Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: (R)-HYDROXYNITRILE LYASE FROM BRASSICACEAE

Inventors:  Thorsten Eggert (Neuss, DE)  Jennifer Andexer (Velbert, DE)
Assignees:  EVOCATAL GMBH
IPC8 Class: AC12P1300FI
USPC Class: 435128
Class name: Chemistry: molecular biology and microbiology micro-organism, tissue cell culture or enzyme using process to synthesize a desired chemical compound or composition preparing nitrogen-containing organic compound
Publication date: 2010-05-06
Patent application number: 20100112648





Sign up to receive free email alerts when patent applications with chosen keywords are published SIGN UP

Abstract:

The invention concerns a polypeptide which can be isolated from the Brassicaceae family and which has at least the activity of a hydroxynitrile lyase (HNL). The hydroxynitrile lyase of the invention is the first HNL from the Brassicaceae family. The plants (Arabidopsis) from which this enzyme or its gene is isolated is also described as non-cyanogenic. All HNL-containing plants described so far are cyanogenic plants and so it has until now been assumed that only cyanogenic plants contain hydroxynitrile lyases. Surprisingly, it transpires that a polypeptide (AtHNL) of the invention is (R)-selective. The amino acid sequence gives a theoretical molecular weight of 29.2 kDa for the AtHNL subunit. The calculated molecular mass of the protein of approximately 30 kDa can be confirmed by SDS gel electrophoresis.

Claims:

1. An isolated polypeptide, wherein said polypeptide is from a Brassicaceae family of plants, and has at least activity of a hydroxynitrile lyase.

2. The isolated polypeptide according to claim 1, wherein the plants are of genus Arabidopsis, in particular of species Arabidopsis thaliana.

3. The isolated polypeptide according to claim 1, wherein the polypeptide catalyzes at least a synthesis of chiral cyanohydrins from aldehydes or ketones and hydrocyanic acid.

4. The isolated polypeptide according to claim 1, wherein the polypeptide catalyzes at least cleavage of a cyanohydrin into an aldehyde or ketone and hydrocyanic acid.

5. The isolated polypeptide according to claim 1, wherein the polypeptide is (R)-selective.

6. The isolated polypeptide according to claim 1, wherein the polypeptide is allocated to a α/β-hydrolase family.

7. A polypeptide which comprises at least amino acid sequence according to SEQ ID NO: 1.

8. A polypeptide which differs from the polypeptide according to claim 7 by one or more amino acid replacement(s), wherein said replacement(s) are:a) asparagine in position 112 for threonine (N12T) or alanine (N12A);b) tyrosine in position 14 for cysteine (Y14C) or alanine (Y14A); and/orc) leucine in position 129 for tryptophan (L129W).

9. A polypeptide which differs from the polypeptide according to claim 7 by deletion, insertion and/or substitution of at least one and at most 100 amino acids, preferably 1 to 50 amino acids, particularly preferably 1 to 20 amino acids, and in particular 1 to 10 amino acids.

10. A protein, in particular a fusion protein, which comprises at least one polypeptide according to claim 1.

11. An isolated nucleic acid molecule which comprises at least one nucleotide sequence for synthesis of at least one polypeptide, wherein the nucleotide sequence is selected from the group consisting of:a) a nucleotide sequence which codes for a polypeptide according to claim 1;b) a nucleotide sequence which codes for a polypeptide which comprises at least amino acid sequence of SEQ ID NO: 1;c) a nucleotide sequence which comprises SEQ ID NO: 2;d) a nucleotide sequence which codes for fragments of the polypeptide coded by the nucleotide sequences of a), b) or c), wherein the fragments have the catalytic activity of the polypeptides coded by the nucleotide sequences of a), b) or c);e) a nucleotide sequence which differs from the nucleotide sequences of a), b), c) or d) by replacement of at least one codon for a synonymous codon;f) a nucleotide sequence, a complementary strand of which hybridizes with the nucleotide sequences of a), b), c) or d) and which codes for at least one polypeptide which has a catalytic activity of the polypeptide coded by the nucleotide sequences of a), b), c) or d);g) a nucleotide sequence which has at least 85%, preferably 90%, in particular 95% identity with the nucleotide sequence of a), b), c) or d) and which codes for at least the polypeptide which has the catalytic activity of the polypeptide coded by the nucleotide sequences of a), b), c) or d); andh) a nucleotide sequence which corresponds to a complementary strand of the nucleotide sequence of a) to g).

12. The nucleic acid molecule according to claim 11, wherein the nucleic acid molecule is operatively coupled with at least one regulatory sequence.

13. The nucleic acid molecule according to claim 12, wherein the regulatory sequence comprises a promoter sequence and/or a transcription termination sequence and/or a regulator gene.

14. The nucleic acid molecule according to claim 11, wherein the nucleic acid molecule is coupled with at least one further nucleotide sequence which codes for a further polypeptide.

15. A polypeptide, encoded by a gene which comprises the nucleic acid molecule according to claim 11.

16. A vector for the synthesis of a polypeptide in a suitable cell, which comprises the nucleic acid molecule according to claim 11 in expressible form.

17. A cell which contains the nucleic acid molecule according to claim 11 and/or a vector comprising said nucleic acid molecule in an expressible form.

18. A cell culture which comprises cells according to claim 17.

19. A method for the synthesis of chiral cyanohydrins from at least one carbonyl compound and hydrocyanic acid comprising:providing said at least one carbonyl compound and said hydrocyanic acid and carrying out a reaction in presence of the polypeptide of claim 1 or a protein, in particular a fusion protein, comprising said polypeptide.

20. A method for the synthesis of chiral cyanohydrins from at least one carbonyl compound and hydrocyanic acid comprising:providing said at least one carbonyl compound and said hydrocyanic acid and carrying out a reaction, in the presence of the cell according to claim 17 or a cell culture comprising said cell.

21. The method according to claim 20, wherein an aliphatic or aromatic aldehyde is used as the carbonyl compound.

22. The method according to claim 20, wherein an aliphatic or aromatic ketone is used as the carbonyl compound.

23. A method for cleavage of cyanohydrins into at least one carbonyl compound and hydrocyanic acid, wherein the cleavage is carried out in presence of a polypeptide according to claim 1, or a protein, in particular a fusion protein, comprising said polypeptide.

24. A method for cleavage of cyanohydrins into at least one carbonyl compound and hydrocyanic acid, wherein said cleavage is carried out in presence of a cell according to claim 17 or a cell culture comprising said cell.

Description:

FIELD OF THE INVENTION

[0001]The invention relates to a polypeptide isolated from plants from the Brassicaceae family. The invention also relates to polypeptides which exhibit hydroxynitrile lyase activity. Further, the invention relates to the use of these polypeptides and to methods wherein the polypeptide is used as a catalyst. Furthermore, the invention relates to nucleic acids which code for the polypeptides of the invention.

BACKGROUND OF THE INVENTION

[0002]Hydroxynitrile lyases (HNLs) (EC 4.1.2.10, EC 4.1.2.11, EC 4.1.2.37, EC 4.1.2.39) catalyze the enantioselective cleavage of cyanohydrins to a carbonyl compound (aldehyde or ketone) and hydrocyanic acid.

##STR00001##

[0003]Reaction catalyzed by HNL: In the natural reaction a cyanohydrin (1) is cleaved into a carbonyl compound (aldehyde or ketone) (2) and hydrocyanic acid (3), while a chiral cyanohydrin is produced from the latter ones in industrial approaches.

[0004]HNL activity was initially detected in 1908 by Rosenthaler in emulsin from almonds. Representatives of this class of enzyme are primarily found in plants, and occasionally also in insects and bacteria. All known HNLs have been isolated from plants; in nature, the catalyzed reaction serves to ward off aggressors which would feed on them. This release of hydrocyanic acid from cyanohydrins is also termed cyanogenesis. The reverse reaction, i.e. the formation of a chiral cyanohydrin from an aldehyde or a ketone and hydrocyanic acid, which is also catalyzed by HNLs, is used industrially. Chiral cyanohydrins constitute important precursors in the manufacture of β-aminoalcohols and α-hydroxy acids, for example.

[0005]The per se highly heterogeneous class of enzymes can be roughly divided into two groups which differ in the presence of the cofactor FAD. The essential FAD molecule appears, however, to have an exclusively structural function; a biochemical significance for the catalyzed reaction has not yet been reported. FAD-containing HNLs have until now only been described for the Rosaceae family--examples of the extensively biochemically characterized representatives are the enzymes from Prunus amygdalus (PaHNL, almond) and Prunus mume (PmHNL, Japanese apricot). The sequences of the enzymes are very similar and all exhibit (R)-selectivity in the formation of chiral cyanohydrins.

[0006]The group of non-cofactor-containing HNLs is much more heterogeneous. Examples which can be mentioned are the enzyme from Linum usitatissimum (LuHNL, linseed, (R)-selective) and Sorghum bicolor (SbHNL, millet, (S)-selective). Further, the group includes enzymes from Hevea brasiliensis (HbHNL, rubber tree) and Manihot esculenta (MeHNL, cassaya). Although the HNL from linseed has similarities with zinc-dependent alcohol dehydrogenases and that from millet has similarities to carboxypeptidases, the latter enzymes (as well as carboxypeptidases) belong to the α/β hydrolase group and are exclusively (S)-selective. In addition to the common fold motif (see below), the two proteins are also sequentially very similar (77% identity for the amino acids).

[0007]In addition to the cited HNLs from cassaya and the rubber tree, various enzyme groups such as lipases, esterases, proteases, epoxyhydrolases and dehalogenases belong to the α/β-hydrolase family. All in all, the fold motif consists of mainly parallel β-leaflet strands which are surrounded by α-helices. The active centre is formed by three residues, the so-called catalytic triad (Ollis et al., 1992). The structures of the two HNLs with a α/β hydrolase fold motif (HbHNL, MeHNL) have been resolved and the catalytic residues have been unambiguously identified.

[0008]Further differences in the various HNLs concern their substrate spectra and enantioselectivities. The articles by Fechter et al (2004) and Sharma et al (2005) provide an overview of the known enzymes.

[0009]Enzymes which are of application on an industrial scale should have a broad substrate spectrum and high enantioselectivity. Furthermore, it is advantageous if the appropriate enzyme can be manufactured in a recombinant manner. An overview of the most important HNLs and their properties is given in Table 1.

TABLE-US-00001 TABLE 1 Overview of properties of the most industrially important HNLs. Recombinant Substrate Stereo- expression Aldehyde Ketone Original organism selectivity host Aliphatic Aromatic Aliphatic Aromatic Misc Literature Manihot esculenta S E. coli + + + + Buhler et al., or MeHNL-"tunnel Methyl ketone 2003 mutation" W128A Hevea brasiliensis S E. coli + + + + Hasslacher P. pastoris Methyl ketone et al., 1997 S. cerevisiae U.S. Pat. No. 6,337,196 B1 Prunus amygdalus R P. pastoris + + + + Glycosylated Glieder et (isoenzyme 5) FAD al., 2003 cofactor EP 1223220 B1 Linum usitatissimum R E. coli + - + - Albrecht et P. pastoris al., 1993

[0010]Chiral cyanohydrins can be produced with the aid of HNLs in both aqueous systems and in organic solvents such as diisopropylether (DIPE). Frequently, two-phase systems such as DIPE/buffer can be used. The advantage in using organic solvents, in addition to the good solubility of the substrates and products, lies in the suppression of the non-catalyzed chemical reaction of aldehyde/ketone and hydrocyanic acid to racemic cyanohydrin. Since this unwanted reaction is temperature-dependent and only occurs at pHs of more than 5, it can also be prevented by dropping the pH to below 5 and a relatively low reaction temperature (<10° C.). Very recently, moreover, there have been reports of initial tests using HNLs in ionic liquids (Gaisberger et al, 2004). The HNLs in question are used in various preparations: as the dissolved enzyme, lyophilisate, immobilisate on various carrier materials, CLECs (cross-linked enzyme crystals) or CLEAS (cross-linked enzyme aggregates).

[0011]U.S. Pat. No. 6,337,196 B1, for example, describes the production of (S)-cyanohydrins with the HNL from Hevea brasiliensis. DE 100 62 306 A1 describes the production of (R)-cyanohydrins with the HNL from Prunus amygdalus. Other specific examples for the use of (R) and (S) cyanohydrins can be found in the articles by Schmidt et al (1999) and Fechter et al (2004).

[0012](S)-selective enzymes, which are currently used industrially, are HNLs from Hevea brasiliensis (HbHNL) and Manihot esculenta (MeHNL); both can readily be produced in microbial hosts and cover a broad substrate spectrum (aliphatic and aromatic aldehydes and ketones, preferably methylketone). The equally (S)-selective enzyme from Sorghum bicolor has until now not been used as it cannot be produced in heterologous hosts.

[0013]EP 1 223 220 A1 describes the use of the (R)-selective HNL from Prunus amygdalus (PaHNL, isoenzyme 5). The enzyme can be produced heterologously, but until now only expression in a eukaryotic host (Picha pastoris) has been successful. The equally (R)-selective HNL from linseed (LuHNL) can be expressed heterologously in bacteria, but suffers from the drawback that only aliphatic substrates are accepted and so use on an industrial scale is correspondingly limited.

[0014]Thus, there is considerable interest in discovering further (R)-selective HNLs with new enzymatic properties, which in particular are suitable for the transformation of aromatic and aliphatic aldehydes and ketones and in addition can be expressed in good yields in bacterial hosts.

BRIEF DESCRIPTION OF THE INVENTION

[0015]Hence, it is the object of the invention to produce novel HNLs which are readily accessible and which can be used in an organic synthesis for the synthesis of chiral (R)-cyanohydrins.

[0016]This object is achieved in accordance with the invention by providing a polypeptide which can be isolated from plants from the Brassicaceae family and which exhibits at least the activity of a hydroxynitrile lyase.

[0017]The hydroxynitrile lyase of the invention is the first HNL from the Brassicaceae family. The plant from which this enzyme or gene is isolated is also described as being non-cyanogenic. All HNL-containing plants described until now are cyanogenic plants, and until now it has been assumed that only cyanogenic plants contain hydroxynitrile lyases. In Arabidopsis, until now neither cyanogenic glycosides (stable storage form of cyanohydrin) nor cyanohydrins have been detected. The presence of the catabolic enzyme was thus explicitly excluded (Waspi et al, 1998). Although the natural function of the enzyme in Arabidopsis is currently unknown, the novel enzyme is a very interesting alternative to the HNLs used until now for enzymatic production. Surprisingly, it has transpired that the polypeptide of the invention is (R)-selective. Because of the homology to enzymes from cassaya and the rubber tree, which both exhibit characteristic α/β-hydrolase folding, (S)-selectivity was expected, since until now all HNLs which exhibit said fold motif are (S)-selective.

[0018]A specific object of the invention was also grounded in the capability of the HNL of accepting carbonyl compounds with aromatic side chains. An example of such a sterically challenging substrate which may be cited is benzaldehyde, which produces mandelonitrile. The broad substrate spectrum of the polypeptide of the invention, which encompasses both aliphatic and aromatic compounds, and the process stability which is suitable for industrial applicable means that many applications are possible. A further advantage lies in the fact that the polypeptide of the invention can be produced cheaply and effectively in E. coli.

[0019]Preferably, the polypeptide of the invention comprises at least one amino acid sequence in accordance with SEQ ID NO: 1. Surprisingly, it has been shown that the polypeptide of the invention which can be expressed from Arabidopsis thaliana (AtHNL) has enzymatic hydroxynitrile lyase activity although A. thaliana is not a cyanogenic plant (Waspi et al, 1998). In particular, the AtHNL of SEQ ID NO: 1 transforms carbonyl compounds with aromatic or aliphatic side chains. Further, the hydroxynitrile lyase of the invention stands out because of its excellent stereoselectivity. Thus, even sterically challenging substrates are transformed into the desired corresponding optically active cyanohydrins with high enantioselectivities of >95% ee.

[0020]Thus, a preferred embodiment of the invention, the polypeptide or hydroxynitrile lyase (AtHNL) from Arabidopsis thaliana, has the following amino acid sequence (SEQ ID NO: 1):

TABLE-US-00002 merkhhfvlv hnayhgawiw yklkpllesa ghrvtavela asgidprpiq avetvdeysk plietlkslp eneevilvgf sfgginiala adifpakikv lvflnaflpd tthvpshvld kymempgglg dcefsshetr ngtmsllkmg pkfmkarlyq ncpiedyela kmlhrqgsff tedlskkekf seegygsvqr vyvmssedka ipcdfirwmi dnfnvskvye idggdhmvml skpqklfdsl saiatdym

or an allele or functional variant thereof, or a functional partial sequence thereof.

[0021]Particularly, preferably, the polypeptide differs from the polypeptide of SEQ ID NO: 1 in one or more amino acid replacement(s). Particularly advantageously, the asparagine in position 12 has been exchanged for threonine (N12T) or alanine (N12A), preferably in combination with an exchange of tyrosine in position 14 for cysteine (Y14C) or alanine (Y14A). By dint of this exchange of the amino acids in position 12, possibly in combination with the exchange in position 14, the substrate spectrum of the polypeptide of the invention can advantageously be extended to better encompass the acceptance of ketones. Further, an exchange of leucine in position 129 for tryptophan (L129W) and/or the exchange of tyrosine in position 14 for cysteine (Y14C) reverses the enantioselectivity, i.e. from (R) selectivity to (S)-selectivity.

[0022]The term "functional variants" as used in the context of this invention means a polypeptide or protein containing an amino acid sequence with a sequence homology of more than 85%, preferably more than 90%, particularly preferably more than 95%. Moreover, the term "functional partial sequence" also means polypeptides or proteins which contain amino acid fragments of at least 50 amino acids, preferably at least 100 amino acids, particularly preferably more than 150 amino acids, as well as functional variants with deletions of up to 100 amino acids, preferably up to 50 amino acids, particularly preferably up to 20 amino acids, in particular up to 10 amino acids, fall within the definition of "functional partial sequence". Thus, the invention also encompasses polypeptides which differ from the polypeptides of the invention by a deletion, insertion and/or substitution of at least one and at most 100 amino acids, preferably 1 to 50 amino acids, particularly preferably 1 to 20 amino acids and more particularly 1 to 10 amino acids.

[0023]The hydroxynitrile lyase of the invention can also have post-translational modifications, such as glycosylations or phosphorylations.

[0024]Further, the invention encompasses proteins, in particular fusion proteins, which comprise at least one polypeptide of the invention.

[0025]The present invention also relates to nucleic acids coding for the polypeptides or proteins or hydroxynitrile lyases or an allelic or functional variant thereof or a partial sequence or DNA fragment thereof, which are complementary to such nucleic acid sequences which hybridize with coding nucleic acids under stringent conditions.

[0026]In particular, the invention encompasses isolated and/or recombinant nucleic acid molecules which comprise at least one nucleotide sequence for the synthesis of at least one polypeptide, wherein the nucleotide sequence is selected from the group consisting of: [0027]a) a nucleotide sequence which codes for a polypeptide of the invention from the Brassicaceae family; [0028]b) a nucleotide sequence which codes for a polypeptide which comprises at least the amino acid sequence of SEQ ID NO: 1; [0029]c) a nucleotide sequence which comprises the sequence of SEQ ID NO: 2; [0030]d) a nucleotide sequence which codes for fragments of the polypeptide coded by the nucleotide sequences of a), b) or c), wherein the fragments have the catalytic activity of the polypeptides coded by the nucleotide sequences of a), b) or c); [0031]e) a nucleotide sequence which differs from the nucleotide sequences of a), b), c) or d) by replacement of at least one codon for a synonymous codon; [0032]f) a nucleotide sequence, the complementary strand of which hybridizes with the nucleotide sequences of a), b), c) or d) and which codes for at least one polypeptide which has the catalytic activity of the polypeptide coded by the nucleotide sequences of a), b), c) or d); [0033]g) a nucleotide sequence which has at least 85%, preferably 90%, in particular 95% identity with the nucleotide sequence of a), b), c) or d) and which codes for at least the polypeptide which has the catalytic activity of the polypeptide coded by the nucleotide sequences of a), b), c) or d); [0034]h) a nucleotide sequence which corresponds to the complementary strand of the nucleotide sequence of a) to g).

[0035]As an example, the hydroxynitrile lyase gene from Arabidopsis thaliana contains the following nucleic acid coding (SEQ ID NO: 2):

TABLE-US-00003 ATGGAGAGGAAACATCACTTCGTGTTAGTTCACAACGCTTATCATGGAGC CTGGATCTGGTACAAGCTCAAGCCCCTCCTTGAATCAGCCGGCCACCGCG TTACTGCTGTCGAACTCGCCGCCTCCGGGATCGACCCACGACCAATCCAG GCCGTTGAAACCGTCGACGAATACTCCAAACCGTTGATCGAAACCCTCAA ATCTCTTCCAGAGAACGAAGAGGTAATTCTGGTTGGATTCAGCTTCGGAG GCATCAACATCGCTCTCGCCGCCGACATATTTCCGGCGAAGATTAAGGTT CTTGTGTTCCTCAACGCCTTCTTGCCCGACACAACCCACGTGCCTTCTCA CGTTCTGGACAAGTATATGGAGATGCCTGGAGGTTTGGGAGATTGTGAGT TTTCATCTCATGAAACAAGAAATGGGACGATGAGTTTATTGAAGATGGGA CCAAAATTCATGAAGGCACGTCTTTACCAAAATTGTCCCATAGAGGATTA CGAGCTGGCAAAAATGTTGCATAGGCAAGGGTCATTTTTCACAGAGGATC TATCAAAGAAAGAAAAGTTTAGCGAGGAAGGATATGGTTCGGTGCAACGA GTTTACGTAATGAGTAGTGAAGACAAAGCCATCCCCTGCGATTTCATTCG TTGGATGATTGATAATTTCAACGTCTCGAAAGTCTACGAGATCGATGGCG GAGATCACATGGTGATGCTCTCCAAACCCCAAAAACTCTTTGACTCTCTC TCTGCTATTGCCACCGATTATATGTAATAATCTTAAGTCCGTTTTACTTT TTTCTCAT

[0036]SEQ ID NO: 2 and its allelic or functional variants with a homology of more than 50%, preferably more than 75%, particularly preferably more than 90% and most preferably more than 95% or the partial sequence thereof consisting of at least 150 nucleotides, preferably at least 300 nucleotides, particularly preferably at least 500 nucleotides, or DNA fragments which are complementary to such nucleic acid sequences which hybridize with a coding nucleic acid sequence SEQ ID NO: 2 or an allelic or functional variation or partial sequence thereof under stringent conditions, belong to the preferred nucleic acids of the invention. In this manner, routine hybridization conditions can be used.

[0037]The information from SEQ ID NO: 2 can be used to produce primers for the identification and cloning of directly homologous forms using PCR. Moreover, because of the sequence information, probes to investigate further naturally occurring functional variants of the athnl gene and thus the corresponding coding enzyme variants can be used. Starting from SEQ ID NO: 2 or from allelic or naturally occurring functional variants thereof, e.g. via PCR using a deficient DNA polymerase, a bank of artificially produced functional enzyme variants can be produced. Similarly, standard methods can be used to introduce individual point mutations into the DNA sequence which lead to amino acid exchanges; this means that the protein's properties such as substrate specificity can be changed.

[0038]The following point mutations are particularly preferred in the nucleotide sequence of SEQ ID NO: 2, either individually or in any combination: [0039]a) exchange of 2nd nucleotide (A=adenine) of the 12th codon (AAC) for cytosine (C), i.e. transformation into the codon with the nucleotide sequence ACC or alternatively exchange of the whole 12th codon for the codon ACT, ACA or ACG or GCT, GCC, GCA or GCG; [0040]b) exchange of 2nd nucleotide (A=adenine) of the 14th codon (TAT) for guanine (G), i.e. transformation into the codon with the nucleotide sequence TGT or alternatively exchange of the whole 14th codon for the codon TGC or GCT, GCC, GCA or GCG; [0041]c) exchange of 2nd nucleotide (T=thymine) of the 129th codon (TTG) for guanine (G), i.e. transformation into the codon with the nucleotide sequence TGG;

[0042]The coding DNA sequences can be cloned into routine vectors and, after transforming host cells with said vectors, can be expressed in cell culture. Examples of suitable expression vectors are pET-28a(+) for E. coli, and also expression vectors of other prokaryotic single cell organisms can be used. Examples of suitable expression vectors for yeasts are the pREP vector or pINT vector. For expression in insect cells, baculovirus vectors are suitable, such as those disclosed in EP-B1-0 127 839 or EP-B1-0 549 721, and for expression in mammalian cells, SV40 vectors, for example, are suitable; they are readily obtainable.

[0043]In addition to the usual markers, such as kanamycin resistance, the vectors may contain other functional nucleotide sequences for regulation, in particular repression or induction of the expression of the HNL gene and/or the reporter gene. Preferably, the promoters are inducible promoters, such as the rha-promoter or the nmt1-promoter, or strong promoters such as the lac-, ara-, lambda-, pL-, T7- or T3-promoter. The coding DNA fragments must be transcribable in the vectors from one promoter. Examples of further reliable promoters are the baculovirus-polyhedrin promoter for expression in insect cells (see, for example, EP-B1-0 127 839) or the early SV40 promoter or the LTR promoters, for example from MMTV (mouse mammary tumour virus, Lee et al, 1981).

[0044]The expression vectors of the invention may contain further functional sequence regions, such as a replication start point, operators, termination signals, tags which facilitate purification (for example a His-tag, a Strep-tag) or other peptide sequences which are produced by the fusion proteins.

[0045]With the vectors described, host cells can be transformed using the usual methods, such as the heat shock method or by electroporation.

[0046]Thus, in a further aspect, the present invention is constituted by expression systems which comprise host cells or host cell cultures which are transformed with the vector systems just described. Preferred hosts are single-cell prokaryotic organisms, in particular E coli. In the case of the expression of eukaryotic hnl genes of the invention, it may be advantageous to use eukaryotic expression systems in order, for example, to introduce post-translational modifications which are typical of eukaryotes into the hnl gene product. Particularly suitable eukaryotic host cells are yeasts.

[0047]A preferred expression system contains a hydroxynitrile lyase gene in accordance with SEQ ID NO: 2 or an allelic or functional variation or a partial sequence thereof in a vector which is suitable for expression in E coli, such as a pET-28a(+) vector wherein the hydroxynitrile lyase gene must be transcribably cloned into the vector. Preferably, the introduced hnl gene is cloned into the pET-28a(+) vector such that the transcription is under the control of the IPTG-inducible promoter present in the vector. Alternatively, rhamnose-inducible promoters may be used.

[0048]The expression systems can be cultivated using standard protocols which are known to the skilled person. Depending on the transcription control and the vector employed, expression of the gene introduced into the expression system can be regulated either constitutively or, as for example when pET-28a(+) is used as the expression plasmid, with added IPTG. After expression of a hydroxynitrile lyase of the invention, it is purified, for example using chromatography or by centrifuging. In order to carry out catalytic reactions, the purified enzymes and also the raw extracts or centrifugation residues or fractions can be used directly. The enzymes can be used both as a catalyst, lyophilisate or immobilisate dissolved in aqueous buffer on various carrier materials (both covalent and non-covalent binding as well as CLEAs or CLECs).

[0049]Thus, the invention also pertains to cells or cell cultures which comprise at least one nucleic acid molecule of the invention or at least one vector containing it.

[0050]The invention also encompasses the use of the polypeptide of the invention, or the protein of the invention, or the cells of the invention, or the cell culture of the invention, for the production of chiral cyanohydrins. Thus, in a further aspect, the present invention concerns the use of hydroxynitrile lyases of the invention for the catalytic production of chiral cyanohydrins.

[0051]Furthermore, the invention encompasses a method for the synthesis of chiral cyanohydrins from at least one carbonyl compound and hydrocyanic acid, wherein the reaction is carried out in the presence of the polypeptide of the invention or the protein of the invention or the cells of the invention or the cell culture of the invention. The carbonyl compound may be an aliphatic or aromatic aldehyde. Alternatively, the carbonyl compound may also be an aliphatic or aromatic ketone. The carbonyl compounds may also be transformed with other nucleophiles instead of HCN.

[0052]The invention also encompasses a method for cleaving cyanohydrins into at least one carbonyl compound and hydrocyanic acid, wherein the reaction is carried out in the presence of the polypeptide of the invention, or the protein of the invention or the cells of the invention or the cell culture of the invention.

BRIEF DESCRIPTION OF THE FIGURES

[0053]The invention will now be described with reference to the accompanying figures and examples, in which:

[0054]FIG. 1 is a DNA-agarose gel with PCR-products (AtHNL) from cDNA from Arabidopsis-germs: 1=Marker, 2 and 3=PCR-products (AtHNL, the PCR product is approximately 780 base pairs long and thus corresponds to the length of the gene in the databases);

[0055]FIG. 2 is a SDS polyacrylamide gel to assay induced gene expression in E coli cells which contain the plasmid pAtHNL: M=Marker, 0-4=induced, 5-9=not induced, 10-13=empty vector; to assay the expression, culture samples taken at the time of protein expression (addition of IPTG) were placed on SDS gel (0-4 h post-induction), the control was a non induced culture and the empty vector was pET28a; at the expected height of ca. 30 kDa in the induced culture is a band which increases with time (marked)--this is not present in the two controls;

[0056]FIG. 3 is a SDS-polyacrylamide gel to confirm purification of the polypeptide of the invention (AtHNL): M=Marker, 1=after Q-Sepharose, 2=after gel filtration; solubilized unrefined cell extract is initially purified on an anion exchanger (Q-Sepharose), followed by a second purification step using gel filtration chromatography;

[0057]FIG. 4 is a bar chart of the enzymatic activity of the polypeptide of the invention at various pHs: the optimum pH for AtHNL is at approximately 5.75, the activity is measured from pH 4.25; from a pH of 5, the activity increases sharply;

[0058]FIG. 5 is a bar chart of the stability of the polypeptide of the invention under reaction conditions compared with hydroxynitrile lyases from cassaya and linseed: the half lives under the reaction conditions for the AtHNL from Arabidopsis are compared with the (S) selective HNL from cassaya and the (R) selective HNL from linseed;

[0059]FIG. 6 is a diagram showing the stereoselectivity of the polypeptide of the invention using chiral gas chromatography: 1=product from AtHNL: (R)-mandelonitrile, 2=racemic mandelonitrile, 3=(S)-mandelonitrile; the AtHNL product on the synthesis of mandelolitrile from benzaldehyde and HCN was investigated, compared with pure (S)-mandelonitrile and racemic mandelonitrile; and

[0060]FIG. 7 is a structural model of the polypeptide of the invention based on the crystalline structure of hydroxynitrile lyase from Hevea brasiliensis: the model was based on the crystalline structure of the homologous HbHNL.

DESCRIPTION OF EXEMPLARY AND PREFERRED EMBODIMENTS OF THE INVENTION

[0061]A polypeptide of the invention from the non-cyanogenic plant Arabidopsis thaliana will now be described by way of example. The results given will be illustrated and substantiated using detailed examples.

[0062]A database search carried out with the amino acid sequence of MeHNL indicated that in the Arabidopsis thaliana plant there were many homologous proteins for which a hydroxynitrile lyase activity had, however, never been described. The Arabidopsis thaliana plant (mouse-ear cress) is a model organism (accessible genome, short generation period) and thus has been comprehensively investigated. The genome has been completely sequenced and recorded in sequence databases. Examples of such databases are, for example, the "Genbank" (http://www.ncbi.nlm.nih.gov/Genbank/index.html) as a collection of all published sequences, or TAIR (www.arabidopsis.org) as a database restricted to a single organism (in this case Arabidopsis). Because of the great strides made in molecular biology, many new sequences are being input into the appropriate databases than can be individually assessed and described. Thus, until now genes which have been identified as true genes but which have not been further investigated have automatically been ascribed types by appropriate computer algorithms because of their similarities to known sequences. Whether the function stated in this description is true, however, must be individually ascertained for each protein. Some of the proteins from Arabidopsis ascribed as putative HNLs by homology with HNLs from cassava had already been cloned during studies, expressed heterologously in E coli and tested for HNL activity (with the substrates acetocyanohydrin and mandelonitrile), but HNL activity could not be established in four out of five of the investigated proteins. Surprisingly, the fifth protein (At5g10300) had high activity as regards the cleavage of mandelonitrile (see Example 6 (Ia)).

[0063]The gene sequence of the novel HNL (hereinafter AtHNL) as described above derives from Arabidopsis thaliana (mouse-ear cress) and exhibits a high degree of homology with enzymes from hevea brasiliensis and Manihot esculenta. The gene (see SEQ ID NO: 1) is described as a homologous sequence in the appropriate literature regarding α/β hydrolases, but HNL activity was not assumed since Arabidopsis thaliana is not known as a plant which can lead to cyanogenesis (Waspi, 1998). The gene appears in the databases under accession number NP--196592 (Genbank) or At5g10300 (TAIR-nomenclature) and is automatically ascribed as a putative hydroxynitrile lyase. This gene is not described in the literature as HNL. The description is found in addition to the cited HNL publications in investigations of the Arabidopsis genome or specific parts (for example water-stress regulated gene) (Bray, 2002)).

[0064]Only one out of five tested enzymes which all exhibit significant similarity with enzymes from cassaya and the rubber tree, actually had the predicted activity. Consequently, in this case too no prediction regarding the activity of a protein can be made on the grounds of the sequence comparison alone. Concerning the sequence then, gene sequences of interest had to be individually cloned, expressed and tested for activity.

Example 1

Database Search

[0065]A database search was carried out with the amino acid for the HNL from Manhiot esculenta (Protein-Protein Blast, standard adjustment, http://www.ncbi.nlm.nig.gov/blast/); the results were filtered onto the organism Arabidopsis thaliana. The resulting list contains 22 sequences with at least 47% similarity as regards the amino acid sequence; 5 thereof are listed in Table 2. The genes listed in Table 2 were cloned, expressed and investigated for HNL activity.

TABLE-US-00004 TABLE 2 List of genes resembling MeHNL from Arabidopsis thaliana Similarity TAIR- Accession to MeHNL nomenclature no. (%) Remarks/misc At4g0990 NM_117058 50 Cloned and expressed, no activity At3g10870 AY096692 48 Cloned and expressed, no activity At3g50440 AY142031 57 Cloned and expressed, no activity At4g37150 BT006227 56 Cloned and expressed, no activity At5g10300 NP_196592 67 Cloned and expressed, HNL activity (a polypeptide in accordance with the invention)

Example 2

Amplification of gene At5g10300 (Hereinafter AtHNL) from cDNA, Cloning in Expression Vector pET28a and Transformation in E. coli

[0066]mRNA was isolated from Arabidopsis germs using "RNeasy® Plant Mini Kits" from Qiagen; the procedure was carried out in accordance with the instructions contained in the kit. Using "RevertAid® First Strand cDNA Synthesis Kits" from Fermentas, the mRNA obtained was transcribed into cDNA. This acted as the target structure for amplification of the HNL-homologous gene. PCR was carried out with sequence-specific primers (SEQ ID NO: 3 & 4) at an annealing temperature of 58° C. After purification of the PCR product on a DNA agarose gel (FIG. 1) using a commercially available gel elution kit, sticky ends were produced with the restriction enzymes NcoI and XhoI. Next, the fragment could be cloned into the vector pET28a which had also been cleaved with the same restriction enzymes. Ligation was carried out for 16 h at 16° C. The sequence of the thus cloned insert was confirmed by sequencing.

[0067]The plasmid described above (pAtNHL) can be transformed in the bacterial host Escherichia coli and the corresponding gene product can be expressed. To this end, (chemically or electrocompetently) competent E coli BL21 (DE3) cells were transformed using standard methods with pATHNL. Successfully transformed clones could be selected on LB agar plates with the antibiotic Kanamycin.

Example 3

Expression of Plasmids in E. coli

[0068]For the expression of HNL, initially an overnight culture of E coli (BL21(DE3), transformed with pAtHNL) at 30° C. in LB-Medium with 50 μg/mL kanamycin was inoculated with a single colony, The next morning, the main culture (also LB-medium/kanamycin) was over-inoculated with the preculture in a ratio of 1:20. Once an optical density of 0.6 to 0.8 had been reached at 550 nm, the cultures were induced with 0.4 mM of IPTG. After growing for 5 h at 30° C., the cells could be harvested by centrifuging and stored at -20° C. Expression success was monitored on SDS-polyacrylamide gel (FIG. 2). The amino acid sequence gave a theoretical molecular weight of 29.2 kDa for the AtHNL subunit.

Example 4

Purification of Proteins

[0069]Centrifuged cells (15-20 g, Example 3) were re-suspended in solubilizing buffer (50 mM KPi, pH 5.5) and placed on an equilibrated Q-sepharose column (bed volume approx 25 mL). AtHNL active fractions were identified by activity tests (mandelonitrile cleavage, see Example 6, Ia).

[0070]A portion of the protein eluted at the end of the run, the remainder at very low concentrations of salt (approx 0.15 M NaCl). The fractions which eluted over the salt gradient were desalted on a Sephadex G-25 column (1 L bed volume, buffer: 10 mM KPi, pH 6). The eluted fractions from the G-25 were purified and lyophilized. For further purification, the lyophilisate (approx 250 mg) was taken up in a little buffer (10 mM acetate, pH 6, 150 mM NaCl) and placed on a gel filtration column (Sephadex G-200, bed volume 125 mL) (FIG. 3). Next, the active fractions were either lyophilized again or concentrated in Centricons (VivaSpin (VivaScience), cut-off volume 10 kDa).

Example 5

Protein Chemical Characterization

[0071]a. Molecular Mass

[0072]The calculated molecular mass of the protein of approx 30 kDa can be confirmed by SDS gel electrophoresis (see FIGS. 2 and 3).

b. Oligomeric Condition

[0073]After calibration of the Sephadex G200-column with ribonuclease A (13.7 kDa), chymotrypsinogen A (25 kDa), ovalbumin (43 kDa), albumin (67 kDa), aldolase (158 kDa), catalase (232 kda), and blue dextran 2000 (2000 kDa), the molecular weight of the native protein came out at approx 50 kDa. It was concluded that the protein was present as the dimer (monomer, calculated from sequence: 29.2 kDa).

c. Optimum pH

[0074]The optimum pH was determined using the enzyme test described in Example 6 (II). A low activity can already be reproducibly measured from a pH of 4.25; at a pH of 5, the activity rises sharply. At a pH of 5.75, the maximum value is reached and this value remains the same up to the highest measured value (pH 6.5) (FIG. 4). Values over a pH of 6.5 could not be measured since the background due to self degradation of the substrate was too high.

d. Stability Under Reaction Conditions

[0075]In order to be able to estimate the suitability for use in industrial applications, the protein had to be investigated as regards the stability in the reaction system used therein. An example of a reaction system which is frequently used in high-tech processes is a two-phase system of buffer and diisopropylether (1:1). The incubation conditions correspond to the conditions of the synthesis reaction given in Example 6 (II). The remaining activity after various times was determined using a slightly modified cleavage test (cf Example 6 (Ia)). The comparisons were the (S) selective HNL from Manihot esculenta (MeHNL) and the (R) selective HNL from Linium usitatissimum LuHNL. In direct comparison with the homologous protein MeHNL, the stability periods determined for AtHNL were much shorter; compared with the LuHNL enzyme, also (R) selective, the values are indeed much better (up to four times higher, FIG. 5)). All of the half lives were over the maximum times for cyanohydrin syntheses (10-24 h) which are in general use.

Example 6

Substrate Spectrum and Stereoselectivity

[0076]The HNL activity was determined both by the cleavage of cyanohydrins and also by the synthesis of cyanohydrins. To this end, various activity tests were used. For a better overview, all of the test systems used are described first, with the results being given later.

Ia) Cleavage of Mandelonitrile (=Benzaldehyde Cyanohydrin), Determination of Liberated Benzaldehyde (Cell Test):

[0077]The protocol employed was based on the test described by Bauer et al in 1999 and was only modified slightly. 700 μl of citrate-phosphate buffer, pH 5 (48.5 mL 0.1 M citric acid, 51.5 mL 0.2 M dipotassium hydrogen phosphate, qsp 100 ml water) was mixed with 100 μl of enzyme sample in a quartz glass cell and the reaction was started with 200 μl of mandelonitrile solution (60 mM in citrate-phosphate buffer, pH 3.5 (1.82 mL 0.1 M citric acid, 1.06 mL 0.1 M disodium hydrogen phosphate, qsp 100 mL water). The increase in the extinction at 280 nm was monitored for 2 min. It was proportional to the benzaldehyde concentration in the sample. Self-degradation of the cyanohydrin was determined in a control sample without enzyme and subtracted from the values measured for the enzyme sample. In order to determine the remaining activity in the course of the stability tests described in Example 5d, a slightly altered procedure was used: 870 μl of citrate buffer (50 mM, pH 4) was supplemented with 30 μl of enzyme sample, the reaction was started by adding 100 μl of mandelonitrile (60 mM in 50 mM of citrate buffer, pH 2) and monitored for 2 minutes at 280 nm. The advantage of this variation is that the non-enzymatic reaction is almost completely suppressed, but nevertheless the control reaction without the enzyme was monitored for each series of measurements. The enzyme activity is, however, much lower with this procedure.

Ib) Cleavage of Various Cyanohydrins, Determination of Hydrocyanic Acid (Microtitre Plate Test):

[0078]140 μl of citrate-phosphate buffer, pH 5 (see Ia) was supplemented with 10 μl of enzyme sample. As was described in Ia, a control was used in each series of measurements (self-degradation of the cyanohydrin in question in the absence of the enzyme) and subtracted from the determined values. The enzymatic reaction was started using 10 μl of substrate solution (any cyanohydrin, 300 mM in 0.1 M citric acid) and stopped after 5 min with 10 μl of 100 mM N-chlorosuccinimide (with a 10× excess (w/w) of succinimide). The liberated hydrocyanic acid reacts with N-chlorosuccinimide and the subsequently added mixture of isonictonic acid and barbituric acid (65 mM/125 mM in 0.2 M of soda lye) to form a violet colorant the formation rate of which correlated with the quantity of HCN (Andexer et al, 2006).

II) Synthesis of Cyanohydrins:

[0079]The example used for the synthesis was in this case a transformation in a two-phase system. Other possibilities such as synthesis in a purely organic solvent (also, for example with an immobilized enzyme), in aqueous systems as well as in other unconventional solvents such as ionic liquids can also be used for the synthesis of cyanohydrins. The reaction system used was a two-phase system of citrate buffer, pH 4 and diisopropyl ether in a ratio of 1:1 (total 5 mL). The reaction took place with 20 U/mL of purified lyophilized HNL at 10° C. and 400 rpm. The substrates were added in a ratio of 1:5 (50 mM aldehyde/ketone and 250 mM HCN). Depending on the reaction rate, the substrates were transformed for 1 h to several days. The samples removed were examined on a gas chromatograph after derivatization (500 μL dichloromethane, 50 μL trifluoroacetic acid anhydride, 50 μL of pyridine +50 μL sample from organic phase). To this end, the CP-3800 gas chromatograph from Varian (FID detector) was used with a CP Chirasil-DEX CB column (length 25 m, internal diameter 0.25 mm, film thickness 0.25 μm) from the same firm. The carrier gas was helium at a flow rate of 2 mL/min. The following temperature program was suitable for almost all products except for 3-phenoxybenzaldehyde cyanohydrin: the column was kept at 50° C. for 1 min then heated at a heating rate of 3°/min to 110° C.; this temperature was maintained for 15 min. For 3-phenoxybenzaldehyde cyanohydrin, the column was maintained at 110° C. for 1 min then heated to 130° C. at a heating rate of 5°/min; this temperature was maintained for 80 min.

[0080]Unexpectedly, the enzyme is (R) selective, since HNLs up to now from the α/β-hydrolase family all favour (S) enantiomers. The transformed substrates encompass both aliphatic and aromatic compounds, however aldehydes were preferably accepted over ketones.

a) Activities for the Cleavage of Cyanohydrins:

[0081]The activities were measured for the cleavage of various commercially available cyanohydrins, however the individual substrates could only be compared with each other in a very limited manner since the substrates a) were partly racemic and also partly achiral and b) the purity of the commercially available substances varied widely. Pollution of the substrates with the corresponding aldehyde or ketone can inhibit the enzyme; this effect arises, for example, in the HNL from Manihot esculenta which is inhibited by benzaldehyde (impurity in mandelonitrile). For these reasons, observation of the cleavage reaction acts only as an initial overview (Table 3). Results which could be used for prediction purposes were obtained by examining the synthesis of cyanohydrins with subsequent gas chromatographic analysis.

TABLE-US-00005 TABLE 3 Substrate spectrum of AtHNL (cleavage reaction) Specific activity (U/mg) HCN-Test Benzaldehyde Substrate (cyanohydrin) (see Ib Test (see Ia R1 R2 above) above) Acetaldehyde cyanohydrin H H <0.05 Propionaldehyde cyanohydrin H CH3 <0.05 Benzaldehyde cyanohydrin H ##STR00002## 4.3 12.5 3-Phenoxybenzaldehyde cyano- hydrin H ##STR00003## 0.3 Acetone cyanohydrin CH3 CH3 <0.05 Cyclohexanone cyanohydrin ##STR00004## 0.11

b) Activities for the Synthesis of Cyanohydrins from Aldehydes/Ketones and Hydrocyanic Acid in a Two-Phase System:

[0082]For the AtHNL, a partial substrate spectrum was recorded (Table 4). The direction of synthesis was observed; the corresponding aldehyde was supplemented with hydrocyanic acid in a two-phase system (results in Table 4). All of the tested aldehydes were transformed; for ketones, only low activities were observed.

c) Demonstration of Stereoselectivity

[0083]The stereoselectivity was determined on the one hand using chiral gas chromatography (FIG. 6), and on the other hand in a cleavage test with enantiomerically pure benzaldehyde cyanohydrin. Only the (R) enantiomer formed or was transformed. As already described above, this circumstance was not predicted; the great similarity with MeHNL or HbHNL meant that (S) selectivity was assumed.

Example 7

Structural Investigations

[0084]Based on the crystal structure of the HNL from Hevea brasiliensis (PDB No. 1QJ4 (no substrate, 1SC9 (with acetone cyanohydrin)), a structural model of AtHNL was produced. FIG. 7).

TABLE-US-00006 TABLE 4 Partial substrate spectrum of AtHNL (synthesis reaction) Substrate (aldehyde or ketone) Trans- Reaction formation R1 R2 period (h) (%) ee (R) (%) Benzaldehyde H ##STR00005## 2 >99.9 95 3- phenoxybenzaldehyde H ##STR00006## 61.5 73 78 4- methoxybenzaldehyde H ##STR00007## 22.5 22.6 0 4-chlorbenzaldehyde H ##STR00008## 7 98 95 Phenylacetaldehyde H ##STR00009## 22.5 90 71 Hexanal H C5H11 2.5 98 n.d. Heptanal H C6H13 2 >99.9 >80% Octanal H C7H15 5 89 n.d. Benzyl acetone CH3 ##STR00010## 22 9 40 2-butanone CH3 C2H5 22 >95 0 2-pentanone CH3 C3H7 22 >95 0 2-hexanone CH3 C4H.sub.9 22 n.d. 0 2-heptanone CH3 C5H11 22 9 9 2-octanone CH3 C6H13 22 0 n.d.

[0085]Assumption of a α/β-hydrolase fold was obvious based on the great similarity (>65%) with known α/β-hydrolase-resembling HNLs and the conserved catalytic triad (S, D, H) and was supported by the model. Sterically too, the residues of the catalytic triad are correctly positioned. Further, the model provides clues to explaining the stereoselectivity and the substrate spectrum. On observing the substrate spectrum, it appears that the tested aldehyde can be transformed very well while the activity towards ketones is rather weak. The comparison of the model structure with the structure of HbHNL (with bound acetone cyanohydrin substrate), however, leads to the conclusion that this problem can be remedied by a point mutation. By comparison with the HbHNL structure, it is clear that one amino acid side chain (asparagine 12) in the model projects a long way into the binding pocket and collides with a methyl group of the substrate, while in the HbHNL crystal structure there is a less sterically hindering amino acid (threonine) in this position.

[0086]The structural analysis of the hydroxynitrile lyase of the invention also shows that the substrate in the active centre of AtHNL is stabilized by the alanine in position 13 (A13), the phenylalanine in position 82 (F82, backbone-NH group) and the asparagine in position 12 (N12, demonstrated by exchange). Further, because of their substrate contact, the amino acids serine in position 81 (S81) and histidine in position 236 (H236) can be assigned to the active centre. (In order to complete the catalytic triad, the asparaginic acid in position 208 (D208) also belongs to it).

[0087]Further amino acid residues in the substrate range, i.e. in or in the vicinity of the catalytic centre or substrate binding pocket are as follows:

M237, A210, L158, F153, L129, M149, Y14, C132, L147, F179, A13, L119, F107 and 1211.

[0088]A further substrate spectrum of the hydroxynitrile lyase of the invention can be seen in Table 5.

[0089]Initial attempts to stabilize the AtHNL at low pHs showed that sorbitol and saccharose at a pH of 5 cause a rise in the half life from 3 hours to more than 72 hours (200 mg/ml of sorbitol).

TABLE-US-00007 TABLE 5 Extended substrate spectrum for AtHNL Non-enzymatic trans- formation (%) Trans- (control reaction with- Substrate Time (h) formation (%) ee (R) (%) out enzyme) ##STR00011## R = H-- 1 2 >99 >99 14 R = o-F-- 2 2 >99 99 17 R = o-Cl-- 3 2 >99 99 26 R = o-Br-- 4 6 99 98 42 R = o-I-- 5 3 >99 >95 26 R = m-F-- 6 2 >99 >99 22 R = m-Cl-- 7 3 99 >99 7 R = m-Br-- 8 6 99 95 9 R = m-I-- 9 6 98 93 5 R = m-phenoxy 10 22 83 >95 0 R = p-F-- 11 2 >99 >99 7 R = p-Cl-- 12 2 >99 >99 4 R = p-Br-- 13 3 99 >99 4 R = p-I-- 14 6 99 92 7 R = p-hydroxy- 15 3 96 97 3 R = p-methoxy- 16 22 87 68 14 ##STR00012## 17 22 97 96 97 ##STR00013## 18 22 99 68 97 ##STR00014## 19 6 68 n.d..sup.[b] 6 ##STR00015## 20 6 99 98 78 ##STR00016## 21 22 56 >95 0 ##STR00017## 22 3 53 n.d..sup.[b] 0 ##STR00018## 23 22 0 -- 0 ##STR00019## 24 6 48 95 2 ##STR00020## 25 22 2 -- 0 ##STR00021## 26 3 94 --.sup.[c] 76 ##STR00022## 27 22 7 n.d. 0 ##STR00023## 28 22 8 95 0 ##STR00024## 29 3 1 -- 0

[0090]To support the structural model and improve the polypeptide of the invention and also to explain the reaction mechanism, insertion of the following point mutations into SEQ ID NO: 1 proved to be particularly advantageous: [0091]verification of α/β-hydrolase folding: the residues identified as the catalytic triad were exchanged for other (sterically similar, but without the corresponding function) amino acids; the resulting polypeptide no longer exhibited any activity: S81A; D208N; H236F; [0092]broadening of substrate spectrum to ketones: N12T, preferably as the double mutation with Y14C; [0093]reversal of enantioselectivity: L129W and/or Y14C.

[0094]The substantiated attempts to improve the polypeptide of the invention (for example as regards the substrate spectrum) have meant that, in addition to the wild type protein, the invention also claims variants which were produced by introducing individual point mutations into the DNA sequence (rational design) as well as by directed evolution methods (epPCR, saturation mutagenesis, etc).

Example 8

Production of AtHNL Using Fed Batch Fermentation on a 15 L Scale

[0095]In order to produce AtHNL on a larger scale, the expressed stock can be fermented in a fed bioreactor. The method used was a standard protocol for high cell density fermentation of E coli (Korz et al, 1995). A 42 L fermenter was inoculated with 100 ml of pre-culture in 10 L of medium; the culture was grown in the pre-defined medium for 27 h at 30° C. The feed rate depended on the quantity of glucose required to obtain optimum growth. After 27 h, induction with IPTG was started; thereafter the protein was expressed for a further 16 h, and then the cells were harvested by centrifuging. 1.75 kg of cells were obtained from a final volume of 15 L. For the subsequent purification (see Example 4), 20 g of cells were used, re-suspended in solubilizing buffer, solubilized by ultrasound, centrifuged and the residue was used as the unrefined extract. This unrefined extract (final volume approx 30 ml) had a volumetric activity of approx 800 μml and a specific activity of 13.3 U/mg. After purification over a Q-Sepharose column and subsequent desalting (see Example 4) as well as lyophilization, an activity of 2.5 U/mg of lyophilisate and a specific activity of approximately 40 U/mg protein was obtained. Starting from 20 g of cells, approximately 6 g of lyophilisate was produced corresponding to a total activity of approximately 15 kU. A high cell density fermentation with 15 L final volume thus produced a total of 525 g of lyophilisate with a total activity of 1300 kunits.

[0096]This example shows that the polypeptide of the invention can surprisingly also be produced readily in large quantities. The yield in the fermenter corresponded to that obtained on the laboratory scale.

LITERATURE

[0097]Albrecht J, Jansen I, Kula M R (1993) Improved Purification of an (R)-Oxynitrilase from Linum-Usitatissimum (Flax) and Investigation of the Substrate Range. Biotechnol Appl Biochem 17: 191-203 [0098]Andexer J, Guterl J K, Pohl M, Eggert T (2006) A high-throughput screening assay for hydroxynitrile lyase activity: Chem Commun 40: 4201-4203 [0099]Bray E A (2002) Classification of genes differentially expressed during water-deficit stress in Arabidopsis thaliana: an analysis using microarray and differential expression data. Ann Bot 89: 803-11 [0100]Bauer M, Griengl H, Steiner W (1999) Kinetic studies on the enzyme (S)-hydroxynitrile lyase from hevea brasiliensis using initial rate methods and progress curve analysis. Biotechnol Bioeng 62: 20-29 [0101]Buhler H, Effenberger F, Forster S, Roos J, Wajant H (2003) Substrate specificity of mutants of the hydroxynitrile lyase from Manihot esculenta. Chembiochem 4:211-216 [0102]Fechter M H, Griengl H (2004) Hydroxynitrile lyases: Biological sources and application as biocatalysts. Food Technol Biotechnol 42: 287-294 [0103]Gaisberger R P, Fechter M H, Griengl H (2004) The first hydroxynitrile lyase catalysed cyanohydrin formation in ionic liquids. Tetrahedron Asymmetry 15: 2959-2963 [0104]Glieder A, Weis R, Skranc W, Poechlauer P, Dreveny I, Majer S, Wubbolts M, Schwab H, Gruber K (2003) Comprehensive step-by-step engineering of an (R)-hydroxynitrile lyase for large-scale asymmetric synthesis. Angew Chem Int Ed Engl 42:4815-4818 [0105]Hasslacher M, Kratky C, Griengl H, Schwab H, Kohlwein S D (1997) Hydroxynitrile lyase from Hevea brasiliensis: molecular characterization and mechanism of enzyme catalysis. Proteins 27: 438-449 [0106]Korz D J, Rinas U, Hellmuth K, Sanders E A and Deckwer W-D (1995) Simple fed-batch technique for high cell density cultivation of Escherichia coli. J Biotechnol 39 (1). 59-65

[0107]Lee F, Mulligan R, Berg P, Ringold G (1981) Glucocorticoids regulate expression of dihydrofolate reductase cDNA in mouse mammary tumour virus chimaeric plasmids. Nature 294: 228-232 [0108]Ollis D L, Cheah E, Cygler M, Dijkstra B, Frolow F, Franken S M, Harel, Remington S J, Silman I, Schrag J (1992) The alpha/beta hydrolase fold. Protein Eng 5:197-211 [0109]Rosenthaler L (1908) Durch Enzyme bewirkte asymmetrische Synthesen. Biochem Z 14:238-253 [0110]Schmidt M, Griengl H (1999) Oxynitrilases: From cyanogenesis to asymmetric synthesis. Biocatalysis--from Discovery to Application 200: 193-226 [0111]Sharma M, Sharma N N, Bhalla T C (2005) Hydroxynitrile lyases: At the interface of biology and chemistry. Enzyme Microb Technol 37:279-294 [0112]Waspi U, Misteli B, Hasslacher M, Jandrositz A, Kohlwein S D, Schwab H, Dudler R (1998) The defense-related rice gene Pir7b encodes an alpha/beta hydrolase fold protein exhibiting esterase activity towards naphthol AS-esters. Eur J Biochem 254:32-37

Sequence CWU 1

41258PRTArabidopsis thaliana 1Met Glu Arg Lys His His Phe Val Leu Val His Asn Ala Tyr His Gly1 5 10 15Ala Trp Ile Trp Tyr Lys Leu Lys Pro Leu Leu Glu Ser Ala Gly His 20 25 30Arg Val Thr Ala Val Glu Leu Ala Ala Ser Gly Ile Asp Pro Arg Pro 35 40 45Ile Gln Ala Val Glu Thr Val Asp Glu Tyr Ser Lys Pro Leu Ile Glu 50 55 60Thr Leu Lys Ser Leu Pro Glu Asn Glu Glu Val Ile Leu Val Gly Phe65 70 75 80Ser Phe Gly Gly Ile Asn Ile Ala Leu Ala Ala Asp Ile Phe Pro Ala 85 90 95Lys Ile Lys Val Leu Val Phe Leu Asn Ala Phe Leu Pro Asp Thr Thr 100 105 110His Val Pro Ser His Val Leu Asp Lys Tyr Met Glu Met Pro Gly Gly 115 120 125Leu Gly Asp Cys Glu Phe Ser Ser His Glu Thr Arg Asn Gly Thr Met 130 135 140Ser Leu Leu Lys Met Gly Pro Lys Phe Met Lys Ala Arg Leu Tyr Gln145 150 155 160Asn Cys Pro Ile Glu Asp Tyr Glu Leu Ala Lys Met Leu His Arg Gln 165 170 175Gly Ser Phe Phe Thr Glu Asp Leu Ser Lys Lys Glu Lys Phe Ser Glu 180 185 190Glu Gly Tyr Gly Ser Val Gln Arg Val Tyr Val Met Ser Ser Glu Asp 195 200 205Lys Ala Ile Pro Cys Asp Phe Ile Arg Trp Met Ile Asp Asn Phe Asn 210 215 220Val Ser Lys Val Tyr Glu Ile Asp Gly Gly Asp His Met Val Met Leu225 230 235 240Ser Lys Pro Gln Lys Leu Phe Asp Ser Leu Ser Ala Ile Ala Thr Asp 245 250 255Tyr Met2808DNAArabidopsis thaliana 2atggagagga aacatcactt cgtgttagtt cacaacgctt atcatggagc ctggatctgg 60tacaagctca agcccctcct tgaatcagcc ggccaccgcg ttactgctgt cgaactcgcc 120gcctccggga tcgacccacg accaatccag gccgttgaaa ccgtcgacga atactccaaa 180ccgttgatcg aaaccctcaa atctcttcca gagaacgaag aggtaattct ggttggattc 240agcttcggag gcatcaacat cgctctcgcc gccgacatat ttccggcgaa gattaaggtt 300cttgtgttcc tcaacgcctt cttgcccgac acaacccacg tgccttctca cgttctggac 360aagtatatgg agatgcctgg aggtttggga gattgtgagt tttcatctca tgaaacaaga 420aatgggacga tgagtttatt gaagatggga ccaaaattca tgaaggcacg tctttaccaa 480aattgtccca tagaggatta cgagctggca aaaatgttgc ataggcaagg gtcatttttc 540acagaggatc tatcaaagaa agaaaagttt agcgaggaag gatatggttc ggtgcaacga 600gtttacgtaa tgagtagtga agacaaagcc atcccctgcg atttcattcg ttggatgatt 660gataatttca acgtctcgaa agtctacgag atcgatggcg gagatcacat ggtgatgctc 720tccaaacccc aaaaactctt tgactctctc tctgctattg ccaccgatta tatgtaataa 780tcttaagtcc gttttacttt tttctcat 808340DNAArtificial Sequence5' primer 3tataccatgg agaggaaaca tcacttcgtg ttagttcaca 40440DNAArtificial Sequence3' primer 4tatactcgag ttacatataa tcggtggcaa tagcagagag 40


Patent applications in class Preparing nitrogen-containing organic compound

Patent applications in all subclasses Preparing nitrogen-containing organic compound


User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
Images included with this patent application:
(R)-HYDROXYNITRILE LYASE FROM BRASSICACEAE diagram and image(R)-HYDROXYNITRILE LYASE FROM BRASSICACEAE diagram and image
(R)-HYDROXYNITRILE LYASE FROM BRASSICACEAE diagram and image(R)-HYDROXYNITRILE LYASE FROM BRASSICACEAE diagram and image
(R)-HYDROXYNITRILE LYASE FROM BRASSICACEAE diagram and image(R)-HYDROXYNITRILE LYASE FROM BRASSICACEAE diagram and image
(R)-HYDROXYNITRILE LYASE FROM BRASSICACEAE diagram and image(R)-HYDROXYNITRILE LYASE FROM BRASSICACEAE diagram and image
(R)-HYDROXYNITRILE LYASE FROM BRASSICACEAE diagram and image(R)-HYDROXYNITRILE LYASE FROM BRASSICACEAE diagram and image
(R)-HYDROXYNITRILE LYASE FROM BRASSICACEAE diagram and image(R)-HYDROXYNITRILE LYASE FROM BRASSICACEAE diagram and image
(R)-HYDROXYNITRILE LYASE FROM BRASSICACEAE diagram and image
New patent applications in this class:
DateTitle
2013-05-09Enone reductases
2013-04-18Process for production of cadaverine
2013-04-11Biocatalysts and methods for the synthesis of (s)-3-(1-aminoethyl)-phenol
2013-03-21Method for producing 1,5-pentanediamine
2013-02-07Process for the enzymatic production of carnitine from beta-lactones
Top Inventors for class "Chemistry: molecular biology and microbiology"
RankInventor's name
1Anthony P. Burgard
2Rangarajan Sampath
3Mark J. Burk
4Toshifumi Fukui
5Robert Dicosimo