Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: Discovery, Cloning and Purification of Thermococccus sp. (Strain 9 Degrees N-7) Dna Ligase

Inventors:  Ira Schildkraut (Cerrillos, NM, US)  Ezra Schildkraut (Cerrillos, NM, US)
Assignees:  NEW ENGLAND BIOLABS, INC.
IPC8 Class: AC12P1934FI
USPC Class: 435 9152
Class name: Involving a ligase (6.)
Publication date: 06/04/2009
Patent application number: 20090142811






Sign up to receive free email alerts when patent applications with chosen keywords are published SIGN UP

Abstract:

Compositions that describe a thermostable DNA ligase isolated from Thermococcus sp. (strain 9° N-7) and methods for making und using the same are described. The thermostable DMA ligase depends on ATP and not NAD+ as a cofactor during ligation, and retains activity at 100° C.

Claims:

1. A substantially pure recombinant protein having DNA ligase activity and having at least 91% amino acid sequence identity with SEQ ID NO:13.

2. A substantially pure protein having DNA ligase activity encoded by a DNA sequence selected from the group consisting of:(a) a sequence substantially the same as SEQ ID NO:2;(b) a sequence substantially complementary to SEQ ID NO:2,(c) a sequence that hybridizes to SEQ ID NO:2 under stringent conditions; and(d) a sequence encoding SEQ ID NO:13.

3. The protein according to claim 1, wherein at least 25% of ligase activity is retained after a 30 minute incubation at a temperature of about 100.degree. C.

4. The protein according to claim 2, wherein at least 25% of ligase activity is retained after a 30 minute incubation at a temperature of about 100.degree. C.

5. A protein according to claim 1, 2, 3 or 4 that can utilize ATP but not NAD.sup.+ as a cofactor during ligation.

6. A DNA encoding a DNA ligase, the DNA having a sequence selected from the group consisting of:(a) a sequence substantially the same as SEQ ID NO:2;(b) a sequence substantially complementary to SEQ ID NO:2,(c) a sequence that hybridizes to SEQ ID NO:2 under stringent conditions; and(d) a sequence encoding SEQ ID NO:13.

7. A vector containing the DNA of claim 6.

8. A host cell capable of expressing the protein of claim 1.

9. A method of ligating a phosphodiester bond, comprising:(a) selecting a ligase according to claim 1 or 2;(b) mixing the ligase with a DNA, the DNA containing a break in at least one strand of the DNA; and(c) ligating the phosphodiester bond at the break.

10. A method according to claim 9, wherein the ligase is a thermostable ligase from an archaeal isolate.

11. A method according to claim 9, wherein the archaeal isolate is Thermococcus sp (strain 9.degree. N-7).

Description:

BACKGROUND

[0001]Thermococcus is a genus of the phylum Archaea. These ancient organisms grow in diverse environments under extreme conditions including high temperatures. The ability to grow these organisms in the laboratory is very limited so that little is known about their biochemistry or their metabolism.

[0002]Ligases are enzymes that catalyze the formation of a phosphodiester bond at the site of a single-stranded break in duplex DNA. The ligase enzyme also catalyzes the covalent linkage of duplex DNA generally blunt end to blunt end, or one cohesive end to another cohesive end. Ligases have been cloned from a variety of bacteria including one heat stable ligase-Thermus aquaticus (Taq ligase). This ligase has been described in U.S. Pat. No. 6,054,564.

[0003]Only a few Thermococci have been isolated and little is known about the properties of ligases they may contain or the genes encoding such proteins (see for example, Nakatani et al. J. Bacteriology 182: 6424-6433 (2000)). A ligase from a different genus of Archaea--a Pyrococcus, has been described in, for example, U.S. Pat. Nos. 5,506,137 and 5,700,672 and in Keppetipola et al. J. Bacteriology 187:6902-6908 (2005).

[0004]Ligases are used in many techniques in molecular biology including DNA amplification, sequencing and detection of single nucleotide polymorphisms. There is a continued need to find improved ligases that are stable at high temperatures and have rapid kinetics and stringent specificity.

SUMMARY

[0005]In an embodiment of the invention, a substantially pure recombinant protein having DNA ligase activity is provided where the protein has at least 91% amino acid sequence identity with SEQ ID NO:13.

[0006]In a further embodiment of the invention, a substantially pure protein having DNA ligase activity is provided where the DNA ligase is encoded by a DNA sequence selected from the group consisting of: (a) a sequence that substantially the same as SEQ ID NO:2; (b) a sequence that is substantially complementary to SEQ ID NO:2, (c) a sequence that is substantially hybridizes to SEQ ID NO:2 under stringent conditions; and (d) a sequence encoding SEQ ID NO:13.

[0007]The protein referred to in the above embodiments is further characterized in that at least 25% of ligase activity is retained by the ligase after 30 minutes incubation at a temperature of about 100° C. Moreover, the ligase may be further characterized by its use of ATP as a cofactor during ligation whereas NAD.sup.+ provides no detectable utility for this purpose.

[0008]In a further embodiment, a DNA encoding a DNA ligase is provided having a sequence selected from the group consisting of: (a) a sequence that is substantially the same as SEQ ID NO:2; (b) a sequence that is substantially complementary to SEQ ID NO:2, (c) a sequence that hybridizes to SEQ ID NO:2 under stringent conditions; and (d) a sequence encoding SEQ ID NO:13.

[0009]In a further embodiment, a vector is described that contains the DNA described above. In addition, a host cell is provided that is capable of expressing the ligase from the vector.

[0010]In a further embodiment, a method of ligating a phosphodiester bond is provided that includes: selecting a DNA ligase of the type described above; mixing the ligase with a DNA, the DNA containing a break in at least one strand of the DNA; and ligating the phosphodiester bond at the break.

[0011]In an example of the method, the DNA ligase is a thermostable ligase from an archaeal isolate more particularly Thermococcus sp. (strain 9° N-7).

BRIEF DESCRIPTION OF THE DRAWINGS

[0012]FIGS. 1a-1-1a-5 show DNA sequence alignments of 9° N-7 DNA ligase variants (SEQ ID NOS:1-7).

[0013]FIGS. 1b-1-1b-2 show protein alignments of Thermococcus sp. (strain 9° N-7) DNA ligase variants (SEQ ID NOS:8-15).

[0014]FIG. 2 shows a plasmid map of Thermococcus sp. (strain 9° N-7) DNA ligase gene inserted into litmus 28i.

[0015]FIG. 3 shows a plasmid map of Thermococcus sp. (strain 9° N-7) DNA ligase gene inserted into pMalC2x.

[0016]FIG. 4 shows protein alignments of Thermococcus sp. (strain 9° N-7) (SEQ ID NO:15) with Thermococcus fumicolans (SEQ ID NO:16), Thermococcus kodakaraensis (SEQ ID NO:17), Pyrococcus abyssi (SEQ ID NO:18), and Pyrococcus furiosus (SEQ ID NO:19).

[0017]FIG. 5 shows an SDS PAGE of phosphocellulose column fractions. Lanes are labeled as follows:

[0018]FT (flow-through of column) refers to fraction numbers 23-34;

[0019]MW refers to molecular weight standards.

The arrow indicates the position of a band corresponding to DNA ligase on the gel.

[0020]FIG. 6 shows thermostability of 9° N-7 DNA ligase. 30 μl of 10 mM Tris HCl pH 7.5, 2.5 mM MgCl2, 2.5 mM DTT, 300 μM ATP and 0.1% Triton X-100 containing 3 μl of a 1:100 dilution of purified 9° N-7 DNA ligase was further diluted serially 3 fold in 10 mM Tris HCl pH 7.5, 2.5 mM MgCl2, 2.5 mM DTT, 300 μM ATP and 0.1% Triton X-100. Four identical sets of dilutions were incubated for 30 minutes at 4° C., 80° C., 90° C. or 100° C.

[0021]To terminate the reaction, the samples were placed on ice and an equal volume of 10 mM Tris HCl, pH 7.5, 2.5 mM MgCl2, 2.5 mM DTT, 300° C. μM ATP, 0.1% Triton X-100 and 50 μg/ml of BstEII Lambda DNA was added to each tube. The reactions were then incubated at 45° C. for 15 minutes after which a 0.15 volume of 50% glycerol, 100 mM EDTA and bromophenol blue was added to each tube. The reactions were then incubated at 75° C. for 5 minutes and electrophoresed on 1% agarose TBE gel.

[0022]Panel A shows the results of incubation on ice for 30 minutes.

[0023]Panel B shows the results of incubation at 80° C. for 30 minutes.

[0024]Panel C shows the results of incubation at 90° C. for 30 minutes.

[0025]Panel D shows the results of incubation at 100° C. for 30 minutes.

For each panel the lanes are designated as follows:

[0026]Lane 1 represents no further dilution;

[0027]Lane 2 was diluted 1:3;

[0028]Lane 3 was diluted 1:9;

[0029]Lane 4 was diluted 1:27; and

[0030]Lane 5 was diluted 1:81.

[0031]FIG. 7 shows a gel in which 9° N-7 polymerase was compared with Taq polymerase in a repair mixture containing E. coli polymerase and E. coli Endo IV. The repair mixture was incubated with depurinated DNA and amplified.

[0032]Lane 1 is a control;

[0033]Lane 2 is the DNA in the absence of a repair mixture;

[0034]Lanes 3 and 4 are duplicate samples of DNA and a repair mix containing 480 units Taq ligase; and

[0035]Lanes 5 and 6 are duplicate samples of DNA and a repair mix containing 500 units of 9° N-7 ligase.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0036]The term "thermostable ligase" is used here to refer to an enzyme that catalyzes ligation of DNA and retains at least 25% of its activity after 30 minutes at 100° C. This thermostability under extreme temperatures is a characteristic that distinguishes the Thermococcus ligase (archaea) from Thermus ligase (bacteria).

[0037]Thermococcus sp. (strain 9° N-7) is a Thermococcus species isolated from hydrothermal vents (Southworth et al. PNAS 93:5281 (1996)).

[0038]The two known closest relatives to Thermococcus sp. (strain 9° N-7) DNA ligase are Thermococcus fumicolans ligase and Thermococcus kodakaraensis ligase (JP 2000308494-A/1), which share respectively 88% and 90% identity on the amino acid level. Both of these are reported to utilize either NAD.sup.+ or ATP as cofactors thereby constituting a new class of ligase. While T. fumicolans ligase is reported by Nakatani et al. (J. Bacteriology 182:6424-6433 (2000)) to utilize either NAD.sup.+ or ATP equally well and T. kodakaraensis ligase was active at a reduced level using NAD.sup.+ instead of ATP, Thermococcus sp. (strain 9° N-7) had no detectable activity with NAD.sup.+ (Example 2).

[0039]The terms "substantially the same" and "substantially complementary" are intended to mean that the DNA or amino acid sequence is largely the same or identical to the identified sequence or is largely the same or identical to the complementary sequence. The terms are intended to encompass sequences containing minor differences in amino acid or DNA sequence to that specified in the Figures. Such differences may arise from mutagenic events that do not significantly interfere with the ligation function of the protein.

[0040]In an embodiment of the invention, stringent hybridization is conducted under the following conditions: a) hybridization: 0.75M NaCl, 0.15 Tris HCl, 10 mM EDTA, 0.1% NaCl, 0.1% SLS, 0.03% BSA, 0.03% Ficoll 400, 0.03% PVP and 100 μg/ml boiled calf thymus DNA at 50° C. for about 12 hours and; b) wash 3 times for 30 minutes with 0.1×SET, 0.1% SDS, 0.1% NaCl and 0.1M phosphate buffer at 45° C. and the presence of double-stranded hybridized DNA detected on a Southern Blot.

[0041]All references cited herein as well as U.S. provisional application 60/717,296 filed Sep. 15, 2005 are incorporated by reference.

EXAMPLES

Example I

Cloning Thermococcus sp. (Strain 9° N-7) DNA Ligase Gene Using Degenerate Primers

[0042]The gene was first amplified from Thermococcus sp. (strain 9° N-7) genomic DNA by PCR. Sequences for forward primers were derived from the references by Nakatani et al. J. Bact. 182(22):6424-6433 (2000) (Thermococcus kodakaraensis) and Rolland et al. FEMS Microbiology Lett. 236(2):267-273 (2004) (Thermococcus fumicolans). Consensus sequences with designated degeneracy were designed as follows:

TABLE-US-00001 (SEQ ID NO: 20) Forward Primer 5'CGGTGGTGCATATGRGCGAYATGMRSTACTC (SEQ ID NO: 21) Reverse Primer 5'ATAAACTCTAGATTACYTCTTCGCCTTGAACCTCTCCTGG

[0043]The primers for Thermococcus sp. (strain 9° N-7) were used to amplify the gene for DNA ligase from genomic Thermococcus sp. (strain 9° N-7) DNA. The PCR reaction conditions used to clone the gene were as follows:

[0044]100 μl reaction mix containing 20 mM Tris-HCL, pH 8.8, 10 mM KCl, 10 mM (NH4)2SO4 with 4 mM MgSO4, 0.1% Triton X-100, 200 μM each dNTP, 50 ng of Thermococcus sp. (strain 9° N-7) genomic DNA, 500 ng each of forward and reverse primer, 2.5 units of Taq DNA polymerase and 0.02 units of Vent® DNA polymerase was heated to 94° C. for 1 minute, then brought to 45° C. for 1 minute and then brought to 72° C. for 3 minutes. The temperature cycle was repeated 30 times. After cycling was completed the reaction temperature was reduced to room temperature and 5 units of E. coli DNA polymerase Klenow fragment was added and incubated for a further 5 minutes at room temperature. The reaction was then adjusted to 70 mM EDTA. The PCR product was phenol extracted, alcohol precipitated and desalted on CL6B sepharose spin column.

[0045]The 1700 bp PCR product was cloned into E. coli. EcoRV-cleaved litmus 28i was used as the vector to clone the DNA fragment.

[0046]A 10 μl ligation reaction in T4 DNA ligase buffer contained 80 ng of the insert, 80 ng of litmus vector and 400 units of T4 DNA ligase (New England Biolabs, Inc., Ipswich, Mass.). The ligation reaction was incubated at 16° C. overnight, electroporated into E. coli TB1 cells and plated on IPTG XGAL plates.

[0047]The white colonies were picked. One out of nine white colonies had a 1700 bp insert. An independent electroporation yielded another clone with 1700 bp insert. The inserts in these two clones were sequenced.

[0048]From the sequence of these clones, a new less degenerate forward primer was designed as follows:

TABLE-US-00002 (SEQ ID NO: 22) 9°N forward primer: 5'cggtggtgcatatgggcgayatgaggtactccgagctgg

(2) Cloning Thermococcus sp. (strain 9° N-7) Ligase Using a Second Forward Primer that was Less Degenerate then the Primer in (1)

[0049]Four additional independent PCR reactions were performed using the 9° N-7 forward primer, which contained only one degenerate base in place of the forward primer in (1) above, which contained 5 degenerate bases.

[0050]100 μl of Phusion HF buffer (New England Biolabs, Inc., Ipswich, Mass.) containing 50 ng of Thermococcus sp. (strain 9° N-7) genomic DNA, 500 ng each of forward and reverse primer, 200 μM each dNTP and 1 μl Phusion DNA polymerase (New England Biolabs, Inc., Ipswich, Mass.) was heated to 98° C. for 30 seconds and then 25 cycles of 98° C. for 10 seconds, followed by 70° C. for 30 seconds followed by 72° C. for 1 minute. The reaction was then incubated 72° C. for 5 minutes. The product of each of the PCR reactions was treated as the initial PCR reaction and cloned into litmus 28i as described above. Two independent clones from the PCR reaction (A1 and A3) were confirmed by miniprep DNA to contain a 1700 base pair inserts as well as one clone from each of the other three PCR reactions (B2, C3, D3). These clones were then grown and their crude extracts were electrophoresed on SDS PAGE. Each of the clones expressed a 60 kd protein.

[0051]Plasmids from clones A1, A3, B2, C3, D3 and additionally lig7 and lig8 were purified and the inserts sequenced. The DNA sequences are provided in FIGS. 1a-1-1a-5 (SEQ ID NOS:1-7).

[0052]While not wishing to be limited by theory, the observed minor differences in sequences may be accounted for by clonal variation within the population of Thermococcus sp. (strain 9° N-7) cells. The sequence variations are all third position changes or conserved amino acid changes. Clone B2 is representative of the consensus sequence of the ligase. The DNA ligase was first expressed in a tightly controlled expression vector (FIG. 2).

(3) Expressing the Ligase Gene (B2) in E. coli

[0053]The B2 fragment was excised from the litmus vector by cleavage with NdeI and XbaI. The 1700 bp fragment was cut from the agarose gel and the gel slice was digested with agarase to release the fragment.

[0054]The expression vector pMalC2X (New England Biolabs, Inc., Ipswich, Mass.) was prepared by cleaving with NdeI and XbaI and dephosphorylated. The 1700 base pair cleaved PCR fragment was ligated to the pMalC2X vector in a 10 μl reaction containing 400 ng of insert and 100 ng of vector in T4 DNA ligase buffer and 200 units of T4 DNA ligase incubated at 16° C. for 16 hours. The ligation reaction was electroporated into E. coli TB1 cells and a clone carrying the 1700 bp fragment was isolated and designated Thermococcus sp. (strain 9° N-7) B2-1 (FIG. 3).

[0055]The clone was grown in LB media and induced with IPTG. A sample of the induced cells was lysed and electrophoresed in a SDS PAGE gel to reveal a band corresponding to a protein of size at ˜60 kd. The analysis of the protein sequence derived from the DNA sequence indicated the gene encoded a protein with 26 rare arginine codons. Therefore host cells containing the rare tRNA for arginine (E. coli BL-2 (DE3) RIL) (Stratagene, La Jolla, Calif.) were used to obtain higher levels of expression. After induction of the Thermococcus sp. (strain 9° N-7), B2-1 plasmid in the host sample was analyzed by SDS PAGE and a significant 60 kd band was observed.

(4) Comparison of Thermococcus sp. (Strain 9° N-7) Ligase With Other Thermostable DNA Ligases

[0056]Thermococcus sp. (strain 9° N-7) DNA ligase amino acid sequence was compared by CLUSTAL multiple sequence alignment to 4 other thermophilic DNA ligases.

CLUSTAL W (1.82) Multiple Sequence Alignments

[0057]Sequence format is Pearson.

Sequence 1: 9° N-7-B2 (SEQ ID NO:15) 564 aa

[0058]Sequence 2: T. kodakaraenis (SEQ ID NO:16) 562 aaSequence 3: P. abyssi (SEQ ID NO:17) 559 aaSequence 4: P. furiosus (SEQ ID NO:18) 561 aaSequence 5: T. fumicolans (SEQ ID NO:19) 559 aa

Identity Scores:

[0059]Sequences (1:2) Aligned. Score: 90Sequences (1:3) Aligned. Score: 81Sequences (1:4) Aligned. Score: 78Sequences (1:5) Aligned. Score: 88Sequences (2:3) Aligned. Score: 80Sequences (2:4) Aligned. Score: 80Sequences (2:5) Aligned. Score: 87Sequences (3:4) Aligned. Score: 90Sequences (3:5) Aligned. Score: 78Sequences (4:5) Aligned. Score: 77

[0060]The alignments are presented in FIG. 4. The closest known relative to Thermococcus sp. (strain 9° N-7) DNA ligase is that of Thermococcus kodakaensis DNA ligase where there is 90% amino acid identity and 80.9% nucleotide identity.

(5) Purification of Thermococcus sp. (Strain 9° N-7) DNA Ligase

[0061]E. coli BL-21 (DE3)-RIL (Stratagene, La Jolla, Calif.) was transformed with pMalC2X plasmid (New England Biolabs, Inc., Ipswich, Mass.) containing the B2 fragment for DNA ligase from Thermococcus sp. (strain 9° N-7). The cells were grown in 100 ml LB media with 50 μg/ml ampicillin and 25 μg/ml chloramphenicol at 37° C. After overnight incubation the culture was transferred to a ten-liter fermenter and incubated at 37° C. until an OD600 of 0.59 was achieved and that 0.1 gram of IPTG was added. The culture was incubated another 5.75 hours and harvested. The cell paste was stored at -20° C.

[0062]10 grams of cell paste in 40 ml of 10 mM Tris HCl, pH 7.5, 20 mM NaCl, 0.1 mM EDTA and 1.0 mM DTT were thawed and lysed by sonication. The extract was brought to 0.3 mM PMSF and 200 mM NaCl. The extract was clarified by centrifugation. The clarified extract was passed through a DEAE sepharose column at 0.2 M NaCl. The protein that flowed through the column was pooled and diluted to 100 mM NaCl. This was applied to a phosphocellulose column and the protein that was absorbed was eluted with a gradient of 100 mM to 1.1 M NaCl. The fractions (FIG. 5) were analyzed by SDS PAGE and the major 60 kd peak was pooled and heated to 75° C. for 30 minutes. This solution was clarified by centrifugation and the clarified solution was diluted to 100 mM NaCl and applied to a hydroxyapatite column. A 0-13 % gradient of ammonium sulfate was applied to the column and fractions collected and assayed for activity by incubating various fractions in T4 DNA ligase buffer (New England Biolabs, Inc., Ipswich, Mass.) with HindIII lambda DNA at 50 μg/ml as a substrate. The reactions were incubated at 37° C. for 10 minutes. The reaction was terminated by addition of 10% 100 mM EDTA and 50% glycerol and bromophenol blue dye. The reactions were heated to 650 and loaded onto 1% agarose gel for analysis.

[0063]The tubes containing about 80% of the ligase activity were pooled and dialyzed against 50% glycerol, 10 mM Tris HCl, pH 7.5, 50 mM KCl, 10 mM (NH4)2SO4, 0.1 mM EDTA and 1.0 mM DTT. The purified Thermococcus sp. (strain 9° N) DNA ligase was stored at -20 C.

Example 2

Properties of Thermococcus sp. (Strain 9° N-7) DNA Ligase

[0064]The recommended reaction conditions are:

10 mM Tris-HCl pH 7.5

2.5 mM MgCl2

2.5 mM DTT

300 uM ATP

[0065]The typical substrate for assaying activity at 45° C. is lambda DNA. Appropriately digested lambda DNA can reveal the state of ligation of the 12-base extension at the termini of lambda DNA. We typically used either a HindIII or BstEII predigested lambda DNA. Analysis of the ligation was performed on agarose gel electrophoresis.

[0066]The Km for ATP appears to be less than 100 μM. The activity was stimulated by Triton X-100.

[0067]Unlike Thermococcus fumicolans DNA ligase, Thermococcus sp. (strain 9° N-7) ligase in the presence of NAD.sup.+ had no detectable activity

[0068]The enzyme requires magnesium ions. 2.5 mM MgCl2 achieved 10 times more activity than 10 mM MgCl2.

[0069]Between 25% and 50% of the activity remained after incubating the enzyme at about 100° C. for 30 min (FIG. 6).

[0070]The ligase is capable of sealing nicked DNA at 90° C. The DNA ligase was incubated with a BstNBI nicked pUC19 plasmid DNA and converted the relaxed nicked plasmid to the position of covalently closed circular DNA as determined by agarose gel electrophoresis. The rate of the reaction was higher at 80° than at 45° C. Although the nicked plasmid underwent denaturation at 90° C., substantial nick sealing occurred at 90° C. before denaturation converted all of the nicked plasmid to single strands.

Example 3

Use of Thermococcus sp. (Strain 9° N-7) DNA Ligase in a DNA Repair Mix

[0071]Repair of DNA damaged by depurination was achieved using a mixture of enzymes that included strain 9° N-7 DNA ligase.

[0072]The DNA in the experimental reaction was damaged by depurination as described by Ide, H., et al. Biochemistry 32(32):8276-83 (1993). Lambda DNA (NEB#N3011, New England Biolabs, Inc., Ipswich, Mass.) was ethanol precipitated. The DNA was resuspended in depurination buffer (100 mM NaCl, 10 mM citrate, pH 5.0) at a concentration of 0.5 mg/ml and incubated at 70° C. for 120 minutes. The sample was then ethanol precipitated and resuspended in a solution of 0.01 M Tris, 0.001 M EDTA, pH 8.0. The DNA concentration was determined by measuring the A260 of the DNA-containing solutions after calibrating with a buffer control.

[0073]The damaged DNA was incubated at room temperature in the following enzyme mixture for 10 minutes as follows: DNA (1 ng); 100 μM dNTPs (NEB#M0447, New England Biolabs, Ipswich, Mass.); 1 mM ATP; 480 units Taq ligase (NEB#M0208, New England Biolabs, Ipswich, Mass.) or 500 units of 9° N-7 DNA ligase (NEB#M0238, New England Biolabs, Ipswich, Mass.); 0.1 unit E. coli DNA polymerase I (E. coli polI) (NEB#M0209, New England Biolabs, Inc., Ipswich, Mass.); 10 units E. coli Endo IV (NEB#M0304, New England Biolabs, Inc., Ipswich, Mass.); 1×Thermopol buffer (NEB#B9004, New England Biolabs, Inc., Ipswich, Mass.) to a final volume of 47.5 μL.

[0074]At the end of the reaction, the samples were transferred to ice and then amplified. A negative control was treated as above, but without the enzymes.

DNA Amplification Reaction

[0075]DNA amplification of lambda was performed using the following primers: CGAACGTCGCGCAGAGAAACAGG (L72-5R) (SEQ ID NO:23) and CCTGCTCTGCCGCTTCACGC (L30350F) (SEQ ID NO:24) according to the method of Wang et al. Nucl. Acids Res. 32:1197-1207(2004).

[0076]2.5 μl of amplification mixture was added to 47.5 ml of the above repair mixture. The amplification mixture contained 100 μM dNTPs, 5 units Taq DNA polymerase (New England Biolabs, Inc., Ipswich, Mass.), 0.1 unit Vent® (exo+) DNA polymerase (New England Biolabs, Inc., Ipswich, Mass.), 5×10-11 M primer L72-5R and 5×10-11 M primer L30350F in 1×Thermopol buffer.

[0077]To correct for any enzyme storage buffer effects, when a repair enzyme was omitted from a reaction, the appropriate volume of its storage buffer was added to the reaction. In all cases, the amplification reactions were processed in a thermal cycler using the following parameters: 20 seconds at 95° C. for 1 cycle followed by 5 seconds at 94° C., then 5 minutes at 72° C. for 25 cycles. The size of the amplicon being amplified was 5 kb.

[0078]The results of amplification of DNA (5 kb) were determined by 1% agarose gel elecrophoresis. 6×loading dye (Molecular Cloning: A Laboratory Manual, 3rd ed., eds. Sambrook and Russell, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 2001, pp. 5.4-5.17) was added to the 50 μl amplification reactions. 20 μl of this solution was then loaded onto the agarose gel along with 1 μg of 2-log ladder (NEB#N3200, New England Biolabs, Inc., Ipswich, Mass.) as a size standard.

Sequence CWU 1

2411695DNAunknownThermococcus sp. strain 9 degrees North 1atgggcgata tgaggtactc cgagctggcc gaactctacc ggaggcttga gaagaccacg 60ctcaaaacgc tcaagaccaa gttcgtcgcg gacttcctca agaaaacacc cgacgatttg 120ctcgagatag ttccctacct gattctcggc aaggtctttc cggactggga cgagcgcgag 180ctcggcgtcg gcgagaagct tctcataagg gccgtttcga tggcaaccgg cgtccccgag 240agggaaatcg agaactcgat taaggacacc ggcgatttgg gcgagagcgt ggctctggct 300ctaaagaaga ggaagcagaa gagcttcttc agccagcccc tcacgataaa gcgcgtctac 360agcaccttcg ttaaggttgc cgaggcgagc ggagagggga gccaggacag gaagatgaag 420tacttagcaa acctcttcat ggatgctcaa cccgaggagg gcaagtacat agccagaacc 480gtcctcggga cgatgaggac gggcgtcgcc gagggaatcc tgcgcgatgc catagcggag 540tccttcaagg tgaagccaga gctcgtcgag agggcctaca tgctcacgag cgacttcggc 600tacgtggcga aggtcgccaa gctcgagggg aacgaggggc tctcgaaggt cagcatacag 660attgggaagc cgataaggcc gatgctagct caaaacgccg ccaacgtcaa ggaagcgcta 720atcgagatgg gcggtgaggc ggccttcgag attaagtacg acggcgcgcg cgttcaggtc 780caccgcgatg gggacagggt gataatctac tcgaggaggc ttgagaacgt cacccgctcg 840attcctgaga tagttgaggc ggtaaaggcc tccctgaagc cctctaatgt catagtcgag 900ggcgagctgg ttgccgtcgg cgagaacggt cgcccgaggc ccttccagta cgtcctgagg 960cgctttagga ggaagtacaa catcgaggag atgattgaga agattccgct cgagctcaac 1020ctcttcgaca tcctctacgt tgaaggagag agcctcatcg acacgaagtt cgcagagagg 1080aggaagaagc tcgaggagag cgttgaggag agcgataaga taaagctcgc cgaacagctc 1140gttacgaaga aggttgaaga ggccgaggag ttctacaaga gggcccttga gctcggccac 1200gagggcctga tggcgaagag gctggactcc atctacgagc ccggaaaccg cggtaagaag 1260tggctgaaga ttaagcccac gatggagaac cttgacctcg tcattatcgg agccgaatgg 1320ggcgagggca ggcgcgcgca cctgctcggc tcgttcctcg ttgcggccta cgaccccgag 1380agcggtgagt tcgtcccggt gggcaaggtc gggagcggtt tcaccgatga agatttggtc 1440gagttcacca agatgctcaa gcccctgatt gtccgtgaag agggcaagtt cgtcgagatt 1500gagcccaagg tcgtcatcga ggtcacctac caggagatac agaagagccc caagtataag 1560agcggtttcg cgcttcgctt cccgcgctac gtggcgctga gggaagataa aagcccggag 1620gaggctgaca ccatagagag ggtcgcccag ctctacgagc tccaggagag gttcaaggcg 1680aagaggtaat ctaga 169521695DNAunknownThermococcus sp. strain 9 degrees North 2atgggcgata tgaggtactc cgagctggcc gaactctacc ggaggcttga gaagaccacg 60ctcaaaacgc tcaagaccaa gttcgtcgcg gacttcctca agaaaacacc cgacgatttg 120ctcgagatag ttccctacct gattctcggc aaggtctttc cggactggga cgagcgcgag 180ctcggcgtcg gcgagaagct tctcataagg gccgtttcga tggcaaccgg cgtccccgag 240agggaaatcg agaactcgat taaggacacc ggcgatttgg gcgagagcgt ggctctggct 300ctaaagaaga ggaagcagaa gagcttcttc agccagcccc tcacgataaa gcgcgtctac 360agcaccttcg ttaaggttgc cgaggcgagc ggagagggga gccaggacag gaagatgaag 420tacttagcaa acctcttcat ggatgctcaa cccgaggagg gcaagtacat agccagaacc 480gtcctcggga cgatgaggac gggcgtcgcc gagggaatcc tgcgcgatgc catagcggag 540tccttcaagg tgaagccaga gctcgtcgag agggcctaca tgctcacgag cgacttcggc 600tacgtggcga aggtcgccaa gctcgagggg aacgaggggc tctcgaaggt cagcatacag 660attgggaagc cgataaggcc gatgctagct caaaacgccg ccaacgtcaa ggaagcgcta 720atcgagatgg gcggtgaggc ggccttcgag attaagtacg acggcgcgcg cgttcaggtc 780caccgcgatg gggacagggt gataatctac tcgaggaggc ttgagaacgt cacccgctcg 840attcctgaga tagttgaggc ggtaaaggcc tccctgaagc cctctaatgt catagtcgag 900ggcgagctgg ttgccgtcgg cgagaacggt cgcccgaggc ccttccagta cgtcctgagg 960cgctttagga ggaagtacaa catcgaggag atgattgaga agattccgct cgagctcaac 1020ctcttcgaca tcctctacgt tgaaggagag agcctcatcg acacgaagtt cgcagagagg 1080aggaagaagc tcgaggagag cgttgaggag agcgataaga taaagctcgc cgaacagctc 1140gttacgaaga aggttgaaga ggccgaggag ttctacaaga gggcccttga gctcggccac 1200gagggcctga tggcgaagag gctggactcc atctacgagc ccggaaaccg cggtaagaag 1260tggctgaaga ttaagcccac gatggagaac cttgacctcg tcattatcgg agccgaatgg 1320ggcgagggca ggcgcgcgca cctgctcggc tcgttcctcg ttgcggccta cgaccccgag 1380agcggtgagt tcgtcccggt gggcaaggtc gggagcggtt tcaccgatga agatttggtc 1440gagttcacca agatgctcaa gcccctgatt gtccgtgaag agggcaagtt cgtcgagatt 1500gagcccaagg tcgtcatcga ggtcacctac caggagatac agaagagccc caagtataag 1560agcggtttcg cgcttcgctt cccgcgctac gtggcgctga gggaagataa aagcccggag 1620gaggctgaca ccatagagag ggtcgcccag ctctacgagc tccaggagag gttcaaggcg 1680aagaagtaat ctaga 169531695DNAunknownThermococcus sp. strain 9 degrees North 3atgggcgata tgaggtactc cgagctggcc gaactttaca gaaggcttga gaagaccacg 60ctcaaaacgc tcaagaccaa gtttgtcgcg gacttcctca agaaaactcc cgacgatttg 120ctcgagatag ttccctacct gattctcggc aaggtctttc cggactggga cgagcgcgag 180ctcggcgtcg gggaaaagtt gctcataagg gccgtttcga tggcaaccgg cgtccccgag 240agggaaatcg agaactcgat taaggacacg ggcgatttgg gcgagagcgt ggctctggct 300ctaaagaaga ggaagcagaa gagcttcttc agccagcccc tcacgataaa gcgcgtctac 360agcaccttcg ttaaggttgc cgaggcgagc ggagagggga gccaggwcag gaagatgaag 420tacttagcaa atctcttcat ggatgctcaa cccgaggagg gcaagtacat agccagaacc 480gtcctcggaa cgatgaggac gggcgtcgcc gagggaatcc tgcgcgatgc catagcggag 540gccttcaagg tgaagccaga gctcgtcgag agggcctaca tgctcacgag cgacttcggc 600tacgtggcga aggtcgccaa gctcgagggg aacgaggggc tctcgaaggt cagcatacag 660attgggaagc cgataaggcc gatgctagct caaaacgccg ccaacgtcaa ggaagcgcta 720atcgagatgg gcggtgaggc ggccttcgag attaagtacg acggcgcgcg cgttcaggtc 780caccgcgatg gggacagggt gataatctac tcgaggaggc ttgagaacgt cacccgctcg 840attcctgaga tagttgaggc ggtaaaggcc tccctgaagc cctctaatgt catagtcgag 900ggcgagctgg ttgccgtcgg cgagaacggt cgcccgaggc ccttccagta cgtcctgagg 960cgctttagga ggaagtacaa catcgaggag atgattgaga agattccgct cgagctcaac 1020ctcttcgaca tcctctacgt tgaaggggag agcctcattg acacgaagtt cgccgagagg 1080aggaggaagc ttgaggagag cgtcgaggag ggcgataaga taaagctcgc cgaacagctc 1140gttacgaaga aggtcgaaga ggccgaggag ttctacaaga gggcccttga gctcggccac 1200gagggcctga tggcgaagag gctggactcc atctacgagc ccggaaaccg cggtaagaag 1260tggctgaaga ttaagcccac gatggagaac cttgacctcg tcattatcgg agccgaatgg 1320ggcgagggga ggcgcgcgca cctgcttggc tcgttcctcg ttgcggccta cgaccccgag 1380agcggtgagt tcgtcccggt gggcaaggtc gggagcggtt tcaccgatga agatttggtc 1440gagttcacca agatgctcaa gcccctgatt gtccgtgaag agggcaagtt cgtcgagatt 1500gagcccaagg tcgtcatcga ggtcacctac caggagatac agaagagccc caagtataag 1560agcggtttcg cgcttcgctt cccgcgctac gtggcgctga gggaagataa aagcccggag 1620gaggctgaca ccatagagag ggtcgcccag ctctacgagc tccaggagag gttcaaggcg 1680aagaagtaat ctaga 169541695DNAunknownThermococcus sp. strain 9 degrees North 4atgggcgata tgaggtactc cgagctggcc gaactctacc ggaggcttga gaagaccacg 60ctcaaaacgc tcaagaccaa gttcgtcgcg gacttcctca agaaaacacc cgacgatttg 120ctcgagatag ttccctacct gattctcggc aaggtctttc cggactggga cgagcgcgag 180ctcggcgtcg gggaaaagtt gctcataagg gccgtttcga tggcgactgg ggttccagag 240agggaaatcg agaactcgat taaggacacg ggcgatttgg gcgagagcgt ggccttggcc 300ctaaagaaga ggaagcagaa gagcttcttc agccagcccc tcacgataaa gcgcgtctac 360agcaccttcg ttaaggttgc cgaggcgagc ggagagggga gccaggacag gaagatgaag 420tacttagcaa acctcttcat ggatgctcaa cccgaggagg gcaagtacat agccagaacc 480gtcctcggga cgatgaggac gggcgtcgcc gagggaatcc tgcgcgatgc catagcggag 540gccttcaagg tgaagccaga gctcgtcgag agggcctaca tgctcacgag cgacttcggc 600tacgtggcga aggttgcaaa gctcgagggg aacgaggggc tctcaaaggt tagcatacag 660attgggaagc cgataaggcc gatgctagct caaaacgccg ccaacgtcaa ggaagcgcta 720atcgagatgg gcggtgaggc ggccttcgag attaagtacg acggcgcgcg cgttcaggtc 780caccgcgatg gggacagggt gataatctac tcgaggaggc ttgagaacgt cacccgctcg 840attcctgaga tagttgaggc ggtaaaggcc tccctgaagc cctctaatgt catagtcgag 900ggcgagctgg ttgccgtcgg cgagaacggt cgcccgaggc ccttccagta cgtcctgagg 960cgctttagga ggaagtacaa catcgaggag atgattgaga agattccgct cgagctcaac 1020ctcttcgaca tcctctacgt tgaaggagag agcctcatcg acacgaagtt cgcagagagg 1080aggaagaagc tcgaggagag cgttgaggag agcgataaga taaagctcgc cgaacagctc 1140gttacgaaga aggtcgaaga ggccgaggag ttctacaaga gggcccttga gctcggccac 1200gagggcctga tggcgaagag gctggactcc atctacgagc ccggaaaccg cggtaagaag 1260tggctgaaga ttaagcccac gatggagaac cttgacctcg tcattatcgg agccgaatgg 1320ggcgagggga ggcgcgcgca cctgctcggc tcgttcctcg ttgcggccta cgaccccgag 1380agcggtgagt tcgtcccggt gggcaaggtc gggagcggtt tcaccgatga agatttggtc 1440gagttcacca agatgctcaa gcccctgatt gtccgtgaag agggcaagtt tgtcgagatt 1500gagcccaagg tcgtcatcga ggtcacctac caggagatac agaagagccc caagtataag 1560agcggtttcg cgcttcgctt cccgcgctac gtggcgctga gggaagataa aagcccggag 1620gaggccgaca ccatagagag ggtcgcccag ctctacgagc tccaggagag gttcaaggcg 1680aagaagtaat ctaga 169551695DNAunknownThermoccocus sp. strain 9 degrees North 5atgggcgata tgaggtactc cgagctggcc gaactctacc ggaggcttga gaagaccacg 60ctcaaaacgc tcaagaccaa gttcgtcgcg gacttcctca agaaaacacc cgacgatttg 120ctcgagatag ttccctacct gattctcggc aaggtctttc cggactggga cgagcgcgag 180ctcggcgtcg gggaaaagtt gctcataagg gccgtttcga tggcgactgg ggttccagag 240agggaaatcg agaactcgat taaggacacg ggcgatttgg gcgagagcgt ggccttggcc 300ctaaagaaga ggaagcagaa gagcttcttc agccagcccc tcacgataaa gcgcgtctac 360agcaccttcg ttaaggttgc cgaggcgagc ggagagggga gccaggacag gaagatgaag 420tacttagcaa acctcttcat ggatgctcaa cccgaggagg gcaagtacat agccagaacc 480gtcctcggga cgatgaggac gggcgtcgcc gagggaatcc tgcgcgatgc catagcggag 540gccttcaagg tgaagccaga gctcgtcgag agggcctaca tgctcacgag cgacttcggc 600tacgtggcga aggttgcaaa gctcgagggg aacgaggggc tctcaaaggt tagcatacag 660attgggaagc cgataaggcc gatgctagct caaaacgccg ccaacgtcaa ggaagcgcta 720atcgagatgg gcggtgaggc ggccttcgag attaagtacg acggcgcgcg cgttcaggtc 780caccgcgacg gggatagggt gataatatac tcgaggaggc ttgagaacgt cacccgctcg 840attcctgaga tagtcgaggc ggtaaaggcc tccctgaagc cttctaaggt catagtcgag 900ggcgagctgg ttgccgtcgg cgagaacggt cgcccgaggc ccttccagta cgtcctcagg 960aggttcagga ggaagtacaa catcgaggag atgattgaga agattccgct cgagctcaac 1020ctcttcgata tcctctacgt tgatggggag agtctcatcg acacgaagtt cgcagagagg 1080aggaagaaac tcgaggagag tgttgaggag agcgataaga taaagctcgc cgaacagctc 1140gttacgaaga aggtcgaaga ggccgaggag ttctacaaga gggcccttga gctcggccac 1200gagggcctga tggcgaagag gctggactcc atctacgagc ccggaaaccg cggtaagaag 1260tggctgaaga ttaagcccac gatggagaac cttgacctcg tcattatcgg agccgaatgg 1320ggcgagggga ggcgcgcgca cctgcttggc tcgttcctcg ttgcggccta cgaccccgag 1380agcggtgagt tcgtcccggt gggcaaggtc gggagcggtt tcaccgatga agatttggtc 1440gagttcacca agatgctcaa gcccctgatt gtccgtgaag agggcaagtt tgtcgagatt 1500gagcccaagg tcgtcatcga agtaacgtat caggagatac agaagagccc caagtataag 1560agcggtttcg cgcttcgctt cccgcgctac gtggcgctga gggaagataa aagcccggag 1620gaggctgaca ccatagagag ggtcgcccag ctctacgagc tccaggagag gttcaaggcg 1680aagaagtaat ctaga 169561695DNAunknownThermococcus sp. strain 9 degrees North 6atgggcgaca tgaggtactc cgagctggcc gaactctacc ggaggcttga gaagaccacg 60ctcaaaacgc tcaagaccaa gttcgtcgcg gacttcctca agaaaacacc cgacgatttg 120ctcgagatag ttccctacct gattctcggc aaggtctttc cggactggga cgagcgcgag 180ctcggcgtcg gggaaaagtt gctcataagg gccgtttcga tggcgactgg ggttccagag 240agggaaatcg agaactcgat taaggacacg ggcgatttgg gcgagagcgt ggccttggcc 300ctaaagaaga ggaagcagaa gagcttcttc agccagcccc tcacgataaa gcgcgtctac 360agcaccttcg ttaaggttgc cgaggcgagc ggagagggga gccaggacag gaagatgaag 420tacttagcaa acctcttcat ggatgctcaa cccgaggagg gcaagtacat agccagaacc 480gtcctcggga cgatgaggac gggcgtcgcc gagggaatcc tgcgcgatgc catagcggag 540gccttcaagg tgaagccaga gctcgtcgag agggcctaca tgctcacgag cgacttcggc 600tacgtggcga aggttgcaaa gctcgagggg aacgaggggc tctcaaaggt tagcatacag 660attgggaagc cgataaggcc gatgctagct caaaacgccg ccaacgtcaa ggaagcgcta 720atcgagatgg gcggtgaggc ggccttcgag attaagtacg acggcgcacg cgttcaggtc 780caccgcgacg gggacagggt gataatctac tcgaggaggc ttgagaacat cacccgctcg 840attcctgaga tagtcgaggc ggtaaaggcc tccctgaagc cttctaaggt catagtcgag 900ggcgagctgg ttgccgtcgg cgagaacggt cgcccgaggc ccttccagta cgtcctcagg 960aggttcagga ggaagtacaa catcgaggag atgattgaga agattccgct cgagctcaac 1020ctcttcgata tcctctacgt tgatggggag agtctcatcg acacgaagtt cgcagagagg 1080aggaagaaac tcgaggagag tgttgaggag agcgataaga taaagctcgc cgaacagctc 1140gttacgaaga aggtcgaaga ggccgaggag ttctacaaga gggcccttga gctcggccac 1200gagggcctga tggcgaagag gctggactcc atctacgagc ccggaaaccg cggtaagaag 1260tggctgaaga ttaagcccac gatggagaac cttgacctcg tcattatcgg agccgaatgg 1320ggcgagggga ggcgcgcgca cctgcttggc tcgttcctcg ttgcggccta cgaccccgag 1380agcggtgagt tcgtcccggt gggcaaggtc gggagcggtt tcaccgatga agatttggtc 1440gagttcacca agatgctcaa gcccctgatt gtccgtgaag agggcaagtt tgtcgagatt 1500gagcccaagg tcgtcatcga agtaacgtat caggagatac agaagagccc caagtataag 1560agcggtttcg cgcttcgctt cccgcgctac gtggcgctga gggaagataa aagcccggag 1620gaggctgaca ccatagagag ggtcgcccag ctctacgagc tccaggagag gtacaaggcg 1680aagaggtaat ctaga 169571695DNAunknownThermococcus sp. strain 9 degrees North 7atgggcgata tgaggtactc cgagctggcc gaactttaca gaaggcttga gaagaccacg 60ctcaaaacgc tcaagaccaa gttcgtcgcg gacttcctca agaaaactcc cgacgatttg 120ctcgagatag ttccctacct gattctcggc aaggtctttc cggactggga cgagcgcgag 180ctcggcgtcg gggaaaagtt gctcataagg gccgtttcga tggcaaccgg cgtccccgag 240agggaaatcg agaactcgat taaggacacg ggcgatttgg gcgagagcgt ggctctggct 300ctaaagaaga ggaagcagaa gagcttcttc agccagcccc tcacgataaa gcgcgtctac 360agcaccttcg ttaaggttgc cgaggcgagc ggagagggga gccaggacag gaagatgaag 420tacttagcaa atctcttcat ggatgctcaa cccgaggagg gcaagtacat agccagaacc 480gtcctcggaa cgatgaggac gggcgtcgcc gagggaatcc tgcgcgatgc catagcggag 540gccttcaagg tgaagccaga gctcgtcgag agggcctaca tgctcacgag cgacttcgga 600tacgtggcaa aggttgcaaa gctcgagggg aacgaggggc tctcaaaggt tagcatacag 660attgggaagc cgataaggcc gatgctagct caaaacgccg ccaacgtcaa ggaagcgcta 720atcgagatgg gcggtgaggc ggccttcgag attaagtacg acggtgcgcg cgttcaggtc 780caccgcgacg gggatagggt gataatctac tcgaggaggc tcgagaacgt cacccgctcg 840attcctgaga tagtcgaggc ggtaaaggcc tccctgaagc cttctaaggt catagtcgag 900ggcgagctgg ttgccgtcgg cgagaacggt cgcccgaggc ccttccagta cgtcctcagg 960aggttcagga ggaagtacaa catcgaggag atgattgaga agattccgct cgagctcaac 1020ctcttcgata tcctctacgt tgatggggag agtctcatcg acacgaagtt cgcagagagg 1080aggaagaaac tcgaggagag tgttgaggag agcgataaga taaagctcgc cgaacagctc 1140gttacgaaga aggtcgaaga ggccgaggag ttctacaaga gggcccttga gctcggccac 1200gagggcctga tggcgaagag gctggactcc atctacgagc ccggaaaccg cggtaagaag 1260tggctgaaga ttaagcccac gatggagaac cttgacctcg tcattatcgg agccgaatgg 1320ggcgagggga ggcgcgcgca cctgcttggc tcgttcctcg ttgcggccta cgaccccgag 1380agcggtgagt tcgtcccggt gggcaaggtc gggagcggtt tcaccgatga agatttggtc 1440gagttcacca agatgctcaa gcccctgatt gtccgtgaag agggcaagtt cgtcgagatt 1500gagcccaagg tcgtcatcga ggtcacctac caggagatac agaagagccc caagtataag 1560agcggtttcg cgcttcgctt cccgcgctac gtggcgctga gggaagataa aagcccggag 1620gaggctgaca ccatagagag ggtcgcccag ctctacgagc tccaggagag gttcaaggcg 1680aagaagtaat ctaga 16958564PRTunknownThermoccus sp. strain 9 degrees North 8Met Gly Asp Met Arg Tyr Ser Glu Leu Ala Glu Leu Tyr Arg Arg Leu1 5 10 15Glu Lys Thr Thr Leu Lys Thr Leu Lys Thr Lys Phe Val Ala Asp Phe20 25 30Leu Lys Lys Thr Pro Asp Asp Leu Leu Glu Ile Val Pro Tyr Leu Ile35 40 45Leu Gly Lys Val Phe Pro Asp Trp Asp Glu Arg Glu Leu Gly Val Gly50 55 60Glu Lys Leu Leu Ile Arg Ala Val Ser Met Ala Thr Gly Val Pro Glu65 70 75 80Arg Glu Ile Glu Asn Ser Ile Lys Asp Thr Gly Asp Leu Gly Glu Ser85 90 95Val Ala Leu Ala Leu Lys Lys Arg Lys Gln Lys Ser Phe Phe Ser Gln100 105 110Pro Leu Thr Ile Lys Arg Val Tyr Ser Thr Phe Val Lys Val Ala Glu115 120 125Ala Ser Gly Glu Gly Ser Gln Asp Arg Lys Met Lys Tyr Leu Ala Asn130 135 140Leu Phe Met Asp Ala Gln Pro Glu Glu Gly Lys Tyr Ile Ala Arg Thr145 150 155 160Val Leu Gly Thr Met Arg Thr Gly Val Ala Glu Gly Ile Leu Arg Asp165 170 175Ala Ile Ala Glu Ala Phe Lys Val Lys Pro Glu Leu Val Glu Arg Ala180 185 190Tyr Met Leu Thr Ser Asp Phe Gly Tyr Val Ala Lys Val Ala Lys Leu195 200 205Glu Gly Asn Glu Gly Leu Ser Lys Val Ser Ile Gln Ile Gly Lys Pro210 215 220Ile Arg Pro Met Leu Ala Gln Asn Ala Ala Asn Val Lys Glu Ala Leu225 230 235 240Ile Glu Met Gly Gly Glu Ala Ala Phe Glu Ile Lys Tyr Asp Gly Ala245 250 255Arg Val Gln Val His Arg Asp Gly Asp Arg Val Ile Ile Tyr Ser Arg260 265 270Arg Leu Glu Asn Val Thr Arg Ser Ile Pro Glu Ile Val Glu Ala Val275 280 285Lys Ala Ser Leu Lys Pro Ser Lys Val Ile Val Glu Gly Glu Leu Val290 295 300Ala Val Gly Glu Asn Gly Arg Pro Arg Pro Phe Gln Tyr Val Leu Arg305 310 315 320Arg Phe Arg Arg Lys Tyr Asn Ile Glu Glu Met Ile Glu Lys Ile Pro325 330 335Leu Glu Leu Asn Leu Phe Asp Ile Leu Tyr Val Asp Gly Glu Ser Leu340 345 350Ile Asp Thr Lys Phe Ala Glu Arg Arg Lys Lys Leu Glu Glu Ser Val355 360 365Glu Glu Ser Asp Lys Ile Lys Leu Ala Glu Gln Leu Val Thr Lys Lys370 375 380Val Glu Glu Ala Glu Glu Phe Tyr Lys Arg Ala Leu Glu Leu Gly His385 390 395 400Glu Gly Leu Met Ala Lys Arg Leu Asp Ser Ile Tyr Glu Pro Gly Asn405 410 415Arg Gly Lys Lys Trp Leu Lys Ile Lys Pro Thr Met Glu Asn Leu

Asp420 425 430Leu Val Ile Ile Gly Ala Glu Trp Gly Glu Gly Arg Arg Ala His Leu435 440 445Leu Gly Ser Phe Leu Val Ala Ala Tyr Asp Pro Glu Ser Gly Glu Phe450 455 460Val Pro Val Gly Lys Val Gly Ser Gly Phe Thr Asp Glu Asp Leu Val465 470 475 480Glu Phe Thr Lys Met Leu Lys Pro Leu Ile Val Arg Glu Glu Gly Lys485 490 495Phe Val Glu Ile Glu Pro Lys Val Val Ile Glu Val Thr Tyr Gln Glu500 505 510Ile Gln Lys Ser Pro Lys Tyr Lys Ser Gly Phe Ala Leu Arg Phe Pro515 520 525Arg Tyr Val Ala Leu Arg Glu Asp Lys Ser Pro Glu Glu Ala Asp Thr530 535 540Ile Glu Arg Val Ala Gln Leu Tyr Glu Leu Gln Glu Arg Phe Lys Ala545 550 555 560Lys Lys Ser Arg9564PRTunknownThermococcus sp. strain 9 degrees North 9Met Gly Asp Met Arg Tyr Ser Glu Leu Ala Glu Leu Tyr Arg Arg Leu1 5 10 15Glu Lys Thr Thr Leu Lys Thr Leu Lys Thr Lys Phe Val Ala Asp Phe20 25 30Leu Lys Lys Thr Pro Asp Asp Leu Leu Glu Ile Val Pro Tyr Leu Ile35 40 45Leu Gly Lys Val Phe Pro Asp Trp Asp Glu Arg Glu Leu Gly Val Gly50 55 60Glu Lys Leu Leu Ile Arg Ala Val Ser Met Ala Thr Gly Val Pro Glu65 70 75 80Arg Glu Ile Glu Asn Ser Ile Lys Asp Thr Gly Asp Leu Gly Glu Ser85 90 95Val Ala Leu Ala Leu Lys Lys Arg Lys Gln Lys Ser Phe Phe Ser Gln100 105 110Pro Leu Thr Ile Lys Arg Val Tyr Ser Thr Phe Val Lys Val Ala Glu115 120 125Ala Ser Gly Glu Gly Ser Gln Asp Arg Lys Met Lys Tyr Leu Ala Asn130 135 140Leu Phe Met Asp Ala Gln Pro Glu Glu Gly Lys Tyr Ile Ala Arg Thr145 150 155 160Val Leu Gly Thr Met Arg Thr Gly Val Ala Glu Gly Ile Leu Arg Asp165 170 175Ala Ile Ala Glu Ala Phe Lys Val Lys Pro Glu Leu Val Glu Arg Ala180 185 190Tyr Met Leu Thr Ser Asp Phe Gly Tyr Val Ala Lys Val Ala Lys Leu195 200 205Glu Gly Asn Glu Gly Leu Ser Lys Val Ser Ile Gln Ile Gly Lys Pro210 215 220Ile Arg Pro Met Leu Ala Gln Asn Ala Ala Asn Val Lys Glu Ala Leu225 230 235 240Ile Glu Met Gly Gly Glu Ala Ala Phe Glu Ile Lys Tyr Asp Gly Ala245 250 255Arg Val Gln Val His Arg Asp Gly Asp Arg Val Ile Ile Tyr Ser Arg260 265 270Arg Leu Glu Asn Val Thr Arg Ser Ile Pro Glu Ile Val Glu Ala Val275 280 285Lys Ala Ser Leu Lys Pro Ser Lys Val Ile Val Glu Gly Glu Leu Val290 295 300Ala Val Gly Glu Asn Gly Arg Pro Arg Pro Phe Gln Tyr Val Leu Arg305 310 315 320Arg Phe Arg Arg Lys Tyr Asn Ile Glu Glu Met Ile Glu Lys Ile Pro325 330 335Leu Glu Leu Asn Leu Phe Asp Ile Leu Tyr Val Asp Gly Glu Ser Leu340 345 350Ile Asp Thr Lys Phe Ala Glu Arg Arg Lys Lys Leu Glu Glu Ser Val355 360 365Glu Glu Ser Asp Lys Ile Lys Leu Ala Glu Gln Leu Val Thr Lys Lys370 375 380Val Glu Glu Ala Glu Glu Phe Tyr Lys Arg Ala Leu Glu Leu Gly His385 390 395 400Glu Gly Leu Met Ala Lys Arg Leu Asp Ser Ile Tyr Glu Pro Gly Asn405 410 415Arg Gly Lys Lys Trp Leu Lys Ile Lys Pro Thr Met Glu Asn Leu Asp420 425 430Leu Val Ile Ile Gly Ala Glu Trp Gly Glu Gly Arg Arg Ala His Leu435 440 445Leu Gly Ser Phe Leu Val Ala Ala Tyr Asp Pro Glu Ser Gly Glu Phe450 455 460Val Pro Val Gly Lys Val Gly Ser Gly Phe Thr Asp Glu Asp Leu Val465 470 475 480Glu Phe Thr Lys Met Leu Lys Pro Leu Ile Val Arg Glu Glu Gly Lys485 490 495Phe Val Glu Ile Glu Pro Lys Val Val Ile Glu Val Thr Tyr Gln Glu500 505 510Ile Gln Lys Ser Pro Lys Tyr Lys Ser Gly Phe Ala Leu Arg Phe Pro515 520 525Arg Tyr Val Ala Leu Arg Glu Asp Lys Ser Pro Glu Glu Ala Asp Thr530 535 540Ile Glu Arg Val Ala Gln Leu Tyr Glu Leu Gln Glu Arg Phe Lys Ala545 550 555 560Lys Lys Ser Arg10564PRTunknownThermococcus sp. strain 9 degrees North 10Met Gly Asp Met Arg Tyr Ser Glu Leu Ala Glu Leu Tyr Arg Arg Leu1 5 10 15Glu Lys Thr Thr Leu Lys Thr Leu Lys Thr Lys Phe Val Ala Asp Phe20 25 30Leu Lys Lys Thr Pro Asp Asp Leu Leu Glu Ile Val Pro Tyr Leu Ile35 40 45Leu Gly Lys Val Phe Pro Asp Trp Asp Glu Arg Glu Leu Gly Val Gly50 55 60Glu Lys Leu Leu Ile Arg Ala Val Ser Met Ala Thr Gly Val Pro Glu65 70 75 80Arg Glu Ile Glu Asn Ser Ile Lys Asp Thr Gly Asp Leu Gly Glu Ser85 90 95Val Ala Leu Ala Leu Lys Lys Arg Lys Gln Lys Ser Phe Phe Ser Gln100 105 110Pro Leu Thr Ile Lys Arg Val Tyr Ser Thr Phe Val Lys Val Ala Glu115 120 125Ala Ser Gly Glu Gly Ser Gln Asp Arg Lys Met Lys Tyr Leu Ala Asn130 135 140Leu Phe Met Asp Ala Gln Pro Glu Glu Gly Lys Tyr Ile Ala Arg Thr145 150 155 160Val Leu Gly Thr Met Arg Thr Gly Val Ala Glu Gly Ile Leu Arg Asp165 170 175Ala Ile Ala Glu Ala Phe Lys Val Lys Pro Glu Leu Val Glu Arg Ala180 185 190Tyr Met Leu Thr Ser Asp Phe Gly Tyr Val Ala Lys Val Ala Lys Leu195 200 205Glu Gly Asn Glu Gly Leu Ser Lys Val Ser Ile Gln Ile Gly Lys Pro210 215 220Ile Arg Pro Met Leu Ala Gln Asn Ala Ala Asn Val Lys Glu Ala Leu225 230 235 240Ile Glu Met Gly Gly Glu Ala Ala Phe Glu Ile Lys Tyr Asp Gly Ala245 250 255Arg Val Gln Val His Arg Asp Gly Asp Arg Val Ile Ile Tyr Ser Arg260 265 270Arg Leu Glu Asn Val Thr Arg Ser Ile Pro Glu Ile Val Glu Ala Val275 280 285Lys Ala Ser Leu Lys Pro Ser Asn Val Ile Val Glu Gly Glu Leu Val290 295 300Ala Val Gly Glu Asn Gly Arg Pro Arg Pro Phe Gln Tyr Val Leu Arg305 310 315 320Arg Phe Arg Arg Lys Tyr Asn Ile Glu Glu Met Ile Glu Lys Ile Pro325 330 335Leu Glu Leu Asn Leu Phe Asp Ile Leu Tyr Val Glu Gly Glu Ser Leu340 345 350Ile Asp Thr Lys Phe Ala Glu Arg Arg Lys Lys Leu Glu Glu Ser Val355 360 365Glu Glu Ser Asp Lys Ile Lys Leu Ala Glu Gln Leu Val Thr Lys Lys370 375 380Val Glu Glu Ala Glu Glu Phe Tyr Lys Arg Ala Leu Glu Leu Gly His385 390 395 400Glu Gly Leu Met Ala Lys Arg Leu Asp Ser Ile Tyr Glu Pro Gly Asn405 410 415Arg Gly Lys Lys Trp Leu Lys Ile Lys Pro Thr Met Glu Asn Leu Asp420 425 430Leu Val Ile Ile Gly Ala Glu Trp Gly Glu Gly Arg Arg Ala His Leu435 440 445Leu Gly Ser Phe Leu Val Ala Ala Tyr Asp Pro Glu Ser Gly Glu Phe450 455 460Val Pro Val Gly Lys Val Gly Ser Gly Phe Thr Asp Glu Asp Leu Val465 470 475 480Glu Phe Thr Lys Met Leu Lys Pro Leu Ile Val Arg Glu Glu Gly Lys485 490 495Phe Val Glu Ile Glu Pro Lys Val Val Ile Glu Val Thr Tyr Gln Glu500 505 510Ile Gln Lys Ser Pro Lys Tyr Lys Ser Gly Phe Ala Leu Arg Phe Pro515 520 525Arg Tyr Val Ala Leu Arg Glu Asp Lys Ser Pro Glu Glu Ala Asp Thr530 535 540Ile Glu Arg Val Ala Gln Leu Tyr Glu Leu Gln Glu Arg Phe Lys Ala545 550 555 560Lys Lys Ser Arg11563PRTunknownThermococcus sp. strain 9 degrees North 11Met Gly Asp Met Arg Tyr Ser Glu Leu Ala Glu Leu Tyr Arg Arg Leu1 5 10 15Glu Lys Thr Thr Leu Lys Thr Leu Lys Thr Lys Phe Val Ala Asp Phe20 25 30Leu Lys Lys Thr Pro Asp Asp Leu Leu Glu Ile Val Pro Tyr Leu Ile35 40 45Leu Gly Lys Val Phe Pro Asp Trp Asp Glu Arg Glu Leu Gly Val Gly50 55 60Glu Lys Leu Leu Ile Arg Ala Val Ser Met Ala Thr Gly Val Pro Glu65 70 75 80Arg Glu Ile Glu Asn Ser Ile Lys Asp Thr Gly Asp Leu Gly Glu Ser85 90 95Val Ala Leu Ala Leu Lys Lys Arg Lys Gln Lys Ser Phe Phe Ser Gln100 105 110Pro Leu Thr Ile Lys Arg Val Tyr Ser Thr Phe Val Lys Val Ala Glu115 120 125Ala Ser Gly Glu Gly Ser Gln Arg Lys Met Lys Tyr Leu Ala Asn Leu130 135 140Phe Met Asp Ala Gln Pro Glu Glu Gly Lys Tyr Ile Ala Arg Thr Val145 150 155 160Leu Gly Thr Met Arg Thr Gly Val Ala Glu Gly Ile Leu Arg Asp Ala165 170 175Ile Ala Glu Ala Phe Lys Val Lys Pro Glu Leu Val Glu Arg Ala Tyr180 185 190Met Leu Thr Ser Asp Phe Gly Tyr Val Ala Lys Val Ala Lys Leu Glu195 200 205Gly Asn Glu Gly Leu Ser Lys Val Ser Ile Gln Ile Gly Lys Pro Ile210 215 220Arg Pro Met Leu Ala Gln Asn Ala Ala Asn Val Lys Glu Ala Leu Ile225 230 235 240Glu Met Gly Gly Glu Ala Ala Phe Glu Ile Lys Tyr Asp Gly Ala Arg245 250 255Val Gln Val His Arg Asp Gly Asp Arg Val Ile Ile Tyr Ser Arg Arg260 265 270Leu Glu Asn Val Thr Arg Ser Ile Pro Glu Ile Val Glu Ala Val Lys275 280 285Ala Ser Leu Lys Pro Ser Asn Val Ile Val Glu Gly Glu Leu Val Ala290 295 300Val Gly Glu Asn Gly Arg Pro Arg Pro Phe Gln Tyr Val Leu Arg Arg305 310 315 320Phe Arg Arg Lys Tyr Asn Ile Glu Glu Met Ile Glu Lys Ile Pro Leu325 330 335Glu Leu Asn Leu Phe Asp Ile Leu Tyr Val Glu Gly Glu Ser Leu Ile340 345 350Asp Thr Lys Phe Ala Glu Arg Arg Arg Lys Leu Glu Glu Ser Val Glu355 360 365Glu Gly Asp Lys Ile Lys Leu Ala Glu Gln Leu Val Thr Lys Lys Val370 375 380Glu Glu Ala Glu Glu Phe Tyr Lys Arg Ala Leu Glu Leu Gly His Glu385 390 395 400Gly Leu Met Ala Lys Arg Leu Asp Ser Ile Tyr Glu Pro Gly Asn Arg405 410 415Gly Lys Lys Trp Leu Lys Ile Lys Pro Thr Met Glu Asn Leu Asp Leu420 425 430Val Ile Ile Gly Ala Glu Trp Gly Glu Gly Arg Arg Ala His Leu Leu435 440 445Gly Ser Phe Leu Val Ala Ala Tyr Asp Pro Glu Ser Gly Glu Phe Val450 455 460Pro Val Gly Lys Val Gly Ser Gly Phe Thr Asp Glu Asp Leu Val Glu465 470 475 480Phe Thr Lys Met Leu Lys Pro Leu Ile Val Arg Glu Glu Gly Lys Phe485 490 495Val Glu Ile Glu Pro Lys Val Val Ile Glu Val Thr Tyr Gln Glu Ile500 505 510Gln Lys Ser Pro Lys Tyr Lys Ser Gly Phe Ala Leu Arg Phe Pro Arg515 520 525Tyr Val Ala Leu Arg Glu Asp Lys Ser Pro Glu Glu Ala Asp Thr Ile530 535 540Glu Arg Val Ala Gln Leu Tyr Glu Leu Gln Glu Arg Phe Lys Ala Lys545 550 555 560Lys Ser Arg12564PRTunknownThermoccocus sp. strain 9 degrees North 12Met Gly Asp Met Arg Tyr Ser Glu Leu Ala Glu Leu Tyr Arg Arg Leu1 5 10 15Glu Lys Thr Thr Leu Lys Thr Leu Lys Thr Lys Phe Val Ala Asp Phe20 25 30Leu Lys Lys Thr Pro Asp Asp Leu Leu Glu Ile Val Pro Tyr Leu Ile35 40 45Leu Gly Lys Val Phe Pro Asp Trp Asp Glu Arg Glu Leu Gly Val Gly50 55 60Glu Lys Leu Leu Ile Arg Ala Val Ser Met Ala Thr Gly Val Pro Glu65 70 75 80Arg Glu Ile Glu Asn Ser Ile Lys Asp Thr Gly Asp Leu Gly Glu Ser85 90 95Val Ala Leu Ala Leu Lys Lys Arg Lys Gln Lys Ser Phe Phe Ser Gln100 105 110Pro Leu Thr Ile Lys Arg Val Tyr Ser Thr Phe Val Lys Val Ala Glu115 120 125Ala Ser Gly Glu Gly Ser Gln Asp Arg Lys Met Lys Tyr Leu Ala Asn130 135 140Leu Phe Met Asp Ala Gln Pro Glu Glu Gly Lys Tyr Ile Ala Arg Thr145 150 155 160Val Leu Gly Thr Met Arg Thr Gly Val Ala Glu Gly Ile Leu Arg Asp165 170 175Ala Ile Ala Glu Ser Phe Lys Val Lys Pro Glu Leu Val Glu Arg Ala180 185 190Tyr Met Leu Thr Ser Asp Phe Gly Tyr Val Ala Lys Val Ala Lys Leu195 200 205Glu Gly Asn Glu Gly Leu Ser Lys Val Ser Ile Gln Ile Gly Lys Pro210 215 220Ile Arg Pro Met Leu Ala Gln Asn Ala Ala Asn Val Lys Glu Ala Leu225 230 235 240Ile Glu Met Gly Gly Glu Ala Ala Phe Glu Ile Lys Tyr Asp Gly Ala245 250 255Arg Val Gln Val His Arg Asp Gly Asp Arg Val Ile Ile Tyr Ser Arg260 265 270Arg Leu Glu Asn Val Thr Arg Ser Ile Pro Glu Ile Val Glu Ala Val275 280 285Lys Ala Ser Leu Lys Pro Ser Asn Val Ile Val Glu Gly Glu Leu Val290 295 300Ala Val Gly Glu Asn Gly Arg Pro Arg Pro Phe Gln Tyr Val Leu Arg305 310 315 320Arg Phe Arg Arg Lys Tyr Asn Ile Glu Glu Met Ile Glu Lys Ile Pro325 330 335Leu Glu Leu Asn Leu Phe Asp Ile Leu Tyr Val Glu Gly Glu Ser Leu340 345 350Ile Asp Thr Lys Phe Ala Glu Arg Arg Lys Lys Leu Glu Glu Ser Val355 360 365Glu Glu Ser Asp Lys Ile Lys Leu Ala Glu Gln Leu Val Thr Lys Lys370 375 380Val Glu Glu Ala Glu Glu Phe Tyr Lys Arg Ala Leu Glu Leu Gly His385 390 395 400Glu Gly Leu Met Ala Lys Arg Leu Asp Ser Ile Tyr Glu Pro Gly Asn405 410 415Arg Gly Lys Lys Trp Leu Lys Ile Lys Pro Thr Met Glu Asn Leu Asp420 425 430Leu Val Ile Ile Gly Ala Glu Trp Gly Glu Gly Arg Arg Ala His Leu435 440 445Leu Gly Ser Phe Leu Val Ala Ala Tyr Asp Pro Glu Ser Gly Glu Phe450 455 460Val Pro Val Gly Lys Val Gly Ser Gly Phe Thr Asp Glu Asp Leu Val465 470 475 480Glu Phe Thr Lys Met Leu Lys Pro Leu Ile Val Arg Glu Glu Gly Lys485 490 495Phe Val Glu Ile Glu Pro Lys Val Val Ile Glu Val Thr Tyr Gln Glu500 505 510Ile Gln Lys Ser Pro Lys Tyr Lys Ser Gly Phe Ala Leu Arg Phe Pro515 520 525Arg Tyr Val Ala Leu Arg Glu Asp Lys Ser Pro Glu Glu Ala Asp Thr530 535 540Ile Glu Arg Val Ala Gln Leu Tyr Glu Leu Gln Glu Arg Phe Lys Ala545 550 555 560Lys Arg Ser Arg13564PRTunknownThermococcus sp. strain 9 degrees North 13Met Gly Asp Met Arg Tyr Ser Glu Leu Ala Glu Leu Tyr Arg Arg Leu1 5 10 15Glu Lys Thr Thr Leu Lys Thr Leu Lys Thr Lys Phe Val Ala Asp Phe20 25 30Leu Lys Lys Thr Pro Asp Asp Leu Leu Glu Ile Val Pro Tyr Leu Ile35 40 45Leu Gly Lys Val Phe Pro Asp Trp Asp Glu Arg Glu Leu Gly Val Gly50 55 60Glu Lys Leu Leu Ile Arg Ala Val Ser Met Ala Thr Gly Val Pro Glu65 70 75 80Arg Glu Ile Glu Asn Ser Ile Lys Asp Thr Gly Asp Leu Gly Glu Ser85 90 95Val Ala Leu Ala Leu Lys Lys Arg Lys Gln Lys Ser Phe Phe Ser Gln100 105 110Pro Leu Thr Ile Lys Arg Val Tyr Ser Thr Phe Val Lys Val Ala Glu115 120 125Ala Ser Gly Glu Gly Ser Gln Asp Arg Lys Met Lys Tyr Leu Ala Asn130 135 140Leu Phe Met Asp Ala Gln Pro Glu Glu Gly Lys Tyr Ile Ala Arg Thr145 150 155 160Val Leu Gly Thr Met Arg Thr Gly Val Ala Glu Gly Ile Leu Arg Asp165 170 175Ala Ile Ala Glu Ser Phe Lys Val Lys Pro Glu Leu Val Glu Arg Ala180 185 190Tyr Met Leu Thr Ser Asp Phe Gly Tyr Val Ala Lys Val Ala Lys Leu195 200 205Glu Gly Asn Glu Gly Leu Ser Lys Val Ser Ile Gln Ile Gly Lys Pro210 215 220Ile Arg Pro

Met Leu Ala Gln Asn Ala Ala Asn Val Lys Glu Ala Leu225 230 235 240Ile Glu Met Gly Gly Glu Ala Ala Phe Glu Ile Lys Tyr Asp Gly Ala245 250 255Arg Val Gln Val His Arg Asp Gly Asp Arg Val Ile Ile Tyr Ser Arg260 265 270Arg Leu Glu Asn Val Thr Arg Ser Ile Pro Glu Ile Val Glu Ala Val275 280 285Lys Ala Ser Leu Lys Pro Ser Asn Val Ile Val Glu Gly Glu Leu Val290 295 300Ala Val Gly Glu Asn Gly Arg Pro Arg Pro Phe Gln Tyr Val Leu Arg305 310 315 320Arg Phe Arg Arg Lys Tyr Asn Ile Glu Glu Met Ile Glu Lys Ile Pro325 330 335Leu Glu Leu Asn Leu Phe Asp Ile Leu Tyr Val Glu Gly Glu Ser Leu340 345 350Ile Asp Thr Lys Phe Ala Glu Arg Arg Lys Lys Leu Glu Glu Ser Val355 360 365Glu Glu Ser Asp Lys Ile Lys Leu Ala Glu Gln Leu Val Thr Lys Lys370 375 380Val Glu Glu Ala Glu Glu Phe Tyr Lys Arg Ala Leu Glu Leu Gly His385 390 395 400Glu Gly Leu Met Ala Lys Arg Leu Asp Ser Ile Tyr Glu Pro Gly Asn405 410 415Arg Gly Lys Lys Trp Leu Lys Ile Lys Pro Thr Met Glu Asn Leu Asp420 425 430Leu Val Ile Ile Gly Ala Glu Trp Gly Glu Gly Arg Arg Ala His Leu435 440 445Leu Gly Ser Phe Leu Val Ala Ala Tyr Asp Pro Glu Ser Gly Glu Phe450 455 460Val Pro Val Gly Lys Val Gly Ser Gly Phe Thr Asp Glu Asp Leu Val465 470 475 480Glu Phe Thr Lys Met Leu Lys Pro Leu Ile Val Arg Glu Glu Gly Lys485 490 495Phe Val Glu Ile Glu Pro Lys Val Val Ile Glu Val Thr Tyr Gln Glu500 505 510Ile Gln Lys Ser Pro Lys Tyr Lys Ser Gly Phe Ala Leu Arg Phe Pro515 520 525Arg Tyr Val Ala Leu Arg Glu Asp Lys Ser Pro Glu Glu Ala Asp Thr530 535 540Ile Glu Arg Val Ala Gln Leu Tyr Glu Leu Gln Glu Arg Phe Lys Ala545 550 555 560Lys Lys Ser Arg14564PRTunknownThermococcus sp. strain 9 degrees North 14Met Gly Asp Met Arg Tyr Ser Glu Leu Ala Glu Leu Tyr Arg Arg Leu1 5 10 15Glu Lys Thr Thr Leu Lys Thr Leu Lys Thr Lys Phe Val Ala Asp Phe20 25 30Leu Lys Lys Thr Pro Asp Asp Leu Leu Glu Ile Val Pro Tyr Leu Ile35 40 45Leu Gly Lys Val Phe Pro Asp Trp Asp Glu Arg Glu Leu Gly Val Gly50 55 60Glu Lys Leu Leu Ile Arg Ala Val Ser Met Ala Thr Gly Val Pro Glu65 70 75 80Arg Glu Ile Glu Asn Ser Ile Lys Asp Thr Gly Asp Leu Gly Glu Ser85 90 95Val Ala Leu Ala Leu Lys Lys Arg Lys Gln Lys Ser Phe Phe Ser Gln100 105 110Pro Leu Thr Ile Lys Arg Val Tyr Ser Thr Phe Val Lys Val Ala Glu115 120 125Ala Ser Gly Glu Gly Ser Gln Asp Arg Lys Met Lys Tyr Leu Ala Asn130 135 140Leu Phe Met Asp Ala Gln Pro Glu Glu Gly Lys Tyr Ile Ala Arg Thr145 150 155 160Val Leu Gly Thr Met Arg Thr Gly Val Ala Glu Gly Ile Leu Arg Asp165 170 175Ala Ile Ala Glu Ala Phe Lys Val Lys Pro Glu Leu Val Glu Arg Ala180 185 190Tyr Met Leu Thr Ser Asp Phe Gly Tyr Val Ala Lys Val Ala Lys Leu195 200 205Glu Gly Asn Glu Gly Leu Ser Lys Val Ser Ile Gln Ile Gly Lys Pro210 215 220Ile Arg Pro Met Leu Ala Gln Asn Ala Ala Asn Val Lys Glu Ala Leu225 230 235 240Ile Glu Met Gly Gly Glu Ala Ala Phe Glu Ile Lys Tyr Asp Gly Ala245 250 255Arg Val Gln Val His Arg Asp Gly Asp Arg Val Ile Ile Tyr Ser Arg260 265 270Arg Leu Glu Asn Ile Thr Arg Ser Ile Pro Glu Ile Val Glu Ala Val275 280 285Lys Ala Ser Leu Lys Pro Ser Lys Val Ile Val Glu Gly Glu Leu Val290 295 300Ala Val Gly Glu Asn Gly Arg Pro Arg Pro Phe Gln Tyr Val Leu Arg305 310 315 320Arg Phe Arg Arg Lys Tyr Asn Ile Glu Glu Met Ile Glu Lys Ile Pro325 330 335Leu Glu Leu Asn Leu Phe Asp Ile Leu Tyr Val Asp Gly Glu Ser Leu340 345 350Ile Asp Thr Lys Phe Ala Glu Arg Arg Lys Lys Leu Glu Glu Ser Val355 360 365Glu Glu Ser Asp Lys Ile Lys Leu Ala Glu Gln Leu Val Thr Lys Lys370 375 380Val Glu Glu Ala Glu Glu Phe Tyr Lys Arg Ala Leu Glu Leu Gly His385 390 395 400Glu Gly Leu Met Ala Lys Arg Leu Asp Ser Ile Tyr Glu Pro Gly Asn405 410 415Arg Gly Lys Lys Trp Leu Lys Ile Lys Pro Thr Met Glu Asn Leu Asp420 425 430Leu Val Ile Ile Gly Ala Glu Trp Gly Glu Gly Arg Arg Ala His Leu435 440 445Leu Gly Ser Phe Leu Val Ala Ala Tyr Asp Pro Glu Ser Gly Glu Phe450 455 460Val Pro Val Gly Lys Val Gly Ser Gly Phe Thr Asp Glu Asp Leu Val465 470 475 480Glu Phe Thr Lys Met Leu Lys Pro Leu Ile Val Arg Glu Glu Gly Lys485 490 495Phe Val Glu Ile Glu Pro Lys Val Val Ile Glu Val Thr Tyr Gln Glu500 505 510Ile Gln Lys Ser Pro Lys Tyr Lys Ser Gly Phe Ala Leu Arg Phe Pro515 520 525Arg Tyr Val Ala Leu Arg Glu Asp Lys Ser Pro Glu Glu Ala Asp Thr530 535 540Ile Glu Arg Val Ala Gln Leu Tyr Glu Leu Gln Glu Arg Tyr Lys Ala545 550 555 560Lys Arg Ser Arg15564PRTunknownThermococcus sp. 9 degrees NB2 15Met Gly Asp Met Arg Tyr Ser Glu Leu Ala Glu Leu Tyr Arg Arg Leu1 5 10 15Glu Lys Thr Thr Leu Lys Thr Leu Lys Thr Lys Phe Val Ala Asp Phe20 25 30Leu Lys Lys Thr Pro Asp Asp Leu Leu Glu Ile Val Pro Tyr Leu Ile35 40 45Leu Gly Lys Val Phe Pro Asp Trp Asp Glu Arg Glu Leu Gly Val Gly50 55 60Glu Lys Leu Leu Ile Arg Ala Val Ser Met Ala Thr Gly Val Pro Glu65 70 75 80Arg Glu Ile Glu Asn Ser Ile Lys Asp Thr Gly Asp Leu Gly Glu Ser85 90 95Val Ala Leu Ala Leu Lys Lys Arg Lys Gln Lys Ser Phe Phe Ser Gln100 105 110Pro Leu Thr Ile Lys Arg Val Tyr Ser Thr Phe Val Lys Val Ala Glu115 120 125Ala Ser Gly Glu Gly Ser Gln Asp Arg Lys Met Lys Tyr Leu Ala Asn130 135 140Leu Phe Met Asp Ala Gln Pro Glu Glu Gly Lys Tyr Ile Ala Arg Thr145 150 155 160Val Leu Gly Thr Met Arg Thr Gly Val Ala Glu Gly Ile Leu Arg Asp165 170 175Ala Ile Ala Glu Ser Phe Lys Val Lys Pro Glu Leu Val Glu Arg Ala180 185 190Tyr Met Leu Thr Ser Asp Phe Gly Tyr Val Ala Lys Val Ala Lys Leu195 200 205Glu Gly Asn Glu Gly Leu Ser Lys Val Ser Ile Gln Ile Gly Lys Pro210 215 220Ile Arg Pro Met Leu Ala Gln Asn Ala Ala Asn Val Lys Glu Ala Leu225 230 235 240Ile Glu Met Gly Gly Glu Ala Ala Phe Glu Ile Lys Tyr Asp Gly Ala245 250 255Arg Val Gln Val His Arg Asp Gly Asp Arg Val Ile Ile Tyr Ser Arg260 265 270Arg Leu Glu Asn Val Thr Arg Ser Ile Pro Glu Ile Val Glu Ala Val275 280 285Lys Ala Ser Leu Lys Pro Ser Asn Val Ile Val Glu Gly Glu Leu Val290 295 300Ala Val Gly Glu Asn Gly Arg Pro Arg Pro Phe Gln Tyr Val Leu Arg305 310 315 320Arg Phe Arg Arg Lys Tyr Asn Ile Glu Glu Met Ile Glu Lys Ile Pro325 330 335Leu Glu Leu Asn Leu Phe Asp Ile Leu Tyr Val Glu Gly Glu Ser Leu340 345 350Ile Asp Thr Lys Phe Ala Glu Arg Arg Lys Lys Leu Glu Glu Ser Val355 360 365Glu Glu Ser Asp Lys Ile Lys Leu Ala Glu Gln Leu Val Thr Lys Lys370 375 380Val Glu Glu Ala Glu Glu Phe Tyr Lys Arg Ala Leu Glu Leu Gly His385 390 395 400Glu Gly Leu Met Ala Lys Arg Leu Asp Ser Ile Tyr Glu Pro Gly Asn405 410 415Arg Gly Lys Lys Trp Leu Lys Ile Lys Pro Thr Met Glu Asn Leu Asp420 425 430Leu Val Ile Ile Gly Ala Glu Trp Gly Glu Gly Arg Arg Ala His Leu435 440 445Leu Gly Ser Phe Leu Val Ala Ala Tyr Asp Pro Glu Ser Gly Glu Phe450 455 460Val Pro Val Gly Lys Val Gly Ser Gly Phe Thr Asp Glu Asp Leu Val465 470 475 480Glu Phe Thr Lys Met Leu Lys Pro Leu Ile Val Arg Glu Glu Gly Lys485 490 495Phe Val Glu Ile Glu Pro Lys Val Val Ile Glu Val Thr Tyr Gln Glu500 505 510Ile Gln Lys Ser Pro Lys Tyr Lys Ser Gly Phe Ala Leu Arg Phe Pro515 520 525Arg Tyr Val Ala Leu Arg Glu Asp Lys Ser Pro Glu Glu Ala Asp Thr530 535 540Ile Glu Arg Val Ala Gln Leu Tyr Glu Leu Gln Glu Arg Phe Lys Ala545 550 555 560Lys Lys Ser Arg16559PRTunknownThermococcus sp. tfumicolans 16Met Lys Tyr Ser Glu Leu Ala Gly Leu Tyr Arg Arg Leu Glu Lys Thr1 5 10 15Thr Leu Lys Thr Leu Lys Thr Arg Phe Val Ala Asp Phe Leu Lys Asn20 25 30Val Pro Asp Glu Leu Leu Glu Ile Val Pro Tyr Leu Ile Leu Gly Lys35 40 45Val Phe Pro Asp Trp Asp Glu Arg Glu Leu Gly Val Gly Glu Lys Leu50 55 60Leu Ile Lys Ala Val Ser Ile Ala Thr Gly Val Pro Glu Gly Glu Ile65 70 75 80Glu Asn Ser Ile Lys Asp Thr Gly Asp Leu Gly Glu Ser Ile Ala Leu85 90 95Ala Val Lys Lys Lys Lys Gln Lys Ser Phe Phe Ser Gln Pro Leu Thr100 105 110Ile Lys Arg Val Tyr Asp Thr Phe Val Lys Val Ala Glu Ser Gln Gly115 120 125Glu Gly Ser Gln Asp Arg Lys Met Lys Tyr Leu Ala Asn Leu Phe Met130 135 140Asp Ala Gln Pro Glu Glu Ala Lys Tyr Ile Ala Arg Thr Val Leu Gly145 150 155 160Thr Met Arg Thr Gly Val Ala Glu Gly Ile Leu Arg Asp Ala Ile Ala165 170 175Glu Ala Phe Lys Val Lys Ala Glu Leu Val Glu Arg Ala Tyr Met Leu180 185 190Thr Ser Asp Phe Gly Tyr Val Thr Lys Val Ala Lys Leu Glu Gly Asn195 200 205Glu Gly Leu Ser Lys Val Arg Ile Gln Val Gly Lys Pro Val Arg Pro210 215 220Met Leu Ala Gln Asn Ala Ala Ser Val Lys Asp Ala Leu Leu Glu Met225 230 235 240Gly Gly Glu Ala Ala Phe Glu Ile Lys Tyr Asp Gly Ala Arg Val Gln245 250 255Val His Lys Asp Gly Asp Arg Val Val Ile Tyr Ser Arg Arg Leu Glu260 265 270Asn Val Thr Arg Ser Ile Pro Glu Ile Val Glu Ala Val Arg Ser Gln275 280 285Leu Arg Pro Glu Lys Ala Ile Val Glu Gly Glu Leu Val Ala Val Gly290 295 300Asp Gly Gly Lys Pro Arg Pro Phe Gln Tyr Val Leu Arg Arg Phe Arg305 310 315 320Arg Lys Tyr Asn Ile Glu Glu Met Ile Glu Arg Ile Pro Leu Glu Leu325 330 335Asn Leu Phe Asp Val Leu Tyr Val Asp Gly Glu Ser Leu Val Asp Thr340 345 350Pro Phe Met Glu Arg Arg Lys Arg Leu Glu Glu Ala Val Glu Glu Ser355 360 365Glu Arg Ile Lys Leu Ala Gln Gln Leu Val Thr Lys Lys Ala Glu Glu370 375 380Ala Glu Glu Phe Tyr Arg Arg Ala Leu Glu Leu Gly His Glu Gly Leu385 390 395 400Met Ala Lys Arg Leu Asp Ser Val Tyr Glu Pro Gly Asn Arg Gly Lys405 410 415Lys Trp Leu Lys Ile Lys Pro Thr Met Glu Asp Leu Asp Leu Val Ile420 425 430Ile Gly Ala Glu Trp Gly Glu Gly Arg Arg Ala His Leu Leu Gly Ser435 440 445Phe Leu Val Ala Ala Tyr Asp Gln His Arg Gly Glu Phe Val Pro Val450 455 460Gly Lys Val Gly Ser Gly Phe Thr Asp Glu Asp Leu Ala Glu Phe Thr465 470 475 480Lys Met Leu Lys Pro Leu Ile Val Arg Glu Glu Gly Lys Tyr Val Glu485 490 495Ile Glu Pro Arg Val Val Ile Gln Val Thr Tyr Gln Glu Ile Gln Lys500 505 510Ser Pro Lys Tyr Glu Ser Gly Phe Ala Leu Arg Phe Pro Arg Tyr Val515 520 525Ala Leu Arg Glu Asp Lys Ser Pro Glu Glu Ala Asp Thr Ile Glu Arg530 535 540Ile Ser Glu Leu Tyr Gly Leu Gln Glu Arg Phe Lys Ala Lys Arg545 550 55517562PRTunknownThermococcus sp. tkodakaraenis 17Met Ser Asp Met Arg Tyr Ser Glu Leu Ala Asp Leu Tyr Arg Arg Leu1 5 10 15Glu Lys Thr Thr Leu Lys Thr Leu Lys Thr Lys Phe Val Ala Asp Phe20 25 30Leu Lys Lys Thr Pro Asp Glu Leu Leu Glu Ile Val Pro Tyr Leu Ile35 40 45Leu Gly Lys Val Phe Pro Asp Trp Asp Glu Arg Glu Leu Gly Val Gly50 55 60Glu Lys Leu Leu Ile Lys Ala Val Ser Met Ala Thr Gly Val Pro Glu65 70 75 80Lys Glu Ile Glu Asp Ser Val Arg Asp Thr Gly Asp Leu Gly Glu Ser85 90 95Val Ala Leu Ala Ile Lys Lys Lys Lys Gln Lys Ser Phe Phe Ser Gln100 105 110Pro Leu Thr Ile Lys Arg Val Tyr Asp Thr Phe Val Lys Ile Ala Glu115 120 125Ala Gln Gly Glu Gly Ser Gln Asp Arg Lys Met Lys Tyr Leu Ala Asn130 135 140Leu Phe Met Asp Ala Glu Pro Glu Glu Gly Lys Tyr Leu Ala Arg Thr145 150 155 160Val Leu Gly Thr Met Arg Thr Gly Val Ala Glu Gly Ile Leu Arg Asp165 170 175Ala Ile Ala Glu Ala Phe Arg Val Lys Pro Glu Leu Val Glu Arg Ala180 185 190Tyr Met Leu Thr Ser Asp Phe Gly Tyr Val Ala Lys Ile Ala Lys Leu195 200 205Glu Gly Asn Glu Gly Leu Ser Lys Val Arg Ile Gln Ile Gly Lys Pro210 215 220Ile Arg Pro Met Leu Ala Gln Asn Ala Ala Ser Val Lys Asp Ala Leu225 230 235 240Ile Glu Met Gly Gly Glu Ala Ala Phe Glu Ile Lys Tyr Asp Gly Ala245 250 255Arg Val Gln Val His Lys Asp Gly Asp Lys Val Ile Val Tyr Ser Arg260 265 270Arg Leu Glu Asn Val Thr Arg Ser Ile Pro Glu Val Ile Glu Ala Ile275 280 285Lys Ala Ala Leu Lys Pro Glu Lys Ala Ile Val Glu Gly Glu Leu Val290 295 300Ala Val Gly Glu Asn Gly Arg Pro Arg Pro Phe Gln Tyr Val Leu Arg305 310 315 320Arg Phe Arg Arg Lys Tyr Asn Ile Asp Glu Met Ile Glu Lys Ile Pro325 330 335Leu Glu Leu Asn Leu Phe Asp Val Met Phe Val Asp Gly Glu Ser Leu340 345 350Ile Glu Thr Lys Phe Ile Asp Arg Arg Asn Lys Leu Glu Glu Ile Val355 360 365Lys Glu Ser Glu Lys Ile Lys Leu Ala Glu Gln Leu Ile Thr Lys Lys370 375 380Val Glu Glu Ala Glu Ala Phe Tyr Arg Arg Ala Leu Glu Leu Gly His385 390 395 400Glu Gly Leu Met Ala Lys Arg Leu Asp Ser Ile Tyr Glu Pro Gly Asn405 410 415Arg Gly Lys Lys Trp Leu Lys Ile Lys Pro Thr Met Glu Asn Leu Asp420 425 430Leu Val Ile Ile Gly Ala Glu Trp Gly Glu Gly Arg Arg Ala His Leu435 440 445Leu Gly Ser Phe Leu Val Ala Ala Tyr Asp Pro His Ser Gly Glu Phe450 455 460Leu Pro Val Gly Lys Val Gly Ser Gly Phe Thr Asp Glu Asp Leu Val465 470 475 480Glu Phe Thr Lys Met Leu Lys Pro Tyr Ile Val Arg Gln Glu Gly Lys485 490 495Phe Val Glu Ile Glu Pro Lys Phe Val Ile Glu Val Thr Tyr Gln Glu500 505 510Ile Gln Lys Ser Pro Lys Tyr Lys Ser Gly Phe Ala Leu Arg Phe Pro515 520 525Arg Tyr Val Ala Leu Arg Glu Asp Lys Ser Pro Glu Glu Ala Asp Thr530 535 540Ile Glu Arg Val Ala Glu Leu Tyr Glu Leu Gln Glu Arg Phe Lys Ala545 550 555 560Lys Lys18559PRTunknownPyrococcus sp. pabyssi 18Met Arg Tyr Ile Glu Leu Ala Gln Leu Tyr Gln Lys Leu Glu Lys Thr1 5 10 15Thr Met Lys Leu Ile Lys Thr Arg Leu Val Ala Asp Phe Leu Lys Lys20 25 30Val Pro Glu Asp His

Leu Glu Phe Ile Pro Tyr Leu Ile Leu Gly Asp35 40 45Val Phe Pro Glu Trp Asp Glu Arg Glu Leu Gly Val Gly Glu Lys Leu50 55 60Leu Ile Lys Ala Val Ser Met Ala Thr Gly Ile Asp Ser Lys Glu Ile65 70 75 80Glu Asn Ser Val Lys Asp Thr Gly Asp Leu Gly Glu Ser Ile Ala Leu85 90 95Ala Val Lys Arg Arg Lys Gln Lys Ser Phe Phe Ser Gln Pro Leu Thr100 105 110Ile Lys Arg Val Tyr Gln Thr Leu Val Lys Val Ala Glu Thr Thr Gly115 120 125Glu Gly Ser Gln Asp Lys Lys Met Lys Tyr Leu Ala Asn Leu Phe Met130 135 140Asp Ala Glu Pro Ile Glu Ala Lys Tyr Ile Ala Arg Thr Val Leu Gly145 150 155 160Thr Met Arg Thr Gly Val Ala Glu Gly Leu Leu Arg Asp Ala Ile Ser165 170 175Leu Ala Phe Asn Val Lys Val Glu Leu Val Glu Arg Ala Tyr Met Leu180 185 190Thr Ser Asp Phe Gly Phe Val Ala Lys Ile Ala Lys Thr Glu Gly Asn195 200 205Asp Gly Leu Ala Lys Val Thr Ile Gln Ile Gly Lys Pro Ile Lys Pro210 215 220Met Leu Ala Gln Gln Ala Ala Asn Ile Lys Glu Ala Leu Leu Glu Met225 230 235 240Gly Gly Glu Ala Glu Phe Glu Ile Lys Tyr Asp Gly Ala Arg Val Gln245 250 255Val His Lys Asp Gly Glu Lys Val Thr Ile Tyr Ser Arg Arg Leu Glu260 265 270Asn Val Thr Arg Ala Ile Pro Glu Ile Val Glu Ala Ile Lys Glu Ala275 280 285Leu Lys Pro Ala Lys Ala Ile Val Glu Gly Glu Leu Val Ala Ile Gly290 295 300Glu Asp Gly Arg Pro Leu Pro Phe Gln Tyr Val Leu Arg Arg Phe Arg305 310 315 320Arg Lys Tyr Asn Ile Glu Glu Met Met Glu Lys Ile Pro Leu Glu Leu325 330 335Asn Leu Phe Asp Val Leu Tyr Val Asp Gly Val Ser Leu Ile Asp Thr340 345 350Lys Phe Met Glu Arg Arg Lys Lys Leu Glu Glu Ile Val Glu Ala Asn355 360 365Gly Lys Val Lys Ile Ala Glu Asn Leu Ile Thr Lys Asn Val Glu Glu370 375 380Ala Glu Gln Phe Tyr Lys Arg Ala Leu Glu Met Gly His Glu Gly Leu385 390 395 400Met Ala Lys Arg Leu Asp Ala Ile Tyr Glu Pro Gly Asn Arg Gly Lys405 410 415Lys Trp Leu Lys Ile Lys Pro Thr Met Glu Asn Leu Asp Leu Val Ile420 425 430Ile Gly Ala Glu Trp Gly Glu Gly Arg Arg Ala His Leu Leu Gly Ser435 440 445Phe Ile Leu Gly Ala Tyr Asp Pro Glu Thr Gly Glu Phe Leu Glu Val450 455 460Gly Lys Val Gly Ser Gly Phe Thr Asp Asp Asp Leu Val Glu Phe Thr465 470 475 480Lys Met Leu Arg Pro Leu Ile Ile Lys Glu Glu Gly Lys Arg Val Trp485 490 495Ile Gln Pro Lys Val Val Ile Glu Val Thr Tyr Gln Glu Ile Gln Lys500 505 510Ser Pro Lys Tyr Arg Ser Gly Phe Ala Leu Arg Phe Pro Arg Tyr Val515 520 525Ala Leu Arg Glu Asp Lys Gly Pro Glu Asp Ala Asp Thr Ile Glu Arg530 535 540Ile Ala Gln Leu Tyr Glu Leu Gln Glu Arg Met Lys Gly Lys Val545 550 55519561PRTunknownPyrococcus sp. pfuriosus 19Met Arg Tyr Leu Glu Leu Ala Gln Leu Tyr Gln Lys Leu Glu Lys Thr1 5 10 15Thr Met Lys Leu Ile Lys Thr Arg Leu Val Ala Asp Phe Leu Lys Lys20 25 30Val Pro Asp Asp His Leu Glu Phe Ile Pro Tyr Leu Ile Leu Gly Glu35 40 45Val Phe Pro Glu Trp Asp Glu Arg Glu Leu Gly Val Gly Glu Lys Leu50 55 60Leu Ile Lys Ala Val Ala Met Ala Thr Gly Ile Asp Ala Lys Glu Ile65 70 75 80Glu Glu Ser Val Lys Asp Thr Gly Asp Leu Gly Glu Ser Ile Ala Leu85 90 95Ala Val Lys Lys Lys Lys Gln Lys Ser Phe Phe Ser Gln Pro Leu Thr100 105 110Ile Lys Arg Val Tyr Gln Thr Leu Val Lys Val Ala Glu Thr Thr Gly115 120 125Glu Gly Ser Gln Asp Lys Lys Val Lys Tyr Leu Ala Asp Leu Phe Met130 135 140Asp Ala Glu Pro Leu Glu Ala Lys Tyr Leu Ala Arg Thr Ile Leu Gly145 150 155 160Thr Met Arg Thr Gly Val Ala Glu Gly Leu Leu Arg Asp Ala Ile Ala165 170 175Met Ala Phe His Val Lys Val Glu Leu Val Glu Arg Ala Tyr Met Leu180 185 190Thr Ser Asp Phe Gly Tyr Val Ala Lys Ile Ala Lys Leu Glu Gly Asn195 200 205Glu Gly Leu Ala Lys Val Gln Val Gln Leu Gly Lys Pro Ile Lys Pro210 215 220Met Leu Ala Gln Gln Ala Ala Ser Ile Arg Asp Ala Leu Leu Glu Met225 230 235 240Gly Gly Glu Ala Glu Phe Glu Ile Lys Tyr Asp Gly Ala Arg Val Gln245 250 255Val His Lys Asp Gly Ser Lys Ile Ile Val Tyr Ser Arg Arg Leu Glu260 265 270Asn Val Thr Arg Ala Ile Pro Glu Ile Val Glu Ala Leu Lys Glu Ala275 280 285Ile Ile Pro Glu Lys Ala Ile Val Glu Gly Glu Leu Val Ala Ile Gly290 295 300Glu Asn Gly Arg Pro Leu Pro Phe Gln Tyr Val Leu Arg Arg Phe Arg305 310 315 320Arg Lys His Asn Ile Glu Glu Met Met Glu Lys Ile Pro Leu Glu Leu325 330 335Asn Leu Phe Asp Val Leu Tyr Val Asp Gly Gln Ser Leu Ile Asp Thr340 345 350Lys Phe Ile Asp Arg Arg Arg Thr Leu Glu Glu Ile Ile Lys Gln Asn355 360 365Glu Lys Ile Lys Val Ala Glu Asn Leu Ile Thr Lys Lys Val Glu Glu370 375 380Ala Glu Ala Phe Tyr Lys Arg Ala Leu Glu Met Gly His Glu Gly Leu385 390 395 400Met Ala Lys Arg Leu Asp Ala Val Tyr Glu Pro Gly Asn Arg Gly Lys405 410 415Lys Trp Leu Lys Ile Lys Pro Thr Met Glu Asn Leu Asp Leu Val Ile420 425 430Ile Gly Ala Glu Trp Gly Glu Gly Arg Arg Ala His Leu Phe Gly Ser435 440 445Phe Ile Leu Gly Ala Tyr Asp Pro Glu Thr Gly Glu Phe Leu Glu Val450 455 460Gly Lys Val Gly Ser Gly Phe Thr Asp Asp Asp Leu Val Glu Phe Thr465 470 475 480Lys Met Leu Lys Pro Leu Ile Ile Lys Glu Glu Gly Lys Arg Val Trp485 490 495Leu Gln Pro Lys Val Val Ile Glu Val Thr Tyr Gln Glu Ile Gln Lys500 505 510Ser Pro Lys Tyr Arg Ser Gly Phe Ala Leu Arg Phe Pro Arg Phe Val515 520 525Ala Leu Arg Asp Asp Lys Gly Pro Glu Asp Ala Asp Thr Ile Glu Arg530 535 540Ile Ala Gln Leu Tyr Glu Leu Gln Glu Lys Met Lys Gly Lys Val Glu545 550 555 560Ser2031DNAunknownprimer 20cggtggtgca tatgrgcgay atgmrstact c 312140DNAunknownprimer 21ataaactcta gattacytct tcgccttgaa cctctcctgg 402239DNAunknownprimer 22cggtggtgca tatgggcgay atgaggtact ccgagctgg 392323DNAunknownprimer 23cgaacgtcgc gcagagaaac agg 232420DNAunknownprimer 24cctgctctgc cgcttcacgc 20


Patent applications by Ira Schildkraut, Cerrillos, NM US

Patent applications by NEW ENGLAND BIOLABS, INC.

Patent applications in class Involving a ligase (6.)

Patent applications in all subclasses Involving a ligase (6.)


User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA