Patent application title: CHIMERIC ANTIGENS FOR ELICITING AN IMMUNE RESPONSE
Inventors:
Rajan George (Edmonton, CA)
Bruce D. Hirsche
Lorne Tyrrell (Edmonton, CA)
Antoine Noujaim (Edmonton, CA)
Antoine Noujaim (Edmonton, CA)
Dakun Wang (Edmonton, CA)
Allan Ma (Edmonton, CA)
IPC8 Class: AC07K1646FI
USPC Class:
435 693
Class name: Micro-organism, tissue cell culture or enzyme using process to synthesize a desired chemical compound or composition recombinant dna technique included in method of making a protein or polypeptide antigens
Publication date: 2013-11-07
Patent application number: 20130295610
Abstract:
Disclosed herein are compositions and methods for eliciting immune
responses against antigens. In particular embodiments, the compounds and
methods elicit immune responses against antigens that are otherwise
recognized by the host as "self" antigens. The immune response is
enhanced by presenting the host immune system with a chimeric antigen
comprising an immune response domain and a target binding domain, wherein
the target binding domain comprises a xenotypic antibody fragment. By
virtue of the target binding domain, antigen presenting cells take up,
process, and present the chimeric antigen, eliciting both a humoral and
cellular immune response.Claims:
1-49. (canceled)
50. A method of producing a chimeric antigen comprising: (a) providing a microorganism or a cell; (b) culturing said microorganism or cell under conditions whereby the chimeric antigen is expressed.
51. The method of claim 50, wherein the microorganism or cell is a eukaryotic microorganism or cell.
52. The method of claim 50, wherein the cell is a yeast cell, a plant cell or an insect cell.
53. The method of claim 52, wherein the chimeric antigen is post-translationally modified to comprise glycosylation.
54. The method of claim 50, wherein the chimeric antigen is post-translationally modified to comprise a mannose glycosylation.
55. A method of producing a chimeric antigen comprising: (a) providing a microorganism or a cell, the microorganism or cell comprising a polynucleotide that encodes a target binding domain bound to a linker molecule; (b) culturing said microorganism or cell under conditions whereby the target binding domain-linker molecule is expressed; and (c) contacting the target binding domain-linker molecule and an immune response domain under conditions that allow for the binding of the linker to the immune response domain, the binding resulting in a chimeric antigen.
56. A polynucleotide encoding a chimeric antigen, said polynucleotide comprising a first polynucleotide portion encoding an immune response domain and a second polynucleotide portion encoding a target binding domain, wherein the target binding domain comprises an antibody fragment.
57. The polynucleotide of claim 56, wherein the antibody fragment is a xenotypic antibody fragment.
58. The polynucleotide of claim 56, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOs:39 and 41-51.
59. The polynucleotide of claim 56, wherein the polynucleotide encodes a chimeric antigen that is at least 90% identical to an entire amino acid sequence selected from the group consisting of the amino acid sequences set forth in SEQ ID NOs:40 and 52-62.
60. The polynucleotide of claim 56, wherein the polynucleotide selectively hybridizes under stringent conditions to a polynucleotide having a nucleotide sequence selected from the group consisting of nucleotide sequences set forth in SEQ ID NOs:39 and 41-51.
61. A vector comprising the polynucleotide of claim 57.
62. The vector of claim 61, wherein the polynucleotide is operably linked to a transcriptional regulatory element (TRE).
63. A microorganism or cell comprising the polynucleotide of claim 57.
Description:
RELATED APPLICATIONS
[0001] The present invention is a continuation-in-part of co-pending U.S. Ser. No. 10/365,620, filed Feb. 13, 2003, which application claims benefit of U.S. Provisional Application Nos. 60/390,564 filed Jun. 20, 2002 and 60/423,578 filed Nov. 5, 2002. The present application is also a continuation-in-part of co-pending international application PCT/IB04/000373, filed Feb. 14, 2004, which application designates the United States. The entire disclosure of each of these priority applications is hereby incorporated by reference.
I. INTRODUCTION
[0002] 1. Technical Field
[0003] The present invention relates to chimeric antigens (fusion proteins) for targeting and activating antigen presenting cells. In particular, the invention describes compositions and methods that contain or use one or more fusion proteins that contain a pre-selected HBV antigen or HCV antigen, and a xenotypic immunoglobulin fragment, wherein the fusion molecule is capable of binding and activating antigen presenting cells, especially dendritic cells.
[0004] 2. Background
[0005] Viral infectious diseases are major public healthcare issues. Human Hepatitis B virus (HBV) is a member of a family of DNA viruses that primarily infect the liver (Gust, et al., Intervirology 25:14-29 (1986). Other members of this family are woodchuck hepatitis B virus (WHV) (Summers, et al., Proc Natl Acad Sci USA 75(9): 4533-7 (1978)), duck hepatitis B virus (DHBV) (Mason, et al., J Virol 36(3): 829-36 (1980)) and heron hepatitis B virus (HHBV) (Sprengel, et al., J Virol 62(10): 3832-9 (1988)). These viruses share a common morphology and replication mechanisms, but are species specific for infectivity (Marion, Prog Med Virol. 35:43-75 (1988)).
[0006] HBV primarily infects liver cells and can cause acute and chronic liver disease resulting in cirrhosis and hepatocellular carcinoma. Infection occurs through blood and other body fluids. Approximately 90% of the individuals infected by HBV are able to clear the infection, while the remaining 10% become chronic carriers of the virus with a high probability of developing cirrhosis of the liver and hepatocellular carcinoma. The World Health Organization statistics show that more than 2 billion people have been infected by HBV and among these, 370 million are chronically infected by the virus (Beasley, Cancer 61(10):1942-56 (1988); Kane Vaccine 12:547-49 (1995)). Prophylactic vaccines based on HBV surface antigen (HBsAg) have been very effective in providing protective immunity against HBV infections. These vaccines have been developed from HBsAg purified from plasma of chronic HBV carriers, produced by recombinant DNA techniques as well as through the use of synthetic peptides (see, e.g. U.S. Pat. Nos. 4,599,230 and 4,599,231). These vaccines are highly effective in the prevention of infection, but are ineffective in eradicating established chronic infections.
[0007] Human Hepatitis B Virus (HBV) belongs to the family of Hepadnaviruses. Other members of this family are Duck Hepatitis B Virus (DHBV), Woodchuck Hepatitis Virus (WHV) Ground Squirrel Hepatitis B Virus (GSHV) and Heron Hepatitis B Virus (HHBV). Although these viruses have similar morphology and replication mechanism, they are fairly species specific. Consequently, they infect only very closely related species. These viruses have a DNA genome ranging in size from 3.0-3.2 Kb, with overlapping reading frames to encode several proteins. HBV genome encodes several proteins. Among these, the surface antigens: Large (S1/S2/S), Medium (S2/S) and Small (S) are proposed to be involved in the binding of the virus to the cellular receptors for uptake. The Core protein (Core) forms capsids, which encapsulate the partially double stranded DNA genome. Polymerase/Reverse Transcriptase (Pol) protein is a multifunctional enzyme necessary for the replication of the virus. The X protein has been proposed to have many properties, including the activation of Src kinases (Ganem, Science 294(5550):2299-300 (2001)). The present invention describes DNA sequences and amino acid compositions of the surface antigen proteins S1/S2, S1/S2/S as well as Core protein fusion proteins with a xenotypic monoclonal antibody (mAb) fragment.
[0008] DHBV, another member of the hepadnaviral family, infects pekin ducks, is species specific, and has served as an animal model for studying the hepatitis B viruses. DHBV has a DNA genome and it codes for surface antigens PreS and PreS/S, Core protein (Core) and Polymerase/Reverse Transcriptase. The present invention also describes DNA sequences and deduced amino acid sequences of fusion proteins of the PreS, PreS/S and Core proteins with a fragment of a xenotypic mAb. These fusion proteins can be used to elicit a broad immune response in chronic viral infections, thus as therapeutic vaccine.
[0009] Hepatitis C virus (HCV) is a member of the flaviviridae family of RNA viruses. The route of infection is via blood and body fluids and over 50% of the patients become chronic carriers of the virus. Persistent infection results in chronic active hepatitis, which may lead to liver cirrhosis and hepatocellular carcinoma (Saito et. al., PNAS USA 87:6547-6549 (1990)).
[0010] Approximately 170 million people worldwide are chronic carriers of HCV (Wild and Hall, Mutation Res. 462: 381-393 (2000)). There is no prophylactic vaccine available at present. Current therapy is interferon α-2b and ribavirin, either alone or as combination therapy. The significant side effects for interferon treatment and the development of mutant strains are major drawbacks to the current therapy. Moreover, interferon therapy is effective only in 20% of the patients. Therapeutic vaccines to enhance host immune system to eliminate chronic HCV infection will be a major advancement in the treatment of this disease.
[0011] HCV genome is a positive sense single stranded RNA molecule of approximately 9.5 Kb in length. This RNA, which contains both 5' and 3' untranslated regions, codes for a single polyprotein that is cleaved into individual proteins and catalyzed by both viral and host proteases (Clarke, J. Gen. Virol. 78: 2397-2410 (1997)). The structural proteins are Core, Envelope E1 & E2 and P7. The non-structural proteins are NS2, NS3, NS4A, NS4B, NS5A and NS5B. Core forms capsids. E1, E2 are envelope proteins, also called "Hypervariable region" due to the high rate of mutations. NS3 is a Serine Protease, the target of several protease inhibitors as antivirals for HCV. NS5B is the RNA Polymerase enzyme. NS5A has recently been suggested to have a direct role in the replication of the virus in the host by counteracting the interferon response (Tan, and Katze, Virology 284:1-12 (2001)) that augments the immune function.
[0012] When a healthy host (human or animal) encounters an antigen (such as a protein derived from a bacterium, virus or parasite), normally the host initiates an immune response. This immune response can be a humoral response and/or a cellular response. In the humoral response antibodies are produced by B cells and are secreted into the blood and/or lymph in response to an antigenic stimulus. The antibody then neutralizes the antigen, e.g. a virus, by binding specifically to antigens on its surface, marking it for destruction by phagocytotic cells and/or complement-mediated mechanisms. The cellular response is characterized by the selection and expansion of specific helper and cytotoxic T-lymphocytes capable of directly eliminating the cells that contain the antigen.
[0013] In many individuals, the immune system does not respond to certain antigens. When an antigen does not stimulate the production of a specific antibody and/or killer T cells, the immune system is unable to prevent the resultant disease. As a result, the infectious agent, e.g. a virus, can establish a chronic infection and the host immune system becomes tolerant to the antigens produced by the virus. The mechanism by which the virus evades the host immune machinery is not clearly established. The best-known examples of chronic viral infections include Hepatitis B, Hepatitis C, Human Immunodeficiency Virus, Human Papilloma Virus and Herpes Simplex Virus.
[0014] In chronic states of viral infections, the virus escapes the host immune system. Viral antigens are recognized as "self," and thus not recognized by the antigen-presenting cells. The lack of proper presentation of the appropriate viral antigen to the host immune system may be a contributing factor. The success in eliminating the virus will result from the manner in which the antigen is processed and presented by the antigen presenting cells (APCs) and the involvement of the regulatory and cytotoxic T cells. The major participant in this process is the Dendritic Cell (DC), which captures and processes antigens, expresses lymphocyte co-stimulatory molecules, migrates to lymphoid organs, and secretes cytokines to initiate immune responses. Dendritic cells also control the proliferation of B and T lymphocytes, which are the mediators of immunity (Steinman, et al., Hum Immunol 60(7):562-7 (1999)). The generation of a cytotoxic T lymphocyte (CTL) response is critical in the elimination of the virus infected cells and thus a cure of the infection.
[0015] Antigen presenting cells process the encountered antigens differently depending on the localization of the antigen (Steinman et al., 1999, supra). Exogenous antigens are processed within the endosomes of the APC and the generated peptide fragments are presented on the surface of the cell complexed with Major Histocompatibility Complex (MHC) Class II. The presentation of this complex to CD4.sup.+ T cells stimulates the CD4.sup.+ T helper cells. As a result, cytokines secreted by the helper cells stimulate B cells to produce antibodies against the exogenous antigen (humoral response). Immunizations using antigens typically generate antibody response through this endosomal antigen processing pathway.
[0016] On the other hand, intracellular antigens are processed in the proteasome and the resulting peptide fragments are presented as complexes with MHC Class I on the surface of APCs. Following binding of this complex to the co-receptor CD8 molecule, antigen presentation to CD8.sup.+ T cells occurs which results in a cytotoxic T lymphocyte (CTL) immune response to remove the host cells that carry the antigen.
[0017] In patients with chronic viral infections, since the virus is actively replicating, viral antigens will be produced within the host cell. Secreted antigens will be present in the circulation. As an example, in the case of chronic HBV carriers, virions and HBV surface antigens and a surrogate for core antigens (in the form of e-antigen) can be detected in the blood. An effective therapeutic vaccine should be able to induce strong CTL responses against an intracellular antigen or an antigen delivered into the appropriate cellular compartment so as to activate the MHC Class I processing pathway. An effective prophylactic vaccine will induce a strong humoral immune response, thus producing antibodies to neutralize circulating virions.
[0018] These findings would suggest that a therapeutic vaccine that can induce a strong CTL response should be processed through the proteasomal pathway and presented via the MHC Class I (Larsson, et al., Trends Immunol 22(3):141-8 (2001)). This can be achieved either by producing the antigen within the host cell, or it can be delivered to the appropriate cellular compartment so that it gets processed and presented so as to elicit a cellular response. Several approaches have been documented in the literature for the intracellular delivery of the antigen. Among these, viral vectors (Lorenz, et al., Hum Gene Ther 10(7):1095-103 (1999)), the use of cDNA-transfected cells (Donnelly, et al., Annu Rev Immunol 15: 617-48 (1997)) as well as the expression of the antigen through injected cDNA vectors (Lai and Bennett, Crit Rev Immunol 18(5): 449-84 (1998); U.S. Pat. No. 5,589,466), have been documented. Further, DNA vaccines expressing antigens targeted to dendritic cells have been described (You, et al., Cancer Res 61:3704-3711 (2001)).
[0019] Delivery vehicles capable of carrying the antigens to the cytosolic compartment of the cell for MHC Class I pathway processing have also been used. The use of adjuvants to achieve the same goal has been described in detail by (Hilgers, et al., Vaccine 17(3):219-28 (1999)) Another approach is the use of biodegradable microspheres in the cytoplasmic delivery of antigens (Newman, et al., J Biomed Mater Res 50(4):591-7 (2000)), exemplified by the generation of a Th1 immune response against ovalbumin peptide (Newman, et al., J Control Release 54(1):49-59 (1998); Newman, et al., J Biomed Mater Res 50(4): 591-7 (2000)). It has also been shown that PLGA nanospheres are taken up by the most potent antigen presenting cells, dendritic cells (Newman, et al., J Biomed Mater Res 60(3): 480-6 (2002)).
[0020] Dendritic cells derived from blood monocytes, by virtue of their capability as professional antigen presenting cells have been shown to have great potential as immune modulators that stimulate primary T cell response (Steinman, et al., Hum Immunol 60(7): 562-7 (1999); Banchereau and Steinman, Nature 392(6673):245-52 (1998)). This property of the DCs to capture, process, present the antigen and stimulate naive T cells has made them very important tools for therapeutic vaccine development (Laupeze, et al., Hum Immunol 60(7): 591-7 (1999)). Targeting of the antigen to the DCs is the crucial step in the antigen presentation and the presence of receptors on the DCs for the Fc region of monoclonal antibodies have been exploited for this purpose (Regnault, et al., J Exp Med 189(2): 371-80 (1999)). Examples of this approach include ovarian cancer mAb-B43.13, Anti-PSA antibody as well as Anti-HBV antibody antigen complexes (Wen, et al., Int Rev Immunol 18(3): 251-8 (1999)). Cancer immunotherapy using DCs loaded with tumor associated antigens have been shown to produce tumor-specific immune responses and anti-tumor activity (Campton, et al., J Invest Dermatol 115(1):57-61 (2000); Fong and Engleman, Annu Rev Immunol 18: 245-73 (2000)). Promising results were obtained in clinical trials in vivo using tumor-antigen-pulsed DCs (Tarte and Klein, Leukemia 13(5): 653-63 (1999)). These studies clearly demonstrate the efficacy of using DCs to generate immune responses against cancer antigens.
[0021] The primary goal in antiviral therapy is the complete elimination of the infectious virus. In the case of chronic hepatitis B, this will result in the eradication of hepatitis B viremia, the arrest of progressive liver injury, normalization of liver transaminase activity, resolution of hepatic inflammation, elimination of HBV cccDNA (covalently closed circular DNA) reservoir, and improve the quality of life of the patient.
[0022] Two forms of antiviral therapies are currently in use for the treatment of chronic hepatitis B infections. First, antiviral compounds, particularly nucleoside analogues, which are DNA chain terminators, suppress the viral replication resulting in a decrease in HBV DNA and HBV antigens. The effectiveness of the antiviral compound depends on the level of immune help from the host. The second therapy involves the use of immune modulators, such as interferons (e.g., interferon α-2b), to stimulate the immune system into mounting a generalized humoral and cellular response against the viral infection.
[0023] The most widely used antiviral nucleoside agent is lamivudine, a cytosine analogue that acts as a chain terminator and inhibits HBV replication. The drug is well tolerated and has marked virus-suppressive activity in the majority of patients; complete clearance of the virus occurs if the patient has elevated levels of liver inflammatory enzymes. This suggests that a strong involvement of the host immune system is needed to clear the HBV infection. While lamivudine suppresses HBV replication in HBV carriers, replication recurs if therapy is stopped. The emergence of resistant mutants also is a possibility.
[0024] Interferons are biologic response modifiers that have a variety of therapeutic activities, including antiviral, immunomodulatory, and antiproliferative effects. They enhance T cell helper activity, cause maturation of B lymphocytes, inhibit T cell suppressors, and enhance HLA type I expression. While interferons have only mild to moderate virus-suppressive activities, they induce a generalized, non-specific but clinically important immune response in receptive individuals.
[0025] The indications for interferon therapy are specific: patients must be HbeAg-positive, have detectable HBV DNA in the serum, and have a serum ALT level double the upper limit of normal. When these patients are treated with a standard course of interferon-α therapy (30-35 MU interferon/week for 16-26 weeks), the response rate is 40-50%. A response is defined as loss of HBeAg, development of anti-HBe, loss of HBV DNA (by non-PCR assays), and normalization of ALT. A sustained response encompasses the foregoing outcomes plus generating effective immune responses. The responses are usually durable, are associated with improvement in liver histology, and produce a better long-term outcome, e.g., with fewer patients progressing to cirrhosis and/or hepatocellular carcinoma.
[0026] For most chronic hepatitis B patients, monotherapy with a standard 16 week course of interferon-α or a one year course of lamivudine is effective in only 30-40% of patients. It is reasonable to assume that combining the antiviral effect of one drug with a second agent promoting immune modulation may improve the response rate beyond that seen with either agent alone. However, in order to produce more effective and specific immune responses against chronic hepatitis B infections than are currently achievable with current biological response modifiers, an agent that induces highly specific cellular immune responses directed against cells harboring the viruses, viral antigens or cccDNA must be employed. The chimeric antigens described in the present invention are such agents.
[0027] The goals of treatment of chronic hepatitis C include eradication of the HCV infection, improvement or normalization of liver histology, prevention of progression of the viral liver infection to cirrhosis and hepatocellular carcinoma, extension of patient survival, improvement of the quality of life, and a reduction in the size of the infectious pool of hepatitis C virus patients in order to reduce the wide spread transmission of the disease.
[0028] Two forms of treatment of chronic hepatitis C are currently in use: pegylated interferon-α used alone and conventional or pegylated interferon-α used in combination with ribavirin. Ribavirin is a purine nucleoside analogue that as monotherapy has little effect on HCV viremia, despite the fact that it significantly reduces serum ALT levels in some patients. While the exact nature of the synergism of ribavirin and interferon has not been elucidated, the efficacy of the combination exceeds that of either agent used alone.
[0029] While the mechanism of action of ribavirin in hepatitis C infection is not understood, a number of mechanisms have been proposed including: (a) the enhancement of host T cell-mediated immunity against viral infection through switching the T cell phenotype from type 2 to type 1; (b) the inhibition of the host enzyme inosine monophosphate dehydrogenase (IMPDH); (c) the direct inhibition of HCV, including NS5B-encoded RNA-dependent RNA polymerase (RdRp); and (d) its action as an RNA mutagen that drives a rapidly mutating RNA virus over the threshold to "error catastrophe."
[0030] Interferons are biologic response modifiers that have a variety of therapeutic activities including antiviral, immunomodulatory, and antiproliferative effects. They enhance T cell helper activity, cause maturation of B lymphocytes, inhibit T cell suppressors, and enhance HLA type I expression. While interferons have only mild to moderate virus-suppressive activities, they induce a generalized, non-specific but clinically important immune response in receptive individuals that reduces viral levels.
[0031] The treatment options for previously untreated patients with hepatitis C include pegylated interferon monotherapy and a combination of conventional or pegylated interferon with ribavirin. The overall sustained response rate (SR) of ribavirin combined with conventional interferon α-2b therapy for 48 weeks is about 40%. The SR for patients infected with genotype 2 or 3 patients is about 60%, whereas the SR is about 30% for patients infected with genotype 1 (Lauer and Walker, NEJ Med 345:41-42 (2001)). However, the combination is associated with significantly more side effects than conventional interferon alone. Up 20% of patients receiving the combination required a reduction of dose or discontinuation of therapy because of the side effects. Nevertheless, the combination represents a significant improvement in the treatment of chronic hepatitis C and has become the current standard of care.
[0032] Conventional interferon-α is rapidly cleared from the circulation by the kidneys. During the first 12 hours after interferon administration, interferon-α causes the viral levels to decrease significantly, but after that time, the viral levels begin to increase because of low blood levels of interferon. Sustained viral suppression can be achieved by the administration of pegylated interferon, which is administered only once a week and produces constant blood levels of interferon for 7 days. Thus, there is no need for the daily dosing that is required with conventional interferon. Per the Peg-Intron® product insert, the overall SR in previously untreated chronic hepatitis C patients who received pegylated interferon for 48 weeks was about 39%, which is comparable to the previously reported SR with combined conventional interferon α-2b and ribavirin combination (Rebetron®).
[0033] In studies comparing combined pegylated interferon and ribavirin to the Rebetron® combination, the pegylated interferon and ribavirin combinations appeared to be more effective, especially in patients infected with HCV genotype 1. For patients infected with this genotype, the sustained response rate (SR) was about 45% for the pegylated interferon and ribavirin combination compared with about 35% for the Rebetron® combination. As expected, the overall response rates in HCV genotype 2 or 3 patients for each of these treatment groups were better than those obtained with HCV genotype 1 patients (SR 60% to 80%).
[0034] In a trial comparing Rebetron® with varying doses of PEG-Intron® (pegylated interferon α-2a) and ribavirin, the patients were predominately male Caucasians, more frequently infected with HCV genotype 1, and had a mean age of 44 years (Mann, et al., Lancet 358:958-965 (2001)). The best-sustained virologic response of 54% was obtained with PEG-Intron® plus ribavirin given for 48 weeks. Patients with HCV genotype 1 had an SR of about 40%, while patients with HCV genotypes 2 and 3 after 48 weeks of therapy had the best sustained virologic response rate of approximately 80%, regardless of whether they received Rebetron® or PEG-Intron® and ribavirin. Adverse events in the PEG-Intron® plus ribavirin group that were more than 10% more frequent than in the standard interferon and ribavirin group included fever, nausea, and injection site reaction. Twelve percent of patients on PEG-Intron® plus ribavirin required dose modifications due to an adverse event, while 34% had dose modifications due to a lab abnormality.
[0035] In another large, multinational, multicenter trial of plus ribavirin, the three arms of the study were Pegasys® plus placebo, standard interferon α-2b plus ribavirin (Rebetron®), and Pegasys® plus ribavirin, which were all given for 48 weeks (Fried et al., N Engl J. Med. 347(13):975-982 (2002)). There were 1,149 predominantly male patients in the trial with an average age of about 40; 12% to 15% of patients had cirrhosis and approximately two-thirds had infection with HCV genotype 1. The overall sustained virologic response with Pegasys® plus ribavirin was 56% compared to 30% in the Pegasys® plus placebo group, and 45% in the standard interferon α-2b plus ribavirin (Rebetron®) group. Patients with HCV genotype I had a 46% SR with Pegasys® plus ribavirin, while patients with genotypes 2 and 3 had a 76% SR. Fever, myalgia, rigors, and depression were relatively less frequent with Pegasys® plus ribavirin compared to standard interferon α-2b plus ribavirin (Rebetron®). In the Pegasys® plus ribavirin group, the rate of discontinuation of therapy due to an adverse event was 7% and due to a lab abnormality was 3%.
[0036] Despite vigorous treatment with the current standard combination therapy of interferon-α and ribavirin, there are still a large proportion of patients with chronic HCV who do not respond. In order to produce an improved sustained response rate in the treatment of chronic hepatitis C infection, an agent that induces highly specific cellular immune responses directed against cells harboring the hepatitis C viruses must be employed. Such an agent is the chimeric antigen hepatitis C vaccine.
[0037] There is no prophylactic vaccine available to prevent new HCV infections. The attempts to develop preventative vaccines using the envelope proteins of HCV have been unsuccessful due to the high rate of mutation of the virus. Similarly, no therapeutic vaccine is available for the treatment of existing and/or chronic HCV infections. Chimeric antigens described in the present invention incorporating immunological attributes of HBV antigen and xenotypic monoclonal antibody have been shown to elicit both a strong humoral and strong cellular immune response against viral antigen in animal models. Chimeric antigens described in the present invention incorporating HCV antigens and xenotypic monoclonal antibody fragment could be used for prophylaxis and/or treatment.
II. SUMMARY OF THE INVENTION
[0038] The present invention pertains to compositions and methods for targeting and activating antigen presenting cells, one of the first steps in eliciting an immune response. The compositions of the present invention include a novel class of bifunctional molecules (hereinafter designated as "chimeric antigens") that include an immune response domain (IRD), for example a recombinant protein, linked to a target binding domain (TBD), for example, a xenotypic antibody fragment portion. More specifically, the chimeric antigens are molecules that couple viral antigens, such as Hepatitis B Core or surface proteins, to a xenotypic Fc fragment, such as a murine immunoglobulin G fragment.
[0039] The compositions and methods of the present invention are useful for targeting and activating antigen presenting cells. The present invention may be useful for inducing cellular and humoral host immune responses against any viral antigen associated with a chronic viral infection, including but not limited to Hepatitis B, Hepatitis C, Human Immunodeficiency Virus, Human Papilloma Virus (HPV), and Herpes Simplex Virus. The invention may also be applicable to prophylactic vaccines, especially for viral disease, and to all autologous antigens in diseases such as cancer and autoimmune disorders.
[0040] The present invention relates to chronic infectious diseases, and in particular to chronic HBV infections. The presentation of HBV antigens to elicit a cellular or humoral immune response by the use of vaccine molecules designed to target the vaccines to DCs whereby the HBV-associated antigens treated as "self" during the chronic infection will be recognized as "foreign" and the host's immune system will mount a CTL response to eliminate HBV-infected cells is provided. At the same time, the antibody response to the circulating HBV antigen will bind to the antigen and remove it from the circulation. Accordingly, the present invention is designed to produce vaccines that can induce a broad immune response in patients who have chronic viral infections such as HBV.
[0041] One or more embodiments of the present invention include one or more chimeric antigens suitable for initiating an immune response against Hepatitis B virus (HBV). In these embodiments of the invention, selected HBV antigens are linked to fragments of xenotypic antibodies. The resulting chimeric antigens are capable of targeting and activating antigen presenting cells, such as dendritic cells.
[0042] One or more embodiments of the present invention include one or more chimeric antigens suitable for initiating an immune response against Hepatitis C virus (HCV). In these embodiments of the invention, selected HCV antigens are linked to fragments of xenotypic antibodies. The resulting chimeric antigens are capable of targeting and activating antigen presenting cells, such as dendritic cells.
[0043] The present invention also includes methods for cloning and producing fusion proteins in a heterologous expression system. In preferred embodiments of the invention, the cloning and production methods introduce unique post-translational modifications including, but not limited to glycosylation on the expressed fusion proteins.
[0044] In order to provide efficient presentation of the antigens, the inventors have developed a novel murine monoclonal antibody Fc fragment-antigen (viral antigenic protein/peptide) fusion protein. This molecule, by virtue of the Fc fragment is recognized at a higher efficiency by the antigen-presenting cells (dendritic cells) as xenotypic, and the viral antigen is processed and presented as complexes with Major Histocompatibility Complex (MHC) Class I. This processing and antigen presentation is expected to result in the up-regulation of the response by cytotoxic T-lymphocytes, resulting in the elimination of virus-infected cell population. In addition, due to antigen presentation by MHC Class II molecules, humoral response also aids in the antibody response to the viral infection.
[0045] The bifunctional nature of the molecule helps to target the antigen to the proper antigen-presenting cells (dendritic cells), making it a unique approach in the therapy of chronic infectious diseases by specifically targeting the antigen presenting cells with the most effective stoichiometry of antigen to antibody. This is useful to the development of therapeutic vaccines to cure chronic viral infections such as Hepatitis B, Hepatitis C, Human Immunodeficiency Virus, Human Papilloma Virus and Herpes Simplex Virus, and may also be applicable to all autologous antigens in diseases such as cancer and autoimmune disorders.
[0046] The administration of these fusion proteins can elicit a broad immune response from the host, including both cellular and humoral responses. Thus, they can be used as therapeutic vaccines to treat subjects that are immune tolerant to a particular infection.
[0047] One aspect of the invention provides chimeric antigens for eliciting an immune response, said chimeric antigen comprising an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. The immune response can be a humoral and/or cellular response, elicited in vivo or ex vivo. In the case where a cellular response is elicited, the immune response can be a Th1 response, a Th2 response and/or a CTL response. The chimeric antigen can comprise more than one immune response domain, or an immune response domain that can confer immunity to more than one antigen. In certain embodiments, the chimeric antigen of the invention further comprises a 6×His-peptide, a protease cleavage site, and/or a linker for linking the immune response domain and the target binding domain. In preferred embodiments, the immune response domain comprises one or more immunogenic portions of a protein selected from the group consisting of a hepatitis B virus (HBV) protein, a duck hepatitis B virus (DHBV) protein, a hepatitis C virus (HCV) protein or a protein from Human Papilloma Virus (HPV), Human Immunodeficiency Virus (HIV), Herpes Simplex Virus (HSV) or a cancer antigen. In other preferred embodiments, the xenotypic antibody fragment comprises an Fc fragment, an antibody hinge region, a portion of or an entire CH1 domain, a portion of or an entire CH2 domain and/or a portion of or an entire CH3 domain. In a particularly preferred embodiment, the xenotypic antibody fragment is a mouse antibody fragment. The target binding domain, optionally, can also comprise a 6×His tag, a protease cleavage site (preferably a rTEV protease cleavage site) and/or a linker for linking the immune response domain and the target binding domain. The linker may be leucine zippers, biotin/avidin or a covalent peptide linkage, such as SRPQGGGS (SEQ ID NO: 28). In a preferred embodiment, the chimeric antigen is glycosylated. The immune response domain and/or the target binding domain can be glycosylated. In a particularly preferred embodiment, the chimeric antigen is mannose glycosylated by either high mannose glycosylation or by pauci mannose glycosylation.
[0048] Another aspect of the invention provides chimeric antigens for eliciting an immune response to HBV, said chimeric antigen comprising an immune response domain and a target binding domain, wherein the immune response domain comprises a protein selected from the group consisting of a HBV Core protein, a HBV S protein, a HBV S1 protein, a HBV S2 protein, and combinations thereof, and wherein the target binding domain comprises a xenotypic antibody fragment. The immune response can be a humoral and/or cellular response, elicited in vivo or ex vivo. When a cellular response is elicited, the immune response can be a Th1 response and or a Th2 response.
[0049] Yet another aspect of the invention relates to chimeric antigens for eliciting an immune response to DHBV, said chimeric antigens comprising an immune response domain and a target binding domain, wherein the immune response domain comprises a protein selected from the group consisting of a DHBV Core protein, a DHBV Pre-S protein, a DHBV PreS/S protein, and combinations thereof, and wherein the target binding domain comprises a xenotypic antibody fragment. The immune response can be a humoral and/or cellular response, elicited in vivo or ex vivo. When a cellular response is elicited, the immune response can be a Th1 response and or a Th2 response.
[0050] An aspect of the invention provides chimeric antigens for eliciting an immune response to HCV, said chimeric antigens comprising an immune response domain and a target binding domain, wherein the immune response domain comprises a protein selected from the group consisting of a HCV Core (1-191) protein, a HCV Core (1-177) protein, a HCV E1 protein, a HCV E2 protein, a HCV E1-E2 protein, a HCV NS3 protein, a HCV NS5A protein, and combinations thereof, and wherein the target binding domain comprises a xenotypic antibody fragment. The immune response can be a humoral and/or cellular response, elicited in vivo or ex vivo. When a cellular response is elicited, the immune response can be a Th1 response and or a Th2 response.
[0051] Another aspect of the invention provides methods of enhancing antigen presentation in antigen presenting cells, said method comprising administering, to the antigen presenting cells, a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. In a preferred embodiment, the antigen presenting cells are dendritic cells.
[0052] An aspect of the invention relates to methods of activating antigen presenting cells comprising contacting an antigen presenting cell with a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. The antigen presenting cell can be contacted with the chimeric antigen in vivo or ex vivo. In another preferred embodiment, the contacting takes place in a human.
[0053] Yet another aspect of the invention provides methods of eliciting an immune response, said method comprising administering to a subject a composition comprising a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. The immune response can be a humoral and/or cellular response, elicited in vivo or ex vivo. When a cellular response is elicited, the immune response can be a Th1 response and/or a Th2 response. In a preferred embodiment, the cellular immune response is a Th1 response, a Th2 response or both a Th1 and a Th2 response.
[0054] Another aspect of the invention provides methods of treating immune-treatable conditions comprising administering, to a subject in need thereof, a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. Preferably, the immune-treatable condition is an infection or a cancer. More preferably, the immune-treatable condition is a viral infection, even more preferably, a chronic viral infection. Most preferably, the immune-treatable condition is a chronic hepatitis B viral infection or a chronic hepatitis C viral infection. For the treatment of HBV, preferably the immune response domain comprises an antigenic portion of a protein selected from the group consisting of a HBV Core protein, a HBV S protein, a HBV S1 protein, a HBV S2 protein, and combinations thereof. For the treatment of HCV, preferably the immune response domain comprises an antigenic portion of a protein selected from the group consisting of a HCV Core (1-191) protein, a HCV Core (1-177) protein, a HCV E1 protein, a HCV E2 protein, a HCV E1-E2 protein, a HCV NS3 protein, a HCV NS5A protein, and combinations thereof.
[0055] Another aspect of the invention provides methods of vaccinating a subject against an infection comprising administering to the subject a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. Preferably, the infection is a viral infection. The method of the invention can prophylactically vaccinate the animal against the infection or therapeutically vaccinate a subject having a preexisting infection.
[0056] Yet another aspect of the invention provides polynucleotides encoding a chimeric antigen, said polynucleotide comprising a first polynucleotide portion encoding an immune response domain and a second polynucleotide portion encoding a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. In one embodiment, the polynucleotide comprises a nucleotide sequence selected from the group consisting of nucleotides 1 to 1326 of SEQ ID NO: 31, nucleotides 1 to 2004 of SEQ ID NO: 35, nucleotides 1 to 1350 of SEQ ID NO: 39, nucleotides 1 to 1293 of SEQ ID NO: 43, nucleotides 1 to 1794 of SEQ ID NO: 47, nucleotides 1 to 1581 of SEQ ID NO: 51, nucleotides 1 to 1389 of SEQ ID NO: 57, nucleotides 1 to 1347 of SEQ ID NO: 61, nucleotides 1 to 2157 of SEQ ID NO: 65, nucleotides 1 to 1395 of SEQ ID NO: 69, nucleotides 1 to 1905 of SEQ ID NO: 73 and nucleotides 1 to 2484 of SEQ ID NO: 77. Yet another embodiment provides polynucleotides that encodes a chimeric antigen that is at least 90% identical to an amino acid sequence selected from the group consisting of amino acids 1 to 442 of SEQ ID NO: 32, amino acids 1 to 668 of SEQ ID NO: 36, amino acids 1 to 450 of SEQ ID NO: 40, amino acids 1 to 431 of SEQ ID NO: 44, amino acids 1 to 598 of SEQ ID NO: 48, amino acids 1 to 527 of SEQ ID NO: 52, amino acids 1 to 463 of SEQ ID NO: 58, amino acids 1 to 449 of SEQ ID NO: 62, amino acids 1 to 719 of SEQ ID NO: 66, amino acids 1 to 465 of SEQ ID NO: 70, amino acids 1 to 635 of SEQ ID NO: 74 and amino acids 1 to 828 of SEQ ID NO: 78. One preferred embodiment includes polynucleotides that selectively hybridize under stringent conditions to a polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 31, 35, 39, 43, 47, 51, 57, 61, 65, 69, 73 and 77.
[0057] The invention also provides microorganisms and cell lines comprising a polynucleotide of the invention. Preferably, the microorganism or cell line is a eukaryotic microorganism or cell line. More preferably the microorganism or cell line is a non-mammalian eukaryotic microorganism or cell line. In a preferred embodiment the microorganism or cell line is a yeast, a plant cell line or an insect cell line. In a particularly preferred embodiment, the cell line is an insect cell line selected from the group consisting of Sf9, Sf21, Drosophila S2 and High Five®.
[0058] One aspect of the invention provides methods for producing a chimeric antigen comprising (a) providing a microorganism or cell line that comprises a polynucleotide encoding a chimeric antigen; and (b) culturing said microorganism or cell line under conditions whereby the chimeric antigen is expressed. Preferably, the microorganism or cell line is eukaryotic, more preferably a non-mammalian eukaryotic, microorganism or cell line. In a preferred embodiment, the microorganism or cell line is a yeast, a plant cell line or an insect cell line. In a particularly preferred embodiment, the cell line is an insect cell line selected from the group consisting of Sf9, Sf21, Drosophila S2 and High Five®. In another particularly preferred embodiment, the yeast is selected from the group consisting of Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, and Pichia august.
[0059] Another aspect of the invention relates to articles of manufacture comprising a chimeric antigen of the invention and instructions for administering the chimeric antigen to a subject, in need thereof.
[0060] Yet another aspect of the invention relates to a pharmaceutical composition comprising a pharmaceutically acceptable excipient and a chimeric antigen that comprises an immune response domain and a target binding domain comprising a xenotypic antibody fragment. Preferably the pharmaceutical composition is formulated for parenteral, transdermal, intradermal, nasal, pulmonary or oral administration.
III. DESCRIPTION OF DRAWINGS
[0061] FIG. 1a provides a schematic diagram illustrating the structure of the chimeric antigen of the present invention as a monomer, wherein the chimeric antigen has two portions, namely an antigen and a xenotypic murine Fc fragment. In a preferred embodiment, a hinge region is present. FIG. 1b provides a schematic diagram illustrating the structure of the chimeric antigen of FIG. 1 in its normal, assembled state as a dimer. FIG. 1b illustrates a particularly preferred embodiment, in which the chimeric antigen comprises a 6×His tag and peptide linker in addition to the IRD and TBD.
[0062] FIG. 2a provides a schematic diagram illustrating the structure of an exemplary modified chimeric antigen as a monomer, wherein the chimeric antigen has two portions, namely a modified viral antigen portion which incorporates any viral antigen or antigens, antigenic protein fragments or peptides, or any of these with glycosylation at specific sites, and a xenotypic binding agent, namely a murine Fc fragment with the hinge region present. FIG. 2b is a schematic diagram illustrating the structure of the modified chimeric antigen of FIG. 2a in its normal, assembled state as a dimer. The abbreviations "Ag1," "Ag2," and "Ag3" represent different viral antigenic peptides or proteins.
[0063] FIG. 3a provides a schematic diagram illustrating the structure of a modified biotinylated immune response domain comprising an antigen and a fusion protein of a streptavidin and a target binding domain comprising a Fc fragment with the hinge region present. FIG. 3b provides a schematic diagram illustrating the structure of the modified chimeric antigen of FIG. 3 in its normal, assembled state as a dimer.
[0064] FIG. 4 is a schematic diagram illustrating a recombinant bacmid, capable of expressing a chimeric antigen.
[0065] FIG. 5 is a schematic embodiment of TBD of the present invention.
[0066] FIG. 6a provides the nucleotide sequences of the open reading frame encoding the TBD of FIG. 5 (SEQ ID NO: 29). FIG. 6b provides the amino acid sequence of the TBD of FIG. 5 (SEQ ID NO: 30).
[0067] FIG. 7 provides a schematic embodiment of an exemplary chimeric antigen of the present invention, suitable for use with an insect cell expression system.
[0068] FIG. 8a provides the nucleotide and deduced amino acid sequences of the chimeric antigen molecule of FIG. 7 (SEQ ID NO: 31). FIG. 8b provides the amino acid sequence of the chimeric antigen of FIG. 7 (SEQ ID NO: 32).
[0069] FIG. 9 shows the nucleotide (FIG. 9a; SEQ ID NO: 33) and deduced amino acid (FIG. 9b; SEQ ID NO: 34) sequences of HBV S1/S2 protein, expressed as described in Example 2.
[0070] FIG. 10 provides a schematic embodiment of an exemplary chimeric antigen of the present invention, illustrating an exemplary IRD of the present invention.
[0071] FIG. 11 shows the nucleotide (FIG. 11a; SEQ ID NO: 35) and deduced amino acid (FIG. 11b; SEQ ID NO: 36) sequences of the chimeric antigen molecule of FIG. 10.
[0072] FIG. 12 shows the nucleotide (FIG. 12a; SEQ ID NO: 37) and deduced amino acid (FIG. 12b; SEQ ID NO: 38) sequences of the HBV S1/S2/S protein, expressed as described in Example 3.
[0073] FIG. 13 is a schematic embodiment of an exemplary chimeric antigen of the present invention, illustrating an exemplary IRD of the present invention.
[0074] FIG. 14 shows the nucleotide (FIG. 14a; SEQ ID NO: 39) and deduced amino acid (FIG. 14b; SEQ ID NO: 40) sequences of the chimeric antigen molecule of FIG. 13.
[0075] FIG. 15 shows the nucleotide (FIG. 15a; SEQ ID NO: 41) and deduced amino acid (FIG. 15b; SEQ ID NO: 42) sequences of the HBV Core protein, expressed as described in Example 4.
[0076] FIG. 16 is a schematic embodiment of an exemplary chimeric antigen of the present invention, illustrating an exemplary IRD of the present invention.
[0077] FIG. 17 shows the nucleotide (FIG. 17a; SEQ ID NO: 43) and deduced amino acid (FIG. 17b; SEQ ID NO: 44) sequences of the chimeric antigen molecule of FIG. 16.
[0078] FIG. 18 shows the nucleotide (FIG. 18a; SEQ ID NO: 45) and deduced amino acid (FIG. 18b; SEQ ID NO: 46) sequences of the DHBV PreS protein, expressed as described in Example 5.
[0079] FIG. 19 is a schematic embodiment of an exemplary chimeric antigen of the present invention, illustrating an exemplary IRD of the present invention.
[0080] FIG. 20 shows the nucleotide (FIG. 20a; SEQ ID NO: 47) and deduced amino acid (FIG. 20b; SEQ ID NO: 48) sequences of the chimeric antigen molecule of FIG. 19.
[0081] FIG. 21 shows the nucleotide (FIG. 21a; SEQ ID NO: 49) and deduced amino acid (FIG. 21b; SEQ ID NO: 50) sequences of the DHBV PreS/S protein, expressed as described in Example 6.
[0082] FIG. 22 is a schematic embodiment of an exemplary chimeric antigen of the present invention, illustrating an exemplary IRD of the present invention.
[0083] FIG. 23 shows the nucleotide (FIG. 23a; SEQ ID NO: 51) and deduced amino acid (FIG. 23b; SEQ ID NO: 52) sequences of the chimeric antigen molecule of FIG. 22.
[0084] FIG. 24 shows the nucleotide (FIG. 24a; SEQ ID NO: 53) and deduced amino acid (FIG. 24b; SEQ ID NO: 54) sequences of the DHBV Core protein, expressed as described in Example 7.
[0085] FIG. 25 shows that a chimeric antigen embodiment of the invention can be taken up by dendritic cells.
[0086] FIG. 26 shows that dendritic cells maturation is higher in the presence of a chimeric antigen of the present invention (S1/S2-TBD), as compared to the target binding domain (TBD) alone, or the immune response domain (S1/S2) alone.
[0087] FIG. 27 shows the expression of MHC Class II by dendritic cells in response to the chimeric antigen (S1/S2-TBD), the target binding domain alone (TBD) or the immune response domain alone (S1/S2).
[0088] FIG. 28 shows that a cellular response is generated after contact with dendritic cells activated with a chimeric antigen of the present invention.
[0089] FIG. 29 shows T cell stimulation by a chimeric antigen of the present invention over a period of 2-4 days.
[0090] FIG. 30 shows a time course of expression of antigen binding receptors on maturing dendritic cells.
[0091] FIG. 31 shows a time course of expression of various dendritic cells activation markers.
[0092] FIG. 32 shows the comparison of binding of HBV S1/S2-TBD, IgG1, and IgG2 to dendritic cells over time.
[0093] FIG. 33 shows a comparison of HBV S1/S2-TBD, IgG1, and IgG2a binding to maturing dendritic cells on day 1.
[0094] FIG. 34 shows the comparison of HBV S1/S2-TBD, IgG1, and IgG2a binding to maturing dendritic cells on day 4.
[0095] FIG. 35 shows the comparison of uptake between HBV S1/S2-TBD, IgG1, and IgG2 as a function of concentration.
[0096] FIG. 36 shows the correlation of HBV S1/S2-TBD binding to CD32 and CD206 expression on dendritic cells.
[0097] FIG. 37 demonstrates that the binding of HBV S1/S2-TBD to CD32 and CD206 receptors on dendritic cells is abolished by Fcγ fragment.
[0098] FIG. 38 shows that glycosylation of S 1/S2 antigen increases the uptake by dendritic cells via the CD206 receptor.
[0099] FIG. 39 shows an increase in intracellular interferon-γ positive T cells after antigen presentation.
[0100] FIG. 40 shows an increase in secretion of interferon-γ after antigen presentation.
[0101] FIG. 41 shows an increase in intracellular interferon-γ positive T cells as a function of S1/S2-TBD concentration
[0102] FIG. 42 shows interferon-γ secretion by T cells as a function of S 1/S2-TBD concentration.
[0103] FIG. 43 shows the effect of glycosylation on intracellular interferon-γ production in T cells.
[0104] FIG. 44 shows the effect of glycosylation on interferon-γ secretion by T cells.
[0105] FIG. 45 shows the nucleotide (FIG. 45a; SEQ ID NO: 55) and amino acid (FIG. 45b; SEQ ID NO: 56) sequences of the ORF of HCV Core (1-191) in the plasmid pFastBac HTa-HCV.
[0106] FIG. 46 shows the nucleotide (FIG. 46a; SEQ ID NO: 57) and amino acid (FIG. 46b; SEQ ID NO: 58) sequences of the ORF of HCV Core-TBD in the plasmid pFastBac HTa-HCV-TBD.
[0107] FIG. 47 shows the nucleotide (FIG. 47a; SEQ ID NO: 59) and amino acid (FIG. 47b; SEQ ID NO: 60) sequences of the ORF of HCV Core (1-177) in the plasmid pFastBac HTa-HCV-Core (1-177).
[0108] FIG. 48 shows the nucleotide (FIG. 48a; SEQ ID NO: 61) and amino acid (FIG. 48b; SEQ ID NO: 62) sequences of the ORF of HCV Core-TBD protein in the plasmid pFastBac HTa-HCV-Core-TBD.
[0109] FIG. 49 shows the nucleotide (FIG. 49a; SEQ ID NO: 63) and amino acid (FIG. 49b; SEQ ID NO: 64) sequences of the ORF of HCV NS5A in the plasmid pFastBac HTa-HCV-NS5A.
[0110] FIG. 50 shows the nucleotide (FIG. 50a; SEQ ID NO: 65) and amino acid (FIG. 50b; SEQ ID NO: 66) sequences of the ORF of HCV NS5A-TBD in the plasmid pFastBac HTa-HCV-NS5A-TBD
[0111] FIG. 51 shows the nucleotide (FIG. 51a; SEQ ID NO: 67) and amino acid (FIG. 51 b; SEQ ID NO: 68) sequences of the ORF of HCV E1 in the plasmid pFastBac HTa-HCV-E1.
[0112] FIG. 52 shows the nucleotide (FIG. 52a; SEQ ID NO: 69) and amino acid (FIG. 52b; SEQ ID NO: 70) sequences of the ORF of HCV E1-TBD in the plasmid pFastBac HTa-HCV-E1-TBD.
[0113] FIG. 53 shows the nucleotide (FIG. 53a; SEQ ID NO: 71) and amino acid (FIG. 53b; SEQ ID NO: 72) sequences of the ORF of HCV E2 in the plasmid pFastBac HTa-HCV-E2.
[0114] FIG. 54 shows the nucleotide (FIG. 54a; SEQ ID NO: 73) and amino acid (FIG. 54b; SEQ ID NO: 74) sequences of the ORF of HCV E2-TBD in the plasmid pFastBac HTa-HCV-E2-TBD.
[0115] FIG. 55 shows the nucleotide (FIG. 55a; SEQ ID NO: 75) and amino acid (FIG. 55b; SEQ ID NO: 76) sequences of the ORF of HCV E1/E2 in the plasmid pFastBac HTa-HCV-E1/E2.
[0116] FIG. 56 shows the nucleotide (FIG. 56a; SEQ ID NO: 77) and amino acid (FIG. 56b; SEQ ID NO: 78) sequences of the ORF of HCV E1/E2-TBD in the plasmid pFastBac HTa-HCV-E1/E2-TBD.
IV. DETAILED DESCRIPTION
A. Overview
[0117] Disclosed herein are compositions and methods for eliciting immune responses against antigens. In particular embodiments, the compounds and methods elicit immune responses against antigens that are otherwise recognized by the host as "self" antigens. The immune response is enhanced by presenting the host immune system with a chimeric antigen comprising an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. By virtue of the target binding domain, antigen presenting cells take up, process and present the chimeric antigen, eliciting both a humoral and cellular immune response.
B. Definitions
[0118] Prior to describing the invention in further detail, the terms used in this application are defined as follows unless otherwise indicated.
[0119] "Antibody" refers to an immunoglobulin molecule produced by B lymphoid cells with a specific amino acid sequence evoked in humans or other animals by an antigen (immunogen). These molecules are characterized by reacting specifically with the antigen, each being defined in terms of the other.
[0120] "Antibody response" or "humoral response" refers to a type of immune response in which antibodies are produced by B lymphoid cells and are secreted into the blood and/or lymph in response to an antigenic stimulus. In a properly functioning immune response, the antibody binds specifically to antigens on the surface of cells (e.g., a pathogen), marking the cell for destruction by phagocytotic cells and/or complement-mediated mechanisms. Antibodies also circulate systemically and can bind to free virions. This antibody binding can neutralize the virion and prevent it from infecting a cell as well as marking the virion for elimination from circulation by phagocytosis or filtration in the kidneys.
[0121] "Antigen" refers to any substance that, as a result of coming in contact with appropriate cells, induces a state of sensitivity and/or immune responsiveness and that reacts in a demonstrable way with antibodies and/or immune cells of the sensitized subject in vivo or in vitro.
[0122] "Antigen-presenting cell" refers to the accessory cells of antigen-inductive events that function primarily by handling and presenting antigen to lymphocytes. The interaction of antigen presenting cells (APC) with antigens is an essential step in immune induction because it enables lymphocytes to encounter and recognize antigenic molecules and to become activated. Exemplary APCs include macrophages, Langerhans-dendritic cells, Follicular dendritic cells, and B cells.
[0123] "B cell" refers to a type of lymphocyte that produces immunoglobulins or antibodies that interact with antigens.
[0124] "CH1 region" refers to a region of the heavy chain constant domain on the antigen binding fragment of an antibody.
[0125] "Cellular response" or "cellular host response" refers to a type of immune response mediated by specific helper and killer T cells capable of directly or indirectly eliminating virally infected or cancerous cells.
[0126] As used herein, the term "chimeric antigen" refers to a polypeptide comprising an immune response domain and a target binding domain. The immune response domain and target binding domains may be directly or indirectly linked by covalent or non-covalent means. "Complex" or "antigen-antibody complex" refers to the product of the reaction between an antibody and an antigen. Complexes formed with polyvalent antigens tend to be insoluble in aqueous systems.
[0127] "Cytotoxic T-lymphocyte" is a specialized type of lymphocyte capable of destroying foreign cells and host cells infected with the infectious agents that produce viral antigens.
[0128] "Epitope" refers to the simplest form of an antigenic determinant, on a complex antigen molecule; this is the specific portion of an antigen that is recognized by an immunoglobulin or T cell receptor.
[0129] "Fusion protein" refers to a protein formed by expression of a hybrid gene made by combining two or more gene sequences.
[0130] "Hinge region" refers to the portion of an antibody that connects the Fab fragment to the Fc fragment; the hinge region contains disulfide bonds that covalently link the two heavy chains.
[0131] The term "homolog" refers to a molecule which exhibits homology to another molecule, by for example, having sequences of chemical residues that are the same or similar at corresponding positions. The phrase "% homologous" or "% homology" refers to the percent of nucleotides or amino acids at the same position of homologous polynucleotides or polypeptides that are identical or similar. For example, if 75 of 80 residues in two proteins are identical, the two proteins are 93.75% homologous. Percent homology can be determined using various software programs known to one of skill in the art.
[0132] "Host" refers to a warm-blooded animal, including a human, which suffers from an immune-treatable condition, such as an infection or a cancer. As used herein, "host" also refers to a warm-blooded animal, including a human, to which a chimeric antigen is administered.
[0133] In the context of this invention, "hybridization" means the pairing of complementary strands of oligomeric compounds. In the present invention, the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds. Hybridization can occur under varying circumstances. The terms "hybridize", "hybridizing", "hybridizes" and the like, used in the context of polynucleotides, are meant to refer to conventional hybridization conditions, preferably such as hybridization in 50% formamide/6×SSC/0.1% SDS/100 μg/ml mDNA, in which temperatures for hybridization are above 37° C. and temperatures for washing in 0.1×SSC/0.1% SDS are above 55° C.
[0134] "Immunity" or "immune response" refers to the body's response to an antigen. In particular embodiments, it refers to the ability of the body to resist or protect itself against infectious disease.
[0135] "Immune Response Domain (IRD)" refers to the variously configured antigenic portion of a bifunctional molecule. The IRD comprises one or more antigens or one or more recombinant antigens. Preferred viral antigens include, but are not limited to, HBV PreS1/S2 HBV PreS1/S2/S, HBV Core, HBV Core ctm (C-terminal modified), HBV e-antigen, HBV Polymerase, HCV Core, HCV E1-E2, HCV E1, HCV E2, HCV NS3-serine protease, HCV NS5A and NS4A, HIV gp120 and HSV Alkaline nuclease and HPV Antigens.
[0136] As used herein, the phrase "immune-treatable condition" refers to a condition or disease that can be prevented, inhibited or relieved by eliciting or modulating an immune response in the subject.
[0137] "Lymphocyte" refers to a subset of nucleated cells found in the blood, which mediate specific immune responses.
[0138] "Monoclonal antibody" or "mAb" refers to an antibody produced from a clone or genetically homogenous population of fused hybrid cells, i.e., a hybridoma cell. Hybrid cells are cloned to establish cells lines producing a specific monoclonal antibody that is chemically and immunologically homogenous, i.e., that recognizes only one type of antigen.
[0139] "Peptide linkage" or "peptide bond" refers to two or more amino acids covalently joined by a substituted amide linkage between the α-amino group of one amino acid and the α-carboxyl group of another amino acid.
[0140] A "pharmaceutical excipient" comprises a material such as an adjuvant, a carrier, a pH-adjusting and buffering agent, a tonicity adjusting agent, a wetting agent, a preservative, and the like.
[0141] "Pharmaceutically acceptable" refers to a non-toxic composition that is physiologically compatible with humans or other animals.
[0142] The term "polynucleotide" as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA and RNA. It also includes known types of modifications, for example, labels which are known in the art, methylation, "caps", substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties, such as, for example proteins (including e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), as well as unmodified forms of the polynucleotide.
[0143] "Protease cleavage site" refers to a site where proteolytic enzymes hydrolize (break) polypeptide chains.
[0144] In the present invention, the phrase "stringent hybridization conditions" or "stringent conditions" refers to conditions under which a compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences.
[0145] The term "subject" refers to any warm-blooded animal, preferably a human.
[0146] "Tag" refers to a marker or marker sequence used to isolate or purify a molecule containing the tag. An exemplary tag includes a 6×His tag.
[0147] "T cell" refers to a type of lymphocyte responsible for antigen-specific cellular interactions, and which mediates humoral and cellular immune responses.
[0148] "Target Binding Domain (TBD)" refers to a region of an immunoglobulin heavy chain constant region.
[0149] The phrase "therapeutically effective amount" refers to an amount of chimeric antigen, or polynucleotide encoding a chimeric antigen, sufficient to elicit an effective B cell, cytotoxic T lymphocyte (CTL) and/or helper T lymphocyte (Th) response to the antigen and to block or to cure or at least partially arrest or slow symptoms and/or complications of a disease or disorder.
[0150] The terms "treating" and "treatment" as used herein cover any treatment of a condition treatable by a chimeric antigen in an animal, particularly a human, and include: (i) preventing the condition from occurring in a subject which may be predisposed to the condition but has not yet been diagnosed as having it; (ii) inhibiting the condition, e.g., arresting or slowing its development; or (iii) relieving the condition, e.g., causing regression of the condition or its symptoms
[0151] "Xenotypic" refers to originating from a different species other than the host. For example, a recombinantly expressed antibody cloned from a mouse genome would be xenotypic to a human but not to a mouse, regardless of whether that recombinantly expressed antibody was produced in a bacterial, insect or mouse cell.
C. Chimeric Antigens
[0152] A composition of the present invention includes a chimeric antigen comprising an immune response domain (IRD) and a target binding domain (TBD). In preferred embodiments of the invention, the protein portion is capable of inducing humoral and/or T cell responses, and the target binding portion is capable of binding an antigen presenting cell, such as a dendritic cell. The chimeric antigen of the present invention may also include one or more of the following: a hinge region of an immunoglobulin, a CH1 region of an immunoglobulin, a peptide linker, a protease cleavage site, and a tag suitable for use with a purification protocol. A chimeric antigen of the present invention is capable of binding to and activating an antigen presenting cell.
[0153] In some embodiments of the invention, the IRD of the chimeric antigen includes one or more proteins selected from the group comprising: one or more HBV proteins, one or more recombinant HBV proteins, one or more HCV proteins, or one or more recombinant HCV proteins.
[0154] In yet another embodiment of the invention, the IRD of the chimeric antigen includes a 6×His-peptide fused to one or more HBV proteins, one or more recombinant HBV proteins, one or more HCV proteins, or one or more recombinant HCV proteins.
[0155] In preferred embodiments of the invention, the target binding domain of the chimeric antigen is an antibody fragment xenotypic to the host. For example, if the host is a human, an exemplary xenotypic antibody fragment is a non-human animal antibody fragment, such as from a mouse. In the preferred embodiments of the invention, the xenotypic antibody fragment comprises a murine Fc fragment. In the most preferred embodiments of the invention, the target binding domain comprises a xenotypic Fc fragment, a hinge region, a CH1 region, and a peptide linkage suitable for linking the target binding domain to the IRD.
[0156] The present invention also comprises the use of linking molecules to join the IRD to the TBD. Exemplary linker molecules include leucine zippers, and biotin/avidin.
[0157] In one embodiment, the chimeric antigen of the present invention is a fusion protein having two portions, namely an IRD containing an antigenic sequence (such as a viral antigen(s)), and a TBD containing a xenotypic Fc fragment. The xenotypic murine Fc fragment with the hinge region present recruits the antigen-presenting cells, specifically dendritic cells, to take up the chimeric antigen. The binding region of the chimeric antigen thus targets antigen-presenting cells specifically. The internal machinery of the APC then processes the IRD to form an activated APC. The activated APC must then be capable of contacting and activating immune response cells for generating humoral and cellular immune responses to clear infected cells.
[0158] In a further embodiment, the chimeric antigen is a fusion protein having two portions, namely a modified viral antigen or antigens, antigenic protein fragments or peptides, or any of these with glycosylation at specific sites, and a xenotypic murine Fc fragment with the hinge region present, which can also be, optionally, glycosylated.
[0159] In yet another embodiment, the invention provides a further modified chimeric antigen, wherein the antigen is biotinylated and the Fc fragment is generated with streptavidin as a fusion protein to facilitate the production of a wide assortment of antigen-Fc conjugates.
[0160] In yet another embodiment, the invention provides an association between the antigen and the antibody Fc fragment through chemical conjugation.
[0161] An embodiment of the present invention includes the use of recombinant antigens of HBV, HCV, or DHBV fused to a xenotypic antibody fragment by molecular biological techniques, production of the fusion proteins in a baculovirus expression system and their use as therapeutic vaccines against chronic HBV and HCV infections. The present invention provides an efficient method to deliver a hitherto unrecognized antigen to APCs in vivo so as to generate a broad immune response, a Th1 response involving CTLs and a Th2 (antibody) response. The immunogenicity of the pre-selected viral antigen unrecognized by the host immune system is increased due to the presence of the xenotypic antibody fragment as well as by the presence of specific glycosylation introduced in the insect cell expression system. The antigen-antibody fragment fusion protein, due to the presence of the antibody component, will bind to specific receptors present on various immune cell types including dendritic cells, macrophages, B cells and granulocytes. The fusion proteins administered to either humans or animals will be taken up by the APCs, especially DCs, will be hydrolyzed to small peptides and presented on the cell surface, complexed with MHC Class I and/or MHC Class II, which can elicit a broad immune response and clear the viral infection.
[0162] As used herein, the term "Target Binding Domain (TBD)" refers to a region of an immunoglobulin heavy chain constant region, which is an antibody fragment capable of binding to an Fc receptor on an APC. In accordance with the present invention, the TBD is a protein capable of binding to an Fc receptor on an APC, particularly a dendritic cell, and is subsequently transported into the APC by receptor-mediated uptake. In accordance with the present invention, the presence of an Fc fragment augments the uptake of the chimeric antigen through the Fc receptor on antigen-presenting cells, specifically dendritic cells. By virtue of the specific uptake, the viral antigen is processed and presented as foreign; thus, an immune response is effectively elicited to the previously tolerated viral antigen.
[0163] Also, in accordance with the present invention, the chimeric antigen, preferably, is capable of binding to a macrophage mannose receptor. The macrophage mannose receptor (MMR), also known as CD206, is expressed on antigen presenting cells (APC) such as dendritic cells (DC). This molecule is a member of the C-type lectin family of endocytic receptors. Mannosylated chimeric antigen can be bound and internalized by CD206. In general, exogenous antigen is thought to be processed and presented primarily through the MHC class II pathway. However, in the case of targeting through CD206, there is evidence that both the MHC class I and class II pathways are involved (Apostolopoulos et al., Eur. J. Immunol. 30:1714 (2000); Apostolopoulos and McKenzie, Curr. Mol. Med. 1:469 (2001); Ramakrishna et al., J. Immunol. 172:2845-2852 (2004)). Thus, monocyte-derived dendritic cells loaded with chimeric antigen that specifically targeted CD206 will induce both a potent class I-dependent CD8.sup.+ CTL response and a class II-dependent proliferative T helper response (Ramakrishna et al., supra (2004)).
[0164] An exemplary TBD is derived from Mouse anti-HBVsAg mAb (Hybridoma 2C12) as cloned in pFastBac HTa expression vector, and expressed in a High Five® insect cell expression system (Invitrogen). This TBD consists of part of CH1, and Hinge-CH2-CH3 from N-terminal to C-terminal of the mouse anti-HBVs Ag mAb. The constant region of the IgG1 molecule for the practice of the present invention contains a linker peptide, part of CH1-hinge and the regions CH2 and CH3. The hinge region portion of the monomeric TBD can form disulphide bonds with a second TBD molecule. FIG. 5 illustrates a schematic representation of a TBD molecule. The protein is expressed as an N-terminal fusion protein with a 6×His tag, a seven amino acid rTEV (recombinant tobacco etch virus) protease cleavage site and the N-terminal fusion of the Target Binding Domain (TBD) of the xenotypic (murine) mAb raised against HBV sAg (Hybridoma 2C12). The exemplary TBD is a fragment of the constant chain of the IgG1 mAb from 2C12 with the sequence of amino acids comprising the 8 amino acid peptide linker, five amino acids of the CH1 region, the hinge sequences, CH2 and CH3 region sequences (FIG. 5) and ten additional amino acids from the expression vector. The exemplary TBD fragment defined herein forms the parent molecule for the generation of fusion proteins with antigens derived from viruses or other infectious agents. FIG. 1b depicts the formation of dimeric chimeric antigen molecule formed via intermolecular disulphide bonds. FIG. 6 shows the nucleotide sequence of the Open Reading Frame (ORF) encoding the exemplary TBD protein and the deduced amino acid sequence as defined in FIG. 5.
[0165] FIG. 7 shows a schematic representation of an exemplary chimeric antigen vaccine molecule, as produced in the insect cell expression system. This molecule is a fusion protein of N-terminal 6×His tag, rTEV protease cleavage site, HBV S1/S2 antigen, linker peptide, a part of the CH1 as well as CH2 and CH3 domains of the mouse monoclonal antibody from 2C12 plus eight additional amino acids introduced as a cloning artifact. Cleavage and purification will result in the generation of HBV S1/S2-TBD molecule. FIG. 8 shows the nucleotide and amino acid sequences of the HBV S 1/S2-TBD chimeric antigen molecule. FIG. 9 shows the nucleotide and the deduced amino acid sequences of the expressed HBV S1/S2 protein.
[0166] FIG. 10 shows a schematic representation of the fusion protein of HBV S1/S2/S-TBD. This molecule is a fusion protein of N-terminal 6×His tag, rTEV protease cleavage site, HBV S1/S2/S antigen, linker peptide, a part of the CH1 as well as CH2 and CH3 domains of the mouse monoclonal antibody from 2C12 plus eight additional amino acids introduced as a cloning artifact. FIG. 11 shows the nucleotide and deduced amino acid sequences of the ORF of the fusion protein. FIG. 12 shows the nucleotide and deduced amino acid sequences of the HBV S1/S2/S protein.
[0167] FIG. 13 illustrates the fusion protein of HBV Core-TBD molecule as expressed in the insect cells. This molecule is a fusion protein of N-terminal 6×His tag, rTEV protease cleavage site, HBV S1/S2 Core, linker peptide, a part of the CH1 as well as CH2 and CH3 domains of the mouse monoclonal antibody from 2C12 plus eight additional amino acids introduced as a cloning artifact. FIG. 14 shows the nucleotide and amino acid sequences in the ORF of the fusion protein. FIG. 15 shows the nucleotide and deduced amino acid sequences of the HBV Core protein.
[0168] Another embodiment of the present invention involves the production and use of fusion proteins generated from Duck Hepatitis B Virus (DHBV) antigens and murine TBD. DHBV has been used as a very versatile animal model for the development of therapies for HBV, its human counterpart. DHBV genome encodes Surface antigens (PreS/S), the Core protein (Core), which form capsids, and the polymerase enzyme, which serves multiple functions.
[0169] FIG. 16 depicts a schematic representation of the fusion protein of DHBV PreS-TBD, as produced in High Five® (Invitrogen) insect cell expression system. This molecule is a fusion protein of N-terminal 6×His tag, rTEV protease cleavage site, DHBV PreS, linker peptide, a part of the CH1 as well as CH2 and CH3 domains of the mouse monoclonal antibody from 2C12 plus eight additional amino acids introduced as a cloning artifact. The nucleotide and deduced amino acid sequences of the ORF of the fusion protein as cloned in the plasmid pFastBac HTa are shown in FIG. 17. The nucleotide and deduced amino acid sequences of the DHBV PreS protein are shown in FIG. 18.
[0170] FIG. 19 shows schematically, another embodiment of the present invention viz. DHBV PreS/S-TBD. This molecule is a fusion protein of N-terminal 6×His tag, rTEV protease cleavage site, DHBV PreS/S, linker peptide, a part of the CH1 as well as CH2 and CH3 domains of the mouse monoclonal antibody from 2C12 plus eight additional amino acids introduced as a cloning artifact. The nucleotide and amino acid sequences are presented in FIG. 20. The nucleotide and deduced amino acid sequences of PreS/S are presented in FIG. 21.
[0171] FIG. 22 shows a schematic representation of the fusion protein of DHBV Core-TBD. This molecule is a fusion protein of N-terminal 6×His tag, rTEV protease cleavage site, DHBV Core, linker peptide, a part of the CH1 as well as CH2 and CH3 domains of the mouse monoclonal antibody from 2C12 plus eight additional amino acids introduced as a cloning artifact. FIG. 23 shows the nucleotide and deduced amino acid sequences of the DHBV Core-TBD fusion protein. The nucleotide and deduced amino acid sequences of DHBV Core protein are shown in FIG. 24.
D. Novel Polynucleotides
[0172] Another aspect of the invention provides polynucleotides encoding a chimeric antigen comprising a first polynucleotide portion encoding an immune response domain and a second polynucleotide portion encoding a target binding domain. The first and second polynucleotide portions may be located on the same or different nucleotide chains.
[0173] The invention provides polynucleotides corresponding or complementary to genes encoding chimeric antigens, mRNAs, and/or coding sequences, preferably in isolated form, including polynucleotides encoding chimeric antigen variant proteins; DNA, RNA, DNA/RNA hybrids, and related molecules, polynucleotides or oligonucleotides complementary or having at least a 90% homology to the genes encoding a chimeric antigen or mRNA sequences or parts thereof; and polynucleotides or oligonucleotides that hybridize to the genes encoding a chimeric antigen, mRNAs, or to chimeric antigen-encoding polynucleotides.
[0174] Additionally, the invention includes analogs of the genes encoding a chimeric antigen specifically disclosed herein. Analogs include, e.g., mutants, that retain the ability to elicit an immune response, and preferably have a homology of at least 80%, more preferably 90%, and most preferably 95% to any of polynucleotides encoding a chimeric antigen, as specifically described by SEQ ID NOs: 31, 35, 39, 43, 47, 51, 57, 61, 65, 69, 73 and 77. Typically, such analogs differ by only 1 to 10 codon changes. Examples include polypeptides with minor amino acid variations from the natural amino acid sequence of a viral antigen or of an antibody fragment; in particular, conservative amino acid replacements. Conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically-encoded amino acids are generally divided into four families: (1) acidic=aspartate, glutamate; (2) basic=lysine, arginine, histidine; (3) non-polar=alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar=glycine, asparagine, glutamine, cystine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids. For example, it is reasonable to expect that an isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar conservative replacement of an amino acid with a structurally related amino acid will not have a major effect on biological activity. Polypeptide molecules having substantially the same amino acid sequence as any of the polypeptides disclosed in any one of SEQ ID NOs: 32, 36, 40, 44, 48, 52, 58, 62, 66, 70, 74 and 78 but possessing minor amino acid substitutions that do not substantially affect the ability of the chimeric antigens to elicit an immune response, are within the definition of a chimeric antigen. Derivatives include aggregative conjugates with other chimeric antigen molecules and covalent conjugates with unrelated chemical moieties. Covalent derivatives are prepared by linkage of functionalities to groups that are found in chimeric antigen amino acid chains or at the N- or C-terminal residues by means known in the art.
[0175] Amino acid abbreviations are provided in Table 1.
TABLE-US-00001 TABLE 1 Amino Acid Abbreviations Alanine Ala A Arginine Arg R Asparagine Asn N Aspartate Asp D Cysteine Cys C Glutamate Glu E Glutamine Gln Q Glycine Gly G Histidine His H Isoleucine Ile I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine Thr T Tryptophan Trp W Tyrosine Tyr Y Valine Val V
[0176] Conservative amino acid substitutions can be made in a protein without altering either the conformation or the function of the protein. Proteins of the invention can comprise 1 to 15 conservative substitutions. Such changes include substituting any of isoleucine (I), valine (V), and leucine (L) for any other of these hydrophobic amino acids; aspartic acid (D) for glutamic acid (E) and vice versa; glutamine (Q) for asparagine (N) and vice versa; and serine (S) for threonine (T) and vice versa. Other substitutions can also be considered conservative, depending on the environment of the particular amino acid and its role in the three dimensional structure of the protein. For example, glycine (G) and alanine (A) can frequently be interchangeable, as can alanine (A) and valine (V). Methionine (M), which is relatively hydrophobic, can frequently be interchanged with leucine and isoleucine, and sometimes with valine. Lysine (K) and arginine (R) are frequently interchangeable in locations in which the significant feature of the amino acid residue is its charge and the differing pK's of these two amino acid residues are not significant Still other changes can be considered "conservative" in particular environments (see, e.g. Biochemistry 4th Ed., Lubert Stryer ed. (W.H. Freeman and Co.), pages 18-23; Henikoff and Henikoff, Proc Nat'l Acad Sci USA 89:10915-10919 (1992); Lei et al., J Biol Chem 270(20):11882-6 (1995)).
[0177] The invention also includes polynucleotides that selectively hybridize to polynucleotides that encode chimeric antigens. Preferably a polynucleotide of the invention will hybridize under stringent conditions to a sequence selected from SEQ ID NOs: 31, 35, 39, 43, 47, 51, 57, 61, 65, 69, 73 and 77. Stringency of hybridization reactions is readily determinable by one of ordinary skill in the art and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured nucleic acid sequences to re-anneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see, e.g., Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (©1995, as Supplemented April 2004, Supplement 66) at pages 2.9.1-2.10.8 and 4.9.1-4.9.13.
[0178] "Stringent conditions" or "high stringency conditions", as defined herein, are identified by, but not limited to, those that (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50° C.; (2) employ, during hybridization, a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42° C.; or (3) employ 50% formamide, 5×SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5×Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0.1% SDS, and 10% dextran sulfate at 42° C., with washes at 42° C. in 0.2×SSC (sodium chloride/sodium citrate) and 50% formamide at 55° C., followed by a high-stringency wash consisting of 0.1×SSC containing EDTA at 55° C. "Moderately stringent conditions" are described by, but not limited to, those in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and % SDS) less stringent than those described above. An example of moderately stringent conditions is overnight incubation at 37° C. in a solution comprising: 20% formamide, 5×SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5×Denhardt's solution, 10% dextran sulfate, and 20 mg/mL denatured sheared salmon sperm DNA, followed by washing the filters in 1×SSC at about 37-50° C. The skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.
[0179] Embodiments of a polynucleotide of the invention include: a polynucleotide encoding a chimeric antigen having a sequence selected from any of the sequences shown in FIGS. 32, 36, 40, 44, 48, 52, 58, 62, 66, 70, 74 and 78, a nucleotide sequence of chimeric antigen selected from any of the sequences shown in FIGS. 31, 35, 39, 43, 47, 51, 57, 61, 65, 69, 73 and 77, wherein T may be U. For example, embodiments of chimeric antigen nucleotides comprise, without limitation:
[0180] (a) a polynucleotide comprising or consisting of a sequence as shown in FIG. 8a, 11a, 14a, 17a, 20a, 23a, 46a, 48a, 50a, 52a, 54a or 56a (SEQ ID NOs: 31, 35, 39, 43, 47, 51, 57, 61, 65, 69, 73 or 77), wherein T can also be U;
[0181] (b) a polynucleotide whose sequence is at least 80% homologous to a sequence shown in FIG. 8a, 11a, 41a, 17a, 20a, 23a, 46a, 48a, 50a, 52a, 54a or 56a (SEQ ID NOs: 31, 35, 39, 43, 47, 51, 57, 61, 65, 69, 73 or 77);
[0182] (c) a polynucleotide that encodes a chimeric antigen whose sequence encoded by a DNA contained in one of the plasmids designated pFastBacHTa HBV S1/S2-TBD, pFastBacHTa HBV core-TBD, pFastBacHTa HCV core(1-177)-TBD, pFastBacHTa HCV NS5A-TBD, and pFastBacHTa HCV E2-TBD;
[0183] (d) a polynucleotide that encodes a chimeric antigen whose sequence is shown in FIG. 8b, 11b, 14b, 20b, 23b, 46b, 48b, 50b, 52b, 54b or 56b (SEQ ID NOs: 32, 36, 40, 44, 48, 52, 58, 62, 66, 70, 74 or 78);
[0184] (e) a polynucleotide that encodes a chimeric antigen-related protein that is at least 90% identical to an entire amino acid sequence shown in FIG. 8b, 11b, 14b, 20b, 23b, 46b, 48b, 50b, 52b, 54b or 56b (SEQ ID NOs: 32, 36, 40, 44, 48, 52, 58, 62, 66, 70, 74 or 78);
[0185] (f) a polynucleotide that is fully complementary to a polynucleotide of any one of (a)-(e); and
[0186] (g) a polynucleotide that selectively hybridizes under stringent conditions to a polynucleotide of (a)-(f).
[0187] The invention also provides recombinant DNA or RNA molecules containing a chimeric antigen polynucleotide, an analog or homologue thereof, including but not limited to phages, plasmids, phagemids, cosmids, YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes), as well as various viral and non-viral vectors well known in the art, and cells transformed or transfected with such recombinant DNA or RNA molecules. Methods for generating such molecules are well known (see, for example, Sambrook et al., 1989, supra).
[0188] The invention further provides a host-vector system comprising a recombinant DNA molecule containing a chimeric antigen polynucleotide, analog or homologue thereof within a suitable prokaryotic or eukaryotic host cell. Examples of suitable eukaryotic host cells include a yeast cell, a plant cell, or an animal cell, such as a mammalian cell or an insect cell (e.g., a baculovirus-infectible cell such as an Sf9, Sf21, Drosophila S2 or High Five® cell). Examples of suitable mammalian cells include various prostate cancer cell lines such as DU145 and TsuPr1, other transfectable or transducible prostate cancer cell lines, primary cells (PrEC), as well as a number of mammalian cells routinely used for the expression of recombinant proteins (e.g., COS, CHO, 293, 293T cells). More particularly, a polynucleotide comprising the coding sequence of chimeric antigen or a fragment, analog or homolog thereof can be used to generate chimeric antigen thereof using any number of host-vector systems routinely used and widely known in the art.
[0189] A wide range of host-vector systems suitable for the expression of chimeric antigens thereof are available, see for example, Sambrook et al., 1989, supra; Ausubel, Current Protocols in Molecular Biology, 1995, supra). Preferred vectors for insect cell expression include, but are not limited to, pFastBac HTa (Invitrogen). Using such expression vectors, chimeric antigens can be expressed in several insect cell lines, including for example Sf9, Sf21, Drosophila S2 or High Five®. Alternatively, preferred yeast expression systems include Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, and Pichia august. The host-vector systems of the invention are useful for the production of a chimeric antigen.
[0190] A chimeric antigen or an analog or homolog thereof can be produced by cells transfected with a construct encoding a chimeric antigen. For example, Sf9 cells can be transfected with an expression plasmid encoding a chimeric antigen or analog or homolog thereof, the chimeric antigen or related protein is expressed in the Sf9 cells, and the chimeric antigen is isolated using standard purification methods. Various other expression systems well known in the art can also be employed. Expression constructs encoding a leader peptide joined in frame to the chimeric antigen coding sequence can be used for the generation of a secreted form of chimeric antigen.
[0191] As discussed herein, redundancy in the genetic code permits variation in chimeric antigen gene sequences. In particular, it is known in the art that specific host species often have specific codon preferences, and thus one can adapt the disclosed sequence as preferred for a desired host. For example, preferred analog codon sequences typically have rare codons (i.e., codons having a usage frequency of less than about 20% in known sequences of the desired host) replaced with higher frequency codons. Codon preferences for a specific species are calculated, for example, by utilizing codon usage tables available on the INTERNET such as at world wide web URL www.kazusa.or.jp/codon.
[0192] Additional sequence modifications are known to enhance protein expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon/intron splice site signals, transposon-like repeats, and/or other such well-characterized sequences that are deleterious to gene expression. The GC content of the sequence is adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. Where possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures. Other useful modifications include the addition of a translational initiation consensus sequence at the start of the open reading frame, as described in Kozak, Mol. Cell Biol. 9:5073-5080 (1989). Skilled artisans understand that the general rule that eukaryotic ribosomes initiate translation exclusively at the 5' proximal AUG codon is abrogated only under rare conditions (see, e.g., Kozak PNAS 92(7):2662-2666 (1995) and Kozak Nucl Acids Res 15(20):8125-8148 (1987)).
E. Pharmaceutical Compositions of the Invention
[0193] One aspect of the invention relates to pharmaceutical compositions comprising a pharmaceutically acceptable excipient and a chimeric antigen comprising an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. In therapeutic applications, the pharmaceutical compositions can be administered to a subject in an amount sufficient to elicit an effective B cell, cytotoxic T lymphocyte (CTL) and/or helper T lymphocyte (Th) response to the antigen and to prevent infenction or to cure or at least partially arrest or slow symptoms and/or complications. Amounts effective for this use will depend on, e.g., the particular composition administered, the manner of administration, the stage and severity of the disease being treated, the weight and general state of health of the subject, and the judgment of the prescribing physician.
[0194] The dosage for an initial therapeutic immunization (with chimeric antigen) generally occurs in a unit dosage range where the lower value is about 1, 5, 50, 500, or 1,000 ng and the higher value is about 10,000; 20,000; 30,000; or 50,000 μg. Dosage values for a human typically range from about 500 ng to about 50,000 μg per 70 kilogram subject. Boosting dosages of between about 1.0 ng to about 50,000 μg of chimeric antigen pursuant to a boosting regimen over weeks to months may be administered depending upon the subject's response and condition. Administration should continue until at least clinical symptoms or laboratory tests indicate that the condition has been prevented, arrested, slowed or eliminated and for a period thereafter. The dosages, routes of administration, and dose schedules are adjusted in accordance with methodologies known in the art.
[0195] A human unit dose form of a chimeric antigen is typically included in a pharmaceutical composition that comprises a human unit dose of an acceptable carrier, in one embodiment an aqueous carrier, and is administered in a volume/quantity that is known by those of skill in the art to be useful for administration of such polypeptides to humans (see, e.g., Remington: The Science and Practice of Pharmacy, 20th Edition, A. Gennaro, Editor, Lippincott Williams & Wilkins, Baltimore, Md., 2000). As appreciated by those of skill in the art, various factors can influence the ideal dose in a particular case. Such factors include, for example, half life of the chimeric antigen, the binding affinity of the chimeric antigen, the immunogenicity of the composition, the desired steady-state concentration level, route of administration, frequency of treatment, and the influence of other agents used in combination with the treatment method of the invention, as well as the health status of a particular subject.
[0196] In certain embodiments, the compositions of the present invention are employed in serious disease states, that is, life-threatening or potentially life-threatening situations. In such cases, as a result of the relative nontoxic nature of the chimeric antigen in preferred compositions of the invention, it is possible and may be felt desirable by the treating physician to administer substantial excesses of these chimeric antigens relative to these stated dosage amounts.
[0197] The concentration of chimeric antigen of the invention in the pharmaceutical formulations can vary widely, i.e., from less than about 0.1%, usually at or at least about 2% to as much as 20% to 50% or more by weight, and will be selected primarily by fluid volumes, viscosities, etc., in accordance with the particular mode of administration selected.
[0198] The pharmaceutical compositions can be delivered via any route known in the art, such as parenterally, intrathecally, intravascularly, intravenously, intramuscularly, transdermally, intradermally, subcutaneously, intranasally, topically, orally, rectally, vaginally, pulmonarily or intraperitoneally. Preferably, the composition is delivered by parenteral routes, such as subcutaneous or intradermal administration.
[0199] The pharmaceutical compositions can be prepared by mixing the desired chimeric antigens with an appropriate vehicle suitable for the intended route of administration. In making the pharmaceutical compositions of this invention, the chimeric antigen is usually mixed with an excipient, diluted by an excipient or enclosed within a carrier that can be in the form of a capsule, sachet, paper or other container. When the pharmaceutically acceptable excipient serves as a diluent, it can be a solid, semi-solid, or liquid material, which acts as a vehicle, carrier or medium for the therapeutic agent. Thus, the compositions can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), ointments containing, for example, up to 10% by weight of the chimeric antigen, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders.
[0200] Some examples of suitable excipients include, but are not limited to, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methyl cellulose. The formulations can additionally include: lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying and suspending agents; preserving agents such as methyl- and propylhydroxy-benzoates; sweetening agents; and flavoring agents. The compositions of the invention can be formulated so as to provide quick, sustained or delayed release of the chimeric antigen after administration to the subject by employing procedures known in the art. See, e.g., Remington, supra, at pages 903-92 and pages 1015-1050.
[0201] For preparing solid compositions such as tablets, the chimeric antigen is mixed with a pharmaceutical excipient to form a solid preformulation composition containing a homogeneous mixture of a chimeric antigen of the present invention. When referring to these preformulation compositions as homogeneous, it is meant that the chimeric antigen is dispersed evenly throughout the composition so that the composition may be readily subdivided into equally effective unit dosage forms such as tablets, pills and capsules.
[0202] The tablets or pills of the present invention may be coated or otherwise compounded to provide a dosage form affording the advantage of prolonged action. For example, the tablet or pill can comprise an inner dosage and an outer dosage component, the latter being in the form of an envelope over the former. The two components can be separated by an enteric layer, which serves to resist disintegration in the stomach and permit the inner component to pass intact into the duodenum or to be delayed in release. A variety of materials can be used for such enteric layers or coatings, such materials including a number of polymeric acids and mixtures of polymeric acids with such materials as shellac, cetyl alcohol, and cellulose acetate.
[0203] The liquid forms in which the novel compositions of the present invention may be incorporated for administration orally or by injection include aqueous solutions, suitably flavored syrups, aqueous or oil suspensions, and flavored emulsions with edible oils such as corn oil, cottonseed oil, sesame oil, coconut oil, or peanut oil, as well as elixirs and similar pharmaceutical vehicles.
[0204] In preparing a composition for parenteral administration strict attention must be paid to tonicity adjustment to reduce irritation. A reconstitutable composition is a sterile solid packaged in a dry form. A reconstitutable composition is preferred because it is more stable when stored as a dry solid rather than in a solution ready for immediate administration. The dry solid is usually packaged in a sterile container with a butyl rubber closure to ensure the solid is kept at an optimal moisture range. A reconstitutable dry solid is formed by dry fill, spray drying, or freeze-drying methods. Descriptions of these methods may be found, e.g., in Remington, supra, at pages 681-685 and 802-803.
[0205] Compositions for parenteral injection are generally dilute, and the component present in the higher proportion is the vehicle. The vehicle normally has no therapeutic activity and is nontoxic, but presents the chimeric antigen to the body tissues in a form appropriate for absorption. Absorption normally will occur most rapidly and completely when the chimeric antigen is presented as an aqueous solution. However, modification of the vehicle with water-miscible liquids or substitution with water-immiscible liquids can affect the rate of absorption. Preferably, the vehicle of greatest value for this composition is isotonic saline. In preparing the compositions that are suitable for injection, one can use aqueous vehicles, water-miscible vehicles, and nonaqueous vehicles
[0206] Additional substances may be included in the injectable compositions of this invention to improve or safeguard the quality of the composition. Thus, an added substance may affect solubility, provide for subject comfort, enhance the chemical stability, or protect the preparation against the growth of microorganisms. Thus, the composition may include an appropriate solubilizer, substances to act as antioxidants, and substances that act as a preservative to prevent the growth of microorganisms. These substances will be present in an amount that is appropriate for their function, but will not adversely affect the action of the composition. Examples of appropriate antimicrobial agents include thimerosal, benzethonium chloride, benzalkonium chloride, phenol, methyl p-hydroxybenzoate, and propyl p-hyrodxybenzoate. Appropriate antioxidants may be found in Remington, supra, at p. 1015-1017.
[0207] In certain embodiments, liposomes, nanocapsules, microparticles, lipid particles, vesicles, and the like, are used for the administration of the chimeric antigens of the present invention. In particular, the compositions of the present invention may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like. Alternatively, compositions of the present invention can be bound, either covalently or non-covalently, to the surface of such carrier vehicles.
[0208] Compositions administered via liposomes may also serve: 1) to target the chimeric antigen to a particular tissue, such as lymphoid tissue; 2) to target selectively to antigen presenting cells; or, 3) to increase the half-life of the peptide composition. Liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers and the like. In these preparations, the chimeric antigen to be delivered is incorporated as part of a liposome, alone or in conjunction with a molecule that binds to a receptor prevalent among lymphoid cells, such as monoclonal antibodies that bind to the CD45 antigen, or with other therapeutic or immunogenic compositions. Thus, liposomes either filled or decorated with a desired chimeric antigen of the invention can be directed to the site of lymphoid cells, where the liposomes then deliver the chimeric antigens. Liposomes for use in accordance with the invention are formed from standard vesicle-forming lipids, which generally include neutral and negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of, e.g., liposome size, acid lability and stability of the liposomes in the blood stream. A variety of methods are available for preparing liposomes, as described in, e.g., Szoka, et al., Ann. Rev. Biophys. Bioeng. 9:467-508 (1980), and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369. A liposome suspension containing a chimeric antigen may be administered intravenously, locally, topically, etc. in a dose which varies according to, inter alia, the manner of administration, the chimeric antigen being delivered, and the stage of the disease being treated.
[0209] Compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable, aqueous or organic solvents, or mixtures thereof, and powders. The liquid or solid compositions may contain suitable pharmaceutically acceptable excipients as described herein. The compositions can be administered by the oral or nasal respiratory route for local or systemic effect. Compositions in pharmaceutically acceptable solvents may be nebulized by use of inert gases. Nebulized solutions may be inhaled directly from the nebulizing device or the nebulizing device may be attached to a facemask tent, or intermittent positive pressure breathing machine. Solution, suspension, or powder compositions may be administered, preferably orally or nasally, from devices that deliver the formulation in an appropriate manner.
[0210] Another formulation employed in the methods of the present invention employs transdermal delivery devices ("patches"). Such transdermal patches may be used to provide continuous or discontinuous infusion of the chimeric antigen of the present invention in controlled amounts. The construction and use of transdermal patches for the delivery of pharmaceutical agents is well known in the art. See, for example, U.S. Pat. No. 5,023,252, herein incorporated by reference. Such patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents.
[0211] Additionally, it may be advantageous to include at least one antiviral therapeutic or chemotherapeutic in addition to the chimeric antigen and pharmaceutical excipient. Antiviral therapeutics include, but are not limited to, peptidomimetics (such as amprenavir, indinavir, lopinavir, nelfinavir, ritonavir, and saquinavir), polynucleotides (such as ampligen and fomivirsen), purine/pyrimidinones (such as abacavir, acyclovir, adefovir, cidofovir, cytarabine, didanosine, dideoxyadenosine, dipivoxil, edoxudine, emtricitabine, entecovir, famciclovir, ganciclovir, idoxuridine, inosine pranobex, lamivudine, MADU, penciclovir, sorivudine, stavudine, tenofovir, trifluridine, valacyclovir, valganciclovir, vidarabine, zalcitabine, and zidovudine), sialic acid analogs (such as oseltamivir and zanamivir), acemannan, acetylleucine monoethanolamine, amantadine, amidinomycin, ateviridine, capravirine, delavirdine, n-docosanol, efavirenz, foscarnet sodium, interferon-α, interferon-β, interferon-γ, kethoxal, lysozyme, methisazone, moroxydine, nevirapine, pentafuside, pleconaril, podophyllotoxin, ribavirin, rimantidine, stallimycin, statolon, termacamra, and traomantadine. Other appropriate antiviral agents are discussed in Remington: supra, at Chapter 87: Anti-Infectives, pp. 1507-1561, particularly pp. 1555-1560. Preferred antiviral therapeutics for inclusion in the pharmaceutical compositions of the present invention include adefovir, dipivoxil, entecovir, lamivudine and ribavirin.
[0212] In some embodiments it may be desirable to include in the pharmaceutical compositions of the invention at least one component which primes B-Lymphocytes or T lymphocytes. Lipids have been identified as agents capable of priming CTL in vivo. For example, palmitic acid residues can be attached to the ε- and α-amino groups of a lysine residue and then linked, e.g., via one or more linking residues such as Gly, Gly-Gly-, Ser, Ser-Ser, or the like, to an immunogenic peptide. The lipidated peptide can then be administered either directly in a micelle or particle, incorporated into a liposome, or emulsified in an adjuvant, e.g., incomplete Freund's adjuvant. In a preferred embodiment, a particularly effective immunogenic composition comprises palmitic acid attached to s- and α-amino groups of Lys, which is attached via linkage, e.g., Ser-Ser, to the amino terminus of the immunogenic peptide.
[0213] As another example of lipid priming of CTL responses, E. coli lipoproteins, such as tripalmitoyl-S-glycerylcysteinlyseryl-serine (P3CSS) can be used to prime virus specific CTL when covalently attached to an appropriate peptide (see, e.g., Deres, et al., Nature 342:561 (1989)). Chimeric antigens of the invention can be coupled to P3CSS, for example, and the lipopeptide administered to an individual to specifically prime an immune response to the target antigen.
[0214] While the compositions of the present invention should not require the use of adjuvants, adjuvant can be used. Various adjuvants may be used to increase the immunological response, depending on the host species, and including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, detergents, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, immunostimulatory polynucleotide sequences, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvum. Additional adjuvants are also well known in the art.
F. Methods of Using Chimeric Antigens
[0215] Another aspect of the invention provides methods of enhancing antigen presentation in antigen presenting cells, said method comprising administering, to the antigen presenting cells, a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. In a preferred embodiment, the antigen presenting cells are dendritic cells.
[0216] An aspect of the invention relates to methods of activating antigen presenting cells comprising contacting the antigen presenting cell with a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. In a preferred embodiment, the antigen presenting cell is contacted with the chimeric antigen in vivo. In another preferred embodiment, the contacting takes place in a human.
[0217] Yet another aspect of the invention provides methods of eliciting an immune response, said method comprising administering to an animal a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. The immune response can be a humoral and/or cellular immune response. In a preferred embodiment, the cellular immune response is both a Th1 and a Th2 response.
[0218] Another aspect of the invention provides methods of treating immune-treatable conditions comprising administering, to an animal in need thereof, a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. Preferably, the immune-treatable condition is a viral infection or cancer. More preferably, the immune-treatable condition is a chronic viral infection. Most preferably, the immune-treatable condition is a chronic hepatitis B viral infection or a chronic hepatitis C viral infection. For the treatment of HBV, preferably the immune response domain comprises a protein selected from the group consisting of a HBV Core protein, a HBV S protein, a HBV S1 protein, a HBV S2 protein, and combinations thereof. For the treatment of HCV, preferably the immune response domain comprises a protein selected from the group consisting of a HCV Core (1-191) protein, a HCV Core (1-177) protein, a HCV E1 protein, a HCV E2 protein, a HCV E1-E2 protein, a HCV NS3A protein, a HCV NS5A protein, and combinations thereof.
[0219] Another aspect of the invention provides methods of vaccinating an animal against a viral infection comprising administering to the animal a chimeric antigen that comprises an immune response domain and a target binding domain, wherein the target binding domain comprises a xenotypic antibody fragment. The method of the invention can prophylactically or therapeutically vaccinate the animal against the viral infection.
[0220] The present invention also comprises methods of using the compositions of the present invention to bind and activate antigen presenting cells, such as dendritic cells. The present invention also comprises methods of using the compositions of the present invention to activate T cells. The present invention also comprises a method of delivering an antigen to an immune system cell, such as an antigen presenting cell. The present invention also comprises compositions and methods for activating a humoral and/or cellular immune response in an animal or human, said method comprising administering one or more chimeric antigens of the present invention.
[0221] Following cloning and expression, the chimeric antigen is evaluated for its efficacy in generating an immune response. Evaluation involves presenting the chimeric antigen to dendritic cells ex vivo or in vivo. The dendritic cells are presented to T-lymphocytes and evaluated for the production of interferon-γ as a marker of T cell response. Specifically, in the ex vivo situation, naive dendritic cells are isolated from peripheral blood. Dendritic cells process and present antigen to naive T-lymphocytes. The chimeric antigen is then presented to naive dendritic cells for processing. These stimulated dendritic cells are in turn presented to a naive T cells, which cause their activation into effector cells, e.g. helper T cells or cytotoxic T-lymphocytes. Activation of the T cells by the dendritic cells is then evaluated by measuring markers, e.g. interferon-γ levels, by a known procedure (Berlyn, et al., Clin. Immunol 101(3):276-283 (2001)). An increase in the percentage of T cells that secrete interferon-γ by at least 50% over background predicts efficacy in vivo. In preferred embodiments, the percentage increase is at least 55%, 60%, 65%, 70%, 75%, 80%, 90% or 100%. In the case of the in vivo situation, the chimeric antigen is directly introduced parenterally in the host, where available dendritic and other antigen-processing cells have the capacity to interact with all antigens and process them accordingly.
G. Combination Therapy
[0222] Another aspect of the invention provides compositions for treating viral infections comprising a chimeric antigen and an antiviral agent. The invention also provides methods of treating viral infections comprising administering a chimeric antigen and an antiviral agent, either concurrently or sequentially.
[0223] Chimeric antigens have been shown to induce specific anti-HBV S1/S2 cytotoxic T cell functions ex vivo, to induce anti-HBV S1/S2 humoral responses in mice, and transiently reduce the viral load in ducks infected with the hepatitis B duck virus (DHBV). The use of a chimeric antigen in combination with an antiviral agent, such as a nucleoside analogue, may prove to be highly efficacious in inducing sustained responses in the treatment of subjects suffering from chronic hepatitis B. The mechanisms of action of the two agents used in combination may produce synergistic effects in treatment of hepatitis B subjects. While not being limited to a particular therapy, a nucleoside analogue, for example, would reduce the number of viral particles circulating in the blood and hence reduce the antigenic load that the immune system must eliminate, and the chimeric antigen would induce a highly specific cellular immune response that would eliminate cells that harbor virus, viral antigens and viral DNA/RNA. In addition, the chimeric antigen would induce a humoral immune response that would neutralize and remove circulating viral particles. Furthermore, the immune mechanism of action of the chimeric antigen could also minimize the toxicity of antiviral agents by permitting lower doses of the antiviral agent to be administered over a shorter period of time. A reduction in the length of time to achieve a sustained response may reduce the chances of development of drug-resistant viral mutants normally induced by antiviral agents, especially nucleoside analogue antiviral agents, when used alone in long-term therapy.
[0224] In brief, combination therapy with the hepatitis B chimeric antigen (e.g. S1/S2-TBD) and a nucleoside analogue in the treatment of hepatitis B has the potential to effect a complete cure of chronic HBV infection. Likewise, a combination of an HCV antiviral such as ribavirin along with the HCV chimeric antigens described herein will produce antigen-specific cellular as well as humoral immune response and thus clear HCV infection in chronically infected subjects.
H. Methods of Preparation
[0225] One aspect of the invention provides methods for producing a chimeric antigen comprising (a) providing a microorganism or cell line, preferably a eukaryotic, more preferably, a non-mammalian microorganism or cell line, that comprises a polynucleotide encoding a chimeric antigen; and (b) culturing said microorganism or cell line under conditions whereby the chimeric antigen is expressed. Preferably, the microorganism or cell line is a yeast, a plant cell line or an insect cell line. More preferably, the cell line is an insect cell line selected from the group consisting of Sf9, Sf21, Drosophila S2, and High Five®.
[0226] The present invention uses established recombinant DNA technology for producing the fusion proteins of selected antigen(s) and the TBD that are necessary in the practice of the invention. Fusion protein constructs are generated at the DNA level incorporating specific restriction enzyme sites, which are exploited in incorporating the desired DNA fragment into expression vectors, and used to express the desired fusion proteins in a heterologous expression system. As used herein, the term "vector" denotes plasmids that are capable of carrying the DNA, which encode the desired protein(s). The plasmid vectors used in the present invention include, but are not limited to, pFastBac HTa and the corresponding recombinant "BACMIDS" generated in DH10Bac® E. coli (Invitrogen). It is possible to mobilize the ORF of the desired proteins and produce other recombinant plasmids for expression of the proteins in other systems, (bacterial or mammalian), in addition to the Bac-To-Bac® baculovirus expression system (Invitrogen), employed in the present invention. The term "expression" is used to mean the transcription of the DNA sequence into mRNA, the translation of the mRNA transcript into the fusion protein.
[0227] This is achieved by the transposition of the gene of interest into the bacmids, transfected into Sf9 insect cells and recombinant baculovirus produced. These are used to infect Sf9 or High Five® insect cells, which produce the protein of interest. All the recombinant proteins produced have an N-terminal 6×His tag, which is exploited in the purification of the proteins by using Ni-NTA Agarose (Qiagen). The proteins also have an N-terminal rTEV protease cleavage site cloned in. The Ni-purified protein is subjected to digestion with rTEV protease (Invitrogen), which also has an N-terminal 6×His tag. Following the protease digestion, the mixture can be loaded on to a Ni-NTA agarose column and the pure protein can be eluted out, while the 6×His tagged fragments will be bound to the column. This method of purification is standard procedure and one skilled in the art would be able to understand the methodology without further explanation.
[0228] Cloning and expression of the DNA sequences which encode the viral antigen and the Fc fragment of the murine monoclonal antibody to generate the chimeric antigen can be achieved through two approaches. The first approach involves cloning the two proteins as a fusion protein, while the second approach involves incorporating specific "bio-linkers" such as biotin or streptavidin in either of the molecules, purifying them separately and generating the chimeric antigen.
[0229] In an exemplary embodiment, a monoclonal antibody (2C12) was generated against the Hepatitis B virus surface antigen, and the hybridoma, which produced this monoclonal antibody, was used to isolate the total RNA for the murine immunoglobulin G. Total RNA was isolated and used to clone the murine Fc fragment. Specifically, the total RNA from a hybridoma cell that expresses murine IgG is isolated using Trizol® reagent (Invitrogen/Gibco BRL, product catalog number 10551-018, 10298-016; a monophasic solution of phenol and guanidine isothiocyante, as described in U.S. Pat. No. 5,346,994). The mRNA was purified from total RNA by affinity chromatography on an oligo-dT column (Invitrogen/Gibco BRL, product catalog number 15939-010). A complementary DNA (cDNA) was produced using reverse transcriptase in a polymerase chain reaction. The oligonucleotide primers were designed to add unique restriction enzyme recognition sites to facilitate cloning. This cDNA was cloned using the Bac-To-Bac® baculovirus expression system (Invitrogen/Gibco BRL, product catalog number 15939-010).
[0230] The baculovirus system, preferentially, is used because not only are large amounts of heterologous proteins are produced, but also because post-translational modifications, such as phosphorylation and glycosylation, of eukaryotic proteins occur within the infected insect cell. In this expression system, the DNA can be cloned into vectors called pFastBac® as illustrated schematically in FIG. 4 (Invitrogen/Gibco BRL, product catalog number 15939-010). In the Bac-To-Bac® system, the generation of recombinants is based on site-specific transposition with the bacterial transposon Tn7. The gene of interest is cloned into pFastBac®, which has mini-Tn7 elements flanking the cloning sites. The plasmid is transformed into Escherichia coli strain DH10Bac® (Invitrogen/Gibco BRL, product catalog number 10361-012), which has a baculovirus shuttle plasmid (bacmid) containing the attachment site of Tn7 within a LacZ gene. Transposition disrupts the LacZ gene so that only recombinants produce white colonies and are easily selected for. The advantage of using transposition in E. coli is that single colonies contain only recombinants so that plaque purification and screening are not required. The recombinant bacmids are transfected in insect cells to generate baculoviruses that express recombinant proteins.
[0231] The Bac-To-Bac® baculovirus expression system is commercially available from Invitrogen and the procedures used were as described in the company protocols, available, for example, at www.invitrogen.com. The gene of interest is cloned into pFastBac HTa donor plasmid and the production of recombinant proteins is based upon the Bac-To-Bac® baculovirus expression system (Invitrogen).
[0232] In the next step, the pFastBac HTa donor plasmid containing the gene of interest is used in a site-specific transposition in order to transfer the cloned gene into a baculovirus shuttle vector (bacmid). This is accomplished in E. coli strain DH10Bac®. The DH10Bac® cells contain the bacmid, which confers kanamycin resistance and a helper plasmid, which encodes the transposase and confers resistance to tetracycline. The recombinant pFastBac HTa plasmids with the gene of interest are transformed into DH10Bac® cells for the transposition to generate recombinant bacmids. A 100 μl aliquot of competent DH10Bac® cells is thawed on ice, the pFastBac HTa based plasmids are added and the mixture is incubated on ice for 30 minutes. The mixture is given a heat shock for 45 seconds at 42° C. and then chilled on ice for 2 minutes. The mixture is then added to 900 μL of LB media and incubated for 4 hours at 37° C. The transformed cells are serially diluted with LB to 10-1 and 10-2 and 100 μl of each dilution is plated on Luria broth (LB) agar plates (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml IPTG) and incubated for at least 36 hours at 37° C. The gentamicin resistance is conferred by the pFastBac HTa and the X-gal and IPTG are used to differentiate between white colonies (recombinant bacmids) from blue colonies (non recombinant). The white colonies are picked and inoculated into 2 ml of LB (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin and 10 μg/ml tetracycline) and incubated overnight at 37° C., with shaking. A sterile loop is used to sample a small amount of the overnight culture and the sample is streaked onto a fresh LB agar plate (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml isopropylthio-β-D-galactoside (IPTG)) and incubated for at least 36 hours at 37° C. to confirm a white phenotype.
[0233] Recombinant bacmids were isolated by standard protocols (Sambrook, supra); the DNA sample was dissolved in 40 μl of TE (10 mM Tris-HCl pH 8, 1 mM EDTA (ethylenediaminetetraacetic acid)) and used for transfections.
[0234] In order to produce baculoviruses, the bacmid is transfected into Sf9 insect cells. Sf9 cells (9×105) were seeded into each well of a 6-well cell culture dish (35 mm wells) in 2 ml of ESF 921 (Expression Systems) and allowed to attach for at least 1 hour at 27° C. Transfections were carried out using Cellfectin® Reagent (Invitrogen, Cat. No. 10362-010; a 1:1.5 (M/M) liposome formulation of the cationic lipid N,NI,NII, NIII-Tetramethyl-N,NI, NII, NIII-tetrapalmitylspermine and dioleoyl phosphatidylethanolammine in membrane filtered water) as per the protocols provided by the supplier of the Sf9 cells. Following transfection, the cells were incubated at 27° C. for 72 hours. The medium containing baculovirus was collected and stored at 4° C. in the dark.
[0235] The efficiency of the transfection was verified by checking for production of baculoviral DNA. The isolated baculovirus DNA is subjected to PCR to screen for the inserted gene of interest. The primers used are pFastBac HTa 5' (sense) TATTCCGGATTATTCATACCG (SEQ ID NO: 3) and pFastBac HTa 3' (antisense) 5' CTCTACAAATGTGGTATGGC (SEQ ID NO: 4). Amplified products were separated on an agarose gel (0.8%). The expression of the heterologous protein in the cells was verified by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and Western blots using the 6×His tag monoclonal antibody (Clontech) as the probe.
[0236] Once production of baculovirus and the expression of protein have been confirmed, the virus stock is amplified to produce a concentrated stock of the baculovirus that carry the gene of interest. It is standard practice in the art to amplify the baculovirus at least two times, and in all protocols described herein this standard practice was adhered to. After the second round of amplification, the concentration of the generated baculovirus was quantified using a plaque assay according to the protocols described by the manufacturer of the kit (Invitrogen). The most appropriate concentration of the virus to infect insect cells and the optimum time point for the production of the desired protein was also established.
[0237] The DNA encoding proteins of interest are generated by PCR with oligonucleotide primers bearing unique restriction enzyme sites from plasmids that contain a copy of the entire viral genome and cloned with the Fc DNA as a fusion protein. This chimeric protein is purified by protein A or G affinity chromatography using techniques known to those skilled in the art.
[0238] The second approach for linking the IRD and TBD involves incorporating specific "bio-linkers" such as biotin or streptavidin in either of the molecules, purifying them separately and generating the chimeric antigen. The viral antigens of interest are cloned into plasmids that control the expression of proteins by the bacteriophage T7 promoter. The recombinant plasmid is then transformed into an E. coli strain, e.g. BL21(DE3) Codon Plus® RIL cells (Stratagene, product catalog number 230245), which has production of T7 RNA polymerase regulated by the lac repressor. The T7 RNA polymerase is highly specific for T7 promoters and is much more processive (˜8 fold faster) than the E. coli host's RNA polymerase. When production of T7 RNA polymerase is induced by isopropylthio-β-D-galactoside (IPTG), the specificity and processivity of T7 RNA polymerase results in a high level of transcription of genes under control of the T7 promoter. In order to couple two proteins together, the tight binding between biotin and streptavidin is exploited. In E. coli, the BirA enzyme catalyzes the covalent linkage of biotin to a defined lysine residue in a specific recognition sequence. The murine Fc fragment is expressed in the baculovirus system, as described above, as a fusion protein with streptavidin. These two proteins can be mixed to form a dimeric protein complex by biotin-streptavidin binding.
[0239] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See e.g., Sambrook, supra; and Ausubel, supra.
I. Article of Manufacture
[0240] Another aspect of this invention provides an article of manufacture that comprises a container holding a composition, comprising a chimeric antigen, that is suitable for injection or reconstitution for injection in combination with printed labeling instructions providing a discussion of how to administer the composition parenterally, e.g. subcutaneously, intramuscularly, intradermally, nasally or intravascularly. The composition will be contained in any suitable container that will not significantly interact with the composition and will be labeled with the appropriate labeling that indicates it will be for parenteral use. Associated with the container will be the labeling instructions consistent with the method of treatment as described hereinbefore. The container that holds the composition of this invention may be a container having a liquid composition suitable for injection that has an appropriate needle for injection and a syringe so that the patient, doctor, nurse, or other practitioner can administer the chimeric antigen. Alternatively, the composition may be a dry or concentrated composition containing a soluble version of the chimeric antigen, to be combined or diluted with an aqueous or nonaqueous vehicle to dissolve or suspend the composition. Alternatively, the container may have a suspension in a liquid or may be an insoluble version of the salt for combination with a vehicle in which the insoluble version will be suspended. Appropriate containers are discussed in Remington, supra, pages 788-789, 805, 850-851 and 1005-1014
[0241] The kit of the invention will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for use. A label can be present on the container to indicate that the composition is used for a specific therapy or non-therapeutic application, and can also indicate directions for either in vivo or ex vivo use, such as those described above. Directions and or other information can also be included on an insert which is included with the kit
V. EXAMPLES
[0242] The following non-limiting examples provide further illustration of the invention.
Example 1
Construction of Murine TBD Protein Expression Vector
[0243] The mouse IgG1 DNA sequences encoding amino acids of a portion of CH1-Hinge-CH2-CH3 region was generated from mRNA isolated from the hybridoma (2C12), which produces mAb against HBV surface antigen (sAg). Total RNA was isolated from 2C12 using Trizol® reagent (Gibco BRL cat. No. 15596-026) and the DNA of the TBD was generated by RT-PCR using Superscript First-strand Synthesis (Invitrogen Cat. No. 11904-018). The PCR primers contained linker sequences encoding the linker peptide--SRPQGGGS--(SEQ ID NO: 28) at the 5' terminus, a unique Not I site at the 5' and a unique Hind III restriction site at the 3' end. The resulting cDNA contains (5' Not I)-linker sequence-Ch1 (VDKKI)-CH2-CH3-(3' Hind III). Following digestion with the respective enzymes, the fragment is ligated with pFastBac HTa expression vector plasmid (Invitrogen) using the same restriction enzyme sites. The 5' primer used for PCR amplification was (Sense) 5' TGTCATTCTGCGGCCGCAAGGCGGCGGATCCGTGGACAAGAAAATTGTGCCC AGG (SEQ ID NO: 1) and the 3' primer was (antisense) 5' ACGAATCAAGCTTTGCAGCCCAGGAGAGTGGGAGAG (SEQ ID NO: 2), which contained the Not I and Hind III sites, respectively. The following protocol was used for directional cloning. The generated fragment was digested with the respective enzymes, purified on agarose gel and cloned into the vector plasmid. The DNA sequence and the correctness of the ORF were verified by standard sequencing methods.
[0244] Following the cloning of the gene of interest (e.g. TBD) into the pFastBac HTa donor plasmid, the production of recombinant proteins was based upon the Bac-To-Bac® baculovirus expression system (Invitrogen). The next step was site-specific transposition of the cloned gene into a baculovirus shuttle vector (Bacmid). This was accomplished in a strain of E. coli called DH10Bac®. The DH10Bac® cells contain the bacmid, which confers kanamycin resistance and a helper plasmid, which encodes the transposase and confers resistance to tetracycline. The recombinant pFastBac HTa plasmids with the gene of interest (TBD) were transformed into DH10Bac® cells for the transposition to generate recombinant bacmids. A 100 μl aliquot of competent DH10Bac® cells was thawed on ice, the pFastBac HTa based plasmids were added and the mixture was incubated on ice for 30 minutes. The mixture was given a heat shock for 45 seconds at 42° C. and then chilled on ice for 2 minutes. The mixture was then added to 900 μL of LB media and incubated for 4 hours at 37° C. The transformed cells were serially diluted with LB to 10-1 and 10-2 and 100 μl of each dilution was plated on LB agar plates supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml IPTG and incubated for at least 36 hours at 37° C. The gentamicin resistance was conferred by the pFastBac HTa and the X-gal and IPTG were used to differentiate between white colonies (recombinant bacmids) from blue colonies (non recombinant). The white colonies were picked and inoculated into 2 ml of LB supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin and 10 μg/ml tetracycline and incubated overnight at 37° C., with shaking. A sterile loop was used to sample a small amount of the overnight culture and the sample was streaked onto a fresh LB agar plate supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml IPTG and incubated for at least 36 hours at 37° C. to confirm a white phenotype.
[0245] Recombinant bacmids were isolated by standard protocols (Sambrook, supra). The DNA sample was dissolved in 40 μl of TE (10 mM Tris-HCl pH 8, 1 mM EDTA) and used for transfections.
[0246] In order to produce baculoviruses, the bacmid was transfected into Sf9 insect cells. Sf9 cells (9×105) were seeded into each well of a 6-well cell culture dish (35 mm wells) in 2 ml of ESF 921 (Expression Systems) and allowed to attach for at least 1 hour at 27° C. Transfections were carried out using Cellfectin® Reagent (Invitrogen, Cat. No. 10362-010) as per the protocols provided by the supplier of the Sf9 cells. Following transfection, the cells were incubated at 27° C. for 72 hours. The medium containing baculovirus was collected and stored at 4° C. in the dark.
[0247] The efficiency of the transfection was verified by checking for production of baculoviral DNA. The isolated baculovirus DNA was subjected to PCR to screen for the inserted gene of interest (TBD). The primers used are pFastBac HTa 5' (sense) TATTCCGGATTATTCATACCG (SEQ ID NO: 3) and pFastBac HTa 3' (antisense) 5' CTCTACAAATGTGGTATGGC (SEQ ID NO: 4). Amplified products were visualized on an agarose gel (0.8%). The expression of the heterologous protein in the cells was verified by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and Western blots using the 6×His tag monoclonal antibody (Clonetech) as the probe.
[0248] Once production of baculovirus and the expression of protein had been confirmed, the virus production was amplified to produce a concentrated stock of the baculovirus that carry the gene of interest (e.g. TBD). It is standard practice in the art to amplify the baculovirus at least two times, and in all protocols described herein this standard practice was adhered to. After the second round of amplification, the concentration of the generated baculovirus was quantified using a plaque assay according to the protocols described by the manufacturer of the kit (Invitrogen). The most appropriate concentration of the virus to infect Sf9 and High Five® cells and the optimum time point for the production of the desired protein was established as well.
Example 2
Construction of HBV Surface Antigen S1/S2 and HBV S1/S2-TBD Fusion Protein Expression Vectors
[0249] The DNA encoding the HBV sAg fragment S1/S2 was generated from the plasmid pRSetB HBV S1/S2 template using PCR methodology. The primers used were: (sense) 5' GGATCTGTACGACGATGACG (SEQ ID NO: 5) and the 3' primer (antisense) 5' AGTCATTCTGCGGCCGCGAGTTCGTCACAGGGTCCCCGG (SEQ ID NO: 6) containing the restriction enzyme site Not I. The 5' end contained a unique Bam HI site derived from the parent plasmid that was used for ligations. Amplified DNA was digested with Bam HI/Not I and ligated with pFastBac HTa expression vector to generate the expression plasmid for HBV S1/S2 protein. The fragment was ligated with the plasmid pFastBac HTa-TBD (described in example 1) following the digestion with the respective enzymes. This produced the expression plasmid pFastBac HTa HBV S 1/S2-TBD. This plasmid was used to produce recombinant baculovirus (described in example 1), which expressed the chimeric antigen-TBD fusion protein: 6×His tag-rTEV protease cleavage site-HBV S1/S2-TBD (See FIGS. 7-9).
Example 3
Construction of HBV Surface Antigen S1/S2/S and HBV S1/S2/S-TBD Fusion Protein Expression Vectors
[0250] The DNA encoding the HBV sAg fragment S 1/S2/S was generated from the plasmid pAlt HBV 991 (University of Alberta) template using PCR methodology. The 5' primer used for the PCR was (sense) 5' GATAAGGATCCTATGGGAGGTTGGTCATCAAAAC (SEQ ID NO: 7), containing the restriction enzyme Bam HI site. The PCR primer for 3' terminus was (antisense) 5' GTCATACTGCGGCCGCGAAATGTATACCCAGAGACAAAAG (SEQ ID NO: 8), containing the restriction enzyme Not I site. Amplified DNA was digested with the respective enzymes and ligated with pFastBac HTa expression vector to generate either the expression plasmid for HBV S1/S2/S or the expression plasmid pFastBac HTa HBV S1/S2/S-TBD for the fusion protein (see FIGS. 10-11).
Example 4
Construction of HBV Core Antigen and HBV Core-TBD Fusion Protein Expression Vectors
[0251] HBV produces the Core proteins (Core) to encapsidate the replicating genome of the virus. There are two forms of the Core one secreted into circulation, also known as the "e" antigen and the capsid forming Core protein. The present invention also relates to the generation of expression plasmids to produce the Core protein as well as the Core antigen-TBD fusion protein, in insect cells. The DNA encoding the HBV Core protein was generated from the plasmid pAlt HBV 991 template using PCR technique. The 5' primer used for the PCR was (sense) 5' TGCGCTACCATGGACATTGACCCTTATAAAG (SEQ ID NO: 9), which contains the restriction enzyme Nco I site and the 3' primer used was (antisense) 5' TGTCATTCTGCGGCCGCGAACATTGAGATTCCCGAGATTGAG (SEQ ID NO: 10), containing the restriction enzyme Not I site. The PCR-amplified DNA was digested with the respective enzymes and ligated with pFastBac HTa expression vector to generate either the expression plasmid for HBV Core protein or the expression plasmid pFastBac HTa HBV Core-TBD for the fusion protein (see FIGS. 13-14).
Example 5
Construction of DHBV Surface Antigen Fragment PreS and DHBV PreS-TBD Fusion Protein Expression Vectors
[0252] DHBV has served as a powerful animal model in the development of antiviral therapy for HBV. Pekin ducks, congenitally infected with DHBV have been used to study the mechanism of replication of the virus and for the screening of antiviral compounds. The present invention also describes the chimeric DHBV antigen-TBD molecules that could be used as therapeutic vaccines in DHBV-infected ducks, thus providing a viable animal model for the feasibility studies for HBV therapeutic vaccines.
[0253] The DNA encoding DHBV PreS antigen was produced by PCR from a plasmid pFastBac Hta-DHBV PreS/S (University of Alberta). The 5' primer used for the PCR was (sense) 5' TATTCCGGATTATTCATACCG (SEQ ID NO: 11). The unique restriction enzyme site EcoRI, resident on the parent plasmid was used for directional cloning. The 3' primer used was (antisense) 5' TGTCATTCTGCGGCCGCGTTTTCTTCTTCAAGGGGGGAGT (SEQ ID NO: 12), containing the restriction enzyme Not I site. Following PCR amplification, the fragment was digested with the restriction enzymes EcoRI and Not I and the DNA fragment was purified on a 1% agarose gel. The fragment was ligated with the expression plasmid pFastBac HTa at the respective sites to produce pFastBac HTa DHBV PreS, which expressed the PreS antigen. The same fragment was also used to ligate with pFastBac HTa-TBD to generate the expression plasmid pFastBac HTa DHBV PreS-TBD. The production of baculovirus stocks from these plasmids and the expression of the PreS and PreS-TBD in High Five® insect cells were done as described in example 1.
Example 6
Construction of DHBV Surface Antigen Fragment PreS/S and DHBV PreS/S-TBD Fusion Protein Expression Vectors
[0254] DHBV PreS/S DNA was produced by PCR methods using 5' primer (sense) 5' TATTCCGGATTATTCATACCG (SEQ ID NO: 11) and the 3' primer (antisense) 5' TGTCATTCAGCGGCCGCGAACTCTTGTAAAAAAGAGCAGA (SEQ ID NO: 13), containing restriction enzyme Not I site. The unique restriction enzyme site EcoRI, resident on the parent plasmid pFastBac HTa PreS/S (University of Alberta) was used for directional cloning. This plasmid also was the template for generating the required DNA by PCR. All other protocols for the production of either the DHBV PreS/S or the fusion protein PreS/S-TBD are the same as described in the example 5 above.
Example 7
Construction of DHBV Core Antigen and DHBV Core-TBD Fusion Protein Expression Vectors
[0255] The DNA coding for DHBV Core was generated from pRSet B DHBV Core by PCR using the following primers. The 5' terminus primer used was (sense) 5' TGCGCTACCATGGATATCAATGCTTCTAGAGCC (SEQ ID NO: 14), containing the restriction enzyme Nco I site. The 3' terminus primer used was (antisense) 5' TGTCATTCTGCGGCCGCGATTTCCTAGGCGAGGGAGATCTATG (SEQ ID NO: 15), containing the restriction enzyme Not I site. All other protocols for the production of either the DHBV Core or the fusion protein DHBV Core-TBD are the same as described in the example 5 above.
Example 8
Chemically Cross-Linked HBV sAg-Fc (Murine)
[0256] HBV sAg was cross linked using the bifunctional cross linking agent dimethyl suberimidate (DMS), a homobifunctional imidoester that reacts with amino groups on the proteins. The unreacted components were removed by gel filtration. The conjugate was characterized with respect to the stoichiometry of sAg/Fc in the conjugate and the fraction containing sAg:Fc at 1:1 ratio was chosen for antigen presentation assays using human monocyte-derived immature Dendritic cells (DCs). Immature DCs were cultured for four days with GM-CSF/IL4, incubated with the sAg-Fc conjugate and matured in the presence of TNFα/IFNα. Autologous CD3+ T cells were added to the mature DCs. Following three rounds of exposure to the mature DCs, T cell stimulation was quantitated by measuring the production of intracellular interferon-γ, using flow cytometry.
[0257] Materials:
HBV sAg (US Biologicals; Cat#H 1910-27)
[0258] Mouse Polyclonal IgG Fc fragment (Harlan Sera-Lab Ltd., Cat#PP-19-01) DMS (Dimethyl suberimidate. 2HCl) (Pierce Cat #20700)
Cross-linking Buffer 0.1M HEPES pH 8.7
Stop Buffer 0.1 M Tris HCl pH 7.8
Elution Buffer Phosphate Buffered Saline (PBS) pH 8.3
Sephadex G 75 (Pharmacia)
[0259] Methods: Solutions of sAg (100 μg) and Mouse Fc fragment (100 μg), were dialyzed against the cross linking buffer overnight at 4° C. The protein solutions were mixed together, DMS reagent was added immediately to a final concentration of 10 mM, and the mixture was incubated at room temperature for 1 hr. The reaction was stopped by the addition of 0.1 M Tris HCl pH 7.8. The reaction mixture was loaded on a Sephadex G 75 column (0.7×12 cm), and fractions were eluted using elution buffer. 0.5 ml fractions were collected and the fractions containing sAg/Fc at a molar ratio of 1:1, as estimated by ELISA using the respective antibodies were pooled and used for Antigen Presentation Assays. (Berlyn, et al., supra (2001)).
[0260] Results: The levels of intracellular interferon-γ produced in T cells in the presence of conjugate was substantially higher than the sAg or the Fc fragment alone.
Example 9
Chimeric Antigens of Hepatitis C Virus (HCV)
[0261] HCV Core-TBD was cloned using the pFastBac HTa vector and the baculovirus system and expressed in Sf9 and High Five® insect cells, similar to the HBV fusion proteins. This was done as follows. The DNA encoding the HCV Core fragment was generated from the plasmid pCV-H77c (NIH) template using PCR methodology.
[0262] The primers used were: (sense) 5' CGGAATTCATGAGCACGAATCCTAAAC (SEQ ID NO: 16) containing the restriction enzyme site EcoRI and the 3' primer (antisense) 5' GGACTAGTCCGGCTGAAGCGGGCACAGTCAGGCAAGAG (SEQ ID NO: 17) containing the restriction enzyme site Spe I. Amplified DNA was digested with EcoRI/Spe I and the fragment was ligated into the plasmid pFastBac HTa TBD (described in example 1) following the digestion with the respective enzymes. This produced the expression plasmid pFastBac HTa HCV Core-TBD. This plasmid was used to produce recombinant baculovirus (described in example 1), which expressed the chimeric antigen (HCV Core-TBD) fusion protein 6×His tag-rTEV protease cleavage site-HCV Core-TBD.
[0263] HCV Core Protein was cloned as follows. Amplified DNA was digested with EcoRI/Spe I and ligated with plasmid pFastBac HTa expression vector to generate the expression plasmid for HCV Core protein. This protein is expressed with N-terminal 6×His tag and rTEV protease cleavage site.
[0264] The following HCV antigens and their respective chimeric antigens (antigen-TBD) have been cloned and are ready for expression.
[0265] E1 & E1-TBD:
[0266] E2 & E2-TBD
[0267] E1 E2 & E1 E2-TBD
[0268] NS5A & NS5A-TBD
Example 10
Cloning, Expression and Purification of Recombinant Proteins Using a Baculovirus Expression System
[0269] Bac-to-Bac® Baculovirus Expresssion System is commercially available from Invitrogen and the procedures used were as described in the company protocols. The gene of interest was cloned into pFastBac HTa donor plasmid and the production of recombinant proteins was based upon the Bac-to-Bac® baculovirus expression system (Invitrogen).
[0270] In the next step, the pFastBac HTa donor plasmid containing the gene of interest was used in a site-specific transposition in order to transfer the cloned gene into a baculovirus shuttle vector (bacmid). This was accomplished in E. coli strain DH10Bac®. The DH10Bac® cells contain the bacmid, which conferred kanamycin resistance and a helper plasmid, which encoded the transposase and conferred resistance to tetracycline. The recombinant pFastBac HTa plasmids with the gene of interest were transformed into DH10Bac® cells for the transposition to generate recombinant bacmids. A 100 μl aliquot of competent DH10Bac® cells was thawed on ice, the pFastBac HTa based plasmids were added and the mixture was incubated on ice for 30 minutes. The mixture was given a heat shock for 45 seconds at 42° C. and then chilled on ice for 2 minutes. The mixture was then added to 900 μL of LB media and incubated for 4 hours at 37° C. The transformed cells were serially diluted with LB to 10-1 and 10-2 and 100 μl of each dilution was plated on Luria broth (LB) agar plates (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml IPTG) and incubated for at least 36 hours at 37° C. The gentamicin resistance was conferred by the pFastBac HTa and the X-gal and IPTG were used to differentiate between white colonies (recombinant bacmids) from blue colonies (non recombinant). The white colonies were picked and inoculated into 2 ml of LB (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin and 10 μg/ml tetracycline) and incubated overnight at 37° C., with shaking. A sterile loop was used to sample a small amount of the overnight culture and the sample was streaked onto a fresh LB agar plate (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml IPTG) and incubated for at least 36 hours at 37° C. to confirm a white phenotype.
[0271] Recombinant bacmids were isolated by standard protocols (Sambrook, supra); the DNA sample was dissolved in 40 μl of TE (10 mM Tris-HCl pH 8, 1 mM EDTA) and used for transfections.
[0272] In order to produce baculoviruses, the bacmid was transfected into Sf9 insect cells. Sf9 cells (9×105) were seeded into each well of a 6-well cell culture dish (35 mm wells) in 2 ml of SFM 900 II and allowed to attach for at least 1 hour at 27° C. Transfections were carried out using Cellfectin® Reagent (Invitrogen, Cat. No. 10362-010) as per the protocols provided by the supplier of the Sf9 cells. Following transfection, the cells were incubated at 27° C. for 72 hours. The medium containing baculovirus was collected and stored at 4° C. in the dark.
[0273] The efficiency of the transfection was verified by checking for production of baculoviral DNA. The isolated baculovirus DNA is subjected to PCR to screen for the inserted gene of interest. The primers used are pFastBac HTa 5' (sense) TATTCCGGATTATTCATACCG (SEQ ID NO: 3) and pFastBac HTa 3' (antisense) 5' CTCTACAAATGTGGTATGGC (SEQ ID NO: 4). Amplified products were separated on an agarose gel (0.8%). The expression of the heterologous protein in the cells was verified by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and Western blots using the 6×His tag monoclonal antibody (Clontech) as the probe.
[0274] Once production of baculovirus and the expression of protein were been confirmed, the virus stock was amplified to produce a concentrated stock of the baculovirus that carry the gene of interest. It is standard practice in the art to amplify the baculovirus at least two times, and in all protocols described herein this standard practice was adhered to. After the second round of amplification, the concentration of the generated baculovirus was quantified using a plaque assay according to the protocols described by the manufacturer of the kit (Invitrogen). The most appropriate concentration of the virus to infect insect cells and the optimum time point for the production of the desired protein was also established.
Example 11
Expression of the Recombinant Proteins
[0275] Recombinant baculovirus of standardized multiplicity of infection (MOI) were used to infect High Five® insect cells. For suspension cultures, cells were seeded at a density of 3×105 cells/mL and incubated at 27.5° C. with shaking at 138 rpm until the cell density reached 2-3×106 cells/mL. Standardized amounts of the respective recombinant baculovirus was added to the cells. The incubation temperature was 27.5° C. and the appropriate infection period was standardized for individual protein expression. The cells were harvested by centrifugation at 2,500 rpm for 10 minutes at 4° C. and used for the purification of the recombinant proteins. Unused portions of cells were snap frozen in liquid nitrogen and stored at -70° C.
Example 12
Purification of Proteins
[0276] For purification under denaturing conditions, the cells were lysed in a buffer containing 6 M guanidinium-HCl in 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCl, 10 mM Imidazole, pH 8.0 (lysis buffer). The suspension was sonicated on ice with 5 pulses of 1 minute per pulse at a power setting of 60 watts, and was mixed at room temperature for 1 hour. The lysate was centrifuged at 27,000×g for 30 min to remove unbroken cells and cell debris. The supernatant was loaded on to a Ni-NTA agarose (Qiagen) bead column (1×5 cm/100 mL cell lysate), pre-equilibrated with lysis buffer. Following loading, the column was washed with 20 column volumes of 6 M guanidinium-HCl in 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCl, 40 mM Imidazole, pH 8.0 (wash buffer 1), followed by washes with 20 column volumes of 8 M urea in 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCl, 40 mM imidazole, pH 8.0 (wash buffer 2). The bound protein was eluted with a buffer containing 8 M urea, 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCl, 250 mM imidazole, pH 8 (Elution Buffer). The fractions containing the protein was pooled and dialyzed against PBS, (Overnight, 4° C.).
Examples 13-16
Use of Chimeric Antigens to Enhance Antigen Presentation by Human PBMC-Derived Dendritic Cells and to Elicit an Immune Response in T Lymphocytes
Example 13
Human PBMC Monocyte Isolation and Differentiation to DCs
[0277] Peripheral blood mononuclear cells (PBMC) were obtained from Ficoll/Histopaque (Sigma) treatment of a leukapheresis cell preparation (Berlyn, et al., supra (2001)). Monocytes were separated from the PBMC population by negative selection using a monocyte isolation kit (Dynal) following the manufacturer's directions. The monocytes were greater than 95% pure as assessed by antibody analysis and flow cytometry (CD3.sup.-, CD19.sup.-, CD16.sup.-, CD11a.sup.+, CD14.sup.+). Monocytes were washed twice with AIM V (Invitrogen) media containing L-glutamine, streptomycin sulfate (50 μg/mL) and gentamicin sulfate (10 μg/mL) with 1% donor matched sera (isolated as described in Berlyn, et al., supra (2001)). Next, the monocytes were cultured in AIM V media containing 2.5% donor matched sera and the cytokines GM-CSF and IL-4 to differentiate the cells toward the dendritic cell (DC) lineage. The cells were incubated in 12-well tissue culture plates at 37° C. under a 7% CO2 atmosphere. The DCs were used for APAs and ligand binding and uptake studies.
[0278] The monocyte-derived DCs (mDC) were harvested on days 1 through 4. The cells were subsequently washed once with AIM V media with 0.1% BSA (Sigma), and twice with Dulbecco's phosphate buffered saline (Invitrogen) with 0.1% (w/v) BSA (PBSB). The mDC were used in 4° C. labeling or binding assays or in 37° C. binding/uptake assays.
Example 14
Human Dendritic Cell T Cell Stimulation Assay
[0279] Antigen presentation assays were performed using human PBMC-derived dendritic cells according to established protocols (Berlyn, et al., supra (2001)). Monocytes were generated from leukapheresis samples from healthy donors and were depleted of lymphocytes and granulocytes by incubation with anti-CD2, CD7, CD16, CD19, and CD56 antibodies. This was followed by incubation with magnetic bead conjugated anti-mouse IgG and separation on a magnet (Dynal). Negatively selected cells were greater than 95% pure monocytes as characterized by flow cytometry using a broad CD marker panel. Next, monocytes were incubated with IL-4 and GM-CSF (R&D Systems) for 4 days in AIM V plus 2.5% matched human serum to generate immature dendritic cells. Again, an aliquot of the cells was stained with a broad CD marker panel to ensure purity and identity of the cells. The cells then were loaded with various antigens for 2-4 hours at 37° C., and matured with interferon-α and TNF-α for 3 days. Dendritic cells were checked again using flow cytometry for an array of CD markers to ensure that cells had undergone proper maturation. The resulting mature, loaded dendritic cells were used for the T cell stimulation assay. A protocol summary for the T cell stimulation assay is presented in schematic form.
##STR00001##
[0280] T cells were generated from the same monocytes as the dendritic cells by means of negative selection using a magnetic T cell isolation kit (Dynal) according to the manufacturer's directions. Mature, loaded dendritic cells (DC-1) were washed thoroughly and added to the T cells (Day 0). The T cells and dendritic cells were incubated for 7 days
[0281] On Day 7, the T cells were re-stimulated with matured, loaded dendritic cells (DC-2). An aliquot of the cells was taken 2 hours later (the Day 7 aliquot). The Day 7 aliquot was incubated with Brefeldin A (GolgiPlug®, R&D Systems) for 18 hours. The cells of the Day 7 aliquot were then assayed for intracellular cytokine staining as described below.
[0282] The remaining cells were incubated for another 7 days. On Day 14, the remaining cells were stimulated with another batch of mature, loaded dendritic cells (DC-3). An aliquot of the cells was taken 2 hours later (the Day 14 aliquot). The Day 14 aliquot was incubated with Brefeldin A (GolgiPlug®, R&D Systems) for 18 hours. The cells of the Day 14 aliquot were then assayed for intracellular cytokine staining as described below.
[0283] After removal of the D14 aliquot, the remaining cells were incubated for three days and the supernatant was used for measuring the level of secreted interferon-γ by ELISA (Opt E1A ELISA kit, BD Biosciences).
[0284] For intracellular cytokine staining, cells were stained with anti-CD3-FITC and anti-CD8-Cy-Chrome for 30 minutes, washed, fixed, permeabilized, and then stained with anti-interferon-γ-PE for 30 minutes on ice. The cells were washed and analyzed by flow cytometry (FACScan, BD Biosciences).
Example 15
Expression of Fc-γ Receptors and CD206 on Maturing DC
[0285] There are several receptors on the APCs that bind and take up antigens. The abundance of these receptors on maturing dendritic cells was evaluated using fluorescent labeled receptor-specific antibodies. FACS analysis was used to estimate percentage of specific receptor positive cells in the total population of dendritic cells. The degree of receptor expression was assessed by determination of the relative mean fluorescent intensity and as a function of relative fluorescent intensity (FIG. 30). The expression of CD64 decreased with time in culture and at day 4 was almost negligible. In contrast, CD32, and to a lesser extent CD16, continued to be expressed after 4 days of DC culture. On day 0 of culture, there was essentially no CD206 expression, but expression was induced upon culture with IL-4 and GM-CSF, and by day 4 CD206 was expressed at very high levels. Thus at day 4, when antigen was loaded in the antigen presentation assays, the DCs possessed at least two potential receptors for the binding of chimeric antigens: CD32 and CD206. In addition, as shown in FIG. 31, they had the full complement of the co-stimulatory molecules. The expression of HLA-DR (Class II) and HLA-ABC (Class I) also increased with time in culture. Co-stimulatory molecules CD86 (B7.2) and CD80 (B7.1) were expressed throughout the period of the assay (FIG. 31). These results indicate that the monocyte-derived DCs were differentiating towards mature DCs and were capable of antigen processing and presentation to T cells. The cells were used to evaluate the binding and uptake of the chimeric antigens in comparison to relevant antibodies.
Example 16
Phenotypic Analysis, Binding and Uptake Assay
[0286] For the phenotypic analysis and binding assay, all procedures using incubations were performed at 4° C.; buffer solutions were also held at 4° C. The binding of antigens, chimeric antigens or antibodies was determined by incubating the cells with various concentrations of the agents for 60 minutes in Dulbecco's phosphate buffered saline with 0.1% (u/v) BSA (PBSB).
[0287] For phenotypic analysis, cells were incubated with the various conjugated mAbs at the concentrations recommended by the manufacturer for 20 minutes. Incubations were performed with 1×105 cells/well in 96-well v-bottom plates in a volume of 25 μL/well. Subsequently, the cells were washed twice with PBSB.
[0288] For binding analysis, the cells were treated with F(ab')2 goat anti-mouse Alexa-488 (10 μg/mL) in PBSB for 20 minutes. The cells were washed twice with PBSB and either resuspended in PBSB with 2% PF and acquired by FACS or in PBSB and incubated with PE-conjugated CD32 or CD206 specific mAb for 20 minutes before washing twice with PBSB.
[0289] To determine the extent of uptake of chimeric antigens (e.g. HBV S1/S2-TBD) compared with IgG1 and IgG2a, cells were incubated with various concentrations of the antigen, IgG1 (2C12, the parent mAb from which TBD was produced) or IgG2a (G155-178) for 1 hour at 37° C. in AIM V media with 0.1% BSA. Cells were washed twice in PBSB and fixed with PBS with 2% PF overnight at 4° C. Subsequently, the cells were washed twice in PBSB and permeabilized with PBS containing 0.1% (w/v) saponin (Sigma) for 40 minutes at 20° C.
[0290] The cells were washed twice with PBSB and incubated with F(ab')2 goat anti-mouse Alexa-488 (10 μg/mL) in PBSB with 0.1% (w/v) saponin for 20 minutes at 4° C. After washing twice in PBSB, the cells were resuspended in PBSB. A variant of this assay involved treating the cells as above with chimeric antigen, IgG1, or IgG2a for 10 minutes followed by the addition of F(ab')2 goat anti-mouse Alexa-488 (10 μg/mL) for 50 minutes. Subsequently the cells were washed and resuspended in PBS with 2% PF. This procedure relied on the ability of the anti-mouse Alexa-488 Ab to directly bind the S1/S2-TBD, IgG1 or IgG2a molecules.
[0291] Cells were acquired by a Becton Dickinson (BD) FACScan fitted with Cellquest acquisition and analysis software (BD). A gate was made on the viable cell population as determined by the FSC and SSC scatter profile and ≧10,000 events were acquired. To determine the percentage of positive cells, a gate was set based on negative control treated cells (isotype control labeled or cells labeled with F(ab')2 goat anti-mouse Alexa-488 alone).
[0292] The percent of specific positive cells was calculated as:
% positive cells test sample - % positive cells control 100 - % positive cells of control × 100 ##EQU00001##
[0293] The relative mean fluorescent intensity (MFI) was determined as the MFI of the test sample minus the MFI of the control sample.
Example 17
Construction of pFastBac HTa-TBD, TBD Protein Expression Vector
[0294] The mouse IgG 1 DNA sequences encoding amino acids of CH1-Hinge-CH2-CH3 region was generated from mRNA isolated from the hybridoma (2C12), which produces mAb against HBV surface antigen (sAg). Total mRNA was isolated using Trizol® reagent (Gibco BRL cat. No. 15596-026) and the cDNA of the TBD was generated by RT-PCR using Superscript First-strand Synthesis (Invitrogen Cat. No. 11904-018). The PCR primers contained linker sequences encoding the linker peptide --SRPQGGGS-- (SEQ ID NO: 28) at the 5' terminus, a unique Not I site at the 5'-end and a unique Hind III restriction site at the 3' end. The resulting cDNA contains (5' Not I)-linker sequence-CH1 (VDKKI)-CH2-CH3-(3' Hind III). Following digestion with the respective enzymes, the fragment is ligated with pFastBac HTa expression vector plasmid (Invitrogen) using the same restriction enzyme sites to generate pFastBac HTa-TBD. The 5' primer used for PCR amplification was (Sense) 5' TGTCATTCTGCGGCCGCAAGGCGGCGGATCCGTGGACAAGAAAATTGTG CCCAGG (SEQ ID NO: 1) and the 3' primer was (antisense) 5' ACGAATCAAGCTTTGCAGCCCAGGAGAGTGGGAGAG (SEQ ID NO: 2), which contained the Not I and Hind III sites, respectively. The following is the protocol used for directional cloning. The generated fragment was digested with the respective enzymes, purified on agarose gel and cloned into the vector plasmid. The DNA sequence and the correctness of the ORF were verified by standard sequencing methods. Nucleotide sequence of the ORF of TBD in the plasmid pFastBac HTa-TBD and the deduced amino acid sequences of the expressed TBD protein from the ORF are shown in FIG. 6.
Example 18
Expression and Purification of TBD Protein
[0295] Recombinant baculovirus of standardized multiplicity of infection (MOI) were used to infect High Five® insect cells. For suspension cultures, cells were seeded at a density of 3×105 cells/mL and incubated at 27.5° C. with shaking at 138 rpm until the cell density reached 2-3×106 cells/mL. Recombinant baculovirus was added to the cells. For the expression of TBD the MOI used was 10 pfu/cell. The incubation at 27.5° C. was continued for 48 hrs. The cells were harvested by centrifugation at 2,500 rpm for 10 minutes at 4° C. and used for the purification of the recombinant proteins.
[0296] TBD protein was expressed in Express Five Insect cells, purified as described in Example 12. The protein was subjected to electrophoresis on a 12% polyacrylamide gel and the coomassie blue-stained band is shown.
Example 19
Construction of HBV Surface Antigen S1/S2 and HBV S1/S2-TBD Chimeric Fusion Protein Plasmids
[0297] The DNA encoding the HBV sAg fragment S1/S2 was generated from the plasmid pRSetB HBV S1/S2 template using PCR methodology. The primers used were: (sense) 5' GGATCTGTACGACGATGACG (SEQ ID NO: 5) and the 3' primer (antisense) 5' AGTCATTCTGCGGCCGCGAGTTCGTCACAGGGTCCCCGG (SEQ ID NO: 6) containing the restriction enzyme site Not I. The 5' end contained a unique Bam HI site derived from the parent plasmid that was used for ligations. Amplified DNA was digested with Bam HI/Not I and ligated with pFastBac HTa expression vector to generate the expression plasmid for HBV S1/S2 protein. The fragment was ligated with the plasmid pFastBac HTa-TBD (described in Example 1) following the digestion with the respective enzymes. This produced the expression plasmid pFastBac HTa HBV S1/S2-TBD. This plasmid was used to produce recombinant baculovirus (as described in Example 1), which expressed the chimeric antigen-TBD fusion protein: 6×His tag-rTEV protease cleavage site-HBV S1/S2-TBD. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa HBV S1/S2 are shown in FIG. 9. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa HBV S1/S2-TBD are shown in FIG. 8.
Example 20
Expression and Purification of HBV Surface Antigen S1/S2 and HBV S1/S2-TBD Chimeric Fusion Proteins
[0298] Recombinant bacmids of standardized multiplicity of infection (MOI) were used to infect High Five® insect cells. For suspension cultures, cells were seeded at a density of 3×105 cells/mL and incubated at 27.5° C. with shaking at 138 rpm until the cell density reached 2-3×106 cells/mL. Recombinant baculovirus was added to the cells. For the expression of the fusion protein HBV S 1/S2-TBD, the MOI was 1 pfu/cell and for S1/S2, 2 pfu/cell was used. The incubation at 27.5° C. was continued for 48 hrs. The cells were harvested by centrifugation at 2,500 rpm for 10 minutes at 4° C. and used for the purification of the recombinant proteins.
[0299] Expression of S1/S2-TBD was performed in High Five® cells (Trichoplusia ni BTI-Tn-5B1-4) grown in Express Five SFM media. The High Five® cells were grown in a shaker culture at 27.5° C. until the cell density reached 2.5×106 cells/ml. Usually, a 250 ml culture is prepared. The culture was infected with HBV S1/S2-TBD baculovirus at a multiplicity of infection (MOI) of 1 pfu/cell and incubated at 27.5° C. for 48 hrs with shaking. Infected cells were harvested by centrifugation at 4000×g on a JA-10 (Beckman) rotor for 10 minutes. The cells were stored at -70° C. until purification were performed.
[0300] For purification, 40 ml of ice-cold lysis buffer (6M guanidine hydrochloride, 0.1 M NaH2PO4, 10 mM Tris, 500 mM NaCl, 10 mM imidazole, pH 8.0) was added to a frozen cell pellet. The cells were sonicated on ice for 5 pulses at 1 minute per pulse at 78-81 W and stirred at room temperature for 1 hour. The lysate was clarified by centrifugation at 27000×g on a JA-25.50 rotor (Beckman) for 30 min. Purification was performed on Ni-NTA Superflow. A 1.5×12 cm column was packed with 3 ml of Ni-NTA Superflow and equilibrated with 10 column volumes of lysis buffer. The clarified lysate was loaded onto the column. First, the column was washed with lysis buffer until the OD280 was <0.01. Next, the column was washed with 6M guanidine hydrochloride, 0.1 M NaH2PO4, 10 mM Tris, 500 mM NaCl, 40 mM imidazole, pH 8.0 until the OD280 is <0.01. Then the column was washed with 8 M urea, 0.1 M NaH2PO4, 10 mM Tris, 500 mM NaCl, 40 mM imidazole, pH 8.0 until the OD280 was <0.01. Elution was performed with 8M urea, 0.1 M NaH2PO4, 10 mM Tris, 500 mM NaCl, 250 mM imidazole, pH 8.0 and 0.5 ml fractions were collected. The fractions were analyzed by OD280 for protein. HBV S1/S2 and TBD protein fractions were dialyzed against 10 mM NaH2PO4, 0.3 M NaCl, pH 8.0.
[0301] S1/S2-TBD was dialyzed against 8M urea, 0.1 M NaH2PO4, 10 mM Tris, pH 8.0 with 3 changes and was subjected to further purification as follows. A 1 ml bed of DEAE Sepharose Fast Flow was equilibrated with 8M urea, 0.1 M NaH2PO4, 10 mM Tris, pH 8.0. The dialyzed S1/S2-TBD was added to the DEAE Sepharose Fast Flow and mixed together for 2 hours at room temperature. The mixture was centrifuged at 2500 rpm for 2 mM and the supernatant was collected.
[0302] Purified S1/S2-TBD was subjected to refolding. The DEAE purified S1/S2-TBD was reduced by adding 10 mM DTT and incubated for 30 minutes at room temperature. The reduced S1/S2-TBD was dialyzed against 4 M urea, 0.1 M NaH2PO4, 10 mM Tris, 150 mM NaCl, pH 8.0 at 4° C. for at least 6 hrs. The buffer was changed to 2M urea, 0.1 M NaH2PO4, 10 mM Tris, 150 mM NaCl, pH 8.0 and dialysis was continued at 4° C. After at least 6 hrs, the dialysis buffer was changed to 1 M urea, 0.1 M NaH2PO4, 10 mM Tris, 150 mM NaCl, 200 mM L-arginine, 0.5 mM oxidized glutathione (GSSG), pH 8.0 and dialysis was continued at 4° C. overnight. Following this, the buffer was changed to 0.5 M urea, 0.1 M NaH2PO4, 10 mM Tris, 150 mM NaCl, 200 mM L-arginine, 0.5 mM GSSG, pH 8.0 and dialysis was continued at 4° C. overnight. Finally, the sample was dialyzed against 10 mM NaH2PO4, 150 mM NaCl, pH 8.0 at 4° C. for at least 6 hrs. The last step was repeated 2 more times.
Example 21
Binding of Chimeric Antigens to Maturing DCs
[0303] The chimeric antigen S1/S2-TBD binds to maturing DCs with high efficiency (FIG. 32). The extent of binding of S1/S2-TBD relative to murine IgG1 and IgG2a to maturating DC was compared. DCs were isolated at various days of ex vivo culture (from day 0 to day 4) and treated with S1/S2-TBD (10 μg/mL) or with murine IgG1 (clone 2C12) or IgG2a (clone G155-178, 90 μg/mL) for 1 hour at 4° C. Subsequently, binding was detected with a F(ab')2 anti-mouse IgG conjugated to Alexa 488 as described in Example 16. The binding of S1/S2-TBD relative to IgG1 and IgG2a on DC after 1 and 4 days of culture is shown in FIGS. 33 and 34. S1/S2-TBD binding was clearly much greater than the binding of either IgG1 or IgG2a with more S1/S2-TBD binding evident on day 1 than on day 4. These experiments clearly demonstrated that S1/S2-TBD was bound with high efficiency to the maturing DC.
Example 22
A High Proportion of Maturing DCs Bind Chimeric Antigen S1/S2-TBD
[0304] A large proportion of maturing DCs bind S1/S2-TBD. The binding of S1/S2-TBD in comparison to murine IgG2a and IgG1 was measured as a function of phenotypic changes on day 2 of the maturation of DCs as described in Example 16. DCs were isolated at various days of culture (from day 0 to day 4) and were treated with S1/S2-TBD (10 μg/mL), murine IgG1 (clone 2C12), or IgG2a (clone G155-178, 90 μg/rap for 1 hour at 4° C. Subsequently, binding was detected with a F(ab)2 anti-mouse IgG conjugated to Alexa 488. The binding of S1/S2-TBD relative to IgG1 and IgG2a on DC after 1 and 4 days of culture is shown in FIGS. 33 and 34. S1/S2-TBD binding was clearly much greater than the binding of either IgG1 or IgG2a with more S1/S2-TBD binding evident on day 1 than day 4. Thus, these experiments demonstrated that a large proportion of maturing DCs bind S1/S2-TBD The proportion of DCs that bind S1/S2-TBD was much greater than either IgG2a or IgG1. Furthermore, the degree of binding of S1/S2-TBD was several orders of magnitude greater than that of the immunoglobulins.
[0305] The chimeric Antigen S1/S2-TBD binds to DCs more efficiently than IgG1 or IgG2a on days 1 and 4 of culture.
Example 23
Chimeric Antigen S1/S2-TBD is Taken up by DCs with High Efficiency
[0306] The uptake of S1/S2-TBD in comparison to murine IgG1 and IgG2a was estimated as a function of concentration on day 4 of DC maturation. The uptake was quantified at 37° C. for 1 hour and the results are shown in FIG. 35.
[0307] There was a linear increase in the uptake of S1/S2-TBD with concentration. IgG 1 was taken up at a much lower level and there was very little uptake of IgG2a. Therefore, the chimeric antigen S1/S2-TBD is taken up by the DCs more efficiently than immunoglobulins.
Example 24
Correlation of CD32/CD206 Expression and S1/S2-TBD Binding to Maturing DCs
[0308] There is a direct correlation between the expression of CD32/CD206 receptors and S1/S2-TBD binding to maturing DCs. Since it was known that murine IgG1 binds to human CD32, it was expected that S1/S2-TBD, which contains the murine Fc component of IgG1, would also bind CD32. Furthermore, S1/S2-TBD by virtue of its high mannose glycosylation, would also be expected to bind to DC through the CD206 receptor.
[0309] The dot plots in FIG. 36 show S1/S2-TBD binding (10 μg/mL) and CD32 expression as well as S1/S2-TBD binding and CD206 expression. There was a direct correlation between the extent of S1/S2-TBD binding and the degree of CD32 expression, which was relatively heterogeneous, i.e., there was a broad degree of expression. These results demonstrate that S1/S2-TBD binds to CD32, and that the greater the expression of CD32, the greater was the degree of binding of the chimeric antigen S 1/S2-TBD. The dot plot of S 1/S2-TBD binding and CD206 expression shows that the vast majority of cells expressing CD206 also bound S 1/S2-TBD A small percentage of the cell population was CD206 negative and was consequently negative for S1/S2-TBD binding. Therefore both CD32 and CD206 receptors correlate with the binding of S1/S2-TBD.
Example 25
The Binding and Uptake of S1/S2-TBD is Primarily Via CD32 with CD206 Involved to a Lesser Extent
[0310] The uptake of S1/S2-TBD in comparison to murine IgG1 and IgG2a was estimated as a function of concentration on day 4 of DC maturation. The uptake was quantified at 37° C. for 1 hour in the presence and absence of inhibitors of CD32 and CD206 and the results are shown in FIG. 37. There was a progressive increase in the binding of the chimeric antigen with its concentration. Incubation of the cells with a high concentration of mouse Fcγ fragment abolished this binding, whereas mannan, an inhibitor of CD206 receptor binding, had only a marginal effect. Therefore, CD32 may be the primary receptor involved in the binding and uptake of the chimeric antigen.
Example 26
Glycosylated HBV S1/S2 Antigen Produced in Insect Cells Binds to DCs Through CD206 Receptors
[0311] The insect cell pathway of protein glycosylation is different from that of mammalian cells in that proteins synthesized in insect cells undergo glycosylation that results in high mannose content and a lack of terminal sialic acid residues in the secreted protein (Altman, et al., Glycoconjug 16:109-123 (1999)).
[0312] HBV S1/S2, the antigen component of the chimeric antigen was expressed in both E. coli (no glycosylation) and in High Five® insect cells (high mannose glycosylation). These antigens were compared for their binding to DCs. Glycosylated protein showed better binding and uptake by DCs (FIG. 38).
Example 27
Chimeric Antigen S1/S2-TBD Elicited T Cell Responses as Measured by Interferon-γ Production
[0313] The T cell response was greater with S1/S2-TBD treatment than with either of its two components measured individually. DCs were loaded with S1/S2 antigen, TBD, or S1/S2-TBD and presented to T cells in an antigen presentation assay as described in example 14. T cell stimulation was evaluated by measuring intracellular and secreted interferon-γ levels. The results are presented in FIGS. 39 and 40. The chimeric antigen S 1/S2-TBD induced the production of higher interferon-γ levels compared to either the IRD or the TBD domain of the molecule when tested alone, at equivalent concentrations. It should be pointed out that 5 μg dose of S1/S2-TBD contains roughly 2.5 μg each of the components.
Example 28
Interferon-γ Production Following S1/S2-TBD Antigen Presentation by DCs
[0314] Interferon-γ production and secretion by CD3.sup.+ T cells increased in a concentration dependent manner following S 1/S2-TBD antigen presentation by DCs. Purified S1/S2-TBD was used in antigen presentation assays using human PBMC-derived DCs, and the secreted and intracellular interferon-γ levels were measured in T cells following three rounds of antigen presentation. FIG. 41 presents intracellular levels and FIG. 42 shows the secreted levels. The results are the mean of three estimates.
[0315] Various concentrations of S1/S2-TBD were tested for the T cell response. The effect of S1/S2-TBD was greater than the tetanus toxoid treatment at similar concentrations. At concentrations lower than 5 μg/mL, the chimeric antigen elicited a concentration dependent increase in the production and secretion of interferon-γ. The positive response at low concentrations would be beneficial with respect to the dose necessary for vaccination and the cost of manufacturing of a vaccine.
Example 29
Glycosylation of HBV S1/S2 Antigen Imparts Immunogenicity to the Antigen and Generates Higher T Cell Responses
[0316] Glycosylation of HBV S1/S2 elicits increased immunogenicity and T Cell responses. The insect cell pathway of protein glycosylation is different from that of mammalian cells in that proteins synthesized in insect cells undergo glycosylation that results in high mannose content and a lack of terminal sialic acid residues in the secreted protein (Altman, et al., supra).
[0317] HBV S1/S2, the antigen component of the chimeric antigen was expressed in both E. coli (no glycosylation) and in High Five® insect cells (high mannose glycosylation). These antigens were compared for T cell responses when presented by DCs. Both intracellular and secreted interferon-γ levels were measured and the results are presented in FIGS. 43 and 44. HBV S 1/S2 expressed in insect cells generated a higher level of both intracellular and secreted interferon, as compared to the unglycosylated protein expressed in E-coli.
Example 30
Construction of HBV Core Antigen and HBV Core-TBD Fusion Protein Expression Vectors
[0318] HBV produces the Core proteins (Core) to encapsidate the replicating genome of the virus. There are two forms of the Core; one secreted into circulation, also known as the "e" antigen; and other is the capsid forming Core protein. The present invention also relates to the generation of expression plasmids to produce the Core protein as well as the Core antigen-TBD fusion protein in insect cells, similar to examples described in Example 19. The DNA encoding the HBV Core protein was generated from the plasmid pAlt HBV 991 template using PCR technique. The 5' primer used for the PCR was (sense) 5' TGCGCTACCATGGACATTGACCCTTATAAAG (SEQ ID NO: 9) that contains the restriction enzyme Nco I site and the 3' primer used was (antisense) 5' TGTCATTCTGCGGCCGCGAACATTGAGATTCCCGAGATTGAG (SEQ ID NO: 10), containing the restriction enzyme Not I site. The PCR-amplified cDNA was digested with the respective enzymes and ligated with pFastBac HTa expression vector to generate either the expression plasmid for HBV Core protein or the expression plasmid pFastBac HTa HBV Core-TBD fusion protein. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa HBV Core are shown in FIG. 15. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa HBV Core-TBD are shown in FIG. 14.
Example 31
Construction of DHBV Surface Antigen PreS/S and DHBV PreS/S-TBD Fusion Protein Expression Vectors
[0319] DHBV has served as a powerful animal model in the development of antiviral therapy for HBV. Pekin ducks, congenitally infected with DHBV have been used to study the mechanism of replication of the virus and for the screening of antiviral compounds. The present invention also describes the chimeric DHBV antigen-TBD molecules that could be used as therapeutic vaccines in DHBV-infected ducks, thus providing a viable animal model for the feasibility studies for a HBV therapeutic vaccines.
[0320] DNA encoding DHBV PreS/S was produced by PCR methods from template plasmid pFastBac HTa PreS/S (University of Alberta) using 5' primer (sense) 5' TATTCCGGATTATTCATACCG (SEQ ID NO: 11) and the 3' primer (antisense) 5' TGTCATTCAGCGGCCGCGAACTCTTGTAAAAAAGAGCAGA (SEQ ID NO: 13), containing restriction enzyme Not I site. The unique restriction enzyme site EcoRI, resident on the parent plasmid pFastBac HTa PreS/S was used for directional cloning. All other protocols for the production of either the DHBV PreS/S or the fusion protein PreS/S-TBD are the same as described in Example 19. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa DHBV PreS/S are shown in FIG. 21. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa DHBV PreS/S-TBD are shown in FIG. 19.
Example 32
Construction of DHBV Core antigen and DHBV Core-TBD Fusion Protein Vector Plasmids
[0321] The DNA coding for DHBV Core was generated by PCR using the following primers. The 5' terminus primer used was (sense) 5' TGCGCTACCATGGATATCAATGCTTCTAGAGCC (SEQ ID NO: 14), containing the restriction enzyme Nco I site. The 3' terminus primer used was (antisense) 5' TGTCATTCTGCGGCCGCGATTTCCTAGGCGAGGGAGATCTATG (SEQ ID NO: 15), containing the restriction enzyme Not I site. All other protocols for the production of either the DHBV Core or the fusion protein DHBV Core-TBD are the same as described in the example 4 above. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa DHBV Core are shown in FIG. 24. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa DHBV Core-TBD are shown in FIG. 23.
Example 33
Construction of pFastBac HTa HCV Core (1-191) Antigen and the Chimeric Antigen pFastBac HTa HCV Core (1-191)-TBD Fusion Protein Vector Plasmids
[0322] The DNA encoding the HCV Core was generated from the plasmid pCV-H77C template (University of Alberta) using PCR methodology. The primers used were: (sense) 5' CGGAATTCATGAGCACGAATCCTAAAC (SEQ ID NO: 16) containing the unique restriction enzyme site EcoRI and the 3' primer (antisense) 5' GGACTAGTCCGGCTGAAGCGGGCACAGTCAGGCAAGAG (SEQ ID NO: 17) containing the unique restriction enzyme site Spe I. Amplified DNA was digested with EcoRI/Spe I and ligated with pFastBac HTa expression vector digested with the same two enzymes. The expression plasmid for HCV Core protein was generated with this method. The fragment was ligated with the plasmid pFastBac HTa (described in Example 19) following the digestion with the respective enzymes. This produced the expression plasmid pFastBac HTa HCV Core. This plasmid was used for the transposition in DH10Bac® and the recombinant Bacmids used for Sf9 insect cell transfections. The resulting baculovirus carrying the gene of interest was optimized for MOI and the time for efficient protein expression (described in example 19). The generation of recombinant expression plasmid pFastBac HTa-HCV Core-TBD was achieved through similar protocols. The PCR-amplified DNA was digested with EcoRI/Spe I and the purified fragment was ligated with the plasmid pFastBac HTa-TBD (described in example 19) following the digestion with the respective enzymes. This produced the expression plasmid pFastBac HTa HCV Core-TBD. This plasmid was used to produce recombinant baculovirus that expressed the chimeric antigen-TBD fusion protein: 6×His tag-rTEV protease cleavage site-HCV Core-TBD. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa HCV Core (1-191) are shown in FIG. 45. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBac HTa HCV Core (1-191)-TBD are shown in FIG. 46. All other protocols are described in example 19.
Example 34
Expression and Purification of HCV Core Antigen and HCV Core-TBD Chimeric Fusion Protein
[0323] Recombinant bacmids of standardized multiplicity of infection (MOI) were used to infect High Five® insect cells. For suspension cultures, cells were seeded at a density of 3×105 cells/mL and incubated at 27.5° C. with shaking at 138 rpm until the cell density reached 2-3×106 cells/mL. Recombinant baculovirus was added to the cells. For HCV Core, infections of High Five® cells were performed at an MOI of 1 pfu/cell. Cells in suspension were grown to mid-log phase and infected with the recombinant baculovirus at this MOI. These infected cultures were incubated for 48 hours and then the cells were harvested. For HCV Core-TBD, infections of High Five® cells were done at an MOI of 1 pfu/cell and for 72 hours.
[0324] Purification of Proteins: The purification of HCV Core and HCV Core-TBD was done under denaturing conditions as follows. The cells were lysed in a buffer containing 6 M Guanidinium-HCl, 0.1 M Na2HPO4, 0.01 M Tris-HCl pH 8.0, 0.01 M Imidazole, (lysis buffer). The suspension was sonicated on ice with 5 pulses of 1 minute per pulse at a power setting of 60 watts, and was mixed at room temperature for 1 hour. The lysate was centrifuged at 27,000×g for 30 min to remove unbroken cells and cell debris. The supernatant was mixed for 1 hr with Ni-NTA agarose (Qiagen) beads (5 mL/100 mL cell lysate), pre-equilibrated with lysis buffer. Following the mixing step, the beads were loaded on to a column and was washed with a minimum of 20 column volumes of 8M Urea, 0.1 M Na2HPO4, 0.01 M Tris-HCl pH 8.0, 0.02M Imidazole (wash buffer), until the OD280 was <0.01. The bound protein was eluted in a buffer containing 8M Urea, 0.1 M Na2HPO4, 0.01 M Tris-HCl pH 8, 0.25 M imidazole.
[0325] HCV Core-TBD was separated from other proteins by gel filtration. The peak elution fractions from Ni-NTA agarose column were loaded on a Sephadex G100 (Pharmacia) gel filtration column and the column was eluted with 8M Urea, 0.1 M Na2HPO4, 0.01 M Tris-HCl, pH 8.0. The fractions containing HCV Core-TBD were pooled and dialyzed against PBS (phosphate buffered saline).
[0326] HCV Core antigen and the fusion protein HCV Core-TBD fusion protein were expressed in High Five® insect cells, and purified; Coomassie blue-stained HCV Core was run on a 12% polyacrylamide gel. Core-TBD was purified and a Western blot using 6×His monoclonal antibody.
Example 35
Construction of pFastBac HTa HCV Core (1-177) Antigen and pFastBac HTa HCV Core (1-177)-TBD Fusion Protein Plasmid Vectors
[0327] The DNA coding for HCV Core (1-177) was generated by PCR using the following primers. The 5' terminus primer used was (sense) 5' CGGAATTCATGAGCACGAATCCTAAAC (SEQ ID NO: 18), containing the restriction enzyme EcoRI site. The 3' terminus primer used was (antisense) 5' GGACTAGTCCGAAGATAGAGAAAGAGC (SEQ ID NO: 19), containing the restriction enzyme Spe I site. Following digestion with the two enzymes, the DNA fragment was ligated with plasmid pFastBac HTa to generate pFastBac HTa HCV (Core 1-177) and with pFastBac HTa-TBD to generate the expression plasmid pFastBac HTa HCV Core (1-177)-TBD. All other protocols for the production of either the HCV Core (1-177) antigen or the chimeric antigen fusion protein HCV Core (1-177)-TBD are the same as described in example 19. Nucleotide sequence and the deduced amino acid sequence of 6×His-rTEVprotease site-HCV Core (1-177) are shown in FIG. 47. Nucleotide sequence and the deduced amino acid sequence of 6×His-rTEVprotease site-HCV Core (1-177)-TBD are shown in FIG. 48.
Example 36
Construction of pFastBac HTa HCV NS5A Antigen and pFastBac HTa HCV NS5A-TBD Fusion Protein Expression Vector Plasmids
[0328] The DNA encoding the HCV NS5A fragment was generated from the plasmid pCV-H77C (University of Alberta) template using PCR methodology. The 5' primer used form the PCR was (sense) 5' CCGGAATTCTCCGGTTCCTGGCTAAGG (SEQ ID NO: 20) containing the restriction enzyme EcoRI site. The PCR primer for 3' terminus was (antisense) 5' GGACTAGTCCGCACACGACATCTTCCGT (SEQ ID NO: 21) containing the restriction enzyme Spe I site. Amplified DNA was digested with the respective enzymes and ligated with pFastBac HTa expression vector to generate either the expression plasmid for HCV NS5A or it was ligated with the expression plasmid pFastBac HTa-TBD to generate the expression plasmid pFastBac HTa HCV NS5A-TBD fusion protein.
[0329] Nucleotide sequence and the deduced amino acid sequence of 6×His-rTEVprotease site-HCV NS5A are shown in FIG. 49. Nucleotide sequence and the deduced amino acid sequence of 6×His-rTEVprotease site-HCV NS5A-TBD are shown in FIG. 50.
Example 37
Construction of pFastBac HTa HCV E1 Antigen and pFastBac HTa HCV E1-TBD Fusion Protein Expression Vectors
[0330] Plasmid pFastBac HTa HCV E1 and pFastBac HTa HCV E1-TBD, which are used to express HCV envelope protein E1 and the respective chimeric antigen E1-TBD fusion protein, were generated as follows. The DNA encoding the E1 protein was generated from the plasmid pCV-H77C template using PCR technique. The 5' primer used for the PCR was (sense) 5' CCGGAATTCTACCAAGTGCGCAATTCCT (SEQ ID NO: 22), which contains the restriction enzyme EcoRI site and the 3' primer used was (antisense) 5' GGACTAGTCCTTCCGCGTCGACGCCGGCAAAT (SEQ ID NO: 23), containing the restriction enzyme Spe I site. The PCR-amplified cDNA was digested with the respective enzymes and ligated with pFastBac HTa expression vector to generate the expression plasmid pFastBac HTa HCV E1 for the expression of HCV E1 protein. The digested DNA fragment was ligated with pFastBac HTa-TBD to generate the plasmid pFastBac HTa HCV E1-TBD, which was used to express HCV E1-TBD fusion protein.
[0331] FIG. 51 shows the nucleotide and the deduced amino acid sequences of 6×His-rTEVprotease site-HCV E1 in the open reading frame of the expression plasmid. FIG. 52 shows nucleotide and the deduced amino acid sequences of 6×His-rTEVprotease site-HCV E1-TBD chimeric antigen fusion protein.
Example 38
Construction of pFastBac HTa HCV E2 Antigen and pFastBac HTa HCV E2-TBD Fusion Protein Expression Vectors
[0332] The DNA encoding HCV E2 antigen was produced by PCR from a plasmid pCV-H77C. The 5' primer used for the PCR was (sense) 5' GCGGAATTCACCCACGTCACCGGGGGAAATGC (SEQ ID NO: 24) containing a unique restriction enzyme site EcoRI that is used for directional cloning. The 3' primer used was (antisense) 5' GGACTAGTCCAGCCGCCTCCGCTTGGGATATGAGT (SEQ ID NO: 25) containing the restriction enzyme Spe I site. Following PCR amplification, the fragment was digested with the restriction enzymes EcoRI and Spe I an the DNA fragment was purified and ligated with the expression plasmid pFastBac HTa at the respective sites to produce pFastBac HTa HCV E2, which expressed the E2 antigen. The same fragment was also used to ligate with pFastBac HTa-TBD to generate the expression plasmid pFastBac HTa HCV E2-TBD, which expressed the chimeric antigen fusion protein HCV E2-TBD. The production of baculovirus stocks from these plasmids and the expression of the E2 and E2-TBD in High Five® insect cells were done as described in previous examples.
[0333] FIG. 53 shows the nucleotide and the deduced amino acid sequences of 6×His-rTEVprotease site-HCV E2 in the open reading frame of the expression plasmid. FIG. 54 shows nucleotide and the deduced amino acid sequences of 6×His-rTEVprotease site-HCV E2-TBD chimeric antigen fusion protein.
[0334] DNA encoding HCV E1/E2 was produced by PCR methods from the plasmid pCV-H77C using 5' primer (sense) 5' CCGGAATTCTACCAAGTGCGCAATTCCT (SEQ ID NO: 26) containing the restriction enzyme site EcoRI and the 3' primer (antisense) 5' GGACTAGTCCAGCCGCCTCCGCTTGGGATATGAGT (SEQ ID NO: 27) containing the restriction enzyme site Spe I. Restriction enzyme-digested DNA fragment was cloned into the respective sites of either pFastBac HTa to generate pFastBac HTa HCV E1/E2 or pFastBac HTa-TBD to generate pFastBac HTa HCV E1/E2-TBD. All other protocols for the production of either the E1/E2 antigen or the fusion protein E1/E2-TBD are the same as described in the example above.
[0335] FIG. 55 shows the nucleotide and the deduced amino acid sequences of 6×His-rTEVprotease site-HCV E1/E2 in the open reading frame of the expression plasmid. FIG. 56 shows nucleotide and the deduced amino acid sequences of 6×His-rTEVprotease site-HCV E1/E2-TBD chimeric antigen fusion protein.
Conclusions from Examples 10-38
[0336] 1. A new class of Chimeric Antigens is designed in order to incorporate antigen and antibody components in the molecule. 2. Antigen components can be derived from infectious agents or cancer antigen. 3. Antibody components are xenotypic, preferably of murine origin, in the case of chimeric antigens for administration to humans. 4. Chimeric antigen fusion proteins, TBD and the respective antigens have been produced by recombinant techniques. 5. Chimeric antigen fusion proteins, TBD and the respective antigens have been produced (expressed) in a heterologous expression system (insect cells). 6. By virtue of the expression in insect cells, the proteins have mannose glycosylation content. 7. Chimeric antigens include fusion proteins from HBV surface antigens (S1/S2), and/or HBV Core and TBD, derived from the murine mAb 2C12. 8. Chimeric antigens include fusion proteins of DHBV surface antigens PreS/S, Core and TBD. 9. The following antigens from HCV have been cloned and expressed in insect cell expression systems. HCV Core (1-191), HCV Core (1-177), HCV NS3, HCV NS5A, HCV E1, HCV E2, HCV E1/E2. 10. Chimeric antigen fusion proteins of HCV include HCV Core (1-191), HCV Core (1-177), HCV NS3, HCV NS5A, HCV E1, HCV E2, HCV E1/E2 and TBD. 11. Chimeric antigen fusion protein HCV Core (1-191)-TBD and HCV Core (1-191) have been expressed and purified. 12. Chimeric antigen fusion protein HBV surface antigen S1/S2-TBD and HBV surface antigen S1/S2 have been expressed and purified. 13. The fusion proteins bind to and are internalized by antigen presenting cells (Human PBMC-derived DCs). 14. Binding and uptake is via Fey receptors CD32 and possibly through CD64. 15. Binding and uptake can occur via CD206, the mannose macrophage receptor. 16. Mannose glycosylation augments the binding and uptake of the antigens via CD206. 17. Chimeric antigen fusion protein HBV surface antigen S1/S2-TBD enhances the antigen presentation by professional antigen presenting cells (DCs). 18. DCs loaded with the Chimeric antigen fusion protein HBV surface antigen S1/S2-TBD, on presentation to T cells, elicit an immune response. 19. The immune response can be measured as an increase in intracellular and secreted interferon-γ.
Example 39
Maturation and Loading of Dendritic Cells
[0337] Peripheral blood mononuclear cells (PBMCs) were thawed by the addition of AIM-V (ratio of 9 ml of AIM-V added to 1 ml of frozen cells). The cells were then centrifuged at 200×g for 5 min, the supernatant removed, and the cells resuspended in AIM-V/1% matched serum and added to either a 100 mm culture dish or a T-25 culture flask. The PBMCs were incubated for 1 hr at 37° C. in a humidified incubator under 7% CO2. To remove non-adherent cells, the culture was triturated several times, the supernatant discarded, and the cells washed once with AIM-V medium. Monocytes were harvested with a cell scraper and centrifuged at 300×g for 5 min. The cell pellet was re-suspended in AIM-V/2.5% matched serum at 2×106 cells/ml and seeded into a 24-well dish. Th IL-4 and GM-CSF (1000 IU/ml each) were added to drive the differentiation of monocytes into immature DCs. Antigen was added to immature DCs within 4 to 24 hr of isolation. After a further 24 hr, antigen loaded immature monocytes were induced to mature by culturing with PGE2 (1 μM), IL-1b (10 ng/ml), and TNF-a (10 ng/ml) for 24 hr.
Example 40
Combination Therapy using DHBV Core-TBD and Lamivudine in Pekin Ducks
[0338] Normal ducklings were infected with DHBV-containing duck serum a day after the ducklings were hatched. This is standard practice in the field of DHBV research. The presence of persistent viremia was verified using established techniques at week four before the start of the immunizations. Congenitally DHBV-infected animals at four weeks of age also were used for the experiments reported herein.
[0339] Congenitally DHBV-infected and post-hatch infected ducks were divided into three groups. A sample of blood (1.0 mL) was collected for reference of pre-immunization antibody levels and blood samples were collected every week before the vaccinations. The first experimental group received DHBV Core-TBD chimeric antigen fusion protein 40 μg/dose injected intramuscularly every other week on the same day until week 22. The second experimental group received DHBV Core protein 19.9 μg/dose injected intramuscularly every other week on the same day until week 22. The third (control) group received buffer (20 mM Sodium Phosphate pH 8.0, 300 mM NaCl) injected intramuscularly every other week on the same day until week 22. In addition, each group also received 20 mg/kg lamivudine injected intramuscularly b.i.d. until week 12, at which point the lamivudine dose was increased to 40 mg/kg injected intramuscularly b.i.d.
[0340] No observable local reaction to the injections of the DHBV core-chimeric antigen vaccine. No other adverse reaction was noticed. Lamivudine alone (control) decreased serum viremia in both congenitally and post-hatch DHBV infected ducks.
[0341] In the control group of ducks, the viremia rebounded at an earlier time point compared to the vaccinated group, i.e., ducks receiving DHBV Core-TBD. Thus a trend towards increased viral suppression exists in response to vaccination with the chimerica antigen, although a complete elimination of the viremia was not seen in any of the experimental animals. A trend towards increased inflammatory response also was observed in the group receiving DHBV Core-TBD compared to the control group (lamibviudine alone). Such a trend indicates that the DHBV Core-chimeric antigen induces immune responses in the duck animal model.
[0342] In post-hatch DHBV-infected ducks, there was an elevation of serum anti-core antibody levels in core-chimeric antigen treated group compared to the control groups. This suggests a humoral response to the vaccination with the chimeric antigen in a chronic virus-infected animal model.
[0343] All publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the following claims.
Sequence CWU
1
1
79155DNAartificial sequenceprimer sequence 1tgtcattctg cggccgcaag
gcggcggatc cgtggacaag aaaattgtgc ccagg 55236DNAartificial
sequenceprimer sequence 2acgaatcaag ctttgcagcc caggagagtg ggagag
36321DNAartificial sequenceprimer sequence
3tattccggat tattcatacc g
21420DNAartificial sequenceprimer sequence 4ctctacaaat gtggtatggc
20520DNAartificial sequenceprimer
sequence 5ggatctgtac gacgatgacg
20639DNAartificial sequenceprimer sequence 6agtcattctg cggccgcgag
ttcgtcacag ggtccccgg 39734DNAartificial
sequenceprimer sequence 7gataaggatc ctatgggagg ttggtcatca aaac
34840DNAartificial sequenceprimer sequence
8gtcatactgc ggccgcgaaa tgtataccca gagacaaaag
40931DNAartificial sequenceprimer sequence 9tgcgctacca tggacattga
cccttataaa g 311042DNAartificial
sequenceprimer sequence 10tgtcattctg cggccgcgaa cattgagatt cccgagattg ag
421121DNAartificial sequenceprimer sequence
11tattccggat tattcatacc g
211240DNAartificial sequenceprimer sequence 12tgtcattctg cggccgcgtt
ttcttcttca aggggggagt 401340DNAartificial
sequenceprimer sequence 13tgtcattcag cggccgcgaa ctcttgtaaa aaagagcaga
401433DNAartificial sequenceprimer sequence
14tgcgctacca tggatatcaa tgcttctaga gcc
331543DNAartificial sequenceprimer sequence 15tgtcattctg cggccgcgat
ttcctaggcg agggagatct atg 431627DNAartificial
sequenceprimer sequence 16cggaattcat gagcacgaat cctaaac
271738DNAartificial sequenceprimer sequence
17ggactagtcc ggctgaagcg ggcacagtca ggcaagag
381827DNAartificial sequenceprimer sequence 18cggaattcat gagcacgaat
cctaaac 271927DNAartificial
sequenceprimer sequence 19ggactagtcc gaagatagag aaagagc
272027DNAartificial sequenceprimer sequence
20ccggaattct ccggttcctg gctaagg
272128DNAartificial sequenceprimer sequence 21ggactagtcc gcacacgaca
tcttccgt 282228DNAartificial
sequenceprimer sequence 22ccggaattct accaagtgcg caattcct
282332DNAartificial sequenceprimer sequence
23ggactagtcc ttccgcgtcg acgccggcaa at
322432DNAartificial sequenceprimer sequence 24gcggaattca cccacgtcac
cgggggaaat gc 322535DNAartificial
sequenceprimer sequence 25ggactagtcc agccgcctcc gcttgggata tgagt
352628DNAartificial sequenceHCV E2 antigen primer
26ccggaattct accaagtgcg caattcct
282735DNAArtificialHCV E1/E2 3' primer 27ggactagtcc agccgcctcc gcttgggata
tgagt 35288PRTArtificiallinker peptide
28Xaa Arg Pro Gln Gly Gly Gly Ser1 529870DNAMus
musculusCDS(1)..(870) 29atg tcg tac tac cat cac cat cac cat cac gat tac
gat atc cca acg 48Met Ser Tyr Tyr His His His His His His Asp Tyr
Asp Ile Pro Thr1 5 10
15acc gaa aac ctg tat ttt cag ggc gcc atg gat ccg gaa ttc aaa ggc
96Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu Phe Lys Gly
20 25 30cta cgt cga cga gct caa cta
gtg cgg ccg caa ggc ggc gga tcc gtg 144Leu Arg Arg Arg Ala Gln Leu
Val Arg Pro Gln Gly Gly Gly Ser Val 35 40
45gac aag aaa att gtg ccc agg gat tgt ggt tgt aag cct tgc ata
tgt 192Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile
Cys 50 55 60aca gtc cca gaa gta tca
tct gtc ttc atc ttc ccc cca aag ccc aag 240Thr Val Pro Glu Val Ser
Ser Val Phe Ile Phe Pro Pro Lys Pro Lys65 70
75 80gat gtg ctc acc att act ctg act cct aag gtc
acg tgt gtt gtg gta 288Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val
Thr Cys Val Val Val 85 90
95gac atc agc aag gat gat ccc gag gtc cag ttc agc tgg ttt gta gat
336Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp
100 105 110gat gtg gag gtg cac aca
gct cag acg caa ccc cgg gag gag cag ttc 384Asp Val Glu Val His Thr
Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe 115 120
125aac agc act ttc cgc tca gtc agt gaa ctt ccc atc atg cac
cag gac 432Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile Met His
Gln Asp 130 135 140tgg ctc aat ggc aag
gag ttc aaa tgc agg gtc aac agt gca gct ttc 480Trp Leu Asn Gly Lys
Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe145 150
155 160cct gcc ccc atc gag aaa acc atc tcc aaa
acc aaa ggc aga ccg aag 528Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys
Thr Lys Gly Arg Pro Lys 165 170
175gct cca cag gtg tac acc att cca cct ccc aag gag cag atg gcc aag
576Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys
180 185 190gat aaa gtc agt ctg acc
tgc atg ata aca gac ttc ttc cct gaa gac 624Asp Lys Val Ser Leu Thr
Cys Met Ile Thr Asp Phe Phe Pro Glu Asp 195 200
205att act gtg gag tgg cag tgg aat ggg cag cca gcg gag aac
tac aag 672Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn
Tyr Lys 210 215 220aac act cag ccc atc
atg gac aca gat ggc tct tac ttc gtc tac agc 720Asn Thr Gln Pro Ile
Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser225 230
235 240aag ctc aat gtg cag aag agc aac tgg gag
gca gga aat act ttc acc 768Lys Leu Asn Val Gln Lys Ser Asn Trp Glu
Ala Gly Asn Thr Phe Thr 245 250
255tgc tct gtg tta cat gag ggc ctg cac aac cac cat act gag aag agc
816Cys Ser Val Leu His Glu Gly Leu His Asn His His Thr Glu Lys Ser
260 265 270ctc tcc cac tct cct ggg
ctg caa agc ttg tcg aga agt act aga gga 864Leu Ser His Ser Pro Gly
Leu Gln Ser Leu Ser Arg Ser Thr Arg Gly 275 280
285tca taa
870Ser30289PRTMus musculus 30Met Ser Tyr Tyr His His His His
His His Asp Tyr Asp Ile Pro Thr1 5 10
15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu Phe
Lys Gly 20 25 30Leu Arg Arg
Arg Ala Gln Leu Val Arg Pro Gln Gly Gly Gly Ser Val 35
40 45Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys
Lys Pro Cys Ile Cys 50 55 60Thr Val
Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys65
70 75 80Asp Val Leu Thr Ile Thr Leu
Thr Pro Lys Val Thr Cys Val Val Val 85 90
95Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser Trp
Phe Val Asp 100 105 110Asp Val
Glu Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe 115
120 125Asn Ser Thr Phe Arg Ser Val Ser Glu Leu
Pro Ile Met His Gln Asp 130 135 140Trp
Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe145
150 155 160Pro Ala Pro Ile Glu Lys
Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys 165
170 175Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu
Gln Met Ala Lys 180 185 190Asp
Lys Val Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp 195
200 205Ile Thr Val Glu Trp Gln Trp Asn Gly
Gln Pro Ala Glu Asn Tyr Lys 210 215
220Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser225
230 235 240Lys Leu Asn Val
Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr 245
250 255Cys Ser Val Leu His Glu Gly Leu His Asn
His His Thr Glu Lys Ser 260 265
270Leu Ser His Ser Pro Gly Leu Gln Ser Leu Ser Arg Ser Thr Arg Gly
275 280 285Ser311359DNAArtificialHBV
plus TBD 31atg tcg tac tac cat cac cat cac cat cac gat tac gat atc cca
acg 48Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro
Thr1 5 10 15acc gaa aac
ctg tat ttt cag ggc gcc atg gat cct atg aaa aaa tgg 96Thr Glu Asn
Leu Tyr Phe Gln Gly Ala Met Asp Pro Met Lys Lys Trp 20
25 30tca tca aaa cct cgc aaa ggc atg ggg acg
aat ctt tct gtt ccc aac 144Ser Ser Lys Pro Arg Lys Gly Met Gly Thr
Asn Leu Ser Val Pro Asn 35 40
45cct ctg gga ttc ttt ccc gat cat cag ttg gac cct gta ttc gga gcc
192Pro Leu Gly Phe Phe Pro Asp His Gln Leu Asp Pro Val Phe Gly Ala 50
55 60aac tca aac aat cca gat tgg gac ttc
aac ccc atc aag gac cac tgg 240Asn Ser Asn Asn Pro Asp Trp Asp Phe
Asn Pro Ile Lys Asp His Trp65 70 75
80cca gca gcc aac cag gta gga gtg gga gca ttc ggg cca ggg
ttc acc 288Pro Ala Ala Asn Gln Val Gly Val Gly Ala Phe Gly Pro Gly
Phe Thr 85 90 95cct cca
cac ggc ggt gtt ttg ggg tgg agc cct cag gct cag ggc atg 336Pro Pro
His Gly Gly Val Leu Gly Trp Ser Pro Gln Ala Gln Gly Met 100
105 110ttg acc cca gtg tca aca att cct cct
cct gcc tcc gcc aat cgg cag 384Leu Thr Pro Val Ser Thr Ile Pro Pro
Pro Ala Ser Ala Asn Arg Gln 115 120
125tca gga agg cag cct act ccc atc tct cca cct cta aga gac agt cat
432Ser Gly Arg Gln Pro Thr Pro Ile Ser Pro Pro Leu Arg Asp Ser His 130
135 140cct cag gcc atg cag tgg aat tcc
act gcc ttc cac caa gct ctg caa 480Pro Gln Ala Met Gln Trp Asn Ser
Thr Ala Phe His Gln Ala Leu Gln145 150
155 160gac ccc aga gtc agg ggt ctg tat ttt cct gct ggt
ggc tcc agt tca 528Asp Pro Arg Val Arg Gly Leu Tyr Phe Pro Ala Gly
Gly Ser Ser Ser 165 170
175gga aca gta aac cct gct ccg aat att gcc tct cac atc tcg tca atc
576Gly Thr Val Asn Pro Ala Pro Asn Ile Ala Ser His Ile Ser Ser Ile
180 185 190tcc gcg agg acc ggg gac
cct gtg acg aac tcg cgg ccg caa ggc ggc 624Ser Ala Arg Thr Gly Asp
Pro Val Thr Asn Ser Arg Pro Gln Gly Gly 195 200
205gga tcc gtg gac aag aaa att gtg ccc agg gat tgt ggt tgt
aag cct 672Gly Ser Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys
Lys Pro 210 215 220tgc ata tgt aca gtc
cca gaa gta tca tct gtc ttc atc ttc ccc cca 720Cys Ile Cys Thr Val
Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro225 230
235 240aag ccc aag gat gtg ctc acc att act ctg
act cct aag gtc acg tgt 768Lys Pro Lys Asp Val Leu Thr Ile Thr Leu
Thr Pro Lys Val Thr Cys 245 250
255gtt gtg gta gac atc agc aag gat gat ccc gag gtc cag ttc agc tgg
816Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser Trp
260 265 270ttt gta gat gat gtg gag
gtg cac aca gct cag acg caa ccc cgg gag 864Phe Val Asp Asp Val Glu
Val His Thr Ala Gln Thr Gln Pro Arg Glu 275 280
285gag cag ttc aac agc act ttc cgc tca gtc agt gaa ctt ccc
atc atg 912Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro
Ile Met 290 295 300cac cag gac tgg ctc
aat ggc aag gag ttc aaa tgc agg gtc aac agt 960His Gln Asp Trp Leu
Asn Gly Lys Glu Phe Lys Cys Arg Val Asn Ser305 310
315 320gca gct ttc cct gcc ccc atc gag aaa acc
atc tcc aaa acc aaa ggc 1008Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr
Ile Ser Lys Thr Lys Gly 325 330
335aga ccg aag gct cca cag gtg tac acc att cca cct ccc aag gag cag
1056Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln
340 345 350atg gcc aag gat aaa gtc
agt ctg acc tgc atg ata aca gac ttc ttc 1104Met Ala Lys Asp Lys Val
Ser Leu Thr Cys Met Ile Thr Asp Phe Phe 355 360
365cct gaa gac att act gtg gag tgg cag tgg aat ggg cag cca
gcg gag 1152Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro
Ala Glu 370 375 380aac tac aag aac act
cag ccc atc atg gac aca gat ggc tct tac ttc 1200Asn Tyr Lys Asn Thr
Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe385 390
395 400gtc tac agc aag ctc aat gtg cag aag agc
aac tgg gag gca gga aat 1248Val Tyr Ser Lys Leu Asn Val Gln Lys Ser
Asn Trp Glu Ala Gly Asn 405 410
415act ttc acc tgc tct gtg tta cat gag ggc ctg cac aac cac cat act
1296Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His Asn His His Thr
420 425 430gag aag agc ctc tcc cac
tct cct ggg ctg caa agc ttg tcg aga agt 1344Glu Lys Ser Leu Ser His
Ser Pro Gly Leu Gln Ser Leu Ser Arg Ser 435 440
445act aga gga tca taa
1359Thr Arg Gly Ser 45032452PRTArtificialSynthetic Construct
32Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro Thr1
5 10 15Thr Glu Asn Leu Tyr Phe
Gln Gly Ala Met Asp Pro Met Lys Lys Trp 20 25
30Ser Ser Lys Pro Arg Lys Gly Met Gly Thr Asn Leu Ser
Val Pro Asn 35 40 45Pro Leu Gly
Phe Phe Pro Asp His Gln Leu Asp Pro Val Phe Gly Ala 50
55 60Asn Ser Asn Asn Pro Asp Trp Asp Phe Asn Pro Ile
Lys Asp His Trp65 70 75
80Pro Ala Ala Asn Gln Val Gly Val Gly Ala Phe Gly Pro Gly Phe Thr
85 90 95Pro Pro His Gly Gly Val
Leu Gly Trp Ser Pro Gln Ala Gln Gly Met 100
105 110Leu Thr Pro Val Ser Thr Ile Pro Pro Pro Ala Ser
Ala Asn Arg Gln 115 120 125Ser Gly
Arg Gln Pro Thr Pro Ile Ser Pro Pro Leu Arg Asp Ser His 130
135 140Pro Gln Ala Met Gln Trp Asn Ser Thr Ala Phe
His Gln Ala Leu Gln145 150 155
160Asp Pro Arg Val Arg Gly Leu Tyr Phe Pro Ala Gly Gly Ser Ser Ser
165 170 175Gly Thr Val Asn
Pro Ala Pro Asn Ile Ala Ser His Ile Ser Ser Ile 180
185 190Ser Ala Arg Thr Gly Asp Pro Val Thr Asn Ser
Arg Pro Gln Gly Gly 195 200 205Gly
Ser Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys Lys Pro 210
215 220Cys Ile Cys Thr Val Pro Glu Val Ser Ser
Val Phe Ile Phe Pro Pro225 230 235
240Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr
Cys 245 250 255Val Val Val
Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser Trp 260
265 270Phe Val Asp Asp Val Glu Val His Thr Ala
Gln Thr Gln Pro Arg Glu 275 280
285Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile Met 290
295 300His Gln Asp Trp Leu Asn Gly Lys
Glu Phe Lys Cys Arg Val Asn Ser305 310
315 320Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser
Lys Thr Lys Gly 325 330
335Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln
340 345 350Met Ala Lys Asp Lys Val
Ser Leu Thr Cys Met Ile Thr Asp Phe Phe 355 360
365Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro
Ala Glu 370 375 380Asn Tyr Lys Asn Thr
Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe385 390
395 400Val Tyr Ser Lys Leu Asn Val Gln Lys Ser
Asn Trp Glu Ala Gly Asn 405 410
415Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His Asn His His Thr
420 425 430Glu Lys Ser Leu Ser
His Ser Pro Gly Leu Gln Ser Leu Ser Arg Ser 435
440 445Thr Arg Gly Ser 45033687DNAHepatitis B
virusCDS(1)..(687) 33atg tcg tac tac cat cac cat cac cat cac gat tac gat
atc cca acg 48Met Ser Tyr Tyr His His His His His His Asp Tyr Asp
Ile Pro Thr1 5 10 15acc
gaa aac ctg tat ttt cag ggc gcc atg gat cct atg aaa aaa tgg 96Thr
Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Met Lys Lys Trp 20
25 30tca tca aaa cct cgc aaa ggc atg
ggg acg aat ctt tct gtt ccc aac 144Ser Ser Lys Pro Arg Lys Gly Met
Gly Thr Asn Leu Ser Val Pro Asn 35 40
45cct ctg gga ttc ttt ccc gat cat cag ttg gac cct gta ttc gga gcc
192Pro Leu Gly Phe Phe Pro Asp His Gln Leu Asp Pro Val Phe Gly Ala
50 55 60aac tca aac aat cca gat tgg gac
ttc aac ccc atc aag gac cac tgg 240Asn Ser Asn Asn Pro Asp Trp Asp
Phe Asn Pro Ile Lys Asp His Trp65 70 75
80cca gca gcc aac cag gta gga gtg gga gca ttc ggg cca
ggg ttc acc 288Pro Ala Ala Asn Gln Val Gly Val Gly Ala Phe Gly Pro
Gly Phe Thr 85 90 95cct
cca cac ggc ggt gtt ttg ggg tgg agc cct cag gct cag ggc atg 336Pro
Pro His Gly Gly Val Leu Gly Trp Ser Pro Gln Ala Gln Gly Met
100 105 110ttg acc cca gtg tca aca att
cct cct cct gcc tcc gcc aat cgg cag 384Leu Thr Pro Val Ser Thr Ile
Pro Pro Pro Ala Ser Ala Asn Arg Gln 115 120
125tca gga agg cag cct act ccc atc tct cca cct cta aga gac agt
cat 432Ser Gly Arg Gln Pro Thr Pro Ile Ser Pro Pro Leu Arg Asp Ser
His 130 135 140cct cag gcc atg cag tgg
aat tcc act gcc ttc cac caa gct ctg caa 480Pro Gln Ala Met Gln Trp
Asn Ser Thr Ala Phe His Gln Ala Leu Gln145 150
155 160gac ccc aga gtc agg ggt ctg tat ttt cct gct
ggt ggc tcc agt tca 528Asp Pro Arg Val Arg Gly Leu Tyr Phe Pro Ala
Gly Gly Ser Ser Ser 165 170
175gga aca gta aac cct gct ccg aat att gcc tct cac atc tcg tca atc
576Gly Thr Val Asn Pro Ala Pro Asn Ile Ala Ser His Ile Ser Ser Ile
180 185 190tcc gcg agg acc ggg gac
cct gtg acg aac tcg cgg ccg ctt tcg aat 624Ser Ala Arg Thr Gly Asp
Pro Val Thr Asn Ser Arg Pro Leu Ser Asn 195 200
205cta gag cct gca gtc tcg agg cat gcg gta cca agc ttg tcg
aga agt 672Leu Glu Pro Ala Val Ser Arg His Ala Val Pro Ser Leu Ser
Arg Ser 210 215 220act aga gga tca taa
687Thr Arg Gly
Ser22534228PRTHepatitis B virus 34Met Ser Tyr Tyr His His His His His His
Asp Tyr Asp Ile Pro Thr1 5 10
15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Met Lys Lys Trp
20 25 30Ser Ser Lys Pro Arg Lys
Gly Met Gly Thr Asn Leu Ser Val Pro Asn 35 40
45Pro Leu Gly Phe Phe Pro Asp His Gln Leu Asp Pro Val Phe
Gly Ala 50 55 60Asn Ser Asn Asn Pro
Asp Trp Asp Phe Asn Pro Ile Lys Asp His Trp65 70
75 80Pro Ala Ala Asn Gln Val Gly Val Gly Ala
Phe Gly Pro Gly Phe Thr 85 90
95Pro Pro His Gly Gly Val Leu Gly Trp Ser Pro Gln Ala Gln Gly Met
100 105 110Leu Thr Pro Val Ser
Thr Ile Pro Pro Pro Ala Ser Ala Asn Arg Gln 115
120 125Ser Gly Arg Gln Pro Thr Pro Ile Ser Pro Pro Leu
Arg Asp Ser His 130 135 140Pro Gln Ala
Met Gln Trp Asn Ser Thr Ala Phe His Gln Ala Leu Gln145
150 155 160Asp Pro Arg Val Arg Gly Leu
Tyr Phe Pro Ala Gly Gly Ser Ser Ser 165
170 175Gly Thr Val Asn Pro Ala Pro Asn Ile Ala Ser His
Ile Ser Ser Ile 180 185 190Ser
Ala Arg Thr Gly Asp Pro Val Thr Asn Ser Arg Pro Leu Ser Asn 195
200 205Leu Glu Pro Ala Val Ser Arg His Ala
Val Pro Ser Leu Ser Arg Ser 210 215
220Thr Arg Gly Ser225352037DNAArtificialHepatitis B Virus plus murine
35atg tcg tac tac cat cac cat cac cat cac gat tac gat atc cca acg
48Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro Thr1
5 10 15acc gaa aac ctg tat ttt
cag ggc gcc atg gat cct atg gga ggt tgg 96Thr Glu Asn Leu Tyr Phe
Gln Gly Ala Met Asp Pro Met Gly Gly Trp 20 25
30tca tca aaa cct cgc aaa ggc atg ggg acg aat ctt tct
gtt ccc aac 144Ser Ser Lys Pro Arg Lys Gly Met Gly Thr Asn Leu Ser
Val Pro Asn 35 40 45cct ctg gga
ttc ttt ccc gat cat cag ttg gac cct gta ttc gga gcc 192Pro Leu Gly
Phe Phe Pro Asp His Gln Leu Asp Pro Val Phe Gly Ala 50
55 60aac tca aac aat cca gat tgg gac ttc aac ccc atc
aag gac cac tgg 240Asn Ser Asn Asn Pro Asp Trp Asp Phe Asn Pro Ile
Lys Asp His Trp65 70 75
80cca gca gcc aac cag gta gga gtg gga gca ttc ggg cca ggg ttc acc
288Pro Ala Ala Asn Gln Val Gly Val Gly Ala Phe Gly Pro Gly Phe Thr
85 90 95cct cca cac ggc ggt gtt
ttg ggg tgg agc cct cag gct cag ggc atg 336Pro Pro His Gly Gly Val
Leu Gly Trp Ser Pro Gln Ala Gln Gly Met 100
105 110ttg acc cca gtg tca aca att cct cct cct gcc tcc
gcc aat cgg cag 384Leu Thr Pro Val Ser Thr Ile Pro Pro Pro Ala Ser
Ala Asn Arg Gln 115 120 125tca gga
agg cag cct act ccc atc tct cca cct cta aga gac agt cat 432Ser Gly
Arg Gln Pro Thr Pro Ile Ser Pro Pro Leu Arg Asp Ser His 130
135 140cct cag gcc atg cag tgg aat tcc act gcc ttc
cac caa gct ctg caa 480Pro Gln Ala Met Gln Trp Asn Ser Thr Ala Phe
His Gln Ala Leu Gln145 150 155
160gac ccc aga gtc agg ggt ctg tat ttt cct gct ggt ggc tcc agt tca
528Asp Pro Arg Val Arg Gly Leu Tyr Phe Pro Ala Gly Gly Ser Ser Ser
165 170 175gga aca gta aac cct
gct ccg aat att gcc tct cac atc tcg tca atc 576Gly Thr Val Asn Pro
Ala Pro Asn Ile Ala Ser His Ile Ser Ser Ile 180
185 190tcc gcg agg act ggg gac cct gtg acg aac atg gag
aac atc aca tca 624Ser Ala Arg Thr Gly Asp Pro Val Thr Asn Met Glu
Asn Ile Thr Ser 195 200 205gga ttc
cta gga ccc ctg ctc gtg tta cag gcg ggg ttt ttc ttg ttg 672Gly Phe
Leu Gly Pro Leu Leu Val Leu Gln Ala Gly Phe Phe Leu Leu 210
215 220aca aga atc ctc aca ata ccg cag agt cta gac
tcg tgg tgg act tct 720Thr Arg Ile Leu Thr Ile Pro Gln Ser Leu Asp
Ser Trp Trp Thr Ser225 230 235
240ctc aat ttt cta ggg gga tca ccc gtg tgt ctt ggc caa aat tcg cag
768Leu Asn Phe Leu Gly Gly Ser Pro Val Cys Leu Gly Gln Asn Ser Gln
245 250 255tcc cca acc tcc aat
cac tca cca acc tcc tgt cct cca att tgt cct 816Ser Pro Thr Ser Asn
His Ser Pro Thr Ser Cys Pro Pro Ile Cys Pro 260
265 270ggt tat cgc tgg atg tgt ctg cgg cgt ttt atc ata
ttc ctc ttc atc 864Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe Ile Ile
Phe Leu Phe Ile 275 280 285ctg ctg
cta tgc ctc atc ttc tta ttg gtt ctt ctg gat tat caa ggt 912Leu Leu
Leu Cys Leu Ile Phe Leu Leu Val Leu Leu Asp Tyr Gln Gly 290
295 300atg ttg ccc gtt tgt cct cta att cca gga tca
aca aca acc agt acg 960Met Leu Pro Val Cys Pro Leu Ile Pro Gly Ser
Thr Thr Thr Ser Thr305 310 315
320gga cca tgc aaa acc tgc acg act cct gct caa ggc aac tct atg ttt
1008Gly Pro Cys Lys Thr Cys Thr Thr Pro Ala Gln Gly Asn Ser Met Phe
325 330 335ccc tca tgt tgc tgt
aca aaa cct acg gat gga aat tgc acc tgt att 1056Pro Ser Cys Cys Cys
Thr Lys Pro Thr Asp Gly Asn Cys Thr Cys Ile 340
345 350ccc atc cca tcg tct tgg gct ttc gca aaa tac cta
tgg gag tgg gcc 1104Pro Ile Pro Ser Ser Trp Ala Phe Ala Lys Tyr Leu
Trp Glu Trp Ala 355 360 365tca gtc
cgt ttc tct tgg ctc agt tta cta gtg cca ttt gtt cag tgg 1152Ser Val
Arg Phe Ser Trp Leu Ser Leu Leu Val Pro Phe Val Gln Trp 370
375 380ttc gta ggg ctt tcc ccc act gtt tgg ctt tca
gct ata tgg atg atg 1200Phe Val Gly Leu Ser Pro Thr Val Trp Leu Ser
Ala Ile Trp Met Met385 390 395
400tgg tat tgg ggg cca agt ctg tac agc atc gtg agt ccc ttt ata ccg
1248Trp Tyr Trp Gly Pro Ser Leu Tyr Ser Ile Val Ser Pro Phe Ile Pro
405 410 415ctg tta cca att ttc
ttt tgt ctc tgg gta tac att tcg cgg ccg caa 1296Leu Leu Pro Ile Phe
Phe Cys Leu Trp Val Tyr Ile Ser Arg Pro Gln 420
425 430ggc ggc gga tcc gtg gac aag aaa att gtg ccc agg
gat tgt ggt tgt 1344Gly Gly Gly Ser Val Asp Lys Lys Ile Val Pro Arg
Asp Cys Gly Cys 435 440 445aag cct
tgc ata tgt aca gtc cca gaa gta tca tct gtc ttc atc ttc 1392Lys Pro
Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe 450
455 460ccc cca aag ccc aag gat gtg ctc acc att act
ctg act cct aag gtc 1440Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr
Leu Thr Pro Lys Val465 470 475
480acg tgt gtt gtg gta gac atc agc aag gat gat ccc gag gtc cag ttc
1488Thr Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe
485 490 495agc tgg ttt gta gat
gat gtg gag gtg cac aca gct cag acg caa ccc 1536Ser Trp Phe Val Asp
Asp Val Glu Val His Thr Ala Gln Thr Gln Pro 500
505 510cgg gag gag cag ttc aac agc act ttc cgc tca gtc
agt gaa ctt ccc 1584Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val
Ser Glu Leu Pro 515 520 525atc atg
cac cag gac tgg ctc aat ggc aag gag ttc aaa tgc agg gtc 1632Ile Met
His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val 530
535 540aac agt gca gct ttc cct gcc ccc atc gag aaa
acc atc tcc aaa acc 1680Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys
Thr Ile Ser Lys Thr545 550 555
560aaa ggc aga ccg aag gct cca cag gtg tac acc att cca cct ccc aag
1728Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys
565 570 575gag cag atg gcc aag
gat aaa gtc agt ctg acc tgc atg ata aca gac 1776Glu Gln Met Ala Lys
Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asp 580
585 590ttc ttc cct gaa gac att act gtg gag tgg cag tgg
aat ggg cag cca 1824Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp
Asn Gly Gln Pro 595 600 605gcg gag
aac tac aag aac act cag ccc atc atg gac aca gat ggc tct 1872Ala Glu
Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser 610
615 620tac ttc gtc tac agc aag ctc aat gtg cag aag
agc aac tgg gag gca 1920Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys
Ser Asn Trp Glu Ala625 630 635
640gga aat act ttc acc tgc tct gtg tta cat gag ggc ctg cac aac cac
1968Gly Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His Asn His
645 650 655cat act gag aag agc
ctc tcc cac tct cct ggg ctg caa agc ttg tcg 2016His Thr Glu Lys Ser
Leu Ser His Ser Pro Gly Leu Gln Ser Leu Ser 660
665 670aga agt act aga gga tca taa
2037Arg Ser Thr Arg Gly Ser
67536678PRTArtificialSynthetic Construct 36Met Ser Tyr Tyr His His His
His His His Asp Tyr Asp Ile Pro Thr1 5 10
15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Met
Gly Gly Trp 20 25 30Ser Ser
Lys Pro Arg Lys Gly Met Gly Thr Asn Leu Ser Val Pro Asn 35
40 45Pro Leu Gly Phe Phe Pro Asp His Gln Leu
Asp Pro Val Phe Gly Ala 50 55 60Asn
Ser Asn Asn Pro Asp Trp Asp Phe Asn Pro Ile Lys Asp His Trp65
70 75 80Pro Ala Ala Asn Gln Val
Gly Val Gly Ala Phe Gly Pro Gly Phe Thr 85
90 95Pro Pro His Gly Gly Val Leu Gly Trp Ser Pro Gln
Ala Gln Gly Met 100 105 110Leu
Thr Pro Val Ser Thr Ile Pro Pro Pro Ala Ser Ala Asn Arg Gln 115
120 125Ser Gly Arg Gln Pro Thr Pro Ile Ser
Pro Pro Leu Arg Asp Ser His 130 135
140Pro Gln Ala Met Gln Trp Asn Ser Thr Ala Phe His Gln Ala Leu Gln145
150 155 160Asp Pro Arg Val
Arg Gly Leu Tyr Phe Pro Ala Gly Gly Ser Ser Ser 165
170 175Gly Thr Val Asn Pro Ala Pro Asn Ile Ala
Ser His Ile Ser Ser Ile 180 185
190Ser Ala Arg Thr Gly Asp Pro Val Thr Asn Met Glu Asn Ile Thr Ser
195 200 205Gly Phe Leu Gly Pro Leu Leu
Val Leu Gln Ala Gly Phe Phe Leu Leu 210 215
220Thr Arg Ile Leu Thr Ile Pro Gln Ser Leu Asp Ser Trp Trp Thr
Ser225 230 235 240Leu Asn
Phe Leu Gly Gly Ser Pro Val Cys Leu Gly Gln Asn Ser Gln
245 250 255Ser Pro Thr Ser Asn His Ser
Pro Thr Ser Cys Pro Pro Ile Cys Pro 260 265
270Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe Ile Ile Phe Leu
Phe Ile 275 280 285Leu Leu Leu Cys
Leu Ile Phe Leu Leu Val Leu Leu Asp Tyr Gln Gly 290
295 300Met Leu Pro Val Cys Pro Leu Ile Pro Gly Ser Thr
Thr Thr Ser Thr305 310 315
320Gly Pro Cys Lys Thr Cys Thr Thr Pro Ala Gln Gly Asn Ser Met Phe
325 330 335Pro Ser Cys Cys Cys
Thr Lys Pro Thr Asp Gly Asn Cys Thr Cys Ile 340
345 350Pro Ile Pro Ser Ser Trp Ala Phe Ala Lys Tyr Leu
Trp Glu Trp Ala 355 360 365Ser Val
Arg Phe Ser Trp Leu Ser Leu Leu Val Pro Phe Val Gln Trp 370
375 380Phe Val Gly Leu Ser Pro Thr Val Trp Leu Ser
Ala Ile Trp Met Met385 390 395
400Trp Tyr Trp Gly Pro Ser Leu Tyr Ser Ile Val Ser Pro Phe Ile Pro
405 410 415Leu Leu Pro Ile
Phe Phe Cys Leu Trp Val Tyr Ile Ser Arg Pro Gln 420
425 430Gly Gly Gly Ser Val Asp Lys Lys Ile Val Pro
Arg Asp Cys Gly Cys 435 440 445Lys
Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe 450
455 460Pro Pro Lys Pro Lys Asp Val Leu Thr Ile
Thr Leu Thr Pro Lys Val465 470 475
480Thr Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln
Phe 485 490 495Ser Trp Phe
Val Asp Asp Val Glu Val His Thr Ala Gln Thr Gln Pro 500
505 510Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg
Ser Val Ser Glu Leu Pro 515 520
525Ile Met His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val 530
535 540Asn Ser Ala Ala Phe Pro Ala Pro
Ile Glu Lys Thr Ile Ser Lys Thr545 550
555 560Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile
Pro Pro Pro Lys 565 570
575Glu Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asp
580 585 590Phe Phe Pro Glu Asp Ile
Thr Val Glu Trp Gln Trp Asn Gly Gln Pro 595 600
605Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp
Gly Ser 610 615 620Tyr Phe Val Tyr Ser
Lys Leu Asn Val Gln Lys Ser Asn Trp Glu Ala625 630
635 640Gly Asn Thr Phe Thr Cys Ser Val Leu His
Glu Gly Leu His Asn His 645 650
655His Thr Glu Lys Ser Leu Ser His Ser Pro Gly Leu Gln Ser Leu Ser
660 665 670Arg Ser Thr Arg Gly
Ser 675371365DNAHepatitis B virusCDS(1)..(1365) 37atg tcg tac tac
cat cac cat cac cat cac gat tac gat atc cca acg 48Met Ser Tyr Tyr
His His His His His His Asp Tyr Asp Ile Pro Thr1 5
10 15acc gaa aac ctg tat ttt cag ggc gcc atg
gat cct atg gga ggt tgg 96Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met
Asp Pro Met Gly Gly Trp 20 25
30tca tca aaa cct cgc aaa ggc atg ggg acg aat ctt tct gtt ccc aac
144Ser Ser Lys Pro Arg Lys Gly Met Gly Thr Asn Leu Ser Val Pro Asn
35 40 45cct ctg gga ttc ttt ccc gat cat
cag ttg gac cct gta ttc gga gcc 192Pro Leu Gly Phe Phe Pro Asp His
Gln Leu Asp Pro Val Phe Gly Ala 50 55
60aac tca aac aat cca gat tgg gac ttc aac ccc atc aag gac cac tgg
240Asn Ser Asn Asn Pro Asp Trp Asp Phe Asn Pro Ile Lys Asp His Trp65
70 75 80cca gca gcc aac cag
gta gga gtg gga gca ttc ggg cca ggg ttc acc 288Pro Ala Ala Asn Gln
Val Gly Val Gly Ala Phe Gly Pro Gly Phe Thr 85
90 95cct cca cac ggc ggt gtt ttg ggg tgg agc cct
cag gct cag ggc atg 336Pro Pro His Gly Gly Val Leu Gly Trp Ser Pro
Gln Ala Gln Gly Met 100 105
110ttg acc cca gtg tca aca att cct cct cct gcc tcc gcc aat cgg cag
384Leu Thr Pro Val Ser Thr Ile Pro Pro Pro Ala Ser Ala Asn Arg Gln
115 120 125tca gga agg cag cct act ccc
atc tct cca cct cta aga gac agt cat 432Ser Gly Arg Gln Pro Thr Pro
Ile Ser Pro Pro Leu Arg Asp Ser His 130 135
140cct cag gcc atg cag tgg aat tcc act gcc ttc cac caa gct ctg caa
480Pro Gln Ala Met Gln Trp Asn Ser Thr Ala Phe His Gln Ala Leu Gln145
150 155 160gac ccc aga gtc
agg ggt ctg tat ttt cct gct ggt ggc tcc agt tca 528Asp Pro Arg Val
Arg Gly Leu Tyr Phe Pro Ala Gly Gly Ser Ser Ser 165
170 175gga aca gta aac cct gct ccg aat att gcc
tct cac atc tcg tca atc 576Gly Thr Val Asn Pro Ala Pro Asn Ile Ala
Ser His Ile Ser Ser Ile 180 185
190tcc gcg agg act ggg gac cct gtg acg aac atg gag aac atc aca tca
624Ser Ala Arg Thr Gly Asp Pro Val Thr Asn Met Glu Asn Ile Thr Ser
195 200 205gga ttc cta gga ccc ctg ctc
gtg tta cag gcg ggg ttt ttc ttg ttg 672Gly Phe Leu Gly Pro Leu Leu
Val Leu Gln Ala Gly Phe Phe Leu Leu 210 215
220aca aga atc ctc aca ata ccg cag agt cta gac tcg tgg tgg act tct
720Thr Arg Ile Leu Thr Ile Pro Gln Ser Leu Asp Ser Trp Trp Thr Ser225
230 235 240ctc aat ttt cta
ggg gga tca ccc gtg tgt ctt ggc caa aat tcg cag 768Leu Asn Phe Leu
Gly Gly Ser Pro Val Cys Leu Gly Gln Asn Ser Gln 245
250 255tcc cca acc tcc aat cac tca cca acc tcc
tgt cct cca att tgt cct 816Ser Pro Thr Ser Asn His Ser Pro Thr Ser
Cys Pro Pro Ile Cys Pro 260 265
270ggt tat cgc tgg atg tgt ctg cgg cgt ttt atc ata ttc ctc ttc atc
864Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe Ile Ile Phe Leu Phe Ile
275 280 285ctg ctg cta tgc ctc atc ttc
tta ttg gtt ctt ctg gat tat caa ggt 912Leu Leu Leu Cys Leu Ile Phe
Leu Leu Val Leu Leu Asp Tyr Gln Gly 290 295
300atg ttg ccc gtt tgt cct cta att cca gga tca aca aca acc agt acg
960Met Leu Pro Val Cys Pro Leu Ile Pro Gly Ser Thr Thr Thr Ser Thr305
310 315 320gga cca tgc aaa
acc tgc acg act cct gct caa ggc aac tct atg ttt 1008Gly Pro Cys Lys
Thr Cys Thr Thr Pro Ala Gln Gly Asn Ser Met Phe 325
330 335ccc tca tgt tgc tgt aca aaa cct acg gat
gga aat tgc acc tgt att 1056Pro Ser Cys Cys Cys Thr Lys Pro Thr Asp
Gly Asn Cys Thr Cys Ile 340 345
350ccc atc cca tcg tct tgg gct ttc gca aaa tac cta tgg gag tgg gcc
1104Pro Ile Pro Ser Ser Trp Ala Phe Ala Lys Tyr Leu Trp Glu Trp Ala
355 360 365tca gtc cgt ttc tct tgg ctc
agt tta cta gtg cca ttt gtt cag tgg 1152Ser Val Arg Phe Ser Trp Leu
Ser Leu Leu Val Pro Phe Val Gln Trp 370 375
380ttc gta ggg ctt tcc ccc act gtt tgg ctt tca gct ata tgg atg atg
1200Phe Val Gly Leu Ser Pro Thr Val Trp Leu Ser Ala Ile Trp Met Met385
390 395 400tgg tat tgg ggg
cca agt ctg tac agc atc gtg agt ccc ttt ata ccg 1248Trp Tyr Trp Gly
Pro Ser Leu Tyr Ser Ile Val Ser Pro Phe Ile Pro 405
410 415ctg tta cca att ttc ttt tgt ctc tgg gta
tac att tcg cgg ccg ctt 1296Leu Leu Pro Ile Phe Phe Cys Leu Trp Val
Tyr Ile Ser Arg Pro Leu 420 425
430tcg aat cta gag cct gca gtc tcg agg cat gcg gta cca agc ttg tcg
1344Ser Asn Leu Glu Pro Ala Val Ser Arg His Ala Val Pro Ser Leu Ser
435 440 445aga agt act aga gga tca taa
1365Arg Ser Thr Arg Gly Ser
45038454PRTHepatitis B virus 38Met Ser Tyr Tyr His His His His His His
Asp Tyr Asp Ile Pro Thr1 5 10
15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Met Gly Gly Trp
20 25 30Ser Ser Lys Pro Arg Lys
Gly Met Gly Thr Asn Leu Ser Val Pro Asn 35 40
45Pro Leu Gly Phe Phe Pro Asp His Gln Leu Asp Pro Val Phe
Gly Ala 50 55 60Asn Ser Asn Asn Pro
Asp Trp Asp Phe Asn Pro Ile Lys Asp His Trp65 70
75 80Pro Ala Ala Asn Gln Val Gly Val Gly Ala
Phe Gly Pro Gly Phe Thr 85 90
95Pro Pro His Gly Gly Val Leu Gly Trp Ser Pro Gln Ala Gln Gly Met
100 105 110Leu Thr Pro Val Ser
Thr Ile Pro Pro Pro Ala Ser Ala Asn Arg Gln 115
120 125Ser Gly Arg Gln Pro Thr Pro Ile Ser Pro Pro Leu
Arg Asp Ser His 130 135 140Pro Gln Ala
Met Gln Trp Asn Ser Thr Ala Phe His Gln Ala Leu Gln145
150 155 160Asp Pro Arg Val Arg Gly Leu
Tyr Phe Pro Ala Gly Gly Ser Ser Ser 165
170 175Gly Thr Val Asn Pro Ala Pro Asn Ile Ala Ser His
Ile Ser Ser Ile 180 185 190Ser
Ala Arg Thr Gly Asp Pro Val Thr Asn Met Glu Asn Ile Thr Ser 195
200 205Gly Phe Leu Gly Pro Leu Leu Val Leu
Gln Ala Gly Phe Phe Leu Leu 210 215
220Thr Arg Ile Leu Thr Ile Pro Gln Ser Leu Asp Ser Trp Trp Thr Ser225
230 235 240Leu Asn Phe Leu
Gly Gly Ser Pro Val Cys Leu Gly Gln Asn Ser Gln 245
250 255Ser Pro Thr Ser Asn His Ser Pro Thr Ser
Cys Pro Pro Ile Cys Pro 260 265
270Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe Ile Ile Phe Leu Phe Ile
275 280 285Leu Leu Leu Cys Leu Ile Phe
Leu Leu Val Leu Leu Asp Tyr Gln Gly 290 295
300Met Leu Pro Val Cys Pro Leu Ile Pro Gly Ser Thr Thr Thr Ser
Thr305 310 315 320Gly Pro
Cys Lys Thr Cys Thr Thr Pro Ala Gln Gly Asn Ser Met Phe
325 330 335Pro Ser Cys Cys Cys Thr Lys
Pro Thr Asp Gly Asn Cys Thr Cys Ile 340 345
350Pro Ile Pro Ser Ser Trp Ala Phe Ala Lys Tyr Leu Trp Glu
Trp Ala 355 360 365Ser Val Arg Phe
Ser Trp Leu Ser Leu Leu Val Pro Phe Val Gln Trp 370
375 380Phe Val Gly Leu Ser Pro Thr Val Trp Leu Ser Ala
Ile Trp Met Met385 390 395
400Trp Tyr Trp Gly Pro Ser Leu Tyr Ser Ile Val Ser Pro Phe Ile Pro
405 410 415Leu Leu Pro Ile Phe
Phe Cys Leu Trp Val Tyr Ile Ser Arg Pro Leu 420
425 430Ser Asn Leu Glu Pro Ala Val Ser Arg His Ala Val
Pro Ser Leu Ser 435 440 445Arg Ser
Thr Arg Gly Ser 450391383DNAArtificialHepatitis B virus plus murine
39atg tcg tac tac cat cac cat cac cat cac gat tac gat atc cca acg
48Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro Thr1
5 10 15acc gaa aac ctg tat ttt
cag ggc gcc atg gac att gac cct tat aaa 96Thr Glu Asn Leu Tyr Phe
Gln Gly Ala Met Asp Ile Asp Pro Tyr Lys 20 25
30gaa ttt gga gct act gtg gag tta ctc tcg ttt ttg cct
tct gac ttc 144Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro
Ser Asp Phe 35 40 45ttt cct tcc
gtc aga gat ctc cta gac acc gcc tcg gct ctg tat cgg 192Phe Pro Ser
Val Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg 50
55 60gaa gcc tta gag tct cct gag cat tgc tca cct cac
cat acc gca ctc 240Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His
His Thr Ala Leu65 70 75
80agg caa gcc att ctc tgc tgg ggg gaa ttg atg act cta gct acc tgg
288Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp
85 90 95gtg ggt aat aat ttg gaa
gat cca gca tcc agg gat cta gta gtc aat 336Val Gly Asn Asn Leu Glu
Asp Pro Ala Ser Arg Asp Leu Val Val Asn 100
105 110tat gtt aat act aac atg gga tta aag atc agg caa
ctc ttg tgg ttt 384Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln
Leu Leu Trp Phe 115 120 125cat atc
tct tgc ctt act ttt gga aga gaa act gta ctt gaa tat ttg 432His Ile
Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu 130
135 140gtc tct ttc gga gtg tgg att cgc act cct cca
gcc tat aga cca cca 480Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro
Ala Tyr Arg Pro Pro145 150 155
160aat gcc cct atc tta tca aca ctt ccg gaa act act gtt gtt aga cga
528Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr Val Val Arg Arg
165 170 175cgg gac cga ggc agg
tcc cct aga aga aga act ccc tcg cct cgc aga 576Arg Asp Arg Gly Arg
Ser Pro Arg Arg Arg Thr Pro Ser Pro Arg Arg 180
185 190cgc aga tct caa tcg ccg cgt cgc aga aga tct caa
tct cgg gaa tct 624Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln
Ser Arg Glu Ser 195 200 205caa tgt
tcg cgg ccg caa ggc ggc gga tcc gtg gac aag aaa att gtg 672Gln Cys
Ser Arg Pro Gln Gly Gly Gly Ser Val Asp Lys Lys Ile Val 210
215 220ccc agg gat tgt ggt tgt aag cct tgc ata tgt
aca gtc cca gaa gta 720Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys
Thr Val Pro Glu Val225 230 235
240tca tct gtc ttc atc ttc ccc cca aag ccc aag gat gtg ctc acc att
768Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile
245 250 255act ctg act cct aag
gtc acg tgt gtt gtg gta gac atc agc aag gat 816Thr Leu Thr Pro Lys
Val Thr Cys Val Val Val Asp Ile Ser Lys Asp 260
265 270gat ccc gag gtc cag ttc agc tgg ttt gta gat gat
gtg gag gtg cac 864Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp
Val Glu Val His 275 280 285aca gct
cag acg caa ccc cgg gag gag cag ttc aac agc act ttc cgc 912Thr Ala
Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg 290
295 300tca gtc agt gaa ctt ccc atc atg cac cag gac
tgg ctc aat ggc aag 960Ser Val Ser Glu Leu Pro Ile Met His Gln Asp
Trp Leu Asn Gly Lys305 310 315
320gag ttc aaa tgc agg gtc aac agt gca gct ttc cct gcc ccc atc gag
1008Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu
325 330 335aaa acc atc tcc aaa
acc aaa ggc aga ccg aag gct cca cag gtg tac 1056Lys Thr Ile Ser Lys
Thr Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr 340
345 350acc att cca cct ccc aag gag cag atg gcc aag gat
aaa gtc agt ctg 1104Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp
Lys Val Ser Leu 355 360 365acc tgc
atg ata aca gac ttc ttc cct gaa gac att act gtg gag tgg 1152Thr Cys
Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp 370
375 380cag tgg aat ggg cag cca gcg gag aac tac aag
aac act cag ccc atc 1200Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys
Asn Thr Gln Pro Ile385 390 395
400atg gac aca gat ggc tct tac ttc gtc tac agc aag ctc aat gtg cag
1248Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln
405 410 415aag agc aac tgg gag
gca gga aat act ttc acc tgc tct gtg tta cat 1296Lys Ser Asn Trp Glu
Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His 420
425 430gag ggc ctg cac aac cac cat act gag aag agc ctc
tcc cac tct cct 1344Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu
Ser His Ser Pro 435 440 445ggg ctg
caa agc ttg tcg aga agt act aga gga tca taa 1383Gly Leu
Gln Ser Leu Ser Arg Ser Thr Arg Gly Ser 450 455
46040460PRTArtificialSynthetic Construct 40Met Ser Tyr Tyr His
His His His His His Asp Tyr Asp Ile Pro Thr1 5
10 15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp
Ile Asp Pro Tyr Lys 20 25
30Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe
35 40 45Phe Pro Ser Val Arg Asp Leu Leu
Asp Thr Ala Ser Ala Leu Tyr Arg 50 55
60Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr Ala Leu65
70 75 80Arg Gln Ala Ile Leu
Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp 85
90 95Val Gly Asn Asn Leu Glu Asp Pro Ala Ser Arg
Asp Leu Val Val Asn 100 105
110Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe
115 120 125His Ile Ser Cys Leu Thr Phe
Gly Arg Glu Thr Val Leu Glu Tyr Leu 130 135
140Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro
Pro145 150 155 160Asn Ala
Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr Val Val Arg Arg
165 170 175Arg Asp Arg Gly Arg Ser Pro
Arg Arg Arg Thr Pro Ser Pro Arg Arg 180 185
190Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg
Glu Ser 195 200 205Gln Cys Ser Arg
Pro Gln Gly Gly Gly Ser Val Asp Lys Lys Ile Val 210
215 220Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr
Val Pro Glu Val225 230 235
240Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile
245 250 255Thr Leu Thr Pro Lys
Val Thr Cys Val Val Val Asp Ile Ser Lys Asp 260
265 270Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp
Val Glu Val His 275 280 285Thr Ala
Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg 290
295 300Ser Val Ser Glu Leu Pro Ile Met His Gln Asp
Trp Leu Asn Gly Lys305 310 315
320Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu
325 330 335Lys Thr Ile Ser
Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr 340
345 350Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys
Asp Lys Val Ser Leu 355 360 365Thr
Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp 370
375 380Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr
Lys Asn Thr Gln Pro Ile385 390 395
400Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val
Gln 405 410 415Lys Ser Asn
Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His 420
425 430Glu Gly Leu His Asn His His Thr Glu Lys
Ser Leu Ser His Ser Pro 435 440
445Gly Leu Gln Ser Leu Ser Arg Ser Thr Arg Gly Ser 450
455 46041711DNAHepatitis B virusCDS(1)..(711) 41atg tcg
tac tac cat cac cat cac cat cac gat tac gat atc cca acg 48Met Ser
Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro Thr1 5
10 15acc gaa aac ctg tat ttt cag ggc
gcc atg gac att gac cct tat aaa 96Thr Glu Asn Leu Tyr Phe Gln Gly
Ala Met Asp Ile Asp Pro Tyr Lys 20 25
30gaa ttt gga gct act gtg gag tta ctc tcg ttt ttg cct tct gac
ttc 144Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp
Phe 35 40 45ttt cct tcc gtc aga
gat ctc cta gac acc gcc tcg gct ctg tat cgg 192Phe Pro Ser Val Arg
Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg 50 55
60gaa gcc tta gag tct cct gag cat tgc tca cct cac cat acc
gca ctc 240Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr
Ala Leu65 70 75 80agg
caa gcc att ctc tgc tgg ggg gaa ttg atg act cta gct acc tgg 288Arg
Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp
85 90 95gtg ggt aat aat ttg gaa gat
cca gca tcc agg gat cta gta gtc aat 336Val Gly Asn Asn Leu Glu Asp
Pro Ala Ser Arg Asp Leu Val Val Asn 100 105
110tat gtt aat act aac atg gga tta aag atc agg caa ctc ttg
tgg ttt 384Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu
Trp Phe 115 120 125cat atc tct tgc
ctt act ttt gga aga gaa act gta ctt gaa tat ttg 432His Ile Ser Cys
Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu 130
135 140gtc tct ttc gga gtg tgg att cgc act cct cca gcc
tat aga cca cca 480Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala
Tyr Arg Pro Pro145 150 155
160aat gcc cct atc tta tca aca ctt ccg gaa act act gtt gtt aga cga
528Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr Val Val Arg Arg
165 170 175cgg gac cga ggc agg
tcc cct aga aga aga act ccc tcg cct cgc aga 576Arg Asp Arg Gly Arg
Ser Pro Arg Arg Arg Thr Pro Ser Pro Arg Arg 180
185 190cgc aga tct caa tcg ccg cgt cgc aga aga tct caa
tct cgg gaa tct 624Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln
Ser Arg Glu Ser 195 200 205caa tgt
tcg cgg ccg ctt tcg aat cta gag cct gca gtc tcg agg cat 672Gln Cys
Ser Arg Pro Leu Ser Asn Leu Glu Pro Ala Val Ser Arg His 210
215 220gcg gta cca agc ttg tcg aga agt act aga gga
tca taa 711Ala Val Pro Ser Leu Ser Arg Ser Thr Arg Gly
Ser225 230 23542236PRTHepatitis B virus
42Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro Thr1
5 10 15Thr Glu Asn Leu Tyr Phe
Gln Gly Ala Met Asp Ile Asp Pro Tyr Lys 20 25
30Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro
Ser Asp Phe 35 40 45Phe Pro Ser
Val Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg 50
55 60Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His
His Thr Ala Leu65 70 75
80Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp
85 90 95Val Gly Asn Asn Leu Glu
Asp Pro Ala Ser Arg Asp Leu Val Val Asn 100
105 110Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln
Leu Leu Trp Phe 115 120 125His Ile
Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu 130
135 140Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro
Ala Tyr Arg Pro Pro145 150 155
160Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr Val Val Arg Arg
165 170 175Arg Asp Arg Gly
Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro Arg Arg 180
185 190Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser
Gln Ser Arg Glu Ser 195 200 205Gln
Cys Ser Arg Pro Leu Ser Asn Leu Glu Pro Ala Val Ser Arg His 210
215 220Ala Val Pro Ser Leu Ser Arg Ser Thr Arg
Gly Ser225 230 235431326DNAArtificialDuck
hepatitis B virus plus murine 43atg tcg tac tac cat cac cat cac cat cac
gat tac gat atc cca acg 48Met Ser Tyr Tyr His His His His His His
Asp Tyr Asp Ile Pro Thr1 5 10
15acc gaa aac ctg tat ttt cag ggc gcc atg gat ccg gaa ttc atg ggg
96Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu Phe Met Gly
20 25 30caa cat cca gca aaa tca
atg gac gtc aga cgg ata gaa gga gga gaa 144Gln His Pro Ala Lys Ser
Met Asp Val Arg Arg Ile Glu Gly Gly Glu 35 40
45ata ctg tta aac caa ctt gcc gga agg atg atc cca aaa ggg
act ttg 192Ile Leu Leu Asn Gln Leu Ala Gly Arg Met Ile Pro Lys Gly
Thr Leu 50 55 60aca tgg tca ggc aag
ttt cca aca cta gat cac gtg tta gac cat gtg 240Thr Trp Ser Gly Lys
Phe Pro Thr Leu Asp His Val Leu Asp His Val65 70
75 80caa aca atg gag gag ata aac acc ctc cag
aat cag gga gct tgg cct 288Gln Thr Met Glu Glu Ile Asn Thr Leu Gln
Asn Gln Gly Ala Trp Pro 85 90
95gct ggg gcg gga agg aga gta gga tta tca aat ccg act cct caa gag
336Ala Gly Ala Gly Arg Arg Val Gly Leu Ser Asn Pro Thr Pro Gln Glu
100 105 110att cct cag ccc cag tgg
act ccc gag gaa gac caa aaa gca cgc gaa 384Ile Pro Gln Pro Gln Trp
Thr Pro Glu Glu Asp Gln Lys Ala Arg Glu 115 120
125gct ttt cgc cgt tat caa gaa gaa aga cca ccg gaa acc acc
acc att 432Ala Phe Arg Arg Tyr Gln Glu Glu Arg Pro Pro Glu Thr Thr
Thr Ile 130 135 140cct ccg tct tcc cct
cct cag tgg aag cta caa ccc ggg gac gat cca 480Pro Pro Ser Ser Pro
Pro Gln Trp Lys Leu Gln Pro Gly Asp Asp Pro145 150
155 160ctc ctg gga aat cag tct ctc ctc gag act
cat ccg cta tac cag tca 528Leu Leu Gly Asn Gln Ser Leu Leu Glu Thr
His Pro Leu Tyr Gln Ser 165 170
175gaa cca gcg gtg cca gtg ata aaa act ccc ccc ttg aag aag aaa acg
576Glu Pro Ala Val Pro Val Ile Lys Thr Pro Pro Leu Lys Lys Lys Thr
180 185 190cgg ccg caa ggc ggc gga
tcc gtg gac aag aaa att gtg ccc agg gat 624Arg Pro Gln Gly Gly Gly
Ser Val Asp Lys Lys Ile Val Pro Arg Asp 195 200
205tgt ggt tgt aag cct tgc ata tgt aca gtc cca gaa gta tca
tct gtc 672Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val Ser
Ser Val 210 215 220ttc atc ttc ccc cca
aag ccc aag gat gtg ctc acc att act ctg act 720Phe Ile Phe Pro Pro
Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr225 230
235 240cct aag gtc acg tgt gtt gtg gta gac atc
agc aag gat gat ccc gag 768Pro Lys Val Thr Cys Val Val Val Asp Ile
Ser Lys Asp Asp Pro Glu 245 250
255gtc cag ttc agc tgg ttt gta gat gat gtg gag gtg cac aca gct cag
816Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His Thr Ala Gln
260 265 270acg caa ccc cgg gag gag
cag ttc aac agc act ttc cgc tca gtc agt 864Thr Gln Pro Arg Glu Glu
Gln Phe Asn Ser Thr Phe Arg Ser Val Ser 275 280
285gaa ctt ccc atc atg cac cag gac tgg ctc aat ggc aag gag
ttc aaa 912Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly Lys Glu
Phe Lys 290 295 300tgc agg gtc aac agt
gca gct ttc cct gcc ccc atc gag aaa acc atc 960Cys Arg Val Asn Ser
Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile305 310
315 320tcc aaa acc aaa ggc aga ccg aag gct cca
cag gtg tac acc att cca 1008Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro
Gln Val Tyr Thr Ile Pro 325 330
335cct ccc aag gag cag atg gcc aag gat aaa gtc agt ctg acc tgc atg
1056Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys Met
340 345 350ata aca gac ttc ttc cct
gaa gac att act gtg gag tgg cag tgg aat 1104Ile Thr Asp Phe Phe Pro
Glu Asp Ile Thr Val Glu Trp Gln Trp Asn 355 360
365ggg cag cca gcg gag aac tac aag aac act cag ccc atc atg
gac aca 1152Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met
Asp Thr 370 375 380gat ggc tct tac ttc
gtc tac agc aag ctc aat gtg cag aag agc aac 1200Asp Gly Ser Tyr Phe
Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn385 390
395 400tgg gag gca gga aat act ttc acc tgc tct
gtg tta cat gag ggc ctg 1248Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser
Val Leu His Glu Gly Leu 405 410
415cac aac cac cat act gag aag agc ctc tcc cac tct cct ggg ctg caa
1296His Asn His His Thr Glu Lys Ser Leu Ser His Ser Pro Gly Leu Gln
420 425 430agc ttg tcg aga agt act
aga gga tca taa 1326Ser Leu Ser Arg Ser Thr
Arg Gly Ser 435 44044441PRTArtificialSynthetic
Construct 44Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro
Thr1 5 10 15Thr Glu Asn
Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu Phe Met Gly 20
25 30Gln His Pro Ala Lys Ser Met Asp Val Arg
Arg Ile Glu Gly Gly Glu 35 40
45Ile Leu Leu Asn Gln Leu Ala Gly Arg Met Ile Pro Lys Gly Thr Leu 50
55 60Thr Trp Ser Gly Lys Phe Pro Thr Leu
Asp His Val Leu Asp His Val65 70 75
80Gln Thr Met Glu Glu Ile Asn Thr Leu Gln Asn Gln Gly Ala
Trp Pro 85 90 95Ala Gly
Ala Gly Arg Arg Val Gly Leu Ser Asn Pro Thr Pro Gln Glu 100
105 110Ile Pro Gln Pro Gln Trp Thr Pro Glu
Glu Asp Gln Lys Ala Arg Glu 115 120
125Ala Phe Arg Arg Tyr Gln Glu Glu Arg Pro Pro Glu Thr Thr Thr Ile
130 135 140Pro Pro Ser Ser Pro Pro Gln
Trp Lys Leu Gln Pro Gly Asp Asp Pro145 150
155 160Leu Leu Gly Asn Gln Ser Leu Leu Glu Thr His Pro
Leu Tyr Gln Ser 165 170
175Glu Pro Ala Val Pro Val Ile Lys Thr Pro Pro Leu Lys Lys Lys Thr
180 185 190Arg Pro Gln Gly Gly Gly
Ser Val Asp Lys Lys Ile Val Pro Arg Asp 195 200
205Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val Ser
Ser Val 210 215 220Phe Ile Phe Pro Pro
Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr225 230
235 240Pro Lys Val Thr Cys Val Val Val Asp Ile
Ser Lys Asp Asp Pro Glu 245 250
255Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His Thr Ala Gln
260 265 270Thr Gln Pro Arg Glu
Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser 275
280 285Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly
Lys Glu Phe Lys 290 295 300Cys Arg Val
Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile305
310 315 320Ser Lys Thr Lys Gly Arg Pro
Lys Ala Pro Gln Val Tyr Thr Ile Pro 325
330 335Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser
Leu Thr Cys Met 340 345 350Ile
Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn 355
360 365Gly Gln Pro Ala Glu Asn Tyr Lys Asn
Thr Gln Pro Ile Met Asp Thr 370 375
380Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn385
390 395 400Trp Glu Ala Gly
Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu 405
410 415His Asn His His Thr Glu Lys Ser Leu Ser
His Ser Pro Gly Leu Gln 420 425
430Ser Leu Ser Arg Ser Thr Arg Gly Ser 435
44045654DNADuck hepatitis B virusCDS(1)..(654) 45atg tcg tac tac cat cac
cat cac cat cac gat tac gat atc cca acg 48Met Ser Tyr Tyr His His
His His His His Asp Tyr Asp Ile Pro Thr1 5
10 15acc gaa aac ctg tat ttt cag ggc gcc atg gat ccg
gaa ttc atg ggg 96Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro
Glu Phe Met Gly 20 25 30caa
cat cca gca aaa tca atg gac gtc aga cgg ata gaa gga gga gaa 144Gln
His Pro Ala Lys Ser Met Asp Val Arg Arg Ile Glu Gly Gly Glu 35
40 45ata ctg tta aac caa ctt gcc gga agg
atg atc cca aaa ggg act ttg 192Ile Leu Leu Asn Gln Leu Ala Gly Arg
Met Ile Pro Lys Gly Thr Leu 50 55
60aca tgg tca ggc aag ttt cca aca cta gat cac gtg tta gac cat gtg
240Thr Trp Ser Gly Lys Phe Pro Thr Leu Asp His Val Leu Asp His Val65
70 75 80caa aca atg gag gag
ata aac acc ctc cag aat cag gga gct tgg cct 288Gln Thr Met Glu Glu
Ile Asn Thr Leu Gln Asn Gln Gly Ala Trp Pro 85
90 95gct ggg gcg gga agg aga gta gga tta tca aat
ccg act cct caa gag 336Ala Gly Ala Gly Arg Arg Val Gly Leu Ser Asn
Pro Thr Pro Gln Glu 100 105
110att cct cag ccc cag tgg act ccc gag gaa gac caa aaa gca cgc gaa
384Ile Pro Gln Pro Gln Trp Thr Pro Glu Glu Asp Gln Lys Ala Arg Glu
115 120 125gct ttt cgc cgt tat caa gaa
gaa aga cca ccg gaa acc acc acc att 432Ala Phe Arg Arg Tyr Gln Glu
Glu Arg Pro Pro Glu Thr Thr Thr Ile 130 135
140cct ccg tct tcc cct cct cag tgg aag cta caa ccc ggg gac gat cca
480Pro Pro Ser Ser Pro Pro Gln Trp Lys Leu Gln Pro Gly Asp Asp Pro145
150 155 160ctc ctg gga aat
cag tct ctc ctc gag act cat ccg cta tac cag tca 528Leu Leu Gly Asn
Gln Ser Leu Leu Glu Thr His Pro Leu Tyr Gln Ser 165
170 175gaa cca gcg gtg cca gtg ata aaa act ccc
ccc ttg aag aag aaa acg 576Glu Pro Ala Val Pro Val Ile Lys Thr Pro
Pro Leu Lys Lys Lys Thr 180 185
190cgg ccg ctt tcg aat cta gag cct gca gtc tcg agg cat gcg gta cca
624Arg Pro Leu Ser Asn Leu Glu Pro Ala Val Ser Arg His Ala Val Pro
195 200 205agc ttg tcg aga agt act aga
gga tca taa 654Ser Leu Ser Arg Ser Thr Arg
Gly Ser 210 21546217PRTDuck hepatitis B virus 46Met
Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro Thr1
5 10 15Thr Glu Asn Leu Tyr Phe Gln
Gly Ala Met Asp Pro Glu Phe Met Gly 20 25
30Gln His Pro Ala Lys Ser Met Asp Val Arg Arg Ile Glu Gly
Gly Glu 35 40 45Ile Leu Leu Asn
Gln Leu Ala Gly Arg Met Ile Pro Lys Gly Thr Leu 50 55
60Thr Trp Ser Gly Lys Phe Pro Thr Leu Asp His Val Leu
Asp His Val65 70 75
80Gln Thr Met Glu Glu Ile Asn Thr Leu Gln Asn Gln Gly Ala Trp Pro
85 90 95Ala Gly Ala Gly Arg Arg
Val Gly Leu Ser Asn Pro Thr Pro Gln Glu 100
105 110Ile Pro Gln Pro Gln Trp Thr Pro Glu Glu Asp Gln
Lys Ala Arg Glu 115 120 125Ala Phe
Arg Arg Tyr Gln Glu Glu Arg Pro Pro Glu Thr Thr Thr Ile 130
135 140Pro Pro Ser Ser Pro Pro Gln Trp Lys Leu Gln
Pro Gly Asp Asp Pro145 150 155
160Leu Leu Gly Asn Gln Ser Leu Leu Glu Thr His Pro Leu Tyr Gln Ser
165 170 175Glu Pro Ala Val
Pro Val Ile Lys Thr Pro Pro Leu Lys Lys Lys Thr 180
185 190Arg Pro Leu Ser Asn Leu Glu Pro Ala Val Ser
Arg His Ala Val Pro 195 200 205Ser
Leu Ser Arg Ser Thr Arg Gly Ser 210
215471827DNAArtificialDuck hepatitis B virus plus murine 47atg tcg tac
tac cat cac cat cac cat cac gat tac gat atc cca acg 48Met Ser Tyr
Tyr His His His His His His Asp Tyr Asp Ile Pro Thr1 5
10 15acc gaa aac ctg tat ttt cag ggc gcc
atg gat ccg gaa ttc atg ggg 96Thr Glu Asn Leu Tyr Phe Gln Gly Ala
Met Asp Pro Glu Phe Met Gly 20 25
30caa cat cca gca aaa tca atg gac gtc aga cgg ata gaa gga gga gaa
144Gln His Pro Ala Lys Ser Met Asp Val Arg Arg Ile Glu Gly Gly Glu
35 40 45ata ctg tta aac caa ctt gcc
gga agg atg atc cca aaa ggg act ttg 192Ile Leu Leu Asn Gln Leu Ala
Gly Arg Met Ile Pro Lys Gly Thr Leu 50 55
60aca tgg tca ggc aag ttt cca aca cta gat cac gtg tta gac cat gtg
240Thr Trp Ser Gly Lys Phe Pro Thr Leu Asp His Val Leu Asp His Val65
70 75 80caa aca atg gag
gag ata aac acc ctc cag aat cag gga gct tgg cct 288Gln Thr Met Glu
Glu Ile Asn Thr Leu Gln Asn Gln Gly Ala Trp Pro 85
90 95gct ggg gcg gga agg aga gta gga tta tca
aat ccg act cct caa gag 336Ala Gly Ala Gly Arg Arg Val Gly Leu Ser
Asn Pro Thr Pro Gln Glu 100 105
110att cct cag ccc cag tgg act ccc gag gaa gac caa aaa gca cgc gaa
384Ile Pro Gln Pro Gln Trp Thr Pro Glu Glu Asp Gln Lys Ala Arg Glu
115 120 125gct ttt cgc cgt tat caa gaa
gaa aga cca ccg gaa acc acc acc att 432Ala Phe Arg Arg Tyr Gln Glu
Glu Arg Pro Pro Glu Thr Thr Thr Ile 130 135
140cct ccg tct tcc cct cct cag tgg aag cta caa ccc ggg gac gat cca
480Pro Pro Ser Ser Pro Pro Gln Trp Lys Leu Gln Pro Gly Asp Asp Pro145
150 155 160ctc ctg gga aat
cag tct ctc ctc gag act cat ccg cta tac cag tca 528Leu Leu Gly Asn
Gln Ser Leu Leu Glu Thr His Pro Leu Tyr Gln Ser 165
170 175gaa cca gcg gtg cca gtg ata aaa act ccc
ccc ttg aag aag aaa atg 576Glu Pro Ala Val Pro Val Ile Lys Thr Pro
Pro Leu Lys Lys Lys Met 180 185
190tct ggt acc ttc ggg gga ata cta gct ggc cta atc gga tta ctg gta
624Ser Gly Thr Phe Gly Gly Ile Leu Ala Gly Leu Ile Gly Leu Leu Val
195 200 205agc ttt ttc ttg ttg ata aaa
att cta gaa ata ctg agg agg cta gat 672Ser Phe Phe Leu Leu Ile Lys
Ile Leu Glu Ile Leu Arg Arg Leu Asp 210 215
220tgg tgg tgg att tct ctc agt tct cca aag gga aaa atg caa tgc gct
720Trp Trp Trp Ile Ser Leu Ser Ser Pro Lys Gly Lys Met Gln Cys Ala225
230 235 240ttc caa gat act
gga gcc caa atc tct cca cat tac gta gga tct tgc 768Phe Gln Asp Thr
Gly Ala Gln Ile Ser Pro His Tyr Val Gly Ser Cys 245
250 255ccg tgg gga tgc cca gga ttt ctt tgg acc
tat ctc agg ctt ttt atc 816Pro Trp Gly Cys Pro Gly Phe Leu Trp Thr
Tyr Leu Arg Leu Phe Ile 260 265
270atc ttc ctc tta atc ctg cta gta gca gca ggc ttg ctg tat ctg acg
864Ile Phe Leu Leu Ile Leu Leu Val Ala Ala Gly Leu Leu Tyr Leu Thr
275 280 285gac aac ggg tct act att tta
gga aag ctc caa tgg gcg tcg gtc tca 912Asp Asn Gly Ser Thr Ile Leu
Gly Lys Leu Gln Trp Ala Ser Val Ser 290 295
300gcc ctt ttc tcc tcc atc tct tca cta ctg ccc tcg gat ccg aaa tct
960Ala Leu Phe Ser Ser Ile Ser Ser Leu Leu Pro Ser Asp Pro Lys Ser305
310 315 320ctc gtc gct tta
acg ttt gga ctt tca ctt ata tgg atg act tcc tcc 1008Leu Val Ala Leu
Thr Phe Gly Leu Ser Leu Ile Trp Met Thr Ser Ser 325
330 335tct gcc acc caa acg ctc gtc acc tta acg
caa tta gcc acg ctg tct 1056Ser Ala Thr Gln Thr Leu Val Thr Leu Thr
Gln Leu Ala Thr Leu Ser 340 345
350gct ctt ttt tac aag agt tcg cgg ccg caa ggc ggc gga tcc gtg gac
1104Ala Leu Phe Tyr Lys Ser Ser Arg Pro Gln Gly Gly Gly Ser Val Asp
355 360 365aag aaa att gtg ccc agg gat
tgt ggt tgt aag cct tgc ata tgt aca 1152Lys Lys Ile Val Pro Arg Asp
Cys Gly Cys Lys Pro Cys Ile Cys Thr 370 375
380gtc cca gaa gta tca tct gtc ttc atc ttc ccc cca aag ccc aag gat
1200Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp385
390 395 400gtg ctc acc att
act ctg act cct aag gtc acg tgt gtt gtg gta gac 1248Val Leu Thr Ile
Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp 405
410 415atc agc aag gat gat ccc gag gtc cag ttc
agc tgg ttt gta gat gat 1296Ile Ser Lys Asp Asp Pro Glu Val Gln Phe
Ser Trp Phe Val Asp Asp 420 425
430gtg gag gtg cac aca gct cag acg caa ccc cgg gag gag cag ttc aac
1344Val Glu Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn
435 440 445agc act ttc cgc tca gtc agt
gaa ctt ccc atc atg cac cag gac tgg 1392Ser Thr Phe Arg Ser Val Ser
Glu Leu Pro Ile Met His Gln Asp Trp 450 455
460ctc aat ggc aag gag ttc aaa tgc agg gtc aac agt gca gct ttc cct
1440Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro465
470 475 480gcc ccc atc gag
aaa acc atc tcc aaa acc aaa ggc aga ccg aag gct 1488Ala Pro Ile Glu
Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala 485
490 495cca cag gtg tac acc att cca cct ccc aag
gag cag atg gcc aag gat 1536Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys
Glu Gln Met Ala Lys Asp 500 505
510aaa gtc agt ctg acc tgc atg ata aca gac ttc ttc cct gaa gac att
1584Lys Val Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile
515 520 525act gtg gag tgg cag tgg aat
ggg cag cca gcg gag aac tac aag aac 1632Thr Val Glu Trp Gln Trp Asn
Gly Gln Pro Ala Glu Asn Tyr Lys Asn 530 535
540act cag ccc atc atg gac aca gat ggc tct tac ttc gtc tac agc aag
1680Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys545
550 555 560ctc aat gtg cag
aag agc aac tgg gag gca gga aat act ttc acc tgc 1728Leu Asn Val Gln
Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys 565
570 575tct gtg tta cat gag ggc ctg cac aac cac
cat act gag aag agc ctc 1776Ser Val Leu His Glu Gly Leu His Asn His
His Thr Glu Lys Ser Leu 580 585
590tcc cac tct cct ggg ctg caa agc ttg tcg aga agt act aga gga tca
1824Ser His Ser Pro Gly Leu Gln Ser Leu Ser Arg Ser Thr Arg Gly Ser
595 600 605taa
182748608PRTArtificialSynthetic
Construct 48Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro
Thr1 5 10 15Thr Glu Asn
Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu Phe Met Gly 20
25 30Gln His Pro Ala Lys Ser Met Asp Val Arg
Arg Ile Glu Gly Gly Glu 35 40
45Ile Leu Leu Asn Gln Leu Ala Gly Arg Met Ile Pro Lys Gly Thr Leu 50
55 60Thr Trp Ser Gly Lys Phe Pro Thr Leu
Asp His Val Leu Asp His Val65 70 75
80Gln Thr Met Glu Glu Ile Asn Thr Leu Gln Asn Gln Gly Ala
Trp Pro 85 90 95Ala Gly
Ala Gly Arg Arg Val Gly Leu Ser Asn Pro Thr Pro Gln Glu 100
105 110Ile Pro Gln Pro Gln Trp Thr Pro Glu
Glu Asp Gln Lys Ala Arg Glu 115 120
125Ala Phe Arg Arg Tyr Gln Glu Glu Arg Pro Pro Glu Thr Thr Thr Ile
130 135 140Pro Pro Ser Ser Pro Pro Gln
Trp Lys Leu Gln Pro Gly Asp Asp Pro145 150
155 160Leu Leu Gly Asn Gln Ser Leu Leu Glu Thr His Pro
Leu Tyr Gln Ser 165 170
175Glu Pro Ala Val Pro Val Ile Lys Thr Pro Pro Leu Lys Lys Lys Met
180 185 190Ser Gly Thr Phe Gly Gly
Ile Leu Ala Gly Leu Ile Gly Leu Leu Val 195 200
205Ser Phe Phe Leu Leu Ile Lys Ile Leu Glu Ile Leu Arg Arg
Leu Asp 210 215 220Trp Trp Trp Ile Ser
Leu Ser Ser Pro Lys Gly Lys Met Gln Cys Ala225 230
235 240Phe Gln Asp Thr Gly Ala Gln Ile Ser Pro
His Tyr Val Gly Ser Cys 245 250
255Pro Trp Gly Cys Pro Gly Phe Leu Trp Thr Tyr Leu Arg Leu Phe Ile
260 265 270Ile Phe Leu Leu Ile
Leu Leu Val Ala Ala Gly Leu Leu Tyr Leu Thr 275
280 285Asp Asn Gly Ser Thr Ile Leu Gly Lys Leu Gln Trp
Ala Ser Val Ser 290 295 300Ala Leu Phe
Ser Ser Ile Ser Ser Leu Leu Pro Ser Asp Pro Lys Ser305
310 315 320Leu Val Ala Leu Thr Phe Gly
Leu Ser Leu Ile Trp Met Thr Ser Ser 325
330 335Ser Ala Thr Gln Thr Leu Val Thr Leu Thr Gln Leu
Ala Thr Leu Ser 340 345 350Ala
Leu Phe Tyr Lys Ser Ser Arg Pro Gln Gly Gly Gly Ser Val Asp 355
360 365Lys Lys Ile Val Pro Arg Asp Cys Gly
Cys Lys Pro Cys Ile Cys Thr 370 375
380Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp385
390 395 400Val Leu Thr Ile
Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp 405
410 415Ile Ser Lys Asp Asp Pro Glu Val Gln Phe
Ser Trp Phe Val Asp Asp 420 425
430Val Glu Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn
435 440 445Ser Thr Phe Arg Ser Val Ser
Glu Leu Pro Ile Met His Gln Asp Trp 450 455
460Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe
Pro465 470 475 480Ala Pro
Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala
485 490 495Pro Gln Val Tyr Thr Ile Pro
Pro Pro Lys Glu Gln Met Ala Lys Asp 500 505
510Lys Val Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu
Asp Ile 515 520 525Thr Val Glu Trp
Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn 530
535 540Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe
Val Tyr Ser Lys545 550 555
560Leu Asn Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys
565 570 575Ser Val Leu His Glu
Gly Leu His Asn His His Thr Glu Lys Ser Leu 580
585 590Ser His Ser Pro Gly Leu Gln Ser Leu Ser Arg Ser
Thr Arg Gly Ser 595 600
605491155DNADuck hepatitis B virusCDS(1)..(1155) 49atg tcg tac tac cat
cac cat cac cat cac gat tac gat atc cca acg 48Met Ser Tyr Tyr His
His His His His His Asp Tyr Asp Ile Pro Thr1 5
10 15acc gaa aac ctg tat ttt cag ggc gcc atg gat
ccg gaa ttc atg ggg 96Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp
Pro Glu Phe Met Gly 20 25
30caa cat cca gca aaa tca atg gac gtc aga cgg ata gaa gga gga gaa
144Gln His Pro Ala Lys Ser Met Asp Val Arg Arg Ile Glu Gly Gly Glu
35 40 45ata ctg tta aac caa ctt gcc gga
agg atg atc cca aaa ggg act ttg 192Ile Leu Leu Asn Gln Leu Ala Gly
Arg Met Ile Pro Lys Gly Thr Leu 50 55
60aca tgg tca ggc aag ttt cca aca cta gat cac gtg tta gac cat gtg
240Thr Trp Ser Gly Lys Phe Pro Thr Leu Asp His Val Leu Asp His Val65
70 75 80caa aca atg gag gag
ata aac acc ctc cag aat cag gga gct tgg cct 288Gln Thr Met Glu Glu
Ile Asn Thr Leu Gln Asn Gln Gly Ala Trp Pro 85
90 95gct ggg gcg gga agg aga gta gga tta tca aat
ccg act cct caa gag 336Ala Gly Ala Gly Arg Arg Val Gly Leu Ser Asn
Pro Thr Pro Gln Glu 100 105
110att cct cag ccc cag tgg act ccc gag gaa gac caa aaa gca cgc gaa
384Ile Pro Gln Pro Gln Trp Thr Pro Glu Glu Asp Gln Lys Ala Arg Glu
115 120 125gct ttt cgc cgt tat caa gaa
gaa aga cca ccg gaa acc acc acc att 432Ala Phe Arg Arg Tyr Gln Glu
Glu Arg Pro Pro Glu Thr Thr Thr Ile 130 135
140cct ccg tct tcc cct cct cag tgg aag cta caa ccc ggg gac gat cca
480Pro Pro Ser Ser Pro Pro Gln Trp Lys Leu Gln Pro Gly Asp Asp Pro145
150 155 160ctc ctg gga aat
cag tct ctc ctc gag act cat ccg cta tac cag tca 528Leu Leu Gly Asn
Gln Ser Leu Leu Glu Thr His Pro Leu Tyr Gln Ser 165
170 175gaa cca gcg gtg cca gtg ata aaa act ccc
ccc ttg aag aag aaa atg 576Glu Pro Ala Val Pro Val Ile Lys Thr Pro
Pro Leu Lys Lys Lys Met 180 185
190tct ggt acc ttc ggg gga ata cta gct ggc cta atc gga tta ctg gta
624Ser Gly Thr Phe Gly Gly Ile Leu Ala Gly Leu Ile Gly Leu Leu Val
195 200 205agc ttt ttc ttg ttg ata aaa
att cta gaa ata ctg agg agg cta gat 672Ser Phe Phe Leu Leu Ile Lys
Ile Leu Glu Ile Leu Arg Arg Leu Asp 210 215
220tgg tgg tgg att tct ctc agt tct cca aag gga aaa atg caa tgc gct
720Trp Trp Trp Ile Ser Leu Ser Ser Pro Lys Gly Lys Met Gln Cys Ala225
230 235 240ttc caa gat act
gga gcc caa atc tct cca cat tac gta gga tct tgc 768Phe Gln Asp Thr
Gly Ala Gln Ile Ser Pro His Tyr Val Gly Ser Cys 245
250 255ccg tgg gga tgc cca gga ttt ctt tgg acc
tat ctc agg ctt ttt atc 816Pro Trp Gly Cys Pro Gly Phe Leu Trp Thr
Tyr Leu Arg Leu Phe Ile 260 265
270atc ttc ctc tta atc ctg cta gta gca gca ggc ttg ctg tat ctg acg
864Ile Phe Leu Leu Ile Leu Leu Val Ala Ala Gly Leu Leu Tyr Leu Thr
275 280 285gac aac ggg tct act att tta
gga aag ctc caa tgg gcg tcg gtc tca 912Asp Asn Gly Ser Thr Ile Leu
Gly Lys Leu Gln Trp Ala Ser Val Ser 290 295
300gcc ctt ttc tcc tcc atc tct tca cta ctg ccc tcg gat ccg aaa tct
960Ala Leu Phe Ser Ser Ile Ser Ser Leu Leu Pro Ser Asp Pro Lys Ser305
310 315 320ctc gtc gct tta
acg ttt gga ctt tca ctt ata tgg atg act tcc tcc 1008Leu Val Ala Leu
Thr Phe Gly Leu Ser Leu Ile Trp Met Thr Ser Ser 325
330 335tct gcc acc caa acg ctc gtc acc tta acg
caa tta gcc acg ctg tct 1056Ser Ala Thr Gln Thr Leu Val Thr Leu Thr
Gln Leu Ala Thr Leu Ser 340 345
350gct ctt ttt tac aag agt tcg cgg ccg ctt tcg aat cta gag cct gca
1104Ala Leu Phe Tyr Lys Ser Ser Arg Pro Leu Ser Asn Leu Glu Pro Ala
355 360 365gtc tcg agg cat gcg gta cca
agc ttg tcg aga agt act aga gga tca 1152Val Ser Arg His Ala Val Pro
Ser Leu Ser Arg Ser Thr Arg Gly Ser 370 375
380taa
115550384PRTDuck hepatitis B virus 50Met Ser Tyr Tyr His His His His
His His Asp Tyr Asp Ile Pro Thr1 5 10
15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu Phe
Met Gly 20 25 30Gln His Pro
Ala Lys Ser Met Asp Val Arg Arg Ile Glu Gly Gly Glu 35
40 45Ile Leu Leu Asn Gln Leu Ala Gly Arg Met Ile
Pro Lys Gly Thr Leu 50 55 60Thr Trp
Ser Gly Lys Phe Pro Thr Leu Asp His Val Leu Asp His Val65
70 75 80Gln Thr Met Glu Glu Ile Asn
Thr Leu Gln Asn Gln Gly Ala Trp Pro 85 90
95Ala Gly Ala Gly Arg Arg Val Gly Leu Ser Asn Pro Thr
Pro Gln Glu 100 105 110Ile Pro
Gln Pro Gln Trp Thr Pro Glu Glu Asp Gln Lys Ala Arg Glu 115
120 125Ala Phe Arg Arg Tyr Gln Glu Glu Arg Pro
Pro Glu Thr Thr Thr Ile 130 135 140Pro
Pro Ser Ser Pro Pro Gln Trp Lys Leu Gln Pro Gly Asp Asp Pro145
150 155 160Leu Leu Gly Asn Gln Ser
Leu Leu Glu Thr His Pro Leu Tyr Gln Ser 165
170 175Glu Pro Ala Val Pro Val Ile Lys Thr Pro Pro Leu
Lys Lys Lys Met 180 185 190Ser
Gly Thr Phe Gly Gly Ile Leu Ala Gly Leu Ile Gly Leu Leu Val 195
200 205Ser Phe Phe Leu Leu Ile Lys Ile Leu
Glu Ile Leu Arg Arg Leu Asp 210 215
220Trp Trp Trp Ile Ser Leu Ser Ser Pro Lys Gly Lys Met Gln Cys Ala225
230 235 240Phe Gln Asp Thr
Gly Ala Gln Ile Ser Pro His Tyr Val Gly Ser Cys 245
250 255Pro Trp Gly Cys Pro Gly Phe Leu Trp Thr
Tyr Leu Arg Leu Phe Ile 260 265
270Ile Phe Leu Leu Ile Leu Leu Val Ala Ala Gly Leu Leu Tyr Leu Thr
275 280 285Asp Asn Gly Ser Thr Ile Leu
Gly Lys Leu Gln Trp Ala Ser Val Ser 290 295
300Ala Leu Phe Ser Ser Ile Ser Ser Leu Leu Pro Ser Asp Pro Lys
Ser305 310 315 320Leu Val
Ala Leu Thr Phe Gly Leu Ser Leu Ile Trp Met Thr Ser Ser
325 330 335Ser Ala Thr Gln Thr Leu Val
Thr Leu Thr Gln Leu Ala Thr Leu Ser 340 345
350Ala Leu Phe Tyr Lys Ser Ser Arg Pro Leu Ser Asn Leu Glu
Pro Ala 355 360 365Val Ser Arg His
Ala Val Pro Ser Leu Ser Arg Ser Thr Arg Gly Ser 370
375 380511614DNAArtificialDuck hepatitis B virus plus
murine 51atg tcg tac tac cat cac cat cac cat cac gat tac gat atc cca acg
48Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro Thr1
5 10 15acc gaa aac ctg tat
ttt cag ggc gcc atg gat atc aat gct tct aga 96Thr Glu Asn Leu Tyr
Phe Gln Gly Ala Met Asp Ile Asn Ala Ser Arg 20
25 30gcc tta gcc aat gtg tat gat cta cca gat gat ttc
ttt cca aaa ata 144Ala Leu Ala Asn Val Tyr Asp Leu Pro Asp Asp Phe
Phe Pro Lys Ile 35 40 45gat gat
ctt gtt aga gat gct aaa gac gct tta gag cct tat tgg aaa 192Asp Asp
Leu Val Arg Asp Ala Lys Asp Ala Leu Glu Pro Tyr Trp Lys 50
55 60tca gat tca ata aag aaa cat gtt ttg att gca
act cac ttt gtg gat 240Ser Asp Ser Ile Lys Lys His Val Leu Ile Ala
Thr His Phe Val Asp65 70 75
80ctc att gaa gac ttc tgg cag act aca cag ggc atg cat gaa ata gcc
288Leu Ile Glu Asp Phe Trp Gln Thr Thr Gln Gly Met His Glu Ile Ala
85 90 95gaa tca tta aga gct
gtt ata cct ccc act act act cct gtt cca ccg 336Glu Ser Leu Arg Ala
Val Ile Pro Pro Thr Thr Thr Pro Val Pro Pro 100
105 110ggt tat ctt att cag cac gag gaa gct gaa gag ata
cct ttg gga gat 384Gly Tyr Leu Ile Gln His Glu Glu Ala Glu Glu Ile
Pro Leu Gly Asp 115 120 125tta ttt
aaa cac caa gaa gaa agg ata gta agt ttc caa ccc gac tat 432Leu Phe
Lys His Gln Glu Glu Arg Ile Val Ser Phe Gln Pro Asp Tyr 130
135 140ccg att acg gct aga att cat gct cat ttg aaa
gct tat gca aaa att 480Pro Ile Thr Ala Arg Ile His Ala His Leu Lys
Ala Tyr Ala Lys Ile145 150 155
160aac gag gaa tca ctg gat agg gct agg aga ttg ctt tgg tgg cat tac
528Asn Glu Glu Ser Leu Asp Arg Ala Arg Arg Leu Leu Trp Trp His Tyr
165 170 175aac tgt tta ctg tgg
gga gaa gct caa gtt act aac tat att tct cgt 576Asn Cys Leu Leu Trp
Gly Glu Ala Gln Val Thr Asn Tyr Ile Ser Arg 180
185 190ttg cgt act tgg ttg tca act cct gag aaa tat aga
ggt aga gat gcc 624Leu Arg Thr Trp Leu Ser Thr Pro Glu Lys Tyr Arg
Gly Arg Asp Ala 195 200 205ccg acc
att gaa gca atc act aga cca atc cag gtg gct cag gga ggc 672Pro Thr
Ile Glu Ala Ile Thr Arg Pro Ile Gln Val Ala Gln Gly Gly 210
215 220aga aaa aca act acg ggt act aga aaa cct cgt
gga ctc gaa cct aga 720Arg Lys Thr Thr Thr Gly Thr Arg Lys Pro Arg
Gly Leu Glu Pro Arg225 230 235
240aga aga aaa gtt aaa acc aca gtt gtc tat ggg aga aga cgt tca aag
768Arg Arg Lys Val Lys Thr Thr Val Val Tyr Gly Arg Arg Arg Ser Lys
245 250 255tcc cgg gaa agg aga
gcc cct aca ccc caa cgt gcg ggc tcc cct ctc 816Ser Arg Glu Arg Arg
Ala Pro Thr Pro Gln Arg Ala Gly Ser Pro Leu 260
265 270cca cgt agt tcg agc agc cac cat aga tct ccc tcg
cct agg aaa tcg 864Pro Arg Ser Ser Ser Ser His His Arg Ser Pro Ser
Pro Arg Lys Ser 275 280 285cgg ccg
caa ggc ggc gga tcc gtg gac aag aaa att gtg ccc agg gat 912Arg Pro
Gln Gly Gly Gly Ser Val Asp Lys Lys Ile Val Pro Arg Asp 290
295 300tgt ggt tgt aag cct tgc ata tgt aca gtc cca
gaa gta tca tct gtc 960Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro
Glu Val Ser Ser Val305 310 315
320ttc atc ttc ccc cca aag ccc aag gat gtg ctc acc att act ctg act
1008Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr
325 330 335cct aag gtc acg tgt
gtt gtg gta gac atc agc aag gat gat ccc gag 1056Pro Lys Val Thr Cys
Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu 340
345 350gtc cag ttc agc tgg ttt gta gat gat gtg gag gtg
cac aca gct cag 1104Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val
His Thr Ala Gln 355 360 365acg caa
ccc cgg gag gag cag ttc aac agc act ttc cgc tca gtc agt 1152Thr Gln
Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser 370
375 380gaa ctt ccc atc atg cac cag gac tgg ctc aat
ggc aag gag ttc aaa 1200Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn
Gly Lys Glu Phe Lys385 390 395
400tgc agg gtc aac agt gca gct ttc cct gcc ccc atc gag aaa acc atc
1248Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile
405 410 415tcc aaa acc aaa ggc
aga ccg aag gct cca cag gtg tac acc att cca 1296Ser Lys Thr Lys Gly
Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro 420
425 430cct ccc aag gag cag atg gcc aag gat aaa gtc agt
ctg acc tgc atg 1344Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser
Leu Thr Cys Met 435 440 445ata aca
gac ttc ttc cct gaa gac att act gtg gag tgg cag tgg aat 1392Ile Thr
Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn 450
455 460ggg cag cca gcg gag aac tac aag aac act cag
ccc atc atg gac aca 1440Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln
Pro Ile Met Asp Thr465 470 475
480gat ggc tct tac ttc gtc tac agc aag ctc aat gtg cag aag agc aac
1488Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn
485 490 495tgg gag gca gga aat
act ttc acc tgc tct gtg tta cat gag ggc ctg 1536Trp Glu Ala Gly Asn
Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu 500
505 510cac aac cac cat act gag aag agc ctc tcc cac tct
cct ggg ctg caa 1584His Asn His His Thr Glu Lys Ser Leu Ser His Ser
Pro Gly Leu Gln 515 520 525agc ttg
tcg aga agt act aga gga tca taa 1614Ser Leu
Ser Arg Ser Thr Arg Gly Ser 530
53552537PRTArtificialSynthetic Construct 52Met Ser Tyr Tyr His His His
His His His Asp Tyr Asp Ile Pro Thr1 5 10
15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Ile Asn
Ala Ser Arg 20 25 30Ala Leu
Ala Asn Val Tyr Asp Leu Pro Asp Asp Phe Phe Pro Lys Ile 35
40 45Asp Asp Leu Val Arg Asp Ala Lys Asp Ala
Leu Glu Pro Tyr Trp Lys 50 55 60Ser
Asp Ser Ile Lys Lys His Val Leu Ile Ala Thr His Phe Val Asp65
70 75 80Leu Ile Glu Asp Phe Trp
Gln Thr Thr Gln Gly Met His Glu Ile Ala 85
90 95Glu Ser Leu Arg Ala Val Ile Pro Pro Thr Thr Thr
Pro Val Pro Pro 100 105 110Gly
Tyr Leu Ile Gln His Glu Glu Ala Glu Glu Ile Pro Leu Gly Asp 115
120 125Leu Phe Lys His Gln Glu Glu Arg Ile
Val Ser Phe Gln Pro Asp Tyr 130 135
140Pro Ile Thr Ala Arg Ile His Ala His Leu Lys Ala Tyr Ala Lys Ile145
150 155 160Asn Glu Glu Ser
Leu Asp Arg Ala Arg Arg Leu Leu Trp Trp His Tyr 165
170 175Asn Cys Leu Leu Trp Gly Glu Ala Gln Val
Thr Asn Tyr Ile Ser Arg 180 185
190Leu Arg Thr Trp Leu Ser Thr Pro Glu Lys Tyr Arg Gly Arg Asp Ala
195 200 205Pro Thr Ile Glu Ala Ile Thr
Arg Pro Ile Gln Val Ala Gln Gly Gly 210 215
220Arg Lys Thr Thr Thr Gly Thr Arg Lys Pro Arg Gly Leu Glu Pro
Arg225 230 235 240Arg Arg
Lys Val Lys Thr Thr Val Val Tyr Gly Arg Arg Arg Ser Lys
245 250 255Ser Arg Glu Arg Arg Ala Pro
Thr Pro Gln Arg Ala Gly Ser Pro Leu 260 265
270Pro Arg Ser Ser Ser Ser His His Arg Ser Pro Ser Pro Arg
Lys Ser 275 280 285Arg Pro Gln Gly
Gly Gly Ser Val Asp Lys Lys Ile Val Pro Arg Asp 290
295 300Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu
Val Ser Ser Val305 310 315
320Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr
325 330 335Pro Lys Val Thr Cys
Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu 340
345 350Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val
His Thr Ala Gln 355 360 365Thr Gln
Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser 370
375 380Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn
Gly Lys Glu Phe Lys385 390 395
400Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile
405 410 415Ser Lys Thr Lys
Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro 420
425 430Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val
Ser Leu Thr Cys Met 435 440 445Ile
Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn 450
455 460Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr
Gln Pro Ile Met Asp Thr465 470 475
480Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser
Asn 485 490 495Trp Glu Ala
Gly Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu 500
505 510His Asn His His Thr Glu Lys Ser Leu Ser
His Ser Pro Gly Leu Gln 515 520
525Ser Leu Ser Arg Ser Thr Arg Gly Ser 530
53553942DNADuck hepatitis B virusCDS(1)..(942) 53atg tcg tac tac cat cac
cat cac cat cac gat tac gat atc cca acg 48Met Ser Tyr Tyr His His
His His His His Asp Tyr Asp Ile Pro Thr1 5
10 15acc gaa aac ctg tat ttt cag ggc gcc atg gat atc
aat gct tct aga 96Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Ile
Asn Ala Ser Arg 20 25 30gcc
tta gcc aat gtg tat gat cta cca gat gat ttc ttt cca aaa ata 144Ala
Leu Ala Asn Val Tyr Asp Leu Pro Asp Asp Phe Phe Pro Lys Ile 35
40 45gat gat ctt gtt aga gat gct aaa gac
gct tta gag cct tat tgg aaa 192Asp Asp Leu Val Arg Asp Ala Lys Asp
Ala Leu Glu Pro Tyr Trp Lys 50 55
60tca gat tca ata aag aaa cat gtt ttg att gca act cac ttt gtg gat
240Ser Asp Ser Ile Lys Lys His Val Leu Ile Ala Thr His Phe Val Asp65
70 75 80ctc att gaa gac ttc
tgg cag act aca cag ggc atg cat gaa ata gcc 288Leu Ile Glu Asp Phe
Trp Gln Thr Thr Gln Gly Met His Glu Ile Ala 85
90 95gaa tca tta aga gct gtt ata cct ccc act act
act cct gtt cca ccg 336Glu Ser Leu Arg Ala Val Ile Pro Pro Thr Thr
Thr Pro Val Pro Pro 100 105
110ggt tat ctt att cag cac gag gaa gct gaa gag ata cct ttg gga gat
384Gly Tyr Leu Ile Gln His Glu Glu Ala Glu Glu Ile Pro Leu Gly Asp
115 120 125tta ttt aaa cac caa gaa gaa
agg ata gta agt ttc caa ccc gac tat 432Leu Phe Lys His Gln Glu Glu
Arg Ile Val Ser Phe Gln Pro Asp Tyr 130 135
140ccg att acg gct aga att cat gct cat ttg aaa gct tat gca aaa att
480Pro Ile Thr Ala Arg Ile His Ala His Leu Lys Ala Tyr Ala Lys Ile145
150 155 160aac gag gaa tca
ctg gat agg gct agg aga ttg ctt tgg tgg cat tac 528Asn Glu Glu Ser
Leu Asp Arg Ala Arg Arg Leu Leu Trp Trp His Tyr 165
170 175aac tgt tta ctg tgg gga gaa gct caa gtt
act aac tat att tct cgt 576Asn Cys Leu Leu Trp Gly Glu Ala Gln Val
Thr Asn Tyr Ile Ser Arg 180 185
190ttg cgt act tgg ttg tca act cct gag aaa tat aga ggt aga gat gcc
624Leu Arg Thr Trp Leu Ser Thr Pro Glu Lys Tyr Arg Gly Arg Asp Ala
195 200 205ccg acc att gaa gca atc act
aga cca atc cag gtg gct cag gga ggc 672Pro Thr Ile Glu Ala Ile Thr
Arg Pro Ile Gln Val Ala Gln Gly Gly 210 215
220aga aaa aca act acg ggt act aga aaa cct cgt gga ctc gaa cct aga
720Arg Lys Thr Thr Thr Gly Thr Arg Lys Pro Arg Gly Leu Glu Pro Arg225
230 235 240aga aga aaa gtt
aaa acc aca gtt gtc tat ggg aga aga cgt tca aag 768Arg Arg Lys Val
Lys Thr Thr Val Val Tyr Gly Arg Arg Arg Ser Lys 245
250 255tcc cgg gaa agg aga gcc cct aca ccc caa
cgt gcg ggc tcc cct ctc 816Ser Arg Glu Arg Arg Ala Pro Thr Pro Gln
Arg Ala Gly Ser Pro Leu 260 265
270cca cgt agt tcg agc agc cac cat aga tct ccc tcg cct agg aaa tcg
864Pro Arg Ser Ser Ser Ser His His Arg Ser Pro Ser Pro Arg Lys Ser
275 280 285cgg ccg ctt tcg aat cta gag
cct gca gtc tcg agg cat gcg gta cca 912Arg Pro Leu Ser Asn Leu Glu
Pro Ala Val Ser Arg His Ala Val Pro 290 295
300agc ttg tcg aga agt act aga gga tca taa
942Ser Leu Ser Arg Ser Thr Arg Gly Ser305
31054313PRTDuck hepatitis B virus 54Met Ser Tyr Tyr His His His His His
His Asp Tyr Asp Ile Pro Thr1 5 10
15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Ile Asn Ala Ser
Arg 20 25 30Ala Leu Ala Asn
Val Tyr Asp Leu Pro Asp Asp Phe Phe Pro Lys Ile 35
40 45Asp Asp Leu Val Arg Asp Ala Lys Asp Ala Leu Glu
Pro Tyr Trp Lys 50 55 60Ser Asp Ser
Ile Lys Lys His Val Leu Ile Ala Thr His Phe Val Asp65 70
75 80Leu Ile Glu Asp Phe Trp Gln Thr
Thr Gln Gly Met His Glu Ile Ala 85 90
95Glu Ser Leu Arg Ala Val Ile Pro Pro Thr Thr Thr Pro Val
Pro Pro 100 105 110Gly Tyr Leu
Ile Gln His Glu Glu Ala Glu Glu Ile Pro Leu Gly Asp 115
120 125Leu Phe Lys His Gln Glu Glu Arg Ile Val Ser
Phe Gln Pro Asp Tyr 130 135 140Pro Ile
Thr Ala Arg Ile His Ala His Leu Lys Ala Tyr Ala Lys Ile145
150 155 160Asn Glu Glu Ser Leu Asp Arg
Ala Arg Arg Leu Leu Trp Trp His Tyr 165
170 175Asn Cys Leu Leu Trp Gly Glu Ala Gln Val Thr Asn
Tyr Ile Ser Arg 180 185 190Leu
Arg Thr Trp Leu Ser Thr Pro Glu Lys Tyr Arg Gly Arg Asp Ala 195
200 205Pro Thr Ile Glu Ala Ile Thr Arg Pro
Ile Gln Val Ala Gln Gly Gly 210 215
220Arg Lys Thr Thr Thr Gly Thr Arg Lys Pro Arg Gly Leu Glu Pro Arg225
230 235 240Arg Arg Lys Val
Lys Thr Thr Val Val Tyr Gly Arg Arg Arg Ser Lys 245
250 255Ser Arg Glu Arg Arg Ala Pro Thr Pro Gln
Arg Ala Gly Ser Pro Leu 260 265
270Pro Arg Ser Ser Ser Ser His His Arg Ser Pro Ser Pro Arg Lys Ser
275 280 285Arg Pro Leu Ser Asn Leu Glu
Pro Ala Val Ser Arg His Ala Val Pro 290 295
300Ser Leu Ser Arg Ser Thr Arg Gly Ser305
31055750DNAHepatitis C virusCDS(1)..(750) 55atg tcg tac tac cat cac cat
cac cat cac gat tac gat atc cca acg 48Met Ser Tyr Tyr His His His
His His His Asp Tyr Asp Ile Pro Thr1 5 10
15acc gaa aac ctg tat ttt cag ggc gcc atg gat ccg gaa
ttc atg agc 96Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu
Phe Met Ser 20 25 30acg aat
cct aaa cct caa aga aaa acc aaa cgt aac acc aac cgt cgc 144Thr Asn
Pro Lys Pro Gln Arg Lys Thr Lys Arg Asn Thr Asn Arg Arg 35
40 45cca cag gac gtc aag ttc ccg ggt ggc ggt
cag atc gtt ggt gga gtt 192Pro Gln Asp Val Lys Phe Pro Gly Gly Gly
Gln Ile Val Gly Gly Val 50 55 60tac
ttg ttg ccg cgc agg ggc cct aga ttg ggt gtg cgc gcg acg agg 240Tyr
Leu Leu Pro Arg Arg Gly Pro Arg Leu Gly Val Arg Ala Thr Arg65
70 75 80aag act tcc gag cgg tcg
caa cct cga ggt aga cgt cag cct atc ccc 288Lys Thr Ser Glu Arg Ser
Gln Pro Arg Gly Arg Arg Gln Pro Ile Pro 85
90 95aag gca cgt cgg ccc gag ggc agg acc tgg gct cag
ccc ggg tac cct 336Lys Ala Arg Arg Pro Glu Gly Arg Thr Trp Ala Gln
Pro Gly Tyr Pro 100 105 110tgg
ccc ctc tat ggc aat gag ggt tgc ggg tgg gcg gga tgg ctc ctg 384Trp
Pro Leu Tyr Gly Asn Glu Gly Cys Gly Trp Ala Gly Trp Leu Leu 115
120 125tct ccc cgt ggc tct cgg cct agc tgg
ggc ccc aca gac ccc cgg cgt 432Ser Pro Arg Gly Ser Arg Pro Ser Trp
Gly Pro Thr Asp Pro Arg Arg 130 135
140agg tcg cgc aat ttg ggt aag gtc atc gat acc ctt acg tgc ggc ttc
480Arg Ser Arg Asn Leu Gly Lys Val Ile Asp Thr Leu Thr Cys Gly Phe145
150 155 160gcc gac ctc atg
ggg tac ata ccg ctc gtc ggc gcc cct ctt gga ggc 528Ala Asp Leu Met
Gly Tyr Ile Pro Leu Val Gly Ala Pro Leu Gly Gly 165
170 175gct gcc agg gcc ctg gcg cat ggc gtc cgg
gtt ctg gaa gac ggc gtg 576Ala Ala Arg Ala Leu Ala His Gly Val Arg
Val Leu Glu Asp Gly Val 180 185
190aac tat gca aca ggg aac ctt cct ggt tgc tct ttc tct atc ttc ctt
624Asn Tyr Ala Thr Gly Asn Leu Pro Gly Cys Ser Phe Ser Ile Phe Leu
195 200 205ctg gcc ctg ctc tct tgc ctg
act gtg ccc gct tca gcc gga cta gtg 672Leu Ala Leu Leu Ser Cys Leu
Thr Val Pro Ala Ser Ala Gly Leu Val 210 215
220cgg ccg ctt tcg aat cta gag cct gca gtc tcg agg cat gcg gta cca
720Arg Pro Leu Ser Asn Leu Glu Pro Ala Val Ser Arg His Ala Val Pro225
230 235 240agc ttg tcg aga
agt act aga gga tca taa 750Ser Leu Ser Arg
Ser Thr Arg Gly Ser 24556249PRTHepatitis C virus 56Met Ser
Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro Thr1 5
10 15Thr Glu Asn Leu Tyr Phe Gln Gly
Ala Met Asp Pro Glu Phe Met Ser 20 25
30Thr Asn Pro Lys Pro Gln Arg Lys Thr Lys Arg Asn Thr Asn Arg
Arg 35 40 45Pro Gln Asp Val Lys
Phe Pro Gly Gly Gly Gln Ile Val Gly Gly Val 50 55
60Tyr Leu Leu Pro Arg Arg Gly Pro Arg Leu Gly Val Arg Ala
Thr Arg65 70 75 80Lys
Thr Ser Glu Arg Ser Gln Pro Arg Gly Arg Arg Gln Pro Ile Pro
85 90 95Lys Ala Arg Arg Pro Glu Gly
Arg Thr Trp Ala Gln Pro Gly Tyr Pro 100 105
110Trp Pro Leu Tyr Gly Asn Glu Gly Cys Gly Trp Ala Gly Trp
Leu Leu 115 120 125Ser Pro Arg Gly
Ser Arg Pro Ser Trp Gly Pro Thr Asp Pro Arg Arg 130
135 140Arg Ser Arg Asn Leu Gly Lys Val Ile Asp Thr Leu
Thr Cys Gly Phe145 150 155
160Ala Asp Leu Met Gly Tyr Ile Pro Leu Val Gly Ala Pro Leu Gly Gly
165 170 175Ala Ala Arg Ala Leu
Ala His Gly Val Arg Val Leu Glu Asp Gly Val 180
185 190Asn Tyr Ala Thr Gly Asn Leu Pro Gly Cys Ser Phe
Ser Ile Phe Leu 195 200 205Leu Ala
Leu Leu Ser Cys Leu Thr Val Pro Ala Ser Ala Gly Leu Val 210
215 220Arg Pro Leu Ser Asn Leu Glu Pro Ala Val Ser
Arg His Ala Val Pro225 230 235
240Ser Leu Ser Arg Ser Thr Arg Gly Ser
245571422DNAArtificialHepatitis C virus plus murine 57atg tcg tac tac cat
cac cat cac cat cac gat tac gat atc cca acg 48Met Ser Tyr Tyr His
His His His His His Asp Tyr Asp Ile Pro Thr1 5
10 15acc gaa aac ctg tat ttt cag ggc gcc atg gat
ccg gaa ttc atg agc 96Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp
Pro Glu Phe Met Ser 20 25
30acg aat cct aaa cct caa aga aaa acc aaa cgt aac acc aac cgt cgc
144Thr Asn Pro Lys Pro Gln Arg Lys Thr Lys Arg Asn Thr Asn Arg Arg
35 40 45cca cag gac gtc aag ttc ccg ggt
ggc ggt cag atc gtt ggt gga gtt 192Pro Gln Asp Val Lys Phe Pro Gly
Gly Gly Gln Ile Val Gly Gly Val 50 55
60tac ttg ttg ccg cgc agg ggc cct aga ttg ggt gtg cgc gcg acg agg
240Tyr Leu Leu Pro Arg Arg Gly Pro Arg Leu Gly Val Arg Ala Thr Arg65
70 75 80aag act tcc gag cgg
tcg caa cct cga ggt aga cgt cag cct atc ccc 288Lys Thr Ser Glu Arg
Ser Gln Pro Arg Gly Arg Arg Gln Pro Ile Pro 85
90 95aag gca cgt cgg ccc gag ggc agg acc tgg gct
cag ccc ggg tac cct 336Lys Ala Arg Arg Pro Glu Gly Arg Thr Trp Ala
Gln Pro Gly Tyr Pro 100 105
110tgg ccc ctc tat ggc aat gag ggt tgc ggg tgg gcg gga tgg ctc ctg
384Trp Pro Leu Tyr Gly Asn Glu Gly Cys Gly Trp Ala Gly Trp Leu Leu
115 120 125tct ccc cgt ggc tct cgg cct
agc tgg ggc ccc aca gac ccc cgg cgt 432Ser Pro Arg Gly Ser Arg Pro
Ser Trp Gly Pro Thr Asp Pro Arg Arg 130 135
140agg tcg cgc aat ttg ggt aag gtc atc gat acc ctt acg tgc ggc ttc
480Arg Ser Arg Asn Leu Gly Lys Val Ile Asp Thr Leu Thr Cys Gly Phe145
150 155 160gcc gac ctc atg
ggg tac ata ccg ctc gtc ggc gcc cct ctt gga ggc 528Ala Asp Leu Met
Gly Tyr Ile Pro Leu Val Gly Ala Pro Leu Gly Gly 165
170 175gct gcc agg gcc ctg gcg cat ggc gtc cgg
gtt ctg gaa gac ggc gtg 576Ala Ala Arg Ala Leu Ala His Gly Val Arg
Val Leu Glu Asp Gly Val 180 185
190aac tat gca aca ggg aac ctt cct ggt tgc tct ttc tct atc ttc ctt
624Asn Tyr Ala Thr Gly Asn Leu Pro Gly Cys Ser Phe Ser Ile Phe Leu
195 200 205ctg gcc ctg ctc tct tgc ctg
act gtg ccc gct tca gcc gga cta gtg 672Leu Ala Leu Leu Ser Cys Leu
Thr Val Pro Ala Ser Ala Gly Leu Val 210 215
220cgg ccg caa ggc ggc gga tcc gtg gac aag aaa att gtg ccc agg gat
720Arg Pro Gln Gly Gly Gly Ser Val Asp Lys Lys Ile Val Pro Arg Asp225
230 235 240tgt ggt tgt aag
cct tgc ata tgt aca gtc cca gaa gta tca tct gtc 768Cys Gly Cys Lys
Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val 245
250 255ttc atc ttc ccc cca aag ccc aag gat gtg
ctc acc att act ctg act 816Phe Ile Phe Pro Pro Lys Pro Lys Asp Val
Leu Thr Ile Thr Leu Thr 260 265
270cct aag gtc acg tgt gtt gtg gta gac atc agc aag gat gat ccc gag
864Pro Lys Val Thr Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu
275 280 285gtc cag ttc agc tgg ttt gta
gat gat gtg gag gtg cac aca gct cag 912Val Gln Phe Ser Trp Phe Val
Asp Asp Val Glu Val His Thr Ala Gln 290 295
300acg caa ccc cgg gag gag cag ttc aac agc act ttc cgc tca gtc agt
960Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser305
310 315 320gaa ctt ccc atc
atg cac cag gac tgg ctc aat ggc aag gag ttc aaa 1008Glu Leu Pro Ile
Met His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys 325
330 335tgc agg gtc aac agt gca gct ttc cct gcc
ccc atc gag aaa acc atc 1056Cys Arg Val Asn Ser Ala Ala Phe Pro Ala
Pro Ile Glu Lys Thr Ile 340 345
350tcc aaa acc aaa ggc aga ccg aag gct cca cag gtg tac acc att cca
1104Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro
355 360 365cct ccc aag gag cag atg gcc
aag gat aaa gtc agt ctg acc tgc atg 1152Pro Pro Lys Glu Gln Met Ala
Lys Asp Lys Val Ser Leu Thr Cys Met 370 375
380ata aca gac ttc ttc cct gaa gac att act gtg gag tgg cag tgg aat
1200Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn385
390 395 400ggg cag cca gcg
gag aac tac aag aac act cag ccc atc atg gac aca 1248Gly Gln Pro Ala
Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr 405
410 415gat ggc tct tac ttc gtc tac agc aag ctc
aat gtg cag aag agc aac 1296Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu
Asn Val Gln Lys Ser Asn 420 425
430tgg gag gca gga aat act ttc acc tgc tct gtg tta cat gag ggc ctg
1344Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu
435 440 445cac aac cac cat act gag aag
agc ctc tcc cac tct cct ggg ctg caa 1392His Asn His His Thr Glu Lys
Ser Leu Ser His Ser Pro Gly Leu Gln 450 455
460agc ttg tcg aga agt act aga gga tca taa
1422Ser Leu Ser Arg Ser Thr Arg Gly Ser465
47058473PRTArtificialSynthetic Construct 58Met Ser Tyr Tyr His His His
His His His Asp Tyr Asp Ile Pro Thr1 5 10
15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu
Phe Met Ser 20 25 30Thr Asn
Pro Lys Pro Gln Arg Lys Thr Lys Arg Asn Thr Asn Arg Arg 35
40 45Pro Gln Asp Val Lys Phe Pro Gly Gly Gly
Gln Ile Val Gly Gly Val 50 55 60Tyr
Leu Leu Pro Arg Arg Gly Pro Arg Leu Gly Val Arg Ala Thr Arg65
70 75 80Lys Thr Ser Glu Arg Ser
Gln Pro Arg Gly Arg Arg Gln Pro Ile Pro 85
90 95Lys Ala Arg Arg Pro Glu Gly Arg Thr Trp Ala Gln
Pro Gly Tyr Pro 100 105 110Trp
Pro Leu Tyr Gly Asn Glu Gly Cys Gly Trp Ala Gly Trp Leu Leu 115
120 125Ser Pro Arg Gly Ser Arg Pro Ser Trp
Gly Pro Thr Asp Pro Arg Arg 130 135
140Arg Ser Arg Asn Leu Gly Lys Val Ile Asp Thr Leu Thr Cys Gly Phe145
150 155 160Ala Asp Leu Met
Gly Tyr Ile Pro Leu Val Gly Ala Pro Leu Gly Gly 165
170 175Ala Ala Arg Ala Leu Ala His Gly Val Arg
Val Leu Glu Asp Gly Val 180 185
190Asn Tyr Ala Thr Gly Asn Leu Pro Gly Cys Ser Phe Ser Ile Phe Leu
195 200 205Leu Ala Leu Leu Ser Cys Leu
Thr Val Pro Ala Ser Ala Gly Leu Val 210 215
220Arg Pro Gln Gly Gly Gly Ser Val Asp Lys Lys Ile Val Pro Arg
Asp225 230 235 240Cys Gly
Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val
245 250 255Phe Ile Phe Pro Pro Lys Pro
Lys Asp Val Leu Thr Ile Thr Leu Thr 260 265
270Pro Lys Val Thr Cys Val Val Val Asp Ile Ser Lys Asp Asp
Pro Glu 275 280 285Val Gln Phe Ser
Trp Phe Val Asp Asp Val Glu Val His Thr Ala Gln 290
295 300Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe
Arg Ser Val Ser305 310 315
320Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys
325 330 335Cys Arg Val Asn Ser
Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile 340
345 350Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln Val
Tyr Thr Ile Pro 355 360 365Pro Pro
Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys Met 370
375 380Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val
Glu Trp Gln Trp Asn385 390 395
400Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr
405 410 415Asp Gly Ser Tyr
Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn 420
425 430Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val
Leu His Glu Gly Leu 435 440 445His
Asn His His Thr Glu Lys Ser Leu Ser His Ser Pro Gly Leu Gln 450
455 460Ser Leu Ser Arg Ser Thr Arg Gly Ser465
47059708DNAHepatitis C virusCDS(1)..(708) 59atg tcg tac tac
cat cac cat cac cat cac gat tac gat atc cca acg 48Met Ser Tyr Tyr
His His His His His His Asp Tyr Asp Ile Pro Thr1 5
10 15acc gaa aac ctg tat ttt cag ggc gcc atg
gat ccg gaa ttc atg agc 96Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met
Asp Pro Glu Phe Met Ser 20 25
30acg aat cct aaa cct caa aga aaa acc aaa cgt aac acc aac cgt cgc
144Thr Asn Pro Lys Pro Gln Arg Lys Thr Lys Arg Asn Thr Asn Arg Arg
35 40 45cca cag gac gtc aag ttc ccg ggt
ggc ggt cag atc gtt ggt gga gtt 192Pro Gln Asp Val Lys Phe Pro Gly
Gly Gly Gln Ile Val Gly Gly Val 50 55
60tac ttg ttg ccg cgc agg ggc cct aga ttg ggt gtg cgc gcg acg agg
240Tyr Leu Leu Pro Arg Arg Gly Pro Arg Leu Gly Val Arg Ala Thr Arg65
70 75 80aag act tcc gag cgg
tcg caa cct cga ggt aga cgt cag cct atc ccc 288Lys Thr Ser Glu Arg
Ser Gln Pro Arg Gly Arg Arg Gln Pro Ile Pro 85
90 95aag gca cgt cgg ccc gag ggc agg acc tgg gct
cag ccc ggg tac cct 336Lys Ala Arg Arg Pro Glu Gly Arg Thr Trp Ala
Gln Pro Gly Tyr Pro 100 105
110tgg ccc ctc tat ggc aat gag ggt tgc ggg tgg gcg gga tgg ctc ctg
384Trp Pro Leu Tyr Gly Asn Glu Gly Cys Gly Trp Ala Gly Trp Leu Leu
115 120 125tct ccc cgt ggc tct cgg cct
agc tgg ggc ccc aca gac ccc cgg cgt 432Ser Pro Arg Gly Ser Arg Pro
Ser Trp Gly Pro Thr Asp Pro Arg Arg 130 135
140agg tcg cgc aat ttg ggt aag gtc atc gat acc ctt acg tgc ggc ttc
480Arg Ser Arg Asn Leu Gly Lys Val Ile Asp Thr Leu Thr Cys Gly Phe145
150 155 160gcc gac ctc atg
ggg tac ata ccg ctc gtc ggc gcc cct ctt gga ggc 528Ala Asp Leu Met
Gly Tyr Ile Pro Leu Val Gly Ala Pro Leu Gly Gly 165
170 175gct gcc agg gcc ctg gcg cat ggc gtc cgg
gtt ctg gaa gac ggc gtg 576Ala Ala Arg Ala Leu Ala His Gly Val Arg
Val Leu Glu Asp Gly Val 180 185
190aac tat gca aca ggg aac ctt cct ggt tgc tct ttc tct atc ttc gga
624Asn Tyr Ala Thr Gly Asn Leu Pro Gly Cys Ser Phe Ser Ile Phe Gly
195 200 205cta gtg cgg ccg ctt tcg aat
cta gag cct gca gtc tcg agg cat gcg 672Leu Val Arg Pro Leu Ser Asn
Leu Glu Pro Ala Val Ser Arg His Ala 210 215
220gta cca agc ttg tcg aga agt act aga gga tca taa
708Val Pro Ser Leu Ser Arg Ser Thr Arg Gly Ser225 230
23560235PRTHepatitis C virus 60Met Ser Tyr Tyr His His His
His His His Asp Tyr Asp Ile Pro Thr1 5 10
15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu
Phe Met Ser 20 25 30Thr Asn
Pro Lys Pro Gln Arg Lys Thr Lys Arg Asn Thr Asn Arg Arg 35
40 45Pro Gln Asp Val Lys Phe Pro Gly Gly Gly
Gln Ile Val Gly Gly Val 50 55 60Tyr
Leu Leu Pro Arg Arg Gly Pro Arg Leu Gly Val Arg Ala Thr Arg65
70 75 80Lys Thr Ser Glu Arg Ser
Gln Pro Arg Gly Arg Arg Gln Pro Ile Pro 85
90 95Lys Ala Arg Arg Pro Glu Gly Arg Thr Trp Ala Gln
Pro Gly Tyr Pro 100 105 110Trp
Pro Leu Tyr Gly Asn Glu Gly Cys Gly Trp Ala Gly Trp Leu Leu 115
120 125Ser Pro Arg Gly Ser Arg Pro Ser Trp
Gly Pro Thr Asp Pro Arg Arg 130 135
140Arg Ser Arg Asn Leu Gly Lys Val Ile Asp Thr Leu Thr Cys Gly Phe145
150 155 160Ala Asp Leu Met
Gly Tyr Ile Pro Leu Val Gly Ala Pro Leu Gly Gly 165
170 175Ala Ala Arg Ala Leu Ala His Gly Val Arg
Val Leu Glu Asp Gly Val 180 185
190Asn Tyr Ala Thr Gly Asn Leu Pro Gly Cys Ser Phe Ser Ile Phe Gly
195 200 205Leu Val Arg Pro Leu Ser Asn
Leu Glu Pro Ala Val Ser Arg His Ala 210 215
220Val Pro Ser Leu Ser Arg Ser Thr Arg Gly Ser225
230 235611380DNAArtificialHepatitis C virus plus murine
61atg tcg tac tac cat cac cat cac cat cac gat tac gat atc cca acg
48Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro Thr1
5 10 15acc gaa aac ctg tat ttt
cag ggc gcc atg gat ccg gaa ttc atg agc 96Thr Glu Asn Leu Tyr Phe
Gln Gly Ala Met Asp Pro Glu Phe Met Ser 20 25
30acg aat cct aaa cct caa aga aaa acc aaa cgt aac acc
aac cgt cgc 144Thr Asn Pro Lys Pro Gln Arg Lys Thr Lys Arg Asn Thr
Asn Arg Arg 35 40 45cca cag gac
gtc aag ttc ccg ggt ggc ggt cag atc gtt ggt gga gtt 192Pro Gln Asp
Val Lys Phe Pro Gly Gly Gly Gln Ile Val Gly Gly Val 50
55 60tac ttg ttg ccg cgc agg ggc cct aga ttg ggt gtg
cgc gcg acg agg 240Tyr Leu Leu Pro Arg Arg Gly Pro Arg Leu Gly Val
Arg Ala Thr Arg65 70 75
80aag act tcc gag cgg tcg caa cct cga ggt aga cgt cag cct atc ccc
288Lys Thr Ser Glu Arg Ser Gln Pro Arg Gly Arg Arg Gln Pro Ile Pro
85 90 95aag gca cgt cgg ccc gag
ggc agg acc tgg gct cag ccc ggg tac cct 336Lys Ala Arg Arg Pro Glu
Gly Arg Thr Trp Ala Gln Pro Gly Tyr Pro 100
105 110tgg ccc ctc tat ggc aat gag ggt tgc ggg tgg gcg
gga tgg ctc ctg 384Trp Pro Leu Tyr Gly Asn Glu Gly Cys Gly Trp Ala
Gly Trp Leu Leu 115 120 125tct ccc
cgt ggc tct cgg cct agc tgg ggc ccc aca gac ccc cgg cgt 432Ser Pro
Arg Gly Ser Arg Pro Ser Trp Gly Pro Thr Asp Pro Arg Arg 130
135 140agg tcg cgc aat ttg ggt aag gtc atc gat acc
ctt acg tgc ggc ttc 480Arg Ser Arg Asn Leu Gly Lys Val Ile Asp Thr
Leu Thr Cys Gly Phe145 150 155
160gcc gac ctc atg ggg tac ata ccg ctc gtc ggc gcc cct ctt gga ggc
528Ala Asp Leu Met Gly Tyr Ile Pro Leu Val Gly Ala Pro Leu Gly Gly
165 170 175gct gcc agg gcc ctg
gcg cat ggc gtc cgg gtt ctg gaa gac ggc gtg 576Ala Ala Arg Ala Leu
Ala His Gly Val Arg Val Leu Glu Asp Gly Val 180
185 190aac tat gca aca ggg aac ctt cct ggt tgc tct ttc
tct atc ttc gga 624Asn Tyr Ala Thr Gly Asn Leu Pro Gly Cys Ser Phe
Ser Ile Phe Gly 195 200 205cta gtg
cgg ccg caa ggc ggc gga tcc gtg gac aag aaa att gtg ccc 672Leu Val
Arg Pro Gln Gly Gly Gly Ser Val Asp Lys Lys Ile Val Pro 210
215 220agg gat tgt ggt tgt aag cct tgc ata tgt aca
gtc cca gaa gta tca 720Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr
Val Pro Glu Val Ser225 230 235
240tct gtc ttc atc ttc ccc cca aag ccc aag gat gtg ctc acc att act
768Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr
245 250 255ctg act cct aag gtc
acg tgt gtt gtg gta gac atc agc aag gat gat 816Leu Thr Pro Lys Val
Thr Cys Val Val Val Asp Ile Ser Lys Asp Asp 260
265 270ccc gag gtc cag ttc agc tgg ttt gta gat gat gtg
gag gtg cac aca 864Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val
Glu Val His Thr 275 280 285gct cag
acg caa ccc cgg gag gag cag ttc aac agc act ttc cgc tca 912Ala Gln
Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser 290
295 300gtc agt gaa ctt ccc atc atg cac cag gac tgg
ctc aat ggc aag gag 960Val Ser Glu Leu Pro Ile Met His Gln Asp Trp
Leu Asn Gly Lys Glu305 310 315
320ttc aaa tgc agg gtc aac agt gca gct ttc cct gcc ccc atc gag aaa
1008Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys
325 330 335acc atc tcc aaa acc
aaa ggc aga ccg aag gct cca cag gtg tac acc 1056Thr Ile Ser Lys Thr
Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr 340
345 350att cca cct ccc aag gag cag atg gcc aag gat aaa
gtc agt ctg acc 1104Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys
Val Ser Leu Thr 355 360 365tgc atg
ata aca gac ttc ttc cct gaa gac att act gtg gag tgg cag 1152Cys Met
Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln 370
375 380tgg aat ggg cag cca gcg gag aac tac aag aac
act cag ccc atc atg 1200Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn
Thr Gln Pro Ile Met385 390 395
400gac aca gat ggc tct tac ttc gtc tac agc aag ctc aat gtg cag aag
1248Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys
405 410 415agc aac tgg gag gca
gga aat act ttc acc tgc tct gtg tta cat gag 1296Ser Asn Trp Glu Ala
Gly Asn Thr Phe Thr Cys Ser Val Leu His Glu 420
425 430ggc ctg cac aac cac cat act gag aag agc ctc tcc
cac tct cct ggg 1344Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser
His Ser Pro Gly 435 440 445ctg caa
agc ttg tcg aga agt act aga gga tca taa 1380Leu Gln
Ser Leu Ser Arg Ser Thr Arg Gly Ser 450
45562459PRTArtificialSynthetic Construct 62Met Ser Tyr Tyr His His His
His His His Asp Tyr Asp Ile Pro Thr1 5 10
15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu
Phe Met Ser 20 25 30Thr Asn
Pro Lys Pro Gln Arg Lys Thr Lys Arg Asn Thr Asn Arg Arg 35
40 45Pro Gln Asp Val Lys Phe Pro Gly Gly Gly
Gln Ile Val Gly Gly Val 50 55 60Tyr
Leu Leu Pro Arg Arg Gly Pro Arg Leu Gly Val Arg Ala Thr Arg65
70 75 80Lys Thr Ser Glu Arg Ser
Gln Pro Arg Gly Arg Arg Gln Pro Ile Pro 85
90 95Lys Ala Arg Arg Pro Glu Gly Arg Thr Trp Ala Gln
Pro Gly Tyr Pro 100 105 110Trp
Pro Leu Tyr Gly Asn Glu Gly Cys Gly Trp Ala Gly Trp Leu Leu 115
120 125Ser Pro Arg Gly Ser Arg Pro Ser Trp
Gly Pro Thr Asp Pro Arg Arg 130 135
140Arg Ser Arg Asn Leu Gly Lys Val Ile Asp Thr Leu Thr Cys Gly Phe145
150 155 160Ala Asp Leu Met
Gly Tyr Ile Pro Leu Val Gly Ala Pro Leu Gly Gly 165
170 175Ala Ala Arg Ala Leu Ala His Gly Val Arg
Val Leu Glu Asp Gly Val 180 185
190Asn Tyr Ala Thr Gly Asn Leu Pro Gly Cys Ser Phe Ser Ile Phe Gly
195 200 205Leu Val Arg Pro Gln Gly Gly
Gly Ser Val Asp Lys Lys Ile Val Pro 210 215
220Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val
Ser225 230 235 240Ser Val
Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr
245 250 255Leu Thr Pro Lys Val Thr Cys
Val Val Val Asp Ile Ser Lys Asp Asp 260 265
270Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val
His Thr 275 280 285Ala Gln Thr Gln
Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser 290
295 300Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu
Asn Gly Lys Glu305 310 315
320Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys
325 330 335Thr Ile Ser Lys Thr
Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr 340
345 350Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys
Val Ser Leu Thr 355 360 365Cys Met
Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln 370
375 380Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn
Thr Gln Pro Ile Met385 390 395
400Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys
405 410 415Ser Asn Trp Glu
Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His Glu 420
425 430Gly Leu His Asn His His Thr Glu Lys Ser Leu
Ser His Ser Pro Gly 435 440 445Leu
Gln Ser Leu Ser Arg Ser Thr Arg Gly Ser 450
455631518DNAHepatitis C virusCDS(1)..(1518) 63atg tcg tac tac cat cac cat
cac cat cac gat tac gat atc cca acg 48Met Ser Tyr Tyr His His His
His His His Asp Tyr Asp Ile Pro Thr1 5 10
15acc gaa aac ctg tat ttt cag ggc gcc atg gat ccg gaa
ttc tcc ggt 96Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu
Phe Ser Gly 20 25 30tcc tgg
cta agg gac atc tgg gac tgg ata tgc gag gtg ctg agc gac 144Ser Trp
Leu Arg Asp Ile Trp Asp Trp Ile Cys Glu Val Leu Ser Asp 35
40 45ttt aag acc tgg ctg aaa gcc aag ctc atg
cca caa ctg cct ggg att 192Phe Lys Thr Trp Leu Lys Ala Lys Leu Met
Pro Gln Leu Pro Gly Ile 50 55 60ccc
ttt gtg tcc tgc cag cgc ggg tat agg ggg gtc tgg cga gga gac 240Pro
Phe Val Ser Cys Gln Arg Gly Tyr Arg Gly Val Trp Arg Gly Asp65
70 75 80ggc att atg cac act cgc
tgc cac tgt gga gct gag atc act gga cat 288Gly Ile Met His Thr Arg
Cys His Cys Gly Ala Glu Ile Thr Gly His 85
90 95gtc aaa aac ggg acg atg agg atc gtc ggt cct agg
acc tgc agg aac 336Val Lys Asn Gly Thr Met Arg Ile Val Gly Pro Arg
Thr Cys Arg Asn 100 105 110atg
tgg agt ggg acg ttc ccc att aac gcc tac acc acg ggc ccc tgt 384Met
Trp Ser Gly Thr Phe Pro Ile Asn Ala Tyr Thr Thr Gly Pro Cys 115
120 125act ccc ctt cct gcg ccg aac tat aag
ttc gcg ctg tgg agg gtg tct 432Thr Pro Leu Pro Ala Pro Asn Tyr Lys
Phe Ala Leu Trp Arg Val Ser 130 135
140gca gag gaa tac gtg gag ata agg cgg gtg ggg gac ttc cac tac gta
480Ala Glu Glu Tyr Val Glu Ile Arg Arg Val Gly Asp Phe His Tyr Val145
150 155 160tcg ggt atg act
act gac aat ctt aaa tgc ccg tgc cag atc cca tcg 528Ser Gly Met Thr
Thr Asp Asn Leu Lys Cys Pro Cys Gln Ile Pro Ser 165
170 175ccc gaa ttt ttc aca gaa ttg gac ggg gtg
cgc cta cac agg ttt gcg 576Pro Glu Phe Phe Thr Glu Leu Asp Gly Val
Arg Leu His Arg Phe Ala 180 185
190ccc cct tgc aag ccc ttg ctg cgg gag gag gta tca ttc aga gta gga
624Pro Pro Cys Lys Pro Leu Leu Arg Glu Glu Val Ser Phe Arg Val Gly
195 200 205ctc cac gag tac ccg gtg ggg
tcg caa tta cct tgc gag ccc gaa ccg 672Leu His Glu Tyr Pro Val Gly
Ser Gln Leu Pro Cys Glu Pro Glu Pro 210 215
220gac gta gcc gtg ttg acg tcc atg ctc act gat ccc tcc cat ata aca
720Asp Val Ala Val Leu Thr Ser Met Leu Thr Asp Pro Ser His Ile Thr225
230 235 240gca gag gcg gcc
ggg aga agg ttg gcg aga ggg tca ccc cct tct atg 768Ala Glu Ala Ala
Gly Arg Arg Leu Ala Arg Gly Ser Pro Pro Ser Met 245
250 255gcc agc tcc tcg gct agc cag ctg tcc gct
cca tct ctc aag gca act 816Ala Ser Ser Ser Ala Ser Gln Leu Ser Ala
Pro Ser Leu Lys Ala Thr 260 265
270tgc acc gcc aac cat gac tcc cct gac gcc gag ctc ata gag gct aac
864Cys Thr Ala Asn His Asp Ser Pro Asp Ala Glu Leu Ile Glu Ala Asn
275 280 285ctc ctg tgg agg cag gag atg
ggc ggc aac atc acc agg gtt gag tca 912Leu Leu Trp Arg Gln Glu Met
Gly Gly Asn Ile Thr Arg Val Glu Ser 290 295
300gag aac aaa gtg gtg att ctg gac tcc ttc gat ccg ctt gtg gca gag
960Glu Asn Lys Val Val Ile Leu Asp Ser Phe Asp Pro Leu Val Ala Glu305
310 315 320gag gat gag cgg
gag gtc tcc gta cct gca gaa att ctg cgg aag tct 1008Glu Asp Glu Arg
Glu Val Ser Val Pro Ala Glu Ile Leu Arg Lys Ser 325
330 335cgg aga ttc gcc cgg gcc ctg ccc gtc tgg
gcg cgg ccg gac tac aac 1056Arg Arg Phe Ala Arg Ala Leu Pro Val Trp
Ala Arg Pro Asp Tyr Asn 340 345
350ccc ccg cta gta gag acg tgg aaa aag cct gac tac gaa cca cct gtg
1104Pro Pro Leu Val Glu Thr Trp Lys Lys Pro Asp Tyr Glu Pro Pro Val
355 360 365gtc cat ggc tgc ccg cta cca
cct cca cgg tcc cct cct gtg cct ccg 1152Val His Gly Cys Pro Leu Pro
Pro Pro Arg Ser Pro Pro Val Pro Pro 370 375
380cct cgg aaa aag cgt acg gtg gtc ctc acc gaa tca acc cta tct act
1200Pro Arg Lys Lys Arg Thr Val Val Leu Thr Glu Ser Thr Leu Ser Thr385
390 395 400gcc ttg gcc gag
ctt gcc acc aaa agt ttt ggc agc tcc tca act tcc 1248Ala Leu Ala Glu
Leu Ala Thr Lys Ser Phe Gly Ser Ser Ser Thr Ser 405
410 415ggc att acg ggc gac aat acg aca aca tcc
tct gag ccc gcc cct tct 1296Gly Ile Thr Gly Asp Asn Thr Thr Thr Ser
Ser Glu Pro Ala Pro Ser 420 425
430ggc tgc ccc ccc gac tcc gac gtt gag tcc tat tct tcc atg ccc ccc
1344Gly Cys Pro Pro Asp Ser Asp Val Glu Ser Tyr Ser Ser Met Pro Pro
435 440 445ctg gag ggg gag cct ggg gat
ccg gat ctc agc gac ggg tca tgg tcg 1392Leu Glu Gly Glu Pro Gly Asp
Pro Asp Leu Ser Asp Gly Ser Trp Ser 450 455
460acg gtc agt agt ggg gcc gac acg gaa gat gtc gtg tgc gga cta gtg
1440Thr Val Ser Ser Gly Ala Asp Thr Glu Asp Val Val Cys Gly Leu Val465
470 475 480cgg ccg ctt tcg
aat cta gag cct gca gtc tcg agg cat gcg gta cca 1488Arg Pro Leu Ser
Asn Leu Glu Pro Ala Val Ser Arg His Ala Val Pro 485
490 495agc ttg tcg aga agt act aga gga tca taa
1518Ser Leu Ser Arg Ser Thr Arg Gly Ser
500 50564505PRTHepatitis C virus 64Met Ser Tyr Tyr His
His His His His His Asp Tyr Asp Ile Pro Thr1 5
10 15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp
Pro Glu Phe Ser Gly 20 25
30Ser Trp Leu Arg Asp Ile Trp Asp Trp Ile Cys Glu Val Leu Ser Asp
35 40 45Phe Lys Thr Trp Leu Lys Ala Lys
Leu Met Pro Gln Leu Pro Gly Ile 50 55
60Pro Phe Val Ser Cys Gln Arg Gly Tyr Arg Gly Val Trp Arg Gly Asp65
70 75 80Gly Ile Met His Thr
Arg Cys His Cys Gly Ala Glu Ile Thr Gly His 85
90 95Val Lys Asn Gly Thr Met Arg Ile Val Gly Pro
Arg Thr Cys Arg Asn 100 105
110Met Trp Ser Gly Thr Phe Pro Ile Asn Ala Tyr Thr Thr Gly Pro Cys
115 120 125Thr Pro Leu Pro Ala Pro Asn
Tyr Lys Phe Ala Leu Trp Arg Val Ser 130 135
140Ala Glu Glu Tyr Val Glu Ile Arg Arg Val Gly Asp Phe His Tyr
Val145 150 155 160Ser Gly
Met Thr Thr Asp Asn Leu Lys Cys Pro Cys Gln Ile Pro Ser
165 170 175Pro Glu Phe Phe Thr Glu Leu
Asp Gly Val Arg Leu His Arg Phe Ala 180 185
190Pro Pro Cys Lys Pro Leu Leu Arg Glu Glu Val Ser Phe Arg
Val Gly 195 200 205Leu His Glu Tyr
Pro Val Gly Ser Gln Leu Pro Cys Glu Pro Glu Pro 210
215 220Asp Val Ala Val Leu Thr Ser Met Leu Thr Asp Pro
Ser His Ile Thr225 230 235
240Ala Glu Ala Ala Gly Arg Arg Leu Ala Arg Gly Ser Pro Pro Ser Met
245 250 255Ala Ser Ser Ser Ala
Ser Gln Leu Ser Ala Pro Ser Leu Lys Ala Thr 260
265 270Cys Thr Ala Asn His Asp Ser Pro Asp Ala Glu Leu
Ile Glu Ala Asn 275 280 285Leu Leu
Trp Arg Gln Glu Met Gly Gly Asn Ile Thr Arg Val Glu Ser 290
295 300Glu Asn Lys Val Val Ile Leu Asp Ser Phe Asp
Pro Leu Val Ala Glu305 310 315
320Glu Asp Glu Arg Glu Val Ser Val Pro Ala Glu Ile Leu Arg Lys Ser
325 330 335Arg Arg Phe Ala
Arg Ala Leu Pro Val Trp Ala Arg Pro Asp Tyr Asn 340
345 350Pro Pro Leu Val Glu Thr Trp Lys Lys Pro Asp
Tyr Glu Pro Pro Val 355 360 365Val
His Gly Cys Pro Leu Pro Pro Pro Arg Ser Pro Pro Val Pro Pro 370
375 380Pro Arg Lys Lys Arg Thr Val Val Leu Thr
Glu Ser Thr Leu Ser Thr385 390 395
400Ala Leu Ala Glu Leu Ala Thr Lys Ser Phe Gly Ser Ser Ser Thr
Ser 405 410 415Gly Ile Thr
Gly Asp Asn Thr Thr Thr Ser Ser Glu Pro Ala Pro Ser 420
425 430Gly Cys Pro Pro Asp Ser Asp Val Glu Ser
Tyr Ser Ser Met Pro Pro 435 440
445Leu Glu Gly Glu Pro Gly Asp Pro Asp Leu Ser Asp Gly Ser Trp Ser 450
455 460Thr Val Ser Ser Gly Ala Asp Thr
Glu Asp Val Val Cys Gly Leu Val465 470
475 480Arg Pro Leu Ser Asn Leu Glu Pro Ala Val Ser Arg
His Ala Val Pro 485 490
495Ser Leu Ser Arg Ser Thr Arg Gly Ser 500
505652190DNAArtificialHepatitis C virus plus murine 65atg tcg tac tac cat
cac cat cac cat cac gat tac gat atc cca acg 48Met Ser Tyr Tyr His
His His His His His Asp Tyr Asp Ile Pro Thr1 5
10 15acc gaa aac ctg tat ttt cag ggc gcc atg gat
ccg gaa ttc tcc ggt 96Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp
Pro Glu Phe Ser Gly 20 25
30tcc tgg cta agg gac atc tgg gac tgg ata tgc gag gtg ctg agc gac
144Ser Trp Leu Arg Asp Ile Trp Asp Trp Ile Cys Glu Val Leu Ser Asp
35 40 45ttt aag acc tgg ctg aaa gcc aag
ctc atg cca caa ctg cct ggg att 192Phe Lys Thr Trp Leu Lys Ala Lys
Leu Met Pro Gln Leu Pro Gly Ile 50 55
60ccc ttt gtg tcc tgc cag cgc ggg tat agg ggg gtc tgg cga gga gac
240Pro Phe Val Ser Cys Gln Arg Gly Tyr Arg Gly Val Trp Arg Gly Asp65
70 75 80ggc att atg cac act
cgc tgc cac tgt gga gct gag atc act gga cat 288Gly Ile Met His Thr
Arg Cys His Cys Gly Ala Glu Ile Thr Gly His 85
90 95gtc aaa aac ggg acg atg agg atc gtc ggt cct
agg acc tgc agg aac 336Val Lys Asn Gly Thr Met Arg Ile Val Gly Pro
Arg Thr Cys Arg Asn 100 105
110atg tgg agt ggg acg ttc ccc att aac gcc tac acc acg ggc ccc tgt
384Met Trp Ser Gly Thr Phe Pro Ile Asn Ala Tyr Thr Thr Gly Pro Cys
115 120 125act ccc ctt cct gcg ccg aac
tat aag ttc gcg ctg tgg agg gtg tct 432Thr Pro Leu Pro Ala Pro Asn
Tyr Lys Phe Ala Leu Trp Arg Val Ser 130 135
140gca gag gaa tac gtg gag ata agg cgg gtg ggg gac ttc cac tac gta
480Ala Glu Glu Tyr Val Glu Ile Arg Arg Val Gly Asp Phe His Tyr Val145
150 155 160tcg ggt atg act
act gac aat ctt aaa tgc ccg tgc cag atc cca tcg 528Ser Gly Met Thr
Thr Asp Asn Leu Lys Cys Pro Cys Gln Ile Pro Ser 165
170 175ccc gaa ttt ttc aca gaa ttg gac ggg gtg
cgc cta cac agg ttt gcg 576Pro Glu Phe Phe Thr Glu Leu Asp Gly Val
Arg Leu His Arg Phe Ala 180 185
190ccc cct tgc aag ccc ttg ctg cgg gag gag gta tca ttc aga gta gga
624Pro Pro Cys Lys Pro Leu Leu Arg Glu Glu Val Ser Phe Arg Val Gly
195 200 205ctc cac gag tac ccg gtg ggg
tcg caa tta cct tgc gag ccc gaa ccg 672Leu His Glu Tyr Pro Val Gly
Ser Gln Leu Pro Cys Glu Pro Glu Pro 210 215
220gac gta gcc gtg ttg acg tcc atg ctc act gat ccc tcc cat ata aca
720Asp Val Ala Val Leu Thr Ser Met Leu Thr Asp Pro Ser His Ile Thr225
230 235 240gca gag gcg gcc
ggg aga agg ttg gcg aga ggg tca ccc cct tct atg 768Ala Glu Ala Ala
Gly Arg Arg Leu Ala Arg Gly Ser Pro Pro Ser Met 245
250 255gcc agc tcc tcg gct agc cag ctg tcc gct
cca tct ctc aag gca act 816Ala Ser Ser Ser Ala Ser Gln Leu Ser Ala
Pro Ser Leu Lys Ala Thr 260 265
270tgc acc gcc aac cat gac tcc cct gac gcc gag ctc ata gag gct aac
864Cys Thr Ala Asn His Asp Ser Pro Asp Ala Glu Leu Ile Glu Ala Asn
275 280 285ctc ctg tgg agg cag gag atg
ggc ggc aac atc acc agg gtt gag tca 912Leu Leu Trp Arg Gln Glu Met
Gly Gly Asn Ile Thr Arg Val Glu Ser 290 295
300gag aac aaa gtg gtg att ctg gac tcc ttc gat ccg ctt gtg gca gag
960Glu Asn Lys Val Val Ile Leu Asp Ser Phe Asp Pro Leu Val Ala Glu305
310 315 320gag gat gag cgg
gag gtc tcc gta cct gca gaa att ctg cgg aag tct 1008Glu Asp Glu Arg
Glu Val Ser Val Pro Ala Glu Ile Leu Arg Lys Ser 325
330 335cgg aga ttc gcc cgg gcc ctg ccc gtc tgg
gcg cgg ccg gac tac aac 1056Arg Arg Phe Ala Arg Ala Leu Pro Val Trp
Ala Arg Pro Asp Tyr Asn 340 345
350ccc ccg cta gta gag acg tgg aaa aag cct gac tac gaa cca cct gtg
1104Pro Pro Leu Val Glu Thr Trp Lys Lys Pro Asp Tyr Glu Pro Pro Val
355 360 365gtc cat ggc tgc ccg cta cca
cct cca cgg tcc cct cct gtg cct ccg 1152Val His Gly Cys Pro Leu Pro
Pro Pro Arg Ser Pro Pro Val Pro Pro 370 375
380cct cgg aaa aag cgt acg gtg gtc ctc acc gaa tca acc cta tct act
1200Pro Arg Lys Lys Arg Thr Val Val Leu Thr Glu Ser Thr Leu Ser Thr385
390 395 400gcc ttg gcc gag
ctt gcc acc aaa agt ttt ggc agc tcc tca act tcc 1248Ala Leu Ala Glu
Leu Ala Thr Lys Ser Phe Gly Ser Ser Ser Thr Ser 405
410 415ggc att acg ggc gac aat acg aca aca tcc
tct gag ccc gcc cct tct 1296Gly Ile Thr Gly Asp Asn Thr Thr Thr Ser
Ser Glu Pro Ala Pro Ser 420 425
430ggc tgc ccc ccc gac tcc gac gtt gag tcc tat tct tcc atg ccc ccc
1344Gly Cys Pro Pro Asp Ser Asp Val Glu Ser Tyr Ser Ser Met Pro Pro
435 440 445ctg gag ggg gag cct ggg gat
ccg gat ctc agc gac ggg tca tgg tcg 1392Leu Glu Gly Glu Pro Gly Asp
Pro Asp Leu Ser Asp Gly Ser Trp Ser 450 455
460acg gtc agt agt ggg gcc gac acg gaa gat gtc gtg tgc gga cta gtg
1440Thr Val Ser Ser Gly Ala Asp Thr Glu Asp Val Val Cys Gly Leu Val465
470 475 480cgg ccg caa ggc
ggc gga tcc gtg gac aag aaa att gtg ccc agg gat 1488Arg Pro Gln Gly
Gly Gly Ser Val Asp Lys Lys Ile Val Pro Arg Asp 485
490 495tgt ggt tgt aag cct tgc ata tgt aca gtc
cca gaa gta tca tct gtc 1536Cys Gly Cys Lys Pro Cys Ile Cys Thr Val
Pro Glu Val Ser Ser Val 500 505
510ttc atc ttc ccc cca aag ccc aag gat gtg ctc acc att act ctg act
1584Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr
515 520 525cct aag gtc acg tgt gtt gtg
gta gac atc agc aag gat gat ccc gag 1632Pro Lys Val Thr Cys Val Val
Val Asp Ile Ser Lys Asp Asp Pro Glu 530 535
540gtc cag ttc agc tgg ttt gta gat gat gtg gag gtg cac aca gct cag
1680Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His Thr Ala Gln545
550 555 560acg caa ccc cgg
gag gag cag ttc aac agc act ttc cgc tca gtc agt 1728Thr Gln Pro Arg
Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser 565
570 575gaa ctt ccc atc atg cac cag gac tgg ctc
aat ggc aag gag ttc aaa 1776Glu Leu Pro Ile Met His Gln Asp Trp Leu
Asn Gly Lys Glu Phe Lys 580 585
590tgc agg gtc aac agt gca gct ttc cct gcc ccc atc gag aaa acc atc
1824Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile
595 600 605tcc aaa acc aaa ggc aga ccg
aag gct cca cag gtg tac acc att cca 1872Ser Lys Thr Lys Gly Arg Pro
Lys Ala Pro Gln Val Tyr Thr Ile Pro 610 615
620cct ccc aag gag cag atg gcc aag gat aaa gtc agt ctg acc tgc atg
1920Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys Met625
630 635 640ata aca gac ttc
ttc cct gaa gac att act gtg gag tgg cag tgg aat 1968Ile Thr Asp Phe
Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn 645
650 655ggg cag cca gcg gag aac tac aag aac act
cag ccc atc atg gac aca 2016Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr
Gln Pro Ile Met Asp Thr 660 665
670gat ggc tct tac ttc gtc tac agc aag ctc aat gtg cag aag agc aac
2064Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn
675 680 685tgg gag gca gga aat act ttc
acc tgc tct gtg tta cat gag ggc ctg 2112Trp Glu Ala Gly Asn Thr Phe
Thr Cys Ser Val Leu His Glu Gly Leu 690 695
700cac aac cac cat act gag aag agc ctc tcc cac tct cct ggg ctg caa
2160His Asn His His Thr Glu Lys Ser Leu Ser His Ser Pro Gly Leu Gln705
710 715 720agc ttg tcg aga
agt act aga gga tca taa 2190Ser Leu Ser Arg
Ser Thr Arg Gly Ser 72566729PRTArtificialSynthetic
Construct 66Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro
Thr1 5 10 15Thr Glu Asn
Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu Phe Ser Gly 20
25 30Ser Trp Leu Arg Asp Ile Trp Asp Trp Ile
Cys Glu Val Leu Ser Asp 35 40
45Phe Lys Thr Trp Leu Lys Ala Lys Leu Met Pro Gln Leu Pro Gly Ile 50
55 60Pro Phe Val Ser Cys Gln Arg Gly Tyr
Arg Gly Val Trp Arg Gly Asp65 70 75
80Gly Ile Met His Thr Arg Cys His Cys Gly Ala Glu Ile Thr
Gly His 85 90 95Val Lys
Asn Gly Thr Met Arg Ile Val Gly Pro Arg Thr Cys Arg Asn 100
105 110Met Trp Ser Gly Thr Phe Pro Ile Asn
Ala Tyr Thr Thr Gly Pro Cys 115 120
125Thr Pro Leu Pro Ala Pro Asn Tyr Lys Phe Ala Leu Trp Arg Val Ser
130 135 140Ala Glu Glu Tyr Val Glu Ile
Arg Arg Val Gly Asp Phe His Tyr Val145 150
155 160Ser Gly Met Thr Thr Asp Asn Leu Lys Cys Pro Cys
Gln Ile Pro Ser 165 170
175Pro Glu Phe Phe Thr Glu Leu Asp Gly Val Arg Leu His Arg Phe Ala
180 185 190Pro Pro Cys Lys Pro Leu
Leu Arg Glu Glu Val Ser Phe Arg Val Gly 195 200
205Leu His Glu Tyr Pro Val Gly Ser Gln Leu Pro Cys Glu Pro
Glu Pro 210 215 220Asp Val Ala Val Leu
Thr Ser Met Leu Thr Asp Pro Ser His Ile Thr225 230
235 240Ala Glu Ala Ala Gly Arg Arg Leu Ala Arg
Gly Ser Pro Pro Ser Met 245 250
255Ala Ser Ser Ser Ala Ser Gln Leu Ser Ala Pro Ser Leu Lys Ala Thr
260 265 270Cys Thr Ala Asn His
Asp Ser Pro Asp Ala Glu Leu Ile Glu Ala Asn 275
280 285Leu Leu Trp Arg Gln Glu Met Gly Gly Asn Ile Thr
Arg Val Glu Ser 290 295 300Glu Asn Lys
Val Val Ile Leu Asp Ser Phe Asp Pro Leu Val Ala Glu305
310 315 320Glu Asp Glu Arg Glu Val Ser
Val Pro Ala Glu Ile Leu Arg Lys Ser 325
330 335Arg Arg Phe Ala Arg Ala Leu Pro Val Trp Ala Arg
Pro Asp Tyr Asn 340 345 350Pro
Pro Leu Val Glu Thr Trp Lys Lys Pro Asp Tyr Glu Pro Pro Val 355
360 365Val His Gly Cys Pro Leu Pro Pro Pro
Arg Ser Pro Pro Val Pro Pro 370 375
380Pro Arg Lys Lys Arg Thr Val Val Leu Thr Glu Ser Thr Leu Ser Thr385
390 395 400Ala Leu Ala Glu
Leu Ala Thr Lys Ser Phe Gly Ser Ser Ser Thr Ser 405
410 415Gly Ile Thr Gly Asp Asn Thr Thr Thr Ser
Ser Glu Pro Ala Pro Ser 420 425
430Gly Cys Pro Pro Asp Ser Asp Val Glu Ser Tyr Ser Ser Met Pro Pro
435 440 445Leu Glu Gly Glu Pro Gly Asp
Pro Asp Leu Ser Asp Gly Ser Trp Ser 450 455
460Thr Val Ser Ser Gly Ala Asp Thr Glu Asp Val Val Cys Gly Leu
Val465 470 475 480Arg Pro
Gln Gly Gly Gly Ser Val Asp Lys Lys Ile Val Pro Arg Asp
485 490 495Cys Gly Cys Lys Pro Cys Ile
Cys Thr Val Pro Glu Val Ser Ser Val 500 505
510Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr
Leu Thr 515 520 525Pro Lys Val Thr
Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu 530
535 540Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val
His Thr Ala Gln545 550 555
560Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser
565 570 575Glu Leu Pro Ile Met
His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys 580
585 590Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile
Glu Lys Thr Ile 595 600 605Ser Lys
Thr Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro 610
615 620Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val
Ser Leu Thr Cys Met625 630 635
640Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn
645 650 655Gly Gln Pro Ala
Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr 660
665 670Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn
Val Gln Lys Ser Asn 675 680 685Trp
Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu 690
695 700His Asn His His Thr Glu Lys Ser Leu Ser
His Ser Pro Gly Leu Gln705 710 715
720Ser Leu Ser Arg Ser Thr Arg Gly Ser
72567756DNAHepatitis C virusCDS(1)..(756) 67atg tcg tac tac cat cac cat
cac cat cac gat tac gat atc cca acg 48Met Ser Tyr Tyr His His His
His His His Asp Tyr Asp Ile Pro Thr1 5 10
15acc gaa aac ctg tat ttt cag ggc gcc atg gat ccg gaa
ttc tac caa 96Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu
Phe Tyr Gln 20 25 30gtg cgc
aat tcc tcg ggg ctt tac cat gtc acc aat gat tgc cct aac 144Val Arg
Asn Ser Ser Gly Leu Tyr His Val Thr Asn Asp Cys Pro Asn 35
40 45tcg agt att gtg tac gag gcg gcc gat gcc
atc ctg cac act ccg ggg 192Ser Ser Ile Val Tyr Glu Ala Ala Asp Ala
Ile Leu His Thr Pro Gly 50 55 60tgt
gtc cct tgc gtt cgc gag ggt aac gcc tcg agg tgt tgg gtg gcg 240Cys
Val Pro Cys Val Arg Glu Gly Asn Ala Ser Arg Cys Trp Val Ala65
70 75 80gtg acc ccc acg gtg gcc
acc agg gac ggc aaa ctc ccc aca acg cag 288Val Thr Pro Thr Val Ala
Thr Arg Asp Gly Lys Leu Pro Thr Thr Gln 85
90 95ctt cga cgt cat atc gat ctg ctt gtc ggg agc gcc
acc ctc tgc tcg 336Leu Arg Arg His Ile Asp Leu Leu Val Gly Ser Ala
Thr Leu Cys Ser 100 105 110gcc
ctc tac gtg ggg gac ctg tgc ggg tct gtc ttt ctt gtt ggt caa 384Ala
Leu Tyr Val Gly Asp Leu Cys Gly Ser Val Phe Leu Val Gly Gln 115
120 125ctg ttt acc ttc tct ccc agg cgc cac
tgg acg acg caa gac tgc aat 432Leu Phe Thr Phe Ser Pro Arg Arg His
Trp Thr Thr Gln Asp Cys Asn 130 135
140tgt tct atc tat ccc ggc cat ata acg ggt cat cgc atg gca tgg gat
480Cys Ser Ile Tyr Pro Gly His Ile Thr Gly His Arg Met Ala Trp Asp145
150 155 160atg atg atg aac
tgg tcc cct acg gca gcg ttg gtg gta gct cag ctg 528Met Met Met Asn
Trp Ser Pro Thr Ala Ala Leu Val Val Ala Gln Leu 165
170 175ctc cgg atc cca caa gcc atc atg gac atg
atc gct ggt gct cac tgg 576Leu Arg Ile Pro Gln Ala Ile Met Asp Met
Ile Ala Gly Ala His Trp 180 185
190gga gtc ctg gcg ggc ata gcg tat ttc tcc atg gtg ggg aac tgg gcg
624Gly Val Leu Ala Gly Ile Ala Tyr Phe Ser Met Val Gly Asn Trp Ala
195 200 205aag gtc ctg gta gtg ctg ctg
cta ttt gcc ggc gtc gac gcg gaa gga 672Lys Val Leu Val Val Leu Leu
Leu Phe Ala Gly Val Asp Ala Glu Gly 210 215
220cta gtg cgg ccg ctt tcg aat cta gag cct gca gtc tcg agg cat gcg
720Leu Val Arg Pro Leu Ser Asn Leu Glu Pro Ala Val Ser Arg His Ala225
230 235 240gta cca agc ttg
tcg aga agt act aga gga tca taa 756Val Pro Ser Leu
Ser Arg Ser Thr Arg Gly Ser 245
25068251PRTHepatitis C virus 68Met Ser Tyr Tyr His His His His His His
Asp Tyr Asp Ile Pro Thr1 5 10
15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu Phe Tyr Gln
20 25 30Val Arg Asn Ser Ser Gly
Leu Tyr His Val Thr Asn Asp Cys Pro Asn 35 40
45Ser Ser Ile Val Tyr Glu Ala Ala Asp Ala Ile Leu His Thr
Pro Gly 50 55 60Cys Val Pro Cys Val
Arg Glu Gly Asn Ala Ser Arg Cys Trp Val Ala65 70
75 80Val Thr Pro Thr Val Ala Thr Arg Asp Gly
Lys Leu Pro Thr Thr Gln 85 90
95Leu Arg Arg His Ile Asp Leu Leu Val Gly Ser Ala Thr Leu Cys Ser
100 105 110Ala Leu Tyr Val Gly
Asp Leu Cys Gly Ser Val Phe Leu Val Gly Gln 115
120 125Leu Phe Thr Phe Ser Pro Arg Arg His Trp Thr Thr
Gln Asp Cys Asn 130 135 140Cys Ser Ile
Tyr Pro Gly His Ile Thr Gly His Arg Met Ala Trp Asp145
150 155 160Met Met Met Asn Trp Ser Pro
Thr Ala Ala Leu Val Val Ala Gln Leu 165
170 175Leu Arg Ile Pro Gln Ala Ile Met Asp Met Ile Ala
Gly Ala His Trp 180 185 190Gly
Val Leu Ala Gly Ile Ala Tyr Phe Ser Met Val Gly Asn Trp Ala 195
200 205Lys Val Leu Val Val Leu Leu Leu Phe
Ala Gly Val Asp Ala Glu Gly 210 215
220Leu Val Arg Pro Leu Ser Asn Leu Glu Pro Ala Val Ser Arg His Ala225
230 235 240Val Pro Ser Leu
Ser Arg Ser Thr Arg Gly Ser 245
250691428DNAArtificialHepatitis C virus plus murine 69atg tcg tac tac cat
cac cat cac cat cac gat tac gat atc cca acg 48Met Ser Tyr Tyr His
His His His His His Asp Tyr Asp Ile Pro Thr1 5
10 15acc gaa aac ctg tat ttt cag ggc gcc atg gat
ccg gaa ttc tac caa 96Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp
Pro Glu Phe Tyr Gln 20 25
30gtg cgc aat tcc tcg ggg ctt tac cat gtc acc aat gat tgc cct aac
144Val Arg Asn Ser Ser Gly Leu Tyr His Val Thr Asn Asp Cys Pro Asn
35 40 45tcg agt att gtg tac gag gcg gcc
gat gcc atc ctg cac act ccg ggg 192Ser Ser Ile Val Tyr Glu Ala Ala
Asp Ala Ile Leu His Thr Pro Gly 50 55
60tgt gtc cct tgc gtt cgc gag ggt aac gcc tcg agg tgt tgg gtg gcg
240Cys Val Pro Cys Val Arg Glu Gly Asn Ala Ser Arg Cys Trp Val Ala65
70 75 80gtg acc ccc acg gtg
gcc acc agg gac ggc aaa ctc ccc aca acg cag 288Val Thr Pro Thr Val
Ala Thr Arg Asp Gly Lys Leu Pro Thr Thr Gln 85
90 95ctt cga cgt cat atc gat ctg ctt gtc ggg agc
gcc acc ctc tgc tcg 336Leu Arg Arg His Ile Asp Leu Leu Val Gly Ser
Ala Thr Leu Cys Ser 100 105
110gcc ctc tac gtg ggg gac ctg tgc ggg tct gtc ttt ctt gtt ggt caa
384Ala Leu Tyr Val Gly Asp Leu Cys Gly Ser Val Phe Leu Val Gly Gln
115 120 125ctg ttt acc ttc tct ccc agg
cgc cac tgg acg acg caa gac tgc aat 432Leu Phe Thr Phe Ser Pro Arg
Arg His Trp Thr Thr Gln Asp Cys Asn 130 135
140tgt tct atc tat ccc ggc cat ata acg ggt cat cgc atg gca tgg gat
480Cys Ser Ile Tyr Pro Gly His Ile Thr Gly His Arg Met Ala Trp Asp145
150 155 160atg atg atg aac
tgg tcc cct acg gca gcg ttg gtg gta gct cag ctg 528Met Met Met Asn
Trp Ser Pro Thr Ala Ala Leu Val Val Ala Gln Leu 165
170 175ctc cgg atc cca caa gcc atc atg gac atg
atc gct ggt gct cac tgg 576Leu Arg Ile Pro Gln Ala Ile Met Asp Met
Ile Ala Gly Ala His Trp 180 185
190gga gtc ctg gcg ggc ata gcg tat ttc tcc atg gtg ggg aac tgg gcg
624Gly Val Leu Ala Gly Ile Ala Tyr Phe Ser Met Val Gly Asn Trp Ala
195 200 205aag gtc ctg gta gtg ctg ctg
cta ttt gcc ggc gtc gac gcg gaa gga 672Lys Val Leu Val Val Leu Leu
Leu Phe Ala Gly Val Asp Ala Glu Gly 210 215
220cta gtg cgg ccg caa ggc ggc gga tcc gtg gac aag aaa att gtg ccc
720Leu Val Arg Pro Gln Gly Gly Gly Ser Val Asp Lys Lys Ile Val Pro225
230 235 240agg gat tgt ggt
tgt aag cct tgc ata tgt aca gtc cca gaa gta tca 768Arg Asp Cys Gly
Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val Ser 245
250 255tct gtc ttc atc ttc ccc cca aag ccc aag
gat gtg ctc acc att act 816Ser Val Phe Ile Phe Pro Pro Lys Pro Lys
Asp Val Leu Thr Ile Thr 260 265
270ctg act cct aag gtc acg tgt gtt gtg gta gac atc agc aag gat gat
864Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser Lys Asp Asp
275 280 285ccc gag gtc cag ttc agc tgg
ttt gta gat gat gtg gag gtg cac aca 912Pro Glu Val Gln Phe Ser Trp
Phe Val Asp Asp Val Glu Val His Thr 290 295
300gct cag acg caa ccc cgg gag gag cag ttc aac agc act ttc cgc tca
960Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser305
310 315 320gtc agt gaa ctt
ccc atc atg cac cag gac tgg ctc aat ggc aag gag 1008Val Ser Glu Leu
Pro Ile Met His Gln Asp Trp Leu Asn Gly Lys Glu 325
330 335ttc aaa tgc agg gtc aac agt gca gct ttc
cct gcc ccc atc gag aaa 1056Phe Lys Cys Arg Val Asn Ser Ala Ala Phe
Pro Ala Pro Ile Glu Lys 340 345
350acc atc tcc aaa acc aaa ggc aga ccg aag gct cca cag gtg tac acc
1104Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr
355 360 365att cca cct ccc aag gag cag
atg gcc aag gat aaa gtc agt ctg acc 1152Ile Pro Pro Pro Lys Glu Gln
Met Ala Lys Asp Lys Val Ser Leu Thr 370 375
380tgc atg ata aca gac ttc ttc cct gaa gac att act gtg gag tgg cag
1200Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln385
390 395 400tgg aat ggg cag
cca gcg gag aac tac aag aac act cag ccc atc atg 1248Trp Asn Gly Gln
Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met 405
410 415gac aca gat ggc tct tac ttc gtc tac agc
aag ctc aat gtg cag aag 1296Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser
Lys Leu Asn Val Gln Lys 420 425
430agc aac tgg gag gca gga aat act ttc acc tgc tct gtg tta cat gag
1344Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His Glu
435 440 445ggc ctg cac aac cac cat act
gag aag agc ctc tcc cac tct cct ggg 1392Gly Leu His Asn His His Thr
Glu Lys Ser Leu Ser His Ser Pro Gly 450 455
460ctg caa agc ttg tcg aga agt act aga gga tca taa
1428Leu Gln Ser Leu Ser Arg Ser Thr Arg Gly Ser465 470
47570475PRTArtificialSynthetic Construct 70Met Ser Tyr Tyr
His His His His His His Asp Tyr Asp Ile Pro Thr1 5
10 15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met
Asp Pro Glu Phe Tyr Gln 20 25
30Val Arg Asn Ser Ser Gly Leu Tyr His Val Thr Asn Asp Cys Pro Asn
35 40 45Ser Ser Ile Val Tyr Glu Ala Ala
Asp Ala Ile Leu His Thr Pro Gly 50 55
60Cys Val Pro Cys Val Arg Glu Gly Asn Ala Ser Arg Cys Trp Val Ala65
70 75 80Val Thr Pro Thr Val
Ala Thr Arg Asp Gly Lys Leu Pro Thr Thr Gln 85
90 95Leu Arg Arg His Ile Asp Leu Leu Val Gly Ser
Ala Thr Leu Cys Ser 100 105
110Ala Leu Tyr Val Gly Asp Leu Cys Gly Ser Val Phe Leu Val Gly Gln
115 120 125Leu Phe Thr Phe Ser Pro Arg
Arg His Trp Thr Thr Gln Asp Cys Asn 130 135
140Cys Ser Ile Tyr Pro Gly His Ile Thr Gly His Arg Met Ala Trp
Asp145 150 155 160Met Met
Met Asn Trp Ser Pro Thr Ala Ala Leu Val Val Ala Gln Leu
165 170 175Leu Arg Ile Pro Gln Ala Ile
Met Asp Met Ile Ala Gly Ala His Trp 180 185
190Gly Val Leu Ala Gly Ile Ala Tyr Phe Ser Met Val Gly Asn
Trp Ala 195 200 205Lys Val Leu Val
Val Leu Leu Leu Phe Ala Gly Val Asp Ala Glu Gly 210
215 220Leu Val Arg Pro Gln Gly Gly Gly Ser Val Asp Lys
Lys Ile Val Pro225 230 235
240Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val Ser
245 250 255Ser Val Phe Ile Phe
Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr 260
265 270Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile
Ser Lys Asp Asp 275 280 285Pro Glu
Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His Thr 290
295 300Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn
Ser Thr Phe Arg Ser305 310 315
320Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly Lys Glu
325 330 335Phe Lys Cys Arg
Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys 340
345 350Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala
Pro Gln Val Tyr Thr 355 360 365Ile
Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu Thr 370
375 380Cys Met Ile Thr Asp Phe Phe Pro Glu Asp
Ile Thr Val Glu Trp Gln385 390 395
400Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile
Met 405 410 415Asp Thr Asp
Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys 420
425 430Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr
Cys Ser Val Leu His Glu 435 440
445Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His Ser Pro Gly 450
455 460Leu Gln Ser Leu Ser Arg Ser Thr
Arg Gly Ser465 470 475711266DNAHepatitis
C virusCDS(1)..(1266) 71atg tcg tac tac cat cac cat cac cat cac gat tac
gat atc cca acg 48Met Ser Tyr Tyr His His His His His His Asp Tyr
Asp Ile Pro Thr1 5 10
15acc gaa aac ctg tat ttt cag ggc gcc atg gat ccg gaa ttc acc cac
96Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu Phe Thr His
20 25 30gtc acc ggg gga aat gcc ggc
cgc acc acg gct ggg ctt gtt ggt ctc 144Val Thr Gly Gly Asn Ala Gly
Arg Thr Thr Ala Gly Leu Val Gly Leu 35 40
45ctt aca cca ggc gcc aag cag aac atc caa ctg atc aac acc aac
ggc 192Leu Thr Pro Gly Ala Lys Gln Asn Ile Gln Leu Ile Asn Thr Asn
Gly 50 55 60agt tgg cac atc aat agc
acg gcc ttg aat tgc aat gaa agc ctt aac 240Ser Trp His Ile Asn Ser
Thr Ala Leu Asn Cys Asn Glu Ser Leu Asn65 70
75 80acc ggc tgg tta gca ggg ctc ttc tat caa cac
aaa ttc aac tct tca 288Thr Gly Trp Leu Ala Gly Leu Phe Tyr Gln His
Lys Phe Asn Ser Ser 85 90
95ggc tgt cct gag agg ttg gcc agc tgc cga cgc ctt acc gat ttt gcc
336Gly Cys Pro Glu Arg Leu Ala Ser Cys Arg Arg Leu Thr Asp Phe Ala
100 105 110cag ggc tgg ggt cct atc
agt tat gcc aac gga agc ggc ctc gac gaa 384Gln Gly Trp Gly Pro Ile
Ser Tyr Ala Asn Gly Ser Gly Leu Asp Glu 115 120
125cgc ccc tac tgc tgg cac tac cct cca aga cct tgt ggc att
gtg ccc 432Arg Pro Tyr Cys Trp His Tyr Pro Pro Arg Pro Cys Gly Ile
Val Pro 130 135 140gca aag agc gtg tgt
ggc ccg gta tat tgc ttc act ccc agc ccc gtg 480Ala Lys Ser Val Cys
Gly Pro Val Tyr Cys Phe Thr Pro Ser Pro Val145 150
155 160gtg gtg gga acg acc gac agg tcg ggc gcg
cct acc tac agc tgg ggt 528Val Val Gly Thr Thr Asp Arg Ser Gly Ala
Pro Thr Tyr Ser Trp Gly 165 170
175gca aat gat acg gat gtc ttc gtc ctt aac aac acc agg cca ccg ctg
576Ala Asn Asp Thr Asp Val Phe Val Leu Asn Asn Thr Arg Pro Pro Leu
180 185 190ggc aat tgg ttc ggt tgt
acc tgg atg aac tca act gga ttc acc aaa 624Gly Asn Trp Phe Gly Cys
Thr Trp Met Asn Ser Thr Gly Phe Thr Lys 195 200
205gtg tgc gga gcg ccc cct tgt gtc atc gga ggg gtg ggc aac
aac acc 672Val Cys Gly Ala Pro Pro Cys Val Ile Gly Gly Val Gly Asn
Asn Thr 210 215 220ttg ctc tgc ccc act
gat tgc ttc cgc aaa cat ccg gaa gcc aca tac 720Leu Leu Cys Pro Thr
Asp Cys Phe Arg Lys His Pro Glu Ala Thr Tyr225 230
235 240tct cgg tgc ggc tcc ggt ccc tgg att aca
ccc agg tgc atg gtc gac 768Ser Arg Cys Gly Ser Gly Pro Trp Ile Thr
Pro Arg Cys Met Val Asp 245 250
255tac ccg tat agg ctt tgg cac tat cct tgt acc atc aat tac acc ata
816Tyr Pro Tyr Arg Leu Trp His Tyr Pro Cys Thr Ile Asn Tyr Thr Ile
260 265 270ttc aaa gtc agg atg tac
gtg gga ggg gtc gag cac agg ctg gaa gcg 864Phe Lys Val Arg Met Tyr
Val Gly Gly Val Glu His Arg Leu Glu Ala 275 280
285gcc tgc aac tgg acg cgg ggc gaa cgc tgt gat ctg gaa gac
agg gac 912Ala Cys Asn Trp Thr Arg Gly Glu Arg Cys Asp Leu Glu Asp
Arg Asp 290 295 300agg tcc gag ctc agc
ccg ttg ctg ctg tcc acc aca cag tgg cag gtc 960Arg Ser Glu Leu Ser
Pro Leu Leu Leu Ser Thr Thr Gln Trp Gln Val305 310
315 320ctt ccg tgt tct ttc acg acc ctg cca gcc
ttg tcc acc ggc ctc atc 1008Leu Pro Cys Ser Phe Thr Thr Leu Pro Ala
Leu Ser Thr Gly Leu Ile 325 330
335cac ctc cac cag aac att gtg gac gtg cag tac ttg tac ggg gta ggg
1056His Leu His Gln Asn Ile Val Asp Val Gln Tyr Leu Tyr Gly Val Gly
340 345 350tca agc atc gcg tcc tgg
gcc att aag tgg gag tac gtc gtt ctc ctg 1104Ser Ser Ile Ala Ser Trp
Ala Ile Lys Trp Glu Tyr Val Val Leu Leu 355 360
365ttc ctt ctg ctt gca gac gcg cgc gtc tgc tcc tgc ttg tgg
atg atg 1152Phe Leu Leu Leu Ala Asp Ala Arg Val Cys Ser Cys Leu Trp
Met Met 370 375 380tta ctc ata tcc caa
gcg gag gcg gct gga cta gtg cgg ccg ctt tcg 1200Leu Leu Ile Ser Gln
Ala Glu Ala Ala Gly Leu Val Arg Pro Leu Ser385 390
395 400aat cta gag cct gca gtc tcg agg cat gcg
gta cca agc ttg tcg aga 1248Asn Leu Glu Pro Ala Val Ser Arg His Ala
Val Pro Ser Leu Ser Arg 405 410
415agt act aga gga tca taa
1266Ser Thr Arg Gly Ser 42072421PRTHepatitis C virus 72Met
Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro Thr1
5 10 15Thr Glu Asn Leu Tyr Phe Gln
Gly Ala Met Asp Pro Glu Phe Thr His 20 25
30Val Thr Gly Gly Asn Ala Gly Arg Thr Thr Ala Gly Leu Val
Gly Leu 35 40 45Leu Thr Pro Gly
Ala Lys Gln Asn Ile Gln Leu Ile Asn Thr Asn Gly 50 55
60Ser Trp His Ile Asn Ser Thr Ala Leu Asn Cys Asn Glu
Ser Leu Asn65 70 75
80Thr Gly Trp Leu Ala Gly Leu Phe Tyr Gln His Lys Phe Asn Ser Ser
85 90 95Gly Cys Pro Glu Arg Leu
Ala Ser Cys Arg Arg Leu Thr Asp Phe Ala 100
105 110Gln Gly Trp Gly Pro Ile Ser Tyr Ala Asn Gly Ser
Gly Leu Asp Glu 115 120 125Arg Pro
Tyr Cys Trp His Tyr Pro Pro Arg Pro Cys Gly Ile Val Pro 130
135 140Ala Lys Ser Val Cys Gly Pro Val Tyr Cys Phe
Thr Pro Ser Pro Val145 150 155
160Val Val Gly Thr Thr Asp Arg Ser Gly Ala Pro Thr Tyr Ser Trp Gly
165 170 175Ala Asn Asp Thr
Asp Val Phe Val Leu Asn Asn Thr Arg Pro Pro Leu 180
185 190Gly Asn Trp Phe Gly Cys Thr Trp Met Asn Ser
Thr Gly Phe Thr Lys 195 200 205Val
Cys Gly Ala Pro Pro Cys Val Ile Gly Gly Val Gly Asn Asn Thr 210
215 220Leu Leu Cys Pro Thr Asp Cys Phe Arg Lys
His Pro Glu Ala Thr Tyr225 230 235
240Ser Arg Cys Gly Ser Gly Pro Trp Ile Thr Pro Arg Cys Met Val
Asp 245 250 255Tyr Pro Tyr
Arg Leu Trp His Tyr Pro Cys Thr Ile Asn Tyr Thr Ile 260
265 270Phe Lys Val Arg Met Tyr Val Gly Gly Val
Glu His Arg Leu Glu Ala 275 280
285Ala Cys Asn Trp Thr Arg Gly Glu Arg Cys Asp Leu Glu Asp Arg Asp 290
295 300Arg Ser Glu Leu Ser Pro Leu Leu
Leu Ser Thr Thr Gln Trp Gln Val305 310
315 320Leu Pro Cys Ser Phe Thr Thr Leu Pro Ala Leu Ser
Thr Gly Leu Ile 325 330
335His Leu His Gln Asn Ile Val Asp Val Gln Tyr Leu Tyr Gly Val Gly
340 345 350Ser Ser Ile Ala Ser Trp
Ala Ile Lys Trp Glu Tyr Val Val Leu Leu 355 360
365Phe Leu Leu Leu Ala Asp Ala Arg Val Cys Ser Cys Leu Trp
Met Met 370 375 380Leu Leu Ile Ser Gln
Ala Glu Ala Ala Gly Leu Val Arg Pro Leu Ser385 390
395 400Asn Leu Glu Pro Ala Val Ser Arg His Ala
Val Pro Ser Leu Ser Arg 405 410
415Ser Thr Arg Gly Ser 420731938DNAArtificialHepatitis C
virus plus murine 73atg tcg tac tac cat cac cat cac cat cac gat tac gat
atc cca acg 48Met Ser Tyr Tyr His His His His His His Asp Tyr Asp
Ile Pro Thr1 5 10 15acc
gaa aac ctg tat ttt cag ggc gcc atg gat ccg gaa ttc acc cac 96Thr
Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu Phe Thr His 20
25 30gtc acc ggg gga aat gcc ggc cgc
acc acg gct ggg ctt gtt ggt ctc 144Val Thr Gly Gly Asn Ala Gly Arg
Thr Thr Ala Gly Leu Val Gly Leu 35 40
45ctt aca cca ggc gcc aag cag aac atc caa ctg atc aac acc aac ggc
192Leu Thr Pro Gly Ala Lys Gln Asn Ile Gln Leu Ile Asn Thr Asn Gly
50 55 60agt tgg cac atc aat agc acg gcc
ttg aat tgc aat gaa agc ctt aac 240Ser Trp His Ile Asn Ser Thr Ala
Leu Asn Cys Asn Glu Ser Leu Asn65 70 75
80acc ggc tgg tta gca ggg ctc ttc tat caa cac aaa ttc
aac tct tca 288Thr Gly Trp Leu Ala Gly Leu Phe Tyr Gln His Lys Phe
Asn Ser Ser 85 90 95ggc
tgt cct gag agg ttg gcc agc tgc cga cgc ctt acc gat ttt gcc 336Gly
Cys Pro Glu Arg Leu Ala Ser Cys Arg Arg Leu Thr Asp Phe Ala
100 105 110cag ggc tgg ggt cct atc agt
tat gcc aac gga agc ggc ctc gac gaa 384Gln Gly Trp Gly Pro Ile Ser
Tyr Ala Asn Gly Ser Gly Leu Asp Glu 115 120
125cgc ccc tac tgc tgg cac tac cct cca aga cct tgt ggc att gtg
ccc 432Arg Pro Tyr Cys Trp His Tyr Pro Pro Arg Pro Cys Gly Ile Val
Pro 130 135 140gca aag agc gtg tgt ggc
ccg gta tat tgc ttc act ccc agc ccc gtg 480Ala Lys Ser Val Cys Gly
Pro Val Tyr Cys Phe Thr Pro Ser Pro Val145 150
155 160gtg gtg gga acg acc gac agg tcg ggc gcg cct
acc tac agc tgg ggt 528Val Val Gly Thr Thr Asp Arg Ser Gly Ala Pro
Thr Tyr Ser Trp Gly 165 170
175gca aat gat acg gat gtc ttc gtc ctt aac aac acc agg cca ccg ctg
576Ala Asn Asp Thr Asp Val Phe Val Leu Asn Asn Thr Arg Pro Pro Leu
180 185 190ggc aat tgg ttc ggt tgt
acc tgg atg aac tca act gga ttc acc aaa 624Gly Asn Trp Phe Gly Cys
Thr Trp Met Asn Ser Thr Gly Phe Thr Lys 195 200
205gtg tgc gga gcg ccc cct tgt gtc atc gga ggg gtg ggc aac
aac acc 672Val Cys Gly Ala Pro Pro Cys Val Ile Gly Gly Val Gly Asn
Asn Thr 210 215 220ttg ctc tgc ccc act
gat tgc ttc cgc aaa cat ccg gaa gcc aca tac 720Leu Leu Cys Pro Thr
Asp Cys Phe Arg Lys His Pro Glu Ala Thr Tyr225 230
235 240tct cgg tgc ggc tcc ggt ccc tgg att aca
ccc agg tgc atg gtc gac 768Ser Arg Cys Gly Ser Gly Pro Trp Ile Thr
Pro Arg Cys Met Val Asp 245 250
255tac ccg tat agg ctt tgg cac tat cct tgt acc atc aat tac acc ata
816Tyr Pro Tyr Arg Leu Trp His Tyr Pro Cys Thr Ile Asn Tyr Thr Ile
260 265 270ttc aaa gtc agg atg tac
gtg gga ggg gtc gag cac agg ctg gaa gcg 864Phe Lys Val Arg Met Tyr
Val Gly Gly Val Glu His Arg Leu Glu Ala 275 280
285gcc tgc aac tgg acg cgg ggc gaa cgc tgt gat ctg gaa gac
agg gac 912Ala Cys Asn Trp Thr Arg Gly Glu Arg Cys Asp Leu Glu Asp
Arg Asp 290 295 300agg tcc gag ctc agc
ccg ttg ctg ctg tcc acc aca cag tgg cag gtc 960Arg Ser Glu Leu Ser
Pro Leu Leu Leu Ser Thr Thr Gln Trp Gln Val305 310
315 320ctt ccg tgt tct ttc acg acc ctg cca gcc
ttg tcc acc ggc ctc atc 1008Leu Pro Cys Ser Phe Thr Thr Leu Pro Ala
Leu Ser Thr Gly Leu Ile 325 330
335cac ctc cac cag aac att gtg gac gtg cag tac ttg tac ggg gta ggg
1056His Leu His Gln Asn Ile Val Asp Val Gln Tyr Leu Tyr Gly Val Gly
340 345 350tca agc atc gcg tcc tgg
gcc att aag tgg gag tac gtc gtt ctc ctg 1104Ser Ser Ile Ala Ser Trp
Ala Ile Lys Trp Glu Tyr Val Val Leu Leu 355 360
365ttc ctt ctg ctt gca gac gcg cgc gtc tgc tcc tgc ttg tgg
atg atg 1152Phe Leu Leu Leu Ala Asp Ala Arg Val Cys Ser Cys Leu Trp
Met Met 370 375 380tta ctc ata tcc caa
gcg gag gcg gct gga cta gtg cgg ccg caa ggc 1200Leu Leu Ile Ser Gln
Ala Glu Ala Ala Gly Leu Val Arg Pro Gln Gly385 390
395 400ggc gga tcc gtg gac aag aaa att gtg ccc
agg gat tgt ggt tgt aag 1248Gly Gly Ser Val Asp Lys Lys Ile Val Pro
Arg Asp Cys Gly Cys Lys 405 410
415cct tgc ata tgt aca gtc cca gaa gta tca tct gtc ttc atc ttc ccc
1296Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro
420 425 430cca aag ccc aag gat gtg
ctc acc att act ctg act cct aag gtc acg 1344Pro Lys Pro Lys Asp Val
Leu Thr Ile Thr Leu Thr Pro Lys Val Thr 435 440
445tgt gtt gtg gta gac atc agc aag gat gat ccc gag gtc cag
ttc agc 1392Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln
Phe Ser 450 455 460tgg ttt gta gat gat
gtg gag gtg cac aca gct cag acg caa ccc cgg 1440Trp Phe Val Asp Asp
Val Glu Val His Thr Ala Gln Thr Gln Pro Arg465 470
475 480gag gag cag ttc aac agc act ttc cgc tca
gtc agt gaa ctt ccc atc 1488Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser
Val Ser Glu Leu Pro Ile 485 490
495atg cac cag gac tgg ctc aat ggc aag gag ttc aaa tgc agg gtc aac
1536Met His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn
500 505 510agt gca gct ttc cct gcc
ccc atc gag aaa acc atc tcc aaa acc aaa 1584Ser Ala Ala Phe Pro Ala
Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys 515 520
525ggc aga ccg aag gct cca cag gtg tac acc att cca cct ccc
aag gag 1632Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro
Lys Glu 530 535 540cag atg gcc aag gat
aaa gtc agt ctg acc tgc atg ata aca gac ttc 1680Gln Met Ala Lys Asp
Lys Val Ser Leu Thr Cys Met Ile Thr Asp Phe545 550
555 560ttc cct gaa gac att act gtg gag tgg cag
tgg aat ggg cag cca gcg 1728Phe Pro Glu Asp Ile Thr Val Glu Trp Gln
Trp Asn Gly Gln Pro Ala 565 570
575gag aac tac aag aac act cag ccc atc atg gac aca gat ggc tct tac
1776Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr
580 585 590ttc gtc tac agc aag ctc
aat gtg cag aag agc aac tgg gag gca gga 1824Phe Val Tyr Ser Lys Leu
Asn Val Gln Lys Ser Asn Trp Glu Ala Gly 595 600
605aat act ttc acc tgc tct gtg tta cat gag ggc ctg cac aac
cac cat 1872Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His Asn
His His 610 615 620act gag aag agc ctc
tcc cac tct cct ggg ctg caa agc ttg tcg aga 1920Thr Glu Lys Ser Leu
Ser His Ser Pro Gly Leu Gln Ser Leu Ser Arg625 630
635 640agt act aga gga tca taa
1938Ser Thr Arg Gly Ser
64574645PRTArtificialSynthetic Construct 74Met Ser Tyr Tyr His His His
His His His Asp Tyr Asp Ile Pro Thr1 5 10
15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu
Phe Thr His 20 25 30Val Thr
Gly Gly Asn Ala Gly Arg Thr Thr Ala Gly Leu Val Gly Leu 35
40 45Leu Thr Pro Gly Ala Lys Gln Asn Ile Gln
Leu Ile Asn Thr Asn Gly 50 55 60Ser
Trp His Ile Asn Ser Thr Ala Leu Asn Cys Asn Glu Ser Leu Asn65
70 75 80Thr Gly Trp Leu Ala Gly
Leu Phe Tyr Gln His Lys Phe Asn Ser Ser 85
90 95Gly Cys Pro Glu Arg Leu Ala Ser Cys Arg Arg Leu
Thr Asp Phe Ala 100 105 110Gln
Gly Trp Gly Pro Ile Ser Tyr Ala Asn Gly Ser Gly Leu Asp Glu 115
120 125Arg Pro Tyr Cys Trp His Tyr Pro Pro
Arg Pro Cys Gly Ile Val Pro 130 135
140Ala Lys Ser Val Cys Gly Pro Val Tyr Cys Phe Thr Pro Ser Pro Val145
150 155 160Val Val Gly Thr
Thr Asp Arg Ser Gly Ala Pro Thr Tyr Ser Trp Gly 165
170 175Ala Asn Asp Thr Asp Val Phe Val Leu Asn
Asn Thr Arg Pro Pro Leu 180 185
190Gly Asn Trp Phe Gly Cys Thr Trp Met Asn Ser Thr Gly Phe Thr Lys
195 200 205Val Cys Gly Ala Pro Pro Cys
Val Ile Gly Gly Val Gly Asn Asn Thr 210 215
220Leu Leu Cys Pro Thr Asp Cys Phe Arg Lys His Pro Glu Ala Thr
Tyr225 230 235 240Ser Arg
Cys Gly Ser Gly Pro Trp Ile Thr Pro Arg Cys Met Val Asp
245 250 255Tyr Pro Tyr Arg Leu Trp His
Tyr Pro Cys Thr Ile Asn Tyr Thr Ile 260 265
270Phe Lys Val Arg Met Tyr Val Gly Gly Val Glu His Arg Leu
Glu Ala 275 280 285Ala Cys Asn Trp
Thr Arg Gly Glu Arg Cys Asp Leu Glu Asp Arg Asp 290
295 300Arg Ser Glu Leu Ser Pro Leu Leu Leu Ser Thr Thr
Gln Trp Gln Val305 310 315
320Leu Pro Cys Ser Phe Thr Thr Leu Pro Ala Leu Ser Thr Gly Leu Ile
325 330 335His Leu His Gln Asn
Ile Val Asp Val Gln Tyr Leu Tyr Gly Val Gly 340
345 350Ser Ser Ile Ala Ser Trp Ala Ile Lys Trp Glu Tyr
Val Val Leu Leu 355 360 365Phe Leu
Leu Leu Ala Asp Ala Arg Val Cys Ser Cys Leu Trp Met Met 370
375 380Leu Leu Ile Ser Gln Ala Glu Ala Ala Gly Leu
Val Arg Pro Gln Gly385 390 395
400Gly Gly Ser Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys Lys
405 410 415Pro Cys Ile Cys
Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro 420
425 430Pro Lys Pro Lys Asp Val Leu Thr Ile Thr Leu
Thr Pro Lys Val Thr 435 440 445Cys
Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser 450
455 460Trp Phe Val Asp Asp Val Glu Val His Thr
Ala Gln Thr Gln Pro Arg465 470 475
480Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro
Ile 485 490 495Met His Gln
Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn 500
505 510Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys
Thr Ile Ser Lys Thr Lys 515 520
525Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu 530
535 540Gln Met Ala Lys Asp Lys Val Ser
Leu Thr Cys Met Ile Thr Asp Phe545 550
555 560Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn
Gly Gln Pro Ala 565 570
575Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr
580 585 590Phe Val Tyr Ser Lys Leu
Asn Val Gln Lys Ser Asn Trp Glu Ala Gly 595 600
605Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His Asn
His His 610 615 620Thr Glu Lys Ser Leu
Ser His Ser Pro Gly Leu Gln Ser Leu Ser Arg625 630
635 640Ser Thr Arg Gly Ser
645751845DNAHCV E1E2CDS(1)..(1845) 75atg tcg tac tac cat cac cat cac cat
cac gat tac gat atc cca acg 48Met Ser Tyr Tyr His His His His His
His Asp Tyr Asp Ile Pro Thr1 5 10
15acc gaa aac ctg tat ttt cag ggc gcc atg gat ccg gaa ttc tac
caa 96Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu Phe Tyr
Gln 20 25 30gtg cgc aat tcc
tcg ggg ctt tac cat gtc acc aat gat tgc cct aac 144Val Arg Asn Ser
Ser Gly Leu Tyr His Val Thr Asn Asp Cys Pro Asn 35
40 45tcg agt att gtg tac gag gcg gcc gat gcc atc ctg
cac act ccg ggg 192Ser Ser Ile Val Tyr Glu Ala Ala Asp Ala Ile Leu
His Thr Pro Gly 50 55 60tgt gtc cct
tgc gtt cgc gag ggt aac gcc tcg agg tgt tgg gtg gcg 240Cys Val Pro
Cys Val Arg Glu Gly Asn Ala Ser Arg Cys Trp Val Ala65 70
75 80gtg acc ccc acg gtg gcc acc agg
gac ggc aaa ctc ccc aca acg cag 288Val Thr Pro Thr Val Ala Thr Arg
Asp Gly Lys Leu Pro Thr Thr Gln 85 90
95ctt cga cgt cat atc gat ctg ctt gtc ggg agc gcc acc ctc
tgc tcg 336Leu Arg Arg His Ile Asp Leu Leu Val Gly Ser Ala Thr Leu
Cys Ser 100 105 110gcc ctc tac
gtg ggg gac ctg tgc ggg tct gtc ttt ctt gtt ggt caa 384Ala Leu Tyr
Val Gly Asp Leu Cys Gly Ser Val Phe Leu Val Gly Gln 115
120 125ctg ttt acc ttc tct ccc agg cgc cac tgg acg
acg caa gac tgc aat 432Leu Phe Thr Phe Ser Pro Arg Arg His Trp Thr
Thr Gln Asp Cys Asn 130 135 140tgt tct
atc tat ccc ggc cat ata acg ggt cat cgc atg gca tgg gat 480Cys Ser
Ile Tyr Pro Gly His Ile Thr Gly His Arg Met Ala Trp Asp145
150 155 160atg atg atg aac tgg tcc cct
acg gca gcg ttg gtg gta gct cag ctg 528Met Met Met Asn Trp Ser Pro
Thr Ala Ala Leu Val Val Ala Gln Leu 165
170 175ctc cgg atc cca caa gcc atc atg gac atg atc gct
ggt gct cac tgg 576Leu Arg Ile Pro Gln Ala Ile Met Asp Met Ile Ala
Gly Ala His Trp 180 185 190gga
gtc ctg gcg ggc ata gcg tat ttc tcc atg gtg ggg aac tgg gcg 624Gly
Val Leu Ala Gly Ile Ala Tyr Phe Ser Met Val Gly Asn Trp Ala 195
200 205aag gtc ctg gta gtg ctg ctg cta ttt
gcc ggc gtc gac gcg gaa acc 672Lys Val Leu Val Val Leu Leu Leu Phe
Ala Gly Val Asp Ala Glu Thr 210 215
220cac gtc acc ggg gga aat gcc ggc cgc acc acg gct ggg ctt gtt ggt
720His Val Thr Gly Gly Asn Ala Gly Arg Thr Thr Ala Gly Leu Val Gly225
230 235 240ctc ctt aca cca
ggc gcc aag cag aac atc caa ctg atc aac acc aac 768Leu Leu Thr Pro
Gly Ala Lys Gln Asn Ile Gln Leu Ile Asn Thr Asn 245
250 255ggc agt tgg cac atc aat agc acg gcc ttg
aat tgc aat gaa agc ctt 816Gly Ser Trp His Ile Asn Ser Thr Ala Leu
Asn Cys Asn Glu Ser Leu 260 265
270aac acc ggc tgg tta gca ggg ctc ttc tat caa cac aaa ttc aac tct
864Asn Thr Gly Trp Leu Ala Gly Leu Phe Tyr Gln His Lys Phe Asn Ser
275 280 285tca ggc tgt cct gag agg ttg
gcc agc tgc cga cgc ctt acc gat ttt 912Ser Gly Cys Pro Glu Arg Leu
Ala Ser Cys Arg Arg Leu Thr Asp Phe 290 295
300gcc cag ggc tgg ggt cct atc agt tat gcc aac gga agc ggc ctc gac
960Ala Gln Gly Trp Gly Pro Ile Ser Tyr Ala Asn Gly Ser Gly Leu Asp305
310 315 320gaa cgc ccc tac
tgc tgg cac tac cct cca aga cct tgt ggc att gtg 1008Glu Arg Pro Tyr
Cys Trp His Tyr Pro Pro Arg Pro Cys Gly Ile Val 325
330 335ccc gca aag agc gtg tgt ggc ccg gta tat
tgc ttc act ccc agc ccc 1056Pro Ala Lys Ser Val Cys Gly Pro Val Tyr
Cys Phe Thr Pro Ser Pro 340 345
350gtg gtg gtg gga acg acc gac agg tcg ggc gcg cct acc tac agc tgg
1104Val Val Val Gly Thr Thr Asp Arg Ser Gly Ala Pro Thr Tyr Ser Trp
355 360 365ggt gca aat gat acg gat gtc
ttc gtc ctt aac aac acc agg cca ccg 1152Gly Ala Asn Asp Thr Asp Val
Phe Val Leu Asn Asn Thr Arg Pro Pro 370 375
380ctg ggc aat tgg ttc ggt tgt acc tgg atg aac tca act gga ttc acc
1200Leu Gly Asn Trp Phe Gly Cys Thr Trp Met Asn Ser Thr Gly Phe Thr385
390 395 400aaa gtg tgc gga
gcg ccc cct tgt gtc atc gga ggg gtg ggc aac aac 1248Lys Val Cys Gly
Ala Pro Pro Cys Val Ile Gly Gly Val Gly Asn Asn 405
410 415acc ttg ctc tgc ccc act gat tgc ttc cgc
aaa cat ccg gaa gcc aca 1296Thr Leu Leu Cys Pro Thr Asp Cys Phe Arg
Lys His Pro Glu Ala Thr 420 425
430tac tct cgg tgc ggc tcc ggt ccc tgg att aca ccc agg tgc atg gtc
1344Tyr Ser Arg Cys Gly Ser Gly Pro Trp Ile Thr Pro Arg Cys Met Val
435 440 445gac tac ccg tat agg ctt tgg
cac tat cct tgt acc atc aat tac acc 1392Asp Tyr Pro Tyr Arg Leu Trp
His Tyr Pro Cys Thr Ile Asn Tyr Thr 450 455
460ata ttc aaa gtc agg atg tac gtg gga ggg gtc gag cac agg ctg gaa
1440Ile Phe Lys Val Arg Met Tyr Val Gly Gly Val Glu His Arg Leu Glu465
470 475 480gcg gcc tgc aac
tgg acg cgg ggc gaa cgc tgt gat ctg gaa gac agg 1488Ala Ala Cys Asn
Trp Thr Arg Gly Glu Arg Cys Asp Leu Glu Asp Arg 485
490 495gac agg tcc gag ctc agc ccg ttg ctg ctg
tcc acc aca cag tgg cag 1536Asp Arg Ser Glu Leu Ser Pro Leu Leu Leu
Ser Thr Thr Gln Trp Gln 500 505
510gtc ctt ccg tgt tct ttc acg acc ctg cca gcc ttg tcc acc ggc ctc
1584Val Leu Pro Cys Ser Phe Thr Thr Leu Pro Ala Leu Ser Thr Gly Leu
515 520 525atc cac ctc cac cag aac att
gtg gac gtg cag tac ttg tac ggg gta 1632Ile His Leu His Gln Asn Ile
Val Asp Val Gln Tyr Leu Tyr Gly Val 530 535
540ggg tca agc atc gcg tcc tgg gcc att aag tgg gag tac gtc gtt ctc
1680Gly Ser Ser Ile Ala Ser Trp Ala Ile Lys Trp Glu Tyr Val Val Leu545
550 555 560ctg ttc ctt ctg
ctt gca gac gcg cgc gtc tgc tcc tgc ttg tgg atg 1728Leu Phe Leu Leu
Leu Ala Asp Ala Arg Val Cys Ser Cys Leu Trp Met 565
570 575atg tta ctc ata tcc caa gcg gag gcg gct
gga cta gtg cgg ccg ctt 1776Met Leu Leu Ile Ser Gln Ala Glu Ala Ala
Gly Leu Val Arg Pro Leu 580 585
590tcg aat cta gag cct gca gtc tcg agg cat gcg gta cca agc ttg tcg
1824Ser Asn Leu Glu Pro Ala Val Ser Arg His Ala Val Pro Ser Leu Ser
595 600 605aga agt act aga gga tca taa
1845Arg Ser Thr Arg Gly Ser
61076614PRTHCV E1E2 76Met Ser Tyr Tyr His His His His His His Asp Tyr Asp
Ile Pro Thr1 5 10 15Thr
Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu Phe Tyr Gln 20
25 30Val Arg Asn Ser Ser Gly Leu Tyr
His Val Thr Asn Asp Cys Pro Asn 35 40
45Ser Ser Ile Val Tyr Glu Ala Ala Asp Ala Ile Leu His Thr Pro Gly
50 55 60Cys Val Pro Cys Val Arg Glu Gly
Asn Ala Ser Arg Cys Trp Val Ala65 70 75
80Val Thr Pro Thr Val Ala Thr Arg Asp Gly Lys Leu Pro
Thr Thr Gln 85 90 95Leu
Arg Arg His Ile Asp Leu Leu Val Gly Ser Ala Thr Leu Cys Ser
100 105 110Ala Leu Tyr Val Gly Asp Leu
Cys Gly Ser Val Phe Leu Val Gly Gln 115 120
125Leu Phe Thr Phe Ser Pro Arg Arg His Trp Thr Thr Gln Asp Cys
Asn 130 135 140Cys Ser Ile Tyr Pro Gly
His Ile Thr Gly His Arg Met Ala Trp Asp145 150
155 160Met Met Met Asn Trp Ser Pro Thr Ala Ala Leu
Val Val Ala Gln Leu 165 170
175Leu Arg Ile Pro Gln Ala Ile Met Asp Met Ile Ala Gly Ala His Trp
180 185 190Gly Val Leu Ala Gly Ile
Ala Tyr Phe Ser Met Val Gly Asn Trp Ala 195 200
205Lys Val Leu Val Val Leu Leu Leu Phe Ala Gly Val Asp Ala
Glu Thr 210 215 220His Val Thr Gly Gly
Asn Ala Gly Arg Thr Thr Ala Gly Leu Val Gly225 230
235 240Leu Leu Thr Pro Gly Ala Lys Gln Asn Ile
Gln Leu Ile Asn Thr Asn 245 250
255Gly Ser Trp His Ile Asn Ser Thr Ala Leu Asn Cys Asn Glu Ser Leu
260 265 270Asn Thr Gly Trp Leu
Ala Gly Leu Phe Tyr Gln His Lys Phe Asn Ser 275
280 285Ser Gly Cys Pro Glu Arg Leu Ala Ser Cys Arg Arg
Leu Thr Asp Phe 290 295 300Ala Gln Gly
Trp Gly Pro Ile Ser Tyr Ala Asn Gly Ser Gly Leu Asp305
310 315 320Glu Arg Pro Tyr Cys Trp His
Tyr Pro Pro Arg Pro Cys Gly Ile Val 325
330 335Pro Ala Lys Ser Val Cys Gly Pro Val Tyr Cys Phe
Thr Pro Ser Pro 340 345 350Val
Val Val Gly Thr Thr Asp Arg Ser Gly Ala Pro Thr Tyr Ser Trp 355
360 365Gly Ala Asn Asp Thr Asp Val Phe Val
Leu Asn Asn Thr Arg Pro Pro 370 375
380Leu Gly Asn Trp Phe Gly Cys Thr Trp Met Asn Ser Thr Gly Phe Thr385
390 395 400Lys Val Cys Gly
Ala Pro Pro Cys Val Ile Gly Gly Val Gly Asn Asn 405
410 415Thr Leu Leu Cys Pro Thr Asp Cys Phe Arg
Lys His Pro Glu Ala Thr 420 425
430Tyr Ser Arg Cys Gly Ser Gly Pro Trp Ile Thr Pro Arg Cys Met Val
435 440 445Asp Tyr Pro Tyr Arg Leu Trp
His Tyr Pro Cys Thr Ile Asn Tyr Thr 450 455
460Ile Phe Lys Val Arg Met Tyr Val Gly Gly Val Glu His Arg Leu
Glu465 470 475 480Ala Ala
Cys Asn Trp Thr Arg Gly Glu Arg Cys Asp Leu Glu Asp Arg
485 490 495Asp Arg Ser Glu Leu Ser Pro
Leu Leu Leu Ser Thr Thr Gln Trp Gln 500 505
510Val Leu Pro Cys Ser Phe Thr Thr Leu Pro Ala Leu Ser Thr
Gly Leu 515 520 525Ile His Leu His
Gln Asn Ile Val Asp Val Gln Tyr Leu Tyr Gly Val 530
535 540Gly Ser Ser Ile Ala Ser Trp Ala Ile Lys Trp Glu
Tyr Val Val Leu545 550 555
560Leu Phe Leu Leu Leu Ala Asp Ala Arg Val Cys Ser Cys Leu Trp Met
565 570 575Met Leu Leu Ile Ser
Gln Ala Glu Ala Ala Gly Leu Val Arg Pro Leu 580
585 590Ser Asn Leu Glu Pro Ala Val Ser Arg His Ala Val
Pro Ser Leu Ser 595 600 605Arg Ser
Thr Arg Gly Ser 610772517DNAArtificialHepatitis C virus plus murine
77atg tcg tac tac cat cac cat cac cat cac gat tac gat atc cca acg
48Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro Thr1
5 10 15acc gaa aac ctg tat ttt
cag ggc gcc atg gat ccg gaa ttc tac caa 96Thr Glu Asn Leu Tyr Phe
Gln Gly Ala Met Asp Pro Glu Phe Tyr Gln 20 25
30gtg cgc aat tcc tcg ggg ctt tac cat gtc acc aat gat
tgc cct aac 144Val Arg Asn Ser Ser Gly Leu Tyr His Val Thr Asn Asp
Cys Pro Asn 35 40 45tcg agt att
gtg tac gag gcg gcc gat gcc atc ctg cac act ccg ggg 192Ser Ser Ile
Val Tyr Glu Ala Ala Asp Ala Ile Leu His Thr Pro Gly 50
55 60tgt gtc cct tgc gtt cgc gag ggt aac gcc tcg agg
tgt tgg gtg gcg 240Cys Val Pro Cys Val Arg Glu Gly Asn Ala Ser Arg
Cys Trp Val Ala65 70 75
80gtg acc ccc acg gtg gcc acc agg gac ggc aaa ctc ccc aca acg cag
288Val Thr Pro Thr Val Ala Thr Arg Asp Gly Lys Leu Pro Thr Thr Gln
85 90 95ctt cga cgt cat atc gat
ctg ctt gtc ggg agc gcc acc ctc tgc tcg 336Leu Arg Arg His Ile Asp
Leu Leu Val Gly Ser Ala Thr Leu Cys Ser 100
105 110gcc ctc tac gtg ggg gac ctg tgc ggg tct gtc ttt
ctt gtt ggt caa 384Ala Leu Tyr Val Gly Asp Leu Cys Gly Ser Val Phe
Leu Val Gly Gln 115 120 125ctg ttt
acc ttc tct ccc agg cgc cac tgg acg acg caa gac tgc aat 432Leu Phe
Thr Phe Ser Pro Arg Arg His Trp Thr Thr Gln Asp Cys Asn 130
135 140tgt tct atc tat ccc ggc cat ata acg ggt cat
cgc atg gca tgg gat 480Cys Ser Ile Tyr Pro Gly His Ile Thr Gly His
Arg Met Ala Trp Asp145 150 155
160atg atg atg aac tgg tcc cct acg gca gcg ttg gtg gta gct cag ctg
528Met Met Met Asn Trp Ser Pro Thr Ala Ala Leu Val Val Ala Gln Leu
165 170 175ctc cgg atc cca caa
gcc atc atg gac atg atc gct ggt gct cac tgg 576Leu Arg Ile Pro Gln
Ala Ile Met Asp Met Ile Ala Gly Ala His Trp 180
185 190gga gtc ctg gcg ggc ata gcg tat ttc tcc atg gtg
ggg aac tgg gcg 624Gly Val Leu Ala Gly Ile Ala Tyr Phe Ser Met Val
Gly Asn Trp Ala 195 200 205aag gtc
ctg gta gtg ctg ctg cta ttt gcc ggc gtc gac gcg gaa acc 672Lys Val
Leu Val Val Leu Leu Leu Phe Ala Gly Val Asp Ala Glu Thr 210
215 220cac gtc acc ggg gga aat gcc ggc cgc acc acg
gct ggg ctt gtt ggt 720His Val Thr Gly Gly Asn Ala Gly Arg Thr Thr
Ala Gly Leu Val Gly225 230 235
240ctc ctt aca cca ggc gcc aag cag aac atc caa ctg atc aac acc aac
768Leu Leu Thr Pro Gly Ala Lys Gln Asn Ile Gln Leu Ile Asn Thr Asn
245 250 255ggc agt tgg cac atc
aat agc acg gcc ttg aat tgc aat gaa agc ctt 816Gly Ser Trp His Ile
Asn Ser Thr Ala Leu Asn Cys Asn Glu Ser Leu 260
265 270aac acc ggc tgg tta gca ggg ctc ttc tat caa cac
aaa ttc aac tct 864Asn Thr Gly Trp Leu Ala Gly Leu Phe Tyr Gln His
Lys Phe Asn Ser 275 280 285tca ggc
tgt cct gag agg ttg gcc agc tgc cga cgc ctt acc gat ttt 912Ser Gly
Cys Pro Glu Arg Leu Ala Ser Cys Arg Arg Leu Thr Asp Phe 290
295 300gcc cag ggc tgg ggt cct atc agt tat gcc aac
gga agc ggc ctc gac 960Ala Gln Gly Trp Gly Pro Ile Ser Tyr Ala Asn
Gly Ser Gly Leu Asp305 310 315
320gaa cgc ccc tac tgc tgg cac tac cct cca aga cct tgt ggc att gtg
1008Glu Arg Pro Tyr Cys Trp His Tyr Pro Pro Arg Pro Cys Gly Ile Val
325 330 335ccc gca aag agc gtg
tgt ggc ccg gta tat tgc ttc act ccc agc ccc 1056Pro Ala Lys Ser Val
Cys Gly Pro Val Tyr Cys Phe Thr Pro Ser Pro 340
345 350gtg gtg gtg gga acg acc gac agg tcg ggc gcg cct
acc tac agc tgg 1104Val Val Val Gly Thr Thr Asp Arg Ser Gly Ala Pro
Thr Tyr Ser Trp 355 360 365ggt gca
aat gat acg gat gtc ttc gtc ctt aac aac acc agg cca ccg 1152Gly Ala
Asn Asp Thr Asp Val Phe Val Leu Asn Asn Thr Arg Pro Pro 370
375 380ctg ggc aat tgg ttc ggt tgt acc tgg atg aac
tca act gga ttc acc 1200Leu Gly Asn Trp Phe Gly Cys Thr Trp Met Asn
Ser Thr Gly Phe Thr385 390 395
400aaa gtg tgc gga gcg ccc cct tgt gtc atc gga ggg gtg ggc aac aac
1248Lys Val Cys Gly Ala Pro Pro Cys Val Ile Gly Gly Val Gly Asn Asn
405 410 415acc ttg ctc tgc ccc
act gat tgc ttc cgc aaa cat ccg gaa gcc aca 1296Thr Leu Leu Cys Pro
Thr Asp Cys Phe Arg Lys His Pro Glu Ala Thr 420
425 430tac tct cgg tgc ggc tcc ggt ccc tgg att aca ccc
agg tgc atg gtc 1344Tyr Ser Arg Cys Gly Ser Gly Pro Trp Ile Thr Pro
Arg Cys Met Val 435 440 445gac tac
ccg tat agg ctt tgg cac tat cct tgt acc atc aat tac acc 1392Asp Tyr
Pro Tyr Arg Leu Trp His Tyr Pro Cys Thr Ile Asn Tyr Thr 450
455 460ata ttc aaa gtc agg atg tac gtg gga ggg gtc
gag cac agg ctg gaa 1440Ile Phe Lys Val Arg Met Tyr Val Gly Gly Val
Glu His Arg Leu Glu465 470 475
480gcg gcc tgc aac tgg acg cgg ggc gaa cgc tgt gat ctg gaa gac agg
1488Ala Ala Cys Asn Trp Thr Arg Gly Glu Arg Cys Asp Leu Glu Asp Arg
485 490 495gac agg tcc gag ctc
agc ccg ttg ctg ctg tcc acc aca cag tgg cag 1536Asp Arg Ser Glu Leu
Ser Pro Leu Leu Leu Ser Thr Thr Gln Trp Gln 500
505 510gtc ctt ccg tgt tct ttc acg acc ctg cca gcc ttg
tcc acc ggc ctc 1584Val Leu Pro Cys Ser Phe Thr Thr Leu Pro Ala Leu
Ser Thr Gly Leu 515 520 525atc cac
ctc cac cag aac att gtg gac gtg cag tac ttg tac ggg gta 1632Ile His
Leu His Gln Asn Ile Val Asp Val Gln Tyr Leu Tyr Gly Val 530
535 540ggg tca agc atc gcg tcc tgg gcc att aag tgg
gag tac gtc gtt ctc 1680Gly Ser Ser Ile Ala Ser Trp Ala Ile Lys Trp
Glu Tyr Val Val Leu545 550 555
560ctg ttc ctt ctg ctt gca gac gcg cgc gtc tgc tcc tgc ttg tgg atg
1728Leu Phe Leu Leu Leu Ala Asp Ala Arg Val Cys Ser Cys Leu Trp Met
565 570 575atg tta ctc ata tcc
caa gcg gag gcg gct gga cta gtg cgg ccg caa 1776Met Leu Leu Ile Ser
Gln Ala Glu Ala Ala Gly Leu Val Arg Pro Gln 580
585 590ggc ggc gga tcc gtg gac aag aaa att gtg ccc agg
gat tgt ggt tgt 1824Gly Gly Gly Ser Val Asp Lys Lys Ile Val Pro Arg
Asp Cys Gly Cys 595 600 605aag cct
tgc ata tgt aca gtc cca gaa gta tca tct gtc ttc atc ttc 1872Lys Pro
Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe 610
615 620ccc cca aag ccc aag gat gtg ctc acc att act
ctg act cct aag gtc 1920Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr
Leu Thr Pro Lys Val625 630 635
640acg tgt gtt gtg gta gac atc agc aag gat gat ccc gag gtc cag ttc
1968Thr Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe
645 650 655agc tgg ttt gta gat
gat gtg gag gtg cac aca gct cag acg caa ccc 2016Ser Trp Phe Val Asp
Asp Val Glu Val His Thr Ala Gln Thr Gln Pro 660
665 670cgg gag gag cag ttc aac agc act ttc cgc tca gtc
agt gaa ctt ccc 2064Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val
Ser Glu Leu Pro 675 680 685atc atg
cac cag gac tgg ctc aat ggc aag gag ttc aaa tgc agg gtc 2112Ile Met
His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val 690
695 700aac agt gca gct ttc cct gcc ccc atc gag aaa
acc atc tcc aaa acc 2160Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys
Thr Ile Ser Lys Thr705 710 715
720aaa ggc aga ccg aag gct cca cag gtg tac acc att cca cct ccc aag
2208Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys
725 730 735gag cag atg gcc aag
gat aaa gtc agt ctg acc tgc atg ata aca gac 2256Glu Gln Met Ala Lys
Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asp 740
745 750ttc ttc cct gaa gac att act gtg gag tgg cag tgg
aat ggg cag cca 2304Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp
Asn Gly Gln Pro 755 760 765gcg gag
aac tac aag aac act cag ccc atc atg gac aca gat ggc tct 2352Ala Glu
Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser 770
775 780tac ttc gtc tac agc aag ctc aat gtg cag aag
agc aac tgg gag gca 2400Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys
Ser Asn Trp Glu Ala785 790 795
800gga aat act ttc acc tgc tct gtg tta cat gag ggc ctg cac aac cac
2448Gly Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His Asn His
805 810 815cat act gag aag agc
ctc tcc cac tct cct ggg ctg caa agc ttg tcg 2496His Thr Glu Lys Ser
Leu Ser His Ser Pro Gly Leu Gln Ser Leu Ser 820
825 830aga agt act aga gga tca taa
2517Arg Ser Thr Arg Gly Ser
83578838PRTArtificialSynthetic Construct 78Met Ser Tyr Tyr His His His
His His His Asp Tyr Asp Ile Pro Thr1 5 10
15Thr Glu Asn Leu Tyr Phe Gln Gly Ala Met Asp Pro Glu
Phe Tyr Gln 20 25 30Val Arg
Asn Ser Ser Gly Leu Tyr His Val Thr Asn Asp Cys Pro Asn 35
40 45Ser Ser Ile Val Tyr Glu Ala Ala Asp Ala
Ile Leu His Thr Pro Gly 50 55 60Cys
Val Pro Cys Val Arg Glu Gly Asn Ala Ser Arg Cys Trp Val Ala65
70 75 80Val Thr Pro Thr Val Ala
Thr Arg Asp Gly Lys Leu Pro Thr Thr Gln 85
90 95Leu Arg Arg His Ile Asp Leu Leu Val Gly Ser Ala
Thr Leu Cys Ser 100 105 110Ala
Leu Tyr Val Gly Asp Leu Cys Gly Ser Val Phe Leu Val Gly Gln 115
120 125Leu Phe Thr Phe Ser Pro Arg Arg His
Trp Thr Thr Gln Asp Cys Asn 130 135
140Cys Ser Ile Tyr Pro Gly His Ile Thr Gly His Arg Met Ala Trp Asp145
150 155 160Met Met Met Asn
Trp Ser Pro Thr Ala Ala Leu Val Val Ala Gln Leu 165
170 175Leu Arg Ile Pro Gln Ala Ile Met Asp Met
Ile Ala Gly Ala His Trp 180 185
190Gly Val Leu Ala Gly Ile Ala Tyr Phe Ser Met Val Gly Asn Trp Ala
195 200 205Lys Val Leu Val Val Leu Leu
Leu Phe Ala Gly Val Asp Ala Glu Thr 210 215
220His Val Thr Gly Gly Asn Ala Gly Arg Thr Thr Ala Gly Leu Val
Gly225 230 235 240Leu Leu
Thr Pro Gly Ala Lys Gln Asn Ile Gln Leu Ile Asn Thr Asn
245 250 255Gly Ser Trp His Ile Asn Ser
Thr Ala Leu Asn Cys Asn Glu Ser Leu 260 265
270Asn Thr Gly Trp Leu Ala Gly Leu Phe Tyr Gln His Lys Phe
Asn Ser 275 280 285Ser Gly Cys Pro
Glu Arg Leu Ala Ser Cys Arg Arg Leu Thr Asp Phe 290
295 300Ala Gln Gly Trp Gly Pro Ile Ser Tyr Ala Asn Gly
Ser Gly Leu Asp305 310 315
320Glu Arg Pro Tyr Cys Trp His Tyr Pro Pro Arg Pro Cys Gly Ile Val
325 330 335Pro Ala Lys Ser Val
Cys Gly Pro Val Tyr Cys Phe Thr Pro Ser Pro 340
345 350Val Val Val Gly Thr Thr Asp Arg Ser Gly Ala Pro
Thr Tyr Ser Trp 355 360 365Gly Ala
Asn Asp Thr Asp Val Phe Val Leu Asn Asn Thr Arg Pro Pro 370
375 380Leu Gly Asn Trp Phe Gly Cys Thr Trp Met Asn
Ser Thr Gly Phe Thr385 390 395
400Lys Val Cys Gly Ala Pro Pro Cys Val Ile Gly Gly Val Gly Asn Asn
405 410 415Thr Leu Leu Cys
Pro Thr Asp Cys Phe Arg Lys His Pro Glu Ala Thr 420
425 430Tyr Ser Arg Cys Gly Ser Gly Pro Trp Ile Thr
Pro Arg Cys Met Val 435 440 445Asp
Tyr Pro Tyr Arg Leu Trp His Tyr Pro Cys Thr Ile Asn Tyr Thr 450
455 460Ile Phe Lys Val Arg Met Tyr Val Gly Gly
Val Glu His Arg Leu Glu465 470 475
480Ala Ala Cys Asn Trp Thr Arg Gly Glu Arg Cys Asp Leu Glu Asp
Arg 485 490 495Asp Arg Ser
Glu Leu Ser Pro Leu Leu Leu Ser Thr Thr Gln Trp Gln 500
505 510Val Leu Pro Cys Ser Phe Thr Thr Leu Pro
Ala Leu Ser Thr Gly Leu 515 520
525Ile His Leu His Gln Asn Ile Val Asp Val Gln Tyr Leu Tyr Gly Val 530
535 540Gly Ser Ser Ile Ala Ser Trp Ala
Ile Lys Trp Glu Tyr Val Val Leu545 550
555 560Leu Phe Leu Leu Leu Ala Asp Ala Arg Val Cys Ser
Cys Leu Trp Met 565 570
575Met Leu Leu Ile Ser Gln Ala Glu Ala Ala Gly Leu Val Arg Pro Gln
580 585 590Gly Gly Gly Ser Val Asp
Lys Lys Ile Val Pro Arg Asp Cys Gly Cys 595 600
605Lys Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe
Ile Phe 610 615 620Pro Pro Lys Pro Lys
Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val625 630
635 640Thr Cys Val Val Val Asp Ile Ser Lys Asp
Asp Pro Glu Val Gln Phe 645 650
655Ser Trp Phe Val Asp Asp Val Glu Val His Thr Ala Gln Thr Gln Pro
660 665 670Arg Glu Glu Gln Phe
Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro 675
680 685Ile Met His Gln Asp Trp Leu Asn Gly Lys Glu Phe
Lys Cys Arg Val 690 695 700Asn Ser Ala
Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr705
710 715 720Lys Gly Arg Pro Lys Ala Pro
Gln Val Tyr Thr Ile Pro Pro Pro Lys 725
730 735Glu Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys
Met Ile Thr Asp 740 745 750Phe
Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro 755
760 765Ala Glu Asn Tyr Lys Asn Thr Gln Pro
Ile Met Asp Thr Asp Gly Ser 770 775
780Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn Trp Glu Ala785
790 795 800Gly Asn Thr Phe
Thr Cys Ser Val Leu His Glu Gly Leu His Asn His 805
810 815His Thr Glu Lys Ser Leu Ser His Ser Pro
Gly Leu Gln Ser Leu Ser 820 825
830Arg Ser Thr Arg Gly Ser 835795PRTMus musculus 79Val Asp Lys
Lys Ile1 5
User Contributions:
Comment about this patent or add new information about this topic: