Patent application title: MANIPULATION OF GENES OF THE MEVALONATE AND ISOPRENOID PATHWAYS TO CREATE NOVEL TRAITS IN TRANSGENIC ORGANISMS
Inventors:
Frederick M. Hahn (Paia, HI, US)
Adelheid R. Kuehnle (Honolulu, HI, US)
Adelheid R. Kuehnle (Honolulu, HI, US)
IPC8 Class: AC12P900FI
USPC Class:
435131
Class name: Chemistry: molecular biology and microbiology micro-organism, tissue cell culture or enzyme using process to synthesize a desired chemical compound or composition preparing organic compound containing a metal or atom other than h, n, c, o, or halogen
Publication date: 2012-04-05
Patent application number: 20120083020
Abstract:
Disclosed are the uses of specific genes of the mevalonate and isoprenoid
biosynthetic pathways, and of inactive gene sites (the pseudogene) to (1)
enhance biosynthesis of isopentenyl diphosphate, dimethylallyl
diphosphate and isoprenoid pathway derived products in the plastids of
transgenic plants and microalgae, (2) create novel antibiotic resistant
transgenic plants and microalgae, and (3) create a novel selection system
and/or targeting sites for mediating the insertion of genetic material
into plant and microalgae plastids. The specific polynucleotides to be
used, solely or in any combination thereof, are publicly available from
GeneBank and contain open reading frames having sequences that upon
expression will produce active proteins with the following enzyme
activities: (a) acetoacetyl CoA thiolase (EC 2.3.1.9), (b)
3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) synthase (EC 4.1.3.5),
(c) HMG-CoA reductase (EC 1.1.1.34), (d) mevalonate kinase (EC 2.7.1.36),
(e) phosphomevalonate kinase (EC 2.7.4.2), (f) mevalonate diphosphate
decarboxylase (EC 4.1.1.33), (g) isopentenyl diphosphate (IPP) isomerase
(EC 5.3.3.2), and (h) phytoene synthase (EC 2.5.1.32).Claims:
1-114. (canceled)
115. A transformed prokaryotic cell that synthesizes an isoprenoid or an isoprenoid precursor via a mevalonate pathway, wherein the transformed prokaryotic cell comprises, one or more nucleic acids heterologous to the prokaryotic cell, wherein the one or more heterologous nucleic acids comprise nucleotide sequences that encode: (a) an enzyme that condenses two molecules of acetyl-CoA to acetoacetyl-CoA as the first step in the synthesis of the isoprenoid or isoprenoid precursor; (b) an enzyme that condenses acetoacetyl-CoA with acetyl-CoA to form HMG-CoA; (c) an enzyme that converts HMG-CoA to mevalonate; (d) an enzyme that phosphorylates mevalonate to mevalonate 5-phosphate; (e) an enzyme that converts mevalonate 5-phosphate to mevalonate 5-pyrophosphate; and (f) an enzyme that converts mevalonate 5-pyrophosphate to isopentenyl pyrophosphate, wherein culturing of said transformed prokaryotic cell in a suitable medium provides for production of the enzymes and synthesis of the isoprenoid or isoprenoid precursor.
116. The transformed prokaryotic cell of claim 115, wherein the one or more heterologous nucleic acids is contained in at least one extrachromosomal expression vector.
117. The transformed prokaryotic cell of claim 115, wherein the one or more heterologous nucleic acids is present in a single expression vector.
118. The transformed prokaryotic cell of claim 115, wherein the isoprenoid precursor is mevalonate.
119. The transformed prokaryotic cell of claim 115, wherein the transformed prokaryotic cell further comprises a heterologous nucleic acid comprising a nucleotide sequence encoding isopentenyl pyrophosphate isomerase.
120. The transformed prokaryotic cell of claim 119, wherein the isoprenoid precursor is IPP, and wherein the IPP is further modified enzymatically by the action of the isopentenyl pyrophosphate isomerase to generate dimethylallyl pyrophosphate (DMAPP).
121. The transformed prokaryotic cell of claim 120, wherein the transformed prokaryotic cell further comprises a heterologous nucleic acid comprising a nucleotide sequence encoding one or more polyprenyl pyrophosphate synthases.
122. The transformed prokaryotic cell of claim 121, wherein the DMAPP is further modified enzymatically with the one or more polyprenyl pyrophosphate synthases to provide an isoprenoid.
123. The transformed prokaryotic cell of claim 122, wherein the isoprenoid is a tetraterpene.
124. The transformed prokaryotic cell of claim 122, wherein the isoprenoid is lycopene.
125. The transformed prokaryotic cell of claim 115, wherein the transformed prokaryotic cell is of the genus Escherichia.
126. The transformed prokaryotic cell of claim 115, wherein the transformed prokaryotic cell is an Escherichia coli.
127. A transformed prokaryotic cell that synthesizes an isoprenoid or an isoprenoid precursor via a mevalonate pathway, wherein the transformed prokaryotic cell comprises one or more nucleic acids heterologous to the prokaryotic cell, wherein the one or more heterologous nucleic acids comprise nucleotide sequences that encode: (a) an enzyme that condenses two molecules of acetyl-CoA to acetoacetyl-CoA as the first step in the synthesis of the isoprenoid or isoprenoid precursor; (b) an enzyme that condenses acetoacetyl-CoA with acetyl-CoA to form HMG-CoA; (c) an enzyme that converts HMG-CoA to mevalonate; (d) an enzyme that phosphorylates mevalonate to mevalonate 5-phosphate; (e) an enzyme that converts mevalonate 5-phosphate to mevalonate 5-pyrophosphate; (f) an enzyme that converts mevalonate 5-pyrophosphate to isopentenyl pyrophosphate (IPP); and (g) an enzyme that isomerizes IPP to dimethylallyl pyrophosphate (DMAPP); wherein culturing of said transformed prokaryotic cell in a suitable medium provides for production of the enzymes and synthesis of the isoprenoid or isoprenoid precursor.
128. The transformed prokaryotic cell of claim 127, wherein the one or more heterologous nucleic acids is contained in at least one extrachromosomal expression vector.
129. The transformed prokaryotic cell of claim 127, wherein the one or more heterologous nucleic acids is present in a single expression vector.
130. The transformed prokaryotic cell of claim 127, wherein the isoprenoid precursor is mevalonate.
131. The transformed prokaryotic cell of claim 127, wherein the transformed prokaryotic cell further comprises a heterologous nucleic acid comprising a nucleotide sequence encoding isopentenyl pyrophosphate isomerase.
132. The transformed prokaryotic cell of claim 131, wherein the isoprenoid precursor is IPP, and wherein the IPP is further modified enzymatically by the action of the isopentenyl pyrophosphate isomerase to generate dimethylallyl pyrophosphate (DMAPP).
133. The transformed prokaryotic cell of claim 132, wherein the transformed prokaryotic cell further comprises a heterologous nucleic acid comprising a nucleotide sequence encoding one or more polyprenyl pyrophosphate synthases.
134. The transformed prokaryotic cell of claim 133, wherein the DMAPP is further modified enzymatically with the one or more polyprenyl pyrophosphate synthases to provide an isoprenoid.
135. The transformed prokaryotic cell of claim 134, wherein the isoprenoid is a tetraterpene.
136. The transformed prokaryotic cell of claim 134, wherein the isoprenoid is lycopene.
137. The transformed prokaryotic cell of claim 127, wherein the transformed prokaryotic cell is of the genus Escherichia.
138. The transformed prokaryotic cell of claim 127, wherein the transformed prokaryotic cell is an Escherichia coli.
139. A transformed Escherichia coli host cell that synthesizes an isoprenoid or an isoprenoid precursor via a mevalonate pathway, wherein the transformed Escherichia coli host cell comprises one or more nucleic acids heterologous to the Escherichia coli host cell, wherein the one or more heterologous nucleic acids comprise nucleotide sequences that encode: (a) an enzyme that condenses two molecules of acetyl-CoA to acetoacetyl-CoA as the first step in the synthesis of the isoprenoid or isoprenoid precursor; (b) an enzyme that condenses acetoacetyl-CoA with acetyl-CoA to form HMG-CoA; (c) an enzyme that converts HMG-CoA to mevalonate; (d) an enzyme that phosphorylates mevalonate to mevalonate 5-phosphate; (e) an enzyme that converts mevalonate 5-phosphate to mevalonate 5-pyrophosphate; and (f) an enzyme that converts mevalonate 5-pyrophosphate to isopentenyl pyrophosphate, wherein culturing of said transformed Escherichia coli host cell in a suitable medium provides for production of the enzymes and synthesis of the isoprenoid or isoprenoid precursor.
140. A transformed Escherichia coli host cell that synthesizes an isoprenoid or an isoprenoid precursor via a mevalonate pathway, wherein the transformed Escherichia coli host cell comprises one or more nucleic acids heterologous to the Escherichia coli host cell, wherein the one or more heterologous nucleic acids comprise nucleotide sequences that encode: (a) an enzyme that condenses two molecules of acetyl-CoA to acetoacetyl-CoA as the first step in the synthesis of the isoprenoid or isoprenoid precursor; (b) an enzyme that condenses acetoacetyl-CoA with acetyl-CoA to form HMG-CoA; (c) an enzyme that converts HMG-CoA to mevalonate; (d) an enzyme that phosphorylates mevalonate to mevalonate 5-phosphate; (e) an enzyme that converts mevalonate 5-phosphate to mevalonate 5-pyrophosphate; (f) an enzyme that converts mevalonate 5-pyrophosphate to isopentenyl pyrophosphate (IPP); and (g) an enzyme that isomerizes IPP to dimethylallyl pyrophosphate (DMAPP); wherein culturing of said transformed Escherichia coli host cell in a suitable medium provides for production of the enzymes and synthesis of the isoprenoid or isoprenoid precursor.
141. A transformed cell having increased isoprenoid production as compared to a non-transformed cell, said cell comprising one or more isolated polynucleotides which together encode the enzymes of the complete mevalonate pathway.
142. The cell of claim 141, wherein the cell is a bacterial cell, a plant cell or a microalgae cell.
143. The cell of claim 142, wherein the bacterial cell is an E. coli cell.
144. The cell according to claim 141, wherein one of the one or more isolated polynucleotides comprises a polynucleotide sequence encoding isopentenyl pyrophosphate (IPP) isomerase.
145. A descendant transformed cell of the transformed cell of claim 141, wherein said descendant cell exhibits increased isoprenoid production as compared to a non-transformed cell of the same type.
146. A transformed cell having increased isoprenoid production as compared to a non-transformed cell, wherein said cell is produced by a method of: providing one or more isolated polynucleotides which together encode the enzymes of the complete mevalonate pathway; providing a plurality of target cells; introducing said isolated polynucleotide(s) into said target cells; selecting target cells which have been transformed with said polynucleotide(s); and growing said transformed cells under conditions whereby additional generations of descendant transformed cells are produced, said transformed cells exhibiting increased isoprenoid production as compared to non-transformed cells of the same type.
147. A cell culture comprising the transformed cell of claim 146.
148. A method of making isopentenyl pyrophosphate (IPP) using the cell of any of claim 146.
149. A method of making isopentenyl pyrophosphate (IPP) via a mevalonate pathway in cells comprising: providing a plurality of target cells that do not naturally produce IPP through the mevalonate pathway or that do not naturally possess the mevalonate pathway; providing one or more isolated polynucleotide(s) which together encode the enzymes of the complete mevalonate pathway; introducing said isolated polynucleotide(s) into said target cells encoding the enzymes of the complete mevalonate pathway; selecting target cells which have been transformed with said polynucleotide(s); and culturing the transformed target cells under conditions whereby additional generations of descendant transformed cells are produced, said transformed cells exhibiting increased IPP production as compared to non-transformed cells of the same type.
150. The method of claim 149, wherein one of the one or more isolated polynucleotides comprises a polynucleotide sequence encoding isopentenyl pyrophosphate (IPP) isomerase.
151. The method of claim 150, wherein the method further comprises converting IPP to dimethylallyl diphosphate (DMAPP).
152. The method of claim 149, wherein the target cells are bacterial cells.
153. The method of claim 152, wherein the bacterial cells are E. coli cells.
154. A method of causing activity of the complete mevalonate pathway in bacteria that naturally possess only the non-mevalonate pathway, comprising: providing target bacterial cells that naturally possess only the non-mevalonate pathway; transforming the bacterial cells with at least one polynucleotide encoding at least one enzyme of the mevalonate pathway such that expression of the at least one polynucleotide results in the enzymes of the complete mevalonate pathway being present in the bacterial cells; selecting the transformed bacterial cells; and culturing the transformed bacterial cells under conditions whereby additional generations of descendant transformed bacterial cells are produced and wherein the complete mevalonate pathway is active in those transformed bacterial cells.
155. The method of claim 154, wherein the at least one polynucleotide comprises an open reading frame encoding at least one of the group comprising: (a) an enzyme that condenses two molecules of acetyl-CoA to acetoacetyl-CoA as the first step in the synthesis of the isoprenoid or isoprenoid precursor; (b) an enzyme that condenses acetoacetyl-CoA with acetyl-CoA to form HMG-CoA; (c) an enzyme that converts HMG-CoA to mevalonate; (d) an enzyme that phosphorylates mevalonate to mevalonate 5-phosphate; and (e) an enzyme that converts mevalonate 5-phosphate to mevalonate 5-pyrophosphate.
156. The method of claim 155, wherein the at least one polynucleotide further comprises an open reading frame encoding IPP isomerase.
157. The method of claim 156, wherein the at least one polynucleotide is a polycistronic polynucleotide encoding all of the enzymes of the complete mevalonate pathway.
158. The method of claim 154, wherein more than one kind of isolated polynucleotide is used to transform the target cell, with no single polynucleotide encoding all enzymes of the complete mevalonate pathway.
159. The method of claim 155, wherein the bacterial cells are E. coli cells.
Description:
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser. No. 12/026,316, filed Feb. 5, 2008, which is a continuation of U.S. application Ser. No. 11/489,050, filed Jul. 18, 2006, now abandoned, which is a continuation of U.S. application Ser. No. 11/053,541, filed Feb. 8, 2005, now U.S. Pat. No. 7,618,819, which is a divisional of U.S. application Ser. No. 10/835,516, filed Apr. 28, 2004, now U.S. Pat. No. 7,129,392, which is a continuation of U.S. application Ser. No. 09/918,740, filed Jul. 31, 2001, now abandoned, from which applications priority is claimed pursuant to 35 U.S.C. §120, and claims the benefit under 35 U.S.C. §119(e)(1) of U.S. Provisional Application No. 60/221,703, filed Jul. 31, 2000, all of which applications are incorporated by reference herein in their entireties.
FIELD OF THE INVENTION
[0002] This invention relates to the fields of biotechnology and genetic engineering, in particular to agricultural and aquacultural biotechnology. More specifically, the invention relates to transgenic plants and microalgae, in particular to transplastomic plants and microalgae and means for insertion of genetic material into plastids.
BACKGROUND OF THE INVENTION
[0003] The ubiquitous isoprenoid biosynthetic pathway is responsible for the formation of the most chemically diverse family of metabolites found in nature (Hahn et al., J. Bacteriol. 178:619-624, 1996) including sterols (Popjak, Biochemical symposium no. 29 (T. W. Goodwin, ed.) Academic Press, New York, pp 17-37, 1970), carotenoids (Goodwin, Biochem. J. 123:293-329, 1971), dolichols (Matsuoka et al., J. Biol. Chem. 266:3464-3468, 1991), ubiquinones (Ashby and Edwards, J. Biol. Chem. 265:13157-13164, 1990), and prenylated proteins (Clarke, Annu. Rev. Biochem. 61:355-386, 1992). Biosynthesis of isopentenyl diphosphate (IPP), the essential 5-carbon isoprenoid precursor, occurs by two distinct compartmentalized routes in plants (Lange and Croteau, Proc. Natl. Acad. Sci. USA 96:13714-13719, 1999). In the plant cytoplasm, IPP is assembled from three molecules of acetyl coenzyme A by the well-characterized mevalonate pathway (Lange and Croteau, Proc. Natl. Acad. Sci. USA 96:13714-13719, 1999). However, a recently discovered mevalonate-independent pathway is responsible for the synthesis of IPP in plant chloroplasts (Lichtenthaler et al. FEBS Letters 400:271-274, 1997).
[0004] Following the synthesis of IPP via the mevalonate route, the carbon-carbon double bond must be isomerized to create the potent electrophile dimethylally diphosphate (DMAPP). This essential activation step, carried out by IPP isomerase, insures the existence of the two 5-carbon isomers, IPP and DMAPP, which must join together in the first of a series of head to tail condensation reactions to create the essential allylic diphosphates of the isoprenoid pathway (Hahn and Poulter, J. Biol. Chem. 270:11298-11303, 1995). Recently, it was reported that IPP isomerase activity was not essential in E. coli, one of many eubacteria containing only the non-mevalonate pathway for the synthesis of both 5-carbon isomers, suggesting the existence of two separate mevalonate-independent routes to IPP and DMAPP (Hahn et al., J. Bacteriol. 181:4499-4504, 1999). Thus, it is unclear whether an IPP isomerase is essential for the synthesis of isoprenoids in plant plastids as well. Regardless of whether IPP isomerase activity is present in plant plastids, the separation by compartmentalization of the two different biosynthetic routes, the mevalonate and deoxyxylulose phosphate pathways (or "non-mevalonate"), for IPP and DMAPP biosynthesis in plants is the fundamental tenet upon which the subject inventions are based.
[0005] The synthesis of IPP by the mevalonate pathway (Eisenreich et al., Chemistry and Biology 5:R221-R233, 1998) is cytoplasm based and occurs as follows: The condensation of two acetyl CoA molecules to yield acetoacetyl CoA is catalyzed by acetoacetyl CoA thiolase (EC 2.3.1.9). The addition of another molecule of acetyl CoA to acetoacetyl CoA is catalyzed by 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) synthase (EC 4.1.3.5) to yield HMG-CoA, which is reduced in the subsequent step to mevalonate by HMG-CoA reductase (EC 1.1.1.34). Mevalonate is phosphorylated by mevalonate kinase (EC 2.7.1.36) to yield phosphomevalonate, which is phosphorylated, by phosphomevalonate kinase (EC 2.7.4.2) to form mevalonate diphosphate. The conversion of mevalonate diphosphate to IPP with the concomitant release of CO2 is catalyzed by mevalonate diphosphate decarboxylase (EC 4.1.1.33).
[0006] In organisms utilizing the deoxyxylulose phosphate pathway (aka "non-mevalonate pathway", "methylerythritol phosphate (MEP) pathway", and "Rohmer pathway"), the five carbon atoms in the basic isoprenoid unit are derived from pyruvate and D-glyceraldehyde phosphate (GAP) (Eisenreich et al., 1998). Thus, synthesis of IPP and/or DMAPP by the non-mevalonate route, which occurs in plastids, is as follows: Pyruvate and GAP are condensed to give 1-deoxy-D-xylulose 5-phosphate (DXP) by DXP synthase (Sprenger et al., Proc. Natl. Acad. Sci. USA 94:12857-12862, 1997). The rearrangement and reduction of DXP to form 2-C-methylerythritol 4-phosphate (MEP), the first committed intermediate in the non-mevalonate pathway for biosynthesis of isoprenoids is catalyzed by DXP reductoisomerase (Kuzuyama et al., Tetrahedron Lett. 39:4509-4512, 1998). MEP is then appended to CTP to form 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol (Rohdich et al., Proc. Natl. Acad. Sci. USA 96:11758-11763, 1999), followed by phosphorylation of the C2 hydroxyl group (Luttgen et al., Proc. Natl. Acad. Sci. USA 97:1062-1067, 2000) and elimination of CMP, to form a 2,4-cyclic diphosphate (Herz et al., Proc. Natl. Acad. Sci. USA 97:2486-2490, 2000). Interestingly, Herz et al. reported the possible existence of bifunctional proteins with both YgbP and YgbB activities. Once the remaining steps to the fundamental five-carbon isoprenoid building blocks, IPP and DMAPP, in the non-mevalonate pathway are discovered, they will serve as additional targets for inhibitors with antiobiotic and herbicidal activity.
[0007] Since the non-mevalonate pathway is ultimately responsible for the biosynthesis of compounds critical for photosynthesis such as the prenyl side-chain of chlorophylls, which serve as lipophillic anchors for the photoreceptors and the photoprotective carotenoid pigments, any enzyme, gene, or regulatory sequence involved in the biosynthesis of IPP and/or DMAPP can be a potential target for herbicides. For example, the antibiotic fosmidomycin, a specific inhibitor of the enzyme DXP reductoisomerase (Kuzuyama et al., Tetrahedron Lett. 39:7913-7916, 1998) has been shown to have significant herbicidal activity, especially in combination with other herbicides (Kamuro et al. "Herbicide" U.S. Pat. No. 4,846,872; issued Jul. 11, 1989). The report of an Arabidopsis thaliana albino mutant being characterized as a disruption of the CLA1 gene, later revealed as encoding DXP synthase by Rohmer et al. (Lois et al., Proc. Natl. Acad. Sci. USA 95:2105-2110, 1998), also illustrates the potential of non-mevalonate pathway enzymes as targets for compounds with herbicidal activity. Accordingly, one of ordinary skill in the art can readily understand that as additional compounds are discovered exhibiting herbicidal activity based on their effects on the non-mevalonate pathway, those compounds could be used in accord with the teachings herein.
[0008] The synthesis of carotenoids from IPP and DMAPP takes place in plant plastids by a genetically- and enzymatically-defined pathway (Cunningham and Gantt, Ann. Rev. Plant Mol. Biol. 39:475-502, 1998). Enhanced production of carotenoids such as lycopene and β-carotene in plants is highly desirable due to the reported health benefits of their consumption (Kajiwara et al., Biochem. J. 324:421-426, 1997). Enhanced carotenoid production in plants can also have a dramatic effect on their coloration and be highly desirable to the growers of ornamentals, for example. The IPP isomerase reaction is considered to be a rate-limiting step for isoprenoid biosynthesis (Ramos-Valdivia et al., Nat. Prod. Rep. 6:591-603, 1997). Kajiwara et al. reported that the expression of heterologous IPP isomerase genes in a strain of E. coli specifically engineered to produce carotenoids resulted in over a 2-fold increase in β-carotene formation. Recently, it has been reported that expression of an additional gene for DXP synthase in an E. coli strain specifically engineered to produce carotenoids also increased the level of lycopene substantially (Harker and Bramley, FEBS Letters 448:115-119, 1999). Increased isoprenoid production also has been shown in bacteria by combining carotenogenic genes from bacteria with an orf encoding IPP isomerase; and was even further enhanced when additionally combined with the dxs gene from the MEP pathway to supply the precursors IPP and DMAPP (Albrecht et al. Nature Biotechnology 18: 843-846, 2000).
[0009] Accumulation of one specific isoprenoid, such as beta-carotene (yellow-orange) or astaxanthin (red-orange), can serve to enhance flower color or nutriceutical composition depending if the host is cultivated as an ornamental or as an output crop; and if the product accumulates in the tissue of interest (i.e. flower parts or harvestable tissue). In plants, tissue with intrinsic carotenoid enzymes can accumulate ketocarotenoids such as astaxanthin in chromoplasts of reproductive tissues of tobacco by addition of the biosynthetic enzyme beta-carotene ketolase (Mann et al., Nature Biotechnology 18: 888-892, 2000). Astaxanthin is the main carotenoid pigment found in aquatic animals; in microalgae it accumulates in the Chlorophyta such as in species of Haematococcus and Chlamydomonas. Thus, an increase in the essential 5-carbon precursors, IPP and DMAPP, by expression of orfs encoding IPP isomerase and orfs upstream thereof, can feed into the production output of such valuable isoprenoids in organisms other than bacteria.
[0010] As a further example of utility, Petunia flower color is usually due to the presence of modified cyanidin and delphinidin anthocyanin pigments to produce shades in red to blue groupings. Recently produced yellow seed-propagated multiflora and grandiflora petunias obtain their coloration from the presence of beta-carotene, lutein and zeaxanthin carotenoid pigments in combination with colorless flavonols (Nielsen and Bloor, Scienia Hort. 71: 257-266, 1997). Industry still lacks bright yellow and orange clonally propagated trailing petunias. Metabolic engineering of the carotenoid pathway is desired to introduce these colors in this popular potted and bedding plant.
[0011] Plant genetic engineering has evolved since the 1980s from arbitrarily located monocistronic insertions into a nuclear chromosome, often subject to multiple copies, rearrangements and methylation, to predetermined sites for defined multicistronic or multigenic operon insertions into a plastid chromosome (plastome), which thus far is thought impervious to typical nuclear gene inactivation. While breeding of crop plants by nuclear genome engineering is nevertheless a proven technology for major agronomic crops and for traits such as herbicide resistance, introgression of genes into the plastome is a highly promising breeding approach for several reasons as described by Bock and Hagemann (Bock and Hagemann, Prog. Bot. 61:76-90, 2000). Of note is the containment of transgenes in the transplastomic plant: Plastids are inherited through the maternal parent in most plant species and thus plastid-encoded transgenes are unable to spread in pollen to non-target species. Therefore plastid engineering can minimize negative impacts of genetically engineered plants. A report on potential transfer by pollen of herbicide resistance into weedy relatives of cultivated crops (Keeler et al., Herbicide Resistant Crops: Agricultural, Economic, Environmental, Regulatory and Technological Aspects, pp. 303-330, 1996) underscores the value of using plastid engineering rather than nuclear engineering for critical production traits such as herbicide resistance. Daniell et al. have recently demonstrated herbicide resistance through genetic engineering of the chloroplast genome (Daniell et al., Nat. Biotechnol., 16:345-348, 1998).
[0012] Moreover, plastids are the site of essential biosynthetic activity. Although most associate photosynthesis as the primary function of the chloroplast, studies document that the chloroplast is the center of activity for functions involving carbon metabolism, nitrogen metabolism, sulfur metabolism, biochemical regulation, and various essential biosynthetic pathways including amino acid, vitamin, and phytohormone biosynthesis. Crop traits of interest such as nutritional enhancement require genetic manipulations that impact plastid biosynthetic pathways such as carotenoid production. While nuclear-encoded gene products can be exported from the engineered nucleus into the plastid for such manipulations, the biosynthetic genes themselves can be inserted into the plastid for expression and activity. As we begin to pyramid multiple genes often required for pathway manipulations (such as the aforementioned carotenoid biosynthesis) the repeated use of selection markers is expected to lead to unstable crops through homology-dependent gene silencing (Meyer and Saedler, Ann. Rev. Plant. Physiol. Mol. Biol. 47:23-48, 1996). In addition, the requirement for higher expression levels of transgenes for effective phenotypes such as vitamin levels and herbicide and pest resistance levels often falls short in nuclear transformations. These deficiencies are overcome through plastid transformation or combining plastid with nuclear transformations: The plastid recognizes strings of genes linked together in multicistronic operons and, due to the high copy number of genes within a plastid and within plastids in a cell, can produce a hundred- to thousand-fold the amount of transgene product. Accordingly, there is a continuing need for improved methods of producing plants having transformed plastids (transplastomic plants).
[0013] Golden rice is one example for which plastid engineering can complement nuclear engineering of pathways that reside in the plastid, yet have met with limited success. The metabolic pathway for beta-carotene (pro-vitamin A) was assembled in rice plastids by introduction into the nuclear genome of four separate genes, three encoding plastid-targeted proteins using three distinct promoters, plus a fourth selectable marker gene using a repeated promoter (Ye et al. Science 287:303-305, 2000). The wild-type rice endosperm is free of carotenoids but it does produce geranylgeranyl diphosphate; combining phytoene synthase, phytoene desaturase, and lycopene-beta cyclase resulted in accumulation of beta-carotene to make "golden rice." However, the quantity produced was lower than the minimum desired for addressing vitamin A deficiency. An increased supply of precursors for increasing intermediates, such as geranylgeranyl diphosphate, is predicted to significantly increase isoprenoid production. Insertion of an operon encoding the entire mevalonate pathway into the rice plastome of the "golden rice" genotype, using for example the methods as described in Khan and Maliga, Nature Biotechnology 17: 910-914, 1999, can provide a means for making improvements in metabolic engineering of this important monocot crop.
[0014] Proplastid and chloroplast genetic engineering have been shown to varying degrees of homoplasmy for several major agronomic crops including potato, rice, maize, soybean, grape, sweet potato, and tobacco including starting from non-green tissues. Non-lethal selection on antibiotics is used to proliferate cells containing plastids with antibiotic resistance genes. Plastid transformation methods use two plastid-DNA flanking sequences that recombine with plastid sequences to insert chimeric DNA into the spacer regions between functional genes of the plastome, as is established in the field (see Bock and Hagemann, Prog. Bot. 61:76-90, 2000, and Guda et al., Plant Cell Reports 19:257-262, 2000, and references therein).
[0015] Antibiotics such as spectinomycin, streptomycin, and kanamycin can shut down gene expression in chloroplasts by ribosome inactivation. These antibiotics bleach leaves and form white callus when tissue is put onto regeneration medium in their presence. The bacterial genes aadA and neo encode the enzymes aminoglycoside-3N-adenyltransferase and neomycin phosphotransferase, which inactivate these antibiotics, and can be used for positive selection of plastids engineered to express these genes. Polynucleotides of interest can be linked to the selectable genes and thus can be enriched by selection during the sorting out of engineered and non-engineered plastids. Consequently, cells with plastids engineered to contain genes for these enzymes (and linkages thereto) can overcome the effects of inhibitors in the plant cell culture medium and can proliferate, while cells lacking engineered plastids cannot proliferate. Similarly, plastids engineered with polynucleotides encoding enzymes from the mevalonate pathway to produce IPP from acetyl CoA in the presence of inhibitors of the non-mevalonate pathway can overcome otherwise inhibitory culture conditions. By utilizing the polynucleotides disclosed herein in accord with this invention, an inhibitor targeting the non-mevalonate pathway and its components can be used for selection purposes of transplastomic plants produced through currently available methods, or any future methods which become known for production of transplastomic plants, to contain and express said polynucleotides and any linked coding sequences of interest.
[0016] This selection process of the subject invention is unique in that it is the first selectable trait that acts by pathway complementation to overcome inhibitors. This is distinguished from the state of the art of selection by other antibiotics to which resistance is conferred by inactivation of the antibiotic itself, e.g. compound inactivation as for the aminoglyoside 3'-adenyltransferase gene or neo gene. This method avoids the occurrence of resistant escapes due to random insertion of the resistance gene into the nuclear genome or by spontaneous mutation of the ribosomal target of the antibiotic, as is known to occur in the state of the art. Moreover, this method requires the presence of an entire functioning mevalonate pathway in plastids. For example, if one of the enzyme activities of the mevalonate pathway is not present in the plastid, resistance will not be conferred.
[0017] There is strong evidence indicating that the origin of plastids within the cell occurred via endosymbiosis and that plastids are derived from cyanobacteria. As such, the genetic organization of the plastid is prokaryotic in nature (as opposed to the eukaryotic nuclear genome of the plant cell). The plastid chromosome ranges from roughly 110 to 150 Kb in size (196 for the green alga Chlamydomonas), much smaller than that of most cyanobacteria. However, many of the bacterium genes have either been lost because their function was no longer necessary for survival, or were transferred to the chromosomes of the nuclear genome. Most, but not all, of the genes remaining on the plastid chromosome function in either carbon metabolism or plastid genetics. However, many genes involved in these functions, as well as the many other functions and pathways intrinsic to plastid function, are also nuclear encoded, and the translated products are transported from the cytoplasm to the plastid. Studies have documented nuclear encoded genes with known activity in the plastid that are genetically more similar to homologous genes in bacteria rather than genes of the same organism with the same function but activity in the cytoplasm as reviewed for example in Martin et al. (1998) Nature 393:162-165 and references therein.
[0018] The process whereby genes are transported from the plastid to the nucleus has been addressed. Evidence indicates that copies of many plastid genes are found among nuclear chromosomes. For some of these, promoter regions and transit peptides (small stretches of DNA encoding peptides that direct polypeptides to the plastid) become associated with the gene that allows it to be transcribed, and the translated polypeptide relocated back into the plastid. Once this genetic apparatus has become established, the genes present in the plastid chromosome may begin to degrade until they are no longer functional, i.e., any such gene becomes a pseudogene.
[0019] As is common in prokaryotic systems, many genes that have a common function are organized into an operon. An operon is a cluster of contiguous genes transcribed from one promoter to give rise to a polycistron mRNA. Proteins from each gene in the polycistron are then translated. There are 18 operons in the plastid chromosome of tobacco (Nicotiana tabacum). Although many of these involve as few as two genes, some are large and include many genes. Evolutionary studies indicate that gene loss--as pseudogenes or completely missing sequences--occurs as individuals rather than as blocks of genes or transcriptional units. Thus other genes surrounding a pseudogene in a polycistronic operon remain functional.
[0020] The rp123 operon consists of genes whose products are involved in protein translation. Most of these genes are ribosomal proteins functioning in either the large or small ribosomal subunit. One particular gene of note, infA, encodes an initiation factor protein that is important in initiating protein translation. Although this gene is functional in many plants, it is a pseudogene in tobacco and all other members of that family (Solanaceae), including the horticulturally valuable tomato, petunia, and potato crops. A recent survey of plant groups has indicated that there have been numerous loses of functionality of infA (Millen et al., Plant Cell 13: 645-658, 2001). This as well as other pseudogenes are identified in species whose chloroplast genomes have not yet been fully sequenced.
[0021] Pseudogenes such as infA become potential target sequences for insertion of intact orfs. Inserted orfs are controlled by regulatory upstream and downstream elements of the polycistron and are promoterless themselves. Pseudogenes are known for a multiplicity of crops and algae with chloroplast genomes that are already fully sequenced. Crops include grains such as rice and trees such as Pinus. Of note in the latter are the eleven ndh genes; all may serve as potential targets for transgene insertion.
[0022] Transplastomic solanaceous crops are highly desirable in order to eliminate the potential for gene transfer from engineered lines to wild species, as demonstrated in Lycopersicon (Dale, P. J. 1992. Spread of engineered genes to wild relatives. Plant Physiol. 100:13-15.). A method for plastid engineering that enables altered pigmentation, for improved nutrition in tomato or improved flower color in Petunia and ornamental tobacco as examples, is desirable for solanaceous crops. The infA gene is widely lost among rosids and some asterids; among the latter, infA is a pseudogene in all solanaceous species examined (representing 16 genera). The solanaceous infA DNA sequences show high similarity, with all nucleotide changes within infA being documented. Thus one set of flanking sequences of reasonable length as known in the art should serve for directed insertion of an individual or multiple orfs into the infA sites of the solanaceous species. It is documented in a solanaceous species that flanking sequences for genes to be inserted into the plastome are not required to be specific for the target species, as incompletely homologous plastid sequences are integrated at comparable frequencies (Kavanagh et al., Genetics 152:1111-1122, 1999).
[0023] The upstream 5' region, often referred to as the 5' UTR, is important on the expression level of a transcript as it is translated. Knowing the translation products of surrounding genes in a polycistron allows one to select a pseudogene site that is affiliated with a strong 5' UTR for optimizing plastid expression in a particular tissue. The plastid genome in many plant species can have multiple pseudogenes that are located in different polycistronic sites. So, if one has a choice, one can select a site based on whether it is actively transcribed in green vs non-green plastid; and then if the polycistron has high or low relative expression in that plastid type. Moreover, monocistronic mRNA of ndhD was detected in developed leaves but not in greening or expanding leaves of barley (Hordeum vulgare), despite this gene being part of a polycistronic unit as reported by del Campo et al. (1997) Plant Physiol 114:748. Thus, one can time transgene product production by treating an inactive gene, based on developmental expression, as a pseudogene for targetting and integration purposes using the invention disclosed herein.
[0024] Algal species are becoming increasingly exploited as sources of nutraceuticals, pharmaceuticals, and lend themselves to aquaculture. Mass production of the isoprenoid compound astaxanthin produced by the green microalga Haemotcoccus is one successful example of the above. Metabolic engineering that would increase product yields and composition in microalgae would significantly benefit the industry. The development of organellar transformation for the unicellular green alga Chlamydomonas reinhardtii, with its single large chloroplast, opens the door for conducting studies on genetic manipulation of the isoprenoid pathway. Filamentous or multicellular algae are also of interest as untapped bio factories, as are other nongreen algae whose pathways for producing unique fatty acids, amino acids, and pigments can be ameliorated for commercial benefit.
[0025] The biolistic DNA delivery method is a general means with which to transform the chloroplast of algae (Boynton and Gillham, Methods Enzymol. 217:510-536, 1993). Sequencing of at least six plastomes from algae should facilitate transformation systems by confirming insertion sites, including pseudogene sites, and the regulatory elements directing heterologous gene expression. What is required is a dominant marker for selection of stable transformants to which natural resistance is absent (Stevens and Purton, J. Phycol 33: 713-722, 1997). For Chlamydomonas, chloroplasts can be engineered using markers that confer spectinomycin resistance following their integration into the plastome via homologous recombination. By utilizing the polynucleotides disclosed herein in accord with this invention, an inhibitor targeting the non-mevalonate pathway and its components can be used for selection purposes of transplastomic algae produced through currently available methods, or any future methods which become known for production of transplastomic algae, to contain and express said polynucleotides and any linked coding sequences of interest. This is a novel selection vehicle for transplastomic algae. Moreover, elevating the supply of essential precursors for isoprenoid production in algae as described above is enabled by this invention.
SUMMARY OF THE INVENTION
[0026] This invention relates to the presence of enzymatic activities necessary to form IPP from acetyl CoA, generally known as the mevalonate pathway, within plant and microalgae plastids. This invention may also require the presence of IPP isomerase activity within plastids resulting from the insertion into said plants and microalgae of a polynucleotide encoding a polypeptide with IPP isomerase activity. This invention may be achieved by the use of any polynucleotide, be it a DNA molecule or molecules, or any hybrid DNA/RNA molecule or molecules, containing at least one open reading frame that when expressed provides a polypeptide(s) exhibiting said activities within plastids. These open reading frames may be identical to their wild type progenitors, or alternatively may be altered in any manner (for example, with plastid-optimized codon usage), may be isolated from the host organism to be modified, may originate from another organism or organisms, or may be any combination of origin so long as the encoded proteins are able to provide the desired enzymatic activity within the target plastids. The described open reading frames may be inserted directly into plastids using established methodology or any methodology yet to be discovered. Alternatively, plastid localization of the desired activities may be achieved by modifying genes already residing in the cell nucleus, inserting foreign polynucleotides for nuclear residence, or inserting polynucleotides contained on exogenous, autonomous plasmids into the cell cytoplasm so that in all cases their encoded proteins are transported into the plastid. For example, a chloroplast transit (targeting) peptide can be fused to a protein of interest. Any combination of the above methods for realizing said activities in plant and microalgae plastids can be utilized. By causing the complete mevalonate pathway enzymatic activity to occur in plastids normally possessing only the non-mevalonate pathway, the presence of said activities within the chloroplasts of a specific plant or microalgae will endow it with resistance to a compound, molecule, etc. that targets a component of non-mevalonate pathway, be it an enzyme, gene, regulatory sequence, etc., thereby also providing a useful selection system based on circumvention of the inhibition of the non-mevalonate pathway in transplastomic plants and microalgae.
[0027] In addition, this invention relates to the use of open reading frames encoding polypeptides with enzymatic activities able to convert acetyl CoA to IPP, generally known as the mevalonate pathway, and a polypeptide with IPP isomerase activity as a method for increasing the production of IPP, DMAPP, and isoprenoid pathway derived products whose level within plant and microalgae plastids is dependent on the level of IPP and/or DMAPP present within the plastids. The presence of exogenous genes encoding 1-deoxy-D-xylulose-5-phosphate synthase and IPP isomerase have been shown to increase the production of carotenoids in eubacteria, presumably due to an increased production of IPP and/or DMAPP. Thus, insertion of the entire mevalonate pathway, solely or coupled with an additional IPP isomerase, into plastids will increase the level of IPP and/or DMAPP, resulting in an increased level of carotenoids and other yet to be determined isoprenoid pathway derived products within plant and micro algae plastids. This invention can utilize an open reading frame encoding the enzymatic activity for IPP isomerase independently or in addition to said open reading frames comprising the entire mevalonate pathway to obtain the increased level of isoprenoid pathway derived products within plant and microalgae plastids. This invention may be achieved by the use of any DNA molecule or molecules, or any hybrid DNA/RNA molecule or molecules, containing open reading frames able to provide said activities within plant and microalgae plastids. These open reading frames may be identical to their wild type progenitors, may be altered in any manner, may be isolated from the plant to be modified, may originate from another organism or organisms, or may be any combination of origin so long as the encoded proteins are able to provide said activities within plastids. The described open reading frames may be inserted directly into plant and microalgae plastids using established methodology or any methodology yet to be discovered. Alternatively, plastid localization of the desired activities may be achieved by modifying genes already residing in the nucleus, inserting foreign genes for nuclear residence, or inserting genes contained on exogenous, autonomous plasmids into the cytoplasm so that in all cases their encoded proteins are transported into the plastid. Any combination of the above methods for realizing said activities in plastids can be utilized.
[0028] Further, this invention also relates to the direct insertion of any foreign gene into a plant or microalgae chloroplast by coupling it to the open reading frames encoding polypeptides with enzymatic activities able to convert acetyl CoA to IPP, thus comprising the entire mevalonate pathway. By utilizing a compound, molecule, etc. that targets a component of the non-mevalonate pathway be it an enzyme, gene, regulatory sequence, etc., a method of selection analogous to the use of kanamycin and spectinomycin resistance for the transformation event is achieved. As inhibition of the non-mevalonate pathway in a plant or microalgae results in the impairment of photosynthesis, the presence of the mevalonate pathway biosynthetic capability is apparent, thus enabling the facile screening of concomitant incorporation into plastids of a foreign gene coupled to the open reading frames comprising the entire mevalonate pathway. The use of a polynucleotide comprising an open reading frame encoding a polypeptide with IPP isomerase activity in addition to the open reading frames encoding the mevalonate pathway is a particularly preferred embodiment, which provides all enzymatic activities necessary to synthesize both IPP and DMAPP and overcome the effect(s) of inhibition of the non-mevalonate pathway.
[0029] Further, this invention is unique and novel in that the transforming DNA, that is integrated by two or more homologous/heterologous recombination events, is purposefully targeted into inactive gene sites selected based on prior knowledge of transcription in plastid type, developmental expression including post-transcriptional editing, and post-transcriptional stability. Additionally, this invention uses the regulatory elements of known inactive genes (pseudogenes) to drive production of a complete transforming gene unrelated to the inserted gene site. Thus, by utilizing the transgene insertion method disclosed herein in accord with this invention, any foreign gene can be targeted to an inactive gene site (the pseudogene) through currently available methods of gene transfer, or any future methods which become known for production of transgenic and transplastomic plants, to contain and express said foreign gene and any linked coding sequences of interest. This gene insertion process of the subject invention is unique in that it is the first method specifically acting by pseudogene insertion to overcome the need for promoters and other regulatory elements normally associated with a transforming DNA vector while permitting site-specific recombination in organellar genomes. The use of the infA pseudogene insertion site in the solanaceous crops in particular is a preferred embodiment for the transformation of plastids using the open reading frames for the mevalonate pathway as well as for providing the necessary precursors for modified output traits in plants.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] FIG. 1 is a map of cloning vector pFCO1 containing S. cerevisiae orfs encoding phosphomevalonate kinase (PMK), mevalonate kinase (MVK), and mevalonate diphosphate decarboxylase (MDD).
[0031] FIG. 2 is a map of expression vector pFCO2 containing S. cerevisiae orfs encoding phosphomevalonate kinase (PMK), mevalonate kinase (MVK), and mevalonate diphosphate decarboxylase (MDD).
[0032] FIG. 3 is a map of cloning vector pHKO1 containing S. cerevisiae orf encoding acetoacetyl thiolase (AACT); A. thaliana orfs encoding HMG-CoA synthase (HMGS), HMG-CoA reductase (HMGRt).
[0033] FIG. 4 is a map of expression vector pHKO2 containing S. cerevisiae orfs encoding phosphomevalonate kinase (PMK), mevalonate kinase (MVK), mevalonate diphosphate decarboxylase (MDD), and acetoacetyl thiolase (AACT); A. thaliana orfs encoding HMG-CoA synthase (HMGS), HMG-CoA reductase (HMGRt) which in their summation are designated Operon A, encoding the entire mevalonate pathway.
[0034] FIG. 5 is a map of cloning vector pHKO3 containing S. cerevisiae orfs encoding phosphomevalonate kinase (PMK), mevalonate kinase (MVK), mevalonate diphosphate decarboxylase (MDD), and acetoacetyl thiolase (AACT); A. thaliana offs encoding HMG-CoA synthase (HMGS), HMG-CoA reductase (HMGRt) which in their summation are designated Operon B, encoding the entire mevalonate pathway.
[0035] FIG. 6 is an illustration of how the mevalonate (MEV) pathway, by providing an alternative biosynthetic route to IPP, circumvents blocks in the MEP pathway due to a mutation in the gene for deoxyxylulose phosphate synthase (dxs) and due to inhibtion by fosmidomycin of deoxyxylulose phosphate reductoisomerase (dxr).
[0036] FIG. 7 is a map of vector pBSNT27 containing N. tabcum chloroplast DNA (cpDNA) and the N. tabcum infA pseudogene and pBSNT27 sequence (SEQ ID NO: 17)
[0037] FIG. 8 is a map of plastid transformation vector pHKO4 containing N. tabcum chloroplast DNA (cpDNA) flanking the insertion of Operon B into the infA pseudogene.
[0038] FIG. 9 is a map of cloning vector pHKO5 containing S. cerevisiae orfs encoding phosphomevalonate kinase (PMK), mevalonate kinase (MVK), and mevalonate diphosphate decarboxylase (MDD), and acetoacetyl thiolase (AACT); A. thaliana orfs encoding HMG-CoA synthase (HMGS), HMG-CoAreductase (HMGRt); R. capsulatus orf encoding IPP isomerase (IPPI) which in their summation are designated Operon C, encoding the entire mevalonate pathway and IPP isomerase.
[0039] FIG. 10 is a map of cloning vector pFHO1 containing S. cerevisiae orf encoding acetoacetyl thiolase (AACT); A. thaliana orf encoding HMG-CoA synthase (HMGS); Streptomyces sp CL190 off encoding HMG-CoA reductase (HMGR).
[0040] FIG. 11 is a map of cloning vector pFHO2 containing S. cerevisiae orfs encoding phosphomevalonate kinase (PMK), mevalonate kinase (MVK), and mevalonate diphosphate decarboxylase (MDD), and acetoacetyl thiolase (AACT); A. thaliana off encoding HMG-CoA synthase (HMGS); Streptomyces sp CL190 orf encoding HMG-CoA reductase (HMGR) which in their summation are designated Operon D, encoding the entire mevalonate pathway.
[0041] FIG. 12 is a map of cloning vector pFHO3 containing S. cerevisiae orfs encoding phosphomevalonate kinase (PMK), mevalonate kinase (MVK), and mevalonate diphosphate decarboxylase (MDD), and acetoacetyl thiolase (AACT); A. thaliana orf encoding HMG-CoA synthase (HMGS); Streptomyces sp CL190 orf encoding HMG-CoA reductase (HMGR); R. capsulatus orf encoding IPP isomerase (IPPI) which in their summation are designated Operon E, encoding the entire mevalonate pathway and IPP isomerase.
[0042] FIG. 13 is a map of cloning vector pFHO4 containing a S. cerevisiae orf encoding acetoacetyl thiolase (AACT) coupled to the Streptomyces sp CL190 gene cluster which in their summation are designated Operon F, encoding the entire mevalonate pathway and IPP isomerase.
[0043] FIG. 14 is a plastid transformation vector pHKO7 containing N. tabacum chloroplast DNA (cpDNA) flanking the insertion of Operon C into the infA pseudogene.
[0044] FIG. 15 is a map of expression vector pHKO9 containing Operon B.
[0045] FIG. 16 is a map of expression vector pHK10 containing Operon C.
[0046] FIG. 17 is a map of plastid transformation vector pFHO6 containing N. tabacum chloroplast DNA (cpDNA) flanking the insertion of both Operon E and the R. capsulatus orf encoding phytoene synthase (PHS) into the infA pseudogene.
BRIEF DESCRIPTION OF THE SEQUENCES
[0047] SEQ ID NO: 1) is a PCR primer containing Saccharomyces cerevisiae DNA.
[0048] SEQ ID NO: 2) is a PCR primer containing S. cerevisiae DNA.
[0049] SEQ ID NO: 3) is a PCR primer containing S. cerevisiae DNA.
[0050] SEQ ID NO: 4) is a PCR primer containing S. cerevisiae DNA.
[0051] SEQ ID NO: 5) is a PCR primer containing S. cerevisiae DNA.
[0052] SEQ ID NO: 6) is a PCR primer containing S. cerevisiae DNA.
[0053] SEQ ID NO: 7) is a PCR primer containing Arabidopsis thaliana DNA.
[0054] SEQ ID NO: 8) is a PCR primer containing A. thaliana DNA.
[0055] SEQ ID NO: 9) is a PCR primer containing A. thaliana DNA.
[0056] SEQ ID NO: 10) is a PCR primer containing A. thaliana DNA.
[0057] SEQ ID NO: 11) is a PCR primer containing S. cerevisiae DNA.
[0058] SEQ ID NO: 12) is a PCR primer containing S. cerevisiae DNA.
[0059] SEQ ID NO: 13) is an Oligonucleotide containing S. cerevisiae DNA.
[0060] SEQ ID NO: 14) is an Oligonucleotide containing A. thaliana and S. cerevisiae DNA.
[0061] SEQ ID NO: 15) is an Oligonucleotide containing S. cerevisiae DNA.
[0062] SEQ ID NO: 16) is an Oligonucleotide containing S. cerevisiae DNA.
[0063] SEQ ID NO: 17) is a Vector pBSNT27 containing Nicotiana tabacum DNA.
[0064] SEQ ID NO: 18) is an Oligonucleotide containing N. tabacum and S. cerevisiae DNA.
[0065] SEQ ID NO: 19) is an Oligonucleotide containing N. tabacum and A. thaliana DNA.
[0066] SEQ ID NO: 20) is a PCR primer containing Rhodobacter capsulatus DNA.
[0067] SEQ ID NO: 21) is a PCR is a primer containing R. capsulatus DNA.
[0068] SEQ ID NO: 22) is a PCR primer containing Schizosaccharomyces pombe DNA.
[0069] SEQ ID NO: 23) is a PCR primer containing S. pombe DNA.
[0070] SEQ ID NO: 24) is a PCR primer containing Streptomyces sp CL190 DNA.
[0071] SEQ ID NO: 25) is a PCR primer containing Streptomyces sp CL190 DNA.
[0072] SEQ ID NO: 26) is an Oligonucleotide containing S. cerevisiae DNA.
[0073] SEQ ID NO: 27) is an Oligonucleotide containing S. cerevisiae DNA.
[0074] SEQ ID NO: 28) is an Oligonucleotide containing Streptomyces sp CL190 and R. capsulatus DNA.
[0075] SEQ ID NO: 29) is an Oligonucleotide containing R. capsulatus DNA.
[0076] SEQ ID NO: 30) is an Oligonucleotide containing Streptomyces sp CL190 and S. cerevisiae DNA.
[0077] SEQ ID NO: 31) is an Oligonucleotide containing Streptomyces sp CL190 DNA.
[0078] SEQ ID NO: 32) is an Oligonucleotide containing N. tabacum and S. cerevisiae DNA.
[0079] SEQ ID NO: 33) is an Oligonucleotide containing N. tabacum and R. capsulatus DNA.
[0080] SEQ ID NO: 34) is an Oligonucleotide containing N. tabacum and S. cerevisiae DNA.
[0081] SEQ ID NO: 35) is an Oligonucleotide containing N. tabacum and S. pombe DNA.
[0082] SEQ ID NO: 36) is an Oligonucleotide containing NotI restriction site.
[0083] SEQ ID NO: 37) is an Oligonucleotide containing NotI restriction site.
[0084] SEQ ID NO: 38) is an Oligonucleotide containing S. cerevisiae DNA.
[0085] SEQ ID NO: 39) is an Oligonucleotide containing A. thaliana DNA.
[0086] SEQ ID NO: 40) is an Oligonucleotide containing S. cerevisiae DNA.
[0087] SEQ ID NO: 41) is an Oligonucleotide containing R. capsulatus DNA.
[0088] SEQ ID NO: 42) is an Oligonucleotide containing S. cerevisiae DNA.
[0089] SEQ ID NO: 43) is an Oligonucleotide containing S. pombe DNA.
[0090] SEQ ID NO: 44) is an Oligonucleotide containing R. capsulatus DNA.
[0091] SEQ ID NO: 45) is an Oligonucleotide containing R. capsulatus DNA.
[0092] SEQ ID NO: 46) is an Oligonucleotide containing S. pombe DNA.
[0093] SEQ ID NO: 47) is an Oligonucleotide containing S. pombe DNA.
[0094] SEQ ID NO: 48) is Saccharomyces cerevisiae orf for phosphomevalonate kinase (ERGS).
[0095] SEQ ID NO: 49) Saccharomyces cerevisiae orf for mevalonate kinase (ERG12).
[0096] SEQ ID NO: 50) Saccharomyces cerevisiae orf for mevalonate diphosphate decarboxylase (ERG19).
[0097] SEQ ID NO: 51) Saccharomyces cerevisiae orf for acetoacetyl thiolase.
[0098] SEQ ID NO: 52) Arabidopsis thaliana orf for 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) synthase.
[0099] SEQ ID NO: 53) Arabidopsis thaliana orf for HMG-CoA reductase.
[0100] SEQ ID NO: 54) Schizosaccharomyces pombe IDI1 (IPP isomerase).
[0101] SEQ ID NO: 55) Rhodobacter capsulatus idiB (IPP isomerase).
[0102] SEQ ID NO: 56) Streptomyces sp CL190 orf encoding HMG-CoA reductase.
[0103] SEQ ID NO: 57) Streptomyces sp CL190 gene cluster containing mevalonate pathway and
[0104] IPP isomerase orfs.
[0105] SEQ ID NO: 58) is Operon A containing A. thaliana and S. cerevisiae DNA SEQ ID NO: 59) is Operon B containing A. thaliana and S. cerevisiae DNA.
[0106] SEQ ID NO: 60) is Operon C containing A. thaliana, S. cerevisiae, and R. capsulatus DNA.
[0107] SEQ ID NO: 61) is Operon D containing A. thaliana, S. cerevisiae, and Streptomycs sp CL190 DNA.
[0108] SEQ ID NO: 62) is Operon E containing A. thaliana, S. cerevisiae, Streptomycs sp CL190 DNA, and R. capsulatus DNA.
[0109] SEQ ID NO: 63) is Operon F containing containing S. cerevisiae and Streptomycs sp CL190 DNA.
[0110] SEQ ID NO: 64) is Operon G containing A. thaliana, S. cerevisiae and S. pombe DNA.
[0111] SEQ ID NO: 65) is PCR primer containing R. capsulatus DNA.
[0112] SEQ ID NO: 66) is PCR primer containing R. capsulatus DNA.
[0113] SEQ ID NO: 67) is an Oligonucleotide containing N. tabacum and R. capsulatus DNA.
[0114] SEQ ID NO: 68) is an Oligonucleotide containing N. tabacum and R. capsulatus DNA.
[0115] SEQ ID NO: 69) is an Oligonucleotide containing N. tabacum and S. cerevisiae DNA.
[0116] SEQ ID NO: 70) is an Oligonucleotide containing N. tabacum and R. capsulatus DNA.
[0117] SEQ ID NO: 71) is Rhodobacter capsulatus orf encoding phytoene synthase (crtB).
[0118] SEQ ID NO: 72) is plastid transformation vector pHKO4, containing Operon B, containing A. thaliana and S. cerevisiae DNA.
[0119] SEQ ID NO: 73) is plastid transformation vector pHKO7, containing Operon C, containing A. thaliana, S. cerevisiae, and R. capsulatus DNA.
[0120] SEQ ID NO: 74) is plastid transformation vector pHKO8, containing Operon containing A. thaliana, S. cerevisiae, and S. pombe DNA.
[0121] SEQ ID NO: 75) is plastid transformation vector pFHO5 containing R. capsulatus DNA encoding phytoene synthase.
[0122] SEQ ID NO: 76) is plastid transformation vector pFHO6, containing Operon E, containing A. thaliana, S. cerevisiae, Streptomycs sp CL190 DNA, and R. capsulatus DNA.
DETAILED DESCRIPTION
[0123] In the description that follows, a number of terms used in genetic engineering are utilized. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided.
[0124] A protein is considered an isolated protein if it is a protein isolated from a host cell in which it is naturally produced. It can be purified or it can simply be free of other proteins and biological materials with which it is associated in nature, for example, if it is recombinantly produced.
[0125] An isolated nucleic acid is a nucleic acid the structure of which is not identical to that of any naturally occurring nucleic acid or to that of any fragment of a naturally occurring genomic nucleic acid spanning more than three separate genes. The term therefore covers, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule, but is not flanked by both of the coding or noncoding sequences that flank that part of the molecule in the genome of the organism in which it naturally occurs; (b) a nucleic acid incorporated into a vector or into the genomic or plastomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic or plastomic DNA; (c) a separate molecule such as a cDNA, a genomic or plastomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein. Specifically excluded from this definition are nucleic acids present in mixtures of (i) DNA molecules, (ii) transfected cells, and (iii) cell clones, e.g., as these occur in a DNA library such as a cDNA or genomic DNA library.
[0126] One DNA portion or sequence is downstream of second DNA portion or sequence when it is located 3' of the second sequence. One DNA portion or sequence is upstream of a second DNA portion or sequence when it is located 5' of that sequence.
[0127] One DNA molecule or sequence and another are heterologous to one another if the two are not derived from the same ultimate natural source, or are not naturally contiguous to each other. The sequences may be natural sequences, or at least one sequence can be derived from two different species or one sequence can be produced by chemical synthesis provided that the nucleotide sequence of the synthesized portion was not derived from the same organism as the other sequence.
[0128] A polynucleotide is said to encode a polypeptide if, in its native state or when manipulated by methods known to those skilled in the art, it can be transcribed and/or translated to produce the polypeptide or a fragment thereof. The anti-sense strand of such a polynucleotide is also said to encode the sequence.
[0129] A nucleotide sequence is operably linked when it is placed into a functional relationship with another nucleotide sequence. For instance, a promoter is operably linked to a coding sequence if the promoter effects its transcription or expression. Generally, operably linked means that the sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame. However, it is well known that certain genetic elements, such as enhancers, may be operably linked even at a distance, i.e., even if not contiguous.
[0130] In a plastome, sequences are physically linked by virtue of the chromosome configuration, but they are not necessarily operably linked due to differential expression for example. Transgenes can be physically linked prior to transformation, or can become physically linked once they insert into a plastome. Transgenes can become operably linked if they share regulatory sequences upon insertion into a plastome.
[0131] The term recombinant polynucleotide refers to a polynucleotide which is made by the combination of two otherwise separated segments of sequence accomplished by the artificial manipulation of isolated segments of polynucleotides by genetic engineering techniques or by chemical synthesis. In so doing one may join together polynucleotide segments of desired functions to generate a desired combination of functions.
[0132] The polynucleotides may also be produced by chemical synthesis, e.g., by the phosphoramidite method described by Beaucage and Caruthers (1981) Tetra. Letts., 22:1859-1862 or the triester method according to Matteuci et al. (1981) J. Am. Chem. Soc., 103: 3185, and may be performed on commercial automated oligonucleotide synthesizers. A double-stranded fragment may be obtained from the single stranded product of chemical synthesis either by synthesizing the complementary strand and annealing the strands together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.
[0133] Polynucleotide constructs prepared for introduction into a prokaryotic or eukaryotic host will typically, but not always, comprise a replication system (i.e. vector) recognized by the host, including the intended polynucleotide fragment encoding the desired polypeptide, and will preferably, but not necessarily, also include transcription and translational initiation regulatory sequences operably linked to the polypeptide-encoding segment. Expression systems (expression vectors) may include, for example, an origin of replication or autonomously replicating sequence (ARS) and expression control sequences, a promoter, an enhancer and necessary processing information sites, such as ribosome-binding sites, RNA splice sites, polyadenylation sites, transcriptional terminator sequences, and mRNA stabilizing sequences. Signal peptides may also be included where appropriate, preferably from secreted polypeptides of the same or related species, which allow the protein to cross and/or lodge in cell membranes or be secreted from the cell.
[0134] Variants or sequences having substantial identity or homology with the polynucleotides encoding enzymes of the mevalonate pathway may be utilized in the practice of the invention. Such sequences can be referred to as variants or modified sequences. That is, a polynucleotide sequence may be modified yet still retain the ability to encode a polypeptide exhibiting the desired activity. Such variants or modified sequences are thus equivalents. Generally, the variant or modified sequence will comprise at least about 40%-60%, preferably about 60%-80%, more preferably about 80%-90%, and even more preferably about 90%-95% sequence identity with the native sequence.
[0135] Sequence relationships between two or more nucleic acids or polynucleotides are generally defined as sequence identity, percentage of sequence identity, and substantial identity. In determining sequence identity, a "reference sequence" is used as a basis for sequence comparison. The reference may be a subset or the entirety of a specified sequence. That is, the reference sequence may be a full-length gene sequence or a segment of the gene sequence.
[0136] Methods for alignment of sequences for comparison are well known in the art. See, for example, Smith et al. (1981) Adv. Appl. Math. 2:482; Needleman et al. (1970) J. Mol. Biol. 48:443; Pearson et al. (1988) Proc. Natl. Acad. Sci. 85:2444; CLUSTAL in the PC/Gene Program by Intelligenetics, Mountain View, Calif.; GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Drive, Madison, Wis., USA. Preferred computer alignment methods also include the BLASTP, BLASTN, and BLASTX algorithms. See, Altschul et al. (1990) J. Mol. Biol. 215:403-410.
[0137] "Sequence identity" or "identity" in the context of nucleic acid or polypeptide sequences refers to the nucleic acid bases or residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. "Percentage of sequence identity" refers to the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions as compared to the reference window for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
[0138] Polynucleotide sequences having "substantial identity" are those sequences having at least about 50%-60% sequence identity, generally at least 70% sequence identity, preferably at least 80%, more preferably at least 90%, and most preferably at least 95%, compared to a reference sequence using one of the alignment programs described above. Preferably sequence identity is determined using the default parameters determined by the program. Substantial identity of amino acid sequence generally means sequence identity of at least 50%, more preferably at least 70%, 80%, 90%, and most preferably at least 95%.
[0139] Nucleotide sequences are generally substantially identical if the two molecules hybridize to each other under stringent conditions. Generally, stringent conditions are selected to be about 5EC lower than the thermal melting point for the specific sequence at a defined ionic strength and pH. Nucleic acid molecules that do not hybridize to each other under stringent conditions may still be substantially identical if the polypeptides they encode are substantially identical. This may occur, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
[0140] As noted, hybridization of sequences may be carried out under stringent conditions. By "stringent conditions" is intended conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30EC for short probes (e.g., 10 to 50 nucleotides) and at least about 60EC for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary stringent conditions include hybridization with a buffer solution of 30 to 35% formamide, 1.0 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37EC, and a wash in 1× to 2×SSC (20×SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55EC. It is recognized that the temperature, salt, and wash conditions may be altered to increase or decrease stringency conditions. For the post-hybridization washes, the critical factors are the ionic strength and temperature of the final wash solution. See, Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284.
[0141] As indicated, fragments and variants of the nucleotide sequences of the invention are encompassed herein. By "fragment" is intended a portion of the nucleotide sequence. Fragments of the polynucleotide sequence will generally encode polypeptides which retain the biological/enzymatic activity of the native protein. Those of skill in the art routinely generate fragments of polynucleotides of interest through use of commercially available restriction enzymes; synthetic construction of desired polynucleotides based on known sequences; or use of "erase-a-base" technologies such as Bal 31 exonuclease, by which the skilled artisan can generate hundreds of fragments of a known polynucleotide sequence from along the entire length of the molecule by time-controlled, limited digestion. Fragments that retain at least one biological or enzymatic activity of the native protein are equivalents of the native protein for that activity.
[0142] By "variants" is intended substantially similar sequences. For example, for nucleotide sequences, conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of an enzyme of the mevalonate pathway. Variant nucleotide sequences include synthetically derived sequences, such as those generated for example, using site-directed mutagenesis. Generally, nucleotide sequence variants of the invention will have at least 40%, 50%, 60%, 70%, generally 80%, preferably 85%, 90%, up to 95% sequence identity to its respective native nucleotide sequence. Activity of polypeptides encoded by fragments or variants of polynucleotides can be confirmed by assays disclosed herein.
[0143] "Variant" in the context of proteins is intended to mean a protein derived from the native protein by deletion or addition of one or more amino acids to the N-terminal and/or C-terminal end of the native protein; deletion or addition of one or more amino acids at one or more sites in the native protein; or substitution of one or more amino acids at one or more sites in the native protein. Such variants may result from, for example, genetic polymorphism or human manipulation. Conservative amino acid substitutions will generally result in variants that retain biological function. Such variants are equivalents of the native protein. Variant proteins that retain a desired biological activity are encompassed within the subject invention. Variant proteins of the invention may include those that are altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulation are generally known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al. (1987) Methods and Enzymol;. 154:367-382; and the references cited therein.
[0144] An expression cassette may contain at least one polynucleotide of interest to be cotransformed into the organism. Such an expression cassette is preferably provided with a plurality of restriction sites for insertion of the sequences of the invention to be under the transcriptional regulation of the regulatory regions. The expression cassette may additionally contain selectable marker genes.
[0145] The cassette may include 5' and 3' regulatory sequences operably linked to a polynucleotide of interest. By "operably linked" is intended, for example, a functional linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame. When a polynucleotide comprises a plurality of coding regions that are operably linked such that they are under the control of a single promoter, the polynucleotide may be referred to as an "operon".
[0146] The expression cassette will optionally include in the 5'-3' direction of transcription, a transcriptional and translational initiation region, a polynucleotide sequence of interest and a transcriptional and translational termination region functional in plants or microalgae. The transcriptional initiation region, the promoter, is optional, but may be native or analogous, or foreign or heterologous, to the intended host. Additionally, the promoter may be the natural sequence or alternatively a synthetic sequence. By "foreign" is intended that the transcriptional initiation region is not found in the native organism into which the transcriptional initiation region is introduced. As used herein, a chimeric gene comprises a coding sequence operably linked to a transcriptional initiation region that is heterologous to the coding sequence.
[0147] The termination region may be native with the transcriptional initiation region, may be native with the operably linked DNA sequence of interest, or may be derived from another source. Convenient termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also Guerineau et al. (1991) Mol. Gen. Genet. 262:141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev. 5:141-149; Mogen et al. (1990) Plant Cell 2:1261-1272; Munroe et al. (1990) Gene 91:151-158; Ballas et al. (1989) Nucleic Acids Res. 17:7891-7903; and Joshi et al. (1987) Nucleic Acid Res. 15:9627-9639.
[0148] Where appropriate, the polynucleotides of interest may be optimized for expression in the transformed organism. That is, the genes can be synthesized using plant or algae plastid-preferred codons corresponding to the plastids of the plant or algae of interest. Methods are available in the art for synthesizing such codon optimized polynucleotides. See, for example, U.S. Pat. Nos. 5,380,831 and 5,436,391, and Murray et al. (1989) Nucleic Acids Res. 17:477-498, herein incorporated by reference. Of course, the skilled artisan will appreciate that for the transplastomic purposes described herein, sequence optimization should be conducted with plastid codon usage frequency in mind, rather than the plant or algae genome codon usage exemplified in these references.
[0149] It is now well known in the art that when synthesizing a polynucleotide of interest for improved expression in a host cell it is desirable to design the gene such that its frequency of codon usage approaches the frequency of codon usage of the host cell. It is also well known that plastome codon usage may vary from that of the host plant or microalgae genome. For purposes of the subject invention, "frequency of preferred codon usage" refers to the preference exhibited by a specific host cell plastid in usage of nucleotide codons to specify a given amino acid. To determine the frequency of usage of a particular codon in a gene, the number of occurrences of that codon in the gene is divided by the total number of occurrences of all codons specifying the same amino acid in the gene. Similarly, the frequency of preferred codon usage exhibited by a plastid can be calculated by averaging frequency of preferred codon usage in a number of genes expressed by the plastid. It usually is preferable that this analysis be limited to genes that are among those more highly expressed by the plastid. Alternatively, the polynucleotide of interest may be synthesized to have a greater number of the host plastid's most preferred codon for each amino acid, or to reduce the number of codons that are rarely used by the host.
[0150] The expression cassettes may additionally contain 5' leader sequences in the expression cassette construct. Such leader sequences can act to enhance translation. Translation leaders are known in the art and include: picornavirus leaders, for example, EMCV leader (Encephalomyocarditis 5' noncoding region), Elroy-Stein et al. (1989) PNAS USA 86:6126-6130; potyvirus leaders, for example, TEV leader (Tobacco Etch Virus), Allison et al. (1986); MDMV Leader (Maize Dwarf Mosaic Virus) Virology 154:9-20; and human immunoglobulin heavy-chain binding protein (BiP), Macejak et al. (1991) Nature 353:90-94; untranslated leader from the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4), Jobling et al. (1987) Nature 325:622-625; tobacco mosaic virus leader (TMV), Gallie et al. (1989) in Molecular Biology of RNA, ed. Cech (Liss, New York), pp. 237-256; and maize chlorotic mottle virus leader (MCMV), Lommel et al. (1991) Virology 81:382-385. See also, Della-Cioppa et al. (1987) Plant Physiol. 84:965-968. Other methods known to enhance translation can also be utilized, for example, introns, and the like.
[0151] In preparing an expression cassette, the various polynucleotide fragments may be manipulated, so as to provide for the polynucleotide sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the polynucleotide fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous nucleotides, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, may be involved.
[0152] In addition, expressed gene products may be localized to specific organelles in the target cell by ligating DNA or RNA coded for peptide leader sequences to the polynucleotide of interest. Such leader sequences can be obtained from several genes of either plant or other sources. These genes encode cytoplasmically-synthesized proteins directed to, for example, mitochondria (the F1-ATPase beta subunit from yeast or tobacco, cytochrome c1 from yeast), chloroplasts (cytochrome oxidase subunit Va from yeast, small subunit of rubisco from pea), endoplasmic reticulum lumen (protein disulfide isomerase), vacuole (carboxypeptidase Y and proteinase A from yeast, phytohemagglutinin from French bean), peroxisomes (D-aminoacid oxidase, uricase) and lysosomes (hydrolases).
[0153] Following transformation, a plant may be regenerated, e.g., from single cells, callus tissue, or leaf discs, as is standard in the art. Almost any plant can be entirely regenerated from cells, tissues, and organs of the plant. Available techniques are reviewed in Vasil et al. (1984) in Cell Culture and Somatic Cell Genetics of Plants, Vols. I, II, and III, Laboratory Procedures and Their Applications (Academic press); and Weissbach et al. (1989) Methods for Plant Mol. Biol.
[0154] The transformed plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting hybrid having expression of the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited, and then seeds harvested to ensure expression of the desired phenotypic characteristic has been achieved.
[0155] The particular choice of a transformation technology will be determined by its efficiency to transform certain target species, as well as the experience and preference of the person practicing the invention with a particular methodology of choice. It will be apparent to the skilled person that the particular choice of a transformation system to introduce nucleic acid into plant or microalgae plastids is not essential to or a limitation of the invention, nor is the choice of technique for plant regeneration.
[0156] Also according to the invention, there is provided a plant or microalgae cell having the constructs of the invention. A further aspect of the present invention provides a method of making such a plant cell involving introduction of a vector including the construct into a plant cell. For integration of the construct into the plastid genome (the plastome), such introduction will be followed by recombination between the vector and the plastome genome to introduce the operon sequence of nucleotides into the plastome. RNA encoded by the introduced nucleic acid construct (operon) may then be transcribed in the cell and descendants thereof, including cells in plants regenerated from transformed material. A gene stably incorporated into the plastome of a plant or micro algae is passed from generation to generation to descendants of the plant or microalgae, so such descendants should show the desired phenotype.
[0157] The present invention also provides a plant or microalgae culture comprising a plant cell as disclosed. Transformed seeds and plant parts are also encompassed. As used herein, the expressions "cell," "cell line," and "cell culture" are used interchangeably and all such designations include progeny, meaning descendants, not limited to the immediate generation of descendants but including all generations of descendants. Thus, the words "transformants" and "transformed cells" include the primary subject cell and cultures derived therefrom without regard for the number of transfers. It is also understood that all progeny may not be precisely identical in DNA content, due to naturally occurring, deliberate, or inadvertent caused mutations. Mutant progeny that have the same function or biological activity as screened for in the originally transformed cell are included. Where distinct designations are intended, it will be clear from the context.
[0158] In addition to a plant or microalgae, the present invention provides any clone of such a plant or micro algae, seed, selfed or hybrid or mated descendants, and any part of any of these, such as cuttings or seed for plants. The invention provides any plant propagule, that is any part which may be used in reproduction or propagation, sexual or asexual, including cuttings, seed, and so on. Also encompassed by the invention is a plant or microalgae which is a sexually or asexually propagated off-spring, clone, or descendant of such a plant or microalgae, or any part or propagule of said plant, off-spring, clone, or descendant. Plant or microalgae extracts and derivatives are also provided.
[0159] The present invention may be used for transformation of any plant species, including, but not limited to, corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annuus), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Ipomoea batatus), cassaya (Manihot esculenta), coffee (Cofea ssp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidental), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), oats, barley, vegetables, ornamentals, and conifers.
[0160] Preferably, plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassaya, barley, pea, and other root, tuber, or seed crops. Important seed crops are oil-seed rape, sugar beet, maize, sunflower, soybean, and sorghum. Horticultural plants to which the present invention may be applied may include lettuce; endive; and vegetable brassicas including cabbage, broccoli, and cauliflower; and carnations and geraniums. The present invention may be applied to tobacco, cucurbits, carrot, strawberry, sunflower, tomato, pepper, chrysanthemum, petunia, rose, poplar, eucalyptus, and pine.
[0161] Grain plants that provide seeds of interest include oil-seed plants and leguminous plants. Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc. Oil seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants include beans and peas. Beans including guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, etc.
[0162] Microalgae include but are not limited to the Chlorophyta and the Rhodophyta and may be such organisms as Chlamydomonas, Haematococcus, and Ouneliella.
[0163] Other features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. Unless indicated otherwise, the respective contents of the documents cited herein are hereby incorporated by reference to the extent they are not inconsistent with the teachings of this specification.
[0164] Percentages and ratios given herein are by weight, and temperatures are in degrees Celsius unless otherwise indicated. The references cited within this application are herein incorporated by reference to the extent applicable. Where necessary to better exemplify the invention, percentages and ratios may be cross-combined.
Example 1
Isolation of Orfs Encoding Enzymes of the Mevalonate Pathway for the Construction of Vectors pFCO1 and pFCO2
[0165] In an exemplified embodiment, vectors containing open reading frames (orfs) encoding enzymes of the mevalonate pathway are constructed. Polynucleotides derived from the yeast Saccharomyces cerevisiae, the plant Arabidopsis thaliana, and the eubacterium Streptomyces sp CL190 are used for the construction of vectors, including plastid delivery vehicles, containing orfs for biosynthesis of the mevalonate pathway enzymes. Construction of the vectors is not limited to the methods described. It is routine for one skilled in the art to choose alternative restriction sites, PCR primers, etc. to create analogous plasmids containing the same orfs or other orfs encoding the enzymes of the mevalonate pathway. Many of the steps in the construction of the plasmids of the subject invention can utilize the joining of blunt-end DNA fragments by ligation. As orientation with respect to the promoter upstream (5') of the described orfs can be critical for biosynthesis of the encoded polypeptides, restriction analysis is used to determine the orientation in all instances involving blunt-end ligations. A novel directional ligation methodology, chain reaction cloning (Pachuk et al., Gene 243:19-25, 2000), can also be used as an alternative to standard ligations in which the resultant orientation of the insert is not fixed. All PCR products are evaluated by sequence analysis as is well known in the art.
[0166] The construction of a synthetic operon comprising three yeast orfs encoding phosphomevalonate kinase, mevalonate kinase, and mevalonate diphosphate decarboxylase is described by Hahn et al. (Hahn et al., J. Bacteriol. 183:1-11, 2001). This same synthetic operon, contained within plasmid pFCO2, is able to synthesize, in vivo, polypeptides with enzymatic activities able to convert exogenously supplied mevalonate to IPP as demonstrated by the ability of the mevalonate pathway orfs to complement the temperature sensitive dxs::kanr lethal mutation in E. coli strain FH11 (Hahn et al., 2001).
[0167] Plasmids pFCO1 and pFCO2 containing a synthetic operon for the biosynthesis of IPP from mevalonate are constructed as follows: Three yeast orfs encoding mevalonate kinase, phosphomevalonate kinase, and mevalonate diphosphate decarboxylase are isolated from S. cerevisiae genomic DNA by PCR using the respective primer sets
TABLE-US-00001 FH0129-2: (SEQ ID NO: 1) 5'GGACTAGTCTGCAGGAGGAGTTTTAATGTCATTACCGTTCTTAAC TTCTGCACCGGG-3' (sense) and FH0129-1: (SEQ ID NO: 2) 5'TTCTCGAG ATTAAAACTCCTCCTGTGAAGTCCATGGTAA ATTCG 3' (antisense); FH0211-1: (SEQ ID NO: 3) 5'TAGCGGCCGCAGGAGGAGTTCATATGTCAGAGTTGAGAGCCTTC AGTGCCCCAGGG 3' (sense) and FH0211-2: (SEQ ID NO: 4) 5'TTTCTGCAGTTTATCAAGATAAGTTTCCGGATCTTT 3' (antisense); CT0419-1: (SEQ ID NO: 5) 5'GGAATTCATGACCGTTTACACAGCATCCGTTACCGCACCCG 3' (sense) and CT0419-2: (SEQ ID NO: 6) 5'GGCTCGAGTTAAAACTCCTCTTCCTTTGGTAGACCAGTCTTTG CG 3' (antisense).
Primer FH0129-2 includes a SpeI site (underlined). Primer FH0129-1 contains an XhoI site (underlined), an AflII site (double-underlined), and 54 nucleotides (bold italics) corresponding to the 5' end of the yeast orf for mevalonate diphosphate decarboxylase. Following PCR using primers FH0129-1 and FH0129-2, a product containing the orf encoding yeast mevalonate kinase is isolated by agarose gel electrophoresis and GeneClean purified. Following restriction with SpeI-XhoI, the PCR product is inserted into the SpeI-XhoI sites of pBluescript(SK+) (Stratagene, LaJolla, Calif.) by ligation to create pBRG12. Primers FH0211-1 and FH0211-2 contain a NotI site (underlined) and a PstI site (underlined), respectively. Following PCR using primers FH0211-1 and FH0211-2, a product containing the orf encoding yeast phosphomevalonate kinase is restricted with NotI-PstI, purified by GeneClean, and inserted into pGEM-T Easy (Promega Corp, Madison, Wis.) by ligation to create pERG8. An orf encoding yeast mevalonate diphosphate decarboxylase is isolated by PCR using primers CT0419-1 and CT0419-2 and inserted directly into pGEM-T Easy by ligation to create pERG19. Restriction of pERG8 with NotI-PstI yields a 1.4 Kb DNA fragment containing the orf for phosphomevalonate kinase. Restriction of pBRG12 with NotI-PstI is followed by the insertion of the 1.4 Kb NotI-PstI DNA fragment by ligation to create pBRG812 containing the orfs for both phosphomevalonate kinase and mevalonate kinase and the 5' end of the orf for yeast mevalonate diphosphate decarboxylase. Restriction of pERG19 with AflII-XhoI yields a 1.2 Kb DNA fragment containing the 3' end of the orf for yeast mevalonate diphosphate decarboxylase missing in pBRG812. Insertion of the 1.2 Kb AflII-XhoI DNA fragment into pBRG812/AflII-XhoI by ligation yields pFCO1 containing the three yeast mevalonate pathway orfs (FIG. 1). Restriction of pFCO1 with XhoI is followed by treatment with the Klenow fragment of T7 DNA polymerase and dNTPs to create blunt ends. Subsequent restriction of pFCO1/XhoI/Klenow with Sad yields a 3.9 Kb DNA fragment containing the three yeast mevalonate pathway orfs. Following agarose gel electrophoresis and GeneClean purification of the 3.9 Kb DNA fragment, it is inserted into the SmaI-Sad sites of pNGH1-amp (Garrett et al., J. Biol. Chem. 273:12457-12465, 1998) by ligation to create pFCO2 (FIG. 2).
Example 2
Construction of E. coli Strain FH11 (JM101/dxs::kanr/pDX4)
[0168] A mutant E. coli strain containing a disruption of the chromosomal dxs gene is constructed as described by Hamilton et al. (Hamilton et al., J. Bacteriol. 171:4617-4622, 1989). The strains are grown at 30EC or 44EC in Luria-Bertani (LB) supplemented with the following antibiotics as necessary; ampicillin (Amp) (50 (g/ml), chloramphenicol (Cam) (30 (g/ml), and kanamycin (Kan) (25 (g/ml). Within phagemid DD92 (F. R. Blattner, University of Wisconsin, Madison, Wis.) is a 19.8 Kb EcoRI fragment of E. coli genomic DNA containing dxs, the gene for DXP synthase. Following the isolation of the phage from E. coli strain LE392, DD92 is restricted with SphI, and the resultant 6.3 Kb fragment is isolated by agarose gel electrophoresis. GeneClean purification of the SphI fragment and restriction with SmaI yields a 2.0 Kb SphI-SmaI fragment containing E. coli dxs. The 2.0 Kb fragment is purified by GeneClean and inserted by ligation into the SphI-HindIII sites of pMAK705, a plasmid containing a temperature-sensitive origin of replication (Hamilton et al., J. Bacteriol. 171:4617-4622, 1989). The resulting plasmid containing wt dxs, pDX4, is restricted with SapI, a unique site located in the middle of the dxs gene, and the 5'-overhangs are filled in with Klenow and dNTPs. The blunt-ended DNA fragment is purified by GeneClean and treated with shrimp alkaline phosphatase (SAP, USB Corp., Cleveland, Ohio) according to the manufacturer's instructions. pUC4K (Amersham Pharmacia Biotech, Piscataway, N.J.) is restricted with EcoRI, Klenow-treated, and the resulting 1.3 Kb blunt-ended DNA fragment containing the gene for Kan resistance is inserted into the filled-in SapI site of pDX4 by blunt-end ligation to create pDX5 with a disruption in E. coli dxs. Competent E. coli JM101 cells are transformed with pDX5, a pMAK705 derivative containing dxs::kanr, and grown to an optical density (A600) of 0.6 at 30EC. Approximately 10,000 cells are plated out on LB/Cam medium prewarmed to 44EC. The plates were incubated at 44EC, and several of the resulting colonies are grown at 44EC in 4 ml of LB/Cam medium. Four 50 ml LB/Cam cultures are started with 0.5 ml from four of the 4 ml cultures and grown overnight at 30EC. Four fresh 50 ml LB/Cam cultures are started with 100 μl of the previous cultures and grown overnight at 30EC. An aliquot of one of the 50 ml cultures is serially diluted 5×105 fold, and 5 μl is plated on LB/Cam medium. Following incubation at 30EC, the resulting colonies are used to individually inoculate 3 ml of LB medium containing Cam and Kan. Twelve LB/Cam/Kan cultures are grown overnight at 30EC and used for plasmid DNA isolation. E. coli cells where the disrupted copy of dxs is incorporated into the genome are identified by restriction analysis of the isolated plasmid DNA and verified by sequence analysis of the DNA contained in the plasmids. The E. coli JM101 derivative containing the dxs::kanr mutation is designated FH11 (Hahn et al. 2001).
Example 3
Assay Demonstrating Synthesis of IPP from Mevalonic Acid in E. coli
[0169] The episomal copy of dxs contained on pDX4 in E. coli strain FH11 is "turned off" at 44EC due to a temperature sensitive origin of replication on the pMAK705 derivative (Hamilton et al., J. Bacteriol. 171:4617-4622, 1989). The inability of FH11 to grow at the restrictive temperature demonstrates that dxs is an essential single copy gene in E. coli (Hahn et al., 2001). A cassette containing three yeast mevalonate pathway orfs is removed from pFCO1 and inserted into pNGH1-Amp to form pFCO2 for testing the ability of the mevalonate pathway orfs to complement the dxs::kanr disruption when FH11 is grown at 44EC on medium containing mevalonate. The utility of strain FH11 as a component of an assay for testing the ability of mevalonate pathway orfs to direct the synthesis of IPP is demonstrated as follows:
[0170] Colonies of E. coli strain FH11 transformed with pFCO2 or pNGH1-Amp, the expression vector without an insert, are isolated by incubation at 30EC on LB plates containing Kan and Amp. Four ml LB/Kan/Amp cultures containing either FH11/pFCO2 or FH11/pNGH1-Amp are grown overnight at 30EC. Following a 10,000-fold dilution, 10 μl portions from the cultures are spread on LB/Kan/Amp plates that are prewarmed to 44E C or are at rt. Approximately 1.3 mg of mevalonic acid is spread on each plate used for FH11/pFCO2. The prewarmed plates are incubated at 44EC, and the rt plates are incubated at 30EC overnight.
[0171] FH11/pNGH1-amp cells will not grow at the restrictive temperature of 44EC and FH11/pFCO2 cells are unable to grow at of 44EC unless mevalonic acid (50 mg/L) is added to the growth medium thus establishing the ability of the polypeptides encoded by the mevalonate pathway orfs contained in the synthetic operon within pFCO2 to form IPP from mevalonate in vivo (Hahn et al., 2001).
Example 4
Isolation of Mevalonate Pathway Orfs
[0172] In a specific, exemplified embodiment, the isolation of orfs, each encoding a polypeptide with either HMG-CoA synthase enzyme activity, HMG-CoA reductase enzyme activity, or acetoacetyl-CoA thiolase enzyme activity, and construction of vectors containing these orfs is as follows: Synthesis of A. thaliana first strand cDNAs is performed utilizing PowerScriptJ (reverse transcriptase (Clontech Laboratories, Inc., Palo Alto, Calif.) according to the manufacturer's instructions. Specifically, a microfuge tube containing 5 μl of A. thaliana RNA (Arabidopsis Biological Resource Center, Ohio State University, Columbus, Ohio), 1.8 μl poly(dT) 15 primer (0.28 μg/μl, Integrated DNA Technologies, Inc. Coralville, Iowa), and 6.2 μl DEPC-treated H2O is heated at 70EC for 10 min and then immediately cooled on ice. The mixture is spun down by centrifugation and 4 μl of 5× First-Strand Buffer (Clontech), 2μ (1 Advantage UltraPure PCR dNTP mix (10 mM each, Clontech) and 2μ (1 100 mM DTT are added and the entire contents mixed by pipetting. Following the addition of 1μ (1 reverse transcriptase (Clontech) and mixing by pipetting, the contents are incubated at 42E C for 90 min and then heated at 70EC for 15 min to terminate the reaction.
[0173] The resulting A. thaliana first strand cDNAs are used as templates for the synthesis of an orf encoding HMG-CoA synthase and a truncated HMG-CoA reductase by PCR in a Perkin-Elmer GeneAmp PCR System 2400 thermal cycler utilizing the Advantage7-HF 2 PCR Kit (Clontech) according to the manufacturer's instructions. An A. thaliana HMG-CoA synthase orf is isolated using the following PCR primers:
TABLE-US-00002 (SEQ ID NO: 7) 1) 5' GCTCTAGATGCGCAGGAGGCACATATGGCGAAGAACGTTGGGA TTTTGGCTATGGATATCTATTTCCC 3' (sense); and (SEQ ID NO: 8) 2) 5' CG CGGATCCTCAGTGTCCATTGGCTACAGATC CATCTTCACCTTTCTTGCC 3' (antisense);
containing the restriction site XbaI shown underlined, the restriction site XhoI shown in bold italic and the restriction site SalI shown double underlined. Specifically, 2 (1 cDNA, 5μ (1 10X HF 2 PCR Buffer (Clontech), 5 μl 10X HF 2 dNTP Mix (Clontech), 1 μl each of the primers described above, 1 μl 50× Advantage-HF 2 Polymerase Mix (Clontech), and 35 μl PCR-Grade H2O (Clontech) are combined in a 0.5 ml PCR tube. The mixture is heated at 94EC for 15 sec then subjected to 40 PCR cycles consisting of 15 sec at 94EC and 4 min at 68EC. After a final incubation at 68EC for 3 min, the reaction is cooled to 4EC. Agarose gel electrophoresis is performed on a 10 μl aliquot to confirm the presence of a DNA fragment of the predicted size of 1.4 Kb. The PCR is repeated in triplicate to generate enough product for its isolation by gel excision and purification by GeneClean (Qbiogene, Inc., Carlsbad Calif.). Following restriction with XbaI-XhoI and purification by GeneClean, the 1.4 Kb PCR product is inserted into the XbaI-XhoI sites of pBluescript(SK+) by ligation to form putative pBSHMGS constructs. Sequence analysis of several of the candidate constructs is performed to identify inserts with DNA identical to the published A. thaliana orf for HMG-CoA synthase and are used for the construction of pBSHMGSR as described below.
[0174] An A. thaliana orf encoding a polypeptide with HMG-CoA reductase enzyme activity is synthesized by PCR essentially as described above using the following primers: 3) 5' CCGCTCGAGCACGTGGAGGCACATATGCAATGCTGTGAGATGCCT GTTGGATACATTCAGATTCCTGTTGGG 3' (sense) (SEQ ID NO: 9); and 4) 5' GGGGTACCTCGGCCGGATCCCGGGTCATGTTGTTGTTGTTGTCGT TGTCGTTGCTCCAGAGATGTCTCGG 3' (antisense) (SEQ ID NO: 10); containing the restriction site XhoI shown underlined, the restriction site KpnI shown in italic, the restriction site EagI shown in bold, and the restriction site SmaI shown double underlined. The 1.1 Kb PCR product is isolated by agarose gel electrophoresis, purified by GeneClean and inserted into the pT7Blue-3 vector (Novagen, Inc., Madison, Wis.) using the Perfectly BluntJ Cloning Kit (Novagen) according to the manufacturer's instructions. Sequence analysis is performed to identify constructs containing A. thaliana DNA encoding the desired C-terminal portion of the published HMG-CoA reductase amino acid sequence and are designated pHMGR.
[0175] PCR is performed on S. cerevisiae genomic DNA (Invitrogen, Corp., Carlsbad, Calif.) by using the Advantage®-HF 2 PCR Kit (Clontech) according to the manufacturer's instructions and the following primers:
TABLE-US-00003 (SEQ ID NO: 11) 5) 5' ACAACACCGCGGCGGCCGCGTCGACTACGTAGGAGGCACATAT GTCTCAGAACGTTTACATTGTATCGACTGCC 3' (sense); and (SEQ ID NO: 12) 6) 5' GC GGATCCTCATATCTTTTCAATGACAATAGAGGAA GCACCACCACC 3' (antisense);
containing the restriction site NotI shown underlined, the restriction site Sad shown in italic, the restriction site SalI shown in bold, the restriction site SnaBI shown double underlined, and the restriction site XbaI in bold italic. The 1.2 Kb PCR product is isolated by agarose gel electrophoresis, purified by GeneClean and inserted into the vector pT7Blue-3 (Novagen,) using the Perfectly BluntJ Cloning Kit (Novagen) according to the manufacturer's instructions. Sequence analysis is performed to identify constructs containing S. cerevisiae DNA identical to the published orf encoding acetoacetyl-CoA thiolase and they are designated pAACT.
Example 5
Construction of pHKO1
[0176] In an exemplified embodiment, a pBluescript(SK+) derivative containing an operon with orfs encoding polypeptides with enzymatic activities for HMG-CoA synthase, HMG-CoA reductase, and acetoacetyl-CoA thiolase is constructed as follows: Following restriction of pHMGR with XhoI-KpnI, isolation of the 1.1 Kb DNA fragment by agarose gel electrophoresis, and purification by GeneClean, the 1.1 Kb XhoI-KpnI DNA fragment containing the orf encoding the C-terminal portion of A. thaliana HMG-CoA reductase is inserted into the SalI-KpnI sites of pBSHMGS by ligation to create pBSHMGSR. Following restriction of pAACT with SacII-XbaI, isolation of the 1.2 Kb DNA fragment containing the orf encoding yeast acetoacetyl-CoA thiolase by agarose gel electrophoresis, and purification by GeneClean, the 1.2 Kb SacII-XbaI DNA fragment is inserted into the SacII-XbaI sites of pBSHMGSR by ligation to create pHKO1 (FIG. 3).
Example 6
Construction of pHKO2
[0177] In a specific, exemplified embodiment, a vector containing a synthetic operon consisting of six orfs encoding polypeptides with acetoacetyl-CoA thiolase, HMG-CoA synthase, HMG-CoA reductase, mevalonate kinase, phosphomevalonate kinase, and mevalonate diphosphate decarboxylase enzymatic activities, thus comprising the entire mevalonate pathway, is constructed as follows: Restriction of pHKO1 with EagI yields a 3.7 Kb DNA fragment containing orfs encoding yeast acetoacetyl-CoA thiolase, A. thaliana HMG-CoA synthase, and a truncated A. thaliana HMG-CoA reductase. Following isolation of the 3.7 Kb Eagl DNA fragment by agarose gel electrophoresis and purification by GeneClean, it is directionally inserted into the NotI site of pFCO2 (Hahn et al., 2001) utilizing the methodology of chain reaction cloning (Pachuk et al., 2000), thermostable Ampligase® (Epicentre Technologies, Madison, Wis.), and the following bridge oligonucleotide primers:
TABLE-US-00004 (SEQ ID NO: 13) 1) 5' TGGAATTCGAGCTCCACCGCGGTGGCGGCCGCGTCGACGCCG GCGGAGGCACATATGTCT 3'; and (SEQ ID NO: 14) 2) 5' AACAACAACAACATGACCCGGGATCCGGCCGCAGGAGGAGTT CATATGTCAGAGTTGAGA 3';
as follows: Agarose gel electrophoresis is performed on the 8.1 Kb pFCO2/NotI DNA fragment and the 3.7 Kb EagI DNA fragment isolated from pHKO1 to visually estimate their relative concentrations. Approximately equivalent amounts of each fragment totaling 4.5 μl, 1 μl of each bridge oligo at a concentration of 200 nM, 5 μl Ampligase® 10× Reaction Buffer (Epicentre), 3 μl Ampligase® (5U/(1) (Epicentre), and 35.5 μl PCR grade H2O are added to a 0.5 ml PCR tube. The mixture is heated at 94EC for 2 min then subjected to 50 PCR cycles consisting of 30 sec at 94EC, 30 sec at 60EC, and 1 min at 66EC. After a final incubation at 66E C for 5 min, the reaction is cooled to 4EC. Colonies resulting from the transformation of E. coli strain NovaBlue (Novagen) with 1 μl of the directional ligation reaction are grown in LB medium supplemented with ampicillin at a final concentration of 50 μg/ml. Restriction analysis with NaeI-KpnI of mini-prep plasmid DNA from the liquid cultures is performed to identify candidate pHKO2 constructs by the presence of both a 5.7 and a 6.2 Kb DNA fragment. Further analysis by restriction with SmaI-XhoI to generate both a 3.9 and 7.9 Kb DNA fragment confirms the successful construction of pHKO2 (FIG. 4).
Example 7
Assay Demonstrating the Synthesis of IPP from Acetyl-CoA in E. coli
[0178] In a specific, exemplified embodiment, a derivative of pNGH1-amp (Hahn et al., 2001), containing the entire mevalonate pathway, is assayed (FIG. 5) for its ability to synthesize IPP from endogenous acetyl-CoA in E. coli strain FH11, containing the temperature sensitive dxs::kanr knockout (Hahn et al., 2001), as follows: Colonies resulting from the transformation of FH11, by pHKO2, containing orfs encoding polypeptides with enzymatic activities for acetoacetyl-CoA thiolase, HMG-CoA synthase, HMG-CoAreductase, mevalonate kinase, phosphomevalonate kinase, and mevalonate diphosphate decarboxylase, are isolated by incubation at 30EC on LB plates containing Kan and Amp. Several 4 ml LB/Kan/amp samples are individually inoculated with single colonies from the FH11/pHKO2 transformation. Following growth at 30EC overnight, the FH11/pHKO2 cultures are diluted 100,000-fold, and 5 μl aliquots are spread on LB/Kan/amp plates at room temperature (rt) or that are prewarmed to 44EC. The prewarmed plates are incubated at 44EC, and the rt plates are incubated at 30EC overnight. FH11 and FH11/pNGH1 amp cells will not grow at the restrictive temperature of 44EC (Hahn et al., 2001). FH11/pHKO2 cells are able to grow at 44EC, thus establishing the ability, of a synthetic operon comprising the entire mevalonate pathway, to form IPP from acetyl-CoA and thereby overcome the dxs::kanr block to MEP pathway biosynthesis of IPP in E. coli strain FH11.
Example 8
Construction of pHKO3
[0179] In another exemplified embodiment, a derivative of pBluescript(SK+) containing an operon comprising orfs, which in their summation is the entire mevalonate pathway, is constructed as follows: pHKO1, containing orfs encoding acetoacetyl-CoA thiolase, HMG-CoA synthase, and an N-terminal truncated HMG-CoA reductase, is restricted with SalI-NotI and purified by GeneClean. The pBluescript(SK+) derivative pFCO1, containing the orfs encoding mevalonate kinase, phosphomevalonate kinase, and mevalonate diphosphate decarboxylase, has been described above in Example 1. Following restriction of pFCO1 with XhoI-NotI, isolation by agarose gel electrophoresis, and purification by GeneClean, the 3.9 Kb DNA fragment containing the mevalonate pathway orfs is inserted into pHKO1/SalI-NotI by directional ligation (Pachuk et al., 2000) utilizing thermostable Ampligase® (Epicentre Technologies, Madison, Wis.), and the following bridging oligonucleotides:
TABLE-US-00005 (SEQ ID NO: 15) 1) 5' CTCAACTCTGACATATGAACTCCTCCTGCGGCCGCCGCGGT GGAGCTCCAGCTTTTGTTCCC 3'; and (SEQ ID NO: 16) 2) 5' GGTCTACCAAAGGAAGAGGAGTTTTAACTCGACGCCGGCGG AGGCACATATGTCTCAGAACG 3';
essentially as described for the construction of pHKO2. Restriction analysis is performed with KpnI to confirm the successful construction of pHKO3 (FIG. 6).
Example 9
Construction of Tobacco Plastid Transformation Vector pHKO4
[0180] In an exemplified embodiment, a vector containing a Nicotiana tabacum plastid pseudogene is utilized to create a plastid transformation vector as follows: The pBluescript(SK+) derivative designated as pBSNT27 (FIG. 7, SEQ ID NO: 17) contains a 3.3 Kb BglII-BamHI DNA fragment of the N. tabacum chloroplast genome corresponding approximately to base-pairs 80553-83810 of the published nucleotide sequence (Sugiura, M., 1986, and Tsudsuki, T., 1998.). A unique restriction site contained within the tobacco infA pseudogene located on pBSNT27 is cleaved with BglII and the resulting 5' overhangs are filled in with Klenow and dNTPs. The resulting 6.2 Kb blunt-ended DNA fragment is GeneClean purified. Following restriction of pHKO3 with EagI, filling in of the resulting 5' overhangs with Klenow and dNTPs, isolation by agarose gel electrophoresis, and purification by GeneClean, the resulting 7.7 Kb blunt-ended DNA fragment, containing orfs encoding the entire mevalonate pathway, is directionally inserted into the blunt-ended BglII site of pBSNT27 utilizing chain reaction cloning (Pachuk et al., 2000.), thermostable Ampligase® (Epicentre Technologies, Madison, Wis.), and the following bridging oligonucleotides:
TABLE-US-00006 (SEQ ID NO: 18) 1) 5' GATCTTTCCTGAAACATAATTTATAATCAGATCGGCCGCAG GAGGAGTTCATATGTCAGAGTTGAG 3'; and (SEQ ID NO: 19) 2) 5' GACAACAACAACAACATGACCCGGGATCCGGCCGATCTAAA CAAACCCGGAACAGACCGTTGGGAA 3';
to form the tobacco plastid-specific transformation vector pHKO4 (FIG. 8).
[0181] Alternatively, other derivatives of pBSNT27 can be constructed, using skills as known in the art, that are not reliant upon an available restriction site(s) in the pseudogene. For example, although the infA pseudogene comprises basepairs 3861-4150 in pBSNT27, there are unique restriction sites in close proximity, upstream and downstream, that can be utilized to excise the entire pseudogene followed by its replacement with an orf or gene cluster comprising multiple orfs, e.g., the complete mevalonate pathway described above. Specifically, there is a unique BsrGI site at 3708 base pairs and a unique Sex AI restriction site at 4433 base pairs within pBSNT27. Thus, as will be readily apparent to those skilled in the art, one can replace the infA pseudogene entirely by inserting a BsrGI-SexAI DNA fragment containing DNA, comprising orfs encoding the entire mevalonate pathway, that is flanked by the excised DNA originally flanking the infA pseudogene, i.e. DNA corresponding to 3708-3860 and 4151-4433 base pairs in pBSNT27. The resultant construct will be missing the pseudogene, but will contain the excised flanking DNA restored to its original position and now surrounding the mevalonate pathway orfs. Also, a similar strategy, that will also be apparent to those skilled in the art in view of this disclosure, can be employed that restores the intact pseudogene to a location between the DNA originally flanking it, yet linked to an orf or orfs located upstream and/or downstream of the pseudogene and adjacent to the original flanking DNA.
Example 10
Construction of Vectors Containing Orfs Encoding IPP Isomerase (pHKO5 and pHKO6)
[0182] In a specific, exemplified embodiment, orfs encoding IPP isomerase are isolated and vectors containing an operon comprising orfs for the entire mevalonate pathway and an additional orf for IPP isomerase are constructed as follows: A Rhodobacter capsulatus orf encoding a polypeptide with IPP isomerase activity is isolated by PCR from genomic DNA (J. E. Hearst, Lawrence Berkeley Laboratories, Berkeley, Calif.) using the following primers:
TABLE-US-00007 (SEQ ID NO: 20) 1) 5' CGCTCGAGTACGTAAGGAGGCACATATGAGTGAGCTT ATACCCGCCTGGGTTGG 3' (sense); and (SEQ ID NO: 21) 2) 5' GCTCTAGAGATATCGGATCCGCGGCCGCTCAGCCGCG CAGGATCGATCCGAAAATCC 3' (antisense);
containing the restriction sites XhoI shown underlined, BsaAI shown in bold, XbaI shown in italic, EcoRV shown double underlined, and NotI shown in bold italic. The PCR product is restricted with XhoI-XbaI, isolated by agarose gel electrophoresis, purified by GeneClean, and inserted into the XhoI-XbaI sites of pBluescript(SK+) by ligation to form pBSIDI. Sequence analysis is performed to identify the plasmids containing R. capsulatus DNA identical to the complementary sequence of base pairs 34678-34148, located on contig rc04 (Rhodobacter Capsulapedia, University of Chicago, Chicago, Ill.). Following restriction of pBSIDI with BsaAI-EcoRV, agarose gel electrophoresis and GeneClean purification, the 0.5 Kb BsaAI-EcoRV DNA fragment containing the R. capsulatus orf is inserted into the dephosphorylated SmaI site of pHKO3 by blunt-end ligation to create pHKO5 (FIG. 9). This establishes the isolation of a previously unknown and unique orf encoding R. capsulatus IPP isomerase.
[0183] A Schizosaccharomyces pombe orf encoding a polypeptide with IPP isomerase activity is isolated from plasmid pBSF19 (Hahn and Poulter, J. Biol. Chem. 270:11298-11303, 1995) by PCR using the following primers
TABLE-US-00008 (SEQ ID NO: 22) 3) 5' GCTCTAGATACGTAGGAGGCACATATGAGTTCCCAACAAGAG AAAAAGGATTATGATGAAGAACAATTAAGG 3' (sense); and (SEQ ID NO: 23) 4) 5' CGCTCGAGCCCGGGGGATCCTTAGCAACGATGAATTAAGGTA TCTTGGAATTTTGACGC 3' (antisense);
containing the restriction site BsaAI shown in bold and the restriction site SmaI shown double underlined. The 0.7 Kb PCR product is isolated by agarose gel electrophoresis, purified by GeneClean and inserted into the pT7Blue-3 vector (Novagen, Inc., Madison, Wis.) using the Perfectly BluntJ Cloning Kit (Novagen) according to the manufacturer's instructions. Sequence analysis is performed to identify constructs containing S. pombe DNA identical to the published DNA sequence (Hahn and Poulter, 1995) and are designated pIDI. Following restriction of pIDI with BsaAI-SmaI, isolation by agarose gel electrophoresis, and purification by GeneClean, the 0.7 Kb BsaAI-SmaI DNA fragment containing the orf encoding S. pombe IPP isomerase is inserted into the dephosphorylated SmaI site of pHKO3 by blunt-end ligation to create pHKO6.
Example 11
Construction of Vectors Containing Alternative Orfs for Mevalonate Pathway Enzymes and IPP Isomerase
[0184] In another exemplified embodiment, vectors containing open reading frames (orfs) encoding enzymes of the mevalonate pathway and IPP isomerase other than those described above are constructed. Polynucleotides derived from the yeast Saccharomyces cerevisiae, the plant Arabidopsis thaliana, and the bacteria Rhodobacter capsulatus and Streptomyces sp strain CL190 are used for the construction of vectors, including plastid delivery vehicles, containing orfs for biosynthesis of the encoded enzymes. Construction of the vectors is not limited to the methods described. One skilled in the art may choose alternative restriction sites, PCR primers, etc. to create analogous plasmids containing the same orfs or other orfs encoding the enzymes of the mevalonate pathway and IPP isomerase.
[0185] Specifically, by way of example, genomic DNA is isolated from Streptomyces sp strain CL190 (American Type Culture Collection, Manassas, Va.) using the DNeasy Tissue Kit (Qiagen) according to the manufacturer's instructions. An orf encoding a polypeptide with HMG-CoA reductase activity (Takahashi et al., J. Bacteriol. 181:1256-1263, 1999) is isolated from the Streptomyces DNA by PCR using the following primers:
TABLE-US-00009 (SEQ ID NO: 24) 1) 5' CCGCTCGAGCACGTGAGGAGGCACATATGACGGAAACGCACGCC ATAGCCGGGGTCCCGATGAGG 3' (sense); and (SEQ ID NO: 25) 2) 5' GGGGTACCGCGGCCGCACGCGTCTATGCACCAACCTTTGCGGTC TTGTTGTCGCGTTCCAGCTGG 3' (antisense);
containing the restriction site XhoI shown underlined, the restriction site KpnI shown in italics, the restriction site Nod shown in bold, and the restriction site M/uI shown double underlined. The 1.1 Kb PCR product is isolated by agarose gel electrophoresis, purified by GeneClean and inserted into the pT7Blue-3 vector (Novagen, Inc., Madison, Wis.) using the Perfectly BluntJ Cloning Kit (Novagen) according to the manufacturer's instructions. Sequence analysis is performed to identify constructs containing Streptomyces sp CL190 DNA identical to the published sequence and are designated pHMGR2.
[0186] Alternatively, using skills as known in the art, an orf encoding a truncated S. cerevisiae HMG-CoA reductase (Chappel et al., U.S. Pat. No. 5,349,126 1994) can be isolated by PCR and inserted into pT7Blue-3 (Novagen, Inc., Madison, Wis.) to construct a vector for use in building a gene cluster comprising the entire mevalonate pathway, in an analgous fashion to the use of the Streptomyces sp CL190 orf encoding HMG-CoA reductase, as described herein.
[0187] Following restriction of pAACT (see Example 4) with SacII-XbaI, isolation of the 1.2 Kb DNA fragment containing the orf encoding yeast acetoacetyl-CoA thiolase by agarose gel electrophoresis, and purification by GeneClean, the 1.2 Kb SacII-XbaI DNA fragment is inserted into the SacII-XbaI sites of pBSHMGS (see Example 4) by ligation to create pBSCTGS. Following restriction of pHMGR2 with XhoI-KpnI, isolation of the 1.1 Kb DNA fragment by agarose gel electrophoresis, and purification by GeneClean, the 1.1 Kb XhoI-KpnI DNA fragment containing the orf encoding Streptomyces sp CL190 HMG-CoA reductase is inserted into the XhoI-KpnI sites of pBSCTGS by ligation to create the pBluescript(SK+) derivative, pFHO1 (FIG. 10).
[0188] A derivative of pFHO1 containing an operon with orfs, which in their summation comprise the entire mevalonate pathway, is constructed as follows: pFHO1 is restricted with SnaBI and the resulting 6.6 Kb blunt-ended DNA fragment is purified by GeneClean. Following the restriction of pFCO1 (see Example 1) with NotI-XhoI, the resulting 3.9 Kb DNA fragment is isolated by agarose gel electrophoresis and purified by GeneClean. The 5' overhangs of the 3.9 Kb DNA fragment are filled in with Klenow and dNTPs. Following purification by GeneClean, the blunt-ended DNA fragment containing three mevalonate pathway orfs (Hahn et al., 2001) is inserted into the SnaBI site of pFHO1 utilizing directional ligation methodology (Pachuk et al., 2000), thermostable Ampligase® (Epicentre Technologies, Madison, Wis.), and the bridging oligonucleotides:
TABLE-US-00010 (SEQ ID NO: 26) 3) 5' GAGCTCCACCGCGGCGGCCGCGTCGACTACGGCCGCAGGAGGAG TTCATATGTCAGAGTT 3'; and (SEQ ID NO: 27) 4) 5' TCTACCAAAGGAAGAGGAGTTTTAACTCGAGTAGGAGGCACATA TGTCTCAGAACGTTTA 3';
to form pFHO2 (FIG. 11).
[0189] A derivative of pFHO2 containing an operon with orfs, which in their summation comprise the entire mevalonate pathway and an orf encoding IPP isomerase is constructed as follows: pFHO2 is restricted with MluI and the resulting 5' overhangs are filled in with Klenow and dNTPs. The 10.6 Kb blunt-ended DNA fragment is purified by GeneClean. Following restriction of pBSIDI with BsaAI-EcoRV, agarose gel electrophoresis and GeneClean purification, the resulting blunt-ended 0.5 Kb DNA fragment containing the R. capsulatus IPP isomerase orf is inserted into the filled in MluI site of pFHO2 utilizing directional ligation methodology (Pachuk et al., 2000), thermostable Ampligase® (Epicentre Technologies, Madison, Wis.), and the following bridging oligonucleotides:
TABLE-US-00011 (SEQ ID NO: 28) 5) 5' CAAGACCGCAAAGGTTGGTGCATAGACGCGGTAAGGAGGCACAT ATGAGTGAGCTTATAC 3'; and (SEQ ID NO: 29) 6) 5' CCTGCGCGGCTGAGCGGCCGCGGATCCGATCGCGTGCGGCCGCG GTACCCAATTCGCCCT 3';
to form pFHO3 (FIG. 12).
[0190] Following the restriction of pBluescript(SK+) with SacII-XbaI and purification by GeneClean, a 1.3 Kb SacII-XbaI DNA fragment containing the orf encoding S. cerevisiae acetoacetyl-CoA thiolase, isolated from pAACT (see Example 4) by restriction and agarose gel electrophoresis, is inserted into pBluescript(SK+)/SacII-XbaI by ligation. The resulting plasmid, pBSAACT, is restricted with XbaI, treated with Klenow and dNTPs, and purified by GeneClean. Following restriction of Streptomyces sp CL190 genomic DNA with SnaBI, a blunt-ended 6.8 Kb DNA fragment, containing five (5) orfs encoding polypeptides with HMG-CoA synthase, HMG-CoA reductase, mevalonate kinase, phosphomevalonate kinase, mevalonate diphosphate decarboxylase and IPP isomerase enzymatic activities (Takagi et al., J. Bacteriol. 182:4153-4157, 2000 and Kuzuyama et al., Proc. Natl. Acad. Sci. USA 98:932-7, 2001), is isolated by agarose gel electrophoresis, purified by GeneClean and inserted into the filled in XbaI site of pBSAACT utilizing directional ligation methodology (Pachuk et al., 2000), thermostable Ampligasequadrature (Epicentre Technologies, Madison, Wis.), and the bridging oligonucleotides:
TABLE-US-00012 (SEQ ID NO: 30) 7) 5' TGTCATTGAAAAGATATGAGGATCCTCTAGGTACTTCCCTGGCG TGTGCAGCGGTTGACG 3'; and (SEQ ID NO: 31) 8) 5' CGATTCCGCATTATCGGTACGGGTGCCTACCTAGAACTAGTGGA TCCCCCGGGCTGCAGG 3';
to form pFHO4 (FIG. 13). Transformation experiments to isolate pFHO4 constructs are performed with E. coli competent cells utilizing media containing ampicillin. Alternatively, media containing only fosmidomycin (20 μg/ml) as the selection agent is used for the direct isolation of pFHO4 constructs containing the Streptomyces sp CL190 gene cluster.
[0191] The construction of vectors pHKO2, pHKO3, pHKO5, pHKO6, pFHO2, pFHO3, and pFHO4, illustrates the many ways of combining orfs isolated from a variety of organisms to encode polypeptides such that in their summation they comprise the entire mevalonate pathway or comprise the entire mevalonate pathway and IPP isomerase.
Example 12
Construction of Tobacco Plastid Transformation Vectors pHKO7 and pHKO8
[0192] In a specific, exemplified embodiment, tobacco plastid-specific transformation vectors containing orfs, which in their summation comprise the mevalonate pathway, and an additional orf encoding IPP isomerase are constructed as follows: Restriction of pHKO5 with NotI generates a DNA fragment containing six orfs comprising the entire mevalonate pathway and an additional orf encoding R. capsulatus IPP isomerase. Restriction of pHKO6 with EagI generates a DNA fragment containing the six orfs comprising the complete mevalonate pathway and an additional orf encoding S. pombe IPP isomerase. Following isolation by agarose gel electrophoresis and purification by GeneClean, the 8.2 Kb NotI DNA fragment from pHKO5 is blunt-ended with Klenow and dNTPs and inserted into the blunt-ended BglII site of pBSNT27 utilizing chain reaction cloning (Pachuk et al., 2000), thermostable Ampligase® (Epicentre Technologies, Madison, Wis.), and the following bridging oligonucleotides:
TABLE-US-00013 (SEQ ID NO: 32) 1) 5' CTTTCCTGAAACATAATTTATAATCAGATCGGCCGCAGGAGGAG TTCATATGTCAGAGTT 3'; and (SEQ ID NO: 33) 2) 5'TTCGGATCGATCCTGCGCGGCTGAGCGGCCGATCTAAACAAACCC GGAACAGACCGTTGG 3';
to create the plastid delivery vehicle pHKO7 (FIG. 14) containing orfs encoding the entire mevalonate pathway and an orf encoding R. capsulatus IPP isomerase. Following isolation by agarose gel electrophoresis and purification by GeneClean, the 8.4 Kb EagI DNA fragment from pHKO6 is blunt-ended with Klenow and dNTPs and inserted into the blunt-ended BglII site of pBSNT27 utilizing chain reaction cloning (Pachuk et al., 2000), thermostable Ampligase® (Epicentre Technologies, Madison, Wis.), and the following bridging oligonucleotides:
TABLE-US-00014 (SEQ ID NO: 34) 3) 5' CTTTCCTGAAACATAATTTATAATCAGATCGGCCGCAGGAGGAG TTCATATGTCAGAGT 3'; and (SEQ ID NO: 35) 4) 5' TCGTTGCTAAGGATCCCCCGGGATCCGGCCGATCTAAACAAACC CGGAACAGACCGTTGG 3';
to create the plastid delivery vehicle pHKO8 containing orfs encoding the entire mevalonate pathway plus the S. pombe IPP isomerase orf.
[0193] Alternatively, either of the IPP isomerase orfs described above can be solely inserted, without orfs for the mevalonate pathway, directly into pBSNT27 (or into any suitable plant transformation vector, known in the art), using skills known in the art.
Example 13
Construction of Vectors used for Increasing Carotenoid Production (pHKO9, pHK10, pHK11, pHK12, and pHK13)
[0194] In yet another exemplified embodiment, a derivative of pTrcHisB (Invitrogen) containing a synthetic operon comprising orfs, which in their summation is the entire mevalonate pathway, is constructed as follows: A unique NotI site was inserted into pTrcHisB utilizing the following oligonucleotides:
TABLE-US-00015 (SEQ ID NO: 36) 1) 5' CATGGCGGCCGCG 3'; and (SEQ ID NO: 37) 2) 5' GATCCGCGGCCGC 3';
that upon annealing, form a double-stranded DNA linker containing NotI with 5' overhangs compatible with StyI and BamHI. Following restriction of pTrcHisB with StyI-BamHI, isolation of the resulting 4.3 Kb DNA fragment by agarose gel electrophoresis, and its purification by GeneClean, the NotI linker was inserted into pTrcHisB/StyI-BamHI by ligation. Restriction analysis with BsaAI-NotI confirms the successful construction of pTrcHisB-NotI (pTHBN1) by the presence of both 2.5 and 1.8 Kb DNA fragments. Following restriction ofpHKO3 with EagI, the 7.7 Kb DNA fragment, containing the six mevalonate pathway orfs, is isolated by agarose gel electrophoresis, purified by GeneClean, and inserted into the NotI site of pTHBN1 utilizing directional ligation methodology (Pachuk et al., 2000), thermostable Ampligase® (Epicentre Technologies, Madison, Wis.), and the bridging oligonucleotides:
TABLE-US-00016 (SEQ ID NO: 38) 3) 5' TTAAATAAGGAGGAATAAACCATGGCGGCCGCAGGAGGAGTTCA TATGTCAGAGTTGAGA 3'; and (SEQ ID NO: 39) 4) 5' AACAACAACAACATGACCCGGGATCCGGCCGCGATCCGAGCTCG AGATCTGCAGCTGGTA 3';
to form pHKO9 (FIG. 15).
[0195] Derivatives of pTHBN1 containing the entire mevalonate pathway plus an additional orf encoding IPP isomerase are constructed as follows: Following restriction of pHKO5 with NotI, the 8.2 Kb DNA fragment, containing the six mevalonate pathway orfs plus an orf encoding R. capsulatus IPP isomerase, is isolated by agarose gel electrophoresis, purified by GeneClean, and inserted into the NotI site of pTHBN1 utilizing directional ligation methodology (Pachuk et al., 2000), thermostable Ampligase® (Epicentre Technologies, Madison, Wis.), and the bridging oligonucleotides:
TABLE-US-00017 (SEQ ID NO: 40) 5) 5' TCGATTAAATAAGGAGGAATAAACCATGGCGGCCGCAGGAGGAG TTCATATGTCAGAGTT 3'; and (SEQ ID NO: 41) 6) 5' GATTTTCGGATCGATCCTGCGCGGCTGAGCGGCCGCGATCCGAG CTCGAGATCTGCAGCT 3';
to form pHK10 (FIG. 16). Following restriction of pHKO6 with Eagl, the 8.4 Kb DNA fragment, containing the six mevalonate pathway orfs plus an orf encoding S. pombe IPP isomerase, is isolated by agarose gel electrophoresis, purified by GeneClean, and inserted into the Nod site of pTHBN1 utilizing directional ligation methodology (Pachuk et al., 2000), thermostable Ampligase® (Epicentre Technologies, Madison, Wis.), and the following bridging oligonucleotides:
TABLE-US-00018 (SEQ ID NO: 42) 7) 5' TCGATTAAATAAGGAGGAATAAACCATGGCGGCCGCAGGAGGAG TTCATATGTCAGAGTT 3'; and (SEQ ID NO: 43) 8) 5' TTCATCGTTGCTAAGGATCCCCCGGGATCCGGCCGCGATCCGAG CTCGAGATCTGCAGCT 3';
to form pHK11.
[0196] Derivatives of pTHBN1 containing only an orf encoding IPP isomerase are constructed as follows: pTHBN1 is restricted with Nod and the resulting 5' overhangs are filled in with Klenow and dNTPs. The 4.3 Kb pTHBN1/NotI blunt-ended DNA fragment is GeneClean purified. Following restriction of pBSIDI with BsaAI-EcoRV, agarose gel electrophoresis and GeneClean purification, the resulting blunt-ended 0.5 Kb DNA fragment containing the R. capsulatus IPP isomerase orf is inserted into the filled in NotI site of pTHBN1 utilizing chain reaction cloning (Pachuk et al., 2000), thermostable Ampligase® (Epicentre Technologies, Madison, Wis.), and the following bridging oligonucleotides:
TABLE-US-00019 (SEQ ID NO: 44) 9) 5' TTAAATAAGGAGGAATAAACCATGGCGGCCGTAAGGAGGCACAT ATGAGTGAGCTTATAC T 3'; and (SEQ ID NO: 45) 10) 5' GCCTGCGCGGCTGAGCGGCCGCGGATCCGATGGCCGCGATCCG AGCTCGAGATCTGCAGCT 3';
to form pHK12. Following restriction of pIDI with BsaAI-SmaI, agarose gel electrophoresis and GeneClean purification, the resulting blunt-ended 0.7 Kb DNA fragment containing the S. pombe IPP isomerase orf is inserted into the filled in NotI site of pTHBN1 utilizing chain reaction cloning (Pachuk et al., 2000), thermostable Ampligase® (Epicentre Technologies, Madison, Wis.), and the bridging oligonucleotides:
TABLE-US-00020 (SEQ ID NO: 46) 11) 5' TTAAATAAGGAGGAATAAACCATGGCGGCCGTAGGAGGCACAT ATGAGTTCCCAACAAGA 3'; and (SEQ ID NO: 47) 12) 5' ACCTTAATTCATCG1TGCTAAGGATCCCCCGGCCGCGATCCGA GCTCGAGATCTGCAGCT 3';
to form pHK13.
Example 14
Increased Isoprenoid Production in Cells Containing the MEP Pathway
[0197] In another exemplified embodiment, a carotenoid producing E. coli strain is utilized to demonstrate the effect of the insertion of orfs encoding the entire mevalonate pathway, or orfs encoding the entire mevalonate pathway and IPP isomerase, or an orf encoding just IPP isomerase, on production of lycopene as follows: Following the transformation of E. coli TOP10 F' (Invitrogen) with pAC-LYC (Cunningham et al., J. Bacteriol. 182:5841-5848, 2000), transformed cells are isolated on LB/Cam (30 μg/ml) plates grown at 30EC. TOP10 F'/pAC-LYC competent cells are prepared by the CaCl2 method (Sambrook et al., 1989) following growth in LB/Cam in darkness at 28EC and 225 rpm to an optical density (A600) of 0.6. Competent TOP10 F/pAC-LYC cells are transformed with one of the following plasmids: pTrcHisB; pHKO9, a pTrcHisB derivative containing the entire mevalonate pathway; pHK10, a pTrcHisB derivative containing the entire mevalonate pathway plus the orf encoding R. capsulatus IPP isomerase; pHK11, a pTrcHisB derivative containing the entire mevalonate pathway plus the orf encoding S. pombe IPP isomerase; pHK12, a pTrcHisB derivative containing the orf encoding R. capsulatus IPP isomerase; and pHK13, a pTrcHisB derivative containing the orf encoding S. pombe IPP isomerase. The bacterial strains described above, comprising pTHBN1 derivatives containing the mevalonate pathway orfs and/or an orf encoding IPP isomerase, are designated HK1, HK2, HK3, HK4, and HK5 respectively. The resulting transformants are isolated as colonies from LB/Cam/amp plates grown at 30EC. Single colonies of TOP10 F'/pAC-LYC/pTrcHisB and HK1 (TOP10 F'/pAC-LYC/pHKO9) are used to individually inoculate 4 ml LB/Cam/amp cultures and grown overnight in the dark at 28EC and 225 rpm. The cultures are serially diluted 10,000 to 100,000-fold, plated on LB/Cam/amp medium containing IPTG, and grown in the dark at rt for 2 to 10 days. The plates are visually examined for an increase in lycopene production as evident by a "darkening" of the light pink colored colonies that are present on the control plates corresponding to TOP10 F'/pAC-LYC/pTrcHisB. The same experiments are performed with strains HK2, HK3, HK4, and HK5 to determine, visually, the effect of the orfs contained within pHK10, pHK11, pHK12, and pHK13 on lycopene production in TOP10 F'/pAC-LYC cells. The quantification of the carotenoid lycopene in cells, identified as potential overproducers due to their darker color when compared to the color of TOP10 F'/pAC-LYC/pTHBN1 cells, is performed utilizing a spectrophotometric assay as described by Cunningham et al. (Cunningham et al., 2000). Increased production of lycopene in E. coli cells containing the entire mevalonate pathway or the entire mevalonate pathway plus an additional orf for IPP isomerase establishes that the presence in cells of an additional biosynthetic pathway for the formation of IPP or IPP and DMAPP enhances the production of isoprenoid compounds, such as carotenoids, that are derived from IPP and DMAPP.
Example 15
Demonstration of Antibiotic Resistance Due to the Mevalonate Pathway in MEP Pathway Dependent Cells
[0198] In still another exemplified embodiment, E. coli cells are transformed with DNA containing orfs, which in their summation comprise the entire mevalonate pathway, and the resulting cells are tested for resistance to the antibiotic fosmidomycin as follows: Following the separate transformation of E. coli TOP10 F' (Invitrogen) with pHKO2, pHKO3 and pHKO9, transformed cells are isolated on LB/Amp (50 μg/ml) plates grown at 30EC. Single colonies of TOP10 F'/pHKO2 (designated strain HK6), TOP 10 F'/pHKO3 (designated strain HK7), and TOP10 F'/pHKO9 (designated strain HK8), are used to individually inoculate 4 ml LB/amp cultures and grown overnight at 30EC, 225 rpm. The HK6 and HK7 cultures are serially diluted 10,000 to 100,000-fold and plated on LB containing fosmidomycin (20 μg/ml). The HK8 cultures are serially diluted 10,000 to 100,000-fold and plated on LB/IPTG containing fosmidomycin (20 μg/ml) Controls are performed with cells comprising TOP10 F' transformed with the parent vectors of pHKO2, pHKO3 and pHKO9, by plating on the appropriate medium containing fosmidomycin establishing that E. coli control cells are unable to grow on medium containing fosmidomycin. The ability of transformed E. coli cells to grow in the presence of the antibiotic fosmidomycin establishes that the inserted DNA, comprising the entire mevalonate pathway and thus an alternative biosynthetic route to IPP, is functional and can circumvent the inhibition of an enzyme in the trunk line of the MEP pathway.
Example 16
Construction of Plastid Transformation Vectors
[0199] In a specific, exemplified embodiment, a plant plastid transformation vector containing a synthetic operon comprising orfs, which in their summation is the entire mevalonate pathway, is constructed as follows: Plasmid pHKO3, a pBluescript derivative containing all six mevalonate pathway orfs, is assembled by restriction of pFCO1 to yield a 3.9 Kb NotI-XhoI DNA fragments containing three mevalonate orfs and its subsequent insertion into the SalI-NotI sites of pHKO1 by directional ligation as described above in Example 8. The plastid transformation vehicle, pHK14 containing the entire mevalonate pathway is constructed as follows: Plastid vector pGS104 (Serino and Maliga, Plant J. 12:687-701, 1997) is restricted with NcoI-XbaI and the two resulting DNA fragment are separated by agarose gel electrophoresis. Following isolation of the larger DNA fragment by gel excision and its purification by GeneClean, the NcoI-XbaI 5' overhangs are dephosphorylated using SAP and filled in with Klenow and dNTPs. The resulting blunt-ended, dephosphorylated DNA fragment derived from pGS104 is GeneClean purified. Following restriction of pHKO3 with EagI, isolation by agarose gel electrophoresis, and purification by GeneClean, the 7.7 Kb DNA fragment is treated with Klenow and dNTPs to fill in the 5' overhangs. The resulting blunt-ended DNA fragment containing the mevalonate pathway is purified by GeneClean and inserted into the dephosphorylated, Klenow-treated NcoI-XbaI sites of pGS104 by blunt-end ligation to yield pHK14.
[0200] Derivatives of pGS104 containing the entire mevalonate pathway plus an additional orf encoding IPP isomerase are constructed as follows: Following restriction of pHKO5 with NotI and treatment with Klenow and dNTPs, the resulting 8.2 Kb blunt-ended DNA fragment, containing the six mevalonate pathway orfs plus an orf encoding R. capsulatus IPP isomerase, is isolated by agarose gel electrophoresis, purified by GeneClean, and inserted into the dephosphorylated, filled in NcoI-XbaI sites of pGS104 by blunt-end ligation to yield pHK15. Following restriction of pHKO6 with EagI and treatment with Klenow and dNTPs, the resulting 8.4 Kb blunt-ended DNA fragment, containing the six mevalonate pathway orfs plus an orf encoding S. pombe IPP isomerase, is isolated by agarose gel electrophoresis, purified by GeneClean, and inserted into the dephosphorylated, filled in NcoI-XbaI sites of pGS104 by blunt-end ligation to yield pHK16.
[0201] Derivatives of pGS104 containing only an orf encoding IPP isomerase are constructed as follows: Following restriction of pBSIDI with BsaAI-EcoRV, agarose gel electrophoresis and GeneClean purification, the resulting blunt-ended 0.5 Kb DNA fragment containing the R. capsulatus IPP isomerase orf is inserted into the dephosphorylated, filled in NcoI-XbaI sites of pGS104 by blunt-end ligation to yield pHK17. Following restriction of pIDI with BsaAI-SmaI, agarose gel electrophoresis and GeneClean purification, the resulting blunt-ended 0.7 Kb DNA fragment containing the S. pombe IPP isomerase orf is inserted into the dephosphorylated, filled in NcoI-XbaI sites of pGS104 by blunt-end ligation to yield pHK18.
Example 17
Construction of Transplastomic Plants Containing Orfs Encoding the Mevalonate Pathway or Orfs Encoding the Mevalonate Pathway Coupled with IPP Isomerase
[0202] In another exemplified embodiment, tobacco is engineered at the plastid level by using any of the plastid transformation vectors described above, or their equivalents, such as variants of those plastid transformation vectors as can be routinely constructed by means known in the art and containing the orfs as taught and described above. Specifically, Nicotiana tabacum var. `Xanthi NC` leaf sections (1×0.5 cm strips from in vitro plants with 3 to 5 cm long leaves) are centered in the dish, top side up and bombarded with 1 μm gold micro particles (Kota et al., 1999) coated with DNA containing orfs, which in their summation comprise the entire mevalonate pathway, using a PDS 1000 He device, at 1100 psi. Toxicity is evident in tobacco after three weeks of growth on medium containing the antibiotic fosmidomycin at a concentration of at least 500 micromolar. Transplastomic plants are recovered from leaf sections cultured under lights on standard RMOP shoot regeneration medium or on a Murashige-Skoog salts shoot regeneration medium with 3% sucrose, Gamborg's B5 vitamins, 2 mg/L 6-benzylamino-purine and Phytagel (2.7 g/L), containing 500 μM fosmidomycin for the direct selection of insertion of the entire mevalonate pathway into plastids. Alternatively, the regeneration medium contains an antibiotic, e.g. spectinomycin, for selection based on antibiotic resistance due to any co-transformed gene on the transforming DNA vector, as would be readily apparent to the skilled artisan. De novo green leaf tissue is visible after three weeks. Tissue is removed to undergo a second round of selection on shoot regeneration medium with 500 μM fosmidomycin to encourage homoplasmy and plants are rooted. Genomic DNA is isolated from TO leaf tissue or T1 leaf tissue derived from in vitro germinated transplastomic seeds utilizing the DNeasy Plant Mini Kit (Qiagen Inc, Valencia, Calif.) according to the manufacturer's instructions and is subjected to analysis as is known in the art to confirm homoplasmy. The ability to select directly for a transformation event corresponding to the successful insertion of the mevalonate pathway orfs into plastids establishes the use of orfs, which in their summation comprise the entire mevalonate pathway, as a selectable marker for plastid transformation. The construction of fosmidomycin resistant plants establishes the ability of the mevalonate pathway, when functioning in plant plastids, to provide an alternate biosynthetic route to IPP, thus overcoming the effect of an inhibitor targeting an enzyme, in the trunk line of the MEP pathway.
Example 18
Metabolic Engineering in Transplastomic Solanaceae Plants
[0203] In another exemplified embodiment, Solanaceae species are engineered at the plastid level using infA pseudogene insertion of a selectable marker and orfs for expression. Specifically, leaf sections of a genetically defined white petunia (or other petunia), are engineered, as for the Solanaceous species tobacco (see Example 16), using vectors pHK04 or pHKO7, or their equivalents, for insertion of orfs encoding the entire mevalonate pathway or orfs encoding the entire mevalonate pathway and IPP isomerase. Transplastomic Solanaceae plants containing orfs encoding the entire mevalonate pathway and IPP isomerase, and containing an additional orf encoding phytoene synthase, are created by insertion of a pBSNT27 (see Example 9) derived vector, constructed as follows:
[0204] A Rhodobacter capsulatus orf encoding a polypeptide with phytoene synthase activity is isolated by PCR from genomic DNA using the primers
TABLE-US-00021 (SEQ ID NO: 65) 1) 5' GCGATATCGGATCCAGGAGGACCATATGATCGCCGAAGCGGATA TGGAGGTCTGC 3' (sense) (SEQ ID NO: 66) 2) 5' GCGATATCAAGCTTGGATCCTCAATCCATCGCCAGGCCGCGGTC GCGCGC 3' (antisense)
containing the restriction site BamHI shown underlined. The 1.1 Kb PCR product is isolated by agarose gel electrophoresis, purified by GeneClean and inserted into the pT7Blue-3 vector (Novagen) using the Perfectly Blunt (Cloning Kit (Novagen) according to the manufacturer's instructions. Sequence analysis is performed to identify constructs containing R. capsulatus DNA identical to the published DNA sequence (SEQ ID NO: 71) and are designated pPHS. Following restriction of pPHS with BamHI, isolation by agarose gel electrophoresis, and purification by GeneClean, the 1.1 Kb BamHI DNA fragment containing the orf encoding R. capsulatus phytoene synthase is inserted into the BglII site of pBSNT27 utilizing chain reaction cloning (Pachuk et al., 2000), thermostable Ampligase((Epicentre Technologies, Madison, Wis.), and the bridging oligonucleotides
TABLE-US-00022 (SEQ ID NO: 67) 3) 5' CTTTCCTGAAACATAATTTATAATCAGATCCAGGAGGACCATAT GATCGCCGAAGCGGAT 3'; and (SEQ ID NO: 68) 4) 5' CGACCGCGGCCTGGCGATGGATTGAGGATCTAAACAAACCCGGA ACAGACCGTTGGGAAG 3';
to create plastid transformation vector pFHO5. Following restriction of pFHO5 with XcmI, a unique site in the infA pseudogene, and purification by GeneClean, the resulting 3' overhangs are removed by treatment with Mung Bean nuclease and the resulting blunt-ended DNA fragment is purified by GeneClean. Vector pFHO3 is restricted with NotI and the resulting 8.3 Kb DNA fragment, containing Operon E, is isolated by agarose gel electrophoresis and purified by GeneClean. The 5' overhangs of the isolated DNA fragment are filled in with Klenow and dNTPs and the resulting blunt end DNA fragment, containing Operon E, is inserted into the Mung Bean nuclease treated XcmI site of pFHO5 utilizing chain reaction cloning (Pachuk et al., 2000), thermostable Ampligase((Epicentre Technologies, Madison, Wis.), and the bridging oligonucleotides
TABLE-US-00023 (SEQ ID NO: 69) 5) 5' ATTTTTCATCTCGAATTGTATTCCCACGAAGGCCGCGTCGACTA CGGCCGCAGGAGGAGT3'; and (SEQ ID NO: 70) 6) 5' TTCGGATCGATCCTGCGCGGCTGAGCGGCCGGAATGGTGAAGTT GAAAAACGAATCCTTC3';
to create the plastid transformation vector pFHO6 (FIG. 17).
[0205] Alternatively, an orf encoding IPP isomerase can be inserted into the XcmI site of pFHO5, utilizing skills as known in the art, to create a plastid transformation vector containing both an orf encoding phytoene synthase and an orf encoding IPP isomerase. Another alternative uses the infA pseudogene as an insertion site for orfs, encoding phytoene synthase, and/or IPP isomerase, and/or the entire mevalonate pathway, linked with the aadA gene as is known in the art for selection of transplastomic plastids on 500 microgram per liter spectinomycin.
[0206] The BioRad PDS 1000 He gene gun is used to deliver BioRad tungsten M10 (0.7 micron approx.) microspheres into petunia (Petunia hybrida `Mitchell`) leaves positioned top-side up. Intact leaves, or equivalent tissues of about 6-8 cm2 per sample are plated onto shoot regeneration medium consisting of Murashige and Skoog basal medium, B5 vitamins, 3% sucrose, 0.7% (w/v) agar and 3 mg/l BA (6-benzylamino-purine), 0.1 mg/l IAA (Deroles and Gardner, Plant Molec. Biol. 11: 355-364, 1988) in 100×10 mm plastic Petri dishes. Leaves are centered in the target zone of the gene gun for bombardment at 1100 psi, third shelf from bottom, ˜5.6 cm gap, 28 mgHg vacuum. M10 microspheres are coated with DNA using standard procedures of CaCl2 and spermidine precipitation, 1.5 to 2 ug DNA/bombardment. After bombardment, tissues are cultured in light in the presence of antibiotic (500 micromolar fosmidomycin). Each leaf sample is then cut into about 6 pieces and cultured on petunia shooting medium containing 500 micromolar fosmidomycin for 3 to 8 weeks, with subculture onto fresh medium every three weeks. Any green shoots are removed and leaves plated onto the same medium containing 500 micromolar fosmidomycin. Plantlets with at least four leaves and of solid green color (no bleaching on petioles or whorls) are transferred for rooting onto solidified hormone-free Murashige and Skoog salts with B5 vitamins and 2% sucrose and are grown to flowering. The dependency of increased carotenoid production in Solanacae on the combination of the orfs inserted, be it an orf encoding phytoene synthase alone; or orfs encoding the entire mevalonate pathway and phytoene synthase; or orfs encoding phytoene synthase, the entire mevalonate pathway and IPP isomerase; or orfs for phytoene synthase and IPP isomerase, establishes that the addition of the mevalonate pathway and/or IPP isomerase to plant plastids enhances the production of isoprenoid compounds that are derived from IPP and DMAPP; and the suitability of a pseudogene insertion site for creating transplastomic Petunia.
Example 19
Transformation of Microalgae
[0207] In a specific exemplified embodiment, chloroplast transformants are obtained by microprojectile bombardment of Chlamydomonas reinhardtii cells and subsequent selection on fosmidomycin. Specifically, a genecluster containing the complete mevalonate pathway is substituted, as a selectable marker, for the coding sequence of the aadA gene in the pUC18 derived vector containing 5-atpA:aadA:rbcL-3 (Goldschmidt-Clermont M., Nucleic Acids Res. 19:4083-4089, 1991) as follows: Plasmid pUC-atpX-AAD is restricted with NcoI, purified by GeneClean and treated with Mung Bean nuclease to remove the resulting 5' overhangs. Following GeneClean purification, the blunt ended DNA fragment is restricted with HindIII to remove the aadA orf and the remaining DNA fragment, containing approximately 653 base pairs of the C. reinhardtii atpA gene and approximately 437 base pairs of the C. reinhardtii rbcL gene (Goldschmidt-Clermont M., 1991), is isolated by agarose gel electrophoresis and purified by GeneClean. Plasmid pFHO4 is restricted with NdeI, purified by GeneClean, and the resulting 5 overhangs are filled in with Klenow and dNTPs. Following GeneClean purification, the blunt ended DNA fragment is restricted with HindIII and the resulting DNA fragment, containing Operon F (see FIG. 13), is isolated by agarose gel electrophoresis and purified by GeneClean. The blunt end-HindIII fragment is inserted into the blunt end HindIII sites of the DNA fragment isolated from pUC-atpX-AAD by ligation resulting in the orf encoding S. cerevisiae acetoacetylCoA thiolase, located at the beginning of Operon F, to be in frame with the ATG start codon of the 5atpA DNA in pUC-atpX-AAD (Goldschmidt-Clermont M., 1991). The resulting modified yeast orf only encodes 2 extra amino acids, Met and Ser, appended to the N-terminal Met of the acetoacetylCoA thiolase polypeptide encoded by Operon F. The resulting chlamydomonas plastid transformation vector is designated pHK19. About 10,000 cells are spread on TAP plates containing 200 micromolar fosmidomycin, plates are dried, and then cells are immediately bombarded with M10 or 1 micron gold particles coated with about 2 micrograms of plasmid DNA using the PDS-1000 He gene gun, 1100 psi, fourth shelf from bottom, ˜2 cm gap, ˜28 mgHg vacuum (alternatively cells are spread over a Nytran nylon 0.45 micron membrane placed on top of TAP agar and bombarded without a drying phase). Plates are incubated in low light for two to three weeks before colonies are counted. Fosmidomycin-resistant colonies are green (vs yellowish for susceptible cells) and transformants are characterized using skills as known in the art. This demonstrates use of orfs encoding the entire mevalonate pathway as a selectable marker for green algae and by virtue of its functioning demonstrates its utility for overproduction of isoprenoid metabolites in microalgae.
Example 20
Metabolic Engineering in Transplastomic Grain Crops (Rice)
[0208] In another exemplified embodiment, an operon comprising orfs encoding the entire mevalonate pathway are inserted into the plastids of rice as follows: A DNA fragment isolated from pHKO3, containing the complete mevalonate pathway, or from pFHO2, containing orfs encoding the entire mevalonate pathway and IPP isomerase, is inserted into the NcoI-XbaI sites of plasmid pMSK49 to replace the gfp coding region adjacent to the coding region for streptomycin resistance, aadA; or inserted into the BstXI-NcoI digested DNA of plasmid pMSK48 using skills as is known in the art for direct selection on fosmidomycin. The resulting plasmids contain rice-specific insertion sequences of pMSK35 as described in Khan and Maliga, Nature Biotechnology 17: 910-914, 1999. Embryonic suspensions, induced as previously described (Khan and Maliga 1999), of japonica rice Oryza sativa `Taipei 309` engineered with the beta-carotene pathway (Ye et al. Science 287:303-305) are plated into filter paper and bombarded with the PDS1000 He device as described in Example 17. After two days on non-selective medium and then one to two weeks in selective AA medium (Toriyama and Hinata, Plant Science 41: 179-183, 1985) tissue is transferred to agar solidified medium of MS salts, and vitamins, 100 mg/L myo-inositol, 4 mg/L 6-benzylaminopurine, 0.5 mg/L indoleacetic acid, 0.5 mg/L1-napthaleneacetic acide, 3% sucrose, 4% maltose and 100 mg/L streptomycin sulfate or 500 μM fosmidomycin. Transplastomic shoots appear following cultivation in the light after three weeks and leaf samples are analyzed for the operon by PCR.
REFERENCES CITED
U.S. Patent Documents
[0209] Adang et al., "Synthetic Insecticidal Crystal Protein Gene," U.S. Pat. No. 5,380,831 (1995) [0210] Chappel et al., "Process for Composition for Increasing Squalene and Sterol Accumulation in Higher Plants," U.S. Pat. No. 5,349,126 (1994) [0211] Fujimoto et al., "Synthetic Insecticidal Gene, Plants of the Genus Oryza Transformed with the Gene, and Production Thereof," U.S. Pat. No. 5,436,391 (1995) [0212] Kamuro et al. "Herbicide" U.S. Pat. No. 4,846,872 (1989)
Other References
[0212] [0213] Albrecht et al., "Novel Hydroxycarotenoids with Improved Antioxidative Properties Produced by Gene Combination in Escherichia coli," Nature Biotech. 18:843-846 (2000) [0214] Allison et al., MDMV Leader (Maize Dwarf Mosaic Virus) Virology 154:9-20 (1986) [0215] Altschul et al., J. Mol. Biol. 215:403-410 (1990) [0216] Ashby and Edwards, "Elucidation of the Deficiency in Two Yeast Coenzyme Q Mutants: Characterization of the Structural Gene Encoding Hexaprenyl Pyrophosphate Synthetase," J. Biol. Chem. 265:13157-13164 (1990) [0217] Ballas et al., Nucleic Acids Res. 17:7891-7903 (1989) [0218] Beaucage and Caruthers, Tetra. Letts., 22:1859-1862 (1981) [0219] Bock and Hagemann, "Extranuclear Inheritance: Plastid Genetic: Manipulation of Plastid Genomes and Biotechnological Application," Prog. Bot. 61:76-90 (2000) [0220] Boyton and Gillham, "Chloroplast Transformation in Chlamydomoas," Methods Enzymol. 217:510-536 (1993) [0221] Clarke, "Protein Isoprenylation and Methylation at Carboxy-terminal Cysteine Residues," Annu. Rev. Biochem. 61:355-386 (1992) [0222] Cunningham and Gantt, "Genes and Enzymes of Carotenoid Biosynthesis in Plants," Ann. Rev. Plant Mol. Biol. 39:475-502 (1998) [0223] Cunningham et al., "Evidence of a Role for LytB in the Nonmevalonate Pathway of Isoprenoid Biosyhthesis," J. Bacteriol. 182:5841-5848 (2000) [0224] Dale, P. J., "Spread of Engineered Genes to Wild Relatives," Plant Physiol. 100:13-15 (1992) [0225] Daniell et al., "Containment of Herbicide Resistance Through Genetic Engineering of the Chloroplast Genome," Nat. Biotechnol. 16:345-348 (1998) [0226] del Campo et al, Plant Physiol 114:748 (1997) [0227] Della-Cioppa et al., Plant Physiol. 84:965-968 (1987) [0228] Deroles and Gardner, "Expression and Inheritance of Kanamycin Resistance in a large Number of Transgenic Petunias Generated by Agrobacterium-Mediated Transformation," Plant Molec. Biol. 11: 355-364 (1988) [0229] Eisenreich et al., "The Deoxyxylulose Phosphate Pathway of Terpenoid Biosynthesis in Plants and Microorganisms," Chemistry and Biology 5:R221-R233 (1998) [0230] Elroy-Stein et al., PNAS USA 86:6126-6130 (1989) [0231] Gallie et al., in Molecular Biology of RNA, ed. Cech, (Liss, New York) 237-256 (1989) [0232] Garrett et al., "Accumulation of a Lipid A Precursor Lacking the 4'-Phosphate following Inactivation of the Escherichia coli 1pxK Gene," J. Biol. Chem. 273:12457-12465 (1998) [0233] Goldschmidt-Clermont M., "Transgenic Expression of Aminoglycoside Adenine Transferase in the Chloroplast: A Selectable Marker for Site-directed Transformation of Chlamydomonas," Nucleic Acids Res.19:4083-4089 (1991) [0234] Goodwin, "Biosynthesis of Carotenoids and Plant Triterpenes: the Fifth CIBA Medal Lecture," Biochem. J. 123:293-329 (1971) [0235] Guda et al., "Stable Expression for a Biodegradable Protein Based Polymer in Tobacco Chloroplasts," Plant Cell Reports 19:257-262 (2000) [0236] Guerineau et al., Mol. Gen. Genet. 262:141-144 (1991) [0237] Hahn et al., "1-Deoxy-D-Xylulose 5-Phosphate Synthase, the Gene Product of Open Reading Frame (ORF) 2816 and ORF2895 in Rhodobacter capsulatus," J. Bacteriol. 183:1-11 (2001) [0238] Hahn and Poulter, "Isolation of Schizosaccharomyces pombe Isopentenyl Diphosphate Isomerase cDNA Clones by Complementation and Synthesis of the Enzyme in Escherichia coli," J. Biol. Chem. 270:11298-11303 (1995) [0239] Hahn et al., `Escherichia coli Open Reading Frame 696 Is idi, a Nonessential Gene Encoding Isopentenyl Diphosphate Isomerase," J. Bacteriol. 181:4499-4504 (1999) [0240] Hahn et al., "Open Reading Frame 176 in the Photosynthesis Gene Cluster of Rhodobacter capsulatus Encodes idi, a Gene for Isopentenyl Diphosphate Isomerase," J. Bacteriol. 178:619-624 (1996) [0241] Hamilton et al., "New Method for Generating Deletions and Gene Replacements in Escherichia coli," J. Bacteriol. 171:4617-4622 (1989) [0242] Harker and Bramley, "Expression of Prokaryotic 1-Deoxy-D-Xylulose 5-Phosphates in Escherichia coli Increases Carotenoid and Ubiquinone Biosynthesis," FEBS Letters 448:115-119 (1999) [0243] Herz et al., "Biosynthesis of Terpenoids: YgbB Protein Converts 4-Diphosphocytidyl-2C-Methyl-D-Erythritol 2-Phosphate to 2C-Methyl-D-Erythritol 2,4-Cyclodiphosphate," Proc. Natl. Acad. Sci. USA 97:2486-2490 (2000) [0244] Jobling et al., Nature 325:622-625 (1987) [0245] Joshi et al., Nucleic Acid Res. 15:9627-9639 (1987) [0246] Kajiwara et al., "Expression of an Exogenous Isopentenyl Diphosphate Isomerase Gene Enhances Isoprenoid Biosynthesis in Escherichia coli," Biochem. J. 324:421-426 (1997) [0247] Kavanagh et al., "Homeologous Plastid DNA Transformation in Tobacco is Mediated by Multiple Recombination Events," Genetics 152:1111-1122 (1999) [0248] Keeler et al., "Movement of Crop Transgenes into Wild Plants," in Herbicide Resistant Crops: Agricultural, Economic, Environmental, Regulatory and Technological Aspects, (S. O. Duke, ed.) CRC Press, Boca Rotan, Fla., pp 303-330 (1996) [0249] Khan and Maliga, "Fluorescent Antibiotic Resistance Marker for Tracking Plastid Transformation in Higher Plants," Nature Biotech. 17:910-914 (1999) [0250] Kota et al., "Overexpression of the Bacilllus thuringiensis (Bt) Cry2Aa2 Protein in Chloroplasts Confers Resistance to Plants Against Susceptible and Bt-resistant Insects," Proc. Natl. Acad. Sci. USA 96:1840-1845 (1999) [0251] Kunkel, Proc. Natl. Acad. Sci. USA 82:488-492 (1985) [0252] Kunkel et al., Methods and Enzymol; 154:367-382 (1987) [0253] Kuzuyama et al., "Direct Formation of 2-C-Methyl-D-Erythritol 4-Phosphate by 1-Deoxy-D-Xylulose 5-Phosphate Reductoisomerase, a New Enzyme in the Non-Mevalonate Pathway to Isopentenyl Diphosphate, Tetrahedron Lett. 39:4509-4512 (1998) [0254] Kuzuyama et al., "Fosmidomycin, a Specific Inhibitor of 1-Deoxy-D-Xylulose 5-Phosphate Reductoisomerase in the Nonmevalonate Pathway for Terpenoid Biosynthesis," Tetrahedron Lett. 39:7913-7916 (1998) [0255] Kuzuyama et al., "An Unusual Isopentenyl Diphosphate Isomerase Found in the Mevalonate Pathway Gene Cluster from Streptomyces sp. strain CL190," Proc. Natl. Acad. Sc.i USA 98:932-7 (2001) [0256] Lange and Croteau, "Isopentenyl diphosphate biosynthesis via a mevalonate independent pathway: Isopentenyl monophosphate kinase catalyzes the terminal enzymatic step," Proc. Natl. Acad. Sci. USA 96:13714-13719 (1999) [0257] Lichtenthaler et al., "Biosynthesis of Isoprenoids in Higher Plant Chloroplasts Proceeds via a Mevalonate-Independent Pathway," FEBS Letters 400:271-274 (1997) [0258] Lois et al, "Cloning and Characterization of a Gene from Escherichia coli Encoding a Transketolase-Like Enzyme that Catalyzes the Synthesis of D-1-Deoxyxylulose 5-Phosphate, a Common Precursor for Isoprenoid, Thiamin, and Pyridoxol Biosynthesis," Proc. Natl. Acad. Sci. USA 95:2105-2110 (1998) [0259] Lommel et al., Virology 81:382-385 (1991) [0260] Luttgen et al., "Biosynthesis of Terpenoids: YchB Protein of Escherichia coli Phosphorylates the 2-Hydroxy Group of 4-Diphosphocytidyl-2-C-Methyl-D-Erythritol," Proc. Natl. Acad. Sci. USA 97:1062-1067 (2000) [0261] Macejak et al., Nature 353:90-94 (1991) [0262] Mann et al., "Metabolic Engineering of Astaxanthin Production in Tobacco Flowers," Nature Biotech. 18:888-892 (2000) [0263] Martin et al., "Gene Transfer to the Nucleus and the Evolution of Chloroplasts," Nature 393:162-165 (1998) [0264] Matsuoka et al., "Variable Product Specificity of Microsomal Dehydrodolichyl Diphosphate Synthase from Rat Liver," J. Biol. Chem. 266:3464-3468 (1991) [0265] Matteuci et al., J. Am. Chem. Soc., 103: 3185 (1981) [0266] Meinkoth and Wahl, Anal. Biochem. 138:267-284 (1984) [0267] Meyer and Saedler, "Homology-Dependent Gene Silencing in Plants," Ann. Rev. Plant. Physiol. Mol. Biol. 47:23-48 (1996) [0268] Millen et al., "Many Parallel Losses of infA from Chloroplast DNA During Angiosperm Evolution with Multiple Independent Transfers to the Nucleus," Plant Cell 13: 645-658 (2001) [0269] Mogen et al., Plant Cell 2:1261-1272 (1990) [0270] Munroe et al., Gene 91:151-158 (1990) [0271] Murray et al., Nucleic Acids Res. 17:477-498 (1989) [0272] Needleman et al., J. Mol. Biol. 48:443 (1970) [0273] Newman et al., "Genes Galore: A Summary of Methods for Accessing Results from Large-Scale Partial Sequencing of Anonymous Arabidopsis cDNA Clones," Plant Physiology 106:1241-1255 (1994) [0274] Nielsen and Bloor, "Analysis and Developmental Profile of Carotenoid Pigments in Petals of Three Yellow Petunia Cultivars," Scientia Hort. 71:257-266 (1997) [0275] Pachuk et al., Gene 243:19-25 (2000) [0276] Pearson et al., Proc. Natl. Acad. Sci. 85:2444 (1988) [0277] Popjak, "Natural Substances Formed Biologically from Mevalonic Acid," Biochemical symposium no. 29 (T. W. Goodwin, ed.) Academic Press, New York, pp 17-37 (1970) [0278] Proudfoot, Cell 64:671-674 (1991) [0279] Ramos-Valdivia et al., "Isopentenyl Diphosphate Isomerase: A Core Enzyme in Isoprenoid Biosynthesis: A Review of its Biochemistry and Function," Nat. Prod. Rep. 6:591-603 (1997) [0280] Rohdich et al., "Cytidine 5'-Triphosphate-Dependent Biosynthesis of Isoprenoids: YgbP Protein of Escherichia coli Catalyzes the Formation of 4-Diphosphocytidyl-2-C-methylerythritol," Proc. Natl. Acad. Sci. USA 96:11758-11763 (1999) [0281] Sambrook et al., "Molecular Cloning: A Laboratory Manual," 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) [0282] Sanfacon et al., Genes Dev. 5:141-149 (1991) [0283] Serino and Maliga, "A Negative Selection Scheme Based on the Expression of Cytosine Deaminase in Plastids," Plant J. 12:687-701 (1997) [0284] Smith et al., Adv. Appl. Math. 2:482 (1981) [0285] Sprenger et al., "Identification of a Thiamin-Dependent. Synthase in Escherichia coli Required for the Formation of the 1-Deoxy-D-Xylulose 5-Phosphate Precursor to Isoprenoids, Thiamin, and Pyridoxol," Proc. Natl. Acad. Sci. USA 94:12857-12862 (1997) [0286] Stevens and Burton, "Genetic Engineering of Eukaryotic Algae: Progress and prospects," J. Phycol 33:713-722 (1997) [0287] Sugiura, M., "Direct submission to the EMBL/GenBank/DDBJ databases, bases 1-155939," (1986) [0288] Takagi et al., "A Gene Cluster for the Mevalonate Pathway from Streptomyces sp Strain CL190," J. Bacteriol. 182:4153-4157 (2000) [0289] Takahashi, et al., "Purification, Characterization, and Cloning of a Eubacterial 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase, a Key Enzyme Involved in Biosynthesis of Terpenoids," J. Bacteriol. 181:1256-1263 (1999) [0290] Toriyama and Hinata, "Cell Suspension and Protoplast Culture in Rice," Plant Science 41:179-183 (1985) [0291] Tsudsuki, T., "Direct submission, bases 1-155939. Data Processing Center, Aichi-Gakuin University, Aichi, Japan," (1998) [0292] Vasil et al., in Cell Culture and Somatic Cell Genetics of Plants, Vols. I, II, and III, Laboratory Procedures and Their Applications (Academic press) (1984) [0293] Weissbach et al., Methods for Plant Mol. Biol. (1989) [0294] Ye et al., Science 287:303-30 (2000)
Sequence CWU
1
76157DNAArtificial SequencePCR primer containing Saccharomyces cerevisiae
DNA 1ggactagtct gcaggaggag ttttaatgtc attaccgttc ttaacttctg caccggg
57296DNAArtificial SequencePCR primer containing S. cerevisiae DNA
2ttctcgagct taagagtagc aatatttacc ggagcagtta cactagcagt atatacagtc
60attaaaactc ctcctgtgaa gtccatggta aattcg
96356DNAArtificial SequencePCR primer containing S. cerevisiae DNA
3tagcggccgc aggaggagtt catatgtcag agttgagagc cttcagtgcc ccaggg
56436DNAArtificial SequencePCR primer containing S. cerevisiae DNA
4tttctgcagt ttatcaagat aagtttccgg atcttt
36541DNAArtificial SequencePCR primer containing S. cerevisiae DNA
5ggaattcatg accgtttaca cagcatccgt taccgcaccc g
41645DNAArtificial SequencePCR primer containing S. cerevisiae DNA
6ggctcgagtt aaaactcctc ttcctttggt agaccagtct ttgcg
45768DNAArtificial SequencePCR primer containing Arabidopsis thaliana DNA
7gctctagatg cgcaggaggc acatatggcg aagaacgttg ggattttggc tatggatatc
60tatttccc
68861DNAArtificial SequencePCR primer containing A. thaliana DNA
8cgctcgagtc gacggatcct cagtgtccat tggctacaga tccatcttca cctttcttgc
60c
61972DNAArtificial SequencePCR primer containing A. thaliana DNA
9ccgctcgagc acgtggaggc acatatgcaa tgctgtgaga tgcctgttgg atacattcag
60attcctgttg gg
721071DNAArtificial SequencePCR primer containing A. thaliana DNA
10ggggtacctg cggccggatc ccgggtcatg ttgttgttgt tgtcgttgtc gttgctccag
60agatgtctcg g
711174DNAArtificial SequencePCR primer containing S. cerevisiae DNA
11acaacaccgc ggcggccgcg tcgacgccgg cggaggcaca tatgtctcag aacgtttaca
60ttgtatcgac tgcc
741253DNAArtificial SequencePCR primer containing S. cerevisiae DNA
12gctctagagg atcctcatat cttttcaatg acaatagagg aagcaccacc acc
531365DNAArtificial SequenceOligonucleotide containing S. cerevisiae DNA
13gctctagata cgtaggaggc acatatgagt gagcttatac ccgcctgggt tggtgacaga
60ctggc
651461DNAArtificial SequenceOligonucleotide containing A. thaliana and S.
cerevisiae DNA 14cgctcgagcc cgggggatcc tcagccgcgc aggatcgatc
cgaaaatccg gtcaagatgg 60c
611572DNAArtificial SequenceOligonucleotide
containing S. cerevisiae DNA 15gctctagata cgtaggaggc acatatgagt
tcccaacaag agaaaaagga ttatgatgaa 60gaacaattaa gg
721659DNAArtificial
SequenceOligonucleotide containing S. cerevisiae DNA 16cgctcgagcc
cgggggatcc ttagcaacga tgaattaagg tatcttggaa ttttgacgc
59176215DNAArtificial Sequencemisc_feature()..()Vector pBSNT27 containing
Nicotiana tabacum DNA 17gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt
atttttctaa atacattcaa 60atatgtatcc gctcatgaga caataaccct gataaatgct
tcaataatat tgaaaaagga 120agagtatgag tattcaacat ttccgtgtcg cccttattcc
cttttttgcg gcattttgcc 180ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa
agatgctgaa gatcagttgg 240gtgcacgagt gggttacatc gaactggatc tcaacagcgg
taagatcctt gagagttttc 300gccccgaaga acgttttcca atgatgagca cttttaaagt
tctgctatgt ggcgcggtat 360tatcccgtat tgacgccggg caagagcaac tcggtcgccg
catacactat tctcagaatg 420acttggttga gtactcacca gtcacagaaa agcatcttac
ggatggcatg acagtaagag 480aattatgcag tgctgccata accatgagtg ataacactgc
ggccaactta cttctgacaa 540cgatcggagg accgaaggag ctaaccgctt ttttgcacaa
catgggggat catgtaactc 600gccttgatcg ttgggaaccg gagctgaatg aagccatacc
aaacgacgag cgtgacacca 660cgatgcctgt agcaatggca acaacgttgc gcaaactatt
aactggcgaa ctacttactc 720tagcttcccg gcaacaatta atagactgga tggaggcgga
taaagttgca ggaccacttc 780tgcgctcggc ccttccggct ggctggttta ttgctgataa
atctggagcc ggtgagcgtg 840ggtctcgcgg tatcattgca gcactggggc cagatggtaa
gccctcccgt atcgtagtta 900tctacacgac ggggagtcag gcaactatgg atgaacgaaa
tagacagatc gctgagatag 960gtgcctcact gattaagcat tggtaactgt cagaccaagt
ttactcatat atactttaga 1020ttgatttaaa acttcatttt taatttaaaa ggatctaggt
gaagatcctt tttgataatc 1080tcatgaccaa aatcccttaa cgtgagtttt cgttccactg
agcgtcagac cccgtagaaa 1140agatcaaagg atcttcttga gatccttttt ttctgcgcgt
aatctgctgc ttgcaaacaa 1200aaaaaccacc gctaccagcg gtggtttgtt tgccggatca
agagctacca actctttttc 1260cgaaggtaac tggcttcagc agagcgcaga taccaaatac
tgtccttcta gtgtagccgt 1320agttaggcca ccacttcaag aactctgtag caccgcctac
atacctcgct ctgctaatcc 1380tgttaccagt ggctgctgcc agtggcgata agtcgtgtct
taccgggttg gactcaagac 1440gatagttacc ggataaggcg cagcggtcgg gctgaacggg
gggttcgtgc acacagccca 1500gcttggagcg aacgacctac accgaactga gatacctaca
gcgtgagcta tgagaaagcg 1560ccacgcttcc cgaagggaga aaggcggaca ggtatccggt
aagcggcagg gtcggaacag 1620gagagcgcac gagggagctt ccagggggaa acgcctggta
tctttatagt cctgtcgggt 1680ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc
gtcagggggg cggagcctat 1740ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc
cttttgctgg ccttttgctc 1800acatgttctt tcctgcgtta tcccctgatt ctgtggataa
ccgtattacc gcctttgagt 1860gagctgatac cgctcgccgc agccgaacga ccgagcgcag
cgagtcagtg agcgaggaag 1920cggaagagcg cccaatacgc aaaccgcctc tccccgcgcg
ttggccgatt cattaatgca 1980gctggcacga caggtttccc gactggaaag cgggcagtga
gcgcaacgca attaatgtga 2040gttagctcac tcattaggca ccccaggctt tacactttat
gcttccggct cgtatgttgt 2100gtggaattgt gagcggataa caatttcaca caggaaacag
ctatgaccat gattacgcca 2160agctcgaaat taaccctcac taaagggaac aaaagctgga
gctccaccgc ggtggcggcc 2220gctctagaac tagtggatct tcttggctgt tattcaaaag
gtccaacaat gtatatatat 2280tggacatttt gaggcaatta tagatcctgg aaggcaattc
tgattggtca ataaaaatcg 2340atttcaatgc tatttttttt ttgtttttta tgagtttagc
caatttatca tgaaaggtaa 2400aaggggataa aggaaccgtg tgttgattgt cctgtaaata
taagttgtct tcctccatat 2460gtaaaaaggg aataaataaa tcaattaaat ttcgggatgc
ttcatgaagt gcttctttcg 2520gagttaaact tccgtttgtc catatttcga gaaaaagtat
ctcttgtttt tcattcccat 2580tcccataaga atgaatacta tgattcgcgt ttcgaacagg
catgaataca gcatctatag 2640gataacttcc atcttgaaag ttatgtggcg tttttataag
atatccacga tttctctcta 2700tttgtaatcc aatacaaaaa tcaattggtt ccgttaaact
ggctatatgt tgtgtattat 2760caacgatttc tacataaggc ggcaagatga tatcttgggc
agttacagat ccaggaccct 2820tgacacaaat agatgcgtca gaagttccat atagattact
tcttaatata atttctttca 2880aattcattaa aatttcatgt accgattctt gaatgcccgt
tatggtagaa tattcatgtg 2940ggactttctc agattttaca cgtgtgatac atgttccttc
tatttctcca agtaaagctc 3000ttcgcatcgc aatgcctatt gtgtcggctt ggcctttcat
aagtggagac agaataaagc 3060gtccataata aaggcgttta ctgtctgttc ttgattcaac
acacttccac tgtagtgtcc 3120gagtagatac tgttactttc tctcgaacca tagtactatt
atttgattag atcatcgaat 3180cttttatttc tcttgagatt tcttcaatgt tcagttctac
acacgtcttt ttttcggagg 3240tctacagcca ttatgtggca taggagttac atcccgtacg
aaagttaata gtataccact 3300tcgacgaata gctcgtaatg ctgcatctct tccgagaccg
ggacctttta tcatgacttc 3360tgctcgttgc ataccttgat ccactactgt acggatagcg
tttgctgctg cggtttgagc 3420agcaaacggt gttcctcttc tcgtaccttt gaatccagaa
gtaccggcgg aggaccaaga 3480aactactcga ccccgtacat ctgtaacagt gacaatggta
ttattgaaac ttgcttgaac 3540atgaataact ccctttggta ttctacgtgc acccttacgt
gaaccaatac gtccattcct 3600acgcgaacta attttcggta tagcttttgc catattttat
catctcgtaa atatgagtca 3660gagatatatg gatatatcca tttcatgtca aaacagattc
tttatttgta catcggctct 3720tctggcaagt ctgattatcc ctgtctttgt ttatgtctcg
ggttggaaca aattactata 3780attcgtcccc gcctacggat tagtcgacat ttttcacaaa
ttttacgaac ggaagctctt 3840attttcatat ttctcattcc ttaccttaat tctgaatcta
tttcttggaa gaaaataagt 3900ttcttgaaat ttttcatctc gaattgtatt cccacgaaag
gaatggtgaa gttgaaaaac 3960gaatccttca aatctttgtt gtggagtcga taaattatac
gccctttggt tgaatcataa 4020ggacttactt caattttgac tctatctcct ggcagtatcc
gtataaaact atgccggatc 4080tttcctgaaa cataatttat aatcagatct aaacaaaccc
ggaacagacc gttgggaagc 4140gattcagtaa ttaaagcttc atgactcctt tttggttctt
aaagtccctt tgaggtatca 4200actaataaga aagatattag acaacccccc ttttttcttt
ttcacaaata ggaagtttcg 4260aatccaattt ggatattaaa aggattacca gatataacac
aaaatctctc cacctattcc 4320ttctagtcga gcctctcggt ctgtcattat acctcgagaa
gtagaaagaa ttacaatccc 4380cattccacct aaaattcgcg gaattcgttg ataattagaa
tagattcgta gaccaggtcg 4440actgattcgt tttaaattta aaatatttct atagggtctt
ttcctattcc ttctatgtcg 4500cagggttaaa accaaaaaat atttgttttt ttctcgatgt
tttctcacgt tttcgataaa 4560accttctcgt aaaagtattt gaacaatatt ttcggtaata
ttagtagatg ctattcgaac 4620cacccttttt cgatccatat cagcatttcg tatagaagtt
attatctcag caatagtgtc 4680cctacccatg atgaactaaa attattgggg cctccaaatt
tgatataatc aacgtgtttt 4740ttacttattt tttttttgaa tatgatatga attattaaag
atatatgcgt gagacacaat 4800ctactaatta atctatttct ttcaaatacc ccactagaaa
cagatcacaa tttcatttta 4860taatacctcg ggagctaatg aaactatttt agtaaaattt
aattctctca attcccgggc 4920gattgcacca aaaattcgag ttccttttga tttccttcct
tcttgatcaa taacaactgc 4980agcattgtca tcatatcgta ttatcatccc gttgtcacgt
ttgagttctt tacaggtccg 5040cacaattaca gctctgacta cttctgatct ttctaggggc
atatttggta cggcttcttt 5100gatcacagca acaataacgt caccaatatg agcatatcga
cgattgctag ctcctatgat 5160tcgaatacac atcaattctc gagccccgct gttatccgct
acatttaaat gggtctgagg 5220ttgaatcatt tttttaatcc gttctttgaa tgcaaagggc
gaagaaaaaa aagaaatatt 5280tttgtccaaa aaaaaagaaa catgcggttt cgtttcatat
ctaagagccc tttccgcatt 5340tttttctatt acattacgaa ataatgaatt gagttcgtat
aggcatttta gatgctgcta 5400gtgaaatagc ccttctggct atattttctg ttactccacc
catttcataa agtattcgac 5460ccggtttaac aacagctacc caatattcag gggatccccc
gggctgcagg aattcgatat 5520caagcttatc gataccgtcg acctcgaggg ggggcccggt
acccaattcg ccctatagtg 5580agtcgtatta caattcactg gccgtcgttt tacaacgtcg
tgactgggaa aaccctggcg 5640ttacccaact taatcgcctt gcagcacatc cccctttcgc
cagctggcgt aatagcgaag 5700aggcccgcac cgatcgccct tcccaacagt tgcgcagcct
gaatggcgaa tgggacgcgc 5760cctgtagcgg cgcattaagc gcggcgggtg tggtggttac
gcgcagcgtg accgctacac 5820ttgccagcgc cctagcgccc gctcctttcg ctttcttccc
ttcctttctc gccacgttcg 5880ccggctttcc ccgtcaagct ctaaatcggg ggctcccttt
agggttccga tttagtgctt 5940tacggcacct cgaccccaaa aaacttgatt agggtgatgg
ttcacgtagt gggccatcgc 6000cctgatagac ggtttttcgc cctttgacgt tggagtccac
gttctttaat agtggactct 6060tgttccaaac tggaacaaca ctcaacccta tctcggtcta
ttcttttgat ttataaggga 6120ttttgccgat ttcggcctat tggttaaaaa atgagctgat
ttaacaaaaa tttaacgcga 6180attttaacaa aatattaacg cttacaattt aggtg
6215181332DNAArtificial SequenceOligonucleotide
containing N. tabacum and S. cerevisiae DNA 18atgtcattac cgttcttaac
ttctgcaccg ggaaaggtta ttatttttgg tgaacactct 60gctgtgtaca acaagcctgc
cgtcgctgct agtgtgtctg cgttgagaac ctacctgcta 120ataagcgagt catctgcacc
agatactatt gaattggact tcccggacat tagctttaat 180cataagtggt ccatcaatga
tttcaatgcc atcaccgagg atcaagtaaa ctcccaaaaa 240ttggccaagg ctcaacaagc
caccgatggc ttgtctcagg aactcgttag tcttttggat 300ccgttgttag ctcaactatc
cgaatccttc cactaccatg cagcgttttg tttcctgtat 360atgtttgttt gcctatgccc
ccatgccaag aatattaagt tttctttaaa gtctacttta 420cccatcggtg ctgggttggg
ctcaagcgcc tctatttctg tatcactggc cttagctatg 480gcctacttgg gggggttaat
aggatctaat gacttggaaa agctgtcaga aaacgataag 540catatagtga atcaatgggc
cttcataggt gaaaagtgta ttcacggtac cccttcagga 600atagataacg ctgtggccac
ttatggtaat gccctgctat ttgaaaaaga ctcacataat 660ggaacaataa acacaaacaa
ttttaagttc ttagatgatt tcccagccat tccaatgatc 720ctaacctata ctagaattcc
aaggtctaca aaagatcttg ttgctcgcgt tcgtgtgttg 780gtcaccgaga aatttcctga
agttatgaag ccaattctag atgccatggg tgaatgtgcc 840ctacaaggct tagagatcat
gactaagtta agtaaatgta aaggcaccga tgacgaggct 900gtagaaacta ataatgaact
gtatgaacaa ctattggaat tgataagaat aaatcatgga 960ctgcttgtct caatcggtgt
ttctcatcct ggattagaac ttattaaaaa tctgagcgat 1020gatttgagaa ttggctccac
aaaacttacc ggtgctggtg gcggcggttg ctctttgact 1080ttgttacgaa gagacattac
tcaagagcaa attgacagct tcaaaaagaa attgcaagat 1140gattttagtt acgagacatt
tgaaacagac ttgggtggga ctggctgctg tttgttaagc 1200gcaaaaaatt tgaataaaga
tcttaaaatc aaatccctag tattccaatt atttgaaaat 1260aaaactacca caaagcaaca
aattgacgat ctattattgc caggaaacac gaatttacca 1320tggacttcat aa
1332191191DNAArtificial
SequenceOligonucleotide containing N. tabacum and A. thaliana DNA
19atgaccgttt acacagcatc cgttaccgca cccgtcaaca tcgcaaccct taagtattgg
60gggaaaaggg acacgaagtt gaatctgccc accaattcgt ccatatcagt gactttatcg
120caagatgacc tcagaacgtt gacctctgcg gctactgcac ctgagtttga acgcgacact
180ttgtggttaa atggagaacc acacagcatc gacaatgaaa gaactcaaaa ttgtctgcgc
240gacctacgcc aattaagaaa ggaaatggaa tcgaaggacg cctcattgcc cacattatct
300caatggaaac tccacattgt ctccgaaaat aactttccta cagcagctgg tttagcttcc
360tccgctgctg gctttgctgc attggtctct gcaattgcta agttatacca attaccacag
420tcaacttcag aaatatctag aatagcaaga aaggggtctg gttcagcttg tagatcgttg
480tttggcggat acgtggcctg ggaaatggga aaagctgaag atggtcatga ttccatggca
540gtacaaatcg cagacagctc tgactggcct cagatgaaag cttgtgtcct agttgtcagc
600gatattaaaa aggatgtgag ttccactcag ggtatgcaat tgaccgtggc aacctccgaa
660ctatttaaag aaagaattga acatgtcgta ccaaagagat ttgaagtcat gcgtaaagcc
720attgttgaaa aagatttcgc cacctttgca aaggaaacaa tgatggattc caactctttc
780catgccacat gtttggactc tttccctcca atattctaca tgaatgacac ttccaagcgt
840atcatcagtt ggtgccacac cattaatcag ttttacggag aaacaatcgt tgcatacacg
900tttgatgcag gtccaaatgc tgtgttgtac tacttagctg aaaatgagtc gaaactcttt
960gcatttatct ataaattgtt tggctctgtt cctggatggg acaagaaatt tactactgag
1020cagcttgagg ctttcaacca tcaatttgaa tcatctaact ttactgcacg tgaattggat
1080cttgagttgc aaaaggatgt tgccagagtg attttaactc aagtcggttc aggcccacaa
1140gaaacaaacg aatctttgat tgacgcaaag actggtctac caaaggaata a
1191201197DNAArtificial SequencePCR primer containing Rhodobacter
capsulatus DNA 20atgtctcaga acgtttacat tgtatcgact gccagaaccc
caattggttc attccagggt 60tctctatcct ccaagacagc agtggaattg ggtgctgttg
ctttaaaagg cgccttggct 120aaggttccag aattggatgc atccaaggat tttgacgaaa
ttatttttgg taacgttctt 180tctgccaatt tgggccaagc tccggccaga caagttgctt
tggctgccgg tttgagtaat 240catatcgttg caagcacagt taacaaggtc tgtgcatccg
ctatgaaggc aatcattttg 300ggtgctcaat ccatcaaatg tggtaatgct gatgttgtcg
tagctggtgg ttgtgaatct 360atgactaacg caccatacta catgccagca gcccgtgcgg
gtgccaaatt tggccaaact 420gttcttgttg atggtgtcga aagagatggg ttgaacgatg
cgtacgatgg tctagccatg 480ggtgtacacg cagaaaagtg tgcccgtgat tgggatatta
ctagagaaca acaagacaat 540tttgccatcg aatcctacca aaaatctcaa aaatctcaaa
aggaaggtaa attcgacaat 600gaaattgtac ctgttaccat taagggattt agaggtaagc
ctgatactca agtcacgaag 660gacgaggaac ctgctagatt acacgttgaa aaattgagat
ctgcaaggac tgttttccaa 720aaagaaaacg gtactgttac tgccgctaac gcttctccaa
tcaacgatgg tgctgcagcc 780gtcatcttgg tttccgaaaa agttttgaag gaaaagaatt
tgaagccttt ggctattatc 840aaaggttggg gtgaggccgc tcatcaacca gctgatttta
catgggctcc atctcttgca 900gttccaaagg ctttgaaaca tgctggcatc gaagacatca
attctgttga ttactttgaa 960ttcaatgaag ccttttcggt tgtcggtttg gtgaacacta
agattttgaa gctagaccca 1020tctaaggtta atgtatatgg tggtgctgtt gctctaggtc
acccattggg ttgttctggt 1080gctagagtgg ttgttacact gctatccatc ttacagcaag
aaggaggtaa gatcggtgtt 1140gccgccattt gtaatggtgg tggtggtgct tcctctattg
tcattgaaaa gatatga 1197211386DNAArtificial SequencePCR primer
containing R. capsulatus DNA 21atggcgaaga acgttgggat tttggctatg
gatatctatt tccctcccac ctgtgttcaa 60caggaagctt tggaagcaca tgatggagca
agtaaaggga aatacactat tggacttggc 120caagattgtt tagctttttg cactgagctt
gaagatgtta tctctatgag tttcaatgcg 180gtgacatcac tttttgagaa gtataagatt
gaccctaacc aaatcgggcg tcttgaagta 240ggaagtgaga ctgttattga caaaagcaag
tccatcaaga ccttcttgat gcagctcttt 300gagaaatgtg gaaacactga tgtcgaaggt
gttgactcga ccaatgcttg ctatggtgga 360actgcagctt tgttaaactg tgtcaattgg
gttgagagta actcttggga tggacgttat 420ggcctcgtca tttgtactga cagcgcggtt
tatgcagaag gacccgcaag gcccactgga 480ggagctgcag cgattgctat gttgatagga
cctgatgctc ctatcgtttt cgaaagcaaa 540ttgagagcaa gccacatggc tcatgtctat
gacttttaca agcccaatct tgctagcgag 600tacccggttg ttgatggtaa gctttcacag
acttgctacc tcatggctct tgactcctgc 660tataaacatt tatgcaacaa gttcgagaag
atcgagggca aagagttctc cataaatgat 720gctgattaca ttgttttcca ttctccatac
aataaacttg tacagaaaag ctttgctcgt 780ctcttgtaca acgacttctt gagaaacgca
agctccattg acgaggctgc caaagaaaag 840ttcacccctt attcatcttt gacccttgac
gagagttacc aaagccgtga tcttgaaaag 900gtgtcacaac aaatttcgaa accgttttat
gatgctaaag tgcaaccaac gactttaata 960ccaaaggaag tcggtaacat gtacactgct
tctctctacg ctgcatttgc ttccctcatc 1020cacaataaac acaatgattt ggcgggaaag
cgggtggtta tgttctctta tggaagtggc 1080tccaccgcaa caatgttctc attacgcctc
aacgacaata agcctccttt cagcatttca 1140aacattgcat ctgtaatgga tgttggcggt
aaattgaaag ctagacatga gtatgcacct 1200gagaagtttg tggagacaat gaagctaatg
gaacataggt atggagcaaa ggactttgtg 1260acaaccaagg agggtattat agatcttttg
gcaccgggaa cttattatct gaaagaggtt 1320gattccttgt accggagatt ctatggcaag
aaaggtgaag atggatctgt agccaatgga 1380cactga
1386221779DNAArtificial SequencePCR
primer containing Schizosaccharomyces pombe DNA 22atggatctcc
gtcggaggcc tcctaaacca ccggttacca acaacaacaa ctccaacgga 60tctttccgtt
cttatcagcc tcgcacttcc gatgacgatc atcgtcgccg ggctacaaca 120attgctcctc
caccgaaagc atccgacgcg cttcctcttc cgttatatct cacaaacgcc 180gttttcttca
cgctcttctt ctccgtcgcg tattacctcc tccaccggtg gcgtgacaag 240atccgttaca
atacgcctct tcacgtcgtc actatcacag aactcggcgc cattattgct 300ctcatcgctt
cgtttatcta tctcctaggg ttttttggta ttgactttgt tcagtcattt 360atctcacgtg
cctctggtga tgcttgggat ctcgccgata cgatcgatga tgatgaccac 420cgccttgtca
cgtgctctcc accgactccg atcgtttccg ttgctaaatt acctaatccg 480gaacctattg
ttaccgaatc gcttcctgag gaagacgagg agattgtgaa atcggttatc 540gacggagtta
ttccatcgta ctcgcttgaa tctcgtctcg gtgattgcaa aagagcggcg 600tcgattcgtc
gtgaggcgtt gcagagagtc accgggagat cgattgaagg gttaccgttg 660gatggatttg
attatgaatc gattttgggg caatgctgtg agatgcctgt tggatacatt 720cagattcctg
ttgggattgc tggtccattg ttgcttgatg gttatgagta ctctgttcct 780atggctacaa
ccgaaggttg tttggttgct agcactaaca gaggctgcaa ggctatgttt 840atctctggtg
gcgccaccag taccgttctt aaggacggta tgacccgagc acctgttgtt 900cggttcgctt
cggcgagacg agcttcggag cttaagtttt tcttggagaa tccagagaac 960tttgatactt
tggcagtagt cttcaacagg tcgagtagat ttgcaagact gcaaagtgtt 1020aaatgcacaa
tcgcggggaa gaatgcttat gtaaggttct gttgtagtac tggtgatgct 1080atggggatga
atatggtttc taaaggtgtg cagaatgttc ttgagtatct taccgatgat 1140ttccctgaca
tggatgtgat tggaatctct ggtaacttct gttcggacaa gaaacctgct 1200gctgtgaact
ggattgaggg acgtggtaaa tcagttgttt gcgaggctgt aatcagagga 1260gagatcgtga
acaaggtctt gaaaacgagc gtggctgctt tagtcgagct caacatgctc 1320aagaacctag
ctggctctgc tgttgcaggc tctctaggtg gattcaacgc tcatgccagt 1380aacatagtgt
ctgctgtatt catagctact ggccaagatc cagctcaaaa cgtggagagt 1440tctcaatgca
tcaccatgat ggaagctatt aatgacggca aagatatcca tatctcagtc 1500actatgccat
ctatcgaggt ggggacagtg ggaggaggaa cacagcttgc atctcaatca 1560gcgtgtttaa
acctgctcgg agttaaagga gcaagcacag agtcgccggg aatgaacgca 1620aggaggctag
cgacgatcgt agccggagca gttttagctg gagagttatc tttaatgtca 1680gcaattgcag
ctggacagct tgtgagaagt cacatgaaat acaatagatc cagccgagac 1740atctctggag
caacgacaac gacaacaaca acaacatga
177923684DNAArtificial SequencePCR primer containing S. pombe DNA
23atgagttccc aacaagagaa aaaggattat gatgaagaac aattaaggtt gatggaagaa
60gtttgtatcg ttgtagatga aaatgatgtc cctttaagat atggaacgaa aaaggagtgt
120catttgatgg aaaatataaa taaaggtctt ttgcatagag cattctctat gttcatcttt
180gatgagcaaa atcgcctttt acttcagcag cgtgcagaag agaaaattac atttccatcc
240ttatggacga atacatgttg ctcccaccca ttggatgttg ctggtgaacg tggtaatact
300ttacctgaag ctgttgaagg tgttaagaat gcagctcaac gcaagctgtt ccatgaattg
360ggtattcaag ccaagtatat tcccaaagac aaatttcagt ttcttacacg aatccattac
420cttgctccta gtactggtgc ttggggagag catgaaattg actacattct tttcttcaaa
480ggtaaagttg agctggatat caatcccaat gaagttcaag cctataagta tgttactatg
540gaagagttaa aagagatgtt ttccgatcct caatatggat tcacaccatg gttcaaactt
600atttgtgagc attttatgtt taaatggtgg caggatgtag atcatgcgtc aaaattccaa
660gataccttaa ttcatcgttg ctaa
68424531DNAArtificial SequencePCR primer containing Streptomyces sp CL190
DNA 24atgagtgagc ttatacccgc ctgggttggt gacagactgg ctccggtgga caagttggag
60gtgcatttga aagggctccg ccacaaggcg gtgtctgttt tcgtcatgga tggcgaaaac
120gtgctgatcc agcgccgctc ggaggagaaa tatcactctc ccgggctttg ggcgaacacc
180tgctgcaccc atccgggctg gaccgaacgc cccgaggaat gcgcggtgcg gcggctgcgc
240gaggagctgg ggatcaccgg gctttatccc gcccatgccg accggctgga atatcgcgcc
300gatgtcggcg gcggcatgat cgagcatgag gtggtcgaca tctatctggc ctatgccaaa
360ccgcatatgc ggatcacccc cgatccgcgc gaagtggccg aggtgcgctg gatcggcctt
420tacgatctgg cggccgaggc cggtcggcat cccgagcggt tctcgaaatg gctcaacatc
480tatctgtcga gccatcttga ccggattttc ggatcgatcc tgcgcggctg a
5312565DNAArtificial SequencePCR primer containing Streptomyces sp CL190
DNA 25ggggtaccgc ggccgcacgc gtctatgcac caacctttgc ggtcttgttg tcgcgttcca
60gctgg
652660DNAArtificial SequenceOligonucleotide containing S. cerevisiae DNA
26gagctccacc gcggcggccg cgtcgactac ggccgcagga ggagttcata tgtcagagtt
602760DNAArtificial SequenceOligonucleotide containing S. cerevisiae DNA
27tctaccaaag gaagaggagt tttaactcga gtaggaggca catatgtctc agaacgttta
602860DNAArtificial SequenceOligonucleotide containing Streptomyces sp
CL190 and R. capsulatus DNA 28caagaccgca aaggttggtg catagacgcg
gtaaggaggc acatatgagt gagcttatac 602960DNAArtificial
SequenceOligonucleotide containing R. capsulatus DNA 29cctgcgcggc
tgagcggccg cggatccgat cgcgtgcggc cgcggtaccc aattcgccct
603060DNAArtificial SequenceOligonucleotide containing Streptomyces sp
CL190 and S. cerevisiae DNA 30tgtcattgaa aagatatgag gatcctctag
gtacttccct ggcgtgtgca gcggttgacg 603160DNAArtificial
SequenceOligonucleotide containing Streptomyces sp CL190 DNA
31cgattccgca ttatcggtac gggtgcctac ctagaactag tggatccccc gggctgcagg
603260DNAArtificial SequenceOligonucleotide containing N. tabacum and S.
cerevisiae DNA 32ctttcctgaa acataattta taatcagatc ggccgcagga
ggagttcata tgtcagagtt 603360DNAArtificial SequenceOligonucleotide
containing N. tabacum and R. capsulatus DNA 33ttcggatcga tcctgcgcgg
ctgagcggcc gatctaaaca aacccggaac agaccgttgg 603459DNAArtificial
SequenceOligonucleotide containing N. tabacum and S. cerevisiae DNA
34ctttcctgaa acataattta taatcagatc ggccgcagga ggagttcata tgtcagagt
593560DNAArtificial SequenceOligonucleotide containing N. tabacum and S.
pombe DNA 35tcgttgctaa ggatcccccg ggatccggcc gatctaaaca aacccggaac
agaccgttgg 603613DNAArtificial SequenceOligonucleotide containing
NotI restriction site 36catggcggcc gcg
133713DNAArtificial SequenceOligonucleotide
containing NotI restriction site 37gatccgcggc cgc
133860DNAArtificial
SequenceOligonucleotide containing S. cerevisiae DNA 38ttaaataagg
aggaataaac catggcggcc gcaggaggag ttcatatgtc agagttgaga
603960DNAArtificial SequenceOligonucleotide containing A. thaliana DNA
39aacaacaaca acatgacccg ggatccggcc gcgatccgag ctcgagatct gcagctggta
604060DNAArtificial SequenceOligonucleotide containing S. cerevisiae DNA
40tcgattaaat aaggaggaat aaaccatggc ggccgcagga ggagttcata tgtcagagtt
604160DNAArtificial SequenceOligonucleotide containing R. capsulatus DNA
41gattttcgga tcgatcctgc gcggctgagc ggccgcgatc cgagctcgag atctgcagct
604260DNAArtificial SequenceOligonucleotide containing S. cerevisiae DNA
42tcgattaaat aaggaggaat aaaccatggc ggccgcagga ggagttcata tgtcagagtt
604360DNAArtificial SequenceOligonucleotide containing S. pombe DNA
43ttcatcgttg ctaaggatcc cccgggatcc ggccgcgatc cgagctcgag atctgcagct
604461DNAArtificial SequenceOligonucleotide containing R. capsulatus DNA
44ttaaataagg aggaataaac catggcggcc gtaaggaggc acatatgagt gagcttatac
60t
614561DNAArtificial SequenceOligonucleotide containing R. capsulatus DNA
45gcctgcgcgg ctgagcggcc gcggatccga tggccgcgat ccgagctcga gatctgcagc
60t
614660DNAArtificial SequenceOligonucleotide containing S. pombe DNA
46ttaaataagg aggaataaac catggcggcc gtaggaggca catatgagtt cccaacaaga
604760DNAArtificial SequenceOligonucleotide containing S. pombe DNA
47accttaattc atcgttgcta aggatccccc ggccgcgatc cgagctcgag atctgcagct
60481356DNASaccharomyces cerevisiae 48atgtcagagt tgagagcctt cagtgcccca
gggaaagcgt tactagctgg tggatattta 60gttttagata caaaatatga agcatttgta
gtcggattat cggcaagaat gcatgctgta 120gcccatcctt acggttcatt gcaagggtct
gataagtttg aagtgcgtgt gaaaagtaaa 180caatttaaag atggggagtg gctgtaccat
ataagtccta aaagtggctt cattcctgtt 240tcgataggcg gatctaagaa ccctttcatt
gaaaaagtta tcgctaacgt atttagctac 300tttaaaccta acatggacga ctactgcaat
agaaacttgt tcgttattga tattttctct 360gatgatgcct accattctca ggaggatagc
gttaccgaac atcgtggcaa cagaagattg 420agttttcatt cgcacagaat tgaagaagtt
cccaaaacag ggctgggctc ctcggcaggt 480ttagtcacag ttttaactac agctttggcc
tccttttttg tatcggacct ggaaaataat 540gtagacaaat atagagaagt tattcataat
ttagcacaag ttgctcattg tcaagctcag 600ggtaaaattg gaagcgggtt tgatgtagcg
gcggcagcat atggatctat cagatataga 660agattcccac ccgcattaat ctctaatttg
ccagatattg gaagtgctac ttacggcagt 720aaactggcgc atttggttga tgaagaagac
tggaatatta cgattaaaag taaccattta 780ccttcgggat taactttatg gatgggcgat
attaagaatg gttcagaaac agtaaaactg 840gtccagaagg taaaaaattg gtatgattcg
catatgccag aaagcttgaa aatatataca 900gaactcgatc atgcaaattc tagatttatg
gatggactat ctaaactaga tcgcttacac 960gagactcatg acgattacag cgatcagata
tttgagtctc ttgagaggaa tgactgtacc 1020tgtcaaaagt atcctgaaat cacagaagtt
agagatgcag ttgccacaat tagacgttcc 1080tttagaaaaa taactaaaga atctggtgcc
gatatcgaac ctcccgtaca aactagctta 1140ttggatgatt gccagacctt aaaaggagtt
cttacttgct taatacctgg tgctggtggt 1200tatgacgcca ttgcagtgat tactaagcaa
gatgttgatc ttagggctca aaccgctaat 1260gacaaaagat tttctaaggt tcaatggctg
gatgtaactc aggctgactg gggtgttagg 1320aaagaaaaag atccggaaac ttatcttgat
aaataa 1356491332DNASaccharomyces cerevisiae
49atgtcattac cgttcttaac ttctgcaccg ggaaaggtta ttatttttgg tgaacactct
60gctgtgtaca acaagcctgc cgtcgctgct agtgtgtctg cgttgagaac ctacctgcta
120ataagcgagt catctgcacc agatactatt gaattggact tcccggacat tagctttaat
180cataagtggt ccatcaatga tttcaatgcc atcaccgagg atcaagtaaa ctcccaaaaa
240ttggccaagg ctcaacaagc caccgatggc ttgtctcagg aactcgttag tcttttggat
300ccgttgttag ctcaactatc cgaatccttc cactaccatg cagcgttttg tttcctgtat
360atgtttgttt gcctatgccc ccatgccaag aatattaagt tttctttaaa gtctacttta
420cccatcggtg ctgggttggg ctcaagcgcc tctatttctg tatcactggc cttagctatg
480gcctacttgg gggggttaat aggatctaat gacttggaaa agctgtcaga aaacgataag
540catatagtga atcaatgggc cttcataggt gaaaagtgta ttcacggtac cccttcagga
600atagataacg ctgtggccac ttatggtaat gccctgctat ttgaaaaaga ctcacataat
660ggaacaataa acacaaacaa ttttaagttc ttagatgatt tcccagccat tccaatgatc
720ctaacctata ctagaattcc aaggtctaca aaagatcttg ttgctcgcgt tcgtgtgttg
780gtcaccgaga aatttcctga agttatgaag ccaattctag atgccatggg tgaatgtgcc
840ctacaaggct tagagatcat gactaagtta agtaaatgta aaggcaccga tgacgaggct
900gtagaaacta ataatgaact gtatgaacaa ctattggaat tgataagaat aaatcatgga
960ctgcttgtct caatcggtgt ttctcatcct ggattagaac ttattaaaaa tctgagcgat
1020gatttgagaa ttggctccac aaaacttacc ggtgctggtg gcggcggttg ctctttgact
1080ttgttacgaa gagacattac tcaagagcaa attgacagct tcaaaaagaa attgcaagat
1140gattttagtt acgagacatt tgaaacagac ttgggtggga ctggctgctg tttgttaagc
1200gcaaaaaatt tgaataaaga tcttaaaatc aaatccctag tattccaatt atttgaaaat
1260aaaactacca caaagcaaca aattgacgat ctattattgc caggaaacac gaatttacca
1320tggacttcat aa
1332501191DNASaccharomyces cerevisiae 50atgaccgttt acacagcatc cgttaccgca
cccgtcaaca tcgcaaccct taagtattgg 60gggaaaaggg acacgaagtt gaatctgccc
accaattcgt ccatatcagt gactttatcg 120caagatgacc tcagaacgtt gacctctgcg
gctactgcac ctgagtttga acgcgacact 180ttgtggttaa atggagaacc acacagcatc
gacaatgaaa gaactcaaaa ttgtctgcgc 240gacctacgcc aattaagaaa ggaaatggaa
tcgaaggacg cctcattgcc cacattatct 300caatggaaac tccacattgt ctccgaaaat
aactttccta cagcagctgg tttagcttcc 360tccgctgctg gctttgctgc attggtctct
gcaattgcta agttatacca attaccacag 420tcaacttcag aaatatctag aatagcaaga
aaggggtctg gttcagcttg tagatcgttg 480tttggcggat acgtggcctg ggaaatggga
aaagctgaag atggtcatga ttccatggca 540gtacaaatcg cagacagctc tgactggcct
cagatgaaag cttgtgtcct agttgtcagc 600gatattaaaa aggatgtgag ttccactcag
ggtatgcaat tgaccgtggc aacctccgaa 660ctatttaaag aaagaattga acatgtcgta
ccaaagagat ttgaagtcat gcgtaaagcc 720attgttgaaa aagatttcgc cacctttgca
aaggaaacaa tgatggattc caactctttc 780catgccacat gtttggactc tttccctcca
atattctaca tgaatgacac ttccaagcgt 840atcatcagtt ggtgccacac cattaatcag
ttttacggag aaacaatcgt tgcatacacg 900tttgatgcag gtccaaatgc tgtgttgtac
tacttagctg aaaatgagtc gaaactcttt 960gcatttatct ataaattgtt tggctctgtt
cctggatggg acaagaaatt tactactgag 1020cagcttgagg ctttcaacca tcaatttgaa
tcatctaact ttactgcacg tgaattggat 1080cttgagttgc aaaaggatgt tgccagagtg
attttaactc aagtcggttc aggcccacaa 1140gaaacaaacg aatctttgat tgacgcaaag
actggtctac caaaggaata a 1191511197DNASaccharomyces cerevisiae
51atgtctcaga acgtttacat tgtatcgact gccagaaccc caattggttc attccagggt
60tctctatcct ccaagacagc agtggaattg ggtgctgttg ctttaaaagg cgccttggct
120aaggttccag aattggatgc atccaaggat tttgacgaaa ttatttttgg taacgttctt
180tctgccaatt tgggccaagc tccggccaga caagttgctt tggctgccgg tttgagtaat
240catatcgttg caagcacagt taacaaggtc tgtgcatccg ctatgaaggc aatcattttg
300ggtgctcaat ccatcaaatg tggtaatgct gatgttgtcg tagctggtgg ttgtgaatct
360atgactaacg caccatacta catgccagca gcccgtgcgg gtgccaaatt tggccaaact
420gttcttgttg atggtgtcga aagagatggg ttgaacgatg cgtacgatgg tctagccatg
480ggtgtacacg cagaaaagtg tgcccgtgat tgggatatta ctagagaaca acaagacaat
540tttgccatcg aatcctacca aaaatctcaa aaatctcaaa aggaaggtaa attcgacaat
600gaaattgtac ctgttaccat taagggattt agaggtaagc ctgatactca agtcacgaag
660gacgaggaac ctgctagatt acacgttgaa aaattgagat ctgcaaggac tgttttccaa
720aaagaaaacg gtactgttac tgccgctaac gcttctccaa tcaacgatgg tgctgcagcc
780gtcatcttgg tttccgaaaa agttttgaag gaaaagaatt tgaagccttt ggctattatc
840aaaggttggg gtgaggccgc tcatcaacca gctgatttta catgggctcc atctcttgca
900gttccaaagg ctttgaaaca tgctggcatc gaagacatca attctgttga ttactttgaa
960ttcaatgaag ccttttcggt tgtcggtttg gtgaacacta agattttgaa gctagaccca
1020tctaaggtta atgtatatgg tggtgctgtt gctctaggtc acccattggg ttgttctggt
1080gctagagtgg ttgttacact gctatccatc ttacagcaag aaggaggtaa gatcggtgtt
1140gccgccattt gtaatggtgg tggtggtgct tcctctattg tcattgaaaa gatatga
1197521386DNAArabidopsis thaliana 52atggcgaaga acgttgggat tttggctatg
gatatctatt tccctcccac ctgtgttcaa 60caggaagctt tggaagcaca tgatggagca
agtaaaggga aatacactat tggacttggc 120caagattgtt tagctttttg cactgagctt
gaagatgtta tctctatgag tttcaatgcg 180gtgacatcac tttttgagaa gtataagatt
gaccctaacc aaatcgggcg tcttgaagta 240ggaagtgaga ctgttattga caaaagcaag
tccatcaaga ccttcttgat gcagctcttt 300gagaaatgtg gaaacactga tgtcgaaggt
gttgactcga ccaatgcttg ctatggtgga 360actgcagctt tgttaaactg tgtcaattgg
gttgagagta actcttggga tggacgttat 420ggcctcgtca tttgtactga cagcgcggtt
tatgcagaag gacccgcaag gcccactgga 480ggagctgcag cgattgctat gttgatagga
cctgatgctc ctatcgtttt cgaaagcaaa 540ttgagagcaa gccacatggc tcatgtctat
gacttttaca agcccaatct tgctagcgag 600tacccggttg ttgatggtaa gctttcacag
acttgctacc tcatggctct tgactcctgc 660tataaacatt tatgcaacaa gttcgagaag
atcgagggca aagagttctc cataaatgat 720gctgattaca ttgttttcca ttctccatac
aataaacttg tacagaaaag ctttgctcgt 780ctcttgtaca acgacttctt gagaaacgca
agctccattg acgaggctgc caaagaaaag 840ttcacccctt attcatcttt gacccttgac
gagagttacc aaagccgtga tcttgaaaag 900gtgtcacaac aaatttcgaa accgttttat
gatgctaaag tgcaaccaac gactttaata 960ccaaaggaag tcggtaacat gtacactgct
tctctctacg ctgcatttgc ttccctcatc 1020cacaataaac acaatgattt ggcgggaaag
cgggtggtta tgttctctta tggaagtggc 1080tccaccgcaa caatgttctc attacgcctc
aacgacaata agcctccttt cagcatttca 1140aacattgcat ctgtaatgga tgttggcggt
aaattgaaag ctagacatga gtatgcacct 1200gagaagtttg tggagacaat gaagctaatg
gaacataggt atggagcaaa ggactttgtg 1260acaaccaagg agggtattat agatcttttg
gcaccgggaa cttattatct gaaagaggtt 1320gattccttgt accggagatt ctatggcaag
aaaggtgaag atggatctgt agccaatgga 1380cactga
1386531779DNAArabidopsis thaliana
53atggatctcc gtcggaggcc tcctaaacca ccggttacca acaacaacaa ctccaacgga
60tctttccgtt cttatcagcc tcgcacttcc gatgacgatc atcgtcgccg ggctacaaca
120attgctcctc caccgaaagc atccgacgcg cttcctcttc cgttatatct cacaaacgcc
180gttttcttca cgctcttctt ctccgtcgcg tattacctcc tccaccggtg gcgtgacaag
240atccgttaca atacgcctct tcacgtcgtc actatcacag aactcggcgc cattattgct
300ctcatcgctt cgtttatcta tctcctaggg ttttttggta ttgactttgt tcagtcattt
360atctcacgtg cctctggtga tgcttgggat ctcgccgata cgatcgatga tgatgaccac
420cgccttgtca cgtgctctcc accgactccg atcgtttccg ttgctaaatt acctaatccg
480gaacctattg ttaccgaatc gcttcctgag gaagacgagg agattgtgaa atcggttatc
540gacggagtta ttccatcgta ctcgcttgaa tctcgtctcg gtgattgcaa aagagcggcg
600tcgattcgtc gtgaggcgtt gcagagagtc accgggagat cgattgaagg gttaccgttg
660gatggatttg attatgaatc gattttgggg caatgctgtg agatgcctgt tggatacatt
720cagattcctg ttgggattgc tggtccattg ttgcttgatg gttatgagta ctctgttcct
780atggctacaa ccgaaggttg tttggttgct agcactaaca gaggctgcaa ggctatgttt
840atctctggtg gcgccaccag taccgttctt aaggacggta tgacccgagc acctgttgtt
900cggttcgctt cggcgagacg agcttcggag cttaagtttt tcttggagaa tccagagaac
960tttgatactt tggcagtagt cttcaacagg tcgagtagat ttgcaagact gcaaagtgtt
1020aaatgcacaa tcgcggggaa gaatgcttat gtaaggttct gttgtagtac tggtgatgct
1080atggggatga atatggtttc taaaggtgtg cagaatgttc ttgagtatct taccgatgat
1140ttccctgaca tggatgtgat tggaatctct ggtaacttct gttcggacaa gaaacctgct
1200gctgtgaact ggattgaggg acgtggtaaa tcagttgttt gcgaggctgt aatcagagga
1260gagatcgtga acaaggtctt gaaaacgagc gtggctgctt tagtcgagct caacatgctc
1320aagaacctag ctggctctgc tgttgcaggc tctctaggtg gattcaacgc tcatgccagt
1380aacatagtgt ctgctgtatt catagctact ggccaagatc cagctcaaaa cgtggagagt
1440tctcaatgca tcaccatgat ggaagctatt aatgacggca aagatatcca tatctcagtc
1500actatgccat ctatcgaggt ggggacagtg ggaggaggaa cacagcttgc atctcaatca
1560gcgtgtttaa acctgctcgg agttaaagga gcaagcacag agtcgccggg aatgaacgca
1620aggaggctag cgacgatcgt agccggagca gttttagctg gagagttatc tttaatgtca
1680gcaattgcag ctggacagct tgtgagaagt cacatgaaat acaatagatc cagccgagac
1740atctctggag caacgacaac gacaacaaca acaacatga
177954684DNAArtificial SequenceSchizosaccharomyces pombe IDI1 (IPP
isomerase) 54atgagttccc aacaagagaa aaaggattat gatgaagaac aattaaggtt
gatggaagaa 60gtttgtatcg ttgtagatga aaatgatgtc cctttaagat atggaacgaa
aaaggagtgt 120catttgatgg aaaatataaa taaaggtctt ttgcatagag cattctctat
gttcatcttt 180gatgagcaaa atcgcctttt acttcagcag cgtgcagaag agaaaattac
atttccatcc 240ttatggacga atacatgttg ctcccaccca ttggatgttg ctggtgaacg
tggtaatact 300ttacctgaag ctgttgaagg tgttaagaat gcagctcaac gcaagctgtt
ccatgaattg 360ggtattcaag ccaagtatat tcccaaagac aaatttcagt ttcttacacg
aatccattac 420cttgctccta gtactggtgc ttggggagag catgaaattg actacattct
tttcttcaaa 480ggtaaagttg agctggatat caatcccaat gaagttcaag cctataagta
tgttactatg 540gaagagttaa aagagatgtt ttccgatcct caatatggat tcacaccatg
gttcaaactt 600atttgtgagc attttatgtt taaatggtgg caggatgtag atcatgcgtc
aaaattccaa 660gataccttaa ttcatcgttg ctaa
68455531DNAArtificial SequenceRhodobacter capsulatus idiB
(IPP isomerase) 55atgagtgagc ttatacccgc ctgggttggt gacagactgg ctccggtgga
caagttggag 60gtgcatttga aagggctccg ccacaaggcg gtgtctgttt tcgtcatgga
tggcgaaaac 120gtgctgatcc agcgccgctc ggaggagaaa tatcactctc ccgggctttg
ggcgaacacc 180tgctgcaccc atccgggctg gaccgaacgc cccgaggaat gcgcggtgcg
gcggctgcgc 240gaggagctgg ggatcaccgg gctttatccc gcccatgccg accggctgga
atatcgcgcc 300gatgtcggcg gcggcatgat cgagcatgag gtggtcgaca tctatctggc
ctatgccaaa 360ccgcatatgc ggatcacccc cgatccgcgc gaagtggccg aggtgcgctg
gatcggcctt 420tacgatctgg cggccgaggc cggtcggcat cccgagcggt tctcgaaatg
gctcaacatc 480tatctgtcga gccatcttga ccggattttc ggatcgatcc tgcgcggctg a
531561059DNAStreptomyces sp. 56atgacggaaa cgcacgccat
agccggggtc ccgatgaggt gggtgggacc ccttcgtatt 60tccgggaacg tcgccgagac
cgagacccag gtcccgctcg ccacgtacga gtcgccgctg 120tggccgtcgg tgggccgcgg
ggcgaaggtc tcccggctga cggagaaggg catcgtcgcc 180accctcgtcg acgagcggat
gacccgctcg gtgatcgtcg aggcgacgga cgcgcagacc 240gcgtacatgg ccgcgcagac
catccacgcc cgcatcgacg agctgcgcga ggtggtgcgc 300ggctgcagcc ggttcgccca
gctgatcaac atcaagcacg agatcaacgc gaacctgctg 360ttcatccggt tcgagttcac
caccggtgac gcctccggcc acaacatggc cacgctcgcc 420tccgatgtgc tcctggggca
cctgctggag acgatccctg gcatctccta cggctcgatc 480tccggcaact actgcacgga
caagaaggcc accgcgatca acggcatcct cggccgcggc 540aagaacgtga tcaccgagct
gctggtgccg cgggacgtcg tcgagaacaa cctgcacacc 600acggctgcca agatcgtcga
gctgaacatc cgcaagaacc tgctcggcac cctgctcgcc 660ggcggcatcc gctcggccaa
cgcccacttc gcgaacatgc tgctcggctt ctacctggcc 720accggccagg acgccgccaa
catcgtcgag ggctcgcagg gcgtcgtcat ggccgaggac 780cgcgacggcg acctctactt
cgcctgcacc ctgccgaacc tgatcgtcgg cacggtcggc 840aacggcaagg gtctcggctt
cgtggagacg aacctcgccc ggctcggctg ccgagccgac 900cgcgaacccg gggagaacgc
ccgccgcctc gccgtcatcg cggcagcgac cgtgctgtgc 960ggtgaactct cgctgctcgc
ggcacagacg aacccgggcg aactcatgcg cgcgcacgtc 1020cagctggaac gcgacaacaa
gaccgcaaag gttggtgca 1059576798DNAArtificial
SequenceStreptomyces sp CL190 gene cluster containing mevalonate
pathway and IPP isomerase orfs 57tacgtacttc cctggcgtgt gcagcggttg
acgcgccgtg ccctcgctgc gagcggcgcg 60cacatctgac gtcctgcttt attgctttct
cagaactcgg gacgaagcga tcccatgatc 120acgcgatctc catgcagaaa agacaaaggg
agctgagtgc gttgacacta ccgacctcgg 180ctgagggggt atcagaaagc caccgggccc
gctcggtcgg catcggtcgc gcccacgcca 240aggccatcct gctgggagag catgcggtcg
tctacggagc gccggcactc gctctgccga 300ttccgcagct cacggtcacg gccagcgtcg
gctggtcgtc cgaggcctcc gacagtgcgg 360gtggcctgtc ctacacgatg accggtacgc
cgtcgcgggc actggtgacg caggcctccg 420acggcctgca ccggctcacc gcggaattca
tggcgcggat gggcgtgacg aacgcgccgc 480acctcgacgt gatcctggac ggcgcgatcc
cgcacggccg gggtctcggc tccagcgcgg 540ccggctcacg cgcgatcgcc ttggccctcg
ccgacctctt cggccacgaa ctggccgagc 600acacggcgta cgaactggtg cagacggccg
agaacatggc gcacggccgg gccagcggcg 660tggacgcgat gacggtcggc gcgtcccggc
cgctgctgtt ccagcagggc cgcaccgagc 720gactggccat cggctgcgac agcctgttca
tcgtcgccga cagcggcgtc ccgggcagca 780ccaaggaagc ggtcgagatg ctgcgggagg
gattcacccg cagcgccgga acacaggagc 840ggttcgtcgg ccgggcgacg gaactgaccg
aggccgcccg gcaggccctc gccgacggcc 900ggcccgagga gctgggctcg cagctgacgt
actaccacga gctgctccat gaggcccgcc 960tgagcaccga cggcatcgat gcgctggtcg
aggccgcgct gaaggcaggc agcctcggag 1020ccaagatcac cggcggtggt ctgggcggct
gcatgatcgc acaggcccgg cccgaacagg 1080cccgggaggt cacccggcag ctccacgagg
ccggtgccgt acagacctgg gtcgtaccgc 1140tgaaagggct cgacaaccat gcgcagtgaa
cacccgacca cgaccgtgct ccagtcgcgg 1200gagcagggca gcgcggccgg cgccaccgcg
gtcgcgcacc caaacatcgc gctgatcaag 1260tactggggca agcgcgacga gcggctgatc
ctgccctgca ccaccagcct gtcgatgacg 1320ctggacgtct tccccacgac caccgaggtc
cggctcgacc ccgccgccga gcacgacacg 1380gccgccctca acggcgaggt ggccacgggc
gagacgctgc gccgcatcag cgccttcctc 1440tccctggtgc gggaggtggc gggcagcgac
cagcgggccg tggtggacac ccgcaacacc 1500gtgcccaccg gggcgggcct ggcgtcctcc
gccagcgggt tcgccgccct cgccgtcgcg 1560gccgcggccg cctacgggct cgaactcgac
gaccgcgggc tgtcccggct ggcccgacgt 1620ggatccggct ccgcctcgcg gtcgatcttc
ggcggcttcg ccgtctggca cgccggcccc 1680gacggcacgg ccacggaagc ggacctcggc
tcctacgccg agccggtgcc cgcggccgac 1740ctcgacccgg cgctggtcat cgccgtggtc
aacgccggcc ccaagcccgt ctccagccgc 1800gaggccatgc gccgcaccgt cgacacctcg
ccgctgtacc ggccgtgggc cgactccagt 1860aaggacgacc tggacgagat gcgctcggcg
ctgctgcgcg gcgacctcga ggccgtgggc 1920gagatcgcgg agcgcaacgc gctcggcatg
cacgccacca tgctggccgc ccgccccgcg 1980gtgcggtacc tgtcgccggc cacggtcacc
gtgctcgaca gcgtgctcca gctccgcaag 2040gacggtgtcc tggcctacgc gaccatggac
gccggtccca acgtgaaggt gctgtgccgg 2100cgggcggacg ccgagcgggt ggccgacgtc
gtacgcgccg ccgcgtccgg cggtcaggtc 2160ctcgtcgccg ggccgggaga cggtgcccgc
ctgctgagcg agggcgcatg acgacaggtc 2220agcgcacgat cgtccggcac gcgccgggca
agctgttcgt cgcgggcgag tacgcggtcg 2280tggatccggg caacccggcg atcctggtag
cggtcgaccg gcacatcagc gtcaccgtgt 2340ccgacgccga cgcggacacc ggggccgccg
acgtcgtgat ctcctccgac ctcggtccgc 2400aggcggtcgg ctggcgctgg cacgacggcc
ggctcgtcgt ccgcgacccg gacgacgggc 2460agcaggcgcg cagcgccctg gcccacgtgg
tgtcggcgat cgagaccgtg ggccggctgc 2520tgggcgaacg cggacagaag gtccccgctc
tcaccctctc cgtcagcagc cgcctgcacg 2580aggacggccg gaagttcggc ctgggctcca
gcggcgcggt gaccgtggcg accgtagccg 2640ccgtcgccgc gttctgcgga ctcgaactgt
ccaccgacga acggttccgg ctggccatgc 2700tcgccaccgc ggaactcgac cccaagggct
ccggcgggga cctcgccgcc agcacctggg 2760gcggctggat cgcctaccag gcgcccgacc
gggcctttgt gctcgacctg gcccggcgcg 2820tgggagtcga ccggacactg aaggcgccct
ggccggggca ctcggtgcgc cgactgccgg 2880cgcccaaggg cctcaccctg gaggtcggct
ggaccggaga gcccgcctcc accgcgtccc 2940tggtgtccga tctgcaccgc cgcacctggc
ggggcagcgc ctcccaccag aggttcgtcg 3000agaccacgac cgactgtgtc cgctccgcgg
tcaccgccct ggagtccggc gacgacacga 3060gcctgctgca cgagatccgc cgggcccgcc
aggagctggc ccgcctggac gacgaggtcg 3120gcctcggcat cttcacaccc aagctgacgg
cgctgtgcga cgccgccgaa gccgtcggcg 3180gcgcggccaa gccctccggg gcaggcggcg
gcgactgcgg catcgccctg ctggacgccg 3240aggcgtcgcg ggacatcaca catgtacggc
aacggtggga gacagccggg gtgctgcccc 3300tgcccctgac tcctgccctg gaagggatct
aagaatgacc agcgcccaac gcaaggacga 3360ccacgtacgg ctcgccatcg agcagcacaa
cgcccacagc ggacgcaacc agttcgacga 3420cgtgtcgttc gtccaccacg ccctggccgg
catcgaccgg ccggacgtgt ccctggccac 3480gtccttcgcc gggatctcct ggcaggtgcc
gatctacatc aacgcgatga ccggcggcag 3540cgagaagacc ggcctcatca accgggacct
ggccaccgcc gcccgcgaga ccggcgtccc 3600catcgcgtcc gggtccatga acgcgtacat
caaggacccc tcctgcgccg acacgttccg 3660tgtgctgcgc gacgagaacc ccaacgggtt
cgtcatcgcg aacatcaacg ccaccacgac 3720ggtcgacaac gcgcagcgcg cgatcgacct
gatcgaggcg aacgccctgc agatccacat 3780caacacggcg caggagacgc cgatgccgga
gggcgaccgg tcgttcgcgt cctgggtccc 3840gcagatcgag aagatcgcgg cggccgtcga
catccccgtg atcgtcaagg aggtcggcaa 3900cggcctgagc cggcagacca tcctgctgct
cgccgacctc ggcgtgcagg cggcggacgt 3960cagcggccgc ggcggcacgg acttcgcccg
catcgagaac ggccgccggg agctcggcga 4020ctacgcgttc ctgcacggct gggggcagtc
caccgccgcc tgcctgctgg acgcccagga 4080catctccctg cccgtcctcg cctccggcgg
tgtgcgtcac ccgctcgacg tggtccgcgc 4140cctcgcgctc ggcgcccgcg ccgtcggctc
ctccgccggc ttcctgcgca ccctgatgga 4200cgacggcgtc gacgcgctga tcacgaagct
cacgacctgg ctggaccagc tggcggcgct 4260gcagaccatg ctcggcgcgc gcaccccggc
cgacctcacc cgctgcgacg tgctgctcca 4320cggcgagctg cgtgacttct gcgccgaccg
gggcatcgac acgcgccgcc tcgcccagcg 4380ctccagctcc atcgaggccc tccagacgac
gggaagcaca cgatgacgga aacgcacgcc 4440atagccgggg tcccgatgag gtgggtggga
ccccttcgta tttccgggaa cgtcgccgag 4500accgagaccc aggtcccgct cgccacgtac
gagtcgccgc tgtggccgtc ggtgggccgc 4560ggggcgaagg tctcccggct gacggagaag
ggcatcgtcg ccaccctcgt cgacgagcgg 4620atgacccgct cggtgatcgt cgaggcgacg
gacgcgcaga ccgcgtacat ggccgcgcag 4680accatccacg cccgcatcga cgagctgcgc
gaggtggtgc gcggctgcag ccggttcgcc 4740cagctgatca acatcaagca cgagatcaac
gcgaacctgc tgttcatccg gttcgagttc 4800accaccggtg acgcctccgg ccacaacatg
gccacgctcg cctccgatgt gctcctgggg 4860cacctgctgg agacgatccc tggcatctcc
tacggctcga tctccggcaa ctactgcacg 4920gacaagaagg ccaccgcgat caacggcatc
ctcggccgcg gcaagaacgt gatcaccgag 4980ctgctggtgc cgcgggacgt cgtcgagaac
aacctgcaca ccacggctgc caagatcgtc 5040gagctgaaca tccgcaagaa cctgctcggc
accctgctcg ccggcggcat ccgctcggcc 5100aacgcccact tcgcgaacat gctgctcggc
ttctacctgg ccaccggcca ggacgccgcc 5160aacatcgtcg agggctcgca gggcgtcgtc
atggccgagg accgcgacgg cgacctctac 5220ttcgcctgca ccctgccgaa cctgatcgtc
ggcacggtcg gcaacggcaa gggtctcggc 5280ttcgtggaga cgaacctcgc ccggctcggc
tgccgagccg accgcgaacc cggggagaac 5340gcccgccgcc tcgccgtcat cgcggcagcg
accgtgctgt gcggtgaact ctcgctgctc 5400gcggcacaga cgaacccggg cgaactcatg
cgcgcgcacg tccagctgga acgcgacaac 5460aagaccgcaa aggttggtgc atagggcatg
tccatctcca taggcattca cgacctgtcg 5520ttcgccacaa ccgagttcgt cctgccgcac
acggcgctcg ccgagtacaa cggcaccgag 5580atcggcaagt accacgtcgg catcggccag
cagtcgatga gcgtgccggc cgccgacgag 5640gacatcgtga ccatggccgc gaccgcggcg
cggcccatca tcgagcgcaa cggcaagagc 5700cggatccgca cggtcgtgtt cgccacggag
tcgtcgatcg accaggcgaa ggcgggcggc 5760gtgtacgtgc actccctgct ggggctggag
tcggcctgcc gggtcgtcga gctgaagcag 5820gcctgctacg gggccaccgc cgcccttcag
ttcgccatcg gcctggtgcg gcgcgacccc 5880gcccagcagg tcctggtcat cgccagtgac
gtctccaagt acgagctgga cagccccggc 5940gaggcgaccc agggcgcggc cgcggtggcc
atgctggtcg gcgccgaccc ggccctgctg 6000cgtatcgagg agccgtcggg cctgttcacc
gccgacgtca tggacttctg gcggcccaac 6060tacctcacca ccgctctggt cgacggccag
gagtccatca acgcctacct gcaggccgtc 6120gagggcgcct ggaaggacta cgcggagcag
gacggccggt cgctggagga gttcgcggcg 6180ttcgtctacc accagccgtt cacgaagatg
gcctacaagg cgcaccgcca cctgctgaac 6240ttcaacggct acgacaccga caaggacgcc
atcgagggcg ccctcggcca gacgacggcg 6300tacaacaacg tcatcggcaa cagctacacc
gcgtcggtgt acctgggcct ggccgccctg 6360ctcgaccagg cggacgacct gacgggccgt
tccatcggct tcctgagcta cggctcgggc 6420agcgtcgccg agttcttctc gggcaccgtc
gtcgccgggt accgcgagcg tctgcgcacc 6480gaggcgaacc aggaggcgat cgcccggcgc
aagagcgtcg actacgccac ctaccgcgag 6540ctgcacgagt acacgctccc gtccgacggc
ggcgaccacg ccaccccggt gcagaccacc 6600ggccccttcc ggctggccgg gatcaacgac
cacaagcgca tctacgaggc gcgctagcga 6660cacccctcgg caacggggtg cgccactgtt
cggcgcaccc cgtgccgggc tttcgcacag 6720ctattcacga ccatttgagg ggcgggcagc
cgcatgaccg acgtccgatt ccgcattatc 6780ggtacgggtg cctacgta
6798587693DNAArtificial SequenceOperon
containing A. thaliana and S. cerevisiae DNA 58ggccgcgtcg acgccggcgg
aggcacatat gtctcagaac gtttacattg tatcgactgc 60cagaacccca attggttcat
tccagggttc tctatcctcc aagacagcag tggaattggg 120tgctgttgct ttaaaaggcg
ccttggctaa ggttccagaa ttggatgcat ccaaggattt 180tgacgaaatt atttttggta
acgttctttc tgccaatttg ggccaagctc cggccagaca 240agttgctttg gctgccggtt
tgagtaatca tatcgttgca agcacagtta acaaggtctg 300tgcatccgct atgaaggcaa
tcattttggg tgctcaatcc atcaaatgtg gtaatgctga 360tgttgtcgta gctggtggtt
gtgaatctat gactaacgca ccatactaca tgccagcagc 420ccgtgcgggt gccaaatttg
gccaaactgt tcttgttgat ggtgtcgaaa gagatgggtt 480gaacgatgcg tacgatggtc
tagccatggg tgtacacgca gaaaagtgtg cccgtgattg 540ggatattact agagaacaac
aagacaattt tgccatcgaa tcctaccaaa aatctcaaaa 600atctcaaaag gaaggtaaat
tcgacaatga aattgtacct gttaccatta agggatttag 660aggtaagcct gatactcaag
tcacgaagga cgaggaacct gctagattac acgttgaaaa 720attgagatct gcaaggactg
ttttccaaaa agaaaacggt actgttactg ccgctaacgc 780ttctccaatc aacgatggtg
ctgcagccgt catcttggtt tccgaaaaag ttttgaagga 840aaagaatttg aagcctttgg
ctattatcaa aggttggggt gaggccgctc atcaaccagc 900tgattttaca tgggctccat
ctcttgcagt tccaaaggct ttgaaacatg ctggcatcga 960agacatcaat tctgttgatt
actttgaatt caatgaagcc ttttcggttg tcggtttggt 1020gaacactaag attttgaagc
tagacccatc taaggttaat gtatatggtg gtgctgttgc 1080tctaggtcac ccattgggtt
gttctggtgc tagagtggtt gttacactgc tatccatctt 1140acagcaagaa ggaggtaaga
tcggtgttgc cgccatttgt aatggtggtg gtggtgcttc 1200ctctattgtc attgaaaaga
tatgaggatc ctctagatgc gcaggaggca catatggcga 1260agaacgttgg gattttggct
atggatatct atttccctcc cacctgtgtt caacaggaag 1320ctttggaagc acatgatgga
gcaagtaaag ggaaatacac tattggactt ggccaagatt 1380gtttagcttt ttgcactgag
cttgaagatg ttatctctat gagtttcaat gcggtgacat 1440cactttttga gaagtataag
attgacccta accaaatcgg gcgtcttgaa gtaggaagtg 1500agactgttat tgacaaaagc
aagtccatca agaccttctt gatgcagctc tttgagaaat 1560gtggaaacac tgatgtcgaa
ggtgttgact cgaccaatgc ttgctatggt ggaactgcag 1620ctttgttaaa ctgtgtcaat
tgggttgaga gtaactcttg ggatggacgt tatggcctcg 1680tcatttgtac tgacagcgcg
gtttatgcag aaggacccgc aaggcccact ggaggagctg 1740cagcgattgc tatgttgata
ggtcctgatg ctcctatcgt tttcgaaagc aaattgagag 1800caagccacat ggctcatgtc
tatgactttt acaagcccaa tcttgctagc gagtacccgg 1860ttgttgatgg taagctttca
cagacttgct acctcatggc tcttgactcc tgctataaac 1920atttatgcaa caagttcgag
aagatcgagg gcaaagagtt ctccataaat gatgctgatt 1980acattgtttt ccattctcca
tacaataaac ttgtacagaa aagctttgct cgtctcttgt 2040acaacgactt cttgagaaac
gcaagctcca ttgacgaggc tgccaaagaa aagttcaccc 2100cttattcatc tttgaccctt
gacgagagtt accaaagccg tgatcttgaa aaggtgtcac 2160aacaaattgc gaaaccgttt
tatgatgcta aagtgcaacc aacgacttta ataccaaagg 2220aagtcggtaa catgtacact
gcttctctct acgctgcatt tgcttccctc atccacaaga 2280aacacaatga tttggcggga
aagcgggtgg ttatgttctc ttatggaagt ggctcaaccg 2340caacaatgtt ctcattacgc
ctcaacgaca ataagcctcc tttcagcatt tcaaacattg 2400catctgtaat ggatgttggc
ggtaaattga aagctagaca tgagtatgca cctgagaagt 2460ttgtggagac aatgaagcta
atggaacata ggtatggagc aaaggacttt gtgacaacca 2520aggagggtat tatagatctt
ttggcaccgg gaacttatta tctgaaagag gttgattcct 2580tgtaccggag attctatggc
aagaaaggtg aagatggatc tgtagccaat ggacactgag 2640gatccgtcga gcacgtggag
gcacatatgc aatgctgtga gatgcctgtt ggatacattc 2700agattcctgt tgggattgct
ggtccattgt tgcttgatgg ttatgagtac tctgttccta 2760tggctacaac cgaaggttgt
ttggttgcta gcactaacag aggctgcaag gctatgttta 2820tctctggtgg cgccaccagt
accgttctta aggacggtat gacccgagca cctgttgttc 2880ggttcgcttc ggcgagacga
gcttcggagc ttaagttttt cttggagaat ccagagaact 2940ttgatacttt ggcagtagtc
ttcaacaggt cgagtagatt tgcaagactg caaagtgtta 3000aatgcacaat cgcggggaag
aatgcttatg taaggttctg ttgtagtact ggtgatgcta 3060tggggatgaa tatggtttct
aaaggtgtgc agaatgttct tgagtatctt accgatgatt 3120tccctgacat ggatgtgatt
ggaatctctg gtaacttctg ttcggacaag aaacctgctg 3180ctgtgaactg gattgaggga
cgtggtaaat cagttgtttg cgaggctgta atcagaggag 3240agatcgtgaa caaggtcttg
aaaacgagcg tggctgcttt agtcgagctc aacatgctca 3300agaacctagc tggctctgct
gttgcaggct ctctaggtgg attcaacgct catgccagta 3360acatagtgtc tgctgtattc
atagctactg gccaagatcc agctcaaaac gtggagagtt 3420ctcaatgcat caccatgatg
gaagctatta atgacggcaa agatatccat atctcagtca 3480ctatgccatc tatcgaggtg
gggacagtgg gaggaggaac acagcttgca tctcaatcag 3540cgtgtttaaa cctgctcgga
gttaaaggag caagcacaga gtcgccggga atgaacgcaa 3600ggaggctagc gacgatcgta
gccggagcag ttttagctgg agagttatct ttaatgtcag 3660caattgcagc tggacagctt
gtgagaagtc acatgaaata caatagatcc agccgagaca 3720tctctggagc aacgacaacg
acaacaacaa caacatgacc cgggatccgg ccgcaggagg 3780agttcatatg tcagagttga
gagccttcag tgccccaggg aaagcgttac tagctggtgg 3840atatttagtt ttagatacaa
aatatgaagc atttgtagtc ggattatcgg caagaatgca 3900tgctgtagcc catccttacg
gttcattgca agggtctgat aagtttgaag tgcgtgtgaa 3960aagtaaacaa tttaaagatg
gggagtggct gtaccatata agtcctaaaa gtggcttcat 4020tcctgtttcg ataggcggat
ctaagaaccc tttcattgaa aaagttatcg ctaacgtatt 4080tagctacttt aaacctaaca
tggacgacta ctgcaataga aacttgttcg ttattgatat 4140tttctctgat gatgcctacc
attctcagga ggatagcgtt accgaacatc gtggcaacag 4200aagattgagt tttcattcgc
acagaattga agaagttccc aaaacagggc tgggctcctc 4260ggcaggttta gtcacagttt
taactacagc tttggcctcc ttttttgtat cggacctgga 4320aaataatgta gacaaatata
gagaagttat tcataattta gcacaagttg ctcattgtca 4380agctcagggt aaaattggaa
gcgggtttga tgtagcggcg gcagcatatg gatctatcag 4440atatagaaga ttcccacccg
cattaatctc taatttgcca gatattggaa gtgctactta 4500cggcagtaaa ctggcgcatt
tggttgatga agaagactgg aatattacga ttaaaagtaa 4560ccatttacct tcgggattaa
ctttatggat gggcgatatt aagaatggtt cagaaacagt 4620aaaactggtc cagaaggtaa
aaaattggta tgattcgcat atgccagaaa gcttgaaaat 4680atatacagaa ctcgatcatg
caaattctag atttatggat ggactatcta aactagatcg 4740cttacacgag actcatgacg
attacagcga tcagatattt gagtctcttg agaggaatga 4800ctgtacctgt caaaagtatc
ctgaaatcac agaagttaga gatgcagttg ccacaattag 4860acgttccttt agaaaaataa
ctaaagaatc tggtgccgat atcgaacctc ccgtacaaac 4920tagcttattg gatgattgcc
agaccttaaa aggagttctt acttgcttaa tacctggtgc 4980tggtggttat gacgccattg
cagtgattac taagcaagat gttgatctta gggctcaaac 5040cgctaatgac aaaagatttt
ctaaggttca atggctggat gtaactcagg ctgactgggg 5100tgttaggaaa gaaaaagatc
cggaaactta tcttgataaa ctgcaggagg agttttaatg 5160tcattaccgt tcttaacttc
tgcaccggga aaggttatta tttttggtga acactctgct 5220gtgtacaaca agcctgccgt
cgctgctagt gtgtctgcgt tgagaaccta cctgctaata 5280agcgagtcat ctgcaccaga
tactattgaa ttggacttcc cggacattag ctttaatcat 5340aagtggtcca tcaatgattt
caatgccatc accgaggatc aagtaaactc ccaaaaattg 5400gccaaggctc aacaagccac
cgatggcttg tctcaggaac tcgttagtct tttggatccg 5460ttgttagctc aactatccga
atccttccac taccatgcag cgttttgttt cctgtatatg 5520tttgtttgcc tatgccccca
tgccaagaat attaagtttt ctttaaagtc tactttaccc 5580atcggtgctg ggttgggctc
aagcgcctct atttctgtat cactggcctt agctatggcc 5640tacttggggg ggttaatagg
atctaatgac ttggaaaagc tgtcagaaaa cgataagcat 5700atagtgaatc aatgggcctt
cataggtgaa aagtgtattc acggtacccc ttcaggaata 5760gataacgctg tggccactta
tggtaatgcc ctgctatttg aaaaagactc acataatgga 5820acaataaaca caaacaattt
taagttctta gatgatttcc cagccattcc aatgatccta 5880acctatacta gaattccaag
gtctacaaaa gatcttgttg ctcgcgttcg tgtgttggtc 5940accgagaaat ttcctgaagt
tatgaagcca attctagatg ccatgggtga atgtgcccta 6000caaggcttag agatcatgac
taagttaagt aaatgtaaag gcaccgatga cgaggctgta 6060gaaactaata atgaactgta
tgaacaacta ttggaattga taagaataaa tcatggactg 6120cttgtctcaa tcggtgtttc
tcatcctgga ttagaactta ttaaaaatct gagcgatgat 6180ttgagaattg gctccacaaa
acttaccggt gctggtggcg gcggttgctc tttgactttg 6240ttacgaagag acattactca
agagcaaatt gacagcttca aaaagaaatt gcaagatgat 6300tttagttacg agacatttga
aacagacttg ggtgggactg gctgctgttt gttaagcgca 6360aaaaatttga ataaagatct
taaaatcaaa tccctagtat tccaattatt tgaaaataaa 6420actaccacaa agcaacaaat
tgacgatcta ttattgccag gaaacacgaa tttaccatgg 6480acttcacagg aggagtttta
atgactgtat atactgctag tgtaactgct ccggtaaata 6540ttgctactct taagtattgg
gggaaaaggg acacgaagtt gaatctgccc accaattcgt 6600ccatatcagt gactttatcg
caagatgacc tcagaacgtt gacctctgcg gctactgcac 6660ctgagtttga acgcgacact
ttgtggttaa atggagaacc acacagcatc gacaatgaaa 6720gaactcaaaa ttgtctgcgc
gacctacgcc aattaagaaa ggaaatggaa tcgaaggacg 6780cctcattgcc cacattatct
caatggaaac tccacattgt ctccgaaaat aactttccta 6840cagcagctgg tttagcttcc
tccgctgctg gctttgctgc attggtctct gcaattgcta 6900agttatacca attaccacag
tcaacttcag aaatatctag aatagcaaga aaggggtctg 6960gttcagcttg tagatcgttg
tttggcggat acgtggcctg ggaaatggga aaagctgaag 7020atggtcatga ttccatggca
gtacaaatcg cagacagctc tgactggcct cagatgaaag 7080cttgtgtcct agttgtcagc
gatattaaaa aggatgtgag ttccactcag ggtatgcaat 7140tgaccgtggc aacctccgaa
ctatttaaag aaagaattga acatgtcgta ccaaagagat 7200ttgaagtcat gcgtaaagcc
attgttgaaa aagatttcgc cacctttgca aaggaaacaa 7260tgatggattc caactctttc
catgccacat gtttggactc tttccctcca atattctaca 7320tgaatgacac ttccaagcgt
atcatcagtt ggtgccacac cattaatcag ttttacggag 7380aaacaatcgt tgcatacacg
tttgatgcag gtccaaatgc tgtgttgtac tacttagctg 7440aaaatgagtc gaaactcttt
gcatttatct ataaattgtt tggctctgtt cctggatggg 7500acaagaaatt tactactgag
cagcttgagg ctttcaacca tcaatttgaa tcatctaact 7560ttactgcacg tgaattggat
cttgagttgc aaaaggatgt tgccagagtg attttaactc 7620aagtcggttc aggcccacaa
gaaacaaacg aatctttgat tgacgcaaag actggtctac 7680caaaggaata act
7693597695DNAArtificial
SequenceOperon B containing A. thaliana and S. cerevisiae DNA
59ggccgcagga ggagttcata tgtcagagtt gagagccttc agtgccccag ggaaagcgtt
60actagctggt ggatatttag ttttagatac aaaatatgaa gcatttgtag tcggattatc
120ggcaagaatg catgctgtag cccatcctta cggttcattg caagggtctg ataagtttga
180agtgcgtgtg aaaagtaaac aatttaaaga tggggagtgg ctgtaccata taagtcctaa
240aagtggcttc attcctgttt cgataggcgg atctaagaac cctttcattg aaaaagttat
300cgctaacgta tttagctact ttaaacctaa catggacgac tactgcaata gaaacttgtt
360cgttattgat attttctctg atgatgccta ccattctcag gaggatagcg ttaccgaaca
420tcgtggcaac agaagattga gttttcattc gcacagaatt gaagaagttc ccaaaacagg
480gctgggctcc tcggcaggtt tagtcacagt tttaactaca gctttggcct ccttttttgt
540atcggacctg gaaaataatg tagacaaata tagagaagtt attcataatt tagcacaagt
600tgctcattgt caagctcagg gtaaaattgg aagcgggttt gatgtagcgg cggcagcata
660tggatctatc agatatagaa gattcccacc cgcattaatc tctaatttgc cagatattgg
720aagtgctact tacggcagta aactggcgca tttggttgat gaagaagact ggaatattac
780gattaaaagt aaccatttac cttcgggatt aactttatgg atgggcgata ttaagaatgg
840ttcagaaaca gtaaaactgg tccagaaggt aaaaaattgg tatgattcgc atatgccaga
900aagcttgaaa atatatacag aactcgatca tgcaaattct agatttatgg atggactatc
960taaactagat cgcttacacg agactcatga cgattacagc gatcagatat ttgagtctct
1020tgagaggaat gactgtacct gtcaaaagta tcctgaaatc acagaagtta gagatgcagt
1080tgccacaatt agacgttcct ttagaaaaat aactaaagaa tctggtgccg atatcgaacc
1140tcccgtacaa actagcttat tggatgattg ccagacctta aaaggagttc ttacttgctt
1200aatacctggt gctggtggtt atgacgccat tgcagtgatt actaagcaag atgttgatct
1260tagggctcaa accgctaatg acaaaagatt ttctaaggtt caatggctgg atgtaactca
1320ggctgactgg ggtgttagga aagaaaaaga tccggaaact tatcttgata aactgcagga
1380ggagttttaa tgtcattacc gttcttaact tctgcaccgg gaaaggttat tatttttggt
1440gaacactctg ctgtgtacaa caagcctgcc gtcgctgcta gtgtgtctgc gttgagaacc
1500tacctgctaa taagcgagtc atctgcacca gatactattg aattggactt cccggacatt
1560agctttaatc ataagtggtc catcaatgat ttcaatgcca tcaccgagga tcaagtaaac
1620tcccaaaaat tggccaaggc tcaacaagcc accgatggct tgtctcagga actcgttagt
1680cttttggatc cgttgttagc tcaactatcc gaatccttcc actaccatgc agcgttttgt
1740ttcctgtata tgtttgtttg cctatgcccc catgccaaga atattaagtt ttctttaaag
1800tctactttac ccatcggtgc tgggttgggc tcaagcgcct ctatttctgt atcactggcc
1860ttagctatgg cctacttggg ggggttaata ggatctaatg acttggaaaa gctgtcagaa
1920aacgataagc atatagtgaa tcaatgggcc ttcataggtg aaaagtgtat tcacggtacc
1980ccttcaggaa tagataacgc tgtggccact tatggtaatg ccctgctatt tgaaaaagac
2040tcacataatg gaacaataaa cacaaacaat tttaagttct tagatgattt cccagccatt
2100ccaatgatcc taacctatac tagaattcca aggtctacaa aagatcttgt tgctcgcgtt
2160cgtgtgttgg tcaccgagaa atttcctgaa gttatgaagc caattctaga tgccatgggt
2220gaatgtgccc tacaaggctt agagatcatg actaagttaa gtaaatgtaa aggcaccgat
2280gacgaggctg tagaaactaa taatgaactg tatgaacaac tattggaatt gataagaata
2340aatcatggac tgcttgtctc aatcggtgtt tctcatcctg gattagaact tattaaaaat
2400ctgagcgatg atttgagaat tggctccaca aaacttaccg gtgctggtgg cggcggttgc
2460tctttgactt tgttacgaag agacattact caagagcaaa ttgacagctt caaaaagaaa
2520ttgcaagatg attttagtta cgagacattt gaaacagact tgggtgggac tggctgctgt
2580ttgttaagcg caaaaaattt gaataaagat cttaaaatca aatccctagt attccaatta
2640tttgaaaata aaactaccac aaagcaacaa attgacgatc tattattgcc aggaaacacg
2700aatttaccat ggacttcaga cgaggagttt taatgactgt atatactgct agtgtaactg
2760ctccggtaaa tattgctact cttaagtatt gggggaaaag ggacacgaag ttgaatctgc
2820ccaccaattc gtccatatca gtgactttat cgcaagatga cctcagaacg ttgacctctg
2880cggctactgc acctgagttt gaacgcgaca ctttgtggtt aaatggagaa ccacacagca
2940tcgacaatga aagaactcaa aattgtctgc gcgacctacg ccaattaaga aaggaaatgg
3000aatcgaagga cgcctcattg cccacattat ctcaatggaa actccacatt gtctccgaaa
3060ataactttcc tacagcagct ggtttagctt cctccgctgc tggctttgct gcattggtct
3120ctgcaattgc taagttatac caattaccac agtcaacttc agaaatatct agaatagcaa
3180gaaaggggtc tggttcagct tgtagatcgt tgtttggcgg atacgtggcc tgggaaatgg
3240gaaaagctga agatggtcat gattccatgg cagtacaaat cgcagacagc tctgactggc
3300ctcagatgaa agcttgtgtc ctagttgtca gcgatattaa aaaggatgtg agttccactc
3360agggtatgca attgaccgtg gcaacctccg aactatttaa agaaagaatt gaacatgtcg
3420taccaaagag atttgaagtc atgcgtaaag ccattgttga aaaagatttc gccacctttg
3480caaaggaaac aatgatggat tccaactctt tccatgccac atgtttggac tctttccctc
3540caatattcta catgaatgac acttccaagc gtatcatcag ttggtgccac accattaatc
3600agttttacgg agaaacaatc gttgcataca cgtttgatgc aggtccaaat gctgtgttgt
3660actacttagc tgaaaatgag tcgaaactct ttgcatttat ctataaattg tttggctctg
3720ttcctggatg ggacaagaaa tttactactg agcagcttga ggctttcaac catcaatttg
3780aatcatctaa ctttactgca cgtgaattgg atcttgagtt gcaaaaggat gttgccagag
3840tgattttaac tcaagtcggt tcaggcccac aagaaacaaa cgaatctttg attgacgcaa
3900agactggtct accaaaggaa gaggagtttt aactcgacgc cggcggaggc acatatgtct
3960cagaacgttt acattgtatc gactgccaga accccaattg gttcattcca gggttctcta
4020tcctccaaga cagcagtgga attgggtgct gttgctttaa aaggcgcctt ggctaaggtt
4080ccagaattgg atgcatccaa ggattttgac gaaattattt ttggtaacgt tctttctgcc
4140aatttgggcc aagctccggc cagacaagtt gctttggctg ccggtttgag taatcatatc
4200gttgcaagca cagttaacaa ggtctgtgca tccgctatga aggcaatcat tttgggtgct
4260caatccatca aatgtggtaa tgctgatgtt gtcgtagctg gtggttgtga atctatgact
4320aacgcaccat actacatgcc agcagcccgt gcgggtgcca aatttggcca aactgttctt
4380gttgatggtg tcgaaagaga tgggttgaac gatgcgtacg atggtctagc catgggtgta
4440cacgcagaaa agtgtgcccg tgattgggat attactagag aacaacaaga caattttgcc
4500atcgaatcct accaaaaatc tcaaaaatct caaaaggaag gtaaattcga caatgaaatt
4560gtacctgtta ccattaaggg atttagaggt aagcctgata ctcaagtcac gaaggacgag
4620gaacctgcta gattacacgt tgaaaaattg agatctgcaa ggactgtttt ccaaaaagaa
4680aacggtactg ttactgccgc taacgcttct ccaatcaacg atggtgctgc agccgtcatc
4740ttggtttccg aaaaagtttt gaaggaaaag aatttgaagc ctttggctat tatcaaaggt
4800tggggtgagg ccgctcatca accagctgat tttacatggg ctccatctct tgcagttcca
4860aaggctttga aacatgctgg catcgaagac atcaattctg ttgattactt tgaattcaat
4920gaagcctttt cggttgtcgg tttggtgaac actaagattt tgaagctaga cccatctaag
4980gttaatgtat atggtggtgc tgttgctcta ggtcacccat tgggttgttc tggtgctaga
5040gtggttgtta cactgctatc catcttacag caagaaggag gtaagatcgg tgttgccgcc
5100atttgtaatg gtggtggtgg tgcttcctct attgtcattg aaaagatatg aggatcctct
5160agatgcgcag gaggcacata tggcgaagaa cgttgggatt ttggctatgg atatctattt
5220ccctcccacc tgtgttcaac aggaagcttt ggaagcacat gatggagcaa gtaaagggaa
5280atacactatt ggacttggcc aagattgttt agctttttgc actgagcttg aagatgttat
5340ctctatgagt ttcaatgcgg tgacatcact ttttgagaag tataagattg accctaacca
5400aatcgggcgt cttgaagtag gaagtgagac tgttattgac aaaagcaagt ccatcaagac
5460cttcttgatg cagctctttg agaaatgtgg aaacactgat gtcgaaggtg ttgactcgac
5520caatgcttgc tatggtggaa ctgcagcttt gttaaactgt gtcaattggg ttgagagtaa
5580ctcttgggat ggacgttatg gcctcgtcat ttgtactgac agcgcggttt atgcagaagg
5640acccgcaagg cccactggag gagctgcagc gattgctatg ttgataggac ctgatgctcc
5700tatcgttttc gaaagcaaat tgagagcaag ccacatggct catgtctatg acttttacaa
5760gcccaatctt gctagcgagt acccggttgt tgatggtaag ctttcacaga cttgctacct
5820catggctctt gactcctgct ataaacattt atgcaacaag ttcgagaaga tcgagggcaa
5880agagttctcc ataaatgatg ctgattacat tgttttccat tctccataca ataaacttgt
5940acagaaaagc tttgctcgtc tcttgtacaa cgacttcttg agaaacgcaa gctccattga
6000cgaggctgcc aaagaaaagt tcacccctta ttcatctttg acccttgacg agagttacca
6060aagccgtgat cttgaaaagg tgtcacaaca aatttcgaaa ccgttttatg atgctaaagt
6120gcaaccaacg actttaatac caaaggaagt cggtaacatg tacactgctt ctctctacgc
6180tgcatttgct tccctcatcc acaataaaca caatgatttg gcgggaaagc gggtggttat
6240gttctcttat ggaagtggct ccaccgcaac aatgttctca ttacgcctca acgacaataa
6300gcctcctttc agcatttcaa acattgcatc tgtaatggat gttggcggta aattgaaagc
6360tagacatgag tatgcacctg agaagtttgt ggagacaatg aagctaatgg aacataggta
6420tggagcaaag gactttgtga caaccaagga gggtattata gatcttttgg caccgggaac
6480ttattatctg aaagaggttg attccttgta ccggagattc tatggcaaga aaggtgaaga
6540tggatctgta gccaatggac actgaggatc cgtcgagcac gtggaggcac atatgcaatg
6600ctgtgagatg cctgttggat acattcagat tcctgttggg attgctggtc cattgttgct
6660tgatggttat gagtactctg ttcctatggc tacaaccgaa ggttgtttgg ttgctagcac
6720taacagaggc tgcaaggcta tgtttatctc tggtggcgcc accagtaccg ttcttaagga
6780cggtatgacc cgagcacctg ttgttcggtt cgcttcggcg agacgagctt cggagcttaa
6840gtttttcttg gagaatccag agaactttga tactttggca gtagtcttca acaggtcgag
6900tagatttgca agactgcaaa gtgttaaatg cacaatcgcg gggaagaatg cttatgtaag
6960gttctgttgt agtactggtg atgctatggg gatgaatatg gtttctaaag gtgtgcagaa
7020tgttcttgag tatcttaccg atgatttccc tgacatggat gtgattggaa tctctggtaa
7080cttctgttcg gacaagaaac ctgctgctgt gaactggatt gagggacgtg gtaaatcagt
7140tgtttgcgag gctgtaatca gaggagagat cgtgaacaag gtcttgaaaa cgagcgtggc
7200tgctttagtc gagctcaaca tgctcaagaa cctagctggc tctgctgttg caggctctct
7260aggtggattc aacgctcatg ccagtaacat agtgtctgct gtattcatag ctactggcca
7320agatccagct caaaacgtgg agagttctca atgcatcacc atgatggaag ctattaatga
7380cggcaaagat atccatatct cagtcactat gccatctatc gaggtgggga cagtgggagg
7440aggaacacag cttgcatctc aatcagcgtg tttaaacctg ctcggagtta aaggagcaag
7500cacagagtcg ccgggaatga acgcaaggag gctagcgacg atcgtagccg gagcagtttt
7560agctggagag ttatctttaa tgtcagcaat tgcagctgga cagcttgtga gaagtcacat
7620gaaatacaat agatccagcc gagacatctc tggagcaacg acaacgacaa caacaacaac
7680atgacccggg atccg
7695608235DNAArtificial SequenceOperon C containing A. thaliana, S.
cerevisiae, and R. caosulatus DNA 60ggccgcagga ggagttcata tgtcagagtt
gagagccttc agtgccccag ggaaagcgtt 60actagctggt ggatatttag ttttagatac
aaaatatgaa gcatttgtag tcggattatc 120ggcaagaatg catgctgtag cccatcctta
cggttcattg caagggtctg ataagtttga 180agtgcgtgtg aaaagtaaac aatttaaaga
tggggagtgg ctgtaccata taagtcctaa 240aagtggcttc attcctgttt cgataggcgg
atctaagaac cctttcattg aaaaagttat 300cgctaacgta tttagctact ttaaacctaa
catggacgac tactgcaata gaaacttgtt 360cgttattgat attttctctg atgatgccta
ccattctcag gaggatagcg ttaccgaaca 420tcgtggcaac agaagattga gttttcattc
gcacagaatt gaagaagttc ccaaaacagg 480gctgggctcc tcggcaggtt tagtcacagt
tttaactaca gctttggcct ccttttttgt 540atcggacctg gaaaataatg tagacaaata
tagagaagtt attcataatt tagcacaagt 600tgctcattgt caagctcagg gtaaaattgg
aagcgggttt gatgtagcgg cggcagcata 660tggatctatc agatatagaa gattcccacc
cgcattaatc tctaatttgc cagatattgg 720aagtgctact tacggcagta aactggcgca
tttggttgat gaagaagact ggaatattac 780gattaaaagt aaccatttac cttcgggatt
aactttatgg atgggcgata ttaagaatgg 840ttcagaaaca gtaaaactgg tccagaaggt
aaaaaattgg tatgattcgc atatgccaga 900aagcttgaaa atatatacag aactcgatca
tgcaaattct agatttatgg atggactatc 960taaactagat cgcttacacg agactcatga
cgattacagc gatcagatat ttgagtctct 1020tgagaggaat gactgtacct gtcaaaagta
tcctgaaatc acagaagtta gagatgcagt 1080tgccacaatt agacgttcct ttagaaaaat
aactaaagaa tctggtgccg atatcgaacc 1140tcccgtacaa actagcttat tggatgattg
ccagacctta aaaggagttc ttacttgctt 1200aatacctggt gctggtggtt atgacgccat
tgcagtgatt actaagcaag atgttgatct 1260tagggctcaa accgctaatg acaaaagatt
ttctaaggtt caatggctgg atgtaactca 1320ggctgactgg ggtgttagga aagaaaaaga
tccggaaact tatcttgata aactgcagga 1380ggagttttaa tgtcattacc gttcttaact
tctgcaccgg gaaaggttat tatttttggt 1440gaacactctg ctgtgtacaa caagcctgcc
gtcgctgcta gtgtgtctgc gttgagaacc 1500tacctgctaa taagcgagtc atctgcacca
gatactattg aattggactt cccggacatt 1560agctttaatc ataagtggtc catcaatgat
ttcaatgcca tcaccgagga tcaagtaaac 1620tcccaaaaat tggccaaggc tcaacaagcc
accgatggct tgtctcagga actcgttagt 1680cttttggatc cgttgttagc tcaactatcc
gaatccttcc actaccatgc agcgttttgt 1740ttcctgtata tgtttgtttg cctatgcccc
catgccaaga atattaagtt ttctttaaag 1800tctactttac ccatcggtgc tgggttgggc
tcaagcgcct ctatttctgt atcactggcc 1860ttagctatgg cctacttggg ggggttaata
ggatctaatg acttggaaaa gctgtcagaa 1920aacgataagc atatagtgaa tcaatgggcc
ttcataggtg aaaagtgtat tcacggtacc 1980ccttcaggaa tagataacgc tgtggccact
tatggtaatg ccctgctatt tgaaaaagac 2040tcacataatg gaacaataaa cacaaacaat
tttaagttct tagatgattt cccagccatt 2100ccaatgatcc taacctatac tagaattcca
aggtctacaa aagatcttgt tgctcgcgtt 2160cgtgtgttgg tcaccgagaa atttcctgaa
gttatgaagc caattctaga tgccatgggt 2220gaatgtgccc tacaaggctt agagatcatg
actaagttaa gtaaatgtaa aggcaccgat 2280gacgaggctg tagaaactaa taatgaactg
tatgaacaac tattggaatt gataagaata 2340aatcatggac tgcttgtctc aatcggtgtt
tctcatcctg gattagaact tattaaaaat 2400ctgagcgatg atttgagaat tggctccaca
aaacttaccg gtgctggtgg cggcggttgc 2460tctttgactt tgttacgaag agacattact
caagagcaaa ttgacagctt caaaaagaaa 2520ttgcaagatg attttagtta cgagacattt
gaaacagact tgggtgggac tggctgctgt 2580ttgttaagcg caaaaaattt gaataaagat
cttaaaatca aatccctagt attccaatta 2640tttgaaaata aaactaccac aaagcaacaa
attgacgatc tattattgcc aggaaacacg 2700aatttaccat ggacttcaga cgaggagttt
taatgactgt atatactgct agtgtaactg 2760ctccggtaaa tattgctact cttaagtatt
gggggaaaag ggacacgaag ttgaatctgc 2820ccaccaattc gtccatatca gtgactttat
cgcaagatga cctcagaacg ttgacctctg 2880cggctactgc acctgagttt gaacgcgaca
ctttgtggtt aaatggagaa ccacacagca 2940tcgacaatga aagaactcaa aattgtctgc
gcgacctacg ccaattaaga aaggaaatgg 3000aatcgaagga cgcctcattg cccacattat
ctcaatggaa actccacatt gtctccgaaa 3060ataactttcc tacagcagct ggtttagctt
cctccgctgc tggctttgct gcattggtct 3120ctgcaattgc taagttatac caattaccac
agtcaacttc agaaatatct agaatagcaa 3180gaaaggggtc tggttcagct tgtagatcgt
tgtttggcgg atacgtggcc tgggaaatgg 3240gaaaagctga agatggtcat gattccatgg
cagtacaaat cgcagacagc tctgactggc 3300ctcagatgaa agcttgtgtc ctagttgtca
gcgatattaa aaaggatgtg agttccactc 3360agggtatgca attgaccgtg gcaacctccg
aactatttaa agaaagaatt gaacatgtcg 3420taccaaagag atttgaagtc atgcgtaaag
ccattgttga aaaagatttc gccacctttg 3480caaaggaaac aatgatggat tccaactctt
tccatgccac atgtttggac tctttccctc 3540caatattcta catgaatgac acttccaagc
gtatcatcag ttggtgccac accattaatc 3600agttttacgg agaaacaatc gttgcataca
cgtttgatgc aggtccaaat gctgtgttgt 3660actacttagc tgaaaatgag tcgaaactct
ttgcatttat ctataaattg tttggctctg 3720ttcctggatg ggacaagaaa tttactactg
agcagcttga ggctttcaac catcaatttg 3780aatcatctaa ctttactgca cgtgaattgg
atcttgagtt gcaaaaggat gttgccagag 3840tgattttaac tcaagtcggt tcaggcccac
aagaaacaaa cgaatctttg attgacgcaa 3900agactggtct accaaaggaa gaggagtttt
aactcgacgc cggcggaggc acatatgtct 3960cagaacgttt acattgtatc gactgccaga
accccaattg gttcattcca gggttctcta 4020tcctccaaga cagcagtgga attgggtgct
gttgctttaa aaggcgcctt ggctaaggtt 4080ccagaattgg atgcatccaa ggattttgac
gaaattattt ttggtaacgt tctttctgcc 4140aatttgggcc aagctccggc cagacaagtt
gctttggctg ccggtttgag taatcatatc 4200gttgcaagca cagttaacaa ggtctgtgca
tccgctatga aggcaatcat tttgggtgct 4260caatccatca aatgtggtaa tgctgatgtt
gtcgtagctg gtggttgtga atctatgact 4320aacgcaccat actacatgcc agcagcccgt
gcgggtgcca aatttggcca aactgttctt 4380gttgatggtg tcgaaagaga tgggttgaac
gatgcgtacg atggtctagc catgggtgta 4440cacgcagaaa agtgtgcccg tgattgggat
attactagag aacaacaaga caattttgcc 4500atcgaatcct accaaaaatc tcaaaaatct
caaaaggaag gtaaattcga caatgaaatt 4560gtacctgtta ccattaaggg atttagaggt
aagcctgata ctcaagtcac gaaggacgag 4620gaacctgcta gattacacgt tgaaaaattg
agatctgcaa ggactgtttt ccaaaaagaa 4680aacggtactg ttactgccgc taacgcttct
ccaatcaacg atggtgctgc agccgtcatc 4740ttggtttccg aaaaagtttt gaaggaaaag
aatttgaagc ctttggctat tatcaaaggt 4800tggggtgagg ccgctcatca accagctgat
tttacatggg ctccatctct tgcagttcca 4860aaggctttga aacatgctgg catcgaagac
atcaattctg ttgattactt tgaattcaat 4920gaagcctttt cggttgtcgg tttggtgaac
actaagattt tgaagctaga cccatctaag 4980gttaatgtat atggtggtgc tgttgctcta
ggtcacccat tgggttgttc tggtgctaga 5040gtggttgtta cactgctatc catcttacag
caagaaggag gtaagatcgg tgttgccgcc 5100atttgtaatg gtggtggtgg tgcttcctct
attgtcattg aaaagatatg aggatcctct 5160agatgcgcag gaggcacata tggcgaagaa
cgttgggatt ttggctatgg atatctattt 5220ccctcccacc tgtgttcaac aggaagcttt
ggaagcacat gatggagcaa gtaaagggaa 5280atacactatt ggacttggcc aagattgttt
agctttttgc actgagcttg aagatgttat 5340ctctatgagt ttcaatgcgg tgacatcact
ttttgagaag tataagattg accctaacca 5400aatcgggcgt cttgaagtag gaagtgagac
tgttattgac aaaagcaagt ccatcaagac 5460cttcttgatg cagctctttg agaaatgtgg
aaacactgat gtcgaaggtg ttgactcgac 5520caatgcttgc tatggtggaa ctgcagcttt
gttaaactgt gtcaattggg ttgagagtaa 5580ctcttgggat ggacgttatg gcctcgtcat
ttgtactgac agcgcggttt atgcagaagg 5640acccgcaagg cccactggag gagctgcagc
gattgctatg ttgataggac ctgatgctcc 5700tatcgttttc gaaagcaaat tgagagcaag
ccacatggct catgtctatg acttttacaa 5760gcccaatctt gctagcgagt acccggttgt
tgatggtaag ctttcacaga cttgctacct 5820catggctctt gactcctgct ataaacattt
atgcaacaag ttcgagaaga tcgagggcaa 5880agagttctcc ataaatgatg ctgattacat
tgttttccat tctccataca ataaacttgt 5940acagaaaagc tttgctcgtc tcttgtacaa
cgacttcttg agaaacgcaa gctccattga 6000cgaggctgcc aaagaaaagt tcacccctta
ttcatctttg acccttgacg agagttacca 6060aagccgtgat cttgaaaagg tgtcacaaca
aatttcgaaa ccgttttatg atgctaaagt 6120gcaaccaacg actttaatac caaaggaagt
cggtaacatg tacactgctt ctctctacgc 6180tgcatttgct tccctcatcc acaataaaca
caatgatttg gcgggaaagc gggtggttat 6240gttctcttat ggaagtggct ccaccgcaac
aatgttctca ttacgcctca acgacaataa 6300gcctcctttc agcatttcaa acattgcatc
tgtaatggat gttggcggta aattgaaagc 6360tagacatgag tatgcacctg agaagtttgt
ggagacaatg aagctaatgg aacataggta 6420tggagcaaag gactttgtga caaccaagga
gggtattata gatcttttgg caccgggaac 6480ttattatctg aaagaggttg attccttgta
ccggagattc tatggcaaga aaggtgaaga 6540tggatctgta gccaatggac actgaggatc
cgtcgagcac gtggaggcac atatgcaatg 6600ctgtgagatg cctgttggat acattcagat
tcctgttggg attgctggtc cattgttgct 6660tgatggttat gagtactctg ttcctatggc
tacaaccgaa ggttgtttgg ttgctagcac 6720taacagaggc tgcaaggcta tgtttatctc
tggtggcgcc accagtaccg ttcttaagga 6780cggtatgacc cgagcacctg ttgttcggtt
cgcttcggcg agacgagctt cggagcttaa 6840gtttttcttg gagaatccag agaactttga
tactttggca gtagtcttca acaggtcgag 6900tagatttgca agactgcaaa gtgttaaatg
cacaatcgcg gggaagaatg cttatgtaag 6960gttctgttgt agtactggtg atgctatggg
gatgaatatg gtttctaaag gtgtgcagaa 7020tgttcttgag tatcttaccg atgatttccc
tgacatggat gtgattggaa tctctggtaa 7080cttctgttcg gacaagaaac ctgctgctgt
gaactggatt gagggacgtg gtaaatcagt 7140tgtttgcgag gctgtaatca gaggagagat
cgtgaacaag gtcttgaaaa cgagcgtggc 7200tgctttagtc gagctcaaca tgctcaagaa
cctagctggc tctgctgttg caggctctct 7260aggtggattc aacgctcatg ccagtaacat
agtgtctgct gtattcatag ctactggcca 7320agatccagct caaaacgtgg agagttctca
atgcatcacc atgatggaag ctattaatga 7380cggcaaagat atccatatct cagtcactat
gccatctatc gaggtgggga cagtgggagg 7440aggaacacag cttgcatctc aatcagcgtg
tttaaacctg ctcggagtta aaggagcaag 7500cacagagtcg ccgggaatga acgcaaggag
gctagcgacg atcgtagccg gagcagtttt 7560agctggagag ttatctttaa tgtcagcaat
tgcagctgga cagcttgtga gaagtcacat 7620gaaatacaat agatccagcc gagacatctc
tggagcaacg acaacgacaa caacaacaac 7680atgacccgta aggaggcaca tatgagtgag
cttatacccg cctgggttgg tgacagactg 7740gctccggtgg acaagttgga ggtgcatttg
aaagggctcc gccacaaggc ggtgtctgtt 7800ttcgtcatgg atggcgaaaa cgtgctgatc
cagcgccgct cggaggagaa atatcactct 7860cccgggcttt gggcgaacac ctgctgcacc
catccgggct ggaccgaacg ccccgaggaa 7920tgcgcggtgc ggcggctgcg cgaggagctg
gggatcaccg ggctttatcc cgcccatgcc 7980gaccggctgg aatatcgcgc cgatgtcggc
ggcggcatga tcgagcatga ggtggtcgac 8040atctatctgg cctatgccaa accgcatatg
cggatcaccc ccgatccgcg cgaagtggcc 8100gaggtgcgct ggatcggcct ttacgatctg
gcggccgagg ccggtcggca tcccgagcgg 8160ttctcgaaat ggctcaacat ctatctgtcg
agccatcttg accggatttt cggatcgatc 8220ctgcgcggct gagcg
8235617681DNAArtificial SequenceOperon C
containing A. thaliana, S. cerevisiae, and Streptomyces sp CL190
DNA, and R. capsulatus DNA 61ggccgcgtcg actacggccg caggaggagt tcatatgtca
gagttgagag ccttcagtgc 60cccagggaaa gcgttactag ctggtggata tttagtttta
gatacaaaat atgaagcatt 120tgtagtcgga ttatcggcaa gaatgcatgc tgtagcccat
ccttacggtt cattgcaagg 180gtctgataag tttgaagtgc gtgtgaaaag taaacaattt
aaagatgggg agtggctgta 240ccatataagt cctaaaagtg gcttcattcc tgtttcgata
ggcggatcta agaacccttt 300cattgaaaaa gttatcgcta acgtatttag ctactttaaa
cctaacatgg acgactactg 360caatagaaac ttgttcgtta ttgatatttt ctctgatgat
gcctaccatt ctcaggagga 420tagcgttacc gaacatcgtg gcaacagaag attgagtttt
cattcgcaca gaattgaaga 480agttcccaaa acagggctgg gctcctcggc aggtttagtc
acagttttaa ctacagcttt 540ggcctccttt tttgtatcgg acctggaaaa taatgtagac
aaatatagag aagttattca 600taatttagca caagttgctc attgtcaagc tcagggtaaa
attggaagcg ggtttgatgt 660agcggcggca gcatatggat ctatcagata tagaagattc
ccacccgcat taatctctaa 720tttgccagat attggaagtg ctacttacgg cagtaaactg
gcgcatttgg ttgatgaaga 780agactggaat attacgatta aaagtaacca tttaccttcg
ggattaactt tatggatggg 840cgatattaag aatggttcag aaacagtaaa actggtccag
aaggtaaaaa attggtatga 900ttcgcatatg ccagaaagct tgaaaatata tacagaactc
gatcatgcaa attctagatt 960tatggatgga ctatctaaac tagatcgctt acacgagact
catgacgatt acagcgatca 1020gatatttgag tctcttgaga ggaatgactg tacctgtcaa
aagtatcctg aaatcacaga 1080agttagagat gcagttgcca caattagacg ttcctttaga
aaaataacta aagaatctgg 1140tgccgatatc gaacctcccg tacaaactag cttattggat
gattgccaga ccttaaaagg 1200agttcttact tgcttaatac ctggtgctgg tggttatgac
gccattgcag tgattactaa 1260gcaagatgtt gatcttaggg ctcaaaccgc taatgacaaa
agattttcta aggttcaatg 1320gctggatgta actcaggctg actggggtgt taggaaagaa
aaagatccgg aaacttatct 1380tgataaactg caggaggagt tttaatgtca ttaccgttct
taacttctgc accgggaaag 1440gttattattt ttggtgaaca ctctgctgtg tacaacaagc
ctgccgtcgc tgctagtgtg 1500tctgcgttga gaacctacct gctaataagc gagtcatctg
caccagatac tattgaattg 1560gacttcccgg acattagctt taatcataag tggtccatca
atgatttcaa tgccatcacc 1620gaggatcaag taaactccca aaaattggcc aaggctcaac
aagccaccga tggcttgtct 1680caggaactcg ttagtctttt ggatccgttg ttagctcaac
tatccgaatc cttccactac 1740catgcagcgt tttgtttcct gtatatgttt gtttgcctat
gcccccatgc caagaatatt 1800aagttttctt taaagtctac tttacccatc ggtgctgggt
tgggctcaag cgcctctatt 1860tctgtatcac tggccttagc tatggcctac ttgggggggt
taataggatc taatgacttg 1920gaaaagctgt cagaaaacga taagcatata gtgaatcaat
gggccttcat aggtgaaaag 1980tgtattcacg gtaccccttc aggaatagat aacgctgtgg
ccacttatgg taatgccctg 2040ctatttgaaa aagactcaca taatggaaca ataaacacaa
acaattttaa gttcttagat 2100gatttcccag ccattccaat gatcctaacc tatactagaa
ttccaaggtc tacaaaagat 2160cttgttgctc gcgttcgtgt gttggtcacc gagaaatttc
ctgaagttat gaagccaatt 2220ctagatgcca tgggtgaatg tgccctacaa ggcttagaga
tcatgactaa gttaagtaaa 2280tgtaaaggca ccgatgacga ggctgtagaa actaataatg
aactgtatga acaactattg 2340gaattgataa gaataaatca tggactgctt gtctcaatcg
gtgtttctca tcctggatta 2400gaacttatta aaaatctgag cgatgatttg agaattggct
ccacaaaact taccggtgct 2460ggtggcggcg gttgctcttt gactttgtta cgaagagaca
ttactcaaga gcaaattgac 2520agcttcaaaa agaaattgca agatgatttt agttacgaga
catttgaaac agacttgggt 2580gggactggct gctgtttgtt aagcgcaaaa aatttgaata
aagatcttaa aatcaaatcc 2640ctagtattcc aattatttga aaataaaact accacaaagc
aacaaattga cgatctatta 2700ttgccaggaa acacgaattt accatggact tcagacgagg
agttttaatg actgtatata 2760ctgctagtgt aactgctccg gtaaatattg ctactcttaa
gtattggggg aaaagggaca 2820cgaagttgaa tctgcccacc aattcgtcca tatcagtgac
tttatcgcaa gatgacctca 2880gaacgttgac ctctgcggct actgcacctg agtttgaacg
cgacactttg tggttaaatg 2940gagaaccaca cagcatcgac aatgaaagaa ctcaaaattg
tctgcgcgac ctacgccaat 3000taagaaagga aatggaatcg aaggacgcct cattgcccac
attatctcaa tggaaactcc 3060acattgtctc cgaaaataac tttcctacag cagctggttt
agcttcctcc gctgctggct 3120ttgctgcatt ggtctctgca attgctaagt tataccaatt
accacagtca acttcagaaa 3180tatctagaat agcaagaaag gggtctggtt cagcttgtag
atcgttgttt ggcggatacg 3240tggcctggga aatgggaaaa gctgaagatg gtcatgattc
catggcagta caaatcgcag 3300acagctctga ctggcctcag atgaaagctt gtgtcctagt
tgtcagcgat attaaaaagg 3360atgtgagttc cactcagggt atgcaattga ccgtggcaac
ctccgaacta tttaaagaaa 3420gaattgaaca tgtcgtacca aagagatttg aagtcatgcg
taaagccatt gttgaaaaag 3480atttcgccac ctttgcaaag gaaacaatga tggattccaa
ctctttccat gccacatgtt 3540tggactcttt ccctccaata ttctacatga atgacacttc
caagcgtatc atcagttggt 3600gccacaccat taatcagttt tacggagaaa caatcgttgc
atacacgttt gatgcaggtc 3660caaatgctgt gttgtactac ttagctgaaa atgagtcgaa
actctttgca tttatctata 3720aattgtttgg ctctgttcct ggatgggaca agaaatttac
tactgagcag cttgaggctt 3780tcaaccatca atttgaatca tctaacttta ctgcacgtga
attggatctt gagttgcaaa 3840aggatgttgc cagagtgatt ttaactcaag tcggttcagg
cccacaagaa acaaacgaat 3900ctttgattga cgcaaagact ggtctaccaa aggaagagga
gttttaactc gagtaggagg 3960cacatatgtc tcagaacgtt tacattgtat cgactgccag
aaccccaatt ggttcattcc 4020agggttctct atcctccaag acagcagtgg aattgggtgc
tgttgcttta aaaggcgcct 4080tggctaaggt tccagaattg gatgcatcca aggattttga
cgaaattatt tttggtaacg 4140ttctttctgc caatttgggc caagctccgg ccagacaagt
tgctttggct gccggtttga 4200gtaatcatat cgttgcaagc acagttaaca aggtctgtgc
atccgctatg aaggcaatca 4260ttttgggtgc tcaatccatc aaatgtggta atgctgatgt
tgtcgtagct ggtggttgtg 4320aatctatgac taacgcacca tactacatgc cagcagcccg
tgcgggtgcc aaatttggcc 4380aaactgttct tgttgatggt gtcgaaagag atgggttgaa
cgatgcgtac gatggtctag 4440ccatgggtgt acacgcagaa aagtgtgccc gtgattggga
tattactaga gaacaacaag 4500acaattttgc catcgaatcc taccaaaaat ctcaaaaatc
tcaaaaggaa ggtaaattcg 4560acaatgaaat tgtacctgtt accattaagg gatttagagg
taagcctgat actcaagtca 4620cgaaggacga ggaacctgct agattacacg ttgaaaaatt
gagatctgca aggactgttt 4680tccaaaaaga aaacggtact gttactgccg ctaacgcttc
tccaatcaac gatggtgctg 4740cagccgtcat cttggtttcc gaaaaagttt tgaaggaaaa
gaatttgaag cctttggcta 4800ttatcaaagg ttggggtgag gccgctcatc aaccagctga
ttttacatgg gctccatctc 4860ttgcagttcc aaaggctttg aaacatgctg gcatcgaaga
catcaattct gttgattact 4920ttgaattcaa tgaagccttt tcggttgtcg gtttggtgaa
cactaagatt ttgaagctag 4980acccatctaa ggttaatgta tatggtggtg ctgttgctct
aggtcaccca ttgggttgtt 5040ctggtgctag agtggttgtt acactgctat ccatcttaca
gcaagaagga ggtaagatcg 5100gtgttgccgc catttgtaat ggtggtggtg gtgcttcctc
tattgtcatt gaaaagatat 5160gaggatcctc tagatgcgca ggaggcacat atggcgaaga
acgttgggat tttggctatg 5220gatatctatt tccctcccac ctgtgttcaa caggaagctt
tggaagcaca tgatggagca 5280agtaaaggga aatacactat tggacttggc caagattgtt
tagctttttg cactgagctt 5340gaagatgtta tctctatgag tttcaatgcg gtgacatcac
tttttgagaa gtataagatt 5400gaccctaacc aaatcgggcg tcttgaagta ggaagtgaga
ctgttattga caaaagcaag 5460tccatcaaga ccttcttgat gcagctcttt gagaaatgtg
gaaacactga tgtcgaaggt 5520gttgactcga ccaatgcttg ctatggtgga actgcagctt
tgttaaactg tgtcaattgg 5580gttgagagta actcttggga tggacgttat ggcctcgtca
tttgtactga cagcgcggtt 5640tatgcagaag gacccgcaag gcccactgga ggagctgcag
cgattgctat gttgatagga 5700cctgatgctc ctatcgtttt cgaaagcaaa ttgagagcaa
gccacatggc tcatgtctat 5760gacttttaca agcccaatct tgctagcgag tacccggttg
ttgatggtaa gctttcacag 5820acttgctacc tcatggctct tgactcctgc tataaacatt
tatgcaacaa gttcgagaag 5880atcgagggca aagagttctc cataaatgat gctgattaca
ttgttttcca ttctccatac 5940aataaacttg tacagaaaag ctttgctcgt ctcttgtaca
acgacttctt gagaaacgca 6000agctccattg acgaggctgc caaagaaaag ttcacccctt
attcatcttt gacccttgac 6060gagagttacc aaagccgtga tcttgaaaag gtgtcacaac
aaatttcgaa accgttttat 6120gatgctaaag tgcaaccaac gactttaata ccaaaggaag
tcggtaacat gtacactgct 6180tctctctacg ctgcatttgc ttccctcatc cacaataaac
acaatgattt ggcgggaaag 6240cgggtggtta tgttctctta tggaagtggc tccaccgcaa
caatgttctc attacgcctc 6300aacgacaata agcctccttt cagcatttca aacattgcat
ctgtaatgga tgttggcggt 6360aaattgaaag ctagacatga gtatgcacct gagaagtttg
tggagacaat gaagctaatg 6420gaacataggt atggagcaaa ggactttgtg acaaccaagg
agggtattat agatcttttg 6480gcaccgggaa cttattatct gaaagaggtt gattccttgt
accggagatt ctatggcaag 6540aaaggtgaag atggatctgt agccaatgga cactgaggat
ccgtcgactc gagcacgtga 6600ggaggcacat atgacggaaa cgcacgccat agccggggtc
ccgatgaggt gggtgggacc 6660ccttcgtatt tccgggaacg tcgccgagac cgagacccag
gtcccgctcg ccacgtacga 6720gtcgccgctg tggccgtcgg tgggccgcgg ggcgaaggtc
tcccggctga cggagaaggg 6780catcgtcgcc accctcgtcg acgagcggat gacccgctcg
gtgatcgtcg aggcgacgga 6840cgcgcagacc gcgtacatgg ccgcgcagac catccacgcc
cgcatcgacg agctgcgcga 6900ggtggtgcgc ggctgcagcc ggttcgccca gctgatcaac
atcaagcacg agatcaacgc 6960gaacctgctg ttcatccggt tcgagttcac caccggtgac
gcctccggcc acaacatggc 7020cacgctcgcc tccgatgtgc tcctggggca cctgctggag
acgatccctg gcatctccta 7080cggctcgatc tccggcaact actgcacgga caagaaggcc
accgcgatca acggcatcct 7140cggccgcggc aagaacgtga tcaccgagct gctggtgccg
cgggacgtcg tcgagaacaa 7200cctgcacacc acggctgcca agatcgtcga gctgaacatc
cgcaagaacc tgctcggcac 7260cctgctcgcc ggcggcatcc gctcggccaa cgcccacttc
gcgaacatgc tgctcggctt 7320ctacctggcc accggccagg acgccgccaa catcgtcgag
ggctcgcagg gcgtcgtcat 7380ggccgaggac cgcgacggcg acctctactt cgcctgcacc
ctgccgaacc tgatcgtcgg 7440cacggtcggc aacggcaagg gtctcggctt cgtggagacg
aacctcgccc ggctcggctg 7500ccgagccgac cgcgaacccg gggagaacgc ccgccgcctc
gccgtcatcg cggcagcgac 7560cgtgctgtgc ggtgaactct cgctgctcgc ggcacagacg
aacccgggcg aactcatgcg 7620cgcgcacgtc cagctggaac gcgacaacaa gaccgcaaag
gttggtgcat agacgcgtgc 7680g
7681628224DNAArtificial SequenceOperon E containing
A. thaliana, S. cerevesiae, Steptomyces sp CL190 DNA, and R.
capsulatus 62ggccgcgtcg actacggccg caggaggagt tcatatgtca gagttgagag
ccttcagtgc 60cccagggaaa gcgttactag ctggtggata tttagtttta gatacaaaat
atgaagcatt 120tgtagtcgga ttatcggcaa gaatgcatgc tgtagcccat ccttacggtt
cattgcaagg 180gtctgataag tttgaagtgc gtgtgaaaag taaacaattt aaagatgggg
agtggctgta 240ccatataagt cctaaaagtg gcttcattcc tgtttcgata ggcggatcta
agaacccttt 300cattgaaaaa gttatcgcta acgtatttag ctactttaaa cctaacatgg
acgactactg 360caatagaaac ttgttcgtta ttgatatttt ctctgatgat gcctaccatt
ctcaggagga 420tagcgttacc gaacatcgtg gcaacagaag attgagtttt cattcgcaca
gaattgaaga 480agttcccaaa acagggctgg gctcctcggc aggtttagtc acagttttaa
ctacagcttt 540ggcctccttt tttgtatcgg acctggaaaa taatgtagac aaatatagag
aagttattca 600taatttagca caagttgctc attgtcaagc tcagggtaaa attggaagcg
ggtttgatgt 660agcggcggca gcatatggat ctatcagata tagaagattc ccacccgcat
taatctctaa 720tttgccagat attggaagtg ctacttacgg cagtaaactg gcgcatttgg
ttgatgaaga 780agactggaat attacgatta aaagtaacca tttaccttcg ggattaactt
tatggatggg 840cgatattaag aatggttcag aaacagtaaa actggtccag aaggtaaaaa
attggtatga 900ttcgcatatg ccagaaagct tgaaaatata tacagaactc gatcatgcaa
attctagatt 960tatggatgga ctatctaaac tagatcgctt acacgagact catgacgatt
acagcgatca 1020gatatttgag tctcttgaga ggaatgactg tacctgtcaa aagtatcctg
aaatcacaga 1080agttagagat gcagttgcca caattagacg ttcctttaga aaaataacta
aagaatctgg 1140tgccgatatc gaacctcccg tacaaactag cttattggat gattgccaga
ccttaaaagg 1200agttcttact tgcttaatac ctggtgctgg tggttatgac gccattgcag
tgattactaa 1260gcaagatgtt gatcttaggg ctcaaaccgc taatgacaaa agattttcta
aggttcaatg 1320gctggatgta actcaggctg actggggtgt taggaaagaa aaagatccgg
aaacttatct 1380tgataaactg caggaggagt tttaatgtca ttaccgttct taacttctgc
accgggaaag 1440gttattattt ttggtgaaca ctctgctgtg tacaacaagc ctgccgtcgc
tgctagtgtg 1500tctgcgttga gaacctacct gctaataagc gagtcatctg caccagatac
tattgaattg 1560gacttcccgg acattagctt taatcataag tggtccatca atgatttcaa
tgccatcacc 1620gaggatcaag taaactccca aaaattggcc aaggctcaac aagccaccga
tggcttgtct 1680caggaactcg ttagtctttt ggatccgttg ttagctcaac tatccgaatc
cttccactac 1740catgcagcgt tttgtttcct gtatatgttt gtttgcctat gcccccatgc
caagaatatt 1800aagttttctt taaagtctac tttacccatc ggtgctgggt tgggctcaag
cgcctctatt 1860tctgtatcac tggccttagc tatggcctac ttgggggggt taataggatc
taatgacttg 1920gaaaagctgt cagaaaacga taagcatata gtgaatcaat gggccttcat
aggtgaaaag 1980tgtattcacg gtaccccttc aggaatagat aacgctgtgg ccacttatgg
taatgccctg 2040ctatttgaaa aagactcaca taatggaaca ataaacacaa acaattttaa
gttcttagat 2100gatttcccag ccattccaat gatcctaacc tatactagaa ttccaaggtc
tacaaaagat 2160cttgttgctc gcgttcgtgt gttggtcacc gagaaatttc ctgaagttat
gaagccaatt 2220ctagatgcca tgggtgaatg tgccctacaa ggcttagaga tcatgactaa
gttaagtaaa 2280tgtaaaggca ccgatgacga ggctgtagaa actaataatg aactgtatga
acaactattg 2340gaattgataa gaataaatca tggactgctt gtctcaatcg gtgtttctca
tcctggatta 2400gaacttatta aaaatctgag cgatgatttg agaattggct ccacaaaact
taccggtgct 2460ggtggcggcg gttgctcttt gactttgtta cgaagagaca ttactcaaga
gcaaattgac 2520agcttcaaaa agaaattgca agatgatttt agttacgaga catttgaaac
agacttgggt 2580gggactggct gctgtttgtt aagcgcaaaa aatttgaata aagatcttaa
aatcaaatcc 2640ctagtattcc aattatttga aaataaaact accacaaagc aacaaattga
cgatctatta 2700ttgccaggaa acacgaattt accatggact tcagacgagg agttttaatg
actgtatata 2760ctgctagtgt aactgctccg gtaaatattg ctactcttaa gtattggggg
aaaagggaca 2820cgaagttgaa tctgcccacc aattcgtcca tatcagtgac tttatcgcaa
gatgacctca 2880gaacgttgac ctctgcggct actgcacctg agtttgaacg cgacactttg
tggttaaatg 2940gagaaccaca cagcatcgac aatgaaagaa ctcaaaattg tctgcgcgac
ctacgccaat 3000taagaaagga aatggaatcg aaggacgcct cattgcccac attatctcaa
tggaaactcc 3060acattgtctc cgaaaataac tttcctacag cagctggttt agcttcctcc
gctgctggct 3120ttgctgcatt ggtctctgca attgctaagt tataccaatt accacagtca
acttcagaaa 3180tatctagaat agcaagaaag gggtctggtt cagcttgtag atcgttgttt
ggcggatacg 3240tggcctggga aatgggaaaa gctgaagatg gtcatgattc catggcagta
caaatcgcag 3300acagctctga ctggcctcag atgaaagctt gtgtcctagt tgtcagcgat
attaaaaagg 3360atgtgagttc cactcagggt atgcaattga ccgtggcaac ctccgaacta
tttaaagaaa 3420gaattgaaca tgtcgtacca aagagatttg aagtcatgcg taaagccatt
gttgaaaaag 3480atttcgccac ctttgcaaag gaaacaatga tggattccaa ctctttccat
gccacatgtt 3540tggactcttt ccctccaata ttctacatga atgacacttc caagcgtatc
atcagttggt 3600gccacaccat taatcagttt tacggagaaa caatcgttgc atacacgttt
gatgcaggtc 3660caaatgctgt gttgtactac ttagctgaaa atgagtcgaa actctttgca
tttatctata 3720aattgtttgg ctctgttcct ggatgggaca agaaatttac tactgagcag
cttgaggctt 3780tcaaccatca atttgaatca tctaacttta ctgcacgtga attggatctt
gagttgcaaa 3840aggatgttgc cagagtgatt ttaactcaag tcggttcagg cccacaagaa
acaaacgaat 3900ctttgattga cgcaaagact ggtctaccaa aggaagagga gttttaactc
gagtaggagg 3960cacatatgtc tcagaacgtt tacattgtat cgactgccag aaccccaatt
ggttcattcc 4020agggttctct atcctccaag acagcagtgg aattgggtgc tgttgcttta
aaaggcgcct 4080tggctaaggt tccagaattg gatgcatcca aggattttga cgaaattatt
tttggtaacg 4140ttctttctgc caatttgggc caagctccgg ccagacaagt tgctttggct
gccggtttga 4200gtaatcatat cgttgcaagc acagttaaca aggtctgtgc atccgctatg
aaggcaatca 4260ttttgggtgc tcaatccatc aaatgtggta atgctgatgt tgtcgtagct
ggtggttgtg 4320aatctatgac taacgcacca tactacatgc cagcagcccg tgcgggtgcc
aaatttggcc 4380aaactgttct tgttgatggt gtcgaaagag atgggttgaa cgatgcgtac
gatggtctag 4440ccatgggtgt acacgcagaa aagtgtgccc gtgattggga tattactaga
gaacaacaag 4500acaattttgc catcgaatcc taccaaaaat ctcaaaaatc tcaaaaggaa
ggtaaattcg 4560acaatgaaat tgtacctgtt accattaagg gatttagagg taagcctgat
actcaagtca 4620cgaaggacga ggaacctgct agattacacg ttgaaaaatt gagatctgca
aggactgttt 4680tccaaaaaga aaacggtact gttactgccg ctaacgcttc tccaatcaac
gatggtgctg 4740cagccgtcat cttggtttcc gaaaaagttt tgaaggaaaa gaatttgaag
cctttggcta 4800ttatcaaagg ttggggtgag gccgctcatc aaccagctga ttttacatgg
gctccatctc 4860ttgcagttcc aaaggctttg aaacatgctg gcatcgaaga catcaattct
gttgattact 4920ttgaattcaa tgaagccttt tcggttgtcg gtttggtgaa cactaagatt
ttgaagctag 4980acccatctaa ggttaatgta tatggtggtg ctgttgctct aggtcaccca
ttgggttgtt 5040ctggtgctag agtggttgtt acactgctat ccatcttaca gcaagaagga
ggtaagatcg 5100gtgttgccgc catttgtaat ggtggtggtg gtgcttcctc tattgtcatt
gaaaagatat 5160gaggatcctc tagatgcgca ggaggcacat atggcgaaga acgttgggat
tttggctatg 5220gatatctatt tccctcccac ctgtgttcaa caggaagctt tggaagcaca
tgatggagca 5280agtaaaggga aatacactat tggacttggc caagattgtt tagctttttg
cactgagctt 5340gaagatgtta tctctatgag tttcaatgcg gtgacatcac tttttgagaa
gtataagatt 5400gaccctaacc aaatcgggcg tcttgaagta ggaagtgaga ctgttattga
caaaagcaag 5460tccatcaaga ccttcttgat gcagctcttt gagaaatgtg gaaacactga
tgtcgaaggt 5520gttgactcga ccaatgcttg ctatggtgga actgcagctt tgttaaactg
tgtcaattgg 5580gttgagagta actcttggga tggacgttat ggcctcgtca tttgtactga
cagcgcggtt 5640tatgcagaag gacccgcaag gcccactgga ggagctgcag cgattgctat
gttgatagga 5700cctgatgctc ctatcgtttt cgaaagcaaa ttgagagcaa gccacatggc
tcatgtctat 5760gacttttaca agcccaatct tgctagcgag tacccggttg ttgatggtaa
gctttcacag 5820acttgctacc tcatggctct tgactcctgc tataaacatt tatgcaacaa
gttcgagaag 5880atcgagggca aagagttctc cataaatgat gctgattaca ttgttttcca
ttctccatac 5940aataaacttg tacagaaaag ctttgctcgt ctcttgtaca acgacttctt
gagaaacgca 6000agctccattg acgaggctgc caaagaaaag ttcacccctt attcatcttt
gacccttgac 6060gagagttacc aaagccgtga tcttgaaaag gtgtcacaac aaatttcgaa
accgttttat 6120gatgctaaag tgcaaccaac gactttaata ccaaaggaag tcggtaacat
gtacactgct 6180tctctctacg ctgcatttgc ttccctcatc cacaataaac acaatgattt
ggcgggaaag 6240cgggtggtta tgttctctta tggaagtggc tccaccgcaa caatgttctc
attacgcctc 6300aacgacaata agcctccttt cagcatttca aacattgcat ctgtaatgga
tgttggcggt 6360aaattgaaag ctagacatga gtatgcacct gagaagtttg tggagacaat
gaagctaatg 6420gaacataggt atggagcaaa ggactttgtg acaaccaagg agggtattat
agatcttttg 6480gcaccgggaa cttattatct gaaagaggtt gattccttgt accggagatt
ctatggcaag 6540aaaggtgaag atggatctgt agccaatgga cactgaggat ccgtcgactc
gagcacgtga 6600ggaggcacat atgacggaaa cgcacgccat agccggggtc ccgatgaggt
gggtgggacc 6660ccttcgtatt tccgggaacg tcgccgagac cgagacccag gtcccgctcg
ccacgtacga 6720gtcgccgctg tggccgtcgg tgggccgcgg ggcgaaggtc tcccggctga
cggagaaggg 6780catcgtcgcc accctcgtcg acgagcggat gacccgctcg gtgatcgtcg
aggcgacgga 6840cgcgcagacc gcgtacatgg ccgcgcagac catccacgcc cgcatcgacg
agctgcgcga 6900ggtggtgcgc ggctgcagcc ggttcgccca gctgatcaac atcaagcacg
agatcaacgc 6960gaacctgctg ttcatccggt tcgagttcac caccggtgac gcctccggcc
acaacatggc 7020cacgctcgcc tccgatgtgc tcctggggca cctgctggag acgatccctg
gcatctccta 7080cggctcgatc tccggcaact actgcacgga caagaaggcc accgcgatca
acggcatcct 7140cggccgcggc aagaacgtga tcaccgagct gctggtgccg cgggacgtcg
tcgagaacaa 7200cctgcacacc acggctgcca agatcgtcga gctgaacatc cgcaagaacc
tgctcggcac 7260cctgctcgcc ggcggcatcc gctcggccaa cgcccacttc gcgaacatgc
tgctcggctt 7320ctacctggcc accggccagg acgccgccaa catcgtcgag ggctcgcagg
gcgtcgtcat 7380ggccgaggac cgcgacggcg acctctactt cgcctgcacc ctgccgaacc
tgatcgtcgg 7440cacggtcggc aacggcaagg gtctcggctt cgtggagacg aacctcgccc
ggctcggctg 7500ccgagccgac cgcgaacccg gggagaacgc ccgccgcctc gccgtcatcg
cggcagcgac 7560cgtgctgtgc ggtgaactct cgctgctcgc ggcacagacg aacccgggcg
aactcatgcg 7620cgcgcacgtc cagctggaac gcgacaacaa gaccgcaaag gttggtgcat
agacgcggta 7680aggaggcaca tatgagtgag cttatacccg cctgggttgg tgacagactg
gctccggtgg 7740acaagttgga ggtgcatttg aaagggctcc gccacaaggc ggtgtctgtt
ttcgtcatgg 7800atggcgaaaa cgtgctgatc cagcgccgct cggaggagaa atatcactct
cccgggcttt 7860gggcgaacac ctgctgcacc catccgggct ggaccgaacg ccccgaggaa
tgcgcggtgc 7920ggcggctgcg cgaggagctg gggatcaccg ggctttatcc cgcccatgcc
gaccggctgg 7980aatatcgcgc cgatgtcggc ggcggcatga tcgagcatga ggtggtcgac
atctatctgg 8040cctatgccaa accgcatatg cggatcaccc ccgatccgcg cgaagtggcc
gaggtgcgct 8100ggatcggcct ttacgatctg gcggccgagg ccggtcggca tcccgagcgg
ttctcgaaat 8160ggctcaacat ctatctgtcg agccatcttg accggatttt cggatcgatc
ctgcgcggct 8220gagc
8224638077DNAArtificial SequenceOperon F containing A.
thaliana, S. cerevisiae, and Streptomyces sp CL190 DNA 63ccaccgcggc
ggccgcgtcg acgccggcgg aggcacatat gtctcagaac gtttacattg 60tatcgactgc
cagaacccca attggttcat tccagggttc tctatcctcc aagacagcag 120tggaattggg
tgctgttgct ttaaaaggcg ccttggctaa ggttccagaa ttggatgcat 180ccaaggattt
tgacgaaatt atttttggta acgttctttc tgccaatttg ggccaagctc 240cggccagaca
agttgctttg gctgccggtt tgagtaatca tatcgttgca agcacagtta 300acaaggtctg
tgcatccgct atgaaggcaa tcattttggg tgctcaatcc atcaaatgtg 360gtaatgctga
tgttgtcgta gctggtggtt gtgaatctat gactaacgca ccatactaca 420tgccagcagc
ccgtgcgggt gccaaatttg gccaaactgt tcttgttgat ggtgtcgaaa 480gagatgggtt
gaacgatgcg tacgatggtc tagccatggg tgtacacgca gaaaagtgtg 540cccgtgattg
ggatattact agagaacaac aagacaattt tgccatcgaa tcctaccaaa 600aatctcaaaa
atctcaaaag gaaggtaaat tcgacaatga aattgtacct gttaccatta 660agggatttag
aggtaagcct gatactcaag tcacgaagga cgaggaacct gctagattac 720acgttgaaaa
attgagatct gcaaggactg ttttccaaaa agaaaacggt actgttactg 780ccgctaacgc
ttctccaatc aacgatggtg ctgcagccgt catcttggtt tccgaaaaag 840ttttgaagga
aaagaatttg aagcctttgg ctattatcaa aggttggggt gaggccgctc 900atcaaccagc
tgattttaca tgggctccat ctcttgcagt tccaaaggct ttgaaacatg 960ctggcatcga
agacatcaat tctgttgatt actttgaatt caatgaagcc ttttcggttg 1020tcggtttggt
gaacactaag attttgaagc tagacccatc taaggttaat gtatatggtg 1080gtgctgttgc
tctaggtcac ccattgggtt gttctggtgc tagagtggtt gttacactgc 1140tatccatctt
acagcaagaa ggaggtaaga tcggtgttgc cgccatttgt aatggtggtg 1200gtggtgcttc
ctctattgtc attgaaaaga tatgaggatc ctctaggtac ttccctggcg 1260tgtgcagcgg
ttgacgcgcc gtgccctcgc tgcgagcggc gcgcacatct gacgtcctgc 1320tttattgctt
tctcagaact cgggacgaag cgatcccatg atcacgcgat ctccatgcag 1380aaaagacaaa
gggagctgag tgcgttgaca ctaccgacct cggctgaggg ggtatcagaa 1440agccaccggg
cccgctcggt cggcatcggt cgcgcccacg ccaaggccat cctgctggga 1500gagcatgcgg
tcgtctacgg agcgccggca ctcgctctgc cgattccgca gctcacggtc 1560acggccagcg
tcggctggtc gtccgaggcc tccgacagtg cgggtggcct gtcctacacg 1620atgaccggta
cgccgtcgcg ggcactggtg acgcaggcct ccgacggcct gcaccggctc 1680accgcggaat
tcatggcgcg gatgggcgtg acgaacgcgc cgcacctcga cgtgatcctg 1740gacggcgcga
tcccgcacgg ccggggtctc ggctccagcg cggccggctc acgcgcgatc 1800gccttggccc
tcgccgacct cttcggccac gaactggccg agcacacggc gtacgaactg 1860gtgcagacgg
ccgagaacat ggcgcacggc cgggccagcg gcgtggacgc gatgacggtc 1920ggcgcgtccc
ggccgctgct gttccagcag ggccgcaccg agcgactggc catcggctgc 1980gacagcctgt
tcatcgtcgc cgacagcggc gtcccgggca gcaccaagga agcggtcgag 2040atgctgcggg
agggattcac ccgcagcgcc ggaacacagg agcggttcgt cggccgggcg 2100acggaactga
ccgaggccgc ccggcaggcc ctcgccgacg gccggcccga ggagctgggc 2160tcgcagctga
cgtactacca cgagctgctc catgaggccc gcctgagcac cgacggcatc 2220gatgcgctgg
tcgaggccgc gctgaaggca ggcagcctcg gagccaagat caccggcggt 2280ggtctgggcg
gctgcatgat cgcacaggcc cggcccgaac aggcccggga ggtcacccgg 2340cagctccacg
aggccggtgc cgtacagacc tgggtcgtac cgctgaaagg gctcgacaac 2400catgcgcagt
gaacacccga ccacgaccgt gctccagtcg cgggagcagg gcagcgcggc 2460cggcgccacc
gcggtcgcgc acccaaacat cgcgctgatc aagtactggg gcaagcgcga 2520cgagcggctg
atcctgccct gcaccaccag cctgtcgatg acgctggacg tcttccccac 2580gaccaccgag
gtccggctcg accccgccgc cgagcacgac acggccgccc tcaacggcga 2640ggtggccacg
ggcgagacgc tgcgccgcat cagcgccttc ctctccctgg tgcgggaggt 2700ggcgggcagc
gaccagcggg ccgtggtgga cacccgcaac accgtgccca ccggggcggg 2760cctggcgtcc
tccgccagcg ggttcgccgc cctcgccgtc gcggccgcgg ccgcctacgg 2820gctcgaactc
gacgaccgcg ggctgtcccg gctggcccga cgtggatccg gctccgcctc 2880gcggtcgatc
ttcggcggct tcgccgtctg gcacgccggc cccgacggca cggccacgga 2940agcggacctc
ggctcctacg ccgagccggt gcccgcggcc gacctcgacc cggcgctggt 3000catcgccgtg
gtcaacgccg gccccaagcc cgtctccagc cgcgaggcca tgcgccgcac 3060cgtcgacacc
tcgccgctgt accggccgtg ggccgactcc agtaaggacg acctggacga 3120gatgcgctcg
gcgctgctgc gcggcgacct cgaggccgtg ggcgagatcg cggagcgcaa 3180cgcgctcggc
atgcacgcca ccatgctggc cgcccgcccc gcggtgcggt acctgtcgcc 3240ggccacggtc
accgtgctcg acagcgtgct ccagctccgc aaggacggtg tcctggccta 3300cgcgaccatg
gacgccggtc ccaacgtgaa ggtgctgtgc cggcgggcgg acgccgagcg 3360ggtggccgac
gtcgtacgcg ccgccgcgtc cggcggtcag gtcctcgtcg ccgggccggg 3420agacggtgcc
cgcctgctga gcgagggcgc atgacgacag gtcagcgcac gatcgtccgg 3480cacgcgccgg
gcaagctgtt cgtcgcgggc gagtacgcgg tcgtggatcc gggcaacccg 3540gcgatcctgg
tagcggtcga ccggcacatc agcgtcaccg tgtccgacgc cgacgcggac 3600accggggccg
ccgacgtcgt gatctcctcc gacctcggtc cgcaggcggt cggctggcgc 3660tggcacgacg
gccggctcgt cgtccgcgac ccggacgacg ggcagcaggc gcgcagcgcc 3720ctggcccacg
tggtgtcggc gatcgagacc gtgggccggc tgctgggcga acgcggacag 3780aaggtccccg
ctctcaccct ctccgtcagc agccgcctgc acgaggacgg ccggaagttc 3840ggcctgggct
ccagcggcgc ggtgaccgtg gcgaccgtag ccgccgtcgc cgcgttctgc 3900ggactcgaac
tgtccaccga cgaacggttc cggctggcca tgctcgccac cgcggaactc 3960gaccccaagg
gctccggcgg ggacctcgcc gccagcacct ggggcggctg gatcgcctac 4020caggcgcccg
accgggcctt tgtgctcgac ctggcccggc gcgtgggagt cgaccggaca 4080ctgaaggcgc
cctggccggg gcactcggtg cgccgactgc cggcgcccaa gggcctcacc 4140ctggaggtcg
gctggaccgg agagcccgcc tccaccgcgt ccctggtgtc cgatctgcac 4200cgccgcacct
ggcggggcag cgcctcccac cagaggttcg tcgagaccac gaccgactgt 4260gtccgctccg
cggtcaccgc cctggagtcc ggcgacgaca cgagcctgct gcacgagatc 4320cgccgggccc
gccaggagct ggcccgcctg gacgacgagg tcggcctcgg catcttcaca 4380cccaagctga
cggcgctgtg cgacgccgcc gaagccgtcg gcggcgcggc caagccctcc 4440ggggcaggcg
gcggcgactg cggcatcgcc ctgctggacg ccgaggcgtc gcgggacatc 4500acacatgtac
ggcaacggtg ggagacagcc ggggtgctgc ccctgcccct gactcctgcc 4560ctggaaggga
tctaagaatg accagcgccc aacgcaagga cgaccacgta cggctcgcca 4620tcgagcagca
caacgcccac agcggacgca accagttcga cgacgtgtcg ttcgtccacc 4680acgccctggc
cggcatcgac cggccggacg tgtccctggc cacgtccttc gccgggatct 4740cctggcaggt
gccgatctac atcaacgcga tgaccggcgg cagcgagaag accggcctca 4800tcaaccggga
cctggccacc gccgcccgcg agaccggcgt ccccatcgcg tccgggtcca 4860tgaacgcgta
catcaaggac ccctcctgcg ccgacacgtt ccgtgtgctg cgcgacgaga 4920accccaacgg
gttcgtcatc gcgaacatca acgccaccac gacggtcgac aacgcgcagc 4980gcgcgatcga
cctgatcgag gcgaacgccc tgcagatcca catcaacacg gcgcaggaga 5040cgccgatgcc
ggagggcgac cggtcgttcg cgtcctgggt cccgcagatc gagaagatcg 5100cggcggccgt
cgacatcccc gtgatcgtca aggaggtcgg caacggcctg agccggcaga 5160ccatcctgct
gctcgccgac ctcggcgtgc aggcggcgga cgtcagcggc cgcggcggca 5220cggacttcgc
ccgcatcgag aacggccgcc gggagctcgg cgactacgcg ttcctgcacg 5280gctgggggca
gtccaccgcc gcctgcctgc tggacgccca ggacatctcc ctgcccgtcc 5340tcgcctccgg
cggtgtgcgt cacccgctcg acgtggtccg cgccctcgcg ctcggcgccc 5400gcgccgtcgg
ctcctccgcc ggcttcctgc gcaccctgat ggacgacggc gtcgacgcgc 5460tgatcacgaa
gctcacgacc tggctggacc agctggcggc gctgcagacc atgctcggcg 5520cgcgcacccc
ggccgacctc acccgctgcg acgtgctgct ccacggcgag ctgcgtgact 5580tctgcgccga
ccggggcatc gacacgcgcc gcctcgccca gcgctccagc tccatcgagg 5640ccctccagac
gacgggaagc acacgatgac ggaaacgcac gccatagccg gggtcccgat 5700gaggtgggtg
ggaccccttc gtatttccgg gaacgtcgcc gagaccgaga cccaggtccc 5760gctcgccacg
tacgagtcgc cgctgtggcc gtcggtgggc cgcggggcga aggtctcccg 5820gctgacggag
aagggcatcg tcgccaccct cgtcgacgag cggatgaccc gctcggtgat 5880cgtcgaggcg
acggacgcgc agaccgcgta catggccgcg cagaccatcc acgcccgcat 5940cgacgagctg
cgcgaggtgg tgcgcggctg cagccggttc gcccagctga tcaacatcaa 6000gcacgagatc
aacgcgaacc tgctgttcat ccggttcgag ttcaccaccg gtgacgcctc 6060cggccacaac
atggccacgc tcgcctccga tgtgctcctg gggcacctgc tggagacgat 6120ccctggcatc
tcctacggct cgatctccgg caactactgc acggacaaga aggccaccgc 6180gatcaacggc
atcctcggcc gcggcaagaa cgtgatcacc gagctgctgg tgccgcggga 6240cgtcgtcgag
aacaacctgc acaccacggc tgccaagatc gtcgagctga acatccgcaa 6300gaacctgctc
ggcaccctgc tcgccggcgg catccgctcg gccaacgccc acttcgcgaa 6360catgctgctc
ggcttctacc tggccaccgg ccaggacgcc gccaacatcg tcgagggctc 6420gcagggcgtc
gtcatggccg aggaccgcga cggcgacctc tacttcgcct gcaccctgcc 6480gaacctgatc
gtcggcacgg tcggcaacgg caagggtctc ggcttcgtgg agacgaacct 6540cgcccggctc
ggctgccgag ccgaccgcga acccggggag aacgcccgcc gcctcgccgt 6600catcgcggca
gcgaccgtgc tgtgcggtga actctcgctg ctcgcggcac agacgaaccc 6660gggcgaactc
atgcgcgcgc acgtccagct ggaacgcgac aacaagaccg caaaggttgg 6720tgcatagggc
atgtccatct ccataggcat tcacgacctg tcgttcgcca caaccgagtt 6780cgtcctgccg
cacacggcgc tcgccgagta caacggcacc gagatcggca agtaccacgt 6840cggcatcggc
cagcagtcga tgagcgtgcc ggccgccgac gaggacatcg tgaccatggc 6900cgcgaccgcg
gcgcggccca tcatcgagcg caacggcaag agccggatcc gcacggtcgt 6960gttcgccacg
gagtcgtcga tcgaccaggc gaaggcgggc ggcgtgtacg tgcactccct 7020gctggggctg
gagtcggcct gccgggtcgt cgagctgaag caggcctgct acggggccac 7080cgccgccctt
cagttcgcca tcggcctggt gcggcgcgac cccgcccagc aggtcctggt 7140catcgccagt
gacgtctcca agtacgagct ggacagcccc ggcgaggcga cccagggcgc 7200ggccgcggtg
gccatgctgg tcggcgccga cccggccctg ctgcgtatcg aggagccgtc 7260gggcctgttc
accgccgacg tcatggactt ctggcggccc aactacctca ccaccgctct 7320ggtcgacggc
caggagtcca tcaacgccta cctgcaggcc gtcgagggcg cctggaagga 7380ctacgcggag
caggacggcc ggtcgctgga ggagttcgcg gcgttcgtct accaccagcc 7440gttcacgaag
atggcctaca aggcgcaccg ccacctgctg aacttcaacg gctacgacac 7500cgacaaggac
gccatcgagg gcgccctcgg ccagacgacg gcgtacaaca acgtcatcgg 7560caacagctac
accgcgtcgg tgtacctggg cctggccgcc ctgctcgacc aggcggacga 7620cctgacgggc
cgttccatcg gcttcctgag ctacggctcg ggcagcgtcg ccgagttctt 7680ctcgggcacc
gtcgtcgccg ggtaccgcga gcgtctgcgc accgaggcga accaggaggc 7740gatcgcccgg
cgcaagagcg tcgactacgc cacctaccgc gagctgcacg agtacacgct 7800cccgtccgac
ggcggcgacc acgccacccc ggtgcagacc accggcccct tccggctggc 7860cgggatcaac
gaccacaagc gcatctacga ggcgcgctag cgacacccct cggcaacggg 7920gtgcgccact
gttcggcgca ccccgtgccg ggctttcgca cagctattca cgaccatttg 7980aggggcgggc
agccgcatga ccgacgtccg attccgcatt atcggtacgg gtgcctacct 8040agaactagtg
gatcccccgg gctgcaggaa ttcgata
8077648400DNAArtificial SequenceOperon G containing A. thaliana, S.
cerevisiae, and S. pombe DNA 64ggccgcagga ggagttcata tgtcagagtt
gagagccttc agtgccccag ggaaagcgtt 60actagctggt ggatatttag ttttagatac
aaaatatgaa gcatttgtag tcggattatc 120ggcaagaatg catgctgtag cccatcctta
cggttcattg caagggtctg ataagtttga 180agtgcgtgtg aaaagtaaac aatttaaaga
tggggagtgg ctgtaccata taagtcctaa 240aagtggcttc attcctgttt cgataggcgg
atctaagaac cctttcattg aaaaagttat 300cgctaacgta tttagctact ttaaacctaa
catggacgac tactgcaata gaaacttgtt 360cgttattgat attttctctg atgatgccta
ccattctcag gaggatagcg ttaccgaaca 420tcgtggcaac agaagattga gttttcattc
gcacagaatt gaagaagttc ccaaaacagg 480gctgggctcc tcggcaggtt tagtcacagt
tttaactaca gctttggcct ccttttttgt 540atcggacctg gaaaataatg tagacaaata
tagagaagtt attcataatt tagcacaagt 600tgctcattgt caagctcagg gtaaaattgg
aagcgggttt gatgtagcgg cggcagcata 660tggatctatc agatatagaa gattcccacc
cgcattaatc tctaatttgc cagatattgg 720aagtgctact tacggcagta aactggcgca
tttggttgat gaagaagact ggaatattac 780gattaaaagt aaccatttac cttcgggatt
aactttatgg atgggcgata ttaagaatgg 840ttcagaaaca gtaaaactgg tccagaaggt
aaaaaattgg tatgattcgc atatgccaga 900aagcttgaaa atatatacag aactcgatca
tgcaaattct agatttatgg atggactatc 960taaactagat cgcttacacg agactcatga
cgattacagc gatcagatat ttgagtctct 1020tgagaggaat gactgtacct gtcaaaagta
tcctgaaatc acagaagtta gagatgcagt 1080tgccacaatt agacgttcct ttagaaaaat
aactaaagaa tctggtgccg atatcgaacc 1140tcccgtacaa actagcttat tggatgattg
ccagacctta aaaggagttc ttacttgctt 1200aatacctggt gctggtggtt atgacgccat
tgcagtgatt actaagcaag atgttgatct 1260tagggctcaa accgctaatg acaaaagatt
ttctaaggtt caatggctgg atgtaactca 1320ggctgactgg ggtgttagga aagaaaaaga
tccggaaact tatcttgata aactgcagga 1380ggagttttaa tgtcattacc gttcttaact
tctgcaccgg gaaaggttat tatttttggt 1440gaacactctg ctgtgtacaa caagcctgcc
gtcgctgcta gtgtgtctgc gttgagaacc 1500tacctgctaa taagcgagtc atctgcacca
gatactattg aattggactt cccggacatt 1560agctttaatc ataagtggtc catcaatgat
ttcaatgcca tcaccgagga tcaagtaaac 1620tcccaaaaat tggccaaggc tcaacaagcc
accgatggct tgtctcagga actcgttagt 1680cttttggatc cgttgttagc tcaactatcc
gaatccttcc actaccatgc agcgttttgt 1740ttcctgtata tgtttgtttg cctatgcccc
catgccaaga atattaagtt ttctttaaag 1800tctactttac ccatcggtgc tgggttgggc
tcaagcgcct ctatttctgt atcactggcc 1860ttagctatgg cctacttggg ggggttaata
ggatctaatg acttggaaaa gctgtcagaa 1920aacgataagc atatagtgaa tcaatgggcc
ttcataggtg aaaagtgtat tcacggtacc 1980ccttcaggaa tagataacgc tgtggccact
tatggtaatg ccctgctatt tgaaaaagac 2040tcacataatg gaacaataaa cacaaacaat
tttaagttct tagatgattt cccagccatt 2100ccaatgatcc taacctatac tagaattcca
aggtctacaa aagatcttgt tgctcgcgtt 2160cgtgtgttgg tcaccgagaa atttcctgaa
gttatgaagc caattctaga tgccatgggt 2220gaatgtgccc tacaaggctt agagatcatg
actaagttaa gtaaatgtaa aggcaccgat 2280gacgaggctg tagaaactaa taatgaactg
tatgaacaac tattggaatt gataagaata 2340aatcatggac tgcttgtctc aatcggtgtt
tctcatcctg gattagaact tattaaaaat 2400ctgagcgatg atttgagaat tggctccaca
aaacttaccg gtgctggtgg cggcggttgc 2460tctttgactt tgttacgaag agacattact
caagagcaaa ttgacagctt caaaaagaaa 2520ttgcaagatg attttagtta cgagacattt
gaaacagact tgggtgggac tggctgctgt 2580ttgttaagcg caaaaaattt gaataaagat
cttaaaatca aatccctagt attccaatta 2640tttgaaaata aaactaccac aaagcaacaa
attgacgatc tattattgcc aggaaacacg 2700aatttaccat ggacttcaga cgaggagttt
taatgactgt atatactgct agtgtaactg 2760ctccggtaaa tattgctact cttaagtatt
gggggaaaag ggacacgaag ttgaatctgc 2820ccaccaattc gtccatatca gtgactttat
cgcaagatga cctcagaacg ttgacctctg 2880cggctactgc acctgagttt gaacgcgaca
ctttgtggtt aaatggagaa ccacacagca 2940tcgacaatga aagaactcaa aattgtctgc
gcgacctacg ccaattaaga aaggaaatgg 3000aatcgaagga cgcctcattg cccacattat
ctcaatggaa actccacatt gtctccgaaa 3060ataactttcc tacagcagct ggtttagctt
cctccgctgc tggctttgct gcattggtct 3120ctgcaattgc taagttatac caattaccac
agtcaacttc agaaatatct agaatagcaa 3180gaaaggggtc tggttcagct tgtagatcgt
tgtttggcgg atacgtggcc tgggaaatgg 3240gaaaagctga agatggtcat gattccatgg
cagtacaaat cgcagacagc tctgactggc 3300ctcagatgaa agcttgtgtc ctagttgtca
gcgatattaa aaaggatgtg agttccactc 3360agggtatgca attgaccgtg gcaacctccg
aactatttaa agaaagaatt gaacatgtcg 3420taccaaagag atttgaagtc atgcgtaaag
ccattgttga aaaagatttc gccacctttg 3480caaaggaaac aatgatggat tccaactctt
tccatgccac atgtttggac tctttccctc 3540caatattcta catgaatgac acttccaagc
gtatcatcag ttggtgccac accattaatc 3600agttttacgg agaaacaatc gttgcataca
cgtttgatgc aggtccaaat gctgtgttgt 3660actacttagc tgaaaatgag tcgaaactct
ttgcatttat ctataaattg tttggctctg 3720ttcctggatg ggacaagaaa tttactactg
agcagcttga ggctttcaac catcaatttg 3780aatcatctaa ctttactgca cgtgaattgg
atcttgagtt gcaaaaggat gttgccagag 3840tgattttaac tcaagtcggt tcaggcccac
aagaaacaaa cgaatctttg attgacgcaa 3900agactggtct accaaaggaa gaggagtttt
aactcgacgc cggcggaggc acatatgtct 3960cagaacgttt acattgtatc gactgccaga
accccaattg gttcattcca gggttctcta 4020tcctccaaga cagcagtgga attgggtgct
gttgctttaa aaggcgcctt ggctaaggtt 4080ccagaattgg atgcatccaa ggattttgac
gaaattattt ttggtaacgt tctttctgcc 4140aatttgggcc aagctccggc cagacaagtt
gctttggctg ccggtttgag taatcatatc 4200gttgcaagca cagttaacaa ggtctgtgca
tccgctatga aggcaatcat tttgggtgct 4260caatccatca aatgtggtaa tgctgatgtt
gtcgtagctg gtggttgtga atctatgact 4320aacgcaccat actacatgcc agcagcccgt
gcgggtgcca aatttggcca aactgttctt 4380gttgatggtg tcgaaagaga tgggttgaac
gatgcgtacg atggtctagc catgggtgta 4440cacgcagaaa agtgtgcccg tgattgggat
attactagag aacaacaaga caattttgcc 4500atcgaatcct accaaaaatc tcaaaaatct
caaaaggaag gtaaattcga caatgaaatt 4560gtacctgtta ccattaaggg atttagaggt
aagcctgata ctcaagtcac gaaggacgag 4620gaacctgcta gattacacgt tgaaaaattg
agatctgcaa ggactgtttt ccaaaaagaa 4680aacggtactg ttactgccgc taacgcttct
ccaatcaacg atggtgctgc agccgtcatc 4740ttggtttccg aaaaagtttt gaaggaaaag
aatttgaagc ctttggctat tatcaaaggt 4800tggggtgagg ccgctcatca accagctgat
tttacatggg ctccatctct tgcagttcca 4860aaggctttga aacatgctgg catcgaagac
atcaattctg ttgattactt tgaattcaat 4920gaagcctttt cggttgtcgg tttggtgaac
actaagattt tgaagctaga cccatctaag 4980gttaatgtat atggtggtgc tgttgctcta
ggtcacccat tgggttgttc tggtgctaga 5040gtggttgtta cactgctatc catcttacag
caagaaggag gtaagatcgg tgttgccgcc 5100atttgtaatg gtggtggtgg tgcttcctct
attgtcattg aaaagatatg aggatcctct 5160agatgcgcag gaggcacata tggcgaagaa
cgttgggatt ttggctatgg atatctattt 5220ccctcccacc tgtgttcaac aggaagcttt
ggaagcacat gatggagcaa gtaaagggaa 5280atacactatt ggacttggcc aagattgttt
agctttttgc actgagcttg aagatgttat 5340ctctatgagt ttcaatgcgg tgacatcact
ttttgagaag tataagattg accctaacca 5400aatcgggcgt cttgaagtag gaagtgagac
tgttattgac aaaagcaagt ccatcaagac 5460cttcttgatg cagctctttg agaaatgtgg
aaacactgat gtcgaaggtg ttgactcgac 5520caatgcttgc tatggtggaa ctgcagcttt
gttaaactgt gtcaattggg ttgagagtaa 5580ctcttgggat ggacgttatg gcctcgtcat
ttgtactgac agcgcggttt atgcagaagg 5640acccgcaagg cccactggag gagctgcagc
gattgctatg ttgataggac ctgatgctcc 5700tatcgttttc gaaagcaaat tgagagcaag
ccacatggct catgtctatg acttttacaa 5760gcccaatctt gctagcgagt acccggttgt
tgatggtaag ctttcacaga cttgctacct 5820catggctctt gactcctgct ataaacattt
atgcaacaag ttcgagaaga tcgagggcaa 5880agagttctcc ataaatgatg ctgattacat
tgttttccat tctccataca ataaacttgt 5940acagaaaagc tttgctcgtc tcttgtacaa
cgacttcttg agaaacgcaa gctccattga 6000cgaggctgcc aaagaaaagt tcacccctta
ttcatctttg acccttgacg agagttacca 6060aagccgtgat cttgaaaagg tgtcacaaca
aatttcgaaa ccgttttatg atgctaaagt 6120gcaaccaacg actttaatac caaaggaagt
cggtaacatg tacactgctt ctctctacgc 6180tgcatttgct tccctcatcc acaataaaca
caatgatttg gcgggaaagc gggtggttat 6240gttctcttat ggaagtggct ccaccgcaac
aatgttctca ttacgcctca acgacaataa 6300gcctcctttc agcatttcaa acattgcatc
tgtaatggat gttggcggta aattgaaagc 6360tagacatgag tatgcacctg agaagtttgt
ggagacaatg aagctaatgg aacataggta 6420tggagcaaag gactttgtga caaccaagga
gggtattata gatcttttgg caccgggaac 6480ttattatctg aaagaggttg attccttgta
ccggagattc tatggcaaga aaggtgaaga 6540tggatctgta gccaatggac actgaggatc
cgtcgagcac gtggaggcac atatgcaatg 6600ctgtgagatg cctgttggat acattcagat
tcctgttggg attgctggtc cattgttgct 6660tgatggttat gagtactctg ttcctatggc
tacaaccgaa ggttgtttgg ttgctagcac 6720taacagaggc tgcaaggcta tgtttatctc
tggtggcgcc accagtaccg ttcttaagga 6780cggtatgacc cgagcacctg ttgttcggtt
cgcttcggcg agacgagctt cggagcttaa 6840gtttttcttg gagaatccag agaactttga
tactttggca gtagtcttca acaggtcgag 6900tagatttgca agactgcaaa gtgttaaatg
cacaatcgcg gggaagaatg cttatgtaag 6960gttctgttgt agtactggtg atgctatggg
gatgaatatg gtttctaaag gtgtgcagaa 7020tgttcttgag tatcttaccg atgatttccc
tgacatggat gtgattggaa tctctggtaa 7080cttctgttcg gacaagaaac ctgctgctgt
gaactggatt gagggacgtg gtaaatcagt 7140tgtttgcgag gctgtaatca gaggagagat
cgtgaacaag gtcttgaaaa cgagcgtggc 7200tgctttagtc gagctcaaca tgctcaagaa
cctagctggc tctgctgttg caggctctct 7260aggtggattc aacgctcatg ccagtaacat
agtgtctgct gtattcatag ctactggcca 7320agatccagct caaaacgtgg agagttctca
atgcatcacc atgatggaag ctattaatga 7380cggcaaagat atccatatct cagtcactat
gccatctatc gaggtgggga cagtgggagg 7440aggaacacag cttgcatctc aatcagcgtg
tttaaacctg ctcggagtta aaggagcaag 7500cacagagtcg ccgggaatga acgcaaggag
gctagcgacg atcgtagccg gagcagtttt 7560agctggagag ttatctttaa tgtcagcaat
tgcagctgga cagcttgtga gaagtcacat 7620gaaatacaat agatccagcc gagacatctc
tggagcaacg acaacgacaa caacaacaac 7680atgacccgta ggaggcacat atgagttccc
aacaagagaa aaaggattat gatgaagaac 7740aattaaggtt gatggaagaa gtttgtatcg
ttgtagatga aaatgatgtc cctttaagat 7800atggaacgaa aaaggagtgt catttgatgg
aaaatataaa taaaggtctt ttgcatagag 7860cattctctat gttcatcttt gatgagcaaa
atcgcctttt acttcagcag cgtgcagaag 7920agaaaattac atttccatcc ttatggacga
atacatgttg ctcccaccca ttggatgttg 7980ctggtgaacg tggtaatact ttacctgaag
ctgttgaagg tgttaagaat gcagctcaac 8040gcaagctgtt ccatgaattg ggtattcaag
ccaagtatat tcccaaagac aaatttcagt 8100ttcttacacg aatccattac cttgctccta
gtactggtgc ttggggagag catgaaattg 8160actacattct tttcttcaaa ggtaaagttg
agctggatat caatcccaat gaagttcaag 8220cctataagta tgttactatg gaagagttaa
aagagatgtt ttccgatcct caatatggat 8280tcacaccatg gttcaaactt atttgtgagc
attttatgtt taaatggtgg caggatgtag 8340atcatgcgtc aaaattccaa gataccttaa
ttcatcgttg ctaaggatcc cccgggatcc 84006555DNAArtificial SequencePCR
primer containing R. capsulatus DNA 65gcgatatcgg atccaggagg accatatgat
cgccgaagcg gatatggagg tctgc 556650DNAArtificial SequencePCR
primer containing R. capsulatus DNA 66gcgatatcaa gcttggatcc tcaatccatc
gccaggccgc ggtcgcgcgc 506760DNAArtificial
SequenceOligonucleotide containing N. tabacum and R. caopsulatus DNA
67ctttcctgaa acataattta taatcagatc caggaggacc atatgatcgc cgaagcggat
606860DNAArtificial SequenceOligonucleotide containing N. tabacum and R.
capsulatus DNA 68cgaccgcggc ctggcgatgg attgaggatc taaacaaacc
cggaacagac cgttgggaag 606960DNAArtificial SequenceOligonucleotide
containing N. tabacum and R. capsulatus DNA 69atttttcatc tcgaattgta
ttcccacgaa ggccgcgtcg actacggccg caggaggagt 607060DNAArtificial
SequenceOligonucleotide containing N. tabacum and R. capsulatus DNA
70ttcggatcga tcctgcgcgg ctgagcggcc ggaatggtga agttgaaaaa cgaatccttc
60711020DNARhodobacter capsulatus 71atgatcgccg aagcggatat ggaggtctgc
cgggagctga tccgcaccgg cagctactcc 60ttccatgcgg cgtccagagt tctgccggcg
cgggtccgtg accccgcgct ggcgctttac 120gccttttgcc gcgtcgccga tgacgaagtc
gacgaggttg gcgcgccgcg cgacaaggct 180gcggcggttt tgaaacttgg cgaccggctg
gaggacatct atgccggtcg tccgcgcaat 240gcgccctcgg atcgggcttt cgcggcggtg
gtcgaggaat tcgagatgcc gcgcgaattg 300cccgaggcgc tgctggaggg cttcgcctgg
gatgccgagg ggcggtggta tcacacgctt 360tcggacgtgc aggcctattc ggcgcgggtg
gcggccgccg tcggcgcgat gatgtgcgtg 420ctgatgcggg tgcgcaaccc cgatgcgctg
gcgcgggcct gcgatctcgg tcttgccatg 480cagatgtcga acatcgcccg cgacgtgggc
gaggatgccc gggcggggcg gcttttcctg 540ccgaccgact ggatggtcga ggaggggatc
gatccgcagg cgttcctggc cgatccgcag 600cccaccaagg gcatccgccg ggtcaccgag
cggttgctga accgcgccga ccggctttac 660tggcgggcgg cgacgggggt gcggcttttg
ccctttgact gccgaccggg gatcatggcc 720gcgggcaaga tctatgccgc gatcggggcc
gaggtggcga aggcgaaata cgacaacatc 780acccggcgtg cccacacgac caagggccgc
aagctgtggc tggtggcgaa ttccgcgatg 840tcggcgacgg cgacctcgat gctgccgctc
tcgccgcggg tgcatgccaa gcccgagccc 900gaagtggcgc atctggtcga tgccgccgcg
catcgcaacc tgcatcccga acggtccgag 960gtgctgatct cggcgctgat ggcgctgaag
gcgcgcgacc gcggcctggc gatggattga 10207213917DNAArtificial
Sequencemisc_feature()..()Plastid transformation vector pHKO4, containing
Operon B, contain i 72gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt
atttttctaa atacattcaa 60atatgtatcc gctcatgaga caataaccct gataaatgct
tcaataatat tgaaaaagga 120agagtatgag tattcaacat ttccgtgtcg cccttattcc
cttttttgcg gcattttgcc 180ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa
agatgctgaa gatcagttgg 240gtgcacgagt gggttacatc gaactggatc tcaacagcgg
taagatcctt gagagttttc 300gccccgaaga acgttttcca atgatgagca cttttaaagt
tctgctatgt ggcgcggtat 360tatcccgtat tgacgccggg caagagcaac tcggtcgccg
catacactat tctcagaatg 420acttggttga gtactcacca gtcacagaaa agcatcttac
ggatggcatg acagtaagag 480aattatgcag tgctgccata accatgagtg ataacactgc
ggccaactta cttctgacaa 540cgatcggagg accgaaggag ctaaccgctt ttttgcacaa
catgggggat catgtaactc 600gccttgatcg ttgggaaccg gagctgaatg aagccatacc
aaacgacgag cgtgacacca 660cgatgcctgt agcaatggca acaacgttgc gcaaactatt
aactggcgaa ctacttactc 720tagcttcccg gcaacaatta atagactgga tggaggcgga
taaagttgca ggaccacttc 780tgcgctcggc ccttccggct ggctggttta ttgctgataa
atctggagcc ggtgagcgtg 840ggtctcgcgg tatcattgca gcactggggc cagatggtaa
gccctcccgt atcgtagtta 900tctacacgac ggggagtcag gcaactatgg atgaacgaaa
tagacagatc gctgagatag 960gtgcctcact gattaagcat tggtaactgt cagaccaagt
ttactcatat atactttaga 1020ttgatttaaa acttcatttt taatttaaaa ggatctaggt
gaagatcctt tttgataatc 1080tcatgaccaa aatcccttaa cgtgagtttt cgttccactg
agcgtcagac cccgtagaaa 1140agatcaaagg atcttcttga gatccttttt ttctgcgcgt
aatctgctgc ttgcaaacaa 1200aaaaaccacc gctaccagcg gtggtttgtt tgccggatca
agagctacca actctttttc 1260cgaaggtaac tggcttcagc agagcgcaga taccaaatac
tgtccttcta gtgtagccgt 1320agttaggcca ccacttcaag aactctgtag caccgcctac
atacctcgct ctgctaatcc 1380tgttaccagt ggctgctgcc agtggcgata agtcgtgtct
taccgggttg gactcaagac 1440gatagttacc ggataaggcg cagcggtcgg gctgaacggg
gggttcgtgc acacagccca 1500gcttggagcg aacgacctac accgaactga gatacctaca
gcgtgagcta tgagaaagcg 1560ccacgcttcc cgaagggaga aaggcggaca ggtatccggt
aagcggcagg gtcggaacag 1620gagagcgcac gagggagctt ccagggggaa acgcctggta
tctttatagt cctgtcgggt 1680ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc
gtcagggggg cggagcctat 1740ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc
cttttgctgg ccttttgctc 1800acatgttctt tcctgcgtta tcccctgatt ctgtggataa
ccgtattacc gcctttgagt 1860gagctgatac cgctcgccgc agccgaacga ccgagcgcag
cgagtcagtg agcgaggaag 1920cggaagagcg cccaatacgc aaaccgcctc tccccgcgcg
ttggccgatt cattaatgca 1980gctggcacga caggtttccc gactggaaag cgggcagtga
gcgcaacgca attaatgtga 2040gttagctcac tcattaggca ccccaggctt tacactttat
gcttccggct cgtatgttgt 2100gtggaattgt gagcggataa caatttcaca caggaaacag
ctatgaccat gattacgcca 2160agctcgaaat taaccctcac taaagggaac aaaagctgga
gctccaccgc ggtggcggcc 2220gctctagaac tagtggatct tcttggctgt tattcaaaag
gtccaacaat gtatatatat 2280tggacatttt gaggcaatta tagatcctgg aaggcaattc
tgattggtca ataaaaatcg 2340atttcaatgc tatttttttt ttgtttttta tgagtttagc
caatttatca tgaaaggtaa 2400aaggggataa aggaaccgtg tgttgattgt cctgtaaata
taagttgtct tcctccatat 2460gtaaaaaggg aataaataaa tcaattaaat ttcgggatgc
ttcatgaagt gcttctttcg 2520gagttaaact tccgtttgtc catatttcga gaaaaagtat
ctcttgtttt tcattcccat 2580tcccataaga atgaatacta tgattcgcgt ttcgaacagg
catgaataca gcatctatag 2640gataacttcc atcttgaaag ttatgtggcg tttttataag
atatccacga tttctctcta 2700tttgtaatcc aatacaaaaa tcaattggtt ccgttaaact
ggctatatgt tgtgtattat 2760caacgatttc tacataaggc ggcaagatga tatcttgggc
agttacagat ccaggaccct 2820tgacacaaat agatgcgtca gaagttccat atagattact
tcttaatata atttctttca 2880aattcattaa aatttcatgt accgattctt gaatgcccgt
tatggtagaa tattcatgtg 2940ggactttctc agattttaca cgtgtgatac atgttccttc
tatttctcca agtaaagctc 3000ttcgcatcgc aatgcctatt gtgtcggctt ggcctttcat
aagtggagac agaataaagc 3060gtccataata aaggcgttta ctgtctgttc ttgattcaac
acacttccac tgtagtgtcc 3120gagtagatac tgttactttc tctcgaacca tagtactatt
atttgattag atcatcgaat 3180cttttatttc tcttgagatt tcttcaatgt tcagttctac
acacgtcttt ttttcggagg 3240tctacagcca ttatgtggca taggagttac atcccgtacg
aaagttaata gtataccact 3300tcgacgaata gctcgtaatg ctgcatctct tccgagaccg
ggacctttta tcatgacttc 3360tgctcgttgc ataccttgat ccactactgt acggatagcg
tttgctgctg cggtttgagc 3420agcaaacggt gttcctcttc tcgtaccttt gaatccagaa
gtaccggcgg aggaccaaga 3480aactactcga ccccgtacat ctgtaacagt gacaatggta
ttattgaaac ttgcttgaac 3540atgaataact ccctttggta ttctacgtgc acccttacgt
gaaccaatac gtccattcct 3600acgcgaacta attttcggta tagcttttgc catattttat
catctcgtaa atatgagtca 3660gagatatatg gatatatcca tttcatgtca aaacagattc
tttatttgta catcggctct 3720tctggcaagt ctgattatcc ctgtctttgt ttatgtctcg
ggttggaaca aattactata 3780attcgtcccc gcctacggat tagtcgacat ttttcacaaa
ttttacgaac ggaagctctt 3840attttcatat ttctcattcc ttaccttaat tctgaatcta
tttcttggaa gaaaataagt 3900ttcttgaaat ttttcatctc gaattgtatt cccacgaaag
gaatggtgaa gttgaaaaac 3960gaatccttca aatctttgtt gtggagtcga taaattatac
gccctttggt tgaatcataa 4020ggacttactt caattttgac tctatctcct ggcagtatcc
gtataaaact atgccggatc 4080tttcctgaaa cataatttat aatcagatcg gccgcaggag
gagttcatat gtcagagttg 4140agagccttca gtgccccagg gaaagcgtta ctagctggtg
gatatttagt tttagataca 4200aaatatgaag catttgtagt cggattatcg gcaagaatgc
atgctgtagc ccatccttac 4260ggttcattgc aagggtctga taagtttgaa gtgcgtgtga
aaagtaaaca atttaaagat 4320ggggagtggc tgtaccatat aagtcctaaa agtggcttca
ttcctgtttc gataggcgga 4380tctaagaacc ctttcattga aaaagttatc gctaacgtat
ttagctactt taaacctaac 4440atggacgact actgcaatag aaacttgttc gttattgata
ttttctctga tgatgcctac 4500cattctcagg aggatagcgt taccgaacat cgtggcaaca
gaagattgag ttttcattcg 4560cacagaattg aagaagttcc caaaacaggg ctgggctcct
cggcaggttt agtcacagtt 4620ttaactacag ctttggcctc cttttttgta tcggacctgg
aaaataatgt agacaaatat 4680agagaagtta ttcataattt agcacaagtt gctcattgtc
aagctcaggg taaaattgga 4740agcgggtttg atgtagcggc ggcagcatat ggatctatca
gatatagaag attcccaccc 4800gcattaatct ctaatttgcc agatattgga agtgctactt
acggcagtaa actggcgcat 4860ttggttgatg aagaagactg gaatattacg attaaaagta
accatttacc ttcgggatta 4920actttatgga tgggcgatat taagaatggt tcagaaacag
taaaactggt ccagaaggta 4980aaaaattggt atgattcgca tatgccagaa agcttgaaaa
tatatacaga actcgatcat 5040gcaaattcta gatttatgga tggactatct aaactagatc
gcttacacga gactcatgac 5100gattacagcg atcagatatt tgagtctctt gagaggaatg
actgtacctg tcaaaagtat 5160cctgaaatca cagaagttag agatgcagtt gccacaatta
gacgttcctt tagaaaaata 5220actaaagaat ctggtgccga tatcgaacct cccgtacaaa
ctagcttatt ggatgattgc 5280cagaccttaa aaggagttct tacttgctta atacctggtg
ctggtggtta tgacgccatt 5340gcagtgatta ctaagcaaga tgttgatctt agggctcaaa
ccgctaatga caaaagattt 5400tctaaggttc aatggctgga tgtaactcag gctgactggg
gtgttaggaa agaaaaagat 5460ccggaaactt atcttgataa actgcaggag gagttttaat
gtcattaccg ttcttaactt 5520ctgcaccggg aaaggttatt atttttggtg aacactctgc
tgtgtacaac aagcctgccg 5580tcgctgctag tgtgtctgcg ttgagaacct acctgctaat
aagcgagtca tctgcaccag 5640atactattga attggacttc ccggacatta gctttaatca
taagtggtcc atcaatgatt 5700tcaatgccat caccgaggat caagtaaact cccaaaaatt
ggccaaggct caacaagcca 5760ccgatggctt gtctcaggaa ctcgttagtc ttttggatcc
gttgttagct caactatccg 5820aatccttcca ctaccatgca gcgttttgtt tcctgtatat
gtttgtttgc ctatgccccc 5880atgccaagaa tattaagttt tctttaaagt ctactttacc
catcggtgct gggttgggct 5940caagcgcctc tatttctgta tcactggcct tagctatggc
ctacttgggg gggttaatag 6000gatctaatga cttggaaaag ctgtcagaaa acgataagca
tatagtgaat caatgggcct 6060tcataggtga aaagtgtatt cacggtaccc cttcaggaat
agataacgct gtggccactt 6120atggtaatgc cctgctattt gaaaaagact cacataatgg
aacaataaac acaaacaatt 6180ttaagttctt agatgatttc ccagccattc caatgatcct
aacctatact agaattccaa 6240ggtctacaaa agatcttgtt gctcgcgttc gtgtgttggt
caccgagaaa tttcctgaag 6300ttatgaagcc aattctagat gccatgggtg aatgtgccct
acaaggctta gagatcatga 6360ctaagttaag taaatgtaaa ggcaccgatg acgaggctgt
agaaactaat aatgaactgt 6420atgaacaact attggaattg ataagaataa atcatggact
gcttgtctca atcggtgttt 6480ctcatcctgg attagaactt attaaaaatc tgagcgatga
tttgagaatt ggctccacaa 6540aacttaccgg tgctggtggc ggcggttgct ctttgacttt
gttacgaaga gacattactc 6600aagagcaaat tgacagcttc aaaaagaaat tgcaagatga
ttttagttac gagacatttg 6660aaacagactt gggtgggact ggctgctgtt tgttaagcgc
aaaaaatttg aataaagatc 6720ttaaaatcaa atccctagta ttccaattat ttgaaaataa
aactaccaca aagcaacaaa 6780ttgacgatct attattgcca ggaaacacga atttaccatg
gacttcagac gaggagtttt 6840aatgactgta tatactgcta gtgtaactgc tccggtaaat
attgctactc ttaagtattg 6900ggggaaaagg gacacgaagt tgaatctgcc caccaattcg
tccatatcag tgactttatc 6960gcaagatgac ctcagaacgt tgacctctgc ggctactgca
cctgagtttg aacgcgacac 7020tttgtggtta aatggagaac cacacagcat cgacaatgaa
agaactcaaa attgtctgcg 7080cgacctacgc caattaagaa aggaaatgga atcgaaggac
gcctcattgc ccacattatc 7140tcaatggaaa ctccacattg tctccgaaaa taactttcct
acagcagctg gtttagcttc 7200ctccgctgct ggctttgctg cattggtctc tgcaattgct
aagttatacc aattaccaca 7260gtcaacttca gaaatatcta gaatagcaag aaaggggtct
ggttcagctt gtagatcgtt 7320gtttggcgga tacgtggcct gggaaatggg aaaagctgaa
gatggtcatg attccatggc 7380agtacaaatc gcagacagct ctgactggcc tcagatgaaa
gcttgtgtcc tagttgtcag 7440cgatattaaa aaggatgtga gttccactca gggtatgcaa
ttgaccgtgg caacctccga 7500actatttaaa gaaagaattg aacatgtcgt accaaagaga
tttgaagtca tgcgtaaagc 7560cattgttgaa aaagatttcg ccacctttgc aaaggaaaca
atgatggatt ccaactcttt 7620ccatgccaca tgtttggact ctttccctcc aatattctac
atgaatgaca cttccaagcg 7680tatcatcagt tggtgccaca ccattaatca gttttacgga
gaaacaatcg ttgcatacac 7740gtttgatgca ggtccaaatg ctgtgttgta ctacttagct
gaaaatgagt cgaaactctt 7800tgcatttatc tataaattgt ttggctctgt tcctggatgg
gacaagaaat ttactactga 7860gcagcttgag gctttcaacc atcaatttga atcatctaac
tttactgcac gtgaattgga 7920tcttgagttg caaaaggatg ttgccagagt gattttaact
caagtcggtt caggcccaca 7980agaaacaaac gaatctttga ttgacgcaaa gactggtcta
ccaaaggaag aggagtttta 8040actcgacgcc ggcggaggca catatgtctc agaacgttta
cattgtatcg actgccagaa 8100ccccaattgg ttcattccag ggttctctat cctccaagac
agcagtggaa ttgggtgctg 8160ttgctttaaa aggcgccttg gctaaggttc cagaattgga
tgcatccaag gattttgacg 8220aaattatttt tggtaacgtt ctttctgcca atttgggcca
agctccggcc agacaagttg 8280ctttggctgc cggtttgagt aatcatatcg ttgcaagcac
agttaacaag gtctgtgcat 8340ccgctatgaa ggcaatcatt ttgggtgctc aatccatcaa
atgtggtaat gctgatgttg 8400tcgtagctgg tggttgtgaa tctatgacta acgcaccata
ctacatgcca gcagcccgtg 8460cgggtgccaa atttggccaa actgttcttg ttgatggtgt
cgaaagagat gggttgaacg 8520atgcgtacga tggtctagcc atgggtgtac acgcagaaaa
gtgtgcccgt gattgggata 8580ttactagaga acaacaagac aattttgcca tcgaatccta
ccaaaaatct caaaaatctc 8640aaaaggaagg taaattcgac aatgaaattg tacctgttac
cattaaggga tttagaggta 8700agcctgatac tcaagtcacg aaggacgagg aacctgctag
attacacgtt gaaaaattga 8760gatctgcaag gactgttttc caaaaagaaa acggtactgt
tactgccgct aacgcttctc 8820caatcaacga tggtgctgca gccgtcatct tggtttccga
aaaagttttg aaggaaaaga 8880atttgaagcc tttggctatt atcaaaggtt ggggtgaggc
cgctcatcaa ccagctgatt 8940ttacatgggc tccatctctt gcagttccaa aggctttgaa
acatgctggc atcgaagaca 9000tcaattctgt tgattacttt gaattcaatg aagccttttc
ggttgtcggt ttggtgaaca 9060ctaagatttt gaagctagac ccatctaagg ttaatgtata
tggtggtgct gttgctctag 9120gtcacccatt gggttgttct ggtgctagag tggttgttac
actgctatcc atcttacagc 9180aagaaggagg taagatcggt gttgccgcca tttgtaatgg
tggtggtggt gcttcctcta 9240ttgtcattga aaagatatga ggatcctcta gatgcgcagg
aggcacatat ggcgaagaac 9300gttgggattt tggctatgga tatctatttc cctcccacct
gtgttcaaca ggaagctttg 9360gaagcacatg atggagcaag taaagggaaa tacactattg
gacttggcca agattgttta 9420gctttttgca ctgagcttga agatgttatc tctatgagtt
tcaatgcggt gacatcactt 9480tttgagaagt ataagattga ccctaaccaa atcgggcgtc
ttgaagtagg aagtgagact 9540gttattgaca aaagcaagtc catcaagacc ttcttgatgc
agctctttga gaaatgtgga 9600aacactgatg tcgaaggtgt tgactcgacc aatgcttgct
atggtggaac tgcagctttg 9660ttaaactgtg tcaattgggt tgagagtaac tcttgggatg
gacgttatgg cctcgtcatt 9720tgtactgaca gcgcggttta tgcagaagga cccgcaaggc
ccactggagg agctgcagcg 9780attgctatgt tgataggacc tgatgctcct atcgttttcg
aaagcaaatt gagagcaagc 9840cacatggctc atgtctatga cttttacaag cccaatcttg
ctagcgagta cccggttgtt 9900gatggtaagc tttcacagac ttgctacctc atggctcttg
actcctgcta taaacattta 9960tgcaacaagt tcgagaagat cgagggcaaa gagttctcca
taaatgatgc tgattacatt 10020gttttccatt ctccatacaa taaacttgta cagaaaagct
ttgctcgtct cttgtacaac 10080gacttcttga gaaacgcaag ctccattgac gaggctgcca
aagaaaagtt caccccttat 10140tcatctttga cccttgacga gagttaccaa agccgtgatc
ttgaaaaggt gtcacaacaa 10200atttcgaaac cgttttatga tgctaaagtg caaccaacga
ctttaatacc aaaggaagtc 10260ggtaacatgt acactgcttc tctctacgct gcatttgctt
ccctcatcca caataaacac 10320aatgatttgg cgggaaagcg ggtggttatg ttctcttatg
gaagtggctc caccgcaaca 10380atgttctcat tacgcctcaa cgacaataag cctcctttca
gcatttcaaa cattgcatct 10440gtaatggatg ttggcggtaa attgaaagct agacatgagt
atgcacctga gaagtttgtg 10500gagacaatga agctaatgga acataggtat ggagcaaagg
actttgtgac aaccaaggag 10560ggtattatag atcttttggc accgggaact tattatctga
aagaggttga ttccttgtac 10620cggagattct atggcaagaa aggtgaagat ggatctgtag
ccaatggaca ctgaggatcc 10680gtcgagcacg tggaggcaca tatgcaatgc tgtgagatgc
ctgttggata cattcagatt 10740cctgttggga ttgctggtcc attgttgctt gatggttatg
agtactctgt tcctatggct 10800acaaccgaag gttgtttggt tgctagcact aacagaggct
gcaaggctat gtttatctct 10860ggtggcgcca ccagtaccgt tcttaaggac ggtatgaccc
gagcacctgt tgttcggttc 10920gcttcggcga gacgagcttc ggagcttaag tttttcttgg
agaatccaga gaactttgat 10980actttggcag tagtcttcaa caggtcgagt agatttgcaa
gactgcaaag tgttaaatgc 11040acaatcgcgg ggaagaatgc ttatgtaagg ttctgttgta
gtactggtga tgctatgggg 11100atgaatatgg tttctaaagg tgtgcagaat gttcttgagt
atcttaccga tgatttccct 11160gacatggatg tgattggaat ctctggtaac ttctgttcgg
acaagaaacc tgctgctgtg 11220aactggattg agggacgtgg taaatcagtt gtttgcgagg
ctgtaatcag aggagagatc 11280gtgaacaagg tcttgaaaac gagcgtggct gctttagtcg
agctcaacat gctcaagaac 11340ctagctggct ctgctgttgc aggctctcta ggtggattca
acgctcatgc cagtaacata 11400gtgtctgctg tattcatagc tactggccaa gatccagctc
aaaacgtgga gagttctcaa 11460tgcatcacca tgatggaagc tattaatgac ggcaaagata
tccatatctc agtcactatg 11520ccatctatcg aggtggggac agtgggagga ggaacacagc
ttgcatctca atcagcgtgt 11580ttaaacctgc tcggagttaa aggagcaagc acagagtcgc
cgggaatgaa cgcaaggagg 11640ctagcgacga tcgtagccgg agcagtttta gctggagagt
tatctttaat gtcagcaatt 11700gcagctggac agcttgtgag aagtcacatg aaatacaata
gatccagccg agacatctct 11760ggagcaacga caacgacaac aacaacaaca tgacccggga
tccggccgat ctaaacaaac 11820ccggaacaga ccgttgggaa gcgattcagt aattaaagct
tcatgactcc tttttggttc 11880ttaaagtccc tttgaggtat caactaataa gaaagatatt
agacaacccc ccttttttct 11940ttttcacaaa taggaagttt cgaatccaat ttggatatta
aaaggattac cagatataac 12000acaaaatctc tccacctatt ccttctagtc gagcctctcg
gtctgtcatt atacctcgag 12060aagtagaaag aattacaatc cccattccac ctaaaattcg
cggaattcgt tgataattag 12120aatagattcg tagaccaggt cgactgattc gttttaaatt
taaaatattt ctatagggtc 12180ttttcctatt ccttctatgt cgcagggtta aaaccaaaaa
atatttgttt ttttctcgat 12240gttttctcac gttttcgata aaaccttctc gtaaaagtat
ttgaacaata ttttcggtaa 12300tattagtaga tgctattcga accacccttt ttcgatccat
atcagcattt cgtatagaag 12360ttattatctc agcaatagtg tccctaccca tgatgaacta
aaattattgg ggcctccaaa 12420tttgatataa tcaacgtgtt ttttacttat tttttttttg
aatatgatat gaattattaa 12480agatatatgc gtgagacaca atctactaat taatctattt
ctttcaaata ccccactaga 12540aacagatcac aatttcattt tataatacct cgggagctaa
tgaaactatt ttagtaaaat 12600ttaattctct caattcccgg gcgattgcac caaaaattcg
agttcctttt gatttccttc 12660cttcttgatc aataacaact gcagcattgt catcatatcg
tattatcatc ccgttgtcac 12720gtttgagttc tttacaggtc cgcacaatta cagctctgac
tacttctgat ctttctaggg 12780gcatatttgg tacggcttct ttgatcacag caacaataac
gtcaccaata tgagcatatc 12840gacgattgct agctcctatg attcgaatac acatcaattc
tcgagccccg ctgttatccg 12900ctacatttaa atgggtctga ggttgaatca tttttttaat
ccgttctttg aatgcaaagg 12960gcgaagaaaa aaaagaaata tttttgtcca aaaaaaaaga
aacatgcggt ttcgtttcat 13020atctaagagc cctttccgca tttttttcta ttacattacg
aaataatgaa ttgagttcgt 13080ataggcattt tagatgctgc tagtgaaata gcccttctgg
ctatattttc tgttactcca 13140cccatttcat aaagtattcg acccggttta acaacagcta
cccaatattc aggggatccc 13200ccgggctgca ggaattcgat atcaagctta tcgataccgt
cgacctcgag ggggggcccg 13260gtacccaatt cgccctatag tgagtcgtat tacaattcac
tggccgtcgt tttacaacgt 13320cgtgactggg aaaaccctgg cgttacccaa cttaatcgcc
ttgcagcaca tccccctttc 13380gccagctggc gtaatagcga agaggcccgc accgatcgcc
cttcccaaca gttgcgcagc 13440ctgaatggcg aatgggacgc gccctgtagc ggcgcattaa
gcgcggcggg tgtggtggtt 13500acgcgcagcg tgaccgctac acttgccagc gccctagcgc
ccgctccttt cgctttcttc 13560ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag
ctctaaatcg ggggctccct 13620ttagggttcc gatttagtgc tttacggcac ctcgacccca
aaaaacttga ttagggtgat 13680ggttcacgta gtgggccatc gccctgatag acggtttttc
gccctttgac gttggagtcc 13740acgttcttta atagtggact cttgttccaa actggaacaa
cactcaaccc tatctcggtc 13800tattcttttg atttataagg gattttgccg atttcggcct
attggttaaa aaatgagctg 13860atttaacaaa aatttaacgc gaattttaac aaaatattaa
cgcttacaat ttaggtg 13917737252DNAArtificial
Sequencemisc_feature()..()Plastid transformation vector pHKO7, containing
Operon C, contain i 73gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt
atttttctaa atacattcaa 60atatgtatcc gctcatgaga caataaccct gataaatgct
tcaataatat tgaaaaagga 120agagtatgag tattcaacat ttccgtgtcg cccttattcc
cttttttgcg gcattttgcc 180ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa
agatgctgaa gatcagttgg 240gtgcacgagt gggttacatc gaactggatc tcaacagcgg
taagatcctt gagagttttc 300gccccgaaga acgttttcca atgatgagca cttttaaagt
tctgctatgt ggcgcggtat 360tatcccgtat tgacgccggg caagagcaac tcggtcgccg
catacactat tctcagaatg 420acttggttga gtactcacca gtcacagaaa agcatcttac
ggatggcatg acagtaagag 480aattatgcag tgctgccata accatgagtg ataacactgc
ggccaactta cttctgacaa 540cgatcggagg accgaaggag ctaaccgctt ttttgcacaa
catgggggat catgtaactc 600gccttgatcg ttgggaaccg gagctgaatg aagccatacc
aaacgacgag cgtgacacca 660cgatgcctgt agcaatggca acaacgttgc gcaaactatt
aactggcgaa ctacttactc 720tagcttcccg gcaacaatta atagactgga tggaggcgga
taaagttgca ggaccacttc 780tgcgctcggc ccttccggct ggctggttta ttgctgataa
atctggagcc ggtgagcgtg 840ggtctcgcgg tatcattgca gcactggggc cagatggtaa
gccctcccgt atcgtagtta 900tctacacgac ggggagtcag gcaactatgg atgaacgaaa
tagacagatc gctgagatag 960gtgcctcact gattaagcat tggtaactgt cagaccaagt
ttactcatat atactttaga 1020ttgatttaaa acttcatttt taatttaaaa ggatctaggt
gaagatcctt tttgataatc 1080tcatgaccaa aatcccttaa cgtgagtttt cgttccactg
agcgtcagac cccgtagaaa 1140agatcaaagg atcttcttga gatccttttt ttctgcgcgt
aatctgctgc ttgcaaacaa 1200aaaaaccacc gctaccagcg gtggtttgtt tgccggatca
agagctacca actctttttc 1260cgaaggtaac tggcttcagc agagcgcaga taccaaatac
tgtccttcta gtgtagccgt 1320agttaggcca ccacttcaag aactctgtag caccgcctac
atacctcgct ctgctaatcc 1380tgttaccagt ggctgctgcc agtggcgata agtcgtgtct
taccgggttg gactcaagac 1440gatagttacc ggataaggcg cagcggtcgg gctgaacggg
gggttcgtgc acacagccca 1500gcttggagcg aacgacctac accgaactga gatacctaca
gcgtgagcta tgagaaagcg 1560ccacgcttcc cgaagggaga aaggcggaca ggtatccggt
aagcggcagg gtcggaacag 1620gagagcgcac gagggagctt ccagggggaa acgcctggta
tctttatagt cctgtcgggt 1680ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc
gtcagggggg cggagcctat 1740ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc
cttttgctgg ccttttgctc 1800acatgttctt tcctgcgtta tcccctgatt ctgtggataa
ccgtattacc gcctttgagt 1860gagctgatac cgctcgccgc agccgaacga ccgagcgcag
cgagtcagtg agcgaggaag 1920cggaagagcg cccaatacgc aaaccgcctc tccccgcgcg
ttggccgatt cattaatgca 1980gctggcacga caggtttccc gactggaaag cgggcagtga
gcgcaacgca attaatgtga 2040gttagctcac tcattaggca ccccaggctt tacactttat
gcttccggct cgtatgttgt 2100gtggaattgt gagcggataa caatttcaca caggaaacag
ctatgaccat gattacgcca 2160agctcgaaat taaccctcac taaagggaac aaaagctgga
gctccaccgc ggtggcggcc 2220gctctagaac tagtggatct tcttggctgt tattcaaaag
gtccaacaat gtatatatat 2280tggacatttt gaggcaatta tagatcctgg aaggcaattc
tgattggtca ataaaaatcg 2340atttcaatgc tatttttttt ttgtttttta tgagtttagc
caatttatca tgaaaggtaa 2400aaggggataa aggaaccgtg tgttgattgt cctgtaaata
taagttgtct tcctccatat 2460gtaaaaaggg aataaataaa tcaattaaat ttcgggatgc
ttcatgaagt gcttctttcg 2520gagttaaact tccgtttgtc catatttcga gaaaaagtat
ctcttgtttt tcattcccat 2580tcccataaga atgaatacta tgattcgcgt ttcgaacagg
catgaataca gcatctatag 2640gataacttcc atcttgaaag ttatgtggcg tttttataag
atatccacga tttctctcta 2700tttgtaatcc aatacaaaaa tcaattggtt ccgttaaact
ggctatatgt tgtgtattat 2760caacgatttc tacataaggc ggcaagatga tatcttgggc
agttacagat ccaggaccct 2820tgacacaaat agatgcgtca gaagttccat atagattact
tcttaatata atttctttca 2880aattcattaa aatttcatgt accgattctt gaatgcccgt
tatggtagaa tattcatgtg 2940ggactttctc agattttaca cgtgtgatac atgttccttc
tatttctcca agtaaagctc 3000ttcgcatcgc aatgcctatt gtgtcggctt ggcctttcat
aagtggagac agaataaagc 3060gtccataata aaggcgttta ctgtctgttc ttgattcaac
acacttccac tgtagtgtcc 3120gagtagatac tgttactttc tctcgaacca tagtactatt
atttgattag atcatcgaat 3180cttttatttc tcttgagatt tcttcaatgt tcagttctac
acacgtcttt ttttcggagg 3240tctacagcca ttatgtggca taggagttac atcccgtacg
aaagttaata gtataccact 3300tcgacgaata gctcgtaatg ctgcatctct tccgagaccg
ggacctttta tcatgacttc 3360tgctcgttgc ataccttgat ccactactgt acggatagcg
tttgctgctg cggtttgagc 3420agcaaacggt gttcctcttc tcgtaccttt gaatccagaa
gtaccggcgg aggaccaaga 3480aactactcga ccccgtacat ctgtaacagt gacaatggta
ttattgaaac ttgcttgaac 3540atgaataact ccctttggta ttctacgtgc acccttacgt
gaaccaatac gtccattcct 3600acgcgaacta attttcggta tagcttttgc catattttat
catctcgtaa atatgagtca 3660gagatatatg gatatatcca tttcatgtca aaacagattc
tttatttgta catcggctct 3720tctggcaagt ctgattatcc ctgtctttgt ttatgtctcg
ggttggaaca aattactata 3780attcgtcccc gcctacggat tagtcgacat ttttcacaaa
ttttacgaac ggaagctctt 3840attttcatat ttctcattcc ttaccttaat tctgaatcta
tttcttggaa gaaaataagt 3900ttcttgaaat ttttcatctc gaattgtatt cccacgaaag
gaatggtgaa gttgaaaaac 3960gaatccttca aatctttgtt gtggagtcga taaattatac
gccctttggt tgaatcataa 4020ggacttactt caattttgac tctatctcct ggcagtatcc
gtataaaact atgccggatc 4080tttcctgaaa cataatttat aatcagatcc aggaggacca
tatgatcgcc gaagcggata 4140tggaggtctg ccgggagctg atccgcaccg gcagctactc
cttccatgcg gcgtccagag 4200ttctgccggc gcgggtccgt gaccccgcgc tggcgcttta
cgccttttgc cgcgtcgccg 4260atgacgaagt cgacgaggtt ggcgcgccgc gcgacaaggc
tgcggcggtt ttgaaacttg 4320gcgaccggct ggaggacatc tatgccggtc gtccgcgcaa
tgcgccctcg gatcgggctt 4380tcgcggcggt ggtcgaggaa ttcgagatgc cgcgcgaatt
gcccgaggcg ctgctggagg 4440gcttcgcctg ggatgccgag gggcggtggt atcacacgct
ttcggacgtg caggcctatt 4500cggcgcgggt ggcggccgcc gtcggcgcga tgatgtgcgt
gctgatgcgg gtgcgcaacc 4560ccgatgcgct ggcgcgggcc tgcgatctcg gtcttgccat
gcagatgtcg aacatcgccc 4620gcgacgtggg cgaggatgcc cgggcggggc ggcttttcct
gccgaccgac tggatggtcg 4680aggaggggat cgatccgcag gcgttcctgg ccgatccgca
gcccaccaag ggcatccgcc 4740gggtcaccga gcggttgctg aaccgcgccg accggcttta
ctggcgggcg gcgacggggg 4800tgcggctttt gccctttgac tgccgaccgg ggatcatggc
cgcgggcaag atctatgccg 4860cgatcggggc cgaggtggcg aaggcgaaat acgacaacat
cacccggcgt gcccacacga 4920ccaagggccg caagctgtgg ctggtggcga attccgcgat
gtcggcgacg gcgacctcga 4980tgctgccgct ctcgccgcgg gtgcatgcca agcccgagcc
cgaagtggcg catctggtcg 5040atgccgccgc gcatcgcaac ctgcatcccg aacggtccga
ggtgctgatc tcggcgctga 5100tggcgctgaa ggcgcgcgac cgcggcctgg cgatggattg
aggatctaaa caaacccgga 5160acagaccgtt gggaagcgat tcagtaatta aagcttcatg
actccttttt ggttcttaaa 5220gtccctttga ggtatcaact aataagaaag atattagaca
accccccttt tttctttttc 5280acaaatagga agtttcgaat ccaatttgga tattaaaagg
attaccagat ataacacaaa 5340atctctccac ctattccttc tagtcgagcc tctcggtctg
tcattatacc tcgagaagta 5400gaaagaatta caatccccat tccacctaaa attcgcggaa
ttcgttgata attagaatag 5460attcgtagac caggtcgact gattcgtttt aaatttaaaa
tatttctata gggtcttttc 5520ctattccttc tatgtcgcag ggttaaaacc aaaaaatatt
tgtttttttc tcgatgtttt 5580ctcacgtttt cgataaaacc ttctcgtaaa agtatttgaa
caatattttc ggtaatatta 5640gtagatgcta ttcgaaccac cctttttcga tccatatcag
catttcgtat agaagttatt 5700atctcagcaa tagtgtccct acccatgatg aactaaaatt
attggggcct ccaaatttga 5760tataatcaac gtgtttttta cttatttttt ttttgaatat
gatatgaatt attaaagata 5820tatgcgtgag acacaatcta ctaattaatc tatttctttc
aaatacccca ctagaaacag 5880atcacaattt cattttataa tacctcggga gctaatgaaa
ctattttagt aaaatttaat 5940tctctcaatt cccgggcgat tgcaccaaaa attcgagttc
cttttgattt ccttccttct 6000tgatcaataa caactgcagc attgtcatca tatcgtatta
tcatcccgtt gtcacgtttg 6060agttctttac aggtccgcac aattacagct ctgactactt
ctgatctttc taggggcata 6120tttggtacgg cttctttgat cacagcaaca ataacgtcac
caatatgagc atatcgacga 6180ttgctagctc ctatgattcg aatacacatc aattctcgag
ccccgctgtt atccgctaca 6240tttaaatggg tctgaggttg aatcattttt ttaatccgtt
ctttgaatgc aaagggcgaa 6300gaaaaaaaag aaatattttt gtccaaaaaa aaagaaacat
gcggtttcgt ttcatatcta 6360agagcccttt ccgcattttt ttctattaca ttacgaaata
atgaattgag ttcgtatagg 6420cattttagat gctgctagtg aaatagccct tctggctata
ttttctgtta ctccacccat 6480ttcataaagt attcgacccg gtttaacaac agctacccaa
tattcagggg atcccccggg 6540ctgcaggaat tcgatatcaa gcttatcgat accgtcgacc
tcgagggggg gcccggtacc 6600caattcgccc tatagtgagt cgtattacaa ttcactggcc
gtcgttttac aacgtcgtga 6660ctgggaaaac cctggcgtta cccaacttaa tcgccttgca
gcacatcccc ctttcgccag 6720ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc
caacagttgc gcagcctgaa 6780tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg
gcgggtgtgg tggttacgcg 6840cagcgtgacc gctacacttg ccagcgccct agcgcccgct
cctttcgctt tcttcccttc 6900ctttctcgcc acgttcgccg gctttccccg tcaagctcta
aatcgggggc tccctttagg 6960gttccgattt agtgctttac ggcacctcga ccccaaaaaa
cttgattagg gtgatggttc 7020acgtagtggg ccatcgccct gatagacggt ttttcgccct
ttgacgttgg agtccacgtt 7080ctttaatagt ggactcttgt tccaaactgg aacaacactc
aaccctatct cggtctattc 7140ttttgattta taagggattt tgccgatttc ggcctattgg
ttaaaaaatg agctgattta 7200acaaaaattt aacgcgaatt ttaacaaaat attaacgctt
acaatttagg tg 72527414623DNAArtificial
Sequencemisc_feature()..()Plastic transformation vector pHKO8, containing
Operon G, contain i 74cacctaaatt gtaagcgtta atattttgtt aaaattcgcg
ttaaattttt gttaaatcag 60ctcatttttt aaccaatagg ccgaaatcgg caaaatccct
tataaatcaa aagaatagac 120cgagataggg ttgagtgttg ttccagtttg gaacaagagt
ccactattaa agaacgtgga 180ctccaacgtc aaagggcgaa aaaccgtcta tcagggcgat
ggcccactac gtgaaccatc 240accctaatca agttttttgg ggtcgaggtg ccgtaaagca
ctaaatcgga accctaaagg 300gagcccccga tttagagctt gacggggaaa gccggcgaac
gtggcgagaa aggaagggaa 360gaaagcgaaa ggagcgggcg ctagggcgct ggcaagtgta
gcggtcacgc tgcgcgtaac 420caccacaccc gccgcgctta atgcgccgct acagggcgcg
tcccattcgc cattcaggct 480gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg
ctattacgcc agctggcgaa 540agggggatgt gctgcaaggc gattaagttg ggtaacgcca
gggttttccc agtcacgacg 600ttgtaaaacg acggccagtg aattgtaata cgactcacta
tagggcgaat tgggtaccgg 660gccccccctc gaggtcgacg gtatcgataa gcttgatatc
gaattcctgc agcccggggg 720atcttcttgg ctgttattca aaaggtccaa caatgtatat
atattggaca ttttgaggca 780attatagatc ctggaaggca attctgattg gtcaataaaa
atcgatttca atgctatttt 840ttttttgttt tttatgagtt tagccaattt atcatgaaag
gtaaaagggg ataaaggaac 900cgtgtgttga ttgtcctgta aatataagtt gtcttcctcc
atatgtaaaa agggaataaa 960taaatcaatt aaatttcggg atgcttcatg aagtgcttct
ttcggagtta aacttccgtt 1020tgtccatatt tcgagaaaaa gtatctcttg tttttcattc
ccattcccat aagaatgaat 1080actatgattc gcgtttcgaa caggcatgaa tacagcatct
ataggataac ttccatcttg 1140aaagttatgt ggcgttttta taagatatcc acgatttctc
tctatttgta atccaataca 1200aaaatcaatt ggttccgtta aactggctat atgttgtgta
ttatcaacga tttctacata 1260aggcggcaag atgatatctt gggcagttac agatccagga
cccttgacac aaatagatgc 1320gtcagaagtt ccatatagat tacttcttaa tataatttct
ttcaaattca ttaaaatttc 1380atgtaccgat tcttgaatgc ccgttatggt agaatattca
tgtgggactt tctcagattt 1440tacacgtgtg atacatgttc cttctatttc tccaagtaaa
gctcttcgca tcgcaatgcc 1500tattgtgtcg gcttggcctt tcataagtgg agacagaata
aagcgtccat aataaaggcg 1560tttactgtct gttcttgatt caacacactt ccactgtagt
gtccgagtag atactgttac 1620tttctctcga accatagtac tattatttga ttagatcatc
gaatctttta tttctcttga 1680gatttcttca atgttcagtt ctacacacgt ctttttttcg
gaggtctaca gccattatgt 1740ggcataggag ttacatcccg tacgaaagtt aatagtatac
cacttcgacg aatagctcgt 1800aatgctgcat ctcttccgag accgggacct tttatcatga
cttctgctcg ttgcatacct 1860tgatccacta ctgtacggat agcgtttgct gctgcggttt
gagcagcaaa cggtgttcct 1920cttctcgtac ctttgaatcc agaagtaccg gcggaggacc
aagaaactac tcgaccccgt 1980acatctgtaa cagtgacaat ggtattattg aaacttgctt
gaacatgaat aactcccttt 2040ggtattctac gtgcaccctt acgtgaacca atacgtccat
tcctacgcga actaattttc 2100ggtatagctt ttgccatatt ttatcatctc gtaaatatga
gtcagagata tatggatata 2160tccatttcat gtcaaaacag attctttatt tgtacatcgg
ctcttctggc aagtctgatt 2220atccctgtct ttgtttatgt ctcgggttgg aacaaattac
tataattcgt ccccgcctac 2280ggattagtcg acatttttca caaattttac gaacggaagc
tcttattttc atatttctca 2340ttccttacct taattctgaa tctatttctt ggaagaaaat
aagtttcttg aaatttttca 2400tctcgaattg tattcccacg aaaggaatgg tgaagttgaa
aaacgaatcc ttcaaatctt 2460tgttgtggag tcgataaatt atacgccctt tggttgaatc
ataaggactt acttcaattt 2520tgactctatc tcctggcagt atccgtataa aactatgccg
gatctttcct gaaacataat 2580ttataatcag atcggccgca ggaggagttc atatgtcaga
gttgagagcc ttcagtgccc 2640cagggaaagc gttactagct ggtggatatt tagttttaga
tacaaaatat gaagcatttg 2700tagtcggatt atcggcaaga atgcatgctg tagcccatcc
ttacggttca ttgcaagggt 2760ctgataagtt tgaagtgcgt gtgaaaagta aacaatttaa
agatggggag tggctgtacc 2820atataagtcc taaaagtggc ttcattcctg tttcgatagg
cggatctaag aaccctttca 2880ttgaaaaagt tatcgctaac gtatttagct actttaaacc
taacatggac gactactgca 2940atagaaactt gttcgttatt gatattttct ctgatgatgc
ctaccattct caggaggata 3000gcgttaccga acatcgtggc aacagaagat tgagttttca
ttcgcacaga attgaagaag 3060ttcccaaaac agggctgggc tcctcggcag gtttagtcac
agttttaact acagctttgg 3120cctccttttt tgtatcggac ctggaaaata atgtagacaa
atatagagaa gttattcata 3180atttagcaca agttgctcat tgtcaagctc agggtaaaat
tggaagcggg tttgatgtag 3240cggcggcagc atatggatct atcagatata gaagattccc
acccgcatta atctctaatt 3300tgccagatat tggaagtgct acttacggca gtaaactggc
gcatttggtt gatgaagaag 3360actggaatat tacgattaaa agtaaccatt taccttcggg
attaacttta tggatgggcg 3420atattaagaa tggttcagaa acagtaaaac tggtccagaa
ggtaaaaaat tggtatgatt 3480cgcatatgcc agaaagcttg aaaatatata cagaactcga
tcatgcaaat tctagattta 3540tggatggact atctaaacta gatcgcttac acgagactca
tgacgattac agcgatcaga 3600tatttgagtc tcttgagagg aatgactgta cctgtcaaaa
gtatcctgaa atcacagaag 3660ttagagatgc agttgccaca attagacgtt cctttagaaa
aataactaaa gaatctggtg 3720ccgatatcga acctcccgta caaactagct tattggatga
ttgccagacc ttaaaaggag 3780ttcttacttg cttaatacct ggtgctggtg gttatgacgc
cattgcagtg attactaagc 3840aagatgttga tcttagggct caaaccgcta atgacaaaag
attttctaag gttcaatggc 3900tggatgtaac tcaggctgac tggggtgtta ggaaagaaaa
agatccggaa acttatcttg 3960ataaactgca ggaggagttt taatgtcatt accgttctta
acttctgcac cgggaaaggt 4020tattattttt ggtgaacact ctgctgtgta caacaagcct
gccgtcgctg ctagtgtgtc 4080tgcgttgaga acctacctgc taataagcga gtcatctgca
ccagatacta ttgaattgga 4140cttcccggac attagcttta atcataagtg gtccatcaat
gatttcaatg ccatcaccga 4200ggatcaagta aactcccaaa aattggccaa ggctcaacaa
gccaccgatg gcttgtctca 4260ggaactcgtt agtcttttgg atccgttgtt agctcaacta
tccgaatcct tccactacca 4320tgcagcgttt tgtttcctgt atatgtttgt ttgcctatgc
ccccatgcca agaatattaa 4380gttttcttta aagtctactt tacccatcgg tgctgggttg
ggctcaagcg cctctatttc 4440tgtatcactg gccttagcta tggcctactt gggggggtta
ataggatcta atgacttgga 4500aaagctgtca gaaaacgata agcatatagt gaatcaatgg
gccttcatag gtgaaaagtg 4560tattcacggt accccttcag gaatagataa cgctgtggcc
acttatggta atgccctgct 4620atttgaaaaa gactcacata atggaacaat aaacacaaac
aattttaagt tcttagatga 4680tttcccagcc attccaatga tcctaaccta tactagaatt
ccaaggtcta caaaagatct 4740tgttgctcgc gttcgtgtgt tggtcaccga gaaatttcct
gaagttatga agccaattct 4800agatgccatg ggtgaatgtg ccctacaagg cttagagatc
atgactaagt taagtaaatg 4860taaaggcacc gatgacgagg ctgtagaaac taataatgaa
ctgtatgaac aactattgga 4920attgataaga ataaatcatg gactgcttgt ctcaatcggt
gtttctcatc ctggattaga 4980acttattaaa aatctgagcg atgatttgag aattggctcc
acaaaactta ccggtgctgg 5040tggcggcggt tgctctttga ctttgttacg aagagacatt
actcaagagc aaattgacag 5100cttcaaaaag aaattgcaag atgattttag ttacgagaca
tttgaaacag acttgggtgg 5160gactggctgc tgtttgttaa gcgcaaaaaa tttgaataaa
gatcttaaaa tcaaatccct 5220agtattccaa ttatttgaaa ataaaactac cacaaagcaa
caaattgacg atctattatt 5280gccaggaaac acgaatttac catggacttc agacgaggag
ttttaatgac tgtatatact 5340gctagtgtaa ctgctccggt aaatattgct actcttaagt
attgggggaa aagggacacg 5400aagttgaatc tgcccaccaa ttcgtccata tcagtgactt
tatcgcaaga tgacctcaga 5460acgttgacct ctgcggctac tgcacctgag tttgaacgcg
acactttgtg gttaaatgga 5520gaaccacaca gcatcgacaa tgaaagaact caaaattgtc
tgcgcgacct acgccaatta 5580agaaaggaaa tggaatcgaa ggacgcctca ttgcccacat
tatctcaatg gaaactccac 5640attgtctccg aaaataactt tcctacagca gctggtttag
cttcctccgc tgctggcttt 5700gctgcattgg tctctgcaat tgctaagtta taccaattac
cacagtcaac ttcagaaata 5760tctagaatag caagaaaggg gtctggttca gcttgtagat
cgttgtttgg cggatacgtg 5820gcctgggaaa tgggaaaagc tgaagatggt catgattcca
tggcagtaca aatcgcagac 5880agctctgact ggcctcagat gaaagcttgt gtcctagttg
tcagcgatat taaaaaggat 5940gtgagttcca ctcagggtat gcaattgacc gtggcaacct
ccgaactatt taaagaaaga 6000attgaacatg tcgtaccaaa gagatttgaa gtcatgcgta
aagccattgt tgaaaaagat 6060ttcgccacct ttgcaaagga aacaatgatg gattccaact
ctttccatgc cacatgtttg 6120gactctttcc ctccaatatt ctacatgaat gacacttcca
agcgtatcat cagttggtgc 6180cacaccatta atcagtttta cggagaaaca atcgttgcat
acacgtttga tgcaggtcca 6240aatgctgtgt tgtactactt agctgaaaat gagtcgaaac
tctttgcatt tatctataaa 6300ttgtttggct ctgttcctgg atgggacaag aaatttacta
ctgagcagct tgaggctttc 6360aaccatcaat ttgaatcatc taactttact gcacgtgaat
tggatcttga gttgcaaaag 6420gatgttgcca gagtgatttt aactcaagtc ggttcaggcc
cacaagaaac aaacgaatct 6480ttgattgacg caaagactgg tctaccaaag gaagaggagt
tttaactcga cgccggcgga 6540ggcacatatg tctcagaacg tttacattgt atcgactgcc
agaaccccaa ttggttcatt 6600ccagggttct ctatcctcca agacagcagt ggaattgggt
gctgttgctt taaaaggcgc 6660cttggctaag gttccagaat tggatgcatc caaggatttt
gacgaaatta tttttggtaa 6720cgttctttct gccaatttgg gccaagctcc ggccagacaa
gttgctttgg ctgccggttt 6780gagtaatcat atcgttgcaa gcacagttaa caaggtctgt
gcatccgcta tgaaggcaat 6840cattttgggt gctcaatcca tcaaatgtgg taatgctgat
gttgtcgtag ctggtggttg 6900tgaatctatg actaacgcac catactacat gccagcagcc
cgtgcgggtg ccaaatttgg 6960ccaaactgtt cttgttgatg gtgtcgaaag agatgggttg
aacgatgcgt acgatggtct 7020agccatgggt gtacacgcag aaaagtgtgc ccgtgattgg
gatattacta gagaacaaca 7080agacaatttt gccatcgaat cctaccaaaa atctcaaaaa
tctcaaaagg aaggtaaatt 7140cgacaatgaa attgtacctg ttaccattaa gggatttaga
ggtaagcctg atactcaagt 7200cacgaaggac gaggaacctg ctagattaca cgttgaaaaa
ttgagatctg caaggactgt 7260tttccaaaaa gaaaacggta ctgttactgc cgctaacgct
tctccaatca acgatggtgc 7320tgcagccgtc atcttggttt ccgaaaaagt tttgaaggaa
aagaatttga agcctttggc 7380tattatcaaa ggttggggtg aggccgctca tcaaccagct
gattttacat gggctccatc 7440tcttgcagtt ccaaaggctt tgaaacatgc tggcatcgaa
gacatcaatt ctgttgatta 7500ctttgaattc aatgaagcct tttcggttgt cggtttggtg
aacactaaga ttttgaagct 7560agacccatct aaggttaatg tatatggtgg tgctgttgct
ctaggtcacc cattgggttg 7620ttctggtgct agagtggttg ttacactgct atccatctta
cagcaagaag gaggtaagat 7680cggtgttgcc gccatttgta atggtggtgg tggtgcttcc
tctattgtca ttgaaaagat 7740atgaggatcc tctagatgcg caggaggcac atatggcgaa
gaacgttggg attttggcta 7800tggatatcta tttccctccc acctgtgttc aacaggaagc
tttggaagca catgatggag 7860caagtaaagg gaaatacact attggacttg gccaagattg
tttagctttt tgcactgagc 7920ttgaagatgt tatctctatg agtttcaatg cggtgacatc
actttttgag aagtataaga 7980ttgaccctaa ccaaatcggg cgtcttgaag taggaagtga
gactgttatt gacaaaagca 8040agtccatcaa gaccttcttg atgcagctct ttgagaaatg
tggaaacact gatgtcgaag 8100gtgttgactc gaccaatgct tgctatggtg gaactgcagc
tttgttaaac tgtgtcaatt 8160gggttgagag taactcttgg gatggacgtt atggcctcgt
catttgtact gacagcgcgg 8220tttatgcaga aggacccgca aggcccactg gaggagctgc
agcgattgct atgttgatag 8280gacctgatgc tcctatcgtt ttcgaaagca aattgagagc
aagccacatg gctcatgtct 8340atgactttta caagcccaat cttgctagcg agtacccggt
tgttgatggt aagctttcac 8400agacttgcta cctcatggct cttgactcct gctataaaca
tttatgcaac aagttcgaga 8460agatcgaggg caaagagttc tccataaatg atgctgatta
cattgttttc cattctccat 8520acaataaact tgtacagaaa agctttgctc gtctcttgta
caacgacttc ttgagaaacg 8580caagctccat tgacgaggct gccaaagaaa agttcacccc
ttattcatct ttgacccttg 8640acgagagtta ccaaagccgt gatcttgaaa aggtgtcaca
acaaatttcg aaaccgtttt 8700atgatgctaa agtgcaacca acgactttaa taccaaagga
agtcggtaac atgtacactg 8760cttctctcta cgctgcattt gcttccctca tccacaataa
acacaatgat ttggcgggaa 8820agcgggtggt tatgttctct tatggaagtg gctccaccgc
aacaatgttc tcattacgcc 8880tcaacgacaa taagcctcct ttcagcattt caaacattgc
atctgtaatg gatgttggcg 8940gtaaattgaa agctagacat gagtatgcac ctgagaagtt
tgtggagaca atgaagctaa 9000tggaacatag gtatggagca aaggactttg tgacaaccaa
ggagggtatt atagatcttt 9060tggcaccggg aacttattat ctgaaagagg ttgattcctt
gtaccggaga ttctatggca 9120agaaaggtga agatggatct gtagccaatg gacactgagg
atccgtcgag cacgtggagg 9180cacatatgca atgctgtgag atgcctgttg gatacattca
gattcctgtt gggattgctg 9240gtccattgtt gcttgatggt tatgagtact ctgttcctat
ggctacaacc gaaggttgtt 9300tggttgctag cactaacaga ggctgcaagg ctatgtttat
ctctggtggc gccaccagta 9360ccgttcttaa ggacggtatg acccgagcac ctgttgttcg
gttcgcttcg gcgagacgag 9420cttcggagct taagtttttc ttggagaatc cagagaactt
tgatactttg gcagtagtct 9480tcaacaggtc gagtagattt gcaagactgc aaagtgttaa
atgcacaatc gcggggaaga 9540atgcttatgt aaggttctgt tgtagtactg gtgatgctat
ggggatgaat atggtttcta 9600aaggtgtgca gaatgttctt gagtatctta ccgatgattt
ccctgacatg gatgtgattg 9660gaatctctgg taacttctgt tcggacaaga aacctgctgc
tgtgaactgg attgagggac 9720gtggtaaatc agttgtttgc gaggctgtaa tcagaggaga
gatcgtgaac aaggtcttga 9780aaacgagcgt ggctgcttta gtcgagctca acatgctcaa
gaacctagct ggctctgctg 9840ttgcaggctc tctaggtgga ttcaacgctc atgccagtaa
catagtgtct gctgtattca 9900tagctactgg ccaagatcca gctcaaaacg tggagagttc
tcaatgcatc accatgatgg 9960aagctattaa tgacggcaaa gatatccata tctcagtcac
tatgccatct atcgaggtgg 10020ggacagtggg aggaggaaca cagcttgcat ctcaatcagc
gtgtttaaac ctgctcggag 10080ttaaaggagc aagcacagag tcgccgggaa tgaacgcaag
gaggctagcg acgatcgtag 10140ccggagcagt tttagctgga gagttatctt taatgtcagc
aattgcagct ggacagcttg 10200tgagaagtca catgaaatac aatagatcca gccgagacat
ctctggagca acgacaacga 10260caacaacaac aacatgaccc gtaggaggca catatgagtt
cccaacaaga gaaaaaggat 10320tatgatgaag aacaattaag gttgatggaa gaagtttgta
tcgttgtaga tgaaaatgat 10380gtccctttaa gatatggaac gaaaaaggag tgtcatttga
tggaaaatat aaataaaggt 10440cttttgcata gagcattctc tatgttcatc tttgatgagc
aaaatcgcct tttacttcag 10500cagcgtgcag aagagaaaat tacatttcca tccttatgga
cgaatacatg ttgctcccac 10560ccattggatg ttgctggtga acgtggtaat actttacctg
aagctgttga aggtgttaag 10620aatgcagctc aacgcaagct gttccatgaa ttgggtattc
aagccaagta tattcccaaa 10680gacaaatttc agtttcttac acgaatccat taccttgctc
ctagtactgg tgcttgggga 10740gagcatgaaa ttgactacat tcttttcttc aaaggtaaag
ttgagctgga tatcaatccc 10800aatgaagttc aagcctataa gtatgttact atggaagagt
taaaagagat gttttccgat 10860cctcaatatg gattcacacc atggttcaaa cttatttgtg
agcattttat gtttaaatgg 10920tggcaggatg tagatcatgc gtcaaaattc caagatacct
taattcatcg ttgctaagga 10980tcccccggga tccggccgat ctaaacaaac ccggaacaga
ccgttgggaa gcgattcagt 11040aattaaagct tcatgactcc tttttggttc ttaaagtccc
tttgaggtat caactaataa 11100gaaagatatt agacaacccc ccttttttct ttttcacaaa
taggaagttt cgaatccaat 11160ttggatatta aaaggattac cagatataac acaaaatctc
tccacctatt ccttctagtc 11220gagcctctcg gtctgtcatt atacctcgag aagtagaaag
aattacaatc cccattccac 11280ctaaaattcg cggaattcgt tgataattag aatagattcg
tagaccaggt cgactgattc 11340gttttaaatt taaaatattt ctatagggtc ttttcctatt
ccttctatgt cgcagggtta 11400aaaccaaaaa atatttgttt ttttctcgat gttttctcac
gttttcgata aaaccttctc 11460gtaaaagtat ttgaacaata ttttcggtaa tattagtaga
tgctattcga accacccttt 11520ttcgatccat atcagcattt cgtatagaag ttattatctc
agcaatagtg tccctaccca 11580tgatgaacta aaattattgg ggcctccaaa tttgatataa
tcaacgtgtt ttttacttat 11640tttttttttg aatatgatat gaattattaa agatatatgc
gtgagacaca atctactaat 11700taatctattt ctttcaaata ccccactaga aacagatcac
aatttcattt tataatacct 11760cgggagctaa tgaaactatt ttagtaaaat ttaattctct
caattcccgg gcgattgcac 11820caaaaattcg agttcctttt gatttccttc cttcttgatc
aataacaact gcagcattgt 11880catcatatcg tattatcatc ccgttgtcac gtttgagttc
tttacaggtc cgcacaatta 11940cagctctgac tacttctgat ctttctaggg gcatatttgg
tacggcttct ttgatcacag 12000caacaataac gtcaccaata tgagcatatc gacgattgct
agctcctatg attcgaatac 12060acatcaattc tcgagccccg ctgttatccg ctacatttaa
atgggtctga ggttgaatca 12120tttttttaat ccgttctttg aatgcaaagg gcgaagaaaa
aaaagaaata tttttgtcca 12180aaaaaaaaga aacatgcggt ttcgtttcat atctaagagc
cctttccgca tttttttcta 12240ttacattacg aaataatgaa ttgagttcgt ataggcattt
tagatgctgc tagtgaaata 12300gcccttctgg ctatattttc tgttactcca cccatttcat
aaagtattcg acccggttta 12360acaacagcta cccaatattc aggggatcca ctagttctag
agcggccgcc accgcggtgg 12420agctccagct tttgttccct ttagtgaggg ttaatttcga
gcttggcgta atcatggtca 12480tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc
cacacaacat acgagccgga 12540agcataaagt gtaaagcctg gggtgcctaa tgagtgagct
aactcacatt aattgcgttg 12600cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc
agctgcatta atgaatcggc 12660caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt
ccgcttcctc gctcactgac 12720tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag
ctcactcaaa ggcggtaata 12780cggttatcca cagaatcagg ggataacgca ggaaagaaca
tgtgagcaaa aggccagcaa 12840aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt
tccataggct ccgcccccct 12900gacgagcatc acaaaaatcg acgctcaagt cagaggtggc
gaaacccgac aggactataa 12960agataccagg cgtttccccc tggaagctcc ctcgtgcgct
ctcctgttcc gaccctgccg 13020cttaccggat acctgtccgc ctttctccct tcgggaagcg
tggcgctttc tcatagctca 13080cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca
agctgggctg tgtgcacgaa 13140ccccccgttc agcccgaccg ctgcgcctta tccggtaact
atcgtcttga gtccaacccg 13200gtaagacacg acttatcgcc actggcagca gccactggta
acaggattag cagagcgagg 13260tatgtaggcg gtgctacaga gttcttgaag tggtggccta
actacggcta cactagaagg 13320acagtatttg gtatctgcgc tctgctgaag ccagttacct
tcggaaaaag agttggtagc 13380tcttgatccg gcaaacaaac caccgctggt agcggtggtt
tttttgtttg caagcagcag 13440attacgcgca gaaaaaaagg atctcaagaa gatcctttga
tcttttctac ggggtctgac 13500gctcagtgga acgaaaactc acgttaaggg attttggtca
tgagattatc aaaaaggatc 13560ttcacctaga tccttttaaa ttaaaaatga agttttaaat
caatctaaag tatatatgag 13620taaacttggt ctgacagtta ccaatgctta atcagtgagg
cacctatctc agcgatctgt 13680ctatttcgtt catccatagt tgcctgactc cccgtcgtgt
agataactac gatacgggag 13740ggcttaccat ctggccccag tgctgcaatg ataccgcgag
acccacgctc accggctcca 13800gatttatcag caataaacca gccagccgga agggccgagc
gcagaagtgg tcctgcaact 13860ttatccgcct ccatccagtc tattaattgt tgccgggaag
ctagagtaag tagttcgcca 13920gttaatagtt tgcgcaacgt tgttgccatt gctacaggca
tcgtggtgtc acgctcgtcg 13980tttggtatgg cttcattcag ctccggttcc caacgatcaa
ggcgagttac atgatccccc 14040atgttgtgca aaaaagcggt tagctccttc ggtcctccga
tcgttgtcag aagtaagttg 14100gccgcagtgt tatcactcat ggttatggca gcactgcata
attctcttac tgtcatgcca 14160tccgtaagat gcttttctgt gactggtgag tactcaacca
agtcattctg agaatagtgt 14220atgcggcgac cgagttgctc ttgcccggcg tcaatacggg
ataataccgc gccacatagc 14280agaactttaa aagtgctcat cattggaaaa cgttcttcgg
ggcgaaaact ctcaaggatc 14340ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg
cacccaactg atcttcagca 14400tcttttactt tcaccagcgt ttctgggtga gcaaaaacag
gaaggcaaaa tgccgcaaaa 14460aagggaataa gggcgacacg gaaatgttga atactcatac
tcttcctttt tcaatattat 14520tgaagcattt atcagggtta ttgtctcatg agcggataca
tatttgaatg tatttagaaa 14580aataaacaaa taggggttcc gcgcacattt ccccgaaaag
tgc 14623757252DNAArtificial
Sequencemisc_feature()..()Plastid transformation vector pFHO5 containing
R. capsulatus DNA e 75gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt
atttttctaa atacattcaa 60atatgtatcc gctcatgaga caataaccct gataaatgct
tcaataatat tgaaaaagga 120agagtatgag tattcaacat ttccgtgtcg cccttattcc
cttttttgcg gcattttgcc 180ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa
agatgctgaa gatcagttgg 240gtgcacgagt gggttacatc gaactggatc tcaacagcgg
taagatcctt gagagttttc 300gccccgaaga acgttttcca atgatgagca cttttaaagt
tctgctatgt ggcgcggtat 360tatcccgtat tgacgccggg caagagcaac tcggtcgccg
catacactat tctcagaatg 420acttggttga gtactcacca gtcacagaaa agcatcttac
ggatggcatg acagtaagag 480aattatgcag tgctgccata accatgagtg ataacactgc
ggccaactta cttctgacaa 540cgatcggagg accgaaggag ctaaccgctt ttttgcacaa
catgggggat catgtaactc 600gccttgatcg ttgggaaccg gagctgaatg aagccatacc
aaacgacgag cgtgacacca 660cgatgcctgt agcaatggca acaacgttgc gcaaactatt
aactggcgaa ctacttactc 720tagcttcccg gcaacaatta atagactgga tggaggcgga
taaagttgca ggaccacttc 780tgcgctcggc ccttccggct ggctggttta ttgctgataa
atctggagcc ggtgagcgtg 840ggtctcgcgg tatcattgca gcactggggc cagatggtaa
gccctcccgt atcgtagtta 900tctacacgac ggggagtcag gcaactatgg atgaacgaaa
tagacagatc gctgagatag 960gtgcctcact gattaagcat tggtaactgt cagaccaagt
ttactcatat atactttaga 1020ttgatttaaa acttcatttt taatttaaaa ggatctaggt
gaagatcctt tttgataatc 1080tcatgaccaa aatcccttaa cgtgagtttt cgttccactg
agcgtcagac cccgtagaaa 1140agatcaaagg atcttcttga gatccttttt ttctgcgcgt
aatctgctgc ttgcaaacaa 1200aaaaaccacc gctaccagcg gtggtttgtt tgccggatca
agagctacca actctttttc 1260cgaaggtaac tggcttcagc agagcgcaga taccaaatac
tgtccttcta gtgtagccgt 1320agttaggcca ccacttcaag aactctgtag caccgcctac
atacctcgct ctgctaatcc 1380tgttaccagt ggctgctgcc agtggcgata agtcgtgtct
taccgggttg gactcaagac 1440gatagttacc ggataaggcg cagcggtcgg gctgaacggg
gggttcgtgc acacagccca 1500gcttggagcg aacgacctac accgaactga gatacctaca
gcgtgagcta tgagaaagcg 1560ccacgcttcc cgaagggaga aaggcggaca ggtatccggt
aagcggcagg gtcggaacag 1620gagagcgcac gagggagctt ccagggggaa acgcctggta
tctttatagt cctgtcgggt 1680ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc
gtcagggggg cggagcctat 1740ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc
cttttgctgg ccttttgctc 1800acatgttctt tcctgcgtta tcccctgatt ctgtggataa
ccgtattacc gcctttgagt 1860gagctgatac cgctcgccgc agccgaacga ccgagcgcag
cgagtcagtg agcgaggaag 1920cggaagagcg cccaatacgc aaaccgcctc tccccgcgcg
ttggccgatt cattaatgca 1980gctggcacga caggtttccc gactggaaag cgggcagtga
gcgcaacgca attaatgtga 2040gttagctcac tcattaggca ccccaggctt tacactttat
gcttccggct cgtatgttgt 2100gtggaattgt gagcggataa caatttcaca caggaaacag
ctatgaccat gattacgcca 2160agctcgaaat taaccctcac taaagggaac aaaagctgga
gctccaccgc ggtggcggcc 2220gctctagaac tagtggatct tcttggctgt tattcaaaag
gtccaacaat gtatatatat 2280tggacatttt gaggcaatta tagatcctgg aaggcaattc
tgattggtca ataaaaatcg 2340atttcaatgc tatttttttt ttgtttttta tgagtttagc
caatttatca tgaaaggtaa 2400aaggggataa aggaaccgtg tgttgattgt cctgtaaata
taagttgtct tcctccatat 2460gtaaaaaggg aataaataaa tcaattaaat ttcgggatgc
ttcatgaagt gcttctttcg 2520gagttaaact tccgtttgtc catatttcga gaaaaagtat
ctcttgtttt tcattcccat 2580tcccataaga atgaatacta tgattcgcgt ttcgaacagg
catgaataca gcatctatag 2640gataacttcc atcttgaaag ttatgtggcg tttttataag
atatccacga tttctctcta 2700tttgtaatcc aatacaaaaa tcaattggtt ccgttaaact
ggctatatgt tgtgtattat 2760caacgatttc tacataaggc ggcaagatga tatcttgggc
agttacagat ccaggaccct 2820tgacacaaat agatgcgtca gaagttccat atagattact
tcttaatata atttctttca 2880aattcattaa aatttcatgt accgattctt gaatgcccgt
tatggtagaa tattcatgtg 2940ggactttctc agattttaca cgtgtgatac atgttccttc
tatttctcca agtaaagctc 3000ttcgcatcgc aatgcctatt gtgtcggctt ggcctttcat
aagtggagac agaataaagc 3060gtccataata aaggcgttta ctgtctgttc ttgattcaac
acacttccac tgtagtgtcc 3120gagtagatac tgttactttc tctcgaacca tagtactatt
atttgattag atcatcgaat 3180cttttatttc tcttgagatt tcttcaatgt tcagttctac
acacgtcttt ttttcggagg 3240tctacagcca ttatgtggca taggagttac atcccgtacg
aaagttaata gtataccact 3300tcgacgaata gctcgtaatg ctgcatctct tccgagaccg
ggacctttta tcatgacttc 3360tgctcgttgc ataccttgat ccactactgt acggatagcg
tttgctgctg cggtttgagc 3420agcaaacggt gttcctcttc tcgtaccttt gaatccagaa
gtaccggcgg aggaccaaga 3480aactactcga ccccgtacat ctgtaacagt gacaatggta
ttattgaaac ttgcttgaac 3540atgaataact ccctttggta ttctacgtgc acccttacgt
gaaccaatac gtccattcct 3600acgcgaacta attttcggta tagcttttgc catattttat
catctcgtaa atatgagtca 3660gagatatatg gatatatcca tttcatgtca aaacagattc
tttatttgta catcggctct 3720tctggcaagt ctgattatcc ctgtctttgt ttatgtctcg
ggttggaaca aattactata 3780attcgtcccc gcctacggat tagtcgacat ttttcacaaa
ttttacgaac ggaagctctt 3840attttcatat ttctcattcc ttaccttaat tctgaatcta
tttcttggaa gaaaataagt 3900ttcttgaaat ttttcatctc gaattgtatt cccacgaaag
gaatggtgaa gttgaaaaac 3960gaatccttca aatctttgtt gtggagtcga taaattatac
gccctttggt tgaatcataa 4020ggacttactt caattttgac tctatctcct ggcagtatcc
gtataaaact atgccggatc 4080tttcctgaaa cataatttat aatcagatcc aggaggacca
tatgatcgcc gaagcggata 4140tggaggtctg ccgggagctg atccgcaccg gcagctactc
cttccatgcg gcgtccagag 4200ttctgccggc gcgggtccgt gaccccgcgc tggcgcttta
cgccttttgc cgcgtcgccg 4260atgacgaagt cgacgaggtt ggcgcgccgc gcgacaaggc
tgcggcggtt ttgaaacttg 4320gcgaccggct ggaggacatc tatgccggtc gtccgcgcaa
tgcgccctcg gatcgggctt 4380tcgcggcggt ggtcgaggaa ttcgagatgc cgcgcgaatt
gcccgaggcg ctgctggagg 4440gcttcgcctg ggatgccgag gggcggtggt atcacacgct
ttcggacgtg caggcctatt 4500cggcgcgggt ggcggccgcc gtcggcgcga tgatgtgcgt
gctgatgcgg gtgcgcaacc 4560ccgatgcgct ggcgcgggcc tgcgatctcg gtcttgccat
gcagatgtcg aacatcgccc 4620gcgacgtggg cgaggatgcc cgggcggggc ggcttttcct
gccgaccgac tggatggtcg 4680aggaggggat cgatccgcag gcgttcctgg ccgatccgca
gcccaccaag ggcatccgcc 4740gggtcaccga gcggttgctg aaccgcgccg accggcttta
ctggcgggcg gcgacggggg 4800tgcggctttt gccctttgac tgccgaccgg ggatcatggc
cgcgggcaag atctatgccg 4860cgatcggggc cgaggtggcg aaggcgaaat acgacaacat
cacccggcgt gcccacacga 4920ccaagggccg caagctgtgg ctggtggcga attccgcgat
gtcggcgacg gcgacctcga 4980tgctgccgct ctcgccgcgg gtgcatgcca agcccgagcc
cgaagtggcg catctggtcg 5040atgccgccgc gcatcgcaac ctgcatcccg aacggtccga
ggtgctgatc tcggcgctga 5100tggcgctgaa ggcgcgcgac cgcggcctgg cgatggattg
aggatctaaa caaacccgga 5160acagaccgtt gggaagcgat tcagtaatta aagcttcatg
actccttttt ggttcttaaa 5220gtccctttga ggtatcaact aataagaaag atattagaca
accccccttt tttctttttc 5280acaaatagga agtttcgaat ccaatttgga tattaaaagg
attaccagat ataacacaaa 5340atctctccac ctattccttc tagtcgagcc tctcggtctg
tcattatacc tcgagaagta 5400gaaagaatta caatccccat tccacctaaa attcgcggaa
ttcgttgata attagaatag 5460attcgtagac caggtcgact gattcgtttt aaatttaaaa
tatttctata gggtcttttc 5520ctattccttc tatgtcgcag ggttaaaacc aaaaaatatt
tgtttttttc tcgatgtttt 5580ctcacgtttt cgataaaacc ttctcgtaaa agtatttgaa
caatattttc ggtaatatta 5640gtagatgcta ttcgaaccac cctttttcga tccatatcag
catttcgtat agaagttatt 5700atctcagcaa tagtgtccct acccatgatg aactaaaatt
attggggcct ccaaatttga 5760tataatcaac gtgtttttta cttatttttt ttttgaatat
gatatgaatt attaaagata 5820tatgcgtgag acacaatcta ctaattaatc tatttctttc
aaatacccca ctagaaacag 5880atcacaattt cattttataa tacctcggga gctaatgaaa
ctattttagt aaaatttaat 5940tctctcaatt cccgggcgat tgcaccaaaa attcgagttc
cttttgattt ccttccttct 6000tgatcaataa caactgcagc attgtcatca tatcgtatta
tcatcccgtt gtcacgtttg 6060agttctttac aggtccgcac aattacagct ctgactactt
ctgatctttc taggggcata 6120tttggtacgg cttctttgat cacagcaaca ataacgtcac
caatatgagc atatcgacga 6180ttgctagctc ctatgattcg aatacacatc aattctcgag
ccccgctgtt atccgctaca 6240tttaaatggg tctgaggttg aatcattttt ttaatccgtt
ctttgaatgc aaagggcgaa 6300gaaaaaaaag aaatattttt gtccaaaaaa aaagaaacat
gcggtttcgt ttcatatcta 6360agagcccttt ccgcattttt ttctattaca ttacgaaata
atgaattgag ttcgtatagg 6420cattttagat gctgctagtg aaatagccct tctggctata
ttttctgtta ctccacccat 6480ttcataaagt attcgacccg gtttaacaac agctacccaa
tattcagggg atcccccggg 6540ctgcaggaat tcgatatcaa gcttatcgat accgtcgacc
tcgagggggg gcccggtacc 6600caattcgccc tatagtgagt cgtattacaa ttcactggcc
gtcgttttac aacgtcgtga 6660ctgggaaaac cctggcgtta cccaacttaa tcgccttgca
gcacatcccc ctttcgccag 6720ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc
caacagttgc gcagcctgaa 6780tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg
gcgggtgtgg tggttacgcg 6840cagcgtgacc gctacacttg ccagcgccct agcgcccgct
cctttcgctt tcttcccttc 6900ctttctcgcc acgttcgccg gctttccccg tcaagctcta
aatcgggggc tccctttagg 6960gttccgattt agtgctttac ggcacctcga ccccaaaaaa
cttgattagg gtgatggttc 7020acgtagtggg ccatcgccct gatagacggt ttttcgccct
ttgacgttgg agtccacgtt 7080ctttaatagt ggactcttgt tccaaactgg aacaacactc
aaccctatct cggtctattc 7140ttttgattta taagggattt tgccgatttc ggcctattgg
ttaaaaaatg agctgattta 7200acaaaaattt aacgcgaatt ttaacaaaat attaacgctt
acaatttagg tg 72527614623DNAArtificial
Sequencemisc_feature()..()Plastid transformation vector pFHO6, containing
Operon E, contain i 76cacctaaatt gtaagcgtta atattttgtt aaaattcgcg
ttaaattttt gttaaatcag 60ctcatttttt aaccaatagg ccgaaatcgg caaaatccct
tataaatcaa aagaatagac 120cgagataggg ttgagtgttg ttccagtttg gaacaagagt
ccactattaa agaacgtgga 180ctccaacgtc aaagggcgaa aaaccgtcta tcagggcgat
ggcccactac gtgaaccatc 240accctaatca agttttttgg ggtcgaggtg ccgtaaagca
ctaaatcgga accctaaagg 300gagcccccga tttagagctt gacggggaaa gccggcgaac
gtggcgagaa aggaagggaa 360gaaagcgaaa ggagcgggcg ctagggcgct ggcaagtgta
gcggtcacgc tgcgcgtaac 420caccacaccc gccgcgctta atgcgccgct acagggcgcg
tcccattcgc cattcaggct 480gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg
ctattacgcc agctggcgaa 540agggggatgt gctgcaaggc gattaagttg ggtaacgcca
gggttttccc agtcacgacg 600ttgtaaaacg acggccagtg aattgtaata cgactcacta
tagggcgaat tgggtaccgg 660gccccccctc gaggtcgacg gtatcgataa gcttgatatc
gaattcctgc agcccggggg 720atcttcttgg ctgttattca aaaggtccaa caatgtatat
atattggaca ttttgaggca 780attatagatc ctggaaggca attctgattg gtcaataaaa
atcgatttca atgctatttt 840ttttttgttt tttatgagtt tagccaattt atcatgaaag
gtaaaagggg ataaaggaac 900cgtgtgttga ttgtcctgta aatataagtt gtcttcctcc
atatgtaaaa agggaataaa 960taaatcaatt aaatttcggg atgcttcatg aagtgcttct
ttcggagtta aacttccgtt 1020tgtccatatt tcgagaaaaa gtatctcttg tttttcattc
ccattcccat aagaatgaat 1080actatgattc gcgtttcgaa caggcatgaa tacagcatct
ataggataac ttccatcttg 1140aaagttatgt ggcgttttta taagatatcc acgatttctc
tctatttgta atccaataca 1200aaaatcaatt ggttccgtta aactggctat atgttgtgta
ttatcaacga tttctacata 1260aggcggcaag atgatatctt gggcagttac agatccagga
cccttgacac aaatagatgc 1320gtcagaagtt ccatatagat tacttcttaa tataatttct
ttcaaattca ttaaaatttc 1380atgtaccgat tcttgaatgc ccgttatggt agaatattca
tgtgggactt tctcagattt 1440tacacgtgtg atacatgttc cttctatttc tccaagtaaa
gctcttcgca tcgcaatgcc 1500tattgtgtcg gcttggcctt tcataagtgg agacagaata
aagcgtccat aataaaggcg 1560tttactgtct gttcttgatt caacacactt ccactgtagt
gtccgagtag atactgttac 1620tttctctcga accatagtac tattatttga ttagatcatc
gaatctttta tttctcttga 1680gatttcttca atgttcagtt ctacacacgt ctttttttcg
gaggtctaca gccattatgt 1740ggcataggag ttacatcccg tacgaaagtt aatagtatac
cacttcgacg aatagctcgt 1800aatgctgcat ctcttccgag accgggacct tttatcatga
cttctgctcg ttgcatacct 1860tgatccacta ctgtacggat agcgtttgct gctgcggttt
gagcagcaaa cggtgttcct 1920cttctcgtac ctttgaatcc agaagtaccg gcggaggacc
aagaaactac tcgaccccgt 1980acatctgtaa cagtgacaat ggtattattg aaacttgctt
gaacatgaat aactcccttt 2040ggtattctac gtgcaccctt acgtgaacca atacgtccat
tcctacgcga actaattttc 2100ggtatagctt ttgccatatt ttatcatctc gtaaatatga
gtcagagata tatggatata 2160tccatttcat gtcaaaacag attctttatt tgtacatcgg
ctcttctggc aagtctgatt 2220atccctgtct ttgtttatgt ctcgggttgg aacaaattac
tataattcgt ccccgcctac 2280ggattagtcg acatttttca caaattttac gaacggaagc
tcttattttc atatttctca 2340ttccttacct taattctgaa tctatttctt ggaagaaaat
aagtttcttg aaatttttca 2400tctcgaattg tattcccacg aaaggaatgg tgaagttgaa
aaacgaatcc ttcaaatctt 2460tgttgtggag tcgataaatt atacgccctt tggttgaatc
ataaggactt acttcaattt 2520tgactctatc tcctggcagt atccgtataa aactatgccg
gatctttcct gaaacataat 2580ttataatcag atcggccgca ggaggagttc atatgtcaga
gttgagagcc ttcagtgccc 2640cagggaaagc gttactagct ggtggatatt tagttttaga
tacaaaatat gaagcatttg 2700tagtcggatt atcggcaaga atgcatgctg tagcccatcc
ttacggttca ttgcaagggt 2760ctgataagtt tgaagtgcgt gtgaaaagta aacaatttaa
agatggggag tggctgtacc 2820atataagtcc taaaagtggc ttcattcctg tttcgatagg
cggatctaag aaccctttca 2880ttgaaaaagt tatcgctaac gtatttagct actttaaacc
taacatggac gactactgca 2940atagaaactt gttcgttatt gatattttct ctgatgatgc
ctaccattct caggaggata 3000gcgttaccga acatcgtggc aacagaagat tgagttttca
ttcgcacaga attgaagaag 3060ttcccaaaac agggctgggc tcctcggcag gtttagtcac
agttttaact acagctttgg 3120cctccttttt tgtatcggac ctggaaaata atgtagacaa
atatagagaa gttattcata 3180atttagcaca agttgctcat tgtcaagctc agggtaaaat
tggaagcggg tttgatgtag 3240cggcggcagc atatggatct atcagatata gaagattccc
acccgcatta atctctaatt 3300tgccagatat tggaagtgct acttacggca gtaaactggc
gcatttggtt gatgaagaag 3360actggaatat tacgattaaa agtaaccatt taccttcggg
attaacttta tggatgggcg 3420atattaagaa tggttcagaa acagtaaaac tggtccagaa
ggtaaaaaat tggtatgatt 3480cgcatatgcc agaaagcttg aaaatatata cagaactcga
tcatgcaaat tctagattta 3540tggatggact atctaaacta gatcgcttac acgagactca
tgacgattac agcgatcaga 3600tatttgagtc tcttgagagg aatgactgta cctgtcaaaa
gtatcctgaa atcacagaag 3660ttagagatgc agttgccaca attagacgtt cctttagaaa
aataactaaa gaatctggtg 3720ccgatatcga acctcccgta caaactagct tattggatga
ttgccagacc ttaaaaggag 3780ttcttacttg cttaatacct ggtgctggtg gttatgacgc
cattgcagtg attactaagc 3840aagatgttga tcttagggct caaaccgcta atgacaaaag
attttctaag gttcaatggc 3900tggatgtaac tcaggctgac tggggtgtta ggaaagaaaa
agatccggaa acttatcttg 3960ataaactgca ggaggagttt taatgtcatt accgttctta
acttctgcac cgggaaaggt 4020tattattttt ggtgaacact ctgctgtgta caacaagcct
gccgtcgctg ctagtgtgtc 4080tgcgttgaga acctacctgc taataagcga gtcatctgca
ccagatacta ttgaattgga 4140cttcccggac attagcttta atcataagtg gtccatcaat
gatttcaatg ccatcaccga 4200ggatcaagta aactcccaaa aattggccaa ggctcaacaa
gccaccgatg gcttgtctca 4260ggaactcgtt agtcttttgg atccgttgtt agctcaacta
tccgaatcct tccactacca 4320tgcagcgttt tgtttcctgt atatgtttgt ttgcctatgc
ccccatgcca agaatattaa 4380gttttcttta aagtctactt tacccatcgg tgctgggttg
ggctcaagcg cctctatttc 4440tgtatcactg gccttagcta tggcctactt gggggggtta
ataggatcta atgacttgga 4500aaagctgtca gaaaacgata agcatatagt gaatcaatgg
gccttcatag gtgaaaagtg 4560tattcacggt accccttcag gaatagataa cgctgtggcc
acttatggta atgccctgct 4620atttgaaaaa gactcacata atggaacaat aaacacaaac
aattttaagt tcttagatga 4680tttcccagcc attccaatga tcctaaccta tactagaatt
ccaaggtcta caaaagatct 4740tgttgctcgc gttcgtgtgt tggtcaccga gaaatttcct
gaagttatga agccaattct 4800agatgccatg ggtgaatgtg ccctacaagg cttagagatc
atgactaagt taagtaaatg 4860taaaggcacc gatgacgagg ctgtagaaac taataatgaa
ctgtatgaac aactattgga 4920attgataaga ataaatcatg gactgcttgt ctcaatcggt
gtttctcatc ctggattaga 4980acttattaaa aatctgagcg atgatttgag aattggctcc
acaaaactta ccggtgctgg 5040tggcggcggt tgctctttga ctttgttacg aagagacatt
actcaagagc aaattgacag 5100cttcaaaaag aaattgcaag atgattttag ttacgagaca
tttgaaacag acttgggtgg 5160gactggctgc tgtttgttaa gcgcaaaaaa tttgaataaa
gatcttaaaa tcaaatccct 5220agtattccaa ttatttgaaa ataaaactac cacaaagcaa
caaattgacg atctattatt 5280gccaggaaac acgaatttac catggacttc agacgaggag
ttttaatgac tgtatatact 5340gctagtgtaa ctgctccggt aaatattgct actcttaagt
attgggggaa aagggacacg 5400aagttgaatc tgcccaccaa ttcgtccata tcagtgactt
tatcgcaaga tgacctcaga 5460acgttgacct ctgcggctac tgcacctgag tttgaacgcg
acactttgtg gttaaatgga 5520gaaccacaca gcatcgacaa tgaaagaact caaaattgtc
tgcgcgacct acgccaatta 5580agaaaggaaa tggaatcgaa ggacgcctca ttgcccacat
tatctcaatg gaaactccac 5640attgtctccg aaaataactt tcctacagca gctggtttag
cttcctccgc tgctggcttt 5700gctgcattgg tctctgcaat tgctaagtta taccaattac
cacagtcaac ttcagaaata 5760tctagaatag caagaaaggg gtctggttca gcttgtagat
cgttgtttgg cggatacgtg 5820gcctgggaaa tgggaaaagc tgaagatggt catgattcca
tggcagtaca aatcgcagac 5880agctctgact ggcctcagat gaaagcttgt gtcctagttg
tcagcgatat taaaaaggat 5940gtgagttcca ctcagggtat gcaattgacc gtggcaacct
ccgaactatt taaagaaaga 6000attgaacatg tcgtaccaaa gagatttgaa gtcatgcgta
aagccattgt tgaaaaagat 6060ttcgccacct ttgcaaagga aacaatgatg gattccaact
ctttccatgc cacatgtttg 6120gactctttcc ctccaatatt ctacatgaat gacacttcca
agcgtatcat cagttggtgc 6180cacaccatta atcagtttta cggagaaaca atcgttgcat
acacgtttga tgcaggtcca 6240aatgctgtgt tgtactactt agctgaaaat gagtcgaaac
tctttgcatt tatctataaa 6300ttgtttggct ctgttcctgg atgggacaag aaatttacta
ctgagcagct tgaggctttc 6360aaccatcaat ttgaatcatc taactttact gcacgtgaat
tggatcttga gttgcaaaag 6420gatgttgcca gagtgatttt aactcaagtc ggttcaggcc
cacaagaaac aaacgaatct 6480ttgattgacg caaagactgg tctaccaaag gaagaggagt
tttaactcga cgccggcgga 6540ggcacatatg tctcagaacg tttacattgt atcgactgcc
agaaccccaa ttggttcatt 6600ccagggttct ctatcctcca agacagcagt ggaattgggt
gctgttgctt taaaaggcgc 6660cttggctaag gttccagaat tggatgcatc caaggatttt
gacgaaatta tttttggtaa 6720cgttctttct gccaatttgg gccaagctcc ggccagacaa
gttgctttgg ctgccggttt 6780gagtaatcat atcgttgcaa gcacagttaa caaggtctgt
gcatccgcta tgaaggcaat 6840cattttgggt gctcaatcca tcaaatgtgg taatgctgat
gttgtcgtag ctggtggttg 6900tgaatctatg actaacgcac catactacat gccagcagcc
cgtgcgggtg ccaaatttgg 6960ccaaactgtt cttgttgatg gtgtcgaaag agatgggttg
aacgatgcgt acgatggtct 7020agccatgggt gtacacgcag aaaagtgtgc ccgtgattgg
gatattacta gagaacaaca 7080agacaatttt gccatcgaat cctaccaaaa atctcaaaaa
tctcaaaagg aaggtaaatt 7140cgacaatgaa attgtacctg ttaccattaa gggatttaga
ggtaagcctg atactcaagt 7200cacgaaggac gaggaacctg ctagattaca cgttgaaaaa
ttgagatctg caaggactgt 7260tttccaaaaa gaaaacggta ctgttactgc cgctaacgct
tctccaatca acgatggtgc 7320tgcagccgtc atcttggttt ccgaaaaagt tttgaaggaa
aagaatttga agcctttggc 7380tattatcaaa ggttggggtg aggccgctca tcaaccagct
gattttacat gggctccatc 7440tcttgcagtt ccaaaggctt tgaaacatgc tggcatcgaa
gacatcaatt ctgttgatta 7500ctttgaattc aatgaagcct tttcggttgt cggtttggtg
aacactaaga ttttgaagct 7560agacccatct aaggttaatg tatatggtgg tgctgttgct
ctaggtcacc cattgggttg 7620ttctggtgct agagtggttg ttacactgct atccatctta
cagcaagaag gaggtaagat 7680cggtgttgcc gccatttgta atggtggtgg tggtgcttcc
tctattgtca ttgaaaagat 7740atgaggatcc tctagatgcg caggaggcac atatggcgaa
gaacgttggg attttggcta 7800tggatatcta tttccctccc acctgtgttc aacaggaagc
tttggaagca catgatggag 7860caagtaaagg gaaatacact attggacttg gccaagattg
tttagctttt tgcactgagc 7920ttgaagatgt tatctctatg agtttcaatg cggtgacatc
actttttgag aagtataaga 7980ttgaccctaa ccaaatcggg cgtcttgaag taggaagtga
gactgttatt gacaaaagca 8040agtccatcaa gaccttcttg atgcagctct ttgagaaatg
tggaaacact gatgtcgaag 8100gtgttgactc gaccaatgct tgctatggtg gaactgcagc
tttgttaaac tgtgtcaatt 8160gggttgagag taactcttgg gatggacgtt atggcctcgt
catttgtact gacagcgcgg 8220tttatgcaga aggacccgca aggcccactg gaggagctgc
agcgattgct atgttgatag 8280gacctgatgc tcctatcgtt ttcgaaagca aattgagagc
aagccacatg gctcatgtct 8340atgactttta caagcccaat cttgctagcg agtacccggt
tgttgatggt aagctttcac 8400agacttgcta cctcatggct cttgactcct gctataaaca
tttatgcaac aagttcgaga 8460agatcgaggg caaagagttc tccataaatg atgctgatta
cattgttttc cattctccat 8520acaataaact tgtacagaaa agctttgctc gtctcttgta
caacgacttc ttgagaaacg 8580caagctccat tgacgaggct gccaaagaaa agttcacccc
ttattcatct ttgacccttg 8640acgagagtta ccaaagccgt gatcttgaaa aggtgtcaca
acaaatttcg aaaccgtttt 8700atgatgctaa agtgcaacca acgactttaa taccaaagga
agtcggtaac atgtacactg 8760cttctctcta cgctgcattt gcttccctca tccacaataa
acacaatgat ttggcgggaa 8820agcgggtggt tatgttctct tatggaagtg gctccaccgc
aacaatgttc tcattacgcc 8880tcaacgacaa taagcctcct ttcagcattt caaacattgc
atctgtaatg gatgttggcg 8940gtaaattgaa agctagacat gagtatgcac ctgagaagtt
tgtggagaca atgaagctaa 9000tggaacatag gtatggagca aaggactttg tgacaaccaa
ggagggtatt atagatcttt 9060tggcaccggg aacttattat ctgaaagagg ttgattcctt
gtaccggaga ttctatggca 9120agaaaggtga agatggatct gtagccaatg gacactgagg
atccgtcgag cacgtggagg 9180cacatatgca atgctgtgag atgcctgttg gatacattca
gattcctgtt gggattgctg 9240gtccattgtt gcttgatggt tatgagtact ctgttcctat
ggctacaacc gaaggttgtt 9300tggttgctag cactaacaga ggctgcaagg ctatgtttat
ctctggtggc gccaccagta 9360ccgttcttaa ggacggtatg acccgagcac ctgttgttcg
gttcgcttcg gcgagacgag 9420cttcggagct taagtttttc ttggagaatc cagagaactt
tgatactttg gcagtagtct 9480tcaacaggtc gagtagattt gcaagactgc aaagtgttaa
atgcacaatc gcggggaaga 9540atgcttatgt aaggttctgt tgtagtactg gtgatgctat
ggggatgaat atggtttcta 9600aaggtgtgca gaatgttctt gagtatctta ccgatgattt
ccctgacatg gatgtgattg 9660gaatctctgg taacttctgt tcggacaaga aacctgctgc
tgtgaactgg attgagggac 9720gtggtaaatc agttgtttgc gaggctgtaa tcagaggaga
gatcgtgaac aaggtcttga 9780aaacgagcgt ggctgcttta gtcgagctca acatgctcaa
gaacctagct ggctctgctg 9840ttgcaggctc tctaggtgga ttcaacgctc atgccagtaa
catagtgtct gctgtattca 9900tagctactgg ccaagatcca gctcaaaacg tggagagttc
tcaatgcatc accatgatgg 9960aagctattaa tgacggcaaa gatatccata tctcagtcac
tatgccatct atcgaggtgg 10020ggacagtggg aggaggaaca cagcttgcat ctcaatcagc
gtgtttaaac ctgctcggag 10080ttaaaggagc aagcacagag tcgccgggaa tgaacgcaag
gaggctagcg acgatcgtag 10140ccggagcagt tttagctgga gagttatctt taatgtcagc
aattgcagct ggacagcttg 10200tgagaagtca catgaaatac aatagatcca gccgagacat
ctctggagca acgacaacga 10260caacaacaac aacatgaccc gtaggaggca catatgagtt
cccaacaaga gaaaaaggat 10320tatgatgaag aacaattaag gttgatggaa gaagtttgta
tcgttgtaga tgaaaatgat 10380gtccctttaa gatatggaac gaaaaaggag tgtcatttga
tggaaaatat aaataaaggt 10440cttttgcata gagcattctc tatgttcatc tttgatgagc
aaaatcgcct tttacttcag 10500cagcgtgcag aagagaaaat tacatttcca tccttatgga
cgaatacatg ttgctcccac 10560ccattggatg ttgctggtga acgtggtaat actttacctg
aagctgttga aggtgttaag 10620aatgcagctc aacgcaagct gttccatgaa ttgggtattc
aagccaagta tattcccaaa 10680gacaaatttc agtttcttac acgaatccat taccttgctc
ctagtactgg tgcttgggga 10740gagcatgaaa ttgactacat tcttttcttc aaaggtaaag
ttgagctgga tatcaatccc 10800aatgaagttc aagcctataa gtatgttact atggaagagt
taaaagagat gttttccgat 10860cctcaatatg gattcacacc atggttcaaa cttatttgtg
agcattttat gtttaaatgg 10920tggcaggatg tagatcatgc gtcaaaattc caagatacct
taattcatcg ttgctaagga 10980tcccccggga tccggccgat ctaaacaaac ccggaacaga
ccgttgggaa gcgattcagt 11040aattaaagct tcatgactcc tttttggttc ttaaagtccc
tttgaggtat caactaataa 11100gaaagatatt agacaacccc ccttttttct ttttcacaaa
taggaagttt cgaatccaat 11160ttggatatta aaaggattac cagatataac acaaaatctc
tccacctatt ccttctagtc 11220gagcctctcg gtctgtcatt atacctcgag aagtagaaag
aattacaatc cccattccac 11280ctaaaattcg cggaattcgt tgataattag aatagattcg
tagaccaggt cgactgattc 11340gttttaaatt taaaatattt ctatagggtc ttttcctatt
ccttctatgt cgcagggtta 11400aaaccaaaaa atatttgttt ttttctcgat gttttctcac
gttttcgata aaaccttctc 11460gtaaaagtat ttgaacaata ttttcggtaa tattagtaga
tgctattcga accacccttt 11520ttcgatccat atcagcattt cgtatagaag ttattatctc
agcaatagtg tccctaccca 11580tgatgaacta aaattattgg ggcctccaaa tttgatataa
tcaacgtgtt ttttacttat 11640tttttttttg aatatgatat gaattattaa agatatatgc
gtgagacaca atctactaat 11700taatctattt ctttcaaata ccccactaga aacagatcac
aatttcattt tataatacct 11760cgggagctaa tgaaactatt ttagtaaaat ttaattctct
caattcccgg gcgattgcac 11820caaaaattcg agttcctttt gatttccttc cttcttgatc
aataacaact gcagcattgt 11880catcatatcg tattatcatc ccgttgtcac gtttgagttc
tttacaggtc cgcacaatta 11940cagctctgac tacttctgat ctttctaggg gcatatttgg
tacggcttct ttgatcacag 12000caacaataac gtcaccaata tgagcatatc gacgattgct
agctcctatg attcgaatac 12060acatcaattc tcgagccccg ctgttatccg ctacatttaa
atgggtctga ggttgaatca 12120tttttttaat ccgttctttg aatgcaaagg gcgaagaaaa
aaaagaaata tttttgtcca 12180aaaaaaaaga aacatgcggt ttcgtttcat atctaagagc
cctttccgca tttttttcta 12240ttacattacg aaataatgaa ttgagttcgt ataggcattt
tagatgctgc tagtgaaata 12300gcccttctgg ctatattttc tgttactcca cccatttcat
aaagtattcg acccggttta 12360acaacagcta cccaatattc aggggatcca ctagttctag
agcggccgcc accgcggtgg 12420agctccagct tttgttccct ttagtgaggg ttaatttcga
gcttggcgta atcatggtca 12480tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc
cacacaacat acgagccgga 12540agcataaagt gtaaagcctg gggtgcctaa tgagtgagct
aactcacatt aattgcgttg 12600cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc
agctgcatta atgaatcggc 12660caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt
ccgcttcctc gctcactgac 12720tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag
ctcactcaaa ggcggtaata 12780cggttatcca cagaatcagg ggataacgca ggaaagaaca
tgtgagcaaa aggccagcaa 12840aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt
tccataggct ccgcccccct 12900gacgagcatc acaaaaatcg acgctcaagt cagaggtggc
gaaacccgac aggactataa 12960agataccagg cgtttccccc tggaagctcc ctcgtgcgct
ctcctgttcc gaccctgccg 13020cttaccggat acctgtccgc ctttctccct tcgggaagcg
tggcgctttc tcatagctca 13080cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca
agctgggctg tgtgcacgaa 13140ccccccgttc agcccgaccg ctgcgcctta tccggtaact
atcgtcttga gtccaacccg 13200gtaagacacg acttatcgcc actggcagca gccactggta
acaggattag cagagcgagg 13260tatgtaggcg gtgctacaga gttcttgaag tggtggccta
actacggcta cactagaagg 13320acagtatttg gtatctgcgc tctgctgaag ccagttacct
tcggaaaaag agttggtagc 13380tcttgatccg gcaaacaaac caccgctggt agcggtggtt
tttttgtttg caagcagcag 13440attacgcgca gaaaaaaagg atctcaagaa gatcctttga
tcttttctac ggggtctgac 13500gctcagtgga acgaaaactc acgttaaggg attttggtca
tgagattatc aaaaaggatc 13560ttcacctaga tccttttaaa ttaaaaatga agttttaaat
caatctaaag tatatatgag 13620taaacttggt ctgacagtta ccaatgctta atcagtgagg
cacctatctc agcgatctgt 13680ctatttcgtt catccatagt tgcctgactc cccgtcgtgt
agataactac gatacgggag 13740ggcttaccat ctggccccag tgctgcaatg ataccgcgag
acccacgctc accggctcca 13800gatttatcag caataaacca gccagccgga agggccgagc
gcagaagtgg tcctgcaact 13860ttatccgcct ccatccagtc tattaattgt tgccgggaag
ctagagtaag tagttcgcca 13920gttaatagtt tgcgcaacgt tgttgccatt gctacaggca
tcgtggtgtc acgctcgtcg 13980tttggtatgg cttcattcag ctccggttcc caacgatcaa
ggcgagttac atgatccccc 14040atgttgtgca aaaaagcggt tagctccttc ggtcctccga
tcgttgtcag aagtaagttg 14100gccgcagtgt tatcactcat ggttatggca gcactgcata
attctcttac tgtcatgcca 14160tccgtaagat gcttttctgt gactggtgag tactcaacca
agtcattctg agaatagtgt 14220atgcggcgac cgagttgctc ttgcccggcg tcaatacggg
ataataccgc gccacatagc 14280agaactttaa aagtgctcat cattggaaaa cgttcttcgg
ggcgaaaact ctcaaggatc 14340ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg
cacccaactg atcttcagca 14400tcttttactt tcaccagcgt ttctgggtga gcaaaaacag
gaaggcaaaa tgccgcaaaa 14460aagggaataa gggcgacacg gaaatgttga atactcatac
tcttcctttt tcaatattat 14520tgaagcattt atcagggtta ttgtctcatg agcggataca
tatttgaatg tatttagaaa 14580aataaacaaa taggggttcc gcgcacattt ccccgaaaag
tgc 14623
User Contributions:
Comment about this patent or add new information about this topic: