Patent application title: COMPOSITIONS AND METHODS FOR REGULATION OF SMOOTH MUSCLE CELLS AND BLOOD PRESSURE

Inventors: Sung W. Rhee (Little Rock, AR, US) Paul L. Hermonat (Little Rock, AR, US) Nancy J. Rusch (Bigelow, AR, US)
Assignees: BOARD OF TRUSTEES OF THE UNIVERSITY OF ARKANSAS
IPC8 Class: AA61K3170FI
USPC Class: 514 44
Class name: Polynucleotide (e.g., RNA, DNA, etc.)
Publication date: 10/30/2008
Patent application number: 20080269159

Abstract:

The invention encompasses a composition for regulating smooth muscle cells. In particular, the invention encompasses a vector comprising a smooth muscle promoter operably-linked to a nucleic acid encoding a calcium-activated potassium channel.

Claims:

1. A vector comprising a smooth muscle specific promoter operably linked to a nucleic acid sequence encoding a calcium-activated potassium channel.

2. The vector of claim 1, wherein the smooth muscle specific promoter is a promoter selected from the group consisting of SEQ ID NO.:1, SEQ ID NO.:2, SEQ ID NO.:3, and SEQ ID NO.:9.

3. The vector of claim 1, wherein the promoter is a human promoter.

4. The vector of claim 1, wherein the nucleic acid sequence encoding a calcium-activated potassium channel encodes a BKα subunit.

5. The vector of claim 4, wherein the BKα subunit is a human BKα subunit.

6. The vector of claim 1, wherein the nucleic acid sequence encoding a calcium-activated potassium channel is selected from the group consisting of SEQ ID NO.:4, SEQ ID NO.:6, SEQ ID NO.:7, SEQ ID NO.:8 and a coding sequence of any of the foregoing.

7. The vector of claim 1, wherein the vector comprises an AAV vector.

8. The vector of claim 5, wherein the vector comprises SEQ ID NO.: 5.

9. A method for regulating the blood pressure of a mouse, the method comprising administering to the mouse a vector comprising a smooth muscle specific promoter operably linked to a nucleic acid sequence encoding a calcium-activated potassium channel.

10. The method of claim 9, wherein the smooth muscle specific promoter is selected from the group consisting of SEQ ID NO.:1, SEQ ID NO.:2, SEQ ID NO.:3, and SEQ ID NO.:9.

11. The vector of claim 9, wherein the nucleic acid sequence encoding a calcium-activated potassium channel encodes a BKα subunit.

12. The method of claim 9, wherein the nucleic acid sequence encoding a calcium-activated potassium channel is selected from the group consisting of SEQ ID NO.: 4, SEQ ID NO.: 6, SEQ ID NO.: 7, SEQ ID NO.: 8 and a coding sequence of any of the foregoing.

13. The method of claim 9, wherein the vector comprises an AAV vector.

14. The method of claim 9, wherein the vector comprises SEQ ID NO.: 5.

15. A method of expressing a calcium-activated potassium channel in a smooth muscle cell, the method comprising contacting the smooth muscle cell with a vector comprising a smooth muscle specific promoter operably-linked to a nucleic acid sequence encoding a calcium-activated potassium channel.

16. The method of claim 15, wherein the smooth muscle specific promoter is selected from the group consisting of SEQ ID NO.:1, SEQ ID NO.:2, SEQ ID NO.:3, and SEQ ID NO.:9.

17. The vector of claim 15, wherein the nucleic acid sequence encoding a calcium-activated potassium channel encodes a BKα subunit.

18. The method of claim 15, wherein the nucleic acid sequence encoding a calcium-activated potassium channel is SEQ ID NO.: 4, SEQ ID NO.: 6, SEQ ID NO.: 7, SEQ ID NO.: 8 and a coding sequence of any of the foregoing.

19. The method of claim 15, wherein the vector comprises an AAV vector.

20. The method of claim 15, wherein the vector comprises SEQ ID NO.: 5.

Description:

CROSS REFERENCE TO RELATED APPLICATIONS

[0001]This application claims the priority of U.S. provisional application No. 60/914,718, filed Apr. 27, 2007, hereby incorporated by reference in its entirety.

REFERENCE TO SEQUENCE LISTING

[0003]A paper copy of the sequence listing and a computer readable form of the same sequence listing are appended below and herein incorporated by reference. The information recorded in computer readable form is identical to the written sequence listing, according to 37 C.F.R. 1.821 (f).

FIELD OF THE INVENTION

[0004]The invention encompasses a composition for regulating smooth muscle cells.

BACKGROUND OF THE INVENTION

[0005]Nearly 60 million Americans are estimated to suffer from systemic hypertension, and the hallmark finding of this disease is an abnormally high peripheral vascular resistance. Additionally, vasospasm is a finding in some forms of coronary, cerebral and systemic arterial occlusions and also can occur during or after angioplasty to relieve vascular stenoses. New therapeutic approaches are needed to reduce the anomalous vascular tone. For example, only about one-third of patients with essential hypertension (i.e., hypertension of unknown etiology) are successfully treated by standard antihypertensive drugs, and most of these patients require daily, multi-drug therapy to achieve blood pressure reduction, which may lead to one or more side effects.

[0006]High-conductance voltage- and calcium-activated potassium channels, named "BK channels" because of their big unitary conductances (150 to 300 pS), are expressed in all vascular beds. The opening of these channels mediates a hyperpolarizing potassium current that buffers contraction of vascular smooth muscle cells (VSMCs) in the arterial wall, resulting in vasodilation of small arteries and arterioles. The α subunit of the BK channel forms the ion-conducting pore, and appears to arise from a single gene family, although phenotypic diversity may be generated by a high level of alternative splicing of the common primary transcript. The BK channel complex also includes a β subunit that increases the sensitivity of the α subunit to intracellular calcium, thereby enhancing its activation level. Deletion of the subunit in KO mice to create poorly functional BK channels results in a blood pressure elevation of approximately 20 mm Hg.

[0007]During vascular activation caused by vasoconstrictor stimuli, membrane depolarization and the associated rise in cytosolic calcium act synergistically to further open BK channels. Thus, the BK channels buffer VSMC excitation and prevent abnormal arterial contraction by exerting a vasodilator influence. However, this vasodilator influence cannot fully dampen anomalous vasoconstriction under some conditions, including local vasospasm and during pulmonary or systemic hypertension in which an elevated arterial tone persists despite the activation of compensatory mechanisms. Under these conditions, therapeutic interventions are required to restore normal levels of vascular tone.

[0008]A unique vasodilator therapy comprising the long-term expression of a potent endogenous vasodilator protein in smooth muscle cells has clear advantages over standard antihypertensive drugs in terms of cost, convenience, and tissue and target specificity. Such a method may provide long-term vasodilation with few side effects compared to standard vasodilator and antihypertensive therapies.

[0009]The long-term delivery of BK channels to VSMCs using a smooth muscle-specific promoter provides at least two important advantages. First, its hyperpolarizing influence may limit further increases in vascular resistance and blood pressure during the pathogenesis of hypertension. Second, a higher density of BK channels may prevent or alleviate anomalous vasoconstriction and vasospasm in a single vessel or in a vessel network.

SUMMARY OF THE INVENTION

[0010]Hence, one aspect of the present invention encompasses a vector. The vector comprises a smooth muscle specific promoter operably linked to a nucleic acid sequence encoding a calcium-activated potassium channel.

[0011]Another aspect of the invention encompasses a method for regulating the blood pressure of a mouse. The method comprises administering to the mouse a vector comprising a smooth muscle specific promoter operably linked to a nucleic acid sequence encoding a calcium-activated potassium channel.

[0012]Yet another aspect of the invention encompasses a method of expressing a calcium-activated potassium channel in a smooth muscle cell. The method comprises contacting the smooth muscle cell with a vector comprising a smooth muscle specific promoter operably-linked to a nucleic acid sequence encoding a calcium-activated potassium channel.

[0013]Other aspects and iterations of the invention are described more thoroughly below.

REFERENCE TO COLOR FIGURES

[0014]The application file contains at least one photograph executed in color. Copies of this patent application publication with color photographs will be provided by the Office upon request and payment of the necessary fee.

BRIEF DESCRIPTION OF THE FIGURES

[0015]FIG. 1 depicts an illustration of a map of a vector of the present invention.

[0016]FIG. 2 depicts a photograph illustrating PCR amplification of the BKα transgene. Samples were taken from heart, liver, and mesenteric arteries of mice 6 weeks after injecting AAV/MusB-GFP (Control, Ctrl) or AAV/SM22-BKα (BK). Only the mesenteric artery showed PCR product corresponding to mRNA of the BKα transgene.

[0017]FIG. 3 depicts a graph showing a reduction in blood pressure. SBP was averaged during a 2 week interval in four groups of mice (n=4-5 each). Control mice (control) were not injected with MV or infused with Ang II. The other 3 groups of mice received tail vein injections of either AAV/MusB-GFP (10¹¹ vp/kg), AAV/MusB-BKα (10¹⁰ vp/kg) or AAV/SM22-BKα (10¹¹ vp/kg). After 3 weeks, Ang II was infused to induce hypertension, and then SBP was measured for two weeks to evaluate the antihypertensive effect of the therapeutic vectors on the established phase of hypertension. Compared to GFP, MV-mediated delivery of AAV/MusB-BKα or AAV/SM22BKα significantly lowered blood pressure, and the effect appeared to be dose-dependent. Mean +SD (n=4, 5). * and #: different from Control and GFP, respectively. (P<0.05)

[0018]FIG. 4 depicts illustrations of vectors and promoters of the invention, and a graph showing promoter activity. A) DNA sequence of the SM22α and MusB promoters. Bolded sequences represent CArG boxes (SM22α) or a modified CArG sequence (MusB). B) Luciferase assay showed ˜20-fold higher activity of MusB in rat aortic VSMCs compared to rat cardiac myocytes. C) The four MV constructs. The SM22α or MusB promoters will be used to drive expression of GFP (control) or the nucleic acid of interest, BKα.

[0019]FIG. 5 depicts photographs of the expressed constructs. A) Green fluorescence from A7r5 cells 72 hr after transfection with SM22-GFP or MusB-GFP plasmids. B) Mouse aorta collected 9 wks after injecting AAV/SM22-GFP. VSMCs show green fluorescence (arrows) when stained with Alexa488-labeled anti-GFP antibody. Autofluorescence from connective layers is seen as yellow (yellow arrowheads) and nuclei were stained with DAPI (blue).

[0020]FIG. 6 depicts a photograph and graphs showing the presence of BKα in mouse aorta and mesenteric arteries. A) Western blot detection of BKα (˜125 kD) in mouse aorta and mesenteric arteries (MA). B) Whole-cell K+ current in a mouse mesenteric current in VSMCs from the mouse VSMC before (left trace), and after (middle trace) the addition of the BK channel mesentery, a vascular bed involved blocker, iberiotoxin (100 nmol/L Ibtx). The difference between the two traces was computed digitally to isolate the Ibtx-sensitive BK current (right trace).

[0021]FIG. 7 depicts illustrations showing expression data. A) PCR amplification revealed the absence of BKα and BKβ1 mRNAs in A7r5 cells. Rat mesenteric arteries (MA) were used as a positive expression control. B) Voltage pulses from a holding potential of -70 mV to +50 mV failed to elicit K+ current in A7r5 cells. C) However, A7r5 cells transfected with SM22-BKα displayed K+ current.

[0022]FIG. 8 depicts photographs showing how vascular reactivity assays will compare the dilator function of BK channels between arteries of normotensive mice, hypertensive mice, and mice treated with the AAV/BKα gene, using: A and B) Isolated, cannulated mesenteric arteries. The dilator influence of BK channels will be blocked by iberiotoxin (Ibtx). C) Similar diameter responses will be assessed in the intact mesenteric vascular bed using intravital video microscopy (IVVM).

[0023]FIG. 9 depicts graphs showing blood pressure of mice exposed to angiotensin II. A) Daily averages of systolic, mean, and diastolic pressure measured by biotelemetry. Ang II minipumps (2 μg/kg/min) were implanted on Day 0. Error bars (SD, n=5). B) Mean arterial pressure from two mice measured by biotelemetry. Ang II minipumps inserted on Day 0 (arrowhead) were exchanged after six weeks (arrow) with a second Ang II (top trace) or a saline minipump (lower trace). C) Systolic blood pressure measured by tailcuff. Ang 11 (2 μg/kg/min), NE (4 μg/kg/min), or saline minipumps were implanted on Day 0. Error bars (SEM, n=6, 7).

[0024]FIG. 10 depicts a photograph of the expression of the vector. DNA extracted from mesenteric arteries from each group of mice was probed for AAV/BKα to confirm AAV-mediated gene delivery.

[0025]FIG. 11 depicts a graph showing Ang II-induced hypertension was not attenuated in mice injected with 2 doses of AAV/SM22-GFP 5×10¹⁰ vp/kg; 3 days apart. However, a sustained reduction in blood pressure was recorded by telemetry in a similar Ang II-infused hypertensive mouse injected with the same viral dose of AAV/SM22-BKα.

DETAILED DESCRIPTION OF THE INVENTION

[0026]The present invention provides compositions and methods for the expression of a calcium-activated potassium channel in smooth muscle cells. In particular, the present invention provides a vector comprising a smooth muscle promoter operably linked to a nucleic acid encoding a calcium-activated potassium channel.

I. Composition Comprising a Vector

[0027]One aspect of the present invention is a composition comprising a vector for expressing a calcium-activated potassium channel in a smooth muscle cell. In various configurations, the vector may comprise a smooth muscle specific promoter operably linked to a nucleic acid sequence encoding a calcium-activated potassium channel. A nucleic acid sequence and a promoter are "operably linked" if the promoter sequence effectively controls transcription of the nucleic acid sequence.

[0028]The term "vector," as used herein, refers to any nucleic acid capable of transforming target cells and expressing an inserted calcium-activated potassium channel nucleic acid or fragment of a calcium-activated potassium channel nucleic acid. The vector may be autonomously replicating or not, double-stranded or single-stranded, or encased in a viral capsid or not. Vectors of the present invention include viruses comprising capsid and nucleic acid, viral nucleic acid without capsid, DNA plasmids, linear DNA molecules and linear or circular RNA molecules. Vectors of the present invention include those vectors derived from retroviruses, adenovirus, adeno-associated virus, SV40 virus, or herpes virus. An adeno-associated virus (AAV) of the present invention may include any sub-type of adeno-associated virus capable of transducing a genetic element. In various embodiments of the present invention, the vector comprises an AAV vector. AAV vectors are known in the art, and may include, for instance, a vector, or a variant thereof, disclosed in U.S. Pat. No. 5,139,941, hereby incorporated by reference in its entirety.

(a) promoter

[0029]A vector of the invention typically comprises a smooth muscle cell specific promoter. A "promoter" or "promoter sequence," as used herein, is a nucleic acid regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. For purposes of defining the present invention, a promoter sequence extends upstream (5' direction) from the transcription start site to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. In some instances, elements of a promoter may be found downstream (3') of the transcription initiation site. Within the promoter sequence may be found a transcription initiation site, as well as protein binding domains (consensus sequences) responsible for the binding of cis and trans acting proteins and RNA polymerase. Eukaryotic promoters often, but not always, contain "TATA" boxes and "CAT" boxes.

[0030]Smooth muscle cell specific," as used herein, means that the promoter preferentially initiates transcription in smooth muscle cells as opposed to other cell types. In an exemplary embodiment, the promoter has detectable activity only in smooth muscle cells. A promoter of the invention may be from a mammal such as a rodent, a non-human primate, a companion animal, a livestock animal, or a human. Non-limiting examples of rodents may include mice, rats, and guinea pigs. Non-limiting examples of companion animals may include dogs and cats. Non-limiting examples of a livestock animal may include swine, cattle, or goats.

[0031]A promoter may be constitutive or may be regulatable. Non-limiting examples of a regulatable promoter may include promoters that require activators to initiate transcription, or alternatively, repressors to stop transcription. For instance, the tetracycline regulatable promoter may be used (i.e. the tet_on/tet_off system). Such regulatable promoters are known in the art.

[0032]In some embodiments, a promoter of the invention may be derived from a nucleic acid sequence specifically expressed in a smooth muscle cell. For instance, the promoter may be selected from the group comprising the SMMHC (smooth muscle myosin heavy chain, 16 kb) promoter, the FRNK (autonomously expressed carboxyl-terminal region of focal adhesion kinase, 15 kb) promoter, the CRP1 (Cysteine-Rich Protein 1, 5 kb) promoter, or the SM22α promoter. In one embodiment, the promoter may be a SM22αpromoter. As used herein, "SM22α promoter" refers to the region immediately upstream (5') of the structural SM22α gene that controls expression of that gene. In some instances, the promoter may comprise the region of up to 50, 100, 500, 1,000, 1, 500, 2,000 or even up to about 5,000 bases immediately upstream of the translational start site of the SM22α gene. An SM22α promoter may also be described as an isolated nucleic acid segment comprising a contiguous sequence of bases from the SM22α gene such as bases -445 to +61, or such as a sequence of -441 to +41 bases from the transcription start site. The designations of -445 to +61 and the like indicate the position of a base relative to the transcriptional start site (+1).

[0033]Additionally, a promoter of the present invention includes any substantially homologous nucleic acid sequence that may be truncated, mutated, or any other variant of a promoter so long as the promoter remains operable and retains specificity for smooth muscle cell expression. Two DNA sequences are "substantially homologous" when at least about 75% (preferably at least about 80%, and most preferably at least about 90% or 95%) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Maniatis et al., DNA Cloning, Vols. I & II; Nucleic Acid Hybridization.

[0034]In one embodiment, the promoter may comprise SEQ ID NO:1. SEQ ID NO. 1 represents a 507 nucleotide sequence corresponding to a mouse SM22α promoter. Alternatively, the promoter may comprise SEQ ID NO:2. SEQ ID NO:2 represents a 499 nucleotide sequence corresponding to a variant of a mouse SM22α promoter. In another embodiment, a promoter of the invention may have 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homologous to SEQ ID NO:1 or SEQ ID NO:2, so long as the promoter remains operable and retains specificity for smooth muscle cell expression. In yet another embodiment, a promoter may be a fragment of SEQ ID NO:1 or SEQ ID NO:2 that remains operable and retains specificity for smooth muscle cell expression.

[0035]In some embodiments, the promoter may be a human SM22α promoter. SEQ ID NO. 9 comprises a nucleotide sequence corresponding to the human SM22α coding sequence and smooth muscle specific promoter, which may be found as GenBank Accession No. D84342. A human SM22α promoter may include regulatory elements found 5' to the ATG codon, including elements such as two CArG/SRF-boxes and two GC-box/Sp 1 binding sites present at bp-147 and -274, and at bp -233 and -1635, respectively.

[0036]In certain embodiments, a smooth muscle cell promoter may be a variant of a parent promoter that is not itself specific for a smooth muscle cell. For instance, a promoter may be altered, or varied, so that it is specific for a smooth muscle cell. For example, the smooth muscle cell promoter may be a variant of the cardiac myocin heavy chain promoter. In particular, the promoter may comprise the MusB promoter. Unlike the parent promoter, MusB is smooth muscle cell specific. Hence, in one embodiment, the promoter comprises SEQ ID NO:3. SEQ ID NO:3 represents a 246 nucleotide sequence corresponding to the mouse smooth muscle specific promoter MusB.

[0037]Additionally, a promoter of the present invention includes any substantially homologous nucleic acid sequence that may be truncated, mutated, or any other variant of the MusB promoter so long as the promoter remains operable and retains specificity for smooth muscle cell expression. Substantially homologous, as used herein, is defined above. For instance, in one embodiment, a promoter of the invention may have 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homologous to SEQ ID NO:3, so long as the promoter remains operable and retains specificity for smooth muscle cell expression. In another embodiment, a promoter may be a fragment of SEQ ID NO:3 that remains operable and retains specificity for smooth muscle cell expression.

[0038]In each of the above embodiments, a promoter may be smaller than the sequences specifically identified herein thereby operating as a minimal sequence required for constitutive smooth muscle cell transcription. Certain portions of sequences in a promoter may be required for spacing of the cis acting elements and any sequence that does not impart deleterious structural properties may be substituted for those spacer regions so long as the spacing remains substantially intact to allow the cis acting elements to function. All such promoters would be encompassed by the present invention.

[0039]In an exemplary embodiment, a promoter of the invention is of a length suitable for use in an AVV vector.

(b) Calcium-Activated Potassium Channel

[0040]A vector of the invention also typically comprises a nucleic acid sequence encoding a calcium-activated potassium channel. As used herein, calcium-activated potassium channel," refers to a protein capable of forming an ion-conducting pore. Suitable calcium-activated potassium channels may include high conductance voltage-activated potassium channels, such as "BK channels." In exemplary embodiments, a vector may comprise α subunit of a BK channel. A BK channel is typically composed of an α subunit (BKα) and a β subunit (BKβ). In one embodiment, a vector of the invention comprises a BKα subunit. In another embodiment, a vector of the invention comprises a BKβ subunit. A calcium-activated potassium channel of the invention may be from a mammal such as a rodent, a non-human primate, a companion animal, a livestock animal, or a human. Non-limiting examples of rodents may include mice, rats, and guinea pigs. Non-limiting examples of companion animals may include dogs and cats. Non-limiting examples of a livestock animal may include swine, cattle, or goats.

[0041]In one embodiment, a nucleic acid sequence encoding a calcium-activated potassium channel may be, for example, SEQ ID NO.:4. SEQ ID NO.:4 is a nucleotide sequence that comprises a coding sequence for a BKα protein, which may be found in GenBank under Accession No. U09383. In various embodiments of the present invention, the vector comprising a calcium-activated potassium channel may comprise the entire nucleotide sequence of SEQ ID NO.: 4. Alternatively, the vector may comprise only the coding sequence of SEQ ID NO.: 4 or a fragment thereof.

[0042]In another embodiment, a nucleic acid sequence encoding a calcium-activated potassium channel may be, for example, SEQ ID NO.:6. SEQ ID NO.:6 is a nucleotide sequence that comprises the coding sequence for a BKα protein, which may be found in GenBank under Accession No. NM_--002247. In various embodiments of the present invention, the vector comprising a calcium-activated potassium channel may comprise the entire nucleotide sequence of SEQ ID NO.:6. Alternatively, the vector may comprise only the coding sequence of SEQ ID NO.: 6 or a fragment thereof.

[0043]In yet another embodiment, a nucleic acid sequence encoding a calcium-activated potassium channel may be, for example, SEQ ID NO.: 7. SEQ ID NO.: 7 is a nucleotide sequence that comprises the coding sequence for a BKα protein, which may be found in GenBank under Accession No. NM_--001014797. In various embodiments of the present invention, the vector comprising a calcium-activated potassium channel may comprise the entire nucleotide sequence of SEQ ID NO.: 7. Alternatively, the vector may comprise only the coding sequence of SEQ ID NO.: 7 or a fragment thereof.

[0044]In still another embodiment, a nucleic acid sequence encoding a calcium-activated potassium channel may be, for example, SEQ ID NO.:8. SEQ ID NO.:8 is a nucleotide sequence that comprises the coding sequence for a BKα protein, which may be found in GenBank under Accession No. NM_--002247. In various embodiments of the present invention, the vector comprising a calcium-activated potassium channel may comprise the entire nucleotide sequence of SEQ ID NO.:8. Alternatively, the vector may comprise only the coding sequence of SEQ ID NO.: 8, or a fragment thereof.

[0045]A calcium-activated potassium channel sequence of the present invention may also include any substantially homologous nucleic acid sequence that may be truncated, mutated, or any other variant of a calcium-activated potassium channel so long as the channel remains operable, i.e. forms an ion-conducting pore. Substantially homologous, as used herein, is defined above. For instance, in one embodiment, a calcium-activated potassium channel of the invention may have 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, so long as the channel remains operable. In another embodiment, a calcium-activated potassium channel may be a fragment of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 that remains operable.

(c) Combinations

[0046]A vector of the invention may comprise various combinations of a smooth muscle promoter operably linked to a calcium-activated potassium channel. For instance, a vector may comprise a combination listed in Table A.

TABLE-US-00001 TABLE A CALCIUM-ACTIVATED PROMOTER POTASSIUM CHANNEL SEQ ID NO: 1 SEQ ID NO: 4 SEQ ID NO: 1 SEQ ID NO: 6 SEQ ID NO: 1 SEQ ID NO: 7 SEQ ID NO: 1 SEQ ID NO: 8 SEQ ID NO: 2 SEQ ID NO: 4 SEQ ID NO: 2 SEQ ID NO: 6 SEQ ID NO: 2 SEQ ID NO: 7 SEQ ID NO: 2 SEQ ID NO: 8 SEQ ID NO: 3 SEQ ID NO: 4 SEQ ID NO: 3 SEQ ID NO: 6 SEQ ID NO: 3 SEQ ID NO: 7 SEQ ID NO: 3 SEQ ID NO: 8 SEQ ID NO: 9 SEQ ID NO: 4 SEQ ID NO: 9 SEQ ID NO: 6 SEQ ID NO: 9 SEQ ID NO: 7 SEQ ID NO: 9 SEQ ID NO: 8

[0047]In particular, the vector may comprise SEQ ID NO.: 5, which is a 9,188 nucleotide sequence comprising part of an AAV genome, the smooth muscle specific promoter sequence of SEQ ID NO.: 1 and a nucleic acid encoding a calcium-activated potassium channel as represented by SEQ ID NO.:4.

(d) Pharmaceutical Composition

[0048]A vector of the invention may comprise a pharmaceutical composition. In some embodiments, the compositions may comprise pharmaceutically acceptable excipients. Examples of suitable excipients may include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methyl cellulose. The compositions may additionally include: lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying and suspending agents; preserving agents such as methyl- and propylhydroxy-benzoates; sweetening agents; and flavoring agents. The compositions of the invention may be formulated so as to provide quick, sustained or delayed release of the active ingredient after administration to a subject by employing procedures known in the art.

[0049]Injectable preparations of a composition of the invention, for example, sterile injectable aqueous or oleaginous suspensions, may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a nontoxic parenterally or intrathecally acceptable diluent or solvent. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed, including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are useful in the preparation of injectables. Dimethyl acetamide, surfactants including ionic and non-ionic detergents, and polyethylene glycols can be used. Mixtures of solvents and wetting agents such as those discussed above are also useful.

[0050]Formulations for administration of the composition may be in the form of aqueous or non-aqueous isotonic sterile injection solutions or suspensions. These solutions and suspensions may be prepared from sterile powders or granules having one or more of the carriers or diluents mentioned for use in the formulations for oral administration. The compounds may be dissolved in water, polyethylene glycol, propylene glycol, ethanol, corn oil, cottonseed oil, peanut oil, sesame oil, benzyl alcohol, sodium chloride, and/or various buffers. Other adjuvants and modes of administration are well and widely known in the pharmaceutical art.

II. Methods

[0051]The present invention further comprises a method of regulating the blood pressure of a mammal. In certain embodiments, the method comprises administering to said mammal a vector comprising a smooth muscle specific promoter operably linked to a nucleic acid sequence encoding a calcium-activated potassium channel. Accordingly, the smooth muscle specific promoter may be selected from the group consisting of SEQ ID NO.: 1, SEQ ID NO.: 2, and SEQ ID NO.: 3. The nucleic acid sequence encoding a calcium-activated potassium channel may be, for example, SEQ ID NO.: 4. In particular embodiments, a vector that is useful for the present method may comprise an AAV vector. Specifically, the vector may comprise SEQ ID NO.: 5. The method of the present embodiment may be used to regulate the blood pressure of a mammal, including for example, the blood pressure of a rodent, a non-human primate, a companion animal, a livestock animal, or a human. Non-limiting examples of rodents may include mice, rats, and guinea pigs. Non-limiting examples of companion animals may include dogs and cats. Non-limiting examples of a livestock animal may include swine, cattle, or goats.

[0052]In a further embodiment of the present invention, a method of expressing a calcium-activated potassium channel in a smooth muscle cell is disclosed. Such a method comprises contacting the smooth muscle cell with a vector comprising a smooth muscle specific promoter operably linked to a nucleic acid sequence encoding a calcium-activated potassium channel. The smooth muscle specific promoter may be selected from the group consisting of SEQ ID NO.: 1, SEQ ID NO.: 2, SEQ ID NO.: 3 and SEQ ID NO:9. Additionally, the nucleic acid sequence encoding a calcium-activated potassium channel may be SEQ ID NO.: 4. In some modes of the present embodiment, the vector may comprise an AAV vector, and in specific modes, the vector may comprise SEQ ID NO.:5. The promoter and the calcium-activated potassium channel may be a mammalian, and in particular, may be from a rodent, a non-human primate, a companion animal, a livestock animal, or a human. Non-limiting examples of rodents may include mice, rats, and guinea pigs. Non-limiting examples of companion animals may include dogs and cats. Non-limiting examples of a livestock animal may include swine, cattle, or goats.

DEFINITIONS

[0053]A DNA "coding sequence" is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are typically determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. A polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.

[0054]The term "high stringency" means DNA hybridization and wash conditions characterized by high temperature and low salt concentration, e.g., wash conditions of 65° C. at a salt concentration of approximately 0.1×SSC, or the functional equivalent thereof. For example, high stringency conditions may include hybridization at about 42° C. in the presence of about 50% formamide; a first wash at about 65° C. with about 2×SSC containing 1% SDS; followed by a second wash at about 65° C. with about 0.1×SSC.

[0055]A cell has been "transformed" by exogenous or heterologous DNA when such DNA has been introduced inside the cell. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell.

[0056]The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of the invention. Those of skill in the art should, however, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention, therefore all matter set forth or shown in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense.

EXAMPLES

[0057]The following examples illustrate various iterations of the invention.

Example 1

Reduction of Blood Pressure

[0058]The MV delivery of pore-forming, BKα-subunits into the vascular smooth muscle cells (VSMCs) of resistance arteries reduces blood pressure in hypertensive mice but does not affect resting blood pressure levels. The present inventors have constructed the MV vector with the mouse BK transgene (mSlo) using either of two smooth muscle specific promoters, including a truncated form of the SM22α promoter that shows VSMC specificity (see FIG. 1 and SEQ ID NO.: 5). Also, the present inventors have constructed an MV vector using a newly designed "MusB" promoter derived from the cardiac myosin heavy chain promoter that prefers VSMC transgene expression.

[0059]The antihypertensive effect of two MV vectors, AAV/MusB-BKα and AAV/SM22BKα, were evaluated using tail-cuff plethysmography. These studies provided the evidence that MV-mediated delivery of BKα could profoundly reduce high blood pressure in hypertensive mice. The MV vectors were administered by tail vein injection prior to inducing hypertension by Ang II infusion in C57BL/6J mice.

[0060]As a first strategy, the virus was allowed to fully express MusB-BKα or SM22-BKα for 3 weeks to determine if the mature expression of the therapeutic BKα transgene could blunt Ang II-induced hypertension. Two different doses of virus particles (vp) were evaluated. Mice were injected with either MV/MusB-BKα (10¹⁰ vp/k g; n=5), VV/SM22-BKα (10¹¹ vp/kg; n=4), or MV/MusB-GFP as a control vector (10¹¹ vp/kg; n=4). Subsequently, PCR amplification of the AAV/BKα DNA fragment confirmed a smaller amount of DNA corresponding to the BKα transgene in the mesenteric arteries of mice injected with MV/MusB-BKα compared to MV/SM22-BKα, corresponding to the 10-fold less AAV/MusB-BKα virus particles injected (FIG. 2 and FIG. 10). Three weeks after MV injection, Ang II (2 μg/kg/min) was infused by osmotic minipump for one week to establish hypertension (as shown in FIG. 9A), and systolic blood pressure (SBP) was monitored by tail cuff every weekday for 2 weeks. One day's measurement consisted of 5 readings from each animal done as a two-person, single-blind experiment. The ten-day average value was assigned to each animal and statistical analysis was done on those values (n=4 or 5). Both AAV/BKα groups had significantly lower SBP than mice injected with the control vector, AAV/MusB-GFP, which showed an average SBP of 177±15 mm Hg (FIG. 3 and FIG. 3). In contrast, the SBP of mice injected with AAV/MusB-BKα (10¹⁰ vp/kg) was 156±6 mm Hg, and the SBP of mice injected with AAV/SM22-BKα (10¹¹ vp/kg) averaged 140±15 mm Hg. All animals appeared healthy, and showed similar weights. To our knowledge, these findings provide the first evidence that AAV delivery using smooth muscle-specific promoters to deliver a K+ channel gene to arterial VSMCs can profoundly blunt the development of high blood pressure in hypertensive animals.

Example 2

Promoters

[0061]The SM22α promoter is one of the few documented smooth muscle-specific promoters that preferentially expresses genes in arterial VSMCs compared to other cell types, and even compared to other types of smooth muscle cells including visceral or venous. The truncated SM22α is the only form that is small enough in size (445 bp) to be packaged into AAV with our therapeutic gene, BKα. However, a putative smooth muscle-specific promoter, "MusB", was recently discovered that also is small enough in size (245 bp) to be used in AAV vectors. The MusB promoter was generated during a study to make small, AAV-friendly, muscle-active promoters. The promoter region of the full-length cardiac a myosin heavy chain (GenBank accession No. Z20656) was truncated by removing the putative "enhancer" element (nucleotide 4120-4321). The resulting MusB promoter (FIG. 4A) is 245 bp in length and has preferential activity in cultured VSMCs compared to cardiac cells. Unlike SM22α, the MusB promoter does not have a perfect CArG box element (CCWWWWWWGG, where W=A or T) directed by the serum response factor that is evolutionarily conserved for SMC-specific promoter activity. However, MusB has an imperfect CArG box (CCAAATTTAG, where A should be G), and there are 1216 permutations of the CArG box that are regarded as functional. Indeed, 24 hours after transfection of the luciferase gene with the MusB promoter, primary cultures of rat aortic VSMCs show about 20-fold more activity than primary cultures of neonatal rat cardiac myocytes (FIG. 4B). Because of the high activity of the MusB promoter in VSMCs, and the paucity of small, smooth muscle-specific promoters available for AAV-mediated delivery of target genes to the vasculature, the efficacy of the two smooth muscle-specific promoters, SM22α and MusB, will be compared for AAV transduction of genes into arterial VSMCs. For clarity, and to avoid confusion of SM22α with BKα in shared constructs, the SM22α promoter is referred to only as "SM22" in the remaining text.

[0062]Four AAV plasmid constructs containing the truncated SM22 promoter or the new MusB promoter and the mouse BKα gene or the gene for green fluorescent protein (GFP) were prepared (FIG. 4C). The large size (3.5 kb) of the BKα gene approaches the insert gene size limit for the AAV vector. Thus GFP requires a separate construct for studies designed to evaluate gene expression conferred by AAV/SM22 or AAV/MusB. From these plasmids, AAV (serotype 2) virus stocks were generated and the titer estimated at ˜10⁹ virus particles per milliliter (vp/ml) by quantitative PCR. These constructs and similar virus stocks will be referred to by promoter and gene, for example, AAV/SM22BKα. A myc tag may also be added to the AAV/SM22-BKα and AAV/MusB-BKα constructs to enhance detection of the BKα protein in the arterial wall and in single VSMCs.

Example 3

The SM22 and MusB Promoters Drive Gene Expression in Arterial VSMCs

[0063]In early experiments, evidence was obtained that the SM22 promoter can achieve long-term gene expression in arterial VSMCs in vivo. As a prelude to these studies, A7r5 cells (an embryonic rat aortic VSMC line) were transfected with plasmids encoding SM22-GFP and MusB-GFP (2 μg/10⁵ cells) to verify that both promoters have activity in these cultured VSMCs. Indeed, GFP associated with both plasmids was detected at 72 hours after transfection at qualitatively similar levels of expression in the A7r5 cells (FIG. 5A). Subsequently, we injected 10¹¹ vp/kg AAV/SM22-GFP into the tail vein of control C57BL/6J adult mice to determine (as a starting point) if our AAV construct, using the best characterized smooth muscle-specific promoter, SM22, could achieve long-lasting gene expression in VSMCs in vivo. Indeed, 10-μm frozen sections of the aorta collected 9 weeks after the mice were injected with AAV/SM22-GFP showed clear GFP expression in the VSMCs composing the aortic medial layers (FIG. 5B, white arrows), which are situated between the elastic fibers that show high auto fluorescence (FIG. 5B, yellow arrowheads). To our knowledge, this is the first use of a smooth muscle-specific promoter to enact long-lasting expression of a gene in VSMCs using AAV-mediated delivery. Standard PCR of the cDNA using a primer pair designed to amplify only the BKα transgene but not the endogenous BKα gene (forward primer: TTCGGCTTGGGTCGACTCTTAGAA (SEQ ID NO:10) reverse primer: TATGATGAGCGCATCCATCTTGGG (SEQ ID NO:11) revealed that only mesenteric arteries from AAV/SM22-BKα-injected mice showed detectible levels of message. The BKα message was not transcribed in heart or liver, confirming that SM22 does not exert promoter activity in nonvascular tissues. An agarose gel comparing transduced BKα amplified product corresponding to mRNA from AAV/MusB-GFP and AAV/SM22-BKα is shown in FIG. 2.

[0064]The pore-forming structure of the BK channel in VSMCs is presumed to represent a tetramer composed of four α subunits, which associate with ancillary β1 subunits to confer Ca²+ sensitivity to the channel complex. Thus, both subunits (α and β1) are thought to be required for normal physiological function. Since we propose to deliver only the BKα subunit to VSMCs by AAV, it is possible that the availability of β3 will limit the number of fully functional BK channels. Thus, one goal of this experiment was to verify that AAV delivery of BKα enhances BK channel-mediated K+ current in the arterial VSMCs of the treated animals, and to confirm that BK channels show normal Ca²+-dependent activation indicative of α4β4 complex formation. In this regard, arterial BKα DNA, mRNA and protein expression was evaluated. In Western blots, the BK subunit is detected as a 125 kD band (FIG. 6A).

[0065]BK channel current in VSMCs from the mouse mesentery, a vascular bed involved in blood pressure regulation will be scrutinized. First, we will characterize the whole-cell properties of BK current in VSMCs of 2nd order mesenteric arteries from untreated C57BL/6J mice. After profiling the density and properties of the native BK channels, the BK current in the VSMCs of hypertensive mice treated with AAV/SM22-BKα or AAV/MusB-BKα antihypertensive therapy will be examined using previously published protocols. A sample protocol is shown in FIG. 6B in a freshly isolated mesenteric VSMC from an untreated C57BL/6J mouse. Voltage-elicited K+ current (left trace) was reduced by the well characterized BK channel blocker, iberiotoxin (Ibtx, middle trace). Other voltage-elicited K+ channel currents also were evident as the Ibtx-resistant residual current. Digital subtraction was used to isolate the Ibtx-sensitive component of BK current from total K+ current (right trace). It is expected that AAV delivery of BKα will increase the density of Ibtx-sensitive current attributed to the BK channel, and further patch-clamp studies will evaluate if the transduced BK channel retains normal voltage and Ca²+-sensitivity.

[0066]Studies were initiated to confirm that the MusB-BKα and SM22-BKα plasmids encode functional BK channels in VSMCs. For these studies, a VSMC line was identified that did not express native BK channels. Notably, a standard non-smooth muscle expression systems (ie, HEK 293) could not be used, because MusB-BKα and SM22-BKα plasmids contain a smooth muscle-specific promoter. Fortunately, screening efforts revealed that A7r5 cells do not express voltage-gated K+ channels. Indeed, the BKα and β1 transcripts that are readily detected in freshly isolated mesenteric arteries (FIG. 7A, MA) are not expressed in A7r5 cells, a neonatal rat aortic cell line. A7r5 cells also lack voltage-dependent K+ current (n=9) (FIG. 7B). It has been observed that patch-cell-specific promoters show activity in VSMCs that appears to result in functional channel proteins.

Example 4

Evaluation of BK Channel Dilator Function In Vitro and In Vivo

[0067]To verify that the antihypertensive effect of BKα gene delivery is associated with an enhanced dilator influence of BK channels, in vitro and in vivo dilator assays will be used. Studies will focus on the mesenteric circulation, a vascular bed that offers a number of advantages. First, the mesenteric circulation plays a central role in blood pressure regulation. Second, the web of mesenteric arcade arteries provides enough vascular tissue from only several mice for DNA, RNA and protein analyses, vessel reactivity studies, and patch-clamp studies. Third, the mesenteric circulation is accessible for intravital video microscopy (IVVM) to assess BK channel-mediated vasodilation in vivo in an anesthetized mouse. Thus, although there is the capability to study other vascular beds if the need arises the mesenteric circulation is conceptually and technically suited to the planned studies. In vitro vascular reactivity studies will use isolated, cannulated mesenteric arteries (FIG. 8A). The dilator function of the BK channel will be evaluated at 3 levels of intramural pressure (60 mm Hg, 100 mm Hg, and 140 mm Hg). A sample protocol in a mouse mesenteric artery perfused at 100 mm Hg is shown in FIG. 8B. After equilibration to establish resting tone (panel 1; internal diameter=127 μm), maximal depolarization-induced contraction was elicited by 60 mmol/L KCl (panel 2). After washout of KCl to re-establish resting diameter (panel 3), iberiotoxin (100 nmol/L Ibtx) was added to block BK channel-mediated dilation. The loss of BK channel-mediated vasodilation caused a diameter reduction that was equal to 16% of the maximal contraction to KCl (panel 4). These data suggest that the BK channel contributes only a small dilator influence to the resting tone of small mesenteric arteries at physiological perfusion pressures. The vasoconstrictor response to Ibtx is expected to be accentuated in arteries of mice transduced with the BKα gene. Similarly, IVVM will be used to compare the vasodilator influence of the BK channel between the mesenteric circulations of control mice and mice treated with AAV/SM22-BKα or AAV/MusB-BKα. In these mice, the mesentery is pulled through a midline incision and placed in an observation chamber on the stage of an upright microscope for on-line recording of arterial diameters in vivo (FIG. 8C). The level of BK channel-mediated vasodilation can be assessed using iberiotoxin as described above for the perfused artery preparation. A similar technique has been used for recording in situ membrane potential and diameters in the mesenteric circulation of anesthetized rats and also for monitoring the reactivity of the renal circulation in mice. This technique will be adapted to the mouse mesenteric circulation, as shown in FIG. 7C.

Example 5

Mouse Models of Hypertension and Biotelemetry Measurement

[0068]To evaluate the antihypertensive effect of AAV-mediated delivery of BKα, two mouse models of hypertension will be used. Surgical procedures will be performed, and heart rate and blood pressure will be monitored using biotelemetry. Chronic hypertension will be induced in C57BL/6J mice by implanting osmotic minipumps for infusion of angiotensin (Ang II, 2 μg/kg/min) or norepinephrine (NE, 4 μg/kg/min). Thus, we will evaluate the therapeutic effect of AAV/SM22-BKα or AAV/MusB-BKα gene delivery in mice with two forms of hypertension. The blood pressure profile of our Ang II-infused C57BL/6J mice includes a resting mean arterial pressure of 110 mm Hg, which rapidly rises over one week and is maintained at 150 to 160 mm Hg by Ang II infusion (FIG. 9A). The osmotic minipumps last up to six weeks, but a second pump can be inserted to maintain the hypertension and permit evaluation of long-term antihypertensive therapies (FIG. 9B, arrow, top trace). The increase in blood pressure is reversible, and returns to normal if the Ang II pump is replaced with a saline pump (FIG. 9B, arrow, lower trace). Similar levels of chronic hypertension can be established by infusing 4 μg/kg/min NE (FIG. 9C).

Example 6

AAV/SM22-BKα Reverses Ang II-Induced Hypertension

[0069]In the typical clinical situation a patient's blood pressure is elevated at diagnosis, and the therapeutic value of an antihypertensive treatment relies on its ability to normalize the elevated pressure without unwanted side effects. To explore this question, mice were instrumented with telemetry transmitters for two weeks to obtain baseline blood pressure recordings. Subsequently, Ang II-minipumps were implanted to induce hypertension. At 7 and 10 days after the start of Ang II infusion when blood pressure was elevated (mean arterial pressure ˜140 mm Hg), AAV/SM22-GFP or AAV/SM22-BKα were injected (2 tail vein injections; 5×10¹⁰ vp/kg; 3 days apart) into two mice each. Mean arterial pressure was monitored for 6 weeks following the virus injection, with telemetry lost in one mouse injected with AAV/SM22-BKα. However, all mice in the study appeared healthy and showed similar weights for the full 6 weeks of the study. As expected, Ang II infusion established chronic hypertension in mice injected with AAV/SM22-GFP for 6 weeks (FIG. 11, top trace). In contrast, blood pressure fell continuously for 7 days in the mouse injected with AAV/SM22-BKα, and remained low for 5 weeks. The moderate rebound in blood pressure during the 2nd and 3rd weeks after AAV injection seems to correlate with the bimodal expression of AAV-transduced genes that have been observed to show a transient expression peak at 1 to 2 weeks, followed by an abating period that precedes strong continuous gene expression.

[0070]As various changes could be made in the above methods and compositions without departing from the scope of the invention, it is intended that all matter contained in the above description be interpreted as illustrative and not in a limiting sense. Unless explicitly stated to recite activities that have been done (i.e., using the past tense), illustrations and examples are not intended to be a representation that given embodiments of this invention have, or have not, been performed.

Sequence CWU 1

111507DNAMus musculus 1ctgcagtcaa gactagttcc caccaactcg attttaaagc cttgcaagaa ggtggcttgt 60ttgtcccttg caggttcctt tgtcgggcca aactctagaa tgcctccccc tttctttctc 120attgaagagc agacccaagt ccgggtaaca aggaagggtt tcagggtcct gcccataaaa 180ggtttttccc ggccgccctc agcaccgccc cgccccgacc cccgcagcat ctccaaagca 240tgcagagaat gtctccggct gcccccgaca gactgctcca acttggtgtc tttccccaaa 300tatggagcct gtgtggagtg agtggggcgg cccggggtgg tgagccaagc agacttccat 360gggcagggag gggcgccagc ggacggcaga ggggtgacat cactgcctag gcggccttta 420aacccctcac ccagccggcg ccccagcccg tctgccccag cccagacacc gaagctactc 480tccttccagt ccacaaacga ccaagcc 5072499DNAMus musculus 2ctgcagtcaa gactagttcc caccaactcg attttaaagc cttgcaagaa ggtggcttgt 60ttgtcccttg caggttcctt tgtcgggcca aactctagaa tgcctccccc tttctttctc 120attgaagagc agacccaagt ccgggtaaca aggaagggtt tcagggtcct gcccataaaa 180ggtttttccc tcagcaccgc cccgccccga cccccgcagc atctccaaag catgcagaga 240atgtctccgg ctgcccccga cagactgctc caacttggtg tctttcccca aatatggagc 300ctgtgtggag tgagtggggc ggcccggggt ggtgagccaa gcagacttcc atgggcaggg 360aggggcgcca gcggacggca gaggggtgac atcactgcct aggcggcctt taaacccctc 420acccagccgg cgccccagcc cgtctgcccc agcccagaca ccgaagctac tctccttcca 480gtccacaaac gaccaagcc 4993246DNAMus musculus 3atcaaaggag gaggagccag gaggggagag aggtgggagg gagggtcctc cggaaggact 60ccaaatttag acagagggtg ggggaaacgg gatataaagg aactggagct ttgaggacag 120atagagagac tctgcggccc aggtaagagg aggtttgggg tgggatgccc tgcagcccgt 180ccacagagcc cccaccgtga gggacctcct tcaccaggag tggggtgcag gtcagttgga 240ggccta 24643555DNAMus musculus 4atgagcagca atatccacgc gaacaatctc agcctagacg cgtcctcctc ctcctcttcc 60tcctcctctt cttcttcttc ctcctcctct tcctcctcgt cctcggtcca cgagcccaag 120atggatgcgc tcatcatacc ggtgaccatg gaggtgccgt gcgacagccg gggccaacgc 180atgtggtggg ctttcttggc ctcctccatg gtgactttct tcgggggcct cttcatcatc 240ttgctctggc ggacgctcaa gtacctgtgg accgtttgct gccactgcgg gggcaagacg 300aaggaggccc agaagataaa caatggctcc agccaggcag atggtactct caagccagtg 360gacgaaaaag aggaggtggt ggcagccgag gtcggctgga tgacatctgt gaaggactgg 420gcaggggtga tgatatccgc ccagacactg actggcagag tcctggttgt gttagtcttt 480gctctcagca ttggtgccct cgtaatatac ttcatagact cgtcaaaccc aatagaatcc 540tgccagaatt tctacaaaga tttcacatta cagatcgaca tggctttcaa cgtgttcttc 600ctcctctact ttggcttgcg gtttattgca gccaacgata agctgtggtt ctggctggaa 660gtgaattcag tagtagattt cttcacagtc cctcctgtgt ttgtgtctgt gtacttaaac 720agaagttggc ttggcttgag atttttaaga gctctcagac tgatacagtt ttcagagatt 780ttgcagtttc tgaatatcct taaaacaagt aactccatca agctggtgaa tctgctctcc 840atatttatca gcacgtggct gactgcagct ggattcatcc acttggtgga gaattcaggg 900gacccatggg aaaatttcca aaacaaccag gcacttacgt actgggaatg tgtctactta 960ctcatggtca caatgtctac agtgggttat ggggacgttt atgcaaaaac cacacttgga 1020cgcctcttca tggtcttctt catcctcggg ggactggcca tgtttgccag ctacgtccct 1080gaaatcatag agttaatagg aaaccgcaag aaatacgggg gctcctatag cgcggttagt 1140ggaagaaagc acattgtagt ctgtggacac attactctgg agagtgtctc taacttcctg 1200aaggactttc tgcacaagga ccgggatgat gtcaacgtgg agattgtctt tcttcacaac 1260atctccccta accttgagct tgaagctctg ttcaaacggc atttcactca ggtggagttt 1320tatcagggct ctgtcctcaa tccacatgat cttgccagag tcaagataga gtcagcagat 1380gcatgcctga tccttgccaa taagtattgc gctgacccgg atgcagaaga tgcctccaac 1440atcatgagag tgatctccat caaaaactac cacccaaaga tcaggatcat cactcagatg 1500ctgcagtatc acaacaaggc ccatctgctc aacatcccca gctggaactg gaaagagggt 1560gatgacgcaa tatgccttgc agagctcaag ttgggtttca tagcccagag ctgtctggct 1620caaggcctct ccacaatgct tgccaatctc ttctctatga ggtcattcat aaagattgag 1680gaagacacat ggcagaaata ctacttggaa ggagtctcca atgaaatgta cacagaatat 1740ctctccagtg ccttcgtggg tctgtccttc cctactgttt gtgagctgtg ttttgtgaag 1800cttaagctcc tgatgatagc cattgagtac aagtctgcca acagagagag ccgaagccga 1860aagcgaatat taattaaccc tgggaaccac cttaagatcc aagaaggtac tttaggattt 1920ttcatcgcaa gtgatgccaa agaagttaaa agggcatttt tttactgcaa ggcctgtcat 1980gatgacgtca cagatcccaa aagaattaaa aaatgtggct gcaggcggct tgaagatgag 2040cagccgccaa ccctgtcacc aaaaaaaaaa caacgtaatg ggggcatgag gaactcgccc 2100aacacctccc cgaagctgat gaggcatgac cccttgttaa ttcctggcaa tgatcagatt 2160gacaacatgg actccaatgt gaaaaagtac gactccactg gaatgtttca ctggtgtgca 2220cccaaggaga ttgagaaagt catcttgact cgaagtgaag ctgccatgac tgtcctgagt 2280ggccatgtcg tagtctgcat ctttggggat gtcagctcag cccrgattgg cctccggaac 2340ctggtgatgc cacttcgtgc tagcaacttt cactatcatg agcrcaaaca cattgtgttt 2400gtgggctcca ttgagtacct caagagggag tgggaaacac tgcacaactt cccgaaagtg 2460tccatattgc ctggtacacc attaagtcgg gctgatttaa gggctgtcaa catcaacctc 2520tgtgacatgt gcgttatcct gtcagccaat cagaataata ttgatgatac ttcgcttcag 2580gacaaggaat gcatcttggc gtcactcaac atcaaatcta tgcagtttga tgacagcatc 2640ggggtcttgc aggctaattc ccaaggattc acacctcctg gaatggacag atcatcaccc 2700gacaacagcc cagtgcacgg gatgttacgc cagccgtcca tcacaactgg ggtcaacatt 2760cccatcatca cggaactcgc taagccgggc aagttgcctt tggtatcagt caatcaggaa 2820aaaaacagtg ggacgcacat tctaatgata acggagttgg tgaatgatac caatgttcag 2880tttttggacc aagacgatga cgatgaccct gacacagagc tgtacctcac acagcccttt 2940gcttgtggga cagcatttgc cgtcagcgtc ctggactcac tcatgagcgc gacatacttc 3000aatgacaata tcctcaccct aatacggacc ctggtgacag gaggagccac accagagctc 3060gaggctctaa tagctgagga gaatgcactt cgaggaggct acagcactcc gcagacattg 3120gccaacaggg accgttgccg agtggcccag ttagccctgt tagatggtcc ctttgcagac 3180ttaggggatg gtggttgtta tggtgatctg ttctgcaaag ctctgaaaac atataatatg 3240ctttgttttg gaatttaccg gctgagagat gcccacctca gcacccccag ccagtgtaca 3300aaaaggtacg tcatcaccaa tcctccctac gagtttgagc tcgtaccaac agacctgatc 3360ttctgcctga tgcagtttga ccacaacgct ggccaatccc gggccagtct gtctcattcc 3420tcccactcct cacagtcgtc cagtaagaag agctcctccg tccactccat cccgtccaca 3480gcaaatcggc cgaaccggcc caagtccagg gagtcccgcg acaaacagaa cagaaaagaa 3540atggtttaca gatga 355559188DNASM22alpha BKalpha AAV 5cgtatcacga ggccctttcg tcttcaagaa ttctcatgtt tgacagctta tcatcgataa 60gctttaatgc ggtagtttat cacagttaaa ttgctaacgc agtcaggcac cgtgtatgaa 120atctaacaat gcgctcatcg tcatcctcgg caccgtcacc ctggatgctg taggcatagg 180cttggttatg ccggtactgc cgggcctctt gcgggatatc gtccattccg acagcatcgc 240cagtcactat ggcgtgctgc tagcgctata tgcgttgatg caatttctat gcgcacccgt 300tctcggagca ctgtccgacc gctttggccg ccgcccagtc ctgctcgctt cgctacttgg 360agccactatc gactacgcga tcatggcgac cacacccgtc ctgtggatcc tctacgccgg 420acgcatcgtg gccggcatca ccggcgccac aggtgcggtt gctggcgcct atatcgccga 480catcaccgat ggggaagatc gggctcgcca cttcgggctc atgagcgctt gtttcggcgt 540gggtatggtg gcaggccccg tggccggggg actgttgggc gccatctcct tgcatgcacc 600attccttgcg gcggcggtgc tcaacggcct caacctacta ctgggctgct tcctaatgca 660ggagtcgcat aagggagagc gtcgaccgat gcccttgaga gccttcaacc cagtcagctc 720cttccggtgg gcgcggggca tgactatcgt cgccgcactt atgactgtct tctttatcat 780gcaactcgta ggacaggtgc cggcagcgct ctgggtcatt ttcggcgagg accgctttcg 840ctggagcgcg acgatgatcg gcctgtcgct tgcggtattc ggaatcttgc acgccctcgc 900tcaagccttc gtcactggtc ccgccaccaa acgtttcggc gagaagcagg ccattatcgc 960cggcatggcg gccgacgcgc tgggctacgt cttgctggcg ttcgcgacgc gaggctggat 1020ggccttcccc attatgattc ttctcgcttc cggcggcatc gggatgcccg cgttgcaggc 1080catgctgtcc aggcaggtag atgacgacca tcagggacag cttcaaggat cgctcgcggc 1140tcttaccagc ctaacttcga tcactggacc gctgatcgtc acggcgattt atgccgcctc 1200ggcgagcaca tggaacgggt tggcatggat tgtaggcgcc gccctatacc ttgtctgcct 1260ccccgcgttg cgtcgcggtg catggagccg ggccacctcg acctgaatgg aagccggcgg 1320cacctcgcta acggattcac cactccaaga attggagcca atcaattctt gcggagaact 1380gtgaatgcgc aaaccaaccc ttggcagaac atatccatcg cgtccgccat ctccagcagc 1440cgcacgcggc gcatctcggg cagcgttggg tcctggccac gggtgcgcat gatcgtgctc 1500ctgtcgttga ggacccggct aggctggcgg ggttgcctta ctggttagca gaatgaatca 1560ccgatacgcg agcgaacgtg aagcgactgc tgctgcaaaa cgtctgcgac ctgagcaaca 1620acatgaatgg tcttcggttt ccgtgtttcg taaagtctgg aaacgcggaa gtcagcgccc 1680tgcaccatta tgttccggat ctgcatcgca ggatgctgct ggctaccctg tggaacacct 1740acatctgtat taacgaagcg ctggcattga ccctgagtga tttttctctg gtcccgccgc 1800atccataccg ccagttgttt accctcacaa cgttccagta accgggcatg ttcatcatca 1860gtaacccgta tcgtgagcat cctctctcgt ttcatcggta tcattacccc catgaacaga 1920aatccccctt acacggaggc atcagtgacc aaacaggaaa aaaccgccct taacatggcc 1980cgctttatca gaagccagac attaacgctt ctggagaaac tcaacgagct ggacgcggat 2040gaacaggcag acatctgtga atcgcttcac gaccacgctg atgagcttta ccgcagctgc 2100ctcgcgcgtt tcggtgatga cggtgaaaac ctctgacaca tgcagctccc ggagacggtc 2160acagcttgtc tgtaagcgga tgccgggagc agacaagccc gtcagggcgc gtcagcgggt 2220gttggcgggt gtcggggcgc agccatgacc cagtcacgta gcgatagcgg agtgtatact 2280ggcttaacta tgcggcatca gagcagattg tactgagagt gcaccatatg cggtgtgaaa 2340taccgcacag atgcgtaagg agaaaatacc gcatcaggcg ctcttccgct tcctcgctca 2400ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg 2460taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc 2520agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc 2580cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac 2640tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc 2700tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata 2760gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc 2820acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca 2880acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag 2940cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta 3000gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg 3060gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc 3120agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt 3180ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa 3240ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat 3300atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga 3360tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac 3420gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg 3480ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg 3540caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt 3600cgccagttaa tagtttgcgc aacgttgttg ccattgctgc aggggggggg ggcccccttg 3660gccactccct ctctgcgcgc tcgctcgctc actgaggccg ggcgaccaaa ggtcgcccga 3720cgcccgggct ttgcccgggc ggcctcagtg agcgagcgag cgcgcagaga gggagtggcc 3780aactccatca ctaggggttc cagatcctcg agctgcagtc aagactagtt cccaccaact 3840cgattttaaa gccttgcaag aaggtggctt gtttgtccct tgcaggttcc tttgtcgggc 3900caaactctag aatgcctccc cctttctttc tcattgaaga gcagacccaa gtccgggtaa 3960caaggaaggg tttcagggtc ctgcccataa aaggtttttc ccggccgccc tcagcaccgc 4020cccgccccga cccccgcagc atctccaaag catgcagaga atgtctccgg ctgcccccga 4080cagactgctc caacttggtg tctttcccca aatatggagc ctgtgtggag tgagtggggc 4140ggcccggggt ggtgagccaa gcagacttcc atgggcaggg aggggcgcca gcggacggca 4200gaggggtgac atcactgcct aggcggcctt taaacccctc acccagccgg cgccccagcc 4260cgtctgcccc agcccagaca ccgaagctac tctccttcca gtccacaaac gaccaagcca 4320gatctggtac catgagcagc aatatccacg cgaacaatct cagcctagac gcgtcctcct 4380cctcctcttc ctcctcctct tcttcttctt cctcctcctc ttcctcctcg tcctcggtcc 4440acgagcccaa gatggatgcg ctcatcatac cggtgaccat ggaggtgccg tgcgacagcc 4500ggggccaacg catgtggtgg gctttcttgg cctcctccat ggtgactttc ttcgggggcc 4560tcttcatcat cttgctctgg cggacgctca agtacctgtg gaccgtttgc tgccactgcg 4620ggggcaagac gaaggaggcc cagaagataa acaatggctc cagccaggca gatggtactc 4680tcaagccagt ggacgaaaaa gaggaggtgg tggcagccga ggtcggctgg atgacatctg 4740tgaaggactg ggcaggggtg atgatatccg cccagacact gactggcaga gtcctggttg 4800tgttagtctt tgctctcagc attggtgccc tcgtaatata cttcatagac tcgtcaaacc 4860caatagaatc ctgccagaat ttctacaaag atttcacatt acagatcgac atggctttca 4920acgtgttctt cctcctctac tttggcttgc ggtttattgc agccaacgat aagctgtggt 4980tctggctgga agtgaattca gtagtagatt tcttcacagt ccctcctgtg tttgtgtctg 5040tgtacttaaa cagaagttgg cttggcttga gatttttaag agctctcaga ctgatacagt 5100tttcagagat tttgcagttt ctgaatatcc ttaaaacaag taactccatc aagctggtga 5160atctgctctc catatttatc agcacgtggc tgactgcagc tggattcatc cacttggtgg 5220agaattcagg ggacccatgg gaaaatttcc aaaacaacca ggcacttacg tactgggaat 5280gtgtctactt actcatggtc acaatgtcta cagrgggtta tggggacgtt tatgcaaaaa 5340ccacacttgg acgcctcttc atggtcttct tcarcctcgg gggactggcc atgtttgcca 5400gctacgtccc tgaaatcata gagttaatag gaaaccgcaa gaaatacggg ggctcctata 5460gcgcggttag tggaagaaag cacattgtag tctgtggaca cattactctg gagagtgtct 5520ctaacttcct gaaggacttt ctgcacaagg accgggatga tgtcaacgtg gagattgtct 5580ttcttcacaa catctcccct aaccttgagc ttgaagctct gttcaaacgg catttcactc 5640aggtggagtt ttatcagggc tctgtcctca atccacatga tcttgccaga gtcaagatag 5700agtcagcaga tgcatgcctg atccttgcca ataagtattg cgctgacccg gatgcagaag 5760atgcctccaa catcatgaga gtgatctcca tcaaaaacta ccacccaaag atcaggatca 5820tcactcagat gctgcagtat cacaacaagg cccatctgct caacatcccc agctggaact 5880ggaaagaggg tgatgacgca atatgccttg cagagctcaa gttgggtttc atagcccaga 5940gctgtctggc tcaaggcctc tccacaatgc ttgccaatct cttctctatg aggtcattca 6000taaagattga ggaagacaca tggcagaaat actacttgga aggagtctcc aatgaaatgt 6060acacagaata tctctccagt gccttcgtgg gtctgtcctt ccctactgtt tgtgagctgt 6120gttttgtgaa gcttaagctc ctgatgatag ccattgagta caagtctgcc aacagagaga 6180gccgaagccg aaagcgaata ttaattaacc ctgggaacca ccttaagatc caagaaggta 6240ctttaggatt tttcatcgca agtgatgcca aagaagttaa aagggcattt ttttactgca 6300aggcctgtca tgatgacgtc acagatccca aaagaattaa aaaatgtggc tgcaggcggc 6360ttgaagatga gcagccgcca accctgtcac caaaaaaaaa acaacgtaat gggggcatga 6420ggaactcgcc caacacctcc ccgaagctga tgaggcatga ccccttgtta attcctggca 6480atgatcagat tgacaacatg gactccaatg tgaaaaagta cgactccact ggaatgtttc 6540actggtgtgc acccaaggag attgagaaag tcatcttgac tcgaagtgaa gctgccatga 6600ctgtcctgag tggccatgtc gtagtctgca tctttgggga tgtcagctca gccctgattg 6660gcctccggaa cctggtgatg ccacttcgtg ctagcaactt tcactatcat gagctcaaac 6720acattgtgtt tgtgggctcc attgagtacc tcaagaggga gtgggaaaca ctgcacaact 6780tcccgaaagt gtccatattg cctggtacac cattaagtcg ggctgattta agggctgtca 6840acatcaacct ctgtgacatg tgcgttatcc tgtcagccaa tcagaataat attgatgata 6900cttcgcttca ggacaaggaa tgcatcttgg cgtcactcaa catcaaatct atgcagtttg 6960atgacagcat cggggtcttg caggctaatt cccaaggatt cacacctcct ggaatggaca 7020gatcatcacc cgacaacagc ccagtgcacg ggatgttacg ccagccgtcc atcacaactg 7080gggtcaacat tcccatcatc acggaactcg ctaagccggg caagttgcct ttggtatcag 7140tcaatcagga aaaaaacagt gggacgcaca ttctaatgat aacggagttg gtgaatgata 7200ccaatgttca gtttttggac caagacgatg acgatgaccc tgacacagag ctgtacctca 7260cacagccctt tgcttgtggg acagcatttg ccgtcagcgt cctggactca ctcatgagcg 7320cgacatactt caatgacaat atcctcaccc taatacggac cctggtgaca ggaggagcca 7380caccagagct cgaggctcta atagctgagg agaatgcact tcgaggaggc tacagcactc 7440cgcagacatt ggccaacagg gaccgttgcc gagtggccca gttagccctg ttagatggtc 7500cctttgcaga cttaggggat ggtggttgtt atggtgatct gttctgcaaa gctctgaaaa 7560catataatat gctttgtttt ggaatttacc ggctgagaga tgcccacctc agcaccccca 7620gccagtgtac aaaaaggtac gtcatcacca atcctcccta cgagtttgag ctcgtaccaa 7680cagacctgat cttctgcctg atgcagtttg accacaacgc tggccaatcc cgggccagtc 7740tgtctcattc ctcccactcc tcacagtcgt ccagtaagaa gagctcctcc gtccactcca 7800tcccgtccac agcaaatcgg ccgaaccggc ccaagtccag ggagtcccgc gacaaacaga 7860acagaaaaga aatggtttac agatgatcta gagtcggggc ggccggccgc ttcgagcaga 7920catgataaga tacattgatg agtttggaca aaccacaact agaatgcagt gaaaaaaatg 7980ctttatttgt gaaatttgtg atgctattgc tttatttgta accattataa gctgcaataa 8040acaagttaac aacaacaatt gcattcattt tatgtttcag gttcaggggg aggtgtggga 8100ggttttttaa agcaagtaaa acctctacaa atgtggtaaa atcgataagg atctactcgt 8160aatctgtaat tgcttgttaa tcaataaacc gtttaattcg tttcagttga actttggtct 8220ctgcgtattt ctttcttatc tagtttccat ggctacgtag ataagtagca tggcgggtta 8280atcattaact acaaggaacc cctagtgatg gagttggcca ctccctctct gcgcgctcgc 8340tcgctcactg aggccgggcg accaaaggtc gcccgacgcc cgggctttgc ccgggcggcc 8400tcagtgagcg agcgagcgcg cagagaggga gtggccaagg gggggggggg ggggggggcc 8460cccctgcagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt 8520cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg gttagctcct 8580tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg 8640cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg 8700agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg 8760cgtcaacacg ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa 8820aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc agttcgatgt 8880aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc gtttctgggt 8940gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt 9000gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca 9060tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat 9120ttccccgaaa agtgccacct gacgtctaag aaaccattat tatcatgaca ttaacctata 9180aaaatagg 918866103DNAHomo sapiens 6cgccaggtcg cgcacagcgc cccgagccca ggcgcctccc cgcccccctc ccgcgctccg 60cggcggcggc ggcggcggca gcagtagcag caatatggct gttgatgggt gtttggggtg 120gcgctggcgg cgggaggagc tcccccgagc ccctgcgccg gctgcccgtt gctagctatg 180gcaaatggtg gcggcggcgg cggcggcagc agcggcggcg gcggcggcgg cggaggcagc 240agtcttagaa tgagtagcaa tatccacgcg aaccatctca gcctagacgc gtcctcctcc 300tcctcctcct cctcttcctc ttcttcttct tcctcctcct cttcctcctc gtcctcggtc 360cacgagccca agatggatgc gctcatcatc ccggtgacca tggaggtgcc gtgcgacagc 420cggggccaac gcatgtggtg ggctttcctg gcctcctcca tggtgacttt cttcgggggc 480ctcttcatca tcttgctctg gcggacgctc aagtacctgt ggaccgtgtg ctgccactgc 540gggggcaaga cgaaggaggc ccagaagatt aacaatggct caagccaggc ggatggcact 600ctcaaaccag tggatgaaaa agaggaggca gtggccgccg aggtcggctg gatgacctcc 660gtgaaggact gggcgggggt gatgatatcc gcccagacac tgactggcag

agtcctggtt 720gtcttagtct ttgctctcag catcggtgca cttgtaatat acttcataga ttcatcaaac 780ccaatagaat cctgccagaa tttctacaaa gatttcacat tacagatcga catggctttc 840aacgtgttct tccttctcta cttcggcttg cggtttattg cagccaacga taaattgtgg 900ttctggctgg aagtgaactc tgtagtggat ttcttcacgg tgccccccgt gtttgtgtct 960gtgtacttaa acagaagttg gcttggtttg agatttttaa gagctctgag actgatacag 1020ttttcagaaa ttttgcagtt tctgaatatt cttaaaacaa gtaattccat caagctggtg 1080aatctgctct ccatatttat cagcacgtgg ctgactgcag ccgggttcat ccatttggtg 1140gagaattcag gggacccatg ggaaaatttc caaaacaacc aggctctcac ctactgggaa 1200tgtgtctatt tactcatggt cacaatgtcc accgttggtt atggggatgt ttatgcaaaa 1260accacacttg ggcgcctctt catggtcttc ttcatcctcg ggggactggc catgtttgcc 1320agctacgtcc ctgaaatcat agagttaata ggaaaccgca agaaatacgg gggctcctat 1380agtgcggtta gtggaagaaa gcacattgtg gtctgcggac acatcactct ggagagtgtt 1440tccaacttcc tgaaggactt tctgcacaag gaccgggatg acgtcaatgt ggagatcgtt 1500tttcttcaca acatctcccc caacctggag cttgaagctc tgttcaaacg acattttact 1560caggtggaat tttatcaggg ttccgtcctc aatccacatg atcttgcaag agtcaagata 1620gagtcagcag atgcatgcct gatccttgcc aacaagtact gcgctgaccc ggatgcggag 1680gatgcctcga atatcatgag agtaatctcc ataaagaact accatccgaa gataagaatc 1740atcactcaaa tgctgcagta tcacaacaag gcccatctgc taaacatccc gagctggaat 1800tggaaagaag gtgatgacgc aatctgcctc gcagagttga agttgggctt catagcccag 1860agctgcctgg ctcaaggcct ctccaccatg cttgccaacc tcttctccat gaggtcattc 1920ataaagattg aggaagacac atggcagaaa tactacttgg aaggagtctc aaatgaaatg 1980tacacagaat atctctccag tgccttcgtg ggtctgtcct tccctactgt ttgtgagctg 2040tgttttgtga agctcaagct cctaatgata gccattgagt acaagtctgc caaccgagag 2100agccgtatat taattaatcc tggaaaccat cttaagatcc aagaaggtac tttaggattt 2160ttcatcgcaa gtgatgccaa agaagttaaa agggcatttt tttactgcaa ggcctgtcat 2220gatgacatca cagatcccaa aagaataaaa aaatgtggct gcaaacggct tgaagatgag 2280cagccgtcaa cactatcacc aaaaaaaaag caacggaatg gaggcatgcg gaactcaccc 2340aacacctcgc ctaagctgat gaggcatgac cccttgttaa ttcctggcaa tgatcagatt 2400gacaacatgg actccaatgt gaagaagtac gactctactg ggatgtttca ctggtgtgca 2460cccaaggaga tagagaaagt catcctgact cgaagtgaag ctgccatgac cgtcctgagt 2520ggccatgtcg tggtctgcat ctttggcgac gtcagctcag ccctgatcgg cctccggaac 2580ctggtgatgc cgctccgtgc cagcaacttt cattaccatg agctcaagca cattgtgttt 2640gtgggctcta ttgagtacct caagcgggaa tgggagacgc ttcataactt ccccaaagtg 2700tccatattgc ctggtacgcc attaagtcgg gctgatttaa gggctgtcaa catcaacctc 2760tgtgacatgt gcgttatcct gtcagccaat cagaataata ttgatgatac ttcgctgcag 2820gacaaggaat gcatcttggc gtcactcaac atcaaatcta tgcagtttga tgacagcatc 2880ggagtcttgc aggctaattc ccaagggttc acacctccag gaatggatag atcctctcca 2940gataacagcc cagtgcacgg gatgttacgt caaccatcca tcacaactgg ggtcaacatc 3000cccatcatca ctgaactagt gaacgatact aatgttcagt ttttggacca agacgatgat 3060gatgaccctg atacagaact gtacctcacg cagccctttg cctgtgggac agcatttgcc 3120gtcagtgtcc tggactcact catgagcgcg acgtacttca atgacaatat cctcaccctg 3180atacggaccc tggtgaccgg aggagccacg ccggagctgg aggctctgat tgctgaggaa 3240aacgccctta gaggtggcta cagcaccccg cagacactgg ccaataggga ccgctgccgc 3300gtggcccagt tagctctgct cgatgggcca tttgcggact taggggatgg tggttgttat 3360ggtgatctgt tctgcaaagc tctgaaaaca tataatatgc tttgttttgg aatttaccgg 3420ctgagagatg ctcacctcag cacccccagt cagtgcacaa agaggtatgt catcaccaac 3480ccgccctatg agtttgagct cgtgccgacg gacctgatct tctgcttaat gcagtttgac 3540cacaatgccg gccagtcccg ggccagcctg tcccattcct cccactcgtc gcagtcctcc 3600agcaagaaga gctcctctgt tcactccatc ccatccacag caaaccgaca gaaccggccc 3660aagtccaggg agtcccggga caaacagaag tacgtgcagg aagagcggct ttgatatgtg 3720tatccaccgc cactgtgtga aactgtatct gccactcatt tccccagttg gtgtttccaa 3780caaagtaact ttccctgttt tcccctgtag tccccccctt tttttttaca catatttgca 3840tatgtatgat agtgtgcatg tggttgtcat ttttatttca ccaccataaa acccttgagc 3900acaacagcaa ataagcagac ggaccaaaag ttatttatga ttctggggga aaaataaccc 3960aaaggcatgc tccagacata aatagctcac tgcaggaacg agttcacaga ttagaaggga 4020gcacttgtga tcaacgtcag ttaggcagag caagtttatt taatgtaaaa gaaaagttga 4080ttctgattta tcaggattat cagggtgctt tgggttttga ttttgttgtt gttgttgttt 4140tcctttcttt ctttttttat acacacaata agttagcaca tgtttatttg aaacaagcaa 4200ccaaacagca atgaaaacat attgattgtt tccagtctct gggccgaagt attgcgaagc 4260atttgaaaag ctttcacgat ttgtgtagat gattatgaag gacctgcttg ttgcaagaga 4320acatcagtga tttttttagt tactcaccaa ggccttttgt cccagagcca gttccctctg 4380ggagttctta tgaacatttc tcaccttaat atggaggaga gaatagtatt ccaatcatgg 4440atgtatcaaa ttctagtcat ttagtttaag tgaaaagagg tttgattgca tattaaattg 4500ttattctgtc tccttatgtt gccatatgaa tagctatttt ttttctttca cttttgacat 4560ttgggatgaa aagccatatg tatcataaat atcagatgta agtcattaaa aactgccttc 4620ctgggacttt tacatctttt aaaaggtgaa ttacttacct tatgtacaga ataaataatg 4680ctcaggaaag agcaagtatt tttccatgca ttctcagggg atctttttac tcccctttgt 4740ttgattagtt agggccccaa tgccaggtag gaggaagggc tggggcaatg gtagagtgag 4800aggaagacaa acccagctgc agatcatgct tttctaggag ccgacatgct aaataaatta 4860gaatgtagga ggatcagcca cagttgactc aacaaagaca aaagccagcc accaccttca 4920actgttggca cagctgtgcg gtgctggctg tcccaatgca gaaagctggt gggaaggaat 4980tcctcatcat cactttcttt aatgtagcca atttaggcag ggtaatgacg gcaatagaga 5040gctgctcctt gtcattatga gacgtgggat aagaagagtg caacagtgag ccaaacacat 5100tttggtatag ttattttttt cttcttttgt tttctttctt ttttaacact tagtaagcat 5160gagaggagag gtagaaaaat accctttttt caacatatag ttgtcagatg ctttgtgcat 5220gcaaatcatg ctttaggcag tgcggtattt cttaaaaact ggccaattca ccataaccaa 5280tttcccttat ggatggacta ggctggtata tacatatttg aaaagtttta cttcaaagaa 5340ttccatcgaa tagaataggg gtaaaaggga ggaggaaaac atgtcacagc tgtaccatct 5400ctaaaaaggt gtttttatgg tgaatgtttt ggatttagat tttggatccc ccgtcccctc 5460aagcatgata gttttggata tttgcttgct gtgtgaattg acaagcactt ttactgacaa 5520atggtgaggc tcagtcagaa cctccaccct cccccacacc aaagacaggg gcagcgtagt 5580attcaaacca gtattgtggt ggggaataat tgtatacatg taaattatca agccctatga 5640gtggaagaat tttttcaaat tatttttgtc cctctatata ttgatttata ttatgtataa 5700ctatctcttt atataaacta tatataatta tatatatata actatataat tatatatata 5760taactatata tataactata tatatgtatc ccctagtatt ggatcatgaa gagctcttca 5820tgcattcttt gcaaaggagg ttataaagtt acgccctcag aacatttata actataagaa 5880tgtgccagtt aaagtgctca acaggaaata tgacagttta aaagcattgt aaaactcaca 5940tagcttactt ctctctctaa agtgcaacaa ggatgaatag aatgggccaa ggtatgacaa 6000ttaatggttc tgcatgacct agccactgct gggggttttc ttctataacg ttgtccttgt 6060gaaaactttt gtgaaattaa aaaaaaagga gttacaaatt tta 6103711993DNAHomo sapiens 7cgccaggtcg cgcacagcgc cccgagccca ggcgcctccc cgcccccctc ccgcgctccg 60cggcggcggc ggcggcggca gcagtagcag caatatggct gttgatgggt gtttggggtg 120gcgctggcgg cgggaggagc tcccccgagc ccctgcgccg gctgcccgtt gctagctatg 180gcaaatggtg gcggcggcgg cggcggcagc agcggcggcg gcggcggcgg cggaggcagc 240agtcttagaa tgagtagcaa tatccacgcg aaccatctca gcctagacgc gtcctcctcc 300tcctcctcct cctcttcctc ttcttcttct tcctcctcct cttcctcctc gtcctcggtc 360cacgagccca agatggatgc gctcatcatc ccggtgacca tggaggtgcc gtgcgacagc 420cggggccaac gcatgtggtg ggctttcctg gcctcctcca tggtgacttt cttcgggggc 480ctcttcatca tcttgctctg gcggacgctc aagtacctgt ggaccgtgtg ctgccactgc 540gggggcaaga cgaaggaggc ccagaagatt aacaatggct caagccaggc ggatggcact 600ctcaaaccag tggatgaaaa agaggaggca gtggccgccg aggtcggctg gatgacctcc 660gtgaaggact gggcgggggt gatgatatcc gcccagacac tgactggcag agtcctggtt 720gtcttagtct ttgctctcag catcggtgca cttgtaatat acttcataga ttcatcaaac 780ccaatagaat cctgccagaa tttctacaaa gatttcacat tacagatcga catggctttc 840aacgtgttct tccttctcta cttcggcttg cggtttattg cagccaacga taaattgtgg 900ttctggctgg aagtgaactc tgtagtggat ttcrtcacgg tgccccccgt gtttgtgtct 960gtgtacttaa acagaagttg gcttggtttg agatttttaa gagctctgag actgatacag 1020ttttcagaaa ttttgcagtt tctgaatatt cttaaaacaa gtaattccat caagctggtg 1080aatctgctct ccatatttat cagcacgtgg ctgactgcag ccgggttcat ccatttggtg 1140gagaattcag gggacccatg ggaaaatttc caaaacaacc aggctctcac ctactgggaa 1200tgtgtctatt tactcatggt cacaatgtcc accgttggtt atggggatgt ttatgcaaaa 1260accacacttg ggcgcctctt catggtcttc ttcatcctcg ggggactggc catgtttgcc 1320agctacgtcc ctgaaatcat agagttaata ggaaaccgca agaaatacgg gggctcctat 1380agtgcggtta gtggaagaaa gcacattgtg gtctgcggac acatcactct ggagagtgtt 1440tccaacttcc tgaaggactt tctgcacaag gaccgggatg acgtcaatgt ggagatcgtt 1500tttcttcaca acatctcccc caacctggag cttgaagctc tgttcaaacg acattttact 1560caggtggaat tttatcaggg ttccgtcctc aatccacatg atcttgcaag agtcaagata 1620gagtcagcag atgcatgcct gatccttgcc aacaagtact gcgctgaccc ggatgcggag 1680gatgcctcga atatcatgag agtaatctcc ataaagaact accatccgaa gataagaatc 1740atcactcaaa tgctgcagta tcacaacaag gcccatctgc taaacatccc gagctggaat 1800tggaaagaag gtgatgacgc aatctgcctc gcagagttga agttgggctt catagcccag 1860agctgcctgg ctcaaggcct ctccaccatg cttgccaacc tcttctccat gaggtcattc 1920ataaagattg aggaagacac atggcagaaa tactacttgg aaggagtctc aaatgaaatg 1980tacacagaat atctctccag tgccttcgtg ggtctgtcct tccctactgt ttgtgagctg 2040tgttttgtga agctcaagct cctaatgata gccattgagt acaagtctgc caaccgagag 2100agccgaagcc gaaagcgtat attaattaat cctggaaacc atcttaagat ccaagaaggt 2160actttaggat ttttcatcgc aagtgatgcc aaagaagtta aaagggcatt tttttactgc 2220aaggcctgtc atgatgacat cacagatccc aaaagaataa aaaaatgtgg ctgcaaacgg 2280cttgaagatg agcagccgtc aacactatca ccaaaaaaaa agcaacggaa tggaggcatg 2340cggaactcac ccaacacctc gcctaagctg atgaggcatg accccttgtt aattcctggc 2400aatgatcaga ttgacaacat ggactccaat gtgaagaagt acgactctac tgggatgttt 2460cactggtgtg cacccaagga gatagagaaa gtcatcctga ctcgaagtga agctgccatg 2520accgtcctga gtggccatgt cgtggtctgc atctttggcg acgtcagctc agccctgatc 2580ggcctccgga acctggtgat gccgctccgt gccagcaact ttcattacca tgagctcaag 2640cacattgtgt ttgtgggctc tattgagtac ctcaagcggg aatgggagac gcttcataac 2700ttccccaaag tgtccatatt gcctggtacg ccattaagtc gggctgattt aagggctgtc 2760aacatcaacc tctgtgacat gtgcgttatc ctgtcagcca atcagaataa tattgatgat 2820acttcgctgc aggacaagga atgcatcttg gcgtcactca acatcaaatc tatgcagttt 2880gatgacagca tcggagtctt gcaggctaat tcccaagggt tcacacctcc aggaatggat 2940agatcctctc cagataacag cccagtgcac gggatgttac gtcaaccatc catcacaact 3000ggggtcaaca tccccatcat cactgaacta gtgaacgata ctaatgttca gtttttggac 3060caagacgatg atgatgaccc tgatacagaa ctgtacctca cgcagccctt tgcctgtggg 3120acagcatttg ccgtcagtgt cctggactca ctcatgagcg cgacgtactt caatgacaat 3180atcctcaccc tgatacggac cctggtgacc ggaggagcca cgccggagct ggaggctctg 3240attgctgagg aaaacgccct tagaggtggc tacagcaccc cgcagacact ggccaatagg 3300gaccgctgcc gcgtggccca gttagctctg ctcgatgggc catttgcgga cttaggggat 3360ggtggttgtt atggtgatct gttctgcaaa gctctgaaaa catataatat gctttgtttt 3420ggaatttacc ggctgagaga tgctcacctc agcaccccca gtcagtgcac aaagaggtat 3480gtcatcacca acccgcccta tgagtttgag ctcgtgccga cggacctgat cttctgctta 3540atgcagtttg accacaatgc cggccagtcc cgggccagcc tgtcccattc ctcccactcg 3600tcgcagtcct ccagcaagaa gagctcctct gttcactcca tcccatccac agcaaaccga 3660cagaaccggc ccaagtccag ggagtcccgg gacaaacaga acagaaaaga aatggtttac 3720agatgaaccg gataatgcct atcccagaaa cattcaaatc aagcccatga gtacccacat 3780ggctaaccag atcaaccaat ataaatccac aagcagcttg attccaccaa tcagagaagt 3840tgaagatgaa tgttgactcc caggagacca gaactatttt tttaaagcct gacaaacttc 3900ataaatggtg atgtgacttt tcttcttaca tgctgaatca ctggtggaaa cgttaggata 3960agcaagaatt gccagaaaat aaagtagaca gatctttctc tttgtctgcc ttgaatattg 4020cttccatgta ttttggaaaa gaaaatgatt tcatttataa atgaacatac taaaatagtc 4080atgtatagcc tctagcattt taaattattt ttatttatta gaaagaaaat atattttttc 4140ttttcattgt caaatatctt ccctatatct aaacaatgca aaatctaaat gaataagtgg 4200tcagactcct taatgtgttt ttctcttctt tctctctttt tctttgagga gaatgatggt 4260caccaccaca attaattgta attaagggaa atgaattatt aaaacaattt taaaatggcc 4320aatgatgtat acatgtattt tagtaaatcc agaaaagaag actaagggga caggtgaata 4380cctgctcctc gcctggatgg gtgtgtattt tgatctgcat tgacaccagc tcttaataaa 4440tggaaactta tttattttca cagttgaaag tcatattttt gtagttctag ttttcattct 4500gtagttctca cccctttgtt catattttta aagggaagac cttctgctgc ttttctacaa 4560ttggcagatc aggtttgtct ggccaactaa ggacaccagg agggttgtgg gcacacctgg 4620gatgtggaag ctgaggacca gatgcacaca aggcattgct ctgtttgctg ttctagtggt 4680ggagactcct acgtgctgtt atgcttctca ttttatattt ccaaaccacc tgagcgagta 4740atgtcaactt cgggagggtc tggtggactt tctccccact ccccaagtct cagagctttt 4800agcctggaag tttgtaaaac tgattagtag ttttacttta ccataggatg tgagagggca 4860gtcattcttc tcactgagtt tttgtttaaa aaccaggaaa tttctacaat catggagaca 4920gattttaatt tgcatgctct cctttattta gttgctgggg ccaaacacat gaacttgtta 4980caacaattta aaaataataa taacaaaagg aaagcaacga atgcacttca tatagactgt 5040tagaaaaggc ctttgaaaat taccagcagt gaaatcaaat aaattagcca ctttaaactg 5100cggtcaaaag atttttctag ccatcagatg caattacgat gtctcagagc tctgctatcg 5160cttgcatgct cggtgtacag tctcccggca actgttttgt tccaatcaac ttagcaagtc 5220tttcaacttt aaaattatca atctttgata tgatcatcaa ggtctctgga gaagcatgga 5280tgtaatagtg atttctattt tcttaaaaaa tgtaaactgt ggacacttaa tggaaccaag 5340ctaaccaaag tatctccccg aagtttcatg atatctagtc cattaactct ttgggccatg 5400acctgtggta cctagttatg gtagtgcaaa tcagatcaga gcaaagcaat gagatcatca 5460tgaagacata tgtccactaa gtactccaat taccagcgta ggcaaaatga gcttccacct 5520ctgtccactc cctgcagagc caatatagtc gtgcttccac ctcgtaggca ttgtcctgca 5580gtgatttgtc ggactgtggt tactctgtcg tcacattttg tagaattagt tctataaaag 5640tattgtgaat acaatgtatg tccaattgga ttgtttaaaa actacttata attaatcact 5700agcctactca gcagactaaa atgatgtcaa cagtctatat tcaggcttat aaacatttct 5760tggtttccaa cagaagtcaa atgtgtttgt ggggagaacg ttttgctagg attttgacaa 5820ctttcctgaa agctaggcct tttttacata atgattttgc attggggtca ccttagtata 5880ttcacgtcaa tccacgctct tctttccttc gtgaaccata gtgggctctt cactcctgct 5940cgtaataacc acctccaaat ttgttagagt gatttggtct cctctggcag gctgtggtgg 6000ccacataaag gatcttccat tagagggaca caggacacaa agctccattc ccatgaccct 6060ctcttccctg tgtctcccct aacaaggcaa tctggaagca gaaatgcaaa ctccagcccc 6120accacacatc caccgatgca tttgtggcta gaaattttaa tctaaacttt ttttaaaaaa 6180aatcataata gttaggatag tttcctatag caaagggctc cttgattcat aagcacctcc 6240cccccaaaaa aaccaaattg gtaaaaattc attttctttt aaatagagca ataagttcat 6300actgtgttgc cgttgtaata atgaattgtt ctggactaga aaacaaaatg aggcattttg 6360ttaagggggt aggaaaatga ctgattgttg ggccctttgg caaaagctgg tgcctggtaa 6420gtagaaacga aatggaaaca gaaataacat ttgtgaaatc actggagggc tcaagcaaat 6480gccagagctt ctccctggct tgttcctact tgttgagctc tttggccctg agtcccatcc 6540atctccactg caacagtctg tctttctgcc tacatccgcc tgagaccaag gagggtcttt 6600ggtacagtcc acattatgag gctctgattt cctatcccag tttagggctc cagaaaagcc 6660attctcccaa actaatgatt cttgggtgct gtgggtcacc aacaggctgt ttacaaagca 6720gaaaatatca tcaccatcat aacctttctc cttgagaaaa cttttatttt tgtctaagca 6780attttatatt ttagaatatc atcttgaacc attataaaac accttaaata aaagtgattg 6840tgactaaggc acgttggaga acattccaat ctttcctccc aagggttctg gcaccttatg 6900atgtactttg taaaaaaatt gattgaagat tttaaataaa caggaaatta gaagtgttag 6960ggttagataa aggaaaagtg aaaaagcata agaaatttgg gactttttca tgttgaaagg 7020agaaaaagca caagttccct agttaccatt taatatgagg gtgcaagagc cacatttaca 7080aacaacaaac ttgatcttta aaaatgtttt taaaactctc tgagtctcag tgacttcatt 7140tgtaaatgag agtgattcat ctagatgact ctaaggtctc tttcaggtcc caggggacgt 7200gatctaagtt aggagtggga acatgggagt ggctgcttct ccttggctaa gcccatgcag 7260actattgtgt ccaggactgg aataaaggtc ctttttgctg catcacccag gcaacactcc 7320cagccttact caggagtggt gaacattttc tgctctggac atagaatagg taggttcatt 7380cctggtcttt tcactttaga ttctctttag gttcaagatg cagatttctc aatttggaca 7440cacctgcatc acgttggtca aattttgctg cctgtttcta gggttttctt ctcagtttca 7500tccctgcctt cccttttttg ttgttttttt tttggttcaa ggcccagctt cagttaatcc 7560cttcatctct atgccatgtc tccaattcct agtatgtaac tagaggttca agagacccca 7620aattcctgcc attttcccca tttatgtttc cccatgtgaa tcttcaggaa gtaaccagtc 7680ttccttctca cttcatttcc tgtcctctgt ttatttggtt attttctttc attaataaac 7740taaccatctc ttagctactt acattcacaa atgtaatttt aatctattgt gtttcattgt 7800gaaagagaat ctcattgaag gaaggaagga agaaattgag gaataaaggt aggaagggag 7860agaaacaaag actatccaac caattgactg agatgtgagc cggcttgact cctaggagac 7920taagtagatc cattcagctt gaacactgag ttccagggca gaatctgtcc attttctgtt 7980ttgttcttac ttgctgcttt tggaatggtg gtaaagccac cagtcaccat gagccttgaa 8040aggaccttca ctaatgagga cttgactcac cctctttaaa aagcaaaaga aacagaattt 8100acttacaatc ttctggtaaa ttacctttct gatcctctcc ttattcccaa aaggcaattt 8160ttttaatcca gcagagatga tttagcatat aaatcccagg tcatttgagg aggtgatgac 8220gctatttgga tttatttatg agacagtagt aattataaat gattcctagg cagtttgtac 8280tagtttggtc atattggttg tttaagtgga gtctcttctg attgtttgtt tccaataaag 8340tatcagttgt taataatttc aagatttcca taaaaataag aaaacttgga aaacattttt 8400aattttattt cttaagagac cacagagcct aattttcaat ttttatggta agcttgctta 8460aaacatgtat aaaaagaagc ctacatgctc aaaggcagag gcacctttag ccctacaaca 8520gttggaagct ccatgatatc acagccccac atggatagat tggagaaaga attctgactt 8580agaccacctg tagcagacct tcctcttttg gcatattttt ttaatcacaa aaaggacctg 8640agactcccta tctgaagata agccaaactt ggggtataca ttaagaatct gggaagaaag 8700aaaaaaaaga aaaagatata ataagcagta ttttaaaata ccatgagtta tgggcatgca 8760tatggtacaa agagtagttc tttgggttga aagaaagaag agtttgcatt gaactgcgta 8820ggctggcaag aatgcagagg tatacaatgt ttgatgggct ttggaggcat ttcaatagta 8880aatgggtgac aggactggaa agatgtggaa tatgagggtt ttccagggag atgggactta 8940atgggccatg atgtatttgt aggaatgtga tttcaataga ttgactattt tgtctactgt 9000gataagtttg tgtaggggaa ctgaggaaaa ctgagatgag acttcatgga aggggctaca 9060aagtacagtc taaaggccta gataaagttt gaaacttgat ttagaaagtc atgaaaagcc 9120actcagagtt ttaagcaaag agtgatgggg cagcaatggc tgtgcatttt tcaggttgaa 9180agtagtgaga tgtcagttct tcctggaaga tatcatgaga atgcacacaa aactgaacat 9240tttctcagca gcaaggagtg ctaaagggtg cacactccaa gtcaacaact caccgtgtgc 9300agcaccttcc tcacacattt tgctttgctt tctgtcacag gaccatcaga cgtagaacgt 9360cctgactctc ctgaattact agaatgtcag caacaaactc acaaagtaga ttagagggta 9420ggaatagata cataaatttt taaaaacctg ccaatcatac tgttttctag acagtaatat 9480aataagaaca tgaggcagga catccacaaa tagtagagaa taattaatag tccagaactg 9540ccaaatagga attcccctta tgaaaacacc cttgcagcta atcaggtagc ccttgtttag 9600aaaccaatta gcactcataa aatatttgta

caaggagtga gtgggggaga aatgagcaca 9660atatgggttc tgccatcaat cagcttataa tacaactaaa gaaagaaaac atgctcaaag 9720caccattaga gaaagggtga gccctaatga catagtttca cattcaatat ggtaggagtt 9780gaaacaaggg agaaatgctg tggtttgaag tggttcaaca aggtaggatt tctagagaaa 9840ggggggttta ggagttagat aagtagagga tcagcattct aggtatgaag gcaggattat 9900ctggcatgtg gcagggtgaa tgatgttaat cagtaactgc taattgatat ttactgagca 9960gctgctgtgt cctcacgatg gtaagactat tagaggaaga cagcccacct gcctaactgg 10020gaacacaagg cacacatata ttggaaagat catgttgcac aaaacaggtg ttcaataaat 10080aatttttgaa taaatgtgaa cactgaatag caaataaatg ttatagatcg taatagttgt 10140agaagattgg ttgggattgt agggactgga tgtggggcaa tggctgtggg tctagagtat 10200attcattgtg cagtggacac acacctaatc tgtcctcaag gacagaacca tgtggaggaa 10260taggaaaaca agagaagcag gcaagaagcg gaggcagtga gtacagcagc taagaaatgt 10320tacattgggt tcatccagag caagaaaagc tgagagctgt ccgtgaggga aggccacaca 10380ggcaagagga gtgggacagg ggagtaaagg agtgggctac aacaggccct gcagatgtgg 10440aagccagacc cacagaggca cttagaaagt gaggatcctg gatgaattat tttagggaga 10500aagtgtaggt ttagatcagc tggcagatgt gtttgtgggc tacagccaag tttttcagga 10560ctaagaagga gcaaaataag tagaacttct tgggacagga gatctagggt actccagaac 10620cagggaaatg agaaacaaga ggggaatttt aagaaagaga gggaagatca tctatgaggt 10680tggagatgaa aggtgttgga gatggtgagg cacaagtcaa aagactcact cgaagggcag 10740gaactctgct tatttgtcca tattcccaga gtttgtcatg aggtctggcc cacgtgggca 10800gtcactcggc cactatgtat cactgtggct gccatggtgg atggaggctg gacagaacct 10860gtggtgatcg gcagtctttc tggaggactc accagggagg ggtctcaggg tgggcatctc 10920ctttcacctt cctgtgcatg tcactgcact gttcttcttc cctccctgaa cagcacacac 10980actgcatcct tagtttcagg ggtctgaaaa caaatgctac gaccaccttg ctttggtggc 11040ttttctgaac aggcattgtg agaagagatg ttctggccag gtgaaagtgg actttatttt 11100taggtaggtt tttcagttta gaaaggtttc ctttgcttat cccttgagga cttctgtgct 11160gctgcttctc ctccatcttg ctagttaaca gaacaggggc agaagtgaca ccaatgctct 11220cggccatgcc tgccttggga agcactaccg ggccccactg tttagaatct tagatggaaa 11280tgtacacaag gcattgacac acgcctgcgg gagtgaccca gtgcttccct cccatgggac 11340tcagggtcag cgtgggaagg cagctggcag ggacaggagc cccgcccgca aggtggactg 11400agcctcactt ccacacaaaa ccagagtccc atctgcccca gagcgctcgc tctcctcccc 11460ttccttccgc tcaatgcagc ctgacacgcc tttgaccaga actgcaacat ttcaaacaca 11520aacccagatc tgttgggaaa tcctaattaa aaacgttgca ttcccaggtg gcacaatcac 11580atcctgccta aaacttctgg cccacatccc accacccaga tgttgaaaag aaacctttct 11640ctgcttaaca ccaaaacctg cacttcaagg tttctttagg ggacaaagaa aaaaaaagta 11700cacacatgca gagttcagcc tacatgttca ttgaggaaaa agagcgtggc ttattcatct 11760ttcaatcttt tgattgttgg cattatgatt atgattatga ttaattactc tgacctgaca 11820ggaattgaag aagagactat atgctggtgc tctgaaatga tctacccaac tctgtcatct 11880gtaacaacca gtgataactc tcttgtcttg taaaaagggt ttgtacataa cttgtacatg 11940gtttcatttt gtatttttcg cagattaaaa atttatgtat ttgtgttcta aaa 1199386103DNAHomo sapiens 8cgccaggtcg cgcacagcgc cccgagccca ggcgcctccc cgcccccctc ccgcgctccg 60cggcggcggc ggcggcggca gcagtagcag caatatggct gttgatgggt gtttggggtg 120gcgctggcgg cgggaggagc tcccccgagc ccctgcgccg gctgcccgtt gctagctatg 180gcaaatggtg gcggcggcgg cggcggcagc agcggcggcg gcggcggcgg cggaggcagc 240agtcttagaa tgagtagcaa tatccacgcg aaccatctca gcctagacgc gtcctcctcc 300tcctcctcct cctcttcctc ttcttcttct tcctcctcct cttcctcctc gtcctcggtc 360cacgagccca agatggatgc gctcatcatc ccggtgacca tggaggtgcc gtgcgacagc 420cggggccaac gcatgtggtg ggctttcctg gcctcctcca tggtgacttt cttcgggggc 480ctcttcatca tcttgctctg gcggacgctc aagtacctgt ggaccgtgtg ctgccactgc 540gggggcaaga cgaaggaggc ccagaagatt aacaatggct caagccaggc ggatggcact 600ctcaaaccag tggatgaaaa agaggaggca gtggccgccg aggtcggctg gatgacctcc 660gtgaaggact gggcgggggt gatgatatcc gcccagacac tgactggcag agtcctggtt 720gtcttagtct ttgctctcag catcggtgca cttgtaatat acttcataga ttcatcaaac 780ccaatagaat cctgccagaa tttctacaaa gatttcacat tacagatcga catggctttc 840aacgtgttct tccttctcta cttcggcttg cggtttattg cagccaacga taaattgtgg 900ttctggctgg aagtgaactc tgtagtggat ttcttcacgg tgccccccgt gtttgtgtct 960gtgtacttaa acagaagttg gcttggtttg agatttttaa gagctctgag actgatacag 1020ttttcagaaa ttttgcagtt tctgaatatt cttaaaacaa gtaattccat caagctggtg 1080aatctgctct ccatatttat cagcacgtgg ctgactgcag ccgggttcat ccatttggtg 1140gagaattcag gggacccatg ggaaaatttc caaaacaacc aggctctcac ctactgggaa 1200tgtgtctatt tactcatggt cacaatgtcc accgttggtt atggggatgt ttatgcaaaa 1260accacacttg ggcgcctctt catggtcttc ttcatcctcg ggggactggc catgtttgcc 1320agctacgtcc ctgaaatcat agagttaata ggaaaccgca agaaatacgg gggctcctat 1380agtgcggtta gtggaagaaa gcacattgtg gtctgcggac acatcactct ggagagtgtt 1440tccaacttcc tgaaggactt tctgcacaag gaccgggatg acgtcaatgt ggagatcgtt 1500tttcttcaca acatctcccc caacctggag cttgaagctc tgttcaaacg acattttact 1560caggtggaat tttatcaggg ttccgtcctc aatccacatg atcttgcaag agtcaagata 1620gagtcagcag atgcatgcct gatccttgcc aacaagtact gcgctgaccc ggatgcggag 1680gatgcctcga atatcatgag agtaatctcc ataaagaact accatccgaa gataagaatc 1740atcactcaaa tgctgcagta tcacaacaag gcccatctgc taaacatccc gagctggaat 1800tggaaagaag gtgatgacgc aatctgcctc gcagagttga agttgggctt catagcccag 1860agctgcctgg ctcaaggcct ctccaccatg cttgccaacc tcttctccat gaggtcattc 1920ataaagattg aggaagacac atggcagaaa tactacttgg aaggagtctc aaatgaaatg 1980tacacagaat atctctccag tgccttcgtg ggtctgtcct tccctactgt ttgtgagctg 2040tgttttgtga agctcaagct cctaatgata gccattgagt acaagtctgc caaccgagag 2100agccgtatat taattaatcc tggaaaccat cttaagatcc aagaaggtac tttaggattt 2160ttcatcgcaa gtgatgccaa agaagttaaa agggcatttt tttactgcaa ggcctgtcat 2220gatgacatca cagatcccaa aagaataaaa aaatgtggct gcaaacggct tgaagatgag 2280cagccgtcaa cactatcacc aaaaaaaaag caacggaatg gaggcatgcg gaactcaccc 2340aacacctcgc ctaagctgat gaggcatgac cccttgttaa ttccrggcaa tgatcagatt 2400gacaacatgg actccaatgt gaagaagtac gactctactg ggatgtttca ctggtgtgca 2460cccaaggaga tagagaaagt catcctgact cgaagtgaag ctgccatgac cgtcctgagt 2520ggccatgtcg tggtctgcat ctttggcgac gtcagctcag ccctgatcgg cctccggaac 2580ctggtgatgc cgctccgtgc cagcaacttt cattaccatg agctcaagca cattgtgttt 2640gtgggctcta ttgagtacct caagcgggaa tgggagacgc ttcataactt ccccaaagtg 2700tccatattgc ctggtacgcc attaagtcgg gctgatttaa gggctgtcaa catcaacctc 2760tgtgacatgt gcgttatcct gtcagccaat cagaataata ttgatgatac ttcgctgcag 2820gacaaggaat gcatcttggc gtcactcaac atcaaatcta tgcagtttga tgacagcatc 2880ggagtcttgc aggctaattc ccaagggttc acacctccag gaatggatag atcctctcca 2940gataacagcc cagtgcacgg gatgttacgt caaccatcca tcacaactgg ggtcaacatc 3000cccatcatca ctgaactagt gaacgatact aatgttcagt ttttggacca agacgatgat 3060gatgaccctg atacagaact gtacctcacg cagccctttg cctgtgggac agcatttgcc 3120gtcagtgtcc tggactcact catgagcgcg acgtacttca atgacaatat cctcaccctg 3180atacggaccc tggtgaccgg aggagccacg ccggagctgg aggctctgat tgctgaggaa 3240aacgccctta gaggtggcta cagcaccccg cagacactgg ccaataggga ccgctgccgc 3300gtggcccagt tagctctgct cgatgggcca tttgcggact taggggatgg tggttgttat 3360ggtgatctgt tctgcaaagc tctgaaaaca tataatatgc tttgttttgg aatttaccgg 3420ctgagagatg ctcacctcag cacccccagt cagtgcacaa agaggtatgt catcaccaac 3480ccgccctatg agtttgagct cgtgccgacg gacctgatct tctgcttaat gcagtttgac 3540cacaatgccg gccagtcccg ggccagcctg tcccattcct cccactcgtc gcagtcctcc 3600agcaagaaga gctcctctgt tcactccatc ccatccacag caaaccgaca gaaccggccc 3660aagtccaggg agtcccggga caaacagaag tacgtgcagg aagagcggct ttgatatgtg 3720tatccaccgc cactgtgtga aactgtatct gccactcatt tccccagttg gtgtttccaa 3780caaagtaact ttccctgttt tcccctgtag tccccccctt tttttttaca catatttgca 3840tatgtatgat agtgtgcatg tggttgtcat ttttatttca ccaccataaa acccttgagc 3900acaacagcaa ataagcagac ggaccaaaag ttatttatga ttctggggga aaaataaccc 3960aaaggcatgc tccagacata aatagctcac tgcaggaacg agttcacaga ttagaaggga 4020gcacttgtga tcaacgtcag ttaggcagag caagtttatt taatgtaaaa gaaaagttga 4080ttctgattta tcaggattat cagggtgctt tgggttttga ttttgttgtt gttgttgttt 4140tcctttcttt ctttttttat acacacaata agttagcaca tgtttatttg aaacaagcaa 4200ccaaacagca atgaaaacat attgattgtt tccagtctct gggccgaagt attgcgaagc 4260atttgaaaag ctttcacgat ttgtgtagat gattatgaag gacctgcttg ttgcaagaga 4320acatcagtga tttttttagt tactcaccaa ggccttttgt cccagagcca gttccctctg 4380ggagttctta tgaacatttc tcaccttaat atggaggaga gaatagtatt ccaatcatgg 4440atgtatcaaa ttctagtcat ttagtttaag tgaaaagagg tttgattgca tattaaattg 4500ttattctgtc tccttatgtt gccatatgaa tagctatttt ttttctttca cttttgacat 4560ttgggatgaa aagccatatg tatcataaat atcagatgta agtcattaaa aactgccttc 4620ctgggacttt tacatctttt aaaaggtgaa ttacttacct tatgtacaga ataaataatg 4680ctcaggaaag agcaagtatt tttccatgca ttctcagggg atctttttac tcccctttgt 4740ttgattagtt agggccccaa tgccaggtag gaggaagggc tggggcaatg gtagagtgag 4800aggaagacaa acccagctgc agatcatgct tttctaggag ccgacatgct aaataaatta 4860gaatgtagga ggatcagcca cagttgactc aacaaagaca aaagccagcc accaccttca 4920actgttggca cagctgtgcg gtgctggctg tcccaatgca gaaagctggt gggaaggaat 4980tcctcatcat cactttcttt aatgtagcca atttaggcag ggtaatgacg gcaatagaga 5040gctgctcctt gtcattatga gacgtgggat aagaagagtg caacagtgag ccaaacacat 5100tttggtatag ttattttttt cttcttttgt tttctttctt ttttaacact tagtaagcat 5160gagaggagag gtagaaaaat accctttttt caacatatag ttgtcagatg ctttgtgcat 5220gcaaatcatg ctttaggcag tgcggtattt cttaaaaact ggccaattca ccataaccaa 5280tttcccttat ggatggacta ggctggtata tacatatttg aaaagtttta cttcaaagaa 5340ttccatcgaa tagaataggg gtaaaaggga ggaggaaaac atgtcacagc tgtaccatct 5400ctaaaaaggt gtttttatgg tgaatgtttt ggatttagat tttggatccc ccgtcccctc 5460aagcatgata gttttggata tttgcttgct gtgtgaattg acaagcactt ttactgacaa 5520atggtgaggc tcagtcagaa cctccaccct cccccacacc aaagacaggg gcagcgtagt 5580attcaaacca gtattgtggt ggggaataat tgtatacatg taaattatca agccctatga 5640gtggaagaat tttttcaaat tatttttgtc cctctatata ttgatttata ttatgtataa 5700ctatctcttt atataaacta tatataatta tatatatata actatataat tatatatata 5760taactatata tataactata tatatgtatc ccctagtatt ggatcatgaa gagctcttca 5820tgcattcttt gcaaaggagg ttataaagtt acgccctcag aacatttata actataagaa 5880tgtgccagtt aaagtgctca acaggaaata tgacagttta aaagcattgt aaaactcaca 5940tagcttactt ctctctctaa agtgcaacaa ggatgaatag aatgggccaa ggtatgacaa 6000ttaatggttc tgcatgacct agccactgct gggggttttc ttctataacg ttgtccttgt 6060gaaaactttt gtgaaattaa aaaaaaagga gttacaaatt tta 610394494DNAHomo sapiensmisc_feature(2161)..(2260)n is a, c, g, or t 9ggatcccctt cgtcccacct ggtccacccc agatgctgag gatgggggag ctcaggcggg 60gcctctgctt tggggatggg aatgtgtttt tctcccaaac ttgtttttat agctctgctt 120gaagggctgg gagatgaggt gggtctggat cttttctcag agcgtctcca tgctattgtt 180gcatttccgt tttctatgaa tgaatttgca ttcaataaac aaccagactc agttcttggg 240gcccttgttt gcactccctc tgggtggagc tgttggatga gggaggggaa gcggagtctt 300ccatttcccc attcttcaag ccatgggcct actgggaact gcaattcctt gattctcccg 360gtttttcctg tcctccagca acagcattaa ttcagttaac atttaccggg ggcaactgtg 420ctggacagag gccagttcct ggaaaagctt ttcccacgcc atcccactgc agacatccct 480ccttacctcc ccaggaacag cagtctctgc ccacctgacc ccgcccacca gactgaggct 540cacttcacct ctgacctgag cggcccccag ctcaccaggc cacaggccca agcagtgctc 600cctgatgcgg cgtttataat ccgctcagcg tgcaggccga ggcaggaggg tgatgaaagc 660tgggcaggct ccaagaggag ggagttttga tatgtccctg aaagattcat ttagacttca 720gtcggctaaa ggaggacatg atttgggggc caaggaatct gttgaattca gaacacaacc 780agaggtctgc agggtcaggg atggaggagt gggctttccc atcgccaggg cccactcctc 840ttcctgcttt tcctgcaggc gccactggga ggtgctatgg ctgtgcctcc cctgggctct 900ggagcatgtc cagttgcagt gggcagaact gcggaggcgg gcccctcctc tgccaggcct 960ggcagccccc tcctagggcc ttgtttggct aggggtggtg ccgggtgtgg cagtgtgtgt 1020gtagtggaga gtgttaggtc ttccctacca ggtgcccttg caggggagtg ccacagcagt 1080cagtccaggg atcccaccgt tagtctcacc ttttttaacc tcttatctct ccccaagatc 1140cctgaagcca ggtacgagca agatgagagt gggttatctc tggagtgaca gaggctggtc 1200tgttttccag gctggtaggg actgttccta aagggaggaa gggatgatac cagcctcctg 1260agcctccttc tcctgcgtta gtgtctcagg ccctgccagg ccttatagac cctcttattg 1320acactgccca ctggatgggg accggagttg gactcagctt ctgccgaacc ctcaaatccc 1380agccccaact aaagcatata actcaagacc tacctgcact gaaagctctt ctcaacctga 1440gcagggtggt ccaattgaaa gggtgggtgt gaccacctct cctgcaccca tgcgggttgg 1500cagaggtgtg caggatctgc cacttaccat tcaccatgtg gccttgagga agacgcactc 1560ggggcctcag tttcctcatc tataaaatgg ggatgtaatt acaccctcac actgtagctg 1620tgagtattca atgagagcac tgcaaagggc ctggtgtgga gtaggtcctc aggaaaggtt 1680ggatcccatg tcccatcaga gctaaaagcc ccaggaggag agggtggctg gtttgtcccc 1740acaaacccct gggattcccg gctccccagc cccttgcccc tctctccagc cagactctat 1800tgaactcccc ctcttctcaa actcggggcc agagaacagt gaagtaggag cagccgtaag 1860tccgggcagg gtcctgtcca taaaaggctt ttcccgggcc ggctccccgc cggcagcgtg 1920ccccgccccg gcccgctcca tctccaaagc atgcagagaa tgtctcggca gccccggtag 1980actgctccaa cttggtgtct ttccccaaat atggagcctg tgtggagtca ctgggggagc 2040cgggggtggg gagcggagcc ggcttcctct agcagggagg gggccgagga gcgagccagt 2100gggggaggct gacatcacca cggcggcagc cctttaaacc cctcacccag ccagcgcccc 2160nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 2220nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn atcctgtctg tccgaaccca 2280gacacaagtc ttcactcctt cctgcgagcc ctgaggaagc cttgtgagtg cattggctgg 2340ggcttggagg gaagttgggc tggagctgga caggagcagt gggtgcattt cagcaggctc 2400tcctgagggt cccaggcgcc agctccagct ccctggctag ggaaacccac cctctcagtc 2460agcatggggg cccaagctcc aagcagggtg ggctggatca ctaacgtcct ggatctctct 2520caaactgggc aaccccgggc tcattgaaat gccccggaat gacttggcta atnnnnnnnn 2580nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 2640nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnccgggtga aagcagagtg ctccctgacc 2700ctctgcccct ccctcctcca ccctggcctg ctttagcttt ccccagacat ggccaacaag 2760ggtccttcct atggcatgag ccgcgaagtg cagtccaaaa tcgagaagaa gtatgacgag 2820gagctggagg agcggctggt ggagtggatc atagtgcagt gtggccctga tgtgggccgc 2880ccagaccgtg ggcgcttggg cttccaggtc tggctgaaga atggcgtggt gagtggcacc 2940ctgggctagg gcgctggggg gctggggtgt gaccccctgt gagtcctggg ccaatccctg 3000aggactgcta agctgcgtcc tatgccctat gcctggtaga ttctgagcaa gctggtgaac 3060agcctgtacc ctgatggctc caagccggtg aaggtgcccg agaacccacc ctccatggtc 3120ttcaagcaga tggagcaggt ggctcagttc ctgaaggcgg ctgaggacta tggggtcatc 3180aagactgaca tgttccagac tgttgacctc tttgaaggta gagaggagaa tgctggggga 3240ggaggtgggc aggaggacag ggtgctggga cagggagagg gtatgaccaa atatgccaca 3300actaggggtg tgctcgcccg cacacagcag ggatgggata tgccgagaat aacacgccac 3360gctcacaggg cccactgaga ggcctccctt gaattgggga caactcttgg ccctggtttg 3420gccatttttt tgtgagagac gggggcaggc cctggcttgg agtcttgttt atacgttctt 3480gatgttcatc tcctctctcc tgtcttctca caggcaaaga catggcagca gtgcagagga 3540ccctgatggc tttgggcagc ttggcagtga ccaagaatga tgggcactac cgtggagatc 3600ccaactggtt tatgaagtat gtggccccca gggagcttga gtctccgcat ggggtgggag 3660gtggcttgtt ctaaggagct tgcgggaagg attaggggaa gcagatagcc aagaaaggat 3720aaagtgaggg tctgggatgg ggaataatgg gtccttaata ctccttgacc cctccctttc 3780caccctcctg cgctcagtct ccctagccta tgaggcaagc tagattaggg aaaaaaagtg 3840caacaggaag gcaatgggat tgggctagga cgtaacagag ggatcagaaa acgggtggaa 3900aacacacagt tctaccaagt ctttatcctg cttcctcctc ttctaggaaa gcgcaggagc 3960ataagaggga attcacagag agccagctgc aggagggaaa gcatgtcatt ggccttcaga 4020tgggcagcaa cagaggggcc tcccaggccg gcatgacagg ctacggacga cctcggcaga 4080tcatcagtta gagcggagag ggctagccct gagcccggcc ctcccccagc tccttggctg 4140cagccatccc gcttagcctg cctcacccac acccgtgtgg taccttcagc cctggccaag 4200ctttgaggct ctgtcactga gcaatggtaa ctgcacctgg gcagctcctc cctgtgcccc 4260cagcctcagc ccaacttctt acccgaaagc atcactgcct tggcccctcc ctcccggctg 4320cccccatcac ctctactgtc tcctccctgg gctaagcagg ggagaagcgg gctgggggta 4380gcctggatgt gggccaagtc cactgtcctc cttggcggca aaagcccatt gaagaagaac 4440cagcccagcc tgccccctat cttgtcctgg aatatttttg gggttggaac tctc 44941024DNAMus musculus 10ttcggcttgg gtcgactctt agaa 241124DNAMus musculus 11tatgatgagc gcatccatct tggg 24

Patent applications by Nancy J. Rusch, Bigelow, AR US

Patent applications by Paul L. Hermonat, Little Rock, AR US

Patent applications by Sung W. Rhee, Little Rock, AR US

Patent applications by BOARD OF TRUSTEES OF THE UNIVERSITY OF ARKANSAS

Patent applications in class Polynucleotide (e.g., RNA, DNA, etc.)

Patent applications in all subclasses Polynucleotide (e.g., RNA, DNA, etc.)

User Contributions:

Comment about this patent or add new information about this topic:

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: COMPOSITIONS AND METHODS FOR REGULATION OF SMOOTH MUSCLE CELLS AND BLOOD PRESSURE

Abstract:

Claims:

Description: