Patent application title: Production of Transgenic Avians Using Improved Retroviral Vectors
Inventors:
Alex J. Harvey (Athens, GA, US)
Jeffrey C. Rapp (Athens, GA, US)
IPC8 Class: AC12N1585FI
USPC Class:
800 4
Class name: Multicellular living organisms and unmodified parts thereof and related processes method of using a transgenic nonhuman animal to manufacture a protein which is then to be isolated or extracted
Publication date: 2013-10-17
Patent application number: 20130276153
Abstract:
A transgenic avian containing in its genome an exogenous nucleotide
sequence which includes a promoter component and a vector with reduced
promoter interference wherein the exogenous nucleotide sequence is
integrated into the genome and the avian.Claims:
1. A method of producing an exogenous protein comprising producing a
transgenic avian having a nucleotide sequence comprising a
self-inactivation (SIN) vector having no selectable marker and a promoter
component operably linked to an exogenous coding sequence, wherein the
exogenous coding sequence is expressed in oviduct cells of the avian; and
obtaining the exogenous protein from egg white of the avian.
2. The method of claim 1, wherein the exogenous coding sequence encodes a human protein.
3. The method of claim 1, wherein the exogenous coding sequence encodes a therapeutic protein.
4. The method of claim 1, wherein the promoter component comprises a functional promoter sequence of a promoter selected from the group consisting of avian ovalbumin promoter component, avian ovomucoid promoter component, avian lysozyme promoter component and avian conalbumin promoter component.
5. The method of claim 1, wherein the avian is selected from the group consisting of a chicken, a turkey and a quail.
6. The method of claim 1, wherein the self-inactivation vector comprises nucleotide sequences set forth in SEQ ID NOs: 25, 26 and 29 or nucleotide sequences having at least 90% identity thereto.
7. The method of claim 1, wherein the promoter component comprises a nucleotide sequence having at least 90% identity to the sequence set forth in 5209 through 8311 of SEQ ID NO:22.
8. A transgenic avian containing in its genome an exogenous nucleotide sequence comprising a promoter component and a self-inactivation (SIN) vector having no selectable marker, wherein the avian produces an exogenous protein.
9. The transgenic avian of claim 8, wherein the promoter component comprises a functional promoter sequence of a promoter selected from the group consisting of avian ovalbumin promoter component, avian ovomucoid promoter component and avian lysozyme promoter component.
10. The transgenic avian of claim 8, wherein the avian is selected from the group consisting of a chicken, a turkey and a quail.
11. The transgenic avian of claim 8, wherein the exogenous nucleotide sequence comprises nucleotide sequences set forth in SEQ ID NOs: 25, 26 and 29 or nucleotide sequences having at least 90% identity thereto.
12. The transgenic avian of claim 8, wherein the exogenous nucleotide sequence comprises a nucleotide sequence having at least 90% identity to the sequence set forth in 5209 through 8311 of SEQ ID NO:22.
Description:
RELATED APPLICATION INFORMATION
[0001] This application is Continuation of U.S. patent application Ser. No. 13/179,281, which is Divisional of U.S. patent application Ser. No. 11/978,360, now abandoned, which claims the benefit of U.S. provisional application Nos. 60/930,491, filed May 16, 2007 and 60/994,203, filed Sep. 18, 2007 and is a continuation-in-part of U.S. patent application Ser. No. 11/699,257, filed Jan. 26, 2007, now U.S. Pat. No. 7,541,512, issued Jun. 2, 2009, and is also a continuation-in-part of U.S. patent application Ser. No. 11/799,253, filed May 1, 2007, now abandoned, which is a continuation-in-part of U.S. patent application Ser. No. 11/210,165, filed Aug. 23, 2005, now abandoned, which claims the benefit of U.S. provisional application No. 60/640,203, filed Dec. 29, 2004. The disclosures of each of these US patent applications and provisional applications are incorporated herein by reference in their entirety.
FIELD OF THE INVENTION
[0002] The present invention relates generally to the use of promoters which function in cells of a transgenic avian (e.g., oviduct cells) such as a transgenic chicken and vectors which contain such promoters. More specifically, the invention relates to recombinant nucleic acids and expression vectors, transfected cells and transgenic animals, for example, transgenic avians such as transgenic chickens, that contain vectors with gene expression controlling regions operably linked to coding sequences.
BACKGROUND
[0003] The field of transgenics was initially developed to understand the action of a single gene in the context of the whole animal and the phenomena of gene activation, expression and interaction. Transgenics technology has also been used to produce models for various diseases in humans and other animals and is among the most powerful tools available for the study of genetics, and the understanding of genetic mechanisms and function. From an economic perspective, the use of transgenic technology to convert animals into "protein factories" for the production of specific proteins or other substances of pharmaceutical interest (Gordon et al., 1987, Biotechnology 5: 1183-1187; Wilmut et al., 1990, Theriogenology 33: 113-123) offers significant advantages over more conventional methods of protein production by gene expression.
[0004] One system useful for expressing foreign proteins is the avian reproductive system. The production of an avian egg begins with formation of a large yolk in the ovary of the hen. The unfertilized oocyte or ovum is positioned on top of the yolk sac. After ovulation, the ovum passes into the infundibulum of the oviduct where it is fertilized, if sperm are present, and then moves into the magnum of the oviduct, which is lined with tubular gland cells. These cells secrete the egg-white proteins, including ovalbumin, lysozyme, ovomucoid, conalbumin and ovomucin, into the lumen of the magnum where they are deposited onto the avian embryo and yolk. In the past exogenous protein production has been performed in the avian reproductive system specifically targeting the avian oviduct.
[0005] Advantages of targeting the avian oviduct for exogenous protein expression can include proper folding and post-translation modification of the target protein, the ease of product recovery, and a shorter developmental period of birds such as chickens compared to other animal species.
[0006] Directing expression of a heterologous gene product in the oviduct of a transgenic avian can be significantly advantageous over ubiquitous expression in the bird. That is, the consequences of ubiquitous expression of a bioactive gene product in a host animal may be undesirable. For example, in certain instances the ubiquitous presence of the recombinant protein may be harmful to the development of the avian which can kill the bird. Additionally, the bird's health may be negatively effected leading to reduced levels of protein production.
[0007] By weight, approximately 60% of an avian egg is composed of albumen which is composed of four major protein components; ovalbumin, ovomucoid, lysozyme and ovotransferrin with ovalbumin and ovomucoid being present in the greatest quantities.
[0008] The ovalbumin promoter, ovomucoid promoter and lysozyme promoter have been successfully employed for the production of heterologous (exogenous) protein in the oviduct of transgenic avians in the past. See, for example, U.S. Pat. Nos. 6,875,588, issued Apr. 5, 2005; 7,176,300, issued Feb. 13, 2007; 7,199,279, issued Apr. 3, 2007; and US patent publication No. 2006/0130170, published Jun. 15, 2006 (the disclosures of each of these three issued patents and one published patent application are incorporated in their entirety herein by reference) which discloses the production of exogenous protein in the avian oviduct facilitated by various avian promoters which are primarily or exclusively expressed in the oviduct. Though expression levels in avians using the promoters and fragments of the promoters disclosed in these issued patents and published application have been at useful levels, the yields have typically been well below 0.1 mg/ml of egg white.
[0009] What is needed is a system that will provide for high level expression of an exogenous coding sequence in the cells of a transgenic avian, in particular, in the oviduct cells (e.g., tubular gland cells) of a transgenic avian.
SUMMARY OF THE INVENTION
[0010] The present invention meets this need and more. After years of exogenous protein production in transgenic avian oviduct tissue with modest yield the inventors of the present invention have discovered that such production levels can be boosted by about 10 fold to about 100 fold and more by employing new compositions and methods as disclosed herein.
[0011] In one aspect, the invention is directed to transgenic avians (e.g., chicken, turkey, quail) containing in their genome an exogenous nucleotide sequence which includes a promoter component and a SIN vector. Typically, the promoter component is linked to a coding sequence exogenous to the avian, i.e., the coding sequence is not normally or naturally present in the avian. Typically, the exogenous nucleotide sequence is integrated into the genome of the avian. In one particularly useful embodiment, the promoter component functions or expresses primarily in the oviduct (e.g., tubular gland cells) of an avian. For example, the promoter component may be an oviduct specific promoter. For example, the promoter component may be one of an avian ovomucoid promoter component, an avian ovalbumin promoter component, an avian lysozyme promoter component and an avian ovoinhibitor promoter component (i.e., conalbumin promoter component).
[0012] SIN vectors have been shown by the inventors to be particularly useful for increasing the quantity of exogenous protein produced in the avian oviduct. This effect can be further enhanced when the SIN vector is also an SC negative vector (i.e., a vector not containing a selectable marker cassette with a functional promoter).
[0013] The invention also includes methods of making the transgenic avians of the invention and methods of producing an exogenous protein using transgenic avians of the invention. In one embodiment, the transgenic avian has a nucleotide sequence in its genome comprising a vector which is at least one of a SIN vector and an SC negative vector. Typically, the nucleotide sequence includes a promoter component linked to an exogenous coding sequence.
[0014] In one useful embodiment, the exogenous coding sequence is expressed in avian oviduct cells and is secreted from the oviduct cells. For example, the exogenous coding sequence may be expressed in tubular gland cells. In one embodiment, the exogenous protein is deposited in a hard shell egg laid by the transgenic avian. In one embodiment, the exogenous protein is a human protein. In one embodiment, the exogenous protein is a therapeutic protein, e.g., a cytokine.
[0015] In one embodiment, the transgenic avian contains an exogenous nucleotide sequence in its genome which has a SC negative vector and a promoter component linked to an exogenous coding sequence encoding an exogenous protein. In one embodiment, the SC negative vector is also a SIN vector.
[0016] In one aspect, avian leukosis virus vector (ALV), a murine leukemia virus (MLV) retroviral vector, moloney murine leukemia Virus (MMLV) and a lentiviral vector can be used in accordance with the invention.
[0017] The invention includes chimeric transgenic avians and fully transgenic germline avians which can be obtained from germline chimeras as is understood by a practitioner of skill in the art of poultry breeding.
[0018] The invention also includes gene expression controlling regions or promoters having a nucleotide sequence (i.e., DNA sequence) similar or identical to the following sequences numbered 1 to 8. In a particularly useful embodiment of the invention, the fragments are listed top to bottom in the 5' to 3' linear order in which they are present on a single DNA molecule. For example, the 3' end of the 3.5 kb OV fragment of sequence 1 would be covalently linked to the 5' end of the 5' UTR-5' portion and the 3' end of the 5' UTR-5' portion would be covalently linked to the 5' end of 5' UTR-3' portion. However, the invention is not limited to any particular order of the fragments and intervening nucleotide sequences may be present between the fragments.
3.5 kb OV fragment (includes DHS I, II & III)
[0019] 5' UTR-5' portion (from Exon L)
[0020] 5' UTR-3' portion (from Exon 1);
2. 3.5 kb OV fragment (includes DHS I, II & III)
[0021] 5' UTR-5' portion (from Exon L)
[0022] Intron A
[0023] 5' UTR-3' portion (from Exon 1)
[0024] 3' UTR;
3. 3.5 kb OV fragment (includes DHS I, II & III)
[0025] 5' UTR-5' portion (from Exon L)
[0026] Intron A
[0027] 5' UTR-3' portion (from Exon 1);
4. 3.5 kb OV fragment (includes DHS I, II & III)
[0028] 5' UTR-5' portion (from Exon L)
[0029] 5' UTR-3' portion (from Exon 1)
[0030] 3' UTR;
5. 3.5 kb OV fragment (includes DHS I, II & III)
[0031] 5' UTR-5' portion (from Exon L)
[0032] Intron A
[0033] 5' UTR-3' portion (from Exon 1)
[0034] 3' UTR/DHS A (bp 13576 to 15163 of SEQ ID NO: 22)
6. 3.5 kb OV fragment (includes DHS I, II & III)
[0035] 5' UTR-5' portion (from Exon L)
[0036] 5' UTR-3' portion (from Exon 1)
[0037] 3' UTR/DHS A (bp 13576 to 15163 of SEQ ID NO: 22)
7. 3.5 kb OV fragment (includes DHS I, II & III)
[0038] 5' UTR-5' portion (from Exon L)
[0039] Intron A
[0040] 5' UTR-3' portion (from Exon 1)
[0041] partial 3' UTR
[0042] RRE (Rev response element) FIG. 9a
8. ALV CTE (FIG. 9 b) inserted 5' of 3.5 kb OV fragment
[0043] 3.5 kb OV fragment (includes DHS I, II & III)
[0044] 5' UTR-5' portion (from Exon L)
[0045] Intron A
[0046] 5' UTR-3' portion (from Exon 1)
[0047] partial 3' UTR;
[0048] Coordinates of some of the elements for specific ovalbumin constructs disclosed herein (e.g., constructs 1 to 8 described above) are shown in the 16051 bp ovalbumin DNA segment of SEQ ID NO: 22 as follows:
[0049] 3.5 kb OV fragment (includes DHS I, II & III): Start: 3199 End: 6659 of FIG. 8 (SEQ ID NO: 22);
[0050] 1.4 kb OV fragment (includes DHS I & II): Start: 5209 End: 6659 of FIG. 8 (SEQ ID NO: 22);
[0051] 3.8 kb OV fragment: Start: 2863 End: 6659 of FIG. 8 (SEQ ID NO: 22);
[0052] 5.2 kb OV fragment: Start: 1463 End: 6659 of FIG. 8 (SEQ ID NO: 22);
[0053] 5' UTR-5' portion (from Exon L): Start: 6659 End: 6705 of FIG. 8 (SEQ ID NO: 22);
[0054] 5' UTR-3' portion (from Exon 1): Start: 8295 End: 8311 of FIG. 8 (SEQ ID NO: 22);
[0055] 3' UTR: Start: 13576 End: 14209 of FIG. 8 (SEQ ID NO: 22);
[0056] partial 3' UTR: Start 13576 End: 13996 of FIG. 8 (SEQ ID NO: 22);
[0057] Intron A: Start: 6706 End: 8294 of FIG. 8 (SEQ ID NO: 22);
[0058] Intron E: Start: 10010 End: 10968 of FIG. 8 (SEQ ID NO: 22);
[0059] Exon L: Start: 6659 End: 6705 of FIG. 8 (SEQ ID NO: 22);
[0060] Exon 1: Start: 8295 End: 8478 of FIG. 8 (SEQ ID NO: 22);
[0061] Exon 2: Start: 8731 End: 8781 of FIG. 8 (SEQ ID NO: 22);
[0062] Exon 3: Start: 9363 End: 9491 of FIG. 8 (SEQ ID NO: 22);
[0063] Exon 4: Start: 9892 End: 10009 of FIG. 8 (SEQ ID NO: 22);
[0064] Exon 5: Start: 10968 End: 11110 of FIG. 8 (SEQ ID NO: 22);
[0065] Exon 6: Start: 11442 End: 11597 of FIG. 8 (SEQ ID NO: 22);
[0066] Exon 7: Start: 13180 End: 13575 of FIG. 8 (SEQ ID NO: 22);
[0067] +1 SITE: Start: 6659 End: 6659 of FIG. 8 (SEQ ID NO: 22);
[0068] ATG: Start: 8312 End: 8312 of FIG. 8 (SEQ ID NO: 22);
[0069] Poly A: Start: 14204 End: 14209 of FIG. 8 (SEQ ID NO: 22);
[0070] TATA: Start: 6627 End: 6632 of FIG. 8 (SEQ ID NO: 22);
[0071] DHS A: Start: 13858 End: 15163 of FIG. 8 (SEQ ID NO: 22);
[0072] DHS IV: Start: 459 End: 859 of FIG. 8 (SEQ ID NO: 22);
[0073] DHS III: Start: 3253 End: 3559 of FIG. 8 (SEQ ID NO: 22);
[0074] DHS II: Start: 5629 End: 6009 of FIG. 8 (SEQ ID NO: 22); and
[0075] DHS I: Start: 6359 End: 6659 of FIG. 8 (SEQ ID NO: 22).
[0076] Promoter constructs are also contemplated that have a nucleotide sequence 80% identical and 85% identical and 90% identical and 91% identical and 92% identical and 93% identical and 94% identical and 95% identical and 96% identical and 97% identical and 98% identical and 99% identical to each of the promoter constructs disclosed herein, such as those described above (i.e., 1 to 8 above).
[0077] The invention also contemplates promoter constructs which correspond to promoter constructs 1 through 8 above in which the 3.5 kb OV fragment is replaced with the 3.8 kb OV fragment. The invention also contemplates promoter constructs which correspond to promoter constructs 1 through 8 in which the 3.5 kb OV fragment is replaced with the 5.2 kb OV fragment.
[0078] Promoter constructs are also contemplated for each of the above specified recombinant promoters (i.e., 1 to 8) in which DHS III is omitted from the construct.
[0079] Promoter constructs are contemplated corresponding to each of constructs 2, 3, 5, 7 and 8 above in which Intron A is replaced with Intron E which may lead to increased levels of exogenous protein production. Intron A and E have DNA sequences that induce alignment of histones in surrounding DNA regions. Such alignment can provide for transcriptional regulation of the OV gene. Without wishing to be bound to any particular theory or mechanism of operation, substitution of Intron E with Intron A may provide a preferential spacing of histones that result from use of Intron E (i.e., the periodicity for Intron A is 202 bp+/-5 bp, for Intron E is 196 bp+/-5 bp). For example, it is believed that the packaging of DNA by histones leads to topological alteration of DNA the manipulation of which can lead to preferential alignment of binding sites for proteins responsible for the transcription regulation (e.g., transcription factors) leading to an enhanced level of transcription.
[0080] Also included in the invention are vector constructs, and other constructs and nucleotide sequences disclosed herein, having a nucleotide sequence 80% identical and 85% identical and 90% identical and 91% identical and 92% identical and 93% identical and 94% identical and 95% identical and 96% identical and 97% identical and 98% identical and 99% identical to each vector construct and other constructs and nucleotide sequences disclosed herein.
[0081] Any useful combination of features described herein is included within the scope of the present invention provided that the features included in any such combination are not mutually inconsistent as will be apparent from the context, this specification, and the knowledge of one of ordinary skill in the art
[0082] Additional objects and aspects of the present invention will become more apparent upon review of the detailed description set forth below when taken in conjunction with the accompanying figures, which are briefly described as follows.
BRIEF DESCRIPTION OF THE FIGURES
[0083] FIG. 1 shows a circular map of the pALV-SIN-4.2-Lys-IFNa-2B vector. The sequence of pALV-SIN-4.2-Lys-IFNa-2B is shown in SEQ ID NO: 1.
[0084] FIG. 2 is a bar graph illustrating expression levels of IFNa in the egg white of a transgenic quail. G0 quail was produced by injection of pALV-SIN-4.0-Lys-IFNa-2B retroviral vector transduction particles into Japanese quail embryos.
[0085] FIG. 3 shows a circular map of the pSIN-OV-3.5-I-CTLA4-inv vector. The nucleotide sequence of pSIN-OV-3.5-I-CTLA4-inv is shown in SEQ ID NO: 19.
[0086] FIG. 4 shows a circular map of the pSIN-3.9-OM-CTLA4-Fc vector. The nucleotide sequence of pSIN-3.9-OM-CTLA4-Fc is shown in SEQ ID NO: 20.
[0087] FIG. 5 shows a circular map of the pBS-OM-4.4 vector. The nucleotide sequence of pBS-OM-4.4 is shown in SEQ ID NO: 23.
[0088] FIG. 6 shows a circular map of the pAVIJCR-A137.91.1.2 vector. The nucleotide sequence of pAVIJCR-A137.91.1.2 is shown in SEQ ID NO: 24.
[0089] FIG. 7 shows a circular map of the pSIN-1.8-OM-IFNa-2B plasmid vector. The nucleotide sequence of pSIN-1.8-OM-IFNa-2B is shown in SEQ ID NO: 21.
[0090] FIG. 8a-e (SEQ ID NO: 22) shows a segment of a chicken ovalbumin gene.
[0091] FIG. 9a (SEQ ID NO: 25) shows the RRE (rev responsive element) sequence of a lenti virus. FIG. 9b (SEQ ID NO: 26) shows the ALV CTE (constitutive transport element) sequence.
[0092] FIG. 10a shows a diagram of the segment deleted from an exemplary retroviral LTR (ALV) to make a SIN vector. FIG. 10b (SEQ ID NO: 29) shows the sequence of the LTR shown in 10a. The underlined sequence is the deleted sequence.
DETAILED DESCRIPTION
Definitions
[0093] The term "animal" is used herein to include all vertebrate animals, including avians and may include humans. It also includes an individual animal in all stages of development, including embryonic and fetal stages.
[0094] The term "antibody" as used herein refers to polyclonal and monoclonal antibodies and functional fragments thereof. An antibody includes modified or derivatised antibody variants that retain the ability to specifically bind an epitope. Antibodies are capable of selectively binding to a target antigen or epitope. Antibodies may include, but are not limited to polyclonal antibodies, monoclonal antibodies (mAbs), humanized and other chimeric antibodies, single chain antibodies (scFvs), Fab fragments, F(ab')2 fragments and disulfide-linked Fvs (sdFv) fragments.
[0095] The term "avian" as used herein refers to any species, subspecies or strain of organism of the taxonomic class ayes, such as, but not limited to, such organisms as chicken, turkey, duck, goose, quail, pheasants, parrots, finches, hawks, crows and ratites including ostrich, emu and cassowary. The term includes the various known strains of Gallus gallus, or chickens, (for example, White Leghorn, Brown Leghorn, Barred-Rock, Sussex, New Hampshire, Rhode Island, Ausstralorp, Minorca, Amrox, California Gray, Italian Partridge-colored), as well as strains of turkeys, pheasants, quails, duck, ostriches and other poultry commonly bred in commercial quantities.
[0096] The phrases "based on" or "derived from" as in a retroviral vector being based on or derived from a particular retrovirus or based on a nucleotide sequence of a particular retrovirus mean that the genome of the retroviral vector contains a substantial portion of the nucleotide sequence of the genome of the particular retrovirus. The substantial portion may be a particular gene or nucleotide sequence such as the nucleotide sequence encoding the gag, pol and/or env proteins or other structural or functional nucleotide sequence of the virus genome such as sequences encoding the LTRs or may be substantially the complete retrovirus genome, for example, most (e.g., more than 60% or more than 70% or more than 80% or more than 90%) or all of the retrovirus genome, as will be apparent from the context in the specification as the knowledge of one skilled in the art. Examples of retroviral vectors that are based on or derived from a retrovirus are the NL retroviral vectors (e.g., NLB) which are based on the ALV retrovirus as disclosed in Cosset et al, Journal of Virology (1991) vol 65, p 3388-3394.
[0097] The terms "coding sequence" and "coding region" as used herein refer to nucleotide sequences and nucleic acid sequences, including both RNA and DNA, that encode genetic information for the synthesis of an RNA, a protein, or any portion of an RNA or protein. Nucleotide sequences that are not naturally part of a particular organism's genome are referred to as "foreign nucleotide sequences," "heterologous nucleotide sequences" or "exogenous nucleotide sequences". "Heterologous proteins" are proteins encoded by foreign, heterologous or exogenous nucleotide sequences and therefore are often not naturally expressed in the cell. A nucleotide sequence that has been isolated and then reintroduced into the same type (e.g., same species) of organism is not considered to be a naturally occurring part of a particular organism's genome and is therefore considered exogenous or heterologous.
[0098] The term "construct" as used herein refers to a linear or circular nucleotide sequence such as DNA that has been assembled from more than one segments of nucleotide sequence which have been isolated from a natural source or have been chemically synthesized, or combinations thereof.
[0099] The term "complementary" as used herein refers to two nucleic acid molecules that can form specific interactions with one another. In the specific interactions, an adenine base within one strand of a nucleic acid can form two hydrogen bonds with thymine within a second nucleic acid strand when the two nucleic acid strands are in opposing polarities. Also in the specific interactions, a guanine base within one strand of a nucleic acid can form three hydrogen bonds with cytosine within a second nucleic acid strand when the two nucleic acid strands are in opposing polarities. Complementary nucleic acids as referred to herein, may further comprise modified bases wherein a modified adenine may form hydrogen bonds with a thymine or modified thymine, and a modified cytosine may form hydrogen bonds with a guanine or a modified guanine.
[0100] The term "cytokine" as used herein refers to any secreted amino acid sequence that affects the functions of cells and is a molecule that modulates interactions between cells in the immune, inflammatory or hematopoietic responses. A cytokine includes, but is not limited to, monokines and lymphokines regardless of which cells produce them. For instance, a monokine is generally referred to as being produced and secreted by a mononuclear cell, such as a macrophage and/or monocyte. Many other cells however also produce monokines, such as natural killer cells, fibroblasts, basophils, neutrophils, endothelial cells, brain astrocytes, bone marrow stromal cells, epideral keratinocytes and B-lymphocytes. Lymphokines are generally referred to as being produced by lymphocyte cells. Examples of cytokines include, but are not limited to, Interleukin-1 (IL-1), Interleukin-6 (IL-6), Interleukin-8 (IL-8), Tumor Necrosis Factor-alpha (TNF-alpha) and Tumor Necrosis Factor beta (TNF-beta).
[0101] The term "expressed" or "expression" as used herein refers to the transcription from a gene to give an RNA nucleic acid molecule at least complementary in part to a region of one of the two nucleic acid strands of the gene. The term "expressed" or "expression" as used herein can also refer to the translation of RNA to produce a protein or peptide.
[0102] The term "expression vector" as used herein refers to a nucleic acid vector that comprises a gene expression controlling region, such as a promoter or promoter component, operably linked to a nucleotide sequence coding at least one polypeptide.
[0103] The term "fragment" as used herein can refer to, for example, an at least about 10, 20, 50, 75, 100, 150, 200, 250, 300, 500, 1,000, 2,000, 5,000, 6,000, 8,000, 10,000, 20,000, 30,000, 40,000, 50,000 or 60,000 nucleotide long portion of a nucleic acid that has been constructed artificially (e.g., by chemical synthesis) or by cleaving a natural product into multiple pieces, using restriction endonucleases or mechanical shearing, or enzymatically, for example, by PCR or any other polymerizing technique known in the art, or expressed in a host cell by recombinant nucleic acid technology known to one of skill in the art. The term "fragment" as used herein may also refer to, for example, an at least about 5, 10, 20, 30, 40, 50, 75, 100, 150, 200, 250, 300, 400, 500, 1,000, 2,000, 5,000, 6,000, 8,000 or 10,000 amino acid portion of an amino acid sequence, which portion is cleaved from a naturally occurring amino acid sequence by proteolytic cleavage by at least one protease, or is a portion of the naturally occurring amino acid sequence synthesized by chemical methods or using recombinant DNA technology (e.g., expressed from a portion of the nucleotide sequence encoding the naturally occurring amino acid sequence) known to one of skill in the art. "Fragment" may also refer to a portion, for example, of about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80% about 90% about 95% or about 99% of a particular nucleotide sequence or amino acid sequence.
[0104] "Functional portion" or "functional fragment" are used interchangeably and as used herein mean a portion or fragment of a whole capable of performing, in whole or in part, a function of the whole. For example, a biologically functional portion of a molecule means a portion of the molecule that performs a biological function of the whole or intact molecule. For example, a functional portion of a gene expression controlling region is a fragment or portion of the specified gene expression controlling region that, in whole or in part, regulates or controls gene expression (e.g., facilitates either in whole or in part) in a biological system (e.g., a promoter). Functional portions may be of any useful size. For example, a functional fragment may range in size from about 20 bases in length to a length equal to the entire length of the specified sequence minus one nucleotide. In another example, a functional fragment may range in size from about 50 bases in length to a length equal to the entire length of the specified sequence minus one nucleotide. In another example, a functional fragment may range in size from about 50 bases in length to about 20 kb in length. In another example, a functional fragment may range in size from about 500 bases in length to about 20 kb in length. In another example, a functional fragment may range in size from about 1 kb in length to about 20 kb in length. In another example, a functional fragment may range in size from about 0.1 kb in length to about 10 kb in length. In another example, a functional fragment may range in size from about 20 bases kb in length to about 10 kb in length.
[0105] The term "gene expression controlling region" as used herein refers to nucleotide sequences that are associated with a coding sequence and which regulate, in whole or in part, expression of the coding sequence, for example, regulate, in whole or in part, the transcription of the coding sequence. Gene expression controlling regions may be isolated from a naturally occurring source or may be chemically synthesized and can be incorporated into a nucleic acid vector to enable regulated transcription in appropriate cells. The "gene expression controlling regions" may precede, but is not limited to preceding, the region of a nucleic acid sequence that is in the region 5' of the end of a coding sequence that may be transcribed into mRNA.
[0106] The terms "heterologous", "exogenous" and "foreign" are used interchangeably herein and in general refer to a biomolecule such as a nucleic acid or a protein that is not normally found in a certain organism or in a certain cell, tissue or other component contained in or produced by an organism. For example, a protein that is heterologous or exogenous to an egg is a protein that is not normally found in the egg. As used herein, the terms "heterologous", "exogenous" and "foreign" with reference to nucleic acids, such as DNA and RNA, are used interchangeably and refer to nucleic acid that does not occur naturally as part of a chromosome, a genome or cell in which it is present or which is found in a location(s) and/or in amounts that differ from the location(s) and/or amounts in which it occurs in nature. It can be nucleic acid that is not endogenous to the genome, chromosome or cell and has been exogenously introduced into the genome, chromosome or cell. Examples of heterologous DNA include, but are not limited to, a DNA comprising a gene expression control region and DNA that encodes a product or products, for example, RNA or protein product. Examples of heterologous DNA include, but are not limited to, gene expression controlling regions or promoters disclosed herein once isolated from the avian and as used thereafter, e.g., after re-introduction into an avian genome.
[0107] The term "isolated nucleic acid" as used herein covers, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic molecule but is not flanked by at least one of the sequences that flank that part of the molecule in the genome of the species in which it naturally occurs; (b) a nucleic acid which has been incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting vector or genomic DNA is not identical to naturally occurring DNA from which the nucleic acid was obtained; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), ligase chain reaction (LCR) or chemical synthesis, or a restriction fragment; (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein, and (e) a recombinant nucleotide sequence that is part of a hybrid sequence that is not naturally occurring. Isolated nucleic acid molecules of the present invention can include, for example, natural allelic variants as well as nucleic acid molecules modified by nucleotide deletions, insertions, inversions, or substitutions.
[0108] The term "nucleic acid" as used herein refers to any linear or sequential array of nucleotides and nucleosides, for example cDNA, genomic DNA, mRNA, tRNA, oligonucleotides, oligonucleosides and derivatives thereof. For ease of discussion, non-naturally occurring nucleic acids may be referred to herein as constructs. Nucleic acids can include bacterial plasmid vectors including expression, cloning, cosmid and transformation vectors such as, animal viral vectors such as, but not limited to, modified adenovirus, influenza virus, polio virus, pox virus, retroviruses such as avian leukosis virus (ALV) retroviral vector, a murine leukemia virus (MLV) retroviral vector, and a lentivirus vector, and the like and fragments thereof. In addition, the nucleic acid can be an LTR of an avian leukosis virus (ALV) retroviral vector, a murine leukemia virus (MLV) retroviral vector, or a lentivirus vector and fragments thereof. Nucleic acids can also include NL vectors such as NLB, NLD, NLA and fragments thereof and synthetic oligonucleotides such as chemically synthesized DNA or RNA. Nucleic acids can include modified or derivatised nucleotides and nucleosides such as, but not limited to, halogenated nucleotides such as, but not only, 5-bromouracil, and derivatised nucleotides such as biotin-labeled nucleotides.
[0109] The term "vector" and "nucleic acid vector" as used herein refers to a natural or synthetic single or double stranded plasmid or viral nucleic acid molecule that can be transfected or transformed into cells and replicate independently of, or within, the host cell genome. A circular double stranded vector can be linearized by treatment with an appropriate restriction enzyme based on the nucleotide sequence of the vector. A nucleic acid can be inserted into a vector by cutting the vector with restriction enzymes and ligating the desired pieces together.
[0110] The term "operably linked" refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Gene expression controlling regions or promoters (e.g., promoter components) operably linked to a coding sequence are capable of effecting the expression of the coding sequence. The controlling sequences need not be contiguous with the coding sequence, so long as they function to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered "operably linked" to the coding sequence.
[0111] The term "oviduct specific promoter" as used herein refers to promoters and promoter components which are functional, i.e., provide for transcription of a coding sequence, to a large extent, for example, primarily (i.e., more than 50% of the transcription product produced in the animal by a particular promoter type being produced in oviduct cells) or exclusively in oviduct cells of a bird. Examples of oviduct specific promoters include, ovalbumin promoter, ovomucoid promoter, ovoinhibitor promoter, lysozyme promoter and ovotransferrin promoter and functional portions of these promoters, e.g., promoter components.
[0112] The terms "percent sequence identity" and "percent identity" as used in, for example, "% identical" and "percent sequence homology" and "percent homology", as used in, for example, "% homology" and "percent sequence similarity" each refer to the degree of sequence matching between two nucleic acid sequences or two amino acid sequences as determined using the algorithm of Karlin & Attschul (1990) Proc. Natl. Acad. Sci. 87: 2264-2268, modified as in Karlin & Attschul (1993) Proc. Natl. Acad. Sci. 90: 5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Attschul et al. (1990) T. Mol. Biol. Q15: 403-410. BLAST nucleotide searches are performed with the NBLAST program, score=100, wordlength=12, to obtain nucleotide sequences homologous to a nucleic acid molecule of the invention. BLAST protein searches are performed with the XBLAST program, score=50, wordlength=3, to obtain amino acid sequences homologous to a reference amino acid sequence. To obtain gapped alignments for comparison purposes, Gapped BLAST is utilized as described in Attschul et al. (1997) Nucl. Acids Res. 25: 3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g. XBLAST and NBLAST) are used. Other algorithms, programs and default settings may also be suitable such as, but not only, the GCG-Sequence Analysis Package of the U.K. Human Genome Mapping Project Resource Centre that includes programs for nucleotide or amino acid sequence comparisons.
[0113] The terms "polynucleotide," "oligonucleotide", "nucleotide sequence" and "nucleic acid sequence" can be used interchangeably herein and include, but are not limited to, coding sequences, i.e., polynucleotide(s) or nucleic acid sequence(s) which are transcribed and translated into polypeptide in vitro or in vivo when placed under the control of appropriate regulatory or control sequences; controlling sequences, e.g., translational start and stop codons, promoter sequences, ribosome binding sites, polyadenylation signals, transcription factor binding sites, transcription termination sequences, upstream and downstream regulatory domains, enhancers, silencers, DNA sequences to which a transcription factor(s) binds and alters the activity of a gene's promoter either positively (induction) or negatively (repression) and the like. No limitation as to length or to synthetic origin are suggested by the terms described herein.
[0114] As used herein the terms "polypeptide" and "protein" refer to a polymer of amino acids of three or more amino acids in a serial array, linked through peptide bonds. The term "polypeptide" includes proteins, protein fragments, protein analogues, oligopeptides and the like. The term "polypeptides" includes polypeptides as defined above that are encoded by nucleic acids, produced through recombinant technology (e.g., isolated from a transgenic bird), or synthesized. The term "polypeptides" further contemplates polypeptides as defined above that include chemically modified amino acids or amino acids covalently or noncovalently linked to labeling ligands.
[0115] The term "promoter" as used herein refers to a DNA sequence useful to initiate transcription initiation by an RNA polymerase in an avian cell. A "promoter component" is a DNA sequence that can, by itself or, in combination with other DNA sequences effect or facilitate transcription. Specific promoter components such as ovalbumin promoter components, ovomucoid promoter components and lysozyme promoter components and other promoters and promoter components disclosed and claimed herein do not describe a specific promoter sequence. Rather, they encompass any sequence or sequence fragment of the respective promoter that is useful to effect or facilitate transcription of a coding sequence. For example, an ovomucoid promoter component includes, without limitation, the about 1.8 kb, the about 3.9 kb and the about 10 kb ovomucoid promoters disclosed in U.S. Ser. No. 11/649,543, published May 17, 2007, which is incorporated in its entirety herein by reference. "Promoter components" can also encompass rearranged gene expression controlling regions which function to initiate RNA transcription and hybrid DNA molecules composed of naturally occurring DNA sequences and/or synthetic DNA sequences which function to initiate RNA transcription.
[0116] The terms "recombinant nucleic acid" and "recombinant DNA" as used herein refer to combinations of at least two nucleic acid sequences that are not naturally found in a eukaryotic or prokaryotic cell. The nucleic acid sequences may include, but are not limited to, nucleic acid vectors, gene expression regulatory elements, origins of replication, suitable gene sequences that when expressed confer antibiotic resistance, protein-encoding sequences and the like. The term "recombinant polypeptide" is meant to include a polypeptide produced by recombinant DNA techniques such that it is distinct from a naturally occurring polypeptide either in its location, purity or structure. Generally, such a recombinant polypeptide will be present in a cell in an amount different from that normally observed in nature.
[0117] As used herein, the term "regulatory sequences" includes promoters, enhancers, and other elements that may control gene expression.
[0118] An "SC negative vector" is a vector that does not contain a selectable or screenable cassette marker having a functional promoter. The promoter may be deleted in whole or in part or may be inactivated by a nucleotide sequence insertion, Screenable cassettes include, without limitation, DNA sequences for antibiotic resistance markers such as neomycin resistance and DNA sequences for other selectable markers such as GFP or lacZ.
[0119] A "SIN vector" is a self-inactivating vector. In particular, a SIN vector is a retroviral vector having an altered genome such that upon integration into genomic DNA of the target cell (e.g., avian embryo cells) the 5' LTR of the integrated retroviral vector will not function as a promoter. For example, a portion or all of the nucleotide sequence of the retroviral vector that results in the U3 region of the 5' LTR of the retroviral vector once integrated may be deleted or altered in order to reduce or eliminate promoter activity of the 5' LTR. In certain examples, deletion of the CAAT box and/or the TAATA box from U3 of the 5' LTR can result in a SIN vector, as is understood in the art.
[0120] A "SIN/SC negative vector" is a vector, i.e., a retroviral vector, that is both a SIN vector and a SC negative vector.
[0121] The term "sense strand" as used herein refers to a single stranded DNA molecule from a genomic DNA that may be transcribed into RNA and translated into the natural polypeptide product of the gene. The term "antisense strand" as used herein refers to the single strand DNA molecule of a genomic DNA that is complementary with the sense strand of the gene.
[0122] A "therapeutic protein" of "pharmaceutical protein" is a substance that, in whole or in part, makes up a drug. In particular, "therapeutic proteins" and "pharmaceutical proteins" include an amino acid sequence which in whole or in part makes up a drug.
[0123] The terms "transcription regulatory sequences" and "gene expression control regions" and "promoter components" as used herein refer to nucleotide sequences that are associated with a nucleic acid sequence and which regulate the transcriptional expression of a coding sequence. Exemplary transcription regulatory sequences include enhancer elements, hormone response elements, steroid response elements, negative regulatory elements, and the like. The "transcription regulatory sequences" may be isolated and incorporated into a vector nucleic acid to enable regulated transcription in appropriate cells of portions of the vector DNA. The "transcription regulatory sequence" may precede, but is not limited to, the region of a nucleic acid sequence that is in the region 5' of the end of a protein coding sequence that may be transcribed into mRNA. Transcriptional regulatory sequences may also be located within a protein coding region, in regions of a gene that are identified as "intron" regions, or may be in regions of nucleic acid sequence that are in the region of nucleic acid.
[0124] The terms "transformation" and "transfection" as used herein refer to the process of inserting a nucleic acid into a host. Many techniques are well known to those skilled in the art to facilitate transformation or transfection of a nucleic acid into a prokaryotic or eukaryotic organism. These methods involve a variety of techniques, such as treating the cells with high concentrations of salt such as, but not only a calcium or magnesium salt, an electric field, detergent, or liposome mediated transfection, to render the host cell competent for the uptake of the nucleic acid molecules.
[0125] As used herein, a "transgenic animal" is any non-human animal, such as an avian species, including the chicken, in which one or more of the cells of the avian may contain heterologous nucleic acid introduced by way of human intervention, such as by transgenic techniques known in the art (see, for example, US patent publication No. 2007/0243165, published Oct. 18, 2007, the disclosure of which is incorporated in its entirety herein by reference) including those disclosed herein. The nucleic acid is introduced into an animal, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus. The term genetic manipulation does not include classical cross-breeding, or in vitro fertilization, but rather is directed to the introduction of a recombinant DNA molecule. This molecule may be integrated within a chromosome, or it may be extrachromosomally replicating DNA. In the typical transgenic animal, the transgene can cause cells to express a recombinant form of the target protein or polypeptide. The terms "chimeric animal" or "mosaic animal" are used herein to refer to animals in which a transgene is found, or in which the recombinant nucleotide sequence is expressed in some but not all cells of the animal. A germ-line chimeric animal contains a transgene in its germ cells and can give rise to a transgenic animal in which most or all cells of the offspring animal will contain the transgene.
[0126] As used herein, the term "transgene" means a nucleic acid sequence (encoding, for example, a human protein) that is partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout). A transgene according to the present invention can include a vector of the invention (e.g., SIN vector) which contains sequences useful for exogenous protein production in an avian (e.g., in an avian oviduct).
[0127] Techniques useful for isolating and characterizing the nucleic acids and proteins of the present invention are well known to those of skill in the art and standard molecular biology and biochemical manuals may be consulted to select suitable protocols for use without undue experimentation. See, for example, Sambrook et al, 1989, "Molecular Cloning: A Laboratory Manual", 2nd ed., Cold Spring Harbor, the content of which is herein incorporated by reference in its entirety.
Abbreviations:
[0128] Abbreviations used herein may include the following: aa, amino acid(s); bp, base pair(s); cDNA, DNA complementary to an RNA; nt, nucleotide(s); kb, 1000 base pairs; μg, microgram; ml, milliliter; ng, nanogram.
Description
[0129] SIN vectors designed and used in accordance with the invention can reduce or eliminate promoter interference of promoters of interest which are employed in transgenic avians. In a particularly useful embodiment, the promoters (i.e., promoter components) of interest preferentially express their gene product in oviduct cells or oviduct tissue, e.g., oviduct specific promoters. Examples of such promoters (e.g., promoter components) include but are not limited to, functional portions of the ovalbumin, lysozyme, conalbumin (i.e., ovotransferrin), ovomucoid, ovomucin, and/or ovoinhibitor gene expression controlling regions or promoter regions. In one embodiment, the promoter of interest is a combination or a fusion of one or more promoters or a fusion of a fragment of one or more promoters such as ovalbumin, lysozyme, conalbumin (i.e., ovotransferrin), ovomucoid, ovomucin, and/or ovoinhibitor promoters with another promoter or promoter fragment such as a viral promoter (e.g., an LTR promoter).
[0130] SIN vectors have been shown to be particularly useful with oviduct specific promoters. Without wishing to limit the invention to any particular theory or mechanism of operation it is believed that oviduct specific promoters can be particularly susceptible to influences of a retroviral LTR promoter. As a result, SIN vectors are particularly useful when employed in combination with avian oviduct specific promoters.
[0131] In one particularly useful embodiment, a SIN vector is produced in which an interfering promoter (e.g., an LTR promoter) that can at least partially inhibit transcription of a coding sequence operably linked to an oviduct specific promoter of the invention is inactivated, for example, by a deletion, insertion or transposition of all or part of the interfering promoter sequence. For example, in the vector pALV-SIN-4.2-Lys-IFNa-2B, shown in FIG. 1, the 3' RAV2 LTR has a deletion in the enhancer such that when the retroviral region integrates, the 5' LTR is inactivated, as is understood in the art. For a detailed diagrammatic of an LTR deletion, see FIG. 10.
[0132] In one useful embodiment of the invention, a SIN vector is employed that is also an SC negative vector to produce a SIN/SC negative vector. The combination of SC negative vector and SIN vector can result in a vector with a substantially reduced amount of promoter interference compared to a vector that is only a SIN vector or only a SC negative vector. For example, pALV-SIN-4.2-Lys-IFNa-2B as well as other SIN vectors disclosed in the Examples also lacks an antibiotic resistance marker making it both a SC negative vector and a SIN vector.
[0133] SIN vectors, SC negative vectors and SIN/SC negative vectors are contemplated for use in accordance with the invention in any useful avian such as chicken, quail and turkey to produce chimeras including germ-line chimeras and progeny birds produced using breeding techniques such as those known to practitioners of ordinary skill in the art. In addition, it is contemplated that an SC negative retroviral vector (which is a non-SIN vector) will also enhance or increase the quantity of exogenous protein produced in a transgenic avian relative to a transgenic avian produced with essentially the same retroviral vector that is not a SC negative vector.
[0134] Without wishing to limit the invention to any particular theory or mechanism of operation it is believed that the lack of a selectable marker cassette decreases the presence of promoter elements such as enhancers which would otherwise be in cis and in close proximity to the promoter employed for exogenous protein production in avian oviduct cells (e.g., oviduct specific promoters). This close proximity may allow for interference by the transcription regulating elements of the marker gene with the promoter of interest, i.e., the promoter employed for exogenous protein production. However, the invention contemplates that marker gene coding sequences, for example, and without limitation, neomycin resistance coding sequence and beta lactamase coding sequence, may be operably linked to a promoter (i.e., second promoter) which does not interfere with the promoter employed for exogenous protein production in avian oviduct cells (i.e., first promoter). For example, it is contemplated that if the marker promoter and the promoter of interest are the same or similar promoters, interference by the selectable cassette will be minimized or eliminated. For example, a second ovalbumin promoter operably linked to a marker gene coding sequence may not interfere with a first ovalbumin promoter employed for exogenous protein production in avian oviduct cells.
[0135] The invention contemplates the employment of any useful oviduct specific promoter, and oviduct specific promoter fragments, in vectors of the invention for exogenous protein expression in avians. For example, promoters and useful (e.g., functional) fragments of promoters (e.g., promoter components) disclosed in US patent publication No. 2005/0176047, filed Jan. 31, 2005, the disclosure of which is incorporated in its entirety herein by reference, and US patent publication No. 2007/0124829, filed Jan. 26, 2007, the disclosure of which is incorporated in its entirety herein by reference, and US patent publication No. 2006/0130170, filed Dec. 11, 2003, the disclosure of which is incorporated in its entirety herein by reference, are contemplated for use in conjunction with SIN vectors and SC negative vectors and SIN/SC negative vectors in accordance with the invention.
[0136] The invention also contemplates other promoters and transcriptionally functional portions thereof (e.g., promoter components) for use as promoters of interest in accordance with the invention such as a cytomegalovirus (CMV) promoter, a rous-sarcoma virus (RSV) promoter, a β-actin promoter (e.g., a chicken β-actin promoter) a murine leukemia virus (MLV) promoter, and a mouse mammary tumor virus (MMTV) promoter.
[0137] The invention also includes various ovalbumin promoter components which are contemplated for use in producing exogenous proteins in transgenic avians. Each of the promoters disclosed herein are contemplated for use in vectors in accordance with the invention.
[0138] Examples of vectors of the invention which contain recombinant ovalbumin DNA are shown below. The fragments are listed top to bottom in the 5' to 3' linear order in which they are present on a single DNA molecule. For example, the 3' end of the 3.5 kb OV fragment of sequence 1 would be covalently linked to the 5' end of the 5' UTR-5' portion and the 3' end of the 5' UTR-5' portion would be covalently linked to the 5' end of 5' UTR-3' portion.
1. pSIN-OV-3.5-CSI
[0139] 3.5 kb OV fragment (includes DHS I, II & III)
[0140] 5' UTR-5' portion (from Exon L)
[0141] 5' UTR-3' portion (from Exon 1)
2. pSIN-OV-3.5-Int-CSI-inv
[0142] 3.5 kb OV fragment (includes DHS I, II & III)
[0143] 5' UTR-5' portion (from Exon L)
[0144] Intron A
[0145] 5' UTR-3' portion (from Exon 1)
[0146] 3' UTR
3. pSIN-OV-3.5-Int-CSI
[0147] 3.5 kb OV fragment (includes DHS I, II & III)
[0148] 5' UTR-5' portion (from Exon L)
[0149] Intron A
[0150] 5' UTR-3' portion (from Exon 1)
4. pSIN-OV-3.5-CSI-UTR-inv
[0151] 3.5 kb OV fragment (includes DHS I, II & III)
[0152] 5' UTR-5' portion (from Exon L)
[0153] 5' UTR-3' portion (from Exon 1)
[0154] 3' UTR
5. PSIN-OV-3.5-Int-CSI-LUTR-inv
[0155] 3.5 kb OV fragment (includes DHS I, II & III)
[0156] 5' UTR-5' portion (from Exon L)
[0157] Intron A
[0158] 5' UTR-3' portion (from Exon 1)
[0159] 3' UTR/DHS A (bp 13576 to 15163 of FIG. 8);
6. pSIN-OV-3.5-CSI-LUTR-inv
[0160] 3.5 kb OV fragment (includes DHS I, II & III)
[0161] 5' UTR-5' portion (from Exon L)
[0162] 5' UTR-3' portion (from Exon 1)
[0163] 3' UTR/DHS A (bp 13576 to 15163 of FIG. 8);
7. pSIN-OV-3.5-Int-CSI-RRE
[0164] 3.5 kb OV fragment (includes DHS I, II & III)
[0165] 5' UTR-5' portion (from Exon L)
[0166] Intron A
[0167] 5' UTR-3' portion (from Exon 1)
[0168] partial 3' UTR
[0169] RRE (Rev response element) FIG. 9a
[0170] Construct 7 includes RRE to allow transport of the unspliced RNA genome to the cytoplasm and thus may enhance packaging of intact retroviral RNA. RRE is only active in presence of the Rev protein. Rev activity is provided in the form of DNA encoding the Rev, RNA encoding the Rev, and/or the Rev protein, which is well known in the art and commercially available (e.g., Invitrogen, Inc.), during the transient transfection of retroviral components. Thus the intron will be present in the transgene contained in the genome of the transgenic bird produced by the virus particles (the rev protein is not present in the cells of the transgenic bird). As a result the RNA should be spliced in the oviduct cells of a laying hen resulting in an enhanced level of protein expression compared to a same transgenic bird having the same transgene without the intron.
8. pSIN-CTE-OV-3.5-Int-CSI
[0171] ALV CTE (FIG. 9b) inserted 5' of 3.5 kb OV fragment
[0172] 3.5 kb OV fragment (includes DHS I, II & III)
[0173] 5' UTR-5' portion (from Exon L)
[0174] Intron A
[0175] 5' UTR-3' portion (from Exon 1)
[0176] partial 3' UTR
[0177] Coordinates for some of the elements for the above eight vectors are described elsewhere in the application. For example, coordinates of sequences from the ovalbumin nucleotide sequence are described in the Summary section above. CSI means a coding sequence of interest, i.e., nucleotide sequence encoding the protein desired to be expressed in a transgenic avian oviduct.
[0178] SIN vectors, SIN/SC negative vectors and SC negative vectors for use in accordance with the invention include vectors such as Avian Leukemia/Leukosis Viruses (ALV), for example, and without limitation, RAV-0, RAV-1, RAV-2; Avian Sarcoma Viruses (ASV); Avian Sarcoma/Acute Leukemia Viruses (ASLV) including, without limitation, Rous Sarcoma Virus (RSV); Fujinami Sarcoma Viruses (FSV); Avian Myeloblastosis Viruses (AMV); Avian Erythroblastosis Viruses (AEV); Avian Myelocytomatosis Viruses (MCV), for example, and without limitation, MC29; Reticuloendotheliosis Viruses (REV), for example, and without limitation, Spleen Necrosis Virus (SNV). The invention also contemplates other useful retroviral vector, including, without limitation, retroviral vectors based upon Murine Leukemia Viruses (MLV); Molony Murine Sarcoma Viruses (MMSV); Moloney Murine Leukemia Viruses (MMLV); and lentiviruses (e.g., human immunodeficiency virus (HIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) and simian immunodeficiency virus (SIV) which are altered to be SIN vectors, SIN/SC negative vectors or SC negative vectors as is understood by a practitioner of ordinary skill in the art.
[0179] In one very specific embodiment, a portion of the 5' LTR of a modified ALV vector disclosed in Cosset et al, J of Virology (1991) vol 65, no. 6, p 3388-3394, the disclosure of which is incorporated in its entirety herein by reference, is deleted to produce a SIN vector. In particular, nucleotides 1 to 173 were deleted from the ALV based vector LTR sequence shown in SEQ ID NO: 29. Specific deletions from 5' LTR sequences useful to produce SIN vectors from other vectors which can be used in avian transgenesis can be determined by a practitioner of ordinary skill in the art.
[0180] In one particularly useful embodiment, the invention is drawn to the production of therapeutic proteins which may be produced in the oviduct of a transgenic avian, such as a chicken, in accordance with the invention. Exemplary proteins for production in accordance with the invention include, without limitation, erythropoietin, GM-CSF, interferon (3, fusion protein, CTLA4-Fc fusion protein, growth hormones, cytokines, structural proteins, interferon, lysozyme, β-casein, albumin, α-1 antitrypsin, antithrombin III, collagen, factors VIII, IX, X (and the like), fibrinogen, lactoferrin, protein C, tissue-type plasminogen activator (tPA), somatotropin, and chymotrypsin, immunoglobulins, antibodies, immunotoxins, factor VIII, b-domain deleted factor VIII, factor VIIa, factor IX, anticoagulants, hirudin, alteplase, tpa, reteplase, tpa-3 of 5 domains deleted, insulin, insulin lispro, insulin aspart, insulin glargine, long-acting insulin analogs, glucagons, tsh, follitropin-beta, fsh, pdgh, ifn-beta, ifn-alpha 1, ifn-alpha 2, ifn-beta, ifn-beta 1b, ifn-beta 1a, ifn-gamma, ifn-gamma 1b, it-2, it-11, hbsag, ospa, dornase-alpha dnase, beta glucocerebrosidase, tnf-alpha, il-2-diptheria toxin fusion protein, tnfr-lgg fragment fusion protein laronidase, dnaases, alefacept, tositumomab, murine mab, alemtuzumab, rasburicase, agalsidase beta, teriparatide, parathyroid hormone derivatives, adalimumab (lgg1), anakinra, nesiritide, human b-type natriuretic peptide (hbnp), colony stimulating factors, pegvisomant, human growth hormone receptor antagonist, recombinant activated protein c, omalizumab, immunoglobulin e (lge) blocker, ibritumomab tiuxetan, ACTH, glucagon, somatostatin, somatotropin, thymosin, parathyroid hormone, pigmentary hormones, somatomedin, luteinizing hormone, chorionic gonadotropin, hypothalmic releasing factors, etanercept, antidiuretic hormones, prolactin and thyroid stimulating hormone, an immunoglobulin polypeptide, immunoglobulin polypeptide D region, immunoglobulin polypeptide J region, immunoglobulin polypeptide C region, immunoglobulin light chain, immunoglobulin heavy chain, an immunoglobulin heavy chain variable region, an immunoglobulin light chain variable region and a linker peptide. Production of each of these, and other, proteins is contemplated using methods, vectors and promoters of the invention.
[0181] The present invention is further illustrated by the following examples, which are provided by way of illustration and should not be construed as limiting. The contents of all references, published patents and patents cited throughout the present application are hereby incorporated by reference in their entireties.
Example 1
[0182] Production of pALV-SIN-4.2-Lys4FNa-2B
[0183] The vector pALV-SIN-4.2-Lys-IFNa-2B (shown in FIG. 1) was constructed and is shown in FIG. 1. The sequence of pALV-SIN-4.2-Lys-IFNa-2B is shown in SEQ ID NO: 1. The 4.2 Kb lysozyme promoter spans from nucleotides 4810 to 9008 of SEQ ID NO: 1. The lysozyme signal peptide coding sequence spans from nucleotides 9037 to 9090 of SEQ ID NO: 1. The interferon alpha 2b coding sequence spans from nucleotides 9091 to 9585 of SEQ ID NO: 1. Other components of the sequence include LTRs spanning from nucleotides 4000 to 4345 and from nucleotides 725 to 897 of SEQ ID NO: 1.
[0184] pALV-SIN-4.2-Lys-IFNa-2B can be constructed by a variety of methods which are apparent to a practitioner of skill in the art. However, the method believed to be the most useful for making the vector is as follows: A 3427 bp region of pNLB-CMV-IFN-alpha2B (disclosed in U.S. patent application Ser. No. 11/167,052, filed Jun. 24, 2005, the disclosure of which is incorporated in its entirety herein by reference) is PCR amplified using primers ATGCGCGCATTGGTAATTGATCGGCTGG (Primer ALV-SIN-1, SEQ ID NO: 2) and ATATGCGGCCGCGGTACCGCCCGGGCATCGATATCAAGCTTACGGTTCACT A AACGAGCTCTGCTTATATAGACCTCCCA (Primer ALV-SIN-2, SEQ ID NO: 3). The product is digested with BssHII and Not I resulting in a 3428 bp fragment which can be isolated by gel purification. A 1436 bp region of pNLB-CMV-IFN-alpha2B is PCR amplified with primers ATATGCGGCCGCGTCGACGGCCGGCCAGATCTGCTGAGCCGGTCGCTACCA TTACCAGT (Primer ALV-SIN-3, SEQ ID NO: 4) and ATACGCGTATTCCCTAACGATCACGTCG (Primer ALV-SIN-4, SEQ ID NO: 5). The resulting product is digested with Not I and Mlu I yielding a 1438 bp fragment which is isolated by gel purification. A Bluescript II SK vector containing a BssHII stuffer fragment is digested with BssHII resulting in a linearized Bluescript vector of 2788 bp which is gel purified and then ligated to the 3428 bp and 1438 bp PCR products to yield JCR.A108.49.5.24.
[0185] JCR.A108.49.5.24 is digested with Hind III and the resulting 6823 bp fragment is circularized by ligation to yield JCR.A108.76.1.1.
[0186] A 1175 bp region of JCR.A108.76.1.1 is PCR amplified with primers CTGAAGTGTAAGGAATGTAAG (Primer ALV-SIN-5, SEQ ID NO: 6) and GCGCGTCTCATCCCCCTCCCTATGCAAAAG (Primer ALV-SIN-6, SEQ ID NO: 7) and the resulting fragment is digested with Blp I and Esp3I producing a 1030 bp fragment which is isolated by gel purification. A 660 bp region of JCR.A108.76.1.1 is PCR amplified with primers GGGCGTCTCAGGGACGGATTGGACGAACCACTGAATT (Primer ALV-SIN-7, SEQ ID NO: 8) and TTAGTGCTTTACGGCACCTC (Primer ALV-SIN-8, SEQ ID NO: 9) and digested with Esp3I and Dra111 resulting in a 596 bp fragment which is isolated by gel purification. JCR.A108.76.1.1 is digested with DraI11 and Blp I and the 5024 bp linear vector is ligated to the 1030 and 596 bp PCR fragments to produce pALV-SIN.
[0187] pALV-SIN is digested with BamHI and the 4795 bp linear vector is isolated by gel purification. A 4815 bp region of JCR.115.93.1.2 (disclosed in US patent publication No. 2007/0124829, published May 31, 2007) is PCR amplified with primers GACGGATCCGATACCGTCCCTATTTTTGTGTTTGCTTC (Primer ALV-SIN-9, SEQ ID NO: 10) and TAACGGATCCTAGACTTTTTACTCCTTAGA (Primer ALV-SIN-10, SEQ ID NO: 11) and is digested with BamHI. The resulting 4802 fragment is ligated to the 4795 bp linear pALV-SIN to produce pALV-SIN-4.0-Lys-IFNa-2B.
Example 2
[0188] Production of Transgenic Quail Using pALV-SIN-4.2-Lys-IFNa-2B
[0189] Transduction particles of the vector pALV-SIN-4.2-Lys-IFNa-2B were produced in fibroblast cells as disclosed in US patent publication No. 2007/0077650, published Apr. 5, 2007, entitled: Rapid Production of High Titer Virus, the disclosure of which is incorporated in its entirety herein by reference.
[0190] Fertilized Japanese quail eggs were windowed essentially according to the Speksnijder procedure disclosed in U.S. Pat. No. 5,897,998, the disclosure of which is incorporated in its entirety herein by reference. Eighty eggs were injected in the subgerminal cavity with about 7 microliters (approximately 7×104 viral particles total) of pALV-SIN-4.2-Lys-IFNa-2B transducing particles per egg. Since no selectable marker is used in pALV-SIN-4.2-Lys-IFNa-2B, the concentration of viral particles is estimated based upon past results for viral particle production where a selectable cassette or marker was used in the vector which allowed for particle quantification. Sixteen chicks hatched about 18 days after injection and human IFN levels were measured by IFN ELISA from serum samples collected from chicks 12 weeks after hatch. None were positive for the IFN protein in the serum.
[0191] In order to identify G0 quail which contained the interferon alpha 2 coding sequence containing transgene in their genome, DNA was extracted from blood of the birds and the DNA samples were subjected to Taqman® analysis on a 7700 Sequence Detector (Perkin Elmer).
[0192] Eggs from eight G0 quail were tested for the presence of the IFN protein in the egg white by ELISA. Quail No. 4 was found to have significant levels of IFN in egg white from her eggs. FIG. 2 shows a bar graph illustrating expression levels of IFN in the egg white of Quail No. 4. Quail No. 4 expressed IFN-alpha-2 at 0.45 μg/ml of egg white, which is a high level of expression for a G0 avian. There was no interferon alpha 2 detected in the blood of Quail No. 4 which is particularly significant. For example, in certain instances the recombinant protein may be harmful to the development or health of the avian when present in the blood which can kill the bird or can lead to reduced levels of protein production.
Example 3
[0193] Production of Transgenic Quail Using pALV-SIN-6.5-Lys-IFNa-2B
[0194] The 4.2 kb lysozyme promoter of vector pALV-SIN-4.2-Lys-IFNa-2B is removed and replaced with a 6.5 kb lysozyme promoter corresponding to about nucleotides 5363 to 11863 of SEQ ID NO: 12, using standard methodologies known to practitioners of skill in the art, resulting in pALV-SIN-6.5-Lys-IFNa-2B. Transduction particles of the new vector pALV-SIN-6.5-Lys-IFNa-2B are produced as disclosed in US patent publication No. 2007/0077650, published Apr. 5, 2007.
[0195] Fertilized chicken eggs or Japanese quail eggs are windowed and about 7×104 pALV-SIN-6.5-Lys-IFNa-2B transducing particles are injected into the subgerminal cavity of each egg. Eggs hatch 21 or 18 days after injection and chimeric birds are identified that contain the active transgene in their genome, as described in Example 2. Fully transgenic G1 birds which contain the transgene in their genome are produced from chimeras using methods known in the art, i.e., crossing male chimeras with non-transgenic females.
Example 4
[0196] Production of Vector pSIN-OV-3.5-I-CTLA4-Fc-Inv
[0197] This vector includes the ovalbumin Dnase hypersensitive sites (DHS) I, II and III, the first exon (exon L), the first intron and the CTLA4-Fc fusion protein coding sequence inserted in frame with the ATG of second exon (exon 1) and with the 3' untranslated region (UTR). The expression cassette is inserted in the inverse orientation into an avian leukosis virus (ALV) vector, which was made self-inactivating (SIN) by deletion of nucleotides 1 to 173 of the ALV LTR sequence shown in SEQ ID NO: 29.
[0198] The vector was constructed as follows: pNLB-3.9-OM-CTLA4-Fc, disclosed in Example 20 of US patent publication No. 2007/0113299, published May 17, 2007, the disclosure of which is incorporated in its entirety herein by reference, was cut with Nae I and Not I. The Not I site was filled in by Klenow reaction. The resulting 8125 bp fragment was gel purified, religated, producing pOM-3.9-CTLA4-dSacI.
[0199] pOM-3.9-CTLA4-dSacI was cut with EcoRI and Kpn I and the 8115 bp fragment gel purified. The 3' UTR of the chicken ovalbumin gene was PCRed from BAC 26, disclosed in US patent publication No. 2006/0130170, published Jun. 15, 2006, with the primers 5'-GCGGAATTCAAAGAAGAAAGCTGAAAAAC-3' (SEQ ID NO: 13) and 5'-GCGGGTACCTTCAAATACTACAAGTGAAA-3' (SEQ ID NO: 14). The 3' UTR PCR was cut with Eco RI and Kpn I and the 684 bp fragment gel purified. The 8115 bp fragment of pOM-3.9-CTLA4-dSacI was ligated to the 684 bp fragment of 3' UTR PCR, producing pOM-3.9-CTLA4-0V3'UTR.
[0200] The 3.5 kb OV promoter region, exon L, first intron and the UTR of exon 1 was PCR amplified with BAC26 as a template and with primers 5'-GGCCTCGAGTCAAGTTCTGAGTAGGTTTTAGTG-3' (SEQ ID NO: 15) and 5'-GCGCGTCTCTGTCTAGAGCAAACAGCAGAACAGTGAAAATG-3' (SEQ ID NO: 16). The PCR product was cut with Xho I and Esp3I and the 5094 bp product was gel purified.
[0201] A 5' portion of the CTLA4-Fc gene was PCR amplified using pOM-3,9-CTLA4 as a template and primers 5'-GCGCGTCTCAAGACAACTCAGAGTTCACCATGGGTGTACTGCTCACACAG-3' (SEQ ID NO: 17) and 5'-GGCCCGGGAGTTTTGTCAGAAGATTTGGG-3' (SEQ ID NO: 18). The PCR product was cut with Esp3I and Sad and the 384 bp product gel purified.
[0202] pOM-3.9-CTLA4-0V3'UTR was cut with Sac I and Xho I, the 4473 bp product gel purified and ligated to the 5094 bp OV PCR fragment and 384 bp CTLA4-Fc fragment, producing pOV-3.5-I-CTLA4.
[0203] pALV-SIN, disclosed, for example, in Example 10 of parent case US patent publication No. 2007/0124829, published May 31, 2007, was cut with Mfe I and Xho I, filled in with Klenow and the 4911 bp fragment gel purified.
[0204] pOV-3.5-I-CTLA4 was cut with XhoI and BamHI, filled in with Klenow and the 6957 bp fragment gel purified. This fragment was ligated into the 4911 bp fragment of pAVI-SIN such that the CTLA4-Fc gene and flanking expression elements are in the opposite orientation of the ALV long terminal repeats, producing pSIN-OV-3.54-CTLA4-inv. See FIG. 3 and SEQ ID NO: 19. Such opposite orientation may be preferred if the coding sequence of interest (i.e., CSI) in the transgene contains one or more introns or splice sites.
Example 5
Production of Transgenic Quail Using SIN-OV-3.5-I-CTLA4-inv
[0205] Retroviral particles containing the pSIN-OV-3.5-I-CTLA4-inv vector (FIG. 3) and pseudotyped with the VSV envelope protein were produced as described in US patent publication No. 2007/0077650, published Apr. 5, 2007. Virus particles were harvested at 48 hours post-transfection, concentrated and on the same day, approximately 4 microliters of the virus suspension containing about 1×105 particles was injected into the subgerminal cavity of stage X quail eggs. Eggs were resealed and hatched.
[0206] ALV has a CTE element in the 3' end of its genome that allows transport of unspliced retroviral RNA to the cytoplasm. In pSIN-OV-3.5-I-CTLA4-inv, due to the inverse orientation of the OV promoter relative to the LTRs, the CTE is upstream of the OV promoter such that the CTE element is only in RNAs derived from the 5' LTR promoter and not in RNAs transcribed by the OV promoter. Therefore, any RNA transcribed by the OV promoter should be spliced prior to being transported into the cytoplasm.
[0207] Egg whites from chimeric quail were assayed using an ELISA for CTLA4-Fc. One quail was found to have CTLA4-Fc in her egg white at approximately 16 μg/ml. The transgenesis level in these quail is estimated at about 5% or less. Thus the level in a G1 should be substantially greater. It is expected that similar levels would be seen in a chicken and other avians, as the quail and chicken ovalbumin genes, as well as ovalbumin genes of other avians, are very similar.
Example 6
[0208] Construction of pSIN-3.9-OM-CTLA4-Fc
[0209] The 4907 bp Mfe I/Xho I fragment of pALV-SIN (disclosed, for example, in US patent publication No. 2007/0124829, published May 31, 2007) was ligated to the 5115 XhoI/EcoRI fragment of pOM-3.9-CTLA4 (shown in FIG. 15 of US patent publication No. 2007/0113299, published May 17, 2007), producing pSIN-3.9-OM-CTLA4-Fc shown in FIG. 4 and SEQ ID NO: 20.
Example 7
[0210] Production of Transgenic Chickens Using pSIN-3.9-OM-CTLA4-Fc
[0211] Retroviral particles pseudotyped with the VSV envelope protein and containing the pSIN-3.9-OM-CTLA4-Fc (FIG. 4) vector were produced as described in US patent publication No. 2007/0077650, published Apr. 5, 2007. Virus was harvested at 48 hours post-transfection, concentrated and on the same day approximately 7 microliters injected into the subgerminal cavity of stage X eggs. Eggs were resealed and incubated until hatch.
[0212] Egg white from hens was assayed using an ELISA for CTLA4-Fc. One hen was found to have CTLA4-Fc in her egg white at approximately 0.37 μg/ml. The transgenesis level in these hens is estimated at 5% or less. Thus the levels in a G1 should be substantially greater.
[0213] Any useful coding sequence may be inserted in place of the CTLA4-Fc coding sequence for production of the corresponding product.
Example 8
[0214] Construction of pSIN-1.8-OM-IFNa-2B
[0215] The 1051 bp Nco I-Nco I fragment from pBS-OM-4.4 (FIG. 5 SEQ ID NO: 23) was inserted into the Nco I site of pAVIJCR-A137.91.1.2 (FIG. 6 SEQ ID NO: 24), thereby inserting the 1 kb ovomucoid promoter in front of an IFN coding sequence and SV40 polyadenylation signal and producing p1kb-OM-IFNMM. A 1816 bp Cla I-Sac I fragment of p1kb-OM-IFNMM was inserted into the 6245 bp Cla I-Sac I fragment of pBS-OM-4.4, thereby fusing the 4.4 kb ovomucoid fragment with the IFN coding sequence and producing p4.4OM-IFNMM. The 8511 bp BamH I-Sal I fragment of pBS-OMUP-10 was ligated to the 5148 bp BamH I-Sal I fragment of p4.4OM-IFN, thereby placing the 10 kb ovomucoid promoter in front of the IFN coding sequence, producing p10-OM-IFN.
[0216] Region 2487-4889 of p10.0-OM-IFN was PCR amplified with primers 5'-GGCGTCGACGGATCCGTTAACCCTAGAACTAGTGGATCTCTGCCCTTGTGC TGAC-3' (SEQ ID NO: 27) and 5'-GGCCTCGAGCCTAGACTTTTTACTCCTTAGA-3' (SEQ ID NO: 28). The PCR product was digested with Sal I and Xho I and the 2435 bp isolated. pALV-SIN (disclosed, for example, in US patent publication No. 2007/0124829, published May 31, 2007) was digested with Xho I and the 4915 bp fragment isolated and ligated to the 2435 bp fragment, producing pSIN-1.8-OM-IFNa-2B, shown in FIG. 7 and SEQ ID NO: 21.
Example 9
[0217] Production of Transgenic Chickens Using pSIN-1.8-OM-IFNa-2B
[0218] Retroviral particles having the pSIN-1.8-OM-IFNa-2B transgene and pseudotyped with the VSV envelope protein were produced as described in US patent publication No. 2007/0077650, published Apr. 5, 2007. Virus was harvested at 48 hours post-transfection, concentrated and, on the same day, approximately 7 microliters injected into the subgerminal cavity of stage X eggs. Eggs were resealed and incubated until hatch.
[0219] Egg whites from hens were assayed using an ELISA for IFNa-2B. Hens were found to have IFNa-2B in egg white at levels that ranged from 1.5 to 865.0 ng/ml with IFNa-2B levels at least about 600 fold lower in the serum. The transgenesis level in these hens is estimated at 5% or less.
[0220] Five G0 sperm positive roosters were bred to non-transgenic hens. Of 1251 offspring, 30 carried the pSIN-1.8-OM-IFNa-2B transgene. Six of the 30 hens expressed human IFN-α-2B at 34.1 to 165.6 μg/ml of egg white. Each of the six hens had a single copy of the transgene. Serum levels of human IFN-α-2B were 0.3 to 9.2 ng/ml which, on average, was 30,000 fold lower than egg white levels.
Example 10
Production of Transgenic Chickens Using Lentivirus Vectors and Moloney Murine Leukemia Virus
[0221] The invention specifically contemplates the employment of other retroviral vectors that are useful in avian transgenesis to be used in accordance with the present invention. Such vectors can be employed to produce transgenic avians, for example, in the same way as ALV-SIN vectors have been used in Examples 1 to 9 above. For example, Moloney Murine Leukemia Virus (MMLV) and Lentiviral Vectors can be used in accordance with the invention, each, for example, by deleting one or more of the CAAT box; the TAATA box; and enhancer contained in the U3 region of the upstream LTR of each virus to produce a SIN vector. Alternatively, or in addition (i.e., in conjunction with a SIN vector) no transcriptionally active markers or selectable cassettes are included in each of the retroviral vectors.
[0222] Although preferred embodiments of the invention have been described using specific terms, devices, and methods, such description is for illustrative purposes only. The words used are words of description rather than of limitation. It is to be understood that changes and variations may be made by those of ordinary skill in the art without departing from the spirit or the scope of the present invention, which is set forth in the following claims. In addition, it should be understood that aspects of the various embodiments may be interchanged both in whole or in part.
Sequence CWU
1
1
2919597DNAArtificial SequencepALV-SIN-4.2-Lys-IFNa-2B Vector 1gatcccccgt
gctgcagaac cgagcggcta ttgacttctt gctcctagct cacggccatg 60gctgtgagga
cattgcggga atgtgttgtt tcaatctgag tgatcacagt gagtctatac 120agaagaagtt
ccagctaatg aaggaacatg tcaataagat cggcgtgaac aacgacccaa 180tcggaagttg
gctgcgagga ttattcggag gaataggaga atgggccgta cacttgctga 240aaggactgct
tttggggctt gtagttatct tgttgctagt agtatgcttg ccttgccttt 300tgcaatgtgt
atctagtagt attcgaaaga tgattgataa ttcactcggc tatcgcgagg 360aatataaaaa
aattacagga ggcttataag cagcccgaaa gaagagcgta ggcgagttct 420tgtattccgt
gtgatagctg gttggattgg taattgatcg gctggcacgc ggaatatagg 480aggtcgctga
atagtaaact tgtagacttg gctacagcat agagtatctt ctgtagctct 540gatgactgct
aggaaataat gctacggata atgtggggag ggcaaggctt gcgaatcggg 600ttgtaacggg
caaggcttga ctgaggggac aatagcatgt ttaggcgaaa agcggggctt 660cggttgtacg
cggttaggag tcccctcagg atatagtagt ttcgcttttg catagggagg 720gggacggatt
ggacgaacca ctgaattccg cattgcagag atattgtatt taagtgccta 780gctcgataca
ataaacgcca tttgaccatt caccacattg gtgtgcacct gggttgatgg 840ccggaccgtt
gattccctgr cgactacgag cacatgcatg aagcagaagg cttcatttgg 900tgaccccgac
gtgatcgtta gggaatacgc gctcactggc cgtcgtttta caacgtcgtg 960actgggaaaa
ccctggcgtt acccaactta atcgccttgc agcacatccc cctttcgcca 1020gctggcgtaa
tagcgaagag gcccgcaccg atcgcccttc ccaacagttg cgcagcctga 1080atggcgaatg
gaaattgtaa gcgttaatat tttgttaaaa ttcgcgttaa atttttgtta 1140aatcagctca
ttttttaacc aataggccga aatcggcaaa atcccttata aatcaaaaga 1200atagaccgag
atagggttga gtgttgttcc agtttggaac aagagtccac tattaaagaa 1260cgtggactcc
aacgtcaaag ggcgaaaaac cgtctatcag ggcgatggcc cactacgtga 1320accatcaccc
taatcaagtt ttttggggtc gaggtgccgt aaagcactaa atcggaaccc 1380taaagggagc
ccccgattta gagcttgacg gggaaagccg gcgaacgtgg cgagaaagga 1440agggaagaaa
gcgaaaggag cgggcgctag ggcgctggca agtgtagcgg tcacgctgcg 1500cgtaaccacc
acacccgccg cgcttaatgc gccgctacag ggcgcgtcag gtggcacttt 1560tcggggaaat
gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 1620tccgctcatg
agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 1680gagtattcaa
catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 1740ttttgctcac
ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 1800agtgggttac
atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 1860agaacgtttt
ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 1920tattgacgcc
gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 1980tgagtactca
ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 2040cagtgctgcc
ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 2100aggaccgaag
gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga 2160tcgttgggaa
ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 2220tgtagcaatg
gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 2280ccggcaacaa
ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 2340ggcccttccg
gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 2400cggtatcatt
gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 2460gacggggagt
caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 2520actgattaag
cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 2580aaaacttcat
ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 2640caaaatccct
taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 2700aggatcttct
tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 2760accgctacca
gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 2820aactggcttc
agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 2880ccaccacttc
aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 2940agtggctgct
gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 3000accggataag
gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 3060gcgaacgacc
tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 3120tcccgaaggg
agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 3180cacgagggag
cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 3240cctctgactt
gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 3300cgccagcaac
gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 3360ctttcctgcg
ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 3420taccgctcgc
cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 3480gcgcccaata
cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 3540cgacaggttt
cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct 3600cactcattag
gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat 3660tgtgagcgga
taacaatttc acacaggaaa cagctatgac catgattacg ccaagcgcgc 3720attggtaatt
gatcggctgg cacgcggaat ataggaggtc gctgaatagt aaacttgtag 3780acttggctac
agcatagagt atcttctgta gctctgatga ctgctaggaa ataatgctac 3840ggataatgtg
gggagggcaa ggcttgcgaa tcgggttgta acgggcaagg cttgactgag 3900gggacaatag
catgtttagg cgaaaagcgg ggcttcggtt gtacgcggtt aggagtcccc 3960tcaggatata
gtagtttcgc ttttgcatag ggagggggaa atgtagtctt atgcaatact 4020cttgtagtct
tgcaacatgc ttatgtaacg atgagttagc aacatgcctt ataaggagag 4080aaaaagcacc
gtgcatgccg attggtggga gtaaggtggt atgatcgtgg tatgatcgtg 4140ccttgttagg
aaggcaacag acgggtctaa cacggattgg acgaaccact gaattccgca 4200ttgcagagat
attgtattta agtgcctagc tcgatacaat aaacgccatt tgaccattca 4260ccacattggt
gtgcacctgg gttgatggcc ggaccgttga ttccctgrcg actacgagca 4320catgcatgaa
gcagaaggct tcatttggtg accccgacgt gatcgttagg gaatagtggt 4380cggccacagg
cggcgtggcg atcctgtcct catccgtctc gcttattcgg ggagcggacg 4440atgaccctag
tagagggggc tgcggcttag gagggcagaa gctgagtggc gtcggaggga 4500gccctactgc
agggggccaa cataccctac cgagaactca gagagtcgtt ggaagacggg 4560aaggaagccc
gacgactgag cggtccaccc caggcgtgat tccggttgct ctgcgtgatt 4620ccggtcgccc
ggtggatcaa gcatggaagc cgtcataaag gtgatttcgt ccgcgtgtaa 4680gacctattgc
gggaaaacct ctccttctaa gaaggaaata ggggctatgt tgtccctgtt 4740acaaaaggaa
gggttgctta cgtccccctc agacttatat tccccggggt cctgggatcc 4800gataccgtcc
ctatttttgt gtttgcttca gcagccattt aattcttcag tgtcatcttg 4860ttctgttgat
gccactggaa caggattttc agcagtcttg caaagaacat ctagctgaaa 4920actttctgcc
attcaatatt cttaccagtt cttcttgttt gaggtgagcc ataaattact 4980agaacttcgt
cactgacaag tttatgcatt ttattacttc tattatgtac ttactttgac 5040ataacacaga
cacgcacata ttttgctggg atttccacag tgtctctgtg tccttcacat 5100ggttttactg
tcatacttcc gttataacct tggcaatctg cccagctgcc catcacaaga 5160aaagagattc
cttttttatt acttctcttc agccaataaa caaaatgtga gaagcccaaa 5220caagaacttg
tggggcaggc tgccatcaag ggagagacag ctgaagggtt gtgtagctca 5280atagaattaa
gaaataataa agctgtgtca gacagttttg cctgatttat acaggcacgc 5340cccaagccag
agaggctgtc tgccaaggcc accttgcagt ccttggtttg taagataagt 5400cataggtaac
ttttctggtg aattgcgtgg agaatcatga tggcagttct tgctgtttac 5460tatggtaaga
tgctaaaata ggagacagca aagtaacact tgctgctgta ggtgctctgc 5520tatccagaca
gcgatggcac tcgcacacca agatgaggga tgctcccagc tgacggatgc 5580tggggcagta
acagtgggtc ccatgctgcc tgctcattag catcacctca gccctcacca 5640gcccatcaga
aggatcatcc caagctgagg aaagttgctc atcttcttca catcatcaaa 5700cctttggcct
gactgatgcc tcccggatgc ttaaatgtgg tcactgacat ctttattttt 5760ctatgatttc
aagtcagaac ctccggatca ggagggaaca catagtggga atgtaccctc 5820agctccaagg
ccagatcttc cttcaatgat catgcatgct acttaggaag gtgtgtgtgt 5880gtgaatgtag
aattgccttt gttatttttt cttcctgctg tcaggaacat tttgaatacc 5940agagaaaaag
aaaagtgctc ttcttggcat gggaggagtt gtcacacttg caaaataaag 6000gatgcagtcc
caaatgttca taatctcagg gtctgaagga ggatcagaaa ctgtgtatac 6060aatttcaggc
ttctctgaat gcagcttttg aaagctgttc ctggccgagg cagtactagt 6120cagaaccctc
ggaaacagga acaaatgtct tcaaggtgca gcaggaggaa acaccttgcc 6180catcatgaaa
gtgaataacc actgccgctg aaggaatcca gctcctgttt gagcaggtgc 6240tgcacactcc
cacactgaaa caacagttca tttttatagg acttccagga aggatcttct 6300tcttaagctt
cttaattatg gtacatctcc agttggcaga tgactatgac tactgacagg 6360agaatgagga
actagctggg aatatttctg tttgaccacc atggagtcac ccatttcttt 6420actggtattt
ggaaataata attctgaatt gcaaagcagg agttagcgaa gatcttcatt 6480tcttccatgt
tggtgacagc acagttctgg ctatgaaagt ctgcttacaa ggaagaggat 6540aaaaatcata
gggataataa atctaagttt gaagacaatg aggttttagc tgcatttgac 6600atgaagaaat
tgagacctct actggatagc tatggtattt acgtgtcttt ttgcttagtt 6660acttattgac
cccagctgag gtcaagtatg aactcaggtc tctcgggcta ctggcatgga 6720ttgattacat
acaactgtaa ttttagcagt gatttagggt ttatgagtac ttttgcagta 6780aatcataggg
ttagtaatgt taatctcagg gaaaaaaaaa aaaagccaac cctgacagac 6840atcccagctc
aggtggaaat caaggatcac agctcagtgc ggtcccagag aacacaggga 6900ctcttctctt
aggaccttta tgtacagggc ctcaagataa ctgatgttag tcagaagact 6960ttccattctg
gccacagttc agctgaggca atcctggaat tttctctccg ctgcacagtt 7020ccagtcatcc
cagtttgtac agttctggca ctttttgggt caggccgtga tccaaggagc 7080agaagttcca
gctatggtca gggagtgcct gaccgtccca actcactgca ctcaaacaaa 7140ggcgaaacca
caagagtggc ttttgttgaa attgcagtgt ggcccagagg ggctgcacca 7200gtactggatt
gaccacgagg caacattaat cctcagcaag tgcaatttgc agccattaaa 7260ttgaactaac
tgatactaca atgcaatcag tatcaacaag tggtttggct tggaagatgg 7320agtctagggg
ctctacagga gtagctactc tctaatggag ttgcattttg aagcaggaca 7380ctgtgaaaag
ctggcctcct aaagaggctg ctaaacatta gggtcaattt tccagtgcac 7440tttctgaagt
gtctgcagtt ccccatgcaa agctgcccaa acatagcact tccaattgaa 7500tacaattata
tgcaggcgta ctgcttcttg ccagcactgt ccttctcaaa tgaactcaac 7560aaacaatttc
aaagtctagt agaaagtaac aagctttgaa tgtcattaaa aagtatatct 7620gctttcagta
gttcagctta tttatgccca ctagaaacat cttgtacaag ctgaacactg 7680gggctccaga
ttagtggtaa aacctacttt atacaatcat agaatcatag aatggcctgg 7740gttggaaggg
accccaagga tcatgaagat ccaacacccc cgccacaggc agggccacca 7800acctccagat
ctggtactag accaggcagc ccagggctcc atccaacctg gccatgaaca 7860cctccaggga
tggagcatcc acaacctctc tgggcagcct gtgccagcac ctcaccaccc 7920tctctgtgaa
gaacttttcc ctgacatcca atctaagcct tccctccttg aggttagatc 7980cactccccct
tgtgctatca ctgtctactc ttgtaaaaag ttgattctcc tcctttttgg 8040aaggttgcaa
tgaggtctcc ttgcagcctt cttctcttct gcaggatgaa caagcccagc 8100tccctcagcc
tgtctttata ggagaggtgc tccagccctc tgatcatctt tgtggccctc 8160ctctggaccc
gctccaagag ctccacatct ttcctgtact gggggcccca ggcctgaatg 8220cagtactcca
gatggggcct caaaagagca gagtaaagag ggacaatcac cttcctcacc 8280ctgctggcca
gccctcttct gatggagccc tggatacaac tggctttctg agctgcaact 8340tctccttatc
agttccacta ttaaaacagg aacaatacaa caggtgctga tggccagtgc 8400agagtttttc
acacttcttc atttcggtag atcttagatg aggaacgttg aagttgtgct 8460tctgcgtgtg
cttcttcctc ctcaaatact cctgcctgat acctcacccc acctgccact 8520gaatggctcc
atggccccct gcagccaggg ccctgatgaa cccggcactg cttcagatgc 8580tgtttaatag
cacagtatga ccaagttgca cctatgaata cacaaacaat gtgttgcatc 8640cttcagcact
tgagaagaag agccaaattt gcattgtcag gaaatggttt agtaattctg 8700ccaattaaaa
cttgtttatc taccatggct gtttttatgg ctgttagtag tggtacactg 8760atgatgaaca
atggctatgc agtaaaatca agactgtaga tattgcaaca gactataaaa 8820ttcctctgtg
gcttagccaa tgtggtactt cccacattgt ataagaaatt tggcaagttt 8880agagcaatgt
ttgaagtgtt gggaaatttc tgtatactca agagggcgtt tttgacaact 8940gtagaacaga
ggaatcaaaa gggggtggga ggaagttaaa agaagaggca ggtgcaagag 9000agcttgcagt
cccgctgtgt gtacgacact ggcaacatga ggtctttgct aatcttggtg 9060ctttgcttcc
tgcccctggc tgccttaggg tgcgatctgc ctcagaccca cagcctgggc 9120agcaggagga
ccctgatgct gctggctcag atgaggagaa tcagcctgtt tagctgcctg 9180aaggataggc
acgattttgg ctttcctcaa gaggagtttg gcaaccagtt tcagaaggct 9240gagaccatcc
ctgtgctgca cgagatgatc cagcagatct ttaacctgtt tagcaccaag 9300gatagcagcg
ctgcttggga tgagaccctg ctggataagt tttacaccga gctgtaccag 9360cagctgaacg
atctggaggc ttgcgtgatc cagggcgtgg gcgtgaccga gacccctctg 9420atgaaggagg
atagcatcct ggctgtgagg aagtactttc agaggatcac cctgtacctg 9480aaggagaaga
agtacagccc ctgcgcttgg gaagtcgtga gggctgagat catgaggagc 9540tttagcctga
gcaccaacct gcaagagagc ttgaggtcta aggagtaaaa agtctag
9597228DNAArtificial SequencePrimer ALV-SIN-1 2atgcgcgcat tggtaattga
tcggctgg 28380DNAArtificial
SequencePrimer ALV-SIN-2 3atatgcggcc gcggtaccgc ccgggcatcg atatcaagct
tacggttcac taaacgagct 60ctgcttatat agacctccca
80459DNAArtificial SequencePrimer ALV-SIN-3
4atatgcggcc gcgtcgacgg ccggccagat ctgctgagcc ggtcgctacc attaccagt
59528DNAArtificial SequencePrimer ALV-SIN-4 5atacgcgtat tccctaacga
tcacgtcg 28621DNAArtificial
SequencePrimer ALV-SIN-5 6ctgaagtgta aggaatgtaa g
21730DNAArtificial SequencePrimer ALV-SIN-6
7gcgcgtctca tccccctccc tatgcaaaag
30837DNAArtificial SequencePrimer ALV-SIN-7 8gggcgtctca gggacggatt
ggacgaacca ctgaatt 37920DNAArtificial
SequencePrimer ALV-SIN-8 9ttagtgcttt acggcacctc
201038DNAArtificial SequencePrimer ALV-SIN-9
10gacggatccg ataccgtccc tatttttgtg tttgcttc
381130DNAArtificial SequencePrimer ALV-SIN-10 11taacggatcc tagacttttt
actccttaga 301211945DNAArtificial
SequenceProximal promoter and lysozyme signal peptide 12tgccgccttc
tttgatattc actctgttgt atttcatctc ttcttgccga tgaaaggata 60taacagtctg
tataacagtc tgtgaggaaa tacttggtat ttcttctgat cagtgttttt 120ataagtaatg
ttgaatattg gataaggctg tgtgtccttt gtcttgggag acaaagccca 180cagcaggtgg
tggttggggt ggtggcagct cagtgacagg agaggttttt ttgcctgttt 240tttttttttt
tttttttttt aagtaaggtg ttcttttttc ttagtaaatt ttctactgga 300ctgtatgttt
tgacaggtca gaaacatttc ttcaaaagaa gaaccttttg gaaactgtac 360agcccttttc
tttcattccc tttttgcttt ctgtgccaat gcctttggtt ctgattgcat 420tatggaaaac
gttgatcgga acttgaggtt tttatttata gtgtggcttg aaagcttgga 480tagctgttgt
tacacgagat accttattaa gtttaggcca gcttgatgct ttattttttc 540cctttgaagt
agtgagcgtt ctctggtttt tttcctttga aactggtgag gcttagattt 600ttctaatggg
attttttacc tgatgatcta gttgcatacc caaatgcttg taaatgtttt 660cctagttaac
atgttgataa cttcggattt acatgttgta tatacttgtc atctgtgttt 720ctagtaaaaa
tatatggcat ttatagaaat acgtaattcc tgatttcctt tttttttatc 780tctatgctct
gtgtgtacag gtcaaacaga cttcactcct atttttattt atagaatttt 840atatgcagtc
tgtcgttggt tcttgtgttg taaggataca gccttaaatt tcctagagcg 900atgctcagta
aggcgggttg tcacatgggt tcaaatgtaa aacgggcacg tttggctgct 960gccttcccga
gatccaggac actaaactgc ttctgcactg aggtataaat cgcttcagat 1020cccagggaag
tgcagatcca cgtgcatatt cttaaagaag aatgaatact ttctaaaata 1080ttttggcata
ggaagcaagc tgcatggatt tgtttgggac ttaaattatt ttggtaacgg 1140agtgcatagg
ttttaaacac agttgcagca tgctaacgag tcacagcgtt tatgcagaag 1200tgatgcctgg
atgcctgttg cagctgttta cggcactgcc ttgcagtgag cattgcagat 1260aggggtgggg
tgctttgtgt cgtgttccca cacgctgcca cacagccacc tcccggaaca 1320catctcacct
gctgggtact tttcaaacca tcttagcagt agtagatgag ttactatgaa 1380acagagaagt
tcctcagttg gatattctca tgggatgtct tttttcccat gttgggcaaa 1440gtatgataaa
gcatctctat ttgtaaatta tgcacttgtt agttcctgaa tcctttctat 1500agcaccactt
attgcagcag gtgtaggctc tggtgtggcc tgtgtctgtg cttcaatctt 1560ttaaagcttc
tttggaaata cactgacttg attgaagtct cttgaagata gtaaacagta 1620cttacctttg
atcccaatga aatcgagcat ttcagttgta aaagaattcc gcctattcat 1680accatgtaat
gtaattttac acccccagtg ctgacacttt ggaatatatt caagtaatag 1740actttggcct
caccctcttg tgtactgtat tttgtaatag aaaatatttt aaactgtgca 1800tatgattatt
acattatgaa agagacattc tgctgatctt caaatgtaag aaaatgagga 1860gtgcgtgtgc
ttttataaat acaagtgatt gcaaattagt gcaggtgtcc ttaaaaaaaa 1920aaaaaaaaag
taatataaaa aggaccaggt gttttacaag tgaaatacat tcctatttgg 1980taaacagtta
catttttatg aagattacca gcgctgctga ctttctaaac ataaggctgt 2040attgtcttcc
tgtaccattg catttcctca ttcccaattt gcacaaggat gtctgggtaa 2100actattcaag
aaatggcttt gaaatacagc atgggagctt gtctgagttg gaatgcagag 2160ttgcactgca
aaatgtcagg aaatggatgt ctctcagaat gcccaactcc aaaggatttt 2220atatgtgtat
atagtaagca gtttcctgat tccagcaggc caaagagtct gctgaatgtt 2280gtgttgccgg
agacctgtat ttctcaacaa ggtaagatgg tatcctagca actgcggatt 2340ttaatacatt
ttcagcagaa gtacttagtt aatctctacc tttagggatc gtttcatcat 2400ttttagatgt
tatacttgaa atactgcata acttttagct ttcatgggtt cctttttttc 2460agcctttagg
agactgttaa gcaatttgct gtccaacttt tgtgttggtc ttaaactgca 2520atagtagttt
accttgtatt gaagaaataa agaccatttt tatattaaaa aatacttttg 2580tctgtcttca
ttttgacttg tctgatatcc ttgcagtgcc cattatgtca gttctgtcag 2640atattcagac
atcaaaactt aacgtgagct cagtggagtt acagctgcgg ttttgatgct 2700gttattattt
ctgaaactag aaatgatgtt gtcttcatct gctcatcaaa cacttcatgc 2760agagtgtaag
gctagtgaga aatgcataca tttattgata cttttttaaa gtcaactttt 2820tatcagattt
ttttttcatt tggaaatata ttgttttcta gactgcatag cttctgaatc 2880tgaaatgcag
tctgattggc atgaagaagc acagcactct tcatcttact taaacttcat 2940tttggaatga
aggaagttaa gcaagggcac aggtccatga aatagagaca gtgcgctcag 3000gagaaagtga
acctggattt ctttggctag tgttctaaat ctgtagtgag gaaagtaaca 3060cccgattcct
tgaaagggct ccagctttaa tgcttccaaa ttgaaggtgg caggcaactt 3120ggccactggt
tatttactgc attatgtctc agtttcgcag ctaacctggc ttctccacta 3180ttgagcatgg
actatagcct ggcttcagag gccaggtgaa ggttgggatg ggtggaagga 3240gtgctgggct
gtggctgggg ggactgtggg gactccaagc tgagcttggg gtgggcagca 3300cagggaaaag
tgtgggtaac tatttttaag tactgtgttg caaacgtctc atctgcaaat 3360acgtagggtg
tgtactctcg aagattaaca gtgtgggttc agtaatatat ggatgaattc 3420acagtggaag
cattcaaggg tagatcatct aacgacacca gatcatcaag ctatgattgg 3480aagcggtatc
agaagagcga ggaaggtaag cagtcttcat atgttttccc tccacgtaaa 3540gcagtctggg
aaagtagcac cccttgagca gagacaagga aataattcag gagcatgtgc 3600taggagaact
ttcttgctga attctacttg caagagcttt gatgcctggc ttctggtgcc 3660ttctgcagca
cctgcaaggc ccagagcctg tggtgagctg gagggaaaga ttctgctcaa 3720gtccaagctt
cagcaggtca ttgtctttgc ttcttccccc agcactgtgc agcagagtgg 3780aactgatgtc
gaagcctcct gtccactacc tgttgctgca ggcagactgc tctcagaaaa 3840agagagctaa
ctctatgcca tagtctgaag gtaaaatggg ttttaaaaaa gaaaacacaa 3900aggcaaaacc
ggctgcccca tgagaagaaa gcagtggtaa acatggtaga aaaggtgcag 3960aagcccccag
gcagtgtgac aggcccctcc tgccacctag aggcgggaac aagcttccct 4020gcctagggct
ctgcccgcga agtgcgtgtt tctttggtgg gttttgtttg gcgtttggtt 4080ttgagattta
gacacaaggg aagcctgaaa ggaggtgttg ggcactattt tggtttgtaa 4140agcctgtact
tcaaatatat attttgtgag ggagtgtagc gaattggcca atttaaaata 4200aagttgcaag
agattgaagg ctgagtagtt gagagggtaa cacgtttaat gagatcttct 4260gaaactactg
cttctaaaca cttgtttgag tggtgagacc ttggataggt gagtgctctt 4320gttacatgtc
tgatgcactt gcttgtcctt ttccatccac atccatgcat tccacatcca 4380cgcatttgtc
acttatccca tatctgtcat atctgacata cctgtctctt cgtcacttgg 4440tcagaagaaa
cagatgtgat aatccccagc cgccccaagt ttgagaagat ggcagttgct 4500tctttccctt
tttcctgcta agtaaggatt ttctcctggc tttgacacct cacgaaatag 4560tcttcctgcc
ttacattctg ggcattattt caaatatctt tggagtgcgc tgctctcaag 4620tttgtgtctt
cctactctta gagtgaatgc tcttagagtg aaagagaagg aagagaagat 4680gttggccgca
gttctctgat gaacacacct ctgaataatg gccaaaggtg ggtgggtttc 4740tctgaggaac
gggcagcgtt tgcctctgaa agcaaggagc tctgcggagt tgcagttatt 4800ttgcaactga
tggtggaact ggtgcttaaa gcagattccc taggttccct gctacttctt 4860ttccttcttg
gcagtcagtt tatttctgac agacaaacag ccacccccac tgcaggctta 4920gaaagtatgt
ggctctgcct gggtgtgtta cagctctgcc ctggtgaaag gggattaaaa 4980cgggcaccat
tcatcccaaa caggatcctc attcatggat caagctgtaa ggaacttggg 5040ctccaacctc
aaaacattaa ttggagtacg aatgtaatta aaactgcatt ctcgcattcc 5100taagtcattt
agtctggact ctgcagcatg taggtcggca gctcccactt tctcaaagac 5160cactgatgga
ggagtagtaa aaatggagac cgattcagaa caaccaacgg agtgttgccg 5220aagaaactga
tggaaataat gcatgaattg tgtggtggac atttttttta aatacataaa 5280ctacttcaaa
tgaggtcgga gaaggtcagt gttttattag cagccataaa accaggtgag 5340cgagtaccat
ttttctctac aagaaaaacg attctgagct ctgcgtaagt ataagttctc 5400catagcggct
gaagctcccc cctggctgcc tgccatctca gctggagtgc agtgccattt 5460ccttggggtt
tctctcacag cagtaatggg acaatacttc acaaaaattc tttcttttcc 5520tgtcatgtgg
gatccctact gtgccctcct ggttttacgt taccccctga ctgttccatt 5580cagcggtttg
gaaagagaaa aagaatttgg aaataaaaca tgtctacgtt atcacctcct 5640ccagcatttt
ggtttttaat tatgtcaata actggcttag atttggaaat gagagggggt 5700tgggtgtatt
accgaggaac aaaggaaggc ttatataaac tcaagtcttt tatttagaga 5760actggcaagc
tgtcaaaaac aaaaaggcct taccaccaaa ttaagtgaat agccgctata 5820gccagcaggg
ccagcacgag ggatggtgca ctgctggcac tatgccacgg cctgcttgtg 5880actctgagag
caactgcttt ggaaatgaca gcacttggtg caatttcctt tgtttcagaa 5940tgcgtagagc
gtgtgcttgg cgacagtttt tctagttagg ccacttcttt tttccttctc 6000tcctcattct
cctaagcatg tctccatgct ggtaatccca gtcaagtgaa cgttcaaaca 6060atgaatccat
cactgtagga ttctcgtggt gatcaaatct ttgtgtgagg tctataaaat 6120atggaagctt
atttattttt cgttcttcca tatcagtctt ctctatgaca attcacatcc 6180accacagcaa
attaaaggtg aaggaggctg gtgggatgaa gagggtcttc tagctttacg 6240ttcttccttg
caaggccaca ggaaaatgct gagagctgta gaatacagcc tggggtaaga 6300agttcagtct
cctgctggga cagctaaccg catcttataa ccccttctga gactcatctt 6360aggaccaaat
agggtctatc tggggttttt gttcctgctg ttcctcctgg aaggctatct 6420cactatttca
ctgctcccac ggttacaaac caaagataca gcctgaattt tttctaggcc 6480acattacata
aatttgacct ggtaccaata ttgttctcta tatagttatt tccttcccca 6540ctgtgtttaa
ccccttaagg cattcagaac aactagaatc atagaatggt ttggattgga 6600aggggcctta
aacatcatcc atttccaacc ctctgccatg ggctgcttgc cacccactgg 6660ctcaggctgc
ccagggcccc atccagcctg gccttgagca cctccaggga tggggcaccc 6720acagcttctc
tgggcagcct gtgccaacac ctcaccactc tctgggtaaa gaattctctt 6780ttaacatcta
atctaaatct cttctctttt agtttaaagc cattcctctt tttcccgttg 6840ctatctgtcc
aagaaatgtg tattggtctc cctcctgctt ataagcagga agtactggaa 6900ggctgcagtg
aggtctcccc acagccttct cttctccagg ctgaacaagc ccagctcctt 6960cagcctgtct
tcgtaggaga tcatcttagt ggccctcctc tggacccatt ccaacagttc 7020cacggctttc
ttgtggagcc ccaggtctgg atgcagtact tcagatgggg ccttacaaag 7080gcagagcaga
tggggacaat cgcttacccc tccctgctgg ctgcccctgt tttgatgcag 7140cccagggtac
tgttggcctt tcaggctccc agaccccttg ctgatttgtg tcaagctttt 7200catccaccag
aacccacgct tcctggttaa tacttctgcc ctcacttctg taagcttgtt 7260tcaggagact
tccattcttt aggacagact gtgttacacc tacctgccct attcttgcat 7320atatacattt
cagttcatgt ttcctgtaac aggacagaat atgtattcct ctaacaaaaa 7380tacatgcaga
attcctagtg ccatctcagt agggttttca tggcagtatt agcacatagt 7440caatttgctg
caagtacctt ccaagctgcg gcctcccata aatcctgtat ttgggatcag 7500ttaccttttg
gggtaagctt ttgtatctgc agagaccctg ggggttctga tgtgcttcag 7560ctctgctctg
ttctgactgc accattttct agatcaccca gttgttcctg tacaacttcc 7620ttgtcctcca
tcctttccca gcttgtatct ttgacaaata caggcctatt tttgtgtttg 7680cttcagcagc
catttaattc ttcagtgtca tcttgttctg ttgatgccac tggaacagga 7740ttttcagcag
tcttgcaaag aacatctagc tgaaaacttt ctgccattca atattcttac 7800cagttcttct
tgtttgaggt gagccataaa ttactagaac ttcgtcactg acaagtttat 7860gcattttatt
acttctatta tgtacttact ttgacataac acagacacgc acatattttg 7920ctgggatttc
cacagtgtct ctgtgtcctt cacatggttt tactgtcata cttccgttat 7980aaccttggca
atctgcccag ctgcccatca caagaaaaga gattcctttt ttattacttc 8040tcttcagcca
ataaacaaaa tgtgagaagc ccaaacaaga acttgtgggg caggctgcca 8100tcaagggaga
gacagctgaa gggttgtgta gctcaataga attaagaaat aataaagctg 8160tgtcagacag
ttttgcctga tttatacagg cacgccccaa gccagagagg ctgtctgcca 8220aggccacctt
gcagtccttg gtttgtaaga taagtcatag gtaacttttc tggtgaattg 8280cgtggagaat
catgatggca gttcttgctg tttactatgg taagatgcta aaataggaga 8340cagcaaagta
acacttgctg ctgtaggtgc tctgctatcc agacagcgat ggcactcgca 8400caccaagatg
agggatgctc ccagctgacg gatgctgggg cagtaacagt gggtcccatg 8460ctgcctgctc
attagcatca cctcagccct caccagccca tcagaaggat catcccaagc 8520tgaggaaagt
tgctcatctt cttcacatca tcaaaccttt ggcctgactg atgcctcccg 8580gatgcttaaa
tgtggtcact gacatcttta tttttctatg atttcaagtc agaacctccg 8640gatcaggagg
gaacacatag tgggaatgta ccctcagctc caaggccaga tcttccttca 8700atgatcatgc
atgctactta ggaaggtgtg tgtgtgtgaa tgtagaattg cctttgttat 8760tttttcttcc
tgctgtcagg aacattttga ataccagaga aaaagaaaag tgctcttctt 8820ggcatgggag
gagttgtcac acttgcaaaa taaaggatgc agtcccaaat gttcataatc 8880tcagggtctg
aaggaggatc agaaactgtg tatacaattt caggcttctc tgaatgcagc 8940ttttgaaagc
tgttcctggc cgaggcagta ctagtcagaa ccctcggaaa caggaacaaa 9000tgtcttcaag
gtgcagcagg aggaaacacc ttgcccatca tgaaagtgaa taaccactgc 9060cgctgaagga
atccagctcc tgtttgagca ggtgctgcac actcccacac tgaaacaaca 9120gttcattttt
ataggacttc caggaaggat cttcttctta agcttcttaa ttatggtaca 9180tctccagttg
gcagatgact atgactactg acaggagaat gaggaactag ctgggaatat 9240ttctgtttga
ccaccatgga gtcacccatt tctttactgg tatttggaaa taataattct 9300gaattgcaaa
gcaggagtta gcgaagatct tcatttcttc catgttggtg acagcacagt 9360tctggctatg
aaagtctgct tacaaggaag aggataaaaa tcatagggat aataaatcta 9420agtttgaaga
caatgaggtt ttagctgcat ttgacatgaa gaaattgaga cctctactgg 9480atagctatgg
tatttacgtg tctttttgct tagttactta ttgaccccag ctgaggtcaa 9540gtatgaactc
aggtctctcg ggctactggc atggattgat tacatacaac tgtaatttta 9600gcagtgattt
agggtttatg agtacttttg cagtaaatca tagggttagt aatgttaatc 9660tcagggaaaa
aaaaaaaaag ccaaccctga cagacatccc agctcaggtg gaaatcaagg 9720atcacagctc
agtgcggtcc cagagaacac agggactctt ctcttaggac ctttatgtac 9780agggcctcaa
gataactgat gttagtcaga agactttcca ttctggccac agttcagctg 9840aggcaatcct
ggaattttct ctccgctgca cagttccagt catcccagtt tgtacagttc 9900tggcactttt
tgggtcaggc cgtgatccaa ggagcagaag ttccagctat ggtcagggag 9960tgcctgaccg
tcccaactca ctgcactcaa acaaaggcga aaccacaaga gtggcttttg 10020ttgaaattgc
agtgtggccc agaggggctg caccagtact ggattgacca cgaggcaaca 10080ttaatcctca
gcaagtgcaa tttgcagcca ttaaattgaa ctaactgata ctacaatgca 10140atcagtatca
acaagtggtt tggcttggaa gatggagtct aggggctcta caggagtagc 10200tactctctaa
tggagttgca ttttgaagca ggacactgtg aaaagctggc ctcctaaaga 10260ggctgctaaa
cattagggtc aattttccag tgcactttct gaagtgtctg cagttcccca 10320tgcaaagctg
cccaaacata gcacttccaa ttgaatacaa ttatatgcag gcgtactgct 10380tcttgccagc
actgtccttc tcaaatgaac tcaacaaaca atttcaaagt ctagtagaaa 10440gtaacaagct
ttgaatgtca ttaaaaagta tatctgcttt cagtagttca gcttatttat 10500gcccactaga
aacatcttgt acaagctgaa cactggggct ccagattagt ggtaaaacct 10560actttataca
atcatagaat catagaatgg cctgggttgg aagggacccc aaggatcatg 10620aagatccaac
acccccgcca caggcagggc caccaacctc cagatctggt actagaccag 10680gcagcccagg
gctccatcca acctggccat gaacacctcc agggatggag catccacaac 10740ctctctgggc
agcctgtgcc agcacctcac caccctctct gtgaagaact tttccctgac 10800atccaatcta
agccttccct ccttgaggtt agatccactc ccccttgtgc tatcactgtc 10860tactcttgta
aaaagttgat tctcctcctt tttggaaggt tgcaatgagg tctccttgca 10920gccttcttct
cttctgcagg atgaacaagc ccagctccct cagcctgtct ttataggaga 10980ggtgctccag
ccctctgatc atctttgtgg ccctcctctg gacccgctcc aagagctcca 11040catctttcct
gtactggggg ccccaggcct gaatgcagta ctccagatgg ggcctcaaaa 11100gagcagagta
aagagggaca atcaccttcc tcaccctgct ggccagccct cttctgatgg 11160agccctggat
acaactggct ttctgagctg caacttctcc ttatcagttc cactattaaa 11220acaggaacaa
tacaacaggt gctgatggcc agtgcagagt ttttcacact tcttcatttc 11280ggtagatctt
agatgaggaa cgttgaagtt gtgcttctgc gtgtgcttct tcctcctcaa 11340atactcctgc
ctgatacctc accccacctg ccactgaatg gctccatggc cccctgcagc 11400cagggccctg
atgaacccgg cactgcttca gatgctgttt aatagcacag tatgaccaag 11460ttgcacctat
gaatacacaa acaatgtgtt gcatccttca gcacttgaga agaagagcca 11520aatttgcatt
gtcaggaaat ggtttagtaa ttctgccaat taaaacttgt ttatctacca 11580tggctgtttt
tatggctgtt agtagtggta cactgatgat gaacaatggc tatgcagtaa 11640aatcaagact
gtagatattg caacagacta taaaattcct ctgtggctta gccaatgtgg 11700tacttcccac
attgtataag aaatttggca agtttagagc aatgtttgaa gtgttgggaa 11760atttctgtat
actcaagagg gcgtttttga caactgtaga acagaggaat caaaaggggg 11820tgggaggaag
ttaaaagaag aggcaggtgc aagagagctt gcagtcccgc tgtgtgtacg 11880acactggcaa
catgaggtct ttgctaatct tggtgctttg cttcctgccc ctggctgcct 11940taggg
119451329DNAArtificial SequenceBAC 26 Primer-1 13gcggaattca aagaagaaag
ctgaaaaac 291429DNAArtificial
SequenceBAC 26 Primer-2 14gcgggtacct tcaaatacta caagtgaaa
291533DNAArtificial SequenceBAC 26-OV Primer 1
15ggcctcgagt caagttctga gtaggtttta gtg
331641DNAArtificial SequenceBAC 26-OV Primer 2 16gcgcgtctct gtctagagca
aacagcagaa cagtgaaaat g 411750DNAArtificial
SequenceCTLA-4-Fc Primer 1 17gcgcgtctca agacaactca gagttcacca tgggtgtact
gctcacacag 501829DNAArtificial SequenceCTLA-4-Fc Primer 2
18ggcccgggag ttttgtcaga agatttggg
291911868DNAArtificial SequencepSIN-OV-3.5-I-CTLA4-inv Vector
19aattgctaga ctaggatccc ccgtgctgca gaaccgagcg gctattgact tcttgctcct
60agctcacggc catggctgtg aggacattgc gggaatgtgt tgtttcaatc tgagtgatca
120cagtgagtct atacagaaga agttccagct aatgaaggaa catgtcaata agatcggcgt
180gaacaacgac ccaatcggaa gttggctgcg aggattattc ggaggaatag gagaatgggc
240cgtacacttg ctgaaaggac tgcttttggg gcttgtagtt atcttgttgc tagtagtatg
300cttgccttgc cttttgcaat gtgtatctag tagtattcga aagatgattg ataattcact
360cggctatcgc gaggaatata aaaaaattac aggaggctta taagcagccc gaaagaagag
420cgtaggcgag ttcttgtatt ccgtgtgata gctggttgga ttggtaattg atcggctggc
480acgcggaata taggaggtcg ctgaatagta aacttgtaga cttggctaca gcatagagta
540tcttctgtag ctctgatgac tgctaggaaa taatgctacg gataatgtgg ggagggcaag
600gcttgcgaat cgggttgtaa cgggcaaggc ttgactgagg ggacaatagc atgtttaggc
660gaaaagcggg gcttcggttg tacgcggtta ggagtcccct caggatatag tagtttcgct
720tttgcatagg gagggggacg gattggacga accactgaat tccgcattgc agagatattg
780tatttaagtg cctagctcga tacaataaac gccatttgac cattcaccac attggtgtgc
840acctgggttg atggccggac cgttgattcc ctgrcgacta cgagcacatg catgaagcag
900aaggcttcat ttggtgaccc cgacgtgatc gttagggaat acgcgctcac tggccgtcgt
960tttacaacgt cgtgactggg aaaaccctgg cgttacccaa cttaatcgcc ttgcagcaca
1020tccccctttc gccagctggc gtaatagcga agaggcccgc accgatcgcc cttcccaaca
1080gttgcgcagc ctgaatggcg aatggaaatt gtaagcgtta atattttgtt aaaattcgcg
1140ttaaattttt gttaaatcag ctcatttttt aaccaatagg ccgaaatcgg caaaatccct
1200tataaatcaa aagaatagac cgagataggg ttgagtgttg ttccagtttg gaacaagagt
1260ccactattaa agaacgtgga ctccaacgtc aaagggcgaa aaaccgtcta tcagggcgat
1320ggcccactac gtgaaccatc accctaatca agttttttgg ggtcgaggtg ccgtaaagca
1380ctaaatcgga accctaaagg gagcccccga tttagagctt gacggggaaa gccggcgaac
1440gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg ctagggcgct ggcaagtgta
1500gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta atgcgccgct acagggcgcg
1560tcaggtggca cttttcgggg aaatgtgcgc ggaaccccta tttgtttatt tttctaaata
1620cattcaaata tgtatccgct catgagacaa taaccctgat aaatgcttca ataatattga
1680aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc ttattccctt ttttgcggca
1740ttttgccttc ctgtttttgc tcacccagaa acgctggtga aagtaaaaga tgctgaagat
1800cagttgggtg cacgagtggg ttacatcgaa ctggatctca acagcggtaa gatccttgag
1860agttttcgcc ccgaagaacg ttttccaatg atgagcactt ttaaagttct gctatgtggc
1920gcggtattat cccgtattga cgccgggcaa gagcaactcg gtcgccgcat acactattct
1980cagaatgact tggttgagta ctcaccagtc acagaaaagc atcttacgga tggcatgaca
2040gtaagagaat tatgcagtgc tgccataacc atgagtgata acactgcggc caacttactt
2100ctgacaacga tcggaggacc gaaggagcta accgcttttt tgcacaacat gggggatcat
2160gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt
2220gacaccacga tgcctgtagc aatggcaaca acgttgcgca aactattaac tggcgaacta
2280cttactctag cttcccggca acaattaata gactggatgg aggcggataa agttgcagga
2340ccacttctgc gctcggccct tccggctggc tggtttattg ctgataaatc tggagccggt
2400gagcgtgggt ctcgcggtat cattgcagca ctggggccag atggtaagcc ctcccgtatc
2460gtagttatct acacgacggg gagtcaggca actatggatg aacgaaatag acagatcgct
2520gagataggtg cctcactgat taagcattgg taactgtcag accaagttta ctcatatata
2580ctttagattg atttaaaact tcatttttaa tttaaaagga tctaggtgaa gatccttttt
2640gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc
2700gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg
2760caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact
2820ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt ccttctagtg
2880tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg
2940ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac
3000tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca
3060cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga
3120gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc
3180ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct
3240gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg
3300agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct
3360tttgctcaca tgttctttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc
3420tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga gtcagtgagc
3480gaggaagcgg aagagcgccc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat
3540taatgcagct ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt
3600aatgtgagtt agctcactca ttaggcaccc caggctttac actttatgct tccggctcgt
3660atgttgtgtg gaattgtgag cggataacaa tttcacacag gaaacagcta tgaccatgat
3720tacgccaagc gcgcattggt aattgatcgg ctggcacgcg gaatatagga ggtcgctgaa
3780tagtaaactt gtagacttgg ctacagcata gagtatcttc tgtagctctg atgactgcta
3840ggaaataatg ctacggataa tgtggggagg gcaaggcttg cgaatcgggt tgtaacgggc
3900aaggcttgac tgaggggaca atagcatgtt taggcgaaaa gcggggcttc ggttgtacgc
3960ggttaggagt cccctcagga tatagtagtt tcgcttttgc atagggaggg ggaaatgtag
4020tcttatgcaa tactcttgta gtcttgcaac atgcttatgt aacgatgagt tagcaacatg
4080ccttataagg agagaaaaag caccgtgcat gccgattggt gggagtaagg tggtatgatc
4140gtggtatgat cgtgccttgt taggaaggca acagacgggt ctaacacgga ttggacgaac
4200cactgaattc cgcattgcag agatattgta tttaagtgcc tagctcgata caataaacgc
4260catttgacca ttcaccacat tggtgtgcac ctgggttgat ggccggaccg ttgattccct
4320grcgactacg agcacatgca tgaagcagaa ggcttcattt ggtgaccccg acgtgatcgt
4380tagggaatag tggtcggcca caggcggcgt ggcgatcctg tcctcatccg tctcgcttat
4440tcggggagcg gacgatgacc ctagtagagg gggctgcggc ttaggagggc agaagctgag
4500tggcgtcgga gggagcccta ctgcaggggg ccaacatacc ctaccgagaa ctcagagagt
4560cgttggaaga cgggaaggaa gcccgacgac tgagcggtcc accccaggcg tgattccggt
4620tgctctgcgt gattccggtc gcccggtgga tcaagcatgg aagccgtcat aaaggtgatt
4680tcgtccgcgt gtaagaccta ttgcgggaaa acctctcctt ctaagaagga aataggggct
4740atgttgtccc tgttacaaaa ggaagggttg cttacgtccc cctcagactt atattccccg
4800gggtcctggg atcccattac cgcggcgctc tctcagcggg ctatggtact tggaaaatcg
4860ggagagttaa aaacctgggg attggttttg ggggcattga aggcggctcg agatccggta
4920ccttcaaata ctacaagtga aaagtgtttg cttaaacatg tttttattat gattaaagga
4980acaaaagagc acattcacaa gacccattac atatgggtac aaggaaaaca atttgaatag
5040taatatacca tatttgccaa cataccatga ttgagtcaaa gtttagggag aaatgtgaat
5100tataagattt ttataatgca tctttaggaa gtcaggaaga gccttgtagt atcaggaaca
5160cagagaacaa gcaattgcct tgtcagcata ggaatggttg gtgacagttg ataatttaat
5220ctgagagatt ttgagtgact aattctggag cagcttggtc atacagatat ctggcttaat
5280tggaaggctg catttttccc ccataaacct tctgctgatg tatcaggttg catttttcag
5340tgtgatgact cagtactgtg agtccaattt cattccctta agccttcatc catgagttac
5400cagtattact ctgtgtaaag gaaaagtgaa ttgcacctgt tctcacagtg taatttcttt
5460ctgatttttt ttctagatta agctccagct tttatgaagt ctggatgcag cagataacat
5520acttttcatt ttacccctga tactacagtg ctctgggtct tgttggaagg gacagagttt
5580ttcagctttc ttctttgaat tcctcattta cccggagaca gggagaggct cttctgcgtg
5640tagtggttgt gcagagcctc atgcatcacg gagcatgaga agacgttccc ctgctgccac
5700ctgctcttgt ccacggtgag cttgctgtag aggaagaagg agccgtcgga gtccagcacg
5760ggaggcgtgg tcttgtagtt gttctccggc tgcccattgc tctcccactc cacggcgatg
5820tcgctgggat agaagccttt gaccaggcag gtcaggctga cctggttctt ggtcagctca
5880tcccgggatg ggggcagggt gtacacctgt ggttctcggg gctgcccttt ggctttggag
5940atggttttct cgatgggggc tgggagggct ttgttggaga ccttgcactt gtactccttg
6000ccattcagcc agtcctggtg caggacggtg aggacgctga ccacccggta cgtgctgttg
6060tactgctcct cccgcggctt tgtcttggca ttatgcacct ccacgccgtc cacgtaccag
6120ttgaacttga cctcagggtc ttcgtggctc acgtccacca ccacgcatgt gacctcaggg
6180gtccgggaga tcatgagggt gtccttgggt tttgggggga agaggaagac tgacgatccc
6240cccaggagtt caggtgctgg ggacggtggg gatgtgtgag ttttgtcaga agatttgggc
6300tcctgatcag aatctgggca cggttctgga tcaattacat aaatctgggt tccgttgcct
6360atgcccaggt agtatggcgg tgggtacatg agctccacct tgcagatgta gagtcccgtg
6420tccatggccc tcagtccttg gatagtgagg ttcacttgat ttccactgga ggtgcccgtg
6480cagatggaat catctaggaa ggtcaactca ttccccatca tgtaggttgc cgcacagact
6540tcagtcacct ggctgtcagc ctgccgaagc actgtcaccc ggacctcagt ggctttgcct
6600ggagatgcat actcacacac aaagctrgcg atgcctcggc tgctggccag taccacagca
6660ggctgggcca cgtgcattgc catgctcgcc atgcttggaa acaggagtgc aaggaccaga
6720ctgagcagcg tcctctgtgt gagcagtaca cccatggtga actctgagtt gtctagagca
6780aacagcagaa cagtgaaaat gtaaggatgg aatgctgtac atagtaccat gcagggtact
6840ctatggtagg ctacaacagt aaattacgag cagtttttag gcaattaaat gttaacaagt
6900agttttaaag taattctgtg gtaatgtgtc tgttgctata tccacctctc atgtgcatgt
6960tcaaaaccat attcataaat ctatttatgt atttgcattc agttgtcttt tgggtagcaa
7020actgtcccag aagccagttg cctctacata tttttgttca gtgaaagcta gaattcattg
7080atacttttca gtacctctga ttaaaacaca atctgatagg cttgcaaaac tggaaattca
7140aagagcaaat ttcagtaaac tttaggtttg gacagatata tgagaaagca gaggcttgct
7200gactatttta tttcttattt ttattcccta aaaataaatg tagagaaata tctgtttgtt
7260gcacactact tgctatgagt agatcttcaa aagtattttt acctttgttt tggtgatggc
7320agaatagata aggaatgtaa tttatatggg gtcatgtagt ctaggagaaa gacacgcatg
7380taattcatat tctgctctat tgcactttca ggtatggttt gctttgctca aagatatgca
7440tgtgtactgt agtataaact ttctgtggag ttaaatttta gtggtgacat tcagacagaa
7500gagaaatgca gacatgataa aatagcaatg tttactataa aacagagcca ctgaatgaat
7560tcttgttcat gacatagacc aatagaagat ttatacttgt tctgtctgtt tctattataa
7620agagctgaac tgtacaacta ttgtatagcc agtgtgctta tataaagcac agcttttgga
7680gccagcatga atctagttgc tttcctgaga tttatataat ctgtgaaagt cagaagtcct
7740tcagagccca gccctttata tgcgtactga gtgctggggc ctcaggattg gattttctgt
7800attaaacccc tcaaaagttt ttactgacca cgtgtgtgag tatacacaca cacatttttc
7860tcattttctt ttctgtatat aagttcacat gtatctatta ttgtaagaat atacgtttat
7920gcacccccca catttttatc ttgtgtagtg atcagcagct gcactttgca ggaattaaac
7980ttctagagaa ttttcacatt aaaataactc cccagaattc actgaacacc atgattttgc
8040tctctgtgca ctctgtaggg ctagaagtta atcaagcaaa ctgcaaagca tatcagatag
8100tgaacgacag gataagatgt tctgaaatta aaaacatatt ttaagcacaa agaataagcc
8160tcctgaaaac aaacacaaag cttttacaca taataaaata gtgcagaatg catacacagg
8220tgagaagttt ttataggggg tatcacgcag gtacttcacc cttaaagata caacacatag
8280cacaataatt gttaattttt taaagtttag gtgcaagtaa gagctaatat agagagaagg
8340taattccaga gagttgctta cctttcgagc ttgactgcta aaggcaatac agctttctag
8400ctgtatgtac agacactggc tgagccctgg ggaatatata gtctgaattg tgacccaccc
8460acaggttccc ttcagaagtt tgacctttga caccatagaa atcatttaat gggattgggt
8520tagattttag tttcaatagg tccattttgg attgaatgga gagcaaatat tagtttttaa
8580ttctgggtaa caatgtgttt tctgcctgtt ctgctaatcc atcaggactg ttggatggga
8640gagaagactg ggaaatattg ctcatgttcc attgagcttc agttacaacc agataatggg
8700atctttaaga aaacagaaaa atgtgggaac cttggagatg gaaaacataa ttagcaatta
8760ttagttagtg tgcttattac tatggttgta gtaacagacc agaagtctgt ttcatttgat
8820ccttcttgta tgtacaatgt gcatctgagc cacgctagac aggacataaa tgagaacaag
8880acttgaccta ttattttctt gacaaaatag gagaaataaa gaagcgtgca tgtgaaggag
8940ccaactgaga ctagagtgaa gagcagacac actttctttc ctatagttgg aatatttaaa
9000tctatctttt tatgggtgtg aatgctttat aacaaacttt tattctgagg atacagcaaa
9060acatagctcc atacaatgca aaacaatact caatttcaaa tgtgtttatg atatgaactt
9120gcagtgttcc tcaaagatct tccatgaata acttaatggc ctggcagatg acagaggaat
9180tgtgaaattc agctggagga gtgttcatgg ttcgagggac aatcataata tacaatagca
9240aatatatttc agttatagaa gctattgttc tgtattgaaa taatagaatt gacaaacagt
9300aaagaaacca ttctgacctc tgtaaagcac tgtttgattt aaaaatgggg gaaaaaagta
9360caacataatt cttcaggaca tacatagaga tcactgcaat ctctgttaag cagaattact
9420ttcctatacc actagctgaa gtttagtcag tgccattttc ttttgtttct ctccttcctt
9480ttgtgaaaac atatatactg tggaaatcta cattctcctt gccaagtctg aggacttaag
9540acaagatggt agtgcaaata atattttttt gctggatgtc tacaccacag gtatcaactg
9600attttttttg tttcattttg tttttaatca cgtcttttgc ttctatttca gccactaaga
9660aagtctgaaa atcttgcctg ctttttgtga tgatagatgt gcttcccagt aaatgttatc
9720tctacctatg aaatgcatgt cagtctgcag aaagagaaag gagattggga ataggttttc
9780tcagatgcac ttctctgtca tctggtgtca atcaaacact aataatttgt gtatagatat
9840cttatatata tatatatatt tggaatttgc aggttggcat agttcagata gtcctgtcac
9900attgtaatat cctggtgaga taacaaggaa aagagagacc gtttcggctc ttactaaggc
9960agggaactgc ttaccagaca gggaggttct ggagatgaca tccagcatga aaagcacact
10020tccaaatact taaaggtatc aagtctaact tgtcagacag gctccagaat aacttctgtc
10080ctaatgctac agaaaagggg gaaggtatcc accatggcca aaattgtcag ccattttgtc
10140tcagcaaaca gcagatctgg tcagtaagga caagattctt ccaaagcaac catgccatat
10200ataattaagc atgtgtaatt aattaataaa aaatataatt tagtgtattt cctcctttgg
10260atgttatgaa gaaatgcttt tattaacaat tcaccataat ctgtcctaag agtagtgaat
10320aacaacaggc tgcttctcac cctgtggttg ggtgtaccag tgagccagag ctaaacgcca
10380cgtttcctct tttgtatccc atagcagaga gggtctccat ttcatttctg tagctcagaa
10440agttgtagtg gatttacact acaagttgtg gtagtggagg tctgccggag tggcctctgt
10500gaacagagcc cagcagctgt cccgtgtcct caaaagggag ctgccactgg ccagagctga
10560gccagtgatc gatgctagat gtacctcagg aggagcaata tgtaagaaca actgctgtac
10620aatggtagtt gggagaggtg agtgagaaaa tgtgagagaa acagccctga tgacactgag
10680gtcagtgcgg aggagggcag gaggtgttcc aggtgtagaa cagaagttcc ctgcagccca
10740agagaggccc atggtggagc actctgaccc tctgcagccc atggtatatc atataaacct
10800cagttctgtg acattatttt aactccatat cccttttctg ttcagggtca ctttgagttc
10860acagccattt ctttatattt ctccaatatc agccttccat tgctacatat gagacttgga
10920cagtacatct gattcagtca aatctgcctt cagaacgtcc ctgaagccct tcttagacag
10980tctcaattct ccttcccttc atctctttta tcatacatgg accacggacc tgtccagacc
11040tgagtcatat gtccatcttt acgtccatct ctatgtcttg tactttaaga caaataaaat
11100atcaaggaaa ttgatgcagt tatgtcagtt atcactgtca tagtatcgtg ctgcaaatat
11160aagatgagaa tgatcccaaa ggctttttaa agctgctcta tttgacttcc acatagtgtc
11220ctgattccag acctacagaa cagttttgta tgcatttgac ttgcagagct ttgttttgtg
11280agtcttataa aagccatttt tcctctccaa gaagtagccg gtggtttaaa acaatgtaga
11340ttaagtgtgg agcatgagaa tttctgcttt tctgtcagat gagaaggata tactacactc
11400tttcccaatg gaagaccagc tgcaagcaac aaaaattgtc catgaacaaa tgagatcttg
11460atcagaacag gctgtcatca tagtgttgtc agcatacctg catagttggt ttgacttggg
11520ggtctagaga gagtaagcaa caatcttctt gcagttggaa ggttacctgg gataggtggc
11580aatggattgc cctgcccagc acagctgtgc aaagcagtac aaatagtttt gtcacacatt
11640gtttgacaat gcttgtccca agaaaaggtc agctaaggct ctgctgccct ttcctatgcc
11700aggcatttca ttgtgggtct gtccctaaac caacagtctc atgaataaag actcggagac
11760ctgaaagtta taaaagcact ttttatccaa aaggatatga agtccaggtg agctcacagg
11820tcaaagcctc ttatccaatc actaaaacct actcagaact tgactcga
118682010021DNAArtificial SequencepSIN-3.9-OM-CTLA4-Fc Vector
20ctagactagg atcccccgtg ctgcagaacc gagcggctat tgacttcttg ctcctagctc
60acggccatgg ctgtgaggac attgcgggaa tgtgttgttt caatctgagt gatcacagtg
120agtctataca gaagaagttc cagctaatga aggaacatgt caataagatc ggcgtgaaca
180acgacccaat cggaagttgg ctgcgaggat tattcggagg aataggagaa tgggccgtac
240acttgctgaa aggactgctt ttggggcttg tagttatctt gttgctagta gtatgcttgc
300cttgcctttt gcaatgtgta tctagtagta ttcgaaagat gattgataat tcactcggct
360atcgcgagga atataaaaaa attacaggag gcttataagc agcccgaaag aagagcgtag
420gcgagttctt gtattccgtg tgatagctgg ttggattggt aattgatcgg ctggcacgcg
480gaatatagga ggtcgctgaa tagtaaactt gtagacttgg ctacagcata gagtatcttc
540tgtagctctg atgactgcta ggaaataatg ctacggataa tgtggggagg gcaaggcttg
600cgaatcgggt tgtaacgggc aaggcttgac tgaggggaca atagcatgtt taggcgaaaa
660gcggggcttc ggttgtacgc ggttaggagt cccctcagga tatagtagtt tcgcttttgc
720atagggaggg ggacggattg gacgaaccac tgaattccgc attgcagaga tattgtattt
780aagtgcctag ctcgatacaa taaacgccat ttgaccattc accacattgg tgtgcacctg
840ggttgatggc cggaccgttg attccctgrc gactacgagc acatgcatga agcagaaggc
900ttcatttggt gaccccgacg tgatcgttag ggaatacgcg ctcactggcc gtcgttttac
960aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa tcgccttgca gcacatcccc
1020ctttcgccag ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc
1080gcagcctgaa tggcgaatgg aaattgtaag cgttaatatt ttgttaaaat tcgcgttaaa
1140tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaaa tcccttataa
1200atcaaaagaa tagaccgaga tagggttgag tgttgttcca gtttggaaca agagtccact
1260attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc
1320actacgtgaa ccatcaccct aatcaagttt tttggggtcg aggtgccgta aagcactaaa
1380tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg cgaacgtggc
1440gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt
1500cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg ccgctacagg gcgcgtcagg
1560tggcactttt cggggaaatg tgcgcggaac ccctatttgt ttatttttct aaatacattc
1620aaatatgtat ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag
1680gaagagtatg agtattcaac atttccgtgt cgcccttatt cccttttttg cggcattttg
1740ccttcctgtt tttgctcacc cagaaacgct ggtgaaagta aaagatgctg aagatcagtt
1800gggtgcacga gtgggttaca tcgaactgga tctcaacagc ggtaagatcc ttgagagttt
1860tcgccccgaa gaacgttttc caatgatgag cacttttaaa gttctgctat gtggcgcggt
1920attatcccgt attgacgccg ggcaagagca actcggtcgc cgcatacact attctcagaa
1980tgacttggtt gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag
2040agaattatgc agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac
2100aacgatcgga ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac
2160tcgccttgat cgttgggaac cggagctgaa tgaagccata ccaaacgacg agcgtgacac
2220cacgatgcct gtagcaatgg caacaacgtt gcgcaaacta ttaactggcg aactacttac
2280tctagcttcc cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact
2340tctgcgctcg gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg
2400tgggtctcgc ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt
2460tatctacacg acggggagtc aggcaactat ggatgaacga aatagacaga tcgctgagat
2520aggtgcctca ctgattaagc attggtaact gtcagaccaa gtttactcat atatacttta
2580gattgattta aaacttcatt tttaatttaa aaggatctag gtgaagatcc tttttgataa
2640tctcatgacc aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga
2700aaagatcaaa ggatcttctt gagatccttt ttttctgcgc gtaatctgct gcttgcaaac
2760aaaaaaacca ccgctaccag cggtggtttg tttgccggat caagagctac caactctttt
2820tccgaaggta actggcttca gcagagcgca gataccaaat actgtccttc tagtgtagcc
2880gtagttaggc caccacttca agaactctgt agcaccgcct acatacctcg ctctgctaat
2940cctgttacca gtggctgctg ccagtggcga taagtcgtgt cttaccgggt tggactcaag
3000acgatagtta ccggataagg cgcagcggtc gggctgaacg gggggttcgt gcacacagcc
3060cagcttggag cgaacgacct acaccgaact gagataccta cagcgtgagc tatgagaaag
3120cgccacgctt cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggaac
3180aggagagcgc acgagggagc ttccaggggg aaacgcctgg tatctttata gtcctgtcgg
3240gtttcgccac ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct
3300atggaaaaac gccagcaacg cggccttttt acggttcctg gccttttgct ggccttttgc
3360tcacatgttc tttcctgcgt tatcccctga ttctgtggat aaccgtatta ccgcctttga
3420gtgagctgat accgctcgcc gcagccgaac gaccgagcgc agcgagtcag tgagcgagga
3480agcggaagag cgcccaatac gcaaaccgcc tctccccgcg cgttggccga ttcattaatg
3540cagctggcac gacaggtttc ccgactggaa agcgggcagt gagcgcaacg caattaatgt
3600gagttagctc actcattagg caccccaggc tttacacttt atgcttccgg ctcgtatgtt
3660gtgtggaatt gtgagcggat aacaatttca cacaggaaac agctatgacc atgattacgc
3720caagcgcgca ttggtaattg atcggctggc acgcggaata taggaggtcg ctgaatagta
3780aacttgtaga cttggctaca gcatagagta tcttctgtag ctctgatgac tgctaggaaa
3840taatgctacg gataatgtgg ggagggcaag gcttgcgaat cgggttgtaa cgggcaaggc
3900ttgactgagg ggacaatagc atgtttaggc gaaaagcggg gcttcggttg tacgcggtta
3960ggagtcccct caggatatag tagtttcgct tttgcatagg gagggggaaa tgtagtctta
4020tgcaatactc ttgtagtctt gcaacatgct tatgtaacga tgagttagca acatgcctta
4080taaggagaga aaaagcaccg tgcatgccga ttggtgggag taaggtggta tgatcgtggt
4140atgatcgtgc cttgttagga aggcaacaga cgggtctaac acggattgga cgaaccactg
4200aattccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgccattt
4260gaccattcac cacattggtg tgcacctggg ttgatggccg gaccgttgat tccctgrcga
4320ctacgagcac atgcatgaag cagaaggctt catttggtga ccccgacgtg atcgttaggg
4380aatagtggtc ggccacaggc ggcgtggcga tcctgtcctc atccgtctcg cttattcggg
4440gagcggacga tgaccctagt agagggggct gcggcttagg agggcagaag ctgagtggcg
4500tcggagggag ccctactgca gggggccaac ataccctacc gagaactcag agagtcgttg
4560gaagacggga aggaagcccg acgactgagc ggtccacccc aggcgtgatt ccggttgctc
4620tgcgtgattc cggtcgcccg gtggatcaag catggaagcc gtcataaagg tgatttcgtc
4680cgcgtgtaag acctattgcg ggaaaacctc tccttctaag aaggaaatag gggctatgtt
4740gtccctgtta caaaaggaag ggttgcttac gtccccctca gacttatatt ccccggggtc
4800ctgggatccc attaccgcgg cgctctctca gcgggctatg gtacttggaa aatcgggaga
4860gttaaaaacc tggggattgg ttttgggggc attgaaggcg gctcgaggtc gacggtatcg
4920ataagcttgc agtccaaggc tttgtctgtg tacccagtga aatccttcct ctgttacata
4980aagcccagat aggactcaga aatgtagtca ttccagcccc cctcttcctc agatctggag
5040cagcacttgt ttgcagccag tcctccccaa aatgcacaga cctcgccgag tggagggaga
5100tgtaaacagc gaaggttaat tacctccttg tcaaaaacac tttgtggtcc atagatgttt
5160ctgtcaatct tacaaaacag aaccgagagg cagcgagcac tgaagagcgt gttcccatgc
5220tgagttaatg agacttggca gctcgctgtg cagagatgat ccctgtgctt catgggaggc
5280tgtaacctgt ctccccatcg ccttcacacc gcagtgctgt cctggacacc tcaccctcca
5340taagctgtag gatgcagctg cccagggatc aagagacttt tcctaaggct cttaggactc
5400atctttgccg ctcagtagcg tgcagcaatt actcatccca actatactga atgggtttct
5460gccagctctg cttgtttgtc aataagcatt tcttcatttt gcctctaagt ttctctcagc
5520agcaccgctc tgggtgacct gagtggccac ctggaacccg aggggcacag ccaccacctc
5580cctgttgctg ctgctccagg gactcatgtg ctgctggatg gggggaagca tgaagttcct
5640cacccagaca cctgggttgc aatggctgca gcgtgctctt cttggtatgc agattgtttc
5700cagccattac ttgtagaaat gtgctgtgga agccctttgt atctctttct gtggcccttc
5760agcaaaagct gtgggaaagc tctgaggctg ctttcttggg tcgtggagga attgtatgtt
5820ccttctttaa caaaaattat ccttaggaga gagcactgtg caagcattgt gcacataaaa
5880caattcaggt tgaaagggct ctctggaggt ttccagcctg actactgctc gaagcaaggc
5940caggttcaaa gatggctcag gatgctgtgt gccttcctga ttatctgtgc caccaatgga
6000ggagattcac agccactctg cttcccgtgc cactcatgga gaggaatatt cccttatatt
6060cagatagaat gttatccttt agctcagcct tccctataac cccatgaggg agctgcagat
6120ccccatactc tccccttctc tggggtgaag gccgtgtccc ccagcccccc ttcccaccct
6180gtgccctaag cagcccgctg gcctctgctg gatgtgtgcc tatatgtcaa tgcctgtcct
6240tgcagtccag cctgggacat ttaattcatc accagggtaa tgtggaactg tgtcatcttc
6300ccctgcaggg tacaaagttc tgcacggggt cctttcggtt caggaaaacc ttcactggtg
6360ctacctgaat caagctctat ttaataagtt cataagcaca tggatgtgtt ttcctagaga
6420tacgttttaa tggtatcagt gatttttatt tgctttgttg cttacttcaa acagtgcctt
6480tgggcaggag gtgagggacg ggtctgccgt tggctctgca gtgatttctc caggcgtgtg
6540gctcaggtca gatagtggtc actctgtggc cagaagaagg acaaagatgg aaattgcaga
6600ttgagtcacg ttaagcaggc atcttggagt gatttgaggc agtttcatga aagagctacg
6660accacttatt gttgttttcc ccttttacaa cagaagtttt catcaaaata acgtggcaaa
6720gcccaggaat gtttgggaaa agtgtagtta aatgttttgt aattcatttg tcggagtgct
6780accagctaag aaaaaagtcc tacctttggt atggtagtcc tgcagagaat acaacatcaa
6840tattagtttg gaaaaaaaca ccaccaccac cagaaactgt aatggaaaat gtaaaccaag
6900aaattccttg ggtaagagag aaaggatgtc gtatactggc caagtcctgc ccagctgtca
6960gcctgctgac cctctgcagt tcaggaccat gaaacgtggc actgtaagac gtgtcccctg
7020cctttgcttg cccacagatc tctgcccttg tgctgactcc tgcacacaag agcatttccc
7080tgtagccaaa cagcgattag ccataagctg cacctgactt tgaggattaa gagtttgcaa
7140ttaagtggat tgcagcagga gatcagtggc agggttgcag atgaaatcct tttctagggg
7200tagctaaggg ctgagcaacc tgtcctacag cacaagccaa accagccaag ggttttcctg
7260tgctgttcac agaggcaggg ccagctggag ctggaggagg ttgtgctggg acccttctcc
7320ctgtgctgag aatggagtga tttctgggtg ctgttcctgt ggcttgcact gagcagctca
7380agggagatcg gtgctcctca tgcagtgcca aaactcgtgt ttgatgcaga aagatggatg
7440tgcacctccc tcctgctaat gcagccgtga gcttatgaag gcaatgagcc ctcagtgcag
7500caggagctgt agtgcactcc tgtaggtgct agggaaaatc tctggttccc agggatgcat
7560tcataagggc aatatatctt gaggctgcgc caaatctttc tgaaatattc atgcgtgttc
7620ccttaattta tagaaacaaa cacagcagaa taattattcc aatgcctccc ctcgaaggaa
7680acccatattt ccatgtagaa atgtaaccta tatacacaca gccatgctgc atccttcaga
7740acgtgccagt gctcatctcc catggcaaaa tactacaggt attctcacta tgttggacct
7800gtgaaaggaa ccatggtaag aaacttcggt taaaggtatg gctgcaaaac tactcatacc
7860aaaacagcag agctccagac ctcctcttag gaaagagcca cttggagagg gatggtgtga
7920aggctggagg tgagagacag agcctgtccc agttttcctg tctctatttt ctgaaacgtt
7980tgcaggagga aaggacaact gtactttcag gcatagctgg tgccctcacg taaataagtt
8040ccccgaactt ctgtgtcatt tgttcttaag atgctttggc agaacacttt gagtcaattc
8100gcttaactgt gactaggtct gtaaataagt gctccctgct gataaggttc aagtgacatt
8160tttagtggta tttgacagca tttaccttgc tttcaagtct tctaccaagc tcttctatac
8220ttaagcagtg aaaccgccaa gaaacccttc cttttatcaa gctagtgcta aataccatta
8280acttcatagg ttagatacgg tgctgccagc ttcacctggc agtggttggt cagttctgct
8340ggtgacaaag cctccctggc ctgtgctttt acctagaggt gaatatccaa gaatgcagaa
8400ctgcatggaa agcagagctg caggcacgat ggtgctgagc cttagctgct tcctgctggg
8460agatgtggat gcagagacga atgaaggacc tgtcccttac tcccctcagc attctgtgct
8520atttagggtt ctaccagagt ccttaagagg tttttttttt ttttggtcca aaagtctgtt
8580tgtttggttt tgaccactga gagcatgtga cacttgtctc aagctattaa ccaagtgtcc
8640agccaaaatc aattgcctgg gagacgcaga ccattacctg gaggtcagga cctcaataaa
8700tattaccagc ctcattgtgc cgctgacaga ttcagctggc tgctccgtgt tccagtccaa
8760cagttcggac gccacgtttg tatatatttg caggcagcct cggggggacc atctcaggag
8820cagagcaccg gcagccgcct gcagagccgg gcagtacctc aacatgggtg tactgctcac
8880acagaggacg ctgctcagtc tggtccttgc actcctgttt ccaagcatgg cgagcatggc
8940aatgcacgtg gcccagcctg ctgtggtact ggccagcagc cgaggcatcg cyagctttgt
9000gtgtgagtat gcatctccag gcaaagccac tgaggtccgg gtgacagtgc ttcggcaggc
9060tgacagccag gtgactgaag tctgtgcggc aacctacatg atggggaatg agttgacctt
9120cctagatgat tccatctgca cgggcacctc cagtggaaat caagtgaacc tcactatcca
9180aggactgagg gccatggaca cgggactcta catctgcaag gtggagctca tgtacccacc
9240gccatactac ctgggcatag gcaacggaac ccagatttat gtaattgatc cagaaccgtg
9300cccagattct gatcaggagc ccaaatcttc tgacaaaact cacacatccc caccgtcccc
9360agcacctgaa ctcctggggg gatcgtcagt cttcctcttc cccccaaaac ccaaggacac
9420cctcatgatc tcccggaccc ctgaggtcac atgcgtggtg gtggacgtga gccacgaaga
9480ccctgaggtc aagttcaact ggtacgtgga cggcgtggag gtgcataatg ccaagacaaa
9540gccgcgggag gagcagtaca acagcacgta ccgggtggtc agcgtcctca ccgtcctgca
9600ccaggactgg ctgaatggca aggagtacaa gtgcaaggtc tccaacaaag ccctcccagc
9660ccccatcgag aaaaccatct ccaaagccaa agggcagccc cgagaaccac aggtgtacac
9720cctgccccca tcccgggatg agctgaccaa gaaccaggtc agcctgacct gcctggtcaa
9780aggcttctat cccagcgaca tcgccgtgga gtgggagagc aatgggcagc cggagaacaa
9840ctacaagacc acgcctcccg tgctggactc cgacggctcc ttcttcctct acagcaagct
9900caccgtggac aagagcaggt ggcagcaggg gaacgtcttc tcatgctccg tgatgcatga
9960ggctctgcac aaccactaca cgcagaagag cctctccctg tctccgggta aatgaggaat
10020t
10021217350DNAArtificial SequencepSIN-1.8-OM-IFNa-2B Vector 21tcgagatcaa
ttgctagact aggatccccc gtgctgcaga accgagcggc tattgacttc 60ttgctcctag
ctcacggcca tggctgtgag gacattgcgg gaatgtgttg tttcaatctg 120agtgatcaca
gtgagtctat acagaagaag ttccagctaa tgaaggaaca tgtcaataag 180atcggcgtga
acaacgaccc aatcggaagt tggctgcgag gattattcgg aggaatagga 240gaatgggccg
tacacttgct gaaaggactg cttttggggc ttgtagttat cttgttgcta 300gtagtatgct
tgccttgcct tttgcaatgt gtatctagta gtattcgaaa gatgattgat 360aattcactcg
gctatcgcga ggaatataaa aaaattacag gaggcttata agcagcccga 420aagaagagcg
taggcgagtt cttgtattcc gtgtgatagc tggttggatt ggtaattgat 480cggctggcac
gcggaatata ggaggtcgct gaatagtaaa cttgtagact tggctacagc 540atagagtatc
ttctgtagct ctgatgactg ctaggaaata atgctacgga taatgtgggg 600agggcaaggc
ttgcgaatcg ggttgtaacg ggcaaggctt gactgagggg acaatagcat 660gtttaggcga
aaagcggggc ttcggttgta cgcggttagg agtcccctca ggatatagta 720gtttcgcttt
tgcataggga gggggacgga ttggacgaac cactgaattc cgcattgcag 780agatattgta
tttaagtgcc tagctcgata caataaacgc catttgacca ttcaccacat 840tggtgtgcac
ctgggttgat ggccggaccg ttgattccct grcgactacg agcacatgca 900tgaagcagaa
ggcttcattt ggtgaccccg acgtgatcgt tagggaatac gcgctcactg 960gccgtcgttt
tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt 1020gcagcacatc
cccctttcgc cagctggcgt aatagcgaag aggcccgcac cgatcgccct 1080tcccaacagt
tgcgcagcct gaatggcgaa tggaaattgt aagcgttaat attttgttaa 1140aattcgcgtt
aaatttttgt taaatcagct cattttttaa ccaataggcc gaaatcggca 1200aaatccctta
taaatcaaaa gaatagaccg agatagggtt gagtgttgtt ccagtttgga 1260acaagagtcc
actattaaag aacgtggact ccaacgtcaa agggcgaaaa accgtctatc 1320agggcgatgg
cccactacgt gaaccatcac cctaatcaag ttttttgggg tcgaggtgcc 1380gtaaagcact
aaatcggaac cctaaaggga gcccccgatt tagagcttga cggggaaagc 1440cggcgaacgt
ggcgagaaag gaagggaaga aagcgaaagg agcgggcgct agggcgctgg 1500caagtgtagc
ggtcacgctg cgcgtaacca ccacacccgc cgcgcttaat gcgccgctac 1560agggcgcgtc
aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 1620tctaaataca
ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 1680aatattgaaa
aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 1740ttgcggcatt
ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 1800ctgaagatca
gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 1860tccttgagag
ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 1920tatgtggcgc
ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 1980actattctca
gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 2040gcatgacagt
aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 2100acttacttct
gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 2160gggatcatgt
aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 2220acgagcgtga
caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 2280gcgaactact
tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 2340ttgcaggacc
acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 2400gagccggtga
gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 2460cccgtatcgt
agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 2520agatcgctga
gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 2580catatatact
ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 2640tcctttttga
taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 2700cagaccccgt
agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 2760gctgcttgca
aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 2820taccaactct
ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc 2880ttctagtgta
gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 2940tcgctctgct
aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 3000ggttggactc
aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 3060cgtgcacaca
gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 3120agctatgaga
aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 3180gcagggtcgg
aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 3240atagtcctgt
cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 3300gggggcggag
cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 3360gctggccttt
tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 3420ttaccgcctt
tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 3480cagtgagcga
ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 3540cgattcatta
atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 3600acgcaattaa
tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 3660cggctcgtat
gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 3720accatgatta
cgccaagcgc gcattggtaa ttgatcggct ggcacgcgga atataggagg 3780tcgctgaata
gtaaacttgt agacttggct acagcataga gtatcttctg tagctctgat 3840gactgctagg
aaataatgct acggataatg tggggagggc aaggcttgcg aatcgggttg 3900taacgggcaa
ggcttgactg aggggacaat agcatgttta ggcgaaaagc ggggcttcgg 3960ttgtacgcgg
ttaggagtcc cctcaggata tagtagtttc gcttttgcat agggaggggg 4020aaatgtagtc
ttatgcaata ctcttgtagt cttgcaacat gcttatgtaa cgatgagtta 4080gcaacatgcc
ttataaggag agaaaaagca ccgtgcatgc cgattggtgg gagtaaggtg 4140gtatgatcgt
ggtatgatcg tgccttgtta ggaaggcaac agacgggtct aacacggatt 4200ggacgaacca
ctgaattccg cattgcagag atattgtatt taagtgccta gctcgataca 4260ataaacgcca
tttgaccatt caccacattg gtgtgcacct gggttgatgg ccggaccgtt 4320gattccctgr
cgactacgag cacatgcatg aagcagaagg cttcatttgg tgaccccgac 4380gtgatcgtta
gggaatagtg gtcggccaca ggcggcgtgg cgatcctgtc ctcatccgtc 4440tcgcttattc
ggggagcgga cgatgaccct agtagagggg gctgcggctt aggagggcag 4500aagctgagtg
gcgtcggagg gagccctact gcagggggcc aacataccct accgagaact 4560cagagagtcg
ttggaagacg ggaaggaagc ccgacgactg agcggtccac cccaggcgtg 4620attccggttg
ctctgcgtga ttccggtcgc ccggtggatc aagcatggaa gccgtcataa 4680aggtgatttc
gtccgcgtgt aagacctatt gcgggaaaac ctctccttct aagaaggaaa 4740taggggctat
gttgtccctg ttacaaaagg aagggttgct tacgtccccc tcagacttat 4800attccccggg
gtcctgggat cccattaccg cggcgctctc tcagcgggct atggtacttg 4860gaaaatcggg
agagttaaaa acctggggat tggttttggg ggcattgaag gcggctcgac 4920ggatccgtta
accctagaac tagtggatct ctgcccttgt gctgactcct gcacacaaga 4980gcatttccct
gtagccaaac agcgattagc cataagctgc acctgacttt gaggattaag 5040agtttgcaat
taagtggatt gcagcaggag atcagtggca gggttgcaga tgaaatcctt 5100ttctaggggt
agctaagggc tgagcaacct gtcctacagc acaagccaaa ccagccaagg 5160gttttcctgt
gctgttcaca gaggcagggc cagctggagc tggaggaggt tgtgctggga 5220cccttctccc
tgtgctgaga atggagtgat ttctgggtgc tgttcctgtg gcttgcactg 5280agcagctcaa
gggagatcgg tgctcctcat gcagtgccaa aactcgtgtt tgatgcagaa 5340agatggatgt
gcacctccct cctgctaatg cagccgtgag cttatgaagg caatgagccc 5400tcagtgcagc
aggagctgta gtgcactcct gtaggtgcta gggaaaatct ctggttccca 5460gggatgcatt
cataagggca atatatcttg aggctgcgcc aaatctttct gaaatattca 5520tgcgtgttcc
cttaatttat agaaacaaac acagcagaat aattattcca atgcctcccc 5580tcgaaggaaa
cccatatttc catgtagaaa tgtaacctat atacacacag ccatgctgca 5640tccttcagaa
cgtgccagtg ctcatctccc atggcaaaat actacaggta ttctcactat 5700gttggacctg
tgaaaggaac catggtaaga aacttcggtt aaaggtatgg ctgcaaaact 5760actcatacca
aaacagcaga gctccagacc tcctcttagg aaagagccac ttggagaggg 5820atggtgtgaa
ggctggaggt gagagacaga gcctgtccca gttttcctgt ctctattttc 5880tgaaacgttt
gcaggaggaa aggacaactg tactttcagg catagctggt gccctcacgt 5940aaataagttc
cccgaacttc tgtgtcattt gttcttaaga tgctttggca gaacactttg 6000agtcaattcg
cttaactgtg actaggtctg taaataagtg ctccctgctg ataaggttca 6060agtgacattt
ttagtggtat ttgacagcat ttaccttgct ttcaagtctt ctaccaagct 6120cttctatact
taagcagtga aaccgccaag aaacccttcc ttttatcaag ctagtgctaa 6180ataccattaa
cttcataggt tagatacggt gctgccagct tcacctggca gtggttggtc 6240agttctgctg
gtgacaaagc ctccctggcc tgtgctttta cctagaggtg aatatccaag 6300aatgcagaac
tgcatggaaa gcagagctgc aggcacgatg gtgctgagcc ttagctgctt 6360cctgctggga
gatgtggatg cagagacgaa tgaaggacct gtcccttact cccctcagca 6420ttctgtgcta
tttagggttc taccagagtc cttaagaggt tttttttttt tttggtccaa 6480aagtctgttt
gtttggtttt gaccactgag agcatgtgac acttgtctca agctattaac 6540caagtgtcca
gccaaaatca attgcctggg agacgcagac cattacctgg aggtcaggac 6600ctcaataaat
attaccagcc tcattgtgcc gctgacagat tcagctggct gctccgtgtt 6660ccagtccaac
agttcggacg ccacgtttgt atatatttgc aggcagcctc ggggggacca 6720tctcaggagc
agagcaccgg cagccgcctg cagagccggg cagtacctca ccatggcttt 6780gacctttgcc
ttactggtgg ctctcctggt gctgagctgc aagagcagct gctctgtggg 6840ctgcgatctg
cctcagaccc acagcctggg cagcaggagg accctgatgc tgctggctca 6900gatgaggaga
atcagcctgt ttagctgcct gaaggatagg cacgattttg gctttcctca 6960agaggagttt
ggcaaccagt ttcagaaggc tgagaccatc cctgtgctgc acgagatgat 7020ccagcagatc
tttaacctgt ttagcaccaa ggatagcagc gctgcttggg atgagaccct 7080gctggataag
ttttacaccg agctgtacca gcagctgaac gatctggagg cttgcgtgat 7140ccagggcgtg
ggcgtgaccg agacccctct gatgaaggag gatagcatcc tggctgtgag 7200gaagtacttt
cagaggatca ccctgtacct gaaggagaag aagtacagcc cctgcgcttg 7260ggaagtcgtg
agggctgaga tcatgaggag ctttagcctg agcaccaacc tgcaagagag 7320cttgaggtct
aaggagtaaa aagtctaggc
73502216051DNAArtificial Sequence16 kbp Ovalbumin Sequence 22ctgcagccca
ggcagcacac tagagcagag aaatctagtt agcagcaacc actggcagac 60agaaatgatt
atatagatta catactgacc ctagcctctt acactgccta ctgcatcact 120gaaaggactg
ggaagaagag agtgcaataa cgaagctgaa gctaggagga aggcaaggag 180aactgaagct
gactagggaa aagggggatt aaaggtttaa gtgtctattc catagtttgc 240tggtttgttt
tttgtcaatt cctgaatcag taatttttat gttaattagc aaaaaattac 300aaacactccc
caagtcagga ctgttaccta caacagaagc tcagatcagc tgagccttag 360tcttttggtc
cctccctagg gaatgctgta tgtgtctctc tctccaggcc tgctcaaaat 420tgacctcaga
cccaaacttt tgctgaatct ccagtaccac ctcttttgct cctaactaga 480taacaaagcc
ctgagcgctt tgcttttagc aaagctttaa gtgccattac caactgcacc 540tggagccttt
acctacccct atggacccag gctctatatt taagctctgc cctgaacctt 600cacttctttc
ctgtcctaag ttagatgtac tagtatggtg tgtactatgt ctccagttca 660aacacagctg
tgcccatacc tggccaagga ctcctagtat gacctgggct gtgccttgct 720gctaaggacc
tgctgggtga ttgctggacc tgatcctaat cctgaattaa gaaatgattt 780cttggcttga
ctggatgtgc cctgtggtat gatactgcct tatgatttgg actcttgttt 840gcagctgtgc
aaatccctaa ggagcccagt ctctggccac ctggaatctt gtcactacca 900aacttcctga
gggactggtc ttgctctggg ttctgatctc tggacagtac tcacccttta 960ctcagcccag
gctcccagtt aagccccttt ccaccctgcc aggctctccg ctccatccct 1020agcaggggct
ctcatgacag tgtgaccccc ccttactcag gtcagggcca cttgtgccac 1080gttcctttcc
tgtcttctgt ccctgccttg gctctaaagc agtgtgctac catccacaac 1140cactgcatct
ctctaaagta agcctctcct gagcccaagt ctctgtaacg aggaaggatg 1200cactttgctc
agaaggatgc gaggctgctt ctgagctctg agggcactga cctcccatga 1260ggtacacccc
atacccagga ccacaattca gcctgctgga accatcaact cctgctggag 1320taaggccata
gcaagaccag catccacctc cctgcagccc tgccctgccc agatattggg 1380cctgctgatc
tcaggatgca gacttgcttc tcagcttgac ctaagcattg ccctgtcttt 1440atggacccac
ctggttagca agttcagtgc agaaggaggc tgttggcatc tagctaattt 1500tccacccaca
ttactgtctg ctgactcatt ctacgtctct cccatcttgt tacaataata 1560atttgggaga
tcatattgaa ggtcttaata aagtcaaggc atgtgatatt ctctgctttg 1620cctttgtttc
tagaataagc cacttcatca tagaagatga aaatgctgat cagcagagat 1680ctgtgcttga
taaatccatg ctggcttttc ctatcacctt atattccttc atatgccttg 1740agacacccaa
ggaggccttg gatcagagct gtctgtagca gtcctaactg gtatacaatt 1800agttgtacaa
caggtagtga tccgcataat agttggcgtg agaaagtggg cctgtgctgt 1860gtcaagcata
gagtttgggt tccagtcctg ttctgcatgg cacatatgcc tgagcagctg 1920ggtaatctct
gcattccaat tggaaggcag gggcctgtag gcagttccca cttggcatgg 1980gtgattgtac
cacctgtgtc ctcatctgtg aagcatcatg ttttcattca aatatccttt 2040tgtttgacag
tagaaatgaa cagaattgtt tttttttcct aagcaaattc tgcaagagct 2100ctgaagaaca
aggtgtcagt gaacttctag ctccatagat aggacttgca tcacatgtca 2160tgccttgatt
ggaggtctat ccgatactga acaacttgtg gttccctgag ggaatgtaag 2220attactgata
ctactctctc tttatgttag ctacaataaa tggtaggtta agcaatagat 2280acagagtttg
agtgcctttc ttacaagcat catagtgaac aaatccactg gtgatctacc 2340ttttcaataa
ctacagagaa ttgtaatctc ttggattctc ctccttcccc gttctgaaaa 2400tgtgttcttt
ttttccaaat cagaaacctt cctcaaccac cctgactatt ctttggacat 2460tgttttgttc
ttgctcctaa ataggcttta taatttttgt aagtgaaagg ctttgcatgc 2520aggtgaggct
acaactcatt cagtaacaat gaggaagact gtcagatttt ggggaaaatt 2580ctcccaccca
accttttgct agccagtaag atgtaatcac tgaatgtcat gccacaaaga 2640ccataccaac
atcagaccac atatctacag gaagctttaa ggaatcattg actgtacagt 2700gaagggtaaa
tcaaattaaa atgaatgtga ggtctgatac gagatatcct catgggaatc 2760aagagcaaag
acaaatagtt tttcacagtc ttgtcatgat ctgtcacaga ccaaggcagc 2820acagcaggca
acaatgttgg tctcttcaga atggcacagc accgctgcag aaaaatgcca 2880ggtggactat
gaactcacat ccaaaggagc ttgacctgat acctgatttt cttcaaacag 2940gggaaacaac
acaatcccac aaaatagctc agagagaaac catcactgat ggctacagca 3000ccaaggtatg
caatggcaat ccattcgaca ttcatctgtg acctgagcaa aatgatttat 3060ctctccatga
atggttgctt ctttccctca tgaaaaggca atttccacac tcacaatatg 3120caacaaagac
aaacagagaa caattaatgt gctccttcct aatgtcaaaa ttgtagtggc 3180aaagaggaga
acaaaatctc aagttctgag taggttttag tgattggata agaggctttg 3240acctgtgagc
tcacctggac ttcatatcct tttggataaa aagtgctttt ataactttca 3300ggtctccgag
tctttattca tgagactgtt ggtttaggga cagacccaca atgaaatgcc 3360tggcatagga
aagggcagca gagccttagc tgaccttttc ttgggacaag cattgtcaaa 3420caatgtgtga
caaaactatt tgtactgctt tgcacagctg tgctgggcag ggcaatccat 3480tgccacctat
cccaggtaac cttccaactg caagaagatt gttgcttact ctctctagac 3540ccccaagtca
aaccaactat gcaggtatgc tgacaacgct atgatgacag cctgttctga 3600tcaagatctc
atttgttcat ggacaatttt tgttgcttgc agctggtctt ccattgggaa 3660agagtgtagt
atatccttct catctgacag aaaagcagaa attctcatgc tccacactta 3720atctacattg
ttttaaacca ccagctactt cttggagagg aaaaatggct tttataagac 3780tcacaaaaca
aagctctgca agtcaaatgc atacaaaact gttctgtagg tctggaatca 3840ggacactatg
tggaagtcaa atagagaagc tttaaaaaaa cctttgggat cattctcatc 3900ttatatttgc
agcacgatac tatgacagtg ataactgaca taactgcatc aatttccttg 3960atattttatt
tgtcttaaag tacaagacat agagatggac gtaaagatgg acatatgact 4020caggtctgga
caggtccgtg gtccatgtat gataaaagag atgaagggaa ggagaatgga 4080gactgtctaa
gaagggcttc agggacgttc tgaaggcaga tttgactgaa tcagatgtac 4140tgtccaagtc
tcatatgtag caatggaaga ctgatattgg agaaatataa agaaatggct 4200gtgaactcaa
agtgaccctg aacagaaaag ggatatggag ttaaaataat ggcacagaac 4260tgaggtttat
atgatatacc atgggctgca gagggtcaga gtgctccacc atgggcctct 4320cttgggctgc
agggaacttc tgttctacac ctggaacacc tcctgccctc ctccgcactg 4380acctcagtgt
catcagggct gtttctctca cattttctca ctcacctctc ccaactacca 4440ttgtacagca
gttgttctta catcttgctc ctcctgaggt gcatctagca tcgatcactg 4500gctcagctct
ggccagtggc agctcccttt tgaggacacg ggacagctgc tgggctctgt 4560tcacagaggc
cactccagca gacctccact accacaactt gtagtgtaaa tccactacaa 4620ctttctgagc
tacagaaatg aaatggagac cctctctgct atgggataca aaagaggaaa 4680cgtggcgttt
agtgctctgg ctcactggta cacccaacca cagggtgaga agcagcctgt 4740tgttattcac
tactcttagg acagattatg gtgaattgtt aataaaagca tttcttcata 4800acatccaaag
gaggaaatac actaaattat attttttatt tattaattac acatgcttaa 4860ttatatatgg
catggttgct ttgaaagaac cttgtcctta ctgaccagat ctgctgtttg 4920ctgagacaaa
atggctgaca attttggcca tggtggatac cttccccctt ttctgtagca 4980ttaggacaga
agttattctg gagcctgtct gacaagtcag acttgataac tttaagtatt 5040tggaagtgtg
cttttcatgc tggatgtcat ctccagaacc tccctgtctg gtaagcagtt 5100ccctgcctta
gtaagagccg aaacggtctc tcttttcctt gttatctcac caggatatta 5160caatgtgaca
ggactatctg aactacgcca acctgcaaat tccaaatata tatatatata 5220tgtaagatat
ctatacacaa attattagtg tttgattgac accagatgac agagaagtgc 5280atctgagaaa
acctattccc aatctccttt ctctttctgc agactgacat gcatttcata 5340ggtagagata
acatttactg ggaagcacat ctatcatcat aaaaagcagg caagattttc 5400agactttctt
agtggctgaa atagaagcaa aagacgtgat taaaaacaaa atgaaacaaa 5460aaaaatcagt
tgatacctgt ggtgtagaca tccagcaaaa aaatattatt tgcactacca 5520tcttgtctta
agtcctcaga cttggcaagg agaatgtaga tttctacagt atatatgttt 5580tcacaaaagg
aaggagagaa acaaaagaaa atggcactga ctaaacttca gctagtggta 5640taggaaagta
attctgctta acagagattg cagtgatctc tatgtatgtc ctgaagaatt 5700atgttgtact
tttttccccc atttttaaat caaacagtgc tttacagagg tcagaatggt 5760ttctttactg
tttgtcaatt ctattatttc aatacagaac aatagcttct ataactgaaa 5820tatatttgct
attgtatatt atgattgtcc ctcgaaccat gaacactcct ccagctgaat 5880ttcacaattc
ctctgtcatc tgccaggcca ttaagttatt catggaagat ctttgaggaa 5940cactgcaagt
tcatatcata aacacatttg aaattgagta ttgttttgca ttgtatggag 6000ctatgttttg
ctgtatcctc agaaaaaaag tttgttataa agcattcaca cccataaaaa 6060gatagattta
aatattccag ctataggaaa gaaagtgcgt ctgctcttca ctctagtctc 6120agttggctcc
ttcacatgca tgcttcttta tttctcctat tttgtcaaga aaataatagg 6180tcacgtcttg
ttctcactta tgtcctgcct agcatggctc agatgcacgt tgtagataca 6240agaaggatca
aatgaaacag acttctggtc tgttactaca accatagtaa taagcacact 6300aactaataat
tgctaattat gttttccatc tctaaggttc ccacattttt ctgttttctt 6360aaagatccca
ttatctggtt gtaactgaag ctcaatggaa catgagcaat atttcccagt 6420cttctctccc
atccaacagt cctgatggat tagcagaaca ggcagaaaac acattgttac 6480ccagaattaa
aaactaatat ttgctctcca ttcaatccaa aatggaccta ttgaaactaa 6540aatctaaccc
aatcccatta aatgatttct atggcgtcaa aggtcaaact tctgaaggga 6600acctgtgggt
gggtcacaat tcaggctata tattccccag ggctcagcca gtgtctgtac 6660atacagctag
aaagctgtat tgcctttagc agtcaagctc gaaaggtaag caactctctg 6720gaattacctt
ctctctatat tagctcttac ttgcacctaa actttaaaaa attaacaatt 6780attgtgctat
gtgttgtatc tttaagggtg aagtacctgc gtgatacccc ctataaaaac 6840ttctcacctg
tgtatgcatt ctgcactatt ttattatgtg taaaagcttt gtgtttgttt 6900tcaggaggct
tattctttgt gcttaaaata tgtttttaat ttcagaacat cttatcctgt 6960cgttcactat
ctgatatgct ttgcagtttg cttgattaac ttctagccct acagagtgca 7020cagagagcaa
aatcatggtg ttcagtgaat tctggggagt tattttaatg tgaaaattct 7080ctagaagttt
aattcctgca aagtgcagct gctgatcact acacaagata aaaatgtggg 7140gggtgcataa
acgtatattc ttacaataat agatacatgt gaacttatat acagaaaaga 7200aaatgagaaa
aatgtgtgtg tgtatactca cacacgtggt cagtaaaaac ttttgagggg 7260tttaatacag
aaaatccaat cctgaggccc cagcactcag tacgcatata aagggctggg 7320ctctgaagga
cttctgactt tcacagatta tataaatctc aggaaagcaa ctagattcat 7380gctggctcca
aaagctgtgc tttatataag cacactggct atacaatagt tgtacagttc 7440agctctttat
aatagaaaca gacagaacaa gtataaatct tctattggtc tatgtcatga 7500acaagaattc
attcagtggc tctgttttat agtaaacatt gctattttat catgtctgca 7560tttctcttct
gtctgaatgt caccactaaa atttaactcc acagaaagtt tatactacag 7620tacacatgca
tatctttgag caaagcaaac catacctgaa agtgcaatag agcagaatat 7680gaattacatg
cgtgtctttc tcctagacta catgacccca tataaattac attacttatc 7740tattctgcca
tcaccaaaac aaaggtaaaa atacttttga agatctactc atagcaagta 7800gtgtgcaaca
aacagatatt tctctacatt tatttttagg gaataaaaat aagaaataaa 7860atagtcagca
agcctctgct ttctcatata tctgtccaaa cctaaagttt actgaaattt 7920gctctttgaa
tttccagttt tgcaagccta tcagattgtg ttttaatcag aggtactgaa 7980aagtatcaat
gaattctagc tttcactgaa caaaaatatg tagaggcaac tggcttctgg 8040gacagtttgc
tacccaaaag acaactgaat gcaaatacat aaatagattt atgaatatgg 8100ttttgaacat
gcacatgaga ggtggatata gcaacagaca cattaccaca gaattacttt 8160aaaactactt
gttaacattt aattgcctaa aaactgctcg taatttactg ttgtagccta 8220ccatagagta
ccctgcatgg tactatgtac agcattccat ccttacattt tcactgttct 8280gctgtttgct
ctagacaact cagagttcac catgggctcc atcggtgcag caagcatgga 8340attttgtttt
gatgtattca aggagctcaa agtccaccat gccaatgaga acatcttcta 8400ctgccccatt
gccatcatgt cagctctagc catggtatac ctgggtgcaa aagacagcac 8460caggacacaa
ataaataagg tgagcctaca gttaaagatt aaaacctttg ccctgctcaa 8520tggagccaca
gcacttaatt gtatgataat gtcccttgga aactgcatag ctcagaggct 8580gaaaatctga
aaccagagtt atctaaaagt gtggccacct ccaactccca gagtgttacc 8640caaatgcact
agctagaaat cttgaaactg gattgcataa cttctttttg tcataaccat 8700tatttcagct
actattattt tcaattacag gttgttcgct ttgataaact tccaggattc 8760ggagacagta
ttgaagctca ggtacagaaa taatttcacc tccttctcta tgtccctttc 8820ctctggaagc
aaaatacagc agatgaagca atctcttagc tgttccaagc cctctctgat 8880gagcagctag
tgctctgcat ccagcagttg ggagaacact gttcataaga acagagaaaa 8940agaaggaagt
aacaggggat tcagaacaaa cagaagataa aactcaggac aaaaataccg 9000tgtgaatgag
gaaacttgtg gatatttgta cgcttaagca agacagctag atgattctgg 9060ataaatgggt
ctggttggaa aagaaggaaa gcctggctga tctgctggag ctagattatt 9120gcagcaggta
ggcaggagtt ccctagagaa aagtatgagg gaattacaga agaaaaacag 9180cacaaaattg
taaatattgg aaaaggacca catcagtgta gttactagca gtaagacaga 9240caggatgaaa
aatagttttg taaacagaag tatctaacta ctttactctg ttcatacact 9300acgtaaaact
tactaagtaa taaaactaga ataacaacat ctttctttct ctttgtattc 9360agtgtggcac
atctgtaaac gttcactctt cacttagaga catcctcaac caaatcacca 9420aaccaaatga
tgtttattcg ttcagccttg ccagtagact ttatgctgaa gagagatacc 9480caatcctgcc
agtaagttgc tctaaaatct gatctgagtg tattccatgc caaagctcta 9540ccattctgta
atgcaaaaac agtcagagtt ccacatgttt cactaagaaa atttcttttt 9600ctcttgtttt
tacaaatgaa agagaggaca aataacattt ctctatcacc gacctgaaac 9660tctacagtct
tcagagaatg aatggcttgc taaaagaatg tcaaatctta ctatacagct 9720atttcatatt
acactactaa atacactata aggcatagca tgtagtaata cagtgtaaaa 9780tagcttttta
cactactata ttattaatat ctgttaattc cagtcttgca tttcacattt 9840gcaaaacgtt
ttgaaattcg tatctgaaag ctgaatactc ttgctttaca ggaatacttg 9900cagtgtgtga
aggaactgta tagaggaggc ttggaaccta tcaactttca aacagctgca 9960gatcaagcca
gagagctcat caattcctgg gtagaaagtc agacaaatgg taaggtagaa 10020catgctttgt
acatagtgag agttggttca ccctaatact gagaacttgg atatagctca 10080gccagcgtgc
tttgcgttca agcttaccag agctgttgta tgcctgttaa gcagggcata 10140cagtcatgag
gctcttgaaa aatcttaaca gacaaagggc aatggaaaat cggagttaag 10200ggatggtagg
gataaaatgc atagaaagag gtaccacaat tttgattttt gccctaatgc 10260ctctctgcgt
ggttcctcaa tttttctact tcattcctca tctcctcaga gcattccttt 10320ccctcatgct
tgaaacacag atgaaagact gtgaattcta actgagatga aaacatccac 10380aaccacacaa
cctctggtgt ggagtcacat tctgtgaagg caaaaactag gccacgtaat 10440ctatgcgtgc
aagctacgcg taagctatgt gtgtgacagg acaatgtgag gaacatacta 10500tgtgcacaag
gactgcagaa taaacaggag caaagttttt gaagaaaaca gagtaaaatc 10560ctgttttcct
cttttgttac attctttaca tatatctcaa atttcctctt tggttagaag 10620caagtaatat
ttatgtttct tggtactgtt tgggttgaag accattctgg gataagagaa 10680attccagtgg
ttcttcccct aatcataaaa tgtcaggttt agtttttttg taacacagaa 10740atctcttcat
cttttatctt ttgttgtgat tcttgataga gagagaaaca agacttactg 10800acaatagcag
caagaaaatc aatcttggaa gaacaagatt gcaattgcaa aaacaaacca 10860atgtccttgc
ccctacatcc tcttccccat aaattctaca ttctctatct accttgtgct 10920tgccaacatg
atatacgtaa actctctttt cctattcatt cttaaaggaa ttatcagaaa 10980tgtccttcag
ccaagctccg tggattctca aactgcaatg gttctggtta atgccattgt 11040cttcaaagga
ctgtgggaga aagcatttaa ggatgaagac acacaagcaa tgcctttcag 11100agtgactgag
gtatatgggc ataccttaga gatgtaatct agaatttatg aagagagtag 11160acatgttgtt
atatgaacac tgcattagcg tatctgctca tttgtctgca tctctttcag 11220acactgtgtt
aaaagcaggg aattttcctt atgtctctct cgtcacaata ttcctgacat 11280tgcaaagctc
ctgagaaata acttcagatt ccacttttcc taggaaggct tctggatgag 11340aactaatcat
cttaactgta actagacatt tctgcatcca agaataatct ttgttaaaac 11400tatattctct
ctctcttttt tttttttttt tggttctcca gcaagaaagc aaacctgtgc 11460agatgatgta
ccagattggt ttatttagag tggcatcaat ggcttctgag aaaatgaaga 11520tcctggagct
tccatttgcc agtgggacaa tgagcatgtt ggtgctgttg cctgatgaag 11580tctcaggcct
tgagcaggta tggccctaga agttggcttc agaatattaa aaacacatgg 11640aaatttagct
gttgtaaagc tcttttcaac acagttatcc taaaacattt aaccagcaca 11700aatttcatca
tgattcaata tgtgattgtt gcatagaagt gtagatttgt cccactgggt 11760cctgcaatag
cccatgctga gcatggcttg ctgaaagaac tgctttagag ggtgaaaagt 11820ttgacacagc
agacaagatg attctcacct aagcagctgt tactgtagtg gcttgaactc 11880taaaggtctt
gtatctccat tcctgtgcac tgaggagctt cttggaaagt tcatataagg 11940tttactagtt
ctaactatta tctcatttgg tggcactcaa tgtgctttgt tcacgtcttc 12000ataaattaat
ctatctaaaa attggatgtg gttaaagcaa tttcagaaat aacatgtaca 12060taatgtacaa
ttattgatat gaacagaaca caggcatagc atattgtaat taggaggact 12120gtagttattt
tgaataggaa acacaatgta ataaatgaga attcattgaa atgttagtat 12180gctaactcaa
tctaaattat aaagataaag aggcatttaa tcacagctag atttccatca 12240cttgtgacag
acaggcatat gaatgattat gtacagctct aggaaaaaaa gtatgtagga 12300aaactagtac
attttgatta gaaagtctga aaatgaggtg ccttgatcaa agagaatacg 12360tgtgtttgag
aaaaaaaaag tttggataga ggtggtaaga gagaatatat tgaaatggtg 12420tttctacaaa
ctgccatggc cagatttgtg taagagacat tcagtaagta ggcaaggaaa 12480gaaatattac
taggtacaaa gcaacatcag taataccaaa agaaaccaat tattccagat 12540gccaatctcg
taatagggtt aagagatttc cacccctcta gtggtcacca gtgcaaccag 12600taactttgct
aatttacatt ttcttttttt aaatggcaga tatagctttg aactgagtga 12660tcatgaactg
gtactgtgta atagatgaag acatacttga cgactaaact tctgattttt 12720aaaaactcaa
attctcttga aagatcagtt cccagtctag taacagctga tagtttaagt 12780atcagtaatt
ggctaccatt aacaactggc tcctgagagg tcttaaatgt agagacagct 12840ttaaactcaa
aagcacagag tgatttttag aatagatttc ccaagcaaag aaaataaaca 12900gggaggagct
ttaagggagt agccatctca ttattattat tatttaaaga aatggcagca 12960agcctacaaa
agaaaaataa gacagagcag agaagaaaga gtcatggtat gcttttctat 13020cttagcaaaa
ttaatctcta catgcctagg aaaaagccat gacaagagca atcagttcaa 13080aaggtgtatg
caaaaaacca cataatagta actagtactg cattgccagg aaggaagtta 13140tgtcgccatt
ccatggatct cattctcatt tccttgcagc ttgagagtat aatcaacttt 13200gaaaaactga
ctgaatggac cagttctaat gttatggaag agaggaagat caaagtgtac 13260ttacctcgca
tgaagatgga ggaaaaatac aacctcacat ctgtcttaat ggctatgggc 13320attactgacg
tgtttagctc ttcagccaat ctgtctggca tctcctcagc agagagcctg 13380aagatatctc
aagctgtcca tgcagcacat gcagaaatca atgaagcagg cagagaggtg 13440gtagggtcag
cagaggctgg agtggatgct gcaagcgtct ctgaagaatt tagggctgac 13500catccattcc
tcttctgtat caagcacatc gcaaccaacg ccgttctctt ctttggcaga 13560tgtgtttccc
cttaaaaaga agaaagctga aaaactctgt cccttccaac aagacccaga 13620gcactgtagt
atcaggggta aaatgaaaag tatgttatct gctgcatcca gacttcataa 13680aagctggagc
ttaatctaga aaaaaaatca gaaagaaatt acactgtgag aacaggtgca 13740attcactttt
cctttacaca gagtaatact ggtaactcat ggatgaaggc ttaagggaat 13800gaaattggac
tcacagtact gagtcatcac actgaaaaat gcaacctgat acatcagcag 13860aaggtttatg
ggggaaaaat gcagccttcc aattaagcca gatatctgta tgaccaagct 13920gctccagaat
tagtcactca aaatctctca gattaaatta tcaactgtca ccaaccattc 13980ctatgctgac
aaggcaattg cttgttctct gtgttcctga tactacaagg ctcttcctga 14040cttcctaaag
atgcattata aaaatcttat aattcacatt tctccctaaa ctttgactca 14100atcatggtat
gttggcaaat atggtatatt actattcaaa ttgttttcct tgtacccata 14160tgtaatgggt
cttgtgaatg tgctcttttg ttcctttaat cataataaaa acatgtttaa 14220gcaaacactt
ttcacttgta gtatttgaag tacagcaagg ttgtgtagca gggaaagaat 14280gacatgcaga
ggaataagta tggacacaca ggctagcagc gactgtagaa caagtactag 14340tgggtgagaa
gttgaacaag agtcccctac aagcaactta atctaataag ctagtggtct 14400acatcagcta
aaagagcata gtgagggatg aaattggttc tcctttctaa gcatcacctg 14460ggacaactca
tctggagcag tgtgtccaat ctgccgctgc cctgatctcg gctggggtga 14520tgggacagac
cttggctgcc actgagacat ctgagacact gagatctgtc tcaactcaga 14580tttacccaag
aacagctcat tgccaacaga acaaaatctc aaacttatgg ctagtgatga 14640cagcagtcag
ttgtcccatc tgtgacccac caaggctggc atgctggaat gagcaggctt 14700tggtggcatg
tagttactgg acagcaccac tgacatgggc aggggaaaaa ctgagcatgg 14760tgtaaatcac
tgcctcaaag ccacttctct gtgcctgcac catgcttgaa agctcttcta 14820caggagctgg
gtttgttcaa gaaagcttct gtttctccca tctgcttctt gtaccttcac 14880agggacagag
ttagaagggt acagccatgg ctggaagggg ctgactttca aatgtgccta 14940attttccttt
ggttgctgct gcagctgcag aagaaggggt tcagaagcca agagctttga 15000gataaggatg
cctaacctat gttgaagaca tttgtgctga cacctcaggc cccaggatag 15060gacaactgct
ggattgtggc taacccacta gctacagaac ctaatttata ttaccagatt 15120aggaagagca
aaagaacatg tatttataac aggaggtctt ctgtgcttct ctactaaaag 15180gtgctgtgaa
ggagcccaca gtgcagcagt gtatgaggcc tgaaagaggc cgcagcacac 15240gaagagccct
ggtaggagca gcacacagag gggcaggagg gctgggggaa ctgccaccca 15300tggggacctg
tgtgaagcag tgcactcctg aggggtggac tgcgtgggaa aggaaaagaa 15360agcaaacaga
cctgtgatga actgtcacac agactgcaga gtgacagagg agggcacgag 15420gcagtgcgcc
cactgcaggg agtggcgctc cttcctcaca gcagcgctaa cagcttggca 15480ccaatattca
gtagtctgtg gtgatacttt ttccagtttc accacacagc atttcgcttg 15540ttctacttgt
tttagctttc cccctccaca agataacaca tactttgcca gtcagtccct 15600aagaccttaa
cttaacagtt agcaaacagg atcttgcaaa agaaggaaga taacatgaca 15660ccaccttcac
tggtgtataa atagttcaaa tactttcctt cactttcccg taaattagtt 15720gattgcaggt
caggagataa caggggaact tactgcaaga gagaaaatga tgtttaatat 15780tgtcttggac
tttctggtgg tctgggcatg aaaatggggt actcaaaatc ctcgggacgt 15840ttatttttca
cctgatttat tcccaaactg cactatttct aggccattgg agttcttatc 15900aattaaatta
tactttggct ctctgctatc tcactccctt tcatcttcag catcactttc 15960agcacaatta
caggagaaga cttagactca gagctttagg actcatcata agaggctttc 16020attgctctgt
caccacaccc catatagatc t
16051237334DNAArtificial SequencepBS-OM-4.4 Vector 23atcaagctta
tcgataccgt cgacctcgag ggggggcccg gtacccagct tttgttccct 60ttagtgaggg
ttaatttcga gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa 120ttgttatccg
ctcacaattc cacacaacat acgagccgga agcataaagt gtaaagcctg 180gggtgcctaa
tgagtgagct aactcacatt aattgcgttg cgctcactgc ccgctttcca 240gtcgggaaac
ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg ggagaggcgg 300tttgcgtatt
gggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg 360gctgcggcga
gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg 420ggataacgca
ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa 480ggccgcgttg
ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 540acgctcaagt
cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 600tggaagctcc
ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 660ctttctccct
tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 720ggtgtaggtc
gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 780ctgcgcctta
tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 840actggcagca
gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 900gttcttgaag
tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc 960tctgctgaag
ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 1020caccgctggt
agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 1080atctcaagaa
gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 1140acgttaaggg
attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa 1200ttaaaaatga
agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta 1260ccaatgctta
atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt 1320tgcctgactc
cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag 1380tgctgcaatg
ataccgcgag acccacgctc accggctcca gatttatcag caataaacca 1440gccagccgga
agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc 1500tattaattgt
tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt 1560tgttgccatt
gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag 1620ctccggttcc
caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt 1680tagctccttc
ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat 1740ggttatggca
gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt 1800gactggtgag
tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc 1860ttgcccggcg
tcaatacggg ataataccgc gccacatagc agaactttaa aagtgctcat 1920cattggaaaa
cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag 1980ttcgatgtaa
cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt 2040ttctgggtga
gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg 2100gaaatgttga
atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta 2160ttgtctcatg
agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc 2220gcgcacattt
ccccgaaaag tgccacctaa attgtaagcg ttaatatttt gttaaaattc 2280gcgttaaatt
tttgttaaat cagctcattt tttaaccaat aggccgaaat cggcaaaatc 2340ccttataaat
caaaagaata gaccgagata gggttgagtg ttgttccagt ttggaacaag 2400agtccactat
taaagaacgt ggactccaac gtcaaagggc gaaaaaccgt ctatcagggc 2460gatggcccac
tacgtgaacc atcaccctaa tcaagttttt tggggtcgag gtgccgtaaa 2520gcactaaatc
ggaaccctaa agggagcccc cgatttagag cttgacgggg aaagccggcg 2580aacgtggcga
gaaaggaagg gaagaaagcg aaaggagcgg gcgctagggc gctggcaagt 2640gtagcggtca
cgctgcgcgt aaccaccaca cccgccgcgc ttaatgcgcc gctacagggc 2700gcgtcccatt
cgccattcag gctgcgcaac tgttgggaag ggcgatcggt gcgggcctct 2760tcgctattac
gccagctggc gaaaggggga tgtgctgcaa ggcgattaag ttgggtaacg 2820ccagggtttt
cccagtcacg acgttgtaaa acgacggcca gtgaattgta atacgactca 2880ctatagggcg
aattggagct ccaccgcggt ggcggccgct ctagaactag tggatccttc 2940ttaaaaagca
gaccatcatt cactgcaaac ccagagcttc atgcctctcc ttccacaacc 3000gaaaacagcc
ggcttcattt gtctttttta aatgctgttt tccaggtgaa ttttggccag 3060cgtgttggct
gagatccagg agcacgtgtc agctttctgc tctcattgct cctgttctgc 3120attgcctctt
tctggggttt ccaagagggg gggagacttt gcgcggggat gagataatgc 3180cccttttctt
agggtggctg ctgggcagca gagtggctct gggtcactgt ggcaccaatg 3240ggaggcacca
gtgggggtgt gttttgtgca ggggggaagc attcacagaa tggggctgat 3300cctgaagctt
gcagtccaag gctttgtctg tgtacccagt gaaatccttc ctctgttaca 3360taaagcccag
ataggactca gaaatgtagt cattccagcc cccctcttcc tcagatctgg 3420agcagcactt
gtttgcagcc agtcctcccc aaaatgcaca gacctcgccg agtggaggga 3480gatgtaaaca
gcgaaggtta attacctcct tgtcaaaaac actttgtggt ccatagatgt 3540ttctgtcaat
cttacaaaac agaaccgaga ggcagcgagc actgaagagc gtgttcccat 3600gctgagttaa
tgagacttgg cagctcgctg tgcagagatg atccctgtgc ttcatgggag 3660gctgtaacct
gtctccccat cgccttcaca ccgcagtgct gtcctggaca cctcaccctc 3720cataagctgt
aggatgcagc tgcccaggga tcaagagact tttcctaagg ctcttaggac 3780tcatctttgc
cgctcagtag cgtgcagcaa ttactcatcc caactatact gaatgggttt 3840ctgccagctc
tgcttgtttg tcaataagca tttcttcatt ttgcctctaa gtttctctca 3900gcagcaccgc
tctgggtgac ctgagtggcc acctggaacc cgaggggcac agccaccacc 3960tccctgttgc
tgctgctcca gggactcatg tgctgctgga tggggggaag catgaagttc 4020ctcacccaga
cacctgggtt gcaatggctg cagcgtgctc ttcttggtat gcagattgtt 4080tccagccatt
acttgtagaa atgtgctgtg gaagcccttt gtatctcttt ctgtggccct 4140tcagcaaaag
ctgtgggaaa gctctgaggc tgctttcttg ggtcgtggag gaattgtatg 4200ttccttcttt
aacaaaaatt atccttagga gagagcactg tgcaagcatt gtgcacataa 4260aacaattcag
gttgaaaggg ctctctggag gtttccagcc tgactactgc tcgaagcaag 4320gccaggttca
aagatggctc aggatgctgt gtgccttcct gattatctgt gccaccaatg 4380gaggagattc
acagccactc tgcttcccgt gccactcatg gagaggaata ttcccttata 4440ttcagataga
atgttatcct ttagctcagc cttccctata accccatgag ggagctgcag 4500atccccatac
tctccccttc tctggggtga aggccgtgtc ccccagcccc ccttcccacc 4560ctgtgcccta
agcagcccgc tggcctctgc tggatgtgtg cctatatgtc aatgcctgtc 4620cttgcagtcc
agcctgggac atttaattca tcaccagggt aatgtggaac tgtgtcatct 4680tcccctgcag
ggtacaaagt tctgcacggg gtcctttcgg ttcaggaaaa ccttcactgg 4740tgctacctga
atcaagctct atttaataag ttcataagca catggatgtg ttttcctaga 4800gatacgtttt
aatggtatca gtgattttta tttgctttgt tgcttacttc aaacagtgcc 4860tttgggcagg
aggtgaggga cgggtctgcc gttggctctg cagtgatttc tccaggcgtg 4920tggctcaggt
cagatagtgg tcactctgtg gccagaagaa ggacaaagat ggaaattgca 4980gattgagtca
cgttaagcag gcatcttgga gtgatttgag gcagtttcat gaaagagcta 5040cgaccactta
ttgttgtttt ccccttttac aacagaagtt ttcatcaaaa taacgtggca 5100aagcccagga
atgtttggga aaagtgtagt taaatgtttt gtaattcatt tgtcggagtg 5160ctaccagcta
agaaaaaagt cctacctttg gtatggtagt cctgcagaga atacaacatc 5220aatattagtt
tggaaaaaaa caccaccacc accagaaact gtaatggaaa atgtaaacca 5280agaaattcct
tgggtaagag agaaaggatg tcgtatactg gccaagtcct gcccagctgt 5340cagcctgctg
accctctgca gttcaggacc atgaaacgtg gcactgtaag acgtgtcccc 5400tgcctttgct
tgcccacaga tctctgccct tgtgctgact cctgcacaca agagcatttc 5460cctgtagcca
aacagcgatt agccataagc tgcacctgac tttgaggatt aagagtttgc 5520aattaagtgg
attgcagcag gagatcagtg gcagggttgc agatgaaatc cttttctagg 5580ggtagctaag
ggctgagcaa cctgtcctac agcacaagcc aaaccagcca agggttttcc 5640tgtgctgttc
acagaggcag ggccagctgg agctggagga ggttgtgctg ggacccttct 5700ccctgtgctg
agaatggagt gatttctggg tgctgttcct gtggcttgca ctgagcagct 5760caagggagat
cggtgctcct catgcagtgc caaaactcgt gtttgatgca gaaagatgga 5820tgtgcacctc
cctcctgcta atgcagccgt gagcttatga aggcaatgag ccctcagtgc 5880agcaggagct
gtagtgcact cctgtaggtg ctagggaaaa tctctggttc ccagggatgc 5940attcataagg
gcaatatatc ttgaggctgc gccaaatctt tctgaaatat tcatgcgtgt 6000tcccttaatt
tatagaaaca aacacagcag aataattatt ccaatgcctc ccctcgaagg 6060aaacccatat
ttccatgtag aaatgtaacc tatatacaca cagccatgct gcatccttca 6120gaacgtgcca
gtgctcatct cccatggcaa aatactacag gtattctcac tatgttggac 6180ctgtgaaagg
aaccatggta agaaacttcg gttaaaggta tggctgcaaa actactcata 6240ccaaaacagc
agagctccag acctcctctt aggaaagagc cacttggaga gggatggtgt 6300gaaggctgga
ggtgagagac agagcctgtc ccagttttcc tgtctctatt ttctgaaacg 6360tttgcaggag
gaaaggacaa ctgtactttc aggcatagct ggtgccctca cgtaaataag 6420ttccccgaac
ttctgtgtca tttgttctta agatgctttg gcagaacact ttgagtcaat 6480tcgcttaact
gtgactaggt ctgtaaataa gtgctccctg ctgataaggt tcaagtgaca 6540tttttagtgg
tatttgacag catttacctt gctttcaagt cttctaccaa gctcttctat 6600acttaagcag
tgaaaccgcc aagaaaccct tccttttatc aagctagtgc taaataccat 6660taacttcata
ggttagatac ggtgctgcca gcttcacctg gcagtggttg gtcagttctg 6720ctggtgacaa
agcctccctg gcctgtgctt ttacctagag gtgaatatcc aagaatgcag 6780aactgcatgg
aaagcagagc tgcaggcacg atggtgctga gccttagctg cttcctgctg 6840ggagatgtgg
atgcagagac gaatgaagga cctgtccctt actcccctca gcattctgtg 6900ctatttaggg
ttctaccaga gtccttaaga ggtttttttt ttttttggtc caaaagtctg 6960tttgtttggt
tttgaccact gagagcatgt gacacttgtc tcaagctatt aaccaagtgt 7020ccagccaaaa
tcaattgcct gggagacgca gaccattacc tggaggtcag gacctcaata 7080aatattacca
gcctcattgt gccgctgaca gattcagctg gctgctccgt gttccagtcc 7140aacagttcgg
acgccacgtt tgtatatatt tgcaggcagc ctcgggggga ccatctcagg 7200agcagagcac
cggcagccgc ctgcagagcc gggcagtacc tcaccatggc catggcaggt 7260gtcttcgtgc
tgttctcttt cgtgctttgt ggcttcctcc caggtgagta actcccagag 7320tgctgcagaa
gctt
7334244327DNAArtificial SequencepAVIJCR-A137.91.1.2 Vector 24gccaatgtgg
tacttcccac attgtataag aaatttggca agtttagagc aatgtttgaa 60gtgttgggaa
atttctgtat actcaagagg gcgtttttga caactgtaga acagaggaat 120caaaaggggg
tgggaggaag ttaaaagaag aggcaggtgc aagagagctt gcagtcccgc 180tgtgtgtacg
acactggcac catggctttg acctttgcct tactggtggc tctcctggtg 240ctgagctgca
agagcagctg ctctgtgggc tgcgatctgc ctcagaccca cagcctgggc 300agcaggagga
ccctgatgct gctggctcag atgaggagaa tcagcctgtt tagctgcctg 360aaggataggc
acgattttgg ctttcctcaa gaggagtttg gcaaccagtt tcagaaggct 420gagaccatcc
ctgtgctgca cgagatgatc cagcagatct ttaacctgtt tagcaccaag 480gatagcagcg
ctgcttggga tgagaccctg ctggataagt tttacaccga gctgtaccag 540cagctgaacg
atctggaggc ttgcgtgatc cagggcgtgg gcgtgaccga gacccctctg 600atgaaggagg
atagcatcct ggctgtgagg aagtactttc agaggatcac cctgtacctg 660aaggagaaga
agtacagccc ctgcgcttgg gaagtcgtga gggctgagat catgaggagc 720tttagcctga
gcaccaacct gcaagagagc ttgaggtcta aggagtaaaa agtctagagt 780cggggcggcc
ggccgcttcg agcagacatg ataagataca ttgatgagtt tggacaaacc 840acaactagaa
tgcagtgaaa aaaatgcttt atttgtgaaa tttgtgatgc tattgcttta 900tttgtaacca
ttataagctg caataaacaa gttaacaaca acaattgcat tcattttatg 960tttcaggttc
agggggaggt gtgggaggtt ttttaaagca agtaaaacct ctacaaatgt 1020ggtaaaatcg
ataaggatcc gtcgaccgat gcccttgaga gccttcaacc cagtcagctc 1080cttccggtgg
gcgcggggca tgactatcgt cgccgcactt atgactgtct tctttatcat 1140gcaactcgta
ggacaggtgc cggcagcgct cttccgcttc ctcgctcact gactcgctgc 1200gctcggtcgt
tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat 1260ccacagaatc
aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca 1320ggaaccgtaa
aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 1380atcacaaaaa
tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 1440aggcgtttcc
ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 1500gatacctgtc
cgcctttctc ccttcgggaa gcgtggcgct ttctcaatgc tcacgctgta 1560ggtatctcag
ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 1620ttcagcccga
ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 1680acgacttatc
gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag 1740gcggtgctac
agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat 1800ttggtatctg
cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat 1860ccggcaaaca
aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc 1920gcagaaaaaa
aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt 1980ggaacgaaaa
ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct 2040agatcctttt
aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt 2100ggtctgacag
ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc 2160gttcatccat
agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac 2220catctggccc
cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat 2280cagcaataaa
ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg 2340cctccatcca
gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata 2400gtttgcgcaa
cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta 2460tggcttcatt
cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt 2520gcaaaaaagc
ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag 2580tgttatcact
catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa 2640gatgcttttc
tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc 2700gaccgagttg
ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt 2760taaaagtgct
catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc 2820tgttgagatc
cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta 2880ctttcaccag
cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa 2940taagggcgac
acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca 3000tttatcaggg
ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac 3060aaataggggt
tccgcgcaca tttccccgaa aagtgccacc tgacgcgccc tgtagcggcg 3120cattaagcgc
ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt gccagcgccc 3180tagcgcccgc
tcctttcgct ttcttccctt cctttctcgc cacgttcgcc ggctttcccc 3240gtcaagctct
aaatcggggg ctccctttag ggttccgatt tagtgcttta cggcacctcg 3300accccaaaaa
acttgattag ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg 3360tttttcgccc
tttgacgttg gagtccacgt tctttaatag tggactcttg ttccaaactg 3420gaacaacact
caaccctatc tcggtctatt cttttgattt ataagggatt ttgccgattt 3480cggcctattg
gttaaaaaat gagctgattt aacaaaaatt taacgcgaat tttaacaaaa 3540tattaacgtt
tacaatttcc cattcgccat tcaggctgcg caactgttgg gaagggcgat 3600cggtgcgggc
ctcttcgcta ttacgccagc ccaagctacc atgataagta agtaatatta 3660aggtacggga
ggtacttgga gcggccgcaa taaaatatct ttattttcat tacatctgtg 3720tgttggtttt
ttgtgtgaat cgatagtact aacatacgct ctccatcaaa acaaaacgaa 3780acaaaacaaa
ctagcaaaat aggctgtccc cagtgcaagt gcaggtgcca gaacatttct 3840ctatcgatag
gtaccgagct cttacgcgtg ctagccccga tgtacgggcc agatatacgc 3900gttgacattg
attattgact agttattaat agtaatcaat tacggggtca ttagttcata 3960gcccatatat
ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 4020ccaacgaccc
ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag 4080ggactttcca
ttgacgtcaa tgggtggact atttacggta aactgcccac ttggcagtac 4140atcaagtgta
tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg 4200cctggcatta
tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 4260tattagtcat
cgctattacc atgcatggct ttgacctttg ccttactggt ggctctcctg 4320gtgctta
432725244DNAArtificial SequenceThe RRE (rev responsive element) sequence
25aattgaggag ctttgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcg
60tcaatgacgc tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac
120aatttgctga gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc
180aagcagctcc aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg
240gtac
24426158DNAArtificial SequenceThe ALV CTE (constitutive transport
element) sequence 26aatgtgggga gggcaaggct tgcgaatcgg gttgtaacgg
gcaaggcttg actgagggga 60caatagcatg tttaggcgaa aagcggggct tcggttgtac
gcggttagga gtcccctcag 120gatatagtag tttcgctttt gcatagggag ggggaaat
1582755DNAArtificial Sequencep10.0-OM-IFN-1 Primer
27ggcgtcgacg gatccgttaa ccctagaact agtggatctc tgcccttgtg ctgac
552831DNAArtificial Sequencep10.0-OM-IFN-2 28ggcctcgagc ctagactttt
tactccttag a 3129346DNAArtificial
SequenceALV vector 5' LTR sequence 29aatgtagtct tatgcaatac tcttgtagtc
ttgcaacatg cttatgtaac gatgagttag 60caacatgcct tataaggaga gaaaaagcac
cgtgcatgcc gattggtggg agtaaggtgg 120tatgatcgtg gtatgatcgt gccttgttag
gaaggcaaca gacgggtcta acacggattg 180gacgaaccac tgaattccgc attgcagaga
tattgtattt aagtgcctag ctcgatacaa 240taaacgccat ttgaccattc accacattgg
tgtgcacctg ggttgatggc cggaccgttg 300attccctgrc gactacgagc acatgcatga
agcagaaggc ttcatt 346
User Contributions:
Comment about this patent or add new information about this topic: