energy source, unlike other natural resources such as petroleum, coal and nuclear fuels. Agricultural products specifically grown for use as biofuels and waste from industry, agriculture, forestry, and households--including straw, lumber, manure, sewage, garbage and food leftovers--can be used for the production of bioenergy.
[0080] Cellulose is a polymer polysaccharide carbohydrate, of beta-glucose. It forms the primary structural component of plants and is not digestible by humans. Cellulose is a common material in plant cell walls and was first noted as such in 1838. Cellulose is the most abundant form of living terrestrial biomass (Crawford, R. L. 1981. Lignin biodegradation and transformation, John Wiley and Sons, New York.). Cellulose is also the major constituent of paper. Cellulose monomers (beta-glucose) are linked together through 1,4 glycosidic bonds.
[0081] A polynucleotide, polypeptide, or peptides may have a certain percent "sequence identity" to another polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids are the same when comparing the two sequences. Sequence similarity can be determined in a number of different manners. To determine sequence identity, sequences can be aligned using the methods and computer programs, including BLAST, available over the world wide web at ncbi.nlm.nih.gov/BLAST. See, e.g., Altschul et al. (1990), Mol. Biol. 215:403-10.
[0082] Exemplary polynucleotide and polypeptides are provided herein. One of skill in the art will recognize that minor modification (e.g., conservative substitutions and the like) can be made to the polypeptide without destroying the biological/enzymatic activity of the polypeptide. Such modification, variation and the like are within the skill in the art as it relates to molecular biology. Screening for activity of such modified polypeptides is described herein. Accordingly, the disclosure encompass polynucleotide and polypeptides having at least 60%, 70%, 80%, 90%, 95%, 98% or 99% identity to a sequence as set forth herein and having a biological activity similar to the wild-type molecule.
[0083] As will be understood by those of skill in the art, it can be advantageous to modify a coding sequence to enhance its expression in a particular host. The genetic code is redundant with 64 possible codons, but most organisms typically use a subset of these codons. The codons that are utilized most often in a species are called optimal codons, and those not utilized very often are classified as rare or low-usage codons. Codons can be substituted to reflect the preferred codon usage of the host, a process sometimes called "codon optimization" or "controlling for species codon bias."
[0084] Optimized coding sequences containing codons preferred by a particular prokaryotic or eukaryotic host (see also, Murray et al. (1989) Nucl. Acids Res. 17:477-508) can be prepared, for example, to increase the rate of translation or to produce recombinant RNA transcripts having desirable properties, such as a longer half-life, as compared with transcripts produced from a non-optimized sequence. Translation stop codons can also be modified to reflect host preference. For example, typical stop codons for S. cerevisiae and mammals are UAA and UGA, respectively. The typical stop codon for monocotyledonous plants is UGA, whereas insects and E. coli commonly use UAA as the stop codon (Dalphin et al. (1996) Nucl. Acids Res. 24: 216-218). Methodology for optimizing a nucleotide sequence for expression in a plant is provided, for example, in U.S. Pat. No. 6,015,891, and the references cited therein.
[0085] Those of skill in the art will recognize that, due to the degenerate nature of the genetic code, a variety of DNA compounds differing in their nucleotide sequences can be used to encode a given enzyme of the disclosure. The native DNA sequence encoding the biosynthetic enzymes described above are referenced herein merely to illustrate an embodiment of the disclosure, and the disclosure includes DNA compounds of any sequence that encode the amino acid sequences of the polypeptides and proteins of the enzymes utilized in the methods of the disclosure. In similar fashion, a polypeptide can typically tolerate one or more amino acid substitutions, deletions, and insertions in its amino acid sequence without loss or significant loss of a desired activity. The disclosure includes such polypeptides with different amino acid sequences than the specific proteins described herein so long as they modified or variant polypeptides have the enzymatic anabolic or catabolic activity of the reference polypeptide. Furthermore, the amino acid sequences encoded by the DNA sequences shown herein merely illustrate embodiments of the disclosure.
[0086] The recombinant yeast cellulosome of the disclosure can be engineered based upon the cellulosic material to be metabolized. For example, different cellulases and other enzymes may be engineered into a cellulosome pathway depending upon the source of substrate. Exemplary substrate sources include alfalfa, corn stover, crop residues, debarking waste, forage grasses, forest residues, municipal solid waste, paper mill residue, pomace, sawdust, spent grains, spent hops, switchgrass, and wood chips. Some substrate sources can have a larger percentage of cellulose compared to other source, which may have a larger percentage of hemicellulose. A hemicellulose substrate comprises short, branched chains of sugars and can comprise a polymer of five different sugars. Hemicellulose comprises five-carbon sugars (e.g., D-xylose and L-arabinose) and six-carbon sugars (e.g., D-galactose, D-glucose, and D-mannose) and uronic acid. The sugars are typically substituted with acetic acid. Hemicellulose is relatively easy to hydrolyze to its constituent sugars. When hydrolyzed, the hemicellulose produces xylose (a five-carbon sugar) or six-carbon sugars from hardwoods or softwoods, respectively.
[0087] In some instances the feedstock can be pretreated using heat, acid treatment or base treatment. Possible pre-treatments include the use of dilute acid, steam explosion, ammonia fiber explosion (AMFE), organic solvents (BioCycle, May 2005 News Bulletin, and see: Ethanol from Cellulose: A General Review, P. Badger, p. 17-21 in J. Janick and A. Whipkey (eds.), Trends in New Crops and Uses, ASHS Press, 2002). Typically the pretreatment will be biocompatible or neutralized prior to contact with a recombinant microorganism of the disclosure.
[0088] Proteins or polypeptides having the ability to convert the hemicellulose components into carbon sources that can be used as a substrate for biofuel production includes, for example, cellobiohydrolases (Accessions: AAC06139, AAR87745, EC 3.2.1.91, 3.2.1.150), cellulases (E.C. 3.2.1.58, 3.2.1.4, Accessions: BAA12070, BAB64431), chitinases (E.C. 3.2.1.14, 3.2.1.17, 3.2.1.-, 3.2.1.91, 3.2.1.8, Accessions: CAA93150, CAD12659), various endoglucanases (E.C. 3.2.1.4, Accessions: BAA92430, AAG45162, P04955, AAD39739), exoglucanases (E.C. 3.2.1.91, Accessions: AAA23226), lichenases (E.C. 3.2.1.73, Accessions: P29716), mannanases (E.C. 3.2.1.4, 3.2.1.-, Accessions: CAB52403), pectate lyases (E.C. 4.2.2.2, Accessions: AAG59609), xylanase (E.C. 3.2.1.136, 3.2.1.156, 3.2.1.8, Accessions: BAA33543, CAA31 109) and silase (E.C. 3.2.2.-, 2.7.7.7, Accessions: CQ80097S).
[0089] Cellulases are a class of enzymes produced chiefly by fungi, bacteria, and protozoans that catalyze the hydrolysis of cellulose. However, there are also cellulases produced by other types of organisms such as plants and animals. Several different kinds of cellulases are known, which differ structurally and mechanistically. The EC number for cellulase enzymes is E.C.3.2.1.4. Assays for testing cellulase activity are known in the art.
[0090] Polypeptides having xylanase activity are useful for including in synthetic cellulosomes. Xylanases is the name given to a class of enzymes which degrade the linear polysaccharide beta-1,4-xylan into xylose, thus breaking down hemicellulose. The EC number for xylanase enzymes is E.C. 3.2.1.136, 3.2.1.156, 3.2.1.8. Assays for testing xylanase activity are known in the art.
[0091] Scaffold or structure polypeptides refer to peptides that do not have enzymatic activity, but rather play a role as a building block. For example, scaffold or structure polypeptides as used herein include scaffoldin, cohesion, and cellulose binding polypeptides useful for generating the cellulosome structure for binding of enzyme(s) to the host cell surface, or bind the cellulosic material degrading enzyme(s) to the cellulosic material carbon source. In one example, a recombinant cellulosome of the disclosure can comprise a recombinant scaffold polypeptide and/or a recombinant enzymatic polypeptide. For example, a synthetic cellulosome can have a cellulosic material degrading enzyme domain, and one or more structural domains. Depending on the structural peptide domain the synthetic cellulosome will bind to the carbon source and serve to place the cellulosic material degrading enzyme activity in close physical proximity to the carbon source. In other examples the synthetic cellulosome will have peptide sequences that bind the synthetic cellulosome to the host cell surface function to place the cellulosic material degrading enzyme activity in close proximity to the cell surface.
[0092] Yeast of the disclosure are engineered to convert cellulosic material to a biofuel, such as ethanol, by engineering them to produce both a synthetic cellulosome and cellulose degrading enzymes. Multiple recombinant yeast can be co-cultured to generate the cellulosome, each of a plurality of recombinant yeast producing one or more, but not all, the elements of a function cellulosome.
[0093] One of ordinary skill in the art will appreciate that there are a variety of synthetic cellulosomes that can be made, for example, comprising a variety of degradation enzymes for a specific cellulose or hemicelluloses containing material, a variety of associated scaffoldin and cohesion molecules to generate a recombinant cellulosome having a desired efficiency or pathway of degrading enzymes provided herein.
[0094] A microorganism (e.g., a yeast) are engineered to express the synthetic cellulosome by constructing a vector containing a scaffoldin domain, a Carbohydrate Binding Domain (CBM), and one or more cellulosic material-degrading enzymes that have been fused with cohesin domains. In one embodiment, a plurality of different recombinant microorganisms are generated each expressing a desired element of a cellulosome. For example, a first recombinant yeast can comprise a polynucleotide encoding a heterologous anchoring protein, a second recombinant yeast comprising a polynucleotide encoding a soluble scaffoldin unit comprising a plurality of cohesion units and a cellulose binding domain, and a third recombinant yeast comprising a polynucleotide encoding an enzyme (e.g., a cellulose or other degradation enzyme) linked to a dockerin subunit. The cells can be recombinant engineered to produce the elements of the cellulosome, wherein a function cellulosome is produced and function in culture.
[0095] The following examples are intended to illustrate but not limit the disclosure. While they are typical of those that might be used, other procedures known to those skilled in the art may alternatively be used.
EXAMPLES
Strains, Plasmids, and Media
[0096] Escherichia coli strain JM109 [endA1 recA1 gyrA96 thi hsdR17 (rK-mK.sup.+) relA1 supE44 Δ(lac-proAB)] was used as the host for genetic manipulations. E. coli BL21(DE3) [F- ompT gal hsdSB (rB-mB-) dcm lon λDE3] was used as the production host for cellulase expression. S. cerevisiae strain EBY100 [MATa AGA1::GAL1-AGA1::URA3 ura3-52 trp1 leu2-1 his3-200 pep4::HIS3 prb1-1.6R can1 GAL] was used for surface display of scaffoldins. All E. coli cultures were grown in Luria-Bertani (LB) medium (10.0 g/liter tryptone, 5.0 g/liter yeast extract, 10.0 g/liter NaCl) supplemented with either 100 μg/ml ampicillin or 50 μg/ml kanamycin. All yeast cultures were grown in SDC medium (20.0 g/liter dextrose, 6.7 g/liter yeast nitrogen base without amino acids, 5.0 g/liter Casamino Acids).
[0097] To display scaffoldins, a gene fragment coding for a scaffoldin containing three cohesins from C. cellulolyticum, C. thermocellum, and R. flavefaciens and one CBD was amplified with plasmid pETscaf6 as the template with forward primer F1NdeI (5'-TATAGCTAGCGGCGATTCTCTTAAAGTTACAGT-3' [the boldface portion is a restriction endonuclease site]) and reverse primer R1SalI (5'-ATATGTCGACGTGGTGGTGGTGGTG-3'). The PCR product was then digested and ligated into the surface display vector pCTCON2 to form pScaf-ctf. Similar procedures, except that the reverse primers were changed to RASalI (5'-ATATGTCGACATCTGACGGCGGTATTGTTGTTG-3') and RBSalI (5'-ATATGTCGACTATATCTCCAACATTTACTCCAC-3'), were used for the construction of pSacf-c and pSacf-ct.
[0098] Plasmids pETEc and pETGf, encoding exoglucanase CelE (Ec) and endoglucanase CelG (Gf) of C. cellulolyticum fused to the dockerins from C. cellulolyticum and R. flavefaciens, respectively. Plasmid pETAt, encoding a His6-tagged endoglucanase (CelA) and a dockerin from C. thermocellum (At), was obtained by PCR from pCelA with forward primer F2NdeI (5'-ATATCATATGGCAGGTGTGCCTTTTAACACAAA-3') and reverse primer R2XhoI (5'-ATATCTCGAGCTAATAAGGTAGGTGGGG-3'). The amplified fragment was cloned into NdeI-XhoI-linearized plasmid pET24a to form pETAt. Plasmid pBglAf, encoding a His6-tagged dockerin from R. flavefaciens fused to a β-glucosidase (BglA) from C. thermocellum, was obtained by two-step cloning. First, a gene fragment coding for the His6-tagged dockerin of R. flavefaciens was obtained from pETGf by digestion with BamHI and XhoI and ligated into pET24a to form pETDf. The gene fragment of BglA was amplified by PCR from pBglA with forward primer F3NdeI (5'-ATATCATATGTCAAAGATAACTTTCCCAAAA-3') and reverse primer R3BglII (5'-ATATAGATCT TTAAAAACCGTTGTTTTTGATTACT-3') and inserted into NdeI-BamHI-linearized pETDf to form pBglAf. A summary of all of the scaffoldins and dockerin-tagged cellulases used in this study is listed in Table 1.
TABLE-US-00001 TABLE 1 Scaffoldins and dockerin-tagged cellulases used in this study Protein name Description (from N terminus to C terminus) Host cell Tag Scaf-c Scaffoldin containing a cohesin from C. cellulolytica followed by a CBD S. cerevisiae c-Myc Scaf-ct Scaffoldin containing a cohesin from C. cellulolytica followed by a CBD S. cerevisiae c-Myc followed by a second cohesin from C. thermocellum Sacf-ctf Scaffoldin containing a cohesin from C. cellulolytica followed by a CBD S. cerevisiae c-Myc followed by a second cohesin from C. thermocellum and a third cohesin from R. flavefaciens At Endoglucanase CelA from C. thermocellum fused with its native dockerin E. coli c-His6 Ec Exoglucanase CelE from C. cellulolytica fused with its native dockerin E. coli c-His6 Gf Endoglucanase CelG from C. cellulolytica fused with a dockerin from E. coli c-His6 R. flavefaciens BglA β-Glucosidase BglA from C. thermocellum fused with a dockerin from E. coli c-His6 R. flavefaciens
[0099] A plasmid coding for a trifunctional scaffoldin (Scaf-ctf (SEQ ID NO:1 and 2) consisting of an internal CBD flanked by three divergent cohesin domains from C. thermocellum (t), C. cellulolyticum (c), and R. flavefaciens (f) (FIG. 3) was created for surface display. To further demonstrate the specificity of the different dockerin-cohesin pairs, two smaller scaffoldins, (i) Scaf-c containing a cohesin domain from C. cellulolyticum followed by a CBD and (ii) Scaf-ct containing an additional cohesin domain from C. thermocellum at the C terminus of the CBD, were generated (FIG. 3). The different scaffoldins were displayed on the yeast cell surface by using the glycosylphosphatidyl-inositol (GPI) anchor linked at the N-terminal side of the scaffoldins. A c-Myc tag was added to the C terminus of each scaffoldin to allow detection with antic-Myc serum.
[0100] Display of Scaffoldins on the Yeast Cell Surface.
[0101] For the display of scaffoldins on the yeast cell surface, yeast cells harboring pScaf-c, pScaf-ct, or pScaf-ctf were precultured in SDC medium for 18 h at 30° C. These precultures were subinoculated into 200 ml SGC medium (20.0 g/liter galactose, 6.7 g/liter yeast nitrogen base without amino acids, 5.0 g/liter Casamino Acids) at an optical density (OD) at 600 nm of 0.1 and grown for 48 h at 20° C.
[0102] Expression and Purification of Dockerin-Tagged Cellulases.
[0103] E. coli strains expressing At, Ec, and Gf were precultured overnight at 37° C. in LB medium supplemented with appropriate antibiotics. The precultures were subinoculated into 200 ml LB medium supplemented with 1.5% glycerol and appropriate antibiotics at an initial OD of 0.01 and incubated at 37° C. until the OD reached 1.5. The cultures were then cooled to 20° C., and isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 200 μM. After 16 h, cells were harvested by centrifugation (3,000×g, 10 min) at 4° C., resuspended in buffer A (50 mM Tris-HCl [pH 8.0], 100 mM NaCl, 10 mM CaCl2), and lysed with a sonicator. The different cellulases were purified with a His-binding resin (Novagen) at 4° C.
[0104] Minicellulosome Assembly on the Yeast Cell Surface.
[0105] To assemble the minicellulosomes, either cell lysates containing dockerin-tagged cellulases or purified cellulases were incubated with yeast cells displaying the scaffoldin for 1 h at 4° C. in buffer A. After incubation, cells were washed and harvested by centrifugation (3,000×g, 10 min) at 4° C. and resuspended in the same buffer for further use.
[0106] Immunofluorescence Microscopy.
[0107] Yeast cells displaying scaffoldins or the minicellulosomes on the surface were harvested by centrifugation, washed with phosphate-buffered saline (PBS; 8 g/liter NaCl, 0.2 g/liter KCl, 1.44 g/liter Na2HPO4, 0.24 g/liter KH2PO4), and resuspended in 250 μl of PBS containing 1 mg/ml bovine serum albumin and 0.5 μg of anti-c-Myc or anti-c-His immunoglobulin G (IgG; Invitrogen) for 4 h with occasional mixing. Cells were then pelleted and washed with PBS before resuspension in PBS plus 1 mg/ml bovine serum albumin and 0.5 μg anti-mouse IgG conjugated with Alexa 488 (Molecular Probes). After incubation for 2 h, cells were pelleted, washed twice with PBS, and resuspended in PBS to an OD at 600 nm of 1. For fluorescence microscopy (Olympus BX51), 5- to 10-_l volumes of cell suspensions were spotted onto slides and a coverslip was added. Images from Alexa 488 were captured with the QCapture Pro6 software. Whole-cell fluorescence was measured with a fluorescence microplate reader (Synergy4; BioTek, VT) at an excitation wavelength of 485 nm and an emission wavelength of 535 nm.
[0108] Enzyme Assays.
[0109] Carboxymethyl cellulose (CMC) was obtained from Sigma and used as a substrate. Phosphoric acid-swollen cellulose (PASC) was prepared from Avicel PH101 (Sigma) according to the method of Walseth (27). Enzyme activity was assayed in the presence of a 0.3% (wt/vol) concentration of cellulose at 30° C. in 20 mM Tris-HCl buffer (pH 6.0). Samples were collected periodically and immediately mixed with 3 ml of DNS reagents (10 g/liter dinitrosalicylic acid, 10 g/liter sodium hydroxide, 2 g/liter phenol, 0.5 g/liter sodium sulfite). After incubation at 95° C. for 10 min, 1 ml of 40% Rochelle salts was added to fix the color before measurement of the absorbance of the supernatants at 575 nm. Glucose concentration was determined with a glucose HK assay kit from Sigma.
[0110] Fermentation.
[0111] Fermentation was conducted anaerobically at 30° C. Briefly, yeast cells were washed once with buffer containing 50 mM Tris-HCl (pH 8.0), 100 mM NaCl, and 10 mM CaCl2 and resuspended in SDC medium containing 6.7 g/liter yeast nitrogen base without amino acids, 20 g/liter Casamino Acids, and 10 g/liter PASC as the carbon source. Reducing sugar production and glucose concentration were measured by the methods described above. The amount of residual cellulose was measured by the phenol-sulfuric acid method as described by Dubois et al. Ethanol concentration was measured with a gas chromatograph (model 6890; Hewlett Packard) with a flame ionization detector and an HP-FFTP column.
[0112] To probe the surface localization of the scaffoldins, immunofluorescent labeling of cells was carried out using anti-c-Myc sera and Alexa Fluor TM 488 conjugated goat anti-mouse IgG (Molecular Probe) and observed under a fluorescence microscope (Olympus America, Inc., San Diego, Calif.). Cells displaying the scaffoldin domains (1, 2, or 3) on the surface were brightly fluorescence (FIG. 2), while no fluorescence was observed for the control yeast cells. These results demonstrate that a synthetic scaffoldin can be successfully displayed on the surface of a heterologous host (e.g., a yeast).
[0113] To test the functionality of the displayed scaffoldins, three different cellulases fused with a corresponding dockerin domain (either c, t, or f) were expressed in E. coli (i.e., an exoglucanase (CelE) from C. cellulolyticum fused to a dockerin domain from the same species (Ec), an endoglucanase (CelG) from C. cellulolyticum fused to a dockerin domain from R. flavefaciens (Gf), and an endoglucanase (CelA) fused to a dockerin domain from C. thermocellum (At) were expressed in E. coli). The plasmids used were: (i) pETEc containing an exoglucanase CelE from C. cellulolytica fused with a dockerin domain from the same species (Ec; see, e.g., SEQ ID NO:3 and 4, Christian Gaudin et al., Journal of Bacteriology, 2000. 182: 1910-1915, incorporated herein by reference); (ii) pETGf containing an endoglucanase CelG from C. cellulolytica fused with a dockerin domain from R. flavefaciens (Gf; see, e.g., SEQ ID NO:5 and 6; Henri-Pierre Fierobe, et al. The Journal of Biological Chemistry. 2005. 280:16325-16334, incorporated herein by reference); and (iii) pETAt containing an endoglucanase CelA fused with a dockerin domain from C. thermocelum (At; see, e.g., SEQ ID NO:7 and 8; Dae-Kyun Chung et al., Biotechnology Letters. 1997, 19:503-506, incorporated herein by reference). A His6 tag was added to the C terminus of each of the dockerin domains for detection of the assembly. Cells displaying scaffoldins on the surface were incubated directly with E. coli cell lysates containing At, Ec, or Gf for 1 h to form the cellulosome complex. The presence of each cellulase-dockerin pair on cells displaying Scaf-ctf was confirmed by immunofluorescence microscopy with the anti-His6 antibody (FIG. 2B).
[0114] To demonstrate the specificity of different cohesin-dockerin pairs, similar experiments were performed with cells displaying either Scaf-ct or Scaf-c. In Scaf-ct-displaying cells, fluorescence was detected only in the presence of Ec or At, whereas incubation with Gf did not result in any detectable fluorescence (FIG. 2C). Similarly, in Scaf-c-displaying cells, fluorescence was only observed in the presence of Ec (FIG. 2D). These results confirm that the specificity of the cohesins is preserved even when they are displayed on the cell surface, as only the corresponding dockerin-tagged enzymes are assembled correctly.
[0115] Functionality of the Displayed Minicellulosomes.
[0116] To demonstrate the functionality of the assembled minicellulosomes, cells expressing Scaf-ctf were first saturated with different combinations of Ec, At, and/or Gf. As depicted in FIG. 3, a similar level of fluorescence was detected from the c-Myc or c-His6 tag when only one dockerin-tagged enzyme was added, indicating the correct 1:1 binding between the cohesin-dockerin pairs. A corresponding increase in fluorescent intensity was observed when an increasing number of enzymes were docked on Scaf-ctf. This result confirms that the correct 1:1 binding ratio of each dockerin-cohesin pair was preserved even when it was assembled into a three-enzyme minicellulosome on the cell surface (FIG. 3).
[0117] Engineered yeast cells docked with different combinations of cellulases were further examined for functionality in cellulose hydrolysis. Cells were resuspended in Tris buffer containing CMC, and the rate of reducing sugar production was determined. As shown in FIG. 4, cells with any one of the three cellulases docked on the surface showed visible differences in cellulose hydrolysis from the control. The endoglucanase At had the highest rate of hydrolysis, followed by Gf and Ec, a trend consistent with the relatively low activity of the exoglucanase CelE on CMC. The rate of CMC hydrolysis increased in an additive fashion when two of the cellulases were docked on the cell surface, and the highest rate of hydrolysis was observed when all three cellulases were assembled. The additive effect on CMC hydrolysis confirms that the recruitment of cellulases to the displayed scafoldin has a very minimum effect on their individual functionality.
[0118] Synergistic Effect of Displayed Minicellulosomes.
[0119] The synergistic effect on cellulose hydrolysis is an intriguing property of naturally occurring cellulosomes. To test whether the synergistic effect of the minicellulosome structure was preserved when displayed on the yeast cell surface, Avicel hydrolysis was compared with that of purified cellulases. In this case, the amount of each cellulase docked on Scaf-ctf was first determined from the binding experiments. These predetermined amounts of cellulases were then mixed together, and the hydrolysis of Avicel with the cellulase mixture was compared with that of whole cells displaying the functional cellulosome containing the same amount of each cellulase. As shown in Table 2, the level of reducing sugar production was consistently higher for cells displaying the cellulosome, confirming that synergy was indeed maintained. The level of synergy increased from 1.62 to 2.44 when the number of cellulases recruited in the minicellulosome system increased from one to three. This result suggests the potential to further enhance cellulose hydrolysis by increasing the number of displayed cellulases.
TABLE-US-00002 TABLE 2 Amounts of reducing sugars released from Avicel after 24 h of incubation at 30° C. either by cells displaying cellulosomes or by the same amount of free enzymesa Amt of reducing sugars (mg/liter) Cellulase released from: Degree of pair(s) Cellulosome Free enzymes synergy At 46.1 28.3 1.62 At + Ec 80.1 37.6 2.13 At + Ec + Gf 132.3 54.2 2.44 aReactions were conducted either with different cellulase pairs (CelE-Dc [Ec], CelA-Dt [At], or CelG-Df [Gf]) docked on the displayed Scaf-ctf or with the corresponding purified cellulases. The degree of synergy is defined as the amount of sugar released from the cellulosome over the amount of sugar released from free enzymes.
[0120] Incorporation of β-Glucosidase into the Minicellulosome.
[0121] Since S. cerevisiae is unable to transport and utilize oligosaccharides, directing the complete hydrolysis of cellulose to glucose is essential. To achieve this goal, a β-glucosidase (BglA) from C. thermocellum tagged with the dockerin from R. flavefaciens was constructed. The resulting dockerin-tagged BglA retained the same specificity and docking efficiency as Gf (FIG. 3). FIG. 5 shows the time course of reducing sugar and glucose released from PASC with different enzyme combinations docked on the cell surface. Although 40% of the PASC was hydrolyzed in the presence of the endoglucanase At, 25% of the reducing sugar was further hydrolyzed to glucose.
[0122] In comparison, the presence of the exoglucanase Ec not only enhanced reducing sugar production but also increased glucose production threefold. The addition of BglA further improved the rate of glucose liberation, although no difference in reducing sugar formation was observed. This result is very significant, as demonstrated, a functional minicellulosome containing all three exoglucanase, endoglucanase, and β-glucosidase activities can be successfully assembled on the surface of a heterologous host cell. The result also confirms a role of β-glucosidase in achieving a higher conversion of cellulose to glucose. The displayed minicellulosome exhibited synergy in both reducing sugar and glucose liberation compared to that of free enzymes.
[0123] Direct Fermentation of Amorphous Cellulose to Ethanol.
[0124] The ability of ethanol fermentation from PASC was examined by using the scaffoldin-displaying strains docked with different cellulases. As shown in FIG. 6, the increase in ethanol production was accompanied by a concomitant decrease in the total sugar concentration. The levels of ethanol production and PASC hydrolysis were directly correlated with the number of cellulases docked on the cell surface. The maximum ethanol production of cells displaying At, Ec, and BglA was 3.5 g/liter after 48 h; this corresponds to 95% of the theoretical ethanol yield, at 0.49 g ethanol/g sugar consumed. Moreover, the glucose concentrations during the fermentation were below the detection limit. This indicates that all of the glucose produced was quickly consumed, resulting in no detectable glucose accumulation in the medium. The level of ethanol production by cells displaying all three cellulases was higher than that of cells displaying only At and Ec, again confirming the importance of β-glucosidase in the overall cellulose-to-ethanol conversion process. More importantly, the synergistic effect of the minicellulosome was also observed, as the ethanol production by a culture with the same amounts of purified At, Ec, and BglA added to the medium was more than threefold lower.
[0125] The feasibility of using secreted cellulases for the direct assembly of functional cellulosome has also been demonstrated. The yeast secretion vector pCEL15 containing the secretion leader sequence MFα1 was used for inserting the gene coding for At. Cells carrying the secretion vector were co-cultured with cells displaying scaff#3 for 24 h. The correct assembly of the secreted At onto the cell surface was again verified by immunofluorescence microscopy. The assembled At remained active as demonstrated by the ability to hydrolyze Avicel. By changing the inoculation densities of the two cultures, different levels of At activity associated with cells and remained in the medium were detected. These results confirm the possibility of fine-tuning the assembly of functional cellulosomes on the cell surface using an engineered consortium of cells performing separate functions.
[0126] Overall, the results demonstrated the successful functional assembly of a mini-cellulosome on the yeast surface. The displayed mini-cellulosomes enable the cells to hydrolyze cellulose and grow using cellulose as the sole carbon source. Moreover, the increased cell growth and reducing sugar production with increasing cellulases docked on the surface indicates the potential to further increase the efficiency of cellulose hydrolysis by increasing the number of displayed cellulases via the use of more complex cellulosome structures.
[0127] A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.
TABLE-US-00003 Sequence of SCAF6 ATGGGCGATTCTCTTAAAGTTACAGTAGGAACAGCTAATGGTAAGCCTGGCGATACAGTAACAGTTCCTGTTAC- AT TTGCTGATGTAGCAAAGATGAAAAACGTAGGAACATGTAATTTCTATCTTGGATATGATGCAAGCCTGTTAGAG- GT AGTATCAGTAGATGCAGGTCCAATAGTTAAGAATGCAGCAGTTAACTTCTCAAGCAGTGCAAGCAACGGAACAA- TC AGCTTCCTGTTCTTGGATAACACAATTACAGACGAATTGATAACTGCAGACGGTGTGTTTGCAAATATTAAGTT- CA AATTAAAGAGTGTAACGGCTAAAACTACAACACCAGTAACATTTAAAGATGGTGGAGCTTTTGGTGACGGAACT- AT GTCAAAGATAGCTTCAGTTACTAAGACAAACGGTAGTGTAACGATCGATCCGACCAAGGGAGCAACACCAACAA- AT ACAGCTACGCCGACAAAATCAGCTACGGCTACGCCCACCAGGCCATCGGTACCGACAAACACACCGACAAACAC- AC CGGCAAATACACCGGTATCAGGCAATTTGAAGGTTGAATTCTACAACAGCAATCCTTCAGATACTACTAACTCA- AT CAATCCTCAGTTCAAGGTTACTAATACCGGAAGCAGTGCAATTGATTTGTCCAAACTCACATTGAGATATTATT- AT ACAGTAGACGGACAGAAAGATCAGACCTTCTGGTGTGACCATGCTGCAATAATCGGCAGTAACGGCAGCTACAA- CG GAATTACTTCAAATGTAAAAGGAACATTTGTAAAAATGAGTTCCTCAACAAATAACGCAGACACCTACCTTGAA- AT AAGCTTTACAGGCGGAACTCTTGAACCGGGTGCACATGTTCAGATACAAGGTAGATTTGCAAAGAATGACTGGA- GT AACTATACACAGTCAAATGACTACTCATTCAAGTCTGCTTCACAGTTTGTTGAATGGGATCAGGTAACAGCATA- CT TGAACGGTGTTCTTGTATGGGGTAAAGAACCCGGTGGCAGTGTAGTACCATCAACACAGCCTGTAACAACACCA- CC TGCAACAACAAAACCACCTGCAACAACAAAACCACCTGCAACAACAATACCGCCGTCAGATGATCCGAATGCAA- TA AAGATTAAGGTGGACACAGTAAATGCAAAACCGGGAGACACAGTAAATATACCTGTAAGATTCAGTGGTATACC- AT CCAAGGGAATAGCAAACTGTGACTTTGTATACAGCTATGACCCGAATGTACTTGAGATAATAGAGATAAAACCG- GG AGAATTGATAGTTGACCCGAATCCTGACAAGAGCTTTGATACTGCAGTATATCCTGACAGAAAGATAATAGTAT- TC CTGTTTGCAGAAGACAGCGGAACAGGAGCGTATGCAATAACTAAAGACGGAGTATTTGCTACGATAGTAGCGAA- AG TAAAATCCGGAGCACCTAACGGACTCAGTGTAATCAAATTTGTAGAAGTAGGCGGATTTGCGAACAATGACCTT- GT AGAACAGAGGACACAGTTCTTTGACGGTGGAGTAAATGTTGGAGATATAGGATCCGCCGGTGGTTTATCCGCTG- TG CAGCCTAATGTTAGTTTAGGCGAAGTACTGGATGTTTCTGCTAACAGAACCGCTGCTGACGGAACAGTTGAATG- GC TTATCCCAACAGTAACTGCAGCTCCAGGCCAGACGGTCACTATGCCCGTAGTAGTCAAGAGTTCAAGTCTTGCA- GT TGCTGGTGCGCAGTTCAAGATCCAGGCGGCGACAGGCGTAAGTTATTCGTCCAAGACGGACGGTGACGCTTACG- GT TCAGGCATTGTGTACAATAATAGTAAGTATGCTTTTGGACAGGGTGCAGGTAGAGGAATAGTTGCAGCTGATGA- TT CGGTTGTGCTTACTCTTGCATATACAGTTCCCGCTGATTGTGCTGAAGGTACATATGATGTCAAGTGGTCTGAT- GC GTTTGTAAGTGATACAGACGGACAGAATATCACAAGTAAGGTTACTCTTACTGATGGCGCTATCATTGTTAAGT- AG Sequence of Ec ATGCTTGTTGGGGCAGGAGATTTGATTCGAAACCATACCTTTGACAACAGAGTAGGTCTTCCATGGCACGTGGT- TG AATCATACCCTGCAAAGGCAAGTTTTGAAATTACATCTGATGGTAAGTACAAGATAACTGCTCAAAAGATCGGT- GA GGCAGGAAAAGGTGAAAGATGGGATATACAATTCCGTCACAGAGGACTCGCATTGCAACAAGGTCATACTTATA- CA GTAAAGTTTACTGTTACTGCTAGCAGAGCTTGTAAAATTTATCCTAAAATAGGTGACCAGGGTGATCCATATGA- TG AATACTGGAATATGAATCAACAATGGAATTTCCTGGAATTACAGGCTAATACTCCAAAAACTGTAACTCAGACA- TT TACACAGACTAAGGGAGATAAGAAGAACGTTGAATTTGCTTTTCACCTTGCTCCCGATAAAACTACATCTGAGG- CA CAGAATCCAGCAAGTTTCCAACCTATAACATATACTTTTGATGAAATTTATATTCAGGACCCTCAATTTGCAGG- AT ATACTGAAGATCCACCTGAACCTACTAATGTTGTACGTTTGAATCAGGTAGGTTTCTATCCTAATGCTGATAAG- AT TGCAACAGTAGCAACAAGTTCAACAACTCCAATTAACTGGCAGTTGGTTAATAGTACTGGAGCAGCTGTTTTAA- CA GGTAAATCAACTGTTAAAGGTGCCGACCGTGCATCAGGTGATAATGTCCATATCATTGATTTCTCTAGTTACAC- AA CACCTGGTACCGACTATAAGATAGTAACAGATGTATCAGTAACAAAAGCCGGAGACAATGAAAGTATGAAGTTC- AA TATTGGAGATGACCTTTTTACTCAAATGAAATACGATTCAATGAAGTATTTCTATCACAACAGAAGTGCTATTC- CA ATACAAATGCCATACTGTGATCAATCACAATGGGCACGTCCTGCAGGACACACAACTGATATACTTGCTCCAGA- TC CAACAAAGGATTACAAGGCTAACTACACACTTGACGTTACAGGTGGTTGGTATGATGCCGGTGACCATGGTAAG- TA TGTTGTTAATGGTGGTATTGCAACCTGGACCGTAATGAATGCATATGAGCGTGCACTACACATGGGTGGAGACA- CT TCAGTTGCTCCATTTAAAGACGGTTCTTTAGCAATACCAGAAGCGGAAGTCTATCCTGACATACTGGACGAAGC- TC GTTACCAGCTCATTAACATGAAAACATTATTAAATAGTCAGGTTCCAGCAGGAAAGTATGCGGGTATGGCTCAC- CA CAAAGCTCATGACGAACGTTGGACAGCTCTTGCTGTACGTCCCGACCAGGATACAATGAAACGTTGGTTGCAGC- CT CCAAGTACAGCAGCTACATTAAATCTGGCTGCTATTGCTGCACAAAGTTCACGTCTTTGGAAACAGTTTGATTC- TG CTTTCGCAACTAAGTGTTTAACTGCAGCAGAAACTGCTAGGGATGCAGCTGTAGCTCATCCAGAAATATATGCA- AC TATGGAACAGGGTGCCGGTGGTGGAGCATACGGAGACAACTATGTTCTTGATGATTTCTACTGGGCAGCATGTG- AA TTGTATGCAACTACAGGCAGTGACAAGTATTTGAACTACATAAAGAGCTCAAAGCATTATCTCGAAATGCCTAC- AG AATTAACAGGCGGTGAGAATACTGGAATTACAGGGGCTTTTGACTGGGGTTGTACAGCAGGTATGGGAACAATA- AC ACTTGCACTTGTACCTACAAAGCTTCCGGCAGCAGATGTTGCTACAGCTAAAGCTAATATTCAAGCTGCAGCTG- AT AAGTTCATATCAATTTCAAAAGCACAAGGCTATGGTGTACCACTAGAAGAAAAAGTAATTTCATCTCCTTTTGA- TG CATCTGTTGTTAAAGGTTTCCAATGGGGATCAAACTCATTCGTTATTAATGAAGCAATAGTTATGTCATATGCT- TA TGAATTCAGCGATGTTAATGGCACAAAGAATAATAAATATATTAATGGTGCTTTAACAGCAATGGATTACCTCC- TC GGACGTAACCCAAATATTCAAAGCTATATAACTGGTTATGGTGACAACCCACTTGAAAATCCTCATCACCGTTT- CT GGGCATACCAGGCAGACAACACATTCCCAAAACCACCTCCGGGATGTCTGTCAGGAGGACCTAACTCCGGCTTG- CA GGATCCTTGGGTTAAGGGTTCAGGCTGGCAGCCAGGTGAAAGACCTGCTGAAAAATGCTTCATGGACAATATTG- AA TCTTGGTCAACAAACGAAATAACCATCAACTGGAATGCTCCTCTTGTATGGATATCAGCTTACCTTGATGAAAA- GG GGCCAGAGATTGGTGGGTCAGTGACTCCTCCAACTAATTTAGGAGATGTTAACGGCGATGGAAACAAGGATGCA- TT GGACTTCGCTGCATTGAAGAAAGCCTTGTTAAGCCAGGATACTTCTACTATAAATGTTGCTAATGCTGATATAA- AC AAAGATGGTTCTATTGATGCAGTTGACTTTGCATTACTCAAATCATTCTTGTTAGGAAAAATCACACAGTGA Sequence of Gf ATGGGAACATATAACTATGGAGAAGCATTACAGAAATCAATAATGTTCTATGAATTCCAGCGTTCGGGAGATCT- TC CGGCTGATAAACGTGACAACTGGAGAGACGATTCCGGTATGAAAGACGGTTCTGATGTAGGAGTTGATCTTACA- GG AGGATGGTACGATGCAGGTGACCATGTGAAATTTAATCTACCTATGTCATATACATCTGCAATGCTTGCATGGT- CC TTATATGAGGATAAGGATGCTTATGATAAGAGCGGTCAGACAAAATATATAATGGACGGTATAAAATGGGCTAA- TG ATTATTTTATTAAATGTAATCCGACACCCGGTGTATATTATTACCAAGTAGGAGACGGCGGAAAGGACCACTCT- TG GTGGGGCCCTGCGGAAGTAATGCAGATGGAAAGACCGTCTTTTAAGGTTGACGCTTCTAAGCCCGGTTCTGCAG- TA TGTGCTTCCACTGCAGCTTCTCTGGCATCTGCAGCAGTAGTCTTTAAATCCAGTGATCCTACTTATGCAGAAAA- GT GCATAAGCCATGCAAAGAACCTGTTTGATATGGCTGACAAAGCAAAGAGTGATGCTGGTTATACTGCGGCTTCA- GG CTACTACAGCTCAAGCTCATTTTACGATGATCTCTCATGGGCTGCAGTATGGTTATATCTTGCTACAAATGACA- GT ACATATTTAGACAAAGCAGAATCCTATGTACCGAATTGGGGTAAAGAACAGCAGACAGATATTATCGCCTACAA- GT GGGGACAGTGCTGGGATGATGTTCATTATGGTGCTGAGCTTCTTCTTGCAAAGCTTACAAACAAACAATTGTAT- AA GGATAGTATAGAAATGAACCTTGACTTCTGGACAACTGGTGTTAACGGAACACGTGTTTCTTACACGCCAAAGG- GT TTGGCGTGGCTATTCCAATGGGGTTCATTAAGACATGCTACAACTCAGGCTTTTTTAGCCGGTGTTTATGCAGA- GT GGGAAGGCTGTACGCCATCCAAAGTATCTGTATATAAGGATTTCCTCAAGAGTCAAATTGATTATGCACTTGGC- AG TACCGGAAGAAGTTTTGTTGTCGGATATGGAGTAAATCCTCCTCAACATCCTCATCACAGAACTGCTCACGGTT- CA TGGACAGATCAAATGACTTCACCAACATACCACAGGCATACTATTTATGGTGCGTTGGTAGGAGGACCGGATAA- TG CAGATGGCTATACTGATGAAATAAACAATTATGTCAATAATGAAATAGCCTGCGATTATAATGCCGGATTTACA- GG TGCACTTGCAAAAATGTACAAGCATTCTGGCGGAGATCCGATTCCAAACTTCAAGGCTATCGAAAAAATAACCA- AC GATGAAGTTATTATAAAGGCAGGTTTGAATTCAACTGGCCCTAACTACACTGAAATCAAGGCTGTTGTTTATAA- CC AGACAGGATGGCCTGCAAGAGTTACCGACAAGATATCATTTAAATATTTTATGGACTTGTCTGAAATTGTACCA- GC AGGAATTGATCCTTTAAGCCTTGTAACAACTTCAAATTATTCTGAAGGTAAGAATACTAAGGTTTCCGGTGTGT- TG CCATGGGATGTTTCAAATAATGTTTACTATGTAAATGTTGATTTGACAGGAGAAAATATCTACCCAGGCGGTCA- GT
CTGCGTGCAGACGAGAACTTCACTTCAGAATTGCCGCACCACAGGGAAGAAGATATTGGAATCCGAAAAATGAT- TT CTCATATGATGGATTACCAACCACCAGTACTGTAAATACCGTTACCAACATACCTGTTTATGATAACCGCGTAA- AA GTATTTGGTAACGAACCCGCAGGTGGATCAGAACCCGCCACAAAGCTCGTTCCTACATGGGGCGATACAAACTG- CG ACCGCGTTGTAAATGTTGCTGACGTAGTACTTCTTAACAGATTCCTCAACGATCCTACATATTCTAACATTACT- GA TCAGGGTAAGGTTAACGCAGACCTTGTTGATCCTCAGGATAAGTCCGGCGCACCAGTTGATCCTGCAGGCGTAA- AG CTCACAGTAGCTGACTCTGAGGCAATCCTCAAGGCTATCGTTGAACTCATCACACTTCCTCAATGA Sequence of At ATGGCAGGTGTGCCTTTTAACACAAAATACCCCTATGGTCCTACTTCTATTGCCGATAATCAGTCGGAAGTAAC- TG CAATGCTCAAACCAGAATGGGAAGACTGGAAGACCAAGAGAATTACCTCGAACCGTGCAGGAGGATACAAGAGA- GT ACACCGTGATGCTTCCACCAATTATGATACCGTATCCGAAGGTATGGGATACCGACTTCTTTTGGCGGTTTGCT- TT AACGAACAGGCTTTGTTTGACGATTTATACCGTTACGTAAAATCTCATTTCAATGGAAACCGACTTATGCACTG- GC ACATTGATGCCAACAACAATGTTACAAGTCATGACCGCGGCGACCGTGCGGCAACCGATGCTGATGAGGATATT- GC ACTTGCGCTCATATTTGCGGACAAGTTATGGGGTTCTTCCGCTGCAATAAACTACCGCCAGGAACCAAGGACAT- TG ATAAACAATCTTTACAACCATTGTGTAGACCATGGATCCTATGTATTAAAGCCCGGTGACAGATGGGGAGGTTC- AT CAGTAACAAACCCGTCATATTTTGCGCCTGCATGGTACAAAGTGTATGCTCAATATACAGGAGACACAAGATGG- AA TCAAGTGGCGGACAAGTGTTACCAAATTGTTGAAGAAGTTAAGAAATACAACAACCGAACCGGCCTTGTTCCTG- AC TGGTGTACTGCAACCGGAACTCCGCCAACCGGTCAGAGTTACGACTACAAATATGATGCTACACGTTACCGCTG- GA GAACTGCCGTGGACTATTCATGGTTTGGTGACCAGAGACCAAAGGCAAACTGCGATATGCTGACCAAATTCTTT- GC CAGAGACCGGGCAAAAGGAATCGTTGACCGATACACAATTCAAGGTTCAAAAATTACCAACAATCACAACGCAT- CA ITTATAGGACCTGTTGCGCCACCAAGTATGACAGGTTACGATTTGAACTTTGCAAAGGAACTTTATAGGGAGAC- TG TTGCTGTAAAGGACAGTGAATATTACCGATATTACCGAAACACCTTGAGACTGCTCACTTTGTTGTACATAACA- GG AAACTTCCCGAATCCTTTGAGTGACCTTTCCGGCCAACCGACACCACCGTCGAATCCGACACCTTCATTGCCTC- CT CAGGTTGTTTACCGTGATGTAAATGGCGACCGTAATGTTAACTCCACTGATTTGACTATGTTAAAAAGATATCT- GC TGAAGAGTGTTACCAATATAAACAGAGAGGCTGCAGACGTTAATCGTGACCGTGCGATTAACTCCTCTGACATG- AC TATATTAAAGAGATATCTGATAAAGACCATACCCCACCTACCTTATTAG
Sequence CWU
1
1
812052DNAArtificial SequenceRecombinant scaffoldin polypeptide 1atg ggc
gat tct ctt aaa gtt aca gta gga aca gct aat ggt aag cct 48Met Gly
Asp Ser Leu Lys Val Thr Val Gly Thr Ala Asn Gly Lys Pro 1
5 10 15 ggc gat aca
gta aca gtt cct gtt aca ttt gct gat gta gca aag atg 96Gly Asp Thr
Val Thr Val Pro Val Thr Phe Ala Asp Val Ala Lys Met
20 25 30 aaa aac gta
gga aca tgt aat ttc tat ctt gga tat gat gca agc ctg 144Lys Asn Val
Gly Thr Cys Asn Phe Tyr Leu Gly Tyr Asp Ala Ser Leu 35
40 45 tta gag gta gta
tca gta gat gca ggt cca ata gtt aag aat gca gca 192Leu Glu Val Val
Ser Val Asp Ala Gly Pro Ile Val Lys Asn Ala Ala 50
55 60 gtt aac ttc tca agc
agt gca agc aac gga aca atc agc ttc ctg ttc 240Val Asn Phe Ser Ser
Ser Ala Ser Asn Gly Thr Ile Ser Phe Leu Phe 65
70 75 80 ttg gat aac aca att
aca gac gaa ttg ata act gca gac ggt gtg ttt 288Leu Asp Asn Thr Ile
Thr Asp Glu Leu Ile Thr Ala Asp Gly Val Phe 85
90 95 gca aat att aag ttc aaa
tta aag agt gta acg gct aaa act aca aca 336Ala Asn Ile Lys Phe Lys
Leu Lys Ser Val Thr Ala Lys Thr Thr Thr 100
105 110 cca gta aca ttt aaa gat ggt
gga gct ttt ggt gac gga act atg tca 384Pro Val Thr Phe Lys Asp Gly
Gly Ala Phe Gly Asp Gly Thr Met Ser 115
120 125 aag ata gct tca gtt act aag
aca aac ggt agt gta acg atc gat ccg 432Lys Ile Ala Ser Val Thr Lys
Thr Asn Gly Ser Val Thr Ile Asp Pro 130 135
140 acc aag gga gca aca cca aca aat
aca gct acg ccg aca aaa tca gct 480Thr Lys Gly Ala Thr Pro Thr Asn
Thr Ala Thr Pro Thr Lys Ser Ala 145 150
155 160 acg gct acg ccc acc agg cca tcg gta
ccg aca aac aca ccg aca aac 528Thr Ala Thr Pro Thr Arg Pro Ser Val
Pro Thr Asn Thr Pro Thr Asn 165
170 175 aca ccg gca aat aca ccg gta tca ggc
aat ttg aag gtt gaa ttc tac 576Thr Pro Ala Asn Thr Pro Val Ser Gly
Asn Leu Lys Val Glu Phe Tyr 180 185
190 aac agc aat cct tca gat act act aac tca
atc aat cct cag ttc aag 624Asn Ser Asn Pro Ser Asp Thr Thr Asn Ser
Ile Asn Pro Gln Phe Lys 195 200
205 gtt act aat acc gga agc agt gca att gat ttg
tcc aaa ctc aca ttg 672Val Thr Asn Thr Gly Ser Ser Ala Ile Asp Leu
Ser Lys Leu Thr Leu 210 215
220 aga tat tat tat aca gta gac gga cag aaa gat
cag acc ttc tgg tgt 720Arg Tyr Tyr Tyr Thr Val Asp Gly Gln Lys Asp
Gln Thr Phe Trp Cys 225 230 235
240 gac cat gct gca ata atc ggc agt aac ggc agc tac
aac gga att act 768Asp His Ala Ala Ile Ile Gly Ser Asn Gly Ser Tyr
Asn Gly Ile Thr 245 250
255 tca aat gta aaa gga aca ttt gta aaa atg agt tcc tca
aca aat aac 816Ser Asn Val Lys Gly Thr Phe Val Lys Met Ser Ser Ser
Thr Asn Asn 260 265
270 gca gac acc tac ctt gaa ata agc ttt aca ggc gga act
ctt gaa ccg 864Ala Asp Thr Tyr Leu Glu Ile Ser Phe Thr Gly Gly Thr
Leu Glu Pro 275 280 285
ggt gca cat gtt cag ata caa ggt aga ttt gca aag aat gac
tgg agt 912Gly Ala His Val Gln Ile Gln Gly Arg Phe Ala Lys Asn Asp
Trp Ser 290 295 300
aac tat aca cag tca aat gac tac tca ttc aag tct gct tca cag
ttt 960Asn Tyr Thr Gln Ser Asn Asp Tyr Ser Phe Lys Ser Ala Ser Gln
Phe 305 310 315
320 gtt gaa tgg gat cag gta aca gca tac ttg aac ggt gtt ctt gta
tgg 1008Val Glu Trp Asp Gln Val Thr Ala Tyr Leu Asn Gly Val Leu Val
Trp 325 330 335
ggt aaa gaa ccc ggt ggc agt gta gta cca tca aca cag cct gta aca
1056Gly Lys Glu Pro Gly Gly Ser Val Val Pro Ser Thr Gln Pro Val Thr
340 345 350
aca cca cct gca aca aca aaa cca cct gca aca aca aaa cca cct gca
1104Thr Pro Pro Ala Thr Thr Lys Pro Pro Ala Thr Thr Lys Pro Pro Ala
355 360 365
aca aca ata ccg ccg tca gat gat ccg aat gca ata aag att aag gtg
1152Thr Thr Ile Pro Pro Ser Asp Asp Pro Asn Ala Ile Lys Ile Lys Val
370 375 380
gac aca gta aat gca aaa ccg gga gac aca gta aat ata cct gta aga
1200Asp Thr Val Asn Ala Lys Pro Gly Asp Thr Val Asn Ile Pro Val Arg
385 390 395 400
ttc agt ggt ata cca tcc aag gga ata gca aac tgt gac ttt gta tac
1248Phe Ser Gly Ile Pro Ser Lys Gly Ile Ala Asn Cys Asp Phe Val Tyr
405 410 415
agc tat gac ccg aat gta ctt gag ata ata gag ata aaa ccg gga gaa
1296Ser Tyr Asp Pro Asn Val Leu Glu Ile Ile Glu Ile Lys Pro Gly Glu
420 425 430
ttg ata gtt gac ccg aat cct gac aag agc ttt gat act gca gta tat
1344Leu Ile Val Asp Pro Asn Pro Asp Lys Ser Phe Asp Thr Ala Val Tyr
435 440 445
cct gac aga aag ata ata gta ttc ctg ttt gca gaa gac agc gga aca
1392Pro Asp Arg Lys Ile Ile Val Phe Leu Phe Ala Glu Asp Ser Gly Thr
450 455 460
gga gcg tat gca ata act aaa gac gga gta ttt gct acg ata gta gcg
1440Gly Ala Tyr Ala Ile Thr Lys Asp Gly Val Phe Ala Thr Ile Val Ala
465 470 475 480
aaa gta aaa tcc gga gca cct aac gga ctc agt gta atc aaa ttt gta
1488Lys Val Lys Ser Gly Ala Pro Asn Gly Leu Ser Val Ile Lys Phe Val
485 490 495
gaa gta ggc gga ttt gcg aac aat gac ctt gta gaa cag agg aca cag
1536Glu Val Gly Gly Phe Ala Asn Asn Asp Leu Val Glu Gln Arg Thr Gln
500 505 510
ttc ttt gac ggt gga gta aat gtt gga gat ata gga tcc gcc ggt ggt
1584Phe Phe Asp Gly Gly Val Asn Val Gly Asp Ile Gly Ser Ala Gly Gly
515 520 525
tta tcc gct gtg cag cct aat gtt agt tta ggc gaa gta ctg gat gtt
1632Leu Ser Ala Val Gln Pro Asn Val Ser Leu Gly Glu Val Leu Asp Val
530 535 540
tct gct aac aga acc gct gct gac gga aca gtt gaa tgg ctt atc cca
1680Ser Ala Asn Arg Thr Ala Ala Asp Gly Thr Val Glu Trp Leu Ile Pro
545 550 555 560
aca gta act gca gct cca ggc cag acg gtc act atg ccc gta gta gtc
1728Thr Val Thr Ala Ala Pro Gly Gln Thr Val Thr Met Pro Val Val Val
565 570 575
aag agt tca agt ctt gca gtt gct ggt gcg cag ttc aag atc cag gcg
1776Lys Ser Ser Ser Leu Ala Val Ala Gly Ala Gln Phe Lys Ile Gln Ala
580 585 590
gcg aca ggc gta agt tat tcg tcc aag acg gac ggt gac gct tac ggt
1824Ala Thr Gly Val Ser Tyr Ser Ser Lys Thr Asp Gly Asp Ala Tyr Gly
595 600 605
tca ggc att gtg tac aat aat agt aag tat gct ttt gga cag ggt gca
1872Ser Gly Ile Val Tyr Asn Asn Ser Lys Tyr Ala Phe Gly Gln Gly Ala
610 615 620
ggt aga gga ata gtt gca gct gat gat tcg gtt gtg ctt act ctt gca
1920Gly Arg Gly Ile Val Ala Ala Asp Asp Ser Val Val Leu Thr Leu Ala
625 630 635 640
tat aca gtt ccc gct gat tgt gct gaa ggt aca tat gat gtc aag tgg
1968Tyr Thr Val Pro Ala Asp Cys Ala Glu Gly Thr Tyr Asp Val Lys Trp
645 650 655
tct gat gcg ttt gta agt gat aca gac gga cag aat atc aca agt aag
2016Ser Asp Ala Phe Val Ser Asp Thr Asp Gly Gln Asn Ile Thr Ser Lys
660 665 670
gtt act ctt act gat ggc gct atc att gtt aag tag
2052Val Thr Leu Thr Asp Gly Ala Ile Ile Val Lys
675 680
2683PRTArtificial SequenceSynthetic Construct 2Met Gly Asp Ser Leu Lys
Val Thr Val Gly Thr Ala Asn Gly Lys Pro 1 5
10 15 Gly Asp Thr Val Thr Val Pro Val Thr Phe Ala
Asp Val Ala Lys Met 20 25
30 Lys Asn Val Gly Thr Cys Asn Phe Tyr Leu Gly Tyr Asp Ala Ser
Leu 35 40 45 Leu
Glu Val Val Ser Val Asp Ala Gly Pro Ile Val Lys Asn Ala Ala 50
55 60 Val Asn Phe Ser Ser Ser
Ala Ser Asn Gly Thr Ile Ser Phe Leu Phe 65 70
75 80 Leu Asp Asn Thr Ile Thr Asp Glu Leu Ile Thr
Ala Asp Gly Val Phe 85 90
95 Ala Asn Ile Lys Phe Lys Leu Lys Ser Val Thr Ala Lys Thr Thr Thr
100 105 110 Pro Val
Thr Phe Lys Asp Gly Gly Ala Phe Gly Asp Gly Thr Met Ser 115
120 125 Lys Ile Ala Ser Val Thr Lys
Thr Asn Gly Ser Val Thr Ile Asp Pro 130 135
140 Thr Lys Gly Ala Thr Pro Thr Asn Thr Ala Thr Pro
Thr Lys Ser Ala 145 150 155
160 Thr Ala Thr Pro Thr Arg Pro Ser Val Pro Thr Asn Thr Pro Thr Asn
165 170 175 Thr Pro Ala
Asn Thr Pro Val Ser Gly Asn Leu Lys Val Glu Phe Tyr 180
185 190 Asn Ser Asn Pro Ser Asp Thr Thr
Asn Ser Ile Asn Pro Gln Phe Lys 195 200
205 Val Thr Asn Thr Gly Ser Ser Ala Ile Asp Leu Ser Lys
Leu Thr Leu 210 215 220
Arg Tyr Tyr Tyr Thr Val Asp Gly Gln Lys Asp Gln Thr Phe Trp Cys 225
230 235 240 Asp His Ala Ala
Ile Ile Gly Ser Asn Gly Ser Tyr Asn Gly Ile Thr 245
250 255 Ser Asn Val Lys Gly Thr Phe Val Lys
Met Ser Ser Ser Thr Asn Asn 260 265
270 Ala Asp Thr Tyr Leu Glu Ile Ser Phe Thr Gly Gly Thr Leu
Glu Pro 275 280 285
Gly Ala His Val Gln Ile Gln Gly Arg Phe Ala Lys Asn Asp Trp Ser 290
295 300 Asn Tyr Thr Gln Ser
Asn Asp Tyr Ser Phe Lys Ser Ala Ser Gln Phe 305 310
315 320 Val Glu Trp Asp Gln Val Thr Ala Tyr Leu
Asn Gly Val Leu Val Trp 325 330
335 Gly Lys Glu Pro Gly Gly Ser Val Val Pro Ser Thr Gln Pro Val
Thr 340 345 350 Thr
Pro Pro Ala Thr Thr Lys Pro Pro Ala Thr Thr Lys Pro Pro Ala 355
360 365 Thr Thr Ile Pro Pro Ser
Asp Asp Pro Asn Ala Ile Lys Ile Lys Val 370 375
380 Asp Thr Val Asn Ala Lys Pro Gly Asp Thr Val
Asn Ile Pro Val Arg 385 390 395
400 Phe Ser Gly Ile Pro Ser Lys Gly Ile Ala Asn Cys Asp Phe Val Tyr
405 410 415 Ser Tyr
Asp Pro Asn Val Leu Glu Ile Ile Glu Ile Lys Pro Gly Glu 420
425 430 Leu Ile Val Asp Pro Asn Pro
Asp Lys Ser Phe Asp Thr Ala Val Tyr 435 440
445 Pro Asp Arg Lys Ile Ile Val Phe Leu Phe Ala Glu
Asp Ser Gly Thr 450 455 460
Gly Ala Tyr Ala Ile Thr Lys Asp Gly Val Phe Ala Thr Ile Val Ala 465
470 475 480 Lys Val Lys
Ser Gly Ala Pro Asn Gly Leu Ser Val Ile Lys Phe Val 485
490 495 Glu Val Gly Gly Phe Ala Asn Asn
Asp Leu Val Glu Gln Arg Thr Gln 500 505
510 Phe Phe Asp Gly Gly Val Asn Val Gly Asp Ile Gly Ser
Ala Gly Gly 515 520 525
Leu Ser Ala Val Gln Pro Asn Val Ser Leu Gly Glu Val Leu Asp Val 530
535 540 Ser Ala Asn Arg
Thr Ala Ala Asp Gly Thr Val Glu Trp Leu Ile Pro 545 550
555 560 Thr Val Thr Ala Ala Pro Gly Gln Thr
Val Thr Met Pro Val Val Val 565 570
575 Lys Ser Ser Ser Leu Ala Val Ala Gly Ala Gln Phe Lys Ile
Gln Ala 580 585 590
Ala Thr Gly Val Ser Tyr Ser Ser Lys Thr Asp Gly Asp Ala Tyr Gly
595 600 605 Ser Gly Ile Val
Tyr Asn Asn Ser Lys Tyr Ala Phe Gly Gln Gly Ala 610
615 620 Gly Arg Gly Ile Val Ala Ala Asp
Asp Ser Val Val Leu Thr Leu Ala 625 630
635 640 Tyr Thr Val Pro Ala Asp Cys Ala Glu Gly Thr Tyr
Asp Val Lys Trp 645 650
655 Ser Asp Ala Phe Val Ser Asp Thr Asp Gly Gln Asn Ile Thr Ser Lys
660 665 670 Val Thr Leu
Thr Asp Gly Ala Ile Ile Val Lys 675 680
32580DNAC. cellulolyticaCDS(1)..(2580) 3atg ctt gtt ggg gca gga gat ttg
att cga aac cat acc ttt gac aac 48Met Leu Val Gly Ala Gly Asp Leu
Ile Arg Asn His Thr Phe Asp Asn 1 5
10 15 aga gta ggt ctt cca tgg cac gtg gtt
gaa tca tac cct gca aag gca 96Arg Val Gly Leu Pro Trp His Val Val
Glu Ser Tyr Pro Ala Lys Ala 20 25
30 agt ttt gaa att aca tct gat ggt aag tac
aag ata act gct caa aag 144Ser Phe Glu Ile Thr Ser Asp Gly Lys Tyr
Lys Ile Thr Ala Gln Lys 35 40
45 atc ggt gag gca gga aaa ggt gaa aga tgg gat
ata caa ttc cgt cac 192Ile Gly Glu Ala Gly Lys Gly Glu Arg Trp Asp
Ile Gln Phe Arg His 50 55
60 aga gga ctc gca ttg caa caa ggt cat act tat
aca gta aag ttt act 240Arg Gly Leu Ala Leu Gln Gln Gly His Thr Tyr
Thr Val Lys Phe Thr 65 70 75
80 gtt act gct agc aga gct tgt aaa att tat cct aaa
ata ggt gac cag 288Val Thr Ala Ser Arg Ala Cys Lys Ile Tyr Pro Lys
Ile Gly Asp Gln 85 90
95 ggt gat cca tat gat gaa tac tgg aat atg aat caa caa
tgg aat ttc 336Gly Asp Pro Tyr Asp Glu Tyr Trp Asn Met Asn Gln Gln
Trp Asn Phe 100 105
110 ctg gaa tta cag gct aat act cca aaa act gta act cag
aca ttt aca 384Leu Glu Leu Gln Ala Asn Thr Pro Lys Thr Val Thr Gln
Thr Phe Thr 115 120 125
cag act aag gga gat aag aag aac gtt gaa ttt gct ttt cac
ctt gct 432Gln Thr Lys Gly Asp Lys Lys Asn Val Glu Phe Ala Phe His
Leu Ala 130 135 140
ccc gat aaa act aca tct gag gca cag aat cca gca agt ttc caa
cct 480Pro Asp Lys Thr Thr Ser Glu Ala Gln Asn Pro Ala Ser Phe Gln
Pro 145 150 155
160 ata aca tat act ttt gat gaa att tat att cag gac cct caa ttt
gca 528Ile Thr Tyr Thr Phe Asp Glu Ile Tyr Ile Gln Asp Pro Gln Phe
Ala 165 170 175
gga tat act gaa gat cca cct gaa cct act aat gtt gta cgt ttg aat
576Gly Tyr Thr Glu Asp Pro Pro Glu Pro Thr Asn Val Val Arg Leu Asn
180 185 190
cag gta ggt ttc tat cct aat gct gat aag att gca aca gta gca aca
624Gln Val Gly Phe Tyr Pro Asn Ala Asp Lys Ile Ala Thr Val Ala Thr
195 200 205
agt tca aca act cca att aac tgg cag ttg gtt aat agt act gga gca
672Ser Ser Thr Thr Pro Ile Asn Trp Gln Leu Val Asn Ser Thr Gly Ala
210 215 220
gct gtt tta aca ggt aaa tca act gtt aaa ggt gcc gac cgt gca tca
720Ala Val Leu Thr Gly Lys Ser Thr Val Lys Gly Ala Asp Arg Ala Ser
225 230 235 240
ggt gat aat gtc cat atc att gat ttc tct agt tac aca aca cct ggt
768Gly Asp Asn Val His Ile Ile Asp Phe Ser Ser Tyr Thr Thr Pro Gly
245 250 255
acc gac tat aag ata gta aca gat gta tca gta aca aaa gcc gga gac
816Thr Asp Tyr Lys Ile Val Thr Asp Val Ser Val Thr Lys Ala Gly Asp
260 265 270
aat gaa agt atg aag ttc aat att gga gat gac ctt ttt act caa atg
864Asn Glu Ser Met Lys Phe Asn Ile Gly Asp Asp Leu Phe Thr Gln Met
275 280 285
aaa tac gat tca atg aag tat ttc tat cac aac aga agt gct att cca
912Lys Tyr Asp Ser Met Lys Tyr Phe Tyr His Asn Arg Ser Ala Ile Pro
290 295 300
ata caa atg cca tac tgt gat caa tca caa tgg gca cgt cct gca gga
960Ile Gln Met Pro Tyr Cys Asp Gln Ser Gln Trp Ala Arg Pro Ala Gly
305 310 315 320
cac aca act gat ata ctt gct cca gat cca aca aag gat tac aag gct
1008His Thr Thr Asp Ile Leu Ala Pro Asp Pro Thr Lys Asp Tyr Lys Ala
325 330 335
aac tac aca ctt gac gtt aca ggt ggt tgg tat gat gcc ggt gac cat
1056Asn Tyr Thr Leu Asp Val Thr Gly Gly Trp Tyr Asp Ala Gly Asp His
340 345 350
ggt aag tat gtt gtt aat ggt ggt att gca acc tgg acc gta atg aat
1104Gly Lys Tyr Val Val Asn Gly Gly Ile Ala Thr Trp Thr Val Met Asn
355 360 365
gca tat gag cgt gca cta cac atg ggt gga gac act tca gtt gct cca
1152Ala Tyr Glu Arg Ala Leu His Met Gly Gly Asp Thr Ser Val Ala Pro
370 375 380
ttt aaa gac ggt tct tta gca ata cca gaa gcg gaa gtc tat cct gac
1200Phe Lys Asp Gly Ser Leu Ala Ile Pro Glu Ala Glu Val Tyr Pro Asp
385 390 395 400
ata ctg gac gaa gct cgt tac cag ctc att aac atg aaa aca tta tta
1248Ile Leu Asp Glu Ala Arg Tyr Gln Leu Ile Asn Met Lys Thr Leu Leu
405 410 415
aat agt cag gtt cca gca gga aag tat gcg ggt atg gct cac cac aaa
1296Asn Ser Gln Val Pro Ala Gly Lys Tyr Ala Gly Met Ala His His Lys
420 425 430
gct cat gac gaa cgt tgg aca gct ctt gct gta cgt ccc gac cag gat
1344Ala His Asp Glu Arg Trp Thr Ala Leu Ala Val Arg Pro Asp Gln Asp
435 440 445
aca atg aaa cgt tgg ttg cag cct cca agt aca gca gct aca tta aat
1392Thr Met Lys Arg Trp Leu Gln Pro Pro Ser Thr Ala Ala Thr Leu Asn
450 455 460
ctg gct gct att gct gca caa agt tca cgt ctt tgg aaa cag ttt gat
1440Leu Ala Ala Ile Ala Ala Gln Ser Ser Arg Leu Trp Lys Gln Phe Asp
465 470 475 480
tct gct ttc gca act aag tgt tta act gca gca gaa act gct agg gat
1488Ser Ala Phe Ala Thr Lys Cys Leu Thr Ala Ala Glu Thr Ala Arg Asp
485 490 495
gca gct gta gct cat cca gaa ata tat gca act atg gaa cag ggt gcc
1536Ala Ala Val Ala His Pro Glu Ile Tyr Ala Thr Met Glu Gln Gly Ala
500 505 510
ggt ggt gga gca tac gga gac aac tat gtt ctt gat gat ttc tac tgg
1584Gly Gly Gly Ala Tyr Gly Asp Asn Tyr Val Leu Asp Asp Phe Tyr Trp
515 520 525
gca gca tgt gaa ttg tat gca act aca ggc agt gac aag tat ttg aac
1632Ala Ala Cys Glu Leu Tyr Ala Thr Thr Gly Ser Asp Lys Tyr Leu Asn
530 535 540
tac ata aag agc tca aag cat tat ctc gaa atg cct aca gaa tta aca
1680Tyr Ile Lys Ser Ser Lys His Tyr Leu Glu Met Pro Thr Glu Leu Thr
545 550 555 560
ggc ggt gag aat act gga att aca ggg gct ttt gac tgg ggt tgt aca
1728Gly Gly Glu Asn Thr Gly Ile Thr Gly Ala Phe Asp Trp Gly Cys Thr
565 570 575
gca ggt atg gga aca ata aca ctt gca ctt gta cct aca aag ctt ccg
1776Ala Gly Met Gly Thr Ile Thr Leu Ala Leu Val Pro Thr Lys Leu Pro
580 585 590
gca gca gat gtt gct aca gct aaa gct aat att caa gct gca gct gat
1824Ala Ala Asp Val Ala Thr Ala Lys Ala Asn Ile Gln Ala Ala Ala Asp
595 600 605
aag ttc ata tca att tca aaa gca caa ggc tat ggt gta cca cta gaa
1872Lys Phe Ile Ser Ile Ser Lys Ala Gln Gly Tyr Gly Val Pro Leu Glu
610 615 620
gaa aaa gta att tca tct cct ttt gat gca tct gtt gtt aaa ggt ttc
1920Glu Lys Val Ile Ser Ser Pro Phe Asp Ala Ser Val Val Lys Gly Phe
625 630 635 640
caa tgg gga tca aac tca ttc gtt att aat gaa gca ata gtt atg tca
1968Gln Trp Gly Ser Asn Ser Phe Val Ile Asn Glu Ala Ile Val Met Ser
645 650 655
tat gct tat gaa ttc agc gat gtt aat ggc aca aag aat aat aaa tat
2016Tyr Ala Tyr Glu Phe Ser Asp Val Asn Gly Thr Lys Asn Asn Lys Tyr
660 665 670
att aat ggt gct tta aca gca atg gat tac ctc ctc gga cgt aac cca
2064Ile Asn Gly Ala Leu Thr Ala Met Asp Tyr Leu Leu Gly Arg Asn Pro
675 680 685
aat att caa agc tat ata act ggt tat ggt gac aac cca ctt gaa aat
2112Asn Ile Gln Ser Tyr Ile Thr Gly Tyr Gly Asp Asn Pro Leu Glu Asn
690 695 700
cct cat cac cgt ttc tgg gca tac cag gca gac aac aca ttc cca aaa
2160Pro His His Arg Phe Trp Ala Tyr Gln Ala Asp Asn Thr Phe Pro Lys
705 710 715 720
cca cct ccg gga tgt ctg tca gga gga cct aac tcc ggc ttg cag gat
2208Pro Pro Pro Gly Cys Leu Ser Gly Gly Pro Asn Ser Gly Leu Gln Asp
725 730 735
cct tgg gtt aag ggt tca ggc tgg cag cca ggt gaa aga cct gct gaa
2256Pro Trp Val Lys Gly Ser Gly Trp Gln Pro Gly Glu Arg Pro Ala Glu
740 745 750
aaa tgc ttc atg gac aat att gaa tct tgg tca aca aac gaa ata acc
2304Lys Cys Phe Met Asp Asn Ile Glu Ser Trp Ser Thr Asn Glu Ile Thr
755 760 765
atc aac tgg aat gct cct ctt gta tgg ata tca gct tac ctt gat gaa
2352Ile Asn Trp Asn Ala Pro Leu Val Trp Ile Ser Ala Tyr Leu Asp Glu
770 775 780
aag ggg cca gag att ggt ggg tca gtg act cct cca act aat tta gga
2400Lys Gly Pro Glu Ile Gly Gly Ser Val Thr Pro Pro Thr Asn Leu Gly
785 790 795 800
gat gtt aac ggc gat gga aac aag gat gca ttg gac ttc gct gca ttg
2448Asp Val Asn Gly Asp Gly Asn Lys Asp Ala Leu Asp Phe Ala Ala Leu
805 810 815
aag aaa gcc ttg tta agc cag gat act tct act ata aat gtt gct aat
2496Lys Lys Ala Leu Leu Ser Gln Asp Thr Ser Thr Ile Asn Val Ala Asn
820 825 830
gct gat ata aac aaa gat ggt tct att gat gca gtt gac ttt gca tta
2544Ala Asp Ile Asn Lys Asp Gly Ser Ile Asp Ala Val Asp Phe Ala Leu
835 840 845
ctc aaa tca ttc ttg tta gga aaa atc aca cag tga
2580Leu Lys Ser Phe Leu Leu Gly Lys Ile Thr Gln
850 855
4859PRTC. cellulolytica 4Met Leu Val Gly Ala Gly Asp Leu Ile Arg Asn His
Thr Phe Asp Asn 1 5 10
15 Arg Val Gly Leu Pro Trp His Val Val Glu Ser Tyr Pro Ala Lys Ala
20 25 30 Ser Phe Glu
Ile Thr Ser Asp Gly Lys Tyr Lys Ile Thr Ala Gln Lys 35
40 45 Ile Gly Glu Ala Gly Lys Gly Glu
Arg Trp Asp Ile Gln Phe Arg His 50 55
60 Arg Gly Leu Ala Leu Gln Gln Gly His Thr Tyr Thr Val
Lys Phe Thr 65 70 75
80 Val Thr Ala Ser Arg Ala Cys Lys Ile Tyr Pro Lys Ile Gly Asp Gln
85 90 95 Gly Asp Pro Tyr
Asp Glu Tyr Trp Asn Met Asn Gln Gln Trp Asn Phe 100
105 110 Leu Glu Leu Gln Ala Asn Thr Pro Lys
Thr Val Thr Gln Thr Phe Thr 115 120
125 Gln Thr Lys Gly Asp Lys Lys Asn Val Glu Phe Ala Phe His
Leu Ala 130 135 140
Pro Asp Lys Thr Thr Ser Glu Ala Gln Asn Pro Ala Ser Phe Gln Pro 145
150 155 160 Ile Thr Tyr Thr Phe
Asp Glu Ile Tyr Ile Gln Asp Pro Gln Phe Ala 165
170 175 Gly Tyr Thr Glu Asp Pro Pro Glu Pro Thr
Asn Val Val Arg Leu Asn 180 185
190 Gln Val Gly Phe Tyr Pro Asn Ala Asp Lys Ile Ala Thr Val Ala
Thr 195 200 205 Ser
Ser Thr Thr Pro Ile Asn Trp Gln Leu Val Asn Ser Thr Gly Ala 210
215 220 Ala Val Leu Thr Gly Lys
Ser Thr Val Lys Gly Ala Asp Arg Ala Ser 225 230
235 240 Gly Asp Asn Val His Ile Ile Asp Phe Ser Ser
Tyr Thr Thr Pro Gly 245 250
255 Thr Asp Tyr Lys Ile Val Thr Asp Val Ser Val Thr Lys Ala Gly Asp
260 265 270 Asn Glu
Ser Met Lys Phe Asn Ile Gly Asp Asp Leu Phe Thr Gln Met 275
280 285 Lys Tyr Asp Ser Met Lys Tyr
Phe Tyr His Asn Arg Ser Ala Ile Pro 290 295
300 Ile Gln Met Pro Tyr Cys Asp Gln Ser Gln Trp Ala
Arg Pro Ala Gly 305 310 315
320 His Thr Thr Asp Ile Leu Ala Pro Asp Pro Thr Lys Asp Tyr Lys Ala
325 330 335 Asn Tyr Thr
Leu Asp Val Thr Gly Gly Trp Tyr Asp Ala Gly Asp His 340
345 350 Gly Lys Tyr Val Val Asn Gly Gly
Ile Ala Thr Trp Thr Val Met Asn 355 360
365 Ala Tyr Glu Arg Ala Leu His Met Gly Gly Asp Thr Ser
Val Ala Pro 370 375 380
Phe Lys Asp Gly Ser Leu Ala Ile Pro Glu Ala Glu Val Tyr Pro Asp 385
390 395 400 Ile Leu Asp Glu
Ala Arg Tyr Gln Leu Ile Asn Met Lys Thr Leu Leu 405
410 415 Asn Ser Gln Val Pro Ala Gly Lys Tyr
Ala Gly Met Ala His His Lys 420 425
430 Ala His Asp Glu Arg Trp Thr Ala Leu Ala Val Arg Pro Asp
Gln Asp 435 440 445
Thr Met Lys Arg Trp Leu Gln Pro Pro Ser Thr Ala Ala Thr Leu Asn 450
455 460 Leu Ala Ala Ile Ala
Ala Gln Ser Ser Arg Leu Trp Lys Gln Phe Asp 465 470
475 480 Ser Ala Phe Ala Thr Lys Cys Leu Thr Ala
Ala Glu Thr Ala Arg Asp 485 490
495 Ala Ala Val Ala His Pro Glu Ile Tyr Ala Thr Met Glu Gln Gly
Ala 500 505 510 Gly
Gly Gly Ala Tyr Gly Asp Asn Tyr Val Leu Asp Asp Phe Tyr Trp 515
520 525 Ala Ala Cys Glu Leu Tyr
Ala Thr Thr Gly Ser Asp Lys Tyr Leu Asn 530 535
540 Tyr Ile Lys Ser Ser Lys His Tyr Leu Glu Met
Pro Thr Glu Leu Thr 545 550 555
560 Gly Gly Glu Asn Thr Gly Ile Thr Gly Ala Phe Asp Trp Gly Cys Thr
565 570 575 Ala Gly
Met Gly Thr Ile Thr Leu Ala Leu Val Pro Thr Lys Leu Pro 580
585 590 Ala Ala Asp Val Ala Thr Ala
Lys Ala Asn Ile Gln Ala Ala Ala Asp 595 600
605 Lys Phe Ile Ser Ile Ser Lys Ala Gln Gly Tyr Gly
Val Pro Leu Glu 610 615 620
Glu Lys Val Ile Ser Ser Pro Phe Asp Ala Ser Val Val Lys Gly Phe 625
630 635 640 Gln Trp Gly
Ser Asn Ser Phe Val Ile Asn Glu Ala Ile Val Met Ser 645
650 655 Tyr Ala Tyr Glu Phe Ser Asp Val
Asn Gly Thr Lys Asn Asn Lys Tyr 660 665
670 Ile Asn Gly Ala Leu Thr Ala Met Asp Tyr Leu Leu Gly
Arg Asn Pro 675 680 685
Asn Ile Gln Ser Tyr Ile Thr Gly Tyr Gly Asp Asn Pro Leu Glu Asn 690
695 700 Pro His His Arg
Phe Trp Ala Tyr Gln Ala Asp Asn Thr Phe Pro Lys 705 710
715 720 Pro Pro Pro Gly Cys Leu Ser Gly Gly
Pro Asn Ser Gly Leu Gln Asp 725 730
735 Pro Trp Val Lys Gly Ser Gly Trp Gln Pro Gly Glu Arg Pro
Ala Glu 740 745 750
Lys Cys Phe Met Asp Asn Ile Glu Ser Trp Ser Thr Asn Glu Ile Thr
755 760 765 Ile Asn Trp Asn
Ala Pro Leu Val Trp Ile Ser Ala Tyr Leu Asp Glu 770
775 780 Lys Gly Pro Glu Ile Gly Gly Ser
Val Thr Pro Pro Thr Asn Leu Gly 785 790
795 800 Asp Val Asn Gly Asp Gly Asn Lys Asp Ala Leu Asp
Phe Ala Ala Leu 805 810
815 Lys Lys Ala Leu Leu Ser Gln Asp Thr Ser Thr Ile Asn Val Ala Asn
820 825 830 Ala Asp Ile
Asn Lys Asp Gly Ser Ile Asp Ala Val Asp Phe Ala Leu 835
840 845 Leu Lys Ser Phe Leu Leu Gly Lys
Ile Thr Gln 850 855
52118DNAArtificial SequenceFusion consruct enzyme-dockerin 5atg gga aca
tat aac tat gga gaa gca tta cag aaa tca ata atg ttc 48Met Gly Thr
Tyr Asn Tyr Gly Glu Ala Leu Gln Lys Ser Ile Met Phe 1
5 10 15 tat gaa ttc cag
cgt tcg gga gat ctt ccg gct gat aaa cgt gac aac 96Tyr Glu Phe Gln
Arg Ser Gly Asp Leu Pro Ala Asp Lys Arg Asp Asn 20
25 30 tgg aga gac gat tcc
ggt atg aaa gac ggt tct gat gta gga gtt gat 144Trp Arg Asp Asp Ser
Gly Met Lys Asp Gly Ser Asp Val Gly Val Asp 35
40 45 ctt aca gga gga tgg tac
gat gca ggt gac cat gtg aaa ttt aat cta 192Leu Thr Gly Gly Trp Tyr
Asp Ala Gly Asp His Val Lys Phe Asn Leu 50
55 60 cct atg tca tat aca tct
gca atg ctt gca tgg tcc tta tat gag gat 240Pro Met Ser Tyr Thr Ser
Ala Met Leu Ala Trp Ser Leu Tyr Glu Asp 65 70
75 80 aag gat gct tat gat aag agc
ggt cag aca aaa tat ata atg gac ggt 288Lys Asp Ala Tyr Asp Lys Ser
Gly Gln Thr Lys Tyr Ile Met Asp Gly 85
90 95 ata aaa tgg gct aat gat tat ttt
att aaa tgt aat ccg aca ccc ggt 336Ile Lys Trp Ala Asn Asp Tyr Phe
Ile Lys Cys Asn Pro Thr Pro Gly 100
105 110 gta tat tat tac caa gta gga gac
ggc gga aag gac cac tct tgg tgg 384Val Tyr Tyr Tyr Gln Val Gly Asp
Gly Gly Lys Asp His Ser Trp Trp 115 120
125 ggc cct gcg gaa gta atg cag atg gaa
aga ccg tct ttt aag gtt gac 432Gly Pro Ala Glu Val Met Gln Met Glu
Arg Pro Ser Phe Lys Val Asp 130 135
140 gct tct aag ccc ggt tct gca gta tgt gct
tcc act gca gct tct ctg 480Ala Ser Lys Pro Gly Ser Ala Val Cys Ala
Ser Thr Ala Ala Ser Leu 145 150
155 160 gca tct gca gca gta gtc ttt aaa tcc agt
gat cct act tat gca gaa 528Ala Ser Ala Ala Val Val Phe Lys Ser Ser
Asp Pro Thr Tyr Ala Glu 165 170
175 aag tgc ata agc cat gca aag aac ctg ttt gat
atg gct gac aaa gca 576Lys Cys Ile Ser His Ala Lys Asn Leu Phe Asp
Met Ala Asp Lys Ala 180 185
190 aag agt gat gct ggt tat act gcg gct tca ggc tac
tac agc tca agc 624Lys Ser Asp Ala Gly Tyr Thr Ala Ala Ser Gly Tyr
Tyr Ser Ser Ser 195 200
205 tca ttt tac gat gat ctc tca tgg gct gca gta tgg
tta tat ctt gct 672Ser Phe Tyr Asp Asp Leu Ser Trp Ala Ala Val Trp
Leu Tyr Leu Ala 210 215 220
aca aat gac agt aca tat tta gac aaa gca gaa tcc tat
gta ccg aat 720Thr Asn Asp Ser Thr Tyr Leu Asp Lys Ala Glu Ser Tyr
Val Pro Asn 225 230 235
240 tgg ggt aaa gaa cag cag aca gat att atc gcc tac aag tgg
gga cag 768Trp Gly Lys Glu Gln Gln Thr Asp Ile Ile Ala Tyr Lys Trp
Gly Gln 245 250
255 tgc tgg gat gat gtt cat tat ggt gct gag ctt ctt ctt gca
aag ctt 816Cys Trp Asp Asp Val His Tyr Gly Ala Glu Leu Leu Leu Ala
Lys Leu 260 265 270
aca aac aaa caa ttg tat aag gat agt ata gaa atg aac ctt gac
ttc 864Thr Asn Lys Gln Leu Tyr Lys Asp Ser Ile Glu Met Asn Leu Asp
Phe 275 280 285
tgg aca act ggt gtt aac gga aca cgt gtt tct tac acg cca aag ggt
912Trp Thr Thr Gly Val Asn Gly Thr Arg Val Ser Tyr Thr Pro Lys Gly
290 295 300
ttg gcg tgg cta ttc caa tgg ggt tca tta aga cat gct aca act cag
960Leu Ala Trp Leu Phe Gln Trp Gly Ser Leu Arg His Ala Thr Thr Gln
305 310 315 320
gct ttt tta gcc ggt gtt tat gca gag tgg gaa ggc tgt acg cca tcc
1008Ala Phe Leu Ala Gly Val Tyr Ala Glu Trp Glu Gly Cys Thr Pro Ser
325 330 335
aaa gta tct gta tat aag gat ttc ctc aag agt caa att gat tat gca
1056Lys Val Ser Val Tyr Lys Asp Phe Leu Lys Ser Gln Ile Asp Tyr Ala
340 345 350
ctt ggc agt acc gga aga agt ttt gtt gtc gga tat gga gta aat cct
1104Leu Gly Ser Thr Gly Arg Ser Phe Val Val Gly Tyr Gly Val Asn Pro
355 360 365
cct caa cat cct cat cac aga act gct cac ggt tca tgg aca gat caa
1152Pro Gln His Pro His His Arg Thr Ala His Gly Ser Trp Thr Asp Gln
370 375 380
atg act tca cca aca tac cac agg cat act att tat ggt gcg ttg gta
1200Met Thr Ser Pro Thr Tyr His Arg His Thr Ile Tyr Gly Ala Leu Val
385 390 395 400
gga gga ccg gat aat gca gat ggc tat act gat gaa ata aac aat tat
1248Gly Gly Pro Asp Asn Ala Asp Gly Tyr Thr Asp Glu Ile Asn Asn Tyr
405 410 415
gtc aat aat gaa ata gcc tgc gat tat aat gcc gga ttt aca ggt gca
1296Val Asn Asn Glu Ile Ala Cys Asp Tyr Asn Ala Gly Phe Thr Gly Ala
420 425 430
ctt gca aaa atg tac aag cat tct ggc gga gat ccg att cca aac ttc
1344Leu Ala Lys Met Tyr Lys His Ser Gly Gly Asp Pro Ile Pro Asn Phe
435 440 445
aag gct atc gaa aaa ata acc aac gat gaa gtt att ata aag gca ggt
1392Lys Ala Ile Glu Lys Ile Thr Asn Asp Glu Val Ile Ile Lys Ala Gly
450 455 460
ttg aat tca act ggc cct aac tac act gaa atc aag gct gtt gtt tat
1440Leu Asn Ser Thr Gly Pro Asn Tyr Thr Glu Ile Lys Ala Val Val Tyr
465 470 475 480
aac cag aca gga tgg cct gca aga gtt acg gac aag ata tca ttt aaa
1488Asn Gln Thr Gly Trp Pro Ala Arg Val Thr Asp Lys Ile Ser Phe Lys
485 490 495
tat ttt atg gac ttg tct gaa att gta gca gca gga att gat cct tta
1536Tyr Phe Met Asp Leu Ser Glu Ile Val Ala Ala Gly Ile Asp Pro Leu
500 505 510
agc ctt gta aca agt tca aat tat tct gaa ggt aag aat act aag gtt
1584Ser Leu Val Thr Ser Ser Asn Tyr Ser Glu Gly Lys Asn Thr Lys Val
515 520 525
tcc ggt gtg ttg cca tgg gat gtt tca aat aat gtt tac tat gta aat
1632Ser Gly Val Leu Pro Trp Asp Val Ser Asn Asn Val Tyr Tyr Val Asn
530 535 540
gtt gat ttg aca gga gaa aat atc tac cca ggc ggt cag tct gcg tgc
1680Val Asp Leu Thr Gly Glu Asn Ile Tyr Pro Gly Gly Gln Ser Ala Cys
545 550 555 560
aga cga gaa gtt cag ttc aga att gcc gca cca cag gga aga aga tat
1728Arg Arg Glu Val Gln Phe Arg Ile Ala Ala Pro Gln Gly Arg Arg Tyr
565 570 575
tgg aat ccg aaa aat gat ttc tca tat gat gga tta cca acc acc agt
1776Trp Asn Pro Lys Asn Asp Phe Ser Tyr Asp Gly Leu Pro Thr Thr Ser
580 585 590
act gta aat acg gtt acc aac ata cct gtt tat gat aac ggc gta aaa
1824Thr Val Asn Thr Val Thr Asn Ile Pro Val Tyr Asp Asn Gly Val Lys
595 600 605
gta ttt ggt aac gaa ccc gca ggt gga tca gaa ccc ggc aca aag ctc
1872Val Phe Gly Asn Glu Pro Ala Gly Gly Ser Glu Pro Gly Thr Lys Leu
610 615 620
gtt cct aca tgg ggc gat aca aac tgc gac ggc gtt gta aat gtt gct
1920Val Pro Thr Trp Gly Asp Thr Asn Cys Asp Gly Val Val Asn Val Ala
625 630 635 640
gac gta gta gtt ctt aac aga ttc ctc aac gat cct aca tat tct aac
1968Asp Val Val Val Leu Asn Arg Phe Leu Asn Asp Pro Thr Tyr Ser Asn
645 650 655
att act gat cag ggt aag gtt aac gca gac gtt gtt gat cct cag gat
2016Ile Thr Asp Gln Gly Lys Val Asn Ala Asp Val Val Asp Pro Gln Asp
660 665 670
aag tcc ggc gca gca gtt gat cct gca ggc gta aag ctc aca gta gct
2064Lys Ser Gly Ala Ala Val Asp Pro Ala Gly Val Lys Leu Thr Val Ala
675 680 685
gac tct gag gca atc ctc aag gct atc gtt gaa ctc atc aca ctt cct
2112Asp Ser Glu Ala Ile Leu Lys Ala Ile Val Glu Leu Ile Thr Leu Pro
690 695 700
caa tga
2118Gln
705
6705PRTArtificial SequenceSynthetic Construct 6Met Gly Thr Tyr Asn Tyr
Gly Glu Ala Leu Gln Lys Ser Ile Met Phe 1 5
10 15 Tyr Glu Phe Gln Arg Ser Gly Asp Leu Pro Ala
Asp Lys Arg Asp Asn 20 25
30 Trp Arg Asp Asp Ser Gly Met Lys Asp Gly Ser Asp Val Gly Val
Asp 35 40 45 Leu
Thr Gly Gly Trp Tyr Asp Ala Gly Asp His Val Lys Phe Asn Leu 50
55 60 Pro Met Ser Tyr Thr Ser
Ala Met Leu Ala Trp Ser Leu Tyr Glu Asp 65 70
75 80 Lys Asp Ala Tyr Asp Lys Ser Gly Gln Thr Lys
Tyr Ile Met Asp Gly 85 90
95 Ile Lys Trp Ala Asn Asp Tyr Phe Ile Lys Cys Asn Pro Thr Pro Gly
100 105 110 Val Tyr
Tyr Tyr Gln Val Gly Asp Gly Gly Lys Asp His Ser Trp Trp 115
120 125 Gly Pro Ala Glu Val Met Gln
Met Glu Arg Pro Ser Phe Lys Val Asp 130 135
140 Ala Ser Lys Pro Gly Ser Ala Val Cys Ala Ser Thr
Ala Ala Ser Leu 145 150 155
160 Ala Ser Ala Ala Val Val Phe Lys Ser Ser Asp Pro Thr Tyr Ala Glu
165 170 175 Lys Cys Ile
Ser His Ala Lys Asn Leu Phe Asp Met Ala Asp Lys Ala 180
185 190 Lys Ser Asp Ala Gly Tyr Thr Ala
Ala Ser Gly Tyr Tyr Ser Ser Ser 195 200
205 Ser Phe Tyr Asp Asp Leu Ser Trp Ala Ala Val Trp Leu
Tyr Leu Ala 210 215 220
Thr Asn Asp Ser Thr Tyr Leu Asp Lys Ala Glu Ser Tyr Val Pro Asn 225
230 235 240 Trp Gly Lys Glu
Gln Gln Thr Asp Ile Ile Ala Tyr Lys Trp Gly Gln 245
250 255 Cys Trp Asp Asp Val His Tyr Gly Ala
Glu Leu Leu Leu Ala Lys Leu 260 265
270 Thr Asn Lys Gln Leu Tyr Lys Asp Ser Ile Glu Met Asn Leu
Asp Phe 275 280 285
Trp Thr Thr Gly Val Asn Gly Thr Arg Val Ser Tyr Thr Pro Lys Gly 290
295 300 Leu Ala Trp Leu Phe
Gln Trp Gly Ser Leu Arg His Ala Thr Thr Gln 305 310
315 320 Ala Phe Leu Ala Gly Val Tyr Ala Glu Trp
Glu Gly Cys Thr Pro Ser 325 330
335 Lys Val Ser Val Tyr Lys Asp Phe Leu Lys Ser Gln Ile Asp Tyr
Ala 340 345 350 Leu
Gly Ser Thr Gly Arg Ser Phe Val Val Gly Tyr Gly Val Asn Pro 355
360 365 Pro Gln His Pro His His
Arg Thr Ala His Gly Ser Trp Thr Asp Gln 370 375
380 Met Thr Ser Pro Thr Tyr His Arg His Thr Ile
Tyr Gly Ala Leu Val 385 390 395
400 Gly Gly Pro Asp Asn Ala Asp Gly Tyr Thr Asp Glu Ile Asn Asn Tyr
405 410 415 Val Asn
Asn Glu Ile Ala Cys Asp Tyr Asn Ala Gly Phe Thr Gly Ala 420
425 430 Leu Ala Lys Met Tyr Lys His
Ser Gly Gly Asp Pro Ile Pro Asn Phe 435 440
445 Lys Ala Ile Glu Lys Ile Thr Asn Asp Glu Val Ile
Ile Lys Ala Gly 450 455 460
Leu Asn Ser Thr Gly Pro Asn Tyr Thr Glu Ile Lys Ala Val Val Tyr 465
470 475 480 Asn Gln Thr
Gly Trp Pro Ala Arg Val Thr Asp Lys Ile Ser Phe Lys 485
490 495 Tyr Phe Met Asp Leu Ser Glu Ile
Val Ala Ala Gly Ile Asp Pro Leu 500 505
510 Ser Leu Val Thr Ser Ser Asn Tyr Ser Glu Gly Lys Asn
Thr Lys Val 515 520 525
Ser Gly Val Leu Pro Trp Asp Val Ser Asn Asn Val Tyr Tyr Val Asn 530
535 540 Val Asp Leu Thr
Gly Glu Asn Ile Tyr Pro Gly Gly Gln Ser Ala Cys 545 550
555 560 Arg Arg Glu Val Gln Phe Arg Ile Ala
Ala Pro Gln Gly Arg Arg Tyr 565 570
575 Trp Asn Pro Lys Asn Asp Phe Ser Tyr Asp Gly Leu Pro Thr
Thr Ser 580 585 590
Thr Val Asn Thr Val Thr Asn Ile Pro Val Tyr Asp Asn Gly Val Lys
595 600 605 Val Phe Gly Asn
Glu Pro Ala Gly Gly Ser Glu Pro Gly Thr Lys Leu 610
615 620 Val Pro Thr Trp Gly Asp Thr Asn
Cys Asp Gly Val Val Asn Val Ala 625 630
635 640 Asp Val Val Val Leu Asn Arg Phe Leu Asn Asp Pro
Thr Tyr Ser Asn 645 650
655 Ile Thr Asp Gln Gly Lys Val Asn Ala Asp Val Val Asp Pro Gln Asp
660 665 670 Lys Ser Gly
Ala Ala Val Asp Pro Ala Gly Val Lys Leu Thr Val Ala 675
680 685 Asp Ser Glu Ala Ile Leu Lys Ala
Ile Val Glu Leu Ile Thr Leu Pro 690 695
700 Gln 705 71341DNAArtificial SequenceFusion construct
enzyme-dockerin 7atg gca ggt gtg cct ttt aac aca aaa tac ccc tat ggt cct
act tct 48Met Ala Gly Val Pro Phe Asn Thr Lys Tyr Pro Tyr Gly Pro
Thr Ser 1 5 10
15 att gcc gat aat cag tcg gaa gta act gca atg ctc aaa gca
gaa tgg 96Ile Ala Asp Asn Gln Ser Glu Val Thr Ala Met Leu Lys Ala
Glu Trp 20 25 30
gaa gac tgg aag agc aag aga att acc tcg aac ggt gca gga gga
tac 144Glu Asp Trp Lys Ser Lys Arg Ile Thr Ser Asn Gly Ala Gly Gly
Tyr 35 40 45
aag aga gta cag cgt gat gct tcc acc aat tat gat acg gta tcc gaa
192Lys Arg Val Gln Arg Asp Ala Ser Thr Asn Tyr Asp Thr Val Ser Glu
50 55 60
ggt atg gga tac gga ctt ctt ttg gcg gtt tgc ttt aac gaa cag gct
240Gly Met Gly Tyr Gly Leu Leu Leu Ala Val Cys Phe Asn Glu Gln Ala
65 70 75 80
ttg ttt gac gat tta tac cgt tac gta aaa tct cat ttc aat gga aac
288Leu Phe Asp Asp Leu Tyr Arg Tyr Val Lys Ser His Phe Asn Gly Asn
85 90 95
gga ctt atg cac tgg cac att gat gcc aac aac aat gtt aca agt cat
336Gly Leu Met His Trp His Ile Asp Ala Asn Asn Asn Val Thr Ser His
100 105 110
gac ggc ggc gac ggt gcg gca acc gat gct gat gag gat att gca ctt
384Asp Gly Gly Asp Gly Ala Ala Thr Asp Ala Asp Glu Asp Ile Ala Leu
115 120 125
gcg ctc ata ttt gcg gac aag tta tgg ggt tct tcc ggt gca ata aac
432Ala Leu Ile Phe Ala Asp Lys Leu Trp Gly Ser Ser Gly Ala Ile Asn
130 135 140
tac ggg cag gaa gca agg aca ttg ata aac aat ctt tac aac cat tgt
480Tyr Gly Gln Glu Ala Arg Thr Leu Ile Asn Asn Leu Tyr Asn His Cys
145 150 155 160
gta gag cat gga tcc tat gta tta aag ccc ggt gac aga tgg gga ggt
528Val Glu His Gly Ser Tyr Val Leu Lys Pro Gly Asp Arg Trp Gly Gly
165 170 175
tca tca gta aca aac ccg tca tat ttt gcg cct gca tgg tac aaa gtg
576Ser Ser Val Thr Asn Pro Ser Tyr Phe Ala Pro Ala Trp Tyr Lys Val
180 185 190
tat gct caa tat aca gga gac aca aga tgg aat caa gtg gcg gac aag
624Tyr Ala Gln Tyr Thr Gly Asp Thr Arg Trp Asn Gln Val Ala Asp Lys
195 200 205
tgt tac caa att gtt gaa gaa gtt aag aaa tac aac aac gga acc ggc
672Cys Tyr Gln Ile Val Glu Glu Val Lys Lys Tyr Asn Asn Gly Thr Gly
210 215 220
ctt gtt cct gac tgg tgt act gca agc gga act ccg gca agc ggt cag
720Leu Val Pro Asp Trp Cys Thr Ala Ser Gly Thr Pro Ala Ser Gly Gln
225 230 235 240
agt tac gac tac aaa tat gat gct aca cgt tac ggc tgg aga act gcc
768Ser Tyr Asp Tyr Lys Tyr Asp Ala Thr Arg Tyr Gly Trp Arg Thr Ala
245 250 255
gtg gac tat tca tgg ttt ggt gac cag aga gca aag gca aac tgc gat
816Val Asp Tyr Ser Trp Phe Gly Asp Gln Arg Ala Lys Ala Asn Cys Asp
260 265 270
atg ctg acc aaa ttc ttt gcc aga gac ggg gca aaa gga atc gtt gac
864Met Leu Thr Lys Phe Phe Ala Arg Asp Gly Ala Lys Gly Ile Val Asp
275 280 285
gga tac aca att caa ggt tca aaa att agc aac aat cac aac gca tca
912Gly Tyr Thr Ile Gln Gly Ser Lys Ile Ser Asn Asn His Asn Ala Ser
290 295 300
ttt ata gga cct gtt gcg gca gca agt atg aca ggt tac gat ttg aac
960Phe Ile Gly Pro Val Ala Ala Ala Ser Met Thr Gly Tyr Asp Leu Asn
305 310 315 320
ttt gca aag gaa ctt tat agg gag act gtt gct gta aag gac agt gaa
1008Phe Ala Lys Glu Leu Tyr Arg Glu Thr Val Ala Val Lys Asp Ser Glu
325 330 335
tat tac gga tat tac gga aac agc ttg aga ctg ctc act ttg ttg tac
1056Tyr Tyr Gly Tyr Tyr Gly Asn Ser Leu Arg Leu Leu Thr Leu Leu Tyr
340 345 350
ata aca gga aac ttc ccg aat cct ttg agt gac ctt tcc ggc caa ccg
1104Ile Thr Gly Asn Phe Pro Asn Pro Leu Ser Asp Leu Ser Gly Gln Pro
355 360 365
aca cca ccg tcg aat ccg aca cct tca ttg cct cct cag gtt gtt tac
1152Thr Pro Pro Ser Asn Pro Thr Pro Ser Leu Pro Pro Gln Val Val Tyr
370 375 380
ggt gat gta aat ggc gac ggt aat gtt aac tcc act gat ttg act atg
1200Gly Asp Val Asn Gly Asp Gly Asn Val Asn Ser Thr Asp Leu Thr Met
385 390 395 400
tta aaa aga tat ctg ctg aag agt gtt acc aat ata aac aga gag gct
1248Leu Lys Arg Tyr Leu Leu Lys Ser Val Thr Asn Ile Asn Arg Glu Ala
405 410 415
gca gac gtt aat cgt gac ggt gcg att aac tcc tct gac atg act ata
1296Ala Asp Val Asn Arg Asp Gly Ala Ile Asn Ser Ser Asp Met Thr Ile
420 425 430
tta aag aga tat ctg ata aag agc ata ccc cac cta cct tat tag
1341Leu Lys Arg Tyr Leu Ile Lys Ser Ile Pro His Leu Pro Tyr
435 440 445
8446PRTArtificial SequenceSynthetic Construct 8Met Ala Gly Val Pro Phe
Asn Thr Lys Tyr Pro Tyr Gly Pro Thr Ser 1 5
10 15 Ile Ala Asp Asn Gln Ser Glu Val Thr Ala Met
Leu Lys Ala Glu Trp 20 25
30 Glu Asp Trp Lys Ser Lys Arg Ile Thr Ser Asn Gly Ala Gly Gly
Tyr 35 40 45 Lys
Arg Val Gln Arg Asp Ala Ser Thr Asn Tyr Asp Thr Val Ser Glu 50
55 60 Gly Met Gly Tyr Gly Leu
Leu Leu Ala Val Cys Phe Asn Glu Gln Ala 65 70
75 80 Leu Phe Asp Asp Leu Tyr Arg Tyr Val Lys Ser
His Phe Asn Gly Asn 85 90
95 Gly Leu Met His Trp His Ile Asp Ala Asn Asn Asn Val Thr Ser His
100 105 110 Asp Gly
Gly Asp Gly Ala Ala Thr Asp Ala Asp Glu Asp Ile Ala Leu 115
120 125 Ala Leu Ile Phe Ala Asp Lys
Leu Trp Gly Ser Ser Gly Ala Ile Asn 130 135
140 Tyr Gly Gln Glu Ala Arg Thr Leu Ile Asn Asn Leu
Tyr Asn His Cys 145 150 155
160 Val Glu His Gly Ser Tyr Val Leu Lys Pro Gly Asp Arg Trp Gly Gly
165 170 175 Ser Ser Val
Thr Asn Pro Ser Tyr Phe Ala Pro Ala Trp Tyr Lys Val 180
185 190 Tyr Ala Gln Tyr Thr Gly Asp Thr
Arg Trp Asn Gln Val Ala Asp Lys 195 200
205 Cys Tyr Gln Ile Val Glu Glu Val Lys Lys Tyr Asn Asn
Gly Thr Gly 210 215 220
Leu Val Pro Asp Trp Cys Thr Ala Ser Gly Thr Pro Ala Ser Gly Gln 225
230 235 240 Ser Tyr Asp Tyr
Lys Tyr Asp Ala Thr Arg Tyr Gly Trp Arg Thr Ala 245
250 255 Val Asp Tyr Ser Trp Phe Gly Asp Gln
Arg Ala Lys Ala Asn Cys Asp 260 265
270 Met Leu Thr Lys Phe Phe Ala Arg Asp Gly Ala Lys Gly Ile
Val Asp 275 280 285
Gly Tyr Thr Ile Gln Gly Ser Lys Ile Ser Asn Asn His Asn Ala Ser 290
295 300 Phe Ile Gly Pro Val
Ala Ala Ala Ser Met Thr Gly Tyr Asp Leu Asn 305 310
315 320 Phe Ala Lys Glu Leu Tyr Arg Glu Thr Val
Ala Val Lys Asp Ser Glu 325 330
335 Tyr Tyr Gly Tyr Tyr Gly Asn Ser Leu Arg Leu Leu Thr Leu Leu
Tyr 340 345 350 Ile
Thr Gly Asn Phe Pro Asn Pro Leu Ser Asp Leu Ser Gly Gln Pro 355
360 365 Thr Pro Pro Ser Asn Pro
Thr Pro Ser Leu Pro Pro Gln Val Val Tyr 370 375
380 Gly Asp Val Asn Gly Asp Gly Asn Val Asn Ser
Thr Asp Leu Thr Met 385 390 395
400 Leu Lys Arg Tyr Leu Leu Lys Ser Val Thr Asn Ile Asn Arg Glu Ala
405 410 415 Ala Asp
Val Asn Arg Asp Gly Ala Ile Asn Ser Ser Asp Met Thr Ile 420
425 430 Leu Lys Arg Tyr Leu Ile Lys
Ser Ile Pro His Leu Pro Tyr 435 440
445
User Contributions:
Comment about this patent or add new information about this topic: