Patent application title: METHODS FOR PEST CONTROL
Inventors:
Peng Cheng (Beijing, CN)
Peng Cheng (Beijing, CN)
Derong Ding (Beijing, CN)
Jie Pang (Beijing, CN)
Jie Pang (Beijing, CN)
Shengbing Li (Beijing, CN)
Lijun Wang (Beijing, CN)
Jinling Song (Beijing, CN)
Di Zhang (Beijing, CN)
Di Zhang (Beijing, CN)
Kaili Li (Beijing, CN)
Kangle Tian (Beijing, CN)
Yong Tang (Beijing, CN)
IPC8 Class: AC12N1582FI
USPC Class:
800302
Class name: Plant, seedling, plant seed, or plant part, per se higher plant, seedling, plant seed, or plant part (i.e., angiosperms or gymnosperms) insect resistant plant which is transgenic or mutant
Publication date: 2014-06-12
Patent application number: 20140165233
Abstract:
Certain embodiments of the present invention provide a method for
controlling Athetis lepigone, which comprises contacting Athetis lepigone
with Cry1F protein. Aspects of the present invention can achieve control
of Athetis lepigone by enabling plants to produce Cry1F protein in vivo,
which can be lethal to Athetis lepigone. In still other instances, the
method can control Athetis lepigone throughout the growth period of the
plants and provide the plants with a full protection. Additionally, the
method, in certain embodiments, can be one or more of stable, complete,
simple, convenient, economical, pollution-free or residue-free.Claims:
1. A method for controlling Athetis lepigone, wherein the method
comprises contacting Athetis lepigone with Cry1F protein.
2. The method of claim 1, wherein the Cry1F protein is Cry1Fa protein.
3. The method of claim 2, wherein the Cry1Fa protein is present in a cell that expresses the Cry1Fa protein of a plant, and Athetis lepigone contacts with the Cry1Fa protein by ingestion of the plant cell.
4. The method of claim 3, wherein the Cry1Fa protein is present in a transgenic plant that expresses the Cry1Fa protein, and Athetis lepigone contacts with the Cry1Fa protein by ingestion of a tissue of the transgenic plant; thereafter, the growth of Athetis lepigone is suppressed, and that eventually leads to Athetis lepigone's death and achieves controlling damage of Athetis lepigone to the plant.
5. The method of claim 4, wherein the transgenic plant is in any growth periods.
6. The method of claim 4, the tissue of the transgenic plant is roots, leaves, stems, tassels, ears, anthers or filaments.
7. The method of claim 4, wherein the control of the damage of Athetis lepigone to the plant does not depend on planting location.
8. The method of claim 4, wherein the control of the damage of Athetis lepigone to the plant does not depend on planting time.
9. The method of claim 4, wherein the plant is maize.
10. The method of claim 3, wherein prior to the contacting step, the method comprises a step to plant a transgenic seedling that comprises a polynucleotide encoding the Cry1Fa protein.
11. The method of claim 2, wherein the amino acid sequence of the Cry1Fa protein comprises an amino acid sequence of SEQ ID NO:1 or SEQ ID NO:2.
12. The method of claim 11, wherein the nucleotide sequence encoding the Cry1Fa protein comprises a nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4.
13. The method of claim 3, wherein the plant further expresses at least one additional nucleotide.
14. The method of claim 13, wherein the additional nucleotide encodes a Cry-like pesticidal protein, a Vip-like pesticidal protein, a protease inhibitor, lectin, α-amylase or peroxidase.
15. The method of claim 14, wherein the additional nucleotide encodes Cry1Ab protein, Cry1Ac protein, Cry1Ba protein or Vip3A protein.
16. The method of claim 15, wherein the additional nucleotide comprises a nucleotide sequence of SEQ ID NO:5 or SEQ ID NO:6.
17. The method of claim 13, wherein the additional nucleotide is dsRNA, which inhibits an important gene of a target pest.
18. A transgenic plant that expresses Cry1F protein.
19. A method of growth suppression of Athetis lepigone, wherein the method comprises contacting Athetis lepigone with the transgenic plant of claim 18 or tissues thereof.
Description:
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims priority under 35 U.S.C. §119(a)-(d) of Chinese Patent Application No. 201210533772.2 filed Dec. 11, 2012, entitled "Method for Pest Control" which is herein incorporated by reference in its entirety.
BACKGROUND
[0002] Some embodiments of the present invention relate to methods for pest control, such as methods for preventing Athetis lepigone from damaging plants by expressing Cry1F protein therein.
[0003] Athetis lepigone belongs to the order of Lepidoptera and the family of Noctuidae. As an omnivorous pest, it sometimes feeds on maize. It can inhabit, in the summer, maize agricultural district of Huang-Huai-Hai region in China, and has also been found in other areas such as in Japan, Korea, Russia and Europe. It can damage aerial roots of maize in topsoil, can eat out maize brace roots and stems, can distort or even kill maize plants. The damaged maize field can show large empty areas or even become sterile if under severe attacks.
[0004] Maize is a major food crop in China. On Jul. 9, 2011, the CCTV's "News Broadcast" reported outbreaks of Athetis lepigone in China. From the autumn of 2011 until May 31 2012, several field surveys conducted by the Pest Prevention and Control Laboratory of National Maize Industry found that 2012's Athetis lepigone included a large number of large-size wintering populations with a high density of larvae, indicating that the outbreak of Athetis lepigone is likely to flare up again in Huang-Huai-Hai region. Two methods that can be used to control Athetis lepigone are the agricultural control method and the chemical control method.
[0005] The agricultural control method is an integrated and coordinated management of multiple factors for the entire ecosystem of farmland, which regulates crops, pests and environmental factors and establishes a farmland ecosystem conducive to crop growth but unfavorable to Athetis lepigone. For example, the prompt removals of straw, weeds and other coverings from the roots of maize seedlings to a bigger space between maize lines far away from the plants so as to expose the ground, is commonly used, in order to make sure the next step of pesticide spray can directly contact Athetis lepigone. However, since the agricultural control must obey the requirements for crop layout and increasing production, such this method has limited applications and cannot be used as an emergency measure when Athetis lepigone outbreaks.
[0006] The chemical control method, also known as the pesticide control method, kills pests by using pesticides. As a means for the comprehensive management of controlling, it can be a fast, convenient, simple and highly cost-effective method. Particularly, it can be used as an emergency practice to reduce the density of Athetis lepigone before damage has occurred. Currently, some measures of the chemical control include poisoned bait, poisoned soil, as well as pesticide drenching and spraying. However, the chemical control has its limitations: its improper use can cause devastating consequences, such as poisoning crops, pest resistance, killing predators and polluting the environment so as to destroy farmland ecosystems; pesticide residues can pose a threat to the safety of local human and livestock; and as Athetis lepigone prefers a moist and dark micro-habitat, it generally hides under coverings such as wheat straws or below the topsoil, making the direct contact between chemicals and Athetis lepigone difficult, which can render the chemical control ineffective.
[0007] To overcome one or more of the limitations of the agricultural control method and/or of the chemical control method, researchers have found that, in some instances, inserting genes coding for pesticidal proteins into plant genome can produce pest-resistant plants. Pesticidal protein Cry1F, among a large group of pesticidal proteins, is an insoluble parasporal crystal protein produced by Bacillus thuringiensis.
[0008] Cry1F protein, if ingested by pests, can be dissolved in the alkaline environment of the pests' midgut and releases protoxin, a precursor to a toxin. Further, alkaline protease digests the protoxin at its N- and C-terminus and can produce an active fragment, which can subsequently bind to a membrane receptor of epithelial cells of the pests' midgut and can insert itself into the intestinal membrane, resulting in deleterious effects to the pest, such as one or more of cell membrane perforation, disequilibrating the pH homeostasis and/or osmotic pressure across the cell membrane; this can disturb the digestion of the pest, and sometimes eventually lead to the death of the pest.
[0009] There are no reports on controlling Athetis lepigone by generating transgenic plants producing a Cry1F protein.
SUMMARY
[0010] Some embodiments of the present invention include providing a pest control method by using transgenic plants expressing Cry1F protein to, for example, control damage caused by Athetis lepigone. In certain embodiments, the method can overcome one or more limitations of the agricultural control method and the chemical control method.
[0011] In other embodiments, the method controls (e.g., limits growth or kills) Athetis lepigone, by, for example, contacting (e.g., eating) Athetis lepigone with the Cry1F protein. In certain instances, the Cry1F protein is Cry1Fa protein.
[0012] In certain aspects, the transgenic plant expresses Cry1F protein in one or more plant parts, including but not limited to reproductive material, such as seeds, seedlings, and the like.
[0013] The Cry1Fa protein can be present in a plant cell expressing the protein, and it can be, in some instances, contacted with Athetis lepigone by ingestion of the plant cell.
[0014] Further, in certain embodiments, the Cry1Fa protein is present in a transgenic plant expressing the Cry1Fa protein, and Athetis lepigone contacts with the Cry1Fa protein by ingestion of a tissue of the transgenic plant.
[0015] In some embodiments, Athetis lepigone is detrimentally effected, such as, but not limited to the inhibition of growth of Athetis lepigone or death of Athetis lepigone; damage to the plant resulting from Athetis lepigone can, in some instances, be controlled.
[0016] In certain embodiments, the transgenic plant can be in any growth period. In other aspects, the tissue of the transgenic plant can be roots, leaves, stems, tassels, ears, anthers or filaments.
[0017] The control of the damage of Athetis lepigone to the plant may or may not depend on planting location.
[0018] The control of the damage of Athetis lepigone to the plant may or may not depend on planting time.
[0019] The plant can be any suitable plant, including but not limited to maize.
[0020] In some instances, prior to the step of contacting Athetis lepigone, a transgenic seedling containing a polynucleotide encoding the Cry1Fa protein is planted.
[0021] In some embodiments, the amino acid sequence of the Cry1Fa protein comprises an amino acid sequence of SEQ ID NO:1 or SEQ ID NO:2. In still other embodiments, the nucleotide sequence encoding the Cry1Fa protein comprises a nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO:4.
[0022] In some instances, the plant can further express at least one of the second nucleotides, which are different from the Cry1Fa protein. In certain aspects, the second nucleotide can encode a Cry-like pesticidal protein, a Vip-like pesticidal protein, a protease inhibitor, lectin, α-amylase or peroxidase. For example, the second nucleotide can encode Cry1Ab protein, Cry1Ac protein, Cry1Ba protein or Vip3A protein. In other examples, the second nucleotide comprises a nucleotide sequence of SEQ ID NO:5 or SEQ ID NO:6. In alternative examples, the second nucleotide is dsRNA, which inhibits an important gene of a target pest.
[0023] In some embodiments, the expression of the Cry1F protein in one transgenic plant can be accompanied by the expression of one or more Cry-like pesticidal proteins and/or Vip-like pesticidal proteins. Such co-expression of more than one pesticidal toxins in the same transgenic plant can be achieved by genetic engineering to make the plant containing and expressing genes of interest. In some examples, one plant (the first parent) expresses Cry1F protein by genetic engineering, while another plant (the second parent) expresses a Cry-like pesticidal protein and/or a Vip-like pesticidal protein by genetic engineering; crossing the first parent with the second parent obtains progeny plants expressing all of the genes introduced into the first parent and the second parent.
[0024] RNA interference (RNAi) can be a highly specific and efficient degradation of homologous mRNA induced by a double-stranded RNA (dsRNA), which can be highly conserved during evolution. Therefore, some aspects of the present invention can use RNAi to specifically knockout or close the expression of genes of target pests.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1 is a flow diagram for constructing recombinant cloning vector DBN01-T comprising the nucleotide sequence of Cry1Fa-01 in some embodiments of the present invention;
[0026] FIG. 2 is a flow diagram for constructing recombinant expression vector DBN100014 comprising the nucleotide sequence of Cry1Fa-01 in some embodiments of the present invention;
[0027] FIG. 3 shows damages to leaves of the transgenic maize plants with inoculation of Athetis lepigone in some embodiments of the present invention;
[0028] FIG. 4 shows the development of Athetis lepigone larvae that are inoculated to the transgenic maize plants in some embodiments of the present invention.
DETAILED DESCRIPTION
[0029] Although both Athetis lepigone and Agrotis ypsilon Rottemberg belong to the order Lepidoptera and are of the family Noctuidae, and they have similar targets and close morphology, they are different species in biology. Below include examples of some aspects of Athetis lepigone and Agrotis ypsilon Rottemberg; the descriptions are not necessarily complete and may not be representative of all Athetis lepigone and/or Agrotis ypsilon Rottemberg.
[0030] 1. Different Feeding Habits.
[0031] In addition to severe damage to summer maize, Athetis lepigone also poses a threat to peanut and soybean. Whereas Agrotis ypsilon Rottermberg, as a polyphagous pest, not only harms maize, sorghum and millet, but also causes damage to a broad range of seedlings including larch, pine, Chinese ash and Manchurian walnut in the northeast, Masson pine, fir, mulberry and tea in the south, as well as Chinese red pine, oleaster and other fruit trees in the northwest.
[0032] 2. Different Geographical Habitations.
[0033] Currently Athetis lepigone has been primarily found in Huang-Huai-Hai summer maize district including six provinces of Hebei, Shandong, Henan, Shanxi, Jiangsu and Anhui, a total of 47 cities and 297 towns. Whereas Agrotis ypsilon Rottermberg can be found in places with humid climate and abundant rainfall in China, such as the Changjiang River Valley, southeast coast, and eastern and southern humid areas of the Northeast China.
[0034] 3. Different Infestation Habits.
[0035] Athetis lepigone causes a problem in some of Hebei summer maize districts, particularly in fields interplanted with wheat. Its larvae hide underneath the surrounding crushed wheat straw of maize seedlings or burrow into 2-5 cm of the topsoil to damage maize seedlings. There are normally 1-2 and up to 10-20 larvae per individual seedling. When maize seedlings are at 3-leaf to 5-leaf stage, larvae feed mainly on its stalk base and leave behind round or oval holes of 3-4 mm in size, resulting in the disruption of nutrition transport to leaves and eventually the wilting and death of interior leaves above ground. When targeting maize seedlings of 8-leaf to 10-leaf stage, larvae mainly feed on roots, including aerial roots and main roots, resulting in lodging or even death of the plants. The damaged plants count for 1% to 5% generally and reach up to 15%-20% in more seriously damaged plots. Larvae of Agrotis ypsilon Rottermberg around instars 1-2 can cluster at the top leaves of seedlings day and night and feed on them, but will disperse after instar 3. The larvae are agile and can feign death. They are sensitive to light, and will huddle themselves up when disturbed. During the day they lurk between the layers of wet and dry topsoil, whereas they can excavate from the ground at night to bite seedling plants and drag the injured plants into underground holes, or bite unearthed seeds. Upon the stalk of seedlings becomes harder, they will feed on fresh leaves and growing points. However, when lack of food or finding next overwintering sites, migration occurs to them.
[0036] 4. Different Morphological Features
[0037] 1) Different morphology of eggs: Athetis lepigone's eggs are steam-bun-shaped with a longitudinal ridge. Newly laid eggs are yellow-green and turn into khaki at later stages. Agrotis ypsilon Rottermberg's eggs are also steam-bun-shaped but with cross carina. The newly laid eggs are creamy white and gradually becoming yellow, and a black spot would emerge on one top of the eggs before hatch.
[0038] 2) Different morphology of larvae: Athetis lepigone's mature larvae are about 20 mm long with pale yellow body and brown head. Newly hatched larvae are 14-18 mm in length and yellow-gray or dark-brown in colour. The salient features thereof are a dark brown speckle in inverted triangle shape on individual somites and two brown dorsal lines from dorsal abdomen to the thoracic segment. By contrast, the larvae of Agrotis ypsilon Rottermberg are cylinder-shaped, and the mature larvae thereof are 37-50 mm long and brown headed with irregular dark brown reticulate stripes. They have taupe or fuscous body and rough surface dotted with different-sized particles. Their dorsal line, sub dorsal line and spiracular line are all black brown, the prothorax is fuscous, the pygidium is tawny with two distinct dark brown vertical bands, and the baenopoda and prolegs are tawny.
[0039] 3) Different morphology of pupae: the pupae of Athetis lepigone are about 10 mm in length, having a fawn body color at early stage then gradually turning brown, and mature larvae pupate underground in the cocoon. By contrast, Agrotis ypsilon Rottermberg's pupae are 18-24 mm in length and bright auburn in color. The mouthpart is lined up with the end of wing buds, both reaching the end of the fourth abdominal segment. The central of the fore part of 4-7 abdominal segments is dark brown with coarse speckles, and has tinny bilateral speckles extended to the spiracle. The anterior part of 5-7 abdominal segments also has tinny speckles. The end of abdomen has a pair of short butt-spines.
[0040] 4) Different morphology of imago: adult Athetis lepigone is 10-12 mm long and 20 mm with wingspan. The female is slightly larger than the male. Its head, thorax and abdomen are taupe. Its forewings are also taupe but with darker markings, fuscous interior and exterior borderlines, annular markings of a black spot and small reniform patterns. Black dots are present on the edge of the outer concave with a white spot. The exterior borderline is wavy; the edge of wings has a black spot. Its hindwings are white and slightly brown, and gradually becomes fuscous at the edge. Its abdomen is taupe. The valvae of male genitalia is half-wide opening, the dorsal margin is concave with a protruding uncus at the middle, and the aedaeagus has inside spiny needles. By contrast, adult Agrotis ypsilon Rottermberg is 17-23 mm in length, 40-54 mm with wingspan. Its head and the back of thorax are fuscous, and the feet are brown. The forefoot tibia and tarsus edge are taupe, and the terminus of every segment of mid- and meta-legs has taupe annular bands. Its brown forewings have black brown anterior areas, fuscous outer borders, light brown base lines and double-lined black wavy endo-transverse lines. There is one round gray speck within black annular bands. Reniform annular shape is black and has black edge. The middle of outside of the reniform annular shape has wedge-shaped black annular shape, which reaches external transverse lines. The mid-transverse line is fuscous wavy shape. The double-lined wavy external transverse lines are brown. The sub-external borderline is irregular saw-tooth shape and gray, the middle of the inner border of which has three pointed teeth. There are small black dots on each vein between sub-external borderline and external transverse line. The outer borderline is black. The color between external transverse line and sub-external borderline is light brown. The color out of sub-external borderline is black brown. The hindwings are hoar. The longitudinal vein and borderline are brown. The back of abdomen is gray.
[0041] 5. Different growth habit and breakout pattern. Athetis lepigone's larvae have 6 instars lasting about 18 days and they have a strong stress resistance. The breakout of adults has two distinct peaks. The first one occurs before the beginning of July while the second one is from the mid-July to mid-August. The adults have a strong reproductive capacity: each female has a production of 300-500 eggs in average and the egg-laying period lasts 3-7 days, while the hatching rate can reach up to 100%. They cause more damage in maize field rotating planting after cotton than continuous planting, covered with wheat bran than without wheat bran, late sowing than early sowing, and having high field humidity than having low field humidity. Athetis lepigone favours dark and moist environment and often hides under the straw or soil, causing a great inconvenience for pesticides spraying. In contrast, Agrotis ypsilon Rottermberg has 3-4 generations in one year. Mature larvae or pupae overwinter in the soil and imagoes start to appear in March. Generally, two moth peaks will occur: one in late March and the other in mid-April. Adults are inactive during the day and become active at dusk till midnight. They have phototaxis and favour sour, sweet, wing fermentations, and various kinds of nectars. The larvae go through six instars: at instars 1 and 2, larvae hide inside the weeds or interior leaves of plants, feeding themselves day and night but with little appetite, and thus cause little damages; after instar 3, they hide under the topsoil during the day and come out for food at the night; at instars 5 and 6, larvae start to have an significantly-increased appetite and each individual can break down 4-5 seedlings in average, up to 10 in extreme cases; and since instar 3, their pesticide resistance significantly increases. The severest damage caused by the first generation of larvae occurs between the end of March and the mid-April. Generations occur from October to April of the next year and do damages. The number of generations in a year varies geographically: 2-3 generations in the northeast, 2-3 generations in the north of the Great Wall, 3 generations in the area between the south of the Great Wall and the north of the Yellow River, 4 generations in the area between the south of Yellow River and Yangtze River, 4-5 generations in the south of Yangtze River, and 6-7 generations in the tropical area in south Asia. However, regardless of the difference in the number of generations in one year, the severest damage is always caused by the larvae of the first generation. Imagoes of southern overwintering generation appear in February. However, the eclosion peak normally occurs from the end of March to the middle of April in most of the country except Ningxia and Inner Mongolia, in which it occurs at the end of April. The Imagoes of Agrotis ypsilon Rottermberg are more likely to start eclosion from 15:00 to 22:00. They lurk under debris and crack during the day and become active after dusk, flying and foraging. After 3-4 days, they start mating and laying eggs. The eggs are mainly laid on the short, high-density weeds and seedlings and sometimes in dead leaves and cracks. Most eggs are near the ground. Each female can lay 800-1000 eggs, or even up to 2000 during their oviposition period of about 5 days. The larval stage consists of 6 instars, and some individuals can reach 7-8 instars. The larval stage varies at different places, but normally takes 30-40 days for the first generation. Once fully matured, they develop into pupae in a soiled chamber around 5 cm underground and the pupal stage is 9-19 days. High temperature is harmful for the development and reproduction of Agrotis ypsilon Rottemberg, thus fewer of them appear during the summer. The optimum survival temperature is 15° C.-25° C. The mortality of Agrotis ypsilon Rottemberg's larvae increases when the temperature of winter is too low, and decreases at places where is low terrain, humid and have abundant rainfall. Additionally, conditions conducive to oviposition and larval feeding such as abundant autumn rainfall, high soil moisture and overgrown weed may lead to an outbreak in the next year. However, excessive rainfall and too much moisture are bad for larval development as first-instar larvae can drown very easily in such environment. Regions having 15-20% soil moisture content during the peak period of oviposition would suffer severer damages. Sandy loam soil is more adapted than clay soil and sandy soil to the reproduction of Agrotis ypsilon Rottemberg, due to its better water permeability and quick draining.
[0042] Collectively, it is evident that Athetis lepigone and Agrotis ypsilon Rottemberg are two distinct species of pests and cannot crossbreed.
[0043] In the present disclosure, the genome of plants, plant tissues or plant cells refers to any genetic material in the plants, tissues or cells, including nucleus, plastid and mitochondrial genome.
[0044] In the present disclosure, polynucleotides and/or nucleotides constitute a complete "gene", and encode a protein or polypeptide in desired host cells. The skilled person in the art would readily recognize that the polynucleotides and/or nucleotides can, in some instances, be placed under the control of regulatory sequences of target hosts.
[0045] DNA normally exists in a form known as double-stranded structure. In this arrangement, one strand is complementary with another strand, and vice versa. DNA generates other complementary strands during replication in plants, thus the present invention includes use of the polynucleotides exemplified in the sequence list and their complementary strands. "Coding strand" commonly used in the art refers to the strand binding to the antisense strand. In order to express proteins in vivo, one strand of DNA is typically transcribed into a complementary strand as mRNA, which is used as a template to be translated into protein. In fact, mRNA is transcribed from the "antisense" strand of DNA. "Sense" or "encoding" strand has a series of codons (one codon contains three nucleotides, which encodes a specific amino acid), and the strand can be used as an open reading frame (ORF) and be transcribed into a protein or peptide. The present invention also encompasses RNA and peptide nucleic acid (PNA), which have considerable functions as the exemplified DNA.
[0046] In some embodiments, the nucleic acid molecules or fragments thereof hybridize to Cry1Fa gene of the present invention under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the Cry1Fa gene. The nucleic acid molecules or fragments thereof in certain cases can specifically hybridize to other nucleic acid molecules. In certain instances, if two nucleic acid molecules can form an antiparallel double-stranded nucleic acid structure, then these two nucleic acid molecules can specifically hybridize to each other. If two nucleic acid molecules exhibit complete complementarity, one nucleic acid molecule is called the "complement" of the other nucleic acid molecule. When every nucleotide of one nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are called to exhibit "complete complementarity". If two nucleic acid molecules can hybridize to each other at an efficiently stable status, and bind to each other after annealing under at least conventional "low stringency" conditions, these two nucleic acid molecules are called "minimal complementarity". Likewise, if two nucleic acid molecules can hybridize to each other at an efficiently stable status, and bind to each other after annealing under conventional "high stringency" conditions, these two nucleic acid molecules are called to have "complementarity". Deviation from complete complementarity is acceptable as long as such deviation does not completely prevent the two molecules from forming a double-stranded structure. In order to ensure that a nucleic acid molecule can be used as a primer or probe, its sequence must have sufficient complementarity so that it can form a stable double-stranded structure in particular solvents and salt concentrations.
[0047] In the present disclosure, a substantially homologous sequence is a nucleic acid molecule, which, under highly stringent conditions, can specifically hybridize with the matched complementary strand of the other nucleic acid molecule. The stringent conditions suitable for DNA hybridization, e.g., processing with 6.0× sodium chloride/sodium citrate (SSC) at about 45° C., and then washing with 2.0×SSC at 50° C., would be well known to the skilled person in the art. For example, during the wash step the salt concentration can be selected from a low stringency condition of about 2.0×SSC to a highly stringent condition of about 0.2×SSC at 50° C. In addition, the temperature in the wash step can be selected from a low stringency condition of room temperature about 22° C. to a highly stringent condition of about 65° C. Both temperature and salt concentration can be changed, or one can remain intact while another one is changed. In some embodiments, the stringent conditions according to the invention are: specific hybridization with SEQ ID NO: 3 or SEQ ID NO: 4 in a 6×SSC, 0.5% SDS solution at 65° C., and then membrane washing with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS once each.
[0048] Therefore, sequences having pest-resistant activity and capable of hybridizing with SEQ ID NO: 3 and/or SEQ ID NO: 4 under stringent conditions are encompassed by some embodiments of the present invention. These sequences are at least of about 40%-50% homology to the sequences of the present invention, about 60%, 65% or 70% homology, or even at least of about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater homology to the sequences of the present invention.
[0049] The genes and proteins encompassed by some embodiments of the present invention include not only the specifically exemplified sequences described herein, but also the portions and/fragments (including those having internal and/or terminal deletions in comparison with the full-length proteins), variants, mutants, substitutes (proteins with substituted amino acids), chimeric and fusion proteins thereof having the pesticidal activity of the exemplified proteins described herein. The "mutants" or "variants" refer to nucleotide sequences encoding the same protein or equivalent protein with the pesticidal activity. The "equivalent protein" refers to a protein presenting the same or substantially the same biological activity of resistance to Athetis lepigone as the claimed proteins.
[0050] The "fragment" or "truncation" of the DNA or protein sequences described in the present invention refers to a part or an artificially modified form (such as sequences suitable for plant expression) of the original DNA or protein sequences (nucleotides or amino acids). The length of the above sequences can be variable, but it should be sufficient to ensure the protein (encoded) as a pest toxin.
[0051] Genes can be modified as gene variants by standard techniques. For example, the technology of point mutation is well known in the art. Another example based on U.S. Pat. No. 5,605,793 (which is herein incorporated by reference in its entirety) describes a method that DNA can be reassembled to generate other molecular diversity after random fracture. Commercially manufactured endonucleases can be used to make fragments of full-length genes, and exonucleases can be used according to standard procedures. For example, enzymes such as Bal31 or site-directed mutagenesis can be used to systematically remove nucleotides from the end of these genes. A variety of restriction endonucleases can also be used to obtain genes that encode active fragments. Proteases can also be used to obtain active fragments of these toxins directly.
[0052] In certain embodiments of the present invention, equivalent proteins and/or genes encoding these equivalent proteins can be derived from B.t. isolates and/or DNA libraries. There are various ways to obtain the pesticidal proteins of the present invention. For example, antibodies of pesticidal proteins disclosed and claimed by the present invention can be used to identify and isolate other proteins from a mixture of proteins. In particular, antibodies may be produced by the most constant and the most different parts from other B.t. proteins. By immunoprecipitation, enzyme-linked immunosorbent assay (ELISA) or western blot, these antibodies can be used to specifically identify equivalent proteins with characteristic activities. Standard procedures in the art can be used to prepare antibodies of the proteins or equivalents or fragments thereof disclosed in the present invention. Also, the genes encoding these proteins can be obtained from microorganisms.
[0053] Due to the redundancy of genetic codes, a variety of different DNA sequences can encode the same amino acid sequence. The skilled person in the art would be able to generate alternative DNA sequences to encode the same or substantially the same protein. These different DNA sequences are included within the scope of certain embodiments of the present invention. The "substantially the same" sequences including fragments with pesticidal activity, refer to sequences with amino acid substitution, deletion, addition or insertion but the pesticidal activity thereof is not essentially affected.
[0054] In some embodiments of the present invention, the substitutions, deletions or additions in amino acid sequences can be obtained using any suitable technique, such as conventional techniques in the art. In some instances, the alterations of amino acid sequences are: a slight change of characteristics, i.e., conservative amino acid substitutions that do not significantly affect folding and/or activity of proteins; a short deletion, usually of 1-30 amino acids; a small amino- or carboxyl-terminal extension, such as an amino-terminal extension of a methionine residue; a small peptide linker with a length of about 20-25 residues for example.
[0055] Examples of conservative substitutions can be selected from the following groups of amino acids: basic amino acids, such as arginine, lysine and histidine; acidic amino acids, such as glutamic acid and aspartic acid; polar amino acids, such as glutamine, asparagine; hydrophobic amino acids, such as leucine, isoleucine and valine; aromatic amino acids, such as phenylalanine, tryptophan and tyrosinel; and small-molecule amino acids, such as glycine, alanine, serine, threonine and methionine. Sometimes, the amino acid substitutions without changing specific activities are known in the art, and they have been, for example, described in "Protein" by N. Neurath and R. L. Hill in 1979, published by Academic Press, New York. Some substitutions are Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and opposite substitutions thereof.
[0056] These substitutions can, in some instances, occur outside the regions that play important roles on the molecular functions but still produce an active polypeptide. For the polypeptides according to some aspects of the present invention, amino acid residues that are necessary for their activity and thus are selected not to be substituted can be identified through any suitable method known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (referring to Cunningham and Wells, 1989, Science 244: 1081-1085). The latter technique is to introduce mutation(s) to each positive charged residue in a molecule and detect pest-resistant activity of the resulting mutants, and then to determine which amino acid residues are important for the activity of the molecule. Substrate-enzyme interaction sites can be identified by the analysis of their three-dimensional structures which can be determined by nuclear magnetic resonance analysis, crystallography or photoaffinity labeling, etc (referring to de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).
[0057] In some embodiments of the present invention, the Cry1F proteins include, but not limited to, Cry1Fa2, Cry1Fa3, Cry1Fb3, Cry1Fb6 or Cry1Fb7 proteins, pesticidal fragments or functional regions that are at least 70% homologous to the amino acid sequences of the above-mentioned proteins, and they have the pesticidal activity to Athetis lepigone.
[0058] Therefore, amino acid sequences with certain homology to SEQ ID NO: 1 and/or 2 are also included in some aspects of the present invention. The homology/similarity/identity of these sequences to the sequences of some aspects of the present invention can, in some instances, be greater than 60%, greater than 75%, greater than 80%, greater than 90% or can be greater than 95%. Also, polynucleotides and proteins of certain aspects of the present invention can be defined by a more particular range of identity and/or similarity and/or homology, for example, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity and/or similarity and/or homology to the exemplified sequences of certain aspects of the present invention.
[0059] The regulatory sequences described in some embodiments of the present invention include, but are not limited to, promoters, transit peptides, terminators, enhancers, leader sequences, introns and other regulatory sequences that can sometimes be operatively linked to the Cry1F protein.
[0060] The promoters can include those expressible in plants; the "promoters expressible in plants" refer to the promoters that ensure expression of the coding sequences connected thereto in plant cells. The promoters expressible in plants can be constitutive promoters. Examples of the promoters directing constitutive expression in the plants include, but are not limited to, 35S promoter from the cauliflower mosaic virus, Ubi promoter, promoter of rice GOS2 gene, etc. Alternatively, the promoters expressible in plants can be tissue-specific, i.e., the expression of coding sequences directed by such promoters in some plant tissues, such as green tissues, is higher than that in other tissues, as determined by routine RNA tests, e.g., PEP carboxylase promoter. Alternatively, the promoters expressible in plants can be wound-inducible promoters. Wound-inducible promoters or promoters directing wound-induced expression patterns refer to that the expression of coding sequences regulated by such promoters is significantly higher in the plants that suffer from mechanical wound or wound caused by pest chewing than in plants under normal growth conditions. Examples of the wound inducible promoters include, but are not limited to, promoters of protease inhibitor genes of potato and tomato (pin I and pin II) and of protease inhibitor gene of maize (MPI).
[0061] The transit peptides, also known as secretory signal sequences or guide sequences, direct transgenic products to specific organelles or cellular compartments. The transit peptides can be heterologous for the target proteins. For example, the sequences encoding the chloroplast transit peptide are used to target chloroplast, or `KDEL` retaining sequences are used to target endoplasmic reticulum, or CTPP of barley lectin gene are used to target vacuoles.
[0062] The leader sequences include, but are not limited to, leader sequences of small RNA viruses, such as EMCV leader sequence (5'-terminal noncoding region of EMCV (encephalomyocarditis virus)); potyvirus leader sequences, such as MDMV (maize dwarf mosaic virus) leader sequence; human immunoglobulin heavy-chain binding protein (BiP); untranslated leader sequence of mRNA of coat protein of alfalfa mosaic virus (AMV RNA4); and tobacco mosaic virus (TMV) leader sequence.
[0063] The enhancers include, but are not limited to, cauliflower mosaic virus (CaMV) enhancer, figwort mosaic virus (FMV) enhancer, carnation efflorescence ring virus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, mirabilis mosaic virus (MMV) enhancer, cestrum yellow leaf curl virus (CmYLCV) enhancer, cotton leaf curl Multan virus (CLCuMV) enhancer, commelina yellow mottle virus (CoYMV) enhancer and peanut chlorotic leaf streak virus (PCLSV) enhancer.
[0064] For applications in the monocotyledon, introns include, but are not limited to, maize hsp70 intron, maize ubiquitin intron, Adh intron 1, sucrose synthase intron or rice Act1 intron. For applications in the dicotyledon, introns include, but are not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and "super ubiquitin" intron.
[0065] The terminators may be signal sequences suitable for polyadenylation and functioning in plants, include but are not limited to, polyadenylation signal sequences derived from nopaline synthase (NOS) gene of Agrobacterium tumefaciens, from protease inhibitor II (pin II) gene, from pea ssRUBISCO E9 gene and from α-tubulin gene.
[0066] The "effective connections" described in the present invention means the connections of nucleic acid sequences and the connections allow sequences to provide desired functions for connected sequences. The "effective connections" described in the present invention may be the connection between promoters and sequences of interest, and whereby the transcription of the sequences of interest is controlled and regulated by the promoters. When the sequences of interest encode proteins and the expression of the proteins is desired, the "effective connections" means the promoters are connected with the sequences in such a way that makes the resulting transcripts translated with a high efficiency. If the connections of the promoters and the coding sequences result in fusion transcripts and the expression of the encoded proteins is desired, such connections allow that the start codon of the resulting transcripts is the initial codon of the coding sequences. Alternatively, if the connections of promoters and coding sequences result in fusion translations and the expression of the proteins is desired, such connections allow the first start codon contained in the 5' untranslated sequences to be connected with the promoters, and the resulted translation products to be in frame relative to the open reading frames of the desired proteins. Nucleic acid sequences for "effective connections" include, but are not limited to, sequences providing genes with expression function, i.e., gene expression elements, such as promoters, 5' untranslated region, introns, protein-coding regions, 3' untranslated regions, polyadenylation sites and/or transcription terminators; sequences providing DNA transfer and/or integration, i.e., T-DNA border sequences, recognition sites of site-specific recombinase, integrase recognition sites; sequences providing selection, i.e., antibiotic resistance markers, biosynthetic genes; sequences providing a scoring markers and assisting operations in vitro or in vivo, i.e., multilinker sequences, site-specific recombination sequences; and sequences providing replication, i.e., bacterial origins of replication, autonomously replicating sequences and centromere sequences.
[0067] The "pesticide" described in the present invention means that it is toxic to crop pests, including but not limited to Athetis lepigone.
[0068] In some embodiments of the present invention, Cry1F protein exhibits cytotoxicity to Athetis lepigone. For example, the transgenic plants, such as maize, in which their genomes contain exogenous DNA comprising nucleotide sequences encoding Cry1F protein, can lead to growth suppression and eventual death of Athetis lepigone by their contact with the protein after ingestion of plant tissues. Growth suppression can be lethal or sub-lethal. In some embodiments, the plants can be morphologically normal and can be cultured by conventional methods for the consumption and/or generation of products. In some instances, the transgenic plants can basically terminate the usage of chemical or biological pesticides that are Cry1F-targeted for Athetis lepigone.
[0069] The expression level of pesticidal crystal proteins (ICP) in plant tissues can be determined by any suitable methods in the art, e.g., quantification of mRNA encoding the pesticidal proteins by specific primers, or direct quantification of pesticidal proteins.
[0070] Various tests can be applied for determining the pesticidal effects of ICP in plants. One target of some embodiments of the present invention is Athetis lepigone.
[0071] In certain aspects of the present invention, the Cry1F protein may have the amino acid sequences shown as SEQ ID NO: 1 and/or SEQ ID NO: 2 in the sequence list. In addition to the Cry1F protein-coding region, other components, such as regions encoding a selection marker protein, can also be included in some aspects.
[0072] Moreover, the expression cassette comprising the nucleotide sequence encoding Cry1F protein can, in certain aspects, additionally express at least one more gene encoding herbicide resistance proteins. The herbicide resistance genes can include, but are not limited to, glufosinate resistance genes, such as bar gene and pat gene; phenmedipham resistance genes, such as pmph gene; glyphosate resistance genes, such as EPSPS gene; bromoxynil resistance genes; sulfonylurea resistance genes; herbicide dalapon resistance genes; cyanamide resistance genes; or glutamine synthetase inhibitor resistance genes such as PPT, thereby obtaining transgenic plants having both high pesticidal activity and herbicide resistance.
[0073] In some embodiments, foreign DNA is introduced into plants, for example, genes or expression cassettes or recombinant vectors encoding the Cry1F protein are introduced into plant cells. Conventional transformation methods include, but are not limited to, Agrobacterium-mediated transformation, micro-emitting bombardment, direct DNA uptake of protoplasts, electroporation, or silicon whisker mediated DNA introduction.
[0074] Some embodiments of the present invention provide a method for controlling pests, with one or more of the following advantages:
[0075] 1. Internal control. Existing technologies are mainly through external actions, i.e. external factors to control the infestation of Athetis lepigone, such as the agricultural control method and the chemical control method. While some embodiments of the present invention is through Cry1F produced in plants to kill Athetis lepigone and subsequently control Athetis lepigone, i.e., through internal factors to control.
[0076] 2. No pollution and no residue. The chemical control method in the art plays a certain role in the control of Athetis lepigone, but it brings pollution, destruction and residues to people, livestock and farmland ecosystem. The method for controlling Athetis lepigone of some embodiments of the present invention can eliminate the above adverse consequences.
[0077] 3. Control throughout the growth period. The methods for controlling Athetis lepigone in the art are staged, while some embodiments of the present invention provides plants with the protection throughout their growth period. That is, the transgenic plants (with Cry1F) from germination, growth, until flowering, fruiting can, in some instances, avoid the damage from Athetis lepigone.
[0078] 4. Control of whole individual plants. The methods for controlling Athetis lepigone in the art, for example foliar spray, are mostly localized. While some embodiments of the present invention provides a protection for the whole individual plants, for example, the roots, leaves, stems, tassels, ears, anthers, filaments, etc. of the individual transgenic plants (with Cry1F) are resistant to Athetis lepigone.
[0079] 5. Stable effects. The current methods of pesticide spray require direct spraying to the surface of the crops, that is likely to cause heterogeneous spray or no spray. Some embodiments of the present invention generate plants expressing the Cry1F protein with constantly level in vivo. Also, the transgenic plants (Cry1F protein) can, in some instances, have a consistently stable effect of controlling in different locations, different time and different genetic backgrounds.
[0080] 6. Simple, convenient and economical. Due to the particular stealth occurrence and damage of Athetis lepigone, its monitoring and prevention is difficult, causing a substantially increased planting cost. In contrast, some embodiments of the present invention only need transgenic plants that express Cry1F protein, thus it saves a lot of manpower, materials and financial resources.
[0081] 7. Complete effect. Methods for controlling Athetis lepigone in the art are not completely efficient, and only slightly reduce the damage. In contrast, the transgenic plants (with Cry1F) in some embodiments of the present invention can lead to 100% death of the newly hatched larvae of Athetis lepigone. For example, the rare larvae can survive, but they are very small due to obvious underdevelopment or even stopping development and hardly cause any damage to the maize plants.
[0082] Some embodiments of the present invention will be described in detail through the following drawings and examples.
EXAMPLES
[0083] The following examples illustrate some embodiments of the present invention of the methods for pest control.
Example 1
Acquisition and Synthesis of Cry1Fa Gene
[0084] I. Acquiring the Nucleotide Sequences of Cry1Fa
[0085] The amino acid sequence (605 amino acids) of pesticidal protein Cry1Fa-01 is shown as SEQ ID NO: 1 in the sequence list; the nucleotide sequence (1818 nucleotides) of Cry1Fa-01 encoding said amino acid sequence (605 amino acids) of pesticidal protein Cry1Fa-01 is shown as SEQ ID NO: 3 in the sequence list.
[0086] The amino acid sequence (1148 amino acids) of pesticidal protein Cry1Fa-02 is shown as SEQ ID NO: 2 in the sequence list; the nucleotide sequence (3447 nucleotides) of Cry1Fa-02 encoding the amino acid sequence (1148 amino acids) of pesticidal protein Cry1Fa-02 is shown as SEQ ID NO: 4 in the sequence list.
[0087] II. Acquiring Nucleotide Sequences of Cry1Ab and Vip3A
[0088] The nucleotide sequence (1848 nucleotides) of Cry1Ab encoding the amino acid sequence (615 amino acids) of pesticidal protein Cry1Ab is shown as SEQ ID NO: 5 in the sequence list; the nucleotide sequence (2370 nucleotides) of Vip3A encoding the amino acid sequence (789 amino acids) of pesticidal protein Vip3A is shown as SEQ ID NO: 6 in the sequence list.
[0089] III. Synthesis of the Above-Mentioned Nucleotide Sequences
[0090] The nucleotide sequences of Cry1Fa-01 (shown as SEQ ID NO: 3 in the sequence list), Cry1Fa-02 (shown as SEQ ID NO: 4 in the sequence list), Cry1Ab (shown as SEQ ID NO: 5 in the sequence list) and Vip3A (shown as SEQ ID NO: 6 in the sequence list) were synthesized by Nanjing GenScript Ltd.; the 5' end of the synthesized nucleotide sequence of the Cry1Fa-01 (SEQ ID NO: 3) was connected to restriction site of AscI, 3' end of the synthesized nucleotide sequence of the Cry1Fa-01 (SEQ ID NO: 3) which was connected to restriction site of BamHI; the 5' end of the synthesized nucleotide sequence of the Cry1Fa-02 (SEQ ID NO: 4) was connected to restriction site of AscI, 3' end of the synthesized nucleotide sequence of the Cry1Fa-02 (SEQ ID NO: 4) which was connected to restriction site of BamHI; the 5' end of the synthesized nucleotide sequence of the Cry1Ab (SEQ ID NO: 5) was connected to restriction site of NcoI, 3' end of the synthesized nucleotide sequence of the Cry1Ab (SEQ ID NO: 5) which was connected to restriction site of SwaI; the 5' end of the synthesized nucleotide sequence of the Vip3A (SEQ ID NO: 6) was connected to restriction site of ScaI, 3' end of the synthesized nucleotide sequence of the Vip3A (SEQ ID NO: 6) which was connected to restriction site of SpeI.
Example 2
Construction of Recombinant Expression Vectors and Transformation the Same into Agrobacterium
[0091] I. Constructing Recombinant Cloning Vectors Comprising Cry1F Gene
[0092] As shown in FIG. 1, the synthesized nucleotide sequence of Cry1Fa-01 was ligated with cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600) according to manufacturer's protocol to generate the recombinant cloning vector DBN01-T. (Note: Amp represents Ampicillin resistance gene; f1 on represents the replication origin of phage f1; LacZ represents the start codon of LacZ; SP6 represents the promoter of SP6 RNA polymerase; T7 represents the promoter of T7 RNA polymerase; Cry1Fa-01 represents the nucleotide sequence of Cry1Fa-01 (SEQ ID NO: 3); and MCS represents a multi-cloning site).
[0093] The next step was to transform the recombinant cloning vector DBN01-T into competent cells T1 of E. coli (Transgen, Beijing, China, CAT: CD501) through a heat-shock method. Specifically, 50 μA of competent cells T1 of E. coli were mixed with 10 μl plasmid DNA (the recombinant cloning vector DBN01-T), incubated in a water bath at 42° C. for 30 seconds and then in a water bath at 37° C. for 1 hour (in a shaker at 100 rpm). The mixture was then grown overnight on a LB plate (tryptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, agar 15 g/L, pH value was adjusted to 7.5 with NaOH) with Ampicillin (100 mg/l), of which the surface was coated with IPTG (isopropyl-thio-β-D-galactoside) and X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside). White colonies were picked up and cultured further at 37° C. overnight in LB medium (tryptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, Ampicillin 100 mg/L, pH value was adjusted to 7.5 with NaOH). The plasmids were extracted by an alkaline method. Specifically, the cultured bacteria in the medium were centrifuged at 12000 rpm for 1 min. The supernatant was discarded and the precipitated cells were resuspended in 100 μl ice-cold solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediamine tetraacetic acid), 50 mM glucose, pH8.0). Following the addition of 150 μl of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), the tube was inverted for four times and placed on ice for 3-5 min. 150 μl ice-cold solution III (4 M potassium acetate, 2 M acetic acid) was added to the mixture, mixed immediately and thoroughly, and then placed on ice for 5-10 min, followed by centrifugation at 12000 rpm for 5 min at 4° C. The supernatant was added into 2 volumes of anhydrous ethanol, mixed thoroughly and then incubated for 5 min at room temperature. The mixture was centrifuged at 12000 rpm for 5 min at 4° C. and the supernatant was discarded. The pellet was washed with 70% (V/V) ethanol and then air dried, followed by addition of 30 μl of TE (10 mM Tris-HCl, 1 mM EDTA, PH 8.0) which contained RNase (20 μg/ml) to dissolve the pellet and digest RNA in a water bath at 37° C. for 30 minutes. The plasmids obtained were stored at -20° C. before use.
[0094] AscI and BamHI were used to identify the extracted plasmids, and positive clones were further verified by sequencing. The results showed that, the nucleotide sequence inserted into the recombinant cloning vector DBN01-T was Cry1Fa-01 shown as SEQ ID NO: 3 in the sequence list, indicating the proper insertion of the nucleotide sequence of Cry1Fa-01.
[0095] Using the above-described method for the construction of the recombinant cloning vector DBN01-T, the synthesized nucleotide sequence of Cry1Fa-02 was ligated with cloning vector pGEM-T to generate the recombinant cloning vector DBN02-T; Cry1Fa-02 is the nucleotide sequence of Cry1Fa-02 (SEQ ID NO: 4). Enzymatic digestion and sequencing were used to verify the proper insertion of the nucleotide sequence Cry1Fa-02 in the recombinant cloning vector DBN02-T.
[0096] Using the above-mentioned construction method of the recombinant cloning vector DBN01-T, the synthetic nucleotide sequence of Cry1Ab was ligated with cloning vector pGEM-T to generate the recombinant cloning vector DBN03-T; Cry1Ab is the nucleotide sequence of Cry1Ab (SEQ ID NO: 5). Enzymatic digestion and sequencing were used to verify the proper insertion of the nucleotide sequence Cry1Ab in the recombinant cloning vector DBN03-T.
[0097] Using the above-mentioned method for the construction of the recombinant cloning vector DBN01-T, the synthesized nucleotide sequence of Vip3A was ligated with cloning vector pGEM-T to generate the recombinant cloning vector DBN04-T; Vip3A is the nucleotide sequence of Vip3A (SEQ ID NO: 6). Enzymatic digestion and sequencing were used to verify the proper insertion of the nucleotide sequence of Vip3A in the recombinant cloning vector DBN04-T.
[0098] II. Constructing Recombinant Expression Vectors Comprising Cry1F Gene
[0099] As shown in FIG. 2, the recombinant cloning vector DBN01-T and expression vector DBNBC-01 (Vector backbone: pCAMBIA2301 (available from CAMBIA institution)) were digested respectively by the restriction enzymes AscI and BamHI; the resulting fragment of the nucleotide sequence of Cry1Fa-01 was then inserted into the digested expression vector DBNBC-01 between AscI and BamHI sites to generate the recombinant expression vector DBN100014. (Note: Kan represents Kanamycin gene; RB represents right border; Ubi represents the promoter of maize ubiquitin gene (SEQ ID NO: 7); Cry1Fa-01 represents the nucleotide sequence of Cry1Fa-01 (SEQ ID NO: 3); Nos represents the terminator of nopaline synthase gene (SEQ ID NO: 8); PMI represents phosphomannose isomerase gene (SEQ ID NO: 9); and LB represents left border).
[0100] The recombinant expression vector DBN100014 was transformed into competent cells T1 of E. coli through a heat-shock method. Specifically, 50 μl competent cells T1 of E. coli were mixed with 10 μl plasmid DNA (the recombinant expression vector DBN1000124), incubated in a water bath at 42° C. for 30 seconds and then in a water bath at 37° C. for 1 hour (in a shaker at 100 rpm). The mixture was then grown at 37° C. for 12 hours on a LB plate (tryptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, agar 15 g/L, pH value was adjusted to 7.5 with NaOH) with 50 mg/L Kanamycin. White colonies were picked up and cultured further at 37° C. overnight in LB medium (tryptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, Kanamycin 50 mg/L, pH value was adjusted to 7.5 with NaOH). The plasmids were extracted by an alkaline method. Enzymatic digestion with AscI and BamHI was used to identify the extracted plasmids, and positive clones were further verified by sequencing. The results showed that the nucleotide sequence inserted into the recombinant cloning vector DBN0100124 between AscI and BamHI sites was Cry1Fa-01 shown as SEQ ID NO: 3 in the sequence list.
[0101] As the above method for the construction of the recombinant expression vector DBN100014, the recombinant cloning vectors DBN01-T and DBN03-T were enzymatically digested by AscI and BamHI, NcoI and SwaI respectively to generate the nucleotide sequences of Cry1Fa-01 and Cry1Ab, which were inserted into expression vector DBNBC-01 to obtain the recombinant expression vector DBN100012. As verified by enzymatic digestion and sequencing, the recombinant expression vector DBN100012 included the nucleotide sequences of Cry1Fa-01 and Cry1Ab shown as SEQ ID NO: 3 and SEQ ID NO: 5 in the sequence list.
[0102] As the above method for the construction of the recombinant expression vector DBN100014, the recombinant cloning vectors DBN02-T and DBN04-T were enzymatically digested by AscI and BamHI, ScaI and SpeI respectively to generate the nucleotide sequences of Cry1Fa-02 and Vip3A, which were further inserted into expression vector DBNBC-01 to obtain the recombinant expression vector DBN100276. As verified by enzymatic digestion and sequencing, the recombinant expression vector DBN100276 included the nucleotide sequences of Cry1Fa-02 and Vip3A shown as SEQ ID NO: 4 and SEQ ID NO: 6 in the sequence list.
[0103] III. Recombinant Expression Vectors were Transformed into Agrobacterium
[0104] The correctly constructed recombinant expression vectors, DBN100014, DBN100012 and DBN100276, were transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat No: 18313-015) through a liquid nitrogen method. Specifically, 100 μL Agrobacterium LBA4404 and 3 μL plasmid DNA (the recombinant expression vectors) were placed in liquid nitrogen for 10 minutes, followed by incubation in a water bath at 37° C. for 10 minutes. The transformed Agrobacterium LBA4404 were inoculated in a LB tube and then cultured at 28° C., 200 rpm for 2 hours. Subsequently, the culture was applied to a LB plate containing 50 mg/L Rifampicin and 100 mg/L Kanamycin until positive individual colonies grew. The individual colonies were picked for further culture to extract plasmids. The recombinant expression vectors were identified by enzymatic digestion, that is, the recombinant expression vectors DBN100014 and DBN100012 were digested with the restriction enzymes AhdI and XbaI, while the recombinant expression vector DBN100276 was digested with restriction enzymes AhdI and AatII indicating the correct construction of the recombinant expression vectors, DBN100014, DBN100012 and DBN100276.
Example 3
Acquisition and Verification of Maize Plants Transformed with Cry1F Genes
[0105] I. Generation of Maize Plants Transformed with Cry1F Genes
[0106] According to the conventional method of Agrobacterium infection, the sterile cultured immature embryos of Maize Z31 were cultured with Agrobacterium strains obtained in Example 2 at section III. The T-DNAs (comprising the promoter sequence of maize Ubiquitin gene, the nucleotide sequence of Cry1Fa-01, the nucleotide sequence of Cry1Fa-02, the nucleotide sequence of Cry1Ab, the nucleotide sequence of Vip3A, PMI gene and the terminator sequence of Nos) of the recombinant expression vectors DBN100014, DBN100012 and DBN100276, which were constructed in Example 2 at section II, were transferred into the maize genome to generate the maize plants transformed with the nucleotide sequence of Cry1Fa-01, the maize plants transformed with the nucleotide sequence of Cry1Fa-01-Cry1Ab and the maize plants transformed with the nucleotide sequence of Cry1Fa-02-Vip3A. The wild-type maize plants were used as control.
[0107] The process of Agrobacterium-mediated transformation of maize was performed, as briefly described as follows. The immature embryos isolated from the maize were contacted with the Agrobacterium suspension, whereby the nucleotide sequences of Cry1Fa-01, Cry1Fa-01-Cry1Ab and/or Cry1Fa-02-Vip3A were delivered into at least one cell of either immature embryo by Agrobacterium (step 1: Infection). In this step, the immature embryos were, in some instances, immersed in Agrobacterium suspension (OD660=0.4-0.6, infection medium (MS salt 4.3 g/L, MS vitamins, casein 300 mg/L, sucrose 68.5 g/L, glucose 36 g/L, Acetosyringone (AS) 40 mg/L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg/L, pH 5.3)) to initiate inoculation. The immature embryos were cultured with Agrobacterium strains for a period of time (3 days) (step 2: Co-culture). In some instances, after the step of infection, the immature embryos were cultured on a solid medium (MS salt 4.3 g/L, MS vitamins, casein 300 mg/L, sucrose 20 g/L, glucose 10 g/L, Acetosyringone (AS) 100 mg/L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg/L, agar 8 g/L, pH 5.8). After the co-culture step, a "recovery" step is optional, wherein there is at least an antibiotic known as inhibiting the growth of Agrobacterium (Cephalosporins) and no selection agents for plant transformants in the recovery medium (MS salt 4.3 g/L, MS vitamins, casein 300 mg/L, sucrose 30 g/L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg/L, agar 8 g/L, pH 5.8) (step 3: Recovery). In some instances, the immature embryos were cultured on the solid medium with an antibiotic but without selection agents to eliminate Agrobacterium and provide a recovery period for transformed cells. Next, the inoculated immature embryos were cultured on the medium with a selection agent (mannose) and the growing transformed calluses were selected (step 4: Selection). In some instances, the immature embryos were cultured on a solid selection medium with a selection agent (MS salt 4.3 g/L, MS vitamins, casein 300 mg/L, sucrose 5 g/L, mannose 12.5 g/L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg/L, agar 8 g/L, pH 5.8), which resulted in a selective growth of transformed cells. Further, the calluses regenerated into plants (step 5: Regeneration). In some instances, the calluses grown on the medium with the selection agent were cultured on a solid medium (MS differentiation medium and MS rooting medium) to regenerate plants.
[0108] The selected resistant calluses were transferred onto the MS differentiation medium (MS salt 4.3 g/L, MS vitamins, casein 300 mg/L, sucrose 30 g/L, 6-benzyladenine 2 mg/L, mannose 5 g/L, agar 8 g/L, pH 5.8), and cultured for differentiation at 25° C. The differentiated seedlings were transferred onto the MS rooting medium (MS salt 2.15 g/L, MS vitamins, casein 300 mg/L, sucrose 30 g/L, indole-3-acetic acid 1 mg/L, agar 8 g/L, pH 5.8), and cultured at 25° C. till the height of about 10 cm. The seedlings were then transferred into a greenhouse and grew to fructify. During the culture in the greenhouse, the seedlings were incubated at 28° C. for 16 hours and then incubated at 20° C. for 8 hours each day.
[0109] II. Verification of Maize Plants Transformed with Cry1F Genes by TaqMan Method
[0110] Using about 100 mg of leaves from each of the maize plants transformed with the nucleotide sequence of Cry1Fa-01, the maize plants transformed with the nucleotide sequence of Cry1Fa-01-Cry1Ab and the maize plants transformed with the nucleotide sequence of Cry1Fa-02-Vip3A as samples, the genomic DNA was extracted with DNeasy Plant Maxi Kit of Qiagen, and the copy numbers of Cry1F gene, Cry1Ab gene and Vip3A gene were determined by fluorescence quantitative PCR method with Taqman probe. The wild-type maize plants were analyzed as control according to the above-mentioned method. The experiments were repeated for 3 times and the results were averaged.
[0111] The detailed protocol for determining the copy numbers of Cry1F gene, Cry1Ab gene and Vip3A gene was as follows:
[0112] Step 11: 100 mg of the leaves from each of the maize plants transformed with the nucleotide sequence of Cry1Fa-01, of the maize plants transformed with the nucleotide sequence of Cry1Fa-01-Cry1Ab and of the maize plants transformed with the nucleotide sequence of Cry1Fa-02-Vip3A, and that of the wild-type maize plants were sampled and homogenized in a mortar with liquid nitrogen. Each sample was taken in triplicate.
[0113] Step 12: The genomic DNA of the above-mentioned samples was extracted with DNeasy Plant Maxi Kit of Qiagen, and the detailed method refers to the manufacturer's protocol.
[0114] Step 13: NanoDrop 2000 (Thermo Scientific) was employed to measure genomic DNA concentrations of the above-mentioned samples.
[0115] Step 14: The concentrations of genomic DNA of the above-mentioned samples were adjusted to the same concentrations in a range of 80-100 ng/μl.
[0116] Step 15: The copy numbers of the samples were determined by a fluorescence quantitative PCR method with Taqman probe. A sample that had a known copy number was used as standard, and a sample from the wild-type maize plants was used as control. Each sample was taken in triplicate and the results were averaged. The primers and probes used in the fluorescence quantitative PCR method are as follows.
[0117] The following primers and probes were used for detecting the nucleotide sequence of Cry1Fa-01:
[0118] Primer 1 (CF1): CAGTCAGGAACTACAGTTGTAAGAGGG, shown as SEQ ID NO: 10 in the sequence list;
[0119] Primer 2 (CR1): ACGCGAATGGTCCTCCACTAG, shown as SEQ ID NO: 11 in the sequence list;
[0120] Probe 1 (CP1): CGTCGAAGAATGTCTCCTCCCGTGAAC, shown as SEQ ID NO: 12 in the sequence list;
[0121] The following primers and probes were used for detecting the nucleotide sequence of Cry1Ab:
[0122] Primer 3 (CF2): TGGTGGAGAACGCATTGAAAC, shown as SEQ ID NO: 13 in the sequence list;
[0123] Primer 4 (CR2): GCTGAGCAGAAACTGTGTCAAGG, shown as SEQ ID NO: 14 in the sequence list;
[0124] Probe 2 (CP2): CGGTTACACTCCCATCGACATCTCCTTG, shown as SEQ ID NO: 15 in the sequence list;
[0125] The following primers and probes were used for detecting the nucleotide sequence of Cry1Fa-02:
[0126] Primer 5 (CF3): CAGTCAGGAACTACAGTTGTAAGAGGG, shown as SEQ ID NO: 16 in the sequence list;
[0127] Primer 6 (CR3): ACGCGAATGGTCCTCCACTAG, shown as SEQ ID NO: 17 in the sequence list;
[0128] Probe 3 (CP3): CGTCGAAGAATGTCTCCTCCCGTGAAC, shown as SEQ ID NO: 18 in the sequence list;
[0129] The following primers and probes were used for detecting the nucleotide sequence of Vip3A:
[0130] Primer 7 (CF4): ATTCTCGAAATCTCCCCTAGCG, shown as SEQ ID NO: 19 in the sequence list;
[0131] Primer 8 (CR4): GCTGCCAGTGGATGTCCAG, shown as SEQ ID NO: 20 in the sequence list;
[0132] Probe 4 (CP4): CTCCTGAGCCCCGAGCTGATTAACACC, shown as SEQ ID NO: 21 in the sequence list;
[0133] PCR reaction system:
TABLE-US-00001 JumpStart ® Taq ReadyMix ® (Sigma) 10 μl 50 × mixture of primers/probes 1 μl Genomic DNA 3 μl Water (ddH2O) 6 μl
[0134] The 50× mixture of primers/probes, containing 1 mM of each primer 45 μl, 100 μM of the probes 50 μl and 1×TE buffer 860 μl, was stored at 4° C. in an amber tube.
[0135] PCR conditions were as follows:
TABLE-US-00002 Step Temperature Time 21 95° C. 5 min 22 95° C. 30 sec.sup. 23 60° C. 1 min 24 returning to step 22, repeating 40 times
[0136] The data were analyzed by SDS2.3 software (Applied Biosystems).
[0137] As shown by the results, the nucleotide sequences of Cry1Fa-01, Cry1Fa-01-Cry1Ab and Cry1Fa-02-Vip3A were successfully integrated into the genomes of the detected maize plants respectively. The maize plants transformed with the nucleotide sequence of Cry1Fa-01, the maize plants transformed with the nucleotide sequence of Cry1Fa-01-Cry1Ab, and the maize plants transformed with the nucleotide sequence of Cry1Fa-02-Vip3A each obtained a single copy of Cry1F gene, Cry1Ab gene and/or Vip3A gene.
Example 4
Detection of Pesticidal Proteins in Transgenic Maize Plants
[0138] I. The Detection of the Contents of Pesticidal Proteins in Transgenic Maize Plants
[0139] The solutions involved in this experiment were as follows:
[0140] Extraction buffer: 8 g/L NaCl, 0.2 g/L KH2PO4, 2.9 g/L Na2HPO4.12H2O, 0.2 g/L KCl, 5.5 ml/L Tween-20, pH 7.4;
[0141] Washing buffer PBST: 8 g/L NaCl, 0.2 g/L KH2PO4, 2.9 g/L Na2HPO4.12H2O, 0.2 g/L KCl, 0.5 ml/L Tween-20, pH 7.4;
[0142] Termination solution: 1M HCl.
[0143] Three (3) mg of fresh leaves from each of the maize plants transformed with the nucleotide sequence of Cry1Fa-01, of the maize plants transformed with the nucleotide sequence of Cry1Fa-01-Cry1Ab and of the maize plants transformed with the nucleotide sequence of Cry1Fa-02-Vip3A were sampled and homogenized with liquid nitrogen, followed by the addition of 800 μl of the extraction buffer. The mixture was centrifuged at 4000 rpm for 10 min, then the supernatant was diluted 40-fold with the extraction buffer and 80 μl of diluted supernatant was used for ELISA test. ELISA (enzyme-linked immunosorbent assay) kits (ENVIRLOGIX Company, Cry1Fa, Cry1Fa/Cry1Ac and Vip3A kits) were employed to determine the ratio of the pesticidal proteins (Cry1Fa, Cry1Ab and Vip3A proteins) content divided by the weight of the fresh leaves. The detailed method refers to the manufacturer's protocol.
[0144] Meanwhile, the wild-type maize plants and the non-transgenic maize plants identified by Taqman were used as controls, and the determination followed the methods as described above. For three lines transformed with Cry1Fa-01 (S1, S2 and S3), with Cry1Fa-01-Cry1Ab (S4, S5 and S6) and with Cry1Fa-02-Vip3A (S7, S8 and S9), one line identified as non-transgenic plant (NGM) by Taqman and one line as wild type (CK), three plants for each line were used and each plant was repeated six times.
[0145] Experimental results of the pesticidal protein Cry1Fa contents in transgenic plants were shown in Table 1. Experimental results of the pesticidal protein Cry1Ab contents in transgenic plants were shown in Table 2. Experimental results of the pesticidal protein Vip3A contents in transgenic plants were shown in Table 3. The ratios of the averaged expressions of the pesticidal protein Cry1Fa divided by the weight of the fresh leaves from the maize plants transformed with the nucleotide sequences of Cry1Fa-01, Cry1Fa-01-Cry1Ab and Cry1Fa-02-Vip3A were determined as 3475.52, 3712.48 and 3888.76 respectively; the ratio of the averaged expressions of the pesticidal protein Cry1Ab divided by the weight of the fresh leaves in the maize plants transformed with the nucleotide sequence of Cry1Fa-01-Cry1Ab was 8234.7, and the ratio of the averaged expressions of the pesticidal protein Vip3A divided by the weight of the fresh leaves in the maize plants transformed with the nucleotide sequence of Cry1Fa-02-Vip3A was 3141.02. These results suggest that the transgenic maize plants have received a relatively high and stable expression of Cry1Fa protein, Cry1Ab protein and Vip3A protein.
TABLE-US-00003 TABLE 1 The average amount of Cry1Fa protein expressed in the transgenic maize plants Amount of Cry1Fa protein Amount of Cry1Fa protein expressed in each plant (ng/g) expressed in each kind of (repeated six times per plant) lines (ng/g) Line 1 2 3 Average amount (ng/g) S1 3535.02 3697.34 2928.71 3475.52 S2 3904.88 2808.72 3044.88 S3 3954.63 3572.96 3832.55 S4 3039.78 3600.01 3753.22 3712.48 S5 4543.98 4251.25 3862.03 S6 3049.4 3834.01 3478.66 S7 3892.15 4215.07 3941.55 3888.76 S8 3905.47 3816.27 4028.96 S9 3617.49 3795.65 3786.19 NGM -0.23 0 -4.21 0 CK -2.36 -1.98 0 0
TABLE-US-00004 TABLE 2 The average amount of Cry1Ab protein expressed in the transgenic maize plants Amount of Cry1Ab protein Amount of Cry1Ab protein expressed in each plant (ng/g) expressed in each kind of (repeated six times per plant) lines (ng/g) Line 1 2 3 Average amount (ng/g) S4 7088.4 9837.5 10626.4 8234.7 S5 9866.7 6863.3 4222.4 S6 9912.1 7724.1 7970.9 NGM -4.51 -2.44 0 0 CK 0 -6.33 -1.97 0
TABLE-US-00005 TABLE 3 The average amount of Vip3A protein expressed in the transgenic maize plants Amount of Vip3A protein Amount of Vip3A protein expressed in each plant (ng/g) expressed in each kind of (repeated six times per plant) line (ng/g) Line 1 2 3 Average amount (ng/g) S7 2989.67 3123.65 3176.48 3141.02 S8 3205.68 3102.69 3312.03 S9 3059.11 3246.85 3167.95 NGM -1.52 0 -6.34 0 CK 0 -0.95 -2.31 0
[0146] II. Detection of Pest Resistance of the Transgenic Maize Plants
[0147] The maize plants transformed with the nucleotide sequence of Cry1Fa-01, the maize plants transformed with the nucleotide sequence of Cry1Fa-01-Cry1Ab and the maize plants transformed with the nucleotide sequence of Cry1Fa-02-Vip3A, the wild-type maize plants and the non-transgenic maize plants confirmed by Taqman were detected for their resistance to Athetis lepigone.
[0148] Fresh leaves of the maize plants transformed with the nucleotide sequence of Cry1Fa-01, of the maize plants transformed with the nucleotide sequence of Cry1Fa-01-Cry1Ab and of the maize plants transformed with the nucleotide sequence of Cry1Fa-02-Vip3A, and those of the wild-type maize plants and of the maize plants identified as non-transgenic plants (V3-V4 stage) by Taqman, were sampled respectively. The leaves were rinsed with sterile water and the water on the leaves was dried up by gauze. The veins of the leaves were removed, and the leaves were cut into stripes of approximately 1 cm×2 cm. Two stripes of the leaves were placed on filter paper wetted with distilled water on the bottom of round plastic Petri dishes. 10 heads of Athetis lepigone (newly hatched larvae) were putted into each dish, and the dishes with pests were covered with lids and placed at 25-28° C., relative humidity of 70%-80% and photoperiod (light/dark) 16:8 for 3 days. According to three indicators, the developmental progress, mortality and leaf damage rate of the Athetis lepigone's larvae, the resistance score was acquired: score=100×mortality+[100×mortality+90×(the number of newly hatched pests/the total number of inoculated pests)+60×(the number of newly hatched pests-the number of negative control pests/the total number of inoculated pests)+10×(the number of negative control pests/the total number of inoculated pests)]+100×(1-leaf damage rate). Three lines were transformed with Cry1Fa-01 (S1, S2 and S3), and 3 lines were transformed with Cry1Fa-01-Cry1Ab (S4, S5 and S6), and 3 lines were transformed with Cry1Fa-02-Vip3A (S7, S8 and S9), and 1 line was identified as non-transgenic plant (NGM) by Taqman, and 1 line was wild type (CK); 3 plants were chosen for test from each line, repeated six times per plants. The results were shown in Table 4, FIG. 3, and FIG. 4.
TABLE-US-00006 TABLE 4 The pest resistance of the transgenic maize plants inoculated with Athetis lepigone Mortality of Athetis Developmental progress of lepigone Athetis lepigone (each line) (each line) Total Newly number Leaf hatched- of Score damage Newly negative ≧negative inoculated Mortality (each line rate (%) hatched control control pests (%) line) Average S1 0 0 0 0 10 100 300 S2 1 0 0 0 10 100 299 288 S3 1 3 0 0 10 70 266 S4 1 0.3 0 0 10 97 297 S5 0.5 0 0 0 10 100 300 298 S6 1 0 0 0 10 100 299 S7 1 0.3 0 0 10 97 296 S8 1.5 0.6 0 0 10 94 292 288 S9 1 2 0 0 10 80 277 NGM 20 0 0 7 10 30 147 147 CK 18 0 0 8 10 20 130 130
[0149] As shown in Table 4, the scores of the maize plants transformed with the nucleotide sequence of Cry1Fa-01, of the maize plants transformed with the nucleotide sequence of Cry1Fa-01-Cry1Ab and of the maize plants transformed with the nucleotide sequence of Cry1Fa-02-Vip3A were mostly of more than 280; while the score of the wild-type maize plants was generally about 150 or less.
[0150] As shown in FIG. 3 and FIG. 4, compared with the wild-type maize plants, the maize plants transformed with the nucleotide sequence of Cry1Fa-01, the maize plants transformed with the nucleotide sequence of Cry1Fa-01-Cry1Ab and the maize plants transformed with the nucleotide sequence of Cry1Fa-02-Vip3A killed nearly 100% of the newly hatched Athetis lepigone, and inhibited the development of rarely survived larvae so that the larvae still remained in the newly hatched state after 3 days. Additionally, the maize plants transformed with the nucleotide sequence of Cry1Fa-01, the maize plants transformed with the nucleotide sequence of Cry1Fa-01-Cry1Ab and the maize plants transformed with the nucleotide sequence of Cry1Fa-02-Vip3A had little damage, shown by a small number of pinholes in a few leaves which could only be observed under a magnifier.
[0151] Thus, the maize plants transformed with the nucleotide sequence of Cry1Fa-01, the maize plants transformed with the nucleotide sequence of Cry1Fa-01-Cry1Ab, and the maize plants transformed with the nucleotide sequence of Cry1Fa-02-Vip3A all showed resistance to Athetis lepigone and was sufficient to cause adverse effects on the growth of Athetis lepigone.
[0152] The above results also appeared to show that the effective control of Athetis lepigone resulted from the Cry1F protein produced by maize plants transformed with the nucleotide sequence of Cry1Fa-01, by maize plants transformed with the nucleotide sequence of Cry1Fa-01-Cry1Ab, and by maize plants transformed with the nucleotide sequence of Cry1Fa-02-Vip3A. Similar transgenic plants that can express Cry1F can be produced to control Athetis lepigone, based on the same toxic effect of Cry1F protein to Athetis lepigone. Cry1F proteins described in the present invention include, but are not limited to, Cry1F proteins shown in the specific embodiments by the specific sequences. The transgenic plants can also generate at least one kind of additional pesticidal protein that is different from Cry1F, e.g., Cry1Ab, Cry1Ac, Cry1Ba and Vip3A.
[0153] In conclusion, some embodiments of the present invention can control Athetis lepigone by enabling the plants to produce Cry1F protein in vivo, which is toxic to Athetis lepigone. In comparison with current agricultural and chemical control methods, the method described by some embodiments of the present invention can control Athetis lepigone throughout the growth period of the plants and provide a full protection to the plants. Additionally, some aspects of the method can be one or more of stable, complete, simple, convenient, economical, pollution-free and residue-free.
[0154] Finally, it should be noted that the above embodiments merely illustrate some of the technical solutions of certain aspects of the present invention and do not limit the scope of the invention. Although some embodiments of the present invention have been described in detail, it should be appreciated that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the invention.
Sequence CWU
1
1
211605PRTArtificial SequenceCry1Fa-01 amino acid sequence 1Met Glu Asn Asn
Ile Gln Asn Gln Cys Val Pro Tyr Asn Cys Leu Asn 1 5
10 15 Asn Pro Glu Val Glu Ile Leu Asn Glu
Glu Arg Ser Thr Gly Arg Leu 20 25
30 Pro Leu Asp Ile Ser Leu Ser Leu Thr Arg Phe Leu Leu Ser
Glu Phe 35 40 45
Val Pro Gly Val Gly Val Ala Phe Gly Leu Phe Asp Leu Ile Trp Gly 50
55 60 Phe Ile Thr Pro Ser
Asp Trp Ser Leu Phe Leu Leu Gln Ile Glu Gln 65 70
75 80 Leu Ile Glu Gln Arg Ile Glu Thr Leu Glu
Arg Asn Arg Ala Ile Thr 85 90
95 Thr Leu Arg Gly Leu Ala Asp Ser Tyr Glu Ile Tyr Ile Glu Ala
Leu 100 105 110 Arg
Glu Trp Glu Ala Asn Pro Asn Asn Ala Gln Leu Arg Glu Asp Val 115
120 125 Arg Ile Arg Phe Ala Asn
Thr Asp Asp Ala Leu Ile Thr Ala Ile Asn 130 135
140 Asn Phe Thr Leu Thr Ser Phe Glu Ile Pro Leu
Leu Ser Val Tyr Val 145 150 155
160 Gln Ala Ala Asn Leu His Leu Ser Leu Leu Arg Asp Ala Val Ser Phe
165 170 175 Gly Gln
Gly Trp Gly Leu Asp Ile Ala Thr Val Asn Asn His Tyr Asn 180
185 190 Arg Leu Ile Asn Leu Ile His
Arg Tyr Thr Lys His Cys Leu Asp Thr 195 200
205 Tyr Asn Gln Gly Leu Glu Asn Leu Arg Gly Thr Asn
Thr Arg Gln Trp 210 215 220
Ala Arg Phe Asn Gln Phe Arg Arg Asp Leu Thr Leu Thr Val Leu Asp 225
230 235 240 Ile Val Ala
Leu Phe Pro Asn Tyr Asp Val Arg Thr Tyr Pro Ile Gln 245
250 255 Thr Ser Ser Gln Leu Thr Arg Glu
Ile Tyr Thr Ser Ser Val Ile Glu 260 265
270 Asp Ser Pro Val Ser Ala Asn Ile Pro Asn Gly Phe Asn
Arg Ala Glu 275 280 285
Phe Gly Val Arg Pro Pro His Leu Met Asp Phe Met Asn Ser Leu Phe 290
295 300 Val Thr Ala Glu
Thr Val Arg Ser Gln Thr Val Trp Gly Gly His Leu 305 310
315 320 Val Ser Ser Arg Asn Thr Ala Gly Asn
Arg Ile Asn Phe Pro Ser Tyr 325 330
335 Gly Val Phe Asn Pro Gly Gly Ala Ile Trp Ile Ala Asp Glu
Asp Pro 340 345 350
Arg Pro Phe Tyr Arg Thr Leu Ser Asp Pro Val Phe Val Arg Gly Gly
355 360 365 Phe Gly Asn Pro
His Tyr Val Leu Gly Leu Arg Gly Val Ala Phe Gln 370
375 380 Gln Thr Gly Thr Asn His Thr Arg
Thr Phe Arg Asn Ser Gly Thr Ile 385 390
395 400 Asp Ser Leu Asp Glu Ile Pro Pro Gln Asp Asn Ser
Gly Ala Pro Trp 405 410
415 Asn Asp Tyr Ser His Val Leu Asn His Val Thr Phe Val Arg Trp Pro
420 425 430 Gly Glu Ile
Ser Gly Ser Asp Ser Trp Arg Ala Pro Met Phe Ser Trp 435
440 445 Thr His Arg Ser Ala Thr Pro Thr
Asn Thr Ile Asp Pro Glu Arg Ile 450 455
460 Thr Gln Ile Pro Leu Val Lys Ala His Thr Leu Gln Ser
Gly Thr Thr 465 470 475
480 Val Val Arg Gly Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg Arg Thr
485 490 495 Ser Gly Gly Pro
Phe Ala Tyr Thr Ile Val Asn Ile Asn Gly Gln Leu 500
505 510 Pro Gln Arg Tyr Arg Ala Arg Ile Arg
Tyr Ala Ser Thr Thr Asn Leu 515 520
525 Arg Ile Tyr Val Thr Val Ala Gly Glu Arg Ile Phe Ala Gly
Gln Phe 530 535 540
Asn Lys Thr Met Asp Thr Gly Asp Pro Leu Thr Phe Gln Ser Phe Ser 545
550 555 560 Tyr Ala Thr Ile Asn
Thr Ala Phe Thr Phe Pro Met Ser Gln Ser Ser 565
570 575 Phe Thr Val Gly Ala Asp Thr Phe Ser Ser
Gly Asn Glu Val Tyr Ile 580 585
590 Asp Arg Phe Glu Leu Ile Pro Val Thr Ala Thr Leu Glu
595 600 605 21148PRTArtificial
SequenceCry1Fa-02 amino acid sequence 2Met Glu Asn Asn Ile Gln Asn Gln
Arg Val Pro Tyr Asn Cys Pro Asn 1 5 10
15 Asn Pro Glu Val Glu Ile Leu Asn Glu Glu Arg Ser Thr
Gly Arg Leu 20 25 30
Pro Leu Asp Ile Ser Leu Ser Leu Thr Arg Phe Leu Leu Ser Glu Phe
35 40 45 Val Pro Gly Val
Gly Val Ala Phe Gly Leu Phe Asp Leu Ile Trp Gly 50
55 60 Phe Ile Thr Pro Ser Asp Trp Ser
Leu Phe Leu Leu Gln Ile Glu Gln 65 70
75 80 Leu Ile Glu Gln Arg Ile Glu Thr Leu Glu Arg Asn
Arg Ala Ile Thr 85 90
95 Thr Leu Arg Gly Leu Ala Asp Ser Tyr Glu Thr Tyr Ile Glu Ala Leu
100 105 110 Arg Glu Arg
Glu Ala Asn Pro Asn Asn Ala Gln Pro Arg Glu Asp Val 115
120 125 Arg Ile Arg Phe Ala Asn Thr Asp
Asp Ala Leu Ile Thr Ala Thr Asn 130 135
140 Asn Phe Thr Leu Thr Ser Phe Glu Thr Pro Leu Leu Ser
Val Tyr Val 145 150 155
160 Gln Ala Ala Asn Leu His Leu Ser Leu Leu Arg Asp Ala Val Ser Phe
165 170 175 Gly Gln Gly Trp
Gly Leu Asp Ile Ala Thr Ala Asn Asn His Tyr Asn 180
185 190 Arg Leu Ile Asn Leu Ile His Arg Tyr
Thr Lys His Cys Leu Asp Thr 195 200
205 Tyr Asn Gln Gly Leu Glu Asn Leu Arg Gly Thr Asn Thr Arg
Gln Trp 210 215 220
Ala Arg Phe Asn Gln Phe Arg Arg Asp Leu Thr Leu Thr Val Leu Asp 225
230 235 240 Thr Val Ala Leu Phe
Pro Asn Tyr Asp Val Arg Thr Tyr Pro Thr Gln 245
250 255 Thr Ser Ser Gln Leu Thr Arg Glu Ile Tyr
Thr Ser Ser Val Ile Glu 260 265
270 Asp Ser Pro Val Ser Ala Asn Ile Pro Asn Gly Phe Asn Arg Ala
Glu 275 280 285 Phe
Gly Ala Arg Pro Pro His Leu Thr Asp Phe Met Asn Ser Leu Phe 290
295 300 Val Thr Ala Glu Thr Val
Arg Ser Gln Thr Val Arg Gly Gly His Leu 305 310
315 320 Val Ser Ser Arg Asn Thr Ala Gly Asn Arg Ile
Asn Phe Pro Ser Tyr 325 330
335 Gly Val Phe Asn Pro Gly Gly Ala Ile Trp Ile Ala Asp Glu Asp Pro
340 345 350 Arg Pro
Phe Tyr Arg Thr Leu Ser Asp Pro Val Phe Val Arg Gly Gly 355
360 365 Phe Gly Asn Pro His Tyr Val
Leu Gly Leu Arg Gly Val Ala Phe Gln 370 375
380 Gln Thr Gly Thr Asn His Thr Arg Thr Phe Arg Asn
Ser Gly Thr Ile 385 390 395
400 Asp Ser Leu Asp Glu Ile Pro Pro Gln Asp Asn Ser Gly Ala Pro Trp
405 410 415 Asn Asp Tyr
Ser His Val Leu Asn His Val Thr Phe Val Arg Trp Pro 420
425 430 Gly Glu Ile Ser Gly Ser Asp Ser
Trp Arg Ala Pro Met Phe Ser Trp 435 440
445 Thr His Arg Ser Ala Thr Pro Thr Asn Thr Ile Asp Pro
Glu Arg Ile 450 455 460
Thr Gln Thr Pro Leu Val Lys Ala His Thr Leu Gln Ser Gly Thr Thr 465
470 475 480 Val Val Arg Gly
Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg Arg Thr 485
490 495 Ser Gly Gly Pro Phe Ala Tyr Thr Ile
Val Asn Ile Asn Gly Gln Leu 500 505
510 Pro Gln Arg Tyr Arg Ala Arg Ile Arg His Ala Ser Thr Thr
Asn Leu 515 520 525
Arg Ile Tyr Val Thr Val Ala Gly Glu Arg Ile Phe Ala Gly Gln Phe 530
535 540 Asn Lys Thr Met Asp
Thr Gly Asp Pro Leu Thr Phe Gln Ser Phe Ser 545 550
555 560 Tyr Ala Thr Ile Asn Thr Ala Phe Thr Phe
Pro Met Ser Gln Ser Ser 565 570
575 Phe Thr Val Gly Ala Asp Thr Phe Ser Ser Gly Asn Glu Val Tyr
Ile 580 585 590 Asp
Arg Phe Glu Leu Ile Pro Val Thr Ala Thr Leu Glu Ala Glu Ser 595
600 605 Asp Leu Glu Arg Ala Gln
Lys Ala Val Asn Ala Leu Phe Thr Ser Ser 610 615
620 Asn Gln Ile Gly Leu Lys Thr Asp Val Thr Asp
Tyr His Ile Asp Arg 625 630 635
640 Val Ser Asn Leu Val Glu Cys Leu Ser Asp Glu Phe Cys Leu Asp Glu
645 650 655 Lys Lys
Glu Leu Ser Glu Lys Val Lys His Ala Lys Arg Leu Ser Asp 660
665 670 Glu Arg Asn Leu Leu Gln Asp
Pro Asn Phe Arg Gly Ile Asn Arg Gln 675 680
685 Leu Asp Arg Gly Trp Arg Gly Ser Thr Asp Thr Thr
Ile Gln Gly Gly 690 695 700
Asp Asp Ala Phe Lys Glu Asn Tyr Val Thr Leu Leu Gly Thr Ser Asp 705
710 715 720 Glu Arg Tyr
Pro Thr Tyr Leu Tyr Gln Lys Ile Asp Glu Ser Lys Leu 725
730 735 Lys Ala Tyr Thr Arg Tyr Gln Leu
Arg Gly Tyr Ile Glu Asp Ser Gln 740 745
750 Asp Leu Glu Ile Tyr Leu Ile Arg Tyr Asn Ala Lys His
Glu Thr Val 755 760 765
Asn Val Pro Gly Thr Gly Ser Leu Trp Pro Leu Ser Ala Pro Ser Pro 770
775 780 Ile Gly Lys Cys
Ala His His Ser His His Phe Ser Ser Asp Ile Asp 785 790
795 800 Val Gly Cys Thr Asp Leu Asn Glu Asp
Leu Gly Val Trp Ala Ile Phe 805 810
815 Lys Ile Lys Thr Gln Asp Gly His Ala Arg Leu Gly Asn Leu
Glu Phe 820 825 830
Leu Glu Glu Lys Pro Leu Val Gly Glu Ala Leu Ala Arg Val Lys Arg
835 840 845 Ala Glu Lys Lys
Trp Arg Asp Lys Arg Glu Lys Leu Glu Trp Glu Thr 850
855 860 Asn Thr Val Tyr Lys Glu Ala Lys
Glu Ser Val Asp Ala Leu Phe Val 865 870
875 880 Asn Ser Gln Tyr Asp Arg Leu Gln Ala Asp Thr Asn
Ile Ala Met Ile 885 890
895 His Ala Ala Asp Lys Arg Val His Ser Ile Arg Glu Ala Tyr Leu Pro
900 905 910 Glu Leu Ser
Val Ile Pro Gly Val Asn Ala Ala Ile Phe Glu Glu Leu 915
920 925 Glu Gly Arg Ile Phe Thr Ala Pro
Ser Leu Tyr Asp Ala Arg Asn Val 930 935
940 Ile Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp
Asn Val Lys 945 950 955
960 Gly His Val Asp Val Glu Glu Gln Asn Asn His Arg Ser Val Pro Val
965 970 975 Val Pro Glu Trp
Glu Ala Glu Val Ser Gln Glu Val Arg Ala Cys Pro 980
985 990 Gly Arg Gly Tyr Thr Leu Arg Val
Thr Ala Tyr Lys Glu Gly Tyr Gly 995 1000
1005 Glu Gly Cys Val Thr Ile His Glu Ile Glu Asn
Asn Thr Asp Glu 1010 1015 1020
Leu Lys Phe Ser Asn Cys Val Glu Glu Glu Val Tyr Pro Asn Asn
1025 1030 1035 Thr Val Thr
Cys Asn Asp Tyr Thr Ala Thr Gln Glu Glu His Glu 1040
1045 1050 Gly Thr Tyr Thr Ser Arg Asn Arg
Gly Tyr Asp Gly Ala Tyr Glu 1055 1060
1065 Ser Asn Ser Ser Ala Pro Ala Asp Tyr Ala Ser Ala Tyr
Glu Glu 1070 1075 1080
Lys Ala Tyr Thr Asp Gly Arg Arg Asp Asn Pro Cys Glu Pro Asn 1085
1090 1095 Arg Gly Tyr Gly Asp
Tyr Thr Pro Leu Pro Ala Gly Tyr Val Thr 1100 1105
1110 Lys Glu Leu Glu His Leu Pro Glu Thr Asp
Lys Val Trp Ile Glu 1115 1120 1125
Ile Gly Glu Thr Glu Gly Thr Leu Ile Val Asp Ser Val Glu Leu
1130 1135 1140 Pro Leu
Met Glu Glu 1145 31818DNAArtificial SequenceCry1Fa-01
nucleotide sequence 3atggagaaca acatacagaa tcagtgcgtc ccctacaact
gcctcaacaa tcctgaagta 60gagattctca acgaagagag gtcgactggc agattgccgt
tagacatctc cctgtccctt 120acacgtttcc tgttgtctga gtttgttcca ggtgtgggag
ttgcgtttgg cctcttcgac 180ctcatctggg gcttcatcac tccatctgat tggagcctct
ttcttctcca gattgaacag 240ttgattgaac aaaggattga gaccttggaa aggaatcggg
ccatcactac ccttcgtggc 300ttagcagaca gctatgagat ctacattgaa gcactaagag
agtgggaagc caatcctaac 360aatgcccaac tgagagaaga tgtgcgtata cgctttgcta
acacagatga tgctttgatc 420acagccatca acaacttcac ccttaccagc ttcgagatcc
ctcttctctc ggtctatgtt 480caagctgcta acctgcactt gtcactactg cgcgacgctg
tgtcgtttgg gcaaggttgg 540ggactggaca tagctactgt caacaatcac tacaacagac
tcatcaatct gattcatcga 600tacacgaaac attgtttgga tacctacaat cagggattgg
agaacctgag aggtactaac 660actcgccaat gggccaggtt caatcagttc aggagagacc
ttacacttac tgtgttagac 720atagttgctc tctttccgaa ctacgatgtt cgtacctatc
cgattcaaac gtcatcccaa 780cttacaaggg agatctacac cagttcagtc attgaagact
ctccagtttc tgcgaacata 840cccaatggtt tcaacagggc tgagtttgga gtcagaccac
cccatctcat ggacttcatg 900aactctttgt ttgtgactgc agagactgtt agatcccaaa
ctgtgtgggg aggacactta 960gttagctcac gcaacacggc tggcaatcgt atcaactttc
ctagttacgg ggtcttcaat 1020cccgggggcg ccatctggat tgcagatgaa gatccacgtc
ctttctatcg gaccttgtca 1080gatcctgtct tcgtccgagg aggctttggc aatcctcact
atgtactcgg tcttagggga 1140gtggcctttc aacaaactgg tacgaatcac acccgcacat
tcaggaactc cgggaccatt 1200gactctctag atgagatacc acctcaagac aacagcggcg
caccttggaa tgactactcc 1260catgtgctga atcatgttac ctttgtgcgc tggccaggtg
agatctcagg ttccgactca 1320tggagagcac caatgttctc ttggacgcat cgtagcgcta
cccccacaaa caccattgat 1380ccagagagaa tcactcagat tcccttggtg aaggcacaca
cacttcagtc aggaactaca 1440gttgtaagag ggccggggtt cacgggagga gacattcttc
gacgcactag tggaggacca 1500ttcgcgtaca ccattgtcaa catcaatggg caacttcccc
aaaggtatcg tgccaggata 1560cgctatgcct ctactaccaa tctaagaatc tacgttacgg
ttgcaggtga acggatcttt 1620gctggtcagt tcaacaagac aatggatacc ggtgatccac
ttacattcca atctttctcc 1680tacgccacta tcaacaccgc gttcaccttt ccaatgagcc
agagcagttt cacagtaggt 1740gctgatacct tcagttcagg caacgaagtg tacattgaca
ggtttgagtt gattccagtt 1800actgccacac tcgagtaa
181843447DNAArtificial SequenceCry1Fa-02 nucleotide
sequence 4atggagaaca acatacagaa tcagcgcgtc ccctacaact gccccaacaa
tcctgaagta 60gagattctca acgaagagag gtcgactggc agattgccgt tagacatctc
cctgtccctt 120acacgtttcc tgttgtctga gtttgttcca ggtgtgggag ttgcgtttgg
cctcttcgac 180ctcatctggg gcttcatcac tccatctgat tggagcctct ttcttctcca
gattgaacag 240ctgattgaac aaaggattga gaccttggaa aggaatcggg ccatcactac
ccttcgtggc 300ttagcagaca gctatgagac ctacattgaa gcactaagag agcgggaagc
caatcctaac 360aatgcccaac cgagagaaga tgtgcgtata cgctttgcta acacagatga
tgctttgatc 420acagccacca acaacttcac ccttaccagc ttcgagaccc ctcttctctc
ggtctatgtt 480caagctgcca acctgcactt gtcactactg cgcgacgctg tgtcgtttgg
gcaaggttgg 540ggactggaca tagctactgc caacaatcac tacaacagac tcatcaatct
gattcatcga 600tacacgaaac attgtttgga tacctacaat cagggattgg agaacctgag
aggtactaac 660actcgccaat gggccaggtt caatcagttc aggagagacc ttacacttac
tgtgttagac 720acagttgctc tctttccgaa ctacgatgtt cgtacctatc cgactcaaac
gtcatcccaa 780cttacaaggg agatctacac cagttcagtc attgaagact ctccagtttc
tgcgaacata 840cccaatggtt tcaacagggc tgagtttgga gccagaccac cccatctcac
ggacttcatg 900aactctttgt ttgtgactgc agagactgtt agatcccaaa ctgtgcgggg
aggacactta 960gttagctcac gcaacacggc tggcaatcgt atcaactttc ctagctacgg
ggtcttcaat 1020cccgggggcg ccatctggat tgcagatgaa gatccacgtc ctttctatcg
gaccttgtca 1080gatcctgtct tcgtccgagg aggctttggc aatcctcact atgtactcgg
tcttagggga 1140gtggcctttc aacaaactgg tacgaatcac acccgcacat tcaggaactc
cgggaccatt 1200gactctctag atgagatacc acctcaagac aacagcggcg caccttggaa
tgactactcc 1260catgtgctga atcatgttac ctttgtgcgc tggccaggtg agatctcagg
ttccgactca 1320tggagagcac caatgttctc ttggacgcat cgtagcgcta cccccacaaa
caccattgat 1380ccagagagaa tcactcagac tcccttggtg aaggcacaca cacttcagtc
aggaactaca 1440gttgtaagag ggccggggtt cacgggagga gacattcttc gacgcactag
tggaggacca 1500ttcgcgtaca ccattgtcaa catcaatggg caacttcccc aaaggtatcg
tgccaggata 1560cgccatgcct ctactaccaa tctaagaatc tacgttacgg ttgcaggtga
acggatcttt 1620gctggtcagt tcaacaagac aatggatacc ggtgatccac ttacattcca
atctttctcc 1680tacgccacta tcaacaccgc gttcaccttt ccaatgagcc agagcagttt
cacagtaggt 1740gctgatacct tcagttcagg caacgaagtg tacattgaca ggtttgagtt
gattccagtt 1800actgccacac tcgaggcaga gtctgacttg gaaagagcac agaaggcggt
gaatgctctg 1860ttcacttcgt ccaatcagat tgggctcaag acagatgtga ctgactatca
catcgatcgc 1920gtttccaacc ttgttgagtg cctctctgat gagttctgtt tggatgagaa
gaaggagttg 1980tccgagaagg tcaaacatgc taagcgactt agtgatgagc ggaacttgct
tcaagatccc 2040aactttcgcg ggatcaacag gcaactagac cgtggatgga ggggaagtac
ggacaccacc 2100attcaaggag gtgatgatgc gttcaaggag aactatgtca cgctcttggg
tacctctgac 2160gagcgctatc caacatacct gtaccagaag atagatgaat cgaaactcaa
agcctacaca 2220agataccagt tgagaggtta catcgaggac agtcaagacc ttgagatcta
cctcatcaga 2280tacaacgcca aacatgagac agtcaatgtg cctgggacgg gttcactctg
gccactttca 2340gccccaagtc ccatcggcaa gtgcgcccac cactcacacc acttctcctc
ggacatagac 2400gttggctgta ccgacctgaa cgaagacctc ggtgtgtggg cgatcttcaa
gatcaagact 2460caagatggcc atgccaggct aggcaatctg gagttcctag aagagaaacc
acttgttgga 2520gaagccctcg ctagagtgaa gagggctgag aagaagtgga gggacaagag
agagaagttg 2580gaatgggaaa caaacactgt gtacaaagaa gccaaagaaa gcgttgacgc
tctgtttgtg 2640aactcccagt atgataggct ccaagctgat accaacatag ctatgattca
tgctgcagac 2700aaacgcgttc atagcattcg ggaagcttac cttcctgaac ttagcgtgat
tccgggtgtc 2760aatgctgcta tctttgaaga gttagaaggg cgcatcttca ctgcaccctc
cttgtatgat 2820gcgaggaatg tcatcaagaa tggtgacttc aacaatggcc tatcctgctg
gaatgtgaaa 2880gggcacgtag atgtagaaga acagaacaat caccgctctg tccctgttgt
tcctgagtgg 2940gaagcagaag tttcacaaga agttcgtgcc tgtcccggcc gtggctacac
tcttcgtgtt 3000accgcgtaca aagaaggata cggagaaggt tgcgtcacca tacacgagat
tgagaacaac 3060accgacgagc tgaagttcag caactgcgtc gaggaggaag tctacccaaa
caacaccgta 3120acttgcaatg actacactgc gactcaagag gagcacgagg gtacttacac
ttctcgcaat 3180cgaggatacg atggagccta tgagagcaac tcttctgcac ccgctgacta
tgcatcagcc 3240tacgaggaga aggcttacac cgatggacgt agggacaacc cttgcgaacc
taacagaggc 3300tacggggact acacaccgtt accagccggc tatgtcacca aagagctaga
gcaccttcca 3360gaaaccgaca aggtttggat tgagattgga gaaacggaag gaacactcat
tgttgatagc 3420gtggagttac ctctgatgga ggaataa
344751848DNAArtificial SequenceCry1Ab nucleotide sequence
5atggacaaca acccaaacat caacgaatgc attccataca actgcttgag taacccagaa
60gttgaagtac ttggtggaga acgcattgaa accggttaca ctcccatcga catctccttg
120tccttgacac agtttctgct cagcgagttc gtgccaggtg ctgggttcgt tctcggacta
180gttgacatca tctggggtat ctttggtcca tctcaatggg atgcattcct ggtgcaaatt
240gagcagttga tcaaccagag gatcgaagag ttcgccagga accaggccat ctctaggttg
300gaaggattga gcaatctcta ccaaatctat gcagagagct tcagagagtg ggaagccgat
360cctactaacc cagctctccg cgaggaaatg cgtattcaat tcaacgacat gaacagcgcc
420ttgaccacag ctatcccatt gttcgcagtc cagaactacc aagttcctct cttgtccgtg
480tacgttcaag cagctaatct tcacctcagc gtgcttcgag acgttagcgt gtttgggcaa
540aggtggggat tcgatgctgc aaccatcaat agccgttaca acgaccttac taggctgatt
600ggaaactaca ccgaccacgc tgttcgttgg tacaacactg gcttggagcg tgtctggggt
660cctgattcta gagattggat tagatacaac cagttcagga gagaattgac cctcacagtt
720ttggacattg tgtctctctt cccgaactat gactccagaa cctaccctat ccgtacagtg
780tcccaactta ccagagaaat ctatactaac ccagttcttg agaacttcga cggtagcttc
840cgtggttctg cccaaggtat cgaaggctcc atcaggagcc cacacttgat ggacatcttg
900aacagcataa ctatctacac cgatgctcac agaggagagt attactggtc tggacaccag
960atcatggcct ctccagttgg attcagcggg cccgagttta cctttcctct ctatggaact
1020atgggaaacg ccgctccaca acaacgtatc gttgctcaac taggtcaggg tgtctacaga
1080accttgtctt ccaccttgta cagaagaccc ttcaatatcg gtatcaacaa ccagcaactt
1140tccgttcttg acggaacaga gttcgcctat ggaacctctt ctaacttgcc atccgctgtt
1200tacagaaaga gcggaaccgt tgattccttg gacgaaatcc caccacagaa caacaatgtg
1260ccacccaggc aaggattctc ccacaggttg agccacgtgt ccatgttccg ttccggattc
1320agcaacagtt ccgtgagcat catcagagct cctatgttct catggattca tcgtagtgct
1380gagttcaaca atatcattcc ttcctctcaa atcacccaaa tcccattgac caagtctact
1440aaccttggat ctggaacttc tgtcgtgaaa ggaccaggct tcacaggagg tgatattctt
1500agaagaactt ctcctggcca gattagcacc ctcagagtta acatcactgc accactttct
1560caaagatatc gtgtcaggat tcgttacgca tctaccacta acttgcaatt ccacacctcc
1620atcgacggaa ggcctatcaa tcagggtaac ttctccgcaa ccatgtcaag cggcagcaac
1680ttgcaatccg gcagcttcag aaccgtcggt ttcactactc ctttcaactt ctctaacgga
1740tcaagcgttt tcacccttag cgctcatgtg ttcaattctg gcaatgaagt gtacattgac
1800cgtattgagt ttgtgcctgc cgaagttacc ttcgaggctg agtactga
184862370DNAArtificial SequenceVip3A nucleotide sequence 6atgaacaaga
acaacaccaa gctctccaca cgggcacttc cctcctttat tgactacttt 60aatggcatct
atgggtttgc tacggggatc aaggacatta tgaacatgat cttcaagaca 120gacactggcg
gggatcttac gctcgacgag attcttaaga atcagcaact cctgaacgat 180atctctggca
agctggacgg cgtgaatggg tcacttaacg acctcatcgc tcaggggaat 240ctcaacacag
aactgtctaa ggagatcctc aagattgcaa atgagcagaa ccaagttctt 300aatgatgtga
acaataagct cgacgccatc aacacaatgc ttcgcgtgta cctcccaaag 360attactagca
tgctctcgga cgtcatgaag cagaactacg cgctgtccct tcaaattgag 420tatctgagca
agcagcttca agaaatctcg gacaagctgg atatcattaa tgtgaacgtc 480ctcatcaaca
gcaccctgac ggagattaca ccggcgtacc agaggatcaa gtatgtgaat 540gagaagttcg
aggaactcac ttttgctaca gaaacttcca gcaaggtcaa gaaggatggc 600tcaccagccg
acatcctgga tgagcttaca gaactcactg agctggcgaa gtccgtgacc 660aagaatgacg
tcgatggctt cgagttttac ctgaacacgt tccacgacgt tatggtgggc 720aacaatcttt
ttgggcggag cgctctcaag actgcatcgg aactgatcac caaggagaac 780gttaagacga
gcggctcgga ggtcgggaat gtttacaact tccttatcgt cctcaccgca 840ctccaggccc
aagcgtttct cacgctgacc acctgccgca agctcctcgg cctcgcagac 900atcgattaca
cctccatcat gaacgagcac ctgaacaagg agaaggagga gttccgcgtg 960aatatccttc
cgacactctc gaacactttt tctaatccaa actacgctaa ggtcaagggc 1020tccgacgaag
atgcaaagat gatcgttgag gccaagcctg gccatgcgct catcgggttc 1080gagatttcta
acgactcaat taccgtgctg aaggtctacg aggcgaagct caagcagaat 1140tatcaagtgg
acaaggattc tctgtcagag gttatctacg gcgacatgga taagctgctt 1200tgccctgatc
agtccgagca aatctactat acgaacaata ttgtcttccc caacgaatac 1260gtgatcacca
agattgactt tacgaagaag atgaagacac tccggtacga ggtgacggct 1320aacttctatg
attcgtctac gggcgagatc gacctcaaca agaagaaggt cgaatcatcc 1380gaggccgaat
acagaaccct gtcggcgaac gacgatggcg tgtatatgcc tcttggggtc 1440atttctgaga
ccttcctcac gcccatcaat ggctttgggc tccaggcaga tgagaactcc 1500cgcctgatca
cccttacgtg caagagctac ctcagggagc tgctgcttgc caccgacctc 1560tctaacaagg
aaacgaagct gatcgttccg ccatcaggct tcatctccaa tattgtggag 1620aacgggtcaa
ttgaggaaga taatctggaa ccgtggaagg ctaacaataa gaacgcatac 1680gttgaccaca
caggcggggt gaatggcact aaggcgctct atgtgcataa ggatggtggc 1740atctcccagt
tcattggcga caagctgaag ccgaagacag aatacgtgat tcaatatact 1800gtgaagggca
agccaagcat ccacctcaag gatgagaaca cagggtacat ccattacgaa 1860gatactaaca
acaacctgga ggactaccag acaatcaata agaggttcac aactggcact 1920gacctgaagg
gggtctatct tattctcaag tcccagaatg gcgatgaggc ctggggcgac 1980aacttcatca
ttctcgaaat ctcccctagc gagaagctcc tgagccccga gctgattaac 2040accaataact
ggacatccac tggcagcacg aatatctcgg ggaacaccct gacgctttac 2100cagggcggga
gaggcattct gaagcagaac ctccaactgg attcgttctc tacctacaga 2160gtctattttt
cagtttccgg cgacgcgaat gtgcgcatca ggaactcgcg ggaagtcctc 2220ttcgagaaga
gatacatgtc tggcgctaag gatgtgtcag aaatgttcac cacgaagttt 2280gagaaggaca
acttttatat cgaactgtcc caagggaata acctctacgg cggccccatt 2340gttcattttt
acgacgtgag catcaagtga
237071992DNAArtificial SequencePromoter of Maize Ubiquitin gene
7ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta
60agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta
120tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa
180tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga
240gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt
300ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg
360gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt
420agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata
480taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa
540aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga
600cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga
660cggcacggca tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg
720acttgctccg ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac
780ggcaggcggc ctcctcctcc tctcacggca cggcagctac gggggattcc tttcccaccg
840ctccttcgct ttcccttcct cgcccgccgt aataaataga caccccctcc acaccctctt
900tccccaacct cgtgttgttc ggagcgcaca cacacacaac cagatctccc ccaaatccac
960ccgtcggcac ctccgcttca aggtacgccg ctcgtcctcc cccccccccc ctctctacct
1020tctctagatc ggcgttccgg tccatggtta gggcccggta gttctacttc tgttcatgtt
1080tgtgttagat ccgtgtttgt gttagatccg tgctgctagc gttcgtacac ggatgcgacc
1140tgtacgtcag acacgttctg attgctaact tgccagtgtt tctctttggg gaatcctggg
1200atggctctag ccgttccgca gacgggatcg atttcatgat tttttttgtt tcgttgcata
1260gggtttggtt tgcccttttc ctttatttca atatatgccg tgcacttgtt tgtcgggtca
1320tcttttcatg cttttttttg tcttggttgt gatgatgtgg tctggttggg cggtcgttct
1380agatcggagt agaattctgt ttcaaactac ctggtggatt tattaatttt ggatctgtat
1440gtgtgtgcca tacatattca tagttacgaa ttgaagatga tggatggaaa tatcgatcta
1500ggataggtat acatgttgat gcgggtttta ctgatgcata tacagagatg ctttttgttc
1560gcttggttgt gatgatgtgg tgtggttggg cggtcgttca ttcgttctag atcggagtag
1620aatactgttt caaactacct ggtgtattta ttaattttgg aactgtatgt gtgtgtcata
1680catcttcata gttacgagtt taagatggat ggaaatatcg atctaggata ggtatacatg
1740ttgatgtggg ttttactgat gcatatacat gatggcatat gcagcatcta ttcatatgct
1800ctaaccttga gtacctatct attataataa acaagtatgt tttataatta ttttgatctt
1860gatatacttg gatgatggca tatgcagcag ctatatgtgg atttttttag ccctgccttc
1920atacgctatt tatttgcttg gtactgtttc ttttgtcgat gctcaccctg ttgtttggtg
1980ttacttctgc ag
19928253DNAArtificial SequenceTerminator of nopaline synthase gene
8gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg
60atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc
120atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac
180gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct
240atgttactag atc
25391176DNAArtificial SequencePhosphomannose isomerase gene 9atgcaaaaac
tcattaactc agtgcaaaac tatgcctggg gcagcaaaac ggcgttgact 60gaactttatg
gtatggaaaa tccgtccagc cagccgatgg ccgagctgtg gatgggcgca 120catccgaaaa
gcagttcacg agtgcagaat gccgccggag atatcgtttc actgcgtgat 180gtgattgaga
gtgataaatc gactctgctc ggagaggccg ttgccaaacg ctttggcgaa 240ctgcctttcc
tgttcaaagt attatgcgca gcacagccac tctccattca ggttcatcca 300aacaaacaca
attctgaaat cggttttgcc aaagaaaatg ccgcaggtat cccgatggat 360gccgccgagc
gtaactataa agatcctaac cacaagccgg agctggtttt tgcgctgacg 420cctttccttg
cgatgaacgc gtttcgtgaa ttttccgaga ttgtctccct actccagccg 480gtcgcaggtg
cacatccggc gattgctcac tttttacaac agcctgatgc cgaacgttta 540agcgaactgt
tcgccagcct gttgaatatg cagggtgaag aaaaatcccg cgcgctggcg 600attttaaaat
cggccctcga tagccagcag ggtgaaccgt ggcaaacgat tcgtttaatt 660tctgaatttt
acccggaaga cagcggtctg ttctccccgc tattgctgaa tgtggtgaaa 720ttgaaccctg
gcgaagcgat gttcctgttc gctgaaacac cgcacgctta cctgcaaggc 780gtggcgctgg
aagtgatggc aaactccgat aacgtgctgc gtgcgggtct gacgcctaaa 840tacattgata
ttccggaact ggttgccaat gtgaaattcg aagccaaacc ggctaaccag 900ttgttgaccc
agccggtgaa acaaggtgca gaactggact tcccgattcc agtggatgat 960tttgccttct
cgctgcatga ccttagtgat aaagaaacca ccattagcca gcagagtgcc 1020gccattttgt
tctgcgtcga aggcgatgca acgttgtgga aaggttctca gcagttacag 1080cttaaaccgg
gtgaatcagc gtttattgcc gccaacgaat caccggtgac tgtcaaaggc 1140cacggccgtt
tagcgcgtgt ttacaacaag ctgtaa
11761027DNAArtificial SequencePrimer 1 10cagtcaggaa ctacagttgt aagaggg
271121DNAArtificial SequencePrimer 2
11acgcgaatgg tcctccacta g
211227DNAArtificial SequenceProbe 1 12cgtcgaagaa tgtctcctcc cgtgaac
271321DNAArtificial SequencePrimer 3
13tggtggagaa cgcattgaaa c
211423DNAArtificial SequencePrimer 4 14gctgagcaga aactgtgtca agg
231528DNAArtificial SequenceProbe 2
15cggttacact cccatcgaca tctccttg
281627DNAArtificial SequencePrimer 5 16cagtcaggaa ctacagttgt aagaggg
271721DNAArtificial SequencePrimer 6
17acgcgaatgg tcctccacta g
211827DNAArtificial SequenceProbe 3 18cgtcgaagaa tgtctcctcc cgtgaac
271922DNAArtificial SequencePrimer 7
19attctcgaaa tctcccctag cg
222019DNAArtificial SequencePrimer 8 20gctgccagtg gatgtccag
192127DNAArtificial SequenceProbe 4
21ctcctgagcc ccgagctgat taacacc
27
User Contributions:
Comment about this patent or add new information about this topic: