Patent application title: MOLECULAR SEQUENCE OF SWINE RETROVIRUS AND METHODS OF USE
Inventors:
Jay A. Fishman (Wellesley, MA, US)
Assignees:
The General Hospital Corporation
IPC8 Class: AC12Q170FI
USPC Class:
435 5
Class name: Chemistry: molecular biology and microbiology measuring or testing process involving enzymes or micro-organisms; composition or test strip therefore; processes of forming such composition or test strip involving virus or bacteriophage
Publication date: 2009-06-25
Patent application number: 20090162834
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: MOLECULAR SEQUENCE OF SWINE RETROVIRUS AND METHODS OF USE
Inventors:
Jay A. Fishman
Agents:
CHOATE, HALL & STEWART LLP
Assignees:
The General Hospital Corporation
Origin: BOSTON, MA US
IPC8 Class: AC12Q170FI
USPC Class:
435 5
Abstract:
Purified nucleic acid which can specifically hybridize with the sequence
of swine retroviruses.Claims:
1-26. (canceled)
27. A method for screening a tissue for the presence or expression of a swine or miniature swine retrovirus, the method comprising:contacting a tissue sample with an antibody specific for a retroviral polypeptide, wherein the retroviral polypeptide is encoded by a nucleic acid molecule having at least 95% identity to a sequence selected from the group consisting of:(a) nucleotides 2-1999 of SEQ ID NO:1 (env);(b) nucleotides 2452-4839 of SEQ ID NO:1 (gag);(c) nucleotides 4871-8060 of SEQ ID NO:1 (pol);(d) nucleotides 598-2169 of SEQ ID NO:2 (gag);(e) nucleotides 2320-4737 of SEQ ID NO:2 (pol);(f) nucleotides 4738-6722 of SEQ ID NO:2 (env);(g) nucleotides 585-2156 of SEQ ID NO:3 (gag);(h) nucleotides 2307-5741 of SEQ ID NO:3 (pol); and(i) nucleotides 5620-7533 of SEQ ID NO:3 (env);thereby determining whether the retroviral polypeptide is present, the presence of the retroviral polypeptide being indicative of the presence or expression of a swine or miniature swine retrovirus.
28. The method of claim 27, wherein the retroviral polypeptide is encoded by nucleotides 2-1999 of SEQ ID NO:1.
29. The method of claim 27, wherein the retroviral polypeptide is encoded by nucleotides 2452-4839 of SEQ ID NO:1.
30. The method of claim 27, wherein the retroviral polypeptide is encoded by nucleotides 4871-8060 of SEQ ID NO:1.
31. The method of claim 27, wherein the retroviral polypeptide is encoded by nucleotides 598-2169 of SEQ ID NO:2.
32. The method of claim 27, wherein the retroviral polypeptide is encoded by nucleotides 2320-4737 of SEQ ID NO:2.
33. The method of claim 27, wherein the retroviral polypeptide is encoded by nucleotides 4738-6722 of SEQ ID NO:2.
34. The method of claim 27, wherein the retroviral polypeptide is encoded by nucleotides 585-2156 of SEQ ID NO:3.
35. The method of claim 27, wherein the retroviral polypeptide is encoded by nucleotides 2307-5741 of SEQ ID NO:3.
36. The method of claim 27, wherein the retroviral polypeptide is encoded by nucleotides 5620-7533 of SEQ ID NO:3.
37. The method of claim 27, wherein the tissue is selected from the group consisting of: heart, lung, liver, bone marrow, kidney, brain, neural tissue, pancreas, thymus, and intestine.
38. The method of claim 27, wherein the method comprises an enzyme-linked immunosorbent assay (ELISA).
39. An antibody specific for a retroviral polypeptide, wherein the retroviral polypeptide is encoded by a nucleic acid molecule having at least 95% identity to a sequence selected from the group consisting of:(a) nucleotides 2-1999 of SEQ ID NO:1 (env);(b) nucleotides 2452-4839 of SEQ ID NO:1 (gag);(c) nucleotides 4871-8060 of SEQ ID NO:1 (pol);(d) nucleotides 598-2169 of SEQ ID NO:2 (gag);(e) nucleotides 2320-4737 of SEQ ID NO:2 (pol);(f) nucleotides 4738-6722 of SEQ ID NO:2 (env);(g) nucleotides 585-2156 of SEQ ID NO:3 (gag);(h) nucleotides 2307-5741 of SEQ ID NO:3 (pol); and(i) nucleotides 5620-7533 of SEQ ID NO:3 (env).
40. The antibody of claim 39, wherein the antibody is a polyclonal antibody.
41. The antibody of claim 39, wherein the antibody is a monoclonal antibody.
42. A method of producing an antibody specific for a retroviral polypeptide, the method comprising:immunizing an animal with a purified polypeptide encoded by a sequence comprising at least 100 nucleotides of a nucleic acid molecule comprising at least 95% identity to a sequence selected from the group consisting of:(a) nucleotides 2-1999 of SEQ ID NO:1 (env);(b) nucleotides 2452-4839 of SEQ ID NO:1 (gag);(c) nucleotides 4871-8060 of SEQ ID NO:1 (pol);(d) nucleotides 598-2169 of SEQ ID NO:2 (gag);(e) nucleotides 2320-4737 of SEQ ID NO:2 (pol);(f) nucleotides 4738-6722 of SEQ ID NO:2 (env);(g) nucleotides 585-2156 of SEQ ID NO:3 (gag);(h) nucleotides 2307-5741 of SEQ ID NO:3 (pol); and(i) nucleotides 5620-7533 of SEQ ID NO:3 (env),thereby producing an antibody.
Description:
[0001]This application is a continuation of U.S. Ser. No. 10/723,552,
filed Nov. 26, 2003, which is a divisional of U.S. Ser. No. 09/661,858,
filed on Sep. 14, 2000, now U.S. Pat. No. 6,699,663, which is a
divisional of U.S. Ser. No. 08/766,528, filed on Dec. 13, 1996, now U.S.
Pat. No. 6,190,861, which is a continuation-in-part of U.S. Ser. No.
08/572,645, filed on Dec. 14, 1995, the entire contents of which are
hereby incorporated by reference.
FIELD OF THE INVENTION
[0002]The invention relates to porcine retroviral sequences, peptides encoded by porcine retroviral sequences, and methods of using the porcine retroviral nucleic acids and peptides.
BACKGROUND OF THE INVENTION
[0003]Advances in solid organ transplantation and a chronic shortage of suitable organ donors have made xenotransplantation an attractive alternative to the use of human allografts. However, the potential for introduction of a new group of infectious diseases from donor animals into the human population is a concern with the use of these methods.
[0004]The term applied to the natural acquisition by humans of infectious agents carried by other species is zoonosis. The transplantation of infection from nonhuman species into humans is best termed "direct zoonosis" or "xenosis."
[0005]Nonhuman primates and swine have been considered the main potential sources of organs for xenotransplantation (Niekrasz et al. (1992) Transplant Proc 24:625; Starzl et al. (1993) Lancet 341:65; Murphy et al. (1970) Trans Proc 4:546; Brede and Murphy (1972) Primates Med 7:18; Cooper et al. In Xenotransplantation: The Transplantation of Organs and Tissues between Species, eds. Cooper et al. (1991) p. 457; R Y Calne (1970) Transplant Proc 2:550; H. Auchincloss, Jr. (1988) Transplantation 46:1; and Chiche et al. (1993) Transplantation 6:1418). The infectious disease issues for primates and swine are similar to those of human donors. The prevention of infection depends on the ability to predict, to recognize, and to prevent common infections in the immunocompromised transplantation recipient (Rubin et al. (1993) Antimicrob Agents Chemother 37:619). Because of the potential carriage by nonhuman primates of pathogens easily adopted to humans, ethical concerns, and the cost of maintaining large colonies of primates, other species have received consideration as organ donors (Brede and Murphy (1972) Primates Med 7:18; Van Der Riet et al. (1987) Transplant Proc 19:4069; Katler In Xenotransplantation: The Transplantation of Organs and Tissues between Species, eds. Cooper et al. (1991) p. 457; Metzger et al. (1981) J Immunol 127:769; McClure et al. (1987) Nature 330:487; Letvin et al. (1987) J Infect Dis 156:406; Castro et al. (1991) Virology 184:219; Benveniste and Todaro (1973) Proc Natl Acad Sci USA 70:3316; and Teich, in RNA Tumor viruses, eds. Weiss et. al. (1985) p. 25). The economic importance of swine and experience in studies of transplantation in the miniature swine model have allowed some of the potential pathogens associated with these animals to be defined (Niekrasz et al. (1992) Transplant Proc 24:625; Cooper et al. In Xenotransplantation: The Transplantation of Organs and Tissues between Species, eds.
Cooper et al. (1991) p. 457; and Leman et al. (1992) Diseases of Swine, 7th ed. Ames, Iowa:Iowa State University). Miniature swine have received consideration as organ donors because of a number of features of the species. The structure and function of the main pig organs are comparable to those of man. Swine attain body weights and organ sizes adequate to the provision of organs for human use. Lastly, veterinarians and commercial breeders have developed approaches to creation of specific-pathogen-free (SPF) swine with the ability to eliminate known pathogens from breeding colonies (Alexander et al. (1980) Proc 6th Int Congr Pig Vet Soc, Copenhagen; Betts (1961) Vet Rec 73:1349; Betts et al. (1960) Vet Rec 72:461; Caldwell et al. (1959) J Am Vet Med Assoc 135:504; and Yong (1964) Adv Vet Sci 9:61).
[0006]Concern exists over the transfer of porcine retroviruses by xenotransplantation (Smith (1993) N Engl J Med 328:141). Many of the unique properties of the retroviruses are due to the synthesis of a complementary DNA copy from the RNA template (by reverse transcriptase), and integration of this DNA into the host genome. The integrated retroviral copy (which is referred to as an endogenous copy or "provirus") can be transmitted via the germ line.
SUMMARY OF THE INVENTION
[0007]In general, the invention features a purified swine or miniature swine retroviral nucleic acid, e.g., a Tsukuba nucleic acid, a purified miniature swine retroviral nucleic acid sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, and methods of their use in detecting the presence of porcine, e.g., miniature swine, retroviral sequences.
[0008]In another aspect, the invention features a purified nucleic acid, e.g., a probe or primer, which can specifically hybridize with a purified swine or miniature swine retroviral genome, e.g., a Tsukuba genome, the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0009]In preferred embodiments the nucleic acid is other than the entire retroviral genome of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, e.g., it is at least 1 nucleotide longer, or at least 1 nucleotide shorter, or differs in sequence at least one position, e.g., the nucleic acid is a fragment of the sequence of SEQ ID NO:1 or its complement SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, or it includes sequence additional to that of SEQ ID NO:1, or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0010]In preferred embodiments, the nucleic acid has at least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0011]In other embodiments: the sequence of the nucleic acid differs from the corresponding sequence of SEQ ID NO: 1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, by 1, 2, 3, 4, or 5 base pairs; the sequence of the nucleic acid differs from the corresponding sequence of SEQ ID NO: 1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, by at least 1, 2, 3, 4, or 5 base pairs but less than 6, 7, 8, 9, or 10 base pairs.
[0012]In other preferred embodiments: the nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length.
[0013]In yet other preferred embodiments: the nucleic acid can specifically hybridize with a translatable region of a miniature swine retroviral genome, e.g., the retroviral genome of SEQ ID NO: 1, or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, e.g., a region from the gag, pol, or env gene; the probe or primer can specifically hybridize with an untranslated region of a miniature swine retroviral genome, e.g., the retroviral genome of SEQ ID NO: 1, or its complement SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement; the probe or primer can specifically hybridize with a non-conserved region of a miniature swine retroviral genome, e.g., the retroviral genome of SEQ ID NO: 1, or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement; the probe or primer can specifically hybridize with the highly conserved regions of a miniature swine retroviral genome, e.g., the retroviral genome of SEQ ID NO: 1, or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0014]In preferred embodiments, the primer is selected from the group consisting of SEQ ID NOs:4-74.
[0015]In preferred embodiments, hybridization of the probe to retroviral sequences can be detected by standard methods, e.g., by radiolabeled probes or by probes bearing nonradioactive markers such as enzymes or antibody binding sites. For example, a probe can be conjugated with an enzyme such as horseradish peroxidase, where the enzymatic activity of the conjugated enzyme is used as a signal for hybridization. Alternatively, the probe can be coupled to an epitope recognized by an antibody, e.g., an antibody conjugated to an enzyme or another marker.
[0016]In another aspect, the invention features a reaction mixture which includes a target nucleic acid, e.g., a human, swine, or a miniature swine nucleic acid, and a purified second nucleic acid, e.g., a probe or primer, as, e.g., is described herein, which specifically hybridizes with the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, a swine or a miniature swine retroviral nucleic acid, e.g., a Tsukuba nucleic acid.
[0017]In preferred embodiments, the target nucleic acid: includes RNA; or includes DNA.
[0018]In preferred embodiments, the target nucleic acid includes: genomic DNA isolated from a miniature swine; RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine; DNA, RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine organ, e.g., a kidney; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine potential donor organ; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine organ which has been transplanted into a organ recipient, e.g., a xenogeneic recipient, e.g., a primate, e.g., a human.
[0019]In preferred embodiments, the target nucleic acid includes: genomic DNA isolated from a swine; RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine; DNA, RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine organ, e.g., a kidney; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine potential donor organ; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine organ which has been transplanted into a organ recipient, e.g., a xenogeneic recipient, e.g., a primate, e.g., a human.
[0020]In a preferred embodiment: the second nucleic acid is a porcine retroviral sequence, probe or primer, e.g., as described herein, e.g., a Tsukuba-1 retroviral sequence the second nucleic acid is a sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, or a fragment of the sequence or complement at least 10, 20, or 30, basepairs in length.
[0021]In preferred embodiments, the second nucleic acid has at least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0022]In other preferred embodiments: the second nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the second nucleic acid is a full length retroviral genome.
[0023]In preferred embodiments the second nucleic acid is: a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a gag protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 (e.g, from nucleotides 3112-4683) of SEQ ID NO:1, nucleotides 598-2169 (e.g, from nucleotides 598-2169) of SEQ ID NO:2, or nucleotides 585-2156 (e.g, from nucleotides 585-2156) of SEQ ID NO:3, or naturally occurring mutants thereof;
a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a pol protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, nucleotides 2320-4737 of SEQ ID NO:2, or nucleotides 2307-5741 of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a env protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 (e.g, from nucleotides 86-1999) of SEQ ID NO:1, nucleotides 4738-6722 (e.g, from nucleotides 4738-6722) of SEQ ID NO:2, or nucleotides 5620-7533 of SEQ ID NO:3, or naturally occurring mutants thereof.
[0024]In another aspect, the invention features a method for screening a cell or a tissue, e.g., a cellular or tissue transplant, e.g., a xenograft, for the presence or expression of a swine or a miniature swine retrovirus or retroviral sequence, e.g., an endogenous miniature swine retrovirus. The method includes:
[0025]contacting a target nucleic acid from the tissue with a second sequence chosen from the group of: a sequence which can specifically hybridize to a porcine retroviral sequence; a sequence which can specifically hybridize to the sequence of SEQ ID NO:1 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:2 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:3 or its complement; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a gag protein: a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 (e.g, from nucleotides 3112-4683) of SEQ ID NO:1, nucleotides 598-2169 (e.g, from nucleotides 598-2169) of SEQ ID NO:2, or nucleotides 585-2156 (e.g, from nucleotides 585-2156) of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a pol protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, nucleotides 2320-4737 of SEQ ID NO:2, or nucleotides 2307-5741 of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a env protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 (e.g, from nucleotides 86-1999) of SEQ ID NO:1, nucleotides 4738-6722 (e.g, from nucleotides 4738-6722) of SEQ ID NO:2, or nucleotides 5620-7533 of SEQ ID NO:3, or naturally occurring mutants thereof; a swine or miniature swine retroviral nucleic acid; or a Tsukuba nucleic acid under conditions in which hybridization can occur, hybridization being indicative of the presence or expression of an endogenous miniature swine retrovirus or retroviral sequence in the tissue or an endogenous swine retrovirus in the tissue.
[0026]In preferred embodiments, the method further includes amplifying the target nucleic acid with primers which specifically hybridize to the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0027]In preferred embodiments, the tissue or cellular transplant is selected from the group consisting of: heart, lung, liver, bone marrow, kidney, brain cells, neural tissue, pancreas or pancreatic cells, thymus, or intestinal tissue.
[0028]In other preferred embodiments, the target nucleic acid is: DNA; RNA; or cDNA.
[0029]In other preferred embodiments, the target nucleic acid is taken from: a tissue sample, or a blood sample, e.g., a tissue biopsy sample, e.g., a tissue sample suitable for in situ hybridization or immunohistochemistry.
[0030]In preferred embodiments, the target nucleic acid includes: genomic DNA isolated from a miniature swine; RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine; DNA, RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine organ, e.g., a kidney; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine potential donor organ; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine organ which has been transplanted into a organ recipient, e.g., a xenogeneic recipient, e.g., a primate, e.g., a human.
[0031]In preferred embodiments, the target nucleic acid includes: genomic DNA isolated from a swine; RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine; DNA, RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine organ, e.g., a kidney; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine potential donor organ; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine organ which has been transplanted into a organ recipient, e.g., a recipient swine or a xenogeneic recipient, e.g., a primate, e.g., a human.
[0032]In a preferred embodiment the target nucleic acid is RNA, or a nucleic acid amplified from RNA in the tissue, and hybridization is correlated with expression of an endogenous miniature swine retrovirus or retroviral sequence or an endogenous swine retrovirus.
[0033]In a preferred embodiment the target nucleic acid is DNA, or a nucleic acid amplified from DNA in the tissue, and hybridization is correlated with the presence of an endogenous miniature swine retrovirus or an endogenous swine retrovirus.
[0034]In preferred embodiments, the second nucleic acid has at least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0035]In other preferred embodiments: the second nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the second nucleic acid is a full length retroviral genome.
[0036]In another aspect, the invention features a method of screening a porcine derived cell or tissue for the presence of an activatable porcine retrovirus, e.g., an activatable porcine provirus. The method includes:
[0037]stimulating a porcine derived cell or tissue with a treatment which can activate a retrovirus;
[0038]contacting a target nucleic acid from the porcine derived cell or tissue with a second sequence chosen from the group of: a sequence which can specifically hybridize to a porcine retroviral sequence; a sequence which can specifically hybridize to the sequence of SEQ ID NO:1 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:2 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:3 or its complement; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a gag protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 (e.g, from nucleotides 3112-4683) of SEQ ID NO:1, nucleotides 598-2169 (e.g, from nucleotides 598-2169) of SEQ ID NO:2, or nucleotides 585-2156 (e.g, from nucleotides 585-2156) of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a pol protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, nucleotides 2320-4737 of SEQ ID NO:2, or nucleotides 2307-5741 of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a env protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 (e.g, from nucleotides 86-1999) of SEQ ID NO:1, nucleotides 4738-6722 (e.g, from nucleotides 4738-6722) of SEQ ID NO:2, or nucleotides 5620-7533 of SEQ ID NO:3, or naturally occurring mutants thereof; a swine or miniature swine retroviral nucleic acid; or a Tsukuba nucleic acid hybridization being indicative of the presence of an activatable porcine provirus in the porcine derived cell or tissue.
[0039]In preferred embodiments the treatment is: contact with a drug, e.g., a steroid or a cytotoxic agent, infection or contact with a virus, the induction of stress, e.g., nutritional stress or immunologic stress, e.g., contact with a T-cell, e.g., a reactive T-cell.
[0040]In preferred embodiments, the method further includes amplifying the target nucleic acid with primers which specifically hybridize to the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0041]In other preferred embodiments, the target nucleic acid is taken from: a tissue sample, or a blood sample, e.g., a tissue biopsy sample, e.g., a tissue sample suitable for in situ hybridization or immunohistochemistry.
[0042]In preferred embodiments, the target nucleic acid includes: genomic DNA isolated from a miniature swine; RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine; DNA, RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine organ, e.g., a kidney; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine potential donor organ; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine organ which has been transplanted into a organ recipient, e.g., a xenogeneic recipient, e.g., a primate, e.g., a human.
[0043]In preferred embodiments, the target nucleic acid includes: genomic DNA isolated from a swine; RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine; DNA, RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine organ, e.g., a kidney; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine potential donor organ; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine organ which has been transplanted into a organ recipient, e.g., a recipient swine or a xenogeneic recipient, e.g., a primate, e.g., a human.
[0044]In preferred embodiments, the second nucleic acid has at least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0045]In other preferred embodiments: the second nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the second nucleic acid is a full length retroviral genome.
[0046]In another aspect, the invention features a method for screening a miniature swine genome or a swine genome for the presence of a porcine retrovirus or retroviral sequence, e.g., an endogenous porcine retrovirus. The method includes:
[0047]contacting the miniature swine (or swine) genomic DNA with a second sequence chosen from the group of: a sequence which can specifically hybridize to a porcine retroviral sequence; a sequence which can specifically hybridize to the sequence of SEQ ID NO:1 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:2 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:3 or its complement; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a gag protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 (e.g, from nucleotides 3112-4683) of SEQ ID NO:1, nucleotides 598-2169 (e.g, from nucleotides 598-2169) of SEQ ID NO:2, or nucleotides 585-2156 (e.g, from nucleotides 585-2156) of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a pol protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, nucleotides 2320-4737 of SEQ ID NO:2, or nucleotides 2307-5741 of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a env protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 (e.g, from nucleotides 86-1999) of SEQ ID NO:1, nucleotides 4738-6722 (e.g, from nucleotides 4738-6722) of SEQ ID NO:2, or nucleotides 5620-7533 of SEQ ID NO:3, or naturally occurring mutants thereof; a swine or miniature swine retroviral nucleic acid; or a Tsukuba nucleic acid under conditions in which the sequences can hybridize, hybridization being indicative of the presence of the endogenous porcine retrovirus or retroviral sequence in the miniature swine (or swine) genome.
[0048]In preferred embodiments, the method further includes amplifying all or a portion of the miniature swine (or swine) genome with primers which specifically hybridize to the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0049]In a preferred embodiment: the second nucleic acid is a porcine retroviral sequence, probe or primer, e.g., as described herein, e.g., a Tsukuba-1 retroviral sequence; the second nucleic acid is a sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, or a fragment of the sequence or complement at least 10, 20, or 30, basepairs in length.
[0050]In preferred embodiments, the second nucleic acid has at least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0051]In other preferred embodiments: the second nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the second nucleic acid is a full length retroviral genome.
[0052]In another aspect, the invention features a method for screening a genetically modified miniature swine or a genetically modified swine for the presence or expression of a miniature swine or swine retrovirus or retroviral sequence, e.g., an endogenous miniature swine retrovirus. The method includes:
[0053]contacting a target nucleic acid from the genetically modified miniature swine or swine with a second sequence chosen from the group of: a sequence which can specifically hybridize to a porcine retroviral sequence; a sequence which can specifically hybridize to the sequence of SEQ ID NO:1 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:2 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:3 or its complement; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a gag protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 (e.g, from nucleotides 3112-4683) of SEQ ID NO:1, nucleotides 598-2169 (e.g, from nucleotides 598-2169) of SEQ ID NO:2, or nucleotides 585-2156 (e.g, from nucleotides 585-2156) of SEQ ID NO:3, or naturally occurring mutants thereof;
[0054]a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a pol protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, nucleotides 2320-4737 of SEQ ID NO:2, or nucleotides 2307-5741 of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a env protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 (e.g, from nucleotides 86-1999) of SEQ ID NO:1, nucleotides 4738-6722 (e.g, from nucleotides 4738-6722) of SEQ ID NO:2, or nucleotides 5620-7533 of SEQ ID NO:3, or naturally occurring mutants thereof; a swine or miniature swine retroviral nucleic acid; or a Tsukuba nucleic acid under conditions in which hybridization can occur, hybridization being indicative of the presence or expression of an endogenous miniature swine retrovirus or retroviral sequence or swine retrovirus or retroviral sequence in the genetically modified miniature swine or swine.
[0055]In preferred embodiments, the method further includes amplifying the target nucleic acid with primers which specifically hybridize to the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0056]In preferred embodiments, the target nucleic acid includes: genomic DNA isolated from a miniature swine; RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine; DNA, RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine organ, e.g., a kidney; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine potential donor organ; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine organ which has been transplanted into a organ recipient, e.g., a xenogeneic recipient, e.g., a primate, e.g., a human.
[0057]In preferred embodiments, the target nucleic acid includes: genomic DNA isolated from a swine; RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine; DNA, RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine organ, e.g., a kidney; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine potential donor organ; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine organ which has been transplanted into a organ recipient, e.g., a recipient swine or a xenogeneic recipient, e.g., a primate, e.g., a human.
[0058]In preferred embodiments, the second nucleic acid has at least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0059]In other preferred embodiments: the second nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the second nucleic acid is a full length retroviral genome.
[0060]In another aspect, the invention features a method of assessing the potential risk associated with the transplantation of a graft from a donor miniature swine or swine into a recipient animal, e.g., a miniature swine or swine, a non-human primate, or a human. The method includes:
[0061]contacting a target nucleic acid from the donor, recipient or the graft, with a second sequence chosen from the group of: a nucleic acid sequence which specifically hybridizes a sequence which can specifically hybridize to a porcine retroviral sequence; a sequence which can specifically hybridize to the sequence of SEQ ID NO:1 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:2 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:3 or its complement; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a gag protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 (e.g, from nucleotides 3112-4683) of SEQ ID NO:1, nucleotides 598-2169 (e.g, from nucleotides 598-2169) of SEQ ID NO:2, or nucleotides 585-2156 (e.g, from nucleotides 585-2156) of SEQ ID NO:3, or naturally occurring mutants thereof;
[0062]a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a pol protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, nucleotides 2320-4737 of SEQ ID NO:2, or nucleotides 2307-5741 of SEQ ID NO:3, or naturally occurring mutants thereof;
[0063]a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a env protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 (e.g, from nucleotides 86-1999) of SEQ ID NO:1, nucleotides 4738-6722 (e.g, from nucleotides 4738-6722) of SEQ ID NO:2, or nucleotides 5620-7533 of SEQ ID NO:3, or naturally occurring mutants thereof; a swine or miniature swine retroviral nucleic acid; or a Tsukuba nucleic acid under conditions in which the sequences can hybridize, hybridization being indicative of a risk associated with the transplantation.
[0064]In a preferred embodiment: the second nucleic acid is a Tsukuba-1 retroviral sequence, probe or primer, e.g., as described herein; the second nucleic acid is a porcine retroviral sequence, probe or primer, e.g., as described herein; the second nucleic acid is the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, or a fragment of the sequence or complement at least 10, 20, or 30, basepairs in length.
[0065]In preferred embodiments, the target nucleic acid includes: genomic DNA isolated from a miniature swine; RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine; DNA, RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine organ, e.g., a kidney; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine potential donor organ; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine organ which has been transplanted into a organ recipient, e.g., a xenogeneic recipient, e.g., a primate, e.g., a human.
[0066]In preferred embodiments, the target nucleic acid includes: genomic DNA isolated from a swine; RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine; DNA, RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine organ, e.g., a kidney; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine potential donor organ; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine organ which has been transplanted into a organ recipient, e.g., a recipient swine or a xenogeneic recipient, e.g., a primate, e.g., a human.
[0067]In preferred embodiments, the second nucleic acid has at least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0068]In other preferred embodiments: the second nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the second nucleic acid is a full length retroviral genome.
[0069]In another aspect, the invention features a method of determining if an endogenous miniature swine or swine retrovirus or retroviral sequence genome includes a mutation which modulates its expression, e.g., results in misexpression. The method includes:
[0070]determining the structure of the endogenous retroviral genome, and
[0071]comparing the structure of the endogenous retroviral genome with the retroviral sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, a difference being predictive of a mutation.
[0072]In preferred embodiments the method includes sequencing the endogenous genome and comparing it with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0073]In preferred embodiments, the method includes using primers to amplify, e.g., by PCR, LCR (ligase chain reaction), or other amplification methods, a region of the endogenous retroviral genome, and comparing the structure of the amplification product to the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement to determine if there is difference in sequence between retroviral genome and SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement. The method further includes determining if one or more restriction sites exist in the endogenous retroviral genome, and determining if the sites exist in SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0074]In preferred embodiments, the mutation is a gross defect, e.g., an insertion, inversion, translocation or a deletion, of all or part of the retroviral genome.
[0075]In preferred embodiments, detecting the mutation can include: (i) providing a labeled PCR probe amplified from DNA (e.g., SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3) containing a porcine retroviral nucleotide sequence which hybridizes to a sense or antisense sequence from the porcine retroviral genome(e.g., SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3), or naturally occurring mutants thereof; (ii) exposing the probe/primer to nucleic acid of the tissue (e.g., genomic DNA) digested with a restriction endonuclease; and (iii) detecting by in situ hybridization of the probe/primer to the nucleic acid, the presence or absence of the genetic lesion. Alternatively, direct PCR analysis, using primers specific for porcine retroviral genes (e.g., genes comprising the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3), can be used to detect the presence or absence of the genetic lesion in the porcine retroviral genome by comparing the products amplified.
[0076]In another aspect, the invention features a method of providing a miniature swine or a swine free of an endogenous retrovirus or retroviral sequence, e.g., activatable retrovirus, insertion at a preselected site. The method includes:
[0077]performing a breeding cross between a first miniature swine (or swine) having a retroviral insertion at the preselected site and a second miniature swine (or swine) not having a retroviral insertion at a preselected site, e.g., the same site, and recovering a progeny miniature swine (or swine), not having the insertion, wherein the presence or absence of the retroviral insertion is determined by contacting the genome of a miniature swine(or swine) with a sequence which can specifically hybridize to a porcine retroviral sequence; a sequence which can specifically hybridize to the sequence of SEQ ID NO:1 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:2 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:3 or its complement; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a gag protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 (e.g, from nucleotides 3112-4683) of SEQ ID NO:1, nucleotides 598-2169 (e.g, from nucleotides 598-2169) of SEQ ID NO:2, or nucleotides 585-2156 (e.g, from nucleotides 585-2156) of SEQ ID NO:3, or naturally occurring mutants thereof;
[0078]a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a pol protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, nucleotides 23204737 of SEQ ID NO:2, or nucleotides 2307-5741 of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a env protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 (e.g, from nucleotides 86-1999) of SEQ ID NO:1, nucleotides 4738-6722 (e.g, from nucleotides 4738-6722) of SEQ ID NO:2, or nucleotides 5620-7533 of SEQ ID NO:3, or naturally occurring mutants thereof; a swine or miniature swine retroviral nucleic acid; or a Tsukuba nucleic acid.
[0079]In preferred embodiments, the nucleic acid is hybridized to nucleic acid, e.g., DNA from the genome, of the first animal or one of its ancestors.
[0080]In preferred embodiments, the nucleic acid is hybridized to nucleic acid, e.g., DNA from the genome, of the second animal or one of its ancestors.
[0081]In preferred embodiments, the nucleic acid is hybridized to nucleic acid, e.g., DNA from the genome, of the progeny animal or one of its descendants.
[0082]In preferred embodiments, the nucleic acid has at least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0083]In other preferred embodiments: the nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is a full length retroviral genome.
[0084]In another aspect, the invention features a method of evaluating a treatment, e.g., an immunosuppressive treatment, for the ability to activate a retrovirus, e.g., an endogenous porcine retrovirus. The method includes:
[0085]administering a treatment to a subject, e.g., a miniature swine (or a swine), having an endogenous porcine retrovirus; and
[0086]detecting expression of the porcine retrovirus with a purified nucleic acid sequence which specifically hybridizes to the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0087]In preferred embodiments, the immunosuppresive treatment includes radiation, chemotherapy or drug treatment.
[0088]In preferred embodiments: the treatment is one which can induce immunological tolerance; the treatment is one which can introduce new genetic material, e.g., introduce new genetic material into a miniature swine genome (or a swine genome) or into the genome of a host which receives a swine or a miniature swine graft, e.g., the treatment is one which introduces a new genetic material via retroviral mediated transfer.
[0089]In a preferred embodiment: the purified nucleic acid is a Tsukuba-1 retroviral sequence, probe or primer, e.g., as described herein; the purified nucleic acid is a porcine retroviral sequence, probe or primer, e.g., as described herein; the purified nucleic acid is the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, or a fragment of such sequence or complement at least 10, 20, or 30, basepairs in length.
[0090]In preferred embodiments, the purified nucleic acid has at least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0091]In other preferred embodiments: the purified nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the purified nucleic acid is a full length retroviral genome.
[0092]In preferred embodiments the second nucleic acid is: a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a gag protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 (e.g, from nucleotides 3112-4683) of SEQ ID NO:1, nucleotides 598-2169 (e.g, from nucleotides 598-2169) of SEQ ID NO:2, or nucleotides 585-2156 (e.g, from nucleotides 585-2156) of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a pol protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, nucleotides 2320-4737 of SEQ ID NO:2, or nucleotides 2307-5741 of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a env protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 (e.g, from nucleotides 86-1999) of SEQ ID NO:1, nucleotides 4738-6722 (e.g, from nucleotides 4738-6722) of SEQ ID NO:2, or nucleotides 5620-7533 of SEQ ID NO:3, or naturally occurring mutants thereof.
[0093]In another aspect, the invention features a method of localizing the origin of a porcine retroviral infection. The method includes:
[0094]contacting a target nucleic acid from the graft with a second sequence chosen from the group of: a sequence which can specifically hybridize to a porcine retroviral sequence; a sequence which can specifically hybridize to the sequence of SEQ ID NO:1 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:2 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:3 or its complement; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a gag protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 (e.g, from nucleotides 3112-4683) of SEQ ID NO:1, nucleotides 598-2169 (e.g, from nucleotides 598-2169) of SEQ ID NO:2, or nucleotides 585-2156 (e.g, from nucleotides 585-2156) of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a pol protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, nucleotides 2320-4737 of SEQ ID NO:2, or nucleotides 2307-5741 of SEQ ID NO:3, or naturally occurring mutants thereof;
[0095]a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a env protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 (e.g, from nucleotides 86-1999) of SEQ ID NO:1, nucleotides 4738-6722 (e.g, from nucleotides 4738-6722) of SEQ ID NO:2, or nucleotides 5620-7533 of SEQ ID NO:3, or naturally occurring mutants thereof; a swine or miniature swine retroviral nucleic acid; or a Tsukuba nucleic acid contacting a target nucleic acid from the recipient with a second sequence chosen from the group of: a sequence which can specifically hybridize to a porcine retroviral sequence; a sequence which can specifically hybridize to the sequence of SEQ ID NO:1 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:2 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:3 or its complement; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a gag protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 (e.g, from nucleotides 3112-4683) of SEQ ID NO:1, nucleotides 598-2169 (e.g, from nucleotides 598-2169) of SEQ ID NO:2, or nucleotides 585-2156 (e.g, from nucleotides 585-2156) of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a pol protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, nucleotides 2320-4737 of SEQ ID NO:2, or nucleotides 2307-5741 of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a env protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 (e.g, from nucleotides 86-1999) of SEQ ID NO:1, nucleotides 4738-6722 (e.g, from nucleotides 4738-6722) of SEQ ID NO:2, or nucleotides 5620-7533 of SEQ ID NO:3, or naturally occurring mutants thereof; a swine or miniature swine retroviral nucleic acid; or a Tsukuba nucleic acid; hybridization to the nucleic acid from the graft correlates with the porcine retroviral infection in the graft; and hybridization to the nucleic acid from the recipient correlates with the porcine retroviral infection in the recipient.
[0096]In preferred embodiments, the target nucleic acid includes: genomic DNA, RNA or cDNA, e.g., cDNA made from an RNA template.
[0097]In a preferred embodiment: the second nucleic acid is a porcine retroviral sequence, probe or primer, e.g., as described herein, e.g., a Tsukuba-1 retroviral sequence; the second nucleic acid is a sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, or a fragment of the sequence or complement at least 10, 20, or 30, basepairs in length.
[0098]In preferred embodiments, the recipient is an animal, e.g., a miniature swine, a swine, a non-human primate, or a human.
[0099]In preferred embodiments, the graft is selected from the group consisting of: heart, lung, liver, bone marrow or kidney.
[0100]In preferred embodiments, the second nucleic acid has at least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0101]In other preferred embodiments: the second nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the second nucleic acid is a full length retroviral genome.
[0102]In another aspect, the invention features a method of screening a cell, e.g., a cell having a disorder, e.g., a proliferative disorder, e.g., a tumor cell, e.g., a cancer cell, e.g., a lymphoma or a hepatocellular carcinoma, developing in a graft recipient, e.g., a xenograft, for the presence or expression of a porcine retrovirus or retroviral sequence. The method includes:
[0103]contacting a target nucleic acid from a tumor cell with a second sequence chosen from the group of: a sequence which can specifically hybridize to a porcine retroviral sequence; a sequence which can specifically hybridize to the sequence of SEQ ID NO:1 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:2 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:3 or its complement; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a gag protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 (e.g, from nucleotides 3112-4683) of SEQ ID NO:1, nucleotides 598-2169 (e.g, from nucleotides 598-2169) of SEQ ID NO:2, or nucleotides 585-2156 (e.g, from nucleotides 585-2156) of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a pol protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, nucleotides 2320-4737 of SEQ ID NO:2, or nucleotides 2307-5741 of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a env protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 (e.g, from nucleotides 86-1999) of SEQ ID NO:1, nucleotides 4738-6722 (e.g, from nucleotides 4738-6722) of SEQ ID NO:2, or nucleotides 5620-7533 of SEQ ID NO:3, or naturally occurring mutants thereof; a swine or miniature swine retroviral nucleic acid; or a Tsukuba nucleic acid, under conditions in which the sample and the nucleic acid sequence can hybridize, hybridization being indicative of the presence of the endogenous porcine retrovirus or retroviral sequence in the tumor cell.
[0104]In preferred embodiments, the target nucleic acid from a tumor cell includes: genomic DNA, RNA or cDNA, e.g., cDNA made from an RNA template.
[0105]In a preferred embodiment: the second nucleic acid is a porcine retroviral sequence, probe or primer, e.g., as described herein, e.g., a Tsukuba-1 retroviral sequence; the second nucleic acid is a sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, or a fragment of the sequence or complement at least 10, 20, or 30, basepairs in length.
[0106]In preferred embodiments, the second nucleic acid has at least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0107]In other preferred embodiments: the second nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the second nucleic acid is a full length retroviral genome.
[0108]In another aspect, the invention features a method of screening a human subject for the presence or expression of an endogenous porcine retrovirus or retroviral sequence comprising:
[0109]contacting a target nucleic acid derived from the human subject with a second sequence chosen from the group of: a sequence which can specifically hybridize to a porcine retroviral sequence; a sequence which can specifically hybridize to the sequence of SEQ ID NO:1 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:2 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:3 or its complement; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a gag protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 (e.g, from nucleotides 3112-4683) of SEQ ID NO:1, nucleotides 598-2169 (e.g, from nucleotides 598-2169) of SEQ ID NO:2, or nucleotides 585-2156 (e.g, from nucleotides 585-2156) of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a pol protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, nucleotides 2320-4737 of SEQ ID NO:2, or nucleotides 2307-5741 of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a env protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 (e.g, from nucleotides 86-1999) of SEQ ID NO:1, nucleotides 4738-6722 (e.g, from nucleotides 4738-6722) of SEQ ID NO:2, or nucleotides 5620-7533 of SEQ ID NO:3, or naturally occurring mutants thereof; a swine or miniature swine retroviral nucleic acid; or a Tsukuba nucleic acid under conditions in which the sequences can hybridize, hybridization being indicative of the presence of the endogenous porcine retrovirus or retroviral sequence in the human subject.
[0110]In preferred embodiments, the target nucleic acid derived from a human subject is DNA, RNA or cDNA sample, nucleic acid from a blood sample or a tissue sample, e.g., a tissue biopsy sample.
[0111]In preferred embodiments, the human subject is a miniature swine or swine xenograft recipient, or a person who has come into contact with a miniature swine or swine xenograft recipient.
[0112]In preferred embodiments, the second nucleic acid has at least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0113]In other preferred embodiments: the second nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the second nucleic acid is a full length retroviral genome.
[0114]In preferred embodiments: the recipient is tested for the presence of porcine retroviral sequences prior to implantation of swine or miniature swine tissue.
[0115]In another aspect, the invention features a method of screening for viral mutations which modulate, e.g., increase or decrease, susceptibility of a porcine retrovirus to an antiviral agent, e.g., an antiviral antibiotic. The method includes:
[0116]administering a treatment, e.g., an antiviral agent, e.g., an antiviral antibiotic;
[0117]isolating a putative mutant porcine retroviral strain;
[0118]determining a structure of the putative mutant retroviral strain; and
[0119]comparing the structure to SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0120]In another aspect, the invention features a method of screening for viral mutations which modulate, e.g., increase or decrease, susceptibility of a porcine retrovirus to an antiviral agent, e.g., an antiviral antibiotic. The method includes:
[0121]growing the porcine retrovirus in a presence of a treatment, e.g., an antiviral agent, e.g., an antiviral antibiotic; and
[0122]determine the amount of porcine retroviral DNA synthesized by hybridizing the porcine retroviral DNA to a second sequence chosen from the group of: a sequence which can specifically hybridize to a porcine retroviral sequence; a sequence which can specifically hybridize to the sequence of SEQ ID NO:1 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:2 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:3 or its complement; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a gag protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 (e.g, from nucleotides 3112-4683) of SEQ ID NO:1, nucleotides 598-2169 (e.g, from nucleotides 598-2169) of SEQ ID NO:2, or nucleotides 585-2156 (e.g, from nucleotides 585-2156) of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a pol protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, nucleotides 2320-4737 of SEQ ID NO:2, or nucleotides 2307-5741 of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a env protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 (e.g, from nucleotides 86-1999) of SEQ ID NO:1, nucleotides 4738-6722 (e.g, from nucleotides 4738-6722) of SEQ ID NO:2, or nucleotides 5620-7533 of SEQ ID NO:3, or naturally occurring mutants thereof; a swine or miniature swine retroviral nucleic acid; or a Tsukuba nucleic acid.
[0123]In preferred embodiments, the method further includes amplifying the porcine retroviral nucleic acid with primers which specifically hybridize to the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, e.g., by polymerase chain reaction quantitative DNA testing (PDQ).
[0124]In a preferred embodiment: the second nucleic acid is a Tsukuba-1 retroviral sequence, probe or primer, e.g., as described herein; the second nucleic acid is a porcine retroviral sequence, probe or primer, e.g., as described herein; the second nucleic acid is the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0125]In preferred embodiments, the second nucleic acid has at least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0126]In other preferred embodiments: the second nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the second nucleic acid is a full length retroviral genome.
[0127]In another aspect, the invention features a method for screening a porcine-derived product for the presence or expression of a swine or miniature swine retrovirus or retroviral sequence, e.g., an endogenous miniature swine retrovirus. The method includes:
[0128]contacting a target nucleic acid from the porcine-derived product with a second sequence chosen from the group of: a sequence which can specifically hybridize to a porcine retroviral sequence; a sequence which can specifically hybridize to the sequence of SEQ ID NO:1 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:2 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:3 or its complement; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a gag protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 (e.g, from nucleotides 3112-4683) of SEQ ID NO:1, nucleotides 598-2169 (e.g, from nucleotides 598-2169) of SEQ ID NO:2, or nucleotides 585-2156 (e.g, from nucleotides 585-2156) of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a pol protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, nucleotides 2320-4737 of SEQ ID NO:2, or nucleotides 2307-5741 of SEQ ID NO:3, or naturally occurring mutants thereof; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a env protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 (e.g, from nucleotides 86-1999) of SEQ ID NO:1, nucleotides 4738-6722 (e.g, from nucleotides 4738-6722) of SEQ ID NO:2, or nucleotides 5620-7533 of SEQ ID NO:3, or naturally occurring mutants thereof; a swine or miniature swine retroviral nucleic acid; or a Tsukuba nucleic acid, under conditions in which hybridization can occur, hybridization being indicative of the presence or expression of an endogenous miniature swine or swine retrovirus or retroviral sequence s in the porcine-derived product.
[0129]In preferred embodiments the product is: a protein product, e.g., insulin; a food product; or a cellular transplant, e.g., a swine or miniature swine cell which is to be transplanted into a host, e.g., a swine or miniature swine cell which is genetically engineered to express a desired product,
[0130]In preferred embodiments, the method further includes amplifying the target nucleic acid with primers which specifically hybridize to the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0131]In other preferred embodiments, the target nucleic acid is: DNA; RNA; or cDNA.
[0132]In preferred embodiments, the second nucleic acid has at least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0133]In other preferred embodiments: the second nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the second nucleic acid is a full length retroviral genome.
[0134]In another aspect, the invention features a transgenic miniature swine or swine having a transgenic element, e.g., a base change, e.g., a change from A to G, or an insertion or a deletion of one or more nucleotides at an endogenous porcine retroviral insertion site, e.g., a retroviral insertion which corresponds to the retroviral genome of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0135]In preferred embodiments, the transgenic element is a knockout, e.g., a deletion, insertion or a translocation, of one or more nucleic acids, which alters the activity of the endogenous porcine retrovirus.
[0136]In another aspect, the invention features a method of inhibiting expression of an endogenous porcine retrovirus, including: inserting a mutation, e.g. a deletion into the endogenous retrovirus.
[0137]In preferred embodiments, the endogenous porcine retrovirus is inactivated.
[0138]In preferred embodiments, the mutation can be a point mutation, an inversion, translocation or a deletion of one or more nucleotides of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0139]In another aspect, the invention features a method of detecting a recombinant virus or other pathogen, e.g., a protozoa or fungi. The method includes:
[0140]providing a pathogen having porcine retroviral sequence; and
[0141]determining if the pathogen includes non-porcine retroviral sequence, the presence of non-porcine retroviral sequence being indicative of viral recombination.
[0142]In preferred embodiments, the method further includes determining the structure of a retrovirus by comparing the retrovirus sequence with sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, a difference being indicative of viral recombination.
[0143]In preferred embodiments, the method further includes comparing the structure of the retrovirus with a human retroviral sequence, e.g., HTLV1, HIV1, or HIV2, a similarity in structure being indicative of viral recombination.
[0144]In another aspect, the invention features a method of determining the copy number, size, or completeness of a porcine retrovirus or retroviral sequence, e.g., in the genome of a donor, recipient or a graft. The method includes:
[0145]contacting a target nucleic acid from the donor, recipient or a graft, with a second sequence chosen from the group of: a sequence which can specifically hybridize to a porcine retroviral sequence; a sequence which can specifically hybridize to the sequence of SEQ ID NO:1 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:2 or its complement; a sequence which can specifically hybridize to the sequence of SEQ ID NO:3 or its complement; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a gag protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 (e.g, from nucleotides 3112-4683) of SEQ ID NO:1, nucleotides 598-2169 (e.g, from nucleotides 598-2169) of SEQ ID NO:2, or nucleotides 585-2156 (e.g, from nucleotides 585-2156) of SEQ ID NO:3, or naturally occurring mutants thereof;
[0146]a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a pol protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, nucleotides 2320-4737 of SEQ ID NO:2, or nucleotides 2307-5741 of SEQ ID NO:3, or naturally occurring mutants thereof;
[0147]a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence which encodes a env protein; a nucleic acid of at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 (e.g, from nucleotides 86-1999) of SEQ ID NO:1, nucleotides 4738-6722 (e.g, from nucleotides 4738-6722) of SEQ ID NO:2, or nucleotides 5620-7533 of SEQ ID NO:3, or naturally occurring mutants thereof; a swine or miniature swine retroviral nucleic acid; or a Tsukuba nucleic acid.
[0148]In preferred embodiments, the method further includes amplifying the porcine retroviral nucleic acid with primers which specifically hybridize to the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, e.g., by polymerase chain reaction quantitative DNA testing (PDQ) or nested PCR.
[0149]In preferred embodiments, the target nucleic acid includes: genomic DNA isolated from a miniature swine; RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine; DNA, RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine organ, e.g., a kidney; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a miniature swine organ which has been transplanted into a organ recipient, e.g., a xenogeneic recipient, e.g., a primate, e.g., a human.
[0150]In preferred embodiments, the target nucleic acid includes: genomic DNA isolated from a swine; RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine; DNA, RNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine organ, e.g., a kidney; RNA, DNA or cDNA, e.g., cDNA made from an RNA template, isolated from a swine organ which has been transplanted into a organ recipient, e.g., a xenogeneic recipient, e.g., a primate, e.g., a human.
[0151]In preferred embodiments, the second nucleic acid has at least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with a sequence from SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0152]In other preferred embodiments: the second nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the second nucleic acid is a full length retroviral genome.
[0153]In another aspect, the invention features a method for screening a tissue, e.g., a cellular or tissue transplant, e.g., a xenograft, or a tissue from a graft recipient, for the presence or expression of a swine or a miniature swine retroviral sequence, e.g., an endogenous miniature swine retrovirus. The method includes: contacting a tissue sample with an antibody specific for a retroviral protein, e.g., an anti-gag, pol, or env antibody, and thereby determining if the sequence is present or expressed.
[0154]In preferred embodiments the protein is encoded by a sequence from: the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0155]In preferred embodiments, the tissue is selected from the group consisting of: heart, lung, liver, bone marrow, kidney, brain cells, neural tissue, pancreas or pancreatic cells, thymus, or intestinal tissue.
[0156]A "purified preparation" or a "substantially pure preparation" of a polypeptide as used herein, means a polypeptide which is free from one or more other proteins, lipids, and nucleic acids with which it naturally occurs. Preferably, the polypeptide, is also separated from substances which are used to purify it, e.g., antibodies or gel matrix, such as polyacrylamide. Preferably, the polypeptide constitutes at least 10, 20, 50 70, 80 or 95% dry weight of the purified preparation. Preferably, the preparation contains: sufficient polypeptide to allow protein sequencing; at least 1, 10, or 100 μg of the polypeptide; at least 1, 10, or 100 mg of the polypeptide.
[0157]Specifically hybridize, as used herein, means that a nucleic acid hybridizes to a target sequence with substantially greater degree than it does to other sequences in a reaction mixture. By substantially greater means a difference sufficient to determine if the target sequence is present in the mixture.
[0158]A "treatment", as used herein, includes any therapeutic treatment, e.g., the administration of a therapeutic agent or substance, e.g., a drug or irradiation.
[0159]A "purified preparation of nucleic acid", is a nucleic acid which is one or both of: not immediately contiguous with one or both of the coding sequences with which it is immediately contiguous (i.e., one at the 5' end and one at the 3' end) in the naturally-occurring genome of the organism from which the nucleic acid is derived; or which is substantially free of a nucleic acid sequence or protein with which it occurs in the organism from which the nucleic acid is derived. The term includes, for example, a recombinant DNA which is incorporated into a vector, e.g., into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other DNA sequences. Substantially pure DNA also includes a recombinant DNA which is part of a hybrid gene encoding additional sequences. A purified retroviral genome is a nucleic acid which is substantially free of host nucleic acid or viral protein.
[0160]"Homologous", as used herein, refers to the sequence similarity between two polypeptide molecules or between two nucleic acid molecules. When a position in both of the two compared sequences is occupied by the same amino acid or base monomer subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then the molecules are homologous at that position. The percent of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared×100. For example, if 6 of 10, of the positions in two sequences are matched or homologous then the two sequences are 60% homologous. By way of example, the DNA sequences ATTGCC and TATGGC share 50% homology. Generally, a comparison is made when two sequences are aligned to give maximum homology. The term sequence identity has substantially the same meaning.
[0161]The term "provirus" or "endogenous retrovirus," as used herein, refers to an integrated form of the retrovirus.
[0162]The terms "peptides", "proteins", and "polypeptides" are used interchangeably herein.
[0163]As used herein, the term "transgenic element" means a nucleic acid sequence, which is partly or entirely heterologous, i.e., foreign, to the animal or cell into which it is introduced but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted. The term includes elements which cause a change in the sequence, or in the ability to be activated, of an endogenous retroviral sequence. Examples of transgenic elements include those which result in changes, e.g., substitutions (e.g., A for G), insertions or deletions of an endogenous retroviral sequence (or flanking regions) which result in inhibition of activation or misexpression of a retroviral product.
[0164]As used herein, the term "transgenic cell" refers to a cell containing a transgenic element.
[0165]As used herein, a "transgenic animal" is any animal in which one or more, and preferably essentially all, of the cells of the animal includes a transgenic element. The transgenic element can be introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection. This molecule may be integrated within a chromosome, or it may be extrachromosomally replicating DNA.
[0166]As described herein, one aspect of the invention features a pure (or recombinant) nucleic acid which includes a miniature swine (or swine) retroviral genome or fragment thereof, e.g., nucleotide sequence encoding a gag-pol or env polypeptide, and/or equivalents of such nucleic acids. The term "nucleic acid", as used herein, can include fragments and equivalents. The term "equivalent" refers to nucleotide sequences encoding functionally equivalent polypeptides or functionally equivalent polypeptides which, for example, retain the ability to react with an antibody specific for a gag-pol or env polypeptide. Equivalent nucleotide sequences will include sequences that differ by one or more nucleotide substitutions, additions or deletions, such as allelic variants, and will, therefore, include sequences that differ from the nucleotide sequence of gag, pol, or env shown in herein due to the degeneracy of the genetic code.
[0167]"Misexpression", as used herein, refers to a non-wild type pattern of gene expression, e.g., porcine retroviral, e.g., Tsukuba-1 gene expression, e.g., gag, pol or env gene expression. It includes: expression at non-wild type levels, i.e., over or under expression; a pattern of expression that differs from wild type in terms of the time or stage at which the gene is expressed, e.g., increased or decreased expression (as compared with wild type) at a predetermined developmental period or stage; a pattern of expression that differs from wild type in terms of decreased expression (as compared with wild type) in a predetermined cell type or tissue type; a pattern of expression that differs from wild type in terms of the splicing, size, amino acid sequence, post-translational modification, stability, or biological activity of the expressed, porcine retroviral, e.g., Tsukuba-1, polypeptides; a pattern of expression that differs from wild type in terms of the effect of an environmental stimulus or extracellular stimulus on expression of the porcine retroviral, e.g., Tsukuba-1 genes, e.g., a pattern of increased or decreased expression (as compared with wild type) in the presence of an increase or decrease in the strength of the stimulus.
[0168]Methods of the invention can be used with swine or miniature swine.
[0169]Endogenous retrovirus is a potential source of infection not always susceptible to conventional breeding practices. Many proviruses are defective and unable to replicate. Provirus, if intact, can be activated by certain stimuli and then initiate viral replication using the host's cellular mechanisms. Retroviral infection will often not harm the host cell. However, replication of virus may result in viremia, malignant transformation (e.g., via insertion of retroviral oncogenes), degeneration, or other insertional effects (e.g., gene inactivation). The effects of such infection may not emerge for many years. The spectrum of behavior of active lentiviral infection in humans is well described relative to HIV. These include AIDS, unusual infections and tumors, recombinant and other viruses, and antigenic variation which may prevent the generation of protective immunity by the infected host.
[0170]Screening of animals will allow elimination of donors with active replication of known viruses. Inactive proviruses can be detected with genetic probes and removed or inactivated. These novel approaches will allow the identification and elimination of potential human pathogens derived from swine in a manner not possible in the outbred human organ donor population and, thus, will be important to the development of human xenotransplantation.
[0171]The porcine retroviral sequences of the invention are also useful as diagnostic probes to detect activation of endogenous porcine retroviruses following transplantation and xenotransplantation of organs derived from swine or miniature swine. The porcine retroviral sequences of the invention also provide diagnostic tools necessary to assess the risks associated with transplantation of organs from swine or miniature swine into human recipients. These sequences are also useful for the longitudinal evaluation of retroviral activation in the human recipient of miniature swine-derived organs.
[0172]The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are described in the literature. See, for example, Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).
[0173]Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described below. All publications mentioned herein are incorporated by reference. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
DETAILED DESCRIPTION OF THE DRAWINGS
[0174]FIG. 1 is the nucleotide sequence (SEQ ID NO: 1) of the Tsukuba-1 cDNA.
[0175]FIG. 2 is the nucleotide sequence (SEQ ID NO: 2) of a defective retroviral genome isolated from the retrovirus from the PK-15 cell line.
[0176]FIG. 3 is the nucleotide sequence (SEQ ID NO: 3) of a retrovirus found in miniature swine.
DETAILED DESCRIPTION
Miniature Swine Retroviruses
[0177]Transplantation may increase the likelihood of retroviral activation, if intact and infectious proviruses are present. Many phenomena associated with transplantation, e.g., immune suppression, graft rejection, graft-versus-host disease, viral co-infection, cytotoxic therapies, radiation therapy or drug treatment, can promote activation of retroviral expression.
[0178]Many species are thought to carry retroviral sequences in their genomic DNA. The number of intact (complete) retroviral elements that could be activated is often unknown. Once activated, swine-derived viruses would require the appropriate receptor on human tissues to spread beyond the transplanted organ. Most intact endogenous proviruses (usually types B and C), once activated, are not pathogenic. However, coinfection with other viruses, recombination with other endogenous viruses, or modification of viral behavior in the foreign human environment may alter the pathogenicity, organ specificity or replication of the retroviruses or other infectious agents.
[0179]The lack of sequence data on pig viruses has impeded efforts to assess the number of porcine sequences, or porcine retroviral sequences, that have incorporated into the human genome or the frequency of incorporation.
[0180]The inventor, by showing that the Tsukuba-1 retrovirus is found in miniature swine, and by providing the entire sequence of the porcine retroviral (Tsukuba-1) genome, has allowed assessment of the risk of endogenous retroviruses in general clinical practice and more importantly in xenotransplantation.
[0181]The porcine retroviral sequences of the invention can be used to determine the level (e.g., copy number) of intact (i.e., potentially replicating) porcine provirus sequences in a strain of xenograft transplantation donors. For example, the copy number of the miniature swine retroviral sequences can be determined by the Polymerase Chain Reaction DNA Quantitation (PDQ) method, described herein, or by other methods known to those skilled in the art. This quantitation technique will allow for the selection of animal donors, e.g., miniature swine donors, without an intact porcine retroviral sequence or with a lower copy number of viral elements.
[0182]The porcine retroviral sequences of the invention can be used to determine if mutations, e.g., inversions, translocations, insertions or deletions, have occurred in the endogenous porcine retroviral sequence. Mutated viral genomes may be expression-deficient. For example, genetic lesions can be identified by exposing a probe/primer derived from porcine retrovirus sequence to nucleic acid of the tissue (e.g., genomic DNA) digested with a restriction endonucleases or by in situ hybridization of the probe/primer derived from the porcine retroviral sequence to the nucleic acid derived from donor, e.g., miniature swine, tissue. Alternatively, direct PCR analysis, using primers specific for porcine retroviral genes (e.g., genes comprising the nucleotide sequence shown in SEQ ID NO: 1, 2, or 3), can be used to detect the presence or absence of the genetic lesion in the porcine retroviral genome.
[0183]Miniature swine retroviral sequences of the invention can also be use to detect viral recombinants within the genome, or in the circulation, cells, or transplanted tissue, between the porcine retrovirus and other endogenous human viruses or opportunistic pathogens (e.g. cytomegalovirus) of the immunocompromised transplant recipient. For example, pieces of the viral genome can be detected via PCR or via hybridization, e.g., Southern or Northern blot hybridization, using sequences derived from SEQ ID NO: 1, 2, or 3 as primers for amplification or probes for hybridization.
[0184]Miniature swine retroviral sequences of the invention, e.g., PCR primers, allow quantitation of activated virus. Sequences of the invention also allow histologic localization (e.g., by in situ hybridization) of activated retrovirus. Localization allows clinicians to determine whether a graft should be removed as a source of potential retroviral infection of the human host or whether the retroviral infection was localized outside the graft.
[0185]Sequences of the invention, e.g., PCR primers, allow the detection of actively replicating virus, e.g., by using reverse transcribed PCR techniques known in the art. Standard techniques for reverse transcriptase measurements are often complicated, species-specific, and are of low sensitivity and specificity, and false positive results may develop using full-length probes for Southern and Northern molecular blotting. Sequences of the invention allow for sensitive and specific assays for the activation of virus and this will allow performance of a wide variety of tests, some of which are outlined below.
[0186]The invention provides for the testing and development of donor animals having reduced numbers of intact proviral insertions. It also provides for the testing of immunosuppressive regimens less likely to provide the conditions for active replication of retrovirus. Conditions likely to activate one retrovirus are generally more likely to activate other viruses including unknown retroviruses and known human pathogens including cytomegalovirus, hepatitis B and C viruses, Human Immunodeficiency Viruses (I and II). Given the availability of preventative therapies for these infections, these therapies could be used prophylactically in patients known to be susceptible to the activation of porcine retrovirus.
[0187]The miniature swine retroviral sequences of the invention can be used to measure the response of the miniature swine retroviral infection in humans to therapy, e.g., immunomodulatory or antiviral therapy, e.g., antiviral agents, e.g., antiviral antibiotics. With HIV, susceptibility to antiviral antibiotics is determined by the genetic sequence of the reverse transcriptase gene (RT pol region) and other genes. The ability to determine the exact sequence of the retroviral genes will allow the detection of mutations occurring during infection which would then confer resistance of this virus to antiviral agents. Primers, e.g., for the RT-pol region, of the invention can be used to detect and to sequence clinical viral isolates from patients which have developed mutations by PDQ method described herein. The primers of the invention can also be used to determine whether tumor cells, e.g., cancer cells, e.g. lymphoma or hepatocellular carcinoma, developing in xenograft recipients contain porcine retroviral elements.
[0188]The porcine retroviral sequences of the invention can also be used to detect other homologous retroviruses and to determine whether these are the same or different as compared to the Tusukuba-1 retroviral sequences. For example, within a species, the polymerase genes are highly conserved. PCR assays aimed at the gag-pol region followed by sequence analysis allow for this detection of homologous viruses. The appropriate regions of the Tsukuba-1 virus can be determined by using sequences derived from SEQ ID NO:1, described herein, to identify additional 5' and 3' viral genomic sequences. As is discussed elsewhere herein, the sequences from SEQ ID NO: 1 were used to obtain the sequence of the PK-15 retroviral insert (SEQ ID NO:2) and of a retroviral insertion in a miniature swine (SEQ ID NO:3).
[0189]Miniature swine retroviral sequences of the invention can be used to screen donor animals and xenograft recipients after transplantation both for infection, and as a measure of the appropriate level of immune suppression, regarding susceptibility to infection. Physicians, medical staff, family, or individuals who come into contact with graft recipients, and others, can be screened for infection with virus derived from the xenograft recipient. Members of the population in general can also be screened. Such screening can be used for broad epidemiologic studies of the community. These methods can help in meeting the requirements of the F.D.A. regarding enhancing the safety of the recipients and of the community to exposure to new viruses introduced into the community by xenograft transplantation.
[0190]As is shown in Suzuka et al., 1986, FEBS 198:339, the swine retroviruses such as the Tsukuba-1 genome can exist as a circular molecule. Upon cloning the circular molecule is generally cleaved to yield a linear molecule. As will be understood by one skilled in the art, the start point and end point of the resulting linear molecule, and the relative subregions of the viral sequence will of course vary with the point of cleavage. For example, in the Suzuka et al. reference the LTR is shown to be in an internal fragment. This is indicated herein in that the order of gag, pol, env in SEQ ID NO 1 is shown as env, gag, pol, while elsewhere herein the order of these regions is given as the naturally occurring gag, pol, env order.
Primers Derived from the Porcine Retroviral (Tsukuba-1) Genome Sequence
[0191]A number of different primers useful in the methods of the invention have been described herein. One skilled in the art can identify additional primers from the viral sequence of SEQ ID NO:1 by using methods known in the art. For example, when trying to identify potentially useful primers one skilled in the art would look for sequences (sequences should be between about 15 and 30 nucleotides in length) which hybridize to SEQ ID NO:1 with high melting temperature; have a balanced distribution of nucleotides, e.g., a balanced distribution of A, T, C and Gs; have a terminal C or G; do not self-hybridize or internally complement.
Use of Primers Derived from the Porcine Retroviral (Tsukuba-1) Genome-Sequence
[0192]I. Testing of Organs or Cells Prior to Transplantation
[0193]Potential donor animals can be screened for active retroviral replication prior to being used in transplantation. This allows avoidance of animals undergoing active viral replication. Replicating virus is often infectious in 100% of recipients, while nonreplicating, latent provirus generally causes infection in 5 to 25% of recipients.
[0194]II. Testing of Recipients
[0195]Serial samples, e.g., of white blood cells, can be obtained from a graft recipient monthly, e.g., for the first month and every three months thereafter. Tissue biopsies obtained for evaluation of graft function can be used to evaluate the activation of retroviral sequences or of the expression retroviral sequences in graft tissue. Samples can be screened for the presence of retrovirus infection both specifically for the homologous virus, for viral recombinants containing portions of the viral genome, and for other retroviruses, using, e.g., PCR primers for the pol region of the virus, which is the region most likely to be conserved. If virus is detected, quantitative PCR can be used to determine the relative stability of viral production. Cells isolated from xenograft recipients can be tested by cocultivation with permissive human and porcine (e.g., pig fallopian tube, pig macrophage, or pig testis) cell lines known to contain endogenous viruses. Isolated virus will be tested for homology with the parental strain and for mutations which might affect susceptibility to antiviral agents, e.g., antiviral antibiotics.
[0196]III. Testing of Surgical and Medical Personnel and Family Members of Graft Recipient
[0197]Samples, e.g., white blood cells, can be banked (archived) from the surgical and medical personnel and from family members of the recipient prior to transplantation and at three months intervals for the first year and at least annually thereafter. Epidemiologic studies can be performed on these samples as well. These samples can be tested if the recipient becomes viremic or if unusual clinical manifestations are noted in these individuals.
[0198]IV. Testing of Tumor Cells
[0199]Tumor cells which develop from a graft, or a graft recipient, can be tested for the presence of active retrovirus and for proviruses.
[0200]V. Testing of Patients
[0201]Patients can be retested for any significant change in clinical condition or for increased immune suppression of graft rejection which may be associated with an increased risk of viral activation.
Sequencing of the Porcine Retroviral (Tsukuba-1) Genome
[0202]A clone (Pλ8.8) containing the 8060 bp XhoI porcine retrovirus (Tsukuba-1) insert was used to transfect competent E. coli, and DNA was isolated for sequencing. The strategy used to sequence the 8060 bp porcine retrovirus genome included a combination of procedures which are outlined below.
[0203]Random fragments (1-3 kb) of the clone (Pλ8.8) were generated by sonication. The fragments were blunt-ended and were subcloned into the EcoRV site of the pBluescript SK vector. Plasmid DNA was prepared using a modified alkaline lysis procedure. DNA sequencing was performed using DyeDeoxy termination reactions (ABI). Base specific fluorescent dyes were used as labels. Sequencing reactions were analyzed on 4.75% polyacrylamide gels by an ABI 373A-S or 373S automated sequencer. Subsequent data analysis was performed on Sequencer® 3.0 software. The following internal sequencing primers were synthesized:
TABLE-US-00001 AP1 5' GATGAACAGGCAGACATCTG 3' (SEQ ID NO:48) AP2 5' CGCTTACAGACAAGCTGTGA 3' (SEQ ID NO:49) AP3 5' AGAACAAAGGCTGGGAAAGC 3' (SEQ ID NO:50) AP4 5' ATAGGAGACAGCCTGAACTC 3' (SEQ ID NO:51) AP5 5' GGACCATTGTCTGACCCTAT 3' (SEQ ID NO:52) AP6 5' GTCAACACCTATACCAGCTC 3' (SEQ ID NO:53) AP7 5' CATCTGAGGTATAGCAGGTC 3' (SEQ ID NO:54) AP8 5' GCAGGTGTAGGAACAGGAAC 3' (SEQ ID NO:55) AP9 5' ACCTGTTGAACCATCCCTCA 3' (SEQ ID NO:56) AP10 5' CGAATGGAGAGATCCAGGTA 3' (SEQ ID NO:57) AP11 5' CCTGCATCACTTCTCTTACC 3' (SEQ ID NO:58) AP12 5' TTGCCTGCTGCTGGAATACG 3' (SEQ ID NO:59) AP13 5' CAAGAGAAGAAGTGGGGAATG 3' (SEQ ID NO:60) AP14 5' CACAGTCGTACACCACGCAG 3' (SEQ ID NO:61) AP15 5' GGGAGACAGAAGAAGAAAGG 3' (SEQ ID.NO:62) AP16 5' CGATAGTCATTAGTCCCAGG 3' (SEQ ID NO:63) AP17 5' TGCTGGTTTGCATCAAGACCG 3' (SEQ ID NO:64) AP18 5' GTCGCAAAGGCATACCTGCT 3' (SEQ ID NO:65) AP19 5' ACAGAGCCTCTGCTAAGAAG 3' (SEQ ID NO:66) AP20 5' GCAGCTGTTGACAATCATC 3' (SEQ ID NO:67) AP21 5' TATGAGGAGAGGGCTTGACT 3' (SEQ ID NO:68) AP22 5' AGCAGACGTGCTAGGAGGT 3' (SEQ ID NO:69) AP23 5' TCCTCTTGCTGTTTGCATC 3' (SEQ ID NO:70) AP24 5' CAGACACTCAGAACAGAGAC 3' (SEQ ID NO:71) AP25 5' ACATCGTCTAACCCACCTAG 3' (SEQ ID NO:72) AP26 5' CTCGTTTCTGGTCATACCTGA 3' (SEQ ID NO:73) AP27 5' GAGTACATCTCTCTAGGCA 3' (SEQ ID NO:74) AP28 5' TGCCTAGAGACATGTACTC 3' (SEQ ID NO:4) AP29 5' CCTCTTCTAGCCATTCCTTCA 3' (SEQ ID NO:5)
The clone (Pλ8.8) containing the 8060 bp XhoI porcine retrovirus (Tsukuba-1) insert was deposited with ATCC on Dec. 27, 1995 (ATCC Deposit No. 97396).
Determination of the Porcine Retroviral (Tsukuba-1) Copy Number in a Miniature Swine
[0204]Total genomic DNA was isolated from miniature swine kidney by the methods known in the art. The isolated genomic DNA was digested with either EcoRI or HindIII restriction enzyme. The DNA digests were electrophoresed on an agarose gel, Southern blotted and hybridized to the full-length, purified, Tsukuba-1 sequence (SEQ ID NO:1) under high stringency conditions (0.1×SSC, 65° C.). In both digested samples (EcoRI or HindIII) at least six copies of the high molecular fragments of the miniature swine genome (over 16 Kb in size) hybridized to SEQ ID NO:1, indicating the presence of homologous retroviral sequences in porcine DNA.
Susceptibility Testing by Polymerase Chain Reaction DNA Quantitation (PDQ)
[0205]Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing can be used to rapidly and directly measure nucleoside sensitivity of porcine retrovirus isolates. PCR can be used to quantitate the amount of porcine retroviral RNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of porcine retroviral RNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. With the PDQ method both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells.
[0206]The PDQ experiments can be performed essentially as described by Eron et al., PNAS USA 89:3241-3245, 1992. Briefly, aliquots (150 μl) of serial dilutions of virus sample can be used to infect 2×106 PHA-stimulated donor PBMCs in 1.5 ml of growth medium per well of a flat-bottom 24-well plate (Corning). Separate cell samples can be counted, harvested, and lysed at 48, 72 and 96 hr. Quantitative PCR and porcine retrovirus copy-number determination can then be performed in duplicate on each lysate.
[0207]The results of a PDQ infectivity titration assay can be used to determine the virus dilution and length of culture time employed in a subsequent PDQ susceptibility test. These parameters should be chosen so that the yield of porcine retrovirus specific PCR product for the untreated control infection would fall on the porcine retrovirus copy-number standard curve before the curve approached its asymptotic maximum, or plateau. PHA-stimulated donor PBMCs can be incubated with drug for 4 hr prior to infection. Duplicate wells in a 24-well plate should receive identical porcine retrovirus inocula for each drug concentration tested and for the untreated infected controls. Uninfected controls and drug toxicity controls should be included in each experiment. All cultures can be harvested and cells lysed for PCT after either 48 or 72 hr. Previously characterized isolates can be used as assay standards in each experiment.
[0208]Cell pellets can be lysed in various volumes of lysis buffer (50 mM KCl/10 mM Tris.HCl, pH 8.3/2.5 mM MgCl2/0.5% Nonidet P-40/0.5% Tween 20/0.01% proteinase K) to yield a concentration of 1.2×104 cell equivalents/μl. Uniformity to cell lysate DNA concentrations should be confirmed in representative experiments by enhancement of Hoechst 33258 fluorescence (Mini-Fluorometer, Hoefer).
[0209]A conserved primer pair can be synthesized according to the pol gene sequences. The primers can than be used to amplify a 1580-base pair fragment of the porcine retrovirus pol gene from 1.2×105 cell equivalents of lysate by using PCR (GeneAmp, Cetus) under standard conditions. Amplifications should be repeated if porcine retrovirus DNA is amplifiable from reagent controls.
[0210]Porcine retrovirus pol gene amplification products can be specifically detected and quantitated as described (Conway, B. C. (1990) in Techniques in HIV Research, (Aldovani & Walker, eds.) (Stockton, N.Y.) pp. 40-46). Heat-denatured PCR products can be hybridized in a Streptavidin-coated microtiter plate well with both biotinylated capture probe and horseradish peroxidase (HRP)-labeled detector probe [enzyme-linked oligonucleotide solution sandwich hybridization assay ((ELOSA), DuPont Medical Products, Billerica, Mass.) for 60 min at 37° C. After extensive washing to remove all reactants except probe-DNA hybrids, an HRP chromogen, tetramethylbenzidine (TMBlue, Transgenic Sciences, Worcester, Mass.), should be added to each well. The HRP-catalyzed color development should be stopped after 1 hr by addition of sulfuric acid to 0.65 M. Absorbance (OD) at 450 nm can be measured in an automated microtiter plate reader (SLT Labinstruments, Hillsborough, N.C.).
[0211]A standard curve of porcine retrovirus DNA copy number can be generated in each PCR by using a dilution series of cells containing one porcine proviral genome per cell.
Preparation of a Miniature Swine Having a Knockout of Tsukuba-1 Viral Sequence Using Isogenic DNA Targeting Vectors
[0212]Isogenic DNA, or DNA that is substantially identical in sequence between the targeting vector and the target DNA in the chromosomes, greatly increases the frequency for homologous recombination events and gene targeting efficiency. Using isogenic-DNA targeting vectors, targeting frequencies of 80% or higher can be achieved in mouse embryonic stem cells. This is in contrast to non-isogenic DNA vectors which normally yield targeting frequencies of around 0.5% to 5%, i.e., approximately two orders of magnitude lower than isogenic DNA vectors. Isogenic DNA constructs are predominantly integrated into chromosomes by homologous recombination rather than random integration. As a consequence, targeted mutagenesis of viral sequences, e.g., viral genes, can be carried out in biological systems including zygotes, which do not lend themselves to the use of elaborate selection protocols, resulting in production of animals, e.g., miniature swine, free of, or having a reduced number of, activatable viral sequences. In order for the isogenic DNA approach to be feasible, targeting vectors should be constructed from a source of DNA that is identical to the DNA of the organism to be targeted. Ideally, isogenic DNA targeting is carried out in inbred strains of animals, e.g., inbred miniature swine, in which all genetic loci are homozygous. Any animal of that strain can serve as a source for generating isogenic targeting vectors. This protocol for isogenic gene targeting is outlined in TeRiele et al., PNAS 89:5128-5132, 1992 and PCT/US92/07184, herein incorporated by reference. A protocol for producing Tsukuba-1 knockout miniature swine is described briefly below.
[0213]An insertion vector is designed as described by Hasty and Bradley (Gene Targeting Vectors for Mammalian Cells, in Gene Targeting: A Practical Approach, ed, Alexandra L. Joyner, IRL Press 1993). Insertion vectors require that only one crossover event occur for integration by homologous recombination into the native locus. The double strand breaks, the two ends of the vector which are known to be highly recombinogenic, are located on adjacent sequences on the chromosome. The targeting frequencies of such constructions will be in the range of 30 to 50%. One disadvantage of insertion vectors, in general, concerns the sequence duplications that are introduced and that potentially make the locus unstable. All these constructions are made using standard cloning procedures.
[0214]Replacement vectors have also been extensively described by Hasty and Bradley. Conceptually more straight forward than the insertion vector, replacement vectors use an essentially co-linear fragment of a stretch of Tsukuba-1 genomic sequence. Preferably, the DNA sequence from which an isogenic replacement vector is constructed includes approximately 6 to 10 kb of uninterrupted DNA. Two crossovers, one on either side of the selectable marker causes the mutant targeting vector to become integrated and replace the wild-type gene.
[0215]Microinjection of the isogenic transgene DNA into one of the pronuclei of a porcine embryo at the zygote stage (one-cell embryo) is accomplished by modification of a protocol described earlier (Hammer et al. 1985, Nature 315, 680; Pursel et al. 1989, Science 244, 1281). The age and the weight of the donor pigs, e.g., haplotype specific mini-swine, are critical to success. Optimally, the animals are of age 8 to 10 months and weigh 70 to 85 lbs. This increases the probability of obtaining an adequate supply of one-cell embryos for microinjection of the transgenes. In order to allow for accurate timing of the embryo collections at this stage from a number of embryo donors, the gilts are synchronized using a preparation of synthetic progesterone (Regumate). Hormone implants are applied to designated gilts 30 days prior to the date of embryo collection. Twenty days later, ten days prior to the date of collection, the implants are removed and the animals are treated with additional hormones to induce superovulation to increase the number of embryos for microinjection. Three days following implant removal, the animals are treated with 400 to 1000 IU of pregnant mare serum gonadotropin (PMSG) and with 750 IU of human chorionic gonadotropin (hCG) three to four days later. These animals are bred by artificial insemination (AI) on two consecutive days following injection of hCG.
[0216]Embryo collections are performed as follows: three days following the initial injection of hCG, the animals are anesthetized with an intramuscular injection of Telazol (3 mg/lb), Rompum (2 mg/lb) and Atropine (1 mg/lb). A midline laparotomy is performed and the reproductive tract exteriorized. Collection of the zygotes is performed by cannulating the ampulla of the oviduct and flushing the oviduct with 10 to 15 ml phosphate buffered saline, prewarmed to 39° C. Following the collection the donor animals are prepared for recovery from surgery according to USDA guidelines. Animals used twice for embryo collections are euthanized according to USDA guidelines.
[0217]Injection of the transgene DNA into the pronuclei of the zygotes is carried out as summarized below: Zygotes are maintained in medium HAM F-12 supplemented with 10% fetal calf serum at 38° C. in 5% CO2 atmosphere. For injection the zygotes are placed into BMOC-2 medium, centrifuged at 13,000 g to partition the embryonic lipids and visualize the pronuclei. The embryos are placed in an injection chamber (depression slide) containing the same medium overlaid with light paraffin oil. Microinjection is performed on a Nikon Diaphot inverted-microscope equipped with Nomarski optics and Narishige micromanipulators. Using 40× lens power the embryos are held in place with a holding pipette and injected with a glass needle which is back-filled with the solution of DNA containing the transgenic element, e.g., a mutant viral gene (2 μg/ml). Injection of approximately 2 picoliters of the solution (4 femptograms of DNA), which is equivalent to around 500 copies of the transgenic element, e.g., a mutant viral gene, is monitored by the swelling of the pronucleus by about 50%. Embryos that are injected are placed into the incubator prior to transfer to recipient animals.
[0218]Recipient animals are prepared similarly to the donor animals, but not superovulated. Prior to the transfer of the injected embryos, recipient gilts are anesthetized, the abdomen opened surgically by applying a longitudinal incision and the ovaries exteriorized. The oviduct ipsilateral to the ovary with the larger number of corpus lutei is flushed, the embryos checked to evaluate if the animals is reproductively sound. Approximately 4 to 6 zygotes injected with the transgenic element, e.g., a mutant viral gene, are transferred to the flushed oviduct, the abdominal incision sutured and the animals placed in a warm area for recovery. The status of the pregnancy is monitored by ultrasound starting at day 25, or approximately one week following the expected date of implantation. Pregnant recipients are housed separately until they are due to farrow.
[0219]Newborn piglets are analyzed for integration of the transgenic element into chromosomal DNA. Genomic DNA is extracted from an ear punch or a blood sample and initial screening is performed using PCR. Animals that are potentially transgenic element-positive are confirmed by Southern analysis. Transgenic founder animals are subjected to further analysis regarding the locus of transgenic element integration using Southern analysis.
The Isolation and Sequencing of an Endogenous Swine Retroviral Insert and of a Retroviral Insert in Porcine PK-15 Cells
Cloning of PK15 and PAL Endogenous Retroviruses
I. Poly A+RNA Isolation
[0220]Peripheral blood lymphocytes (PBLs) were prepared from haplotype d/d miniswine using standard protocols known in the art. The PBLs were cultured in the presence of 1% phytohemagglutinin (PHA) for about 84 hours. The activated PBLs were collected and total RNA was isolated using commercially available kits, such at Gentra's (Minneapolis, Minn.) PUREscript Kit. Poly A+RNA was isolated from the total RNA using another commercially available product, Dynal Dynabeads (Lake Success, N.Y.). Northern analysis of the RNA using a pig retroviral probe confirmed the presence of potentially full-length retroviral genome RNA. RNA from PK15 cells was isolated using similar protocols.
II. Construction of the cDNA Libraries
[0221]Using Superscript Choice System (Life Technologies Ltd, Gibco BRL, Gaithersburg, Md.) for cDNA Synthesis, a cDNA library was constructed using oligo dT to make the first strand cDNA. The use of Superscript reverse transcriptase was important in order to obtain full-length retroviral (RV) cDNAs, due to the length of the RV RNA. The cDNA library was enriched for large cDNA fragments by size selecting >4 kb fragments by gel electrophoresis. The cDNAs were cloned into Lambda ZAP Express (Clontech Laboratories, Inc. Palo Alto, Calif.), which is one of the few commercially available cDNA vectors that would accept inserts in the 1-12 kb range.
III. Screening of the cDNA Libraries
[0222]0.75-1.2×106 independent clones were screened using either gag and pol or gag and env probes. Double positive clones were further purified until single isolates were obtained (1 or 2 additional rounds of screening).
IV. Characterization of the Clones
[0223]Between 18 and 30 double positive clones were selected for evaluation. Lambda DNA was prepared using standard protocols, such as the Lambda DNA Kit (Qiagen Inc., Chatsworth, Calif.). The clones were analyzed by PCR to check for (a) RV genes, and (b) determine the size of insert and LTR regions. Restriction digests were also done to confirm the size of insert and to attempt to categorize the clones. Clones containing the longest inserts and having consistent and predicted PCR data were sequenced.
Development of a PCR-Based Assay for the Detection of the Presence of an Endogenous Retrovirus in Cells, Tissues, Organs, Miniswine or Recipient Hosts (e.g., Primates, Humans)
[0224]Using a commercially available computer software program (such as RightPrimer, Oligo 4.0, MacVector or Geneworks), one can analyze sequences disclosed herein for the selection of PCR primer pairs. The criteria for the general selection of primer pairs includes:
[0225]a. The Tm of each primer is between 65-70° C.
[0226]b. The Tm's for each pair differ by no more than 3° C.
[0227]c. The PCR fragment is between 200-800 bp in length
[0228]d. There are no repeats, self complementary bases, primer-dimer issues, etc for each pair
A. Additional Criteria for: a Pig-Specific PCR Assay
[0229]a. Primers are selected within porcine-specific regions of the sequence--such as within gag, env, or U3. Porcine-specific primers are defined as sequences which overall have <70% homology to the corresponding region in human, mouse and primate retroviruses. In addition, the last five bases at the 3' end of the primer should be unique to the pig retroviral sequence.
[0230]b. Primers should have no more than one or two mismatched bases based on the miniswine, and retroviral sequences disclosed herein. These mismatched bases should not be within the last three or four bases of the 3' end of the primer.
B. Additional Criteria for: Miniswine-Specific PCR Assay
[0231]a Primers are selected such that there are at least one or two mismatches between miniswine and domestic pig sequences. At least one of these mismatches should be located within the last three or four bases at the 3' end of the primer. Preferably, these mismatches would be a change from either a G or C in miniswine to either an A or T in domestic pig.
RT-PCR Strategy
[0232]There are a number of commercially available RT-PCR Kits for routine amplification of fragments. Several primer pairs should be tested to confirm Tm and specificity. Location of primers within the sequence depends in part on what question is being answered. RT-PCR should answer questions about expression and presence of RV sequences. PCR will not necessarily answer the question of whether the retroviral sequence is full-length or encodes a replication competent retrovirus. A positive signal in these tests only says there is RV sequence present. Indication of the possibility of full-length viral genomes being present can be obtained by performing long PCR using primers in U5 and U3. A commercial kit for long RT-PCR amplification is available (Takara RNA LA PCR Kit). Confirmation of full-length viral genomes requires infectivity studies and/or isolation of viral particles.
[0233]Northern analyses would complement RT-PCR data. Detection of bands at the predicted size of full-length viral genomes with hybridization probes from env, U3 or U5 would provide stronger evidence. The presence of other small bands hybridizing would indicate the amount of defective viral fragments present.
ELISA-Based Assay to Detect the Presence of Porcine Retroviral Proteins, Polypeptides or Peptides
[0234]In addition to the use of nucleic acid-based, e.g., PCR-based assays, to detect the presence of retroviral sequences, ELISA based assays can detect the presence of porcine retroviral proteins, polypeptides and peptides.
[0235]The basic steps to developing an ELISA include (a) generation of porcine retroviral specific peptides, polypeptides and proteins; (b) generation of antibodies which are specific for the porcine retroviral sequences; (c) developing the assay.
[0236]Using the retroviral sequences disclosed herein, antigenic peptides can be designed using computer based programs such as MacVector or Geneworks to analyse the retroviral sequences. Alternatively, it is possible to express the porcine retroviral sequences in gene expression systems and to purify the expressed polypeptides or proteins. After synthesis, the peptides, polypeptides or proteins are used to immunize mice or rabbits and to develop serum containing antibodies.
[0237]Having obtained the porcine retroviral specific antibodies the ELISA can be developed as follows. ELISA plates are coated with a volume of polyclonal or monoclonal antibody (capture antibody) which is reactive with the analyte to be tested. Such analytes include porcine retroviruses or retroviral proteins such as env or p24. The ELISA plates are then incubated at 4° C. overnight. The coated plates are then washed and blocked with a volume of a blocking reagent to reduce or prevent non-specific hybridization. Such blocking reagents include bovine serum albumin (BSA), fetal bovine serum (FBS), milk, or gelatin. The temperature for the blocking process is 37° C. Plates can be used immediately or stored frozen at -20° C. until needed. The plates are then washed, loaded with a serial dilution of the analyte, incubated at 37° C., and washed again. Bound analyte is detected using a detecting antibody. Detecting antibodies include enzyme-linked, fluoresceinated, biotin-conjugated or other tagged polyclonal or monoclonal antibodies which are reactive with the analyte. If monoclonal antibodies are used the detecting antibody should recognize an epitope which is different from the capture antibody.
OTHER EMBODIMENTS
[0238]In another aspect, the invention provides a substantially pure nucleic acid having, or comprising, a nucleotide sequence which encodes a swine or miniature swine, e.g., a Tsukuba-1 retroviral gag polypeptide.
[0239]In preferred embodiments: the nucleic acid is or includes the nucleotide sequence from nucleotides 2452-4839 of SEQ ID NO:1; the nucleic acid is at least 60%, 70%, 80%, 90%, 95%, 98%, or 99% homologous with a nucleic acid sequence corresponding to nucleotides 2452-4839 of SEQ ID NO:1; or by a sequence which, hybridizes under high stringency conditions to nucleotides 2452-4839 of SEQ ID NO:1; the nucleic acid includes a fragment of SEQ ID NO:1 which is at least 25, 50, 100, 200, 300, 400, 500, or 1,000 bases in length; the nucleic acid differs from the nucleotide sequence corresponding to nucleotides 2452-4839 of SEQ ID NO: 1 due to degeneracy in the genetic code; the nucleic acid differs from the nucleic acid sequence corresponding to nucleotides 2452-4839 of SEQ ID NO:1 by at least one nucleotide but by less than 5, 10, 15 or 20 nucleotides and preferably which encodes an active peptide.
[0240]In yet another preferred embodiment, the nucleic acid of the invention hybridizes under stringent conditions to a nucleic acid probe corresponding to at least 12 consecutive nucleotides from nucleotides 2452-4839 of SEQ ID NO:1, or more preferably to at least 20 consecutive nucleotides from nucleotides 2452-4839 of SEQ ID NO:1, or more preferably to at least 40 consecutive nucleotides from nucleotides 2452-4839 of SEQ ID NO:1.
[0241]In another aspect, the invention features, a purified recombinant nucleic acid having at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% homology with a nucleotide sequence corresponding to nucleotides 2452-4839 of SEQ ID NO:1.
[0242]The invention also provides a probe or primer which includes or comprises a substantially purified oligonucleotide. The oligonucleotide includes a region of nucleotide sequence which hybridizes under stringent conditions to at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2452-4839 of SEQ ID NO:1, or naturally occurring mutants thereof. In preferred embodiments, the probe or primer further includes a label attached thereto. The label can be, e.g., a radioisotope, a fluorescent compound, an enzyme, and/or an enzyme co-factor. Preferably the oligonucleotide is at least 10 and less than 20, 30, 50, 100, or 150 nucleotides in length. Preferred primers of the invention include oligonucleotides having a nucleotide sequence shown in any of SEQ ID NOs:32-37.
[0243]The invention involves nucleic acids, e.g., RNA or DNA, encoding a polypeptide of the invention. This includes double stranded nucleic acids as well as coding and antisense single strands.
[0244]In another aspect, the invention provides a substantially pure nucleic acid having, or comprising, a nucleotide sequence which encodes a swine or miniature swine, e.g., a Tsukuba-1 retroviral pol polypeptide.
[0245]In preferred embodiments: the nucleic acid is or includes the nucleotide sequence corresponding to nucleotides 4871-8060 of SEQ ID NO:1; the nucleic acid is at least 60%, 70%, 80%, 90%, 95%, 98%, or 99% homologous with a nucleic acid sequence corresponding to nucleotides 4871-8060 of SEQ ID NO:1; or by a sequence which, hybridizes under high stringency conditions to nucleotides 4871-8060 of SEQ ID NO1; the nucleic acid includes a fragment of SEQ ID NO:1 which is at least 25, 50, 100, 200, 300, 400, 500, or 1,000 bases in length; the nucleic acid differs from the nucleotide sequence corresponding to nucleotides 4871-8060 of SEQ ID NO:1 due to degeneracy in the genetic code; the nucleic acid differs from the nucleic acid sequence corresponding to nucleotides 4871-8060 of SEQ ID NO:1 by at least one nucleotide but by less than 5, 10, 15 or 20 nucleotides and preferably which encodes an active peptide.
[0246]In yet another preferred embodiment, the nucleic acid of the invention hybridizes under stringent conditions to a nucleic acid probe corresponding to at least 12 consecutive nucleotides from nucleotides 4871-8060 of SEQ ID NO:1, or more preferably to at least 20 consecutive nucleotides from nucleotides 4871-8060 of SEQ ID NO:1, or more preferably to at least 40 consecutive nucleotides from nucleotides 4871-8060 of SEQ ID NO:1.
[0247]In another aspect, the invention features, a purified recombinant nucleic acid having at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% homology with a nucleotide sequence corresponding to nucleotides 4871-8060 of SEQ ID NO:1.
[0248]The invention also provides a probe or primer which includes or comprises a substantially purified oligonucleotide. The oligonucleotide includes a region of nucleotide sequence which hybridizes under stringent conditions to at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 4871-8060 of SEQ ID NO:1, or naturally occurring mutants thereof. In preferred embodiments, the probe or primer further includes a label attached thereto. The label can be, e.g., a radioisotope, a fluorescent compound, an enzyme, and/or an enzyme co-factor. Preferably the oligonucleotide is at least 10 and less than 20, 30, 50, 100, or 150 nucleotides in length. Preferred primers of the invention include oligonucleotides having a nucleotide sequence shown in any of SEQ ID NOs:38-47.
[0249]The invention involves nucleic acids, e.g., RNA or DNA, encoding a polypeptide of the invention. This includes double stranded nucleic acids as well as coding and antisense single strands.
[0250]In another aspect, the invention provides a substantially pure nucleic acid having, or comprising, a nucleotide sequence which encodes a swine or miniature swine, e.g., a Tsukuba-1 retroviral env polypeptide.
[0251]In preferred embodiments: the nucleic acid is or includes the nucleotide sequence corresponding to nucleotides 2-1999 of SEQ ID NO:1; the nucleic acid is at least 60%, 70%, 80%, 90%, 95%, 98%, or 99% homologous with a nucleic acid sequence corresponding to nucleotides 2-1999 of SEQ ID NO:1; or by a sequence which, hybridizes under high stringency conditions to nucleotides 2-1999 of SEQ ID NO:1; the nucleic acid includes a fragment of SEQ ID NO:1 which is at least 25, 50, 100, 200, 300, 400, 500, or 1,000 bases in length; the nucleic acid differs from the nucleotide sequence corresponding to nucleotides 2-1999 of SEQ ID NO:1 due to degeneracy in the genetic code; the nucleic acid differs from the nucleic acid sequence corresponding to nucleotides 2-1999 of SEQ ID NO:1 by at least one nucleotide but by less than 5, 10, 15 or 20 nucleotides and preferably which encodes an active peptide.
[0252]In yet another preferred embodiment, the nucleic acid of the invention hybridizes under stringent conditions to a nucleic acid probe corresponding to at least 12 consecutive nucleotides from nucleotides 2-1999 of SEQ ID NO:1, or more preferably to at least 20 consecutive nucleotides from nucleotides 2-1999 of SEQ ID NO:1, or more preferably to at least 40 consecutive nucleotides from nucleotides 2-1999 of SEQ ID NO:1.
[0253]In another aspect, the invention features, a purified recombinant nucleic acid having at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% homology with a nucleotide sequence corresponding to nucleotides 2-1999 of SEQ ID NO:1.
[0254]The invention also provides a probe or primer which includes or comprises a substantially purified oligonucleotide. The oligonucleotide includes a region of nucleotide sequence which hybridizes under stringent conditions to at least 10 consecutive nucleotides of sense or antisense sequence from nucleotides 2-1999 of SEQ ID NO:1, or naturally occurring mutants thereof. In preferred embodiments, the probe or primer further includes a label attached thereto. The label can be, e.g., a radioisotope, a fluorescent compound, an enzyme, and/or an enzyme co-factor. Preferably the oligonucleotide is at least 10 and less than 20, 30, 50, 100, or 150 nucleotides in length. Preferred primers of the invention include oligonucleotides having a nucleotide sequence shown in any of SEQ ID NOs:6-31.
[0255]The invention includes nucleic acids, e.g., RNA or DNA, encoding a polypeptide of the invention. This includes double stranded nucleic acids as well as coding and antisense single strands.
[0256]Included in the invention are: allelic variations, natural mutants, induced mutants, that hybridize under high or low stringency conditions to the nucleic acid of SEQ ID NO:1, 2, or 3 (for definitions of high and low stringency see Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989, 6.3.1-6.3.6, hereby incorporated by reference).
[0257]The invention also includes purified preparations of swine or miniature swine retroviral polypeptides, e.g., gag pol, or env polypeptides, or fragments thereof, preferably biologically active fragments, or analogs, of such polypeptides. In preferred embodiments: the polypeptides are miniature swine retroviruses polypeptides; the polypeptides are Tsukuba polypeptides; the polypeptides are gag, pol, or env polypeptides encoded by SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, or naturally occurring variants thereof.
[0258]A biologically active fragment or analog is one having any in vivo or in vitro activity which is characteristic of the Tsukuba-1 polypeptides described herein, or of other naturally occurring Tsukuba-1 polypeptides. Fragments include those expressed in native or endogenous cells, e.g., as a result of post-translational processing, e.g., as the result of the removal of an amino-terminal signal sequence, as well as those made in expression systems, e.g., in CHO cells. A useful polypeptide fragment or polypeptide analog is one which exhibits a biological activity in any biological assay for Tusukuba-1 polypeptide activity. Most preferably the fragment or analog possesses 10%, preferably 40%, or at least 90% of the activity of Tsukuba-1 polypeptides, in any in vivo or in vitro Tsukuba-1 polypeptide assay.
[0259]In order to obtain a such polypeptides, polypeptide-encoding DNA can be introduced into an expression vector, the vector introduced into a cell suitable for expression of the desired protein, and the peptide recovered and purified, by prior art methods. Antibodies to the polypeptides can be made by immunizing an animal, e.g., a rabbit or mouse, and recovering antibodies by prior art methods.
[0260]The invention also features a purified nucleic acid, which has least 60%, 70%, 72%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% or 100% sequence identity or homology with SEQ ID NO:1 or its complement, SEQ ID NO: 2 or its complement, or SEQ ID NO: 3 or its complement.
[0261]In preferred embodiments the nucleic acid is other than the entire retroviral genome of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, e.g., it is at least 1 nucleotide longer, or at least 1 nucleotide shorter, or differs in sequence at least one position. E.g., the nucleic acid is a fragment of the sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, or it includes sequence additional to that of SEQ ID NO:1, or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement.
[0262]In preferred embodiments: the sequence of the nucleic acid differs from the corresponding sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, by 1, 2, 3, 4, or 5 base pairs; the sequence of the nucleic acid differs from the corresponding sequence of SEQ ID NO:1 or its complement, SEQ ID NO:2 or its complement, or SEQ ID NO:3 or its complement, by at least 1, 2, 3, 4, or 5 base pairs but less than 6, 7, 8, 9, or 10 base pairs.
[0263]In other preferred embodiments: the nucleic acid is at least 10, more preferably at least 15, more preferably at least 20, most preferably at least 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length; the nucleic acid is less than 15, more preferably less than 20, most preferably less than 25, 30, 50, 100, 1000, 2000, 4000, 6000, or 8060 nucleotides in length.
EQUIVALENTS
[0264]Those skilled in the art will be able to recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the following claims.
Sequence CWU
1
8218060DNAPorcine endogenous retrovirus 1ctcgagactc ggtggaaggg cccttatctc
gtacttttga ccacaccaac ggctgtgaaa 60gtcgaaggaa tctccacctg gatccatgca
tcccacgtta agccggcgcc acctcccgat 120tcggggtgga aagccgaaaa gactgaaaat
ccccttaagc ttcgcctcca tcgcgtggtt 180ccttactctg tcaataacct ctcagactaa
tggtatgcgc ataggagaca gcctgaactc 240ccataaaccc ttatctctca cctggttaat
tactgactcc ggcacaggta ttaatatcaa 300caacactcaa ggggaggctc ctttaggaac
ctggtggcct gatctatacg tttgcctcag 360atcagttatt cctagtctga cctcaccccc
agatatcctc catgctcacg gattttatgt 420ttgcccagga ccaccaaata atggaaaaca
ttgcggaaat cccagagatt tcttttgtaa 480acaatggaac tgtgtaacct ctaatgatgg
atattggaaa tggccaacct ctcagcagga 540tagggtaagt ttttcttatg tcaacaccta
taccagctct ggacaattta attacctgac 600ctggattaga actggaagcc ccaagtgctc
tccttcagac ctagattacc taaaaataag 660tttcactgag aaaggaaaac aagaaaatat
cctaaaatgg gtaaatggta tgtcttgggg 720aatggtatat tatggaggct cgggtaaaca
accaggctcc attctaacta ttcgcctcaa 780aataaaccag ctggagcctc caatggctat
aggaccaaat acggtcttga cgggtcaaag 840acccccaacc caaggaccag gaccatcctc
taacataact tctggatcag accccactga 900gtctagcagc acgactaaaa tgggggcaaa
actttttagc ctcatccagg gagcttttca 960agctcttaac tccacgactc cagaggctac
ctcttcttgt tggctatgct tagctttggg 1020cccaccttac tatgaaggaa tggctagaag
agggaaattc aatgtgacaa aagaacatag 1080agaccaatgc acatggggat cccaaaataa
gcttaccctt actgaggttt ctggaaaagg 1140cacctgcata ggaaaggttc ccccatccca
ccaacacctt tgtaaccaca ctgaagcctt 1200taatcaaacc tctgaaagtc aatatctggt
acctggttat gacaggtggt gggcatgtaa 1260tactggatta accccttgtg tttccacctt
ggtttttaac caaactaaag atttttgcat 1320tatggtccaa attgttcccc gagtgtatta
ctatcccgaa aaagcaatcc ttgatgaata 1380tgactacaga aatcatcgac aaaagagaga
acccatatct ctgacacttg ctgtgatgct 1440cggacttgga gtggcagcag gtgtaggaac
aggaacagct gccctggtca cgggaccaca 1500gcagctagaa acaggactta gtaacctaca
tcgaattgta acagaagatc tccaagccct 1560agaaaaatct gtcagtaacc tggaggaatc
cctaacctcc ttatctgaag tagtcctaca 1620gaatagaaga gggttagatt tattatttct
aaaagaagga ggattatgtg tagccttgaa 1680ggaggaatgc tgtttttatg tggatcattc
aggggccatc agagactcca tgaacaaact 1740tagagaaagg ttggagaagc gtcgaaggga
aaaggaaact actcaagggt ggtttgaggg 1800atggttcaac aggtctcctt ggttggctac
cctactttct gctttaacag gacccttaat 1860agtcctcctc ctgttactca cagttgggcc
atgtattatt aacaagttaa ttgccttcat 1920tagagaacga ataagtgcag tccagatcat
ggtacttaga caacagtacc aaagcccgtc 1980tagcagggaa gctggccgct agctctacca
gttctaagat tagaactatt aacaagagaa 2040gaagtgggga atgaaaggat gaaaatacaa
cctaagctaa tgagaagctt aaaattgttc 2100tgaattccag agtttgttcc ttataggtaa
aagattaggt tttttgctgt tttaaaatat 2160gcggaagtaa aataggccct gagtacatgt
ctctaggcat gaaacttctt gaaactattt 2220gagataacaa gaaaagggag tttctaactg
cttgtttagc ttctgtaaaa ctggttgcgc 2280cataaagatg ttgaaatgtt gatacacata
tcttggtgac aacatgtctc ccccaccccg 2340aaacatgcgc aaatgtgtaa ctctaaaaca
atttaaatta attggtccac gaagcgcggg 2400ctctcgaagt tttaaattga ctggtttgtg
atattttgaa atgattggtt tgtaaagcgc 2460gggctttgct gtgaacccca taaaagctgt
cccgactcca cactcggggc cgcagtcctc 2520tacccctgcg tggtgtacga ctgtgggccc
cagcgcgctt ggaataaaaa tcctcttgct 2580gtttgcatca agaccgcttc tcgtgagtga
ttaaggggag tcgccttttc cgagcctgga 2640ggttcttttt gctggtctta catttggggg
ctcgtccggg atctgtcgcg gccaccccta 2700acacccgaga accgacttgg aggtaaaaag
gatcctcttt ttaacgtgta tgcatgtacc 2760ggccggcgtc tctgttctga gtgtctgttt
tcagtggtgc gcgctttcgg tttgcagctg 2820tcctctcagg ccgtaagggc tgggggactg
tgatcagcag acgtgctagg aggatcacag 2880gctgctgccc tgggggacgc cccgggaggt
gaggagagcc agggacgcct ggtggtctcc 2940tactgtcggt cagaggaccg aattctgttg
ctgaagcgaa agcttccccc tccgcgaccg 3000tccgactctt ttgcctgctt gtggaatacg
tggacgggtc acgtgtgtct ggatctgttg 3060gtttctgttt tgtgtgtctt tgtcttgtgt
gtccttgtct acagttttaa tatgggacag 3120acggtgacga cccctcttag tttgactctc
gaccattgga ctgaagttaa atccagggct 3180cataatttgt cagttcaggt taagaaggga
ccttggcaga ctttctgtgt ctctgaatgg 3240ccgacattcg atgttggatg gccatcagag
gggaccttta attctgagat tatcctggct 3300gttaaagcaa ttatttttca gactggaccc
ggctctcatc ccgatcagga gccctatatc 3360cttacgtggc aagatttggc agaggatcct
ccgccatggg ttaaaccatg gctgaataag 3420ccaagaaagc caggtccccg aattctggct
cttggagaga aaaacaaaca ctcggctgaa 3480aaagtcaagc cctctcctca tatctacccc
gagattgagg aaccaccggc ttggccggaa 3540ccccaatctg ttcccccacc cccttatctg
gcacagggtg ccgcgagggg accctttgcc 3600cctcctggag ctccggcggt ggagggacct
tctgcaggga ctcggagccg gaggggcgcc 3660accccggagc ggacagacga gatcgcgaca
ttaccgctgc gcacgtacgg ccctcccaca 3720ccggggggcc aattgcagcc cctccagtat
tggccctttt cttctgcaga tctctataat 3780tggaaaacta accatccccc tttctcggag
gatccccaac gcctcacggg gttggtggag 3840tcccttatgt tctctcacca gcctacttgg
gatgattgtc aacagctgct gcagacactc 3900ttcacaaccg aggagcgaga gagaattcta
ttagaggcta gaaaaaatgt tcctggggcc 3960gacgggcgac ccacgcggtt gcaaaatgag
attgacatgg gatttccctt aactcgcccc 4020ggttgggact acaacacggc tgaaggtagg
gagagcttga aaatctatcg ccaggctctg 4080gtggcgggtc tccggggcgc ctcaagacgg
cccactaatt tggctaaggt aagagaagtg 4140atgcagggac cgaatgaacc cccctctgtt
tttcttgaga ggctcttgga agccttcagg 4200cggtacaccc cttttgatcc cacctcagag
gcccaaaaag cctcagtggc tttggccttt 4260ataggacagt cagccttgga tattagaaag
aagcttcaga gactggaagg gttacaggag 4320gctgagttac gtgatctagt gaaggaggca
gagaaagtat attacaaaag ggagacagaa 4380gaagaaaggg aacaaagaaa agagagagaa
agagaggaaa gggaggaaag acgtaataaa 4440cggcaagaga agaatttgac taagatcttg
gctgcagtgg ttgaagggaa aagcaatacg 4500gaaagagaga gagattttag gaaaattagg
tcaggcccta gacagtcagg gaacctgggc 4560aataggaccc cactcgacaa ggaccaatgt
gcatattgta aagaaagagg acactgggca 4620aggaactgcc ccaagaaggg aaacaaagga
ccaaggatcc tagctctaga agaagataaa 4680gattagggga gacggggttc ggaccccctc
cccgagccca gggtaacttt gaaggtggag 4740gggcaaccag ttgagttcct ggttgatacc
ggagcgaaac attcagtgct actacagcca 4800ttaggaaaac taaaagataa aaaatcctgg
gtgatgggtg cacagggcaa caacagtatc 4860catggactac ccgaagacag ttgacttggg
agtgggacgg gtaacccact cgtttctggt 4920catacctgag tgcccagcac ccctcttagg
tagagactta ttgaccaaga tgggagcaca 4980aatttctttt gaacaaggga aaccagaagt
gtctgcaaat aacaaaccta tcactgtgtt 5040gaccctccaa ttagatgacg aatatcgact
atactctccc ctagtaaagc ctgatcaaaa 5100tatacaattc tggttggaac agtttcccca
agcctgggca gaaaccgcag ggatgggttt 5160ggcaaagcaa gttcccccac aagttattca
actgaaggcc agtgccacac cagtgtcagt 5220cagacagtac cccttgagta aagaagctca
agaaggaatt cggccgcatg tccaaagatt 5280aatccaacag ggcatcctag ttcctgtcca
atctccctgg aatactcccc tgctaccggt 5340tagaaagcct gggactaatg actatcgacc
agtacaggac ttgagagagg tcaataaacg 5400ggtgcaggat atacacccaa cagtcccgaa
cccttataac ctcttgtgtg ctctcccacc 5460ccaacggagc tggtatacag tattggactt
aaaggatgcc ttcttctgcc tgagattaca 5520ccccactagc caaccacttt ttgccttcga
atggagagat ccaggtacgg gaagaaccgg 5580gcagctcacc tggacccgac tgccccaagg
gttcaagaac tccccgacca tctttgacga 5640agccctacac agagacctgg ccaacttcag
gatccaacac cctcaggtga ccctcctcca 5700gtacgtggat gacctgcttc tggcgggagc
caccaaacag gactgcttag aaggcacgaa 5760ggcactactg ctggaattgt ctgacctagg
ctacagagcc tctgctaaga aggcccagat 5820ttgcaggaga gaggtaacat acttggggta
cagtttacgg gacgggcagc gatggctgac 5880ggaggcacgg aagaaaactg tagtccagat
accggcccca accacagcca aacaaatgag 5940agagtttttg gggacagctg gattttgcag
actgtggatc ccggggtttg cgaccttagc 6000agccccactc tacccgctaa ccaaagaaaa
aggggaattc tcctgggctc ctgagcacca 6060gaaggcattt gatgctatca aaaaggccct
gctgagcgca cctgctctgg ccctccctga 6120cgtaactaaa ccctttaccc tttatgtgga
tgagcgtaag ggagtagccc ggggagtttt 6180aacccaaacc ctaggaccat ggagaagacc
tgtcgcctac ctgtcaaaga agctcgatcc 6240tgtagccagt ggttggccca tatgcctgaa
ggctatcgca gctgtggcca tactggtcaa 6300ggacgctgac aaattgactt tgggacaaga
atataactgt aatagccccc catgcattgg 6360agaacatcgt tcggcagccc ccagaccgat
ggatgaccaa cgcccgcatg acccactatc 6420aaagcctgct tctcacagag agggtcacgt
tcgctccacc aaccgctctc aaccctgcca 6480ctcttctgcc tgaagagact gatgaaccag
tgactcatga ttgccatcaa ctattgattg 6540aggagactgg ggtccgcaag gaccttacag
acataccgct gactggagaa gtgctaacct 6600ggttcactga cggaagcagc tatgtggtgg
aaggtaagag gatggctggg gcggcggtgg 6660tggacgggac ccgcacgatc tgggccagca
gcctgccggg aggaacttca gcacaaaagg 6720ctgagctcat ggccctcacg caagctttgc
ggctggccga agggaaatcc ataaacattt 6780atacggacag caggtatgcc tttgcgactg
cacacgtaca tggggccatc tataaacaaa 6840gggggttgct tacctcagca gggagggaaa
taaagaacaa agaggaaatt ctaagcctat 6900tagaagccgt acatttacca aaaaggctag
ctattataca ctgtcctgga catcagaaag 6960ctaaagatct catatccaga ggaaaccaga
tggctgaccg ggttgccaag caggcagccc 7020agggtgttaa ccttctgcct ataatagaaa
tgcccaaagc cccagaaccc agacgacagt 7080acaccctaga agactggcaa gagataaaaa
agatagacca ttctctgaga ctccggaagg 7140gacctgctat acctcagatg ggaaggaaat
cctgccccac aaagaagggt tagaatatgt 7200ccaacaagat acatcgtcta acccacctag
gaactaaaca cctgcagcag ttggtcagaa 7260catcccctta tcatgttctg aggctaccag
gagtggctga ctcggtggtc aaacattgtg 7320tgccctgcca gctggttaat gctaatcctt
ccagaatgcc tccagggaag agactaaggg 7380gaagccaccc aggcgctcac tgggaagtgg
acttcactga ggtaaagccg gctaaatatg 7440gaaacaaata cctattggtt tttgtagaca
ccttttcagg atgggtagag gcttatccta 7500ctaagaaaga gacttcaacc gtggtagcta
aaaaaatact ggaagaaatt tttccaagat 7560ttggaatacc taaggtaata gggtcagaca
atggtccagc ttttgttgcc caggtaagtc 7620agggactggc caagatattg gggattgatt
ggaaactgca ttgtgcatac agaccccaaa 7680gctcaggaca ggtagagagg atgaatagaa
ccattaaaga gacccttact aaattgaccg 7740cggagactgg cgttaatgat tggatagctc
tcctgccctt tgtgcttttt agggttagga 7800acacccctgg acagtttggg ctgaccccct
atgaattact ctacggggga ccccccccat 7860tggtagaaat tgcttctgta catagtgctg
atgtgctgct ttcccagcct ttgttctcta 7920ggctcaaggc acttgagtgg gtgagacaac
gagcgtggag gcaactccgg gaggcctact 7980caggaggagg agacttgcag atcccacatc
gtttccaagt gggagattca gtctacgtta 8040gacgccaccg tgcaggaaac
806027333DNAPorcine endogenous
retrovirus 2ctacccctgc gtggtgtacg actgtgggcc ccagcgcgct tggaataaaa
atcctcttgc 60tgtttgcatc aagaccgctt cttgtgagtg atttggggtg tcgcctcttc
cgagcccgga 120cgagggggat tgttctttta ctggcctttc atttggtgcg ttggccggga
aatcctgcga 180ccacccctta cacccgagaa ccgacttgga ggtaaaggga tcccctttgg
aacatatgtg 240tgtgtcggcc ggcgtctctg ttctgagtgt ctgttttcgg tgatgcgcgc
tttcggtttg 300cagctgtcct ctcagaccgt aaggactgga ggactgtgat cagcagacgt
gctaggagga 360tcacaggctg ccaccctggg ggacgccccg ggaggtgggg agagccaggg
acgcctggtg 420gtctcctact gtcggtcaga ggaccgagtt ctgttgttga agcgaaagct
tccccctccg 480cggccgtccg actcttttgc ctgcttgtgg aagacgcgga cgggtcgcgt
gtgtctggat 540ctgttggttt ctgtttcgtg tgtctttgtc ttgtgcgtcc ttgtctacag
ttttaatatg 600ggacagacag tgactacccc ccttagtttg actctcgacc attggactga
agttagatcc 660agggctcata atttgtcagt tcaggttaag aagggacctt ggcagacttt
ctgtgcctct 720gaatggccaa cattcgatgt tggatggcca tcagagggga cctttaattc
tgaaattatc 780ctggctgtta aggcaatcat ttttcagact ggacccggct ctcatcctga
tcaggagccc 840tatatcctta cgtggcaaga tttggcagaa gatcctccgc catgggttaa
accatggcta 900aataaaccaa gaaagccagg tccccgaatc ctggctcttg gagagaaaaa
caaacactcg 960gccgaaaaag tcgagccctc tcctcgtatc taccccgaga tcgaggagcc
gccgacttgg 1020ccggaacccc aacctgttcc cccaccccct tatccagcac agggtgctgt
gaggggaccc 1080tctgcccctc ctggagctcc ggtggtggag ggacctgctg ccgggactcg
gagccggaga 1140ggcgccaccc cggagcggac agacgagatc gcgatattac cgctgcgcac
ctatggccct 1200cccatgccag ggggccaatt gcagcccctc cagtattggc ccttttcttc
tgcagatctc 1260tataattgga aaactaacca tccccctttc tcggaggatc cccaacgcct
cacggggttg 1320gtggagtccc ttatgttctc tcaccagcct acttgggatg attgtcaaca
gctgctgcag 1380acactcttca caaccgagga gcgagagaga attctgttag aggctaaaaa
aaatgttcct 1440ggggccgacg ggcgacccac gcagttgcaa aatgagattg acatgggatt
tcccttgact 1500cgccccggtt gggactacaa cacggctgaa ggtagggaga gcttgaaaat
ctatcgccag 1560gctctggtgg cgggtctccg gggcgcctca agacggccca ctaatttggc
taaggtaaga 1620gaggtgatgc agggaccgaa cgaacctccc tcggtatttc ttgagaggct
catggaagcc 1680ttcaggcggt tcaccccttt tgatcctacc tcagaggccc agaaagcctc
agtggccctg 1740gccttcattg ggcagtcggc tctggatatc aggaagaaac ttcagagact
ggaagggtta 1800caggaggctg agttacgtga tctagtgaga gaggcagaga aggtgtatta
cagaagggag 1860acagaagagg agaaggaaca gagaaaagaa aaggagagag aagaaaggga
ggaaagacgt 1920gatagacggc aagagaagaa tttgactaag atcttggccg cagtggttga
agggaagagc 1980agcagggaga gagagagaga ttttaggaaa attaggtcag gccctagaca
gtcagggaac 2040ctgggcaata ggaccccact cgacaaggac cagtgtgcgt attgtaaaga
aaaaggacac 2100tgggcaagga actgccccaa gaagggaaac aaaggaccga aggtcctagc
tctagaagaa 2160gataaagatt aggggagacg gggttcggac cccctccccg agcccagggt
aactttgaag 2220gtggaggggc aaccagttga gttcctggtt gataccggag cggagcattc
agtgctgcta 2280caaccattag gaaaactaaa agaaaaaaaa tcctgggtga tgggtgccac
agggcaacgg 2340cagtatccat ggactacccg aagaaccgtt gacttgggag tgggacgggt
aacccactcg 2400tttctggtca tccctgagtg cccagtaccc cttctaggta gagacttact
gaccaagatg 2460ggagctcaaa tttcttttga acaaggaaga ccagaagtgt ctgtgaataa
caaacccatc 2520actgtgttga ccctccaatt agatgatgaa tatcgactat attctcccca
agtaaagcct 2580gatcaagata tacagtcctg gttggagcag tttccccaag cctgggcaga
aaccgcaggg 2640atgggtttgg caaagcaagt tcccccacag gttattcaac tgaaggccag
tgctacacca 2700gtatcagtca gacagtaccc cttgagtaga gaggctcgag aaggaatttg
gccgcatgtt 2760caaagattaa tccaacaggg catcctagtt cctgtccaat ccccttggaa
tactcccctg 2820ctaccggtta ggaagcctgg gaccaatgat tatcgaccag tacaggactt
gagagaggtc 2880aataaaaggg tgcaggacat acacccaacg gtcccgaacc cttataacct
cttgagcgcc 2940ctcccgcctg aacggaactg gtacacagta ttggacttaa aagatgcctt
cttctgcctg 3000agattacacc ccactagcca accacttttt accttcgaat ggagagatcc
aggtacggga 3060agaaccgggc agctcacctg gacccgactg ccccaagggt tcaagaactc
cccgaccatc 3120tttgacgaag ccctacacag ggacctggcc aacttcagga tccaacaccc
tcaggtgacc 3180ctcctccagt acgtggatga cctgcttctg gcgggagcca ccaaacagga
ctgcttagaa 3240ggtacgaagg cactactgct ggaattgtct gacctaggct acagagcctc
tgctaagaag 3300gcccagattt gcaggagaga ggtaacatac ttggggtaca gtttgcgggg
cgggcagcga 3360tggctgacgg aggcacggaa gaaaactgta gtccagatac cggccccaac
cacagccaaa 3420caagtgagag agtttttggg gacagctgga ttttgcagac tgtggatccc
ggggtttgcg 3480accttagcag ccccactcta cccgctaacc aaagaaaaag ggggttgctt
acctcagcag 3540ggagggaaat aaagaacaaa gaggaaattc taagcctatt agaagcctta
catttgccaa 3600aaaggctagc tattatacac tgtcctggac atcagaaagc caaagatctc
atatctagag 3660ggaaccagat ggctgaccgg gttgccaagc aggcagccca ggctgttaac
cttctgccta 3720taatagaaac gcccaaagcc ccagaaccca gacgacagta caccctagaa
gactggcaag 3780agataaaaaa gatagaccag ttctctgaga ctccggaggg gacctgctat
acctcatatg 3840ggaaggaaat cctgccccac aaagaagggt tagaatatgt ccaacagata
catcgtctaa 3900cccacctagg aactaaacac ctgcagcagt tggtcagaac atccccttat
catgttctga 3960ggctaccagg agtggctgac tcggtggtca aacattgtgt gccctgccag
ctggttaatg 4020ctaatccttc cagaatacct ccaggaaaga gactaagggg aagccaccca
ggcgctcact 4080gggaagtgga cttcactgag gtaaagccgg ctaaatacgg aaacaaatat
ctattggttt 4140ttgtagacac cttttcagga tgggtagagg cttatcctac taaaaaagag
acttcaaccg 4200tggtggctaa gaaaatactg gaggaaattt ttccaagatt tggaatacct
aaggtaatag 4260ggtcagacaa tggtccagct ttcgttgccc aggtaagtca gggactggcc
aagatattgg 4320ggattgattg aaaactgcat tgtgcataca gaccccaaag ctcaggacag
gtagagagga 4380tgaatagaac cattaaagag acccttacca aattgaccac agagactggc
attaatgatt 4440ggatggctct cctgcccttt gtgcttttta gggtgaggaa cacccctgga
cagtttgggc 4500tgacccccta taaattgctc tacgggggac cccccccgtt ggcagaaatt
gcctttgcac 4560atagtgctga tgtgctgctt tcccagcctt tgttctctag gctcaaggcg
ctcgagtggg 4620tgaggcagcg agcgtggaag cagctccggg aggcctactc aggaggagac
ttgcaagttc 4680cacatcgctt ccaagttgga gattcagtct atgttagacg ccaccgtgca
ggaaacctcg 4740agactcggta gaagggacct tatctcgtac ttttgaccac accaacggct
gtgaaagtcg 4800aaggaatccc cttaagcttc gcctccatcg cgtggttcct tactctgtca
ataactcctc 4860aagttaatgg taaacgcctt gtggacagcc cgaactccca taaaccctta
tctctcacct 4920ggttacttac tgactccggt acaggtatta atattaacag cactcaaggg
gaggctccct 4980tggggacctg gtggcctgaa ttatatgtct gccttcgatc agtaatccct
ggtctcaatg 5040accaggccac accccccgat gtactccgtg cttacgggtt ttacgtttgc
ccaggacccc 5100caaataatga agaatattgt ggaaatcctc aggatttctt ttgcaagcaa
tggagctgca 5160taacttctaa tgatgggaat tggaaatggc cagtctctca gcaagacaga
gtaagttact 5220cttttgttaa caatcctacc agttataatc aatttaatta tggccatggg
agatggaaag 5280attggcaaca gcgggtacaa aaagatgtac gaaataagca aataagctgt
cattcgttag 5340acctagatta cttaaaaata agtttcactg aaaaaggaaa acaagaaaat
attcaaaagt 5400gggtaaatgg tatatcttgg ggaatagtgt actatggagg ctctgggaga
aagaaaggat 5460ctgttctgac tattcgcctc agaatagaaa ctcagatgga acctccggtt
gctataggac 5520caaataaggg tttggccgaa caaggacctc caatccaaga acagaggcca
tctcctaacc 5580cctctgatta caatacaacc tctggatcag tccccactga gcctaacatc
actattaaaa 5640caggggcgaa actttttagc ctcatccagg gagcttttca agctcttaac
tccacgactc 5700cagaggctac ctcttcttgt tggctttgct tagcttcggg cccaccttac
tatgagggaa 5760tggctagagg agggaaattc aatgtgacaa aggaacatag agaccaatgt
acatggggat 5820cccaaaataa gcttaccctt actgaggttt ctggaaaagg cacctgcata
gggatggttc 5880ccccatccca ccaacacctt tgtaaccaca ctgaagcctt taatcgaacc
tctgagagtc 5940aatatctggt acctggttat gacaggtggt gggcatgtaa tactggatta
accccttgtg 6000tttccacctt ggttttcaac caaactaaag acttttgcgt tatggtccaa
attgtccccc 6060gggtgtacta ctatcccgaa aaagcagtcc ttgatgaata tgactataga
tataatcggc 6120caaaaagaga gcccatatcc ctgacactag ctgtaatgct cggattggga
gtggctgcag 6180gcgtgggaac aggaacggct gccctaatca caggaccgca acagctggag
aaaggactta 6240gtaacctaca tcgaattgta acggaagatc tccaagccct agaaaaatct
gtcagtaacc 6300tggaggaatc cctaacctcc ttatctgaag tggttctaca gaacagaagg
gggttagatc 6360tgttatttct aaaagaagga gggttatgtg tagccttaaa agaggaatgc
tgcttctatg 6420tagatcactc aggagccatc agagactcca tgagcaagct tagagaaagg
ttagagaggc 6480gtcgaaggga aagagaggct gaccaggggt ggtttgaagg atggttcaac
aggtctcctt 6540ggatgaccac cctgctttct gctctgacgg ggcccctagt agtcctgctc
ctgttactta 6600cagttgggcc ttgcttaatt aataggtttg ttgcctttgt tagagaacga
gtgagtgcag 6660tccagatcat ggtacttagg caacagtacc aaggccttct gagccaagga
gaaactgacc 6720tctagccttc ccagttctaa gattagaact attaacaaga caagaagtgg
ggaatgaaag 6780gatgaaaatg caacctaacc ctcccagaac ccaggaagtt aataaaaagc
tctaaatgcc 6840cccgaattcc agaccctgct ggctgccagt aaataggtag aaggtcacac
ttcctattgt 6900tccagggcct gctatcctgg cctaagtaag ataacaggaa atgagttgac
taatcgctta 6960tctggattct gtaaaactga ctggcaccat agaagaattg attacacatt
gacagcccta 7020gtgacctatc tcaactgcaa tctgtcactc tgcccaggag cccacgcaga
tgcggacctc 7080cggagctatt ttaaaatgat tggtccacgg agcgcgggct ctcgatattt
taaaatgatt 7140ggtccatgga gcgcgggctc tcgatatttt aaaatgattg gtttgtgacg
cacaggcttt 7200gttgtgaacc ccataaaagc tgtcccgatt ccgcactcgg ggccgcagtc
ctctacccct 7260gcgtggtgta cgactgtggg ccccagcgcg cttggaataa aaatcctctt
gctgtttgca 7320tcaaaaaaaa aaa
733338132DNAPorcine endogenous retrovirus 3gcgtggtgta
cgactgtggg ccccagcgcg cttggaataa aaatcctctt gctgtttgca 60tcaagaccgc
ttctcgtgag tgattaaggg gagtcgcctt ttccgagcct ggaggttctt 120tttgctggtc
ttacatttgg gggctcgtcc gggatctgtc gcggccaccc ctaacacccg 180agaaccgact
tggaggtaaa aaggatcctc tttttaacgt gtatgcatgt accggccggc 240gtctctgttc
tgagtgtctg ttttcagtgg tgcgcgcttt cggtttgcag ctgtcctctc 300aggccgtaag
ggctggggga ctgtgatcag cagacgtgct aggaggatca caggctgctg 360ccctggggga
cgccccggga ggtgaggaga gccagggacg cctggtggtc tcctactgtc 420ggtcagagga
ccgaattctg ttgctgaagc gaaagcttcc ccctccgcga ccgtccgact 480cttttgcctg
cttgtggaag acgtggacgg gtcacgtgtg tctggatctg ttggtttctg 540ttttgtgtgt
ctttgtcttg tgtgtccttg tctacagttt taatatggga cagacggtga 600cgacccctct
tagtttgact ctcgaccatt ggactgaagt taaatccagg gctcataatt 660tgtcagttca
ggttaagaag ggaccttggc agactttctg tgtctctgaa tggccgacat 720tcgatgttgg
atggccatca gaggggacct ttaattctga gattatcctg gctgttaaag 780cagttatttt
tcagactgga cccggctctc atcccgatca ggagccctat atccttacgt 840ggcaagattt
ggcagaggat cctccgccat gggttaaacc atggctgaat aagccaagaa 900agccaggtcc
ccgaattctg gctcttggag agaaaaacaa acactcggct gaaaaagtca 960agccctctcc
tcatatctac cccgagattg aggagccacc ggcttggccg gaaccccaat 1020ctgttccccc
acccccttat ctggcacagg gtgccgcgag gggacccttt gcccctcctg 1080gagctccggc
ggtggaggga cctgctgcag ggactcggag ccggaggggc gccaccccgg 1140agcggacaga
cgagatcgcg acattaccgc tgcgcacgta cggccctccc acaccggggg 1200gccaattgca
gcccctccag tattggccct tttcttctgc agatctctat aattggaaaa 1260ctaaccatcc
ccctttctcg gaggatcccc aacgcctcac ggggttggtg gagtccctta 1320tgttctctca
ccagcctact tgggatgatt gtcaacagct gctgcagaca ctcttcacaa 1380ccgaggagcg
agagagaatt ctattagagg ctagaaaaaa tgttcctggg gccgacgggc 1440gacccacgcg
gttgcaaaat gagattgaca tgggatttcc cttaactcgc cccggttggg 1500actacaacac
ggctgaaggt agggagagct tgaaaatcta tcgccaggct ctggtggcgg 1560gtctccgggg
cgcctcaaga cggcccacta atttggctaa ggtaagagaa gtgatgcagg 1620gaccgaatga
acccccctct gtttttcttg agaggctctt ggaagccttc aggcggtaca 1680ccccttttga
tcccacctca gaggcccaaa aagcctcagt ggctttggcc tttataggac 1740agtcagcctt
ggatattaga aagaagcttc agagactgga agggttacag gaggctgagt 1800tacgtgatct
agtgaaggag gcagagaaag tatattacaa aagggagaca gaagaagaaa 1860gggaacaaag
aaaagagaga gaaagagagg aaagggagga aagacgtaat aaacggcaag 1920agaagaattt
gactaagatc ttggctgcag tggttgaagg gaaaagcaat acggaaagag 1980agagagattt
taggaaaatt aggtcaggcc ctagacagtc agggaacctg ggcaatagga 2040ccccactcga
caaggaccaa tgtgcatatt gtaaagaaag aggacactgg gcaaggaact 2100gccccaagaa
gggaaacaaa ggaccaagga tcctagctct agaagaagat aaagattagg 2160ggagacgggg
ttcggacccc ctccccgagc ccagggtaac tttgaaggtg gaggggcaac 2220cagttgagtt
cctggttgat accggagcga aacattcagt gctactacag ccattaggaa 2280aactaaaaga
taaaaaatcc tgggtgatgg gtgccacagg gcaacaacag tatccatgga 2340ctacccgaag
aacagttgac ttgggagtgg gacgggtaac ccactcgttt ctggtcatac 2400ctgagtgccc
agcacccctc ttaggtagag acttattgac caagatggga gcacaaattt 2460cttttgaaca
agggaaacca gaagtgtctg caaataacaa acctatcact gtgttgaccc 2520tccaattaga
tgacgaatat cgactatact ctcccctagt aaagcctgat caaaatatac 2580aattctggtt
ggaacagttt ccccaagcct gggcagaaac cgcagggatg ggtttggcaa 2640agcaagttcc
cccacaagtt attcaactga aggccagtgc cacaccagtg tcagtcagac 2700agtacccctt
gagtaaagaa gctcaagaag gaattcggcc gcatgtccaa agattaatcc 2760aacagggcat
cctagttcct gtccaatctc cctggaatac tcccctgcta ccggttagaa 2820agcctgggac
taatgactat cgaccagtac aggacttgag agaggtcaat aaacgggtgc 2880aggatataca
cccaacagtc ccgaaccctt ataacctctt gtgtgctctc ccaccccaac 2940ggagctggta
tacagtattg gacttaaagg atgccttctt ctgcctgaga ttacacccca 3000ctagccaacc
actttttgcc ttcgaatgga gagatccagg tacgggaaga accgggcagc 3060tcacctggac
ccgactgccc caagggttca agaactcccc gaccatcttt gacgaagccc 3120tacacagaga
cctggccaac ttcaggatcc aacaccctca ggtgaccctc ctccagtacg 3180tggatgacct
gcttctggcg ggagccacca aacaggactg cttagaaggc acgaaggcac 3240tactgctgga
attgtctgac ctaggctaca gagcctctgc taagaaggcc cagatttgca 3300ggagagaggt
aacatacttg gggtacagtt tgcgggacgg gcagcgatgg ctgacggagg 3360cacggaagaa
aactgtagtc cagataccgg ccccaaccac agccaaacaa atgagagagt 3420ttttggggac
agctggattt tgcagactgt ggatcccggg gtttgcgacc ttagcagccc 3480cactctaccc
gctaaccaaa gaaaaagggg aattctcctg ggctcctgag caccagaagg 3540catttgatgc
tatcaaaaag gccctgctga gcgcacctgc tctggccctc cctgacgtaa 3600ctaaaccctt
taccctttat gtggatgagc gtaagggagt agcccgggga gttttaaccc 3660aaaccctagg
accatggaga agacctgtcg cctacctgtc aaagaagctc gatcctgtag 3720ccagtggttg
gcccatatgc ctgaaggcta tcgcagctgt ggccatactg gtcaaggacg 3780ctgacaaatt
gactttggga cagaatataa ctgtaatagc cccccatgca ttggagaaca 3840tcgttcggca
gcccccagac cgatggatga ccaacgcccg catgacccac tatcaaagcc 3900tgcttctcac
agagagggtc acgttcgctc caccagccgc tctcaaccct gccactcttc 3960tgcctgaaga
gactgatgaa ccagtgactc atgattgcca tcaactattg attgaggaga 4020ctggggtccg
caaggacctt acagacatac cgctgactgg agaagtgcta acctggttca 4080ctgacggaag
cagctatgtg gtggaaggta agaggatggc tggggcggcg gtggtggacg 4140ggacccgcac
gatctgggcc agcagcctgc cggaaggaac ttcagcacaa aaggctgagc 4200tcatggccct
cacgcaagct ttgcggctgg ccgaagggaa atccataaac atttatacgg 4260acagcaggta
tgcctttgcg actgcacacg tacatggggc catctataaa caaagggggt 4320tgcttacctc
agcagggagg gaaataaaga acaaagagga aattctaagc ctattagaag 4380ccgtacattt
accaaaaagg ctagctatta tacactgtcc tggacatcag aaagctaaag 4440atctcatatc
cagaggaaac cagatggctg accgggttgc caagcaggca gcccagggtg 4500ttaaccttct
gcctataata gaaatgccca aagccccaga acccagacga cagtacaccc 4560tagaagactg
gcaagagata aaaaagatag accagttctc tgagactccg gaagggacct 4620gctatacctc
agatgggaag gaaatcctgc cccacaaaga agggttagaa tatgtccaac 4680agatacatcg
tctaacccac ctaggaacta aacacctgca gcagttggtc agaacatccc 4740cttatcatgt
tctgaggcta ccaggagtgg ctgactcggt ggtcaaacat tgtgtgccct 4800gccagctggt
taatgctaat ccttccagaa tgcctccagg gaagagacta aggggaagcc 4860acccaggcgc
tcactgggaa gtggacttca ctgaggtaaa gccggctaaa tacggaaaca 4920aatacctatt
ggtttttgta gacacctttt caggatgggt agaggcttat cctactaaga 4980aagagacttc
aaccgtggtg gctaaaaaaa tactggaaga aatttttcca agatttggaa 5040tacctaaggt
aatagggtca gacaatggtc cagcttttgt tgcccaggta agtcagggac 5100tggccaagat
attggggatt gattggaaac tgcattgtgc atacagaccc caaagctcag 5160gacaggtaga
gaggatgaat agaaccatta aagagaccct tactaaattg accgcggaga 5220ctggcgttaa
tgattggata gctctcctgc cctttgtgct ttttagggtt aggaacaccc 5280ctggacagtt
tgggctgacc ccctatgaat tactctacgg gggacccccc ccattggtag 5340aaattgcttc
tgtacatagt gctgacgtgc tgctttccca gcctttgttc tctaggctca 5400aggcacttga
gtgggtgaga caacgagcgt ggaggcaact ccgggaggcc tactcaggag 5460gaggagactt
gcagatccca catcgtttcc aagtgggaga ttcagtctac gttagacgcc 5520accgtgcagg
aaacctcgag actcggtgga agggccctta tctcgtactt ttgaccacac 5580caacggctgt
gaaagtcgaa ggaatctcca cctggatcca tgcatcccac gttaaaccgg 5640cgccacctcc
cgattcgggg tggaaagccg aaaagactga aaatcccctt aagcttcgcc 5700tccatcgcgt
ggttccttac tctgtcaata acctctcaga ctaatggtat gcgcatagga 5760gacagcctga
actcccataa acccttatct ctcacctggt taattactga ctccggcaca 5820ggtattaata
tcaacaacac tcaaggggag gctcctttag gaacctggtg gcctgatcta 5880tacgtttgcc
tcagatcagt tattcctagt ctgacctcac ccccagatat cctccatgct 5940cacggatttt
atgtttgccc aggaccacca aataatggaa aacattgcgg aaatcccaga 6000gatttctttt
gtaaacaatg gaactgtgta acctctaatg atggatattg gaaatggcca 6060acctctcagc
aggatagggt aagtttttct tatgtcaaca cctataccag ctctggacaa 6120tttaattacc
tgacctggat tagaactgga agccccaagt gctctccttc agacctagat 6180tacctaaaaa
taagtttcac tgagaaagga aaacaagaaa atatcctaaa atgggtaaat 6240ggtatgtctt
ggggaatggt atattatgga ggctcgggta aacaaccagg ctccattcta 6300actattcgcc
tcaaaataaa ccagctggag cctccaatgg ctataggacc aaatacggtc 6360ttgacgggtc
aaagaccccc aacccaagga ccaggaccat cctctaacat aacttctgga 6420tcagacccca
ctgagtctaa cagcacgact aaaatggggg caaaactttt tagcctcatc 6480cagggagctt
ttcaagctct taactccacg actccagagg ctacctcttc ttgttggcta 6540tgcttagctt
cgggcccacc ttactatgaa ggaatggcta gaagagggaa attcaatgtg 6600acaaaagaac
atagagacca atgcacatgg ggatcccaaa ataagcttac ccttactgag 6660gtttctggaa
aaggcacctg cataggaaag gttcccccat cccaccaaca cctttgtaac 6720cacactgaag
cctttaatca aacctctgag agtcaatatc tggtacctgg ttatgacagg 6780tggtgggcat
gtaatactgg attaacccct tgtgtttcca ccttggtttt taaccaaact 6840aaagattttt
gcattatggt ccaaattgtt ccccgagtgt attactatcc cgaaaaagca 6900atccttgatg
aatatgacta cagaaatcat cgacaaaaga gagaacccat atctctgaca 6960cttgctgtga
tgctcggact tggagtggca gcaggtgtag gaacaggaac agctgccctg 7020gtcacgggac
cacagcagct agaaacagga cttagtaacc tacatcgaat tgtaacagaa 7080gatctccaag
ccctagaaaa atctgtcagt aacctggagg aatccctaac ctccttatct 7140gaagtagtcc
tacagaatag aagagggtta gatttattat ttctaaaaga aggaggatta 7200tgtgtagcct
tgaaggagga atgctgtttt tatgtggatc attcaggggc catcagagac 7260tccatgaaca
agcttagaga aaggttggag aagcgtcgaa gggaaaagga aactactcaa 7320gggtggtttg
agggatggtt caacaggtct ctttggttgg ctaccctact ttctgcttta 7380acaggaccct
taatagtcct cctcctgtta ctcacagttg ggccatgtat tattaacaag 7440ttaattgcct
tcattagaga acgaataagt gcagtccaga tcatggtact tagacaacag 7500taccaaagcc
cgtctagcag ggaagctggc cgctagctct accagttcta agattagaac 7560tattaacaag
agaagaagtg gggaatgaaa ggatgaaaat acaacctaag ctaatgagaa 7620gcttaaaatt
gttctgaatt ccagagtttg ttccttatag gtaaaagatt aggttttttg 7680ctgttttaaa
atatgcggaa gtaaaatagg ccctgagtac atgtctctag gcatgaaact 7740tcttgaaact
atttgagata acaagaaaag ggagtttcta actgcttgtt tagcttctgt 7800aaaactggtt
gcgccataaa gatgttgaaa tgttgataca catatcttgg tgacaacatg 7860tctcccccac
cccgaaacat gcgcaaatgt gtaactctaa aacaatttaa attaattggt 7920ccacgaagcg
cgggctctcg aagttttaaa ttgactggtt tgtgatattt tgaaatgatt 7980ggtttgtaaa
gcgcgggctt tgttgtgaac cccataaaag ctgtcccgac tccacactcg 8040gggccgcagt
cctctacccc tgcgtggtgt acgactgtgg gccccagcgc gcttggaata 8100aaaatcctct
tgctgtttgc atcaaaaaaa aa
8132419DNAArtificial SequencePrimer 4tgcctagaga catgtactc
19521DNAArtificial SequencePrimer
5cctcttctag ccattccttc a
21622DNAArtificial SequencePrimer 6tcgagactcg gtggaagggc cc
22722DNAArtificial SequencePrimer
7gggcccttcc accgagtctc ga
22822DNAArtificial SequencePrimer 8acctggatcc atgcatccca cg
22922DNAArtificial SequencePrimer
9cgtgggatgc atggatccag gt
221020DNAArtificial SequencePrimer 10ggcgccacct cccgattcgg
201120DNAArtificial SequencePrimer
11ccgaatcggg aggtggcgcc
201220DNAArtificial SequencePrimer 12tccccttaag cttcgcctcc
201320DNAArtificial SequencePrimer
13ggaggcgaag cttaagggga
201423DNAArtificial SequencePrimer 14aaaagcacaa agggcaggag agc
231523DNAArtificial SequencePrimer
15gctctcctgc cctttgtgct ttt
231620DNAArtificial SequencePrimer 16cctttaggaa cctggtggcc
201720DNAArtificial SequencePrimer
17ggccaccagg ttcctaaagg
201820DNAArtificial SequencePrimer 18cccccagata tcctccatgc
201920DNAArtificial SequencePrimer
19gcatggagga tatctggggg
202022DNAArtificial SequencePrimer 20gcagtttcca atcaatcccc aa
222122DNAArtificial SequencePrimer
21ttggggattg attggaaact gc
222223DNAArtificial SequencePrimer 22tttatgtttg cccaggacca cca
232323DNAArtificial SequencePrimer
23tggtggtcct gggcaaacat aaa
232423DNAArtificial SequencePrimer 24gggaggtggc gccggcttaa cgt
232523DNAArtificial SequencePrimer
25acgttaagcc ggcgccacct ccc
232624DNAArtificial SequencePrimer 26cccccaaccc aaggaccagg acca
242724DNAArtificial SequencePrimer
27tggtcctggt ccttgggttg gggg
242822DNAArtificial SequencePrimer 28gcagcacgac taaaatgggg gc
222922DNAArtificial SequencePrimer
29gcccccattt tagtcgtgct gc
223020DNAArtificial SequencePrimer 30cccccatccc accaacacct
203120DNAArtificial SequencePrimer
31aggtgttggt gggatggggg
203220DNAArtificial SequencePrimer 32tctcccccac cccgaaacat
203320DNAArtificial SequencePrimer
33atgtttcggg gtgggggaga
203424DNAArtificial SequencePrimer 34agccaagaaa gccaggtccc cgaa
243524DNAArtificial SequencePrimer
35ttcggggacc tggctttctt ggct
243621DNAArtificial SequencePrimer 36aggctctggt ggcgggtctc c
213721DNAArtificial SequencePrimer
37ggagacccgc caccagagcc t
213820DNAArtificial SequencePrimer 38ccgcagggat gggtttggca
203920DNAArtificial SequencePrimer
39tgccaaaccc atccctgcgg
204022DNAArtificial SequencePrimer 40gctcacctgg acccgactgc cc
224122DNAArtificial SequencePrimer
41gggcagtcgg gtccaggtga gc
224224DNAArtificial SequencePrimer 42gtttacggga cgggcagcga tggc
244324DNAArtificial SequencePrimer
43gccatcgctg cccgtcccgt aaac
244426DNAArtificial SequencePrimer 44tggctggggc ggcggtggtg gacggg
264526DNAArtificial SequencePrimer
45cccgtccacc accgccgccc cagcca
264624DNAArtificial SequencePrimer 46gcccaaagcc ccagaaccca gacg
244724DNAArtificial SequencePrimer
47cgtctgggtt ctggggcttt gggc
244820DNAArtificial SequencePrimer 48gatgaacagg cagacatctg
204920DNAArtificial SequencePrimer
49cgcttacaga caagctgtga
205019DNAArtificial SequencePrimer 50agaacaaagg ctgggaagc
195120DNAArtificial SequencePrimer
51ataggagaca gcctgaactc
205220DNAArtificial SequencePrimer 52ggaccattgt ctgaccctat
205320DNAArtificial SequencePrimer
53gtcaacacct ataccagctc
205420DNAArtificial SequencePrimer 54catctgaggt atagcaggtc
205520DNAArtificial SequencePrimer
55gcaggtgtag gaacaggaac
205620DNAArtificial SequencePrimer 56acctgttgaa ccatccctca
205720DNAArtificial SequencePrimer
57cgaatggaga gatccaggta
205820DNAArtificial SequencePrimer 58cctgcatcac ttctcttacc
205920DNAArtificial SequencePrimer
59ttgcctgctt gtggaatacg
206021DNAArtificial SequencePrimer 60caagagaaga agtggggaat g
216120DNAArtificial SequencePrimer
61cacagtcgta caccacgcag
206220DNAArtificial SequencePrimer 62gggagacaga agaagaaagg
206320DNAArtificial SequencePrimer
63cgatagtcat tagtcccagg
206421DNAArtificial SequencePrimer 64tgctggtttg catcaagacc g
216520DNAArtificial SequencePrimer
65gtcgcaaagg catacctgct
206620DNAArtificial SequencePrimer 66acagagcctc tgctaagaag
206719DNAArtificial SequencePrimer
67gcagctgttg acaatcatc
196820DNAArtificial SequencePrimer 68tatgaggaga gggcttgact
206919DNAArtificial SequencePrimer
69agcagacgtg ctaggaggt
197019DNAArtificial SequencePrimer 70tcctcttgct gtttgcatc
197120DNAArtificial SequencePrimer
71cagacactca gaacagagac
207220DNAArtificial SequencePrimer 72acatcgtcta acccacctag
207321DNAArtificial SequencePrimer
73ctcgtttctg gtcatacctg a
217419DNAArtificial SequencePrimer 74gagtacatct ctctaggca
1975524PRTPorcine endogenous retrovirus
75Met Gly Gln Thr Val Thr Thr Pro Leu Ser Leu Thr Leu Asp His Trp1
5 10 15Thr Glu Val Arg Ser Arg
Ala His Asn Leu Ser Val Gln Val Lys Lys20 25
30Gly Pro Trp Gln Thr Phe Cys Ala Ser Glu Trp Pro Thr Phe Asp Val35
40 45Gly Trp Pro Ser Glu Gly Thr Phe Asn
Ser Glu Ile Ile Leu Ala Val50 55 60Lys
Ala Ile Ile Phe Gln Thr Gly Pro Gly Ser His Pro Asp Gln Glu65
70 75 80Pro Tyr Ile Leu Thr Trp
Gln Asp Leu Ala Glu Asp Pro Pro Pro Trp85 90
95Val Lys Pro Trp Leu Asn Lys Pro Arg Lys Pro Gly Pro Arg Ile Leu100
105 110Ala Leu Gly Glu Lys Asn Lys His
Ser Ala Glu Lys Val Glu Pro Ser115 120
125Pro Arg Ile Tyr Pro Glu Ile Glu Glu Pro Pro Thr Trp Pro Glu Pro130
135 140Gln Pro Val Pro Pro Pro Pro Tyr Pro
Ala Gln Gly Ala Val Arg Gly145 150 155
160Pro Ser Ala Pro Pro Gly Ala Pro Val Val Glu Gly Pro Ala
Ala Gly165 170 175Thr Arg Ser Arg Arg Gly
Ala Thr Pro Glu Arg Thr Asp Glu Ile Ala180 185
190Ile Leu Pro Leu Arg Thr Tyr Gly Pro Pro Met Pro Gly Gly Gln
Leu195 200 205Gln Pro Leu Gln Tyr Trp Pro
Phe Ser Ser Ala Asp Leu Tyr Asn Trp210 215
220Lys Thr Asn His Pro Pro Phe Ser Glu Asp Pro Gln Arg Leu Thr Gly225
230 235 240Leu Val Glu Ser
Leu Met Phe Ser His Gln Pro Thr Trp Asp Asp Cys245 250
255Gln Gln Leu Leu Gln Thr Leu Phe Thr Thr Glu Glu Arg Glu
Arg Ile260 265 270Leu Leu Glu Ala Lys Lys
Asn Val Pro Gly Ala Asp Gly Arg Pro Thr275 280
285Gln Leu Gln Asn Glu Ile Asp Met Gly Phe Pro Leu Thr Arg Pro
Gly290 295 300Trp Asp Tyr Asn Thr Ala Glu
Gly Arg Glu Ser Leu Lys Ile Tyr Arg305 310
315 320Gln Ala Leu Val Ala Gly Leu Arg Gly Ala Ser Arg
Arg Pro Thr Asn325 330 335Leu Ala Lys Val
Arg Glu Val Met Gln Gly Pro Asn Glu Pro Pro Ser340 345
350Val Phe Leu Glu Arg Leu Met Glu Ala Phe Arg Arg Phe Thr
Pro Phe355 360 365Asp Pro Thr Ser Glu Ala
Gln Lys Ala Ser Val Ala Leu Ala Phe Ile370 375
380Gly Gln Ser Ala Leu Asp Ile Arg Lys Lys Leu Gln Arg Leu Glu
Gly385 390 395 400Leu Gln
Glu Ala Glu Leu Arg Asp Leu Val Arg Glu Ala Glu Lys Val405
410 415Tyr Tyr Arg Arg Glu Thr Glu Glu Glu Lys Glu Gln
Arg Lys Glu Lys420 425 430Glu Arg Glu Glu
Arg Glu Glu Arg Arg Asp Arg Arg Gln Glu Lys Asn435 440
445Leu Thr Lys Ile Leu Ala Ala Val Val Glu Gly Lys Ser Ser
Arg Glu450 455 460Arg Glu Arg Asp Phe Arg
Lys Ile Arg Ser Gly Pro Arg Gln Ser Gly465 470
475 480Asn Leu Gly Asn Arg Thr Pro Leu Asp Lys Asp
Gln Cys Ala Tyr Cys485 490 495Lys Glu Lys
Gly His Trp Ala Arg Asn Cys Pro Lys Lys Gly Asn Lys500
505 510Gly Pro Lys Val Leu Ala Leu Glu Glu Asp Lys Asp515
52076401PRTPorcine endogenous retrovirus 76Met Gly Ala
Thr Gly Gln Arg Gln Tyr Pro Trp Thr Thr Arg Arg Thr1 5
10 15Val Asp Leu Gly Val Gly Arg Val Thr His
Ser Phe Leu Val Ile Pro20 25 30Glu Cys
Pro Val Pro Leu Leu Gly Arg Asp Leu Leu Thr Lys Met Gly35
40 45Ala Gln Ile Ser Phe Glu Gln Gly Arg Pro Glu Val
Ser Val Asn Asn50 55 60Lys Pro Ile Thr
Val Leu Thr Leu Gln Leu Asp Asp Glu Tyr Arg Leu65 70
75 80Tyr Ser Pro Gln Val Lys Pro Asp Gln
Asp Ile Gln Ser Trp Leu Glu85 90 95Gln
Phe Pro Gln Ala Trp Ala Glu Thr Ala Gly Met Gly Leu Ala Lys100
105 110Gln Val Pro Pro Gln Val Ile Gln Leu Lys Ala
Ser Ala Thr Pro Val115 120 125Ser Val Arg
Gln Tyr Pro Leu Ser Arg Glu Ala Arg Glu Gly Ile Trp130
135 140Pro His Val Gln Arg Leu Ile Gln Gln Gly Ile Leu
Val Pro Val Gln145 150 155
160Ser Pro Trp Asn Thr Pro Leu Leu Pro Val Arg Lys Pro Gly Thr Asn165
170 175Asp Tyr Arg Pro Val Gln Asp Leu Arg
Glu Val Asn Lys Arg Val Gln180 185 190Asp
Ile His Pro Thr Val Pro Asn Pro Tyr Asn Leu Leu Ser Ala Leu195
200 205Pro Pro Glu Arg Asn Trp Tyr Thr Val Leu Asp
Leu Lys Asp Ala Phe210 215 220Phe Cys Leu
Arg Leu His Pro Thr Ser Gln Pro Leu Phe Thr Phe Glu225
230 235 240Trp Arg Asp Pro Gly Thr Gly
Arg Thr Gly Gln Leu Thr Trp Thr Arg245 250
255Leu Pro Gln Gly Phe Lys Asn Ser Pro Thr Ile Phe Asp Glu Ala Leu260
265 270His Arg Asp Leu Ala Asn Phe Arg Ile
Gln His Pro Gln Val Thr Leu275 280 285Leu
Gln Tyr Val Asp Asp Leu Leu Leu Ala Gly Ala Thr Lys Gln Asp290
295 300Cys Leu Glu Gly Thr Lys Ala Leu Leu Leu Glu
Leu Ser Asp Leu Gly305 310 315
320Tyr Arg Ala Ser Ala Lys Lys Ala Gln Ile Cys Arg Arg Glu Val
Thr325 330 335Tyr Leu Gly Tyr Ser Leu Arg
Gly Gly Gln Arg Trp Leu Thr Glu Ala340 345
350Arg Lys Lys Thr Val Val Gln Ile Pro Ala Pro Thr Thr Ala Lys Gln355
360 365Val Arg Glu Phe Leu Gly Thr Ala Gly
Phe Cys Arg Leu Trp Ile Pro370 375 380Gly
Phe Ala Thr Leu Ala Ala Pro Leu Tyr Pro Leu Thr Lys Glu Lys385
390 395 400Gly77271PRTPorcine
endogenous retrovirus 77Lys Arg Gly Leu Leu Thr Ser Ala Gly Arg Glu Ile
Lys Asn Lys Glu1 5 10
15Glu Ile Leu Ser Leu Leu Glu Ala Leu His Leu Pro Lys Arg Leu Ala20
25 30Ile Ile His Cys Pro Gly His Gln Lys Ala
Lys Asp Leu Ile Ser Arg35 40 45Gly Asn
Gln Met Ala Asp Arg Val Ala Lys Gln Ala Ala Gln Ala Val50
55 60Asn Leu Leu Pro Ile Ile Glu Thr Pro Lys Ala Pro
Glu Pro Arg Arg65 70 75
80Gln Tyr Thr Leu Glu Asp Trp Gln Glu Ile Lys Lys Ile Asp Gln Phe85
90 95Ser Glu Thr Pro Glu Gly Thr Cys Tyr Thr
Ser Tyr Gly Lys Glu Ile100 105 110Leu Pro
His Lys Glu Gly Leu Glu Tyr Val Gln Gln Ile His Arg Leu115
120 125Thr His Leu Gly Thr Lys His Leu Gln Gln Leu Val
Arg Thr Ser Pro130 135 140Tyr His Val Leu
Arg Leu Pro Gly Val Ala Asp Ser Val Val Lys His145 150
155 160Cys Val Pro Cys Gln Leu Val Asn Ala
Asn Pro Ser Arg Ile Pro Pro165 170 175Gly
Lys Arg Leu Arg Gly Ser His Pro Gly Ala His Trp Glu Val Asp180
185 190Phe Thr Glu Val Lys Pro Ala Lys Tyr Gly Asn
Lys Tyr Leu Leu Val195 200 205Phe Val Asp
Thr Phe Ser Gly Trp Val Glu Ala Tyr Pro Thr Lys Lys210
215 220Glu Thr Ser Thr Val Val Ala Lys Lys Ile Leu Glu
Glu Ile Phe Pro225 230 235
240Arg Phe Gly Ile Pro Lys Val Ile Gly Ser Asp Asn Gly Pro Ala Phe245
250 255Val Ala Gln Val Ser Gln Gly Leu Ala
Lys Ile Leu Gly Ile Asp260 265
27078139PRTPorcine endogenous retrovirus 78Lys Leu His Cys Ala Tyr Arg
Pro Gln Ser Ser Gly Gln Val Glu Arg1 5 10
15Met Asn Arg Thr Ile Lys Glu Thr Leu Thr Lys Leu Thr Thr
Glu Thr20 25 30Gly Ile Asn Asp Trp Met
Ala Leu Leu Pro Phe Val Leu Phe Arg Val35 40
45Arg Asn Thr Pro Gly Gln Phe Gly Leu Thr Pro Tyr Lys Leu Leu Tyr50
55 60Gly Gly Pro Pro Pro Leu Ala Glu Ile
Ala Phe Ala His Ser Ala Asp65 70 75
80Val Leu Leu Ser Gln Pro Leu Phe Ser Arg Leu Lys Ala Leu
Glu Trp85 90 95Val Arg Gln Arg Ala Trp
Lys Gln Leu Arg Glu Ala Tyr Ser Gly Gly100 105
110Asp Leu Gln Val Pro His Arg Phe Gln Val Gly Asp Ser Val Tyr
Val115 120 125Arg Arg His Arg Ala Gly Asn
Leu Glu Thr Arg130 13579657PRTPorcine endogenous
retrovirus 79Lys Gly Pro Tyr Leu Val Leu Leu Thr Thr Pro Thr Ala Val Lys
Val1 5 10 15Glu Gly Ile
Pro Leu Ser Phe Ala Ser Ile Ala Trp Phe Leu Thr Leu20 25
30Ser Ile Thr Pro Gln Val Asn Gly Lys Arg Leu Val Asp
Ser Pro Asn35 40 45Ser His Lys Pro Leu
Ser Leu Thr Trp Leu Leu Thr Asp Ser Gly Thr50 55
60Gly Ile Asn Ile Asn Ser Thr Gln Gly Glu Ala Pro Leu Gly Thr
Trp65 70 75 80Trp Pro
Glu Leu Tyr Val Cys Leu Arg Ser Val Ile Pro Gly Leu Asn85
90 95Asp Gln Ala Thr Pro Pro Asp Val Leu Arg Ala Tyr
Gly Phe Tyr Val100 105 110Cys Pro Gly Pro
Pro Asn Asn Glu Glu Tyr Cys Gly Asn Pro Gln Asp115 120
125Phe Phe Cys Lys Gln Trp Ser Cys Ile Thr Ser Asn Asp Gly
Asn Trp130 135 140Lys Trp Pro Val Ser Gln
Gln Asp Arg Val Ser Tyr Ser Phe Val Asn145 150
155 160Asn Pro Thr Ser Tyr Asn Gln Phe Asn Tyr Gly
His Gly Arg Trp Lys165 170 175Asp Trp Gln
Gln Arg Val Gln Lys Asp Val Arg Asn Lys Gln Ile Ser180
185 190Cys His Ser Leu Asp Leu Asp Tyr Leu Lys Ile Ser
Phe Thr Glu Lys195 200 205Gly Lys Gln Glu
Asn Ile Gln Lys Trp Val Asn Gly Ile Ser Trp Gly210 215
220Ile Val Tyr Tyr Gly Gly Ser Gly Arg Lys Lys Gly Ser Val
Leu Thr225 230 235 240Ile
Arg Leu Arg Ile Glu Thr Gln Met Glu Pro Pro Val Ala Ile Gly245
250 255Pro Asn Lys Gly Leu Ala Glu Gln Gly Pro Pro
Ile Gln Glu Gln Arg260 265 270Pro Ser Pro
Asn Pro Ser Asp Tyr Asn Thr Thr Ser Gly Ser Val Pro275
280 285Thr Glu Pro Asn Ile Thr Ile Lys Thr Gly Ala Lys
Leu Phe Ser Leu290 295 300Ile Gln Gly Ala
Phe Gln Ala Leu Asn Ser Thr Thr Pro Glu Ala Thr305 310
315 320Ser Ser Cys Trp Leu Cys Leu Ala Ser
Gly Pro Pro Tyr Tyr Glu Gly325 330 335Met
Ala Arg Gly Gly Lys Phe Asn Val Thr Lys Glu His Arg Asp Gln340
345 350Cys Thr Trp Gly Ser Gln Asn Lys Leu Thr Leu
Thr Glu Val Ser Gly355 360 365Lys Gly Thr
Cys Ile Gly Met Val Pro Pro Ser His Gln His Leu Cys370
375 380Asn His Thr Glu Ala Phe Asn Arg Thr Ser Glu Ser
Gln Tyr Leu Val385 390 395
400Pro Gly Tyr Asp Arg Trp Trp Ala Cys Asn Thr Gly Leu Thr Pro Cys405
410 415Val Ser Thr Leu Val Phe Asn Gln Thr
Lys Asp Phe Cys Val Met Val420 425 430Gln
Ile Val Pro Arg Val Tyr Tyr Tyr Pro Glu Lys Ala Val Leu Asp435
440 445Glu Tyr Asp Tyr Arg Tyr Asn Arg Pro Lys Arg
Glu Pro Ile Ser Leu450 455 460Thr Leu Ala
Val Met Leu Gly Leu Gly Val Ala Ala Gly Val Gly Thr465
470 475 480Gly Thr Ala Ala Leu Ile Thr
Gly Pro Gln Gln Leu Glu Lys Gly Leu485 490
495Ser Asn Leu His Arg Ile Val Thr Glu Asp Leu Gln Ala Leu Glu Lys500
505 510Ser Val Ser Asn Leu Glu Glu Ser Leu
Thr Ser Leu Ser Glu Val Val515 520 525Leu
Gln Asn Arg Arg Gly Leu Asp Leu Leu Phe Leu Lys Glu Gly Gly530
535 540Leu Cys Val Ala Leu Lys Glu Glu Cys Cys Phe
Tyr Val Asp His Ser545 550 555
560Gly Ala Ile Arg Asp Ser Met Ser Lys Leu Arg Glu Arg Leu Glu
Arg565 570 575Arg Arg Arg Glu Arg Glu Ala
Asp Gln Gly Trp Phe Glu Gly Trp Phe580 585
590Asn Arg Ser Pro Trp Met Thr Thr Leu Leu Ser Ala Leu Thr Gly Pro595
600 605Leu Val Val Leu Leu Leu Leu Leu Thr
Val Gly Pro Cys Leu Ile Asn610 615 620Arg
Phe Val Ala Phe Val Arg Glu Arg Val Ser Ala Val Gln Ile Met625
630 635 640Val Leu Arg Gln Gln Tyr
Gln Gly Leu Leu Ser Gln Gly Glu Thr Asp645 650
655Leu80524PRTPorcine endogenous retrovirus 80Met Gly Gln Thr Val
Thr Thr Pro Leu Ser Leu Thr Leu Asp His Trp1 5
10 15Thr Glu Val Lys Ser Arg Ala His Asn Leu Ser Val
Gln Val Lys Lys20 25 30Gly Pro Trp Gln
Thr Phe Cys Val Ser Glu Trp Pro Thr Phe Asp Val35 40
45Gly Trp Pro Ser Glu Gly Thr Phe Asn Ser Glu Ile Ile Leu
Ala Val50 55 60Lys Ala Val Ile Phe Gln
Thr Gly Pro Gly Ser His Pro Asp Gln Glu65 70
75 80Pro Tyr Ile Leu Thr Trp Gln Asp Leu Ala Glu
Asp Pro Pro Pro Trp85 90 95Val Lys Pro
Trp Leu Asn Lys Pro Arg Lys Pro Gly Pro Arg Ile Leu100
105 110Ala Leu Gly Glu Lys Asn Lys His Ser Ala Glu Lys
Val Lys Pro Ser115 120 125Pro His Ile Tyr
Pro Glu Ile Glu Glu Pro Pro Ala Trp Pro Glu Pro130 135
140Gln Ser Val Pro Pro Pro Pro Tyr Leu Ala Gln Gly Ala Ala
Arg Gly145 150 155 160Pro
Phe Ala Pro Pro Gly Ala Pro Ala Val Glu Gly Pro Ala Ala Gly165
170 175Thr Arg Ser Arg Arg Gly Ala Thr Pro Glu Arg
Thr Asp Glu Ile Ala180 185 190Thr Leu Pro
Leu Arg Thr Tyr Gly Pro Pro Thr Pro Gly Gly Gln Leu195
200 205Gln Pro Leu Gln Tyr Trp Pro Phe Ser Ser Ala Asp
Leu Tyr Asn Trp210 215 220Lys Thr Asn His
Pro Pro Phe Ser Glu Asp Pro Gln Arg Leu Thr Gly225 230
235 240Leu Val Glu Ser Leu Met Phe Ser His
Gln Pro Thr Trp Asp Asp Cys245 250 255Gln
Gln Leu Leu Gln Thr Leu Phe Thr Thr Glu Glu Arg Glu Arg Ile260
265 270Leu Leu Glu Ala Arg Lys Asn Val Pro Gly Ala
Asp Gly Arg Pro Thr275 280 285Arg Leu Gln
Asn Glu Ile Asp Met Gly Phe Pro Leu Thr Arg Pro Gly290
295 300Trp Asp Tyr Asn Thr Ala Glu Gly Arg Glu Ser Leu
Lys Ile Tyr Arg305 310 315
320Gln Ala Leu Val Ala Gly Leu Arg Gly Ala Ser Arg Arg Pro Thr Asn325
330 335Leu Ala Lys Val Arg Glu Val Met Gln
Gly Pro Asn Glu Pro Pro Ser340 345 350Val
Phe Leu Glu Arg Leu Leu Glu Ala Phe Arg Arg Tyr Thr Pro Phe355
360 365Asp Pro Thr Ser Glu Ala Gln Lys Ala Ser Val
Ala Leu Ala Phe Ile370 375 380Gly Gln Ser
Ala Leu Asp Ile Arg Lys Lys Leu Gln Arg Leu Glu Gly385
390 395 400Leu Gln Glu Ala Glu Leu Arg
Asp Leu Val Lys Glu Ala Glu Lys Val405 410
415Tyr Tyr Lys Arg Glu Thr Glu Glu Glu Arg Glu Gln Arg Lys Glu Arg420
425 430Glu Arg Glu Glu Arg Glu Glu Arg Arg
Asn Lys Arg Gln Glu Lys Asn435 440 445Leu
Thr Lys Ile Leu Ala Ala Val Val Glu Gly Lys Ser Asn Thr Glu450
455 460Arg Glu Arg Asp Phe Arg Lys Ile Arg Ser Gly
Pro Arg Gln Ser Gly465 470 475
480Asn Leu Gly Asn Arg Thr Pro Leu Asp Lys Asp Gln Cys Ala Tyr
Cys485 490 495Lys Glu Arg Gly His Trp Ala
Arg Asn Cys Pro Lys Lys Gly Asn Lys500 505
510Gly Pro Arg Ile Leu Ala Leu Glu Glu Asp Lys Asp515
520811145PRTPorcine endogenous retrovirus 81Met Gly Ala Thr Gly Gln Gln
Gln Tyr Pro Trp Thr Thr Arg Arg Thr1 5 10
15Val Asp Leu Gly Val Gly Arg Val Thr His Ser Phe Leu Val
Ile Pro20 25 30Glu Cys Pro Ala Pro Leu
Leu Gly Arg Asp Leu Leu Thr Lys Met Gly35 40
45Ala Gln Ile Ser Phe Glu Gln Gly Lys Pro Glu Val Ser Ala Asn Asn50
55 60Lys Pro Ile Thr Val Leu Thr Leu Gln
Leu Asp Asp Glu Tyr Arg Leu65 70 75
80Tyr Ser Pro Leu Val Lys Pro Asp Gln Asn Ile Gln Phe Trp
Leu Glu85 90 95Gln Phe Pro Gln Ala Trp
Ala Glu Thr Ala Gly Met Gly Leu Ala Lys100 105
110Gln Val Pro Pro Gln Val Ile Gln Leu Lys Ala Ser Ala Thr Pro
Val115 120 125Ser Val Arg Gln Tyr Pro Leu
Ser Lys Glu Ala Gln Glu Gly Ile Arg130 135
140Pro His Val Gln Arg Leu Ile Gln Gln Gly Ile Leu Val Pro Val Gln145
150 155 160Ser Pro Trp Asn
Thr Pro Leu Leu Pro Val Arg Lys Pro Gly Thr Asn165 170
175Asp Tyr Arg Pro Val Gln Asp Leu Arg Glu Val Asn Lys Arg
Val Gln180 185 190Asp Ile His Pro Thr Val
Pro Asn Pro Tyr Asn Leu Leu Cys Ala Leu195 200
205Pro Pro Gln Arg Ser Trp Tyr Thr Val Leu Asp Leu Lys Asp Ala
Phe210 215 220Phe Cys Leu Arg Leu His Pro
Thr Ser Gln Pro Leu Phe Ala Phe Glu225 230
235 240Trp Arg Asp Pro Gly Thr Gly Arg Thr Gly Gln Leu
Thr Trp Thr Arg245 250 255Leu Pro Gln Gly
Phe Lys Asn Ser Pro Thr Ile Phe Asp Glu Ala Leu260 265
270His Arg Asp Leu Ala Asn Phe Arg Ile Gln His Pro Gln Val
Thr Leu275 280 285Leu Gln Tyr Val Asp Asp
Leu Leu Leu Ala Gly Ala Thr Lys Gln Asp290 295
300Cys Leu Glu Gly Thr Lys Ala Leu Leu Leu Glu Leu Ser Asp Leu
Gly305 310 315 320Tyr Arg
Ala Ser Ala Lys Lys Ala Gln Ile Cys Arg Arg Glu Val Thr325
330 335Tyr Leu Gly Tyr Ser Leu Arg Asp Gly Gln Arg Trp
Leu Thr Glu Ala340 345 350Arg Lys Lys Thr
Val Val Gln Ile Pro Ala Pro Thr Thr Ala Lys Gln355 360
365Met Arg Glu Phe Leu Gly Thr Ala Gly Phe Cys Arg Leu Trp
Ile Pro370 375 380Gly Phe Ala Thr Leu Ala
Ala Pro Leu Tyr Pro Leu Thr Lys Glu Lys385 390
395 400Gly Glu Phe Ser Trp Ala Pro Glu His Gln Lys
Ala Phe Asp Ala Ile405 410 415Lys Lys Ala
Leu Leu Ser Ala Pro Ala Leu Ala Leu Pro Asp Val Thr420
425 430Lys Pro Phe Thr Leu Tyr Val Asp Glu Arg Lys Gly
Val Ala Arg Gly435 440 445Val Leu Thr Gln
Thr Leu Gly Pro Trp Arg Arg Pro Val Ala Tyr Leu450 455
460Ser Lys Lys Leu Asp Pro Val Ala Ser Gly Trp Pro Ile Cys
Leu Lys465 470 475 480Ala
Ile Ala Ala Val Ala Ile Leu Val Lys Asp Ala Asp Lys Leu Thr485
490 495Leu Gly Gln Asn Ile Thr Val Ile Ala Pro His
Ala Leu Glu Asn Ile500 505 510Val Arg Gln
Pro Pro Asp Arg Trp Met Thr Asn Ala Arg Met Thr His515
520 525Tyr Gln Ser Leu Leu Leu Thr Glu Arg Val Thr Phe
Ala Pro Pro Ala530 535 540Ala Leu Asn Pro
Ala Thr Leu Leu Pro Glu Glu Thr Asp Glu Pro Val545 550
555 560Thr His Asp Cys His Gln Leu Leu Ile
Glu Glu Thr Gly Val Arg Lys565 570 575Asp
Leu Thr Asp Ile Pro Leu Thr Gly Glu Val Leu Thr Trp Phe Thr580
585 590Asp Gly Ser Ser Tyr Val Val Glu Gly Lys Arg
Met Ala Gly Ala Ala595 600 605Val Val Asp
Gly Thr Arg Thr Ile Trp Ala Ser Ser Leu Pro Glu Gly610
615 620Thr Ser Ala Gln Lys Ala Glu Leu Met Ala Leu Thr
Gln Ala Leu Arg625 630 635
640Leu Ala Glu Gly Lys Ser Ile Asn Ile Tyr Thr Asp Ser Arg Tyr Ala645
650 655Phe Ala Thr Ala His Val His Gly Ala
Ile Tyr Lys Gln Arg Gly Leu660 665 670Leu
Thr Ser Ala Gly Arg Glu Ile Lys Asn Lys Glu Glu Ile Leu Ser675
680 685Leu Leu Glu Ala Val His Leu Pro Lys Arg Leu
Ala Ile Ile His Cys690 695 700Pro Gly His
Gln Lys Ala Lys Asp Leu Ile Ser Arg Gly Asn Gln Met705
710 715 720Ala Asp Arg Val Ala Lys Gln
Ala Ala Gln Gly Val Asn Leu Leu Pro725 730
735Ile Ile Glu Met Pro Lys Ala Pro Glu Pro Arg Arg Gln Tyr Thr Leu740
745 750Glu Asp Trp Gln Glu Ile Lys Lys Ile
Asp Gln Phe Ser Glu Thr Pro755 760 765Glu
Gly Thr Cys Tyr Thr Ser Asp Gly Lys Glu Ile Leu Pro His Lys770
775 780Glu Gly Leu Glu Tyr Val Gln Gln Ile His Arg
Leu Thr His Leu Gly785 790 795
800Thr Lys His Leu Gln Gln Leu Val Arg Thr Ser Pro Tyr His Val
Leu805 810 815Arg Leu Pro Gly Val Ala Asp
Ser Val Val Lys His Cys Val Pro Cys820 825
830Gln Leu Val Asn Ala Asn Pro Ser Arg Met Pro Pro Gly Lys Arg Leu835
840 845Arg Gly Ser His Pro Gly Ala His Trp
Glu Val Asp Phe Thr Glu Val850 855 860Lys
Pro Ala Lys Tyr Gly Asn Lys Tyr Leu Leu Val Phe Val Asp Thr865
870 875 880Phe Ser Gly Trp Val Glu
Ala Tyr Pro Thr Lys Lys Glu Thr Ser Thr885 890
895Val Val Ala Lys Lys Ile Leu Glu Glu Ile Phe Pro Arg Phe Gly
Ile900 905 910Pro Lys Val Ile Gly Ser Asp
Asn Gly Pro Ala Phe Val Ala Gln Val915 920
925Ser Gln Gly Leu Ala Lys Ile Leu Gly Ile Asp Trp Lys Leu His Cys930
935 940Ala Tyr Arg Pro Gln Ser Ser Gly Gln
Val Glu Arg Met Asn Arg Thr945 950 955
960Ile Lys Glu Thr Leu Thr Lys Leu Thr Ala Glu Thr Gly Val
Asn Asp965 970 975Trp Ile Ala Leu Leu Pro
Phe Val Leu Phe Arg Val Arg Asn Thr Pro980 985
990Gly Gln Phe Gly Leu Thr Pro Tyr Glu Leu Leu Tyr Gly Gly Pro
Pro995 1000 1005Pro Leu Val Glu Ile Ala
Ser Val His Ser Ala Asp Val Leu Leu Ser1010 1015
1020Gln Pro Leu Phe Ser Arg Leu Lys Ala Leu Glu Trp Val Arg Gln
Arg1025 1030 1035 1040Ala
Trp Arg Gln Leu Arg Glu Ala Tyr Ser Gly Gly Gly Asp Leu Gln1045
1050 1055Ile Pro His Arg Phe Gln Val Gly Asp Ser Val
Tyr Val Arg Arg His1060 1065 1070Arg Ala
Gly Asn Leu Glu Thr Arg Trp Lys Gly Pro Tyr Leu Val Leu1075
1080 1085Leu Thr Thr Pro Thr Ala Val Lys Val Glu Gly Ile
Ser Thr Trp Ile1090 1095 1100His Ala Ser
His Val Lys Pro Ala Pro Pro Pro Asp Ser Gly Trp Lys1105
1110 1115 1120Ala Glu Lys Thr Glu Asn Pro
Leu Lys Leu Arg Leu His Arg Val Val1125 1130
1135Pro Tyr Ser Val Asn Asn Leu Ser Asp1140
114582638PRTPorcine endogenous retrovirus 82Met His Pro Thr Leu Asn Arg
Arg His Leu Pro Ile Arg Gly Gly Lys1 5 10
15Pro Lys Arg Leu Lys Ile Pro Leu Ser Phe Ala Ser Ile Ala
Trp Phe20 25 30Leu Thr Leu Ser Ile Thr
Ser Gln Thr Asn Gly Met Arg Ile Gly Asp35 40
45Ser Leu Asn Ser His Lys Pro Leu Ser Leu Thr Trp Leu Ile Thr Asp50
55 60Ser Gly Thr Gly Ile Asn Ile Asn Asn
Thr Gln Gly Glu Ala Pro Leu65 70 75
80Gly Thr Trp Trp Pro Asp Leu Tyr Val Cys Leu Arg Ser Val
Ile Pro85 90 95Ser Leu Thr Ser Pro Pro
Asp Ile Leu His Ala His Gly Phe Tyr Val100 105
110Cys Pro Gly Pro Pro Asn Asn Gly Lys His Cys Gly Asn Pro Arg
Asp115 120 125Phe Phe Cys Lys Gln Trp Asn
Cys Val Thr Ser Asn Asp Gly Tyr Trp130 135
140Lys Trp Pro Thr Ser Gln Gln Asp Arg Val Ser Phe Ser Tyr Val Asn145
150 155 160Thr Tyr Thr Ser
Ser Gly Gln Phe Asn Tyr Leu Thr Trp Ile Arg Thr165 170
175Gly Ser Pro Lys Cys Ser Pro Ser Asp Leu Asp Tyr Leu Lys
Ile Ser180 185 190Phe Thr Glu Lys Gly Lys
Gln Glu Asn Ile Leu Lys Trp Val Asn Gly195 200
205Met Ser Trp Gly Met Val Tyr Tyr Gly Gly Ser Gly Lys Gln Pro
Gly210 215 220Ser Ile Leu Thr Ile Arg Leu
Lys Ile Asn Gln Leu Glu Pro Pro Met225 230
235 240Ala Ile Gly Pro Asn Thr Val Leu Thr Gly Gln Arg
Pro Pro Thr Gln245 250 255Gly Pro Gly Pro
Ser Ser Asn Ile Thr Ser Gly Ser Asp Pro Thr Glu260 265
270Ser Asn Ser Thr Thr Lys Met Gly Ala Lys Leu Phe Ser Leu
Ile Gln275 280 285Gly Ala Phe Gln Ala Leu
Asn Ser Thr Thr Pro Glu Ala Thr Ser Ser290 295
300Cys Trp Leu Cys Leu Ala Ser Gly Pro Pro Tyr Tyr Glu Gly Met
Ala305 310 315 320Arg Arg
Gly Lys Phe Asn Val Thr Lys Glu His Arg Asp Gln Cys Thr325
330 335Trp Gly Ser Gln Asn Lys Leu Thr Leu Thr Glu Val
Ser Gly Lys Gly340 345 350Thr Cys Ile Gly
Lys Val Pro Pro Ser His Gln His Leu Cys Asn His355 360
365Thr Glu Ala Phe Asn Gln Thr Ser Glu Ser Gln Tyr Leu Val
Pro Gly370 375 380Tyr Asp Arg Trp Trp Ala
Cys Asn Thr Gly Leu Thr Pro Cys Val Ser385 390
395 400Thr Leu Val Phe Asn Gln Thr Lys Asp Phe Cys
Ile Met Val Gln Ile405 410 415Val Pro Arg
Val Tyr Tyr Tyr Pro Glu Lys Ala Ile Leu Asp Glu Tyr420
425 430Asp Tyr Arg Asn His Arg Gln Lys Arg Glu Pro Ile
Ser Leu Thr Leu435 440 445Ala Val Met Leu
Gly Leu Gly Val Ala Ala Gly Val Gly Thr Gly Thr450 455
460Ala Ala Leu Val Thr Gly Pro Gln Gln Leu Glu Thr Gly Leu
Ser Asn465 470 475 480Leu
His Arg Ile Val Thr Glu Asp Leu Gln Ala Leu Glu Lys Ser Val485
490 495Ser Asn Leu Glu Glu Ser Leu Thr Ser Leu Ser
Glu Val Val Leu Gln500 505 510Asn Arg Arg
Gly Leu Asp Leu Leu Phe Leu Lys Glu Gly Gly Leu Cys515
520 525Val Ala Leu Lys Glu Glu Cys Cys Phe Tyr Val Asp
His Ser Gly Ala530 535 540Ile Arg Asp Ser
Met Asn Lys Leu Arg Glu Arg Leu Glu Lys Arg Arg545 550
555 560Arg Glu Lys Glu Thr Thr Gln Gly Trp
Phe Glu Gly Trp Phe Asn Arg565 570 575Ser
Leu Trp Leu Ala Thr Leu Leu Ser Ala Leu Thr Gly Pro Leu Ile580
585 590Val Leu Leu Leu Leu Leu Thr Val Gly Pro Cys
Ile Ile Asn Lys Leu595 600 605Ile Ala Phe
Ile Arg Glu Arg Ile Ser Ala Val Gln Ile Met Val Leu610
615 620Arg Gln Gln Tyr Gln Ser Pro Ser Ser Arg Glu Ala
Gly Arg625 630 635
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic: