Inventors list |
Assignees list |
Classification tree browser |
Top 100 Inventors |
Top 100 Assignees |
Patent application title: Polypeptides of Botryosphaeria Rhodina
Inventors:
Kirk Matthew Schnorr (Holte, DK)
Kirk Matthew Schnorr (Holte, DK)
Lene Lange (Valby, DK)
Pernille Uldall Bolvig (Roskilde, DK)
Assignees:
Novozymes A/S
IPC8 Class: AA01N6304FI
USPC Class:
424 944
Class name: Drug, bio-affecting and body treating compositions enzyme or coenzyme containing oxidoreductases (1. ) (e.g., catalase, dehydrogenases, reductases, etc.)
Publication date: 2012-07-05
Patent application number: 20120171189
Sign up to receive free email alerts when patent applications with chosen keywords are published SIGN UP
Abstract:
The invention relates to functional polypeptides secreted from
Botryospaeria rhodina CBS 274.96.Claims:
1. An isolated polypeptide selected from the group consisting of: (a) a
polypeptide comprising an amino acid sequence which has at least 90%
identity with a sequence of a mature polypeptide comprised in the group
consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ
ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18,
SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO:
28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO:36, SEQ ID NO:
38, SEQ ID NO: 40 and SEQ ID NO: 42; and (b) a polypeptide which is
encoded by a nucleotide sequence which hybridize under high stringency
conditions with a polynucleotide probe selected from the group consisting
of (i) the complementary strand to a nucleotide sequence selected from
the group of regions of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID
NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID
NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO:23, SEQ ID NO: 25, SEQ ID
NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ
ID NO: 37, SEQ ID NO: 39 and SEQ ID NO: 41 encoding a mature polypeptide,
(ii) the complementary strand to the cDNA sequence contained in a
nucleotide sequences selected from the group of regions of SEQ ID NO: 1,
SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11,
SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO:
21, SEQ ID NO:23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO:
31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 and SEQ ID
NO: 41 encoding a mature polypeptide, wherein the polypeptide has a
function of the corresponding mature polypeptides comprised in the group
consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ
ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18,
SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO:
28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO:36, SEQ ID NO:
38, SEQ ID NO: 40 and SEQ ID NO: 42.
2. An isolated enzyme selected from the group consisting of: (a) an enzyme comprising an amino acid sequence which has at least 90% identity with the amino acid sequence of a mature enzyme selected from the group consisting of xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase secreted from the strain of Botryosphaeria rhodina deposited under CBS accession No. 274.96, (b) a polypeptide which is encoded by a nucleotide sequence which hybridizes under high stringency conditions with a polynucleotide probe selected from the group consisting of (i) the complementary strand to a nucleotide sequence comprised in the strain of Botryosphaeria rhodina deposited under CBS accession No. 274.96 encoding a mature enzyme selected from the group consisting of xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase secreted from that strain; ii) the complementary strand to the cDNA sequence contained in a nucleotide sequences comprised in the strain of Botryosphaeria rhodina deposited under CBS accession No. 274.96 encoding a mature enzyme selected from the group consisting of xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase secreted from that strain; wherein the enzyme has a function selected from xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase.
3. The polypeptide of claim 1 or 2 selected from the group consisting of: a) a polypeptide comprising an amino acid sequence which has at least 90% identity with a sequence selected from the group consisting of amino acids 1-291 of SEQ ID NO:2; 1-202 of SEQ ID NO:4; amino acids 1-352 of SEQ ID NO:6; amino acids 1-431 of SEQ ID NO:8; amino acids 1-185 of SEQ ID NO:10; amino acids 1-218 of SEQ ID NO:12; amino acids 1-249 of SEQ ID NO:14; amino acids 1-255 of SEQ ID NO:16; amino acids 1-205 of SEQ ID NO:18; amino acids 1-243 of SEQ ID NO:20; amino acids 1-415 of SEQ ID NO:22; amino acids 1-377 of SEQ ID NO:24; amino acids 1-259 of SEQ ID NO:26; amino acids 1-248 of SEQ ID NO:28; amino acids 1-149 of SEQ ID NO:30, amino acids 1-202 of SEQ ID NO:32; amino acids 1 to 603 of SEQ ID NO: 34; amino acids 1 to 301 of SEQ ID NO: 36; amino acids 1 to 438 of SEQ ID NO: 38; amino acids 1 to 396 of SEQ ID NO: 40 and amino acids 1 to 262 of SEQ ID NO: 42; b) a polypeptide which is encoded by a nucleotide sequence which hybridizes under high stringency conditions with a polynucleotide selected from the group consisting of: i) the complementary strand of a nucleotide sequence selected from the group consisting of nucleotides 55-927 of SEQ ID NO:1; nucleotides 58-663 of SEQ ID NO:3; nucleotides 55-1110 of SEQ ID NO:5; nucleotides 55-1347 of SEQ ID NO:7; nucleotides 1-555 of SEQ ID NO:9; nucleotides 49-702 of SEQ ID NO:11; nucleotides 40-786 of SEQ ID NO:13; nucleotides 55-819 of SEQ ID NO:15; nucleotides 61-675 of SEQ ID NO:17; nucleotides 1-729 of SEQ ID NO:19; nucleotides 55-1299 of SEQ ID NO:21; nucleotides 49-1179 of SEQ ID NO:23; nucleotides 70-846 of SEQ ID NO:25; nucleotides 58-810 of SEQ ID NO:27; nucleotides 55-660 of SEQ ID NO:31; nucleotides 46 to 1854 of SEQ ID NO: 33; nucleotides 64 to 966 of SEQ ID NO: 35; nucleotides 55 to 1368 of SEQ ID NO: 37; nucleotides 61 to 1248 of SEQ ID NO: 39 and nucleotides 64 to 849 of SEQ ID NO: 41; ii) the complementary strand to the cDNA sequence contained in a nucleotide sequences selected from the group of regions consisting of nucleotides 55-927 of SEQ ID NO:1; nucleotides 58-663 of SEQ ID NO:3; nucleotides 55-1110 of SEQ ID NO:5; nucleotides 55-1347 of SEQ ID NO:7; nucleotides 1-555 of SEQ ID NO:9; nucleotides 49-702 of SEQ ID NO:11; nucleotides 40-786 of SEQ ID NO:13; nucleotides 55-819 of SEQ ID NO:15; nucleotides 61-675 of SEQ ID NO:17; nucleotides 1-729 of SEQ ID NO:19; nucleotides 55-1299 of SEQ ID NO:21; nucleotides 49-1179 of SEQ ID NO:23; nucleotides 70-846 of SEQ ID NO:25; nucleotides 58-810 of SEQ ID NO:27; nucleotides 55-660 of SEQ ID NO:31; nucleotides 46 to 1854 of SEQ ID NO: 33; nucleotides 64 to 966 of SEQ ID NO: 35; nucleotides 55 to 1368 of SEQ ID NO: 37; nucleotides 61 to 1248 of SEQ ID NO: 39 and nucleotides 64 to 849 of SEQ ID NO: 41.
4. The polypeptide of claim 3, wherein the polypeptide is an enzyme selected from the group consisting of a polypeptide having an amino acid sequence which has at least 95% identity with an amino acid sequence selected from the group consisting of amino acids 1-291 of SEQ ID NO:2; 1-202 of SEQ ID NO:4; amino acids 1-352 of SEQ ID NO:6; amino acids 1-431 of SEQ ID NO:8; amino acids 1-185 of SEQ ID NO:10; amino acids 1-218 of SEQ ID NO:12; amino acids 1-249 of SEQ ID NO:14; amino acids 1-255 of SEQ ID NO:16; amino acids 1-205 of SEQ ID NO:18; amino acids 1-243 of SEQ ID NO:20; amino acids 1-415 of SEQ ID NO:22; amino acids 1-377 of SEQ ID NO:24; amino acids 1-259 of SEQ ID NO:26; amino acids 1-248 of SEQ ID NO:28; amino acids 1-149 of SEQ ID NO:30; amino acids 1-202 of SEQ ID NO:32; amino acids 1 to 603 of SEQ ID NO: 34; amino acids 1 to 301 of SEQ ID NO: 36; amino acids 1 to 438 of SEQ ID NO: 38; amino acids 1 to 396 of SEQ ID NO: 40 and amino acids 1 to 262 of SEQ ID NO: 42.
5. The polypeptide of claim 4, wherein the polypeptide is an enzyme selected from the group consisting of a polypeptide which is encoded by a nucleotide sequence which hybridize under very high stringency conditions with a polynucleotide selected from the group consisting of i) the complementary strand to a nucleotide sequence selected from the group of regions consisting of nucleotides 55-927 of SEQ ID NO:1; nucleotides 58-663 of SEQ ID NO:3; nucleotides 55-1110 of SEQ ID NO:5; nucleotides 55-1347 of SEQ ID NO:7; nucleotides 1-555 of SEQ ID NO:9; nucleotides 49-702 of SEQ ID NO:11; nucleotides 40-786 of SEQ ID NO:13; nucleotides 55-819 of SEQ ID NO:15; nucleotides 61-675 of SEQ ID NO:17; nucleotides 1-729 of SEQ ID NO:19; nucleotides 55-1299 of SEQ ID NO:21; nucleotides 49-1179 of SEQ ID NO:23; nucleotides 70-846 of SEQ ID NO:25; nucleotides 58-810 of SEQ ID NO:27; nucleotides 55-660 of SEQ ID NO:31; nucleotides 46 to 1854 of SEQ ID NO: 33; nucleotides 64 to 966 of SEQ ID NO: 35; nucleotides 55 to 1368 of SEQ ID NO: 37; nucleotides 61 to 1248 of SEQ ID NO: 39 and nucleotides 64 to 849 of SEQ ID NO: 41 and ii) the complementary strand to the cDNA sequence contained in a nucleotide sequences selected from the group of regions consisting of nucleotides 55-927 of SEQ ID NO:1; nucleotides 58-663 of SEQ ID NO:3; nucleotides 55-1110 of SEQ ID NO:5; nucleotides 55-1347 of SEQ ID NO:7; nucleotides 1-555 of SEQ ID NO:9; nucleotides 49-702 of SEQ ID NO:11; nucleotides 40-786 of SEQ ID NO:13; nucleotides 55-819 of SEQ ID NO:15; nucleotides 61-675 of SEQ ID NO:17; nucleotides 1-729 of SEQ ID NO:19; nucleotides 55-1299 of SEQ ID NO:21; nucleotides 49-1179 of SEQ ID NO:23; nucleotides 70-846 of SEQ ID NO:25; nucleotides 58-810 of SEQ ID NO:27; nucleotides 55-660 of SEQ ID NO:31 nucleotides 46 to 1854 of SEQ ID NO: 33; nucleotides 64 to 966 of SEQ ID NO: 35; nucleotides 55 to 1368 of SEQ ID NO: 37; nucleotides 61 to 1248 of SEQ ID NO: 39 and nucleotides 64 to 849 of SEQ ID NO: 41.
6. The polypeptide of claim 3, wherein the polynucleotide encoding the polypeptide consists of a polypeptide selected from the group consisting of amino acids 1-291 of SEQ ID NO:2; 1-202 of SEQ ID NO:4; amino acids 1-352 of SEQ ID NO:6; amino acids 1-431 of SEQ ID NO:8; amino acids 1-185 of SEQ ID NO:10; amino acids 1-218 of SEQ ID NO:12; amino acids 1-249 of SEQ ID NO:14; amino acids 1-255 of SEQ ID NO:16; amino acids 1-205 of SEQ ID NO:18; amino acids 1-243 of SEQ ID NO:20; amino acids 1-415 of SEQ ID NO:22; amino acids 1-377 of SEQ ID NO:24; amino acids 1-259 of SEQ ID NO:26; amino acids 1-248 of SEQ ID NO:28; amino acids 1-149 of SEQ ID NO:30; amino acids 1-202 of SEQ ID NO:32; amino acids 1 to 603 of SEQ ID NO: 34; amino acids 1 to 301 of SEQ ID NO: 36; amino acids 1 to 438 of SEQ ID NO: 38; amino acids 1 to 396 of SEQ ID NO: 40 and amino acids 1 to 262 of SEQ ID NO: 42.
7. The polypeptide of claim 3, wherein the polypeptide is a GH10 xylanase comprising an amino acid sequence which has at least 90% identity with a GH10 xylanase obtainable from Botryosphaeria rhodina deposited under deposit accession number CBS 274.96.
8. The polypeptide of claim 3, wherein the polypeptide is a GH10 xylanase comprising amino acids 1-291 of SEQ ID NO:2.
9. The polypeptide of claim 3, wherein the polypeptide is a GH10 xylanase consisting of amino acids 1-291 of SEQ ID NO:2.
10. The polypeptide of claim 3, wherein the polypeptide is a GH11 xylanase comprising an amino acid sequence which has at least 90% identity with a GH11 xylanase obtainable from Botryosphaeria rhodina deposited under deposit accession number CBS 274.96.
11. The polypeptide of claim 3, wherein the polypeptides is a GH11 xylanase comprising amino acids 1-202 of SEQ ID NO:4.
12. The polypeptide of claim 3, wherein the polypeptides is a GH11 xylanase consisting of amino acids 1-202 of SEQ ID NO:4.
13. The polypeptide of claim 3, wherein the polypeptide is a serine esterase comprising an amino acid sequence which has at least 90% identity with a serine esterase obtainable from Botryosphaeria rhodina deposited under deposit accession number CBS 274.96.
14. The polypeptide of claim 3, wherein the polypeptide is a serine esterase comprising amino acids 1-352 of SEQ ID NO:6.
15. The polypeptide of claim 3, wherein the polypeptide is a serine esterase consisting of amino acids 1-352 of SEQ ID NO:6.
16. The polypeptide of claim 3, wherein the polypeptide is a lipase comprising an amino acid sequence which has at least 90% identity with a serine esterase obtainable from Botryosphaeria rhodina deposited under deposit accession number CBS 274.96.
17. The polypeptide of claim 3, wherein the polypeptide is a lipase comprising amino acids 1-431 of SEQ ID NO:8.
18. The polypeptide of claim 3, wherein the polypeptide is a lipase consisting of amino acids 1-431 of SEQ ID NO:8.
19. The polypeptide of claim 3, wherein the polypeptide is a peroxidase comprising an amino acid sequence which has at least 90% identity with a peroxidase obtainable from Botryosphaeria rhodina deposited under deposit accession number CBS 274.96.
20. The polypeptide of claim 3, wherein the polypeptide is a peroxidase comprising amino acids 1-185 of SEQ ID NO:10.
21. The polypeptide of claim 3, wherein the polypeptide is a peroxidase consisting of amino acids 1-185 of SEQ ID NO:10.
22. The polypeptide of claim 3, wherein the polypeptide is a GH 61A polypeptide comprising an amino acid sequence which has at least 90% identity with a GH 61A polypeptide obtainable from Botryosphaeria rhodina deposited under deposit accession number CBS 274.96.
23. The polypeptide of claim 3, wherein the polypeptide is a GH 61A polypeptide comprising amino acids 1-218 of SEQ ID NO:12.
24. The polypeptide of claim 3, wherein the polypeptide is a GH 61A polypeptide consisting of amino acids 1-218 of SEQ ID NO:12.
25. The polypeptide of claim 3, wherein the polypeptide is a GH 61B polypeptide comprising an amino acid sequence which has at least 90% identity with a GH 61B polypeptide obtainable from Botryosphaeria rhodina deposited under deposit accession number CBS 274.96.
26. The polypeptide of claim 3, wherein the polypeptide is a GH 61B polypeptide comprising amino acids 1-249 of SEQ ID NO:14.
27. The polypeptide of claim 3, wherein the polypeptide is a GH 61B polypeptide consisting of amino acids 1-249 of SEQ ID NO:14.
28. The polypeptide of claim 3, wherein the polypeptide is a GH 61C polypeptide comprising an amino acid sequence which has at least 90% identity with a GH 61C polypeptide obtainable from Botryosphaeria rhodina deposited under deposit accession number CBS 274.96.
29. The polypeptide of claim 3, wherein the polypeptide is a GH 61C polypeptide comprising amino acids 1-255 of SEQ ID NO:16.
30. The polypeptide of claim 3, wherein the polypeptide is a GH 61C polypeptide consisting of amino acids 1-255 of SEQ ID NO:16.
31. The polypeptide of claim 3, wherein the polypeptide is a GH 61D polypeptide comprising an amino acid sequence which has at least 90% identity with a GH 61D polypeptide obtainable from Botryosphaeria rhodina deposited under deposit accession number CBS 274.96.
32. The polypeptide of claim 3, wherein the polypeptide is a GH 61D polypeptide comprising amino acids 1-205 of SEQ ID NO:18.
33. The polypeptide of claim 3, wherein the polypeptide is a GH 61D polypeptide consisting of amino acids 1-205 of SEQ ID NO:18.
34. The polypeptide of claim 3, wherein the polypeptide is a beta-glucosidase comprising an amino acid sequence which has at least 90% identity with a beta-glucosidase obtainable from Botryosphaeria rhodina deposited under deposit accession number CBS 274.96.
35. The polypeptide of claim 3, wherein the polypeptide is a beta-glucosidase comprising amino acids 1 to 603 of SEQ ID NO: 34.
36. The polypeptide of claim 3, wherein the polypeptide is a beta-glucosidase consisting of amino acids 1 to 603 of SEQ ID NO: 34.
37. The polypeptide of claim 3, wherein the polypeptide is an endo-arabinase comprising an amino acid sequence which has at least 90% identity with a endo-arabinase obtainable from Botryosphaeria rhodina deposited under deposit accession number CBS 274.96.
38. The polypeptide of claim 3, wherein the polypeptide is an endo-arabinase comprising amino acids 1 to 301 of SEQ ID NO: 36.
39. The polypeptide of claim 3, wherein the polypeptide is an endo-arabinase consisting of amino acids 1 to 301 of SEQ ID NO: 36.
40. The polypeptide of claim 3, wherein the polypeptide is an endo-arabinase comprising an amino acid sequence which has at least 90% identity with a endo-arabinase obtainable from Botryosphaeria rhodina deposited under deposit accession number CBS 274.96.
41. The polypeptide of claim 3, wherein the polypeptide is an endo-arabinase comprising amino acids 1 to 438 of SEQ ID NO: 38.
42. The polypeptide of claim 3, wherein the polypeptide is an endo-arabinase consisting of amino acids 1 to 438 of SEQ ID NO: 38.
43. The polypeptide of claim 3, wherein the polypeptide is a pepsin peptidase comprising an amino acid sequence which has at least 90% identity with a pepsin peptidase obtainable from Botryosphaeria rhodina deposited under deposit accession number CBS 274.96.
44. The polypeptide of claim 3, wherein the polypeptide is a pepsin peptidase comprising amino acids 1 to 396 of SEQ ID NO: 40.
45. The polypeptide of claim 3, wherein the polypeptide is a pepsin peptidase consisting of amino acids 1 to 396 of SEQ ID NO: 40.
46. The polypeptide of claim 3, wherein the polypeptide is a pepsin peptidase comprising an amino acid sequence which has at least 90% identity with a pepsin peptidase obtainable from Botryosphaeria rhodina deposited under deposit accession number CBS 274.96.
47. The polypeptide of claim 3, wherein the polypeptide is a pepsin peptidase comprising amino acids 1 to 262 of SEQ ID NO: 42.
48. The polypeptide of claim 3, wherein the polypeptide is a pepsin peptidase consisting of amino acids 1 to 262 of SEQ ID NO: 42.
49. A polynucleotide comprising a nucleotide sequence which encodes for the polypeptide defined in claim 3.
50. A nucleic acid construct comprising the nucleotide sequence defined in claim 49 operably linked to one or more control sequences that direct the production of the polypeptide in a host cell.
51. A recombinant expression vector comprising the nucleic acid construct of claim 50.
52. A recombinant host cell comprising the nucleic acid construct of claim 50.
53. A method for producing the polypeptide of claim 3 comprising: (a) cultivating a strain, which in its wild-type form is capable of producing the polypeptide, to produce the polypeptide; and (b) recovering the polypeptide.
54. A method for producing a polypeptide of claim 3 comprising: (a) cultivating a recombinant host cell as defined in claim 52 under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
55. A composition comprising the polypeptide of claim 3 and an excipient.
56. A method for preparing a composition of claim 55 comprising admixing the polypeptide of claim 1 with the excipient.
57. A storage medium suitable for use in an electronic device comprising information of the amino acid sequence of the polypeptide of claim 3.
58. A storage medium suitable for use in an electronic device comprising information of the nucleic acid sequence of the polynucleotide of claim 49.
Description:
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser. No. 12/631,477 filed on Dec. 4, 2009 (now allowed), which is a divisional of U.S. application Ser. No. 11/573,261 filed on Mar. 13, 2007 (now U.S. Pat. No. 7,666,649), which is 35 U.S.C. 371 national application of PCT/DK2005/00519 filed Aug. 6, 2005, which claims priority or the benefit under 35 U.S.C. 119 of Danish application nos. PA 2004 01197 and PA 2004 01215 filed Aug. 6, 2004 and Aug. 11, 2004, respectively, and U.S. provisional application No. 60/622,984 filed Oct. 28, 2004, the contents of which are fully incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to functional polypeptides encoded by polynucleotides comprised in the mRNA of Diplodia gossypina, syn. Botryospaeria rhodina deposited under deposit accession number CBS 274.96. The invention relates further to the polynucleotides and constructs of such polynucleotides encoding such polypeptides or facilitating their expression as well as to method for preparing the polypeptide. Still further the invention relates to compositions comprising the polypeptide and to uses of the polypeptide.
BACKGROUND OF THE INVENTION
[0003] Botryosphaeria rhodina (Berk. & M. A. Curtis) Arx, (syn. Diplodia gossypina Cooke). Very few reports have been published concerning the characterization of this organism; Selbmann et al., 2003 report exopolysaccharide production from Botryosphaeria rhodina (Selbmann et al., 2003, Exopolysaccharide production by filamentous fungi: the example of Botryosphaeria rhodina, Antonie van Leeuwenhoek, 84(2): 135-145. A single patent exists on the use of Botryosphaeria rhodina to hydroxylate beta Damascone as a flavouring agent for tobacco (CH 654567). Jasmonic acid can also be produced by fermenting the organism (EP 1118672). The presence of cellobiohydrolases (WO 03/000941) and lactase (WO 01/49878) have been previously reported.
[0004] In the pursuit of novel enzymes it is also known to screen for such new enzymes by subjecting potential candidates to specific enzyme assays. This approach is limited to the availability of enzyme assays and does not allow the identification of functional enzymes or polypeptides for which the activity is still unknown.
[0005] Further, whole genome sequencing is a known method to obtain the information on all genes from a given microorganism, e.g., as described in Fleischmann et al., 1995, Whole genome sequences and assembly of Haemophilus influenzae Rd; Nature 269: 496-512.
[0006] Most enzymes for industrial use are enzymes which are secreted to the medium by a microorganism. However, only a few percent of a microorganisms' genome encodes secreted proteins. For example only approx. 4% of the Bacillus subtilis genome or its closest relatives encode secreted proteins (Van Dijl et al.: Protein transport pathways in Bacillus subtilis: a genome-based road map; in "Basillus subtilis and it's closest relatives"--From genes to cells; p. 337-355; A. L. Sonenshein (ed.); ASM Press 2002).
[0007] One disadvantage of genome sequencing is that the vast majority of the obtained sequences encode non secreted proteins.
[0008] An additional disadvantage of gemomic sequencing particular to eukaryotes such as fungi is that the genome size is many times larger than a bacterial genome making gene discovery by this method more costly and time consuming.
[0009] The random sequencing of cDNAs (Expressed sequence tags or ESTs) is another approach that allows for discovery of secreted proteins. In general, EST approaches suffer two drawbacks with regard to secreted protein identification; 1) Depending on the induction conditions used for the cDNA library sequenced, very few, typically between 0.5%-15% or even 1 and 5% of the cDNAs encode secreted proteins. 2) The clones all come from a cDNA pool derived from mRNAs that are present in the organism in proportion to the induction level of each particular gene.
[0010] Also known is signal trapping which is a method to identify genes including nucleotides encoding a signal peptide using a translational fusion to an extracellular reporter gene lacking its own signal (WO 01/77315).
SUMMARY OF THE INVENTION
[0011] The genome of a microorganism contains thousands of different genes; some encoding polypeptides some coding for RNAs. Only a limited number of the genes in the genome of a microorganism encode functional polypeptides which are secreted by the microorganism to the surrounding medium serving an external purpose for the microorganism.
[0012] Such polypeptides are interesting for industry from the point of view that such polypeptides may be produced in considerable amounts in continuous processes without destroying the cells producing the polypeptides.
[0013] It is an object of the present invention to identify and provide polypeptides secreted from Botryosphaeria rhodina deposited under deposit accession number CBS 274.96 which have functional purpose for the Botryosphaeria rhodina because such polypeptides may not only be used for industrial purposes but they may also be produced in industrially relevant processes and amounts.
[0014] The present invention provides in a first aspect an isolated polypeptide selected from the group consisting of:
[0015] (a) a polypeptide comprising an amino acid sequence which has at least 90% identity with a sequence of a mature polypeptide comprised in the group consisting of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 32, 34, 36, 38, 40 and 42; and
[0016] (b) a polypeptide which is encoded by a nucleotide sequence which hybridize under high stringency conditions with a polynucleotide probe selected from the group consisting of [0017] (i) the complementary strand to a nucleotide sequence selected from the group of regions of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39 and 41 encoding a mature polypeptide; [0018] (ii) the complementary strand to the cDNA sequence contained in a nucleotide sequences selected from the group of regions of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39 and 41 encoding a mature polypeptide; wherein the polypeptide has a function of the corresponding mature polypeptides comprised in the group consisting of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 32, 34, 36, 38, 40 and 42.
[0019] In a further aspect the invention provides an isolated enzyme selected from the group consisting of:
[0020] (a) an enzyme comprising an amino acid sequence which has at least 90% identity with the amino acid sequence of a mature enzyme selected from the group consisting of xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase secreted from the strain of Botryosphaeria rhodina deposited under CBS accession No. 274.96
[0021] (b) a polypeptide which is encoded by a nucleotide sequence which hybridize under high stringency conditions with a polynucleotide probe selected from the group consisting of [0022] (i) the complementary strand to a nucleotide sequence comprised in the strain of Botryosphaeria rhodina deposited under CBS accession No. 274.96 encoding a mature enzyme selected from the group consisting of xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase secreted from that strain; [0023] ii) the complementary strand to the cDNA sequence contained in a nucleotide sequences comprised in the strain of Botryosphaeria rhodina deposited under CBS accession No. 274.96 encoding a mature enzyme selected from the group consisting of xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase secreted from that strain; wherein the enzyme have a function selected from xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase.
[0024] In further aspects the invention provides a polynucleotide encoding the polypeptide of the invention; a nucleotide construct comprising the polynucleotide encoding the polypeptide, operably linked to one or more control sequences that direct the production of the polypeptide in a host cell; a recombinant expression vector comprising the nucleotide construct of the invention and to a recombinant host cell comprising the nucleotide construct of the invention.
[0025] In still further aspects the invention provides a method of preparing a polypeptide of the invention comprising:
[0026] (a) cultivating a strain comprising a nucleotide sequence encoding a polypeptide of the invention which strain is capable of expressing and secreting the polypeptide and
[0027] (b) recovering the polypeptide.
[0028] In still further aspects the invention provide a composition comprising a polypeptide of the invention and a method for preparing such a composition comprising admixing the polypeptide of the invention with an excipient.
[0029] In still further aspects the invention provides use of the polypeptide of the invention or a composition comprising said polypeptide in various applications.
Sequence Listing
[0030] The present application contains information in the form of a sequence listing, which is appended to the application and also submitted on a data carrier accompanying this application. The contents of the data carrier are fully incorporated herein by reference. The regions of sequences selected from the group consisting of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39 and 41 which encode the mature polypeptides of sequences selected from the group consisting of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 32, 34, 36, 38, 40 and 42 respectively. The region of SEQ ID NO: 1 encoding a mature polypeptide thus encodes the mature polypeptide sequence comprised in SEQ ID NO:2, the region of SEQ ID NO:3 encoding a mature polypeptide encodes the mature polypeptide comprised in SEQ ID NO:4 and so on.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0031] The term "group ADNA" as used hereinafter means a group of nucleotide sequences consisting of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39 and 41. Hence when referral is made to a nucleotide sequence comprised in or selected from group of sequences consisting of "group ADNA "(or just comprised in or selected from "group ADNA"), it means that the sequence is comprised in or selected from the group of nucleotide sequences consisting of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39 and 41.
[0032] The term "group EDNA" as used hereinafter means a group of nucleotide sequences consisting of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 33, 35, 37, 39 and 41. Hence when referral is made to a nucleotide sequence comprised in or selected from group of sequences consisting of "group EDNA" (or just comprised in or selected from "group EDNA"), it means that the sequence is comprised in or selected from the group of nucleotide sequences consisting of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 33, 35, 37, 39 and 41.
[0033] Like wise the term "group Bpolypeptide" as used hereinafter means a group of polypeptide sequences consisting of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 32, 34, 36, 38, 40 and 42. Hence when referral is made to a polypeptide sequence comprised in or selected from the group of sequences consisting of "group BPolypeptide" (or just comprised in or selected from "group BPolypeptide") it means that the sequence is comprised in or selected from the group of polypeptide sequences consisting of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 32, 34, 36, 38, 40 and 42.
[0034] Like wise the term "group Dpolypeptide" as used hereinafter means a group of polypeptide sequences consisting of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 34, 36, 38, 40 and 42. Hence when referral is made to a polypeptide sequence comprised in or selected from the group of sequences consisting of "group DPolypeptide" (or just comprised in or selected from "group DPolypeptide") it means that the sequence is comprised in or selected from the group of polypeptide sequences consisting of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 34, 36, 38, 40 and 42.
[0035] The term "identity" as used herein, is to be understood as the homology between two amino acid sequences or between two nucleotide sequences. For purposes of the present invention, the degree of identity between two amino acid sequences is determined by using AlignX in the program of Vector NTI ver. 7.1 (Informax inc., 7600 Wisconsin Avenue, Suite #1100, Bethesda, Md. 20814, USA). Amino acid alignment is created using the Clustal W algorithm (Thompson et al., 1994, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research 22:4673-4680). The following additional parameters are used: Gap opening penalty of 10, Gap extension penalty of 0.05, Gap separation penalty range of 8. Pairwise alignment parameters were Ktuple=1, gap penalty=3, gap length opening penalty=10, gap extension penalty=0.1, window size=5 and diagonals=5. The degree of identity between two nucleotide sequences is determined using the same algorithm and software package as described above for example with the following settings: Gap penalty of 10, and gap length penalty of 10. Pairwise alignment parameters is Ktuple=3, gap penalty=3 and windows=20.
[0036] The term "functional polypeptide" as used herein in the context of the present invention means a polypeptide which can be expressed and secreted by a cell and which constitutes an operational unit capable of operating in accordance with the function it is designed to fulfill by the cell. Optionally, co-factors may be required for the polypeptide to adopt the intended function. One example of functional polypeptides is catalytically active polypeptides or enzymes which help the cell catalyzing reactions in the environment surrounding the cell. Another example could be polypeptides which serve as signal substance. Further examples are polypeptides which function as sensors (receptors) for environmental parameters (chemicals in the environment surrounding the cell) or polypeptides, which are active against other organisms (antimicrobial (poly)peptides) or polypeptides, which contributes to the structural integrity of the cell.
[0037] The term "mature region" as used herein about portion of an amino acid sequences or polypeptide means the portion or region or domain or section of the amino acid sequences or polypeptide which is the mature functional polypeptide.
[0038] The term "region of nucleotide sequence encoding a mature polypeptide" as used herein means the region of a nucleotide sequence counting from the triplet encoding the first amino acid of a mature polypeptide to the last triplet encoding the last amino acid of a mature polypeptide.
[0039] The term "GH" as used about certain enzymes of the present invention, as for example "GH10", is a family classification system for glycosyl hydrolase enzymes made by B. Henrissat. The number following the GH each denotes distinct families. This classification system is well known to the skilled person. See Henrissat, 1991, A classification of glycosyl hydrolases based on amino-acid sequence similarities, Biochem. J. 280:309-316; Henrissat and Bairoch, 1993, New families in the classification of glycosyl hydrolases based on amino-acid sequence similarities, Biochem. J. 293:781-788; Henrissat and Bairoch, 1996, Updating the sequence-based classification of glycosyl hydrolases, Biochem. J. 316:695-696; Davies and Henrissat, 1995, Structures and mechanisms of glycosyl hydrolases, Structure 3:853-859.
Polypeptides of the Invention
[0040] The polypeptides of the invention are all polypeptides secreted by Botryosphaeria rhodina CBS 274.96 with the purpose of serving a function for that particular cell.
[0041] Among the thousands of potential genes in the genome of Botryosphaeria rhodina CBS 274.96 the polynucleotides of this genome encoded 21 secreted functional mature polypeptides comprised in group BPolypeptide, which were determined to be functional, that is translated into functional polypeptides and secreted by the chosen host cell.
[0042] Accordingly, Botryosphaeria rhodina CBS 274.96 expresses and secretes the functional mature polypeptides comprised in group BPolypeptide, and in the genome of that particular strain, the regions of sequences of group ADNA, encoding a mature polypeptide are the genes encoding the mature polypeptides comprised in the sequences of group BPolypeptide. Further in a particular embodiment the genes encoding the mature polypeptides comprised in the sequences of group BPolypeptide can all be expressed and their corresponding mature polypeptides can be secreted when culturing an E. coli host transformed with polynucleotides comprising those regions of the sequences of group ADNA encoding a mature polypeptide. By comparing homology or identity of the sequences of the 21 polypeptide sequences to known sequences the particular function of the polypeptides were annotated. At least 14 of the 21 secreted functional polypeptides were determined to be enzymes and/or enzyme like.
[0043] The invention thus provides an isolated polypeptide selected from the group consisting of:
[0044] (a) a polypeptide having an amino acid sequence which has at least 90% identity with an amino acid sequence selected from the group consisting of the mature polypeptides comprised in group BPolypeptide and
[0045] (b) a polypeptide which is encoded by a nucleotide sequence which hybridize under high stringency conditions with a polynucleotide probe selected from the group consisting of [0046] (i) the complementary strand to a nucleotide sequence selected from the group consisting of the regions of group ADNA sequences encoding a mature polypeptide, [0047] (ii) the complementary strand to the cDNA sequence contained in a nucleotide sequences selected from the group consisting of the regions of group ADNA sequences encoding a mature polypeptide; wherein the polypeptide exhibits the function of the corresponding mature polypeptides of group BPolypeptide.
[0048] In one particular embodiment the polypeptide of the invention is selected among the enzymes secreted by Botryosphaeria rhodina deposited under CBS accession No. 274.96 and isolated by the present inventors, i.e., the group of enzymes consisting of xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase.
[0049] The invention also provides an isolated enzyme selected from the group consisting of:
[0050] (a) an enzyme comprising an amino acid sequence which has at least 90% identity with the amino acid sequence of a mature enzyme selected from the group consisting of xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase secreted from the strain of Botryosphaeria rhodina deposited under CBS accession No. 274.96 and
[0051] (b) a polypeptide which is encoded by a nucleotide sequence which hybridize under high stringency conditions with a polynucleotide probe selected from the group consisting of [0052] (i) the complementary strand to a nucleotide sequence comprised in the strain of Botryosphaeria rhodina deposited under CBS accession No. 274.96 encoding a mature enzyme selected from the group consisting of xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase secreted from that strain; [0053] ii) the complementary strand to the cDNA sequence contained in a nucleotide sequences comprised in the strain of Botryosphaeria rhodina deposited under CBS accession No. 274.96 encoding a mature enzyme selected from the group consisting of xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B
[0054] polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase secreted from that strain and
wherein the enzyme have a function selected from xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase.
[0055] In a particular embodiment the enzyme is an isolated enzyme selected from the group consisting of:
[0056] (a) an enzyme having an amino acid sequence which has at least 90% identity with an amino acid sequence selected from mature enzymes comprised in the sequences of group DPolypeptide and
[0057] (b) an enzyme which is encoded by a nucleotide sequence which hybridize under high stringency conditions with a polynucleotide probe selected from the group consisting of [0058] (i) the complementary strand to a nucleotide sequence selected from the group consisting of the regions of group EDNA sequences encoding a mature enzyme, [0059] (ii) the complementary strand to the cDNA sequence contained in a nucleotide sequences selected from the group consisting of the regions of group EDNA sequences encoding a mature enzyme; wherein the enzyme exhibits the function of the corresponding mature enzyme of group DPolypeptide.
[0060] The polypeptide of the invention is an isolated polypeptide, preferably the preparation of the polypeptide of the invention contains at the most 90% by weight of other polypeptide material with which it may be natively associated (lower percentages of other polypeptide material are preferred, e.g., at the most 80% by weight, at the most 60% by weight, at the most 50% by weight, at the most 40% at the most 30% by weight, at the most 20% by weight, at the most 10% by weight, at the most 9% by weight ,at the most 8% by weight, at the most 6% by weight, at the most 5% by weight, at the most 4% at the most 3% by weight, at the most 2% by weight, at the most 1% by weight and at the most %% by weight). Thus, it is preferred that the isolated polypeptide of the invention is at least 92% pure, i.e., that the polypeptide of the invention constitutes at least 92% by weight of the total polypeptide material present in the preparation, and higher percentages are preferred such as at least 94% pure, at least 95% pure, at least 96% pure, at least 96% pure, at least 97% pure, at least 98% pure, at least 99%, and at the most 99.5% pure. In particular, it is preferred that the polypeptide of the invention is in "essentially pure form", i.e., that the polypeptide preparation is essentially free of other polypeptide material with which it is natively associated. This can be accomplished, for example, by preparing the polypeptide of the invention by means of well-known recombinant methods.
[0061] The polypeptide of the invention of the invention may be synthetically made, naturally occurring or a combination thereof. In a particular embodiment the polypeptide of the invention may be obtained from a microorganism such as a prokaryotic cell, an archaeal cell or a eukaryotic cell. The cell may further have been modified by genetic engineering
[0062] In a particular embodiment, the polypeptide of the invention is an enzyme exhibiting optimum enzyme activity at a temperature within the range from about 10° C. to about 80° C., particularly in the range from about 20° C. to about 60° C.
[0063] In a particular embodiment the polypeptide of the invention is an enzyme, which is functionally stabile at a temperature of up to 100° C., in particular up to 80° C., more particularly up to 60° C.
[0064] In a particular embodiment the polypeptide of the invention is an enzyme exhibiting at least 20%, in particular at least 40%, such as at least 50%, in particular at least 60%, such as at least 70%, more particularly at least 80%, such as at least 90%, most particularly at least 95%, such as about or at least 100% of the enzyme activity of an enzyme selected from mature enzymes comprised in group BPolypeptide.
[0065] In a particular embodiment the polypeptide of the invention comprises, contains or consists of an amino acid sequence which has at least 90% identity with a polypeptide sequence selected from the group consisting of mature polypeptides comprised in group BPolypeptide; particularly at least 95%, e.g., at least 96%, such as at least 97%, and even more particularly at least 98%, such as at least 99% or even 100% identity.
[0066] In another particular embodiment the polypeptide of the invention comprises, contains or consists of an amino acid sequence, which has at least 50% identity with a polypeptide sequence selected from the group consisting of mature polypeptides comprised in group BPolypeptide; particularly at least 60%, particularly at least 65%, particularly at least 70%, particularly at least 75%, particularly at least 80%, and even more particularly at least 85% identity.
[0067] In a particular embodiment, the amino acid sequence of the polypeptide of the invention differs by at the most ten amino acids (e.g., by ten amino acids), in particular by at the most five amino acids (e.g., by five amino acids), such as by at the most four amino acids (e.g., by four amino acids), e.g., by at the most three amino acids (e.g., by three amino acids), in particular by at the most two amino acids (e.g., by two amino acids), such as by one amino acid from the mature polypeptides comprised in group BPolypeptide.
[0068] The polypeptide of the invention may be a wild-type polypeptide isolated from a natural source such as the strain Botryosphaeria rhodina CBS 274.96 or another wild type strain, however the present invention also encompass artificial variants, where a polypeptide of the invention has been mutated for example by adding, substituting and/or deleting one or more amino acids from said polypeptide while retaining the function of the polypeptide and/or other properties.
[0069] Hence, the polypeptide of the invention may be an artificial variant, wherein at least one substitution, deletion and/or insertion of an amino acid has been made to an amino acid sequence comprising or consisting of the mature polypeptide comprised in group BPolypeptide.
[0070] The polypeptides of the invention also include functional fragments of the amino acid sequences described herein and nucleic acids encoding functional fragments of the amino acid sequences described herein, including fragments of the mature enzymes secreted from the strain of Botryosphaeria rhodina deposited under CBS accession No. 274.96, as described herein, including fragment of an enzyme selected from the group consisting of xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase secreted from the strain of Botryosphaeria rhodina deposited under CBS accession No. 274.96.
[0071] Artificial variants may be constructed by standard techniques known in the art usually followed by screening and/or characterization. Standard techniques includes classical mutagenesis, e.g., by UV irradiation of the cells or treatment of cells with chemical mutagens as described by Gerhardt et al. (1994); in vivo gene shuffling as described in WO 97/07205; in vitro shuffling as described by Stemmer (1994) or WO 95/17413, random mutagenesis as described by Eisenstadt et al. (1994); PCR techniques as described by Poulsen et al. (1991); family shuffling as described by Ness, et al, 1999, Nature Biotechnology. 17: 893-896; site-directed mutagenesis as described by Sambrook et al., 1989, Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor, N.Y. A general description of nucleotide substitution can be found in, e.g., Ford et al., 1991, Protein Expression and Purification 2: 95-107.
[0072] Such standard genetic engineering methods may also be used prepare a diversified library of variant nucleotide sequences from the genes encoding one or more parent enzymes of the invention, expressing the enzyme variants in a suitable host cell and selecting a preferred variant(s). A diversified library can be established by a range of techniques known to the art (Reetz M T; Jaeger K E, in Biocatalysis--from Discovery to Application edited by Fessner W D, Vol. 200, pp. 31-57 (1999); Stemmer, 1994, Nature 370: 389-391, 1994; Zhao and Arnold, 1997, Proc. Natl. Acad. Sci. USA 94: 7997-8000; or Yano et al., 1998, Proc. Natl. Acad. Sci. USA 95: 5511-5515).
[0073] In a particular embodiment of the invention, amino acid changes (in the artificial variant as well as in wild-type enzyme) are of a minor nature, that is conservative amino acid substitutions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of one to about 30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to about 20-25 residues; or a small extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding domain.
[0074] Examples of conservative substitutions are within the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine, valine and methionine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine and threonine). Amino acid substitutions which do not generally alter and or impair the function of a protein are known in the art and are described, for example, by H. Neurath and R. L. Hill, 1979, In, The Proteins, Academic Press, New York. The most commonly occurring exchanges are Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly as well as these in reverse.
[0075] In a particular embodiment the amino acid changes are of such a nature that the physico-chemical properties of the polypeptides are altered. For example, amino acid changes may be performed, which improve the thermal stability of the enzyme, which alter the substrate specificity, which changes the pH optimum, and the like.
[0076] Particularly, the number of such substitutions, deletions and/or insertions in the polypeptide of the invention, particularly in those polypeptides selected from the group consisting of mature polypeptides comprised in group BPolypeptide to produce an artificial variant is at the most 10, such as at the most 9, e.g., at the most 8, more preferably at the most 7, e.g., at the most 6, such as at the most 5, most preferably at the most 4, e.g., at the most 3, such as at the most 2, in particular at the most 1.
[0077] In a particular embodiment the artificial variant is a variant, which has an altered, preferably reduced, immunogenicity, especially allergenicity, in animals including man as compared to a parent enzyme. The term "immunogenicity" in this context is to be understood as the artificial variant capability of invoking a an altered, in particular reduced, immunological response when administered to an animal, including intravenous, cutaneous, subcutaneous, oral and intratracheal administration. The term "immunological response" in this context means that the administration of the artificial variant causes an alteration in the immunoglobulin levels in the animal body, such as in IgE, IgG and IgM or an alteration in the cytokine level in the animal body. Methods for mapping immunogenic/antigenic epitopes of a protein, preparing variants with altered immunogenicity and methods for measuring an immunological response is well known to the art and are described in, e.g., WO 92/10755, WO 00/26230, WO 00/26354 and WO 01/31989. The term "allergenicity" in this context is to be understood as the artificial variant ability of invoking an altered, in particular reduced, production of IgE in an animal as well as the ability to bind IgE from said animal. Particularly allergenicity arising from intratracheal administration of the polypeptide variant to the animal is particularly of interest (also known as respiratory allergenicity).
[0078] In a further embodiment, the polypeptide of the invention is a polypeptide which is encoded by nucleotide sequences which hybridize under at least high stringency conditions, particularly under very high stringency conditions with a polynucleotide probe selected from the group consisting of
[0079] (i) the complementary strand to a nucleotide sequence selected from the group consisting of the regions of group ADNA sequences encoding a mature polypeptide,
[0080] (ii) the complementary strand to the cDNA sequence contained in a nucleotide sequences selected from the group consisting of the regions of group ADNA sequences encoding a mature polypeptide;
[0081] (iii) a fragment of (i) or (ii) encoding a secreted polypeptide having the function of the corresponding mature polypeptide comprised in group BPolypeptide.
(Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, N.Y.).
[0082] In particular, the polypeptide of the invention is encoded by a polynucleotide comprising a nucleotide sequence selected from the group of regions of group ADNA sequences encoding a mature polypeptide or a sequences differing there from by virtue of the degeneracy of the genetic code. More particularly, the polypeptide of the invention is encoded by a polynucleotide consisting of a nucleotide sequence selected from the group of regions of group ADNA sequences encoding a mature polypeptide or a sequence differing there from by virtue of the degeneracy of the genetic code.
[0083] The nucleotide sequences of regions of group ADNA sequences encoding a mature polypeptide or a subsequence thereof, as well as the amino acid sequences of the mature polypeptides comprised in group BPolypeptide or a fragment thereof, may be used to design a polynucleotide probe to identify and clone DNA encoding enzymes of the invention from strains of different genera or species according to methods well known in the art. In particular, such probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein. Such probes can be considerably shorter than the entire sequence, but should be at least 15, preferably at least 25, more preferably at least 35 nucleotides in length, such as at least 70 nucleotides in length. It is; however, preferred that the polynucleotide probe is at least 100 nucleotides in length. For example, the polynucleotide probe may be at least 200 nucleotides in length, at least 300 nucleotides in length, at least 400 nucleotides in length or at least 500 nucleotides in length. Even longer probes may be used, e.g., polynucleotide probes which are at least 600 nucleotides in length, at least 700 nucleotides in length, at least 800 nucleotides in length, or at least 900 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labelled for detecting the corresponding gene (for example, with 32P, 3H, 35S, biotin, or avidin).
[0084] Thus, a genomic DNA or cDNA library prepared from such other organisms may be screened for DNA, which hybridizes with the probes described above and which encodes enzymes of the invention. Genomic or other DNA from such other organisms may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA may be transferred to, and immobilized, on nitrocellulose or other suitable carrier materials. In order to identify a clone or DNA which has the required homology and/or identity or is homologous and/or identical with nucleotides selected from regions of group ADNA sequences encoding a mature polypeptide, the carrier material with the immobilized DNA is used in a Southern blot.
[0085] For purposes of the present invention, hybridization indicates that the nucleotide sequence hybridizes to a labelled polynucleotide probe which again hybridizes to a nucleotide sequence selected from regions of group ADNA sequences encoding a mature polypeptide under high to very high stringency conditions. Molecules to which the polynucleotide probe hybridizes under these conditions may be detected using X-ray film or by any other method known in the art. Whenever the term "polynucleotide probe" is used in the present context, it is to be understood that such a probe contains at least 15 nucleotides.
[0086] In an interesting embodiment, the polynucleotide probe is the complementary strand of a nucleotide sequence selected from regions of group ADNA sequences encoding a mature polypeptide.
[0087] In another interesting embodiment, the polynucleotide probe is the complementary strand of a nucleotide sequence which encodes an enzyme selected from group BPolypeptide. In a further interesting embodiment, the polynucleotide probe is the complementary strand of a mature polypeptide coding region of a nucleotide sequence selected from regions of group ADNA sequences encoding a mature polypeptide.
[0088] For long probes of at least 100 nucleotides in length, high to very high stringency conditions are defined as pre-hybridization and hybridization at 42° C. in 5×SSPE, 1.0% SDS, 5× Denhardt's solution, 100 microgram/ml sheared and denatured salmon sperm DNA, following standard Southern blotting procedures. Preferably, the long probes of at least 100 nucleotides do not contain more than 1000 nucleotides. For long probes of at least 100 nucleotides in length, the carrier material is finally washed three times each for 15 minutes using 0.1×SSC, 0.1% SDS at 60° C. (high stringency), in particular washed three times each for 15 minutes using 0.1×SSC, 0.1% SDS at 68° C. (very high stringency).
[0089] Although not particularly preferred, it is contemplated that shorter probes, e.g., probes which are from about 15 to 99 nucleotides in length, such as from about 15 to about 70 nucleotides in length, may be also be used. For such short probes, stringency conditions are defined as pre-hybridization, hybridization, and washing post-hybridization at 5° C. to 10° C. below the calculated Tm using the calculation according to Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48:1390) in 0.9 M NaCl, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% NP-40, 1× Denhardt's solution, 1 mM sodium pyrophosphate, 1 mM sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mg of yeast RNA per ml following standard Southern blotting procedures.
[0090] For short probes which are about 15 nucleotides to 99 nucleotides in length, the carrier material is washed once in 6×SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6×SSC at 5° C. to 10° C. below the calculated Tm.
SEQ ID NO: 2 Xylanase GH10
[0091] In a particular embodiment the polypeptide of the invention is a GH10 xylanase comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with a GH10 xylanase obtainable from Botryosphaeria rhodina, in particular that strain of Botryosphaeria rhodina deposited under deposit accession number CBS 274.96, more particularly the mature GH10 xylanase comprised in SEQ ID NO: 2. More specifically the mature GH10 xylanase comprise or consists of the sequences from position 1 to 291 of SEQ ID NO: 2. In the present context a GH10 xylanase is defined as an enzyme beloning to the EC 3.2.1.8 enzyme activity grouping. This grouping endohydrolyzes 1,4-β-D-xylosidic linkages in xylans. The glycoside hydrolase family 10 (GH10) also comprises enzymes with two other known activities; endo-1,3-beta-xylanase (EC: 3.2.1.32); cellobiohydrolase (EC: 3.2.1.91).
SEQ ID NO: 4 Xylanase GH11
[0092] In a particular embodiment the polypeptide of the invention is a GH11 xylanase comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with a xylanase GH11 obtainable from Botryosphaeria rhodina, in particular that strain of Botryosphaeria rhodina deposited under deposit accession number CBS 274.96, more particularly the mature GH11 xylanase comprised in SEQ ID NO: 4. More specifically the mature GH11 xylanase comprise or consists of the sequences from position 1 to 202 of SEQ ID NO: 4. In the present context a GH11 xylanase is defined as an enzyme beloning to the EC 3.2.1.8 enzyme activity grouping. This grouping endohydrolyzes 1,4-β-D-xylosidic linkages in xylans. Glycoside hydrolase family 11 (GH11) comprises enzymes with only one known activity; xylanase (EC: 3.2.1.8).
SEQ ID NO: 6 Serine Esterase
[0093] In a particular embodiment the polypeptide of the invention is a serine esterase, in particular a cutinase or a lipase or a carboxyesterase comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with a serine esterase obtainable from Botryosphaeria rhodina, in particular that strain of Botryosphaeria rhodina deposited under deposit accession number CBS 274.96, more particularly the mature serine esterase comprised in SEQ ID NO: 6. More specifically the mature serine esterase comprise or consists of the sequences from position 1 to 352 of SEQ ID NO: 6. In the present context a serine esterase is defined as an enzyme capable of hydrolyzing soluble esters in solution (esters which are not in micelle form). More specifically the serin esters are enzymes acting as cutinase (EC 3.1.1.50) or lipase (EC.3.1.1.3) or carboxyesterase capable of hydrolyzing wax-esters, cutin, tracyl fats, oils and/or fatty acid chains. In particular the serine esterases contain the classical Ser, His, Asp triad of serine hydrolase, such as tri-acyl lipase/cutinase.
SEQ ID NO: 8 Candida B Type Lipase
[0094] In a particular embodiment the polypeptide of the invention is a Candida B type lipase (EC 3.1.1.3) comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with a Candida B type Lipase obtainable from Botryosphaeria rhodina, in particular that strain of Botryosphaeria rhodina deposited under deposit accession number CBS 274.96, more particularly the mature Candida B type Lipase comprised in SEQ ID NO: 8. More specifically the mature Candida B type Lipase comprise or consists of the sequences from position 1 to 431 of SEQ ID NO: 8. In the present context the Candida B type Lipase is defined as an enzyme capable of hydrolyzing triglycerides to diacyl glycerides and fatty acid anions, in particular triacylglycerol to diacylglycerol and a fatty acid anion.
SEQ ID NO: 10 Peroxidase
[0095] In a particular embodiment the polypeptide of the invention is a peroxidase comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with a peroxidase obtainable from Botryosphaeria rhodina, in particular that strain of Botryosphaeria rhodina deposited under deposit accession number CBS 274.96, more particularly the mature peroxidase comprised in SEQ ID NO: 10. More specifically the mature peroxidase comprises or consists of the sequences from position 1 to 185 of SEQ ID NO: 10. In the present context a peroxidase is defined as an enzyme belonging to defined as a group of enzymes that catalyze oxidation-reduction reactions. As such, they are classified as oxidoreductases. They are given the official EC number 1.11.1. Peroxidases reduce H2O2 to water while oxidizing a variety of substrates. Thus, peroxidases are oxidoreductases which use H2O2 as electron acceptor for catalyzing different oxidative reactions.
SEQ ID NO: 12 GH61A Polypeptide
[0096] In a particular embodiment the polypeptide of the invention is a GH61A polypeptide comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with a GH61A polypeptide obtainable from Botryosphaeria rhodina, in particular that strain of Botryosphaeria rhodina deposited under deposit accession number CBS 274.96, more particularly the mature GH61A polypeptide comprised in SEQ ID NO: 12. More specifically the mature GH61A polypeptide comprises or consists of the sequences from position 1 to 218 of SEQ ID NO: 12. In the present context a GH 61A polypeptide is defined as a secreted polypeptide or protein providing one or more of the group of effects selected from: [0097] 1) Enhancing degradation of cellulosic materials when used in conjunction with a cellulase or a mixture of cellulases. [0098] 2) Increasing solubility of enzymes. [0099] 3) Increasing the stability of enzymes [0100] 4) Reducing enzyme inhibition.
SEQ ID NO: 14 GH 61B Polypeptide
[0101] In a particular embodiment the polypeptide of the invention is a GH 61B polypeptide comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with a GH 61B polypeptide obtainable from Botryosphaeria rhodina, in particular that strain of Botryosphaeria rhodina deposited under deposit accession number CBS 274.96, more particularly the mature GH 61B polypeptide comprised in SEQ ID NO: 14. More specifically the mature GH 61B polypeptide comprises or consists of the sequences from position 1 to 249 of SEQ ID NO: 14. In the present context a GH 61B polypeptide is defined as a secreted polypeptide or protein providing one or more of the group of effects selected from: [0102] 1) Enhancing degradation of cellulosic materials when used in conjunction with a cellulase or a mixture of cellulases. [0103] 2) Increasing solubility of enzymes. [0104] 3) Increasing the stability of enzymes
SEQ ID NO: 16 GH 61C Polypeptide
[0105] In a particular embodiment the polypeptide of the invention is a GH 61C polypeptide comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with a GH 61C polypeptide obtainable from Botryosphaeria rhodina, in particular that strain of Botryosphaeria rhodina deposited under deposit accession number CBS 274.96, more particularly the mature GH 61C polypeptide comprised in SEQ ID NO: 16. More specifically the mature GH 61C polypeptide comprises or consists of the sequences from position 1 to 255 of SEQ ID NO: 16. In the present context a GH 61C polypeptide is defined as a secreted polypeptide or protein providing one or more of the group of effects selected from: [0106] 1) Enhancing degradation of cellulosic materials when used in conjunction with a cellulase or a mixture of cellulases. [0107] 2) Increasing solubility of enzymes. [0108] 3) Increasing the stability of enzymes
SEQ ID NO: 18 GH 61D Polypeptide
[0109] In a particular embodiment the polypeptide of the invention is a GH 61D polypeptide comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with a GH 61D polypeptide obtainable from Botryosphaeria rhodina, in particular that strain of Botryosphaeria rhodina deposited under deposit accession number CBS 274.96, more particularly the mature GH 61D polypeptide comprised in SEQ ID NO: 18. More specifically the mature GH 61D polypeptide comprises or consists of the sequences from position 1 to 205 of SEQ ID NO: 18. In the present context a GH 61C polypeptide is defined as a secreted polypeptide or protein providing one or more of the group of effects selected from: [0110] 1) Enhancing degradation of cellulosic materials when used in conjunction with a cellulase or a mixture of cellulases. [0111] 2) Increasing solubility of enzymes. [0112] 3) Increasing the stability of enzymes
SEQ ID NO:20 Functional Polypeptide
[0113] In a particular embodiment the polypeptide of the invention is a functional polypeptide comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with SEQ ID NO: 20. In particular with the mature functional polypeptide comprised in SEQ ID NO: 20. More specifically the mature functional polypeptide comprises or consists of the sequences from position 1 to 243 of SEQ ID NO: 20.
SEQ ID NO: 22 Functional Polypeptide
[0114] In a particular embodiment the polypeptide of the invention is a functional polypeptide comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with SEQ ID NO: 22. In particular with the mature functional polypeptide comprised in SEQ ID NO: 22. More specifically the mature functional polypeptide comprises or consists of the sequences from position 1 to 415 of SEQ ID NO: 22.
SEQ ID NO: 24 Functional Polypeptide
[0115] In a particular embodiment the polypeptide of the invention is a functional polypeptide comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with SEQ ID NO: 24. In particular with the mature functional polypeptide comprised in SEQ ID NO: 24. More specifically the mature functional polypeptide comprises or consists of the sequences from position 1 to 377 of SEQ ID NO: 24.
SEQ ID NO: 26 Functional Polypeptide
[0116] In a particular embodiment the polypeptide of the invention is a functional polypeptide comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with SEQ ID NO: 26. In particular with the mature functional polypeptide comprised in SEQ ID NO: 26. More specifically the mature functional polypeptide comprises or consists of the sequences from position 1 to 259 of SEQ ID NO: 26.
SEQ ID NO: 28 Functional Polypeptide
[0117] In a particular embodiment the polypeptide of the invention is a functional polypeptide comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with SEQ ID NO: 28. In particular with the mature functional polypeptide comprised in SEQ ID NO: 28. More specifically the mature functional polypeptide comprises or consists of the sequences from position 1 to 248 of SEQ ID NO: 28.
SEQ ID NO: 30 Functional Polypeptide
[0118] In a particular embodiment the polypeptide of the invention is a functional polypeptide comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with SEQ ID NO: 30. In particular with the mature functional polypeptide comprised in SEQ ID NO: 30. More specifically the mature functional polypeptide comprises or consists of the sequences from position 1 to 149 of SEQ ID NO: 30.
SEQ ID NO: 32 Functional Polypeptide
[0119] In a particular embodiment the polypeptide of the invention is a functional polypeptide comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with SEQ ID NO: 32. In particular with the mature functional polypeptide comprised in SEQ ID NO: 32. More specifically the mature functional polypeptide comprises or consists of the sequences from position 1 to 202 of SEQ ID NO: 32.
SEQ ID NO: 34 Beta-Glucosidase
[0120] In a particular embodiment the polypeptide of the invention is a beta-glucosidase comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with a beta-glucosidase obtainable from Botryosphaeria rhodina, in particular that strain of Botryosphaeria rhodina deposited under deposit accession number CBS 274.96, more particularly the mature beta-glucosidase comprised in SEQ ID NO: 34. More specifically the mature beta-glucosidase comprise or consists of the sequences from position 1 to 603 of SEQ ID NO: 34. In the present context the beta-glucosidase is defined as a beta-D-glucoside glucohydrolase (E.C. 3.2.1.21) which catalyzes the hydrolysis of terminal non-reducing beta-D-glucose residues with the release of beta-D-glucose. For purposes of the present invention, beta-glucosidase activity is determined according to the basic procedure described by Venturi et al., 2002, J. Basic Microbiol. 42: 55-66, except different conditions were employed as described herein. One unit of beta-glucosidase activity is defined as 1.0 micromole of p-nitrophenol produced per minute at 50° C., pH 5 from 4 mM p-nitrophenyl-beta-D-glucopyranoside as substrate in 100 mM sodium citrate, 0.01% Tween-20.
SEQ ID NO: 36 Endo-Arabinase
[0121] In a particular embodiment the polypeptide of the invention is a endo-arabinase comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with a endo-arabinase obtainable from Botryosphaeria rhodina, in particular that strain of Botryosphaeria rhodina deposited under deposit accession number CBS 274.96, more particularly the mature endo-arabinase comprised in SEQ ID NO: 36. More specifically the mature endo-arabinase comprises or consists of the sequences from position 1 to 301 of SEQ ID NO: 36. In the present context an endo-arabinase is defined as an enzyme capable of hydrolyzing arabinan.
SEQ ID NO: 38 Endo-Arabinase
[0122] In a particular embodiment the polypeptide of the invention is a endo-arabinase comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with a endo-arabinase obtainable from Botryosphaeria rhodina, in particular that strain of Botryosphaeria rhodina deposited under deposit accession number CBS 274.96, more particularly the mature endo-arabinase comprised in SEQ ID NO: 38. More specifically the mature endo-arabinase comprises or consists of the sequences from position 1 to 438 of SEQ ID NO: 38. In the present context an endo-arabinase is defined as an enzyme capable of hydrolyzing arabinan.
SEQ ID NO: 40 A1 Pepsin Peptidase
[0123] In a particular embodiment the polypeptide of the invention is a pepsin peptidase comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with a pepsin peptidase obtainable from Botryosphaeria rhodina, in particular that strain of Botryosphaeria rhodina deposited under deposit accession number CBS 274.96, more particularly the mature pepsin peptidase comprised in SEQ ID NO: 40. More specifically the mature pepsin peptidase comprises or consists of the sequences from position 1 to 396 of SEQ ID NO: 40. In the present context a pepsin peptidase is defined as an enzyme capable of hydrolyzing proteins or peptides.
SEQ ID NO: 42 M43 Pepsin Peptidase
[0124] In a particular embodiment the polypeptide of the invention is a pepsin peptidase comprising or consisting of an amino acid sequence which has at least 90%, particularly at least 95%, more particularly at least 96%, more particularly at least 97%, more particularly at least 98%, more particularly at least 99% or most particularly 100% identity with a pepsin peptidase obtainable from Botryosphaeria rhodina, in particular that strain of Botryosphaeria rhodina deposited under deposit accession number CBS 274.96, more particularly the mature pepsin peptidase comprised in SEQ ID NO: 42. More specifically the mature pepsin peptidase comprises or consists of the sequences from position 1 to 262 of SEQ ID NO: 42. In the present context a Pepsin peptidase is defined as an enzyme capable of hydrolyzing proteins or peptides.
Polynucleotides
[0125] The present invention also relates to polynucleotides comprising or consisting of a nucleotide sequence encoding a polypeptide of the invention. In a particular embodiment, the nucleotide sequence is set forth in the sequences of group ADNA including nucleotide sequences differing there from by virtue of the degeneracy of the genetic code. In a further embodiment the polynucleotide of the invention is a modified nucleotide sequence which comprises or consists of a nucleotide sequence selected from the the regions of group ADNA sequences encoding a mature polypeptide and which comprises at least one modification/mutation compared with the parent nucleotide sequence comprised in the sequences of group ADNA.
[0126] The techniques used to isolate and/or clone a nucleotide sequence encoding an enzyme are known in the art and include isolation from genomic DNA, preparation from cDNA, or a combination thereof. The cloning of the nucleotide sequences of the present invention from such genomic DNA can be effected, e.g., by using the well known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cloned DNA fragments with shared structural features. See, e.g., Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other amplification procedures such as ligase chain reaction (LCR), ligated activated transcription (LAT) and nucleotide sequence-based amplification (NASBA) may be used.
[0127] The nucleotide sequence may be obtained by standard cloning procedures used in genetic engineering to relocate the nucleotide sequence from its natural location to a different site where it will be reproduced. The cloning procedures may involve excision and isolation of a desired fragment comprising the nucleotide sequence encoding the polypeptide, insertion of the fragment into a vector molecule, and incorporation of the recombinant vector into a host cell where multiple copies or clones of the nucleotide sequence will be replicated. The nucleotide sequence may be of genomic, cDNA, RNA, semi-synthetic, synthetic origin, or any combinations thereof.
[0128] In particular the polynucleotide comprises, preferably consists of, a nucleotide sequence which has at least 50% identity with a nucleotide sequence selected from the regions of group ADNA sequences encoding a mature polypeptide. Particularly, the nucleotide sequence has at least 65% identity, more particularly at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with a nucleotide sequence selected from the regions of group ADNA sequences encoding a mature polypeptide. Particularly, the nucleotide sequence comprises a nucleotide sequence selected from the regions of group ADNA sequences encoding a mature polypeptide. In an even more particular embodiment, the nucleotide sequence consists of a nucleotide sequence selected from the regions of group ADNA sequences encoding a mature polypeptide.
[0129] In particular the polynucleotide comprises, preferably consists of, a nucleotide sequence encoding a mature enzyme selected from xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase and which has at least 50% identity, particularly at least 65% identity, more particularly at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with a nucleotide sequence encoding a mature enzyme selected from xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase secreted from Botryosphaeria rhodina deposited under CBS accession No. 274.96 and isolated by the present inventors.
[0130] In a particular embodiment the polynucleotide comprises, preferably consists of, a nucleotide sequence encoding a mature enzyme selected from xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase and which has at least 50% identity, particularly at least 65% identity, more particularly at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with a nucleotide sequence encoding a mature enzyme selected from the group DPolypeptide sequences.
[0131] In a particular embodiment the polynucleotide comprises, preferably consists of, a nucleotide sequence encoding a mature enzyme selected from xylanase, serine esterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase, endo-arabinase and pepsin peptidase and which has at least 50% identity, particularly at least 65% identity, more particularly at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with a nucleotide sequence selected from EDNA sequences.
SEQ ID NO: 1
[0132] In a particular embodiment the polynucleotide of the invention encodes a GH 10 xylanase and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 55 to 927 of SEQ ID NO: 1.
SEQ ID NO: 3
[0133] In a particular embodiment the polynucleotide of the invention encodes a GH11 xylanase and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 58 to 663 of SEQ ID NO: 3.
SEQ ID NO: 5
[0134] In a particular embodiment the polynucleotide of the invention encodes a serine esterase and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 55 to 1110 of SEQ ID NO: 5.
SEQ ID NO: 7
[0135] In a particular embodiment the polynucleotide of the invention encodes a lipase and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 55 to 1347 of SEQ ID NO: 7.
SEQ ID NO: 9
[0136] In a particular embodiment the polynucleotide of the invention encodes a peroxidase and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 1 to 555 of SEQ ID NO: 9.
SEQ ID NO: 11
[0137] In a particular embodiment the polynucleotide of the invention encodes a GH61A polypeptide and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 49 to 702 of SEQ ID NO: 11.
SEQ ID NO: 13
[0138] In a particular embodiment the polynucleotide of the invention encodes a GH 61B polypeptide and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 40 to 786 of SEQ ID NO: 13.
SEQ ID NO: 15
[0139] In a particular embodiment the polynucleotide of the invention encodes a GH 61C polypeptide and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 55 to 819 of SEQ ID NO: 15.
SEQ ID NO: 17
[0140] In a particular embodiment the polynucleotide of the invention encodes a GH 61D polypeptide and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 61 to 675 of SEQ ID NO: 17.
SEQ ID NO: 19
[0141] In a particular embodiment the polynucleotide of the invention encodes a mature functional polypeptide and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 1 to 729 of SEQ ID NO: 19.
SEQ ID NO: 21
[0142] In a particular embodiment the polynucleotide of the invention encodes a mature functional polypeptide and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 55 to 1299 of SEQ ID NO: 21.
SEQ ID NO: 23
[0143] In a particular embodiment the polynucleotide of the invention encodes a mature functional polypeptide and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 49 to 1179 of SEQ ID NO: 23.
SEQ ID NO: 25
[0144] In a particular embodiment the polynucleotide of the invention encodes a mature functional polypeptide and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 70 to 846 of SEQ ID NO: 25.
SEQ ID NO: 27
[0145] In a particular embodiment the polynucleotide of the invention encodes mature functional polypeptide and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 58 to 801 of SEQ ID NO: 27.
SEQ ID NO: 29
[0146] In a particular embodiment the polynucleotide of the invention encodes a mature functional polypeptide and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 157 to 603 of SEQ ID NO: 29.
SEQ ID NO: 31
[0147] In a particular embodiment the polynucleotide of the invention encodes a mature functional polypeptide and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 55 to 660 of SEQ ID NO: 31.
SEQ ID NO: 33
[0148] In a particular embodiment the polynucleotide of the invention encodes a beta-glucosidase and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 46 to 1854 of SEQ ID NO: 33.
SEQ ID NO: 35
[0149] In a particular embodiment the polynucleotide of the invention encodes a endo-arabinase and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 64 to 966 of SEQ ID NO: 35.
SEQ ID NO: 37
[0150] In a particular embodiment the polynucleotide of the invention encodes a endo-arabinase and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 55 to 1368 of SEQ ID NO: 37.
SEQ ID NO: 39
[0151] In a particular embodiment the polynucleotide of the invention encodes a pepsin protease and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 61 to 1248 of SEQ ID NO: 39.
SEQ ID NO: 41
[0152] In a particular embodiment the polynucleotide of the invention encodes a pepsin protease and comprises or consists of an nucleotide sequence which has at least 70% identity, more particularly at least 80% identity, more particularly at least 90% identity, more particularly at least 95% identity, more particularly at least 96% identity, more particularly at least 97% identity, more particularly at least 98% identity, more particularly at least 99% identity or most particularly 100% identity with the nucleotide sequence of position 64 to 849 of SEQ ID NO: 41.
[0153] Modification of a nucleotide sequence encoding a polypeptide of the present invention may be necessary for the synthesis of a polypeptide which comprises an amino acid sequence that has at least one substitution, deletion and/or insertion as compared to an amino acid sequence selected from mature polypeptide comprised in group BPolypeptide.
[0154] It will be apparent to those skilled in the art that such modifications can be made to preserve the function of the enzyme, i.e., made outside regions critical to the function of the enzyme. Amino acid residues which are essential to the function are therefore preferably not subject to modification, such as substitution. Amino acid residues essential to the function may be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham and Wells, 1989, Science 244: 1081-1085). Sites of substrate-enzyme interaction can be determined by analysis of the three-dimensional structure as determined by such techniques as nuclear magnetic resonance analysis, crystallography or photoaffinity labeling (see, e.g., de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, Journal of Molecular Biology 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).
[0155] Moreover, a nucleotide sequence encoding an enzyme of the invention may be modified by introduction of nucleotide substitutions which do not give rise to another amino acid sequence of the enzyme encoded by the nucleotide sequence, but which correspond to the codon usage of the host organism intended for production of the enzyme.
[0156] The introduction of a mutation into the nucleotide sequence to exchange one nucleotide for another nucleotide may be accomplished by site-directed mutagenesis using any of the methods known in the art. Particularly useful is the procedure, which utilizes a super coiled, double stranded DNA vector with an insert of interest and two synthetic primers containing the desired mutation. The oligonucleotide primers, each complementary to opposite strands of the vector, extend during temperature cycling by means of Pfu DNA polymerase. On incorporation of the primers, a mutated plasmid containing staggered nicks is generated. Following temperature cycling, the product is treated with Dpnl, which is specific for methylated and hemimethylated DNA to digest the parental DNA template and to select for mutation-containing synthesized DNA. Other procedures known in the art may also be used. For a general description of nucleotide substitution, one may consult with e.g., Ford et al., 1991, Protein Expression and Purification 2: 95-107.
[0157] The present invention also relates to a polynucleotide comprising, preferably consisting of, a nucleotide sequence which encodes a polypeptide of the invention and which hybridizes under high stringency conditions, preferably under very high stringency conditions with a polynucleotide probe selected from the group consisting of:
[0158] (i) the complementary strand to a nucleotide sequence selected from the group consisting of the regions of group ADNA sequences encoding a mature polypeptide,
[0159] (ii) the complementary strand to the cDNA sequence contained in a nucleotide sequences selected from the group consisting of the regions of group ADNA sequences encoding a mature polypeptide,
[0160] (iii) a fragment of (i) or (ii) encoding a secreted mature polypeptide having the function of the corresponding mature polypeptides comprised in group BPolypeptide (Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, N.Y.).
[0161] As will be understood, details and particulars concerning hybridization of the nucleotide sequences will be the same or analogous to the hybridization aspects discussed in the section titled "polypeptides of the invention" herein.
[0162] The present invention also encompasses a storage medium suitable for use in an electronic device comprising information of the amino acid sequence of polypeptides of the invention or the nucleotide sequences of the polynucleotide of the invention. The storage medium may suitably be a magnetic or optical disk and the electronic device a computing device and the information may in particular be stored on the storage medium in a digital form.
Nucleotide Constructs
[0163] The present invention also relates to nucleic acid constructs comprising a nucleotide sequence of the invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
[0164] A nucleotide sequence encoding an enzyme of the invention may be manipulated in a variety of ways to provide for expression of the enzyme. Manipulation of the nucleotide sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying nucleotide sequences utilizing recombinant DNA methods are well known in the art.
[0165] The control sequence may be an appropriate promoter sequence, a nucleotide sequence that is recognized by a host cell for expression of the nucleotide sequence. The promoter sequence contains transcriptional control sequences, which mediate the expression of the polypeptide. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extra cellular or intracellular polypeptides either homologous or heterologous to the host cell.
[0166] Examples of suitable promoters for directing the transcription of the nucleic acid constructs of the present invention, especially in a bacterial host cell, are the promoters obtained from the E. coli lac operon, Streptomyces coelicolor agarase gene (dagA), Bacillus subtilis levansucrase gene (sacB), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), Bacillus subtilis xylA and xylB genes, and prokaryotic beta-lactamase gene (Villa-Kamaroff et al., 1978, Proceedings of the National Academy of Sciences USA 75: 3727-3731), as well as the tac promoter (DeBoer et al., 1983, Proceedings of the National Academy of Sciences USA 80: 21-25). Further promoters are described in "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242: 74-94; and in Sambrook et al., 1989, supra.
[0167] Examples of suitable promoters for directing the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, and Fusarium oxysporum trypsin-like protease (WO 96/00787), as well as the NA2-tpi promoter (a hybrid of the promoters from the genes for Aspergillus niger neutral alpha-amylase and Aspergillus oryzae triose phosphate isomerase), and mutant, truncated, and hybrid promoters thereof.
[0168] In a yeast host, useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8: 423-488.
[0169] The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the enzyme. Any terminator which is functional in the host cell of choice may be used in the present invention.
[0170] Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha-glucosidase, and Fusarium oxysporum trypsin-like protease.
[0171] Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.
[0172] The control sequence may also be a suitable leader sequence, a non-translated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used in the present invention.
[0173] Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
[0174] Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).
[0175] The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3' terminus of the nucleotide sequence and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence which is functional in the host cell of choice may be used in the present invention.
[0176] Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum trypsin-like protease, and Aspergillus niger alpha-glucosidase.
[0177] Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Molecular Cellular Biology 15: 5983-5990.
[0178] The control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded enzyme into the cell's secretory pathway. The 5' end of the coding sequence of the nucleotide sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted enzyme. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding region which is foreign to the coding sequence. The foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region. Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to enhance secretion of the enzyme. However, any signal peptide coding region which directs the expressed enzyme into the secretory pathway of a host cell of choice may be used in the present invention.
[0179] Effective signal peptide coding regions for bacterial host cells are the signal peptide coding regions obtained from the genes for Bacillus NCIB 11837 maltogenic amylase, Bacillus stearothermophilus alpha-amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis beta-lactamase, Bacillus stearothermophilus neutral proteases (nprT, nprS, nprM), and Bacillus subtilis prsA. Further signal peptides are described by Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.
[0180] Effective signal peptide coding regions for filamentous fungal host cells are the signal peptide coding regions obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Rhizomucor miehei aspartic proteinase, Humicola insolens cellulase, and Humicola lanuginosa lipase.
[0181] Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding regions are described by Romanos et al., 1992, supra.
[0182] The control sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of an enzyme. The resultant polypeptide may be denoted a pro-enzyme or propolypeptide. A propolypeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding region may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic proteinase, and Myceliophthora thermophila laccase (WO 95/33836).
[0183] Where both signal peptide and propeptide regions are present at the amino terminus of a polypeptide, the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region.
[0184] In yeast, the ADH2 system or GAL1 system may be used. In filamentous fungi, the TAKA alpha-amylase promoter, Aspergillus niger glucoamylase promoter, and Aspergillus oryzae glucoamylase promoter may be used as regulatory sequences.
[0185] Other examples of regulatory sequences are those which allow for gene amplification. In eukaryotic systems, these include the dihydrofolate reductase gene which is amplified in the presence of methotrexate, and the metallothionein genes which are amplified with heavy metals. In these cases, the nucleotide sequence encoding the polypeptide would be operably linked with the regulatory sequence.
Recombinant Expression Vectors
[0186] The present invention also relates to recombinant expression vectors comprising the nucleic acid construct of the invention. The various nucleotide and control sequences described above may be joined together to produce a recombinant expression vector, which may include one or more convenient restriction sites to allow for insertion or substitution of the nucleotide sequence encoding the polypeptide at such sites. Alternatively, the nucleotide sequence of the present invention may be expressed by inserting the nucleotide sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
[0187] The recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the nucleotide sequence. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vectors may be linear or closed circular plasmids.
[0188] The vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
[0189] The vector may contain any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
[0190] The vectors of the present invention preferably contain one or more selectable markers that permit easy selection of transformed cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
[0191] Examples of bacterial selectable markers are the dal genes from Bacillus subtilis or Bacillus licheniformis, or markers that confer antibiotic resistance such as ampicillin, kanamycin, chloramphenicol or tetracycline resistance. Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hygB (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), trpC (anthranilate synthase), as well as equivalents thereof.
[0192] Preferred for use in an Aspergillus cell are the amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar gene of Streptomyces hygroscopicus.
[0193] The vectors of the present invention preferably contain an element(s) that permits stable integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
[0194] For integration into the host cell genome, the vector may rely on the nucleotide sequence encoding the polypeptide or any other element of the vector for stable integration of the vector into the genome by homologous or nonhomologous recombination. Alternatively, the vector may contain additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell. The additional nucleotide sequences enable the vector to be integrated into the host cell genome at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should preferably contain a sufficient number of nucleotides, such as 100 to 1,500 base pairs, preferably 400 to 1,500 base pairs, and most preferably 800 to 1,500 base pairs, which are highly homologous with the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding nucleotide sequences. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.
[0195] For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting replication in E. coli, and pUB110, pE194, pTA1060, and pAMβ1 permitting replication in Bacillus. Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.
[0196] The origin of replication may be one having a mutation which makes its functioning temperature-sensitive in the host cell (see, e.g., Ehrlich, 1978, Proceedings of the National Academy of Sciences USA 75: 1433).
[0197] More than one copy of a nucleotide sequence of the present invention may be inserted into the host cell to increase production of the gene product. An increase in the copy number of the nucleotide sequence can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the nucleotide sequence where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the nucleotide sequence, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
[0198] The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, supra).
Recombinant Host Cells
[0199] The present invention also relates to recombinant a host cell comprising the nucleic acid construct of the invention, which are advantageously used in the recombinant production of the polypeptides. A vector comprising a nucleotide sequence of the present invention is introduced into a host cell so that the vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier.
[0200] The host cell may be a unicellular microorganism, e.g., a prokaryote or a non-unicellular microorganism, e.g., a eukaryote.
[0201] Useful unicellular cells are bacterial cells such as gram positive bacteria including, but not limited to, a Bacillus cell, e.g., Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis; or a Streptomyces cell, e.g., Streptomyces lividans or Streptomyces murinus, or gram negative bacteria such as E. coli and Pseudomonas sp. In a preferred embodiment, the bacterial host cell is a Bacillus lentus, Bacillus licheniformis, Bacillus stearothermophilus, or Bacillus subtilis cell. In another preferred embodiment, the Bacillus cell is an alkalophilic Bacillus.
[0202] The introduction of a vector into a bacterial host cell may, for instance, be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), using competent cells (see, e.g., Young and Spizizin, 1961, Journal of Bacteriology 81: 823-829, or Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and Thorne, 1987, Journal of Bacteriology 169: 5771-5278).
[0203] The host cell may be a eukaryote, such as a mammalian, insect, plant, or fungal cell.
[0204] In a preferred embodiment, the host cell is a fungal cell. "Fungi" as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK) as well as the Oomycota (as cited in Hawksworth et al., 1995, supra, page 171) and all mitosporic fungi (Hawksworth et al., 1995, supra). In a more preferred embodiment, the fungal host cell is a yeast cell. "Yeast" as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, F. A., Passmore, S. M., and Davenport, R. R., eds, Soc. App. Bacteriol. Symposium Series No. 9, 1980).
[0205] In an even more preferred embodiment, the yeast host cell is a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell.
[0206] In a most preferred embodiment, the yeast host cell is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis cell. In another most preferred embodiment, the yeast host cell is a Kluyveromyces lactis cell. In another most preferred embodiment, the yeast host cell is a Yarrowia lipolytica cell.
[0207] In another more preferred embodiment, the fungal host cell is a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). The filamentous fungi are characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.
[0208] In an even more preferred embodiment, the filamentous fungal host cell is a cell of a species of, but not limited to, Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium, or Trichoderma.
[0209] In a most preferred embodiment, the filamentous fungal host cell is an Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae cell. In another most preferred embodiment, the filamentous fungal host cell is a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, or Fusarium venenatum cell. In an even most preferred embodiment, the filamentous fungal parent cell is a Fusarium venenatum (Nirenberg sp. nov.) cell. In another most preferred embodiment, the filamentous fungal host cell is a Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Thielavia terrestris, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.
[0210] Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus host cells are described in EP 238 023 and Yelton et al., 1984, Proceedings of the National Academy of Sciences USA 81: 1470-1474. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156 and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J. N. and Simon, M. I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, Journal of Bacteriology 153: 163; and Hinnen et al., 1978, Proceedings of the National Academy of Sciences USA 75: 1920.
Methods for Preparing Enzyme Polypeptides
[0211] The present invention also relates to methods for producing an enzyme of the invention comprising (a) cultivating a strain comprising a nucleotide sequence encoding an enzyme of the invention which strain is capable of expressing and secreting the enzyme and (b) recovering the enzyme. In a particular embodiment the strain is a wild type strain such as the Botryospaeria rhodina CBS 274.96, while in another embodiment the strain is a recombinant host cell as described, supra.
[0212] In these methods of the invention, the cells are cultivated in a nutrient medium suitable for production of the enzyme using methods known in the art. For example, the cell may be cultivated by shake flask cultivation, small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). As the enzyme is secreted into the nutrient medium, the enzyme can be recovered directly from the medium.
[0213] The resulting enzyme may be recovered by methods known in the art. For example, the enzyme may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
[0214] The polypeptides of the present invention may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).
Transgenic Plants
[0215] The present invention also relates to a transgenic plant, plant part, or plant cell that has been transformed with a nucleotide sequence encoding an enzyme of the invention so as to express and produce the enzyme. In one embodiment the plant could be used as host for production of enzyme in recoverable quantities. The enzyme may be recovered from the plant or plant part. Alternatively, the plant or plant part containing the recombinant enzyme may be used as such for improving the quality of a food or feed, e.g., improving nutritional value, palatability, and rheological properties, or to destroy an antinutritive factor. In particular the plant or plant parts expressing the enzyme may be used as an improved starting material for production of fuel-alcohols or bio-ethanol
[0216] The transgenic plant can be dicotyledonous (a dicot) or monocotyledonous (a monocot). Examples of monocot plants are grasses, such as meadow grass (blue grass, Poa), forage grass such as festuca, lolium, temperate grass, such as Agrostis, and cereals, e.g., wheat, oats, rye, barley, rice, sorghum, and maize (corn).
[0217] Examples of dicot plants are tobacco, legumes, such as lupins, potato, sugar beet, pea, bean and soybean, and cruciferous plants (family Brassicaceae), such as cauliflower, rape seed, and the closely related model organism Arabidopsis thaliana.
[0218] Examples of plant parts are stem, callus, leaves, root, fruits, seeds, and tubers. Also specific plant tissues, such as chloroplast, apoplast, mitochondria, vacuole, peroxisomes, and cytoplasm are considered to be a plant part. Furthermore, any plant cell, whatever the tissue origin, is considered to be a plant part.
[0219] Also included within the scope of the present invention are the progeny of such plants, plant parts and plant cells.
[0220] The transgenic plant or plant cell expressing an enzyme of the invention may be constructed in accordance with methods known in the art. Briefly, the plant or plant cell is constructed by incorporating one or more expression constructs encoding an enzyme of the invention into the plant host genome and propagating the resulting modified plant or plant cell into a transgenic plant or plant cell.
[0221] Conveniently, the expression construct is a nucleic acid construct which comprises a nucleotide sequence encoding an enzyme of the present invention operably linked with appropriate regulatory sequences required for expression of the nucleotide sequence in the plant or plant part of choice. Furthermore, the expression construct may comprise a selectable marker useful for identifying host cells into which the expression construct has been integrated and DNA sequences necessary for introduction of the construct into the plant in question (the latter depends on the DNA introduction method to be used).
[0222] The choice of regulatory sequences, such as promoter and terminator sequences and optionally signal or transit sequences, is determined, for example, on the basis of when, where, and how the enzyme is desired to be expressed. For instance, the expression of the gene encoding an enzyme of the invention may be constitutive or inducible, or may be developmental, stage or tissue specific, and the gene product may be targeted to a specific tissue or plant part such as seeds or leaves. Regulatory sequences are, for example, described by Tague et al., 1988, Plant Physiology 86: 506.
[0223] For constitutive expression, the 35S-CaMV promoter may be used (Franck et al., 1980, Cell 21: 285-294). Organ-specific promoters may be, for example, a promoter from storage sink tissues such as seeds, potato tubers, and fruits (Edwards & Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), or from metabolic sink tissues such as meristems (Ito et al., 1994, Plant Mol. Biol. 24: 863-878), a seed specific promoter such as the glutelin, prolamin, globulin, or albumin promoter from rice (Wu et al., 1998, Plant and Cell Physiology 39: 885-889), a Vicia faba promoter from the legumin B4 and the unknown seed protein gene from Vicia faba (Conrad et al., 1998, Journal of Plant Physiology 152: 708-711), a promoter from a seed oil body protein (Chen et al., 1998, Plant and Cell Physiology 39: 935-941), the storage protein napA promoter from Brassica napus, or any other seed specific promoter known in the art, e.g., as described in WO 91/14772. Furthermore, the promoter may be a leaf specific promoter such as the rbcs promoter from rice or tomato (Kyozuka et al., 1993, Plant Physiology 102: 991-1000, the chlorella virus adenine methyltransferase gene promoter (Mitra and Higgins, 1994, Plant Molecular Biology 26: 85-93), or the aldP gene promoter from rice (Kagaya et al., 1995, Molecular and General Genetics 248: 668-674), or a wound inducible promoter such as the potato pin2 promoter (Xu et al., 1993, Plant Molecular Biology 22: 573-588).
[0224] A promoter enhancer element may also be used to achieve higher expression of the enzyme of the invention in the plant. For instance, the promoter enhancer element may be an intron which is placed between the promoter and the nucleotide sequence encoding an enzyme of the present invention. For instance, Xu et al., 1993, supra disclose the use of the first intron of the rice actin 1 gene to enhance expression.
[0225] The selectable marker gene and any other parts of the expression construct may be chosen from those available in the art.
[0226] The nucleic acid construct is incorporated into the plant genome according to conventional techniques known in the art, including Agrobacterium-mediated transformation, virus-mediated transformation, microinjection, particle bombardment, biolistic transformation, and electroporation (Gasser et al., 1990, Science 244: 1293; Potrykus, 1990, Bio/Technology 8: 535; Shimamoto et al., 1989, Nature 338: 274).
[0227] Presently, Agrobacterium tumefaciens-mediated gene transfer is the method of choice for generating transgenic dicots (for a review, see Hooykas and Schilperoort, 1992, Plant Molecular Biology 19: 15-38). However, it can also be used for transforming monocots, although other transformation methods are generally preferred for these plants. Presently, the method of choice for generating transgenic monocots is particle bombardment (microscopic gold or tungsten particles coated with the transforming DNA) of embryonic calli or developing embryos (Christou, 1992, Plant Journal 2: 275-281; Shimamoto, 1994, Current Opinion Biotechnology 5: 158-162; Vasil et al., 1992, Bio/Technology 10: 667-674). An alternative method for transformation of monocots is based on protoplast transformation as described by Omirulleh et al., 1993, Plant Molecular Biology 21: 415-428.
[0228] Following transformation, the transformants having incorporated therein the expression construct are selected and regenerated into whole plants according to methods well known in the art.
[0229] The present invention also relates to methods for producing an enzyme of the invention comprising (a) cultivating a transgenic plant or a plant cell comprising a nucleotide sequence encoding an enzyme of the invention under conditions conducive for production of the enzyme and (b) recovering the enzyme.
Compositions Comprising Enzyme Polypeptides and Methods for their Preparation
[0230] The invention provide a composition comprising a polypeptide of the invention and an excipient and a method for preparing such a composition comprising admixing the polypeptide of the invention with an excipient. In a particular embodiment the polypeptide of the invention is the major (polypeptide) component of the composition, e.g., a mono-component composition. The excipient in this context is to be understood as any auxilliary agent or compound used to formulate the composition and includes solvent, carriers, stabilizers and the like.
[0231] The composition may further comprise one or more additional enzymes, such as an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, haloperoxidase, invertase, laccase, lipase, mannosidase, oxidase, pectinolytic enzyme, peptidoglutaminase, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, or xylanase.
[0232] The compositions may be prepared in accordance with methods known in the art and may be in the form of a liquid or a solid composition. For instance, the enzyme composition may be formulated using methods known to the art of formulating polypeptides and/or pharmaceutical products, e.g., into coated or uncoated granules or micro-granules. The polypeptide of the invention may thus be provided in the form of a granule, preferably a non-dusting granule, a liquid, in particular a stabilized liquid, a slurry or a protected polypeptide. For certain applications, immobilization of the polypeptide on a solid matrix may be preferred.
[0233] The polypeptide to be included in the composition may be stabilized in accordance with methods known in the art, e.g., by stabilizing the polypeptide in the composition by adding and antioxidant or reducing agent to limit oxidation of the polypeptide or it may be stabilized by adding polymers such as PVP, PVA, PEG or other suitable polymers known to be beneficial to the stability of polypeptides in solid or liquid compositions.
[0234] In a further embodiment the composition of the invention is a detergent composition which, in addition to the polypeptide of the invention, comprises a surfactant and optionally compounds selected from the group consisting of builders such as zeolites, bleaching agents such as percarbonate, bleach enhancers such as TAED or NOBS, suds suppressors, fragrants, etc.
[0235] In a further embodiment the composition of the invention is a feed composition that in addition to the polypeptide of the invention comprises a cereal or grain product.
[0236] In a further embodiment the composition of the invention is a food composition such as a baker's flour composition, a brewed product, a fruit juice, an oil or lard product comprising the polypeptide of the invention.
[0237] In a further embodiment the composition of the invention is a pulping composition, which in addition to the polypeptide of the invention, comprises pulp.
[0238] In a further embodiment the composition of the invention is a biocidal composition, which comprises in addition to the polypeptide of the invention, an oxidoreductase enhancer.
Use of Enzyme Polypeptides or Compositions Comprising them
[0239] In still further aspects the invention provides use of the polypeptides or polynucleotides of the invention or a composition comprising said polypeptides or polynucleotides in various applications, particularly (technical) processes such as processes performed in industry or household, herein under for commercial research purposes. Hence the invention encompasses a process comprising employing a polypeptide of the invention or a polynucleotide of the invention in a (technical) industrial, research or household process.
[0240] In one embodiment the polypeptide or the composition of the invention is used for cleaning a cellulosic fabric.
[0241] In another embodiment the polypeptide or the composition of the invention is used to prepare a food or feed additive.
[0242] In yet another embodiment the polypeptide or the composition of the invention is used for treatment of lignolosic materials and pulp.
Detergent Disclosure
[0243] The polypeptide of the invention may be added to and thus become a component of a detergent composition.
[0244] The detergent composition of the invention may for example be formulated as a hand or machine laundry detergent composition including a laundry additive composition suitable for pre-treatment of stained fabrics and a rinse added fabric softener composition, or be formulated as a detergent composition for use in general household hard surface cleaning operations, or be formulated for hand or machine dishwashing operations.
[0245] In a specific aspect, the invention provides a detergent additive comprising the polypeptide of the invention. The detergent additive as well as the detergent composition may comprise one or more other enzymes such as a protease, a lipase, a cutinase, an amylase, a carbohydrase, a cellulase, a pectinase, a mannanase, an arabinase, a galactanase, a xylanase, an oxidase, e.g., a laccase, and/or a peroxidase.
[0246] In general the properties of the chosen enzyme(s) should be compatible with the selected detergent, (i.e., pH-optimum, compatibility with other enzymatic and non-enzymatic ingredients, etc.), and the enzyme(s) should be present in effective amounts.
[0247] Proteases: Suitable proteases include those of animal, vegetable or microbial origin. Microbial origin is preferred. Chemically modified or protein engineered mutants are included. The protease may be a serine protease or a metallo protease, preferably an alkaline microbial protease or a trypsin-like protease. Examples of alkaline proteases are subtilisins, especially those derived from Bacillus, e.g., subtilisin Novo, subtilisin Carlsberg, subtilisin 309, subtilisin 147 and subtilisin 168 (described in WO 89/06279). Examples of trypsin-like proteases are trypsin (e.g., of porcine or bovine origin) and the Fusarium protease described in WO 89/06270 and WO 94/25583.
[0248] Examples of useful proteases are the variants described in WO 92/19729, WO 98/20115, WO 98/20116, and WO 98/34946, especially the variants with the specific position substitutions mentioned therein.
[0249] Preferred commercially available protease enzymes include Alcalase®, Savinase®, Primase®, Duralase®, Esperase®, and Kannase® (Novozymes A/S), Maxatase®, Maxacal®, Maxapem®, Properase®, Purafect®, Purafect OxP®, FN2®, and FN3® (Genencor International Inc.).
[0250] Lipases: Suitable lipases include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Examples of useful lipases include lipases from Humicola (synonym Thermomyces), e.g., from H. lanuginosa (T. lanuginosus) as described in EP 258 068 and EP 305 216 or from H. insolens as described in WO 96/13580, a Pseudomonas lipase, e.g., from P. alcaligenes or P. pseudoalcaligenes (EP 218 272), P. cepacia (EP 331 376), P. stutzeri (GB 1,372,034), P. fluorescens, Pseudomonas sp. strain SD 705 (WO 95/06720 and WO 96/27002), P. wisconsinensis (WO 96/12012), a Bacillus lipase, e.g., from B. subtilis (Dartois et al., 1993, Biochemica et Biophysica Acta 1131: 253-360), B. stearothermophilus (JP 64/744992) or B. pumilus (WO 91/16422).
[0251] Other examples are lipase variants such as those described in WO 92/05249, WO 94/01541, EP 407 225, EP 260 105, WO 95/35381, WO 96/00292, WO 95/30744, WO 94/25578, WO 95/14783, WO 95/22615, WO 97/04079 and WO 97/07202.
[0252] Preferred commercially available lipase enzymes include Lipolase®, Lipolase Ultra® and Lipex® (Novozymes A/S).
[0253] Amylases: Suitable amylases (alpha and/or beta) include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Amylases include, for example, alpha-amylases obtained from Bacillus, e.g., a special strain of B. licheniformis, described in more detail in GB 1,296,839.
[0254] Examples of useful amylases are the variants described in WO 94/02597, WO 94/18314, WO 96/23873, and WO 97/43424, especially the variants with the specific position substitutions mentioned therein.
[0255] Commercially available amylases are Duramyl®, Termamyl®, Fungamyl® and BAN® (Novozymes A/S), Rapidase® and Purastar® (from Genencor International Inc.).
[0256] Cellulases: Suitable cellulases include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Suitable cellulases include cellulases from the genera Bacillus, Pseudomonas, Humicola, Fusarium, Thielavia, Acremonium, e.g., the fungal cellulases produced from Humicola insolens, Myceliophthora thermophila and Fusarium oxysporum disclosed in U.S. Pat. No. 4,435,307, U.S. Pat. No. 5,648,263, U.S. Pat. No. 5,691,178, U.S. Pat. No. 5,776,757 and WO 89/09259.
[0257] Especially suitable cellulases are the alkaline or neutral cellulases having colour care benefits. Examples of such cellulases are cellulases described in EP 0 495 257, EP 0 531 372, WO 96/11262, WO 96/29397, WO 98/08940. Other examples are cellulase variants such as those described in WO 94/07998, EP 0 531 315, U.S. Pat. No. 5,457,046, U.S. Pat. No. 5,686,593, U.S. Pat. No. 5,763,254, WO 95/24471, WO 98/12307 and PCT/DK98/00299.
[0258] Commercially available cellulases include Celluzyme®, and Carezyme® (Novozymes), Clazinase®, and Puradax HA® (Genencor International Inc.), and KAC-500(B)® (Kao Corporation).
[0259] Peroxidases/Oxidases: Suitable peroxidases/oxidases include those of plant, bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Examples of useful peroxidases include peroxidases from Coprinus, e.g., from C. cinereus, and variants thereof as those described in WO 93/24618, WO 95/10602, and WO 98/15257.
[0260] Commercially available peroxidases include Guardzyme® (Novozymes A/S).
[0261] The detergent enzyme(s) may be included in a detergent composition by adding separate additives containing one or more enzymes, or by adding a combined additive comprising all of these enzymes. A detergent additive of the invention, i.e., a separate additive or a combined additive, can be formulated, e.g., as a granule, a liquid, a slurry, etc. Preferred detergent additive formulations are granulates, in particular non-dusting granulates, liquids, in particular stabilized liquids, or slurries.
[0262] Non-dusting granulates may be produced, e.g., as disclosed in U.S. Pat. Nos. 4,106,991 and 4,661,452 and may optionally be coated by methods known in the art. Examples of waxy coating materials are poly(ethylene oxide) products (polyethyleneglycol, PEG) with mean molar weights of 1000 to 20000; ethoxylated nonylphenols having from 16 to 50 ethylene oxide units; ethoxylated fatty alcohols in which the alcohol contains from 12 to 20 carbon atoms and in which there are 15 to 80 ethylene oxide units; fatty alcohols; fatty acids; and mono- and di- and triglycerides of fatty acids. Examples of film-forming coating materials suitable for application by fluid bed techniques are given in GB 1483591. Liquid enzyme preparations may, for instance, be stabilized by adding a polyol such as propylene glycol, a sugar or sugar alcohol, lactic acid or boric acid according to established methods. Protected enzymes may be prepared according to the method disclosed in EP 238,216.
[0263] The detergent composition of the invention may be in any convenient form, e.g., a bar, a tablet, a powder, a granule, a paste or a liquid. A liquid detergent may be aqueous, typically containing up to 70% water and 0-30% organic solvent, or non-aqueous.
[0264] The detergent composition comprises one or more surfactants, which may be non-ionic including semi-polar and/or anionic and/or cationic and/or zwitterionic. The surfactants are typically present at a level of from 0.1% to 60% by weight.
[0265] When included therein the detergent will usually contain from about 1% to about 40% of an anionic surfactant such as linear alkylbenzenesulfonate, alpha-olefinsulfonate, alkyl sulfate (fatty alcohol sulfate), alcohol ethoxysulfate, secondary alkanesulfonate, alpha-sulfo fatty acid methyl ester, alkyl- or alkenylsuccinic acid or soap.
[0266] When included therein the detergent will usually contain from about 0.2% to about 40% of a non-ionic surfactant such as alcohol ethoxylate, nonylphenol ethoxylate, alkylpolyglycoside, alkyldimethylamineoxide, ethoxylated fatty acid monoethanolamide, fatty acid monoethanolamide, polyhydroxy alkyl fatty acid amide, or N-acyl N-alkyl derivatives of glucosamine ("glucamides").
[0267] The detergent may contain 0-65% of a detergent builder or complexing agent such as zeolite, diphosphate, triphosphate, phosphonate, carbonate, citrate, nitrilotriacetic acid, ethylenediaminetetraacetic acid, diethylenetriaminepentaacetic acid, alkyl- or alkenylsuccinic acid, soluble silicates or layered silicates (e.g., SKS-6 from Hoechst).
[0268] The detergent may comprise one or more polymers. Examples are carboxymethylcellulose, poly(vinylpyrrolidone), poly(ethylene glycol), poly(vinyl alcohol), poly(vinylpyridine-N-oxide), poly(vinylimidazole), polycarboxylates such as polyacrylates, maleic/acrylic acid copolymers and lauryl methacrylate/acrylic acid copolymers.
[0269] The detergent may contain a bleaching system which may comprise a H2O2 source such as perborate or percarbonate which may be combined with a peracid-forming bleach activator such as tetraacetylethylenediamine or nonanoyloxybenzenesulfonate. Alternatively, the bleaching system may comprise peroxyacids of, e.g., the amide, imide, or sulfone type.
[0270] The enzyme(s) of the detergent composition of the invention may be stabilized using conventional stabilizing agents, e.g., a polyol such as propylene glycol or glycerol, a sugar or sugar alcohol, lactic acid, boric acid, or a boric acid derivative, e.g., an aromatic borate ester, or a phenyl boronic acid derivative such as 4-formylphenyl boronic acid, and the composition may be formulated as described in, e.g., WO 92/19709 and WO 92/19708.
[0271] The detergent may also contain other conventional detergent ingredients such as, e.g., fabric conditioners including clays, foam boosters, suds suppressors, anti-corrosion agents, soil-suspending agents, anti-soil redeposition agents, dyes, bactericides, optical brighteners, hydrotropes, tarnish inhibitors, or perfumes.
[0272] It is at present contemplated that in the detergent compositions any enzyme, in particular the enzyme of the invention, may be added in an amount corresponding to 0.01-100 mg of enzyme protein per liter of wash liquor, preferably 0.05-5 mg of enzyme protein per liter of wash liquor, in particular 0.1-1 mg of enzyme protein per liter of wash liquor.
[0273] The enzyme of the invention may additionally be incorporated in the detergent formulations disclosed in WO 97/07202 that is hereby incorporated as reference.
Deposited Microorganism
[0274] The following microorganism was deposited by the applicant according to the Budapest Treaty on the International Recognition of the Deposits of Microorganisms for the Purpose of Patent Procedures at Centraalbureau voor Schimmelcultures, Fungal and Yeast Collection, Uppsalalaan 8, 3584 CT Utrecht, P.O. Box 85167, 3508 AD Utrecht, The Netherlands: [0275] Name: Botryosphaeria rhodina [0276] Synonym: Diplodia gossypina (SBL 274) (Berkeley & M. A. Curtis) von Arx Protolog Arx, J. A. von 1970, "The genera of fungi sporulating in pure culture": 143 [0277] Classification: Dothideaceae, Dothideales, Dothidemycetes; Ascomycota [0278] Deposit accession number: CBS 274.96 [0279] Date of deposit: 12 Mar. 1996
EXAMPLES
Example 1
Identifying Functional Polypeptides Secreted by Botryosphaeria rhodina CBS 274.96
Enzyme Finger Printing of Culture Fluids
[0280] An enzyme activity profile was obtained by assaying the culture broth on a wide spectrum of enzyme assays. 96 wells microtiter (MT) plates were prepared with substrates and stored at +10° C. until use. Two different pH variaties were prepared: pH 3 and pH 7. Following substrates were used: 0.05% AZCL (Mazurine dyed and cross-linked substrates, Megazyme)--Amylose, Arabinan, Beta Glucan (Barley), Casein, Collagen, Curdlan, Dextran, Galactan (potato), Galactomannan (Carob), He-Cellulose, Pullulan, Xylan (oat), and Xyloglucan (AZCL-casein could not be used at pH3, and was therefore left out from these plates).
Preparation of pH3 Substrates:
[0281] 0.1 g of each AZCL substrate was dissolved in 100 ml 0.2 M Succinic acid pH 3+10 microliters TritonX-100 (0.01%), to give a final concentration of 0.1% AZCL.
Preparation of pH7 Substrates:
[0282] 0.1 g of each AZCL substrate was dissolved in 50 ml sterile H20 plus 10 microliters TritonX-100 (0.01%). 50 ml 0.4 M MOPS pH 7 was added to each 50 ml AZCL substrate, to give a final volume of 100 ml and a final concentration of 0.2 M buffer, 0.1% AZCL.
[0283] Laccase and lipase activity assays were included and substrates were prepared as follows:
Preparation of Laccase Substrate:
[0284] 35 ml 0.08 mg/ml Chicago Sky Blue in 0.2 M phosphate/borate-buffer, pH 9, was prepared
Preparation of Lipase Substrate:
[0285] A polyvinyl alcohol (PVA)/soy bean oil emulsion was prepared by mixing a 2% PVA solution with soy bean oil 3:1. The oil was emulsified using ULTRA-TURRAX mixer and 12 ml of the emulsion was mixed with 500 ml 0.2 M sodium-acetate buffer including 10 mM CaCl2 pH 5.5 and 5 ml 0.2% Crystal Violet solution.
[0286] US Sterilin 96-wells MT plates were used with a Multidrop S20 Stacker, Titertek Instruments, Inc., Alabama. 200 microliters of each AZCL-substrate and of the lipase substrate and 150 microliters of the laccase substrate were dispensed into MT wells and 30-50 μl culture broth were added to each substrate and incubated over night at 26° C. Result scores were made the assays as follows: 0: no activity, 1: weak activity, 2: strong activity.
Result Table I: Fingerprinting of D. gossypina Culture Broth
TABLE-US-00001 Substrate Enzyme activity pH 3 pH 7 AZCL-Amylose α-amylase 0a 1 AZCL-Arabinan endo-1,5-α-L- 0 2 (Debranched) arabinanase AZCL-Beta-Glucan β-glucanase, 2 1 (Barley) lichenase and cellulases AZCL-Casein proteases Ntb 2 AZCL-Collagen proteases 0 1 AZCL-Curdlan endo-1,3-β-D- 1 0 glucanase AZCL-Dextran endo-1,6-α-D- 0 0 glucanase (dextranase) AZCL-Galactan endo-1,4-β-D- 0 2 (Potato) galactanase AZCL- endo-1,4-β-D- 2 2 Galactomannan mannanase (Carob) AZCL-HE-Cellulose endo-cellulase 2 2 AZCL-Pullulan limit-dextrinase 0 0 (pullulanase) AZCL-Xylan (Oat endo-1,4-β-D- xylanase 2 2 Spelts) AZCL-Xyloglucan endo-cellulases 0 2 Chicago Sky Blue Laccase 0 0 PVA/soyabean oil Lipase 0 0 aresult score for the activity assays: 0 = no activity, 1 = weak reaction and 2 = strong reaction bnt = not tested
A. cDNA Library Construction
[0287] cDNA from Botryosphaeria rhodina CBS 274.96 was prepared by using standard molecular biology techniques (Ausuble et al. 1995 "Current protocols in molecular biology" Publ.: John Wiley and sons).
[0288] Fermentation of the biomass used in the cDNA library production was initiated from an inoculated PDA plate that had been incubated for 7 days at 28 degrees. Several mycelia-PDA agar plugs were inoculated in shake flasks with Mex1 media containing (per liter): 20 g of soy bean, 15 g of wheat bran, 10 g of cellulose Avicel, 5 g of maltodextrin 01, 3 g of bacto peptone, 0.2 g of pluronic PE6100, and 1 gram Olive oil. The flasks were shaken at 150 RPM at 26 degrees. After 7 days the mycelium was harvested by filtration through Miracloth and frozen in liquid nitrogen and stored at -80° C. until use. [0289] RNA isolation: The total RNA was prepared from frozen, powdered mycelium of Botryospaeria rhodina by extraction with guanidium thiocyanate followed by ultracentrifugation though a 5.7M CsCl cushion (Chirgwin et al., 1979, Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease, Biochemistry 18: 5294-5299). The polyA enriched RNA was isolated by oligo (dT)-cellulose affinity chromatography (Aviv and Leder, 1972, Purification of biologically active globin messenger RNA by chromatography on oligothymidylic acid-cellulose, Proc. Natl. Acad. Sci. USA 69(6): 1408-1412).
[0290] Construction of the cDNA library: Double stranded cDNA was synthesized according to the general methods of Gubler and Hoffman, 1983, A simple and very efficient method for generating cDNA libraries, Gene 25(2-3), 263-269; Sambrook et al., 1989, Molecular cloning: A laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. and Kofod et al. (1994) using a polyA-Not1 primer (Promega, USA). After synthesis, the cDNA was treated with mung bean nuclease, blunt ended with T4 DNA polymerase, and ligated to a 50 fold molar excess of EcoRI adaptors (Invitrogen, USA). The cDNA was cleaved with NotI restriction enzyme (New England Biolabs, USA) according to the manufacturer's instructions and the cDNA size fractionated by agarose gel electrophoresis. cDNA corresponding to 700 bp and larger were excised from the gel and purified using the GFX DNA isolation kit (AP Biotech). The prepared cDNA was then directionally cloned by ligation into EcoRI-NotI cleaved pMHas5. The ligation mixture was electroporated into DH10B cells (Invitrogen) and plated on LB agar with 50 mgs/liter kanamycin. A cDNA plasmid pool was prepared from 30,000 total transformants of the original cDNA-pMHas5 vector ligation. Plasmid DNA was prepared directly from a pool of colonies recovered from solid LB kanamycin selective media according to the Qiagen protocol for plasmid DNA isolation (Qiagen Inc. GMBH).
[0291] Vector used for cloning was pMhas5, which is described in patent WO 03/044049 and has the following features:
TABLE-US-00002 Feature Location Description CDS 365-1156 Kanamycin resistance CDS 2232-2387 Beta galactosidase alpha peptide -10 signal 2189-2192 Shine Dalgarno promotor 2101-2189 Lac promotor misc feature 626-650 KanP1 primer for BACE system
[0292] Notable features of this plasmid are the EcoRI-NotI restriction sites proximal to the Shine Dalgarno region of the Lac promoter. This allows EcoRI-NotI adapted cDNAs to be cloned into the vector and the resulting constructs to be actively transcribed and translated in the E. coli host.
B. Transposon Construction and Preparation
[0293] The rationale behind the methology of Transposon Assisted Signal Trapping (TAST) as described in WO 01/77315 is to fuse all genes within a selected genome with a gene encoding a signalless beta-lactamase via a transposon tag. Hence when growing host cell clones comprising the genes of a genome fused with a gene encoding a signalless beta-lactamase via a transposon tag in an ampicillin containing medium only those clones expressing and secreting a beta-lactamase will survive. However the beta-lactamase will only be secreted if the gene to which the beta-lactamase gene is fused has an intact promotor and ribosome binding site (i.e., a gene which is expressed by the cell to produce a polypeptide in real life), which can be recognized in the host strain, and if the beta-lactamase is translated so that the synthesized polypeptide is transported across the cytoplasma membrane and folded correctly. Hence, when inserting the fused gene into a selected host cell, those clones, which are ampicillin resistant contains a gene which encodes a functional secreted polypeptide.
[0294] Usually, when employing the TAST methodology it is even not necessary to express the entire gene. When tagging the genes with a transposon, expression of the N-terminal part of the genes as protein fusion shows that the genes contain intact transcription, translation and secretion sequences. Hence expression of the N-terminal part of the genes as protein fusion is usually regarded as sufficient for assuring expression and secretion of the entire gene.
[0295] Thus it can be concluded that the genes obtained by the TAST method actually do encode secreted functional polypeptides.
Construction of a SigA4 Transposon Containing the β-Lactamase Reporter Gene:
[0296] Following the instructions of WO 01/77315, the construction of a transposon containing a signal-less β-lactamase gene was carried out using standard molecular biology techniques.
[0297] The signal-less β-lactamase gene was initially PCR amplified from the vector pUC19) using a proofreading polymerase (Pfu Turbo, Stratagene, USA). The resulting PCR fragment contained the restriction sites NotI and EcoRI in order to aid cloning. The plasmid pEntranceposon(Camr) containing the Entranceposon and the antibiotic resistance markers CAT (encoding chloramphencol resistance in the transposon) was obtained from Finnzymes, OY (Espoo Finland). The plasmid was digested with the restriction enzymes NotI and EcoRI, gel purified and ligated with the signal-less β-lactamase containing fragment. The ligation was transformed into electro-competent DH10B cells and the E. coli clone containing the recombinant plasmid with the signal-less β-lactamase was identified by restriction analysis and named SigA2.
[0298] For transposon preparation, a smaller derivative of SigA2 was constructed, which lacked the bla gene encoding beta-lactamase: Two oligonucleotide primers SigA2NotU-P 5'-TCG CGA TCC GTT TTC GCA TTT ATC GTG AAA CGC T-3' (SEQ ID NO: 43) and SigA2NotD-P 5'-CCG CAA ACG CTG GTG AAA GTA AAA GAT GCT GAA-3' (SEQ ID NO: 44), which bind to the start and stop of the bla gene of SigA2 directing outwards were used PCR amplify SigA2 without the bla gene. A amplificate of approx. 3.6 kb generated in the this PCR reaction was relegated and transformed in to a suitable E. coli strain. A plasmid of 3.6 kb was isolated from a transformant which was able to grow on LB chloramphenicol but not on LB ampicillin. This plasmid maintained both BgIII sites and lacks the active bla gene and was called pSig4.
[0299] 60 microliters of pSigA4 plasmid DNA preparation with a concentration of 0.3 μg/μl was digested with BgIII and separated on an agarose gel. The SigA2 transposon DNA band of 2 kb was eluted and purified by using the "GFX® PCR, DNA and Gel Band Purification Kit" (Amersham Pharmacia Biotech Inc, USA) according to the instructions of the vendor and eluted in 200 microliters EB buffer. SigA2 prepared in this manner could be be used for transposon assisted signal trapping (TAST vide infra).
C. Transposon Tagging
[0300] The transposon prepared from pSigA4 carries a 5'-truncated bla-gene encoding a β-lactamase from which the secretion signal was removed. The β-lactamase conveys ampicillin resistance on E. coli only when the protein is secreted to the periplasm, whereas cytoplasmic expression of β-lactamase does not confer ampicillin resistance. Without a signal sequence, the β-lactamase enzyme will not be transported to the periplasm and therefore the clone will not grow on media containing ampicillin. The signal-less β-lactamase gene was contained within the transposon in such a way that there was a continuous open reading frame between the transposon border and the β-lactamase coding region. In this way the modified transposon, when it transposes into a gene encoding a protein that is secreted, could cause an in-frame fusion with the target gene. This resulted in a fusion gene product that is secreted to the periplasm of E. coli and conveys resistance to the ampicillin. If the transposon integrated even in-frame into a gene encoding a non-secreted protein, the respective host will not become ampicillin resistance.
D. Transposon Assisted Signal Trapping of Botryosphaeria rhodina
[0301] A complete description of transposon assisted signal trapping can be found in WO 01/77315. A cDNA plasmid pool was prepared from 30,000 total transformants of the original cDNA-pMHas5 vector ligation. Plasmid DNA was prepared directly from a pool of colonies recovered from solid LB selective media according to the Qiagen protocol for plasmid DNA isolation (Qiagen Inc.). The plasmid pool was treated with transposon SigA2 and MuA transposase according to the transposase manufacturer's instructions (Finnizyme, Finland).
[0302] For the in vitro transposon tagging of the Botryosphaeria rhodina CBS 274.96 cDNA library, 4 or 8 microliters of SigA2 transposon containing approx. 2.6 micrograms DNA were mixed with 1 microliter of the DNA concentration of the plasmid pool DNA of the Botryosphaeria rhodina CBS 274.96 cDNA library, 2 microliters of Finnzymes MuA Transposase (0.22 micrograms/microliter) and 5 microliters of 5× buffer from Finnzymes O Y, Espoo, Finland) in a total volume of 50 microliters and incubated at 30° C. for 3.5 hours and followed by heat inactivation at 75° C. for 10 min. The DNA was precipitated by addition of 5 microliters 3 M Na-acetate pH 5 and 110 microliters 96% ethanol and centrifugation for 30 min at 20000 rpm. The pellet was washed and dried and resuspended in 10 microliters TE buffer.
[0303] 1.5 microliter of the transposon tagged plasmid pool were electroporated into 20 microliters DH10B ultra-competent cells according to the standard protocol provided with the cells (Gibco-BRL) in a Biorad Gene Pulse device (50 uF, 25 mAmp, 1.8 kV)
[0304] Electroporated cells were incubated in SOC media with shaking (28 degrees celcius, 2 hours, 250 rpm) before being plated on selective media. Three agar media were used: [0305] LB+50 micrograms pr. ml kanamycin, [0306] LB+kanamycin+15 micrograms pr. ml chloramphencol, and/or [0307] LB+kanamycin+chloramphenicol+12.5 micrograms pr. ml ampicillin.
[0308] From dilution plating of the electroporation onto LB+kanamycin+chloramphenicol media, it was determined that approximately 72.000 colonies were present containing a cDNA library plasmid with a SigA2 transposition per electroporation and that approximately 69 colonies were recovered under triple selection (LB, kanamycin, chorlamphenicol, ampicillin). Further electroporation and plating experiments were performed until 445 colonies, in all, were recovered from the experiment under triple selection. The colonies were miniprepped according to the Qiagen Qiaturbo96 protocol (Qiagen Inc.--USA). Plasmids were sequenced with the transposon forward and reverse primers (primers A and B) according to the procedure disclosed in the examples of international patent application WO 01/77315 (page 28)
TABLE-US-00003 Primer A: (SEQ ID NO: 45) AGCGT TTGCG GCCGC GATCC Primer B: (SEQ ID NO: 46) TTATT CGGTC GAAAA GGATC C
E. Sequence Assembly and Annotation
[0309] DNA sequence was obtained for the reactions on an AB3700 capillary sequencer. Sequences were trimmed to remove vector and transposon sequence and the A and B primer reads for each plasmid. This resulted in 225 assembled sequences which were grouped into 148 contigs by using the program PhredPhrap (Ewing et al., 1998, Base-calling of automated sequencer traces using phred I. Accuracy assessment; Genome Research 8:175-185; Ewing and Green. 1998, Base-calling of automated sequencer traces using phred II. Error probabilities; Genome Research 8:186-194). All 148 contigs were subsequently compared to sequences available in standard public DNA and protein sequences databases (TrEMBL, SWALL, PDB, EnsemblPep, GeneSeqP) by using the program BLASTX 2.0a19MP-WashU [14 Jul. 1998] [Build linux-x86 18:51:44 30 Jul. 1998] (Gish, Warren 1994-1997--Unpublished; Gish, Warren and David J. States; Identification of protein coding regions by database similarity search; Nat. Genet. 3:266-72; 1993).
[0310] The obtained sequences being, the majority of which were functional genes encoding intact and functional polypeptides, by being obtained from ampicillin resistant clones as explained supra, were used as a basis for the manual analysis.
[0311] In order to verify that ampicillin resistance of the colonies were from increased beta lactamase activity, beta-lactamase activity was tested in ten different signal trapped clones with different transposon landing sites on the cDNA. Plasmid DNA was re-transformed into One Shot TOP10 chemically competent E. coli cells according to the protocol of Invitrogen Life Technologies and the transformation mixture spread on LB agar with kanamycin (50 μg/ml) and chloramphenicol (10 μg/ml). Colonies were replica plated on LB kanamycin, chloramphenicol with 15 (10 μg/ml) ampicillin after 2 days at 28° C. After 3 days at 28° C., the true growers were inoculated into 10 ml LB medium with Kanamycin (50 μg/ml) and chloramphenicol (10 μg/ml), and incubated over night at 37° C., 275 rpm. The overnight culture were diluted 1:100 in fresh LB Kan/CAM medium and grown to OD600=0.5. The cells were harvested by centrifugation and washed once in 0.9% NaCl. Pellet were suspended in sonication buffer (100 mM Tris-HCl, 2 mM EDTA, pH 8.0), the number of cells adjusted to an optical density of OD600=0.5 and sonicated at an of amplitude 1.5 microns using a Soniprep 150, (MSE). The samples were centrifuged at 15.000 rpm for 10 min. and the supernatant used for beta-lactamase assay. The supernatant was mixed with 50 μl nitrocefin chromogenic beta-lactamase substrate. (1 mg/ml in 50% DMSO; 0.05 M PO4 buffer) and 0.1 M PO4 buffer, pH 7.0 up to 1 ml in a plastic cuvette and the change in Abs482 was measured in an Ultrospec 3300 pro spectrophotometer (O'Callahan, 1972). The results were as follows:
TABLE-US-00004 TABLE IX β-lactamase activity of clones with different distances between the Shine Dalgarno (SD) sequence and the ATG translation initiation codon and transposon landing site. β-lactamase activity Transposon landing Distances between SD (Normalized to site on the cDNA sequence and the ATG trappant Clones (bp) initiation codon (bp) ZY063807) ZY063832 806 102 5.5 ZY063832 650 102 11.5 ZY063836 991 35 35.5 ZY063836 991 35 4.0 ZY063807 851 256 1.0 ZY063827 568 8 202.0 ZY063816 476 126 16.0 ZY063816 634 126 3.0 ZY065171 469 9 106.5 ZY065171 684 9 52.0
[0312] The table above illustrates three main points: [0313] 1) Beta-lactamase activity can be detected in all ten clones. It should be emphasized that corresponding plasmid containing E. coli transformants are resistant to 50 mg/liter ampicillin selection. Combining these two facts, indicates that all ten clones produce an hybrid protein consisting of part of the transposon tagged cDNA fused to the beta lactamase gene in such a manner as to provide an peptide with beta lactamase activity. [0314] 2) Because the cDNA of the ten clones were completely sequenced, the landing site of the SigA2 transposon in each clone was established. The 10 clones all had a SigA2 transposon in the correct orientation and in the correct reading frame to promote a hybrid fusion between the N terminal of the native encoded protein and the transposon encoded beta lactamase. [0315] 3) In Eukaryotic cDNAs, untranslated upstream (5' UTR) leaders can vary in length from 1 bp to several hundred base pairs. For the cDNA to be optimally translated from the E. coli translation elements such as the Shine-Dalgarno region, an optimal distance of between 4 and 11 base pairs before the ATG start codon is optimal. In the table, we can see that 5'UTRs much longer than optimal still allow for some expression of the cDNA hybrid-beta lactamase fusion protein because beta lactamase activity is observed from the transformed E. coli in the example.
[0316] The obtained nucleotide sequences of the invention are functional genes which encode intact and functional polypeptides, not only for the reasons above, but because they were obtained from ampicillin resistant clone. The clones obtained herein were ampicillin resistant, because after transposon tagging, the genes were fused with the signalless beta-lactamase gene, which is only expressed when fused to a gene with an intact promoter and ribosome-binding site, which can be recognized in the host strain, and translated and transported across the cytoplasm membrane and folded correctly.
[0317] Therefore is could be concluded that the genes of the invention actually do encode active secreted polypeptides. For the 16 genes sequence analysis revealed, that in-frame fusion with the signalless beta-lactamase gene was obtained. In addition, the intactness of the genes' open reading frame was confirmed by determining the entire nucleotide sequence.
Example 2
Determining Enzyme Function by Homology
[0318] The function of a gene or the encoded polypeptide can be predicted by sequences comparison with genes or polypeptides of known function. Similarities between group ADNA and group Bpolypeptide sequences and sequences from public and internal databases were analysed, to determine the functionality of the group ADNA and group Bpolypeptide sequences. The sequence comparison was carried out using the program BLASTX 2.0a19MP-WashU [14 Jul. 1998]. A careful manual analysis of sequence alignments of group ADNA and group Bpolypeptide sequences to their closest related sequences with known function made it possible to predict the function of these genes and the encoded polypeptides. Even when the overall amino acid identity was below 40%, which can make it difficult to make reliable predictions, it was possible to predict the function of group ADNA and group Bpolypeptide sequences by carefully analysing and interpreting the amino acid residues in the catalytic sites and/or in important regions of the polypeptide sequences. If the amino acids of the catalytic site of known sequences were also present in the polypeptide of the invention, combined with a sufficient overall amino acid identity, it was concluded that the polypeptide from Botryosphaeria rhodina CBS 274.96 had the same function as the known sequence.
Example 3
Preparing Group Bpolypeptide Polypeptides
[0319] To prepare polypeptides from cDNA sequences of a filamentous fungus such as Botryosphaeria rhodina CBS 274.96, it was feasible to express the cDNA in yeast or another filamentous fungus. A good choice, serving as a non-exhaustive example, is expression in Aspergillus oryzae. The example given below is how a cDNA encoding a xylanase (SEQ ID No: 3) was expressed in A. oryzae.
[0320] An expression plasmid pDaU71 was used. This plasmid contained (1) the A. nidulans amdS gene as selection marker in Aspergillus, (2) the yeast URA3 gene, interrupted by the ampicillin resistance gene for selection in E. coli, (3) a duplication of the A. niger NA2 promoter (neutral amylase) with 3 extra amyR-sites+the 5' untranslated part of the A. nidulans TPI promoter for heterologous expression and (4) the A. niger AMG terminator. As template for amplication of the relevant portion of the Botryosphaeria rhodina cDNA library pool, the following primers were used in the PCR reaction:
TABLE-US-00005 Primer #166: (SEQ ID NO: 47) CGCGGATCCACCATGGTCTCCTTCAAGTCGATTC Primer #167: (SEQ ID NO: 47) CCGCTCGAGTTACTGCACGGTAATCGTAGC
[0321] The following conditions were used: [0322] Extensor Hi Fidelity Reddy Load DNA polymerase PCR mix was used according to the manufacturer's instructions (ABGene, Great Britain).
TABLE-US-00006 [0322] cDNA plasmid pool (1 nanogram/microliter): 5 microliters Primer #166 1 microliters Primer #167 1 microliter PCR master mix 12.5 microliters Deionized water 7.5 microliters Total volume 25 microliters
[0323] The reaction was transferred to an MJ Research DNA engine prewarmed to 94° C. and the following cycle was performed:
TABLE-US-00007 94° C. 2 minutes then 25 cycles of 94° C. 30 seconds 53° C. 30 seconds 72° C. 1 minute then 72° C. 10 minutes.
[0324] Five microliters of product was analyzed on a 1% agarose gel to confirm the correct size and quantify the amount of PCR product produced. The remaining 20 microliters mixture was GFX purified according to the manufacturer's instructions (AP Pharma). 20 microliters of the 40 microliter purified product was used for a standard BamHI-XhoI restriction digest in a 30 microliter standard overnight digestion reaction. The restricted product was once again purified by GFX and used in a standard ligation reaction with BamHI-XhoI restricted and purified pDau71. The ligation product was transformed into DH10B E. coli cells (E. coli DH10B or TOP10 (available from Invitrogen) could be used as cloning hosts in construction of the expression vector) and plated on LB ampicillin media. Ten transformants were selected for plasmid DNA purification and were sequenced to confirm the sequence integrity of the insert. One PCR error free clone pPFJo147 was selected for further studies.
[0325] Aspergillus oryzae strain BECh2, which was constructed as described in WO 00/39322 (BECh2 is derived from strain Aspergillus oryzae JaL228, which is constructed on the basis of the deposited strain Aspergillus oryzae IFO 4177 as described in WO 98/12300).
[0326] Transformation and culture conditions were performed according to Christiansen et al., 1988, Biotechnology 6: 1419-1422 and as described in WO 01/12794, page 63. After one round of reisolation, 10 ml YPglucose or YPmaltose medium in Nunc tubes were inoculated with spores from the transformants and the cultures were inoculated for 3 days at 30° C.
[0327] 10 microliters supernatant samples from the above described 10 ml cultures were subjected to SDS-gel electrophoresis. The gel was stained with SYPRO Orange Protein Gel Stain (Molecular Probes). Several Aspergillus transformants had a prominent band on the SDS gel. These positives were further analyzed for xylanase activity by performing an AZCL-wheat arabinoxylan assay at pH 6.0. The substrate, AZCL-Arabinoxylan from wheat (Megazyme), was prepared as a 0.2% w/v suspension in 0.2 M Na-phosphate buffer pH 6.0+0.01% Triton-X 100. 900 microliters substrate was preheated to 37° C. in an Eppendorf thermomixer. 100 microliters crude culture fluid supernatant from the recombinant host strain Bech2 or the different samples was added to the substrate and incubated for 15 min at 37° C. at maximum speed. The reaction mixture was then placed on ice for 2 minutes and then centrifuged for 1 min 20.000×G. 2×200 microliters supernatant was transferred to a microtiter plate and measured at OD 590. Activity was determined as an increase in absorbance.
Example 4
Determining Xylanase Activity
[0328] The culture fluid or a cell lysate of a host strain synthesising and secreting a xylanase in a suitable buffer is used for measuring the activity. A suitable volume of such a sample is spotted on agarose plates which contain the insoluble chromogenic substrate AZCL-Birch xylan (Megazyme®) and a suitable buffer at pH, e.g., pH is 4.5-7.5. The plate is incubated for an appropriate time, e.g., one day, at an appropriate temperature, e.g., 37° C. The activity is visible as blue halos around the spots.
Example 5
Determining Peroxidase Activity
[0329] Peroxidase can be determined spectrophotmetricly using the 2,4 dichlorophenol method of Ishida et al., 1987, Detection of peroxidase activity and its localisation in the forespore envelopes of Bacillus cereus, J. Gen. Appl. Microbiol. 33:27-32. As indicator a mixture of 1.0 mM 2,4 Dichlorophenol and 82 mM 4-aminoantipyrene in 100 mM potassium phosphate buffer (pH 7.0) can be used while a substrate of hydrogen peroxide (Sigma), 50 mM in 100 mM potassium phosphate buffer (pH7.0) is suitable.
[0330] 200 microliters of appropriately diluted culture fluid supernatant is added to a 1 ml plastic cuvette. 200 microliters of the indicator mixture is added. Reactions are initiated by the addition of 200 microliters hydrogen peroxide substrate. Changes in absorbance are observed in a standard spectorophotometer measuring at a wavelength of 510 nm.
Example 6
Determining Cellulose Degradation Boosting Effect on Cellulose Degrading Enzymes or Enzyme Mixtures
[0331] Some secreted proteins demonstrate synergistic action in degradation of cellose in the presence of cellulose degrading enzymes or mixtures thereof. Such secreted proteins may or may not have, in themselves, hydrolase activity. Examples of such secreted proteins and how one detects their cellulose degradation boosting effect can be found in patent application Ser. No. 11/046,124 and corresponding PCT application PCT/US2005/003525 published 30 Jul. 2005, in particular using the examples 24 and anyone from examples 25 to 28, hereby incorporated by reference.
[0332] One way of determining this boosting effect is as follows: Culture fluid or a cell lysate of a host strain synthesising and secreting a cellulase boosting polypeptide are concentrated using an Amicon stirred cell equipped with a PM10 membrane, 10 kDa cutoff (Millipore, Billerica, Mass.), and desalted using an Econo-Pac 10DG column (BioRad Laboratories, Hercules, Calif.). After assay of the protein concentration by BCA (bicinchoninic acid, Smith et al., 1985, Anal. Biochem. 150: 76) Protein Assay Kit (Pierce, Rockford, Ill.) using BSA as standard these polypeptide stocks are stored at -20° C. The polypeptides are not further purified, and stocks are added to reaction mixtures based on total protein measured.
[0333] Corn stover is pretreated at the U.S. Department of Energy National Renewable Energy Laboratory (NREL) using dilute sulfuric acid. The following conditions are used for the pretreatment: 1.4 wt % sulfuric acid at 165° C. and 107 psi for 8 minutes. According to NREL, the water-insoluble solids in the pretreated corn stover (PCS) contain 56.5% cellulose, 4.6% hemicellulose and 28.4% lignin. Cellulose and hemicellulose are determined by a two-stage sulfuric acid hydrolysis with subsequent analysis of sugars by high performance liquid chromatography using NREL Standard Analytical Procedure #002. Lignin is determined gravimetrically after hydrolyzing the cellulose and hemicellulose fractions with sulfuric acid using NREL Standard Analytical Procedure #003. Prior to enzymatic hydrolysis, the PCS is ished with a large volume of DDI water on a glass filter; finding the dry weight of the water-ished PCS. Milled PCS is prepared from the water-ished PCS by milling in a coffee-grinder and subsequent ishing with deionized water on a 22 μm Millipore Filter (6P Express Membrane, Stericup, Millipore, Bedford, Mass.).
[0334] Hydrolysis of PCS is conducted using 1.1 ml Immunoware microtubes (Pierce, Rockford, Ill.) using a total reaction volume of 1.0 ml. In this protocol hydrolysis of PCS (10 mg/ml in 50 mM sodium acetate pH 5.0 buffer) is performed using different protein loadings (expressed as mg of enzyme per gram of PCS) of a test polypeptide of the invention or Celluclast® 1.5 L sample (Novozymes A/S, Bagsv.ae butted.rd, Denmark) in the presence of 3% Aspergillus oryzae beta-glucosidase (recombinantly produced in Aspergillus oryzae according to WO 02/095014) of the cellulase protein loading. Screening of polypeptides of the invention for PCS hydrolyzing capability is performed at 50° C. (Isotemp 102S water baths or TS Autoflow CO2 Jacketed Incubator). Typically, reactions are run in quadruplicate and aliquots taken during the course of hydrolysis. PCS hydrolysis reactions are stopped by mixing a 20 μl aliquot of each hydrolyzate with 180 μl of 0.11 M NaOH (stop reagent). Appropriate serial dilutions are generated for each sample and the reducing sugar content determined using a para-hydroxybenzoic acid hydrazide (PHBAH, Sigma, St. Louis, Mo.) assay adapted to a 96 well microplate format as described below. Briefly, a 90 μl aliquot of an appropriately diluted sample is placed in a 96 well conical bottomed microplate. Reactions are initiated by adding 60 μl of 1.5% (w/v) PHBAH in 2% NaOH to each well. Plates are heated uncovered at 95° C. for 10 minutes. Plates are allowed to cool to room temperature (RT) and 50 μl of distilled H2O added to each well. A 100 μl aliquot from each well is transferred to a flat bottomed 96 well plate and the absorbance at A410nm measured using a SpectraMax Microplate Reader (Molecular Devices, Sunnyvale, Calif.). Glucose standards (0.1-0.0125 mg/ml diluted with 0.4% sodium hydroxide) are used to prepare a standard curve to translate the obtained A410nm values into glucose equivalents. The resultant equivalents are used to calculate the percentage of PCS cellulose conversion for each reaction.
[0335] The degree of cellulose conversion to reducing sugar (conversion, %) is calculated using the following equation:
Conversion.sub.(%)=RS.sub.(mg/ml)*100*162/(Cellulose.sub.(mg/ml)*180)==R- S.sub.(mg/ml)*100/(Cellulose.sub.(mg/ml)*1.111)
[0336] In this equation, RS is the concentration of reducing sugar in solution measured in glucose equivalents (mg/ml), and the factor 1.111 reflects the weight gain in converting cellulose to glucose.
[0337] To screen for polypeptides of the invention which can enhance Celluclast® 1.5 L performance, PCS hydrolysis reactions (1.0 ml protocol, 10 g of PCS per liter, 50° C., supplemented by addition of 3% of total loading of Aspergillus oryzae beta-glucosidase) are performed in which 2.5 mg enzyme loading Celluclast® 1.5 L is mixed with 2.5 mg polypeptide loading of each sample (5 mg enzyme loading Total protein per reaction). Celluclast® 1.5 L control reactions consisting of 10 mg enzyme loading, 5 mg enzyme loading and 2.5 mg enzyme loading are measured and their PCS cellulose conversion values recorded for comparison.
Example 7
Determining Lipase Activity
[0338] The culture fluid or a cell lysate of a host strain synthesising and secreting a lipase in a suitable buffer is used for measuring the activity.
[0339] Lipase assay (PNV assay): 20 microliters of dilution buffer is pipetted into each well of a 96 well microtiter plate. 5 microliters of sample (supernatant) is added to the dilution buffer. At the start of the assay 200 microliters of substrate is added to each well and the plate is mounted into an ELISA reader (a programmable spectrophotometer that can read 96 well plates). Absorbance is measured at 405 nm every 30 seconds for 10 minutes. The slope of the time vs. abs405 curve is used as an arbitrary activity unit.
[0340] Dilution buffer: 25 ml 2 M Tris/HCl pH 7.5, 0.50 ml 2 M CaCl2, 2.5 ml 15% Brij 35, H2O ad 500 ml.
[0341] Substrate stock solution: 0.1295 g (117 microliters) p-Nitrophenyl valerate SIGMA N 4377 (density 1.11 g/ml) is dissolved in 10 ml methanol. Store in freezer
[0342] Substrate: 100 microliters substrate stock solution is mixed with 10 ml dilution buffer.
Example 8
Determining Protease and Peptidase Activity
[0343] The culture fluid or a cell lysate of a host strain synthesising and secreting a peptidase and/or protease, in a suitable buffer having a pH chosen for optimal activity of the peptidase, may be assayed for that activity by spotting a suitable sample volume (for example 20 microliter) on an agarose plate which contain the insoluble chromogenic substrate AZCL-casein (Megazyme®) or AZCL-collagen (Megazyme®) OR Azocoll (Sigma-Aldrich), e.g., at a level of 0.1% w/w. The plate is incubated for an appropriate time, e.g., one day, at a temperature suitable for the function of the peptidase, e.g., 37° C. The activity is visible as blue halos around the spots. As an alternative to AZCL-casein and AZCL-collagen (Megazyme®) non-labelled casein or non-labelled collagene can be used. On non-labelled collagen or non-labelled casein spotted on agarose plates, clearing zones form in the presence of peptidase and/or protease.
Example 9
Determining Endo-Arabinase Activity
[0344] The culture fluid or a cell lysate of a host strain synthesising and secreting an arabinase in a suitable buffer having a pH chosen for optimal activity of the arabinase, may be assayed for that activity by spotting a suitable sample volume (for example 20 microliters) on an agarose plate which contain the insoluble chromogenic substrate AZCL-arabinan--e.g., at a level of 0.1% w/w. The plate is incubated for an appropriate time, e.g., one day, at a temperature suitable for the function of the arabinase, e.g., 37° C. The activity is visible as blue halos around the spots.
[0345] The assay may be performed at different pH. At acidic pH the AZCL-arabinan may be prepared by dissolving 0.1 g of AZCL arabinan (Mazurine dyed and cross-linked substrate, Megazyme, Ireland) in 100 ml 0.2 M Succinic acid pH3+10 microliters TritonX-100 (0.01%), to give a final concentration of 0.1% AZCL. At neutral pH the AZCL-arabinan may be prepared by dissolving 0.1 g of AZCL arabinan (Mazurine dyed and cross-linked substrate, Megazyme, Ireland) in 50 ml sterile H20 plus 10 microliters TritonX-100 (0.01%). 50 ml 0.4 M MOPS pH 7 is then added to the 50 ml AZCL substrate, to give a final volume of 100 ml and a final concentration of 0.2 M buffer, 0.1% AZCL.
Example 10
Determining Beta-Glucosidase Activity
[0346] Many betaglucosidases are likely to have at least some activity on 4-nitrophenyl β-D-glucopyranoside or cellobiose even though that may not be their natural substrates. Activity may also be found using methyl-umbiliferyl beta-D-glucoside which is very sensitive. Generally any (1,4)-β- and (1,3)-β-oligoglucosides can be used as substrate to assess activity of beta-glucosidase by measuring released glucose by using the Trinder assay (The Sigma Diagnostic Glucose (Trinder) Assay, Sigma, St. Louis, Mo.).
[0347] One way of determining beta-glucosidase activity is to make a preparation of the culture fluid or a cell lysate of a host strain synthesising and secreting a beta-glucosidase so that the preparation contains approximately 6.9×10-6 mg/ml of total protein, 100 mM sodium citrate pH 5.0, 0.01% Tween-20 and 4 mM p-nitrophenyl-beta-D-glucopyranoside. The preparation is incubated at 50° C. and aliquots are taken at 0.5, 1, 2, 3, 3.75, and 24 hours. To each aliquot is added 1 M sodium carbonate pH 10.0, and the p-nitrophenyl anion concentration is determined from the absorbance at 405 nm.
[0348] Another way of determining beta-glucosidase is make a preparation of the culture fluid or a cell lysate of a host strain synthesising and secreting a beta-glucosidase by first desalting (BioRad Econo-Pac 10DG column) and then concentrating (Centricon Plus-20, Biomax-5, 5 kD cut-off), to a concentration of 0.92 mg/ml (BCA assay). Then the preparation is incubated at 0.037 and 0.0092 μg/ml total protein with 10 mM cellobiose in 100 mM sodium citrate pH 5.0 plus 0.01% Tween-20 at 65° C. Aliquots are taken at 0.5, 1, 2, 3, 4, 6, and 19 hours. Aliquots are boiled 6 minutes to terminate the reaction, and the glucose concentration is determined using the Trinder assay (Sigma Chemical Co., St. Louis, Mo.) and external glucose standards.
Example 11
Determining Esterase Activity
[0349] The culture fluid or a cell lysate of a host strain synthesising and secreting an esterase in a suitable buffer is used for measuring the activity. When choosing a substrate for detecting activity of the serine esterase one should preferably choose one which does not form micelles at the concentrations at which the esterase is saturated with substrate, to gain optimal conversion of substrate.
[0350] One way of testing esterase activity is to measure the hydrolysis of triacetin in a concentration below CMC for triacetin by the enzyme, by the alkali consumption registered as a function of time under standard conditions such as 30° C.; pH 7.0. Hydrolysis of triacetin by esterase will liberate acetic acid which will requires addition of alkali to maintain a a constant pH of 7.0 (pH-stat method) thus the amount of alkali (usually in the form of sodium hydroxide) required to maintain the pH at 7.0 is a measure of triacetin ester bonds hydrolyzed.
[0351] Another way of testing esterase activity is to measure the hydrolysis by the esterase of PNP-acetat (para-nitrophenyl-acetate) releasing the coloured PNP. 20 microliters of dilution buffer is pipetted into each well of a 96 well microtiter plate. 5 microliters of sample (culture fluid supernatant or filtered cell lysate) is added to the dilution buffer. At the start of the assay 200 microliters of substrate is added to each well and the plate is mounted into an ELISA reader (a programmable spectrophotometer that can read 96 well plates). Absorbance is measured at 405 nm every 30 seconds for 10 minutes. The slope of the time vs. abs405 curve is used as an arbitrary activity unit.
[0352] Dilution buffer: 25 ml 2 M Tris/HCl pH 7.5, 0.50 ml 2 M CaCl2, 2.5 ml 15% Brij 35, H2O ad 500 ml.
[0353] Substrate stock solution: a suitable amount of p-Nitrophenyl acetate (analytical grade) is dissolved in 10 ml methanol and stored in a freezer
[0354] Substrate: 100 microliters substrate stock solution is mixed with 10 ml dilution buffer.
Sequence CWU
1
481930DNABotryosphaeria
rhodinaCDS(1)..(927)sig_peptide(1)..(54)mat_peptide(55)..(927)misc_featur-
e(55)..(162)Domain CBM1 1atg cat cag aat tcc gcc ttg ttg ctg ctg gca gcc
atc cca gcg acg 48Met His Gln Asn Ser Ala Leu Leu Leu Leu Ala Ala
Ile Pro Ala Thr -15 -10 -5tat
gcc gcc gtc cct gcc tgg ggt cag tgc ggc ggt tcg ggc tat agt 96Tyr
Ala Ala Val Pro Ala Trp Gly Gln Cys Gly Gly Ser Gly Tyr Ser -1 1
5 10ggc gaa acc act tgt gta tct ggt tat acc
tgc gtg act gta aac caa 144Gly Glu Thr Thr Cys Val Ser Gly Tyr Thr
Cys Val Thr Val Asn Gln15 20 25
30tgg tac tcc caa tgc cag caa gga tcc gca ggt ccc acc acc acg
ctc 192Trp Tyr Ser Gln Cys Gln Gln Gly Ser Ala Gly Pro Thr Thr Thr
Leu 35 40 45gcc aca gtc
aca acc acg ggc agc ggc acc acg ccg agc tcg acc tct 240Ala Thr Val
Thr Thr Thr Gly Ser Gly Thr Thr Pro Ser Ser Thr Ser 50
55 60ggc agc atc gat gcc aag ttc aag gcc aag
gga aag aag tac ttt ggc 288Gly Ser Ile Asp Ala Lys Phe Lys Ala Lys
Gly Lys Lys Tyr Phe Gly 65 70
75gtg gcg acg gac cag ggc cga ctc acg agc ggg cag aac gcg gcc atc
336Val Ala Thr Asp Gln Gly Arg Leu Thr Ser Gly Gln Asn Ala Ala Ile 80
85 90atc aaa gcc gac ttt ggc cag gtc acg
ccg gag aac agc atg aag tgg 384Ile Lys Ala Asp Phe Gly Gln Val Thr
Pro Glu Asn Ser Met Lys Trp95 100 105
110gac gcc acc gag cct tca cgc aac acg ttc acc ttc acg acg
gcc gac 432Asp Ala Thr Glu Pro Ser Arg Asn Thr Phe Thr Phe Thr Thr
Ala Asp 115 120 125tac ctg
gtt gat tgg gcg acg acc aac gac aag ctg atc cgt ggc cac 480Tyr Leu
Val Asp Trp Ala Thr Thr Asn Asp Lys Leu Ile Arg Gly His 130
135 140acg acc gtc tgg cac tcg cag ctg ccc
acc tgg gtc tca agc atc acc 528Thr Thr Val Trp His Ser Gln Leu Pro
Thr Trp Val Ser Ser Ile Thr 145 150
155gat aag gcc act ttg acg acc gtc atg cag aac cac atc gcc acc gaa
576Asp Lys Ala Thr Leu Thr Thr Val Met Gln Asn His Ile Ala Thr Glu 160
165 170atg ggt cgc tgg aag ggc aag atc
tac gct tgg gat gtc gtc aac gag 624Met Gly Arg Trp Lys Gly Lys Ile
Tyr Ala Trp Asp Val Val Asn Glu175 180
185 190atc ttc aac gag gac ggc tca ttc agg tcc tcg gtc
ttc tac aac gtc 672Ile Phe Asn Glu Asp Gly Ser Phe Arg Ser Ser Val
Phe Tyr Asn Val 195 200
205ctc ggc gag gac ttt gtc cgc ctc gcc ttc gag gct gcg cgc gcc gcc
720Leu Gly Glu Asp Phe Val Arg Leu Ala Phe Glu Ala Ala Arg Ala Ala
210 215 220gac ccc aac gcc aag ctg
tac atc aac gac tac aac ctc gac tcc gcc 768Asp Pro Asn Ala Lys Leu
Tyr Ile Asn Asp Tyr Asn Leu Asp Ser Ala 225 230
235acc tac gcc aaa acc acc ggc ctg gac gtc acc aac tgc gtc
ggc atc 816Thr Tyr Ala Lys Thr Thr Gly Leu Asp Val Thr Asn Cys Val
Gly Ile 240 245 250acc gtt tgg ggc ctg
cgc gac ccg gat agc tgg agg gcg agc agc acg 864Thr Val Trp Gly Leu
Arg Asp Pro Asp Ser Trp Arg Ala Ser Ser Thr255 260
265 270ccg ttg ctg ttt gat gcc gac ttc cag ccg
aag gcc gcg tat acc gcc 912Pro Leu Leu Phe Asp Ala Asp Phe Gln Pro
Lys Ala Ala Tyr Thr Ala 275 280
285att ttg aac agt ttg tag
930Ile Leu Asn Ser Leu 2902309PRTBotryosphaeria rhodina
2Met His Gln Asn Ser Ala Leu Leu Leu Leu Ala Ala Ile Pro Ala Thr
-15 -10 -5Tyr Ala Ala Val Pro Ala Trp
Gly Gln Cys Gly Gly Ser Gly Tyr Ser -1 1 5
10Gly Glu Thr Thr Cys Val Ser Gly Tyr Thr Cys Val Thr Val Asn Gln15
20 25 30Trp Tyr Ser Gln
Cys Gln Gln Gly Ser Ala Gly Pro Thr Thr Thr Leu 35
40 45 Ala Thr Val Thr Thr Thr Gly Ser Gly Thr
Thr Pro Ser Ser Thr Ser 50 55
60Gly Ser Ile Asp Ala Lys Phe Lys Ala Lys Gly Lys Lys Tyr Phe Gly
65 70 75Val Ala Thr Asp Gln Gly Arg Leu
Thr Ser Gly Gln Asn Ala Ala Ile 80 85
90Ile Lys Ala Asp Phe Gly Gln Val Thr Pro Glu Asn Ser Met Lys Trp95
100 105 110Asp Ala Thr Glu
Pro Ser Arg Asn Thr Phe Thr Phe Thr Thr Ala Asp 115
120 125Tyr Leu Val Asp Trp Ala Thr Thr Asn Asp
Lys Leu Ile Arg Gly His 130 135
140Thr Thr Val Trp His Ser Gln Leu Pro Thr Trp Val Ser Ser Ile Thr
145 150 155Asp Lys Ala Thr Leu Thr Thr
Val Met Gln Asn His Ile Ala Thr Glu 160 165
170Met Gly Arg Trp Lys Gly Lys Ile Tyr Ala Trp Asp Val Val Asn
Glu175 180 185 190Ile Phe
Asn Glu Asp Gly Ser Phe Arg Ser Ser Val Phe Tyr Asn Val
195 200 205Leu Gly Glu Asp Phe Val Arg
Leu Ala Phe Glu Ala Ala Arg Ala Ala 210 215
220Asp Pro Asn Ala Lys Leu Tyr Ile Asn Asp Tyr Asn Leu Asp
Ser Ala 225 230 235Thr Tyr Ala Lys
Thr Thr Gly Leu Asp Val Thr Asn Cys Val Gly Ile 240
245 250Thr Val Trp Gly Leu Arg Asp Pro Asp Ser Trp Arg
Ala Ser Ser Thr255 260 265
270Pro Leu Leu Phe Asp Ala Asp Phe Gln Pro Lys Ala Ala Tyr Thr Ala
275 280 285Ile Leu Asn Ser Leu
2903663DNABotryosphaeria
rhodinaCDS(1)..(663)sig_peptide(1)..(57)mat_peptide(58)..(663) 3atg gtc
tcc ttc aag tcg att ctt ctc act ctc acc gcc gct gcc agc 48Met Val
Ser Phe Lys Ser Ile Leu Leu Thr Leu Thr Ala Ala Ala Ser
-15 -10 -5gtc ttc tcc gcc ccg acc cct gag
gcg ggc gag ctg atc gcg agg cag 96Val Phe Ser Ala Pro Thr Pro Glu
Ala Gly Glu Leu Ile Ala Arg Gln -1 1 5
10aac acg cca agc ggc acc ggc acg cac aac ggc tac ttc tat tcc ttc
144Asn Thr Pro Ser Gly Thr Gly Thr His Asn Gly Tyr Phe Tyr Ser Phe
15 20 25tgg acc gac ggt gct ggc cag gtg
acc tac acc aac ggc gct ggt ggt 192Trp Thr Asp Gly Ala Gly Gln Val
Thr Tyr Thr Asn Gly Ala Gly Gly30 35 40
45tcg tac agc gtg acg tgg tcc ggc aac gcc ggc aac tgg
gtt ggc ggc 240Ser Tyr Ser Val Thr Trp Ser Gly Asn Ala Gly Asn Trp
Val Gly Gly 50 55 60aag
gga tgg cag acg ggc agc gcc agg acg atc aac tac tcg ggc acc 288Lys
Gly Trp Gln Thr Gly Ser Ala Arg Thr Ile Asn Tyr Ser Gly Thr 65
70 75tac aac ccc aac ggc aac tcg tac
ctc gcc gtg tac ggc tgg tcg cgc 336Tyr Asn Pro Asn Gly Asn Ser Tyr
Leu Ala Val Tyr Gly Trp Ser Arg 80 85
90aac ccg ctg gtg gag tac tac atc gtc gag tcg tac ggc acg tac aac
384Asn Pro Leu Val Glu Tyr Tyr Ile Val Glu Ser Tyr Gly Thr Tyr Asn
95 100 105ccg ggc tcg ggc ggc acc aag
aag ggc acg gtc acg tcg gac ggc ggc 432Pro Gly Ser Gly Gly Thr Lys
Lys Gly Thr Val Thr Ser Asp Gly Gly110 115
120 125acc tac gac atc tac gtg agc acc cgc acc aac gcg
ccc agc atc gac 480Thr Tyr Asp Ile Tyr Val Ser Thr Arg Thr Asn Ala
Pro Ser Ile Asp 130 135
140ggc acc cag acc ttc cag cag tac tgg tcc gtg cgc cag tcc aag cgc
528Gly Thr Gln Thr Phe Gln Gln Tyr Trp Ser Val Arg Gln Ser Lys Arg
145 150 155gtc ggc ggc acc gtg acg
acc aag aac cac ttc gat gcc tgg gcc gcc 576Val Gly Gly Thr Val Thr
Thr Lys Asn His Phe Asp Ala Trp Ala Ala 160 165
170gtt ggc ctt aac ctg ggc act ttc gac tac cag atc gtc gct
acc gag 624Val Gly Leu Asn Leu Gly Thr Phe Asp Tyr Gln Ile Val Ala
Thr Glu 175 180 185ggc tac cag agc agc
ggg tcg gct acg att acc gtg cag 663Gly Tyr Gln Ser Ser
Gly Ser Ala Thr Ile Thr Val Gln190 195
2004221PRTBotryosphaeria rhodina 4Met Val Ser Phe Lys Ser Ile Leu Leu Thr
Leu Thr Ala Ala Ala Ser -15 -10
-5Val Phe Ser Ala Pro Thr Pro Glu Ala Gly Glu Leu Ile Ala Arg Gln
-1 1 5 10Asn Thr Pro Ser Gly Thr Gly
Thr His Asn Gly Tyr Phe Tyr Ser Phe 15 20
25Trp Thr Asp Gly Ala Gly Gln Val Thr Tyr Thr Asn Gly Ala Gly Gly30
35 40 45Ser Tyr Ser Val
Thr Trp Ser Gly Asn Ala Gly Asn Trp Val Gly Gly 50
55 60Lys Gly Trp Gln Thr Gly Ser Ala Arg Thr
Ile Asn Tyr Ser Gly Thr 65 70
75Tyr Asn Pro Asn Gly Asn Ser Tyr Leu Ala Val Tyr Gly Trp Ser Arg
80 85 90Asn Pro Leu Val Glu Tyr Tyr Ile
Val Glu Ser Tyr Gly Thr Tyr Asn 95 100
105Pro Gly Ser Gly Gly Thr Lys Lys Gly Thr Val Thr Ser Asp Gly Gly110
115 120 125Thr Tyr Asp Ile
Tyr Val Ser Thr Arg Thr Asn Ala Pro Ser Ile Asp 130
135 140Gly Thr Gln Thr Phe Gln Gln Tyr Trp Ser
Val Arg Gln Ser Lys Arg 145 150
155Val Gly Gly Thr Val Thr Thr Lys Asn His Phe Asp Ala Trp Ala Ala
160 165 170Val Gly Leu Asn Leu Gly Thr
Phe Asp Tyr Gln Ile Val Ala Thr Glu 175 180
185Gly Tyr Gln Ser Ser Gly Ser Ala Thr Ile Thr Val Gln190
195 20051113DNABotryosphaeria
rhodinaCDS(1)..(1110)misc_feature(1)..(1110)Propeptide 5atg gtc gct atc
aac tac ctc gca acc ctg gcc ctg gcg gcc tca gca 48Met Val Ala Ile
Asn Tyr Leu Ala Thr Leu Ala Leu Ala Ala Ser Ala -15
-10 -5agc gcc atc ccc atg gac tcc cgc ctg gaa gcg
cgc caa agc ttc tcc 96Ser Ala Ile Pro Met Asp Ser Arg Leu Glu Ala
Arg Gln Ser Phe Ser -1 1 5 10atc ccc
ggc atc ggc gga cag acc gcc aac gac gtg cag tcc ggt acc 144Ile Pro
Gly Ile Gly Gly Gln Thr Ala Asn Asp Val Gln Ser Gly Thr15
20 25 30tgc aag gac gtg acg tac atc
ttc gcg cgg ggc acg acg gag cag ggc 192Cys Lys Asp Val Thr Tyr Ile
Phe Ala Arg Gly Thr Thr Glu Gln Gly 35 40
45aac atg ggc agc acg gtc ggg ccg gcg ctg aag acg aag
ctg gag gcg 240Asn Met Gly Ser Thr Val Gly Pro Ala Leu Lys Thr Lys
Leu Glu Ala 50 55 60gcc atc
ggc gcc gac aag ctc gcg acg cag ggc gtc aac tac ccg gcc 288Ala Ile
Gly Ala Asp Lys Leu Ala Thr Gln Gly Val Asn Tyr Pro Ala 65
70 75gac gtg gcg ggc acc gtc gtc ggc agc atg
tca ccc ggc cag gcc gag 336Asp Val Ala Gly Thr Val Val Gly Ser Met
Ser Pro Gly Gln Ala Glu 80 85 90ggc
agc aag aac tgc gcg cag ctg gtc aaa cag gct ttg tcc aac tgc 384Gly
Ser Lys Asn Cys Ala Gln Leu Val Lys Gln Ala Leu Ser Asn Cys95
100 105 110ccg cag acc aag atc gtg
ctg gcc ggc tac tcg cag ggc gcg cag cag 432Pro Gln Thr Lys Ile Val
Leu Ala Gly Tyr Ser Gln Gly Ala Gln Gln 115
120 125gtc cac ggc tgc ctc atc gat ttg agc gcc gat gag
gcg cag aag gtc 480Val His Gly Cys Leu Ile Asp Leu Ser Ala Asp Glu
Ala Gln Lys Val 130 135 140gcg
gcc gcc gtc acc ttc ggc gac ccc ctg cgg gcg cag cag ttc aag 528Ala
Ala Ala Val Thr Phe Gly Asp Pro Leu Arg Ala Gln Gln Phe Lys 145
150 155aac atc gac cag tcg cgc acc aag atc
ttc tgc gcc acc ggc gac ctc 576Asn Ile Asp Gln Ser Arg Thr Lys Ile
Phe Cys Ala Thr Gly Asp Leu 160 165
170gtc tgc acc aac cag ttc atc atc acg gcc gcc cac ctc tcc tat gcc
624Val Cys Thr Asn Gln Phe Ile Ile Thr Ala Ala His Leu Ser Tyr Ala175
180 185 190tcc gag tcc acc
ggc ccg gcc gcc gag ttc atc cag cag cag ctg ggc 672Ser Glu Ser Thr
Gly Pro Ala Ala Glu Phe Ile Gln Gln Gln Leu Gly 195
200 205act ctc gac tcc tct tct tcc tcg tcc aac
agc tcg tcg tcg acg acg 720Thr Leu Asp Ser Ser Ser Ser Ser Ser Asn
Ser Ser Ser Ser Thr Thr 210 215
220acg gcg tca act tcc gct gac agc agc gcc acc agt acc ggc tcg tcc
768Thr Ala Ser Thr Ser Ala Asp Ser Ser Ala Thr Ser Thr Gly Ser Ser
225 230 235gac agc agc gtt gcc tcg tct
ggc cta ggc tcc ggg ctt ctc ggt ggc 816Asp Ser Ser Val Ala Ser Ser
Gly Leu Gly Ser Gly Leu Leu Gly Gly 240 245
250ggc ttg agt ggc ttg acc ggt ggc ggt tcc agc ggt ggt tcg agt ctg
864Gly Leu Ser Gly Leu Thr Gly Gly Gly Ser Ser Gly Gly Ser Ser Leu255
260 265 270ctc agc ggc ttg
agc ggt ctg agt gga agt gat tcc agc agc agt ggc 912Leu Ser Gly Leu
Ser Gly Leu Ser Gly Ser Asp Ser Ser Ser Ser Gly 275
280 285ggt tcg agc ctc ctg agt gga ttg agc gga
ttg agc ggg agc agc ggt 960Gly Ser Ser Leu Leu Ser Gly Leu Ser Gly
Leu Ser Gly Ser Ser Gly 290 295
300tcc agc gac agc ggt tcg agc atg ctt ggc ggg ctc agc ggt ctc agt
1008Ser Ser Asp Ser Gly Ser Ser Met Leu Gly Gly Leu Ser Gly Leu Ser
305 310 315ggg ctt agc ggg ctg gga gga
tcg tcg agc ggc gga tcg ggc ctc atg 1056Gly Leu Ser Gly Leu Gly Gly
Ser Ser Ser Gly Gly Ser Gly Leu Met 320 325
330agc ggt ttg agc ggt ctg agt ggc ctg agc ggc ctt ggg ggc tcg aag
1104Ser Gly Leu Ser Gly Leu Ser Gly Leu Ser Gly Leu Gly Gly Ser Lys335
340 345 350aag aac tga
1113Lys
Asn6370PRTBotryosphaeria rhodina 6Met Val Ala Ile Asn Tyr Leu Ala Thr Leu
Ala Leu Ala Ala Ser Ala -15 -10
-5Ser Ala Ile Pro Met Asp Ser Arg Leu Glu Ala Arg Gln Ser Phe Ser -1
1 5 10Ile Pro Gly Ile Gly Gly Gln Thr Ala
Asn Asp Val Gln Ser Gly Thr15 20 25
30Cys Lys Asp Val Thr Tyr Ile Phe Ala Arg Gly Thr Thr Glu
Gln Gly 35 40 45Asn Met
Gly Ser Thr Val Gly Pro Ala Leu Lys Thr Lys Leu Glu Ala 50
55 60Ala Ile Gly Ala Asp Lys Leu Ala Thr
Gln Gly Val Asn Tyr Pro Ala 65 70
75Asp Val Ala Gly Thr Val Val Gly Ser Met Ser Pro Gly Gln Ala Glu 80
85 90Gly Ser Lys Asn Cys Ala Gln Leu Val
Lys Gln Ala Leu Ser Asn Cys95 100 105
110Pro Gln Thr Lys Ile Val Leu Ala Gly Tyr Ser Gln Gly Ala
Gln Gln 115 120 125Val His
Gly Cys Leu Ile Asp Leu Ser Ala Asp Glu Ala Gln Lys Val 130
135 140Ala Ala Ala Val Thr Phe Gly Asp Pro
Leu Arg Ala Gln Gln Phe Lys 145 150
155Asn Ile Asp Gln Ser Arg Thr Lys Ile Phe Cys Ala Thr Gly Asp Leu
160 165 170Val Cys Thr Asn Gln Phe Ile
Ile Thr Ala Ala His Leu Ser Tyr Ala175 180
185 190Ser Glu Ser Thr Gly Pro Ala Ala Glu Phe Ile Gln
Gln Gln Leu Gly 195 200
205Thr Leu Asp Ser Ser Ser Ser Ser Ser Asn Ser Ser Ser Ser Thr Thr
210 215 220Thr Ala Ser Thr Ser Ala
Asp Ser Ser Ala Thr Ser Thr Gly Ser Ser 225 230
235Asp Ser Ser Val Ala Ser Ser Gly Leu Gly Ser Gly Leu Leu
Gly Gly 240 245 250Gly Leu Ser Gly Leu
Thr Gly Gly Gly Ser Ser Gly Gly Ser Ser Leu255 260
265 270Leu Ser Gly Leu Ser Gly Leu Ser Gly Ser
Asp Ser Ser Ser Ser Gly 275 280
285Gly Ser Ser Leu Leu Ser Gly Leu Ser Gly Leu Ser Gly Ser Ser Gly
290 295 300Ser Ser Asp Ser Gly
Ser Ser Met Leu Gly Gly Leu Ser Gly Leu Ser 305
310 315Gly Leu Ser Gly Leu Gly Gly Ser Ser Ser Gly Gly
Ser Gly Leu Met 320 325 330Ser Gly Leu
Ser Gly Leu Ser Gly Leu Ser Gly Leu Gly Gly Ser Lys335
340 345 350Lys Asn71350DNABotryosphaeria
rhodinaCDS(1)..(1347)misc_feature(1)..(1347)Propeptide 7atg cat ttg tcc
agt gtt tgt ctc gtc ctc agt ggg ctt ctc ctt acc 48Met His Leu Ser
Ser Val Cys Leu Val Leu Ser Gly Leu Leu Leu Thr -15
-10 -5aac gct gcc cca gcc cct gtc cct gaa aat ggg
ctc gag aag agg cag 96Asn Ala Ala Pro Ala Pro Val Pro Glu Asn Gly
Leu Glu Lys Arg Gln -1 1 5 10tcc ctg
agc agc gtc ctg agc gcc ctc agt ggc ctg acc gaa cct acg 144Ser Leu
Ser Ser Val Leu Ser Ala Leu Ser Gly Leu Thr Glu Pro Thr15
20 25 30gcc atc ttg tct cag ctc gag
gcg gtt gaa gcg aca tcg acg ccc acc 192Ala Ile Leu Ser Gln Leu Glu
Ala Val Glu Ala Thr Ser Thr Pro Thr 35 40
45agc gtc gag cag gcg cag gag cag ctc gag gcc atc tac
ggg acg aca 240Ser Val Glu Gln Ala Gln Glu Gln Leu Glu Ala Ile Tyr
Gly Thr Thr 50 55 60cca acc
aac atc ttc gag aac atc gcg cag caa atc gcc gac gga ctg 288Pro Thr
Asn Ile Phe Glu Asn Ile Ala Gln Gln Ile Ala Asp Gly Leu 65
70 75tcg acg ctg acc atc gtc caa gcc ctc ggc
ttc tcc ccc agc ggc gag 336Ser Thr Leu Thr Ile Val Gln Ala Leu Gly
Phe Ser Pro Ser Gly Glu 80 85 90aac
tcg gaa acc aac agc aac acg cgc gaa ccg tcg acg acc atc tac 384Asn
Ser Glu Thr Asn Ser Asn Thr Arg Glu Pro Ser Thr Thr Ile Tyr95
100 105 110ccc aag aag tcg tcc tcg
gat gcc ccc tat tcc atc act gag gaa gag 432Pro Lys Lys Ser Ser Ser
Asp Ala Pro Tyr Ser Ile Thr Glu Glu Glu 115
120 125ctc cgc caa gcc atc tac atc ccc tcc gac ttc acg
tac ggc gac aag 480Leu Arg Gln Ala Ile Tyr Ile Pro Ser Asp Phe Thr
Tyr Gly Asp Lys 130 135 140ccg
ccg gtc atc ttc gtg ccg ggc acg ggc tcg tac ggc ggc atc agc 528Pro
Pro Val Ile Phe Val Pro Gly Thr Gly Ser Tyr Gly Gly Ile Ser 145
150 155ttc gga tcg aac ctg cgc aag ctg ctg
acg ggc gtg tcg tac gcg gac 576Phe Gly Ser Asn Leu Arg Lys Leu Leu
Thr Gly Val Ser Tyr Ala Asp 160 165
170ccg gtc tgg ctc aac gtg ccg gac gcg ctg ctg cgc gac gcg cag acg
624Pro Val Trp Leu Asn Val Pro Asp Ala Leu Leu Arg Asp Ala Gln Thr175
180 185 190aac ggc gag ttc
gtg gcg tac gcc atc aac tac atc tcg ggc ata tcc 672Asn Gly Glu Phe
Val Ala Tyr Ala Ile Asn Tyr Ile Ser Gly Ile Ser 195
200 205ggc gac gcc aac gtg tcg gtc gtc tcg tgg
tcg cag ggc ggg ctg gac 720Gly Asp Ala Asn Val Ser Val Val Ser Trp
Ser Gln Gly Gly Leu Asp 210 215
220acg cag tgg gct ttt act tat tgg ccg tcg acg cgc gcc ctg gtc tct
768Thr Gln Trp Ala Phe Thr Tyr Trp Pro Ser Thr Arg Ala Leu Val Ser
225 230 235gac ttc gtg ccc gtc agc ccg
gac ttc cac ggc acc gtc ctg gcc aac 816Asp Phe Val Pro Val Ser Pro
Asp Phe His Gly Thr Val Leu Ala Asn 240 245
250gtc atc tgc ctc aac ccg ggc gcc ggc ggt gtt ggg ttg ggc ccc tgc
864Val Ile Cys Leu Asn Pro Gly Ala Gly Gly Val Gly Leu Gly Pro Cys255
260 265 270gcg ccg gcg gtg
ctg cag cag gag tac aac agc aac ttc gtc acg gcc 912Ala Pro Ala Val
Leu Gln Gln Glu Tyr Asn Ser Asn Phe Val Thr Ala 275
280 285ctg cgc gcg gcg ggc ggt gcg gac gct tac
gtg ccg acg acg tct gtt 960Leu Arg Ala Ala Gly Gly Ala Asp Ala Tyr
Val Pro Thr Thr Ser Val 290 295
300ttc tct ggc ttc ctc gat gag att gtc cag ccg cag tcc ggc acc ggc
1008Phe Ser Gly Phe Leu Asp Glu Ile Val Gln Pro Gln Ser Gly Thr Gly
305 310 315gcg tcc gcg tac atc aat gat
gct agg ggt gtg ggc acg acc aat gct 1056Ala Ser Ala Tyr Ile Asn Asp
Ala Arg Gly Val Gly Thr Thr Asn Ala 320 325
330gag gtg cag gtc gtg tgc aag ggc aag ggt ccc gct ggc ggt ttt tac
1104Glu Val Gln Val Val Cys Lys Gly Lys Gly Pro Ala Gly Gly Phe Tyr335
340 345 350acg cac gag agc
ttg ctg gtc aac ccg ctg acc tat gct ctc ctc gtc 1152Thr His Glu Ser
Leu Leu Val Asn Pro Leu Thr Tyr Ala Leu Leu Val 355
360 365gat gcc ttg acc cat gat ggc ccg ggt agt
gtg gac agg ctg gat ctg 1200Asp Ala Leu Thr His Asp Gly Pro Gly Ser
Val Asp Arg Leu Asp Leu 370 375
380gat acc gtg tgc tcg acc gtc gtg gcg ccc ggc ctg ggg ctg gat gcg
1248Asp Thr Val Cys Ser Thr Val Val Ala Pro Gly Leu Gly Leu Asp Ala
385 390 395ttg ttg gag att gag ggc gtg
aat gtt ctg gcc gct gtc aat ctg ttg 1296Leu Leu Glu Ile Glu Gly Val
Asn Val Leu Ala Ala Val Asn Leu Leu 400 405
410acc tac tcg gac agg agg ttg gcc gag ccg gcg ctg atg tct tat gcg
1344Thr Tyr Ser Asp Arg Arg Leu Ala Glu Pro Ala Leu Met Ser Tyr Ala415
420 425 430gct taa
1350Ala8449PRTBotryosphaeria rhodina 8Met His Leu Ser Ser Val Cys Leu Val
Leu Ser Gly Leu Leu Leu Thr -15 -10
-5Asn Ala Ala Pro Ala Pro Val Pro Glu Asn Gly Leu Glu Lys Arg Gln
-1 1 5 10Ser Leu Ser Ser Val Leu Ser Ala
Leu Ser Gly Leu Thr Glu Pro Thr15 20 25
30Ala Ile Leu Ser Gln Leu Glu Ala Val Glu Ala Thr Ser
Thr Pro Thr 35 40 45Ser
Val Glu Gln Ala Gln Glu Gln Leu Glu Ala Ile Tyr Gly Thr Thr 50
55 60Pro Thr Asn Ile Phe Glu Asn Ile
Ala Gln Gln Ile Ala Asp Gly Leu 65 70
75Ser Thr Leu Thr Ile Val Gln Ala Leu Gly Phe Ser Pro Ser Gly Glu
80 85 90Asn Ser Glu Thr Asn Ser Asn Thr
Arg Glu Pro Ser Thr Thr Ile Tyr95 100
105 110Pro Lys Lys Ser Ser Ser Asp Ala Pro Tyr Ser Ile
Thr Glu Glu Glu 115 120
125Leu Arg Gln Ala Ile Tyr Ile Pro Ser Asp Phe Thr Tyr Gly Asp Lys
130 135 140Pro Pro Val Ile Phe Val
Pro Gly Thr Gly Ser Tyr Gly Gly Ile Ser 145 150
155Phe Gly Ser Asn Leu Arg Lys Leu Leu Thr Gly Val Ser Tyr
Ala Asp 160 165 170Pro Val Trp Leu Asn
Val Pro Asp Ala Leu Leu Arg Asp Ala Gln Thr175 180
185 190Asn Gly Glu Phe Val Ala Tyr Ala Ile Asn
Tyr Ile Ser Gly Ile Ser 195 200
205Gly Asp Ala Asn Val Ser Val Val Ser Trp Ser Gln Gly Gly Leu Asp
210 215 220Thr Gln Trp Ala Phe
Thr Tyr Trp Pro Ser Thr Arg Ala Leu Val Ser 225
230 235Asp Phe Val Pro Val Ser Pro Asp Phe His Gly Thr
Val Leu Ala Asn 240 245 250Val Ile Cys
Leu Asn Pro Gly Ala Gly Gly Val Gly Leu Gly Pro Cys255
260 265 270Ala Pro Ala Val Leu Gln Gln
Glu Tyr Asn Ser Asn Phe Val Thr Ala 275
280 285Leu Arg Ala Ala Gly Gly Ala Asp Ala Tyr Val Pro
Thr Thr Ser Val 290 295 300Phe
Ser Gly Phe Leu Asp Glu Ile Val Gln Pro Gln Ser Gly Thr Gly 305
310 315Ala Ser Ala Tyr Ile Asn Asp Ala Arg
Gly Val Gly Thr Thr Asn Ala 320 325
330Glu Val Gln Val Val Cys Lys Gly Lys Gly Pro Ala Gly Gly Phe Tyr335
340 345 350Thr His Glu Ser
Leu Leu Val Asn Pro Leu Thr Tyr Ala Leu Leu Val 355
360 365Asp Ala Leu Thr His Asp Gly Pro Gly Ser
Val Asp Arg Leu Asp Leu 370 375
380Asp Thr Val Cys Ser Thr Val Val Ala Pro Gly Leu Gly Leu Asp Ala
385 390 395Leu Leu Glu Ile Glu Gly Val
Asn Val Leu Ala Ala Val Asn Leu Leu 400 405
410Thr Tyr Ser Asp Arg Arg Leu Ala Glu Pro Ala Leu Met Ser Tyr
Ala415 420 425 430Ala
9555DNABotryosphaeria rhodinaCDS(1)..(555) 9atg cgc ttc gcc acc gcc gcc
acc gcc ctc gcc ctc acc ggc ttc tgc 48Met Arg Phe Ala Thr Ala Ala
Thr Ala Leu Ala Leu Thr Gly Phe Cys1 5 10
15agc gcc gcc gtc ctg ccg cgc gcc acc gag cac aag gtc
tac gtc gac 96Ser Ala Ala Val Leu Pro Arg Ala Thr Glu His Lys Val
Tyr Val Asp 20 25 30act tcc
aag tgc gcc gac aac ggc cgc acc ctg ccg cag atc tac ggc 144Thr Ser
Lys Cys Ala Asp Asn Gly Arg Thr Leu Pro Gln Ile Tyr Gly 35
40 45 atc tcc aac tcg acc tcg cag gac ttc acc
gac ccg cag cgc ttc gac 192Ile Ser Asn Ser Thr Ser Gln Asp Phe Thr
Asp Pro Gln Arg Phe Asp 50 55 60ggg
ccc acc ttc acc ttc acc gtg ccc gcc tac tac cag ggc cac ctc 240Gly
Pro Thr Phe Thr Phe Thr Val Pro Ala Tyr Tyr Gln Gly His Leu65
70 75 80tgg ctg tac aac agc gac
gac cag gcc gcc tcg agc ggt gac aac acc 288Trp Leu Tyr Asn Ser Asp
Asp Gln Ala Ala Ser Ser Gly Asp Asn Thr 85
90 95ccc ctg aac gtc cag ggc gtc gac ttc tac ttc tac
gac cag ccc acc 336Pro Leu Asn Val Gln Gly Val Asp Phe Tyr Phe Tyr
Asp Gln Pro Thr 100 105 110gac
gtc gag cgc aac cag gcc acc gtg ccc gct gag ggc gac gcc aac 384Asp
Val Glu Arg Asn Gln Ala Thr Val Pro Ala Glu Gly Asp Ala Asn 115
120 125cag gac ggc cag gtg tac agc gtt ccc
gac ccc atc act gcc gtc cgc 432Gln Asp Gly Gln Val Tyr Ser Val Pro
Asp Pro Ile Thr Ala Val Arg 130 135
140ttc gcc agc acc cct agc agc acc ttc atc gag ggc aag agc ggc ggg
480Phe Ala Ser Thr Pro Ser Ser Thr Phe Ile Glu Gly Lys Ser Gly Gly145
150 155 160cac tct gta cag
cac cca gga ggg cga cgc tct gta cgt cta cta ctg 528His Ser Val Gln
His Pro Gly Gly Arg Arg Ser Val Arg Leu Leu Leu 165
170 175cga gga gtg gcc cgt cca gaa cta gag
555Arg Gly Val Ala Arg Pro Glu Leu Glu
180 18510185PRTBotryosphaeria rhodina 10Met Arg Phe
Ala Thr Ala Ala Thr Ala Leu Ala Leu Thr Gly Phe Cys1 5
10 15Ser Ala Ala Val Leu Pro Arg Ala Thr
Glu His Lys Val Tyr Val Asp 20 25
30Thr Ser Lys Cys Ala Asp Asn Gly Arg Thr Leu Pro Gln Ile Tyr Gly
35 40 45Ile Ser Asn Ser Thr Ser Gln
Asp Phe Thr Asp Pro Gln Arg Phe Asp 50 55
60Gly Pro Thr Phe Thr Phe Thr Val Pro Ala Tyr Tyr Gln Gly His Leu65
70 75 80Trp Leu Tyr Asn
Ser Asp Asp Gln Ala Ala Ser Ser Gly Asp Asn Thr 85
90 95Pro Leu Asn Val Gln Gly Val Asp Phe Tyr
Phe Tyr Asp Gln Pro Thr 100 105
110Asp Val Glu Arg Asn Gln Ala Thr Val Pro Ala Glu Gly Asp Ala Asn
115 120 125Gln Asp Gly Gln Val Tyr Ser
Val Pro Asp Pro Ile Thr Ala Val Arg 130 135
140Phe Ala Ser Thr Pro Ser Ser Thr Phe Ile Glu Gly Lys Ser Gly
Gly145 150 155 160His Ser
Val Gln His Pro Gly Gly Arg Arg Ser Val Arg Leu Leu Leu
165 170 175Arg Gly Val Ala Arg Pro Glu
Leu Glu 180 18511702DNABotryosphaeria
rhodinaCDS(1)..(702)transit_peptide(1)..(48)misc_feature(1)..(702)propept-
ide 11atg aag ggt ctc ttc gct att ctt gcc acg gct tcg gtc gtc tct gcc
48Met Lys Gly Leu Phe Ala Ile Leu Ala Thr Ala Ser Val Val Ser Ala -15
-10 -5 -1cac gcc acc tgg cag
gag ctc tgg gtt ggt act gag gac aag gag gga 96His Ala Thr Trp Gln
Glu Leu Trp Val Gly Thr Glu Asp Lys Glu Gly1 5
10 15act tgc atc cgc ctt cct cag agc aac agc ccc
gtc acc gat gtc acc 144Thr Cys Ile Arg Leu Pro Gln Ser Asn Ser Pro
Val Thr Asp Val Thr 20 25
30tcc aac gac atc cgc tgc aac gcc agc ccc agc gct gcc tcg acc act
192Ser Asn Asp Ile Arg Cys Asn Ala Ser Pro Ser Ala Ala Ser Thr Thr
35 40 45tgc tcc gtt gcc gcc ggc ggt tca
ctg acg gtt gag atg cac cag cag 240Cys Ser Val Ala Ala Gly Gly Ser
Leu Thr Val Glu Met His Gln Gln 50 55
60ccc aac gac cgc agc tgc gac aac gag gcc atc ggt ggc aac cac ttc
288Pro Asn Asp Arg Ser Cys Asp Asn Glu Ala Ile Gly Gly Asn His Phe65
70 75 80ggc cca gtc atg atc
tac atg tcc aag gtc gac gac gcc gcc act gcc 336Gly Pro Val Met Ile
Tyr Met Ser Lys Val Asp Asp Ala Ala Thr Ala 85
90 95gat ggc tct ggc gac tgg ttc aag gtc gct cag
gac acc tac aac ggc 384Asp Gly Ser Gly Asp Trp Phe Lys Val Ala Gln
Asp Thr Tyr Asn Gly 100 105
110act gag gct agc tgg ggt acc gag atc ctc aac gcc aac tgc ggc aag
432Thr Glu Ala Ser Trp Gly Thr Glu Ile Leu Asn Ala Asn Cys Gly Lys
115 120 125cgc gcc ttc acc gtc ccc aag
tct ctc ccg tcg ggc gac tac ctc gtc 480Arg Ala Phe Thr Val Pro Lys
Ser Leu Pro Ser Gly Asp Tyr Leu Val 130 135
140cgc gcc gag gcg ctg gcc ctg cac agc gca ggt agc gag ggc ggt gct
528Arg Ala Glu Ala Leu Ala Leu His Ser Ala Gly Ser Glu Gly Gly Ala145
150 155 160cag ttc tac atg
agc tgc tac cag gtc acc gtc acc ggc ggc ggc agc 576Gln Phe Tyr Met
Ser Cys Tyr Gln Val Thr Val Thr Gly Gly Gly Ser 165
170 175gcc acc ccg tcc ccg acc gtc aag ttc cct
ggc gcc tac agc gcc gac 624Ala Thr Pro Ser Pro Thr Val Lys Phe Pro
Gly Ala Tyr Ser Ala Asp 180 185
190gat gct ggt atc ctc atc aac atc tac cag acc ccg ctg acg tac gag
672Asp Ala Gly Ile Leu Ile Asn Ile Tyr Gln Thr Pro Leu Thr Tyr Glu
195 200 205gcc cct ggc ccg gct gtc tgg
agc ggt aac 702Ala Pro Gly Pro Ala Val Trp
Ser Gly Asn 210 21512234PRTBotryosphaeria rhodina
12Met Lys Gly Leu Phe Ala Ile Leu Ala Thr Ala Ser Val Val Ser Ala -15
-10 -5 -1His Ala Thr Trp Gln
Glu Leu Trp Val Gly Thr Glu Asp Lys Glu Gly1 5
10 15Thr Cys Ile Arg Leu Pro Gln Ser Asn Ser Pro
Val Thr Asp Val Thr 20 25
30Ser Asn Asp Ile Arg Cys Asn Ala Ser Pro Ser Ala Ala Ser Thr Thr
35 40 45Cys Ser Val Ala Ala Gly Gly Ser
Leu Thr Val Glu Met His Gln Gln 50 55
60Pro Asn Asp Arg Ser Cys Asp Asn Glu Ala Ile Gly Gly Asn His Phe65
70 75 80Gly Pro Val Met Ile
Tyr Met Ser Lys Val Asp Asp Ala Ala Thr Ala 85
90 95Asp Gly Ser Gly Asp Trp Phe Lys Val Ala Gln
Asp Thr Tyr Asn Gly 100 105
110Thr Glu Ala Ser Trp Gly Thr Glu Ile Leu Asn Ala Asn Cys Gly Lys
115 120 125Arg Ala Phe Thr Val Pro Lys
Ser Leu Pro Ser Gly Asp Tyr Leu Val 130 135
140Arg Ala Glu Ala Leu Ala Leu His Ser Ala Gly Ser Glu Gly Gly
Ala145 150 155 160Gln Phe
Tyr Met Ser Cys Tyr Gln Val Thr Val Thr Gly Gly Gly Ser
165 170 175Ala Thr Pro Ser Pro Thr Val
Lys Phe Pro Gly Ala Tyr Ser Ala Asp 180 185
190Asp Ala Gly Ile Leu Ile Asn Ile Tyr Gln Thr Pro Leu Thr
Tyr Glu 195 200 205Ala Pro Gly Pro
Ala Val Trp Ser Gly Asn 210 21513786DNABotryosphaeria
rhodinaCDS(1)..(786)transit_peptide(1)..(39)misc_feature(1)..(786)propept-
ide 13atg ttc ttc tcc caa aag ctc atc gcg gcc gtc gcc gcc ctc ccc gac
48Met Phe Phe Ser Gln Lys Leu Ile Ala Ala Val Ala Ala Leu Pro Asp
-10 -5 -1 1cat gac ttc ggc cca cta ctt
ctg tcc gca act cat cgt caa cgg cga 96His Asp Phe Gly Pro Leu Leu
Leu Ser Ala Thr His Arg Gln Arg Arg 5 10
15acc tcc gag caa tgg gaa tac gtc cgc gaa acc tct cag ggc tac gag
144Thr Ser Glu Gln Trp Glu Tyr Val Arg Glu Thr Ser Gln Gly Tyr Glu20
25 30 35ccg caa tac act
ccg gac atc ctc acc tcc aac gac ctg cgc tgc aac 192Pro Gln Tyr Thr
Pro Asp Ile Leu Thr Ser Asn Asp Leu Arg Cys Asn 40
45 50acg gac agc ctc gcc gcc gct gcc aac acc
aag gtc gcg tcc gtc gcg 240Thr Asp Ser Leu Ala Ala Ala Ala Asn Thr
Lys Val Ala Ser Val Ala 55 60
65gcc ggc gac acc gtc tcc ttc gtc acc gac tac ggc gcc aag gtg cag
288Ala Gly Asp Thr Val Ser Phe Val Thr Asp Tyr Gly Ala Lys Val Gln
70 75 80cac ccg ggc ccg ctg acg ttc tgg
atg tcg cag gcg ccg ggc ggg gat 336His Pro Gly Pro Leu Thr Phe Trp
Met Ser Gln Ala Pro Gly Gly Asp 85 90
95gta acc aca tac gat ggc tca ggc gat tgg ttc aag atc ggc gtc gtg
384Val Thr Thr Tyr Asp Gly Ser Gly Asp Trp Phe Lys Ile Gly Val Val100
105 110 115ggc tac gac acg
ccg ttc gac tcg acg gga acg aac tgg cgc gcc tac 432Gly Tyr Asp Thr
Pro Phe Asp Ser Thr Gly Thr Asn Trp Arg Ala Tyr 120
125 130gat gag ggc acg ttc aac gtg tcc atc ccg
aca acg gtg ccg aat ggc 480Asp Glu Gly Thr Phe Asn Val Ser Ile Pro
Thr Thr Val Pro Asn Gly 135 140
145caa tac ttg ctg cgc atc gag cat atc ggc ctg cac cgc ccg tcg acg
528Gln Tyr Leu Leu Arg Ile Glu His Ile Gly Leu His Arg Pro Ser Thr
150 155 160cgc gag atg ttc ttc aac tgc
gcg cag gtt gag gtg acg ggg tcg tcc 576Arg Glu Met Phe Phe Asn Cys
Ala Gln Val Glu Val Thr Gly Ser Ser 165 170
175gcc aca gcg gtg ccg agt gag acg gcg aag att cct gcg gga tct ata
624Ala Thr Ala Val Pro Ser Glu Thr Ala Lys Ile Pro Ala Gly Ser Ile180
185 190 195gtg aga gcg atg
agt ggg tgt cca agt gga gca tgt ata gta gcc cga 672Val Arg Ala Met
Ser Gly Cys Pro Ser Gly Ala Cys Ile Val Ala Arg 200
205 210gca gct tcc cgt act ctg gcc cag cta ctg
ttg atg gtg gtg ttt ttg 720Ala Ala Ser Arg Thr Leu Ala Gln Leu Leu
Leu Met Val Val Phe Leu 215 220
225att ctc agg gct ctg att ctg ctt aaa tgg gcg gga ttt tcc ctt tcc
768Ile Leu Arg Ala Leu Ile Leu Leu Lys Trp Ala Gly Phe Ser Leu Ser
230 235 240ata tgt tct att gtt gta
786Ile Cys Ser Ile Val Val
24514262PRTBotryosphaeria rhodina 14Met Phe Phe Ser Gln Lys Leu Ile Ala
Ala Val Ala Ala Leu Pro Asp -10 -5
-1 1His Asp Phe Gly Pro Leu Leu Leu Ser Ala Thr His Arg Gln Arg Arg
5 10 15Thr Ser Glu Gln Trp Glu Tyr Val
Arg Glu Thr Ser Gln Gly Tyr Glu20 25 30
35Pro Gln Tyr Thr Pro Asp Ile Leu Thr Ser Asn Asp Leu
Arg Cys Asn 40 45 50Thr
Asp Ser Leu Ala Ala Ala Ala Asn Thr Lys Val Ala Ser Val Ala 55
60 65Ala Gly Asp Thr Val Ser Phe Val
Thr Asp Tyr Gly Ala Lys Val Gln 70 75
80His Pro Gly Pro Leu Thr Phe Trp Met Ser Gln Ala Pro Gly Gly Asp
85 90 95Val Thr Thr Tyr Asp Gly Ser Gly
Asp Trp Phe Lys Ile Gly Val Val100 105
110 115Gly Tyr Asp Thr Pro Phe Asp Ser Thr Gly Thr Asn
Trp Arg Ala Tyr 120 125
130Asp Glu Gly Thr Phe Asn Val Ser Ile Pro Thr Thr Val Pro Asn Gly
135 140 145Gln Tyr Leu Leu Arg Ile
Glu His Ile Gly Leu His Arg Pro Ser Thr 150 155
160Arg Glu Met Phe Phe Asn Cys Ala Gln Val Glu Val Thr Gly
Ser Ser 165 170 175Ala Thr Ala Val Pro
Ser Glu Thr Ala Lys Ile Pro Ala Gly Ser Ile180 185
190 195Val Arg Ala Met Ser Gly Cys Pro Ser Gly
Ala Cys Ile Val Ala Arg 200 205
210Ala Ala Ser Arg Thr Leu Ala Gln Leu Leu Leu Met Val Val Phe Leu
215 220 225Ile Leu Arg Ala Leu
Ile Leu Leu Lys Trp Ala Gly Phe Ser Leu Ser 230
235 240Ile Cys Ser Ile Val Val
24515819DNABotryosphaeria
rhodinaCDS(1)..(819)transit_peptide(1)..(54)misc_feature(1)..(819)propept-
ide 15atg tct ttc aag tct ctt gct gtt att gcc gct ggt gcg gcc acc gcc
48Met Ser Phe Lys Ser Leu Ala Val Ile Ala Ala Gly Ala Ala Thr Ala
-15 -10 -5aac gcc cac ggt gtc atc ctg
gac atc gtg tct ggc ggc aag acc tac 96Asn Ala His Gly Val Ile Leu
Asp Ile Val Ser Gly Gly Lys Thr Tyr -1 1 5
10ggt ggc tgg gac gcc agc tac gtc tac tac aac ccc gtc ccc gag gtt
144Gly Gly Trp Asp Ala Ser Tyr Val Tyr Tyr Asn Pro Val Pro Glu Val15
20 25 30gct gcc tgg cag
tct ggt ggc ttc ggc cac ggc ccc atc gtc ggc acc 192Ala Ala Trp Gln
Ser Gly Gly Phe Gly His Gly Pro Ile Val Gly Thr 35
40 45cag tac tcg acc gct tcc atc aac tgc cac
gac gac gct att gcc gct 240Gln Tyr Ser Thr Ala Ser Ile Asn Cys His
Asp Asp Ala Ile Ala Ala 50 55
60ccc atc tac atg gag gcc gcc gcc ggt gac gag atc gcc atc tcc tgg
288Pro Ile Tyr Met Glu Ala Ala Ala Gly Asp Glu Ile Ala Ile Ser Trp
65 70 75ggt acc cct ggc aac ccc ccc agc
gcc tgg ccc acg agc cac cac ggc 336Gly Thr Pro Gly Asn Pro Pro Ser
Ala Trp Pro Thr Ser His His Gly 80 85
90ccc atc att acc tac atg gct cct tgc ggt ggt gct gat gct act ggc
384Pro Ile Ile Thr Tyr Met Ala Pro Cys Gly Gly Ala Asp Ala Thr Gly95
100 105 110gac tgc acc tcc
ctg aac gtc acc gac ctc gct tgg acc aag gtc tac 432Asp Cys Thr Ser
Leu Asn Val Thr Asp Leu Ala Trp Thr Lys Val Tyr 115
120 125cag aag ggt ctc atc acc ggc ggt gat gtt
gac agc cag gtc tgg gcc 480Gln Lys Gly Leu Ile Thr Gly Gly Asp Val
Asp Ser Gln Val Trp Ala 130 135
140acc gac gag ctc atc tcg aac aac aag acc atg gtc acc atc ccc tcc
528Thr Asp Glu Leu Ile Ser Asn Asn Lys Thr Met Val Thr Ile Pro Ser
145 150 155tcg ctc gcc ccg ggc aac tac
gtc ctc cgc aac gag atc atc gcc ctt 576Ser Leu Ala Pro Gly Asn Tyr
Val Leu Arg Asn Glu Ile Ile Ala Leu 160 165
170cac gcc ggc ggt gag gtc aac ggc ccc cag aac tac ccc cag tgc tac
624His Ala Gly Gly Glu Val Asn Gly Pro Gln Asn Tyr Pro Gln Cys Tyr175
180 185 190aac gtc aag atc
acc ggc tct ggc tcc gga aag ctt acc gac ggc gtc 672Asn Val Lys Ile
Thr Gly Ser Gly Ser Gly Lys Leu Thr Asp Gly Val 195
200 205aag ggc acc gag ctc tac acc ccc gag gac
acc gtc ttc aac atc tac 720Lys Gly Thr Glu Leu Tyr Thr Pro Glu Asp
Thr Val Phe Asn Ile Tyr 210 215
220gcc aac att gac agc tac ccc ttc ccc ggc ccc gag ctc tgg agc ggc
768Ala Asn Ile Asp Ser Tyr Pro Phe Pro Gly Pro Glu Leu Trp Ser Gly
225 230 235gct tcc tct acc tcc aac gcc
acc aag cgc tct ttc cgt acc ttc aag 816Ala Ser Ser Thr Ser Asn Ala
Thr Lys Arg Ser Phe Arg Thr Phe Lys 240 245
250gca
819Ala25516273PRTBotryosphaeria rhodina 16Met Ser Phe Lys Ser Leu Ala
Val Ile Ala Ala Gly Ala Ala Thr Ala -15 -10
-5Asn Ala His Gly Val Ile Leu Asp Ile Val Ser Gly Gly Lys
Thr Tyr -1 1 5 10Gly Gly Trp Asp Ala
Ser Tyr Val Tyr Tyr Asn Pro Val Pro Glu Val15 20
25 30Ala Ala Trp Gln Ser Gly Gly Phe Gly His
Gly Pro Ile Val Gly Thr 35 40
45Gln Tyr Ser Thr Ala Ser Ile Asn Cys His Asp Asp Ala Ile Ala Ala
50 55 60Pro Ile Tyr Met Glu Ala
Ala Ala Gly Asp Glu Ile Ala Ile Ser Trp 65 70
75Gly Thr Pro Gly Asn Pro Pro Ser Ala Trp Pro Thr Ser His
His Gly 80 85 90Pro Ile Ile Thr Tyr
Met Ala Pro Cys Gly Gly Ala Asp Ala Thr Gly95 100
105 110Asp Cys Thr Ser Leu Asn Val Thr Asp Leu
Ala Trp Thr Lys Val Tyr 115 120
125Gln Lys Gly Leu Ile Thr Gly Gly Asp Val Asp Ser Gln Val Trp Ala
130 135 140Thr Asp Glu Leu Ile
Ser Asn Asn Lys Thr Met Val Thr Ile Pro Ser 145
150 155Ser Leu Ala Pro Gly Asn Tyr Val Leu Arg Asn Glu
Ile Ile Ala Leu 160 165 170His Ala Gly
Gly Glu Val Asn Gly Pro Gln Asn Tyr Pro Gln Cys Tyr175
180 185 190Asn Val Lys Ile Thr Gly Ser
Gly Ser Gly Lys Leu Thr Asp Gly Val 195
200 205Lys Gly Thr Glu Leu Tyr Thr Pro Glu Asp Thr Val
Phe Asn Ile Tyr 210 215 220Ala
Asn Ile Asp Ser Tyr Pro Phe Pro Gly Pro Glu Leu Trp Ser Gly 225
230 235Ala Ser Ser Thr Ser Asn Ala Thr Lys
Arg Ser Phe Arg Thr Phe Lys 240 245
250Ala25517675DNABotryosphaeria
rhodinaCDS(1)..(675)sig_peptide(1)..(60)misc_feature(1)..(675)propeptide
17atg aag act ttc act act ttc gca ttc gct gcc tct gtg ctg gca cag
48Met Lys Thr Phe Thr Thr Phe Ala Phe Ala Ala Ser Val Leu Ala Gln-20
-15 -10 -5gct gtc aac gga cac
tac atc ttc caa tac ctc act gcc aac ggc gtg 96Ala Val Asn Gly His
Tyr Ile Phe Gln Tyr Leu Thr Ala Asn Gly Val -1 1
5 10aag ggt ggt atc tat cag aac att agg gag aac acg
aac aac aac tcg 144Lys Gly Gly Ile Tyr Gln Asn Ile Arg Glu Asn Thr
Asn Asn Asn Ser 15 20 25ccc gtg
act gat ctc gag tcc aac gac ctc cgc tgc aat gtt ggt ggt 192Pro Val
Thr Asp Leu Glu Ser Asn Asp Leu Arg Cys Asn Val Gly Gly 30
35 40gag gat ggc agc aag act agc acg gtc tcc gtc
gct gct ggc agc acc 240Glu Asp Gly Ser Lys Thr Ser Thr Val Ser Val
Ala Ala Gly Ser Thr45 50 55
60gtc gct ttc act gcc gac atc gcc gtg tac cac cag ggc ccc gtc tct
288Val Ala Phe Thr Ala Asp Ile Ala Val Tyr His Gln Gly Pro Val Ser
65 70 75ttc tac atg aca aag
gtc gac gac gcg gcg gcg gcg gac ggc agc acg 336Phe Tyr Met Thr Lys
Val Asp Asp Ala Ala Ala Ala Asp Gly Ser Thr 80
85 90ccg tgg ttt aag atc aag gac atc gga ccc act ttc
tcc aac ggc cag 384Pro Trp Phe Lys Ile Lys Asp Ile Gly Pro Thr Phe
Ser Asn Gly Gln 95 100 105gcg act
tgg gac ctc gag acg acg tac aac gtg acc atc ccc aac tgc 432Ala Thr
Trp Asp Leu Glu Thr Thr Tyr Asn Val Thr Ile Pro Asn Cys 110
115 120ctt ccc gcc ggc gag tac ctg ctg cgc atc cag
cag ctt ggc atc cac 480Leu Pro Ala Gly Glu Tyr Leu Leu Arg Ile Gln
Gln Leu Gly Ile His125 130 135
140aac ccg tgg ccg gcc ggc atc ccg caa ttc tac atc tcg tgc gcc cag
528Asn Pro Trp Pro Ala Gly Ile Pro Gln Phe Tyr Ile Ser Cys Ala Gln
145 150 155gtc aag gtc acg ggc
agc ggc tcg ggc tcg ccc agc ccg act gtt tcc 576Val Lys Val Thr Gly
Ser Gly Ser Gly Ser Pro Ser Pro Thr Val Ser 160
165 170atc ccc ggc gcg ttc aag gag acg gac ccc ggc tat
acc gtc aac att 624Ile Pro Gly Ala Phe Lys Glu Thr Asp Pro Gly Tyr
Thr Val Asn Ile 175 180 185tac aac
gac ttc acc aac tat act gtc ccc ggc ccg gag gtg tgg acg 672Tyr Asn
Asp Phe Thr Asn Tyr Thr Val Pro Gly Pro Glu Val Trp Thr 190
195 200tgc
675Cys20518225PRTBotryosphaeria rhodina 18Met Lys
Thr Phe Thr Thr Phe Ala Phe Ala Ala Ser Val Leu Ala Gln-20
-15 -10 -5Ala Val Asn Gly His Tyr Ile
Phe Gln Tyr Leu Thr Ala Asn Gly Val -1 1 5
10Lys Gly Gly Ile Tyr Gln Asn Ile Arg Glu Asn Thr Asn Asn
Asn Ser 15 20 25Pro Val Thr Asp
Leu Glu Ser Asn Asp Leu Arg Cys Asn Val Gly Gly 30 35
40Glu Asp Gly Ser Lys Thr Ser Thr Val Ser Val Ala Ala
Gly Ser Thr45 50 55
60Val Ala Phe Thr Ala Asp Ile Ala Val Tyr His Gln Gly Pro Val Ser
65 70 75Phe Tyr Met Thr Lys Val
Asp Asp Ala Ala Ala Ala Asp Gly Ser Thr 80 85
90Pro Trp Phe Lys Ile Lys Asp Ile Gly Pro Thr Phe Ser
Asn Gly Gln 95 100 105Ala Thr Trp
Asp Leu Glu Thr Thr Tyr Asn Val Thr Ile Pro Asn Cys 110
115 120Leu Pro Ala Gly Glu Tyr Leu Leu Arg Ile Gln Gln
Leu Gly Ile His125 130 135
140Asn Pro Trp Pro Ala Gly Ile Pro Gln Phe Tyr Ile Ser Cys Ala Gln
145 150 155Val Lys Val Thr Gly
Ser Gly Ser Gly Ser Pro Ser Pro Thr Val Ser 160
165 170Ile Pro Gly Ala Phe Lys Glu Thr Asp Pro Gly Tyr
Thr Val Asn Ile 175 180 185Tyr Asn
Asp Phe Thr Asn Tyr Thr Val Pro Gly Pro Glu Val Trp Thr 190
195 200Cys20519729DNABotryosphaeria
rhodinaCDS(1)..(729) 19atg gag tcg gcg tcc aag acg ctg aag cgc gtg acg
ctt gag ctg ggt 48Met Glu Ser Ala Ser Lys Thr Leu Lys Arg Val Thr
Leu Glu Leu Gly1 5 10
15ggc aag gac ccg gcc atc gtg tgc tcg gac gtc gac atc gcg gcg acg
96Gly Lys Asp Pro Ala Ile Val Cys Ser Asp Val Asp Ile Ala Ala Thr
20 25 30gcc ccc aag gtt gcc acc ctg
gcc ttc ctc aac tcg ggt cag atc tgc 144Ala Pro Lys Val Ala Thr Leu
Ala Phe Leu Asn Ser Gly Gln Ile Cys 35 40
45ctg gcc atc aag cgt atc tac gtt cac gag aag atc tac gac gag
ttc 192Leu Ala Ile Lys Arg Ile Tyr Val His Glu Lys Ile Tyr Asp Glu
Phe 50 55 60ctc aag gcg tgc gtc gag
cac acc aag acg ctc gtg ctc ggc aac ggc 240Leu Lys Ala Cys Val Glu
His Thr Lys Thr Leu Val Leu Gly Asn Gly65 70
75 80acc gag ccc aac acc ttc ctc ggc ccc gtg cag
aac gcc atg cag tac 288Thr Glu Pro Asn Thr Phe Leu Gly Pro Val Gln
Asn Ala Met Gln Tyr 85 90
95gag cgc gtc aag ggc ttc ttc cag gac gtg cac gag cac aag atg aag
336Glu Arg Val Lys Gly Phe Phe Gln Asp Val His Glu His Lys Met Lys
100 105 110gtg gcc gtc ggc ggc gtc
aac gac aag acg ggc ggc tac tac atc acc 384Val Ala Val Gly Gly Val
Asn Asp Lys Thr Gly Gly Tyr Tyr Ile Thr 115 120
125ccg acc atc atc gac aac ccg gcc gag acg agc aag atc gtg
acc gag 432Pro Thr Ile Ile Asp Asn Pro Ala Glu Thr Ser Lys Ile Val
Thr Glu 130 135 140gag ccc ttc ggc ccc
atc gtg ccg ctg ctc aag tgg agc gac gag agc 480Glu Pro Phe Gly Pro
Ile Val Pro Leu Leu Lys Trp Ser Asp Glu Ser145 150
155 160gag gtc gtc cac cgc gcc aac gac acc aag
atg ggt ctc ggc gcc tcc 528Glu Val Val His Arg Ala Asn Asp Thr Lys
Met Gly Leu Gly Ala Ser 165 170
175gtg tgg agc aac gac ctc gcc cag gcc gag cgc atc gcc cgc cag ctc
576Val Trp Ser Asn Asp Leu Ala Gln Ala Glu Arg Ile Ala Arg Gln Leu
180 185 190gac gcc ggc agc gtc tgg
atc aac act cac ctc gag ctc gac ccc aac 624Asp Ala Gly Ser Val Trp
Ile Asn Thr His Leu Glu Leu Asp Pro Asn 195 200
205gct ccc ttc ggc ggc cac aag gag agc ggt gtt ggc tac gag
tgg ggt 672Ala Pro Phe Gly Gly His Lys Glu Ser Gly Val Gly Tyr Glu
Trp Gly 210 215 220ctt ggt ggc atg aag
gcc tac tgc aac gtc cag acc ctg ttc ttg aag 720Leu Gly Gly Met Lys
Ala Tyr Cys Asn Val Gln Thr Leu Phe Leu Lys225 230
235 240aag aag gtc
729Lys Lys Val20243PRTBotryosphaeria rhodina
20Met Glu Ser Ala Ser Lys Thr Leu Lys Arg Val Thr Leu Glu Leu Gly1
5 10 15Gly Lys Asp Pro Ala Ile
Val Cys Ser Asp Val Asp Ile Ala Ala Thr 20 25
30Ala Pro Lys Val Ala Thr Leu Ala Phe Leu Asn Ser Gly
Gln Ile Cys 35 40 45Leu Ala Ile
Lys Arg Ile Tyr Val His Glu Lys Ile Tyr Asp Glu Phe 50
55 60Leu Lys Ala Cys Val Glu His Thr Lys Thr Leu Val
Leu Gly Asn Gly65 70 75
80Thr Glu Pro Asn Thr Phe Leu Gly Pro Val Gln Asn Ala Met Gln Tyr
85 90 95Glu Arg Val Lys Gly Phe
Phe Gln Asp Val His Glu His Lys Met Lys 100
105 110Val Ala Val Gly Gly Val Asn Asp Lys Thr Gly Gly
Tyr Tyr Ile Thr 115 120 125Pro Thr
Ile Ile Asp Asn Pro Ala Glu Thr Ser Lys Ile Val Thr Glu 130
135 140Glu Pro Phe Gly Pro Ile Val Pro Leu Leu Lys
Trp Ser Asp Glu Ser145 150 155
160Glu Val Val His Arg Ala Asn Asp Thr Lys Met Gly Leu Gly Ala Ser
165 170 175Val Trp Ser Asn
Asp Leu Ala Gln Ala Glu Arg Ile Ala Arg Gln Leu 180
185 190Asp Ala Gly Ser Val Trp Ile Asn Thr His Leu
Glu Leu Asp Pro Asn 195 200 205Ala
Pro Phe Gly Gly His Lys Glu Ser Gly Val Gly Tyr Glu Trp Gly 210
215 220Leu Gly Gly Met Lys Ala Tyr Cys Asn Val
Gln Thr Leu Phe Leu Lys225 230 235
240Lys Lys Val211300DNABotryosphaeria
rhodinaCDS(1)..(1299)sig_peptide(1)..(54)mat_peptide(55)..(1299)misc_feat-
ure(55)..(456)Unknown domain 21atg aag ttg gcg gcg tcg ctt ttg ctt gtc gca
gcc gcg ctt gcg ggg 48Met Lys Leu Ala Ala Ser Leu Leu Leu Val Ala
Ala Ala Leu Ala Gly -15 -10
-5gcc ttt gac aac cgc caa tcg cat gca agg gcc ccc gtt ccg cga gac
96Ala Phe Asp Asn Arg Gln Ser His Ala Arg Ala Pro Val Pro Arg Asp -1
1 5 10gcc ttc gac aat gct tgc gag acc gtc
tac atc acg agt tat gtc tgc 144Ala Phe Asp Asn Ala Cys Glu Thr Val
Tyr Ile Thr Ser Tyr Val Cys15 20 25
30acc acc ttc gtc gtc cct tcg ctt agc tac acc agc cat gag
ttt agc 192Thr Thr Phe Val Val Pro Ser Leu Ser Tyr Thr Ser His Glu
Phe Ser 35 40 45tgc acc
act cac ttg acc aac acc acg cgt atc aca tct tcc gga tcc 240Cys Thr
Thr His Leu Thr Asn Thr Thr Arg Ile Thr Ser Ser Gly Ser 50
55 60acg acc gca gaa act tta act tca ggt
cac acg agc tca gag agc cgc 288Thr Thr Ala Glu Thr Leu Thr Ser Gly
His Thr Ser Ser Glu Ser Arg 65 70
75gct att agc ccg aca caa aac tca tcc agc gtt tac ccg agc gac agc
336Ala Ile Ser Pro Thr Gln Asn Ser Ser Ser Val Tyr Pro Ser Asp Ser 80
85 90cct tca cgt tct gtg tct tca tcc aca
ctg tcg cag tct tcc aga acc 384Pro Ser Arg Ser Val Ser Ser Ser Thr
Leu Ser Gln Ser Ser Arg Thr95 100 105
110gaa aca agc aat aga gac acg agc aat acg tct cac agc gac
agc cct 432Glu Thr Ser Asn Arg Asp Thr Ser Asn Thr Ser His Ser Asp
Ser Pro 115 120 125act ccc
ggc ccc agc gag gag ccc tgt tgc ggc ccg caa ggc ggt aac 480Thr Pro
Gly Pro Ser Glu Glu Pro Cys Cys Gly Pro Gln Gly Gly Asn 130
135 140cgt cgt tgt ccc cat gga aca tgc tgt
tcc aaa aat gga cac tgt ggt 528Arg Arg Cys Pro His Gly Thr Cys Cys
Ser Lys Asn Gly His Cys Gly 145 150
155tcg ggg cca gat ttc tgt ggt gat ggg tgc caa tct tcg tgg gga aac
576Ser Gly Pro Asp Phe Cys Gly Asp Gly Cys Gln Ser Ser Trp Gly Asn 160
165 170tgt acc aac gac aac agc gat gag
ata tct ccc tcg agc agt ccc tca 624Cys Thr Asn Asp Asn Ser Asp Glu
Ile Ser Pro Ser Ser Ser Pro Ser175 180
185 190aac tac tcg gcg cca gct gca tgg gct cga gtg aaa
aga gat gag ttt 672Asn Tyr Ser Ala Pro Ala Ala Trp Ala Arg Val Lys
Arg Asp Glu Phe 195 200
205gac gca ggt gca ttt gaa ctc ttg aca agt ctc aag tac atc gtt gaa
720Asp Ala Gly Ala Phe Glu Leu Leu Thr Ser Leu Lys Tyr Ile Val Glu
210 215 220ggc acc atg gtg aga acc
agc act tgc act tac act cac tgg cac acc 768Gly Thr Met Val Arg Thr
Ser Thr Cys Thr Tyr Thr His Trp His Thr 225 230
235atc tcg act aca tca aag cga acg agt acc atc acc gtc tac
att tcg 816Ile Ser Thr Thr Ser Lys Arg Thr Ser Thr Ile Thr Val Tyr
Ile Ser 240 245 250acg tgt cta tca tca
aat cca cca gtc acc agc agc agc aca cag tcc 864Thr Cys Leu Ser Ser
Asn Pro Pro Val Thr Ser Ser Ser Thr Gln Ser255 260
265 270atc tcc tct ctc atc aca tct cct acg ttg
gtg tca act tcg agt gtc 912Ile Ser Ser Leu Ile Thr Ser Pro Thr Leu
Val Ser Thr Ser Ser Val 275 280
285att acg aca tcc agc aca tcc caa tac tca agc agt acc tca tgc acc
960Ile Thr Thr Ser Ser Thr Ser Gln Tyr Ser Ser Ser Thr Ser Cys Thr
290 295 300tat aca aaa agt tca aac
act aca ata ccg tgg tca cca ccc aca agc 1008Tyr Thr Lys Ser Ser Asn
Thr Thr Ile Pro Trp Ser Pro Pro Thr Ser 305 310
315atg tcg ata acc agc tct tca tgc act cgc tca tcg gac tgg
aca acc 1056Met Ser Ile Thr Ser Ser Ser Cys Thr Arg Ser Ser Asp Trp
Thr Thr 320 325 330cca aag ccg cca ccc
tcg acc tca aca acc ata caa acg aca caa acc 1104Pro Lys Pro Pro Pro
Ser Thr Ser Thr Thr Ile Gln Thr Thr Gln Thr335 340
345 350ccg gat act ata acg aaa tcg aat act ccc
act acg acc aag acc aca 1152Pro Asp Thr Ile Thr Lys Ser Asn Thr Pro
Thr Thr Thr Lys Thr Thr 355 360
365act aag atc tcg att tca att tcc act cca tgg aat act aca tgt acc
1200Thr Lys Ile Ser Ile Ser Ile Ser Thr Pro Trp Asn Thr Thr Cys Thr
370 375 380tca tca acg aac agc acc
aca tcc aca ccc caa acc aca cat aca gcg 1248Ser Ser Thr Asn Ser Thr
Thr Ser Thr Pro Gln Thr Thr His Thr Ala 385 390
395aca gaa cca ccc act tcc agc atc ata gca ata tca agc tcc
tct aac 1296Thr Glu Pro Pro Thr Ser Ser Ile Ile Ala Ile Ser Ser Ser
Ser Asn 400 405 410ccg c
1300Pro41522433PRTBotryosphaeria rhodina 22Met Lys Leu Ala Ala Ser Leu
Leu Leu Val Ala Ala Ala Leu Ala Gly -15 -10
-5Ala Phe Asp Asn Arg Gln Ser His Ala Arg Ala Pro Val Pro
Arg Asp -1 1 5 10Ala Phe Asp Asn Ala
Cys Glu Thr Val Tyr Ile Thr Ser Tyr Val Cys15 20
25 30Thr Thr Phe Val Val Pro Ser Leu Ser Tyr
Thr Ser His Glu Phe Ser 35 40
45Cys Thr Thr His Leu Thr Asn Thr Thr Arg Ile Thr Ser Ser Gly Ser
50 55 60Thr Thr Ala Glu Thr Leu
Thr Ser Gly His Thr Ser Ser Glu Ser Arg 65 70
75Ala Ile Ser Pro Thr Gln Asn Ser Ser Ser Val Tyr Pro Ser
Asp Ser 80 85 90Pro Ser Arg Ser Val
Ser Ser Ser Thr Leu Ser Gln Ser Ser Arg Thr95 100
105 110Glu Thr Ser Asn Arg Asp Thr Ser Asn Thr
Ser His Ser Asp Ser Pro 115 120
125Thr Pro Gly Pro Ser Glu Glu Pro Cys Cys Gly Pro Gln Gly Gly Asn
130 135 140Arg Arg Cys Pro His
Gly Thr Cys Cys Ser Lys Asn Gly His Cys Gly 145
150 155Ser Gly Pro Asp Phe Cys Gly Asp Gly Cys Gln Ser
Ser Trp Gly Asn 160 165 170Cys Thr Asn
Asp Asn Ser Asp Glu Ile Ser Pro Ser Ser Ser Pro Ser175
180 185 190Asn Tyr Ser Ala Pro Ala Ala
Trp Ala Arg Val Lys Arg Asp Glu Phe 195
200 205Asp Ala Gly Ala Phe Glu Leu Leu Thr Ser Leu Lys
Tyr Ile Val Glu 210 215 220Gly
Thr Met Val Arg Thr Ser Thr Cys Thr Tyr Thr His Trp His Thr 225
230 235Ile Ser Thr Thr Ser Lys Arg Thr Ser
Thr Ile Thr Val Tyr Ile Ser 240 245
250Thr Cys Leu Ser Ser Asn Pro Pro Val Thr Ser Ser Ser Thr Gln Ser255
260 265 270Ile Ser Ser Leu
Ile Thr Ser Pro Thr Leu Val Ser Thr Ser Ser Val 275
280 285Ile Thr Thr Ser Ser Thr Ser Gln Tyr Ser
Ser Ser Thr Ser Cys Thr 290 295
300Tyr Thr Lys Ser Ser Asn Thr Thr Ile Pro Trp Ser Pro Pro Thr Ser
305 310 315Met Ser Ile Thr Ser Ser Ser
Cys Thr Arg Ser Ser Asp Trp Thr Thr 320 325
330Pro Lys Pro Pro Pro Ser Thr Ser Thr Thr Ile Gln Thr Thr Gln
Thr335 340 345 350Pro Asp
Thr Ile Thr Lys Ser Asn Thr Pro Thr Thr Thr Lys Thr Thr
355 360 365Thr Lys Ile Ser Ile Ser Ile
Ser Thr Pro Trp Asn Thr Thr Cys Thr 370 375
380Ser Ser Thr Asn Ser Thr Thr Ser Thr Pro Gln Thr Thr His
Thr Ala 385 390 395Thr Glu Pro Pro
Thr Ser Ser Ile Ile Ala Ile Ser Ser Ser Ser Asn 400
405 410Pro415231179DNABotryosphaeria
rhodinaCDS(1)..(1179)sig_peptide(1)..(48)mat_peptide(49)..(1179) 23atg
ctt aag cac atc acc ctt gcg gca ttg gcc tcg atg gcc ttt gcc 48Met
Leu Lys His Ile Thr Leu Ala Ala Leu Ala Ser Met Ala Phe Ala -15
-10 -5 -1cag aca caa gac ctc aat
gcc aca ctc agc ggc att ccc gag ctg tcc 96Gln Thr Gln Asp Leu Asn
Ala Thr Leu Ser Gly Ile Pro Glu Leu Ser1 5
10 15aat cta acg tca tac tac atc tcg ctc cct gac tcc
ctg agc gcg ttg 144Asn Leu Thr Ser Tyr Tyr Ile Ser Leu Pro Asp Ser
Leu Ser Ala Leu 20 25 30tcg
gct gcc agg aac atc acc atc ctg gcg cct agt aac aat gcc ttc 192Ser
Ala Ala Arg Asn Ile Thr Ile Leu Ala Pro Ser Asn Asn Ala Phe 35
40 45gag cag ctg ttg agc agc ccc ctc ggc
gcg gcg ctg acc aac gac ccg 240Glu Gln Leu Leu Ser Ser Pro Leu Gly
Ala Ala Leu Thr Asn Asp Pro 50 55
60gat ctc gtc caa gcc atg ctt acc tac cac gtg ctc aac ggc agc tac
288Asp Leu Val Gln Ala Met Leu Thr Tyr His Val Leu Asn Gly Ser Tyr65
70 75 80agc tcg agc cag atc
act gag gac agt caa ttc atc ccc act ctc ctg 336Ser Ser Ser Gln Ile
Thr Glu Asp Ser Gln Phe Ile Pro Thr Leu Leu 85
90 95acc gac cct agg tat acc aat gtt acc ggc ggt
cag cgg gtt gag gtg 384Thr Asp Pro Arg Tyr Thr Asn Val Thr Gly Gly
Gln Arg Val Glu Val 100 105
110gag aaa gag gat ggt aac gac gtc ttt tac tcg ggg ctg cgg cag aat
432Glu Lys Glu Asp Gly Asn Asp Val Phe Tyr Ser Gly Leu Arg Gln Asn
115 120 125ctg act ttg gga cga agt gac
atc aac ttc acc ggc ggt tac atc cac 480Leu Thr Leu Gly Arg Ser Asp
Ile Asn Phe Thr Gly Gly Tyr Ile His 130 135
140atc att gac acc gtc ctc acg ctg cca cca aac gtc agc tcg acg gcc
528Ile Ile Asp Thr Val Leu Thr Leu Pro Pro Asn Val Ser Ser Thr Ala145
150 155 160gtg gcc acg aac
ctg acg gcg ctc gtc ggg gcg ctg acc aac gcc agc 576Val Ala Thr Asn
Leu Thr Ala Leu Val Gly Ala Leu Thr Asn Ala Ser 165
170 175ctg gtc ggg gcg gtc gac acg acg ccg gac
gtg acc atc ttc gcg ccg 624Leu Val Gly Ala Val Asp Thr Thr Pro Asp
Val Thr Ile Phe Ala Pro 180 185
190gcc aac gac gca ttc gct gcc atc ggc tca gtg ctc gac ggc acg tca
672Ala Asn Asp Ala Phe Ala Ala Ile Gly Ser Val Leu Asp Gly Thr Ser
195 200 205tcg gac gac ctg tcg aac ctg
ctc agc tac cac gtc gtc aac ggc acc 720Ser Asp Asp Leu Ser Asn Leu
Leu Ser Tyr His Val Val Asn Gly Thr 210 215
220gtc gcg tac tcg tcg gac ctc cag ggc aac cag acg gtc acg gcg ctc
768Val Ala Tyr Ser Ser Asp Leu Gln Gly Asn Gln Thr Val Thr Ala Leu225
230 235 240aac ggc ggc gac
ctg acg atc cgc gtg ctg gac gac ggc gac gtc ttc 816Asn Gly Gly Asp
Leu Thr Ile Arg Val Leu Asp Asp Gly Asp Val Phe 245
250 255gtc aac ggc gcg cgc gtg atc att ccg gac
atc ctg gtg gcg aac ggt 864Val Asn Gly Ala Arg Val Ile Ile Pro Asp
Ile Leu Val Ala Asn Gly 260 265
270gtg gtg cat gtc atc gac aac gtc ctc aac ccc tcc aat tcc acg tcc
912Val Val His Val Ile Asp Asn Val Leu Asn Pro Ser Asn Ser Thr Ser
275 280 285ggc ccc agc gac gag aac gac
gac agc gga gac gtc cag tac acc ggc 960Gly Pro Ser Asp Glu Asn Asp
Asp Ser Gly Asp Val Gln Tyr Thr Gly 290 295
300gcc acg tcc gcg acc aac gtg ccc ttc act tcc ggc gtg gcc acg gca
1008Ala Thr Ser Ala Thr Asn Val Pro Phe Thr Ser Gly Val Ala Thr Ala305
310 315 320acg gcg acc gtc
ggc gtc acc ggc acc ggc ggt ggt ggt ggt gcg acg 1056Thr Ala Thr Val
Gly Val Thr Gly Thr Gly Gly Gly Gly Gly Ala Thr 325
330 335ggc acg gcg acg ggc act ggt ggt gcc gcg
agc gcg agc gcc tcg ggt 1104Gly Thr Ala Thr Gly Thr Gly Gly Ala Ala
Ser Ala Ser Ala Ser Gly 340 345
350gct gcc gct ggt gtt ggg ctg agt ggt ggg ttg atg ggt gtg gcc ctc
1152Ala Ala Ala Gly Val Gly Leu Ser Gly Gly Leu Met Gly Val Ala Leu
355 360 365gcg ttg ggt gca gtc ctg tcg
ccg ttg 1179Ala Leu Gly Ala Val Leu Ser
Pro Leu 370 37524393PRTBotryosphaeria rhodina 24Met
Leu Lys His Ile Thr Leu Ala Ala Leu Ala Ser Met Ala Phe Ala -15
-10 -5 -1Gln Thr Gln Asp Leu Asn
Ala Thr Leu Ser Gly Ile Pro Glu Leu Ser1 5
10 15Asn Leu Thr Ser Tyr Tyr Ile Ser Leu Pro Asp Ser
Leu Ser Ala Leu 20 25 30Ser
Ala Ala Arg Asn Ile Thr Ile Leu Ala Pro Ser Asn Asn Ala Phe 35
40 45Glu Gln Leu Leu Ser Ser Pro Leu Gly
Ala Ala Leu Thr Asn Asp Pro 50 55
60Asp Leu Val Gln Ala Met Leu Thr Tyr His Val Leu Asn Gly Ser Tyr65
70 75 80Ser Ser Ser Gln Ile
Thr Glu Asp Ser Gln Phe Ile Pro Thr Leu Leu 85
90 95Thr Asp Pro Arg Tyr Thr Asn Val Thr Gly Gly
Gln Arg Val Glu Val 100 105
110Glu Lys Glu Asp Gly Asn Asp Val Phe Tyr Ser Gly Leu Arg Gln Asn
115 120 125Leu Thr Leu Gly Arg Ser Asp
Ile Asn Phe Thr Gly Gly Tyr Ile His 130 135
140Ile Ile Asp Thr Val Leu Thr Leu Pro Pro Asn Val Ser Ser Thr
Ala145 150 155 160Val Ala
Thr Asn Leu Thr Ala Leu Val Gly Ala Leu Thr Asn Ala Ser
165 170 175Leu Val Gly Ala Val Asp Thr
Thr Pro Asp Val Thr Ile Phe Ala Pro 180 185
190Ala Asn Asp Ala Phe Ala Ala Ile Gly Ser Val Leu Asp Gly
Thr Ser 195 200 205Ser Asp Asp Leu
Ser Asn Leu Leu Ser Tyr His Val Val Asn Gly Thr 210
215 220Val Ala Tyr Ser Ser Asp Leu Gln Gly Asn Gln Thr
Val Thr Ala Leu225 230 235
240Asn Gly Gly Asp Leu Thr Ile Arg Val Leu Asp Asp Gly Asp Val Phe
245 250 255Val Asn Gly Ala Arg
Val Ile Ile Pro Asp Ile Leu Val Ala Asn Gly 260
265 270Val Val His Val Ile Asp Asn Val Leu Asn Pro Ser
Asn Ser Thr Ser 275 280 285Gly Pro
Ser Asp Glu Asn Asp Asp Ser Gly Asp Val Gln Tyr Thr Gly 290
295 300Ala Thr Ser Ala Thr Asn Val Pro Phe Thr Ser
Gly Val Ala Thr Ala305 310 315
320Thr Ala Thr Val Gly Val Thr Gly Thr Gly Gly Gly Gly Gly Ala Thr
325 330 335Gly Thr Ala Thr
Gly Thr Gly Gly Ala Ala Ser Ala Ser Ala Ser Gly 340
345 350Ala Ala Ala Gly Val Gly Leu Ser Gly Gly Leu
Met Gly Val Ala Leu 355 360 365Ala
Leu Gly Ala Val Leu Ser Pro Leu 370
37525846DNABotryosphaeria
rhodinaCDS(1)..(846)sig_peptide(1)..(69)mat_peptide(70)..(846) 25atg cgt
ttc aca aag acc act cct ctc ctc ctt atc gcc acc acc ttt 48Met Arg
Phe Thr Lys Thr Thr Pro Leu Leu Leu Ile Ala Thr Thr Phe
-20 -15 -10tcc ctc acc tac gcc gcc gct
ctc ccg cct gat gac caa cga ctc cct 96Ser Leu Thr Tyr Ala Ala Ala
Leu Pro Pro Asp Asp Gln Arg Leu Pro -5 -1 1
5cag cct gtg act gac aac aag gac gcc gcc cca ttc aac ttt aac acc
144Gln Pro Val Thr Asp Asn Lys Asp Ala Ala Pro Phe Asn Phe Asn Thr10
15 20 25gac ggc aac
ggc aaa ttc tat tac aat ggg ggc ggc gac gat gac aat 192Asp Gly Asn
Gly Lys Phe Tyr Tyr Asn Gly Gly Gly Asp Asp Asp Asn 30
35 40gac gac gac gac gac gat gat gat gac
gat gac gac cag ttc gag gcc 240Asp Asp Asp Asp Asp Asp Asp Asp Asp
Asp Asp Asp Gln Phe Glu Ala 45 50
55cca gac tgc gac gac gca gaa gat gtg ttg gag gga gag tgc ggc aat
288Pro Asp Cys Asp Asp Ala Glu Asp Val Leu Glu Gly Glu Cys Gly Asn
60 65 70ctc ctc aac ggt gaa ggc cgt
ccc gtg ctg gag ggt gac ggc agt gta 336Leu Leu Asn Gly Glu Gly Arg
Pro Val Leu Glu Gly Asp Gly Ser Val 75 80
85gcg cag aag ggg gct ccg ccg cgc aag gag cgc atc aag gtg cgc agg
384Ala Gln Lys Gly Ala Pro Pro Arg Lys Glu Arg Ile Lys Val Arg Arg90
95 100 105agc ctg aag ctt
cat cgt ctt cgt cgt cgc aat gcc atc aag gac gat 432Ser Leu Lys Leu
His Arg Leu Arg Arg Arg Asn Ala Ile Lys Asp Asp 110
115 120gat cat gat cac gac gac aaa gac gac cac
gac cat gac cat gat gac 480Asp His Asp His Asp Asp Lys Asp Asp His
Asp His Asp His Asp Asp 125 130
135gac acg ccg gcg gag aag gct cgc gag aag gag gaa gac cgt ctc gaa
528Asp Thr Pro Ala Glu Lys Ala Arg Glu Lys Glu Glu Asp Arg Leu Glu
140 145 150gac ctg cgg gat gcc gag gag
gag gct ttg gag aag ttg aag aag ggc 576Asp Leu Arg Asp Ala Glu Glu
Glu Ala Leu Glu Lys Leu Lys Lys Gly 155 160
165ccg aat cat cgc cgc gat gaa gac gac tcc cca gcg gag cgg gct cgt
624Pro Asn His Arg Arg Asp Glu Asp Asp Ser Pro Ala Glu Arg Ala Arg170
175 180 185gag aag gaa gag
gac aag aag gaa gat ttg cgg gat gcg gag gag gac 672Glu Lys Glu Glu
Asp Lys Lys Glu Asp Leu Arg Asp Ala Glu Glu Asp 190
195 200cgc ttg gag cgt gag cgc aag aag cag ggt
aag ggg cat cca cac gac 720Arg Leu Glu Arg Glu Arg Lys Lys Gln Gly
Lys Gly His Pro His Asp 205 210
215gat gac gac gac gat gat gat act cct gag gag aaa gcc cgc gaa cgc
768Asp Asp Asp Asp Asp Asp Asp Thr Pro Glu Glu Lys Ala Arg Glu Arg
220 225 230gaa gaa gat cgg ctc gag gac
ctg cgt gat gcg gag gac ccg tta gtg 816Glu Glu Asp Arg Leu Glu Asp
Leu Arg Asp Ala Glu Asp Pro Leu Val 235 240
245cga atg caa agg cgg cgc caa cca tct tgc
846Arg Met Gln Arg Arg Arg Gln Pro Ser Cys250
25526282PRTBotryosphaeria rhodina 26Met Arg Phe Thr Lys Thr Thr Pro Leu
Leu Leu Ile Ala Thr Thr Phe -20 -15
-10Ser Leu Thr Tyr Ala Ala Ala Leu Pro Pro Asp Asp Gln Arg Leu Pro
-5 -1 1 5Gln Pro Val Thr Asp Asn Lys Asp
Ala Ala Pro Phe Asn Phe Asn Thr10 15 20
25Asp Gly Asn Gly Lys Phe Tyr Tyr Asn Gly Gly Gly Asp
Asp Asp Asn 30 35 40Asp
Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Gln Phe Glu Ala 45
50 55Pro Asp Cys Asp Asp Ala Glu Asp
Val Leu Glu Gly Glu Cys Gly Asn 60 65
70Leu Leu Asn Gly Glu Gly Arg Pro Val Leu Glu Gly Asp Gly Ser Val
75 80 85Ala Gln Lys Gly Ala Pro Pro Arg
Lys Glu Arg Ile Lys Val Arg Arg90 95
100 105Ser Leu Lys Leu His Arg Leu Arg Arg Arg Asn Ala
Ile Lys Asp Asp 110 115
120Asp His Asp His Asp Asp Lys Asp Asp His Asp His Asp His Asp Asp
125 130 135Asp Thr Pro Ala Glu Lys
Ala Arg Glu Lys Glu Glu Asp Arg Leu Glu 140 145
150Asp Leu Arg Asp Ala Glu Glu Glu Ala Leu Glu Lys Leu Lys
Lys Gly 155 160 165Pro Asn His Arg Arg
Asp Glu Asp Asp Ser Pro Ala Glu Arg Ala Arg170 175
180 185Glu Lys Glu Glu Asp Lys Lys Glu Asp Leu
Arg Asp Ala Glu Glu Asp 190 195
200Arg Leu Glu Arg Glu Arg Lys Lys Gln Gly Lys Gly His Pro His Asp
205 210 215Asp Asp Asp Asp Asp
Asp Asp Thr Pro Glu Glu Lys Ala Arg Glu Arg 220
225 230Glu Glu Asp Arg Leu Glu Asp Leu Arg Asp Ala Glu
Asp Pro Leu Val 235 240 245Arg Met Gln
Arg Arg Arg Gln Pro Ser Cys250 25527801DNABotryosphaeria
rhodinaCDS(1)..(801)sig_peptide(1)..(57)misc_feature(1)..(801)propeptide
27atg cgc ttc ttc tcc acc atc gtc ggc gct gcc gcc ctc att tcg agc
48Met Arg Phe Phe Ser Thr Ile Val Gly Ala Ala Ala Leu Ile Ser Ser
-15 -10 -5gtc gtt gct cag gac ctc ggc
atc acc aag gct ccc tcc tct gtc cag 96Val Val Ala Gln Asp Leu Gly
Ile Thr Lys Ala Pro Ser Ser Val Gln -1 1 5
10gcc ggc caa acc tac acc att gag tac act gcg ccg gct ggc gcc
gct 144Ala Gly Gln Thr Tyr Thr Ile Glu Tyr Thr Ala Pro Ala Gly Ala
Ala 15 20 25gtg tct ctc atc ctg cgc
aag ggt gac ccc aac aac ctg gac act ctc 192Val Ser Leu Ile Leu Arg
Lys Gly Asp Pro Asn Asn Leu Asp Thr Leu30 35
40 45act acc ctg acc tcc aat gcc gaa ggc ggt tct
tac gag tgg act gtg 240Thr Thr Leu Thr Ser Asn Ala Glu Gly Gly Ser
Tyr Glu Trp Thr Val 50 55
60gcc agc agc cta gag agc gac gac gac tac gcc atc gag att aag cag
288Ala Ser Ser Leu Glu Ser Asp Asp Asp Tyr Ala Ile Glu Ile Lys Gln
65 70 75ggc gac gac aac aac tac ttc
ggc ccc ttc agc ctc acc ggt ggt tcc 336Gly Asp Asp Asn Asn Tyr Phe
Gly Pro Phe Ser Leu Thr Gly Gly Ser 80 85
90gcc tcg gcc tct tcg gca tct tcc agc tcc tct gct tct gct tct
gcc 384Ala Ser Ala Ser Ser Ala Ser Ser Ser Ser Ser Ala Ser Ala Ser
Ala 95 100 105tct tct tcg gcc tct gcc
tct gcc tct gcg tcc gcg tct gct tcg gcc 432Ser Ser Ser Ala Ser Ala
Ser Ala Ser Ala Ser Ala Ser Ala Ser Ala110 115
120 125tct gcc tcg gct tct ggc tcc gcc agc tcg acc
gag agc tcc acc atc 480Ser Ala Ser Ala Ser Gly Ser Ala Ser Ser Thr
Glu Ser Ser Thr Ile 130 135
140act gcc agc gcc tcg ctc tcc tcg gct gcc tcc tcg ctg tcc tcg ctg
528Thr Ala Ser Ala Ser Leu Ser Ser Ala Ala Ser Ser Leu Ser Ser Leu
145 150 155atc tcg gcc gcc aac tcg
acc ctg gcc tcc atc acc agc tcg aac gcg 576Ile Ser Ala Ala Asn Ser
Thr Leu Ala Ser Ile Thr Ser Ser Asn Ala 160 165
170act gcc acc agc agc aag ccg tcc aac ggc act atc agc agc
acc ctg 624Thr Ala Thr Ser Ser Lys Pro Ser Asn Gly Thr Ile Ser Ser
Thr Leu 175 180 185cac agc tcg act gcc
acc tcc acc tcg tcg tcg tcg tct gag ggc tcg 672His Ser Ser Thr Ala
Thr Ser Thr Ser Ser Ser Ser Ser Glu Gly Ser190 195
200 205agc tcc tcc ggc gcg tcc gag act gcc agc
tcg act ggc ggc gcc cct 720Ser Ser Ser Gly Ala Ser Glu Thr Ala Ser
Ser Thr Gly Gly Ala Pro 210 215
220acc tcc ggt gcc gcc atg ccc agc atg gtc agc ccc atc gcg ctc gtc
768Thr Ser Gly Ala Ala Met Pro Ser Met Val Ser Pro Ile Ala Leu Val
225 230 235ctc ggc gcc gtt gct gcc
atg atc ttc ctc aac 801Leu Gly Ala Val Ala Ala
Met Ile Phe Leu Asn 240 24528267PRTBotryosphaeria
rhodina 28Met Arg Phe Phe Ser Thr Ile Val Gly Ala Ala Ala Leu Ile Ser Ser
-15 -10 -5Val Val Ala Gln Asp
Leu Gly Ile Thr Lys Ala Pro Ser Ser Val Gln -1 1 5
10Ala Gly Gln Thr Tyr Thr Ile Glu Tyr Thr Ala Pro Ala
Gly Ala Ala 15 20 25Val Ser Leu Ile
Leu Arg Lys Gly Asp Pro Asn Asn Leu Asp Thr Leu30 35
40 45Thr Thr Leu Thr Ser Asn Ala Glu Gly
Gly Ser Tyr Glu Trp Thr Val 50 55
60Ala Ser Ser Leu Glu Ser Asp Asp Asp Tyr Ala Ile Glu Ile Lys
Gln 65 70 75Gly Asp Asp Asn
Asn Tyr Phe Gly Pro Phe Ser Leu Thr Gly Gly Ser 80
85 90Ala Ser Ala Ser Ser Ala Ser Ser Ser Ser Ser Ala
Ser Ala Ser Ala 95 100 105Ser Ser Ser
Ala Ser Ala Ser Ala Ser Ala Ser Ala Ser Ala Ser Ala110
115 120 125Ser Ala Ser Ala Ser Gly Ser
Ala Ser Ser Thr Glu Ser Ser Thr Ile 130
135 140Thr Ala Ser Ala Ser Leu Ser Ser Ala Ala Ser Ser
Leu Ser Ser Leu 145 150 155Ile
Ser Ala Ala Asn Ser Thr Leu Ala Ser Ile Thr Ser Ser Asn Ala 160
165 170Thr Ala Thr Ser Ser Lys Pro Ser Asn
Gly Thr Ile Ser Ser Thr Leu 175 180
185His Ser Ser Thr Ala Thr Ser Thr Ser Ser Ser Ser Ser Glu Gly Ser190
195 200 205Ser Ser Ser Gly
Ala Ser Glu Thr Ala Ser Ser Thr Gly Gly Ala Pro 210
215 220Thr Ser Gly Ala Ala Met Pro Ser Met Val
Ser Pro Ile Ala Leu Val 225 230
235Leu Gly Ala Val Ala Ala Met Ile Phe Leu Asn 240
245291065DNABotryosphaeria rhodinamisc_feature(1)..(1065)cDNA
29ggcacgaggc accataatca ctatcagaac ccaaaccagt cgtttctgat atcaaaccct
60catctaaacc tcatctcaaa ccaaccgaaa aggaccaata aaaccaac atg atg caa
117 Met Met Gln
-15ttc ctc act gtc gcc
gcc ctc ttc acc acc gcc gcc ttc gcc tct ccc 165Phe Leu Thr Val Ala
Ala Leu Phe Thr Thr Ala Ala Phe Ala Ser Pro -10
-5 -1 1atc gca cag gct ccc aac acc cca cct gcc ggc act ccc
gtc tac act 213Ile Ala Gln Ala Pro Asn Thr Pro Pro Ala Gly Thr Pro
Val Tyr Thr 5 10 15ccg gcc agc acc
ccg atc tac tac ccc ctc aac act ccg gtc aac acg 261Pro Ala Ser Thr
Pro Ile Tyr Tyr Pro Leu Asn Thr Pro Val Asn Thr20 25
30 35cca gtc gcc act ccc ggc agc ggc agc
ggc ccc ggc ttc atc ggc ggc 309Pro Val Ala Thr Pro Gly Ser Gly Ser
Gly Pro Gly Phe Ile Gly Gly 40 45
50ggc tac aac agc ctc ccc gtc tgc ggc ccg cac gcc tac gac ccg
cgc 357Gly Tyr Asn Ser Leu Pro Val Cys Gly Pro His Ala Tyr Asp Pro
Arg 55 60 65gcc ttc cac tgc
tac gac agc agc gtc ggc tac ggc ggc cag acg tac 405Ala Phe His Cys
Tyr Asp Ser Ser Val Gly Tyr Gly Gly Gln Thr Tyr 70
75 80acc aac atc ctg tgc ccg ctg cag aac ggc gag ccg
ctg gcc gcc tgc 453Thr Asn Ile Leu Cys Pro Leu Gln Asn Gly Glu Pro
Leu Ala Ala Cys 85 90 95ggc ccg agc
tgc tac gac ccg gag atc ttc acc tgc ggc gcc gac ggc 501Gly Pro Ser
Cys Tyr Asp Pro Glu Ile Phe Thr Cys Gly Ala Asp Gly100
105 110 115atc ctg tct gtc gcc ggc cag
tac gcc acc ccc gcc gcc gct acc ccg 549Ile Leu Ser Val Ala Gly Gln
Tyr Ala Thr Pro Ala Ala Ala Thr Pro 120
125 130atg act ccg gcc ggc gtc ttc cct ccg gcc ggc gcg
acg ccg acg ggg 597Met Thr Pro Ala Gly Val Phe Pro Pro Ala Gly Ala
Thr Pro Thr Gly 135 140 145ggc
ctc taagcgggat cgtccggaat gacgatcagc tcaagcatgt gtgagcgaga 653Gly
Leugagacagagc atagctactg cgtattaaaa gctgtgaaga ggtgacacgg caatgcacgt
713tcgtcttggg catttctttt ggggtttcat ggcgtaggat gctgggcgct tcttgggtgg
773tcttatgagc atttaacgtt ccttctacgc ttagagtggc tgcaacgttg atgaatgagg
833ggggtgatgg tcgatcagtt gaccgttccg tgtgaaccgt gtcaaacacg tcacacgtcg
893ccatgagtcg accacgtcgt tgatgtgcaa aagaacatcg aggatgcaac aaggaaatga
953ttaatggaca tcatgtttta agtacataaa gggagatcat gggtagacta aacgaaaagc
1013cccctctaat gttaatattt ctcatcttaa aaaaaaaaga ttcatttgtc tc
106530165PRTBotryosphaeria rhodina 30Met Met Gln Phe Leu Thr Val Ala Ala
Leu Phe Thr Thr Ala Ala Phe -15 -10 -5
-1Ala Ser Pro Ile Ala Gln Ala Pro Asn Thr Pro Pro Ala Gly
Thr Pro1 5 10 15Val Tyr
Thr Pro Ala Ser Thr Pro Ile Tyr Tyr Pro Leu Asn Thr Pro 20
25 30Val Asn Thr Pro Val Ala Thr Pro Gly
Ser Gly Ser Gly Pro Gly Phe 35 40
45Ile Gly Gly Gly Tyr Asn Ser Leu Pro Val Cys Gly Pro His Ala Tyr 50
55 60Asp Pro Arg Ala Phe His Cys Tyr Asp
Ser Ser Val Gly Tyr Gly Gly65 70 75
80Gln Thr Tyr Thr Asn Ile Leu Cys Pro Leu Gln Asn Gly Glu
Pro Leu 85 90 95Ala Ala
Cys Gly Pro Ser Cys Tyr Asp Pro Glu Ile Phe Thr Cys Gly 100
105 110Ala Asp Gly Ile Leu Ser Val Ala Gly
Gln Tyr Ala Thr Pro Ala Ala 115 120
125Ala Thr Pro Met Thr Pro Ala Gly Val Phe Pro Pro Ala Gly Ala Thr
130 135 140Pro Thr Gly Gly
Leu14531660DNABotryosphaeria
rhodinaCDS(1)..(660)transit_peptide(1)..(54)misc_feature(1)..(660)propept-
ide 31atg aag act ttc gca ttc gcc acc gtg gct gcg ctc agc gct gtt gct
48Met Lys Thr Phe Ala Phe Ala Thr Val Ala Ala Leu Ser Ala Val Ala
-15 -10 -5acc gcc caa gac ttg ggg ctg ttg
ctc tca tcc tgc gcc tcc gat caa 96Thr Ala Gln Asp Leu Gly Leu Leu
Leu Ser Ser Cys Ala Ser Asp Gln -1 1 5
10ttt cag gaa ctt gga ttg acc gga gtc gac ggt gat ccg tgc aag agc
144Phe Gln Glu Leu Gly Leu Thr Gly Val Asp Gly Asp Pro Cys Lys Ser15
20 25 30gat gcg ggc aaa tct
tcg tac tat gag tgc tcc tgc acc aag ggt cag 192Asp Ala Gly Lys Ser
Ser Tyr Tyr Glu Cys Ser Cys Thr Lys Gly Gln 35
40 45gag ttt gtc gtc gat tac ctc tgc aaa aac cct
gga tcc tgc agc ccc 240Glu Phe Val Val Asp Tyr Leu Cys Lys Asn Pro
Gly Ser Cys Ser Pro 50 55
60agc gac atc cct ggc ttg acg gat act ctc gtc agc ttc tgc aaa tcg
288Ser Asp Ile Pro Gly Leu Thr Asp Thr Leu Val Ser Phe Cys Lys Ser
65 70 75gtc ggt gtc acc gtc aca gct ccc
tcg aac ccg tgc ggt ctc tcc ggc 336Val Gly Val Thr Val Thr Ala Pro
Ser Asn Pro Cys Gly Leu Ser Gly 80 85
90ggt agt agc tct tct gct cct gcg tcc tct gcc aca tcc gct ccc gcc
384Gly Ser Ser Ser Ser Ala Pro Ala Ser Ser Ala Thr Ser Ala Pro Ala95
100 105 110acg tcc gcc cct
agt tct tca cct gca tcg tcg cca gcc tcc tcg gcg 432Thr Ser Ala Pro
Ser Ser Ser Pro Ala Ser Ser Pro Ala Ser Ser Ala 115
120 125gct tcc tcc gca gcg agc tct gcc ccg agc
tat gcc ccc agc tcc gct 480Ala Ser Ser Ala Ala Ser Ser Ala Pro Ser
Tyr Ala Pro Ser Ser Ala 130 135
140gca tca tct cct ccg gcc aca act ccc gcc ggt aca ccc act acc ccg
528Ala Ser Ser Pro Pro Ala Thr Thr Pro Ala Gly Thr Pro Thr Thr Pro
145 150 155gct gga acc cct tat ggt act
cca gtc ggc acc ccg gcc agc act ccg 576Ala Gly Thr Pro Tyr Gly Thr
Pro Val Gly Thr Pro Ala Ser Thr Pro 160 165
170gct gcc tac act ggt gca gct gca gtt aaa aac gtg gct ggt ggt ctc
624Ala Ala Tyr Thr Gly Ala Ala Ala Val Lys Asn Val Ala Gly Gly Leu175
180 185 190gtc ggt gtg gct
ggt ttt gct ggc ctc ttc ttc ctc 660Val Gly Val Ala
Gly Phe Ala Gly Leu Phe Phe Leu 195
20032220PRTBotryosphaeria rhodina 32Met Lys Thr Phe Ala Phe Ala Thr Val
Ala Ala Leu Ser Ala Val Ala -15 -10
-5Thr Ala Gln Asp Leu Gly Leu Leu Leu Ser Ser Cys Ala Ser Asp Gln -1
1 5 10Phe Gln Glu Leu Gly Leu Thr Gly Val
Asp Gly Asp Pro Cys Lys Ser15 20 25
30Asp Ala Gly Lys Ser Ser Tyr Tyr Glu Cys Ser Cys Thr Lys
Gly Gln 35 40 45Glu Phe
Val Val Asp Tyr Leu Cys Lys Asn Pro Gly Ser Cys Ser Pro 50
55 60Ser Asp Ile Pro Gly Leu Thr Asp Thr
Leu Val Ser Phe Cys Lys Ser 65 70
75Val Gly Val Thr Val Thr Ala Pro Ser Asn Pro Cys Gly Leu Ser Gly 80
85 90Gly Ser Ser Ser Ser Ala Pro Ala Ser
Ser Ala Thr Ser Ala Pro Ala95 100 105
110Thr Ser Ala Pro Ser Ser Ser Pro Ala Ser Ser Pro Ala Ser
Ser Ala 115 120 125Ala Ser
Ser Ala Ala Ser Ser Ala Pro Ser Tyr Ala Pro Ser Ser Ala 130
135 140Ala Ser Ser Pro Pro Ala Thr Thr Pro
Ala Gly Thr Pro Thr Thr Pro 145 150
155Ala Gly Thr Pro Tyr Gly Thr Pro Val Gly Thr Pro Ala Ser Thr Pro
160 165 170Ala Ala Tyr Thr Gly Ala Ala
Ala Val Lys Asn Val Ala Gly Gly Leu175 180
185 190Val Gly Val Ala Gly Phe Ala Gly Leu Phe Phe Leu
195 200331854DNABotryosphaeria
rhodinaCDS(1)..(1854)sig_peptide(1)..(45)mat_peptide(46)..(1854) 33atg
tct ttg ctt ttg ctg ctc agc agc ggc gct att gcg ctc gca caa 48Met
Ser Leu Leu Leu Leu Leu Ser Ser Gly Ala Ile Ala Leu Ala Gln-15
-10 -5 -1 1cag gtc tat gtg tct gct gat
gga cct gct caa tgc acc gca agc cag 96Gln Val Tyr Val Ser Ala Asp
Gly Pro Ala Gln Cys Thr Ala Ser Gln 5 10
15act tat tct gcg act tac gct tct ccg acc tat gcc ttc agc
aac ttt 144Thr Tyr Ser Ala Thr Tyr Ala Ser Pro Thr Tyr Ala Phe Ser
Asn Phe 20 25 30tcg ttc acg caa
acg gag acg gtc cgg act gct acc tca gtc aag tct 192Ser Phe Thr Gln
Thr Glu Thr Val Arg Thr Ala Thr Ser Val Lys Ser 35 40
45gcg cca gtc aca act tac gcc ccg cca tac gca tcc ctc
agc cac ctg 240Ala Pro Val Thr Thr Tyr Ala Pro Pro Tyr Ala Ser Leu
Ser His Leu50 55 60
65gtt cca gat ctg agc aca acg aca tgg gga aac tgg gat ccc aat gcc
288Val Pro Asp Leu Ser Thr Thr Thr Trp Gly Asn Trp Asp Pro Asn Ala
70 75 80acg gca act gcc acc gat
acc gcc gac ccc tac gga cag gct gcg tgg 336Thr Ala Thr Ala Thr Asp
Thr Ala Asp Pro Tyr Gly Gln Ala Ala Trp 85 90
95tct gct ttg tgg gaa cat gcc agt ctc gcc aac ttt acc
ttc agg ggt 384Ser Ala Leu Trp Glu His Ala Ser Leu Ala Asn Phe Thr
Phe Arg Gly 100 105 110ctt tac tca
aca acc gtc tcc cca act ccg gtg cct act agt gaa ctt 432Leu Tyr Ser
Thr Thr Val Ser Pro Thr Pro Val Pro Thr Ser Glu Leu 115
120 125gtt ctg ccg cct cca gaa tat ttc act ccc cag gac
tgc tct tac ttc 480Val Leu Pro Pro Pro Glu Tyr Phe Thr Pro Gln Asp
Cys Ser Tyr Phe130 135 140
145cca gac gac ttc atg ttc gga gtt gca ggc tct gct tcc cag atc gaa
528Pro Asp Asp Phe Met Phe Gly Val Ala Gly Ser Ala Ser Gln Ile Glu
150 155 160ggg gcc atc gca gac
gaa ggg aga aca ccc tct ctc atg gaa att ttg 576Gly Ala Ile Ala Asp
Glu Gly Arg Thr Pro Ser Leu Met Glu Ile Leu 165
170 175atc tct cct tcg acc gga aaa ccc acc aac tac gtc
aca aac gag aac 624Ile Ser Pro Ser Thr Gly Lys Pro Thr Asn Tyr Val
Thr Asn Glu Asn 180 185 190tac tac
ctg tac aag cag gat atc gag cgt ctg gct gct atg gga gtc 672Tyr Tyr
Leu Tyr Lys Gln Asp Ile Glu Arg Leu Ala Ala Met Gly Val 195
200 205aag tac tat tct ttt act att ccg tgg tct cga
atc ttg cca ttc gtg 720Lys Tyr Tyr Ser Phe Thr Ile Pro Trp Ser Arg
Ile Leu Pro Phe Val210 215 220
225ctt gaa ggc acc ccc ctc aac cag caa ggc ctc gac cac tac gac gat
768Leu Glu Gly Thr Pro Leu Asn Gln Gln Gly Leu Asp His Tyr Asp Asp
230 235 240ctc att aat ttt gtc
ctt gag aag gga atg cag ccg act gtc acc ctg 816Leu Ile Asn Phe Val
Leu Glu Lys Gly Met Gln Pro Thr Val Thr Leu 245
250 255atc cac ttc gac acg cct ctg cag ttc tac gga aac
aac tta agc act 864Ile His Phe Asp Thr Pro Leu Gln Phe Tyr Gly Asn
Asn Leu Ser Thr 260 265 270gct gcg
gac cct cct ctt att ggt tac acc aac gga gct tat cag aat 912Ala Ala
Asp Pro Pro Leu Ile Gly Tyr Thr Asn Gly Ala Tyr Gln Asn 275
280 285gag acg ttc gag gat gct ttc gtg aac tat ggc
aag atc gtc atg act 960Glu Thr Phe Glu Asp Ala Phe Val Asn Tyr Gly
Lys Ile Val Met Thr290 295 300
305cac ttt gct gac cgt gtt cct gtc tgg ttc act ttc aat gaa ccc tta
1008His Phe Ala Asp Arg Val Pro Val Trp Phe Thr Phe Asn Glu Pro Leu
310 315 320ctc tat tgt gac aat
ggc aag agt gta aac acg gtt gtc aaa gcc cat 1056Leu Tyr Cys Asp Asn
Gly Lys Ser Val Asn Thr Val Val Lys Ala His 325
330 335gcc aga ctc tat cat ttc tat cac gag gag atc aac
ggc acc ggc aag 1104Ala Arg Leu Tyr His Phe Tyr His Glu Glu Ile Asn
Gly Thr Gly Lys 340 345 350gtt gga
atc aag ttc aac gac aac ttt ggt gta cca cgc gac cct cag 1152Val Gly
Ile Lys Phe Asn Asp Asn Phe Gly Val Pro Arg Asp Pro Gln 355
360 365gat tcc tcg gat gtg gac gcc gcg aac cat ttc
aac gag ttt caa ctg 1200Asp Ser Ser Asp Val Asp Ala Ala Asn His Phe
Asn Glu Phe Gln Leu370 375 380
385gca aca ttt gcc aac cct atc ttc ctc ggg aag gat tac cct gag gcc
1248Ala Thr Phe Ala Asn Pro Ile Phe Leu Gly Lys Asp Tyr Pro Glu Ala
390 395 400ttc aag atg aca gtc
ccc gat tat gtg ccg ctc tca cag gag gat ttg 1296Phe Lys Met Thr Val
Pro Asp Tyr Val Pro Leu Ser Gln Glu Asp Leu 405
410 415gaa tac atc ggt ggt aca tca gac ttc ctc ggc atc
gat ccc tac act 1344Glu Tyr Ile Gly Gly Thr Ser Asp Phe Leu Gly Ile
Asp Pro Tyr Thr 420 425 430gcg aca
gtc gta agc ccg ccg cct gat gga att gcg gtt tgc gca gcc 1392Ala Thr
Val Val Ser Pro Pro Pro Asp Gly Ile Ala Val Cys Ala Ala 435
440 445aac aca tcc gac ccc ctc ttc ccc tac tgc gtc
gag caa tca acc ttg 1440Asn Thr Ser Asp Pro Leu Phe Pro Tyr Cys Val
Glu Gln Ser Thr Leu450 455 460
465aca agc acc ggc tgg aac atc ggt tac cgt tcg cag acc tac gtc tac
1488Thr Ser Thr Gly Trp Asn Ile Gly Tyr Arg Ser Gln Thr Tyr Val Tyr
470 475 480atc acg ccc aag tac
ctg cgc acc tac ctg tcc tat ctg tgg aac acc 1536Ile Thr Pro Lys Tyr
Leu Arg Thr Tyr Leu Ser Tyr Leu Trp Asn Thr 485
490 495ttc cag cac cct gtc atg atc act gag ttt ggc tac
cct gtg ttc ggc 1584Phe Gln His Pro Val Met Ile Thr Glu Phe Gly Tyr
Pro Val Phe Gly 500 505 510gag gcg
gac aag gaa gat ctc tcg gac cag ttg tac gac ctt cct cgc 1632Glu Ala
Asp Lys Glu Asp Leu Ser Asp Gln Leu Tyr Asp Leu Pro Arg 515
520 525agc tac tac tac ctc tct ttc atg agt gag gtg
ctc aag gca atc tgg 1680Ser Tyr Tyr Tyr Leu Ser Phe Met Ser Glu Val
Leu Lys Ala Ile Trp530 535 540
545gag gac aac gtc cac gtc ctt ggg gcg ttc gcg tgg agc ttt gcc gat
1728Glu Asp Asn Val His Val Leu Gly Ala Phe Ala Trp Ser Phe Ala Asp
550 555 560aac tgg gaa ttc ggt
gac tac gcg caa caa ttt ggc att cag gtc gtc 1776Asn Trp Glu Phe Gly
Asp Tyr Ala Gln Gln Phe Gly Ile Gln Val Val 565
570 575aac cgt acg acg caa gag agg tat tat aag aag agt
ttc ttc gat ctg 1824Asn Arg Thr Thr Gln Glu Arg Tyr Tyr Lys Lys Ser
Phe Phe Asp Leu 580 585 590gtg gac
ttc gtg gcg gcg agg aca aag tct 1854Val Asp
Phe Val Ala Ala Arg Thr Lys Ser 595
60034618PRTBotryosphaeria rhodina 34Met Ser Leu Leu Leu Leu Leu Ser Ser
Gly Ala Ile Ala Leu Ala Gln-15 -10 -5
-1 1Gln Val Tyr Val Ser Ala Asp Gly Pro Ala Gln Cys Thr Ala Ser
Gln 5 10 15Thr Tyr Ser Ala
Thr Tyr Ala Ser Pro Thr Tyr Ala Phe Ser Asn Phe 20
25 30Ser Phe Thr Gln Thr Glu Thr Val Arg Thr Ala Thr
Ser Val Lys Ser 35 40 45Ala Pro Val
Thr Thr Tyr Ala Pro Pro Tyr Ala Ser Leu Ser His Leu50 55
60 65Val Pro Asp Leu Ser Thr Thr Thr
Trp Gly Asn Trp Asp Pro Asn Ala 70 75
80Thr Ala Thr Ala Thr Asp Thr Ala Asp Pro Tyr Gly Gln Ala
Ala Trp 85 90 95Ser Ala Leu
Trp Glu His Ala Ser Leu Ala Asn Phe Thr Phe Arg Gly 100
105 110Leu Tyr Ser Thr Thr Val Ser Pro Thr Pro Val
Pro Thr Ser Glu Leu 115 120 125Val Leu
Pro Pro Pro Glu Tyr Phe Thr Pro Gln Asp Cys Ser Tyr Phe130
135 140 145Pro Asp Asp Phe Met Phe Gly
Val Ala Gly Ser Ala Ser Gln Ile Glu 150
155 160Gly Ala Ile Ala Asp Glu Gly Arg Thr Pro Ser Leu
Met Glu Ile Leu 165 170 175Ile
Ser Pro Ser Thr Gly Lys Pro Thr Asn Tyr Val Thr Asn Glu Asn 180
185 190Tyr Tyr Leu Tyr Lys Gln Asp Ile Glu
Arg Leu Ala Ala Met Gly Val 195 200
205Lys Tyr Tyr Ser Phe Thr Ile Pro Trp Ser Arg Ile Leu Pro Phe Val210
215 220 225Leu Glu Gly Thr
Pro Leu Asn Gln Gln Gly Leu Asp His Tyr Asp Asp 230
235 240Leu Ile Asn Phe Val Leu Glu Lys Gly Met
Gln Pro Thr Val Thr Leu 245 250
255Ile His Phe Asp Thr Pro Leu Gln Phe Tyr Gly Asn Asn Leu Ser Thr
260 265 270Ala Ala Asp Pro Pro Leu Ile
Gly Tyr Thr Asn Gly Ala Tyr Gln Asn 275 280
285Glu Thr Phe Glu Asp Ala Phe Val Asn Tyr Gly Lys Ile Val Met
Thr290 295 300 305His Phe
Ala Asp Arg Val Pro Val Trp Phe Thr Phe Asn Glu Pro Leu
310 315 320Leu Tyr Cys Asp Asn Gly Lys
Ser Val Asn Thr Val Val Lys Ala His 325 330
335Ala Arg Leu Tyr His Phe Tyr His Glu Glu Ile Asn Gly Thr
Gly Lys 340 345 350Val Gly Ile Lys
Phe Asn Asp Asn Phe Gly Val Pro Arg Asp Pro Gln 355
360 365Asp Ser Ser Asp Val Asp Ala Ala Asn His Phe Asn
Glu Phe Gln Leu370 375 380
385Ala Thr Phe Ala Asn Pro Ile Phe Leu Gly Lys Asp Tyr Pro Glu Ala
390 395 400Phe Lys Met Thr Val
Pro Asp Tyr Val Pro Leu Ser Gln Glu Asp Leu 405
410 415Glu Tyr Ile Gly Gly Thr Ser Asp Phe Leu Gly Ile
Asp Pro Tyr Thr 420 425 430Ala Thr
Val Val Ser Pro Pro Pro Asp Gly Ile Ala Val Cys Ala Ala 435
440 445Asn Thr Ser Asp Pro Leu Phe Pro Tyr Cys Val
Glu Gln Ser Thr Leu450 455 460
465Thr Ser Thr Gly Trp Asn Ile Gly Tyr Arg Ser Gln Thr Tyr Val Tyr
470 475 480Ile Thr Pro Lys
Tyr Leu Arg Thr Tyr Leu Ser Tyr Leu Trp Asn Thr 485
490 495Phe Gln His Pro Val Met Ile Thr Glu Phe Gly
Tyr Pro Val Phe Gly 500 505 510Glu
Ala Asp Lys Glu Asp Leu Ser Asp Gln Leu Tyr Asp Leu Pro Arg 515
520 525Ser Tyr Tyr Tyr Leu Ser Phe Met Ser Glu
Val Leu Lys Ala Ile Trp530 535 540
545Glu Asp Asn Val His Val Leu Gly Ala Phe Ala Trp Ser Phe Ala
Asp 550 555 560Asn Trp Glu
Phe Gly Asp Tyr Ala Gln Gln Phe Gly Ile Gln Val Val 565
570 575Asn Arg Thr Thr Gln Glu Arg Tyr Tyr Lys
Lys Ser Phe Phe Asp Leu 580 585
590Val Asp Phe Val Ala Ala Arg Thr Lys Ser 595
60035966DNABotryosphaeria
rhodinaCDS(1)..(966)sig_peptide(1)..(63)mat_peptide(64)..(966) 35atg ttg
aat ctg aag atc ctc gcg acc tcg ttc ctc cct ctc ctc ccg 48Met Leu
Asn Leu Lys Ile Leu Ala Thr Ser Phe Leu Pro Leu Leu Pro -20
-15 -10acc ctg gtg agc gga tat gcc aat ccc ggg gcc
tgc tca ggg act tgc 96Thr Leu Val Ser Gly Tyr Ala Asn Pro Gly Ala
Cys Ser Gly Thr Cys-5 -1 1 5
10gtg aac acg cac gac ccc tcg atc att cgc cgc tcc gat ggc aca tac
144Val Asn Thr His Asp Pro Ser Ile Ile Arg Arg Ser Asp Gly Thr Tyr
15 20 25ttc cgc ttc tcg acg ggc ggc
aag atc gcc atc cac act gcg cca gac 192Phe Arg Phe Ser Thr Gly Gly
Lys Ile Ala Ile His Thr Ala Pro Asp 30 35
40atc acg gga cca tgg act tac aag gga gct gct ctg ccc gac ggc
tcg 240Ile Thr Gly Pro Trp Thr Tyr Lys Gly Ala Ala Leu Pro Asp Gly
Ser 45 50 55agc att gac ctc gct ggc
aaa gac gac ctc tgg gca ccc agc gtc cac 288Ser Ile Asp Leu Ala Gly
Lys Asp Asp Leu Trp Ala Pro Ser Val His60 65
70 75cag atc gga agc ctg tac tac ctt tac tac tcg
gtg agc acg ttt ggg 336Gln Ile Gly Ser Leu Tyr Tyr Leu Tyr Tyr Ser
Val Ser Thr Phe Gly 80 85
90tcg cag aac tcg gca att gga ctg gcg cgg tcg tcg acg atg gac gtg
384Ser Gln Asn Ser Ala Ile Gly Leu Ala Arg Ser Ser Thr Met Asp Val
95 100 105ggc agc tgg acg gac gtg
gga agc acg ggc atc aag tcg gac tcg tcg 432Gly Ser Trp Thr Asp Val
Gly Ser Thr Gly Ile Lys Ser Asp Ser Ser 110 115
120aag ccg tac aac gcg att gat ccg gcg ctg atc aac gcc gac
ggc acg 480Lys Pro Tyr Asn Ala Ile Asp Pro Ala Leu Ile Asn Ala Asp
Gly Thr 125 130 135tac ctc ctc act ttc
ggg tcg ttc tgg aag gac ctg tac cag gtg ccg 528Tyr Leu Leu Thr Phe
Gly Ser Phe Trp Lys Asp Leu Tyr Gln Val Pro140 145
150 155atg aag acc acg ccg acg gct gca agc ggg
tcg gcg tac caa gtg gcg 576Met Lys Thr Thr Pro Thr Ala Ala Ser Gly
Ser Ala Tyr Gln Val Ala 160 165
170tac gac ccg gtc agc acg gcg gaa gag ggc ccg ttc atc ttc aag tac
624Tyr Asp Pro Val Ser Thr Ala Glu Glu Gly Pro Phe Ile Phe Lys Tyr
175 180 185ggc agc tac tac tac ctc
ttc tac tcc aag ggc aag tgc tgc ggc tac 672Gly Ser Tyr Tyr Tyr Leu
Phe Tyr Ser Lys Gly Lys Cys Cys Gly Tyr 190 195
200gac agc tcc agg ccg gcg gcg gga gag gag tac aag atc atg
gtc tgc 720Asp Ser Ser Arg Pro Ala Ala Gly Glu Glu Tyr Lys Ile Met
Val Cys 205 210 215cgg tcg tcc aag gcc
acg ggc gga ttt gtc gac aag agc gga aca tcg 768Arg Ser Ser Lys Ala
Thr Gly Gly Phe Val Asp Lys Ser Gly Thr Ser220 225
230 235tgc acc aac gga ggc ggg aca gtc gtt ttg
gaa tcg cac ggc aac gtt 816Cys Thr Asn Gly Gly Gly Thr Val Val Leu
Glu Ser His Gly Asn Val 240 245
250tac gga ccc gga ggc caa gga gtc tac gac gat ccc aca tac ggg ccg
864Tyr Gly Pro Gly Gly Gln Gly Val Tyr Asp Asp Pro Thr Tyr Gly Pro
255 260 265att ctc tac tat cac tac
gtc gtc acg acc atc gga tac gcc gac ggc 912Ile Leu Tyr Tyr His Tyr
Val Val Thr Thr Ile Gly Tyr Ala Asp Gly 270 275
280cag aag cag ttc ggg tgg aac aag atc aat ttc tcc agc ggt
tgg ccg 960Gln Lys Gln Phe Gly Trp Asn Lys Ile Asn Phe Ser Ser Gly
Trp Pro 285 290 295gtc gtg
966Val
Val30036322PRTBotryosphaeria rhodina 36Met Leu Asn Leu Lys Ile Leu Ala
Thr Ser Phe Leu Pro Leu Leu Pro -20 -15
-10Thr Leu Val Ser Gly Tyr Ala Asn Pro Gly Ala Cys Ser Gly Thr Cys-5
-1 1 5 10Val Asn Thr His Asp Pro
Ser Ile Ile Arg Arg Ser Asp Gly Thr Tyr 15 20
25Phe Arg Phe Ser Thr Gly Gly Lys Ile Ala Ile His Thr
Ala Pro Asp 30 35 40Ile Thr Gly
Pro Trp Thr Tyr Lys Gly Ala Ala Leu Pro Asp Gly Ser 45
50 55Ser Ile Asp Leu Ala Gly Lys Asp Asp Leu Trp Ala
Pro Ser Val His60 65 70
75Gln Ile Gly Ser Leu Tyr Tyr Leu Tyr Tyr Ser Val Ser Thr Phe Gly
80 85 90Ser Gln Asn Ser Ala Ile
Gly Leu Ala Arg Ser Ser Thr Met Asp Val 95
100 105Gly Ser Trp Thr Asp Val Gly Ser Thr Gly Ile Lys
Ser Asp Ser Ser 110 115 120Lys Pro
Tyr Asn Ala Ile Asp Pro Ala Leu Ile Asn Ala Asp Gly Thr 125
130 135Tyr Leu Leu Thr Phe Gly Ser Phe Trp Lys Asp
Leu Tyr Gln Val Pro140 145 150
155Met Lys Thr Thr Pro Thr Ala Ala Ser Gly Ser Ala Tyr Gln Val Ala
160 165 170Tyr Asp Pro Val
Ser Thr Ala Glu Glu Gly Pro Phe Ile Phe Lys Tyr 175
180 185Gly Ser Tyr Tyr Tyr Leu Phe Tyr Ser Lys Gly
Lys Cys Cys Gly Tyr 190 195 200Asp
Ser Ser Arg Pro Ala Ala Gly Glu Glu Tyr Lys Ile Met Val Cys 205
210 215Arg Ser Ser Lys Ala Thr Gly Gly Phe Val
Asp Lys Ser Gly Thr Ser220 225 230
235Cys Thr Asn Gly Gly Gly Thr Val Val Leu Glu Ser His Gly Asn
Val 240 245 250Tyr Gly Pro
Gly Gly Gln Gly Val Tyr Asp Asp Pro Thr Tyr Gly Pro 255
260 265Ile Leu Tyr Tyr His Tyr Val Val Thr Thr
Ile Gly Tyr Ala Asp Gly 270 275
280Gln Lys Gln Phe Gly Trp Asn Lys Ile Asn Phe Ser Ser Gly Trp Pro 285
290 295Val Val300371368DNABotryosphaeria
rhodinaCDS(1)..(1368)sig_peptide(1)..(54)mat_peptide(55)..(1368) 37atg
cat ttc cct tcc att tgg agc ctc gcg ctc ctt tca tca tca gcc 48Met
His Phe Pro Ser Ile Trp Ser Leu Ala Leu Leu Ser Ser Ser Ala -15
-10 -5ctc gcg tcg ctg cag atc gtc ccg ggc
gcc aca tgg act gcc acc aac 96Leu Ala Ser Leu Gln Ile Val Pro Gly
Ala Thr Trp Thr Ala Thr Asn -1 1 5
10acc gga cag cac ctt cag gcc cat ggt acc ggc atc atc aag gtt ggc
144Thr Gly Gln His Leu Gln Ala His Gly Thr Gly Ile Ile Lys Val Gly15
20 25 30gac acg tac tac atg
atc ggc gag gac aag acg aac ggc acc agt ttc 192Asp Thr Tyr Tyr Met
Ile Gly Glu Asp Lys Thr Asn Gly Thr Ser Phe 35
40 45cag aac gtc aac tgc tac tcg tcc acg aac ctc
gtc gaa tgg aag tac 240Gln Asn Val Asn Cys Tyr Ser Ser Thr Asn Leu
Val Glu Trp Lys Tyr 50 55
60gaa ggc gcc ctg ctc tcc cag acg gcc tcg ggc gat ctc ggt ccc agc
288Glu Gly Ala Leu Leu Ser Gln Thr Ala Ser Gly Asp Leu Gly Pro Ser
65 70 75cgc gtg gtt gag cgt ccc aag gtc
atc tac aac gac cag acc agc aag 336Arg Val Val Glu Arg Pro Lys Val
Ile Tyr Asn Asp Gln Thr Ser Lys 80 85
90tac gtg ctc tgg atg cac atc gac tcg tcc gac tac aag gac gcc aag
384Tyr Val Leu Trp Met His Ile Asp Ser Ser Asp Tyr Lys Asp Ala Lys95
100 105 110aca ggc gtc gcc
tcc ggc gat agc gtt tgc ggc tcc tac gag tac cac 432Thr Gly Val Ala
Ser Gly Asp Ser Val Cys Gly Ser Tyr Glu Tyr His 115
120 125ggc agc ttc cgg ccg ttg ggc ttc cag agc
agg gat atg ggc ctg ttc 480Gly Ser Phe Arg Pro Leu Gly Phe Gln Ser
Arg Asp Met Gly Leu Phe 130 135
140aag gac gat gat ggc aag gcg tac ttg atg acc gaa gac cgt gaa aac
528Lys Asp Asp Asp Gly Lys Ala Tyr Leu Met Thr Glu Asp Arg Glu Asn
145 150 155ggc ctc cgc atc aac gcc ttg
acc gac gac tac ctg aac gtc acc ggc 576Gly Leu Arg Ile Asn Ala Leu
Thr Asp Asp Tyr Leu Asn Val Thr Gly 160 165
170gac tcc tct gtc tac cgc ttc gac gag aag tac gaa tcc ccc gcc atg
624Asp Ser Ser Val Tyr Arg Phe Asp Glu Lys Tyr Glu Ser Pro Ala Met175
180 185 190gtc aag gtt gac
ggg acc tac tac ctc ttc gcc tcc cag ctt acc ggc 672Val Lys Val Asp
Gly Thr Tyr Tyr Leu Phe Ala Ser Gln Leu Thr Gly 195
200 205tgg aac ccc aac gac aac tac tac gtc aca
gcc tcc tcc ctc tcc ggc 720Trp Asn Pro Asn Asp Asn Tyr Tyr Val Thr
Ala Ser Ser Leu Ser Gly 210 215
220ccc tgg acc tcc tgg aag acc ttc gcc gac gtc ggc tcc aac acc tac
768Pro Trp Thr Ser Trp Lys Thr Phe Ala Asp Val Gly Ser Asn Thr Tyr
225 230 235tcc tcg caa acc tcc ttc atc
ctc ccc atc acc ggc agc tcc ggc acg 816Ser Ser Gln Thr Ser Phe Ile
Leu Pro Ile Thr Gly Ser Ser Gly Thr 240 245
250acg tac atg tac cta ggc gac cgc tgg atc agc tcc gcc ctc ttc cgc
864Thr Tyr Met Tyr Leu Gly Asp Arg Trp Ile Ser Ser Ala Leu Phe Arg255
260 265 270agc acc tac atc
tgg ctg ccg ctc acg atc gac tcc gcc gca aag acc 912Ser Thr Tyr Ile
Trp Leu Pro Leu Thr Ile Asp Ser Ala Ala Lys Thr 275
280 285gca tcc atg aag aac gcc gtc aac tgg gtc
ccc gac gtc gcc gcc ggc 960Ala Ser Met Lys Asn Ala Val Asn Trp Val
Pro Asp Val Ala Ala Gly 290 295
300acc tgg gcc gct ggc ccc agc gag acg cag ccg gag ggc gaa gac gcg
1008Thr Trp Ala Ala Gly Pro Ser Glu Thr Gln Pro Glu Gly Glu Asp Ala
305 310 315acg ctc agc ggc ggc gcg agg
acg gtg acc tgc agt ggg tgc agc ggc 1056Thr Leu Ser Gly Gly Ala Arg
Thr Val Thr Cys Ser Gly Cys Ser Gly 320 325
330ggg gag ggg gcc ggg tat ctc ggt ggg acg gac tcg ggc gtc gtg acg
1104Gly Glu Gly Ala Gly Tyr Leu Gly Gly Thr Asp Ser Gly Val Val Thr335
340 345 350ttt gcg ggg gtg
acg agc gat gcg gcg acg aag tcg tcg gtt cgg gtc 1152Phe Ala Gly Val
Thr Ser Asp Ala Ala Thr Lys Ser Ser Val Arg Val 355
360 365aag tat cag aat ttg gat agc acc gcg cgg
tat gcg gat gtg agc gtt 1200Lys Tyr Gln Asn Leu Asp Ser Thr Ala Arg
Tyr Ala Asp Val Ser Val 370 375
380aat ggc ggc gcg aag cag agg atc gcg ttt ttg ccg acg gcg aac ggg
1248Asn Gly Gly Ala Lys Gln Arg Ile Ala Phe Leu Pro Thr Ala Asn Gly
385 390 395acg cct ggg agt agc gtt gtg
aat ctg gat ttg aag gcg ggc agt gcg 1296Thr Pro Gly Ser Ser Val Val
Asn Leu Asp Leu Lys Ala Gly Ser Ala 400 405
410aat gag gtg gtt att gag ggc gcg aat ggt ggg tgg gga cct gat gtg
1344Asn Glu Val Val Ile Glu Gly Ala Asn Gly Gly Trp Gly Pro Asp Val415
420 425 430gat cgg att atg
gtg ccg cgg tcg 1368Asp Arg Ile Met
Val Pro Arg Ser 43538456PRTBotryosphaeria rhodina 38Met
His Phe Pro Ser Ile Trp Ser Leu Ala Leu Leu Ser Ser Ser Ala -15
-10 -5Leu Ala Ser Leu Gln Ile Val Pro Gly
Ala Thr Trp Thr Ala Thr Asn -1 1 5
10Thr Gly Gln His Leu Gln Ala His Gly Thr Gly Ile Ile Lys Val Gly15
20 25 30Asp Thr Tyr Tyr Met
Ile Gly Glu Asp Lys Thr Asn Gly Thr Ser Phe 35
40 45Gln Asn Val Asn Cys Tyr Ser Ser Thr Asn Leu
Val Glu Trp Lys Tyr 50 55
60Glu Gly Ala Leu Leu Ser Gln Thr Ala Ser Gly Asp Leu Gly Pro Ser
65 70 75Arg Val Val Glu Arg Pro Lys Val
Ile Tyr Asn Asp Gln Thr Ser Lys 80 85
90Tyr Val Leu Trp Met His Ile Asp Ser Ser Asp Tyr Lys Asp Ala Lys95
100 105 110Thr Gly Val Ala
Ser Gly Asp Ser Val Cys Gly Ser Tyr Glu Tyr His 115
120 125Gly Ser Phe Arg Pro Leu Gly Phe Gln Ser
Arg Asp Met Gly Leu Phe 130 135
140Lys Asp Asp Asp Gly Lys Ala Tyr Leu Met Thr Glu Asp Arg Glu Asn
145 150 155Gly Leu Arg Ile Asn Ala Leu
Thr Asp Asp Tyr Leu Asn Val Thr Gly 160 165
170Asp Ser Ser Val Tyr Arg Phe Asp Glu Lys Tyr Glu Ser Pro Ala
Met175 180 185 190Val Lys
Val Asp Gly Thr Tyr Tyr Leu Phe Ala Ser Gln Leu Thr Gly
195 200 205Trp Asn Pro Asn Asp Asn Tyr
Tyr Val Thr Ala Ser Ser Leu Ser Gly 210 215
220Pro Trp Thr Ser Trp Lys Thr Phe Ala Asp Val Gly Ser Asn
Thr Tyr 225 230 235Ser Ser Gln Thr
Ser Phe Ile Leu Pro Ile Thr Gly Ser Ser Gly Thr 240
245 250Thr Tyr Met Tyr Leu Gly Asp Arg Trp Ile Ser Ser
Ala Leu Phe Arg255 260 265
270Ser Thr Tyr Ile Trp Leu Pro Leu Thr Ile Asp Ser Ala Ala Lys Thr
275 280 285Ala Ser Met Lys Asn
Ala Val Asn Trp Val Pro Asp Val Ala Ala Gly 290
295 300Thr Trp Ala Ala Gly Pro Ser Glu Thr Gln Pro Glu
Gly Glu Asp Ala 305 310 315Thr Leu
Ser Gly Gly Ala Arg Thr Val Thr Cys Ser Gly Cys Ser Gly 320
325 330Gly Glu Gly Ala Gly Tyr Leu Gly Gly Thr Asp
Ser Gly Val Val Thr335 340 345
350Phe Ala Gly Val Thr Ser Asp Ala Ala Thr Lys Ser Ser Val Arg Val
355 360 365Lys Tyr Gln Asn
Leu Asp Ser Thr Ala Arg Tyr Ala Asp Val Ser Val 370
375 380Asn Gly Gly Ala Lys Gln Arg Ile Ala Phe Leu
Pro Thr Ala Asn Gly 385 390 395Thr
Pro Gly Ser Ser Val Val Asn Leu Asp Leu Lys Ala Gly Ser Ala 400
405 410Asn Glu Val Val Ile Glu Gly Ala Asn Gly
Gly Trp Gly Pro Asp Val415 420 425
430Asp Arg Ile Met Val Pro Arg Ser
435391248DNABotryosphaeria
rhodinaCDS(1)..(1248)sig_peptide(1)..(60)mat_peptide(61)..(1248) 39atg
gca acg cgt gca ctc tct acg ttc gtt ttg gcc aac ttt ctg ggc 48Met
Ala Thr Arg Ala Leu Ser Thr Phe Val Leu Ala Asn Phe Leu Gly-20
-15 -10 -5tca tgc ctc tct tta gct
gtt cca gtc gtg cgc caa agc ggc aaa gtt 96Ser Cys Leu Ser Leu Ala
Val Pro Val Val Arg Gln Ser Gly Lys Val -1 1 5
10ggc gtc ctt gat gtt tcc atc cca ccc aac agg aac gat
gac caa tac 144Gly Val Leu Asp Val Ser Ile Pro Pro Asn Arg Asn Asp
Asp Gln Tyr 15 20 25tac acg gtt
gat ctc gat ttc gat ggc caa act gtt ccg gtt ctt ctc 192Tyr Thr Val
Asp Leu Asp Phe Asp Gly Gln Thr Val Pro Val Leu Leu 30
35 40gat act ggc tct gga gat ctc ttc gtt ggg tca aac
caa tgc agc acg 240Asp Thr Gly Ser Gly Asp Leu Phe Val Gly Ser Asn
Gln Cys Ser Thr45 50 55
60act gat cca gac agt gga tgc tac aac agc cca ttt tac caa atc acc
288Thr Asp Pro Asp Ser Gly Cys Tyr Asn Ser Pro Phe Tyr Gln Ile Thr
65 70 75aat gaa acc gtc atc gtt
gcg aac gag acg ttc ggc act gtt gtg gga 336Asn Glu Thr Val Ile Val
Ala Asn Glu Thr Phe Gly Thr Val Val Gly 80 85
90gtt gcc ggc gtg aat gga aat cag tcc atc atg ccc gtt
gat ttt gga 384Val Ala Gly Val Asn Gly Asn Gln Ser Ile Met Pro Val
Asp Phe Gly 95 100 105ggc gtt acc
att cca gat ctc gcc act ccc ctt ctt tat tat gcg ggc 432Gly Val Thr
Ile Pro Asp Leu Ala Thr Pro Leu Leu Tyr Tyr Ala Gly 110
115 120aag ggc gag ttc cag aat ggg tct ttt gga ggc att
ctt ggt gtc tct 480Lys Gly Glu Phe Gln Asn Gly Ser Phe Gly Gly Ile
Leu Gly Val Ser125 130 135
140ccg cgc aac gtt tct cgc aac tat tac ttc ttc gag cgg ctt cct cca
528Pro Arg Asn Val Ser Arg Asn Tyr Tyr Phe Phe Glu Arg Leu Pro Pro
145 150 155atc gat gcc atg atc
aca gaa ggt ctg ttg gag aag ccc gtc ttc tcg 576Ile Asp Ala Met Ile
Thr Glu Gly Leu Leu Glu Lys Pro Val Phe Ser 160
165 170ctg acc ctg ccg aga ctg gga gat cct gat tcc ata
tcc gga aaa ttg 624Leu Thr Leu Pro Arg Leu Gly Asp Pro Asp Ser Ile
Ser Gly Lys Leu 175 180 185aca ctt
ggc gcc atc gag gac gct ccg atc atc gga gac atc tcc tac 672Thr Leu
Gly Ala Ile Glu Asp Ala Pro Ile Ile Gly Asp Ile Ser Tyr 190
195 200aac gaa atc atc gac gca ccc aac tac ggc tac
gag gat gcc cgt ctc 720Asn Glu Ile Ile Asp Ala Pro Asn Tyr Gly Tyr
Glu Asp Ala Arg Leu205 210 215
220gcc ccg atg tcc tgg acc tcc cag ctg gag ggc gtg cgc atg aac gga
768Ala Pro Met Ser Trp Thr Ser Gln Leu Glu Gly Val Arg Met Asn Gly
225 230 235gtt gag atc aac atg
acg cag agc tca atc gac gcg caa ggc cgc tac 816Val Glu Ile Asn Met
Thr Gln Ser Ser Ile Asp Ala Gln Gly Arg Tyr 240
245 250ctc tcc ctc ttc gac tcg ggc gcc caa acc atc ctc
ctc cgc tac caa 864Leu Ser Leu Phe Asp Ser Gly Ala Gln Thr Ile Leu
Leu Arg Tyr Gln 255 260 265gaa ttc
acc gcc gtc gcc gcg ctc ttc aag ggc aag acg att gtg cag 912Glu Phe
Thr Ala Val Ala Ala Leu Phe Lys Gly Lys Thr Ile Val Gln 270
275 280gac ggc tac gcc gtc tac ttc gac tgc gcc gag
ccg cag ctg ctc gag 960Asp Gly Tyr Ala Val Tyr Phe Asp Cys Ala Glu
Pro Gln Leu Leu Glu285 290 295
300ctg aac tac cac ggc cgc tgg ttc gcc gtc gac ccg ctc gac ttg ata
1008Leu Asn Tyr His Gly Arg Trp Phe Ala Val Asp Pro Leu Asp Leu Ile
305 310 315atc ccc agc gac cat
ggt gtg gtc aac ggg acg gtg atg tgc aag tcc 1056Ile Pro Ser Asp His
Gly Val Val Asn Gly Thr Val Met Cys Lys Ser 320
325 330gcg ctg ggc acg tgg agc agg acg ttt gcg gac tcg
att atc ggt gtg 1104Ala Leu Gly Thr Trp Ser Arg Thr Phe Ala Asp Ser
Ile Ile Gly Val 335 340 345ccg ttt
atg cgg aat acg ctg agt gtg ttt gat tac gtg acg gag gat 1152Pro Phe
Met Arg Asn Thr Leu Ser Val Phe Asp Tyr Val Thr Glu Asp 350
355 360ttg tac agt gtg cag ccg cgc gtg ggg ttg ggg
agc ttg acg gat ggc 1200Leu Tyr Ser Val Gln Pro Arg Val Gly Leu Gly
Ser Leu Thr Asp Gly365 370 375
380gcg gcg gcg atg gag agg tat gcg ggg ttg tat cag aat agg ttg ttg
1248Ala Ala Ala Met Glu Arg Tyr Ala Gly Leu Tyr Gln Asn Arg Leu Leu
385 390
39540416PRTBotryosphaeria rhodina 40Met Ala Thr Arg Ala Leu Ser Thr Phe
Val Leu Ala Asn Phe Leu Gly-20 -15 -10
-5 Ser Cys Leu Ser Leu Ala Val Pro Val Val Arg Gln Ser Gly
Lys Val -1 1 5 10Gly Val Leu
Asp Val Ser Ile Pro Pro Asn Arg Asn Asp Asp Gln Tyr 15
20 25Tyr Thr Val Asp Leu Asp Phe Asp Gly Gln Thr
Val Pro Val Leu Leu 30 35 40 Asp Thr
Gly Ser Gly Asp Leu Phe Val Gly Ser Asn Gln Cys Ser Thr45
50 55 60Thr Asp Pro Asp Ser Gly Cys
Tyr Asn Ser Pro Phe Tyr Gln Ile Thr 65 70
75Asn Glu Thr Val Ile Val Ala Asn Glu Thr Phe Gly Thr
Val Val Gly 80 85 90Val Ala
Gly Val Asn Gly Asn Gln Ser Ile Met Pro Val Asp Phe Gly 95
100 105Gly Val Thr Ile Pro Asp Leu Ala Thr Pro
Leu Leu Tyr Tyr Ala Gly 110 115 120Lys
Gly Glu Phe Gln Asn Gly Ser Phe Gly Gly Ile Leu Gly Val Ser125
130 135 140Pro Arg Asn Val Ser Arg
Asn Tyr Tyr Phe Phe Glu Arg Leu Pro Pro 145
150 155Ile Asp Ala Met Ile Thr Glu Gly Leu Leu Glu Lys
Pro Val Phe Ser 160 165 170Leu
Thr Leu Pro Arg Leu Gly Asp Pro Asp Ser Ile Ser Gly Lys Leu 175
180 185Thr Leu Gly Ala Ile Glu Asp Ala Pro
Ile Ile Gly Asp Ile Ser Tyr 190 195
200Asn Glu Ile Ile Asp Ala Pro Asn Tyr Gly Tyr Glu Asp Ala Arg Leu205
210 215 220Ala Pro Met Ser
Trp Thr Ser Gln Leu Glu Gly Val Arg Met Asn Gly 225
230 235Val Glu Ile Asn Met Thr Gln Ser Ser Ile
Asp Ala Gln Gly Arg Tyr 240 245
250Leu Ser Leu Phe Asp Ser Gly Ala Gln Thr Ile Leu Leu Arg Tyr Gln
255 260 265Glu Phe Thr Ala Val Ala Ala
Leu Phe Lys Gly Lys Thr Ile Val Gln 270 275
280Asp Gly Tyr Ala Val Tyr Phe Asp Cys Ala Glu Pro Gln Leu Leu
Glu285 290 295 300Leu Asn
Tyr His Gly Arg Trp Phe Ala Val Asp Pro Leu Asp Leu Ile
305 310 315Ile Pro Ser Asp His Gly Val
Val Asn Gly Thr Val Met Cys Lys Ser 320 325
330Ala Leu Gly Thr Trp Ser Arg Thr Phe Ala Asp Ser Ile Ile
Gly Val 335 340 345Pro Phe Met Arg
Asn Thr Leu Ser Val Phe Asp Tyr Val Thr Glu Asp 350
355 360Leu Tyr Ser Val Gln Pro Arg Val Gly Leu Gly Ser
Leu Thr Asp Gly365 370 375
380Ala Ala Ala Met Glu Arg Tyr Ala Gly Leu Tyr Gln Asn Arg Leu Leu
385 390
39541849DNABotryosphaeria
rhodinaCDS(1)..(849)sig_peptide(1)..(63)mat_peptide(64)..(849) 41atg ctt
ccg aaa atc gct ctt cag ggt ggc ctc gtg gct ctg ctg gtg 48Met Leu
Pro Lys Ile Ala Leu Gln Gly Gly Leu Val Ala Leu Leu Val -20
-15 -10caa aca gcc gca gcc caa gta cga tgc gcc act
ccc gat ccc cca aaa 96Gln Thr Ala Ala Ala Gln Val Arg Cys Ala Thr
Pro Asp Pro Pro Lys-5 -1 1 5
10gag ctg ctg gag cat gca gcg gag atg aaa gcg caa gaa aag gcg atg
144Glu Leu Leu Glu His Ala Ala Glu Met Lys Ala Gln Glu Lys Ala Met
15 20 25aaa gat gct gga att cag caa
gcc cgg gcc cct atc aca atc aat gct 192Lys Asp Ala Gly Ile Gln Gln
Ala Arg Ala Pro Ile Thr Ile Asn Ala 30 35
40tgg ttc cac gtc atc gct gcc tct gac acc gtt gag gat gcc aac
ttg 240Trp Phe His Val Ile Ala Ala Ser Asp Thr Val Glu Asp Ala Asn
Leu 45 50 55act gat gaa atg ctt caa
aac caa ctt gag gtg ctc aat tcc aac tac 288Thr Asp Glu Met Leu Gln
Asn Gln Leu Glu Val Leu Asn Ser Asn Tyr60 65
70 75gct ccg cac gac atc cag ttc aat ctc tcg ggc
aca acc agg act gtc 336Ala Pro His Asp Ile Gln Phe Asn Leu Ser Gly
Thr Thr Arg Thr Val 80 85
90aac agc agt tgg tct gac aac acc gat acg ctt gtc atg aag aca caa
384Asn Ser Ser Trp Ser Asp Asn Thr Asp Thr Leu Val Met Lys Thr Gln
95 100 105ctc cgg aag ggc gat tat
gct act ctc aac ttg tat ttc cag agg aaa 432Leu Arg Lys Gly Asp Tyr
Ala Thr Leu Asn Leu Tyr Phe Gln Arg Lys 110 115
120ctc ccg ggt gac tca tca ggt tac tgc acc ttc cct gga atc
gtt gaa 480Leu Pro Gly Asp Ser Ser Gly Tyr Cys Thr Phe Pro Gly Ile
Val Glu 125 130 135gag ggg acg cta gac
ttc ttc aac gac ggc tgc gtg att gac gcc cag 528Glu Gly Thr Leu Asp
Phe Phe Asn Asp Gly Cys Val Ile Asp Ala Gln140 145
150 155acc gtg cct gga ggc agc aaa gtc ccg tac
aac gag ggg aaa aca gcc 576Thr Val Pro Gly Gly Ser Lys Val Pro Tyr
Asn Glu Gly Lys Thr Ala 160 165
170acc cat gag gtc ggc cac tgg ttc ggt ctc tac cac aca ttt caa ggc
624Thr His Glu Val Gly His Trp Phe Gly Leu Tyr His Thr Phe Gln Gly
175 180 185ggc tgc aac ggc ggc gac
ggt att gac gac acg cca gct caa gca agc 672Gly Cys Asn Gly Gly Asp
Gly Ile Asp Asp Thr Pro Ala Gln Ala Ser 190 195
200tac agc gag ggt tgt ccc gtt ggt agg gac tcg tgt ccg gat
ttg cct 720Tyr Ser Glu Gly Cys Pro Val Gly Arg Asp Ser Cys Pro Asp
Leu Pro 205 210 215gga ttg gac ccg att
cac aac tac atg gac tat tca gat gac gct tgc 768Gly Leu Asp Pro Ile
His Asn Tyr Met Asp Tyr Ser Asp Asp Ala Cys220 225
230 235tac gaa gaa ttt act cct gat caa gat gct
cgc atg cgg tcc aac tgg 816Tyr Glu Glu Phe Thr Pro Asp Gln Asp Ala
Arg Met Arg Ser Asn Trp 240 245
250gac tac tat cgc gcg gcc gcg cag ggc agt gag
849Asp Tyr Tyr Arg Ala Ala Ala Gln Gly Ser Glu 255
26042283PRTBotryosphaeria rhodina 42Met Leu Pro Lys Ile Ala Leu
Gln Gly Gly Leu Val Ala Leu Leu Val -20 -15
-10Gln Thr Ala Ala Ala Gln Val Arg Cys Ala Thr Pro Asp Pro Pro Lys-5
-1 1 5 10Glu Leu Leu Glu
His Ala Ala Glu Met Lys Ala Gln Glu Lys Ala Met 15
20 25Lys Asp Ala Gly Ile Gln Gln Ala Arg Ala Pro
Ile Thr Ile Asn Ala 30 35 40Trp
Phe His Val Ile Ala Ala Ser Asp Thr Val Glu Asp Ala Asn Leu 45
50 55Thr Asp Glu Met Leu Gln Asn Gln Leu Glu
Val Leu Asn Ser Asn Tyr60 65 70
75Ala Pro His Asp Ile Gln Phe Asn Leu Ser Gly Thr Thr Arg Thr
Val 80 85 90Asn Ser Ser
Trp Ser Asp Asn Thr Asp Thr Leu Val Met Lys Thr Gln 95
100 105Leu Arg Lys Gly Asp Tyr Ala Thr Leu Asn
Leu Tyr Phe Gln Arg Lys 110 115
120Leu Pro Gly Asp Ser Ser Gly Tyr Cys Thr Phe Pro Gly Ile Val Glu 125
130 135Glu Gly Thr Leu Asp Phe Phe Asn
Asp Gly Cys Val Ile Asp Ala Gln140 145
150 155Thr Val Pro Gly Gly Ser Lys Val Pro Tyr Asn Glu
Gly Lys Thr Ala 160 165
170Thr His Glu Val Gly His Trp Phe Gly Leu Tyr His Thr Phe Gln Gly
175 180 185Gly Cys Asn Gly Gly Asp
Gly Ile Asp Asp Thr Pro Ala Gln Ala Ser 190 195
200Tyr Ser Glu Gly Cys Pro Val Gly Arg Asp Ser Cys Pro Asp
Leu Pro 205 210 215Gly Leu Asp Pro Ile
His Asn Tyr Met Asp Tyr Ser Asp Asp Ala Cys220 225
230 235Tyr Glu Glu Phe Thr Pro Asp Gln Asp Ala
Arg Met Arg Ser Asn Trp 240 245
250Asp Tyr Tyr Arg Ala Ala Ala Gln Gly Ser Glu 255
2604334DNAArtificial sequencePrimer SigA2NotU-P 43tcgcgatccg
ttttcgcatt tatcgtgaaa cgct
344433DNAArtificial sequencePrimer SigA2NotD-P 44ccgcaaacgc tggtgaaagt
aaaagatgct gaa 334520DNAArtificial
sequencePrimer A 45agcgtttgcg gccgcgatcc
204621DNAArtificial sequencePrimer B 46ttattcggtc
gaaaaggatc c
214734DNAArtificial sequencePrimer #166 47cgcggatcca ccatggtctc
cttcaagtcg attc 344830DNAArtificial
sequencePrimer #167 48ccgctcgagt tactgcacgg taatcgtagc
30
User Contributions:
Comment about this patent or add new information about this topic:

















































