Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: CORN PLANTS AND SEED ENHANCED FOR ASPARAGINE AND PROTEIN

Inventors:  Scott Andersen (Manchester, MO, US)  James Crowley (Manchester, MO, US)  Stephen M. Duff (St. Louis, MO, US)  Bradon J. Fabbri (Chesterfield, MO, US)  Qungang Qi (Ballwin, MO, US)  Bo-Xing Qiu (Chesterfield, MO, US)  Steven Screen (St. Louis, MO, US)
IPC8 Class: AA23L110FI
USPC Class: 426622
Class name: Flour or meal type
Publication date: 03/26/2009
Patent application number: 20090081353






Sign up to receive free email alerts when patent applications with chosen keywords are published SIGN UP

Abstract:

The present invention relates to a corn plant and seed with enhanced levels of protein and amino acids. The invention also relates to DNA constructs that provide expression in transgenic corn cells of an asparagine synthetase enzyme. The DNA constructs are used in a method to produce transgenic corn plants and seeds and to select for plants and seeds with enhanced levels of protein and amino acids.

Claims:

1. An isolated nucleic acid sequence selected from the group consisting of:(a) a nucleic acid sequence comprising the sequence of SEQ ID NO:50;(b) a nucleic acid sequence with at least about 90% sequence identity to the sequence of SEQ ID NO:50, wherein the nucleic acid sequence encodes a polypeptide with asparagine synthetase activity;(c) a nucleic acid sequence that encodes the polypeptide sequence of SEQ ID NO:51;(d) a nucleic acid sequence that encodes a polypeptide with at least about 90% sequence identity to the polypeptide sequence of SEQ ID NO:51, wherein the polypeptide has asparagine synthetase activity; and(e) a nucleic acid sequence that hybridizes to a sequence of (a)-(d) under high stringency conditions of about 0.2.times.SSC and 65.degree. C., wherein the nucleic acid sequence encodes a polypeptide comprising asparagine synthetase activity.

2. The isolated nucleic acid sequence of claim 1, further defined as operably linked to a heterologous regulatory element.

3. The isolated nucleic acid sequence of claim 1, further defined as operably linked to a heterologous promoter functional in plants.

4. A transgenic plant cell transformed with the isolated nucleic acid sequence of claim 1.

5. A transgenic plant transformed with the isolated nucleic acid sequence of claim 1, or a part thereof.

6. The transgenic plant of claim 5, further defined as a corn plant.

7. A transgenic seed comprising the isolated nucleic acid sequence of claim 1.

8. A transgenic corn seed with an increased asparagine and/or protein content comprising in its genome a DNA construct comprising a polynucleotide encoding an AsnS4 asparagine synthetase polypeptide operably linked to a heterologous promoter, wherein said seed has an increased asparagine and/or protein content relative to the protein level of a seed of the same variety as the transgenic corn seed but not containing said DNA construct in its genome.

9. The transgenic corn seed of claim 8, wherein the polynucleotide encoding an asparagine synthetase polypeptide comprises the isolated nucleic acid sequence of claim 1.

10. The transgenic corn seed of claim 8, wherein said asparagine synthetase polypeptide comprises SEQ ID NO:51.

11. The transgenic corn seed of claim 8, wherein said polynucleotide comprises the nucleic acid sequence of SEQ ID NO:50.

12. The transgenic corn seed of claim 8, wherein said promoter is a rice actin 1 promoter.

13. A method of producing a transgenic corn plant with increased asparagine comprisinga) introducing into a corn plant a heterologous DNA construct comprising a promoter molecule functional in a corn cell operably linked to a DNA molecule encoding an asparagine synthetase polypeptide;b) growing the plant to maturity; andc) harvesting seed from the plant.

14. The method of claim 13, wherein said polynucleotide encoding a heterologous asparagine synthetase comprises the isolated nucleic acid sequence of claim 1.

15. The method of claim 13, wherein said asparagine synthetase polypeptide comprises the amino acid sequence of SEQ ID NO:51.

16. The method of claim 13, wherein said DNA molecule comprises the nucleic acid sequence of SEQ ID NO:50.

17. The method of claim 13, further comprising the step of:f) selecting a seed with increased protein.

18. Corn meal produced from the plant of claim 6, wherein the corn meal comprises the isolated nucleic acid sequence of claim 1.

19. The corn meal of claim 18, wherein said nucleic acid sequence comprises the sequence of SEQ ID NO:50.

20. The corn meal of claim 18, wherein said nucleic acid sequence encodes a polypeptide of SEQ ID NO:51.

21. A method of producing food or feed comprising obtaining the transgenic plant of claim 5 and producing food or feed from the plant or a part thereof.

22. Food or feed produced by the method of claim 21, wherein the food or feed comprises the isolated nucleic acid sequence of claim 1.

Description:

[0001]This application claims the priority of U.S. Provisional application Ser. No. 60/912,909, filed Apr. 19, 2007, the entire disclosure of which is incorporated herein by reference.

BACKGROUND OF THE INVENTION

[0002]1. Field of the Invention

[0003]The present invention relates generally to the field of plant biotechnology and more specifically to enhancing asparagine and protein in plants and seeds.

[0004]2. Description of Related Art

[0005]Farmers and consumers desire crop plants with improved agronomic traits such as increased yield, increased seed protein production, and improved nutritional composition. Desirable nutritional components of crop plants include, among others, fiber, antioxidants such as Vitamin E, selenium, iron, magnesium, zinc, B vitamins, lignans, phenolic acids, essential amino acids, and phytoestrogens. Although considerable efforts in plant breeding have provided some gains in these desired traits, the ability to introduce specific non-host DNA into a plant genome provides further opportunities for generation of plants with these traits. In particular, while the yield of conventional corn has steadily increased over the years, there has not been a similar increase in the capacity of corn plants to assimilate nitrogen more efficiently or to increase seed protein content.

[0006]Availability of nitrogen has a significant positive impact on plant productivity, biomass, and crop yield including the production of seed protein. In plants, inorganic nitrogen is assimilated from the soil, reduced to ammonia, and incorporated into organic nitrogen in the form of the nitrogen-transporting amino acids asparagine, glutamine, aspartic acid and glutamic acid. Asparagine (Asn) is the preferred amide transport molecule because of its high nitrogen to carbon ratio (2N:4C versus 2N:5C) and because it is relatively inert. Asn and other amino acids are also used as building blocks for protein synthesis.

[0007]In plants, Asn is synthesized from glutamine, aspartate and ATP, in a reaction catalyzed by the enzyme asparagine synthetase (AsnS). Glutamate, AMP and pyrophosphate are formed as by-products. Two forms of AsnS have been described: a glutamine-dependent form and an ammonia-dependent form. The glutamine-dependent AsnS can catalyze both the glutamine-dependent and ammonia-dependent reactions although glutamine is the preferred nitrogen source.

[0008]High concentration of protein is considered an important quality trait for most major crops, including soybean, corn, and wheat. Varieties of high protein corn, wheat, and soybeans, for example, have been identified through traditional breeding. However, most of the high protein lines developed this way have yield drag or other agronomic disadvantages. It would be desirable if the protein content of crops, especially corn, could be increased above the presently available levels, both for human consumption and for use of the product in animal feeds. This would offer the benefit of greatly enhanced nutrient value when the crop is used as food and feed for humans and animals.

SUMMARY OF THE INVENTION

[0009]The invention provides methods and compositions for development of crops and plant products to increase the protein and amino acid content. The methods and compositions increase the level of free amino acids and protein in plant tissues, particularly in seeds. More specifically, transgenic plants and seeds are provided that contain heterologous DNA compositions that expresses a gene product involved in increased asparagine and increased protein biosynthesis. The expression of the product enhances the nutritional value of food corn and feed corn sources and processed products derived from the transgenic corn seed or parts thereof.

[0010]In one aspect, the invention provides methods for increasing protein content in a corn plant. DNA constructs comprising a polynucleotide sequence encoding polypeptides with asparagine synthetase activity are also provided.

[0011]In another embodiment, the present invention comprises a corn plant cell transformed with the heterologous DNA composition encoding an asparagine synthetase identified herein. In specific embodiments, the heterologous expression of a corn AsnS4 (asparagine synthetase isozyme 4) polynucleotide molecule is provided, for example, to result in elevated asparagine and/or protein in a transgenic plant, including in the seeds, relative to a plant of the same variety not expressing the heterologous corn AsnS2 polynucleotide molecule.

[0012]In particular embodiments, a nucleic acid sequence is provided, as well as methods of use thereof, wherein the sequence is selected from the group consisting of: (a) a nucleic acid sequence comprising the sequence of SEQ ID NO:50; (b) a nucleic acid sequence with at least about 90% identity to the sequence of SEQ ID NO:50, wherein the nucleic acid sequence encodes a polypeptide comprising asparagine synthetase activity; (c) a nucleic acid sequence that encodes the polypeptide sequence of SEQ ID NO:51; (d) a nucleic acid sequence that encodes a polypeptide sequence with at least about 90% identity to the sequence of SEQ ID NO:51, wherein the polypeptide comprises asparagine synthetase activity; and (e) a nucleic acid sequence that hybridizes to a sequence of (a)-(d) under high stringency conditions of about 0.2×SSC and 65° C., wherein the nucleic acid sequence encodes a polypeptide comprising asparagine synthetase activity. In particular emnbodiments, nucleic acids are provided having at least 90%, 93%, 95%, 96%, 97%, 98% or 99% sequence identity with the sequence of SEQ ID NO:50. In further embodiments, nucleic acids are provided encoding a polypeptide sequence having at least 90%, 93%, 95%, 96%, 97%, 98% or 99% sequence identity with the sequence of SEQ ID NO:51. The invention also provides isolated polypeptide sequences comprising SEQ ID NO:51, as well as sequences having at least 90%, 93%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0013]The present invention also relates to food or animal feed prepared from a seed provided by the invention with increased protein and/or amino acid content, or a processed product of such seed, for example, a meal. Accordingly, the present invention also encompasses a corn seed containing an asparagine synthetase enzyme produced by expression of a heterologous DNA construct comprising a DNA molecule encoding a corn asparagine synthetase enzyme. One embodiment of such a seed is harvested grain, the present invention also encompasses meal, gluten and other corn products made from such grain.

[0014]The present invention includes isolated nucleic acid primer sequences comprising one or more of SEQ ID NOs:52-59, or the complement thereof. The present invention includes a method to detect or identify, in the genome of a transformed plant or progeny thereof, a heterologous polynucleotide molecule encoding a plant AsnS polypeptide, or a plant polypeptide having AsnS activity of the present invention, comprising a polynucleotide molecule selected from the group consisting of SEQ ID NOs:52-59, wherein said polynucleotide molecule is used as a DNA primer in a DNA amplification method.

BRIEF DESCRIPTION OF THE FIGURES

[0015]FIG. 1 illustrates the plasmid map of pMON79706.

[0016]FIG. 2 illustrates the plasmid map of pMON66229.

[0017]FIG. 3 illustrates the plasmid map of pMON66230.

[0018]FIG. 4 illustrates the plasmid map of pMON66231.

[0019]FIG. 5 illustrates the plasmid map of pMON66239.

[0020]FIG. 6 Transgene expression in pMON79706 events. Error bars represent 95% confidence interval, with n=5 for transgenic events and n=10 for inbred control.

[0021]FIG. 7 Transgene expression in pMON92870 events. Error bars represent 95% confidence interval, with n>3 plants for transgenic events and n=8 plants for inbred control.

DESCRIPTION OF THE NUCLEIC ACID AND POLYPEPTIDE SEQUENCES

[0022]SEQ ID NO: 1 is a polynucleotide sequence encoding a Zea mays AsnS1.

[0023]SEQ ID NO: 2 is a Zea mays AsnS1 polypeptide.

[0024]SEQ ID NO: 3 is a polynucleotide sequence encoding a Zea mays AsnS2.

[0025]SEQ ID NO: 4 is a Zea mays AsnS2 polypeptide.

[0026]SEQ ID NO: 5 is a polynucleotide sequence encoding a Zea mays AsnS3.

[0027]SEQ ID NO: 6 is a Zea mays AsnS3 polypeptide.

[0028]SEQ ID NO: 7 is a polynucleotide sequence encoding a Glycine max AsnS.

[0029]SEQ ID NO: 8 is a Glycine max AsnS polypeptide.

[0030]SEQ ID NO: 9 is a polynucleotide sequence encoding a Xylella fastidiosa AsnS.

[0031]SEQ ID NO: 10 is a polynucleotide sequence encoding a Xanthomonas campestris AsnS.

[0032]SEQ ID NO: 11 is a polynucleotide sequence encoding a Bacillus halodurans AsnS.

[0033]SEQ ID NO: 12 is a polynucleotide sequence encoding an Oryza sativa AsnS.

[0034]SEQ ID NO: 13 is a polynucleotide sequence encoding a Galdieria sulphuraria AsnS.

[0035]SEQ ID NO: 14 is a polynucleotide sequence encoding a Galdieria sulphuraria AsnS.

[0036]SEQ ID NO: 15 is a polynucleotide sequence encoding a Galdieria sulphuraria AsnS.

[0037]SEQ ID NO: 16 is a polynucleotide sequence encoding a Galdieria sulphuraria AsnS.

[0038]SEQ ID NO: 17 is a polynucleotide sequence encoding a Saccharomyces cerevisiae CGPG3913 AsnS.

[0039]SEQ ID NO: 18 is a forward (f) AsnS PCR primer sequence.

[0040]SEQ ID NO: 19 is a forward (f) AsnS PCR primer sequence.

[0041]SEQ ID NOs 20-43, are primary and secondary forward (f) and reverse (r) AsnS PCR primer sequences used in a Gateway cloning procedure.

[0042]SEQ ID NO: 44, a forward (f) AsnS PCR primer sequence.

[0043]SEQ ID NO: 45, a forward (f) AsnS PCR primer sequence.

[0044]SEQ ID NO:46 ZmASsense primer

[0045]SEQ ID NO:47 ZmASantisense primer

[0046]SEQ ID NO: 48 corn AsnS3 forward primer

[0047]SEQ ID NO: 49 corn AsnS3 reverse primer

[0048]SEQ ID NO: 50 is a polynucleotide sequence encoding a Zea mays AsnS4.

[0049]SEQ ID NO: 51 is a Zea mays AsnS4 polypeptide.

[0050]SEQ ID NO: 52 is a forward PCR primer, Zm-AsnS1_for1.

[0051]SEQ ID NO: 53 is a reverse PCR primer, Zm-AsnS1_rev1.

[0052]SEQ ID NO: 54 is a forward PCR primer, Zm-AsnS3_for 2.

[0053]SEQ ID NO: 55 is a reverse PCR primer, Zm-AsnS3_rev2.

[0054]SEQ ID NO: 56 is a forward PCR primer, Zm-AsnS4_for 3.

[0055]SEQ ID NO: 57 is a reverse PCR primer, Zm-AsnS4_rev3.

[0056]SEQ ID NO: 58 is a forward PCR primer, Zm-AsnS2_for 4.

[0057]SEQ ID NO: 59 is a reverse PCR primer, Zm-AsnS2_rev4.

DETAILED DESCRIPTION OF THE INVENTION

[0058]The following is a detailed description of the invention provided to aid those skilled in the art in practicing the present invention. Unless otherwise defined herein, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art. Definitions of common terms in molecular biology may also be found in Rieger et al., 1991; and Lewin, 1994. The nomenclature for DNA bases as set forth at 37 CFR § 1.822 is used. The standard one- and three-letter nomenclature for amino acid residues is used. Modifications and variations in the embodiments described herein may be made by those of ordinary skill in the art without departing from the spirit or scope of the present invention.

[0059]The present invention provides a method to increase protein content in a corn plant by introducing into the genome of a corn plant cell a heterologous polynucleotide that expresses an AsnS polypeptide in the transgenic plant cell. The present invention provides DNA constructs that comprise (comprise means "including but not limited to") polynucleotide molecules, or segments of a polynucleotide molecule that encode an AsnS polypeptide, optionally operably linked to a chloroplast transit peptide.

[0060]Polynucleotide molecules encoding a AsnS polypeptide or analog or allele thereof, or polynucleotide molecules encoding a transit peptide or marker/reporter gene are "isolated" in that they have been at least partially prepared in vitro, e.g., isolated from its native state, from a cell, purified, and amplified, e.g., they are in combination with genetic elements heterologous to those found normally associated with them in their native state. As used herein, a heterologous DNA construct comprising an AsnS encoding polynucleotide molecule that has been introduced into a host cell, is preferably not identical to any polynucleotide molecule present in the cell in its native, untransformed state and is isolated with respect of other DNA molecules that occur in the genome of the host cell.

[0061]As used herein, "altered or increased" levels of asparagine in a transformed plant, plant tissue, or plant cell are levels which are greater than the levels found in the corresponding plant, plant tissue, or plant cells not containing the DNA constructs of the present invention.

[0062]The agents of the present invention may also be recombinant. As used herein, the term recombinant means any agent (e.g., DNA, peptide, etc.), that is, or results, however indirectly, from human manipulation of a polynucleotide molecule.

[0063]As used herein in a preferred aspect, an increase in the nutritional quality of a seed, for example, increased seed protein content, is determined by the ability of a plant to produce a seed having a higher yield of protein or a nutritional component than a seed without such increase in protein or nutritional quality. In a particularly preferred aspect of the present invention, the increase in nutritional quality is measured relative to a plant with a similar genetic background to the nutritionally enhanced plant except that the plant of the present invention expresses or over expresses a protein or fragment thereof described in the heterologous DNA constructs herein.

Polynucleotide Molecules

[0064]The present invention includes and provides transgenic corn plants and seed that comprise in their genome a transgene comprising a heterologous DNA molecule encoding a corn asparagine synthetase (Zm.AsnS4) enzyme, the DNA molecule, for example, comprising SEQ ID NO:50 and sequences having at least 90%, 95%, or 99% identity to such sequences with asparagine synthetase activity.

[0065]A further aspect of the invention is a method for increasing protein in a corn plant by introducing into a corn cell a DNA construct that provides a heterologous polynucleotide molecules, for example, SEQ ID NOs:1, 3, 5, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17 and 50 that encode an asparagine synthetase enzyme. The polynucleotide can differ from any of these examples without altering the polypeptide for which it encodes. For example, it is understood that codons capable of coding for such conservative amino acid substitutions are known in the art. Additionally, the invention contemplates that polypeptides in which one or more amino acid have been deleted, substituted, or added without altering the asparagine synthetase function can be used in the invention

[0066]In one aspect of the present invention the polynucleotide of the present invention are said to be introduced polynucleotide molecules. A polynucleotide molecule is said to be "introduced" if it is inserted into a cell or organism as a result of human manipulation, no matter how indirect. Examples of introduced polynucleotide molecules include, without limitation, polynucleotides that have been introduced into cells via transformation, transfection, injection, and projection, and those that have been introduced into an organism via conjugation, endocytosis, phagocytosis, etc. Preferably, the polynucleotide is inserted into the genome of the cell.

[0067]One subset of the polynucleotide molecules of the present invention is fragment polynucleotide molecules. Fragment polynucleotide molecules may consist of significant portion(s) of, or indeed most of, the polynucleotide molecules of the present invention, such as those specifically disclosed. Alternatively, the fragments may comprise smaller oligonucleotides (having from about 15 to about 400 nucleotide residues and more preferably, about 15 to about 30 nucleotide residues, or about 50 to about 100 nucleotide residues, or about 100 to about 200 nucleotide residues, or about 200 to about 400 nucleotide residues, or about 275 to about 350 nucleotide residues). A fragment of one or more of the polynucleotide molecules of the present invention may be a probe and specifically a PCR primer molecule. A PCR primer is a polynucleotide molecule capable of initiating a polymerase activity while in a double-stranded structure with another polynucleotide. Various methods for determining the structure of PCR probes and PCR techniques exist in the art.

[0068]As used herein, two polynucleotide molecules are said to be capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double-stranded polynucleotide structure.

[0069]A polynucleotide molecule is said to be the "complement" of another polynucleotide molecule if they exhibit complete complementarity. As used herein, molecules are said to exhibit "complete complementarity" when every nucleotide of one of the molecules is complementary to a nucleotide of the other. Two molecules are said to be "minimally complementary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional "low-stringency" conditions. Similarly, the molecules are said to be "complementary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional "high-stringency" conditions. Conventional stringency conditions are described by Sambrook et al., (2001), and by Haymes et al., (1985). Departures from complete complementarity are therefore permissible, as long as such departures do not completely preclude the capacity of the molecules to form a double-stranded structure. Thus, in order for a polynucleotide molecule to serve as a primer or probe it need only be sufficiently complementary in sequence to be able to form a stable double-stranded structure under the particular solvent and salt concentrations employed.

[0070]Appropriate stringency conditions which promote DNA hybridization are, for example, 6.0× sodium chloride/sodium citrate (SSC) at about 45° C., followed by a wash of 2.0×SSC at 20-25° C., are known to those skilled in the art or can be found in Ausubel, et al., eds. (1989), section 6.3.1-6.3.6. For example, the salt concentration in the wash step can be selected from a low stringency of about 2.0×SSC at 50° C. to a high stringency of about 0.2×SSC at 65° C. In addition, the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22° C., to high stringency conditions at about 65° C. Both temperature and salt may be varied, or either the temperature or the salt concentration may be held constant such that a nucleic acid will specifically hybridize to one or more of the polynucleotide molecules provided herein, for example, as set forth in: SEQ ID NOs 1, 3, 5, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18-45 and 50, and complements thereof, under moderately stringent conditions, for example at about 2.0×SSC and about 65° C.

[0071]In one embodiment of a method of the present invention, any of the polynucleotide sequences or polypeptide sequences, or fragments of either, of the present invention can be used to search for related sequences. As used herein, "search for related sequences" means any method of determining relatedness between two sequences, including, but not limited to, searches that compare sequence homology: for example, a PBLAST search of a database for relatedness to a single polypeptide sequence. Other searches may be conducted using profile based methods, such as the HMM (Hidden Markov model) META-MEME, which is maintained by South Dakota State University, SD, and PSI-BLAST, which is maintained by the National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health (NCBI).

[0072]A polynucleotide molecule can encode for a substantially identical or substantially homologous polypeptide molecule. The degree of identity or homology can be determined by use of computer software such as the WISCONSIN PACKAGE Gap Program. The Gap program in the WISCONSIN PACKAGE version 10.0-UNIX from Genetics Computer Group, Inc. is based on the method of Needleman and Wunsch, 1970. Using the TBLASTN program in the BLAST 2.2.1 software suite (Altschul et al., (1997, or using BLOSUM62 matrix (Henikoff and Henikoff, 1992). A polynucleotide molecule of the present invention can also encode a homolog polypeptide. As used herein, a homolog polypeptide molecule or fragment thereof is a counterpart protein molecule or fragment thereof in a second species (e.g., corn rubisco small subunit is a homolog of Arabidopsis rubisco small subunit). A homolog can also be generated by molecular evolution or DNA shuffling techniques, so that the molecule retains at least one functional or structure characteristic of the original polypeptide (see, for example, U.S. Pat. No. 5,811,238).

[0073]In a preferred embodiment, any of the polynucleotide molecules of the present invention can be operably linked to a promoter region that functions in a plant cell to cause the production of an mRNA molecule, where the polynucleotide molecule that is linked to the promoter is heterologous with respect to that promoter. As used herein, "heterologous" DNA is any DNA sequence which is not naturally found next to the adjacent DNA. "Native" refers to a naturally occurring nucleic acid sequence. "Heterologous" sequence often originates from a foreign source or species or, if from the same source, is modified from its original form and/or location in the genome.

[0074]As used herein, the terms "protein," "peptide molecule," or "polypeptide" includes any molecule that comprises five or more amino acids. It is well known in the art that protein, peptide, or polypeptide molecules may undergo modification, including post-translational modifications, such as, but not limited to, disulfide bond formation, glycosylation, phosphorylation, or oligomerization. Thus, as used herein, the terms "protein," "peptide molecule," or "polypeptide" includes any protein that is modified by any biological or non-biological process. The terms "amino acid" and "amino acids" refer to all naturally occurring L-amino acids. This definition is meant to include norleucine, norvaline, ornithine, homocysteine, and homoserine.

[0075]A "protein fragment" is a peptide or polypeptide molecule whose amino acid sequence comprises a subset of the amino acid sequence of that protein. A protein or fragment thereof that comprises one or more additional peptide regions not derived from that protein is a "fusion" protein. Such molecules may be derivatized to contain carbohydrate or other moieties (such as keyhole limpet hemocyanin). Fusion protein or peptide molecules of the present invention are preferably produced via recombinant means.

Plant Constructs and Plant Transformants

[0076]One or more of the DNA constructs of the present invention that encode for an asparagine synthetase may be used in plant transformation or transfection. Exogenous genetic material may be transferred into a plant cell and the plant cell regenerated into a whole, fertile, or sterile plant. Exogenous genetic material is any genetic material, whether naturally occurring or otherwise, from any source that is capable of being inserted into any organism.

[0077]In a further aspect of the present invention, polynucleotide sequences of the present invention also encode peptides involved in intracellular localization, export, or post-translational modification, for example chloroplast transit peptides.

[0078]As used herein, the term "gene" includes a nucleic acid molecule that provides regulation of transcription that includes a promoter that functions in plants, 5' untranslated molecules, e.g., introns and leader sequences, a transcribed nucleic acid molecule and a 3' transcriptional termination molecule.

[0079]The polynucleic acid molecules encoding a polypeptide of the present invention may be combined with other non-native, or heterologous sequences in a variety of ways. By "heterologous" sequences it is meant any sequence that is not naturally found joined to the nucleotide sequence encoding polypeptide of the present invention, including, for example, combinations of nucleotide sequences from the same plant that are not naturally found joined together, or the two sequences originate from two different species. The term "operably linked", as used in reference to the physical and function arrangement of regulatory and structural polynucleotide molecules that causes regulated expression of an operably linked structural polynucleotide molecule.

[0080]The expression of a DNA construct or transgene means the transcription and stable accumulation of sense or antisense RNA or protein derived from the polynucleotide molecule of the present invention or translation thereof. "Sense" RNA means RNA transcript that includes the mRNA and so can be translated into polypeptide or protein by the cell. "Antisense RNA" means a RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target gene (U.S. Pat. No. 5,107,065, incorporated herein by reference). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5' non-coding sequence, 3' non-translated sequence, introns, or the coding sequence. "RNA transcript" means the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be a RNA sequence derived from post-transcriptional processing of the primary transcript and is referred to as the mature RNA.

[0081]As used herein, the term plant expression cassette refers to a construct comprising the necessary DNA regulatory molecules operably linked to the target molecule to provide expression in a plant cell.

[0082]The DNA construct of the present invention can, in one embodiment, contain a promoter that causes the over expression of the polypeptide of the present invention, where "overexpression" means the expression of a polypeptide either not normally present in the host cell, or present in said host cell at a higher level than that normally expressed from the endogenous gene encoding said polypeptide. Promoters, which can cause the overexpression of the polypeptide of the present invention, are generally known in the art, examples of such that provide constitutive expression pattern include cauliflower mosaic virus 19S promoter and cauliflower mosaic virus 35S promoter (U.S. Pat. No. 5,352,605), figwort mosaic virus 35S promoter (U.S. Pat. No. 6,051,753), sugarcane bacilliform virus promoter (U.S. Pat. No. 5,994,123), commelina yellow mottle virus promoter (Medberry et al., 1992), small subunit of ribulose-1,5-bisphosphate carboxylase promoter, rice cytosolic triosephosphate isomerase promoter, adenine phosphoribosyltransferase promoter, rice actin 1 promoter (U.S. Pat. No. 5,641,876), maize ubiquitin promoter, mannopine synthase promoter and octopine synthase promoter.

[0083]Such genetic constructs may be transferred into either monocotyledonous or dicotyledonous plants including, but not limited to alfalfa, apple, Arabidopsis, banana, Brassica campestris, canola, castor bean, coffee, corn, cotton, cottonseed, chrysanthemum, crambe, cucumber, Dendrobium spp., Dioscorea spp., eucalyptus, fescue, flax, gladiolus, liliacea, linseed, millet, muskmelon, mustard, oat, oil palms, oilseed rape, peanut, perennial ryegrass, Phaseolus, rapeseed, rice, sorghum, soybean, rye, tritordeum, turfgrass, wheat, safflower, sesame, sugarbeet, sugarcane, cranberry, papaya, safflower, and sunflower (Christou, 1996). In a preferred embodiment, the genetic material is transferred into a corn cell.

[0084]Transfer of a polynucleotide molecule that encodes a protein can result in expression or overexpression of that polypeptide in a transformed cell or transgenic plant. One or more of the proteins or fragments thereof encoded by polynucleotide molecules of the present invention may be overexpressed in a transformed cell or transformed plant.

[0085]In one embodiment, DNA constructs of the present invention comprise a polynucleotide molecule encoding a polypeptide sequence selected from the group consisting of SEQ ID NOs 1, 3, 5, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17 and 50. The invention provides transformed corn cells wherein, relative to an untransformed corn plant without such a DNA construct, the cell has an enhanced asparagine level.

[0086]In another embodiment, DNA constructs of the present invention comprise a heterologous DNA molecule operably linked to a corn asparagine synthetase coding sequence, for example, SEQ ID NOs 1, 3, 5 or 50, and the DNA construct is transformed corn cell In a one embodiment, DNA constructs of the present invention comprising SEQ ID NO:50 or related sequences described herein are provided in a transformed corn cell, and expression of the DNA construct provides a corn plant tissue with increased asparagine or a corn plant seed with increased protein relative to a corn plant not transformed with the DNA construct.

[0087]In some embodiments, the levels of one or more products of the AsnS may be increased throughout a plant or localized in one or more specific organs or tissues of the plant. Without limiting the scope of the present invention, several promoter sequences are useful for expressing the gene of the above enzyme. For example, maize C4 type PPDK promoter (Glackin et al., 1990), maize C4 type PEPC promoter (Hudspeth and Grula, 1989), rice Rubisco small subunit promoter (Kyozuka et al., 1993), and light-harvesting chlorophyll a/b binding protein promoter (Sakamoto et al., 1991), the P-FDA promoter (US20040216189A1, the polynucleotide sequence of which is herein incorporated by reference) and P-RTBV promoter (U.S. Pat. No. 5,824,857, the polynucleotide sequence of which is herein incorporated by reference). For example the levels of asparagine or protein may be increased in one or more of the tissues and organs of a plant including without limitation: roots, tubers, stems, leaves, stalks, fruit, berries, nuts, bark, pods, seeds, and flowers. A preferred organ is a seed.

[0088]For the purpose of expression in source tissues of the plant, such as the leaf, seed, root, or stem, it is preferred that the promoters utilized have relatively high expression in these specific tissues. Tissue-specific expression of a protein of the present invention is a particularly preferred embodiment.

[0089]DNA constructs or vectors may also include, with the coding region of interest, a polynucleotide sequence that acts, in whole or in part, to terminate transcription of that region. A number of such sequences have been isolated, including the T-NOS 3' region (Ingelbrecht et al., 1989; Bevan et al., 1983). Regulatory transcript termination regions can be provided in plant expression constructs of this present invention as well. Transcript termination regions can be provided by the DNA sequence encoding the gene of interest or a convenient transcription termination region derived from a different gene source, for example, the transcript termination region that is naturally associated with the transcript initiation region. The skilled artisan will recognize that any convenient transcript termination region that is capable of terminating transcription in a plant cell can be employed in the constructs of the present invention.

[0090]A vector or construct may also include regulatory elements, such as introns. Examples of such include, the Adh intron 1 (Callis et al., 1987), the sucrose synthase intron (Vasil et al., 1989), hsp70 intron (U.S. Pat. No. 5,859,347), and the TMV omega element (Gallie et al., 1989). These and other regulatory elements may be included when appropriate.

[0091]A vector or construct may also include a selectable marker. Selectable markers may also be used to select for plants or plant cells that contain the exogenous genetic material. Examples of such include, but are not limited to: a neo gene (Potrykus et al., 1985), which codes for kanamycin resistance and can be selected for using kanamycin, nptII, G418, hpt, etc.; a bar gene, which codes for bialaphos resistance; a mutant EPSP synthase gene (Hinchee et al., 1988; Reynaerts et al., 1988; Jones et al., 1987), which encodes glyphosate resistance; a nitrilase gene which confers resistance to bromoxynil (Stalker et al., 1988); a mutant acetolactate synthase gene (ALS) which confers imidazolinone or sulphonylurea resistance (U.S. Pat. No. 4,761,373); D'Halluin et al., 1992); and a methotrexate resistant DHFR gene (Thillet et al., 1988).

Plant Transformation

[0092]The most commonly used methods for transformation of plant cells are the Agrobacterium-mediated DNA transfer process and the biolistics or microprojectile bombardment mediated process (i.e., the gene gun). Typically, nuclear transformation is desired but if it is desirable to specifically transform plastids, such as chloroplasts or amyloplasts, plant plastids may be transformed utilizing a microprojectile-mediated delivery of the desired polynucleotide.

[0093]The methods for introducing transgenes into plants by Agrobacterium-mediated transformation utilize a T-DNA (transfer DNA) that incorporates the genetic elements of the transgene and transfers those genetic elements into the genome of a plant. Generally, the transgene(s) bordered by a right border DNA molecule (RB) and a left border DNA molecule (LB) is (are) transferred into the plant genome at a single locus. The "T-DNA molecule" refers to a DNA molecule that integrates into a plant genome via an Agrobacterium mediated transformation method. The ends of the T-DNA molecule are defined in the present invention as being flanked by the border regions of the T-DNA from Agrobacterium Ti plasmids. These border regions are generally referred to as the Right border (RB) and Left border (LB) regions and exist as variations in nucleotide sequence and length depending on whether they are derived from nopaline or octopine producing strains of Agrobacterium. The border regions commonly used in DNA constructs designed for transferring transgenes into plants are often several hundred polynucleotides in length and comprise a nick site where an endonuclease digests the DNA to provide a site for insertion into the genome of a plant. T-DNA molecules generally contain one or more plant expression cassettes.

[0094]With respect to microprojectile bombardment (U.S. Pat. Nos. 5,550,318; 5,538,880; and 5,610,042; each of which is specifically incorporated herein by reference in its entirety), particles are coated with polynucleotides and delivered into cells by a propelling force. Exemplary particles include those comprised of tungsten, platinum, and preferably, gold. A useful method for delivering DNA into plant cells by particle acceleration is the Biolistics Particle Delivery System (BioRad, Hercules, Calif.), which can be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with monocot plant cells cultured in suspension. Microprojectile bombardment techniques are widely applicable, and may be used to transform virtually any plant species. Examples of species that have been transformed by microprojectile bombardment include monocot species such as corn (PCT Publication WO 95/06128), barley, wheat (U.S. Pat. No. 5,563,055, incorporated herein by reference in its entirety), rice, oat, rye, sugarcane, and sorghum; as well as a number of dicots including tobacco, soybean (U.S. Pat. No. 5,322,783, incorporated herein by reference in its entirety), sunflower, peanut, cotton, tomato, and legumes in general (U.S. Pat. No. 5,563,055, incorporated herein by reference in its entirety).

[0095]To select or score for transformed plant cells regardless of transformation methodology, the DNA introduced into the cell contains a gene that functions in a regenerable plant tissue to produce a compound that confers upon the plant tissue resistance to an otherwise toxic compound. Genes of interest for use as a selectable, screenable, or scorable marker would include but are not limited to GUS, green fluorescent protein (GFP), luciferase (LUX), and antibiotic or herbicide tolerance genes. Examples of antibiotic resistance genes include those conferring resistance to kanamycin (and neomycin, G418), and bleomycin.

[0096]The regeneration, development, and cultivation of plants from various transformed explants are well documented in the art. This regeneration and growth process typically includes the steps of selecting transformed cells and culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil. Cells that survive the exposure to the selective agent, or cells that have been scored positive in a screening assay, may be cultured in media that supports regeneration of plants. Developing plantlets are transferred to soil-less plant growth mix, and hardened off, prior to transfer to a greenhouse or growth chamber for maturation.

[0097]The present invention can be used with any transformable cell or tissue. By transformable as used herein is meant a cell or tissue that is capable of further propagation to give rise to a plant. Those of skill in the art recognize that a number of plant cells or tissues are transformable in which after insertion of exogenous DNA and appropriate culture conditions the plant cells or tissues can form into a differentiated plant. Tissue suitable for these purposes can include but is not limited to immature embryos, scutellar tissue, suspension cell cultures, immature inflorescence, shoot meristem, nodal explants, callus tissue, hypocotyl tissue, cotyledons, roots, and leaves.

[0098]Any suitable plant culture medium can be used. Examples of suitable media would include but are not limited to MS-based media (Murashige and Skoog, 1962) or N6-based media (Chu et al., 18: 659, 1975) supplemented with additional plant growth regulators including but not limited to auxins, cytokinins, ABA, and gibberellins. Those of skill in the art are familiar with the variety of tissue culture media, which when supplemented appropriately, support plant tissue growth and development and are suitable for plant transformation and regeneration. These tissue culture media can either be purchased as a commercial preparation, or custom prepared and modified. Those of skill in the art are aware that media and media supplements such as nutrients and growth regulators for use in transformation and regeneration and other culture conditions such as light intensity during incubation, pH, and incubation temperatures that can be optimized for the particular variety of interest.

[0099]Any of the polynucleotide molecules of the present invention may be introduced into a plant cell in a permanent or transient manner in combination with other genetic elements such as vectors, promoters, enhancers, etc. Further, any of the polynucleotide molecules of the present invention may be introduced into a plant cell in a manner that allows for expression or overexpression of the protein or fragment thereof encoded by the polynucleotide molecule.

[0100]The present invention also provides for parts of the plants, particularly reproductive or storage parts, of the present invention. Plant parts, without limitation, include seed, endosperm, ovule, pollen, or tubers. In a particularly preferred embodiment of the present invention, the plant part is a corn seed. In one embodiment the corn seed (or grain) is a constituent of animal feed.

[0101]In a preferred embodiment the corn feed or corn meal or protein from the corn seed is designed for livestock animals or humans, or both. Methods to produce feed, meal, and protein, are known in the art. See, for example, U.S. Pat. Nos. 4,957,748; 5,100,679; 5,219,596; 5,936,069; 6,005,076; 6,146,669; and 6,156,227. In a preferred embodiment, the protein preparation is a high protein preparation. Such a high protein preparation preferably has a protein content of greater than about 5% (w/v), more preferably 10% (w/v), and even more preferably 15% (w/v).

[0102]Descriptions of breeding methods that are commonly used for different traits and crops can be found in one of several reference books (e.g., Hayward, 1993; Richards, 1997; Allard, 1999).

Other Organisms

[0103]A polynucleotide of the present invention may be introduced into any cell or organism such as a mammalian cell, mammal, fish cell, fish, bird cell, bird, algae cell, algae, fungal cell, fungi, or bacterial cell. A protein of the present invention may be produced in an appropriate cell or organism. Preferred host and transformants include: fungal cells such as Aspergillus, yeasts, mammals, particularly bovine and porcine, insects, bacteria, and algae. Particularly preferred bacteria are Agrobacterium tumefaciens and E. coli.

[0104]In an aspect of the present invention, one or more of the nucleic acid molecules of the present invention are used to determine the level of expression (i.e., the concentration of mRNA in a sample, etc.) in a plant (preferably canola, corn, Brassica campestris, oilseed rape, rapeseed, soybean, crambe, mustard, castor bean, peanut, sesame, cottonseed, linseed, safflower, oil palm, flax or sunflower) or pattern (i.e., the kinetics of expression, rate of decomposition, stability profile, etc.) of the expression of a protein encoded in part or whole by one or more of the polynucleotide molecule of the present invention. A number of methods can be used to compare the expression between two or more samples of cells or tissue. These methods include hybridization assays, such as northerns, RNAase protection assays, and in situ hybridization. Alternatively, the methods include PCR-type assays. In a preferred method, expression is assessed by hybridizing polynucleotides from the two or more samples to an array of polynucleotides. The array contains a plurality of suspected sequences known or suspected of being present in the cells or tissue of the samples.

[0105]The following examples are included to demonstrate aspects of the invention, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific aspects which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

EXAMPLES

[0106]Those of skill in the art will appreciate the many advantages of the methods and compositions provided by the present invention. The following examples are included to demonstrate the preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention. All references cited herein are incorporated herein by reference to the extent that they supplement, explain, provide a background for, or teach methodology, techniques, or compositions employed herein.

Example 1

Construction of Corn and Soy Plant cDNA and Genomic Libraries

[0107]This example describes the production of cDNA libraries made from corn and soy plant tissues from which the corn AsnS and soy polynucleotide sequences of the present invention were isolated. cDNA Libraries were generated from Zea mays and Glycine max tissue using techniques known in the art, for example, Alba, 2004. Corn cDNA libraries were made from two different tissues. A library was made from incipient kernels harvested at the dilatory phase from inbred line 90DDD5. A second corn cDNA library was made from silk tissue at the silking growth stage from corn inbred line H99 and germinating pollen from corn inbred line MO17. For construction of a cDNA library from soybean (Glycine max), meristematic tissue and part of the hypocotyl were excised from rehydrated dry soybean seeds of variety A3237 (Asgrow). Explants were prepared by first germinating surface sterilized seeds on solid tissue culture media for 6 days at 28° C. at 18 hours of light/day, and then transferring germinated seeds to 4° C. for at least 24 hours. For the tissue used in library preparation the cotyledons were removed to enrich for the specific tissue of interest. 0.5 to 2 grams of tissue were used for preparation of total RNA and poly A+ RNA. For all cDNA libraries, plant tissues were harvested and immediately frozen in liquid nitrogen. The harvested tissue was stored at -80° C. until preparation of total RNA. The total RNA was purified using Trizol reagent from Invitrogen Corporation (Invitrogen Corporation, Carlsbad, Calif., U.S.A.), essentially as recommended by the manufacturer. Poly A+ RNA (mRNA) was purified using magnetic oligo dT beads essentially as recommended by the manufacturer (Dynabeads®, Dynal Biotech, Oslo, Norway).

[0108]Construction of plant cDNA libraries is well known in the art and a number of cloning strategies exist. A number of cDNA library construction kits are commercially available. cDNA libraries were prepared using the Superscript® Plasmid System for cDNA synthesis and Plasmid Cloning (Invitrogen Corporation), as described in the Superscript II cDNA library synthesis protocol. The cDNA libraries were checked to confirm an appropriate insert:vector ratio.

[0109]A genomic DNA library was constructed using genomic DNA isolated from Zea mays using a modified genomic DNA isolation protocol described below (Dellaporta et al., 1983). Corn seedlings were grown in soil or in Petri plates, were harvested, and kept frozen in liquid nitrogen until extraction. The tissue was ground to a fine powder using a mortar and pestle while keeping the tissue frozen with liquid nitrogen. The powdered tissue was transferred to a Warning blender containing 200 mL of cold (0° C.) DNA extraction buffer (350 mM sorbitol; 100 mM Tris; 5 mM EDTA; pH to 7.5 with HCl; sodium bisulfite, 3.8 mg/mL) that was added just before use, and homogenized at high speed for 30-60 seconds. The homogenate was filtered through a layer of cheesecloth and collected in a centrifuge bottle. The samples were then centrifuged at 2500×g for 20 minutes, and the supernatant and any loose green material were discarded. The pellet was then resuspended in 1.25 mL of DNA extraction buffer and transferred to a 50 mL polypropylene tube. Nuclei lysis buffer (1.75 mL containing 200 mM Tris; 50 mM EDTA; 2 M NaCl; 2.0% (w/v) CTAB; pH adjusted to 7.5 with HCl) was then added, followed by addition of 0.6 mL of 5% (w/v) sarkosyl. The tubes were mixed gently, and the samples were incubated at 65° C. for 20 minutes. An equal volume of chloroform:isoamyl alcohol (24:1) was added and the tubes were again mixed gently. The tubes were then centrifuged at 2500×g for 15 minutes, and the resulting supernatant was transferred to a clean tube. An equal volume of ice-cold isopropanol was poured onto the sample, and the sample was inverted several times until a precipitate formed. The precipitate was removed from the solution using a glass pipette and residual alcohol removed by allowing the precipitate to air dry for 2-5 minutes. The precipitate was resuspended in 400 μL TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH adjusted to 8.0).

Example 2

Isolation of AsnS Polynucleotide Sequences by Ligation Independent and Gateway® Cloning Methods and Corn Transformation

[0110]This example illustrates the isolation of polynucleotide molecules encoding AsnS using ligation independent and Gateway® cloning methods and the construction of DNA constructs of the present invention that comprise the polynucleotide molecules that encode AsnS polypeptides isolated from various plant and microorganisms sources as described in Table 1. The promoter molecules used to drive the expression of the linked AsnS-encoding polynucleotide molecules are the rice actin 1 promoter, P-Os.Act1 (U.S. Pat. No. 5,641,876, herein incorporated by reference); the Zea mays PPDK (Matsuoka et al., 1993), P-RTBV-1 (U.S. Pat. No. 5,824,857, herein incorporated by reference), and the P-Zm.NAS (promoter molecule of the genomic region coding for a nicotianamine synthase 2 polypeptide from corn).

TABLE-US-00001 TABLE 1 AsnS coding sequence source, promoter and DNA constructs SEQ ID Exemplary DNA NO: Coding sequence source Promoter construct 3 Zea mays AsnS2 P-Os•Act1 pMON79706 5 Zea mays AsnS3 P-Os•Act1 pMON92870 7 Glycine max P-Os•Act1 pMON79700 17 Saccharomyces cerevisiae P-Os•Act1 PMON79653

[0111]Ligation independent cloning was developed to clone PCR products and is based on the annealing of non-palindromic single-stranded ends. LIC is an efficient cloning method, which is not limited by restriction sites or the need for restriction enzyme digestion or ligation reactions and leaves seamless junctions (Aslanidis and de Jong, 1990).

[0112]Terminal, single-stranded DNA segments are produced in the vector through the use of a "nicking endonuclease" and restriction endonuclease. A nicking endonuclease is an endonuclease that nicks one strand of the polynucleotide duplex to create single stranded tails on the cloning vector. The vector is first linearized with a standard restriction endonuclease. This is then followed by digestion with a nicking endonuclease. After heat treatment, terminal, single-stranded DNA segments are produced in the vector. A GC content of roughly 55% is recommended for downstream PCR amplification and efficient annealing. The promoter, tag, or other sequence element can be added to the 5' and 3' ends of the PCR-amplified product to create a linear construct that can be used in downstream applications.

[0113]The DNA construct pMON92870 was assembled from the base vector, pMON82060, and a corn AsnS3 polynucleotide molecule encoding an AsnS polypeptide provided as SEQ ID NO 5. The plasmid backbone pMON82060 was linearized using the restriction endonuclease, HpaI. The plasmid backbone was then treated with the nicking endonuclease, N.BbvC IA (New England Biolabs, Beverly, Mass.). After digestion, the reaction was heated to 65° C. This causes the nicked strands of DNA to disassociate from their complementary DNA strands. The resulting linearized plasmid backbone was left with two terminal, single-stranded DNA segments available for assembly.

[0114]The polymerase chain reaction was employed to produce the terminal single-stranded DNA segments in the DNA molecule encoding AsnS. The corn AsnS3 polynucleotide sequence (SEQ ID NO: 5) encoding the AsnS polypeptide was used for the design of the forward PCR primer (SEQ ID NO: 48) and the reverse PCR primer (SEQ ID NO: 49):

TABLE-US-00002 SEQ ID NO:48: GCAGTCGCTGTCGTTACCCGGCATCATGTGTGGCATC SEQ ID NO:49: GCGAGTACCGCTGGGTTCTAACGTACTCTCGTCAGACCGCG

Polymerase chain reaction amplification was performed using the high fidelity thermal polymerase, KOD hot start DNA polymerase (Novagen, Madison, Wis.). The polymerase chain reaction was performed in a 25 μL volume containing, 1×KOD hot start DNA polymerase buffer, 1M betaine (Sigma, St. Louis, Mo.), 1 mM MgSO4, 250 μM dNTPs, 5 pmols of each primer and 1 unit of KOD hot start DNA polymerase. The polymerase chain reaction was performed in a PTC-225 DNA Engine Tetrad® thermal cycler (MJ Research Inc., Waltham, Mass.) using the following cycler parameters:

TABLE-US-00003 1. 94° C. for 2 minutes 2. 94° C. for 15 seconds 3. 70° C. for 30 seconds (-1° C. per cycle) 4. 72° C. for 5 minutes 5. Go to step 2, 9 times 6. 94° C. for 15 seconds 7. 60° C. for 30 seconds 8. 72° C. for 5 minutes 9. Go to step 6, 24 times 10. 72° C. for 10 minutes 11. 10° C. hold 12. end

[0115]A second round of polymerase chain reaction was performed to introduce uridine residues in the region in which the terminal, single-stranded DNA segments were produced. Many DNA polymerases are unable to read uridine residues in the template strand of DNA or are unable to polymerize strands using uridine residues. Polymerase chain reaction was therefore performed using an enzyme capable of incorporating and reading uridines (Expand High Fidelity® plus PCR System; Roche, Indianapolis, Ind.). Modification of this method and use of other methods that provide the expected result are known by those skilled in the art.

[0116]The assembled DNA construct was transformed into ElectroMAX® DH10B E. coli competent cells (Invitrogen, Carlsbad, Calif.). A 0.5 μL (microliter) aliquot from the assembly reaction was mixed with 20 μL of ElectroMAX® DH10B competent cells on ice and loaded into a MicroPulser 0.2 mm electroporation cuvette (Bio-Rad Laboratories Inc., Hercules Calif.) for electroporation. Cells were subjected to electroporation at 1.8 kV using a 165-2100 MicroPulser Electroporator (Bio-Rad Laboratories Inc.). Electroporated cells were incubated in 180 μL of SOC medium (Invitrogen Inc.) at 37° C. for 1 hour. Cells were then plated onto LB agar plates containing spectinomycin (75 mg/L) and grown overnight at 37° C. Colonies were selected and grown in LB media overnight at 37° C. The plasmid DNA construct was isolated using the QIAprep® Spin Miniprep Kit (QIAgen Sciences, Valencia, Calif.). DNA sequencing was performed on an ABI 3730x1 DNA Analyzer, using BigDye® terminator (Applied Biosystems, Foster City, Calif.).

[0117]The cloning of corn AsnS2, soy AsnS, and yeast AsnS1 AsnS-encoding polynucleotide sequences was accomplished using the Gateway® cloning method as described by the manufacturer (Invitrogen Corp.). The goal of the Gateway® cloning method is to make an expression clone. This two-step process involves first, the cloning of the gene of interest into an entry vector, followed by subcloning of the gene of interest from the entry vector into a destination vector to produce an expression vector. The cloning technology is based on the site-specific recombination system used by phage lambda to integrate its DNA into the E. coli chromosome.

[0118]DNA constructs for use in subsequent recombination cloning, two attB or attR recombination sequences were cloned into a recombinant vector flanking a Spectinomycin/Streptomycin resistance gene (SPC/STR) and an AsnS-encoding polynucleotide sequence. The AsnS-encoding polynucleotide sequences were isolated from cDNA or genomic libraries made from their respective species using the primary and secondary primer sequences (SEQ ID NOs 20-43). The contiguous attB1/R1, SPC/STR gene, AsnS gene, and attB2/R2 sequences were moved as a single polynucleotide molecule into a recombinant construct for expression in plant cells, the double-stranded DNA plasmids designated pMON79706 (Zea mays AsnS2), pMON79700 (Glycine max AsnS) or pMON79653 (Saccharomyces cerevisiae AsnS). These DNA constructs comprise the Agrobacterium right border (O-OTH.-RB) regions and left border (LB) regions, and others disclosed by Herrera-Estrella et al., 1983; Bevan, 1984; Klee et al., 1985, the e35S promoter (P-CAMV.35S, tandemly duplicated enhancer U.S. Pat. No. 5,322,938), the attB1/R1 genetic element (O-Lam.attB1/R1), the SPC/STR gene, the respective AsnS-coding region (CR), the attB2/R2 genetic element (O-Lam.attB2/R2), the potato protease inhibitor II terminator (St.Pis), the Agrobacterium NOS promoter (P-AGRtu.nos, Fraley et al., 1983), the Agrobacterium left border (O-OTH.-LB), the kanamycin resistance gene (CR-OTH.-Kan, U.S. Pat. No. 6,255,560), and the E. coli origin of replication (Ec.ori.ColE).

[0119]The DNA constructs were amplified in Library Efficiency® DB3.1® cells (Invitrogen Corporation) under chloramphenicol selection (25 μg/mL) and kanamycin selection (50 μg/mL) for pMON79706, pMON79700 or pMON79653. Vector DNA was purified from bacterial cultures using a QIAGEN Plasmid Kit (QIAGEN Inc.).

[0120]DNA for pMON79700, pMON79706, and pMON79653 was introduced into the corn embryos as described in U.S. Pat. No. 5,015,580, using the electric discharge particle acceleration gene delivery device. For microprojectile bombardment of LH59 pre-cultured immature embryos, 35% to 45% of maximum voltage was preferably used. Following microprojectile bombardment, the corn tissue was cultured in the dark at 27 quadratureC. Transformation methods and materials for making transgenic plants of this invention, for example, various media and recipient target cells, transformation of immature embryos and subsequent regeneration of fertile transgenic plants are disclosed in U.S. Pat. Nos. 6,194,636 and 6,232,526 and U.S. Patent Application Publication 20040216189, which are incorporated herein by reference.

[0121]Fertile transgenic corn plants were produced from transformed corn cells by growing transformed callus on the appropriate regeneration media to initiate shoot development and plantlet formation. Plantlets were transferred to soil when they were about 3 inches tall and possessed roots (about four to 6 weeks after transfer to medium). Plants were maintained for two weeks in a growth chamber at 26° C., followed by two weeks on a mist bench in a greenhouse. The plants were subsequently transplanted into 5-gallon pots and grown to maturity in the greenhouse. Reciprocal pollinations were made with the corn LH59 inbred line. Seed was collected from corn plants and used for analysis of protein and further breeding activities.

Example 3

Vector Construction and Transformation of Corn with AsnS Polynucleotide Sequences

[0122]The corn AsnS2 (SEQ ID NO: 3, pMON79706, FIG. 1) was amplified by use of PCR (polymerase chain reaction). The reaction conditions for the PCR reaction followed the manufacturer's protocol (PE Applied Biosystems, Foster City, Calif.). Approximately 100 ng of corn DNA, prepared as described above, was amplified using 30 nmole each of forward (f) primer (SEQ ID NO: 32) and reverse (r) primer (SEQ ID NO: 33) and 10 micromoles each of dATP, dCTP, dGTP and TTP, 2.5 units of TaKaRaLA Taq in 1×LA PCR Buffer II (Takara Bio INC, Shiga, Japan). After initial incubation at 94° C. for 1 minute, 35 cycles of PCR were performed at 94° C. for 45 seconds, followed by annealing at 60° C. for 45 seconds, 72° C. for 1 minute 15 seconds, followed, by 1 cycle of 72° C. for 7 minutes.

[0123]Five AsnS2 DNA constructs were made. The first corn AsnS2 construct was made by isolating an 1821 base pair AsnS2 fragment from pMON79706 by PCR, as described above, followed by restriction digestion with XbaI and EcoRI restriction enzymes. The resulting AsnS2 gene was ligated into pMON61560, which had also been digested with XbaI and EcoRI. The resulting shuttle vector (pMON66246) was digested with NotI and the insert containing the AsnS2 gene, in operable linkage with the PPDK promoter and RGLUT1 terminator, was ligated into pMON30167, which had also been digested with NotI. The pMON30167 plasmid, which contains the EPSPS gene, provides for selection with glyphosate. The resulting final plasmid was designated pMON66230 (FIG. 3).

[0124]A second AsnS2 construct was made using the aforementioned AsnS2 (pMON79706) gene. The construct was made by insertion of the XbaI/EcoRI digested AsnS2 gene into pMON61562, which had also been digested with XbaI and EcoRI, resulting in the AsnS2 gene being in operable linkage with the NAS promoter and RGLUT1 terminator. The resulting plasmid was digested with NotI and ligated into the NotI digested pMON30167. The resulting plasmid was designated pMON66229 (FIG. 2).

[0125]A third AsnS2 construct was made using the aforementioned AsnS2 gene (pMON79706). The P-FDA promoter used in this construct was isolated from pMON78810 by digestion with NotI and XbaI restriction enzymes. The P-FDA promoter was then ligated into pMON66246, which was previously digested with NotI and XbaI to remove its PPDK promoter. The resulting plasmid was digested with NotI and ligated into the NotI digested pMON30167. The resulting plasmid was designated pMON66231 (FIG. 4).

[0126]A fourth AsnS2 construct was made using the aforementioned AsnS2 gene (pMON79706). The P-RTBV promoter to be used in this construct was generated by PCR from pMON74576. The 721 bp fragment was digested with NotI and XbaI and ligated into pMON66246, which was previously digested with NotI and XbaI. The resulting plasmid, containing the AsnS2 gene in operable linkage with the P-RTBV promoter and RGLUT1 terminator was digested with NotI and ligated into the NotI digested pMON30167. The resulting plasmid was designated pMON66239 (FIG. 5).

[0127]A fifth AsnS2 construct was made using the aforementioned AsnS2 gene (pMON79706). A primer pair of ZmASsense,

TABLE-US-00004 5'TCCTAGACATGTCCGGCATACTTGCTG3', (SEQ ID NO:46)

and ZmASantisense,

TABLE-US-00005 [0128] 5'TGCAGAATTCTATCCCTCGATGG;, (SEQ ID NO:47)

was used to amplify corn AsnS2 from pMON66240. PCR set up was as follows: in a total volume of 50 μl PCR reaction, 1 μl of 10 mM each primer of ZmASsense and ZmASantisense, 0.2 to 0.5 μg (1 μl) of plasmid DNA of pMON66240, 5 μl of 10× AccuPrime® Pfx Reaction Mix, 1 μl of ACCuPrime® Pfx DNA Polymerase (Invitrogen), and 41 μl of distilled water. The PCR reaction was carried out with the following cycle parameters: 94° C. for 1 min., followed by 30 cycles of 94° C. for 15 seconds for denaturing; 58° C. for 15 sec of annealing, and 68° C. for 4 min.; followed by 10 min. of extension at 68° C. The PCR product was purified using a PCR purification kit from QIAGEN (QIAGEN Inc.). An aliquot of the PCR corn AsnS2 product was digested with NcoI and EcoRI restriction enzyme and another aliquot of the PCR product was digested with AflIII and NcoI. The NcoI and EcoRI fragment was then cloned into NcoI and EcoRI sites of pMON94901. The AflIII and NcoI 5' end fragment of corn AsnS2 was cloned into the NcoI and EcoRI of the corn AsnS2 fragment at NcoI site. The resulting plasmid (pMON74940), containing corn AsnS2 in operable linkage with the e35S promoter and the Hsp 17 terminator, was digested with NotI and ligated into NotI digested pMON53616 to construct pMON74946.

[0129]Each construct described above contained an expression cassette for expression of a glyphosate insensitive Type II EPSPS as a means for selecting transgenic events (U.S. Pat. No. 5,633,435). The nucleic acid sequence of each construct was determined using standard methodology as set forth by PE Applied Biosystems BigDye terminator v.3.0 (PE Applied Biosystems, Foster City, Calif.) and the integrity of the cloning junctions confirmed. The pMON66229, pMON66230, pMON66231, pMON66239, and pMON74946 vectors were used in the subsequent transformation of corn cells and regeneration of these cells into intact corn plants. Constructs of interest were introduced to immature embryos from corn line LH244 by an Agrobacterium-mediated transformation method, for instance as described in U.S. Published Patent Application 20050048624.

Example 4

Protein and Amino Acid Analysis of Corn Seed Samples

[0130]This example sets forth a method of protein and amino acid analysis to select seed of the present invention with increased asparagine and protein using HPLC and near infrared measurements. For seed protein analysis, small bulk samples consisting of 50-100 seeds for each treatment were measured using near infrared transmittance spectroscopy (Infratec model 1221, Tecator, Hoganas Sweden). This procedure was based upon the observation that a linear relation exists between the absorption of near infrared radiation and the quantity of chemical constituents comprised in a typical seed sample. Prior to analyzing unknown samples, spectral data was collected with calibration samples that were subsequently analyzed using a primary analysis technique. The primary technique used was nitrogen combustion (Murray and Williams, 1987). A multivariate model was developed using the spectral data from the spectrometer and the primary data. In the present case, a PLS-1 (Partial Least Squares Regression Type I) multivariate model was constructed using 152 calibration samples. Each unknown sample was scanned on the spectrometer at least five times and its protein content predicted with each scan. Each time the sample was scanned, it was added back to the sample cuvette to provide an accurate representation of the sample tested. The predicted protein values were averaged for the multiple scans and then reported for each sample.

[0131]Free amino acid analysis was performed on corn tissues by HPLC. For each sample, 20-50 mg lyophilized tissue were extracted with 1.5 mL of 10% trichloroacetic acid in 2-mL microfuge tubes. Samples were extracted at room temperature overnight with gentle shaking. Extracted samples were cleared by centrifugation and the supernatant was removed for further analysis. Free amino acid analysis was performed by HPLC on an Agilent Series 1100 HPLC with a fluorescence detector and 96-well plate autosampler equipped with a Zorbax Eclipse AAA C18 column (4.6×75 mm, 3.5 micron, Agilent Technologies, Palo Alto, Calif.) and Zorbax Eclipse AAA analytical guard column (4.6×12.5 mm, 5 micron). Samples were pre-derivatized with o-pthalaldehyde immediately prior to separation. Free amino acids were resolved with a 40 mM phosphate buffer, pH 7.6/Methanol/Acetonitrile gradient followed by fluorescence detection at 340 nm/450 nm (excitation/emission). Free amino acids were quantified based on external amino acid standards and peaks were integrated with ChemStation software (Agilent). Relative standard deviations were typically less than 8%.

Example 5

Field Evaluation of Asparagine Levels and Grain Protein Content in Transgenic Corn Plants

[0132]This example sets forth the results of a field evaluation of the effects of the corn AsnS constructs (pMON79706 and pMON92870) on asparagine and protein levels in transformed corn plants and seed; and the effects of the corn AsnS constructs (pMON79700 and pMON79653) on grain protein content. The relative concentration of free asparagine in corn tissues was obtained from inbred lines derived from R0 corn plants transformed with pMON79706 or pMON92870. For pMON79706, R0 transformants were backcrossed to the parent inbred, LH59, to create BC1 seed. The BC1 seed, which segregates with the transgene, was planted in a field nursery and individual plants were scored for the presence of the NPTII marker gene. Leaf tissue was collected for free amino acid analysis from transgene-positive and transgene-negative plants for each transgenic event for free amino acid analysis. Leaf free amino acids of pMON79706 transgenic plants were compared to negative isoline plants within each event and analyzed statistically by Student's T test with JMP 5.1 software (SAS Institute, Cary, N.C.). For pMON92870, R0 transformants were backcrossed to the parent inbred, LH244, to create BC1 seed. The BC1 seed was planted in a field nursery and self-pollinated to create the BC1S1 seed, which subsequently was planted in a second inbred nursery. Transgene-positive plants were identified for each transgenic event following scoring for the presence of the NPTII marker gene. Leaf tissue was collected from transgene-positive BC1S1 plants and parental inbred plots planted at regular intervals in the nursery. Leaf free amino acids for pMON92870 were analyzed statistically by performing analysis of variance and comparing transgenic entries to the parental control by conducting Student's T test using SAS 9.1 software. For free amino acid analyses for both constructs, leaf tissue was collected by removal of an upper fully expanded leaf at anthesis followed by freezing on dry ice. Leaf samples were ground frozen, lyophilized, and measured for free amino acid content by HPLC.

[0133]Multiple transgenic events of pMON79706 and pMON92870 were observed to show substantial increases in leaf asparagine content (Table 2). Four of seven events of pMON79706 tested showed significant increases in the concentration of leaf asparagine, as indicated by a p value of 0.05 or less. In transgenic events of pMON92870, expressing a second maize asparagine synthetase gene, four of five events showed significant increases in leaf asparagine levels (Table 2). These data show that transgenic expression of maize AsnS2 and maize AsnS3 under the rice actin promoter in pMON79706 and pMON92870, respectively, can result in a specific increase in free asparagine, which is consistent with the overexpression of active asparagine synthetase.

[0134]The relative concentration of protein in corn seed was obtained from inbred lines derived from R0 corn plants transformed with pMON79706 or pMON92870. BC1 transgenic plants of pMON79706 (described above) were self-pollinated and the resulting BC1S1 grain was grown to maturity and measured for protein content by single ears. Protein was measured as a percentage of dry weight at 0% moisture. Grain protein for pMON79706 transgenic plants were compared to negative isoline plants within each event and analyzed statistically by Student's T test with SAS 9.1 software. For pMON98270, BC1S1 plants were self-pollinated and grown to maturity and measured for protein content by single ears. Grain protein for pMON92870 was analyzed statistically with a custom developed spatial method by conducting a by-location analysis. The by-location analysis is a two-step process. The first step in the analysis involved estimating the spatial autocorrelation in the field by fitting an anisotropic spherical semi-variogram model using all spatial check plots that were placed systematically in the field (every 6th plot). The second stage of analysis involved adjusting the values of the transgenic entries for the spatial variability using the spatial autocorrelation structure estimated in the first stage of the analysis. Following the adjustment for spatial autocorrelation, mean comparison was carried out where the mean value of a transgenic entry was compared to the parental control to test the statistical significance of the difference between a transgene and the control mean.

[0135]Multiple events of both pMON79706 and pMON92870 showed significant increases in inbred grain protein content (Table 3). Three of five events of pMON79706 that were analyzed statistically showed significant increases in grain protein content (p<0.05) and two other events showed trends toward significant increases (p<0.15). Two events did not return sufficient numbers of ears for a statistical analysis. Three of four transgenic events of pMON92870 showed significant increases in grain protein content (p<0.1), with one event untested due to insufficient numbers of ears for analysis. These data confirm that pMON79706 and pMON92870 produce transgenic events that increase grain protein content in maize in addition to increasing leaf asparagine content.

TABLE-US-00006 TABLE 2 Relative leaf asparagine concentrations in inbred maize transformed with corn AsnS2 gene (pMON79706) or corn AsnS3 gene (pMON92870). Mean of Mean of Transgene- Transgene- p Constructa Event Generation positive Plantsb negative Plants Difference value pMON79706 ZM_M50965 BC1 16.3 10.7 5.6 0.319 ZM_M50973 BC1 32.0 7.3 24.3 0.025 ZM_M50974 BC1 25.0 5.3 19.8 0.014 ZM_M50980 BC1 18.0 5.3 12.5 0.001 ZM_M50984 BC1 29.3 10.3 19.1 0.002 ZM_M50985 BC1 15.7 6.3 9.5 0.278 ZM_M51011 BC1 15.0 7.3 7.7 0.191 pMON92870 ZM_M102252 BC1S1 22.5 0.0 22.5 <0.001 ZM_M103304 BC1S1 18.8 0.0 18.8 <0.001 ZM_M103315 BC1S1 30.6 0.0 30.6 <0.001 ZM_M103316 BC1S1 2.6 0.0 2.6 0.55 ZM_M103320 BC1S1 30.0 0.0 30.0 <0.001 aLeaf asparagine was determined in two separate experiments for pMON79706 and pMON92870. bRelative free asparagine measured as a percentage of total free amino acids in leaf tissue

TABLE-US-00007 TABLE 3 Grain protein content in inbred maize transformed with maize AsnS2 gene (pMON79706) or maize AsnS3 gene (pMON92870). Mean of Mean of Transgene- Transgene- p Constructa Event Generation positive Plantsa negative Plants Difference value pMON79706 ZM_M50965 BC1 ndc nd nd nd ZM_M50973 BC1 15.1 11.6 3.5 0.024 ZM_M50974 BC1 nd nd nd nd ZM_M50980 BC1 13.8 12.0 1.8 0.118 ZM_M50984 BC1 15.1 11.4 3.7 0.002 ZM_M50985 BC1 13.9 10.8 3.1 0.003 ZM_M51011 BC1 13.5 11.4 2.2 0.08 pMON92870 ZM_M102252 BC1S1 13.3 11.9 1.4 0.096 ZM_M103304 BC1S1 13.7 11.9 1.8 0.042 ZM_M103315 BC1S1 nd 11.9 nd nd ZM_M103316 BC1S1 11.2 11.9 -0.7 0.373 ZM_M103320 BC1S1 14.2 11.9 2.3 0.003 aGrain protein was determined in two separate experiments for pMON79706 and pMON92870. bGrain protein measured as a percentage of total grain composition on a 0% moisture basis. cnd; not determined.

[0136]The high asparagine and grain protein phenotype pMON79706 was confirmed in multiple tissues in a second trial. After the BC1 generation, five events of pMON79706 were self-pollinated in two following nurseries to generate BC1S3 seed that was homozygous for the transgene. The relative concentration of asparagine resulting from expression of the pMON79706 construct was determined in a study at the corn V8 growth stage by comparing homozygous BC1S3 plants and a LH59 corn variety control (Table 4). Transgenic entries and controls were planted in a randomized complete block design with 5 replicated blocks in a field plot. The upper fully expanded leaves and stem sections of two plants were sampled and pooled, placed on dry ice, ground, lyophilized, and measured for free amino acid content by HPLC. Values followed by "*" indicate a significant difference from the LH59 control (Dunnett's one-tail test; (SAS 9.1, Cary, N.C.). Asparagine measurements taken at both the V8 growth stage and the R1 generation showed that plants from five pMON79706 events had significant increases in free asparagine. Relative free asparagine levels in V8 leaf tissue were increased up to 13.9% as compared to 3.4% in the LH59 variety control, and stem asparagine was increased up to 39% as compared to 9.6 in the control (Table 4). For grain protein analysis, 10 ears were sampled per plot, shelled, and analyzed for grain protein concentration. Grain protein was also increased significantly in the five events of pMON79706 (Table 4). The results show that, as a general trend, events producing a significant increase in asparagine also produced as significant increase in kernel protein (Tables 2-4).

TABLE-US-00008 TABLE 4 Relative asparagine concentrations at V8 growth stage and grain protein concentration at maturity in BC1S3 corn plants transformed with the corn AsnS2 gene (pMON79706). Leaf Stem Grain Asn % Asn (ppm) Asn % Asn (ppm) Protein % Event Mean Mean Mean Mean Mean LH59 control 3.54 389 9.6 2254 12.3 ZM_M50974 12.31* 1312* 32.20* 9179* 14.8* ZM_M50980 10.20* 1058* 38.68* 12844* 15.2* ZM_M50984 9.18* 997* 28.20* 8062* 14.4* ZM_M50985 5.86* 697 15.12* 3404 14.5* ZM_M51011 13.89* 1740* 37.05* 11820* 15.0* *Significant at p < 0.05

[0137]Significant increases in hybrid grain protein were observed for three different constructs expressing asparagine synthetase genes under the rice actin promoter. Homozygous inbred corn lines were produced from R0 transgenic events of pMON79706 (corn AsnS2), pMON79700 (soy AsnS), and pMON79653 (yeast AsnS1) by first backcrossing R0 events to the recurrent parent, LH59, followed by self-pollinations of transgene-positive selections in two subsequent inbred nurseries using the NPTII selectable marker to score for zygosity. The homozygous events for each construct were then used as a male pollen donor in a cross with a female inbred line to create the F1 hybrid. The F1 hybrid seed was planted in a multiple-location trial and transgenic events for each construct were analyzed for final grain protein and compared to the recurrent parent hybrid control following a spatial correction analysis based on grain protein in control hybrids that were planted at regular intervals throughout the field. Grain was harvested from each plot, shelled, and analyzed for protein content. Data were analyzed using a custom developed spatial method by conducting a by-location and an across location analysis. The by-location analysis is a two-step process. The first step in the analysis involved estimating the spatial autocorrelation in the field by fitting an anisotropic spherical semi-variogram model using all spatial check plots that were placed systematically in the field (every 3rd plot). The second stage of analysis involved adjusting the values of the transgenic entries for the spatial variability using the spatial autocorrelation structure estimated in the first stage of the analysis. Following the adjustment for spatial autocorrelation in each location separately, an across-location analysis was conducted where the mean value of a transgenic entry was compared to the parental control to test the statistical significance (P=0.20) of the difference between a transgene and the control mean. All five events of pMON79706 showed significant increases in grain protein in the hybrid trial, consistent with the observation that grain protein was increased in the inbred lines of transgenic events of this construct (Table 5). Two other asparagine synthetase constructs, pMON79700 (soy AsnS) and pMON79653 (yeast AsnS), also showed significant increases in grain protein levels in two of five events and two of two events, respectively.

TABLE-US-00009 TABLE 5 Grain protein content in hybrid maize transformed with genes for asparagine synthetase from maize (Zea mays), soy (Glycine max), and yeast (Saccharomyces cerevisiae)a. Protein Protein Transgenic Control Protein Construct Gene Event Mean Mean Delta p value pMON79706 Maize AsnS2 ZM_M50974 11.12 8.65 2.48 0.000 ZM_M50980 9.17 8.65 0.53 0.003 ZM_M50984 9.56 8.65 0.91 0.000 ZM_M50985 9.71 8.65 1.07 0.000 ZM_M51011 9.45 8.65 0.81 0.000 pMON79700 Soy AsnS ZM_M49436 8.52 8.65 -0.13 0.469 ZM_M61615 11.25 8.65 2.61 0.000 ZM_M62422 13.30 8.65 4.65 0.000 ZM_M62428 8.61 8.65 -0.04 0.826 ZM_M64520 8.76 8.65 0.11 0.570 pMON79653 Yeast AsnS1 ZM_M49883 9.12 8.65 0.48 0.007 ZM_M65281 9.43 8.65 0.79 0.000 aGrain protein measured as a percentage of total grain composition on a 0% moisture basis.

Example 6

Field Evaluation of the Transgene Expression and Asparagine Synthetase Enzyme Activity Due to pMON79706 and pMON92870

[0138]Transgene expression was confirmed in transgenic events of pMON79706 and pMON92870. For pMON79706, tissue used for the determination of leaf asparagine content in the field trial with BC1S3 homozygous inbred lines was also used for determination of transgene expression based on measurement of the expression from the 3'-terminator sequence (St.Pis4) from pMON79706 at anthesis. Two leaf samples were harvested and pooled from each of 5 replicate plots (10 for inbred control) and frozen on dry ice. Leaf samples were then ground frozen for expression analysis. For RNA extraction, 50 mg of frozen tissue were aliquoted into 96-well plates. Each sample was extracted with 500 μl of lysis buffer containing a 1:1 solution of ABI nucleic acid lysis solution (Applied Biosystems, Foster City, Calif.) to 1×PBS pH 7.4 (without MgCl or CaCl). RNA was extracted from fresh-frozen tissue samples using filter-plates to capture nucleic acids from crude lysates, and 50 μl of ABI elution buffer was used to elute bound RNA. Quantitative PCR was performed using a 5 μl RNA template with 5 μl ABI one-step RT-PCR reagent. The reactions were carried out for 40 PCR cycles on an ABI Taqman 7900 PCR instrument, with cycling parameters of 48° C. for 30 min., 95° C. for 10 min., 95° C. for 10 sec., 60° C. for 1 min. Fluorescent measurements were taken from each well at each of the 40 cycles for both the terminator sequence derived from the potato protease inhibitor II (St.Pis4) and the endogenous control (ubiquitin). A subset of samples was run without reverse transcriptase to monitor DNA contamination. Samples were scored for relative expression by subtracting the cycle threshold values for St.Pis4 from the cycle threshold value of the endogenous control. The cycle threshold (Ct) was determined, and the delta Ct was calculated from the St.Pis4 minus endogenous control value. An in situ wild-type was created by calculating the average endogenous control signals and setting the St.Pis4 signal value at 40. The delta Ct of the unknown samples was subtracted from the delta Ct of the in situ wild-type. Final data was reported as pinII (St.Pis4) expression relative to wild type. Quantitative RT-PCR analysis confirmed overexpression of the transgene from six of six events of pMON79706 (FIG. 6).

[0139]Transgene expression was also confirmed in inbred events comprising pMON92870. RNA expression was determined from leaf tissue at anthesis of inbred plants grown in a field nursery by first harvesting an upper expanded leaf from each plant (4-8 plants per event) and freezing on dry ice. Transgene-positive plants were previously identified based on presence of the NPTII marker gene. Leaf tissue was ground while frozen, and analyzed for expression from the 3'-terminator sequence (St.Pis4) of pMON92870. Quantitative RT-PCR analysis showed that five of six events comprising pMON92870 showed increased transgene expression as compared to an inbred control (FIG. 7). The low RNA expression in pMON92870 event ZM_M103316 is consistent with the low leaf asparagine content and grain protein content in this event.

[0140]The effect of expression of asparagine synthetase genes on asparagine synthetase activity was measured in transgenic events of pMON79706 and pMON92870. Frozen, ground leaf tissue was aliquoted (200-400 mg) into wells from a precooled 96 deep-well plate. Protein was extracted in Buffer A (100 mM Hepes-OH, pH 8.0, 0.1 mM EDTA, 10 mM MgCl2, 2 mM aspartate, 0.5 mM DTT, 67 mM mercaptoethanol, 20% (v/v) glycerol, 0.1 mM ATP, 1% (v/v) P9599 (Sigma Company), 25 mM KCl). A small amount of sand was added to each well. Buffer A was then added to the leaf tissue in the wells at a ratio of 4:1 (buffer:tissue). The plates were then agitated in a paint shaker for 2 min. to mix the sample and then centrifuged at 5000×g for 10 minutes. The supernatant (100-200 μL) was desalted in a 96-well macro spin plate (SNS S025L, The Nest Group Inc., Southboro, Mass.) equilibrated in buffer A. The supernatant was then either assayed immediately or frozen in liquid nitrogen and maintained at -80° C. until used. To assay asparagine synthetase activity, desalted protein extracts (10-50 μL) were added to wells containing 100 μL assay solution (100 mM Hepes, pH 8.0, 10 mM MgCl2, 2 mM aspartate, 5 mM DTT, 10 mM ATP, 1 mM amino(oxy)acetic acid (aspartate amino transferase inhibitor), 1 mM aspartic semialdehyde (asparaginase inhibitor). To start the reaction, glutamine (final concentration of 2 mM for standard assay) was added to the solution, which was then mixed. The assay mixture was then incubated for 1 to 2 hours. The reaction was then stopped by the addition of an equal volume of 20% (w/v) trichloroacetic acid. The mixture was then filtered to remove precipitate and asparagine was measured by HPLC. Sample size was increased from 0.5 μL to 2.5 μL for HPLC, excitation wavelength was reduced from 340 nm to 235 nm, and fluorimeter gain was increased from 10 to 13. This results in a sensitivity of detection of 0.5 to 100 μM asparagine and allows the measurement of levels of activity in the 100s of microunits.

[0141]For pMON79706, tissue used for the determination of leaf asparagine synthetase enzyme activity was from a field trial with BC1S3 homozygous inbred lines harvested at the V7 growth stage. Events of pMON79706 were shown to display increased leaf asparagine synthetase activity (Table 6). Asparagine synthetase activity was increased up to 5-fold over the inbred variety control. Asparagine synthetase enzyme activity was also determined for transgenic events of pMON92870 in an inbred field nursery at the time of anthesis. Four of five pMON92870 events also showed increased enzyme activity (Table 6). The increased asparagine synthetase enzyme activity in corn plants expressing the corn AsnS2 (pMON79706) or corn AsnS3 (pMON92870) under the rice actin promoter is consistent with the increase in gene expression and leaf asparagine increases observed with these constructs.

TABLE-US-00010 TABLE 6 Asparagine synthetase activity in inbred lines of transgenic events of pMON79706 and pMON92870a. Construct Event AsnS Activity (μunits/mg protein) Control LH59 276 pMON79706 ZM_M50973 519 ZM_M50974 1179 ZM_M50984 1592 ZM_M50985 450 ZM_M51011 1031 Control LH244 98 pMON92870 ZM_M102252 160 ZM_M103304 209 ZM_M103315 243 ZM_M103316 11 ZM_M103319 192 ZM_M103320 240 aEnzyme activities for pMON79706 and pMON92870 were determined from two different field experiments.

Example 7

Field Evaluation of the Effects of pMON66231, pMON66239, and pMON74946 on Asparagine and Grain Protein Content

[0142]The relative content of free asparagine in corn tissues was obtained from hybrid lines derived from R0 corn plants (LH244 background) transformed with pMON66231 (FIG. 4), where corn AsnS2 is under the control of the corn FDA promoter. Hybrids were made by crossing the R0 plants to the male inbred line LH59, which creates a segregating (1:1) F1 population. The resulting F1 seed was planted in three midwest location with two replications at each location. Plots were sprayed with glyphosate at V3 growth stage to eliminate null sergeants. A hybrid control was planted in the perimeter and comparisons were made to the hybrid control. Upper leaves were collected and pooled from three plants within each plot at the time of anthesis, two hours after sunset, at all three locations. Leaves were placed immediately on dry ice and then stored at -80° C. until processing. Leaves were ground frozen, and a portion was lyophilized for free amino acid analysis by HPLC. Data were first screened for outliers with the two-pass method for deleted studentized residuals using Bonferroni-adjusted p-values. Outliers were identified and removed from the data set before analysis of variance calculations were initiated. The data were analyzed according to an across-locations randomized complete block design. Construct-event combinations were modeled with fixed effects, and locations and reps within locations were modeled with random effects. Treatment comparisons were made by performing contrasts of the least-squares means of the construct-event combinations. Relative leaf asparagine was increased significantly in 11 of 12 events of pMON66231, with asparagine levels as high as 16% as compared to 3% in the control (Table 7). Mature grain protein was also measured following harvest of 10 ears per plot followed by shelling and pooling of seed for each plot, which was then measured for grain protein content. Nine of 12 events were found to significantly increase protein content in the mature grain over the LH244/LH59 hybrid control.

TABLE-US-00011 TABLE 7 Relative leaf asparagine and mature grain protein content in pMON66231 transgenic events. Leaf Asn %a Grain Protein % Event Mean p valueb Mean p valueb LH244/LH59 2.73 8.68 ZM_S120303 11.41 <.001 8.57 0.774 ZM_S120316 8.92 0.007 9.90 0.002 ZM_S122246 8.69 0.01 10.22 <.001 ZM_S122249 9.85 0.002 10.83 <.001 ZM_S122257 9.57 0.003 12.48 <.001 ZM_S122262 10.10 0.001 9.70 0.011 ZM_S122267 9.33 0.004 9.23 0.162 ZM_S122279 12.67 <.001 11.13 <.001 ZM_S122280 12.54 <.001 10.90 <.001 ZM_S122281 9.47 0.003 10.53 <.001 ZM_S122291 16.25 <.001 9.83 0.004 ZM_S122303 6.44 0.126 8.53 0.71 aRelative free asparagine measured as a percentage of total free amino acids in leaf tissue bCompared to hybrid control.

[0143]The relative content of free asparagine in corn tissues was obtained from hybrid lines derived from R0 corn plants (LH244 background) transformed with pMON66239 and pMON74946, where corn AsnS2 is under the control of the RTBV or e35S promoter, respectively. Hybrids were made by crossing the R0 plants to the male inbred line, LH59, which creates a segregating (1:1) F1 population. The resulting F1 seed was planted in one location in Hawaii with three replications for each transgenic event. Plots were sprayed with glyphosate at V3 growth stage to eliminate null sergeants. A hybrid control lacking the corn AsnS2 gene was included for comparison. Upper leaves were collected and pooled from three plants within each plot at the time of anthesis, two hours after sunset. Leaves were placed immediately on dry ice and then stored at -80° C. until processing. Leaves were ground frozen, and a portion was lyophilized for free amino acid analysis by HPLC. Data were first screened for outliers with the two-pass method for deleted studentized residuals using Bonferroni-adjusted p-values. Outliers were identified and removed from the data set before analysis of variance calculations were initiated. The data were analyzed according to a randomized complete block design. Construct-event combinations were modeled with fixed effects, and reps were modeled with random effects. Treatment comparisons were made by performing contrasts of the least-squares means of the construct-event combinations. Relative leaf asparagine was increased significantly in 10 of 13 events of pMON74946, with asparagine levels as high as 16% as compared to 2% in the control (Table 8). Mature grain protein was also measured following harvest of all ears per plot followed by shelling and pooling of seed for each plot, which was then measured for grain protein content and analyzed statistically as for the leaf asparagine trait. Ten of thirteen events were found to possess significantly increased protein content in the mature grain as compared to the hybrid control, and the same 10 events with increased leaf asparagine also showed increased protein in the hybrid trial. For transgenic events of pMON66239, 11 of 15 events showed increases in leaf asparagine content, and 3 of 15 events showed significant increases in grain protein at the 0.05 alpha level, although an additional five transgenic events showed increased protein at p<0.15, indicating that expression of corn AsnS2 under the RTBV promoter (pMON66239) can increase leaf asparagine content and kernel protein content, but to a lesser extent than under the e35s promoter (pMON74946) (Table 8).

TABLE-US-00012 TABLE 8 Relative leaf asparagine and mature grain protein content in pMON74946 and pMON66239 transgenic events. Leaf Asn %a Grain Protein % Construct Event Mean p valueb Mean p valueb Control Hybrid control 1.47 7.98 pMON74946 ZM_S156600 10.37 <.0001 8.67 0.0398 ZM_S156602 1.23 0.7315 8.43 0.1728 ZM_S156606 0.39 0.1214 7.43 0.0995 ZM_S156613 0.71 0.2786 7.70 0.3959 ZM_S156634 14.79 <.0001 9.37 <.0001 ZM_S156636 12.28 <.0001 9.23 0.0002 ZM_S160005 15.57 <.0001 9.50 <.0001 ZM_S160015 15.85 <.0001 13.10 <.0001 ZM_S160025 13.41 <.0001 9.13 0.0007 ZM_S160026 11.94 <.0001 9.17 0.0005 ZM_S160034 11.00 <.0001 9.60 <.0001 ZM_S160037 15.79 <.0001 9.10 0.001 ZM_S160042 14.73 <.0001 9.17 0.0005 pMON66239 ZM_S140597 8.84 <.0001 11.03 <.0001 ZM_S140601 2.14 0.3419 8.20 0.5078 ZM_S140609 10.08 <.0001 8.50 0.1182 ZM_S140613 2.67 0.0881 8.50 0.1182 ZM_S140615 1.23 0.7333 8.20 0.5078 ZM_S140617 6.68 <.0001 8.50 0.1182 ZM_S140618 3.93 0.0005 8.73 0.0244 ZM_S140633 5.96 <.0001 8.63 0.0503 ZM_S140635 3.69 0.0017 8.37 0.2445 ZM_S140645 5.88 <.0001 8.37 0.2445 ZM_S140647 3.66 0.0019 8.30 0.3353 ZM_S140651 4.66 <.0001 8.57 0.0784 ZM_S140661 4.13 0.0002 8.03 0.8741 ZM_S140663 2.07 0.61 9.03 0.0018 ZM_S140665 7.33 <.0001 8.27 0.388 aRelative free asparagine measured as a percentage of total free amino acids in leaf tissue bCompared to hybrid control.

Example 8

Bacterial Expression Vectors, Purification, and Kinetics of AsnS1, AsnS2, AsnS3 and AsnS4 Isoforms

[0144]This example describes the cloning of the nucleotide sequence for AsnS1 (SEQ ID NO: 1), AsnS2 (SEQ ID NO: 3), AsnS3 (SEQ ID NO: 5) and AsnS4 (SEQ ID NO: 50) into E. coli expression vectors, as well as the expression, purification and kinetics of the recombinant forms of the four AsnS isoforms.

[0145]Bioinformatic searches using a published maize AsnS gene sequence (Chevalier et al., 1996; gi984262) resulted in the identification of four full-length cDNA sequences in proprietary in-house cDNA collections which were identified as sharing significant sequence similarity to the published maize AsnS gene. Two of the full-length cDNAs that share sequence identity with the public AsnS sequence were named Zm-AsnS1 and Zm-AsnS3. The other two genes were named Zm-AsnS2 and Zm-AsnS4 (SEQ ID NO:50) respectively. Cloning of Zm-AsnS1, Zm-AsnS2, and Zm-AsnS3 sequences into plant expression vectors is described in Examples 2 and 3 above. These three genes as well as Zm-AsnS4 were cloned into bacterial expression vectors as follows:

[0146]The full-length coding sequences of Zm-AsnS1, Zm-AsnS3 and AsnS4 were amplified by polymerase chain reaction (PCR) from cDNA clones 700151670_FLI, LIB5399-001-A2, and LibLIB3732-039-F9_FLI respectively in the proprietary in-house cDNA collections. Sequences of the forward and reverse primers for PCR-amplified fragments encoding the Zm-AsnS1 were:

TABLE-US-00013 Zm-AsnS1_for1 (SEQ ID NO: 52) 5'-ggaattccatATGTGTGGCATCTTAGC-3' and Zm-AsnS 1_rev1 (SEQ ID NO: 53) 5'-ataagaatgcggccgcGACCGCGATCGCGACTGCGACA-3'

[0147]Sequences of the forward and reverse primers used for the Zm-AsnS3 PCR amplification were:

TABLE-US-00014 Zm-AsnS3_for2 (SEQ ID NO: 54) 5'-ctagctagctagATGTGCGGCATCCTC-3' and Zm-AsnS3_rev2 (SEQ ID NO: 55) 5'-ccgctcgagGACAGCTGTGGCTGAAGCAACG-3'

[0148]A PCR-amplified fragment encoding the full length of AsnS4 (SEQ ID NO: 50) was obtained with the following primer pair:

TABLE-US-00015 Zm-AsnS4=HD --for3 (SEQ ID NO: 56) 5'-gggaattccatATGTGTGGCATCTTAGC-3' and Zm-AsnS4_rev3 (SEQ ID NO: 57) 5'-ataagaatgcggccgcCACCGCGATCGCGACAGCGA-3'

[0149]The full-length coding sequence of Zm-AsnS2 was amplified by polymerase chain reaction (PCR) from pMON79706 (FIG. 1; SEQ ID NO: 3). Sequences of primers for PCR amplification of Zm-AsnS2 were:

TABLE-US-00016 Zm-AsnS2_for4 (SEQ ID NO: 58) 5'-tatgtgcggcatacttgctgtgctcgggt -3' and Zm-AsnS2_rev4 (SEQ ID NO: 59) 5'-gctatccctcgatggcaacgccagat-3'

[0150]PCR was carried out in a total volume of 50 μL using the Expand® High Fidelity PCR kit (Boehringer Mannheim, Germany). The reaction was carried out in a PTC-200 Peltier thermal cycler (MJ Research Inc., Watertown, Mass.) under the following conditions:

[0151]Initial incubation: [0152]5 min at 95° C.

[0153]27 cycles of: [0154]1 min at 95° C. [0155]1 min annealing at 56° C.

[0156]followed by: [0157]2 min extension at 72° C. [0158]10 min incubation at 72° C.

[0159]The resulting PCR fragments were subcloned into one of the expression plasmids pET30a(+) or pET21d(+) (Novagen, San Diego, Calif.), yielding plasmids pET30a-Zm-AsnS1, pET30a-ZmAsnS2, pET30a-Zm-AsnS,3 and pET21d-Zm-AsnS4. The plasmid sequences were confirmed by DNA sequence analysis. These vectors are expected to produce recombinant proteins with C-terminal histidine tags.

[0160]The E. coli expression vectors described in the previous paragraph were used to transform Rosetta DE5® E. coli cells (Novagen). Transformed cells were transferred from solid LB media plates and grown in liquid LB media containing standard concentrations of kanomycin (50 μM) and chloramphenicol (25 μM) at 37° C. An overnight culture was used to inoculate a 25 mL culture, which was grown at 37° C. until mid log phase (OD600=0.4-0.6). Cells were then transferred to 20° C. for 30 min after which IPTG was added to a final concentration of 0.5 mM. The cells were then grown at 20° C. for 12 hours and cell pellets were harvested by centrifugation.

[0161]The protein was recovered from the insoluble fraction while bound to a nickel column. Buffers used for the purification of recombinant AsnS were:

[0162]Buffer A: 100 mM Hepes-OH, pH=7.6, 0.1 mM EDTA, 10 mM MgCl2, 2 mM aspartate, 0.5 mM DTT, 20% (v/v) glycerol, 0.1 mM ATP, 1% (v/v) protease inhibitor cocktail (Sigma Product No. P9599), 25 mM KCl

[0163]Buffer B: (Buffer A+6 M Guanidine-HCl)

[0164]Buffer C: (Buffer A+6 M Urea)

[0165]Buffer D: (Buffer A+4 M Urea)

[0166]Buffer E: (Buffer A+2 M Urea)

[0167]Buffer F: (Buffer A+1 M Urea)

[0168]Buffer G: (Buffer A+500 mM imidazole)

[0169]All purification procedures were performed at 4° C. unless otherwise stated. E. coli pellets were solubilized in Buffer A and passed through a French Press three times at 16,000 PSI. The sample was then centrifuged at 75,000×g for at least one hour. The pellet (inclusion body) was frozen in liquid N2 and then stored at -80° C. until used.

[0170]All routine kinetic measurements of plant AsnS enzymes were performed on his-tagged plant AsnS forms which had been refolded on the nickel column during purification. An E. coli pellet resulting from bacteria expressing one of the AsnS forms in 200 mL of LB media as described above was used as the starting material. Inclusion bodies were isolated using the method described in the Pierce Pro-Matrix® Protein Refolding Guide (Thermo Fisher Scientific, Rockford, Ill., product No. 89867; Appendix A) and then solubilized using the protocol Pierce Pro-Matrix Protein Refolding Guide (product No. 89867; Appendix B) except that Buffer B was used in place of the 6-8M GdnHCl, 50 mM Tris. The solubilized sample was then applied at a flow rate of 1 mL/min to a 3-5 mL Nickel NTA agarose (Qiagen) column previously equilibrated in Buffer B. The column was then successively washed at 1 mL/min with at least two column bed volumes of Buffers B, C, D and E and F. The column was then washed with Buffer A until the OD280 of the column eluent was less than 0.05. The entire wash process was completed within 1-2 hours. The protein was then eluted with Buffer G at 1 mL/min. 2 mL fractions were taken and the three fractions with the highest protein amounts were pooled, frozen in liquid N2 and stored at -80° C. until assayed as described in Example 6. Levels of each substrate (ATP, glutamine, NH4.sup.+ and aspartate) were titrated to determine the individual Km and Vmax values. Kinetic parameters measured were Km (Asp), Km (Gln), Km (NH4.sup.+) and Vmax, for each substrate, and for some enzymes. Results are reported in Table 9.

[0171]All four genes encode sequences which give rise to polypeptides with AsnS activity. AsnS1, AsnS2 and AsnS3 appear to be kinetically distinct since Km (Gln) for AsnS2 is several fold lower than the other enzymes; and the Vmax of AsnS1 is several fold lower than the other enzymes.

TABLE-US-00017 TABLE 9 Kinetic comparison of maize asparagine synthetases Vmax Km(Gln) Km(ASP) Km(ATP) Km(NH4.sup.+) μu/mg μM μM μM μM Zm AsnS1 170 543 980 110 9900 Zm AsnS2 850 110 910 125 750 Zm AsnS3 350 423 1200 97 8400 Zm AsnS4 310 233 930 128 9000

[0172]All publications, patents and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

REFERENCES

[0173]The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference: [0174]U.S. Pat. No. 4,761,373 [0175]U.S. Pat. No. 4,957,748 [0176]U.S. Pat. No. 5,100,679 [0177]U.S. Pat. No. 5,219,596 [0178]U.S. Pat. No. 5,322,783 [0179]U.S. Pat. No. 5,322,938 [0180]U.S. Pat. No. 5,538,880 [0181]U.S. Pat. No. 5,550,318 [0182]U.S. Pat. No. 5,563,055 [0183]U.S. Pat. No. 5,610,042 [0184]U.S. Pat. No. 5,633,435 [0185]U.S. Pat. No. 5,936,069 [0186]U.S. Pat. No. 6,005,076 [0187]U.S. Pat. No. 6,146,669 [0188]U.S. Pat. No. 6,156,227 [0189]U.S. Pat. No. 6,194,636 [0190]U.S. Pat. No. 6,232,526 [0191]U.S. Patent Application Publication 20040216189A1 [0192]U.S. Patent Application Publication 20050048624A1 [0193]Alba, Plant J., 39(5): 681-808, 2004. [0194]Allard, In: Principles of Plant Breeding, 2nd Ed., John Wiley & Sons, ISBN: 0471023094, 1999. [0195]Altschul et al., Nucleic Acids Res., 25:3389-3402, 1997. [0196]Aslanidis and de Jong, Nucleic Acids Res., 18(20):6069-6074, 1990. [0197]Ausubel et al., eds. Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989. [0198]Bevan, Nucleic Acids Res., 12:8711-8721, 1984. [0199]Chu et al., Scientia Sinica, 18:659, 1975. [0200]Dellaporta et al., Plant Molecular Biology Reporter, 1:19-21, 1983. [0201]D'Halluin et al., Bio/Technology, 10: 309-314, 1992. [0202]Fraley et al., Proc. Natl. Acad. Sci. USA, 80:4803-4807, 1983. [0203]Haymes et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C., 1985. [0204]Hayward, In: Plant Breeding: Principles and Prospects, Vol. 1, Chapman & Hall, ISBN: 0412433907, 1993. [0205]Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA, 89:10915-10919, 1992. [0206]Herrera-Estrella et al., Nature, 303:209, 1983. [0207]Hinchee et al., Bio/Technology, 6: 915-922, 1988. [0208]Jones and Shenk, Cell, 13:181-188, 1978. [0209]Jones et al., Mol. Gen. Genet., 210(1):1-4, 1987. [0210]Klee et al., Bio-Technology, 3(7):637-642, 1985. [0211]Lewin, In: Genes V, Oxford University Press, NY, 1994. [0212]Matsuoka et al, Proc. Natl. Acad. Sci. USA, 90:9586-9590, 1993. [0213]Murashige and Skoog, Physiol. Plant, 15:473-497, 1962. [0214]Murray and Williams, In: Chemical Principles of Near-Infrared Technology, Near-Infrared Technology in the Agricultural and Food Industries, Williams and K. Norris (Eds.), 1987. [0215]PCT Appln. WO 95/06128 [0216]Reynaerts et al., In: Selectable and Screenable Markers, Gelvin and Schilperoort (Eds.), Plant Molecular Biology Manual, Kluwer, Dordrecht, 1988. [0217]Richards, In: Plant Breeding Systems, Stanley Thornes Pub Ltd; 2nd Ed., ISBN: 0412574500, 1997. [0218]Rieger et al., Glossary of Genetics: Classical and Molecular, 5th edition, Springer-Verlag: New York, 1991. [0219]Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 2001. [0220]Stalker et al., J. Biol. Chem., 263:6310-6314, 1988. [0221]Thillet et al., J. Biol. Chem., 263:12500-12508, 1988.

Sequence CWU 1

5911869DNAZea mays 1atgatttgtg acaaatgcag cctcgtgcgg agcttttttg taggtagacc gcgggatatc 60acaagtttgt acaaaaaagc aggctcctgc aggaccatgt gcggcatcct cgctgtcctc 120ggcgtcgctg aggtctccct cgccaagcgc tcccgcatca ttgagctctc gcgcaggtta 180cggcaccgag ggcctgattg gagtggtttg cactgtcatg aggattgtta ccttgcacac 240cagcggttgg ctattatcga tcctacatct ggagaccagc ctttgtacaa tgaggataaa 300acagttgttg taacggtgaa cggagagatc tataaccatg aagaattgaa agctaagttg 360aaaactcatg agttccaaac tggcagtgat tgtgaagtta tagcccatct ttacgaagaa 420tatggcgaag aatttgtgga tatgttggat ggaatgttct cctttgttct tcttgataca 480cgtgataaaa gcttcatcgc agctcgtgat gctattggca tctgcccttt atacatggga 540tggggtcttg atggatcagt ctggttttct tcagagatga aggcattgag tgatgattgt 600gaacgcttca taacatttcc cccagggcat ctctactcca gcaagacagg tggtctaagg 660agatggtaca acccaccatg gttttcagag acggtccctt caacccctta caatgctctc 720ttcctccggg agatgtttga gaaggctgtt attaagaggc tgatgactga tgtgccattt 780ggtgtgcttt tatctggtgg actcgactct tctttggttg catctgttgc ttcgcggcac 840ttaaacgaaa caaaggttga caggcagtgg ggaaataaat tgcatacttt ctgtataggc 900ttgaagggtt ctcctgatct taaagctgct agagaagttg ctgattacct cagcactgta 960catcatgagt tccacttcac agtgcaggag ggcattgatg ccttggaaga agtcatctac 1020catattgaga catatgatgt tacaacaatc agagcaagta ccccaatgtt tttgatgtca 1080cgcaaaatca aatctttggg tgtgaagatg gttatttctg gcgaaggttc agatgaaatt 1140tttggtggtt acctttattt tcacaaggca ccaaacaaga aagaattcca tgaggaaaca 1200tgtcggaaga taaaagcact acatctgtat gactgcttga gagctaacaa agcaacttct 1260gcctggggtg ttgaggctcg tgttccattc cttgacaaaa gtttcatcag tgtagcaatg 1320gacattgatc ctgaatggaa gatgataaaa cgtgacctcg gtcgaattga gaaatgggtt 1380atccgtaatg catttgatga tgatgagagg ccctatttac ctaagcacat tctctacagg 1440caaaaggaac agttcagtga tggtgttggg tatagttgga tcgatggatt gaaggaccat 1500gccagccaac atgtctccga ttccatgatg atgaatgctg gctttgttta cccagagaac 1560acacccacaa caaaagaagg gtactactac agaatgatat tcgagaaatt ctttcccaag 1620cctgcagcaa ggtcaactgt tcctggaggt cctagtgtgg cctgcagcac tgccaaagct 1680gttgaatggg acgcatcctg gtccaagaac cttgatcctt ctggccgtgc tgctttgggt 1740gttcacgatg ctgcgtatga agacactgca gggaaaactc ctgcctctgc tgatcctgtc 1800tcagacaagg gccttcgtcc agctattggc gaaagcctag ggacacccgt tgcttcagcc 1860acagctgtc 18692623PRTZea mays 2Met Ile Cys Asp Lys Cys Ser Leu Val Arg Ser Phe Phe Val Gly Arg1 5 10 15Pro Arg Asp Ile Thr Ser Leu Tyr Lys Lys Ala Gly Ser Cys Arg Thr20 25 30Met Cys Gly Ile Leu Ala Val Leu Gly Val Ala Glu Val Ser Leu Ala35 40 45Lys Arg Ser Arg Ile Ile Glu Leu Ser Arg Arg Leu Arg His Arg Gly50 55 60Pro Asp Trp Ser Gly Leu His Cys His Glu Asp Cys Tyr Leu Ala His65 70 75 80Gln Arg Leu Ala Ile Ile Asp Pro Thr Ser Gly Asp Gln Pro Leu Tyr85 90 95Asn Glu Asp Lys Thr Val Val Val Thr Val Asn Gly Glu Ile Tyr Asn100 105 110His Glu Glu Leu Lys Ala Lys Leu Lys Thr His Glu Phe Gln Thr Gly115 120 125Ser Asp Cys Glu Val Ile Ala His Leu Tyr Glu Glu Tyr Gly Glu Glu130 135 140Phe Val Asp Met Leu Asp Gly Met Phe Ser Phe Val Leu Leu Asp Thr145 150 155 160Arg Asp Lys Ser Phe Ile Ala Ala Arg Asp Ala Ile Gly Ile Cys Pro165 170 175Leu Tyr Met Gly Trp Gly Leu Asp Gly Ser Val Trp Phe Ser Ser Glu180 185 190Met Lys Ala Leu Ser Asp Asp Cys Glu Arg Phe Ile Thr Phe Pro Pro195 200 205Gly His Leu Tyr Ser Ser Lys Thr Gly Gly Leu Arg Arg Trp Tyr Asn210 215 220Pro Pro Trp Phe Ser Glu Thr Val Pro Ser Thr Pro Tyr Asn Ala Leu225 230 235 240Phe Leu Arg Glu Met Phe Glu Lys Ala Val Ile Lys Arg Leu Met Thr245 250 255Asp Val Pro Phe Gly Val Leu Leu Ser Gly Gly Leu Asp Ser Ser Leu260 265 270Val Ala Ser Val Ala Ser Arg His Leu Asn Glu Thr Lys Val Asp Arg275 280 285Gln Trp Gly Asn Lys Leu His Thr Phe Cys Ile Gly Leu Lys Gly Ser290 295 300Pro Asp Leu Lys Ala Ala Arg Glu Val Ala Asp Tyr Leu Ser Thr Val305 310 315 320His His Glu Phe His Phe Thr Val Gln Glu Gly Ile Asp Ala Leu Glu325 330 335Glu Val Ile Tyr His Ile Glu Thr Tyr Asp Val Thr Thr Ile Arg Ala340 345 350Ser Thr Pro Met Phe Leu Met Ser Arg Lys Ile Lys Ser Leu Gly Val355 360 365Lys Met Val Ile Ser Gly Glu Gly Ser Asp Glu Ile Phe Gly Gly Tyr370 375 380Leu Tyr Phe His Lys Ala Pro Asn Lys Lys Glu Phe His Glu Glu Thr385 390 395 400Cys Arg Lys Ile Lys Ala Leu His Leu Tyr Asp Cys Leu Arg Ala Asn405 410 415Lys Ala Thr Ser Ala Trp Gly Val Glu Ala Arg Val Pro Phe Leu Asp420 425 430Lys Ser Phe Ile Ser Val Ala Met Asp Ile Asp Pro Glu Trp Lys Met435 440 445Ile Lys Arg Asp Leu Gly Arg Ile Glu Lys Trp Val Ile Arg Asn Ala450 455 460Phe Asp Asp Asp Glu Arg Pro Tyr Leu Pro Lys His Ile Leu Tyr Arg465 470 475 480Gln Lys Glu Gln Phe Ser Asp Gly Val Gly Tyr Ser Trp Ile Asp Gly485 490 495Leu Lys Asp His Ala Ser Gln His Val Ser Asp Ser Met Met Met Asn500 505 510Ala Gly Phe Val Tyr Pro Glu Asn Thr Pro Thr Thr Lys Glu Gly Tyr515 520 525Tyr Tyr Arg Met Ile Phe Glu Lys Phe Phe Pro Lys Pro Ala Ala Arg530 535 540Ser Thr Val Pro Gly Gly Pro Ser Val Ala Cys Ser Thr Ala Lys Ala545 550 555 560Val Glu Trp Asp Ala Ser Trp Ser Lys Asn Leu Asp Pro Ser Gly Arg565 570 575Ala Ala Leu Gly Val His Asp Ala Ala Tyr Glu Asp Thr Ala Gly Lys580 585 590Thr Pro Ala Ser Ala Asp Pro Val Ser Asp Lys Gly Leu Arg Pro Ala595 600 605Ile Gly Glu Ser Leu Gly Thr Pro Val Ala Ser Ala Thr Ala Val610 615 62031818DNAZea mays 3atgtgcggca tacttgctgt gctcgggtgc gccgacgagg ccaagggcag cagcaagagg 60tcccgggtgc tggagctgtc gcggcggctg aagcaccggg gccccgactg gagcggcctc 120cggcaggtgg gcgactgcta cctctctcac cagcgcctcg ccatcatcga cccggcctct 180ggcgaccagc ccctctacaa cgaggaccag tcggtggtcg tcgccgtcaa cggcgagatc 240tacaaccacc tggacctcag gagccgcctc gccggcgcag gccacagctt caggaccggc 300agcgactgcg aggtcatcgc gcacctgtac gaggagcatg gagaagagtt cgtggacatg 360ctggacggcg tcttctcctt cgtgctgctg gacactcgcc atggcgaccg cgcgggcagc 420agcttcttca tggctgctcg cgacgccatc ggtgtgacgc ccctctacat cggatgggga 480gtcgatgggt cggtgtggat ttcgtcggag atgaaggccc tgcacgacga gtgtgagcac 540ttcgagatct tccctccggg gcatctctac tccagcaaca ccggcggatt cagcaggtgg 600tacaaccctc cttggtacga cgacgacgac gacgaggagg ccgtcgtcac cccctccgtc 660ccctacgacc cgctggcgct aaggaaggcg ttcgagaagg ccgtggtgaa gcggctgatg 720acagacgtcc cgttcggcgt cctgctctcc ggcgggctgg actcgtcgct ggtggcgacc 780gtcgccgtgc gccacctcgc ccggacagag gccgccaggc gctggggcac caagctccac 840tccttctgcg tgggcctgga ggggtcccct gacctcaagg cggccaggga ggtggcggag 900tacctgggca ccctgcacca tgagttccac ttcactgttc aggacggcat cgacgccatc 960gaggacgtga tctaccacac ggagacgtac gacgtcacca cgatcagggc gagcacgccc 1020atgttcctca tgtcgcgcaa gatcaagtcg ctcggggtca agatggtcat ctccggcgag 1080ggctccgacg agctcttcgg aggctacctc tacttccaca aggcgcccaa caaggaggag 1140ttgcaccgag agacgtgtag gaaggttaag gctctgcatc agtacgactg cctgagagcc 1200aacaaggcga catcagcttg gggcctggag gctcgcgtcc cgttcctgga caaggagttc 1260atcaatgcgg ccatgagcat cgatcctgag tggaagatgg tccagcctga tcttggaagg 1320attgagaagt gggtgctgag gaaggcattc gacgacgagg agcagccatt cctgcccaag 1380catatcctct acagacagaa ggagcagttc agtgacggcg ttgggtacag ctggatcgat 1440ggcctgaagg ctcatgcaac atcaaatgtg actgacaaga tgctgtcaaa tgcaaagttc 1500atcttcccac acaacactcc gaccaccaag gaggcctact actacaggat ggtcttcgag 1560aggttcttcc cacagaaatc tgctatcctg acggtacctg gtgggccaag tgtggcgtgc 1620agcacagcca aagccatcga gtgggacgca caatggtcag gaaatctgga cccctcggga 1680agggcggcac tgggcgtcca tctcgccgcc tacgaacacc aacatgatcc cgagcatgtc 1740ccggcggcca ttgcagcagg aagcggcaag aagccaagga cgattagggt ggcaccgcct 1800ggcgttgcca tcgaggga 18184606PRTZea mays 4Met Cys Gly Ile Leu Ala Val Leu Gly Cys Ala Asp Glu Ala Lys Gly1 5 10 15Ser Ser Lys Arg Ser Arg Val Leu Glu Leu Ser Arg Arg Leu Lys His20 25 30Arg Gly Pro Asp Trp Ser Gly Leu Arg Gln Val Gly Asp Cys Tyr Leu35 40 45Ser His Gln Arg Leu Ala Ile Ile Asp Pro Ala Ser Gly Asp Gln Pro50 55 60Leu Tyr Asn Glu Asp Gln Ser Val Val Val Ala Val Asn Gly Glu Ile65 70 75 80Tyr Asn His Leu Asp Leu Arg Ser Arg Leu Ala Gly Ala Gly His Ser85 90 95Phe Arg Thr Gly Ser Asp Cys Glu Val Ile Ala His Leu Tyr Glu Glu100 105 110His Gly Glu Glu Phe Val Asp Met Leu Asp Gly Val Phe Ser Phe Val115 120 125Leu Leu Asp Thr Arg His Gly Asp Arg Ala Gly Ser Ser Phe Phe Met130 135 140Ala Ala Arg Asp Ala Ile Gly Val Thr Pro Leu Tyr Ile Gly Trp Gly145 150 155 160Val Asp Gly Ser Val Trp Ile Ser Ser Glu Met Lys Ala Leu His Asp165 170 175Glu Cys Glu His Phe Glu Ile Phe Pro Pro Gly His Leu Tyr Ser Ser180 185 190Asn Thr Gly Gly Phe Ser Arg Trp Tyr Asn Pro Pro Trp Tyr Asp Asp195 200 205Asp Asp Asp Glu Glu Ala Val Val Thr Pro Ser Val Pro Tyr Asp Pro210 215 220Leu Ala Leu Arg Lys Ala Phe Glu Lys Ala Val Val Lys Arg Leu Met225 230 235 240Thr Asp Val Pro Phe Gly Val Leu Leu Ser Gly Gly Leu Asp Ser Ser245 250 255Leu Val Ala Thr Val Ala Val Arg His Leu Ala Arg Thr Glu Ala Ala260 265 270Arg Arg Trp Gly Thr Lys Leu His Ser Phe Cys Val Gly Leu Glu Gly275 280 285Ser Pro Asp Leu Lys Ala Ala Arg Glu Val Ala Glu Tyr Leu Gly Thr290 295 300Leu His His Glu Phe His Phe Thr Val Gln Asp Gly Ile Asp Ala Ile305 310 315 320Glu Asp Val Ile Tyr His Thr Glu Thr Tyr Asp Val Thr Thr Ile Arg325 330 335Ala Ser Thr Pro Met Phe Leu Met Ser Arg Lys Ile Lys Ser Leu Gly340 345 350Val Lys Met Val Ile Ser Gly Glu Gly Ser Asp Glu Leu Phe Gly Gly355 360 365Tyr Leu Tyr Phe His Lys Ala Pro Asn Lys Glu Glu Leu His Arg Glu370 375 380Thr Cys Arg Lys Val Lys Ala Leu His Gln Tyr Asp Cys Leu Arg Ala385 390 395 400Asn Lys Ala Thr Ser Ala Trp Gly Leu Glu Ala Arg Val Pro Phe Leu405 410 415Asp Lys Glu Phe Ile Asn Ala Ala Met Ser Ile Asp Pro Glu Trp Lys420 425 430Met Val Gln Pro Asp Leu Gly Arg Ile Glu Lys Trp Val Leu Arg Lys435 440 445Ala Phe Asp Asp Glu Glu Gln Pro Phe Leu Pro Lys His Ile Leu Tyr450 455 460Arg Gln Lys Glu Gln Phe Ser Asp Gly Val Gly Tyr Ser Trp Ile Asp465 470 475 480Gly Leu Lys Ala His Ala Thr Ser Asn Val Thr Asp Lys Met Leu Ser485 490 495Asn Ala Lys Phe Ile Phe Pro His Asn Thr Pro Thr Thr Lys Glu Ala500 505 510Tyr Tyr Tyr Arg Met Val Phe Glu Arg Phe Phe Pro Gln Lys Ser Ala515 520 525Ile Leu Thr Val Pro Gly Gly Pro Ser Val Ala Cys Ser Thr Ala Lys530 535 540Ala Ile Glu Trp Asp Ala Gln Trp Ser Gly Asn Leu Asp Pro Ser Gly545 550 555 560Arg Ala Ala Leu Gly Val His Leu Ala Ala Tyr Glu His Gln His Asp565 570 575Pro Glu His Val Pro Ala Ala Ile Ala Ala Gly Ser Gly Lys Lys Pro580 585 590Arg Thr Ile Arg Val Ala Pro Pro Gly Val Ala Ile Glu Gly595 600 60551764DNAZea mays 5atgtgtggca tcttagccgt gctcggttgc tccgactggt ctcaggcaaa gagggctcgc 60atcctcgcct gctccagaag gttgaagcac aggggccccg actggtcggg cctttaccag 120cacgagggca acttcctggc gcagcagcgg ctcgccgtcg tctccccgct gtccggcgac 180cagccgctgt tcaacgagga ccgcaccgtc gtggtggtgg ccaatggaga gatctacaac 240cacaagaacg tccggaagca gttcaccggc acacacaact tcagcacggg cagtgactgc 300gaggtcatca tgcccctgta cgagaagtac ggcgagaact tcgtggacat gctggacggg 360gtgttcgcgt tcgtgctcta cgacacccgc gacaggacct acgtggcggc gcgcgacgcc 420atcggcgtca acccgctcta catcggctgg ggcagtgacg gttccgtctg gatcgcgtcc 480gagatgaagg cgctgaacga ggactgcgtg cgcttcgaga tcttcccgcc gggccacctc 540tactccagcg ccggcggcgg gttccggcgg tggtacaccc cgcactggtt ccaggagcag 600gtgccccgga cgccgtacca gccgctcgtc ctcagagagg ccttcgagaa ggcggtcatc 660aagaggctca tgactgacgt cccgttcggg gtcctcctct ccggcggcct cgactcctcg 720ctagtcgcct ccgtcaccaa gcgccacctc gtcgagaccg aggccgccga gaagttcggc 780accgagctcc actcctttgt cgtcggcctc gagggctccc ctgacctgaa ggccgcacga 840gaggtcgctg actacctcgg aaccatccat cacgagttcc acttcaccgt acaggacggc 900atcgacgcga tcgaggaggt gatctaccac gacgagacgt acgacgtgac gacgatccgg 960gccagcacgc ccatgttcct gatggctcgc aagatcaagt cgctgggcgt gaagatggtg 1020ctgtccgggg agggctccga cgagctcctg ggcggctacc tctacttcca cttcgccccc 1080aacaaggagg agttccacag ggagacctgc cgcaaggtga aagccctgca ccagtacgac 1140tgcctgcgcg ccaacaaggc cacgtcggcg tggggcctgg aggtccgcgt gccgttcctc 1200gacaaggagt tcatcaacgt cgccatgggc atggaccccg aatggaaaat gtacgacaag 1260aacctgggcc gcatcgagaa gtgggtcatg aggaaggcgt tcgacgacga cgagcaccct 1320tacctgccca agcatattct ctaccggcag aaagaacagt tcagtgacgg cgttggctac 1380aactggatcg atggccttaa atccttcact gaacagcagg tgacggatga gatgatgaac 1440aacgccgccc agatgttccc ctacaacacg cccgtcaaca aggaggccta ctactaccgg 1500atgatattcg agaggctctt ccctcaggac tcggcgaggg agacggtgcc gtggggcccg 1560agcatcgcct gcagcacgcc cgcggccatc gagtgggtgg agcagtggaa ggcctccaac 1620gacccctccg gccgcttcat ctcctcccac gactccgccg ccaccgacca caccggcggt 1680aagccggcgg tggccaacgg cggcggccac ggcgcggcga acggcacggt caacggcaag 1740gacgtcgcag tcgcgatcgc ggtc 17646588PRTZea mays 6Met Cys Gly Ile Leu Ala Val Leu Gly Cys Ser Asp Trp Ser Gln Ala1 5 10 15Lys Arg Ala Arg Ile Leu Ala Cys Ser Arg Arg Leu Lys His Arg Gly20 25 30Pro Asp Trp Ser Gly Leu Tyr Gln His Glu Gly Asn Phe Leu Ala Gln35 40 45Gln Arg Leu Ala Val Val Ser Pro Leu Ser Gly Asp Gln Pro Leu Phe50 55 60Asn Glu Asp Arg Thr Val Val Val Val Ala Asn Gly Glu Ile Tyr Asn65 70 75 80His Lys Asn Val Arg Lys Gln Phe Thr Gly Thr His Asn Phe Ser Thr85 90 95Gly Ser Asp Cys Glu Val Ile Met Pro Leu Tyr Glu Lys Tyr Gly Glu100 105 110Asn Phe Val Asp Met Leu Asp Gly Val Phe Ala Phe Val Leu Tyr Asp115 120 125Thr Arg Asp Arg Thr Tyr Val Ala Ala Arg Asp Ala Ile Gly Val Asn130 135 140Pro Leu Tyr Ile Gly Trp Gly Ser Asp Gly Ser Val Trp Ile Ala Ser145 150 155 160Glu Met Lys Ala Leu Asn Glu Asp Cys Val Arg Phe Glu Ile Phe Pro165 170 175Pro Gly His Leu Tyr Ser Ser Ala Gly Gly Gly Phe Arg Arg Trp Tyr180 185 190Thr Pro His Trp Phe Gln Glu Gln Val Pro Arg Thr Pro Tyr Gln Pro195 200 205Leu Val Leu Arg Glu Ala Phe Glu Lys Ala Val Ile Lys Arg Leu Met210 215 220Thr Asp Val Pro Phe Gly Val Leu Leu Ser Gly Gly Leu Asp Ser Ser225 230 235 240Leu Val Ala Ser Val Thr Lys Arg His Leu Val Glu Thr Glu Ala Ala245 250 255Glu Lys Phe Gly Thr Glu Leu His Ser Phe Val Val Gly Leu Glu Gly260 265 270Ser Pro Asp Leu Lys Ala Ala Arg Glu Val Ala Asp Tyr Leu Gly Thr275 280 285Ile His His Glu Phe His Phe Thr Val Gln Asp Gly Ile Asp Ala Ile290 295 300Glu Glu Val Ile Tyr His Asp Glu Thr Tyr Asp Val Thr Thr Ile Arg305 310 315 320Ala Ser Thr Pro Met Phe Leu Met Ala Arg Lys Ile Lys Ser Leu Gly325 330 335Val Lys Met Val Leu Ser Gly Glu Gly Ser Asp Glu Leu Leu Gly Gly340 345 350Tyr Leu Tyr Phe His Phe Ala Pro Asn Lys Glu Glu Phe His Arg Glu355 360 365Thr Cys Arg Lys Val Lys Ala Leu His Gln Tyr Asp Cys Leu Arg Ala370 375 380Asn Lys Ala Thr Ser Ala Trp Gly Leu Glu Val Arg Val Pro Phe Leu385 390 395 400Asp Lys Glu Phe Ile Asn Val Ala Met Gly Met Asp Pro Glu Trp Lys405 410 415Met Tyr Asp Lys Asn Leu Gly Arg Ile Glu Lys Trp Val Met Arg Lys420 425

430Ala Phe Asp Asp Asp Glu His Pro Tyr Leu Pro Lys His Ile Leu Tyr435 440 445Arg Gln Lys Glu Gln Phe Ser Asp Gly Val Gly Tyr Asn Trp Ile Asp450 455 460Gly Leu Lys Ser Phe Thr Glu Gln Gln Val Thr Asp Glu Met Met Asn465 470 475 480Asn Ala Ala Gln Met Phe Pro Tyr Asn Thr Pro Val Asn Lys Glu Ala485 490 495Tyr Tyr Tyr Arg Met Ile Phe Glu Arg Leu Phe Pro Gln Asp Ser Ala500 505 510Arg Glu Thr Val Pro Trp Gly Pro Ser Ile Ala Cys Ser Thr Pro Ala515 520 525Ala Ile Glu Trp Val Glu Gln Trp Lys Ala Ser Asn Asp Pro Ser Gly530 535 540Arg Phe Ile Ser Ser His Asp Ser Ala Ala Thr Asp His Thr Gly Gly545 550 555 560Lys Pro Ala Val Ala Asn Gly Gly Gly His Gly Ala Ala Asn Gly Thr565 570 575Val Asn Gly Lys Asp Val Ala Val Ala Ile Ala Val580 58571743DNAGlycine max 7atgtgtggta ttcttgctgt tcttggttgt tctgatgact ctcgagccaa aagggtccgc 60gtgcttgagc tctctcgcag attgaagcac cgtggccctg actggagtgg gctccatcaa 120catggtgact gctttttggc acatcaacgg ttagccatag ttgatcctgc ttctggggat 180caacctctct ttaacgagga caaatccgtc attgttacgg taaatggaga gatttacaac 240catgaagagc tcaggaaaca gctgcctaat cacaacttcc gaactggaag tgattgtgat 300gttattgcac acctgtacga ggaacatgga gaagactttg tggacatgct ggatggtatc 360ttctcatttg ttctactgga cacccgtgac aacagtttta tagtggctcg ggatgctatt 420ggggtcactt ccttgtacat tggatggggg ttagatggct ctgtttggat ttcatcagaa 480atgaaaggcc tgaatgatga ttgtgaacac tttgagtgtt ttccacctgg tcacttgtac 540tctagcaaag aaagagggtt ccgcagatgg tacaatcctc cttggttctc tgaggctatt 600ccatctgccc cttatgatcc tcttgtttta agacacgcct ttgagcaggc agtcataaaa 660aggttgatga ctgatgtgcc ttttggtgtt ctactctctg gaggtttgga ctcttctttg 720gttgcatcca tcacttctcg ttacttggcc aacacaaagg ctgctgagca gtggggatca 780aagttacatt cattctgtgt aggccttgag ggctcaccag atttgaaggc tgcaaaagag 840gttgctgact atctaggcac tgtccaccat gagtttacct tcactgttca ggatggaata 900gatgccattg aagatgttat ctaccatatt gaaacatatg atgtgactac aattagagca 960agcacaccta tgtttctcat gtctcggaag attaaatcac ttggtgtcaa atgggttatc 1020tcaggagaag gatctgatga gatctttgga gggtatttgt acttccacaa ggcacccaac 1080aaggaggagt tccacagaga aacatgccgc aagatcaaag cacttcacca atatgattgc 1140ttgcgagcca ataaatcaac atttgcttgg ggtctagaag cccgtgtacc atttttggac 1200aaggcgttta tcaatgctgc aatgagtatt gaccctgagt ggaagatgat aaaaagagat 1260gaaggacgaa ttgagaagtg gattctgagg agagcctttg atgatgaaga gcatccttat 1320ctgccaaagc acattttata caggcagaaa gaacaattca gtgatggagt tggctatagt 1380tggattgatg gccttaaggc ccatgctgca aaacatgtga ctgaaaaaat gatgcttaat 1440gctggtaaca tttaccccca caacacccca aaaaccaagg aagcatatta ctacagaatg 1500atctttgaga ggttcttccc tcagaactca gctaggctca ctgttcctgg aggagcaagt 1560gttgcatgta gcacagccaa agctgttgag tgggatgctg cttggtctaa caaccttgat 1620ccctctggta gagcagcact tggagtgcac atttcagcct atgaaaacca gaacaacaag 1680ggtgtagaaa ttgagaagat aatacctatg gatgctgctc cccttggtgt tgccatccag 1740ggc 17438581PRTGlycine max 8Met Cys Gly Ile Leu Ala Val Leu Gly Cys Ser Asp Asp Ser Arg Ala1 5 10 15Lys Arg Val Arg Val Leu Glu Leu Ser Arg Arg Leu Lys His Arg Gly20 25 30Pro Asp Trp Ser Gly Leu His Gln His Gly Asp Cys Phe Leu Ala His35 40 45Gln Arg Leu Ala Ile Val Asp Pro Ala Ser Gly Asp Gln Pro Leu Phe50 55 60Asn Glu Asp Lys Ser Val Ile Val Thr Val Asn Gly Glu Ile Tyr Asn65 70 75 80His Glu Glu Leu Arg Lys Gln Leu Pro Asn His Asn Phe Arg Thr Gly85 90 95Ser Asp Cys Asp Val Ile Ala His Leu Tyr Glu Glu His Gly Glu Asp100 105 110Phe Val Asp Met Leu Asp Gly Ile Phe Ser Phe Val Leu Leu Asp Thr115 120 125Arg Asp Asn Ser Phe Ile Val Ala Arg Asp Ala Ile Gly Val Thr Ser130 135 140Leu Tyr Ile Gly Trp Gly Leu Asp Gly Ser Val Trp Ile Ser Ser Glu145 150 155 160Met Lys Gly Leu Asn Asp Asp Cys Glu His Phe Glu Cys Phe Pro Pro165 170 175Gly His Leu Tyr Ser Ser Lys Glu Arg Gly Phe Arg Arg Trp Tyr Asn180 185 190Pro Pro Trp Phe Ser Glu Ala Ile Pro Ser Ala Pro Tyr Asp Pro Leu195 200 205Val Leu Arg His Ala Phe Glu Gln Ala Val Ile Lys Arg Leu Met Thr210 215 220Asp Val Pro Phe Gly Val Leu Leu Ser Gly Gly Leu Asp Ser Ser Leu225 230 235 240Val Ala Ser Ile Thr Ser Arg Tyr Leu Ala Asn Thr Lys Ala Ala Glu245 250 255Gln Trp Gly Ser Lys Leu His Ser Phe Cys Val Gly Leu Glu Gly Ser260 265 270Pro Asp Leu Lys Ala Ala Lys Glu Val Ala Asp Tyr Leu Gly Thr Val275 280 285His His Glu Phe Thr Phe Thr Val Gln Asp Gly Ile Asp Ala Ile Glu290 295 300Asp Val Ile Tyr His Ile Glu Thr Tyr Asp Val Thr Thr Ile Arg Ala305 310 315 320Ser Thr Pro Met Phe Leu Met Ser Arg Lys Ile Lys Ser Leu Gly Val325 330 335Lys Trp Val Ile Ser Gly Glu Gly Ser Asp Glu Ile Phe Gly Gly Tyr340 345 350Leu Tyr Phe His Lys Ala Pro Asn Lys Glu Glu Phe His Arg Glu Thr355 360 365Cys Arg Lys Ile Lys Ala Leu His Gln Tyr Asp Cys Leu Arg Ala Asn370 375 380Lys Ser Thr Phe Ala Trp Gly Leu Glu Ala Arg Val Pro Phe Leu Asp385 390 395 400Lys Ala Phe Ile Asn Ala Ala Met Ser Ile Asp Pro Glu Trp Lys Met405 410 415Ile Lys Arg Asp Glu Gly Arg Ile Glu Lys Trp Ile Leu Arg Arg Ala420 425 430Phe Asp Asp Glu Glu His Pro Tyr Leu Pro Lys His Ile Leu Tyr Arg435 440 445Gln Lys Glu Gln Phe Ser Asp Gly Val Gly Tyr Ser Trp Ile Asp Gly450 455 460Leu Lys Ala His Ala Ala Lys His Val Thr Glu Lys Met Met Leu Asn465 470 475 480Ala Gly Asn Ile Tyr Pro His Asn Thr Pro Lys Thr Lys Glu Ala Tyr485 490 495Tyr Tyr Arg Met Ile Phe Glu Arg Phe Phe Pro Gln Asn Ser Ala Arg500 505 510Leu Thr Val Pro Gly Gly Ala Ser Val Ala Cys Ser Thr Ala Lys Ala515 520 525Val Glu Trp Asp Ala Ala Trp Ser Asn Asn Leu Asp Pro Ser Gly Arg530 535 540Ala Ala Leu Gly Val His Ile Ser Ala Tyr Glu Asn Gln Asn Asn Lys545 550 555 560Gly Val Glu Ile Glu Lys Ile Ile Pro Met Asp Ala Ala Pro Leu Gly565 570 575Val Ala Ile Gln Gly58091785DNAXylella fastidiosa 9atgatttgtg acaaatgcag cctcgtgcgg agcttttttg taggtagacc gcgggatatc 60acaagtttgt acaaaaaagc aggctcctgc aggaccatgt gttccatttt tggaatcttc 120aacctgcaac ccagtgacaa cctacagata ctgcgtcacc aagcattgga gtgctcgcaa 180cggcaacggc atcgcggacc cgattggagc ggcgtttacg ttgatgtggg tgcgattctg 240gtgcacgaac gtcttgctat cgttgatcca gctggcggtg cccagccact gctctccgag 300gatggcaccc tggcgttggc ggtcaacggc gaaatctata accacgctgt actcaaagga 360acattgcagc agccctatgc gttccaaact cattctgatt gcgaagtgat taatgcgctt 420taccgcgaag aaactccaac ctcgtttctg aatcgcttaa atgggatttt tgcattcgta 480ttatgggaca agactaccgg acgtggcctc atcgcacgcg atccaatggg tgtggtgccg 540ctgtactggg ggcacgatca ggacggtcgc ttacgtgtcg cgtcagagat gaaagcattg 600gttgagcatt gctccgacgt tgcacaattc ccacccggcc attggtacga caccacaacg 660ggcacgctgg tgaagtatta cgaacgcccc tggaaaaact attctgcagt ggaaggagtg 720caggtctcac tacaggaact gcgtgaagcg ttcgagcggg ccgtccatcg tcaactcatg 780acagatgttc catacggtgt actgctttct ggtggattgg attcttccct ggtggctgcg 840gtggccgcac gctacgcacg ccatcgcatc gaaaccaatg atcagagcga agcatggtgg 900ccacgtctgc actcatttgc gattggactg aaagactcgc cagatttgag tgcggcgaac 960gtggctgctg aggcgttgaa taccgtccac catcgtttcg agtacacctt ccaggagggg 1020ctggatgttc tacctgaagt gattcgtcac attgaaactt acgatgtcac gacgattcgc 1080gcatctacac caatgttcct gctggcacgt cgcattaagg cgatgggagt gaagatggtc 1140ttgtcaggtg aaggtagcga tgaaattttt ggcggttacc tgtacttcca caaagcgccg 1200aacgcacgcg agttccacga agaattggtc cgtaagctca acgccctgta ttactacgac 1260tgcttgcgcg ccaacaaagc gatgatggcg tggggtgtcg agccgcgcgt gccgtttttg 1320gaccgtgaat ttctcgatgt ggctatgcgg atggatgctc agcataagat ggtcgacaag 1380accagcaacg gcccacaacg gatggagaaa ggcatcctgc gtgcagcgtt tgacggctat 1440ttgccgccat caatcctgtg gcgacagaag gagcagttca gtgatggtgt tggctacggt 1500tggatcgacg gactgaaagc acacgctgaa acgcaagtgt ctgaccatgc gctggcaact 1560gccgagacac gtttccaggt gaatcctccc cagaccaaag aagcctatta ctaccgcagc 1620atatttgagc gcttcttccc aagcccggcg gcggctgaga cggtaccggg cggtaaatca 1680attgcctgtt cctcaccggc ggcgattgcc tgggatgcca gcttcgccac aatggctgac 1740ccatccggtc gtgcagtcag cggggttcat caacaagcac tgctg 1785101779DNAXanthomonas campestris 10atgatttgtg acaaatgcag cctcgtgcgg agcttttttg taggtagacc gcggaccggt 60cgcgcctcag cagtcgctgt cgttaccatg tgttccatct tcggtatctt cggcctgcaa 120cccggcgacg acctgcaggc cctgcgccgg caggccctgg aatgttcgca gcggcaacgc 180catcgcgggc cggactggag cggcgtgtac gtcgatgccg gtgccatcct ggtgcacgag 240cgcctggcca tcgtcgaccc ggcgggcggt tcgcagccgc tgttgtcgga ggacggcagc 300ctggcgttgg cagtcaacgg cgagatctat aaccatcgcg aactcaaggc cgagctactg 360cagccgtacg cttttcagac cggctcggac tgcgaagtga tcaacgcgct gtaccgcgaa 420gatgcgccgg cctcctatct caaccgcctc aatggcatct tcgcctttgc gttgtgggac 480aaggccgcgg ggcgggtgat catcgcgcgc gacccgattg gcgtggtgcc gttgtactgg 540ggacacgacc gcgaaggccg tctgcgcgtg gcgtccgaac tcaagtcgct ggtggacgat 600tgcgccgatg ctgcgcagtt tccgcctggt cattggtacg acagcgccac cggcgcattg 660agccgctact acgagcgctc gtggcgcgaa tacagcgaag tggaaaatgt gcaggtgccg 720ctgcaggaac tgcgcgaggc gttcgagcgc gcggtgcatc gccagctgat gaccgacgtg 780ccctacggtg tgctgctgtc cggtggcctg gattcgtcgt tggtggcggc agtggccgcg 840cgctacgcgc ggcatcgtat cgaagagaac gacaccaccg aagcctggtg gccgcgcctg 900cattccttcg caatcggcct gaccggctcg ccggatctgg ccgctgccga agtggccgcc 960gccgcgctcg gtaccgtgca ccacggcttc gaatacagct ttgaagaagg cctggatgca 1020ttgccggaag tgatccgcca catcgaaacc tacgacgtca ccacgattcg tgcgtccacg 1080ccgatgttcc tgctggcgcg gcgcatcaag gcgatgggcg tcaagatggt gctgtccggc 1140gaaggcagcg acgagatctt cggtggctac ctgtacttcc acaaggcacc gaacgcccgc 1200gaattccacg aagaactggt gcgcaagctc gatgcgctca acaactacga ttgcctgcgc 1260gccaacaagt cgatgatggc ctggggcgtg gaaccgcgcg tgccgttcct ggatcgcgaa 1320ttcctggacg tggcgatgcg catggacgcg cgcttcaaga tgatcgacaa gaccagcacc 1380ggtgccaccc gcatcgagaa gggcatcttg cgcgaggcat ttgccggcta tctgccggaa 1440tcgatcctgt ggcggcagaa ggagcaattc agcgatggcg ttggttatgg ctggatcgac 1500ggcctcaagg cacatgccgc cgcgcacgtg agcgaccgcg aactcgcagc ggccgaccgg 1560cgcttcccgg tgaacccgcc gcagaccaag gaagcctatt tctaccgcag tctgttcgag 1620cagttcttcc ccagccaggc cgctgcggag acggtgccgg gtggtaaatc catcgcgtgt 1680tcgtcgccga cggccattgc ctgggacgcg agctttgcgg cgatggccga tccgtcgggc 1740cgtgcgattg ccggcgtgca cgcgcaggcg ttggcgtcc 1779111941DNABacillus halodurans 11atgatttgtg acaaatgcag cctcgtgcgg agcttttttg taggtagacc gcgggatatc 60acaagtttgt acaaaaaagc aggctcctgc aggaccatgt gtggaattac aggctgggta 120gattggcgac gcaacttgca aaatgagacg gaaacgatca aacagatggc ggaaacgcaa 180acacatcgag ggcccgatga tttgaacgtt tggacagaga agcatgctgc cttaggccac 240tcgcggctca ttgtcgttga tccggaaggc ggttgtcagc cgatgatgag ggagaggaat 300ggcaaacgct atacgatcgt gtataacggc gaattataca atacagaaga tttacggaaa 360gagcttatag taaaaggtta ccaatttcaa ggccattcgg atacggaagt attactcgtg 420tcttatatcg aatggggtta ccaatgtgtg gagaagttca atggcatttt tgcgtttgcg 480atttggaatg ataaagatca gagcttgttt atggcccgcg accgattagg ggtaaagccg 540ctattttata ctgttcgcca tggattttta ctttttgcaa ctgagataaa agcgctgctt 600gctcatcctg aaatcgagcc ggttcttacc gaagaagggc tatcggaagt gctcgggctt 660gggccatcac gttcaccggg taatggcgtt tttgatgata ttcaagagtt gcgaccagct 720catcttttga catacgatcg caatggggca aaagtgagcc gttattggag attaaaatca 780atggctcatt ctgaagatgc gatggaaacg gccgcccatc ttcgcgactt attagaagat 840actgtcgaac gtcagctatt tgcagatgtt ccagttggaa tgtttctttc gggtggagtc 900gattcgagtg ctttaacggc aattgcggcg ctgatttacg agcgagaagg gaagggcctg 960attcggacgt actcgattga ttatgacgaa aatgataagt attttaaagc gaatgacttt 1020caaccgaatg ccgatggacc ttgggttgaa aaagtttcaa ctacttttcg aacgaaccac 1080cacaatgctg tcatctcgat cgaggagttg gctaatcaat taaagcgagc ggtagagctt 1140cgtgacttac ctggaatggc cgatgtagac tcttcattgt attggttttg taagcaaatc 1200aaaaaagatg ttaccgttgg cttatcgggt gaatgtgctg acgaaatttt tggtgggtat 1260ccttggttcc ataagccaga ggtcatgaat tttaatgggt ttccttggat gagatcagcg 1320gatgaacgtc aggagcttct tcatgaacga tggcgccaaa agttaaattt gcccaaatac 1380gttcatgatc gttataaaga aacgattgcc gaaacgcctc gcttcgaaga ggacacaccg 1440gaagaagcgc gacgcaggga aatttcgtat ttgaacatgg tctggtttat gacaacgctt 1500cttgatcgga aggatcgaat gagcatggga gcgagcttag aagtgcgagt tccattttct 1560gaccaccgaa ttgtagaata cgcttggaac attccgtggg aaattaaaca attcggaggg 1620agagagaagg gcattttacg aaaagcgttg gaaggcatcc tcccagatga agtgttatac 1680cggaaaaaaa gtccttatcc gaaaacgcac catccaaaat acacgaaaat ggtccagcaa 1740gagatggaac gaattctcgg tcaaagcgat agccccctct ttgatgtagt gaaccggaaa 1800aagttaaaag agttaaccga aactggtggc aaggcattaa cgacacctta ttttgggcag 1860cttatgacag gcccgcagct ccttgcccac ttcatccaaa tggagcattg gcttaagcat 1920tacaatatca aattaattgg t 1941121869DNAOryza sativa 12atgatttgtg acaaatgcag cctcgtgcgg agcttttttg taggtagacc gcgggatatc 60acaagtttgt acaaaaaagc aggctcctgc aggaccatgt gtggcatcct cgccgtgctc 120ggcgtcgcag acgtctccct cgtcaagcgc tcccgcatca tcgagctatc ccgccggtta 180cgtcatagag gccctgattg gagtggtata cactgctatc aggattgcta tcttgcacac 240cagcggttgg ctattgttga tcccacatcc ggagaccagc cgttgtacaa tgaggacaaa 300tctgttgttg tgacggtgaa tggagagatc tataaccatg aagaattgaa agctaacctg 360aaatctcata aattccaaac tgctagcgat tgtgaagtta ttgctcatct gtatgaggaa 420tatggggagg aatttgtgga tatgttggat gggatgttcg cttttgttct tcttgacaca 480cgtgataaaa gcttcattgc agcccgtgat gctattggca tttgtccttt atacatgggc 540tggggtcttg atggttcggt ttggttttcg tcagagatga aggcattaag tgatgattgc 600gagcgattca tatccttccc ccctgggcac ttgtactcca gcaaaacagg tggcctaagg 660agatggtaca acccaccatg gttttctgaa agcattccct ccaccccgta caatcctctt 720cttctccgac agagctttga gaaggctatt attaagaggc taatgacaga tgtgccattt 780ggtgttctct tgtctggtgg actggactct tctttggttg catctgttgt ttcgcggcac 840ttggcagagg caaaagttgc cgcacagtgg ggaaacaaac tgcatacatt ttgcattggt 900ttgaaaggtt ctcctgatct tagagctgct aaggaagttg cagactacct tggtactgtt 960catcacgaac tccacttcac agtgcaggaa ggcattgatg cactggagga agtcatttac 1020catgttgaga catatgatgt aacgacaatt agagcaagca ccccaatgtt cttgatgtca 1080cgtaaaatta aatctttggg ggtgaagatg gttctttcgg gagaaggttc tgatgaaata 1140tttggcggtt acctttattt tcacaaggca ccaaacaaga aggaattcca tgaggaaaca 1200tgtcggaaga taaaagccct tcatttatat gattgcttga gagcgaacaa atcaacttct 1260gcatggggtg ttgaggcccg tgttccgttc cttgacaaaa acttcatcaa tgtagctatg 1320gacattgatc ctgaatggaa aatgataaaa cgtgatcttg gccgtattga gaaatgggtt 1380ctccggaatg catttgatga tgaggagaag ccctatttac ctaagcacat tctatacagg 1440caaaaggagc aattcagtga tggtgttggg tacagttgga ttgatggatt gaaggatcat 1500gcaaatgaac atgtatcaga ttccatgatg atgaacgcta gctttgttta cccagaaaac 1560actccagtta caaaagaagc gtactattat aggacaatat tcgagaaatt ctttcccaag 1620aatgctgcta ggttgacagt acctggaggt cctagcgtcg cgtgcagcac tgctaaagct 1680gttgaatggg acgcagcctg gtccaaaaac cttgatccat ctggtcgtgc tgctcttggt 1740gttcatgatg ctgcatatga agatactcta caaaaatctc ctgcctctgc caatcctgtc 1800ttggataacg gctttggtcc agcccttggg gaaagcatgg tcaaaaccgt tgcttcagcc 1860actgccgtt 1869131764DNAGaldieria sulphuraria 13atgatttgtg acaaatgcag cctcgtgcgg agcttttttg taggtagacc gcggaccggt 60cgcgcctcag cagtcgctgt cgttaccatg tgtgggattc ttgcggtgtt gggctcgtcg 120ttaccggtcg aagagcttag agagttggtt aaaagctgca ccaaaaaact atatcacaga 180ggtccagatg aagaacaata tttcattagt gaagatgggt ggtgtggttt aggctttgcc 240aggttgaaga ttgttgatcc tgagcacggt gtccagccta tgttcaacga ccaacggaca 300gtttggagtg tcactaatgg cgagctttac aaccatgaag agatccgaaa aacggaattg 360aacaatatga cactccattc tcattctgac tgcgaaataa tgataccttt gtatgagaaa 420tatgtttcta gtcagcgtta tgatcatgac attcaatatg tttataatct tctccgtgga 480gtctttgctt cttgcctggt tgatttgaaa cgtggttttt tcatggctgg aagagatcct 540atcggggtcc gagctctttt ttatgggaca agtaaagatg gtgctgtttg gtttgcttca 600gaggcaaaag caattgtgga tgtttgtgat tatgtgacag cattcatacc aggtaccttt 660gtgaaaggat acagaggccg cgaacaagca ttttctttta cgagatatta cgaaccagtg 720tactggcatg atcactggat gccggtttct ccagttgact atcaactttt acatgacacc 780tttgtgttgt cttgtaagcg tcgtttaatg tccgacgtgc ctattggagt atttatctct 840ggtggtttgg gttcttctct tgtggcctcc gtcgccaaac gcttactgga tcccaactat 900gattttcatt cttttgcttg tggtcttgaa ggagcaccag atgttgctgc agcgcaaaga 960gttgccgatt tcttaggaac aaagcaccac gtattaacat ttactgtgga ggagggtatc 1020caagcactag accaagtaat atatcacttg gaaacgtacg atgttaccac agttagagca 1080tcgacgccga tgtatttgtt atcaggtttg tgcaaaaagt atgtcaaagt agtgttatca 1140ggtgaaggag cagatgaaat cttcggtgga tatctctatt tccacaatgc accaaatgag 1200attgcatttc atcaagaagt tgttcgccga gtgaaacttt tatacacagc cgacgtattg 1260cgtggagata gagcaacggc agcacaaagt ttagaacttc gagttccgtt tcttgataga 1320gactttctgg atgttgcaat gagtattcat ccgcgtgaaa aggttacttc taagcataga 1380atcgagaaat atatcattcg ctatgccttt

tccaaggagt tttgtggtga agagtatctt 1440cctgacgata ttctttggag acaaaaagaa cagttttcgg atggcgtggg ctatagctgg 1500atcgatggtt taaaggcgta ttgtgaaaag gccgtttccg atgcagactt gcaaaatgcc 1560gctcagcgtt ttccgcacga tactccaaca accaaagagg catatgttta ccgagctata 1620ttcgaaaaac attttgggaa ttgcaaggca gtacaaggtc ttcgtgaatc agttgcaaga 1680tgggtaccta tgtggagtga cagcacggat cctagcggtc gtgcacaaaa agttcatgtg 1740gctgcatatt caaatggagg agac 1764141905DNAGaldieria sulphuraria 14atgtgttgct ctccttacct cctgatggta tctagtatct accaactgac actatattgc 60ttctctttac atacgtatct tgctcgatgc cttctcccta gtgttgacca gtgttactca 120catagtcttt gctcatttca ttgtaatgca gataccaagc ggggtaccag atctgagctc 180ccgcgggata tcacaagttt gtacaaaaaa gcaggctcct gcaggaccat gtgtgggatt 240cttgcggtgt tgggctcgtc gttaccggtc gaagagctta gagagttggt taaaagctgc 300accaaaaaac tatatcacag aggtccagat gaagaacaat atttcattag tgaagatggg 360tggtgtggtt taggctttgc caggttgaag attgttgatc ctgagcacgg tgtccagcct 420atgttcaacg accaacggac agtttggagt gtcactaatg gcgagcttta caaccatgaa 480gagatccgaa aaacggaatt gaacaatatg acactccatt ctcattctga ctgcgaaata 540atgatacctt tgtatgagaa atatgtttct agtcagcgtt atgatcatga cattcaatat 600gtttataatc ttctccgtgg agtctttgct tcttgcctgg ttgatttgaa acgtggtttt 660ttcatggctg gaagagatcc tatcggggtc cgagctcttt tttatgggac aagtaaagat 720ggtgctgttt ggtttgcttc agaggcaaaa gcaattgtgg atgtttgtga ttatgtgaca 780gcattcatac caggtacctt tgtgaaagga tacagaggcc gcgaacaagc attttctttt 840acgagatatt acgaaccagt gtactggcat gatcactgga tgccggtttc tccagttgac 900tatcaacttt tacatgacac ctttgtgttg tcttgtaagc gtcgtttaat gtccgacgtg 960cctattggag tatttatctc tggtggtttg ggttcttctc ttgtggcctc cgtcgccaaa 1020cgcttactgg atcccaacta tgattttcat tcttttgctt gtggtcttga aggagcacca 1080gatgttgctg cagcgcaaag agttgccgat ttcttaggaa caaagcacca cgtattaaca 1140tttactgtgg aggagggtat ccaagcacta gaccaagtaa tatatcactt ggaaacgtac 1200gatgttacca cagttagagc atcgacgccg atgtatttgt tatcaggttt gtgcaaaaag 1260tatgtcaaag tagtgttatc aggtgaagga gcagatgaaa tcttcggtgg atatctctat 1320ttccacaatg caccaaatga gattgcattt catcaagaag ttgttcgccg agtgaaactt 1380ttatacacag ccgacgtatt gcgtggagat agagcaacgg cagcacaaag tttagaactt 1440cgagttccgt ttcttgatag agactttctg gatgttgcaa tgagtattca tccgcgtgaa 1500aaggttactt ctaagcatag aatcgagaaa tatatcattc gctatgcctt ttccaaggag 1560ttttgtggtg aagagtatct tcctgacgat attctttgga gacaaaaaga acagttttcg 1620gatggcgtgg gctatagctg gatcgatggt ttaaaggcgt attgtgaaaa ggccgtttcc 1680gatgcagact tgcaaaatgc cgctcagcgt tttccgcacg atactccaac aaccaaagag 1740gcatatgttt accgagctat attcgaaaaa cattttggga attgcaaggc agtacaaggt 1800cttcgtgaat cagttgcaag atgggtacct atgtggagtg acagcacgga tcctagcggt 1860cgtgcacaaa aagttcatgt ggctgcatat tcaaatggag gagac 1905151851DNAGaldieria sulphuraria 15atggtatcta gtatctacca actgacacta tattgcttct ctttacatac gtatcttgct 60cgatgccttc tccctagtgt tgaccagtgt tactcacata gtctttgctc atttcattgt 120aatgcagata ccaagcggga gctcgacgtc cctcagcagt cgctgtgcga taccatgtgt 180gggattcttg cggtgttggg ctcgtcgtta ccggtcgaag agcttagaga gttggttaaa 240agctgcacca aaaaactata tcacagaggt ccagatgaag aacaatattt cattagtgaa 300gatgggtggt gtggtttagg ctttgccagg ttgaagattg ttgatcctga gcacggtgtc 360cagcctatgt tcaacgacca acggacagtt tggagtgtca ctaatggcga gctttacaac 420catgaagaga tccgaaaaac ggaattgaac aatatgacac tccattctca ttctgactgc 480gaaataatga tacctttgta tgagaaatat gtttctagtc agcgttatga tcatgacatt 540caatatgttt ataatcttct ccgtggagtc tttgcttctt gcctggttga tttgaaacgt 600ggttttttca tggctggaag agatcctatc ggggtccgag ctctttttta tgggacaagt 660aaagatggtg ctgtttggtt tgcttcagag gcaaaagcaa ttgtggatgt ttgtgattat 720gtgacagcat tcataccagg tacctttgtg aaaggataca gaggccgcga acaagcattt 780tcttttacga gatattacga accagtgtac tggcatgatc actggatgcc ggtttctcca 840gttgactatc aacttttaca tgacaccttt gtgttgtctt gtaagcgtcg tttaatgtcc 900gacgtgccta ttggagtatt tatctctggt ggtttgggtt cttctcttgt ggcctccgtc 960gccaaacgct tactggatcc caactatgat tttcattctt ttgcttgtgg tcttgaagga 1020gcaccagatg ttgctgcagc gcaaagagtt gccgatttct taggaacaaa gcaccacgta 1080ttaacattta ctgtggagga gggtatccaa gcactagacc aagtaatata tcacttggaa 1140acgtacgatg ttaccacagt tagagcatcg acgccgatgt atttgttatc aggtttgtgc 1200aaaaagtatg tcaaagtagt gttatcaggt gaaggagcag atgaaatctt cggtggatat 1260ctctatttcc acaatgcacc aaatgagatt gcatttcatc aagaagttgt tcgccgagtg 1320aaacttttat acacagccga cgtattgcgt ggagatagag caacggcagc acaaagttta 1380gaacttcgag ttccgtttct tgatagagac tttctggatg ttgcaatgag tattcatccg 1440cgtgaaaagg ttacttctaa gcatagaatc gagaaatata tcattcgcta tgccttttcc 1500aaggagtttt gtggtgaaga gtatcttcct gacgatattc tttggagaca aaaagaacag 1560ttttcggatg gcgtgggcta tagctggatc gatggtttaa aggcgtattg tgaaaaggcc 1620gtttccgatg cagacttgca aaatgccgct cagcgttttc cgcacgatac tccaacaacc 1680aaagaggcat atgtttaccg agctatattc gaaaaacatt ttgggaattg caaggcagta 1740caaggtcttc gtgaatcagt tgcaagatgg gtacctatgt ggagtgacag cacggatcct 1800agcggtcgtg cacaaaaagt tcatgtggct gcatattcaa atggaggaga c 1851161851DNAGaldieria sulphuraria 16atggtatcta gtatctacca actgacacta tattgcttct ctttacatac gtatcttgct 60cgatgccttc tccctagtgt tgaccagtgt tactcacata gtctttgctc atttcattgt 120aatgcagata ccaagcggga gctcgacgtc cctcagcagt cgctgtgcga taccatgtgt 180gggattcttg cggtgttggg ctcgtcgtta ccggtcgaag agcttagaga gttggttaaa 240agctgcacca aaaaactata tcacagaggt ccagatgaag aacaatattt cattagtgaa 300gatgggtggt gtggtttagg ctttgccagg ttgaagattg ttgatcctga gcacggtgtc 360cagcctatgt tcaacgacca acggacagtt tggagtgtca ctaatggcga gctttacaac 420catgaagaga tccgaaaaac ggaattgaac aatatgacac tccattctca ttctgactgc 480gaaataatga tacctttgta tgagaaatat gtttctagtc agcgttatga tcatgacatt 540caatatgttt ataatcttct ccgtggagtc tttgcttctt gcctggttga tttgaaacgt 600ggttttttca tggctggaag agatcctatc ggggtccgag ctctttttta tgggacaagt 660aaagatggtg ctgtttggtt tgcttcagag gcaaaagcaa ttgtggatgt ttgtgattat 720gtgacagcat tcataccagg tacctttgtg aaaggataca gaggccgcga acaagcattt 780tcttttacga gatattacga accagtgtac tggcatgatc actggatgcc ggtttctcca 840gttgactatc aacttttaca tgacaccttt gtgttgtctt gtaagcgtcg tttaatgtcc 900gacgtgccta ttggagtatt tatctctggt ggtttgggtt cttctcttgt ggcctccgtc 960gccaaacgct tactggatcc caactatgat tttcattctt ttgcttgtgg tcttgaagga 1020gcaccagatg ttgctgcagc gcaaagagtt gccgatttct taggaacaaa gcaccacgta 1080ttaacattta ctgtggagga gggtatccaa gcactagacc aagtaatata tcacttggaa 1140acgtacgatg ttaccacagt tagagcatcg acgccgatgt atttgttatc aggtttgtgc 1200aaaaagtatg tcaaagtagt gttatcaggt gaaggagcag atgaaatctt cggtggatat 1260ctctatttcc acaatgcacc aaatgagatt gcatttcatc aagaagttgt tcgccgagtg 1320aaacttttat acacagccga cgtattgcgt ggagatagag caacggcagc acaaagttta 1380gaacttcgag ttccgtttct tgatagagac tttctggatg ttgcaatgag tattcatccg 1440cgtgaaaagg ttacttctaa gcatagaatc gagaaatata tcattcgcta tgccttttcc 1500aaggagtttt gtggtgaaga gtatcttcct gacgatattc tttggagaca aaaagaacag 1560ttttcggatg gcgtgggcta tagctggatc gatggtttaa aggcgtattg tgaaaaggcc 1620gtttccgatg cagacttgca aaatgccgct cagcgttttc cgcacgatac tccaacaacc 1680aaagaggcat atgtttaccg agctatattc gaaaaacatt ttgggaattg caaggcagta 1740caaggtcttc gtgaatcagt tgcaagatgg gtacctatgt ggagtgacag cacggatcct 1800agcggtcgtg cacaaaaagt tcatgtggct gcatattcaa atggaggaga c 1851171803DNASaccharomyces cerevisiae 17atgatttgtg acaaatgcag cctcgtgcgg agcttttttg taggtagacc gcggaccggt 60cgcgcctcag cagtcgctgt cgttaccatg tgtggtatct ttgcagcctt caagcatgaa 120gatattcaca acttcaaacc aaaagctcta caactatcta aaaaaatcag acaccgtggc 180ccagattggt caggaaatgc cgttatgaat tccaccattt tcgttcacga gaggttggct 240attgttggtt tagactccgg tgcccagcca atcacttcag ctgatggcga atatatgctt 300ggcgttaatg gtgagatcta caaccacatc caactaaggg agatgtgctc tgattacaag 360tttcaaactt tcagtgactg tgaacccatc ataccgttat atttggaaca tgatatcgat 420gctccaaaat atctggacgg tatgttcgca ttttgtctgt atgattccaa gaaagaccgt 480attgtcgctg caagagaccc tatcggtgtt gtcactttat acatggggcg ttcttctcag 540tctccagaga ccgtttattt tgcctccgaa ttaaaatgtc taactgacgt ttgtgacagt 600atcatttcgt tccctcctgg tcatgtctac gattctgaaa cggacaagat tactcgttac 660tttaccccag actggttgga tgaaaagcgt atcccatcca ccccagttga ctaccatgct 720atcagacaca gtttagaaaa ggccgttaga aagaggctaa tggctgaagt tccatacggt 780gttcttctat ccggtgggct ggactcttct ttgattgctg cgattgctgc tcgtgaaacg 840gaaaaagcta atgctgatgc taacgaagac aacaatgttg acgagaagca acttgcaggt 900atcgatgacc aaggccatct acacacatcc ggttggtctc gtttgcattc gtttgcgatt 960ggtctaccaa atgcacctga tttacaagcg gctagaaaag tcgccaaatt cattggttct 1020atccaccatg aacacacttt tacattacaa gaaggtttgg atgctttgga cgacgtgatc 1080taccatttgg aaacttacga cgttaccact atcagagctt ctacaccaat gttcttacta 1140tctagaaaga ttaaggccca aggtgtcaaa atggttcttt ctggtgaagg ctcggacgaa 1200atattcggtg gctatctata tttcgcacaa gcaccttctg ctgcagaatt tcacaccgaa 1260tctgtgcaac gtgtcaagaa cttgcatttg gcagattgtt tgagagctaa taagtccacg 1320atggcttggg gtctagaagc tcgtgttccc ttcttagaca aagacttttt gcagctatgt 1380atgaacattg atccaaatga aaagatgatc aagccaaagg aaggacgtat cgaaaaatac 1440attttaagaa aggcattcga cactacagat gaaccagatg ttaagccata cctacctgaa 1500gaaatcttat ggagacaaaa ggaacaattt tccgatggtg ttggctactc atggattgac 1560ggcctaagag acactgctga aagggccatt tctgacgcca tgtttgccaa tccaaaggct 1620gattggggcg acgatattcc aaccaccaaa gaagcttact ggtacaggct gaagtttgat 1680gcttggtttc ctcaaaagac tgcggcagac actgtcatga gatggattcc aaaggccgat 1740tggggttgtg ccgaagatcc ttcaggtaga tacgccaaaa tacacgaaaa gcacgtcagt 1800gct 18031821DNAArtificial Sequencesynthetic primer sequence 18gcagucgctg ucgtuaccat g 211920DNAArtificial Sequencesynthetic primer sequence 19gcgaguaccg cugggtucta 202039DNAArtificial Sequencesynthetic primer sequence 20gctcctgcag gaccatgtgt tccatttttg gaatcttca 392137DNAArtificial Sequencesynthetic primer sequence 21ctgggtctcg agctacagca gtgcttgttg atgaacc 372253DNAArtificial Sequencesynthetic primer sequence 22ccccttttat aatgccaact ttgtacaaaa aagcaggctc ctgcaggacc atg 532348DNAArtificial Sequencesynthetic primer sequence 23ggggtcttat aatgccaact ttgtacaaga aagctgggtc tcgagcta 482436DNAArtificial Sequencesynthetic primer sequence 24gctcctgcag gaccatgtgt ggaattacag gctggg 362547DNAArtificial Sequencesynthetic primer sequence 25ctgggtctcg agctaaccaa ttaatttgat attgtaatgc ttaagcc 472653DNAArtificial Sequencesynthetic primer sequence 26ccccttttat aatgccaact ttgtacaaaa aagcaggctc ctgcaggacc atg 532748DNAArtificial Sequencesynthetic primer sequence 27ggggtcttat aatgccaact ttgtacaaga aagctgggtc tcgagcta 482831DNAArtificial Sequencesynthetic primer sequence 28gctcctgcag gaccatgtgc ggcatcctcg c 312936DNAArtificial Sequencesynthetic primer sequence 29ctgggtctcg agctagacag ctgtggctga agcaac 363053DNAArtificial Sequencesynthetic primer sequence 30ccccttttat aatgccaact ttgtacaaaa aagcaggctc ctgcaggacc atg 533148DNAArtificial Sequencesynthetic primer sequence 31ggggtcttat aatgccaact ttgtacaaga aagctgggtc tcgagcta 483235DNAArtificial Sequencesynthetic primer sequence 32gctcctgcag gaccatgtgc ggcatacttg ctgtg 353332DNAArtificial Sequencesynthetic primer sequence 33ctgggtctcg agctatccct cgatggcaac gc 323453DNAArtificial Sequencesynthetic primer sequence 34ccccttttat aatgccaact ttgtacaaaa aagcaggctc ctgcaggacc atg 533548DNAArtificial Sequencesynthetic primer sequence 35ggggtcttat aatgccaact ttgtacaaga aagctgggtc tcgagcta 483634DNAArtificial Sequencesynthetic primer sequence 36gctcctgcag gaccatgtgt ggcatcctcg ccgt 343734DNAArtificial Sequencesynthetic primer sequence 37ctgggtctcg agctaaacgg cagtggctga agca 343853DNAArtificial Sequencesynthetic primer sequence 38ccccttttat aatgccaact ttgtacaaaa aagcaggctc ctgcaggacc atg 533948DNAArtificial Sequencesynthetic primer sequence 39ggggtcttat aatgccaact ttgtacaaga aagctgggtc tcgagcta 484040DNAArtificial Sequencesynthetic primer sequence 40gctcctgcag gaccatgtgt ggtattcttg ctgttcttgg 404133DNAArtificial Sequencesynthetic primer sequence 41ctgggtctcg agctagccct ggatggcaac acc 334233DNAArtificial Sequencesynthetic primer sequence 42ctgggtctcg agctagccct ggatggcaac acc 334348DNAArtificial Sequencesynthetic primer sequence 43ggggtcttat aatgccaact ttgtacaaga aagctgggtc tcgagcta 484426DNAArtificial Sequencesynthetic primer sequence 44cctctagatg tgcggcatac ttgctg 264525DNAArtificial Sequencesynthetic primer sequence 45cgaattctat ccctcgatgg caacg 254627DNAArtificial Sequencesynthetic primer sequence 46tcctagacat gtccggcata cttgctg 274723DNAArtificial Sequencesynthetic primer sequence 47tgcagaattc tatccctcga tgg 234837DNAArtificial Sequencesynthetic primer sequence 48gcagtcgctg tcgttacccg gcatcatgtg tggcatc 374941DNAArtificial Sequencesynthetic primer sequence 49gcgagtaccg ctgggttcta acgtactctc gtcagaccgc g 41501767DNAZea mays 50atgtgtggca tcttagccgt gctcggatgc tccgactgct cccaggccag gagggctcgc 60atcctcgcct gctccagaag gctgaagcac aggggccccg actggtcggg cctctaccag 120cacgagggca acttcctggc gcagcagcgg ctcgccatcg tctccccgct gtccggcgac 180cagccgctgt tcaacgagga ccgcaccgtc gtggtggtgg ccaatggaga gatctacaac 240cacaagaacg tccggaagca gttcaccggc gcgcacagct tcagcaccgg aagtgactgc 300gaggtcatca tccccctgta cgagaagtac ggcgagaact tcgtggacat gctggacgga 360gtcttcgcgt tcgtgctcta cgacacgcga gacaggacct acgtggcggc acgcgacgcc 420atcggcgtca acccgctcta catcggctgg ggcagcgacg gttccgtctg gatgtcatcc 480gagatgaagg cgctgaacga ggactgcgtg cgcttcgaga tcttcccgcc gggccacctc 540tactccagcg ccggcggcgg gttccgccgg tggtacaccc cgcactggtt ccaggagcag 600gtgccccgga cgccgtacca gtcgctcgtc cttagagagg ccttcgagaa ggcggttatc 660aagaggctca tgaccgacgt cccgttcggg gtcctcctct ccggcggcct cgactcctcc 720ctcgtcgcct ccgtcaccaa gcgccacctc gtcgagaccg acgccgccga aaagttcggc 780acagagctcc actccttcgt cgtcggcctc gagggctccc ctgacctgaa ggccgcacga 840gaggtcgctg actacctcgg aaccacccat cacgagttcc atttcaccgt acaggacggc 900atcgacgcga tcgaggaggt gatctaccac gacgagacgt acgacgtgac gacgatccgg 960gccagcacgc ccatgttcct gatggctcgc aagatcaagt cgctgggcgt gaagatggtg 1020ctgtccgggg agggctccga cgagctcctg ggcggctacc tctacttcca cttcgccccc 1080aacagggagg agctccacag ggagacctgc cgcaaggtga aggccctgca ccagtacgac 1140tgcctgcgcg ccaacaaggc gacgtcggcg tggggcctgg aggtccgcgt gccgttcctc 1200gacaaggagt tcgtcgacgt cgcgatgggc atggaccccg aatggaaaat gtacgacaag 1260aacctgggtc gcatcgagaa gtgggtcctg aggaaggcgt tcgacgacga ggagcaccct 1320tacctgcccg agcatattct gtacaggcag aaagaacagt tcagtgacgg agtgggctac 1380aactggatcg atggactcaa atccttcacc gaacagcagg tgacggatga gatgatgaac 1440agcgccgccc agatgttccc gtacaacacg cccgtcaaca aggaggccta ctactaccgg 1500atgatattcg agaggctctt ccctcaggac tcggcgaggg agacggtgcc gtggggcccg 1560agcatcgcct gcagcacgcc cgcggccatc gagtgggtgg agcagtggaa ggcctccaac 1620gacccctccg gccgcttcat ctcctcccac gactccgccg ccaccgaccg caccggcgac 1680aagctggcgg tggccaacgg cggcgggcac ggcgcggcga acggcacggt caacggcaac 1740gacgtcgctg tcgcgatcgc ggtgtaa 176751588PRTZea mays 51Met Cys Gly Ile Leu Ala Val Leu Gly Cys Ser Asp Cys Ser Gln Ala1 5 10 15Arg Arg Ala Arg Ile Leu Ala Cys Ser Arg Arg Leu Lys His Arg Gly20 25 30Pro Asp Trp Ser Gly Leu Tyr Gln His Glu Gly Asn Phe Leu Ala Gln35 40 45Gln Arg Leu Ala Ile Val Ser Pro Leu Ser Gly Asp Gln Pro Leu Phe50 55 60Asn Glu Asp Arg Thr Val Val Val Val Ala Asn Gly Glu Ile Tyr Asn65 70 75 80His Lys Asn Val Arg Lys Gln Phe Thr Gly Ala His Ser Phe Ser Thr85 90 95Gly Ser Asp Cys Glu Val Ile Ile Pro Leu Tyr Glu Lys Tyr Gly Glu100 105 110Asn Phe Val Asp Met Leu Asp Gly Val Phe Ala Phe Val Leu Tyr Asp115 120 125Thr Arg Asp Arg Thr Tyr Val Ala Ala Arg Asp Ala Ile Gly Val Asn130 135 140Pro Leu Tyr Ile Gly Trp Gly Ser Asp Gly Ser Val Trp Met Ser Ser145 150 155 160Glu Met Lys Ala Leu Asn Glu Asp Cys Val Arg Phe Glu Ile Phe Pro165 170 175Pro Gly His Leu Tyr Ser Ser Ala Gly Gly Gly Phe Arg Arg Trp Tyr180 185 190Thr Pro His Trp Phe Gln Glu Gln Val Pro Arg Thr Pro Tyr Gln Ser195 200 205Leu Val Leu Arg Glu Ala Phe Glu Lys Ala Val Ile Lys Arg Leu Met210 215 220Thr Asp Val Pro Phe Gly Val Leu Leu Ser Gly Gly Leu Asp Ser Ser225 230 235 240Leu Val Ala Ser Val Thr Lys Arg His Leu Val Glu Thr Asp Ala Ala245

250 255Glu Lys Phe Gly Thr Glu Leu His Ser Phe Val Val Gly Leu Glu Gly260 265 270Ser Pro Asp Leu Lys Ala Ala Arg Glu Val Ala Asp Tyr Leu Gly Thr275 280 285Thr His His Glu Phe His Phe Thr Val Gln Asp Gly Ile Asp Ala Ile290 295 300Glu Glu Val Ile Tyr His Asp Glu Thr Tyr Asp Val Thr Thr Ile Arg305 310 315 320Ala Ser Thr Pro Met Phe Leu Met Ala Arg Lys Ile Lys Ser Leu Gly325 330 335Val Lys Met Val Leu Ser Gly Glu Gly Ser Asp Glu Leu Leu Gly Gly340 345 350Tyr Leu Tyr Phe His Phe Ala Pro Asn Arg Glu Glu Leu His Arg Glu355 360 365Thr Cys Arg Lys Val Lys Ala Leu His Gln Tyr Asp Cys Leu Arg Ala370 375 380Asn Lys Ala Thr Ser Ala Trp Gly Leu Glu Val Arg Val Pro Phe Leu385 390 395 400Asp Lys Glu Phe Val Asp Val Ala Met Gly Met Asp Pro Glu Trp Lys405 410 415Met Tyr Asp Lys Asn Leu Gly Arg Ile Glu Lys Trp Val Leu Arg Lys420 425 430Ala Phe Asp Asp Glu Glu His Pro Tyr Leu Pro Glu His Ile Leu Tyr435 440 445Arg Gln Lys Glu Gln Phe Ser Asp Gly Val Gly Tyr Asn Trp Ile Asp450 455 460Gly Leu Lys Ser Phe Thr Glu Gln Gln Val Thr Asp Glu Met Met Asn465 470 475 480Ser Ala Ala Gln Met Phe Pro Tyr Asn Thr Pro Val Asn Lys Glu Ala485 490 495Tyr Tyr Tyr Arg Met Ile Phe Glu Arg Leu Phe Pro Gln Asp Ser Ala500 505 510Arg Glu Thr Val Pro Trp Gly Pro Ser Ile Ala Cys Ser Thr Pro Ala515 520 525Ala Ile Glu Trp Val Glu Gln Trp Lys Ala Ser Asn Asp Pro Ser Gly530 535 540Arg Phe Ile Ser Ser His Asp Ser Ala Ala Thr Asp Arg Thr Gly Asp545 550 555 560Lys Leu Ala Val Ala Asn Gly Gly Gly His Gly Ala Ala Asn Gly Thr565 570 575Val Asn Gly Asn Asp Val Ala Val Ala Ile Ala Val580 5855227DNAArtificial Sequencesynthetic primer sequence 52ggaattccat atgtgtggca tcttagc 275338DNAArtificial Sequencesynthetic primer sequence 53ataagaatgc ggccgcgacc gcgatcgcga ctgcgaca 385427DNAArtificial Sequencesynthetic primer sequence 54ctagctagct agatgtgcgg catcctc 275531DNAArtificial Sequencesynthetic primer sequence 55ccgctcgagg acagctgtgg ctgaagcaac g 315628DNAArtificial Sequencesynthetic primer sequence 56gggaattcca tatgtgtggc atcttagc 285736DNAArtificial Sequencesynthetic primer sequence 57ataagaatgc ggccgccacc gcgatcgcga cagcga 365829DNAArtificial Sequencesynthetic primer sequence 58tatgtgcggc atacttgctg tgctcgggt 295926DNAArtificial Sequencesynthetic primer sequence 59gctatccctc gatggcaacg ccagat 26


Patent applications by Bo-Xing Qiu, Chesterfield, MO US

Patent applications by Bradon J. Fabbri, Chesterfield, MO US

Patent applications by James Crowley, Manchester, MO US

Patent applications by Scott Andersen, Manchester, MO US

Patent applications by Stephen M. Duff, St. Louis, MO US

Patent applications by Steven Screen, St. Louis, MO US

Patent applications in class Flour or meal type

Patent applications in all subclasses Flour or meal type


User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA