Inventors list |
Assignees list |
Classification tree browser |
Top 100 Inventors |
Top 100 Assignees |
Patent application title: Host Cells Containing Multiple Integrating Vectors
Inventors:
Robert D. Bremmel (Hillpoint, WI, US)
Linda U. Miller (Lodi, WI, US)
Gregory T. Bleck (Baraboo, WI, US)
Assignees:
Organization Name Catalent Pharma Solutions
IPC8 Class: AC12Q168FI
USPC Class:
435 6
Class name: Involving nucleic acid
Publication date: 11/20/2008
Patent application number: 20080286779
Sign up to receive free email alerts when patent applications with chosen keywords are published SIGN UP
Abstract:
The present invention relates to the production of proteins in host cells,
and more particularly to host cells containing multiple integrated copies
of an integrating vector. Suitable integrating vectors for use in the
present invention include retrovirus vectors, lentivirus vectors,
transposon vectors, and adeno-associated virus vectors. Methods are
provided in which the host cells are prepared by using the integrating
vectors at a high multiplicity of infection. The host cells are useful
for producing pharmaceutical proteins, variants of proteins for use in
screening assays, and for direct use in high throughput screening.Claims:
1. A host cell comprising a genome, said genome comprising at least two
integrated integrating vectors, wherein said integrating vectors comprise
at least one exogenous gene operably linked to a promoter.
2. The host cell of claim 1, wherein said integrating vectors further comprise a secretion signal sequence operably linked to said exogenous gene.
3. The host cell of claim 1, wherein said integrating vectors further comprise an RNA stabilizing element operably linked to said exogenous gene.
4. The host cell of claim 1, wherein said integrating vectors comprise at least two exogenous genes.
5. The host cell of claim 4, wherein said at least two exogenous genes are arranged in a polycistronic sequence.
6. The host cell of claim 5, wherein said at least two exogenous genes are separated by at least one internal ribosome entry site.
7. The host cell of claim 5, wherein two exogenous genes are arranged in said polycistronic sequence.
8. The host cell of claim 7, wherein said two exogenous genes encode a heavy chain of an immunoglobulin molecule and a light chain of an immunoglobulin molecule.
9. The host cell of claim 4, wherein one of said at least two exogenous genes is a selectable marker.
10. The host cell of claim 1, wherein said integrating vector is a retroviral vector.
11. The host cell of claim 10, wherein said retrovirus vector is a pseudotyped retroviral vector.
12. The host cell of claim 11, wherein said pseudotyped retroviral vector comprises a G glycoprotein.
13. The host cell of claim 12, wherein the G glycoprotein is selected from the group consisting of vesicular stomatitis virus, Piry virus, Chandipura virus, Spring viremia of carp virus and Mokola virus G glycoproteins.
14. The host cell of claim 10, wherein said retroviral vector comprises long terminal repeats selected from the group consisting of MoMLV, MoMuSV, and MMTV long terminal repeats.
15. The host cell of claim 11, wherein said retroviral vector is a lentiviral vector.
16. The host cell of claim 15, wherein said lentiviral vector comprises long terminal repeats selected from the group consisting of HIV and equine infectious anemia virus long terminal repeats.
17. The host cell of claim 1, wherein said host cell is present in a culture system selected from the group consisting of in vitro and in vivo cultures.
18. The host cell of claim 1, wherein said host cell is selected from Chinese hamster ovary cells, baby hamster kidney cells, and bovine mammary epithelial cells.
19. The host cell of claim 1, wherein said host cell is clonally derived.
20. The host cell of claim 1, wherein said host cell is non-clonally derived.
21. The host cell of claim 1, wherein genome is stable for greater than 10 passages.
22. The host cell of claim 21, wherein said genome is stable for greater than 50 passages.
23. The host cell of claim 21, wherein said genome is stable for greater than 100 passages.
24. The host cell of claim 1, wherein said integrated exogenous gene is stable in the absence of selection.
25. The host cell of claim 1, wherein said promoter is selected from the group consisting of alpha-lactalbumin promoter, cytomegalovirus promoter and the long terminal repeat of Moloney murine leukemia virus.
26. The host cell of claim 1, wherein said at least one exogenous gene is selected from the group consisting of genes encoding antigen binding proteins, pharmaceutical proteins, kinases, phosphatases, nucleic acid binding proteins, membrane receptor proteins, signal transduction proteins, ion channel proteins, and oncoproteins.
27. The host cell of claim 1, wherein said genome comprises at least 3 integrated integrating vectors.
28. The host cell of claim 1, wherein said genome comprises at least 4 integrated integrating vectors.
29. The host cell of claim 1, wherein said genome comprises at least 5 integrated integrating vectors.
30. The host cell of claim 1, wherein said genome comprises at least 7 integrated integrating vectors.
31. The host cell of claim 1, wherein said genome comprises at least 10 integrated integrating vectors.
32. The host cell of claim 1, wherein said genome comprises at least 20 integrated integrating vectors.
33. The host cell of claim 1, wherein said genome comprises at least 1000 integrated integrating vectors.
34. The host cells of claim 1, further comprising at least 2 integrated copies of a first integrating vector comprising a first exogenous gene, and at least 1 integrated copy of a second integrating vector comprising a second exogenous gene.
35. The host cell of claim 1, wherein said host cell expresses greater than about 10 picograms of said exogenous protein per day.
36. A method for transfecting host cells comprising:1) providing:a) a host cell comprising a genome, andb) a plurality of integrating vectors; and2) contacting said host cell with said plurality of integrating vectors under conditions such that at least two integrating vectors integrate into said genome of said host cell.
37. The method of claim 36, wherein said conditions comprise contacting said host at a multiplicity of infection of greater than 10.
38. The method of claim 36, wherein said conditions comprise contacting said host at a multiplicity of infection of from about 10 to 1000.
39. The method of claim 36, wherein said host cells are contacted with said plurality of integrating vectors under conditions such that at least 3 integrating vectors integrate into said genome of said host cell.
40. The method of claim 36, wherein said host cells are contacted with said plurality of integrating vectors under conditions such that at least 4 integrating vectors integrate into said genome of said host cell.
41. The method of claim 36, wherein said host cells are contacted with said plurality of integrating vectors under conditions such that at least 5 integrating vectors integrate into said genome of said host cell.
42. The method of claim 36, wherein said host cells are contacted with said plurality of integrating vectors under conditions such that at least 7 integrating vectors integrate into said genome of said host cell.
43. The method of claim 36, wherein said host cells are contacted with said plurality of integrating vectors under conditions such that at least 10 integrating vectors integrate into said genome of said host cell.
44. The method of claim 36, wherein said integrating vectors comprise at least one exogenous gene operably linked to a promoter
45. The method of claim 36, wherein said integrating vectors further comprise a secretion signal sequence operably linked to said exogenous gene.
46. The method of claim 36, wherein said integrating vectors further comprise an RNA stabilizing element operably linked to said gene exogenous gene.
47. The method of claim 36, wherein said integrating vectors comprises at least two exogenous genes.
48. The method of claim 47, wherein said at least two exogenous genes are arranged in a polycistronic sequence.
49. The method of claim 36, wherein said integrating vector is a retroviral vector.
50. The method of claim 49, wherein said retroviral vector is a pseudotyped retroviral vector.
51. The method of claim 49, wherein said retroviral vector is a lentiviral vector.
52. The method of claim 51, wherein said lentiviral vector is a pseudotyped lentivirus vector comprising a G glycoprotein.
53. The method of claim 36, wherein said host cell is selected from Chinese hamster ovary cells, baby hamster kidney cells, and bovine mammary epithelial cells.
54. The method of claim 36, further comprising clonally selecting said transfected host cells.
55. The method of claim 36, further comprising transfecting said host cells with at least two integrating vectors, each of said two integrating vectors comprising a different exogenous gene.
56. A method of producing a protein of interest comprising:1) providing a host cell comprising a genome, said genome comprising at least two integrated copies of at least one integrating vector comprising an exogenous gene operably linked to a promoter, wherein said exogenous gene encodes a protein of interest, and2) culturing said host cells under conditions such that said protein of interest is produced.
57. The method of claim 56, wherein said integrating vector further comprises a secretion signal sequence operably linked to said exogenous gene.
58. The method of claim 56, further comprising step3) isolating said protein of interest.
59. The method of claim 57, wherein said conditions are selected from the group consisting of roller bottle cultures, perfusion cultures, batch fed cultures, and petri dish cultures.
60. The method of claim 56, wherein said genome of said host cell comprises greater than 3 integrated copies of said integrating vector.
61. The method of claim 56, wherein said genome of said host cell comprises greater than 4 integrated copies of said integrating vector.
62. The method of claim 56, wherein said genome of said host cell comprises greater than 5 integrated copies of said integrating vector.
63. The method of claim 56, wherein said genome of said host cell comprises greater than 7 integrated copies of said integrating vector.
64. The method of claim 56, wherein said genome of said host cell comprises greater than 10 integrated copies of said integrating vector.
65. The method of claim 56, wherein said genome of said host cell comprises between about 2 and 20 integrated copies of said integrating vector.
66. The method of claim 56, wherein said genome of said host cell comprises between about 3 and 10 integrated copies of said integrating vector.
67. The method of claim 56, wherein said integrating vector is a retroviral vector.
68. The method of claim 67, wherein said retroviral vector is a pseudotyped retroviral vector.
69. The method of claim 67, wherein said retroviral vector is a lentiviral vector.
70. The method of claim 56, wherein said host cell is selected from Chinese hamster ovary cells, baby hamster kidney cells, and bovine mammary epithelial cells.
71. The method of claim 56, wherein said host cells synthesize greater than about 1 picograms per cell per day of said protein of interest.
72. The method of claim 56, wherein said host cells synthesize greater than about 10 picograms per cell per day of said protein of interest.
73. The method of claim 56, wherein said host cells synthesize greater than about 50 picograms per cell per day of said protein of interest.
74. The method of claim 56, wherein said cells are clonally selected.
75. A method for screening compounds comprising:1) providing:a) providing a host cell comprising a genome, said genome comprising at least two integrated copies of at least one integrating vector comprising an exogenous gene operably linked to a promotor, wherein said exogenous gene encodes a protein of interest; andb) one or more test compounds;2) culturing said host cells under conditions such that said protein of interest is expressed;3) treating said host cells with said one or more test compounds; and4) assaying for the presence of a response in said host cells to said test compound.
76. The method of claim 75 wherein said exogenous gene encodes a protein selected from the group consisting of membrane receptor proteins, nucleic acid binding proteins, cytoplasmic receptor proteins, ion channel proteins, signal transduction proteins, protein kinases, protein phosphatases, and proteins encoded by oncogenes.
77. The method of claim 76, wherein said host cell further comprises a reporter gene.
78. The method of claim 77, wherein said reporter gene is selected from the group consisting of green fluorescent protein, luciferase, beta-galactosidase, and beta-lactamase.
79. The method of claim 75, wherein said assaying step further comprising detecting a signal from said reporter gene.
80. The method of claim 75, wherein said genome of said host comprises at least two integrating vectors, wherein each of said at least two integrating vectors comprises a different exogenous gene.
81. The method of claim 75, wherein said integrating vector is a pseudotyped retroviral vector.
82. The method of claim 75, wherein said host cell is selected from chinese hamster ovary cells, baby hamster kidney cells, and bovine mammary epithelial cells.
83. A method for comparing protein function comprising:1) providinga) a first host cell comprising a first integrating vector comprising a promoter operably linked to a first exogenous gene, wherein said first exogenous gene encodes a first protein of interest;b) at least a second host cell comprising a second integrating vector comprising a promoter operably linked to a second exogenous gene, wherein said second exogenous gene encodes a second protein of interest that is a variant of said first protein of interest;2) culturing said host cells under conditions such that said first and second proteins of interest are produced; and3) comparing the activities of said first and second proteins of interest.
84. The method of claim 83, wherein said exogenous gene encodes a protein selected from the group consisting of membrane receptor proteins, nucleic acid binding proteins, cytoplasmic receptor proteins, ion channel proteins, signal transduction proteins, protein kinases, protein phosphatases, cell cycle proteins, and proteins encoded by oncogenes.
85. The method of claim 83, wherein said first and second proteins of interest differ by a single nucleotide polymorphism.
86. The method of claim 83, wherein said first and second proteins of interest are greater than 95% identical.
87. The method of claim 83, wherein said first and second proteins of interest are greater than 90% identical.
88. The method of claim 83, wherein said genomes of said first and second host cells each comprise greater than 3 integrated copies of said integrating vector.
89. The method of claim 83, wherein said genomes of said first and second host cells each comprise greater than 4 integrated copies of said integrating vector.
90. The method of claim 83, wherein said genomes of said first and second host cells comprises greater than 5 integrated copies of said integrating vector.
91. The method of claim 83, wherein said integrating vector is a retroviral vector.
92. The method of claim 91, wherein said retrovirus vector is a pseudotyped retroviral vector.
93. The method of claim 91, wherein said retroviral vector is a lentiviral vector.
94. A method comprising:1) providing:a) a host cell comprising a genome comprising at least one integrated exogenous gene; andb) a plurality of integrating vectors; and2) contacting said host cell with said plurality of integrating vectors under conditions such that at least two of said integrating vectors integrate into said genome of said host cell.
95. The method of claim 94, wherein said integrated exogenous gene comprises an integrating vector.
96. The method of claim 94, wherein said host cell is clonally selected.
97. The method of claim 94, wherein said host cell is non-clonally selected.
98. The method of claim 94, wherein said conditions comprise contacting said host at a multiplicity of infection of greater than 10.
99. The method of claim 94, wherein said conditions comprise contacting said host at a multiplicity of infection of from about 10 to 1000.
100. The method of claim 94, wherein said host cells are contacted with said plurality of integrating vectors under conditions such that at least 3 integrating vectors integrate into said genome of said host cell.
101. The method of claim 94, wherein said integrating vector is a retroviral vector.
102. The method of claim 101, wherein said retroviral vector is a pseudotyped retroviral vector.
Description:
[0001]This application claims priority to provisional appl. 60/215,925,
filed 3 Jul. 2000.
FIELD OF THE INVENTION
[0002]The present invention relates to the production of proteins in host cells, and more particularly to host cells containing multiple integrated copies of an integrating vector.
BACKGROUND OF THE INVENTION
[0003]The pharmaceutical biotechnology industry is based on the production of recombinant proteins in mammalian cells. These proteins are essential to the therapeutic treatment of many diseases and conditions. In many cases, the market for these proteins exceeds a billion dollars a year. Examples of proteins produced recombinantly in mammalian cells include erythropoietin, factor VIII, factor IX, and insulin. For many of these proteins, expression in mammalian cells is preferred over expression in prokaryotic cells because of the need for correct post-translational modification (e.g., glycosylation or silation; see, e.g., U.S. Pat. No. 5,721,121, incorporated herein by reference).
[0004]Several methods are known for creating host cells that express recombinant proteins. In the most basic methods, a nucleic acid construct containing a gene encoding a heterologous protein and appropriate regulatory regions is introduced into the host cell and allowed to integrate. Methods of introduction include calcium phosphate precipitation, microinjection, lipofection, and electroporation. In other methods, a selection scheme is used to amplify the introduced nucleic acid construct. In these methods, the cells are co-transfected with a gene encoding an amplifiable selection marker and a gene encoding a heterologous protein (See, e.g., Schroder and Friedl, Biotech. Bioeng. 53(6):547-59 [1997]). After selection of the initial tranformants, the transfected genes are amplified by the stepwise increase of the selective agent (e.g., dihydrofolate reductase) in the culture medium. In some cases, the exogenous gene may be amplified several hundred-fold by these procedures. Other methods of recombinant protein expression in mammalian cells utilize transfection with episomal vectors (e.g., plasmids).
[0005]Current methods for creating mammalian cell line for expression of recombinant proteins suffer from several drawbacks. (See, e.g., Mielke et al., Biochem. 35:2239-52 [1996]). Episomal systems allow for high expression levels of the recombinant protein, but are frequently only stable for a short time period (See, e.g., Klehr and Bode, Mol. Genet. (Life Sci. Adv.) 7:47-52 [1988]). Mammalian cell lines containing integrated exogenous genes are somewhat more stable, but there is increasing evidence that stability depends on the presence of only a few copies or even a single copy of the exogenous gene.
[0006]Standard transfection techniques favor the introduction of multiple copies of the transgene into the genome of the host cell. Multiple integration of the transgene has, in many cases, proven to be intrinsically unstable. This intrinsic instability may be due to the characteristic head-to-tail mode of integration which promotes the loss of coding sequences by homologous recombination (See, e.g., Weidle et al., Gene 66:193-203 [1988]) especially when the transgenes are transcribed (See, e.g., McBurney et al., Somatic Cell Molec. Genet. 20:529-40 [1994]). Host cells also have epigenetic defense mechanisms directed against multiple copy integration events. In plants, this mechanism has been termed "cosuppression." (See, e.g., Allen et al., Plant Cell 5:603-13 [1993]). Indeed, it is not uncommon that the level of expression is inversely related to copy number. These observations are consistent with findings that multiple copies of exogenous genes become inactivated by methylation (See, e.g., Mehtali et al., Gene 91:179-84 [1990]) and subsequent mutagenesis (See, e.g., Kricker et al., Proc. Natl. Acad. Sci. 89:1075-79 [1992]) or silenced by heterochromatin formation (See, e.g., Dorer and Henikoff, Cell 77:993-1002 [1994]).
[0007]Accordingly, what is needed in the art are improved methods for making host cells that express recombinant proteins. Preferably, the host cells will be stable over extended periods of time and express the protein encoded by a transgene at high levels.
SUMMARY OF THE INVENTION
[0008]The present invention relates to the production of proteins in host cells, and more particularly to host cells containing multiple integrated copies of an integrating vector. The present invention is not limited to host cells transfected with a particular number of integrating vectors. Indeed, host cells containing a wide range of integrating vectors are contemplated. In some embodiments, the present invention provides a host cell comprising a genome containing preferably at least about two integrated integrating vectors. In still further embodiments, the genome preferably comprises at least 3 integrated integrating vectors and most preferably at least 4 integrated integrating vectors, 5 integrated integrating vectors, 6 integrated integrating vectors, 7 integrated integrating vectors, 10 integrated integrating vectors, 15 integrated integrating vectors, 20 integrated integrating vectors, or 50 integrated integrating vectors.
[0009]The present invention is not limited to host cells containing vectors encoding a single protein of interest (i.e., exogenous protein). Indeed, it is contemplated that the host cells are transfected with vectors encoding multiple proteins of interest. In some embodiments, the integrating vector comprises at least two exogenous genes. In some preferred embodiments, the at least two exogenous genes are arranged in a polycistronic sequence. In some particularly preferred embodiments, the at least two exogenous genes are separated by an internal ribosome entry site. In other preferred embodiments, the at least two exogenous genes are arranged in a polycistronic sequence. In still further embodiments, the two exogenous genes comprise a heavy chain of an immunoglobulin molecule and a light chain of an immunoglobulin molecule. In other embodiments, one of the at least two exogenous genes is a selectable marker. In still other embodiments, the host cells comprise at least 2 integrated copies of a first integrating vector comprising a first exogenous gene, and at least 1 integrated copy of a second integrating vector or other vector comprising a second exogenous gene. In still further embodiments, the host cells comprise at least 10 integrated copies of a first integrating vector comprising a first exogenous gene, and at least 1 integrated copy of a second integrating vector or other vector comprising a second exogenous gene.
[0010]In some preferred embodiments, the integrating vectors comprise at least one exogenous gene operably linked to a promoter. The present invention is not limited to vectors containing a particular promoter. Indeed, a variety of promoters are contemplated. In some embodiments of the present invention, the promoter is selected from the group consisting of the alpha-lactalbumin promoter, cytomegalovirus promoter and the long terminal repeat of Moloney murine leukemia virus. In other preferred embodiments, the integrating vectors further comprise a secretion signal operably linked to the exogenous gene. In still other embodiments, the integrating vectors further comprise an RNA export element operably linked to the exogenous gene.
[0011]The present invention is not limited to a particular integrating vector. Indeed, a variety of integrating vectors are contemplated. In some embodiments of the present invention, the integrating vector is selected from the group consisting of a retroviral vector, a lentiviral vector, and a transposon vector. In some preferred embodiments, the retroviral vector is a pseudotyped retroviral vector. In other preferred embodiments, the pseudotyped retroviral vector comprises a G glycoprotein. The retroviral vectors of the present invention are not limited to a particular G glycoprotein. Indeed, a variety of G glycoproteins are contemplated. In some particularly preferred embodiments, the G glycoprotein is selected from the group consisting of vesicular stomatitis virus, Piry virus, Chandipura virus, Spring viremia of carp virus and Mokola virus G glycoproteins. In still further embodiments, the retroviral vector comprises long terminal repeats. The retroviral vectors of the present invention are not limited to a particular LTR. Indeed, a variety of LTRs are contemplated, including, but not limited to MoMLV, MoMuSV, MMTV long terminal repeats.
[0012]In other embodiments, the retroviral vector is a lentiviral vector. In some preferred embodiments, the lentiviral vector is pseudotyped. In some particularly preferred embodiments, the lentiviral vector comprises a G glycoprotein. In still further embodiments, the G glycoprotein is selected from the group consisting of vesicular stomatitis virus, Piry virus, Chandipura virus, Spring viremia of carp virus and Mokola virus G glycoproteins. In still other embodiments, the lentiviral vector comprises long terminal repeats selected from the group consisting of HIV and equine infectious anemia long terminal repeats.
[0013]In still further embodiments of the present invention, the integrating vector is a transposon vector. In some preferred embodiments, the transposon vector is selected from Tn5, Tn7, and Tn10 transposon vectors.
[0014]The present invention is not limited to a particular host cell. Indeed, a variety of host cells are contemplated. In some embodiments of the present invention, the host cell is cultured in vitro. In still further embodiments of the present invention, the host cell is selected from chinese hamster ovary cells, baby hamster kidney cells, and bovine mammary epithelial cells. In some preferred embodiments, the host cells are clonally derived. In other embodiments, the host cells are non-clonally derived. In some embodiments, the genome of the host cell is stable for greater than 10 passages. In other embodiments, the genome is stable for greater than 50 passages, while in still other embodiments, the genome is stable for greater than 100 passages. In still other embodiments, the host cells can be an embryonic stem cell, oocyte, or embryo. In some embodiments, the integrated vector is stable in the absence of selection.
[0015]The present invention is not limited to vectors encoding a particular protein of interest. Indeed, vectors encoding a variety of proteins of interest encoded by exogenous genes are contemplated. In some embodiments, the protein of interest is selected from hepatitis B surface antigen, MN14 antibody, LL2 antibody, botulinum toxin antibody and cc49IL2. In some embodiments, the genes encoding the protein of interest are intronless, while in other embodiments, the genes encoding the protein of interest include at least one intron.
[0016]The present invention also provides a method for transfecting or transducing host cells comprising: 1) providing: a) a host cell comprising a genome, and b) a plurality of integrating vectors; and 2) contacting the host cell with the plurality of integrating vectors under conditions such that at least two integrating vectors integrate into the genome of the host cell. In some embodiments, the conditions comprise contacting the host cells at a multiplicity of infection of greater than 10. In other embodiments, the conditions comprise contacting the host cells at a multiplicity of infection of from about 10 to 1,000,000. In still further embodiments, the conditions comprise contacting the host cells at a multiplicity of infection of from about 100 to 10,000. In still further embodiments, the conditions comprise contacting the host cells at a multiplicity of infection of from about 100 to 1,000. In still other embodiments of the present invention, the method further comprises transfecting said host cells with at least two integrating vectors, each of said two integrating comprising a different exogenous gene. In still other embodiments, the conditions comprise serial transfection or transduction or host cells wherein the host cells are transfected or transduced in at least a first transfection or transduction with a vector encoding a protein of interest and then re-transfected or re-transduced in a separate transfection or transduction step.
[0017]The present invention further provides a method of producing a protein of interest comprising: 1) providing a host cell comprising a genome, the genome comprising at least two integrated copies of at least one integrating vector comprising an exogenous gene operably linked to a promotor, wherein the exogenous gene encodes a protein of interest, and 2) culturing the host cells under conditions such that the protein of interest is produced. In some preferred embodiments, the integrating vector further comprises a secretion signal sequence operably linked to said exogenous gene. In other embodiments, the methods further comprise step 3) isolating the protein of interest. The present invention is not limited to any particular culture system. Indeed, a variety of culture systems are contemplated, including, but not limited to roller bottle cultures, perfusion cultures, batch fed cultures, and petri dish cultures. In some embodiments, the cell line is clonally selected, while in other embodiments, the cells are non-clonally selected.
[0018]The methods of the present invention are not limited to host cells containing any particular number of integrated integrating vectors. Indeed, in some embodiments, the genome of the host cell comprises greater than 3 integrated copies of the integrating vector; in other embodiments, genome of the host cell comprises greater than 4 integrated copies of the integrating vector.; in still other embodiments, the genome of the host cell comprises greater than 5 integrated copies of the integrating vector; in further embodiments, the genome of the host cell comprises greater than 7 integrated copies of the integrating vector; while in still further embodiments, the genome of the host cell comprises greater than 10 integrated copies of the integrating vector. In other embodiments, the genome of the host cell comprises between about 2 and 20 integrated copies of the integrating vector. In some embodiments, the genome of the host cell comprises between about 3 and 10 integrated copies of the integrating vector.
[0019]The methods of the present invention are not limited to any particular integrating vector. Indeed, the use of a variety of integrating vectors is contemplated. In some embodiments, the integrating vector is a retroviral vector. In some preferred embodiments, the retroviral vector is a pseudotyped retroviral vector. In other embodiments, the retroviral vector is a lentiviral vector.
[0020]The methods of the present invention are not limited to the use of any particular host cell. Indeed, the use of a variety of host cells is contemplated, including, but not limited to, Chinese hamster ovary cells, baby hamster kidney cells, bovine mammary epithelial cells, oocytes, embryos, stem cells, and embryonic stem cells.
[0021]The methods of the present invention are not limited to the production of any particular amount of exogenous protein (i.e., protein of interest) from the host cells. Indeed, it is contemplated that a variety of expression levels are acceptable from the methods of the present invention. In some embodiments, the host cells synthesize greater than about 1 picogram per cell per day of the protein of interest. In other embodiments, the host cells synthesize greater than about 10 picograms per cell per day of the protein of interest. In still further embodiments, the host cells synthesize greater than about 50 picograms per cell per day of the protein of interest.
[0022]In other embodiments, the present invention provides a method for screening compounds comprising: 1) providing a) a host cell comprising a genome, the genome comprising at least two integrated copies of at least one integrating vector comprising an exogenous gene operably linked to a promotor, wherein the exogenous gene encodes a protein of interest; and b) one or more test compounds; 2) culturing the host cells under conditions such that the protein of interest is expressed; 3) treating the host cells with one or more test compounds; and 4) assaying for the presence or absence of a response in the host cells to the test compound. In some embodiments of the present invention, the exogenous gene encodes a protein selected from the group consisting of reporter proteins, membrane receptor proteins, nucleic acid binding proteins, cytoplasmic receptor proteins, ion channel proteins, signal transduction proteins, protein kinases, protein phosphatases, and proteins encoded by oncogenes.
[0023]In still further embodiments, the host cell further comprises a reporter gene. In some particularly preferred embodiments, the reporter gene is selected from the group consisting of green fluorescent protein, luciferase, beta-galactosidase, and beta-lactamase. In some embodiments, the assaying step further comprises detecting a signal from the reporter gene. In other embodiments, the genome of the host cell comprises at least two integrating vectors, each comprising a different exogenous gene.
[0024]In still other embodiments, the present invention provides methods for comparing protein activity comprising: 1) providing a) a first host cell comprising a first integrating vector comprising a promoter operably to a first exogenous gene, wherein the first exogenous gene encodes a first protein of interest, and b) at least a second host cell comprising a second integrating vector comprising a promoter operably linked to a second exogenous gene, wherein the second exogenous gene encodes a second exogenous gene that is a variant of the first protein of interest; 2) culturing the host cells under conditions such that the first and second proteins of interest are produced; and 3) comparing the activities of the first and second proteins of interest.
[0025]In some embodiments, the exogenous gene encodes a protein selected from the group consisting of membrane receptor proteins, nucleic acid binding proteins, cytoplasmic receptor proteins, ion channel proteins, signal transduction proteins, protein kinases, protein phosphatases, cell cycle proteins, and proteins encoded by oncogenes. In other embodiments, the first and second proteins of interest differ by a single amino acid. In still further embodiments, the first and second proteins of interest are greater than 95% identical, preferably greater than 90% identical, and most preferably greater than 80% identical.
[0026]In other embodiments, the present invention provides methods comprising: 1) providing: a) a host cell comprising a genome comprising at least one integrated exogenous gene; and b) a plurality of integrating vectors; and 2) contacting the host cell with the plurality of integrating vectors under conditions such that at least two of the integrating vectors integrate into the genome of the host cell. In some embodiments, the integrated exogenous gene comprises an integrating vector. In other embodiments, the host cell is clonally selected. In alternative embodiments, the host cell is non-clonally selected.
[0027]In still further embodiments, the present invention provides methods of indirectly detecting the expression of a protein of interest comprising providing a host cell transfected with a vector encoding a polycistronic sequence, wherein the polycistronic sequence comprises a signal protein and a protein of interest operably linked by an IRES, and culturing the host cells under conditions such that the signal protein and protein of interest are produced, wherein the presence of the signal protein indicates the presence of the protein of interest. The methods of the present invention are not limited to the expression of any particular protein of interest. Indeed, the expression of a variety of proteins of interest is contemplated, including, but not limited to, G-protein coupled receptors. The present invention is not limited to the use of any particular signal protein. Indeed, the use of variety of signal proteins is contemplated, including, but not limited to, immunoglobulin heavy and light chains, beta-galactosidase, beta-lactamase, green fluorescent protein, and luciferase. In particularly preferred embodiments, expression of the signal protein and protein of interest is driven by the same promoter and the signal protein and protein of interest are transcribed as a single transcriptional unit.
DESCRIPTION OF THE FIGURES
[0028]FIG. 1 is a western blot of a 15% SDS-PAGE gel run under denaturing conditions and probed with anti-human IgG (Fc) and anti-human IgG (Kappa).
[0029]FIG. 2 is a graph of MN14 expression over time.
[0030]FIG. 3 is a Western blot of a 15% PAGE run under non-denaturing conditions and probed with anti-human IgG (Fc) and anti-human IgG (Kappa).
[0031]FIG. 4 provides the sequence for the hybrid human-bovine alpha-lactalbumin promoter (SEQ ID NO:1).
[0032]FIG. 5 provides the sequence for the mutated PPE sequence (SEQ ID NO:2).
[0033]FIG. 6 provides the sequence for the IRES-Signal peptide sequence (SEQ ID NO:3).
[0034]FIGS. 7a and 7b provide the sequence for CMV MN14 vector (SEQ ID NO:4).
[0035]FIGS. 8a and 8b provide the sequence for the CMV LL2 vector (SEQ ID NO:5).
[0036]FIGS. 9a-c provide the sequence for the MMTV MN14 vector (SEQ ID NO:6).
[0037]FIGS. 10a-d provide the sequence for the alpha-lactalbumin MN14 Vector (SEQ ID NO:7).
[0038]FIGS. 11a-c provide the sequence for the alpha-lactalbumin Bot vector (SEQ ID NO:8).
[0039]FIGS. 12a-b provide the sequence for the LSRNL vector (SEQ ID NO:9).
[0040]FIGS. 13a-b provide the sequence for the alpha-lactalbumin cc49IL2 vector (SEQ ID NO:10).
[0041]FIGS. 14a-c provides the sequence for the alpha-lactalbumin YP vector (SEQ ID NO:11).
[0042]FIG. 15 provides the sequence for the IRES-Casein signal peptide sequence (SEQ ID NO:12).
[0043]FIGS. 16a-c provide the sequence for the LNBOTDC vector (SEQ ID NO:13).
[0044]FIG. 17 provides a graph depicting the INVADER Assay gene ratio in CMV promoter cell lines.
[0045]FIG. 18 provides a graph depicting the INVADER Assay gene ratio in α-lactalbumin promotor cell lines.
[0046]FIGS. 19a-d provide the sequence of a retroviral vector that expresses a G-Protein coupled receptor and antibody light chain.
DEFINITIONS
[0047]To facilitate understanding of the invention, a number of terms are defined below.
[0048]As used herein, the term "host cell" refers to any eukaryotic cell (e.g., mammalian cells, avian cells, amphibian cells, plant cells, fish cells, and insect cells), whether located in vitro or in vivo.
[0049]As used herein, the term "cell culture" refers to any in vitro culture of cells. Included within this term are continuous cell lines (e.g., with an immortal phenotype), primary cell cultures, finite cell lines (e.g., non-transformed cells), and any other cell population maintained in vitro, including oocytes and embryos.
[0050]As used herein, the term "vector" refers to any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc., which is capable of replication when associated with the proper control elements and which can transfer gene sequences between cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors.
[0051]As used herein, the term "integrating vector" refers to a vector whose integration or insertion into a nucleic acid (e.g., a chromosome) is accomplished via an integrase. Examples of "integrating vectors" include, but are not limited to, retroviral vectors, transposons, and adeno associated virus vectors.
[0052]As used herein, the term "integrated" refers to a vector that is stably inserted into the genome (i.e., into a chromosome) of a host cell.
[0053]As used herein, the term "multiplicity of infection" or "MOI" refers to the ratio of integrating vectors:host cells used during transfection or transduction of host cells. For example, if 1,000,000 vectors are used to transduce 100,000 host cells, the multiplicity of infection is 10. The use of this term is not limited to events involving transduction, but instead encompasses introduction of a vector into a host by methods such as lipofection, microinjection, calcium phosphate precipitation, and electroporation.
[0054]As used herein, the term "genome" refers to the genetic material (e.g., chomosomes) of an organism.
[0055]The term "nucleotide sequence of interest" refers to any nucleotide sequence (e.g., RNA or DNA), the manipulation of which may be deemed desirable for any reason (e.g., treat disease, confer improved qualities, expression of a protein of interest in a host cell, expression of a ribozyme, etc.), by one of ordinary skill in the art. Such nucleotide sequences include, but are not limited to, coding sequences of structural genes (e.g., reporter genes, selection marker genes, oncogenes, drug resistance genes, growth factors, etc.), and non-coding regulatory sequences which do not encode an mRNA or protein product (e.g., promoter sequence, polyadenylation sequence, termination sequence, enhancer sequence, etc.).
[0056]As used herein, the term "protein of interest" refers to a protein encoded by a nucleic acid of interest.
[0057]As used herein, the term "signal protein" refers to a protein that is co-expressed with a protein of interest and which, when detected by a suitable assay, provides indirect evidence of expression of the protein of interest. Examples of signal protein useful in the present invention include, but are not limited to, immunoglobulin heavy and light chains, beta-galactosidase, beta-lactamase, green fluorescent protein, and luciferase.
[0058]As used herein, the term "exogenous gene" refers to a gene that is not naturally present in a host organism or cell, or is artificially introduced into a host organism or cell.
[0059]The term "gene" refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises coding sequences necessary for the production of a polypeptide or precursor (e.g., proinsulin). The polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, etc.) of the full-length or fragment are retained. The term also encompasses the coding region of a structural gene and includes sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb or more on either end such that the gene corresponds to the length of the full-length mRNA. The sequences that are located 5' of the coding region and which are present on the mRNA are referred to as 5' untranslated sequences. The sequences that are located 3' or downstream of the coding region and which are present on the mRNA are referred to as 3' untranslated sequences. The term "gene" encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed "introns" or "intervening regions" or "intervening sequences." Introns are segments of a gene which are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or "spliced out" from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.
[0060]As used herein, the term "gene expression" refers to the process of converting genetic information encoded in a gene into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through "transcription" of the gene (i.e., via the enzymatic action of an RNA polymerase), and for protein encoding genes, into protein through "translation" of mRNA. Gene expression can be regulated at many stages in the process. "Up-regulation" or "activation" refers to regulation that increases the production of gene expression products (i.e., RNA or protein), while "down-regulation" or "repression" refers to regulation that decrease production. Molecules (e.g., transcription factors) that are involved in up-regulation or down-regulation are often called "activators" and "repressors," respectively.
[0061]Where "amino acid sequence" is recited herein to refer to an amino acid sequence of a naturally occurring protein molecule, "amino acid sequence" and like terms, such as "polypeptide" or "protein" are not meant to limit the amino acid sequence to the complete, native amino acid sequence associated with the recited protein molecule.
[0062]As used herein, the terms "nucleic acid molecule encoding," "DNA sequence encoding," "DNA encoding," "RNA sequence encoding," and "RNA encoding" refer to the order or sequence of deoxyribonucleotides or ribonucleotides along a strand of deoxyribonucleic acid or ribonucleic acid. The order of these deoxyribonucleotides or ribonucleotides determines the order of amino acids along the polypeptide (protein) chain. The DNA or RNA sequence thus codes for the amino acid sequence.
[0063]As used herein, the term "variant," when used in reference to a protein, refers to proteins encoded by partially homologous nucleic acids so that the amino acid sequence of the proteins varies. As used herein, the term "variant" encompasses proteins encoded by homologous genes having both conservative and nonconservative amino acid substitutions that do not result in a change in protein function, as well as proteins encoded by homologous genes having amino acid substitutions that cause decreased (e.g., null mutations) protein function or increased protein function.
[0064]As used herein, the terms "complementary" or "complementarity" are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, for the sequence "A-G-T," is complementary to the sequence "T-C-A." Complementarity may be "partial," in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be "complete" or "total" complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids.
[0065]The terms "homology" and "percent identity" when used in relation to nucleic acids refers to a degree of complementarity. There may be partial homology (i.e., partial identity) or complete homology (i.e., complete identity). A partially complementary sequence is one that at least partially inhibits a completely complementary sequence from hybridizing to a target nucleic acid sequence and is referred to using the functional term "substantially homologous." The inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or Northern blot, solution hybridization and the like) under conditions of low stringency. A substantially homologous sequence or probe (i.e., an oligonucleotide which is capable of hybridizing to another oligonucleotide of interest) will compete for and inhibit the binding (i.e., the hybridization) of a completely homologous sequence to a target sequence under conditions of low stringency. This is not to say that conditions of low stringency are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction. The absence of non-specific binding may be tested by the use of a second target which lacks even a partial degree of complementarity (e.g., less than about 30% identity); in the absence of non-specific binding the probe will not hybridize to the second non-complementary target.
[0066]The art knows well that numerous equivalent conditions may be employed to comprise low stringency conditions; factors such as the length and nature (DNA, RNA, base composition) of the probe and nature of the target (DNA, RNA, base composition, present in solution or immobilized, etc.) and the concentration of the salts and other components (e.g., the presence or absence of formamide, dextran sulfate, polyethylene glycol) are considered and the hybridization solution may be varied to generate conditions of low stringency hybridization different from, but equivalent to, the above listed conditions. In addition, the art knows conditions that promote hybridization under conditions of high stringency (e.g., increasing the temperature of the hybridization and/or wash steps, the use of formamide in the hybridization solution, etc.).
[0067]When used in reference to a double-stranded nucleic acid sequence such as a cDNA or genomic clone, the term "substantially homologous" refers to any probe that can hybridize to either or both strands of the double-stranded nucleic acid sequence under conditions of low stringency as described above.
[0068]When used in reference to a single-stranded nucleic acid sequence, the term "substantially homologous" refers to any probe that can hybridize (i.e., it is the complement of) the single-stranded nucleic acid sequence under conditions of low stringency as described above.
[0069]As used herein, the term "hybridization" is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is impacted by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, the Tm of the formed hybrid, and the G:C ratio within the nucleic acids. A single molecule that contains pairing of complementary nucleic acids within its structure is said to be "self-hybridized."
[0070]As used herein, the term "Tm" is used in reference to the "melting temperature" of a nucleic acid. The melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands. The equation for calculating the Tm of nucleic acids is well known in the art. As indicated by standard references, a simple estimate of the Tm value may be calculated by the equation: Tm=81.5+0.41 (% G+C), when a nucleic acid is in aqueous solution at 1 M NaCl (See e.g., Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization [1985]). Other references include more sophisticated computations that take structural as well as sequence characteristics into account for the calculation of Tm.
[0071]As used herein the term "stringency" is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds such as organic solvents, under which nucleic acid hybridizations are conducted. With "high stringency" conditions, nucleic acid base pairing will occur only between nucleic acid fragments that have a high frequency of complementary base sequences. Thus, conditions of "weak" or "low" stringency are often required with nucleic acids that are derived from organisms that are genetically diverse, as the frequency of complementary sequences is usually less.
[0072]High stringency conditions" when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42° C. in a solution consisting of 5×SSPE (43.8 g/l NaCl, 6.9 g/l NaH2PO4.H2O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5×Denhardt's reagent and 100 μg/ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1×SSPE, 1.0% SDS at 42° C. when a probe of about 500 nucleotides in length is employed.
[0073]Medium stringency conditions" when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42° C. in a solution consisting of 5×SSPE (43.8 g/l NaCl, 6.9 g/l NaH2PO4.H2O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5×Denhardt's reagent and 100 μg/ml denatured salmon sperm DNA followed by washing in a solution comprising 1.0×SSPE, 1.0% SDS at 42° C. when a probe of about 500 nucleotides in length is employed.
[0074]Low stringency conditions" comprise conditions equivalent to binding or hybridization at 42° C. in a solution consisting of 5×SSPE (43.8 g/l NaCl, 6.9 g/l NaH2PO4.H2O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDS, 5×Denhardt's reagent [50×Denhardt's contains per 500 ml: 5 g Ficoll (Type 400, Pharamcia), 5 g BSA (Fraction V; Sigma)] and 100 μg/ml denatured salmon sperm DNA followed by washing in a solution comprising 5×SSPE, 0.1% SDS at 42° C. when a probe of about 500 nucleotides in length is employed.
[0075]A gene may produce multiple RNA species that are generated by differential splicing of the primary RNA transcript. cDNAs that are splice variants of the same gene will contain regions of sequence identity or complete homology (representing the presence of the same exon or portion of the same exon on both cDNAs) and regions of complete non-identity (for example, representing the presence of exon "A" on cDNA 1 wherein cDNA 2 contains exon "B" instead). Because the two cDNAs contain regions of sequence identity they will both hybridize to a probe derived from the entire gene or portions of the gene containing sequences found on both cDNAs; the two splice variants are therefore substantially homologous to such a probe and to each other.
[0076]The terms "in operable combination," "in operable order," and "operably linked" as used herein refer to the linkage of nucleic acid sequences in such a manner that a nucleic acid molecule capable of directing the transcription of a given gene and/or the synthesis of a desired protein molecule is produced. The term also refers to the linkage of amino acid sequences in such a manner so that a functional protein is produced.
[0077]As used herein, the term "selectable marker" refers to a gene that encodes an enzymatic activity that confers the ability to grow in medium lacking what would otherwise be an essential nutrient (e.g. the HIS3 gene in yeast cells); in addition, a selectable marker may confer resistance to an antibiotic or drug upon the cell in which the selectable marker is expressed. Selectable markers may be "dominant"; a dominant selectable marker encodes an enzymatic activity that can be detected in any eukaryotic cell line. Examples of dominant selectable markers include the bacterial aminoglycoside 3' phosphotransferase gene (also referred to as the neo gene) that confers resistance to the drug G418 in mammalian cells, the bacterial hygromycin G phosphotransferase (hyg) gene that confers resistance to the antibiotic hygromycin and the bacterial xanthine-guanine phosphoribosyl transferase gene (also referred to as the gpt gene) that confers the ability to grow in the presence of mycophenolic acid. Other selectable markers are not dominant in that their use must be in conjunction with a cell line that lacks the relevant enzyme activity. Examples of non-dominant selectable markers include the thymidine kinase (tk) gene that is used in conjunction with tk.sup.- cell lines, the CAD gene which is used in conjunction with CAD-deficient cells and the mammalian hypoxanthine-guanine phosphoribosyl transferase (hprt) gene which is used in conjunction with hprt.sup.- cell lines. A review of the use of selectable markers in mammalian cell lines is provided in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York (1989) pp. 16.9-16.15.
[0078]As used herein, the term "regulatory element" refers to a genetic element which controls some aspect of the expression of nucleic acid sequences. For example, a promoter is a regulatory element that facilitates the initiation of transcription of an operably linked coding region. Other regulatory elements are splicing signals, polyadenylation signals, termination signals, RNA export elements, internal ribosome entry sites, etc. (defined infra).
[0079]Transcriptional control signals in eukaryotes comprise "promoter" and "enhancer" elements. Promoters and enhancers consist of short arrays of DNA sequences that interact specifically with cellular proteins involved in transcription (Maniatis et al., Science 236:1237 [1987]). Promoter and enhancer elements have been isolated from a variety of eukaryotic sources including genes in yeast, insect and mammalian cells, and viruses (analogous control elements, i.e., promoters, are also found in prokaryotes). The selection of a particular promoter and enhancer depends on what cell type is to be used to express the protein of interest. Some eukaryotic promoters and enhancers have a broad host range while others are functional in a limited subset of cell types (for review see, Voss et al., Trends Biochem. Sci., 11:287 [1986]; and Maniatis et al., supra). For example, the SV40 early gene enhancer is very active in a wide variety of cell types from many mammalian species and has been widely used for the expression of proteins in mammalian cells (Dijkema et al., EMBO J. 4:761 [1985]). Two other examples of promoter/enhancer elements active in a broad range of mammalian cell types are those from the human elongation factor 1α gene (Uetsuki et al., J. Biol. Chem., 264:5791 [1989]; Kim et al., Gene 91:217 [1990]; and Mizushima and Nagata, Nuc. Acids. Res., 18:5322 [1990]) and the long terminal repeats of the Rous sarcoma virus (Gorman et al., Proc. Natl. Acad. Sci. USA 79:6777 [1982]) and the human cytomegalovirus (Boshart et al., Cell 41:521 [1985]).
[0080]As used herein, the term "promoter/enhancer" denotes a segment of DNA which contains sequences capable of providing both promoter and enhancer functions (i.e., the functions provided by a promoter element and an enhancer element, see above for a discussion of these functions). For example, the long terminal repeats of retroviruses contain both promoter and enhancer functions. The enhancer/promoter may be "endogenous" or "exogenous" or "heterologous." An "endogenous" enhancer/promoter is one which is naturally linked with a given gene in the genome. An "exogenous" or "heterologous" enhancer/promoter is one which is placed in juxtaposition to a gene by means of genetic manipulation (i.e., molecular biological techniques such as cloning and recombination) such that transcription of that gene is directed by the linked enhancer/promoter.
[0081]Regulatory elements may be tissue specific or cell specific. The term "tissue specific" as it applies to a regulatory element refers to a regulatory element that is capable of directing selective expression of a nucleotide sequence of interest to a specific type of tissue (e.g., liver) in the relative absence of expression of the same nucleotide sequence of interest in a different type of tissue (e.g., lung).
[0082]Tissue specificity of a regulatory element may be evaluated by, for example, operably linking a reporter gene to a promoter sequence (which is not tissue-specific) and to the regulatory element to generate a reporter construct, introducing the reporter construct into the genome of an animal such that the reporter construct is integrated into every tissue of the resulting transgenic animal, and detecting the expression of the reporter gene (e.g., detecting mRNA, protein, or the activity of a protein encoded by the reporter gene) in different tissues of the transgenic animal. The detection of a greater level of expression of the reporter gene in one or more tissues relative to the level of expression of the reporter gene in other tissues shows that the regulatory element is "specific" for the tissues in which greater levels of expression are detected. Thus, the term "tissue-specific" (e.g., liver-specific) as used herein is a relative term that does not require absolute specificity of expression. In other words, the term "tissue-specific" does not require that one tissue have extremely high levels of expression and another tissue have no expression. It is sufficient that expression is greater in one tissue than another. By contrast, "strict" or "absolute" tissue-specific expression is meant to indicate expression in a single tissue type (e.g., liver) with no detectable expression in other tissues.
[0083]The term "cell type specific" as applied to a regulatory element refers to a regulatory element which is capable of directing selective expression of a nucleotide sequence of interest in a specific type of cell in the relative absence of expression of the same nucleotide sequence of interest in a different type of cell within the same tissue. The term "cell type specific" when applied to a regulatory element also means a regulatory element capable of promoting selective expression of a nucleotide sequence of interest in a region within a single tissue.
[0084]Cell type specificity of a regulatory element may be assessed using methods well known in the art (e.g., immunohistochemical staining and/or Northern blot analysis). Briefly, for immunohistochemical staining, tissue sections are embedded in paraffin, and paraffin sections are reacted with a primary antibody specific for the polypeptide product encoded by the nucleotide sequence of interest whose expression is regulated by the regulatory element. A labeled (e.g., peroxidase conjugated) secondary antibody specific for the primary antibody is allowed to bind to the sectioned tissue and specific binding detected (e.g., with avidin/biotin) by microscopy. Briefly, for Northern blot analysis, RNA is isolated from cells and electrophoresed on agarose gels to fractionate the RNA according to size followed by transfer of the RNA from the gel to a solid support (e.g., nitrocellulose or a nylon membrane). The immobilized RNA is then probed with a labeled oligo-deoxyribonucleotide probe or DNA probe to detect RNA species complementary to the probe used. Northern blots are a standard tool of molecular biologists.
[0085]The term "promoter," "promoter element," or "promoter sequence" as used herein, refers to a DNA sequence which when ligated to a nucleotide sequence of interest is capable of controlling the transcription of the nucleotide sequence of interest into mRNA. A promoter is typically, though not necessarily, located 5' (i.e., upstream) of a nucleotide sequence of interest whose transcription into mRNA it controls, and provides a site for specific binding by RNA polymerase and other transcription factors for initiation of transcription.
[0086]Promoters may be constitutive or regulatable. The term "constitutive" when made in reference to a promoter means that the promoter is capable of directing transcription of an operably linked nucleic acid sequence in the absence of a stimulus (e.g., heat shock, chemicals, etc.). In contrast, a "regulatable" promoter is one which is capable of directing a level of transcription of an operably linked nucleic acid sequence in the presence of a stimulus (e.g., heat shock, chemicals, etc.) which is different from the level of transcription of the operably linked nucleic acid sequence in the absence of the stimulus.
[0087]The presence of "splicing signals" on an expression vector often results in higher levels of expression of the recombinant transcript. Splicing signals mediate the removal of introns from the primary RNA transcript and consist of a splice donor and acceptor site (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York [1989], pp. 16.7-16.8). A commonly used splice donor and acceptor site is the splice junction from the 16S RNA of SV40.
[0088]Efficient expression of recombinant DNA sequences in eukaryotic cells requires expression of signals directing the efficient termination and polyadenylation of the resulting transcript. Transcription termination signals are generally found downstream of the polyadenylation signal and are a few hundred nucleotides in length. The term "poly A site" or "poly A sequence" as used herein denotes a DNA sequence that directs both the termination and polyadenylation of the nascent RNA transcript. Efficient polyadenylation of the recombinant transcript is desirable as transcripts lacking a poly A tail are unstable and are rapidly degraded. The poly A signal utilized in an expression vector may be "heterologous" or "endogenous." An endogenous poly A signal is one that is found naturally at the 3' end of the coding region of a given gene in the genome. A heterologous poly A signal is one that is isolated from one gene and placed 3' of another gene. A commonly used heterologous poly A signal is the SV40 poly A signal. The SV40 poly A signal is contained on a 237 bp BamHI/BclI restriction fragment and directs both termination and polyadenylation (Sambrook, supra, at 16.6-16.7).
[0089]Eukaryotic expression vectors may also contain "viral replicons" or "viral origins of replication." Viral replicons are viral DNA sequences that allow for the extrachromosomal replication of a vector in a host cell expressing the appropriate replication factors. Vectors that contain either the SV40 or polyoma virus origin of replication replicate to high "copy number" (up to 104 copies/cell) in cells that express the appropriate viral T antigen. Vectors that contain the replicons from bovine papillomavirus or Epstein-Barr virus replicate extrachromosomally at "low copy number" (˜100 copies/cell). However, it is not intended that expression vectors be limited to any particular viral origin of replication.
[0090]As used herein, the term "long terminal repeat" of "LTR" refers to transcriptional control elements located in or isolated from the U3 region 5' and 3' of a retroviral genome. As is known in the art, long terminal repeats may be used as control elements in retroviral vectors, or isolated from the retroviral genome and used to control expression from other types of vectors.
[0091]As used herein, the term "secretion signal" refers to any DNA sequence which when operably linked to a recombinant DNA sequence encodes a signal peptide which is capable of causing the secretion of the recombinant polypeptide. In general, the signal peptides comprise a series of about 15 to 30 hydrophobic amino acid residues (See, e.g., Zwizinski et al., J. Biol. Chem. 255(16): 7973-77 [1980], Gray et al., Gene 39(2): 247-54 [1985], and Martial et al., Science 205: 602-607 [1979]). Such secretion signal sequences are preferably derived from genes encoding polypeptides secreted from the cell type targeted for tissue-specific expression (e.g., secreted milk proteins for expression in and secretion from mammary secretory cells). Secretory DNA sequences, however, are not limited to such sequences. Secretory DNA sequences from proteins secreted from many cell types and organisms may also be used (e.g., the secretion signals for t-PA, serum albumin, lactoferrin, and growth hormone, and secretion signals from microbial genes encoding secreted polypeptides such as from yeast, filamentous fungi, and bacteria).
[0092]As used herein, the terms "RNA export element" or "Pre-mRNA Processing Enhancer (PPE)" refer to 3' and 5' cis-acting post-transcriptional regulatory elements that enhance export of RNA from the nucleus. "PPE" elements include, but are not limited to Mertz sequences (described in U.S. Pat. Nos. 5,914,267 and 5,686,120, all of which are incorporated herein by reference) and woodchuck mRNA processing enhancer (WPRE; WO99/14310 and U.S. Pat. No. 6,136,597, each of which is incorporated herein by reference).
[0093]As used herein, the term "polycistronic" refers to an mRNA encoding more than polypeptide chain (See, e.g., WO 93/03143, WO 88/05486, and European Pat. No. 117058, all of which are incorporated herein by reference). Likewise, the term "arranged in polycistronic sequence" refers to the arrangement of genes encoding two different polypeptide chains in a single mRNA.
[0094]As used herein, the term "internal ribosome entry site" or "IRES" refers to a sequence located between polycistronic genes that permits the production of the expression product originating from the second gene by internal initiation of the translation of the dicistronic mRNA. Examples of internal ribosome entry sites include, but are not limited to, those derived from foot and mouth disease virus (FDV), encephalomyocarditis virus, poliovirus and RDV (Scheper et al., Biochem. 76: 801-809 [1994]; Meyer et al., J. Virol. 69: 2819-2824 [1995]; Jang et al., 1988, J. Virol. 62: 2636-2643 [1998]; Haller et al., J. Virol. 66: 5075-5086 [1995]). Vectors incorporating IRES's may be assembled as is known in the art. For example, a retroviral vector containing a polycistronic sequence may contain the following elements in operable association: nucleotide polylinker, gene of interest, an internal ribosome entry site and a mammalian selectable marker or another gene of interest. The polycistronic cassette is situated within the retroviral vector between the 5' LTR and the 3' LTR at a position such that transcription from the 5' LTR promoter transcribes the polycistronic message cassette. The transcription of the polycistronic message cassette may also be driven by an internal promoter (e.g., cytomegalovirus promoter) or an inducible promoter, which may be preferable depending on the use. The polycistronic message cassette can further comprise a cDNA or genomic DNA (gDNA) sequence operatively associated within the polylinker. Any mammalian selectable marker can be utilized as the polycistronic message cassette mammalian selectable marker. Such mammalian selectable markers are well known to those of skill in the art and can include, but are not limited to, kanamycin/G418, hygromycin B or mycophenolic acid resistance markers.
[0095]As used herein, the term "retrovirus" refers to a retroviral particle which is capable of entering a cell (i.e., the particle contains a membrane-associated protein such as an envelope protein or a viral G glycoprotein which can bind to the host cell surface and facilitate entry of the viral particle into the cytoplasm of the host cell) and integrating the retroviral genome (as a double-stranded provirus) into the genome of the host cell. The term "retrovirus" encompasses Oncovirinae (e.g., Moloney murine leukemia virus (MoMOLV), Moloney murine sarcoma virus (MoMSV), and Mouse mammary tumor virus (MMTV), Spumavirinae, amd Lentivirinae (e.g., Human immunodeficiency virus, Simian immunodeficiency virus, Equine infection anemia virus, and Caprine arthritis-encephalitis virus; See, e.g., U.S. Pat. Nos. 5,994,136 and 6,013,516, both of which are incorporated herein by reference).
[0096]As used herein, the term "retroviral vector" refers to a retrovirus that has been modified to express a gene of interest. Retroviral vectors can be used to transfer genes efficiently into host cells by exploiting the viral infectious process. Foreign or heterologous genes cloned (i.e., inserted using molecular biological techniques) into the retroviral genome can be delivered efficiently to host cells which are susceptible to infection by the retrovirus. Through well known genetic manipulations, the replicative capacity of the retroviral genome can be destroyed. The resulting replication-defective vectors can be used to introduce new genetic material to a cell but they are unable to replicate. A helper virus or packaging cell line can be used to permit vector particle assembly and egress from the cell. Such retroviral vectors comprise a replication-deficient retroviral genome containing a nucleic acid sequence encoding at least one gene of interest (i.e., a polycistronic nucleic acid sequence can encode more than one gene of interest), a 5' retroviral long terminal repeat (5' LTR); and a 3' retroviral long terminal repeat (3' LTR).
[0097]The term "pseudotyped retroviral vector" refers to a retroviral vector containing a heterologous membrane protein. The term "membrane-associated protein" refers to a protein (e.g., a viral envelope glycoprotein or the G proteins of viruses in the Rhabdoviridae family such as VSV, Piry, Chandipura and Mokola) which are associated with the membrane surrounding a viral particle; these membrane-associated proteins mediate the entry of the viral particle into the host cell. The membrane associated protein may bind to specific cell surface protein receptors, as is the case for retroviral envelope proteins or the membrane-associated protein may interact with a phospholipid component of the plasma membrane of the host cell, as is the case for the G proteins derived from members of the Rhabdoviridae family.
[0098]The term "heterologous membrane-associated protein" refers to a membrane-associated protein which is derived from a virus which is not a member of the same viral class or family as that from which the nucleocapsid protein of the vector particle is derived. "Viral class or family" refers to the taxonomic rank of class or family, as assigned by the International Committee on Taxonomy of Viruses.
[0099]The term "Rhabdoviridae" refers to a family of enveloped RNA viruses that infect animals, including humans, and plants. The Rhabdoviridae family encompasses the genus Vesiculovirus which includes vesicular stomatitis virus (VSV), Cocal virus, Piry virus, Chandipura virus, and Spring viremia of carp virus (sequences encoding the Spring viremia of carp virus are available under GenBank accession number U18101). The G proteins of viruses in the Vesiculovirus genera are virally-encoded integral membrane proteins that form externally projecting homotrimeric spike glycoproteins complexes that are required for receptor binding and membrane fusion. The G proteins of viruses in the Vesiculovirus genera have a covalently bound palmititic acid (C16) moiety. The amino acid sequences of the G proteins from the Vesiculoviruses are fairly well conserved. For example, the Piry virus G protein share about 38% identity and about 55% similarity with the VSV G proteins (several strains of VSV are known, e.g., Indiana, New Jersey, Orsay, San Juan, etc., and their G proteins are highly homologous). The Chandipura virus G protein and the VSV G proteins share about 37% identity and 52% similarity. Given the high degree of conservation (amino acid sequence) and the related functional characteristics (e.g., binding of the virus to the host cell and fusion of membranes, including syncytia formation) of the G proteins of the Vesiculoviruses, the G proteins from non-VSV Vesiculoviruses may be used in place of the VSV G protein for the pseudotyping of viral particles. The G proteins of the Lyssa viruses (another genera within the Rhabdoviridae family) also share a fair degree of conservation with the VSV G proteins and function in a similar manner (e.g., mediate fusion of membranes) and therefore may be used in place of the VSV G protein for the pseudotyping of viral particles. The Lyssa viruses include the Mokola virus and the Rabies viruses (several strains of Rabies virus are known and their G proteins have been cloned and sequenced). The Mokola virus G protein shares stretches of homology (particularly over the extracellular and transmembrane domains) with the VSV G proteins which show about 31% identity and 48% similarity with the VSV G proteins. Preferred G proteins share at least 25% identity, preferably at least 30% identity and most preferably at least 35% identity with the VSV G proteins. The VSV G protein from which New Jersey strain (the sequence of this G protein is provided in GenBank accession numbers M27165 and M21557) is employed as the reference VSV G protein.
[0100]As used herein, the term "lentivirus vector" refers to retroviral vectors derived from the Lentiviridae family (e.g., human immunodeficiency virus, simian immunodeficiency virus, equine infectious anemia virus, and caprine arthritis-encephalitis virus) that are capable of integrating into non-dividing cells (See, e.g., U.S. Pat. Nos. 5,994,136 and 6,013,516, both of which are incorporated herein by reference).
[0101]The term "pseudotyped lentivirus vector" refers to lentivirus vector containing a heterologous membrane protein (e.g., a viral envelope glycoprotein or the G proteins of viruses in the Rhabdoviridae family such as VSV, Piry, Chandipura and Mokola).
[0102]As used herein, the term "transposon" refers to transposable elements (e.g., Tn5, Tn7, and TN10) that can move or transpose from one position to another in a genome. In general, the transposition is controlled by a transposase. The term "transposon vector," as used herein, refers to a vector encoding a nucleic acid of interest flanked by the terminal ends of transposon. Examples of transposon vectors include, but are not limited to, those described in U.S. Pat. Nos. 6,027,722; 5,958,775; 5,968,785; 5,965,443; and 5,719,055, all of which are incorporated herein by reference.
[0103]As used herein, the term "adeno-associated virus (AAV) vector" refers to a vector derived from an adeno-associated virus serotype, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc. AAV vectors can have one or more of the AAV wild-type genes deleted in whole or part, preferably the rep and/or cap genes, but retain functional flanking ITR sequences.
[0104]AAV vectors can be constructed using recombinant techniques that are known in the art to include one or more heterologous nucleotide sequences flanked on both ends (5' and 3') with functional AAV ITRs. In the practice of the invention, an AAV vector can include at least one AAV ITR and a suitable promoter sequence positioned upstream of the heterologous nucleotide sequence and at least one AAV ITR positioned downstream of the heterologous sequence. A "recombinant AAV vector plasmid" refers to one type of recombinant AAV vector wherein the vector comprises a plasmid. As with AAV vectors in general, 5' and 3' ITRs flank the selected heterologous nucleotide sequence.
[0105]AAV vectors can also include transcription sequences such as polyadenylation sites, as well as selectable markers or reporter genes, enhancer sequences, and other control elements which allow for the induction of transcription. Such control elements are described above.
[0106]As used herein, the term "AAV virion" refers to a complete virus particle. An AAV virion may be a wild type AAV virus particle (comprising a linear, single-stranded AAV nucleic acid genome associated with an AAV capsid, i.e., a protein coat), or a recombinant AAV virus particle (described below). In this regard, single-stranded AAV nucleic acid molecules (either the sense/coding strand or the antisense/anticoding strand as those terms are generally defined) can be packaged into an AAV virion; both the sense and the antisense strands are equally infectious.
[0107]As used herein, the term "recombinant AAV virion" or "rAAV" is defined as an infectious, replication-defective virus composed of an AAV protein shell encapsidating (i.e., surrounding with a protein coat) a heterologous nucleotide sequence, which in turn is flanked 5' and 3' by AAV ITRs. A number of techniques for constructing recombinant AAV virions are known in the art (See, e.g., U.S. Pat. No. 5,173,414; WO 92/01070; WO 93/03769; Lebkowski et al., Molec. Cell. Biol. 8:3988-3996 [1988]; Vincent et al., Vaccines 90 [1990] (Cold Spring Harbor Laboratory Press); Carter, Current Opinion in Biotechnology 3:533-539 [1992]; Muzyczka, Current Topics in Microbiol. and Immunol. 158:97-129 [1992]; Kotin, Human Gene Therapy 5:793-801 [1994]; Shelling and Smith, Gene Therapy 1:165-169 [1994]; and Zhou et al., J. Exp. Med. 179:1867-1875 [1994], all of which are incorporated herein by reference).
[0108]Suitable nucleotide sequences for use in AAV vectors (and, indeed, any of the vectors described herein) include any functionally relevant nucleotide sequence. Thus, the AAV vectors of the present invention can comprise any desired gene that encodes a protein that is defective or missing from a target cell genome or that encodes a non-native protein having a desired biological or therapeutic effect (e.g., an antiviral function), or the sequence can correspond to a molecule having an antisense or ribozyme function. Suitable genes include those used for the treatment of inflammatory diseases, autoimmune, chronic and infectious diseases, including such disorders as AIDS, cancer, neurological diseases, cardiovascular disease, hypercholestemia; various blood disorders including various anemias, thalasemias and hemophilia; genetic defects such as cystic fibrosis, Gaucher's Disease, adenosine deaminase (ADA) deficiency, emphysema, etc. A number of antisense oligonucleotides (e.g., short oligonucleotides complementary to sequences around the translational initiation site (AUG codon) of an mRNA) that are useful in antisense therapy for cancer and for viral diseases have been described in the art. (See, e.g., Han et al., Proc. Natl. Acad. Sci. USA 88:4313-4317 [1991]; Uhlmann et al., Chem. Rev. 90:543-584 [1990]; Helene et al., Biochim. Biophys. Acta. 1049:99-125 [1990]; Agarwal et al., Proc. Natl. Acad. Sci. USA 85:7079-7083 [1989]; and Heikkila et al., Nature 328:445-449 [1987]). For a discussion of suitable ribozymes, see, e.g., Cech et al. (1992) J. Biol. Chem. 267:17479-17482 and U.S. Pat. No. 5,225,347, incorporated herein by reference.
[0109]By "adeno-associated virus inverted terminal repeats" or "AAV ITRs" is meant the art-recognized palindromic regions found at each end of the AAV genome which function together in cis as origins of DNA replication and as packaging signals for the virus. For use with the present invention, flanking AAV ITRs are positioned 5' and 3' of one or more selected heterologous nucleotide sequences and, together with the rep coding region or the Rep expression product, provide for the integration of the selected sequences into the genome of a target cell.
[0110]The nucleotide sequences of AAV ITR regions are known (See, e.g., Kotin, Human Gene Therapy 5:793-801 [1994]; Berns, K. I. "Parvoviridae and their Replication" in Fundamental Virology, 2nd Edition, (B. N. Fields and D. M. Knipe, eds.) for the AAV-2 sequence. As used herein, an "AAV ITR" need not have the wild-type nucleotide sequence depicted, but may be altered, e.g., by the insertion, deletion or substitution of nucleotides. Additionally, the AAV ITR may be derived from any of several AAV serotypes, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc. The 5' and 3' ITRs which flank a selected heterologous nucleotide sequence need not necessarily be identical or derived from the same AAV serotype or isolate, so long as they function as intended, i.e., to allow for the integration of the associated heterologous sequence into the target cell genome when the rep gene is present (either on the same or on a different vector), or when the Rep expression product is present in the target cell.
[0111]As used herein the term, the term "in vitro" refers to an artificial environment and to processes or reactions that occur within an artificial environment. In vitro environments can consist of, but are not limited to, test tubes and cell cultures. The term "in vivo" refers to the natural environment (e.g., an animal or a cell) and to processes or reaction that occur within a natural environment.
[0112]As used herein, the term "clonally derived" refers to a cell line that it derived from a single cell.
[0113]As used herein, the term "non-clonally derived" refers to a cell line that is derived from more than one cell.
[0114]As used herein, the term "passage" refers to the process of diluting a culture of cells that has grown to a particular density or confluency (e.g., 70% or 80% confluent), and then allowing the diluted cells to regrow to the particular density or confluency desired (e.g., by replating the cells or establishing a new roller bottle culture with the cells.
[0115]As used herein, the term "stable," when used in reference to genome, refers to the stable maintenance of the information content of the genome from one generation to the next, or, in the particular case of a cell line, from one passage to the next. Accordingly, a genome is considered to be stable if no gross changes occur in the genome (e.g., a gene is deleted or a chromosomal translocation occurs). The term "stable" does not exclude subtle changes that may occur to the genome such as point mutations.
[0116]As used herein, the term "response," when used in reference to an assay, refers to the generation of a detectable signal (e.g., accumulation of reporter protein, increase in ion concentration, accumulation of a detectable chemical product).
[0117]As used herein, the term "membrane receptor protein" refers to membrane spanning proteins that bind a ligand (e.g., a hormone or neurotransmitter). As is known in the art, protein phosphorylation is a common regulatory mechanism used by cells to selectively modify proteins carrying regulatory signals from outside the cell to the nucleus. The proteins that execute these biochemical modifications are a group of enzymes known as protein kinases. They may further be defined by the substrate residue that they target for phosphorylation. One group of protein kinases are the tyrosine kinases (TKs) which selectively phosphorylate a target protein on its tyrosine residues. Some tyrosine kinases are membrane-bound receptors (RTKs), and, upon activation by a ligand, can autophosphorylate as well as modify substrates. The initiation of sequential phosphorylation by ligand stimulation is a paradigm that underlies the action of such effectors as, for example, epidermal growth factor (EGF), insulin, platelet-derived growth factor (PDGF), and fibroblast growth factor (FGF). The receptors for these ligands are tyrosine kinases and provide the interface between the binding of a ligand (hormone, growth factor) to a target cell and the transmission of a signal into the cell by the activation of one or more biochemical pathways. Ligand binding to a receptor tyrosine kinase activates its intrinsic enzymatic activity (See, e.g., Ullrich and Schlessinger, Cell 61:203-212 [1990]). Tyrosine kinases can also be cytoplasmic, non-receptor-type enzymes and act as a downstream component of a signal transduction pathway.
[0118]As used herein, the term "signal transduction protein" refers to a proteins that are activated or otherwise effected by ligand binding to a membrane receptor protein or some other stimulus. Examples of signal transduction protein include adenyl cyclase, phospholipase C, and G-proteins. Many membrane receptor proteins are coupled to G-proteins (i.e., G-protein coupled receptors (GPCRs); for a review, see Neer, 1995, Cell 80:249-257 [1995]). Typically, GPCRs contain seven transmembrane domains. Putative GPCRs can be identified on the basis of sequence homology to known GPCRs.
[0119]GPCRs mediate signal transduction across a cell membrane upon the binding of a ligand to an extracellular portion of a GPCR. The intracellular portion of a GPCR interacts with a G-protein to modulate signal transduction from outside to inside a cell. A GPCR is therefore said to be "coupled" to a G-protein. G-proteins are composed of three polypeptide subunits: an α subunit, which binds and hydrolyses GTP, and a dimeric βγ subunit. In the basal, inactive state, the G-protein exists as a heterotrimer of the α and βγ subunits. When the G-protein is inactive, guanosine diphosphate (GDP) is associated with the α subunit of the G-protein. When a GPCR is bound and activated by a ligand, the GPCR binds to the G-protein heterotrimer and decreases the affinity of the Gα subunit for GDP. In its active state, the G subunit exchanges GDP for guanine triphosphate (GTP) and active Gα subunit disassociates from both the receptor and the dimeric βγ subunit. The disassociated, active Gα subunit transduces signals to effectors that are "downstream" in the G-protein signalling pathway within the cell. Eventually, the G-protein's endogenous GTPase activity returns active G subunit to its inactive state, in which it is associated with GDP and the dimeric βγ subunit.
[0120]Numerous members of the heterotrimeric G-protein family have been cloned, including more than 20 genes encoding various Gα subunits. The various G subunits have been categorized into four families, on the basis of amino acid sequences and functional homology. These four families are termed Gαs, Gαi, Gαq, and Gα12. Functionally, these four families differ with respect to the intracellular signaling pathways that they activate and the GPCR to which they couple.
[0121]For example, certain GPCRs normally couple with Gαs and, through Gαs, these GPCRs stimulate adenylyl cyclase activity. Other GPCRs normally couple with GGαq, and through GGαq, these GPCRs can activate phospholipase C(PLC), such as the β isoform of phospholipase C (i.e., PLCβ, Stermweis and Smrcka, Trends in Biochem. Sci. 17:502-506 [1992]).
[0122]As used herein, the term "nucleic acid binding protein" refers to proteins that bind to nucleic acid, and in particular to proteins that cause increased (i.e., activators or transcription factors) or decreased (i.e., inhibitors) transcription from a gene.
[0123]As used herein, the term "ion channel protein" refers to proteins that control the ingress or egress of ions across cell membranes. Examples of ion channel proteins include, but are not limited to, the Na+-K+ ATPase pump, the Ca2+ pump, and the K+ leak channel.
[0124]As used herein, the term "protein kinase" refers to proteins that catalyze the addition of a phosphate group from a nucleoside triphosphate to an amino acid side chain in a protein. Kinases comprise the largest known enzyme superfamily and vary widely in their target proteins. Kinases may be categorized as protein tyrosine kinases (PTKs), which phosphorylate tyrosine residues, and protein serine/threonine kinases (STKs), which phosphorylate serine and/or threonine residues. Some kinases have dual specificity for both serine/threonine and tyrosine residues. Almost all kinases contain a conserved 250-300 amino acid catalytic domain. This domain can be further divided into 11 subdomains. N-terminal subdomains I-IV fold into a two-lobed structure which binds and orients the ATP donor molecule, and subdomain V spans the two lobes. C-terminal subdomains VI-XI bind the protein substrate and transfer the gamma phosphate from ATP to the hydroxyl group of a serine, threonine, or tyrosine residue. Each of the 11 subdomains contains specific catalytic residues or amino acid motifs characteristic of that subdomain. For example, subdomain I contains an 8-amino acid glycine-rich ATP binding consensus motif, subdomain II contains a critical lysine residue required for maximal catalytic activity, and subdomains VI through IX comprise the highly conserved catalytic core. STKs and PTKs also contain distinct sequence motifs in subdomains VI and VIII which may confer hydroxyamino acid specificity. Some STKs and PTKs possess structural characteristics of both families. In addition, kinases may also be classified by additional amino acid sequences, generally between 5 and 100 residues, which either flank or occur within the kinase domain.
[0125]Non-transmembrane PTKs form signaling complexes with the cytosolic domains of plasma membrane receptors. Receptors that signal through non-transmembrane PTKs include cytokine, hormone, and antigen-specific lymphocytic receptors. Many PTKs were first identified as oncogene products in cancer cells in which PTK activation was no longer subject to normal cellular controls. In fact, about one third of the known oncogenes encode PTKs. Furthermore, cellular transformation (oncogenesis) is often accompanied by increased tyrosine phosphorylation activity (See, e.g., Carbonneau, H. and Tonks, Annu. Rev. Cell Biol. 8:463-93 [1992]). Regulation of PTK activity may therefore be an important strategy in controlling some types of cancer.
[0126]Examples of protein kinases include, but are not limited to, cAMP-dependent protein kinase, protein kinase C, and cyclin-dependent protein kinases (See, e.g., U.S. Pat. Nos. 6,034,228; 6,030,822; 6,030,788; 6,020,306; 6,013,455; 6,013,464; and 6,015,807, all of which are incorporated herein by reference).
[0127]As used herein, the term "protein phosphatase" refers to proteins that remove a phosphate group from a protein. Protein phosphatases are generally divided into two groups, receptor and non-receptor type proteins. Most receptor-type protein tyrosine phosphatases contain two conserved catalytic domains, each of which encompasses a segment of 240 amino acid residues. (See, e.g., Saito et al., Cell Growth and Diff. 2:59-65 [1991]). Receptor protein tyrosine phosphatases can be subclassified further based upon the amino acid sequence diversity of their extracellular domains. (See, e.g., Krueger et al., Proc. Natl. Acad. Sci. USA 89:7417-7421 [1992]). Examples of protein phosphatases include, but are not limited to, cdc25 a, b, and c, PTP20, PTP1D, and PTPλ (See, e.g., U.S. Pat. Nos. 5,976,853; 5,994,074; 6,004,791; 5,981,251; 5,976,852; 5,958,719; 5,955,592; and 5,952,212, all of which are incorporated herein by reference).
[0128]As used herein, the term "protein encoded by an oncogene" refers to proteins that cause, either directly or indirectly, the neoplastic transformation of a host cell. Examples of oncogenes include, but are not limited to, the following genes: src, fps, fes, fgr, ros, H-ras, abl, ski, erbA, erbB, fms, fos, mos, sis, myc, myb, rel kit, raf, K-ras, and ets.
[0129]As used herein, the term "immunoglobulin" refers to proteins which bind a specific antigen. Immunoglobulins include, but are not limited to, polyclonal, monoclonal, chimeric, and humanized antibodies, Fab fragments, F(ab')2 fragments, and includes immunoglobulins of the following classes: IgG, IgA, IgM, IgD, IbE, and secreted immunoglobulins (sIg). Immunoglobulins generally comprise two identical heavy chains (γ, α, μ, δ, or ε) and two light chains (κ or λ).
[0130]As used herein, the term "antigen binding protein" refers to proteins which bind to a specific antigen. "Antigen binding proteins" include, but are not limited to, immunoglobulins, including polyclonal, monoclonal, chimeric, and humanized antibodies; Fab fragments, F(ab')2 fragments, and Fab expression libraries; and single chain antibodies. Various procedures known in the art are used for the production of polyclonal antibodies. For the production of an antibody, various host animals can be immunized by injection with the peptide corresponding to the desired epitope including but not limited to rabbits, mice, rats, sheep, goats, etc. In a preferred embodiment, the peptide is conjugated to an immunogenic carrier (e.g., diphtheria toxoid, bovine serum albumin (BSA), or keyhole limpet hemocyanin (KLH)). Various adjuvants are used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (Bacille Calmette-Guerin) and Corynebacterium parvum.
[0131]For preparation of monoclonal antibodies, any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used (See, e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). These include, but are not limited to, the hybridoma technique originally developed by Kohler and Milstein (Kohler and Milstein, Nature 256:495-497 [1975]), as well as the trioma technique, the human B-cell hybridoma technique (See e.g., Kozbor et al. Immunol. Today 4:72 [1983]), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96 [1985]).
[0132]According to the invention, techniques described for the production of single chain antibodies (U.S. Pat. No. 4,946,778; herein incorporated by reference) can be adapted to produce specific single chain antibodies as desired. An additional embodiment of the invention utilizes the techniques known in the art for the construction of Fab expression libraries (Huse et al., Science 246:1275-1281 [1989]) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity.
[0133]Antibody fragments that contain the idiotype (antigen binding region) of the antibody molecule can be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')2 fragment that can be produced by pepsin digestion of an antibody molecule; the Fab' fragments that can be generated by reducing the disulfide bridges of an F(ab')2 fragment, and the Fab fragments that can be generated by treating an antibody molecule with papain and a reducing agent.
[0134]Genes encoding antigen binding proteins can be isolated by methods known in the art. In the production of antibodies, screening for the desired antibody can be accomplished by techniques known in the art (e.g., radioimmunoassay, ELISA (enzyme-linked immunosorbant assay), "sandwich" immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), Western Blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays, etc.), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc.) etc.
[0135]As used herein, the term "reporter gene" refers to a gene encoding a protein that may be assayed. Examples of reporter genes include, but are not limited to, luciferase (See, e.g., deWet et al., Mol. Cell. Biol. 7:725 [1987] and U.S. Pat. Nos. 6,074,859; 5,976,796; 5,674,713; and 5,618,682; all of which are incorporated herein by reference), green fluorescent protein (e.g., GenBank Accession Number U43284; a number of GFP variants are commercially available from CLONTECH Laboratories, Palo Alto, Calif.), chloramphenicol acetyltransferase, β-galactosidase, alkaline phosphatase, and horse radish peroxidase.
[0136]As used herein, the term "purified" refers to molecules, either nucleic or amino acid sequences, that are removed from their natural environment, isolated or separated. An "isolated nucleic acid sequence" is therefore a purified nucleic acid sequence. "Substantially purified" molecules are at least 60% free, preferably at least 75% free, and more preferably at least 90% free from other components with which they are naturally associated.
[0137]The term "test compound" refers to any chemical entity, pharmaceutical, drug, and the like contemplated to be useful in the treatment and/or prevention of a disease, illness, sickness, or disorder of bodily function, or otherwise alter the physiological or cellular status of a sample. Test compounds comprise both known and potential therapeutic compounds. A test compound can be determined to be therapeutic by screening using the screening methods of the present invention. A "known therapeutic compound" refers to a therapeutic compound that has been shown (e.g., through animal trials or prior experience with administration to humans) to be effective in such treatment or prevention.
DETAILED DESCRIPTION OF THE INVENTION
[0138]The present invention relates to the production of proteins in host cells, and more particularly to host cells containing multiple integrated copies of an integrating vector. The present invention utilizes integrating vectors (i.e., vectors that integrate via an integrase or transposase) to create cell lines containing a high copy number of a nucleic acid encoding a gene of interest. The transfected genomes of the high copy number cells are stable through repeated passages (e.g., at least 10 passages, preferably at least 50 passages, and most preferably at least 100 passages). Furthermore, the host cells of the present invention are capable of producing high levels of protein (e.g., more than 1 pg/cell/day, preferably more than 10 pg/cell/day, more preferably more than 50 pg/cell/day, and most preferably more than 100 pg/cell/day.)
[0139]The genomic stability and high expression levels of the host cells of the present invention provide distinct advantages over previously described methods of cell culture. For example, mammalian cell lines containing multiple copies of genes are known in the art to be intrinsically unstable. Indeed, this instability is a recognized problem facing researchers desiring to use mammalian cell lines for various purposes, including high throughput screening assays (See, e.g., Sittampalam et al., Curr. Opin. Chem. Biol. 1(3):384-91 [1997]).
[0140]It is not intended that the present invention be limited to particular mechanism of action. Indeed, an understanding of the mechanism is not necessary to make and use the present invention. However, the high genomic stability and protein expression levels of the host cells of the present invention are thought to be due to unique properties of the integrating vectors (e.g., retroviral vectors). For example, it is known that retroviruses are inherited elements in the germ line of many organisms. Indeed, as much as 5-10% of the mammalian genome may consist of elements contributed by reverse transcription, indicating a high degree of stability. Likewise, many of these types of vectors target active (e.g., DNase I hypersensitive sites) transcriptional sites in the genome.
[0141]Many investigations have focused on the deleterious effects of retroviral and transposon integration. The property of targeting active regions of the genome has led to the use of retroviral vectors and transposon vectors in promoter trap schemes and for saturation mutagenesis (See, e.g., U.S. Pat. Nos. 5,627,058 and 5,922,601, all of which are herein incorporated by reference). In promoter trap schemes, the cells are infected with a promoterless reporter vector. If the promoterless vector integrates downstream of a promoter (i.e., into a gene), the reporter gene encoded by the vector is activated. The promoter can then be cloned and further characterized.
[0142]As can be seen, these schemes rely on the disruption of an endogenous gene. Therefore, it is surprising that the methods of the present invention, which utilize integrating vectors at high multiplicities of infection that would normally be thought to lead to gene disruption, led to the development of stable cell lines that express high quantities of a protein of interest. The development of these cell lines is described more fully below. The description is divided into the following sections: I) Host Cells; II) Vectors and Methods of Transfection; and III) Uses of Transfected Host Cells.
I. Host Cells
[0143]The present invention contemplates the transfection of a variety of host cells with integrating vectors. A number of mammalian host cell lines are known in the art. In general, these host cells are capable of growth and survival when placed in either monolayer culture or in suspension culture in a medium containing the appropriate nutrients and growth factors, as is described in more detail below. Typically, the cells are capable of expressing and secreting large quantities of a particular protein of interest into the culture medium. Examples of suitable mammalian host cells include, but are not limited to Chinese hamster ovary cells (CHO-K1, ATCC CCl-61); bovine mammary epithelial cells (ATCC CRL 10274; bovine mammary epithelial cells); monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture; see, e.g., Graham et al., J. Gen Virol., 36:59 [1977]); baby hamster kidney cells (BHK, ATCC CCL 10); mouse sertoli cells (TM4, Mather, Biol. Reprod. 23:243-251 [1980]); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TR1 cells (Mather et al., Annals N.Y. Acad. Sci., 383:44-68 [1982]); MRC 5 cells; FS4 cells; rat fibroblasts (208F cells); MDBK cells (bovine kidney cells); and a human hepatoma line (Hep G2).
[0144]In addition to mammalian cell lines, the present invention also contemplates the transfection of plant protoplasts with integrating vectors at a low or high multiplicity of infection. For example, the present invention contemplates a plant cell or whole plant comprising at least one integrated integrating vector, preferably a retroviral vector, and most preferably a pseudotyped retroviral vector. All plants that can be produced by regeneration from protoplasts can also be transfected using the process according to the invention (e.g., cultivated plants of the genera Solanum, Nicotiana, Brassica, Beta, Pisum, Phaseolus, Glycine, Helianthus, Allium, Avena, Hordeum, Oryzae, Setaria, Secale, Sorghum, Triticum, Zea, Musa, Cocos, Cydonia, Pyrus, Malus, Phoenix, Elaeis, Rubus, Fragaria, Prunus, Arachis, Panicum, Saccharum, Coffea, Camellia, Ananas, Vitis or Citrus). In general, protoplasts are produced in accordance with conventional methods (See, e.g., U.S. Pat. Nos. 4,743,548; 4,677,066, 5,149,645; and 5,508,184; all of which are incorporated herein by reference). Plant tissue may be dispersed in an appropriate medium having an appropriate osmotic potential (e.g., 3 to 8 wt. % of a sugar polyol) and one or more polysaccharide hydrolases (e.g., pectinase, cellulase, etc.), and the cell wall degradation allowed to proceed for a sufficient time to provide protoplasts. After filtration the protoplasts may be isolated by centrifugation and may then be resuspended for subsequent treatment or use. Regeneration of protoplasts kept in culture to whole plants is performed by methods known in the art (See, e.g., Evans et al., Handbook of Plant Cell Culture, 1: 124-176, MacMillan Publishing Co., New York [1983]; Binding, Plant Protoplasts, p. 21-37, CRC Press, Boca Raton [1985],) and Potrykus and Shillito, Methods in Enzymology, Vol. 118, Plant Molecular Biology, A. and H. Weissbach eds., Academic Press, Orlando [1986]).
[0145]The present invention also contemplates the use of amphibian and insect host cell lines. Examples of suitable insect host cell lines include, but are not limited to, mosquito cell lines (e.g., ATCC CRL-1660). Examples of suitable amphibian host cell lines include, but are not limited to, toad cell lines (e.g., ATCC CCL-102).
II. Vectors and Methods for Transfection
[0146]According to the present invention, host cells such as those described above are transduced or transfected with integrating vectors. Examples of integrating vectors include, but are not limited to, retroviral vectors, lentiviral vectors, adeno-associated viral vectors, and transposon vectors. The design, production, and use of these vectors in the present invention is described below.
A. Retroviral Vectors
[0147]Retroviruses (family Retroviridae) are divided into three groups: the spumaviruses (e.g., human foamy virus); the lentiviruses (e.g., human immunodeficiency virus and sheep visna virus) and the oncoviruses (e.g., MLV, Rous sarcoma virus).
[0148]Retroviruses are enveloped (i.e., surrounded by a host cell-derived lipid bilayer membrane) single-stranded RNA viruses which infect animal cells. When a retrovirus infects a cell, its RNA genome is converted into a double-stranded linear DNA form (i.e., it is reverse transcribed). The DNA form of the virus is then integrated into the host cell genome as a provirus. The provirus serves as a template for the production of additional viral genomes and viral mRNAs. Mature viral particles containing two copies of genomic RNA bud from the surface of the infected cell. The viral particle comprises the genomic RNA, reverse transcriptase and other pol gene products inside the viral capsid (which contains the viral gag gene products) which is surrounded by a lipid bilayer membrane derived from the host cell containing the viral envelope glycoproteins (also referred to as membrane-associated proteins).
[0149]The organization of the genomes of numerous retroviruses is well known to the art and this has allowed the adaptation of the retroviral genome to produce retroviral vectors. The production of a recombinant retroviral vector carrying a gene of interest is typically achieved in two stages.
[0150]First, the gene of interest is inserted into a retroviral vector which contains the sequences necessary for the efficient expression of the gene of interest (including promoter and/or enhancer elements which may be provided by the viral long terminal repeats (LTRs) or by an internal promoter/enhancer and relevant splicing signals), sequences required for the efficient packaging of the viral RNA into infectious virions (e.g., the packaging signal (Psi), the tRNA primer binding site (-PBS), the 3' regulatory sequences required for reverse transcription (+PBS)) and the viral LTRs. The LTPs contain sequences required for the association of viral genomic RNA, reverse transcriptase and integrase functions, and sequences involved in directing the expression of the genomic RNA to be packaged in viral particles. For safety reasons, many recombinant retroviral vectors lack functional copies of the genes which are essential for viral replication (these essential genes are either deleted or disabled); therefore, the resulting virus is said to be replication defective.
[0151]Second, following the construction of the recombinant vector, the vector DNA is introduced into a packaging cell line. Packaging cell lines provide proteins required in trans for the packaging of the viral genomic RNA into viral particles having the desired host range (i.e., the viral-encoded gag, pol and env proteins). The host range is controlled, in part, by the type of envelope gene product expressed on the surface of the viral particle. Packaging cell lines may express ecotrophic, amphotropic or xenotropic envelope gene products. Alternatively, the packaging cell line may lack sequences encoding a viral envelope (env) protein. In this case the packaging cell line will package the viral genome into particles which lack a membrane-associated protein (e.g., an env protein). In order to produce viral particles containing a membrane associated protein which will permit entry of the virus into a cell, the packaging cell line containing the retroviral sequences is transfected with sequences encoding a membrane-associated protein (e.g., the G protein of vesicular stomatitis virus (VSV)). The transfected packaging cell will then produce viral particles which contain the membrane-associated protein expressed by the transfected packaging cell line; these viral particles which contain viral genomic RNA derived from one virus encapsidated by the envelope proteins of another virus are said to be pseudotyped virus particles.
[0152]The retroviral vectors of the present invention can be further modified to include additional regulatory sequences. As described above, the retroviral vectors of the present invention include the following elements in operable association: a) a 5' LTR; b) a packaging signal; c) a 3' LTR and d) a nucleic acid encoding a protein of interest located between the 5' and 3' LTRs. In some embodiments of the present invention, the nucleic acid of interest may be arranged in opposite orientation to the 5' LTR when transcription from an internal promoter is desired. Suitable internal promoters include, but are not limited to, the alpha-lactalbumin promoter, the CMV promoter (human or ape), and the thymidine kinase promoter.
[0153]In other embodiments of the present invention, where secretion of the protein of interest is desired, the vectors are modified by including a signal peptide sequence in operable association with the protein of interest. The sequences of several suitable signal peptides are known to those in the art, including, but not limited to, those derived from tissue plasminogen activator, human growth hormone, lactoferrin, alpha-casein, and alpha-lactalbumin.
[0154]In other embodiments of the present invention, the vectors are modified by incorporating an RNA export element (See, e.g., U.S. Pat. Nos. 5,914,267; 6,136,597; and 5,686,120; and WO99/14310, all of which are incorporated herein by reference) either 3' or 5' to the nucleic acid sequence encoding the protein of interest. It is contemplated that the use of RNA export elements allows high levels of expression of the protein of interest without incorporating splice signals or introns in the nucleic acid sequence encoding the protein of interest.
[0155]In still other embodiments, the vector further comprises at least one internal ribosome entry site (IRES) sequence. The sequences of several suitable IRES's are available, including, but not limited to, those derived from foot and mouth disease virus (FDV), encephalomyocarditis virus, and poliovirus. The IRES sequence can be interposed between two transcriptional units (e.g., nucleic acids encoding different proteins of interest or subunits of a multisubunit protein such as an antibody) to form a polycistronic sequence so that the two transcriptional units are transcribed from the same promoter.
[0156]The retroviral vectors of the present invention may also further comprise a selectable marker allowing selection of transformed cells. A number of selectable markers find use in the present invention, including, but not limited to the bacterial aminoglycoside 3' phosphotransferase gene (also referred to as the neo gene) that confers resistance to the drug G418 in mammalian cells, the bacterial hygromycin G phosphotransferase (hyg) gene that confers resistance to the antibiotic hygromycin and the bacterial xanthine-guanine phosphoribosyl transferase gene (also referred to as the gpt gene) that confers the ability to grow in the presence of mycophenolic acid. In some embodiments, the selectable marker gene is provided as part of polycistronic sequence that also encodes the protein of interest.
[0157]In still other embodiments of the present invention, the retroviral vectors may comprise recombination elements recognized by a recombination system (e.g., the cre/loxP or flp recombinase systems, see, e.g., Hoess et al., Nucleic Acids Res. 14:2287-2300 [1986], O'Gorman et al., Science 251:1351-55 [1991], van Deursen et al., Proc. Natl. Acad. Sci. USA 92:7376-80 [1995], and U.S. Pat. No. 6,025,192, herein incorporated by reference). After integration of the vectors into the genome of the host cell, the host cell can be transiently transfected (e.g., by electroporation, lipofection, or microinjection) with either a recombinase enzyme (e.g., Cre recombinase) or a nucleic acid sequence encoding the recombinase enzyme and one or more nucleic acid sequences encoding a protein of interest flanked by sequences recognized by the recombination enzyme so that the nucleic acid sequence is inserted into the integrated vector.
[0158]Viral vectors, including recombinant retroviral vectors, provide a more efficient means of transferring genes into cells as compared to other techniques such as calcium phosphate-DNA co-precipitation or DEAE-dextran-mediated transfection, electroporation or microinjection of nucleic acids. It is believed that the efficiency of viral transfer is due in part to the fact that the transfer of nucleic acid is a receptor-mediated process (i.e., the virus binds to a specific receptor protein on the surface of the cell to be infected). In addition, the virally transferred nucleic acid once inside a cell integrates in controlled manner in contrast to the integration of nucleic acids which are not virally transferred; nucleic acids transferred by other means such as calcium phosphate-DNA co-precipitation are subject to rearrangement and degradation.
[0159]The most commonly used recombinant retroviral vectors are derived from the amphotropic Moloney murine leukemia virus (MoMLV) (See e.g., Miller and Baltimore Mol. Cell. Biol. 6:2895 [1986]). The MoMLV system has several advantages: 1) this specific retrovirus can infect many different cell types, 2) established packaging cell lines are available for the production of recombinant MoMLV viral particles and 3) the transferred genes are permanently integrated into the target cell chromosome. The established MoMLV vector systems comprise a DNA vector containing a small portion of the retroviral sequence (e.g., the viral long terminal repeat or "LTR" and the packaging or "psi" signal) and a packaging cell line. The gene to be transferred is inserted into the DNA vector. The viral sequences present on the DNA vector provide the signals necessary for the insertion or packaging of the vector RNA into the viral particle and for the expression of the inserted gene. The packaging cell line provides the proteins required for particle assembly (Markowitz et al., J. Virol. 62:1120 [1988]).
[0160]Despite these advantages, existing retroviral vectors based upon MoMLV are limited by several intrinsic problems: 1) they do not infect non-dividing cells (Miller et al., Mol. Cell. Biol. 10:4239 [1990]), except, perhaps, oocytes; 2) they produce low titers of the recombinant virus (Miller and Rosman, BioTechniques 7: 980 [1980] and Miller, Nature 357: 455 [1990]); and 3) they infect certain cell types (e.g., human lymphocytes) with low efficiency (Adams et al., Proc. Natl. Acad. Sci. USA 89:8981 [1992]). The low titers associated with MoMLV-based vectors have been attributed, at least in part, to the instability of the virus-encoded envelope protein. Concentration of retrovirus stocks by physical means (e.g., ultracentrifugation and ultrafiltration) leads to a severe loss of infectious virus.
[0161]The low titer and inefficient infection of certain cell types by MoMLV-based vectors has been overcome by the use of pseudotyped retroviral vectors which contain the G protein of VSV as the membrane associated protein. Unlike retroviral envelope proteins which bind to a specific cell surface protein receptor to gain entry into a cell, the VSV G protein interacts with a phospholipid component of the plasma membrane (Mastromarino et al., J. Gen. Virol. 68:2359 [1977]). Because entry of VSV into a cell is not dependent upon the presence of specific protein receptors, VSV has an extremely broad host range. Pseudotyped retroviral vectors bearing the VSV G protein have an altered host range characteristic of VSV (i.e., they can infect almost all species of vertebrate, invertebrate and insect cells). Importantly, VSV G-pseudotyped retroviral vectors can be concentrated 2000-fold or more by ultracentrifugation without significant loss of infectivity (Burns et al. Proc. Natl. Acad. Sci. USA 90:8033 [1993]).
[0162]The present invention is not limited to the use of the VSV G protein when a viral G protein is employed as the heterologous membrane-associated protein within a viral particle (See, e.g., U.S. Pat. No. 5,512,421, which is incorporated herein by reference). The G proteins of viruses in the Vesiculovirus genera other than VSV, such as the Piry and Chandipura viruses, that are highly homologous to the VSV G protein and, like the VSV G protein, contain covalently linked palmitic acid (Brun et al. Intervirol. 38:274 [1995] and Masters et al., Virol. 171:285 (1990]). Thus, the G protein of the Piry and Chandipura viruses can be used in place of the VSV G protein for the pseudotyping of viral particles. In addition, the VSV G proteins of viruses within the Lyssa virus genera such as Rabies and Mokola viruses show a high degree of conservation (amino acid sequence as well as functional conservation) with the VSV G proteins. For example, the Mokola virus G protein has been shown to function in a manner similar to the VSV G protein (i.e., to mediate membrane fusion) and therefore may be used in place of the VSV G protein for the pseudotyping of viral particles (Mebatsion et al., J. Virol. 69:1444 [1995]). Viral particles may be pseudotyped using either the Piry, Chandipura or Mokola G protein as described in Example 2, with the exception that a plasmid containing sequences encoding either the Piry, Chandipura or Mokola G protein under the transcriptional control of a suitable promoter element (e.g., the CMV intermediate-early promoter; numerous expression vectors containing the CMV IE promoter are available, such as the pcDNA3.1 vectors (Invitrogen)) is used in place of pHCMV-G. Sequences encoding other G proteins derived from other members of the Rhabdoviridae family may be used; sequences encoding numerous rhabdoviral G proteins are available from the GenBank database.
[0163]The majority of retroviruses can transfer or integrate a double-stranded linear form of the virus (the provirus) into the genome of the recipient cell only if the recipient cell is cycling (i.e., dividing) at the time of infection. Retroviruses which have been shown to infect dividing cells exclusively, or more efficiently, include MLV, spleen necrosis virus, Rous sarcoma virus and human immunodeficiency virus (HIV; while HIV infects dividing cells more efficiently, HIV can infect non-dividing cells).
[0164]It has been shown that the integration of MLV virus DNA depends upon the host cell's progression through mitosis and it has been postulated that the dependence upon mitosis reflects a requirement for the breakdown of the nuclear envelope in order for the viral integration complex to gain entry into the nucleus (Roe et al., EMBO J. 12:2099 [1993]). However, as integration does not occur in cells arrested in metaphase, the breakdown of the nuclear envelope alone may not be sufficient to permit viral integration; there may be additional requirements such as the state of condensation of the genomic DNA (Roe et al., supra).
B. Lentiviral Vectors
[0165]The present invention also contemplates the use of lentiviral vectors to generate high copy number cell lines. The lentiviruses (e.g., equine infectious anemia virus, caprine arthritis-encephalitis virus, human immunodeficiency virus) are a subfamily of retroviruses that are able to integrate into non-dividing cells. The lentiviral genome and the proviral DNA have the three genes found in all retroviruses: gag, pol, and env, which are flanked by two LTR sequences. The gag gene encodes the internal structural proteins (e.g., matrix, capsid, and nucleocapsid proteins); the pol gene encodes the reverse transcriptase, protease, and integrase proteins; and the pol gene encodes the viral envelope glycoproteins. The 5' and 3' LTRs control transcription and polyadenylation of the viral RNAs. Additional genes in the lentiviral genome include the vif, vpr, tat, rev, vpu, nef, and vpx genes.
[0166]A variety of lentiviral vectors and packaging cell lines are known in the art and find use in the present invention (See, e.g., U.S. Pat. Nos. 5,994,136 and 6,013,516, both of which are herein incorporated by reference). Furthermore, the VSV G protein has also been used to pseudotype retroviral vectors based upon the human immunodeficiency virus (HIV) (Naldini et al., Science 272:263 [1996]). Thus, the VSV G protein may be used to generate a variety of pseudotyped retroviral vectors and is not limited to vectors based on MoMLV. The lentiviral vectors may also be modified as described above to contain various regulatory sequences (e.g., signal peptide sequences, RNA export elements, and IRES's). After the lentiviral vectors are produced, they may be used to transfect host cells as described above for retroviral vectors.
C. Adeno-Associated Viral Vectors
[0167]The present invention also contemplates the use of adeno associated virus (AAV) vectors to generate high copy number cell lines. AAV is a human DNA parvovirus which belongs to the genus Dependovirus. The AAV genome is composed of a linear, single-stranded DNA molecule which contains approximately 4680 bases. The genome includes inverted terminal repeats (ITRs) at each end which function in cis as origins of DNA replication and as packaging signals for the virus. The internal nonrepeated portion of the genome includes two large open reading frames, known as the AAV rep and cap regions, respectively. These regions code for the viral proteins involved in replication and packaging of the virion. A family of at least four viral proteins are synthesized from the AAV rep region, Rep 78, Rep 68, Rep 52 and Rep 40, named according to their apparent molecular weight. The AAV cap region encodes at least three proteins, VP1, VP2 and VP3 (for a detailed description of the AAV genome, see e.g., Muzyczka, Current Topics Microbiol. Immunol. 158:97-129 [1992]; Kotin, Human Gene Therapy 5:793-801 [1994]).
[0168]AAV requires coinfection with an unrelated helper virus, such as adenovirus, a herpesvirus or vaccinia, in order for a productive infection to occur. In the absence of such coinfection, AAV establishes a latent state by insertion of its genome into a host cell chromosome. Subsequent infection by a helper virus rescues the integrated copy which can then replicate to produce infectious viral progeny. Unlike the non-pseudotyped retroviruses, AAV has a wide host range and is able to replicate in cells from any species so long as there is coinfection with a helper virus that will also multiply in that species. Thus, for example, human AAV will replicate in canine cells coinfected with a canine adenovirus. Furthermore, unlike the retroviruses, AAV is not associated with any human or animal disease, does not appear to alter the biological properties of the host cell upon integration and is able to integrate into nondividing cells. It has also recently been found that AAV is capable of site-specific integration into a host cell genome.
[0169]In light of the above-described properties, a number of recombinant AAV vectors have been developed for gene delivery (See, e.g., U.S. Pat. Nos. 5,173,414; 5,139,941; WO 92/01070 and WO 93/03769, both of which are incorporated herein by reference; Lebkowski et al., Molec. Cell. Biol. 8:3988-3996 [1988]; Carter, B. J., Current Opinion in Biotechnology 3:533-539 [1992]; Muzyczka, Current Topics in Microbiol. and Immunol. 158:97-129 [1992]; Kotin, R. M. (1994) Human Gene Therapy 5:793-801; Shelling and Smith, Gene Therapy 1:165-169 [1994]; and Zhou et al., J. Exp. Med. 179:1867-1875 [1994]).
[0170]Recombinant AAV virions can be produced in a suitable host cell which has been transfected with both an AAV helper plasmid and an AAV vector. An AAV helper plasmid generally includes AAV rep and cap coding regions, but lacks AAV ITRs. Accordingly, the helper plasmid can neither replicate nor package itself. An AAV vector generally includes a selected gene of interest bounded by AAV ITRs which provide for viral replication and packaging functions. Both the helper plasmid and the AAV vector bearing the selected gene are introduced into a suitable host cell by transient transfection. The transfected cell is then infected with a helper virus, such as an adenovirus, which transactivates the AAV promoters present on the helper plasmid that direct the transcription and translation of AAV rep and cap regions. Recombinant AAV virions harboring the selected gene are formed and can be purified from the preparation. Once the AAV vectors are produced, they may be used to transfect (See, e.g., U.S. Pat. No. 5,843,742, herein incorporated by reference) host cells at the desired multiplicity of infection to produce high copy number host cells. As will be understood by those skilled in the art, the AAV vectors may also be modified as described above to contain various regulatory sequences (e.g., signal peptide sequences, RNA export elements, and IRES's).
D. Transposon Vectors
[0171]The present invention also contemplates the use of transposon vectors to generate high copy number cell lines. Transposons are mobile genetic elements that can move or transpose from one location another in the genome. Transposition within the genome is controlled by a transposase enzyme that is encoded by the transposon. Many examples of transposons are known in the art, including, but not limited to, Tn5 (See e.g., de la Cruz et al., J. Bact. 175: 6932-38 [1993], Tn7 (See e.g., Craig, Curr. Topics Microbiol. Immunol. 204: 27-48 [1996]), and Tn10 (See e.g., Morisato and Kleckner, Cell 51:101-111 [1987]). The ability of transposons to integrate into genomes has been utilized to create transposon vectors (See, e.g., U.S. Pat. Nos. 5,719,055; 5,968,785; 5,958,775; and 6,027,722; all of which are incorporated herein by reference.) Because transposons are not infectious, transposon vectors are introduced into host cells via methods known in the art (e.g., electroporation, lipofection, or microinjection). Therefore, the ratio of transposon vectors to host cells may be adjusted to provide the desired multiplicity of infection to produce the high copy number host cells of the present invention.
[0172]Transposon vectors suitable for use in the present invention generally comprise a nucleic acid encoding a protein of interest interposed between two transposon insertion sequences. Some vectors also comprise a nucleic acid sequence encoding a transposase enzyme. In these vectors, the one of the insertion sequences is positioned between the transposase enzyme and the nucleic acid encoding the protein of interest so that it is not incorporated into the genome of the host cell during recombination. Alternatively, the transposase enzyme may be provided by a suitable method (e.g., lipofection or microinjection). As will be understood by those skilled in the art, the transposon vectors may also be modified as described above to contain various regulatory sequences (e.g., signal peptide sequences, RNA export elements, and IRES's).
E. Transfection at High Multiplicities of Infection
[0173]Once integrating vectors (e.g., retroviral vectors) encoding a protein of interest have been produced, they may be used to transfect or transduce host cells (examples of which are described above in Section I). Preferably, host cells are transfected or transduced with integrating vectors at a multiplicity of infection sufficient to result in the integration of at least 1, and preferably at least 2 or more retroviral vectors. In some embodiments, multiplicities of infection of from 10 to 1,000,000 may be utilized, so that the genomes of the infected host cells contain from 2 to 100 copies of the integrated vectors, and preferably from 5 to 50 copies of the integrated vectors. In other embodiments, a multiplicity of infection of from 10 to 10,000 is utilized. When non-pseudotyped retroviral vectors are utilized for infection, the host cells are incubated with the culture medium from the retroviral producers cells containing the desired titer (i.e., colony forming units, CFUs) of infectious vectors. When pseudotyped retroviral vectors are utilized, the vectors are concentrated to the appropriate titer by ultracentrifugation and then added to the host cell culture. Alternatively, the concentrated vectors can be diluted in a culture medium appropriate for the cell type. Additionally, when expression of more than one protein of interest by the host cell is desired, the host cells can be transfected with multiple vectors each containing a nucleic acid encoding a different protein of interest.
[0174]In each case, the host cells are exposed to medium containing the infectious retroviral vectors for a sufficient period of time to allow infection and subsequent integration of the vectors. In general, the amount of medium used to overlay the cells should be kept to as small a volume as possible so as to encourage the maximum amount of integration events per cell. As a general guideline, the number of colony forming units (cfu) per milliliter should be about 105 to 107 cfu/ml, depending upon the number of integration events desired.
[0175]The present invention is not limited to any particular mechanism of action. Indeed, an understanding of the mechanism of action is not necessary for practicing the present invention. However, the diffusion rate of the vectors is known to be very limited (See, e.g., U.S. Pat. No. 5,866,400, herein incorporated by reference, for a discussion of diffusion rates). Therefore, it is expected that the actual integration rate will be lower (and in some cases much lower) than the multiplicity of infection. Applying the equations from U.S. Pat. No. 5,866,400, a titer of 106 cfu/ml has an average vector-vector spacing of 1 micron. The diffusion time of a MMLV vector across 100 microns is approximately 20 minutes. Accordingly, the vector can travel approximately 300 microns in one hour. If 1000 cells are plated in a T25 flask, the cells are spaced 2.5 mm apart on average. Using these values, the only 56 viral particles would be expected to contact a given cell within an hour. The Table below provides the expected contact rate for a given number of cells in a T25 flask with a particular vector titer. However, as shown below in the examples, the actual number of integrations obtained is much lower than may be predicted by these equations.
TABLE-US-00001 Vector Contact Frequency As A Function of Time and Cell Spacing Vector Titer Cells/T25 Flask MOI Contacts/Hour 106 1000 1,000 56 106 100 10,000 <56 105 1000 100 5.6 104 1000 10 0.6
[0176]Accordingly, it is contemplated that the actual integration rate is dependent not only on the multiplicity of infection, but also on the contact time (i.e., the length of time the host cells are exposed to infectious vector), the confluency or geometry of the host cells being transfected, and the volume of media that the vectors are contained in. It is contemplated that these conditions can be varied as taught herein to produce host cell lines containing multiple integrated copies of integrating vectors. As demonstrated in Examples 8 and 9, MOI can be varied by either holding the number of cells constant and varying CFU's (Example 9), or by holding CFU's constant and varying cell number (Example 8).
[0177]In some embodiments, after transfection or transduction, the cells are allowed to multiply, and are then trypsinized and replated. Individual colonies are then selected to provide clonally selected cell lines. In still further embodiments, the clonally selected cell lines are screened by Southern blotting or INVADER assay to verify that the desired number of integration events has occurred. It is also contemplated that clonal selection allows the identification of superior protein producing cell lines. In other embodiments, the cells are not clonally selected following transfection.
[0178]In some embodiments, the host cells are transfected with vectors encoding different proteins of interest. The vectors encoding different proteins of interest can be used to transfect the cells at the same time (e.g., the host cells are exposed to a solution containing vectors encoding different proteins of interest) or the transfection can be serial (e.g., the host cells are first transfected with a vector encoding a first protein of interest, a period of time is allowed to pass, and the host cells are then transfected with a vector encoding a second protein of interest). In some preferred embodiments, the host cells are transfected with an integrating vector encoding a first protein of interest, high expressing cell lines containing multiple integrated copies of the integrating vector are selected (e.g., clonally selected), and the selected cell line is transfected with an integrating vector encoding a second protein of interest. This process may be repeated to introduce multiple proteins of interest. In some embodiments, the multiplicities of infection may be manipulated (e.g., increased or decreased) to increase or decrease the expression of the protein of interest. Likewise, the different promoters may be utilized to vary the expression of the proteins of interest. It is contemplated that these transfection methods can be used to construct host cell lines containing an entire exogenous metabolic pathway or to provide host cells with an increased capability to process proteins (e.g., the host cells can be provided with enzymes necessary for post-translational modification).
[0179]In still further embodiments, cell lines are serially transfected with vectors encoding the same gene. In some preferred embodiments, the host cells are transfected (e.g., at an MOI of about 10 to 100,000, preferably 100 to 10,000) with an integrating vector encoding a protein of interest, cell lines containing single or multiple integrated copies of the integrating vector or expressing high levels of the desired protein are selected (e.g., clonally selected), and the selected cell line is retransfected with the vector (e.g., at an MOI of about 10 to 100,000, preferably 100 to 10,000). In some embodiments, cell lines comprising at least two integrated copies of the vector are identified and selected. This process may be repeated multiple times until the desired level of protein expression is obtained and may also be repeated to introduce vectors encoding multiple proteins of interest. Unexpectedly, serial transfection with the same gene results in increases in protein production from the resulting cells that are not merely additive.
III. Uses of Transfected Host Cells
[0180]The host cells transfected at a high multiplicity of infection can be used for a variety of purposes. First, the host cells find use in the production of proteins for pharmaceutical, industrial, diagnostic, and other purposes. Second, host cells expressing a particular protein or proteins find use in screening assays (e.g., high throughput screening). Third, the host cells find use in the production of multiple variants of proteins, followed by analysis of the activity of the protein variants. Each of these uses is explained in more detail below.
A. Production of Proteins
[0181]It is contemplated that the host cells of the present invention find use in the production of proteins for pharmaceutical, industrial, diagnostic, and other uses. The present invention is not limited to the production of any particular protein. Indeed, the production of a wide variety of proteins is contemplated, including, but not limited to, erythropoietin, alpha-interferon, alpha-1 proteinase inhibitor, angiogenin, antithrombin III, beta-acid decarboxylase, human growth hormone, bovine growth hormone, porcine growth hormone, human serum albumin, beta-interferon, calf intestine alkaline phosphatase, cystic fibrosis transmembrane regulator, Factor VIII, Factor IX, Factor X, insulin, lactoferrin, tissue plasminogen activator, myelin basic protein, insulin, proinsulin, prolactin, hepatitis B antigen, immunoglobulins, monoclonal antibody CTLA4 Ig, Tag 72 monoclonal antibody, Tag 72 single chain antigen binding protein, protein C, cytokines and their receptors, including, for instance tumor necrosis factors alpha and beta, their receptors and their derivatives; renin; growth hormone releasing factor; parathyroid hormone; thyroid stimulating hormone; lipoproteins; alpha-1-antitrypsin; follicle stimulating hormone; calcitonin; luteinizing hormone; glucagon; von Willebrands factor; atrial natriuretic factor; lung surfactant; urokinase; bombesin; thrombin; hemopoietic growth factor; enkephalinase; human macrophage inflammatory protein (MIP-1-alpha); a serum albumin such mullerian-inhibiting substance; relaxin A-chain; relaxin B-chain; prorelaxin; mouse gonadotropin-associated peptide; beta-lactamase; DNase; inhibin; activin; vascular endothelial growth factor (VEGF); receptors for hormones or growth factors; integrin; protein A or D; rheumatoid factors; a neurotrophic factor such as bone-derived neurotrophic factor (BDNF), neurotrophin-3, -4, -5, or -6 (NT-3, NT-4, NT-5, or NT-6), or a nerve growth factor such as NGF-beta; platelet-derived growth factor (PDGF); fibroblast growth factor such as aFGF and bFGF; epidermal growth factor (EGF); transforming growth factor (TGF) such as TGF-alpha and TGF-beta, including TGF-β1, TGF-β2, TGF-β3, TGF-β4, or TGF-β5; insulin-like growth factor-I and -II (IGF-I and IGF-II); des(1-3)-IGF-I (brain IGF-I), insulinslike growth factor binding proteins; CD proteins such as CD-3, CD-4, CD-8, and CD-19; osteoinductive factors; immunotoxins; a bone morphogenetic protein (BMP); an interferon such as interferon-alpha, -beta, and -gamma; colony stimulating factors (CSFs), e.g., M-CSF, GM-CSF, and G-CSF; interleukins (ILs), e.g., IL-1 to IL-10; superoxide dismutase; T-cell receptors; surface membrane proteins; decay accelerating factor; viral antigen such as, for example, a portion of the AIDS envelope; transport proteins; homing receptors; addressins; regulatory proteins; antibodies; chimeric proteins, such as immunoadhesins, and fragments of any of the above-listed polypeptides. Nucleic acid and protein sequences for these proteins are available in public databases such as GenBank.
[0182]In some embodiments, the host cells express more than one exogenous protein. For example, the host cells may be transfected vectors encoding different proteins of interest (e.g., cotransfection or infection at a multiplicity of infection of 1000 with one vector encoding a first protein of interest and a second vector encoding a second protein of interest or serial transfection or infection) so that the host cell contains at least one integrated copy of a first vector encoding a first protein of interest and at least one integrated copy of second integrating vector encoding a second protein of interest. In other embodiments, more than one protein is expressed by arranging the nucleic acids encoding the different proteins of interest in a polycistronic sequence (e.g., bicistronic or tricistronic sequences). This arrangement is especially useful when expression of the different proteins of interest in about a 1:1 molar ratio is desired (e.g., expressing the light and heavy chains of an antibody molecule).
[0183]In still further embodiments, ribozymes are expressed in the host cells. It is contemplated that the ribozyme can be utilized for down-regulating expression of a particular gene or used in conjunction with gene switches such as TET, ecdysone, glucocorticoid enhancer, etc. to provide host cells with various phenotypes.
[0184]The transfected host cells are cultured according to methods known in the art.
[0185]Suitable culture conditions for mammalian cells are well known in the art (See e.g., J. Immunol. Methods (1983) 56:221-234 [1983], Animal Cell Culture: A Practical Approach 2nd Ed., Rickwood, D. and Hames, B. D., eds. Oxford University Press, New York [1992]).
[0186]The host cell cultures of the present invention are prepared in a media suitable for the particular cell being cultured. Commercially available media such as Ham's F10 (Sigma, St. Louis, Mo.), Minimal Essential Medium (MEM, Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium (DMEM, Sigma) are exemplary nutrient solutions. Suitable media are also described in U.S. Pat. Nos. 4,767,704; 4,657,866; 4,927,762; 5,122,469; 4,560,655; and WO 90/03430 and WO 87/00195; the disclosures of which are herein incorporated by reference. Any of these media may be supplemented as necessary with serum, hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleosides (such as adenosine and thymidine), antibiotics (such as gentamycin (gentarnicin), trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range) lipids (such as linoleic or other fatty acids) and their suitable carriers, and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled in the art. For mammalian cell culture, the osmolality of the culture medium is generally about 290-330 mOsm.
[0187]The present invention also contemplates the use of a variety of culture systems (e.g., petri dishes, 96 well plates, roller bottles, and bioreactors) for the transfected host cells. For example, the transfected host cells can be cultured in a perfusion system. Perfusion culture refers to providing a continuous flow of culture medium through a culture maintained at high cell density. The cells are suspended and do not require a solid support to grow on. Generally, fresh nutrients must be supplied continuously with concomitant removal of toxic metabolites and, ideally, selective removal of dead cells. Filtering, entrapment and micro-capsulation methods are all suitable for refreshing the culture environment at sufficient rates.
[0188]As another example, in some embodiments a fed batch culture procedure can be employed. In the preferred fed batch culture the mammalian host, cells and culture medium are supplied to a culturing vessel initially and additional culture nutrients are fed, continuously or in discrete increments, to the culture during culturing, with or without periodic cell and/or product harvest before termination of culture. The fed batch culture can include, for example, a semi-continuous fed batch culture, wherein periodically whole culture (including cells and medium) is removed and replaced by fresh medium. Fed batch culture is distinguished from simple batch culture in which all components for cell culturing (including the cells and all culture nutrients) are supplied to the culturing vessel at the start of the culturing process. Fed batch culture can be further distinguished from perfusion culturing insofar as the supernate is not removed from the culturing vessel during the process (in perfusion culturing, the cells are restrained in the culture by, e.g., filtration, encapsulation, anchoring to microcarriers etc. and the culture medium is continuously or intermittently introduced and removed from the culturing vessel). In some particularly preferred embodiments, the batch cultures are performed in roller bottles.
[0189]Further, the cells of the culture may be propagated according to any scheme or routine that may be suitable for the particular host cell and the particular production plan contemplated. Therefore, the present invention contemplates a single step or multiple step culture procedure. In a single step culture the host cells are inoculated into a culture environment and the processes of the instant invention are employed during a single production phase of the cell culture. Alternatively, a multi-stage culture is envisioned. In the multi-stage culture cells may be cultivated in a number of steps or phases. For instance, cells may be grown in a first step or growth phase culture wherein cells, possibly removed from storage, are inoculated into a medium suitable for promoting growth and high viability. The cells may be maintained in the growth phase for a suitable period of time by the addition of fresh medium to the host cell culture.
[0190]Fed batch or continuous cell culture conditions are devised to enhance growth of the mammalian cells in the growth phase of the cell culture. In the growth phase cells are grown under conditions and for a period of time that is maximized for growth. Culture conditions, such as temperature, pH, dissolved oxygen (dO2) and the like, are those used with the particular host and will be apparent to the ordinarily skilled artisan. Generally, the pH is adjusted to a level between about 6.5 and 7.5 using either an acid (e.g., CO2) or a base (e.g., Na2CO3 or NaOH). A suitable temperature range for culturing mammalian cells such as CHO cells is between about 30° to 38° C. and a suitable dO2 is between 5-90% of air saturation.
[0191]Following the polypeptide production phase, the polypeptide of interest is recovered from the culture medium using techniques which are well established in the art. The protein of interest preferably is recovered from the culture medium as a secreted polypeptide (e.g., the secretion of the protein of interest is directed by a signal peptide sequence), although it also may be recovered from host cell lysates. As a first step, the culture medium or lysate is centrifuged to remove particulate cell debris. The polypeptide thereafter is purified from contaminant soluble proteins and polypeptides, with the following procedures being exemplary of suitable purification procedures: by fractionation on immunoaffinity or ion-exchange columns; ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; and protein A Sepharose columns to remove contaminants such as IgG. A protease inhibitor such as phenyl methyl sulfonyl fluoride (PMSF) also may be useful to inhibit proteolytic degradation during purification. Additionally, the protein of interest can be fused in frame to a marker sequence which allows for purification of the protein of interest. Non-limiting examples of marker sequences include a hexahistidine tag which may be supplied by a vector, preferably a pQE-9 vector, and a hemagglutinin (HA) tag. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (See e.g., Wilson et al., Cell, 37:767 [1984]). One skilled in the art will appreciate that purification methods suitable for the polypeptide of interest may require modification to account for changes in the character of the polypeptide upon expression in recombinant cell culture.
[0192]The host cells of the present invention are also useful for expressing G-protein coupled receptors (GPCRs) and other transmembrane proteins. It is contemplated that when these proteins are expressed, they are correctly inserted into the membrane in their native conformation. Thus, GPCRs and other transmembrane proteins may be purified as part of a membrane fraction or purified from the membranes by methods known in the art.
[0193]Furthermore, the vectors of the present invention are useful for co-expressing a protein of interest for which there is no assay or for which assays are difficult. In this system, a protein of interest and a signal protein are arranged in a polycistronic sequence. Preferably, an IRES sequence separates the signal protein and protein of interest (e.g., a GPCR) and the genes encoding the signal protein and protein of interest are expressed as a single transcriptional unit. The present invention is not limited to any particular signal protein. Indeed, the use of a variety of signal proteins for which easy assays exist is contemplated. These signal proteins include, but are not limited to, green fluorescent protein, luciferase, beta-galactosidase, and antibody heavy or light chains. It is contemplated that when the signal protein and protein of interest are co-expressed from a polycistronic sequence, the presence of the signal protein is indicative of the presence of the protein of interest. Accordingly, in some embodiments, the present invention provides methods for indirectly detecting the expression of a protein of interest comprising providing a host cell transfected with a vector encoding a polycistronic sequence, wherein the polycistronic sequence comprises a signal protein and a protein of interest operably linked by an IRES, and culturing the host cells under conditions such that the signal protein and protein of interest are produced, wherein the presence of the signal protein indicates the presence of the protein of interest.
B. Screening Compounds for Activity
[0194]The present invention contemplates the use of the high copy number cell lines for screening compounds for activity, and in particular to high throughput screening of compounds from combinatorial libraries (e.g., libraries containing greater than 104 compounds). The high copy number cell lines of the present invention can be used in a variety of screening methods. In some embodiments, the cells can be used in second messenger assays that monitor signal transduction following activation of cell-surface receptors. In other embodiments, the cells can be used in reporter gene assays that monitor cellular responses at the transcription/translation level. In still further embodiments, the cells can be used in cell proliferation assays to monitor the overall growth/no growth response of cells to external stimuli.
[0195]In second messenger assays, the host cells are preferably transfected as described above with vectors encoding cell surface receptors, ion channels, cytoplasmic receptors, or other proteins involved in signal transduction (e.g., G proteins, protein kinases, or protein phosphatases) (See, e.g., U.S. Pat. Nos. 5,670,113; 5,807,689; 5,876,946; and 6,027,875; all of which are incorporated herein by reference). The host cells are then treated with a compound or plurality of compounds (e.g., from a combinatorial library) and assayed for the presence or absence of a response. It is contemplated that at least some of the compounds in the combinatorial library can serve as agonists, antagonists, activators, or inhibitors of the protein or proteins encoded by the vectors. It is also contemplated that at least some of the compounds in the combinatorial library can serve as agonists, antagonists, activators, or inhibitors of protein acting upstream or downstream of the protein encoded by the vector in a signal transduction pathway.
[0196]By way of non-limiting example, it is known that agonist engaged transmembrane receptors are functionally linked to the modulation of several well characterized promoter/enhancer elements (e.g., AP1, cAMP response element (CRE), serum response element (SRE), and nuclear factor of activated T-cells (NF-AT)). Upon activation of a G.sub.αs coupling receptor, adenylyl cyclase is stimulated, producing increased concentrations of intracellular cAMP, stimulation of protein kinase A, phosphorylation of the CRE binding protein (CREB) and induction of promoters with CRE elements. G.sub.αi coupling receptors dampen CRE activity by inhibition of the same signal transduction components. G.sub.αq and some βγ pairs stimulate phospholipase C(PLC), and the generation of inositol triphosphate (IP3) and diacylglycerol (DAG). A transient flux in intracellular calcium promotes induction of calcineurin and NA-FT, as well as calmodulin (CaM)-dependent kinase and CREB. Increased DAG concentrations stimulate protein kinase C(PKC) and endosomal/lysosomal acidic sphingomyelinase (aSMase); while the aSMase pathway is dominant, both induce degradation of the NFκB inhibitor IκB as well as NFκB activation. In an alternative pathway, a receptor such as growth factor receptor is activated and recruits Sos to the plasma membrane, resulting in the stimulation of Ras, which in turn recruits the serine/threonine kinase Raf to the plasma membrane. Once activated, Raf phosphorylates MEK kinase, which phosphorylates and activates MAPK and the transcription factor ELK. ELK drives transcription from promoters with SRE elements, leading the synthesis of the transcription factors Fos and Jun, thus forming a transcription factor complex capable of activating AP1 sites. It is contemplated that the proteins forming the described pathways, as well as other receptors, kinases, phosphatases, and nucleic binding proteins, are targets for compounds in the combinatorial library, as well as candidates for expression in the host cells of the present invention.
[0197]In some embodiments, the second messenger assays measure fluorescent signals from reporter molecules that respond to intracellular changes (e.g., Ca2+ concentration, membrane potential, pH, IP3, cAMP, arachidonic acid release) due to stimulation of membrane receptors and ion channels (e.g., ligand gated ion channels; see Denyer et al., Drug Discov. Today 3:323-32 [1998]; and Gonzales et al., Drug. Discov. Today 4:431-39 [1999]). Examples of reporter molecules include, but are not limited to, FRET (florescence resonance energy transfer) systems (e.g., Cuo-lipids and oxonols, EDAN/DABCYL), calcium sensitive indicators (e.g., Fluo-3, FURA 2, INDO 1, and FLUO3 μM, BAPTA AM), chloride-sensitive indicators (e.g., SPQ, SPA), potassium-sensitive indicators (e.g., PBFI), sodium-sensitive indicators (e.g., SBFI), and pH sensitive indicators (e.g., BCECF).
[0198]In general, the host cells are loaded with the indicator prior to exposure to the compound. Responses of the host cells to treatment with the compounds can be detected by methods known in the art, including, but not limited to, fluorescence microscopy, confocal microscopy (e.g., FCS systems), flow cytometry, microfluidic devices, FLIPR systems (See, e.g., Schroeder and Neagle, J. Biomol. Screening 1:75-80 [1996]), and plate-reading systems. In some preferred embodiments, the response (e.g., increase in fluorescent intensity) caused by compound of unknown activity is compared to the response generated by a known agonist and expressed as a percentage of the maximal response of the known agonist. The maximum response caused by a known agonist is defined as a 100% response. Likewise, the maximal response recorded after addition of an agonist to a sample containing a known or test antagonist is detectably lower than the 100% response.
[0199]The cells are also useful in reporter gene assays. Reporter gene assays involve the use of host cells transfected with vectors encoding a nucleic acid comprising transcriptional control elements of a target gene (i.e., a gene that controls the biological expression and function of a disease target) spliced to a coding sequence for a reporter gene. Therefore, activation of the target gene results in activation of the reporter gene product. Examples of reporter genes finding use in the present invention include, but are not limited to, chloramphenicol transferase, alkaline phosphatase, firefly and bacterial luciferases, α-galactosidase, β-lactamase, and green fluorescent protein. The production of these proteins, with the exception of green fluorescent protein, is detected through the use of chemiluminescent, calorimetric, or bioluminecent products of specific substrates (e.g., X-gal and luciferin). Comparsions between compounds of known and unknown activities may be conducted as described above.
C. Comparison of Variant Protein Activity
[0200]The present invention also contemplates the use of the high copy number host cells to produce variants of proteins so that the activity of the variants can be compared. In some embodiments, the variants differ by a single nucleotide polymorphism (SNP) causing a single amino acid difference. In other embodiments, the variants contain multiple amino acid substitutions. In some embodiments, the activity of the variant proteins are assayed in vivo or in cell extracts. In other embodiments, the proteins are purified and assayed in vitro. It is also contemplated that in some embodiments the variant proteins are fused to a sequence that allows easy purification (e.g., a his-tag sequence) or to a reporter gene (e.g., green fluorescent protein). Activity of the proteins may be assayed by appropriate methods known in the art (e.g., conversion of a substrate to a product). In some preferred embodiments, the activity of a wild-type protein is determined, and the activity of variant versions of the wild-type proteins are expressed as a percentage of the activity of the wild-type protein. Furthermore, the intracellular activity of variant proteins may be compared by constructing a plurality of host cells lines, each of which expresses a different variant of the wild-type protein. The activity of the variant proteins (e.g., variants of proteins involved in signal transduction pathways) may then be compared using the reporter systems for second messenger assays described above. Therefore, in some embodiments, the direct or indirect response (e.g., through downstream or upstream activation of signal transduction pathway) of variant proteins to stimulation or binding by agonists or antagonists is compared. In some preferred embodiments, the response of a wild-type protein is determined, and the responses of variant versions of the wild-type proteins are expressed as a percentage of the response of the wild-type protein.
Experimental
[0201]The following examples serve to illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.
[0202]In the experimental disclosure which follows, the following abbreviations apply: M (molar); mM (millimolar); μM (micromolar); nM (nanomolar); mol (moles); mmol (millimoles); μmol (micromoles); nmol (nanomoles); gm (grams); mg (milligrams); μg (micrograms); pg (picograms); L (liters); ml (milliliters); μl (microliters); cm (centimeters); mm (millimeters); μm (micrometers); nm (nanometers); ° C. (degrees Centigrade); AMP (adenosine 5'-monophosphate); BSA (bovine serum albumin); cDNA (copy or complimentary DNA); CS (calf serum); DNA (deoxyribonucleic acid); ssDNA (single stranded DNA); dsDNA (double stranded DNA); dNTP (deoxyribonucleotide triphosphate); LH (luteinizing hormone); NIH (National Institues of Health, Besthesda, Md.); RNA (ribonucleic acid); PBS (phosphate buffered saline); g (gravity); OD (optical density); HEPES (N-[2-Hydroxyethyl]piperazine-N-[2-ethanesulfonic acid]); HBS (HEPES buffered saline); PBS (phosphate buffered saline); SDS (sodium dodecylsulfate); Tris.HCl (tris[Hydroxymethyl]aminomethane-hydrochloride); Klenow (DNA polymerase I large (Klenow) fragment); rpm (revolutions per minute); EGTA (ethylene glycol-bis(β-aminoethyl ether) N,N, N',N'-tetraacetic acid); EDTA (ethylenediaminetetracetic acid); bla (β-lactamase or ampicillin-resistance gene); OR1 (plasmid origin of replication); lacI (lac repressor); X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside); ATCC (American Type Culture Collection, Rockville, Md.); GIBCO/BRL (GIBCO/BRL, Grand Island, N.Y.); Perkin-Elmer (Perkin-Elmer, Norwalk, Conn.); and Sigma (Sigma Chemical Company, St. Louis, Mo.).
EXAMPLE 1
Vector Construction
[0203]The following Example describes the construction of vectors used in the experiments below.
A. CMV MN14
[0204]The CMV MN14 vector (SEQ ID NO:4; MN14 antibody is described in U.S. Pat. No. 5,874,540, incorporated herein by reference) comprises the following elements, arranged in 5' to 3' order: CMV promoter; MN14 heavy chain signal peptide, MN14 antibody heavy chain; IRES from encephalomyocarditis virus; bovine α-lactalbumin signal peptide; MN14 antibody light chain; and 3' MoMuLV LTR. In addition to sequences described in SEQ ID NO: 4, the CMV MN14 vector further comprises a 5' MoMuLV LTR, a MoMuLV extended viral packaging signal, and a neomycin phosphotransferase gene (these additional elements are provided in SEQ ID NO:7; the 5' LTR is derived from Moloney Murine Sarcoma Virus in each of the constructs described herein, but is converted to the MoMuLV 5' LTR when integrated).
[0205]This construct uses the 5' MoMuLV LTR to control production of the neomycin phosphotransferase gene. The expression of MN14 antibody is controlled by the CMV promoter. The MN14 heavy chain gene and light chain gene are attached together by an IRES sequence. The CMV promoter drives production of a mRNA containing the heavy chain gene and the light chain gene attached by the IRES. Ribosomes attach to the mRNA at the CAP site and at the IRES sequence. This allows both heavy and light chain protein to be produced from a single mRNA. The mRNA expression from the LTR as well as from the CMV promoter is terminated and poly adenylated in the 3' LTR. The construct was cloned by similar methods as described in section B below.
[0206]The IRES sequence (SEQ ID NO:3) comprises a fusion of the IRES from the plasmid pLXIN (Clontech) and the bovine α-lactalbumin signal peptide. The initial ATG of the signal peptide was attached to the IRES to allow the most efficient translation initiation from the IRES. The 3' end of the signal peptide provides a multiple cloning site allowing easy attachment of any protein of interest to create a fusion protein with the signal peptide. The IRES sequence can serve as a translational enhancer as well as creating a second translation initiation site that allows two proteins to be produced from a single mRNA.
[0207]The IRES-bovine α-lactalbumin signal peptide was constructed as follows. The portion of the plasmid pLXIN (Clontech, Palo Alto, Calif.) containing the ECMV IRES was PCR amplified using the following primers.
TABLE-US-00002 Primer 1 (SEQ ID NO: 35): 5' GATCCACTAGTAACGGCCGCCAGAATTCGC 3' Primer 2 (SEQ ID NO: 36): 5' CAGAGAGACAAAGGAGGCCATATTATCATCGTGTTTTTCAAAG 3'
[0208]Primer 2 attaches a tail corresponding to the start of the bovine α-lactalbumin signal peptide coding region to the IRES sequence. In addition, the second triplet codon of the α-lactalbumin signal peptide was mutated from ATG to GCC to allow efficient translation from the IRES sequence. This mutation results in a methionine to alanine change in the protein sequence. This mutation was performed because the IRES prefers an alanine as the second amino acid in the protein chain. The resulting IRES PCR product contains an EcoRI site on the 5' end of the fragment ((just downstream of Primer 1 above).
[0209]Next, the α-lactalbumin signal peptide containing sequence was PCR amplified from the α-LA Signal Peptide vector construct using the following primers.
TABLE-US-00003 Primer 3 (SEQ ID NO: 14): 5' CTTTGAAAAACACGATGATAATATGGCCTCCTTTGTCTCTCTG 3' Primer 4 (SEQ ID NO: 15): 5' TTCGCGAGCTCGAGATCTAGATATCCCATG 3'
[0210]Primer 3 attaches a tail corresponding to the 3' end of the IRES sequence to the α-lactalbumin signal peptide coding region. As stated above, the second triplet codon of the bovine α-lactalbumin signal peptide was mutated to allow efficient translation from the IRES sequence. The resulting signal peptide PCR fragment contains NaeI, NcoI, EcoRV, XbaI, BglII and XhoI sites on the 3' end.
[0211]After the IRES and signal peptide were amplified individually using the primers shown above, the two reaction products were mixed and PCR was performed using primer 1 and primer 4. The resultant product of this reaction is a spliced fragment that contains the IRES attached to the full length α-lactalbumin signal peptide. The ATG encoding the start of the signal peptide is placed at the same location as the ATG encoding the start of the neomycin phosphotransferase gene found in the vector pLXIN. The fragment also contains the EcoRI site on the 5' end and NaeI, NcoI, EcoRV, XbaI, BglII and XhoI sites on the 3' end.
[0212]The spliced IRES/α-lactalbumin signal peptide PCR fragment was digested with EcoRI and XhoI. The α-LA Signal Peptide vector construct was also digested with EcoRI and XhoI. These two fragments were ligated together to give the pIRES construct.
[0213]The IRES/α-lactalbumin signal peptide portion of the pIRES vector was sequenced and found to contain mutations in the 5' end of the IRES. These mutations occur in a long stretch of C's and were found in all clones that were isolated.
[0214]To repair this problem, pLXIN DNA was digested with EcoRI and BsmFI. The 500 bp band corresponding to a portion of the IRES sequence was isolated. The mutated IRES/α-lactalbumin signal peptide construct was also digested with EcoRI and BsmFI and the mutated IRES fragment was removed. The IRES fragment from pLXIN was then substituted for the IRES fragment of the mutated IRES/α-lactalbumin signal peptide construct. The IRES/α-LA signal peptide portion of resulting plasmid was then verified by DNA sequencing.
[0215]The resulting construct was found to have a number of sequence differences when compared to the expected pLXIN sequence obtained from Clontech. We also sequenced the IRES portion of pLXIN purchased from Clontech to verify its sequence. The differences from the expected sequence also appear to be present in the pLXIN plasmid that we obtained from Clontech. Four sequence differences were identified: [0216]bp 347 T--was G in pLXIN sequence [0217]bp 786-788 ACG--was GC in LXIN sequence.
B. CMV LL2
[0218]The CMV LL2 (SEQ ID NO:5; LL2 antibody is described in U.S. Pat. No. 6,187,287, incorporated herein by reference) construct comprises the following elements, arranged in 5' to 3' order: 5'CMV promoter (Clonetech), LL2 heavy chain signal peptide, LL2 antibody heavy chain; IRES from encephalomyocarditis virus; bovine α-LA signal peptide; LL2 antibody light chain; and 3' MoMuLV LTR. In addition to sequences described in SEQ ID NO:5, the CMV LL2 vector further comprises a 5' MoMuLV LTR, a MoMuLV extended viral packaging signal, and a neomycin phosphotransferase gene (these additional elements are provided in SEQ ID NO:7).
[0219]This construct uses the 5' MoMuLV LTR to control production of the neomycin phosphotransferase gene. The expression of LL2 antibody is controlled by the CMV promoter (Clontech). The LL2 heavy chain gene and light chain gene are attached together by an IRES sequence. The CMV promoter drives production of a mRNA containing the heavy chain gene and the light chain gene attached by the IRES. Ribosomes attach to the mRNA at the CAP site and at the IRES sequence. This allows both heavy and light chain protein to be produced from a single mRNA. The mRNA expression from the LTR as well as from the CMV promoter is terminated and poly adenylated in the 3' LTR.
[0220]The IRES sequence (SEQ ID NO:3) comprises a fusion of the IRES from the plasmid pLXIN (Clontech) and the bovine alpha-lactalbumin signal peptide. The initial ATG of the signal peptide was attached to the IRES to allow the most efficient translation initiation from the IRES. The 3' end of the signal peptide provides a multiple cloning site allowing easy attachment of any protein of interest to create a fusion protein with the signal peptide. The IRES sequence can serve as a translational enhancer as well as creating a second translation initiation site that allows two proteins to be produced from a single mRNA.
[0221]The LL2 light chain gene was attached to the IRES α-lactalbumin signal peptide as follows. The LL2 light chain was PCR amplified from the vector pCRLL2 using the following primers.
TABLE-US-00004 Primer 1 (SEQ ID NO: 16): 5' CTACAGGTGTCCACGTCGACATCCAGCTGACCCAG 3' Primer 2 (SEQ ID NO: 17): 5' CTGCAGAATAGATCTCTAACACTCTCCCCTGTTG 3'
[0222]These primers add a HincII site right at the start of the coding region for mature LL2 light chain. Digestion of the PCR product with HincII gives a blunt end fragment starting with the initial GAC encoding mature LL2 on the 5' end. Primer 2 adds a BglII site to the 3' end of the gene right after the stop codon. The resulting PCR product was digested with HincII and BglII and cloned directly into the IRES-Signal Peptide plasmid that was digested with Nael and BglII.
[0223]The Kozak sequence of the LL2 heavy chain gene was then modified. The vector pCRMN14HC was digested with XhoI and AvrII to remove about a 400 bp fragment. PCR was then used to amplify the same portion of the LL2 heavy chain construct that was removed by the XhoI-AvrII digestion. This amplification also mutated the 5' end of the gene to add a better Kozak sequence to the clone. The Kozak sequence was modified to resemble the typical IgG Kozak sequence. The PCR primers are shown below.
TABLE-US-00005 Primer 1 (SEQ ID NO: 18): 5' CAGTGTGATCTCGAGAATTCAGGACCTCACCATGGGATGGAGCTGTA TCAT 3' Primer 2 (SEQ ID NO: 19): 5' AGGCTGTATTGGTGGATTCGTCT 3'
[0224]The PCR product was digested with XhoI and AvrII and inserted back into the previously digested plasmid backbone.
[0225]The "good" Kozak sequence was then added to the light chain gene. The "good" Kozak LL2 heavy chain gene construct was digested with EcoRI and the heavy chain gene containing fragment was isolated. The IRES α-Lactalbumin Signal Peptide LL2 light chain gene construct was also digested with EcoRI. The heavy chain gene was then cloned into the EcoRI site of IRES light chain construct. This resulted in the heavy chain gene being placed at the 5' end of the IRES sequence.
[0226]Next, a multiple cloning site was added into the LNCX retroviral backbone plasmid. The LNCX plasmid was digested with HindIII and ClaI. Two oligonucleotide primers were produced and annealed together to create an double stranded DNA multiple cloning site. The following primers were annealed together.
TABLE-US-00006 Primer 1 (SEQ ID NO: 20): 5' AGCTTCTCGAGTTAACAGATCTAGGCCTCCTAGGTCGACAT 3' Primer 2 (SEQ ID NO: 21): 5' CGATGTCGACCTAGGAGGCCTAGATCTGTTAACTCGAGA 3'
[0227]After annealing, the multiple cloning site was ligated into LNCX to create LNC-MCS.
[0228]Next, the double chain gene fragment was ligated into the retroviral backbone gene construct. The double chain gene construct created above was digested with SalI and BglII and the double chain containing fragment was isolated. The retroviral expression plasmid LNC-MCS was digested with XhoI and BglII. The double chain fragment was then cloned into the LNC-MCS retroviral expression backbone.
[0229]Next, an RNA splicing problem in the construct was corrected. The construct was digested with NsiI. The resulting fragment was then partially digested with EcoRI. The fragments resulting from the partial digest that were approximately 9300 base pairs in size were gel purified. A linker was created to mutate the splice donor site at the 3' end of the LL2 heavy chain gene. The linker was again created by annealing two oligonucleotide primers together to form the double stranded DNA linker. The two primers used to create the linker are shown below.
TABLE-US-00007 Primer 1 (SEQ ID NO: 22): 5' CGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTC CCGGGAAATGAAAGCCG 3' Primer 2 (SEQ ID NO: 23): 5' AATTCGGCTTTCATTTCCCGGGAGACAGGGAGAGGCTCTTCTGCGTG TAGTGGTTGTGCAGAGCCTCGTGCA 3'
[0230]After annealing the linker was substituted for the original NsiI/EcoRI fragment that was removed during the partial digestion.
C. MMTV MN14
[0231]The MMTV MN14 (SEQ ID NO:6) construct comprises the following elements, arranged in 5' to 3' order: 5' MMTV promoter; double mutated PPE sequence; MN14 antibody heavy chain; IRES from encephalomyocarditis virus; bovine αLA signal peptide MN 14 antibody light chain; WPRE sequence; and 3' MoMuLV LTR. In addition to the sequences described in SEQ ID NO:6, the MMTV MN14 vector further comprises a MoMuLV LTR, MoMuLV extended viral packaging signal; neomycin phosphotransferase gene located 5' of the MMTV promoter (these additional elements are provided in SEQ ID NO: 7).
[0232]This construct uses the 5' MoMuLV LTR to control production of the neomycin phosphotransferase gene. The expression of MN14 antibody is controlled by the MMTV promoter (Pharmacia). The MN14 heavy chain gene and light chain gene are attached together by an IRES/bovine α-LA signal peptide sequence (SEQ ID NO: 3). The MMTV promoter drives production of a mRNA containing the heavy chain gene and the light chain gene attached by the IRES/bovine α-LA signal peptide sequence. Ribosomes attach to the mRNA at the CAP site and at the IRES/bovine α-LA signal peptide sequence. This allows both heavy and light chain protein to be produced from a single mRNA. In addition, there are two genetic elements contained within the mRNA to aid in export of the mRNA from the nucleus to the cytoplasm and aid in poly-adenylation of the mRNA. The PPE sequence is contained between the RNA CAP site and the start of the MN14 protein coding region, the WPRE is contained between the end of MN14 protein coding and the poly-adenylation site. The mRNA expression from the LTR as well as from the MMTV promoter is terminated and poly-adenylated in the 3' LTR.
[0233]ATG sequences within the PPE element (SEQ ID NO:2) were mutated to prevent potential unwanted translation initiation. Two copies of this mutated sequence were used in a head to tail array. This sequence is placed just downstream of the promoter and upstream of the Kozak sequence and signal peptide-coding region. The WPRE is isolated from woodchuck hepatitis virus and also aids in the export of mRNA from the nucleus and creating stability in the mRNA. If this sequence is included in the 3' untranslated region of the RNA, level of protein expression from this RNA increases up to 10-fold.
D. α-LA MN14
[0234]The α-LA MN14 (SEQ ID NO:7) construct comprises the following elements, arranged in 5' to 3' order: 5' MoMuLV LTR, MoMuLV extended viral packaging signal, neomycin phosphotransferase gene, bovine/human alpha-lactalbumin hybrid promoter, double mutated PPE element, MN14 heavy chain signal peptide, MN14 antibody heavy chain, IRES from encephalomyocarditis virus/bovine αLA signal peptide, M14 antibody light chain, WPRE sequence; and 3' MoMuLV LTR.
[0235]This construct uses the 5' MoMuLV LTR to control production of the neomycin phosphotransferase gene. The expression of MN14 antibody is controlled by the hybrid α-LA promoter (SEQ ID NO:1). The MN14 heavy chain gene and light chain gene are attached together by an IRES sequence/bovine α-LA signal peptide (SEQ ID NO:3). The α-LA promoter drives production of a mRNA containing the heavy chain gene and the light chain gene attached by the IRES. Ribosomes attach to the mRNA at the CAP site and at the IRES sequence. This allows both heavy and light chain protein to be produced from a single mRNA.
[0236]In addition, there are two genetic elements contained within the mRNA to aid in export of the mRNA from the nucleus to the cytoplasm and aid in poly-adenylation of the mRNA. The mutated PPE sequence (SEQ ID NO:2) is contained between the RNA CAP site and the start of the MN14 protein coding region. ATG sequences within the PPE element (SEQ ID NO:2) were mutated to prevent potential unwanted translation initiation. Two copies of this mutated sequence were used in a head to tail array. This sequence is placed just downstream of the promoter and upstream of the Kozak sequence and signal peptide-coding region. The WPRE was isolated from woodchuck hepatitis virus and also aids in the export of mRNA from the nucleus and creating stability in the mRNA. If this sequence is included in the 3' untranslated region of the RNA, level of protein expression from this RNA increases up to 10-fold. The WPRE is contained between the end of MN14 protein coding and the poly-adenylation site. The mRNA expression from the LTR as well as from the bovine/human alpha-lactalbumin hybrid promoter is terminated and poly adenylated in the 3' LTR.
[0237]The bovine/human alpha-lactalbumin hybrid promoter (SEQ ID NO:1) is a modular promoter/enhancer element derived from human and bovine alpha-lactalbumin promoter sequences. The human portion of the promoter is from +15 relative to transcription start point (tsp) to -600 relative to the tsp. The bovine portion is then attached to the end of the human portion and corresponds to -550 to -2000 relative to the tsp. The hybrid was developed to remove poly-adenylation signals that were present in the bovine promoter and hinder retroviral RNA production. It was also developed to contain genetic control elements that are present in the human gene, but not the bovine.
[0238]For construction of the bovine/human α-lactalbumin promoter, human genomic DNA was isolated and purified. A portion of the human α-lactalbumin promoter was PCR amplified using the following two primers:
TABLE-US-00008 Primer 1 (SEQ ID NO: 24): 5' AAAGCATATGTTCTGGGCCTTGTTACATGGCTGGATTGGTT 3' Primer 2 (SEQ ID NO: 25): 5' TGAATTCGGCGCCCCCAAGAACCTGAAATGGAAGCATCACTCAGTTT CATATAT 3'
[0239]This two primers created a NdeI site on the 5' end of the PCR fragment and a EcoRI site on the 3' end of the PCR fragment.
[0240]The human PCR fragment created using the above primers was double digested with the restriction enzymes NdeI and EcoRI. The plasmid pKBaP-1 was also double digested with NdeI and EcoRI. The plasmid pKBaP-1 contains the bovine α-lactalbumin 5' flanking region attached to a multiple cloning site. This plasmid allows attachment of various genes to the bovine α-lactalbumin promoter.
[0241]Subsequently, the human fragment was ligated/substituted for the bovine fragment of the promoter that was removed from the pKBaP-1 plasmid during the double digestion. The resulting plasmid was confirmed by DNA sequencing to be a hybrid of the Bovine and Human a-lactalbumin promoter/regulatory regions.
[0242]Attachment of the MN14 light chain gene to the IRES α-lactalbumin signal peptide was accomplished as follows. The MN14 light chain was PCR amplified from the vector pCRMN14LC using the following primers.
TABLE-US-00009 Primer 1 (SEQ ID NO: 26): 5' CTACAGGTGTCCACGTCGACATCCAGCTGACCCAG 3' Primer 2 (SEQ ID NO: 27): 5' CTGCAGAATAGATCTCTAACACTCTCCCCTGTTG 3'
[0243]These primers add a HincII site right at the start of the coding region for mature MN14 light chain. Digestion of the PCR product with HincII gives a blunt end fragment starting with the initial GAC encoding mature MN14 on the 5' end. Primer 2 adds a BglII site to the 3' end of the gene right after the stop codon. The resulting PCR product was digested with HincII and BglII and cloned directly into the IRES-Signal Peptide plasmid that was digested with NaeI and BglII.
[0244]Next, the vector pCRMN14HC was digested with XhoI and NruI to remove about a 500 bp fragment. PCR was then used to amplify the same portion of the MN14 heavy chain construct that was removed by the XhoI-NruI digestion. This amplification also mutated the 5' end of the gene to add a better Kozak sequence to the clone. The Kozak sequence was modified to resemble the typical IgG Kozak sequence. The PCR primers are shown below.
TABLE-US-00010 Primer 1 (SEQ ID NO: 28): 5' CAGTGTGATCTCGAGAATTCAGGACCTCACCATGGGATGGAGCTGTA TCAT 3' Primer 2 (SEQ ID NO: 29): 5' GTGTCTTCGGGTCTCAGGCTGT 3'
[0245]The PCR product was digested with XhoI and NruI and inserted back into the previously digested plasmid backbone.
[0246]Next, the "good" Kozak MN14 heavy chain gene construct was digested with EcoRI and the heavy chain gene containing fragment was isolated. The IRES α-Lactalbumin Signal Peptide MN14 light chain gene construct was also digested with EcoRI. The heavy chain gene was then cloned into the EcoRI site of IRES light chain construct. This resulted in the heavy chain gene being placed at the 5' end of the IRES sequence.
[0247]A multiple cloning site was then added to the LNCX retroviral backbone plasmid. The LNCX plasmid was digested with HindIII and ClaI. Two oligonucleotide primers were produced and annealed together to create an double stranded DNA multiple cloning site. The following primers were annealed together.
TABLE-US-00011 Primer 1 (SEQ ID NO: 30): 5' AGCTTCTCGAGTTAACAGATCTAGGCCTCCTAGGTCGACAT 3' Primer 2 (SEQ ID NO: 31): 5' CGATGTCGACCTAGGAGGCCTAGATCTGTTAACTCGAGA 3'
After annealing the multiple cloning site was ligated into LNCX to create LNC-MCS.
[0248]The double chain gene fragment was then inserted into a retroviral backbone gene construct. The double chain gene construct created in step 3 was digested with SalI and BglII and the double chain containing fragment was isolated. The retroviral expression plasmid LNC-MCS was digested with XhoI and BglII. The double chain fragment was then cloned into the LNC-MCS retroviral expression backbone.
[0249]Next, a RNA splicing problem in the construct was repaired. The construct was digested with NsiI. The resulting fragment was then partially digested with EcoRI. The fragments resulting from the partial digest that were approximately 9300 base pairs in size, were gel purified. A linker was created to mutate the splice donor site at the 3' end of the MN14 heavy chain gene. The linker was again created by annealing two oligonucleotide primers together to form the double stranded DNA linker. The two primers used to create the linker are shown below.
TABLE-US-00012 Primer 1 (SEQ ID NO: 32): 5' CGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTC CCGGGAAATGAAAGCCG 3' Primer 2 (SEQ ID NO: 33): 5' AATTCGGCTTTCATTTCCCGGGAGACAGGGAGAGGCTCTTCTGCGTG TAGTGGTTGTGCAGAGCCTCGTGCA 3'
[0250]After annealing the linker was substituted for the original NsiI/EcoRI fragment that was removed during the partial digestion.
[0251]Next, the mutated double chain fragment was inserted into the α-Lactalbumin expression retroviral backbone LN α-LA-Mertz-MCS. The gene construct produced above was digested with BamHI and BglII and the mutated double chain gene containing fragment was isolated. The LN α-LA-Mertz-MCS retroviral backbone plasmid was digested with BglII. The BamHI/BglII fragment was then inserted into the retroviral backbone plasmid.
[0252]A WPRE element was then inserted into the gene construct. The plasmid BluescriptII SK+ WPRE-B11 was digested with BamHI and HincII to remove the WPRE element and the element was isolated. The vector created above was digested with BglII and HpaI. The WPRE fragment was ligated into the BglII and HpaI sites to create the final gene construct.
E. α-LA Bot
[0253]The α-LA Bot (SEQ ID NO:8, botulinum toxin antibody) construct comprises the following elements, arranged in 5' to 3' order: bovine/human alpha-lactalbumin hybrid promoter, mutated PPE element, cc49 signal peptide, botulinum toxin antibody light chain, IRES from encephalomyocarditis virus/bovine α-LA signal peptide, botulinum toxin antibody heavy chain, WPRE sequence, and 3' MoMuLV LTR. In addition, the α-LA botulinum toxin antibody vector further comprises a 5' MoMuLV LTR, a MoMuLV extended viral packaging signal, and a neomycin phosphotransferase gene (these additional elements are provided in SEQ ID NO: 7).
[0254]This construct uses the 5' MoMuLV LTR to control production of the neomycin phosphotransferase gene. The expression of botulinum toxin antibody is controlled by the hybrid a-LA promoter. The botulinum toxin antibody light chain gene and heavy chain gene are attached together by an IRES/bovine α-LA signal peptide sequence. The bovine/human alpha-lactalbumin hybrid promoter drives production of a mRNA containing the light chain gene and the heavy chain gene attached by the IRES. Ribosomes attach to the mRNA at the CAP site and at the IRES sequence. This allows both light and heavy chain protein to be produced from a single mRNA.
[0255]In addition, there are two genetic elements contained within the mRNA to aid in export of the mRNA from the nucleus to the cytoplasm and aid in poly-adenylation of the mRNA. The mutated PPE sequence (SEQ ID NO:2) is contained between the RNA CAP site and the start of the MN14 protein coding region. ATG sequences within the PPE element (SEQ ID NO:2) were mutated to prevent potential unwanted translation initiation. Two copies of this mutated sequence were used in a head to tail array. This sequence was placed just downstream of the promoter and upstream of the Kozak sequence and signal peptide-coding region. The WPRE was isolated from woodchuck hepatitis virus and also aids in the export of mRNA from the nucleus and creating stability in the mRNA. If this sequence is included in the 3' untranslated region of the RNA, level of protein expression from this RNA increases up to 10-fold. The WPRE is contained between the end of MN14 protein coding and the poly-adenylation site. The mRNA expression from the LTR as well as from the bovine/human alpha-lactalbumin hybrid promoter is terminated and poly adenylated in the 3' LTR.
[0256]The bovine/human α-lactalbumin hybrid promoter (SEQ ID NO:1) is a modular promoter/enhancer element derived from human and bovine α-lactalbumin promoter sequences. The human portion of the promoter is from +15 relative to transcription start point to -600 relative to the tsp. The bovine portion is then attached to the end of the human portion and corresponds to -550 to -2000 relative to the tsp. The hybrid was developed to remove poly-adenylation signals that were present in the bovine promoter and hinder retroviral RNA production. It was also developed to contain genetic control elements that are present in the human gene, but not the bovine. Likewise, the construct contains control elements present in the bovine but not in the human.
F. LSRNL
[0257]The LSRNL (SEQ ID NO:9) construct comprises the following elements, arranged in 5' to 3' order: 5' MoMuLV LTR, MoMuLV viral packaging signal; hepatitis B surface antigen; RSV promoter; neomycin phosphotransferase gene; and 3' MoMuLV LTR.
[0258]This construct uses the 5' MoMuLV LTR to control production of the Hepatitis B surface antigen gene. The expression of the neomycin phosphotransferase gene is controlled by the RSV promoter. The mRNA expression from the LTR as well as from the RSV promoter is terminated and poly adenylated in the 3' LTR.
G. α-LA cc49IL2
[0259]The α-LA cc49IL2 (SEQ ID NO:10; the cc49 antibody is described in U.S. Pat. Nos. 5,512,443; 5,993,813; and 5,892,019; each of which is herein incorporated by reference) construct comprises the following elements, arranged in 5' to 3' order: 5' bovine/human α-lactalbumin hybrid promoter; cc49-IL2 coding region; and 3' MoMuLV LTR. This gene construct expresses a fusion protein of the single chain antibody cc49 attached to Interleukin-2. Expression of the fusion protein is controlled by the bovine/human α-lactalbumin hybrid promoter.
[0260]The bovine/human α-lactalbumin hybrid promoter (SEQ ID NO:1) is a modular promoter/enhancer element derived from human and bovine alpha-lactalbumin promoter sequences. The human portion of the promoter is from +15 relative to transcription start point to -600 relative to the tsp. The bovine portion is then attached to the end of the human portion and corresponds to -550 to -2000 relative to the tsp. The hybrid was developed to remove poly-adenylation signals that were present in the bovine promoter and hinder retroviral RNA production. It was also developed to contain genetic control elements that are present in the human gene, but not the bovine. Likewise, the construct contains control elements present in the bovine but not in the human. The 3' viral LTR provide the poly-adenylation sequence for the mRNA.
H. α-LA YP
[0261]The α-LA YP (SEQ ID NO: 11) construct comprises the following elements, arranged in 5' to 3' order: 5' bovine/human alpha-lactalbumin hybrid promoter; double mutated PPE sequence; bovine αLA signal peptide; Yersenia pestis antibody heavy chain Fab coding region; EMCV IRES/bovine α-LA signal peptide; Yersenia pestis antibody light chain Fab coding region; WPRE sequence; 3' MoMuLV LTR.
[0262]This gene construct will cause the expression of Yersenia pestis mouse Fab antibody. The expression of the gene construct is controlled by the bovine/human α-lactalbumin hybrid promoter. The PPE sequence and the WPRE sequence aid in moving the mRNA from the nucleus to the cytoplasm. The IRES sequence allows both the heavy and the light chain genes to be translated from the same mRNA. The 3' viral LTR provides the poly-adenylation sequence for the mRNA.
[0263]In addition, there are two genetic elements contained within the mRNA to aid in export of the mRNA from the nucleus to the cytoplasm and aid in poly-adenylation of the mRNA. The mutated PPE sequence (SEQ ID NO:2) is contained between the RNA CAP site and the start of the MN14 protein coding region. ATG sequences within the PPE element (SEQ ID NO:2) were mutated (bases 4, 112, 131, and 238 of SEQ ID NO: 2 were changed from a G to a T) to prevent potential unwanted translation initiation. Two copies of this mutated sequence were used in a head to tail array. This sequence was placed just downstream of the promoter and upstream of the Kozak sequence and signal peptide-coding region. The WPRE was isolated from woodchuck hepatitis virus and also aids in the export of mRNA from the nucleus and creating stability in the mRNA. If this sequence is included in the 3' untranslated region of the RNA, level of protein expression from this RNA increases up to 10-fold. The WPRE is contained between the end of MN14 protein coding and the poly-adenylation site. The mRNA expression from the LTR as well as from the bovine/human alpha-lactalbumin hybrid promoter is terminated and poly adenylated in the 3' LTR.
[0264]The bovine/human alpha-lactalbumin hybrid promoter (SEQ ID NO:1) is a modular promoter/enhancer element derived from human and bovine alpha-lactalbumin promoter sequences. The human portion of the promoter is from +15 relative to transcription start point to -600 relative to the tsp. The bovine portion is then attached to the end of the human portion and corresponds to -550 to -2000 relative to the tsp. The hybrid was developed to remove poly-adenylation signals that were present in the bovine promoter and hinder retroviral RNA production. It was also developed to contain genetic control elements that are present in the human gene, but not the bovine. Likewise, the construct contains control elements present in the bovine but not in the human.
EXAMPLE 2
Generation of Cell Lines Stably Expressing the MoMLV gag and pol Proteins
[0265]Examples 2-5 describe the production of pseudotyped retroviral vectors. These methods are generally applicable to the production of the vectors described above. The expression of the fusogenic VSV G protein on the surface of cells results in syncytium formation and cell death. Therefore, in order to produce retroviral particles containing the VSV G protein as the membrane-associated protein a two-step approach was taken. First, stable cell lines expressing the gag and pol proteins from MoMLV at high levels were generated (e.g., 293GPSD cells). The stable cell line which expresses the gag and pol proteins produces noninfectious viral particles lacking a membrane-associated protein (e.g., an envelope protein). The stable cell line was then co-transfected, using the calcium phosphate precipitation, with VSV-G and gene of interest plasmid DNAs. The pseudotyped vector generated was used to infect 293GPSD cells to produce stably transformed cell lines. Stable cell lines can be transiently transfected with a plasmid capable of directing the high level expression of the VSV G protein (see below). The transiently transfected cells produce VSV G-pseudotyped retroviral vectors which can be collected from the cells over a period of 3 to 4 days before the producing cells die as a result of syncytium formation.
[0266]The first step in the production of VSV G-pseudotyped retroviral vectors, the generation of stable cell lines expressing the MoMLV gag and pol proteins is described below. The human adenovirus Ad-5-transformed embryonal kidney cell line 293 (ATCC CRL 1573) was cotransfected with the pCMVgag-pol and the gene encoding for phleomycin. pCMV gag-pol contains the MoMLV gag and pol genes under the control of the CMV promoter (pCMV gag-pol is available from the ATCC).
[0267]The plasmid DNA was introduced into the 293 cells using calcium phosphate co-precipitation (Graham and Van der Eb, Virol. 52:456 [1973]). Approximately 5×105 293 cells were plated into a 100 mm tissue culture plate the day before the DNA co-precipitate was added. Stable transformants were selected by growth in DMEM-high glucose medium containing 10% FCS and 10 μg/ml phleomycin (selective medium). Colonies which grew in the selective medium were screened for extracellular reverse transcriptase activity (Goff et al., J. Virol. 38:239 [1981]) and intracellular p30gag expression. The presence of p30gag expression was determined by Western blotting using a goat-anti p30 antibody (NCl antiserum 77S000087). A clone which exhibited stable expression of the retroviral genes was selected. This clone was named 293GPSD (293 gag-pol-San Diego). The 293GPSD cell line, a derivative of the human Ad-5-transformed embryonal kidney cell line 293, was grown in DMEM-high glucose medium containing 10% FCS.
EXAMPLE 3
Preparation of Pseudotyped Retroviral Vectors Bearing the G Glycoprotein of VSV
[0268]In order to produce VSV G protein pseudotyped retrovirus the following steps were taken. The 293GPSD cell line was co-transfected with VSV-G plasmid and DNA plasmid of interest. This co-transfection generates the infectious particles used to infect 293GPSD cells to generate the packaging cell lines. This Example describes the production of pseudotyped LNBOTDC virus. This general method may be used to produce any of the vectors described in Example 1.
[0269]a) Cell Lines and Plasmids
[0270]The packaging cell line, 293GPSD was grown in alpha-MEM-high glucose medium containing 10% FCS The titer of the pseudo-typed virus may be determined using either 208F cells (Quade, Virol. 98:461 [1979]) or NIH/3T3 cells (ATCC CRL 1658); 208F and NIH/3T3 cells are grown in DMEM-high glucose medium containing 10% CS.
[0271]The plasmid LNBOTDC contains the gene encoding BOTD under the transcriptional control of cytomegalovirus intermediate-early promoter followed by the gene encoding neomycin phosphotransferase (Neo) under the transcriptional control of the LTR promoter. The plasmid pHCMV-G contains the VSV G gene under the transcriptional control of the human cytomegalovirus intermediate-early promoter (Yee et al., Meth. Cell Biol. 43:99 [1994]).
[0272]b) Production of Stable Packaging Cell Lines, Pseudotyped Vector and Titering of Pseudotyped LNBOTDC Vector
[0273]LNBOTDC DNA (SEQ ID NO: 13) was co-transfected with pHCMV-G DNA into the packaging line 293GPSD to produce LNBOTDC virus. The resulting LNBOTDC virus was then used to infect 293GPSD cells to transform the cells. The procedure for producing pseudotyped LNBOTDC virus was carried out as described (Yee et al., Meth. Cell Biol. 43:99 [1994].
[0274]This is a retroviral gene construct that upon creation of infectious replication defective retroviral vector will cause the insertion of the sequence described above into the cells of interest. Upon insertion the CMV regulatory sequences control the expression of the botulinum toxin antibody heavy and light chain genes. The IRES sequence allows both the heavy and the light chain genes to be translated from the same mRNA. The 3' viral LTR provides the poly-adenylation sequence for the mRNA.
[0275]Both heavy and light chain protein for botulinum toxin antibody are produced from this signal mRNA. The two proteins associated to form active botulinum toxin antibody. The heavy and light chain proteins also appear to be formed in an equal molar ratio to each other.
[0276]Briefly, on day 1, approximately 5×104 293GPSD cells were placed in a 75 cm2 tissue culture flask. On the following day (day 2), the 293GPSD cells were transfected with 25 μg of pLNBOTDC plasmid DNA and 25 μg of VSV-G plasmid DNA using the standard calcium phosphate co-precipitation procedure (Graham and Van der Eb, Virol. 52:456 [1973]). A range of 10 to 40 μg of plasmid DNA may be used. Because 293GPSD cells may take more than 24 hours to attach firmly to tissue culture plates, the 293GPSD cells may be placed in 75 cm2 flasks 48 hours prior to transfection. The transfected 293GPSD cells provide pseudotyped LNBOTDC virus.
[0277]On day 3, approximately 1×105 293GPSD cells were placed in a 75 cm2 tissue culture flask 24 hours prior to the harvest of the pseudotyped virus from the transfected 293GPSD cells. On day 4, culture medium was harvested from the transfected 2093GPSD cells 48 hours after the application of the pLNBOTDC and VSV-G DNA. The culture medium was filtered through a 0.45 μm filter and polybrene was added to a final concentration of 8 μg/ml. The culture medium containing LNBOTDC virus was used to infect the 293GPSD cells as follows. The culture medium was removed from the 293GPSD cells and was replaced with the LNBOTDC virus containing culture medium. Polybrene was added to the medium following addition to cells. The virus containing medium was allowed to remain on the 293GPSD cells for 24 hours. Following the 16 hour infection period (on day 5), the medium was removed from the 293GPSD cells and was replaced with fresh medium containing 400 μg/ml G418 (GIBCO/BRL). The medium was changed approximately every 3 days until G418-resistant colonies appeared approximately two weeks later.
[0278]The G418-resistant 293 colonies were plated as single cells in 96 wells. Sixty to one hundred G418-resistant colonies were screened for the expression of the BOTDC antibody in order to identify high producing clones. The top 10 clones in 96-well plates were transferred 6-well plates and allowed to grow to confluency.
[0279]The top 10 clones were then expanded to screen for high titer production. Based on protein expression and titer production, 5 clonal cell lines were selected. One line was designated the master cell bank and the other 4 as backup cell lines. Pseudotyped vector was generated as follows. Approximately 1×106 293GPSD/LNBOTDC cells were placed into a 75 cm2 tissue culture flask. Twenty-four hours later, the cells were transfected with 25 μg of pHCMV-G plasmid DNA using calcium phosphate co-precipitation. Six to eight hours after the calcium-DNA precipitate was applied to the cells, the DNA solution was replaced with fresh culture medium (lacking G418). Longer transfection times (overnight) were found to result in the detachment of the majority of the 293GPSD/LNBOTDC cells from the plate and are therefore avoided. The transfected 293GPSD/LNBOTDC cells produce pseudotyped LNBOTDC virus.
[0280]The pseudotyped LNBOTDC virus generated from the transfected 293GPSD/LNBOTDC cells can be collected at least once a day between 24 and 96 hr after transfection. The highest virus titer was generated approximately 48 to 72 hr after initial pHCMV-G transfection. While syncytium formation became visible about 48 hr after transfection in the majority of the transfected cells, the cells continued to generate pseudotyped virus for at least an additional 48 hr as long as the cells remained attached to the tissue culture plate. The collected culture medium containing the VSV G-pseudotyped LNBOTDC virus was pooled, filtered through a 0.45 μm filter and stored at -80° C. or concentrated immediately and then stored at -80° C.
[0281]The titer of the VSV G-pseudotyped LNBOTDC virus was then determined as follows. Approximately 5×104 rat 208F fibroblasts cells were plated into 6 well plates. Twenty-fours hours after plating, the cells were infected with serial dilutions of the LNBOTDC virus-containing culture medium in the presence of 8 μg/ml polybrene. Twenty four hours after infection with virus, the medium was replaced with fresh medium containing 400 μg/ml G418 and selection was continued for 14 days until G418-resistant colonies became visible. Viral titers were typically about 0.5 to 5.0×106 colony forming units (cfu)/ml. The titer of the virus stock could be concentrated to a titer of greater than 109 cfu/ml as described below.
EXAMPLE 4
Concentration of Pseudotyped Retroviral Vectors
[0282]The VSV G-pseudotyped LNBOTDC viruses were concentrated to a high titer by one cycle of ultracentrifugation. However, two cycles can be performed for further concentration. The frozen culture medium collected as described in Example 2 which contained pseudotyped LNBOTDC virus was thawed in a 37° C. water bath and was then transferred to Oakridge centrifuge tubes (50 ml Oakridge tubes with sealing caps, Nalge Nunc International) previously sterilized by autoclaving. The virus was sedimented in a JA20 rotor (Beckman) at 48,000×g (20,000 rpm) at 4° C. for 120 min. The culture medium was then removed from the tubes in a biosafety hood and the media remaining in the tubes was aspirated to remove the supernatent. The virus pellet was resuspended to 0.5 to 1% of the original volume of culture medium DMEM. The resuspended virus pellet was incubated overnight at 4° C. without swirling. The virus pellet could be dispersed with gentle pipetting after the overnight incubation without significant loss of infectious virus. The titer of the virus stock was routinely increased 100- to 300-fold after one round of ultracentrifugation. The efficiency of recovery of infectious virus varied between 30 and 100%.
[0283]The virus stock was then subjected to low speed centrifugation in a microfuge for 5 min at 4° C. to remove any visible cell debris or aggregated virions that were not resuspended under the above conditions. It was noted that if the virus stock is not to be used for injection into oocytes or embryos, this centrifugation step may be omitted.
[0284]The virus stock can be subjected to another round of ultracentrifugation to further concentrate the virus stock. The resuspended virus from the first round of centrifugation is pooled and pelleted by a second round of ultracentrifugation which is performed as described above. Viral titers are increased approximately 2000-fold after the second round of ultracentrifugation (titers of the pseudotyped LNBOTDC virus are typically greater than or equal to 1×109 cfu/ml after the second round of ultracentrifugation).
[0285]The titers of the pre- and post-centrifugation fluids were determined by infection of 208F cells (NIH 3T3 or bovine mammary epithelial cells can also be employed) followed by selection of G418-resistant colonies as described above in Example 2.
EXAMPLE 5
Preparation of Pseudotyped Retrovirus for Infection of Host Cells
[0286]The concentrated pseudotyped retroviruses were resuspended in 0.1×HBS (2.5 mM HEPES, pH 7.12, 14 mM NaCl, 75 μM Na2HPO4--H2O) and 18 μl aliquots were placed in 0.5 ml vials (Eppendorf) and stored at -80° C. until used. The titer of the concentrated vector was determined by diluting 1 μl of the concentrated virus 10-7- or 10-8-fold with 0.1×HBS. The diluted virus solution was then used to infect 208F and bovine mammary epithelial cells and viral titers were determined as described in Example 2.
EXAMPLE 6
Expression of MN14 by Host Cells
[0287]This Example describes the production of antibody MN14 from cells transfected with a high number of integrating vectors. Pseudotyped vector were made from the packaging cell lines for the following vectors: CMV MN14, α-LA MN14, and MMTV MN14. Rat fibroblasts (208F cells), MDBK cells (bovine kidney cells), and bovine mammary epithelial cells were transfected at a multiplicity of infection of 1000. One thousand cells were plated in a T25 flask and 106 colony forming units (CFU's) of vector in 3 ml media was incubated with the cells. The duration of the infection was 24 hr, followed by a media change. Following transfection, the cells were allowed to grow and become confluent.
[0288]The cell lines were grown to confluency in T25 flasks and 5 ml of media was changed daily. The media was assayed daily for the presence of MN14. All of the MN14 produced is active (an ELISA to detect human IgG gave the exact same values as the CEA binding ELISA) and Western blotting has shown that the heavy and light chains are produced at a ratio that appears to be a 1:1 ratio. In addition, a non-denaturing Western blot indicated that what appeared to be 100% of the antibody complexes were correctly formed (See FIG. 1: Lane 1, 85 ng control Mn14; Lane 2, bovine mammary cell line, α-LA promoter; Lane 3, bovine mammary cell line, CMV promoter; Lane 4, bovine kidney cell line, α-LA promoter; Lane 5, bovine kidney cell line, CMV promoter; Lane 6, 208 cell line, α-LA promoter; Lane 7, 208 cell line, CMV promoter)).
[0289]FIG. 2 is a graph showing the production of MN14 over time for four cell lines. The Y axis shows MN14 production in ng/ml of media. The X-axis shows the day of media collection for the experiment. Four sets of data are shown on the graph. The comparisons are between the CMV and α-LA promoter and between the 208 cells and the bovine mammary cells. The bovine mammary cell line exhibited the highest expression, followed by the 208F cells and MDBK cells. With respect to the constructs, the CMV-driven construct demonstrated the highest level of expression, followed by the α-LA driven gene construct and the MMTV construct. At 2 weeks, the level of daily production of the CMV construct was 4.5 μg/ml of media (22.5 mg/day in a T25 flask). The level of expression subsequently increased slowly to 40 μg/day as the cells became very densely confluent over the subsequent week. 2.7 L of media from an α-lac-MN14 packaging cell line was processed by affinity chromatography to produce a purified stock of MN14.
[0290]FIG. 3 is a western blot of a 15% SDS-PAGE gel run under denaturing conditions in order to separate the heavy and light chains of the MN14 antibody. Lane 1 shows MN14 from bovine mammary cell line, hybrid α-LA promoter; lane 2 shows MN14 from bovine mammary cell line, CMV promoter; lane 3 shows MN14 from bovine kidney cell line, hybrid αLA promoter; lane 4 shows MN14 from bovine kidney cell line, CMV promoter; lane 5 shows MN14 from rat fibroblast cell line, hybrid α-LA promoter; lane 6 shows MN14 from rat fibroblast, CMV promoter. In agreement with FIG. 1 above, the results show that the heavy and light chains are produced in a ratio of approximately 1:1.
EXAMPLE 7
Quantitation of Protein Produced Per Cell
[0291]This Example describes the quantitation of the amount of protein produced per cell in cell cultures produced according to the invention. Various cells (208F cells, MDBK cells, and bovine mammary cells) were plated in 25 cm2 culture dishes at 1000 cells/dish. Three different vectors were used to infect the three cells types (CMV-MN14, MMTV-MN14, and α-LA-MN14) at an MOI of 1000 (titers: 2.8×106, 4.9×106, and 4.3×106, respectively). Media was collected approximately every 24 hours from all cells. Following one month of media collection, the 208F and MDBK cells were discarded due to poor health and low MN14 expression. The cells were passaged to T25 flasks and collection of media from the bovine mammary cells was continued for approximately 2 months with continued expression of MN14. After two months in T25 flasks, the cells with CMV promoters were producing 22.5 pg/cell/day and the cells with α-LA promoters were producing 2.5 pg MN14/cell/day.
[0292]After 2 months in T25 flasks, roller bottles (850 cm2) were seeded to scale-up production and to determine if MN14 expression was stable following multiple passages. Two roller bottles were seeded with bovine mammary cells expressing MN14 from a CMV promoter and two roller bottles were seeded with bovine mammary cells expressing MN14 from the α-LA promoter. The cultures reached confluency after approximately two weeks and continue to express MN14. Roller bottle expression is shown in Table 1 below.
TABLE-US-00013 TABLE 1 Production of MN14 in Roller Bottles MN14 MN14 Production/ Production/ Week - Total Cell Line Promoter Week (μg/ml) (μg/ml) Bovine CMV 2.6 1 - 520 mammary Bovine CMV 10.6 2 - 2120 mammary Bovine CMV 8.7 3 - 1740 mammary Bovine CMV 7.8 4 - 1560 mammary Bovine α-LA 0.272 1 - 54.4 mammary Bovine α-LA 2.8 2 - 560 mammary Bovine α-LA 2.2 3 - 440 mammary Bovine α-LA 2.3 4 - 460 mammary
EXAMPLE 8
Transfection at Varied Multiplicities of Infection
[0293]This Example describes the effect of transfection at varied multiplicities of infection on protein expression. 208F rat fibroblast and bovine mammary epithelial cells (BMEC) were plated in a 25 cm2 plates at varied cell numbers/25 cm2. Cells were infected with either the CMV MN14 vector or the αLA MN14 vector at a MOI of 1,10, 1000, and 10,000 by keeping the number of CFUs kept constant and varying the number of cells infected.
[0294]Following infection, medium was changed daily and collected approximately every 24 hours from all cells for approximately 2 months. The results of both of the vectors in bovine mammary epithelial cells are shown in Table 2 below. Cells without data indicate cultures that became infected prior to the completion of the experiment. The "# cells" column represents the number of cells at the conclusion of the experiment. The results indicate that a higher MOI results in increased MN14 production, both in terms of the amount of protein produced per day, and the total accumulation.
TABLE-US-00014 TABLE 2 MOI vs. Protein Production MN14 % cell Production/ Cell Con- MN14 day Line Promoter MOI fluency (ng/ml) # Cells (pg/cell) BMEC CMV 10000 100% 4228 4.5E5 47 BMEC CMV 1000 100% 2832 2.0E6 7.1 BMEC CMV 100 BMEC CMV 10 100% 1873 2.5E6 3.75 BMEC CMV 1 BMEC αLA 10000 100% 1024 1.5E6 3.4 BMEC αLA 1000 BMEC αLA 100 100% 722 1.8E6 1.9 BMEC αLA 10 100% 421234 2.3E6 .925 BMEC αLA 1 100% 1.9E6 .325
EXAMPLE 9
Transfection at Varied Multiplicities of Infection
[0295]This experiment describes protein production from the CMV MN14 vector at a variety of MOI values. Bovine mammary cells, CHO cells, and human embryo kidney cells (293 cells) were plated in 24 well plates (2 cm2) at 100 cells/2 cm2 well. Cells were infected at various dilutions with CMV MN14 to obtain MOI values of 1, 10, 100, 1000, and 10000. The CHO cells reached confluency at all MOI within 11 days of infection. However, the cells infected at a MOI of 10,000 grew more slowly. The bovine mammary and 293 cells grew slower, especially at the highest MOI of 10,000. The cells were then passaged into T25 flasks to disperse cells. Following dispersion, cells reached confluence within 1 week. the medium was collected after one week and analyzed for MN14 production. The CHO and human 293 cells did not exhibit good growth in extended culture. Thus, data were not collected from these cells. Data for bovine mammary epithelial cells are shown in Table 3 below. The results indicate that production of MN14 increased with higher MOI.
TABLE-US-00015 TABLE 3 MOI vs. Protein Production MN14 Production Cell Line Promoter MOI % confluency (ng/ml) BMEC CMV 10000 100% 1312 BMEC CMV 1000 100% 100 BMEC CMV 100 100% 7.23 BMEC CMV 10 100% 0 BMEC CMV 1 100% 0
EXAMPLE 10
Expression of LL2 Antibody by Bovine Mammary Cells
[0296]This Example describes the expression of antibody LL2 by bovine mammary cells. Bovine mammary cells were infected with vector CMV LL2 (7.85×107 CFU/ml) at MOI's of 1000 and 10,000 and plated in 25 cm2 culture dishes. None of the cells survived transfection at the MOI of 10,000. At 20% confluency, 250 ng/ml of LL2 was present in the media.
EXAMPLE 11
Expression of Botulinum Toxin Antibody by Bovine Mammary Cells
[0297]This Example describes the expression of Botulinum toxin antibody in bovine mammary cells. Bovine mammary cells were infected with vector α-LA Bot (2.2×102 CFU/ml) and plated in 25 cm2 culture dishes. At 100% confluency, 6 ng/ml of Botulinum toxin antibody was present in the media.
EXAMPLE 12
Expression of Hepatitis B Surface Antigen by Bovine Mammary Cells
[0298]This Example describes the expression of hepatitis B surface antigen (HBSAg) in bovine mammary cells. Bovine mammary cells were infected with vector LSRNL (350 CFU/ml) and plated in 25 cm2 culture dishes. At 100% confluency, 20 ng/ml of HBSAg was present in the media.
EXAMPLE 13
Expression of cc49IL2 Antigen Binding Protein by Bovine Mammary Cells
[0299]This Example describes the expression of cc49IL2 in bovine mammary cells. Bovine mammary cells were infected with vector cc49IL2 (3.1×105 CFU/ml) at a MOI of 1000 and plated in 25 cm2 culture dishes. At 100% confluency, 10 μg/ml of cc49IL2 was present in the media.
EXAMPLE 14
Expression of Multiple Proteins by Bovine Mammary Cells
[0300]This Example describes the expression of multiple proteins in bovine mammary cells. Mammary cells producing MN14 (infected with CMV-MN14 vector) were infected with cc49IL2 vector (3.1×105 CFU/ml) at an MOI of 1000, and 1000 cells were plated in 25 cm2 culture plates. At 100% confluency, the cells expressed MN14 at 2.5 μg/ml and cc49IL2 at 5 μg/ml.
EXAMPLE 15
Expression of Multiple Proteins by Bovine Mammary Cells
[0301]This Example describes the expression of multiple proteins in bovine mammary cells. Mammary cells producing MN14 (infected with CMV-MN14 vector) were infected with LSNRL vector (100 CFU/ml) at an MOI of 1000, and 1000 cells were plated in 25 cm2 culture plates. At 100% confluency, the cells expressed MN14 at 2.5 μg/ml and hepatitis surface antigen at 150 ng/ml.
EXAMPLE 16
Expression of Multiple Proteins by Bovine Mammary Cells
[0302]This Example describes the expression of multiple proteins in bovine mammary cells. Mammary cells producing hepatitis B surface antigen (infected with LSRNL vector) were infected with cc49IL2 vector at an MOI of 1000, and 1000 cells were plated in 25 cm2 culture plates. At 100% confluency, the cells expressed MN14 at 2.4 μg/ml and hepatitis B surface antigen at 13 ng/ml. It will be understood that multiple proteins may be expressed in the other cell lines described above.
EXAMPLE 17
Expression of Hepatitis B Surface Antigen and Botulinum Toxin Antibody in Bovine Mammary Cells
[0303]This Example describes the culture of transfected cells in roller bottle cultures. 208F cells and bovine mammary cells were plated in 25 cm2 culture dishes at 1000 cells/25 cm2. LSRNL or α-LA Bot vectors were used to infect each cell line at a MOI of 1000. Following one month of culture and media collection, the 208F cells were discarded due to poor growth and plating. Likewise, the bovine mammary cells infected with α-LA Bot were discarded due to low protein expression. The bovine mammary cells infected with LSRNL were passaged to seed roller bottles (850 cm2). Approximately 20 ng/ml hepatitis type B surface antigen was produced in the roller bottle cultures.
EXAMPLE 18
Expression in Clonally Selected Cell Lines
[0304]This experiment describes expression of MN14 from clonally selected cell lines. Cell lines were grown to confluency in T25 flasks and 5 ml of media were collected daily. The media was assayed daily for the presence of MN14. All the MN14 produced was active and Western blotting indicated that the heavy and light chains were produce at a ratio that appears to be almost exactly 1:1. In addition, a non-denaturing western blot indicated that approximately 100% of the antibody complexes were correctly formed. After being in culture for about two months, the cells were expanded into roller bottles or plated as single cell clones in 96 well plates.
[0305]The production of MN14 in the roller bottles was analyzed for a 24 hour period to determine if additional medium changing would increase production over what was obtained with weekly medium changes. Three 24 hour periods were examined. The CMV promoter cells in 850 cm2 roller bottles produced 909 ng/ml the first day, 1160 ng/ml the second day and 1112 ng/ml the third day. The α-LA promoter cells produced 401 ng/ml the first day, 477 ng/ml the second day and 463 ng/ml the third day. These values correspond well to the 8-10 mg/ml/week that were obtained for the CMV cells and the 2-3 mg/ml that were obtained for the α-LA cells. It does not appear that more frequent media changing would increase MN14 production in roller bottles.
[0306]Single cell lines were established in 96 well plates and then passaged into the same wells to allow the cells to grow to confluency. Once the cells reached confluency, they were assayed for MN14 production over a 24 hour period. The clonal production of MN14 from CMV cell lines ranged from 19 ng/ml/day to 5500 ng/ml/day. The average production of all cell clones was 1984 ng/ml/day. The α-LA cell clones yielded similar results. The clonal production of MN14 from α-LA cell lines ranged from 1 ng/ml/day to 2800 ng/ml/day. The average production of these cell clones was 622 ng/ml/day. The results are provided in Table 4 below.
TABLE-US-00016 TABLE 4 Expression in Clonal Cell Lines MN14 Alpha-lactalbumin CMV Clonal Cell Production Clonal Cell Line MN14 Production Line Number (ng/ml) Number (ng/ml) 22 19 27 0 6 88 29 0 29 134 12 0.7 34 151 50 8 32 221 28 55 23 343 43 57 27 423 8 81 4 536 13 154 41 682 48 159 45 685 7 186 40 696 36 228 11 1042 39 239 8 1044 51 275 5 1066 31 283 19 1104 54 311 48 1142 38 317 12 1224 21 318 26 1315 16 322 39 1418 47 322 37 1610 17 325 20 1830 37 367 21 1898 45 395 47 1918 25 431 35 1938 5 441 15 1968 20 449 3 1976 19 454 28 1976 22 503 1 2166 55 510 16 2172 14 519 17 2188 41 565 33 2238 46 566 30 2312 23 570 38 2429 1 602 2 2503 9 609 14 2564 53 610 24 2571 56 631 9 2708 2 641 42 2729 40 643 44 2971 32 653 7 3125 24 664 43 3125 26 671 25 3650 52 684 46 3706 6 693 50 3947 33 758 49 4538 42 844 18 4695 10 1014 31 4919 3 1076 10 5518 44 1077 35 1469 34 1596 18 1820 30 2021 11 2585 4 2800
EXAMPLE 19
Estimation of Insert Copy Number
[0307]This example describes the relationship of multiplicity of infection, gene copy number, and protein expression. Three DNA assays were developed using the INVADER Assay system (Third Wave Technologies, Madison, Wis.). One of the assays detects a portion of the bovine α-lactalbumin 5' flanking region. This assay is specific for bovine and does not detect the porcine or human α-lactalbumin gene. This assay will detect two copies of the α-lactalbumin gene in all control bovine DNA samples and also in bovine mammary epithelial cells. The second assay detects a portion of the extended packaging region from the MLV virus. This assay is specific for this region and does not detect a signal in the 293 human cell line, bovine mammary epithelial cell line or bovine DNA samples. Theoretically, all cell lines or other samples not infected with MLV should not produce a signal. However, since the 293GP cell line was produced with the extended packaging region of DNA, this cell line gives a signal when the assay is run. From the initial analysis, it appears that the 293GP cell line contains two copies of the extended packing region sequence that are detected by the assay. The final assay is the control assay. This assay detects a portion of the insulin-like growth factor I gene that is identical in bovine, porcine, humans and a number of other species. It is used as a control on every sample that is run in order to determine the amount of signal that is generated from this sample for a two copy gene. All samples that are tested should contain two copies of the control gene.
[0308]DNA samples can be isolated using a number of methods. Two assays are then performed on each sample. The control assay is performed along with either the bovine α-lactalbumin assay or the extended packaging region assay. The sample and the type of information needed will determine which assay is run. Both the control and the transgene detection assay are run on the same DNA sample, using the exact same quantity of DNA.
[0309]The data resulting from the assay are as follows (Counts indicate arbitrary fluorescence units): [0310]Extended Packaging Region or α-Lactalbumin Background counts [0311]Extended Packaging Region or α-Lactalbumin counts [0312]Internal Control background counts [0313]Internal Control counts
[0314]To determine net counts for the assay the background counts are subtracted from the actual counts. This occurs for both the control and transgene detection assay. Once the net counts are obtained, a ratio of the net counts for the transgene detection assay to the net counts of the control assay can be produced. This value is an indication of the number of copies of transgene compared to the number of copies of the internal control gene (in this case IGF-I). Because the transgene detection assay and the control assay are two totally different assays, they do not behave exactly the same. This means that one does not get an exact 1:1 ratio if there are two copies of the transgene and two copies of the control gene in a specific sample. However the values are generally close to the 1:1 ratio. Also, different insertion sites for the transgene may cause the transgene assay to behave differently depending on where the insertions are located.
[0315]Therefore, although the ratio is not an exact measure of copy number, it is a good indication of relative copy number between samples. The greater the value of the ratio the greater the copy number of the transgene. Thus, a ranking of samples from lowest to highest will give a very accurate comparison of the samples to one another with regard to copy number. Table 5 provides actual data for the EPR assay:
TABLE-US-00017 TABLE 5 Control Net Transgene Net Control Background Control Transgene Background Transgene Net Sample # Counts Counts Counts Counts Counts Counts Ratio 293 116 44 72 46.3 46 0.3 0 293GP 112 44 68 104 46 58 .84 1 74 40 34 88 41 47 1.38 2 64 40 24 83 41 43 1.75 3 62 44 18 144 46 98 5.57
[0316]From this data, it can be determined that the 293 cell line has no copies of the extended packaging region/transgene. However the 293 GP cells appear to have two copies of the extended packaging region. The other three cell lines appear to have three or more copies of the extended packaging region (one or more additional copies compared to 293GP cells). Invader Assay Gene Ratio and Cell Line Protein Production Bovine mammary epithelial cells were infected with either the CMV driven MN14 construct or the α-lactalbumin driven MN14 construct. The cells were infected at a 1000 to 1 vector to cell ratio. The infected cells were expanded. Clonal cell lines were established for both the α-LA and CMV containing cells from this initial pooled population of cells. Approximately 50 cell lines were produced for each gene construct. Individual cells were placed in 96 well plates and then passaged into the same well to allow the cells to grow to confluency. Once the cells lines reached confluency, they were assayed for MN14 production over a 24 hour period. The clonal production of MN14 from CMV cell lines ranged from 0 ng/ml/day to 5500 ng/ml/day. The average production of all cell clones was 1984 ng/ml/day. The α-LA cell clones showed similar trends. The clonal production of MN14 from α-LA cell lines ranged from 0 ng/ml/day to 2800 ng/ml/day. The average production of these cell clones was 622 ng/ml/day.
[0317]For further analysis of these clonal lines, fifteen CMV clones and fifteen α-LA clones were selected. Five highest expressing, five low expressing and five mid-level expressing lines were chosen. These thirty cell lines were expanded and banked. DNA was isolated from most all of the thirty cell lines. The cell lines were passed into 6 well plates and grown to confluency. Once at confluency, the media was changed every 24 hours and two separate collections from each cell line were assayed for MN14 production. The results of these two assays were averaged and these numbers were used to create Tables 6 and 7 below. DNA from the cell lines was run using the Invader extended packaging region assay and the results are shown below. The Tables show the cell line number, corresponding gene ratio and antibody production.
TABLE-US-00018 TABLE 6 CMV Clonal Cell Invader MN14 Production Line Number Gene Ratio (ng/ml) 6 0.19 104 7 1.62 2874 10 2.57 11202 18 3.12 7757 19 1.62 2483 21 1.53 3922 22 0 0 29 0.23 443 31 3.45 5697 32 0.27 346 34 0.37 305 38 1.47 2708 41 1.54 5434 49 2.6 7892 50 1.56 5022 Average of All 1.48 3746 Clones
TABLE-US-00019 TABLE 7 α-LA Clonal Cell Invader MN14 Production Line Number Gene Ratio (ng/ml) 4 4.28 3600 6 1.15 959 12 0.35 21 17 0.54 538 28 0.75 60 30 1.73 2076 31 0.74 484 34 4.04 3332 41 1.33 771 Average of All 1.66 1316 Clones
[0318]The graphs (FIGS. 17 and 18) show the comparison between protein expression and invader assay gene ratio. The results indicate that there is a direct correlation between invader assay gene ratio and protein production. It also appears that the protein production has not reached a maximum and if cells containing a higher invader assay gene ratio were produced, higher protein production would occur.
Invader Assay Gene Ratio and Multiple Cell Line Infections
[0319]Two packaging cell lines (293GP) produced using previously described methods were used to produce replication defective retroviral vector. One of the cell lines contains a retroviral gene construct that expresses the botulinum toxin antibody gene from the CMV promoter (LTR-Extended Viral Packaging Region-Neo Gene-CMV Promoter-Bot Light Chain Gene-IRES-Bot Heavy Chain Gene-LTR), the other cell line contains a retroviral gene construct that expresses the YP antibody gene from the CMV promoter (LTR-Extended Viral Packaging Region-Neo Gene-CMV Promoter-YP Heavy Chain Gene-IRES-YP Light Chain Gene-WPRE-LTR). In addition to being able to produce replication defective retroviral vector, each of these cell lines also produce either botulinum toxin antibody or YP antibody.
[0320]The vector produced from these cell lines was then used to re-infect the parent cell line. This procedure was performed in order to increase the number of gene insertions and to improve antibody production from these cell lines. The botulinum toxin parent cell line was infected with a new aliquot of vector on three successive days. The titer of the vector used to perform the infection was 1×108 cfu/ml. Upon completion of the final 24 hour infection, clonal selection was performed on the cells and the highest protein producing line was established for botulinum toxin antibody production. A similar procedure was performed on the YP parent cell line. This cell line was also infected with a new aliquot of vector on three successive days. The titer of the YP vector aliquots was 1×104. Upon completion of the final 24 hour infection, clonal selection was performed on the cells and the highest protein producing line was established for YP production.
[0321]Each of the parent cell lines and the daughter production cell lines were examined for Invader gene ratio using the extended packaging region assay and for protein production. The Bot production cell line which was generated using the highest titer vector had the highest gene ratio. It also had the highest protein production, again suggesting that gene copy number is proportional to protein production. The YP production cell line also had a higher gene ratio and produced more protein than its parent cell line, also suggesting that increasing gene copy is directly related to increases in protein production. The data is presented in Table 8.
TABLE-US-00020 TABLE 8 Antibody Production Cell Line Invader Gene Ratio (Bot/YP) Bot Parent Cell Line 1.12 4.8 mg/ml Bot Production Cell Line 3.03 55 mg/ml YP Parent Cell Line 1.32 4 mg/ml YP Production Cell Line 2.04 25 mg/ml
EXAMPLE 20
Transfection with Lentivirus Vectors
[0322]This example describes methods for the production of lentivirus vectors and their use to infect host cells at a high multiplicity of infection. Replication-defective viral particles are produced by the transient cotransfection of the plasmids described in U.S. Pat. No. 6,013,516 in 293T human kidney cells. All plasmids are transformed and grown in E. coli HB101 bacteria following standard molecular biology procedures. For transfection of eukaryotic cells, plasmid DNA is purified twice by equilibrium centrifugation in CsCl-ethidium bromide gradients. A total of 40 μg DNA is used for the transfection of a culture in a 10 cm dish, in the following proportions: 10 μg pCMVΔR8, 20 μg pHR', and 10 μg env plasmids, either MLV/Ampho, MLV/Eco or VSV-G. 293T cells are grown in DMEM supplemented with 10% fetal calf serum and antibiotics in a 10% CO2 incubator. Cells are plated at a density of 1.3×106/10 cm dish the day before transfection. Culture medium is changed 4 to 6 hrs before transfection. Calcium phosphate-DNA complexes are prepared according to the method of Chen and Okayama (Mol. Cell. Biol., 7:2745, 1987), and incubated overnight with the cells in an atmosphere of 5% CO2. The following morning, the medium is replaced, and the cultures returned to 10% CO2. Conditioned medium is harvested 48 to 60 hrs after transfection, cleared of cellular debris by low speed centrifugation (300×g 10 min), and filtered through 0.45 μm low protein binding filters.
[0323]To concentrate vector particles, pooled conditioned medium harvested as described above is layered on top of a cushion of 20% sucrose solution in PBS and centrifuged in a Beckman SW28 rotor at 50,000×g for 90 min. The pellet is resuspended by incubation and gentle pipetting in 1-4 ml PBS for 30-60 min, then centrifuged again at 50,000×g for 90 min in a Beckmann SW55 rotor. The pellet is resuspended in a minimal volume (20-50 μl) of PBS and either used directly for infection or stored in frozen aliquots at -80° C.
[0324]The concentrated lentivirus vectors are titered and used to transfect an appropriate cell line (e.g., 293 cells, Hela cells, rat 208F fibroblasts)) at a multiplicity of infection of 1,000. Analysis of clonally selected cell lines expressing the exogenous protein will reveal that a portion of the selected cell lines contain more than two integrated copies of the vector. These cell lines will produce more of the exogenous protein than cell lines containing only one copy of the integrated vector.
EXAMPLE 21
Expression and Assay of G-protein Coupled Receptors
[0325]This example describes the expression of a G-Protein Coupled Receptor protein (GPCR) from a retroviral vector. This example also describes the expression of a signal protein from an IRES as a marker for expression of a difficult to assay protein or a protein that has no assay such as a GPCR. The gene construct (SEQ ID NO: 34; FIG. 19) comprises a G-protein-coupled receptor followed by the IRES-signal peptide-antibody light chain cloned into the MCS of pLBCX retroviral backbone. Briefly, a PvuII/PvuII fragment (3057 bp) containing the GPCR-IRES-antibody light chain was cloned into the StuI site of pLBCX. pLBCX contains the EM7 (T7) promoter, Blasticidin gene and SV40 polyA in place of the Neomycin resistance gene from pLNCX.
[0326]The gene construct was used to produce a replication defective retroviral packaging cell line and this cell line was used to produce replication defective retroviral vector. The vector produced from this cell line was then used to infect 293GP cells (human embryonic kidney cells). After infection, the cells were placed under Blasticidin selection and single cell Blasticidin resistant clones were isolated. The clones were screened for expression of antibody light chain. The top 12 light chain expressing clones were selected. These 12 light chain expressing clones were then screened for expression of the GPCR using a ligand binding assay. All twelve of the samples also expressed the receptor protein. The clonal cell lines and there expression are shown in Table 9.
TABLE-US-00021 TABLE 9 Antibody Light Cell Clone Number Chain Expression GPCR Expression 4 + + 8 + + 13 + + 19 + + 20 + + 22 + + 24 + + 27 + + 30 + + 45 + + 46 + + 50 + +
EXAMPLE 22
Multiple Infection of 293 Cells with Replication Defective Retroviral Vector
[0327]This example describes the multiple serial transfection of cells with retroviral vectors. The following gene construct was used to produce a replication defective retroviral packaging cell line.
5' LTR=Moloney murine sarcoma virus 5' long terminal repeat.EPR=Moloney murine leukemia virus extended packaging region.Blast=Blasticidin resistance gene.CMV=Human cytomegalovirus immediate early promoter.Gene=Gene encoding test proteinWPRE=RNA transport element3' LTR=Moloney murine leukemia virus 3' LTR.
[0328]This packaging cell line was then used to produce a replication defective retroviral vector arranged as follows. The vector was produced from cells grown in T150 flasks and frozen. The frozen vector was thawed at each infection. For infection # 3 a concentrated solution of vector was used to perform the infection. All other infections were performed using non-concentrated vector. The infections were performed over a period of approximately five months by placing 5 ml of vector/media solution on a T25 flask containing 30% confluent 293 cells. Eight mg/ml of polybrene was also placed in the vector solution during infection. The vector solution was left on the cells for 24 hours and then removed. Media (DMEM with 10% fetal calf serum) was then added to the cells. Cells were grown to full confluency and passaged into a new T25 flask. The cells were then grown to 30% confluency and the infection procedure was repeated. This process was repeated 12 times and is outlined Table 10 below. After infections 1, 3, 6, 9 and 12, cells left over after passaging were used to obtain a DNA sample. The DNA was analyzed using the INVADER assay to determine an estimate of the number of vector inserts in the cells after various times in the infection procedure. The results indicate that the number of vector insertions goes up over time with the highest level being after the 12th infection. Since a value of 0.5 is approximately an average of one vector insert copy per cell, after twelve infections the average vector insert copy has yet to reach two. These data indicates that the average vector copy per cell is a little less that 1.5 copies per cell. Also, there was no real change in gene copy number from infection #6 to infection #9. Furthermore, these data indicate that transfection conducted at a standard low multiplicity of infection fail to introduce more than one copy of the retroviral vector into the cells.
TABLE-US-00022 TABLE 10 Cell Line or Vector Titer "Invader" Gene Infection Number (CFU/ml) Ratio 293 0.053 Infection #1 1.05 × 103 0.39 Infection #2 1.05 × 103 Infection #3 7.6 × 104 0.45 Infection #4 1.05 × 103 Infection #5 1.05 × 103 Infection #6 1.05 × 103 0.54 Infection #7 1.05 × 103 Infection #8 1.05 × 103 Infection #9 1.05 × 103 0.52 Infection #10 1.05 × 103 Infection #11 1.05 × 103 Infection #12 1.05 × 103 0.69
EXAMPLE 23
Production of YP Antibody
[0329]This Example demonstrates the production of Yersinia pestis antibody by bovine mammary epithelial cells and human kidney fibroblast cells (293 cells). Cells lines were infected with the α-LA YP vector. Both of the cell lines produced YP antibody. All of the antibody is active and the heavy and light chains are produced in a ratio approximating 1:1.
EXAMPLE 24
Transduction of Plant Protoplasts
[0330]This Example describes a method for transducing plant protoplasts. Tobacco protoplasts of Nicotiana tabacum c.v. Petit Havanna are produced according to conventional processes from a tobacco suspension culture (Potrykus and Shillito, Methods in Enzymology, vol. 118, Plant Molecular Biology, eds. A. and H. Weissbach, Academic Press, Orlando, 1986). Completely unfolded leaves are removed under sterile conditions from 6-week-old shoot cultures and thoroughly wetted with an enzyme solution of the following composition: Enzyme solution: H2O, 70 ml; sucrose, 13 g; macerozyme R 10, 1 g; cellulase, 2 g; "Onozuka" R 10 (Yakult Co. Ltd., Japan) Drisellase (Chemische Fabrik Schweizerhalle, Switzerland), 0.13 g; and 2(n-morpholine)-ethanesulphonic acid (MES), 0.5 ml pH 6.0
[0331]Leaves are then cut into squares from 1 to 2 cm in size and the squares are floated on the above-mentioned enzyme solution. They are incubated overnight at a temperature of 26° C. in the dark. This mixture is then gently shaken and incubated for a further 30 minutes until digestion is complete.
[0332]The suspension is then filtered through a steel sieve having a mesh width of 100 μm, rinsed thoroughly with 0.6M sucrose (MES, pH 5.6) and subsequently centrifuged for 10 minutes at from 4000 to 5000 rpm. The protoplasts collect on the surface of the medium which is then removed from under the protoplasts, for example using a sterilized injection syringe.
[0333]The protoplasts are resuspended in a K3 medium [sucrose (102.96 g/l; xylose (0.25 g/l); 2,4-dichlorophenoxyacetic acid (0.10 mg/l); 1-naphthylacetic acid (1.00 mg/l); 6-benzylaminopurine (0.20 mg/i); pH 5.8](Potrykus and Shillito, supra) that contains 0.4M sucrose.
[0334]To carry out the transformation experiments, the protoplasts are first of all washed, counted and then resuspended, at a cell density of from 1 to 2.5×106 cells per ml, in a W5 medium [154 mM NaCl, 125 mM CaCl2×2H2O, 5 mM KCl, 5 mM glucose, pH 5.6), which ensures a high survival rate of the isolated protoplasts. After incubation for 30 minutes at from 6 to 8° C., the protoplasts are then used for the transduction experiments.
[0335]The protoplasts are exposed to a pseudotyped retroviral vector (e.g., a lentiviral vector) encoding a protein of interest driven by a plant specific promoter. The vector is prepared as described above and is used at an MOI of 1,000. The protoplasts are then resuspended in fresh K3 medium (0.3 ml protoplast solution in 10 ml of fresh K3 medium). Further incubation is carried out in 10 ml portions in 10 cm diameter petri dishes at 24° C. in the dark, the population density being from 4 to 8×104 protoplasts per ml. After 3 days, the culture medium is diluted with 0.3 parts by volume of K3 medium per dish and incubation is continued for a further 4 days at 24° C. and 3000 lux of artificial light. After a total of 7 days, the clones that have developed from the protoplasts are embedded in nutrient medium that contains 50 mg/l of kanamycin and has been solidified with 1% agarose, and are cultured at 24° C. in the dark in accordance with the "bead-type" culturing method (Shillito, et al., Plant Cell Reports, 2, 244-247 (1983)). The nutrient medium is replaced every 5 days by a fresh amount of the same nutrient solution. Analysis of the clones indicates that express the gene of interest.
EXAMPLE 25
Stability of Vector Insertions in Cell Lines Over Time
[0336]Two cell lines that contain gene inserts of the LN-CMV-Bot vector were analyzed for there ability to maintain the vector inserts over a number of passages with and without neomycin selection. The first cell line is a bovine mammary epithelial cell line that contains a low number of insert copies. The second cell line is a 293GP line that contains multiple copies of the vector insert. At the start of the experiment, cell cultures were split. This was at passage 10 for the bovine mammary epithelial cells and passage 8 for the 293GP cells. One sample was continually passaged in media containing the neomycin analog G418, the other culture was continually passaged in media without any antibiotic. Every 3-6 passages, cells were collected and DNA was isolated for determination of gene ratio using the INVADER assay. Cell were continually grown and passaged in T25 flasks. The results of the assays are shown below:
TABLE-US-00023 TABLE 11 Low Gene Copy Cell Line INVADER Gene Cell Line and Treatment Passage Number Ratio BMEC/Bot #66 + G418 10 0.67 BMEC/Bot #66 - G418 10 0.89 BMEC/Bot #66 + G418 16 0.67 BMEC/Bot #66 - G418 16 0.64 BMEC/Bot #66 + G418 21 0.62 BMEC/Bot #66 - G418 21 0.58 BMEC/Bot #66 + G418 27 0.98 BMEC/Bot #66 - G418 27 0.56 BMEC/Bot #66 + G418 33 0.80 BMEC/Bot #66 - G418 33 0.53
TABLE-US-00024 TABLE 12 High Gene Copy Cell Line Cell Line and Treatment Passage Number INVADER Gene Ratio 293GP/Bot #23 + G418 8 3.46 293GP/Bot #23 - G418 8 3.73 293GP/Bot #23 + G418 14 3.28 293GP/Bot #23 - G418 14 3.13 293GP/Bot #23 + G418 17 3.12 293GP/Bot #23 - G418 17 2.91 293GP/Bot #23 + G418 22 3.6 293GP/Bot #23 - G418 22 2.58 293GP/Bot #23 + G418 28 2.78 293GP/Bot #23 - G418 28 3.44 293GP/Bot #23 + G418 36 2.6 293GP/Bot #23 - G418 36 2.98
[0337]These data show that there are no consistent differences in gene ratio between cells treated with G418 and those not treated with antibiotic. This suggests that G418 selection is not necessary to maintain the stability of the vector gene insertions. Also, these vector inserts appear to be very stable over time.
[0338]All publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology, protein fermentation, biochemistry, or related fields are intended to be within the scope of the following claims.
SEQUENCE LISTING
<110> Bleck, Gregory
[0339]Bremel, Robert [0340]Miller, Linda [0341]York, Donna
<120> Host Cells Containing Multiple Integrating Vectors
<130> GALA-04198
[0342]150> 60/215,925<151> 2000-07-03<160> 36<170> PatentIn version 3.0<210> 1<211> 2101
Sequence CWU
1
3612101DNAArtificialSynthetic 1gatcagtcct gggtggtcat tgaaaggact gatgctgaag
ttgaagctcc aatactttgg 60ccacctgatg cgaagaactg actcatgtga taagaccctg
atactgggaa agattgaagg 120caggaggaga agggatgaca gaggatggaa gagttggatg
gaatcaccaa ctcgatggac 180atgagtttga gcaagcttcc aggagttggt aatgggcagg
gaagcctggc gtgctgcagt 240ccatggggtt gcaaagagtt ggacactact gagtgactga
actgaactga tagtgtaatc 300catggtacag aatataggat aaaaaagagg aagagtttgc
cctgattctg aagagttgta 360ggatataaaa gtttagaata cctttagttt ggaagtctta
aattatttac ttaggatggg 420tacccactgc aatataagaa atcaggcttt agagactgat
gtagagagaa tgagccctgg 480cataccagaa gctaacagct attggttata gctgttataa
ccaatatata accaatatat 540tggttatata gcatgaagct tgatgccagc aatttgaagg
aaccatttag aactagtatc 600ctaaactcta catgttccag gacactgatc ttaaagctca
ggttcagaat cttgttttat 660aggctctagg tgtatattgt ggggcttccc tggtggctca
gatggtaaag tgtctgcctg 720caatgtgggt gatctgggtt cgatccctgg cttgggaaga
tcccctggag aaggaaatgg 780caacccactc tagtactctt acctggaaaa ttccatggac
agaggagcct tgtaagctac 840agtccatggg attgcaaaga gttgaacaca actgagcaac
taagcacagc acagtacagt 900atacacctgt gaggtgaagt gaagtgaagg ttcaatgcag
ggtctcctgc attgcagaaa 960gattctttac catctgagcc accagggaag cccaagaata
ctggagtggg tagcctattc 1020cttctccagg ggatcttccc atcccaggaa ttgaactgga
gtctcctgca tttcaggtgg 1080attcttcacc agctgaacta ccaggtggat actactccaa
tattaaagtg cttaaagtcc 1140agttttccca cctttcccaa aaaggttggg tcactctttt
ttaaccttct gtggcctact 1200ctgaggctgt ctacaagctt atatatttat gaacacattt
attgcaagtt gttagtttta 1260gatttacaat gtggtatctg gctatttagt ggtattggtg
gttggggatg gggaggctga 1320tagcatctca gagggcagct agatactgtc atacacactt
ttcaagttct ccatttttgt 1380gaaatagaaa gtctctggat ctaagttata tgtgattctc
agtctctgtg gtcatattct 1440attctactcc tgaccactca acaaggaacc aagatatcaa
gggacacttg ttttgtttca 1500tgcctgggtt gagtgggcca tgacatatgt tctgggcctt
gttacatggc tggattggtt 1560ggacaagtgc cagctctgat cctgggactg tggcatgtga
tgacatacac cccctctcca 1620cattctgcat gtctctaggg gggaaggggg aagctcggta
tagaaccttt attgtatttt 1680ctgattgcct cacttcttat attgccccca tgcccttctt
tgttcctcaa gtaaccagag 1740acagtgcttc ccagaaccaa ccctacaaga aacaaagggc
taaacaaagc caaatgggaa 1800gcaggatcat ggtttgaact ctttctggcc agagaacaat
acctgctatg gactagatac 1860tgggagaggg aaaggaaaag tagggtgaat tatggaagga
agctggcagg ctcagcgttt 1920ctgtcttggc atgaccagtc tctcttcatt ctcttcctag
atgtagggct tggtaccaga 1980gcccctgagg ctttctgcat gaatataaat atatgaaact
gagtgatgct tccatttcag 2040gttcttgggg gcgccgaatt cgagctcggt acccggggat
ctcgaggggg ggcccggtac 2100c
21012245DNAArtificialSynthetic 2gattacttac
tggcaggtgc tgggggcttc cgagacaatc gcgaacatct acaccacaca 60acaccgcctc
gaccagggtg agatatcggc cggggacgcg gcggtggtaa ttacaagcga 120ggatccgatt
acttactggc aggtgctggg ggcttccgag acaatcgcga acatctacac 180cacacaacac
cgcctcgacc agggtgagat atcggccggg gacgcggcgg tggtaattac 240aagcg
2453680DNAArtificialSynthetic 3ggaattcgcc cctctccctc ccccccccct
aacgttactg gccgaagccg cttggaataa 60ggccggtgtg cgtttgtcta tatgttattt
tccaccatat tgccgtcttt tggcaatgtg 120agggcccgga aacctggccc tgtcttcttg
acgagcattc ctaggggtct ttcccctctc 180gccaaaggaa tgcaaggtct gttgaatgtc
gtgaaggaag cagttcctct ggaagcttct 240tgaagacaaa caacgtctgt agcgaccctt
tgcaggcagc ggaacccccc acctggcgac 300aggtgcctct gcggccaaaa gccacgtgta
taagatacac ctgcaaaggc ggcacaaccc 360cagtgccacg ttgtgagttg gatagttgtg
gaaagagtca aatggctctc ctcaagcgta 420ttcaacaagg ggctgaagga tgcccagaag
gtaccccatt gtatgggatc tgatctgggg 480cctcggtgca catgctttac atgtgtttag
tcgaggttaa aaaaacgtct aggccccccg 540aaccacgggg acgtggtttt cctttgaaaa
acacgatgat aatatggcct cctttgtctc 600tctgctcctg gtaggcatcc tattccatgc
cacccaggcc ggcgccatgg gatatctaga 660tctcgagctc gcgaaagctt
68044207DNAArtificialSynthetic
4cggatccggc cattagccat attattcatt ggttatatag cataaatcaa tattggctat
60tggccattgc atacgttgta tccatatcat aatatgtaca tttatattgg ctcatgtcca
120acattaccgc catgttgaca ttgattattg actagttatt aatagtaatc aattacgggg
180tcattagttc atagcccata tatggagttc cgcgttacat aacttacggt aaatggcccg
240cctggctgac cgcccaacga cccccgccca ttgacgtcaa taatgacgta tgttcccata
300gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg gtaaactgcc
360cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga cgtcaatgac
420ggtaaatggc ccgcctggca ttatgcccag tacatgacct tatgggactt tcctacttgg
480cagtacatct acgtattagt catcgctatt accatggtga tgcggttttg gcagtacatc
540aatgggcgtg gatagcggtt tgactcacgg ggatttccaa gtctccaccc cattgacgtc
600aatgggagtt tgttttggca ccaaaatcaa cgggactttc caaaatgtcg taacaactcc
660gccccattga cgcaaatggg cggtaggcat gtacggtggg aggtctatat aagcagagct
720cgtttagtga accgtcagat cgcctggaga cgccatccac gctgttttga cctccataga
780agacaccggg accgatccag cctccgcggc cccaagcttc tcgacggatc cccgggaatt
840caggacctca ccatgggatg gagctgtatc atcctcttct tggtagcaac agctacaggt
900gtccactccg aggtccaact ggtggagagc ggtggaggtg ttgtgcaacc tggccggtcc
960ctgcgcctgt cctgctccgc atctggcttc gatttcacca catattggat gagttgggtg
1020agacaggcac ctggaaaagg tcttgagtgg attggagaaa ttcatccaga tagcagtacg
1080attaactatg cgccgtctct aaaggataga tttacaatat cgcgagacaa cgccaagaac
1140acattgttcc tgcaaatgga cagcctgaga cccgaagaca ccggggtcta tttttgtgca
1200agcctttact tcggcttccc ctggtttgct tattggggcc aagggacccc ggtcaccgtc
1260tcctcagcct ccaccaaggg cccatcggtc ttccccctgg caccctcctc caagagcacc
1320tctgggggca cagcggccct gggctgcctg gtcaaggact acttccccga accggtgacg
1380gtgtcgtgga actcaggcgc cctgaccagc ggcgtgcaca ccttcccggc tgtcctacag
1440tcctcaggac tctactccct cagcagcgtg gtgaccgtgc cctccagcag cttgggcacc
1500cagacctaca tctgcaacgt gaatcacaag cccagcaaca ccaaggtgga caagagagtt
1560gagcccaaat cttgtgacaa aactcacaca tgcccaccgt gcccagcacc tgaactcctg
1620gggggaccgt cagtcttcct cttcccccca aaacccaagg acaccctcat gatctcccgg
1680acccctgagg tcacatgcgt ggtggtggac gtgagccacg aagaccctga ggtcaagttc
1740aactggtacg tggacggcgt ggaggtgcat aatgccaaga caaagccgcg ggaggagcag
1800tacaacagca cgtaccgtgt ggtcagcgtc ctcaccgtcc tgcaccagga ctggctgaat
1860ggcaaggagt acaagtgcaa ggtctccaac aaagccctcc cagcccccat cgagaaaacc
1920atctccaaag ccaaagggca gccccgagaa ccacaggtgt acaccctgcc cccatcccgg
1980gaggagatga ccaagaacca ggtcagcctg acctgcctgg tcaaaggctt ctatcccagc
2040gacatcgccg tggagtggga gagcaatggg cagccggaga acaactacaa gaccacgcct
2100cccgtgctgg actccgacgg ctccttcttc ctctatagca agctcaccgt ggacaagagc
2160aggtggcagc aggggaacgt cttctcatgc tccgtgatgc acgaggctct gcacaaccac
2220tacacgcaga agagcctctc cctgtctccc gggaaatgaa agccgaattc gcccctctcc
2280ctcccccccc cctaacgtta ctggccgaag ccgcttggaa taaggccggt gtgcgtttgt
2340ctatatgtta ttttccacca tattgccgtc ttttggcaat gtgagggccc ggaaacctgg
2400ccctgtcttc ttgacgagca ttcctagggg tctttcccct ctcgccaaag gaatgcaagg
2460tctgttgaat gtcgtgaagg aagcagttcc tctggaagct tcttgaagac aaacaacgtc
2520tgtagcgacc ctttgcaggc agcggaaccc cccacctggc gacaggtgcc tctgcggcca
2580aaagccacgt gtataagata cacctgcaaa ggcggcacaa ccccagtgcc acgttgtgag
2640ttggatagtt gtggaaagag tcaaatggct ctcctcaagc gtattcaaca aggggctgaa
2700ggatgcccag aaggtacccc attgtatggg atctgatctg gggcctcggt gcacatgctt
2760tacatgtgtt tagtcgaggt taaaaaaacg tctaggcccc ccgaaccacg gggacgtggt
2820tttcctttga aaaacacgat gataatatgg cctcctttgt ctctctgctc ctggtaggca
2880tcctattcca tgccacccag gccgacatcc agctgaccca gagcccaagc agcctgagcg
2940ccagcgtggg tgacagagtg accatcacct gtaaggccag tcaggatgtg ggtacttctg
3000tagcctggta ccagcagaag ccaggtaagg ctccaaagct gctgatctac tggacatcca
3060cccggcacac tggtgtgcca agcagattca gcggtagcgg tagcggtacc gacttcacct
3120tcaccatcag cagcctccag ccagaggaca tcgccaccta ctactgccag caatatagcc
3180tctatcggtc gttcggccaa gggaccaagg tggaaatcaa acgaactgtg gctgcaccat
3240ctgtcttcat cttcccgcca tctgatgagc agttgaaatc tggaactgcc tctgttgtgt
3300gcctgctgaa taacttctat cccagagagg ccaaagtaca gtggaaggtg gataacgccc
3360tccaatcggg taactcccag gagagtgtca cagagcagga cagcaaggac agcacctaca
3420gcctcagcag caccctgacg ctgagcaaag cagactacga gaaacacaaa gtctacgcct
3480gcgaagtcac ccatcagggc ctgagctcgc ccgtcacaaa gagcttcaac aggggagagt
3540gttagagatc taggcctcct aggtcgacat cgataaaata aaagatttta tttagtctcc
3600agaaaaaggg gggaatgaaa gaccccacct gtaggtttgg caagctagct taagtaacgc
3660cattttgcaa ggcatggaaa aatacataac tgagaataga gaagttcaga tcaaggtcag
3720gaacagatgg aacagctgaa tatgggccaa acaggatatc tgtggtaagc agttcctgcc
3780ccggctcagg gccaagaaca gatggaacag ctgaatatgg gccaaacagg atatctgtgg
3840taagcagttc ctgccccggc tcagggccaa gaacagatgg tccccagatg cggtccagcc
3900ctcagcagtt tctagagaac catcagatgt ttccagggtg ccccaaggac ctgaaatgac
3960cctgtgcctt atttgaacta accaatcagt tcgcttctcg cttctgttcg cgcgcttctg
4020ctccccgagc tcaataaaag agcccacaac ccctcactcg gggcgccagt cctccgattg
4080actgagtcgc ccgggtaccc gtgtatccaa taaaccctct tgcagttgca tccgacttgt
4140ggtctcgctg ttccttggga gggtctcctc tgagtgattg actacccgtc agcgggggtc
4200tttcatt
420754210DNAArtificialSynthetic 5ggatccggcc attagccata ttattcattg
gttatatagc ataaatcaat attggctatt 60ggccattgca tacgttgtat ccatatcata
atatgtacat ttatattggc tcatgtccaa 120cattaccgcc atgttgacat tgattattga
ctagttatta atagtaatca attacggggt 180cattagttca tagcccatat atggagttcc
gcgttacata acttacggta aatggcccgc 240ctggctgacc gcccaacgac ccccgcccat
tgacgtcaat aatgacgtat gttcccatag 300taacgccaat agggactttc cattgacgtc
aatgggtgga gtatttacgg taaactgccc 360acttggcagt acatcaagtg tatcatatgc
caagtacgcc ccctattgac gtcaatgacg 420gtaaatggcc cgcctggcat tatgcccagt
acatgacctt atgggacttt cctacttggc 480agtacatcta cgtattagtc atcgctatta
ccatggtgat gcggttttgg cagtacatca 540atgggcgtgg atagcggttt gactcacggg
gatttccaag tctccacccc attgacgtca 600atgggagttt gttttggcac caaaatcaac
gggactttcc aaaatgtcgt aacaactccg 660ccccattgac gcaaatgggc ggtaggcatg
tacggtggga ggtctatata agcagagctc 720gtttagtgaa ccgtcagatc gcctggagac
gccatccacg ctgttttgac ctccatagaa 780gacaccggga ccgatccagc ctccgcggcc
ccaagcttct cgacggatcc ccgggaattc 840aggacctcac catgggatgg agctgtatca
tcctcttctt ggtagcaaca gctacaggtg 900tccactccca ggtccagctg gtccaatcag
gggctgaagt caagaaacct gggtcatcag 960tgaaggtctc ctgcaaggct tctggctaca
cctttactag ctactggctg cactgggtca 1020ggcaggcacc tggacagggt ctggaatgga
ttggatacat taatcctagg aatgattata 1080ctgagtacaa tcagaacttc aaggacaagg
ccacaataac tgcagacgaa tccaccaata 1140cagcctacat ggagctgagc agcctgaggt
ctgaggacac ggcattttat ttttgtgcaa 1200gaagggatat tactacgttc tactggggcc
aaggcaccac ggtcaccgtc tcctcagcct 1260ccaccaaggg cccatcggtc ttccccctgg
caccctcctc caagagcacc tctgggggca 1320cagcggccct gggctgcctg gtcaaggact
acttccccga accggtgacg gtgtcgtgga 1380actcaggcgc cctgaccagc ggcgtgcaca
ccttcccggc tgtcctacag tcctcaggac 1440tctactccct cagcagcgtg gtgaccgtgc
cctccagcag cttgggcacc cagacctaca 1500tctgcaacgt gaatcacaag cccagcaaca
ccaaggtgga caagagagtt gagcccaaat 1560cttgtgacaa aactcacaca tgcccaccgt
gcccagcacc tgaactcctg gggggaccgt 1620cagtcttcct cttcccccca aaacccaagg
acaccctcat gatctcccgg acccctgagg 1680tcacatgcgt ggtggtggac gtgagccacg
aagaccctga ggtcaagttc aactggtacg 1740tggacggcgt ggaggtgcat aatgccaaga
caaagccgcg ggaggagcag tacaacagca 1800cgtaccgtgt ggtcagcgtc ctcaccgtcc
tgcaccagga ctggctgaat ggcaaggagt 1860acaagtgcaa ggtctccaac aaagccctcc
cagcccccat cgagaaaacc atctccaaag 1920ccaaagggca gccccgagaa ccacaggtgt
acaccctgcc cccatcccgg gaggagatga 1980ccaagaacca ggtcagcctg acctgcctgg
tcaaaggctt ctatcccagc gacatcgccg 2040tggagtggga gagcaatggg cagccggaga
acaactacaa gaccacgcct cccgtgctgg 2100actccgacgg ctccttcttc ctctatagca
agctcaccgt ggacaagagc aggtggcagc 2160aggggaacgt cttctcatgc tccgtgatgc
acgaggctct gcacaaccac tacacgcaga 2220agagcctctc cctgtctccc gggaaatgaa
agccgaattc gcccctctcc ctcccccccc 2280cctaacgtta ctggccgaag ccgcttggaa
taaggccggt gtgcgtttgt ctatatgtta 2340ttttccacca tattgccgtc ttttggcaat
gtgagggccc ggaaacctgg ccctgtcttc 2400ttgacgagca ttcctagggg tctttcccct
ctcgccaaag gaatgcaagg tctgttgaat 2460gtcgtgaagg aagcagttcc tctggaagct
tcttgaagac aaacaacgtc tgtagcgacc 2520ctttgcaggc agcggaaccc cccacctggc
gacaggtgcc tctgcggcca aaagccacgt 2580gtataagata cacctgcaaa ggcggcacaa
ccccagtgcc acgttgtgag ttggatagtt 2640gtggaaagag tcaaatggct ctcctcaagc
gtattcaaca aggggctgaa ggatgcccag 2700aaggtacccc attgtatggg atctgatctg
gggcctcggt gcacatgctt tacatgtgtt 2760tagtcgaggt taaaaaaacg tctaggcccc
ccgaaccacg gggacgtggt tttcctttga 2820aaaacacgat gataatatgg cctcctttgt
ctctctgctc ctggtaggca tcctattcca 2880tgccacccag gccgacatcc agctgaccca
gtctccatca tctctgagcg catctgttgg 2940agatagggtc actatgagct gtaagtccag
tcaaagtgtt ttatacagtg caaatcacaa 3000gaactacttg gcctggtacc agcagaaacc
agggaaagca cctaaactgc tgatctactg 3060ggcatccact agggaatctg gtgtcccttc
gcgattctct ggcagcggat ctgggacaga 3120ttttactttc accatcagct ctcttcaacc
agaagacatt gcaacatatt attgtcacca 3180atacctctcc tcgtggacgt tcggtggagg
gaccaaggtg cagatcaaac gaactgtggc 3240tgcaccatct gtcttcatct tcccgccatc
tgatgagcag ttgaaatctg gaactgcctc 3300tgttgtgtgc ctgctgaata acttctatcc
cagagaggcc aaagtacagt ggaaggtgga 3360taacgccctc caatcgggta actcccagga
gagtgtcaca gagcaggaca gcaaggacag 3420cacctacagc ctcagcagca ccctgacgct
gagcaaagca gactacgaga aacacaaagt 3480ctacgcctgc gaagtcaccc atcagggcct
gagctcgccc gtcacaaaga gcttcaacag 3540gggagagtgt tagagatcta ggcctcctag
gtcgacatcg ataaaataaa agattttatt 3600tagtctccag aaaaaggggg gaatgaaaga
ccccacctgt aggtttggca agctagctta 3660agtaacgcca ttttgcaagg catggaaaaa
tacataactg agaatagaga agttcagatc 3720aaggtcagga acagatggaa cagctgaata
tgggccaaac aggatatctg tggtaagcag 3780ttcctgcccc ggctcagggc caagaacaga
tggaacagct gaatatgggc caaacaggat 3840atctgtggta agcagttcct gccccggctc
agggccaaga acagatggtc cccagatgcg 3900gtccagccct cagcagtttc tagagaacca
tcagatgttt ccagggtgcc ccaaggacct 3960gaaatgaccc tgtgccttat ttgaactaac
caatcagttc gcttctcgct tctgttcgcg 4020cgcttctgct ccccgagctc aataaaagag
cccacaaccc ctcactcggg gcgccagtcc 4080tccgattgac tgagtcgccc gggtacccgt
gtatccaata aaccctcttg cagttgcatc 4140cgacttgtgg tctcgctgtt ccttgggagg
gtctcctctg agtgattgac tacccgtcag 4200gtctttcatt
421065732DNAArtificialSynthetic
6cgagcttggc agaaatggtt gaactcccga gagtgtccta cacctagggg agaagcagcc
60aaggggttgt ttcccaccaa ggacgacccg tctgcgcaca aacggatgag cccatcagac
120aaagacatat tcattctctg ctgcaaactt ggcatagctc tgctttgcct ggggctattg
180ggggaagttg cggttcgtgc tcgcagggct ctcacccttg actctttcaa taataactct
240tctgtgcaag attacaatct aaacaattcg gagaactcga ccttcctcct gaggcaagga
300ccacagccaa cttcctctta caagccgcat cgattttgtc cttcagaaat agaaataaga
360atgcttgcta aaaattatat ttttaccaat aagaccaatc caataggtag attattagtt
420actatgttaa gaaatgaatc attatctttt agtactattt ttactcaaat tcagaagtta
480gaaatgggaa tagaaaatag aaagagacgc tcaacctcaa ttgaagaaca ggtgcaagga
540ctattgacca caggcctaga agtaaaaaag ggaaaaaaga gtgtttttgt caaaatagga
600gacaggtggt ggcaaccagg gacttatagg ggaccttaca tctacagacc aacagatgcc
660cccttaccat atacaggaag atatgactta aattgggata ggtgggttac agtcaatggc
720tataaagtgt tatatagatc cctccccttt cgtgaaagac tcgccagagc tagacctcct
780tggtgtatgt tgtctcaaga aaagaaagac gacatgaaac aacaggtaca tgattatatt
840tatctaggaa caggaatgca cttttgggga aagattttcc ataccaagga ggggacagtg
900gctggactaa tagaacatta ttctgcaaaa acttatggca tgagttatta tgattagcct
960tgatttgccc aaccttgcgg ttcccaaggc ttaagtaagt ttttggttac aaactgttct
1020taaaacaagg atgtgagaca agtggtttcc tgacttggtt tggtatcaaa ggttctgatc
1080tgagctctga gtgttctatt ttcctatgtt cttttggaat ttatccaaat cttatgtaaa
1140tgcttatgta aaccaagata taaaagagtg ctgatttttt gagtaaactt gcaacagtcc
1200taacattcac ctcttgtgtg tttgtgtctg ttcgccatcc cgtctccgct cgtcacttat
1260ccttcacttt ccagagggtc cccccgcaga ccccggcgac cctcaggtcg gccgactgcg
1320gcagctggcg cccgaacagg gaccctcgga taagtgaccc ttgtctttat ttctactatt
1380ttgtgttcgt cttgttttgt ctctatcttg tctggctatc atcacaagag cggaacggac
1440tcacctcagg gaaccaagct agcccggggt cgacggatcc gattacttac tggcaggtgc
1500tgggggcttc cgagacaatc gcgaacatct acaccacaca acaccgcctc gaccagggtg
1560agatatcggc cggggacgcg gcggtggtaa ttacaagcga gatccgatta cttactggca
1620ggtgctgggg gcttccgaga caatcgcgaa catctacacc acacaacacc gcctcgacca
1680gggtgagata tcggccgggg acgcggcggt ggtaattaca agcgagatcc ccgggaattc
1740aggacctcac catgggatgg agctgtatca tcctcttctt ggtagcaaca gctacaggtg
1800tccactccga ggtccaactg gtggagagcg gtggaggtgt tgtgcaacct ggccggtccc
1860tgcgcctgtc ctgctccgca tctggcttcg atttcaccac atattggatg agttgggtga
1920gacaggcacc tggaaaaggt cttgagtgga ttggagaaat tcatccagat agcagtacga
1980ttaactatgc gccgtctcta aaggatagat ttacaatatc gcgagacaac gccaagaaca
2040cattgttcct gcaaatggac agcctgagac ccgaagacac cggggtctat ttttgtgcaa
2100gcctttactt cggcttcccc tggtttgctt attggggcca agggaccccg gtcaccgtct
2160cctcagcctc caccaagggc ccatcggtct tccccctggc accctcctcc aagagcacct
2220ctgggggcac agcggccctg ggctgcctgg tcaaggacta cttccccgaa ccggtgacgg
2280tgtcgtggaa ctcaggcgcc ctgaccagcg gcgtgcacac cttcccggct gtcctacagt
2340cctcaggact ctactccctc agcagcgtgg tgaccgtgcc ctccagcagc ttgggcaccc
2400agacctacat ctgcaacgtg aatcacaagc ccagcaacac caaggtggac aagagagttg
2460agcccaaatc ttgtgacaaa actcacacat gcccaccgtg cccagcacct gaactcctgg
2520ggggaccgtc agtcttcctc ttccccccaa aacccaagga caccctcatg atctcccgga
2580cccctgaggt cacatgcgtg gtggtggacg tgagccacga agaccctgag gtcaagttca
2640actggtacgt ggacggcgtg gaggtgcata atgccaagac aaagccgcgg gaggagcagt
2700acaacagcac gtaccgtgtg gtcagcgtcc tcaccgtcct gcaccaggac tggctgaatg
2760gcaaggagta caagtgcaag gtctccaaca aagccctccc agcccccatc gagaaaacca
2820tctccaaagc caaagggcag ccccgagaac cacaggtgta caccctgccc ccatcccggg
2880aggagatgac caagaaccag gtcagcctga cctgcctggt caaaggcttc tatcccagcg
2940acatcgccgt ggagtgggag agcaatgggc agccggagaa caactacaag accacgcctc
3000ccgtgctgga ctccgacggc tccttcttcc tctatagcaa gctcaccgtg gacaagagca
3060ggtggcagca ggggaacgtc ttctcatgct ccgtgatgca cgaggctctg cacaaccact
3120acacgcagaa gagcctctcc ctgtctcccg ggaaatgaaa gccgaattcg cccctctccc
3180tccccccccc ctaacgttac tggccgaagc cgcttggaat aaggccggtg tgcgtttgtc
3240tatatgttat tttccaccat attgccgtct tttggcaatg tgagggcccg gaaacctggc
3300cctgtcttct tgacgagcat tcctaggggt ctttcccctc tcgccaaagg aatgcaaggt
3360ctgttgaatg tcgtgaagga agcagttcct ctggaagctt cttgaagaca aacaacgtct
3420gtagcgaccc tttgcaggca gcggaacccc ccacctggcg acaggtgcct ctgcggccaa
3480aagccacgtg tataagatac acctgcaaag gcggcacaac cccagtgcca cgttgtgagt
3540tggatagttg tggaaagagt caaatggctc tcctcaagcg tattcaacaa ggggctgaag
3600gatgcccaga aggtacccca ttgtatggga tctgatctgg ggcctcggtg cacatgcttt
3660acatgtgttt agtcgaggtt aaaaaaacgt ctaggccccc cgaaccacgg ggacgtggtt
3720ttcctttgaa aaacacgatg ataatatggc ctcctttgtc tctctgctcc tggtaggcat
3780cctattccat gccacccagg ccgacatcca gctgacccag agcccaagca gcctgagcgc
3840cagcgtgggt gacagagtga ccatcacctg taaggccagt caggatgtgg gtacttctgt
3900agcctggtac cagcagaagc caggtaaggc tccaaagctg ctgatctact ggacatccac
3960ccggcacact ggtgtgccaa gcagattcag cggtagcggt agcggtaccg acttcacctt
4020caccatcagc agcctccagc cagaggacat cgccacctac tactgccagc aatatagcct
4080ctatcggtcg ttcggccaag ggaccaaggt ggaaatcaaa cgaactgtgg ctgcaccatc
4140tgtcttcatc ttcccgccat ctgatgagca gttgaaatct ggaactgcct ctgttgtgtg
4200cctgctgaat aacttctatc ccagagaggc caaagtacag tggaaggtgg ataacgccct
4260ccaatcgggt aactcccagg agagtgtcac agagcaggac agcaaggaca gcacctacag
4320cctcagcagc accctgacgc tgagcaaagc agactacgag aaacacaaag tctacgcctg
4380cgaagtcacc catcagggcc tgagctcgcc cgtcacaaag agcttcaaca ggggagagtg
4440ttagagatcc cccgggctgc aggaattcga tatcaagctt atcgataatc aacctctgga
4500ttacaaaatt tgtgaaagat tgactggtat tcttaactat gttgctcctt ttacgctatg
4560tggatacgct gctttaatgc ctttgtatca tgctattgct tcccgtatgg ctttcatttt
4620ctcctccttg tataaatcct ggttgctgtc tctttatgag gagttgtggc ccgttgtcag
4680gcaacgtggc gtggtgtgca ctgtgtttgc tgacgcaacc cccactggtt ggggcattgc
4740caccacctgt cagctccttt ccgggacttt cgctttcccc ctccctattg ccacggcgga
4800actcatcgcc gcctgccttg cccgctgctg gacaggggct cggctgttgg gcactgacaa
4860ttccgtggtg ttgtcgggga aatcatcgtc ctttccttgg ctgctcgcct gtgttgccac
4920ctggattctg cgcgggacgt ccttctgcta cgtcccttcg gccctcaatc cagcggacct
4980tccttcccgc ggcctgctgc cggctctgcg gcctcttccg cgtcttcgcc ttcgccctca
5040gacgagtcgg atctcccttt gggccgcctc cccgcctgat cgataccgtc aacatcgata
5100aaataaaaga ttttatttag tctccagaaa aaggggggaa tgaaagaccc cacctgtagg
5160tttggcaagc tagcttaagt aacgccattt tgcaaggcat ggaaaaatac ataactgaga
5220atagagaagt tcagatcaag gtcaggaaca gatggaacag ctgaatatgg gccaaacagg
5280atatctgtgg taagcagttc ctgccccggc tcagggccaa gaacagatgg aacagctgaa
5340tatgggccaa acaggatatc tgtggtaagc agttcctgcc ccggctcagg gccaagaaca
5400gatggtcccc agatgcggtc cagccctcag cagtttctag agaaccatca gatgtttcca
5460gggtgcccca aggacctgaa atgaccctgt gccttatttg aactaaccaa tcagttcgct
5520tctcgcttct gttcgcgcgc ttctgctccc cgagctcaat aaaagagccc acaacccctc
5580actcggggcg ccagtcctcc gattgactga gtcgcccggg tacccgtgta tccaataaac
5640cctcttgcag ttgcatccga cttgtggtct cgctgttcct tgggagggtc tcctctgagt
5700gattgactac ccgtcagcgg gggtctttca tt
573279183DNAArtificialSynthetic 7aaagacccca cccgtaggtg gcaagctagc
ttaagtaacg ccactttgca aggcatggaa 60aaatacataa ctgagaatag aaaagttcag
atcaaggtca ggaacaaaga aacagctgaa 120taccaaacag gatatctgtg gtaagcggtt
cctgccccgg ctcagggcca agaacagatg 180agacagctga gtgatgggcc aaacaggata
tctgtggtaa gcagttcctg ccccggctcg 240gggccaagaa cagatggtcc ccagatgcgg
tccagccctc agcagtttct agtgaatcat 300cagatgtttc cagggtgccc caaggacctg
aaaatgaccc tgtaccttat ttgaactaac 360caatcagttc gcttctcgct tctgttcgcg
cgcttccgct ctccgagctc aataaaagag 420cccacaaccc ctcactcggc gcgccagtct
tccgatagac tgcgtcgccc gggtacccgt 480attcccaata aagcctcttg ctgtttgcat
ccgaatcgtg gtctcgctgt tccttgggag 540ggtctcctct gagtgattga ctacccacga
cgggggtctt tcatttgggg gctcgtccgg 600gatttggaga cccctgccca gggaccaccg
acccaccacc gggaggtaag ctggccagca 660acttatctgt gtctgtccga ttgtctagtg
tctatgtttg atgttatgcg cctgcgtctg 720tactagttag ctaactagct ctgtatctgg
cggacccgtg gtggaactga cgagttctga 780acacccggcc gcaaccctgg gagacgtccc
agggactttg ggggccgttt ttgtggcccg 840acctgaggaa gggagtcgat gtggaatccg
accccgtcag gatatgtggt tctggtagga 900gacgagaacc taaaacagtt cccgcctccg
tctgaatttt tgctttcggt ttggaaccga 960agccgcgcgt cttgtctgct gcagcgctgc
agcatcgttc tgtgttgtct ctgtctgact 1020gtgtttctgt atttgtctga aaattagggc
cagactgtta ccactccctt aagtttgacc 1080ttaggtcact ggaaagatgt cgagcggatc
gctcacaacc agtcggtaga tgtcaagaag 1140agacgttggg ttaccttctg ctctgcagaa
tggccaacct ttaacgtcgg atggccgcga 1200gacggcacct ttaaccgaga cctcatcacc
caggttaaga tcaaggtctt ttcacctggc 1260ccgcatggac acccagacca ggtcccctac
atcgtgacct gggaagcctt ggcttttgac 1320ccccctccct gggtcaagcc ctttgtacac
cctaagcctc cgcctcctct tcctccatcc 1380gccccgtctc tcccccttga acctcctcgt
tcgaccccgc ctcgatcctc cctttatcca 1440gccctcactc cttctctagg cgccggaatt
ccgatctgat caagagacag gatgaggatc 1500gtttcgcatg attgaacaag atggattgca
cgcaggttct ccggccgctt gggtggagag 1560gctattcggc tatgactggg cacaacagac
aatcggctgc tctgatgccg ccgtgttccg 1620gctgtcagcg caggggcgcc cggttctttt
tgtcaagacc gacctgtccg gtgccctgaa 1680tgaactgcag gacgaggcag cgcggctatc
gtggctggcc acgacgggcg ttccttgcgc 1740agctgtgctc gacgttgtca ctgaagcggg
aagggactgg ctgctattgg gcgaagtgcc 1800ggggcaggat ctcctgtcat ctcaccttgc
tcctgccgag aaagtatcca tcatggctga 1860tgcaatgcgg cggctgcata cgcttgatcc
ggctacctgc ccattcgacc accaagcgaa 1920acatcgcatc gagcgagcac gtactcggat
ggaagccggt cttgtcgatc aggatgatct 1980ggacgaagag catcaggggc tcgcgccagc
cgaactgttc gccaggctca aggcgcgcat 2040gcccgacggc gaggatctcg tcgtgaccca
tggcgatgcc tgcttgccga atatcatggt 2100ggaaaatggc cgcttttctg gattcatcga
ctgtggccgg ctgggtgtgg cggaccgcta 2160tcaggacata gcgttggcta cccgtgatat
tgctgaagag cttggcggcg aatgggctga 2220ccgcttcctc gtgctttacg gtatcgccgc
tcccgattcg cagcgcatcg ccttctatcg 2280ccttcttgac gagttcttct gagcgggact
ctggggttcg aaatgaccga ccaagcgacg 2340cccaacctgc catcacgaga tttcgattcc
accgccgcct tctatgaaag gttgggcttc 2400ggaatcgttt tccgggacgc cggctggatg
atcctccagc gcggggatct catgctggag 2460ttcttcgccc accccgggct cgatcccctc
gcgagttggt tcagctgctg cctgaggctg 2520gacgacctcg cggagttcta ccggcagtgc
aaatccgtcg gcatccagga aaccagcagc 2580ggctatccgc gcatccatgc ccccgaactg
caggagtggg gaggcacgat ggccgctttg 2640gtcgaggcgg atcctagaac tagcgaaaat
gcaagagcaa agacgaaaac atgccacaca 2700tgaggaatac cgattctctc attaacatat
tcaggccagt tatctgggct taaaagcaga 2760agtccaaccc agataacgat catatacatg
gttctctcca gaggttcatt actgaacact 2820cgtccgagaa taacgagtgg atcagtcctg
ggtggtcatt gaaaggactg atgctgaagt 2880tgaagctcca atactttggc cacctgatgc
gaagaactga ctcatgtgat aagaccctga 2940tactgggaaa gattgaaggc aggaggagaa
gggatgacag aggatggaag agttggatgg 3000aatcaccaac tcgatggaca tgagtttgag
caagcttcca ggagttggta atgggcaggg 3060aagcctggcg tgctgcagtc catggggttg
caaagagttg gacactactg agtgactgaa 3120ctgaactgat agtgtaatcc atggtacaga
atataggata aaaaagagga agagtttgcc 3180ctgattctga agagttgtag gatataaaag
tttagaatac ctttagtttg gaagtcttaa 3240attatttact taggatgggt acccactgca
atataagaaa tcaggcttta gagactgatg 3300tagagagaat gagccctggc ataccagaag
ctaacagcta ttggttatag ctgttataac 3360caatatataa ccaatatatt ggttatatag
catgaagctt gatgccagca atttgaagga 3420accatttaga actagtatcc taaactctac
atgttccagg acactgatct taaagctcag 3480gttcagaatc ttgttttata ggctctaggt
gtatattgtg gggcttccct ggtggctcag 3540atggtaaagt gtctgcctgc aatgtgggtg
atctgggttc gatccctggc ttgggaagat 3600cccctggaga aggaaatggc aacccactct
agtactctta cctggaaaat tccatggaca 3660gaggagcctt gtaagctaca gtccatggga
ttgcaaagag ttgaacacaa ctgagcaact 3720aagcacagca cagtacagta tacacctgtg
aggtgaagtg aagtgaaggt tcaatgcagg 3780gtctcctgca ttgcagaaag attctttacc
atctgagcca ccagggaagc ccaagaatac 3840tggagtgggt agcctattcc ttctccaggg
gatcttccca tcccaggaat tgaactggag 3900tctcctgcat ttcaggtgga ttcttcacca
gctgaactac caggtggata ctactccaat 3960attaaagtgc ttaaagtcca gttttcccac
ctttcccaaa aaggttgggt cactcttttt 4020taaccttctg tggcctactc tgaggctgtc
tacaagctta tatatttatg aacacattta 4080ttgcaagttg ttagttttag atttacaatg
tggtatctgg ctatttagtg gtattggtgg 4140ttggggatgg ggaggctgat agcatctcag
agggcagcta gatactgtca tacacacttt 4200tcaagttctc catttttgtg aaatagaaag
tctctggatc taagttatat gtgattctca 4260gtctctgtgg tcatattcta ttctactcct
gaccactcaa caaggaacca agatatcaag 4320ggacacttgt tttgtttcat gcctgggttg
agtgggccat gacatatgtt ctgggccttg 4380ttacatggct ggattggttg gacaagtgcc
agctctgatc ctgggactgt ggcatgtgat 4440gacatacacc ccctctccac attctgcatg
tctctagggg ggaaggggga agctcggtat 4500agaaccttta ttgtattttc tgattgcctc
acttcttata ttgcccccat gcccttcttt 4560gttcctcaag taaccagaga cagtgcttcc
cagaaccaac cctacaagaa acaaagggct 4620aaacaaagcc aaatgggaag caggatcatg
gtttgaactc tttctggcca gagaacaata 4680cctgctatgg actagatact gggagaggga
aaggaaaagt agggtgaatt atggaaggaa 4740gctggcaggc tcagcgtttc tgtcttggca
tgaccagtct ctcttcattc tcttcctaga 4800tgtagggctt ggtaccagag cccctgaggc
tttctgcatg aatataaata tatgaaactg 4860agtgatgctt ccatttcagg ttcttggggg
cgccgaattc gagctcggta cccggggatc 4920tcgacggatc cgattactta ctggcaggtg
ctgggggctt ccgagacaat cgcgaacatc 4980tacaccacac aacaccgcct cgaccagggt
gagatatcgg ccggggacgc ggcggtggta 5040attacaagcg agatccgatt acttactggc
aggtgctggg ggcttccgag acaatcgcga 5100acatctacac cacacaacac cgcctcgacc
agggtgagat atcggccggg gacgcggcgg 5160tggtaattac aagcgagatc cccgggaatt
caggacctca ccatgggatg gagctgtatc 5220atcctcttct tggtagcaac agctacaggt
gtccactccg aggtccaact ggtggagagc 5280ggtggaggtg ttgtgcaacc tggccggtcc
ctgcgcctgt cctgctccgc atctggcttc 5340gatttcacca catattggat gagttgggtg
agacaggcac ctggaaaagg tcttgagtgg 5400attggagaaa ttcatccaga tagcagtacg
attaactatg cgccgtctct aaaggataga 5460tttacaatat cgcgagacaa cgccaagaac
acattgttcc tgcaaatgga cagcctgaga 5520cccgaagaca ccggggtcta tttttgtgca
agcctttact tcggcttccc ctggtttgct 5580tattggggcc aagggacccc ggtcaccgtc
tcctcagcct ccaccaaggg cccatcggtc 5640ttccccctgg caccctcctc caagagcacc
tctgggggca cagcggccct gggctgcctg 5700gtcaaggact acttccccga accggtgacg
gtgtcgtgga actcaggcgc cctgaccagc 5760ggcgtgcaca ccttcccggc tgtcctacag
tcctcaggac tctactccct cagcagcgtg 5820gtgaccgtgc cctccagcag cttgggcacc
cagacctaca tctgcaacgt gaatcacaag 5880cccagcaaca ccaaggtgga caagagagtt
gagcccaaat cttgtgacaa aactcacaca 5940tgcccaccgt gcccagcacc tgaactcctg
gggggaccgt cagtcttcct cttcccccca 6000aaacccaagg acaccctcat gatctcccgg
acccctgagg tcacatgcgt ggtggtggac 6060gtgagccacg aagaccctga ggtcaagttc
aactggtacg tggacggcgt ggaggtgcat 6120aatgccaaga caaagccgcg ggaggagcag
tacaacagca cgtaccgtgt ggtcagcgtc 6180ctcaccgtcc tgcaccagga ctggctgaat
ggcaaggagt acaagtgcaa ggtctccaac 6240aaagccctcc cagcccccat cgagaaaacc
atctccaaag ccaaagggca gccccgagaa 6300ccacaggtgt acaccctgcc cccatcccgg
gaggagatga ccaagaacca ggtcagcctg 6360acctgcctgg tcaaaggctt ctatcccagc
gacatcgccg tggagtggga gagcaatggg 6420cagccggaga acaactacaa gaccacgcct
cccgtgctgg actccgacgg ctccttcttc 6480ctctatagca agctcaccgt ggacaagagc
aggtggcagc aggggaacgt cttctcatgc 6540tccgtgatgc acgaggctct gcacaaccac
tacacgcaga agagcctctc cctgtctccc 6600gggaaatgaa agccgaattc gcccctctcc
ctcccccccc cctaacgtta ctggccgaag 6660ccgcttggaa taaggccggt gtgcgtttgt
ctatatgtta ttttccacca tattgccgtc 6720ttttggcaat gtgagggccc ggaaacctgg
ccctgtcttc ttgacgagca ttcctagggg 6780tctttcccct ctcgccaaag gaatgcaagg
tctgttgaat gtcgtgaagg aagcagttcc 6840tctggaagct tcttgaagac aaacaacgtc
tgtagcgacc ctttgcaggc agcggaaccc 6900cccacctggc gacaggtgcc tctgcggcca
aaagccacgt gtataagata cacctgcaaa 6960ggcggcacaa ccccagtgcc acgttgtgag
ttggatagtt gtggaaagag tcaaatggct 7020ctcctcaagc gtattcaaca aggggctgaa
ggatgcccag aaggtacccc attgtatggg 7080atctgatctg gggcctcggt gcacatgctt
tacatgtgtt tagtcgaggt taaaaaaacg 7140tctaggcccc ccgaaccacg gggacgtggt
tttcctttga aaaacacgat gataatatgg 7200cctcctttgt ctctctgctc ctggtaggca
tcctattcca tgccacccag gccgacatcc 7260agctgaccca gagcccaagc agcctgagcg
ccagcgtggg tgacagagtg accatcacct 7320gtaaggccag tcaggatgtg ggtacttctg
tagcctggta ccagcagaag ccaggtaagg 7380ctccaaagct gctgatctac tggacatcca
cccggcacac tggtgtgcca agcagattca 7440gcggtagcgg tagcggtacc gacttcacct
tcaccatcag cagcctccag ccagaggaca 7500tcgccaccta ctactgccag caatatagcc
tctatcggtc gttcggccaa gggaccaagg 7560tggaaatcaa acgaactgtg gctgcaccat
ctgtcttcat cttcccgcca tctgatgagc 7620agttgaaatc tggaactgcc tctgttgtgt
gcctgctgaa taacttctat cccagagagg 7680ccaaagtaca gtggaaggtg gataacgccc
tccaatcggg taactcccag gagagtgtca 7740cagagcagga cagcaaggac agcacctaca
gcctcagcag caccctgacg ctgagcaaag 7800cagactacga gaaacacaaa gtctacgcct
gcgaagtcac ccatcagggc ctgagctcgc 7860ccgtcacaaa gagcttcaac aggggagagt
gttagagatc ccccgggctg caggaattcg 7920atatcaagct tatcgataat caacctctgg
attacaaaat ttgtgaaaga ttgactggta 7980ttcttaacta tgttgctcct tttacgctat
gtggatacgc tgctttaatg cctttgtatc 8040atgctattgc ttcccgtatg gctttcattt
tctcctcctt gtataaatcc tggttgctgt 8100ctctttatga ggagttgtgg cccgttgtca
ggcaacgtgg cgtggtgtgc actgtgtttg 8160ctgacgcaac ccccactggt tggggcattg
ccaccacctg tcagctcctt tccgggactt 8220tcgctttccc cctccctatt gccacggcgg
aactcatcgc cgcctgcctt gcccgctgct 8280ggacaggggc tcggctgttg ggcactgaca
attccgtggt gttgtcgggg aaatcatcgt 8340cctttccttg gctgctcgcc tgtgttgcca
cctggattct gcgcgggacg tccttctgct 8400acgtcccttc ggccctcaat ccagcggacc
ttccttcccg cggcctgctg ccggctctgc 8460ggcctcttcc gcgtcttcgc cttcgccctc
agacgagtcg gatctccctt tgggccgcct 8520ccccgcctga tcgataccgt caacatcgat
aaaataaaag attttattta gtctccagaa 8580aaagggggga atgaaagacc ccacctgtag
gtttggcaag ctagcttaag taacgccatt 8640ttgcaaggca tggaaaaata cataactgag
aatagagaag ttcagatcaa ggtcaggaac 8700agatggaaca gctgaatatg ggccaaacag
gatatctgtg gtaagcagtt cctgccccgg 8760ctcagggcca agaacagatg gaacagctga
atatgggcca aacaggatat ctgtggtaag 8820cagttcctgc cccggctcag ggccaagaac
agatggtccc cagatgcggt ccagccctca 8880gcagtttcta gagaaccatc agatgtttcc
agggtgcccc aaggacctga aatgaccctg 8940tgccttattt gaactaacca atcagttcgc
ttctcgcttc tgttcgcgcg cttctgctcc 9000ccgagctcaa taaaagagcc cacaacccct
cactcggggc gccagtcctc cgattgactg 9060agtcgcccgg gtacccgtgt atccaataaa
ccctcttgca gttgcatccg acttgtggtc 9120tcgctgttcc ttgggagggt ctcctctgag
tgattgacta cccgtcagcg ggggtctttc 9180att
918385711DNAArtificialSynthetic
8gatcagtcct gggtggtcat tgaaaggact gatgctgaag ttgaagctcc aatactttgg
60ccacctgatg cgaagaactg actcatgtga taagaccctg atactgggaa agattgaagg
120caggaggaga agggatgaca gaggatggaa gagttggatg gaatcaccaa ctcgatggac
180atgagtttga gcaagcttcc aggagttggt aatgggcagg gaagcctggc gtgctgcagt
240ccatggggtt gcaaagagtt ggacactact gagtgactga actgaactga tagtgtaatc
300catggtacag aatataggat aaaaaagagg aagagtttgc cctgattctg aagagttgta
360ggatataaaa gtttagaata cctttagttt ggaagtctta aattatttac ttaggatggg
420tacccactgc aatataagaa atcaggcttt agagactgat gtagagagaa tgagccctgg
480cataccagaa gctaacagct attggttata gctgttataa ccaatatata accaatatat
540tggttatata gcatgaagct tgatgccagc aatttgaagg aaccatttag aactagtatc
600ctaaactcta catgttccag gacactgatc ttaaagctca ggttcagaat cttgttttat
660aggctctagg tgtatattgt ggggcttccc tggtggctca gatggtaaag tgtctgcctg
720caatgtgggt gatctgggtt cgatccctgg cttgggaaga tcccctggag aaggaaatgg
780caacccactc tagtactctt acctggaaaa ttccatggac agaggagcct tgtaagctac
840agtccatggg attgcaaaga gttgaacaca actgagcaac taagcacagc acagtacagt
900atacacctgt gaggtgaagt gaagtgaagg ttcaatgcag ggtctcctgc attgcagaaa
960gattctttac catctgagcc accagggaag cccaagaata ctggagtggg tagcctattc
1020cttctccagg ggatcttccc atcccaggaa ttgaactgga gtctcctgca tttcaggtgg
1080attcttcacc agctgaacta ccaggtggat actactccaa tattaaagtg cttaaagtcc
1140agttttccca cctttcccaa aaaggttggg tcactctttt ttaaccttct gtggcctact
1200ctgaggctgt ctacaagctt atatatttat gaacacattt attgcaagtt gttagtttta
1260gatttacaat gtggtatctg gctatttagt ggtattggtg gttggggatg gggaggctga
1320tagcatctca gagggcagct agatactgtc atacacactt ttcaagttct ccatttttgt
1380gaaatagaaa gtctctggat ctaagttata tgtgattctc agtctctgtg gtcatattct
1440attctactcc tgaccactca acaaggaacc aagatatcaa gggacacttg ttttgtttca
1500tgcctgggtt gagtgggcca tgacatatgt tctgggcctt gttacatggc tggattggtt
1560ggacaagtgc cagctctgat cctgggactg tggcatgtga tgacatacac cccctctcca
1620cattctgcat gtctctaggg gggaaggggg aagctcggta tagaaccttt attgtatttt
1680ctgattgcct cacttcttat attgccccca tgcccttctt tgttcctcaa gtaaccagag
1740acagtgcttc ccagaaccaa ccctacaaga aacaaagggc taaacaaagc caaatgggaa
1800gcaggatcat ggtttgaact ctttctggcc agagaacaat acctgctatg gactagatac
1860tgggagaggg aaaggaaaag tagggtgaat tatggaagga agctggcagg ctcagcgttt
1920ctgtcttggc atgaccagtc tctcttcatt ctcttcctag atgtagggct tggtaccaga
1980gcccctgagg ctttctgcat gaatataaat atatgaaact gagtgatgct tccatttcag
2040gttcttgggg gcgccgaatt cgagctcggt acccggggat ctcgacggat ccgattactt
2100actggcaggt gctgggggct tccgagacaa tcgcgaacat ctacaccaca caacaccgcc
2160tcgaccaggg tgagatatcg gccggggacg cggcggtggt aattacaagc gagatccgat
2220tacttactgg caggtgctgg gggcttccga gacaatcgcg aacatctaca ccacacaaca
2280ccgcctcgac cagggtgaga tatcggccgg ggacgcggcg gtggtaatta caagcgagat
2340ctcgagaagc ttgttgggaa ttcaggccat cgatcccgcc gccaccatgg aatggagctg
2400ggtctttctc ttcttcctgt cagtaactac aggtgtccac tccgacatcc agatgaccca
2460gtctccagcc tccctatctg catctgtggg agaaactgtc actatcacat gtcgagcaag
2520tgggaatatt cacaattatt tagcatggta tcagcagaaa cagggaaaat ctcctcagct
2580cctggtctat aatgcaaaaa ccttagcaga tggtgtgcca tcaaggttca gtggcagtgg
2640atcaggaaca caatattctc tcaagatcaa cagcctgcag cctgaagatt ttgggagtta
2700ttactgtcaa catttttgga gtactccgtg gacgttcggt ggaggcacca agctggaaat
2760caaacgggct gatgctgcac caactgtatc catcttccca ccatccagtg agcagttaac
2820atctggaggt gcctcagtcg tgtgcttctt gaacaacttc taccccaaag acatcaatgt
2880caagtggaag attgatggca gtgaacgaca aaatggcgtc ctgaacagtt ggactgatca
2940ggacagcaaa gacagcacct acagcatgag cagcaccctc acattgacca aggacgagta
3000tgaacgacat aacagctata cctgtgaggc cactcacaag acatcaactt cacccattgt
3060caagagcttc aacaggaatg agtgttgaaa gcatcgattt cccctgaatt cgcccctctc
3120cctccccccc ccctaacgtt actggccgaa gccgcttgga ataaggccgg tgtgcgtttg
3180tctatatgtt attttccacc atattgccgt cttttggcaa tgtgagggcc cggaaacctg
3240gccctgtctt cttgacgagc attcctaggg gtctttcccc tctcgccaaa ggaatgcaag
3300gtctgttgaa tgtcgtgaag gaagcagttc ctctggaagc ttcttgaaga caaacaacgt
3360ctgtagcgac cctttgcagg cagcggaacc ccccacctgg cgacaggtgc ctctgcggcc
3420aaaagccacg tgtataagat acacctgcaa aggcggcaca accccagtgc cacgttgtga
3480gttggatagt tgtggaaaga gtcaaatggc tctcctcaag cgtattcaac aaggggctga
3540aggatgccca gaaggtaccc cattgtatgg gatctgatct ggggcctcgg tgcacatgct
3600ttacatgtgt ttagtcgagg ttaaaaaaac gtctaggccc cccgaaccac ggggacgtgg
3660ttttcctttg aaaaacacga tgataatatg gcctcctttg tctctctgct cctggtaggc
3720atcctattcc atgccaccca ggccgaggtt cagcttcagc agtctggggc agagcttgtg
3780aagccagggg cctcagtcaa gttgtcctgc acagcttctg gcttcaacat taaagacacc
3840tttatgcact gggtgaagca gaggcctgaa cagggcctgg agtggattgg aaggattgat
3900cctgcgaatg ggaatactga atatgacccg aagttccagg gcaaggccac tataacagca
3960gacacatcct ccaacacagt caacctgcag ctcagcagcc tgacatctga ggacactgcc
4020gtctattact gtgctagtgg aggggaactg gggtttcctt actggggcca agggactctg
4080gtcactgtct ctgcagccaa aacgacaccc ccatctgtct atccactggc ccctggatct
4140gctgcccaaa ctaactccat ggtgaccctg ggatgcctgg tcaagggcta tttccctgag
4200ccagtgacag tgacctggaa ctctggatcc ctgtccagcg gtgtgcacac cttcccagct
4260gtcctgcagt ttgacctcta cactctgagc agctcagtga ctgtcccctc cagcacctgg
4320cccagcgaga ccgtcacctg caacgttgcc cacccggcca gcagcaccaa ggtggacaag
4380aaaattgtgc ccagggattg tactagtgga ggtggaggta gccaccatca ccatcaccat
4440taatctagag ttaagcggcc gtcgagatct cgacatcgat aatcaacctc tggattacaa
4500aatttgtgaa agattgactg gtattcttaa ctatgttgct ccttttacgc tatgtggata
4560cgctgcttta atgcctttgt atcatgctat tgcttcccgt atggctttca ttttctcctc
4620cttgtataaa tcctggttgc tgtctcttta tgaggagttg tggcccgttg tcaggcaacg
4680tggcgtggtg tgcactgtgt ttgctgacgc aacccccact ggttggggca ttgccaccac
4740ctgtcagctc ctttccggga ctttcgcttt ccccctccct attgccacgg cggaactcat
4800cgccgcctgc cttgcccgct gctggacagg ggctcggctg ttgggcactg acaattccgt
4860ggtgttgtcg gggaaatcat cgtcctttcc ttggctgctc gcctgtgttg ccacctggat
4920tctgcgcggg acgtccttct gctacgtccc ttcggccctc aatccagcgg accttccttc
4980ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt cgccttcgcc ctcagacgag
5040tcggatctcc ctttgggccg cctccccgcc tgatcgataa aataaaagat tttatttagt
5100ctccagaaaa aggggggaat gaaagacccc acctgtaggt ttggcaagct agcttaagta
5160acgccatttt gcaaggcatg gaaaaataca taactgagaa tagagaagtt cagatcaagg
5220tcaggaacag atggaacagc tgaatatggg ccaaacagga tatctgtggt aagcagttcc
5280tgccccggct cagggccaag aacagatgga acagctgaat atgggccaaa caggatatct
5340gtggtaagca gttcctgccc cggctcaggg ccaagaacag atggtcccca gatgcggtcc
5400agccctcagc agtttctaga gaaccatcag atgtttccag ggtgccccaa ggacctgaaa
5460tgaccctgtg ccttatttga actaaccaat cagttcgctt ctcgcttctg ttcgcgcgct
5520tctgctcccc gagctcaata aaagagccca caacccctca ctcggggcgc cagtcctccg
5580attgactgag tcgcccgggt acccgtgtat ccaataaacc ctcttgcagt tgcatccgac
5640ttgtggtctc gctgttcctt gggagggtct cctctgagtg attgactacc cgtcagcggg
5700ggtctttcat t
571195130DNAArtificialSynthetic 9tttgaaagac cccacccgta ggtggcaagc
tagcttaagt aacgccactt tgcaaggcat 60ggaaaaatac ataactgaga atagaaaagt
tcagatcaag gtcaggaaca aagaaacagc 120tgaataccaa acaggatatc tgtggtaagc
ggttcctgcc ccggctcagg gccaagaaca 180gatgagacag ctgagtgatg ggccaaacag
gatatctgtg gtaagcagtt cctgccccgg 240ctcggggcca agaacagatg gtccccagat
gcggtccagc cctcagcagt ttctagtgaa 300tcatcagatg tttccagggt gccccaagga
cctgaaaatg accctgtacc ttatttgaac 360taaccaatca gttcgcttct cgcttctgtt
cgcgcgcttc cgctctccga gctcaataaa 420agagcccaca acccctcact cggcgcgcca
gtcttccgat agactgcgtc gcccgggtac 480ccgtattccc aataaagcct cttgctgttt
gcatccgaat cgtggtctcg ctgttccttg 540ggagggtctc ctctgagtga ttgactaccc
acgacggggg tctttcattt gggggctcgt 600ccgggatttg gagacccctg cccagggacc
accgacccac caccgggagg taagctggcc 660agcaacttat ctgtgtctgt ccgattgtct
agtgtctatg tttgatgtta tgcgcctgcg 720tctgtactag ttagctaact agctctgtat
ctggcggacc cgtggtggaa ctgacgagtt 780ctgaacaccc ggccgcaacc ctgggagacg
tcccagggac tttgggggcc gtttttgtgg 840cccgacctga ggaagggagt cgatgtggaa
tccgaccccg tcaggatatg tggttctggt 900aggagacgag aacctaaaac agttcccgcc
tccgtctgaa tttttgcttt cggtttggaa 960ccgaagccgc gcgtcttgtc tgctgcagcc
aagcttgggc tgcaggtcga ggactgggga 1020ccctgcaccg aacatggaga acacaacatc
aggattccta ggacccctgc tcgtgttaca 1080ggcggggttt ttcttgttga caagaatcct
cacaatacca cagagtctag actcgtggtg 1140gacttctctc aattttctag ggggagcacc
cacgtgtcct ggccaaaatt cgcagtcccc 1200aacctccaat cactcaccaa cctcttgtcc
tccaatttgt cctggctatc gctggatgtg 1260tctgcggcgt tttatcatat tcctcttcat
cctgctgcta tgcctcatct tcttgttggt 1320tcttctggac taccaaggta tgttgcccgt
ttgtcctcta cttccaggaa catcaactac 1380cagcacggga ccatgcaaga cctgcacgat
tcctgctcaa ggaacctcta tgtttccctc 1440ttgttgctgt acaaaacctt cggacggaaa
ctgcacttgt attcccatcc catcatcctg 1500ggctttcgca agattcctat gggagtgggc
ctcagtccgt ttctcctggc tcagtttact 1560agtgccattt gttcagtggt tcgtagggct
ttcccccact gtttggcttt cagttatatg 1620gatgatgtgg tattgggggc caagtctgta
caacatcttg agtccctttt tacctctatt 1680accaattttc ttttgtcttt gggtatacat
ttaaacccta ataaaaccaa acgttggggc 1740tactccctta acttcatggg atatgtaatt
ggatgttggg gtactttacc gcaagaacat 1800attgtactaa aaatcaagca atgttttcga
aaactgcctg taaatagacc tattgattgg 1860aaagtatgtc agagacttgt gggtcttttg
ggctttgctg ccccttttac acaatgtggc 1920tatcctgcct taatgccttt atatgcatgt
atacaatcta agcaggcttt cactttctcg 1980ccaacttaca aggcctttct gtgtaaacaa
tatctgaacc tttaccccgt tgcccggcaa 2040cggtcaggtc tctgccaagt gtttgctgac
gcaaccccca ctggatgggg cttggctatc 2100ggccatagcc gcatgcgcgg acctttgtgg
ctcctctgcc gatccatact gcggaactcc 2160tagcagcttg ttttgctcgc aggcggtctg
gagcgaaact tatcggcacc gacaactctg 2220ttgtcctctc tcggaaatac acctcctttc
catggctgct agggtgtgct gccaactgga 2280tcccctcagg atatagtagt ttcgcttttg
catagggagg gggaaatgta gtcttatgca 2340atacacttgt agtcttgcaa catggtaacg
atgagttagc aacatgcctt acaaggagag 2400aaaaagcacc gtgcatgccg attggtggaa
gtaaggtggt acgatcgtgc cttattagga 2460aggcaacaga caggtctgac atggattgga
cgaaccactg aattccgcat tgcagagata 2520attgtattta agtgcctagc tcgatacagc
aaacgccatt tttgaccatt caccacattg 2580gtgtgcacct tccaaagctt cacgctgccg
caagcactca gggcgcaagg gctgctaaag 2640gaagcggaac acgtagaaag ccagtccgca
gaaacggtgc tgaccccgga tgaatgtcag 2700ctactgggct atctggacaa gggaaaacgc
aagcgcaaag agaaagcagg tagcttgcag 2760tgggcttaca tggcgatagc tagactgggc
ggttttatgg acagcaagcg aaccggaatt 2820gccagctggg gcgccctctg gtaaggttgg
gaagccctgc aaagtaaact ggatggcttt 2880cttgccgcca aggatctgat ggcgcagggg
atcaagatct gatcaagaga caggatgagg 2940atcgtttcgc atgattgaac aagatggatt
gcacgcaggt tctccggccg cttgggtgga 3000gaggctattc ggctatgact gggcacaaca
gacaatcggc tgctctgatg ccgccgtgtt 3060ccggctgtca gcgcaggggc gcccggttct
ttttgtcaag accgacctgt ccggtgccct 3120gaatgaactg caggacgagg cagcgcggct
atcgtggctg gccacgacgg gcgttccttg 3180cgcagctgtg ctcgacgttg tcactgaagc
gggaagggac tggctgctat tgggcgaagt 3240gccggggcag gatctcctgt catctcacct
tgctcctgcc gagaaagtat ccatcatggc 3300tgatgcaatg cggcggctgc atacgcttga
tccggctacc tgcccattcg accaccaagc 3360gaaacatcgc atcgagcgag cacgtactcg
gatggaagcc ggtcttgtcg atcaggatga 3420tctggacgaa gagcatcagg ggctcgcgcc
agccgaactg ttcgccaggc tcaaggcgcg 3480catgcccgac ggcgaggatc tcgtcgtgac
ccatggcgat gcctgcttgc cgaatatcat 3540ggtggaaaat ggccgctttt ctggattcat
cgactgtggc cggctgggtg tggcggaccg 3600ctatcaggac atagcgttgg ctacccgtga
tattgctgaa gagcttggcg gcgaatgggc 3660tgaccgcttc ctcgtgcttt acggtatcgc
cgctcccgat tcgcagcgca tcgccttcta 3720tcgccttctt gacgagttct tctgagcggg
actctggggt tcgaaatgac cgaccaagcg 3780acgcccaacc tgccatcacg agatttcgat
tccaccgccg ccttctatga aaggttgggc 3840ttcggaatcg ttttccggga cgccggctgg
atgatcctcc agcgcgggga tctcatgctg 3900gagttcttcg cccaccccaa ccctggccct
attattgggt ggactaacca tggggggaat 3960tgccgctgga ataggaacag ggactactgc
tctaatggcc actcagcaat tccagcagct 4020ccaagccgca gtacaggatg atctcaggga
ggttgaaaaa tcaatctcta acctagaaaa 4080gtctctcact tccctgtctg aagttgtcct
acagaatcga aggggcctag acttgttatt 4140tctaaaagaa ggagggctgt gtgctgctct
aaaagaagaa tgttgcttct atgcggacca 4200cacaggacta gtgagagaca gcatggccaa
attgagagag aggcttaatc agagacagaa 4260actgtttgag tcaactcaag gatggtttga
gggactgttt aacagatccc cttggtttac 4320caccttgata tctaccatta tgggacccct
cattgtactc ctaatgattt tgctcttcgg 4380accctgcatt cttaatcgat tagtccaatt
tgttaaagac aggatatcag tggtccaggc 4440tctagttttg actcaacaat atcaccagct
gaagcctata gagtacgagc catagataaa 4500ataaaagatt ttatttagtc tccagaaaaa
ggggggaatg aaagacccca cctgtaggtt 4560tggcaagcta gcttaagtaa cgccattttg
caaggcatgg aaaaatacat aactgagaat 4620agagaagttc agatcaaggt caggaacaga
tggaacagct gaatatgggc caaacaggat 4680atctgtggta agcagttcct gccccggctc
agggccaaga acagatggaa cagctgaata 4740tgggccaaac aggatatctg tggtaagcag
ttcctgcccc ggctcagggc caagaacaga 4800tggtccccag atgcggtcca gccctcagca
gtttctagag aaccatcaga tgtttccagg 4860gtgccccaag gacctgaaat gaccctgtgc
cttatttgaa ctaaccaatc agttcgcttc 4920tcgcttctgt tcgcgcgctt ctgctccccg
agctcaataa aagagcccac aacccctcac 4980tcggggcgcc agtcctccga ttgactgagt
cgcccgggta cccgtgtatc caataaaccc 5040tcttgcagtt gcatccgact tgtggtctcg
ctgttccttg ggagggtctc ctctgagtga 5100ttgactaccc gtcagcgggg gtctttcatt
5130104661DNAArtificialSynthetic
10gatcagtcct gggtggtcat tgaaaggact gatgctgaag ttgaagctcc aatactttgg
60ccacctgatg cgaagaactg actcatgtga taagaccctg atactgggaa agattgaagg
120caggaggaga agggatgaca gaggatggaa gagttggatg gaatcaccaa ctcgatggac
180atgagtttga gcaagcttcc aggagttggt aatgggcagg gaagcctggc gtgctgcagt
240ccatggggtt gcaaagagtt ggacactact gagtgactga actgaactga tagtgtaatc
300catggtacag aatataggat aaaaaagagg aagagtttgc cctgattctg aagagttgta
360ggatataaaa gtttagaata cctttagttt ggaagtctta aattatttac ttaggatggg
420tacccactgc aatataagaa atcaggcttt agagactgat gtagagagaa tgagccctgg
480cataccagaa gctaacagct attggttata gctgttataa ccaatatata accaatatat
540tggttatata gcatgaagct tgatgccagc aatttgaagg aaccatttag aactagtatc
600ctaaactcta catgttccag gacactgatc ttaaagctca ggttcagaat cttgttttat
660aggctctagg tgtatattgt ggggcttccc tggtggctca gatggtaaag tgtctgcctg
720caatgtgggt gatctgggtt cgatccctgg cttgggaaga tcccctggag aaggaaatgg
780caacccactc tagtactctt acctggaaaa ttccatggac agaggagcct tgtaagctac
840agtccatggg attgcaaaga gttgaacaca actgagcaac taagcacagc acagtacagt
900atacacctgt gaggtgaagt gaagtgaagg ttcaatgcag ggtctcctgc attgcagaaa
960gattctttac catctgagcc accagggaag cccaagaata ctggagtggg tagcctattc
1020cttctccagg ggatcttccc atcccaggaa ttgaactgga gtctcctgca tttcaggtgg
1080attcttcacc agctgaacta ccaggtggat actactccaa tattaaagtg cttaaagtcc
1140agttttccca cctttcccaa aaaggttggg tcactctttt ttaaccttct gtggcctact
1200ctgaggctgt ctacaagctt atatatttat gaacacattt attgcaagtt gttagtttta
1260gatttacaat gtggtatctg gctatttagt ggtattggtg gttggggatg gggaggctga
1320tagcatctca gagggcagct agatactgtc atacacactt ttcaagttct ccatttttgt
1380gaaatagaaa gtctctggat ctaagttata tgtgattctc agtctctgtg gtcatattct
1440attctactcc tgaccactca acaaggaacc aagatatcaa gggacacttg ttttgtttca
1500tgcctgggtt gagtgggcca tgacatatgt tctgggcctt gttacatggc tggattggtt
1560ggacaagtgc cagctctgat cctgggactg tggcatgtga tgacatacac cccctctcca
1620cattctgcat gtctctaggg gggaaggggg aagctcggta tagaaccttt attgtatttt
1680ctgattgcct cacttcttat attgccccca tgcccttctt tgttcctcaa gtaaccagag
1740acagtgcttc ccagaaccaa ccctacaaga aacaaagggc taaacaaagc caaatgggaa
1800gcaggatcat ggtttgaact ctttctggcc agagaacaat acctgctatg gactagatac
1860tgggagaggg aaaggaaaag tagggtgaat tatggaagga agctggcagg ctcagcgttt
1920ctgtcttggc atgaccagtc tctcttcatt ctcttcctag atgtagggct tggtaccaga
1980gcccctgagg ctttctgcat gaatataaat atatgaaact gagtgatgct tccatttcag
2040gttcttgggg gcgccgaatt cgagctcggt acccggggat ctcgagaagc tttaaccatg
2100gaatggagct gggtctttct cttcttcctg tcagtaacta caggtgtcca ctcccaggtt
2160cagttgcagc agtctgacgc tgagttggtg aaacctgggg cttcagtgaa gatttcctgc
2220aaggcttctg gctacacctt cactgaccat gcaattcact gggtgaaaca gaaccctgaa
2280cagggcctgg aatggattgg atatttttct cccggaaatg atgattttaa atacaatgag
2340aggttcaagg gcaaggccac actgactgca gacaaatcct ccagcactgc ctacgtgcag
2400ctcaacagcc tgacatctga ggattctgca gtgtatttct gtacaagatc cctgaatatg
2460gcctactggg gtcaaggaac ctcagtcacc gtctcctcag gaggcggagg cagcggaggc
2520ggtggctcgg gaggcggagg ctcggacatt gtgatgtcac agtctccatc ctccctacct
2580gtgtcagttg gcgagaaggt tactttgagc tgcaagtcca gtcagagcct tttatatagt
2640ggtaatcaaa agaactactt ggcctggtac cagcagaaac cagggcagtc tcctaaactg
2700ctgatttact gggcatccgc tagggaatct ggggtccctg atcgcttcac aggcagtgga
2760tctgggacag atttcactct ctccatcagc agtgtgaaga ctgaagacct ggcagtttat
2820tactgtcagc agtattatag ctatcccctc acgttcggtg ctgggaccaa gctggtgctg
2880aaacgggccg ccgagcccaa atctcctgac aaaactcaca catgcccacc gtgcccagca
2940cctgaactcc tggggggacc gtcagtcttc ctcttccccc caaaacccaa ggacaccctc
3000atgatctccc ggacccctga ggtcacatgc gtggtggtgg acgtgagcca cgaagaccct
3060gaggtcaagt tcaactggta cgtggacggc gtggaggtgc ataatgccaa gacaaagccg
3120cgggaggagc agtacaacag cacgtaccgt gtggtcagcg tcctcaccgt cctgcaccag
3180gactggctga atggcaagga gtacaagtgc aaggtctcca acaaagccct cccagccccc
3240atcgagaaaa ccatctccaa agccaaaggg cagccccgag aaccacaggt gtacaccctg
3300cccccatccc gggatgagct gaccaagaac caggtcagcc tgacctgcct ggtcaaaggc
3360ttctatccca gcgacatcgc cgtggagtgg gagagcaatg ggcagccgga gaacaactac
3420aagaccacgc ctcccgtgct ggactccgac ggctccttct tcctctacag caagctcacc
3480gtggacaaga gcaggtggca gcaggggaac gtcttctcat gctccgtgat gcatgaggct
3540ctgcacaacc actacacgca gaagagcctc tccctgtctc cgggtaaagg aggcggatca
3600ggaggtggcg cacctacttc aagttctaca aagaaaacac agctacaact ggagcattta
3660ctgctggatt tacagatgat tttgaatgga attaataatt acaagaatcc caaactcacc
3720aggatgctca catttaagtt ttacatgccc aagaaggcca cagaactgaa acatcttcag
3780tgtctagaag aagaactcaa acctctggag gaagtgctaa atttagctca aagcaaaaac
3840tttcacttaa gacccaggga cttaatcagc aatatcaacg taatagttct ggaactaaag
3900ggatctgaaa caacattcat gtgtgaatat gctgatgaga cagcaaccat tgtagaattt
3960ctgaacagat ggattacctt ttgtcaaagc atcatctcaa cactaacttg aagcttgtta
4020acatcgataa aataaaagat tttatttagt ctccagaaaa aggggggaat gaaagacccc
4080acctgtaggt ttggcaagct agcttaagta acgccatttt gcaaggcatg gaaaaataca
4140taactgagaa tagagaagtt cagatcaagg tcaggaacag atggaacagc tgaatatggg
4200ccaaacagga tatctgtggt aagcagttcc tgccccggct cagggccaag aacagatgga
4260acagctgaat atgggccaaa caggatatct gtggtaagca gttcctgccc cggctcaggg
4320ccaagaacag atggtcccca gatgcggtcc agccctcagc agtttctaga gaaccatcag
4380atgtttccag ggtgccccaa ggacctgaaa tgaccctgtg ccttatttga actaaccaat
4440cagttcgctt ctcgcttctg ttcgcgcgct tctgctcccc gagctcaata aaagagccca
4500caacccctca ctcggggcgc cagtcctccg attgactgag tcgcccgggt acccgtgtat
4560ccaataaacc ctcttgcagt tgcatccgac ttgtggtctc gctgttcctt gggagggtct
4620cctctgagtg attgactacc cgtcagcggg ggtctttcat t
4661115691DNAArtificialSynthetic 11gatcagtcct gggtggtcat tgaaaggact
gatgctgaag ttgaagctcc aatactttgg 60ccacctgatg cgaagaactg actcatgtga
taagaccctg atactgggaa agattgaagg 120caggaggaga agggatgaca gaggatggaa
gagttggatg gaatcaccaa ctcgatggac 180atgagtttga gcaagcttcc aggagttggt
aatgggcagg gaagcctggc gtgctgcagt 240ccatggggtt gcaaagagtt ggacactact
gagtgactga actgaactga tagtgtaatc 300catggtacag aatataggat aaaaaagagg
aagagtttgc cctgattctg aagagttgta 360ggatataaaa gtttagaata cctttagttt
ggaagtctta aattatttac ttaggatggg 420tacccactgc aatataagaa atcaggcttt
agagactgat gtagagagaa tgagccctgg 480cataccagaa gctaacagct attggttata
gctgttataa ccaatatata accaatatat 540tggttatata gcatgaagct tgatgccagc
aatttgaagg aaccatttag aactagtatc 600ctaaactcta catgttccag gacactgatc
ttaaagctca ggttcagaat cttgttttat 660aggctctagg tgtatattgt ggggcttccc
tggtggctca gatggtaaag tgtctgcctg 720caatgtgggt gatctgggtt cgatccctgg
cttgggaaga tcccctggag aaggaaatgg 780caacccactc tagtactctt acctggaaaa
ttccatggac agaggagcct tgtaagctac 840agtccatggg attgcaaaga gttgaacaca
actgagcaac taagcacagc acagtacagt 900atacacctgt gaggtgaagt gaagtgaagg
ttcaatgcag ggtctcctgc attgcagaaa 960gattctttac catctgagcc accagggaag
cccaagaata ctggagtggg tagcctattc 1020cttctccagg ggatcttccc atcccaggaa
ttgaactgga gtctcctgca tttcaggtgg 1080attcttcacc agctgaacta ccaggtggat
actactccaa tattaaagtg cttaaagtcc 1140agttttccca cctttcccaa aaaggttggg
tcactctttt ttaaccttct gtggcctact 1200ctgaggctgt ctacaagctt atatatttat
gaacacattt attgcaagtt gttagtttta 1260gatttacaat gtggtatctg gctatttagt
ggtattggtg gttggggatg gggaggctga 1320tagcatctca gagggcagct agatactgtc
atacacactt ttcaagttct ccatttttgt 1380gaaatagaaa gtctctggat ctaagttata
tgtgattctc agtctctgtg gtcatattct 1440attctactcc tgaccactca acaaggaacc
aagatatcaa gggacacttg ttttgtttca 1500tgcctgggtt gagtgggcca tgacatatgt
tctgggcctt gttacatggc tggattggtt 1560ggacaagtgc cagctctgat cctgggactg
tggcatgtga tgacatacac cccctctcca 1620cattctgcat gtctctaggg gggaaggggg
aagctcggta tagaaccttt attgtatttt 1680ctgattgcct cacttcttat attgccccca
tgcccttctt tgttcctcaa gtaaccagag 1740acagtgcttc ccagaaccaa ccctacaaga
aacaaagggc taaacaaagc caaatgggaa 1800gcaggatcat ggtttgaact ctttctggcc
agagaacaat acctgctatg gactagatac 1860tgggagaggg aaaggaaaag tagggtgaat
tatggaagga agctggcagg ctcagcgttt 1920ctgtcttggc atgaccagtc tctcttcatt
ctcttcctag atgtagggct tggtaccaga 1980gcccctgagg ctttctgcat gaatataaat
atatgaaact gagtgatgct tccatttcag 2040gttcttgggg gcgccgaatt cgagctcggt
acccggggat ctcgacggat ccgattactt 2100actggcaggt gctgggggct tccgagacaa
tcgcgaacat ctacaccaca caacaccgcc 2160tcgaccaggg tgagatatcg gccggggacg
cggcggtggt aattacaagc gagatccgat 2220tacttactgg caggtgctgg gggcttccga
gacaatcgcg aacatctaca ccacacaaca 2280ccgcctcgac cagggtgaga tatcggccgg
ggacgcggcg gtggtaatta caagcgagat 2340ctcgagttaa cagatctagg cctcctaggt
cgacggatcc ccgggaattc ggcgccgcca 2400ccatgatgtc ctttgtctct ctgctcctgg
taggcatcct attccatgcc acccaggccc 2460aggtccaact gcagcagtct gggcctgagc
tggtgaagcc tgggacttca gtgaggatat 2520cctgcaaggc ttctggctac accttcacaa
gctactattt acactgggtg aagcagaggc 2580ctggacaggg acttgagtgg attgcatgga
tttatcctgg aaatgttatt actacgtaca 2640atgagaagtt caagggcaag gccacactga
ctgcagacaa atcctccagc acagcctaca 2700tgcacctcaa cagcctgacc tctgaggact
ctgcggtcta tttctgtgca aggggtgacc 2760atgatcttga ctactggggc caaggcacca
ctctcacagt ctcctcagcc aaaacgacac 2820ccccatctgt ctatccactg gcccctggat
ctgctgccca aactaactcc atggtgaccc 2880tgggatgcct ggtcaagggc tatttccctg
agccagtgac agtgacctgg aactctggat 2940ccctgtccag cggtgtgcac accttcccag
ctgtcctgca gtctgacctc tacactctga 3000gcagctcagt gactgtcccc tccagcacct
ggcccagcga gaccgtcacc tgcaacgttg 3060cccacccggc cagcagcacc aaggtggaca
agaaaattgt gcccagggat tgtactagtg 3120gaggtggagg tagctaaggg agatctcgac
ggatccccgg gaattcgccc ctctccctcc 3180ccccccccta acgttactgg ccgaagccgc
ttggaataag gccggtgtgc gtttgtctat 3240atgttatttt ccaccatatt gccgtctttt
ggcaatgtga gggcccggaa acctggccct 3300gtcttcttga cgagcattcc taggggtctt
tcccctctcg ccaaaggaat gcaaggtctg 3360ttgaatgtcg tgaaggaagc agttcctctg
gaagcttctt gaagacaaac aacgtctgta 3420gcgacccttt gcaggcagcg gaacccccca
cctggcgaca ggtgcctctg cggccaaaag 3480ccacgtgtat aagatacacc tgcaaaggcg
gcacaacccc agtgccacgt tgtgagttgg 3540atagttgtgg aaagagtcaa atggctctcc
tcaagcgtat tcaacaaggg gctgaaggat 3600gcccagaagg taccccattg tatgggatct
gatctggggc ctcggtgcac atgctttaca 3660tgtgtttagt cgaggttaaa aaaacgtcta
ggccccccga accacgggga cgtggttttc 3720ctttgaaaaa cacgatgata atatggcctc
ctttgtctct ctgctcctgg taggcatcct 3780attccatgcc acccaggccg acattgtgct
gacacaatct ccagcaatca tgtctgcatc 3840tccaggggag aaggtcacca tgacctgcag
tgccacctca agtgtaagtt acatacactg 3900gtaccagcag aagtcaggca cctcccccaa
aagatggatt tatgacacat ccaaactggc 3960ttctggagtc cctgctcgct tcagtggcag
tgggtctggg acctctcact ctctcacact 4020cagcagcatg gaggctgaag atgctgccac
ttattactgc cagcagtggg gtagttacct 4080cacgttcggt gcggggacca agctggagct
gaaacgggct gatgctgcac caactgtatc 4140catcttccca ccatccagtg agcagttaac
atctggaggt gcctcagtcg tgtgcttctt 4200gaacaacttc taccccaaag acatcaatgt
caagtggaag attgatggca gtgaacgaca 4260aaatggcgtc ctgaacagtt ggactgatca
ggacagcaaa gacagcacct acagcatgag 4320cagcaccctc acgttgacca aggacgagta
tgaacgacat aacagctata cctgtgaggc 4380cactcacaag acatcaactt cacccattgt
caagagcttc aacaggaatg agtgttaata 4440ggggagatct cgacatcgat aatcaacctc
tggattacaa aatttgtgaa agattgactg 4500gtattcttaa ctatgttgct ccttttacgc
tatgtggata cgctgcttta atgcctttgt 4560atcatgctat tgcttcccgt atggctttca
ttttctcctc cttgtataaa tcctggttgc 4620tgtctcttta tgaggagttg tggcccgttg
tcaggcaacg tggcgtggtg tgcactgtgt 4680ttgctgacgc aacccccact ggttggggca
ttgccaccac ctgtcagctc ctttccggga 4740ctttcgcttt ccccctccct attgccacgg
cggaactcat cgccgcctgc cttgcccgct 4800gctggacagg ggctcggctg ttgggcactg
acaattccgt ggtgttgtcg gggaaatcat 4860cgtcctttcc ttggctgctc gcctgtgttg
ccacctggat tctgcgcggg acgtccttct 4920gctacgtccc ttcggccctc aatccagcgg
accttccttc ccgcggcctg ctgccggctc 4980tgcggcctct tccgcgtctt cgccttcgcc
ctcagacgag tcggatctcc ctttgggccg 5040cctccccgcc tgatcgataa aataaaagat
tttatttagt ctccagaaaa aggggggaat 5100gaaagacccc acctgtaggt ttggcaagct
agcttaagta acgccatttt gcaaggcatg 5160gaaaaataca taactgagaa tagagaagtt
cagatcaagg tcaggaacag atggaacagc 5220tgaatatggg ccaaacagga tatctgtggt
aagcagttcc tgccccggct cagggccaag 5280aacagatgga acagctgaat atgggccaaa
caggatatct gtggtaagca gttcctgccc 5340cggctcaggg ccaagaacag atggtcccca
gatgcggtcc agccctcagc agtttctaga 5400gaaccatcag atgtttccag ggtgccccaa
ggacctgaaa tgaccctgtg ccttatttga 5460actaaccaat cagttcgctt ctcgcttctg
ttcgcgcgct tctgctcccc gagctcaata 5520aaagagccca caacccctca ctcggggcgc
cagtcctccg attgactgag tcgcccgggt 5580acccgtgtat ccaataaacc ctcttgcagt
tgcatccgac ttgtggtctc gctgttcctt 5640gggagggtct cctctgagtg attgactacc
cgtcagcggg ggtctttcat t 569112668DNAArtificialSynthetic
12ggaattcgcc cctctccctc ccccccccct aacgttactg gccgaagccg cttggaataa
60ggccggtgtg cgtttgtcta tatgttattt tccaccatat tgccgtcttt tggcaatgtg
120agggcccgga aacctggccc tgtcttcttg acgagcattc ctaggggtct ttcccctctc
180gccaaaggaa tgcaaggtct gttgaatgtc gtgaaggaag cagttcctct ggaagcttct
240tgaagacaaa caacgtctgt agcgaccctt tgcaggcagc ggaacccccc acctggcgac
300aggtgcctct gcggccaaaa gccacgtgta taagatacac ctgcaaaggc ggcacaaccc
360cagtgccacg ttgtgagttg gatagttgtg gaaagagtca aatggctctc ctcaagcgta
420ttcaacaagg ggctgaagga tgcccagaag gtaccccatt gtatgggatc tgatctgggg
480cctcggtgca catgctttac atgtgtttag tcgaggttaa aaaaacgtct aggccccccg
540aaccacgggg acgtggtttt cctttgaaaa acacgatgat aatatggcct tgctcatcct
600tacctgtctt gtggctgttg ctcttgccgg cgccatggga tatctagatc tcgagctcgc
660gaaagctt
668136255DNAArtificialSynthetic 13tttgaaagac cccacccgta ggtggcaagc
tagcttaagt aacgccactt tgcaaggcat 60ggaaaaatac ataactgaga atagaaaagt
tcagatcaag gtcaggaaca aagaaacagc 120tgaataccaa acaggatatc tgtggtaagc
ggttcctgcc ccggctcagg gccaagaaca 180gatgagacag ctgagtgatg ggccaaacag
gatatctgtg gtaagcagtt cctgccccgg 240ctcggggcca agaacagatg gtccccagat
gcggtccagc cctcagcagt ttctagtgaa 300tcatcagatg tttccagggt gccccaagga
cctgaaaatg accctgtacc ttatttgaac 360taaccaatca gttcgcttct cgcttctgtt
cgcgcgcttc cgctctccga gctcaataaa 420agagcccaca acccctcact cggcgcgcca
gtcttccgat agactgcgtc gcccgggtac 480ccgtattccc aataaagcct cttgctgttt
gcatccgaat cgtggtctcg ctgttccttg 540ggagggtctc ctctgagtga ttgactaccc
acgacggggg tctttcattt gggggctcgt 600ccgggatttg gagacccctg cccagggacc
accgacccac caccgggagg taagctggcc 660agcaacttat ctgtgtctgt ccgattgtct
agtgtctatg tttgatgtta tgcgcctgcg 720tctgtactag ttagctaact agctctgtat
ctggcggacc cgtggtggaa ctgacgagtt 780ctgaacaccc ggccgcaacc ctgggagacg
tcccagggac tttgggggcc gtttttgtgg 840cccgacctga ggaagggagt cgatgtggaa
tccgaccccg tcaggatatg tggttctggt 900aggagacgag aacctaaaac agttcccgcc
tccgtctgaa tttttgcttt cggtttggaa 960ccgaagccgc gcgtcttgtc tgctgcagcg
ctgcagcatc gttctgtgtt gtctctgtct 1020gactgtgttt ctgtatttgt ctgaaaatta
gggccagact gttaccactc ccttaagttt 1080gaccttaggt cactggaaag atgtcgagcg
gatcgctcac aaccagtcgg tagatgtcaa 1140gaagagacgt tgggttacct tctgctctgc
agaatggcca acctttaacg tcggatggcc 1200gcgagacggc acctttaacc gagacctcat
cacccaggtt aagatcaagg tcttttcacc 1260tggcccgcat ggacacccag accaggtccc
ctacatcgtg acctgggaag ccttggcttt 1320tgacccccct ccctgggtca agccctttgt
acaccctaag cctccgcctc ctcttcctcc 1380atccgccccg tctctccccc ttgaacctcc
tcgttcgacc ccgcctcgat cctcccttta 1440tccagccctc actccttctc taggcgccgg
aattccgatc tgatcaagag acaggatgag 1500gatcgtttcg catgattgaa caagatggat
tgcacgcagg ttctccggcc gcttgggtgg 1560agaggctatt cggctatgac tgggcacaac
agacaatcgg ctgctctgat gccgccgtgt 1620tccggctgtc agcgcagggg cgcccggttc
tttttgtcaa gaccgacctg tccggtgccc 1680tgaatgaact gcaggacgag gcagcgcggc
tatcgtggct ggccacgacg ggcgttcctt 1740gcgcagctgt gctcgacgtt gtcactgaag
cgggaaggga ctggctgcta ttgggcgaag 1800tgccggggca ggatctcctg tcatctcacc
ttgctcctgc cgagaaagta tccatcatgg 1860ctgatgcaat gcggcggctg catacgcttg
atccggctac ctgcccattc gaccaccaag 1920cgaaacatcg catcgagcga gcacgtactc
ggatggaagc cggtcttgtc gatcaggatg 1980atctggacga agagcatcag gggctcgcgc
cagccgaact gttcgccagg ctcaaggcgc 2040gcatgcccga cggcgaggat ctcgtcgtga
cccatggcga tgcctgcttg ccgaatatca 2100tggtggaaaa tggccgcttt tctggattca
tcgactgtgg ccggctgggt gtggcggacc 2160gctatcagga catagcgttg gctacccgtg
atattgctga agagcttggc ggcgaatggg 2220ctgaccgctt cctcgtgctt tacggtatcg
ccgctcccga ttcgcagcgc atcgccttct 2280atcgccttct tgacgagttc ttctgagcgg
gactctgggg ttcgaaatga ccgaccaagc 2340gacgcccaac ctgccatcac gagatttcga
ttccaccgcc gccttctatg aaaggttggg 2400cttcggaatc gttttccggg acgccggctg
gatgatcctc cagcgcgggg atctcatgct 2460ggagttcttc gcccaccccg ggctcgatcc
cctcgcgagt tggttcagct gctgcctgag 2520gctggacgac ctcgcggagt tctaccggca
gtgcaaatcc gtcggcatcc aggaaaccag 2580cagcggctat ccgcgcatcc atgcccccga
actgcaggag tggggaggca cgatggccgc 2640tttggtcgag gcggatccgg ccattagcca
tattattcat tggttatata gcataaatca 2700atattggcta ttggccattg catacgttgt
atccatatca taatatgtac atttatattg 2760gctcatgtcc aacattaccg ccatgttgac
attgattatt gactagttat taatagtaat 2820caattacggg gtcattagtt catagcccat
atatggagtt ccgcgttaca taacttacgg 2880taaatggccc gcctggctga ccgcccaacg
acccccgccc attgacgtca ataatgacgt 2940atgttcccat agtaacgcca atagggactt
tccattgacg tcaatgggtg gagtatttac 3000ggtaaactgc ccacttggca gtacatcaag
tgtatcatat gccaagtacg ccccctattg 3060acgtcaatga cggtaaatgg cccgcctggc
attatgccca gtacatgacc ttatgggact 3120ttcctacttg gcagtacatc tacgtattag
tcatcgctat taccatggtg atgcggtttt 3180ggcagtacat caatgggcgt ggatagcggt
ttgactcacg gggatttcca agtctccacc 3240ccattgacgt caatgggagt ttgttttggc
accaaaatca acgggacttt ccaaaatgtc 3300gtaacaactc cgccccattg acgcaaatgg
gcggtaggca tgtacggtgg gaggtctata 3360taagcagagc tcgtttagtg aaccgtcaga
tcgcctggag acgccatcca cgctgttttg 3420acctccatag aagacaccgg gaccgatcca
gcctccgcgg ccccaagctt ctcgacggat 3480ccccgggaat tcaggccatc gatcccgccg
ccaccatgga atggagctgg gtctttctct 3540tcttcctgtc agtaactaca ggtgtccact
ccgacatcca gatgacccag tctccagcct 3600ccctatctgc atctgtggga gaaactgtca
ctatcacatg tcgagcaagt gggaatattc 3660acaattattt agcatggtat cagcagaaac
agggaaaatc tcctcagctc ctggtctata 3720atgcaaaaac cttagcagat ggtgtgccat
caaggttcag tggcagtgga tcaggaacac 3780aatattctct caagatcaac agcctgcagc
ctgaagattt tgggagttat tactgtcaac 3840atttttggag tactccgtgg acgttcggtg
gaggcaccaa gctggaaatc aaacgggctg 3900atgctgcacc aactgtatcc atcttcccac
catccagtga gcagttaaca tctggaggtg 3960cctcagtcgt gtgcttcttg aacaacttct
accccaaaga catcaatgtc aagtggaaga 4020ttgatggcag tgaacgacaa aatggcgtcc
tgaacagttg gactgatcag gacagcaaag 4080acagcaccta cagcatgagc agcaccctca
cattgaccaa ggacgagtat gaacgacata 4140acagctatac ctgtgaggcc actcacaaga
catcaacttc acccattgtc aagagcttca 4200acaggaatga gtgttgaaag catcgatttc
ccctgaattc gcccctctcc ctcccccccc 4260cctaacgtta ctggccgaag ccgcttggaa
taaggccggt gtgcgtttgt ctatatgtta 4320ttttccacca tattgccgtc ttttggcaat
gtgagggccc ggaaacctgg ccctgtcttc 4380ttgacgagca ttcctagggg tctttcccct
ctcgccaaag gaatgcaagg tctgttgaat 4440gtcgtgaagg aagcagttcc tctggaagct
tcttgaagac aaacaacgtc tgtagcgacc 4500ctttgcaggc agcggaaccc cccacctggc
gacaggtgcc tctgcggcca aaagccacgt 4560gtataagata cacctgcaaa ggcggcacaa
ccccagtgcc acgttgtgag ttggatagtt 4620gtggaaagag tcaaatggct ctcctcaagc
gtattcaaca aggggctgaa ggatgcccag 4680aaggtacccc attgtatggg atctgatctg
gggcctcggt gcacatgctt tacatgtgtt 4740tagtcgaggt taaaaaaacg tctaggcccc
ccgaaccacg gggacgtggt tttcctttga 4800aaaacacgat gataatatgg cctcctttgt
ctctctgctc ctggtaggca tcctattcca 4860tgccacccag gccgaggttc agcttcagca
gtctggggca gagcttgtga agccaggggc 4920ctcagtcaag ttgtcctgca cagcttctgg
cttcaacatt aaagacacct ttatgcactg 4980ggtgaagcag aggcctgaac agggcctgga
gtggattgga aggattgatc ctgcgaatgg 5040gaatactgaa tatgacccga agttccaggg
caaggccact ataacagcag acacatcctc 5100caacacagtc aacctgcagc tcagcagcct
gacatctgag gacactgccg tctattactg 5160tgctagtgga ggggaactgg ggtttcctta
ctggggccaa gggactctgg tcactgtctc 5220tgcagccaaa acgacacccc catctgtcta
tccactggcc cctggatctg ctgcccaaac 5280taactccatg gtgaccctgg gatgcctggt
caagggctat ttccctgagc cagtgacagt 5340gacctggaac tctggatccc tgtccagcgg
tgtgcacacc ttcccagctg tcctgcagtc 5400tgacctctac actctgagca gctcagtgac
tgtcccctcc agcacctggc ccagcgagac 5460cgtcacctgc aacgttgccc acccggccag
cagcaccaag gtggacaaga aaattgtgcc 5520cagggattgt actagtggag gtggaggtag
ccaccatcac catcaccatt aatctagagt 5580taagcggccg tcgagatcta ggcctcctag
gtcgacatcg ataaaataaa agattttatt 5640tagtctccag aaaaaggggg gaatgaaaga
ccccacctgt aggtttggca agctagctta 5700agtaacgcca ttttgcaagg catggaaaaa
tacataactg agaatagaga agttcagatc 5760aaggtcagga acagatggaa cagctgaata
tgggccaaac aggatatctg tggtaagcag 5820ttcctgcccc ggctcagggc caagaacaga
tggaacagct gaatatgggc caaacaggat 5880atctgtggta agcagttcct gccccggctc
agggccaaga acagatggtc cccagatgcg 5940gtccagccct cagcagtttc tagagaacca
tcagatgttt ccagggtgcc ccaaggacct 6000gaaatgaccc tgtgccttat ttgaactaac
caatcagttc gcttctcgct tctgttcgcg 6060cgcttctgct ccccgagctc aataaaagag
cccacaaccc ctcactcggg gcgccagtcc 6120tccgattgac tgagtcgccc gggtacccgt
gtatccaata aaccctcttg cagttgcatc 6180cgacttgtgg tctcgctgtt ccttgggagg
gtctcctctg agtgattgac tacccgtcag 6240cgggggtctt tcatt
62551443DNAArtificialSynthetic
14ctttgaaaaa cacgatgata atatggcctc ctttgtctct ctg
431530DNAArtificialSynthetic 15ttcgcgagct cgagatctag atatcccatg
301635DNAArtificialSynthetic 16ctacaggtgt
ccacgtcgac atccagctga cccag
351734DNAArtificialSynthetic 17ctgcagaata gatctctaac actctcccct gttg
341851DNAArtificialSynthetic 18cagtgtgatc
tcgagaattc aggacctcac catgggatgg agctgtatca t
511923DNAArtificialSynthetic 19aggctgtatt ggtggattcg tct
232041DNAArtificialSynthetic 20agcttctcga
gttaacagat ctaggcctcc taggtcgaca t
412139DNAArtificialSynthetic 21cgatgtcgac ctaggaggcc tagatctgtt aactcgaga
392264DNAArtificialSynthetic 22cgaggctctg
cacaaccact acacgcagaa gagcctctcc ctgtctcccg ggaaatgaaa 60gccg
642372DNAArtificialSynthetic 23aattcggctt tcatttcccg ggagacaggg
agaggctctt ctgcgtgtag tggttgtgca 60gagcctcgtg ca
722441DNAArtificialSynthetic
24aaagcatatg ttctgggcct tgttacatgg ctggattggt t
412554DNAArtificialSynthetic 25tgaattcggc gcccccaaga acctgaaatg
gaagcatcac tcagtttcat atat 542635DNAArtificialSynthetic
26ctacaggtgt ccacgtcgac atccagctga cccag
352734DNAArtificialSynthetic 27ctgcagaata gatctctaac actctcccct gttg
342851DNAArtificialSynthetic 28cagtgtgatc
tcgagaattc aggacctcac catgggatgg agctgtatca t
512922DNAArtificialSynthetic 29gtgtcttcgg gtctcaggct gt
223041DNAArtificialSynthetic 30agcttctcga
gttaacagat ctaggcctcc taggtcgaca t
413139DNAArtificialSynthetic 31cgatgtcgac ctaggaggcc tagatctgtt aactcgaga
393264DNAArtificialSynthetic 32cgaggctctg
cacaaccact acacgcagaa gagcctctcc ctgtctcccg ggaaatgaaa 60gccg
643372DNAArtificialSynthetic 33aattcggctt tcatttcccg ggagacaggg
agaggctctt ctgcgtgtag tggttgtgca 60gagcctcgtg ca
72349511DNAArtificialSynthetic
34gaattaattc ataccagatc accgaaaact gtcctccaaa tgtgtccccc tcacactccc
60aaattcgcgg gcttctgcct cttagaccac tctaccctat tccccacact caccggagcc
120aaagccgcgg cccttccgtt tctttgcttt tgaaagaccc cacccgtagg tggcaagcta
180gcttaagtaa cgccactttg caaggcatgg aaaaatacat aactgagaat agaaaagttc
240agatcaaggt caggaacaaa gaaacagctg aataccaaac aggatatctg tggtaagcgg
300ttcctgcccc ggctcagggc caagaacaga tgagacagct gagtgatggg ccaaacagga
360tatctgtggt aagcagttcc tgccccggct cggggccaag aacagatggt ccccagatgc
420ggtccagccc tcagcagttt ctagtgaatc atcagatgtt tccagggtgc cccaaggacc
480tgaaaatgac cctgtacctt atttgaacta accaatcagt tcgcttctcg cttctgttcg
540cgcgcttccg ctctccgagc tcaataaaag agcccacaac ccctcactcg gcgcgccagt
600cttccgatag actgcgtcgc ccgggtaccc gtattcccaa taaagcctct tgctgtttgc
660atccgaatcg tggtctcgct gttccttggg agggtctcct ctgagtgatt gactacccac
720gacgggggtc tttcatttgg gggctcgtcc gggatttgga gacccctgcc cagggaccac
780cgacccacca ccgggaggta agctggccag caacttatct gtgtctgtcc gattgtctag
840tgtctatgtt tgatgttatg cgcctgcgtc tgtactagtt agctaactag ctctgtatct
900ggcggacccg tggtggaact gacgagttct gaacacccgg ccgcaaccct gggagacgtc
960ccagggactt tgggggccgt ttttgtggcc cgacctgagg aagggagtcg atgtggaatc
1020cgaccccgtc aggatatgtg gttctggtag gagacgagaa cctaaaacag ttcccgcctc
1080cgtctgaatt tttgctttcg gtttggaacc gaagccgcgc gtcttgtctg ctgcagcgct
1140gcagcatcgt tctgtgttgt ctctgtctga ctgtgtttct gtatttgtct gaaaattagg
1200gccagactgt taccactccc ttaagtttga ccttaggtca ctggaaagat gtcgagcgga
1260tcgctcacaa ccagtcggta gatgtcaaga agagacgttg ggttaccttc tgctctgcag
1320aatggccaac ctttaacgtc ggatggccgc gagacggcac ctttaaccga gacctcatca
1380cccaggttaa gatcaaggtc ttttcacctg gcccgcatgg acacccagac caggtcccct
1440acatcgtgac ctgggaagcc ttggcttttg acccccctcc ctgggtcaag ccctttgtac
1500accctaagcc tccgcctcct cttcctccat ccgccccgtc tctccccctt gaacctcctc
1560gttcgacccc gcctcgatcc tccctttatc cagccctcac tccttctcta ggcgccggaa
1620ttccgatctg atcaagagac aggatgaggg agcttgtata tccattttcg gatctgatca
1680gcacgtgttg acaattaatc atcggcatag tatatcggca tagtataata cgacaaggtg
1740aggaactaaa ccatggccaa gcctttgtct caagaagaat ccaccctcat tgaaagagca
1800acggctacaa tcaacagcat ccccatctct gaagactaca gcgtcgccag cgcagctctc
1860tctagcgacg gccgcatctt cactggtgtc aatgtatatc attttactgg gggaccttgt
1920gcagaactcg tggtgctggg cactgctgct gctgcggcag ctggcaacct gacttgtatc
1980gtcgcgatcg gaaatgagaa caggggcatc ttgagcccct gcggacggtg tcgacaggtg
2040cttctcgatc tgcatcctgg gatcaaagcg atagtgaagg acagtgatgg acagccgacg
2100gcagttggga ttcgtgaatt gctgccctct ggttatgtgt gggagggcta agcacttcgt
2160ggccgaggag caggactgac acgtgctacg agatttcgat tccaccgccg ccttctatga
2220aaggttgggc ttcggaatcg ttttccggga cgccggctgg atgatcctcc agcgcgggga
2280tctcatgctg gagttcttcg cccaccccaa cttgtttatt gcagcttata atggttacaa
2340ataaagcaat agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg
2400tggtttgtcc aaactcatca atgtatctta tcatgtctgt acgagttggt tcagctgctg
2460cctgaggctg gacgacctcg cggagttcta ccggcagtgc aaatccgtcg gcatccagga
2520aaccagcagc ggctatccgc gcatccatgc ccccgaactg caggagtggg gaggcacgat
2580ggccgctttg gtcgaggcgg atccggccat tagccatatt attcattggt tatatagcat
2640aaatcaatat tggctattgg ccattgcata cgttgtatcc atatcataat atgtacattt
2700atattggctc atgtccaaca ttaccgccat gttgacattg attattgact agttattaat
2760agtaatcaat tacggggtca ttagttcata gcccatatat ggagttccgc gttacataac
2820ttacggtaaa tggcccgcct ggctgaccgc ccaacgaccc ccgcccattg acgtcaataa
2880tgacgtatgt tcccatagta acgccaatag ggactttcca ttgacgtcaa tgggtggagt
2940atttacggta aactgcccac ttggcagtac atcaagtgta tcatatgcca agtacgcccc
3000ctattgacgt caatgacggt aaatggcccg cctggcatta tgcccagtac atgaccttat
3060gggactttcc tacttggcag tacatctacg tattagtcat cgctattacc atggtgatgc
3120ggttttggca gtacatcaat gggcgtggat agcggtttga ctcacgggga tttccaagtc
3180tccaccccat tgacgtcaat gggagtttgt tttggcacca aaatcaacgg gactttccaa
3240aatgtcgtaa caactccgcc ccattgacgc aaatgggcgg taggcatgta cggtgggagg
3300tctatataag cagagctcgt ttagtgaacc gtcagatcgc ctggagacgc catccacgct
3360gttttgacct ccatagaaga caccgggacc gatccagcct ccgcggcccc aagcttctcg
3420agttaacaga tctaggctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca
3480acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc
3540cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg
3600accatgatta cgccaagctt ggctgcaggt cgacggatcc actagtaacg gccgccagtg
3660tgctggaatt caccatgggg caacccggga acggcagcgc cttcttgctg gcacccaatg
3720gaagccatgc gccggaccac gacgtcacgc agcaaaggga cgaggtgtgg gtggtgggca
3780tgggcatcgt catgtctctc atcgtcctgg ccatcgtgtt tggcaatgtg ctggtcatca
3840cagccattgc caagttcgag cgtctgcaga cggtcaccaa ctacttcatc acaagcttgg
3900cctgtgctga tctggtcatg gggctagcag tggtgccctt tggggccgcc catattctca
3960tgaaaatgtg gacttttggc aacttctggt gcgagttctg gacttccatt gatgtgctgt
4020gcgtcacggc atcgattgag accctgtgcg tgatcgcagt cgaccgctac tttgccatta
4080ctagtccttt caagtaccag agcctgctga ccaagaataa ggcccgggtg atcattctga
4140tggtgtggat tgtgtcaggc cttacctcct tcttgcccat tcagatgcac tggtacaggg
4200ccacccacca ggaagccatc aactgctatg ccaatgagac ctgctgtgac ttcttcacga
4260accaagccta tgccattgcc tcttccatcg tgtccttcta cgttcccctg gtgatcatgg
4320tcttcgtcta ctccagggtc tttcaggagg ccaaaaggca gctccagaag attgacaaat
4380ctgagggccg cttccatgtc cagaacctta gccaggtgga gcaggatggg cggacggggc
4440atggactccg cagatcttcc aagttctgct tgaaggagca caaagccctc aagacgttag
4500gcatcatcat gggcactttc accctctgct ggctgccctt cttcatcgtt aacattgtgc
4560atgtgatcca ggataacctc atccgtaagg aagtttacat cctcctaaat tggataggct
4620atgtcaattc tggtttcaat ccccttatct actgccggag cccagatttc aggattgcct
4680tccaggagct tctgtgcctg cgcaggtctt ctttgaaggc ctatggcaat ggctactcca
4740gcaacggcaa cacaggggag cagagtggat atcacgtgga acaggagaaa gaaaataaac
4800tgctgtgtga agacctccca ggcacggaag actttgtggg ccatcaaggt actgtgccta
4860gcgataacat tgattcacaa gggaggaatt gtagtacaaa tgactcactg ctctcgagaa
4920tcgaggggcg gcaccaccat catcaccacg tcgaccccgg ggactacaag gatgacgatg
4980acaagtaagc tttatccatc acactggcgg ccgctcgagc atgcatctag cggccgctcg
5040aggccggcaa ggccggatcc ccgggaattc gcccctctcc ctcccccccc cctaacgtta
5100ctggccgaag ccgcttggaa taaggccggt gtgcgtttgt ctatatgtta ttttccacca
5160tattgccgtc ttttggcaat gtgagggccc ggaaacctgg ccctgtcttc ttgacgagca
5220ttcctagggg tctttcccct ctcgccaaag gaatgcaagg tctgttgaat gtcgtgaagg
5280aagcagttcc tctggaagct tcttgaagac aaacaacgtc tgtagcgacc ctttgcaggc
5340agcggaaccc cccacctggc gacaggtgcc tctgcggcca aaagccacgt gtataagata
5400cacctgcaaa ggcggcacaa ccccagtgcc acgttgtgag ttggatagtt gtggaaagag
5460tcaaatggct ctcctcaagc gtattcaaca aggggctgaa ggatgcccag aaggtacccc
5520attgtatggg atctgatctg gggcctcggt gcacatgctt tacatgtgtt tagtcgaggt
5580taaaaaaacg tctaggcccc ccgaaccacg gggacgtggt tttcctttga aaaacacgat
5640gataatatgg cctcctttgt ctctctgctc ctggtaggca tcctattcca tgccacccag
5700gccgagctca cccagtctcc agactccctg gctgtgtctc tgggcgagag ggccaccatc
5760aactgcaagt ccagccagag tgttttgtac agctccaaca ataagaacta tttagcttgg
5820tatcagcaga aaccaggaca gcctcctaag ctgctcattt actgggcatc tacccgggaa
5880tccggggtcc ctgaccgatt cagtggcagc gggtctggga cagatttcac tctcaccatc
5940agcagcctgc aggctgaaga tgtggcagtt tattactgtc agcaatatta tagtactcag
6000acgttcggcc aagggaccaa ggtggaaatc aaacgaactg tggctgcacc atctgtcttc
6060atcttcccgc catctgatga gcagttgaaa tctggaactg cctctgttgt gtgcctgctg
6120aataacttct atcccagaga ggccaaagta cagtggaagg tggataacgc cctccaatcg
6180ggtaactccc aggagagtgt cacagagcag gacagcaagg acagcaccta cagcctcagc
6240agcaccctga cgctgagcaa agcagactac gagaaacaca aactctacgc ctgcgaagtc
6300acccatcagg gcctgagatc gcccgtcaca aagagcttca acaaggggag agtgttagtt
6360ctagataatt aattaggagg agatctcgag ctcgcgaaag cttggcactg gccgtcgttt
6420tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt gcagcacatc
6480cccctttcgc cagcctccta ggtcgacatc gataaaataa aagattttat ttagtctcca
6540gaaaaagggg ggaatgaaag accccacctg taggtttggc aagctagctt aagtaacgcc
6600attttgcaag gcatggaaaa atacataact gagaatagag aagttcagat caaggtcagg
6660aacagatgga acagctgaat atgggccaaa caggatatct gtggtaagca gttcctgccc
6720cggctcaggg ccaagaacag atggaacagc tgaatatggg ccaaacagga tatctgtggt
6780aagcagttcc tgccccggct cagggccaag aacagatggt ccccagatgc ggtccagccc
6840tcagcagttt ctagagaacc atcagatgtt tccagggtgc cccaaggacc tgaaatgacc
6900ctgtgcctta tttgaactaa ccaatcagtt cgcttctcgc ttctgttcgc gcgcttctgc
6960tccccgagct caataaaaga gcccacaacc cctcactcgg ggcgccagtc ctccgattga
7020ctgagtcgcc cgggtacccg tgtatccaat aaaccctctt gcagttgcat ccgacttgtg
7080gtctcgctgt tccttgggag ggtctcctct gagtgattga ctacccgtca gcgggggtct
7140ttcatttggg ggctcgtccg ggatcgggag acccctgccc agggaccacc gacccaccac
7200cgggaggtaa gctggctgcc tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat
7260gcagctcccg gagacggtca cagcttgtct gtaagcggat gccgggagca gacaagcccg
7320tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc agtcacgtag
7380cgatagcgga gtgtatactg gcttaactat gcggcatcag agcagattgt actgagagtg
7440caccatatgc ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg catcaggcgc
7500tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta
7560tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag
7620aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg
7680tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg
7740tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg
7800cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga
7860agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc
7920tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt
7980aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact
8040ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg
8100cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt
8160accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt
8220ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct
8280ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg
8340gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt
8400aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt
8460gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc
8520gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg
8580cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc
8640gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg
8700gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctgca
8760ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga
8820tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct
8880ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg
8940cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca
9000accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaaca
9060cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct
9120tcggggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact
9180cgtgcaccca actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa
9240acaggaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc
9300atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga
9360tacatatttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga
9420aaagtgccac ctgacgtcta agaaaccatt attatcatga cattaaccta taaaaatagg
9480cgtatcacga ggccctttcg tcttcaagaa t
95113530DNAArtificialSynthetic 35gatccactag taacggccgc cagaattcgc
303643DNAArtificialSynthetic 36cagagagaca
aaggaggcca tattatcatc gtgtttttca aag 43
User Contributions:
Comment about this patent or add new information about this topic:
