Patent application title: DELIVERY OF THERAPEUTIC AGENTS TO THE BONE
Inventors:
Shunji Tomatsu (Saint Louis, MO, US)
Adriana M. Montaño-Suarez (Saint Louis, MO, US)
Carlos J. Alméciga-Diaz (Bogota D.c., CO)
Luis Barrera (Bogota D.c., CO)
Assignees:
SAINT LOUIS UNIVERSITY
IPC8 Class: AA61K4800FI
USPC Class:
424 932
Class name: Drug, bio-affecting and body treating compositions whole live micro-organism, cell, or virus containing genetically modified micro-organism, cell, or virus (e.g., transformed, fused, hybrid, etc.)
Publication date: 2011-12-22
Patent application number: 20110311487
Abstract:
This invention relates to compositions and methods of delivering
therapeutic agents to bone. More specifically, the invention relates to
endowing a large molecule vectors i.e., adeno virus, retrovirus,
liposomes, micelles, natural and synthetic polymers, or combinations
thereof, with the ability to target bone tissue in vivo and with improved
stability in the blood, by attaching multiple copies of acid amino acid
peptides. One preferred embodiment of the invention relates to endowing
an adeno-associated virus (AAV) vector with the ability to target
bone-tissue in vivo and improve its stability, by the addition of
multiple acidic amino acid peptides attached to the capsid of the viral
vector.Claims:
1. An insolated adeno-associated virus-2 comprising: a) a capsid encoded
by adeno-associated virus-2 DNA modified by insertion of acid amino acid
polypeptide encoding DNA immediately after the adeno-associated virus-2
initial codon of capsid protein VP2; b) wherein the acid amino acid
polypeptide consist of 4-15 acid amino acids; and c) wherein the
adeno-associated virus-2 targets bone in vivo and is capable of
transfecting single stranded DNA into a mammalian cell.
2. The insolated adeno-associated virus-2 of claim 1, wherein the acid amino acid polypeptide consist of 6-10 acid amino acids.
3. The insolated adeno-associated virus-2 of claim 1, wherein the acid amino acid polypeptide consist of 8 acid amino acids.
4. The insolated adeno-associated virus-2 of claim 1, wherein the acid amino acid polypeptide consist of aspartic acid.
5. The insolated adeno-associated virus-2 of claim 1, wherein the acid amino acid polypeptide consist of glutamic acid.
6. The insolated adeno-associated virus-2 of claim 1, wherein the DNA sequence encoding for the acid amino acid polypeptide consists of SEQ ID NO:3.
7. The insolated adeno-associated virus-2 of claim 1, wherein the adeno-associated virus-2 comprises a single stranded DNA encoding an N-acetylgalactosamine-6-sulfate-sulfatase, and wherein the single stranded DNA expresses a physiologically active N-acetylgalactosamine-6-sulfate-sulfatase after transfection into a mammalian cell.
8. The insolated adeno-associated virus-2 of claim 1, wherein the adeno-associated virus-2 comprises a single stranded DNA encoding a tissue non-specific alkaline phosphatase, and wherein the single stranded DNA expresses a physiologically active tissue non-specific alkaline phosphatase after transfection into a mammalian cell.
9. The insolated adeno-associated virus-2 of claim 1, wherein the adeno-associated virus-2 comprises a single stranded DNA encoding a β-glucuronidase, and wherein the single stranded DNA expresses a physiologically active β-glucuronidase after transfection into a mammalian cell.
10. The insolated adeno-associated virus-2 of claim 1, further comprising a pharmaceutical composition.
11. An insolated adeno-associated virus-2 comprising: a) a capsid encoded by adeno-associated virus-2 DNA modified by insertion of SEQ ID NO:3 immediately after the adeno-associated virus-2 initial codon of capsid protein VP2; b) wherein the adeno-associated virus-2 targets bone in vivo and is capable of transfecting single stranded DNA into a mammalian cell.
12. The insolated adeno-associated virus-2 of claim 11, wherein the adeno-associated virus-2 comprises a single stranded DNA encoding a N-acetylgalactosamine-6-sulfate-sulfatase, and wherein the single stranded DNA expresses a physiologically active N-acetylgalactosamine-6-sulfate-sulfatase after transfection into a mammalian cell.
13. The insolated adeno-associated virus-2 of claim 11, wherein the adeno-associated virus-2 comprises a single stranded DNA encoding a tissue non-specific alkaline phosphatase, and wherein the single stranded DNA expresses a physiologically active tissue non-specific alkaline phosphatase alter transfection into a mammalian cell.
14. The insolated adeno-associated virus-2 of claim 11, wherein the adeno-associated virus-2 comprises a single stranded DNA encoding a β-glucuronidase, and wherein the single stranded DNA expresses a physiologically active β-glucuronidase after transfection into a mammalian cell.
15. The insolated adeno-associated virus-2 of claim 11, further comprising a pharmaceutical composition.
16. A method of transfecting a gene into a mammalian cell, comprising: a) incorporating the gene into the adeno-associated virus-2 of claim 1; b) contacting the mammalian cell with the composition in a); c) wherein the gene is expressed in the mammalian cell.
17. The method of claim 16, wherein the mammalian cell is in vitro.
18. The method of claim 16, wherein the mammalian cell is in an animal and the adeno-associated virus-2 is administered intravenously.
19. The method of claim 16, wherein the gene encodes for N-acetylgalactosamine-6-sulfate-sulfatase.
20. The method of claim 16, wherein the adeno-associated virus-2 further comprises a pharmaceutical composition.
Description:
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent application Ser. No. 12/497,612, filed Jul. 3, 2009, which claims priority to U.S. Provisional Patent Application No. 61/081,711, filed Jul. 17, 2008. All documents above are incorporated herein in their entirety by reference.
FIELD OF THE INVENTION
[0002] The invention relates to compositions and methods for targeting vectors to bone tissue for the delivery of therapeutic agents, including but not limited to viral vectors, liposomes, and large synthetic and natural polymers, for the delivery of polypeptides, polynucleic acids, and other therapeutic agents.
BACKGROUND OF THE INVENTION
[0003] Mucopolysaccharidosis IVA (MPS IVA) is an autosomal recessive disorder caused by deficiency of N-acetylgalactosamine-6-sulfate-sulfatase (GALNS; EC 3.1.6.4), leading to accumulation of glycosaminoglycans (GAGs), keratan sulfate (KS) and chondroitin-6-sulfate (C6S) (For review see; Neufeld et al. (2001) McGraw-Hill: New York. vol III, pp 3421-3452). Clinical manifestations vary from severe to an attenuated form characterized by systemic skeletal dysplasia, laxity of joints, hearing loss, corneal clouding, and heart valvular disease, with normal intelligence. Generally MPS IVA patients do not survive beyond second or third decade of life, although patients with an attenuated form can survive into the seventh decade of life (Montano et al. (2007) J Inherit Metab Dis., 30: 165-174). Currently, no effective therapies exist for MPS IVA. Surgical interventions are used to treat some manifestations of the disease Id. Although other tissues are affected in MPS IVA patients, an ideal therapeutic agent would be efficiently distributed to bone and bone marrow. Other diseases also exist for which delivery of therapeutic agents to bone would be beneficial. One example is hypophosphatasia, for which the targeted delivery of tissue non-specific alkaline phosphatase (TNSALP) would be highly beneficial. Another example is type VII mucopolysaccharidosis, which would benefit greatly from the targeted delivery of β-glucuronidase (GUS). Gene and enzyme replacement therapy are promising treatments for bone related diseases. However, there exists a need to facilitate the delivery of therapeutic agents including polynucleotides and polypeptides to bone. The inventors provide compositions and methods to promote effective delivery of therapeutic agents to bone using large molecule vectors.
SUMMARY
[0004] The present invention relates to methods and compositions for delivering therapeutic agents to bone. More specifically the present invention is directed to endowing large molecule vectors with capable of targeting bone by attaching acid amino acid peptides to these vectors externally.
[0005] In the one embodiment, the vector is a viral vector, a liposome, a large synthetic polymer, a large natural polymer, or a polymer comprised of natural and synthetic components, with acid amino acid peptides attached externally. The vector incorporates a therapeutic agent. The therapeutic agent is a pharmaceutical, a nucleotide, or a polypeptide therapeutic agent.
[0006] In a preferred embodiment, the vector is adeno-associated virus, with acid amino acid peptides attached externally, and the therapeutic polypeptide is either N-acetylgalactosamine-6-sulfate-sulfatase, tissue non-specific alkaline phosphatase, or β-glucuronidase.
[0007] In a most preferred embodiment, the vector is adeno-associated virus, with acid amino acid peptides attached externally, and the therapeutic polypeptide is N-acetylgalactosamine-6-sulfate-sulfatase.
[0008] In yet another embodiment, is a method of making an adeno-associated viral vector, targeted to bone, with acid amino acid peptides attached externally, and incorporating a polypeptide therapeutic agent.
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIG. 1. Map of plasmid pAAV-CBA-GALNS. ITR: inverted terminal repeat, CBA promoter: cytomegalovirus enhancer and β-actin promoter, b-globin: rabbit β-globin polyA, polyA: Fragment containing the bovine growth hormone poly-A signal, Amp: β-lactamase gene.
[0010] FIG. 2. Map of plasmid pAAV-CMV-GALNS. ITR: inverted terminal repeat, CMV/IE: cytomegalovirus immediate early enhancer/promoter, IVS: Synthetic intron, IRES: Attenuated internal ribosome entry site (IRES) from encephalomyocarditis virus, Neo: Neomycin phosphotransferase coding sequence, polyA: fragment containing the bovine growth hormone poly-A signal, Amp: β-lactamase gene.
[0011] FIG. 3. Map of plasmid pCXN. CMV-IE: cytomegalovirus immediate early enhancer, Amp: β-lactamase, Neo: Neomycin phosphotransferase coding sequence.
[0012] FIG. 4. Scheme of the construction of the plasmid pAAV-CBA-GALNS.
[0013] FIG. 5. Insertion of sequence encoding the octapeptide of aspartic amino acids in the pXX2 plasmid. Arrows show the site for the initial codon of VP1, VP2 and VP3.
[0014] FIG. 6. Construction of pXX2-ND8 plasmid. (a) Positive done after site-directed mutagenesis was screened by PCR using primers flanking the insertion site. The 715-bp fragment was produced for the targeted done compared to the 691-bp fragment from pXX2 plasmid. Marker: 100 bp ladder. (b) Alignment of sequencing result of pXX2 and clone 19. A box (single strand) designates the insertion site and the nucleotide sequence encoding eight aspartic amino acids in clone 19.
[0015] FIG. 7. Transfection of HEK293 cells. HEK293 cells were transfected with 1×1010 vg of the unmodified native AAV capsid or the modified AAV-AAA-capsid. GALNS activity in the cell lysate was assayed after 4 days of post-transfection.
[0016] FIG. 8. Hydroxyapatite-binding assay. Hydroxyapatite beads were incubated with 5×1011 vg (blue, n=3) or 1×1012 vg (red, n=3) of each virus for 1 h at 37° C. After centrifugation virus titers were quantified in the supernatant by spectrophotometric method, and compared with the initial amount of virus mixed.
[0017] FIG. 9. Biodistribution experiment. Mice were sacrificed 48 h after a vein tail infusion of 1.5×1011 vg. 1 μg of DNA samples from bone (1), liver (2), brain (3) and bone marrow (4) were subjected to PCR using specific primers for GALNS cDNA. Primers for mouse β-glucuronidase (GUS) were used as internal control to check DNA quality and absence of PCR-inhibitors
DETAILED DESCRIPTION
[0018] The inventors have made the surprising discovered that 4-15 acidic amino acid polypeptides, inserted into a large molecule or vector such as adeno-associated virus (AAV)(approximately 5000 KDa), by incorporating the acidic amino acid polypeptides into the AAV capsid, will increase the affinity of this viral vector for bone. Most therapeutic agents intended for bone diseases including AAV, do not have a particular affinity to Bone (Gittensa et al. (2005) Adv Drug Deliv Rev. 57: 1011-1036). Bone is distinguished from other tissues by the presence of hydroxyapatite (HA), which is positively charged. The inventors have utilized a peptides of 4-15 acidic amino acid residues (AAA), inserted into a virus capsid to increase the affinity for HA and enhance delivery of the vector nucleotides to bone. As disclosed below, AAA tagged AAV (AAA-AAV), showed 100% binding to HA while the untagged vector showed no binding with HA. In addition, the level of viral gene production after transduction of virus into the cells was not affected by the addition of the AAA peptide. Experiments in mice showed that 48 hours after intravenous infusion of the AAA tagged vector, the virus genome was increased between 16 and 291 fold in bone compared to mice infused with untagged vector.
Adeno-Associated Virus (AAV).
[0019] Adeno-associated virus (AAV) are non-enveloped virus with a linear single-stranded DNA of 4.7 kb genome. AAV typically require a helper virus, usually adenovirus or herpesvirus, for replication (Flotte (2004) Gene Ther 11: 805-810). The viral capsid protein is the first element that a cellular receptor encounters during a viral infection. Capsid structure for the serotypes AAV2, AAV4, AAV5, and AAV8 has been determined and the regions involved in host receptor interactions have been identified (see Xie et al, (2002) Proc Nati Aced Sci USA 99: 10405-10410; Nam et al. (2007) J Virol 81: 12260-12271; Choi et al. (2005) Curr Gen Ther 5: 299-310). The AAV capsid is formed by 60 proteins consisting of VP1, VP2 and VP3 in a 1:1:20 ratio, respectively, which differ in their N-terminus (Flotte (2004) Gene Ther 11: 805-810). Mutagenesis analysis has identified capsid positions which allow the insertion of peptide sequences with little effect on the DNA packaging and virus trafficking. These positions are exposed on the capsid surface (Buning, et al. (2003) Gene Ther 10: 1142-1151). For example, in AAV2, the most studied serotype, peptides inserted after amino acid positions 138, 161, 459, 584, 587 and 588, relative to VP1 sequence, are exposed on the viral vector surface. It was seen that modified AAV2 produced viral titers similar to wild-type AAV2 (Buning, et al. (2003) Gene Ther 10: 1142-1151)-12; Wu et al. (2000) J Viral 74; 8635-8647; Shi et al. (2001) Hum Gene Ther 12: 1697-1711). It was reasoned that the attachment of ligands with an affinity for a component of bone such as hydroxyapatite may endow AAV with the ability to target bone and, if attached externally, would not affect the functionality of the virus.
Method of Making Acid Amino Acid-Adeno-Associated Virus (AAA-AAV)
[0020] Producing AAA-AAV, involves methodology that is generally known by the skilled artisan and described in detail in numerous laboratory protocols, one of which is Molecular Cloning 3rd edition, (2001) J. F. Sambrook and D. W. Russell, ed., Cold Spring Harbor University Press, incorporated by reference herein in it entirety. Many modifications and variations of the present illustrative DNA sequences and nucleotide vectors are possible. For example, the degeneracy of the genetic code allows for the substitution of nucleotides throughout polypeptide coding regions, as well as in the translational stop signal, without alteration of the encoded polypeptide coding sequence. Such substitutable sequences can be deduced from the known amino acid or DNA sequence. AAA-AAV can be constructed by following conventional synthetic or site-directed mutagenesis procedures. Synthetic methods can be carried out in substantial accordance with the procedures of Itakura et. al., (1977) Science 198:1056; and Crea et. al. (1978) Proc. Natl. Acad. Sci, USA 75:5765, incorporated by reference herein in their entirety. The present invention is in no way limited to the DNA sequences and plasmids specifically exemplified.
Plasmid Construction.
[0021] The pAAV-CBA-GALNS plasmid, as illustrated in FIG. 1., incorporates the cytomegalovirus enhancer and β-actin promoter (CBA) to drive expression of the human N-acetylgalactosamine-6-sulphate sulphatase (GALNS). It is flanked by AAV2 ITRs. The plasmid was constructed by replacing the cytomegalovirus immediate early enhancer/promoter (CMV) in pAAV-CMV-GALNS (FIG. 2) as previously constructed with a 1.8-kb fragment from pCXN (FIG. 3) containing the CBA promoter. The CMV immediate early enhancer/promoter in pAAV-CMV-GALNS has been previously described (Niwa et al. (1991) December 15; 108(2):193-9) and is herein incorporated by reference in its entirety. The 1.8-kb fragment was ligated into the plasmid and the correct orientation of the insert was confirmed by restriction enzyme analysis (FIG. 4).
[0022] To produce the AAA-AAV vector which incorporates the octapeptide of aspartic acid in to the capsid protein, the pXX2 plasmid (SEQ ID NO:1) which encodes for the Rep and Cap AAV2 proteins (Xiao et al. (1998) J Virol 72: 2224-2232), was modified to produce (pXX2-ND8) (SEQ ID NO:2). This was done by inserting a sequence encoding eight aspartic amino acids (ND8) (5'-GATGATGATGATGATGATGACGAC-3') (SEQ ID NO:3), immediately after the initial codon of the VP2 protein in the packing plasmid pXX (FIG. 5). Insertion was carried out using a commercial sire-directed mutagenesis kit (QuikChange® Site-Directed Mutagenesis Kit, Stratagene, La Jolla, Calif.) according to manufacturer's instructions, by using the primers: 5-gaggaacctgttaagacgGATGATGATGATGATGATGACGACgctccgggaaaaaagagg-3 (SEQ ID NO:4) (XX2-ND8 sense) and its complement (XX2-ND8 antisense). Insertion of the sequence encoding the octapeptide sequence was first confirmed by PCR with primers XX2-ND8-4F 5'-ATCTCAACCCGTTTCTGTCG-3' (SEQ ID NO:5) and XX2-ND8-4R 5''-GCGTCTCCAGTCTGACCAA-3'(SEQ ID NO:6), flanking the insertion site, which produced a PCR product of 691 bp with the original pXX2 plasmid and 715 bp after the insertion of sequence. The resulting plasmid (pXX2-ND8) (SEQ ID NO:2) was sequenced to ensure the presence of the eight aspartic amino acids without introduction of fortuitous mutations.
Production of Recombinant AAV-AAV Vectors
[0023] CBA-GALNS (native capsid) or ND8/CBA-GALNS (AAA tagged capsid) were produced by calcium phosphate-mediated co-transfection of pAAV-CBA-GALNS, pXX6-80 helper plasmid (Xiao et al. (1998) J Virol 72: 2224-2232), and pXX2 or pXX2-ND8 plasmids (Zolotukhin et al. (1999). Gene Ther 6: 973-985). HEK 293 cells were seeded to 80-90% confluence on 15-cm culture plates and media was removed immediately before starting the transfection. The three plasmids were mixed in 18:18:54 μg ratio (1:1:1 molar ratio) with 1.25 mL of 0.25 M CaCl2. Then, 1.25 mL of 2× HeBS buffer (280 mM NaCl, 1.5 mM Na2HPO4, 50 mM HEPES, pH 7.1) was added and the mixture was incubated for 1 minute at room temperature. The mixture was added to 20 mL of culture media (DMEM with FBS and antibiotics) and immediately dispensed into the culture plate. Forty-eight hours after transfection, the cells were harvested, resuspended in 15 mL of AAV lysis buffer (0.15 M NaCl, 50 mM Tris-HCl pH 8.5), and lysated by three freeze/thaw cycles. The solution was clarified by centrifugation at 3,700 g at 4° for 20 minutes. The supernatant was designated the primary viral solution and stored at -80° C. for further analysis.
[0024] AAV vectors were purified by iodixanol gradient (Zolotukhin et al. (1999) Gene Ther 6: 973-985). The gradient was prepared by combining 9 mL of 15% iodixanol (Optiprep®, Sigma-Aldrich, Saint Louis, Mo.), 1 M NaCl in PBS-MK buffer (1× PBS, 1 mM MgCl2 and 2.5 mM KCl), 6 mL of 25% iodixanol in PBS-MK buffer with Phenol red (2.5 μL of stock solution per mL of iodixanol solution), 5 mL of 40% iodixanol in PBS-MK buffer, and 5 mL of 60% iodixanol in PBS-MK. Primary viral solution (aprox. 15 mL) was added and gradient was centrifuged at 25,000 RPM for 3 h at 18° C. Using a syringe with a 18-gauge needle, 2.5 mL were aspirated of each of the 60% and 40% phases. The virus solution was concentrated with Centricon 100 K (Millipore), desalted with 2 mL of 0.9% NaCl, and stored to -80° C. Quantification was be carried out by a spectrophotometric method, based on the extinction coefficient of the AAV2 capsid proteins and genome (Sommer et al. (2003). Mol Ther 7:122-128). For quantification 100 μL of viral solution was incubated with 0.5 μL of 20% SDS at 75° C. for 10 minutes, and absorbance was measured at 260 and 280 nm. A solution of 0.9% NaCl with 0.5 μL of 20% SDS was used as blank. Virus genomes per mL (vg/mL) were calculated according to the equation:
vg / mL = 4 , 47 × 10 19 ( A 260 - 0 , 59 A 280 ) MW DNA ( 1 ) ##EQU00001##
where MWDNA is the molecular weight of each viral genome based on its sequence and using the molecular weight of each nucleotide (A=312.2 Da, C=288.2 Da, G=328.2 Da y T=303.2 Da) (see Sommer et al. (2003). Mol Ther 7: 122-128).
In Vitro Transfection.
[0025] HEK293 cells, 1×105 (ATCC CRL-1573) were seeded in 12-well plates and transfected with 1×1010 vg (1×105 vg/cell) of each viral genome. Cells were harvested postransfection, and resuspended in 100 μL of 1% sodium deoxycholate (Sigma-Aldrich, Saint Louis, Mo.). GALNS activity in cell lysate was assayed using the substrate 4-methylumbeliferyl-β-D-galactopyranoside-6-sulphate (Toronto Chemicals Research, North York, On, Canada), as described (van Diggelen et al. (1993) Clin Chem Acta 187:131-140). One unit is defined as the enzyme catalyzing 1 nmol of substrate per hour. Total protein in cell lysate will be determined by micro-Lowry protein assay.
Hydroxyapatite-Binding Assay.
[0026] Assays were carried out essentially as described (Nishioka et al. (2006) Mol Genet Metab 88: 244-255). Hydroxyapatite beads (Sigma-Aldrich, Saint Louis, Mo.) were suspended in 25 mM Tris-HCl buffered saline, pH 7.4, at a concentration of 100 μg/μL. AAV2 (wild-type virus), CBA-GALNS and ND8/CBA-GALNS plasmids were mixed at a final concentration 5×1011 and 1×1012 vg. The mixture was incubated at 37° C. for 1 h, and centrifuged at 14,000 rpm for 10 minutes. The AAV titers were measured in the supernatant, and the bound AAV fraction was determined from the amount of the total and unbound AAV. Quantification of AAV vectors in the supernatant was carried out by the spectrophotometric method described above. Hydroxyapatite-binding assays for each AAV vector was carried out by triplicate.
Biodistribution Experiment.
[0027] 1.5×1011 vg of CBA-GALNS or ND8/CBA-GALNS were injected intravenously into 7-8-weeks-old MPS IVA knock-out mice (n=3 for each group) according to Tomatsu et al. (2003) Hum Mol Genet 12: 3349-3358, incorporated by reference herein. Control animals were injected with PBS. Mice were sacrificed 48 hours after the injection, and liver, brain, and bone (leg) were dissected and immediately frozen in dry-ice. Bone marrow was obtained by flushing the femurs with PBS. Genomic DNA was extracted by tissue homogenization in 1 ml of DNAzol (GIBCO, Grand Island, N.Y.) according to manufacturer's instructions. DNA samples from liver, brain, bone and bone marrow were analyzed for the presence of viral DNA by PCR using the primers TOMF23 5'-ACAGGGCCATTGATGGCCTCAACCTCCT-3' (SEQ ID NO:7) and TOMF34R 5'-GCTTCGTGTGGTCTTCCAGATT GTGAGTTG-3'(SEQ ID NO:8), which were specific for human GALNS cDNA, and produced a 235 bp PCR-fragment. This pair-primers specific for human GALNS cDNA, did not amplify the genomic GALNS sequence under these conditions, because the primers annealed in exons 10 and 12, producing a 4.1 kb PCR product. Primers of mouse β-glucuronidase gene were used as an internal control to check DNA quality and absence of PCR-inhibitors. Quantification of the viral genome in bone samples was done by real-time PCR (Tomatsu, et al. (2003) Hum Mol Genet 12: 3349-3358), with a commercial kit, the Fast SYBR® Green Master Mix (Applied Biosystems, Foster City, Calif.), according to manufacturer's instructions, using 1 μg of total DNA and the primers TOMF23 and TOMF34R. The pAAV-CBA-GALNS plasmid was used as standard.
DEFINITIONS
[0028] The term "vector" as used herein, refers to vectors for the delivery of therapeutic agents. Examples include, but are not limited to, viral vectors, liposomes, large natural polymers, large synthetic polymers, and polymers comprised of both natural and synthetic components.
[0029] The term "therapeutic agent" is intended in its broadest meaning to include not only the polypeptides and polynucleotides of the instance invention but also any agent which conveys an effect beneficial to health including but not limited to any pharmaceutical agent, including cytokines, small molecule drugs, cell-permeable small molecule drugs, hormones, chemotherapy, combinations of interleukins, lectins and other stimulating agents.
[0030] The term "polypeptide therapeutic agent" as used herein, refers to any peptide, polypeptide, or protein, with out limitation with therapeutic benefits. By way of example and not of limitation are enzymes which may be useful in enzyme replacement therapy. Non-limiting examples include N-acetylgalactosamine-6-sulfate-sulfatase (GALNS), also described in U.S. patent application Ser. No. 10/864,758, and tissue non-specific alkaline phosphatase (TNSALP) also described in U.S. patent application Ser. No. 11/484,870, and P-glucuronidase (GUS), also described in Ser. No. 11/614,970. Polypeptide therapeutic agents may include enzymes in their native form, or functional fragments thereof. Polypeptide therapeutic agents may be used alone, or in combination or incorporated into fusion proteins.
[0031] The term "acidic amino acid" or "AAA" as used herein, refers to any repeating amino acid sequence of glutamic acid or aspartic acid. As used herein AAA may comprise multiple copies of acidic amino acid peptides, in any arbitrary combination including repeating glutamic acid or aspartic acid sequences or a combination thereof. The number of acid amino acids in each AAA peptide may be 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. Preferably 4-15, more preferably 4-0.8, and most preferably 8 acid amino acids. Multiple copies of a peptide consisting of AAA may be directly attached to a vector (viral and non-viral) via a peptide bond or the like. In the present invention, though there is no specific limitation as to the method for attaching multiple copies of a AAA peptide to a vector, it is advantageous, e.g., to produce and use fusion proteins of comprising the vector and the AAA peptide.
[0032] The term "large polymer" as used herein, refers to any polymer which may be used to deliver a therapeutic agent. Non-limiting examples of polymers and methods of modification may be found in International Patent Applications Nos. WO/2007/012013 and WO/2004/022099 incorporated by reference herein.
[0033] In addition to HEK 293 cells described herein, any number of cell lines are know in the art are capable of expressing the various polynucleotides and phasmids in the invention. To this end, any eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript may be used. Cell culture techniques are also well known in the art.
Other Large Molecule Vectors.
[0034] The instant invention is not limited to AAV. The surprising discovery that AAA peptides may endow large molecules with an affinity for hydroxyapatite (HA) may be applied to other virus or large molecule vectors including any virus vector, by way of example but not of limitation, adenoviruses, retro viruses, HCV, HIV, herpesvirus, papovavirus, poxvirus hepadnavirus, adeno-associated virus, parvovirus, vaccinia virus, etc. or related or derived viruses thereof. Mutant herpesviruses can for example be based on HSV1, HSV2, VZV, CMV, EBV, HHV6, HHV7, or on non-human animal herpesviruses such as PRY, IBRV/BHV, MDV, EHV, and others. Vectors may also include Lentiviruses which have been used for delivery of small interfering RNA as described (Li and Rossi (2005) Methods Enzymol 392, 226), hereby incorporated by reference in its entirety. AAA peptides may be inserted into, capsid or coat proteins of any of the aforementioned viral vectors, as described herein for AAV, whereby the virus vector is endowed with an increased affinity for HA.
[0035] Also included are any and all vectors derived from liposomes, micelles, or large natural or synthetic polymers. Methods of attaching polypeptides to liposomes are know in the art and may be adapted to the AAA peptides of the instant invention. By way of example but not of limitation, AAA peptides may be fused with transmembrane proteins using methods described in U.S. Pat. No. 5,374,548, incorporated herein by reference in its entirety. Other methods include chemical linking AAA to liposomes, using methods described in U.S. Pat. No. 5,401,511, incorporated herein by reference in its entirety. Other gene delivery vectors include liposome-derived systems, artificial viral envelopes, and other systems known in the art (See, e.g., Rossi, J. J. (1995) Br. Med. Bull. 51(1):217-225; Boado, R. J. et al. (1998) J. Pharm. Sci. 87(11):1308-1315; and Morris, M. C. et al. (1997) Nucleic Acids Res. 25(14):2730-2736; El-Aneed, (2004) J Control Release 94, 1-14), all, herein incorporated by reference in its entirety.
[0036] These same chemical linking methods may be applied to large natural and synthetic polymers. By way of example, but not of limitation, natural polymers include polymers derived proteins including collagen and fibrin, or, carbohydrates including hyaluronic acid and sulfated glycosaminoglycans, as well as polymers derived from lipids including liposome or micelles, or polymers derived from polyamino acids including poly-L-arginine, poly-L-lysine and poly-L-ornithine. By way of example but not of limitation, synthetic polymers may include poly(methyl methacrylate) (PMMA), and poly(hydroxyethyl methacrylic) poly(HEMA), or derivatives thereof. By way of example but not of limitation, polymers which are combinations of synthetic and natural polymers include HEMA-PC and pMPC as described in International Patent Application publication WO 2007/100902, and hereby incorporated by reference in its entirety.
[0037] The skilled artisan will recognize that amino acid coupling to proteins or synthetic polymers differ, and conditions will be varied as necessary to promote the formation of the conjugates. Additional guidance maybe obtained from texts such as Wong, 8.S., "Chemistry of Protein Conjugation and Cross-Linking," (CRC Press 1991), or standard texts in organic chemistry.
[0038] In one embodiment is a vector with 4-15 acid amino acids attached externally, incorporating a therapeutic agent.
[0039] In another embodiment is a viral vector with 4-15 acid amino acids attached externally, incorporating a nucleic acid encoding a polypeptide therapeutic agent. Examples of polypeptide therapeutic agent include, N-acetylgalactosamine-6-sulfate-sulfatase (GALNS), tissue non-specific alkaline phosphatase (TNSALP), and β-glucuronidase (GUS) alone or in combination.
[0040] In one preferred embodiment is an adeno-associated virus with 4-15 acid amino acids attached externally, incorporating a nucleic acid encoding N-acetylgalactosamine-6-sulfate-sulfatase (GALNS).
[0041] In another embodiment is an adeno-associated virus with 4-15 acid amino acids attached externally, incorporating a nucleic acid encoding tissue non-specific alkaline phosphatase (TNSALP).
[0042] In another embodiment is an adeno-associated virus with 4-15 acid amino acids attached externally, incorporating a nucleic acid encoding β-glucuronidase (GUS).
[0043] In one embodiment is a method of making a viral vector which targets bone by incorporating 4-15 acid amino acids into the viral caspid.
[0044] In another embodiment is a method of treating a subject in need by administering a viral vector with 4-15 acid amino acids attached externally and incorporating a therapeutic agent.
[0045] In another embodiment is a liposome with 4-15 acid amino acids attached externally, incorporating a therapeutic agent.
[0046] In another embodiment is a synthetic polymer with 4-15 acid amino acids attached externally, incorporating a therapeutic agent.
[0047] In another embodiment is a natural polymer with 4-15 acid amino acids attached externally, incorporating a therapeutic agent.
[0048] In another embodiment is a polymer with both natural and synthetic components with 4-15 acid amino acids attached externally, incorporating a therapeutic agent.
Methods of Practicing the Invention
Administration
[0049] An AAA-AAV vector of the present invention may be prepared in the form of a pharmaceutical composition containing the fusion protein dissolved or dispersed in a pharmaceutically acceptable carrier well known to those who are skilled in the art, for parenteral administration by e.g., intravenous, subcutaneous, or intramuscular injection or by intravenous drip infusion. For the pharmaceutical composition for parenteral administration, any conventional additives may be used such as excipients, binders, disintegrates, dispersing agents, lubricants, diluents, absorption enhancers, buffering agents, surfactants, solubilizing agents, preservatives, emulsifiers, isotonizers, stabilizers, solubilizers for injection, pH adjusting agents, etc. An AAA viral, liposomal, or polymer vector of the present invention, in particular a AAA-AAV viral vector and a AAA peptide attached to a viral capsid, may be used advantageously in place of the conventional untagged (native) viral vector in a substitution therapy for the treatment of bone diseases. In the treatment, the vector carrying the fusion protein may be administered intravenously, subcutaneously, or intramuscularly. Doses and frequencies of administration are to be determined by the physician in charge in accordance with the condition of his or her patient.
[0050] The various embodiment described herein are water-soluble and maybe administered, by way of example, in a sterile aqueous solution, preferably a physiological solution. A pharmaceutically acceptable formulation of the present invention may be any injectable or topically applied physiological solution. A physiological solution may be comprised of isotonic balanced salts with a pH of about 7.0 to about 7.5. A preferred physiological solution may comprise isotonic saline and a pH of 7.5. For topical administration or for certain targeted applications it may be desirable to increase the viscosity of the formulation. Various carriers known to increase viscosity include but are not limited to such high molecular weight polymers such as, hyaluronic acid, hydroxypropyl methyl cellulose, as well as other carbohydrates or sugars. These are typical included in the formulation at 0.01 to 0.1 percent, 0.1 to 1.0 percent, 1 to 2 percent, 2 to 3 percent, 3 to 4 percent, 4 to 5 percent 5 to 10 percent, or 10 to 20 percent by weight. By way of example and not of limitation, recombinant viruses may be administered at a dose of 107-1012 pfu for a non-intravenous administration.
[0051] Preferred embodiments of the invention are described in the following examples. Other embodiments within the scope of the claims herein will be apparent to one skilled in the art from consideration of the specification or practice of the invention as disclosed herein. It is intended that the specification, together with the examples, be considered exemplary only, with the scope and spirit of the invention being indicated by the claims, which follow the examples.
EXAMPLES
Example 1
Construction of pXX2-ND8 Plasmid
[0052] After site-directed mutagenesis was performed, 20 clones were obtained. Five clones out of 20 clones had an expected size of 8.3 kb. PCR with XX2-ND8-4F and XX2-ND8-4R primers showed that in three clones a PCR product of 715 bp was obtained (FIG. 6a). Sequencing of those plasmids showed the presence of the precise insertional sequence in one clone (FIG. 6b) without introduction of fortuitous mutations.
Example 2
In Vitro Transfection
[0053] GALNS activity from transfected cells with either untagged or tagged plasmid increased to 12.24+/-3.25 U/mg or 12.53+/-2.33 U/mg respectively, compared to 0.63+/-0.55 U/mg in untransfected cells (FIG. 7). These results show that the presence of the AAA in the capsid does not alter the transfection efficacy of the plasmid and expression level of the gene product.
Example 3
Hydroxyapatite-Binding Assay
[0054] AAV2 wild-type and CBA-GALNS (native capsid) virus vectors were found in all 100% in the supernatant after the hydroxyapatite-binding assay indicating no binding with hydroxyapatite, while no ND8/CBA-GALNS virus vectors were was found in the supernatant, indicating 100% affinity with hydroxyapatite (FIG. 8).
Example 4
Biodistribution Experiment
[0055] DNA samples from bone, liver, brain and bone marrow were tested by PCR for presence of vector DNA after 48 h. After 48 h post injection, virus DNA was detected in liver, brain, and bone marrow with both CBA-GALNS and ND8/CBA-GALNS vectors. However, in bone with ND8/CBA-GALNS, the virus genome was detected while CBA-GALNS, was not detected (FIG. 9). Although mouse-by-mouse variation was observed, virus genome quantification by real-time PCR in DNA samples from bone showed an increment between 16- and 291-folds in the amount of virus genome in mice infused with ND8/CBA-GALNS compared to mice infused with CBA-GALNS. No virus DNA was detected in any tissue sample from control mice with PBS.
[0056] All publications and patents cited in this specification, including U.S. patent application Ser. Nos., 12/497,612, 61/081,711, 11/614,970, 11/245,424, 11/484,870, 60/725,563, and 10/864,758, are hereby incorporated by reference in their entirety. The discussion of the references herein is intended merely to summarize the assertions made by the authors and no admission is made that any reference constitutes prior art. Applicants reserve the right to challenge the accuracy and pertinence of the cited references.
Sequences
[0057] SEQ ID NO: 1. Complete sequence of packing plasmid pXX2 (8.3 kb). Initial codon for capsid proteins VP1, VP2 and VP3 are shown in bold.
TABLE-US-00001 CGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGAATTCCCATCATCAATAATA TACCTTATTTTGGATTGAAGCCAATATGATAATGAGGGGGTGGAGTTTGTGACGTGG CGCGGGGCGTGGGAACGGGGCGGGTGACGTAGTAGCTCTAGAGGTCCTGTATTAGA GGTCACGTGAGTGTTTTGCGACATTTTGCGACACCATGTGGTCACGCTGGGTATTTA AGCCCGAGTGAGCACGCAGGGTCTCCATTTTGAAGCGGGAGGTTTGAACGCGCAGC CACCACGGCGGGGTTTTACGAGATTGTGATTAAGGTCCCCAGCGACCTTGACGAGCA TCTGCCCGGCATTTCTGACAGCTTTGTGAACTGGGTGGCCGAGAAGGAATGGGAGTT GCCGCCAGATTCTGACATGGATCTGAATCTGATTGAGCAGGCACCCCTGACCGTGGC CGAGAAGCTGCAGCGCGACTTTCTGACGGAATGGCGCCGTGTGAGTAAGGCCCCGG AGGCCCTTTTCTTTGTGCAATTTGAGAAGGGAGAGAGCTACTTCCACATGCACGTGC TCGTGGAAACCACCGGGGTGAAATCCATGGTTTTGGGACGTTTCCTGAGTCAGATTC GCGAAAAACTGATTCAGAGAATTTACCGCGGGATCGAGCCGACTTTGCCAAACTGG TTCGCGGTCACAAAGACCAGAAATGGCGCCGGAGGCGGGAACAAGGTGGTGGATG AGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCGT GGACTAATATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGT TGGTGGCGCAGCATCTGACGCACGTGTCGCAGACGCAGGAGCAGAACAAAGAGAAT CAGAATCCCAATTCTGATGCGCCGGTGATCAGATCAAAAACTTCAGCCAGGTACATG GAGCTGGTCGGGTGGCTCGTGGACAAGGGGATTACCTCGGAGAAGCAGTGGATCCA GGAGGACCAGGCCTCATACATCTCCTTCAATGCGGCCTCCAACTCGCGGTCCCAAAT CAAGGCTGCCTTGGACAATGCGGGAAAGATTATGAGCCTGACTAAAACCGCCCCCG ACTACCTGGTGGGCCAGCAGCCCGTGGAGGACATTTCCAGCAATCGGATTTATAAA ATTTTGGAACTAAACGGGTACGATCCCCAATATGCGGCTTCCGTCTTTCTGGGATGG GCCACGAAAAAGTTCGGCAAGAGGAACACCATCTGGCTGTTTGGGCCTGCAACTAC CGGGAAGACCAACATCGCGGAGGCCATAGCCCACACTGTGCCCTTCTACGGGTGCG TAAACTGGACCAATGAGAACTTTCCCTTCAACGACTGTGTCGACAAGATGGTGATCT GGTGGGAGGAGGGGAAGATGACCGCCAAGGTCGTGGAGTCGGCCAAAGCCATTCTC GGAGGAAGCAAGGTGCGCGTGGACCAGAAATGCAAGTCCTCGGCCCAGATAGACCC GACTCCCGTGATCGTCACCTCCAACACCAACATGTGCGCCGTGATTGACGGGAACTC AACGACCTTCGAACACCAGCAGCCGTTGCAAGACCGGATGTTCAAATTTGAACTCA CCCGCCGTCTGGATCATGACTTTGGGAAGGTCACCAAGCAGGAAGTCAAAGACTTTT TCCGGTGGGCAAAGGATCACGTGGTTGAGGTGGAGCATGAATTCTACGTCAAAAAG GGTGGAGCCAAGAAAAGACCCGCCCCCAGTGACGCAGATATAAGTGAGCCCAAAC GGGTGCGCGAGTCAGTTGCGCAGCCATCGACGTCAGACGCGGAAGCTTCGATCAAC TACGCAGACAGGTACCAAAACAAATGTTCTCGTCACGTGGGCATGAATCTGATGCTG TTTCCCTGCAGACAATGCGAGAGAATGAATCAGAATTCAAATATCTGCTTCACTCAC GGACAGAAAGACTGTTTAGAGTGCTTTCCCGTGTCAGAATCTCAACCCGTTTCTGTC GTCAAAAAGGCGTATCAGAAACTGTGCTACATTCATCATATCATGGGAAAGGTGCC AGACGCTTGCACTGCCTGCGATCTGGTCAATGTGGATTTGGATGACTGCATCTTTGA ACAATAAATGATTTAAATCAGGTATGGCTGCCGATGGTTATCTTCCAGATTGGCTCG AGGACACTCTCTCTGAAGGAATAAGACAGTGGTGGAAGCTCAAACCTGGCCCACCA CCACCAAAGCCCGCAGAGCGGCATAAGGACGACAGCAGGGGTCTTGTGCTTCCTGG GTACAAGTACCTCGGACCCTTCAACGGACTCGACAAGGGAGAGCCGGTCAACGAGG CAGACGCCGCGGCCCTCGAGCACGACAAAGCCTACGACCGGCAGCTCGACAGCGGA GACAACCCGTACCTCAAGTACAACCACGCCGACGCGGAGTTTCAGGAGCGCCTTAA AGAAGATACGTCTTTTGGGGGCAACCTCGGACGAGCAGTCTTCCAGGCGAAAAAGA GGGTTCTTGAACCTCTGGGCCTGGTTGAGGAACCTGTTAAGACGGCTCCGGGAAAA AAGAGGCCGGTAGAGCACTCTCCTGTGGAGCCAGACTCCTCCTCGGGAACCGGAAA GGCGGGCCAGCAGCCTGCAAGAAAAAGATTGAATTTTGGTCAGACTGGAGACGCAG ACTCAGTACCTGACCCCCAGCCTCTCGGACAGCCACCAGCAGCCCCCTCTGGTCTGG GAACTAATACGATGGCTACAGGCAGTGGCGCACCAATGGCAGACAATAACGAGGG CGCCGACGGAGTGGGTAATTCCTCGGGAAATTGGCATTGCGATTCCACATGGATGG GCGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAAC CACCTCTACAAACAAATTTCCAGCCAATCAGGAGCCTCGAACGACAATCACTACTTT GGCTACAGCACCCCTTGGGGGTATTTTGACTTCAACAGATTCCACTGCCACTTTTCAC CACGTGACTGGCAAAGACTCATCAACAACAACTGGGGATTCCGACCCAAGAGACTC AACTTCAAGCTCTTTAACATTCAAGTCAAAGAGGTCACGCAGAATGACGGTACGAC GACGATTGCCAATAACCTTACCAGCACGGTTCAGGTGTTTACTGACTCGGAGTACCA GCTCCCGTACGTCCTCGGCTCGGCGCATCAAGGATGCCTCCCGCCGTTCCCAGCAGA CGTCTTCATGGTGCCACAGTATGGATACCTCACCCTGAACAACGGGAGTCAGGCAGT AGGACGCTCTTCATTTTACTGCCTGGAGTACTTTCCTTCTCAGATGCTGCGTACCGGA AACAACTTTACCTTCAGCTACACTTTTGAGGACGTTCCTTTCCACAGCAGCTACGCTC ACAGCCAGAGTCTGGACCGTCTCATGAATCCTCTCATCGACCAGTACCTGTATTACT TGAGCAGAACAAACACTCCAAGTGGAACCACCACGCAGTCAAGGCTTCAGTTTTCT CAGGCCGGAGCGAGTGACATTCGGGACCAGTCTAGGAACTGGCTTCCTGGACCCTG TTACCGCCAGCAGCGAGTATCAAAGACATCTGCGGATAACAACAACAGTGAATACT CGTGGACTGGAGCTACCAAGTACCACCTCAATGGCAGAGACTCTCTGGTGAATCCG GGCCCGGCCATGGCAAGCCACAAGGACGATGAAGAAAAGTTTTTTCCTCAGAGCGG GGTTCTCATCTTTGGGAAGCAAGGCTCAGAGAAAACAAATGTGGACATTGAAAAGG TCATGATTACAGACGAAGAGGAAATCAGGACAACCAATCCCGTGGCTACGGAGCAG TATGGTTCTGTATCTACCAACCTCCAGAGAGGCAACAGACAAGCAGCTACCGCAGA TGTCAACACACAAGGCGTTCTTCCAGGCATGGTCTGGCAGGACAGAGATGTGTACCT TCAGGGGCCCATCTGGGCAAAGATTCCACACACGGACGGACATTTTCACCCCTCTCC CCTCATGGGTGGATTCGGACTTAAACACCCTCCTCCACAGATTCTCATCAAGAACAC CCCGGTACCTGCGAATCCTTCGACCACCTTCAGTGCGGCAAAGTTTGCTTCCTTCATC ACACAGTACTCCACGGGACAGGTCAGCGTGGAGATCGAGTGGGAGCTGCAGAAGGA AAACAGCAAACGCTGGAATCCCGAAATTCAGTACACTTCCAACTACAACAAGTCTG TTAATGTGGACTTTACTGTGGACACTAATGGCGTGTATTCAGAGCCTCGCCCCATTG GCACCAGATACCTGACTCGTAATCTGTAATTGCTTGTTAATCAATAAACCGTTTAATT CGTTTCAGTTGAACTTTGGTCTCTGCGTATTTCTTTCTTATCTAGTTTCCATGCTCTAG AGGTCCTGTATTAGAGGTCACGTGAGTGTTTTGCGACATTTTGCGACACCATGTGGT CACGCTGGGTATTTAAGCCCGAGTGAGCACGCAGGGTCTCCATTTTGAAGCGGGAG GTTTGAACGCGCAGCCACCACGGCGGGGTTTTACGAGATTGTGATTAAGGTCCCCAG CGACCTTGACGAGCATCTGCCCGGCATTTCTGACAGCTTTGTGAACTGGGTGGCCGA GAAGGAATGGGAGTTGCCGCCAGATTCTGACATGGATCTGAATCTGATTGAGCAGG CACCCCTGACCGTGGCCGAGAAGCTGCATCGCTGGCGTAATAGCGAAGAGGCCCGC ACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGATTCCGTTGC AATGGCTGGCGGTAATATTGTTCTGGATATTACCAGCAAGGCCGATAGTTTGAGTTC TTCTACTCAGGCAAGTGATGTTATTACTAATCAAAGAAGTATTGCGACAACGGTTAA TTTGCGTGATGGACAGACTCTTTTACTCGGTGGCCTCACTGATTATAAAAACACTTCT CAGGATTCTGGCGTACCGTTCCTGTCTAAAATCCCTTTAATCGGCCTCCTGTTTAGCT CCCGCTCTGATTCTAACGAGGAAAGCACGTTATACGTGCTCGTCAAAGCAACCATAG TACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGT GACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTT CTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGG TTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGT TCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCC ACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCG GTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATG AGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTT AAATATTTGCTTATACAATCTTCCTGTTTTTGGGGCTTTTCTGATTATCAACCGGGGT ACATATGATTGACATGCTAGTTTTACGATTACCGTTCATCGATTCTCTTGTTTGCTCC AGACTCTCAGGCAATGACCTGATAGCCTTTGTAGAGACCTCTCAAAAATAGCTACCC TCTCCGGCATGAATTTATCAGCTAGAACGGTTGAATATCATATTGATGGTGATTTGA CTGTCTCCGGCCTTTCTCACCCGTTTGAATCTTTACCTACACATTACTCAGGCATTGC ATTTAAAATATATGAGGGTTCTAAAAATTTTTATCCTTGCGTTGAAATAAAGGCTTCT CCCGCAAAAGTATTACAGGGTCATAATGTTTTTGGTACAACCGATTTAGCTTTATGC TCTGAGGCTTTATTGCTTAATTTTGCTAATTCTTTGCCTTGCCTGTATGATTTATTGGA TGTTGCAATTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCG CATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCG ACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGC TTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTC ATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAA TGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCG CGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGA CAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCA ACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTC ACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTG GGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAA GAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCC GTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACT TGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGA GAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTG ACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTGCACAACATGGGGGATCA TGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACG AGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACT
GGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGAT AAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGAT AAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGA TGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGA TGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAAC TGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATT TAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACG TGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTG AGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACC AGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGG CTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCA CCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACC AGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATA GTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCA GCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAA AGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGG TCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTAT AGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAG GGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCC TTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAA CCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCG CAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAC
[0058] SEQ ID NO: 2. Complete sequence of packing plasmid pXX2 with the bone-tag sequence (pXX2-ND8-8.4 kb). Initial codon for capsid proteins VP1, VP2 and VP3 are shown in bold. Sequence encoding for the amino acidic octapeptide is underlined.
TABLE-US-00002 CGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGAATTCCCATCATCAATAATA TACCTTATTTTGGATTGAAGCCAATATGATAATGAGGGGGTGGAGTTTGTGACGTGG CGCGGGGCGTGGGAACGGGGCGGGTGACGTAGTAGCTCTAGAGGTCCTGTATTAGA GGTCACGTGAGTGTTTTGCGACATTTTGCGACACCATGTGGTCACGCTGGGTATTTA AGCCCGAGTGAGCACGCAGGGTCTCCATTTTGAAGCGGGAGGTTTGAACGCGCAGC CACCACGGCGGGGTTTTACGAGATTGTGATTAAGGTCCCCAGCGACCTTGACGAGCA TCTGCCCGGCATTTCTGACAGCTTTGTGAACTGGGTGGCCGAGAAGGAATGGGAGTT GCCGCCAGATTCTGACATGGATCTGAATCTGATTGAGCAGGCACCCCTGACCGTGGC CGAGAAGCTGCAGCGCGACTTTCTGACGGAATGGCGCCGTGTGAGTAAGGCCCCGG AGGCCCTTTTCTTTGTGCAATTTGAGAAGGGAGAGAGCTACTTCCACATGCACGTGC TCGTGGAAACCACCGGGGTGAAATCCATGGTTTTGGGACGTTTCCTGAGTCAGATTC GCGAAAAACTGATTCAGAGAATTTACCGCGGGATCGAGCCGACTTTGCCAAACTGG TTCGCGGTCACAAAGACCAGAAATGGCGCCGGAGGCGGGAACAAGGTGGTGGATG AGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCGT GGACTAATATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGT TGGTGGCGCAGCATCTGACGCACGTGTCGCAGACGCAGGAGCAGAACAAAGAGAAT CAGAATCCCAATTCTGATGCGCCGGTGATCAGATCAAAAACTTCAGCCAGGTACATG GAGCTGGTCGGGTGGCTCGTGGACAAGGGGATTACCTCGGAGAAGCAGTGGATCCA GGAGGACCAGGCCTCATACATCTCCTTCAATGCGGCCTCCAACTCGCGGTCCCAAAT CAAGGCTGCCTTGGACAATGCGGGAAAGATTATGAGCCTGACTAAAACCGCCCCCG ACTACCTGGTGGGCCAGCAGCCCGTGGAGGACATTTCCAGCAATCGGATTTATAAA ATTTTGGAACTAAACGGGTACGATCCCCAATATGCGGCTTCCGTCTTTCTGGGATGG GCCACGAAAAAGTTCGGCAAGAGGAACACCATCTGGCTGTTTGGGCCTGCAACTAC CGGGAAGACCAACATCGCGGAGGCCATAGCCCACACTGTGCCCTTCTACGGGTGCG TAAACTGGACCAATGAGAACTTTCCCTTCAACGACTGTGTCGACAAGATGGTGATCT GGTGGGAGGAGGGGAAGATGACCGCCAAGGTCGTGGAGTCGGCCAAAGCCATTCTC GGAGGAAGCAAGGTGCGCGTGGACCAGAAATGCAAGTCCTCGGCCCAGATAGACCC GACTCCCGTGATCGTCACCTCCAACACCAACATGTGCGCCGTGATTGACGGGAACTC AACGACCTTCGAACACCAGCAGCCGTTGCAAGACCGGATGTTCAAATTTGAACTCA CCCGCCGTCTGGATCATGACTTTGGGAAGGTCACCAAGCAGGAAGTCAAAGACTTTT TCCGGTGGGCAAAGGATCACGTGGTTGAGGTGGAGCATGAATTCTACGTCAAAAAG GGTGGAGCCAAGAAAAGACCCGCCCCCAGTGACGCAGATATAAGTGAGCCCAAAC GGGTGCGCGAGTCAGTTGCGCAGCCATCGACGTCAGACGCGGAAGCTTCGATCAAC TACGCAGACAGGTACCAAAACAAATGTTCTCGTCACGTGGGCATGAATCTGATGCTG TTTCCCTGCAGACAATGCGAGAGAATGAATCAGAATTCAAATATCTGCTTCACTCAC GGACAGAAAGACTGTTTAGAGTGCTTTCCCGTGTCAGAATCTCAACCCGTTTCTGTC GTCAAAAAGGCGTATCAGAAACTGTGCTACATTCATCATATCATGGGAAAGGTGCC AGACGCTTGCACTGCCTGCGATCTGGTCAATGTGGATTTGGATGACTGCATCTTTGA ACAATAAATGATTTAAATCAGGTATGGCTGCCGATGGTTATCTTCCAGATTGGCTCG AGGACACTCTCTCTGAAGGAATAAGACAGTGGTGGAAGCTCAAACCTGGCCCACCA CCACCAAAGCCCGCAGAGCGGCATAAGGACGACAGCAGGGGTCTTGTGCTTCCTGG GTACAAGTACCTCGGACCCTTCAACGGACTCGACAAGGGAGAGCCGGTCAACGAGG CAGACGCCGCGGCCCTCGAGCACGACAAAGCCTACGACCGGCAGCTCGACAGCGGA GACAACCCGTACCTCAAGTACAACCACGCCGACGCGGAGTTTCAGGAGCGCCTTAA AGAAGATACGTCTTTTGGGGGCAACCTCGGACGAGCAGTCTTCCAGGCGAAAAAGA GGGTTCTTGAACCTCTGGGCCTGGTTGAGGAACCTGTTAAGACGGATGATGATGATG ATGATGACGACGCTCCGGGAAAAAAGAGGCCGGTAGAGCACTCTCCTGTGGAGCCA GACTCCTCCTCGGGAACCGGAAAGGCGGGCCAGCAGCCTGCAAGAAAAAGATTGAA TTTTGGTCAGACTGGAGACGCAGACTCAGTACCTGACCCCCAGCCTCTCGGACAGCC ACCAGCAGCCCCCTCTGGTCTGGGAACTAATACGATGGCTACAGGCAGTGGCGCAC CAATGGCAGACAATAACGAGGGCGCCGACGGAGTGGGTAATTCCTCGGGAAATTGG CATTGCGATTCCACATGGATGGGCGACAGAGTCATCACCACCAGCACCCGAACCTG GGCCCTGCCCACCTACAACAACCACCTCTACAAACAAATTTCCAGCCAATCAGGAG CCTCGAACGACAATCACTACTTTGGCTACAGCACCCCTTGGGGGTATTTTGACTTCA ACAGATTCCACTGCCACTTTTCACCACGTGACTGGCAAAGACTCATCAACAACAACT GGGGATTCCGACCCAAGAGACTCAACTTCAAGCTCTTTAACATTCAAGTCAAAGAG GTCACGCAGAATGACGGTACGACGACGATTGCCAATAACCTTACCAGCACGGTTCA GGTGTTTACTGACTCGGAGTACCAGCTCCCGTACGTCCTCGGCTCGGCGCATCAAGG ATGCCTCCCGCCGTTCCCAGCAGACGTCTTCATGGTGCCACAGTATGGATACCTCAC CCTGAACAACGGGAGTCAGGCAGTAGGACGCTCTTCATTTTACTGCCTGGAGTACTT TCCTTCTCAGATGCTGCGTACCGGAAACAACTTTACCTTCAGCTACACTTTTGAGGA CGTTCCTTTCCACAGCAGCTACGCTCACAGCCAGAGTCTGGACCGTCTCATGAATCC TCTCATCGACCAGTACCTGTATTACTTGAGCAGAACAAACACTCCAAGTGGAACCAC CACGCAGTCAAGGCTTCAGTTTTCTCAGGCCGGAGCGAGTGACATTCGGGACCAGTC TAGGAACTGGCTTCCTGGACCCTGTTACCGCCAGCAGCGAGTATCAAAGACATCTGC GGATAACAACAACAGTGAATACTCGTGGACTGGAGCTACCAAGTACCACCTCAATG GCAGAGACTCTCTGGTGAATCCGGGCCCGGCCATGGCAAGCCACAAGGACGATGAA GAAAAGTTTTTTCCTCAGAGCGGGGTTCTCATCTTTGGGAAGCAAGGCTCAGAGAAA ACAAATGTGGACATTGAAAAGGTCATGATTACAGACGAAGAGGAAATCAGGACAAC CAATCCCGTGGCTACGGAGCAGTATGGTTCTGTATCTACCAACCTCCAGAGAGGCAA CAGACAAGCAGCTACCGCAGATGTCAACACACAAGGCGTTCTTCCAGGCATGGTCT GGCAGGACAGAGATGTGTACCTTCAGGGGCCCATCTGGGCAAAGATTCCACACACG GACGGACATTTTCACCCCTCTCCCCTCATGGGTGGATTCGGACTTAAACACCCTCCT CCACAGATTCTCATCAAGAACACCCCGGTACCTGCGAATCCTTCGACCACCTTCAGT GCGGCAAAGTTTGCTTCCTTCATCACACAGTACTCCACGGGACAGGTCAGCGTGGAG ATCGAGTGGGAGCTGCAGAAGGAAAACAGCAAACGCTGGAATCCCGAAATTCAGTA CACTTCCAACTACAACAAGTCTGTTAATGTGGACTTTACTGTGGACACTAATGGCGT GTATTCAGAGCCTCGCCCCATTGGCACCAGATACCTGACTCGTAATCTGTAATTGCT TGTTAATCAATAAACCGTTTAATTCGTTTCAGTTGAACTTTGGTCTCTGCGTATTTCT TTCTTATCTAGTTTCCATGCTCTAGAGGTCCTGTATTAGAGGTCACGTGAGTGTTTTG CGACATTTTGCGACACCATGTGGTCACGCTGGGTATTTAAGCCCGAGTGAGCACGCA GGGTCTCCATTTTGAAGCGGGAGGTTTGAACGCGCAGCCACCACGGCGGGGTTTTAC GAGATTGTGATTAAGGTCCCCAGCGACCTTGACGAGCATCTGCCCGGCATTTCTGAC AGCTTTGTGAACTGGGTGGCCGAGAAGGAATGGGAGTTGCCGCCAGATTCTGACAT GGATCTGAATCTGATTGAGCAGGCACCCCTGACCGTGGCCGAGAAGCTGCATCGCT GGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTG AATGGCGAATGGCGATTCCGTTGCAATGGCTGGCGGTAATATTGTTCTGGATATTAC CAGCAAGGCCGATAGTTTGAGTTCTTCTACTCAGGCAAGTGATGTTATTACTAATCA AAGAAGTATTGCGACAACGGTTAATTTGCGTGATGGACAGACTCTTTTACTCGGTGG CCTCACTGATTATAAAAACACTTCTCAGGATTCTGGCGTACCGTTCCTGTCTAAAATC CCTTTAATCGGCCTCCTGTTTAGCTCCCGCTCTGATTCTAACGAGGAAAGCACGTTAT ACGTGCTCGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGC GGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGC TCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTC TAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCA AAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTT TTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGG AACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATT TCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAAC AAAATATTAACGTTTACAATTTAAATATTTGCTTATACAATCTTCCTGTTTTTGGGGC TTTTCTGATTATCAACCGGGGTACATATGATTGACATGCTAGTTTTACGATTACCGTT CATCGATTCTCTTGTTTGCTCCAGACTCTCAGGCAATGACCTGATAGCCTTTGTAGAG ACCTCTCAAAAATAGCTACCCTCTCCGGCATGAATTTATCAGCTAGAACGGTTGAAT ATCATATTGATGGTGATTTGACTGTCTCCGGCCTTTCTCACCCGTTTGAATCTTTACC TACACATTACTCAGGCATTGCATTTAAAATATATGAGGGTTCTAAAAATTTTTATCCT TGCGTTGAAATAAAGGCTTCTCCCGCAAAAGTATTACAGGGTCATAATGTTTTTGGT ACAACCGATTTAGCTTTATGCTCTGAGGCTTTATTGCTTAATTTTGCTAATTCTTTGC CTTGCCTGTATGATTTATTGGATGTTGCAATTCCTGATGCGGTATTTTCTCCTTACGC ATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGC CGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGG CTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCA TGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTG ATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTG GCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTC AAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAA AAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCA TTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAA GATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGAT CCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCT GCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCG CATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCT TACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATA ACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCT TTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTG AATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAAC
AACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATT AATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCC GGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTAT CATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGAC GGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCT CACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTG ATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCT CATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGA AAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAA ACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAAC TCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCT AGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCT CGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTAC CGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGG GGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATAC CTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACA GGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGG GGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCG TCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACG CGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCG TTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTC GCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCG CCCAATACGCAAAC
Sequence CWU
1
818332DNAadeno-associated virus 2 1cgcctctccc cgcgcgttgg ccgattcatt
aatgcagaat tcccatcatc aataatatac 60cttattttgg attgaagcca atatgataat
gagggggtgg agtttgtgac gtggcgcggg 120gcgtgggaac ggggcgggtg acgtagtagc
tctagaggtc ctgtattaga ggtcacgtga 180gtgttttgcg acattttgcg acaccatgtg
gtcacgctgg gtatttaagc ccgagtgagc 240acgcagggtc tccattttga agcgggaggt
ttgaacgcgc agccaccacg gcggggtttt 300acgagattgt gattaaggtc cccagcgacc
ttgacgagca tctgcccggc atttctgaca 360gctttgtgaa ctgggtggcc gagaaggaat
gggagttgcc gccagattct gacatggatc 420tgaatctgat tgagcaggca cccctgaccg
tggccgagaa gctgcagcgc gactttctga 480cggaatggcg ccgtgtgagt aaggccccgg
aggccctttt ctttgtgcaa tttgagaagg 540gagagagcta cttccacatg cacgtgctcg
tggaaaccac cggggtgaaa tccatggttt 600tgggacgttt cctgagtcag attcgcgaaa
aactgattca gagaatttac cgcgggatcg 660agccgacttt gccaaactgg ttcgcggtca
caaagaccag aaatggcgcc ggaggcggga 720acaaggtggt ggatgagtgc tacatcccca
attacttgct ccccaaaacc cagcctgagc 780tccagtgggc gtggactaat atggaacagt
atttaagcgc ctgtttgaat ctcacggagc 840gtaaacggtt ggtggcgcag catctgacgc
acgtgtcgca gacgcaggag cagaacaaag 900agaatcagaa tcccaattct gatgcgccgg
tgatcagatc aaaaacttca gccaggtaca 960tggagctggt cgggtggctc gtggacaagg
ggattacctc ggagaagcag tggatccagg 1020aggaccaggc ctcatacatc tccttcaatg
cggcctccaa ctcgcggtcc caaatcaagg 1080ctgccttgga caatgcggga aagattatga
gcctgactaa aaccgccccc gactacctgg 1140tgggccagca gcccgtggag gacatttcca
gcaatcggat ttataaaatt ttggaactaa 1200acgggtacga tccccaatat gcggcttccg
tctttctggg atgggccacg aaaaagttcg 1260gcaagaggaa caccatctgg ctgtttgggc
ctgcaactac cgggaagacc aacatcgcgg 1320aggccatagc ccacactgtg cccttctacg
ggtgcgtaaa ctggaccaat gagaactttc 1380ccttcaacga ctgtgtcgac aagatggtga
tctggtggga ggaggggaag atgaccgcca 1440aggtcgtgga gtcggccaaa gccattctcg
gaggaagcaa ggtgcgcgtg gaccagaaat 1500gcaagtcctc ggcccagata gacccgactc
ccgtgatcgt cacctccaac accaacatgt 1560gcgccgtgat tgacgggaac tcaacgacct
tcgaacacca gcagccgttg caagaccgga 1620tgttcaaatt tgaactcacc cgccgtctgg
atcatgactt tgggaaggtc accaagcagg 1680aagtcaaaga ctttttccgg tgggcaaagg
atcacgtggt tgaggtggag catgaattct 1740acgtcaaaaa gggtggagcc aagaaaagac
ccgcccccag tgacgcagat ataagtgagc 1800ccaaacgggt gcgcgagtca gttgcgcagc
catcgacgtc agacgcggaa gcttcgatca 1860actacgcaga caggtaccaa aacaaatgtt
ctcgtcacgt gggcatgaat ctgatgctgt 1920ttccctgcag acaatgcgag agaatgaatc
agaattcaaa tatctgcttc actcacggac 1980agaaagactg tttagagtgc tttcccgtgt
cagaatctca acccgtttct gtcgtcaaaa 2040aggcgtatca gaaactgtgc tacattcatc
atatcatggg aaaggtgcca gacgcttgca 2100ctgcctgcga tctggtcaat gtggatttgg
atgactgcat ctttgaacaa taaatgattt 2160aaatcaggta tggctgccga tggttatctt
ccagattggc tcgaggacac tctctctgaa 2220ggaataagac agtggtggaa gctcaaacct
ggcccaccac caccaaagcc cgcagagcgg 2280cataaggacg acagcagggg tcttgtgctt
cctgggtaca agtacctcgg acccttcaac 2340ggactcgaca agggagagcc ggtcaacgag
gcagacgccg cggccctcga gcacgacaaa 2400gcctacgacc ggcagctcga cagcggagac
aacccgtacc tcaagtacaa ccacgccgac 2460gcggagtttc aggagcgcct taaagaagat
acgtcttttg ggggcaacct cggacgagca 2520gtcttccagg cgaaaaagag ggttcttgaa
cctctgggcc tggttgagga acctgttaag 2580acggctccgg gaaaaaagag gccggtagag
cactctcctg tggagccaga ctcctcctcg 2640ggaaccggaa aggcgggcca gcagcctgca
agaaaaagat tgaattttgg tcagactgga 2700gacgcagact cagtacctga cccccagcct
ctcggacagc caccagcagc cccctctggt 2760ctgggaacta atacgatggc tacaggcagt
ggcgcaccaa tggcagacaa taacgagggc 2820gccgacggag tgggtaattc ctcgggaaat
tggcattgcg attccacatg gatgggcgac 2880agagtcatca ccaccagcac ccgaacctgg
gccctgccca cctacaacaa ccacctctac 2940aaacaaattt ccagccaatc aggagcctcg
aacgacaatc actactttgg ctacagcacc 3000ccttgggggt attttgactt caacagattc
cactgccact tttcaccacg tgactggcaa 3060agactcatca acaacaactg gggattccga
cccaagagac tcaacttcaa gctctttaac 3120attcaagtca aagaggtcac gcagaatgac
ggtacgacga cgattgccaa taaccttacc 3180agcacggttc aggtgtttac tgactcggag
taccagctcc cgtacgtcct cggctcggcg 3240catcaaggat gcctcccgcc gttcccagca
gacgtcttca tggtgccaca gtatggatac 3300ctcaccctga acaacgggag tcaggcagta
ggacgctctt cattttactg cctggagtac 3360tttccttctc agatgctgcg taccggaaac
aactttacct tcagctacac ttttgaggac 3420gttcctttcc acagcagcta cgctcacagc
cagagtctgg accgtctcat gaatcctctc 3480atcgaccagt acctgtatta cttgagcaga
acaaacactc caagtggaac caccacgcag 3540tcaaggcttc agttttctca ggccggagcg
agtgacattc gggaccagtc taggaactgg 3600cttcctggac cctgttaccg ccagcagcga
gtatcaaaga catctgcgga taacaacaac 3660agtgaatact cgtggactgg agctaccaag
taccacctca atggcagaga ctctctggtg 3720aatccgggcc cggccatggc aagccacaag
gacgatgaag aaaagttttt tcctcagagc 3780ggggttctca tctttgggaa gcaaggctca
gagaaaacaa atgtggacat tgaaaaggtc 3840atgattacag acgaagagga aatcaggaca
accaatcccg tggctacgga gcagtatggt 3900tctgtatcta ccaacctcca gagaggcaac
agacaagcag ctaccgcaga tgtcaacaca 3960caaggcgttc ttccaggcat ggtctggcag
gacagagatg tgtaccttca ggggcccatc 4020tgggcaaaga ttccacacac ggacggacat
tttcacccct ctcccctcat gggtggattc 4080ggacttaaac accctcctcc acagattctc
atcaagaaca ccccggtacc tgcgaatcct 4140tcgaccacct tcagtgcggc aaagtttgct
tccttcatca cacagtactc cacgggacag 4200gtcagcgtgg agatcgagtg ggagctgcag
aaggaaaaca gcaaacgctg gaatcccgaa 4260attcagtaca cttccaacta caacaagtct
gttaatgtgg actttactgt ggacactaat 4320ggcgtgtatt cagagcctcg ccccattggc
accagatacc tgactcgtaa tctgtaattg 4380cttgttaatc aataaaccgt ttaattcgtt
tcagttgaac tttggtctct gcgtatttct 4440ttcttatcta gtttccatgc tctagaggtc
ctgtattaga ggtcacgtga gtgttttgcg 4500acattttgcg acaccatgtg gtcacgctgg
gtatttaagc ccgagtgagc acgcagggtc 4560tccattttga agcgggaggt ttgaacgcgc
agccaccacg gcggggtttt acgagattgt 4620gattaaggtc cccagcgacc ttgacgagca
tctgcccggc atttctgaca gctttgtgaa 4680ctgggtggcc gagaaggaat gggagttgcc
gccagattct gacatggatc tgaatctgat 4740tgagcaggca cccctgaccg tggccgagaa
gctgcatcgc tggcgtaata gcgaagaggc 4800ccgcaccgat cgcccttccc aacagttgcg
cagcctgaat ggcgaatggc gattccgttg 4860caatggctgg cggtaatatt gttctggata
ttaccagcaa ggccgatagt ttgagttctt 4920ctactcaggc aagtgatgtt attactaatc
aaagaagtat tgcgacaacg gttaatttgc 4980gtgatggaca gactctttta ctcggtggcc
tcactgatta taaaaacact tctcaggatt 5040ctggcgtacc gttcctgtct aaaatccctt
taatcggcct cctgtttagc tcccgctctg 5100attctaacga ggaaagcacg ttatacgtgc
tcgtcaaagc aaccatagta cgcgccctgt 5160agcggcgcat taagcgcggc gggtgtggtg
gttacgcgca gcgtgaccgc tacacttgcc 5220agcgccctag cgcccgctcc tttcgctttc
ttcccttcct ttctcgccac gttcgccggc 5280tttccccgtc aagctctaaa tcgggggctc
cctttagggt tccgatttag tgctttacgg 5340cacctcgacc ccaaaaaact tgattagggt
gatggttcac gtagtgggcc atcgccctga 5400tagacggttt ttcgcccttt gacgttggag
tccacgttct ttaatagtgg actcttgttc 5460caaactggaa caacactcaa ccctatctcg
gtctattctt ttgatttata agggattttg 5520ccgatttcgg cctattggtt aaaaaatgag
ctgatttaac aaaaatttaa cgcgaatttt 5580aacaaaatat taacgtttac aatttaaata
tttgcttata caatcttcct gtttttgggg 5640cttttctgat tatcaaccgg ggtacatatg
attgacatgc tagttttacg attaccgttc 5700atcgattctc ttgtttgctc cagactctca
ggcaatgacc tgatagcctt tgtagagacc 5760tctcaaaaat agctaccctc tccggcatga
atttatcagc tagaacggtt gaatatcata 5820ttgatggtga tttgactgtc tccggccttt
ctcacccgtt tgaatcttta cctacacatt 5880actcaggcat tgcatttaaa atatatgagg
gttctaaaaa tttttatcct tgcgttgaaa 5940taaaggcttc tcccgcaaaa gtattacagg
gtcataatgt ttttggtaca accgatttag 6000ctttatgctc tgaggcttta ttgcttaatt
ttgctaattc tttgccttgc ctgtatgatt 6060tattggatgt tgcaattcct gatgcggtat
tttctcctta cgcatctgtg cggtatttca 6120caccgcatat ggtgcactct cagtacaatc
tgctctgatg ccgcatagtt aagccagccc 6180cgacacccgc caacacccgc tgacgcgccc
tgacgggctt gtctgctccc ggcatccgct 6240tacagacaag ctgtgaccgt ctccgggagc
tgcatgtgtc agaggttttc accgtcatca 6300ccgaaacgcg cgagacgaaa gggcctcgtg
atacgcctat ttttataggt taatgtcatg 6360ataataatgg tttcttagac gtcaggtggc
acttttcggg gaaatgtgcg cggaacccct 6420atttgtttat ttttctaaat acattcaaat
atgtatccgc tcatgagaca ataaccctga 6480taaatgcttc aataatattg aaaaaggaag
agtatgagta ttcaacattt ccgtgtcgcc 6540cttattccct tttttgcggc attttgcctt
cctgtttttg ctcacccaga aacgctggtg 6600aaagtaaaag atgctgaaga tcagttgggt
gcacgagtgg gttacatcga actggatctc 6660aacagcggta agatccttga gagttttcgc
cccgaagaac gttttccaat gatgagcact 6720tttaaagttc tgctatgtgg cgcggtatta
tcccgtattg acgccgggca agagcaactc 6780ggtcgccgca tacactattc tcagaatgac
ttggttgagt actcaccagt cacagaaaag 6840catcttacgg atggcatgac agtaagagaa
ttatgcagtg ctgccataac catgagtgat 6900aacactgcgg ccaacttact tctgacaacg
atcggaggac cgaaggagct aaccgctttt 6960ttgcacaaca tgggggatca tgtaactcgc
cttgatcgtt gggaaccgga gctgaatgaa 7020gccataccaa acgacgagcg tgacaccacg
atgcctgtag caatggcaac aacgttgcgc 7080aaactattaa ctggcgaact acttactcta
gcttcccggc aacaattaat agactggatg 7140gaggcggata aagttgcagg accacttctg
cgctcggccc ttccggctgg ctggtttatt 7200gctgataaat ctggagccgg tgagcgtggg
tctcgcggta tcattgcagc actggggcca 7260gatggtaagc cctcccgtat cgtagttatc
tacacgacgg ggagtcaggc aactatggat 7320gaacgaaata gacagatcgc tgagataggt
gcctcactga ttaagcattg gtaactgtca 7380gaccaagttt actcatatat actttagatt
gatttaaaac ttcattttta atttaaaagg 7440atctaggtga agatcctttt tgataatctc
atgaccaaaa tcccttaacg tgagttttcg 7500ttccactgag cgtcagaccc cgtagaaaag
atcaaaggat cttcttgaga tccttttttt 7560ctgcgcgtaa tctgctgctt gcaaacaaaa
aaaccaccgc taccagcggt ggtttgtttg 7620ccggatcaag agctaccaac tctttttccg
aaggtaactg gcttcagcag agcgcagata 7680ccaaatactg tccttctagt gtagccgtag
ttaggccacc acttcaagaa ctctgtagca 7740ccgcctacat acctcgctct gctaatcctg
ttaccagtgg ctgctgccag tggcgataag 7800tcgtgtctta ccgggttgga ctcaagacga
tagttaccgg ataaggcgca gcggtcgggc 7860tgaacggggg gttcgtgcac acagcccagc
ttggagcgaa cgacctacac cgaactgaga 7920tacctacagc gtgagctatg agaaagcgcc
acgcttcccg aagggagaaa ggcggacagg 7980tatccggtaa gcggcagggt cggaacagga
gagcgcacga gggagcttcc agggggaaac 8040gcctggtatc tttatagtcc tgtcgggttt
cgccacctct gacttgagcg tcgatttttg 8100tgatgctcgt caggggggcg gagcctatgg
aaaaacgcca gcaacgcggc ctttttacgg 8160ttcctggcct tttgctggcc ttttgctcac
atgttctttc ctgcgttatc ccctgattct 8220gtggataacc gtattaccgc ctttgagtga
gctgataccg ctcgccgcag ccgaacgacc 8280gagcgcagcg agtcagtgag cgaggaagcg
gaagagcgcc caatacgcaa ac 833228356DNAadeno-associated virus 2
2cgcctctccc cgcgcgttgg ccgattcatt aatgcagaat tcccatcatc aataatatac
60cttattttgg attgaagcca atatgataat gagggggtgg agtttgtgac gtggcgcggg
120gcgtgggaac ggggcgggtg acgtagtagc tctagaggtc ctgtattaga ggtcacgtga
180gtgttttgcg acattttgcg acaccatgtg gtcacgctgg gtatttaagc ccgagtgagc
240acgcagggtc tccattttga agcgggaggt ttgaacgcgc agccaccacg gcggggtttt
300acgagattgt gattaaggtc cccagcgacc ttgacgagca tctgcccggc atttctgaca
360gctttgtgaa ctgggtggcc gagaaggaat gggagttgcc gccagattct gacatggatc
420tgaatctgat tgagcaggca cccctgaccg tggccgagaa gctgcagcgc gactttctga
480cggaatggcg ccgtgtgagt aaggccccgg aggccctttt ctttgtgcaa tttgagaagg
540gagagagcta cttccacatg cacgtgctcg tggaaaccac cggggtgaaa tccatggttt
600tgggacgttt cctgagtcag attcgcgaaa aactgattca gagaatttac cgcgggatcg
660agccgacttt gccaaactgg ttcgcggtca caaagaccag aaatggcgcc ggaggcggga
720acaaggtggt ggatgagtgc tacatcccca attacttgct ccccaaaacc cagcctgagc
780tccagtgggc gtggactaat atggaacagt atttaagcgc ctgtttgaat ctcacggagc
840gtaaacggtt ggtggcgcag catctgacgc acgtgtcgca gacgcaggag cagaacaaag
900agaatcagaa tcccaattct gatgcgccgg tgatcagatc aaaaacttca gccaggtaca
960tggagctggt cgggtggctc gtggacaagg ggattacctc ggagaagcag tggatccagg
1020aggaccaggc ctcatacatc tccttcaatg cggcctccaa ctcgcggtcc caaatcaagg
1080ctgccttgga caatgcggga aagattatga gcctgactaa aaccgccccc gactacctgg
1140tgggccagca gcccgtggag gacatttcca gcaatcggat ttataaaatt ttggaactaa
1200acgggtacga tccccaatat gcggcttccg tctttctggg atgggccacg aaaaagttcg
1260gcaagaggaa caccatctgg ctgtttgggc ctgcaactac cgggaagacc aacatcgcgg
1320aggccatagc ccacactgtg cccttctacg ggtgcgtaaa ctggaccaat gagaactttc
1380ccttcaacga ctgtgtcgac aagatggtga tctggtggga ggaggggaag atgaccgcca
1440aggtcgtgga gtcggccaaa gccattctcg gaggaagcaa ggtgcgcgtg gaccagaaat
1500gcaagtcctc ggcccagata gacccgactc ccgtgatcgt cacctccaac accaacatgt
1560gcgccgtgat tgacgggaac tcaacgacct tcgaacacca gcagccgttg caagaccgga
1620tgttcaaatt tgaactcacc cgccgtctgg atcatgactt tgggaaggtc accaagcagg
1680aagtcaaaga ctttttccgg tgggcaaagg atcacgtggt tgaggtggag catgaattct
1740acgtcaaaaa gggtggagcc aagaaaagac ccgcccccag tgacgcagat ataagtgagc
1800ccaaacgggt gcgcgagtca gttgcgcagc catcgacgtc agacgcggaa gcttcgatca
1860actacgcaga caggtaccaa aacaaatgtt ctcgtcacgt gggcatgaat ctgatgctgt
1920ttccctgcag acaatgcgag agaatgaatc agaattcaaa tatctgcttc actcacggac
1980agaaagactg tttagagtgc tttcccgtgt cagaatctca acccgtttct gtcgtcaaaa
2040aggcgtatca gaaactgtgc tacattcatc atatcatggg aaaggtgcca gacgcttgca
2100ctgcctgcga tctggtcaat gtggatttgg atgactgcat ctttgaacaa taaatgattt
2160aaatcaggta tggctgccga tggttatctt ccagattggc tcgaggacac tctctctgaa
2220ggaataagac agtggtggaa gctcaaacct ggcccaccac caccaaagcc cgcagagcgg
2280cataaggacg acagcagggg tcttgtgctt cctgggtaca agtacctcgg acccttcaac
2340ggactcgaca agggagagcc ggtcaacgag gcagacgccg cggccctcga gcacgacaaa
2400gcctacgacc ggcagctcga cagcggagac aacccgtacc tcaagtacaa ccacgccgac
2460gcggagtttc aggagcgcct taaagaagat acgtcttttg ggggcaacct cggacgagca
2520gtcttccagg cgaaaaagag ggttcttgaa cctctgggcc tggttgagga acctgttaag
2580acggatgatg atgatgatga tgacgacgct ccgggaaaaa agaggccggt agagcactct
2640cctgtggagc cagactcctc ctcgggaacc ggaaaggcgg gccagcagcc tgcaagaaaa
2700agattgaatt ttggtcagac tggagacgca gactcagtac ctgaccccca gcctctcgga
2760cagccaccag cagccccctc tggtctggga actaatacga tggctacagg cagtggcgca
2820ccaatggcag acaataacga gggcgccgac ggagtgggta attcctcggg aaattggcat
2880tgcgattcca catggatggg cgacagagtc atcaccacca gcacccgaac ctgggccctg
2940cccacctaca acaaccacct ctacaaacaa atttccagcc aatcaggagc ctcgaacgac
3000aatcactact ttggctacag caccccttgg gggtattttg acttcaacag attccactgc
3060cacttttcac cacgtgactg gcaaagactc atcaacaaca actggggatt ccgacccaag
3120agactcaact tcaagctctt taacattcaa gtcaaagagg tcacgcagaa tgacggtacg
3180acgacgattg ccaataacct taccagcacg gttcaggtgt ttactgactc ggagtaccag
3240ctcccgtacg tcctcggctc ggcgcatcaa ggatgcctcc cgccgttccc agcagacgtc
3300ttcatggtgc cacagtatgg atacctcacc ctgaacaacg ggagtcaggc agtaggacgc
3360tcttcatttt actgcctgga gtactttcct tctcagatgc tgcgtaccgg aaacaacttt
3420accttcagct acacttttga ggacgttcct ttccacagca gctacgctca cagccagagt
3480ctggaccgtc tcatgaatcc tctcatcgac cagtacctgt attacttgag cagaacaaac
3540actccaagtg gaaccaccac gcagtcaagg cttcagtttt ctcaggccgg agcgagtgac
3600attcgggacc agtctaggaa ctggcttcct ggaccctgtt accgccagca gcgagtatca
3660aagacatctg cggataacaa caacagtgaa tactcgtgga ctggagctac caagtaccac
3720ctcaatggca gagactctct ggtgaatccg ggcccggcca tggcaagcca caaggacgat
3780gaagaaaagt tttttcctca gagcggggtt ctcatctttg ggaagcaagg ctcagagaaa
3840acaaatgtgg acattgaaaa ggtcatgatt acagacgaag aggaaatcag gacaaccaat
3900cccgtggcta cggagcagta tggttctgta tctaccaacc tccagagagg caacagacaa
3960gcagctaccg cagatgtcaa cacacaaggc gttcttccag gcatggtctg gcaggacaga
4020gatgtgtacc ttcaggggcc catctgggca aagattccac acacggacgg acattttcac
4080ccctctcccc tcatgggtgg attcggactt aaacaccctc ctccacagat tctcatcaag
4140aacaccccgg tacctgcgaa tccttcgacc accttcagtg cggcaaagtt tgcttccttc
4200atcacacagt actccacggg acaggtcagc gtggagatcg agtgggagct gcagaaggaa
4260aacagcaaac gctggaatcc cgaaattcag tacacttcca actacaacaa gtctgttaat
4320gtggacttta ctgtggacac taatggcgtg tattcagagc ctcgccccat tggcaccaga
4380tacctgactc gtaatctgta attgcttgtt aatcaataaa ccgtttaatt cgtttcagtt
4440gaactttggt ctctgcgtat ttctttctta tctagtttcc atgctctaga ggtcctgtat
4500tagaggtcac gtgagtgttt tgcgacattt tgcgacacca tgtggtcacg ctgggtattt
4560aagcccgagt gagcacgcag ggtctccatt ttgaagcggg aggtttgaac gcgcagccac
4620cacggcgggg ttttacgaga ttgtgattaa ggtccccagc gaccttgacg agcatctgcc
4680cggcatttct gacagctttg tgaactgggt ggccgagaag gaatgggagt tgccgccaga
4740ttctgacatg gatctgaatc tgattgagca ggcacccctg accgtggccg agaagctgca
4800tcgctggcgt aatagcgaag aggcccgcac cgatcgccct tcccaacagt tgcgcagcct
4860gaatggcgaa tggcgattcc gttgcaatgg ctggcggtaa tattgttctg gatattacca
4920gcaaggccga tagtttgagt tcttctactc aggcaagtga tgttattact aatcaaagaa
4980gtattgcgac aacggttaat ttgcgtgatg gacagactct tttactcggt ggcctcactg
5040attataaaaa cacttctcag gattctggcg taccgttcct gtctaaaatc cctttaatcg
5100gcctcctgtt tagctcccgc tctgattcta acgaggaaag cacgttatac gtgctcgtca
5160aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg
5220cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct
5280tcctttctcg ccacgttcgc cggctttccc cgtcaagctc taaatcgggg gctcccttta
5340gggttccgat ttagtgcttt acggcacctc gaccccaaaa aacttgatta gggtgatggt
5400tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg
5460ttctttaata gtggactctt gttccaaact ggaacaacac tcaaccctat ctcggtctat
5520tcttttgatt tataagggat tttgccgatt tcggcctatt ggttaaaaaa tgagctgatt
5580taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt ttacaattta aatatttgct
5640tatacaatct tcctgttttt ggggcttttc tgattatcaa ccggggtaca tatgattgac
5700atgctagttt tacgattacc gttcatcgat tctcttgttt gctccagact ctcaggcaat
5760gacctgatag cctttgtaga gacctctcaa aaatagctac cctctccggc atgaatttat
5820cagctagaac ggttgaatat catattgatg gtgatttgac tgtctccggc ctttctcacc
5880cgtttgaatc tttacctaca cattactcag gcattgcatt taaaatatat gagggttcta
5940aaaattttta tccttgcgtt gaaataaagg cttctcccgc aaaagtatta cagggtcata
6000atgtttttgg tacaaccgat ttagctttat gctctgaggc tttattgctt aattttgcta
6060attctttgcc ttgcctgtat gatttattgg atgttgcaat tcctgatgcg gtattttctc
6120cttacgcatc tgtgcggtat ttcacaccgc atatggtgca ctctcagtac aatctgctct
6180gatgccgcat agttaagcca gccccgacac ccgccaacac ccgctgacgc gccctgacgg
6240gcttgtctgc tcccggcatc cgcttacaga caagctgtga ccgtctccgg gagctgcatg
6300tgtcagaggt tttcaccgtc atcaccgaaa cgcgcgagac gaaagggcct cgtgatacgc
6360ctatttttat aggttaatgt catgataata atggtttctt agacgtcagg tggcactttt
6420cggggaaatg tgcgcggaac ccctatttgt ttatttttct aaatacattc aaatatgtat
6480ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtatg
6540agtattcaac atttccgtgt cgcccttatt cccttttttg cggcattttg ccttcctgtt
6600tttgctcacc cagaaacgct ggtgaaagta aaagatgctg aagatcagtt gggtgcacga
6660gtgggttaca tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa
6720gaacgttttc caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt
6780attgacgccg ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt
6840gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc
6900agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga
6960ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac tcgccttgat
7020cgttgggaac cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct
7080gtagcaatgg caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc
7140cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg
7200gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc
7260ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt tatctacacg
7320acggggagtc aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcctca
7380ctgattaagc attggtaact gtcagaccaa gtttactcat atatacttta gattgattta
7440aaacttcatt tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc
7500aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa
7560ggatcttctt gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca
7620ccgctaccag cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta
7680actggcttca gcagagcgca gataccaaat actgtccttc tagtgtagcc gtagttaggc
7740caccacttca agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca
7800gtggctgctg ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta
7860ccggataagg cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag
7920cgaacgacct acaccgaact gagataccta cagcgtgagc tatgagaaag cgccacgctt
7980cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc
8040acgagggagc ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac
8100ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac
8160gccagcaacg cggccttttt acggttcctg gccttttgct ggccttttgc tcacatgttc
8220tttcctgcgt tatcccctga ttctgtggat aaccgtatta ccgcctttga gtgagctgat
8280accgctcgcc gcagccgaac gaccgagcgc agcgagtcag tgagcgagga agcggaagag
8340cgcccaatac gcaaac
8356324DNAadeno-associated virus 2 3gatgatgatg atgatgatga cgac
24460DNAadeno-associated virus 2
4gaggaacctg ttaagacgga tgatgatgat gatgatgacg acgctccggg aaaaaagagg
60520DNAadeno-associated virus 2 5atctcaaccc gtttctgtcg
20619DNAadeno-associated virus 2
6gcgtctccag tctgaccaa
19728DNAadeno-associated virus 2 7acagggccat tgatggcctc aacctcct
28830DNAadeno-associated virus 2
8gcttcgtgtg gtcttccaga ttgtgagttg 30
User Contributions:
Comment about this patent or add new information about this topic: