Patent application title: Mutant Endoglycoceramidases With Enhanced Synthetic Activity
Inventors:
Karl F. Johnson (Hatboro, PA, US)
Shawn Defrees (North Wales, PA, US)
Stephen Withers (Vancouver, CA)
Mark Vaughan (Vancouver, CA)
Assignees:
THE UNIVERSITY OF BRITISH COLUMBIA UNIVERSITY-INDU
IPC8 Class: AC12P2106FI
USPC Class:
435 691
Class name: Chemistry: molecular biology and microbiology micro-organism, tissue cell culture or enzyme using process to synthesize a desired chemical compound or composition recombinant dna technique included in method of making a protein or polypeptide
Publication date: 2009-07-02
Patent application number: 20090170155
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: Mutant Endoglycoceramidases With Enhanced Synthetic Activity
Inventors:
Karl F. Johnson
Shawn Defrees
Stephen Withers
Mark Vaughan
Agents:
TOWNSEND AND TOWNSEND AND CREW, LLP
Assignees:
THE UNIVERSITY OF BRITISH COLUMBIA UNIVERSITY-INDU
Origin: SAN FRANCISCO, CA US
IPC8 Class: AC12P2106FI
USPC Class:
435 691
Abstract:
The present invention relates to a novel endoglycoceramidase whose
hydrolytic activity has been substantially reduced or eliminated, such
that the enzyme is useful for synthesis of glycolipids from a
monosaccharide or oligosaccharide and a ceramide. More specifically, the
endoglycoceramidase is a mutant version of a naturally occurring
endoglycoceramidase, preferably comprising a mutation within the active
site or the nucleophilic site of the enzyme and more preferably
comprising a substitution mutation of the Glu residue within the active
site or the nucleophilic site. Also disclosed are a method for generating
the mutant endoglycoceramidase and a method for enzymatically
synthesizing glycolipids using this mutant enzyme.Claims:
1. A mutant endoglycoceramidase having a modified nucleophilic carboxylate
amino acid residue, wherein the nucleophilic carboxylate amino acid
residue resides within a
(Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-(Glu/Asp)-(Phe/Thr/-
Met/Leu)-(Gly/Leu/Phe) sequence (motif E or SEQ ID NO:46) of a
corresponding wild-type endoglycoceramidase, wherein the mutant
endoglycoceramidase catalyzes the transfer of a saccharide moiety from a
donor substrate to an acceptor substrate.
2. The mutant endoglycoceramidase of claim 1, wherein the wherein the nucleophilic carboxylate amino acid residue is a Glu residing within a (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-Glu-(Phe/Thr/Met/Le- u)-(Gly/Leu/Phe) sequence (motif D or SEQ ID NO:45).
3. The mutant endoglycoceramidase of claim 1, wherein the synthetic activity is increased compared to that of the corresponding wild-type endoglycoceramidase.
4. The mutant endoglycoceramidase of claim 1, wherein the hydrolytic activity is decreased compared to that of the corresponding wild-type endoglycoceramidase.
5. The mutant endoglycoceramidase of claim 2, wherein the nucleophilic Glu residue is substituted with an amino acid other than Glu.
6. The mutant endoglycoceramidase of claim 5, wherein the nucleophilic Glu residue is substituted with an amino acid selected from the group consisting of Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu and Val.
7. The mutant endoglycoceramidase of claim 1, wherein the enzyme has had its native signal peptide sequence removed.
8. The mutant endoglycoceramidase of claim 4, wherein the corresponding wild-type endoglycoceramidase is selected from the group consisting of a Rhodococcus endoglycoceramidase, a Propionibacterium endoglycoceramidase, a Dictyostelium endoglycoceramidase, a Cyanea endoglycoceramidase, a Hydra endoglycoceramidase, a Streptomyces endoglycoceramidase, a Schistosoma endoglycoceramidase, a Leptospira endoglycoceramidase, and a Neurospora endoglycoceramidase.
9. The mutant endoglycoceramidase of claim 2, wherein the corresponding wild-type endoglycoceramidase comprises an amino acid sequence of any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16-20.
10. The mutant endoglycoceramidase of claim 1, wherein the mutant endoglycoceramidase is part of a fusion protein.
11. The mutant endoglycoceramidase of claim 1, further comprising an amino acid tag.
12. The mutant endoglycoceramidase of claim 1, further comprising an N-terminus (Met/Val/Leu)-Leu-Asp-(Met-Phe-Ala)-His-Gln-Asp-(Met/Val/Leu)-X-(Ser/Asn) motif (motif A or SEQ ID NO:42) and a C-terminus Ala-Ile-Arg-(Gln/Ser/Thr)-Val-Asp motif (motif C or SEQ ID NO:44).
13. A nucleic acid that comprises a nucleotide sequence that encodes a mutant endoglycoceramidase of claim 1.
14. An expression vector that comprises the nucleic acid sequence of claim 13.
15. A host cell that comprises the expression vector of claim 14.
16. A method of producing a mutant endoglycoceramidase, the method comprising growing the host cell of claim 15, under conditions suitable for expression of the mutant endoglycoceramidase.
17. A mutant endoglycoceramidase comprising an amino acid sequence of any one of SEQ ID NOs:47-58.
18. A method for making a mutant endoglycoceramidase having enhanced synthetic activity in comparison to a corresponding wild-type endoglycoceramidase, the method comprising modifying the nucleophilic carboxylate amino acid residue in a corresponding wild-type endoglycoceramidase, wherein the nucleophilic carboxylate residue resides within a (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-(Glu/Asp)-- (Phe/Thr/Met/Leu)-(Gly/Leu/Phe) sequence (SEQ ID NO:46) of a corresponding wild-type endoglycoceramidase.
19. The method of claim 18, wherein the nucleophilic carboxylate amino acid residue is a Glu residing within a (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-Glu-(Phe/Thr/Met/Le- u)-(Gly/Leu/Phe) sequence (SEQ ID NO:45) of a corresponding wild-type endoglycoceramidase.
20. The method of claim 19, wherein the nucleophilic Glu residue is modified by replacing the codon encoding the nucleophilic Glu residue with a codon encoding an amino acid other than Glu.
21. The method of claim 20, wherein the nucleic acid codon encoding the nucleophilic Glu residue is replaced with a nucleic acid codon encoding an amino acid residue selected from the group consisting of Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu and Val.
22. A method of synthesizing a glycolipid, the method comprising, contacting a donor substrate comprising a saccharide moiety and an acceptor substrate with a mutant endoglycoceramidase having a modified nucleophilic carboxylate amino acid residue, wherein the nucleophilic carboxylate residue resides within a (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-(Glu/Asp)-(Phe/Thr/- Met/Leu)-(Gly/Leu/Phe) sequence (SEQ ID NO:46) of a corresponding wild-type endoglycoceramidase, under conditions wherein the endoglycoceramidase catalyzes the transfer of a saccharide moiety from a donor substrate to an acceptor substrate, thereby producing the glycolipid.
23. The method of claim 22, wherein the nucleophilic carboxylate amino acid residue is a Glu residing within a (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-Glu-(Phe/Thr/Met/Le- u)-(Gly/Leu/Phe) sequence (SEQ ID NO:45) of a corresponding wild-type endoglycoceramidase.
24. The method of claim 22, wherein the donor substrate is an α-modified glycosyl donor of anomeric configuration opposite the natural glycosidic linkage.
25. The method of claim 24, wherein the donor substrate is a glycosyl fluoride.
26. The method of claim 22, wherein the acceptor substrate is an aglycone of Formulas Ia, Ib, II or III.
27. The method of claim 26, wherein the acceptor substrate is a sphingosine or a sphingosine analog.
28. The method of claim 27, wherein the sphingosine is selected from the group consisting of from D-erythro-sphingosine, D-erythro-sphinganine, L-threo-sphingosine, L-threo-dihydrosphingosine, D-erythro-phytosphingosine, N-ocatanoyl-D-erythro-sphingosine.
29. The method of claim 26, wherein the acceptor substrate is a ceramide.
30. The method of claim 22, wherein the glycolipid is selected from the group consisting of a glycosphingolipid, a ganglioside and a cerebroside.
31. The method of claim 30, wherein the glycolipid is a ganglioside selected from the group consisting of GD1a, GD.sub.1.alpha., GD1b, GD2, GD3, Gg3, Gg4, GH1, GH2, GH3, GM1, GM1b, GM2, GM3, Fuc-GM1, GP1, GP2, GP3, GQ1b, GQ1B, GQ.sub.1.beta., GQ1c, GQ2, GQ3, GT1a, GT1b, GT1c, GT.sub.1.beta., GT1c, GT2, GT3, and polysialylated lactose.
32. A reaction mixture comprising a mutant endoglycoceramidase of claim 1, a donor substrate comprising a saccharide moiety and an acceptor substrate.
33. The reaction mixture of claim 32, wherein the acceptor substrate is a ceramide, a sphingosine or a sphingosine analog.
34. A mutant endoglycoceramidase characterized in thati) in its native form the endoglycoceramidase comprises an amino acid sequence that is any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16-20; andii) the nucleophilic Glu residue within a (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-Glu-(Phe/Thr/Met/Le- u)-(Gly/Leu/Phe) sequence of a corresponding wild-type endoglycoceramidase is modified to an amino acid other than Glu.
35. The mutant endoglycoceramidase of claim 34, wherein the nucleophilic Glu residue is modified to an amino acid selected from the group consisting of Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu and Val.
Description:
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001]This application claims the benefit of U.S. Provisional Application 60/576,316, filed Jun. 1, 2004; U.S. Provisional Application 60/626,791, filed Nov. 10, 2004; and U.S. Provisional 60/666,765, filed Mar. 29, 2005, the disclosures of each of which are incorporated herein by reference in their entirety for all purposes.
REFERENCE TO THE SEQUENCE LISTING
[0002]SEQ ID NO:1: nucleic acid sequence of a wild-type endoglycoceramidase from Rhodococcus sp. M-777. GenBank Accession No. U39554.
[0003]SEQ ID NO:2: amino acid sequence of a wild-type endoglycoceramidase from Rhodococcus sp. M-777. GenBank Accession No. AAB67050.
[0004]SEQ ID NO:3: nucleic acid sequence of a wild-type endoglycoceramidase from Rhodococcus sp. C9. GenBank Accession No. AB042327.
[0005]SEQ ID NO:4: amino acid sequence of a wild-type endoglycoceramidase from Rhodococcus sp. C9. GenBank Accession No. BAB17317.
[0006]SEQ ID NO:5: nucleic acid sequence of a wild-type endoglycoceramidase from Propionibacterium acnes KPA171202. GenBank Accession No. gi50839098:2281629.
[0007]SEQ ID NO:6: amino acid sequence of a wild-type endoglycoceramidase from Propionibacterium acnes KPA171202. GenBank Accession No. YP--056771.
[0008]SEQ ID NO:7: nucleic acid sequence of a wild-type endoglycoceramidase from Propionibacterium acnes KPA171202. GenBank Accession No. gi50839098:c709797-708223.
[0009]SEQ ID NO:8: amino acid sequence of a wild-type endoglycoceramidase from Propionibacterium acnes KPA171202. GenBank Accession No. YP--055358.
[0010]SEQ ID NO:9: nucleic acid sequence of a wild-type endoglycoceramidase from Cyanea nozakii. GenBank Accession No. AB047321.
[0011]SEQ ID NO:10: amino acid sequence of a wild-type endoglycoceramidase from Cyanea nozakii. GenBank Accession No. BAB16369.
[0012]SEQ ID NO:11: nucleic acid sequence of a wild-type endoglycoceramidase from Cyanea nozakii. GenBank Accession No. AB047322.
[0013]SEQ ID NO:12: amino acid sequence of a wild-type endoglycoceramidase from Cyanea nozakii. GenBank Accession No. BAB16370.
[0014]SEQ ID NO:13: nucleic acid sequence of a wild-type endoglycoceramidase from Hydra magnipapillata. GenBank Accession No. AB179748.
[0015]SEQ ID NO:14: amino acid sequence of a wild-type endoglycoceramidase from Hydra magnipapillata. GenBank Accession No. BAD20464.
[0016]SEQ ID NO:15: nucleic acid sequence of a wild-type endoglycoceramidase from Schistosoma japonicum. GenBank Accession No. AY813337.
[0017]SEQ ID NO:16: amino acid sequence of a wild-type endoglycoceramidase from Schistosoma japonicum. GenBank Accession No. AAW25069.
[0018]SEQ ID NO:17: amino acid sequence of a putative wild-type endoglycoceramidase from Dictyostelium discoideum. GenBank Accession No. EAL72387.
[0019]SEQ ID NO:18: amino acid sequence of a putative wild-type endoglycoceramidase from Streptomyces avermitilis str. MA-4680. GenBank Accession No. BAC75219.
[0020]SEQ ID NO:19: amino acid sequence of a putative wild-type endoglycoceramidase from Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130. GenBank Accession No. YP--003582.
[0021]SEQ ID NO:20: amino acid sequence of a putative wild-type endoglycoceramidase from Neurospora crassa. GenBank Accession No. XP--331009.
[0022]SEQ ID NO:21: amino acid sequence of mutant endoglycoceramidase A derived from AAB67050 (E233A).
[0023]SEQ ID NO:22: amino acid sequence of mutant endoglycoceramidase A derived from AAB67050 (E233S).
[0024]SEQ ID NO:23: amino acid sequence of mutant endoglycoceramidase A derived from AAB67050 (E233G).
[0025]SEQ ID NO:24: amino acid sequence of mutant endoglycoceramidase A derived from AAB67050 (E233D).
[0026]SEQ ID NO:25: amino acid sequence of mutant endoglycoceramidase A derived from AAB67050 (E233AQ).
[0027]SEQ ID NO:26: 5' PCR primer: 5'Copt
[0028]SEQ ID NO:27: 3' PCR primer: 3' Asp PstI
[0029]SEQ ID NO:28: 3' PCR primer: 3'Gln PstI
[0030]SEQ ID NO:29: 3' PCR primer: 3' Ala PstI-11-1
[0031]SEQ ID NO:30: 3' PCR primer: 3' Gly PstI-11-1
[0032]SEQ ID NO:31: 3' PCR primer: 3' Ser PstI-11-1
[0033]SEQ ID NO:32: Rhodococcus EGC-E351A-forward primer
[0034]SEQ ID NO:33: Rhodococcus EGC-E351A-reverse primer
[0035]SEQ ID NO:34: Rhodococcus EGC-E351D-forward primer
[0036]SEQ ID NO:35: Rhodococcus EGC-E351D-reverse primer
[0037]SEQ ID NO:36: Rhodococcus EGC-E351G-forward primer
[0038]SEQ ID NO:37: Rhodococcus EGC-E351G-reverse primer
[0039]SEQ ID NO:38: Rhodococcus EGC-E351S-forward primer
[0040]SEQ ID NO:39: Rhodococcus EGC-E351S-reverse primer
[0041]SEQ ID NO:40: nucleic acid sequence encoding mutant endoglycoceramidase His E351S, derived from GenBank Accession No. U39554.
[0042]SEQ ID NO:41: amino acid sequence encoding mutant endoglycoceramidase His E351S, derived from GenBank Accession No. AAB67050.
[0043]SEQ ID NO:42: Endoglycoceramidase identifying motif A.
[0044]SEQ ID NO:43: Endoglycoceramidase identifying motif B, including the acid-base sequence region.
[0045]SEQ ID NO:44: Endoglycoceramidase identifying motif C.
[0046]SEQ ID NO:45: Endoglycoceramidase identifying motif D, including the nucleophilic glutamic acid residue.
[0047]SEQ ID NO:46: Endoglycoceramidase identifying motif E, including nucleophilic carboxylate glutamic acid or aspartic acid residues.
[0048]SEQ ID NO:47: amino acid sequence of a mutant endoglycoceramidase derived from Rhodococcus sp. M-777. GenBank Accession No. AAB67050. X=Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val.
[0049]SEQ ID NO:48: amino acid sequence of a mutant endoglycoceramidase derived from Rhodococcus sp. C9. GenBank Accession No. BAB17317. X=Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val.
[0050]SEQ ID NO:49: amino acid sequence of a mutant endoglycoceramidase derived from Propionibacterium acnes KPA171202. GenBank Accession No. YP--056771. X=Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val.
[0051]SEQ ID NO:50: amino acid sequence of a mutant endoglycoceramidase derived from Propionibacterium acnes KPA171202. GenBank Accession No. YP--055358. X=Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val.
[0052]SEQ ID NO:51: amino acid sequence of a mutant endoglycoceramidase derived from Cyanea nozakii. GenBank Accession No. BAB16369. X=Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val.
[0053]SEQ ID NO:52: amino acid sequence of a mutant endoglycoceramidase derived from Cyanea nozakii. GenBank Accession No. BAB16370. X=Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val.
[0054]SEQ ID NO:53: amino acid sequence of a mutant endoglycoceramidase derived from Hydra magnipapillata. GenBank Accession No. BAD20464. X=Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val.
[0055]SEQ ID NO:54: amino acid sequence of a mutant endoglycoceramidase derived from Schistosoma japonicum. GenBank Accession No. AAW25069. X=Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val.
[0056]SEQ ID NO:55: amino acid sequence of a mutant endoglycoceramidase derived from Dictyostelium discoideum. GenBank Accession No. EAL72387. X=Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val.
[0057]SEQ ID NO:56: amino acid sequence of a mutant endoglycoceramidase derived from Streptomyces avermitilis str. MA-4680. GenBank Accession No. BAC75219. X=Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val.
[0058]SEQ ID NO:57: amino acid sequence of a mutant endoglycoceramidase derived from Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130. GenBank Accession No. YP--003582. X=Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val.
[0059]SEQ ID NO:58: amino acid sequence of a mutant endoglycoceramidase derived from Neurospora crassa. GenBank Accession No. XP--331009. X=Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val.
[0060]SEQ ID NO:59: predicted N-terminal signal sequence for wild-type endoglycoceramidase from Rhodococcus sp. M-777. GenBank Accession No. AAB67050.
[0061]SEQ ID NO:60: predicted N-terminal signal sequence for wild-type endoglycoceramidase from Rhodococcus sp. C9. GenBank Accession No. BAB17317.
[0062]SEQ ID NO:61: predicted N-terminal signal sequence for wild-type endoglycoceramidase from Propionibacterium acnes KPA171202. GenBank Accession No. YP--056771.
[0063]SEQ ID NO:62: predicted N-terminal signal sequence for wild-type endoglycoceramidase from Propionibacterium acnes KPA171202. GenBank Accession No. YP--055358.
[0064]SEQ ID NO:63: predicted N-terminal signal sequence for wild-type endoglycoceramidase from Cyanea nozakii. GenBank Accession No. BAB16369 and BAB16370.
[0065]SEQ ID NO:64: predicted N-terminal signal sequence for wild-type endoglycoceramidase from Hydra magnipapillata. GenBank Accession No. BAD20464.
[0066]SEQ ID NO:65: predicted N-terminal signal sequence for wild-type endoglycoceramidase from Schistosoma japonicum. GenBank Accession No. AAW25069.
[0067]SEQ ID NO:66: predicted N-terminal signal sequence for wild-type endoglycoceramidase from Dictyostelium discoideum. GenBank Accession No. EAL72387.
[0068]SEQ ID NO:67: predicted N-terminal signal sequence for wild-type endoglycoceramidase from Streptomyces avermitilis str. MA-4680. GenBank Accession No. BAC75219.
[0069]SEQ ID NO:68: predicted N-terminal signal sequence for wild-type endoglycoceramidase from Neurospora crassa. GenBank Accession No. XP--331009.
FIELD OF THE INVENTION
[0070]The present invention relates to the field of synthesis of saccharides, particularly those of use in preparing glycolipids, e.g., glycosphingolipids. More specifically, the invention relates to a novel approach for producing a mutant endoglycoceramidase, which has a synthetic activity that can be used to catalyze the formation of the glycosidic linkage between a monosaccharide or oligosaccharide and an aglycone to form various glycolipids.
BACKGROUND OF THE INVENTION
[0071]Glycolipids, a group of amphipathic compounds that structurally consist of a sugar chain (monosaccharide or oligosaccharide) bound to an aglycone, are important cellular membrane components known to participate in various cellular events mediating physiological processes such as the cell-cell recognition, antigenicity, and cell growth regulation (Hakomori, Annu. Rev. Biochem., 50: 733-764, 1981; Makita and Taniguchi, Glycolipid (Wiegandt, ed.) pp 59-82, Elsevier Scientific Publishing Co., New York, 1985). Because there are no known enzymes that can universally transfer a saccharyl residue to a an aglycone (e.g., ceramide or sphingosine), synthesis of glycolipids usually requires a multi-step complex process that has the disadvantages of high cost and low yield.
[0072]Endoglycoceramidase (EC3.2.1.123), an enzyme first isolated from the Actinomycetes of Rhodococcus strain (Horibata, J. Biol. Chem. May 2004 10.1094/jbc.M401460200; Ito and Yamagata, J. Biol. Chem., 261: 14278-14282, 1986), hydrolyzes the glycoside linkage between the sugar chain and the ceramide in glycolipids to produce intact monosaccharide or oligosaccharide and ceramide. To this date, several more endoglycoceramidases have been isolated and characterized (see e.g., Li et al., Biochem. Biophy. Res. Comm., 149: 167-172, 1987; Ito and Yamagata, J. Biol. Chem., 264: 9510-9519, 1989; Zhou et al., J. Biol. Chem., 264: 12272-12277, 1989; Ashida et al., Eur. J. Biochem., 205: 729-735, 1992; Izu et al., J. Biol. Chem., 272: 19846-19850, 1997; Horibata et al., J. Biol. Chem., 275:31297-31304, 2000; Sakaguchi et al., J. Biochem., 128: 145-152, 2000; and U.S. Pat. No. 5,795,765). The active site of endoglycoceramidases has also been described by Sakaguchi et al., Biochem. Biophy. Res. Comm., 260: 89-93, 1999, as including a three amino acid segment of Asn-Glu-Pro, among which the Glu residue appears to be the most important to the enzymatic activity.
[0073]Endoglycoceramidases are also known to possess an additional transglycosylation activity, which is much weaker than the hydrolytic activity (Li et al., J. Biol. Chem., 266:10723-10726, 1991; Ashida et al., Arch. Biochem. Biophy., 305:559-562, 1993; Horibata et al., J. Biochem., 130:263-268, 2001). This transglycosylation activity has not yet been exploited to synthesize glycolipids, because the far more potent hydrolytic activity of the enzyme counteracts this synthetic activity by quickly hydrolyzing newly made glycolipid.
[0074]In view of the deficiencies of the current methods for chemically synthesizing glycosphigolipids, a method that relies on the substrate specificity of a synthetic endoglycoceramidase would represent a significant advance in the field of saccharide (glycolipid) synthesis. The present invention provides such a synthetic endoglycoceramidase ("endoglycoceramide synthase") and methods for using this new enzyme.
BRIEF SUMMARY OF THE INVENTION
[0075]The present invention provides mutant endoglycoceramidase enzymes that have synthetic activity, assembling a saccharide and an aglycone, e.g., a ceramide or sphingosine, to form a glycolipid or a component thereof. The enzymes of the invention exploit the exquisite selectivity of enzymatic reactions to simplify the synthesis of glycolipids.
[0076]In a first aspect, the invention provides a mutant endoglycoceramidase having a modified nucleophilic carboxylate (i.e., Glu or Asp) residue, wherein the nucleophilic carboxylate residue resides within a (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-(Glu/Asp)-- (Phe/Thr/Met/Leu)-(Gly/Leu/Phe) sequence (SEQ ID NO:46 or motif E), or conservative variants thereof, of a corresponding wild-type endoglycoceramidase, wherein the mutant endoglycoceramidase catalyzes the transfer of a saccharide moiety from a donor substrate to an acceptor substrate (e.g., an aglycone). Typically, the Glu/Asp residue is substituted with an amino acid residue other than a Glu/Asp residue, for example, a Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val. In certain embodiments, the mutant endoglycoceramidase comprises any one of an amino acid sequence of SEQ ID NOs:47-58.
[0077]In a related aspect, the invention provides a mutant endoglycoceramidase characterized in that [0078]i) in its native form the endoglycoceramidase comprises an amino acid sequence that is any one of SEQ ID NOs: 2 (Rhodococcus), 4 (Rhodococcus), 6 (Propionibacterium acnes), 8 (Propionibacterium acnes), 10 (Cyanea nozakii), 12 (Cyanea nozakii), 14 (Hydra magnipapillata), 16 (Schistosoma japonicum), 17 (Dictyostelium discoideum), 18 (Streptomyces avermitilis), 19 (Leptospira interrogans), and 20 (Neurospora crassa); and [0079]ii) the nucleophilic carboxylate (i.e., Glu or Asp) residue within a (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-(Glu/Asp)-(Phe/Thr/- Met/Leu)-(Gly/Leu/Phe) sequence (SEQ ID NO:46) of a corresponding wild-type endoglycoceramidase is modified to an amino acid other than Glu/Asp.
[0080]In another aspect, the invention provides a method for making a mutant endoglycoceramidase having enhanced synthetic activity in comparison to a corresponding wild-type endoglycoceramidase, the method comprising modifying the nucleophilic carboxylate (i.e., Glu or Asp) residue in a corresponding wild-type endoglycoceramidase, wherein the nucleophilic Glu/Asp resides within a (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-(Glu/Asp)-(Phe/Thr/- Met/Leu)-(Gly/Leu/Phe) sequence (SEQ ID NO:46) of a corresponding wild-type endoglycoceramidase.
[0081]In another aspect, the invention provides a method of synthesizing a glycolipid or an aglycone, the method comprising, contacting a donor substrate comprising a saccharide moiety and an acceptor substrate with a mutant endoglycoceramidase having a modified nucleophilic carboxylate residue (i.e., Glu or Asp), wherein the nucleophilic Glu/Asp resides within a (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-(Glu/Asp)-- (Phe/Thr/Met/Leu)-(Gly/Leu/Phe) sequence (SEQ ID NO:46 or motif E) of a corresponding wild-type endoglycoceramidase, under conditions wherein the endoglycoceramidase catalyzes the transfer of a saccharide moiety from a donor substrate to an acceptor substrate, thereby producing the glycolipid or aglycone.
[0082]In a further aspect the invention provides expression vectors that comprise mutant endoglycoceramidase polynucleotide sequences; host cells that comprise the expression vectors, and methods of making the mutant endoglycoceramidase polypeptides described herein, by growing the host cells under conditions suitable for expression of the mutant endoglycoceramidase polypeptide.
[0083]Other objects, aspects and advantages of the invention will be apparent from the detailed description that follows.
DEFINITIONS
[0084]A "glycolipid" is a covalent conjugate between a glycosyl moiety and a substrate for a mutant endoglycoceramidase of the invention, such as an aglycone. An exemplary "glycolipid" is a covalent conjugate, between a glycosyl moiety and an aglycone, formed by a mutant endoglycoceramidase of the invention. The term "glycolipid" encompasses all glycosphingolipids, which are a group of amphipathic compounds that structurally consist of a sugar chain moiety (monosaccharide, oligosaccharide, or derivatives thereof) and an aglycone (i.e., a ceramide, a sphingosine, or a sphingosine analog). This term encompasses both cerebrosides and gangliosides. In certain embodiments, a glycolipid is an aglycone (non-carbohydrate alcohol (OH) or (SH)) conjugated to a non-reducing sugar and a non-glycoside.
[0085]An "aglycone," as referred to herein, is an acceptor substrate onto which a mutant endoglycoceramidase of the invention transfers glycosyl moiety from a glycosyl donor that is a substrate for said glycosyl donor. A glycosyl donor may be an activated or non-activated saccharide. An exemplary aglycone is a heteroalkyl moiety, which has the structure of, e.g., Formula Ia, Formula Ib or Formula II as shown below:
##STR00001##
[0086]In Formula Ia and Formula Ib, the symbol Z represents OH, SH, or NR4R4'. R1 and R2 are members independently selected from NHR4, SR4, OR4, OCOR4, OC(O)NHR4, NHC(O)OR4, OS(O)2OR4, C(O)R4, NHC(O)R4, detectable labels, and targeting moieties. The symbols R3, R4 and R4', R5, R6 and R7 each are members independently selected from H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocycloalkyl.
##STR00002##
[0087]In Formula II, Z1 is a member selected from O, S, and NR4; R1 and R2 are members independently selected from NHR4, SR4, OR4, OCOR4, OC(O)NHR4, NHC(O)OR4, OS(O)2OR4, C(O)R4, NHC(O)R4, detectable labels, and targeting moieties. The symbols R3, R4, R5, R6 and R7 each are members independently selected from H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocycloalkyl. Formula II is representative of certain embodiments wherein the aglycone portion is conjugated to a further substrate component, for example, a leaving group or a solid support.
[0088]The following abbreviations are used herein: [0089]Ara=arabinosyl; [0090]Cer=ceramide [0091]Fru=fructosyl; [0092]Fuc=fucosyl; [0093]Gal=galactosyl; [0094]GalNAc=N-acetylgalactosaminyl; [0095]Glc=glucosyl; [0096]GlcNAc=N-acetylglucosaminyl; [0097]Man=mannosyl; and [0098]NeuAc=sialyl (N-acetylneuraminyl).
[0099]The term "sialic acid" or "sialic acid moiety" refers to any member of a family of nine-carbon carboxylated sugars. The most common member of the sialic acid family is N-acetyl-neuraminic acid (2-keto-5-acetamido-3,5-dideoxy-D-glycero-D-galactononulopyranos-1-onic acid (often abbreviated as Neu5Ac, NeuAc, or NANA). A second member of the family is N-glycolyl-neuraminic acid (Neu5Gc or NeuGc), in which the N-acetyl group of NeuAc is hydroxylated. A third sialic acid family member is 2-keto-3-deoxy-nonulosonic acid (KDN) (Nadano et al. (1986) J. Biol. Chem. 261: 11550-11557; Kanamori et al., J. Biol. Chem. 265: 21811-21819 (1990)). Also included are 9-substituted sialic acids such as a 9-O--C1-C6 acyl-Neu5Ac like 9-O-lactyl-Neu5Ac or 9-O-acetyl-Neu5Ac, 9-deoxy-9-fluoro-Neu5Ac and 9-azido-9-deoxy-Neu5Ac. For review of the sialic acid family, see, e.g., Varki, Glycobiology 2: 2540 (1992); Sialic Acids: Chemistry, Metabolism and Function, R. Schauer, Ed. (Springer-Verlag, New York (1992)). The synthesis and use of sialic acid compounds in a sialylation procedure is disclosed in international application WO 92/16640, published Oct. 1, 1992.
[0100]The term "ceramide," as used herein, encompasses all ceramides and sphingosine as conventionally defined. See, for example, Berg, et al, Biochemistry, 2002, 5th ed., W.H. Freeman and Co.
[0101]The term "sphingosine analog" refers to lipid moieties that are chemically similar to sphingosine, but are modified at the polar head and/or the hydrophobic carbon chain. Sphingolipid analog moieties useful as acceptor substrates in the present methods include, but are not limited to, those described in co-pending patent applications PCT/US2004/006904 (which claims priority to U.S. Provisional Patent Application No. 60/452,796); U.S. patent application Ser. No. 10/487,841; U.S. patent application Ser. Nos. 10/485,892; 10/485,195, and 60/626,678, the disclosures of each of which are hereby incorporated herein by reference in their entirety for all purposes.
[0102]In general, the sphingosine analogs described in the above-referenced applications are those compounds having the formula:
##STR00003##
wherein Z is a member selected from O, S, C(R2)2 and NR2; X is a member selected from H, --OR3, --NR3R4, CR3, and --CHR3R4; R1, R2, R3 and R4 are members independently selected from H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocycloalkyl, --C(=M)R5, --C(=M)-Z1-R5, --SO2R5, and --SO3; wherein M and Z1 are members independently selected from O, NR6 or S; Y is a member selected from H, --OR7, --SR7, --NR7R8, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, and substituted or unsubstituted heterocycloalkyl, wherein R5, R6, R7 and R8 are members independently selected from H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocycloalkyl; and Ra, Rb, Rc and Rd are each independently H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocycloalkyl.
[0103]An "acceptor substrate" for a wild-type endoglycoceramidase or a mutant endoglycoceramidase, is any aglycone moiety that can act as an acceptor for a particular endoglycoceramidase. When the acceptor substrate is contacted with the corresponding endoglycoceramidase and sugar donor substrate, and other necessary reaction mixture components, and the reaction mixture is incubated for a sufficient period of time, the endoglycoceramidase transfers sugar residues from the sugar donor substrate to the acceptor substrate. The acceptor substrate can vary for different types of a particular endoglycoceramidase. Accordingly, the term "acceptor substrate" is taken in context with the particular endoglycoceramidase or mutant endoglycoceramidase of interest for a particular application. Acceptor substrates for endoglycoceramidases and mutant endoglycoceramidases are described herein.
[0104]A "donor substrate" for wild-type and mutant endoglycoceramidases includes any activated glycosyl derivatives of anomeric configuration opposite the natural glycosidic linkage. The enzymes of the invention are used to couple α-modified or β-modified glycosyl donors, usually α-modified glycosyl donors, with glycoside acceptors. Preferred donor molecules are glycosyl fluorides, although donors with other groups which are reasonably small and which function as relatively good leaving groups can also be used. Examples of other glycosyl donor molecules include glycosyl chlorides, bromides, acetates, mesylates, propionates, pivaloates, and glycosyl molecules modified with substituted phenols. Among the α-modified or βmodified glycosyl donors, α-galactosyl, α-mannosyl, α-glucosyl, α-fucosyl, α-xylosyl, α-sialyl, α-N-acetylglucosaminyl, α-N-acetylgalactosaminyl, β-galactosyl, β-mannosyl, β-glucosyl, β-fucosyl, β-xylosyl, β-sialyl, β-N-acetylglucosaminyl and β-N-acetylgalactosaminyl are most preferred. The donor molecules can be monosaccharides, or may themselves contain multiple sugar moieties (oligosaccharides). Donor substrates of use in the particular methods include those described in U.S. Pat. Nos. 6,284,494; 6,204,029; 5,952,203; and 5,716,812, the disclosures of which are hereby incorporated herein by reference in their entirety for all purposes.
[0105]The term "contacting" is used herein interchangeably with the following: combined with, added to, mixed with, passed over, incubated with, flowed over, etc.
[0106]"Endoglycoceramidase," as used herein, refers to an enzyme that in its native or wild-type version has a primary activity of cleaving the glycosidic linkage between a monosaccharide or an oligosaccharide and a ceramide (or sphingosine) of an acidic or neutral glycolipid, producing intact monosaccharide or oligosaccharide and ceramide (Registry number: EC 3.2.1.123). The wild-type version of this enzyme may also have a secondary activity of catalyzing the formation of the glycosidic linkage between a monosaccharide or oligosaccharide and an aglycone (i.e., a ceramide or a sphingosine) to form various glycolipids. Wild-type endoglycoceramidases have at least two identifiable conserved motifs, including an acid-base region (Val-X1-(Ala/Gly)-(Tyr/Phe)-(Asp/Glu)-(Leu/Ile)-X2-Asn-Glu-Pro-- X3-X4-Gly or motif B or SEQ ID NO:43), and a nucleophilic region ((Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/r)-Glu-(Phe/Thr/Met/Leu- )-(Gly/Leu/Phe or motif D or SEQ ID NO:45).
[0107]The terms "mutated" or "modified" as used in the context of altering the structure or enzymatic activity of a wild-type endoglycoceramidase, refers to the deletion, insertion, or substitution of any nucleotide or amino acid residue, by chemical, enzymatic, or any other means, in a polynucleotide sequence encoding an endoglycoceramidase or the amino acid sequence of a wild-type endoglycoceramidase, respectively, such that the amino acid sequence of the resulting endoglycoceramidase is altered at one or more amino acid residues. The site for such an activity-altering mutation may be located anywhere in the enzyme, including within the active site of the endoglycoceramidase, particularly involving the glutamic acid residue of the Asn-Glu-Pro subsequence of the acid-base sequence region. An artisan of ordinary skill will readily locate this Glu residue, for example, at position 233 in SEQ ID NO:2 and at position 224 in SEQ ID NO:4. Other examples of Glu residues that, once mutated, can alter the enzymatic activity of an endoglycoceramidase include a carboxylate (i.e., Glu or Asp) nucleophilic Glu/Asp residue (bolded) in the (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-Glu/Asp-(Phe/Th- r/Met/Leu)-(Gly/Leu/Phe) motif of a corresponding wild-type endoglycoceramidase.
[0108]A "mutant endoglycoceramidase" or "modified endoglycoceramidase" of this invention thus comprises at least one mutated or modified amino acid residue. On the other hand, the wild-type endoglycoceramidase whose coding sequence is modified to generate a mutant endoglycoceramidase is referred to in this application as "the corresponding native or wild-type endoglycoceramidase." One exemplary mutant endoglycoceramidase of the invention includes the deletion or substitution of a nucleophilic carboxylate Glu/Asp residue (bolded) in the (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-Glu/Asp-(Phe/Thr/Me- t/Leu)-(Gly/Leu/Phe) motif of a corresponding wild-type endoglycoceramidase. One exemplary mutant endoglycoceramidase of the invention includes a mutation within the active site, e.g., the deletion or substitution of the Glu residue within the Asn-Glu-Pro subsequence of the acid-base sequence region. The mutant endoglycoceramidase exhibits an altered enzymatic activity, e.g., an enhanced glycolipid synthetic activity, in comparison with its wild-type counterpart. A mutant endoglycoceramidase that has demonstrated an increased glycolipid synthetic activity is also called an "endoglycoceramide synthase."
[0109]The term "acid-base sequence region" refers to a conserved Val-X1-(Ala/Gly)-(Tyr/Phe)-(Asp/Glu)-(Leu/Ile)-X2-Asn-Glu-Pro-X- 3-X4-Gly sequence (SEQ ID NO:43) in a corresponding wild-type endoglycoceramidase which includes a conserved Asn-Glu-Pro subsequence. The acid-base glutamic acid residue is located within the conserved Asn-Glu-Pro subsequence, for example, at position 233 in Rhodococcus sp. M-777; position 224 in Rhodococcus sp. C9; position 229 in Propionibacterium acnes EGCa; position 248 in Propionibacterium acnes EGCb; position 238 in Cyanea nozakii; at position 229 in Hydra magnipapillata; at position 234 in Dictyostelium; at position 214 in Schistosoma; at position 241 in Leptospira interrogans; at position 272 of Streptomyces; and at position 247 of Neurosporassa (see, FIG. 15). The conserved sequence encoding a three-amino acid segment Asn-Glu-Pro was previously identified within the active site of endoglycoceramidases, and the Glu residue within the segment was thought to be connected to the hydrolytic activity of the endoglycoceramidase (Sakaguchi et al., Biochem. Biophys. Res. Commun., 1999, 260: 89-93).
[0110]The term "nucleophilic residue" or "nucleophilic motif" refers to the carboxylate amino acid residue within the (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-(Asp/Glu)-Phe/Met/L- eu)-(Gly/Leu/Phe) motif (SEQ ID NO:46) of a corresponding wild-type endoglycoceramidase. The nucleophilic residue can be a glutamate or an aspartate, usually a glutamate. A nucleophilic glutamic acid residue is located, for example, at position 351 in Rhodococcus sp. M-777; position 343 in Rhodococcus sp. C9; position 342 in Propionibacterium acnes EGCa; position 360 in Propionibacterium acnes EGCb; position 361 in Cyanea nozakii; and at position 349 in Hydra magnipapillata; at position 354 in Dictyostelium; at position 351 in Schistosoma; at position 461 in Leptospira interrogans; at position 391 of Streptomyces; and at position 498 of Neurosporassa (see, FIG. 15).
[0111]The recombinant fusion proteins of the invention can be constructed and expressed as a fusion protein with a molecular "purification tag" at one end, which facilitates purification of the protein. Such tags can also be used for immobilization of a protein of interest during the glycolipid synthesis reaction. Exemplified purification tags include MalE, 6 or more sequential histidine residues, cellulose binding protein, maltose binding protein (malE), glutathione S-transferase (GST), lactoferrin, and Sumo fusion protein cleavable sequences (commercially available from LifeSensors, Malvern, Pa. and EMD Biosciences). Suitable tags include "epitope tags," which are a protein sequence that is specifically recognized by an antibody. Epitope tags are generally incorporated into fusion proteins to enable the use of a readily available antibody to unambiguously detect or isolate the fusion protein. A "FLAG tag" is a commonly used epitope tag, specifically recognized by a monoclonal anti-FLAG antibody, consisting of the sequence AspTyrLysAspAspAsp AspLys or a substantially identical variant thereof. Other epitope tags that can be used in the invention include, e.g., myc tag, AU1, AU5, DDDDK (EC5), E tag, E2 tag, Glu-Glu, a 6 residue peptide, EYMPME, derived from the Polyoma middle T protein, HA, HSV, IRS, KT3, S tage, S1 tag, T7 tag, V5 tag, VSV-G, β-galactosidase, Gal4, green fluorescent protein (GFP), luciferase, protein C, protein A, cellulose binding protein, GST (glutathione S-transferase), a step-tag, Nus-S, PPI-ases, Pfg 27, calmodulin binding protein, dsb A and fragments thereof, and granzyme B. Epitope peptides and antibodies that bind specifically to epitope sequences are commercially available from, e.g., Covance Research Products, Inc.; Bethyl Laboratories, Inc.; Abcam Ltd.; and Novus Biologicals, Inc.
[0112]The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). The term nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene.
[0113]The term "gene" means the segment of DNA involved in producing a polypeptide chain. It may include regions preceding and following the coding region deader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).
[0114]The term "operably linked" refers to functional linkage between a nucleic acid expression control sequence (such as a promoter, signal sequence, or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence affects transcription and/or translation of the nucleic acid corresponding to the second sequence.
[0115]A "recombinant expression cassette" or simply an "expression cassette" is a nucleic acid construct, generated recombinantly or synthetically, with nucleic acid elements that are capable of affecting expression of a structural gene in hosts compatible with such sequences. Expression cassettes include at least promoters and optionally, transcription termination signals. Typically, the recombinant expression cassette includes a nucleic acid to be transcribed (e.g., a nucleic acid encoding a desired polypeptide), and a promoter. Additional factors necessary or helpful in effecting expression may also be used as described herein. For example, an expression cassette can also include nucleotide sequences that encode a signal sequence that directs secretion of an expressed protein from the host cell. Transcription termination signals, enhancers, and other nucleic acid sequences that influence gene expression, can also be included in an expression cassette.
[0116]The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, γ-carboxyglutamate, and O-phosphoserine.
[0117]"Amino acid analogs" refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
[0118]"Unnatural amino acids" are not encoded by the genetic code and can, but do not necessarily have the same basic structure as a naturally occurring amino acid. Unnatural amino acids include, but are not limited to azetidinecarboxylic acid, 2-aminoadipic acid, 3-aminoadipic acid, beta-alanine, aminopropionic acid, 2-aminobutyric acid, 4-aminobutyric acid, 6-aminocaproic acid, 2-aminoheptanoic acid, 2-aminoisobutyric acid, 3-aminoisbutyric acid, 2-aminopimelic acid, tertiary-butylglycine, 2,4-diaminoisobutyric acid, desmosine, 2,2'-diaminopimelic acid, 2,3-diaminopropionic acid, N-ethylglycine, N-ethylasparagine, homoproline, hydroxylysine, allo-hydroxylysine, 3-hydroxyproline, 4-hydroxyproline, isodesmosine, allo-isoleucine, N-methylalanine, N-methylglycine, N-methylisoleucine, N-methylpentylglycine, N-methylvaline, naphthalanine, norvaline, ornithine, pentylglycine, pipecolic acid and thioproline.
[0119]"Amino acid mimetics" refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
[0120]Amino acids may be referred to herein by either the commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
[0121]"Conservatively modified variants" applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, "conservatively modified variants" refers to those nucleic acids that encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein that encodes a polypeptide also describes every possible silent variation of the nucleic acid. One of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan) can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid that encodes a polypeptide is implicit in each described sequence.
[0122]As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid (i.e., hydrophobic, hydrophilic, positively charged, neutral, negatively charged). Exemplified hydrophobic amino acids include valine, leucine, isoleucine, methionine, phenylalanine, and tryptophan. Exemplified aromatic amino acids include phenylalanine, tyrosine and tryptophan. Exemplified aliphatic amino acids include serine and threonine. Exemplified basic aminoacids include lysine, arginine and histidine. Exemplified amino acids with carboxylate side-chains include aspartate and glutamate. Exemplified amino acids with carboxamide side chains include asparagines and glutamine. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention.
[0123]The following eight groups each contain amino acids that are conservative substitutions for one another:
1) Alanine (A), Glycine (G);
[0124]2) Aspartic acid (D), Glutamic acid (E);
3) Asparagine (N), Glutamine (Q);
4) Arginine (R), Lysine (K);
5) Isoleucine (1), Leucine (L), Methionine (M), Valine (V);
6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W);
7) Serine (S), Threonine (T); and
8) Cysteine (C), Methionine (M)
[0125](see, e.g., Creighton, Proteins (1984)).
[0126]Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
[0127]"Polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. All three terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. As used herein, the terms encompass amino acid chains of any length, including full-length proteins, wherein the amino acid residues are linked by covalent peptide bonds.
[0128]A "heterologous polynucleotide," "heterologous nucleic acid", or "heterologous polypeptide," as used herein, is one that originates from a source foreign to the particular host cell, or, if from the same source, is modified from its original form. Thus, a heterologous endoglycoceramidase gene in a prokaryotic host cell includes a endoglycoceramidase gene that is endogenous to the particular host cell but has been modified. Modification of the heterologous sequence may occur, e.g., by treating the DNA with a restriction enzyme to generate a DNA fragment that is capable of being operably linked to a promoter. Techniques such as site-directed mutagenesis are also useful for modifying a heterologous sequence.
[0129]A "subsequence" refers to a sequence of nucleic acids or amino acids that comprise a part of a longer sequence of nucleic acids or amino acids (e.g., polypeptide) respectively.
[0130]The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, for example over a region of at least about 25, 50, 75, 100, 150, 200, 250, 500, 1000, or more nucleic acids or amino acids, up to the full length sequence, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site http://www.ncbi.nlm.nih.gov/BLAST/ or the like). Such sequences are then said to be "substantially identical." This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.
[0131]For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
[0132]A "comparison window", as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology (Ausubel et al., eds. 1995 supplement)).
[0133]A preferred example of algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al., J. Mol. Biol. 215:403-410 (1990), respectively. BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins of the invention. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.
[0134]The phrase "stringent hybridization conditions" refers to conditions under which a nucleic acid will hybridize to its target subsequence, typically in a complex mixture of nucleic acids, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993). Generally, stringent conditions are selected to be about 5-10° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short nucleic acid sequences (e.g., 10 to 50 nucleotides) and at least about 60° C. for long nucleic acid sequences (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably 10 times background hybridization. Exemplary "highly stringent" hybridization conditions include hybridization in a buffer comprising 50% formamide, 5×SSC, and 1% SDS at 42° C., or hybridization in a buffer comprising 5×SSC and 1% SDS at 65° C., both with a wash of 0.2×SSC and 0.1% SDS at 65° C. Exemplary "moderately stringent hybridization conditions" include a hybridization in a buffer of 40% formamide, 1 M NaCl, and 1% SDS at 37° C., and a wash in 1×SSC at 45° C.
[0135]The term "alkyl," by itself or as part of another substituent, means, unless otherwise stated, a straight or branched chain, or cyclic hydrocarbon radical, or combination thereof, which may be fully saturated, mono- or polyunsaturated and can include mono-, di- and multivalent radicals, having the number of carbon atoms designated (i.e. C1-C10 means one to ten carbons). Examples of saturated alkyl radicals include, but are not limited to, groups such as methyl, methylene, ethyl, ethylene, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl, (cyclohexyl)methyl, cyclopropylmethyl, homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, n-octyl, and the like. An unsaturated alkyl group is one having one or more double bonds or triple bonds. Examples of unsaturated alkyl groups include, but are not limited to, vinyl, 2-propenyl, crotyl, 2-isopentenyl, 2-(butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), ethynyl, 1- and 3-propynyl, 3-butynyl, and the higher homologs and isomers. The term "alkyl," unless otherwise noted, includes "alkylene" and those derivatives of alkyl defined in more detail below, such as "heteroalkyl." Alkyl groups, which are limited to hydrocarbon groups, are termed "homoalkyl."
[0136]The term "heteroalkyl," by itself or in combination with another term, means, unless otherwise stated, a stable straight or branched chain, or cyclic hydrocarbon radical, or combinations thereof, consisting of the stated number of carbon atoms and at least one heteroatom selected from the group consisting of O, N, Si and S, and wherein the nitrogen and sulfur atoms may optionally be oxidized and the nitrogen heteroatom may optionally be quaternized. The heteroatom(s) O, N and S and Si may be placed at any interior position of the heteroalkyl group or at the position at which the alkyl group is attached to the remainder of the molecule. Examples include, but are not limited to, --CH2--CH2--O--CH3, --CH2--CH2--NH--CH3, --CH2--CH2--N(CH3)--CH3, --CH2--S--CH2--CH3, --CH2--CH2, --S(O)--CH3, --CH2--CH2--S(O)2--CH3, --CH═CH--O--CH3, --Si(CH3)3, --CH2--CH═N--OCH3, and --CH═CH--N(CH3)--CH3. Up to two heteroatoms may be consecutive, such as, for example, --CH2--NH--OCH3 and CH2--O--Si(CH3)3. Similarly, the term "heteroalkylene" by itself or as part of another substituent means a divalent radical derived from heteroalkyl, as exemplified, but not limited by, --CH2--CH2--S--CH2--CH2-- and --CH2--S--CH2--CH2--NH--CH2--. For heteroalkylene groups, heteroatoms can also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like). Still further, for alkylene and heteroalkylene linking groups, no orientation of the linking group is implied by the direction in which the formula of the linking group is written.
[0137]Each of the above terms (e.g., "alkyl" and "heteroalkyl") are meant to include both substituted and unsubstituted forms of the indicated radical. Preferred substituents for each type of radical are provided below.
[0138]Substituents for the alkyl and heteroalkyl radicals (including those groups often referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) can be one or more of a variety of groups selected from, but not limited to: --OR', ═O, ═NR', ═N--OR', --NR'R'', --SR', -halogen, --SiR'R''R''', --OC(O)R', --C(O)R', --CO2R', --CONR'R'', --OC(O)NR'R'', --NR''C(O)R', --NR'--C(O)NR''R''', --NR''C(O)2R', --NR--C(NR'R''R''')═NR'''', --NR--C(NR'R'')═NR''', --S(O)R', --S(O)2R', --S(O)2NR'R'', --NRSO2R', --CN and --NO2 in a number ranging from zero to (2m'+1), where m' is the total number of carbon atoms in such radical. R', R'', R''' and R'''' each preferably independently refer to hydrogen, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, e.g., aryl substituted with 1-3 halogens, substituted or unsubstituted alkyl, alkoxy or thioalkoxy groups, or arylalkyl groups. When a compound of the invention includes more than one R group, for example, each of the R groups is independently selected as are each R', R'', R''' and R'''' groups when more than one of these groups is present. When R' and R'' are attached to the same nitrogen atom, they can be combined with the nitrogen atom to form a 5-, 6-, or 7-membered ring. For example, --NR'R'' is meant to include, but not be limited to, 1-pyrrolidinyl and 4-morpholinyl. From the above discussion of substituents, one of skill in the art will understand that the term "alkyl" is meant to include groups including carbon atoms bound to groups other than hydrogen groups, such as haloalkyl (e.g., --CF3 and --CH2CF3) and acyl (e.g., --C(O)CH3, --C(O)CF3, --C(O)CH2OCH3, and the like).
[0139]The term "aryl" means, unless otherwise stated, a polyunsaturated, aromatic, hydrocarbon substituent, which can be a single ring or multiple rings (preferably from 1 to 3 rings), which are fused together or linked covalently. The term "heteroaryl" refers to aryl groups (or rings) that contain from one to four heteroatoms selected from N, O, and S, wherein the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atom(s) are optionally quaternized. A heteroaryl group can be attached to the remainder of the molecule through a heteroatom. Non-limiting examples of aryl and heteroaryl groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl, 2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, and 6-quinolyl. Substituents for each of the above noted aryl and heteroaryl ring systems are selected from the group of acceptable substituents described below.
[0140]Similar to the substituents described for the alkyl radical, substituents for the aryl and heteroaryl groups are varied and are selected from, for example: halogen, OR', --NR'R'', --SR', -halogen, --SiR'R''R''', OC(O)R', --C(O)R', CO2R', --CONR'R'', --OC(O)NR'R'', --NR''C(O)R', NR'C(O)NR''R''', --NR''C(O)2R', NR--C(NR'R''R''')═NR'''', NR C(NR'R'')--NR''', --S(O)R', --S(O)2R', --S(O)2NR'R'', NRSO2R', --CN and --NO2, --R', --N3, --CH(Ph)2, fluoro(C1-C4)alkoxy, and fluoro(C1-C4)alkyl, in a number ranging from zero to the total number of open valences on the aromatic ring system. When a compound of the invention includes more than one R group, for example, each of the R groups is independently selected as are each R', R'', R''' and R'''' groups when more than one of these groups is present.
[0141]Two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -T-C(O)--(CRR')q--U--, wherein T and U are independently --NR--, --O--, --CRR'-- or a single bond, and q is an integer of from 0 to 40. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -A(CH2)rB--, wherein A and B are independently --CRR'--, --O--, --NR--, --S--, --S(O)--, S(O)2, --S(O)2NR'-- or a single bond, and r is an integer of from 1 to 40. One of the single bonds of the new ring so formed may optionally be replaced with a double bond. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula --(CRR')s--X--(CR''R''')d--, where s and d are independently integers of from 0 to 40, and X is --O--, --NR'--, --S--, --S(O)--, --S(O)2--, or --S(O)2NR'--. The substituents R, R', R'' and R''' are preferably independently selected from hydrogen or substituted or unsubstituted (C1-C40)alkyl.
[0142]The term "detectable label" refers to a moiety renders a molecule to which it is attached to detectable by a variety of mechanisms including chemical, enzymatic, immunological, or radiological means. Some examples of detectable labels include fluorescent molecules (such as fluorescein, rhodamine, Texas Red, and phycoerythrin) and enzyme molecules (such as horseradish peroxidase, alkaline phosphatase, and β-galactosidase) that allow detection based on fluorescence emission or a product of a chemical reaction catalyzed by the enzyme. Radioactive labels involving various isotopes, such as 3H, 125I, 35S, 14C, or 32P, can also be attached to appropriate molecules to enable detection by any suitable methods that registers radioactivity, such as autoradiography. See, e.g., Tijssen, "Practice and Theory of Enzyme Immunoassays," Laboratory Techniques in Biochenmistry and Molecular Biology, Burdon and van Knippenberg Eds., Elsevier (1985), pp. 9-20. An introduction to labels, labeling procedures, and detection of labels can also be found in Polak and Van Noorden, Introduction to Immunocytochemistry, 2d Ed., Springer Verlag, NY (1997); and in Haugland, Handbook of Fluorescent Probes and Research Chemicals, a combined handbook and catalogue published by Molecular Probes, Inc. (1996).
[0143]The term "targeting moiety," as used herein, refers to species that will selectively localize in a particular tissue or region of the body. The localization is mediated by specific recognition of molecular determinants, molecular size of the targeting agent or conjugate, ionic interactions, hydrophobic interactions and the like. Other mechanisms of targeting an agent to a particular tissue or region are known to those of skill in the art. Exemplary targeting moieties include antibodies, antibody fragments, transferrin, HS-glycoprotein, coagulation factors, serum proteins, β-glycoprotein, G-CSF, GM-CSF, M-CSF, EPO, saccharides, lectins, receptors, ligand for receptors, proteins such as BSA and the like. The targeting group can also be a small molecule, a term that is intended to include both non-peptides and peptides.
[0144]The symbol , whether utilized as a bond or displayed perpendicular to a bond indicates the point at which the displayed moiety is attached to the remainder of the molecule, solid support, etc.
[0145]The term "increase," as used herein, refers to a detectable positive change in quantity of a parameter when compared to a standard. The level of this positive change, for example, in the synthetic activity of a mutant endoglycoceramidase from its corresponding wild-type endoglycoceramidase, is preferably at least 10% or 20%, and more preferably at least 30%, 40%, 50%, 60% or 80%, and most preferably at least 100%.
[0146]The term "reduce" or "decrease" is defined as a detectable negative change in quantity of a parameter when compared to a standard. The level of this negative change, for example, in the hydrolytic activity of a mutant endoglycoceramidase from its corresponding wild-type endoglycoceramidase, is preferably at least 10% or 20%, and more preferably at least 30%, 40%, 50%, 60%, 80%, 90%, and most preferably at least 100%.
BRIEF DESCRIPTION OF THE DRAWINGS
[0147]FIG. 1 sets forth compounds that can be made using the enzyme of the invention.
[0148]FIG. 2 sets forth compounds that can be made using the enzyme of the invention.
[0149]FIG. 3 sets forth compounds that can be made using the enzyme of the invention.
[0150]FIG. 4 sets forth compounds that can be made using the enzyme of the invention.
[0151]FIG. 5 sets forth compounds that can be made using the enzyme of the invention
[0152]FIG. 6 sets forth compounds that can be made using the enzyme of the invention.
[0153]FIG. 7 sets forth compounds that can be made using the enzyme of the invention.
[0154]FIG. 8 sets forth compounds that can be made using the enzyme of the invention.
[0155]FIG. 9 sets forth compounds that can be made using the enzyme of the invention.
[0156]FIG. 10 sets forth compounds that can be made using the enzyme of the invention.
[0157]FIG. 11 sets forth compounds that can be made using the enzyme of the invention.
[0158]FIG. 12 sets forth compounds that can be made using the enzyme of the invention.
[0159]FIG. 13 sets forth compounds that can be made using the enzyme of the invention.
[0160]FIG. 14 is a schematic depiction of expression vector pT7-7, indicating restriction enzyme sites.
[0161]FIG. 15 illustrates an amino acid sequence alignment of wild-type endoglycoceramidases from Rhodococcus, Propionibacterium, Cyanea, and Hydra.
[0162]FIG. 16 illustrates SDS-PAGE analysis of EGCase purification. Lanes: 1) insoluble pellet fraction; 2) lysate soluble fraction; and 3) purified fraction.
[0163]FIG. 17 illustrates a reaction analysis by HPLC showing the synthesis of Lyso-GM3 after 12 hrs. Top panels: control runs. Bottom panels: reaction runs.
[0164]FIG. 18 illustrates a Michaelis-Menten curve for wild-type Rhodococcus EGC using 2,4-dinitrophenyl lactoside as the substrate.
[0165]FIG. 19 illustrates variation of kcat, Km, and kcat/Km with increasing detergent concentration for wild-type Rhodococcus EGC.
[0166]FIG. 20 illustrates pH rate profile for wild-type Rhodococcus EGC. Estimated pKa values for the catalytic glutamate residues are 3.2 and 6.5.
[0167]FIG. 21 illustrates expression in E. coli of Propionibacterium acnes wild-type EGC under a variety of conditions. In each series of three lanes, the first shows the pre-induction expression level, the second the total cell fraction after induction, and the third the soluble fraction of the cell lysate. In all cases, induction was performed at 18° C. Lanes 1-3: BL21 pLysS, 0.1 mM IPTG, M9 media. Lanes 4-6: Tuner, 0.1 mM IPTG, M9. Lanes 7-9: BL21 pLysS, 0.01 mM IPTG, Typ media. Lanes 10-12: Tuner, 0.1 mM IPTG, Typ media. Lane 14: Molecular weight standards.
DETAILED DESCRIPTION
Introduction
[0168]Glycolipids, each consisting of a saccharide moiety and a heteroalkyl moiety, e.g., Formula Ia, Formula Ib, Formula II or Formula III, are important constituents of cellular membranes. With their diverse sugar groups extruding outward from the membrane surface, glycolipids mediate cell growth and differentiation, recognize hormones and bacterial toxins, and determine antigenicity; some are recognized as tumor-associated antigens (Hakomori, Annu. Rev. Biochem., 50:733-764, 1981; Marcus, Mol. Immunol. 21:1083-1091, 1984). The present invention discloses novel enzymes and methods for producing glycolipids having a saccharyl moiety of virtually any structure, making it possible to study these important molecules and develop therapeutics, e.g., anti-tumor agents, targeting certain glycolipids.
[0169]Mutant Endoglycoceramidases
[0170]The present invention provides mutant endoglycoceramidases, also termed "endoglycoceramide synthases," which have an increased synthetic activity for attaching a donor substrate comprising a saccharide moiety to an acceptor substrate (an aglycone) compared to the corresponding wild-type endoglycoceramidase. The mutant endoglycoceramidases can also have a reduced hydrolytic activity towards glycolipids compared to the corresponding wild-type endoglycoceramidase. Corresponding wild-type endoglycoceramidases have at least two identifiable conserved motifs, including an acid-base region (Val-X1-(Ala/Gly)-(Tyr/Phe)-(Asp/Glu)-(Leu/Ile)-X2-Asn-Glu-Pro-- X3-X4-Gly or motif B or SEQ ID NO:43), and a nucleophilic region ((Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-Glu-(Phe/Thr/Met/L- eu)-(Gly/Leu/Phe or motif D or SEQ ID NO:45), and hydrolyze the glycoside linkage between a sugar chain and a lipid moiety in a glycolipid.
[0171]Structurally, the invention provides a mutant endoglycoceramidase having a modified nucleophilic carboxylate Glu/Asp residue, wherein the nucleophilic Glu/Asp resides within a (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-(Glu/Asp)-(Phe/Thr/- Met/Leu)-(Gly/Leu/Phe) sequence (SEQ ID NO:46) of a corresponding wild-type endoglycoceramidase, wherein the mutant endoglycoceramidase catalyzes the transfer of a saccharide moiety from a donor substrate to an acceptor substrate.
[0172]In a further aspect, the invention provides a mutant endoglycoceramidase having a modified Glu residue within the subsequence of Asn-Glu-Pro, wherein the subsequence resides within the acid-base sequence region of Val-X1-(Ala/Gly)-(Tyr/Phe)-(Asp/Glu)-(Leu/Ile)-X2-Asn-Glu-Pro-X- 3-X4-Gly sequence in the corresponding wild-type protein, wherein the mutant endoglycoceramidase catalyzes the transfer of a saccharide moiety from a donor substrate to an acceptor substrate.
[0173]In a related aspect, the invention provides a mutant endoglycoceramidase characterized in that [0174]i) in its native form the endoglycoceramidase comprises an amino acid sequence that is any one of SEQ ID NOs: 2 (Rhodococcus), 4 (Rhodococcus), 6 (Propionibacterium acnes), 8 (Propionibacterium acnes), 10 (Cyanea nozakii), 12 (Cyanea nozakii), 14 (Hydra magnipapillata), 16 (Schistosoma japonicum), 17 (Dictyostelium discoideum), 18 (Streptomyces avermitilis), 19 (Leptospira interrogans), and 20 (Neurospora crassa); and [0175]ii) the nucleophilic Glu/Asp residue within a (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-Glu/Asp-(Phe/Thr/Me- t/Leu)-(Gly/Leu/Phe) sequence of a corresponding wild-type endoglycoceramidase is modified to an amino acid other than Glu/Asp.
[0176]In a further aspect, the invention provides a mutant endoglycoceramidase characterized in that [0177]i) in its native form the endoglycoceramidase comprises an amino acid sequence that is any one of SEQ ID NOs: 2 (Rhodococcus), 4 (Rhodococcus), 6 (Propionibacterium acnes), 8 (Propionibacterium acnes), 10 (Cyanea nozakii), 12 (Cyanea nozakii), 14 (Hydra magnipapillata), 16 (Schistosoma japonicum), 17 (Dictyostelium discoideum), 18 (Streptomyces avermitilis), 19 (Leptospira interrogans), and 20 (Neurospora crassa); and [0178]ii) the Glu residue within the subsequence of Asn-Glu-Pro of the acid-base sequence region Val-X1-(Ala/Gly)-(Tyr/Phe)-(Asp/Glu)-(Leu/Ile)-X2-Asn-Glu-Pro-X- 3-X4-Gly in the corresponding wild-type protein is modified to an amino acid other than Glu.
[0179]Typically, the mutant endoglycoceramidases of the present invention comprise a modified nucleophilic Glu/Asp residue and/or a modified acid-base sequence region Glu residue within the Asn-Glu-Pro subsequence of a corresponding wild-type endoglyoceramidase. One or both of the Glu residues are deleted or replaced with another chemical moiety that retains the integral structure of the protein such that the mutant enzyme has synthetic activity. For example, one or more of the nucleophilic and/or acid-base sequence region Glu residues (i.e., in the Asn-Glu-Pro subsequence region) can be replaced with an L-amino acid residue other than Glu, an unnatural amino acid, an amino acid analog, an amino acid mimetic, and the like. Usually, the one or more Glu residues are substituted with another L-amino acid other than Glu, for example, Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val.
[0180]Functionally, the invention provides mutant endoglycoceramidases having a synthetic activity of coupling a glycosyl moiety and an aglycone substrate, forming a glycolipid. The mutant endoglycoceramidase can also have a reduced hydrolytic activity towards glycolipids compared to the corresponding wild-type endoglycoceramidase. The mutant endoglycoceramidases of the invention have a synthetic activity that is greater than the synthetic activity of the corresponding wild type endoglycoceramidase. Preferably, the synthetic activity is greater than its degradative (i.e., hydrolytic) activity in an assay. The assay for the synthetic activity of the mutant endoglycoceramidase comprises transferring a glycosyl moiety from a glycosyl donor substrate for said mutant to an aglycone (i.e., acceptor substrate). The synthetic activity can be readily measured in an assay designed to detect the rate of glycolipid synthesis by the mutant or the quantity of product synthesized by the enzyme.
[0181]In general, preferred mutant endoglycoceramidases of the invention are at least about 1.5-fold more synthetically active than their wild type analogues, more preferably, at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, a least about 50-fold and more preferably still, at least about 100-fold. By more synthetically active is meant that the rate of starting material conversion by the enzyme is greater than that of the corresponding wild type enzyme and/or the amount of product produced within a selected time is greater than that produced by the corresponding wild type enzyme in a similar amount of time. A useful assay for determining enzyme synthetic activity includes transferring a glycosyl moiety from a glycosyl donor substrate for said mutant to an aglycone.
[0182]The corresponding wild-type endoglycoceramidase can be from a prokaryotic organism (e.g., a Rhodococcus, a Propionibacterium, a Streptomyces, or a Leptospira) or a eukaryotic organism (e.g., a Cyanea, a Hydra, a Schistosoma, a Dictyostelium, a Neurospora). For example, the corresponding wild-type or native endoglycoceramidase can be from an Actinobacteria, including a Rhodococcus, a Propionibacterium, or a Streptomyces. The corresponding wild-type or native endoglycoceramidase also can be from a Metazoan; including a Cyanea, a Hydra, or a Schistosoma, or from a Cnidaria, including a Cyanea or a Hydra. The corresponding wild-type or native endoglycoceramidase also can be from a Mycetozoa (e.g., a Dictyostelium), a Spirochete (e.g., a Leptospira), or a fungus, such as an Ascomycete (e.g., a Neurospora). In one embodiment, the corresponding wild-type endoglycoceramidase has an amino acid sequence of any one of SEQ ID NOs:2, 4, 6, 8, 10, 12, 14, 16, 17, 18, 19, or 20. In one embodiment, the corresponding wild-type endoglycoceramidase is encoded by a nucleic acid sequence of any one of SEQ ID NOs:1, 3, 5, 7, 9, 11, 13, or 15.
[0183]The corresponding wild-type endoglycoceramidase can be from any known endoglycoceramidase sequence or any endoglycoceramidase sequence which has yet to be determined. Additional corresponding wild-type endoglycoceramidases can be identified using sequence databases and sequence alignment algorithms, for example, the publicly available GenBank database and the BLAST alignment algorithm, available on the worldwide web through ncbi.nlm.nih.gov. Additional corresponding wild-type endoglycoceramidases also can be found using routine techniques of hybridization and recombinant genetics. Basic texts disclosing the general methods of use in this invention include Sambrook and Russell, Molecular Cloning, A Laboratory Manual (3rd ed. 2001); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); and Ausubel et al., eds., Current Protocols in Molecular Biology (1994). Native or wild-type endoglycoceramidases of interest include those encoded by nucleic acid sequences that hybridize under stringent hybridization conditions to one or more of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, or 15. Native or wild-type endoglycoceramidases of interest also include those with one or more conservatively substituted amino acids or with at least about 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to one or more of SEQ ID NOs:2, 4, 6, 8, 10, 12, 14, or 16-20.
[0184]Wild-type and mutant endoglycoceramidases can be further characterized by a (Met/Val/Leu)-Leu-Asp-(Met-Phe-Ala)-His-Gln-Asp-(Met/Val/Leu)-X-(Ser/Asn) motif (motif A or SEQ ID NO:42) located N-terminal to the acid-base sequence region and a C-terminal Ala-Ile-Arg-(Gln/Ser/Thr)-Val-Asp motif (motif C or SEQ ID NO:44) located C-terminal to the acid-base sequence region. For example, the (Met/Val/Leu)-Leu-Asp-(Met-Phe-Ala)-His-Gln-Asp-(Met/Val/Leu) motif is located at residues 131-140 in Rhodococcus sp. M-777; at residues 129-138 in Rhodococcus sp. C9; at residues 136-145 in Propionibacterium acnes EGCa; at residues 153-162 in Propionibacterium acnes EGCb; at residues 130-139 in Cyanea nozakii; and at residues 121-130 in Hydra magnipapillata. The Ala-Ile-Arg-(Gln/Ser/Thr)-Val-Asp motif is located at residues 259-264 in Rhodococcus sp. M-777; at residues 250-255 in Rhodococcus sp. C9; at residues 262-267 in Propionibacterium acnes EGCa; at residues 280-285 in Propionibacterium acnes EGCb; at residues 272-277 in Cyanea nozakii; and at residues 263-268 in Hydra magnipapillata.
[0185]To enhance expression of a mutant endoglycoceramidase in the soluble fraction of a bacterial host cell, the mutant endoglycoceramidases typically have had removed the native N-terminal signal peptide sequence that is expressed in the corresponding wild-type enzyme. The signal peptide sequence is typically found within the N-terminal 15, 20, 25, 30, 35, 40, 40, 45, 50 or 55 amino acid residues of a corresponding wild-type endoglycoceramidase. Predicted native N-terminal signal peptide sequences for wild-type endoglycoceramidases from Rhodococcus, Propionibacter, Cyanea, Hydra, Schistosoma, Dyctyostelium, Streptomyces, and Neurospora species are shown in SEQ ID NOs:59-68.
[0186]In addition to the amino acid sequences that comprise the mutant endoglycoceramidases, the present invention also includes nucleic acid sequences encoding a mutant endoglycoceramidase, expression vectors comprising such nucleic acid sequences, and host cells that comprise such expression vectors.
Cloning and Subcloning of a Wild-Type Endoglycoceramidase Coding Sequence
[0187]A number of polynucleotide sequences encoding wild-type endoglycoceramidases, e.g., GenBank Accession No. U39554, have been determined and can be synthesized or obtained from a commercial supplier, such as Blue Heron Biotechnology (Bothell, Wash.).
[0188]The rapid progress in the studies of organism genomes has made possible a cloning approach where an organism DNA sequence database can be searched for any gene segment that has a certain percentage of sequence homology to a known nucleotide sequence, such as one encoding a previously identified endoglycoceramidase. Any DNA sequence so identified can be subsequently obtained by chemical synthesis and/or a polymerase chain reaction (PCR) technique such as overlap extension method. For a short sequence, completely de novo synthesis may be sufficient; whereas further isolation of full length coding sequence from a human cDNA or genomic library using a synthetic probe may be necessary to obtain a larger gene.
[0189]Alternatively, a nucleic acid sequence encoding an endoglycoceramidase can be isolated from a cDNA or genomic DNA library using standard cloning techniques such as polymerase chain reaction (PCR), where homology-based primers can often be derived from a known nucleic acid sequence encoding an endoglycoceramidase. Most commonly used techniques for this purpose are described in standard texts, e.g., Sambrook and Russell, supra.
[0190]cDNA libraries suitable for obtaining a coding sequence for a wild-type endoglycoceramidase may be commercially available or can be constructed. The general methods of isolating mRNA, making cDNA by reverse transcription, ligating cDNA into a recombinant vector, transfecting into a recombinant host for propagation, screening, and cloning are well known (see, e.g. Gubler and Hoffman, Gene, 25: 263-269 (1983); Ausubel et al., supra). Upon obtaining an amplified segment of nucleotide sequence by PCR, the segment can be further used as a probe to isolate the full length polynucleotide sequence encoding the wild-type endoglycoceramidase from the cDNA library. A general description of appropriate procedures can be found in Sambrook and Russell, supra.
[0191]A similar procedure can be followed to obtain a full length sequence encoding a wild-type endoglycoceramidase from a genomic library. Genomic libraries are commercially available or can be constructed according to various art-recognized methods. In general, to construct a genomic library, the DNA is first extracted from an organism where an endoglycoceramidase is likely found. The DNA is then either mechanically sheared or enzymatically digested to yield fragments of about 12-20 kb in length. The fragments are subsequently separated by gradient centrifugation from polynucleotide fragments of undesired sizes and are inserted in bacteriophage λ vectors. These vectors and phages are packaged in vitro. Recombinant phages are analyzed by plaque hybridization as described in Benton and Davis, Science, 196: 180-182 (1977). Colony hybridization is carried out as described by Grunstein et al., Proc. Natl. Acad. Sci. USA, 72: 3961-3965 (1975).
[0192]Based on sequence homology, degenerate oligonucleotides can be designed as primer sets and PCR can be performed under suitable conditions (see, e.g., White et al., PCR Protocols: Current Methods and Applications, 1993; Griffin and Griffin, PCR Technology, CRC Press Inc. 1994) to amplify a segment of nucleotide sequence from a cDNA or genomic library. Using the amplified segment as a probe, the full length nucleic acid encoding a wild-type endoglycoceramidase is obtained. Oligonucleotides that are not commercially available can be chemically synthesized, e.g., according to the solid phase phosphoramidite triester method first described by Beaucage & Caruthers, Tetrahedron Lett. 22: 1859-1862 (1981), using an automated synthesizer, as described in Van Devanter et. al., Nucleic Acids Res. 12: 6159-6168 (1984). Purification of oligonucleotides is performed using any art-recognized strategy, e.g., native acrylamide gel electrophoresis or anion-exchange HPLC as described in Pearson & Reanier, J. Chrom. 255: 137-149 (1983).
[0193]Upon acquiring a nucleic acid sequence encoding a wild-type endoglycoceramidase, the coding sequence can be subcloned into a vector, for instance, an expression vector, so that a recombinant endoglycoceramidase can be produced from the resulting construct. Further modifications to the wild-type endoglycoceramidase coding sequence, e.g., nucleotide substitutions, may be subsequently made to alter the characteristics of the enzyme.
Methods for Producing Mutant Endoglycoceramidases
[0194]In one aspect, the invention provides a method for generating a mutant endoglycoceramidase having a synthetic activity of coupling a saccharide and a substrate and forming glycolipids compared to the corresponding wild-type endoglycoceramidases. The mutant endoglycoceramidase can also have a reduced hydrolytic activity towards glycolipids compared to the corresponding wild-type endoglycoceramidase. The method includes selectively conferring synthetic activity and/or disrupting the hydrolytic activity of the corresponding wild-type endoglycoceramidase. Synthetic activity can be conferred by modifying the nucleophilic carboxylate amino acid residue (i.e., a Glu or an Asp) of a corresponding wild-type endoglycoceramidase.
[0195]Accordingly, in one aspect, the invention provides a method for making a mutant endoglycoceramidase having enhanced synthetic activity in comparison to a corresponding wild-type endoglycoceramidase, the method comprising modifying the nucleophilic carboxylate amino acid residue in a corresponding wild-type endoglycoceramidase, wherein the nucleophilic carboxylate amino acid residue resides within a (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-(Glu/Asp)-(Phe/Thr/- Met/Leu)-(Gly/Leu/Phe) sequence (SEQ ID NO:46) of a corresponding wild-type endoglycoceramidase.
[0196]In carrying out the methods of producing a mutant endoglycoceramidase, one or both of the nucleophilic carboxylate amino acid residues (i.e., a Glu or an Asp) and/or acid-base sequence region Glu residues of a corresponding endoglycoceramidase can be deleted or replaced with another chemical moiety that retains the integral structure of the protein such that the mutant enzyme has synthetic activity. For example, one or more of the nucleophilic and/or hydrolytic Glu or Asp residues can be replaced with an L-amino acid residue other than Glu or Asp, a D-amino acid residue (including a D-Glu or a D-Asp), an unnatural amino acid, an amino acid analog, an amino acid mimetic, and the like. Usually, the one or more Glu or Asp residues are substituted with another L-amino acid other than Glu or Asp, for example, Gly, Ala, Ser, Asp, Asn, Glu, Gln, Cys, Thr, Ile, Leu or Val.
Introducing Mutations into the Endoglycoceramidase Coding Sequence
[0197]Modifications altering the enzymatic activity of an endoglycoceramidase may be made in various locations within the polynucleotide coding sequence. The preferred locations for such modifications are, however, within the nucleophilic site and the acid-base sequence region of the enzyme. Conserved regions likely to contain important residues for structure or native enzymatic activity can be identified by aligning amino acid sequences of wild-type endoglycoceramidases from different organisms. Such amino acid sequences are readily available on public databases, including GenBank. Alignment of endoglycoceramidase sequences with an endoglycoceramidase sequence where the nucleophilic residue has been identified allows for the identification of the nucleophilic residue in subsequent sequences. Alternatively, the nucleophilic residue can be identified (or confirmed) via a fluorosugar labeling strategy (see, U.S. Pat. No. 5,716,812).
[0198]From an encoding nucleic acid sequence, the amino acid sequence of a wild-type endoglycoceramidase, e.g., SEQ ID NOs:2, 4, 6, 8, 10, 12, 14, 16-20 can be deduced and the presence of a nucleophilic region or an acid-base region can be confirmed. Preferably, mutations are introduced into the nucleophilic region or the acid-base region. For instance, the Glu residue located in the middle of the three-amino acid segment Asn-Glu-Pro of the acid-base sequence region, can be targeted for mutation, such as deletion or substitution by another amino acid residue. In addition, the nucleophilic carboxylate (i.e., Glu or Asp) residue (bolded) in the (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-Glu/Asp-(Phe/Thr/Me- t/Leu)-(Gly/Leu/Phe) motif of a corresponding wild-type endoglycoceramidase is also a target for introducing mutations to alter the enzymatic activity of an endoglycoceramidase. An artisan can accomplish the goal of mutating a target Glu residue by employing any one of the well known mutagenesis methods, which are discussed in detail below. Exemplary modifications are introduced to replace the Glu residue with another amino acid residue as depicted in SEQ ID NOs:21-25.
[0199]Modifications can be directed to the nucleic acid sequence encoding a wild-type or mutant endoglycoceramidase or to one or more amino acids of an endoglycoceramidase enzyme. Typically, modifications are directed to one or more nucleic acid codons encoding one or both of the nucleophilic site and the acid-base sequence region. For example, one or more nucleic acids in the codon encoding for the Glu residue in the acid-base sequence region are modified such that the codon encodes for an amino acid other than Glu, for example, Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val. In another example, one or more nucleic acids in the codon encoding for the Glu residue in the nucleophilic site are modified such that the codon encodes for an amino acid other than Glu, for example, Gly, Ala, Ser, Asp, Asn, Gln, Cys, Thr, Ile, Leu or Val. Site-directed modifications to wild-type or mutant endoglycoceramidase nucleic acid sequences can be introduced using methods well-known in the art, including overlapping PCR or overlap extension PCR (see, for example, Aiyar, et al., Methods Mol Biol (1996) 57:177-91; and Pogulis, et al., Methods Mol Biol (1996) 57:167-76). Suitable PCR primers can be determined by one of skill in the art using the sequence information provided in GenBank or other sources. Services for large-scale site-directed mutagenesis of a desired sequence are commercially available, for example, from GeneArt of Toronto, Canada.
[0200]In addition, a variety of diversity-generating protocols are established and described in the art. See, e.g., Zhang et al., Proc. Natl. Acad. Sci. USA, 94: 4504-4509 (1997); and Stemmer, Nature, 370: 389-391 (1994). The procedures can be used separately or in combination to produce variants of a set of nucleic acids, and hence variants of encoded polypeptides. Kits for mutagenesis, library construction, and other diversity-generating methods are commercially available.
[0201]Mutational methods of generating diversity include, for example, site-directed mutagenesis (Botstein and Shortle, Science, 229: 1193-1201 (1985)), mutagenesis using uracil-containing templates (Kunkel, Proc. Natl. Acad. Sci. USA, 82: 488-492 (1985)), oligonucleotide-directed mutagenesis (Zoller and Smith, Nucl. Acids Res., 10: 6487-6500 (1982)), phosphorothioate-modified DNA mutagenesis (Taylor et al., Nucl. Acids Res., 13: 8749-8764 and 8765-8787 (1985)), and mutagenesis using gapped duplex DNA (Kramer et al., Nucl. Acids Res., 12: 9441-9456 (1984)).
[0202]Other possible methods for generating mutations include point mismatch repair (Kramer et al., Cell, 38: 879-887 (1984)), mutagenesis using repair-deficient host strains (Carter et al., Nucl. Acids Res., 13: 4431-4443 (1985)), deletion mutagenesis (Eghtedarzadeh and Henikoff, Nucl. Acids Res., 14: 5115 (1986)), restriction-selection and restriction-purification (Wells et al., Phil. Trans. R. Soc. Lond. A, 317: 415-423 (1986)), mutagenesis by total gene synthesis (Nambiar et al., Science, 223: 1299-1301 (1984)), double-strand break repair (Mandecki, Proc. Natl. Acad. Sci. USA, 83: 7177-7181 (1986)), mutagenesis by polynucleotide chain termination methods (U.S. Pat. No. 5,965,408), and error-prone PCR (Leung et al., Biotechniques, 1: 11-15 (1989)).
[0203]At the completion of modification, the mutant endoglycoceramidase coding sequences can then be subcloned into an appropriate vector for recombinant production in the same manner as the wild-type genes.
Modification of Nucleic Acids for Preferred Codon Usage in a Host Organism
[0204]The polynucleotide sequence encoding an endoglycoceramidase (either wild-type or mutant) can be altered to coincide with the preferred codon usage of a particular host. For example, the preferred codon usage of one strain of bacteria can be used to derive a polynucleotide that encodes a mutant endoglycoceramidase of the invention and includes the codons favored by this strain. The frequency of preferred codon usage exhibited by a host cell can be calculated by averaging frequency of preferred codon usage in a large number of genes expressed by the host cell (e.g., calculation service is available from web site of the Kazusa DNA Research Institute, Japan). This analysis is preferably limited to genes that are highly expressed by the host cell. U.S. Pat. No. 5,824,864, for example, provides the frequency of codon usage by highly expressed genes exhibited by dicotyledonous plants and monocotyledonous plants. Services for the creation of nucleic acid sequences of preferred codon usage for optimized expression in cells of a particular desired organism (e.g. bacteria, yeast, insect, mammalian) can be commercially purchased, for example, from Blue Heron Biotechnology, Bothell, Wash.
[0205]The sequences of the cloned endoglycoceramidase genes, synthetic polynucleotides, and modified endoglycoceramidase genes can be verified using, e.g., the chain termination method for sequencing double-stranded templates as described in Wallace et al., Gene 16:21-26 (1981).
Expression of the Endoglycoceramidases
[0206]Following sequence verification, the wild-type or mutant endoglycoceramidase of the present invention can be produced using routine techniques in the field of recombinant genetics, relying on the polynucleotide sequences encoding the polypeptide disclosed herein.
Expression Systems
[0207]To obtain high level expression of a nucleic acid encoding a wild-type or a mutant endoglycoceramidase of the present invention, one typically subclones a polynucleotide encoding the endoglycoceramidase into an expression vector that contains a strong promoter to direct transcription, a transcription/translation terminator and a ribosome binding site for translational initiation. Suitable bacterial promoters are well known in the art and described, e.g., in Sambrook and Russell, supra, and Ausubel et al., supra. Bacterial expression systems for expressing the wild-type or mutant endoglycoceramidase are available in, e.g., E. coli, Bacillus sp., Salmonella, and Caulobacter. Kits for such expression systems are commercially available. Eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available. For example, Pichia and Baculovirus expression systems can be purchased from Invitrogen (Carlsbad, Calif.). Pichia expression systems are also available for purchase from Research Corporation Technologies of Tucson, Ariz. Mammalian cells for heterologous polypeptide expression can be purchased from the American Type Culture Collection (ATCC) in Manassas, Va. and expression systems are commercially available, for example, from New England Biolabs, Beverly, Mass. In one embodiment, the eukaryotic expression vector is an adenoviral vector, an adeno-associated vector, or a retroviral vector.
[0208]The host cells are preferably microorganisms, such as, for example, yeast cells, bacterial cells, or filamentous fungal cells. Examples of suitable host cells include, for example, Azotobacter sp. (e.g., A. vinelandii), Pseudomonas sp., Rhizobium sp., Erwinia sp., Escherichia sp. (e.g., E. coli), Bacillus, Pseudomonas, Proteus, Salmonella, Serratia, Shigella, Rhizobia, Vitreoscilla, Paracoccus and Klebsiella sp., among many others. The cells can be of any of several genera, including Saccharomyces (e.g., S. cerevisiae), Candida (e.g., C. utilis, C. parapsilosis, C. krusei, C. versatilis, C. lipolytica, C. zeylanoides, C. guilliermondii, C. albicans, and C. humicola), Pichia (e.g., P. farinosa and P. ohmeri), Torulopsis (e.g., T. candida, T. sphaerica, T. xylinus, T. famata, and T. versatilis), Debaryomyces (e.g., D. subglobosus, D. cantarellii, D. globosus, D. hansenii, and D. japonicus), Zygosaccharomyces (e.g., Z. rouxii and Z. bailii), Kluyveromyces (e.g., K. marxianus), Hansenula (e.g., H. anomala and H. jadinii), and Brettanomyces (e.g., B. lambicus and B. anomalus). Examples of useful bacteria include, but are not limited to, Escherichia, Enterobacter, Azotobacter, Erwinia, Klebsielia, Bacillus, Pseudomonas, Proteus, and Salmonella. Suitable mammalian cells for expression include Chinese Hamster Ovary (CHO) cells, human epithial kidney (HEK)293 cells, and NIH 3T3 cells.
[0209]A construct that includes a polynucleotide of interest operably linked to gene expression control signals that, when placed in an appropriate host cell, drive expression of the polynucleotide is termed an "expression cassette." A typical expression cassette generally contains a promoter operably linked to the nucleic acid sequence encoding the wild-type or mutant endoglycoceramidase and signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination. Accordingly, the invention provides expression cassettes into which the nucleic acids that encode fusion proteins are incorporated for high level expression in a desired host cell. The nucleic acid sequence encoding the endoglycoceramidase is typically linked to a cleavable signal peptide sequence to promote secretion of the endoglycoceramidase by the transformed cell. Such signal peptides include, among others, the signal peptides from tissue plasminogen activator, insulin, and neuron growth factor, and juvenile hormone esterase of Heliothis virescens. Additional elements of the cassette may include enhancers and, if genomic DNA is used as the structural gene, introns with functional splice donor and acceptor sites.
[0210]Typically, the polynucleotide that encodes the wild-type or mutant endoglycoceramidase polypeptides is placed under the control of a promoter that is functional in the desired host cell. An extremely wide variety of promoters are well known, and can be used in the expression vectors of the invention, depending on the particular application. Ordinarily, the promoter selected depends upon the cell in which the promoter is to be active. Other expression control sequences such as ribosome binding sites, transcription termination sites and the like are also optionally included.
[0211]Expression control sequences that are suitable for use in a particular host cell are often obtained by cloning a gene that is expressed in that cell. Commonly used prokaryotic control sequences, which are defined herein to include promoters for transcription initiation, option ally with an operator, along with ribosome binding site sequences, include such commonly used promoters as the beta-lactamase (penicillinase) and lactose (lac) promoter systems (Change et al., Nature (1977) 198: 1056), the tryptophan (trp) promoter system (Goeddel et al., Nucleic Acids Res. (1980) 8: 4057), the tac promoter (DeBoer, et al., Proc. Natl. Acad. Sci. U.S.A. (1983) 80:21-25); and the lambda-derived PL promoter and N-gene ribosome binding site (Shimatake et al., Nature (1981) 292: 128). The particular promoter system is not critical to the invention, any available promoter that functions in prokaryotes can be used.
[0212]For expression of endoglycoceramidase proteins in host cells other than E. coli, a promoter that functions in the particular prokaryotic species is required. Such promoters can be obtained from genes that have been cloned from the species, or heterologous promoters can be used. For example, the hybrid trp-lac promoter functions in Bacillus in addition to E. coli.
[0213]A ribosome binding site (RBS) is conveniently included in the expression cassettes of the invention. An RBS in E. coli, for example, consists of a nucleotide sequence 3-9 nucleotides in length located 3-11 nucleotides upstream of the initiation codon (Shine and Dalgarno, Nature (1975) 254: 34; Steitz, In Biological regulation and development: Gene expression (ed. R. F. Goldberger), vol. 1, p. 349, 1979, Plenum Publishing, NY).
[0214]For expression of the endoglycoceramidase proteins in yeast, convenient promoters include GAL1-10 (Johnson and Davies (1984) Mol. Cell. Biol. 4:1440-1448) ADH2 (Russell et al. (1983) J. Biol. Chem. 258:2674-2682), PHO5 (EMBO J. (1982) 6:675-680), and MFα (Herskowitz and Oshima (1982) in The Molecular Biology of the Yeast Saccharomyces (eds. Strathern, Jones, and Broach) Cold Spring Harbor Lab., Cold Spring Harbor, N.Y., pp. 181-209). Additional suitable promoters for use in yeast include the ADH2/GAPDH hybrid promoter as described in Cousens et al., Gene 61:265-275 (1987) and the AOX1 promoter for use in Pichia strains. For filamentous fungi such as, for example, strains of the fungi Aspergillus (McKnight et al., U.S. Pat. No. 4,935,349), examples of useful promoters include those derived from Aspergillus nidulans glycolytic genes, such as the ADH3 promoter (McKnight et al., EMBO J. 4: 2093 2099 (1985)) and the tpiA promoter. Yeast selectable markers include ADE2, HIS4, LEU2, TRP1, and ALG7, which confers resistance to tunicamycin; the neomycin phosphotransferase gene, which confers resistance to G418; and the CUP1 gene, which allows yeast to grow in the presence of copper ions. An example of a suitable terminator is the ADH3 terminator (McKnight et al.). Recombinant protein expression in yeast host cells is well known in the art. See, for example, Pichia Protocols, Higgins and Cregg, eds., 1998, Humana Press; Foreign Gene Expression in Fission Yeast: Schizosaccharomyces Pombe, Giga-Hama and Kumagai eds., 1997, Springer Verlag. Expression of heterologous proteins in Pichia strains of yeast (including Pichia pastoris, Pichia methanolica, and Pichia ciferrii) is also described in U.S. Pat. Nos. 6,638,735; 6,258,559; 6,194,196; 6,001,597; and 5,707,828, the disclosures of which are hereby incorporated herein by reference in their entirety for all purposes.
[0215]Either constitutive or regulated promoters can be used in the present invention. Regulated promoters can be advantageous because the host cells can be grown to high densities before expression of the endoglycoceramidase proteins is induced. High level expression of heterologous proteins slows cell growth in some situations. An inducible promoter is a promoter that directs expression of a gene where the level of expression is alterable by environmental or developmental factors such as, for example, temperature, pH, anaerobic or aerobic conditions, light, transcription factors and chemicals. Such promoters are referred to herein as "inducible" promoters, which allow one to control the timing of expression of the endoglycoceramidase proteins. For E. coli and other bacterial host cells, inducible promoters are known to those of skill in the art. These include, for example, the lac promoter, the bacteriophage lambda PL promoter, the hybrid trp-lac promoter (Amann et al. (1983) Gene 25: 167; de Boer et al. (1983) Proc. Nat'l. Acad. Sci. USA 80: 21), and the bacteriophage T7 promoter (Studier et al. (1986) J. Mol. Biol.; Tabor et al. (1985) Proc. Nat'l. Acad. Sci. USA 82: 1074-8). These promoters and their use are discussed in Sambrook et al., supra. One preferred inducible promoter for expression in prokaryotes is a dual promoter that includes a tac promoter component linked to a promoter component obtained from a gene or genes that encode enzymes involved in galactose metabolism (e.g., a promoter from a UDP galactose 4-epimerase gene (galE)). The dual tac-gal promoter, which is described in PCT Patent Application Publ. No. WO98/20111.
[0216]The particular expression vector used to transport the genetic information into the cell is not particularly critical. Any of the conventional vectors used for expression in eukaryotic or prokaryotic cells may be used. Standard bacterial expression vectors include plasmids such as pBR322 based plasmids, pSKF, pUC based plasmids, pET based plasmids (i.e., pET23D, pET28A, commercially available from Novagen/EMD Biosciences) and fusion expression systems such as GST and LacZ. Epitope tags can also be added to recombinant proteins to provide convenient methods of isolation, e.g., c-myc. In yeast, vectors include Yeast Integrating plasmids (e.g., YIp5) and Yeast Replicating plasmids (the YRp series plasmids) and pGPD-2.
[0217]Expression vectors containing regulatory elements from eukaryotic viruses are typically used in eukaryotic expression vectors, e.g., SV40 vectors, papilloma virus vectors, and vectors derived from Epstein-Barr virus. Other exemplary eukaryotic vectors include pMSG, pAV009/A.sup.+, pMTO10/A.sup.+, pMAMeo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV40 early promoter, SV40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells. Expression in mammalian cells can be achieved using a variety of commonly available plasmids, including pSV2, pBC12BI, and p91023, as well as lytic virus vectors (e.g., vaccinia virus, adeno virus, and baculovirus), episomal virus vectors (e.g., bovine papillomavirus), and retroviral vectors (e.g., murine retroviruses). Mammalian host cells suitable for expression of heterologous polypeptides include, for example, Chinese Hamster Ovary (CHO) cells, human epithial kidney (HEK)293 cells, and NIH 3T3 cells. Expression of heterologous polypeptides in mammalian expression systems is reviewed in Makrides, Gene Transfer and Expression in Mammalian Cells: New Comprehensive Biochemistry, 2003, Elsevier Science Ltd.
[0218]Some expression systems have markers that provide gene amplification such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase. Alternatively, high yield expression systems not involving gene amplification are also suitable, such as a baculovirus vector in insect cells, with a polynucleotide sequence encoding the mutant endoglycoceramidase under the direction of the polyhedrin promoter or other strong baculovirus promoters.
[0219]The elements that are typically included in expression vectors also include a replicon that functions in E. coli, a gene encoding antibiotic resistance to permit selection of bacteria that harbor recombinant plasmids, and unique restriction sites in nonessential regions of the plasmid to allow insertion of eukaryotic sequences. The particular antibiotic resistance gene chosen is not critical, any of the many resistance genes known in the art are suitable. The prokaryotic sequences are optionally chosen such that they do not interfere with the replication of the DNA in eukaryotic cells, if necessary.
[0220]Translational coupling may be used to enhance expression. The strategy uses a short upstream open reading frame derived from a highly expressed gene native to the translational system, which is placed downstream of the promoter, and a ribosome binding site followed after a few amino acid codons by a termination codon. Just prior to the termination codon is a second ribosome binding site, and following the termination codon is a start codon for the initiation of translation. The system dissolves secondary structure in the RNA, allowing for the efficient initiation of translation. See Squires, et. al. (1988), J. Biol. Chem. 263: 16297-16302.
[0221]The endoglycoceramidase polypeptides can be expressed intracellularly, or can be secreted from the cell. Intracellular expression often results in high yields. If necessary, the amount of soluble, active fusion protein may be increased by performing refolding procedures (see, e.g., Sambrook et al., supra.; Marston et al., Bio/Technology (1984) 2: 800; Schoner et al., Bio/Technology (1985) 3:151). In embodiments in which the endoglycoceramidase polypeptides are secreted from the cell, either into the periplasm or into the extracellular medium, the DNA sequence is linked to a cleavable signal peptide sequence. The signal sequence directs translocation of the fusion protein through the cell membrane. An example of a suitable vector for use in E. coli that contains a promoter-signal sequence unit is pTA1529, which has the E. coli phoA promoter and signal sequence (see, e.g., Sambrook et al., supra.; Oka et al., Proc. Natl. Acad. Sci. USA (1985) 82: 7212; Talmadge et al., Proc. Natl. Acad. Sci. USA (1980) 77: 3988; Takahara et al., J. Biol. Chem. (1985) 260: 2670). In another embodiment, the fusion proteins are fused to a subsequence of protein A or bovine serum albumin (BSA), for example, to facilitate purification, secretion, or stability.
[0222]The endoglycoceramidase polypeptides of the invention can also be further linked to other bacterial proteins. This approach often results in high yields, because normal prokaryotic control sequences direct transcription and translation. In E. coli, lacZ fusions are often used to express heterologous polypeptides. Suitable vectors are readily available, such as the pUR, pEX, and pMR100 series (see, e.g., Sambrook et al., supra.). For certain applications, it may be desirable to cleave the non-endoglycoceramidase from the fusion protein after purification. This can be accomplished by any of several methods known in the art, including cleavage by cyanogen bromide, a protease, or by Factor Xa (see, e.g., Sambrook et al., supra.; Itakura et al., Science (1977) 198: 1056; Goeddel et al., Proc. Natl. Acad. Sci. USA (1979) 76:106; Nagai et al., Nature (1984) 309: 810; Sung et al., Proc. Natl. Acad. Si. USA (1986) 83: 561). Cleavage sites can be engineered into the gene for the fusion protein at tme desired point of cleavage. The present invention further encompasses vectors comprising fusion proteins comprising the mutant endoglycoceramidases.
[0223]More than one recombinant protein may be expressed in a single host cell by placing multiple transcriptional cassettes in a single expression vector, or by utilizing different selectable markers for each of the expression vectors which are employed in the cloning strategy.
[0224]A suitable system for obtaining recombinant proteins from E. coli which maintains the integrity of their N-termini has been described by Miller et al. Biotechnology 7:698-704 (1989). In this system, the gene of interest is produced as a C-terminal fusion to the first 76 residues of the yeast ubiquitin gene containing a peptidase cleavage site. Cleavage at the junction of the two moieties results in production of a protein having an intact authentic N-terminal reside.
[0225]As discussed above, a person skilled in the art will recognize that various conservative substitutions can be made to any wild-type or mutant endoglycoceramidase or its coding sequence while still retaining the synthetic activity of the endoglycoceramidase. Moreover, modifications of a polynucleotide coding sequence may also be made to accommodate preferred codon usage in a particular expression host without altering the resulting amino acid sequence.
[0226]When recombinantly over-expressed in bacteria, wild-type and mutant endoglycoceramidases can form insoluble protein aggregates; significant amounts of the recombinant protein will reside in the insoluble fraction during subsequent purification procedures. Expression of recombinant endoglycoceramidases in insoluble inclusion bodies can be minimized by using one or more of several strategies known to those in the art, including for example, expressing from an inducible promoter (e.g., lac, T7), adding low concentrations of inducer (e.g., IPTG), using bacterial expression strains that suppress uninduced protein expression (e.g., BL21 pLysS), using a bacterial expression strain with a heightened sensitivity to the concentration of inducer (e.g., Tuner® host cells from Novagen/EMD Biosciences, San Diego, Calif.), using a bacterial expression strain that favors disulfide formation of expressed recombinant proteins (e.g., Origami® host cells from Novagen), using minimal media (e.g., M9), varying induction temperatures (e.g., 16-37° C.), adding a signal sequence to direct secretion into the periplasm (e.g., pelB).
Transfection Methods
[0227]Standard transfection methods are used to produce bacterial, mammalian, yeast or insect cell lines that express large quantities of the wild-type or mutant endoglycoceramidase, which are then purified using standard techniques (see, e.g., Colley et al., J. Biol. Chem. 264: 17619-17622 (1989); Guide to Protein Purification, in Methods in Enzymology, vol. 182 (Deutscher, ed., 1990)). Transformation of eukaryotic and prokaryotic cells are performed according to standard techniques (see, e.g., Morrison, J. Bact. 132: 349-351 (1977); Clark-Curtiss & Curtiss, Methods in Enzymology 101: 347-362 (Wu et al., eds, 1983).
[0228]Any of the well known procedures for introducing foreign nucleotide sequences into host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, liposomes, microinjection, plasma vectors, viral vectors and any of the other well known methods for introducing cloned genomic DNA, cDNA, synthetic DNA, or other foreign genetic material into a host cell (see, e.g., Sambrook and Russell, supra). It is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one gene into the host cell capable of expressing the wild-type or mutant endoglycoceramidase.
Detection of the Expression of Recombinant Endoglycoceramidases
[0229]After the expression vector is introduced into appropriate host cells, the transfected cells are cultured under conditions favoring expression of the wild-type or mutant endoglycoceramidase. The cells are then screened for the expression of the recombinant polypeptide, which is subsequently recovered from the culture using standard techniques (see, e.g., Scopes, Protein Purification: Principles and Practice (1982); U.S. Pat. No. 4,673,641; Ausubel et al., supra; and Sambrook and Russell, supra).
[0230]Several general methods for screening gene expression are well known among those skilled in the art. First, gene expression can be detected at the nucleic acid level. A variety of methods of specific DNA and RNA measurement using nucleic acid hybridization techniques are commonly used (e.g., Sambrook and Russell, supra). Some methods involve an electrophoretic separation (e.g., Southern blot for detecting DNA and Northern blot for detecting RNA), but detection of DNA or RNA can be carried out without electrophoresis as well (such as by dot blot). The presence of nucleic acid encoding an endoglycoceramidase in transfected cells can also be detected by PCR or RT-PCR using sequence-specific primers.
[0231]Second, gene expression can be detected at the polypeptide level. Various immunological assays are routinely used by those skilled in the art to measure the level of a gene product, particularly using polyclonal or monoclonal antibodies that react specifically with a wild-type or mutant endoglycoceramidase of the present invention, such as a polypeptide having the amino acid sequence of SEQ ID NOs:21-25, (e.g., Harlow and Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor, 1998; Harlow and Lane, Antibodies, A Laboratory Manual, Chapter 14, Cold Spring Harbor, 1988; Kohler and Milstein, Nature, 256: 495-497 (1975)). Such techniques require antibody preparation by selecting antibodies with high specificity against the recombinant polypeptide or an antigenic portion thereof. The methods of raising polyclonal and monoclonal antibodies are well established and their descriptions can be found in the literature, see, e.g., Harlow and Lane, supra; Kohler and Milstein, Eur. J. Immunol., 6: 511-519 (1976). More detailed descriptions of preparing antibody against the mutant endoglycoceramidase of the present invention and conducting immunological assays detecting the mutant endoglycoceramidase are provided in a later section.
[0232]In addition, functional assays may also be performed for the detection of a recombinant endoglycoceramidase in transfected cells. Assays for detecting hydrolytic or synthetic activity of the recombinant endoglycoceramidase are generally described in a later section.
Purification of Recombinant Endoglycoceramidases
Solubilization
[0233]Once the expression of a recombinant endoglycoceramidase in transfected host cells is confirmed, the host cells are then cultured in an appropriate scale for the purpose of purifying the recombinant enzyme.
[0234]When the endoglycoceramidases of the present invention are produced recombinantly by transformed bacteria in large amounts, typically after promoter induction, although expression can be constitutive, the proteins may form insoluble aggregates. There are several protocols that are suitable for purification of protein inclusion bodies. For example, purification of aggregate proteins (hereinafter referred to as inclusion bodies) typically involves the extraction, separation and/or purification of inclusion bodies by disruption of bacterial cells, e.g., by incubation in a buffer of about 100-150 μg/ml lysozyme and 0.1% Nonidet P40, a non-ionic detergent. The cell suspension can be ground using a Polytron grinder (Brinkman Instruments, Westbury, N.Y.). Alternatively, the cells can be sonicated on ice. Alternate methods of lysing bacteria are described in Ausubel et al. and Sambrook and Russell, both supra, and will be apparent to those of skill in the art.
[0235]The cell suspension is generally centrifuged and the pellet containing the inclusion bodies resuspended in buffer which does not dissolve but washes the inclusion bodies, e.g., 20 mM Tris-HCl (pH 7.2), 1 mM EDTA, 150 mM NaCl and 2% Triton-X 100, a non-ionic detergent. It may be necessary to repeat the wash step to remove as much cellular debris as possible. The remaining pellet of inclusion bodies may be resuspended in an appropriate buffer (e.g., 20 mM sodium phosphate, pH 6.8, 150 mM NaCl). Other appropriate buffers will be apparent to those of skill in the art.
[0236]Following the washing step, the inclusion bodies are solubilized by the addition of a solvent that is both a strong hydrogen acceptor and a strong hydrogen donor (or a combination of solvents each having one of these properties). The proteins that formed the inclusion bodies may then be renatured by dilution or dialysis with a compatible buffer. Suitable solubilization solvents include, but are not limited to, urea (from about 4 M to about 8 M), formamide (at least about 80%, volume/volume basis), guanidine hydrochloride (from about 4 M to about 8 M), and detergents including N-laurylsarcosine (sarkosyl), 3-(Cyclohexylamino)-1-propanesulfonic acid (CAPS), 3-[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), and lauryl maltoside. Some solvents that are capable of solubilizing aggregate-forming proteins, such as SDS (sodium dodecyl sulfate) and 70% formic acid, may be inappropriate for use in this procedure due to the possibility of irreversible denaturation of the proteins, accompanied by a lack of immunogenicity and/or activity. Although guanidine hydrochloride and similar agents are denaturants, this denaturation is not irreversible and renaturation may occur upon removal (by dialysis, for example) or dilution of the denaturant, allowing re-formation of the immunologically and/or biologically active protein of interest. After solubilization, the protein can be separated from other bacterial proteins by standard separation techniques.
[0237]Alternatively, it is possible to purify recombinant polypeptides, e.g., a mutant endoglycoceramidase, from bacterial periplasm. Where the recombinant protein is exported into the periplasm of the bacteria, the periplasmic fraction of the bacteria can be isolated by cold osmotic shock in addition to other methods known to those of skill in the art (see e.g., Ausubel et al., supra). To isolate recombinant proteins from the periplasm, the bacterial cells are centrifuged to form a pellet. The pellet is resuspended in a buffer containing 20% sucrose. To lyse the cells, the bacteria are centrifuged and the pellet is resuspended in ice-cold 5 mM MgSO4 and kept in an ice bath for approximately 10 minutes. The cell suspension is centrifuged and the supernatant decanted and saved. The recombinant proteins present in the supernatant can be separated from the host proteins by standard separation techniques well known to those of skill in the art. Proteins exported into the periplasmic space may still form inclusion bodies.
Protein Refolding
[0238]Wild-type or mutant endoglycoceramidases purified from inclusion bodies generally must be refolded after solubilization. The presence of recombinantly expressed endoglycoceramidases in inclusion bodies can be minimized and subsequent proper refolding maximized by expressing the enzymes in a bacterial strain that favors formation of disulfide bonds (e.g., Origami® host cells from Novagen/EMD Biosciences). Alternatively, unpaired cysteines, signal peptide sequences can be removed from the recombinant sequences, for instance, using truncation and site-directed mutagenesis techniques. The presence of recombinantly expressed enzyme in inclusion bodies also can be minimized by expressing the endoglycoceramidases as a fusion protein with a maltose binding domain (see, for example, Sachdev and Chirgwin, Protein Expr Purif. (1998) 1:122-32). Enzyme ultimately purified from inclusion bodies can be solubilized and then subject to refolding buffers containing redox couples, for example reduced glutathione/oxidized glutathione (GSH/GSSH), or cysteine/cystamine. Described in, PCT/US05/03856 which claims priority to U.S. Provisional Patent Application Nos. 60/542,210; 60/599,406; and 60/627,406, the disclosures of each of which are hereby incorporated herein by reference in their entirety or all purposes. Protein refolding kits are commercially available, for example, from Novagen/EMD Biosciences (see also, Frankel, et al., Proc. Natl. Acad. Sci. USA (1991) 88:1192-1196). Optimization of biochemical variables for proper refolding of a particular endoglycoceramidase, including protein concentration, addition of polar additives (e.g., arginine), pH, redox environment potential (the presence of redox couples), ionic strength, and species and concentration of detergent, chaotrope, divalent cations, osmolytes (e.g., polyethylene glycol (PEG)), non-polar additives (e.g., sugars) can be evaluated using a fractional factorial screen, described in Armstrong, et al., Protein Science (1999) 8:1475-1483. Kits for carrying out fractional factorial protein refolding optimization screens are commercially available, for example, from Hampton Research, Laguna Niguel, Calif.).
Purification of Protein
Purification Tags
[0239]The recombinant fusion protein of the invention can be constructed and expressed as a fusion protein with a molecular "purification tag" at one end, which facilitates purification of the protein. Such tags can also be used for immobilization of a protein of interest during the glycosylation reaction. Exemplified purification tags include MalE, 6 or more sequential histidine residues, cellulose binding protein, maltose binding protein (malE), glutathione S-transferase (GST), lactoferrin, and Sumo fusion protein cleavable sequences (commercially available from LifeSensors, Malvern, Pa. and EMD Biosciences). Vectors with purification tag sequences are commercially available from, for example, Novagen/EMD Biosciences. Suitable tags include "epitope tags," which are a protein sequence that is specifically recognized by an antibody. Epitope tags are generally incorporated into fusion proteins to enable the use of a readily available antibody to unambiguously detect or isolate the fusion protein. A "FLAG tag" is a commonly used epitope tag, specifically recognized by a monoclonal anti-FLAG antibody, consisting of the sequence AspTyrLysAspAspAsp AspLys or a substantially identical variant thereof. Other epitope tags that can be used in the invention include, e.g., myc tag, AU1, AU5, DDDDK (EC5), E tag, E2 tag, Glu-Glu, a 6 residue histidine peptide, EYMPME, derived from the Polyoma middle T protein, HA, HSV, IRS, KT3, S tag, S1 tag, T7 tag, V5 tag, VSV-G, β-galactosidase, Gal4, green fluorescent protein (GFP), luciferase, protein C, protein A, cellulose binding protein, GST (glutathione S-transferase), a step-tag, Nus-S, PPI-ases, Pfg 27, calmodulin binding protein, dsb A and fragments thereof, and granzyme B. Epitope peptides and antibodies that bind specifically to epitope sequences are commercially available from, e.g., Covance Research Products, Inc.; Bethyl Laboratories, Inc.; Abcam Ltd.; and Novus Biologicals, Inc.
[0240]Other haptens that are suitable for use as tags are known to those of skill in the art and are described, for example, in the Handbook of Fluorescent Probes and Research Chemicals (6th Ed., Molecular Probes, Inc., Eugene Oreg.). For example, dinitrophenol (DNP), digoxigenin, barbiturates (see, e.g., U.S. Pat. No. 5,414,085), and several types of fluorophores are useful as haptens, as are derivatives of these compounds. Kits are commercially available for linking haptens and other moieties to proteins and other molecules. For example, where the hapten includes a thiol, a heterobifunctional linker such as SMCC can be used to attach the tag to lysine residues present on the capture reagent.
Standard Protein Separation Techniques For Purification
[0241]When a recombinant polypeptide, e.g., the mutant endoglycoceramidase of the present invention, is expressed in host cells in a soluble form, its purification can follow the standard protein purification procedures known in the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like (see, generally, R. Scopes, Protein Purification, Springer-Verlag, N.Y. (1982), Deutscher, Methods in Enzymology Vol. 182: Guide to Protein Purification, Academic Press, Inc. N.Y. (1990)). Substantially pure compositions of at least about 70, 75, 80, 85, 90% homogeneity are preferred, and 92, 95, 98 to 99% or more homogeneity are most preferred. The purified proteins may also be used, e.g., as immunogens for antibody production.
Solubility Fractionation
[0242]Often as an initial step, and if the protein mixture is complex, an initial salt fractionation can separate many of the unwanted host cell proteins (or proteins derived from the cell culture media) from the recombinant protein of interest, e.g., a mutant endoglycoceramidase of the present invention. The preferred salt is ammonium sulfate. Ammonium sulfate precipitates proteins by effectively reducing the amount of water in the protein mixture. Proteins then precipitate on the basis of their solubility. The more hydrophobic a protein is, the more likely it is to precipitate at lower ammonium sulfate concentrations. A typical protocol is to add saturated ammonium sulfate to a protein solution so that the resultant ammonium sulfate concentration is between 20-30%. This will precipitate the most hydrophobic proteins. The precipitate is discarded (unless the protein of interest is hydrophobic) and ammonium sulfate is added to the supernatant to a concentration known to precipitate the protein of interest. The precipitate is then solubilized in buffer and the excess salt removed if necessary, through either dialysis or diafiltration. Other methods that rely on solubility of proteins, such as cold ethanol precipitation, are well known to those of skill in the art and can be used to fractionate complex protein mixtures.
Size Differential Filtration
[0243]Based on a calculated molecular weight, a protein of greater and lesser size can be isolated using ultrafiltration through membranes of different pore sizes (for example, Amicon or Millipore membranes). As a first step, the protein mixture is ultrafiltered through a membrane with a pore size that has a lower molecular weight cut-off than the molecular weight of a protein of interest, e.g., a mutant endoglycoceramidase. The retentate of the ultrafiltration is then ultrafiltered against a membrane with a molecular cut off greater than the molecular weight of the protein of interest. The recombinant protein will pass through the membrane into the filtrate. The filtrate can then be chromatographed as described below.
Column Chromatography
[0244]The proteins of interest (such as the mutant endoglycoceramidase of the present invention) can also be separated from other proteins on the basis of their size, net surface charge, hydrophobicity, or affinity for ligands. In addition, antibodies raised against endoglycoceramidase can be conjugated to column matrices and the endoglycoceramidase immunopurified. When the enzymes are expressed as fusion proteins with purification tags, a column loaded with resin that specifically binds to the purification tag is used, for example, resin conjugated to nickel, cellulose, maltose, anti-lactoferrin antibodies, or glutathione. All of these methods are well known in the art.
[0245]It will be apparent to one of skill that chromatographic techniques can be performed at any scale and using equipment from many different manufacturers (e.g., Pharmacia Biotech).
Production of Antibodies Against Endoglycoceramidases and Immunoassays for Detection of Endoglycoceramidase Expression
[0246]To confirm the production of a recombinant endoglycoceramidase, immunological assays may be useful to detect in a sample the expression of the endoglycoceramidase. Immunological assays are also useful for quantifying the expression level of the recombinant enzyme.
Production of Antibodies Against Endoglycoceramidase
[0247]Methods for producing polyclonal and monoclonal antibodies that react specifically with an immunogen of interest are known to those of skill in the art (see, e.g., Coligan, Current Protocols in Immunology Wiley/Greene, N.Y., 1991; Harlow and Lane, Antibodies: A Laboratory Manual Cold Spring Harbor Press, NY, 1989; Stites et al. (eds.) Basic and Clinical Immunology (4th ed.) Lange Medical Publications, Los Altos, Calif., and references cited therein; Goding, Monoclonal Antibodies: Principles and Practice (2d ed.) Academic Press, New York, N.Y., 1986; and Kohler and Milstein Nature 256: 495-497,1975). Such techniques include antibody preparation by selection of antibodies from libraries of recombinant antibodies in phage or similar vectors (see, Huse et al., Science 246: 1275-1281, 1989; and Ward et al., Nature 341: 544-546, 1989).
[0248]In order to produce antisera containing antibodies with desired specificity, the polypeptide of interest (e.g., a mutant endoglycoceramidase of the present invention) or an antigenic fragment thereof can be used to immunize suitable animals, e.g., mice, rabbits, or primates. A standard adjuvant, such as Freund's adjuvant, can be used in accordance with a standard immunization protocol. Alternatively, a synthetic antigenic peptide derived from that particular polypeptide can be conjugated to a carrier protein and subsequently used as an immunogen.
[0249]The animal's immune response to the immunogen preparation is monitored by taking test bleeds and determining the titer of reactivity to the antigen of interest. When appropriately high titers of antibody to the antigen are obtained, blood is collected from the animal and antisera are prepared. Further fractionation of the antisera to enrich antibodies specifically reactive to the antigen and purification of the antibodies can be performed subsequently, see, Harlow and Lane, supra, and the general descriptions of protein purification provided above.
[0250]Monoclonal antibodies are obtained using various techniques familiar to those of skill in the art. Typically, spleen cells from an animal immunized with a desired antigen are immortalized, commonly by fusion with a myeloma cell (see, Kohler and Milstein, Eur. J. Immunol. 6:511-519, 1976). Alternative methods of immortalization include, e.g., transformation with Epstein Barr Virus, oncogenes, or retroviruses, or other methods well known in the art. Colonies arising from single immortalized cells are screened for production of antibodies of the desired specificity and affinity for the antigen, and the yield of the monoclonal antibodies produced by such cells may be enhanced by various techniques, including injection into the peritoneal cavity of a vertebrate host.
[0251]Additionally, monoclonal antibodies may also be recombinantly produced upon identification of nucleic acid sequences encoding an antibody with desired specificity or a binding fragment of such antibody by screening a human B cell cDNA library according to the general protocol outlined by Huse et al., supra. The general principles and methods of recombinant polypeptide production discussed above are applicable for antibody production by recombinant methods.
[0252]When necessary, antibodies capable of specifically recognizing a mutant endoglycoceramidase of the present invention can be tested for their cross-reactivity against the corresponding wild-type endoglycoceramidase and thus distinguished from the antibodies against the wild-type enzyme. For instance, antisera obtained from an animal immunized with a mutant endoglycoceramidase can be run through a column on which a corresponding wild-type endoglycoceramidase is immobilized. The portion of the antisera that passes through the column recognizes only the mutant endoglycoceramidase and not the corresponding wild-type endoglycoceramidase. Similarly, monoclonal antibodies against a mutant endoglycoceramidase can also be screened for their exclusivity in recognizing only the mutant but not the wild-type endoglycoceramidase.
[0253]Polyclonal or monoclonal antibodies that specifically recognize only the mutant endoglycoceramidase of the present invention but not the corresponding wild-type endoglycoceramidase are useful for isolating the mutant enzyme from the wild-type endoglycoceramidase, for example, by incubating a sample with a mutant endoglycoceramidase-specific polyclonal or monoclonal antibody immobilized on a solid support.
Immunoassays for Detecting Endoglycoceramidase Expression
[0254]Once antibodies specific for an endoglycoceramidase of the present invention are available, the amount of the polypeptide in a sample, e.g., a cell lysate, can be measured by a variety of immunoassay methods providing qualitative and quantitative results to a skilled artisan. For a review of immunological and immunoassay procedures in general see, e.g., Stites, supra; U.S. Pat. Nos. 4,366,241; 4,376,110; 4,517,288; and 4,837,168.
Labeling in Immunoassays
[0255]Immunoassays often utilize a labeling agent to specifically bind to and label the binding complex formed by the antibody and the target protein. The labeling agent may itself be one of the moieties comprising the antibody/target protein complex, or may be a third moiety, such as another antibody, that specifically binds to the antibody/target protein complex. A label may be detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means. Examples include, but are not limited to, magnetic beads (e.g., Dynabeads®), fluorescent dyes (e.g. fluorescein isothiocyanate, Texas red, rhodamine, and the like), radiolabels (e.g. 3H, 125I, 35S, 14C, or 32P), enzymes (e.g., horse radish peroxidase, alkaline phosphatase, and others commonly used in an ELISA), and colorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads.
[0256]In some cases, the labeling agent is a second antibody bearing a detectable label. Alternatively, the second antibody may lack a label, but it may, in turn, be bound by a labeled third antibody specific to antibodies of the species from which the second antibody is derived. The second antibody can be modified with a detectable moiety, such as biotin, to which a third labeled molecule can specifically bind, such as enzyme-labeled streptavidin.
[0257]Other proteins capable of specifically binding immunoglobulin constant regions, such as protein A or protein G, can also be used as the label agents. These proteins are normal constituents of the cell walls of streptococcal bacteria. They exhibit a strong non-immunogenic reactivity with immunoglobulin constant regions from a variety of species (see, generally, Kronval, et al. J. Immunol., 111: 1401-1406 (1973); and Akerstrom, et al., J. Immunol., 135: 2589-2542 (1985)).
Immunoassay Formats
[0258]Immunoassays for detecting a target protein of interest (e.g., a recombinant endoglycoceramidase) from samples may be either competitive or noncompetitive. Noncompetitive immunoassays are assays in which the amount of captured target protein is directly measured. In one preferred "sandwich" assay, for example, the antibody specific for the target protein can be bound directly to a solid substrate where the antibody is immobilized. It then captures the target protein in test samples. The antibody/target protein complex thus immobilized is then bound by a labeling agent, such as a second or third antibody bearing a label, as described above.
[0259]In competitive assays, the amount of target protein in a sample is measured indirectly by measuring the amount of an added (exogenous) target protein displaced (or competed away) from an antibody specific for the target protein by the target protein present in the sample. In a typical example of such an assay, the antibody is immobilized and the exogenous target protein is labeled. Since the amount of the exogenous target protein bound to the antibody is inversely proportional to the concentration of the target protein present in the sample, the target protein level in the sample can thus be determined based on the amount of exogenous target protein bound to the antibody and thus immobilized.
[0260]In some cases, western blot (immunoblot) analysis is used to detect and quantify the presence of a wild-type or mutant endoglycoceramidase in the samples. The technique generally comprises separating sample proteins by gel electrophoresis on the basis of molecular weight, transferring the separated proteins to a suitable solid support (such as a nitrocellulose filter, a nylon filter, or a derivatized nylon filter) and incubating the samples with the antibodies that specifically bind the target protein. These antibodies may be directly labeled or alternatively may be subsequently detected using labeled antibodies (e.g., labeled sheep anti-mouse antibodies) that specifically bind to the antibodies against the endoglycoceramidase.
[0261]Other assay formats include liposome immunoassays (LIA), which use liposomes designed to bind specific molecules (e.g., antibodies) and release encapsulated reagents or markers. The released chemicals are then detected according to standard techniques (see, Monroe et al., Amer. Clin. Prod. Rev., 5: 34-41 (1986)).
Methods for Synthesizing a Glycolipid Using Mutant Endoglycoceramidases
[0262]The invention also provides a method of synthesizing a glycolipid or aglycone. The method includes contacting a glycosyl donor comprising a glycosyl group, and an aglycone with a mutant endoglycoceramidase of the invention under conditions appropriate to transfer said glycosyl group to said aglycone.
[0263]In one aspect, the invention provides a method of synthesizing a glycolipid or aglycone, the method comprising, contacting a donor substrate comprising a saccharide moiety and an acceptor substrate with a mutant endoglycoceramidase having a modified nucleophilic carboxylate (i.e., Glu or Asp) residue, wherein the nucleophilic Glu/Asp resides within a (Ile/Met/Leu/Phe/Val)-(Leu/Met/Ile/Val)-(Gly/Ser/Thr)-(Glu/Asp)-- (Phe/Thr/Met/Leu)-(Gly/Leu/Phe) sequence of a corresponding wild-type endoglycoceramidase, under conditions wherein the endoglycoceramidase catalyzes the transfer of a saccharide moiety from a donor substrate to an acceptor substrate, thereby producing the glycolipid or aglycone.
[0264]In a further aspect, the invention provides a method of synthesizing a glycolipid or aglycone, the method comprising, contacting a donor substrate comprising a saccharide moiety and an acceptor substrate with a mutant endoglycoceramidase having a modified Glu residue within the subsequence of Asn-Glu-Pro, wherein the subsequence resides within the acid-base sequence region of Val-X1-(Ala/Gly)-(Tyr/Phe)-(Asp/Glu)-(Leu/Ile)-X2-Asn-Glu-Pro-X- 3-X4-Gly sequence in the corresponding wild-type protein, under conditions wherein the endoglycoceramidase catalyzes, the transfer of a saccharide moiety from a donor substrate to an acceptor substrate, thereby producing the glycolipid or aglycone.
[0265]In carrying out the methods of glycolipid synthesis, one or both of the nucleophilic carboxylate amino acid residue (i.e., a Glu or an Asp) and/or acid-base sequence region Glu residues of a corresponding wild-type endoglycoceramidase can be deleted or replaced with another chemical moiety that retains the integral structure of the protein such that the mutant enzyme has synthetic activity. For example, one or more of the nucleophilic carboxylate amino acid residues (Glu or Asp) and/or acid-base sequence region Glu residues can be replaced with an L-amino acid residue other than Glu or Asp, a D-amino acid residue (including a D-Glu or a D-Asp), an unnatural amino acid, an amino acid analog, an amino acid mimetic, and the like. Usually, the one or more carboxylate amino acid residues (Glu or Asp) are substituted with another L-amino acid other than Glu or Asp, for example, Gly, Ala, Ser, Asp, Asn, Glu, Gln, Cys, Thr, Ile, Leu or Val.
[0266]In one embodiment, the mutant enzymes of the invention converts at least about 50% of the starting materials, based upon the limiting reagent, to a desired glycolipid, more preferably, at least about 60%, 70%, 80% or 90%. In another preferred embodiment, the conversion of the limiting reagent to glycolipid is virtually quantitative, affording a conversion that is at least about 90%, and more preferably, at least about 92%, 94%, 96%, 98% and even more preferably, at least about 99%.
[0267]In another exemplary embodiment, the glycosyl donor and the acceptor substrate (i.e., aglycone) are present in an approximately 1:1 molar ratio and the enzyme of the invention, acting catalytically, converts the two reagents to a glycolipid in at least about 50% yield, more preferably at least about 60%, 70%, or 80%. In a further exemplary embodiment, the conversion is essentially quantitative as discussed above.
[0268]In one embodiment, the synthesized glycolipid is an aglycone (non-carbohydrate alcohol (OH) or (SH)) conjugated to a non-reducing sugar and a non-glycoside.
Donor Substrates
[0269]Donor substrates for wild-type and mutant endoglycoceramidases include any activated glycosyl derivatives of anomeric configuration opposite the natural glycosidic linkage. The enzymes of the invention are used to couple α-modified or β-modified glycosyl donors, usually α-modified glycosyl donors, with glycoside acceptors. Preferred donor molecules are glycosyl fluorides, although donors with other groups which are reasonably small and which function as relatively good leaving groups can also be used. Examples of other glycosyl donor molecules include glycosyl chlorides, bromides, acetates, mesylates, propionates, pivaloates, and glycosyl molecules modified with substituted phenols. Among the α-modified or β-modified glycosyl donors, α-galactosyl, α-mannosyl, α-glucosyl, α-fucosyl, α-xylosyl, α-sialyl, α-N-acetylglucosaminyl, α-N-acetylgalactosaminyl, β-galactosyl, β-mannosyl, β-glucosyl, β-fucosyl, β-xylosyl, β-sialyl, β-N-acetylglucosaminyl and β-N-acetylgalactosaminyl are most preferred. Additional donor substrates include ganglioside head groups, for example, those listed in Table 2, below, and those depicted in FIGS. 1-13. Accordingly, in one embodiment, the donor substrate can be one or more ganglioside glycosyl head groups selected from the group consisting of GD1a, GD1α, GD1b, GD2, GD3, Gg3, Gg4, GH1, GH2, GH3, GM1, GM1b, GM2, GM3, Fuc-GM1, GP1, GP2, GP3, GQ1b, GQ1B, GQ1β, GQ1c, GQ2, GQ3, GT1a, GT1b, GT1c, GT1β, GT1c, GT2, and GT3. The donor molecules can be monosaccharides, or may themselves contain multiple sugar moieties (oligosaccharides). Donor substrates of use in the particular methods include those described in U.S. Pat. Nos. 6,284,494; 6,204,029; 5,952,203; and 5,716,812.
[0270]Glycosyl fluorides can be prepared from the free sugar by first acetylating the sugar and then treating it with HF/pyridine. This will generate the thermodynamically most stable anomer of the protected (acetylated) glycosyl fluoride. If the less stable anomer is desired, it may be prepared by converting the peracetylated sugar with HBr/HOAc or with HCL to generate the anomeric bromide or chloride. This intermediate is reacted with a fluoride salt such as silver fluoride to generate the glycosyl fluoride. Acetylated glycosyl fluorides may be deprotected by reaction with mild (catalytic) base in methanol (e.g., NaOMe/MeOH). In addition, glycosyl donor molecules, including many glycosyl fluorides can be purchased commercially. Thus a wide range of donor molecules are available for use in the methods of the present invention.
Acceptor Substrates
[0271]Suitable acceptor substrates include any aglycone that the mutant endoceramidases can conjugate with a saccharide moiety. For example, the mutant endoglycoceramide synthases are capable of synthesizing a glycolipid or aglycone by coupling a saccharide and a heteroalkyl substrate with a structure as shown in Formula Ia, Formula Ib, Formula II or Formula III as shown below:
##STR00004##
[0272]In Formula Ia and Formula Ib, the symbol Z represents OH, SH, or NR4R4'. R1 and R2 are members independently selected from NHR4, SR4, OR4, OCOR4, OC(O)NHR4, NHC(O)OR4, OS(O)2OR4, C(O)R4, NHC(O)R4, detectable labels, and targeting moieties. The symbols R3, R4 and R4', R5, R6 and R7 each are members independently selected from H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocycloalkyl.
##STR00005##
[0273]In Formula II, Z1 is a member selected from O, S, and NR4; R1 and R2 are members independently selected from NHR4, SR4, OR4, OCOR4, OC(O)NHR4, NHC(O)OR4, OS(O)2OR4, C(O)R4, NHC(O)R4, detectable labels, and targeting moieties. The symbols R3, R4, R5, R6 and R7 each are members independently selected from H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocycloalkyl. Formula II is representative of certain embodiments wherein the aglycone portion is conjugated to a further substrate component, for example, a leaving group or a solid support.
[0274]In certain embodiments, acceptor substrates such as those depicted in Table 1 below are used in the methods of glycolipid or aglycone synthesis employing the mutant endoglycoceramidases.
TABLE-US-00001 TABLE 1 Representative Acceptor Substrates For Glycosynthase Synthesis Reactions A ##STR00006## B ##STR00007## C ##STR00008## D ##STR00009## E ##STR00010## F ##STR00011## G ##STR00012## H ##STR00013## I ##STR00014## J ##STR00015##
[0275]In certain embodiments, the acceptor substrate is a sphingosine, a sphingosine analog or a ceramide. In certain embodiments, the acceptor substrate is one or more sphingosine analogs, including those described in co-pending patent applications PCT/US2004/006904 (which claims priority to U.S. Provisional Patent Application No. 60/452,796); U.S. patent application Ser. No. 10/487,841; U.S. patent application Ser. No. 10/485,892; 10/485,195, and 60/626,678.
[0276]In general, the sphingosine analogs described in the above-referenced applications are those compounds having the formula:
##STR00016##
wherein Z is a member selected from O, S, C(R2)2 and NR2; X is a member selected from H, --OR3, --NR3R4, --SR3, and --CHR3R4; R1, R2, R3 and R4 are members independently selected from H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocycloalkyl, --C(=M)R5, --C(=M)-Z1-R5, --SO2R5, and --SO3; wherein M and Z1 are members independently selected from O, NR6 or S; Y is a member selected from H, --OR7, --SR7, --NR7R8, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, and substituted or unsubstituted heterocycloalkyl, wherein R5, R6, R7 and R8 are members independently selected from H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocycloalkyl; and Ra, Rb, Rc and Rd are each independently H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocycloalkyl.
[0277]In certain embodiments, the acceptor substrate can be one or more sphingosine analogs including D-erythro-sphingosine, D-erythro-sphinganine, L-threo-sphingosine, L-threo-dihydrosphingosine, D-erythro-phytosphingosine, or N-ocatanoyl-D-erythro-sphingosine.
Production of Glycolipids
[0278]Wild-type and mutant endoglycoceramidase polypeptides can be used to make glycolipid products in in vitro reactions mixes or by in vivo reactions, e.g. by fermentative growth of recombinant microorganisms that comprise nucleotides that encode endoglycoceramidase polypeptides.
[0279]A. In Vitro Reactions
[0280]The wild-type and mutant endoglycoceramidase polypeptides can be used to make sialylated products in in vitro reactions mixes. The in vitro reaction mixtures can include permeabilized microorganisms comprising the wild-type or mutant endoglycoceramidase polypeptides, partially purified endoglycoceramidase polypeptides, or purified endoglycoceramidase polypeptides; as well as donor substrates, acceptor substrates, and appropriate reaction buffers. For in vitro reactions, the recombinant wild-type or mutant endoglycoceramidase proteins, acceptor substrates, donor substrates and other reaction mixture ingredients are combined by admixture in an aqueous reaction medium. Additional glycosyltransferases can be used in combination with the endoglycoceramidase polypeptides, depending on the desired glycolipid end product. The medium generally has a pH value of about 5 to about 8.5. The selection of a medium is based on the ability of the medium to maintain pH value at the desired level. Thus, in some embodiments, the medium is buffered to a pH value of about 7.5. If a buffer is not used, the pH of the medium should be maintained at about 5 to 8.5, depending upon the particular endoglycoceramidase and other enzymes used.
[0281]Enzyme amounts or concentrations are expressed in activity units, which is a measure of the initial rate of catalysis. One activity unit catalyzes the formation of 1 μmol of product per minute at a given temperature (typically 37° C.) and pH value (typically 7.5). Thus, 10 units of an enzyme is a catalytic amount of that enzyme where 10 μmol of substrate are converted to 10 μmol of product in one minute at a temperature of 37° C. and a pH value of 7.5.
[0282]The reaction mixture may include divalent metal cations (Mg2+, Mn2+). The reaction medium may also comprise solubilizing detergents (e.g., Triton or SDS) and organic solvents such as methanol or ethanol, if necessary. The enzymes can be utilized free in solution or can be bound to a support such as a polymer. The reaction mixture is thus substantially homogeneous at the beginning, although some precipitate can form during the reaction.
[0283]The temperature at which an above process is carried out can range from just above freezing to the temperature at which the most sensitive enzyme denatures. That temperature range is preferably about 0° C. to about 45° C., and more preferably at about 20° C. to about 37° C.
[0284]The reaction mixture so formed is maintained for a period of time sufficient to obtain the desired high yield of desired glycolipid determinants. For large-scale preparations, the reaction will often be allowed to proceed for between about 0.5-240 hours, and more typically between about 1-18 hours.
[0285]Preferably, the concentrations of activating donor substrates and enzymes are selected such that glycosylation proceeds until the acceptor substrate is consumed.
[0286]Each of the enzymes is present in a catalytic amount. The catalytic amount of a particular enzyme varies according to the concentration of that enzyme's substrate as well as to reaction conditions such as temperature, time and pH value. Means for determining the catalytic amount for a given enzyme under preselected substrate concentrations and reaction conditions are well known to those of skill in the art.
[0287]B. In Vivo Reactions
[0288]The mutant endoglycoceramidase polypeptides can be used to make glycolipid products by in vivo reactions, e.g., fermentative growth of recombinant microorganisms comprising the endoglycoceramidase polypeptides. Fermentative growth of recombinant microorganisms can occur in the presence of medium that includes an acceptor substrate and a donor substrate or a precursor to a donor substrate. See, e.g., Priem et al., Glycobiology 12:235-240 (2002). The microorganism takes up the acceptor substrate and the donor substrate or the precursor to a donor substrate and the addition of the donor substrate to the acceptor substrate takes place in the living cell. The microorganism can be altered to facilitate uptake of the acceptor substrate, e.g., by expressing a sugar transport protein.
[0289]For glycosyltransferase cycles carried out in vitro, the concentrations or amounts of the various reactants used in the processes depend upon numerous factors including reaction conditions such as temperature and pH value, and the choice and amount of acceptor saccharides to be glycosylated. Because the glycosylation process permits regeneration of activating nucleotides, activated donor sugars and scavenging of produced PPi in the presence of catalytic amounts of the enzymes, the process is limited by the concentrations or amounts of the stoichiometric substrates discussed before. The upper limit for the concentrations of reactants that can be used in accordance with the method of the present invention is determined by the solubility of such reactants.
Functional Assays for the Endoglycoceramidases
[0290]In addition to immunological assays, enzymatic assays can be used for detecting the presence and/or activity of the endoglycoceramidase of the present invention. These enzymatic assays are useful to establish the distinct functional characteristics of the wild-type and mutant endoglycoceramidases of the present invention. The production of glycolipid end products can be monitored by e.g., determining that production of the desired product has occurred or by determining that a substrate such as the acceptor substrate has been depleted. Those of skill will recognize that glycolipid end products including gangliosides or glycosphingolipid analogs can be identified using techniques such as chromatography, e.g., using paper or TLC plates, or by mass spectrometry, e.g., MALDI-TOF spectrometry, or by NMR spectroscopy.
Assays for Hydrolytic Activity
[0291]To test the hydrolytic activity of an endoglycoceramidase, either the wild-type or a modified version of the enzyme, a glycolipid can be used as a substrate. Upon incubation of the substrate (e.g., lyso-GM2, GM2, or GM3) with the endoglycoceramidase under appropriate conditions, assays are performed to detect the presence of hydrolytic products such as an oligosaccharide and an aglycone (e.g., C-18 ceramide), which indicates that the endoglycoceramidase is hydrolytically active. To facilitate the detection of hydrolytic products, the substrate for a hydrolytic assay may be labeled with a detectably moiety, for instance, a fluorescent or radioactive label. Sugars which release a fluorescent or chromophoric group on hydrolysis (i.e., dinitrophenyl, p-nitrophenyl, or methylumbelliferyl glycosides) can also be used to test for hydrolytic activity. A preferred assay format for detecting hydrolytic products includes various chromatographic methods, such as thin-layer chromatography (TLC).
[0292]An appropriate control is preferably included in each hydrolytic activity assay such that the activity level of a mutant endoglycoceramidase can be assessed in comparison with that of a wild-type endoglycoceramidase.
Assays for Synthetic Activity
[0293]To test the synthetic activity of an endoglycoceramidase, particularly a mutant endoglycoceramidase (or an "endoglycoceramide synthase"), an oligosaccharide and a heteroalkyl substrate, e.g., of Formula I and Formula II, can be used as substrates. Upon incubation of the two substrates with the "endoglycoceramide synthase" under appropriate conditions, assays are performed to detect the presence of glycolipid formed by reaction between the oligosaccharide and the heteroalkyl substrate, e.g., an aglycone including a ceramide or a sphingosine, which indicates that the "endoglycoceramide synthase" is synthetically active. To facilitate the detection of the synthetic process, at least one of the two substrates for the synthetic assay may be labeled with a detectably moiety, for instance, a fluorescent or radioactive label. The same assay format, such as TLC, for detecting hydrolytic products can be used for detecting synthetic products.
[0294]An appropriate control is preferably included in each assay such that the activity level of an endoglycoceramide synthase can be assessed in comparison with that of a wild-type endoglycoceramidase.
Synthesis of Glycolipids Using Mutant Endoglycoceramide Synthases
[0295]Upon identifying a mutant endoglycoceramidase that is synthetically active, this enzyme can be used for production of a large variety of glycolipids based on different combinations of heteroalkyl substrates. End products of particular interest are glycosylated aglycones, including glycosylated sphingosines, glycosylated sphingosine analogs, and glycosylated ceramides (i.e., cerebrosides and gangliosides). The methods of the invention are useful for producing any of a large number of gangliosides and related structures. Many gangliosides of interest are described in Oettgen, H. F., ed., Gangliosides and Cancer, VCH, Germany, 1989, pp. 10-15, and references cited therein. The end product can be a glycosylsphingosine, a glycosphingolipid, a cerebroside or a ganglioside. Exemplified ganglioside end products include those listed in Table 2, below. Accordingly, in one embodiment, the synthesized glycolipid can be one or more of GD1a, GD1α, GD1b, GD2, GD3, Gg3, Gg4, GH1, GH2, GH3, GM1, GM1b, GM2, GM3, Fuc-GM1, GP1, GP2, GP3, GQ1b, GQ1B, GQ1β, GQ1c, GQ2, GQ3, GT1a, GT1b, GT1c, GT1β, GT1c, GT2, GT3, or polysialylated lactose.
TABLE-US-00002 TABLE 2 Exemplified Ganglioside Formulas and Abbreviations Structure Abbreviation Neu5Ac3Gal4GlcCer GM3 GalNAc4(Neu5Ac3)Gal4GlcCer GM2 Gal3GalNAc4(Neu5Ac3)Gal4GlcCer GM1a Neu5Ac3Gal3GalNAc4Gal4GlcCer GM1b Neu5Ac8Neu5Ac3Gal4GlcCer GD3 GalNAc4(Neu5Ac8Neu5Ac3)Gal4GlcCer GD2 Neu5Ac3Gal3GalNAc4(Neu5Ac3)Gal4GlcCer GD1a Neu5Ac3Gal3(Neu5Ac6)GalNAc4Gal4GlcCer GD1α Gal3GalNAc4(Neu5Ac8Neu5Ac3)Gal4GlcCer GD1b Neu5Ac8Neu5Ac3Gal3GalNAc4(Neu5Ac3)Gal4GlcCer GT1a Neu5Ac3Gal3GalNAc4(Neu5Ac8Neu5Ac3)Gal4GlcCer GT1b Gal3GalNAc4(Neu5Ac8Neu5Ac8Neu5Ac3)Gal4GlcCer GT1c Neu5Ac8Neu5Ac3Gal3GalNAc4(Neu5Ac8Neu5c3)Gal4GlcCer GQ1b Nomenclature of Glycolipids, IUPAC-IUB Joint Commission on Biochemical Nomenclature (Recommendations 1997); Pure Appl. Chem. (1997) 69: 2475-2487; Eur. J. Biochem (1998) 257: 293-298) (see, the worldwide web at chem.qmw.ac.uk/iupac/misc/glylp.html).
[0296]Exemplified end products further include those depicted in FIGS. 1-13. Additional end product glycolipids that can be produced using the mutant endoglycoceramidases of the present invention include the glycosphingolipids, glycosylsphingosines and ganglioside derivatives disclosed in co-pending patent applications PCT/US2004/006904 (which claims priority to U.S. Provisional Patent Application No. 60/452,796); U.S. patent application Ser. No. 10/487,841; U.S. patent application Ser. No. 10/485,892; 10/485,195, and 60/626,678.
[0297]Further modifications can be made to the glycolipids synthesized using the endoglycoceramide synthase of the present invention. Exemplary methods of further elaborating glycolipids produced using the present invention are set forth in WO 03/017949; PCT/US02/24574; US2004063911 (although each is broadly directed to modification of peptides with glycosyl moieties, the methods disclosed therein are equally applicable to the glycolipids and method of producing them set forth herein). Moreover, the glycolipid compositions of the invention can be subjected to glycoconjugation as disclosed in WO 03/031464 and its progeny (although each is broadly directed to modification of peptides with glycosyl moieties, the methods disclosed therein are equally applicable to the glycolipids and method of producing them set forth herein).
EXAMPLES
[0298]The following examples are provided by way of illustration only and not by way of limitation. Those of skill in the art will readily recognize a variety of non-critical parameters that could be changed or modified to yield essentially similar results.
Example I
Generating Mutant Endoglycoceramidases
[0299]A synthetic endoglycoceramidase gene was produced by Blue Heron Biotechnology (EGCase1395). Subsequently the gene was subcloned into a pT7-7 expression vector (FIG. 14). Mutations at one of the nucleotides encoding Glu233 of endoglycoceramidase derived from Rhodococcus sp. M-777 (GenBank Accession No. AAB67050, SEQ ID NO:2), were introduced into the EGCase gene by a PCR-based method using five primer sets by combining the same 5' primer with five different 3' primers:
TABLE-US-00003 The 5' primer: 5 'Copt AATTCGATTGGATCCCATATGAGCGGAAGCG (SEQ ID NO:26) The 3' primers: 3'Asp PstI TCGATTCTGCAGGGAGCCACCAAACGGGTCATTCATCAG (SEQ ID NO:27) 3'Gln PstI TCGATTCTGCAGGGAGCCACCAAACGGCTGATTCATCAG (SEQ ID NO:28) 3'Ala PstI-11-1 CGGTCCCTGCAGGGAGCCACCAAACGGCGCATTCATCAG (SEQ ID NO:29) 3'Gly PstI-11-1 CGGTCCCTGCAGGGAGCCACCAAACGGCCCATTCATCAG (SEQ ID NO:30) 3'Ser PstI-11-1 CGGTCCCTGCAGGGAGCCACCAAACGGCGAATTCATCAG (SEQ ID NO:31)
[0300]The PCR program used for generating mutations was essentially as follows: the template and primers were first incubated at 95° C. for 5 minutes, Vent DNA polymerase (New England Biolabs) was then added, which was followed by 30 cycles of amplification: 94° C. for 1 minute, 55° C. for 1 minute, and 72° C. for 2 minutes.
[0301]PCR products were digested with NdeI and PstI, and pT7-7 vector was digested with NdeI, EcoRI, and PstI. Following purification of the digestion products from a 0.8% TAE agarose gel, the PCR products were subcloned into pT7-7 vector via a ligation reaction. Upon completion of the ligation reaction, the ligation product was electroporated into BL21DE3 LacZ cells, which were prepared from BL21DE3 cells (William Studier, Brookhaven National Laboratories, Upton, N.Y.) by disrupting the LacZ gene with a tetracycline or kanamycin resistance gene (generated at Neose Technologies, Inc.). Colonies were screened for PCR product insert. All EGCase mutants were confirmed by sequencing.
Example II
Hydrolytic Assays
[0302]An exemplary hydrolytic reaction had a volume of 50 μL, containing 20 μg of substrate (pre-dried lyso-GM2, GM2, or GM3, generated at Neose Technologies, Inc.), 25 μg of Taurodeoxycholic acid (Sigma, Cat # T-0875), 50 mM sodium acetate (pH 5.2), and 5-10 μL of crude cell lysate containing a wild-type or mutant EGCase. The hydrolytic mixture was incubated at 37° C. for 10 to 120 minutes.
Example III
Synthetic Assays
[0303]An exemplary synthetic reaction had a volume of 50 μL, containing 5 mM MgCl2, 0.5% detergent, 0.3 mM ceramide-C-18 (pre-dried), 20 mM Tris-HCl (pH 7.5), and 0.36 mM 3' sialyl lactose fluoride (3' SLF). The detergents used in the reaction were Triton-X100 (0.5%), Taurodeoxycholic acid (25 μg), NP-40 (0.5%), Tween-80 (0.5%), 3-14 Zwittergent (0.5%), and Triton-CF54 (0.5%). The reaction times ranged from 2 to 16 h in various buffers ranging in pH from 5.2 to 8.0.
Example IV
TLC Analysis
[0304]5 μL of a hydrolytic or synthetic reaction was spotted on a TLC plate. The plate was then dried with a hair dryer set on low. The plate was run in an appropriate solvent system (solvent A: chloroform/methanol at 95:5 v/v, solvent B: 1-butyl alcohol/acetic acid/H2O at 2:1:1 v/v, solvent C: chloroform/methanol/H2O/ammonium hydroxide at 60:40:5:3). The plate was then dried and stained with anisaldehye. The TLC plate was subsequently developed by heating on a hot plate set at three.
Example V
[0305]The following example illustrates the successful generation of a glycosynthase enzyme capable of performing the efficient glycosidic coupling between 3'-sialyllactosyl fluoride and a variety of lipid acceptors by performing selected modifications on the endoglycoceramidase II enzyme from Rhodococcus M-777 (SEQ ID NO:2).
Cloning of Exemplified Mutant Endoglycoceramidase E351S
[0306]The DNA sequence of the wild-type EGCase gene from Rhodococcus was used as a template for the design of the construct. Using an overlapping PCR strategy, an amino acid substitution of serine for glutamic acid at amino acid position 351 relative to the wild-type enzyme was engineered into the coding sequence (see, primer sequences SEQ ID NOs:32-39). The final coding sequence was also truncated at amino acid 29 relative to the wild-type enzyme in order to mimic the mature version of the enzyme that is normally generated during secretion (SEQ ID NOs:40 and 41). Restriction sites were engineered onto the ends of the coding sequence (Nde1 and Xho1, respectively) in order to ligate to the corresponding sites in frame with the six his tag from the pET28A vector (Novagen/EMD Biosciences, San Diego Calif.). This construct was confirmed to be correct by restriction and sequence analysis and then was used to transform the E. coli strain BL21 (DE3) (Novagen) using 50 mcg/ml Kanamycin selection. An individual colony was used to inoculate a culture of Maritone-50 mcg/ml Kanamycin that was incubated for 16 hrs at 37° C. A sample of culture was mixed to achieve 20% glycerol and aliquots were frozen at -80° C. and referred as stock vials.
Mutant Endoglycoceramidase (EGC) Expression and Purification
[0307]Wild-type EGC and the following EGC mutants; E351A, E351D, E351D, E351G, and E351S have been successfully expressed and purified. The expression levels for the EGC variants are quite high, therefore cell cultures of 50 ml were used to produce the enzymes.
[0308]Cells from a -80° C. freezer stock were directly inoculated into 50 ml Typ broth and were grown at 37° C. to saturation. The temperature was then lowered to 20° C. and protein production was induced by addition of IPTG to 0.1 mM (due to solubility issues, the E351G mutant was expressed at an IPTG concentration of 0.05 mM to prevent aggregation). After 8-12 hours, the cells are harvested by centrifugation and the pellet was resuspended in 2.5 ml BugBuster protein extraction reagent (Novagen). Cell lysis was allowed to proceed for 20 min, and the cell debris was then removed by centrifugation.
[0309]The cell lysate was then applied to a 1 ml Ni-NTA column (Amersham), which was then washed with two column volumes of binding buffer (20 mM sodium phosphate, pH 7.0, containing 0.5 M NaCl). EGC was eluted by the stepwise addition of imidazole to a final concentration of 0.5 M (EGC elutes between 0.2 and 0.3 M imidazole). Fractions containing EGC were identified by SDS-PAGE. The purification gave a protein of >95% purity after a single step. The expression and purification of exemplified Rhodococcus EGC mutant E351S is depicted in FIG. 16.
[0310]Fractions containing EGC were pooled and the buffer was changed to 25 mM NaOAc, pH 5.0, containing 0.2% Triton X-100 using an Amicon centrifugal ultrafiltration device (MWCO=10,000 Da). At this time, the protein was concentrated to a final volume of approximately 2 ml.
[0311]Protein concentration was then assessed using the Bradford method. The purification generally yielded about 10 mg EGC (180-200 mg per liter of expression culture). The enzyme was stable in this form for at least 3 months.
Enzymatic Synthesis of Lyso-GM1 by Mutant EGC Enzymes
[0312]Reactions were performed in 25 mM NaOAc (pH 5.0) containing 0.1-0.2% Triton X-100. A typical reaction mixture contained approximately 50 mg/ml of a fluorinated GM1 sugar donor (GM1-F), 15 mg/ml of an acceptor sphingosine, and 2.0 mg/ml of the appropriate EGC mutant in a total reaction volume of 50 μl. Under these conditions, the reaction proceeds to >90% completion within 12 hours at 37° C. based on TLC analysis. Transfer of the fluorinated GM1 sugar donor was monitored using an HPLC reverse phase method on a Chromolith RP-8e column with eluants of 0.1% trifluoroacetic acid (TFA) in acetonitrile (ACN) to 0.1% TFA in H2O. Exemplified results of HPLC monitoring of a glycosynthase reaction for a Rhodococcus E351S mutant is depicted in FIG. 17.
Enzymatic Synthesis of Lyso-GM3 by Mutant EGC Enzymes
[0313]Reactions were performed in 25 mM NaOAc (pH 5.0) containing 0.2% Triton X-100. A typical reaction mixture contained approximately 10 mM 3'-sialyllactosyl fluoride (3'-SLF), 20 mM of the acceptor D-erythro-sphingosine, and 0.5 mg/ml of the appropriate EGC mutant in a total reaction volume of 100 μl. Under these conditions, the reaction proceeds to >90% completion within 12 hours at 37° C. based on TLC analysis. In addition to D-erythro-sphingosine, Table 1, above, shows the structures of other acceptor species that have been used in glycosynthase reactions with 3'-SLF.
[0314]Essentially all of the 3'-SLF was consumed in the enzymatic reaction with D-erythro-sphingosine. Thus this reaction delivered a conservative estimate of a minimum of 90% turnover with respect to 3'-SLF. Running solvent was CHCl3/MeOH/0.2% CaCl2 (5:4:1), with detection by orcinol-H2SO4 stain. Purification of the lyso-GM3 product was achieved using a combination of normal phase and reversed phase SepPak cartridges (Waters). The identity of the product as lyso-GM3 was supported by mass spectrometry and NMR.
Example VI
Kinetic Parameters of Wild-Type Rhodococcus M-777 Endoglycoceramidase
[0315]Using 2,4-dinitrophenyl lactoside as a substrate, the Rhodococcus M-777 EGC enzyme has a Km of approximately 2 mM, and a kcat of 90 min-1 (FIG. 18). The dependence of the activity on detergent concentration was also investigated. It was found that in the absence of detergent, the rate of hydrolysis was very low. With the addition of Triton X-100 to 0.1%, the kcat/Km increased dramatically, and gradually decreased with further additions of detergent. The dependence of kcat/Km on detergent concentration leveled off at concentrations greater than 0.5%; increasing the detergent concentration caused a steady increase in both kcat and Km up to a concentration of 1% (FIG. 19 a-c). The pH dependence of the hydrolysis activity was also investigated. As expected, the maximal kcat/Km is observed around pH 5 (FIG. 20).
Example VII
Expression of Wild-Type Propionibacterium acnes Endoglycoceramidase in E. coli
[0316]The expression level of P. acnes EGC enzyme was extremely high, likely exceeding 200 mg/l. However, the expressed protein exclusively formed inclusion bodies under a variety of conditions. This propensity to form inclusion bodies is also observed for the Rhodococcus enzyme, but it is possible to minimize this tendency using Tuner cells in conjunction with a low induction temperature (<20° C.) and low concentration of IPTG (0.1 mM). These tactics proved unsuccessful with the P. acnes enzyme. Furthermore, the P. acnes enzyme was found to express at a very high level even in the absence of IPTG, with inclusion bodies forming during the pre-induction growth phase.
[0317]A series of experiments was performed to try to bring at least some protein into the soluble fraction, including:
[0318]variation of induction temperature (16-37° C.) in conjunction with variation of [IPTG] (0-0.1 mM);
[0319]pre-induction growth at room temperature to lower the levels of background expression;
[0320]transformation into BL21 pLysS (to suppress background expression) with variation of conditions as described above;
[0321]expression from a lac promoter rather than the T7 system with the above variations;
[0322]heat shock of the cells prior to induction (42° C. and 60° C. for 2 min in separate experiments) to induce chaperone expression;
[0323]adding a pelB signal sequence to direct secretion into the periplasm; and
[0324]attempts were also made to resolubilize the inclusion by denaturation with either urea (8 M) or guanidinium HCL (2 M) as the chaotropic agent followed by either iterative lowering of the denaturant concentration by dialysis or removal of the denaturant by first adsorbing the protein onto a Ni-NTA column and then decreasing the denaturant concentration using a linear gradient.
[0325]Soluble P. acnes EGC was obtained by performing the growth and induction steps in M9 minimal medium using Tuner cells with induction overnight at 18° C. in the presence of 0.1 mM IPTG (essentially the same conditions used for the Rhodococcus, except with minimal media rather than rich) (FIG. 21, lane 6). In a simultaneous experiment using BL21 pLysS as the expression strain, inclusion bodies were formed, presumably due to the action of the lactose permease in increasing the internal IPTG concentration to a level where expression still proceeds at a very high rate even in minimal media. Simultaneously employing the following three tactics lowered the rate of protein production sufficiently to obtain soluble P. acnes EGC enzyme while retaining the Histag: (i) minimal media for growth and expression, (ii) a very low IPTG concentration, and (iii) expression in the lactose permease deficient Tuner cells. Under these conditions, hydrolysis activity on both 2,4-dinitrophenyl lactoside and GM3 ganglioside in the cell extract was detected.
[0326]A gene construct for an E319S mutant EGC was prepared in parallel with the wild-type sequence. This mutant enzyme catalyzed the glycosynthase reaction as well.
[0327]It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.
Sequence CWU
1
7412012DNARhodococcus sp.Rhodococcus sp. strain M-777
endoglycoceramidase (EGC, EGCase) II genomic DNA 1cctgaccatg ttgggcccca
acggtttcag gagggagttc gccggggcga ccgacggggc 60cgcggccgaa ctcgagctgt
cctcgacgat cgtcgccggg acgcgatctc tcgctctgag 120cgtgaacaac cgtggaacgc
acgagctgac ggtcgcggtc gacggtcaac ggcgccgggt 180cgcggcccac gggtcggaat
cactgacggt gtcctcggtg aacggttggt acgaggccgc 240cgtgaccgtc gacgaggacc
ccgacttccg gcgacggctc gtcgggcaca tcgagaacgg 300gcaggacagc gtcagtcagc
cgagctgacg gggtgtcgcc ggtaccccgg caaggaacgt 360gatcgaacca agagtccagt
aggaggacac gtgcgtcgca cccggctcgt atcgctgatc 420gtgacaggtt cgctggtgtt
cggcggcggc gttgccgccg ctcagagcag cttggccgca 480tccggaagcg gaagtggcag
tggtaccgcg ctgacgccgt cctacctgaa ggacgatgac 540ggccgctcac tgatcctgcg
cgggttcaac acggcatcga gcgcgaagag cgcgccggac 600ggcatgccgc agttcaccga
ggcggacctg gcgcgcgagt atgcagacat gggaaccaac 660ttcgttcggt tcctcatctc
gtggcggtcg gtcgaaccag caccgggcgt gtacgaccag 720cagtatctgg accgtgtcga
agatcgggtc ggctggtacg ccgagcgcgg ctacaaggtg 780atgctcgaca tgcaccagga
cgtgtactcc ggcgcgatca ccccggaggg caacagcggc 840aacggtgccg gcgccatcgg
caacggcgca ccggcctggg cgacctacat ggacggcctt 900ccggtcgagc cgcagccccg
gtgggagctg tactacatcc agcccggcgt gatgcgcgcg 960ttcgacaact tctggaacac
caccggcaag caccccgaac tcgtcgagca ctacgcgaaa 1020gcgtggcggg cggtcgccga
ccgattcgcc gacaacgacg ccgtcgtggc ctacgacctg 1080atgaacgagc cgttcggagg
atccctgcag ggaccggcgt tcgaggcagg gccgctcgcc 1140gcgatgtacc agcgcaccac
cgacgccatc cggcaggtag accaggacac ctgggtctgc 1200gtggccccgc aggcgatcgg
cgtcaaccag ggtctcccca gcgggctcac caagatcgac 1260gaccctcgtg cgggtcaaca
gcgcatcgcg tactgcccgc acctctaccc actgccgctg 1320gatatcggtg acggccacga
gggcctggcc cggacgctca ccgacgtgac catcgacgcc 1380tggcgtgcca acaccgccca
caccgcccgt gtgctgggtg acgtgcccat catcctcggc 1440gagttcggcc tggacacaac
gctgcccggg gcccgggatt acatcgaacg cgtctacggg 1500accgcgcgag agatgggggc
cggagtctcg tactggtcca gcgatcccgg cccctggggc 1560ccgtacctgc ctgacggcac
gcagacgctg ctcgtcgaca ccctgaacaa gccgtacccc 1620cgcgcagtgg ccggcacacc
caccgagtgg tcgtcgacct ccgatcgcct ccaattgacg 1680atcgagccgg acgccgcgat
caccgctccc accgagatct acctcccgga ggcaggattc 1740ccgggcgacg tccacgtcga
aggcgccgac gtcgtggggt gggatcggca gagtcgactg 1800ctcacggtgc gcactccggc
cgactcgggc aacgtgaccg tgacggtcac tccggcagcc 1860tgatccggcc gacgcgacga
ccggccgtcg gtgcgacgat gactgcatgg atgaagtggt 1920ctcggtctac gacgcagacg
gcaccgtgat cggcacggcg ccacgctcgc gcgtgtacgc 1980cgaggggctg tggcatgcca
gtgcgggcgt gc 20122490PRTRhodococcus
sp.Rhodococcus sp. strain M-777 endoglycoceramidase (EGC, EGCase)
II 2Met Arg Arg Thr Arg Leu Val Ser Leu Ile Val Thr Gly Ser Leu Val1
5 10 15Phe Gly Gly Gly Val Ala
Ala Ala Gln Ser Ser Leu Ala Ala Ser Gly20 25
30Ser Gly Ser Gly Ser Gly Thr Ala Leu Thr Pro Ser Tyr Leu Lys Asp35
40 45Asp Asp Gly Arg Ser Leu Ile Leu Arg
Gly Phe Asn Thr Ala Ser Ser50 55 60Ala
Lys Ser Ala Pro Asp Gly Met Pro Gln Phe Thr Glu Ala Asp Leu65
70 75 80Ala Arg Glu Tyr Ala Asp
Met Gly Thr Asn Phe Val Arg Phe Leu Ile85 90
95Ser Trp Arg Ser Val Glu Pro Ala Pro Gly Val Tyr Asp Gln Gln Tyr100
105 110Leu Asp Arg Val Glu Asp Arg Val
Gly Trp Tyr Ala Glu Arg Gly Tyr115 120
125Lys Val Met Leu Asp Met His Gln Asp Val Tyr Ser Gly Ala Ile Thr130
135 140Pro Glu Gly Asn Ser Gly Asn Gly Ala
Gly Ala Ile Gly Asn Gly Ala145 150 155
160Pro Ala Trp Ala Thr Tyr Met Asp Gly Leu Pro Val Glu Pro
Gln Pro165 170 175Arg Trp Glu Leu Tyr Tyr
Ile Gln Pro Gly Val Met Arg Ala Phe Asp180 185
190Asn Phe Trp Asn Thr Thr Gly Lys His Pro Glu Leu Val Glu His
Tyr195 200 205Ala Lys Ala Trp Arg Ala Val
Ala Asp Arg Phe Ala Asp Asn Asp Ala210 215
220Val Val Ala Tyr Asp Leu Met Asn Glu Pro Phe Gly Gly Ser Leu Gln225
230 235 240Gly Pro Ala Phe
Glu Ala Gly Pro Leu Ala Ala Met Tyr Gln Arg Thr245 250
255Thr Asp Ala Ile Arg Gln Val Asp Gln Asp Thr Trp Val Cys
Val Ala260 265 270Pro Gln Ala Ile Gly Val
Asn Gln Gly Leu Pro Ser Gly Leu Thr Lys275 280
285Ile Asp Asp Pro Arg Ala Gly Gln Gln Arg Ile Ala Tyr Cys Pro
His290 295 300Leu Tyr Pro Leu Pro Leu Asp
Ile Gly Asp Gly His Glu Gly Leu Ala305 310
315 320Arg Thr Leu Thr Asp Val Thr Ile Asp Ala Trp Arg
Ala Asn Thr Ala325 330 335His Thr Ala Arg
Val Leu Gly Asp Val Pro Ile Ile Leu Gly Glu Phe340 345
350Gly Leu Asp Thr Thr Leu Pro Gly Ala Arg Asp Tyr Ile Glu
Arg Val355 360 365Tyr Gly Thr Ala Arg Glu
Met Gly Ala Gly Val Ser Tyr Trp Ser Ser370 375
380Asp Pro Gly Pro Trp Gly Pro Tyr Leu Pro Asp Gly Thr Gln Thr
Leu385 390 395 400Leu Val
Asp Thr Leu Asn Lys Pro Tyr Pro Arg Ala Val Ala Gly Thr405
410 415Pro Thr Glu Trp Ser Ser Thr Ser Asp Arg Leu Gln
Leu Thr Ile Glu420 425 430Pro Asp Ala Ala
Ile Thr Ala Pro Thr Glu Ile Tyr Leu Pro Glu Ala435 440
445Gly Phe Pro Gly Asp Val His Val Glu Gly Ala Asp Val Val
Gly Trp450 455 460Asp Arg Gln Ser Arg Leu
Leu Thr Val Arg Thr Pro Ala Asp Ser Gly465 470
475 480Asn Val Thr Val Thr Val Thr Pro Ala Ala485
49032012DNARhodococcus sp.Rhodococcus sp. strain C9
endoglycoceramidase (EGC, EGCase) genomic DNA 3gggcccgaac ggattccgcc
gcgagttcgc cgggtcgacg gacggcccgg ccgcgagggt 60ctcggtctcg acgacggtcg
acgcgggcgg acgcaccctc gacctggtcg tgacgaacgg 120aggaacccgg gatgtgacgg
tcgtcgtcga cggccgcggt ggaacgctgg gtcccggcgc 180ccgacgctcg tggacggtgc
cgtcgacgga cggctggtac cggtgcgccg tgaccgtcga 240cgaggacacg gacttccggc
gcacgctggc cggacacatc gagaacggcg aggacagcgt 300cagccaaccc acctgacgcg
gcacctgcca ccgtgcgggc acacggccgc acgaccgcca 360tctgatccac acaacccgta
ggaggagcga cagtgcgtcc aggaggaacg acagtgcgtc 420gaacaagaat cgcgtccctt
gccgtggcgg ggtcgctcgt actcggggcc ggtgtggcca 480ccgcgcagag cagcttgccg
gccaccggga gtgactcgag cgagtggagc gcatcggcct 540acctgacgga cgacgcgggc
cgatccctga tcctgcgtgg gttcaacacg gcatcgagcg 600cgaagagcac cccggacggc
atgccgatct tcaccgagtc cgacctggac cgcgagcacg 660ccgacatggg aaccaacttc
gtgcgcttcc tgatctcctg gcgttcggtg gaacccgaac 720cgggacagta cgaccaggcg
tatctggacc gggtcgagca gcgcgtcggc tggtatgccg 780aacgcggcta caaggtcatg
ctcgacatgc accaggacct ctactccggc gcgatcaccc 840ccgacggcaa gaccggcaac
ggcgcgccgg catgggcgac gtacatggac ggtctccccg 900tcaacgagcg ggacagctgg
gagctgtact acatcgagcc cggcgtgatc cgcgcgttcg 960acaacttctg gaacaccacc
ggaaagcacc ccgaactcgt cgaccactac gtgaatgcct 1020ggaaggccgt cgcggaccgg
ttcgccgaca acgagactgt cgtcgcctac gacctgatga 1080acgagccgtg gggcggatcc
ttgcagggac cggcgttcga ggcaggacca ctcacctcga 1140tgtaccagcg gaccaccgac
gccatccgac aggtcgacca ggacagctgg gtctgcgtcg 1200ccccgcaggc tgtcggcgtc
aaccagggca ttccgagcgc actcggcacg atcgccgatc 1260cccgccaggg cgctcggcgc
atcgcctact gcccgcacct gtatcccctc cccctcgacc 1320tcggtgacgg gtactcgggg
ttctcgaaga ccctcaccga cgccaccatc gaaacctggc 1380gcacgagcat cgaacacgtc
gccgacaccg ttctcgaggg tgcaccggtg atcctcggag 1440agttcgggct cgacaccacc
ctgcccggcg cccaggacta cctcgatcgc gtctacaccg 1500tcgctcgcga catgggtgcg
ggtgtctcgt actggtcgag cgatcgcggt ccctggggtc 1560cctacctgga ggacgggacg
cagaccatcc tcgtcgacac cgtgaacaag ccgtatccgc 1620gggccgtggc gggcatgccc
gtccggtggt cgtcgacctc cgatcgactg gacctgacgt 1680accgcaacga tcccgcggtg
accgcgccca ccgagatcta ccttccggca gcaggattcc 1740ccggcgacat cgccgtccag
ggggcggacg tggtcggatg ggactcacag agtcggctcc 1800tgaccgttcg gtccgcgccc
gacgcgggtg aggtgaccgt gacggtgacg cccgcggcgt 1860gaccccgtac ctgcggccgg
ccggtcaggc cggccgcggg tggtgtcaca tgtcgaggcc 1920gaggtccagc accgtcaccg
aatgggtgag agcgccgacg gcgaggtagt cgacaccggt 1980cgccgcgtag tcggccgcga
cgcccagggt ca 20124482PRTRhodococcus
sp.Rhodococcus sp. strain C9 endoglycoceramidase (EGC, EGCase) 4Met
Arg Arg Thr Arg Ile Ala Ser Leu Ala Val Ala Gly Ser Leu Val1
5 10 15Leu Gly Ala Gly Val Ala Thr Ala
Gln Ser Ser Leu Pro Ala Thr Gly20 25
30Ser Asp Ser Ser Glu Trp Ser Ala Ser Ala Tyr Leu Thr Asp Asp Ala35
40 45Gly Arg Ser Leu Ile Leu Arg Gly Phe Asn
Thr Ala Ser Ser Ala Lys50 55 60Ser Thr
Pro Asp Gly Met Pro Ile Phe Thr Glu Ser Asp Leu Asp Arg65
70 75 80Glu His Ala Asp Met Gly Thr
Asn Phe Val Arg Phe Leu Ile Ser Trp85 90
95Arg Ser Val Glu Pro Glu Pro Gly Gln Tyr Asp Gln Ala Tyr Leu Asp100
105 110Arg Val Glu Gln Arg Val Gly Trp Tyr
Ala Glu Arg Gly Tyr Lys Val115 120 125Met
Leu Asp Met His Gln Asp Leu Tyr Ser Gly Ala Ile Thr Pro Asp130
135 140Gly Lys Thr Gly Asn Gly Ala Pro Ala Trp Ala
Thr Tyr Met Asp Gly145 150 155
160Leu Pro Val Asn Glu Arg Asp Ser Trp Glu Leu Tyr Tyr Ile Glu
Pro165 170 175Gly Val Ile Arg Ala Phe Asp
Asn Phe Trp Asn Thr Thr Gly Lys His180 185
190Pro Glu Leu Val Asp His Tyr Val Asn Ala Trp Lys Ala Val Ala Asp195
200 205Arg Phe Ala Asp Asn Glu Thr Val Val
Ala Tyr Asp Leu Met Asn Glu210 215 220Pro
Trp Gly Gly Ser Leu Gln Gly Pro Ala Phe Glu Ala Gly Pro Leu225
230 235 240Thr Ser Met Tyr Gln Arg
Thr Thr Asp Ala Ile Arg Gln Val Asp Gln245 250
255Asp Ser Trp Val Cys Val Ala Pro Gln Ala Val Gly Val Asn Gln
Gly260 265 270Ile Pro Ser Ala Leu Gly Thr
Ile Ala Asp Pro Arg Gln Gly Ala Arg275 280
285Arg Ile Ala Tyr Cys Pro His Leu Tyr Pro Leu Pro Leu Asp Leu Gly290
295 300Asp Gly Tyr Ser Gly Phe Ser Lys Thr
Leu Thr Asp Ala Thr Ile Glu305 310 315
320Thr Trp Arg Thr Ser Ile Glu His Val Ala Asp Thr Val Leu
Glu Gly325 330 335Ala Pro Val Ile Leu Gly
Glu Phe Gly Leu Asp Thr Thr Leu Pro Gly340 345
350Ala Gln Asp Tyr Leu Asp Arg Val Tyr Thr Val Ala Arg Asp Met
Gly355 360 365Ala Gly Val Ser Tyr Trp Ser
Ser Asp Arg Gly Pro Trp Gly Pro Tyr370 375
380Leu Glu Asp Gly Thr Gln Thr Ile Leu Val Asp Thr Val Asn Lys Pro385
390 395 400Tyr Pro Arg Ala
Val Ala Gly Met Pro Val Arg Trp Ser Ser Thr Ser405 410
415Asp Arg Leu Asp Leu Thr Tyr Arg Asn Asp Pro Ala Val Thr
Ala Pro420 425 430Thr Glu Ile Tyr Leu Pro
Ala Ala Gly Phe Pro Gly Asp Ile Ala Val435 440
445Gln Gly Ala Asp Val Val Gly Trp Asp Ser Gln Ser Arg Leu Leu
Thr450 455 460Val Arg Ser Ala Pro Asp Ala
Gly Glu Val Thr Val Thr Val Thr Pro465 470
475 480Ala Ala51503DNAPropionibacterium
acnesProprionibacterium acnes KPA171202 endoglycoceramidase (EGCa)
CDS 5atgcgtcgaa agtctgccct cggatttgta gctttgtccc tgttcgccac agggatgggc
60gttgccgcag caacaccggc aactgcctcg ccggcggata cggcagcgcc agttcacgtc
120gacgcttcac ggtggaccac ccaggggcgt tgggtgaccg acacccagca ccgcgtggtc
180atcacgcagg ggatcaacga ggtcgccaag agcgccccct acgcccccga tgccgtcggt
240ttcggtgaag acgacgcagc cttcctcgag gcgcaggggt tcaccagcgt ccggctgggg
300gtgctgtggg ccggcgtcga gcctcggccg ggcgtctacg acgacgctta cctggcccgg
360gtcgaacgca ccgtgcggat cctcaacgcc cacggcatcg ccagtgtcct cgacttccat
420caggacatgg tcaacgagaa gtaccagggg gaggggtggc ctgcctgggc cgcgctcgac
480cacggcatgc ccaacatcgt caagacgggc ttccccggca actatttcct caacgaggcc
540gtcaaatact ccttcgactc cttctacgac aacaccaagg cctccgacgg catcggtgtt
600gccgaccact acgccagcgc ctggcgacat gtggccgagc atttccgaaa cgtgcccggc
660gtgcagggct acgacctgtt caacgagccg ttcccgggcc accgctacac gcggtgcctc
720acgcagctcg gttgccgcgc tgctgacgcg cgactgtcgg ccgtccagca gaagactgtc
780gacgcgatcc gctcggtcga caaggccacc actgtctggt acgagccgat gcagttcttc
840aatataggtg tcgggaccaa cgtccggctc acgggatcca acctggggtt gagcttccac
900gactactgca ccagccaggc caccctccac tcctatgtcg ggtgcactgc gcccgacaac
960cgggtcttca ctaacgcaga gaagcattca cgtcagaccg ggtcggggct gatgctcacc
1020gagttcggcg ccatcacgac ccccgcggtg atcacgtccc agatggacct ggcagctcgc
1080aaccgggtcg gcgtccagtg gtgggcctac actgccggtg atcccaccac agccggcccg
1140ggcaccgagc aagccctcgt cgacgaccca gctcggccac cccaggggac caacgtcgaa
1200agcgccaagc tgacgctgat cgccgttccc cacccggacc gtgtcgcggg caccccatcc
1260gcgtaccacc acgaccggtc ccgacgcgtg ttcaccatga cctggaccgc ccagcggccc
1320gacgggtcgc gcgcggagga gtcggacgag acgactgtgg tggtccctgc catctcagcg
1380ccccacgggt acgacgtgca ggcatccggc gcccacgtca cctcccaccc aggcgaccgg
1440gtggcgcggt tgcacctcaa ccaaggcagt gccacggcga aggtcacgat caccctgcgc
1500taa
15036500PRTPropionibacterium acnesProprionibacterium acnes KPA171202
endoglycoceramidase (EGCa) 6Met Arg Arg Lys Ser Ala Leu Gly Phe Val Ala
Leu Ser Leu Phe Ala1 5 10
15Thr Gly Met Gly Val Ala Ala Ala Thr Pro Ala Thr Ala Ser Pro Ala20
25 30Asp Thr Ala Ala Pro Val His Val Asp Ala
Ser Arg Trp Thr Thr Gln35 40 45Gly Arg
Trp Val Thr Asp Thr Gln His Arg Val Val Ile Thr Gln Gly50
55 60Ile Asn Glu Val Ala Lys Ser Ala Pro Tyr Ala Pro
Asp Ala Val Gly65 70 75
80Phe Gly Glu Asp Asp Ala Ala Phe Leu Glu Ala Gln Gly Phe Thr Ser85
90 95Val Arg Leu Gly Val Leu Trp Ala Gly Val
Glu Pro Arg Pro Gly Val100 105 110Tyr Asp
Asp Ala Tyr Leu Ala Arg Val Glu Arg Thr Val Arg Ile Leu115
120 125Asn Ala His Gly Ile Ala Ser Val Leu Asp Phe His
Gln Asp Met Val130 135 140Asn Glu Lys Tyr
Gln Gly Glu Gly Trp Pro Ala Trp Ala Ala Leu Asp145 150
155 160His Gly Met Pro Asn Ile Val Lys Thr
Gly Phe Pro Gly Asn Tyr Phe165 170 175Leu
Asn Glu Ala Val Lys Tyr Ser Phe Asp Ser Phe Tyr Asp Asn Thr180
185 190Lys Ala Ser Asp Gly Ile Gly Val Ala Asp His
Tyr Ala Ser Ala Trp195 200 205Arg His Val
Ala Glu His Phe Arg Asn Val Pro Gly Val Gln Gly Tyr210
215 220Asp Leu Phe Asn Glu Pro Phe Pro Gly His Arg Tyr
Thr Arg Cys Leu225 230 235
240Thr Gln Leu Gly Cys Arg Ala Ala Asp Ala Arg Leu Ser Ala Val Gln245
250 255Gln Lys Thr Val Asp Ala Ile Arg Ser
Val Asp Lys Ala Thr Thr Val260 265 270Trp
Tyr Glu Pro Met Gln Phe Phe Asn Ile Gly Val Gly Thr Asn Val275
280 285Arg Leu Thr Gly Ser Asn Leu Gly Leu Ser Phe
His Asp Tyr Cys Thr290 295 300Ser Gln Ala
Thr Leu His Ser Tyr Val Gly Cys Thr Ala Pro Asp Asn305
310 315 320Arg Val Phe Thr Asn Ala Glu
Lys His Ser Arg Gln Thr Gly Ser Gly325 330
335Leu Met Leu Thr Glu Phe Gly Ala Ile Thr Thr Pro Ala Val Ile Thr340
345 350Ser Gln Met Asp Leu Ala Ala Arg Asn
Arg Val Gly Val Gln Trp Trp355 360 365Ala
Tyr Thr Ala Gly Asp Pro Thr Thr Ala Gly Pro Gly Thr Glu Gln370
375 380Ala Leu Val Asp Asp Pro Ala Arg Pro Pro Gln
Gly Thr Asn Val Glu385 390 395
400Ser Ala Lys Leu Thr Leu Ile Ala Val Pro His Pro Asp Arg Val
Ala405 410 415Gly Thr Pro Ser Ala Tyr His
His Asp Arg Ser Arg Arg Val Phe Thr420 425
430Met Thr Trp Thr Ala Gln Arg Pro Asp Gly Ser Arg Ala Glu Glu Ser435
440 445Asp Glu Thr Thr Val Val Val Pro Ala
Ile Ser Ala Pro His Gly Tyr450 455 460Asp
Val Gln Ala Ser Gly Ala His Val Thr Ser His Pro Gly Asp Arg465
470 475 480Val Ala Arg Leu His Leu
Asn Gln Gly Ser Ala Thr Ala Lys Val Thr485 490
495Ile Thr Leu Arg50071575DNAPropionibacterium
acnesProprionibacterium acnes KPA171202 endoglycoceramidase (EGCb)
CDS 7atgtatcacc attcatggca ttccccggat gcacgacgcc gaggcgtcac ccggtgggcg
60accaccttca ttgctgccct tactgccgcc tgcatggcac agatgcctgc acaggcctcg
120ccccatacca gcgacgccgc tccccacatc gcaacgtcaa agaccatcac cgacgccggc
180cccatcgggc agtccggccg ttggtacacc gacggtcagg gtcgcgctat cctcaccgcc
240ggcgtcaaca tggtctctaa acgtcaccca tacagtcccg aagccgatgg attcgatgac
300gccgacgctg cctggttaca gaagaacggc ttcgattcgg tgcgcctggg agtcatatgg
360aagggggtcg agcccaagcc cggagagtac gacgacgcct acctggccag catcacccgc
420acagtaagaa cacttcgcgc tcacggcata atgaccctct tggacgctca ccaggacatg
480tataacgaga agttcgaggg tgagggagcc cccgactggg ccgttctcga caagggagca
540ccgaatctgc tcaaggttgg cttccccgcc aaccaggtct tcaacctcgg actcatcaag
600gcttacgaca gtttcctgga caatgccaag ggcccgggcg gagtgggctt gcaggatcgt
660tacgcggcca tgtggaagca cgtcgcacag gtcgtcgggc aggaacccgg cgtcatggga
720tacgacatta tcaacgagcc ttggccggga catcactacc ccatctgcta cgttgccttc
780ggctggtgcg gccgagcgat ggtgtccttg gacaccttgt acgagaaagt cggcagagcc
840atcacctcgg tcgaccccga cggcatcgtc acctacgagc cctactcaac gtggaacatg
900gggctggaca gccgcccagc ccgcccatcc tcaccgaagg ctgccatttc ttggcacgtc
960tactgcccca tgaacgcaat cttcggctcc tacgtcgggt gcaatctccc cgacactcgc
1020accttccaca acgccgacca ggcagcccag ttcaacaact cagcctcctt gctcagtgaa
1080ttcggggcca ccaaagaccc cggcactctc atgggggtca catccaaggc tcgcgcccat
1140ctggtcggct ggctgtactg gacgtacaac ggaaactccg acccgacaac ccagaatgct
1200gcagacgagg agctcgtccg tcatatcaac cgtccgggac ctgtcaccga cgaacaagtg
1260gaccacacca agctcgccat tctggcggta ccgcacctgc gcgccgctgc gggcaccccg
1320acctcgacga cctgggacca gtccacccgg acgtaccagg ccacgtggac ggctaaacgt
1380gtcgccggtg acggtgactt cgcggcagga tccgtctccg agatcgccgt cccggctatc
1440cactacccca atggttacaa ggtcgaggtg aagggcgcca aggtcatttc caaagccgga
1500gacacacgcc tgcaggtcag ctccaccgga gaaggcccgg taagcgtcac catcacccct
1560gccggtcagg cctaa
15758524PRTPropionibacterium acnesProprionibacterium acnes KPA171202
endoglycoceramidase (EGCb) 8Met Tyr His His Ser Trp His Ser Pro Asp Ala
Arg Arg Arg Gly Val1 5 10
15Thr Arg Trp Ala Thr Thr Phe Ile Ala Ala Leu Thr Ala Ala Cys Met20
25 30Ala Gln Met Pro Ala Gln Ala Ser Pro His
Thr Ser Asp Ala Ala Pro35 40 45His Ile
Ala Thr Ser Lys Thr Ile Thr Asp Ala Gly Pro Ile Gly Gln50
55 60Ser Gly Arg Trp Tyr Thr Asp Gly Gln Gly Arg Ala
Ile Leu Thr Ala65 70 75
80Gly Val Asn Met Val Ser Lys Arg His Pro Tyr Ser Pro Glu Ala Asp85
90 95Gly Phe Asp Asp Ala Asp Ala Ala Trp Leu
Gln Lys Asn Gly Phe Asp100 105 110Ser Val
Arg Leu Gly Val Ile Trp Lys Gly Val Glu Pro Lys Pro Gly115
120 125Glu Tyr Asp Asp Ala Tyr Leu Ala Ser Ile Thr Arg
Thr Val Arg Thr130 135 140Leu Arg Ala His
Gly Ile Met Thr Leu Leu Asp Ala His Gln Asp Met145 150
155 160Tyr Asn Glu Lys Phe Glu Gly Glu Gly
Ala Pro Asp Trp Ala Val Leu165 170 175Asp
Lys Gly Ala Pro Asn Leu Leu Lys Val Gly Phe Pro Ala Asn Gln180
185 190Val Phe Asn Leu Gly Leu Ile Lys Ala Tyr Asp
Ser Phe Leu Asp Asn195 200 205Ala Lys Gly
Pro Gly Gly Val Gly Leu Gln Asp Arg Tyr Ala Ala Met210
215 220Trp Lys His Val Ala Gln Val Val Gly Gln Glu Pro
Gly Val Met Gly225 230 235
240Tyr Asp Ile Ile Asn Glu Pro Trp Pro Gly His His Tyr Pro Ile Cys245
250 255Tyr Val Ala Phe Gly Trp Cys Gly Arg
Ala Met Val Ser Leu Asp Thr260 265 270Leu
Tyr Glu Lys Val Gly Arg Ala Ile Thr Ser Val Asp Pro Asp Gly275
280 285Ile Val Thr Tyr Glu Pro Tyr Ser Thr Trp Asn
Met Gly Leu Asp Ser290 295 300Arg Pro Ala
Arg Pro Ser Ser Pro Lys Ala Ala Ile Ser Trp His Val305
310 315 320Tyr Cys Pro Met Asn Ala Ile
Phe Gly Ser Tyr Val Gly Cys Asn Leu325 330
335Pro Asp Thr Arg Thr Phe His Asn Ala Asp Gln Ala Ala Gln Phe Asn340
345 350Asn Ser Ala Ser Leu Leu Ser Glu Phe
Gly Ala Thr Lys Asp Pro Gly355 360 365Thr
Leu Met Gly Val Thr Ser Lys Ala Arg Ala His Leu Val Gly Trp370
375 380Leu Tyr Trp Thr Tyr Asn Gly Asn Ser Asp Pro
Thr Thr Gln Asn Ala385 390 395
400Ala Asp Glu Glu Leu Val Arg His Ile Asn Arg Pro Gly Pro Val
Thr405 410 415Asp Glu Gln Val Asp His Thr
Lys Leu Ala Ile Leu Ala Val Pro His420 425
430Leu Arg Ala Ala Ala Gly Thr Pro Thr Ser Thr Thr Trp Asp Gln Ser435
440 445Thr Arg Thr Tyr Gln Ala Thr Trp Thr
Ala Lys Arg Val Ala Gly Asp450 455 460Gly
Asp Phe Ala Ala Gly Ser Val Ser Glu Ile Ala Val Pro Ala Ile465
470 475 480His Tyr Pro Asn Gly Tyr
Lys Val Glu Val Lys Gly Ala Lys Val Ile485 490
495Ser Lys Ala Gly Asp Thr Arg Leu Gln Val Ser Ser Thr Gly Glu
Gly500 505 510Pro Val Ser Val Thr Ile Thr
Pro Ala Gly Gln Ala515 52091730DNACyanella capensisCyanea
nozakii jellyfish endoglycoceramidase (EGC,EGCase) cDNA 9ggcgatttgc
aatggctgaa acacaaccat tggtgtttgt cttgatgagc atttcagcta 60ttttaacggc
aggacttcca ataaacgatg atgcatcatt gttgataagc gtcaatcctg 120aaacacaaca
gttggttgat agtttgggga gagagagatt ttttcatgga acgaacgttg 180ttgtcaaaca
taaaccttat catccatcag ttgagggtta tgacaatacg tctttctcag 240aagttgatat
gaagattttg caagatcttg gcctcaatac aattcgcctt ggtatgatgc 300tgccaggcta
cgtgcctacc cgaggtaatt acaatgaaac atacttgaag atcatacagg 360aaattgtatc
aaaggcagct aaatatggca tttatacttt actggatatg caccaggatg 420ttatgtctgc
aaagttttgc gttgaaggat ttcctgattg ggctgttaat acaggcaatg 480cagacaattt
cccttttcca cttgaagaca aataccccct gaatctgcag actggatacc 540cttatccaaa
agactgtgca aagcatgcct ggggggacta ctacttcacg gaagcagccg 600ccgcagcttt
ccagaacttc tacaataaca ctgacgggct attagatgca tgggcggact 660tctggaagaa
aacagcacag ggtttcaaag attataaaag tgtcattgga tatgaactta 720ttaatgaacc
atttgctggc gatatataca gggatccttc actcatgatt cctggcgttg 780cggacgaaag
aaacctcgcg ccagcctatg acgtcatcca taaagccatt cgtacggtgg 840atgaacaaca
cagcatattt ttcgagggcg taacgtggga ttatttcgcg gcgggattca 900gtaaagtacc
aggcggtgac gcataccgta atcggagcgt tttaagctat cattattacg 960agcctccaga
tttcaataag aagtttcagt tcgaggtgcg tatggaagat cttaggcgtt 1020taaaatgtgg
cggtttcttg accgaacttc ttacggttgg cgatacggcg aaagatatga 1080gcgatatgct
cgaacttttc gacatttgcg atcaacataa gcagtcctgg atgggatggc 1140tatacaaatc
ctacggttgc tacaagcaac atctgggctg tctaacggac tctatgcatg 1200acgaaacagg
acatttacgc gatatcgtcc ttcaaaacac tactcgcacc tacccgcaag 1260ctgtcgcagg
acacacaatt ggatataagt ttgacaggat tacgaaaaag ttcgatttga 1320gtttcgtcgt
tactgcagat tgtcgaagca cggagtctat cgtctacttc aacaaagatt 1380tacattactc
gaatggttac gacgttacgg tttttccgaa agattccgtt acgtggaagc 1440aagtagagaa
gaaaataatc atcaaccatt cgcaaaagct ttctgctggc acgactgtga 1500ctttctctct
cgttgctaag tagctattgc catggaaaca aatattctgc tgttggtgat 1560tcaaatctga
aaaggactgc gtattatatc agtgtcatga tttatattaa aacgaggcta 1620atccaaaatg
gctgggtaga ttttgttgct aatagtgaac aatagtgaaa accaagatat 1680gccataaaaa
gtttgtttta aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
173010503PRTCyanella capensisCyanea nozakii jellyfish endoglycoceramidase
(EGC,EGCase) 10Met Ala Glu Thr Gln Pro Leu Val Phe Val Leu Met Ser
Ile Ser Ala1 5 10 15Ile
Leu Thr Ala Gly Leu Pro Ile Asn Asp Asp Ala Ser Leu Leu Ile20
25 30Ser Val Asn Pro Glu Thr Gln Gln Leu Val Asp
Ser Leu Gly Arg Glu35 40 45Arg Phe Phe
His Gly Thr Asn Val Val Val Lys His Lys Pro Tyr His50 55
60Pro Ser Val Glu Gly Tyr Asp Asn Thr Ser Phe Ser Glu
Val Asp Met65 70 75
80Lys Ile Leu Gln Asp Leu Gly Leu Asn Thr Ile Arg Leu Gly Met Met85
90 95Leu Pro Gly Tyr Val Pro Thr Arg Gly Asn
Tyr Asn Glu Thr Tyr Leu100 105 110Lys Ile
Ile Gln Glu Ile Val Ser Lys Ala Ala Lys Tyr Gly Ile Tyr115
120 125Thr Leu Leu Asp Met His Gln Asp Val Met Ser Ala
Lys Phe Cys Val130 135 140Glu Gly Phe Pro
Asp Trp Ala Val Asn Thr Gly Asn Ala Asp Asn Phe145 150
155 160Pro Phe Pro Leu Glu Asp Lys Tyr Pro
Leu Asn Leu Gln Thr Gly Tyr165 170 175Pro
Tyr Pro Lys Asp Cys Ala Lys His Ala Trp Gly Asp Tyr Tyr Phe180
185 190Thr Glu Ala Ala Ala Ala Ala Phe Gln Asn Phe
Tyr Asn Asn Thr Asp195 200 205Gly Leu Leu
Asp Ala Trp Ala Asp Phe Trp Lys Lys Thr Ala Gln Gly210
215 220Phe Lys Asp Tyr Lys Ser Val Ile Gly Tyr Glu Leu
Ile Asn Glu Pro225 230 235
240Phe Ala Gly Asp Ile Tyr Arg Asp Pro Ser Leu Met Ile Pro Gly Val245
250 255Ala Asp Glu Arg Asn Leu Ala Pro Ala
Tyr Asp Val Ile His Lys Ala260 265 270Ile
Arg Thr Val Asp Glu Gln His Ser Ile Phe Phe Glu Gly Val Thr275
280 285Trp Asp Tyr Phe Ala Ala Gly Phe Ser Lys Val
Pro Gly Gly Asp Ala290 295 300Tyr Arg Asn
Arg Ser Val Leu Ser Tyr His Tyr Tyr Glu Pro Pro Asp305
310 315 320Phe Asn Lys Lys Phe Gln Phe
Glu Val Arg Met Glu Asp Leu Arg Arg325 330
335Leu Lys Cys Gly Gly Phe Leu Thr Glu Leu Leu Thr Val Gly Asp Thr340
345 350Ala Lys Asp Met Ser Asp Met Leu Glu
Leu Phe Asp Ile Cys Asp Gln355 360 365His
Lys Gln Ser Trp Met Gly Trp Leu Tyr Lys Ser Tyr Gly Cys Tyr370
375 380Lys Gln His Leu Gly Cys Leu Thr Asp Ser Met
His Asp Glu Thr Gly385 390 395
400His Leu Arg Asp Ile Val Leu Gln Asn Thr Thr Arg Thr Tyr Pro
Gln405 410 415Ala Val Ala Gly His Thr Ile
Gly Tyr Lys Phe Asp Arg Ile Thr Lys420 425
430Lys Phe Asp Leu Ser Phe Val Val Thr Ala Asp Cys Arg Ser Thr Glu435
440 445Ser Ile Val Tyr Phe Asn Lys Asp Leu
His Tyr Ser Asn Gly Tyr Asp450 455 460Val
Thr Val Phe Pro Lys Asp Ser Val Thr Trp Lys Gln Val Glu Lys465
470 475 480Lys Ile Ile Ile Asn His
Ser Gln Lys Leu Ser Ala Gly Thr Thr Val485 490
495Thr Phe Ser Leu Val Ala Lys500111730DNACyanella capensisCyanea
nozakii jellyfish endoglycoceramidase (EGC,EGCase) cDNA
11ggcgatttgc aatggctgaa acacaaccat tggtgtttgt cttgatgagc atttcagcta
60ttttaacggc aggacttcca ataaacgatg atgcatcatt gttgataagc gtcaatcctg
120aaacacaaca gttggttgat agtttgggga gagagagatt tttccatgga acgaacgttg
180ttgtcaaaca taaaccttat catccatcag ttgagggtta tgacaatacg tctttctcag
240aagttgatat gaagattttg caagatcttg gcctcaatac aattcgcctt ggtatgatgc
300tgccaggcta tgtgcctacc cgaggtaatt acaatgaaac atacttgaag atcatacagg
360aaattgtatc aaaggcagct aaatatggca tttatacttt actggatatg caccaggatg
420ttatgtctgc aaagttttgc gttgaaggat ttcctgattg ggctgttaat acaggcaatg
480cagacaattt cccttttcca cttgaagaca aataccccct gaatccgcag actggatacc
540cttatccaaa agactgtgca aagcatgcct ggggggacta ctacttcacg gaagcagccg
600ccgcagcttt ccagaacttc tacaataaca ctgacgggct attagatgca tgggcggact
660tctggaagaa aacagcacag ggtttcaaag attataaaag tgtcattgga tatgaactta
720ttaatgaacc atttgctggc gatatataca gggatccttc actcatgatt cctggcgttg
780cggacgaaag aaatctcgcg ccagcctatg acgtcatcca taaagccatt cgtacggtgg
840atgaacaaca cagcatattt ttcgagggcg taacgtggga ttatttcgcg gcgggattca
900gtaaagtacc aggcggtgac gcataccgta atcggagcgt tttaagctat cattattacg
960agcctccaga tttcaataag aagtttcagt tcgaggtgcg tatggaagat cttaggcgtt
1020taaaatgtgg cggtttcttg accgaacttc ttacggttgg cgatacggcg aaagatatga
1080gcgatatgct cgaacttttc gacatttgcg atcaacataa gcagtcctgg atgggatggc
1140tatacaaatc ctacggttgc tacaagcaac atctgggctg tctaacggac tctatgcatg
1200acgaaacagg acatttacgc gatatcgtcc ttcaaaacac tactcgcacc tacccgcaag
1260ctgtcgcagg acacacaatt ggatataagt ttgacaggat tacgaaaaag ttcgatttga
1320gtttcgtcgt tactgcagat tgtcgaagca cggagtctat cgtctacttc aacaaagatt
1380tacattactc gaatggttac gacgttacgg tttttccgaa agattccgtt acgtggaagc
1440aagtagagaa gaaaataatc atcaaccatt cgcaaaagct ttctgctggc acgactgtga
1500ctttctctct cgttgctaag tagctattgc catggaaaca aatattctgc tgttggtgat
1560tcaaatctga aaaggactgc gtattatatc agtgtcatga tttatattaa aacgaggcta
1620atccaaaatg gctgggtaga ttttgttgct aatagtgaac aatagtgaaa accaagatat
1680gccataaaaa gtttgtttta aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
173012503PRTCyanella capensisCyanea nozakii jellyfish endoglycoceramidase
(EGC,EGCase) 12Met Ala Glu Thr Gln Pro Leu Val Phe Val Leu Met Ser
Ile Ser Ala1 5 10 15Ile
Leu Thr Ala Gly Leu Pro Ile Asn Asp Asp Ala Ser Leu Leu Ile20
25 30Ser Val Asn Pro Glu Thr Gln Gln Leu Val Asp
Ser Leu Gly Arg Glu35 40 45Arg Phe Phe
His Gly Thr Asn Val Val Val Lys His Lys Pro Tyr His50 55
60Pro Ser Val Glu Gly Tyr Asp Asn Thr Ser Phe Ser Glu
Val Asp Met65 70 75
80Lys Ile Leu Gln Asp Leu Gly Leu Asn Thr Ile Arg Leu Gly Met Met85
90 95Leu Pro Gly Tyr Val Pro Thr Arg Gly Asn
Tyr Asn Glu Thr Tyr Leu100 105 110Lys Ile
Ile Gln Glu Ile Val Ser Lys Ala Ala Lys Tyr Gly Ile Tyr115
120 125Thr Leu Leu Asp Met His Gln Asp Val Met Ser Ala
Lys Phe Cys Val130 135 140Glu Gly Phe Pro
Asp Trp Ala Val Asn Thr Gly Asn Ala Asp Asn Phe145 150
155 160Pro Phe Pro Leu Glu Asp Lys Tyr Pro
Leu Asn Pro Gln Thr Gly Tyr165 170 175Pro
Tyr Pro Lys Asp Cys Ala Lys His Ala Trp Gly Asp Tyr Tyr Phe180
185 190Thr Glu Ala Ala Ala Ala Ala Phe Gln Asn Phe
Tyr Asn Asn Thr Asp195 200 205Gly Leu Leu
Asp Ala Trp Ala Asp Phe Trp Lys Lys Thr Ala Gln Gly210
215 220Phe Lys Asp Tyr Lys Ser Val Ile Gly Tyr Glu Leu
Ile Asn Glu Pro225 230 235
240Phe Ala Gly Asp Ile Tyr Arg Asp Pro Ser Leu Met Ile Pro Gly Val245
250 255Ala Asp Glu Arg Asn Leu Ala Pro Ala
Tyr Asp Val Ile His Lys Ala260 265 270Ile
Arg Thr Val Asp Glu Gln His Ser Ile Phe Phe Glu Gly Val Thr275
280 285Trp Asp Tyr Phe Ala Ala Gly Phe Ser Lys Val
Pro Gly Gly Asp Ala290 295 300Tyr Arg Asn
Arg Ser Val Leu Ser Tyr His Tyr Tyr Glu Pro Pro Asp305
310 315 320Phe Asn Lys Lys Phe Gln Phe
Glu Val Arg Met Glu Asp Leu Arg Arg325 330
335Leu Lys Cys Gly Gly Phe Leu Thr Glu Leu Leu Thr Val Gly Asp Thr340
345 350Ala Lys Asp Met Ser Asp Met Leu Glu
Leu Phe Asp Ile Cys Asp Gln355 360 365His
Lys Gln Ser Trp Met Gly Trp Leu Tyr Lys Ser Tyr Gly Cys Tyr370
375 380Lys Gln His Leu Gly Cys Leu Thr Asp Ser Met
His Asp Glu Thr Gly385 390 395
400His Leu Arg Asp Ile Val Leu Gln Asn Thr Thr Arg Thr Tyr Pro
Gln405 410 415Ala Val Ala Gly His Thr Ile
Gly Tyr Lys Phe Asp Arg Ile Thr Lys420 425
430Lys Phe Asp Leu Ser Phe Val Val Thr Ala Asp Cys Arg Ser Thr Glu435
440 445Ser Ile Val Tyr Phe Asn Lys Asp Leu
His Tyr Ser Asn Gly Tyr Asp450 455 460Val
Thr Val Phe Pro Lys Asp Ser Val Thr Trp Lys Gln Val Glu Lys465
470 475 480Lys Ile Ile Ile Asn His
Ser Gln Lys Leu Ser Ala Gly Thr Thr Val485 490
495Thr Phe Ser Leu Val Ala Lys500131856DNAHydra magnipapillataHydra
magnipapillata hydrozoan endoglycoceramidase (EGC, EGCase) cDNA
13atatattaaa aaaaaaaaat gataagcgtc gcacttatta tactttttct tgcaaaagtt
60atttccggaa aatcggatga ttttatatct gtaaaccctg aaacaaatat gcttattgat
120ggctatgggc gagaaagatt ttttcacggt accaatgttg tggtgaagca ttttcctttt
180catcctgaaa ctacagggtt taacaaagac acgttttctg aagatgacat gaaaattcta
240cagaagtttg gattaaactc aattcgatta ggaatgatgc tacctggata tgtgccaaaa
300agagaggaat ataatgaaac ttatataaaa gttatacaaa gtattgtcac tacagctgca
360aagtatggta tttacacatt gttagacatg catcaagatg ttttttcacc aaaattttgt
420gtagaaggca tgcctgattg gatagttaac acacaaggag caaaagattt tccaatgcca
480cttcataaac cgttcaattt ggatcctaaa acaggatatc cataccctga ggattgcgcc
540aagttttcat gggcagacta ttattttact gaagcagcag gacaagcttt tcaaaatctt
600tacgacaatg ttgatggact gcgtgacgaa tgggcacaat tttggaaaaa aactgctgat
660gtttttaaag aagaacctag cgttattgga tatgaactca taaacgaacc gttttgtggc
720aatgtattta aacacccgac attgctgatt cccggtgttg ccgattatct caacctacaa
780ccaacatatg acgcattaca aaaagctata cgtcaagttg atgaagaaca taacatattt
840tttgaaggag ttacatggga cttttttgaa gttggtttta ctgaagttcc tggcggtaaa
900cagtatcaaa atcggagcgt tcttagttat cattattatg agccgccaga cttttctaaa
960aaactaaatt ttgaagctcg tttgcttgat cttaaacgat tgaaatgtgg tggatttctt
1020actgaaatgt ttacagttgg aacagatttt aacagcatgt ttgaaatgtt tgatttatgc
1080gataaattca agcaaagttg gcatggatgg atgtataaat catacgggtg tatagagcaa
1140aacctgggtt gtttgaatat gtcttctcca ggtaaagaat ctattcaaat tgcgaacact
1200tcaagaacgt atccacaggc ggtggctggg cgtacgcaat cctacgcatt tgacataaag
1260actaaagtat tcacattggt atacgaaact gttggcagtt gcaaaagtgg tagaaccatt
1320gtttacttta ataaaaatct tcattatcct aacggatatc gctatgagat aaatccaaat
1380ttcaaagtaa cccccagtga aaatgaatac tttctttatt tagatgaagt taataaagta
1440ccaaacaccg ttgtgacatt taaacttttt ccactcagct ttactgatag tgaagatatt
1500catccagtaa cggtgatggg tgataaacat ctatcagaaa atcataatga aaatgaaaaa
1560aaaaaaaagt gaaaattata tttgaaaaaa ataattcgac tttaaacaca ttttaaaaat
1620tacttattat aaaaacgttt ttaaatattt tttaatgtaa aattttaaaa atcaatgaag
1680ttaatataag ctttaaataa catttatggt atattattta taaattgtaa catttaaagc
1740acaggtcagc aaaataattt ttttttggtt tttaagatat caggtatgat tttgtataat
1800ttggtgtgct gaatttgaga ataacatttt atgaaaaaaa aaaaaaaaaa aaaaaa
185614517PRTHydra magnipapillataHydra magnipapillata hydrozoan
endoglycoceramidase (EGC, EGCase) 14Met Ile Ser Val Ala Leu Ile Ile Leu
Phe Leu Ala Lys Val Ile Ser1 5 10
15Gly Lys Ser Asp Asp Phe Ile Ser Val Asn Pro Glu Thr Asn Met
Leu20 25 30Ile Asp Gly Tyr Gly Arg Glu
Arg Phe Phe His Gly Thr Asn Val Val35 40
45Val Lys His Phe Pro Phe His Pro Glu Thr Thr Gly Phe Asn Lys Asp50
55 60Thr Phe Ser Glu Asp Asp Met Lys Ile Leu
Gln Lys Phe Gly Leu Asn65 70 75
80Ser Ile Arg Leu Gly Met Met Leu Pro Gly Tyr Val Pro Lys Arg
Glu85 90 95Glu Tyr Asn Glu Thr Tyr Ile
Lys Val Ile Gln Ser Ile Val Thr Thr100 105
110Ala Ala Lys Tyr Gly Ile Tyr Thr Leu Leu Asp Met His Gln Asp Val115
120 125Phe Ser Pro Lys Phe Cys Val Glu Gly
Met Pro Asp Trp Ile Val Asn130 135 140Thr
Gln Gly Ala Lys Asp Phe Pro Met Pro Leu His Lys Pro Phe Asn145
150 155 160Leu Asp Pro Lys Thr Gly
Tyr Pro Tyr Pro Glu Asp Cys Ala Lys Phe165 170
175Ser Trp Ala Asp Tyr Tyr Phe Thr Glu Ala Ala Gly Gln Ala Phe
Gln180 185 190Asn Leu Tyr Asp Asn Val Asp
Gly Leu Arg Asp Glu Trp Ala Gln Phe195 200
205Trp Lys Lys Thr Ala Asp Val Phe Lys Glu Glu Pro Ser Val Ile Gly210
215 220Tyr Glu Leu Ile Asn Glu Pro Phe Cys
Gly Asn Val Phe Lys His Pro225 230 235
240Thr Leu Leu Ile Pro Gly Val Ala Asp Tyr Leu Asn Leu Gln
Pro Thr245 250 255Tyr Asp Ala Leu Gln Lys
Ala Ile Arg Gln Val Asp Glu Glu His Asn260 265
270Ile Phe Phe Glu Gly Val Thr Trp Asp Phe Phe Glu Val Gly Phe
Thr275 280 285Glu Val Pro Gly Gly Lys Gln
Tyr Gln Asn Arg Ser Val Leu Ser Tyr290 295
300His Tyr Tyr Glu Pro Pro Asp Phe Ser Lys Lys Leu Asn Phe Glu Ala305
310 315 320Arg Leu Leu Asp
Leu Lys Arg Leu Lys Cys Gly Gly Phe Leu Thr Glu325 330
335Met Phe Thr Val Gly Thr Asp Phe Asn Ser Met Phe Glu Met
Phe Asp340 345 350Leu Cys Asp Lys Phe Lys
Gln Ser Trp His Gly Trp Met Tyr Lys Ser355 360
365Tyr Gly Cys Ile Glu Gln Asn Leu Gly Cys Leu Asn Met Ser Ser
Pro370 375 380Gly Lys Glu Ser Ile Gln Ile
Ala Asn Thr Ser Arg Thr Tyr Pro Gln385 390
395 400Ala Val Ala Gly Arg Thr Gln Ser Tyr Ala Phe Asp
Ile Lys Thr Lys405 410 415Val Phe Thr Leu
Val Tyr Glu Thr Val Gly Ser Cys Lys Ser Gly Arg420 425
430Thr Ile Val Tyr Phe Asn Lys Asn Leu His Tyr Pro Asn Gly
Tyr Arg435 440 445Tyr Glu Ile Asn Pro Asn
Phe Lys Val Thr Pro Ser Glu Asn Glu Tyr450 455
460Phe Leu Tyr Leu Asp Glu Val Asn Lys Val Pro Asn Thr Val Val
Thr465 470 475 480Phe Lys
Leu Phe Pro Leu Ser Phe Thr Asp Ser Glu Asp Ile His Pro485
490 495Val Thr Val Met Gly Asp Lys His Leu Ser Glu Asn
His Asn Glu Asn500 505 510Glu Lys Lys Lys
Lys515151830DNASchistosoma japonicumSchsistosoma japonicum similar to
endoglycoceramidase (EGC, EGCase) cDNA 15agaattgtcg atagccgaga
gtagatctat agtataatat agtgttcatt gaaataattg 60tcactaattc aactactaat
tcattaactt ttacaataat acttagtctg gttattatta 120ccaaacgtag ttattattcc
atgtggtcaa tattcatctt gacatttcta atctggacat 180cagttcagac aaaacagatc
ccactgagca aaatacatct caattcagat ggactattca 240ctgattctcg aggattcatt
aaattattta gagggtttaa caatgtgcat aaacattttc 300catggtataa tgtaaattct
acgaatatca cacaattaga aatgtttaaa aattggggtt 360tgaatgttgt tcgattaggt
gtaatgtgga gtggagtgaa gccgacaata tcaatagtga 420ataccacata cttagatgtg
attgagaatg tgattgattt atatgctgat tatgggattt 480atgtaatatt ggatatgcat
caagatgtat tgtcatcgtt gtatggtctt tatgatggca 540ttccactatg gttaattgaa
aaatttaaga gaccacctca tcatttacaa tatccctggc 600catataagaa aaagccagat
ttttgggtga tgtcttattt aacttatgaa tgtgctaatg 660gagcccagca attgtataat
aatgtgtcgg gtgcatggaa tcattggggt gaattttggg 720aaatagtggc tagacgattt
ggtggaaagt caaatgtgct tggttatgaa ttgataaatg 780aaccaccacc aggaaacttt
tataccaatc cacttcgagg tcttccaggt tatgctggtc 840gatataactt gcaaccggtt
tatgattatc tcgttaagag aatacgcaaa tacgacaatt 900cgacactgat attctatgaa
ccagttacat atggagtatt tacgccagtg agatcatcag 960gatggttagg aactggattc
gatcgcgtcc ctggagccca tcgtgacaaa tcggcaccaa 1020gtaaaagtgt tctatcttat
cattattact gttggatact acaaactgat gcacaaaaca 1080cgacaatgcc attctggaag
aaagttatct gtgacaggct cctcttgcct aacgtcatct 1140ccaatgcaat cagagcaaca
aagtcaactg gaggtggccg atttctaact gaattcggtt 1200tatgtggaga tgacgggaat
ccacgtagtg tgaatacaat tgaatgtaat aatatattaa 1260atgaagctga taaacatttt
gaatcatgga cctactggga cagtaatctc ttagatttgt 1320caggaaatcc tatagtaact
gaggtgaaat cattcattcg tccgtatcca cattcaataa 1380gaggagtatt tcggaagcaa
cagttcgatc ataaaacagg ggattttcac ctctccttca 1440ttgctaacac aaccaaagag
cagaacaatg agaagcagac gttgatcgca gagatttaca 1500taccgagatc tgttcattat
cccaatggat tttccatgag tgtgaaaccg gacaatttaa 1560gcacgaagat gaatgagaat
atgatgtatg tatacttacc aagtggtgtc agtaatgcga 1620gtgtgtttgt tcgaatcgaa
atagtgagaa aatcgatcga gtgaactatt ctaattgtgg 1680tggctatccg ctgaactaaa
tgtcattgat gttattcata tgttatctgt gttattgaat 1740tcaacaagtt gtgtgtttgt
ttatttctat tgatttctac tgttccgact tttttatttt 1800taaatatatc agtcatccat
aatcatccat 183016507PRTSchistosoma
japonicumSchsistosoma japonicum similar to endoglycoceramidase (EGC,
EGCase) 16Met Trp Ser Ile Phe Ile Leu Thr Phe Leu Ile Trp Thr Ser Val
Gln1 5 10 15Thr Lys Gln
Ile Pro Leu Ser Lys Ile His Leu Asn Ser Asp Gly Leu20 25
30Phe Thr Asp Ser Arg Gly Phe Ile Lys Leu Phe Arg Gly
Phe Asn Asn35 40 45Val His Lys His Phe
Pro Trp Tyr Asn Val Asn Ser Thr Asn Ile Thr50 55
60Gln Leu Glu Met Phe Lys Asn Trp Gly Leu Asn Val Val Arg Leu
Gly65 70 75 80Val Met
Trp Ser Gly Val Lys Pro Thr Ile Ser Ile Val Asn Thr Thr85
90 95Tyr Leu Asp Val Ile Glu Asn Val Ile Asp Leu Tyr
Ala Asp Tyr Gly100 105 110Ile Tyr Val Ile
Leu Asp Met His Gln Asp Val Leu Ser Ser Leu Tyr115 120
125Gly Leu Tyr Asp Gly Ile Pro Leu Trp Leu Ile Glu Lys Phe
Lys Arg130 135 140Pro Pro His His Leu Gln
Tyr Pro Trp Pro Tyr Lys Lys Lys Pro Asp145 150
155 160Phe Trp Val Met Ser Tyr Leu Thr Tyr Glu Cys
Ala Asn Gly Ala Gln165 170 175Gln Leu Tyr
Asn Asn Val Ser Gly Ala Trp Asn His Trp Gly Glu Phe180
185 190Trp Glu Ile Val Ala Arg Arg Phe Gly Gly Lys Ser
Asn Val Leu Gly195 200 205Tyr Glu Leu Ile
Asn Glu Pro Pro Pro Gly Asn Phe Tyr Thr Asn Pro210 215
220Leu Arg Gly Leu Pro Gly Tyr Ala Gly Arg Tyr Asn Leu Gln
Pro Val225 230 235 240Tyr
Asp Tyr Leu Val Lys Arg Ile Arg Lys Tyr Asp Asn Ser Thr Leu245
250 255Ile Phe Tyr Glu Pro Val Thr Tyr Gly Val Phe
Thr Pro Val Arg Ser260 265 270Ser Gly Trp
Leu Gly Thr Gly Phe Asp Arg Val Pro Gly Ala His Arg275
280 285Asp Lys Ser Ala Pro Ser Lys Ser Val Leu Ser Tyr
His Tyr Tyr Cys290 295 300Trp Ile Leu Gln
Thr Asp Ala Gln Asn Thr Thr Met Pro Phe Trp Lys305 310
315 320Lys Val Ile Cys Asp Arg Leu Leu Leu
Pro Asn Val Ile Ser Asn Ala325 330 335Ile
Arg Ala Thr Lys Ser Thr Gly Gly Gly Arg Phe Leu Thr Glu Phe340
345 350Gly Leu Cys Gly Asp Asp Gly Asn Pro Arg Ser
Val Asn Thr Ile Glu355 360 365Cys Asn Asn
Ile Leu Asn Glu Ala Asp Lys His Phe Glu Ser Trp Thr370
375 380Tyr Trp Asp Ser Asn Leu Leu Asp Leu Ser Gly Asn
Pro Ile Val Thr385 390 395
400Glu Val Lys Ser Phe Ile Arg Pro Tyr Pro His Ser Ile Arg Gly Val405
410 415Phe Arg Lys Gln Gln Phe Asp His Lys
Thr Gly Asp Phe His Leu Ser420 425 430Phe
Ile Ala Asn Thr Thr Lys Glu Gln Asn Asn Glu Lys Gln Thr Leu435
440 445Ile Ala Glu Ile Tyr Ile Pro Arg Ser Val His
Tyr Pro Asn Gly Phe450 455 460Ser Met Ser
Val Lys Pro Asp Asn Leu Ser Thr Lys Met Asn Glu Asn465
470 475 480Met Met Tyr Val Tyr Leu Pro
Ser Gly Val Ser Asn Ala Ser Val Phe485 490
495Val Arg Ile Glu Ile Val Arg Lys Ser Ile Glu500
50517509PRTDictyostelium discoideumDictyostelium discoideum strain AX4
putative endoglycoceramidase (EGC, EGCase), hypothetical
protein DDB0190788 17Met Asn Lys Lys Lys Gln Ile Ile Thr Thr Ile Thr Leu
Leu Ser Phe1 5 10 15Ile
Asn Leu Phe Ser Ile Val Asn Ala Ile Ile Lys Val Asn Pro Ala20
25 30Asn Gln Phe Phe Ile Asp Gln Tyr Asn Arg Val
Arg Leu Phe His Gly35 40 45Val Asn Val
Val Tyr Lys Ile Pro Pro Phe His Pro Ser Leu Glu Gly50 55
60Phe Asp Pro Val Thr Ser Phe Ser Ser Gln Asp Ile Glu
Asn Leu Val65 70 75
80Glu Trp Gly Phe Asn Ala Val Arg Leu Gly Val Met Trp Pro Gly Val85
90 95Glu Pro Val Lys Asp Glu Tyr Asn Gln Thr
Tyr Leu Asp Val Met Ser100 105 110Lys Leu
Val Ser Glu Met Glu Asp Asn Glu Ile Tyr Thr Leu Ile Asp115
120 125Phe His Gln Asp Leu Leu Ser Arg Lys Tyr Cys Gly
Glu Gly Leu Pro130 135 140Asp Trp Ile Val
Ser Asn Asp Thr Asn Asp Ser Phe Pro Ser Pro Val145 150
155 160Ala His Ser Tyr Pro Lys Asn Asn Glu
Ser Tyr Pro Ser Leu Asp Gln165 170 175Cys
Leu Asn Lys Asp Phe Gly Val Tyr Tyr Phe Ser Glu Asp Val Asn180
185 190Arg Glu Phe Gln Asn Leu Tyr Asp Asn Val Asn
Gly Val Gln Asp Lys195 200 205Phe Ile Asp
Tyr Trp Arg Gln Val Val Asn Thr Phe Lys Ser Tyr Asp210
215 220Thr Val Leu Gly Tyr Glu Ile Ile Asn Glu Pro Trp
Gly Gly Asp Ile225 230 235
240Tyr Gln Asn Pro Glu Tyr Leu Leu Lys Leu Gly Tyr Ala Asp Ser Lys245
250 255Asn Leu Leu Pro Leu Tyr Gln Ala Val
Asn Asn Ala Ile Arg Glu Leu260 265 270Asp
Asp Gln His Cys Val Tyr Tyr Glu Lys Ala Leu Thr Asp Leu Phe275
280 285His Ser Tyr Phe Pro Ser Gly Thr Pro Gly Gly
Val Gln Tyr Asn Asp290 295 300Arg Gln Val
Leu Ser Tyr His Ile Tyr Cys Ala Thr Asp Arg Asp Gly305
310 315 320Asn Pro Arg His Glu Tyr Val
Cys Asp Gly Glu Asp Asp Ile Phe Leu325 330
335Val Ser Ala Met Lys Asp Leu Lys Gln Thr Gly Gly Gly Gly Phe Met340
345 350Thr Glu Phe Gly Ala Val Ser Asn Gly
Thr Asn Ser Ile Glu Met Leu355 360 365Asn
Tyr Leu Thr Gly Ser Ala Asp Lys Tyr Leu Gln Ser Trp Thr Tyr370
375 380Trp Gln Leu Lys Tyr Tyr Asn Asp Ile Thr Thr
Ala Gly Ser Thr Glu385 390 395
400Ser Leu Tyr Leu Pro Asn Gly Glu Leu Asp Ile Pro Lys Ile Thr
Ala405 410 415Leu Ser Arg Thr Tyr Ala Gln
Ala Ile Ala Gly Val Pro Leu Ser Met420 425
430Ser Phe Asn Pro Ala Asn Ser Asp Phe Ser Phe Ser Tyr Asn Ile Asn435
440 445Thr Thr Ile Thr Gln Pro Thr Gln Ile
Tyr Leu Asn Gln Asp Ile Tyr450 455 460Tyr
Pro Asn Gly Phe Thr Thr Asn Ile Ile Thr Gly Thr Ala Thr Val465
470 475 480Ser Ile Pro Gln Lys Asn
Leu Ile Tyr Ile Leu Pro Asn Ser Asn Thr485 490
495Ile Asn Gln Ser Thr Ile Thr Ile Thr Ile Leu Lys Lys500
50518647PRTStreptomyces avermitilisStreptomyces avermitilis strain
MA-4680 (ATCC 31267, NCIMB 12804, NRRL 8165) putative
endoglycoceramidase (EGC, EGCase), cellulase (glycosyl hydrolase
family 5) 18Met Arg Lys Asn Ala Lys Leu Thr His Glu Ser Glu Val Leu Thr
Phe1 5 10 15His Arg Ser
Ala Arg Thr Val Val Asp Met Ser Lys Leu Arg Ala Arg20 25
30Leu Leu Gly Val Leu Val Ser Leu Thr Gly Leu Leu Gly
Ala Thr Gly35 40 45Ala Gln Pro Ala Ala
Ala Asp Ser Leu Pro Asp Ser Leu Trp Phe Asp50 55
60Ala Ser Ala Ser Ala Ala Phe Thr Val Gln Asn Gly Arg Phe Ser
Asp65 70 75 80Gly Leu
Gly Arg Glu Val Val Leu Arg Gly Tyr Asn Val Ser Gly Glu85
90 95Thr Lys Leu Glu Glu Asn Ser Gly Leu Pro Phe Ala
Ser Val Ala Asp100 105 110Ala Arg Lys Ser
Ala Thr Ala Leu Arg Thr Leu Gly Gly Gly Asn Ser115 120
125Val Arg Phe Leu Leu Ser Trp Ala His Ala Glu Pro Val Arg
Gly Gln130 135 140Val Asp Thr Ala Tyr Leu
Ala Ala Ala Thr Ala Gln Met Arg Ala Phe145 150
155 160Leu Asp Ala Gly Ile Arg Val Phe Pro Asp Phe
His Gln Asp Leu Tyr165 170 175Ser Arg Tyr
Leu Phe Asn Ser Gly Ser Trp Tyr Thr Gly Asp Gly Ala180
185 190Pro Glu Trp Ala Val Asp Ala Gly Asp Tyr Pro Ala
Glu Ser Cys Gly195 200 205Ile Cys Leu Phe
Trp Gly Gln Asn Ile Thr Gln Asn Gly Ala Val Thr210 215
220Gln Ala Ser His Asp Phe Trp His Asn Ala Tyr Gly Val Gln
Asp Ala225 230 235 240Phe
Leu Ala Thr Ala Gln Ala Thr Met Ala Tyr Ile Gln Gln Asn Leu245
250 255Ser Ala Asp Glu Phe Asn Gly Val Val Gly Phe
Asp Pro Tyr Asn Glu260 265 270Pro His Ala
Gly Thr Tyr Asp Ser Gly Glu Thr Ser Arg Thr Trp Glu275
280 285Gln Asn Val Leu Trp Pro Phe Tyr Lys Lys Phe Arg
Ala Arg Met Asp290 295 300Ala Ala Gly Trp
Gln Thr Lys Pro Ala Phe Ile Glu Pro Asn Leu Phe305 310
315 320Trp Asn Ala Asn Ile Asp Phe Gln Lys
Gln Glu Gly Gly Leu Leu Asp325 330 335Ala
Gly Thr Leu Gly Pro Arg Tyr Val Leu Asn Thr His Phe Tyr Asp340
345 350Gln Lys Ala Ile Ser Gly Val Leu Met Trp Gly
Lys Ala Ala Asp Gly355 360 365Gln Tyr Ala
Thr Asp Phe Gly Lys Val Arg Asp Arg Ala Ala Gly Ala370
375 380Gly Thr Ala Ala Val Val Ser Glu Phe Gly His Pro
Leu Ser Gly Ser385 390 395
400Val Ser Asp Lys Ala Pro Thr Val Val Lys Ala Met Tyr Gln Ala Leu405
410 415Asp Ser Arg Leu Pro Gly Ser Thr Trp
Trp Ser Asp Pro Thr Gly Ser420 425 430Gly
Pro Val Leu Ser Gly Ala Gln Trp Gln Trp Asp Ile Tyr Asn Gly435
440 445Arg His His Glu Leu Glu Asn Gly Asn Pro Asp
Lys Val Leu Thr Ser450 455 460Gly Asp Ala
Trp Asn Asp Glu Asp Leu Ser Ala Val Ser Leu Asn Asp465
470 475 480Ser Gly Thr Ala Val Leu Arg
Gln Asp Ala Arg Leu Leu Asp Arg Leu485 490
495Tyr Pro Ser Ala Thr Ala Gly Ala Thr Val Ala Phe Thr Tyr Glu Asp500
505 510Arg Ser Arg Asp Gly Ser Thr Thr Leu
Thr Trp Asn Pro Val Pro Ser515 520 525Ser
Leu Pro Asn Val Ser Arg Leu Val Gly Ser Gly Gln Tyr Gly Leu530
535 540Leu Val Trp Arg Ser Asn Gly Ser Thr Ala Pro
Thr Glu Leu His Leu545 550 555
560Pro Ala Ser Phe Pro Ala Ala Ser Thr Thr Val Val Ser Asp Leu
Gly565 570 575Thr Thr Ser Gly Leu Pro Ala
Tyr Thr Arg Thr Thr Pro Val Gly His580 585
590Ala Ala Glu Pro Gly Gly Thr Gly Ser His Arg Leu Leu Leu Thr Ala595
600 605Ala Asp Ser Gly Thr Val His Tyr Ala
Leu Val Thr Asn Gly Ala Thr610 615 620Ala
Pro Ser Ala Gly Leu Leu Ser Ala Ala Arg Ala Glu Leu Ser Ser625
630 635 640Trp Ala Ala Thr Lys Val
Gly64519654PRTLeptospira interrogansLeptospira interrogans serovar
Copenhageni strain Fiocruz L1-130 putative endoglycoceramidase
(EGC, EGCase), hypothetical protein LIC20191 19Met Glu Glu Leu Phe
Val Lys Asn Gly His Phe Ala Ser Lys Glu Gly1 5
10 15Ala Ile Tyr Gln Leu Arg Gly Val Asn Leu Ser Gly
Ser Ala Lys Leu20 25 30Pro Leu Lys Pro
Asp Gly Thr Thr His Phe Asp Gln Thr Thr Thr Phe35 40
45Asp Asn His Lys Asn Val Ser Phe Val Gly Arg Pro Leu Lys
Glu Asp50 55 60Gln Ala Glu Glu His Phe
Asp Arg Leu Arg Lys Trp Gly Phe Asn Phe65 70
75 80Leu Arg Phe Leu Ile Thr Trp Glu Ala Ile Glu
His Lys Gly Pro Gly85 90 95Lys Tyr Asp
Asn Glu Tyr Ile Asp Tyr Val Glu Arg Met Val Ser Leu100
105 110Ala Ala Lys Lys Gly Phe Tyr Leu Phe Ile Asp Pro
His Gln Asp Val115 120 125Trp Ser Arg Phe
Thr Gly Gly Asp Gly Ala Pro Gly Trp Thr Leu Glu130 135
140Glu Leu Gly Met Asn Ile Ser Lys Ile Arg Asn Ser Glu Thr
Ala Ile145 150 155 160Val
His His His Gln Gly Lys Asn Tyr Arg Arg Met Ser Trp Pro Leu165
170 175Asn Tyr Gln Lys Tyr Ser Cys Ala Thr Met Phe
Ser Leu Phe Phe Gly180 185 190Gly Lys Glu
Phe Ala Pro Asp Thr Lys Ile Asp Gly Arg Asn Val Gln195
200 205Asp Phe Leu Gln Asp His Tyr Ile Asp Ser Val Leu
Lys Ile Val Arg210 215 220Lys Leu Lys Lys
Tyr Lys Asn Val Ile Gly Phe Asp Thr Leu Asn Glu225 230
235 240Pro Ser Pro Gly Trp Ile Gly Lys Lys
Asn Leu Gly Glu Phe Asp Gly245 250 255Phe
Gly Phe Gly Lys Val Val Lys Ser Ser Pro Phe Gln Glu Met Tyr260
265 270Leu Ser Glu Gly Arg Ala Val Ser Ala Ala Gln
Ala Tyr Met Leu Gly275 280 285Phe Trp Ser
Leu Pro Phe Gly Lys Val Arg Leu Asn Pro Glu Gly Val290
295 300Pro Leu Trp Glu Arg Gly His Gln Cys Ile Trp Arg
Asn His Gly Val305 310 315
320Trp Asp Tyr Asp Pro Asn Gly Ala Pro Met Met Leu Lys Pro Glu Tyr325
330 335Phe Tyr Lys Lys Asn Gly Arg Lys Tyr
Glu Phe Tyr Ser Asp Phe Met340 345 350Tyr
Pro Phe Ile Lys Lys Phe Lys Glu Arg Val Gln Lys Leu Glu Asn355
360 365Arg Phe His Ile Phe Ile Glu Ser Asp Pro Ser
Lys Leu Glu Leu Glu370 375 380Trp Lys Glu
Ile Pro Lys Lys Asn Gln Gly Ser Val Ile Asn Ala Thr385
390 395 400His Trp Tyr Asp Ile Ser Val
Leu Met Leu Lys Arg Tyr Leu Pro Trp405 410
415Phe Gly Val His Val Phe Lys Gln Lys Pro Ile Phe Gly Lys Glu Asn420
425 430Ile Asp Asn Ala Tyr Glu Glu Thr Ile
Arg Met Ile Arg Glu Met Ser435 440 445Glu
Lys Lys Met Gly Asn Cys Pro Thr Val Ile Gly Glu Thr Gly Ile450
455 460Pro Met Asp Leu Asn His Arg Val Ala Tyr Leu
Lys Asn Asp Tyr Gly465 470 475
480Val Leu Glu Lys Ala Leu Asp Arg Ile Met Lys Ala Val Glu Lys
Asn485 490 495Phe Val Asn Leu Ala Leu Trp
Asn Tyr Thr Pro Asp His Thr His Ser500 505
510Leu Gly Asp Arg Trp Asn Glu Glu Asp Leu Ser Ile Tyr Ser Gln Asp515
520 525Thr Pro Ser Ser Tyr Asp Glu Asp Gly
Gly Arg Ala Val Arg Ala Phe530 535 540Ser
Arg Pro Tyr Pro Ile Arg Thr Lys Gly Phe Pro Val Ala Leu Thr545
550 555 560Phe Asp Met Glu Arg Ser
Leu Phe Lys Tyr Ala Phe Arg Gln Glu Gly565 570
575Asp Leu Phe Pro Glu Thr Glu Ile Phe Ile Pro Glu Ile His Tyr
Lys580 585 590Lys Gly Phe Glu Val Leu Val
Asn Ala Gly Thr Tyr Gln Tyr Asp Phe595 600
605Arg Ser Arg Val Leu Lys Phe Lys Gly Glu Lys Gly Ile Leu Asp Tyr610
615 620Gly Ile Thr Val Tyr Pro Ser Lys Lys
Ser Leu Ser Arg Glu Gln Asp625 630 635
640Arg Thr Lys Val Val Pro Lys Thr Gln Lys Arg Lys Thr
Gln645 65020770PRTNeurospora crassaNeurospora crassa
strain OR74A putative endoglycoceramidase (EGC, EGCase),
hypothetical protein 20Met Ala Gly Phe Arg Leu Thr Ile Glu Asn Gly
Ser Phe Arg Asp Val1 5 10
15His Gly Arg Gln Ile Thr Leu Arg Gly Ile Asn Val Ala Gly Asp Ala20
25 30Lys Tyr Pro Asn Lys Pro Glu Gln Pro Ser
His Val Gly Glu Asn Phe35 40 45Phe Asp
Gly Asp Asn Val Lys Phe Thr Gly Arg Pro Phe Pro Lys Glu50
55 60Glu Ala His Leu His Phe Ser Arg Leu Lys Arg Phe
Gly Tyr Asn Thr65 70 75
80Ile Arg Tyr Val Phe Thr Trp Glu Ala Ile Glu Ala Ala Gly Pro Gly85
90 95Ile Tyr Asp Glu Glu Trp Ile Gln His Thr
Ile Asp Val Leu Arg Val100 105 110Ala Lys
Arg Tyr Gly Phe Tyr Ile Phe Met Asp Pro His Gln Asp Val115
120 125Trp Ser Arg Phe Ser Gly Gly Ser Gly Ala Pro Met
Trp Thr Leu Tyr130 135 140Ala Ala Gly Leu
Asn Pro Gln Ser Phe Ala Ala Thr Glu Ala Ala Ile145 150
155 160Val His Asn Val Tyr Pro Glu Pro His
Asn Phe Pro Lys Met Ile Trp165 170 175Ser
Thr Asn Tyr Tyr Arg Leu Ala Ala Ala Thr Met Phe Thr Leu Phe180
185 190Phe Ala Gly Arg Asp Phe Ala Pro Lys Cys Ile
Ile Asp Gly Val Asn195 200 205Ile Gln Asp
Tyr Leu Gln Asp His Phe Leu Arg Ala Cys Ala His Leu210
215 220Ala Gln Arg Ile His Glu Ala Gly Asp Ile Glu Asn
Asp Val Val Phe225 230 235
240Gly Trp Glu Ser Leu Asn Glu Pro Asn Lys Gly Met Ile Ala Tyr Glu245
250 255Asp Ile Ser Val Ile Pro Lys Glu Gln
Asn Leu Lys Lys Gly Thr Cys260 265 270Pro
Thr Ile Trp Gln Thr Ile Leu Thr Gly Ser Gly Arg Ala Val Glu275
280 285Val Asp Thr Trp Asp Met Gly Gly Met Gly Pro
Tyr Lys Val Gly Arg290 295 300Ala Leu Ile
Asp Pro Ser Gly Glu Gln Ala Trp Leu Pro Ala Asp Tyr305
310 315 320Asp Glu Ser Arg Tyr Gly Tyr
Lys Arg Asp Pro Gly Trp Lys Leu Gly325 330
335Gln Cys Ile Trp Ala Gln His Gly Val Trp Asp Pro Ala Thr Asp Ser340
345 350Leu Leu Lys Lys Asp Tyr Phe Gly Lys
His Pro Ala Thr Gly Glu His355 360 365Val
Asp Tyr Pro Tyr Phe Ser Asn Arg Tyr Phe Met Asp Phe Phe Arg370
375 380Lys Tyr Arg Asp Thr Ile Arg Ser Ile His Pro
Asn Ala Ile Ile Leu385 390 395
400Leu Gln Gly Pro Thr Met Glu Leu Pro Pro Lys Ile Ile Gly Thr
Pro405 410 415Asp Gly Asp Asp Pro Leu Leu
Val Tyr Ala Pro His Trp Tyr Asp Gly420 425
430Ile Thr Leu Met Thr Lys Lys Trp Asn Arg Val Trp Asn Val Asp Val435
440 445Ile Gly Ile Leu Arg Gly Lys Tyr Trp
Ser Pro Ala Phe Gly Ile Lys450 455 460Ile
Gly Glu Thr Ala Ile Arg Asn Cys Phe Lys Asn Gln His Ala Thr465
470 475 480Met Arg Gln Glu Gly Leu
Asp Tyr Ile Gly Asn His Pro Cys Val Met485 490
495Thr Glu Phe Gly Ile Pro Tyr Asp Met Asp Asp Lys Asn Ala Tyr
Lys500 505 510Thr Gly Asp Tyr Ser Ser Gln
Ser Ala Ala Met Asp Ala Asn His Tyr515 520
525Gly Val Glu Gly Ala Gly Leu Glu Gly Tyr Thr Leu Trp Leu Tyr Met530
535 540Thr Lys Asn Asp His Glu Leu Gly Asp
Gln Trp Asn Gly Glu Asp Leu545 550 555
560Ser Ile Phe Ser Val Asp Asp Lys Leu Leu Pro Glu Ser Pro
Val Pro565 570 575Lys Ser His Ser Arg Asp
Gly Ser Ser Ser Ser Ile Ala Thr Pro Thr580 585
590Gly Thr Lys Asp Asp Asp Leu Asp Asp Asp Ser Ser Val Thr Pro
Ala595 600 605Asn Ile Lys Arg Thr Leu Thr
Asn Pro Ser Ile Ser Ser Val Ser Thr610 615
620Gln Arg Gln Pro Glu Leu Thr Asn Ser Pro Gly Tyr Arg Ala Ala Glu625
630 635 640Ala Tyr Val Arg
Pro Ala Pro Ile Ala Thr Ala Gly Thr Val Lys Lys645 650
655Tyr Gly Phe Asp Leu Arg Ser Cys Gln Phe His Val Thr Ile
Gln Ala660 665 670Pro Glu Ala Ala Lys Pro
Asp Thr Pro Thr Val Val Phe Leu Pro Asp675 680
685Tyr His Phe Pro Lys Asp Ala Cys Gln Val Glu Val Ser Ser Gly
Lys690 695 700Trp Glu Ile Arg Ser Asp Glu
Glu Glu Thr Thr Pro Leu Gln Lys Leu705 710
715 720Arg Trp Trp His Gly Glu Gly Glu Gln Thr Leu Arg
Val Thr Gly Val725 730 735Val Lys Gln Val
Asn Gly Asn Ser Ser Glu Gly Ala Glu Val Gly Tyr740 745
750Tyr Asp Gln Val Phe Asn Gln Ala Lys Gly Phe Leu Asp Ala
Cys Val755 760 765Ile
Met77021490PRTArtificial SequenceDescription of Artificial Sequencemutant
endoglycoceramidase (EGC, EGCase) A derived from GenBank
Accession #AAB67050 (E233A) 21Met Arg Arg Thr Arg Leu Val Ser Leu Ile Val
Thr Gly Ser Leu Val1 5 10
15Phe Gly Gly Gly Val Ala Ala Ala Gln Ser Ser Leu Ala Ala Ser Gly20
25 30Ser Gly Ser Gly Ser Gly Thr Ala Leu Thr
Pro Ser Tyr Leu Lys Asp35 40 45Asp Asp
Gly Arg Ser Leu Ile Leu Arg Gly Phe Asn Thr Ala Ser Ser50
55 60Ala Lys Ser Ala Pro Asp Gly Met Pro Gln Phe Thr
Glu Ala Asp Leu65 70 75
80Ala Arg Glu Tyr Ala Asp Met Gly Thr Asn Phe Val Arg Phe Leu Ile85
90 95Ser Trp Arg Ser Val Glu Pro Ala Pro Gly
Val Tyr Asp Gln Gln Tyr100 105 110Leu Asp
Arg Val Glu Asp Arg Val Gly Trp Tyr Ala Glu Arg Gly Tyr115
120 125Lys Val Met Leu Asp Met His Gln Asp Val Tyr Ser
Gly Ala Ile Thr130 135 140Pro Glu Gly Asn
Ser Gly Asn Gly Ala Gly Ala Ile Gly Asn Gly Ala145 150
155 160Pro Ala Trp Ala Thr Tyr Met Asp Gly
Leu Pro Val Glu Pro Gln Pro165 170 175Arg
Trp Glu Leu Tyr Tyr Ile Gln Pro Gly Val Met Arg Ala Phe Asp180
185 190Asn Phe Trp Asn Thr Thr Gly Lys His Pro Glu
Leu Val Glu His Tyr195 200 205Ala Lys Ala
Trp Arg Ala Val Ala Asp Arg Phe Ala Asp Asn Asp Ala210
215 220Val Val Ala Tyr Asp Leu Met Asn Ala Pro Phe Gly
Gly Ser Leu Gln225 230 235
240Gly Pro Ala Phe Glu Ala Gly Pro Leu Ala Ala Met Tyr Gln Arg Thr245
250 255Thr Asp Ala Ile Arg Gln Val Asp Gln
Asp Thr Trp Val Cys Val Ala260 265 270Pro
Gln Ala Ile Gly Val Asn Gln Gly Leu Pro Ser Gly Leu Thr Lys275
280 285Ile Asp Asp Pro Arg Ala Gly Gln Gln Arg Ile
Ala Tyr Cys Pro His290 295 300Leu Tyr Pro
Leu Pro Leu Asp Ile Gly Asp Gly His Glu Gly Leu Ala305
310 315 320Arg Thr Leu Thr Asp Val Thr
Ile Asp Ala Trp Arg Ala Asn Thr Ala325 330
335His Thr Ala Arg Val Leu Gly Asp Val Pro Ile Ile Leu Gly Glu Phe340
345 350Gly Leu Asp Thr Thr Leu Pro Gly Ala
Arg Asp Tyr Ile Glu Arg Val355 360 365Tyr
Gly Thr Ala Arg Glu Met Gly Ala Gly Val Ser Tyr Trp Ser Ser370
375 380Asp Pro Gly Pro Trp Gly Pro Tyr Leu Pro Asp
Gly Thr Gln Thr Leu385 390 395
400Leu Val Asp Thr Leu Asn Lys Pro Tyr Pro Arg Ala Val Ala Gly
Thr405 410 415Pro Thr Glu Trp Ser Ser Thr
Ser Asp Arg Leu Gln Leu Thr Ile Glu420 425
430Pro Asp Ala Ala Ile Thr Ala Pro Thr Glu Ile Tyr Leu Pro Glu Ala435
440 445Gly Phe Pro Gly Asp Val His Val Glu
Gly Ala Asp Val Val Gly Trp450 455 460Asp
Arg Gln Ser Arg Leu Leu Thr Val Arg Thr Pro Ala Asp Ser Gly465
470 475 480Asn Val Thr Val Thr Val
Thr Pro Ala Ala485 49022490PRTArtificial
SequenceDescription of Artificial Sequencemutant endoglycoceramidase
(EGC, EGCase) B derived from GenBank Accession #AAB67050 (E233S)
22Met Arg Arg Thr Arg Leu Val Ser Leu Ile Val Thr Gly Ser Leu Val1
5 10 15Phe Gly Gly Gly Val Ala
Ala Ala Gln Ser Ser Leu Ala Ala Ser Gly20 25
30Ser Gly Ser Gly Ser Gly Thr Ala Leu Thr Pro Ser Tyr Leu Lys Asp35
40 45Asp Asp Gly Arg Ser Leu Ile Leu Arg
Gly Phe Asn Thr Ala Ser Ser50 55 60Ala
Lys Ser Ala Pro Asp Gly Met Pro Gln Phe Thr Glu Ala Asp Leu65
70 75 80Ala Arg Glu Tyr Ala Asp
Met Gly Thr Asn Phe Val Arg Phe Leu Ile85 90
95Ser Trp Arg Ser Val Glu Pro Ala Pro Gly Val Tyr Asp Gln Gln Tyr100
105 110Leu Asp Arg Val Glu Asp Arg Val
Gly Trp Tyr Ala Glu Arg Gly Tyr115 120
125Lys Val Met Leu Asp Met His Gln Asp Val Tyr Ser Gly Ala Ile Thr130
135 140Pro Glu Gly Asn Ser Gly Asn Gly Ala
Gly Ala Ile Gly Asn Gly Ala145 150 155
160Pro Ala Trp Ala Thr Tyr Met Asp Gly Leu Pro Val Glu Pro
Gln Pro165 170 175Arg Trp Glu Leu Tyr Tyr
Ile Gln Pro Gly Val Met Arg Ala Phe Asp180 185
190Asn Phe Trp Asn Thr Thr Gly Lys His Pro Glu Leu Val Glu His
Tyr195 200 205Ala Lys Ala Trp Arg Ala Val
Ala Asp Arg Phe Ala Asp Asn Asp Ala210 215
220Val Val Ala Tyr Asp Leu Met Asn Ser Pro Phe Gly Gly Ser Leu Gln225
230 235 240Gly Pro Ala Phe
Glu Ala Gly Pro Leu Ala Ala Met Tyr Gln Arg Thr245 250
255Thr Asp Ala Ile Arg Gln Val Asp Gln Asp Thr Trp Val Cys
Val Ala260 265 270Pro Gln Ala Ile Gly Val
Asn Gln Gly Leu Pro Ser Gly Leu Thr Lys275 280
285Ile Asp Asp Pro Arg Ala Gly Gln Gln Arg Ile Ala Tyr Cys Pro
His290 295 300Leu Tyr Pro Leu Pro Leu Asp
Ile Gly Asp Gly His Glu Gly Leu Ala305 310
315 320Arg Thr Leu Thr Asp Val Thr Ile Asp Ala Trp Arg
Ala Asn Thr Ala325 330 335His Thr Ala Arg
Val Leu Gly Asp Val Pro Ile Ile Leu Gly Glu Phe340 345
350Gly Leu Asp Thr Thr Leu Pro Gly Ala Arg Asp Tyr Ile Glu
Arg Val355 360 365Tyr Gly Thr Ala Arg Glu
Met Gly Ala Gly Val Ser Tyr Trp Ser Ser370 375
380Asp Pro Gly Pro Trp Gly Pro Tyr Leu Pro Asp Gly Thr Gln Thr
Leu385 390 395 400Leu Val
Asp Thr Leu Asn Lys Pro Tyr Pro Arg Ala Val Ala Gly Thr405
410 415Pro Thr Glu Trp Ser Ser Thr Ser Asp Arg Leu Gln
Leu Thr Ile Glu420 425 430Pro Asp Ala Ala
Ile Thr Ala Pro Thr Glu Ile Tyr Leu Pro Glu Ala435 440
445Gly Phe Pro Gly Asp Val His Val Glu Gly Ala Asp Val Val
Gly Trp450 455 460Asp Arg Gln Ser Arg Leu
Leu Thr Val Arg Thr Pro Ala Asp Ser Gly465 470
475 480Asn Val Thr Val Thr Val Thr Pro Ala Ala485
49023490PRTArtificial SequenceDescription of Artificial
Sequencemutant endoglycoceramidase (EGC, EGCase) C derived from
GenBank Accession #AAB67050 (E233G) 23Met Arg Arg Thr Arg Leu Val Ser Leu
Ile Val Thr Gly Ser Leu Val1 5 10
15Phe Gly Gly Gly Val Ala Ala Ala Gln Ser Ser Leu Ala Ala Ser
Gly20 25 30Ser Gly Ser Gly Ser Gly Thr
Ala Leu Thr Pro Ser Tyr Leu Lys Asp35 40
45Asp Asp Gly Arg Ser Leu Ile Leu Arg Gly Phe Asn Thr Ala Ser Ser50
55 60Ala Lys Ser Ala Pro Asp Gly Met Pro Gln
Phe Thr Glu Ala Asp Leu65 70 75
80Ala Arg Glu Tyr Ala Asp Met Gly Thr Asn Phe Val Arg Phe Leu
Ile85 90 95Ser Trp Arg Ser Val Glu Pro
Ala Pro Gly Val Tyr Asp Gln Gln Tyr100 105
110Leu Asp Arg Val Glu Asp Arg Val Gly Trp Tyr Ala Glu Arg Gly Tyr115
120 125Lys Val Met Leu Asp Met His Gln Asp
Val Tyr Ser Gly Ala Ile Thr130 135 140Pro
Glu Gly Asn Ser Gly Asn Gly Ala Gly Ala Ile Gly Asn Gly Ala145
150 155 160Pro Ala Trp Ala Thr Tyr
Met Asp Gly Leu Pro Val Glu Pro Gln Pro165 170
175Arg Trp Glu Leu Tyr Tyr Ile Gln Pro Gly Val Met Arg Ala Phe
Asp180 185 190Asn Phe Trp Asn Thr Thr Gly
Lys His Pro Glu Leu Val Glu His Tyr195 200
205Ala Lys Ala Trp Arg Ala Val Ala Asp Arg Phe Ala Asp Asn Asp Ala210
215 220Val Val Ala Tyr Asp Leu Met Asn Gly
Pro Phe Gly Gly Ser Leu Gln225 230 235
240Gly Pro Ala Phe Glu Ala Gly Pro Leu Ala Ala Met Tyr Gln
Arg Thr245 250 255Thr Asp Ala Ile Arg Gln
Val Asp Gln Asp Thr Trp Val Cys Val Ala260 265
270Pro Gln Ala Ile Gly Val Asn Gln Gly Leu Pro Ser Gly Leu Thr
Lys275 280 285Ile Asp Asp Pro Arg Ala Gly
Gln Gln Arg Ile Ala Tyr Cys Pro His290 295
300Leu Tyr Pro Leu Pro Leu Asp Ile Gly Asp Gly His Glu Gly Leu Ala305
310 315 320Arg Thr Leu Thr
Asp Val Thr Ile Asp Ala Trp Arg Ala Asn Thr Ala325 330
335His Thr Ala Arg Val Leu Gly Asp Val Pro Ile Ile Leu Gly
Glu Phe340 345 350Gly Leu Asp Thr Thr Leu
Pro Gly Ala Arg Asp Tyr Ile Glu Arg Val355 360
365Tyr Gly Thr Ala Arg Glu Met Gly Ala Gly Val Ser Tyr Trp Ser
Ser370 375 380Asp Pro Gly Pro Trp Gly Pro
Tyr Leu Pro Asp Gly Thr Gln Thr Leu385 390
395 400Leu Val Asp Thr Leu Asn Lys Pro Tyr Pro Arg Ala
Val Ala Gly Thr405 410 415Pro Thr Glu Trp
Ser Ser Thr Ser Asp Arg Leu Gln Leu Thr Ile Glu420 425
430Pro Asp Ala Ala Ile Thr Ala Pro Thr Glu Ile Tyr Leu Pro
Glu Ala435 440 445Gly Phe Pro Gly Asp Val
His Val Glu Gly Ala Asp Val Val Gly Trp450 455
460Asp Arg Gln Ser Arg Leu Leu Thr Val Arg Thr Pro Ala Asp Ser
Gly465 470 475 480Asn Val
Thr Val Thr Val Thr Pro Ala Ala485 49024490PRTArtificial
SequenceDescription of Artificial Sequencemutant endoglycoceramidase
(EGC, EGCase) D derived from GenBank Accession #AAB67050 (E233D)
24Met Arg Arg Thr Arg Leu Val Ser Leu Ile Val Thr Gly Ser Leu Val1
5 10 15Phe Gly Gly Gly Val Ala
Ala Ala Gln Ser Ser Leu Ala Ala Ser Gly20 25
30Ser Gly Ser Gly Ser Gly Thr Ala Leu Thr Pro Ser Tyr Leu Lys Asp35
40 45Asp Asp Gly Arg Ser Leu Ile Leu Arg
Gly Phe Asn Thr Ala Ser Ser50 55 60Ala
Lys Ser Ala Pro Asp Gly Met Pro Gln Phe Thr Glu Ala Asp Leu65
70 75 80Ala Arg Glu Tyr Ala Asp
Met Gly Thr Asn Phe Val Arg Phe Leu Ile85 90
95Ser Trp Arg Ser Val Glu Pro Ala Pro Gly Val Tyr Asp Gln Gln Tyr100
105 110Leu Asp Arg Val Glu Asp Arg Val
Gly Trp Tyr Ala Glu Arg Gly Tyr115 120
125Lys Val Met Leu Asp Met His Gln Asp Val Tyr Ser Gly Ala Ile Thr130
135 140Pro Glu Gly Asn Ser Gly Asn Gly Ala
Gly Ala Ile Gly Asn Gly Ala145 150 155
160Pro Ala Trp Ala Thr Tyr Met Asp Gly Leu Pro Val Glu Pro
Gln Pro165 170 175Arg Trp Glu Leu Tyr Tyr
Ile Gln Pro Gly Val Met Arg Ala Phe Asp180 185
190Asn Phe Trp Asn Thr Thr Gly Lys His Pro Glu Leu Val Glu His
Tyr195 200 205Ala Lys Ala Trp Arg Ala Val
Ala Asp Arg Phe Ala Asp Asn Asp Ala210 215
220Val Val Ala Tyr Asp Leu Met Asn Asp Pro Phe Gly Gly Ser Leu Gln225
230 235 240Gly Pro Ala Phe
Glu Ala Gly Pro Leu Ala Ala Met Tyr Gln Arg Thr245 250
255Thr Asp Ala Ile Arg Gln Val Asp Gln Asp Thr Trp Val Cys
Val Ala260 265 270Pro Gln Ala Ile Gly Val
Asn Gln Gly Leu Pro Ser Gly Leu Thr Lys275 280
285Ile Asp Asp Pro Arg Ala Gly Gln Gln Arg Ile Ala Tyr Cys Pro
His290 295 300Leu Tyr Pro Leu Pro Leu Asp
Ile Gly Asp Gly His Glu Gly Leu Ala305 310
315 320Arg Thr Leu Thr Asp Val Thr Ile Asp Ala Trp Arg
Ala Asn Thr Ala325 330 335His Thr Ala Arg
Val Leu Gly Asp Val Pro Ile Ile Leu Gly Glu Phe340 345
350Gly Leu Asp Thr Thr Leu Pro Gly Ala Arg Asp Tyr Ile Glu
Arg Val355 360 365Tyr Gly Thr Ala Arg Glu
Met Gly Ala Gly Val Ser Tyr Trp Ser Ser370 375
380Asp Pro Gly Pro Trp Gly Pro Tyr Leu Pro Asp Gly Thr Gln Thr
Leu385 390 395 400Leu Val
Asp Thr Leu Asn Lys Pro Tyr Pro Arg Ala Val Ala Gly Thr405
410 415Pro Thr Glu Trp Ser Ser Thr Ser Asp Arg Leu Gln
Leu Thr Ile Glu420 425 430Pro Asp Ala Ala
Ile Thr Ala Pro Thr Glu Ile Tyr Leu Pro Glu Ala435 440
445Gly Phe Pro Gly Asp Val His Val Glu Gly Ala Asp Val Val
Gly Trp450 455 460Asp Arg Gln Ser Arg Leu
Leu Thr Val Arg Thr Pro Ala Asp Ser Gly465 470
475 480Asn Val Thr Val Thr Val Thr Pro Ala Ala485
49025490PRTArtificial SequenceDescription of Artificial
Sequencemutant endoglycoceramidase (EGC, EGCase) E derived from
GenBank Accession #AAB67050 (E233Q) 25Met Arg Arg Thr Arg Leu Val Ser Leu
Ile Val Thr Gly Ser Leu Val1 5 10
15Phe Gly Gly Gly Val Ala Ala Ala Gln Ser Ser Leu Ala Ala Ser
Gly20 25 30Ser Gly Ser Gly Ser Gly Thr
Ala Leu Thr Pro Ser Tyr Leu Lys Asp35 40
45Asp Asp Gly Arg Ser Leu Ile Leu Arg Gly Phe Asn Thr Ala Ser Ser50
55 60Ala Lys Ser Ala Pro Asp Gly Met Pro Gln
Phe Thr Glu Ala Asp Leu65 70 75
80Ala Arg Glu Tyr Ala Asp Met Gly Thr Asn Phe Val Arg Phe Leu
Ile85 90 95Ser Trp Arg Ser Val Glu Pro
Ala Pro Gly Val Tyr Asp Gln Gln Tyr100 105
110Leu Asp Arg Val Glu Asp Arg Val Gly Trp Tyr Ala Glu Arg Gly Tyr115
120 125Lys Val Met Leu Asp Met His Gln Asp
Val Tyr Ser Gly Ala Ile Thr130 135 140Pro
Glu Gly Asn Ser Gly Asn Gly Ala Gly Ala Ile Gly Asn Gly Ala145
150 155 160Pro Ala Trp Ala Thr Tyr
Met Asp Gly Leu Pro Val Glu Pro Gln Pro165 170
175Arg Trp Glu Leu Tyr Tyr Ile Gln Pro Gly Val Met Arg Ala Phe
Asp180 185 190Asn Phe Trp Asn Thr Thr Gly
Lys His Pro Glu Leu Val Glu His Tyr195 200
205Ala Lys Ala Trp Arg Ala Val Ala Asp Arg Phe Ala Asp Asn Asp Ala210
215 220Val Val Ala Tyr Asp Leu Met Asn Gln
Pro Phe Gly Gly Ser Leu Gln225 230 235
240Gly Pro Ala Phe Glu Ala Gly Pro Leu Ala Ala Met Tyr Gln
Arg Thr245 250 255Thr Asp Ala Ile Arg Gln
Val Asp Gln Asp Thr Trp Val Cys Val Ala260 265
270Pro Gln Ala Ile Gly Val Asn Gln Gly Leu Pro Ser Gly Leu Thr
Lys275 280 285Ile Asp Asp Pro Arg Ala Gly
Gln Gln Arg Ile Ala Tyr Cys Pro His290 295
300Leu Tyr Pro Leu Pro Leu Asp Ile Gly Asp Gly His Glu Gly Leu Ala305
310 315 320Arg Thr Leu Thr
Asp Val Thr Ile Asp Ala Trp Arg Ala Asn Thr Ala325 330
335His Thr Ala Arg Val Leu Gly Asp Val Pro Ile Ile Leu Gly
Glu Phe340 345 350Gly Leu Asp Thr Thr Leu
Pro Gly Ala Arg Asp Tyr Ile Glu Arg Val355 360
365Tyr Gly Thr Ala Arg Glu Met Gly Ala Gly Val Ser Tyr Trp Ser
Ser370 375 380Asp Pro Gly Pro Trp Gly Pro
Tyr Leu Pro Asp Gly Thr Gln Thr Leu385 390
395 400Leu Val Asp Thr Leu Asn Lys Pro Tyr Pro Arg Ala
Val Ala Gly Thr405 410 415Pro Thr Glu Trp
Ser Ser Thr Ser Asp Arg Leu Gln Leu Thr Ile Glu420 425
430Pro Asp Ala Ala Ile Thr Ala Pro Thr Glu Ile Tyr Leu Pro
Glu Ala435 440 445Gly Phe Pro Gly Asp Val
His Val Glu Gly Ala Asp Val Val Gly Trp450 455
460Asp Arg Gln Ser Arg Leu Leu Thr Val Arg Thr Pro Ala Asp Ser
Gly465 470 475 480Asn Val
Thr Val Thr Val Thr Pro Ala Ala485 4902631DNAArtificial
SequenceDescription of Artificial Sequence5'Copt PCR 5' primer for
introducing mutations into EGCase gene 26aattcgattg gatcccatat gagcggaagc
g 312739DNAArtificial
SequenceDescription of Artificial Sequence3'Asp PstI PCR 3' primer
for introducing mutations into EGCase gene 27tcgattctgc agggagccac
caaacgggtc attcatcag 392839DNAArtificial
SequenceDescription of Artificial Sequence3'Gln PstI PCR 3' primer
for introducing mutations into EGCase gene 28tcgattctgc agggagccac
caaacggctg attcatcag 392939DNAArtificial
SequenceDescription of Artificial Sequence3'Ala PstI-11-1PCR 3'
primer for introducing mutations into EGCase gene 29cggtccctgc
agggagccac caaacggcgc attcatcag
393039DNAArtificial SequenceDescription of Artificial Sequence3'Gly
PstI-11-1PCR 3' primer for introducing mutations into EGCase gene
30cggtccctgc agggagccac caaacggccc attcatcag
393139DNAArtificial SequenceDescription of Artificial Sequence3'Ser
PstI-11-1PCR 3' primer for introducing mutations into EGCase gene
31cggtccctgc agggagccac caaacggcga attcatcag
393224DNAArtificial SequenceDescription of Artificial SequenceRhodococcus
EGC-E351A-forward overlapping PCR primer 32ctcggtgcgt tcggtttaga
ttac 243324DNAArtificial
SequenceDescription of Artificial SequenceRhodococcus
EGC-E351A-reverse overlapping PCR primer 33ggtatctaaa ccgaacgcac cgag
243424DNAArtificial
SequenceDescription of Artificial SequenceRhodococcus
EGC-E351D-forward overlapping PCR primer 34ctcggtgatt tcggtttaga tacc
243524DNAArtificial
SequenceDescription of Artificial SequenceRhodococcus
EGC-E351D-reverse overlapping PCR primer 35ggtatctaaa ccgaaatcac cgag
243624DNAArtificial
SequenceDescription of Artificial SequenceRhodococcus
EGC-E351G-forward overlapping PCR primer 36ctcggtgggt tcggtttaga tacc
243724DNAArtificial
SequenceDescription of Artificial SequenceRhodococcus
EGC-E351G-reverse overlapping PCR primer 37ggtatctaaa ccgaacccac cgag
243824DNAArtificial
SequenceDescription of Artificial SequenceRhodococcus
EGC-E351S-forward overlapping PCR primer 38ctcggtagtt tcggtttaga tacc
243924DNAArtificial
SequenceDescription of Artificial SequenceRhodococcus
EGC-E351S-reverse overlapping PCR primer 39ggtatctaaa ccgaaactac cgag
24401401DNAArtificial
SequenceDescription of Artificial Sequencemutant endoglycoceramidase
(EGC, EGCase) His E351S derived from GenBank Accession #U39554
40catatgggat ccagcggaag cggtagcggt tcgggtaccg cgctgacacc ttcatatctg
60aaggatgatg acgggcggag cctcattctt cgtggattta atacggcctc atctgcaaaa
120agtgcccctg acggcatgcc acagttcact gaagcagatt tggcgcgtga atatgcggac
180atgggtacta attttgtacg ttttctgatc tcttggcgct cggtggaacc ggctcctggc
240gtatatgatc aacagtacct ggatcgtgta gaagaccgtg taggttggta cgcagagcgt
300ggttataaag ttatgctgga catgcatcaa gacgtgtact cgggggccat tactccggaa
360ggcaatagtg gtaatggcgc aggtgcgatt ggtaatgggg caccggcgtg ggccacctat
420atggatggtc tgccagtgga accccaaccc cgctgggaac tgtattacat ccagccaggc
480gtgatgcggg cgtttgataa tttttggaac acgaccggca agcatccgga actggtggaa
540cattatgcga aagcgtggcg cgcggtagct gaccgcttcg cggataatga tgcggttgtg
600gcctatgacc tgatgaatga gccgtttggt ggctccctgc agggaccggc attcgaagcg
660ggcccattag cagcaatgta ccagcgcact actgatgcca tccgtcaggt ggatcaggat
720acttgggttt gtgtggcacc gcaggccatt ggcgttaatc aaggtttacc atcgggctta
780actaaaattg atgaccctcg cgccggtcaa caacgcattg cctattgccc gcatctgtac
840ccgctgccat tggacatcgg cgacggccac gaaggacttg cgcgcactct gaccgatgta
900accattgatg cctggcgtgc gaacacggct cataccgcgc gcgtcttggg tgatgtgcct
960atcattctcg gttcgttcgg tttagatacc acgctgcccg gagcacgcga ttacattgaa
1020cgtgtctatg ggaccgcacg cgaaatgggt gcgggcgtta gttattggtc gagtgatccc
1080ggcccgtggg gcccgtatct gccggacggt acgcagacct tgttagtgga taccttaaac
1140aagccatacc ctcgtgcagt ggcggggacc cctaccgaat ggagcagcac ttcggatcgc
1200ctgcaattga ccattgaacc agatgccgct attaccgcgc ctacagaaat ctacctgcct
1260gaggctggtt tccccgggga tgtgcatgta gaaggggcgg atgtcgttgg ctgggatcgt
1320caatcgcgtc ttttaaccgt acgcactccc gcggacagtg gtaacgtcac agtgacagtt
1380acgcccgcag cgtgactcga g
140141483PRTArtificial SequenceDescription of Artificial Sequencemutant
endoglycoceramidase (EGC, EGCase) His E351S derived from GenBank
Accession #AAB67050 41Met Gly Ser Ser His His His His His His Ser Ser Gly
Leu Val Pro1 5 10 15Arg
Gly Ser His Met Gly Ser Ser Gly Ser Gly Ser Gly Ser Gly Thr20
25 30Ala Leu Thr Pro Ser Tyr Leu Lys Asp Asp Asp
Gly Arg Ser Leu Ile35 40 45Leu Arg Gly
Phe Asn Thr Ala Ser Ser Ala Lys Ser Ala Pro Asp Gly50 55
60Met Pro Gln Phe Thr Glu Ala Asp Leu Ala Arg Glu Tyr
Ala Asp Met65 70 75
80Gly Thr Asn Phe Val Arg Phe Leu Ile Ser Trp Arg Ser Val Glu Pro85
90 95Ala Pro Gly Val Tyr Asp Gln Gln Tyr Leu
Asp Arg Val Glu Asp Arg100 105 110Val Gly
Trp Tyr Ala Glu Arg Gly Tyr Lys Val Met Leu Asp Met His115
120 125Gln Asp Val Tyr Ser Gly Ala Ile Thr Pro Glu Gly
Asn Ser Gly Asn130 135 140Gly Ala Gly Ala
Ile Gly Asn Gly Ala Pro Ala Trp Ala Thr Tyr Met145 150
155 160Asp Gly Leu Pro Val Glu Pro Gln Pro
Arg Trp Glu Leu Tyr Tyr Ile165 170 175Gln
Pro Gly Val Met Arg Ala Phe Asp Asn Phe Trp Asn Thr Thr Gly180
185 190Lys His Pro Glu Leu Val Glu His Tyr Ala Lys
Ala Trp Arg Ala Val195 200 205Ala Asp Arg
Phe Ala Asp Asn Asp Ala Val Val Ala Tyr Asp Leu Met210
215 220Asn Glu Pro Phe Gly Gly Ser Leu Gln Gly Pro Ala
Phe Glu Ala Gly225 230 235
240Pro Leu Ala Ala Met Tyr Gln Arg Thr Thr Asp Ala Ile Arg Gln Val245
250 255Asp Gln Asp Thr Trp Val Cys Val Ala
Pro Gln Ala Ile Gly Val Asn260 265 270Gln
Gly Leu Pro Ser Gly Leu Thr Lys Ile Asp Asp Pro Arg Ala Gly275
280 285Gln Gln Arg Ile Ala Tyr Cys Pro His Leu Tyr
Pro Leu Pro Leu Asp290 295 300Ile Gly Asp
Gly His Glu Gly Leu Ala Arg Thr Leu Thr Asp Val Thr305
310 315 320Ile Asp Ala Trp Arg Ala Asn
Thr Ala His Thr Ala Arg Val Leu Gly325 330
335Asp Val Pro Ile Ile Leu Gly Ser Phe Gly Leu Asp Thr Thr Leu Pro340
345 350Gly Ala Arg Asp Tyr Ile Glu Arg Val
Tyr Gly Thr Ala Arg Glu Met355 360 365Gly
Ala Gly Val Ser Tyr Trp Ser Ser Asp Pro Gly Pro Trp Gly Pro370
375 380Tyr Leu Pro Asp Gly Thr Gln Thr Leu Leu Val
Asp Thr Leu Asn Lys385 390 395
400Pro Tyr Pro Arg Ala Val Ala Gly Thr Pro Thr Glu Trp Ser Ser
Thr405 410 415Ser Asp Arg Leu Gln Leu Thr
Ile Glu Pro Asp Ala Ala Ile Thr Ala420 425
430Pro Thr Glu Ile Tyr Leu Pro Glu Ala Gly Phe Pro Gly Asp Val His435
440 445Val Glu Gly Ala Asp Val Val Gly Trp
Asp Arg Gln Ser Arg Leu Leu450 455 460Thr
Val Arg Thr Pro Ala Asp Ser Gly Asn Val Thr Val Thr Val Thr465
470 475 480Pro Ala
Ala4210PRTArtificial SequenceDescription of Artificial Sequence
endoglycoceramidase (EGC, EGCase) identifying motif A located
N-terminal tothe acid-base sequence region 42Xaa Leu Asp Xaa His Gln Asp
Xaa Xaa Xaa1 5 104313PRTArtificial
SequenceDescription of Artificial Sequence endoglycoceramidase (EGC,
EGCase) identifying conserved motif B, includingthe acid-base
sequence region, conserved Asn-Glu-Pro subsequence with acid-base
Glu residue 43Val Xaa Xaa Xaa Xaa Xaa Xaa Asn Glu Pro Xaa Xaa Gly1
5 10446PRTArtificial SequenceDescription of
Artificial Sequence endoglycoceramidase (EGC, EGCase) identifying
motif C located C-terminal tothe acid-base sequence region 44Ala
Ile Arg Xaa Val Asp1 5456PRTArtificial SequenceDescription
of Artificial Sequence endoglycoceramidase (EGC, EGCase) identifying
conserved motif D, includingthe nucleophilic Glu residue region
45Xaa Xaa Xaa Glu Xaa Xaa1 5466PRTArtificial
SequenceDescription of Artificial Sequence endoglycoceramidase (EGC,
EGCase) identifying motif E, including nucleophilic carboxylate
Glu/Asp residue 46Xaa Xaa Xaa Xaa Xaa Xaa1
547490PRTArtificial SequenceDescription of Artificial Sequencemutant
endoglycoceramidase (EGC, EGCase) derived from Rhodococcus sp.
strain M-777, GenBank Accession #AAB67050 47Met Arg Arg Thr Arg Leu
Val Ser Leu Ile Val Thr Gly Ser Leu Val1 5
10 15Phe Gly Gly Gly Val Ala Ala Ala Gln Ser Ser Leu Ala
Ala Ser Gly20 25 30Ser Gly Ser Gly Ser
Gly Thr Ala Leu Thr Pro Ser Tyr Leu Lys Asp35 40
45Asp Asp Gly Arg Ser Leu Ile Leu Arg Gly Phe Asn Thr Ala Ser
Ser50 55 60Ala Lys Ser Ala Pro Asp Gly
Met Pro Gln Phe Thr Glu Ala Asp Leu65 70
75 80Ala Arg Glu Tyr Ala Asp Met Gly Thr Asn Phe Val
Arg Phe Leu Ile85 90 95Ser Trp Arg Ser
Val Glu Pro Ala Pro Gly Val Tyr Asp Gln Gln Tyr100 105
110Leu Asp Arg Val Glu Asp Arg Val Gly Trp Tyr Ala Glu Arg
Gly Tyr115 120 125Lys Val Met Leu Asp Met
His Gln Asp Val Tyr Ser Gly Ala Ile Thr130 135
140Pro Glu Gly Asn Ser Gly Asn Gly Ala Gly Ala Ile Gly Asn Gly
Ala145 150 155 160Pro Ala
Trp Ala Thr Tyr Met Asp Gly Leu Pro Val Glu Pro Gln Pro165
170 175Arg Trp Glu Leu Tyr Tyr Ile Gln Pro Gly Val Met
Arg Ala Phe Asp180 185 190Asn Phe Trp Asn
Thr Thr Gly Lys His Pro Glu Leu Val Glu His Tyr195 200
205Ala Lys Ala Trp Arg Ala Val Ala Asp Arg Phe Ala Asp Asn
Asp Ala210 215 220Val Val Ala Tyr Asp Leu
Met Asn Glu Pro Phe Gly Gly Ser Leu Gln225 230
235 240Gly Pro Ala Phe Glu Ala Gly Pro Leu Ala Ala
Met Tyr Gln Arg Thr245 250 255Thr Asp Ala
Ile Arg Gln Val Asp Gln Asp Thr Trp Val Cys Val Ala260
265 270Pro Gln Ala Ile Gly Val Asn Gln Gly Leu Pro Ser
Gly Leu Thr Lys275 280 285Ile Asp Asp Pro
Arg Ala Gly Gln Gln Arg Ile Ala Tyr Cys Pro His290 295
300Leu Tyr Pro Leu Pro Leu Asp Ile Gly Asp Gly His Glu Gly
Leu Ala305 310 315 320Arg
Thr Leu Thr Asp Val Thr Ile Asp Ala Trp Arg Ala Asn Thr Ala325
330 335His Thr Ala Arg Val Leu Gly Asp Val Pro Ile
Ile Leu Gly Xaa Phe340 345 350Gly Leu Asp
Thr Thr Leu Pro Gly Ala Arg Asp Tyr Ile Glu Arg Val355
360 365Tyr Gly Thr Ala Arg Glu Met Gly Ala Gly Val Ser
Tyr Trp Ser Ser370 375 380Asp Pro Gly Pro
Trp Gly Pro Tyr Leu Pro Asp Gly Thr Gln Thr Leu385 390
395 400Leu Val Asp Thr Leu Asn Lys Pro Tyr
Pro Arg Ala Val Ala Gly Thr405 410 415Pro
Thr Glu Trp Ser Ser Thr Ser Asp Arg Leu Gln Leu Thr Ile Glu420
425 430Pro Asp Ala Ala Ile Thr Ala Pro Thr Glu Ile
Tyr Leu Pro Glu Ala435 440 445Gly Phe Pro
Gly Asp Val His Val Glu Gly Ala Asp Val Val Gly Trp450
455 460Asp Arg Gln Ser Arg Leu Leu Thr Val Arg Thr Pro
Ala Asp Ser Gly465 470 475
480Asn Val Thr Val Thr Val Thr Pro Ala Ala485
49048482PRTArtificial SequenceDescription of Artificial Sequencemutant
endoglycoceramidase (EGC, EGCase) derived from Rhodococcus sp.
strain C9, GenBank Accession #BAB17317 48Met Arg Arg Thr Arg Ile Ala
Ser Leu Ala Val Ala Gly Ser Leu Val1 5 10
15Leu Gly Ala Gly Val Ala Thr Ala Gln Ser Ser Leu Pro Ala
Thr Gly20 25 30Ser Asp Ser Ser Glu Trp
Ser Ala Ser Ala Tyr Leu Thr Asp Asp Ala35 40
45Gly Arg Ser Leu Ile Leu Arg Gly Phe Asn Thr Ala Ser Ser Ala Lys50
55 60Ser Thr Pro Asp Gly Met Pro Ile Phe
Thr Glu Ser Asp Leu Asp Arg65 70 75
80Glu His Ala Asp Met Gly Thr Asn Phe Val Arg Phe Leu Ile
Ser Trp85 90 95Arg Ser Val Glu Pro Glu
Pro Gly Gln Tyr Asp Gln Ala Tyr Leu Asp100 105
110Arg Val Glu Gln Arg Val Gly Trp Tyr Ala Glu Arg Gly Tyr Lys
Val115 120 125Met Leu Asp Met His Gln Asp
Leu Tyr Ser Gly Ala Ile Thr Pro Asp130 135
140Gly Lys Thr Gly Asn Gly Ala Pro Ala Trp Ala Thr Tyr Met Asp Gly145
150 155 160Leu Pro Val Asn
Glu Arg Asp Ser Trp Glu Leu Tyr Tyr Ile Glu Pro165 170
175Gly Val Ile Arg Ala Phe Asp Asn Phe Trp Asn Thr Thr Gly
Lys His180 185 190Pro Glu Leu Val Asp His
Tyr Val Asn Ala Trp Lys Ala Val Ala Asp195 200
205Arg Phe Ala Asp Asn Glu Thr Val Val Ala Tyr Asp Leu Met Asn
Glu210 215 220Pro Trp Gly Gly Ser Leu Gln
Gly Pro Ala Phe Glu Ala Gly Pro Leu225 230
235 240Thr Ser Met Tyr Gln Arg Thr Thr Asp Ala Ile Arg
Gln Val Asp Gln245 250 255Asp Ser Trp Val
Cys Val Ala Pro Gln Ala Val Gly Val Asn Gln Gly260 265
270Ile Pro Ser Ala Leu Gly Thr Ile Ala Asp Pro Arg Gln Gly
Ala Arg275 280 285Arg Ile Ala Tyr Cys Pro
His Leu Tyr Pro Leu Pro Leu Asp Leu Gly290 295
300Asp Gly Tyr Ser Gly Phe Ser Lys Thr Leu Thr Asp Ala Thr Ile
Glu305 310 315 320Thr Trp
Arg Thr Ser Ile Glu His Val Ala Asp Thr Val Leu Glu Gly325
330 335Ala Pro Val Ile Leu Gly Xaa Phe Gly Leu Asp Thr
Thr Leu Pro Gly340 345 350Ala Gln Asp Tyr
Leu Asp Arg Val Tyr Thr Val Ala Arg Asp Met Gly355 360
365Ala Gly Val Ser Tyr Trp Ser Ser Asp Arg Gly Pro Trp Gly
Pro Tyr370 375 380Leu Glu Asp Gly Thr Gln
Thr Ile Leu Val Asp Thr Val Asn Lys Pro385 390
395 400Tyr Pro Arg Ala Val Ala Gly Met Pro Val Arg
Trp Ser Ser Thr Ser405 410 415Asp Arg Leu
Asp Leu Thr Tyr Arg Asn Asp Pro Ala Val Thr Ala Pro420
425 430Thr Glu Ile Tyr Leu Pro Ala Ala Gly Phe Pro Gly
Asp Ile Ala Val435 440 445Gln Gly Ala Asp
Val Val Gly Trp Asp Ser Gln Ser Arg Leu Leu Thr450 455
460Val Arg Ser Ala Pro Asp Ala Gly Glu Val Thr Val Thr Val
Thr Pro465 470 475 480Ala
Ala49500PRTArtificial SequenceDescription of Artificial Sequencemutant
endoglycoceramidase (EGC, EGCase) derived from Propionibacterium
acnes KPA171202, GenBank Accession #YP_056771 49Met Arg Arg Lys Ser
Ala Leu Gly Phe Val Ala Leu Ser Leu Phe Ala1 5
10 15Thr Gly Met Gly Val Ala Ala Ala Thr Pro Ala Thr
Ala Ser Pro Ala20 25 30Asp Thr Ala Ala
Pro Val His Val Asp Ala Ser Arg Trp Thr Thr Gln35 40
45Gly Arg Trp Val Thr Asp Thr Gln His Arg Val Val Ile Thr
Gln Gly50 55 60Ile Asn Glu Val Ala Lys
Ser Ala Pro Tyr Ala Pro Asp Ala Val Gly65 70
75 80Phe Gly Glu Asp Asp Ala Ala Phe Leu Glu Ala
Gln Gly Phe Thr Ser85 90 95Val Arg Leu
Gly Val Leu Trp Ala Gly Val Glu Pro Arg Pro Gly Val100
105 110Tyr Asp Asp Ala Tyr Leu Ala Arg Val Glu Arg Thr
Val Arg Ile Leu115 120 125Asn Ala His Gly
Ile Ala Ser Val Leu Asp Phe His Gln Asp Met Val130 135
140Asn Glu Lys Tyr Gln Gly Glu Gly Trp Pro Ala Trp Ala Ala
Leu Asp145 150 155 160His
Gly Met Pro Asn Ile Val Lys Thr Gly Phe Pro Gly Asn Tyr Phe165
170 175Leu Asn Glu Ala Val Lys Tyr Ser Phe Asp Ser
Phe Tyr Asp Asn Thr180 185 190Lys Ala Ser
Asp Gly Ile Gly Val Ala Asp His Tyr Ala Ser Ala Trp195
200 205Arg His Val Ala Glu His Phe Arg Asn Val Pro Gly
Val Gln Gly Tyr210 215 220Asp Leu Phe Asn
Glu Pro Phe Pro Gly His Arg Tyr Thr Arg Cys Leu225 230
235 240Thr Gln Leu Gly Cys Arg Ala Ala Asp
Ala Arg Leu Ser Ala Val Gln245 250 255Gln
Lys Thr Val Asp Ala Ile Arg Ser Val Asp Lys Ala Thr Thr Val260
265 270Trp Tyr Glu Pro Met Gln Phe Phe Asn Ile Gly
Val Gly Thr Asn Val275 280 285Arg Leu Thr
Gly Ser Asn Leu Gly Leu Ser Phe His Asp Tyr Cys Thr290
295 300Ser Gln Ala Thr Leu His Ser Tyr Val Gly Cys Thr
Ala Pro Asp Asn305 310 315
320Arg Val Phe Thr Asn Ala Glu Lys His Ser Arg Gln Thr Gly Ser Gly325
330 335Leu Met Leu Thr Xaa Phe Gly Ala Ile
Thr Thr Pro Ala Val Ile Thr340 345 350Ser
Gln Met Asp Leu Ala Ala Arg Asn Arg Val Gly Val Gln Trp Trp355
360 365Ala Tyr Thr Ala Gly Asp Pro Thr Thr Ala Gly
Pro Gly Thr Glu Gln370 375 380Ala Leu Val
Asp Asp Pro Ala Arg Pro Pro Gln Gly Thr Asn Val Glu385
390 395 400Ser Ala Lys Leu Thr Leu Ile
Ala Val Pro His Pro Asp Arg Val Ala405 410
415Gly Thr Pro Ser Ala Tyr His His Asp Arg Ser Arg Arg Val Phe Thr420
425 430Met Thr Trp Thr Ala Gln Arg Pro Asp
Gly Ser Arg Ala Glu Glu Ser435 440 445Asp
Glu Thr Thr Val Val Val Pro Ala Ile Ser Ala Pro His Gly Tyr450
455 460Asp Val Gln Ala Ser Gly Ala His Val Thr Ser
His Pro Gly Asp Arg465 470 475
480Val Ala Arg Leu His Leu Asn Gln Gly Ser Ala Thr Ala Lys Val
Thr485 490 495Ile Thr Leu
Arg50050524PRTArtificial SequenceDescription of Artificial Sequencemutant
endoglycoceramidase (EGC, EGCase) derived from
Propionibacterium acnes KPA171202, GenBank Accession #YP_055358
50Met Tyr His His Ser Trp His Ser Pro Asp Ala Arg Arg Arg Gly Val1
5 10 15Thr Arg Trp Ala Thr Thr
Phe Ile Ala Ala Leu Thr Ala Ala Cys Met20 25
30Ala Gln Met Pro Ala Gln Ala Ser Pro His Thr Ser Asp Ala Ala Pro35
40 45His Ile Ala Thr Ser Lys Thr Ile Thr
Asp Ala Gly Pro Ile Gly Gln50 55 60Ser
Gly Arg Trp Tyr Thr Asp Gly Gln Gly Arg Ala Ile Leu Thr Ala65
70 75 80Gly Val Asn Met Val Ser
Lys Arg His Pro Tyr Ser Pro Glu Ala Asp85 90
95Gly Phe Asp Asp Ala Asp Ala Ala Trp Leu Gln Lys Asn Gly Phe Asp100
105 110Ser Val Arg Leu Gly Val Ile Trp
Lys Gly Val Glu Pro Lys Pro Gly115 120
125Glu Tyr Asp Asp Ala Tyr Leu Ala Ser Ile Thr Arg Thr Val Arg Thr130
135 140Leu Arg Ala His Gly Ile Met Thr Leu
Leu Asp Ala His Gln Asp Met145 150 155
160Tyr Asn Glu Lys Phe Glu Gly Glu Gly Ala Pro Asp Trp Ala
Val Leu165 170 175Asp Lys Gly Ala Pro Asn
Leu Leu Lys Val Gly Phe Pro Ala Asn Gln180 185
190Val Phe Asn Leu Gly Leu Ile Lys Ala Tyr Asp Ser Phe Leu Asp
Asn195 200 205Ala Lys Gly Pro Gly Gly Val
Gly Leu Gln Asp Arg Tyr Ala Ala Met210 215
220Trp Lys His Val Ala Gln Val Val Gly Gln Glu Pro Gly Val Met Gly225
230 235 240Tyr Asp Ile Ile
Asn Glu Pro Trp Pro Gly His His Tyr Pro Ile Cys245 250
255Tyr Val Ala Phe Gly Trp Cys Gly Arg Ala Met Val Ser Leu
Asp Thr260 265 270Leu Tyr Glu Lys Val Gly
Arg Ala Ile Thr Ser Val Asp Pro Asp Gly275 280
285Ile Val Thr Tyr Glu Pro Tyr Ser Thr Trp Asn Met Gly Leu Asp
Ser290 295 300Arg Pro Ala Arg Pro Ser Ser
Pro Lys Ala Ala Ile Ser Trp His Val305 310
315 320Tyr Cys Pro Met Asn Ala Ile Phe Gly Ser Tyr Val
Gly Cys Asn Leu325 330 335Pro Asp Thr Arg
Thr Phe His Asn Ala Asp Gln Ala Ala Gln Phe Asn340 345
350Asn Ser Ala Ser Leu Leu Ser Xaa Phe Gly Ala Thr Lys Asp
Pro Gly355 360 365Thr Leu Met Gly Val Thr
Ser Lys Ala Arg Ala His Leu Val Gly Trp370 375
380Leu Tyr Trp Thr Tyr Asn Gly Asn Ser Asp Pro Thr Thr Gln Asn
Ala385 390 395 400Ala Asp
Glu Glu Leu Val Arg His Ile Asn Arg Pro Gly Pro Val Thr405
410 415Asp Glu Gln Val Asp His Thr Lys Leu Ala Ile Leu
Ala Val Pro His420 425 430Leu Arg Ala Ala
Ala Gly Thr Pro Thr Ser Thr Thr Trp Asp Gln Ser435 440
445Thr Arg Thr Tyr Gln Ala Thr Trp Thr Ala Lys Arg Val Ala
Gly Asp450 455 460Gly Asp Phe Ala Ala Gly
Ser Val Ser Glu Ile Ala Val Pro Ala Ile465 470
475 480His Tyr Pro Asn Gly Tyr Lys Val Glu Val Lys
Gly Ala Lys Val Ile485 490 495Ser Lys Ala
Gly Asp Thr Arg Leu Gln Val Ser Ser Thr Gly Glu Gly500
505 510Pro Val Ser Val Thr Ile Thr Pro Ala Gly Gln Ala515
52051503PRTArtificial SequenceDescription of Artificial
Sequencemutant endoglycoceramidase (EGC, EGCase) derived from
Cyanea nozakii, GenBank Accession #BAB16369 51Met Ala Glu Thr Gln Pro Leu
Val Phe Val Leu Met Ser Ile Ser Ala1 5 10
15Ile Leu Thr Ala Gly Leu Pro Ile Asn Asp Asp Ala Ser Leu
Leu Ile20 25 30Ser Val Asn Pro Glu Thr
Gln Gln Leu Val Asp Ser Leu Gly Arg Glu35 40
45Arg Phe Phe His Gly Thr Asn Val Val Val Lys His Lys Pro Tyr His50
55 60Pro Ser Val Glu Gly Tyr Asp Asn Thr
Ser Phe Ser Glu Val Asp Met65 70 75
80Lys Ile Leu Gln Asp Leu Gly Leu Asn Thr Ile Arg Leu Gly
Met Met85 90 95Leu Pro Gly Tyr Val Pro
Thr Arg Gly Asn Tyr Asn Glu Thr Tyr Leu100 105
110Lys Ile Ile Gln Glu Ile Val Ser Lys Ala Ala Lys Tyr Gly Ile
Tyr115 120 125Thr Leu Leu Asp Met His Gln
Asp Val Met Ser Ala Lys Phe Cys Val130 135
140Glu Gly Phe Pro Asp Trp Ala Val Asn Thr Gly Asn Ala Asp Asn Phe145
150 155 160Pro Phe Pro Leu
Glu Asp Lys Tyr Pro Leu Asn Leu Gln Thr Gly Tyr165 170
175Pro Tyr Pro Lys Asp Cys Ala Lys His Ala Trp Gly Asp Tyr
Tyr Phe180 185 190Thr Glu Ala Ala Ala Ala
Ala Phe Gln Asn Phe Tyr Asn Asn Thr Asp195 200
205Gly Leu Leu Asp Ala Trp Ala Asp Phe Trp Lys Lys Thr Ala Gln
Gly210 215 220Phe Lys Asp Tyr Lys Ser Val
Ile Gly Tyr Glu Leu Ile Asn Glu Pro225 230
235 240Phe Ala Gly Asp Ile Tyr Arg Asp Pro Ser Leu Met
Ile Pro Gly Val245 250 255Ala Asp Glu Arg
Asn Leu Ala Pro Ala Tyr Asp Val Ile His Lys Ala260 265
270Ile Arg Thr Val Asp Glu Gln His Ser Ile Phe Phe Glu Gly
Val Thr275 280 285Trp Asp Tyr Phe Ala Ala
Gly Phe Ser Lys Val Pro Gly Gly Asp Ala290 295
300Tyr Arg Asn Arg Ser Val Leu Ser Tyr His Tyr Tyr Glu Pro Pro
Asp305 310 315 320Phe Asn
Lys Lys Phe Gln Phe Glu Val Arg Met Glu Asp Leu Arg Arg325
330 335Leu Lys Cys Gly Gly Phe Leu Thr Glu Leu Leu Thr
Val Gly Asp Thr340 345 350Ala Lys Asp Met
Ser Asp Met Leu Xaa Leu Phe Asp Ile Cys Asp Gln355 360
365His Lys Gln Ser Trp Met Gly Trp Leu Tyr Lys Ser Tyr Gly
Cys Tyr370 375 380Lys Gln His Leu Gly Cys
Leu Thr Asp Ser Met His Asp Glu Thr Gly385 390
395 400His Leu Arg Asp Ile Val Leu Gln Asn Thr Thr
Arg Thr Tyr Pro Gln405 410 415Ala Val Ala
Gly His Thr Ile Gly Tyr Lys Phe Asp Arg Ile Thr Lys420
425 430Lys Phe Asp Leu Ser Phe Val Val Thr Ala Asp Cys
Arg Ser Thr Glu435 440 445Ser Ile Val Tyr
Phe Asn Lys Asp Leu His Tyr Ser Asn Gly Tyr Asp450 455
460Val Thr Val Phe Pro Lys Asp Ser Val Thr Trp Lys Gln Val
Glu Lys465 470 475 480Lys
Ile Ile Ile Asn His Ser Gln Lys Leu Ser Ala Gly Thr Thr Val485
490 495Thr Phe Ser Leu Val Ala
Lys50052503PRTArtificial SequenceDescription of Artificial Sequencemutant
endoglycoceramidase (EGC, EGCase) derived from Cyanea nozakii,
GenBank Accession #BAB16370 52Met Ala Glu Thr Gln Pro Leu Val Phe Val Leu
Met Ser Ile Ser Ala1 5 10
15Ile Leu Thr Ala Gly Leu Pro Ile Asn Asp Asp Ala Ser Leu Leu Ile20
25 30Ser Val Asn Pro Glu Thr Gln Gln Leu Val
Asp Ser Leu Gly Arg Glu35 40 45Arg Phe
Phe His Gly Thr Asn Val Val Val Lys His Lys Pro Tyr His50
55 60Pro Ser Val Glu Gly Tyr Asp Asn Thr Ser Phe Ser
Glu Val Asp Met65 70 75
80Lys Ile Leu Gln Asp Leu Gly Leu Asn Thr Ile Arg Leu Gly Met Met85
90 95Leu Pro Gly Tyr Val Pro Thr Arg Gly Asn
Tyr Asn Glu Thr Tyr Leu100 105 110Lys Ile
Ile Gln Glu Ile Val Ser Lys Ala Ala Lys Tyr Gly Ile Tyr115
120 125Thr Leu Leu Asp Met His Gln Asp Val Met Ser Ala
Lys Phe Cys Val130 135 140Glu Gly Phe Pro
Asp Trp Ala Val Asn Thr Gly Asn Ala Asp Asn Phe145 150
155 160Pro Phe Pro Leu Glu Asp Lys Tyr Pro
Leu Asn Pro Gln Thr Gly Tyr165 170 175Pro
Tyr Pro Lys Asp Cys Ala Lys His Ala Trp Gly Asp Tyr Tyr Phe180
185 190Thr Glu Ala Ala Ala Ala Ala Phe Gln Asn Phe
Tyr Asn Asn Thr Asp195 200 205Gly Leu Leu
Asp Ala Trp Ala Asp Phe Trp Lys Lys Thr Ala Gln Gly210
215 220Phe Lys Asp Tyr Lys Ser Val Ile Gly Tyr Glu Leu
Ile Asn Glu Pro225 230 235
240Phe Ala Gly Asp Ile Tyr Arg Asp Pro Ser Leu Met Ile Pro Gly Val245
250 255Ala Asp Glu Arg Asn Leu Ala Pro Ala
Tyr Asp Val Ile His Lys Ala260 265 270Ile
Arg Thr Val Asp Glu Gln His Ser Ile Phe Phe Glu Gly Val Thr275
280 285Trp Asp Tyr Phe Ala Ala Gly Phe Ser Lys Val
Pro Gly Gly Asp Ala290 295 300Tyr Arg Asn
Arg Ser Val Leu Ser Tyr His Tyr Tyr Glu Pro Pro Asp305
310 315 320Phe Asn Lys Lys Phe Gln Phe
Glu Val Arg Met Glu Asp Leu Arg Arg325 330
335Leu Lys Cys Gly Gly Phe Leu Thr Glu Leu Leu Thr Val Gly Asp Thr340
345 350Ala Lys Asp Met Ser Asp Met Leu Xaa
Leu Phe Asp Ile Cys Asp Gln355 360 365His
Lys Gln Ser Trp Met Gly Trp Leu Tyr Lys Ser Tyr Gly Cys Tyr370
375 380Lys Gln His Leu Gly Cys Leu Thr Asp Ser Met
His Asp Glu Thr Gly385 390 395
400His Leu Arg Asp Ile Val Leu Gln Asn Thr Thr Arg Thr Tyr Pro
Gln405 410 415Ala Val Ala Gly His Thr Ile
Gly Tyr Lys Phe Asp Arg Ile Thr Lys420 425
430Lys Phe Asp Leu Ser Phe Val Val Thr Ala Asp Cys Arg Ser Thr Glu435
440 445Ser Ile Val Tyr Phe Asn Lys Asp Leu
His Tyr Ser Asn Gly Tyr Asp450 455 460Val
Thr Val Phe Pro Lys Asp Ser Val Thr Trp Lys Gln Val Glu Lys465
470 475 480Lys Ile Ile Ile Asn His
Ser Gln Lys Leu Ser Ala Gly Thr Thr Val485 490
495Thr Phe Ser Leu Val Ala Lys50053517PRTArtificial
SequenceDescription of Artificial Sequencemutant endoglycoceramidase
(EGC, EGCase) derived from Hydra magnipapillata, GenBank Accession
#BAD20464 53Met Ile Ser Val Ala Leu Ile Ile Leu Phe Leu Ala Lys Val Ile
Ser1 5 10 15Gly Lys Ser
Asp Asp Phe Ile Ser Val Asn Pro Glu Thr Asn Met Leu20 25
30Ile Asp Gly Tyr Gly Arg Glu Arg Phe Phe His Gly Thr
Asn Val Val35 40 45Val Lys His Phe Pro
Phe His Pro Glu Thr Thr Gly Phe Asn Lys Asp50 55
60Thr Phe Ser Glu Asp Asp Met Lys Ile Leu Gln Lys Phe Gly Leu
Asn65 70 75 80Ser Ile
Arg Leu Gly Met Met Leu Pro Gly Tyr Val Pro Lys Arg Glu85
90 95Glu Tyr Asn Glu Thr Tyr Ile Lys Val Ile Gln Ser
Ile Val Thr Thr100 105 110Ala Ala Lys Tyr
Gly Ile Tyr Thr Leu Leu Asp Met His Gln Asp Val115 120
125Phe Ser Pro Lys Phe Cys Val Glu Gly Met Pro Asp Trp Ile
Val Asn130 135 140Thr Gln Gly Ala Lys Asp
Phe Pro Met Pro Leu His Lys Pro Phe Asn145 150
155 160Leu Asp Pro Lys Thr Gly Tyr Pro Tyr Pro Glu
Asp Cys Ala Lys Phe165 170 175Ser Trp Ala
Asp Tyr Tyr Phe Thr Glu Ala Ala Gly Gln Ala Phe Gln180
185 190Asn Leu Tyr Asp Asn Val Asp Gly Leu Arg Asp Glu
Trp Ala Gln Phe195 200 205Trp Lys Lys Thr
Ala Asp Val Phe Lys Glu Glu Pro Ser Val Ile Gly210 215
220Tyr Glu Leu Ile Asn Glu Pro Phe Cys Gly Asn Val Phe Lys
His Pro225 230 235 240Thr
Leu Leu Ile Pro Gly Val Ala Asp Tyr Leu Asn Leu Gln Pro Thr245
250 255Tyr Asp Ala Leu Gln Lys Ala Ile Arg Gln Val
Asp Glu Glu His Asn260 265 270Ile Phe Phe
Glu Gly Val Thr Trp Asp Phe Phe Glu Val Gly Phe Thr275
280 285Glu Val Pro Gly Gly Lys Gln Tyr Gln Asn Arg Ser
Val Leu Ser Tyr290 295 300His Tyr Tyr Glu
Pro Pro Asp Phe Ser Lys Lys Leu Asn Phe Glu Ala305 310
315 320Arg Leu Leu Asp Leu Lys Arg Leu Lys
Cys Gly Gly Phe Leu Thr Glu325 330 335Met
Phe Thr Val Gly Thr Asp Phe Asn Ser Met Phe Xaa Met Phe Asp340
345 350Leu Cys Asp Lys Phe Lys Gln Ser Trp His Gly
Trp Met Tyr Lys Ser355 360 365Tyr Gly Cys
Ile Glu Gln Asn Leu Gly Cys Leu Asn Met Ser Ser Pro370
375 380Gly Lys Glu Ser Ile Gln Ile Ala Asn Thr Ser Arg
Thr Tyr Pro Gln385 390 395
400Ala Val Ala Gly Arg Thr Gln Ser Tyr Ala Phe Asp Ile Lys Thr Lys405
410 415Val Phe Thr Leu Val Tyr Glu Thr Val
Gly Ser Cys Lys Ser Gly Arg420 425 430Thr
Ile Val Tyr Phe Asn Lys Asn Leu His Tyr Pro Asn Gly Tyr Arg435
440 445Tyr Glu Ile Asn Pro Asn Phe Lys Val Thr Pro
Ser Glu Asn Glu Tyr450 455 460Phe Leu Tyr
Leu Asp Glu Val Asn Lys Val Pro Asn Thr Val Val Thr465
470 475 480Phe Lys Leu Phe Pro Leu Ser
Phe Thr Asp Ser Glu Asp Ile His Pro485 490
495Val Thr Val Met Gly Asp Lys His Leu Ser Glu Asn His Asn Glu Asn500
505 510Glu Lys Lys Lys
Lys51554507PRTArtificial SequenceDescription of Artificial Sequencemutant
endoglycoceramidase (EGC, EGCase) derived from Schistosoma
japonicum, GenBank Accession #AAW25069 54Met Trp Ser Ile Phe Ile Leu Thr
Phe Leu Ile Trp Thr Ser Val Gln1 5 10
15Thr Lys Gln Ile Pro Leu Ser Lys Ile His Leu Asn Ser Asp Gly
Leu20 25 30Phe Thr Asp Ser Arg Gly Phe
Ile Lys Leu Phe Arg Gly Phe Asn Asn35 40
45Val His Lys His Phe Pro Trp Tyr Asn Val Asn Ser Thr Asn Ile Thr50
55 60Gln Leu Glu Met Phe Lys Asn Trp Gly Leu
Asn Val Val Arg Leu Gly65 70 75
80Val Met Trp Ser Gly Val Lys Pro Thr Ile Ser Ile Val Asn Thr
Thr85 90 95Tyr Leu Asp Val Ile Glu Asn
Val Ile Asp Leu Tyr Ala Asp Tyr Gly100 105
110Ile Tyr Val Ile Leu Asp Met His Gln Asp Val Leu Ser Ser Leu Tyr115
120 125Gly Leu Tyr Asp Gly Ile Pro Leu Trp
Leu Ile Glu Lys Phe Lys Arg130 135 140Pro
Pro His His Leu Gln Tyr Pro Trp Pro Tyr Lys Lys Lys Pro Asp145
150 155 160Phe Trp Val Met Ser Tyr
Leu Thr Tyr Glu Cys Ala Asn Gly Ala Gln165 170
175Gln Leu Tyr Asn Asn Val Ser Gly Ala Trp Asn His Trp Gly Glu
Phe180 185 190Trp Glu Ile Val Ala Arg Arg
Phe Gly Gly Lys Ser Asn Val Leu Gly195 200
205Tyr Glu Leu Ile Asn Glu Pro Pro Pro Gly Asn Phe Tyr Thr Asn Pro210
215 220Leu Arg Gly Leu Pro Gly Tyr Ala Gly
Arg Tyr Asn Leu Gln Pro Val225 230 235
240Tyr Asp Tyr Leu Val Lys Arg Ile Arg Lys Tyr Asp Asn Ser
Thr Leu245 250 255Ile Phe Tyr Glu Pro Val
Thr Tyr Gly Val Phe Thr Pro Val Arg Ser260 265
270Ser Gly Trp Leu Gly Thr Gly Phe Asp Arg Val Pro Gly Ala His
Arg275 280 285Asp Lys Ser Ala Pro Ser Lys
Ser Val Leu Ser Tyr His Tyr Tyr Cys290 295
300Trp Ile Leu Gln Thr Asp Ala Gln Asn Thr Thr Met Pro Phe Trp Lys305
310 315 320Lys Val Ile Cys
Asp Arg Leu Leu Leu Pro Asn Val Ile Ser Asn Ala325 330
335Ile Arg Ala Thr Lys Ser Thr Gly Gly Gly Arg Phe Leu Thr
Xaa Phe340 345 350Gly Leu Cys Gly Asp Asp
Gly Asn Pro Arg Ser Val Asn Thr Ile Glu355 360
365Cys Asn Asn Ile Leu Asn Glu Ala Asp Lys His Phe Glu Ser Trp
Thr370 375 380Tyr Trp Asp Ser Asn Leu Leu
Asp Leu Ser Gly Asn Pro Ile Val Thr385 390
395 400Glu Val Lys Ser Phe Ile Arg Pro Tyr Pro His Ser
Ile Arg Gly Val405 410 415Phe Arg Lys Gln
Gln Phe Asp His Lys Thr Gly Asp Phe His Leu Ser420 425
430Phe Ile Ala Asn Thr Thr Lys Glu Gln Asn Asn Glu Lys Gln
Thr Leu435 440 445Ile Ala Glu Ile Tyr Ile
Pro Arg Ser Val His Tyr Pro Asn Gly Phe450 455
460Ser Met Ser Val Lys Pro Asp Asn Leu Ser Thr Lys Met Asn Glu
Asn465 470 475 480Met Met
Tyr Val Tyr Leu Pro Ser Gly Val Ser Asn Ala Ser Val Phe485
490 495Val Arg Ile Glu Ile Val Arg Lys Ser Ile Glu500
50555509PRTArtificial SequenceDescription of Artificial
Sequencemutant endoglycoceramidase (EGC, EGCase) derived from
Dictyostelium discoideum, GenBank Accession #EAL72387 55Met Asn Lys
Lys Lys Gln Ile Ile Thr Thr Ile Thr Leu Leu Ser Phe1 5
10 15Ile Asn Leu Phe Ser Ile Val Asn Ala Ile
Ile Lys Val Asn Pro Ala20 25 30Asn Gln
Phe Phe Ile Asp Gln Tyr Asn Arg Val Arg Leu Phe His Gly35
40 45Val Asn Val Val Tyr Lys Ile Pro Pro Phe His Pro
Ser Leu Glu Gly50 55 60Phe Asp Pro Val
Thr Ser Phe Ser Ser Gln Asp Ile Glu Asn Leu Val65 70
75 80Glu Trp Gly Phe Asn Ala Val Arg Leu
Gly Val Met Trp Pro Gly Val85 90 95Glu
Pro Val Lys Asp Glu Tyr Asn Gln Thr Tyr Leu Asp Val Met Ser100
105 110Lys Leu Val Ser Glu Met Glu Asp Asn Glu Ile
Tyr Thr Leu Ile Asp115 120 125Phe His Gln
Asp Leu Leu Ser Arg Lys Tyr Cys Gly Glu Gly Leu Pro130
135 140Asp Trp Ile Val Ser Asn Asp Thr Asn Asp Ser Phe
Pro Ser Pro Val145 150 155
160Ala His Ser Tyr Pro Lys Asn Asn Glu Ser Tyr Pro Ser Leu Asp Gln165
170 175Cys Leu Asn Lys Asp Phe Gly Val Tyr
Tyr Phe Ser Glu Asp Val Asn180 185 190Arg
Glu Phe Gln Asn Leu Tyr Asp Asn Val Asn Gly Val Gln Asp Lys195
200 205Phe Ile Asp Tyr Trp Arg Gln Val Val Asn Thr
Phe Lys Ser Tyr Asp210 215 220Thr Val Leu
Gly Tyr Glu Ile Ile Asn Glu Pro Trp Gly Gly Asp Ile225
230 235 240Tyr Gln Asn Pro Glu Tyr Leu
Leu Lys Leu Gly Tyr Ala Asp Ser Lys245 250
255Asn Leu Leu Pro Leu Tyr Gln Ala Val Asn Asn Ala Ile Arg Glu Leu260
265 270Asp Asp Gln His Cys Val Tyr Tyr Glu
Lys Ala Leu Thr Asp Leu Phe275 280 285His
Ser Tyr Phe Pro Ser Gly Thr Pro Gly Gly Val Gln Tyr Asn Asp290
295 300Arg Gln Val Leu Ser Tyr His Ile Tyr Cys Ala
Thr Asp Arg Asp Gly305 310 315
320Asn Pro Arg His Glu Tyr Val Cys Asp Gly Glu Asp Asp Ile Phe
Leu325 330 335Val Ser Ala Met Lys Asp Leu
Lys Gln Thr Gly Gly Gly Gly Phe Met340 345
350Thr Xaa Phe Gly Ala Val Ser Asn Gly Thr Asn Ser Ile Glu Met Leu355
360 365Asn Tyr Leu Thr Gly Ser Ala Asp Lys
Tyr Leu Gln Ser Trp Thr Tyr370 375 380Trp
Gln Leu Lys Tyr Tyr Asn Asp Ile Thr Thr Ala Gly Ser Thr Glu385
390 395 400Ser Leu Tyr Leu Pro Asn
Gly Glu Leu Asp Ile Pro Lys Ile Thr Ala405 410
415Leu Ser Arg Thr Tyr Ala Gln Ala Ile Ala Gly Val Pro Leu Ser
Met420 425 430Ser Phe Asn Pro Ala Asn Ser
Asp Phe Ser Phe Ser Tyr Asn Ile Asn435 440
445Thr Thr Ile Thr Gln Pro Thr Gln Ile Tyr Leu Asn Gln Asp Ile Tyr450
455 460Tyr Pro Asn Gly Phe Thr Thr Asn Ile
Ile Thr Gly Thr Ala Thr Val465 470 475
480Ser Ile Pro Gln Lys Asn Leu Ile Tyr Ile Leu Pro Asn Ser
Asn Thr485 490 495Ile Asn Gln Ser Thr Ile
Thr Ile Thr Ile Leu Lys Lys500 50556647PRTArtificial
SequenceDescription of Artificial Sequencemutant endoglycoceramidase
(EGC, EGCase) derived from Streptomyces avermitilis strain MA-4680,
GenBank Accession #BAC75219 56Met Arg Lys Asn Ala Lys Leu Thr His
Glu Ser Glu Val Leu Thr Phe1 5 10
15His Arg Ser Ala Arg Thr Val Val Asp Met Ser Lys Leu Arg Ala
Arg20 25 30Leu Leu Gly Val Leu Val Ser
Leu Thr Gly Leu Leu Gly Ala Thr Gly35 40
45Ala Gln Pro Ala Ala Ala Asp Ser Leu Pro Asp Ser Leu Trp Phe Asp50
55 60Ala Ser Ala Ser Ala Ala Phe Thr Val Gln
Asn Gly Arg Phe Ser Asp65 70 75
80Gly Leu Gly Arg Glu Val Val Leu Arg Gly Tyr Asn Val Ser Gly
Glu85 90 95Thr Lys Leu Glu Glu Asn Ser
Gly Leu Pro Phe Ala Ser Val Ala Asp100 105
110Ala Arg Lys Ser Ala Thr Ala Leu Arg Thr Leu Gly Gly Gly Asn Ser115
120 125Val Arg Phe Leu Leu Ser Trp Ala His
Ala Glu Pro Val Arg Gly Gln130 135 140Val
Asp Thr Ala Tyr Leu Ala Ala Ala Thr Ala Gln Met Arg Ala Phe145
150 155 160Leu Asp Ala Gly Ile Arg
Val Phe Pro Asp Phe His Gln Asp Leu Tyr165 170
175Ser Arg Tyr Leu Phe Asn Ser Gly Ser Trp Tyr Thr Gly Asp Gly
Ala180 185 190Pro Glu Trp Ala Val Asp Ala
Gly Asp Tyr Pro Ala Glu Ser Cys Gly195 200
205Ile Cys Leu Phe Trp Gly Gln Asn Ile Thr Gln Asn Gly Ala Val Thr210
215 220Gln Ala Ser His Asp Phe Trp His Asn
Ala Tyr Gly Val Gln Asp Ala225 230 235
240Phe Leu Ala Thr Ala Gln Ala Thr Met Ala Tyr Ile Gln Gln
Asn Leu245 250 255Ser Ala Asp Glu Phe Asn
Gly Val Val Gly Phe Asp Pro Tyr Asn Glu260 265
270Pro His Ala Gly Thr Tyr Asp Ser Gly Glu Thr Ser Arg Thr Trp
Glu275 280 285Gln Asn Val Leu Trp Pro Phe
Tyr Lys Lys Phe Arg Ala Arg Met Asp290 295
300Ala Ala Gly Trp Gln Thr Lys Pro Ala Phe Ile Glu Pro Asn Leu Phe305
310 315 320Trp Asn Ala Asn
Ile Asp Phe Gln Lys Gln Glu Gly Gly Leu Leu Asp325 330
335Ala Gly Thr Leu Gly Pro Arg Tyr Val Leu Asn Thr His Phe
Tyr Asp340 345 350Gln Lys Ala Ile Ser Gly
Val Leu Met Trp Gly Lys Ala Ala Asp Gly355 360
365Gln Tyr Ala Thr Asp Phe Gly Lys Val Arg Asp Arg Ala Ala Gly
Ala370 375 380Gly Thr Ala Ala Val Val Ser
Xaa Phe Gly His Pro Leu Ser Gly Ser385 390
395 400Val Ser Asp Lys Ala Pro Thr Val Val Lys Ala Met
Tyr Gln Ala Leu405 410 415Asp Ser Arg Leu
Pro Gly Ser Thr Trp Trp Ser Asp Pro Thr Gly Ser420 425
430Gly Pro Val Leu Ser Gly Ala Gln Trp Gln Trp Asp Ile Tyr
Asn Gly435 440 445Arg His His Glu Leu Glu
Asn Gly Asn Pro Asp Lys Val Leu Thr Ser450 455
460Gly Asp Ala Trp Asn Asp Glu Asp Leu Ser Ala Val Ser Leu Asn
Asp465 470 475 480Ser Gly
Thr Ala Val Leu Arg Gln Asp Ala Arg Leu Leu Asp Arg Leu485
490 495Tyr Pro Ser Ala Thr Ala Gly Ala Thr Val Ala Phe
Thr Tyr Glu Asp500 505 510Arg Ser Arg Asp
Gly Ser Thr Thr Leu Thr Trp Asn Pro Val Pro Ser515 520
525Ser Leu Pro Asn Val Ser Arg Leu Val Gly Ser Gly Gln Tyr
Gly Leu530 535 540Leu Val Trp Arg Ser Asn
Gly Ser Thr Ala Pro Thr Glu Leu His Leu545 550
555 560Pro Ala Ser Phe Pro Ala Ala Ser Thr Thr Val
Val Ser Asp Leu Gly565 570 575Thr Thr Ser
Gly Leu Pro Ala Tyr Thr Arg Thr Thr Pro Val Gly His580
585 590Ala Ala Glu Pro Gly Gly Thr Gly Ser His Arg Leu
Leu Leu Thr Ala595 600 605Ala Asp Ser Gly
Thr Val His Tyr Ala Leu Val Thr Asn Gly Ala Thr610 615
620Ala Pro Ser Ala Gly Leu Leu Ser Ala Ala Arg Ala Glu Leu
Ser Ser625 630 635 640Trp
Ala Ala Thr Lys Val Gly64557654PRTArtificial SequenceDescription of
Artificial Sequencemutant endoglycoceramidase (EGC, EGCase) derived
from Leptospira interrogans serovar Copenhageni strain Fiocruz
L1-130, GenBank Accession #YP_003582 57Met Glu Glu Leu Phe Val Lys Asn
Gly His Phe Ala Ser Lys Glu Gly1 5 10
15Ala Ile Tyr Gln Leu Arg Gly Val Asn Leu Ser Gly Ser Ala Lys
Leu20 25 30Pro Leu Lys Pro Asp Gly Thr
Thr His Phe Asp Gln Thr Thr Thr Phe35 40
45Asp Asn His Lys Asn Val Ser Phe Val Gly Arg Pro Leu Lys Glu Asp50
55 60Gln Ala Glu Glu His Phe Asp Arg Leu Arg
Lys Trp Gly Phe Asn Phe65 70 75
80Leu Arg Phe Leu Ile Thr Trp Glu Ala Ile Glu His Lys Gly Pro
Gly85 90 95Lys Tyr Asp Asn Glu Tyr Ile
Asp Tyr Val Glu Arg Met Val Ser Leu100 105
110Ala Ala Lys Lys Gly Phe Tyr Leu Phe Ile Asp Pro His Gln Asp Val115
120 125Trp Ser Arg Phe Thr Gly Gly Asp Gly
Ala Pro Gly Trp Thr Leu Glu130 135 140Glu
Leu Gly Met Asn Ile Ser Lys Ile Arg Asn Ser Glu Thr Ala Ile145
150 155 160Val His His His Gln Gly
Lys Asn Tyr Arg Arg Met Ser Trp Pro Leu165 170
175Asn Tyr Gln Lys Tyr Ser Cys Ala Thr Met Phe Ser Leu Phe Phe
Gly180 185 190Gly Lys Glu Phe Ala Pro Asp
Thr Lys Ile Asp Gly Arg Asn Val Gln195 200
205Asp Phe Leu Gln Asp His Tyr Ile Asp Ser Val Leu Lys Ile Val Arg210
215 220Lys Leu Lys Lys Tyr Lys Asn Val Ile
Gly Phe Asp Thr Leu Asn Glu225 230 235
240Pro Ser Pro Gly Trp Ile Gly Lys Lys Asn Leu Gly Glu Phe
Asp Gly245 250 255Phe Gly Phe Gly Lys Val
Val Lys Ser Ser Pro Phe Gln Glu Met Tyr260 265
270Leu Ser Glu Gly Arg Ala Val Ser Ala Ala Gln Ala Tyr Met Leu
Gly275 280 285Phe Trp Ser Leu Pro Phe Gly
Lys Val Arg Leu Asn Pro Glu Gly Val290 295
300Pro Leu Trp Glu Arg Gly His Gln Cys Ile Trp Arg Asn His Gly Val305
310 315 320Trp Asp Tyr Asp
Pro Asn Gly Ala Pro Met Met Leu Lys Pro Glu Tyr325 330
335Phe Tyr Lys Lys Asn Gly Arg Lys Tyr Glu Phe Tyr Ser Asp
Phe Met340 345 350Tyr Pro Phe Ile Lys Lys
Phe Lys Glu Arg Val Gln Lys Leu Glu Asn355 360
365Arg Phe His Ile Phe Ile Glu Ser Asp Pro Ser Lys Leu Glu Leu
Glu370 375 380Trp Lys Glu Ile Pro Lys Lys
Asn Gln Gly Ser Val Ile Asn Ala Thr385 390
395 400His Trp Tyr Asp Ile Ser Val Leu Met Leu Lys Arg
Tyr Leu Pro Trp405 410 415Phe Gly Val His
Val Phe Lys Gln Lys Pro Ile Phe Gly Lys Glu Asn420 425
430Ile Asp Asn Ala Tyr Glu Glu Thr Ile Arg Met Ile Arg Glu
Met Ser435 440 445Glu Lys Lys Met Gly Asn
Cys Pro Thr Val Ile Gly Xaa Thr Gly Ile450 455
460Pro Met Asp Leu Asn His Arg Val Ala Tyr Leu Lys Asn Asp Tyr
Gly465 470 475 480Val Leu
Glu Lys Ala Leu Asp Arg Ile Met Lys Ala Val Glu Lys Asn485
490 495Phe Val Asn Leu Ala Leu Trp Asn Tyr Thr Pro Asp
His Thr His Ser500 505 510Leu Gly Asp Arg
Trp Asn Glu Glu Asp Leu Ser Ile Tyr Ser Gln Asp515 520
525Thr Pro Ser Ser Tyr Asp Glu Asp Gly Gly Arg Ala Val Arg
Ala Phe530 535 540Ser Arg Pro Tyr Pro Ile
Arg Thr Lys Gly Phe Pro Val Ala Leu Thr545 550
555 560Phe Asp Met Glu Arg Ser Leu Phe Lys Tyr Ala
Phe Arg Gln Glu Gly565 570 575Asp Leu Phe
Pro Glu Thr Glu Ile Phe Ile Pro Glu Ile His Tyr Lys580
585 590Lys Gly Phe Glu Val Leu Val Asn Ala Gly Thr Tyr
Gln Tyr Asp Phe595 600 605Arg Ser Arg Val
Leu Lys Phe Lys Gly Glu Lys Gly Ile Leu Asp Tyr610 615
620Gly Ile Thr Val Tyr Pro Ser Lys Lys Ser Leu Ser Arg Glu
Gln Asp625 630 635 640Arg
Thr Lys Val Val Pro Lys Thr Gln Lys Arg Lys Thr Gln645
65058770PRTArtificial SequenceDescription of Artificial Sequencemutant
endoglycoceramidase (EGC, EGCase) derived from Neurospora crassa,
GenBank Accession #XP_331009 58Met Ala Gly Phe Arg Leu Thr Ile Glu Asn
Gly Ser Phe Arg Asp Val1 5 10
15His Gly Arg Gln Ile Thr Leu Arg Gly Ile Asn Val Ala Gly Asp Ala20
25 30Lys Tyr Pro Asn Lys Pro Glu Gln Pro
Ser His Val Gly Glu Asn Phe35 40 45Phe
Asp Gly Asp Asn Val Lys Phe Thr Gly Arg Pro Phe Pro Lys Glu50
55 60Glu Ala His Leu His Phe Ser Arg Leu Lys Arg
Phe Gly Tyr Asn Thr65 70 75
80Ile Arg Tyr Val Phe Thr Trp Glu Ala Ile Glu Ala Ala Gly Pro Gly85
90 95Ile Tyr Asp Glu Glu Trp Ile Gln His
Thr Ile Asp Val Leu Arg Val100 105 110Ala
Lys Arg Tyr Gly Phe Tyr Ile Phe Met Asp Pro His Gln Asp Val115
120 125Trp Ser Arg Phe Ser Gly Gly Ser Gly Ala Pro
Met Trp Thr Leu Tyr130 135 140Ala Ala Gly
Leu Asn Pro Gln Ser Phe Ala Ala Thr Glu Ala Ala Ile145
150 155 160Val His Asn Val Tyr Pro Glu
Pro His Asn Phe Pro Lys Met Ile Trp165 170
175Ser Thr Asn Tyr Tyr Arg Leu Ala Ala Ala Thr Met Phe Thr Leu Phe180
185 190Phe Ala Gly Arg Asp Phe Ala Pro Lys
Cys Ile Ile Asp Gly Val Asn195 200 205Ile
Gln Asp Tyr Leu Gln Asp His Phe Leu Arg Ala Cys Ala His Leu210
215 220Ala Gln Arg Ile His Glu Ala Gly Asp Ile Glu
Asn Asp Val Val Phe225 230 235
240Gly Trp Glu Ser Leu Asn Glu Pro Asn Lys Gly Met Ile Ala Tyr
Glu245 250 255Asp Ile Ser Val Ile Pro Lys
Glu Gln Asn Leu Lys Lys Gly Thr Cys260 265
270Pro Thr Ile Trp Gln Thr Ile Leu Thr Gly Ser Gly Arg Ala Val Glu275
280 285Val Asp Thr Trp Asp Met Gly Gly Met
Gly Pro Tyr Lys Val Gly Arg290 295 300Ala
Leu Ile Asp Pro Ser Gly Glu Gln Ala Trp Leu Pro Ala Asp Tyr305
310 315 320Asp Glu Ser Arg Tyr Gly
Tyr Lys Arg Asp Pro Gly Trp Lys Leu Gly325 330
335Gln Cys Ile Trp Ala Gln His Gly Val Trp Asp Pro Ala Thr Asp
Ser340 345 350Leu Leu Lys Lys Asp Tyr Phe
Gly Lys His Pro Ala Thr Gly Glu His355 360
365Val Asp Tyr Pro Tyr Phe Ser Asn Arg Tyr Phe Met Asp Phe Phe Arg370
375 380Lys Tyr Arg Asp Thr Ile Arg Ser Ile
His Pro Asn Ala Ile Ile Leu385 390 395
400Leu Gln Gly Pro Thr Met Glu Leu Pro Pro Lys Ile Ile Gly
Thr Pro405 410 415Asp Gly Asp Asp Pro Leu
Leu Val Tyr Ala Pro His Trp Tyr Asp Gly420 425
430Ile Thr Leu Met Thr Lys Lys Trp Asn Arg Val Trp Asn Val Asp
Val435 440 445Ile Gly Ile Leu Arg Gly Lys
Tyr Trp Ser Pro Ala Phe Gly Ile Lys450 455
460Ile Gly Glu Thr Ala Ile Arg Asn Cys Phe Lys Asn Gln His Ala Thr465
470 475 480Met Arg Gln Glu
Gly Leu Asp Tyr Ile Gly Asn His Pro Cys Val Met485 490
495Thr Xaa Phe Gly Ile Pro Tyr Asp Met Asp Asp Lys Asn Ala
Tyr Lys500 505 510Thr Gly Asp Tyr Ser Ser
Gln Ser Ala Ala Met Asp Ala Asn His Tyr515 520
525Gly Val Glu Gly Ala Gly Leu Glu Gly Tyr Thr Leu Trp Leu Tyr
Met530 535 540Thr Lys Asn Asp His Glu Leu
Gly Asp Gln Trp Asn Gly Glu Asp Leu545 550
555 560Ser Ile Phe Ser Val Asp Asp Lys Leu Leu Pro Glu
Ser Pro Val Pro565 570 575Lys Ser His Ser
Arg Asp Gly Ser Ser Ser Ser Ile Ala Thr Pro Thr580 585
590Gly Thr Lys Asp Asp Asp Leu Asp Asp Asp Ser Ser Val Thr
Pro Ala595 600 605Asn Ile Lys Arg Thr Leu
Thr Asn Pro Ser Ile Ser Ser Val Ser Thr610 615
620Gln Arg Gln Pro Glu Leu Thr Asn Ser Pro Gly Tyr Arg Ala Ala
Glu625 630 635 640Ala Tyr
Val Arg Pro Ala Pro Ile Ala Thr Ala Gly Thr Val Lys Lys645
650 655Tyr Gly Phe Asp Leu Arg Ser Cys Gln Phe His Val
Thr Ile Gln Ala660 665 670Pro Glu Ala Ala
Lys Pro Asp Thr Pro Thr Val Val Phe Leu Pro Asp675 680
685Tyr His Phe Pro Lys Asp Ala Cys Gln Val Glu Val Ser Ser
Gly Lys690 695 700Trp Glu Ile Arg Ser Asp
Glu Glu Glu Thr Thr Pro Leu Gln Lys Leu705 710
715 720Arg Trp Trp His Gly Glu Gly Glu Gln Thr Leu
Arg Val Thr Gly Val725 730 735Val Lys Gln
Val Asn Gly Asn Ser Ser Glu Gly Ala Glu Val Gly Tyr740
745 750Tyr Asp Gln Val Phe Asn Gln Ala Lys Gly Phe Leu
Asp Ala Cys Val755 760 765Ile
Met7705924PRTArtificial SequenceDescription of Artificial
Sequencepredicted native N-terminal signal peptide sequence for
wild type endoglycoceramidase (EGC, EGCase) from Rhodococcus sp.
strain M-777, GenBank Accession #AAB67050 59Met Arg Arg Thr Arg Leu Val
Ser Leu Ile Val Thr Gly Ser Leu Val1 5 10
15Phe Gly Gly Gly Val Ala Ala Ala206024PRTArtificial
SequenceDescription of Artificial Sequencepredicted native
N-terminal signal peptide sequence for wild type endoglycoceramidase
(EGC, EGCase) from Rhodococcus sp. strain C9, GenBank Accession
#BAB17317 60Met Arg Arg Thr Arg Ile Ala Ser Leu Ala Val Ala Gly Ser Leu
Val1 5 10 15Leu Gly Ala
Gly Val Ala Thr Ala206129PRTArtificial SequenceDescription of Artificial
Sequencepredicted native N-terminal signal peptide sequence for
wild type endoglycoceramidase (EGC, EGCase) from Propionibacterium
acnes KPA171202, GenBank Accession #YP_056771 61Met Arg Arg Lys Ser
Ala Leu Gly Phe Val Ala Leu Ser Leu Phe Ala1 5
10 15Thr Gly Met Gly Val Ala Ala Ala Thr Pro Ala Thr
Ala20 256239PRTArtificial SequenceDescription of
Artificial Sequencepredicted native N-terminal signal peptide
sequence for wild type endoglycoceramidase (EGC, EGCase) from
Propionibacterium acnes KPA171202, GenBank Accession #YP_055358
62Met Tyr His His Ser Trp His Ser Pro Asp Ala Arg Arg Arg Gly Val1
5 10 15Thr Arg Trp Ala Thr Thr
Phe Ile Ala Ala Leu Thr Ala Ala Cys Met20 25
30Ala Gln Met Pro Ala Gln Ala356321PRTArtificial SequenceDescription
of Artificial Sequencepredicted native N-terminal signal peptide
sequence for wild type endoglycoceramidase (EGC, EGCase) from Cyanea
nozakii, GenBank Accession #BAB16369 63Met Ala Glu Thr Gln Pro Leu
Val Phe Val Leu Met Ser Ile Ser Ala1 5 10
15Ile Leu Thr Ala Gly206417PRTArtificial
SequenceDescription of Artificial Sequencepredicted native
N-terminal signal peptide sequence for wild type endoglycoceramidase
(EGC, EGCase) from Hydra magnipapillata, GenBank Accession #BAD20464
64Met Ile Ser Val Ala Leu Ile Ile Leu Phe Leu Ala Lys Val Ile Ser1
5 10 15Gly6517PRTArtificial
SequenceDescription of Artificial Sequencepredicted native
N-terminal signal peptide sequence for wild type endoglycoceramidase
(EGC, EGCase) from Schistosoma japonicum, GenBank Accession
#AAW25069 65Met Trp Ser Ile Phe Ile Leu Thr Phe Leu Ile Trp Thr Ser Val
Gln1 5 10
15Thr6625PRTArtificial SequenceDescription of Artificial
Sequencepredicted native N-terminal signal peptide sequence for
wild type endoglycoceramidase (EGC, EGCase) from Dictyostelium
discoideum, GenBank Accession #EAL72387 66Met Asn Lys Lys Lys Gln Ile Ile
Thr Thr Ile Thr Leu Leu Ser Phe1 5 10
15Ile Asn Leu Phe Ser Ile Val Asn Ala20
256754PRTArtificial SequenceDescription of Artificial Sequencepredicted
native N-terminal signal peptide sequence for wild type
endoglycoceramidase (EGC, EGCase) from Streptomyces avermitilis
strain MA-4680, GenBank Accession #BAC75219 67Met Arg Lys Asn Ala Lys Leu
Thr His Glu Ser Glu Val Leu Thr Phe1 5 10
15His Arg Ser Ala Arg Thr Val Val Asp Met Ser Lys Leu Arg
Ala Arg20 25 30Leu Leu Gly Val Leu Val
Ser Leu Thr Gly Leu Leu Gly Ala Thr Gly35 40
45Ala Gln Pro Ala Ala Ala506818PRTArtificial SequenceDescription of
Artificial Sequencepredicted native N-terminal signal peptide
sequence for wild type endoglycoceramidase (EGC, EGCase) from
Neurospora crassa, GenBank Accession #XP_331009 68Met Ala Gly Phe
Arg Leu Thr Ile Glu Asn Gly Ser Phe Arg Asp Val1 5
10 15His Gly698PRTArtificial SequenceDescription
of Artificial Sequenceepitope tag for monoclonal anti-FLAG
antibody, "FLAG tag" 69Asp Tyr Lys Asp Asp Asp Asp Lys1
5705PRTArtificial SequenceDescription of Artificial SequenceDDDDK
epitope tag 70Asp Asp Asp Asp Lys1 5716PRTArtificial
SequenceDescription of Artificial Sequence6 residue histidine
peptide epitope tag 71His His His His His His1
5726PRTArtificial SequenceDescription of Artificial SequencePolyoma
middle T protein epitope tag 72Glu Tyr Met Pro Met Glu1
573169DNAArtificial SequenceDescription of Artificial Sequenceportion of
expression vector pT7-7 with T7 promoter and transcription start
site 73cgattcgaac ttctgataga cttcgaaatt aatacgactc actataggga gaccacaacg
60gtttccctct agaaataatt ttgtttaact ttaagaagga gatatacata tggctagaat
120tcgcgcccgg ggatcctcta gagtcgacct gcagcccaag cttatcgat
1697420PRTArtificial SequenceDescription of Artificial Sequenceportion of
expression vector pT7-7 with transcription start site 74Met Ala Arg
Ile Arg Ala Arg Gly Ser Ser Arg Val Asp Leu Gln Pro1 5
10 15Lys Leu Ile Asp20
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20110176714 | METHOD TO DETERMINE A BACKGROUND PHASE IN PHASE IMAGE DATA SETS |
20110176713 | BIOLOGICAL LIGHT MEASUREMENT DEVICE AND POSITION DISPLAY METHOD OF LIGHT IRRADIATION POSITION AND LIGHT DETECTION POSITION OR MEASUREMENT CHANNEL |
20110176712 | IMAGE DATA FRAUD DETECTION SYSTEMS |
20110176711 | METHODS, APPARATUSES & COMPUTER PROGRAM PRODUCTS FOR FACILITATING PROGRESSIVE DISPLAY OF MULTI-PLANAR RECONSTRUCTIONS |
20110176710 | Method and system for automatic processing and evaluation of images, particularly diagnostic images |