Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: Engineering Fungi for the Utilisation of L-Arabinose
Inventors:
John Londesborough
Merja Penttila
Peter Richard
Agents:
ROTHWELL, FIGG, ERNST & MANBECK, P.C.
Assignees:
Origin: WASHINGTON, DC US
IPC8 Class: AC12P756FI
USPC Class:
435139
Abstract:
A fungal microorganism can be engineered by means of genetic engineering
to utilise L-arabinose. The genes of the L-arabinose pathway, which were
unknown, i.e. L-arabinitol 4-dehydrogenase and L-xylulose reductase, were
identified. These genes, together with the known genes of the L-arabinose
pathway, form a functional pathway. This pathway can be introduced to a
fungus, which is completely or partially lacking this pathway.Claims:
1. A method for producing ethanol, lactic acid or xylitol using fungal
biofermentation of L-arabinose, which comprises(a) providing a first
fungus that is unable to use or is inefficient in metabolising
L-arabinose;(b) providing a nucleic acid that(1) encodes a fungal enzyme
selected from the group consisting of LA4D and LXR wherein said LA4D
converts L-arabinitol and NAD to L-xylulose and NADH and wherein said LXR
converts xylitol and NADP to L-xylulose and NADPH;(2) is contained within
the genomic DNA of a second fungus that is able to efficiently metabolise
L-arabinose; and(3) is amplifiable from said genomic DNA by PCR, using
the primers of SEQ ID NOS:13 and 14 when said nucleic acid encodes LA4D
and the primers of SEQ ID NOS:15 and 16 when said nucleic acid encodes
LXR;(c) expressing said nucleic acid in said first fungus; and(d)
performing biofermentation by growing said first fungus in the presence
of L-arabinose to produce ethanol, lactic acid or xylitol.
2. The method of claim 1, wherein said first fungus is selected from the group consisting of Aspergillus species, Trichoderma species, Neurospora species, Fusarium species, Penicillium species, Humicola species, Tolypocladium geodes, Trichoderma reesei (Hypocrea jecorina), Mucor species, Trichoderma longibrachiatum, Aspergillus nidulans, Aspergillus niger and Aspergillus awamori.
3. The method of claim 1, wherein said second fungus is selected from the group consisting of Saccharomyces species, Schizosaccharomyces species, Kluveromyces species, Pichia species, Candida species and Pachysolen species.
4. The method of claim 3, wherein said second fungus is Saccharomyces cerevisiae.
5. The method of claim 1, wherein said nucleic acid encodes SEQ ID NO:17.
6. The method of claim 1, wherein said nucleic acid encodes SEQ ID NO:18.
7. A method for producing ethanol, lactic acid or xylitol using fungal biofermentation of L-arabinose, which comprises(a) providing a fungus that is unable to use or is inefficient in metabolising L-arabinose;(b) providing a nucleic acid that encodes a protein sequence selected from the group consisting of SEQ ID NOs:17 and 18;(c) expressing said nucleic acid in said fungus; and(d) performing biofermentation by growing said fungus in the presence of L-arabinose to produce ethanol, lactic acid or xylitol.
8. A method of claim 7, wherein said fungus selected from the group consisting of Aspergillus species, Trichoderma species, Neurospora species, Fusarium species, Penicillium species, Humicola species, Tolypocladium geodes, Trichoderma reesei (Hypocrea jecorina), Mucor species, Trichoderma longibrachiatum, Aspergillus nidulans, Aspergillus niger and Aspergillus awamori.
9. A method of modifying the L-arabinose metabolic pathway of a fungus to allow metabolic conversion of L-arabinose to ethanol, lactic acid or xylitol, which comprise transferring to said fungus an LA4D-encoding nucleic acid from Penicillium chrysogenum or Aspergillus niger, an LXR-encoding nucleic acid from Erwinia uredovora or Aspergillus niger, or both.
10. The method of claim 9, wherein said fungus is selected from the group consisting of Aspergillus species, Trichoderma species, Neurospora species, Fusarium species, Penicillium species, Humicola species, Tolypocladium geodes, Trichoderma reesei (Hypocrea jecorina), Mucor species, Trichoderma longibrachiatum, Aspergillus nidulans, Aspergillus niger and Aspergillus awamori.
11. A method of producing a useful product from biomass containing L-arabinose, which comprises:(a) providing a genetically modified fungus which is transformed with a DNA encoding an enzyme selected from the group consisting of L-arabinitol 4-dehydrogenase (LA4D) and L-xylulose reductase (LXR), each of the fungal L-arabinose pathway, wherein said fungus has an increased ability to utilise L-arabinose; and(b) fermenting said fungus under conditions suitable to produce said useful product,wherein the DNA is selected from the group consisting of nucleic acids that encode SEQ ID NOs:17 and 18.
Description:
[0001]This application is a divisional of U.S. Ser. No. 10/257,821, filed
Mar. 10, 2003, which is a U.S. national phase entry application under
.sctn.371 for International Application No. PCT/FI02/00125, filed Feb.
15, 2002, which claims the benefit of Finnish Patent Application No.
20010308, filed Feb. 16, 2001.
FIELD OF THE INVENTION
[0002]The present invention relates to a genetically modified fungus and its use for the production of useful products such as ethanol, lactic acid, xylitol and the like from materials containing the pentose sugar L-arabinose.
BACKGROUND OF THE INVENTION
[0003]L-arabinose is a major constituent of plant material. L-arabinose fermentation is therefore also of potential biotechnological interest.
[0004]Fungi that can use L-arabinose and D-xylose are not necessarily good for industrial use. Many pentose-utilising yeast species for example have a low ethanol tolerance, which makes them unsuitable for ethanol production. One approach would be to improve the industrial properties of these organisms. Another is to give a suitable organism the ability to use L-arabinose and D-xylose. There are pathways for D-xylose and L-arabinose, which are known to be active in bacteria. For D-xylose catabolism it is a xylose isomerase, which converts D-xylose to D-xylulose and a xylulokinase to make D-xylulose 5-phosphate. For L-arabinose catabolism the pathway consists of an isomerase, a kinase and an epimerase which convert L-arabinitol to L-ribulose, L-ribulose 5-phosphate and D-xylulose 5-phosphate, with D-xylulose 5-phosphate being an intermediate of the pentose phosphate pathway (Stryer, 1988). It has been tried to overexpress this bacterial pathway in the yeast S. cerevisiae, but it was not functional. The three enzymes of the L-arabinose pathway were expressed and shown to be active. However no growth on L-arabinose as a sole carbon source was reported (Sedlak and Ho, 2001). Also the expression of xylose isomerase in a fungal host was not successful (Sarthy et al., 1987; Chan et al., 1989; Kristo et al., 1989, Moes et al., 1996; Schrunder et al., 1996). The reason for this is not clear. There might be a species barrier, which prevents these bacterial isomerases from working in fungi. It can also be metabolic imbalances in the host, which are solved by an unknown mechanism in the donor.
[0005]There also is a hypothetical eukaryotic, i.e. fungal, pathway where L-arabinose also is converted to D-xylulose 5-phosphate, but by a different pathway (see FIG. 1). This pathway has been suggested to use 2 reductases, 2 dehydrogenases and a kinase as shown (Chiang and Knight, 1961, Witteveen et al., 1989). While the genes of the bacterial pathway have been known for decades, very little is known about this hypothetical fungal pathway.
[0006]A fungal pathway for L-arabinose utilisation was described by Chiang and Knight (1961) for Penicillium chrysogenum and by Witteveen et al. (1989) for Aspergillus niger. It consists of an NADPH-linked reductase, which forms L-arabinitol, an NAD-linked dehydrogenase which forms L-xylulose, an NADPH-linked reductase which forms xylitol, an NAD-linked dehydrogenase which forms D-xylulose and a xylulokinase. The final product is D-xylulose 5-phosphate as in the bacterial L-arabinose pathway (see FIG. 1). This pathway was described only for filamentous fungi, but there are indications that it may also occur in yeast. Shi et al. (2000) described a mutant of Pichia stipitis which was unable to grow on L-arabinose. Overexpression of the NAD-linked xylitol dehydrogenase could restore the growth on L-arabinitol indicating that xylitol may be an intermediate in the L-arabinose pathway. Also yeast strains, which had L-arabinose as a sole carbon source, produced L-arabinitol and small amounts of xylitol (Dien et al., 1996), indicating that yeast might use this pathway. The capability of L-arabinose fermentation is not a common feature of yeast. Many yeast species mainly accumulate the L-arabinitol formed from L-arabinose (McMillan and Boynton, 1994). Only recently, yeast species were identified which were capable of L-arabinose fermentation (Dien et al., 1996).
[0007]The hypothetical fungal L-arabinose pathway has similarities to the fungal D-xylose pathway. In both pathways, the pentose sugar goes through reduction and oxidation reactions where the reductions are NADPH-linked and the oxidations NAD-linked. D-xylose goes through one pair of reduction and oxidation reaction and L-arabinose goes through two pairs. The process is redox neutral but different redox cofactors, i.e. NADPH and NAD are used, which have to be separately regenerated in other metabolic pathways. In the D-xylose pathway an NADPH-linked reductase converts D-xylose into xylitol, which is then converted to D-xylulose by an NAD-linked dehydrogenase and to D-xylulose 5-phosphate by xylulokinase. The enzymes of the D-xylose pathway all can be used in the L-arabinose pathway. The first enzyme in both pathways is an aldose reductase (EC 1.1.1.21). The corresponding enzymes in Saccharomyces cerevisiae (Kuhn et al., 1995) and Pichia stipitis (Verduyn, 1985) have been characterised. They are unspecific and can use either L-arabinose or D-xylose with approximately the same rate to produce L-arabinitol or xylitol respectively. Genes coding for this enzyme are known, e.g. for Pichia stipitis (Amore et al., 1991), Saccharomyces cerevisiae (Kuhn et al., 1995; Richard et al., 1999), Candida tenius (Hacker et al., 1999), Kluyveromyces lactis (Billard et al., 1995) and Pachysolen tannophilus (Bolen et al., 1996).
[0008]The xylitol dehydrogenase (also known as D-xylulose reductase EC 1.1.1.9) and xylulokinase EC 2.7.1.17 are the same in the D-xylose and L-arabinose pathway of fungi. Genes for the D-xylulose reductase are known from Pichia stipitis (Kotter et al., 1990) Saccharomyces cerevisiae (Richard et al., 1999) and Tricoderma reesei (Wang et al., 1998). The gene for a fungal xylulokinase is only known for Saccharomyces cerevisiae (Ho and Chang, 1998).
[0009]Genes coding for L-arabinitol 4-dehydrogenase (EC 1.1.1.12) or L-xylulose reductase (EC 1.1.1.10) are not known.
[0010]The invention aims to be able to express the pathway for L-arabinose utilisation in fungi. The hypothetical fungal pathway expressed in Saccharomyces cerevisiae would result in a strain, which can ferment nearly all sugars from forestry and agricultural waste to ethanol.
SUMMARY OF THE INVENTION
[0011]According to the invention, the inability of a fungus to utilise L-arabinose efficiently is solved by a genetic modification of the fungus, which is characterised in that the fungus is transformed with a gene for L-arabinitol 4-dehydrogenase or a gene for L-xylulose reductase or both such genes.
[0012]According to the present invention, a fungus is transformed with all or some of the genes coding for the enzymes of the L-arabinose pathway, i.e. aldose reductase, L-arabinitol 4-dehydrogenase, L-xylulose reductase, D-xylulose reductase and xylulokinase. The resulting fungus is then able to utilise L-arabinose. We disclose genes for L-arabinitol dehydrogenase and L-xylulose reductase. We disclose that when a fungus as S. cerevisiae that is unable to utilise L-arabinose is transformed with genes for aldose reductase, L-arabinitol 4-dehydrogenase, L-xylulose reductase, D-xylulose reductase and xylulokinase, it becomes able to utilise L-arabinose. We also disclose that when a fungus, such as genetically engineered S. cerevisiae, that can use D-xylose but not L-arabinose is transformed with genes for L-arabinitol 4-dehydrogenase and L-xylulose reductase it can utilise L-arabinose.
[0013]By the term utilisation is meant here that the organism can use L-arabinose as a carbon source or as an energy source or that it can convert L-arabinose into another compound that is a useful substance.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014]FIG. 1 shows the hypothetical fungal and the bacterial pathway for L-arabinose utilisation.
[0015]FIG. 2 provides the L-arabinitol 4-dehydrogenase gene sequence (SEQ ID NO: 1). The sequence of the genomic DNA was combined with the cDNA sequences of the N-terminal and C-terminal region. The intron sequence is from nucleotide 247 to 315. The protein is encoded from nucleotide 47 to 1246 (SEQ ID NO:17).
[0016]FIG. 3 provides the sequence of the cDNA clone and protein sequence for the L-xylulose reductase (SEQ ID NO: 2). The protein is encoded from nucleotide 24 to 821 (SEQ ID NO:18).
[0017]FIG. 4 shows ethanol production from L-arabinose using a genetically modified fungus according to the invention (strain H2651) compared to a control strain (H2652).
DETAILED DESCRIPTION OF THE INVENTION
[0018]The central teaching of this invention is to demonstrate how a fungal microorganism can be genetically engineered to utilise L-arabinose. By utilisation we mean that the organism can use L-arabinose as a carbon source or as an energy source or that it can convert L-arabinose into another compound that is a useful substance. Some fungi can naturally utilise L-arabinose, others cannot. It can be desirable to transfer the capacity of utilising L-arabinose to a organism lacking the capacity of L-arabinose utilisation but with other desired features, such as the ability to tolerate industrial conditions or to produce particular useful products, such as ethanol or lactic acid or xylitol. In order to transfer the capacity of L-arabinose utilisation by means of genetic engineering, it is essential to know all the genes of a set of enzymes that can function together in a host cell to convert L-arabinose into a derivative, e.g. D-xylulose 5-phosphate, that the host can catabolise and so produce useful products. This set of enzymes can then be completed in a particular host by transforming that host with the gene or genes encoding the missing enzyme or enzymes.
[0019]One example is to genetically engineer S. cerevisiae to utilise L-arabinose. S. cerevisiae is a good ethanol producer but lacks the capacity for L-arabinose utilisation. Other examples are organisms with a useful feature but lacking at least part of a functional L-arabinose pathway.
[0020]An L-arabinose pathway believed to function in fungi is shown in the FIG. 1. Genes coding for the aldose reductase (EC 1.1.1.21), the D-xylulose reductase (EC 1.1.1.9) and xylulokinase (EC 2.7.1.17) are known. In order to construct a strain that can use L-arabinose by this hypothetical pathway, two additional genes would be required, i.e. genes for L-arabinitol 4-dehydrogenase (EC 1.1.1.12) and for L-xylulose reductase (EC 1.1.1.10).
[0021]L-arabinitol 4-dehydrogenase: an L-arabinitol 4-dehydrogenase was described for Penicillium chrysogenum and Aspergillus niger by Chiang and Knight (1960) and Witteveen et al. (1989), respectively. This enzyme converts L-arabinitol and NAD to L-xylulose and NADH. It was also reported to have activity with NAD and adonitol (ribitol) and NAD and xylitol (Chiang and Knight, 1960).
[0022]L-xylulose reductase: the L-xylulose reductase (EC 1.1.1.10) converts xylitol and NADP to L-xylulose and NADPH. Another enzyme, which has been reported to catalyse the same reaction, is the D-iditol 2-dehydrogenase (EC 1.1.1.15) (Shaw, 1956).
[0023]L-xylulose reductase was found in Erwinia uredovora (Doten et al., 1985), Aspergillus niger (Witteveen et al., 1994) and guinea pig (Hickman and Ashwell, 1959). A preparation from pigeon liver is commercially available (Sigma-Aldrich.TM.). A single subunit of the enzyme from Aspergillus niger has a molecular weight 32 kDa, the native enzyme an estimated weight of 250 kDa (Witteveen et al., 1994).
[0024]However, the amino acid sequences and the encoding genes are not known for any L-arabinitol dehydrogenase or L-xylulose reductase. We now disclose such genes. We also disclose that transforming these genes into a fungus that cannot utilise L-arabinose but can utilise xylose confers the ability to utilise L-arabinose upon the transformed fungus.
[0025]To identify the genes for L-arabinitol 4-dehydrogenase or L-xylulose reductase, different approaches are possible and a person knowledgeable in the art might use different approaches. One approach is to purify the protein with the corresponding activity and use information about this protein to clone the corresponding gene. This can include the proteolytic digestion of the purified protein, amino acid sequencing of the proteolytic digests and cloning a part of the gene by PCR with primers derived from the amino acid sequence. The rest of the DNA sequence can then be obtained in various ways. One way is from a cDNA library by PCR using primers from the library vector and the known part of the gene. Once the complete sequence is known, the gene can be amplified from the cDNA library and cloned into an expression vector and expressed in an heterologous host. This is a useful strategy if screening strategies or strategies based on homology between sequences are not suitable.
[0026]Another approach to clone a gene is to screen a DNA library. This is especially a good and fast procedure, when overexpression of a single gene causes a phenotype that is easy to detect. Now that we have disclosed that transformation of a xylose utilising fungus with genes encoding L-arabinitol dehydrogenase and L-xylulose reductase confers the ability to grow in L-arabinose, another strategy to find the genes for L-arabinitol 4-dehydrogenase and L-xylulose reductase is the following: One of the two enzymes is purified and the corresponding gene is cloned. Now, all the genes of the pathway, except one, are known. In this situation, a screening strategy is suitable to find the last gene of the pathway. A strain with all the genes of the pathway except one can be constructed, transformed with a DNA library, and screened for growth on L-arabinose. In this strategy one can first purify the L-arabinitol 4-dehydrogenase and then screen for the L-xylulose reductase or first purify the L-xylulose reductase and then screen for the L-arabinitol 4-dehydrogenase.
[0027]There are other ways and possibilities to clone these genes:
[0028]One can purify both enzymes and find the corresponding genes. One can screen a DNA library or a combination of two DNA libraries to find both genes at once. One can use other screens to find the individual genes. One could screen, for example, for growth on L-xylulose to find the L-xylulose reductase and then for growth on L-arabinose or L-arabinitol to screen for L-arabinitol 4-dehydrogenase.
[0029]Other possible screens could make use of the cofactor requirements, e.g. in a screening condition which is lethal because of NADPH depletion one could screen for a L-xylulose reductase in the presence of xylitol.
[0030]One can screen existing databanks for genes with homology to genes from related protein families and test whether they encode the desired enzyme activity. Now that we have disclosed sequences for genes encoding L-arabinitol-4-dehydrogenase (SEQ ID NO:1) and L-xylulose reductase (SEQ ID NO:2), it is easy for a person skilled in the art to screen data banks for genes homologous to SEQ ID NOs:1 and 2. Homologous genes can also be readily found by physical screening of DNA libraries using probes based on SEQ ID NOs:1 and 2. Suitable DNA libraries include DNA isolated from fungi and other microbes able to utilise L-arabinose or L-xylulose.
[0031]For a person skilled in the art there are different ways to identify the gene, which codes for a protein with the desired enzyme activity. The methods described here illustrate our invention, but any other method known in the art may be used.
[0032]Once all the genes of the L-arabinose pathway are identified, this pathway can be introduced to a new host organism, which is lacking this pathway. It is not always necessary to introduce all the genes. It might be that the host organism has already part of the pathway. For example a fungus that can utilise D-xylose might only re-quire the enzymes that convert L-arabinitol to xylitol. Expression of L-arabinitol 4-dehydrogenase and L-xylulose reductase would then be sufficient to complete the L-arabinose pathway. Enzyme assays have been described for all the steps of the fungal arabinose pathway (Witteveen et al., 1989) and these can be used if necessary to help identify the missing or inefficient steps in a particular host.
[0033]The L-arabinose pathway can be introduced to S. cerevisiae to generate a strain which is a good ethanol producer and can utilise the pentoses L-arabinose and D-xylose. In such a strain, the most abundant hexose and pentose sugars can be fermented to ethanol.
[0034]In Examples 3 and 5, the genes were cloned into a genetically engineered laboratory strain of S. cerevisiae. The same approach can be used with an industrial strain of S. cerevisiae, e.g. a brewer's, distiller's or baker's yeast. Industrial yeasts have process advantages such as high ethanol tolerance, tolerance of other industrial stresses and rapid fermentation. They are normally polyploid and their genetic engineering is more difficult compared to laboratory strains, but methods for their engineering are known in the art (see, e.g., Blomqvist et al., 1991; Henderson et al., 1980). Other yeasts unable or inefficient to utilise L-arabinose could be used as hosts, e.g. Schizosaccaromyces pombe or Pichia spp., Candida spp., Pachvsolen spp., Schwanniomyces spp., Arxula, spp., Trichosporon spp., Hansenula spp. or Yarrowia spp. Potential hosts also include filamentous fungi such as Aspergillus species, Trichoderma species, Neurospora species, Fusarium species, Penicillium species, Humicola species. Tolypocladium geodes, Trichoderma reesei (Hypocrea jecorina), Mucor species, Trichoderma longibrachiatum, Aspergillus nidulans, Aspergillus niger or Aspergillus awamori. But our invention is not restricted to yeasts and other fungi. The genes encoding L-arabinitol 4-dehydrogenase and/or L-xylulose reductase can be expressed in any organism such as bacteria, plants or higher eukaryotes unable to use or inefficient in using L-arabinose by applying the genetic tools suitable and known in the art for that particular organism.
[0035]In Examples 3 and 5, we used a TPI promoter from S. cerevisiae for the expression of L-arabinitol 4-dehydrogenase and the PGK promoter from S. cerevisiae for the expression of L-xylulose reductase. Both promoters are considered strong and constitutive. Other promoters, which are stronger or less strong, can be used. It is also not necessary to use a constitutive promoter. Inducible or repressible promoters can be used, and may have advantages, for example if a sequential fermentation of different sugars is desired.
[0036]In our example we used two plasmids for the two genes L-arabinitol 4-dehydrogenase and L-xylulose reductase. Each plasmid contained a different selection marker. These genes can also be expressed from a single plasmid with or without a selection marker or they can be integrated into the chromosomes. The selection markers were used to find successful transformations more easily and to stabilise the genetic construct. The yeast strain was transformed successively with the different genes and the transformation to S. cerevisiae was performed with the lithium acetate procedure (Gietz et al., 1992). This is only one method to accomplish the desired genetic construct. All the necessary genes can be transformed simultaneously or in succession. Other transformation procedures are known in the art, some being preferred for a particular host, and they can be used to achieve our invention.
[0037]In Examples 2 and 4 are disclosed the nucleotide sequences (SEQ ID NOs:1 and 2, respectively) of T. reesei genes encoding L-arabinitol dehydrogenase and L-xylulose reductase. These are suitable genes for practicing our invention as is disclosed in Examples 5 and 6. It is well known that genes from different organisms encoding enzymes with the same catalytic activity have sequence similarities and these similarities can be exploited in many ways by those skilled in the art to clone other genes from other organisms with the same catalytic activity. Such genes are also suitable to practice our invention. It is also well known that many small variations in the nucleotide sequence of a gene do not significantly change the catalytic properties of the encoded protein. For example, many changes in nucleotide sequence do not change the amino acid sequence of the encoded protein, whereas many changes in amino acid sequence do not change the functional properties of a protein, in particular they do not prevent an enzyme from carrying out its catalytic function. We call such variations in the nucleotide sequence of DNA molecules "functionally equivalent variations" because they do not significantly change the function of the gene to encode a protein with a particular function, e.g. catalysing a particular reaction. DNA molecules that are functionally equivalent variations of the molecules defined by SEQ ID NOs:1 and 2 can be used to practice our invention.
[0038]Sometimes organisms contain genes that are not expressed under conditions that are useful in biotechnological applications. For example, although it was once generally believed that S. cerevisiae cannot utilise xylose and it was therefore expected that S. cerevisiae did not contain genes encoding enzymes that would enable it to use xylose it has nevertheless been shown that S. cerevisiae does contain such genes (Richard et al., 1999). However, these genes are not usually expressed adequately. Thus, another aspect of our invention is to identify genes for L-arabinitol 4-dehydrogenase or L-xylulose reductase or both in a host organism itself and to cause these genes to be expressed in that same organism under conditions that are convenient for a biotechnological process, such as ethanolic fermentation of L-arabinose-containing biomass. We disclose a method of identifying candidates for such normally unexpressed genes, which is to search for similarity to SEQ ID NOs:1 and 2. A candidate gene can then be cloned in an expression vector and expressed in a suitable host and cell-free extracts of the host tested for appropriate catalytic activity as described in Examples 1 and 6. When the normally unexpressed or inadequately expressed gene has been confirmed to encode the desired enzyme, the gene can then be cloned back into the original organism but with a new promoter that causes the gene to be expressed under appropriate biotechnological conditions. This can also be achieved by genetically engineering the promoter of the gene in the intact organism.
[0039]In yet another aspect of the invention the genes encoding L-arabinitol dehydrogenate and L-xylulose reductase from a fungus, including fungi such as filamentous fungi that can have the ability to utilise L-arabinose can now be easily identified by similarity to SEQ ID NOs:1 and 2. These genes can then be modified for example by changing their promoters to stronger promoters or promoters with different properties so as to enhance the organism's ability to utilise L-arabinose.
[0040]One embodiment of this aspect is to modify these genes (and possibly also the well known gene encoding D-xylulose reductase) to create a fungus with an enhanced capacity to produce the valuable sugar alcohols, L-arabinitol and xylitol, the latter being a useful sweetener. For example, a fungus containing aldose reductase but lacking L-arabinitol 4-dehydrogenase will convert L-arabinose to L-arabinitol and can now be created by the steps of (1) transforming the fungus with the gene for aldose reductase if it lacks this enzyme and (2) deleting or disrupting the gene for L-arabinitol 4-dehydrogenase by well known methods that utilise the sequence we disclose for this gene (SEQ ID NO:1). Similarly a fungus that contains all the enzymes of the fungal pathway for converting L-arabinose to xylitol but lacks D-xylulose reductase will convert L-arabinose into xylitol and can now be created using the information we disclose in SEQ ID NOs:1 and 2 together with information about genes for D-xylulose reductase that is already known.
[0041]A fungus may not naturally have the enzymes needed for lactic acid production, or it may produce lactic acid inefficiently. In these cases expression of the gene encoding lactate dehydrogenase (LDH) enzyme can be increased or improved in the fungus, and a fungus can then produce lactic acid more efficiently (e.g., WO 99/14335). Similarly, using methods known in the art, a fungus modified to use arabinose more efficiently as described in this invention can be further modified to produce lactic acid. As well as ethanol, lactate and sugar alcohols such as arabinitol and xylitol, other useful products can be obtained from the L-arabinose-utilising fungi of the present invention. These fungi convert L-arabinose via the arabinose pathway to xylulose-5-phosphate, which is an intermediate of the pentose phosphate pathway. Thus, derivatives of the pentose phosphate pathway, such as aromatic amino acids, can also be produced as well as other substances derived from pyruvate, the common precursor of lactate and ethanol.
[0042]The transformed fungus of the invention may be used to produce ethanol from L-arabinose. A host fungus is transformed with genes for L-arabinitol 4-dehydrogenase, L-xylulose reductase or both. The host can be any fungus that has no or only a limited ability to use L-arabinose but is able to ferment D-xylose. For example, it can be a Saccharomyces cerevisiae strain that has been transformed with genes enabling it to ferment D-xylose. The genes for L-arabinitol 4-dehydrogenase and L-xylulose reductase can be obtained from T. reesei, as described in Examples 2 and 4, but other genes encoding enzymes with these catalytic activities can also be used. Such genes are now easily found, for example from microorganisms able to use L-arabinose, because the sequences disclosed as SEQ ID Nos:1 and 2 can be exploited in various ways well known in the art to clone similar genes. The methods used to transform the host fungus and to select transformants can be the same as those used in Examples 3 and 5, but other methods known in the art can be used successfully to provide a transformed fungus according to our invention.
[0043]The transformed fungus is then used to ferment a carbon source such as biomass comprising agricultural or forestry products and waste products containing L-arabinose and possibly also other pentoses or other fermentable sugars. The preparation of the carbon source for fermentation and the fermentation conditions can be the same as those that would be used to ferment the same carbon source using the host fungus. However, the transformed fungus according to the invention consumes more L-arabinose than does the host fungus and produces a higher yield of ethanol on total carbohydrate than does the host fungus. This is shown in Example 7. It is well known that fermentation conditions, including preparation of carbon source, addition of co-substrates and other nutrients, and fermentation temperature, agitation, gas supply, nitrogen supply, pH control, amount of fermenting organism added, can be optimised according to the nature of the raw material being fermented and the fermenting microorganism. Therefore, the improved performance of the transformed fungus compared to the host fungus can be further improved by optimising the fermentation conditions according to well-established process engineering procedures.
[0044]Use of a transformed fungus according to the invention to produce ethanol from carbon sources containing L-arabinose and other fermentable sugars has several industrial advantages. These include a higher yield of ethanol per ton of carbon source and a higher concentration of ethanol in the fermented material, both of which contribute to lowering the costs of producing, for example, distilled ethanol for use as fuel. Further, the pollution load in waste materials from the fermentation is lowered because the L-arabinose content is lowered, so creating a cleaner process.
[0045]Lignocellulosic raw materials are very abundant in nature and offer both renewable and cheap carbohydrate sources for microbial processing. Arabinose-containing raw materials are e.g. various pectins and hemicellulosics (such as xylans) which contain mixtures of hexoses and pentoses (xylose, arabinose). Useful raw materials include by-products from paper and pulp industry such as spent liquor and wood hydrolysates, and agricultural by-products such as sugar bagasse, corn cobs, corn fiber, oat, wheat, barley and rice hulls and straw and hydrolysates thereof. Also arabanane or galacturonic acid containing polymeric materials can be utilised.
EXAMPLES
Example 1
Purification and Amino Acid Sequencing of the L-Arabinitol 4-Dehydrogenase
[0046]Tricoderma reesei (Rut C-30) was grown in a medium containing 40 g/L L-arabinose, 2 g/L proteose peptone, 15 g/L KH.sub.2PO.sub.4, 5 g/L (NH.sub.4).sub.2SO.sub.4, 0.6 g/L Mg.sub.2SO.sub.4.times.7H.sub.2O, 0.8 g/L CaCl.sub.2.times.2H.sub.2O and trace elements (Mandels and Weber, 1969) at 28.degree. C., pH 4.0 and 30% dissolved oxygen in a fermenter (Chepmap.TM. CF2000). The fermentation was stopped when the L-arabinose was about 10 g/L. The cells were harvested with a plastic mesh sieve and washed with 10 mM sodium phosphate pH 7. Five hundred grams of the biomass was frozen in liquid nitrogen in 100 g aliquots. After thawing and sonifying with a tip sonifier, DTT was added to a final concentration of 5 mM and the suspension centrifuged (Sorvall.TM. SS34, 40 min, 20,000 rpm). The supernatant was dialysed overnight against a 10 fold volume of buffer A (10 mM sodium phosphate pH 7, 5 mM DTT). The retentate was then centrifuged (Sorvall.TM. SS34, 40 min, 20,000 rpm). All steps were performed at 4.degree. C. The crude extract had a protein content of 7 g/L and an L-arabinitol dehydrogenase activity of 0.7 nkat per mg of extracted protein. Five hundred milliliters of this crude extract was loaded onto a column with 200 mL DEAE and eluted with a linear gradient from buffer A to buffer A supplemented with 100 mM NaCl. The highest activity (16 nkat/mg, 5 mg/mL protein) eluted at about 80 mM NaCl.
[0047]The L-arabinitol 4-dehydrogenase activity was measured by adding the enzyme preparation to a buffer containing 100 mM Tris HCl pH 9.0, 0.5 mM MgCl.sub.2, 2 mM NAD. The reaction was then started by adding L-arabinitol (or other sugars if specified) to a final concentration of 10 mM. The activity was calculated from the changes in NADH absorbence at 340 nm. All enzyme assays were done at 37.degree. C. in a Cobas Mira automated analyser (Roche.TM.). In the reverse reaction the activity was measured by adding the enzyme preparation to a buffer containing 200 mM NaPO.sub.4 pH 7.0, 0.5 mM MgCl.sub.2, 200 .mu.M NADH and 2 mM L-xylulose. The activity was calculated from the changes in NADH absorbence at 340 nm.
[0048]The partially purified enzyme was tested for activity with other sugars. No activity was found with D-arabinitol. Activity was found with L-arabinitol and adonitoi (ribitol). The activity with ribitol was about 80% of the activity found with L-arabinitol. No activity with either sugar was found when NADP was used as a co-substrate.
[0049]In the reversible reaction with L-xylulose and NADH an activity of 0.8 nkat/mg was found with 2 mM L-xylulose at pH 7.0 compared to 6.4 nkat/mg with 10 mM L-arabinitol and 5 nkat/mg with 10 mM adonitol (ribitol).
[0050]Six hundred microliters of the fraction with the highest activity after the DEAE column was then run on a native PAGE (12% acrylamide, BioRad.TM.). The gel was then stained in a Zymogram.TM. staining solution containing: 200 mM Tris HCl pH 9.0, 100 mM L-arabinitol, 0.25 mM nitroblue tetrazolium, 0.06 mM phenazine metasulfate, 1.5 mM NAD.
[0051]The only band which appeared in the staining was cut out and eluted by overnight incubation in 2 mL 100 mM Tris HCl pH 9.0, 0.1% SDS. It was then concentrated to about 80 .mu.L with Centricon (Amicon.TM.).
[0052]This gave an almost pure enzyme preparation with the major band in SDS PAGE at about 38 kDa. This protein was then used for amino acid sequencing of the proteolytic digests. The results of this sequencing were the following:
Internal Peptide Sequences of the Purified L-Arabinitol 4 Dehydrogenase:
TABLE-US-00001 [0053] 1. ATGAAISVKPNIGVFTNPK (SEQ ID NO:3) 2. YSNTWPR (SEQ ID NO:4) 3. AFETSADPK (SEQ ID NO:5) 4. HDLWISEAEP. (SEQ ID NO:6)
Example 2
Cloning of the L-Arabinitol 4-Dehydrogenase
[0054]Cloning a gene fragment by using the internal amino acid sequences. The internal peptide sequences were used to design degenerative primers for PCR. The template in the first approach was genomic DNA from Tricoderma reesei. A sense DNA sequence corresponding to the amino acid fragment ATGAAISVKPNIGVFTNPK (SEQ ID NO:3) (primer 5384: ARCCIAAYATHGGIGTITTYACIAAYCC; SEQ ID NO:7) and an anti-sense DNA sequence corresponding to the amino acid fragment AFETSADPK (SEQ ID NO:5)(primer 5285: GGRTCIGCIGAIGTYTCRAAIGC; SEQ ID NO:8) were used. The PCR conditions were: denaturation 30 s, 96.degree. C.; annealing 30 s, first 2 times 37.degree. C. and then 27 times 42.degree. C.; extension 2 min at 72.degree. C.; final extension 5 min 72.degree. C. This procedure gave a PCR product of about 1 kb. The resulting fragment of about 1 kb was then cloned to a TOPO vector (Invitrogen.TM.). This construct was then used for sequencing.
[0055]The sequence of the PCR product coded also for the remaining two peptide sequences (see FIG. 2).
Cloning the N and C Terminus from a cDNA Library.
[0056]A cDNA library in a yeast expression vector (Margolles-Clark et al., 1996) was used to clone the residual parts of the gene. In this expression vector the cDNA is located between a PGK promoter and terminator. To clone the part of the gene which corresponds to the N-terminus of the protein a PCR reaction was carried out with the cDNA library as a template and one primer in the PGR promoter region and an antisense primer from the gene fragment of the L-arabinitol 4-dehydrogenase.
TABLE-US-00002 Primer of the PGK promoter region: (primer 4196: TCAAGTTCTTAGATGCTT; SEQ ID NO:9). Antisense primer of the gene fragment: (primer 5431: CCTTTCCTCCAAACTTGCTGG; SEQ ID NO:10).
[0057]The part of the gene which corresponds to the C-terminus of the protein, was cloned in a similar way with primers from the gene fragment and an antisense primer from the PGK terminator.
TABLE-US-00003 Antisense primer of the PGK terminator region: (primer 3900: TAGCGTAAAGGATGGGG; SEQ ID NO:11). Primer of the gene fragment: (Primer 5430: CTGCATTGGGCCCATGAT; SEQ ID NO:12).
The PCR conditions were as described above except the annealing was 30 times at 50.degree. C.
[0058]The N terminus gave a PCR product of about 0.8 kb; the C terminus gave a PCR product of about 0.9 kb. The PCR products were cloned to TOPO vectors and the resulting vectors used for sequencing.
[0059]With the information of the C-terminus and the N-terminus the open reading frame was then cloned by PCR from the cDNA library. The primer for the N-terminus contained an additional EcoRI restriction site (primer 5526: AGAATTCACCATGTCGCCTTCCGCAGTC; SEQ ID NO:13). The primer for the C-terminus contained an additional with BamHI restriction site (primer 5468: ACGGATCCTCTACCTGGTAGCACCTCA; SEQ ID NO:14). The annealing in the PCR reaction was 30 times 60.5.degree. C. Otherwise, the conditions were as described above. This gave a fragment of 1.1 kb, which was then cloned to a TOPO vector and used for sequencing. Comparing the sequences derived from genomic DNA and cDNA reveals an intron of 69 base pairs (see FIG. 2). The open reading frame codes for a protein with 377 amino acids and a calculated molecular weight of 39806 g/mol.
Example 3
Expression of L-Arabinitol 4-Dehydrogenase in S. cerevisiae
[0060]From the TOPO vector the 1.1 kb EcoRI, BamHI fragment was ligated into the corresponding sites of the pYX242 vector (R&D Systems.TM.). The pYX242 is a multicopy yeast expression vector with a yeast TPI promoter and LEU2 for selection. This plasmid was then transformed to the S. cerevisiae strain CEN.PK2 (VW1 b). The recombinant yeast cells were grown on selective medium. The intracellular proteins were then extracted from the yeast cells by vortexing with glass beads. The extract was then analysed for L-arabinitol dehydrogenase activity. We found an L-arabinitol 4-dehydrogenase activity of 0.2 to 0.3 nkat per mg of extracted protein.
Example 4
Screening for the L-Xylulose Reductase
[0061]To screen for an L-xylulose reductase a S. cerevisiae strain was used which contained the genes xylose reductase (aldose reductase EC 1.1.1.21), L-arabinitol-4-dehydrogenase (EC 1.1.1.12), D-xylulose reductase (EC 1.1.1.9) and xylulokinase (EC 2.7.1.17). The aldose reductase, D-xylulose reductase and xylulokinase were integrated. This strain was constructed so that uracil and leucine could still be used for selection. The plasmid from Example 3 with the L-arabinitol 4-dehydrogenase on a multicopy plasmid, was transformed to the strain with the integrated aldose reductase, D-xylulose reductase and xylulokinase. In this strain the uracil auxotrophy was still left for selection. A cDNA library from T. reesei in a yeast expression vector with uracil marker (Margolles-Clark et al., 1996) was then transformed to this strain and screened for growth on L-arabinose. For screening the transformants were first grown on glucose plates with selection. About 750,000 transformants were then replica plated to selective plates with 5% L-arabinose as a sole carbon source. Colonies, which appeared after 2 to 3 weeks, were streaked again on L-arabinose. The resulting colonies were then grown on glucose and the plasmids rescued. The plasmids were transformed to E. coli cells. Since both plasmids (the plasmid with the L-arabinitol 4-dehydrogenase and the plasmid from the cDNA library) contained only ampicillin resistance, we used colony PCR to identify the E. coli with the cDNA library plasmid. For the colony PCR we used primers of the PGK promoter and terminator region. From 4 independent clones which appeared in the L-arabinose screening a PCR product of 0.9 kb was obtained. The corresponding plasmids were then sequenced. The sequence of the cDNA is in FIG. 3. The open reading frame codes for a protein with 266 amino acids with a calculated molecular weight of 28,428 Da.
Example 5
Expression of the L-Xylulose Reductase
[0062]The expression vector with the L-xylulose reductase obtained in Example 4 was used. It was retransformed to the strain containing the genes xylose reductase (aldose reductase EC 1.1.1.21), L-arabinitol-4-dehydrogenase (EC 1.1.1.12), D-xylulose reductase (EC 1.1.1.9) and xylulokinase (EC 2.7.1.17) which was also used in Example 4. As a control the empty vector cloning vector pAJ401 was transformed instead of the vector with the L-xylulose reductase. Transformants were first grown on D-glucose plates and then streaked on plates with 5% L-arabinose as a sole carbon source. The plates contained a carbon source and selective medium leaving out uracil and leucine as required for selection (Sherman et al., 1983). On the L-arabinose plates colonies appeared after 2 to 4 weeks with the strains with L-xylulose reductase, no colonies appeared in the control.
Example 6
Expression of the L-Xylulose Reductase Under TPI Promoter
[0063]The L-xylulose reductase was cloned by PCR, using the vector from Example 5 as a template. The primers were (LXR-start EcoRI: GCCGAATTCATCATGCCTCAGCCTGTCCCCACCGCC; SEQ ID NO:15) and (LXR-stop Hind III: CGCCAAGCTTTTATCGTGTAGTGTAACCTCCGTCAATCAC; SEQ ID NO:16). The conditions were as in Example 2 except that the annealing temperature was 63.degree. C. The PCR product was digested with EcoRI and HindIII. The vector pXY212 (R&D Systems) which is an yeast expression vector with TPI promoter and contains the URA3 gene for selection was digested with EcoRI and Hind III. The PCR product was then ligated to the expression vector. The resulting vector was then transformed to the yeast strain CEN.PK2. The recombinant yeast cells were grown on selective medium. The intracellular proteins were then extracted from the yeast cells by vortexing with glass beads. The extract was then analysed for L-xylulose reductase activity. The activity was measured in a medium containing 100 mM Tris HCl pH 9.0, 1.6 M xylitol and 2 mM MgCl.sub.2. Two millimolar NADP (final concentration) was added as a start reagent. The activity was calculated from the change in NADPH absorbence at 340 nm. The assay was performed at 37.degree. C. in a Cobas Mira automated analyser (Roche.TM.). The activity was between 2 and 5 nkat per mg of extracted protein.
Example 7
L-Arabinose Fermentation with the Recombinant Yeast Strains
[0064]A yeast strain carrying all the genes of the L-arabinose pathway was constructed. For that purpose, a strain was constructed where the aldose reductase and xylitol dehydrogenase (Toivari et al., 2001) and the xylulokinase (Richard et al., 2000) were integrated into the chromosomes and the L-arabitol dehydrogenase and L-xylulose reductase were expressed from plasmids. The plasmids are described in Examples 3 and 6. The resulting strain carrying all the genes of the L-arabinose pathway was called H2651. A control strain (H2652) was constructed which was similar to the strain H2651 except that it carried the empty plasmid pYX212 instead of the Ixrl containing plasmid.
[0065]Fermentation was carried out as a batch cultivation in two separate fermenters, one containing the strain H2651, the other the strain H2652. Cells were first grown in shake flasks on selective media with glucose as a carbon source (SCD-leu-ura) to an OD.sub.600 of approximately 8, then harvested and inoculated to the fermenters and cultivated two days on D-glucose. After two days, the cells had metabolised all the ethanol produced from D-glucose. L-arabinose was then added and the fermentation switched to anaerobiosis. The OD.sub.600 after L-arabinose inoculation of the strains H2651 and H2652 were 16.6 and 8.9 respectively. FIG. 4 shows that the strain H2651 produced more than 0.12 g/L ethanol from L-arabinose during the first 50 hours of cultivation on the L-arabinose. During the same time ethanol production by the control strain was almost not detectable.
REFERENCES
[0066]Amore, R., Kotter, P., Kuster, C., Ciriacy, M. and Hollenberg, C. P. (1991), Cloning and expression in Saccharomyces cerevisiae of the NAD(P)H-dependent xylose reductase-encoding gene (XYLI) from the xylose assimilating yeast Pichia stipitis, Gene 109, 89-97. [0067]Billard, P., Menart, S., Fleer, R. and Bolotin-Fukuhara, M. (1995), Isolation and characterisation of the gene encoding xylose reductase from Kluyveromyces lactis, Gene 162, 93-97. [0068]Blomqvist, K., Suihko, M.-L., Knowles, J. and Penttila, M. (1991), Chromosomal integration and expression of two bacterial .alpha.-acetolactate decarboxylase genes in brewer's yeast, Appl. Environ. Microbiol, 57, 2796-2803. [0069]Bolen, P. L., Hayman, G. T. and Sheperd, H. S. (1996), Sequence and analysis of an aldose reductase gene from xylose fermenting yeast Pachysolen tannophilus, Yeast, 12, 1367-1375. [0070]Chan, E.-C., Ueng, P. P. and Chen, L. F. (1989), Metabolism of D-xylose in Schizosaccharomyces pombe cloned with a xylose isomerase gene, Appl. Micrbiol. Biotechnol., 31, 524-528. [0071]Chiang, C. and Knight, S. G. (1960), A new pathway of pentose metabolism, Biochem. Biophys. Res., Commun., 3, 554-559. [0072]Chiang, C and Knight, S. G. (1961), L-arabinose metabolism by cell free extracts of Penicillium chrysogenum, Biochim. Biophys., Acta, 35, 454-463. [0073]Dien, B. S., Kurtzman, C. P., Saha, B. C. and Bothast, R. J. (1996), Screening for L-arabinose fermenting yeasts, Appl. Biochem., Biotechnol., 47/48, 233-242. [0074]Doten, R. C. and Mortlock, R. P. (1985), Characterisation of xylitol-utilizing mutants of Erwinia uredovora, J. Bacteriol., 161, 529-533. [0075]Gietz, D., St Jean, A., Woods, R. A., and Schiesti, R. A. (1992), Improved method for high efficiency transformation of intact yeast cells, Nucleic Acids Res., 20, 1425. [0076]Hacker, B., Habenicht, A., Kiess, M. and Mattes R. (1999), Xylose utilisation: cloning and characterisation of the xylose reductase from Candida tenius, Biol. Chem., 380, 1395-1403. [0077]Henderson, R. C. A., Cox, B. S. and Tubb, R. (1985), The transformation of brewing yeasts with a plasmid containing the gene for copper resistance, Current Genetics, 9, 133-138. [0078]Hickman, J. and Ashwell, G. (1959), A sensitive and stereospecific enzymatic assay for xylulose, J. Biol. Chem., 234, 758-761. [0079]Ho, N. W. Y. and Chang, S.-F. (1989), Cloning of yeast xylulokinase gene by complementation of E. coli and yeast mutations, Enzyme Microb. Technol., 11, 417-421. [0080]Kotter, P, Amore, R., Hollenberg, C. P. and Ciriacy, M. (1990) Isolation and characterisation of the Pichia stipitis xylitol dehydrogenase gene, XYL2, and construction of a xylulose-utilizing Saccharomyces cerevisiae transformant. Curr. Genet. 18, 493-500. [0081]Kristo, P., Saarelainen, R., Fagerstrom, R., Aho, S. and Korhola, M. (1996) Protein purification, and cloning and characterization of the cDNA and gene for xylose isomerase of barley. Eur. J. Biochem. 237, 240-246. [0082]Kuhn, A., van Zyl, C., van Tonder, A. and Prior. B. A. (1995) Purification and partial characterisation of an aldo-keto reductase from Saccharomyces cerevisiae. Appl. Environ. Microbiol. 61, 1580-1585. [0083]McMillan, J. D. and Boynton (1994) Arabinose utilisation by xylose fermenting yeasts and fungi. Appl. Biochem. Biotechnol. 45/46. 596-584. [0084]Mandels M, Weber J (1969) The production of cellulases. Adv Chem Ser 95, 391-414. [0085]Mellor, J., Dobson, M. J., Roberts, N. A., Tuite, M. F., Emtage, J. S., White, S., Lowe, P. A., Patel, T., Kingsman, A. J. and Kingsman, S. M. (1983). Efficient synthesis of enzymatically active calf chymosin in Saccharomyces cerevisiae. Gene 24, 1-14. [0086]Moes, C. J., Pretorius, I. S. and van Zyl, W. H. (1996) Cloning and expression of the clostridiumthermosulfurogenes d-xylose isomerase gene (xylA) in Saccharomyces cerevisiae. Biotechnology letters 18, 269-274. [0087]Margolles-Clark E., Tenkanen, M., Nakari-Setala, T. and Penttila, M. (1996) Cloning of genes encoding alpha-L-arabinofuranosidase and beta-xylosidase from Trichoderma reesei by expression in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 62, 3840-3846 [0088]Richard, P., Toivari, M. H. and Penttila, M. (1999) Evidence that the gene YLRO70c of Saccharomyces cerevisiae encodes a xylitol dehydrogenase. FEBS Letters 457, 135-138. [0089]Richard, P., Toivari, M. H. and Penttila, M. (2000) The role of xylulokinase in Saccharomyces cerevisiae xylulose catabolism. FEMS Microbiol. Lett. 190, 39-43. [0090]Sarthy, A. V., McConaughy, B. L., Lobo, Z, Sundstrom, J. A., Furlong, C. E. and Hall, B. D. (1987) Expression of the Escheria coli xylose isomerase gene in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 53, 1996-2000. [0091]Schriinder, J., Gunge, N. and Meinhardt, M. (1996) Extranuclear expression of the bacterial xylose isomerase (xylA) and the UDP-glucose dehydrogenase (hasB) genes in yeast with Kluyveromyces lactis linear killer plasmids as vectors. Current Microbiology 33, 323-330. [0092]Sedlac, M. and Ho, N. W. Y. (2001) Expression of E. coli araBAD operon encoding enzymes for metabolizing L-arabinose in Saccharomyces cerevisiae. Enzyme. Microb. Technol. 28, 16-24. [0093]Shaw, D. R. D. (1956) Polyol dehydrogenases. 3. Galactitol dehydrogenase and D-iditol dehydrogenase. Biochem. J. 64, 394-405. [0094]Sherman, F., Fink, G. and Hicks, J. B. (1983) Methods in yeast genetics. A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. [0095]Shi, N. Q., Prahl, K., Hendrick, J., Cruz, J., Lu, P., Cho, J. Y., Jones, S. and Jeffries, T. (2000) Characterization and complementation of a Pichia stipitis mutant unable to grow on D-xylose or L-arabinose. Appl Biochem Biotechnol. 84-86:201-16. [0096]Stryer, L. (1988) Biochemistry, Freeman/New York [0097]Toivari, M. H., Aristidou, A., Ruohonen L. & Penttila, M. (2001). Conversion of xylose to ethanol by recombinant Saccharomyces cerevisiae: Importance of xylulokinase (XKSJ) and oxygen availability. Metab. Eng. 3, 236-249. [0098]Verduyn, C., van Kleef, R., Frank, J., Schreuder, J. H., van Dijken, J. P. and Scheffers, W. A. (1985) Properties of the NAD(P)H-dependent xylose reductase from the xylose-fermenting yeast Pichia stipitis. Biochem. J. 226, 668-677. [0099]Wang, T., Penttila, M., Gao, P., Wang, C. and Zhong, L. (1998) Isolation and Identification of xylitol dehydrogenase gene from Trichoderma reesei. Chin. J. Biotechnol. 14, 179-185. [0100]Witteveen, C. F. B., Bunsink, R., van de Vondervoort, P., Dijkema, C., Swart, K. and Visser, J. (1989) L-arabinose and D-xylose catabolism in Aspergillus niger. J. Gen. Microbiol. 135, 2163-2171. [0101]Witteveen, C. F. B., Weber, F., Busink, R. and Visser, J. (1994) Isolation and characterisation of two xylitol dehydrogenases from Aspergillus niger. Microbiol. 140, 1679-1685.
Sequence CWU
1
1811361DNATricoderma reesei 1ctcaaacgcc ttgttcgccg gagaccgcgc gcattcacag
ctcgccatgt cgccttccgc 60agtcgatgac gctcccaagg ccacaggggc agccatctca
gtcaagccca acattggcgt 120cttcacaaat ccaaaacatg acctctggat tagcgaagct
gaacccagcg ccgatgccgt 180caaatctggc gctgatctga agcccggcga ggtgaccatt
gctgtccgca gcactggtat 240ctgtgggtat gtataacgct tctgtccaca gagcgcaagc
gcagaggagc agcatgctga 300acgaaatacg aatagttcag atgtccattt ctggcacgcc
ggctgcattg ggcccatgat 360cgtcgagggc gaccacatcc tcggccacga gtctgccggc
gaggtcatcg ccgtccaccc 420gactgtcagt agcctccaaa tcggcgatcg ggttgccatc
gagcccaaca tcatctgcaa 480cgcgtgcgag ccctgcctga caggtcgata caacggctgc
gaaaaggtcg agttcctatc 540cacgccgcca gtgcccggac cgctgcgacg ctacgtcaac
cacccagccg tttggtgcca 600caagattggc aacatgtcgt gggagaacgg cgcgctgctg
gagcccctga gcgtggctct 660ggccggcatg cagagggcca aggttcagct cggtgacccc
gtgctggtct gcggcgctgg 720tccgattgga ttggtgtcaa tgctgtgcgc tgctgccgcc
ggtgcttgcc cgcttgtcat 780cacagacatt tcagagagcc gtctggcgtt tgcaaaggag
atctgccccc gcgtcaccac 840gcaccgcatc gagattggca agtcggctga ggaaacggcc
aaaagcatcg tcagctcttt 900tgggggcgtc gagccagccg tgaccctgga gtgcaccggt
gtggagagca gcattgcagc 960ggccatctgg gccagcaagt ttggaggaaa ggtctttgtg
atcggcgtcg gcaagaatga 1020aatcagcatt ccctttatga gggccagtgt acgcgaggtc
gatatccagc tgcagtatcg 1080ctacagcaac acctggcctc gtgccatccg gctcatcgag
agcggtgtca tcgatctatc 1140caaatttgtg acgcatcgct tcccgctgga ggatgccgtc
aaggcatttg agacgtcagc 1200agatcccaag agcggcgcca ttaaggtcat gattcagagc
ctggattgag agtgaggtgc 1260taccaggtag aggtagataa tagatagatg atgaagatgg
aaagactgcg ggcgcaagaa 1320tcgggcggat agggagttgg ctgtaatggt ttgcaaagca t
13612923DNAS. cerevisiae 2ccccatcctt tgcatcgccc
atcatgcctc agcctgtccc caccgccaac agactccttg 60atctcttcag cttgaagggc
aaggtcgtcg tcgtcaccgg cgcttccggc cctcgaggca 120tgggaatcga agctgcccgt
ggctgcgccg agatgggcgc tgacctcgcc atcacctact 180cgtctcgcaa ggagggcgcg
gagaagaacg ccgaggaatt gaccaaggaa tacggcgtca 240aagtcaaggt gtacaaggtc
aaccagagcg actacaacga tgttgagcgc tttgtgaacc 300aggtcgtgtc tgactttggc
aagatcgatg cctttattgc caacgccgga gccacagcta 360atagcggagt tgttgacggc
agcgccagcg attgggacca tgtcatccag gtcgacctga 420gcggcaccgc atactgcgca
aaggctgttg gcgcgcactt caagaagcag ggccacggct 480cccttgtcat cacagcttca
atgtccggcc acgtcgcaaa ctatccccag gaacagacct 540catacaacgt cgccaaggcc
ggttgcatcc atctggcgcg gtctctggcc aacgagtggc 600gtgattttgc ccgcgtcaac
agcatttcgc ccggttatat cgataccggc ctgtccgact 660tcatcgacga gaagacgcaa
gagctgtgga ggagcatgat ccccatggga cgaaacggcg 720atgccaagga gctcaagggc
gcgtatgtat atctggtcag cgacgctagc tcgtacacga 780cgggagccga tattgtgatt
gacggaggtt acactacacg ataaagaaat aatgtattgt 840tagactataa tcaatgtgac
gaacaagatt tgtgattaag aaaaaaaaaa aaaaaaaaaa 900aaaactcgag taattccgat
aga 923319PRTTricoderma reesei
3Ala Thr Gly Ala Ala Ile Ser Val Lys Pro Asn Ile Gly Val Phe Thr1
5 10 15Asn Pro
Lys47PRTTricoderma reesei 4Tyr Ser Asn Thr Trp Pro Arg1
559PRTTricoderma reesei 5Ala Phe Glu Thr Ser Ala Asp Pro Lys1
5610PRTTricoderma reesei 6His Asp Leu Trp Ile Ser Glu Ala Glu Pro1
5 10728DNAArtificial SequencePrimer used to
screen a Tricoderma reesei library 7arccnaayat hggngtntty acnaaycc
28823DNAArtificial SequencePrimer
used to screen a Tricoderma reesei library 8ggrtcngcng angtytcraa
ngc 23918DNAArtificial
SequencePrimer used to screen a Tricoderma reesei library
9tcaagttctt agatgctt
181021DNAArtificial SequencePrimer used to screen a Tricoderma reesei
library 10cctttcctcc aaacttgctg g
211117DNAArtificial SequencePrimer used to screen a Tricoderma
reesei library 11tagcgtaaag gatgggg
171218DNAArtificial SequencePrimer used to screen a
Tricoderma reesei library 12ctgcattggg cccatgat
181328DNAArtificial SequencePrimer used to
screen a Tricoderma reesei library 13agaattcacc atgtcgcctt ccgcagtc
281427DNAArtificial SequencePrimer
used to screen a Tricoderma reesei library 14acggatcctc tacctggtag
cacctca 271536DNAArtificial
SequencePrimer used to screen a S. cerevisiae library 15gccgaattca
tcatgcctca gcctgtcccc accgcc
361640DNAArtificial SequencePrimer used to screen a S. cerevisiae library
16cgccaagctt ttatcgtgta gtgtaacctc cgtcaatcac
4017377PRTTricoderma reesei 17Met Ser Pro Ser Ala Val Asp Asp Ala Pro Lys
Ala Thr Gly Ala Ala1 5 10
15Ile Ser Val Lys Pro Asn Ile Gly Val Phe Thr Asn Pro Lys His Asp
20 25 30Leu Trp Ile Ser Glu Ala Glu
Pro Ser Ala Asp Ala Val Lys Ser Gly 35 40
45Ala Asp Leu Lys Pro Gly Glu Val Thr Ile Ala Val Arg Ser Thr
Gly 50 55 60Ile Cys Gly Ser Asp Val
His Phe Trp His Ala Gly Cys Ile Gly Pro65 70
75 80Met Ile Val Glu Gly Asp His Ile Leu Gly His
Glu Ser Ala Gly Glu 85 90
95Val Ile Ala Val His Pro Thr Val Ser Ser Leu Gln Ile Gly Asp Arg
100 105 110Val Ala Ile Glu Pro Asn
Ile Ile Cys Asn Ala Cys Glu Pro Cys Leu 115 120
125Thr Gly Arg Tyr Asn Gly Cys Glu Lys Val Glu Phe Leu Ser
Thr Pro 130 135 140Pro Val Pro Gly Pro
Leu Arg Arg Tyr Val Asn His Pro Ala Val Trp145 150
155 160Cys His Lys Ile Gly Asn Met Ser Trp Glu
Asn Gly Ala Leu Leu Glu 165 170
175Pro Leu Ser Val Ala Leu Ala Gly Met Gln Arg Ala Lys Val Gln Leu
180 185 190Gly Asp Pro Val Leu
Val Cys Gly Ala Gly Pro Ile Gly Leu Val Ser 195
200 205Met Leu Cys Ala Ala Ala Ala Gly Ala Cys Pro Leu
Val Ile Thr Asp 210 215 220Ile Ser Glu
Ser Arg Leu Ala Phe Ala Lys Glu Ile Cys Pro Arg Val225
230 235 240Thr Thr His Arg Ile Glu Ile
Gly Lys Ser Ala Glu Glu Thr Ala Lys 245
250 255Ser Ile Val Ser Ser Phe Gly Gly Val Glu Pro Ala
Val Thr Leu Glu 260 265 270Cys
Thr Gly Val Glu Ser Ser Ile Ala Ala Ala Ile Trp Ala Ser Lys 275
280 285Phe Gly Gly Lys Val Phe Val Ile Gly
Val Gly Lys Asn Glu Ile Ser 290 295
300Ile Pro Phe Met Arg Ala Ser Val Arg Glu Val Asp Ile Gln Leu Gln305
310 315 320Tyr Arg Tyr Ser
Asn Thr Trp Pro Arg Ala Ile Arg Leu Ile Glu Ser 325
330 335Gly Val Ile Asp Leu Ser Lys Phe Val Thr
His Arg Phe Pro Leu Glu 340 345
350Asp Ala Val Lys Ala Phe Glu Thr Ser Ala Asp Pro Lys Ser Gly Ala
355 360 365Ile Lys Val Met Ile Gln Ser
Leu Asp 370 37518266PRTS. cerevisiae 18Met Pro Gln Pro
Val Pro Thr Ala Asn Arg Leu Leu Asp Leu Phe Ser1 5
10 15Leu Lys Gly Lys Val Val Val Val Thr Gly
Ala Ser Gly Pro Arg Gly 20 25
30Met Gly Ile Glu Ala Ala Arg Gly Cys Ala Glu Met Gly Ala Asp Leu
35 40 45Ala Ile Thr Tyr Ser Ser Arg Lys
Glu Gly Ala Glu Lys Asn Ala Glu 50 55
60Glu Leu Thr Lys Glu Tyr Gly Val Lys Val Lys Val Tyr Lys Val Asn65
70 75 80Gln Ser Asp Tyr Asn
Asp Val Glu Arg Phe Val Asn Gln Val Val Ser 85
90 95Asp Phe Gly Lys Ile Asp Ala Phe Ile Ala Asn
Ala Gly Ala Thr Ala 100 105
110Asn Ser Gly Val Val Asp Gly Ser Ala Ser Asp Trp Asp His Val Ile
115 120 125Gln Val Asp Leu Ser Gly Thr
Ala Tyr Cys Ala Lys Ala Val Gly Ala 130 135
140His Phe Lys Lys Gln Gly His Gly Ser Leu Val Ile Thr Ala Ser
Met145 150 155 160Ser Gly
His Val Ala Asn Tyr Pro Gln Glu Gln Thr Ser Tyr Asn Val
165 170 175Ala Lys Ala Gly Cys Ile His
Leu Ala Arg Ser Leu Ala Asn Glu Trp 180 185
190Arg Asp Phe Ala Arg Val Asn Ser Ile Ser Pro Gly Tyr Ile
Asp Thr 195 200 205Gly Leu Ser Asp
Phe Ile Asp Glu Lys Thr Gln Glu Leu Trp Arg Ser 210
215 220Met Ile Pro Met Gly Arg Asn Gly Asp Ala Lys Glu
Leu Lys Gly Ala225 230 235
240Tyr Val Tyr Leu Val Ser Asp Ala Ser Ser Tyr Thr Thr Gly Ala Asp
245 250 255Ile Val Ile Asp Gly
Gly Tyr Thr Thr Arg 260 265
|
|
|
|
|
|
User Contributions:
Comment about this patent or add new information about this topic:
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
