Inventors list |
Assignees list |
Classification tree browser |
Top 100 Inventors |
Top 100 Assignees |
Patent application title: Methods and probes for identifying a nucleotide sequence
Inventors:
Malcolm James Simons (Victoria, AU)
Assignees:
SIMONS HAPLOMICS LIMITED
IPC8 Class: AC40B4006FI
USPC Class:
506 16
Class name: Nucleotides or polynucleotides, or derivatives thereof
Publication date: 10/09/2008
Patent application number: 20080248969
Sign up to receive free email alerts when patent applications with chosen keywords are published SIGN UP
Abstract:
The present invention provides a method for identifying a set of target
nucleotide sequences capable of identifying a member of a group of
related nucleotide sequences, the method comprising the step of dividing
the nucleotide sequence of each member of the group into a plurality of
subsequences, wherein at least two of the subsequences overlap. The
method is useful in generating probe sets capable of assigning alleles at
HLA or KIR loci.Claims:
1. A method for identifying a set of target nucleotide sequences capable
of identifying a member of a group of related nucleotide sequences, the
method comprising the step of dividing the nucleotide sequence of each
member of the group into a plurality of subsequences, wherein at least
two of the subsequences overlap.
2. A method according to claim 1 wherein at least three of the subsequences overlap with each other.
3. A method according to claim 1 wherein at least four of the subsequences overlap with each other.
4. A method according to claim 1 wherein at least five of the subsequences overlap with each other.
5. A method according to claim 1 wherein the overlap is complete overlap.
6. A method according to claim 1 comprising the step of analyzing at least a portion of the subsequences for redundancy.
7. A method according to claim 1 wherein one or more of the subsequences does not contain one or more polymorphic sites at, or toward, the 5' and/or 3' ends of the one or more subsequences.
8. A method according to claim 1 wherein one or more of the subsequences contains one or more polymorphic sites at, or toward, the center of the one or more subsequences.
9. A method according to claim 1 wherein one or more of the subsequences contain one polymorphic site at the center of the one or more subsequences.
10. A method according to claim 1 wherein the related sequences differ by the presence of one or more nucleotide polymorphisms.
11. A method according to claim 10 wherein the nucleotide polymorphisms are single nucleotide polymorphisms.
12. A method according to claim 1 wherein the subsequences are probe-length.
13. A method according to claim 1 wherein the subsequences are from about 10 to about 50 nucleotides in length.
14. A method according to claim 1 wherein the subsequences are from about 15 to about 35 nucleotides in length.
15. A method according to claim 1 wherein the subsequences are about 25 nucleotides in length.
16. A method according to claim 1 wherein all subsequences are of the same or similar length.
17. A method according to claim 1 wherein the related nucleotide sequences have a sequence identity of at least 50%, 60%, 70%, 80%, 90%, 95% or 99%.
18. A method according to claim 1 wherein the related sequences exhibit SNPs at a high density.
19. A method according to claim 1 wherein the related sequences are protein coding, non-coding, or a combination of protein coding and non-coding.
20. A method according to claim 1 wherein the related sequences are directed to the same region of a genome.
21. A method according to claim 1 wherein the related nucleotide sequences are alleles of a gene.
22. A method according to claim 1 wherein the number of related nucleotide sequences in the group of related nucleotide sequences is more than 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000.
23. A method according to claim 1 wherein the related nucleotide sequences are part of a gene locus involved in the immune system.
24. A method according to claim 23 wherein the locus is a locus of the Major Histocompatability Complex (MHC), the T-cell receptor, the B-cell receptor, the Killer Inhibitory Receptor, or an immunoglobulin.
25. A method according to claim 23 wherein the locus is a locus of the Human Leukocyte Antigen (HLA) system.
26. A method according to claim 23 wherein the wherein the locus is a Class I or Class II MHC transmembrane protein.
27. A method according to claim 23 wherein the locus is a DR, DQ or DP locus.
28. A method according to claim 6 comprising removal or non-inclusion of at least one redundant sequence from the set of target nucleotide sequences.
29. A method according to claim 28 wherein the method reduces the number of sequences in the set of target nucleotide sequences by a multiple of at least about 5, 10 or 20 from the number of probes expected by theory.
30. A method according to claim 28 wherein the method reduces the probe number by at least about 50%, 60%, 70%, 80%, 90% or 95%.
31. A method according to claim 28 wherein substantially all redundant sequences are removed, or are not included, in the probe set.
32. A method according to claim 1, wherein the method is amenable to automation.
33. A method according to claim 1, wherein the method is capable of identifying new polymorphic sites, or new combinations of polymorphic sites in the related sequences.
34. A probe set capable of specifically hybridizing to target nucleotide sequences identified by a method according to claim 1.
35. A probe set according to claim 34 wherein at least one probe comprises a label selected from the group consisting of Cy5, Cy3, FITC, rhodamine, biotin, DIG and a radioisotope.
36. A solid matrix including an immobilized probe set according to claim 34.
37. A solid matrix according to claim 36, wherein the solid matrix is a microarray chip.
38. A method of identifying a member of a group of related nucleotide sequences using a probe set according to claim 34.
39. A method according to claim 38 comprising the step of recovering a member of a group of related nucleotide sequences using a probe set according to claim 34.
40. A method according to claim 39 comprising the steps of exposing the probe set to the group of related nucleotide sequences under conditions allowing a probe of the probe set to bind to a nucleotide sequence of the group of related nucleotide sequences to form a probe/nucleotide sequence complex, and substantially isolating the probe/nucleotide sequence complex.
41. A method of definitive allele assignment comprising use of a probe set according to claim 34.
42. A method of transplantation tissue typing based on the HLA system comprising use of a probe set according to claim 34.
43. A method of identifying a new allele comprising use of a probe set according to claim 34.
44. A computer executable code capable of executing a method according to claim 1.
45. A method according to claim 1 substantially as herein before described with reference to any of the Figures or Examples.
Description:
FIELD OF THE INVENTION
[0001]The present invention is directed to the field of molecular biology. More specifically the invention is directed to methods for generating oligonucleotide probes and uses thereof in identifying members of a group of related nucleotide sequences. The methods and probes may be used in identifying an allele of a gene in an individual.
BACKGROUND TO THE INVENTION
[0002]The Human Genome Project has highlighted the importance of single nucleotide polymorphisms (SNPs) in the genome. These polymorphisms occur on average every 100 to 300 bases throughout the genome. While the genes of all humans are known to be more than 99% identical, it is presence of SNPs that provide a major component of genetic diversity in a species. Different alleles of a gene can confer very different phenotypes on an individual including characteristics as diverse as disease resistance, the ability to respond to a pharmaceutical compound, sporting ability and the like.
[0003]Plant genomes also contain SNPs that can result in different characteristics. SNPs are increasingly becoming the marker of choice in genetic analysis and are used routinely as markers in agricultural breeding programs. SNPs cannot only be used to link a particular genotype to phenotype. They can also be used as a "fingerprint" in identifying organisms as diverse as bacteria, viruses and the like.
[0004]The ability to ascribe a genotype to an individual is of significance for a number of reasons. As a broad concept this involves identification of a nucleotide sequence of a subject gene of the organism involved. The most direct manner of providing this information is to sequence the subject gene. While automated sequencing has been possible for some years, the process is still time intensive and expensive.
[0005]As a result of the limitations to the widespread use of direct sequencing, a number of indirect methods have been advanced to identify alleles. One of the simplest is the use of Restriction Fragment Length Polymorphism (RFLP). This approach relies on the specificity of restriction endonucleases for certain nucleotide sequences. Thus, if a certain sequence is present, the endonuclease will cleave the polynucleotide, and if not no cleavage will result. Different genotypes are detected by the different pattern of restriction fragments, as detected by gel electrophoresis. The disadvantage of this method is that where there is no endonuclease specific for each and every SNP in the range of alleles, then all alleles will not be identifiable by RFLP. This is often the case, and so use of RFLP is significantly limited.
[0006]Another method to detect an allele involves the use of an oligonucleotide probe that binds specifically to sequences found in one allele, but not to other alleles. Binding of the probe to a target allele may be detected by the use of tags such as fluorescent compounds or radioisotopes. A problem of oligonucleotide probe-based methods is that to definitively ascribe a genotype it may be necessary to use a very large number of probes. Since the biophysics of polynucleotide hybridization dictate that probe length is limited (typically no more than about 65 nucleotides), where the subject gene is longer than the maximum probe length a series of different probes must be designed to cover the entire length of the gene. The number of different probes escalates greatly where the subject gene has a large number of alleles, a large number of SNPs, where the density of SNPs is high, or a combination of any of these factors.
[0007]An example of a problem in the art is the human leukocyte antigen HLA-DRB locus that is often analysed in tissue typing for organ transplantation. The locus currently has 483 identified alleles, and there are 270 nucleotides in the variable 2nd exon. Simple multiplication produces 130,410 different nucleotide sequence variations for probes that would be required to resolve a genotype at this locus. Generating such a large number of different oligonucleotide probes, and then assessing the ability of each probe to hybridise to a test sample, is clearly a significant burden. Furthermore, previously unrecognised alleles continue to be discovered thereby exacerbating the problem of providing a probe set capable of resolving an individual's HLA type.
[0008]The problems inherent in using large numbers of probes has been partially overcome by advances in solid-phase technologies that allow binding of many thousands of probes to "chips" to form a "microarray". However, microarray technology still requires the use of many probes to identify all alleles of a gene and simply provides a more convenient format for handling large probe sets. Current probes for SNP detection are directed to physically separate regions of the target DNA molecule, and often selected where the sequence flanking the SNP is monomorphic. Use of probes such as this is known in the art as "resequencing".
[0009]Resequencing relies on the use of specifically designed probes capable of identifying all possible SNPs. Guo et al (2002, Genome Research 12:447-457) address the problem of providing probes for HLA-typing by making 20-mer probes, with each probe designed to represent particular combinations of SNPs, rather than a single SNP. A problem with this approach is that it is not systematic, and it is necessary for a human to judiciously design the probes. Given the real possibility of error in this process it remains an uncertainty whether the probe set will identify all alleles at the end of the probe design process.
[0010]A further problem with the method provided by Guo et al is that it is necessary to include SNP sites over the length of the probe. Consideration of Table 1 of Guo et al shows that polymorphic sites are present from the 5' end to the 3' end of the 20-mer probes. It is known in the art that the accuracy of hybridization diminishes toward the flanks of a probe, and so it would be expected that there will be inaccuracies in the hybridization reactions using the method of Guo et al. Of particular note the probe set designed by Guo et al resulted in 32 false positive reactions among 100 hybridizations.
[0011]Accordingly, it is an aspect of the present invention to overcome or alleviate a problem of the prior art by providing a systematic method for designing probe sets capable of robustly identifying all known polymorphisms in a nucleotide sequence.
[0012]The discussion of documents, acts, materials, devices, articles and the like is included in this specification solely for the purpose of providing a context for the present invention. It is not suggested or represented that any or all of these matters formed part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.
SUMMARY OF THE INVENTION
[0013]In a first aspect the present invention provides a method for identifying a set of target nucleotide sequences capable of identifying a member of a group of related nucleotide sequences, the method comprising the step of dividing the nucleotide sequence of each member of the group into a plurality of subsequences, wherein at least two of the subsequences overlap. Applicants have found that it is possible to identify a set of target nucleotide sequences useful as targets for hybridization with oligonucleotide probes by dividing the sequences under consideration into overlapping subsequences. Preferably, at least one of the subsequences overlaps with more than one other subsequence. More preferably, at least one of the subsequences overlaps with more than 2, 3, 4 or 5 other subsequences.
[0014]Advantageously, the method is amenable to automation and is proposed to be useful for providing probes capable of resolving genes having a high number of alleles and/or a high density of SNPs such as those of the major histocompatability complex (MHC), the T-cell receptor, the B-cell receptor, immunoglobulins, the killer inhibitory receptor (KIR), and the like.
[0015]In one embodiment of the method, the number of probes required for the application can be significantly reduced by identifying redundant probes, and removing or not including the redundant probes in the probe set. It has not been appreciated in the art that when analyzing related sequences for the purposes of designing a set of oligonucleotide probes, a polymorphism in one member sequence is not necessarily present in another member sequence. Accordingly, it is unnecessary to provide probes covering every combination of every polymorphism, since not all combinations necessarily exist in the group of related sequences.
[0016]In another embodiment of the method, one or more of the subsequences (and any probes derived from the subsequences) does not contain one or more polymorphic sites at, or toward, the 5' and/or 3' ends of the one or more subsequences. In another embodiment of the method one or more of the subsequences contains one or more polymorphic sites at, or toward, the center of the one or more subsequences. The avoidance of polymorphic sites toward the flanks of the probe, and concentrating the sites to the centre of the probe overcomes the problem of probes provide by Guo et al (2002) that apparently bind inaccurately such that a large number of false positive hybridization reactions are generated.
[0017]In another aspect the present invention provides a set of probes capable of specifically hybridizing to target nucleotide sequences identified by the methods described herein. Preferably, the probes are directed tomulti-exon coverage and are capable of providing total allele assignment.
[0018]In another aspect the present invention provides a method of identifying and/or recovering a member of a group of related nucleotide sequences using a set of probes as described herein. The method will typically utilise probes immobilised on microarray chip.
[0019]In another aspect the present invention provides a computer executable program (software) capable of executing the methods described herein.
BRIEF DESCRIPTION OF THE FIGURES
[0020]FIG. 1 shows hypothetical application of the method of selecting a probe set. In this case, there are three related 19-mer sequences (#1, #2 and #3). Taking the first nucleotide in the exon as 1 (i.e. the 5th nucleotide in), the exon has two SNPs at positions 6 and 11 (underlined). FIG. 1A shows the related sequences divided into 9-mer subsequences, with complete overlap between the subsequences. FIG. 1B shows all subsequences pooled from related sequences #1, #2 and #3. FIG. 1C shows the set of subsequences from FIG. 1B after removal of redundant subsequences. It is emphasized that this hypothetical example does not necessarily show all the advantages of the invention, but is intended to demonstrate only the operation of a preferred form the method.
[0021]FIG. 2 shows probe sequences identified by the present invention for assignment of HLA-A*0201 (exons 2 and 3). A 25-mer probe length was chosen, with maximal overlap between probes.
DETAILED DESCRIPTION OF THE INVENTION
[0022]Applicants propose a systematic method for designing probes capable of identifying the member of a group of related nucleotide sequences. Accordingly, in a first aspect the present invention provides a method for identifying a set of target nucleotide sequences capable of identifying a member of a group of related nucleotide sequences, the method comprising the step of dividing the nucleotide sequence of each member of the group into a plurality of subsequences, wherein at least two of the subsequences overlap.
[0023]Applicants have found that it is possible to identify a set of target nucleotide sequences useful for hybridization with oligonucleotide probes by dividing the sequence under consideration into overlapping subsequences. Thus, the related group of subsequences may cover a particular locus, with each member of the related group having a different nucleotide sequence. In one form of the present method, each member of the group of related sequences is divided into a number of subsequences. Within a given member sequence, the subsequences overlap each other such that a potentially large number of subsequences may be generated. This approach is clearly distinguished from methods of the prior art that are based on the use of consecutive subsequences.
[0024]Preferably, at least one of the subsequences overlaps with more than one other subsequence. More preferably, at least one of the subsequences overlaps with more than 2, 3, 4 or 5 other subsequences.
[0025]The degree of overlap used to generate the series of overlapping probe-length subsequences may be the minimum possible. An example of minimum overlap for a series of 25-mer subsequences would be where the first subsequence covers nucleotides 1 to 25, the second subsequence covers nucleotides 25 to 50, the third subsequence covers nucleotides 50 to 75, et cetera.
[0026]The overlap may be the maximum degree of overlap possible. An example for a series of 25-mer subsequences having the maximum possible overlap would be where the first subsequence covers nucleotides 1 to 25, the second subsequence covers nucleotides 2 to 26, the third subsequence covers nucleotides 3 to 27, et cetera.
[0027]The invention includes any intermediate degree of overlap between the minimum and maximum available. However, the use of substantially maximum overlap is preferred since this requires the least amount of judgement on the part of the individual designing the probe set. The higher the degree of overlap used, the greater the ability to cover more combinations of SNPs present in the related sequences.
[0028]It is not necessary for the amount of overlap to be fixed for the use of the method with any given member of the group. It is also not necessary for the length of the subsequence to be fixed. It will be possible for the skilled person to routinely investigate the effects of varying subsequence lengths and degree of overlap between the subsequences to ascertain whether any advantage is gained.
[0029]It will be understood that where a high degree of overlap is used, a very large number of subsequences will be generated. Accordingly, a very large number of probes will be included in the probe set. While microarray chips are able to carry large numbers of probes, for economic reasons at least it is desirable to limit the number of probes required for a given analysis. In one embodiment of the method, the number of probes required for the application can be significantly reduced by identifying redundant probes, and removing or not including the redundant probes in the probe set. It has not been appreciated in the art that when analyzing related sequences for the purposes of designing a set of oligonucleotide probes, a polymorphism in one member sequence is not necessarily present in another member sequence. Accordingly, it is unnecessary to provide probes covering every combination of every polymorphism, since not all combinations necessarily exist in the group of related sequences. This approach is especially useful where the related sequences are highly polymorphic, and the present state of the art predicts that a larger-than-necessary number of probes are required to identify all theoretical members of the group. Thus, in a preferred embodiment, the method includes the step of analyzing at least a portion of the subsequences for redundancy and removing at least a proportion of any subsequences identified as redundant.
[0030]Decreasing the level of redundancy may be achieved using a subtractive approach by, for example, assuming that all polymorphisms are present in all members of the group, and generating a plurality of subsequences based on that assumption. Subsequently, the plurality of subsequences is analyzed for the presence of redundant sequences, which are then removed to leave the set of unique target nucleotide sequences. It will be appreciated that the set of target nucleotide subsequences has the same capability of identifying every member of the group as the larger set of subsequences that are generated on the assumption that all polymorphisms are present in all members.
[0031]Alternatively, an additive method may be used where the plurality of probe-length sequences is incrementally generated, one by one, with each newly generated subsequence being analyzed for redundancy in light of all previously generated subsequences. If a newly generated subsequence is found to be redundant it is not added to the set of target nucleotide sequences, otherwise it is included in the set of target nucleotide sequences. Whether an additive or subtractive method is used, the end result is the same: a set of subsequences having no redundancy, or a reduced level of redundancy, is generated that is capable of identifying all members of the group of related sequences.
[0032]It is desirable to limit the number of probes required to identify a member sequence for a number of reasons. The cost of synthesizing probes and producing microarray chips to carry those probes is a significant consideration in the economic viability of implementing a method for identifying a nucleotide sequence. This is the case whether it is for purely research purposes, or for a high throughput commercial application such as in a pathology laboratory. Particularly, where a nucleotide sequence can have many alternative forms (i.e. where the number of members in the group of related sequences is high), the prior art methods require a commensurately high number of different specific probes. Thus, to screen for the presence of a single member nucleotide sequence it may be necessary to use hundreds, or even thousands of individual probes depending on the length of the sequence to be interrogated.
[0033]Another reason for limiting the number of probes necessary for identifying a member nucleotide sequence relates to the practical limits of certain probe hybridization methods. For example, a standard dot blot apparatus may have only 64 wells for sample application, thereby restricting the user to only 64 different probes, and therefore the ability to identify only 64 different nucleotide sequences per run. A further example is where a microarray system is used to identify a very large number of alternative forms of a nucleotide sequence. At present, a standard microarray chip can hold up to 500,000 different oligonucleotide probes. While this may appear to be ample, for some applications this number is insufficient and it would be necessary to prepare multiple chips to accommodate all probes.
[0034]In one embodiment of the method, one or more of the subsequences (and any probes derived from the subsequences) does not contain one or more polymorphic sites at, or toward, the 5' and/or 3' ends of the one or more subsequences. In another embodiment of the method one or more of the subsequences contains one or more polymorphic sites at, or toward, the center of the one or more subsequences. The avoidance of polymorphic sites toward the flanks of the probe, and concentrating the sites to the centre of the probe overcomes the problem of probes provide by Guo et al (2002) that apparently bind inaccurately such that a large number of false positive hybridization reactions are generated.
[0035]The related nucleic acid sequences can be genomic, RNA, cDNA, or cRNA. Genomic DNA samples are usually subject to amplification before application to an array using primers flanking the region of interest. Genomic DNA can be obtained from virtually any tissue source (other than pure red blood cells). For example, convenient tissue samples include-whole blood, semen, saliva, tears, urine, fecal material, sweat, buccal, skin and hair. Amplification of genomic DNA containing a polymorphic site generates a single species of target nucleic acid if the individual from the sample was obtained is homozygous at the polymorphic site or two species of target molecules if the individual is heterozygous.
[0036]The DNA may be prepared for analysis by any suitable method known to the skilled artisan, including by PCR using appropriate primers. Where it is desired to analyze the entire genome, the method of whole genome amplification (WGA) may be used. Commercial kits are readily available for this method including the GenoPlex® Complete WGA kit manufactured by Sigma-Aldrich Corp (St Louis, Mo., USA). This kit is based upon random fragmentation of the genome into a series templates. The resulting shorter DNA strands generate a library of DNA fragments with defined 3 primed and 5 primed termini. The library is replicated using a linear, isothermal amplification in the initial stages, followed by a limited round of geometric (PCR) amplifications. WGA methods are suitable for use with purified genomic DNA from a variety of sources including blood cards, whole blood, buccal swabs, soil, plant, and formalin-fixed paraffin-embedded tissues.
[0037]mRNA samples are also often subject to amplification. In this case amplification is typically preceded by reverse transcription. Amplification of all expressed mRNA can be performed as described in WO 96/14839 and WO 97/01603. Amplification of an RNA sample from a diploid sample can generate two species of target molecule if the individual from whom the sample was obtained is heterozygous at a polymorphic site occurring within expressed mRNA.
[0038]As will be apparent, the nucleotide subsequences identified by the method may be subsequently used to design a probe set capable of identifying all currently identified members of the group of related sequences. As used herein the term "target nucleotide sequence" means a sequence against which a substantially specific probe may be generated. The generation of probes is discussed further infra, however the probe is typically an oligonucleotide probe capable of hybridizing to the target nucleotide sequence.
[0039]Applicants have found that even where the group of related sequences has a large number of members, and/or where the members have a large number of polymorphic bases, and/or where the polymorphic bases have more than two alternative forms, it is possible to produce a probe set capable of definitively identifying any member of the group using a number of probes significantly less than that previously considered in the art to be necessary. The method may be used, for example, to produce a probe set capable of identifying any given allele of a gene locus, and is especially useful where the number of alleles is very high. By contrast, Guo et al (2002) do not disclose a practical and robust method for designing probes for multi-exon coverage capable of providing total allele assignment.
[0040]The skilled person will understand that the length of the probe-length subsequences may be any length that provides the ability to discriminate between the members of the group of related sequences.
[0041]Probes used for microarray applications are typically about 25 nucleotides in length, however longer and shorter probes are contemplated to be useful in the context of the invention. A lower useful length may be determined by the need for sufficient nucleotides to provide specificity of binding, and may be from about 10 nucleotides to about 15 nucleotides. Probes of a less than 15 nucleotides could be contemplated where a "sub-genome" is under test. An example of this is where single haploid chromosomes are under test, and sequence detection specificity does not require a probe length needed to analyze the approximately 3 billion nucleotides in the entire genome of a human. The upper limit may be determined by physical constraints relating to the need to melt double-stranded regions and anneal single strands of polynucleotide. This may be from about 30 to about 50 nucleotides. The upper limit may vary according to the proportion of C/G bases given the higher melting temperatures needed to separate these bases in a duplex, as compared with an A/T pairing. While there may be practical upper and lower limits for the length of probe, these limits will vary according to the specifics of the application and the skilled person will be able to identify the probe of most appropriate length by routine empirical experimentation.
[0042]It will be understood that the method may be applied to any situation where it is necessary to discriminate between a number of related nucleotide sequences. As used herein, the term "nucleotide sequence" and variations thereof is intended to include deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) sequences. The related nucleotide sequences may be any group of nucleotide sequences that exhibit a minimum level of sequence identity. Preferably the sequences have an identity of at least 50%, 60%, 70%, 80%, 90%, 95% or 99%. The identity may be even higher than 99% where, for example, the related sequences are long, and there are a series of SNPs scattered throughout.
[0043]The related sequences may be protein coding, non-protein coding, or a combination of protein coding and non-protein coding.
[0044]The related sequences may be derived from diploid, haploid, triploid or polyploid material, or provide information on the diploid, haploid, triploid or polyploid state.
[0045]Where information is sought on the haploid state, the present methods are useful for providing probes that can provide definitive DNA allele assignment to haplotype stratification. The concept of locus allelism is known in the art, however it has not previously been appreciated that allelism of loci that bound regions, including alleles that involve synonymous changes, are contributory to haplotype stratification. Thus, probes for genomic (diploid) DNA can inform about haplotypic (cis phase) multi-allele assignment. Specifically, synonymous alleles are a unit in multilocus chromosomal haplotypic segment. Probes generated by the methods described herein that characterise locus allelism contribute to revelation of patterns of multilocus co-allelism, which is haplotypy. This concept is exemplified by telomeric G and F loci. There are 23 alleles at HLA-G and 20 at HLA-F. These 43, combined with the 120 at centromeric DPB1 locus, as well as those many in between will assist in assigning the finite multi-locus allelic variations as haplotypes spanning the <4 Mb MHC region.
[0046]The related sequences may be natural or synthetic. They may be from any organism including an animal, plant, microorganism, bacterium, or virus.
[0047]In one form of the invention, the related sequences are directed to the same region of the genome. For example, the region from the first nucleotide of an exon to the last nucleotide of the exon. In this case, and where a 25-mer probe is to be used, the probe may be designed such that the 13th nucleotide of the probe (i.e. the central nucleotide) is directed to the first nucleotide of the exon. Thus, where the first nucleotide is G, the 13th nucleotide of the probe will be C. It will be apparent that the flanking 12-mer regions of the probe will be directed in one case to the pre-exon region and in the other case, further into the exon.
[0048]The general operation of one embodiment of the method can be demonstrated by consideration of the greatly simplified example shown in FIG. 1. This demonstration is directed to 3 related nucleotide sequences (#1, #2 and #3), with the exon starting at the 5th nucleotide in from the left hand or 5' end (i.e. A). Taking the first nucleotide in the exon as 1, the exon has two SNPs at positions 6 and 11 (underlined). Subsequences of 9 nucleotides were used, with there being complete overlap in the subsequences. Thus, the first subsequence commences at position -4 and terminates at position +5.
[0049]As will be apparent from FIG. 1A, each related sequence is divided into 11, 9-mer subsequences. This provides a total of 33 subsequences (FIG. 1B). Duplicate subsequences are removed to leave 17 unique subsequences (FIG. 1C). The skilled person will understand that the probe sequences do not need to be complimentary if the original target molecule was a double-stranded molecule. In that case, the nucleotide sequence can be directly used as the probe sequence or complimented to ACAGGGGTGTCGTGCAAAGMCCTC, depending on the target generation strategy chosen by the skilled artisan. Thus, the probe can be directed to either strand, or both, on the array if dsDNA is used in final target generation).
[0050]It should be appreciated that this example is provided simply to demonstrate the steps required to generate a probe set capable of distinguishing the members of a group of related nucleotide sequences according to one form of the present invention. In this case, a reduction in probe number of about 50% is achieved. In more complex systems, the reduction in probe number will be significantly greater, possibly in excess of 95%.
[0051]The methods of the present invention will allow analysis of many variations in nucleotide sequences including deletions, substitutions, additions and the like. In one form of the invention the related nucleotide sequences are identical except for the presence of SNPs.
[0052]While the SNPs may be present at any density, the methods provide greater advantages where the SNPs are present at a high density. Preferably the density is such that two or more SNPs are present within a probe length region of the nucleotide sequence. The ability to distinguish related nucleotide sequences that include SNPs at high density has previously been problematic since it has hitherto been thought necessary to provide a large number of probes to cover every combination of SNPs in a given region. This has especially been an issue in designing probe sets for HLA typing where 20% to 50% of the nucleotides in HLA exons are polymorphic, and often the polymorphic sites are clustered. This has resulted in the prior art predicting that a practically infeasible number of different probes would be required to definitively ascribe an HLA type to an individual.
[0053]It will be clear that while the number of related nucleotide sequences in the group may be as low as two, the method provides an increased advantage where the number of related nucleotide sequences is high. In a preferred form of the method the number of related nucleotide sequences in the group of related nucleotide sequences is more than 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000. The present invention is particularly applicable where the number of related nucleotide sequences is high and the density of SNPs is high.
[0054]In a preferred form of the method, the related nucleotide sequences are alleles of a gene. It is known that a human gene encoding the same protein may have different sequences (alleles) in different individuals. The proportion of the gene analyzed can be any proportion capable of providing allele-specific information. For example, polymorphic sites are often distributed non-randomly across the length of exons. Thus it may be necessary to direct probes only to certain discrete regions of a gene.
[0055]While most genes have only several alleles, some genes have a very high number. Examples of genes having high numbers of alleles are mainly those involved in the immune system, where hypervariability is a common feature. Exemplary genes include those of the major histocompatability complex (MHC), the T-cell receptor, the B-cell receptor, immunoglobulins, the killer inhibitory receptor (KIR), and the like. It will be understood however, that the methods described herein will be useful for any group of related nucleotide sequences, but that a greater advantage is gained where the related nucleotide sequences are hypervariable. A greater advantage still is provided where the hypervariability exits as high density SNPs.
[0056]As mentioned supra, MHC genes are extremely polymorphic. Class I and II MHC transmembrane proteins make up the Human Leukocyte Antigen (HLA) system that is used in tissue typing for the purposes of assessing transplant compatibility. Class I proteins are encoded by three loci: HLA-A, HLA-B and HLA-C that currently recognize 309, 563 and 167 alleles respectively.
[0057]Class II proteins have an alpha and beta chain, and are encoded by the loci DR, DQ and DP. The DR loci comprise 3 alleles for alpha and 483 for the beta chain. The DQ loci comprise 25 alleles for alpha and 56 for beta. The DP loci comprise 20 alleles for alpha and 107 for beta. It will therefore be noted that for the Class I region alone, there are many combinations of alleles that provide the HLA type of an individual.
[0058]Historically, HLA-based tissue typing was performed serologically using antibodies specific for those HLA antigens that have been identified in the human population. Most HLA typing is now performed by DNA methods, for high level allele assignment by sequencing, or sequence-equivalent methods. Such DNA typing, promises to improve the sensitivity and specificity of tissue typing. However, a problem with attempting to identify all HLA alleles by DNA-based methods (involving oligonucleotide sequences as probes) is that a very large number of probes is required to cover all possible alleles. The present invention alleviates this problem by providing probe sets that are manageable in number, while still capable of identifying all known alleles.
[0059]While the HLA-DR beta loci is currently recognized to comprise 483 alleles, it may appear that only 483 probes are necessary (one for each allele) until it is understood that each allele is a unique combination/pattern of SNPs distributed across all exonic nucleotides. The art has generally considered that the presence of even di-allelic SNPs is a significant problem in probe design given that current microarray SNP detection practice in which where a 25-mer oligonucleotide probe is used, the 12-mers flank the 13th position SNP allele. Therefore, where the flanking region(s) are non-monomorphic the art has hitherto thought it necessary to include probes that cover every SNP in every known combination within the 25-mer region even though not all exist in nature. It is accepted in the art that any polymorphic site requires 4 to the power of the number of alleles known to occur at that site. Thus, if the flanking 12-mers encompass two SNPs each, in both flanks, then the number of probes required to type the 13th position SNP is at least 4 to the power of 2=16.
[0060]Applicant's approach is divergent and is based on the recognition that not all sites that are polymorphic in any probe-length subsequence is present in all alleles of a HLA locus.
[0061]Without wishing to be limited by theory in any way, it is proposed that for HLA loci the theoretical possibilities are some 5-20 fold greater than the observed allelic sequences. An example of complex high SNP density loci are the HLA-DRB region loci (Expressed DRB1, DRB3, DRB4, DRB5; pseudogenes-not expressed DRB2, DRB6, DRB7, DRB8, DRB9). There are (some) 483 identified alleles among both categories of genes in this region. There are 270 nucleotides in the variable 2nd exon. Simple multiplication produces 130,410 different probes that would be required to resolve a genotype at this locus. There may be two main reasons for this observation: (i) combinations of SNPs exhibit linkage disequilibrium because they are inherited on chromosomal lengths that ensures non-randomness of SNP association; and (ii) populations have experienced `bottleneck`, resulting in the disappearance of some multi-SNP alleles, and the relative increase in frequency of others, influenced by population genetic factors such as natural selection, propensity for recombination, et cetera.
[0062]The present invention makes it possible to reduce the number of probes necessary for the identification of a genotype in a highly polymorphic system (such as HLA loci) such that all probes required to identify every allele may be immobilized on a single typical microarray chip.
[0063]It will be understood that the final number of probes required to definitively identify an allele will depend on the locus under consideration. However, in a preferred form of the method it is expected that more than a 50%, 60%, 70%, 80%, 90% or 95% reduction in probe number may be possible relative to the theoretical number of probes thought to be necessary.
[0064]While it is contemplated that maximum advantage in terms of minimising probe number will be gained where all redundant subsequences are removed, it is not essential to the invention that all are removed. Indeed, in some instances it is advantageous for some redundancy in subsequences to be maintained, in that an internal quality control mechanism results. Redundancy in the probe set can result from the fact that redundancy occurs across loci. Redundant probes relating to redundancy across loci may therefore be maintained in a probe set provided by the present invention for the purposes of quality control. As an example, where a probe list is generated for the assignment of allele types at HLA Class I and Class II loci and of genes and allele types at the KIR loci, about 34,500 probes are identified. The list identifies variations involving hypervariable exons 2 and 3 at HLA Class I loci (A, B, C) and exon 2 at Class II loci (DRB, DQB, DPB), and all known variations at up to 10 exons at KIR loci. In the list of probes, there are 2167 duplicated sequences due to direct repeats of sequences present when comparing HLA-A, -B, and -C, or DPB, DQB, and DRB, e.g.
TABLE-US-00001 !Probe Tag? Probe Sequence 5522A_E3_232_2_25 TCCGCAGATACCTGGAGAACAGGAA 15458C_E3_232_4_25 TCCGCAGATACCTGGAGAACAGGAA 9492B_E3_13_17_25 TCCAGAGGATGTTTGGCTGCGACCT 13765C_E3_13_10_25 TCCAGAGGATGTTTGGCTGCGACCT 22138R_E2_155_21_25 TGTCGCCGAGTACTGGAACAGCCAG 17957Q_E2_155_9_25 TGTCGCCGAGTACTGGAACAGCCAG 21088R_E2_105_3_25 TTCGACAGCGACGTGGGGGAGTTCC 17442Q_E2_105_3_25 TTCGACAGCGACGTGGGGGAGTTCC 16011P_E2_99_1_25 TTCGACAGCGACGTGGGGGAGTTCC
[0065]Where probes are labelled in the following manner
a=consecutive probe numberF=either A, B, C, P, Q, R, KE=exonc=exon numberd=first base of 25-mer in exone=1-30, 1 is the reference (consensus), unique allele types follow consecutivelyf=probe length.
[0066]The replicate probe sequences are retained in one form of the invention to contribute to both technical and genetic components of quality assurance. Specifically, where there is a bona fide hybridisation with one probe consistent with reactivity to all other probes identifying an allele at the first locus, but in which the same probe sequence is not an integral component of either allele at a second locus, then there will be reactivity in the replicate distinct from those reflecting the alleles at the second locus.
[0067]As an example of the operation of this internal quality control mechanism, the lowest level of resolution is the allele lineage, or family. Considering DRB there are 13 lineages (*01, *03, *04, *07, *08, *09, *10, *11, *12, *13, *14, *15, *16). By including probes for all four DRB expressed loci, the presence or absence of DRB3, DRB4 and DRB5 provides information on the lineage type of DRB1 alleles, independent of DRB1 probe reactivity.
[0068]In the context of the present invention, the term "redundant" is intended to mean that if the sequence is removed from the first set of subsequences there is no appreciable difference in the ability to identify a member of the group of related nucleotide sequences. Redundancy may be considered as complete (i.e. two subsequences are identical in nucleotide sequence) or incomplete (e.g. the two subsequences are physically non-identical, but are functionally identical). Thus, depending on the hybridisation conditions used, two different probes may bind to a single nucleotide sequence and are therefore functionally identical. This would be expected where hybridisation conditions are of a relatively low stringency.
[0069]The non-redundant or reduced redundancy sequences are generated based on the alleles previously identified using DNA sequencing. If a new allele is identified that contains a new polymorphism, then additional target sequences may need to be included in the probe set to ensure detection of that new polymorphism. If the new polymorphism occurs in a target sequence that was previously found to be redundant, then in light of the knowledge of the new polymorphism, that target sequence becomes necessary as a probe target and therefore non-redundant.
[0070]In one form of the method, the method is amenable to automation. Methods of the prior art such as Guo et al (2002) design probes based on the careful consideration of all related nucleotide sequences in an effort to identify probes that cover all observed combinations of SNPs. This is of course very labour intensive, and the success or failure dependant on the expertise of the individual performing the analysis. The task of designing probes may become practically infeasible if the number of related sequences is very large, or the number of alleles is very large. By contrast, the present methods are particularly amenable for implementation on a computer in the form of software-based probe set design.
[0071]The method may include a combination of different subsequence lengths and different levels of overlap between the subsequences. In a highly preferred form of the invention the subsequence is about 25 nucleotides in length, and the degree of overlap is maximal.
[0072]The related sequences may include sequences from all known alleles of a gene. Alternatively, the related sequences may include known and hitherto unknown sequences. For example, it may be known that a polymorphism is found at a given position in a gene, and that the position can have one of two alternative forms (e.g. A or T). It will be possible to include "hypothetical" sequences where a G or C is present in that position. Alternatively, where a given position is not known to have any polymorphisms but is suspected to, probes directed to the three alternative forms may be included in the probe set. Furthermore, the invention will allow the detection of new combinations of SNPs that result in a new allele. These approaches are very probe-demanding, and use of the present invention makes it practically feasible given the vast reduction in probe numbers required. The chance for finding new alleles will be greater where maximum overlap between the subsequences is used.
[0073]It will be appreciated that the presence of a hitherto unrecognised allele may also be discovered by the internal quality control mechanisms as discussed supra. Probe reactivity discordance with known alleles will signal the presence of either an error in assay, or the presence of a new allele.
[0074]As discussed supra, the allele analysed may be directed to protein-coding regions exclusively, or noncoding regions exclusively. Alternatively, a combination of noncoding and protein-coding regions may be used.
[0075]In another aspect the present invention provides a set of probes capable of specifically hybridizing to target nucleotide sequences identified by the methods described herein. In one form of the invention, the probe set has a lower level of redundancy than a probe set designed by methods known in the art.
[0076]Given the target subsequences, the skilled person will be capable of synthesizing probes capable of hybridising with each target subsequence. The probes are substantially complimentary to the non-redundant sequences identified. The probes may be sense or antisense if the target is generated from a double stranded template. The probes can be made by any method known to the skilled artisan, although the final use of the probes will likely dictate the most appropriate method. For example where the probes are for use in a microarray environment, they may be synthesized in situ on the glass or nylon wafer forming the array solid support matrix. For other applications, the probes may be synthesized on an automated apparatus such as the Beckman 1000M DNA synthesizer and subsequently used for methods such as PCR to detect an allele. Alternatively, the probe may be coupled to a solid support after manufacture.
[0077]It is well within the ability of the skilled person to investigate whether any advantage is gained by the use of modified nucleotides in probes designed by the instant methods, such as locked nucleic acids.
[0078]For the purposes of quality assurance, the probe set optionally includes a paired "mismatch" probe for each probe on the array that perfectly matches its target sequence. The mismatch probe contains a single mismatch located directly in the middle of the 25-base probe sequence. While the perfect match probe provides measurable fluorescence when sample binds to it, the paired mismatch probe is used to detect and eliminate any false or contaminating fluorescence within that measurement. The mismatch probe serves as an internal control for its perfect match partner because it hybridizes to non-specific sequences about as effectively as its counterpart, allowing spurious signals, from cross hybridization for example, to be efficiently quantified and subtracted from a gene expression measurement or genotype call.
[0079]The probe may include a label to facilitate detection. Exemplary labels include Cy5, Cy3, FITC, rhodamine, biotin, DIG and various radioisotopes.
[0080]A probe sequence list generated according to the present invention can be expanded to include additional allelic variation at other exons within the mRNA transcript, at sequences intervening or flanking the exons, including introns, 5' and 3' untranslated regions, and intergenic regions.
[0081]In another aspect the present invention provides a method of identifying a member of a group of related nucleotide sequences using a set of probes as described herein. One way of achieving this is using microarray technology. Thus, another aspect the invention provides a set of probes as described herein immobilized on a solid matrix. An exemplary embodiment of this form of the invention is found in the GeneChip® technology marketed by Affymetrix®. This technology relies on a photolithographic process by coating a 5''×5'' quartz wafer with a light-sensitive chemical compound that prevents coupling between the wafer and the first nucleotide of the DNA probe being created. Lithographic masks are used to either block or transmit light onto specific locations of the wafer surface. The surface is then flooded with a solution containing either adenine, thymine, cytosine, or guanine, and coupling occurs only in those regions on the glass that have been deprotected through illumination. The coupled nucleotide also bears a light-sensitive protecting group, so the cycle can be repeated. Other methods of immobilizing probes are provided by a number of companies including Oxford Gene Technology (Oxford, U.K.), Agilent Technologies (Palo Alto, Calif., U.S.A.) and Nimblegen Systems Inc (Madison, Wis., U.S.A).
[0082]The probes of the present invention are useful not only for identifying a member of a group of related nucleotide sequences, but also for the recovery of the member so identified. Accordingly, one form of the method further comprises the step of recovering a member of a group of related nucleotide sequences using a probe set as described herein. In the context of the present invention, the term "recover" includes the physical separation of the member identified by (or bound to) a probe forming part of a probe set of the present invention from at least one other member of a group of related nucleotide sequences. Advantageously, the recovered member can be analysed to provide genotypic and/or phenotypic information on the subject from which the member is derived.
[0083]The method may comprise the steps of exposing the probe to the group of related nucleotide sequences under conditions allowing a probe of the probe set to bind to a nucleotide sequence of the group of related nucleotide sequences to form a probe/nucleotide sequence complex, and substantially isolating the probe/nucleotide sequence complex.
[0084]The skilled person is familiar with identifying conditions allowing binding of a nucleic acid probe to a target nucleotide sequence. It is also within the capabilities of the skilled person to identify conditions conducive to the specific binding of a nucleic acid probe to a target nucleotide sequence. Physical parameters of the reaction solution such as temperature, ionic strength and pH may be manipulated such that binding takes place on a specific or non-specific basis.
[0085]The skilled person is also aware of many methods for the substantial isolation of a probe/nucleotide sequence complex. Recovery of molecules using reagents that are chemically reciprocal to the target, such as nucleotide sequence by anti-sense sequence, or vice versa; are well known across many chemistries. Typically, a probe is attached to a solid phase such as a chromatographic matrix, a bead (for example, a magnetic bead), or a planar glass surfaces (such as those used microarray formats, for example SuperEpoxy, SuperAmine, SuperAldehyde and SuperNitro manufactured by Telechem International Inc). The attached probe is then exposed to a solution containing a mixture of nucleic acid sequence fragments, and binding of the probe to nucleic sequence allowed to occur. The probe/nucleic acid sequence complex is then separated from unbound molecules by a suitable method. For example, where the probe is bound to a magnetic bead, the magnetic beads (with at least some having bound nucleic acid sequence fragment) are separated by the application of a magnetic field to the reaction solution.
[0086]It will be understood that in some situations the probe/nucleotide sequence complex can be recovered without attachment of either reactant to a solid phase. For instance, probe/nucleotide sequence complexes may be separated in the fluid phase of electrophoresis. A DNA fragment bound to a probe will migrate at a different rate to a fragment of the same, or similar, electrophoretic mobility.
[0087]Once the probe/nucleotide sequence complex is substantially isolated, the nucleotide sequence may be eluted from the probe. Typically, it is the elution step that is manipulated to increase or decrease the specificity of the probe/nucleotide sequence binding reaction. Elution may be achieved by altering any one of more of the following parameters: temperature, ionic strength and pH. Elution may also be controlled with the use of detergents or other additives.
[0088]The recovered nucleotide sequence may be analyzed by any appropriate method to obtain any required information. The analysis may include any one or more of the following characteristics: nucleotide sequence, AT content, CG content, length, secondary structure, ability to bind to a protein, ability to bind to another nucleic acid sequence, ability to be cleaved by an endonuclease, methylation status, and the like. Typically, however, the analysis will be nucleotide sequence analysis.
[0089]The recovered nucleic acid sequences may be any length, but in some forms of the invention at least 10, 20, 30, 40, 50, 60, 70, 80 or 90 bases long. In other forms of the invention the recovered nucleic acid sequence is at least 100, 200, 300, 400, or 500 bases long.
[0090]The recovered nucleic acid sequence may be used for any reason, however it is typically used for providing genotypic and/or phenotypic information on a subject. The probe sets provided by the present invention are, in some embodiments, capable of binding to every known allele of a given gene. For example, if it is desired to read the nucleotide sequence of a certain fragment of genomic DNA, and that fragment of genomic DNA included a number of sites at which mutations were possible, then that fragment may be recovered from any subject irrespective of the presence or absence of any mutation(s). As discussed supra a particular advantage is gained for the recovery of fragments having a high density of SNPs, such as fragments of HLA-MHC genes, or KIR genes.
[0091]In one embodiment, the method is used for the isolation of exomic nucleic acid sequences from a subject. As is now understood, the proportion of genomic DNA that actually codes for protein is small, and the present invention may be used to extract just that exomic proportion from the whole of a subject's genomic DNA for subsequent analysis. This approach requires significantly less sequence analysis than would be otherwise required where the whole genome is sequenced.
[0092]In another aspect the present invention provides a computer executable program (software) capable of executing the methods described herein. While the present invention may be implemented manually, it is preferably performed on a personal computer under the instruction of appropriate software. Given the disclosure herein, the skilled person will be enabled to write appropriate code to execute the method. Example pseudo-code for the 0101 allele DRB1 locus follows:
TABLE-US-00002 [AWAIT USER INPUT] (IF) Mouse_Click Event detected on the Grid interface; [DETERMINE]grid row and grid column of the Click; /* Since all sequences are displayed in tabular format, they are also stored in tabular format as a memory object according to the following: ReferenceNameArray[position 0] = "DRB10101"; ReferenceBasisArray[position 0] = "TGTCCCCA...."; which in memory forms a tabular structure like this: ReferenceNameArray ReferenceBasisArray Index 0: "DRB01*010101" " TGTCCCCA...." Index 1: "DRB01*010102" " TGTCCCCC...." Index 2: "DRB01*010103" " TGTCCCCC...." */ [DETERMINE] ReferenceBasisArray base range (25 mers) using grid column click value as index. [DETERMINE] ReferenceNameArray using grid row click as index /** how to determine the range of 25? If the ReferenceBasisArray (ie: array of all bases) contains 150 bases, then use the grid column click value to determine the middle point. ie: hence if the user clicks on column 12, then our range becomes, min = middle_point - 12, max = middle_point + 12; **/ [EXTRACT] 25 bases from each ReferenceBasisArray Record (IF) base is different to Reference Record [HIDE/DISCARD] row else [DISPLAY ROW] ------------------------------------------------------
[0093]The software may have the facility to investigate the effects of a range of parameters on the number of probes required to resolve a specific allele. In this way, it may be possible to further decrease the number of probes required. For example, the software may allow the user to define the length of the probe-length subsequence, the degree of overlap of the subsequences, the rules for defining whether two subsequences are redundant and the like. Indeed, the software may include algorithms to automatically trial a range for each parameter to give the lowest number of probe-length subsequences (and therefore the number of probes in the probe set). A probe may also be removed from the probe set if it is considered likely to have significant secondary structure, or too high or too low a melting temperature such that it will not reliably hybridise to the relevant target. A probe may be removed from the probe set on the basis of empirical probe optimisation experiments demonstrating a lack of suitability.
[0094]It will be appreciated that the present invention will have application in a wide range of technical fields. It is anticipated that the field of medicine will gain particular advantage, where the method may be used for genotyping individuals. The methods will be particularly useful in transplantation tissue typing (e.g. using the HLA genes, KIR genes, minor Histocompatability loci, and the like), as well as pharmacogenomics, DNA "fingerprinting" and the like. The probes may be used for any application comprising in situ hybridisation, slot blot, dot blot, colony hybridization, plaque hybridization, Northern blotting, Southern blotting, as well as microarray applications,
[0095]It is anticipated that the invention will be useful in any application where it is necessary or desirable to reduce the number of unique probes required for analysis of a nucleotide sequence, and not only in the area of microarray analysis. The invention will be applicable even where the numbers of probes required to undertake a task in identifying a particular nucleotide sequence amongst a number of others are not so great as to extend beyond the capacity of a chip. Minimisation of probe numbers will allow tests for other loci to be included on the one chip such that an increase number of loci can be tested for on the one chip. It is of course less costly to run one chip as compared with 20.
[0096]It is anticipated that applications will extend to use in non-human animals such as primates, for example in the pre-clinical pharmacogenomic assessments of candidate pharmaceuticals. The invention is also contemplated to be useful for testing of animals having economic importance (such as cattle, poultry and the like), for example in breeding programs to improve parameters such as lean muscle content.
[0097]The present invention will now be further described by reference to the following non-limiting example. The skilled person will understand that the HLA loci are some of the most variable loci found in nature. It will be appreciated that a method able to be operable for an HLA locus, then any other locus will be operable.
EXAMPLE 1
Identification of Oligonucleotide Probe Set for Definitive Genotyping of the HLA-DRB Locus
Outline of Protocol
[0098]The DRB locus of HLA was analyzed by the present methods to identify a probe set capable of identifying any known allele of the locus. The DRB locus has the following known alleles:
DRB1*010101, DRB1*010102, DRB1*010103, DRB1*010201, DRB1*010202, DRB1*010203, DRB1*010204, DRB1*0103, DRB1*0104, DRB1*0105, DRB1*0106, DRB1*0107, DRB1*0108, DRB1*0109, DRB1*0110, DRB1*0111, DRB1*0112, DRB1*0113, DRB1*030101, DRB1*030102, DRB1*030201, DRB1*030202, DRB1*0303, DRB1*0304, DRB1*030501, DRB1*030502, DRB1*0306, DRB1*0307, DRB1*0308, DRB1*0309, DRB1*0310, DRB1*0311, DRB1*0312, DRB1*0313, DRB1*0314, DRB1*0315, DRB1*0316, DRB1*0317, DRB1*0318, DRB1*0319, DRB1*0320, DRB1*0321, DRB1*0322, DRB1*0323, DRB1*0324, DRB1*0325, DRB1*0326, DRB1*0327, DRB1*0328, DRB1*040101, DRB1*040102, DRB1*0402, DRB1*040301, DRB1*040302, DRB1*0404, DRB1*040501, DRB1*040502, DRB1*040503, DRB1*040504, DRB1*0406, DRB1*040701, DRB1*040702, DRB1*040703, DRB1*0408, DRB1*0409, DRB1*0410, DRB1*0411, DRB1*0412, DRB1*0413, DRB1*0414, DRB1*0415, DRB1*0416, DRB1*0417, DRB1*0418, DRB1*0419, DRB1*0420, DRB1*0421, DRB1*0422, DRB1*0423, DRB1*0424, DRB1*0425, DRB1*0426, DRB1*0427, DRB1*0428, DRB1*0429, DRB1*0430, DRB1*0431, DRB1*0432, DRB1*0433, DRB1*0434, DRB1*0435, DRB1*0436, DRB1*0437, DRB1*0438, DRB1*0439, DRB1*0440, DRB1*0441, DRB1*0442, DRB1*0443, DRB1*0444, DRB1*0445, DRB1*0446, DRB1*0447, DRB1*0448, DRB1*0449, DRB1*0450, DRB1*0451, DRB1*0452, DRB1*070101, DRB1*070102, DRB1*0703, DRB1*0704, DRB1*0705, DRB1*0706, DRB1*0707, DRB1*0708, DRB1*0709, DRB1*080101, DRB1*080102, DRB1*080201, DRB1*080202, DRB1*080203, DRB1*080302, DRB1*080401, DRB1*080402, DRB1*080403, DRB1*080404, DRB1*0805, DRB1*0806, DRB1*0807, DRB1*0808, DRB1*0809, DRB1*0810, DRB1*0811, DRB1*0812, DRB1*0813, DRB1*0814, DRB1*0815, DRB1*0816, DRB1*0817, DRB1*0818, DRB1*0819, DRB1*0820, DRB1*0821, DRB1*0822, DRB1*0823, DRB1*0824, DRB1*0825, DRB1*0826, DRB1*0827, DRB1*0828, DRB1*0829, DRB1*090102, DRB1*0902, DRB1*0903, DRB1*0904, DRB1*100101, DRB1*100102, DRB1*110101, DRB1*110102, DRB1*110103, DRB1*110104, DRB1*110105, DRB1*1102, DRB1*1103, DRB1*110401, DRB1*110402, DRB1*1105, DRB1*110601, DRB1*110602, DRB1*1107, DRB1*110801, DRB1*110802, DRB1*1109, DRB1*1110, DRB1*1111, DRB1*111201, DRB1*111202, DRB1*1113, DRB1*1114, DRB1*1115, DRB1*1116, DRB1*1117, DRB1*1118, DRB1*111901, DRB1*111902, DRB1*1120, DRB1*1121, DRB1*1122, DRB1*1123, DRB1*1124, DRB1*1125, DRB1*1126, DRB1*112701, DRB1*112702, DRB1*1128, DRB1*1129, DRB1*1130, DRB1*1131, DRB1*1132, DRB1*1133, DRB1*1134, DRB1*1135, DRB1*1136, DRB1*1137, DRB1*1138, DRB1*1139, DRB1*1140, DRB1*1141, DRB1*1142, DRB1*1143, DRB1*1144, DRB1*1145, DRB1*1146, DRB1*1147, DRB1*1148, DRB1*1149, DRB1*1150, DRB1*1151, DRB1*1152, DRB1*1153, DRB1*1154, DRB1*120101, DRB1*120102, DRB1*120201, DRB1*120202, DRB1*120302, DRB1*1204, DRB1*1205, DRB1*1206, DRB1*1207, DRB1*1208, DRB1*1209, DRB1*1210, DRB1*1211, DRB1*130101, DRB1*130102, DRB1*130103, DRB1*130201, DRB1*130202, DRB1*130301, DRB1*130302 DRB1*1304, DRB1*1305, DRB1*1306, DRB1*130701, DRB1*130702, DRB1*1308, DRB1*1309, DRB1*1310, DRB1*1311, DRB1*1312, DRB1*1313, DRB1*131401, DRB1*131402, DRB1*1315, DRB1*1316, DRB1*1317, DRB1*1318, DRB1*1319, DRB1*1320, DRB1*1321, DRB1*1322, DRB1*1323, DRB1*1324, DRB1*1325, DRB1*1326, DRB1*1327, DRB1*1328, DRB1*1329, DRB1*1330, DRB1*1331, DRB1*1332, DRB1*1333, DRB1*1334, DRB1*1335, DRB1*1336, DRB1*1337, DRB1*1338, DRB1*1339, DRB1*1340, DRB1*1341, DRB1*1342, DRB1*1343, DRB1*1344, DRB1*1345, DRB1*1346, DRB1*1347, DRB1*1348, DRB1*1349, DRB1*1350, DRB1*1351, DRB1*1352, DRB1*1353, DRB1*1354, DRB1*1355, DRB1*1356, DRB1*1357, DRB1*1358, DRB1*1359, DRB1*1360, DRB1*1361, DRB1*1362, DRB1*1363, DRB1*1364, DRB1*1365, DRB1*1366, DRB1*140101, DRB1*140102, DRB1*1402, DRB1*140301, DRB1*140302, DRB1*1404, DRB1*140501, DRB1*140502, DRB1*1406, DRB1*140701, DRB1*140702, DRB1*1408, DRB1*1409, DRB1*1410, DRB1*1411, DRB1*1412, DRB1*1413, DRB1*1414, DRB1*1415, DRB1*1416, DRB1*1417, DRB1*1418, DRB1*1419, DRB1*1420, DRB1*1421, DRB1*1422, DRB1*142301, DRB1*142302, DRB1*1424, DRB1*1425, DRB1*1426, DRB1*1427, DRB1*1428, DRB1*1429, DRB1*1430, DRB1*1431, DRB1*1432, DRB1*1433, DRB1*1434, DRB1*1435, DRB1*1436, DRB1*1437, DRB1*1438, DRB1*1439, DRB1*1440, DRB1*1441, DRB1*1442, DRB1*1443, DRB1*1444, DRB1*1445, DRB1*1446, DRB1*1447, DRB1*1448, DRB1*150101, DRB1*150102, DRB1*150103, DRB1*150104, DRB1*150105, DRB1*150201, DRB1*150202, DRB1*150203, DRB1*1503, DRB1*1504, DRB1*1505, DRB1*1506, DRB1*1507, DRB1*1508, DRB1*1509, DRB1*1510, DRB1*1511, DRB1*1512, DRB1*1513, DRB1*1514, DRB1*1515, DRB1*160101, DRB1*160102, DRB1*160201, DRB1*160202, DRB1*1603, DRB1*1604, DRB1*160501, DRB1*160502, DRB1*1607, DRB1*1608, DRB2*0101, DRB3*010101, DRB3*01010201, DRB3*01010202, DRB3*010103, DRB3*010104, DRB3*0102, DRB3*0103, DRB3*0104, DRB3*0105, DRB3*0106, DRB3*0107, DRB3*0108, DRB3*0109, DRB3*0110, DRB3*0111, DRB3*0201, DRB3*020201, DRB3*020202, DRB3*020203, DRB3*020204, DRB3*0203, DRB3*0204, DRB3*0205, DRB3*0206, DRB3*0207, DRB3*0208, DRB3*0209, DRB3*0210, DRB3*0211, DRB3*0212, DRB3*0213, DRB3*0214, DRB3*0215, DRB3*0216, DRB3*0217, DRB3*0218, DRB3*0219, DRB3*030101, DRB3*030102, DRB3*0302, DRB3*0303, DRB4*01010101, DRB4*0102, DRB4*01030101, DRB4*01030102N, DRB4*010302, DRB4*010303, DRB4*010304, DRB4*0104, DRB4*0105, DRB4*0106, DRB4*0107, DRB4*0201N, DRB4*0301N, DRB5*010101, DRB5*010102, DRB5*0102, DRB5*0103, DRB5*0104, DRB5*0105, DRB5*0106, DRB5*0107, DRB5*0108N, DRB5*0109, DRB5*0110N, DRB5*0111, DRB5*0112, DRB5*0113, DRB5*0202, DRB5*0203, DRB5*0204, DRB5*0205, DRB6*0101, DRB6*0201, DRB6*0202, DRB7*010101, DRB7*010102, DRB8*0101, and DRB9*0101.
[0099]A subsequence length of 25 nucleotides was selected, and maximal sequential overlap was used to provide the series of subsequences. The second exon was chosen as the starting point for the analysis, with the first 25-mer subsequence positioned such that the 13th nucleotide of the subsequence (underlined, see below) aligned with the first base of the second exon. This is shown below using a reference sequence typical of many DRB alleles as follows:
TABLE-US-00003 intron 1 exon 2 . . . GTGTCCCCACAGCACGTTTCTTGTG . . .
Step 1: Defining Subsequences for Selecting Probes Centered on the First Nucleotide of the Second Exon.
[0100]The first subject subsequence is the 25 nucleotide subsequence of the DRB locus about the interface of intron 1 and exon 2. This first subsequence is generated against the first nucleotide in exon 1 (the underlined "C" residue): GTGTCCCCACAGCACGTTTCTTGTG (this sequence is a reference sequence found in 26 alleles).
Step 2: Defining Subsequences for Selecting Probes Centered on the Second Nucleotide of the Second Exon.
[0101]The protocol of step 1 is repeated, except that 25-mer subsequence is centered on the second nucleotide. Again, considering a reference sequence the 25-mer is: TGTCCCCACAGCACGTTTCTTGTGG.
Steps 3 to 284. Defining Subsequences for Selecting Probes Centered on the 3rd to 284th Nucleotide of the Second Exon.
[0102]The protocol of step 1 is repeated for each nucleotide in the exon.
Step 285: Pooling of 25-mer Subsequences
[0103]All 25-mer subsequences for each allele of the locus are combined to form a set of target nucleotide sequences capable of identifying all alleles of the locus.
Step 286: Removal of Redundant Subsequences
[0104]All subsequences are analyzed, and redundant sequences (exact matches) are removed to leave only unique subsequences. It is estimated that if the process was carried out for all 270 nucleotides of the second exon, only about 5,500 unique subsequences would be generated. This is a significant reduction in probe number predicted in the prior art.
EXAMPLE 2
Production of Microarray Chip
[0105]The 5,500 target nucleotide sequences in the pool are synthesized directly onto a microarray chip by Affymetrix Inc who provide a custom gene chip array service.
EXAMPLE 3
Use of Probes to Assign Identify DRB Allele for an Individual
Patient Sample.
[0106]DNA extraction of peripheral blood or buccal smear is standard practice. Approx. 1,000 ng of DNA is recommended for microarray assay.
Long PCR.
[0107]Primers can be located in introns, exons or a combination. For instance, for HLA-DRB typing, primers are selected upstream in intron 1, and downstream in exon 6. The amplicon is approx. 5.1 kb. The disadvantage of using intron sequences as primer sites is that there is usually less sequence data, and absence of data corresponding to exon alleles, than for corresponding exon sequence. For HLA-DRB, published data provides sufficient intron 1 data for primer selection. However, even in this case, further sequencing is near certain to reveal new SNPs. If they occur in the primer sequence, it can be expected to complicate amplification of sequences bearing that new variant. The alternative is to utilise exon sequences since these have been more extensively studied. For HLA-DRB there are sites suitable as primers further upstream, in exon 1, Since amplicons using exon 1 and exon 6 primers span the full length of the 8 kb intron 1, the resulting amplicon is over 13 kb in length. Applicants have confirmed the suitability of the commercial Long PCR kit for amplification of 17 kb, so the exon only primered amplicon is also suitable.
Fragmentation of Amplicons.
[0108]The protocol process is non-specific, resulting in the shearing of the amplicons into fragments of tens to low hundreds of nucleotides required for efficient hybridisation to the chip-adherent probes. Details provided in the following document GeneChip® CustomSeq® Resequencing (Array Protocol) Version 2.0, 701231 Rev. 3; the entire contents of which is incorporated by reference. This document can be obtained from Affymetrix Inc (Technical Support) 3380 Central Expressway Santa Clara, Calif. 95051 U.S.A.
Hybridisation.
[0109]Details are provided in GeneChip® CustomSeq® Resequencing (Array Protocol) Version 2.0, 701231 Rev. 3
Allele Assignment.
[0110]Allele assignment is achieved by relating the probe hybridisation patterns to allele sequence variation by an iterative reduction algorithm (Helmberg W, Lanzer G, Zahn R, Weinmayr B, Wagner T, Albert E. Virtual DNA analysis--a new tool for combination and standardised evaluation of SSO, SSP and sequencing-based typing results. Tissue Antigens. 1998 June; 51(6):587-92.)
EXAMPLE 4
Generation of Probe Set for Assignment of Allele Types at HLA-A*0201 (Exons 2 and 3)
[0111]The following exon sequences of HLA*0201 were used to generate a probe set for assignment of HLA-A*0201. For the purposes of probe generation, the exon sequences were extended by 12 nucleotides in both 5' and 3' directions into the adjacent intronic regions.
TABLE-US-00004 Exon2: GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGC GGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGT GCGGTTCGACAGCGACGCCGCGAGCCAGAGGATGGAGCCGCGGGCGCCGT GGATAGAGCAGGAGGGTCCGGAGTATTGGGACGGGGAGACACGGAAAGTG AAGGCCCACTCACAGACTCACCGAGTGGACCTGGGGACCCTGCGCGGCTA CTACAACCAGAGCGAGGCCG Exon 3 GTTCTCACACCGTCCAGAGGATGTATGGCTGCGACGTGGGGTCGGACTGG CGCTTCCTCCGCGGGTACCACCAGTACGCCTACGACGGCAAGGATTACAT CGCCCTGAAAGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTC AGACCACCAAGCACAAGTGGGAGGCGGCCCATGTGGCGGAGCAGTTGAGA GCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAA CGGGAAGGAGACGCTGCAGCGCACGG
[0112]A subsequence length of 25 was chosen, and maximum overlap utilized.
[0113]Probe sets that are capable of identifying the above hypervariable Exon 2/3 regions are shown in FIG. 2. Where it is desired to identify hypervariable regions other than that shown above, the probe generation process is repeated for each hypervariable region. The redundant probe sequences may then be removed.
[0114]Finally, it is to be understood that various other modifications and/or alterations may be made without departing from the spirit of the present invention as outlined herein.
Sequence CWU
1
582125DNAArtificial SequenceProbe 1acaggggtgt cgtgcaaaga acctc
25225DNAArtificial SequenceProbe
2tccgcagata cctggagaac aggaa
25325DNAArtificial SequenceProbe 3tccgcagata cctggagaac aggaa
25425DNAArtificial SequenceProbe
4tccagaggat gtttggctgc gacct
25525DNAArtificial SequenceProbe 5tccagaggat gtttggctgc gacct
25625DNAArtificial SequenceProbe
6tgtcgccgag tactggaaca gccag
25725DNAArtificial SequenceProbe 7tgtcgccgag tactggaaca gccag
25825DNAArtificial SequenceProbe
8ttcgacagcg acgtggggga gttcc
25925DNAArtificial SequenceProbe 9ttcgacagcg acgtggggga gttcc
251025DNAArtificial SequenceProbe
10ttcgacagcg acgtggggga gttcc
251125DNAArtificial SequenceTypical Reference Sequence for DRB allele
11gtgtccccac agcacgtttc ttgtg
251225DNAArtificial SequenceTarget Sequence 12gtgtccccac agcacgtttc ttgtg
251325DNAArtificial
SequenceTarget Sequence 13tgtccccaca gcacgtttct tgtgg
2514270DNAHomo sapiens 14gctcccactc catgaggtat
ttcttcacat ccgtgtcccg gcccggccgc ggggagcccc 60gcttcatcgc cgtgggctac
gtggacgaca cgcagttcgt gcggttcgac agcgacgccg 120cgagccagag gatggagccg
cgggcgccgt ggatagagca ggagggtccg gagtattggg 180acggggagac acggaaagtg
aaggcccact cacagactca ccgagtggac ctggggaccc 240tgcgcggcta ctacaaccag
agcgaggccg 27015270DNAHomo sapiens
15gctcccactc catgaggtat ttcttcacat ccgtgtcccg gcccggccgc ggggagcccc
60gcttcatcgc cgtgggctac gtggacgaca cgcagttcgt gcggttcgac agcgacgccg
120cgagccagag gatggagccg cgggcgccgt ggatagagca ggagggtccg gagtattggg
180acggggagac acggaaagtg aaggcccact cacagactca ccgagtggac ctggggaccc
240tgcgcggcta ctacaaccag agcgaggccg
2701619DNAArtificial SequenceDNA probe 16atcgatcgat cgatcgatc
19179DNAArtificial SequenceDNA probe
17atcgatcga
9189DNAArtificial SequenceDNA probe 18tcgatcgat
9199DNAArtificial SequenceDNA probe
19cgatcgatc
9209DNAArtificial SequenceDNA probe 20gatcgatcg
9219DNAArtificial SequenceDNA probe
21atcgatcga
9229DNAArtificial SequenceDNA probe 22tcgatcgat
9239DNAArtificial SequenceDNA probe
23cgatcgatc
9249DNAArtificial SequenceDNA probe 24gatcgatcg
9259DNAArtificial SequenceDNA probe
25atcgatcga
9269DNAArtificial SequenceDNA probe 26tcgatcgat
9279DNAArtificial SequenceDNA probe
27cgatcgatc
92819DNAArtificial SequenceDNA probe 28atcgatcgat ggatcgatc
19299DNAArtificial SequenceDNA probe
29atcgatcga
9309DNAArtificial SequenceDNA probe 30tcgatcgat
9319DNAArtificial SequenceDNA probe
31cgatcgatg
9329DNAArtificial SequenceDNA probe 32gatcgatgg
9339DNAArtificial SequenceDNA probe
33atcgatgga
9349DNAArtificial SequenceDNA probe 34tcgatggat
9359DNAArtificial SequenceDNA probe
35cgatggatc
9369DNAArtificial SequenceDNA probe 36gatggatcg
9379DNAArtificial SequenceDNA probe
37atggatcga
9389DNAArtificial SequenceDNA probe 38tggatcgat
9399DNAArtificial SequenceDNA probe
39ggatcgatc
94019DNAArtificial SequenceDNA probe 40atcgatcgat cgatccatc
19419DNAArtificial SequenceDNA probe
41atcgatcga
9429DNAArtificial SequenceDNA probe 42tcgatcgat
9439DNAArtificial SequenceDNA probe
43cgatcgatc
9449DNAArtificial SequenceDNA probe 44gatcgatcg
9459DNAArtificial SequenceDNA probe
45atcgatcga
9469DNAArtificial SequenceDNA probe 46tcgatcgat
9479DNAArtificial SequenceDNA probe
47cgatcgatc
9489DNAArtificial SequenceDNA probe 48gatcgatcc
9499DNAArtificial SequenceDNA probe
49atcgatcca
9509DNAArtificial SequenceDNA probe 50tcgatccat
9519DNAArtificial SequenceDNA probe
51cgatccatc
9529DNAArtificial SequenceDNA probe 52atcgatcga
9539DNAArtificial SequenceDNA probe
53tcgatcgat
9549DNAArtificial SequenceDNA probe 54cgatcgatc
9559DNAArtificial SequenceDNA probe
55gatcgatcg
9569DNAArtificial SequenceDNA probe 56atcgatcga
9579DNAArtificial SequenceDNA probe
57tcgatcgat
9589DNAArtificial SequenceDNA probe 58cgatcgatc
9599DNAArtificial SequenceDNA probe
59gatcgatcg
9609DNAArtificial SequenceDNA probe 60atcgatcga
9619DNAArtificial SequenceDNA probe
61tcgatcgat
9629DNAArtificial SequenceDNA probe 62cgatcgatc
9639DNAArtificial SequenceDNA probe
63atcgatcga
9649DNAArtificial SequenceDNA probe 64tcgatcgat
9659DNAArtificial SequenceDNA probe
65cgatcgatg
9669DNAArtificial SequenceDNA probe 66gatcgatgg
9679DNAArtificial SequenceDNA probe
67atcgatgga
9689DNAArtificial SequenceDNA probe 68tcgatggat
9699DNAArtificial SequenceDNA probe
69cgatggatc
9709DNAArtificial SequenceDNA probe 70gatggatcg
9719DNAArtificial SequenceDNA probe
71atggatcga
9729DNAArtificial SequenceDNA probe 72tggatcgat
9739DNAArtificial SequenceDNA probe
73ggatcgatc
9749DNAArtificial SequenceDNA probe 74atcgatcga
9759DNAArtificial SequenceDNA probe
75tcgatcgat
9769DNAArtificial SequenceDNA probe 76cgatcgatc
9779DNAArtificial SequenceDNA probe
77gatcgatcg
9789DNAArtificial SequenceDNA probe 78atcgatcga
9799DNAArtificial SequenceDNA probe
79tcgatcgat
9809DNAArtificial SequenceDNA probe 80cgatcgatc
9819DNAArtificial SequenceDNA probe
81gatcgatcc
9829DNAArtificial SequenceDNA probe 82atcgatcca
9839DNAArtificial SequenceDNA probe
83tcgatccat
9849DNAArtificial SequenceDNA probe 84cgatccatc
98525DNAArtificial SequenceDNA probe
85cgagggtgag gtactccata aagaa
258625DNAArtificial SequenceDNA probe 86gagggtgagg tactccataa agaag
258725DNAArtificial SequenceDNA probe
87agggtgaggt actccataaa gaagt
258825DNAArtificial SequenceDNA probe 88gggtgaggta ctccataaag aagtg
258925DNAArtificial SequenceDNA probe
89ggtgaggtac tccataaaga agtgt
259025DNAArtificial SequenceDNA probe 90gtgaggtact ccataaagaa gtgta
259125DNAArtificial SequenceDNA probe
91tgaggtactc cataaagaag tgtag
259225DNAArtificial SequenceDNA probe 92gaggtactcc ataaagaagt gtagg
259325DNAArtificial SequenceDNA probe
93aggtactcca taaagaagtg taggc
259425DNAArtificial SequenceDNA probe 94ggtactccat aaagaagtgt aggca
259525DNAArtificial SequenceDNA probe
95gtactccata aagaagtgta ggcac
259625DNAArtificial SequenceDNA probe 96tactccataa agaagtgtag gcaca
259725DNAArtificial SequenceDNA probe
97actccataaa gaagtgtagg cacag
259825DNAArtificial SequenceDNA probe 98ctccataaag aagtgtaggc acagg
259925DNAArtificial SequenceDNA probe
99tccataaaga agtgtaggca caggg
2510025DNAArtificial SequenceDNA probe 100ccataaagaa gtgtaggcac agggc
2510125DNAArtificial SequenceDNA
probe 101cataaagaag tgtaggcaca gggcc
2510225DNAArtificial SequenceDNA probe 102ataaagaagt gtaggcacag
ggccg 2510325DNAArtificial
SequenceDNA probe 103taaagaagtg taggcacagg gccgg
2510425DNAArtificial SequenceDNA probe 104aaagaagtgt
aggcacaggg ccggg
2510525DNAArtificial SequenceDNA probe 105aagaagtgta ggcacagggc cgggc
2510625DNAArtificial SequenceDNA
probe 106agaagtgtag gcacagggcc gggcc
2510725DNAArtificial SequenceDNA probe 107gaagtgtagg cacagggccg
ggccg 2510825DNAArtificial
SequenceDNA probe 108aagtgtaggc acagggccgg gccgg
2510925DNAArtificial SequenceDNA probe 109agtgtaggca
cagggccggg ccggc
2511025DNAArtificial SequenceDNA probe 110gtgtaggcac agggccgggc cggcg
2511125DNAArtificial SequenceDNA
probe 111tgtaggcaca gggccgggcc ggcgc
2511225DNAArtificial SequenceDNA probe 112gtaggcacag ggccgggccg
gcgcc 2511325DNAArtificial
SequenceDNA probe 113taggcacagg gccgggccgg cgccc
2511425DNAArtificial SequenceDNA probe 114aggcacaggg
ccgggccggc gcccc
2511525DNAArtificial SequenceDNA probe 115ggcacagggc cgggccggcg cccct
2511625DNAArtificial SequenceDNA
probe 116gcacagggcc gggccggcgc ccctc
2511725DNAArtificial SequenceDNA probe 117cacagggccg ggccggcgcc
cctcg 2511825DNAArtificial
SequenceDNA probe 118acagggccgg gccggcgccc ctcgg
2511925DNAArtificial SequenceDNA probe 119cagggccggg
ccggcgcccc tcggg
2512025DNAArtificial SequenceDNA probe 120agggccgggc cggcgcccct cgggg
2512125DNAArtificial SequenceDNA
probe 121gggccgggcc ggcgcccctc ggggc
2512225DNAArtificial SequenceDNA probe 122ggccgggccg gcgcccctcg
gggcg 2512325DNAArtificial
SequenceDNA probe 123gccgggccgg cgcccctcgg ggcga
2512425DNAArtificial SequenceDNA probe 124ccgggccggc
gcccctcggg gcgaa
2512525DNAArtificial SequenceDNA probe 125cgggccggcg cccctcgggg cgaag
2512625DNAArtificial SequenceDNA
probe 126gggccggcgc ccctcggggc gaagt
2512725DNAArtificial SequenceDNA probe 127ggccggcgcc cctcggggcg
aagta 2512825DNAArtificial
SequenceDNA probe 128gccggcgccc ctcggggcga agtag
2512925DNAArtificial SequenceDNA probe 129ccggcgcccc
tcggggcgaa gtagc
2513025DNAArtificial SequenceDNA probe 130cggcgcccct cggggcgaag tagcg
2513125DNAArtificial SequenceDNA
probe 131ggcgcccctc ggggcgaagt agcgg
2513225DNAArtificial SequenceDNA probe 132gcgcccctcg gggcgaagta
gcggc 2513325DNAArtificial
SequenceDNA probe 133cgcccctcgg ggcgaagtag cggca
2513425DNAArtificial SequenceDNA probe 134gcccctcggg
gcgaagtagc ggcac
2513525DNAArtificial SequenceDNA probe 135cccctcgggg cgaagtagcg gcacc
2513625DNAArtificial SequenceDNA
probe 136ccctcggggc gaagtagcgg caccc
2513725DNAArtificial SequenceDNA probe 137cctcggggcg aagtagcggc
acccg 2513825DNAArtificial
SequenceDNA probe 138ctcggggcga agtagcggca cccga
2513925DNAArtificial SequenceDNA probe 139tcggggcgaa
gtagcggcac ccgat
2514025DNAArtificial SequenceDNA probe 140cggggcgaag tagcggcacc cgatg
2514125DNAArtificial SequenceDNA
probe 141ggggcgaagt agcggcaccc gatgc
2514225DNAArtificial SequenceDNA probe 142gggcgaagta gcggcacccg
atgca 2514325DNAArtificial
SequenceDNA probe 143ggcgaagtag cggcacccga tgcac
2514425DNAArtificial SequenceDNA probe 144gcgaagtagc
ggcacccgat gcacc
2514525DNAArtificial SequenceDNA probe 145cgaagtagcg gcacccgatg cacct
2514625DNAArtificial SequenceDNA
probe 146gaagtagcgg cacccgatgc acctg
2514725DNAArtificial SequenceDNA probe 147aagtagcggc acccgatgca
cctgc 2514825DNAArtificial
SequenceDNA probe 148agtagcggca cccgatgcac ctgct
2514925DNAArtificial SequenceDNA probe 149gtagcggcac
ccgatgcacc tgctg
2515025DNAArtificial SequenceDNA probe 150tagcggcacc cgatgcacct gctgt
2515125DNAArtificial SequenceDNA
probe 151agcggcaccc gatgcacctg ctgtg
2515225DNAArtificial SequenceDNA probe 152gcggcacccg atgcacctgc
tgtgc 2515325DNAArtificial
SequenceDNA probe 153cggcacccga tgcacctgct gtgcg
2515425DNAArtificial SequenceDNA probe 154ggcacccgat
gcacctgctg tgcgt
2515525DNAArtificial SequenceDNA probe 155gcacccgatg cacctgctgt gcgtc
2515625DNAArtificial SequenceDNA
probe 156cacccgatgc acctgctgtg cgtca
2515725DNAArtificial SequenceDNA probe 157acccgatgca cctgctgtgc
gtcaa 2515825DNAArtificial
SequenceDNA probe 158cccgatgcac ctgctgtgcg tcaag
2515925DNAArtificial SequenceDNA probe 159ccgatgcacc
tgctgtgcgt caagc
2516025DNAArtificial SequenceDNA probe 160cgatgcacct gctgtgcgtc aagca
2516125DNAArtificial SequenceDNA
probe 161gatgcacctg ctgtgcgtca agcac
2516225DNAArtificial SequenceDNA probe 162atgcacctgc tgtgcgtcaa
gcacg 2516325DNAArtificial
SequenceDNA probe 163tgcacctgct gtgcgtcaag cacgc
2516425DNAArtificial SequenceDNA probe 164gcacctgctg
tgcgtcaagc acgcc
2516525DNAArtificial SequenceDNA probe 165cacctgctgt gcgtcaagca cgcca
2516625DNAArtificial SequenceDNA
probe 166acctgctgtg cgtcaagcac gccaa
2516725DNAArtificial SequenceDNA probe 167cctgctgtgc gtcaagcacg
ccaag 2516825DNAArtificial
SequenceDNA probe 168ctgctgtgcg tcaagcacgc caagc
2516925DNAArtificial SequenceDNA probe 169tgctgtgcgt
caagcacgcc aagct
2517025DNAArtificial SequenceDNA probe 170gctgtgcgtc aagcacgcca agctg
2517125DNAArtificial SequenceDNA
probe 171ctgtgcgtca agcacgccaa gctgt
2517225DNAArtificial SequenceDNA probe 172tgtgcgtcaa gcacgccaag
ctgtc 2517325DNAArtificial
SequenceDNA probe 173gtgcgtcaag cacgccaagc tgtcg
2517425DNAArtificial SequenceDNA probe 174tgcgtcaagc
acgccaagct gtcgc
2517525DNAArtificial SequenceDNA probe 175gcgtcaagca cgccaagctg tcgct
2517625DNAArtificial SequenceDNA
probe 176cgtcaagcac gccaagctgt cgctg
2517725DNAArtificial SequenceDNA probe 177gtcaagcacg ccaagctgtc
gctgc 2517825DNAArtificial
SequenceDNA probe 178tcaagcacgc caagctgtcg ctgcg
2517925DNAArtificial SequenceDNA probe 179caagcacgcc
aagctgtcgc tgcgg
2518025DNAArtificial SequenceDNA probe 180aagcacgcca agctgtcgct gcggc
2518125DNAArtificial SequenceDNA
probe 181agcacgccaa gctgtcgctg cggcg
2518225DNAArtificial SequenceDNA probe 182gcacgccaag ctgtcgctgc
ggcgc 2518325DNAArtificial
SequenceDNA probe 183cacgccaagc tgtcgctgcg gcgct
2518425DNAArtificial SequenceDNA probe 184acgccaagct
gtcgctgcgg cgctc
2518525DNAArtificial SequenceDNA probe 185cgccaagctg tcgctgcggc gctcg
2518625DNAArtificial SequenceDNA
probe 186gccaagctgt cgctgcggcg ctcgg
2518725DNAArtificial SequenceDNA probe 187ccaagctgtc gctgcggcgc
tcggt 2518825DNAArtificial
SequenceDNA probe 188caagctgtcg ctgcggcgct cggtc
2518925DNAArtificial SequenceDNA probe 189aagctgtcgc
tgcggcgctc ggtct
2519025DNAArtificial SequenceDNA probe 190agctgtcgct gcggcgctcg gtctc
2519125DNAArtificial SequenceDNA
probe 191gctgtcgctg cggcgctcgg tctcc
2519225DNAArtificial SequenceDNA probe 192ctgtcgctgc ggcgctcggt
ctcct 2519325DNAArtificial
SequenceDNA probe 193tgtcgctgcg gcgctcggtc tccta
2519425DNAArtificial SequenceDNA probe 194gtcgctgcgg
cgctcggtct cctac
2519525DNAArtificial SequenceDNA probe 195tcgctgcggc gctcggtctc ctacc
2519625DNAArtificial SequenceDNA
probe 196cgctgcggcg ctcggtctcc tacct
2519725DNAArtificial SequenceDNA probe 197gctgcggcgc tcggtctcct
acctc 2519825DNAArtificial
SequenceDNA probe 198ctgcggcgct cggtctccta cctcg
2519925DNAArtificial SequenceDNA probe 199tgcggcgctc
ggtctcctac ctcgg
2520025DNAArtificial SequenceDNA probe 200gcggcgctcg gtctcctacc tcggc
2520125DNAArtificial SequenceDNA
probe 201cggcgctcgg tctcctacct cggcg
2520225DNAArtificial SequenceDNA probe 202ggcgctcggt ctcctacctc
ggcgc 2520325DNAArtificial
SequenceDNA probe 203gcgctcggtc tcctacctcg gcgcc
2520425DNAArtificial SequenceDNA probe 204cgctcggtct
cctacctcgg cgccc
2520525DNAArtificial SequenceDNA probe 205gctcggtctc ctacctcggc gcccg
2520625DNAArtificial SequenceDNA
probe 206ctcggtctcc tacctcggcg cccgc
2520725DNAArtificial SequenceDNA probe 207tcggtctcct acctcggcgc
ccgcg 2520825DNAArtificial
SequenceDNA probe 208cggtctccta cctcggcgcc cgcgg
2520925DNAArtificial SequenceDNA probe 209ggtctcctac
ctcggcgccc gcggc
2521025DNAArtificial SequenceDNA probe 210gtctcctacc tcggcgcccg cggca
2521125DNAArtificial SequenceDNA
probe 211tctcctacct cggcgcccgc ggcac
2521225DNAArtificial SequenceDNA probe 212ctcctacctc ggcgcccgcg
gcacc 2521325DNAArtificial
SequenceDNA probe 213tcctacctcg gcgcccgcgg cacct
2521425DNAArtificial SequenceDNA probe 214cctacctcgg
cgcccgcggc accta
2521525DNAArtificial SequenceDNA probe 215ctacctcggc gcccgcggca cctat
2521625DNAArtificial SequenceDNA
probe 216tacctcggcg cccgcggcac ctatc
2521725DNAArtificial SequenceDNA probe 217acctcggcgc ccgcggcacc
tatct 2521825DNAArtificial
SequenceDNA probe 218cctcggcgcc cgcggcacct atctc
2521925DNAArtificial SequenceDNA probe 219ctcggcgccc
gcggcaccta tctcg
2522025DNAArtificial SequenceDNA probe 220tcggcgcccg cggcacctat ctcgt
2522125DNAArtificial SequenceDNA
probe 221cggcgcccgc ggcacctatc tcgtc
2522225DNAArtificial SequenceDNA probe 222ggcgcccgcg gcacctatct
cgtcc 2522325DNAArtificial
SequenceDNA probe 223gcgcccgcgg cacctatctc gtcct
2522425DNAArtificial SequenceDNA probe 224cgcccgcggc
acctatctcg tcctc
2522525DNAArtificial SequenceDNA probe 225gcccgcggca cctatctcgt cctcc
2522625DNAArtificial SequenceDNA
probe 226cccgcggcac ctatctcgtc ctccc
2522725DNAArtificial SequenceDNA probe 227ccgcggcacc tatctcgtcc
tccca 2522825DNAArtificial
SequenceDNA probe 228cgcggcacct atctcgtcct cccag
2522925DNAArtificial SequenceDNA probe 229gcggcaccta
tctcgtcctc ccagg
2523025DNAArtificial SequenceDNA probe 230cggcacctat ctcgtcctcc caggc
2523125DNAArtificial SequenceDNA
probe 231ggcacctatc tcgtcctccc aggcc
2523225DNAArtificial SequenceDNA probe 232gcacctatct cgtcctccca
ggcct 2523325DNAArtificial
SequenceDNA probe 233cacctatctc gtcctcccag gcctc
2523425DNAArtificial SequenceDNA probe 234acctatctcg
tcctcccagg cctca
2523525DNAArtificial SequenceDNA probe 235cctatctcgt cctcccaggc ctcat
2523625DNAArtificial SequenceDNA
probe 236ctatctcgtc ctcccaggcc tcata
2523725DNAArtificial SequenceDNA probe 237tatctcgtcc tcccaggcct
cataa 2523825DNAArtificial
SequenceDNA probe 238atctcgtcct cccaggcctc ataac
2523925DNAArtificial SequenceDNA probe 239tctcgtcctc
ccaggcctca taacc
2524025DNAArtificial SequenceDNA probe 240ctcgtcctcc caggcctcat aaccc
2524125DNAArtificial SequenceDNA
probe 241tcgtcctccc aggcctcata accct
2524225DNAArtificial SequenceDNA probe 242cgtcctccca ggcctcataa
ccctg 2524325DNAArtificial
SequenceDNA probe 243gtcctcccag gcctcataac cctgc
2524425DNAArtificial SequenceDNA probe 244tcctcccagg
cctcataacc ctgcc
2524525DNAArtificial SequenceDNA probe 245cctcccaggc ctcataaccc tgccc
2524625DNAArtificial SequenceDNA
probe 246ctcccaggcc tcataaccct gcccc
2524725DNAArtificial SequenceDNA probe 247tcccaggcct cataaccctg
cccct 2524825DNAArtificial
SequenceDNA probe 248cccaggcctc ataaccctgc ccctc
2524925DNAArtificial SequenceDNA probe 249ccaggcctca
taaccctgcc cctct
2525025DNAArtificial SequenceDNA probe 250caggcctcat aaccctgccc ctctg
2525125DNAArtificial SequenceDNA
probe 251aggcctcata accctgcccc tctgt
2525225DNAArtificial SequenceDNA probe 252ggcctcataa ccctgcccct
ctgtg 2525325DNAArtificial
SequenceDNA probe 253gcctcataac cctgcccctc tgtgc
2525425DNAArtificial SequenceDNA probe 254cctcataacc
ctgcccctct gtgcc
2525525DNAArtificial SequenceDNA probe 255ctcataaccc tgcccctctg tgcct
2525625DNAArtificial SequenceDNA
probe 256tcataaccct gcccctctgt gcctt
2525725DNAArtificial SequenceDNA probe 257cataaccctg cccctctgtg
ccttt 2525825DNAArtificial
SequenceDNA probe 258ataaccctgc ccctctgtgc ctttc
2525925DNAArtificial SequenceDNA probe 259taaccctgcc
cctctgtgcc tttca
2526025DNAArtificial SequenceDNA probe 260aaccctgccc ctctgtgcct ttcac
2526125DNAArtificial SequenceDNA
probe 261accctgcccc tctgtgcctt tcact
2526225DNAArtificial SequenceDNA probe 262ccctgcccct ctgtgccttt
cactt 2526325DNAArtificial
SequenceDNA probe 263cctgcccctc tgtgcctttc acttc
2526425DNAArtificial SequenceDNA probe 264ctgcccctct
gtgcctttca cttcc
2526525DNAArtificial SequenceDNA probe 265tgcccctctg tgcctttcac ttccg
2526625DNAArtificial SequenceDNA
probe 266gcccctctgt gcctttcact tccgg
2526725DNAArtificial SequenceDNA probe 267cccctctgtg cctttcactt
ccggg 2526825DNAArtificial
SequenceDNA probe 268ccctctgtgc ctttcacttc cgggt
2526925DNAArtificial SequenceDNA probe 269cctctgtgcc
tttcacttcc gggtg
2527025DNAArtificial SequenceDNA probe 270ctctgtgcct ttcacttccg ggtga
2527125DNAArtificial SequenceDNA
probe 271tctgtgcctt tcacttccgg gtgag
2527225DNAArtificial SequenceDNA probe 272ctgtgccttt cacttccggg
tgagt 2527325DNAArtificial
SequenceDNA probe 273tgtgcctttc acttccgggt gagtg
2527425DNAArtificial SequenceDNA probe 274gtgcctttca
cttccgggtg agtgt
2527525DNAArtificial SequenceDNA probe 275tgcctttcac ttccgggtga gtgtc
2527625DNAArtificial SequenceDNA
probe 276gcctttcact tccgggtgag tgtct
2527725DNAArtificial SequenceDNA probe 277cctttcactt ccgggtgagt
gtctg 2527825DNAArtificial
SequenceDNA probe 278ctttcacttc cgggtgagtg tctga
2527925DNAArtificial SequenceDNA probe 279tttcacttcc
gggtgagtgt ctgag
2528025DNAArtificial SequenceDNA probe 280ttcacttccg ggtgagtgtc tgagt
2528125DNAArtificial SequenceDNA
probe 281tcacttccgg gtgagtgtct gagtg
2528225DNAArtificial SequenceDNA probe 282cacttccggg tgagtgtctg
agtgg 2528325DNAArtificial
SequenceDNA probe 283acttccgggt gagtgtctga gtggc
2528425DNAArtificial SequenceDNA probe 284cttccgggtg
agtgtctgag tggct
2528525DNAArtificial SequenceDNA probe 285ttccgggtga gtgtctgagt ggctc
2528625DNAArtificial SequenceDNA
probe 286tccgggtgag tgtctgagtg gctca
2528725DNAArtificial SequenceDNA probe 287ccgggtgagt gtctgagtgg
ctcac 2528825DNAArtificial
SequenceDNA probe 288cgggtgagtg tctgagtggc tcacc
2528925DNAArtificial SequenceDNA probe 289gggtgagtgt
ctgagtggct cacct
2529025DNAArtificial SequenceDNA probe 290ggtgagtgtc tgagtggctc acctg
2529125DNAArtificial SequenceDNA
probe 291gtgagtgtct gagtggctca cctgg
2529225DNAArtificial SequenceDNA probe 292tgagtgtctg agtggctcac
ctgga 2529325DNAArtificial
SequenceDNA probe 293gagtgtctga gtggctcacc tggac
2529425DNAArtificial SequenceDNA probe 294agtgtctgag
tggctcacct ggacc
2529525DNAArtificial SequenceDNA probe 295gtgtctgagt ggctcacctg gaccc
2529625DNAArtificial SequenceDNA
probe 296tgtctgagtg gctcacctgg acccc
2529725DNAArtificial SequenceDNA probe 297gtctgagtgg ctcacctgga
cccct 2529825DNAArtificial
SequenceDNA probe 298tctgagtggc tcacctggac ccctg
2529925DNAArtificial SequenceDNA probe 299ctgagtggct
cacctggacc cctgg
2530025DNAArtificial SequenceDNA probe 300tgagtggctc acctggaccc ctggg
2530125DNAArtificial SequenceDNA
probe 301gagtggctca cctggacccc tggga
2530225DNAArtificial SequenceDNA probe 302agtggctcac ctggacccct
gggac 2530325DNAArtificial
SequenceDNA probe 303gtggctcacc tggacccctg ggacg
2530425DNAArtificial SequenceDNA probe 304tggctcacct
ggacccctgg gacgc
2530525DNAArtificial SequenceDNA probe 305ggctcacctg gacccctggg acgcg
2530625DNAArtificial SequenceDNA
probe 306gctcacctgg acccctggga cgcgc
2530725DNAArtificial SequenceDNA probe 307ctcacctgga cccctgggac
gcgcc 2530825DNAArtificial
SequenceDNA probe 308tcacctggac ccctgggacg cgccg
2530925DNAArtificial SequenceDNA probe 309cacctggacc
cctgggacgc gccga
2531025DNAArtificial SequenceDNA probe 310acctggaccc ctgggacgcg ccgat
2531125DNAArtificial SequenceDNA
probe 311cctggacccc tgggacgcgc cgatg
2531225DNAArtificial SequenceDNA probe 312ctggacccct gggacgcgcc
gatga 2531325DNAArtificial
SequenceDNA probe 313tggacccctg ggacgcgccg atgat
2531425DNAArtificial SequenceDNA probe 314ggacccctgg
gacgcgccga tgatg
2531525DNAArtificial SequenceDNA probe 315gacccctggg acgcgccgat gatgt
2531625DNAArtificial SequenceDNA
probe 316acccctggga cgcgccgatg atgtt
2531725DNAArtificial SequenceDNA probe 317cccctgggac gcgccgatga
tgttg 2531825DNAArtificial
SequenceDNA probe 318ccctgggacg cgccgatgat gttgg
2531925DNAArtificial SequenceDNA probe 319cctgggacgc
gccgatgatg ttggt
2532025DNAArtificial SequenceDNA probe 320ctgggacgcg ccgatgatgt tggtc
2532125DNAArtificial SequenceDNA
probe 321tgggacgcgc cgatgatgtt ggtct
2532225DNAArtificial SequenceDNA probe 322gggacgcgcc gatgatgttg
gtctc 2532325DNAArtificial
SequenceDNA probe 323ggacgcgccg atgatgttgg tctcg
2532425DNAArtificial SequenceDNA probe 324gacgcgccga
tgatgttggt ctcgc
2532525DNAArtificial SequenceDNA probe 325acgcgccgat gatgttggtc tcgct
2532625DNAArtificial SequenceDNA
probe 326cgcgccgatg atgttggtct cgctc
2532725DNAArtificial SequenceDNA probe 327gcgccgatga tgttggtctc
gctcc 2532825DNAArtificial
SequenceDNA probe 328cgccgatgat gttggtctcg ctccg
2532925DNAArtificial SequenceDNA probe 329gccgatgatg
ttggtctcgc tccgg
2533025DNAArtificial SequenceDNA probe 330ccgatgatgt tggtctcgct ccggc
2533125DNAArtificial SequenceDNA
probe 331caagagtgtg gcaggtctcc tacat
2533225DNAArtificial SequenceDNA probe 332aagagtgtgg caggtctcct
acata 2533325DNAArtificial
SequenceDNA probe 333agagtgtggc aggtctccta catac
2533425DNAArtificial SequenceDNA probe 334gagtgtggca
ggtctcctac atacc
2533525DNAArtificial SequenceDNA probe 335agtgtggcag gtctcctaca taccg
2533625DNAArtificial SequenceDNA
probe 336gtgtggcagg tctcctacat accga
2533725DNAArtificial SequenceDNA probe 337tgtggcaggt ctcctacata
ccgac 2533825DNAArtificial
SequenceDNA probe 338gtggcaggtc tcctacatac cgacg
2533925DNAArtificial SequenceDNA probe 339tggcaggtct
cctacatacc gacgc
2534025DNAArtificial SequenceDNA probe 340ggcaggtctc ctacataccg acgct
2534125DNAArtificial SequenceDNA
probe 341gcaggtctcc tacataccga cgctg
2534225DNAArtificial SequenceDNA probe 342caggtctcct acataccgac
gctgc 2534325DNAArtificial
SequenceDNA probe 343aggtctccta cataccgacg ctgca
2534425DNAArtificial SequenceDNA probe 344ggtctcctac
ataccgacgc tgcac
2534525DNAArtificial SequenceDNA probe 345gtctcctaca taccgacgct gcacc
2534625DNAArtificial SequenceDNA
probe 346tctcctacat accgacgctg caccc
2534725DNAArtificial SequenceDNA probe 347ctcctacata ccgacgctgc
acccc 2534825DNAArtificial
SequenceDNA probe 348tcctacatac cgacgctgca cccca
2534925DNAArtificial SequenceDNA probe 349cctacatacc
gacgctgcac cccag
2535025DNAArtificial SequenceDNA probe 350ctacataccg acgctgcacc ccagc
2535125DNAArtificial SequenceDNA
probe 351tacataccga cgctgcaccc cagcc
2535225DNAArtificial SequenceDNA probe 352acataccgac gctgcacccc
agcct 2535325DNAArtificial
SequenceDNA probe 353cataccgacg ctgcacccca gcctg
2535425DNAArtificial SequenceDNA probe 354ataccgacgc
tgcaccccag cctga
2535525DNAArtificial SequenceDNA probe 355taccgacgct gcaccccagc ctgac
2535625DNAArtificial SequenceDNA
probe 356accgacgctg caccccagcc tgacc
2535725DNAArtificial SequenceDNA probe 357ccgacgctgc accccagcct
gaccg 2535825DNAArtificial
SequenceDNA probe 358cgacgctgca ccccagcctg accgc
2535925DNAArtificial SequenceDNA probe 359gacgctgcac
cccagcctga ccgcg
2536025DNAArtificial SequenceDNA probe 360acgctgcacc ccagcctgac cgcga
2536125DNAArtificial SequenceDNA
probe 361cgctgcaccc cagcctgacc gcgaa
2536225DNAArtificial SequenceDNA probe 362gctgcacccc agcctgaccg
cgaag 2536325DNAArtificial
SequenceDNA probe 363ctgcacccca gcctgaccgc gaagg
2536425DNAArtificial SequenceDNA probe 364tgcaccccag
cctgaccgcg aagga
2536525DNAArtificial SequenceDNA probe 365gcaccccagc ctgaccgcga aggag
2536625DNAArtificial SequenceDNA
probe 366caccccagcc tgaccgcgaa ggagg
2536725DNAArtificial SequenceDNA probe 367accccagcct gaccgcgaag
gaggc 2536825DNAArtificial
SequenceDNA probe 368ccccagcctg accgcgaagg aggcg
2536925DNAArtificial SequenceDNA probe 369cccagcctga
ccgcgaagga ggcgc
2537025DNAArtificial SequenceDNA probe 370ccagcctgac cgcgaaggag gcgcc
2537125DNAArtificial SequenceDNA
probe 371cagcctgacc gcgaaggagg cgccc
2537225DNAArtificial SequenceDNA probe 372agcctgaccg cgaaggaggc
gccca 2537325DNAArtificial
SequenceDNA probe 373gcctgaccgc gaaggaggcg cccat
2537425DNAArtificial SequenceDNA probe 374cctgaccgcg
aaggaggcgc ccatg
2537525DNAArtificial SequenceDNA probe 375ctgaccgcga aggaggcgcc catgg
2537625DNAArtificial SequenceDNA
probe 376tgaccgcgaa ggaggcgccc atggt
2537725DNAArtificial SequenceDNA probe 377gaccgcgaag gaggcgccca
tggtg 2537825DNAArtificial
SequenceDNA probe 378accgcgaagg aggcgcccat ggtgg
2537925DNAArtificial SequenceDNA probe 379ccgcgaagga
ggcgcccatg gtggt
2538025DNAArtificial SequenceDNA probe 380cgcgaaggag gcgcccatgg tggtc
2538125DNAArtificial SequenceDNA
probe 381gcgaaggagg cgcccatggt ggtca
2538225DNAArtificial SequenceDNA probe 382cgaaggaggc gcccatggtg
gtcat 2538325DNAArtificial
SequenceDNA probe 383gaaggaggcg cccatggtgg tcatg
2538425DNAArtificial SequenceDNA probe 384aaggaggcgc
ccatggtggt catgc
2538525DNAArtificial SequenceDNA probe 385aggaggcgcc catggtggtc atgcg
2538625DNAArtificial SequenceDNA
probe 386ggaggcgccc atggtggtca tgcgg
2538725DNAArtificial SequenceDNA probe 387gaggcgccca tggtggtcat
gcgga 2538825DNAArtificial
SequenceDNA probe 388aggcgcccat ggtggtcatg cggat
2538925DNAArtificial SequenceDNA probe 389ggcgcccatg
gtggtcatgc ggatg
2539025DNAArtificial SequenceDNA probe 390gcgcccatgg tggtcatgcg gatgc
2539125DNAArtificial SequenceDNA
probe 391cgcccatggt ggtcatgcgg atgct
2539225DNAArtificial SequenceDNA probe 392gcccatggtg gtcatgcgga
tgctg 2539325DNAArtificial
SequenceDNA probe 393cccatggtgg tcatgcggat gctgc
2539425DNAArtificial SequenceDNA probe 394ccatggtggt
catgcggatg ctgcc
2539525DNAArtificial SequenceDNA probe 395catggtggtc atgcggatgc tgccg
2539625DNAArtificial SequenceDNA
probe 396atggtggtca tgcggatgct gccgt
2539725DNAArtificial SequenceDNA probe 397tggtggtcat gcggatgctg
ccgtt 2539825DNAArtificial
SequenceDNA probe 398ggtggtcatg cggatgctgc cgttc
2539925DNAArtificial SequenceDNA probe 399gtggtcatgc
ggatgctgcc gttcc
2540025DNAArtificial SequenceDNA probe 400tggtcatgcg gatgctgccg ttcct
2540125DNAArtificial SequenceDNA
probe 401ggtcatgcgg atgctgccgt tccta
2540225DNAArtificial SequenceDNA probe 402gtcatgcgga tgctgccgtt
cctaa 2540325DNAArtificial
SequenceDNA probe 403tcatgcggat gctgccgttc ctaat
2540425DNAArtificial SequenceDNA probe 404catgcggatg
ctgccgttcc taatg
2540525DNAArtificial SequenceDNA probe 405atgcggatgc tgccgttcct aatgt
2540625DNAArtificial SequenceDNA
probe 406tgcggatgct gccgttccta atgta
2540725DNAArtificial SequenceDNA probe 407gcggatgctg ccgttcctaa
tgtag 2540825DNAArtificial
SequenceDNA probe 408cggatgctgc cgttcctaat gtagc
2540925DNAArtificial SequenceDNA probe 409ggatgctgcc
gttcctaatg tagcg
2541025DNAArtificial SequenceDNA probe 410gatgctgccg ttcctaatgt agcgg
2541125DNAArtificial SequenceDNA
probe 411atgctgccgt tcctaatgta gcggg
2541225DNAArtificial SequenceDNA probe 412tgctgccgtt cctaatgtag
cggga 2541325DNAArtificial
SequenceDNA probe 413gctgccgttc ctaatgtagc gggac
2541425DNAArtificial SequenceDNA probe 414ctgccgttcc
taatgtagcg ggact
2541525DNAArtificial SequenceDNA probe 415tgccgttcct aatgtagcgg gactt
2541625DNAArtificial SequenceDNA
probe 416gccgttccta atgtagcggg acttt
2541725DNAArtificial SequenceDNA probe 417ccgttcctaa tgtagcggga
ctttc 2541825DNAArtificial
SequenceDNA probe 418cgttcctaat gtagcgggac tttct
2541925DNAArtificial SequenceDNA probe 419gttcctaatg
tagcgggact ttctc
2542025DNAArtificial SequenceDNA probe 420ttcctaatgt agcgggactt tctcc
2542125DNAArtificial SequenceDNA
probe 421tcctaatgta gcgggacttt ctcct
2542225DNAArtificial SequenceDNA probe 422cctaatgtag cgggactttc
tcctg 2542325DNAArtificial
SequenceDNA probe 423ctaatgtagc gggactttct cctgg
2542425DNAArtificial SequenceDNA probe 424taatgtagcg
ggactttctc ctgga
2542525DNAArtificial SequenceDNA probe 425aatgtagcgg gactttctcc tggac
2542625DNAArtificial SequenceDNA
probe 426atgtagcggg actttctcct ggacg
2542725DNAArtificial SequenceDNA probe 427tgtagcggga ctttctcctg
gacgc 2542825DNAArtificial
SequenceDNA probe 428gtagcgggac tttctcctgg acgcg
2542925DNAArtificial SequenceDNA probe 429tagcgggact
ttctcctgga cgcga
2543025DNAArtificial SequenceDNA probe 430agcgggactt tctcctggac gcgag
2543125DNAArtificial SequenceDNA
probe 431gcgggacttt ctcctggacg cgaga
2543225DNAArtificial SequenceDNA probe 432cgggactttc tcctggacgc
gagaa 2543325DNAArtificial
SequenceDNA probe 433gggactttct cctggacgcg agaac
2543425DNAArtificial SequenceDNA probe 434ggactttctc
ctggacgcga gaacc
2543525DNAArtificial SequenceDNA probe 435gactttctcc tggacgcgag aacct
2543625DNAArtificial SequenceDNA
probe 436actttctcct ggacgcgaga acctg
2543725DNAArtificial SequenceDNA probe 437ctttctcctg gacgcgagaa
cctgg 2543825DNAArtificial
SequenceDNA probe 438tttctcctgg acgcgagaac ctggc
2543925DNAArtificial SequenceDNA probe 439ttctcctgga
cgcgagaacc tggcg
2544025DNAArtificial SequenceDNA probe 440tctcctggac gcgagaacct ggcgc
2544125DNAArtificial SequenceDNA
probe 441ctcctggacg cgagaacctg gcgcc
2544225DNAArtificial SequenceDNA probe 442tcctggacgc gagaacctgg
cgccg 2544325DNAArtificial
SequenceDNA probe 443cctggacgcg agaacctggc gccgc
2544425DNAArtificial SequenceDNA probe 444ctggacgcga
gaacctggcg ccgcc
2544525DNAArtificial SequenceDNA probe 445tggacgcgag aacctggcgc cgcct
2544625DNAArtificial SequenceDNA
probe 446ggacgcgaga acctggcgcc gcctg
2544725DNAArtificial SequenceDNA probe 447gacgcgagaa cctggcgccg
cctgt 2544825DNAArtificial
SequenceDNA probe 448acgcgagaac ctggcgccgc ctgta
2544925DNAArtificial SequenceDNA probe 449cgcgagaacc
tggcgccgcc tgtac
2545025DNAArtificial SequenceDNA probe 450gcgagaacct ggcgccgcct gtacc
2545125DNAArtificial SequenceDNA
probe 451cgagaacctg gcgccgcctg taccg
2545225DNAArtificial SequenceDNA probe 452gagaacctgg cgccgcctgt
accgt 2545325DNAArtificial
SequenceDNA probe 453agaacctggc gccgcctgta ccgtc
2545425DNAArtificial SequenceDNA probe 454gaacctggcg
ccgcctgtac cgtcg
2545525DNAArtificial SequenceDNA probe 455aacctggcgc cgcctgtacc gtcga
2545625DNAArtificial SequenceDNA
probe 456acctggcgcc gcctgtaccg tcgag
2545725DNAArtificial SequenceDNA probe 457cctggcgccg cctgtaccgt
cgagt 2545825DNAArtificial
SequenceDNA probe 458ctggcgccgc ctgtaccgtc gagtc
2545925DNAArtificial SequenceDNA probe 459tggcgccgcc
tgtaccgtcg agtct
2546025DNAArtificial SequenceDNA probe 460ggcgccgcct gtaccgtcga gtctg
2546125DNAArtificial SequenceDNA
probe 461gcgccgcctg taccgtcgag tctgg
2546225DNAArtificial SequenceDNA probe 462cgccgcctgt accgtcgagt
ctggt 2546325DNAArtificial
SequenceDNA probe 463gccgcctgta ccgtcgagtc tggtg
2546425DNAArtificial SequenceDNA probe 464ccgcctgtac
cgtcgagtct ggtgg
2546525DNAArtificial SequenceDNA probe 465cgcctgtacc gtcgagtctg gtggt
2546625DNAArtificial SequenceDNA
probe 466gcctgtaccg tcgagtctgg tggtt
2546725DNAArtificial SequenceDNA probe 467cctgtaccgt cgagtctggt
ggttc 2546825DNAArtificial
SequenceDNA probe 468ctgtaccgtc gagtctggtg gttcg
2546925DNAArtificial SequenceDNA probe 469tgtaccgtcg
agtctggtgg ttcgt
2547025DNAArtificial SequenceDNA probe 470gtaccgtcga gtctggtggt tcgtg
2547125DNAArtificial SequenceDNA
probe 471taccgtcgag tctggtggtt cgtgt
2547225DNAArtificial SequenceDNA probe 472accgtcgagt ctggtggttc
gtgtt 2547325DNAArtificial
SequenceDNA probe 473ccgtcgagtc tggtggttcg tgttc
2547425DNAArtificial SequenceDNA probe 474cgtcgagtct
ggtggttcgt gttca
2547525DNAArtificial SequenceDNA probe 475gtcgagtctg gtggttcgtg ttcac
2547625DNAArtificial SequenceDNA
probe 476tcgagtctgg tggttcgtgt tcacc
2547725DNAArtificial SequenceDNA probe 477cgagtctggt ggttcgtgtt
caccc 2547825DNAArtificial
SequenceDNA probe 478gagtctggtg gttcgtgttc accct
2547925DNAArtificial SequenceDNA probe 479agtctggtgg
ttcgtgttca ccctc
2548025DNAArtificial SequenceDNA probe 480gtctggtggt tcgtgttcac cctcc
2548125DNAArtificial SequenceDNA
probe 481tctggtggtt cgtgttcacc ctccg
2548225DNAArtificial SequenceDNA probe 482ctggtggttc gtgttcaccc
tccgc 2548325DNAArtificial
SequenceDNA probe 483tggtggttcg tgttcaccct ccgcc
2548425DNAArtificial SequenceDNA probe 484ggtggttcgt
gttcaccctc cgccg
2548525DNAArtificial SequenceDNA probe 485gtggttcgtg ttcaccctcc gccgg
2548625DNAArtificial SequenceDNA
probe 486tggttcgtgt tcaccctccg ccggg
2548725DNAArtificial SequenceDNA probe 487ggttcgtgtt caccctccgc
cgggt 2548825DNAArtificial
SequenceDNA probe 488gttcgtgttc accctccgcc gggta
2548925DNAArtificial SequenceDNA probe 489ttcgtgttca
ccctccgccg ggtac
2549025DNAArtificial SequenceDNA probe 490tcgtgttcac cctccgccgg gtaca
2549125DNAArtificial SequenceDNA
probe 491cgtgttcacc ctccgccggg tacac
2549225DNAArtificial SequenceDNA probe 492gtgttcaccc tccgccgggt
acacc 2549325DNAArtificial
SequenceDNA probe 493tgttcaccct ccgccgggta caccg
2549425DNAArtificial SequenceDNA probe 494gttcaccctc
cgccgggtac accgc
2549525DNAArtificial SequenceDNA probe 495ttcaccctcc gccgggtaca ccgcc
2549625DNAArtificial SequenceDNA
probe 496tcaccctccg ccgggtacac cgcct
2549725DNAArtificial SequenceDNA probe 497caccctccgc cgggtacacc
gcctc 2549825DNAArtificial
SequenceDNA probe 498accctccgcc gggtacaccg cctcg
2549925DNAArtificial SequenceDNA probe 499ccctccgccg
ggtacaccgc ctcgt
2550025DNAArtificial SequenceDNA probe 500cctccgccgg gtacaccgcc tcgtc
2550125DNAArtificial SequenceDNA
probe 501ctccgccggg tacaccgcct cgtca
2550225DNAArtificial SequenceDNA probe 502tccgccgggt acaccgcctc
gtcaa 2550325DNAArtificial
SequenceDNA probe 503ccgccgggta caccgcctcg tcaac
2550425DNAArtificial SequenceDNA probe 504cgccgggtac
accgcctcgt caact
2550525DNAArtificial SequenceDNA probe 505gccgggtaca ccgcctcgtc aactc
2550625DNAArtificial SequenceDNA
probe 506ccgggtacac cgcctcgtca actct
2550725DNAArtificial SequenceDNA probe 507cgggtacacc gcctcgtcaa
ctctc 2550825DNAArtificial
SequenceDNA probe 508gggtacaccg cctcgtcaac tctcg
2550925DNAArtificial SequenceDNA probe 509ggtacaccgc
ctcgtcaact ctcgg
2551025DNAArtificial SequenceDNA probe 510gtacaccgcc tcgtcaactc tcgga
2551125DNAArtificial SequenceDNA
probe 511tacaccgcct cgtcaactct cggat
2551225DNAArtificial SequenceDNA probe 512acaccgcctc gtcaactctc
ggatg 2551325DNAArtificial
SequenceDNA probe 513caccgcctcg tcaactctcg gatgg
2551425DNAArtificial SequenceDNA probe 514accgcctcgt
caactctcgg atgga
2551525DNAArtificial SequenceDNA probe 515ccgcctcgtc aactctcgga tggac
2551625DNAArtificial SequenceDNA
probe 516cgcctcgtca actctcggat ggacc
2551725DNAArtificial SequenceDNA probe 517gcctcgtcaa ctctcggatg
gacct 2551825DNAArtificial
SequenceDNA probe 518cctcgtcaac tctcggatgg acctc
2551925DNAArtificial SequenceDNA probe 519ctcgtcaact
ctcggatgga cctcc
2552025DNAArtificial SequenceDNA probe 520tcgtcaactc tcggatggac ctccc
2552125DNAArtificial SequenceDNA
probe 521cgtcaactct cggatggacc tcccg
2552225DNAArtificial SequenceDNA probe 522gtcaactctc ggatggacct
cccgt 2552325DNAArtificial
SequenceDNA probe 523tcaactctcg gatggacctc ccgtg
2552425DNAArtificial SequenceDNA probe 524caactctcgg
atggacctcc cgtgc
2552525DNAArtificial SequenceDNA probe 525aactctcgga tggacctccc gtgca
2552625DNAArtificial SequenceDNA
probe 526actctcggat ggacctcccg tgcac
2552725DNAArtificial SequenceDNA probe 527ctctcggatg gacctcccgt
gcacg 2552825DNAArtificial
SequenceDNA probe 528tctcggatgg acctcccgtg cacgc
2552925DNAArtificial SequenceDNA probe 529ctcggatgga
cctcccgtgc acgca
2553025DNAArtificial SequenceDNA probe 530tcggatggac ctcccgtgca cgcac
2553125DNAArtificial SequenceDNA
probe 531cggatggacc tcccgtgcac gcacc
2553225DNAArtificial SequenceDNA probe 532ggatggacct cccgtgcacg
cacct 2553325DNAArtificial
SequenceDNA probe 533gatggacctc ccgtgcacgc acctc
2553425DNAArtificial SequenceDNA probe 534atggacctcc
cgtgcacgca cctca
2553525DNAArtificial SequenceDNA probe 535tggacctccc gtgcacgcac ctcac
2553625DNAArtificial SequenceDNA
probe 536ggacctcccg tgcacgcacc tcacc
2553725DNAArtificial SequenceDNA probe 537gacctcccgt gcacgcacct
caccg 2553825DNAArtificial
SequenceDNA probe 538acctcccgtg cacgcacctc accga
2553925DNAArtificial SequenceDNA probe 539cctcccgtgc
acgcacctca ccgag
2554025DNAArtificial SequenceDNA probe 540ctcccgtgca cgcacctcac cgagg
2554125DNAArtificial SequenceDNA
probe 541tcccgtgcac gcacctcacc gaggc
2554225DNAArtificial SequenceDNA probe 542cccgtgcacg cacctcaccg
aggcg 2554325DNAArtificial
SequenceDNA probe 543ccgtgcacgc acctcaccga ggcgt
2554425DNAArtificial SequenceDNA probe 544cgtgcacgca
cctcaccgag gcgtc
2554525DNAArtificial SequenceDNA probe 545gtgcacgcac ctcaccgagg cgtct
2554625DNAArtificial SequenceDNA
probe 546tgcacgcacc tcaccgaggc gtcta
2554725DNAArtificial SequenceDNA probe 547gcacgcacct caccgaggcg
tctat 2554825DNAArtificial
SequenceDNA probe 548cacgcacctc accgaggcgt ctatg
2554925DNAArtificial SequenceDNA probe 549acgcacctca
ccgaggcgtc tatgg
2555025DNAArtificial SequenceDNA probe 550cgcacctcac cgaggcgtct atgga
2555125DNAArtificial SequenceDNA
probe 551gcacctcacc gaggcgtcta tggac
2555225DNAArtificial SequenceDNA probe 552cacctcaccg aggcgtctat
ggacc 2555325DNAArtificial
SequenceDNA probe 553acctcaccga ggcgtctatg gacct
2555425DNAArtificial SequenceDNA probe 554cctcaccgag
gcgtctatgg acctc
2555525DNAArtificial SequenceDNA probe 555ctcaccgagg cgtctatgga cctct
2555625DNAArtificial SequenceDNA
probe 556tcaccgaggc gtctatggac ctctt
2555725DNAArtificial SequenceDNA probe 557caccgaggcg tctatggacc
tcttg 2555825DNAArtificial
SequenceDNA probe 558accgaggcgt ctatggacct cttgc
2555925DNAArtificial SequenceDNA probe 559ccgaggcgtc
tatggacctc ttgcc
2556025DNAArtificial SequenceDNA probe 560cgaggcgtct atggacctct tgccc
2556125DNAArtificial SequenceDNA
probe 561gaggcgtcta tggacctctt gccct
2556225DNAArtificial SequenceDNA probe 562aggcgtctat ggacctcttg
ccctt 2556325DNAArtificial
SequenceDNA probe 563ggcgtctatg gacctcttgc ccttc
2556425DNAArtificial SequenceDNA probe 564gcgtctatgg
acctcttgcc cttcc
2556525DNAArtificial SequenceDNA probe 565cgtctatgga cctcttgccc ttcct
2556625DNAArtificial SequenceDNA
probe 566gtctatggac ctcttgccct tcctc
2556725DNAArtificial SequenceDNA probe 567tctatggacc tcttgccctt
cctct 2556825DNAArtificial
SequenceDNA probe 568ctatggacct cttgcccttc ctctg
2556925DNAArtificial SequenceDNA probe 569tatggacctc
ttgcccttcc tctgc
2557025DNAArtificial SequenceDNA probe 570atggacctct tgcccttcct ctgcg
2557125DNAArtificial SequenceDNA
probe 571tggacctctt gcccttcctc tgcga
2557225DNAArtificial SequenceDNA probe 572ggacctcttg cccttcctct
gcgac 2557325DNAArtificial
SequenceDNA probe 573gacctcttgc ccttcctctg cgacg
2557425DNAArtificial SequenceDNA probe 574acctcttgcc
cttcctctgc gacgt
2557525DNAArtificial SequenceDNA probe 575cctcttgccc ttcctctgcg acgtc
2557625DNAArtificial SequenceDNA
probe 576ctcttgccct tcctctgcga cgtcg
2557725DNAArtificial SequenceDNA probe 577tcttgccctt cctctgcgac
gtcgc 2557825DNAArtificial
SequenceDNA probe 578cttgcccttc ctctgcgacg tcgcg
2557925DNAArtificial SequenceDNA probe 579ttgcccttcc
tctgcgacgt cgcgt
2558025DNAArtificial SequenceDNA probe 580tgcccttcct ctgcgacgtc gcgtg
2558125DNAArtificial SequenceDNA
probe 581gcccttcctc tgcgacgtcg cgtgc
2558225DNAArtificial SequenceDNA probe 582cccttcctct gcgacgtcgc
gtgcc 25
User Contributions:
Comment about this patent or add new information about this topic:
