Inventors list |
Assignees list |
Classification tree browser |
Top 100 Inventors |
Top 100 Assignees |
Patent application title: A34 AND A33-LIKE 3 DNA PROTEIN, ANTIBODIES THERETO AND METHODS OF TREATMENT USING SAME
Inventors:
Matthew Scanlan (New York, NY, US)
Cynthia Scanlan (Princeton Junction, NY, US)
Gerd Ritter (New York, NY, US)
Gerd Ritter (New York, NY, US)
Lioyd Old (New York, NY, US)
Achim Jungbluth (New York, NY, US)
Assignees:
LUDWIG INSTITUTE FOR CANCER RESEARCH
IPC8 Class: AA61K39395FI
USPC Class:
4241381
Class name: Binds expression product or fragment thereof of cancer-related gene (e.g., oncogene, proto-oncogene, etc.)
Publication date: 10/22/2009
Patent application number: 20090263394
Sign up to receive free email alerts when patent applications with chosen keywords are published SIGN UP
Abstract:
Polynucleotide molecules and polypeptide molecules A34 and A33-like 3 are
described, as well as antibodies to polypeptide molecules A34 and
A33-like 3. Also described are methods of detecting cancers expressing
these polypeptides, and methods and kits for diagnosing said cancers, and
methods of inhibiting effects of a cancer in a patient.Claims:
1-7. (canceled)
8. A method of reducing the effects in a patient of a cancer that expresses A34 antigen, comprising administering to said patient a therapeutically effective amount of an immunoglobulin molecule which binds to A34 protein.
9. A method of reducing the effects in a patient of a cancer that expresses A34 antigen, comprising administering to said patient a therapeutically effective amount of an immunoglobulin which binds to A34 protein and is conjugated to an anti-cancer agent.
10. An isolated polynucleotide molecule comprising an isolated polynucleotide encoding A34 protein.
11. An expression vector comprising the isolated polynucleotide molecule of claim 10, wherein said polynucleotide molecule is located in operable relation to at least one promoter.
12. A host cell transformed or transfected with the isolated polynucleotide molecule of claim 10.
13. A host cell transformed or transfected with the expression vector of claim 11.
14. An isolated polypeptide molecule comprising A34, or an antigenic fragment of said A34.
15. The isolated polypeptide of claim 14, wherein said isolated polypeptide comprises SEQ ID NO: 1 or SEQ ID NO: 6.
16. A polypeptide produced by recombinant expression of the isolated polynucleotide molecule of claim 10.
17. A method of diagnosing cancer characterized by the presence of A34 antigen in cancer cells, comprising:obtaining a sample of cells of interest;contacting said sample with an agent, which specifically binds A34 antigen, such that A34/agent complexes may be formed; anddetecting the presence or absence of said complexes, wherein the presence of said complexes indicates a positive cancer diagnosis.
18. The method of claim 17, wherein the agent is an antibody, or immunologically active fragment thereof, wherein said antibody or fragment is specific for the A34 protein.
19. The method of claim 17, wherein the agent is a nucleic acid molecule comprising contacting said sample with a nucleic acid molecule which hybridizes to all or part of the nucleic acid molecule of A34.
20. (canceled)
21. A method for determining regression, progression, or onset of a cancerous condition comprising monitoring a sample from a patient with said cancerous condition for the presence, absence, or change in expression level of A34 antigen comprising:obtaining a sample of interest;contacting said sample with at least one agent, which specifically binds A34 antigen, such that A34/agent complexes may be formed; anddetecting the presence, absence or change in of said complexes, wherein the presence, absence, or change in expression level of said complexes indicates progression, regression or onset of cancer diagnosis.
22. The method of claim 21, wherein the at least one agent is an antibody, or immunologically active fragment thereof, wherein said antibody or fragment is specific for the A34 polypeptide.
23. The method of claim 21, wherein the agent is a nucleic acid molecule comprising contacting said sample with a nucleic acid molecule which hybridizes to all or part of the nucleic acid molecule of A34.
24-32. (canceled)
33. A method for determining if cancer cells which express A34 are present in a sample, comprising:contacting a sample of interest with at least one oligonucleotide molecule which specifically hybridizes to a nucleic acid molecule which encodes A34, wherein hybridization of said at least one oligonucleotide molecule to a nucleic acid molecule is indicative of cancer cells which express A34 in said sample; anddetecting the presence or absence of such hybridization, wherein the presence of said hybridization indicates the presence of cancer cells which express A34.
34. An isolated polynucleotide molecule comprising a polynucleotide sequence which is an antisense sequence of A34.
35-47. (canceled)
Description:
FIELD OF THE INVENTION
[0001]The invention relates to A34 and A33-like 3 polypeptides, and to the nucleotide sequences encoding these polypeptides, and nucleotide and polypeptide fragments thereof, as well as antisense sequences thereof. The invention also relates to immunoglobulin products that bind with specificity to A34 antigen and/or A33-like 3 antigen, and CDR and variable regions thereof. This invention is also directed to methods of inhibiting cancer in a patient with such immunoglobulin products, and to compositions comprising such immunoglobulin products, as well as to kits and methods of detecting cancers.
BACKGROUND OF THE INVENTION
[0002]Modern medicine has been indisputably enriched by the intersection of traditional treatments for disease with the inroads of molecular biology. In particular, immunology has provided new hope for the treatment of various diseases, particularly neoplastic diseases, by providing well-characterized and specific antibodies. Antibodies have become important as therapeutic agents because they may be targeted to a specific site for action. For example, cancer cells may possess a "marker" protein that may be a binding site or antigen for a particular antibody.
[0003]Historically, antibodies were generated in laboratory animals (usually mice or rabbits) by injecting laboratory animals with the antigen of interest over an extended period. (For general discussion of the structure and biosynthesis of immunoglobulins, see standard immunology textbooks, such as W. E. Paul, Fundamental Immunology, Raven Press, New York, N.Y. 1993, or Janeway et al., Immunobiology The Immune System In Health and Disease, Garland Publishing, New York, N.Y. 2001.) The foreign antigen resulted in an immune response; the resulting antibodies could then be purified from blood. However, this approach has limitations. In vivo use of antibodies from a different species may induce a potentially fatal response (for example, murine antibodies when injected into humans may produce a human anti-mouse antibody response--the "HAMA" response, see, for example, Schiff et al., Cancer Research 45: 879-885 (1985)). Additionally, non-human antibodies will be less efficacious in stimulating human complement or cell mediated toxicity.
[0004]Molecular biology again begins to provide an answer to these issues. Chimeric and recombinant antibodies are now being used to address these issues. Chimeric antibodies exploit the component nature of immunoglobulin products by combining portions of antibodies from different species. For example, the variable region from a mouse may be combined with the constant regions from a human. Recombinant DNA techniques are then used for cutting and splicing the various components to form functional immunoglobulin products. Another approach for expanding the utility of antibodies into immunoglobulin products is the technique known as "CDR grafting." In this method, only the complementarity determining region, "CDR," is inserted into a human antibody framework. Even this approach may be fine-tuned by substitution of critical murine antibody residues in the human variable regions. The binding of an antibody to its target antigen is mediated through the complementarity-determining regions (CDRs) of its heavy and light chains, with the role of CDR3 of the heavy chain being of particular importance (Xu and Davis, Immunity, 13:37-45, 2000). The use and production of such humanized antibodies continues to be explored, but these techniques are in common current usage. U.S. Pat. Nos. 5,225,539; 5,530,101; 5,585,089; and 5,859,205 describe examples of such techniques.
[0005]Yet another approach to avoid the potential problems of immunogenic reactions against non-human protein sequences is using fully human antibodies. Methods for preparing fully human antibodies are well known in the art. For example, fully human antibodies can be prepared by immunizing transgenic mice which express human immunoglobulins instead of mouse immunoglobulins. An antibody response in such a mouse directly generates fully human antibodies. Examples of such mice include the Xenomouse® (Abgenix, Inc.) and the HuMAb-Mouse@ (Medarex, Inc.), see also U.S. Pat. No. 6,207,418, U.S. Pat. No. 6,150,584, U.S. Pat. No. 6,111,166, U.S. Pat. No. 6,075,181, U.S. Pat. No. 5,922,545, U.S. Pat. No. 5,545,806 and U.S. Pat. No. 5,569,825. Antibodies can then be prepared by standard techniques, e.g., standard hybridoma techniques, or by phage display (see below). These antibodies will then contain only fully human amino acid sequences.
[0006]Monoclonal antibodies, including fully human antibodies, may also be generated and isolated from phage display libraries. The construction and screening of phage display libraries are well known in the art, see, e.g., Marks et al., J. Mol. Biol. 222(3): 581-597 (1991); Hoogenboom et al., J. Mol. Biol., 227(2): 381-388 (1992); and U.S. Pat. Nos. 5,885,793, and 5,969,108.
[0007]The following references are illustrative of such fully human antibodies and phage display techniques: Marks et al., "By-passing immunization. Human antibodies from V-gene libraries displayed on phage," J. Mol. Biol. 222(3):581-597 (1991); Hoogenboom et al., "By-passing immunisation. Human antibodies from synthetic repertoires of germline VH gene segments rearranged in vitro," J. Mol. Biol. 227(2):381-388 (1992).
[0008]Novel strategies for improving the efficacy of therapeutic monoclonal antibodies, such as augmenting their in vivo effector function, conjugating them directly to cytotoxic agents or radionuclides, and activating such conjugated agents with pre-targeted pro-drugs, as well as coupling monoclonal antibody therapy with traditional chemotherapy regimes, have been introduced. Large scale clinical trials employing these second generation monoclonal antibodies are currently underway and some have gained FDA approval for the treatment of cancer, most notably anti-c-erbB-2/Her2neu (Herceptin) for the treatment of breast cancer, anti-CD20 (Rituxan) for the treatment of non-Hodgkins lymphoma, and anti-CD52 (Campath) for the treatment B cell chronic lymphocytic leukemia.
[0009]The discovery of new, therapeutically relevant cell surface target molecules has not kept pace with the rapid advances in monoclonal antibody technology, and only a relatively small number of antigenic targets are being pursued in this regard. This is especially poignant given the momentous progress in gene discovery emanating from the analysis of the human genome, transcriptome, and proteome. In contrast, the identification of intracellular targets for active-specific cancer immunotherapy i.e., cancer vaccines, has flourished in the last decade. Thus, mining the human transcriptome for new cell surface antigens is highly warranted. In this regard, the instant invention resulted partially from searching the human expressed sequence tag (EST) database for novel transcripts encoding tissue-restricted cell surface proteins because these may represent new targets for monoclonal antibody based therapies.
[0010]The A33/JAM gene family includes at least seven previously known proteins (A33, CAR, HCTX, ELAM, JAM1, JAM2, and JAM3). These proteins are generally distinguished by two transmembrane domains (with a single signal sequence) and two Ig-like domains. One member, A33, is known to be associated with colon cancer. The isolation and characterization of the A33 molecule is described in U.S. Pat. No. 5,712,369. Humanized antibodies to A33 are described in U.S. Pat. Nos. 5,958,412; 6,307,026, and Rader et al., J. Biol. Chem. 275(18):13668-76 (2000); methods of using A33 antibodies are described in U.S. Pat. Nos. 6,346,249 B1 and 6,342,587. All these references are specifically incorporated herein by reference.
[0011]Human clinical trials have been conducted with mouse and humanized antibodies directed to A33. The biodistribution and imaging characteristics of 131I-mAb A33 were studied in colon carcinoma patients with hepatic metastases. The studies showed that mAb A33 localization was antigen-specific, cancer:liver ratios were 2.3- to 45 fold higher for specific antibody as compared to non-specific antibodies. See, for example, Welt et al., J. Clin. Oncol. 8:1894-1906 (1990). A subsequent radioimmunotherapy phase I/II study of 131I-mAb A33 demonstrated that 131I-mAb A33 had modest anticancer effects in heavily pre-treated patients who were no longer responding to chemotherapy. See, for example, Welt et al., J. Clin. Oncol. 12:1561-1571 (1994).
[0012]Other clinical trials and results for A33 mAbs have been described in, for example, Welt et al., "Quantitative analysis of antibody localization in human metastatic colon cancer: a phase I study of monoclonal antibody A33," J. Clin. Oncol. 8(11):1894-906 (1990); and Welt et al., "Phase I/II study of iodine 131-labeled monoclonal antibody A33 in patients with advanced colon cancer," J. Clin. Oncol. 12(8):1561-71 (1994).
[0013]However, A33 is a marker mainly limited to colon cancer. Two novel members of the A33/JAM family are herein described. One new protein/gene is termed "A34." Yet another novel member of this family is also described and is termed "A33-like 3."
[0014]U.S. Pat. No. 6,312,921, to Jacobs et al. for "Secreted Proteins and Polynucleotides Encoding Them," discloses protein and polynucleotides with some overlap with A34. However, these sequences are not identical to A34 or A33-like 3; and, in contrast to the disclosed methods of the instant invention, Jacobs' disclosed uses are non-specific, i.e., for unspecified biological activity, research uses, and nutritional uses.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0015]Bispecific antibodies: Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for A34 or A33 like 3, the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit.
[0016]Methods for making bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-chain/light-chain pairs, where the two heavy chains have different specificities [Milstein and Cuello, Nature, 305:537-539 (1983)]. It is also well known within the art of how to generate bispecific antibodies, or bispecific antibody fragments, by using recombinant DNA techniques [Kriangkum et al. Biomol Eng. 2001 September; 18(2):31-40].
[0017]Cancer: Any one of a number of diseases characterized by uncontrolled cell growth and/or proliferation. Examples are neoplasms, adenocarcinomas, carcinomas, tumors, leukemias, etc.
[0018]CDR: Complementarity determining regions, sections of an immunoglobulin molecule. There are typically three CDRs present in each heavy and light chain, respectively.
[0019]Epitope: A portion of a molecule (generally a protein, though it may be any moiety) that is specifically recognized by an immunoglobulin product.
[0020]Fragment: Various fragments of immunoglobulin or antibodies are known in the art, i.e., Fab, Fab2, F(ab')2, Fv, Fc, Fd, scFvs, etc. A Fab fragment is a multimeric protein consisting of the immunologically active portions of an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region, covalently coupled together and capable of specifically binding to an antigen. Fab fragments are generated via proteolytic cleavage (with, for example, papain) of an intact immunoglobulin molecule. A Fab2 fragment comprises two joined Fab fragments. When these two fragments are joined by the immunoglobulin hinge region, a F(ab')2 fragment results. An Fv fragment is a multimeric protein consisting of the immunologically active portions of an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region covalently coupled together and capable of specifically binding to an antigen. A fragment could also be a single chain polypeptide containing only one light chain variable region, or a fragment thereof that contains the three CDRs of the light chain variable region, without an associated heavy chain moiety or, a single chain polypeptides containing only one heavy chain variable region, or a fragment thereof containing the three CDRs of the heavy chain variable region, without an associated light chain moiety; and multi specific antibodies formed from antibody fragments, this has for example been described in U.S. Pat. No. 6,248,516. Fv fragments or single region (domain) fragments are typically generated by expression in host cell lines of the relevant identified regions. These and other immunoglobulin or antibody fragments are within the scope of the invention and are described in standard immunology textbooks such as Paul, Fundamental Immunology or Janeway et al. Immunobiology (cited above). Molecular biology now allows direct synthesis (via expression in cells or chemically) of these fragments, as well as synthesis of combinations thereof. A fragment of an antibody or immunoglobulin can also have bispecific function as described above.
[0021]Immunoglobulin molecule (Igs): A class of protein molecules present in bodily fluids (e.g., plasma, colostrum, and tears) which have one or more immunoglobulin domains. Typically, a monomeric immunoglobulin molecule comprises four polypeptide chains. The four chains are two identical heavy chains and two identical light chains and are linked by disulfide bonds to form the Y-shaped monomeric antibody molecule.
[0022]Immunoglobulin superfamily molecule: A molecule that has a domain size and an amino acid sequence that is significantly similar to immunoglobulin or immunoglobulin domains. This similarity significance is determined via computer program (for example, Align, a program described by Dayhoff et al., Meth. Enzymol. 91: 524-545 (1983)). An Align computer program score of less than 3 indicates that the molecule is a member of an immunoglobulin superfamily. Examples include immunoglobulin heavy chains from IgM, IgD, IgG, IgA, or IgE, light chains kappa and lambda, major histocompatability antigens, etc.
[0023]Multimeric protein: a protein containing more than one separate polypeptide or protein chain associated with one another to form a singular protein unit. The units may be the same or different, i.e., homodimers and heterodimers are both encompassed.
[0024]Polypeptide and peptide: A linear series of amino acids connected covalently by peptide bonds between the alpha amino and carboxy groups of adjacent amino acids.
[0025]Protein: A linear series of greater than about 50 amino acids where said amino acids are connected covalently by peptide bonds between the alpha amino and carboxyl groups of adjacent amino acids.
[0026]Therapeutically effective amount: The amount of a composition administered to a patient in need thereof in the course of treatment. The amount and concentration of the active ingredient(s) is within the skill of one of ordinary skill in the medical and biomedical arts, and takes into account such factors as the age, health, weight, height, overall physical condition, disease state, other medications received, etc., of the patient in need of treatment.
[0027]Treatment or treating: A method of inhibiting, reducing, alleviating, and/or ameliorating all or some of the effects of a disease in a patient. Treatment includes the prevention of occurrence of a disease in a patient who is currently not experiencing any symptoms, but who is or who may be at risk for the disease.
[0028]The instant invention comprises isolated A34 and A33-like 3 proteins and/or polypeptide molecules, and isolated polynucleotide molecules encoding these proteins and/or polypeptide molecules. It also encompasses the isolated immunoglobulin products that bind these proteins and/or any epitopes thereof, and various fragments thereof, including variable regions and/or CDRs.
[0029]The protein and/or immunoglobulin product according to the invention may be isolated from natural sources, or may be produced recombinantly in host cells. Included within the scope of the invention are the conservative substitutions known to one of ordinary skill in the art, i.e., substitutions resulting in substantially similar sequences. Conservative substitutions are those amino acid or nucleic acid substitutions which do not significantly change the properties of the molecule compared to the molecule before the substitution(s). Substantially similar nucleic acid fragments of the instant invention may also be characterized by the percent identity of the amino acid sequences that they encode to the amino acid sequences disclosed herein, as determined by algorithms commonly employed by those skilled in this art.
[0030]As used herein, the term "conservative substitution" denotes the replacement of an amino acid residue by another, biologically similar residue. As such, it should be understood that in the context of the present invention, a conservative substitution is recognized in the art as a substitution of one amino acid for another amino acid that has similar properties. Examples of conservative substitutions include the substitution of one hydrophobic residue such as isoleucine, valine, leucine, alanine, cysteine, glycine, phenylalanine, proline, tryptophan, tyrosine, norleucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like. Neutral hydrophilic amino acids which can be substituted for one another include asparagine, glutamine, serine and threonine. The term "conservative substitution" also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid.
[0031]Exemplary conservative substitutions are set out in the following Table A from WO 97/09433.
TABLE-US-00001 TABLE A Conservative Substitutions I SIDE CHAIN CHARACTERISTIC AMINO ACID Aliphatic Non-polar G A P I L V Polar - uncharged C S T M N Q Polar - charged D E K R Aromatic H F W Y Other N Q D E
[0032]Alternatively, conservative amino acids can be grouped as described in Lehninger, (Biochemistry, 2nd Ed.; Worth Publishers, Inc. NY:NY (1975), pp. 71-77) as set out in the following Table B.
TABLE-US-00002 TABLE B Conservative Amino Acid Substitutions II SIDE CHAIN CHARACTERISTIC AMINO ACID Non-polar (hydrophobic) A. Aliphatic: A L I V P B. Aromatic: F W C. Sulfur-containing: M D. Borderline: G Uncharged-polar A. Hydroxyl: S T Y B. Amides: N Q C. Sulfhydryl: C D. Borderline: G Positively Charged (Basic): K R H Negatively Charged (Acidic): D E
[0033]Exemplary conservative substitutions are set out in the following Table C.
TABLE-US-00003 TABLE C Conservative Substitutions III Original Exemplary Residue Substitution Ala (A) Val, Leu, Ile Arg (R) Lys, Gln, Asn Asn (N) Gln, His, Lys, Arg Asp (D) Glu Cys (C) Ser Gln (Q) Asn Glu (E) Asp His (H) Asn, Gln, Lys, Arg Ile (I) Leu, Val, Met, Ala, Phe Leu (L) Ile, Val, Met, Ala, Phe Lys (K) Arg, Gln, Asn Met (M) Leu, Phe, Ile Phe (F) Leu, Val, Ile, Ala Pro (P) Gly Ser (S) Thr Thr (T) Ser Trp (W) Tyr, Phe Tyr (Y) Trp, Phe, Thr, Ser Val (V) Ile, Leu, Met, Phe, Ala
[0034]If desired, the peptides of the invention can be modified, for instance, by glycosylation, amidation, carboxylation, or phosphorylation, or by the creation of acid addition salts, amides, esters, in particular C-terminal esters, and N-acyl derivatives of the peptides of the invention. The peptides also can be modified to create peptide derivatives by forming covalent or noncovalent complexes with other moieties. Covalently-bound complexes can be prepared by linking the chemical moieties to functional groups on the side chains of amino acids comprising the peptides, or at the N- or C-terminus.
[0035]In particular, it is anticipated that the aforementioned peptides can be conjugated to a reporter group, including, but not limited to a radiolabel, a fluorescent label, an enzyme (e.g., that catalyzes a colorimetric or fluorometric reaction), a substrate, a solid matrix, or a carrier (e.g., biotin or avidin).
[0036]Suitable nucleic acid fragments (isolated polynucleotides of the present invention) encode polypeptides that are at least about 70% identical, preferably at least about 80% identical, to the amino acid sequences reported herein. Preferred nucleic acid fragments encode amino acid sequences that are about 85% identical to the amino acid sequences reported herein. More preferred nucleic acid fragments encode amino acid sequences that are at least about 90% identical to the amino acid sequences reported herein. Most preferred are nucleic acid fragments that encode amino acid sequences that are at least about 95% identical to the amino acid sequences reported herein. Suitable nucleic acid fragments not only have the above identities but typically encode a polypeptide having at least 50 amino acids, preferably at least 100 amino acids, more preferably at least 150 amino acids, still more preferably at least 200 amino acids, and most preferably at least 250 amino acids. Also encompassed in the invention are antisense sequences of the isolated polynucleotides of the present invention.
[0037]Sequence alignments and percent identity calculations may be performed, for example, using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignment of the sequences may be performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method may be KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5, for example.
[0038]For the multiple sequence alignments shown, the Clustal (found at http://clustalw.genome.ad.jp/) default settings were utilized which rely on a GAP OPEN PENALTY=10 and a GAP EXTENSION PENALTY=0.05. For the pairwise alignments shown, the default settings for BLAST (found at http://www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html) were used, which rely on a GAP OPEN PENALTY=11 and a GAP EXTENSION PENALTY=1.
[0039]A "substantial portion" of an amino acid or nucleotide sequence comprises an amino acid or a nucleotide sequence that is sufficient to afford putative identification of the protein or gene that the amino acid or nucleotide sequence comprises. Amino acid and nucleotide sequences can be evaluated either manually, by one skilled in the art, or by using computer-based sequence comparison and identification tools that employ algorithms such as BLAST (Basic Local Alignment Search Tool; Altschul et al. J. Mol. Biol. 215:403-410 (1993); see also www.ncbi.nlm.nih.gov/BLAST/).
[0040]In general, a sequence of ten or more contiguous amino acids or thirty or more contiguous nucleotides is necessary in order to putatively identify a polypeptide or nucleic acid sequence as homologous to a known protein or gene. Moreover, with respect to nucleotide sequences, gene-specific oligonucleotide probes comprising 30 or more contiguous nucleotides may be used in sequence-dependent methods of gene identification (e.g., Southern hybridization) and isolation (e.g., in situ hybridization of bacterial colonies or bacteriophage plaques). In addition, short oligonucleotides of 12 or more nucleotides may be used as amplification primers in PCR in order to obtain a particular nucleic acid fragment comprising the primers.
[0041]Accordingly, a "substantial portion" of a nucleotide sequence comprises a nucleotide sequence that will afford specific identification and/or isolation of a nucleic acid fragment comprising the sequence. The instant specification teaches amino acid and nucleotide sequences encoding polypeptides that comprise A34 and A33-like 3. The skilled artisan, having the benefit of the sequences as reported herein, may now use all or a substantial portion of the disclosed sequences for purposes known to those skilled in this art. Accordingly, the instant invention comprises the complete sequences as reported in the accompanying Figures and Sequence Listing, as well as substantial portions of those sequences as defined above, and antisense sequences thereof.
[0042]"Codon degeneracy" refers to divergence in the genetic code permitting variation of the nucleotide sequence without affecting the amino acid sequence of an encoded polypeptide. Accordingly, the instant invention includes any nucleic acid fragment comprising a nucleotide sequence that encodes all or a substantial portion of the amino acid sequences set forth herein. The skilled artisan is well aware of the "codon-bias" exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. Therefore, when synthesizing a nucleic acid fragment for improved expression in a host cell, it is desirable to design the nucleic acid fragment such that its frequency of codon usage approaches the frequency of preferred codon usage of the host cell.
[0043]The immunoglobulin molecule may be an antibody, an Fv fragment, an Fc fragment, an Fd fragment, a Fab fragment, a Fab' fragment, a F(ab)2 fragment, F(ab')2 fragment, an scFvs fragment, a single chain antibody, a multimeric antibody, or any combination thereof. The immunoglobulin molecule may be joined to a reporter or chemotherapeutic molecule, or it may be joined to an additional fragment, and it may be a monomer or a multimeric product. The immunoglobulin molecule may also be made recombinantly, to include all or part of the variable regions and/or CDRs.
[0044]The inventive protein(s)/antibody(ies) make it possible to detect A34 and/or A33-like 3 polypeptide or polynucleotide molecules, in order to provide a patient with an accurate diagnosis of the presence of cancer that expresses any of these proteins. Detection methods and kits according to the invention may detect A34 and A33-like 3 molecules in any way known in the art. For example, the expression of A34 and A33-like 3 may be detected directly, via mRNA or antisense technology, e.g., by using PCR based techniques, or agents which bind the expressed protein may be detected, e.g., directly with an antibody or polypeptide fragment which binds said A34 and A33-like 3 molecule to form a complex. The antibody or polypeptide fragment which is capable of forming a complex may be linked with a label in order to facilitate detection of the complexes. Such labels are well known in the art, and include, for example, radioactive labels and fluorescent labels.
[0045]The bound complexes comprise immunoglobulin molecules with an affinity for A34 protein. This affinity may be greater than about 50 nM, or preferably greater than about 5 nM, as measured, for example, by surface plasmon resonance (Biacore®) or other biosensor system.
[0046]The present invention encompasses methods of diagnosing cancer characterized by the presence of A34 antigen in cancer cells, comprising: obtaining a sample of cells of interest; contacting said sample with an agent, which specifically binds A34 antigen, such that A34/agent complexes may be formed; and detecting the presence or absence of said complexes, wherein the presence of said complexes indicates a positive cancer diagnosis.
[0047]In another embodiment, the present invention encompasses methods for determining regression, progression, or onset of a cancerous condition comprising monitoring a sample from a patient with said cancerous condition for the presence, absence, or change in expression level of A34 antigen comprising: obtaining a sample of interest; contacting said sample with at least one agent, which specifically binds A34 antigen, such that A34/agent complexes may be formed; and detecting the presence, absence or change in of said complexes, wherein the presence, absence, or change in expression level of said complexes indicates progression, regression or onset of cancer diagnosis.
[0048]In a further embodiment, the present invention encompasses methods for determining if cancer cells which express A34 are present in a sample, comprising: contacting a sample of interest with at least one oligonucleotide molecule which specifically hybridizes to a nucleic acid molecule which encodes A34, wherein hybridization of said at least one oligonucleotide molecule to a nucleic acid molecule is indicative of cancer cells which express A34 in said sample; and detecting the presence or absence of such hybridization, wherein the presence of said hybridization indicates the presence of cancer cells which express A34.
[0049]A kit according to the invention generally comprises an appropriate agent which forms a complex with at least one of the A34 and A33-like 3 molecules (either polynucleotide or polypeptide molecules) and instructions for the method of forming and detecting complexes in a sample of interest.
[0050]In general, the patient is a mammal; preferably, the patient is a human.
[0051]A further advantage of the immunoglobulin products according to the instant invention is in methods of treatment of cancers or neoplasms that express A34 and/or A33-like 3 protein. In addition to detecting these cancers, the immunoglobulins of the instant invention may be used to treat or to reduce the effects of said cancers and neoplasms by administration of the inventive immunoglobulin products, either alone, with a pharmaceutically acceptable carrier, or in combination with another anti-cancer agent. When the inventive immunoglobulin products are administered in combination with an additional anti-cancer agent, the complex is specifically targeted to the cancer cells, thus maximizing the therapeutic potential of the anti-cancer agent while minimizing damage to healthy tissues.
BRIEF DESCRIPTION OF THE DRAWINGS
[0052]The invention will be described in further detail with reference to illustrative embodiments shown in the accompanying drawings.
[0053]FIG. 1 shows the end point RT-PCR expression of A34 mRNA in 24 normal tissues.
[0054]FIG. 2 shows an analysis of A34 expression in normal and malignant tissues using real-time PCR.
[0055]FIG. 3 shows the full length A34 amino acid sequence (SEQ ID NO: 1) and the amino acid sequence comparison of A34 with A33 (SEQ ID NO: 2).
[0056]FIG. 4 shows an initially obtained polynucleotide sequence (SEQ ID NO: 3) and amino acid sequence (SEQ ID NO: 4) of A34.
[0057]FIG. 5 shows an additional A34 clone polynucleotide (SEQ ID NO: 5) and amino acid sequence (SEQ ID NO: 6).
[0058]FIG. 6 shows the polynucleotide sequence (SEQ ID NO: 7) and amino acid sequence (SEQ ID NO: 8) of A33-like 3.
[0059]FIG. 7 shows a comparison between the amino acid sequences of A33-like 3 (SEQ ID NO: 9) and A33 (SEQ ID NO: 10).
[0060]FIG. 8 shows a Western blot with mAb 342 of normal colonic mucosa and normal gastric mucosa.
[0061]FIGS. 9 and 10 show immunohistochemical analyses of A34 expression in normal testis.
[0062]FIG. 11 shows an immunohistochemical analysis of A34 expression in normal stomach mucosa/surface epithelium.
[0063]FIGS. 12, 13, and 14 show an immunohistochemical analyses of A34 expression in normal stomach mucosa/fundic glands.
[0064]FIGS. 15 and 16 show an immunohistochemical analysis of A34 expression in normal pancreas.
[0065]FIGS. 17-20 show immunohistochemical analyses of A34 expression in stomach carcinoma.
[0066]FIG. 21 shows the polynucleotide and amino acid sequences of an murine A34 variable region light chain clone and heavy chain clone designated 209-970. CDRs are indicated with shaded boxes and underlining.
[0067]FIG. 22 shows the polynucleotide and amino acid sequences of an murine A34 variable region light chain clone and heavy chain clone designated 209-564. CDRs are indicated with shaded boxes and underlining.
[0068]FIG. 23 shows the polynucleotide and amino acid sequences of an murine A34 variable region light chain clone and heavy chain clone designated 209-342.
[0069]FIG. 24 shows the amino acid sequences of the CDR regions for the three A34 antibody clones. (SEQ ID NOS: 32-49).
[0070]FIG. 25 shows the full length A34 nucleotide sequence, SEQ ID NO: 50.
[0071]FIG. 25 shows the full length A34 amino acid sequence, SEQ ID NO 1.
SUMMARY OF THE INVENTION
[0072]The invention relates to novel proteins from the same protein family as the A33 protein and to immunoglobulin products which recognize and bind to these novel proteins. Two additional members of the A33 protein family have been identified and are described herein, i.e., A34 and A33-like 3 protein. All three are members of the A33/JAM family, as shown by their amino acid sequences and expression profiles. Antibodies to A34 are of particular interest in treating esophaegeal, ovarian, and stomach cancers.
Example 1
General Materials and Methods for Reverse Transcription and PCR
[0073]Tumor tissues were obtained from Memorial Sloan-Kettering Cancer Center, Weill Medical College of Cornell University and Aichi Cancer Center Research Center, Nagoya Japan. Normal tissue RNA preparations were purchased from Clontech Laboratories Inc. (Palo Alto, Calif.) and Ambion Inc. (Austin, Tex.). Total RNA from tumor tissues was prepared by the guanidinium thiocyanate method.
[0074]Normalized cDNA preparations derived from various normal tissues were purchased from Clontech laboratories Inc. (Palo Alto, Calif.). Additional cDNA preparations (tumor and normal tissues) were prepared using the Superscript First strand synthesis kit from Invitrogen Life Technologies (Carlsbad, Calif.) as per manufacturer's instructions using 5 micrograms of total RNA in 40 ml reaction. Normal tissue cDNA was also purchased from Origene Technologies Inc. (Rockville, Md.). This is the source of cDNA panel of 24 tissues used in the end point RT-PCR data shown in FIG. 1.
[0075]The concentration of A33, A34 and A33-like 3 mRNA transcripts in normal tissues was measured by real-time RT-PCR using 16 different normal tissue cDNA preparations (ovary, leukocyte, prostate, spleen, testis, thymus, brain, heart, kidney, liver, lung, placenta, skeletal muscle, pancreas, small intestine and colon) that had been normalized for 6 housekeeping genes (Clontech). Gene-specific TaqMan probes and PCR primers were designed using Primer Express software (Applied Biosystems, Foster City, Calif.), and their sequences are provided below.
[0076]Multiplex PCR reactions were prepared using 2.5 μl of cDNA diluted in TaqMan PCR Master Mix supplemented with 1.25 μl of Vic labeled human beta glucuronidase (GUS) endogenous control probe/primer mix (Applied Biosystems proprietary dye), 200 nM 6-carboxy-fluorescein labeled gene-specific TaqMan probe, and a 900 nM concentration of gene specific forward and reverse primers (300-900 nM). Triplicate PCR reactions were prepared for each cDNA sample. PCR consisted of 40 cycles of 95° C. denaturation (15 seconds) and 60° C. annealing/extension (60 seconds).
[0077]Thermal cycling and fluorescent monitoring were performed using an ABI 7700 sequence analyzer (Applied Biosystems). The point at which the PCR product is first detected above a fixed threshold, termed cycle threshold (Ct), was determined for each sample. The abundance of gene-specific transcripts in normal tissues was determined by comparison with a standard curve generated from the Ct values of known concentrations of plasmid DNA template encoding, for example, A33, A34 and/or A33-like 3.
[0078]The quantity of the specific transcripts of interest (i.e., A34, A33-like 3, etc.) present in various cancer specimens and additional normal tissues (breast, stomach, esophagus, cervix, adrenal) were calculated relative to a similarly prepared normal testis cDNA specimen. In these experiments, the resultant Ct values were first normalized by subtracting the Ct value obtained from the GUS endogenous control (DCt=Ct FAM-Ct VIC).
[0079]The concentration of the mRNA of interest (i.e., A34, A33-like 3, etc.) in various cancer specimens and additional normal tissues (experimental samples) was calculated relative to normal testis by subtracting the normalized Ct values obtained with normal tissue (for A34, subtracting the normalized Ct values obtained with normal testis) from those obtained with experimental samples (DDCt=DCt of experimental samples-DCt of normal tissue), and the relative concentration was determined (Relative Concentration=2-DDCt, formula derived by Applied Biosystems and published in ABI PRISM 7700 Sequence Detection System User Bulletin #2, Dec. 11, 1997).
[0080]Relative concentrations in the experimental samples were then plotted in terms of fg cDNA starting material, using the normalized testis cDNA preparation (Clontech) as a calibrator. For example, A34 mRNA was expressed in gastric cancer specimen #5 at a level that was 0.387 times the level detected in testis, and the expression level of A34 in a normalized, normal testis specimen was equivalent to 3.38 fg of cDNA starting material. Using the expression level in normal testis as a calibrator, gastric cancer specimen #5 was expressed at a level equivalent to 1.31 fg of cDNA starting material (0.387×3.38).
Example 2
The A34 Gene and its Murine Orthologue
[0081]Analysis of the human genome database mapped the A34 gene to chromosome Xq22.1-22.3, and revealed no sequences of high similarity, suggesting that A34 is a single copy gene with no additional family members. The A34 gene is approximately 34 Kb in length, equivalent to bp 117203-151283 of the chromosome X genomic contiguous sequence, NT 011765. The A34 gene spans 7 exons, whereby exon 1 encodes the 5' untranslated region and a large portion of the signal sequence, exons 2 and 3 encode the variable (V) immunoglobulin (Ig)-like domain, exons 4 and 5 encode the constant type 2 (C2) Ig-like domain, exon 6 encodes the transmembrane domain and a portion of the cytoplasmic domain, and exon 7 encodes the remainder of the cytoplasmic domain and the 3' untranslated region. This intron/exon structure is quite similar to that of the A33 gene.
[0082]A putative murine ortholog of A34 was identified on the basis of nucleotide similarities, tissue distribution of homologous ESTs, protein similarities, chromosomal localization, and gene structure. Comparison of the human A34 nucleotide sequence with the mouse EST database showed more than 83% nucleotide identity with EST sequences belonging to murine Unigene cluster Mm.66893. There are currently 31 sequences in this Unigene cluster, including 23 ESTs derived from normal testis, 6 ESTs from derived normal stomach and 2 ESTs from derived normal cecum. This tissue distribution is quite similar to the tissue distribution of human A34 EST sequences.
[0083]The full length murine EST clone, RIKEN cDNA 4930405J24 (Genbank Acc. No. NM--030181), is the reference cDNA sequence for this mouse gene. This transcript consists of 2182 nucleotides and encodes a protein of 407 amino acids, which is 73% identical (330 amino acid overlap) to human A34 and maintains the human A34 domain structure i.e. extracellular V-type and C2 type Ig-like domains, transmembrane domain, and intracellular domain. The extracellular cysteine residues are conserved among the human and murine proteins, and like human A34, there are 6 potential N-glycosylation sites. The intracellular domain is the least conserved portion of the protein, though, like human A34, EP repeats are also found in carboxyl terminal residues of the intracellular domain of the putative murine protein. The murine A34 gene is approximately 31 Kb in length, equivalent to bp 5534868-5566206 of murine chromosome X genomic contiguous sequence, NT 039716, and spans 7 exons, encoding the same protein domains as the 7 exons of human A34 described above.
Example 3
[0084]A34 mRNA expression in normal tissues was investigated in an initial experiment by RT-PCR according to the experimental procedure of Example 1 using the following primers:
[0085]ACTGTTGGATCTAATGTCAC A33L2F, bp 222 (SEQ ID NO: 11)
[0086]AAGGTTTCACTAACACACTG A33L2R, bp 543 (SEQ ID NO: 12)
[0087]The results showed that A34 was expressed in testis and stomach, but no significant expression was found in any of the other 22 normal tissues tested, see FIG. 1 (Origene cDNA panel of 24 normal tissues was used).
[0088]Subsequently, a A34 clone of 1045 bp (SEQ ID NO: 5) encoding 348 amino acids (SEQ ID NO: 6) was obtained. Although the protein obtained was partial, its sequence includes all but the amino-terminal-most 48 amino acids (which are part of the extracellular domain) and the caroboxyl-terminal most 48 amino acids (which are part of the intracellular domain).
[0089]Further expression analysis on normal and tumor tissues using real time RT-PCR utilized the following primers:
TABLE-US-00004 L2f = GAAGGAGATGGAGCCAATTTCTATT (SEQ ID NO: 13) L2r = CCTGTAATTCGATCTTTAAATTGCC (SEQ ID NO: 14)
with the following Taqman probe:6FAM-CTTTTCTCAAGGTGGACAAGCTGTAGCCATC-TAMARA (SEQ ID NO: 15). The experimental procedure was performed similarly to that described in Example 1. In this instance, TAMARA was used as the quencher dye, with VIC or FAM as reporter dyes, though any quencher/reporter system known to one of ordinary skill may also be used.
[0090]This experiment showed significant A34 expression in testis and stomach, while 19 other specimens showed low to trace levels of A34 expression. These results are illustrated graphically in FIG. 2. A34 was also expressed at high levels in 2 of 6 gastric cancers, 9 of 16 esophageal cancers, and 4 of 17 ovarian cancers as shown in Table 1. This differential expression can be exploited by targeting with immunoglobulin molecules, such as antibodies, and/or conjugated immunoglobulin molecules, such as antibody-drug conjugates or antibody-radionuclide conjugates for therapeutic or diagnostic purposes. The differential expression can also be exploited for diagnostic purposes by using techniques such as PCR in measuring the A34 nucleic acid expression.
TABLE-US-00005 TABLE 1 Tumor Tissues: Gastric Cancer 2/6 (33%) Esophageal Cancer 9/16 (56%) Ovarian Cancer 4/17 (23%) Lung Cancer 0/9 Colon Cancer 0/5 Melanoma 0/3
[0091]Expression Profile of A34 mRNA Transcripts:
[0092]In order to investigate the expression pattern of A34 mRNA, real-time quantitative RT-PCR was performed using a normalized cDNA panel derived from 21 normal adult tissues, and various malignant tissues. As shown in FIG. 2, A34 mRNA was expressed at high levels in testis (3.4 fg) and stomach (7.4 fg), and at a low level in normal pancreas (0.07 fg). Only trace levels (0.03-0.001 fg) of mRNA were detected in 13 other normal tissues (spleen, PBL, thymus, brain, heart, liver, lung, placenta, small intestine, breast, esophagus, adrenal gland, cervix). No A34 mRNA was detected in the remaining 5 normal tissues (ovary, prostate, colon, kidney, and skeletal muscle). A34 mRNA expression was also examined in a normalized cDNA panel derived from various malignant tissues. As shown in FIG. 2, high level A34 mRNA expression (0.5 fg or above) was detected in 2/6 gastric cancer specimens, 8/16 esophageal cancer specimens, and 4/17 ovarian cancer specimens. A34 mRNA was not detected in lung cancer (0/9 specimens), colon cancer (0/5 specimens), or breast cancer (0/13 specimens). Thus in the cDNA panels examined, A34 mRNA expression was largely restricted to normal testis and stomach, as well as ovarian, gastric and esophageal cancers.
Example 4
Identification of the A34 mRNA Transcript
[0093]In order to identify paralogues of the A33 colon cancer antigen that could serve as novel targets for monoclonal antibody-based therapy of human cancer, the amino acid sequence glycoprotein A33 was compared with a translated, non-redundant nucleotide database:
[0094](tblastn, http://www.ncbi.nlm.nih.gov/BLAST/). A novel transcript termed A34 was identified, which upon hypothetical translation showed 31% amino acid identity with A33, including limited conservation of a putative signal sequence, immunoglobulin (Ig)-like domains and a transmembrane domain, suggesting it encoded a cell surface protein. The A34 transcript was represented by Unigene cluster Hs.177164 (http://www.ncbi.nlm.nih.gov/entrez), which contains a full length testis-derived cDNA clone, MGC:44287 (Genbank Acc. No. BC043216), as well as 15 other homologous expressed sequence tags (ESTs), derived mainly from normal testis (7 ESTs), and also from normal stomach (2 ESTs), normal aorta (1 EST), uterine cancer (2 ESTs), pancreatic cancer (1 EST), and pooled tissues (2 ESTs). The limited distribution of homologous ESTs suggested that the A34 transcript was differentially expressed.
[0095]Analysis of the human genome database (http://www.ncbi.nlm.nih.gov/genome) mapped the gene encoding A34 to chromosome Xq22.1. Thus, A34 shares certain characteristics, such as a prevalence of testis-derived ESTs and mapping to chromosome X, with members of the cancer/testis (CT) antigen family, a group of immunogenic proteins whose expression is restricted to gametogenic tissue and cancer, and are considered target molecules for therapeutic cancer vaccines. Therefore, on the basis of its similarity with the A33 colon cancer antigen, the limited tissue distribution of homologous ESTs, and its similarity with CT antigens, the A34 gene product became the focus of our search for novel cell surface molecules expressed in cancer.
[0096]The full length A34 transcript, represented by testis-derived cDNA clone, MGC:44287, consists of 3017 nucleotides (see FIG. 25), a length in agreement with the single hybridization signal of 3.1 Kb detected on Northern blots of testis mRNA hybridized with a 32P labeled A34 cDNA probe. The A34 transcript, as represented by MGC:44287, contains 122 bp of 5' untranslated sequence and 1731 bp of 3' untranslated sequence. The A34 nucleotide sequence was verified by sequencing an additional full length A34 EST clone, IMAGE:5266771, as well as four independent cDNA clones, encompassing the entire protein coding region of A34, generated by RT-PCR of human testis RNA. Both strategies yielded cDNA sequences identical to MGC:44287 in the protein coding regions, although IMAGE:5266771 contained a 712 bp deletion in the 3' untranslated region corresponding to nucleotides 1702-2413 of MGC:44287.
[0097]A34 Protein:
[0098]An initial experiment showed that A34 (SEQ ID NO: 3) encoded a protein of 387 amino acids (SEQ ID NO: 4). Subsequent cloning of the A34 transcript as detailed above revealed the complete protein and DNA (see SEQ ID NOs: 1 and 50).
[0099]The predicted ATG start site, present at bp 123 of clone MGC:44287, conformed to the Kozak consensus sequence for initiation of protein translation, and is followed by the longest possible open reading frame of 1161 bp. The A34 protein consisted of 387 amino acids (Mr 41,816), comprising three structural domains: an extracellular domain of 233 amino acids, a transmembrane domain of 23 amino acids, and an intracellular domain of 131 amino acids (FIG. 3). Following the initial methionine residue, the N-terminal most 21 amino acids formed a putative hydrophobic signal sequence with a possible cleavage site between residues 21 and 22. Amino acid residues 33-123 encompassed an N-terminal, V-type Ig-like domain containing two cysteine residues (C43, C116), which are predicted to form disulfide bonds. A segment of 31 amino acids separated the V-type Ig-like domain from a second Ig-like domain of the C2 type present at residues 154-218, which contains two cysteine residues (C161, C211).
[0100]The extracellular domain of A34 has 6 potential N-linked glycosylation sites. Given that the average size of an oligosaccharide chain is approximately of 2.5 kDa, the carbohydrate portion of A34 could potentially contribute approximately 15 kDa of mass, and thus the predicted size of native A34 protein (less the signal peptide of 2.3 kDa) is 54.4 kDa. Hydrophobicity plots and transmembrane domain prediction software:
http://sosui.proteome.bio.tuat.ac.jp/sosuiframe0.html andhttp://www.cbs.dtu.dk/services/TMHMM/)located a transmembrane domain at residues 234-256, which was followed by a C-terminal intracellular domain encompasing residues 257-387. The A34 intracellular domain contained 7 sites of potential serine/threonine phosphorylation (casein kinase II phosphorylation sites), and a GSK3 phosphorylation site. Two TRAF2-binding consensus motifs are present at amino acids 314-317 and 324-327. Furthermore, a unique pattern of glutamic acid/proline repeats (EP) is found in the carboxyl terminus of A34. This pattern is found in only two other known human proteins, hematopoietic lineage cell specific protein (HS1) and src substrate protein p85/cortactin.
[0101]The domain organization and amino acid sequence of A34 placed it in the junctional adhesion molecule (JAM) family. The JAM family includes molecules such as GPA33, Coxsackie and adenovirus receptor (CXADR), cortical thymocyte receptor-like protein (CTXL), JAM1/F11 receptor, JAM2, and JAM3/Mac-1 receptor, which are believed to mediate cell-cell adhesion, and localize to tight junctions of epithelial and endothelial cells. Members are characterized by two extracellular Ig-like domains (V and C2 type), conserved cysteine residues in the extracellular domain, and a single transmembrane domain. The A34 domain structure has a similar organization. An alignment of A34 and A33 is provided in FIG. 3. The A34 amino acid sequence is 35%, 32%, 28%, 26%, 25%, and 27% identical to CTXL (244 amino acid overlap), A33 (262 amino acid overlap), JAM2 (232 amino acid overlap), CXADR (259 amino acid overlap), JAM1 (270 amino acid overlap), and JAM3 (113 amino acid overlap), respectively, with conservation of at least 4/6 cysteine residues in the extracellular domain.
[0102]A34 has a predicted molecular weight of 41.8 kDa and which is 32% identical to A33 and 49% similar to A33, see Table 2 for comparisons with other A33/JAM family proteins (similarity percentage obtained according to BLAST).
[0103]A34 was located in unigene cluster Hs.177164 on chromosome Xq22.1-22.3. The A34 amino acid sequence contains a hydrophilic signal (leader sequence) residues 2-21, two Ig-like domains (residues 33-123, and 154-218) and a single transmembrane domain (residues 234-256).
TABLE-US-00006 TABLE 2 Family Member Compared with A34 Identity Similarity Location A33 32% 49% 262 aa, A34 aa 1-256, A33 aa 1-257 CXADR 26% 43% 259 aa, A34 aa 9-258, CAR aa 7-261 CTXL 35% 55% 244 aa, A34 aa 9-256, hCTX aa 16-261 ESAM 29% 45% 261 aa, A34 aa 8-254, ESAM aa 16-268 JAM1 25% 40% 270 aa, A34 aa 11-257, JAM1 aa 16-260 JAM2 28% 44% 232 aa, A34 aa 48-258, JAM2 aa 56-262 JAM3 27% 42% 113 aa, A34 aa 158-257, JAM3 aa 3-112
[0104]The intracellular domains of the JAM family, including A34, are poorly conserved. For example, the intracellular domain of A34 consists of 131 amino acids, while the intracellular domain of A33 consists of 60 amino acids, and there is no significant similarity in composition between the two intracellular domains (FIG. 3).
[0105]A34 Antibodies:
[0106]In order to investigate the A34 protein in vivo and in vitro, a murine monoclonal antibodies were generated to the extracellular domain of A34 (amino acids 35-231). A recombinant HIS-tagged recombinant polypeptide, comprising 209 amino acids (23 kDa) derived from the extracellular domain of A34, was produced. Mice were immunized with this recombinant polypeptide and three IgG1 monoclonal antibodies were isolated (identified as 342, 564, and 970) and purified in milligram quantities.
[0107]Total RNA was extracted by standard RNA isolation techniques (Chomczynski & Sacchi, Anal. Biochem. 1987 162: 156-159) from the hybridomas corresponding to the three IgG1 monoclonal antibodies. First strand cDNA was prepared using the First strand cDNA synthesis kit (Pharmacia Biotech) and priming with d(T)18 for both the heavy and light chains (Renner et al., Biotechniques 1998 24(5): 720-2). This cDNA was subjected to PCR using combinations of standard primers for murine heavy and light chains. The PCR products for heavy and light variable regions were cloned using the TA Cloning System (Invitrogen Corporation, Carlsbad, Calif.) and subsequently sequenced using standard techniques. The sequences for variable and CDR regions of the three murine antibodies are shown in FIGS. 21-24.
[0108]As shown in FIG. 8, monoclonal antibody 342 recognized a 51 kDa protein in Western blots prepared from human gastric mucosa. This protein was not present in similar lysates prepared from human colonic mucosa. The 51 kDa size of the A34 protein detected by Western blotting is consistent with predicted size of 54.4 kDA determined by hypothetical translation of the A34 cDNA and predicted carbohydrate contributions.
[0109]Preliminary immunohistochemical analyses of A34 were done on formalin-fixed paraffin embedded tissues as follows.
[0110]Initially, four antibody clones, which were positive by ELISA, were analyzed by immunohistochemistry (IHC). Reactivity was first tested on frozen tissues with known A34 mRNA expression and different dilutions of newly generated hybridoma supernatant were tested. The tissues were snap-frozen specimens, embedded in OCT (optimal cutting temperature) compound. Five mm cuts were fixed in cold acetone for 10 minutes and blocking of endogenous peroxidase activity was done with 3% H2O2. Primary antibody incubation was done overnight at 5° C. The primary antibodies were detected by a biotinylated horse-anti-mouse (Vector, Labs, Burlingame, Calif.) secondary antibody, followed by an avidin-biotin-complex (ABC-Elite, Vector Labs) system. 3,3'-diaminobenzidine (Liquid DAB, BioGenex, San Ramon, Calif.) served as a chromogen, and hematoxylin was used as a counterstain.
[0111]Reactive clones were then purified and an optimal working concentration was established by IHC titering on tissue specimens. Three of the four (342, 970, 564) hybridoma clones showed reactivity in frozen stomach and testis, and dilutions were 1:20 of all three clones. These clones were purified and again titered, revealing good staining at 1.0 ug/ml.
[0112]In a second step, the three positive clones in frozen tissues were tested on formalin-fixed paraffin embedded (FFPE) tissues blocks using antigen retrieval techniques consisting of a steamer and different antigen retrieval solutions. Incubation and detection of primary antibody was done as with the frozen tissues. A panel of normal tissues as well as gastric carcinomas were analyzed. In formalin fixed parafin embedded tissues, the best staining was achieved by using an antigen-retrieval technique employing heating the slides for 30 minutes at 93° C. in an Tris-acetate (TA) buffer solution (pH 8.0, 1 mM). All three clones showed similar staining, and 342 was chosen for further analyses.
[0113]Results:
[0114]In normal tissues, immunoreactivity was predominantly present in stomach and testis. In stomach, intense staining was observed in the mucosa. There was mostly membranous and also cytoplasmic staining of all epithelial cellular components reaching from the surface epithelium to the bottom of the specialized glands (FIGS. 11-14). In testis, a cytoplasmic staining of the germ cells which was present in all tubules could be observed (FIGS. 9-10). In pancreas, a focal staining of the duct epithelium was occasionally seen (FIGS. 15-16). No staining was present in any other normal tissue, such as colon, esophagus, small intestine, lung, liver, skin and kidney.
[0115]In a panel of 20 normal tissues, A34 could only be found in stomach mucosa (FIGS. 11-14), testis (FIGS. 9-10), and, to a much lesser degree, in pancreas (FIGS. 15-16). In stomach, the epithelial cells throughout the entire mucosa were stained. No other tissue component was stained. The mucosal cells showed a typical membranous staining pattern. A similar staining pattern was observed in ductal epithelial cells of the pancreas, however, in pancreas, only focal cells were immunopositive.
[0116]In testis, a reactivity staining pattern was observed consisting entirely of germ cells. No staining was observed in the testicular interstitial tissue.
[0117]In a limited set of gastric, ovarian and esophageal carcinomas, A34 showed a mostly heterogeneous or sometimes homogeneous labeling of tumor cells. As in normal tissues, the immunoreactivity pattern was membranous.
[0118]The following tables represent, in tabular form, immunohistochemical analyses performed on gastric/stomach cancer cells, ovarian cancer cells, and esophageal carcinoma cells with A34 clone 342. "Neg" indicates a negative response and the plus signs indicate the percentage of stained tumor cells, where Focal: ˜<5% (for very small numbers of cells); +: >5-25%; ++>25-50%; +++>50-75%; and ++++>75%. This grading is reproducible and conforms to standard procedures found in the literature.
TABLE-US-00007 TABLE 3 Gastric/stomach cancer Sample A34 staining 1 neg 2 neg 3 neg 4 ++ 5 neg 6 neg 7 neg 8 neg 9 Foc. (single cells) 10 neg 11 Foc. w 12 neg 13 pos 14 Foc. w 15 neg 16 neg 17 Foc. 18 neg 19 Foc. 20 neg. 21 Foc. 22 Neg. 23 neg 24 neg 25 neg 26 neg 27 neg 28 neg 29 neg 30 neg 31 + 32 +++ 33 neg 34 neg 35 + 36 ++ 37 + 38 neg 39 neg 40 neg 41 ++++ 42 neg 43 + Total 14/43 Foc 6 + 4 ++ 2 +++ 1 ++++ 1
TABLE-US-00008 TABLE 4 Ovarian cancer Sample A34 1 Neg 2 Neg 3 + 4 Neg 5 Neg 6 Neg 7 Neg 8 Neg 9 Neg 10 ++++ 11 Neg 12 Neg 13 Neg 14 Neg 15 Neg 16 Neg 17 Neg 18 Neg 19 Neg 20 Neg 21 Neg Total 2/21 foc -- + 1 ++ -- +++ -- ++++ 1
TABLE-US-00009 TABLE 5 Eosphaegeal carcinoma Sample A34 staining 1 - 2 - 3 + 4 ++ 5 - 6 - 7 + 8 ++ 9 ++ 10 ++ 11 + Total 7/11 Neg 4 Foc -- + 3 ++ 4 +++ -- ++++ --
[0119]Table 6 indicates the immunohistochemical analyses of A34 protein expression in normal tissues as detected by A34 antibody clone 342. The majority of the tissues tested were negative. Stomach and testis were positive.
TABLE-US-00010 TABLE 6 Tissue A34 Clone 342 Esophagus m 2x - Esophagus sub 2x - Stomach 1x Pos Stomach sub 1x - Small intestine duo m 1x - Small intestine duo sub 1x - liver - Small intestine m 2x - Small intestine sub 2x - Colon m 3x - Colon sub 3x - Appendix m 3x - Appendix sub 3x - Liver 3x Gall bladder Brownish hue Pancreatic islets 3x - Pancreatic exo 3x Duct epi.cut/hit in 1 pan Mesentery - Thyroid - Synovia - Salivary gland 2x - Skeletal muscle 3x - Synovia - Adrenal gland med 4x - Adrenal gland cortex 4x - Lymph node 1x - Peripheral nerve 1x - Thymus 2x - Spleen 3x - Tonsil 3x - Lung alve 3x - Lung bro 2x - Pleura 2x - Prostate 2x GC/surface Kidney med 3x - Kidney cort 3x - Ureter 2x - UB m 3x - UB sub 3x Muscl. Pos 1x Testis 3x Pos Vagin 1x - Omentum 1x - Cervix 2 - Endometrium 3x - Fallopian tub 2x - Ovary 3x - Placenta villi 2x - Placenta plate 2x - Placenta am = pl 1x - Amnion 2x - Breast gland 3x - Breast duct 3x - Skin epithelium 3x - Skin dermis 3x - Valve 1x -
Example 5
[0120]The stomach/testis-related expression profiles of both human and mouse A34 transcripts suggested that expression of these two orthologs may be under the control of similar regulatory sequences in their corresponding promotors. A comparison of DNA sequences located upstream of the human and mouse A34 start site revealed 64% nucleotide identity between the orthologous genes at positions 1 to 600 of the putative start site (80% identity from 1 to 300 of the putative start site). These regions may constitute the A34 promotor regions.
[0121]Like the human and mouse A33 gene, these putative A34 promoters lack a TATA box within 25-30 bp of the start site, indicating that mRNA transcription is independent of TATA sequences, but do contain a CAAT box, located at position 67 and 70 upstream of the human and murine ATG start site, respectively. Binding sites for 3 tissue specific transcription factors are highly conserved between the human and mouse A34 orthologs, including an intestinal specific homeobox transcription factor, CDX1, and 2 testis-related transcription factors, SRY and SOX-5. CDX1 binding sites, which are also found in the A33 orthologues, are present at 236 and 233 upstream of the human and murine ATG start site, respectively. Binding sites for the 2 testis-related transcription factors, SRY and SOX-5, overlap each other, and are found at positions 294 and 288 upstream of the human and murine ATG start site, respectively. The presence of binding sites for these 3 transcription factors in the putative A34 promotors is consistent with the stomach/testis-related mRNA expression profile of A34.
[0122]Human A34 promotor region:
TABLE-US-00011 (SEQ ID NO: 16) GGTAGTGACAACTGCCAGTGTTTCAAAAAAGAGTAACATATCC AGAGTTTGTTCACACAGAAATGAATGCTTTTTAGCTTCATAACCCCTGT GCCCTTCCCGTGAGCCCCATCTCCCCAGGAAACGATATAGTACCAATTT ACTAACTTAATTTGTAAAAGGAGGTTAGTGAATCAATTCTGTAAGACTC ATGGAAATATTTGAAATTAATTAGCCTTGTCAGCTTTTATTTGCATAGG CTCTCTTCCAACCATATCCCCCAGCCCAAGTACAACGTTTTAGTAAGAT TGATTTTAAACAATGAGACTTAGAGAATCTGTGTACAAGGAGCTTGAAT AATTTAAATGCGTGGGTTTATTATTAACACAGTAGCAAATATATCAAGG AAACACGCCCCATGAAAAGTGTTTCAAAGAAACACAAATCTGTACTGAA AAAAGTCTATACGCAATAAGTAAGCCCAAAGAGGCATGTTTGCTTGGC GATGCCCAGCAGATAAGCCAGGCAAACCTCGGTGTGATCGAAGAAGCC AATTTGAGACTCAGCCTAGTCCAGGCAAGCTACTGGCACCTGCTGCTCT CAACTAACCTCCACACAATG
[0123]Murine A34 promotor region:
TABLE-US-00012 (SEQ ID NO: 17) GGATTTGCTGACAGTCCAATCACTGGAAAGTGTTACTGGAAAT GCCTTATTAGAGTTGAGATTTTTAGCCTGGGACTGGTACAAATTATTAC ATAGGATGAAGGAGAAAGAAACCCAGGAGACCATTCAGGAAGCTGTTG CTTTAGGCTAACGTAATATCTAGAACAAAATGGAAGCAGCAGGTTGGA GATGGGACAAATCTACCATTCACTTTAGAAGCAGCAGGACCAAGATAT CTTATGGGAAGAACTGGAGGAGGCCCTCCAAGTACAACTTTCTTTTTTT AAAAAGGGTTGATTTTAAACAATGTAACCTAAGAGAATCTGTGTACAAA GAACTGAAAGGATTTAAGTGCGTGGTTTATTATTAACACAGTAGCAAAT ATATCAAGGGGACACACCCCGGGGGAAAAGGGTTTCAAATAAACACAG ATTTGTTCAGAGAGAACTCAGTGCCCAATAAGCAAGCGTAAGGAGGCC TATTTGCTTGGTGATGCCCAGCCGATAAGCCAGGCTGTGACTGAAGAA GCCAATTTGAAACTCAGCCTAGTTCAGGCAGCCTTCGGACTGGCACCT GCTGCTCCAAGCGACTTTCAGCATG
[0124]The ATG start codon is underlined in the murine and human sequences.
Example 6
[0125]A33-like 3 (SEQ ID NO: 7) is located on human chromosome 1 at >gi|18547605|ref|XM--089096.1|, and has similarities with coxsackievirus and adenovirus receptor-like proteins. A33-like 3 polypeptide molecule (SEQ ID NO: 8) weighs approximately 40,085 Da (approx. 370 amino acids) which is 27% identical to A33 and 40% similar to A33 (using computer-based sequence comparison and identification tools that employ algorithms, i.e., BLAST or a similar program).
[0126]A33-like 3 protein has one transmembrane domain, extending from amino acids 4-26, and has two Ig-like domains extending from amino acids 37-128 and 160-241. Table 7 shows a comparison between A33-like 3 and the other family members, including the novel polypeptide A34.
TABLE-US-00013 TABLE 7 Family Member Compared with A33-like 3 Identity Similarity Location A33 27% 40% 232 aa, A33-like 3 aa 29-256, A33 aa 28-228 CAR 33% 49% 231aa, A33-like 3 aa 29-256, CAR aa 26-229 HCTX 23% 42% 168 aa, A33-like 3 aa 95-258, hCTX aa 109-255 ELAM 25% 40% 168 aa, A33-like 3 aa 97-257, ELAM aa 100-244 JAM1 24% 33% 219 aa, A33-like 3 aa 34-246, JAM1 aa 40-219 JAM2 28% 36% 150 aa, A33-like 3 aa 108-250, JAM2 aa 91-225 JAM3 none none n/a A34 (A33-like 2) 24% 45% 161 aa, A33-like 3 aa 101-257
[0127]A33-like 3 mRNA expression in normal tissues is investigated in an initial experiment by RT-PCR according to the experimental procedure of Example 1 using the following primers:
TABLE-US-00014 (SEQ ID NO: 18) TGCCCATGTGCTGGACAGAG, A33L3F, bp 733 (SEQ ID NO: 19) CACGTTGTTGGCCACTGTGC, A33L3R, bp 1025
Example 7
[0128]Recombinant protein A34 and A33-like 3, or fragments thereof, are produced from the appropriate isolated cDNA sequence. Mic, rabbits, or other appropriate mammals are immunized with at least one of recombinant or isolated A34 protein (either whole or appropriate antigenic fragments), and antibodies are generated and purified by standard techniques as detailed in the references cited previously and known to those of skill in the art.
Example 8
[0129]Antibodies targeting the A34 and/or A33-like 3 antigens are used for both diagnostic and therapeutic purposes. For therapeutic purposes the naked (unconjugated) antibody itself is used as a therapeutic, for example, by eliciting a immunoresponse against a tumor by stimulating ADCC and/or CDC responses. The A34 and/or A33-like 3 specific antibodies are conjugated with a radioisotope or a chemotherapeutic or cytotoxic agent for both therapeutic and/or diagnostic purposes. The radioisotope is, for example, 125I, 131I, 99Tc, 90Y and 111In, or any other γ, α or β emitter. Those of skill in the art will appreciate that many methods are suitable for the conjugation of an antibody with a radioisotope, e.g., U.S. Pat. Nos. 5,160,723 and 5,851,526.
[0130]The antibodies that bind to A34 and/or A33-like 3 antigens are optionally conjugated with at least one chemotherapeutic agent, or at least one cytotoxic agent, or may be used in conjunction with such an agent. For example, the antibodies can be conjugated to, or used in combination therapy together with, QFA (an antifolate), BCNU, mercaptopurine, methotrexate, docetaxel, adriamycin or calicheamicin. These are all well known chemotherapeutics or cytotoxic drugs and conjugation, and combination use, of these with proteins, including antibodies, have been described, e.g. Hellstrom et al., Methods Mol. Biol. 166:3-16 (2001); Sievers et al., Curr. Opin. Oncol. 13(6):522-7 (2001); Winer et al., Oncology 61 Suppl 2:50-7 (2001).
[0131]The antibodies, or any fragments thereof, may also be conjugated or recombinantly fused to any cellular toxin, bacterial or other, e.g., pseudomonas exotoxin, ricin, or diptheria toxin. The part of the toxin used can be the whole toxin, or any particular domain of the toxin. Such antibody-toxin molecules have successfully been used for targeting and therapy of different kinds of cancers, see e.g., Pastan, Biochim Biophys Acta., 1333(2):Cl-6 (Oct. 24, 1997); Kreitman et al., New Engl. J. Med. 345(4):241-247 (2001); Schnell et al., Leukemia 14(1):129-35 (2000) and Ghetie et al., Mol. Biotechnol., 18(3):251-68 (2001).
[0132]Other conjugation partners can also be conjugated to the antibodies used in the methods of this invention, for example, enzymes, and prodrugs, such as the ADEPT approach, e.g., Xu et al., Clin Cancer Res. 7(11):3314-24 (2001). Any method known in the art for preparing antibody conjugates may be used to generate conjugates useful in this invention. The A34 or A33-like 3 specific antibodies conjugated with a cytotoxic or chemotherapeutic agent may be administered to a patient in need thereof before, after, or concurrently with a non-conjugated form of an A34 or A33-like 3 specific antibody.
[0133]Examples describing drug conjugates, etc. are found in: Hellstrom et al., "Development and activities of the BR96-doxorubicin immunoconjugate," Methods Mol. Biol. 166:3-16 (2001); Sievers et al., "Mylotarg: antibody-targeted chemotherapy comes of age," Curr Opin Oncol. 13(6):522-7 (2001); Winer et al., "New combinations with Herceptin in metastatic breast cancer," Oncology 61 Suppl 2:50-7 (2001); Pastan I., "Targeted therapy of cancer with recombinant immunotoxins," Biochim Biophys Acta. 1333(2):C1-6 (1997); Kreitman et al., "Efficacy of the anti-CD22 recombinant immunotoxin BL22 in chemotherapy-resistant hairy-cell leukemia," New Engl J. Med. 345(4):241-7 (2001); Schnell et al., "Treatment of refractory Hodgkin's lymphoma patients with an anti-CD25 ricin A-chain immunotoxin," Leukemia 14(1):129-35 (2000); Ghetie et al., "Chemical construction of immunotoxins," Mol. Biotechnol. 18(3):251-68 (2001); Xu et al., "Strategies for enzyme/prodrug cancer therapy," Clin. Cancer Res. 7(11):3314-24 (2001); Hudson et al., "Recombinant antibodies for cancer diagnosis and therapy," Expert Opin Biol Ther. 1(5):845-55 (2001).
Example 9
[0134]Humanized, fully human, and/or chimeric antibodies and/or immunoglobulin products which bind to A34 and/or A33-like 3 are used as targeting agents in conjunction with other cancer therapies. The antibody, fragment, or other immunoglobulin product is linked to an additional anti-cancer agent, and a therapeutically effective amount of the conjugate produced is administered to a patient in need thereof. Alternatively, the agent is linked to a label for detection. Examples of labels include radioactive isotopes and fluorescent markers. The linkage may be covalent or ionic in nature.
Example 10
[0135]These antibodies, or antigenically active fragments thereof which bind to A34 and/or A33-like 3 are further manipulated by molecular biological techniques known in the art to make humanized antibodies. The antibodies may be fully or partially human.
Example 11
[0136]Humanized, fully human, and/or chimeric antibodies and/or immunoglobulin products which bind to A34 and/or A33-like 3, or appropriately antigenic fragments that bind to at least one of A34 and A33-like 3, are combined with, or linked to, other agents, such as radioisotopes, chemotherapeutic agents, cytokines, cytotoxic agents, or other immunoglobulin products. The linkage may be ionic or covalent, and is formed by methods known in the art (see references cited above).
Example 12
[0137]A composition of at least one immunoglobulin product (whether an antibody, a fragment, or an immunoglobulin linked to another agent, or any combination thereof), wherein said at least one immunoglobulin product binds to at least one of A34 and/or A33-like 3, will be formed by combining a therapeutically effective amount of said immunoglobulin product with a pharmaceutically acceptable carrier. This composition will then be administered to a patient in need thereof (i.e., a human or other mammal).
[0138]Such patients will be suffering from a disorder, such as a neoplastic disease, wherein the disorder expresses the antigen to which the immunoglobulin product binds (i.e., A34 or A33-like 3).
[0139]A composition, or treatment regimen, with at least one immunoglobulin product (whether an antibody, a fragment, or an immunoglobulin linked to another agent, or any combination thereof), wherein said at least one immunoglobulin product binds to at least one of A34 and/or A33-like 3, will be formed by combining said immunoglobulin product with a chemotherapeutic agent. The chemotherapeutic agents may be administered prior to, concurrently with, or after A34 and/or A33-like 3 specific immunoglobulin product is administered to the patient. Examples of chemotherapeutic drugs that could be used in such a combination are (but not limited to) oxaliplatin, irinotecan, topotecan, carmustine, vincristine, leucovorin, streptozocin, Orzel® and fluoropyrimidines, e.g., 5-fluorouracil, ftoraflur, capecitabine, gemcitabine, floxuridine and fluoritine, and other nucleoside analogs, and vinca alkaloid analogs, including but not limited to vinblastine, navelbine, and vinzolidine, topoisomerase I inhibitors, including but not limited to topotecan and camptothecin, and other platinum analogs including but not limited to cisplatin and carboplatin.
[0140]A composition, or treatment regimen, with at least one immunoglobulin product (whether an antibody, a fragment, or an immunoglobulin linked to another agent, or any combination thereof), wherein said at least one immunoglobulin product binds to at least one of A34 and/or A33-like 3, is formed by combining said immunoglobulin product with another immunoglobulin product that is not specific for A34 or the A33 like 3 antigens. Examples of such immunoglobulins are antibodies targeting receptors of the Epidermal Growth Factor Receptor (EGFR) family of proteins, e.g., Cetuximab (Erbitux®, ImClone Systems Inc.) and Trastuzumab (Herceptin®, Genentech Inc.).
[0141]A composition, or treatment regimen, with at least one immunoglobulin product (whether an antibody, a fragment, or an immunoglobulin linked to another agent, or any combination thereof), wherein said at least one immunoglobulin product binds to at least one of A34 and/or A33-like 3, is formed by combining said immunoglobulin product with a small molecule signalling inhibitor. Examples of such small molecule signaling inhibitors are Imatinib Mesylate (Glivec®, Novartis AG) and Gefitinib (Iressa®, AstraZeneca Ltd.).
[0142]The foregoing description and examples have been set forth merely to illustrate the invention and are not intended to be limiting. Since modifications of the described embodiments incorporating the spirit and substance of the invention may occur to persons skilled in the art, the invention should be construed broadly to include all variations falling within the scope of the appended claims and equivalents thereof.
Sequence CWU
1
501387PRTHomo sapiens 1Met Val Phe Ala Phe Trp Lys Val Phe Leu Ile Leu Ser
Cys Leu Ala 1 5 10 15Gly
Gln Val Ser Val Val Gln Val Thr Ile Pro Asp Gly Phe Val Asn
20 25 30Val Thr Val Gly Ser Asn Val Thr
Leu Ile Cys Ile Tyr Thr Thr Thr 35 40
45Val Ala Ser Arg Glu Gln Leu Ser Ile Gln Trp Ser Phe Phe His Lys
50 55 60Lys Glu Met Glu Pro Ile Ser
Ile Tyr Phe Ser Gln Gly Gly Gln Ala 65 70
75 80Val Ala Ile Gly Gln Phe Lys Asp Arg Ile Thr Gly
Ser Asn Asp Pro 85 90
95Gly Asn Ala Ser Ile Thr Ile Ser His Met Gln Pro Ala Asp Ser Gly
100 105 110Ile Tyr Ile Cys Asp Val Asn
Asn Pro Pro Asp Phe Leu Gly Gln Asn 115 120
125Gln Gly Ile Leu Asn Val Ser Val Leu Val Lys Pro Ser Lys Pro
Leu 130 135 140Cys Ser Val Gln Gly Arg
Pro Glu Thr Gly His Thr Ile Ser Leu Ser145 150
155 160Cys Leu Ser Ala Leu Gly Thr Pro Ser Pro Val
Tyr Tyr Trp His Lys 165 170
175Leu Glu Gly Arg Asp Ile Val Pro Val Lys Glu Asn Phe Asn Pro Thr
180 185 190Thr Gly Ile Leu Val Ile
Gly Asn Leu Thr Asn Phe Glu Gln Gly Tyr 195 200
205Tyr Gln Cys Thr Ala Ile Asn Arg Leu Gly Asn Ser Ser Cys
Glu Ile 210 215 220Asp Leu Thr Ser Ser
His Pro Glu Val Gly Ile Ile Val Gly Ala Leu225 230
235 240Ile Gly Ser Leu Val Gly Ala Ala Ile Ile
Ile Ser Val Val Cys Phe 245 250
255Ala Arg Asn Lys Ala Lys Ala Lys Ala Lys Glu Arg Asn Ser Lys Thr
260 265 270Ile Ala Glu Leu Glu
Pro Met Thr Lys Ile Asn Pro Arg Gly Glu Ser 275
280 285Glu Ala Met Pro Arg Glu Asp Ala Thr Gln Leu Glu
Val Thr Leu Pro 290 295 300Ser Ser Ile
His Glu Thr Gly Pro Asp Thr Ile Gln Glu Pro Asp Tyr305
310 315 320Glu Pro Lys Pro Thr Gln Glu
Pro Ala Pro Glu Pro Ala Pro Gly Ser 325
330 335Glu Pro Met Ala Val Pro Asp Leu Asp Ile Glu Leu
Glu Leu Glu Pro 340 345 350Glu
Thr Gln Ser Glu Leu Glu Pro Glu Pro Glu Pro Glu Pro Glu Ser 355
360 365Glu Pro Gly Val Val Val Glu Pro Leu
Ser Glu Asp Glu Lys Gly Val 370 375
380Val Lys Ala3852319PRTHomo sapiens 2Met Val Gly Lys Met Trp Pro Val Leu
Trp Thr Leu Cys Ala Val Arg 1 5 10
15Val Thr Val Asp Ala Ile Ser Val Glu Thr Pro Gln Asp Val Leu
Arg 20 25 30Ala Ser Gln Gly
Lys Ser Val Thr Leu Pro Cys Thr Tyr His Thr Ser 35
40 45Thr Ser Ser Arg Glu Gly Leu Ile Gln Trp Asp Lys
Leu Leu Leu Thr 50 55 60His Thr Glu
Arg Val Val Ile Trp Pro Phe Ser Asn Lys Asn Tyr Ile 65
70 75 80His Gly Glu Leu Tyr Lys Asn Arg
Val Ser Ile Ser Asn Asn Ala Glu 85 90
95Gln Ser Asp Ala Ser Ile Thr Ile Asp Gln Leu Thr Met Ala
Asp Asn 100 105 110Gly Thr Tyr
Glu Cys Ser Val Ser Leu Met Ser Asp Leu Glu Gly Asn 115
120 125Thr Lys Ser Arg Val Arg Leu Leu Val Leu Val
Pro Pro Ser Lys Pro 130 135 140Glu Cys
Gly Ile Glu Gly Glu Thr Ile Ile Gly Asn Asn Ile Gln Leu145
150 155 160Thr Cys Gln Ser Lys Glu Gly
Ser Pro Thr Pro Gln Tyr Ser Trp Lys 165
170 175Arg Tyr Asn Ile Leu Asn Gln Glu Gln Pro Leu Ala
Gln Pro Ala Ser 180 185 190Gly
Gln Pro Val Ser Leu Lys Asn Ile Ser Thr Asp Thr Ser Gly Tyr 195
200 205Tyr Ile Cys Thr Ser Ser Asn Glu Glu
Gly Thr Gln Phe Cys Asn Ile 210 215
220Thr Val Ala Val Arg Ser Pro Ser Met Asn Val Ala Leu Tyr Val Gly225
230 235 240Ile Ala Val Gly
Val Val Ala Ala Leu Ile Ile Ile Gly Ile Ile Ile 245
250 255Tyr Cys Cys Cys Cys Arg Gly Lys Asp Asp
Asn Thr Glu Asp Lys Glu 260 265
270Asp Ala Arg Pro Asn Arg Glu Ala Tyr Glu Glu Pro Pro Glu Gln Leu
275 280 285Arg Glu Leu Ser Arg Glu Arg
Glu Glu Glu Asp Asp Tyr Arg Gln Glu 290 295
300Glu Gln Arg Ser Thr Gly Arg Glu Ser Pro Asp His Leu Asp Gln305
310 31531910DNAHomo sapiens 3cttcttgtgg
tagggacctc tcctcagtat ttgaaactaa ccagcatctg acagatttcg 60aatttgtaaa
aaataccctc gaagattcag gaatgaagct tctgtgtgaa ggattaaaac 120agcccaactg
tgtattacag acattgaggt ggtaccggtg ccttatctct tctgcttctt 180gtggggctct
agcagctgtt cttagcacca gtcagtggct cactgaactg gaatttagtg 240agacaaaact
ggaagcttca gctttgaaat tgctctatgg aggcttaaaa gatccaaatt 300gcaaattaca
gaagctcaac ttgcagtttt ctttatctgt aaccgctgca aaacttccag 360ttggaatggt
tggaaattgt tctggtttct cgggatcatt ggtgcaatct cattttggct 420actgtcagga
cagttctttc aaatgtgatc tttgtaagct gctctggcct tccaccagag 480ttgctgctgc
aaaggattgt gggagtccta agtccttcct atcagaaggg ctgaactggg 540caggaagact
tgaggcagtg gaggaggttt tggggttggg ggtgcttgta cagcccggtg 600acccagcatc
tcagggtggg gggcattgtg aaaactatgg gtcttttaga gacttggtgg 660acttagaagt
caaggcagaa ccaagcctga gaaaaggtgg tatggatctc cagagaccca 720ccctacaagt
tgtcctcctt tgcaaaatct tctccctcaa actatttctc tttattgcat 780tgcctaattc
tcctggtcag gttagtgtgg tgcaagtgac catcccagac ggtttcgtga 840acgtgactgt
tggatctaat gtcactctca tctgcatcta caccaccact gtggcctccc 900gagaacagct
ttccatccag tggtctttct tccataagaa ggagatggag ccaatttcta 960tttacttttc
tcaaggtgga caagctgtag ccatcgggca atttaaagat cgaattacag 1020ggtccaacga
tccaggtaat gcatctatca ctatctcgca tatgcagcca gcagacagtg 1080gaatttacat
ctgcgatgtt aacaaccccc cagactttct cggccaaaac caaggcatcc 1140tcaacgtcag
tgtgttagtg aaaccttcta agcccctttg tagcgttcaa ggaagaccag 1200aaactggcca
cactatttcc ctttcctgtc tctctgcgct tggaacacct tcccctgtgt 1260actactggca
taaacttgag ggaagagaca tcgtgccagt gaaagaaaac ttcaacccaa 1320ccaccgggat
tttggtcatt ggaaatctga caaattttga acaaggttat taccagtgta 1380ctgccatcaa
cagacttggc aatagttcct gcgaaatcga tctcacttct tcacatccag 1440aagttggaat
cattgttggg gccttgattg gtagcctggt aggtgccgcc atcatcatct 1500ctgttgtgtg
cttcgcaagg aataaggcaa aagcaaaggc aaaagaaaga aattctaaga 1560ccatcgcgga
acttgagcca atgacaaaga taaacccaag gggagaaagc gaagcaatgc 1620caagagaaga
cgctacccaa ctagaagtaa ctctaccatc ttccattcat gagactggcc 1680ctgataccat
ccaagaacca gactatgagc caaagcctac tcaggagcct gccccagagc 1740ctgccccagg
atcagagcct atggcagtgc ctgaccttga catcgagctg gagctggagc 1800cagaaacgca
gtcggaattg gagccagagc cagagccaga gccagagtca gagcctgggg 1860ttgtagttga
gcccttaagt gaagatgaaa agggagtggt taaggcatag 19104402PRTHomo
sapiens 4Met Asp Leu Gln Arg Pro Thr Leu Gln Val Val Leu Leu Cys Lys Ile
1 5 10 15Phe Ser Leu Lys
Leu Phe Leu Phe Ile Ala Leu Pro Asn Ser Pro Gly 20
25 30Gln Val Ser Val Val Gln Val Thr Ile Pro Asp
Gly Phe Val Asn Val 35 40 45Thr
Val Gly Ser Asn Val Thr Leu Ile Cys Ile Tyr Thr Thr Thr Val 50
55 60Ala Ser Arg Glu Gln Leu Ser Ile Gln Trp
Ser Phe Phe His Lys Lys 65 70 75
80Glu Met Glu Pro Ile Ser Ile Tyr Phe Ser Gln Gly Gly Gln Ala
Val 85 90 95Ala Ile Gly
Gln Phe Lys Asp Arg Ile Thr Gly Ser Asn Asp Pro Gly 100
105 110Asn Ala Ser Ile Thr Ile Ser His Met Gln
Pro Ala Asp Ser Gly Ile 115 120
125Tyr Ile Cys Asp Val Asn Asn Pro Pro Asp Phe Leu Gly Gln Asn Gln 130
135 140Gly Ile Leu Asn Val Ser Val Leu
Val Lys Pro Ser Lys Pro Leu Cys145 150
155 160Ser Val Gln Gly Arg Pro Glu Thr Gly His Thr Ile
Ser Leu Ser Cys 165 170
175Leu Ser Ala Leu Gly Thr Pro Ser Pro Val Tyr Tyr Trp His Lys Leu
180 185 190Glu Gly Arg Asp Ile Val
Pro Val Lys Glu Asn Phe Asn Pro Thr Thr 195 200
205Gly Ile Leu Val Ile Gly Asn Leu Thr Asn Phe Glu Gln Gly
Tyr Tyr 210 215 220Gln Cys Thr Ala Ile
Asn Arg Leu Gly Asn Ser Ser Cys Glu Ile Asp225 230
235 240Leu Thr Ser Ser His Pro Glu Val Gly Ile
Ile Val Gly Ala Leu Ile 245 250
255Gly Ser Leu Val Gly Ala Ala Ile Ile Ile Ser Val Val Cys Phe Ala
260 265 270Arg Asn Lys Ala Lys
Ala Lys Ala Lys Glu Arg Asn Ser Lys Thr Ile 275
280 285Ala Glu Leu Glu Pro Met Thr Lys Ile Asn Pro Arg
Gly Glu Ser Glu 290 295 300Ala Met Pro
Arg Glu Asp Ala Thr Gln Leu Glu Val Thr Leu Pro Ser305
310 315 320Ser Ile His Glu Thr Gly Pro
Asp Thr Ile Gln Glu Pro Asp Tyr Glu 325
330 335Pro Lys Pro Thr Gln Glu Pro Ala Pro Glu Pro Ala
Pro Gly Ser Glu 340 345 350Pro
Met Ala Val Pro Asp Leu Asp Ile Glu Leu Glu Leu Glu Pro Glu 355
360 365Thr Gln Ser Glu Leu Glu Pro Glu Pro
Glu Pro Glu Pro Glu Ser Glu 370 375
380Pro Gly Val Val Val Glu Pro Leu Ser Glu Asp Glu Lys Gly Val Val385
390 395 400Lys
Ala51045DNAHomo sapiens 5actgttggat ctaatgtcac tctcatctgc atctacacca
ccactgtggc ctcccgagaa 60cagctttcca tccagtggtc tttcttccat aagaaggaga
tggagccaat ttctatttac 120ttttctcaag gtggacaagc tgtagccatc gggcaattta
aagatcgaat tacagggtcc 180aacgatccag gtaatgcatc tatcactatc tcgcatatgc
agccagcaga cagtggaatt 240tacatctgcg atgttaacaa ccccccagac tttctcggcc
aaaaccaagg catcctcaac 300gtcagtgtgt tagtgaaacc ttctaagccc ctttgtagcg
ttcaaggaag accagaaact 360ggccacacta tttccctttc ctgtctctct gcgcttggaa
caccttcccc tgtgtactac 420tggcataaac ttgagggaag agacatcgtg ccagtgaaag
aaaacttcaa cccaaccacc 480gggattttgg tcattggaaa tctgacaaat tttgaacaag
gttattacca gtgtactgcc 540atcaacagac ttggcaatag ttcctgcgaa atcgatctca
cttcttcaca tccagaagtt 600ggaatcattg ttggggcctt gattggtagc ctggtaggtg
ccgccatcat catctctgtt 660gtgtgcttcg caaggaataa ggcaaaagca aaggcaaaag
aaagaaattc taagaccatc 720gcggaacttg agccaatgac aaagataaac ccaaggggag
aaagcgaagc aatgccaaga 780gaagacgcta cccaactaga agtaactcta ccatcttcca
ttcatgagac tggccctgat 840accatccaag aaccagacta tgagccaaag cctactcagg
agcctgcccc agagcctgcc 900ccaggatcag agcctatggc agtgcctgac cttgacatcg
agctggagct ggagccagaa 960acgcagtcgg aattggagcc agagccagag ccagagccag
agtcagagcc tggggttgta 1020gttgagccct taagtgaaga tgaaa
10456348PRTHomo sapiens 6Thr Val Gly Ser Asn Val
Thr Leu Ile Cys Ile Tyr Thr Thr Thr Val 1 5
10 15Ala Ser Arg Glu Gln Leu Ser Ile Gln Trp Ser Phe
Phe His Lys Lys 20 25 30Glu
Met Glu Pro Ile Ser Ile Tyr Phe Ser Gln Gly Gly Gln Ala Val 35
40 45Ala Ile Gly Gln Phe Lys Asp Arg Ile
Thr Gly Ser Asn Asp Pro Gly 50 55
60Asn Ala Ser Ile Thr Ile Ser His Met Gln Pro Ala Asp Ser Gly Ile 65
70 75 80Tyr Ile Cys Asp Val
Asn Asn Pro Pro Asp Phe Leu Gly Gln Asn Gln 85
90 95Gly Ile Leu Asn Val Ser Val Leu Val Lys Pro
Ser Lys Pro Leu Cys 100 105
110Ser Val Gln Gly Arg Pro Glu Thr Gly His Thr Ile Ser Leu Ser Cys
115 120 125Leu Ser Ala Leu Gly Thr Pro
Ser Pro Val Tyr Tyr Trp His Lys Leu 130 135
140Glu Gly Arg Asp Ile Val Pro Val Lys Glu Asn Phe Asn Pro Thr
Thr145 150 155 160Gly Ile
Leu Val Ile Gly Asn Leu Thr Asn Phe Glu Gln Gly Tyr Tyr
165 170 175Gln Cys Thr Ala Ile Asn Arg
Leu Gly Asn Ser Ser Cys Glu Ile Asp 180 185
190Leu Thr Ser Ser His Pro Glu Val Gly Ile Ile Val Gly Ala
Leu Ile 195 200 205Gly Ser Leu Val
Gly Ala Ala Ile Ile Ile Ser Val Val Cys Phe Ala 210
215 220Arg Asn Lys Ala Lys Ala Lys Ala Lys Glu Arg Asn
Ser Lys Thr Ile225 230 235
240Ala Glu Leu Glu Pro Met Thr Lys Ile Asn Pro Arg Gly Glu Ser Glu
245 250 255Ala Met Pro Arg Glu
Asp Ala Thr Gln Leu Glu Val Thr Leu Pro Ser 260
265 270Ser Ile His Glu Thr Gly Pro Asp Thr Ile Gln Glu
Pro Asp Tyr Glu 275 280 285Pro Lys
Pro Thr Gln Glu Pro Ala Pro Glu Pro Ala Pro Gly Ser Glu 290
295 300Pro Met Ala Val Pro Asp Leu Asp Ile Glu Leu
Glu Leu Glu Pro Glu305 310 315
320Thr Gln Ser Glu Leu Glu Pro Glu Pro Glu Pro Glu Pro Glu Ser Glu
325 330 335Pro Gly Val Val
Val Glu Pro Leu Ser Glu Asp Glu 340
34571403DNAHomo sapiens 7tgtgcaggca acaggaaaca aatacagagg gcagagcaag
gattggtcag gacgggctta 60gtgagaaagg ctctgaacga gacacacacc agctgcagct
tcgtactgac gcctgccagc 120tcctacacac cttcctgggc aactgccagc ggggcaaggc
aggcctgggg ccaccctgca 180ggcagtgtct gggccctcag ctccccctcc ctccacctac
cccctcacac ccaccactac 240gaccccacgg gatacccagc ccagacggag gaaacaccga
gcctagagac atgagagttg 300gaggagcatt ccaccttcta ctcgtgtgcc tgagcccagc
actgctgtct gctgtgcgga 360tcaacgggga tggacaggag gtcctgtacc tggcagaagg
tgataatgtg aggctgggct 420gcccctacgt cctggaccct gaggactatg gtcccaatgg
gctggacatc gagtggatgc 480aggtcaactc agaccccgcc caccaccgag agaacgtgtt
ccttagttac caggacaaga 540ggatcaacca tggcagcctt ccccatctgc agcagagggt
ccgctttgca gcctcagacc 600caagccagta cgatgcctcc atcaacctca tgaacctgca
ggtatctgat acagccactt 660atgagtgccg ggtgaagaag accaccatgg ccacccggaa
ggtcattgtc actgtccaag 720cacgacctgc agtgcccatg tgctggacag agggccacat
gacatatggc aacgatgtgg 780tgctgaagtg ctatgccagt gggggctccc agcccctctc
ctacaagtgg gccaagatca 840gtgggcacca ttacccctat cgagctgggt cttacacctc
ccagcacagc taccactcag 900agctgtccta ccaggagtcc ttccacagct ccataaacca
aggcctgaac aatggggacc 960tggtgttgaa ggatatctcc agagcagatg atgggctgta
tcagtgcaca gtggccaaca 1020acgtgggcta cagtgtttgt gtggtggagg tgaaggtctc
agactcccgg cgtataggcg 1080tgatcatcgg catcgtcctg ggctctctgc tcgcgctggg
ctgcctggcc agaggacgcc 1140gtggcgcccg ggtgcaaggc cagcgggcgc ggcagccgcg
tcacccacct cctggggtac 1200ccgacgcaga acgtcagccg ctccctgcgc cgcaatacgc
gcctcccccc tgcggcggcc 1260ccgaggacgt ggccctggcg ccctgcaccg ccgccgccgc
ctgcgaagcg ggcccctccc 1320cggtctacgt caaggtcaag agcgcggagc cggctgactg
cgccgagggg ccggtgcagt 1380gcaagaacgg cctcttggtg tga
14038370PRTHomo sapiens 8Met Arg Val Gly Gly Ala
Phe His Leu Leu Leu Val Cys Leu Ser Pro 1 5
10 15Ala Leu Leu Ser Ala Val Arg Ile Asn Gly Asp Gly
Gln Glu Val Leu 20 25 30Tyr
Leu Ala Glu Gly Asp Asn Val Arg Leu Gly Cys Pro Tyr Val Leu 35
40 45Asp Pro Glu Asp Tyr Gly Pro Asn Gly
Leu Asp Ile Glu Trp Met Gln 50 55
60Val Asn Ser Asp Pro Ala His His Arg Glu Asn Val Phe Leu Ser Tyr 65
70 75 80Gln Asp Lys Arg Ile
Asn His Gly Ser Leu Pro His Leu Gln Gln Arg 85
90 95Val Arg Phe Ala Ala Ser Asp Pro Ser Gln Tyr
Asp Ala Ser Ile Asn 100 105
110Leu Met Asn Leu Gln Val Ser Asp Thr Ala Thr Tyr Glu Cys Arg Val
115 120 125Lys Lys Thr Thr Met Ala Thr
Arg Lys Val Ile Val Thr Val Gln Ala 130 135
140Arg Pro Ala Val Pro Met Cys Trp Thr Glu Gly His Met Thr Tyr
Gly145 150 155 160Asn Asp
Val Val Leu Lys Cys Tyr Ala Ser Gly Gly Ser Gln Pro Leu
165 170 175Ser Tyr Lys Trp Ala Lys Ile
Ser Gly His His Tyr Pro Tyr Arg Ala 180 185
190Gly Ser Tyr Thr Ser Gln His Ser Tyr His Ser Glu Leu Ser
Tyr Gln 195 200 205Glu Ser Phe His
Ser Ser Ile Asn Gln Gly Leu Asn Asn Gly Asp Leu 210
215 220Val Leu Lys Asp Ile Ser Arg Ala Asp Asp Gly Leu
Tyr Gln Cys Thr225 230 235
240Val Ala Asn Asn Val Gly Tyr Ser Val Cys Val Val Glu Val Lys Val
245 250 255Ser Asp Ser Arg Arg
Ile Gly Val Ile Ile Gly Ile Val Leu Gly Ser 260
265 270Leu Leu Ala Leu Gly Cys Leu Ala Arg Gly Arg Arg
Gly Ala Arg Val 275 280 285Gln Gly
Gln Arg Ala Arg Gln Pro Arg His Pro Pro Pro Gly Val Pro 290
295 300Asp Ala Glu Arg Gln Pro Leu Pro Ala Pro Gln
Tyr Ala Pro Pro Pro305 310 315
320Cys Gly Gly Pro Glu Asp Val Ala Leu Ala Pro Cys Thr Ala Ala Ala
325 330 335Ala Cys Glu Ala
Gly Pro Ser Pro Val Tyr Val Lys Val Lys Ser Ala 340
345 350Glu Pro Ala Asp Cys Ala Glu Gly Pro Val Gln
Cys Lys Asn Gly Leu 355 360 365Leu
Val 3709228PRTHomo sapiens 9Gln Glu Val Leu Tyr Leu Ala Glu Gly Asp
Asn Val Arg Leu Gly Cys 1 5 10
15Pro Tyr Val Leu Asp Pro Glu Asp Tyr Gly Pro Asn Gly Leu Asp Ile
20 25 30Glu Trp Met Gln Val
Asn Ser Asp Pro Ala His His Arg Glu Asn Val 35
40 45Phe Leu Ser Tyr Gln Asp Lys Arg Ile Asn His Gly Ser
Leu Pro His 50 55 60Leu Gln Gln Arg
Val Arg Phe Ala Ala Ser Asp Pro Ser Gln Tyr Asp 65 70
75 80Ala Ser Ile Asn Leu Met Asn Leu Gln
Val Ser Asp Thr Ala Thr Tyr 85 90
95Glu Cys Arg Val Lys Lys Thr Thr Met Ala Thr Arg Lys Val Ile
Val 100 105 110Thr Val Gln Ala
Arg Pro Ala Val Pro Met Cys Trp Thr Glu Gly His 115
120 125Met Thr Tyr Gly Asn Asp Val Val Leu Lys Cys Tyr
Ala Ser Gly Gly 130 135 140Ser Gln Pro
Leu Ser Tyr Lys Trp Ala Lys Ile Ser Gly His His Tyr145
150 155 160Pro Tyr Arg Ala Gly Ser Tyr
Thr Ser Gln His Ser Tyr His Ser Glu 165
170 175Leu Ser Tyr Gln Glu Ser Phe His Ser Ser Ile Asn
Gln Gly Leu Asn 180 185 190Asn
Gly Asp Leu Val Leu Lys Asp Ile Ser Arg Ala Asp Asp Gly Leu 195
200 205Tyr Gln Cys Thr Val Ala Asn Asn Val
Gly Tyr Ser Val Cys Val Val 210 215
220Glu Val Lys Val22510201PRTHomo sapiens 10Gln Asp Val Leu Arg Ala Ser
Gln Gly Lys Ser Val Thr Leu Pro Cys 1 5
10 15Thr Tyr His Thr Ser Thr Ser Ser Arg Glu Gly Leu Ile
Gln Trp Asp 20 25 30Lys Leu
Leu Leu Thr His Thr Glu Arg Val Val Ile Trp Pro Phe Ser 35
40 45Asn Lys Asn Tyr Ile His Gly Glu Leu Tyr
Lys Asn Arg Val Ser Ile 50 55 60Ser
Asn Asn Ala Glu Gln Ser Asp Ala Ser Ile Thr Ile Asp Gln Leu 65
70 75 80Thr Met Ala Asp Asn Gly
Thr Tyr Glu Cys Ser Val Ser Leu Met Ser 85
90 95Asp Leu Glu Gly Asn Thr Lys Ser Arg Val Arg Leu
Leu Val Leu Val 100 105 110Pro
Pro Ser Lys Pro Glu Cys Gly Ile Glu Gly Glu Thr Ile Ile Gly 115
120 125Asn Asn Ile Gln Leu Thr Cys Gln Ser
Lys Glu Gly Ser Pro Thr Pro 130 135
140Gln Tyr Ser Trp Lys Arg Tyr Asn Ile Leu Asn Gln Glu Gln Pro Leu145
150 155 160Ala Gln Pro Ala
Ser Gly Gln Pro Val Ser Leu Lys Asn Ile Ser Thr 165
170 175Asp Thr Ser Gly Tyr Tyr Ile Cys Thr Ser
Ser Asn Glu Glu Gly Thr 180 185
190Gln Phe Cys Asn Ile Thr Val Ala Val 195
2001120DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 11actgttggat ctaatgtcac
201220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 12aaggtttcac taacacactg
201325DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 13gaaggagatg gagccaattt ctatt
251425DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 14cctgtaattc gatctttaaa ttgcc
251531DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
15cttttctcaa ggtggacaag ctgtagccat c
3116600DNAHomo sapiens 16ggtagtgaca actgccagtg tttcaaaaaa gagtaacata
tccagagttt gttcacacag 60aaatgaatgc tttttagctt cataacccct gtgcccttcc
cgtgagcccc atctccccag 120gaaacgatat agtaccaatt tactaactta atttgtaaaa
ggaggttagt gaatcaattc 180tgtaagactc atggaaatat ttgaaattaa ttagccttgt
cagcttttat ttgcataggc 240tctcttccaa ccatatcccc cagcccaagt acaacgtttt
agtaagattg attttaaaca 300atgagactta gagaatctgt gtacaaggag cttgaataat
ttaaatgcgt gggtttatta 360ttaacacagt agcaaatata tcaaggaaac acgccccatg
aaaagtgttt caaagaaaca 420caaatctgta ctgaaaaaag tctatacgca ataagtaagc
ccaaagaggc atgtttgctt 480ggcgatgccc agcagataag ccaggcaaac ctcggtgtga
tcgaagaagc caatttgaga 540ctcagcctag tccaggcaag ctactggcac ctgctgctct
caactaacct ccacacaatg 60017600DNAMus musculus 17ggatttgctg acagtccaat
cactggaaag tgttactgga aatgccttat tagagttgag 60atttttagcc tgggactggt
acaaattatt acataggatg aaggagaaag aaacccagga 120gaccattcag gaagctgttg
ctttaggcta acgtaatatc tagaacaaaa tggaagcagc 180aggttggaga tgggacaaat
ctaccattca ctttagaagc agcaggacca agatatctta 240tgggaagaac tggaggaggc
cctccaagta caactttctt tttttaaaaa gggttgattt 300taaacaatgt aacctaagag
aatctgtgta caaagaactg aaaggattta agtgcgtggt 360ttattattaa cacagtagca
aatatatcaa ggggacacac cccgggggaa aagggtttca 420aataaacaca gatttgttca
gagagaactc agtgcccaat aagcaagcgt aaggaggcct 480atttgcttgg tgatgcccag
ccgataagcc aggctgtgac tgaagaagcc aatttgaaac 540tcagcctagt tcaggcagcc
ttcggactgg cacctgctgc tccaagcgac tttcagcatg 6001820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
18tgcccatgtg ctggacagag
201920DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 19cacgttgttg gccactgtgc
2020399DNAMus musculusCDS(1)..(399) 20atg agg tgc ctt gtt cag
ttt ctg ggg ctg ctt gtg ctc tgg atc cct 48Met Arg Cys Leu Val Gln
Phe Leu Gly Leu Leu Val Leu Trp Ile Pro 1 5
10 15gga gcc att ggg gat att gtg atg act cag gct gca
ccc tct gtc cct 96Gly Ala Ile Gly Asp Ile Val Met Thr Gln Ala Ala
Pro Ser Val Pro 20 25 30gtc
act cct gga gag tca gta tcc atc tcc tgc agg tct agt acg agt 144Val
Thr Pro Gly Glu Ser Val Ser Ile Ser Cys Arg Ser Ser Thr Ser 35
40 45ctc ctg cat agt aat ggc aac act tac
ttg tat tgg ttc ctg cag agg 192Leu Leu His Ser Asn Gly Asn Thr Tyr
Leu Tyr Trp Phe Leu Gln Arg 50 55
60cca ggc cag tct cct cag ctc ctg ata tat cgg atg tcc aac ctt gcc
240Pro Gly Gln Ser Pro Gln Leu Leu Ile Tyr Arg Met Ser Asn Leu Ala 65
70 75 80tca gga gtc cca
gac agg ttc agt ggc agt ggg tca gga act gct ttc 288Ser Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Ala Phe 85
90 95aca ctg aga atc agt aga gtg gag gct gag
gat gtg ggt att tat tac 336Thr Leu Arg Ile Ser Arg Val Glu Ala Glu
Asp Val Gly Ile Tyr Tyr 100 105
110tgt atg caa cat cta gaa tat cct ttc acg ttc gga ggg ggg acc aaa
384Cys Met Gln His Leu Glu Tyr Pro Phe Thr Phe Gly Gly Gly Thr Lys
115 120 125ctg gaa ata aaa cgg
399Leu Glu Ile Lys Arg 130
21133PRTMus musculus 21Met Arg Cys Leu Val Gln Phe Leu Gly Leu Leu Val
Leu Trp Ile Pro 1 5 10
15Gly Ala Ile Gly Asp Ile Val Met Thr Gln Ala Ala Pro Ser Val Pro
20 25 30Val Thr Pro Gly Glu Ser Val
Ser Ile Ser Cys Arg Ser Ser Thr Ser 35 40
45Leu Leu His Ser Asn Gly Asn Thr Tyr Leu Tyr Trp Phe Leu Gln
Arg 50 55 60Pro Gly Gln Ser Pro Gln
Leu Leu Ile Tyr Arg Met Ser Asn Leu Ala 65 70
75 80Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly
Ser Gly Thr Ala Phe 85 90
95Thr Leu Arg Ile Ser Arg Val Glu Ala Glu Asp Val Gly Ile Tyr Tyr
100 105 110Cys Met Gln His Leu Glu
Tyr Pro Phe Thr Phe Gly Gly Gly Thr Lys 115 120
125Leu Glu Ile Lys Arg 13022423DNAMus
musculusCDS(1)..(423) 22atg aac ttt ggg ttc agc ttg gtt ttc ctt gcc ctt
att tta aaa ggt 48Met Asn Phe Gly Phe Ser Leu Val Phe Leu Ala Leu
Ile Leu Lys Gly 1 5 10
15gtc cag tgt gag gtg gag ctg gtg gag tct ggg gga ggc cta gtg cag
96Val Gln Cys Glu Val Glu Leu Val Glu Ser Gly Gly Gly Leu Val Gln
20 25 30cct gga ggg tcc ctg aaa ctc
tcc tgt gca gcc tct gga ttc acc ttc 144Pro Gly Gly Ser Leu Lys Leu
Ser Cys Ala Ala Ser Gly Phe Thr Phe 35 40
45agt act ttt ggc atg tct tgg gtt cgc cag act cca gac aag agg
ctg 192Ser Thr Phe Gly Met Ser Trp Val Arg Gln Thr Pro Asp Lys Arg
Leu 50 55 60gag ttg gtc gca acc att
aat agt aat ggt ggt agg acc tat tat cta 240Glu Leu Val Ala Thr Ile
Asn Ser Asn Gly Gly Arg Thr Tyr Tyr Leu 65 70
75 80gac agt gtg aag ggc cga ttc acc atc tcc aga
gaa aat gcc aag aac 288Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg
Glu Asn Ala Lys Asn 85 90
95acc ctg tac ctg caa atg agc agt ctg aag tct gag gac aca gcc atg
336Thr Leu Tyr Leu Gln Met Ser Ser Leu Lys Ser Glu Asp Thr Ala Met
100 105 110tat tac tgt gca aga gat
ggg gga cta cta cgg gat tcc gcc tgg ttt 384Tyr Tyr Cys Ala Arg Asp
Gly Gly Leu Leu Arg Asp Ser Ala Trp Phe 115 120
125gct tac tgg ggc caa ggg act ctg gtc act gtc tct gca
423Ala Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala 130
135 14023141PRTMus musculus 23Met Asn Phe
Gly Phe Ser Leu Val Phe Leu Ala Leu Ile Leu Lys Gly 1 5
10 15Val Gln Cys Glu Val Glu Leu Val Glu
Ser Gly Gly Gly Leu Val Gln 20 25
30Pro Gly Gly Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
35 40 45Ser Thr Phe Gly Met Ser
Trp Val Arg Gln Thr Pro Asp Lys Arg Leu 50 55
60Glu Leu Val Ala Thr Ile Asn Ser Asn Gly Gly Arg Thr Tyr Tyr
Leu 65 70 75 80Asp Ser
Val Lys Gly Arg Phe Thr Ile Ser Arg Glu Asn Ala Lys Asn
85 90 95Thr Leu Tyr Leu Gln Met Ser Ser
Leu Lys Ser Glu Asp Thr Ala Met 100 105
110Tyr Tyr Cys Ala Arg Asp Gly Gly Leu Leu Arg Asp Ser Ala Trp
Phe 115 120 125Ala Tyr Trp Gly Gln
Gly Thr Leu Val Thr Val Ser Ala 130 135
14024399DNAMus musculusCDS(1)..(399) 24atg agg tgc ctt gct cag ctt ctg
ggg ctg ctt gtg ctc tgg atc cct 48Met Arg Cys Leu Ala Gln Leu Leu
Gly Leu Leu Val Leu Trp Ile Pro 1 5 10
15gga gcc att ggg gat att gtg atg act cag gct gca ccc tct
gta cct 96Gly Ala Ile Gly Asp Ile Val Met Thr Gln Ala Ala Pro Ser
Val Pro 20 25 30gtc act cct
gga gag tca gta tcc atc tcc tgc agg tct agt acg agt 144Val Thr Pro
Gly Glu Ser Val Ser Ile Ser Cys Arg Ser Ser Thr Ser 35
40 45ctc ctg cat ggt aat ggc aac act tac ttg tat
tgg ttc ctg cag agg 192Leu Leu His Gly Asn Gly Asn Thr Tyr Leu Tyr
Trp Phe Leu Gln Arg 50 55 60cca ggc
cag tct cct cag ctc ctg ata tat cgg atg tcc aac ctt gcc 240Pro Gly
Gln Ser Pro Gln Leu Leu Ile Tyr Arg Met Ser Asn Leu Ala 65
70 75 80tca gga gtc cca gac agg ttc
agt ggc agt ggg tca gga act gct ttc 288Ser Gly Val Pro Asp Arg Phe
Ser Gly Ser Gly Ser Gly Thr Ala Phe 85
90 95aca ctg aga atc agt aga gtg gag gct gag gat gtg ggt
att tat tac 336Thr Leu Arg Ile Ser Arg Val Glu Ala Glu Asp Val Gly
Ile Tyr Tyr 100 105 110tgt atg
cag cat cta gaa tat cct ttc acg ttc gga ggg ggg acc aag 384Cys Met
Gln His Leu Glu Tyr Pro Phe Thr Phe Gly Gly Gly Thr Lys 115
120 125ctg gaa ata aaa cgg
399Leu Glu Ile Lys Arg 13025133PRTMus
musculus 25Met Arg Cys Leu Ala Gln Leu Leu Gly Leu Leu Val Leu Trp Ile
Pro 1 5 10 15Gly Ala Ile
Gly Asp Ile Val Met Thr Gln Ala Ala Pro Ser Val Pro 20
25 30Val Thr Pro Gly Glu Ser Val Ser Ile Ser
Cys Arg Ser Ser Thr Ser 35 40
45Leu Leu His Gly Asn Gly Asn Thr Tyr Leu Tyr Trp Phe Leu Gln Arg 50
55 60Pro Gly Gln Ser Pro Gln Leu Leu Ile
Tyr Arg Met Ser Asn Leu Ala 65 70 75
80Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr
Ala Phe 85 90 95Thr Leu
Arg Ile Ser Arg Val Glu Ala Glu Asp Val Gly Ile Tyr Tyr 100
105 110Cys Met Gln His Leu Glu Tyr Pro Phe
Thr Phe Gly Gly Gly Thr Lys 115 120
125Leu Glu Ile Lys Arg 13026423DNAMus musculusCDS(1)..(423) 26atg gac
ttt ggg ttc agc ttg gtt ttc ctt gcc ctt att tta aaa ggt 48Met Asp
Phe Gly Phe Ser Leu Val Phe Leu Ala Leu Ile Leu Lys Gly 1
5 10 15gtc cag tgt gag gtg gag ctg gtg
gag tct ggg gga ggc tta gtg cag 96Val Gln Cys Glu Val Glu Leu Val
Glu Ser Gly Gly Gly Leu Val Gln 20 25
30cct gga ggg tcc ctg aaa ctc tcc tgt gca gcc tct gga ttc acc
ttc 144Pro Gly Gly Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr
Phe 35 40 45agt agt tat ggc atg
tct tgg gtt cgc cag act cca gac aag agg ctg 192Ser Ser Tyr Gly Met
Ser Trp Val Arg Gln Thr Pro Asp Lys Arg Leu 50 55
60gag ttg gtc gca acc att aat agt aat ggt ggt agg acc tat
tat cta 240Glu Leu Val Ala Thr Ile Asn Ser Asn Gly Gly Arg Thr Tyr
Tyr Leu 65 70 75 80gac
agt gtg aag ggc cga ttc acc atc tcc aga gac aat gcc aag aac 288Asp
Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn
85 90 95acc ctg tac ctg caa atg agc
agt ctg aag tct gag gac aca gcc atg 336Thr Leu Tyr Leu Gln Met Ser
Ser Leu Lys Ser Glu Asp Thr Ala Met 100 105
110tat tac tgt gca aga gat ggg gga ctc cta cga gat tcc gcc
tgg ttt 384Tyr Tyr Cys Ala Arg Asp Gly Gly Leu Leu Arg Asp Ser Ala
Trp Phe 115 120 125gct tac tgg ggc
caa ggg act ctg gtc act gtc tct gca 423Ala Tyr Trp Gly
Gln Gly Thr Leu Val Thr Val Ser Ala 130 135
14027141PRTMus musculus 27Met Asp Phe Gly Phe Ser Leu Val Phe Leu
Ala Leu Ile Leu Lys Gly 1 5 10
15Val Gln Cys Glu Val Glu Leu Val Glu Ser Gly Gly Gly Leu Val Gln
20 25 30Pro Gly Gly Ser Leu
Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 35
40 45Ser Ser Tyr Gly Met Ser Trp Val Arg Gln Thr Pro Asp
Lys Arg Leu 50 55 60Glu Leu Val Ala
Thr Ile Asn Ser Asn Gly Gly Arg Thr Tyr Tyr Leu 65 70
75 80Asp Ser Val Lys Gly Arg Phe Thr Ile
Ser Arg Asp Asn Ala Lys Asn 85 90
95Thr Leu Tyr Leu Gln Met Ser Ser Leu Lys Ser Glu Asp Thr Ala
Met 100 105 110Tyr Tyr Cys Ala
Arg Asp Gly Gly Leu Leu Arg Asp Ser Ala Trp Phe 115
120 125Ala Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser
Ala 130 135 14028384DNAMus
musculusCDS(1)..(384) 28atg agg gcc cct gct cag att ttt gga ttc ttg ttg
ctc tgg ttc cca 48Met Arg Ala Pro Ala Gln Ile Phe Gly Phe Leu Leu
Leu Trp Phe Pro 1 5 10
15ggt gcc aga tgt gaa atc cag atg acc cag tct cca tcc tct atg tct
96Gly Ala Arg Cys Glu Ile Gln Met Thr Gln Ser Pro Ser Ser Met Ser
20 25 30gca tct ctg gga gac aga ata
acc atc act tgc cag gca act caa gac 144Ala Ser Leu Gly Asp Arg Ile
Thr Ile Thr Cys Gln Ala Thr Gln Asp 35 40
45att gtt aag aat tta aac tgg tat cag cag aaa cca ggg aaa ccc
cct 192Ile Val Lys Asn Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Pro
Pro 50 55 60tca atc ctg atc tat tat
gca act gaa ctg gca gaa ggg gtc cca tca 240Ser Ile Leu Ile Tyr Tyr
Ala Thr Glu Leu Ala Glu Gly Val Pro Ser 65 70
75 80agg ttc agt ggc agt ggg tct ggg tca gac tat
tct ctg aca atc agc 288Arg Phe Ser Gly Ser Gly Ser Gly Ser Asp Tyr
Ser Leu Thr Ile Ser 85 90
95aac ctg gag tct gaa gat ttt gca gac tat tac tgt cta cag ttt tat
336Asn Leu Glu Ser Glu Asp Phe Ala Asp Tyr Tyr Cys Leu Gln Phe Tyr
100 105 110gac ttt ccg ctc acg ttc
ggt gct ggg acc aag ctg gag ctg aaa cgg 384Asp Phe Pro Leu Thr Phe
Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg 115 120
12529128PRTMus musculus 29Met Arg Ala Pro Ala Gln Ile Phe
Gly Phe Leu Leu Leu Trp Phe Pro 1 5 10
15Gly Ala Arg Cys Glu Ile Gln Met Thr Gln Ser Pro Ser Ser
Met Ser 20 25 30Ala Ser Leu
Gly Asp Arg Ile Thr Ile Thr Cys Gln Ala Thr Gln Asp 35
40 45Ile Val Lys Asn Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Pro Pro 50 55 60Ser Ile
Leu Ile Tyr Tyr Ala Thr Glu Leu Ala Glu Gly Val Pro Ser 65
70 75 80Arg Phe Ser Gly Ser Gly Ser
Gly Ser Asp Tyr Ser Leu Thr Ile Ser 85
90 95Asn Leu Glu Ser Glu Asp Phe Ala Asp Tyr Tyr Cys Leu
Gln Phe Tyr 100 105 110Asp Phe
Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg 115
120 12530420DNAMus musculusCDS(1)..(420) 30atg
gga tgg agc tat atc atc ttc ttt ctg gta gca aca gct aca ggt 48Met
Gly Trp Ser Tyr Ile Ile Phe Phe Leu Val Ala Thr Ala Thr Gly 1
5 10 15gtg cac tcc cag gtc cag ctg
cag cag tct ggg cct gag ctg gtg agg 96Val His Ser Gln Val Gln Leu
Gln Gln Ser Gly Pro Glu Leu Val Arg 20 25
30cct ggg gtc tca gtg aag att tcc tgc aag ggt tcc ggc tac
aca ttc 144Pro Gly Val Ser Val Lys Ile Ser Cys Lys Gly Ser Gly Tyr
Thr Phe 35 40 45act gat tat gct
acg cac tgg gtg agg cag agt cat gca aag agt cta 192Thr Asp Tyr Ala
Thr His Trp Val Arg Gln Ser His Ala Lys Ser Leu 50
55 60gag tgg att gga gtt att agt agt tac tct ggt aat aca
aag tac aac 240Glu Trp Ile Gly Val Ile Ser Ser Tyr Ser Gly Asn Thr
Lys Tyr Asn 65 70 75
80cag aac ttt aag gac aag gcc aca atg act gta gac aaa tcc tcc agc
288Gln Asn Phe Lys Asp Lys Ala Thr Met Thr Val Asp Lys Ser Ser Ser
85 90 95aca gcc tat atg gaa
ctt gcc aga ttg aca tct gag gat tct gcc atg 336Thr Ala Tyr Met Glu
Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala Met 100
105 110tat tac tgt gca aga tat gat tac gac gtc cgg tac
tat gct atg gac 384Tyr Tyr Cys Ala Arg Tyr Asp Tyr Asp Val Arg Tyr
Tyr Ala Met Asp 115 120 125tac tgg
ggt caa gga acc tca gtc acc gtc tcc tca 420Tyr Trp
Gly Gln Gly Thr Ser Val Thr Val Ser Ser 130 135
14031140PRTMus musculus 31Met Gly Trp Ser Tyr Ile Ile Phe Phe
Leu Val Ala Thr Ala Thr Gly 1 5 10
15Val His Ser Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val
Arg 20 25 30Pro Gly Val Ser
Val Lys Ile Ser Cys Lys Gly Ser Gly Tyr Thr Phe 35
40 45Thr Asp Tyr Ala Thr His Trp Val Arg Gln Ser His
Ala Lys Ser Leu 50 55 60Glu Trp Ile
Gly Val Ile Ser Ser Tyr Ser Gly Asn Thr Lys Tyr Asn 65
70 75 80Gln Asn Phe Lys Asp Lys Ala Thr
Met Thr Val Asp Lys Ser Ser Ser 85 90
95Thr Ala Tyr Met Glu Leu Ala Arg Leu Thr Ser Glu Asp Ser
Ala Met 100 105 110Tyr Tyr Cys
Ala Arg Tyr Asp Tyr Asp Val Arg Tyr Tyr Ala Met Asp 115
120 125Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser
Ser 130 135 140328PRTMus musculus
32Ser Asn Gly Asn Thr Tyr Leu Tyr 1 5337PRTMus musculus
33Arg Met Ser Asn Leu Ala Ser 1 5349PRTMus musculus 34Met
Gln His Leu Glu Tyr Pro Phe Thr 1 5355PRTMus musculus
35Thr Phe Gly Met Ser 1 53617PRTMus musculus 36Thr Ile Asn
Ser Asn Gly Gly Arg Thr Tyr Tyr Leu Asp Ser Val Lys 1 5
10 15Gly3713PRTMus musculus 37Asp Gly Gly
Leu Leu Arg Asp Ser Ala Trp Phe Ala Tyr 1 5
10388PRTMus musculus 38Gly Asn Gly Asn Thr Tyr Leu Tyr 1
5397PRTMus musculus 39Arg Met Ser Asn Leu Ala Ser 1
5409PRTMus musculus 40Met Gln His Leu Glu Tyr Pro Phe Thr 1
5415PRTMus musculus 41Ser Tyr Gly Met Ser 1 54217PRTMus
musculus 42Thr Ile Asn Ser Asn Gly Gly Arg Thr Tyr Tyr Leu Asp Ser Val
Lys 1 5 10
15Gly4313PRTMus musculus 43Asp Gly Gly Leu Leu Arg Asp Ser Ala Trp Phe
Ala Tyr 1 5 104411PRTMus musculus 44Gln
Ala Thr Gln Asp Ile Val Lys Asn Leu Asn 1 5
10457PRTMus musculus 45Tyr Ala Thr Glu Leu Ala Glu 1
5469PRTMus musculus 46Leu Gln Phe Tyr Asp Phe Pro Leu Thr 1
5475PRTMus musculus 47Asp Tyr Ala Thr His 1 5489PRTMus
musculus 48Val Ile Ser Ser Tyr Ser Gly Asn Thr 1
54912PRTMus musculus 49Tyr Asp Tyr Asp Val Arg Tyr Tyr Ala Met Asp Tyr 1
5 10503017DNAHomo sapiens 50agcggggcga
tgcccagcag ataagccagg caaacctcgg tgtgatcgaa gaagccaatt 60tgagactcag
cctagtccag gcaagctact ggcacctgct gctctcaact aacctccaca 120caatggtgtt
cgcattttgg aaggtctttc tgatcctaag ctgccttgca ggtcaggtta 180gtgtggtgca
agtgaccatc ccagacggtt tcgtgaacgt gactgttgga tctaatgtca 240ctctcatctg
catctacacc accactgtgg cctcccgaga acagctttcc atccagtggt 300ctttcttcca
taagaaggag atggagccaa tttctattta cttttctcaa ggtggacaag 360ctgtagccat
cgggcaattt aaagatcgaa ttacagggtc caacgatcca ggtaatgcat 420ctatcactat
ctcgcatatg cagccagcag acagtggaat ttacatctgc gatgttaaca 480accccccaga
ctttctcggc caaaaccaag gcatcctcaa cgtcagtgtg ttagtgaaac 540cttctaagcc
cctttgtagc gttcaaggaa gaccagaaac tggccacact atttcccttt 600cctgtctctc
tgcgcttgga acaccttccc ctgtgtacta ctggcataaa cttgagggaa 660gagacatcgt
gccagtgaaa gaaaacttca acccaaccac cgggattttg gtcattggaa 720atctgacaaa
ttttgaacaa ggttattacc agtgtactgc catcaacaga cttggcaata 780gttcctgcga
aatcgatctc acttcttcac atccagaagt tggaatcatt gttggggcct 840tgattggtag
cctggtaggt gccgccatca tcatctctgt tgtgtgcttc gcaaggaata 900aggcaaaagc
aaaggcaaaa gaaagaaatt ctaagaccat cgcggaactt gagccaatga 960caaagataaa
cccaagggga gaaagcgaag caatgccaag agaagacgct acccaactag 1020aagtaactct
accatcttcc attcatgaga ctggccctga taccatccaa gaaccagact 1080atgagccaaa
gcctactcag gagcctgccc cagagcctgc cccaggatca gagcctatgg 1140cagtgcctga
ccttgacatc gagctggagc tggagccaga aacgcagtcg gaattggagc 1200cagagccaga
gccagagcca gagtcagagc ctggggttgt agttgagccc ttaagtgaag 1260atgaaaaggg
agtggttaag gcataggctg gtggcctaag tacagcatta atcattaagg 1320aacccattac
tgccatttgg aattcaaata acctaaccaa cctccacctc ctccttccat 1380tttgaccaac
cttcttctaa caaggtgctc attcctacta tgaatccaga ataaacacgc 1440caagataaca
gctaaatcag caagggttcc tgtattacca atatagaata ctaacaattt 1500tactaacacg
taagcataac aaatgacagg gcaagtgatt tctaacttag ttgagttttg 1560caacagtacc
tgtgttgtta tttcagaaaa tattatttct ctctttttaa ctactctttt 1620tttttatttt
ggacagagtc ttgctccgtc gcgcaggctg tgatcgtagt ggtgcgatct 1680cggctcactg
cggcctccgc tccctgggtt cgggcgattc tcctgcctgg gcctcctgag 1740tggctgggac
tgcaggcacg tgccgccacg cccggctaat tttttgtatt tttggtagag 1800atggggtttc
acgttgttgg ccaggatggt ctccatctcc tgacctcatg atccgcccac 1860cttggcctcc
caaaatgctg ggattacagg catgagccac tgcgcccggc ctctttttag 1920ctactcttat
gttccacatg cacatatgac aaggtggcat taattagatt caatattatt 1980tctaggaata
gttcctcatt catttttata ttgaccacta agaaaataat tcatcagcat 2040tatctcatag
attggaaaat tttctccaaa tacaatagag gagaatatgt aaagggtata 2100cattaattgg
tacgtagcat ttaaaatcag gtcttataat taatgcttca ttcctcatat 2160tagatttccc
aagaaatcac cctggtatcc aatatctgag catggcaaat ttaaaaaata 2220acacaatttc
ttgcctgtga ccctagcact ttgggaggcc gaggcaggtg gatcacctga 2280ggtcaggggt
tcgagaccag cctggccgac atggcgaagc cccttctctg ctaggaatgc 2340agaaattggc
tgggcgtggt ggtgcatgcc tgtagtcccg gctacttggg aggctgaggc 2400aggagagtcg
cttgaaccca gggggtggag gttgcagtga gccgagattg tgccactgca 2460ctccaacctg
ggtgacggag tgagattcca tctgaaaaac aaaaacaaaa acagaaaaca 2520aacaaacaaa
aaacaaaaaa tccccacaac tttgtcaaat aatgtacagg caaacacttt 2580caaatataat
ttccttcagt gaatacaaaa tgttgatatc ataggtgatg tacaatttag 2640ttttgaatga
gttattatgt tatcactgtg tctgatgtta tctactttga aaggcagtcc 2700agaaaagtgt
tctaagtgaa ctcttaagat ctattttaga taatttcaac taattaaata 2760acctgtttta
ctgcctgtac attccacatt aataaagcga taccaatctt atatgaatgc 2820taatattact
aaaatgcact gatatcactt cttcttccac tgttgaaaag ctttctcatg 2880atcatatttc
acccacatct caccttgaag aaacttacag gtagacttac cttttcactt 2940gtggaattaa
tcatatttaa atcttacttt aaggctcaat aaataatact cataatgtcc 3000caaaaaaaaa
aaaaaaa 3017
User Contributions:
Comment about this patent or add new information about this topic:
