Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: METHOD FOR PRODUCTION OF PLANT IMPARTED WITH STRESS TOLERANCE AND USE THEREOF

Inventors:  Masaru Takagi (Ibaraki, JP)  Tomomi Mito (Ibaraki, JP)  Kyoko Matsui (Ibaraki, JP)
Assignees:  National Institute of Advanced Industrial Science and Technology  GreenSogna, Inc.
IPC8 Class: AA01H100FI
USPC Class: 800278
Class name: Multicellular living organisms and unmodified parts thereof and related processes method of introducing a polynucleotide molecule into or rearrangement of genetic material within a plant or plant part
Publication date: 2011-08-25
Patent application number: 20110209244





Sign up to receive free email alerts when patent applications with chosen keywords are published SIGN UP

Abstract:

The present invention provides a method for producing a plant with a stress tolerance, comprising the step of inhibiting, in a plant, a function of a first polypeptide including an amino acid sequence represented by any one of SEQ ID NOS: 2, 4, 6, 8, and 10. This enables developing a new technique capable of producing a plant with a stress tolerance such as a salt tolerance and a high osmotic pressure tolerance.

Claims:

1. A method for producing a plant with a stress tolerance, comprising the step of inhibiting, in a plant, a function of a first polypeptide including an amino acid sequence represented by any one of SEQ ID NOS: 2, 4, 6, 8, and 10.

2. The method as set forth in claim 1, wherein the step of inhibiting a function of a first polypeptide is carried out in such a manner that a fusion protein of the first polypeptide and a second polypeptide which converts any transcription factor into a transcription inhibiting factor is produced in the plant.

3. The method as set forth in claim 1, wherein the step of inhibiting a function of a first polypeptide is carried out in such a manner that expression of the first polypeptide is inhibited in the plant.

4. The method as set forth in claim 1, wherein the stress tolerance is a salt tolerance and/or a high osmotic pressure tolerance.

5. A plant, produced by a method as set forth in claim 1.

6. The plant as set forth in claim 5, selected from the group consisting of a grown plant individual, a plant cell, a plant tissue, a callus, and a seed.

7. A kit for producing a plant with a stress tolerance, comprising: a first polynucleotide including a base sequence represented by any one of SEQ ID NOS: 1, 3, 5, 7, and 9; and a second polynucleotide encoding a functional peptide which converts any transcription factor into a transcription inhibiting factor.

8. The kit as set forth in claim 7, wherein the first polynucleotide and the second polynucleotide are bound to each other in frame.

9. A kit for producing a plant with a stress tolerance, comprising: an oligonucleotide set including any one of a first primer set (SEQ ID NOS: 11 and 12), a second primer set (SEQ ID NOS: 13 and 14), a third primer set (SEQ ID NOS: 15 and 16), a fourth primer set (SEQ ID NOS: 17 and 18), and a fifth primer set (SEQ ID NOS: 19 and 20); and a polynucleotide encoding a functional peptide which converts any transcription factor into a transcription inhibiting factor.

10. The kit as set forth in claim 7, further comprising an expression vector for expressing a target polypeptide in a plant.

11. The kit as set forth in claim 10, further comprising reagents for introducing the expression vector into a plant cell.

12. A method for imparting a plant with a stress tolerance, comprising the step of inhibiting, in a plant, a function of a polypeptide including an amino acid sequence represented by any one of SEQ ID NOS: 2, 4, 6, 8, and 10.

13. A kit for imparting a plant with a stress tolerance, comprising: a first polynucleotide including a base sequence represented by any one of SEQ ID NOS: 1, 3, 5, 7, and 9; and a second polynucleotide encoding a functional peptide which converts any transcription factor into a transcription inhibiting factor.

14. The kit as set forth in claim 13, wherein the first polynucleotide and the second polynucleotide are bound to each other in frame.

15. A kit for imparting a plant with a stress tolerance, comprising: an oligonucleotide set including any one of a first primer set (SEQ ID NOS: 11 and 12), a second primer set (SEQ ID NOS: 13 and 14), a third primer set (SEQ ID NOS: 15 and 16), a fourth primer set (SEQ ID NOS: 17 and 18), and a fifth primer set (SEQ ID NOS: 19 and 20); and a polynucleotide encoding a functional peptide which converts any transcription factor into a transcription inhibiting factor.

16. The kit as set forth in claim 9, further comprising an expression vector for expressing a target polypeptide in a plant.

17. The kit as set forth in claim 16, further comprising reagents for introducing the expression vector into a plant cell.

Description:

TECHNICAL FIELD

[0001] The present invention relates to a new technique for imparting a plant with a stress tolerance. To be more specific, the present invention relates to a method for production of a plant imparted with a salt tolerance and/or a high osmotic pressure tolerance and use thereof.

BACKGROUND ART

[0002] In view of the increase in food production and environment conservation, there has been expected production of plants having a tolerance against environmental stresses such as salt and an osmotic pressure. Researches on plants having a tolerance against environmental stresses have been made so far, and there have been reported isolation of plants having resistant mutation (see Non-patent Literatures 1 and 2 for example) and imparting of tolerance by overexpression (see Non-patent Literatures 3 and 4 for example).

Citation List

[Patent Literatures]

[0003] Patent Literature 1: Japanese Patent Application Publication Tokukai No. 2001-269177 (published on Oct. 2, 2001) [0004] Patent Literature 2: Japanese Patent Application Publication Tokukai No. 2001-269178 (published on Oct. 2, 2001) [0005] Patent Literature 3: Japanese Patent Application Publication Tokukai No. 2001-292776 (published on Oct. 2, 2001) [0006] Patent Literature 4: Japanese Patent Application Publication Tokukai No. 2001-292777 (published on Oct. 23, 2001) [0007] Patent Literature 5: Japanese Patent Application Publication Tokukai No. 2001-269176 (published on Oct. 2, 2001) [0008] Patent Literature 6: Japanese Patent Application Publication Tokukai No. 2001-269179 (published on Oct. 2, 2001) [0009] Patent Literature 7: Japanese Patent Application Publication Tokukai No. 2005-13214 (published on Jan. 20, 2005) [0010] Patent Literature 8: Japanese Patent Application Publication Tokukai No. 2005-27654 (published on Feb. 3, 2005) [0011] Patent Literature 9: Japanese Patent Application Publication Tokukai No. 2005-204573 (published on Aug. 4, 2005) [0012] Patent Literature 10: Japanese Patent Application Publication Tokukai No. 2006-006248 (published on Jan. 12, 2006) [0013] Patent Literature 11: Japanese Patent Application Publication Tokukai No. 2006-020607 (published on Jan. 26, 2006)

[Non-patent Literatures]

[0013] [0014] Non-patent Literature 1: The Plant Cell (1998) 10: 1181-91 [0015] Non-patent Literature 2: FEBS Lett. (2006) 580: 6537-42 [0016] Non-patent Literature 3: Nat. Biotechnol. (1999) 17: 287-91 [0017] Non-patent Literature 4: J. Biol. Chem. (2007) 282: 9260-8 [0018] Non-patent Literature 5: The Plant Cell (2001) 13: 1959-1968 [0019] Non-patent Literature 6: FEBS Letters (2002) 514: 351-354 [0020] Non-patent Literature 7: The Plant Cell (2007) 19: 473-484 [0021] Non-patent Literature 8: Plant Physiol. (2003) 132(3): 1415-23 [0022] Non-patent Literature 9: Plant Physiol. (2007) 145: 147-59 [0023] Non-patent Literature 10: The Plant Cell (2000) 12(3): 393-404

SUMMARY OF INVENTION

Technical Problem

[0024] However, most of the resistant mutations shown in Non-patent Literatures 1 and 2 are recessive traits, and so it is difficult to make practical use of plants having the resistant mutations. Further, imparting of tolerance by overexpression shown in Non-patent Literatures 3 and 4 may have an influence on growth of plants and forms of plants, and so it is difficult to make practical use of plants imparted with a tolerance by overexpression.

[0025] The present invention was made in view of the foregoing problems. An object of the present invention is to provide a technique of easily producing a plant imparted with a stress tolerance.

Solution to Problem

[0026] The inventors of the present invention have so far developed a technique of converting a transcription factor into a transcription inhibiting factor. This technique is useful for analyzing functions of various plant genes in vivo. In this technique, any gene is regarded as a target (target gene), for example, the effecter plasmid is introduced into plant cells so as to inhibit transcription of the target gene, resulting in inhibition of the function of the target gene in the plant to which the effecter plasmid has been introduced. Consequently, observing the phenotype expressed in the transgenic plant enables analysis of the function of the target gene. As for functional peptide usable in such a technique, see Patent Literatures 1-8 and Non-patent Literatures 5-6 etc. These documents are incorporated herein for reference.

[0027] The inventors of the present invention have used the above technique and found that a transcription factor family (TCP family) protein is essential for normal morphogenesis of a flower and inhibiting the function of this protein enables effectively changing the shape of the flower (see Patent Literatures 9-11 and Non-patent Literature 7). The inventors of the present invention have further studied in order to clarify TCP family-related signaling for morphogenesis of leaves and found various genes whose expressions increase by inhibiting the function of the TCP family protein.

[0028] The various genes whose expressions increase by inhibiting the function of the TCP family protein include a transcription factor whose function was unknown. The inventors of the present invention have further studied to find what role this transcription factor plays in morphogenesis of leaves, and found that this transcription factor is related to a function entirely different from morphogenesis of leaves. Thus, the present invention has been completed.

[0029] A method of the present invention for producing a plant with a stress tolerance includes the step of inhibiting, in a plant, a function of a first polypeptide including an amino acid sequence represented by any one of SEQ ID NOS: 2, 4, 6, 8, and 10.

[0030] As described above, the function of the first polypeptide had not been known other than the fact that the first polypeptide is a transcription factor. Further, the function conceivable from the study of TCP family proteins (control of morphogenesis of leaves) and a stress tolerance are not related to each other at all. Thus, a person skilled in the art did not know, and could not have expected, that the first polypeptide is related a stress tolerance.

[0031] It is preferable to arrange the method of the present invention such that the step of inhibiting a function of a first polypeptide is carried out in such a manner that a fusion protein of the first polypeptide and a second polypeptide which converts any transcription factor into a transcription inhibiting factor is produced in the plant.

[0032] The second polypeptide is a functional peptide which was developed by the inventors of the present invention, and has a function of converting any transcription factor into a transcription inhibiting factor. Since such a peptide can be used as a selection marker, it is possible to select a desired plant without using chemical agents. Further, most of resistant mutations isolated so far are recessive traits and it is not easy to make practical use of plants having such resistant mutations. On the other hand, use of the functional peptide enables imparting a resistant trait as a dominant trait, and also enables inducing the resistant trait by a specific promoter. Further, since the resistant trait serves as a dominant trait, the functional peptide is applicable to plants whose gene information is little known.

[0033] The method of the present invention may be arranged such that the step of inhibiting a function of a first polypeptide is carried out in such a manner that expression of the first polypeptide is inhibited in the plant. In this case, the inhibition of the expression of the first polypeptide may be made by a knock-put process or an RNAi process.

[0034] It is preferable to arrange the method of the present invention such that the stress tolerance is a salt tolerance and/or a high osmotic pressure tolerance.

[0035] The plant of the present invention is produced by the above method. It is preferable that the plant of the present invention is selected from the group consisting of a grown plant individual, a plant cell, a plant tissue, a callus, and a seed.

[0036] A kit of the present invention for producing a plant with a stress tolerance includes: a first polynucleotide including a base sequence represented by any one of SEQ ID NOS: 1, 3, 5, 7, and 9; and a second polynucleotide encoding a functional peptide which converts any transcription factor into a transcription inhibiting factor.

[0037] A kit of the present invention for producing a plant with a stress tolerance may include: an oligonucleotide set including any one of a first primer set (SEQ ID NOS: 11 and 12), a second primer set (SEQ ID NOS: 13 and 14), a third primer set (SEQ ID NOS: 15 and 16), a fourth primer set (SEQ ID NOS: 17 and 18), and a fifth primer set (SEQ ID NOS: 19 and 20); and a polynucleotide (second polynucleotide) encoding a functional peptide which converts any transcription factor into a transcription inhibiting factor.

[0038] It is preferable that the kit of the present invention further includes an expression vector for expressing a target polypeptide in a plant. It is more preferable that the kit of the present invention further includes reagents for introducing the expression vector into a plant cell.

[0039] The method of the present invention for producing a plant may be a method for imparting a plant with a stress tolerance. Further, the kit of the present invention may be a kit for imparting a plant with a stress tolerance.

Advantageous Effects of Invention

[0040] The present invention enables imparting a plant with a salt tolerance and an osmotic pressure tolerance. This enables producing a functional plant capable of standing up to salt damage or dryness. This enables producing a desired crop in a wide variety of areas.

BRIEF DESCRIPTION OF DRAWINGS

[0041] FIG. 1

[0042] FIG. 1 shows states of wild type Arabidopsis thaliana and Arabidopsis thaliana expressing a salt-tolerance chimeric repressor, which were three weeks after sowing with various salt concentrations.

[0043] FIG. 2

[0044] FIG. 2 shows states of wild type Arabidopsis thaliana and Arabidopsis thaliana expressing an osmotic pressure-tolerance chimeric repressor, which were three weeks after sowing with various mannitol concentrations.

DESCRIPTION OF EMBODIMENTS

[0045] The present invention provides a method for production of a plant with a stress tolerance. The method of the present invention includes the step of inhibiting a function of a particular transcription factor in a plant.

[0046] In the present invention, "transcription factor (transcription factor etc.)" indicates a transcription factor or a DNA-binding domain of the transcription factor, and is preferably a transcription factor of a plant. "transcription factor" indicates a polypeptide (transcription control factor) which positively or negatively controls transcription or initiation reaction of the transcription, and is preferably a polypeptide which positively controls the transcription or initiation reaction of the transcription.

[0047] The term "polypeptide" used herein is compatible with "peptide" or "protein". The term "fragment" of polypeptide indicates a partial fragment of the polypeptide. The polypeptide according to the present invention may be isolated from a natural source or may be synthesized chemically.

[0048] The term "isolated" polypeptide or protein indicates polypeptide or protein extracted from its natural environment. For example, recombinantly produced polypeptide or protein expressed in a host cell is considered as being isolated, as with natural or recombinant polypeptide or protein which is substantially purified by any proper technique.

[0049] Examples of the "polypeptide" include naturally purified products, chemically synthesized products, and products produced by a recombinant technique from a prokaryote host or a eucaryote host (e.g. bacteria cells, yeast cells, higher plant cells, insect cells, and mammal cells). The "polypeptide" may be glycosylated or non-glycosylated depending on a host used in a recombinant production process. Further, in some cases, the "polypeptide" may contain a modified methionine residue resulting from a start codon as a result of a host-mediated expression process.

[0050] The "polypeptide" may be polypeptide in which amino acids are bound to each other by a peptide bond. Alternatively, the "polypeptide" may be a complex polypeptide including a structure other than polypeptide. Examples of the "structure other than polypeptide" used herein include, but not limited to, glycans and isoprenoid groups.

[0051] The term "polynucleotide" used herein is compatible with "gene", "nucleic acid", or "nucleic acid molecule", and indicates a polymer of nucleotides. The term "base sequence" used herein is compatible with "nucleic acid sequence" or "nucleotide sequence", and is shown as a sequence of deoxyribonucleotides (abbreviated as A, G, C, and T).

[0052] Polynucleotide can exist in the form of RNA (e.g. mRNA) or in the form of DNA (e.g. cDNA or genome DNA). DNA may be double-stranded or single-stranded. The single-stranded DNA or RNA may be a code strand (also known as a sense strand) or may be a non-code strand (also known as anti-sense strand).

[0053] The expression "inhibit the function of a transcription factor" indicates causing the function of the transcription factor as a transcription control factor to be lost. Examples of the loss of the transcription control factor include loss of an interactional function between proteins, loss of a DNA binding function, loss of a transcription control function and/or inversion of the transcription control function. A person skilled in the art who reads the present specification easily understands that a transcription factor having lost these functions is inhibited from realizing these functions. As described above, inhibiting the function of a transcription factor suppresses expression of a target gene which is a target of the transcription factor. Alternatively, inhibiting the function of a transcription factor suppresses expression of a downstream gene which is positioned downstream of the transcription factor, resulting in subdual of the function of the downstream gene. That is, in the present specification, the expression "inhibit the function of a transcription factor" is compatible with "suppress expression of a target gene which is a target of the transcription factor", "suppress expression of a downstream gene which is positioned downstream of the transcription factor", and "suppress the function of the downstream gene".

[0054] A method for inhibiting the function of a transcription factor may be inhibition of expression of a gene or protein corresponding to a target transcription factor in a plant, or may be inhibition of synthesis of RNA or inhibition of synthesis of protein. A method for inhibiting expression of protein may be a technique well known in the art. Examples of the technique include, but not limited to, a knock-out process and an RNAi process.

[0055] As described above, the inventors of the present invention have already developed a technique of converting a transcription factor into a transcription inhibiting factor. The "transcription inhibiting factor" used herein is compatible with "chimeric repressor", and is a fusion protein including a "transcription factor" and a "functional peptide". That is, in the present invention, in order to inhibit the function of a transcription factor, a fusion protein (chimeric repressor) of a target transcription factor and a functional peptide which converts any transcription factor into a transcription inhibiting factor may be expressed in a plant. In order to express a target protein in a plant, a gene encoding the protein is introduced into the plant. As described above, application of the chimeric repressor technique enables subduing expression of a target gene which is a target of a transcription factor. Alternatively, application of the chimeric repressor technique enables subduing expression of a downstream gene which is positioned downstream of the transcription factor, resulting in subdual of the function of the downstream gene.

[0056] In the present invention, the term "include" indicates substantially encompassing components, and may be replaced with "made of", but not limited to "consist of". That is, the term "made of" also indicates encompassing additional components.

[0057] The wording "a gene is introduced" used herein indicates that a gene is introduced into a target cell (host cell) by a well-known genetic engineering process (gene manipulation technique) in such a manner that the gene can be expressed in the target cell (i.e. transformant). Accordingly, the transformant used herein may be obtained by introducing a recombinant expression vector including a chimeric repressor gene into a living organism. Examples of the transformant used herein include not only cells but also tissues and organs of a living organism and individual plants or animals. The living organism is not particularly limited. Examples of a living organism to be used in the test include plants such as Arabidopsis thaliana and animals such as mice, rats, drosophilas, and nematodes.

[0058] Alternatively, in a case where the present invention is applied to an industrial field using plants, examples of the living organism include various products (plants and crops produced in agriculture, forestry and marine products industry). Specific examples of such products and crops include grains (e.g. rice plant, wheat, and corn), vegetables, flowers, ornamental plants, and timbers (e.g. pine, cedar, and Japanese cypress).

[0059] In the present specification, a method for introducing a gene into a plant is not particularly limited, but it is preferable that a target gene is incorporated into an expression vector. An example of the expression vector may be a publicly known plant transforming vector (e.g. binary vector (pBIN19, pBI121, pBIG etc.)). However, as described in Patent Literature 7, in a case where a publicly known plant transforming vector is used, some applications of the vector are unable to achieve a sufficient transformation ratio. Accordingly, it is preferable to use a vector for constructing an expression vector which is described in Patent Literature 7. A preferable expression vector is a vector which includes a promoter and a terminator for a plant and a target gene positioned between the promoter and the terminator and which expresses, in a host plant, a protein encoded by the target gene.

[0060] A method for transforming a plant by using such an expression vector is not particularly limited, and the recombinant expression vector may be introduced into a host by a suitable method of transformation according to the kind of the host. In the present invention, a particularly preferable example of the host is a plant. In this case, examples of the method for transformation are not particularly limited, and may be conventional and publicly known transformation such as transformation using a gene gun, protoplast/spheroplast transformation, Agrobacterium transformation, electroporation, calcium phosphate transformation, transformation using ribosome, and DEAE dextran transformation. In order to carry out the present invention, Agrobacterium-mediated transformation assisted by vacuum infiltration is preferable.

[0061] In order to confirm whether a target gene is introduced into a host cell or not and whether the target gene is surely expressed in the host cell or not, a marker may be used. For example, a gene which is deleted in the host cell is used as a marker, and a plasmid etc. including the marker and the target gene is introduced as an expression vector into the host cell. This enables confirmation of introduction of the target gene by observing expression of the marker gene. Alternatively, a target protein may be expressed as a fusion protein. For example, GFP (Green Fluorescent Protein) derived from Aequorea victoria is used as a marker and the target protein may be expressed as a GFP fusion protein. Alternatively, a gene for causing an expression site of a transgenic plant to be visible for monitoring may be introduced into a recombinant expression vector. An example of such a gene is β-glucuronidase (GUS) gene.

[0062] In the present specification, a transcription factor whose function is to be inhibited in order to impart a plant with a stress tolerance is also referred to as a first polypeptide. The first polypeptide is encoded by one of genes whose expression is increased by inhibiting the function of a TCP family protein known as relating to morphogenesis of a plant. As for the TCP family protein, see Patent Literatures 9-11 and Non-patent Literature 7. The first polypeptide is not related to the structure and the function of the TCP family protein.

[0063] In one embodiment, the first polypeptide may be a polypeptide made of an amino acid sequence represented by any one of SEQ ID. Nos. 2, 4, 6, 8, and 10, or may be a variant of the polypeptide which variant has the same function as that of the polypeptide. The function of the first polypeptide indicates a one inhibition of which enables imparting a plant with a stress tolerance. In the present invention, the stress tolerance is preferably a salt tolerance and/or a high osmotic pressure tolerance.

[0064] As described in later-mentioned Examples, the inventors of the present invention found that transcription factors At4g21440 (SEQ ID Nos. 1 and 2), At3g04070 (SEQ ID Nos. 3 and 4), and At1g13300 (SEQ ID Nos. 5 and 6) are related to a salt tolerance. That is, by inhibiting the function of the transcription factor At4g21440, At3g04070, or At1g13300, it is possible to prepare a plant with a salt tolerance. Further, the inventors of the present invention found that transcription factors At5g04340 (SEQ ID Nos. 7 and 8) and At5g47230 (SEQ ID Nos. 9 and 10) are related to a high osmotic pressure. That is, by inhibiting the function of the transcription factor At5g04340 or At5g47230, it is possible to prepare a plant with a high osmotic pressure tolerance.

[0065] It is reported that At4g21440 is "MYB102" which is involved in an injury and osmotic pressure stress signaling system (see Non-patent Literature 8). However, Non-patent Literature 8 neither describes nor suggests that inhibition of the function of At4g21440 in a plant enables imparting the plant with a salt tolerance. At3g04070 is also referred to as "ANAC047", but its function has not been reported. At1g13300 is considered as belonging to "GARP family", but its function has not been reported.

[0066] It is reported that At5g04340 is "ZAT6" which negatively controls growth of a main root of Arabidopsis thaliana and changes the structure of the root in order to balance phosphoric acid (see Non-patent Literature 9). However, Non-patent Literature 9 neither describes nor suggests that inhibition of the function of At5g04340 in a plant enables imparting the plant with a high osmotic pressure tolerance. It is reported that At5g47230 is "AtERF5" which is induced by injury (see Non-patent Literature 10). However, Non-patent Literature 10 neither describes nor suggests that inhibition of the function of At5g47230 in a plant enables imparting the plant with a high osmotic pressure tolerance.

[0067] In the present specification, an example of a variant is a polypeptide (protein) including an amino acid sequence derived from the amino acid sequence represented by any one of SEQ ID NOS: 2, 4, 6, and 10 by deletion, addition, or substitution of one or several amino acids. It is well known in the art that some amino acids in the amino acid sequence of the polypeptide can be easily modified without a significant influence on the structure or the function of the polypeptide. Further, it is also well known in the art that other than artificial modification, there exist variants of natural proteins in which structures or functions of the natural proteins are not significantly changed.

[0068] A person skilled in the art can easily mutate one or several amino acids in an amino acid sequence of a polypeptide by using a well-known art. For example, by employing publicly known point mutation, it is possible to mutate any base of a polynucleotide which encodes a polypeptide. Further, by designing a primer corresponding to any site of a polynucleotide which encodes a polypeptide, it is possible to prepare a variant with deletion or a variant with addition. Further, it is also possible to attain the object by using random variation.

[0069] In the present specification, another example of a variant is preferably a variant encoded by a polynucleotide including a base sequence derived from a base sequence represented by any one of SEQ ID Nos: 1, 3, 5, 7 and 9 by deletion, substitution, or addition of one or several bases.

[0070] In the present specification, another example of a variant is preferably a variant encoded by a polynucleotide which is hybridized, under a stringent condition, with a polynucleotide including a sequence complementary to a base sequence represented by any one of SEQ ID Nos: 1, 3, 5, 7 and 9.

[0071] Hybridization may be carried out by a well known method such as a method described in "Molecular Cloning: A Laboratory Manual, Third Edition, edited by J. Sambrook and D. W. Russell, Cold Spring Harbor Laboratory, N.Y. (2001)" (incorporated herein for reference). Normally, higher temperature and lower salt concentration makes the condition more stringent (makes hybridization more difficult), so that a more homologous polynucleotide can be obtained. A temperature suitable for the hybridization varies according to a base sequence and the length of the base sequence. For example, in a case where a DNA fragment including eighteen bases encoding six amino acids is used as a probe, the temperature of 50° C. or less is preferable.

[0072] The term "stringent hybridization condition" used herein indicates one-night incubation at 42° C. in a hybridization solution (containing 50% formaldehyde, 5×SSC (150 mM NaCl and 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5×Denhardt's solution, 10% dextran sulfate, and 20 μg/ml denatured sonicated sermon sperm DNA), and then washing a filter at approximately 65° C. in 0.1×SSC.

[0073] In the present specification, "functional peptide" indicates a peptide capable of converting a transcription factor into a transcription inhibiting factor, and is compatible with "transcription inhibition converting peptide" or "repressor domain". In the present specification, the "functional peptide" is also referred to as a second polypeptide.

[0074] As described above, the "functional peptide" has been already well known in the art (see Patent Literatures 1-8 and Non-patent Literatures 5-6 etc.). Accordingly, a person skilled in the art can easily prepare a desired functional peptide by using a well-known technique such as a recombinant technique or chemical synthesis. Further, a person skilled in the art can easily prepare a fusion protein of a desired transcription factor and a desired functional peptide.

[0075] In one embodiment, it is preferable that the functional peptide includes an amino acid sequence represented by any one of [0076] (1) X1-Leu-Asp-Leu-X2-Leu-X3 [0077] (2) Y1-Phe-Asp-Leu-Asn-Y2-Y3 [0078] (3) Z1-Asp-Leu-Z2-Leu-Arg-Leu-Z3 [0079] (4) Asp-Leu-Z4-Leu-Arg-Leu where X1 indicates 0-10 amino acid residues, X2 indicates Asn or Glu, X3 indicates at least 6 amino acid residues, Y1 indicates 0-10 amino acid residues, Y2 indicates Phe or Ile, Y3 indicates at least 6 amino acid residues, Z1 indicates Leu, Asp-Leu or Leu-Asp-Leu, Z2 indicates Glu, Gln, or Asp, Z3 indicates 0-10 amino acid residues, and Z4 indicates Glu, Gln, or Asp.

[0080] In the functional peptide represented by formula (1), the number of amino acid residues represented by X1 should be 0-10. The specific kind of an amino acid constituting the amino acid residue represented by X1 is not particularly limited. In other words, to an N-terminus of the functional peptide represented by formula (1), an oligomer made of any one amino acid or any two-ten amino acid residues may be added, or no amino acid may be added.

[0081] The amino acid residue represented by X1 should be as short as possible in consideration of easiness in synthesizing the functional peptide represented by formula (1). Specifically, the number of amino acid residues represented by X1 is preferably 10 or less, and more preferably 5 or less.

[0082] Similarly, in the functional peptide represented by formula (1), the number of amino acid residues represented by X3 should be at least 6. The specific kind of an amino acid sequence constituting the amino acid residue represented by X3 is not particularly limited. In other words, to a C-terminus of the functional peptide represented by formula (1), an oligomer made of any at least 6 amino acid residues should be added. The amino acid residues represented by X3 can express the above function provided that there exist at least 6 such amino acid residues.

[0083] In the functional peptide represented by formula (2), the number of amino acid residues represented by Y1 should be 0-10, as in the case of X1 in the functional peptide represented by formula (1). The specific kind of an amino acid constituting the amino acid residue represented by Y1 is not particularly limited. In other words, to an N-terminus of the functional peptide represented by formula (2), an oligomer made of any one amino acid or any two-ten amino acid residues may be added, or no amino acid may be added, as in the case of the functional peptide represented by formula (1).

[0084] The amino acid residue represented by Y1 should be as short as possible in consideration of easiness in synthesizing the functional peptide represented by formula (2). Specifically, the number of amino acid residues represented by Y1 is preferably 10 or less, and more preferably 5 or less.

[0085] Similarly, in the functional peptide represented by formula (2), the number of amino acid residues represented by Y3 should be at least 6, as in the case of X3 in the functional peptide represented by formula (1). The specific kind of an amino acid sequence constituting the amino acid residue represented by Y3 is not particularly limited. In other words, to a C-terminus of the functional peptide represented by formula (2), an oligomer made of any at least 6 amino acid residues should be added, as in the case of the functional peptide represented by formula (1). The amino acid residues represented by Y3 can exert the above function provided that there exist at least 6 such amino acid residues.

[0086] In the functional peptide represented by formula (3), the amino acid residue represented by Z1 includes Leu in the number of 1-3. In a case of one amino acid, the amino acid residue represented by Z1 includes Leu. In a case of two amino acids, Asp-Leu. In a case of three amino acids, Leu-Asp-Leu.

[0087] On the other hand, in the functional peptide represented by formula (3), the number of amino acid residues represented by Z3 should be 0-10, as in the case of X1 in the functional peptide represented by formula (1). The specific kind of an amino acid constituting the amino acid residue represented by Z3 is not particularly limited. In other words, to a C-terminus of the functional peptide represented by formula (3), an oligomer made of any one amino acid or any two-ten amino acid residues may be added, or no amino acid may be added.

[0088] The amino acid residue represented by Z3 should be as short as possible in consideration of easiness in synthesizing the functional peptide represented by formula (3). Specifically, the number of amino acid residues represented by Z3 is preferably 10 or less, and more preferably 5 or less. Specific examples of the amino acid residue represented by Z3 include, but not limited to, Gly, Gly-Phe-Phe, Gly-Phe-Ala, Gly-Tyr-Tyr, Ala-Ala-Ala.

[0089] The number of amino acid residues in the whole functional peptide represented by formula (3) is not particularly limited. However, in consideration of easiness in synthesis, the number is preferably 20 or less. The most preferable example of the functional peptide represented by formula (3) is peptide SRDX (LDLDLELRLGFA: SEQ ID NO: 21).

[0090] In another embodiment, it is preferable that the functional peptide includes an amino acid sequence represented by [0091] (5) α1-Leu-β1-Leu-γ1-Leu where α1 represents Asp, Asn, Glu, Gln, Thr, or Ser, β-1 represents Asp, Gln, Asn, Arg, Glu, Thr, Ser, or His, and γ1 represents Arg, Gln, Asn, Thr, Ser, His, Lys, or Asp.

[0092] The amino acid sequence represented by formula (5) may be further classified into the following (6)-(9): [0093] (6) α1-Leu-β1-Leu-γ2-Leu; [0094] (7) α1-Leu-β1-Leu-Arg-Leu; or [0095] (8) α2-Leu-β1-Leu-Arg-Leu [0096] (9) Asp-Leu-β3-Leu-Arg-Leu where α1 represents Asp, Asn, Glu, Gln, Thr, or Ser, α2 represents Asn, Glu, Gln, Thr, or Ser, β1 represents Asp, Gln, Asn, Arg, Glu, Thr, Ser, or His, β2 represents Asn, Arg, Thr, Ser, or His, β3 represents Glu, Asp, or Gln, and γ2 represents Gln, Asn, Thr, Ser, His, Lys, or Asp.

[0097] The functional peptide can convert any transcription factor into a transcription inhibiting factor by fusing with the transcription factor. Accordingly, by using an expression vector including a gene encoding a transcription factor etc. capable of binding to an expression control region of a specific target gene, it is possible to efficiently analyze the function of a plant gene in vivo.

[0098] In the present specification, the term "target gene" indicates any gene which is a target of a transcription factor etc. to be fused with a functional peptide. By introducing, to a plant, an expression vector including a chimera gene of a functional peptide and a transcription factor etc. in accordance with the present invention, a chimera protein derived from the chimera gene serves as a transcription inhibiting factor which inhibits transcription of the target gene in vivo. Consequently, a protein encoded by the target gene is not expressed.

[0099] As described above, the functional peptide can convert any transcription factor into a transcription inhibiting factor. Accordingly, by incorporating a transcription factor etc. which controls transcription of a specific target gene, it is possible to inhibit transcription of the target gene. Consequently, if a plant shows any change, it is possible to analyze the function of the target gene in consideration of the change.

[0100] The functional peptide can inhibit expression of a target gene in preference to activity of other transcription factor which is functionally redundant. Accordingly, if a transcription inhibition converting polynucleotide is incorporated into a constructing vector of the present invention, the constructing vector can be used for analyzing the function of the activity of the functionally redundant transcription factor.

[0101] For example, as a transcription factor for controlling formation of an apical bud of seedling, CUC1 protein and CUC2 protein are known. It is known that only when both of CUC1 gene and CUC2 gene respectively encoding these proteins have mutation, seed leaves of a plant having the CUC1 and CUC2 genes have a cup shape, and a meristem of an apical bud is not formed.

[0102] Even when only one of these functionally redundant genes (e.g. only CUC1 gene) is bound to the functional peptide to make a chimera gene and the chimera gene is expressed in a plant, an expressed chimera protein inhibits not only the transcription activity of the CUC 1 protein but also the transcription activity of the CUC2 protein.

[0103] It is often that a plant has a plurality of transcription factors which are functionally redundant. Since a transcription inhibiting factor obtained by transforming the function of a transcription factor by the functional peptide is dominant, use of the present invention enables analysis of the function of a transcription factor which function has not been clarified by knocking out one gene. Further, the present invention is applicable to a plant having an amphidiploid genome, such as wheat.

[0104] A polynucleotide encoding the first polypeptide (herein, this polynucleotide is also referred to as a first polynucleotide) is not particularly limited as long as the polynucleotide contains a base sequence corresponding to an amino acid sequence of the first polypeptide, based on a genetic code. If necessary, the first polynucleotide may contain a base sequence serving as a connection site to be connected with a polynucleotide encoding a functional peptide (herein, this polynucleotide is also referred to as a second polynucleotide). Further, if the reading frame of the first polynucleotide does not correspond to the reading frame of the second polynucleotide, the first polynucleotide may contain an additional base sequence used to make these reading frames correspond to each other. Further, the first polynucleotide may be fused, at its 5' terminus or 3' terminus, with a polynucleotide encoding a tag marker (tag sequence or marker sequence).

[0105] Similarly, the second polynucleotide is not particularly limited as long as the second polynucleotide contains a base sequence corresponding to an amino acid sequence of the second polypeptide, based on a genetic code. If necessary, the second polynucleotide may contain a base sequence serving as a connection site to be connected with the first polynucleotide. Further, if the reading frame of the first polynucleotide does not correspond to the reading frame of the second polynucleotide, the second polynucleotide may contain an additional base sequence used to make these reading frames correspond to each other. Further, the second polynucleotide may be fused, at its 5' terminus or 3' terminus, with a polynucleotide encoding a tag marker (tag sequence or marker sequence).

[0106] In the present specification, the "gene encoding a transcription inhibiting factor which is a fusion protein of a transcription factor and a functional peptide" should be designed such that the first polynucleotide and the second polynucleotide are bound to each other in frame. Accordingly, the "first polynucleotide" and the "second polynucleotide" may be individually inserted into an expression vector to be used, or the "first polynucleotide" and the "second polynucleotide" may be bound to each other in advance and then simultaneously inserted into the expression vector. Further, an expression vector to which the second polynucleotide is inserted may be designed to have a "site to which the first polynucleotide is to be inserted" and a desired gene is inserted into the site.

[0107] A person skilled in the art who reads the present specification easily understands that the method of the present invention for production of a plant may be a method for imparting a plant with a stress tolerance. That is, the present invention provides a method for imparting a plant with a stress tolerance. The method includes the step of inhibiting the function of a transcription factor for controlling expression of the useful trait. In order to inhibit the function of the transcription factor, expression of the transcription factor may be inhibited in the plant, or a fusion protein (chimeric repressor) of the transcription factor and a functional peptide which converts any transcription factor into a transcription inhibiting factor may be expressed in the plant. The method for inhibiting expression of a protein should be a technique well known in the art. Examples thereof include, but not limited to, a knock-out process and an RNAi process.

[0108] Further, the present invention provides a kit for production of a plant with a stress tolerance. The kit of the present invention includes members necessary for carrying out the above method for production of a plant. In one embodiment, the kit includes at least a gene encoding a transcription factor (first polynucleotide) and a gene encoding a functional peptide (second polynucleotide). The kit in accordance with the present embodiment may include a fusion gene obtained by fusing these genes, and preferably, further include an expression vector for expressing a target polypeptide in a plant (plant transforming vector). In one aspect, the kit in accordance with the present embodiment includes a first polynucleotide including a base sequence represented by any one of SEQ ID Nos. 1, 3, 5, 7, and 9, and a second polynucleotide encoding a functional peptide for converting any transcription factor into a transcription inhibiting factor.

[0109] In another embodiment, the kit of the present invention may include, instead of the first polynucleotide, an oligonucleotide set necessary for obtaining the first polynucleotide. In order to produce a plant with a stress tolerance, the kit in accordance with the present embodiment includes a first primer pair (SEQ ID Nos. 11 and 12), a second primer pair (SEQ ID Nos. 13 and 14), a third primer pair (SEQ ID Nos. 15 and 16), a fourth primer pair (SEQ ID Nos. 17 and 18), or a fifth primer pair (SEQ ID Nos. 19 and 20), and a second polynucleotide encoding a functional peptide which converts any transcription factor into a transcription inhibiting factor. The kit in accordance with the present embodiment may further include reagents necessary for PCR.

[0110] The "kit" used herein indicates a member in which a plurality of components are packaged. For example, the kit indicates a member in which a "gene encoding a transcription factor", a "gene encoding a functional peptide", and a "plant transforming vector" in respective vessels are packaged. It is preferable that the kit of the present invention further includes reagents for introducing the expression vector into a plant cell.

[0111] A person skilled in the art who reads the present specification easily understands that reagents other than the reagents for the aforementioned polynucleotide or oligonucleotide may be ones publicly known in the art. Further, a person skilled in the art who reads the present specification easily understands that the kit for production of a plant with a stress tolerance may be used as a kit for imparting a plant with a stress tolerance.

[0112] Further, a person skilled in the art who reads the present specification easily understands that a plant produced by the method and the kit for production of a plant with a stress tolerance and a plant produced by the method and the kit for imparting a plant with a stress tolerance are also encompassed in the scope of the present invention.

EXAMPLES

<1. Preparation of DNA Construct>

[0113] Primers for amplifying protein-encoding regions of genes encoding transcription factors were synthesized (SEQ ID Nos. 11-20). PCR consisting of 25 cycles each having denaturation at 94° C. for 1 min, annealing at 47° C. for 2 min, and extension at 74° C. for 1 min was carried out. DNA fragments amplified by the PCR were inserted into SmaI sites of p35SSRDXG. p35SSRDXG is a vector having two recombinant sites derived from publicly known λ phage (hereinafter referred to as att site) and has cauliflower mosaic virus 35S promoter (hereinafter referred to as CaMV35S promoter), transcription inhibiting peptide SRDX derived from Arabidopsis thaliana (LDLDLELRLGFA: SEQ ID No. 21), and a transcription termination region of a gene of a nopaline synthesizing enzyme (hereinafter referred to as NOS-ter). Using the construct thus obtained, Escherichia coli was transformed. Escherichia coli thus transformed was proliferated and then the construct was prepared from the Escherichia coli and a base sequence of the construct was determined. A clone to which a gene encoding a transcription factor was inserted in a forward direction was isolated, and a DNA construct containing a chimera gene of the gene encoding a transcription factor and SRDX was obtained.

<2. Introduction of Transforming Vector into Agrobacterium>

[0114] DNA fragments containing the two att sites, the CaMV35S promoter, the chimera gene, and the NOS-ter of the DNA construct were inserted into a plant transforming vector pBIGCKH (see Patent Literature 7). For this recombination, Gate way® and LR clonase® (Invitrogen) were used.

[0115] To a mixture of 1.5 μl (approximately 300 ng) of the DNA construct thus obtained and 4.0 μl (approximately 600 ng) of pBIGCKH, 4.0 μl of LR buffer diluted 5 times and 5.5 μl of TE buffer solution (10 mM Tris-Cl (pH 7.0), 1 mM EDTA) were added. 4.0 μl of LR clonase was added to the obtained solution, and the resultant was incubated at 25° C. for 60 min. Subsequently, 2.0 μl of protein kinase K was added, and the resultant was incubated at 37° C. for 10 min. Escherichia coli (DH5α etc.) to which 1-2 μl of the obtained solution was introduced was cultivated in a culture solution containing kanamycin so as to select Escherichia coli to which a marker gene was introduced. From the Escherichia coli, there was prepared a plant transforming vector, which was obtained by successfully inserting, into pBIGCKH, DNA fragments of the DNA construct having the two att and a region between the two att. The vector thus obtained was introduced into strains of soil bacteria (Agrobacterium tumefaciens Strain GV3101 (C58C1Rifr) pMP90 (Gmr) (koncz and Sahell 1986)).

<3. Transformation of Plant and Collection of T1 seeds>

[0116] Using 1 liter of a YEP culture medium or an LB culture medium containing an antibiotic (50 μg/ml of kanamycin (Km), 25 μg/ml of gentamicin (GM), and 50 μpg/ml of rifampicin (Rif), Agrobacterium to which the above vector had been inserted was cultured. The culture was carried out until OD600 of the culture solution became 1, and then the bacterial cells were collected from the culture solution and suspended in 1 liter of a culture medium for infection (infiltration medium) (see Patent Literature 7). Arabidopsis thaliana cultured for 14 days or more was immersed in the bacterial cell suspension for 2 min so that the Arabidopsis thaliana was infected with the bacterial cells of Agrobacterium to which the transforming vector had been introduced. The Arabidopsis thaliana thus transformed was cultured to obtain T1 seeds.

<4. Selection of Transformant and Collection of T2 seeds>

[0117] The T1 seeds were subjected to sterilization for 7 min with a solution of 25% bleach and 0.02% Triton X-100, and then rinsed three times with sterilized water, and were sown on a sterilized hygromycin selection medium (see Patent Literature 7). From rosette leaves of Arabidopsis thaliana obtained by growing the sown T1 seeds, genome DNA was extracted using Nucleon Phytopure (GE Healthcare). Specifically, freeze-dried plant tissues were crushed into powder with dry ice or liquid nitrogen (breaking-down of cell walls). The crushed tissues were removed to a tube, Reagent I was added, and the resultant was suspended, and then Reagent II was added and the resultant was inverted and mixed (lysis of cells). The tube was shaken at 65° C. for 10 min in a water bath, and then left on ice for 20 min. The tube was taken from the ice, chloroform and PhytoPure resin were added, and then the resultant was shaken at room temperature for 10 min. The tube was subjected to centrifugation at 1,300×g for 10 min, and then the supernatant was collected (extraction of DNA). To the collected supernatant was added cold isopropanol in the same amount as that of the collected supernatant, and the resultant was inverted and mixed, subjected to centrifugation at 4,000×g for 5 min, and then the supernatant was removed. The precipitate was washed with cold 70% ethanol, subjected to centrifugation at 4,000×g for 5 min, and the supernatant was removed. The precipitate was dried by wind for 10 min, and a suitable amount of a TE buffer solution or water was added to obtain a DNA solution. Using a genome DNA as a template, PCR was carried out with a primer for a DNA sequence of CaMV35S promoter (GAAGTTCATTTCATTTGGAGAGG: SEQ ID No. 22) and a primer for NOS-ter (AGACCGGCAACAGGATTCAATC: SEQ ID No. 23). A plant having the genome DNA amplified by this PCR was selected as a target transgenic plant. T2 seeds were obtained from the selected transgenic plant.

<5. Evaluation of Salt Tolerance>

[0118] T2 seeds of the transgenic plant were sown on an MS culture medium containing 225 mM of NaCl, and the states of seedlings after 3 weeks were evaluated (first selection). It should be noted that under this condition, all wild-type plants die. In order to confirm reproducibility, a further verification test was carried out. MS culture media with four different salt concentrations (Sodium Chloride; 0-250 mM) were prepared, T2 seeds of the transgenic plants and seeds of wild-type plants were sown, and comparison in the state of growth between the T2 seeds and the wild type seeds was made after approximately one month.

[0119] FIG. 1 shows the states of growth of breeds which could grow in culture media having a salt concentration (250 mM NaCl) at which wild type Arabidopsis thaliana cannot grow.

[0120] FIG. 1 shows states of wild type Arabidopsis thaliana and Arabidopsis thaliana expressing a salt-tolerance chimeric repressor, which were three weeks after sowing on MS plates with various salt concentrations. In the drawing, the uppermost row shows wild type Arabidopsis Thaliana (WT), the second row shows At4g21440 (MYB102) chimeric repressor (HR0522) plants, the third row shows At3g04070 (ANAC047) chimeric repressor (CR242) plants, and the lowermost row shows At1g13300 chimeric repressor (HR0237) plants. Panels in each row show, from the left, plants growing on an MS culture medium with a normal composition, an MS culture medium containing 150 mM of NaCl, an MS culture medium containing 200 mM of NaCl, and an MS culture medium containing 250 mM of NaCl, respectively.

[0121] The salt concentration used here (250 mM NaCl) was sufficiently high as a salt concentration at which a salt tolerance of a plant was evaluated. It is found from the test that under such a salt concentration, transgenic plants (HR0522, CR242, and HR0237) containing chimeric repressors derived from the three kinds of transcription factors (AT4G21440, AT3G04070, and AT1G13300, respectively) can growth. This shows that the chimeric repressors derived from the three kinds of transcription factors are effective in producing plants capable of standing up to salt damage.

<6. Evaluation of High Osmotic Pressure Tolerance>

[0122] T2 seeds were sown on MS culture media containing 600 mM of mannitol and the states of seedlings after three weeks were evaluated (first selection). It should be noted that under this condition, all wild-type plants die. In order to confirm reproducibility, a further verification test was carried out. MS culture media with four different mannitol concentrations (500-650 mM) were prepared, T2 seeds of the transgenic plants and seeds of wild-type plants were sown, and comparison in the state of growth between the T2 seeds and the wild type seeds was made after approximately one month.

[0123] FIG. 2 shows the states of growth of breeds which could grow in culture media having a mannitol concentration (650 mM) at which wild type Arabidopsis thaliana cannot grow.

[0124] FIG. 2 shows states of wild type Arabidopsis thaliana and Arabidopsis thaliana expressing an osmotic pressure-tolerance chimeric repressor, which were three weeks after sowing on MS plates with various mannitol concentrations. In the drawing, the uppermost row shows wild type Arabidopsis Thaliana (WT), the second row shows AT5G04340 (ZAT6) chimeric repressor (HR1169) plants, and the third row shows AT5G47230 (ATERF5) chimeric repressor (TP124) plants. Panels in each row show, from the left, plants growing on an MS culture medium containing 500 mM mannitol, an MS culture medium containing 550 mM mannitol, an MS culture medium containing 600 mM mannitol, and an MS culture medium containing 650 mM mannitol, respectively.

[0125] All wild-type plants die in a culture medium containing 600 mM mannitol. However, it was found from the test that even under such a condition, transgenic plants (HR1169 and TP124) having chimeric repressors derived from the two kinds of transcription factors (AT5G04340 and AT5G47230, respectively) can grow. Since the condition of a high osmotic pressure can be regarded as a stressed condition due to dryness, the chimeric repressors having the two kinds of transcription factors are considered as effective in preventing global warming from having an influence on plants.

[0126] The present invention is not limited to the description of the embodiments above, but may be altered by a skilled person within the scope of the claims. An embodiment based on a proper combination of technical means disclosed in different embodiments is encompassed in the technical scope of the present invention.

[0127] All the academic literatures and patent literatures cited in the specification are incorporated herein for reference.

INDUSTRIAL APPLICABILITY

[0128] The present invention enables producing plants with a stress tolerance such as a salt tolerance and a high osmotic pressure tolerance. Accordingly, the present invention can greatly contribute to the increase in food production. Further, the present invention is effective in producing plants capable of standing up to salt damage and in preventing global warming from having an influence on plants.

Sequence Listing

[0129] 2009001599_seq.txt

Sequence CWU 1

2311053DNAArabidopsis thaliana 1atggcaaggt caccttgttg cgagaagaac ggactcaaga aagggccttg gacatctgaa 60gaagaccaga agcttgttga ctatatccag aaacatggtt atggtaactg gagaaccctc 120cccaaaaatg ccggtttgca aagatgtggc aaaagttgta ggttaaggtg gactaattat 180ctccgaccag atataaagcg aggaaggttc tcttttgagg aagaagaaac cattattcag 240cttcatagct tcttaggaaa caagtggtct gcgattgcgg cgcgtttacc aggaagaaca 300gataatgaga tcaagaactt ttggaacact catataagaa agaagctact tagaatgggg 360attgatccag tgactcacag tccacgactc gatctcctcg atatctcatc catcttagct 420tcatctctat acaattcatc ttcacatcac atgaacatgt caagactcat gatggatact 480aatcgtcgtc atcaccagca acatccattg gttaaccccg agatactcaa gctcgctacc 540tctctcttct ctcaaaatca aaaccaaaac cttgtggtgg atcatgactc gagaactcaa 600gagaagcaaa cagtttatag ccaaaccgga gtaaaccaat accaaaccaa ccaatatttc 660gagaacacga ttactcaaga actccaatct tccatgccac cattccccaa tgaagctcgt 720cagtttaaca acatggatca tcacttcaat ggttttggag aacaaaatct tgtttcaact 780tctactacgt cagtccaaga ttgctataat ccgtcattca acgattattc aagttcaaat 840tttgtcttgg atccttctta ttcggatcag agcttcaact tcgcaaattc ggtcttaaac 900acgccatcct cgagcccgag cccgactacg ttaaactcga gttacatcaa tagtagcagt 960tgcagcactg aggatgaaat agaaagctat tgcagtaatc tcatgaagtt tgatattccc 1020gatttcttgg acgttaatgg ttttattata taa 10532350PRTArabidopsis thaliana 2Met Ala Arg Ser Pro Cys Cys Glu Lys Asn Gly Leu Lys Lys Gly Pro1 5 10 15Trp Thr Ser Glu Glu Asp Gln Lys Leu Val Asp Tyr Ile Gln Lys His 20 25 30Gly Tyr Gly Asn Trp Arg Thr Leu Pro Lys Asn Ala Gly Leu Gln Arg 35 40 45Cys Gly Lys Ser Cys Arg Leu Arg Trp Thr Asn Tyr Leu Arg Pro Asp 50 55 60Ile Lys Arg Gly Arg Phe Ser Phe Glu Glu Glu Glu Thr Ile Ile Gln65 70 75 80Leu His Ser Phe Leu Gly Asn Lys Trp Ser Ala Ile Ala Ala Arg Leu 85 90 95Pro Gly Arg Thr Asp Asn Glu Ile Lys Asn Phe Trp Asn Thr His Ile 100 105 110Arg Lys Lys Leu Leu Arg Met Gly Ile Asp Pro Val Thr His Ser Pro 115 120 125Arg Leu Asp Leu Leu Asp Ile Ser Ser Ile Leu Ala Ser Ser Leu Tyr 130 135 140Asn Ser Ser Ser His His Met Asn Met Ser Arg Leu Met Met Asp Thr145 150 155 160Asn Arg Arg His His Gln Gln His Pro Leu Val Asn Pro Glu Ile Leu 165 170 175Lys Leu Ala Thr Ser Leu Phe Ser Gln Asn Gln Asn Gln Asn Leu Val 180 185 190Val Asp His Asp Ser Arg Thr Gln Glu Lys Gln Thr Val Tyr Ser Gln 195 200 205Thr Gly Val Asn Gln Tyr Gln Thr Asn Gln Tyr Phe Glu Asn Thr Ile 210 215 220Thr Gln Glu Leu Gln Ser Ser Met Pro Pro Phe Pro Asn Glu Ala Arg225 230 235 240Gln Phe Asn Asn Met Asp His His Phe Asn Gly Phe Gly Glu Gln Asn 245 250 255Leu Val Ser Thr Ser Thr Thr Ser Val Gln Asp Cys Tyr Asn Pro Ser 260 265 270Phe Asn Asp Tyr Ser Ser Ser Asn Phe Val Leu Asp Pro Ser Tyr Ser 275 280 285Asp Gln Ser Phe Asn Phe Ala Asn Ser Val Leu Asn Thr Pro Ser Ser 290 295 300Ser Pro Ser Pro Thr Thr Leu Asn Ser Ser Tyr Ile Asn Ser Ser Ser305 310 315 320Cys Ser Thr Glu Asp Glu Ile Glu Ser Tyr Cys Ser Asn Leu Met Lys 325 330 335Phe Asp Ile Pro Asp Phe Leu Asp Val Asn Gly Phe Ile Ile 340 345 35031080DNAArabidopsis thaliana 3atgataagca aggatccaag atcgagttta cctccagggt ttcgatttca tccaacagat 60gaagaactca ttctccatta cctaaggaag aaagtttcct cttccccagt cccgctttcg 120attatcgccg atgtcgatat ctacaaatcc gatccatggg atttaccagc taaggctcca 180tttggggaga aagagtggta ttttttcagt ccgagggata ggaaatatcc aaacggagca 240agaccaaaca gagcagctgc gtctggatat tggaaagcaa ccggaacaga taaattgatt 300gcggtaccaa atggtgaagg gtttcatgaa aacattggta taaaaaaagc tcttgtgttt 360tatagaggaa agcctccaaa aggtgttaaa accaattgga tcatgcatga atatcgtctt 420gccgattcat tatctcccaa aagaattaac tcttctagga gcggtggtag cgaagttaat 480aataattttg gagataggaa ttctaaagaa tattcgatga gactggatga ttgggttctt 540tgccggattt acaagaaatc acacgcttca ttgtcatcac ctgatgttgc tttggtcaca 600agcaatcaag agcatgagga aaatgacaac gaaccattcg tagaccgcgg aacctttttg 660ccaaatttgc aaaatgatca accccttaaa cgccagaagt cttcttgttc gttctcaaac 720ttactagacg ctacagattt gacgtttctc gcaaattttc taaacgaaac cccggaaaat 780cgttctgaat cagatttttc tttcatgatt ggcaatttct ctaatcctga catttacgga 840aaccattact tggatcagaa gttaccgcag ttgagctctc ccacttcaga gacaagcggc 900atcggaagca aaagagagag agtggatttt gcggaagaaa cgataaacgc ttcgaagaag 960atgatgaaca catatagtta caataatagt atagatcaaa tggatcatag tatgatgcaa 1020caacctagtt tcctgaacca ggaactcatg atgagttctc accttcaata tcaaggctag 10804359PRTArabidopsis thaliana 4Met Ile Ser Lys Asp Pro Arg Ser Ser Leu Pro Pro Gly Phe Arg Phe1 5 10 15His Pro Thr Asp Glu Glu Leu Ile Leu His Tyr Leu Arg Lys Lys Val 20 25 30Ser Ser Ser Pro Val Pro Leu Ser Ile Ile Ala Asp Val Asp Ile Tyr 35 40 45Lys Ser Asp Pro Trp Asp Leu Pro Ala Lys Ala Pro Phe Gly Glu Lys 50 55 60Glu Trp Tyr Phe Phe Ser Pro Arg Asp Arg Lys Tyr Pro Asn Gly Ala65 70 75 80Arg Pro Asn Arg Ala Ala Ala Ser Gly Tyr Trp Lys Ala Thr Gly Thr 85 90 95Asp Lys Leu Ile Ala Val Pro Asn Gly Glu Gly Phe His Glu Asn Ile 100 105 110Gly Ile Lys Lys Ala Leu Val Phe Tyr Arg Gly Lys Pro Pro Lys Gly 115 120 125Val Lys Thr Asn Trp Ile Met His Glu Tyr Arg Leu Ala Asp Ser Leu 130 135 140Ser Pro Lys Arg Ile Asn Ser Ser Arg Ser Gly Gly Ser Glu Val Asn145 150 155 160Asn Asn Phe Gly Asp Arg Asn Ser Lys Glu Tyr Ser Met Arg Leu Asp 165 170 175Asp Trp Val Leu Cys Arg Ile Tyr Lys Lys Ser His Ala Ser Leu Ser 180 185 190Ser Pro Asp Val Ala Leu Val Thr Ser Asn Gln Glu His Glu Glu Asn 195 200 205Asp Asn Glu Pro Phe Val Asp Arg Gly Thr Phe Leu Pro Asn Leu Gln 210 215 220Asn Asp Gln Pro Leu Lys Arg Gln Lys Ser Ser Cys Ser Phe Ser Asn225 230 235 240Leu Leu Asp Ala Thr Asp Leu Thr Phe Leu Ala Asn Phe Leu Asn Glu 245 250 255Thr Pro Glu Asn Arg Ser Glu Ser Asp Phe Ser Phe Met Ile Gly Asn 260 265 270Phe Ser Asn Pro Asp Ile Tyr Gly Asn His Tyr Leu Asp Gln Lys Leu 275 280 285Pro Gln Leu Ser Ser Pro Thr Ser Glu Thr Ser Gly Ile Gly Ser Lys 290 295 300Arg Glu Arg Val Asp Phe Ala Glu Glu Thr Ile Asn Ala Ser Lys Lys305 310 315 320Met Met Asn Thr Tyr Ser Tyr Asn Asn Ser Ile Asp Gln Met Asp His 325 330 335Ser Met Met Gln Gln Pro Ser Phe Leu Asn Gln Glu Leu Met Met Ser 340 345 350Ser His Leu Gln Tyr Gln Gly 35551035DNAArabidopsis thaliana 5atgattaaaa agttcagcaa tatggattac aaccagaaac gagagagatg tgggcaatac 60atcgaagccc tcgaagagga acgtcgcaag attcatgtat ttcaacgtga acttcctctt 120tgcttagacc ttgtaactca agcgatcgag gcatgtaaga gggagttacc ggagatgacg 180acggagaata tgtacggaca accagagtgc tcggagcaga cgaccggaga atgtgggccg 240gtcttggagc agtttctaac tattaaagat tcatcgacat ccaacgaaga agaagatgaa 300gaattcgacg atgagcatgg aaatcacgat ccagacaatg attccgagga caagaacacg 360aaatctgatt ggcttaagtc tgttcaactc tggaatcaac ccgaccaccc acttcttcca 420aaagaggaaa ggttgcagca ggagacgatg acaagagatg agagtatgag aaaagatccg 480atggtgaacg gtggcgaagg gaggaagaga gaggcggaga aagacggagg aggagggaga 540aagcaaagaa ggtgttggtc gtcgcaattg catagacgct tcttgaacgc tcttcaacac 600ttaggtggac ctcatgtagc tacgccaaag caaatcaggg agtttatgaa ggttgatggg 660ttaaccaatg atgaagttaa aagccattta cagaaatata gactgcatac aagaaggcca 720cgccaaacag tccctaacaa cggaaactct caaacgcaac atttcgtagt cgtcggtggt 780ttatgggtac cacaatcgga ctactctacg ggcaagacta ccggaggagc caccaccagc 840agtaccacca caaccaccgg catctatgga accatggccg caccgccacc tccacaatgg 900cctagccatt ccaattatag accgtcgatt attgtggacg aaggatcggg aagtcatagt 960gaaggggtcg tggtccggtg tagctcgccg gcgatgtctt cttctacccg taatcattac 1020gtcaagaata attaa 10356344PRTArabidopsis thaliana 6Met Ile Lys Lys Phe Ser Asn Met Asp Tyr Asn Gln Lys Arg Glu Arg1 5 10 15Cys Gly Gln Tyr Ile Glu Ala Leu Glu Glu Glu Arg Arg Lys Ile His 20 25 30Val Phe Gln Arg Glu Leu Pro Leu Cys Leu Asp Leu Val Thr Gln Ala 35 40 45Ile Glu Ala Cys Lys Arg Glu Leu Pro Glu Met Thr Thr Glu Asn Met 50 55 60Tyr Gly Gln Pro Glu Cys Ser Glu Gln Thr Thr Gly Glu Cys Gly Pro65 70 75 80Val Leu Glu Gln Phe Leu Thr Ile Lys Asp Ser Ser Thr Ser Asn Glu 85 90 95Glu Glu Asp Glu Glu Phe Asp Asp Glu His Gly Asn His Asp Pro Asp 100 105 110Asn Asp Ser Glu Asp Lys Asn Thr Lys Ser Asp Trp Leu Lys Ser Val 115 120 125Gln Leu Trp Asn Gln Pro Asp His Pro Leu Leu Pro Lys Glu Glu Arg 130 135 140Leu Gln Gln Glu Thr Met Thr Arg Asp Glu Ser Met Arg Lys Asp Pro145 150 155 160Met Val Asn Gly Gly Glu Gly Arg Lys Arg Glu Ala Glu Lys Asp Gly 165 170 175Gly Gly Gly Arg Lys Gln Arg Arg Cys Trp Ser Ser Gln Leu His Arg 180 185 190Arg Phe Leu Asn Ala Leu Gln His Leu Gly Gly Pro His Val Ala Thr 195 200 205Pro Lys Gln Ile Arg Glu Phe Met Lys Val Asp Gly Leu Thr Asn Asp 210 215 220Glu Val Lys Ser His Leu Gln Lys Tyr Arg Leu His Thr Arg Arg Pro225 230 235 240Arg Gln Thr Val Pro Asn Asn Gly Asn Ser Gln Thr Gln His Phe Val 245 250 255Val Val Gly Gly Leu Trp Val Pro Gln Ser Asp Tyr Ser Thr Gly Lys 260 265 270Thr Thr Gly Gly Ala Thr Thr Ser Ser Thr Thr Thr Thr Thr Gly Ile 275 280 285Tyr Gly Thr Met Ala Ala Pro Pro Pro Pro Gln Trp Pro Ser His Ser 290 295 300Asn Tyr Arg Pro Ser Ile Ile Val Asp Glu Gly Ser Gly Ser His Ser305 310 315 320Glu Gly Val Val Val Arg Cys Ser Ser Pro Ala Met Ser Ser Ser Thr 325 330 335Arg Asn His Tyr Val Lys Asn Asn 3407717DNAArabidopsis thaliana 7atggcacttg aaactcttac ttctccaaga ttatcttctc cgatgccgac tctgtttcaa 60gattcagcac tagggtttca tggaagcaaa ggcaaacgat ctaagcgatc aagatctgaa 120ttcgaccgtc agagtctcac ggaggatgaa tatatcgctt tatgtctcat gcttcttgct 180cgcgacggag atagaaaccg tgaccttgac ctgccttctt cttcgtcttc acctcctctg 240cttcctcctc ttcctactcc gatctacaag tgtagcgtct gtgacaaggc gttttcgtct 300taccaggctc ttggtggaca caaggcaagt caccggaaaa gcttttcgct tactcaatct 360gccggaggag atgagctgtc gacatcgtcg gcgataacca cgtctggtat atccggtggc 420gggggaggaa gtgtgaagtc gcacgtttgc tctatctgtc ataaatcgtt cgccaccggt 480caagctctcg gcggccacaa acggtgccac tacgaaggaa agaacggagg cggtgtgagt 540agtagcgtgt cgaattctga agatgtgggg tctacaagcc acgtcagcag tggccaccgt 600gggtttgacc tcaacatacc gccgataccg gaattctcga tggtcaacgg agacgaagag 660gtgatgagtc ctatgccggc gaagaaactc cggtttgact tcccggagaa accctaa 7178238PRTArabidopsis thaliana 8Met Ala Leu Glu Thr Leu Thr Ser Pro Arg Leu Ser Ser Pro Met Pro1 5 10 15Thr Leu Phe Gln Asp Ser Ala Leu Gly Phe His Gly Ser Lys Gly Lys 20 25 30Arg Ser Lys Arg Ser Arg Ser Glu Phe Asp Arg Gln Ser Leu Thr Glu 35 40 45Asp Glu Tyr Ile Ala Leu Cys Leu Met Leu Leu Ala Arg Asp Gly Asp 50 55 60Arg Asn Arg Asp Leu Asp Leu Pro Ser Ser Ser Ser Ser Pro Pro Leu65 70 75 80Leu Pro Pro Leu Pro Thr Pro Ile Tyr Lys Cys Ser Val Cys Asp Lys 85 90 95Ala Phe Ser Ser Tyr Gln Ala Leu Gly Gly His Lys Ala Ser His Arg 100 105 110Lys Ser Phe Ser Leu Thr Gln Ser Ala Gly Gly Asp Glu Leu Ser Thr 115 120 125Ser Ser Ala Ile Thr Thr Ser Gly Ile Ser Gly Gly Gly Gly Gly Ser 130 135 140Val Lys Ser His Val Cys Ser Ile Cys His Lys Ser Phe Ala Thr Gly145 150 155 160Gln Ala Leu Gly Gly His Lys Arg Cys His Tyr Glu Gly Lys Asn Gly 165 170 175Gly Gly Val Ser Ser Ser Val Ser Asn Ser Glu Asp Val Gly Ser Thr 180 185 190Ser His Val Ser Ser Gly His Arg Gly Phe Asp Leu Asn Ile Pro Pro 195 200 205Ile Pro Glu Phe Ser Met Val Asn Gly Asp Glu Glu Val Met Ser Pro 210 215 220Met Pro Ala Lys Lys Leu Arg Phe Asp Phe Pro Glu Lys Pro225 230 2359903DNAArabidopsis thaliana 9atggcgactc ctaacgaagt atctgcactt tggttcatcg agaaacatct actcgacgag 60gcttctcctg tggctacaga tccatggatg aagcacgaat catcatcagc aacagaatct 120agctctgact cttcttctat catcttcgga tcatcgtcct cttctttcgc cccaattgat 180ttctctgaat ccgtatgcaa acctgaaatc atcgatctcg atactcccag atctatggaa 240tttctatcga ttccatttga atttgactca gaagtttctg tttctgattt cgattttaaa 300ccttctaatc aaaatcaaaa tcagtttgaa ccggagctta aatctcaaat tcgtaaaccg 360ccattgaaga tttcgcttcc agctaaaaca gagtggattc aattcgcagc tgaaaacacc 420aaaccggaag ttactaaacc ggtttcggaa gaagagaaga agcattacag aggagtaaga 480caaagaccgt gggggaaatt cgcggcggag attcgtgacc cgaataaacg cggatctcgc 540gtttggcttg ggacgtttga tacagcgatt gaagcggcta gagcttatga cgaagcagcg 600tttagactac gaggatcgaa agcgattttg aatttccctc ttgaagttgg gaagtggaaa 660ccacgcgccg atgaaggtga gaagaaacgg aagagagacg atgatgagaa agtgactgtg 720gttgagaaag tgttgaagac ggaacagagc gttgacgtta acggtggaga gacgtttccg 780tttgtaacgt cgaatttaac ggaattatgt gactgggatt taacggggtt tcttaacttt 840ccgcttctgt cgccgttatc tcctcatcca ccgtttggtt attcccagtt gaccgttgtt 900tga 90310300PRTArabidopsis thaliana 10Met Ala Thr Pro Asn Glu Val Ser Ala Leu Trp Phe Ile Glu Lys His1 5 10 15Leu Leu Asp Glu Ala Ser Pro Val Ala Thr Asp Pro Trp Met Lys His 20 25 30Glu Ser Ser Ser Ala Thr Glu Ser Ser Ser Asp Ser Ser Ser Ile Ile 35 40 45Phe Gly Ser Ser Ser Ser Ser Phe Ala Pro Ile Asp Phe Ser Glu Ser 50 55 60Val Cys Lys Pro Glu Ile Ile Asp Leu Asp Thr Pro Arg Ser Met Glu65 70 75 80Phe Leu Ser Ile Pro Phe Glu Phe Asp Ser Glu Val Ser Val Ser Asp 85 90 95Phe Asp Phe Lys Pro Ser Asn Gln Asn Gln Asn Gln Phe Glu Pro Glu 100 105 110Leu Lys Ser Gln Ile Arg Lys Pro Pro Leu Lys Ile Ser Leu Pro Ala 115 120 125Lys Thr Glu Trp Ile Gln Phe Ala Ala Glu Asn Thr Lys Pro Glu Val 130 135 140Thr Lys Pro Val Ser Glu Glu Glu Lys Lys His Tyr Arg Gly Val Arg145 150 155 160Gln Arg Pro Trp Gly Lys Phe Ala Ala Glu Ile Arg Asp Pro Asn Lys 165 170 175Arg Gly Ser Arg Val Trp Leu Gly Thr Phe Asp Thr Ala Ile Glu Ala 180 185 190Ala Arg Ala Tyr Asp Glu Ala Ala Phe Arg Leu Arg Gly Ser Lys Ala 195 200 205Ile Leu Asn Phe Pro Leu Glu Val Gly Lys Trp Lys Pro Arg Ala Asp 210 215 220Glu Gly Glu Lys Lys Arg Lys Arg Asp Asp Asp Glu Lys Val Thr Val225 230 235 240Val Glu Lys Val Leu Lys Thr Glu Gln Ser Val Asp Val Asn Gly Gly 245 250 255Glu Thr Phe Pro Phe Val Thr Ser Asn Leu Thr Glu Leu Cys Asp Trp 260 265 270Asp Leu Thr Gly Phe Leu Asn Phe Pro Leu Leu Ser Pro Leu Ser Pro 275 280 285His Pro Pro Phe Gly Tyr Ser Gln Leu Thr Val Val 290 295 3001130DNAArtificial SequenceSynthetic 11gatggcaagg tcaccttgtt gcgagaagaa 301230DNAArtificial SequenceSynthetic 12tataataaaa ccattaacgt ccaagaaatc

301330DNAArtificial SequenceSynthetic 13gatgataagc aaggatccaa gatcgagttt 301430DNAArtificial SequenceSynthetic 14gccttgatat tgaaggtgag aactcatcat 301530DNAArtificial SequenceSynthetic 15gatgattaaa aagttcagca atatggatta 301630DNAArtificial SequenceSynthetic 16attattcttg acgtaatgat tacgggtaga 301730DNAArtificial SequenceSynthetic 17gatggcactt gaaactctta cttctccaag 301830DNAArtificial SequenceSynthetic 18gggtttctcc gggaagtcaa accggagttt 301930DNAArtificial SequenceSynthetic 19gatggcgact cctaacgaag tatctgcact 302032DNAArtificial SequenceSynthetic 20aacaacggtc aactgggaat aaccaaacgg tg 322112PRTArabidopsis thaliana 21Leu Asp Leu Asp Leu Glu Leu Arg Leu Gly Phe Ala1 5 102223DNAArtificial SequenceSynthetic 22gaagttcatt tcatttggag agg 232322DNAArtificial SequenceSynthetic 23agaccggcaa caggattcaa tc 22


Patent applications by Masaru Takagi, Ibaraki JP

Patent applications by National Institute of Advanced Industrial Science and Technology

Patent applications in class METHOD OF INTRODUCING A POLYNUCLEOTIDE MOLECULE INTO OR REARRANGEMENT OF GENETIC MATERIAL WITHIN A PLANT OR PLANT PART

Patent applications in all subclasses METHOD OF INTRODUCING A POLYNUCLEOTIDE MOLECULE INTO OR REARRANGEMENT OF GENETIC MATERIAL WITHIN A PLANT OR PLANT PART


User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
Images included with this patent application:
METHOD FOR PRODUCTION OF PLANT IMPARTED WITH STRESS TOLERANCE AND USE     THEREOF diagram and image
Similar patent applications:
DateTitle
2010-09-23Composition for production of plant body having improved sugar content, and use thereof
2011-12-29Polypeptide having function for delaying anthesis or suppressing growth, polynucleotide encoding the same, and use thereof
2011-05-19Genes controlling plant root growth and development for stress tolerance and method of their use
2011-10-27Signatures and pcdeterminants associated with prostate cancer and methods of use thereof
2011-11-24Gene-transfer vector comprising helper-component protease gene of papaya ringspot virus for broad-spectrum virus resistance in crops and use thereof
New patent applications in this class:
DateTitle
2013-05-23Isolated polynucleotides and methods and plants using same for regulating plant acidity
2013-05-23Plant cytochrome p450
2013-05-23Plants having altered agronomic characteristics under nitrogen limiting conditions and related constructs and methods involving genes encoding lnt5 polypeptides and homologs thereof
2013-05-23Manipulation of glutamine synthetases (gs) to improve nitrogen use efficiency and grain yield in higher plants
2013-05-23Targeting signal for integrating proteins, peptides and biological molecules into bacterial microcompartments
New patent applications from these inventors:
DateTitle
2011-04-28Producing process of sterile plants, plants obtained by the process, and use of the plants
2011-02-10Transcriptional repressor peptides and genes for the same
2010-06-10Method for producing plant with modified flower morphology
Top Inventors for class "Multicellular living organisms and unmodified parts thereof and related processes"
RankInventor's name
1William H. Eby
2Richard G. Stelpflug
3Gregory J. Holland
4Laron L. Peters
5Fufa H. Birru