Patent application title: NOVEL RECOMBINANT AND MUTANT ADENOVIRUSES

Inventors: Mark D. Cochran Christina H. Chiang
Agents: SCHERING-PLOUGH CORPORATION;PATENT DEPARTMENT (K-6-1, 1990)
Assignees:
Origin: KENILWORTH, NJ US
IPC8 Class: AA61K3912FI
USPC Class: 4241991
Patent application number: 20090274724

Abstract:

The present invention provides novel viral vectors. In one embodiment, the present invention provides mutant and recombinant bovine adenoviruses having a deletion and/or insertion of DNA in the early gene region 4 (E4). In another embodiment, the present invention provides mutant and recombinant bovine adenovirus 1 viruses having a deletion and/or insertion of DNA in the early gene region 3 (E3). The present invention also contemplates the use of the viral vectors for vaccination, gene therapy or other applications as suitable.

Claims:

1. A recombinant virus comprising a foreign DNA sequence inserted into the E4 gene region of a bovine adenovirus.

2. The recombinant virus of claim 1, wherein said foreign DNA encodes a polypeptide from a virus or bacteria selected from the group consisting of bovine rotavirus, bovine coronavirus, bovine herpes virus type 1, bovine respiratory syncytial virus, bovine para influenza virus type 3 (BPI-3), bovine diarrhea virus, bovine rhinotracheitis virus, bovine parainfluenza type 3 virus, Pasteurella haemolytica, Pasteurella multocida and/or Haemophilus somnus.

3. The recombinant virus of claim 2, wherein said polypeptide comprises more than ten amino acids.

4. The recombinant virus of claim 2, wherein said polypeptide is antigenic.

5. The recombinant virus of claim 1, wherein said bovine adenovirus is a Subgroup 1 bovine adenovirus.

6. The recombinant virus of claim 1, wherein said bovine adenovirus is a Subgroup 2 bovine adenovirus.

7. The recombinant virus of claim 5, wherein said foreign DNA sequence is under control of a promoter located upstream of said foreign DNA sequence

8. A mutant virus comprising a deletion of at least a portion of the E4 gene region of a bovine adenovirus.

9. The mutant virus of claim 8 which also has a foreign DNA sequence inserted into the E4 gene region.

10. The mutant virus of claim 8, wherein at least one open reading frame of said E4 gene region of said bovine adenovirus is completely deleted.

11. A recombinant virus comprising a foreign DNA sequence inserted into the E3 gene region of a bovine adenovirus 1.

12. The recombinant virus of claim 11, wherein said foreign DNA encodes a polypeptide from a virus or bacteria selected from the group consisting of bovine rotavirus, bovine coronavirus, bovine herpes virus type 1, bovine respiratory syncytial virus, bovine para influenza virus type 3 (BPI-3), bovine diarrhea virus, bovine rhinotracheitis virus, bovine parainfluenza type 3 virus, Pasteurella haemolytica, Pasteurella multocida and/or Haemophilus somnus.

13. The recombinant virus of claim 12, wherein said polypeptide comprises more than ten amino acids.

14. The recombinant virus of claim 12, wherein said polypeptide is antigenic.

15. The recombinant virus of claim 12, wherein said foreign DNA sequence is under control of a promoter located upstream of said foreign DNA sequence.

16. A mutant virus comprising a deletion of at least a portion of the E3 gene region of a bovine adenovirus 1.

17. The mutant virus of claim 16 which also has a foreign DNA sequence inserted into the E3 gene region.

18. The recombinant virus of claim 16, wherein at least one open reading frame of said E3 gene region of said bovine adenovirus 1 is completely deleted.

19. A vaccine comprising the recombinant virus of claim 1.

20. A method of inducing an immunological response in an animal, comprising introducing the vaccine of claim 19 to said animal.

21. A vaccine comprising the recombinant virus of claim 11.

22. A method of inducing an immunological response in an animal comprising introducing the vaccine of claim 21 to said animal.

Description:

[0001]The benefit of the Apr. 9, 1999 filing date of Provisional Application No. 60/128,766 is claimed.

FIELD OF THE INVENTION

[0002]The present invention relates to viral vectors for vaccination of animals. In particular, the present invention pertains to viral vectors having insertion sites for the introduction of foreign DNA.

BACKGROUND OF THE INVENTION

[0003]The adenoviruses cause enteric or respiratory infection in humans as well as in domestic and laboratory animals.

[0004]Inserting genes into adenoviruses has been accomplished. In the human adenovirus (HuAd) genome there are two important regions: E1 and E3 in which foreign genes can be inserted to generate recombinant adenoviruses.

[0005]This application of genetic engineering has resulted in several attempts to prepare adenovirus expression systems for obtaining vaccines. Examples of such research include the disclosure of U.S. Pat. No. 4,510,245 of an adenovirus major late promoter for expression in a yeast host; U.S. Pat. No. 4,920,209 of a live recombinant adenovirus type 7 with a gene coding for hepatitis-B surface antigen; European patent No. 389,286 of a non-defective human adenovirus 5 recombinant expression system in human cells; and published International application No. WO 91/11525 of live non-pathogenic immunogenic viable canine adenovirus in a cell.

[0006]However, because they are more suitable for entering a host cell, an indigenous adenovirus vector would be better suited for use as a live recombinant virus vaccine in different animal species compared to an adenovirus of human origin. For example, bovine adenovirus-based expression vectors have been reported for bovine adenovirus 3 (BAV-3) (see U.S. Pat. No. 5,820,868).

[0007]Bovine adenoviruses (BAVs) comprise at least nine serotypes divided into two subgroups. These subgroups have been characterized based on enzyme-linked immunoassays (ELISA), serologic studies with immunofluorescence assays, virus-neutralization tests, immunoelectron microscopy and by their host specificity and clinical syndromes. Subgroup 1 viruses include BAV 1, 2, 3 and 9 and grow relatively well in established bovine cells compared to subgroup 2 viruses which include BAV 4, 5, 6, 7 and 8.

[0008]BAV-3 was first isolated in 1965 and is the best characterized of the BAV genotypes and contains a genome of approximately 35 kilobases. The locations of hexon and proteinase genes in the BAV-3 genome have been identified and sequenced.

[0009]Genes of the bovine adenovirus 1 (BAV-1) genome have also been identified and sequenced. However, the location and sequences of other genes such as certain early gene regions in the BAV genome have not been reported.

[0010]The continued identification of suitable viruses and gene insertion sites are valuable for the development of new vaccines. The selection of (i) a suitable virus and (ii) the particular portion of the genome to use as an insertion site for creating a vector for foreign gene expression, however, pose a significant challenge. In particular, the insertion site must be non-essential for the viable replication of the virus, as well as its operation in tissue culture and in vivo. Moreover, the insertion site must be capable of accepting new genetic material, while ensuring that the virus continues to replicate.

[0011]What is needed is the identification of novel viruses and gene insertion sites for the creation of new viral vectors.

SUMMARY OF THE INVENTION

[0012]In one embodiment, the present invention provides recombinant viruses. while not limited to a particular use, these recombinant viruses can be used to generate vaccines.

[0013]While not limited to a particular virus, in one embodiment the present invention provides a recombinant virus comprising a foreign DNA sequence inserted into the E4 gene region of a bovine adenovirus. In a preferred embodiment, the insertion is to a non-essential site. In another embodiment, the present invention provides a recombinant virus comprising a foreign DNA sequence inserted into the E3 gene region of a bovine adenovirus 1. In a preferred embodiment, the insertion is to a non-essential site.

[0014]While not limited to its ability to replicate, in a preferred embodiment, the recombinant virus is replication competent. Likewise, while not limited to the foreign DNA to be inserted, in a preferred embodiment, the foreign DNA encodes a polypeptide and is from a virus or bacteria selected from the group consisting of bovine rotavirus, bovine coronavirus, bovine herpes virus type 1, bovine respiratory syncytial virus, bovine para influenza virus type 3 (BPI-3), bovine diarrhea virus, bovine rhinotracheitis virus, bovine parainfluenza type 3 virus, Pasteurella haemolytica, Pasteurella multocida and/or Haemophilus somnus. In another preferred embodiment, the foreign DNA encodes a cytokine. In a further preferred embodiment, the polypeptide comprises more than ten amino acids and is antigenic. Finally, in a particularly preferred embodiment, the foreign DNA sequence is under the control of a promoter located upstream of the foreign DNA sequence.

[0015]The present invention also contemplates mutant viruses. While not limited to a particular mutant virus, in one embodiment, the mutant virus comprises a deletion of at least a portion of the E4 gene region of a bovine adenovirus. In a preferred embodiment, the deletion is of a non-essential site. In another embodiment, the virus comprises a deletion of at least a portion of the E3 gene region of a bovine adenovirus 1. In a preferred embodiment, the mutant virus is replication competent. In a further preferred embodiment, at least one open reading frame of the relevant gene region of the bovine adenovirus is completely deleted.

[0016]In yet another embodiment, the present invention provides a method for preparing a recombinant virus comprising inserting at least one foreign gene or gene fragment that encodes at least one antigen into the genome of a virus wherein said gene or gene fragment has been inserted into the early gene region 4 of a bovine adenovirus or inserted into the early gene region 3 of bovine adenovirus 1. In a preferred embodiment, the method includes the insertion of at least a part of the genome of a virus into a bacterial plasmid, transforming said bacteria with said plasmid, and incubating said bacteria at approximately 25.degree. C.

[0017]In another embodiment, the present invention provides vaccines. While not limited to a particular vaccine, in one embodiment, the vaccines comprise the recombinant viruses described above.

[0018]The present invention also contemplates methods of vaccination, including, but not limited to, the introduction of the above-described vaccines to an animal.

Definitions

[0019]The term, "animal" refers to organisms in the animal kingdom. Thus, this term includes humans, as well as other organisms. Preferably, the term refers to vertebrates. More preferably, the term refers to bovine animals.

[0020]A "vector" is a replicon, such as a plasmid, phage, cosmid or virus, to which another DNA sequence may be attached so as to bring about the expression of the attached DNA sequence.

[0021]For purposes of this invention, a "host cell" is a cell used to propagate a vector and its insert. Infecting the cell can be accomplished by methods well known to those skilled in the art, for example, as set forth in Transfection of BAV-1 DNA below.

[0022]A DNA "coding sequence" is a DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, procaryotic sequences, cDNA from eucaryotic mRNA, genomic DNA sequences from eucaryotic (e.g., mammalian) DNA, viral DNA, and even synthetic DNA sequences. A polyadenylation signal and transcription termination sequence can be located 3' to the coding sequence.

[0023]A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase or an auxiliary protein and initiating transcription of a downstream (3' direction) coding sequence. For purposes of defining the present invention, the promoter sequence is in close proximity to the 5' terminus by the translation start codon (ATG) of a coding sequence and extends upstream (5' direction) to include the minimum number of bases or elements necessary to facilitate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site, as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eucaryotic promoters will often, but not always, contain "TATA" boxes and "CAAT" boxes, conserved sequences found in the promoter region of many eucaryotic organisms.

[0024]A coding sequence is "operably linked to" or "under the control of" promoter or control sequences in a cell when RNA polymerase will interact with the promoter sequence directly or indirectly and result in transcription of the coding sequence into mRNA, which is then translated into the polypeptide encoded by the coding sequence.

[0025]A "double-stranded DNA molecule" refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its normal, double-stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes, for example, double-stranded DNA found in linear DNA molecules (e.g., restriction fragments of DNA from viruses, plasmids, and chromosomes), as well as circular and concatamerized forms of DNA.

[0026]A "foreign DNA sequence" is a segment of DNA that has been or will be attached to another DNA molecule using recombinant techniques wherein that particular DNA segment is not found in association with the other DNA molecule in nature. The source of such foreign DNA may or may not be from a separate organism than that into which it is placed. The foreign DNA may also be a synthetic sequence having codons different from the native gene. Examples of recombinant techniques include, but are not limited to, the use of restriction enzymes and ligases to splice DNA.

[0027]An "insertion site" is a restriction site in a DNA molecule into which foreign DNA can be inserted.

[0028]For purposes of this invention, a "homology vector" is a plasmid constructed to insert foreign DNA sequence in a specific site on the genome of an adenovirus.

[0029]The term "open reading frame" or "ORF" is defined as a genetic coding region for a particular gene that, when expressed, can produce a complete and specific polypeptide chain protein.

[0030]A cell has been "transformed" with exogenous DNA when such exogenous DNA has been introduced inside the cell membrane. Exogenous DNA may or may not be integrated (covalently linked) to chromosomal DNA making up the genome of the cell. In procaryotes and yeasts, for example, the exogenous DNA may be maintained on an episomal element, such as a plasmid. A stably transformed cell is one in which the exogenous DNA has become integrated into the chromosome so that it is inherited by daughter cells through chromosome replication. For mammalian cells, this stability is demonstrated by the ability of the cell to establish cell lines or clones comprised of a population of daughter cells containing the exogenous DNA.

[0031]A "replication competent virus" is a virus whose genetic material contains all of the DNA or RNA sequences necessary for viral replication as are found in a wild-type of the organism. Thus, a replication competent virus does not require a second virus or a cell line to supply something defective in or missing from the virus in order to replicate. A "non-essential site in the adenovirus genome" means a region in the adenovirus genome, the polypeptide product or regulatory sequence of which is not necessary for viral infection or replication.

[0032]Two polypeptide sequences are "substantially homologous" when at least about 80% (preferably at least about 90%, and most preferably at least about 95%) of the amino acids match over a defined length of the molecule.

[0033]Two DNA sequences are "substantially homologous" when they are identical to or not differing in more that 40% of the nucleotides, more preferably about 20% of the nucleotides, and most preferably about 10% of the nucleotides.

[0034]A virus that has had a foreign DNA sequence inserted into its genome is a "recombinant virus," while a virus that has had a portion of its genome removed by intentional deletion (e.g., by genetic engineering) is a "mutant virus."

[0035]The term "polypeptide" is used in its broadest sense, i.e., any polymer of amino acids (dipeptide or greater) linked through peptide bonds. Thus, the term "polypeptide" includes proteins, oligopeptides, protein fragments, analogs, muteins, fusion proteins, etc.

[0036]"Antigenic" refers to the ability of a molecule containing one or more epitopes to stimulate an animal or human immune system to make a humoral and/or cellular antigens specific response. An "antigen" is an antigenic polypeptide.

[0037]An "immunological response" to a composition or vaccine is the development in the host of a cellular and/or antibody-mediated immune response to the composition or vaccine of interest. Usually, such a response consists of the subject producing antibodies, B cells, helper T cells, suppressor T cells, and/or cytotoxic T cells directed specifically to an antigen or antigens included in the composition or vaccine of interest.

[0038]The terms "immunogenic polypeptide" and "immunogenic amino acid sequence" refer to a polypeptide or amino acid sequence, respectively, which elicit antibodies that neutralize viral infectivity, and/or mediate antibody-complement or antibody dependent cell cytotoxicity to provide protection of an immunized host. An "immunogenic polypeptide" as used herein, includes the full length (or near full length) sequence of the desired protein or an immunogenic fragment thereof.

[0039]By "immunogenic fragment" is meant a fragment of a polypeptide which includes one or more epitopes and thus elicits antibodies that neutralize viral infectivity, and/or mediates antibody-complement or antibody dependent cell cytotoxicity to provide protection of an immunized host. Such fragments will usually be at least about 5 amino acids in length, and preferably at least about 10 to 15 amino acids in length. There is no critical upper limit to the length of the fragment, which could comprise nearly the fill length of the protein sequence, or even a fusion protein comprising fragments of two or more of the antigens.

[0040]By "infectious" is meant having the capacity to deliver the viral genome into cells.

[0041]A "substantially pure" protein will be free of other proteins, preferably at least 10% homogeneous, more preferably 60% homogeneous, and most preferably 95% homogeneous.

BRIEF DESCRIPTION OF THE DRAWING FIGURE

[0042]FIG. 1 is a diagram of BAV-1 genomic DNA showing the relative size of various regions in kilobase pairs. Fragments are lettered in order of decreasing size.

DETAILED DESCRIPTION OF THE INVENTION

[0043]Throughout this disclosure, various publications, patents and patent applications are referenced. The disclosures of these publications, patents and patent applications are herein incorporated by reference.

[0044]The methods and compositions of the present invention involve modifying DNA sequences from various prokaryotic and eucaryotic sources and by gene insertions, gene deletions, single or multiple base changes, and subsequent insertions of these modified sequences into the genome of an adenovirus. One example includes inserting parts of an adenovirus DNA into plasmids in bacteria, reconstructing the virus DNA while in this state so that the DNA contains deletions of certain sequences, and/or furthermore adding foreign DNA sequences either in place of the deletions or at sites removed by the deletions.

[0045]Generally, the foreign gene construct is cloned into an adenovirus nucleotide sequence which represents only a part of the entire adenovirus genome, which may have one or more appropriate deletions. This chimeric DNA sequence is usually present in a plasmid which allows successful cloning to produce many copies of the sequence. The cloned foreign gene construct can then be included in the complete viral genome, for example, by in vivo recombination following a DNA-mediated cotransfection technique. Multiple copies of a coding sequence or more than one coding sequences can be inserted into the viral genome so that the recombinant virus can express more than one foreign protein or multiple copies of the same protein. The foreign gene can have additions, deletions or substitutions to enhance expression and/or immunological effects of the expressed protein.

[0046]In order for successful expression of the gene to occur, it can be inserted into an expression vector together with a suitable promoter including enhancer elements and polyadenylation sequences. A number of eucaryotic promoter and polyadenylation sequences which provide successful expression of foreign genes in mammalian cells and how to construct expression cassettes, are known in the art, for example in U.S. Pat. No. 5,151,267. The promoter is selected to give optimal expression of immunogenic protein which in turn satisfactorily leads to humoral, cell mediated and mucosal immune responses according to known criteria.

[0047]The polypeptide encoded by the foreign DNA sequence is produced by expression in vivo in a recombinant virus-infected cell. The polypeptide may be immunogenic. More than one foreign gene can be inserted into the viral-genome to obtain successful production of more than one effective protein.

[0048]Therefore, one utility of the use of a mutant adenovirus or the addition of a foreign DNA sequence into the genome of an adenovirus is to vaccinate an animal. For example, a mutant virus could be introduced into an animal to elicit an immune response to the mutant virus.

[0049]Alternatively, a recombinant adenovirus having a foreign DNA sequence inserted into its genome that encodes a polypeptide may also serve to elicit an immune response in an animal to the foreign DNA sequence, the polypeptide encoded by the foreign DNA sequence and/or the adenovirus itself. Such a virus may also be used to introduce foreign DNA and its products into the host animal to alleviate a defective genomic condition in the host animal or to enhance the genomic condition of the host animal.

[0050]While the present invention is not limited to the use of particular viral vectors, in preferred embodiments the present invention utilizes bovine adenovirus expression vector systems. In particularly preferred embodiments, the present invention comprises a bovine adenovirus in which part or all of the E4 gene region is deleted and/or into which foreign DNA is introduced. Alternatively, the system comprises a bovine adenovirus 1 (BAV-1) in which part or all of the E3 and/or E4 gene regions are deleted and/or into which foreign DNA is introduced.

[0051]The present invention is not limited by the foreign genes or coding sequences (viral, prokaryotic, and eukaryotic) that are inserted into a bovine adenovirus nucleotide sequence in accordance with the present invention. Typically the foreign DNA sequence of interest will be derived from pathogens that in bovine cause diseases that have an economic impact on the cattle or dairy industry. The genes may be derived from organisms for which there are existing vaccines, and because of the novel advantages of the vectoring technology, the adenovirus derived vaccines will be superior. Also, the gene of interest may be derived from pathogens for which there is currently no vaccine but where there is a requirement for control of the disease. Typically, the gene of interest encodes immunogenic polypeptides of the pathogen and may represent surface proteins, secreted proteins and structural proteins.

[0052]The present invention is not limited by the particular organisms from which a foreign DNA sequence is obtained for gene insertion into a bovine adenovirus genome. In preferred embodiments, the foreign DNA is from bovine rotavirus, bovine coronavirus, bovine herpes virus type 1, bovine respiratory syncytial virus, bovine para influenza virus type 3 (BPI-3), bovine diarrhea virus, bovine rhinotracheitis virus, bovine parainfluenza type 3 virus, Pasteurella haemolytica, Pasteurella multocida and/or Haemophitus somnus. In another preferred embodiment, the foreign DNA encodes a cytokine.

[0053]The present invention is also not limited to the use of a particular DNA sequence from such an organism. Often selection of the foreign DNA sequence to be inserted into an adenovirus genome is based upon the protein it encodes. Preferably, the foreign DNA sequence encodes an immunogenic polypeptide.

[0054]The preferred immunogenic polypeptide to be expressed by the virus systems of the present invention contain full-length (or near full-length) sequences encoding antigens. Alternatively, shorter sequences that are immunogenic (i.e., encode one or more epitopes) can be used. The shorter sequence can encode a neutralizing epitope, which is defined as an epitope capable of eliciting antibodies that neutralize virus infectivity in an in vitro assay. Preferably the peptide should encode a protective epitope that is capable of raising in the host an protective immune response; i.e., an antibody-mediated and/or a cell-mediated immune response that protects an immunized host from infection. In some cases the gene for a particular antigen can contain a large number of introns or can be from an RNA virus. In these cases a complementary DNA copy (cDNA) can be used.

[0055]It is also possible to use fragments of nucleotide sequences of genes rather than the complete sequence as found in the wild-type organism. where available, synthetic genes or fragments thereof can also be used. However, the present invention can be used with a wide variety of genes and/or fragment and is not limited to those set out herein.

[0056]Thus, the antigens encoded by the foreign DNA sequences used in the present invention can be either native or recombinant immunogenic polypeptides or fragments. They can be partial sequences, full-length sequences, or even fusions (e.g., having appropriate leader sequences for the recombinant host and/or with an additional antigen sequence for another pathogen).

[0057]The present invention is also not limited by the ability of the resulting recombinant and mutant viruses to replicate. In a preferred embodiment, the mutant and recombinant viruses of the present invention are replication competent. In this manner, a complimenting cell line is not necessary to produce adequate supplies of virus.

[0058]As stated above, the present invention contemplates the administration of the recombinant and mutant viruses of the present invention to vaccinate an animal. The present invention is not limited by the nature of administration to an animal. For example, the antigens used in the present invention, particularly when comprised of short oligopeptides, can be conjugated to a vaccine carrier. Vaccine carriers are well known in the art: for example, bovine serum albumin (BSA), human serum albumin (HSA) and keyhole limpet hemocyanin (KLH). A preferred carrier protein, rotavirus VP6, is disclosed in EPO Pub. No. 0259149.

[0059]The vaccines of the present invention carrying foreign genes or fragments can also be orally administered in a suitable oral carrier, such as in an enteric-coated dosage form. Oral formulations include such normally-employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin cellulose, magnesium carbonate, etc. Oral vaccine compositions may be taken in the form of solutions (e.g., water), suspensions, tablets, pills, capsules, sustained release formulations, or powders, containing from about 10% to about 95% of the active ingredient, preferably about 25% to about 70%. An oral vaccine may be preferable to raise mucosal immunity in combination with systemic immunity, which plays an important role in protection against pathogens infecting the gastrointestinal tract.

[0060]In addition, the vaccine can be formulated into a suppository For suppositories, the vaccine composition will include traditional binders and carriers, such as polyalkaline glycols or triglycerides. Such suppositories may be formed from mixtures containing the active ingredient in the range of about 0.5% to about 10% (w/w), preferably about 1% to about 2%.

[0061]Protocols for administering the vaccine composition(s) of the present invention to animals are within the skill of the art in view of the present disclosure. Those skilled in the art will select a concentration of the vaccine composition in a dose effective to elicit an antibody and/or T-cell mediated immune response to the antigenic fragment.

[0062]The timing of administration may also be important. For example, a primary inoculation preferably may be followed by subsequent booster inoculations if needed. It may also be preferred, although optional, to administer a second, booster immunization to the animal several weeks to several months after the initial immunization. To insure sustained high levels of protection against disease, it may be helpful to readminister a booster immunization to the animals at regular intervals, for example once every several years. Alternatively, an initial dose may be administered orally followed by later inoculations, or vice versa. Preferred vaccination protocols can be established through routine vaccination protocol experiments.

[0063]The dosage for all routes of administration of an in vivo recombinant virus vaccine depends on various factors, including the size of the patient, the nature of the infection against which protection is needed, the type of carrier and other factors, which can readily be determined by those of skill in the art. By way of non-limiting example, a dosage of between 10.sup.3 plaque forming units (pfu) and 10.sup.8 pfu can be used.

[0064]The present invention also includes a method for providing gene therapy to a mammal in need thereof to control a gene deficiency. In one embodiment, the methods comprises administering to said mammal a live recombinant bovine adenovirus containing a foreign nucleotide sequence encoding a non-defective form of a gene. The foreign nucleotide sequence is either incorporated into the mammalian genome or is maintained independently to provide expression of the required gene in the target organ or tissue. These kinds of techniques have recently been used by those of skill in the art to replace a defective gene or portion thereof For example, U.S. Pat. No. 5,399,346 to Anderson et al. describes techniques for gene therapy. Moreover, examples of foreign genes nucleotide sequences or portions thereof that can be incorporated for use in a conventional gene therapy include, but are not limited to, cystic fibrosis transmembrane conductance regulator gene, human minidystrophin gene, alpha 1-antitrypsin gene and others.

[0065]Methods for constructing, selecting and purifying recombinant adenovirus are detailed below in the materials, methods and examples below. The following serve to illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.

Preparation of Bovine Adenovirus (BAV-1) Stock

[0066]Bovine adenovirus stocks were prepared by infecting tissue culture cells, Madin-Darby bovine kidney cells (MDBK), at a multiplicity of infection of 0.01 PFU/cell in Dulbecco's Modified Eagle Medium (DMEM) containing 2 mM glutamine, 100 units/ml penicillin, 100 units/ml streptomycin (these components are obtained from Sigma (St. Louis, Mo.) or an equivalent supplier, and hereafter are referred to as complete DME medium) plus 1% fetal bovine serum. After cytopathic effect was complete, the medium and cells were harvested. After one or two cycles of freezing (-70.degree. C.) and thawing (37.degree. C.), the infected cells were aliquot as 1 ml stock and stored frozen at -70''C.

Preparation of Bovine Adenovirus (BAV-1) DNA

[0067]All manipulations of bovine adenovirus were made using strain 10 (ATCC VR-313). For the preparation of BAV-1 viral DNA from the cytoplasm of infected cells, MDBK cells were infected at a multiplicity of infection (MOI) sufficient to cause extensive cytopathic effect before the cells overgrew. All incubations were carried out at 37.degree. C. in a humidified incubator with 5% CO.sub.2 in air.

[0068]The best DNA yields were obtained by harvesting monolayers which were maximally infected, but showing incomplete cell lysis (typically 5-7 days). Infected cells were harvested by scraping the cells into the medium using a cell scraper (Costar brand). The cell suspension was centrifuged at 3000 rpm for 10 minutes at 5.degree. C. in a GS-3 rotor (Sorvall Instruments, Newtown, Conn.). The resultant pellet was resuspended in cold PBS (20 ml/Roller Bottle) and subjected to another centrifugation for 10 minutes at 3000 rpm in the cold.

[0069]After decanting the PBS, the cellular pellet was resuspended in 5 ml/roller bottle of TE buffer (10 mM Tris pH 7.5 and 1 mM EDTA) and swell on ice for 15 minutes. NP40 Nonidet P40..TM..; Sigma, St. Louis, Mo.) was added to the sample to a final concentration of 0.5% and keep on ice for another 15 minutes. The sample was centrifuged for 10 minutes at 3000 rpm in the cold to pellet the nuclei and remove cellular debris.

[0070]The supernatant fluid was carefully transferred to a 30 ml Corex centrifuge tube. SDS (sodium dodecyl sulfate; stock 20%) were added to the sample to final concentrations of 1%. 200 .mu.l of proteinase-K at 10 mg/ml (Boelringer Mannheim, Indianapolis, Ind.) was added per roller bottle of sample, mixed, and incubated at 45.degree. C. for 1-2 hours.

[0071]After this period, an equal volume of water-saturated phenol was added to the sample and mixed by vortex. The sample was spun in a clinical centrifuge for 5 minutes at 3000 rpm to separate the phases. NaAc was added to the aqueous phase to a final concentration of 0.3M (stock solution 3M pH 5.2), and the nucleic acid precipitated at -70.degree. C. for 30 minutes after the addition of 2.5 volumes of cold absolute ethanol. DNA in the sample was pelleted by spinning for 20 minutes to 8000 rpm in an HB-4 rotor at 4.degree. C.

[0072]The supernatant was carefully removed and the DNA pellet washed once with 25 ml of 80% ethanol. The DNA pellet was dried briefly by vacuum (2-3 minutes), and resuspended in 2 ml/roller bottle of infected cells of TE buffer (20 mM Tris pH 7.5, 1 mM EDTA). 10 .mu.l of RNaseA at 10 mg/ml (Sigma, St. Louis, Mo.) was added and incubate at 37.degree. C. for one hour. 0.5 ml of 5N NaCl and 0.75 ml of 30% PEG was added and precipitated at 4.degree. C. overnight.

[0073]DNA in the sample was pelleted by spinning for 20 minutes to 8000 rpm in an HB-4 rotor at 4.degree. c. Resuspend pellet in 2 ml TE buffer (20 mM Tris pH7.5, 1 mM EDTA and 0.2% SDS) and extracted with an equal volume of water-saturated phenol. The sample was spun in a clinical centrifuge for 5 minutes at 3000 rpm to separate the phases. NaAc was added to the aqueous phase to a final concentration of 0.3M (stock solution 3M pH 5.2), and the nucleic acid precipitated at -70.degree. C. for 30 minutes after the addition of 2.5 volumes of cold absolute ethanol.

[0074]DNA in the sample was pelleted by spinning for 20 minutes to 8000 rpm in an HB-4 rotor at 5.degree. C. The supernatant was carefully removed and the DNA pellet washed once with 25 ml of 80% ethanol. The DNA pellet was dried briefly by vacuum (2-3 minutes), and resuspended in 200 .mu.l/roller bottle of infected cells of TE buffer (10 mM Tris pH 7.5, 1 mM EDTA). All viral DNA was stored at approximately 4.degree. C.

Molecular Biological Techniques

[0075]Techniques for the manipulation of bacteria and DNA, including such procedures as digestion with restriction endonucleases, gel electrophoresis, extraction of DNA from gels, ligation, phosphorylation with kinase, treatment with phosphatase, growth of bacterial cultures, transformation of bacteria with DNA, and other molecular biological methods are described by Maniatis et al. (T. Maniatis, et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y. (1982)) and Sambrook et al. (J. Sambrook, et al., Molecular Cloning: A Laboratory Manual Second Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989)). The polymerase chain reaction (PCR) was used to introduce restriction sites convenient for the manipulation of various DNAs. The procedures used are described by Innis et al (M. A. Innis, et al., PCR Protocols: A Guide To Methods And Applications, pp. 84-91, Academic Press, Inc., San Diego, Calif. (1990)).

[0076]In general, amplified fragments were less than 2000 base pairs in size and critical regions of amplified fragments were confirmed by DNA sequencing. Except as noted, these techniques were used with minor variations.

DNA Sequencing

[0077]DNA sequencing was performed on the Applied Biosystems Automated Sequencer Model 373A (with XL upgrade) per instructions of the manufacturer. Subclones were made to facilitate sequencing. Internal primers were synthesized on an ABI 392 DNA synthesizer or obtained commercially (Genosys Biotechnologies, Inc., The Woodlands, Tex.) larger DNA sequences were built utilizing consecutive overlapping primers. Sequence across the junctions of large genomic subclones was determined directly using a full length genomic clone as template. Assembly, manipulation and comparison of sequences was performed with DNAstar programs. Comparisons with GenBank were performed using NCBI BLAST programs (Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.).

Construction of Recombinant BAV-1 Genomes in E. coli

[0078]Recombinant BAV-1 genomes are constructed by homologous recombination according to the method of C. Chartier et al (1996) J. of Virology 70:805-4810.

[0079]A small, easily manipulated plasmid was constructed containing approximately 1000 base pairs each of the Left and Right ends of the BAV-1 genome. Homologous recombination between this vector and BAV-1 genomic DNA results in a plasmid containing the entire BAV-1 genome (adenoviral backbone vector). This BAV-1 genomic plasmid may be used to generate recombinant genomes by linearization of the plasmid and recombination with homology DNAs engineered to contain foreign DNA flanked by DNA derived from the desired BAV-1 insertion site. Note that in order to linearize the adenoviral backbone vector, an infrequent cutting enzyme must be located within the region analogous to the flanking BAV-1 sequences.

[0080]We have mapped the restriction sites of such an enzyme. PvuI cuts the BAV-1 genome at two locations one in the BamH1 D fragment and one in the BamH1 C fragment (see FIG. 1). The adenoviral backbone vector contains a third PvuI site within the antibiotic resistance gene of the plasmid. The PvuI site within the BamH1 C fragment is suitable for gene insertion sites within both the E3 and E4 regions. Therefore a partial PvuI digestion of the adenoviral backbone vector will yield a sub population of molecules linearized at the PvuI site in the BamH1 C fragment. These molecules may recombine with the homology DNA to generate a viable plasmid. Molecules linearized at the other two sites will not be able to recombine to generate viable plasmids.

[0081]The high competence of bacteria cells E. coli BJ5183 recBC sbcBC (D. Hanahan (1983) J. Mol. Biol. 166:557-580) is desired to achieve efficient recombination. Typically, 10 nanograms of a restriction fragment containing foreign DNA flanked by the appropriate BAV insertion sequences (homology DNA) is mixed with 1 nanogram of linearized adenoviral backbone vector in a total volume of 10 .mu.l. Fifty microliters of competent BJ5183 cells were added. After 15 min. on ice, 5 min. at 37.degree. C. and 15 min. on ice, 200 .mu.l of LB was added and the cells plated on agar containing LB+80 .mu.g/ml carbenicillin, after one hour at 37.degree. C.,

[0082]Low temperature (25-27.degree. C.) for growing small scale cultures (for screening carbenicillin resistant colonies) and subsequent large scale cultures (for isolation of large quantities of plasmid DNA) is essential. Carb.sup.R colonies were first grown in 4-5 ml cultures at 25-27.degree. C. for two days. Small scale DNAs were prepared using boiling method (J. Sambrook, et al., Molecular Cloning: A Laboratory Manual Second Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989)) and analyzed by DNA restriction analysis. To purify the DNA away from vector DNA concatemers the UNAs from correct clones were re-transform into DH10B (Life Technologies) cells. Analysis of bacterial colonies by DNA restriction analysis was repeated. Glycerol stocks were prepared from the correct clones and stored at -70.degree. C. Large quantities of plasmid DNA were prepared using Qiagen Plasmid Kit (Qiagen Inc.) or scale-up of boiling method from 250 ml cultures which were inoculated with glycerol stock and grown at 37.degree. C. for one day.

Transfection of BAV-1 DNA

[0083]Approximately 1.5.times.10.sup.5 cells/ml (MBK) were plated in 6 cm plates 24 hr before transfection, by which time they reached 50-70% confluency. For transfection the Lipofectin method was used according to the manufacturer's instructions (Lipofectin, Life Technologies, Rockville, Md.). A transfection mix was prepared by adding several (4-15) .mu.g of BAV-1 viral DNA or linearized genome plasmid DNA and 50 .mu.l of Lipofectin Reagent to 200 .mu.l of serum-free medium according to the manufacturer's instruction.

[0084]After incubation at room temperature for 15-30 min, the transfection mix was added to the cells. After 4-6 hr at 37.degree. C., the media containing the transfection mix was removed, and 5 ml of growth medium was added. Cyopathic effect became apparent within 7-10 days. The transfected virus stock was harvested by scraping cells in the culture and stored at -70.degree. C.

Plaque Purification of Recombinant Constructs

[0085]Monolayers of MDBK cells in 6 cm or 10 cm plates were infected with transfection stock, overlaid with nutrient agarose media and incubated for 5-10 days at 37.degree. C. Once plaques have developed, single and well-isolated plaque was picked onto MDBK cells. After 5-10 days when 80-90% cytopathic effect was reached, the infected cells (P1 stock) were harvested and stored at -70.degree. C. This procedure was repeated one more time with P1 stock.

Cloning of Bovine Viral Diarrhea Virus (BVDV) Glycoprotein 53 (g53) Gene

[0086]The bovine viral diarrhea g53 gene was cloned by a PCR cloning procedure essentially as described by Katz et al. (Journal of Virology 64: 1808-1811 (1990)) for the HA gene of human influenza. Viral RNA prepared from BVD virus Singer strain grown in MDBK cells was first converted to cDNA utilizing an oligonucleotide primer specific for the target gene. The cDNA was then used as a template for polymerase chain reaction (PCR) cloning (M. A. Innis et al., PCR Protocols: A Guide to Methods and Applications, 84-91, Academic Press, Inc. San Diego (1990)) of the targeted region. The PCR primers were designed to incorporate restriction sites which permit the cloning of the amplified coding regions into vectors containing the appropriate signals for expression in BAV-1. One pair of oligonucleotides were required for the coding region. The g53 gene coding region (amino acids 1-394) from the BVDV Singer strain (M. S. Collett et al., Journal of Virology 65, 200-208, (1988)) was cloned using the following primers: 5'-CTGGATCCTCATCCATACTGAGTCCCTGAGGCCTTCTGTTC-3' [SEQ ID NO: 1] for cDNA priming and combined with 5'-CATAGATCTTGTGGTGCTGTCCGACTT CGCA-3' [SEQ ID NO: 2] for PCR.

Western Blotting Procedure

[0087]Samples of lysates and protein standards were on a polyacrylamide gel according to the procedure of Laemnli, Nature 227, 680-685 (1970)). After gel electrophoresis the proteins were transferred and processed according to Sambrook, et al., Molecular Cloning A Laboratory Manual Second Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989). The primary antibody was a mouse monoclonal antibody (Mab 6.12.2 from Dubovi, Cornell University, Ithaca, N.Y.) diluted 1:100 with 5% non-fat dry milk in Tris-sodium chloride, and sodium Azide (TSA: 6.61g Tris-HCl, 0.97 g Tris-base, 9.0 g NaCl and 2.0 g Sodium Azide per liter H2O). The secondary antibody was a goat anti-mouse alkaline phosphatase conjugate diluted 1:1000 with TSA.

Plasmid 990-11

[0088]Plasmid 990-11 contains the Left and Right ends of the BAV-1 genome. These sequences were cloned by standard PCR methods (M. A. Innis, et al., PCR Protocols: A Guide To Methods And Applications, pp. 84-91, Academic Press, Inc., San Diego, Calif. (1990) using primers based on the sequences determined for the EcoR1 A and BamH1 F fragments respectively. Primers (1) 5'-3' GGCCTTAATTAACATCATCAATAATA TACGGAACAC [SEQ ID NO: 5] and (2) 5'-3' GGAAGATCTTGAGCATGCAGAGC AATTCACGCCGGGTAT [SEQ ID NO: 6] were used to PCR the Left end of BAV-1. Since three repetitive elements within this region shared the same 5' end sequences (i. e. primer 1), 1760 bp, 1340 bp and 920 bp BAV-1 DNA fragments were amplified by PCR. The 920 bp DNA fragment was cloned into PCR-Blunt vector (Invitrogen, Carlsbad, Calif.). Primers (1) and (3) 5'-GGCAATGAGATCTTTTGGATGACAAGCTGAGCTACGCG-3' [SEQ ID NO: 7] were used to PCR the Right end of BAV-1, 740 bp and 1160 bp PCR products were amplified and 1160 bp fragment DNA was cloned into pCR-Blunt vector (Invitrogen, Carlsbad, Calif.). Plasmid 990-11 was then constructed by cloning the BAV-1 end fragments into the polylinker of plasmid pPolyII (R. Lathe, J. L. Vilotte, and A. J. Clark, Gene, 57:193-201, 1997). The end fragments were cloned as a single PacI fragment containing a unique BglII site at their internal junction. Only the BamH1 and EcoR1 sites were retained from the polylinker.

Plasmid 990-50 (Adenoviral Backbone Vector)

[0089]Plasmid 990-50 was constructed according to the method described above (Construction of Recombinant BAV-1 Genomes in E. coli). Briefly, co-transformation of the BglII-linearized plasmid 990-11 and BAV-1 genomic DNA regenerated a stable circular plasmid containing the entire BAV-1 genome. In this plasmid PacI sites flank the inserted BAV-1 genomic sequences. As Pac is absent from BAV-1 genomic DNA, digestion with this enzyme allows the precise excision of the full-length BAV-1 genome from the plasmid 990-50.

Plasmid 996-80D

[0090]Plasmid 996-80D contains DNA encompassing approximately 5945 base pairs of the Right end of the BAV-1 genome from which the EcoR1 "G" and "H" fragments have been deleted and replaced with a synthetic SmaI site. The plasmid was constructed for the purpose of deleting a portion of the BAV-1 E4 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique SmaI restriction enzyme site into which foreign DNA may be inserted. The plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The plasmid vector is derived from an approximately 2774 base pair HindIII to PvuII restriction fragment of pSP64 (Promega Corporation, Madison, Wis.). The synthetic linker sequence 5'-CTGTAGATCTGCGGCCGCGTTTAAACGT CGACAAGCTTCCC-3' [SEQ ID NO: 8] is ligated to the PvuII site of pSP64 (Promega Corporation, Madison, Wis.). Fragment 1 is an approximately 1693 base pair PstI to EcoR1 sub fragment of the BAV-1 BamH1 "C" fragment (positions 28241 to 2993 from SEQ ID NO: 3). The synthetic linker sequence 5'-AATTCGAGCTCGCCCGGGCGAGCTCGA-3' [SEQ ID NO: 9] is ligated to fragment 1 retaining EcoR1 sites at both ends of the linker sequence. Fragment 2 is an approximately 48 base pair EcoR1 to BamH1 restriction sub fragment of the BAV-1 BamH1 "C" fragment positions 31732 to 31779 from SEQ ID NO: 3). Fragment 3 is the approximately 2406 base pair BAV-1 BamH1 "F" fragment positions 31780 to 34185 from SEQ ID NO: 3). The synthetic linker sequence 5'-GACTCTAGGGGCGGGGAGTTTAAACGCGGCCGCAGATCTAGCT-3' [SEQ ID NO: 10] is ligated between fragment 3 and the HindIII site of pSP64 (Promega Corporation, Madison, Wis.). Note that the BAV-1 sequences can be cut out of this plasmid via the NotI restriction sites located in the flanking synthetic linker sequences.

Plasmid 1004-73.16.14

[0091]Plasmid 1004-73.16.14 contains a recombinant BAV-1 genome from which the EcoR1 "G" and "H" fragments have been deleted and replaced by a synthetic SmaI site (5'-GAATTCGAGCTCGCCCGGGCGAGCTCGAATTC-3') [SEQ ID NO: 11]. This plasmid may be used to generate recombinant bovine adenovirus vectors with deletion and gene insertions at the E4 region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 996-80D and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1004-07.16

[0092]Plasmid 1004-07.16 was constructed by inserting a BVDV g53 gene, engineered to be under control of the human cytomegalovirus immediate early promoter (Invitrogen, Carlsbad, Calif.), into the unique SmaI site of plasmid 996-80D. The BVDV g53 gene was isolated according to the method above (Cloning of Bovine Viral Diarrhea virus g53 gene).

Plasmid 1004-40

[0093]Plasmid 1004-40 contains a recombinant BAV-1 genome from which the EcoR1 G and H fragments have been deleted, The gene for the bovine viral diarrhea virus (BVDV) glycoprotein 53 (g53) (amino acids 1-394) under the control of the HCMV immediate early promoter was inserted into the deleted region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1004-17.16 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1018-14.2

[0094]Plasmid 1018-14.2 contains DNA flanking the E3 region of BAV-1, from which a specific region of this sequence flanked by SalI and BamH1 sites (positions 25664 to 26840 from SEQ ID NO: 3) has been deleted. The plasmid was constructed for the purpose of deleting the corresponding portion of the BAV-1 E3 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique HindIII restriction enzyme site into which foreign DNA may be inserted. The plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The plasmid vector is derived from an approximately 2774 base pair HindIIII to PvuII restriction fragment of pSP64 (Promega Corporation, Madison, Wis.). The synthetic linker sequence 5'-CTGTAGATCTG CGGCCGCGTTTAAACG-3' [SEQ ID NO: 12] is ligated to the PvuII site of pSP64 (Promega Corporation, Madison, Wis.). Fragment 1 is an approximately 2665 base pair SalI to SalI sub fragment (positions 22999 to 25663 from SEQ ID NO: 3) of the BAV-1 BamH1 B fragment. Fragment 1 is ligated to the upstream synthetic sequence retaining the SalI site at the junction. Fragment 1 contains a unique AvaI site (positions 25317 to 25322 from SEQ ID NO: 3). Fragment 1 is oriented such that the unique AvaI site is closer (406 base pairs) to fragment 2 than to the plasmid vector. The synthetic linker sequence 5'-TCGACAAGCTTCCC-3' [SEQ ID NO: 13] is ligated to second end of fragment 1 again retaining the SalI site at the junction. Fragment 2 is an approximately 4223 base pair BamH1 to HindIII restriction sub fragment of the BAV-1 BamH1 C fragment (positions 26851 to 31073 from SEQ ID NO: 3). Note that the end of both fragments were blunt end by treatment with T4 polymerase. The synthetic linker sequence 5'-CCCGGG AGTTTAAACGCGGCCGCAGATCTAGCT-3' [SEQ ID NO. 14] is ligated between fragment 2 and the HindIII site of pSP.sup.64 (Promega Corporation, Madison, Wis.). Note that the HindIII site is not retained. The BAV-1 sequences can be cut out of this plasmid via the NotI restriction sites located in the flanking synthetic linker sequences.

Plasmid 1018-75

[0095]Plasmid 1018-75 contains a recombinant BAV-1 genome from which a specific region of the BamH1 "B" fragment (positions 25664 to 26840 from SEQ ID NO: 3) has been deleted. This plasmid may be used to generate recombinant bovine adenovirus vectors with deletions and gene insertions at the E3 region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1018-14.2 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1018-23C15

[0096]Plasmid 1018-23C15 was constructed by inserting a BVDV g53 gene, engineered to be under control of the human cytomegalovirus immediate early promoter (Invitrogen, Carlsbad, Calif.), into the unique HindIII site of plasmid 1018-14.2. The BVDV g53 gene was isolated according to the method above (Cloning of Bovine Viral Diarrhea virus g53 gene).

Plasmid 1018-42

[0097]Plasmid 1018-42 contains a recombinant BAV-1 genome from which a specific region of the BamH1 "B" fragment (positions 25664 to 26840 from SEQ ID NO: 3) has been deleted. The gene for the bovine viral diarrhea virus (BVDV) glycoprotein 53 (g53) (amino acids 1-394) under the control of the HCMV immediate early promoter was inserted into the deleted region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1018-23C15 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1018-45

[0098]Plasmid 1018-45 contains DNA flanking the E3 region of BAV-1, from which a specific region of this sequence flanked by EcoR1 and BamH1 sites positions 25765 to 26850 from SEQ ID NO: 3) has been deleted. The plasmid was constructed for the purpose of deleting the corresponding portion of the BAV-1 E3 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique HindIII restriction enzyme site into which foreign DNA may be inserted. The plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The plasmid vector is derived from an approximately 2774 base pair HindIIII to PvuII restriction fragment of pSP64 (Promega Corporation, Madison, Wis.). The synthetic linker sequence 5'-CTGTAGATC TGCGGCCGCGTTTAACG-3' [SEQ ID NO: 12] is ligated to the PvuII site of pSP64 (Promega Corporation, Madison, Wis.). Fragment 1 is an approximately 1582 base pair SacI to EcoR1 sub fragment (positions 24183 to 25764 from SEQ ID NO: 3) of the BAV-1 BamH1 B fragment. Fragment 1 is ligated to the upstream synthetic sequence. The fragment was blunted end with T4 polymerase treatment so neither the SacI nor EcoR1 sites are retained. Fragment 1 contains a unique AvaI site (positions 25317 to 25322 from SEQ ID NO: 3). Fragment 1 is oriented such that the unique AvaI site is closer (406 base pairs) to fragment 2 than to the plasmid vector. The synthetic linker sequence 5'-CAAGCTTCCC-3' [SEQ ID NO: 17] is ligated to second end of fragment 1 again retaining the SalI site at the junction. Fragment 2 is an approximately 4223 base pair BamH1 to HindIII restriction sub fragment of the BAV-1 BamH1 C fragment positions 26851 to 31073 from SEQ ID NO: 3). Note that the end of both fragments were blunt end by treatment with T4 polymerase. The synthetic linker sequence 5'-CCCGG GAGTTTAAACGCGGCCGCAGATCTAGCT-3' [SEQ ID NO: 14] is ligated between fragment 2 and the HindIII site of pSP64 (Promega Corporation, Madison, Wis.). Note that the HindIII site is not retained. The BAV-1 sequences can be cut out of this plasmid via the NotI restriction sites located in the flanking synthetic linker sequences.

Plasmid 1028-03

[0099]Plasmid 1028-03 contains a recombinant BAV-1 genome from which a specific region of the BamH1 "B" fragment (positions 25765 to 26850 from SEQ ID NO: 3) has been deleted. This plasmid may be used to generate recombinant bovine adenovirus vectors with deletions and gene insertions at the E3 region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1018-45 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1028-77

[0100]Plasmid 1028-77 was constructed by inserting a BVDV g53 gene, engineered to be under control of the human cytomegalovirus immediate early promoter (Invitrogen, Carlsbad, Calif.), into the unique HindIII site of plasmid 1018-45. The BVDV g53 gene was isolated according to the method above (Cloning of Bovine Viral Diarrhea virus g53 gene).

Plasmid 1038-16

[0101]Plasmid 1038-16 contains a recombinant BAV-1 The genome from which a specific region of the BamH1 "B" fragment (positions 25765 to 26850 from SEQ ID NO: 3) has been deleted. The gene for the bovine viral diarrhea virus (BVDV) glycoprotein 53 (g53) (amino acids 1-394) under the control of the HCMV immediate early promoter was inserted into the deleted region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1028-77 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1054-93

[0102]Plasmid 1054-93 contains DNA derived from the E4 region of BAV-1. The sequence corresponding to positions 33614 to 3375 fro SEQ ID NO: 3 has been deleted and replaced with a synthetic PstI site. The plasmid was constructed for the purpose of deleting a portion of the BAV-1 E4 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique PstI restriction enzyme site into which foreign DNA may be inserted. The plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. Note that fragments derived from BAV-1 DNA are ligated in the orientation indicated by the positions given for each fragment, The plasmid vector is derived from an approximately 2774 base pair HindIII to PvuII restriction fragment of pSP64 (Promega Corporation, Madison, Wis.). The synthetic linker sequence 5'-CTGTAGATCTGCGG CCGCGTTTAAACGTCGACAAGCTTCCC-3' [SEQ ID NO: 8] is ligated to the PvuII site of pSP64 (Promega Corporation, Madison, Wis.). Fragment I is an approximately 3538 base pair PstI to BamHI sub fragment of the BAV-1 BamHI "C" fragment positions 28241 to 31779 from SEQ. ID NO.3. Fragment 1 is ligated to the 3' end of the synthetic linker sequence [SEQ ID NO: 8]. Fragment 2 is an approximately 1832 base pair PCR fragment containing sequences derived from the BAV-1 genome (positions 31780 to 33613 from SEQ ID NO: 3). Fragment 2 is ligated to fragment 1 such that the BamHI site at the junction is retained. The synthetic linker sequence 5'-CTGCAG-3' [SEQ ID NO: 4] is ligated to fragment 2. Fragment 3 is an approximately 460 base pair PCR fragment containing sequences derived from the BAV-1 genome positions 33725 to 34185 from SEQ ID NO: 3). Fragment 3 is ligated to the 3, end of the synthetic linker sequence 5'-CTGCAG-3'. The synthetic linker sequence 5'-GACTCTAGGGGCGGGGAGTTT AAACGCGGCCGCAGATCTAGCT-3' [SEQ ID NO: 10] is ligated between fragment 3 and the HindIII site of pSP64 (Promega Corporation, Madison, Wis.). Note that the BAV-1 sequences can be cut out of this plasmid via the NotI restriction sites located in the flanking synthetic linker sequences.

Plasmid 1055-38

[0103]Plasmid 1055-38 contains DNA derived from the E4 region of BAV-1. The sequence encoding nORF13 (see Table 1) has been deleted and replaced with a synthetic PstI site. The plasmid was constructed for the purpose of deleting a portion of the BAV-1 E4 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique PstI restriction enzyme site into which foreign DNA may be inserted. The plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining DNA fragments from the following sources with the synthetic DNA sequences indicated. Note that fragments derived from BAV-1 DNA are ligated in the orientation indicated by the positions given for each fragment. The plasmid vector is derived from an approximately 2774 base pair HindIII to PvuII restriction fragment of pSP64 (Promega Corporation, Madison, Wis.). The synthetic linker sequence 5'-CTGTAGATCTGCGGCCGCGTTTAAACGTCGACAAGCTTCCC-3' [SEQ ID NO: 8] is ligated to the PvuII site of pSPM (Promega Corporation, Madison, Wis.). Fragment 1 is an approximately 1282 base pair PCR fragment containing sequences derived from the BAV-1 genome (positions 28240 to 29522 from SEQ ID NO: 3). Fragment 1 is ligated to the 3' end of the synthetic linker sequence indicated above [SEQ ID NO: 8]. The synthetic linker sequence 5'-CTGCAG-3' [SEQ ID NO: 4] is ligated to fragment 1. Fragment 2 is an approximately 1372 base pair PCR fragment containing sequences derived from the BAV-1 genome positions 30407 to 31779 from SEQ ID NO: 3). Fragment 2 is ligated to the 3' end of the synthetic linker sequence 5'-CTGCAG-3' [SEQ ID NO: 4]. Fragment 3 is the approximately 2406 base pair BAV-1 BamH1 "F" fragment (positions 31779 to 34185 from SEQ ID NO: 3). Fragment 3 is ligated to the 3' end of fragment 2. The synthetic linker sequence 5'-GACTCTAGGGGCGGGGAGTTTTA AACGCGGCCGCAGATCTAGCT-3' [SEQ ID NO: 10] is ligated between fragment 3 and the HindIII site of SP64 (Promega Corporation, Madison, Wis.). Note that the BAV-1 sequences can be cut out of this plasmid via the NotI restriction sites located in the flanking synthetic linker sequences.

Plasmid 1055-52

[0104]Plasmid 1055-52 contains a recombinant BAV-1 genome from which a portion of the E4 region positions 29522-30407 from SEQ ID NO: 3) has been deleted and replaced by a synthetic PstI site (5-CTGCAG-3') [SEQ ID NO: 4]. This plasmid may be used to generate recombinant bovine adenovirus vectors with gene insertions and/or a deletion at the E4 region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1055-38 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1055-47

[0105]Plasmid 1055-47 was constructed by inserting a BVDV g53 gene into the unique Pst1 site of plasmid 1055-38. The BVDV coding region was inserted in the reverse complimentary orientation such that it is transcribed by the E4 region promoter located at the right end of the genome. The BVDV g53 gene was isolated according to the method above (Cloning of Bovine Viral Diarrhea virus g53 gene).

Plasmid 1055-56

[0106]Plasmid 1055-56 contains a recombinant BAV-1 genome from which the BAV-1's sequence from positions 29522 to 30407 [SEQ ID NO: 3] has been deleted. The gene for the BVDV g53 (amino acids 1-394) was inserted into the deleted region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1055-47 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1055-93

[0107]Plasmid 1055-93 contains DNA derived from the E4 region of BAV-1. The sequence encoding nORF13 (see Table 1) has been deleted and replaced with a synthetic PstI site. Te plasmid was constructed for the purpose of deleting a portion of the BAV-1 E4 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique PstI restriction enzyme site into which foreign DNA may be inserted. The plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining DNA fragments from the following sources with the synthetic DNA sequences indicated. Note that fragments derived from BAV-1 DNA are ligated in the orientation indicated by the positions given for each fragment. The plasmid vector is derived from an approximately 2774 base pair HindIII to PvuII restriction fragment of pSP64 (Promega Corporation, Madison, Wis.). The synthetic linker sequence S'-CTGTAGATCTGCGGCCGCGTTTAAACGTCGACAAGCTTCCC-3' [SEQ ID NO: 8] is ligated to the PvuII site of pSP64 (Promega Corporation, Madison, Wis.). Fragment 1 is an approximately 1282 base pair PCR fragment containing sequences derived from the BAV-1 genome positions 28240 to 29522 from SEQ ID NO: 3). Fragment 1 is ligated to the 3' end of the synthetic linker sequence indicated above [SEQ ID NO: 8]. The synthetic linker sequence 5'-CTGCAG-3' [SEQ ID NO: 4] is ligated to fragment 1. Fragment 2 is an approximately 1372 base pair PCR fragment containing sequences derived from the BAV-1 genome (positions 30403 to 31779 from SEQ ID NO: 3). Fragment 2 is ligated to the 3' end of the synthetic linker sequence 5'-CTGCAG-3' [SEQ ID NO. 4]. Fragment 3 is the approximately 2406 base pair BAV-1 BamH1 "F" fragment (positions 31779 to 34185 from SEQ ID NO: 3). Fragment 3 is ligated to the 3' end of fragment 2. The synthetic linker sequence 5'-GACTCTAGGGGCGGG GAGTTTAAACGCGGCCGCAGATCTAGCT-3' [SEQ ID NO: 10] is ligated between fragment 3 and the HindIII site of pSP64 (Promega Corporation, Madison, Wis.). Note that the BAV-1 sequences can be cut out of this plasmid via the NotI restriction sites located in the flanking synthetic linker sequences.

Plasmid 1064-26

[0108]Plasmid 1064-26 contains a recombinant BAV-1 genome from which a portion of the E4 region (positions 33613 to 33725 from SEQ ID NO: 3) has been deleted and replaced by a synthetic PstI site (5'-CTGCAG-3') [SEQ ID NO: 4]. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1054-93 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1066-29

[0109]Plasmid 1066-29 was constructed by inserting a BVDV g53 gene into the unique Pst1 site of plasmid 1055-93. The BVDV coding region was inserted in the reverse complimentary orientation such that it is transcribed by the E4 region promoter located at the right end of the genome. The BVDV g53 gene was isolated according to the method above (Cloning of Bovine Viral Diarrhea virus g53 gene).

Plasmid 106644

[0110]Plasmid 1066-44 contains a recombinant BAV-1 genome from which a portion of to the E4 region (positions 29523 to 30403 from SEQ ID NO: 3) has been deleted and replaced by a synthetic PstI site (5'-CTGCAG-3') [SEQ ID NO: 4]. This plasmid may be used to generate recombinant bovine adenovirus vectors with gene insertions and/or a deletion at the E4 region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1055-93 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1066-51

[0111]Plasmid 1066-51 contains a recombinant BAV-1 genome from which the BAV-1's sequence from positions 30403 to 29523 [SEQ ID NO: 3] has been deleted. The gene for the BVDV g53 (amino acids 1-394) was inserted into the deleted region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1066-29 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

EXAMPLES

Example 1

Sequence of BAV-1

[0112]By convention we will refer to the region containing the EcoR1 A fragment as the Left end of the BAV-1 genome. To complement the previously published restriction map (Maria Benko and B. Harrach, 1990 Acta Veterinaria Hungarica 38:281-284) other restriction enzyme sites in the BAV-1 genome were defined (PuvI, SmaI). The complete genome was cloned as several large restriction fragments. These included BamHI "B", "C", "D", "F", EcoR1 "A", "E", and PvuI "B". The genome was also clone in its entirety as described above (Construction of Recombinant BAV-1 Genomes in E. coli). These clones and 126 different oligonucleotide primers were used according to the method described above (DNA Sequencing) to determine an over lapping sequence for the entire BAV-1 genome.

[0113]This sequence (34,185 base pairs ) contains 43 methionine initiated open reading frames (ORF) of greater than or equal to 110 amino acids (excluding smaller nested ORFs). All 43 ORFs were compared to the current version of the Genbank protein subset as described in the methods above (DNA Sequencing). Based on the BLAST analysis 28 of the ORFs (ORFS 1-28) exhibited significant homology to one or more other virus genes. Fifteen ORFs showed no significant homology to virus genes in the current version of Genbank (nORFs 1-15). Table 1 shows that the ORFs have a widely varying homology to adenovirus genes from several different species.

TABLE-US-00001 TABLE 1 BAV-1 Left end Open reading frames (Orf) % ORF* Location** Best Match to GenBank*** Similarity. ORF1 1400, 1867 BAV-2 E1A 49.5% ORF2 2189, 2656 BAV-2 E1B 58.6% ORF3 2566, 3777 SAV-3 E1B 42.3% ORF4 3838, 4185 BAV-2 Hexon 36.9% ORF5 RC 4197, 5315 HuAd-7 Maturation Protein 69.6% ORF6 RC 5285, 8530 BAV-2 Polymerase 72.9% ORF7 6255, 6680 HuAd-7 unknown protein 59.4% ORF8 RC 8527, 10185 BAV-2 Terminal protein 71.2% ORF9 10376, 11437 CAV-1 Orf9 63.0% ORF10 11465, 13174 CAV-2 Hexon protein 57.0% ORF11 13235, 14662 SAV-3 Penton base protein 74.6% ORF12 14725, 15207 BAV-2 Major core protein 37.1% ORF13 15267, 16388 BAV-2 Minor core protein 62.2% ORF14 16703, 17113 CAV-1 Minor capsid protein 60.5% ORF15 17509, 20238 CAV-1 Hexon Late protein 2 75.3% ORF16 20241, 20864 BAV-2 endoprotease 82.6% ORF17 RC 20906, 22246 OvAV DNA binding protein 77.8% ORF18 22258, 24498 BAV-3 Late 100 kd protein 59.0% ORF19 24212, 24796 BAV-3 Late 33 kd protein 44.0% ORF20 25009, 25680 BAV-1 Hexon protein 97.8% ORF21 25673, 26041 BAV-1 E3 12.5 kd protein 87.7% ORF22 25923, 27287 BAV-1 unknown protein 85.8% ORF23 27483, 29294 HuAd-12 Fiber protein 31.2% ORF24 RC 29311, 29730 HuAd-40 E4 protein 38.2% ORF25 RC 30404, 30739 HuAd-12 unknown protein 38.5% ORF26 RC 30730, 31464 HuAd-40 E4 30 kd protein 28.9% ORF27 RC 31471, 32232 HuAd-9 E4 34 kd protein 40.8% ORF28 RC 32956, 33384 AvAd dUTPase 54.7% nOrf1 278, 736 nOrf2 697, 1167 nOrf3 5634, 5975 nOrf4 RC 10301, 10669 nOrf5 RC 12607, 13212 nOrf6 RC 14246, 14722 nOrf7 RC 15479, 16102 nOrf8 RC 17878, 18288 nOrf9 19031, 19621 NOrf10 21464, 21991 NOrf11 RC 24437, 24820 nOrf12 RC 27800, 28174 nOrf13 RC 29523, 30407 nOrfl4 RC 32219, 32557 nOrfl5 RC 33438, 33908 *RC, reverse compliment **positions on SEQ ID NO: 3 ***AvAd, Avian adenovirus; HuAD, Human Adenovirus; CAV, Canine Adenovirus, SAV, swine adenoviras; OvAd, sheep adenovirus

[0114]The E3 and E4 gene regions of BAV-1 can defined by homology to genes from the corresponding regions of the human adenoviruses. Evans et al (Virology 244:173-185) define the BAV-1 E3 gene region as bound by the TATA box sequence at positions 25362 to 25365 and the polyadenlyation signal at positions 27291 to 27296. Analysis of the gene homologies from Table 1 indicates that the E4 region of BAV-1 is bounded by the polyadenylation signal at positions 29059 to 29065 and the TATA box sequence at positions 34171 to 34174.

[0115]BAV-1 exhibits a complex sequence organization at its left and night ends. The genome exhibits an inverted terminal repeat (ITR) of 578 base pairs. A sequence of 419 base pairs is repeated twice at the left end of the genome. A single inverted copy of this repeat occurs at the right end of the genome. The two 419 base pair repeats a the left end of the genome are followed by a 424 bp sequence that appears as an inverted copy upstream of the 419 base pair sequence at the right end of the genome.

[0116]The sequence of the BAV-1 genome is useful for the construction of recombinant BAV-1 viral vectors For example this information may be used by analogy to human adenovirus vector systems to predict non-essential regions that may be used as gene insertion sites. The information may also be used to predict intergenic regions, which may also be used as gene insertion sites.

Example 2

Method of Constructing Recombinant BAV-1 Viral Vectors

[0117]We have developed a novel procedure for the generation of recombinant bovine adenovirus vectors. This procedure takes advantage of recombinant viral genomes constructed as bacterial plasmids (see methods--Construction of Recombinant BAV-1 Genomes in E. coli. When DNA derived from these bacterial plasmids is transfected into the appropriate cells (see methods--Transfection of BAV-1 DNA) recombinant bovine adenovirus vectors are generated.

[0118]This procedure is exemplified by the infectivity of plasmid 990-50. DNA derived from this plasmid was transfected as described above into MDBK cells. Progeny viruses recovered from independent transfection stocks were amplified on MDBK cells and analyzed for growth characteristics, virus production yields, and DNA restriction patterns. In all cases, plasmid 990-50 derived adenovirus (S-BAV-002) was indistinguishable from wild-type BAV-1.

[0119]This procedure can be used to generate bovine adenovirus vectors expressing useful foreign DNA sequences. The procedure may also be used to delete genomic sequences from the bovine adenovirus vector. The production of bovine adenovirus vectors bearing a bovine diarrhea virus (BVDV) glycoprotein E2 (g53) expression cassette and deletions in E4 and E3 regions of BAV-1 respectively are described below (see examples 4-6.

Example 3

Preparation of Recombinant Adenovirus Vector S-BAV-003

[0120]S-BAV-003 is a BAV-1 s that has a deletion in the E4 region of the genome. This deletion spans the EcoR1 H and G fragments. This deletion removes all or a major portion of ORFs 25-27 and nORF13. A poly linker sequence (GAATTCGAGCTCGCCCGGGCGAGCTCGAATTC) [SEQ ID NO: 15] containing a SmaI site was inserted into the deletion. As SmaI is absent from BAV-1 genomic DNA (see FIG. 1), the introduction of this poly linker sequence creates a useful unique SmaI site that may be exploited to directly engineer the virus.

[0121]S-BAV-003 was created by transfection of DNA derived from plasmid 1004-73.16.14 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs). Progeny viruses derived from independent transfection stocks were amplified on MDBK cells and analyzed for BamH1, EcoR1, and SmaI DNA restriction patterns. This analysis indicates that the EcoR1 G and H fragments have been deleted and a SmaI site has been introduced into the genome. S-BAV-003 was also shown to grow to similar titers as the wild type BAV-1.

Example 4

Preparation of Recombinant Adenovirus Vector S-BAV-004

[0122]S-BAV-004 is a BAV-1 virus that has a deletion in the E4 region of the genome. This deletion spans the EcoR1 H and G fragments. This deletion removes all or a major portion of ORFs 25-27 and nORF13. The gene for the bovine viral diarrhea virus (BVDV) glycoprotein 53 (g53) (amino acids 1-394) under the control of the HCMV immediate early promoter was inserted into the deleted region.

[0123]S-BAV-004 was created by transfection of DNA derived from plasmid 1004-40 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant-Constructs).

Example 5

Preparation of Recombinant Adenovirus Vector S-BAV-005

[0124]S-BAV-005 is a BAV-1 virus that has a deletion in the E3 region of the genome. The smaller SalI to BamH1 sub fragment of BamH1 fragment "B.sup.1" (positions 25664 to 26850 from SEQ ID NO: 3) has been deleted. This deletion removes a major portion of ORFs 21 and 22. A poly linker sequence (5'-TCGACAAGCTTCCC-3') [SEQ ID NO: 16] containing a HindIII site was inserted into the deletion.

[0125]S-BAV-005 was created by transfection of DNA derived from plasmid 1018-75 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs).

Example 6

Preparation of Recombinant Adenovirus Vector S-BAV-006

[0126]S-BAV-006 is a BAV-1 virus that has a deletion in the E3 region of the genome. The smaller SalI to BamH1 sub fragment of BamH-1 fragment B (positions 25664 to 26850 from SEQ ID NO: 3) has been deleted. This deletion removes a major portion of ORFs 21 and 22. The gene for the BVDV g53 (amino acids 1-394) under the control of the HCMV immediate early promoter was inserted into the deleted region.

[0127]S-BAV-006 was created by transfection of DNA derived from plasmid 1018-42 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs).

Example 7

Preparation of Recombinant Adenovirus Vector S-BAV-007

[0128]S-BAV-005 is a BAV-1 virus that has a deletion in the E3 region of the genome. The smaller EcoR1 to BamH1 sub fragment of BamH1 fragment "B" (positions 25765 to 26850 from SEQ ID NO: 3) has been deleted. This deletion removes a major portion of ORFs 21 and 22. A poly linker sequence (5'-TCGACAAGCTTCCC-3') [SEQ ID NO:16] containing a HindIII site was inserted into the deletion.

[0129]S-BAV-007 was created by transfection of DNA derived from plasmid 1018-45 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs). Progeny viruses derived from independent transfection stocks were amplified on MDBK cells and analyzed for BamH1, EcoR1, and XbaI DNA restriction patterns. S-BAV-007 was also shown to grow to similar titers as the wild type BAV-1.

Example 8

Preparation of Recombinant Adenovirus Vector S-BAV-014

[0130]S-BAV-014 is a BAV-1 virus that has a deletion in the E3 region of the genome. The smaller EcoIR1 to BamH1 sub fragment of BamH1 fragment B (positions 25765 to 26850 from SEQ ID NO: 3) has been deleted. This deletion removes a major portion of ORFs 21 and 22. The gene for the BVDV g53 (amino acids 1-394) under the control of the HCMV immediate early promoter was inserted into the deleted region.

[0131]S-BAV-014 was created by transfection of DNA derived from plasmid 1038-16 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs). Expression of the BVDV g53 gene was assayed by the Western Blotting Procedure. S-BAV-014 exhibited expression of a correct size protein with specific reactivity to BVDV g53 antibody.

Example 9

Preparation of Recombinant Adenovirus Vector S-BAV-022

[0132]S-BAV-022 is a BAV-1 virus that has a deletion in the E4 region of the genome. This deletion spans from positions 29523-30407 of SEQ ID NO: 3. A linker sequence 5'-CTGCAG-3' containing a PstI site was inserted into the deletion.

[0133]S-BAV-022 was created by transfection of DNA derived from plasmid 1055-52 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs). Progeny viruses derived from independent transfection stocks were amplified on MDBK cells and analyzed for BamH1, EcoR1, and XbaI DNA restriction patterns S-BAV-022 was also shown to grow to similar titers as the wild type BAV-1.

Example 10

Preparation of Recombinant Adenovirus Vector S-BAV-023

[0134]S-BAV-023 is a BAV-1 virus that has a deletion in the E4 region of the genome. This deletion spans from positions 29523-30407 of SEQ ID NO: 3. The gene for the BVDV g53 (amino acids 1-394) was inserted into the deleted region. The BVDV g53 gene was under the control of E4 promoter(s).

[0135]S-BAV-023 was created by transfection of DNA derived from plasmid 1055-56 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs). Expression of the BVDV g53 gene was assayed by the Western Blotting Procedure. S-BAV-006 exhibited expression of a correct size protein with specific reactivity to BVDV g53 antibody. Expression of the BDV g53 foreign antigen in S-BAV-023 establishes the utility of the BAV-1 E4 region promoter for transcription of foreign genes in vector systems.

Example 11

Preparation of Recombinant Adenovirus Vector S-BAV-025

[0136]S-BAV-025 is a BAV-1 virus that has a deletion in the E4 region of the genome. This deletion spans from positions 33614-33725 of SEQ. ID NO: 3. A linker sequence 5'-CTGCAG-3' containing a PstI site was inserted into the deletion.

[0137]S-BAV-025 was created by transfection of DNA derived from plasmid 1064-26 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs). Progeny viruses derived from independent transfection stocks were amplified on MDBK cells and analyzed for BamH1, EcoR1, and PstII DNA restriction patterns. S-BAV-025 was also shown to grow to similar titers as the wild type BAV-1.

Example 12

Preparation of Recombinant Adenovirus Vector S-BAV-026

[0138]S-BAV-026 is a BAV-1 virus that has a deletion in the E4 region of the genome. This deletion spans from positions 29523-30403 of SEQ ID NO: 3. A linker sequence 5'-CTGCAG-3' containing a PstI site was inserted into the deletion.

[0139]S-BAV-026 was created by transfection of DNA derived from plasmid 1066-44 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs). Progeny viruses derived from independent transfection stocks were amplified an MDBK cells and analyzed for BamH1, EcoR1, and XbaI DNA restriction patterns. S-BAV-026 was also shown to grow to similar titers as the wild type BAV-1.

Example 13

Preparation of Recombinant Adenovirus Vector S-BAV-027

[0140]S-BAV-027 is a BAV-1 virus that has a deletion in the E4 region of the genome. This deletion spans from positions 29523-3043of SEQ ID NO: 3. The gene for the BVDV g53 (amino acids 1-394) was inserted into the deleted region. The BVDV g53 gene was under the control of E4 promoter(s).

[0141]S-BAV-027 was created by transfection of DNA derived from plasmid 1066-51 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs).

Example 14

Shipping Fever Vaccine

[0142]Shipping fever or bovine respiratory disease (BRD) complex is manifested as a result of a combination of infectious diseases of cattle and additional stress related factors (C. A. Hjerpe, The Bovine Respiratory Disease Complex. In: Current Veterinary Therapy 2: Food Animal Practice. Ed. by J. L. Howard, Philadelphia, W.B. Saunders Co., 1986, pp 670-680.). Respiratory virus infections, augmented by pathophysiological effects of stress, alter the susceptibility of cattle to Pasteurella organisms that are normally present in the upper respiratory tract by a number of mechanisms. Control of the viral infections that initiate BRD as well as control of the terminal bacterial pneumonia is essential to preventing the disease syndrome (F. Fenner, et at., "Mechanisms of Disease Production: Acute Infections", Veterinary Virology. Academic Press, Inc., Orlando, Fla., 1987, pp 183-202.).

[0143]The major infectious diseases that contribute to BRD are: infectious bovine rhinotracheitis virus, parainfluenza type 3 virus, bovine viral diarrhea virus, bovine respiratory syncytial virus, and Pasteurella haemolytica (F. Fenner, et al., "Mechanisms of Disease Production: Acute Infections", Veterinary Virology. Academic Press, Inc., Orlando, Fla., 1987, pp 183-202.) An extension of this approach is to combine vaccines in a manner so as to control the array of disease pathogens with a single immunization. To this end, mixing of the various BAV-1 vectored antigens (IBR, BRSV, PI-3, BVDV and P. Haemolytica) in a single vaccine dose. Also, conventionally derived vaccines (killed virus, inactivated bacterins and modified live viruses) could be included as part of the BRD vaccine formulation should such vaccine components prove to be more effective.

[0144]Many modifications and variations of this invention can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. The specific embodiments described herein are offered by way of example only, and the invention is to be limited only by the terms of the appended claims, along with the fill scope of equivalents to which such claims are entitled.

Sequence CWU 1

17142DNAArtificial SequenceDescription of Artificial Sequence DNA Primer 1cttggatcct catccatact gagtccctga ggccttctgt tc 42231DNAArtificial SequenceDescription of Artificial Sequence DNA Primer 2catagatctt gtggtgctgt ccgacttcgc a 31334185DNABovine adenovirus type 1 3catcatcaat aatatacgga acacttttgc gtgatgacgt tgacgtgctg tgcgtaaggg 60ggcgtgggaa aattgttcaa aggtcgctgg gcgggagttt ctgggagggg cggggagtgt 120ccgtgtgcgt gcgagcggcg gggcgaggcg ctgagtcagg tgtatttatg atggggtgtt 180tagggtatca gctgttggac tttgactttc actgtcgtaa atttgccact ttattggagc 240cctttgcccg cggacgtgga gggatttttc ccaatttatg gccactttta ctgcgatgcc 300gcacgaaacc tgtctaaagg tctatgccac gtctcccatc atgggcggtc ttttttctct 360atgcaccact cccagtgagc tatatattac ctgcgcaggt aaagaggtgc cactcttgac 420atcatcaata atatacggaa cacttttgcg tgatgacgtt gacgtgctgt gcgtaagggg 480gcgtgggaaa attgttcaaa ggtcgctggg cgggagtttc tgggaggggc ggggagtgtc 540cgtgtgcgtg cgagcggcgg ggcgaggcgc tgagtcaggt gtatttatga tggggtgttt 600agggtatcag ctgttggact ttgactttca ctgtcgtaaa tttgccactt tattggagcc 660ctttgcccgc ggacgtggag ggatttttcc caatttatgg ccacttttac tgcgatgccg 720cacgaaacct gtctaaaggt ctatgccacg tctcccatca tgggcggtct tttttctcta 780tgcaccactc ccagtgagct atatattacc tgcgcaggta aagaggtgcc actcttgaca 840tcatcaataa tatacggaac acttttgcgt gatgacgttg acgtgctgtg cgtaaggggg 900cgtgggaaaa ttgttcaaag gtcgctgggc gggagtttct gggaggggcg gggagtgtcc 960gtgtgcgtgc gagcggcggg gcgaggcgct gagtcactgc ccttttgcac tgtcttgtgc 1020tttgtcacgc ggtttcggtt acgcctgtca ggcgccagaa gccctttcgc ctcgtcacag 1080accgcgcctt ttcgctctat aaagccattt ctctcctctg ctcgtcattc gcctctgctc 1140ctgagccttc tgtgctgcca tttctaaact tacactcctt gctgtaggcc gtggtctact 1200ttgccaagag taagtacatc atggctgaca agctgctctt tgtgcgtgtg tctgactcgg 1260cttgccacgt ctcccatcat gggcggtctt ttttctctat gcaccactcc cagtgagcta 1320tatattacct gcgcaggtaa agaggtgcca ctcttgagtc gaagagagta gagttttctc 1380atctgctcat tcattcacca tgaggcacct aagactcgct tttgatgagc gcttctggat 1440agccgccgaa ggtttgctgg cggattctcc tgctgatgaa gatgagggat ttcatgagcc 1500tttgtctttg caggacttga ttgaaattga tgacgcttca gacgtggtta gcttattttt 1560ccctgaactt gaagttcagc aagacctgcc aacagcggag gaggttgagg acttgttaca 1620ctgtgaggag actgctgctg acttagaatc tgtttctgac ttaccgcctg tggagtctcc 1680tgaacctccg gattctcact tttccacatt tgagttggat tatcctgaga tacccggcgt 1740gaattgctct gcatgctcat ttcatcgtca ggagactgga tctgaggagg ctgtatgctc 1800gctctgctat atgagaaaaa cggcttatgc tgtatatggt aggttgcttt acatactttt 1860cttttgatta ctcttgcatt gcaatattag cctaatgtgt tgatttgtgc ttgcagagcc 1920tgtttctcca gctccgccta ctgttgatga gcaacatgag acaggtgcgc cagtttcgtc 1980tccgcctgct ggccgcaagc ggcgccacca ggatgacctc atactgttta accataaacg 2040ctgcgcccag gatgaacctt tggacttgtc cttacccaag cccaatgccc aataaactat 2100gttaatcagt acctagaaag gtgtggtcac tgcctatata aactagggag cgctgctcag 2160atgcagcctg gcgctcactt ggactaccat ggacatttct ctgggctttt gcgaaaagct 2220gtccgatttc caatacttaa gacgggtgct gtactacgcc tcagccagac caggttggtg 2280gacacgcact ctctgtgggg acagactctc aagtttggtt tataatacaa aaattgagca 2340ttggaaaaac ttagaggaaa tttttaaacg cgattcaggt ttctggtcta tgctttctag 2400tgggcgcagc cttgggtttg aggcgaaagt agttccttgg ctggattttt cgtctccagg 2460gagaactgtg gccagtttat cgttactaac ttatattgtt gatactttgg ataaacagac 2520tcagctgagc ccagattaca ttttggactc gatttgcggc ccagtatgtt tcaggctgaa 2580aaccttggtt tcaatcagga aaatgcagca agccgtgcgg ggtcaggagg gtccaattat 2640agaggaagtg gattaaaccc agacggtata ccataccagt ctatattgat ggagtttgct 2700agagatccat tttctactca tgacaaatat gattttgaga cagttcagac ttactttctt 2760aagccagggg atgatttaga aacagtgatc agccagcatg ctaaaattgc tttagatcct 2820gaggtagagt atgtgattga acatccagta aagattcgat ctctgtgtta tataattggc 2880aatggagcta aaataaaaat agcatgtcca gaacactttg gaatagaaat ttatccaaga 2940gatcacagcc ctggtatagt tggaatgtgg cttgtcacat ttaacaatgt ggtgtttgaa 3000agggaacgaa gtattcctgg tggcattatt cagagtagga cattcttttt gtgccatggc 3060tgtaatttct tgggagcatt gggaacagct gtttcggctc tggctggtgg ggaagttagg 3120gggtgccatt tctttggatg tttcaagtgt gttgatagta gaagtaaatt taaggtgaaa 3180gttagccact ctgtaattga gacttgtatg gtaggcataa gcgcttcagg gccagtgagt 3240gtaaagcatt gtcaaggatt gagtgtgtac tgctttttgt ttatgttagg agctggtaag 3300gttgagggaa acagtgtgat caacccaaac aagttttatg agtctgccct tacagagatg 3360gtgtcttgct atggcaaaat tgttttgccc ctggccactg ttcatatttc ggcctcgccg 3420aaacatcagt atccacactt tgaagcaaat gtgctgacaa gatgtaaggt gtttgtgggc 3480gccaggcaag gcacttttac gccaatgctt tcatcactaa gttatacttc tattgtggct 3540gaccgcgatg ctttcaaaag cctgaatctg aattatactt ttcaccaaac tactactatt 3600tggaagcttc tgagtgctgc tgatgctgac tttgaccatg gaactgccag aaagtgcctg 3660tgtggtgatt tgcatccatg tcctgtgttg aagcagcttg attacacaag ccgggttagg 3720cctaacccat acgaccactc atgtgattcc agggtgtttt ctgatgacga gaattaaggt 3780aagccacgcc caccatctat ataagcggga gtaaaagcgt ggggtggtat ttgcacaatg 3840actgatcaag gtgacattcg tacgtgtttt cttacagcga gactgcccag gtgggcaggt 3900gttcgccaaa atgtcgtcgg gtcaaatatt tctggtggcg ttgtcgactc cccggagacg 3960cttctggcat ctagatctaa cgcggcagct gcgatgatga ctttgaggaa catcgcgacc 4020agcagacagt tggaagagca ggtggagact ttgctggagc agaacttgga tctgacggcc 4080cagcttaatg ccttgctgat gcgtgtcaac gcgattgaac ggcagctagc tgatatgcag 4140cgcgacttgg aaccaatcat tcaacaacac aatgcaataa tttgatcaat aaatctttat 4200ttctttgcat gataatatcg agtccagcgt tgtctgtcag caattacttt gctaattttt 4260tccaaaatag agtacagttt acattgcaca tttagataca ttggtataag tccttctgat 4320gggtgtaggt atgaccactg tagggcttca ttttctggac atgtattata aattatccag 4380tcatagttgg tgttaatttt gtgatagttg aatatgtctt ttagcaggag ggaaattggc 4440aatggcagtc ctttagtgta ttgatttata aatctattaa gctgtgaagg ctgcatttta 4500ggagagatga tgtgcagctt tgcttgtatt tttaaatttg atatgttccc agcgtgatct 4560tttctggggt tcatattgtg caatactacc atgacagagt agcctgtgca ttttggaaac 4620ttatcatgta gtttagatgg aaatgcgtgg aaaaactttg aaattccttt gtgggctccc 4680agatcctcca tacattcgtc tagtattata gcgattggac cttttgatgc cgctttagca 4740aatatgtttc tggggtcgct caggtcatag ttgtattcct gcgttaggtc tgaatatgcc 4800atttttatga attttggcat cagcgagcca ctctgtggaa ctaaggtccc ctgaggcccc 4860atgctgtagt tgccttcaca gatctgtgtt tcccaagcac ttatctcttg ggggggtatc 4920atgtcaattt gcggcactat aaagaaaaca gtttctgggg gcggtgtgat taactgtgag 4980gaaattatgt tcctaagaag ttgggatttg ccgcagcctg tggggccgta aacaacccct 5040atgacaggct gcatctgaaa attaatagac ctgcatgccc cttgcgggtt caaataaggt 5100acgcatttat taagcaactc cctgacacaa acattttctt cagccaaatc taaaagtaaa 5160ctgtgtccgg ctaatgacat cagttgctgg aaagaggaga acgtgtgaag aggttttagg 5220ccttcagcaa aaggcatgct ttttaagctg ttgtgcaaga cggtcagtct gtcccatagt 5280tcatttatat gtcccacggt aatgtcatcc agcatttgtc gccgtttctt ggatttgggt 5340tgcttttgga gtagggcatt agtcgatgct ggtcgaggtt tacgagggtt ctgtccttcc 5400acggcctcac tgtccgagtc agagttgtct ctgtcactgt gaatggagcg gcgtttgctt 5460ggtttgtcgc tagagtgcgc ttcaggctca tccggctggt ctgaaagtgg tctgagccgt 5520gctggctgtc cgctaggtag cactgggcga gagtatcata agatagctca gtggttgcgt 5580gccctttagc tcttagcttg cctttcccca cgtgaccgca gttagggcag tgtatgcttt 5640tcaacgcata cagctttggc gccaggaata cagattcagg actgtatgca tcactcttgc 5700atttttcgca ctgcgtttcg cattctacta gccaggtgat gcttgggcag cttgggtcaa 5760acactagact tcctccattt tttttaattc tatgtttacc tttttcttgc attaggcgat 5820gtccttcttc tgtcacgaac aggctgtcgg tgtcaccgta cacggacttg attgtgcgtt 5880gttccatggg ctttcccctg tcgtcgctgt acaggaactc ggcccactcc gccacaaaca 5940ctcttgtcca agctagcaca aaagaagcga tgtgagaagc gtaccggttg tttttgataa 6000gtaaagaatt ttgctcgagg gtgtgtaaac aaatgtcatc gtcatcggtg tccatgaatg 6060tgattggctt gtaagtgtag gtcacgtgac ccgccgtagg tataaaaggg gcggggtcct 6120cgtcttcctc atttgcttct ggctcgacgt gcggtgcagg tgggtaggct acggtaaatt 6180ctggcataag ttcagcactt aagttgtcgg tttcaatgaa agaagaggat ttgacactgt 6240aggtgccagt ggcgatgttt tttgacattt ctgattcaag ctggtcagaa aacactattt 6300ttttgttatc gagtttagta gcaaagctgc cgtacagagc atttgacaac agtttggcta 6360tgctgcgcat tgtttggttt ttgtttttgt ctgctttttc tttggcggct atgttcagct 6420ggacatattc tttagccacg caacgccatt ctggaaatat tgttgttctt tcatctggta 6480gtatgcgcac tttccagcct ctgttgtgca gggttatcat gtctactgat gtggcaacct 6540caccgcggag aggctcgttt gtccagcata gcctgcctcc cttcctggag cagaagggcg 6600ggagctcgtc caggaagagt tcgtctggag ggtcggcgtc cactgtgaag atacctggca 6660acagcgtgtc atcgaaataa tcaatgcgcg aaccatgcgc gctcaacctt ctgctccagt 6720ctgatgcagc aactgcgcgc tcgaatgggt tcagcggctg ccccgctgga aatggatgag 6780tcaatgcgct tgcatacatt ccacagatgt catacacata aataggctgt tccagtatgc 6840cgatgtatgt ggggtagcag cgtcccccac ggatgctttg gcgaacgtaa tcatacatct 6900cgtttgacgg cgcaagcagg gtgtttgaca tgttggaacg gttaggtttg attgagcgat 6960acaaaatttg tttgaagatt gcatgggagt ttgagctaat tgttggtctt tgaaaaatgt 7020tgaatgctgc ttcaggtaag tcaacttctt tctgaatgaa ctgctggtat gagttttgga 7080gttttctgac cagctcagag gtgactaaaa catcttgggc gcaatattca agcgtttgct 7140ggatgatatc gtaagccccc acgttttttt ctctccacag cgctttgttg agctcgtatt 7200ctgctgtgtc cttccagtac cgaaggtgtg ggaaaccatc ctcgtcctgc tggtaagagc 7260ccaggcgata aaattcgttt accgcttcgt acggacagct tcccttttct actggaagtt 7320catacgccga tgcggcattt ttcaagcttg tgtgtgtcaa cgcaaatgtg tctctgacca 7380tgaacttaac gaactgcatt ttgtagtctc ctgctgtcat ttttcccagt tcccagtcct 7440caaatgtttt cctggaaaca aactttgggt ttggaagtcc aaatgtgatg tcattaaata 7500aaatctttcc atttcttggc ataaagtttc tacttatttt aaatgctgga aggacctcat 7560ctctgttgtg aatcacttga gccgccagca cgatttcatc gaaaccgcag atgttatgtc 7620ccaccacata tatttccata aacttagggt ctccgtttag ttgacacttt ctaagcatct 7680caaatgtgat atcatctact gcagctaggc catgttgctc tttaagctgt tccagatgtg 7740ggttgtgagc gagaaggtgc tcccatagta tggcggtcgt gcgccgctgt acggcgtcgc 7800ggaacttttt aaaagctctt cccacctctc cctttgttgg ggtgatgata tagtaagtgt 7860acttttcgcg ccacgctgtc cactctaggt ttatggcgac attattcgcg gcttctagca 7920gctcgctgtc cccagatagg tgcatcacta gcataaatgg caccagttgt ttgccaaagc 7980gcccgtgcca ggtgtaagtc tccacgtcgt atgtgatgaa cagcctttga atgtcaacgt 8040acgagcctat tggctgaaat gggataagtt cccaccagtc ggcagattta tgattgacgt 8100ggtgaaagta aaaatcacgc ctccgcacag aacaagtgtg agaatgtttg taaaagtctc 8160cacagaaatc acatttttgc gagggtgaaa tttcttttat taaaaacacc ttcccatgtt 8220tgacgaagaa attaattgaa aaaggtagga tgctttcttc catgattgtg gacttttttg 8280aaattcttcc tttgttgtag ataaaaacac ctccgtcact cggtagtagg ctttctaaca 8340ttgcgagggc gtttcgtgga gtgaccgctg cggcgttaaa gtgatcaggc atgtcaaata 8400gatgaatgtg gaaaaggttt gcaagtgctg gctgtagtgc gctgtggtat ttgatttcga 8460cgtgggtccc atcctccatt gtcccactgc ttgttagcgt ggcgcgtttg gccactactg 8520tgcctctcat tgctcttccg gcggcggaag gcgcactgct tcgtttagcg ccggcagtgg 8580acgccgttct tgacgcaaca ttgttgctgc gcgtatcact cgtcggttta tattctggat 8640ttccctcagg ccggagaaca ccacaggacc gctcactcga aacctgaaag atatttcgat 8700agaatcaatt tcagaatcat tggtggccac ctgtcttaga atttctgtta catcgccgct 8760gttttcgtga tatgctattt ctgccataaa ttgttctatt tcctcctcct cgagctctcc 8820tctgccagcg cgctcaacgg tggctgccaa atcaacactt attctgttca taatagcaga 8880aaacgcttgc tcgccgtttt cgttccagac gcgactgtag accagcctgc cgtcctgaga 8940ccttgctctc atgaccactt gtgccagatt tagcatgacg tatcttccga atgggctcgc 9000gactctcagt tgatgattta agtagttgag agtggtggcg atgtgctccg ccacgaagaa 9060atacatcacc catcgcctga gtgtcagctc gttgatatcc ccaagcgctt ctaaacgctg 9120tataacttcg tagaagttca cagcaaaact gaaaaactgc tgatttctgg ccgcaaccgt 9180cagctcttct tcaagcaatc tgattgcttc agccactgcc gctctaactt cttcttcaaa 9240cgtagtctca gggctttctt cctcaacttc cattggcgcc tcttccggtg gtggaggcgg 9300ctgtcttcgg cgccgtctgc gcatcggaag acggtccacg aactgttcta tcatttctcc 9360tctggctctt ctcatgcttt ctgtgactgc ccggtttcct tctcttggtc gtagctggaa 9420agcgcctcca ctcatggctg tgccgtggca actggggagg ctcagtgcgc taataataca 9480ttttgtcaat atttgcgcag gaacttgttg cagcctcatt gcttcgctga tatcggcaga 9540ttgatcgctt tcggcgaact tctccacgaa ggcatttaac caatagcagt cgcaaggtaa 9600gtttaactct tgctcttggg ctagtgggag gtggcggcat attagaaagt tgaaatatgc 9660tgttttgagc ttgcgaatcg atgacagcac cactaagtct ttgcgcccgg cgttttgcac 9720tctgattctg tcagccagcc cccaggcttg gccctggcat gcccctatgt ccttgtattg 9780ttcctggagc aagtattcca cgggaacgtc gtttctatcg actgaggtgc gaccaaatcc 9840ccgcattggt cggataagag ctaggtctgc tacgatgcgc tctgccagaa tagcctgctg 9900gacggctgtg agcgtttcag aaaagttgtc catgtctatg aagcgatggt atgccccggt 9960gttcacagtg tatgagcagt ttgccattac tgaccaattc attatctgcg atccaaagct 10020aagctgttcg gtgtatttta accggctgta tgctctggcg tcaaaaatgt agtcgttgca 10080tatctgcaac agcttttgat atccaaccaa aaagtgcggc ggtgggtagt tatataacgg 10140ccagttccta gtagccggct cccgcggcga tagattcatc agcattaggc ggtgatattg 10200gtagacgtgt cttgacagcc atccgagccc ggctggtgtg acagcagccc ttgcccaatc 10260ttggacacgg ttccaaatgt tgcgcactgg cctaaacact tcaattgtgt aaacgctctg 10320gccggtcagg cgcgcgcagt cgatggcgtt ctaaaagaaa taaacaacat gtccaatggg 10380atttgtgcag atgcatccgg tgctgcgcca gctgaaacca ttgccccata gtaaggcatc 10440gcccgttgta acgtgggccg atgacgaccc cgcgcctacg ccgcccatcc aggagggaga 10500gggtgttgcg cgactgaacg tggagagccc cgagcaacac ccccgtgttc agcttaagaa 10560ggatgccgga gaggctttcg tcccacccgc caatgtattc agagaccggg agggcgaaga 10620ggaggctcag atgaggcaca tgagatttaa agcgggagaa caaatgcatg tccctaagaa 10680gcgcgtgcta agtgatactg actttgaagt ggatgaggtg tccggggtga gcccagccaa 10740ggctcatatg gcggcagccg atctgctgac cgcctatcag caaactgtca gagaggaggt 10800caacttccaa aagacattta ataataatgt tcgaacactg gtggccaggg aagaagtggc 10860agtggggctc atgcatttgt gggactttgt tgaggcgtac gttgtaaatc catcttccaa 10920agctttaact gcccagctat ttcttattgt ccaacactgc cgcgacgaag gcattctaaa 10980ggaatcgctg ttgaacattg cagagccaga gagcaggtgg ctgttagatc taataaatct 11040gctccaaacg atagtggttc aagaacgggg catgtccatt acagaaaagg tggccgccat 11100taactattct gtaataactc tcagcaagca ttatgccagg aaagtttata ggactccgtt 11160tgtccccatt gacaaggaag caaagatcac cactttttac atgcgaattg tggttaaact 11220gttggtgttg agcgatgact tgggcatgta tcgtaatgag cgcatggagc gggtagtcag 11280cgctgcccgc agacgagaat tcacagataa agagctgatg ttcagtttgc gtaaagcgct 11340ggcaggagaa gacgaggtat atgacggcca attagaatct gctgttcaga gcgtgccagg 11400tatagaatgg gcgcatgagg atgatgacga cgagtagtaa gatgttatct tggttacagc 11460cgccatgttt cgctcccgca acaccgtgtc tgcggcgcgc aatcctaacg ccttggcgcg 11520cctgcagtct caagcgtctg gggacgtgga atgggccgat gccattaagc gtataatggc 11580tttgaccgcc agatacccgg aagcgttcgc tagtcagcca tttgcaaata ggatcagcgc 11640tattcttgag gcggtggttc cttctagaaa aaatccgact catgaaaaag tgctgtcaat 11700tgtcaacgcc ttggtagaaa cgggcgctat tcgtcctgat gagggagggc aggtgtacaa 11760cgctctgctt gagagggtat ctcgatacaa cagtatgaat gttcagacta gtatagacag 11820gcttagtcaa gatgtgagaa acgtagttgc tcaaaaggaa aggatggttg gagagaacat 11880ggggtcgatg gtggccctta atgcattttt gtcaactctg ccggccaatg tggagagagg 11940gcaggaaaat tacacagctt tcataagcgc tttgaggctg ttggtgtctg aagtgcctca 12000gactgaagta tatcagtctg ggccaaatta ctacctgcag acctctagga atggcagtca 12060cactgtcaac ctgactagag cttttgaaaa cctgagctct ttgtggggag tgaatgcgcc 12120agtggccgaa cgaagtgcca tatcttccat tctcactcca aacactaggc tgctgcttct 12180gcttatagcc ccgtttacag acggggttaa catttccaga gcttcataca ttggttacct 12240gctgacccta tacagggaaa ctatcgggca ggctcatatt gacgaaagaa catacaatga 12300gattactagc gtaagccggg ctgttggcaa cgaagacgct gcaaacctgc aggccacatt 12360gaatttccta ctgacaaatc ggcagtacag gatccctaaa gagtactcat tgacgccaga 12420ggaggagcga atattacgtt ttgtgcagca gtctgtcagc ctgcatatga tgcaagacgg 12480cagcacacct tctgccgccc ttgatgaaac aagccgtaat tttgaaccta gcttttatgc 12540gggaaatagg ttattcatta acaagctgat ggattatttt cacagggctg ccgctgtagc 12600cccaaactat tttatgaacg cggttctaaa tccaaaatgg ctccctcctg aagggttttt 12660tactggcgtc tttgattttc ctgagggcga tgacggtttt gtgtgggacg atacagatgt 12720atctgaggtt ggggcgagag gtgccgttcc ggcgctagtg gccaagaaag agggagggga 12780tgattcagat ctgtccatca cgatcccctc tattcccagg cagttacgca gggcttctgt 12840tgtgtctgat actagcgaca tgagccgcgg tagggtgcgc agccgcagtc gtgtacgacg 12900gccggtagac atagacattg ggcgctggct agaggacaaa aacactaatg cgacccgagc 12960ctcagctgct attaataacg aaatggaaaa tttagtcgac aagatgacta gatggcgcac 13020gtatgcccag gagcaaatgg aggaagtcag agcgcgctct cccataaaaa tagaacagga 13080tgatgatgat tggagaaacg acaggttttt gaagtttgaa ggcagtgggg cagtcaatct 13140gttcagccac ttaaagccaa aaggcatggt gtaacaaaaa aaaaaaaaaa taaagtcact 13200taccacagac atggtttggt tttgtgattg ctagatgata cgagccaggc cagtggaatc 13260gcctcctcct tcctatgaga gcgtggtcgg cactatggat ccgctctacg tgcccccgcg 13320atacttgggt cctactgaag gaagaagcag catccgttac tccctattgc ccccgcttta 13380tgacaccacc aagctttact ttatcgataa caagtcggca gatatttcgt cactcaatta 13440tcaaaataac cacagcaatt acctcaccag tgttgtgcaa aacagcgact acacgccgca 13500ggaggctagc acgcaaacta taaactttga tgataggtcg cggtgggggg cggactttaa 13560aactattttg catatgaaca tgcccaacgt gactgaattt atgtttagca attcattcag 13620ggctaaattg atgtctgcca aggtgggtgg caacccaacc tatgagtggt tcactctcac 13680cattccagag ggcaactact cagacattgc agtcttagac ttgatgaata atgcgatagt 13740agaaaattat ctgcaggttg gacgccagaa tggagtagcg gaagaagaca taggcgtaaa 13800gtttgacact agaaatttca gattgggcta tgatcctgta acccagcttg taatgccagg 13860gaaatatact tatttggctt ttcacccaga catcatactc gcccctggct gtgcggtaga 13920ctttacaacg agccgcctaa acaatctact tggtattcga aaaaggcagc catttcagga 13980aggatttcaa atagcctatg aagatttggt aggtggtaat attccagctc tccttgacgt 14040ggacaactat gatgaggcag acccagccac aattaggcct atagaggccg acccgtcagg 14100ccgctcatac cacgtaggtc aagacccgtc tgctggtccc acattcacgt attataggag 14160ttggtacgtg gcttacaact acggtgaccc acagactgga attcgcagca gtacgttgct 14220ggtgacccct gacgttacgt gtggttcaga gcaagtatac tggagtgttc cggacatgta 14280tgtagagcct gtgacgttta aagctagcca aaacgtggca aattatcctg taattggggc 14340agagctcatg cccgttcagt cgcgcagtta ttataacgcg caggctgtgt attcgcaaat 14400gattcaagaa agcactaatc agacactggt ttttaaccgc tttcccgaca accagatttt 14460ggtgcggccg cccgaatcta ctatcacgtt cgtcagtgaa aacgtgccag cgcagactga 14520tcacggaacg ctccccatca gaaacagtgt gtctggggtg cagcgagtca ctctgactga 14580cgctaggcgc agagccagtc cttacgttta caaaagcata gccatagctc agccaaaggt 14640tctgtccagc aggacgttct aaaatggcga ttttagtgtc cccaagcaac aacacagggt 14700gggggattgg atgcaaaagc atgtatggcg gcgcccgcac gctatcagca aactttccag 14760tgctcgtgcg aaagcactac agggccgtcg

tggggaagca ggaaagggcg cgttgtcgca 14820ccaacagttg aggttacaga cgaccctgtg gccgatgtag tcaacgccat tgctggtcag 14880acacgccgcc gacgcggagc caggcgccgc aggcgcgcta cggcagcggt gcgcgccgct 14940agagcgttgg tgcgaaatgc acggcgcacg ctagcccgta gggggcgcat gcggagaacc 15000cggaatccag tggctgacgt ggtgagagca gtggaagcca tcgcacgcgc aaacccacgc 15060cgtcgaagcg ctaggttgat ggcgcgtgct gccaacgcac cgcctccacg tccgcgcgcg 15120aggaatatct attgggtgcg agacagtaat ggagtccgcg ttcctgtgac gtcccgccct 15180ccaagaactg tggggactgt ggtttaataa agcctcgttt gctgcatcac acagcgcgtg 15240cctgttcgtg ctttgtgcca acgtcaatgt cttcgcgaaa gataaaagaa gagatgcttg 15300aaatcgtggc gccagagatc tatgcgccta gacgccggcg tagtgttaaa gttgagacaa 15360aaacgaggat taaggtccca aaagatgaaa taaaatctaa acgcaagtgg aggcgtcctg 15420gcatggctga catagatgag gtcgaaatac tgggagccac tgctcctagg cgcccgtatc 15480agtggcgcgg taggcgcgta cagcgcatat tgcgtccagg aacggccgtg gtgtttacac 15540cgggcgctcg tagtcgggaa cgagcaagca agcgttcttc cgacgaaatg tttgcggacg 15600cagatatact ggaacagttt gaaagtggag atggcgagtt tagatacgga aagcgtggcc 15660ggtctgaggc gctagtgttg gacgcctcta acccaactcc gagcatgcag cctgtaacgc 15720cgcaggtacc tatcatgaca ccttcggtgg cagctaagcg cggcgctagc gcagtgccca 15780cggtgcaagt actggcgcca aagaagcgac gcatagacgc agtagcgaca gacgatgtat 15840ttgtcgctcc ttctccactt agcgagatgg acaccgtaga gccaggcacg gccgtccttc 15900ttccttctag agcagttaag cgagttagga agagacgcgg agttgaagaa atcaagagcg 15960atcctatggt tcttgaagaa gtaaaggtta gggatgtaaa accgatcgct cctgggatag 16020gcgtgcagac aatagacgtg aaagtgccgg cggctcctcc agaaataaag ccaccagtgt 16080cagtggtgga gaagatggac ataagcacag ctcccgcgtc acgaatcacc tatgggcccg 16140ccagcaagat atttccacag taccgacagc atccgagtca aatgggattt ccaaaagtag 16200ttcgcactcg aaggcgcgcg gttaggagga gacgaaggcg ggcggcgccc attggtgttg 16260aaattacagc cgcgcgaaga cgggcgctag gcgccgcata ttgcttccgc ctgttcgcta 16320tcacccgtcc ctgcagacgg cgcctcgctc tcaggtcgca atctggcgtt gatcgatcat 16380gcgaataaat tcctgtggta ctgcgtttag gcacctatct aacgcgatgg ctggcgtccc 16440gagaatcacg taccgagtcc gcgtgcccgt gcacacacga gtgcggcgaa gtggaagact 16500ggcgcggcgc gcgcctcgac gaaggggact taagggcggc tttctacccg ctctaatacc 16560tatcatagcg gcggcaattg gcgctgcgcc cggcattgca tccgtagcaa tacaggccgc 16620ccgccgcaaa taaagttagt tactgtctcc aagactcatt gttatcttta tttgcgccag 16680ctgcctgcct gcgcccgtcg ccatggaagg aattaatttc tccgcgttgg ctcccagatg 16740cgggtcaaga cccatgctta gcagttggtc tgatatcgga acaagctcca tgaacggcgg 16800agcatttaac tggggaaacc tatggagcgg cgttaagtcg tttggcagct ccattaaaaa 16860ctggggcaat cgcgcctgga acagtagcac tgggcaggcg ttgcgccaaa agctgaaaga 16920cagcaacctg caggaaaagg tggtagaggg gttggctagt ggcattcacg gcgctgtaga 16980tattgctaac caggagattg ctaaggcggt gcagaagcgc ttagagtcta ggccgaccgt 17040tcaaatagag gatccagatt taatgtcaac agccgaagaa ctggatcgtg gaaaaaccgg 17100ctccgtccac taaagcgcca gttaaagcca ctgtagaaga gtgtagcgaa aaaaccgccc 17160gtccgacgaa gaagagatag tcattcgtac agaggagccg cccagatacg aagacatttt 17220ccccaataac tccgcggttc caataagcct gcgccctaca gcggttaggc cgtctgctcc 17280agtagtcact gtaccggcgg cccgccccgt aaccacggaa attgtagaag ttcctccaac 17340gagacctagc gctcgtccgg cggtggtgcc ttctagaaca acaagaggat ggcaggggac 17400gctcaacagc atagtgggcc taggtgttcg atcagtaaaa cgaagacgct gtttttaagc 17460atctcgctgc tctttccaag cgcgccccag tgatacccgg ccgcgaagat ggcgactcca 17520tcgatgatgc cccagtggtc gtacatgcac atcgccgggc aggatgcctc agagtacctg 17580tctcccggcc tggtgcagtt cgcgcaggcc acagagacct actttaagct gggtaacaag 17640tttagaaacc ccactgtggc tccaacgcat gacgtcacca cagagcggtc acagcggctg 17700cagctgcgat ttgttccagt tgaccgtgaa gacacgcagt acactcacaa gaccagattt 17760cagttggctg tgggcgacaa ccgagtactt gacatggcga gcacttactt tgacatccgc 17820ggtactttgg acagaggtcc aagctttaag ccatacagcg gcacggcata caacgctcta 17880gcccctaagg ggtctatcaa taacactttc gtatccgtgg ctggaaacaa caacgccaaa 17940gcttttgcgc aagcccctca gtcggcaaca gtagacggaa ctacgggcgc catccaaata 18000gacggcgccg ccatcgacaa cacctaccag ccagaacctc aaataggaga ggaatcttgg 18060ttgtccggca ctgtgaaccc aatcgcgcag gctaccggaa gaatactgaa tacatctact 18120gatcccctgc catgttacgg gtcttatgcc gctcctacga acattgaggg agcccaaact 18180cttaacaaca atttgataca agtgaatttt gtggctggag gcgcgcctgg cgccccagac 18240gtaggcatga ttatggaaga cgtggctctg caaaccccag acacacattt agtgtacaag 18300gtgccagccg ccaacgtagg caacacggcg gccttagcgc agcaagctgc gccaaacaga 18360gcaaactata ttggcttcag agacaatttc atcggtctaa tgtactacaa cagcaatgga 18420aacctagggg ttttggcggg gcaggcttcg caattgaatg ccgtcgtgga cctgcaagac 18480agaaatacag agttgtctta ccagcttatg ctcgacaacc tgtatgacag aagccggtat 18540tttagcattt ggaaccaggc tgtagacagc tatgacccgg atgttaggat aatagagaac 18600cacggagtgg aagatgaatt gccaaactac tgcttcccaa taagcggaat agttcctggc 18660accacctcta ctagagtcac cagaaacggt ggaaactggg aagccacggc aaacaacgat 18720ccggcgtatg tcaacaaagg caatttagac tgtatggaaa taaacctcgc ggctaatctg 18780tggcgcgggt tcctatattc taatgttgcc ctgtacttgc cagacgacct taagttcaca 18840ccgccaaatg tcacacttcc taacaacacc aatacgtatg catacatgaa cggtcgcgtt 18900ccagcggctg ggttggttga cacttacgtc aacattggcg ctcggtggtc gttggatgtg 18960atggataacg tgaacccatt caaccatcac agaaacgcgg gcctgcgcta ccgctctcaa 19020cttctaggca atggccggta ctgtcatttt cacatccaag ttccgcagaa gtttttcgcc 19080atcaagaacc ttcttctgct gcctgggacg tacacttacg aatggtcttt cagaaaagac 19140gttaacatgg ttcttcagag cactcttggg aatgatctgc gtgtggacgg agcctccatc 19200acaattgaga gcgttaacct gtatgccagc tttttcccaa tggcacacaa taccgcatcc 19260actcttgaag ccatgctgcg caatgacaca aacgaccaat cgttcatcga ctacctgtct 19320tcagccaaca tgttgtatcc aattcctgcc aatgccacta acctgccaat ttccatccca 19380tctcgcaact gggccgcctt ccgcggatgg agcttcacca gaattaagca gaaagaaaca 19440cccgccttgg gctctccatt cgacccctac ttcacatact caggcactat accatacttg 19500gacggcacct tttatctcaa tcacaccttc agaagggtgt ctatacagtt tgattcgtcg 19560gtgcagtggc cgggcaacga ccgcttgctc acaccaaatg agtttgagat taaaaggcta 19620gtggatggag aggggtacaa tgtagctcag agcaacatga caaaggactg gtttctagtg 19680cagatgcttg caaattacaa cattggctac cagggctatc atctcccgga tggctataaa 19740gatcgcacat attcttttct gagaaacttt cagccaatga ctaggcagat agtggaccaa 19800actaacgtgc ccgcgtatca gaatgtccca atcacccacc agcacaataa ttctggcttt 19860actggatttg ccagtccagc gctgccgcgt gagggacacc cgtatccagc taactggccg 19920tatccactga ttagcgctac tgcagtggcc acgcaaacac agcgaaagtt cctatgtgac 19980aggacgctgt ggcgcattcc attctcgtcc aactttatgt ctatgggatc gcttaccgat 20040ctggggcaga acctgctgta tgcaaatgct gctcacgcct tagacatgac ctttgaagtg 20100gacgcgatgg acgagcccac gctgctttat gttttatttg aagtgtttga cgtggttcgc 20160gttcaccagc ctcacagggg agtcatcgaa actgtctacc tcagaactcc attctctgcc 20220ggcaacgcca ctacataagc atgggatcca gggaagagga actgcgcgcc attgtgcgcg 20280acctcggagt tgggccatac ttcctgggga cgttcgacaa acgctttcct ggttttctaa 20340ataactcaaa gccgagctgc gccatcgtga ataccgcagg tagagaaaca ggcggcgcgc 20400attggctggc cctggcttgg ttccctaaat ctaaggcttt ttactttttt gatccatttg 20460gattcagtga tagcaaactg aagcagatat atgagtttga gtatgaaggt ctgctgcgcc 20520gcagcgcctt ggcggctact ggcgatggct gcataaacct ggttaagagc agtgaatcgg 20580tacagggtcc gaacagcgcc gcctgtggct tattttgctg catgttttta catgcttttg 20640ctcactggcc ccacagtcct atgacccaca accccaccat ggacttgttg actggtgtgc 20700ctaaccataa cattatgtca cctagcgccc agcccacact gcgagaaaat caagtcaagc 20760tttataagtt tctagcagcc cattctcagt actttcgcac ccatcgcccc caaattgaac 20820gagacacctc ttttaataaa ctgctggaat caaaattgca ataaatgatt ttattttgaa 20880tcaacatttg agcagcgtgg tgtgttcaaa ataacgcgtc gtcggcgtct tcctgaccgg 20940tgggtaggat ggtgttctgc actctgtact ggggaagcca cttaaattct tgcacgacaa 21000tgggcggttt cgtgccaacc attgaattcc agatttgctt tgcgagctgc agccccatga 21060ctacatctgt cgagctgatc ttaaagtcgc aattcttctg agggtttgct ttggtattgc 21120gaaatacagg gttgcagcac tgaaatacaa gcactgcagg gtggtctagg gtggccaaca 21180ccttagcgtc gtcaatcaag gcgcgatcta tgctgttgag tgcagtcatc gcgaacggcg 21240tgaccttgca cgtctgcttt ccaagcaggg gtagaggctg atgaccgtag ttacaatcac 21300ataccagcgg cattaagagc atctcaccag cttttggcat gttgggatac atcgccttta 21360caaaagcgcc tatctgcttg aaggccatca gcgccttggg gccatctgtg taaaaatacc 21420cacaagactg agagctaaaa ctgttgattg gagactttag atcatgatag caactcatcg 21480cgtcgctatt cttgacttga accacgctgc ggccccagcg gttggtgaca atcttcgcgc 21540gctcaggtgt atccttcaat gctcgctggc cattttcgct gttaatgtcc atctcaatga 21600tctgctcctt gtttatcatg ggcaagccgt gcaaacaata caatttgtcc tcgtctgcct 21660tgtgctccca cacaacacaa ccagatgggt tccaatctgc cgccgttata tcggcgccgc 21720gcagaatgaa atccagcaaa aaacgcgcta tcaccgtctg caggctcttc tgagtagaaa 21780acgtgagttg gatgaatttt tttcgatcat tcatccacgc ctgggctgct tttttcaggc 21840actccatggt gccggaatca ggaagcaagg taaggtcttt tatgtccact ttcagtggca 21900cgagaataga cacagccaaa tccattgcgc gttgccactt ctgctcattt ttgtcaatca 21960actgacgccc catacgagcg acctgggata gctgcgggtc ttggttcttc ttgcgtccct 22020ggggcgatct agaagggcct ggctgctcat cgtcggtgtc ggaaattggt ttcgattttt 22080tacgctgcgg gccatccagt aacgcttcgg cgctctgcgg cgcagcgtcc tcactgacgg 22140ctttgcggcg tctggcaacg cgctttggct tcggtgtttc gtcaatgaac agcttgccct 22200cgtcgccgct gctttcagac acatcctcat agtgataccg gctcattttc cttctagatg 22260gaagaacaca gcggtcagtc cagctccgag ccggcgccga atcacgagcc cgcggagctt 22320agcttagaag atgctttgtc tccccaaccc gcggttgaaa gcgccgctcc gggttccgag 22380gatgaaagcg aagctctcaa acactacatt gactccgacg tgctatttaa gcacatcgct 22440agacagagtc gcatcctcaa agatagcctc gccgaccgct ttgaagtgcc tacagacgcg 22500ctagaactaa gtctagcgta tgagcgctct ctattttctc catctacccc acccaagaag 22560caagaaaacg gcacctgcga gccaaaccct cgaatcaatt tctacccaac cttcatgctg 22620ccagaaacac tggcaacata tcacatattc ttttttaacc acaaaattcc gctgtcgtgt 22680cgcgctaatc gcagtcgagc cgatgaaaag ttaatgctaa cagaaggaga ctgcatacct 22740gattttccaa ccacggatcg ggttccaaaa atcttcgaag gtttgggctc agaagagaca 22800gtggcctcca actcactaga agagaaaaga gacagcgctt tagtagaact gcttaacgac 22860tcgccgcggc tcgcgattat aaagcgctcc acagcgctga ctcatttcgc atatcccgcc 22920ataaacatgc cgccaaaagt gatgagttgt gtcatggagg aaatgattgt gaaaaaggcc 22980gaacccgtgg gagaagagtc gacacctgac ggtccagaag ggggcgcgcc agttgtcagt 23040gacgcagaat tggccaagtg gcttggaagt agcgacgcca ccctgctcga agacaggcga 23100aaactgatga tggccgttgt tctagtaaca gctcagctgg agtgcatgaa aaggtttttt 23160acttcttctg acatgatcag aaagctaggt gaaacgctac actacacttt caggcacgga 23220tacgtcaaac aagcctgtaa aatatcaaat gtcgaactac caaacctggt atcatacatg 23280ggcatacttc atgaaaacag actaggtcag cacgtactgc acaacacact ccgcgatgaa 23340cagaggcggg actacattag agacaccatc tttctgatgc ttttgtacac atggcagaca 23400gcgatgggag tgtggcaaca atgtcttgag gtcgaaaaca tcaaagaact aagtaaactg 23460ctcagacgaa agagacgggc gctttggaca ggctttgatg agcgaacaac cgccggcgac 23520ctagccgaca taatctttcc gtcaaaactg ctatcgacat tgcaagccgg gctaccggat 23580tttacaagcc agagcatgat gcaaaatttc cgcagcttca tattagaaag gtctggaata 23640ttgccagcat tatgcaacgc cataccttca gactttgtgc caatagaata caaagagtgc 23700ccgcctccgc tatgggcata ctgttatttg ctaaaattgg caaactacct aatgttccac 23760tctgacgtag cttttaatat ggaaggagag gggctatttg agtgctactg tcgctgtaac 23820ttgtgcaccc ctcaccgctg tcttgcaacc aacactgcct tactaaacga ggtgcaggcc 23880attggcagtt ttgagcttca aaggccccca aatcctgacg ggtctatgcc tcccacactg 23940aaattaacgg cgggggcttg gacctcggca tatttgagaa aatttgaacc tgcagactac 24000cgtcacgatc aaattcgatt ctatgaggac caatcaaaac caccaaaatc cgagccatct 24060gcctgcatca tcacgcaagc cgccattctc gcccaattac atgacataaa aaaagagcgg 24120gaaaaattct tgcttaaaaa gggccacggc gtgtacctag accccaaaac aggcgaagag 24180ctcaacacgc tagagccatc agtctctcac aatgccgcga gccgtcagac cgaccagtct 24240aaatttgaca aaaccgaagt cgcggaaaaa agccgcgcca gaaccccctc ctccaacgcc 24300agacgaggaa actctggaga gcattccagg cgaggacgta gaggaggaat gggacgatat 24360agacagtttg gtcgcggagg agagcgagat ggaggacgag gaattggagg atggcgagac 24420atcagtctcg gagctattaa agaaggatca gcctccgccg ctcccgccga aaacaaggaa 24480ggccccaaaa cagcgtagat gggaccaaac tccaacatcg gcccctggta agcagaactc 24540gtcggtggga ggaaaataca agtcgtggcg tccccacaaa catcacataa ttacggctct 24600gctggcaagc gggtatgacg tgtccttcgc ccgcagattt atgctttacc gccacggaat 24660aaacgttcca aaaaatgtaa tccattacta caattcccaa tgcaggacag aatccccaga 24720agaagtctgg aaagcgaaca atccagtcag ccagtacatc cgcagagccg gcgacgaccc 24780aagagctgag agctaaaata ttcccaacgt tgtacgccat attccagcaa agcagaggtg 24840gcggagtatc tctaaagata aagaaccgat ccttaagatc cctcacaaaa agctgccttt 24900accacaagca ggagagtcag ctgcagagaa ccttggaaga cgccgaggct ctactccaga 24960agtactgttc cgggctgaga ggctctgcgc cttatatctc agctcagcat gagtaaagac 25020atccccaccc cttacgtatg gactttccag ccccaattgg ggcaggctgc cggcgcgtca 25080caagactatt cgactcgcat gaactggcta agtgcaggtc cttcaatgat taaccaggtg 25140aactctgtcc gagccgaccg aaacagaatc ttattgcgtc aagctgcagt atcggaaacg 25200cccagactcg tccgcaaccc gccaacgtgg cctgcccaat acctatttca gccaattggc 25260gcgcctcaga cctttgagct tcccaggaat gagtcattgg aggtggcaat gagtaactcg 25320ggcatgcaat tagccggggg cgggacgcat cgcactaagg atataaaacc agaagacata 25380gtgggacgcg gcctagagct gaacagcgac attccgagcg cttcgttttt gcgtcctgac 25440ggagttttcc agcttgccgg aggtagccgt tcctctttca acccaggact gagtaccttg 25500ctcacggtac aacctgcttc aagcctgcct aggtccggag gaatcggcga agtgcaattt 25560gtgcacgagt ttgtgccgtc cgtgtacttt cagccttttt caggaccacc tggaacatat 25620ccagacgaat ttatctacaa ctacgacata gtctcagatt ccgtcgacgg ttatgactga 25680tacagagtct gatctttcgc tgtttggtgt ctgccggctg cactactccc gctgccagtc 25740taccaactgc ttctggaagc agggaattct gccaacctac cagtgcattt tagacgcgga 25800cctccacgcc gactgcgtgc cagactccct gcaagccggc cacagcctgc ggctcgaact 25860gccacaccgt tttgcctgtt atcaaacctc aaatcacgga ttgcctatcg tgtgctccag 25920caatgtcaag tcaagcagct tcaaagttac atgctcctgt tccagtactg ggatgcatct 25980ggcgctcgcc gatgctctct gtgatcttgt taaccattct atggcagatg aagagcgcta 26040aatcgctgcc gcacaaccac acagcggtaa tccccaggag tgtctgcgtg gccaacgttt 26100cctgtacagg tgtggtgagt gcgacggcga ccctcacaga cgcccagact accgcatcag 26160ccgcgcgcca ccagtgggta tgcgtagtat ccatcaactc cagcagcgac acaacgtgtg 26220tttggaacgg ttggacatac aaagaatttc cgcttgaaat tcaattggac gaacgcttag 26280ccgacacccc tgtggactgt gtggaaggaa ggcgccgcac aacatttgac ctaagagctc 26340tgtgtcggtt tcgctacacg cctctatatg ttttgaaatt agccatacca atctatgcga 26400ctgtgcttac cattgtgggg gcgctcattg cgtttccggc tctgcgctcc cctctcgcca 26460tcagcatgct cccagcagcc atggcagata atggctacca ccaccaccac acctgcgcgc 26520cgttgctact gaccatatta atgttaatcg ccatgctgtg taaggtcacg aagcccacaa 26580acaaactttt catcttagct cttcttagtc tagctgtgcc aggaaattgt ttgaaccagt 26640acagtgtgct agaagggagt ccatgtgaac ttaaatctgc aacaaaacgc tacaccaaag 26700cctcatggta tcgcgactct gaatctgcgc tgctttctcc tttcgccaca atcagtcaat 26760cctcagtaac atactcttcc ccatcctcca gaataatcct agcttcaaac ttgtctctaa 26820tttttacttc tgtaaaacct tcagacaacg gatcctattt tctaagcatc gactatcgcg 26880aatttatcaa gtatgacctg cttgttagtc ctaaaattca aatcaaccta gccatacaaa 26940cacagccagg agttaatcac acatgcataa tttctgccac ttgcagccca cacagcgccc 27000agtacaggtc agtgatcaag tggcagaacc acacttacca ttcaaaagcg cttttcacag 27060ttttcactga gcagttaaat aacaacataa catgcacagt gtcttctcct cttgaaacta 27120attccaagtc tttaacagcg tcacaaatgt gtgtttttca caatcctaat gacttcagcc 27180ctctaatcat tgtaggtgtt ttaactcttg tgttcatagc catatggatc atctctatgt 27240ttcatactgt acgcgtccca atctttaagt atgaactggt gatataaatc aataaactca 27300cgtgattatt agacgcagct tctccgggtc ttcttttccc caacaatcta ttacagctcc 27360ttcgtcaaga ctgacataac gcaacttaag caggtaagct aactttctaa attgcctaaa 27420aggcagcaaa acactaccta acggcactcc attatacttt atctccattg cagttatccg 27480caatgaagcg ctcgattccg tcagatttcg atccagtata tccctatgga aaaagacctt 27540cacttaatat catgccgcca ttttacagcc aagacggttt tcaagaagca ccaaccgcca 27600ccctctcact caaaatcaca gacccaataa cgtttaattc cagcggggca ctttcagtta 27660aagtgggagg gggaataact attaaccaaa acggccaatt agaaactact aacgcgacca 27720cagcagttaa cccaccatta gagtatgcta atggggcgat aagcctaaat accggaaacg 27780gactggcagt tgactcaact caaaatctga caattcttac atcgagccca cttgccgtgt 27840cacaatctgg tttaacgctg aacacaggtg atggcctaga ggtggatggt gatgaagtga 27900aagttaagag cgggcaaggt gtgagtgtag gcactactgg agttgggata aatgccgcct 27960catactttgc ctttccctca aatgtattat ccctccttac tacagctcct ttaagtgtat 28020ccagcggctc tcttggagta gagctaggca acggattaca agtgtcaaat gaccaactga 28080cgctcaacac acagccacta tttacatttt ccaacggggc aatggggctg gcagtcggca 28140acggaatcca aatagaaaat aacgctgtcg ccatttatgc ccaaccatat ttccaataca 28200ccaacagagc cctgggcctt cgccttggaa atggcctgca gaccgaaaat aatgcaattg 28260ccttatattg tcagccgtac ttccaatata cagataacgc actagcgctg cggctagggc 28320aaggactgca aatctccaac aatcaagtag ctttatatgc tcagtcttac tttcaatata 28380ccaataatgc attggcattg cgcttagcga acggtttagg cacgtctaac aataacgttg 28440ttgtaaatta tggaaaaggc ttatttataa actcaagcga ttcaaacaaa ttgcaagtga 28500atattagatc tccgctaaac tactatggca gttcacacac aattggtcta aatacaggaa 28560acggtctaac tgttactagt cttggcgcgc taggtggcaa tgtatccgtt aatattggaa 28620gcgggctatc ttttagctca actgggcagg tgcaggcttc attaggaaac gggctccaaa 28680tcgcttccag tgccatagaa gtcaaactag gcaacggttt acagtttgac aatggcgcca 28740tttccctatc agggtcatct cccgcctaca cagactacac tttatggact actccggacc 28800cctctccaaa cgctaccatc agcgcagaat tagatgccaa gctggtgctt agtatttcaa 28860aagcaggaag cactgctatc ggcaccatcg gtgtagttgg attgaaaggg cctctattaa 28920gtttggccga gcaagccatc aatgttgaaa tttactttga caccagcggt aatattattt 28980ttagcacaag cacgctgaag tcatactggg gatttaggtc tggtgattca tatgatccaa 29040actccacact taatcctctt tatttaatgc caaatcagac cgcataccct ccagggcgac 29100aaaccataac ccaaatagcc tcacttgaag tgtacttagg tggggatact accaaacctg 29160ttcttttaga ggtagctttt aacaccgcaa gtagtggcta ctccctgaag tttacttggc 29220gaaacttggc cagctatgcc ggacagacct tcgctgtatc ccttggaacc ttcacatata 29280tcacacaaca ataaataagt tttaacatct ttatttgagt cgtgaatttt gtggcatcac 29340tcttacagtc attccaccac caccactcca tgcaacctta tacacaagcc tttcaaaatg 29400cattccagtg ttataacaat cagctttttt atgcaatttt acagcatgtt cataacattc 29460aaagtcaggg gaagttatag agacaaagcc agcgggcata gactccaaag atggtttcag 29520gtctaaaagt ttggatgcgt gtccacagtg tggtgaggct gattctccgg aggttctttc 29580tggagcagat agcacttggg gcagccgcag cggtacttcg tcatcctcac tttgcagatc 29640ggagtccctc tcgcaatcgc tagagtctcc actccaggaa caagacgaag ttccagactc 29700ggtgtcgctg actcgtccca gatctgacat tctgaagcct caagtccttc tagtccacac 29760aagtcggaca aagaacacct ggcataccac ccaaacggaa catcgatcga cacattaaac 29820ttcattactc tagaactgcc cgcagttaat

aacatatcac tttccgcaca caaatgagcc 29880gtttccccac ttctaatagg ggccgggtta tgtgagcgaa aaagacagcg aggaattcgc 29940cgcctacctt cccattcttt cctttcgctt tcgctcatcc tagcccatcg ccgctcaaat 30000cttaatttat tccttggctc gcaagcgtca tgcccacaat catcatattc acaatcagca 30060tatttataca tcaagacagg cgtgccggcg cgcaaagcga tagggccttc ttcttccccc 30120caccaaggca gctctatggt aaatcctgga gaggtgcata gtgacaaatg actgctaaat 30180gcccaagaaa acacttttag atctggatta aacaatgatg aaagcatccc aactccataa 30240tagccgtccg gatttctaat ctttacatca aacactatta cagttttttc ttttgtgaga 30300attacatctt cttcaagaca cagatgaacc accgtcttgt cgctgttaaa gattggccgg 30360tgtttgcatt tctccccaac ctcgatatta attggaggcg tgctcattct gaaagagatt 30420ttttttcaat tgaaattttt actactggct ctccaggatt agcataaatc acatagtcta 30480cccactcata cattttacac actatatttt taatcaaatt tggctcatgg gtgatgtctg 30540catacagcca tggaactaaa catgaaacac tgaaatcata accggggggt ataaacactt 30600catgatctaa gcagaagtcg ctctccccat atggcaggaa aaccattttc ttaggtgcca 30660gcagccacac ttcattatcc gacttaagta tcggagcaag tgcatctgga ccggtgtaga 30720caaataactt caactgcatc tgcaacacaa atgcgattta cgcgtcaagc gcttaatcaa 30780gcgttgcttg ttgcgctcat actcgctagg tggcagtgaa agaatgttac atgcactgcc 30840agcaagcagt aacaccgttc tagttctctc tgcacatgct aatgcggcca cctgtgtcat 30900ttcatgacag tgtctacaaa ttattacaag atacaccccg gtataaccta tgcaaaacac 30960cgccccttca aacctaagat tacgaattcg tggcacatcg ccccagtaat taatctttat 31020aaaaatcaaa tgcaaacccc taaacataat actaccctca tataacagcc taaagcttaa 31080atctttgtta gtcagtggcc tataaaatgg aaacctaata ttgtattctg tcccacccac 31140cagctctttc acaatgtcag taataaagcg cctgcgtgac aaggcttcca aagtgctccc 31200ttcatgcaaa tcatgacaac aaacagacca tttaaagcct ttattccttt tgaacattaa 31260ttcaatgtct ccaccacatt caacttttaa gcgagtcccc aagcacagat aatctttcaa 31320caatctatat tgccaagaaa caagaatact tttccatgga attggaattt ctaaattcat 31380agccaatggc agagctgact gtggagaatc aacataagaa ataattttgt gctgaaattt 31440cgaccgagtg gactccgctg tcatctgtaa ttaaagatat ttaacatatt tttgagacat 31500tggcaggcca tacttcataa gctgcaacag ctctctctgc ctaactacct cttttttgct 31560tggctgttta gggccagagc agcaacccac agctcttttt aataggcgcc tagttcgttt 31620tgcacacacc ttggcttgaa tttcagataa attacatgac ctgcaaataa ctattaaaaa 31680atttccatac aaaccatcca catatacagc ctctccaaaa tttaatttac gaattctctt 31740catgtcgcca tctaaaatta ctctgatgta tataaggtgg atcccacgaa tgtaaacact 31800acccatgtac atcaacccct ctggtaaatt cttattcaca caccccctgt aaaaccaaaa 31860tagctgattg taaaatgtcc cttttaaaac ctcttgaaac agtccagtaa gcactttacg 31920ggaagacaag cactgaagac tgccagagtt gtcacaatgg caatgtaaat accatcttga 31980ttgcaatgaa gaaaaatcag gttgaagatc tttagagaac acagaacaca tctctagttc 32040aacgccgtca cacaaatggc gcttcaaaaa cacaaactca tgatgactta atatatgcat 32100ccatggcacc ggcagttcca agcacatagc aaaacaggca gcagtgcgcg gtgagcgaac 32160aaaggctact ggatgactgt ctgttgaatt gcaacaaatt aggccgctgc ctggaacctc 32220aaaatgctcc atcctcaatc ttaagcagaa gctgtcgcag tttaggttcg acggaactcc 32280aggagcagaa agcctcagca acctcttcgg gcactccctc gcccctaggg ccgcaattga 32340tgtaattggc caacacaaaa ccaacgtagt gcacttggcg cattagagtc tggtctgctt 32400tcctggtgaa atgaattttc gcagttgact gattggaaga gtaaataatt gagattatct 32460ctgatgattt ctgcaacgca agcgcctcag ttgaaatgct cattgggtaa taatcacgaa 32520gaatgcgctt cttaaagtga agacgtctgg atgtcattac tgcaataatg caacagtgat 32580tgttttacat tcttccagac tcacatcctc accgattaat ctaaggtaat catacaaagc 32640ctcatgtagg taatcccgca aatccgaaac taagaagtct tcatcactgc ctccattagt 32700cagcaaagcg tccatagagc ttccagcaag gcaaaataat caacatagtt gcctcaagat 32760ccgtatgatg ataggagcta acgtacagca agttagaacc agagaaatat aaagaagctc 32820tggcagtcac aaaagccttt gccatagatg aaacagaagc aatgaaagat tctctattct 32880ccacctgaag gcgagatgta aggcaatggg gaatggaaat ctgcatcatc tccccgtctc 32940taacaggtgg tgccattata ctccagtaga tccaaatccg ccttcccctc gctcagtgtc 33000gtcaagtgta tcaacctcct gaacctcagg caatgagatc ttttggatga caagctgagc 33060tacgcgctgg cctggcgaaa taaggacgtg atgattccca tggttaaaga gcaggacgaa 33120cacctctccc ctgtagtcgc tgtcaatcac gccagcgccc acatccaagc cttgagtcac 33180agacaagcca gagcgaggtg caacgcgtcc gtagtgtccc tcaggaatac ggagctttag 33240gccagtaggc acaagagcgc gagatccagc ctgaatctca acgtaatgcg aagcgcacaa 33300atcatatcca gccgcaccat tagaagctct tttaggaggc acagccgagt cagacacacg 33360cacaaagagc agcttgtcag ccatgatgta cttactcttg gcaaagtaga ccacggccta 33420cagcaaggag tgtaagttta gaaatggcag cacagaaggc tcaggagcag aggcgaatga 33480cgagcagagg agagaaatgg ctttatagag cgaaaaggcg cggtctgtga cgaggcgaaa 33540gggcttctgg cgcctgacag gcgtaaccga aaccgcgtga caaagcacaa gacagtgcaa 33600aagggcagtg actcagcgcc tcgccccgcc gctcgcacgc acacggacac tccccgcccc 33660tcccagaaac tcccgcccag cgacctttga acaattttcc cacgccccct tacgcacagc 33720acgtcaacgt catcacgcaa aagtgttccg tatattattg atgatgtcaa gagtggcacc 33780tctttacctg cgcaggtaat atatagctca ctgggagtgg tgcatagaga aaaaagaccg 33840cccatgatgg gagacgtggc atagaccttt agacaggttt cgtgcggcat cgcagtaaaa 33900gtggccataa attgggaaaa atccctccac gtccgcgggc aaagggctcc aataaagtgg 33960caaatttacg acagtgaaag tcaaagtcca acagctgata ccctaaacac cccatcataa 34020atacacctga ctcagcgcct cgccccgccg ctcgcacgca cacggacact ccccgcccct 34080cccagaaact cccgcccagc gacctttgaa caattttccc acgccccctt acgcacagca 34140cgtcaacgtc atcacgcaaa agtgttccgt atattattga tgatg 3418546DNAArtificial SequenceDescription of Artificial Sequence Synthetic DNA Linker 4ctgcag 6536DNAArtificial SequenceDescription of Artificial Sequence DNA Primer 5ggccttaatt aacatcatca ataatatacg gaacac 36639DNAArtificial SequenceDescription of Artificial Sequence DNA Primer 6ggaagatctt gagcatgcag agcaattcac gccgggtat 39738DNAArtificial SequenceDescription of Artificial Sequence DNA Primer 7ggcaatgaga tcttttggat gacaagctga gctacgcg 38841DNAArtificial SequenceDescription of Artificial Sequence Synthetic DNA Linker 8ctgtagatct gcggccgcgt ttaaacgtcg acaagcttcc c 41927DNAArtificial SequenceDescription of Artificial Sequence Synthetic DNA Linker 9aattcgagct cgcccgggcg agctcga 271042DNAArtificial SequenceDescription of Artificial Sequence Synthetic DNA Linker 10gactctaggg gcggggagtt taaacgcggc cgcagatcta gc 421132DNAArtificial SequenceDescription of Artificial Sequence Synthetic SmaI Site 11gaattcgagc tcgcccgggc gagctcgaat tc 321227DNAArtificial SequenceDescription of Artificial Sequence Synthetic DNA Linker 12ctgtagatct gcggccgcgt ttaaacg 271314DNAArtificial SequenceDescription of Artificial Sequence Synthetic DNA Linker 13tcgacaagct tccc 141433DNAArtificial SequenceDescription of Artificial Sequence Synthetic DNA Linker 14cccgggagtt taaacgcggc cgcagatcta gct 331532DNAArtificial SequenceDescription of Artificial Sequence Synthetic DNA Linker 15gaattcgagc tcgcccgggc gagctcgaat tc 321614DNAArtificial SequenceDescription of Artificial Sequence Synthetic DNA Linker 16tcgacaagct tccc 141710DNAArtificial SequenceDescription of Artificial Sequence Synthetic DNA Linker 17caagcttccc 10

Patents by SCHERING-PLOUGH CORPORATION;PATENT DEPARTMENT (K-6-1, 1990)

Patents by Mark D. Cochran

Patents in class Recombinant virus encoding one or more heterologous proteins or fragments thereof

Patents in all subclasses Recombinant virus encoding one or more heterologous proteins or fragments thereof

User Contributions:

Comment about this patent or add new information about this topic:

Inventors list

Agents list

Assignees list

List by place

Classification tree browser

Top 100 Inventors

Top 100 Agents

Top 100 Assignees

Usenet FAQ Index

Documents

Other FAQs

Patent application title: NOVEL RECOMBINANT AND MUTANT ADENOVIRUSES

Inventors: Mark D. Cochran Christina H. Chiang
Agents: SCHERING-PLOUGH CORPORATION;PATENT DEPARTMENT (K-6-1, 1990)
Assignees:
Origin: KENILWORTH, NJ US
IPC8 Class: AA61K3912FI
USPC Class: 4241991
Patent application number: 20090274724

Abstract:

Claims:

Description:

Inventors list

Agents list

Assignees list

List by place

Classification tree browser

Top 100 Inventors

Top 100 Agents

Top 100 Assignees

Usenet FAQ Index

Documents

Other FAQs

Patent application title: NOVEL RECOMBINANT AND MUTANT ADENOVIRUSES

Inventors: Mark D. Cochran Christina H. Chiang Agents: SCHERING-PLOUGH CORPORATION;PATENT DEPARTMENT (K-6-1, 1990) Assignees: Origin: KENILWORTH, NJ US IPC8 Class: AA61K3912FI USPC Class: 4241991 Patent application number: 20090274724

Abstract:

Claims:

Description:

Inventors: Mark D. Cochran Christina H. Chiang
Agents: SCHERING-PLOUGH CORPORATION;PATENT DEPARTMENT (K-6-1, 1990)
Assignees:
Origin: KENILWORTH, NJ US
IPC8 Class: AA61K3912FI
USPC Class: 4241991
Patent application number: 20090274724