Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: Vaccine for preventing and treating porcine progressive atrophic rhinitis
Inventors:
Maw-Sheng Chien
Cheng-I Liu
Chih-Ming Liao
Agents:
CHARLES E. BAXLEY, ESQUIRE
Assignees:
Origin: NEW YORK, NY US
IPC8 Class: AA61K39102FI
USPC Class:
4241901
Abstract:
The present invention relates to an animal vaccine directed to progressive
atrophic rhinitis (PAR), comprising at least two fragments of recombinant
subunit Pasteurella multocida toxins (rsPMT) capable of eliciting the
production of antibodies against. Pasteurella multocida associated with
PAR, said fragments each having an amino acid sequence that substantially
corresponds to the 2-486, 486-986 or 986-1281 amino acid residues of
Pasteurella multocida toxin (PMT), respectively. Also disclosed is a
multivalent animal vaccine, comprising said fragments as active
components against PAR, and at least a pathogenic antigen or epitope
thereof associated with other animal disease(s), such as inactivated
gE-deleted Pseudorabies virus.Claims:
1. A multivalent vaccine against progressive atrophic rhinitis (PAR),
comprising:(i) as the first component a combination of either recombinant
Pasteurella multocida toxin (rPMT) subunits having an amino acid sequence
corresponding to the 2-486 and 986-1281 amino acid residues, or to the
486-986 and 986-1281 amino acid residues, or to the 2-486, 486-986 and
986-1281 amino acid residues in SEQ ID NO: 2 respectively, and(ii) as the
second component at least one antigen or epitope associated with another
animal pathology.
2. The multivalent vaccine of claim 1, which comprises inactivated gE-deleted Pseudorabies virus as the second component.
3. The multivalent vaccine of claim 1, which further comprises at least one antigen derived from PMT toxoid, Pasteurella multocida serotype A, Pasteurella multocida serotype D or Bordetella bronchiseptica.
4. The multivalent vaccine of claim 1, which further comprises at least one adjuvant selected from Freund's complete adjuvant, Freund's incomplete adjuvant, aluminum gel, oily adjuvant (W/O/W) water-in-oil (W/O) emulsion, oil-in-water (O/W) emulsion, Con A, .beta.-glucosan, and combination thereof.
5. The multivalent vaccine of claim 1, wherein the PMT subunits are derived from Pasteurella multocida serotype D isolate.
6. The multivalent vaccine of claim 1, wherein the PMT subunits and the PR are produced by recombinant DNA technology.
Description:
CROSS REFERENCE
[0001]The present Application is a Division of co-pending U.S. application Ser. No. 11/206,071 by the same inventors filed on Aug. 18, 2005.
BACKGROUND OF THE INVENTION
[0002]1. Field of the Invention
[0003]This invention is generally in the field of veterinary vaccines, vaccine compositions, and methods of producing the same. Particularly, provided herein are the vaccines for immunizing animal against progressive atrophic rhinitis (PAR), which comprise a combination of at least two fragments of recombinant subunit Pasteurella multocida toxins (rsPMT) each having an amino acid sequence that substantially corresponds to the 2-486, 486-986 or 986-1281 amino acid residues of Pasteurella multocida toxin (PMT).
[0004]2. Description of Related Art
[0005]Progressive atrophic rhinitis (PAR) is an important upper respiratory disease in swine. The characteristic lesions include turbinate bone hypoplasia, facial distortion and nasal hemorrhage as a result of frequent sneezing. Moreover, PAR causes significant global economic loss in swine production due to growth retardation. Several studies have demonstrated that Pasteurella multocida toxin (PMT) is the major virulence factor responsible for the turbinate atrophy seen in PAR (see, for example, Ackermann M R et al. 1996; Am J Vet Res 57(6):848-852; and Lax A J & Chanter N. 1990; J Gen Microbiol 136:81-87). Inoculation of PMT alone could reproduce all major symptoms of PAR in experimentally challenged pigs. Either aerosolized or injected into swine, PMT causes severe turbinate atrophy and reduces weight gain (Kamp E M & Kimman T G 1988; Am. J. Vet. Res. 49:1844-1849). The mechanisms by which PMT reduces weight gain and conchal bone atrophy have been widely studied. Results of several studies indicate that PMT could increase bone resorption and reduce bone formation by altering the functions of osteoblasts and osteoclasts.
[0006]The molecular basis for the virulence of PMT remains unclear, but may be associated with the activation of osteoclasts or inactivation of osteoblasts. It has been demonstrated that PMT is a potent mitogen for several types of cells such as Swiss 3T3 fibroblasts. PMT was able to induce half-maximal stimulation of DNA synthesis and cell proliferation at doses as low as 1 pM. The effect of PMT on porcine osteoclasts and osteoblasts has been investigated using an in vitro cell culture system. Exposure of bone marrow cells to Vitamin D3 and PMT during growth led to an increase in cell numbers and earlier appearance of osteoclasts compared to controls. Low concentrations of PMT resulted in growth retardation, and decreased nodule formation in osteoblasts, while high concentrations of PMT increased cell death and inhibited nodule formation (Gwaltney S M et al. 1997; Vet Pathol 34(5):421-430). PMT also stimulates cell proliferation, but impairs cell maturation and cell function in primary cultures of rat osteoblasts. These findings suggest that PMT may increase bone resorption and decrease bone apposition, eventually leading to progressive osteolysis and continuous bone atrophy.
[0007]Many potential bacterial pathogens can colonize the nasal cavity or tonsils of swine and P. multocida is one of the primary opportunistic pathogens able to cause porcine respiratory disease complex (PRDC). In fact, PAR is considered a contagious respiratory disease with high prevalence throughout the areas of the world where modern pig husbandry is practiced. Antibiotics, vaccination and good management can reduce the severity and frequency of PAR. However, overuse of antibiotics is a source of public health concern and vaccination has emerged as the most attractive approach in controlling PAR (Foged N T et al. Vet Rec 1989; 125(1):7-11; Kobisch M, Pennings A, Vet Rec 1989; 124(3):57-61; and Sakano T et al. J Vet Med Sci 1997; 59(1):55-57).
[0008]The entire PMT gene (toxA) encoding a protein of 1285 amino acids has been cloned and expressed in E. coli (Petersen S K & Foged N T 1989; Infect Immun 57(12):3907-3913). A recombinant PMT derivative lacking N-terminal amino acid residues 27-147 was shown to induce a protective response against challenge with a lethal dose of PMT in mice (Petersen S K et al. 1991; Infect Immun 59(4):1387-1393), and to reduce colonization by toxigenic P. multocida in the nares and tonsils of swine (Nielsen J P et al. 1991; Can J Vet Res 55(2):128-138). Thus, recombinant PMT derivatives may serve as ideal immunogens to elicit a good protective response without cytotoxicity in animals.
[0009]Formalin is the most common reagent used to inactivate PMT, but it may induce chemical alterations that can reduce the immunogenicity or efficacy of vaccines (Nielsen J P et al. 1991; as described). Therefore, a non-toxic but immunogenic PMT derivative could be advantageous to the development of effective vaccines against PAR. Most of the PAR vaccines tested to date consist of inactivated cultures of P. multocida or PMT toxoids. The toxoids are prepared by treatment of PMT with formaldehyde, which eliminates toxicity while maintaining antigenicity. These PAR vaccines are effective when tested on farms. However, PMT constitutes less than 0.6% of the total cellular proteins of P. multocida making it necessary to culture a large quantity of bacteria in order to obtain sufficient antigen for commercial scale use. Traditional toxoid vaccines require large scaled culture of a toxigenic strain of P. multocida and a tedious, expensive procedure for preparation of the PMT toxoid. In addition to being both time-consuming and expensive, the need to use inactivating reagents such as formaldehyde may induce uncontrollable chemical alterations in the immunogenicity of proteins that can reduce or eliminate the efficacy of such vaccines.
[0010]The N-terminal portion of PMT (residues 1 to 506 a.a.) has been considered to contain the putative cell binding domain and translocation domain. Immunization of the N-terminal rsPMT Tox1 (residues 1 to 487 a.a.) could elicit neutralizing antibodies that could prevent PMT from binding to the target cells and subsequently translocating across the cell membrane. Consequently, the PMT activity was blocked. In addition, the C-terminal portion of PMT was suggested as the catalytic domain and antibodies raised against C-terminal fragments (residues 681-1285 and 849-1285) were capable of inhibiting the mitogenic effect of PMT. The residues 1165 (cysteine), 1205 (histidine) and 1223 (histidine) were showed to be essential for the intracellular activity of PMT (Baldwin M R et al. 2004; 54(1):239-250; and Pullinger G D et al. 2001; Infect. Immun. 69: 7839-7850). The rsPMT derivatives are easy to produce and not cytotoxic so that no extra chemical inactivation is required before use. U.S. Pat. No. 6,110,470 disclosed polypeptide derivatives of P. multocida toxin comprising amino acid sequences identical to PMT but lacking amino acids 1043-1130 or lacking amino acids 1130-1285.
[0011]Therefore, in this invention, three recombinant subunit PMT (rsPMT) derivatives, representing the N-terminal (aa. 2-486), middle (aa. 486-986), and C-terminal (aa. 986-1281) portions of PMT, are produced and their immunogenicities are characterized by assessing the level of PMT-specific antibody secreting cells, the serum neutralizing antibody titers and the degree of lymphocyte proliferation in immunized mice and swine. The efficacy of these recombinant subunits as a vaccine was also evaluated in pregnant sows and their offspring by analysis of neutralizing antibody titers in colostrum and serum, and by monitoring the survival rate and the mean weight gain in piglets after PMT challenge.
SUMMARY OF THE INVENTION
[0012]One aspect of the present invention is to provide a vaccine for immunizing animal against progressive atrophic rhinitis (PAR), which comprises a combination of at least two fragments of recombinant subunit Pasteurella multocida toxins (rsPMT) each having an amino acid sequence that substantially corresponds to the 2-486, 486-986 or 986-1281 amino acid residues in SEQ ID No: 2.
[0013]In a preferred embodiment, the vaccine comprises a combination of the N-terminal (aa. 2-486) and C-terminal (aa. 986-1281) portions of PMT. In another embodiment, the vaccine comprises a combination of the middle (aa. 486-986) and C-terminal (aa. 986-1281) portions of PMT.
[0014]In one embodiment, the fragments of PMT are manufactured by host cell that has been transformed with a plasmid comprising the coding sequence of Pasteurella multocida toxin fragment 2-486, 486-986 and/or 986-1281. The host cell used herein may be prokaryotic or eukaryotic.
[0015]In the second aspect, the present invention provides a multivalent vaccine against progressive atrophic rhinitis (PAR), which comprises a combination of at least two fragments of recombinant subunit Pasteurella multocida toxins (rsPMT) each having an amino acid sequence that substantially corresponds to the 2-486, 486-986 or 986-1281 amino acid residues in SEQ ID No: 2 as the first component; and at least one antigen or epitope associated with another animal pathology. In one embodiment, the multivalent vaccine is used for preventing and/or treating progressive atrophic rhinitis (PAR) and pseudorabies (PR).
BRIEF DESCRIPTION OF THE FIGURE
[0016]FIG. 1A-1C depict the total cellular proteins expressed by different rsPMT clones in E. coli were separated on 10% SDS-PAGE (A), followed by the Western blotting analysis using anti-PMT monoclonal antibody (B), or swine immune serum (C). Lane 1, protein standards (BIO-RAD); lane 2, Tox1 (86 kDa); lane 3, Tox2 (86 kDa); lane 4, Tox7 (55.4 kDa); lane 5, Tox6 (158 kDa); lane 6, PMT (155 kDa); lane 7, pET 32b(+). The location of each expressed rsPMT protein is indicated by an arrow, and native PMT synthesized in P. multocida PMD 48 is indicated by an arrowhead.
[0017]FIG. 2A-2C depict the cytotoxicity of rsPMT and native PMT on Vero cells. Monolayers of Vero cells were treated with DMEM (A), 140 ng/ml native PMT (B), and 1.5 mg/ml Tox1 (C), respectively at 37.degree. C. for 7 days. The cellular morphology is visualized by the phase-contrast microscope (Olympus IX-70). Magnification 100.times..
[0018]FIG. 3 depicts the PMT-specific ASCs of immunized mice present in spleen at 14 days post booster vaccination (open bars) and lethal dose of native PMT challenged (closed bars). At each time point, 3 mice/group were studied. .sup.#Significantly (p<0.05) different with toxoid-immunized mice after booster vaccination. *Significantly (p<0.05) different with toxoid-immunized mice after native PMT challenged.
[0019]FIG. 4A-4B depict PMT-specific ASCs detected in pulmonary lymph node (A) and spleen (B) of piglets after booster immunization (vaccinated), and subsequent PMT challenge (challenged) or homologous antigen booster (boosted). The results of each experiment were analyzed for effect of treatment using Student's t distribution. Statistical results were considered to be significant when p-values were lower than or equal to 0.05 (*).
[0020]FIG. 5 depicts PMT-specific serum neutralizing antibody titers in piglets after boost immunization (vaccinated), and subsequent PMT challenging (challenged) or homologous antigen booster (boosted). The SN titer was expressed as the end-point dilution of serum that could inhibit the cytotoxicity of 4-fold MTD of authentic PMT on Vero cells.
[0021]FIG. 6A-6D depict the representative photographs of the turbinate conchae of experimental pigs in groups vaccinated with rsPMTs vaccine (B), conventional AR-toxoid vaccine (C), and unvaccinated (D), at 2-weeks after authentic PMT challenge. The unvaccinated and unchallenged pigs were served as the negative control (A).
[0022]FIG. 7 depicts the PMT-specific serum neutralizing antibody titers in pregnant saws before and after boost immunization (vaccinated) of the PAR-PR bivalent vaccine.
[0023]FIG. 8 depicts the PR-specific serum neutralizing antibody titers in pregnant sows before and after boost immunization of the PAR-PR bivalent vaccine.
DETAILED DESCRIPTION
[0024]Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art of the invention. All patents and published lectures cited herein are incorporated by reference in their entirety.
[0025]The vaccine according to the present invention comprises a combination of at least two fragments of recombinant subunit Pasteurella multocida toxins (rsPMT) each having an amino acid sequence that substantially corresponds to the 2-486, 486-986 or 986-1281 amino acid residues in SEQ ID No: 2. The fragments of rsPMT may be expressed in prokaryotic or eukaryotic host cell transformed with a plasmid comprising the coding sequence of the Pasteurella multocida toxin fragments.
[0026]As used herein, a combination refers to any association between or among two or more elements.
[0027]As used herein, production by recombinant DNA technique by using recombinant DNA methods means the use of the well-known methods of molecular biology for expressing proteins encoded by cloned DNA.
[0028]As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. In general, expression vectors are in the form of "plasmid", which are generally circular double stranded DNA loops that are not bound to the chromosome.
[0029]As used herein, "amino acid residue" refers to an amino acid formed upon chemical digestion (hydrolysis) of a polypeptide at its peptide linkages.
[0030]The amino acid sequence that "substantially corresponds to" means with homology of about greater than or equal to 80%, 85%, 90%, 95% or 99% sequence homology; the precise percentage can be specified if necessary.
[0031]Examples of conventional adjuvant used in the present vaccine formulations include Aluminum compounds, also known as aluminum gel, such as aluminum hydroxide, Al(OH).sub.3 and aluminum phosphate, AlPO.sub.4; potassium aluminum sulfate, KAI(SO.sub.4).sub.2.12H.sub.2O (D.E.S. Stewart-Tull (1996), Aluminum adjuvants. In Vaccine protocols, Robinson, A., G. H., and C. N. Wiblin, Farrar Human Press. Totoga, N.J., USA. pp. 135-139); Freund's complete adjuvant, FCA; Freund's incomplete adjuvant, FIA; water-in-oil, W/O emulsion; oil-in-water, O/W emulsion and the like.
[0032]Concanavalin A, Con A is an effective immunostimulant which activating T cells. The proliferative responses of T lymphocytes secrete IL-2 and other cytokines for promoting the associated immune responses.
EXAMPLES
[0033]Other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments. These examples are given for illustration of the invention and are not intended to be limiting thereof.
Example 1
Construction of Derivative Clones of PMT
[0034]Pasteurella multocida PMD 48 is a type D toxigenic isolate obtained from a pig affected by a typical case of PAR in Taiwan (Liao C M et al. 2002; Taiwan Vet J 28(4):281-293.). P. multocida PMD 48 was cultured in Brain Heart Infusion (BHI) broth (Difco) for authentic Pasteurella multocida toxin preparation and genomic DNA extraction. The E. coli BL21 (DE3) strain (Novagen) was cultured in Luria-Bertain (LB) medium for cloning and protein expression. The PMT protein coding sequences were cloned into the T7 promoter-based pET expression vectors (Novagen). Restriction enzymes and T4 DNA ligase were purchased from New England Biolabs.
[0035]A full-length PMT gene product was created by polymerase chain reaction (PCR) using PMT-specific primers (forward: 5' AGAGGTTATGGATCCGAAAACAAAACATTTT3', SEQ ID NO: 3; reverse: 5' CTCTTGTTAAGCTAGCCTTTGTGAAAAGAGGAG3', SEQ ID NO: 10). The full-length gene product was purified and then digested with appropriate combinations of restriction enzymes to produce three different coding regions of the PMT gene. The 1459 bp BamHI/HindIII fragment encoding N-terminal amino acids 1-487 of PMT was cloned into pET32b to generate the Tox1 clone. The 1508 bp HindIII/HindIII fragment encoding the middle region (aa 485 to 987) of PMT was cloned into pET32a to generate the Tox2 clone. The 891 bp HindIII/NheI fragment encoding the C-terminal region (aa 986 to 1282) of PMT was cloned into pET25b and followed by subcloning the BamHI/BlpI fragment into pET32b to generate the C-terminal Tox7 clone. Recombinant expression plasmids Tox1, Tox2, and Tox7 were transformed into E. coli BL21 (DE3) according to the manufacturer's manual. The rsPMT expression was induced with 1 mM Isopropyl-.beta.-D-thiogalactopyranoside (IPTG; Protech), and rsPMT was purified using the His Bind.RTM. Kits (Novagen, Darmstadt, Germany) according to the manufacturer's manual. The protein concentration was quantified using the Bio-Rad Protein Assay reagent (BIO-RAD, Hercules, Calif.). Authentic PMT was prepared from P. multocida PMD 48 cultured in BHI medium at 37.degree. C. for 26 h as previously described (Nakai T et al. 1984; Infect Immun 46(2):429-434). The authentic PMT was detoxified with 0.3% (v/v) formalin (Fisher) at 37.degree. C. with shaking for 48 h to generate PMT toxoid.
Example 2
Expression and Purification of rsPMT
[0036]The rsPMTs were expressed as fusion proteins containing an N-terminal fusion peptide. Plasmids Tox1, Tox2, Tox6 and Tox7 were transformed into competent E. coli BL21 (DE3) cells according to the manufacturer's instructions. A single colony of each transformant was grown at 37.degree. C. in Luria-Bertain (LB) medium containing 100 .mu.g/ml ampicillin until the OD.sub.600 reached 1.0. Isopropyl-.beta.-D-thiogalactopyranoside (IPTG) was then added to a final concentration of 1 mM. The culture was incubated for an additional 6 hr at 37.degree. C. The cells were harvested by centrifugation and resuspended in phosphate buffered saline (PBS) with 0.1% Triton X-100. Cells were broken by sonication and the suspension were mixed with an equal volume of 2.times.SDS-PAGE sample buffer (125 mM Tis-HCl [pH 6.8], 20% glycerol, 4% SDS, 10% .beta.-mercaptoethanol, 0.25% bromophenol blue) and the proteins were separated by SDS-PAGE. Native PMT was prepared from R multocida PMD 48 cultured in BHI medium at 37.degree. C. for 26 hr as previously described in the report of Nakai T et al. After cells were broken, the insoluble fractions containing rsPMTs were harvest by the centrifugation. The insoluble fractions were dissolved in solubilization buffer (50 mM CAPS, 0.3% N-lauroylsarcosine, 1 mM DTT; Novagen, Darmstadt, Germany) and incubated at room temperature for 15 min. After centrifugation, supernatant containing the solubilized protein was transferred to a clean tube for further recombinant protein purification. The rsPMT was purified using the H is Binds Kits (Novagen, Darmstadt, Germany) according to the manufacturer's manual, followed by refolding in 10-fold volumes of PBS at 4.degree. C. overnight. After concentrated with Amicon.RTM. Ultra 30,000 MWCO (Millipore, Bedford, USA), the protein concentration was quantified using the Bio-Rad Protein Assay reagent (BIO-RAD, Hercules, Calif.).
[0037]Three recombinant subunit PMT proteins representing the N-terminal (Tox1; aa 1 to 487), the middle (Tox2; aa 485 to 987), and C-terminal (Tox7; aa 98.6 to 1282) regions of PMT, respectively, were successfully produced in E. coli. The molecular weight of Tox1, Tox2, and Tox7 on 10% SDS-PAGE was 86, 86, and 55.4 kDa, respectively (FIG. 2). The expression efficiencies of rsPMT proteins ranged from 28-35% of the total cellular protein (data not shown). The expression of rsPMT was remarkably increased up to 60 fold in the total cellular proteins. These results suggest that, as compared with production of native PMT, sufficient quantities of rsPMT proteins could be obtained to significantly decrease the costs of vaccine preparation.
Example 3
Cytotoxicity Assay of rsPMT in Mice
[0038]African green monkey kidney cells (Vero, ATCC CCL-81) were obtained from Food Industry Research and Development of Taiwan, R.O.C. and cultured in DMEM supplemented with 2 mM L-glutamine, 1.5 g/l sodium bicarbonate, 0.1 mM sodium pyruvate and 5% fetal calf serum (FCS, Gibco/BRL). Vero cells were seeded into the wells of 96-well plates (Costar) at a density of 5.times.10.sup.4 cells per well and the plates were incubated at 37 C overnight. Serial dilutions of rsPMT or native PMT proteins were added to the cell monolayers and the cells were incubated in DMEM containing 2% FCS at 37.degree. C. for 5-7 days. Cytopathic effects consisting of nodular formation in the monolayer were visualized by phase-contrast microscope (Olympus IX-70) and the minimal toxic dose (MTD) was calculated for each rsPMT and the native PMT. All of the rsPMT were non-cytotoxic (FIG. 3), even at dosages as high as 1.5 mg/ml. In contrast, the minimal toxic dose (MTD) of native PMT was 140 ng/ml, which was at least 10000-fold more toxic to Vero cells than any of the rsPMT proteins.
[0039]LD.sub.50 in mice. Fifty SPF BALB/c mice were randomly grouped and each mouse was inoculated via intraperitoneal (i.p.) injection with 0.5 ml of a suspension containing a selected concentration of rsPMT or native PMT at six-week-old. These mice were observed for 14 days after inoculation and mortality was recorded. The LD.sub.50 was determined by the 50% end-point method of Behrens-Karber. Mice inoculated with native PMT demonstrated rough hair coat, anorexia and reluctance to move. These animals huddled in the corners of cages and died within 2-3 days. Lesions at necropsy included congestion or hyperemia of organs and atrophy of spleen. The LD.sub.50 of native PMT in BALB/c mouse was 1.30 .mu.g. In contrast, no significant clinical symptoms, gross lesions or other pathological findings were observed in mice receiving doses as high as 1 mg of rsPMT proteins (Table 1).
TABLE-US-00001 TABLE 1 The expression efficiency of native and recombinant subunit PMT, and their 50% lethal dose (LD.sub.50) in BALB/c mouse Recombinant subunit PMT Native Tox1 Tox2 Tox6 Tox7 PMT Recombinant protein/ 28.2 .+-. 5.07 35.8 .+-. 6.88 4.1 .+-. 0.41 32.1 .+-. 6.92 0.6 .+-. 0.15 total cellular protein (%).sup.a LD.sub.50 (.mu.g/0.5 ml).sup.b >1000 >1000 ND >1000 1.30 .sup.aThe expression efficacy was analyzed with AlphaImager .TM. 2200 image system. .sup.bLD.sub.50 was presented as the protein concentration needed to kill 50% of mice.
Example 4
Immunoprotective Properties of the rsPMT Proteins in Mice ELISPOT of Antibody Secreting Cells
[0040]A suspension of mouse spleen MNCs was assayed for PMT-specific ASCs by the enzyme-linked immunospot (ELISPOT) assay. The 96-well nitrocellulose bottomed plates (Millititer H A, Millipore Corp) were coated with rsPMT (100 ng/ml) and incubated at 4 C overnight. The plate was washed with PBS containing 0.05% Tween-20 (PBS-T) and blocked with PBS containing 0.5% bovine serum albumin. Following incubation at 37 C for 1 hr, the plate was washed once with PBS-T and incubated with serial dilutions of a suspension of MNCs. Cells were incubated at 37 C in an atmosphere containing 5% CO.sub.2 for a further 6 hr. The plate was washed once with PBS-T, followed by reacting with. PBS-diluted alkaline phosphatase-conjugated goat anti-mouse IgG at 37 C for 1 hr. Finally, the plate was washed six times with PBS-T, and reacted with a chromogen/substrate solution NBT/BCIP (Sigma) at room temperature for 15 to 20 min. After rinsing with deionized water, the color spots present on each well were visualized and quantified with stereomicroscope.
[0041]The mouse spleens were markedly enlarged following the second immunization. Two weeks following challenge with native PMT, the spleens from Tox1- and Tox2-immunized mice began to atrophy, but all of the mice survived. The greatest numbers of ASCs were detected in the Tox2-immunized mice possessing 2993.33.+-.200.33 ASCs specific to PMT in 10.sup.6 MNCs. The lowest amount of ASCs (1386.67.+-.477.21 in 10.sup.6 MNCs) was detected in the PMT toxoid-immunized mice. Except Tox2-immunized mice, there was no significant difference among the Tox1-, Tox7- and toxoid-immunized mice (p<0.05). The ASCs of immunized mice increased significantly in every group after challenge with native PMT (p.ltoreq.0.001) (FIG. 3). The Tox1-immunized mice demonstrated the greatest increase in the number of ASCs with 10233.33.+-.850.49 in 1.06 MNCs (FIG. 3).
Cellular Response of Immunized Mice
[0042]Anti-PMT cellular immune response of mice was analyzed by a lymphocyte proliferation assay. The mean stimulation indices of Tox1-, Tox2-, Tox7-, and toxoid-vaccinated mice were 2.11.+-.0.27, 3.31.+-.0.95, 2.31.+-.0.26, and 6.02.+-.0.68, respectively. After challenge with native PMT, only the cells isolated from Tox7- and toxoid-immunized mice could be stimulated with native PMT in vitro. The results implied that mice vaccinated with rsPMT proteins could mount a specific cellular response against PMT (SI>2), but the response might be inhibited by exposure to native PMT (Table 2).
TABLE-US-00002 TABLE 2 Lymphocyte proliferation assay of immunized mice at 14 days post booster vaccination and lethal dose of native PMT challenge Grouping Booster vaccination (n = 3) PMT Challenge (n = 3) Mock 0.99 .+-. 0.26 1.66 .+-. 0.49 Tox1 2.11 .+-. 0.27 1.06 .+-. 0.49 Tox2 3.31 .+-. 0.95 0.96 .+-. 0.19 Tox7 2.31 .+-. 0.26 2.8 .+-. 0.37 Toxoid 6.02 .+-. 0.68 8.07 .+-. 4.13
Data were Expressed as the Stimulation Index (SI).
[0043]SI=cpm in antigen stimulated cultures/cpm in unstimulated cultures. An SI value greater than 2 was regarded as positive (van Diemen et al., 1994)
Example 5
Protection Efficacy of rsPMT Vaccine in Pigs
Antibody Responses in Immunized Piglets
[0044]The antigenicity of the rsPMT products was tested in 4-week-old piglets by analyzing the level of PMT-specific antibody secreting cells and titers of neutralizing antibodies after immunization, PMT challenge, or homologous antigen booster. The spleen and pulmonary lymph node antibody secreting cells were quantified by ELISPOT assay. Each staining spot represented one PMT-specific ASC, and total color spots were quantified. Only a few PMT-specific ASCs were detected at 14 days after booster vaccination in each vaccinated group. The greatest number of PMT-specific ASCs in the spleen was detected in Tox7-immunized piglets that had 11.5.+-.0.7 ASCs per 106 MNCs (see, FIG. 4B), and the greatest number of PMT-specific ASCs in lymph nodes was shown in the Tox1 group (FIG. 4A). The amounts of ASCs increased slightly at 4 weeks after authentic PMT challenge, but increased dramatically in the group booster with homologous antigen. The Tox1-immunized piglets demonstrated the greatest increase in ASCs with 493.3.+-.138.7 per 10.sup.6 MNCs in pulmonary lymph node and Tox7-immunized piglets possessed the greatest increase in ASCs with 440.+-.104.4 per 10.sup.6 MNCs in spleen MNCs after antigen booster (showed in FIG. 4).
[0045]Furthermore, the PMT-specific neutralizing antibody titer was determined as its ability to inhibit the cytopathic effects induced by PMT in Vero cells. After booster vaccination, moderate levels of neutralizing antibody titer (.gtoreq.1:16) were detected in Tox1- and Tox7-immunized pigs, and a low level of neutralizing antibody titer (1:4) was detected in Tox2 group. The neutralizing antibody titers increased significantly after PMT challenge or booster with homologous rsPMT antigen, but not in the PMT toxoid vaccinated group. The Tox1 immunized pigs could generate the highest neutralizing antibody titers in every assay point and the Tox7-immunized pigs were the next. There was no detectable neutralizing antibody in unvaccinated pigs. In summary, after PMT challenge or homologous antigen booster, the neutralizing antibody titers in recombinant subunit PMT immunized pigs could reach 1:32 to 1:512, but only 1:8 in PMT toxoid immunized pigs (FIG. 5).
Cellular Immune Response in Immunized Piglets
[0046]The specific cellular immune response to each recombinant subunit PMT was analyzed by the lymphocyte proliferation assay. Lymphocyte proliferation was measured and presented as the stimulation index (SI). After booster vaccination, a PMT-specific lymphocytes proliferation in spleen was observed in Tox2- and Tox7-vaccinated pigs as indicated with a SI greater than 2, while no response was detected in pulmonary lymph node. After PMT challenge or homologous antigen booster, the spleen MNCs from each rsPMT or toxoid immunized group all demonstrated significant enhancement of lymphocyte proliferation (Table 3). Except for Tox1-immunized pigs, the pulmonary lymph node MNCs in each group also showed specific proliferation response after homologous antigen booster.
TABLE-US-00003 TABLE 3 PMT-specific proliferation of lymphocytes in MNCs from pulmonary lymph nodes (PLN) and spleen isolated from immunized piglets after booster vaccination, challenged with PMT, and boosted with homologous antigen Homologous Group PMT antigen (Vaccination Vaccination challenge booster antigen) PLN Spleen PLN Spleen PLN Spleen Tox1 1.1 1.0 1.2 5.6 1.8 4.8 Tox2 1.2 4.0 1.9 4.9 3.1 5.1 Tox7 1.4 3.4 1.4 3.5 4.2 4.6 Toxoid 1.5 1.8 1.0 6.9 4.0 5.6
Data are average of the stimulation index (SI) of PMT-specific lymphocyte proliferation form three pigs at each time point. The SI was calculated as described in Materials and Methods, and SI>2 represent lymphocyte proliferation.Protection Efficacy of rsPMT Vaccine in Piglet
[0047]To evaluate the protection efficacy of these rsPMTs in newborn piglets, immunization of the pregnant sows with rsPMTs mixture with or without P. multocida type A bacterin and a conventional PAR-toxoid vaccine were applied for comparison. The neutralizing antibody titers in sows' colostrum were assayed at parturition and the maternal neutralizing antibody titers in sera from offspring were analyzed at one-day of age. Pregnant sows vaccinated with rsPMTs then given (group A) or not given (group B) an injection of P. multocida type A bacterin could mount a significant response with high neutralizing antibody titers in colostrum (.gtoreq.1:80) that could be transferred successfully to newborn piglets (Table 4). Immunized sows in group A demonstrated a higher antibody response than those in group B. By contrast, the conventional PAR-toxoid vaccine (group C) induced a medium level of neutralizing antibody leading to low antibody titers in their offspring (1:8). Only basal levels of neutralizing antibody titer (.ltoreq.1:4) were detected in the control animals (group D). In addition, ten offspring from each group at 14-day-old were challenged by intramuscular injection with 200 .mu.g/kg (5-fold lethal dose) of authentic PMT. The death of piglets was observed as early as 24 h post-inoculation in groups C and D, but not until 4th days post-inoculation in groups A and B. The survival rates of offspring from groups C and D were 0% but reached 60% in groups A and B at 28-days of age (Table 4).
TABLE-US-00004 TABLE 4 Neutralizing antibody titers of immunized sows and their offspring, and the survival rate of offspring after challenged with a 5-fold lethal dose (200 .mu.g/kg) of authentic PMT at 14-day-old Mean neutralizing antibody titer Vaccine Sows Newborn Piglets Survival Group composition Colostrums 1-day-old 28-day-old rate.sup.a A rsPMTs + 1:101 1:102 1:2 60% P. multocida bacterin B rsPMTs 1:80 1:79 1:2 60% C Conventional 1:39 1:8 ND.sup.b 0% AR-toxoid vaccine D Unvaccinated 1:4 1:2 ND.sup.b 0% .sup.aSurvival rate was calculated at 28-day-old. .sup.bNot determined, all piglets were dead within 24 h after PMT challenge.
[0048]Furthermore, another twenty offspring from each group were tested for weight gain. Half of the piglets in each group were challenged with 30 .mu.g/kg (sublethal dose) of authentic PMT via intramuscular injection at 14-days of age, and the remaining half were untreated. The mean body weight gain of piglets was recorded at 14 days post-inoculation. There was no significant difference among the piglets from three vaccination groups, either challenged or unchallenged, but a significant reduction in weight gain (p<0.05) was observed among piglets in the control group D that were challenged with authentic PMT compared with their unchallenged cohort (Table 5). In the nasal conchal gross examination, there were low levels of turbinate atrophy with scores ranged from 0.1 to 0.3 in the piglets from sows vaccinated with rsPMTs, even after these piglets were challenged with authentic PMT. In contrast, after authentic PMT challenge, piglets from the conventional AR-toxoid vaccinated and unvaccinated sows showed mild to severe turbinate atrophy with average scores of 1.4 and 3.4, respectively (see, Table 5; and FIG. 6), which were significantly different from rsPMTs vaccinated groups (p<0.05).
TABLE-US-00005 TABLE 5 Mean weight gain and turbinate conchal score of the offspring piglets after 2 weeks challenged with subleathal dose (30 .mu.g/kg) of authentic PMT Mean weight gain of Mean score of piglets (mean .+-. SD) turbinate conchal (kg) atrophy.sup.a Sows Vaccine Unchal- Unchal- group composition lenged Challenged lenged Challenged A rsPMTs + 3.9 .+-. 0.8 3.5 .+-. 0.4 0.1 0.2 P. multocida bacterin B rsPMTs 5.0 .+-. 0.6 4.5 .+-. 1.3 0.2 0.3 C Conventional 4.4 .+-. 1.0 3.5 .+-. 0.9 0.2 1.4.sup.# AR-toxoid vaccine D Unvaccinated 5.2 .+-. 0.3 3.5 .+-. 0.8* 0.2 3.4.sup.# .sup.aThe degrees of turbinate conchal atrophy were ranged from 0 (normal) to 4 (complete atrophy) *The mean daily weight gain in control group differs significantly (t-test, p < 0.05) .sup.#The mean score of turbinate conchal atrophy in control group differs significantly (t-test, p < 0.05)
[0049]There was no significant difference in weight-gain between the toxin-challenged and unchallenged subgroups, but piglets from unvaccinated sows showed poorer growth performance after PMT challenge than those unchallenged (p<0.05). In addition, piglets from sows vaccinated with rsPMTs mixture with or without P. multocida type A bacterin exhibited low level of turbinate conchal atrophy after challenged with authentic PMT. In contrast, piglets from the conventional PAR-toxoid vaccinated and unvaccinated sows showed significant atrophy of turbinate conchae. These results indicated that an effective vaccination of sows during pregnancy could protect offspring against PAR.
[0050]In conclusion, vaccination with the short fragments of recombinant subunit PMT proteins resulted in high levels of neutralizing antibody and a specific cellular immune response against PMT in swine. Immunization of sows with recombinant subunit PMT vaccine during pregnancy is safe and able to elicit levels of neutralizing antibodies in colostrum that could protect their offspring against PMT. These non-toxic recombinant subunit PMT proteins hold great potential as suitable antigens in developing an effective subunit vaccine against PAR.
Example 6
Preparation and Immunogenicity Test of the Bivalent Vaccine (PAR-Ps) Against Progressive Atrophic Rhinitis and Pseudorabies
[0051]The PAR vaccine (comprising 2.1 mg PMT recombinant subunit proteins, each 0.7 mg, 1.times.10.sup.9 CFU of inactivated P. multocida serotype A, and 1.times.10.sup.9 CFU of inactivated P. multocida serotype D) was mixed with inactivated gE-deleted pseudorabies virus (10.sup.8 TCID.sub.50), and then the sterile oily adjuvant (W/O/W type) or aluminum gel was added to the mixture to form a PAR-PR bivalent vaccine formulation of 2-ml and 4-ml dosage.
Immunoprotection of PAR-PR bivalent Vaccine in Pregnant Sows
[0052]The pregnant sows were immunized by intramuscularly injecting with the PAR-PR bivalent vaccine formulation comprising aluminum gel or oily adjuvant in 2-ml and 4-ml dosage respectively and collected blood samples for the detection of PMT- and PR-specific serum neutralizing antibody titers. As showed in FIGS. 7 and 8, the average PMT and PR neutralizing antibody titers observed in sows immunized with the 2-ml dosed aluminum gel containing bivalent vaccine were 8.8.4- and 90.4-folds respectively, and of 75.2 and 99.2-folds observed in the 4-ml dosage treated sows. Of the observation in oily adjuvant containing bivalent vaccine treated animals, the average PMT and PR neutralizing antibody titers detected were 88.8- and 92.8-folds in 2-ml dosage groups, respectively. In 4-ml dosage groups, the average PMT neutralizing antibody titer detected was 101.2-folds and the RP neutralizing antibody titer was 110.5-folds.
Sequence CWU
1
1314380DNAPasteurella multocidaCDS(219)..(4076) 1aacaagggaa aatagctaga
ttagacgata tcgataatat cataaataat atttaaaaat 60tacgcccctt gacctagagg
ggctttttta ttacatcaaa aaaataaacc caaacactgc 120gaatgtttgg ggttttattt
ataaccaaaa tacattaata tgtttattaa gtaagcatta 180tcttacttta ggaataaact
aacatagagg ttatggat atg aaa aca aaa cat ttt 236Met Lys Thr Lys His
Phe1 5ttt aac tca gat ttt act gta aaa gga aaa agt gcc gat
gaa att ttt 284Phe Asn Ser Asp Phe Thr Val Lys Gly Lys Ser Ala Asp
Glu Ile Phe10 15 20aga aga ttg tgt act
gat cat cct gac aag caa tta aac aat gta aaa 332Arg Arg Leu Cys Thr
Asp His Pro Asp Lys Gln Leu Asn Asn Val Lys25 30
35tgg aaa gaa gtt ttt att aat cgt ttt ggt cag atg atg cta gat
act 380Trp Lys Glu Val Phe Ile Asn Arg Phe Gly Gln Met Met Leu Asp
Thr40 45 50cct aat ccg aga aag att gta
gaa aaa att att aat gaa ggg ctt gaa 428Pro Asn Pro Arg Lys Ile Val
Glu Lys Ile Ile Asn Glu Gly Leu Glu55 60
65 70aaa caa ggc ctg aaa aat ata gat cct gaa act aca
tat ttc aac att 476Lys Gln Gly Leu Lys Asn Ile Asp Pro Glu Thr Thr
Tyr Phe Asn Ile75 80 85ttt tca tct tct
gac agc tcc gat ggg aac gtt ttt cat tat aac tct 524Phe Ser Ser Ser
Asp Ser Ser Asp Gly Asn Val Phe His Tyr Asn Ser90 95
100tta tca gaa tcc tat cga gtt act gat gcc tgc cta atg aat
att ttt 572Leu Ser Glu Ser Tyr Arg Val Thr Asp Ala Cys Leu Met Asn
Ile Phe105 110 115gtg gag cgt tat ttt gat
gat tgg gac ttg cta aat agc tta gcc agt 620Val Glu Arg Tyr Phe Asp
Asp Trp Asp Leu Leu Asn Ser Leu Ala Ser120 125
130aat gga ata tat tca gta gga aaa gaa gga gct tat tat cct gat cat
668Asn Gly Ile Tyr Ser Val Gly Lys Glu Gly Ala Tyr Tyr Pro Asp His135
140 145 150gat tat ggt cca
gaa tat aac cct gtt tgg gga cca aac gaa caa att 716Asp Tyr Gly Pro
Glu Tyr Asn Pro Val Trp Gly Pro Asn Glu Gln Ile155 160
165tac cat tct aga gtg att gca gat atc ctt tat gct cgc tcc
gta tgg 764Tyr His Ser Arg Val Ile Ala Asp Ile Leu Tyr Ala Arg Ser
Val Trp170 175 180gat gaa ttt aaa aaa tac
ttc atg gag tat tgg caa aaa tat gct cag 812Asp Glu Phe Lys Lys Tyr
Phe Met Glu Tyr Trp Gln Lys Tyr Ala Gln185 190
195ctt tat acc gaa atg tta tct gat aca ttt ctt gca atg gct att cag
860Leu Tyr Thr Glu Met Leu Ser Asp Thr Phe Leu Ala Met Ala Ile Gln200
205 210caa tat aca cga caa acg ctt act gat
gaa ggc ttt ctt atg gtt tgt 908Gln Tyr Thr Arg Gln Thr Leu Thr Asp
Glu Gly Phe Leu Met Val Cys215 220 225
230aac aca tat tat ggc aat aag gaa gaa gtt caa ata act cta
cta gat 956Asn Thr Tyr Tyr Gly Asn Lys Glu Glu Val Gln Ile Thr Leu
Leu Asp235 240 245atc tat gga tac cct tcc
act gat ata att tgt ata gag caa aaa ggg 1004Ile Tyr Gly Tyr Pro Ser
Thr Asp Ile Ile Cys Ile Glu Gln Lys Gly250 255
260ctt cct act cct aaa gtg ata ctt tac att cct gga gga aca caa cca
1052Leu Pro Thr Pro Lys Val Ile Leu Tyr Ile Pro Gly Gly Thr Gln Pro265
270 275ttt gtt gaa ttt ctt aat aca gat gat
ctg aaa caa tgg att gca tgg 1100Phe Val Glu Phe Leu Asn Thr Asp Asp
Leu Lys Gln Trp Ile Ala Trp280 285 290cat
tta aaa gat aac aaa cat atg gtc cga ttc cgc aaa cat ttc tcg 1148His
Leu Lys Asp Asn Lys His Met Val Arg Phe Arg Lys His Phe Ser295
300 305 310cta aaa caa cgt cag gaa
gga gaa acg ttt aca ggt ata gat aaa gca 1196Leu Lys Gln Arg Gln Glu
Gly Glu Thr Phe Thr Gly Ile Asp Lys Ala315 320
325ctt caa tat att gca gaa gag tcc cct gaa tgg cct gcc aat aaa tac
1244Leu Gln Tyr Ile Ala Glu Glu Ser Pro Glu Trp Pro Ala Asn Lys Tyr330
335 340atc ctt tat aat ccg aca cat tta gaa
aca gaa aat tta ttt aac atc 1292Ile Leu Tyr Asn Pro Thr His Leu Glu
Thr Glu Asn Leu Phe Asn Ile345 350 355atg
atg aag cga aca gaa cag cgg atg ctt gaa gat agt gat gta cag 1340Met
Met Lys Arg Thr Glu Gln Arg Met Leu Glu Asp Ser Asp Val Gln360
365 370att aga tca aat tca gaa gct acc cgt gac tat
gct ctt tca tta ctc 1388Ile Arg Ser Asn Ser Glu Ala Thr Arg Asp Tyr
Ala Leu Ser Leu Leu375 380 385
390gaa acc ttt att tca cag tta tct gca ata gat atg tta gta cca gca
1436Glu Thr Phe Ile Ser Gln Leu Ser Ala Ile Asp Met Leu Val Pro Ala395
400 405gta ggt atc cca att aat ttt gcc cta
tca gct aca gca tta gga ctt 1484Val Gly Ile Pro Ile Asn Phe Ala Leu
Ser Ala Thr Ala Leu Gly Leu410 415 420agc
tcg gat att gta gtt aat gga gat tca tat gaa aag aga aaa tat 1532Ser
Ser Asp Ile Val Val Asn Gly Asp Ser Tyr Glu Lys Arg Lys Tyr425
430 435gga att ggg tcc tta gtg caa tct gca tta ttc
aca gga att aat ctt 1580Gly Ile Gly Ser Leu Val Gln Ser Ala Leu Phe
Thr Gly Ile Asn Leu440 445 450att cca gtt
att tcg gaa acc gca gaa att tta tct tct ttc tct aga 1628Ile Pro Val
Ile Ser Glu Thr Ala Glu Ile Leu Ser Ser Phe Ser Arg455
460 465 470aca gaa gaa gat att cca gct
ttt ttc act gaa gaa caa gct tta gct 1676Thr Glu Glu Asp Ile Pro Ala
Phe Phe Thr Glu Glu Gln Ala Leu Ala475 480
485caa cgc ttt gaa ata gta gaa gaa gaa tta cat tct atc tca cct gat
1724Gln Arg Phe Glu Ile Val Glu Glu Glu Leu His Ser Ile Ser Pro Asp490
495 500gat cct cct cga gaa att act gac gaa
aat tta cat aaa att cgt ctg 1772Asp Pro Pro Arg Glu Ile Thr Asp Glu
Asn Leu His Lys Ile Arg Leu505 510 515gta
cgt ctt aac aat gaa aat caa cct tta gtt gtg tta cga aga tta 1820Val
Arg Leu Asn Asn Glu Asn Gln Pro Leu Val Val Leu Arg Arg Leu520
525 530gga gga aat aaa ttt atc aga atc gag cct ata
aca ttc cag gaa ata 1868Gly Gly Asn Lys Phe Ile Arg Ile Glu Pro Ile
Thr Phe Gln Glu Ile535 540 545
550aaa ggt tct tta gta agt gaa gtt ata aat cca gtg act aat aaa acg
1916Lys Gly Ser Leu Val Ser Glu Val Ile Asn Pro Val Thr Asn Lys Thr555
560 565tac tac gta agc aat gct aaa cta tta
ggg ggc tct cct tat agt cct 1964Tyr Tyr Val Ser Asn Ala Lys Leu Leu
Gly Gly Ser Pro Tyr Ser Pro570 575 580ttc
cgt att gga tta gaa ggt gtt tgg aca cca gag gta tta aaa gca 2012Phe
Arg Ile Gly Leu Glu Gly Val Trp Thr Pro Glu Val Leu Lys Ala585
590 595aga gct tcc gtt att gga aag cct att gga gaa
tca tat aaa aga ata 2060Arg Ala Ser Val Ile Gly Lys Pro Ile Gly Glu
Ser Tyr Lys Arg Ile600 605 610tta gcc aaa
cta caa aga ata cat aac agt aat atc tta gat gag cga 2108Leu Ala Lys
Leu Gln Arg Ile His Asn Ser Asn Ile Leu Asp Glu Arg615
620 625 630caa ggt tta atg cat gaa ctc
atg gag ctt att gat ctt tat gaa gaa 2156Gln Gly Leu Met His Glu Leu
Met Glu Leu Ile Asp Leu Tyr Glu Glu635 640
645tcg caa cct tct tca gag cgt ttg aat gct ttt cgt gaa ctg cgt act
2204Ser Gln Pro Ser Ser Glu Arg Leu Asn Ala Phe Arg Glu Leu Arg Thr650
655 660caa tta gaa aaa gcg ctt tat ctt cct
gaa atg gaa gca tta aaa aaa 2252Gln Leu Glu Lys Ala Leu Tyr Leu Pro
Glu Met Glu Ala Leu Lys Lys665 670 675caa
ata cta cag att cct aac aaa ggt tct ggt gcc gct cga ttt tta 2300Gln
Ile Leu Gln Ile Pro Asn Lys Gly Ser Gly Ala Ala Arg Phe Leu680
685 690ctt cgt aca gcc atg aat gaa atg gct gga aaa
acc agt gaa agc acg 2348Leu Arg Thr Ala Met Asn Glu Met Ala Gly Lys
Thr Ser Glu Ser Thr695 700 705
710gct gat tta ata cgc ttt gcc ttg caa gat aca gta att tca gcg cct
2396Ala Asp Leu Ile Arg Phe Ala Leu Gln Asp Thr Val Ile Ser Ala Pro715
720 725ttt cgc gga tat gct ggt gcg att cca
gag gca ata gac ttt cct gta 2444Phe Arg Gly Tyr Ala Gly Ala Ile Pro
Glu Ala Ile Asp Phe Pro Val730 735 740aaa
tat gta ata gaa gac ata tct gta ttt gat aaa ata cag aca aat 2492Lys
Tyr Val Ile Glu Asp Ile Ser Val Phe Asp Lys Ile Gln Thr Asn745
750 755tac tgg gaa ctt cct gct tat gaa agc tgg aac
gaa gga agt aat agc 2540Tyr Trp Glu Leu Pro Ala Tyr Glu Ser Trp Asn
Glu Gly Ser Asn Ser760 765 770cga tta ctg
cct ggt ttg tta cgt gaa tcg caa agc aag ggg atg tta 2588Arg Leu Leu
Pro Gly Leu Leu Arg Glu Ser Gln Ser Lys Gly Met Leu775
780 785 790agt aag tgt cgt atc ata gaa
aat agc ctt tat att gga cat agc tat 2636Ser Lys Cys Arg Ile Ile Glu
Asn Ser Leu Tyr Ile Gly His Ser Tyr795 800
805gaa gaa atg ttt tac agc att tct cca tat tca aac cag gtt gga ggg
2684Glu Glu Met Phe Tyr Ser Ile Ser Pro Tyr Ser Asn Gln Val Gly Gly810
815 820cct tat gaa tta tat cct ttc act ttt
ttc agt atg ctt caa gaa gta 2732Pro Tyr Glu Leu Tyr Pro Phe Thr Phe
Phe Ser Met Leu Gln Glu Val825 830 835caa
ggt gat tta gga ttt gag cag gcc ttt gcc aca cgt aac ttt ttc 2780Gln
Gly Asp Leu Gly Phe Glu Gln Ala Phe Ala Thr Arg Asn Phe Phe840
845 850aat act ctt gtt tct gat cga cta tcc tta atg
gaa aat acg atg tta 2828Asn Thr Leu Val Ser Asp Arg Leu Ser Leu Met
Glu Asn Thr Met Leu855 860 865
870ctt aca gaa agt ttt gat tat aca cct tgg gat gct att tat gga gat
2876Leu Thr Glu Ser Phe Asp Tyr Thr Pro Trp Asp Ala Ile Tyr Gly Asp875
880 885att aat tat gat gaa caa ttt gct gca
atg tct att aat gaa cgc ata 2924Ile Asn Tyr Asp Glu Gln Phe Ala Ala
Met Ser Ile Asn Glu Arg Ile890 895 900gaa
aaa tgt atg aat acc tat aga ggt gtg gca ttc caa aac tct tca 2972Glu
Lys Cys Met Asn Thr Tyr Arg Gly Val Ala Phe Gln Asn Ser Ser905
910 915aaa agt att gac ttt ttc cta aat aat cta acc
aca ttc att gat aat 3020Lys Ser Ile Asp Phe Phe Leu Asn Asn Leu Thr
Thr Phe Ile Asp Asn920 925 930gga cta acc
gaa att gct ata tct gat tta ccg tat gat att gtg caa 3068Gly Leu Thr
Glu Ile Ala Ile Ser Asp Leu Pro Tyr Asp Ile Val Gln935
940 945 950caa gaa atc tct caa ttc tta
caa gga agt aat gaa tgg aaa aca ctt 3116Gln Glu Ile Ser Gln Phe Leu
Gln Gly Ser Asn Glu Trp Lys Thr Leu955 960
965gat gcc atg tta ttt aac tta gat aaa gga gat att aat ggt gct ttc
3164Asp Ala Met Leu Phe Asn Leu Asp Lys Gly Asp Ile Asn Gly Ala Phe970
975 980aga aag ctt ctg caa tca gca aaa gat
aat aat ata aaa ttt aga gct 3212Arg Lys Leu Leu Gln Ser Ala Lys Asp
Asn Asn Ile Lys Phe Arg Ala985 990 995ata
ggg cat tca gat aat tct gtt ccg cca ttt aat aac cct tat 3257Ile
Gly His Ser Asp Asn Ser Val Pro Pro Phe Asn Asn Pro Tyr1000
1005 1010aag tct tta tat tat aaa gga aat ata ata
gct gaa gca att gaa 3302Lys Ser Leu Tyr Tyr Lys Gly Asn Ile Ile
Ala Glu Ala Ile Glu1015 1020 1025aaa cta
gat cga gaa ggt caa aaa ttt gtt gta ttt gct gat agt 3347Lys Leu
Asp Arg Glu Gly Gln Lys Phe Val Val Phe Ala Asp Ser1030
1035 1040tct ctg ctc aac agc acg cct ggg aca ggt cgt
cct atg cca gga 3392Ser Leu Leu Asn Ser Thr Pro Gly Thr Gly Arg
Pro Met Pro Gly1045 1050 1055cta gtt
caa tat tta aaa ata cca gca act gta gta gat agc gat 3437Leu Val
Gln Tyr Leu Lys Ile Pro Ala Thr Val Val Asp Ser Asp1060
1065 1070ggt gca tgg caa ttt ctt cca gat gta gct tca
agc aga gtt cct 3482Gly Ala Trp Gln Phe Leu Pro Asp Val Ala Ser
Ser Arg Val Pro1075 1080 1085att gaa
gtt aca gag tta gaa aat tgg caa gtc tta act cct cca 3527Ile Glu
Val Thr Glu Leu Glu Asn Trp Gln Val Leu Thr Pro Pro1090
1095 1100caa ggt aag att ctt gga tta aag caa ttt aag
tta acg gca ggt 3572Gln Gly Lys Ile Leu Gly Leu Lys Gln Phe Lys
Leu Thr Ala Gly1105 1110 1115ttt cca
aca gaa caa agt cgc tta cct ctt tta gag aat tcg gtt 3617Phe Pro
Thr Glu Gln Ser Arg Leu Pro Leu Leu Glu Asn Ser Val1120
1125 1130tct gaa gat tta agg gaa gaa tta atg caa aag
att gat gca ata 3662Ser Glu Asp Leu Arg Glu Glu Leu Met Gln Lys
Ile Asp Ala Ile1135 1140 1145aaa aat
gat gtg aaa atg aat agt tta gtg tgt atg gaa gct ggc 3707Lys Asn
Asp Val Lys Met Asn Ser Leu Val Cys Met Glu Ala Gly1150
1155 1160tct tgt gat tca gta agc cct aag gta gct gcc
cgt ctt aaa gat 3752Ser Cys Asp Ser Val Ser Pro Lys Val Ala Ala
Arg Leu Lys Asp1165 1170 1175atg ggg
tta gaa gct ggg atg ggt gct tct att acc tgg tgg aga 3797Met Gly
Leu Glu Ala Gly Met Gly Ala Ser Ile Thr Trp Trp Arg1180
1185 1190cgt gaa ggc ggg atg gaa ttt tca cat cag atg
cat act act gct 3842Arg Glu Gly Gly Met Glu Phe Ser His Gln Met
His Thr Thr Ala1195 1200 1205tcc ttt
aaa ttt gct ggt aaa gag ttt gcc gtg gat gct tca cat 3887Ser Phe
Lys Phe Ala Gly Lys Glu Phe Ala Val Asp Ala Ser His1210
1215 1220tta caa ttt gta cac gac caa tta gat aca act
atc ctg ata cta 3932Leu Gln Phe Val His Asp Gln Leu Asp Thr Thr
Ile Leu Ile Leu1225 1230 1235cct gta
gat gat tgg gct tta gaa ata gct caa aga aat cgg gct 3977Pro Val
Asp Asp Trp Ala Leu Glu Ile Ala Gln Arg Asn Arg Ala1240
1245 1250att aat cct ttt gtg gaa tat gtt agt aaa aca
gga aac atg tta 4022Ile Asn Pro Phe Val Glu Tyr Val Ser Lys Thr
Gly Asn Met Leu1255 1260 1265gca ctc
ttc atg cct cct ctt ttc aca aag cct cgc tta aca aga 4067Ala Leu
Phe Met Pro Pro Leu Phe Thr Lys Pro Arg Leu Thr Arg1270
1275 1280gca cta taa ctaattaaaa actgtattaa agccttatat
tataaggctt 4116Ala Leu1285taattttctt tcaagaatta ttaagtagaa
gaatcaaaat caatgagata gataaaatca 4176aatgttatta ccaatacaac tttcttaagt
atactttttg aattttttgc gttaataaat 4236ttataatacc cttaactcaa taaaagaagt
tattgagaag tttaaatctt gtgagcaaga 4296tgaagatata atttcagcaa tcgatcttat
tagcgcttca tatagaaggg ctgtggatgc 4356agtggaacaa agattcggtt ctag
438021285PRTPasteurella multocida 2Met
Lys Thr Lys His Phe Phe Asn Ser Asp Phe Thr Val Lys Gly Lys1
5 10 15Ser Ala Asp Glu Ile Phe Arg
Arg Leu Cys Thr Asp His Pro Asp Lys20 25
30Gln Leu Asn Asn Val Lys Trp Lys Glu Val Phe Ile Asn Arg Phe Gly35
40 45Gln Met Met Leu Asp Thr Pro Asn Pro Arg
Lys Ile Val Glu Lys Ile50 55 60Ile Asn
Glu Gly Leu Glu Lys Gln Gly Leu Lys Asn Ile Asp Pro Glu65
70 75 80Thr Thr Tyr Phe Asn Ile Phe
Ser Ser Ser Asp Ser Ser Asp Gly Asn85 90
95Val Phe His Tyr Asn Ser Leu Ser Glu Ser Tyr Arg Val Thr Asp Ala100
105 110Cys Leu Met Asn Ile Phe Val Glu Arg
Tyr Phe Asp Asp Trp Asp Leu115 120 125Leu
Asn Ser Leu Ala Ser Asn Gly Ile Tyr Ser Val Gly Lys Glu Gly130
135 140Ala Tyr Tyr Pro Asp His Asp Tyr Gly Pro Glu
Tyr Asn Pro Val Trp145 150 155
160Gly Pro Asn Glu Gln Ile Tyr His Ser Arg Val Ile Ala Asp Ile
Leu165 170 175Tyr Ala Arg Ser Val Trp Asp
Glu Phe Lys Lys Tyr Phe Met Glu Tyr180 185
190Trp Gln Lys Tyr Ala Gln Leu Tyr Thr Glu Met Leu Ser Asp Thr Phe195
200 205Leu Ala Met Ala Ile Gln Gln Tyr Thr
Arg Gln Thr Leu Thr Asp Glu210 215 220Gly
Phe Leu Met Val Cys Asn Thr Tyr Tyr Gly Asn Lys Glu Glu Val225
230 235 240Gln Ile Thr Leu Leu Asp
Ile Tyr Gly Tyr Pro Ser Thr Asp Ile Ile245 250
255Cys Ile Glu Gln Lys Gly Leu Pro Thr Pro Lys Val Ile Leu Tyr
Ile260 265 270Pro Gly Gly Thr Gln Pro Phe
Val Glu Phe Leu Asn Thr Asp Asp Leu275 280
285Lys Gln Trp Ile Ala Trp His Leu Lys Asp Asn Lys His Met Val Arg290
295 300Phe Arg Lys His Phe Ser Leu Lys Gln
Arg Gln Glu Gly Glu Thr Phe305 310 315
320Thr Gly Ile Asp Lys Ala Leu Gln Tyr Ile Ala Glu Glu Ser
Pro Glu325 330 335Trp Pro Ala Asn Lys Tyr
Ile Leu Tyr Asn Pro Thr His Leu Glu Thr340 345
350Glu Asn Leu Phe Asn Ile Met Met Lys Arg Thr Glu Gln Arg Met
Leu355 360 365Glu Asp Ser Asp Val Gln Ile
Arg Ser Asn Ser Glu Ala Thr Arg Asp370 375
380Tyr Ala Leu Ser Leu Leu Glu Thr Phe Ile Ser Gln Leu Ser Ala Ile385
390 395 400Asp Met Leu Val
Pro Ala Val Gly Ile Pro Ile Asn Phe Ala Leu Ser405 410
415Ala Thr Ala Leu Gly Leu Ser Ser Asp Ile Val Val Asn Gly
Asp Ser420 425 430Tyr Glu Lys Arg Lys Tyr
Gly Ile Gly Ser Leu Val Gln Ser Ala Leu435 440
445Phe Thr Gly Ile Asn Leu Ile Pro Val Ile Ser Glu Thr Ala Glu
Ile450 455 460Leu Ser Ser Phe Ser Arg Thr
Glu Glu Asp Ile Pro Ala Phe Phe Thr465 470
475 480Glu Glu Gln Ala Leu Ala Gln Arg Phe Glu Ile Val
Glu Glu Glu Leu485 490 495His Ser Ile Ser
Pro Asp Asp Pro Pro Arg Glu Ile Thr Asp Glu Asn500 505
510Leu His Lys Ile Arg Leu Val Arg Leu Asn Asn Glu Asn Gln
Pro Leu515 520 525Val Val Leu Arg Arg Leu
Gly Gly Asn Lys Phe Ile Arg Ile Glu Pro530 535
540Ile Thr Phe Gln Glu Ile Lys Gly Ser Leu Val Ser Glu Val Ile
Asn545 550 555 560Pro Val
Thr Asn Lys Thr Tyr Tyr Val Ser Asn Ala Lys Leu Leu Gly565
570 575Gly Ser Pro Tyr Ser Pro Phe Arg Ile Gly Leu Glu
Gly Val Trp Thr580 585 590Pro Glu Val Leu
Lys Ala Arg Ala Ser Val Ile Gly Lys Pro Ile Gly595 600
605Glu Ser Tyr Lys Arg Ile Leu Ala Lys Leu Gln Arg Ile His
Asn Ser610 615 620Asn Ile Leu Asp Glu Arg
Gln Gly Leu Met His Glu Leu Met Glu Leu625 630
635 640Ile Asp Leu Tyr Glu Glu Ser Gln Pro Ser Ser
Glu Arg Leu Asn Ala645 650 655Phe Arg Glu
Leu Arg Thr Gln Leu Glu Lys Ala Leu Tyr Leu Pro Glu660
665 670Met Glu Ala Leu Lys Lys Gln Ile Leu Gln Ile Pro
Asn Lys Gly Ser675 680 685Gly Ala Ala Arg
Phe Leu Leu Arg Thr Ala Met Asn Glu Met Ala Gly690 695
700Lys Thr Ser Glu Ser Thr Ala Asp Leu Ile Arg Phe Ala Leu
Gln Asp705 710 715 720Thr
Val Ile Ser Ala Pro Phe Arg Gly Tyr Ala Gly Ala Ile Pro Glu725
730 735Ala Ile Asp Phe Pro Val Lys Tyr Val Ile Glu
Asp Ile Ser Val Phe740 745 750Asp Lys Ile
Gln Thr Asn Tyr Trp Glu Leu Pro Ala Tyr Glu Ser Trp755
760 765Asn Glu Gly Ser Asn Ser Arg Leu Leu Pro Gly Leu
Leu Arg Glu Ser770 775 780Gln Ser Lys Gly
Met Leu Ser Lys Cys Arg Ile Ile Glu Asn Ser Leu785 790
795 800Tyr Ile Gly His Ser Tyr Glu Glu Met
Phe Tyr Ser Ile Ser Pro Tyr805 810 815Ser
Asn Gln Val Gly Gly Pro Tyr Glu Leu Tyr Pro Phe Thr Phe Phe820
825 830Ser Met Leu Gln Glu Val Gln Gly Asp Leu Gly
Phe Glu Gln Ala Phe835 840 845Ala Thr Arg
Asn Phe Phe Asn Thr Leu Val Ser Asp Arg Leu Ser Leu850
855 860Met Glu Asn Thr Met Leu Leu Thr Glu Ser Phe Asp
Tyr Thr Pro Trp865 870 875
880Asp Ala Ile Tyr Gly Asp Ile Asn Tyr Asp Glu Gln Phe Ala Ala Met885
890 895Ser Ile Asn Glu Arg Ile Glu Lys Cys
Met Asn Thr Tyr Arg Gly Val900 905 910Ala
Phe Gln Asn Ser Ser Lys Ser Ile Asp Phe Phe Leu Asn Asn Leu915
920 925Thr Thr Phe Ile Asp Asn Gly Leu Thr Glu Ile
Ala Ile Ser Asp Leu930 935 940Pro Tyr Asp
Ile Val Gln Gln Glu Ile Ser Gln Phe Leu Gln Gly Ser945
950 955 960Asn Glu Trp Lys Thr Leu Asp
Ala Met Leu Phe Asn Leu Asp Lys Gly965 970
975Asp Ile Asn Gly Ala Phe Arg Lys Leu Leu Gln Ser Ala Lys Asp Asn980
985 990Asn Ile Lys Phe Arg Ala Ile Gly His
Ser Asp Asn Ser Val Pro Pro995 1000
1005Phe Asn Asn Pro Tyr Lys Ser Leu Tyr Tyr Lys Gly Asn Ile Ile1010
1015 1020Ala Glu Ala Ile Glu Lys Leu Asp
Arg Glu Gly Gln Lys Phe Val1025 1030
1035Val Phe Ala Asp Ser Ser Leu Leu Asn Ser Thr Pro Gly Thr Gly1040
1045 1050Arg Pro Met Pro Gly Leu Val Gln
Tyr Leu Lys Ile Pro Ala Thr1055 1060
1065Val Val Asp Ser Asp Gly Ala Trp Gln Phe Leu Pro Asp Val Ala1070
1075 1080Ser Ser Arg Val Pro Ile Glu Val
Thr Glu Leu Glu Asn Trp Gln1085 1090
1095Val Leu Thr Pro Pro Gln Gly Lys Ile Leu Gly Leu Lys Gln Phe1100
1105 1110Lys Leu Thr Ala Gly Phe Pro Thr
Glu Gln Ser Arg Leu Pro Leu1115 1120
1125Leu Glu Asn Ser Val Ser Glu Asp Leu Arg Glu Glu Leu Met Gln1130
1135 1140Lys Ile Asp Ala Ile Lys Asn Asp
Val Lys Met Asn Ser Leu Val1145 1150
1155Cys Met Glu Ala Gly Ser Cys Asp Ser Val Ser Pro Lys Val Ala1160
1165 1170Ala Arg Leu Lys Asp Met Gly Leu
Glu Ala Gly Met Gly Ala Ser1175 1180
1185Ile Thr Trp Trp Arg Arg Glu Gly Gly Met Glu Phe Ser His Gln1190
1195 1200Met His Thr Thr Ala Ser Phe Lys
Phe Ala Gly Lys Glu Phe Ala1205 1210
1215Val Asp Ala Ser His Leu Gln Phe Val His Asp Gln Leu Asp Thr1220
1225 1230Thr Ile Leu Ile Leu Pro Val Asp
Asp Trp Ala Leu Glu Ile Ala1235 1240
1245Gln Arg Asn Arg Ala Ile Asn Pro Phe Val Glu Tyr Val Ser Lys1250
1255 1260Thr Gly Asn Met Leu Ala Leu Phe
Met Pro Pro Leu Phe Thr Lys1265 1270
1275Pro Arg Leu Thr Arg Ala Leu1280 1285331DNAArtificial
sequencePMT-specific forward primer 3agaggttatg gatccgaaaa caaaacattt t
31420DNAArtificial sequencePrimer
4atagtagaag aagaattaca
20534DNAArtificial sequencePrimer 5ctaacataga ggccatggat atgaaaacaa aaca
34634DNAArtificial sequencePrimer
6acttcgtaca gccatgaatg aaatggctgg aaaa
34720DNAArtificial sequencePrimer 7actcaattag aaaaagcgct
20820DNAArtificial sequencePrimer
8ctactacagt tgctggtatt
20922DNAArtificial sequencePrimer 9attgttaaga cgtaccagac ga
221033DNAArtificial sequencePrimer
10ctcttgttaa gctagccttt gtgaaaagag gag
331120DNAArtificial sequencePrimer 11ttcttccctt aaatcttcag
201232DNAArtificial sequencePrimer
12tcactggttt ttccagccat ttcattcatg gc
321310DNAArtificial sequenceSynthetic random primer 13aagcggcctc
10
|
|
|
|
|
|
User Contributions:
Comment about this patent or add new information about this topic:
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
