Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: Nematode PAN and ZP Receptor-Like Sequences

Inventors:  Michelle Coutu Hresko (Chesterfield, MO, US)  Merry B. Mclaird (Kirkwood, MO, US)  Deryck J. Williams (University City, MO, US)  Anita M. Frevert (St. Louis, MO, US)  Brandi Chiapelli (St. Louis, MO, US)  Catherine Baublite (St. Louis, MO, US)  Andrew P. Kloek (San Francisco, CA, US)  Jennifer A. Davila-Aponte (St. Louis, MO, US)  John D. Bradley (St. Louis, MO, US)  Siqun Xu (Ballwin, MO, US)
IPC8 Class: AC07K14435FI
USPC Class: 530324
Class name: 25 or more amino acid residues in defined sequence
Publication date: 09/18/2008
Patent application number: 20080227955






Sign up to receive free email alerts when patent applications with chosen keywords are published SIGN UP

Abstract:

Nucleic acid molecules from nematodes encoding PAN and ZP domain containing receptor polypeptides are described. PANZP polypeptide sequences are also provided, as are vectors, host cells, and recombinant methods for production of PANZP nucleotides and polypeptides. Also described are screening methods for identifying inhibitors and/or activators, as well as methods for antibody production.

Claims:

1. A purified polypeptide comprising an amino acid sequence that is at least 80% identical to the amino acid sequence of SEQ ID NO: 3, 10, 11 or 12.

Description:

RELATED APPLICATION INFORMATION

[0001]This application is a continuation of U.S. application Ser. No. 11/191,588, filed on Jul. 28, 2005, which is a divisional of U.S. application Ser. No. 10/771,708, filed on Feb. 4, 2004, which claims priority from U.S. provisional application Ser. No. 60/444,771, filed on Feb. 4, 2003.

BACKGROUND

[0002]Nematodes (derived from the Greek word for thread) are active, flexible, elongate, organisms that live on moist surfaces or in liquid environments, including films of water within soil and moist tissues within other organisms. While only 20,000 species of nematode have been identified, it is estimated that 40,000 to 10 million actually exist. Some species of nematodes have evolved to be very successful parasites of both plants and animals and are responsible for significant economic losses in agriculture and livestock and for morbidity and mortality in humans (Whitehead (1998) Plant Nematode Control, CAB International, New York).

[0003]Nematode parasites of plants can inhabit all parts of plants, including roots, developing flower buds, leaves, and stems. Plant parasites are classified on the basis of their feeding habits into the broad categories: migratory ectoparasites, migratory endoparasites, and sedentary endoparasites. Sedentary endoparasites, which include the root knot nematodes (Meloidogyne) and cyst nematodes (Globodera and Heterodera) induce feeding sites and establish long-term infections within roots that are often very damaging to crops (Whitehead, supra). It is estimated that parasitic nematodes cost the horticulture and agriculture industries in excess of $78 billion worldwide a year, based on an estimated average 12% annual loss spread across all major crops. For example, it is estimated that nematodes cause soybean losses of approximately $3.2 billion annually worldwide (Barker et al. (1994) Plant and Soil Nematodes: Societal Impact and Focus for the Future. The Committee on National Needs and Priorities in Nematology. Cooperative State Research Service, US Department of Agriculture and Society of Nematologists). Several factors make the need for safe and effective nematode controls urgent. Continuing population growth, famines, and environmental degradation have heightened concern for the sustainability of agriculture, and new government regulations may prevent or severely restrict the use of many available agricultural anthelmintic agents.

[0004]The situation is particularly dire for high value crops such as strawberries and tomatoes where chemicals have been used extensively to control soil pests. The soil fumigant methyl bromide has been used effectively to reduce nematode infestations in a variety of these specialty crops. It is however regulated under the U.N. Montreal Protocol as an ozone-depleting substance and is scheduled for elimination in 2005 in the US (Carter (2001) California Agriculture, 55(3):2). It is expected that strawberry and other commodity crop industries will be significantly impacted if a suitable replacement for methyl bromide is not found. Presently there are a very small array of chemicals available to control nematodes and they are frequently inadequate, unsuitable, or too costly for some crops or soils (Becker (1999) Agricultural Research Magazine 47(3):22-24; U.S. Pat. Nos. 6,048,714). The few available broad-spectrum nematicides such as Telone (a mixture of 1,3-dichloropropene and chloropicrin) have significant restrictions on their use because of toxicological concerns (Carter (2001) California Agriculture, Vol. 55(3):12-18).

[0005]The macrocyclic lactones (e.g., avermectins and milbemycins) and delta-toxins from Bacillus thuringiensis (Bt) are nematicidal actives that in principle provide excellent specificity and efficacy and should allow environmentally safe control of plant parasitic nematodes. Unfortunately, in practice, these two approaches have proven less effective for agricultural applications against root pathogens. Although certain avermectins show exquisite activity against plant parasitic nematodes these chemicals are hampered by poor bioavailability due to their light sensitivity, degradation by soil microorganisms and tight binding to soil particles (Lasota & Dybas (1990) Acta Leiden 59(1-2):217-225; Wright & Perry (1998) Musculature and Neurobiology. In: The Physiology and Biochemistry of Free-Living and Plant-parasitic Nematodes (eds R. N. Perry & D. J. Wright), CAB International 1998). Consequently despite years of research and extensive use against animal parasitic nematodes, mites and insects (plant and animal applications), macrocyclic lactones (e.g., avermectins and milbemycins) have never been commercially developed to control plant parasitic nematodes in the soil.

[0006]Bt delta toxins must be ingested to affect their target organ, the brush border of midgut epithelial cells (Marroquin et al. (2000) Genetics. 155(4):1693-1699). Consequently they are not anticipated to be effective against the dispersal, non-feeding, juvenile stages of plant parasitic nematodes in the field. Because juvenile stages only commence feeding when a susceptible host has been infected, nematicides may need to penetrate the plant cuticle to be effective. In addition, soil mobility of a relatively large 65-130 kDa protein--the size of typical Bt delta toxins--is expected to be poor and transgenic delivery in planta is likely to be constrained by the exclusion of large particles by the feeding tube of certain plant parasitic nematodes such as Heterodera (Atkinson et al. (1998) Engineering resistance to plant-parasitic nematodes. In: The Physiology and Biochemistry of Free-Living and Plant-parasitic Nematodes (eds R. N. Perry & D. J. Wright), CAB International 1998).

[0007]Many plant species are known to be highly resistant to nematodes. The best documented of these include marigolds (Tagetes spp.), rattlebox (Crotalaria spectabilis), chrysanthemums (Chrysanthemum spp.), castor bean (Ricinus communis), margosa (Azardiracta indica), and many members of the family Asteraceae (family Compositae) (Hackney & Dickerson. (1975) J Nematol 7(1):84-90). In the case of the Asteraceae, the photodynamic compound alpha-terthienyl has been shown to account for the strong nematicidal activity of the roots. Castor beans are plowed under as a green manure before a seed crop is set. However, a significant drawback of the castor plant is that the seed contains toxic compounds (such as ricin) that can kill humans, pets, and livestock and is also highly allergenic. In many cases however, the active principle(s) for plant nematicidal activity has not been discovered and it remains difficult to derive commercially successful nematicidal products from these resistant plants or to transfer the resistance to agronomically important crops such as soybeans and cotton.

[0008]There remains an urgent need to develop environmentally safe, target-specific ways of controlling plant parasitic nematodes. In the specialty crop markets, economic hardship resulting from nematode infestation is highest in strawberries, bananas, and other high value vegetables and fruits. In the high-acreage crop markets, nematode damage is greatest in soybeans and cotton. There are however, dozens of additional crops that suffer from nematode infestation including potato, pepper, onion, citrus, coffee, sugarcane, greenhouse ornamentals and golf course turf grasses.

[0009]Nematode parasites of vertebrates (e.g., humans, livestock and companion animals) include gut roundworms, hookworms, pinworms, whipworms, and filarial worms. They can be transmitted in a variety of ways, including by water contamination, skin penetration, biting insects, or by ingestion of contaminated food.

[0010]In domesticated animals, nematode control or "de-worming" is essential to the economic viability of livestock producers and is a necessary part of veterinary care of companion animals. Parasitic nematodes cause mortality in animals (e.g., heartworm in dogs and cats) and morbidity as a result of the parasites' inhibiting the ability of the infected animal to absorb nutrients. The parasite-induced nutrient deficiency leads to disease and stunted growth in livestock and companion animals. For instance, in cattle and dairy herds, a single untreated infection with the brown stomach worm can permanently restrict an animal's ability to convert feed into muscle mass or milk.

[0011]Two factors contribute to the need for novel anthelmintics and vaccines for control of parasitic nematodes of animals. First, some of the more prevalent species of parasitic nematodes of livestock are building resistance to the anthelmintic drugs available currently, meaning that these products will eventually lose their efficacy. These developments are not surprising because few effective anthelmintic drugs are available and most have been used continuously. Some parasitic species have developed resistance to most of the anthelmintics (Geents et al. (1997) Parasitology Today 13:149-151; Prichard (1994) Veterinary Parasitology 54:259-268). The fact that many of the anthelmintic drugs have similar modes of action complicates matters, as the loss of sensitivity of the parasite to one drug is often accompanied by side resistance--that is, resistance to other drugs in the same class (Sangster & Gill (1999) Parasitology Today 15(4):141-146). Secondly, there are some issues with toxicity for the major compounds currently available.

[0012]Infections by parasitic nematode worms result in substantial human mortality and morbidity, especially in tropical regions of Africa, Asia, and the Americas. The World Health Organization estimates 2.9 billion people are infected, and in some areas, 85% of the population carries worms. While mortality is rare in proportion to infections, morbidity is substantial and rivals diabetes and lung cancer in worldwide disability adjusted life year (DALY) measurements.

[0013]Examples of human parasitic nematodes include hookworms, filarial worms, and pinworms. Hookworms (1.3 billion infections) are the major cause of anemia in millions of children, resulting in growth retardation and impaired cognitive development. Filarial worm species invade the lymphatics, resulting in permanently swollen and deformed limbs (elephantiasis), and the eyes, causing African river blindness. The large gut roundworm Ascaris lumbricoides infects more than one billion people worldwide and causes malnutrition and obstructive bowel disease. In developed countries, pinworms are common and often transmitted through children in daycare.

[0014]Even in asymptomatic parasitic infections, nematodes can still deprive the host of valuable nutrients and increase the ability of other organisms to establish secondary infections. In some cases, infections can cause debilitating illnesses and can result in anemia, diarrhea, dehydration, loss of appetite, or death.

[0015]Despite some advances in drug availability and public health infrastructure and the near elimination of one tropical nematode (the water-borne Guinea worm), most nematode diseases have remained intractable problems. Treatment of hookworm diseases with anthelmintic drugs, for instance, has not provided adequate control in regions of high incidence because rapid re-infection occurs after treatment. In fact, over the last 50 years, while nematode infection rates have fallen in the United States, Europe, and Japan, the overall number of infections worldwide has kept pace with the growing world population. Large scale initiatives by regional governments, the World Health Organization, foundations, and pharmaceutical companies are now underway attempting to control nematode infections with currently available tools, including three programs for control of Onchocerciasis (river blindness) in Africa and the Americas using ivermectin and vector control; The Global Alliance to Eliminate Lymphatic Filariasis using DEC, albendazole, and ivermectin; and the highly successful Guinea Worm Eradication Program.

[0016]The obvious missing weapons in the fight to control human parasitic nematodes are vaccines. Systematic vaccination against childhood diseases likes measles, mumps, polio, etc. has been among the most important and cost effective factors increasing lifespan and wellness in the developed world over the course of the 20th century. Expansion of these health gains into the developing world using existing vaccines, as the Gates Foundation is supporting, has the potential to capture immediate health gains. Such an approach could be equally effective for nematodes if such vaccines existed.

[0017]Research into vaccines for parasites, from malaria to nematode worms, has shown parasites to be challenging organisms to control by immunization since, unlike many viruses, antibody or cellular responses to most surface antigens fail to result in control. However, multiple vaccines for the control of nematode parasites in animals have shown efficacy either in testing or in veterinary use. For example, vaccination of dogs with irradiated hookworm larva results in high levels of protection to subsequent hookworm challenge. The same approach works for protection of gerbils from filarial worms. Unfortunately, parasitic nematodes cannot be grown in the quantities required for such a killed whole organism vaccination approach, with limited exceptions such as the Intervet niche product HuskVac® for cattle lungworm. The greatest commercial success to date in immunization for veterinary parasites has come from the recombinant antigen vaccines TickGARD® and Gavac® for cattle which block the lifecycle of the ectoparasite Boophilus microplus, a bovine tick. Rather than utilizing a surface antigen, each of these vaccines targets an antigen, Bm86, expressed on the luminal surface of the tick mid-gut so that as the ectoparasite drinks the host's blood, it is exposed to antibodies that interfere with intestinal function. The same intestinal target approach has been successful in small-scale trials against the sheep parasitic nematode Haemonchus, a blood feeder similar to hookworms that can be controlled by vaccination with the purified parasite intestinal microvilli protein H11. Importantly, unlike a typical vaccine where the antigen is used to trigger a cascade of immune attack on the entire organism, the parasite intestinal approach utilizes an antibody response to "knockout" the function of a crucial nematode gene product, similar to the function of a drug.

[0018]Finding effective compounds and vaccines against parasitic nematodes has been complicated by the fact that the parasites have not been amenable to culturing in the laboratory. Parasitic nematodes are often obligate parasites (i.e., they can only complete their lifecycles in their respective hosts, such as in plants, animals, and/or humans) with slow generation times. Thus, they are difficult to grow under artificial conditions, making genetic and molecular experimentation difficult or impossible. To circumvent these limitations, scientists have used Caenorhabidits elegans as a model system for parasitic nematode discovery efforts.

[0019]C. elegans is a small free-living bacteriovorous nematode that for many years has served as an important model system for multicellular animals (Burglin (1998) Int. J. Parasitol. 28(3):395-411). The genome of C. elegans has been completely sequenced and the nematode shares many general developmental and basic cellular processes with vertebrates (Ruvkin et al. (1998) Science 282:2033-41). This, together with its short generation time and ease of culturing, has made it a model system of choice for higher eukaryotes (Aboobaker et al. (2000) Ann. Med. 32:23-30).

[0020]Although C. elegans serves as a good model system for vertebrates, it is an even better model for study of parasitic nematodes, as C. elegans and other nematodes share unique biological processes not found in vertebrates. For example, unlike vertebrates, nematodes produce and use chitin, have gap junctions comprised of innexin rather than connexin and contain glutamate-gated chloride channels rather than glycine-gated chloride channels (Bargmann (1998) Science 282:2028-33). The latter property is of particular relevance given that the avermectin class of drugs is thought to act at glutamate-gated chloride receptors and is highly selective for invertebrates (Martin (1997) Vet. J. 154:11-34).

[0021]A subset of the genes involved in nematode-specific processes will be conserved in nematodes and absent or significantly diverged from homologues in other phyla. In other words, it is expected that at least some of the genes associated with functions unique to nematodes will have restricted phylogenetic distributions. The completion of the C. elegans genome project and the growing database of expressed sequence tags (ESTs) from numerous nematodes facilitate identification of these "nematode-specific" genes. In addition, conserved genes involved in nematode-specific processes are expected to retain the same or very similar functions in different nematodes. This functional equivalence has been demonstrated in some cases by transforming C. elegans with homologous genes from other nematodes (Kwa et al. (1995) J. Mol. Biol. 246:500-10; Redmond et al. (2001) Mol. Biochem. Parasitol. 112:125-131). This sort of data transfer has been shown in cross phyla comparisons for conserved genes and is expected to be more robust among species within a phylum. Consequently, C. elegans and other free-living nematode species are likely excellent surrogates for parasitic nematodes with respect to conserved nematode processes.

[0022]Many expressed genes in C. elegans and certain genes in other free-living nematodes can be "knocked out" genetically by a process referred to as RNA interference (RNAi), a technique that provides a powerful experimental tool for the study of gene function in nematodes (Fire et al. (1998) Nature 391(6669):806-811; Montgomery et al. (1998) Proc. Natl. Acad Sci USA 95(26):15502-15507). Treatment of a nematode with double-stranded RNA of a selected gene triggers the destruction of expressed sequences transcribed from that gene, thus reducing or eliminating expression of the corresponding protein. By preventing the translation of specific proteins, their functional significance and essentiality to the nematode can be assessed. Determination of essential genes and their corresponding proteins using C. elegans as a model system will assist in the rational design of anti-parasitic nematode control products.

SUMMARY

[0023]The invention features nucleic acid molecules encoding Strongyloides stercoralis, Meloidogyne javanica, Heterodera glycines and Brugia malayi PANZP proteins, e.g., PANZP1 and PANZP2. S. stercoralis is a nematode parasite that infects humans, primates, and dogs. It is one of the few nematodes that can multiply within its host and can multiply unchecked in immunosuppressed individuals. M. javanica is a Root Knot Nematode that causes substantial damage to several crops, including cotton, tobacco, pepper, and tomato. H. glycines, referred to as Soybean Cyst Nematode, is a major pest of soybean. B. malayi, is an arthropod vectored human parasite that is one of a causative agents of lymphatic filariasis, a disease that afflicts roughly 120 million people world wide. The PANZP proteins of the invention resemble the Drosophila melanogaster no-mechanoreceptor potential A (nompA) and Sp71 proteins. The PANZP proteins of the invention include Plasminogen Apple Nematode (PAN) and Zona Pellucida (ZP) domains.

[0024]The PANZP nucleic acids and polypeptides of the invention allow for the identification of nematode species. The nucleic acids and polypeptides of the invention also allow for the identification of compounds that bind to or alter the activity of PANZP polypeptides as well as compounds that alter the expression of PANZP polypeptides. Such compounds may provide a means for combating diseases and infestations caused by nematodes, particularly those caused by S. stercoralis, M. javanica, H. glycines and B. malayi (e.g., in mammals and plants). These nucleic acids and polypeptides also allow for the vaccination of animals and humans against nematode parasites. In addition, anti-nematode peptide or protein inhibitors and antibodies directed against nematode PAN and ZP containing proteins can be expressed in plants (plantibodies) to produce transgenic nematode resistance.

[0025]The invention is based, in part, on the identification of a cDNA encoding S. stercoralis PANZP1 (SEQ ID NO: 1). This 3750 nucleotide cDNA has a 3369 nucleotide open reading frame (SEQ ID NO: 5) encoding an 1122 amino acid polypeptide (SEQ ID NO: 3). The nucleotide and amino acid sequence of S. stercoralis PANZP1 is shown in FIGS. 1A-1C.

[0026]The invention is also based, in part, on the identification of a cDNA encoding S. stercoralis PANZP2 (SEQ ID NO: 2). This 1951 nucleotide cDNA has a 1674 nucleotide open reading frame (SEQ ID NO: 6) encoding a 557 amino acid polypeptide (SEQ ID NO: 4). The nucleotide and amino acid sequence of S. stercoralis PANZP2 is shown in FIGS. 2A-2B.

[0027]The invention is also based, in part, on the identification of a cDNA encoding M. javanica PANZP1 (SEQ ID NO: 7). This 3848 nucleotide cDNA has a 3633 nucleotide open reading frame (SEQ ID NO: 13) encoding a 1210 amino acid polypeptide (SEQ ID NO: 10). The nucleotide and amino acid sequence of M. javanica PANZP2 is shown in FIGS. 3A-3C.

[0028]The invention is also based, in part, on the identification of a partial cDNA fragment encoding H. glycines PANZP1 (SEQ ID NO: 8). This 752 nucleotide partial cDNA fragment has a 750 nucleotide open reading frame (SEQ ID NO: 14) encoding a 250 amino acid polypeptide (SEQ ID NO: 11). The nucleotide and amino acid sequence of H. glycines PANZP2 is shown in FIG. 4.

[0029]The invention is also based, in part, on the identification of a partial cDNA fragment encoding B. malayi PANZP1 (SEQ ID NO: 9). This 2808 nucleotide partial cDNA fragment has a 2643 nucleotide open reading frame (SEQ ID NO: 15) encoding a 881 amino acid polypeptide (SEQ ID NO: 12). The nucleotide and amino acid sequence of B. malayi PANZP2 is shown in FIGS. 5A-5B.

[0030]In one aspect, the invention features novel nematode PAN and ZP containing receptor-like polypeptides. Such polypeptides include purified polypeptides having the amino acid sequences set forth in SEQ ID NO: 3, 4, 10, 11 and/or 12. Also included are polypeptides having an amino acid sequence that is at least about 80%, 85%, 90%, 95%, or 98% identical to SEQ ID NO: 3, 4, 10, 11 and/or 12 as well as polypeptides having a sequence that differs from that of SEQ ID NO: 3, 4, 10, 11 and/or 12 at 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 residues (amino acids). The purified polypeptides can be encoded by a nematode gene, e.g., a nematode gene other than a C. elegans gene. For example, the purified polypeptide has a sequence other than SEQ ID NO: 16, 17, and 18 (C. elegans PANZP1 and PANZP2 proteins). The purified polypeptides can further include a heterologous amino acid sequence, e.g., an amino-terminal or carboxy-terminal sequence. Also featured are purified polypeptide fragments of the aforementioned PANZP polypeptides, e.g., a fragment of at least about 20, 30, 40, 50, 75, 85, 104, 106, 113 150, 200, 250 amino acids. Non-limiting examples of such fragments include: fragments from about amino acid 20 to 110 and 100 to 210 of SEQ ID NO: 3, 4, 10, 11 and/or 12 and 200 to 310, 300 to 400 and 400 to 500 of SEQ ID NO: 3, 4, 10 and/or 12. The polypeptide or fragment thereof can be modified, e.g., processed, truncated, modified (e.g. by glycosylation, phosphorylation, acetylation, myristylation, prenylation, palmitoylation, amidation, addition of glycerophosphatidyl inositol), or any combination of the above. Certain PANZP polypeptides comprise a sequence of 600, 700, 800, 900, 1000, 1100, 1200, 1300 amino acids or fewer. The invention also features polypeptides comprising, consisting essentially of or consisting of the aforementioned polypeptides. Also within the invention are polypeptides, including immunogenic polypeptides comprising (or consisting of or consisting essentially of) a PAN or ZP domain of SEQ ID NO: 3, 4, 10, 11, or 12, e.g., a PAN or ZP domain listed in Table 3.

[0031]In another aspect, the invention features novel isolated nucleic acid molecules encoding nematode PAN and ZP containing receptor-like polypeptides. Such isolated nucleic acid molecules include nucleic acids having the nucleotide sequence set forth in SEQ ID NO: 1, 2, 7, 8 or SEQ ID NO: 9. Also included are isolated nucleic acid molecules having the same sequence as or encoding the same polypeptide as a nematode PAN and ZP containing receptor-like gene (other than a C. elegans PANZP genes).

[0032]Also featured are: 1) isolated nucleic acid molecules having a strand that hybridizes under low stringency conditions to a single stranded probe of the sequences of SEQ ID NO: 1, 2, 7, 8, 9, or their complements and, optionally, encodes polypeptides of between 500 and 1300 amino acids; 2) isolated nucleic acid molecules having a strand that hybridizes under high stringency conditions to a single stranded probe of the sequence of SEQ ID NO: 1, 2, 7, 8, 9 or their complements and, optionally, encodes polypeptides of between 500 and 1300 amino acids; 3) isolated nucleic acid fragments of a PANZP nucleic acid molecule, e.g., a fragment of SEQ ID NO:1, 2, 7, 8 or 9 that is about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 1000, 1500, 2000, 2500, 3000 and 3500 or more nucleotides in length or ranges between such lengths; and 4) oligonucleotides that are complementary to a PANZP nucleic acid molecule or a PANZP nucleic acid complement, e.g., an oligonucleotide or probe of about 10, 15, 18, 20, 22, 24, 28, 30, 35, 40, 50, 60, 70, 80, or more nucleotides in length. Exemplary oligonucleotides are oligonucleotides which anneal to a site located between nucleotides about 1 to 96, 1 to 180, 1 to 270, 1 to 324, 96 to 324, 96 to 345, 324 to 345, 324 to 603, 345 to 603, 345 to 618, 603 to 618, 603 to 752 of SEQ ID NO: 1, 2, 7, 8 or 9; 618 to 1197, 906 to 1524, 1524 to 1951 of SEQ ID NO: 1, 2, 7 or 9; 1197 to 2124, 1524 to 2808 of SEQ ID NO: 1, 7, or 9; 1197 to 2124, 1524 to 3750 of SEQ ID NO: 1 or 7; 1197 to 2124, 1524 to 3848 of SEQ ID NO: 7. Nucleic acid fragments include the following non-limiting examples: nucleotides about 1 to 200 of SEQ ID NO: 1, 2, 7, 8, or 9, 100 to 300, 200 to 400, 300 to 500, 400 to 700, 500 to 800, 600 to 1200, 1200 to 1951 of SEQ ID NO: 1, 2, 7, or 9, 1200 to 2808 of SEQ ID NO: 1, 7 or 9; 1200 to 3750 of SEQ ID NO: 1 or 7, 1200 to 3848 of SEQ ID NO: 7. Also within the invention are nucleic acid molecules that hybridize under stringent conditions to nucleic acid molecule comprising SEQ ID NO: 1, 2, 7, 8 or 9 and comprise 4000, 3000, 2000, 1000 or fewer nucleotides. The isolated nucleic acid can further include a heterologous promoter or other sequences required for transcription or translation of the nucleic acid molecule in a cell, e.g., a mammalian or eukaryotic or prokaryotic cell, operably linked to the PANZP nucleic acid molecule. The isolated nucleic acid molecule can encode a polypeptide having PAN and ZP containing receptor-like function.

[0033]A molecule featured herein can be from a nematode of the class Araeolaimida, Ascaridida, Chromadorida, Desmodorida, Diplogasterida, Monhysterida, Mononchida, Oxyurida, Rhigonematida, Spirurida, Enoplia, Desmoscolecidae, Rhabditida, or Tylenchida. Alternatively, the molecule can be from a species of the class Rhabditida, particularly a species other than C. elegans.

[0034]In another aspect, the invention features a vector, e.g., a vector containing an aforementioned nucleic acid. The vector can further include one or more regulatory elements, e.g., a heterologous promoter or elements required for translation. The regulatory elements for directing transcription and translation elements can be suitable for expression in bacteria, plants, animals, or insects. The regulatory elements can be operably linked to the PAN and ZP containing receptor-like nucleic acid molecules in order to express a PANZP nucleic acid molecule. In yet another aspect, the invention features a transgenic cell or transgenic organism having in its genome a transgene containing an aforementioned PANZP nucleic acid molecule and a heterologous nucleic acid, e.g., a heterologous promoter.

[0035]In still another aspect, the invention features an antibody, e.g., an antibody, antibody fragment, or derivative thereof that binds specifically to an aforementioned polypeptide. Such antibodies can be polyclonal or monoclonal antibodies. The antibodies can be modified, e.g., humanized, rearranged as a single-chain, or CDR-grafted. The antibodies may be directed against a fragment, a peptide, or a discontinuous epitope from a PANZP polypeptide. The antibody need not include domain that trigger an immune response.

[0036]In another aspect, the invention features a method of screening for a compound that binds to a nematode PANZP polypeptide, e.g., an aforementioned polypeptide. The method includes providing the nematode polypeptide; contacting a test compound to the polypeptide; and detecting binding of the test compound to the nematode polypeptide. In one embodiment, the method further includes contacting the test compound to a mammalian PAN or ZP domain-containing polypeptide and detecting binding of the test compound to the mammalian PAN or ZP polypeptide in order to identify compounds with selective binding activity. A test compound that binds the nematode PANZP polypeptide with at least 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, or 100-fold affinity greater relative to its affinity for the mammalian (e.g., a human) PAN or ZP polypeptide can be identified.

[0037]The invention also features methods for identifying compounds that alter (increases or decreases) the association of a nematode PAN and ZP containing domain receptor-like polypeptide with a substrate such as a small molecule or protein. The method includes contacting the test compound to the nematode PANZP polypeptide; and detecting a decrease in the binding of the PANZP protein to the substrate. A decrease in the level of PANZP polypeptide binding to the substrate relative to the PANZP polypeptide binding to the substrate in the absence of the test compound is an indication that the test compound is an inhibitor of the PANZP activity. The inhibitor can be a direct competitor of the binding or an allosteric inhibitor that prevents binding of the PANZP polypeptide to other molecules or proteins. Such inhibitory compounds are potential selective agents for reducing the viability of a nematode expressing a PANZP polypeptide, e.g., S. stercoralis, M. javanica, H. glycines and B. malayi. These methods can also include contacting the compound with a vertebrate PAN containing protein (e.g., human Factor XI) or a vertebrate ZP containing polypeptide (e.g., human uromodulin) and detecting binding of the compounds to the proteins. A compound that binds to the nematode PAN and ZP containing receptor-like polypeptides to a greater extent than it binds to vertebrate PAN or ZP polypeptides could be useful as a selective inhibitor of the nematode polypeptide. A desirable compound can exhibit 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold or greater selective affinity against the nematode polypeptide.

[0038]Another featured method is a method of screening for a compound that alters (increases or decreases) the binding of a PAN and ZP containing receptor-like polypeptide to a small molecule or protein substrate or alters the regulation of other polypeptides by the PANZP protein. The method includes providing the PANZP polypeptide; contacting a test compound to the PANZP polypeptide; and detecting an alteration of the binding activity or the activity of polypeptides regulated by the PANZP protein, wherein a change in binding activity of the PANZP polypeptides to its substrates or a change in the activity of other polypeptides downstream of the PANZP protein binding activity relative to the binding activity of the PANZP protein or the activity of downstream polypeptides in the absence of the test compound is an indication that the test compound alters the activity of the PANZP polypeptide(s). The method can further include contacting the test compound to a vertebrate PAN containing protein (e.g., human Factor XI) or a vertebrate ZP containing polypeptide (e.g., human uromodulin) and detecting binding of the compounds to the proteins and measuring the effects of the compounds on the activities of the vertebrate proteins. A test compound that alters the activity of the nematode PANZP polypeptide at a given concentration and that does not substantially alter the activity of the vertebrate PAN or ZP containing polypeptide or downstream polypeptides at the given concentration can be identified. An additional method includes screening for both binding to a PANZP polypeptide and for an alteration in the binding activity of a PANZP polypeptide. Yet another featured method is a method of screening for a compound that alters (increases or decreases) the viability or fitness of a transgenic cell or organism or nematode. The transgenic cell or organism has a transgene that expresses a PAN and ZP containing receptor-like polypeptide. The method includes contacting a test compound to the transgenic cell or organism and detecting changes in the viability or fitness of the transgenic cell or organism. This alteration in viability or fitness can be measured relative to an otherwise identical cell or organism that does not harbor the transgene.

[0039]Also featured is a method of screening for a compound that alters the expression of a nematode nucleic acid encoding a PAN and ZP containing receptor-like polypeptide, e.g., a nucleic acid encoding a S. stercoralis, M. javanica, H. glycines or B. malayi PANZP polypeptide. The method includes contacting a cell, e.g., a nematode cell, with a test compound and detecting expression of a nematode nucleic acid encoding a PANZP polypeptide, e.g., by hybridization to a probe complementary to the nematode nucleic acid encoding a PANZP polypeptide or by contacting polypeptides isolated from the cell with a compound, e.g., antibody that binds a PANZP polypeptide. Compounds identified by the method are also within the scope of the invention.

[0040]In yet another aspect, the invention features a method of treating a disorder (e.g., an infection) caused by a nematode, e.g., S. stercoralis, M. javanica, H. glycines or B. malayi in a subject, e.g., a host plant or host animal. The method includes administering to the subject an effective amount of an inhibitor of a PANZP polypeptide activity or an inhibitor of expression of a PANZP polypeptide. Non-limiting examples of such inhibitors include: an antisense nucleic acid (or PNA) to a PANZP nucleic acid, a double-stranded RNA inhibitor capable of triggering RNA interference, an antibody to a PANZP polypeptide, an inhibitory peptide or protein, or a small molecule identified as a PANZP polypeptide inhibitor by a method described herein.

[0041]Also featured is a method of preventing or treating a disorder (e.g., an infection) caused by a nematode (e.g., S. stercoralis or B. malayi) in a host animal by vaccinating the animal with nematode PANZP protein or nucleic acid (e.g., a PANZP DNA vaccine) or both. Also featured is a method of preventing infection of a plant host by a nematode (e.g., M. javanica or H. glycines) by expressing an antisense RNA or double-stranded RNA to the nematode PANZP nucleic acid or by expressing antibodies or other proteins which interfere with the function of the nematode PANZP protein.

[0042]In yet another aspect, the invention features methods for the production of nematode resistant transgenic plants by obtaining specific antibodies to nematode PANZP proteins, deriving the nucleic acid sequences that code for these antibodies and expressing these nucleic acids in plants under the control of appropriate promoters (e.g., constitutive or inducible, non-tissue specific, root specific, feeding site specific) and with other suitable control sequences (e.g., enhancers, introns, UTRs, terminators) to produce antibodies to the PANZP proteins in plants (plantibodies).

[0043]Also featured in this invention is a method of producing nematode resistant transgenic plants by the expression of nucleic acids coding for PANZP nematode proteins or portions of PANZP nematode proteins that can produce PANZP peptides or polypeptides capable of dominant negative interaction with endogenous nematode PAN and ZP containing receptor-like proteins upon ingestion by plant parasitic nematodes.

[0044]Also within the scope of this invention is the use of selection techniques like phage display or polysome display to generate peptides or proteins which bind to and inhibit the function of nematode PANZP proteins.

[0045]A "purified polypeptide", as used herein, refers to a polypeptide that has been separated from other proteins, lipids, and nucleic acids with which it is naturally associated. The polypeptide can constitute at least 10, 20, 50 70, 80 or 95% by dry weight of the purified preparation.

[0046]An "isolated nucleic acid" is a nucleic acid, the structure of which is not identical to that of any naturally occurring nucleic acid, or to that of any fragment of a naturally occurring genomic nucleic acid spanning more than three separate genes. The term therefore covers, for example: (a) a DNA which is part of a naturally occurring genomic DNA molecule but is not flanked by both of the nucleic acid sequences that flank that part of the molecule in the genome of the organism in which it naturally occurs; (b) a nucleic acid incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein. Specifically excluded from this definition are nucleic acids present in mixtures of different (i) DNA molecules, (ii) transfected cells, or (iii) cell clones in a DNA library such as a cDNA or genomic DNA library. Isolated nucleic acid molecules according to the present invention further include molecules produced synthetically, as well as any nucleic acids that have been altered chemically and/or that have modified backbones.

[0047]Although the phrase "nucleic acid molecule" primarily refers to the physical nucleic acid molecule and the phrase "nucleic acid sequence" refers to the sequence of the nucleotides in the nucleic acid molecule, the two phrases can be used interchangeably.

[0048]The term "substantially pure" as used herein in reference to a given polypeptide means that the polypeptide is substantially free from other biological macromolecules. The substantially pure polypeptide is at least 75% (e.g., at least 80, 85, 95, or 99%) pure by dry weight. Purity can be measured by any appropriate standard method, for example, by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

[0049]A percent identity for any subject nucleic acid or amino acid sequence (e.g., any of the PANZP polypeptides described herein) relative to another "target" nucleic acid or amino acid sequence can be determined as follows. First, a target nucleic acid or amino acid sequence of the invention can be compared and aligned to a subject nucleic acid or amino acid sequence, using the BLAST 2 Sequences (Bl2seq) program from the stand-alone version of BLASTZ containing BLASTN and BLASTP (e.g., version 2.0.14). The stand-alone version of BLASTZ can be obtained at or www.ncbi.nlm.nih.gov>. Instructions explaining how to use BLASTZ, and specifically the Bl2seq program, can be found in the `readme` file accompanying BLASTZ. The programs also are described in detail by Karlin et al. (1990) Proc. Natl. Acad. Sci. 87:2264; Karlin et al. (1990) Proc. Natl. Acad. Sci. 90:5873; and Altschul et al. (1997) Nucl. Acids Res. 25:3389.

[0050]Bl2seq performs a comparison between the subject sequence and a target sequence using either the BLASTN (used to compare nucleic acid sequences) or BLASTP (used to compare amino acid sequences) algorithm. Typically, the default parameters of a BLOSUM62 scoring matrix, gap existence cost of 11 and extension cost of 1, a word size of 3, an expect value of 10, a per residue cost of 1 and a lambda ratio of 0.85 are used when performing amino acid sequence alignments. The output file contains aligned regions of homology between the target sequence and the subject sequence. Once aligned, a length is determined by counting the number of consecutive nucleotides or amino acid residues (i.e., excluding gaps) from the target sequence that align with sequence from the subject sequence starting with any matched position and ending with any other matched position. A matched position is any position where an identical nucleotide or amino acid residue is present in both the target and subject sequence. Gaps of one or more residues can be inserted into a target or subject sequence to maximize sequence alignments between structurally conserved domains (e.g., α-helices, β-sheets, and loops).

[0051]The percent identity over a particular length is determined by counting the number of matched positions over that particular length, dividing that number by the length and multiplying the resulting value by 100. For example, if (i) a 500 amino acid target sequence is compared to a subject amino acid sequence, (ii) the Bl2seq program presents 200 amino acids from the target sequence aligned with a region of the subject sequence where the first and last amino acids of that 200 amino acid region are matches, and (iii) the number of matches over those 200 aligned amino acids is 180, then the 500 amino acid target sequence contains a length of 200 and a sequence identity over that length of 90% (i.e., 180/200×100=90).

[0052]It will be appreciated that a nucleic acid or amino acid target sequence that aligns with a subject sequence can result in many different lengths with each length having its own percent identity. It is noted that the percent identity value can be rounded to the nearest tenth. For example, 78.11, 78.12, 78.13, and 78.14 is rounded down to 78.1, while 78.15, 78.16, 78.17, 78.18, and 78.19 is rounded up to 78.2. It is also noted that the length value will always be an integer.

[0053]The identification of conserved regions in a template, or subject, polypeptide can facilitate homologous polypeptide sequence analysis. Conserved regions can be identified by locating a region within the primary amino acid sequence of a template polypeptide that is a repeated sequence, forms some secondary structure (e.g., helices and beta sheets), establishes positively or negatively charged domains, or represents a protein motif or domain. See, e.g., the Pfam web site describing consensus sequences for a variety of protein motifs and domains at http://www.sanger.ac.uk/Pfam/ and http://genome.wustl.edu/Pfam/. A description of the information included at the Pfam database is described in Sonnhammer et al. (1998) Nucl. Acids Res. 26: 320-322; Sonnhammer et al. (1997) Proteins 28:405-420; and Bateman et al. (1999) Nucl. Acids Res. 27:260-262. From the Pfam database, consensus sequences of protein motifs and domains can be aligned with the template polypeptide sequence to determine conserved region(s).

[0054]As used herein, the term "transgene" means a nucleic acid sequence (encoding, e.g., one or more subject polypeptides), which is partly or entirely heterologous, i.e., foreign, to the transgenic plant, animal, or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic plant, animal, or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the plant's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout). A transgene can include one or more transcriptional regulatory sequences and other nucleic acid sequences, such as introns, that may be necessary for optimal expression of the selected nucleic acid, all operably linked to the selected nucleic acid, and may include an enhancer sequence.

[0055]As used herein, the term "transgenic cell" refers to a cell containing a transgene.

[0056]As used herein, a "transgenic plant" is any plant in which one or more, or all, of the cells of the plant includes a transgene. The transgene can be introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by T-DNA mediated transfer, electroporation, or protoplast transformation. The transgene may be integrated within a chromosome, or it may be extrachromosomally replicating DNA.

[0057]As used herein, the term "tissue-specific promoter" means a DNA sequence that serves as a promoter, i.e., regulates expression of a selected DNA sequence operably linked to the promoter, and which affects expression of the selected DNA sequence in specific cells of a tissue, such as a leaf, root, or stem.

[0058]As used herein, the terms "hybridizes under stringent conditions" and "hybridizes under high stringency conditions" refer to conditions for hybridization in 6× sodium chloride/sodium citrate (SSC) buffer at about 45° C., followed by two washes in 0.2×SSC buffer, 0.1% SDS at 60° C. or 65° C. As used herein, the term "hybridizes under low stringency conditions" refers to conditions for hybridization in 6×SSC buffer at about 45° C., followed by two washes in 6×SSC buffer, 0.1% (w/v) SDS at 50° C.

[0059]A "heterologous promoter", when operably linked to a nucleic acid sequence, refers to a promoter which is not naturally associated with the nucleic acid sequence.

[0060]As used herein, an agent with "anthelmintic activity" is an agent, which when tested, has measurable nematode-killing activity or results in infertility or sterility in the nematodes such that unviable or no offspring result. In the assay, the agent is combined with nematodes, e.g., in a well of microtiter dish having agar media or in the soil containing the agent. Staged adult nematodes are placed on the media. The time of survival, viability or number of offspring, and/or the movement of the nematodes are measured. An agent with "anthelmintic activity" reduces the survival time of adult nematodes relative to unexposed similarly staged adults, e.g., by about 20%, 40%, 60%, 80%, or more. In the alternative, an agent with "anthelmintic activity" may also cause the nematodes to cease replicating, regenerating, and/or producing viable progeny, e.g., by about 20%, 40%, 60%, 80%, or more.

[0061]As used herein, the term "binding" refers to the ability of a first compound and a second compound that are not covalently linked to physically interact. The apparent dissociation constant for a binding event can be 1 mM or less, for example, 10 nM, 1 nM, 0.1 nM or less.

[0062]As used herein, the term "binds specifically" refers to the ability of an antibody to discriminate between a target ligand and a non-target ligand such that the antibody binds to the target ligand and not to the non-target ligand when simultaneously exposed to both the given ligand and non-target ligand, and when the target ligand and the non-target ligand are both present in molar excess over the antibody.

[0063]As used herein, the term "altering an activity" refers to a change in level, either an increase or a decrease in the activity, (e.g., an increase or decrease in the ability of the polypeptide to bind or regulate other polypeptides or molecules) particularly a PANZP activity. The change can be detected in a qualitative or quantitative observation. If a quantitative observation is made, and if a comprehensive analysis is performed over a plurality of observations, one skilled in the art can apply routine statistical analysis to identify modulations where a level is changed and where the statistical parameter, the p value, is less than 0.05.

[0064]In part, the nematode PAN and ZP containing receptor-like proteins and nucleic acids described herein are novel targets for anti-nematode vaccines, pesticides, and drugs. These polypeptides are also useful for the creation of nematode resistant transgenic plants. Inhibition of these molecules can provide means of inhibiting nematode metabolism and/or the nematode life-cycle.

[0065]The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.

DESCRIPTION OF DRAWINGS

[0066]FIGS. 1A-1C depict the cDNA sequence of a S. stercoralis PAN and ZP containing receptor-like protein 1 (PANZP1) (SEQ ID NO: 1), its corresponding encoded amino acid sequence (SEQ ID NO: 3), and its open reading frame (SEQ ID NO: 5).

[0067]FIGS. 2A-2B depict the cDNA sequence of a S. stercoralis PAN and ZP containing receptor-like protein 2 (PANZP2) (SEQ ID NO: 2), its corresponding encoded amino acid sequence (SEQ ID NO: 4), and its open reading frame (SEQ ID NO: 6).

[0068]FIGS. 3A-3C depict the cDNA sequence of a M. javanica PAN and ZP containing receptor-like protein 1 (PANZP1) (SEQ ID NO: 7), its corresponding encoded amino acid sequence (SEQ ID NO: 10), and its open reading frame (SEQ ID NO: 13).

[0069]FIG. 4 depicts the partial cDNA fragment of the sequence of a H. glycines PAN and ZP containing receptor-like protein 1 (PANZP1) (SEQ ID NO: 8), its corresponding encoded amino acid sequence (SEQ ID NO: 11), and its open reading frame (SEQ ID NO: 14).

[0070]FIGS. 5A-5B depict the partial cDNA fragment of a sequence of a B. malayi PAN and ZP containing receptor-like protein 1 (PANZP1) (SEQ ID NO: 9), its corresponding encoded amino acid sequence (SEQ ID NO: 12), and its open reading frame (SEQ ID NO: 15).

[0071]FIG. 6 depicts an alignment showing schematic depictions of a number of PAN and ZP domain containing proteins including: D. melanogaster GenBank® Accession No. NP--524831, C. elegans GenBank® Accession No. NP--505875, C. elegans GenBank® Accession No. NP--502253, C. elegans GenBank® Accession No. NP--505874, C. elegans GenBank® Accession No. NP--502699, C. elegans GenBank® Accession No. NP--501670, C. elegans GenBank® Accession No. NP--502252, C. elegans GenBank® Accession No. NP--491706, C. elegans GenBank® Accession No. AAB52479, D. melanogaster GenBank® Accession No. AAK09434.

[0072]FIG. 7 is an alignment of the sequences of S. stercoralis, M. javanica, H. glycines and B. malayi PAN and ZP containing receptor-like polypeptide proteins and fragments (PANZP1; SEQ ID NO: 3, 10, 11, 12), C. elegans PANZP1 polypeptides (SEQ ID NO: 16 and 17) and C. briggsae PANZP1 polypeptide (SEQ ID NO: 45).

[0073]FIG. 8 is an alignment of the sequences of S. stercoralis PAN and ZP containing receptor-like polypeptide protein 2 (PANZP2; SEQ ID NO: 4), C. elegans PANZP2 polypeptide (SEQ ID NO: 18) and C. briggsae PANZP2 (SEQ ID NO: 46).

DETAILED DESCRIPTION

[0074]An important step toward the development of new anthelmintic agents is the identification of nematode-specific gene products that can serve as targets for inhibitory peptides and proteins (e.g., antibodies) and antiparasitic chemicals. An ideal target gene would be essential for nematode viability, such that interference with the target would result in the arrest of parasite growth and reproduction. In addition, the protein product of the target gene should be accessible to drugs, small chemicals or antibodies. Finally, the ideal target should be specific to nematodes and not closely related to any gene in plants or animals. Based on these criteria, we have identified two C. elegans genes, PANZP1 (C34G6.6) and PANZP2 (F52B11.3), as important targets for the development of vaccines, small molecule anthelmintic chemicals for both human and animal parasites and nematicides for plant parasitic nematode control. In addition, inhibitors of PANZP1 and PANZP2 could be used in the design of transgenic plants producing anti-nematode peptides, small natural products with nematicidal activity, and antibodies (plantibodies) directed against endogenous nematode targets.

[0075]PANZP1 and PANZP2 are predicted to be secreted, membrane-bound proteins. Close homologs of the C. elegans PANZP1 genes were identified in an intestinal library from Ascaris suum, suggesting that these genes are expressed in the nematode gastrointestinal system. The presence of C-terminal transmembrane domains suggests that the proteins are anchored in the membrane. Domain analysis of the PANZP1 and PANZP2 sequences using TargetP (a secretion prediction tool available on the internet at cbs.dtu.dk/services/TargetP/), PFAM (a domain analysis tool available on the internet at pfam.wustl.edu;) and TMHMM (a transmembrane domain prediction tool available on the internet at cbs.dtu.dk/services/TMHMM) indicates the presence of a secretion leader, several Plasminogen Apple Nematode (PAN) domains and a single C-terminal Zona Pellucida (ZP) domain before the transmembrane helix which is followed by a short C-terminal tail. The domain architecture of PANZP1 and PANZP2 is illustrated at the top of FIG. 6 along with the domain structure of a number of C. elegans and D. melanogaster PAN and ZP domain-containing proteins. The C. elegans genome contains several predicted proteins with a similar modular arrangement to PANZP1 and PANZP2. Of these, two (C34G6.6a and C34G6.6b) appear to be isoforms of the same gene (C34G6.6[p] is an older gene prediction), but the others appear to represent unique loci. Additionally, homologs containing the same domain layout are found in Drosophila melanogaster and the Anopheles gambiae genomes.

[0076]PAN domains and the related PAN_AP domains are typically 80-90 amino acids in length and are defined by a characteristic pattern of six cysteine residues and conserved hydrophobic residues. The cysteine residues form three highly conserved disulfide bonds linking the first and sixth, second and fifth, and third and fourth cysteine residues present in each repeat (McMullen et al. (1991) Biochemistry, 30(8):2050-2056; Brown et al. (2001) FEBS Lett. 497(1)31-38). The conserved disulfide linkages give the PAN domains a characteristic apple-like globular structure. PAN domains were originally referred to as "Apple" domains based on this characteristic structure.

[0077]PAN and PAN_AP domains have been extensively studied in the mammalian blood coagulation proteins Factor XI (FXI), plasma pre-kallikrein (PK), and plasminogen. The specific involvement of the apple (or PAN) domains in protein-protein interactions that mediate blood clotting has been demonstrated (Baglia et al. (1995) J. Biol. Chem. 270(12):6734-6740; Sun & Gailani (1996) J. Biol. Chem. 271(46):29023-29028; Ho et al. (2000) Biochemistry, 39(2):316-323; Renne et al. (2002) J. Biol. Chem. 277(7):4892-4899). PAN domains are also thought to mediate protein-protein or protein-carbohydrate interactions in adhesive proteins that are secreted by apicomplexan parasites, single-celled eukaryotic organisms that invade target host cells in order to replicate. PAN domain-containing proteins are secreted by these organisms and are thought to play a role in the recognition and attachment of the parasite to host cells (Brown et al. (2001) FEBS Lett. 497(1)31-38; Brecht et al. (2001) J. Biol. Chem. 276(6):4119-4127).

[0078]The C. elegans genome contains at least 20 predicted proteins that contain one or more PAN domains. Although the level of sequence percent identity is low among the PAN domain family members, the pattern of conserved cysteines and hydrophobic residues establishes the three dimensional structure that is characteristic of the domain (Tordai et al. (1999) FEBS Lett. 461(1-2):63-67). The possibility for a high degree of sequence diversity within the family enables the domain to mediate a large number of protein-protein interactions.

[0079]In addition to N-terminal PAN domains, PANZP1 and PANZP2 contain a C-terminal ZP (zona pellucida) domain. Many eukaryotic proteins contain ZP domains, including the mammalian sperm cell receptors ZP2 and ZP3 and other large modular transmembrane proteins such as the major urinary protein uromodulin (Tamm-Horsfall protein or THP), human alpha-tectorin, and Drosophila nompA. In all examples found to date, the ZP domain occurs at the C-terminus of the protein.

[0080]The ZP domain occurs in proteins that are known to polymerize to form filaments and matrices. For example, THP, the most abundant urinary protein, is a secreted protein that polymerizes into filaments that are thought to be responsible for the water-impermeability of the thick ascending limb of the loop of Henle (Kokot & Dulawa (2000) Nephron, 85(2):97-102). Mammalian sperm receptors ZP2 and ZP3 are secreted by oocytes and polymerize to form the thick extracellular matrix, the zona pellucida, which surrounds oocytes. Another ZP domain-containing protein, alpha-tectorin, is the primary non-collagenous component of the cochlear tectorial membrane, an extracellular matrix that is important in the transduction of sound into neuronal impulses. The requirement of the ZP domain for the assembly of THP and for ZP2 and ZP3 proteins into supramolecular filaments was recently demonstrated (Jovine et al. (2002) Nat. Cell. Biol. 4(6):457-461).

[0081]The Drosophila nompA gene has a similar domain arrangement to PANZP1 and PANZP2, and while overall sequence percent identity between the insect and nematode proteins is low, the nompA protein (along with Sp71) is one of the most closely related non-nematode sequences by BLAST analysis to (the C. elegans PAN-ZP containing proteins). Like PANZP1 and PANZP2, the Drosophila nompA (no-mechanoreceptor potential A) is a transmembrane protein with a large, modular extracellular segment that includes the PAN and ZP domains. NompA is localized in an extracellular matrix that is responsible for the transduction of mechanical stimuli to sensory processes in the peripheral nervous system (Chung et al. (2001) Neuron 29(2):415-428). Mutations in the no-mechanoreceptor-potential A (nompA) gene eliminate transduction in Drosophila mechanosensory organs by disrupting contacts between neuronal sensory endings and cuticular structures.

[0082]PANZP1 and PANZP2 are essential for nematode viability. RNAi-generated mutations of PANZP1 and PANZP2 result in larval arrest at the L2 stage. A related C. elegans PAN-domain containing protein, LET-653 (C29E6.1) has also been shown to be an essential gene (Clark & Baille (1992) Mol. Gen. Genet. 232(1):97-105). Mutations in the let-653 gene are lethal and are associated with the appearance of large vacuoles that suggest a dysfunction of the secretory/excretory apparatus (Jones & Baille (1995) Mol. Gen. Genet. 248(6):719-726). LET-653 has two N-terminal PAN domains and a weakly predicted C-terminal ZP domain that contains a region of low-complexity sequence. The function of LET-653 is unknown, but it has been speculated that it may be functionally similar to the mammalian ZP-domain containing GP2 protein (Tordai et al. (1999) FEBS Lett. 461(1-2):63-67; Wong & Lowe, (1996) Gene, 171(2):311-312). GP2 plays an important role in the secretion of pancreatic digestive enzymes. GP2 is the major glycoprotein component of the zymogen granule membrane. Proteolytic processing of GP2 and its release from the zymogen granule membrane occur as part of the normal process of zymogen granule secretion in the pancreas (Fritz et al. (2002) Pancreas, 24(4):336-343).

[0083]Proteins such as PANZP1 and PANZP2 that are localized in the nematode gut are especially attractive targets for the development of vaccines. Although gut-localized proteins are accessible to antibodies, they are normally inaccessible to host immune surveillance that is required to mount an immune response. Nevertheless, these so-called "hidden antigens", when purified, can be used to stimulate highly effective antibody responses in animals, especially against blood-feeding nematodes (Munn (1997) Int. J. Parasit. 27(4):359-366); Newton & Munn (1999) Parasitology Today, 15:116-122).

[0084]The structural features of the PANZP1 and PANZP2 suggest possible strategies for the production of antibodies and for the rational design of peptide inhibitors that could interfere with the protein-protein interactions mediated by the PAN and ZP domain portions of the molecule. It has been shown in studies with blood coagulation factors that antibodies and peptides that compete for binding to PAN domains disrupt the normal protein-protein interactions, and prevent blood coagulation (Baglia et al. (1995) J. Biol. Chem. 270(12):6734-6740; Sun & Gailani (1996) J. Biol. Chem. 271(46):29023-29028; Renne et al. (2002) J. Biol. Chem. 277(7):4892-4899). Recombinant proteins containing the PAN domain only have been shown to assume the proper conformation, suggesting that it would be possible to purify amounts of PAN domains that could be used for the production of antibodies (Baglia & Walsh (1996) J. Biol. Chem. 271(7): 3652-3658; Baglia et al. (2000) J. Biol. Chem. 275(41):31954-31962). It has also been demonstrated that synthetic peptides that are designed from conformationally constrained portions of the PAN domain sequence (i.e., peptides which have at least one of the conserved disulfide linkages) are effective inhibitors of the normal protein-protein interaction carried out by the whole protein. Nematode resistant transgenic plants may be created by the production of plantibodies capable of interfering with the function of PANZP1 or PANZP2 or the expression in plants of peptides or individual PAN or ZP domains that can interfere with the normal functioning of nematode PANZP1 or PANZP2 in dominant negative fashion. The small size of peptides or individual domains may be an advantage for applications against certain plant parasitic nematodes, which appear to have size exclusion constraints for oral uptake.

[0085]The present invention provides nucleic acid sequences from nematodes encoding PAN and ZP containing receptor-like polypeptides. The S. stercoralis nucleic acid molecule (SEQ ID NO: 1) and the encoded PANZP1 (SEQ ID NO: 3) are depicted in FIGS. 1A-1C. The S. stercoralis nucleic acid molecule (SEQ ID NO: 2) and the encoded PANZP2 (SEQ ID NO: 4) are depicted in FIGS. 2A-2B. The M. javanica nucleic acid molecule (SEQ ID NO: 7) and the encoded PANZP1 (SEQ ID NO: 10) are depicted in FIGS. 3A-3C. The partial H. glycines nucleic acid molecule (SEQ ID NO: 8) and the encoded PANZP1 (SEQ ID NO: 11) are depicted in FIG. 4. The partial B. malayi nucleic acid molecule (SEQ ID NO: 9) and the encoded PANZP1 (SEQ ID NO: 12) are depicted in FIGS. 5A-5B. Certain sequence information for the PANZP1 and PANZP2 genes described herein is summarized in Table 1, below.

TABLE-US-00001 TABLE 1 Species CDNA ORF Polypeptide Figure S. stercoralis SEQ ID NO: 1 SEQ ID NO: 5 SEQ ID NO: 3 FIGS. 1A-1C S. stercoralis SEQ ID NO: 2 SEQ ID NO: 6 SEQ ID NO: 4 FIGS. 2A-2B M. javanica SEQ ID NO: 7 SEQ ID NO: 13 SEQ ID NO: 10 FIGS. 3A-3C H. glycines SEQ ID NO: 8 SEQ ID NO: 14 SEQ ID NO: 11 FIG. 4 B. malayi SEQ ID NO: 9 SEQ ID NO: 15 SEQ ID NO: 12 FIGS. 5A-5B

[0086]The invention is based, in part, on the discovery of PANZP sequences from S. stercoralis, M. javanica, H. glycines, and B. malayi. The following examples are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All of the publications cited herein are hereby incorporated by reference in their entirety.

EXAMPLES

[0087]A TBLASTN query with the C. elegans genes C34G6.6 (gi|17505859|ref|NP--491706.1|; PANZP1) and F52B11.3 (gi|17540572|ref|NP--502699.1|; PANZP2) identified multiple expressed sequence tags (ESTs are short nucleic acid fragment sequences from single sequencing reads) in dbest that are predicted to encode a portion of PANZP enzymes in multiple nematode species.

[0088]PANZP ESTs identified as similar to C. elegans C34G6.6 (C. elegans PANZP1) include but are not limited to Brugia malayi (gi|2199168|gb|AA471404.1|AA471-404); Pristionchus pacificus (gi|15339536|gb|BI500192.1|BI500192); Strongyloides stercoralis (gi|9830619|gb|BE579677.1|BE579677); Ascaris summ (gi|15785830|gb|BI782938.1|BI782938); Meloidogyne javanica (gi|15766417|gb|BI744615.1|BI744615); Strongyloides ratti (gi|14494496|gb|BI073876.1|BI073876); and Haemonchus contortus (gi|10818965|gb|BF060055.1|BF060055).

[0089]PANZP ESTs identified as similar to C. elegans F52B11.3 (C. elegans PANZP2) include but are not limited to Strongyloides ratti (gi|14288440|gb|BG893830.1|BG893830); Strongyloides stercoralis (gi|9831122|gb|BE580180.1|BE580180); Meloidogyne hapla (gi|19435833|gb|BM952243.1|BM952243); Brugia malayi (gi|2605443|gb|AA661399.1|AA661399); and Onchocerca volvulus (gi|14624150|gb|BI142440.1|BI142440).

Full-Length PAN and ZP Containing Receptor-Like cDNA Sequences

[0090]Plasmid clone, Div3206, corresponding to the S. stercoralis EST sequence (GenBank® Identification No: 9831352) was obtained from the Genome Sequencing Center (St. Louis, Mo.). The cDNA insert in the plasmid was sequenced in its entirety. Unless otherwise indicated, all nucleotide sequences determined herein were sequenced with an automated DNA sequencer (such as model 373 from Applied Biosystems, Inc.) using processes well-known to those skilled in the art. Primers used for sequencing are listed in Table 2 (see below). Partial sequence data for the S. stercoralis PANZP1 was obtained from Div3206, including nucleotide sequence for codons 141-1122 and additional 3' untranslated sequence. To obtain the missing 5'-sequence of the S. stercoralis PANZP1 gene, the 5'-oligo-capped RACE method (GeneRacer® kit from Invitrogen Life Technologies) was applied. This technique results in the selective ligation of an RNA oligonucleotide (SEQ ID NO: 22) to the 5'-ends of decapped mRNA using T4 RNA ligase. First strand cDNA synthesis from total S. stercoralis oligo-capped RNA was performed using an internal gene specific primer (PN1ss-5; SEQ ID NO: 23), designed from the known sequence, that anneals within the cDNA molecule of interest. The first strand cDNA was then directly PCR amplified using a nested gene specific primer (PN1ss-2; SEQ ID NO: 24) designed from known sequence that anneals within the cDNA molecule of interest, and the GeneRacer® 5' nested oligo (SEQ ID NO: 26), which is homologous to the 5'-end of all cDNAs amplified with the GeneRacer® oligo-capped RNA method. This procedure was performed to generate clone Div3577, which contains codons 1-184 in addition to 5'-untranslated sequences. Taken together, clones Div3206 and Div3577 contain sequences comprising the complete open reading frame of the PANZP1 gene of S. stercoralis.

[0091]Plasmid clone, Div3172, corresponding to the S. stercoralis EST sequence (GenBank® Identification No: 9830179) was obtained from the Genome Sequencing Center (St. Louis, Mo.). The cDNA insert in the plasmid was sequenced in its entirety. Primers used for sequencing are listed in Table 2. Full sequence data for the S. stercoralis PANZP2 was obtained from Div3172, including nucleotide sequence for codons 1-557 and additional 5'- and 3'-untranslated sequences. Div3172 contains the complete open reading frame of the PANZP2 gene of S. stercoralis.

[0092]Plasmid clone, Div2577, corresponding to the M. javanica EST sequence (GenBank® Identification No: 15766417) was obtained from the Genome Sequencing Center (St. Louis, Mo.). The cDNA insert in the plasmid was sequenced in its entirety. Partial sequence data for the M. javanica PANZP1 was obtained from Div2577, including nucleotide sequence for codons 100-233. The available sequence lacked the first 99 codons and the last 977 codons of the M. javanica PANZP1, as well as 5' and 3' untranslated regions. To obtain the middle region of the M. javanica PANZP1 gene, the 3' RACE technique was applied. First strand cDNA synthesis from total M. javanica RNA was performed using an oligo dT primer (SEQ ID NO: 21). The cDNA was then directly PCR amplified using a gene specific primer (PAN18; SEQ ID NO: 37) designed from the known sequence that anneals within the cDNA molecule of interest, and a degenerate primer (PAN25; SEQ ID NO: 38) designed to anneal to region of the gene predicted to exhibit strong homology shared across many nematode PANZP1 genes. This procedure was performed to generate clone Div3651, which contains codons 164-913.

[0093]To obtain the missing 5' end of the M. javanica PANZP1 gene, the 5' RACE technique was applied. First strand cDNA synthesis from total M. javanica RNA was performed using a gene specific primer (Mj-P1-R2; SEQ ID NO: 40). Single stranded cDNA was then dC-tailed and PCR amplified using a gene specific primer (Mj-P1-R3; SEQ ID NO: 41) and the AAP (abridged anchor primer) (SEQ ID NO: 50) A final nested PCR was performed using gene specific primer Mj-P1-R4 (SEQ ID NO: 42) and AUAP (abridged universal primer) (SEQ ID NO: 19). This procedure was performed to generate clone Div4453, which contains codons 1-118.

[0094]To obtain the 3' end of the M. javanica PANZP1 gene, the 3' RACE technique was applied. First strand cDNA synthesis from M. javanica RNA was performed as described previously. The first strand cDNA was directly PCR amplified using a gene specific primer (P1-Mj-F2; SEQ ID NO: 39) designed from the known sequence that anneals within the first strand cDNA molecule of interest, and the AUAP primer (SEQ ID NO: 19), which is homologous to the 3' end of the cDNA of interest. This procedure was performed to generate clone Div4470, which contains codons 846-1210 in addition to 3' untranslated sequences. Taken together, clones Div2577, Div3651, Div4453, and Div4470 contain sequences comprising the complete open reading frame of the PANZP1 gene of M. javanica.

Partial-Length PAN and ZP Containing Receptor-Like cDNA Sequences

[0095]In an attempt to obtain the H. glycines PANZP1 gene, first strand cDNA derived from total H. glycines RNA by reverse transcription with the Oligo dT primer, was directly PCR amplified, using a degenerate primer (P1-10FA; SEQ ID NO: 43) designed to anneal to a region of strong homology shared across many nematode PANZP1 genes, and another degenerate primer (P1-02R; SEQ ID NO: 44). This procedure was performed to obtain clone Div4504, which contains codons 1-252. The H. glycines PANZP1 gene fragment within plasmid Div4504 is missing the 5' and 3' coding sequences. The encoded codons are arbitrarily numbered starting with number 1 for convenience. The codons contained in the H. glycines PANZP1 gene fragment correspond to codons 112-364 of the C. elegans PANZP1 gene.

[0096]Partial sequence data for the B. malayi PANZP1 was obtained from a B. malayi EST (GenBank® Identification No: 2199168), including nucleotide sequence for codons 207-363. The available sequence lacked the first 206 codons and, approximately, the last 700 codons of the B. malayi PANZP1, as well as the 5' and 3' untranslated regions. Partial sequence data for the B. malayi PANZP1 was also obtained from the B. malayi EST (GenBank® Identification No: 5342885), including nucleotide sequence for codons 256-386. The available sequence lacked the first 255 codons and, approximately, the last 680 codons of the B. malayi PANZP1, as well as the 5' and 3' untranslated regions.

[0097]To obtain the middle region of the B. malayi PANZP1 gene, the 3' RACE technique was applied. First strand cDNA synthesis from total B. malayi RNA was performed using an oligo dT primer (SEQ ID NO: 21). The cDNA was then directly PCR amplified using a gene specific primer (PNbm-3; SEQ ID NO: 36) designed from the known sequence that anneals within the cDNA molecule of interest, and a degenerate primer (PAN20; SEQ ID NO: 35) designed to anneal to region of strong homology shared across many nematode PANZP1 genes. This procedure was performed to generate clone Div3410, which contains codons 162-340. To obtain the 5' sequence of the B. malayi PANZP1 gene, the 5'-oligo-capped RACE method (GeneRacer® kit from Invitrogen Life Technologies) was applied. This technique results in the selective ligation of an RNA oligonucleotide (SEQ ID NO: 22) to the 5'-ends of decapped mRNA using T4 RNA ligase. First strand cDNA synthesis from total B. malayi oligo-capped RNA was performed using an internal gene specific primer (PNbm-GR; SEQ ID NO: 31), designed from the known sequence, that anneals within the cDNA molecule of interest. The first strand cDNA was then directly PCR amplified using a nested gene specific primer (PN1bm-GR-nest; SEQ ID NO: 32) designed from known sequence that anneals within the cDNA molecule of interest, and the GeneRacer® 5' nested oligo (SEQ ID NO: 26), which is homologous to the 5'-end of all cDNAs amplified with the GeneRacer® oligo-capped RNA method. This procedure was performed to generate clone Div3663, which contains codons 1-232, in addition to 5'-untranslated sequences. To obtain more of the 3' sequence of the B. malayi PANZP1 gene, the 3' RACE technique was applied. First strand cDNA synthesis from total B. malayi RNA was performed using an oligo dT primer (SEQ ID NO: 21). The cDNA was then directly PCR amplified using a gene specific primer (PNbm-5; SEQ ID NO: 33) designed from the known sequence that anneals within the cDNA molecule of interest, and a degenerate primer (PAN23; SEQ ID NO: 34) designed to anneal to region of strong homology shared across many nematode PANZP1 genes. This procedure was performed to generate clone Div3643, which contains codons 305-881. Taken together, clones Div3410, Div3663, and Div3643 contain sequences comprising approximately 75% of the complete B. malayi PANZP1 open reading frame. The 3' end sequence has yet to be completed.

TABLE-US-00002 TABLE 2 SEQ ID Name Sequence NO Homology to AUAP ggccacgcgtcgactagtac 19 abridged universal primer (homolgous to the 5' ends of primers Oligo dT and AAP) SL1 gggtttaattacccaagtttga 20 nematode transpliced leader Oligo dT ggccacgcgtcgactagtacttttttttttttttttt 21 universal primer to poly A tail RNA oligo cgacuggagcacgaggacacugacauggacugaaggaguagaaa 22 GeneRacert RNA oligo PN1 ss-5 ccgtccaagaggctttgaac 23 Ss PANZP1 (codons 274-279) PN1 ss-2 gatctggtcgatcaagtc 24 Ss PANZP1 (codons 180-184) GR5 cgactggagcacgaggacactga 25 GeneRacer ® 5' primer GR5n ggacactgacatggactgaaggagta 26 GeneRacer ® 5' nested primer AN07.C09 tcagtgacgttatgtcctcc 27 Ce PANZP1 genomic AN07.D09 tgacagatggaacattctcc 28 Ce PANZP1 genomic AN08.A10 acttcaggacacgacttgac 29 Ce PANZP2 genomic AN08.B10 caatcagagatggtaactcc 30 Ce PANZP2 genomic PNbm-GR cgttgtagacagtcgctgagtacata 31 Bm PANZP1 (codons 247-254) PN1bm-GR-n ccaactcgttagctagctgacg 32 Bm PANZP1 (codons 226-232) PNbm-5 cgaacatgtcgcaatgtac 33 Bm PANZP1 (codons 305-310) PAN23 catngccatdatytccca 34 PANZP1 degenerate (codons 876-881) PAN20 ttyggnttygartgygar 35 PANZP1 degenerate (codons 162-167) PNbm-3 gatcgaggcacatcgttac 36 Bm PANZP1 (codons 335-340) PAN18 gtttagatgctgttgatac 37 Mj PANZP1 (codons 164-168) PAN25 tcdatyttnccyctnggytg 38 Mj PANZP1 degenerate (codons 908-913) P1-Mj-F2 caagatatggacaatggaac 39 Mj PANZP1 (codons 846-851) Mj-P1-R2 atacattcggcatccaatgg 40 Mj PANZP1 (codons 181-186) Mj-P1-R3 actgactcgcattcaaagcc 41 Mj PANZP1 (codons 171-176) Mj-P1-R4 tagctaatctagctagtgtc 42 Mj PANZP1 (codons 113-118) P1-10FA garcaraaratgctngt 43 Hg PANZP1 (codons 1-6) P1-02R tgytcrttrtartartacat 44 Hg PANZP1 (codons 247-252) T7 gtaatacgactcactatagggc 47 vector polylinker primer T3 aattaaccctcactaaaggg 48 vector polylinker primer SP6 gatttaggtgacactatag 49 vector polylinker primer AAP ggccacgcgtcgactagtacggggggggg 50 abridged anchor primer

Characterization of Nematode PAN and ZP Containing Receptor-Like Proteins

[0098]The sequences of the two PANZP-like nucleic acid molecules (PANZP1 and PANZP2 from S. stercoralis, respectively) are depicted in FIGS. 1A-1C and FIGS. 2A-2B as SEQ ID NO: 1 and SEQ ID NO: 2. The open reading frame of SEQ ID NO: 1 (SEQ ID NO: 5) contains an open reading frame encoding a 1122 amino acid polypeptide (SEQ ID NO:3). The open reading frame of SEQ ID NO: 2 (SEQ ID NO: 6) contains an open reading frame encoding a 557 amino acid polypeptide (SEQ ID NO: 4).

[0099]The S. stercoralis PANZP1 protein (FIGS. 1A-1C: SEQ ID NO: 3) is approximately 54% identical (in the region of shared homology) to the C. elegans PANZP1 proteins (FIG. 4; SEQ ID NOs: 7 and 8). The similarity between the PANZP1 proteins from S. stercoralis and from C. elegans is presented as a multiple alignment generated by the ClustalX multiple alignment program as described below (FIG. 7).

[0100]The S. stercoralis PANZP2 protein (FIGS. 2A-2B; SEQ ID NO: 4) is approximately 79% identical (in the region of shared homology) to the C. elegans PANZP2 protein (FIGS. 5A-5B; SEQ ID NO: 9). The similarity between the PANZP2 proteins from S. stercoralis and from C. elegans is presented as a multiple alignment generated by the ClustalX multiple alignment program as described below (FIG. 8).

[0101]The sequences of PANZP1-like nucleic acid molecules from M. javanica, H. glycines, and B. malayi are depicted in FIGS. 3A-3C, 4, and 5 as SEQ ID NO: 7, 8, and 9 respectively. The open reading frames within SEQ ID NO: 7-9 are shown as SEQ ID NO: 13-15 respectively. The M. javanica PANZP1-like sequence encodes a predicted polypeptide of 1210 amino acids (SEQ ID NO: 10). The partial H. glycines PANZP1-like sequence encodes a predicted polypeptide of 250 amino acids (SEQ ID NO: 11). The partial B. malayi PANZP1-like sequence encodes a predicted polypeptide of 881 amino acids (SEQ ID NO: 12).

[0102]The M. javanica PANZP1 protein (FIGS. 3A-3C: SEQ ID NO: 10) is approximately 46% identical (in the region of shared homology) to the C. elegans PANZP1 proteins (FIG. 7; SEQ ID NO: 17). The similarity between the PANZP1 proteins from M. javanica and from C. elegans is presented as a multiple alignment generated by the ClustalX multiple alignment program as described below (FIG. 7).

[0103]The H. glycines PANZP1 protein (FIG. 4: SEQ ID NO: 11) is approximately 65% identical (in the region of shared homology) to the C. elegans PANZP1 proteins (FIG. 7; SEQ ID NO: 17). The similarity between the PANZP1 proteins from H. glycines and from C. elegans is presented as a multiple alignment generated by the ClustalX multiple alignment program as described below (FIG. 7).

[0104]The B. malayi PANZP1 protein (FIGS. 5A-5B: SEQ ID NO: 12) is approximately 56% identical (in the region of shared homology) to the C. elegans PANZP1 proteins (FIG. 7; SEQ ID NO: 17). The similarity between the PANZP1 proteins from B. malayi and from C. elegans is presented as a multiple alignment generated by the ClustalX multiple alignment program as described below (FIG. 7).

[0105]Hidden Markov Model based domain analysis of the nematode PAN and ZP containing receptor-like proteins using the PFAM database (available on the internet at pfam.wustl.edu) shows that the nematode PANZP1 proteins contain six PAN domains and a single ZP domain. Different PANZP proteins have different numbers of PAN domains (e.g., C. elegans PANZP2 has four PAN domains) but the overall module arrangement is the same (i.e., secretion leader, (PAN)X, ZP, TM). In PANZP1 the seven domains are referred to as PAN1, PAN2, PAN3, PAN4, PAN5, PAN6 and ZP. The predicted amino acid positions of these domains in the PANZP proteins are listed in the table below.

TABLE-US-00003 TABLE 3 Amino Acid positions of conserved PAN and ZP motifs in Nematode PANZP proteins Nematode PAN1 PAN2 PAN3 PAN4 PAN5 PAN6 ZP S. stercoralis 32-108 115-201 206-295 302-392 399-485 508-580 708-999 PANZP1 (SEQ ID NO: 3) M. javanica 36-122 129-215 220-309 316-406 413-499 520-603 731-1045 PANZP1 (SEQ ID NO: 10) H. glycines 1-77 106-196 198-250 PANZP1 (SEQ ID NO: 11) B. malayi 40-114 121-207 212-300 307-397 404-490 497-575 PANZP1 (SEQ ID NO: 12) C. elegansa 25-97 104-190 212-300 307-397 404-491 504-576 652-953 PANZP1 C. elegansb 25-97 104-190 212-300 307-397 404-491 508-580 656-957 PANZP1 C. briggsae 25-97 104-190 211-299 306-396 403-490 507-579 655-956 PANZP1 S. stercoralis 23-114 124-207 215-298 308-385 384-442 PANZP2 (SEQ ID NO: 4) C. elegans 21-112 122-204 212-295 305-382 391-632 PANZP2 C. briggsae 22-113 123-205 213-296 306-383 392-633 PANZP2

[0106]The similarity between S. stercoralis, M. javanica, H. glycines, and B. malayi PANZP sequences and other sequences was also investigated by comparison to sequence databases using BLASTP analysis against nr (a non-redundant protein sequence database available on the internet at ncbi.nlm.nih.gov) and TBLASTN analysis against dbest (an EST sequence database available on the internet at ncbi.nlm.nih.gov; top 500 hits; E=1e-4). The "Expect (E) value" is the number of sequences that are predicted to align by chance to the query sequence with a score S or greater given the size of the database queried. This analysis was used to determine the potential number of plant and vertebrate homologs for each of the nematode PANZP polypeptides described above. None of the PANZP sequences described above had high scoring vertebrate hits in nr or dbest having sufficient sequence similarity to meet the threshold E value of 1e-4 (this E value approximately corresponds to a threshold for removing sequences having a sequence identity of less than about 25% over approximately 100 amino acids). Accordingly, the PANZP enzymes of this invention do not appear to share significant sequence similarity with common vertebrate PAN containing proteins such as the Homo sapiens Plasminogen (gi|4505881|ref|NP--000292.1|) or ZP containing proteins such as the Homo sapiens Zona Pellucida 2 glycoprotein (gi|4508045|ref|NP--003451.1|).

[0107]On the basis of the lack of similarity to vertebrate PAN or ZP containing proteins and the lack of significant plant homologs, the PANZP enzymes are useful targets of inhibitory (small molecule, peptide or protein) compounds selective for nematodes over their hosts (e.g., humans, animals, and plants).

[0108]Functional predictions were made using BLAST with the default parameters on the nr database. BLAST searches and multiple alignment construction with CLUSTALX demonstrated that the C. elegans genes C34G6.6a, C34G6.6b and F52B11.3 define a family of PAN and ZP containing proteins found in nematodes and arthropods (e.g., Anopheles gambiae, C. briggsae and Drosophila melanogaster). Reciprocal blast searches and phylogenetic trees confirm that the nucleotide sequences from S. stercoralis, M. javanica, H. glycines, and B. malayi are orthologs of the C. elegans and C. briggsae genes and are therefore members of the same PANZP family of proteins. Protein localizations were predicted using the TargetP server (available on the internet at cbs.dtu.dk/services/TargetP) and transmembrane domains with the TMHMM server (available on the internet at cbs.dtu.dk/services/TMHMM). The nematode PANZP polypeptides (SEQ ID NO: 3.4, 10, 11, and 12), like the C. elegans and C. briggsae proteins (SEQ ID NO: 7, 8, 9, 45 and 46), are likely extracellular transmembrane proteins because of the presence of strong secretion leaders, C-terminal transmembrane domains and PAN and ZP domains that are likely glycosylated. Additionally, some fraction of the PANZP proteins may be cleaved from the membrane (e.g., at a polybasic site after the ZP domain) by the action of an endoproteinases (e.g., a furin-type endopeptidase).

RNA Mediated Interference (RNAi)

[0109]A double stranded RNA (dsRNA) molecule can be used to inactivate a gene encoding a PAN and ZP domain protein (PANZP) in a cell by a process known as RNA mediated-interference (Fire et al. (1998) Nature 391:806-811, and Gonczy et al. (2000) Nature 408:331-336). The dsRNA molecule can have the nucleotide sequence of a PANZP nucleic acid (preferably exonic) or a fragment thereof. For example, the molecule can comprise at least 50, at least 100, at least 200, at least 300, or at least 500 or more contiguous nucleotides of a PANZP gene. The dsRNA molecule can be delivered to nematodes via direct injection, by soaking nematodes in aqueous solution containing concentrated dsRNA, or by raising bacteriovorous nematodes on E. coli genetically engineered to produce the dsRNA molecule (Kamath et al. (2000) Genome Biol. 2; Tabara et al. (1998) Science 282:430-431).

PANZP RNAi by Feeding

[0110]C. elegans were grown on lawns of E. coli genetically engineered to produce double-stranded RNA (dsRNA) designed to inhibit PANZP1 or PANZP2 expression in order to investigate whether PANZP1 or PANZP2 expression is essential. Briefly, E. coli were transformed with genomic fragments encoding portions of the C. elegans PANZP1 or the PANZP2 gene. A 1048 nucleotide fragment was amplified from the PANZP1 gene using oligo-nucleotide primers containing the sequences 5'-TCAGTGACGTTATGTCCTCC-3' (SEQ ID NO: 51) and 5'-TGACAGATGGAACATTCTCC-3' (SEQ ID NO: 52). A 926 nucleotide fragment was amplified from the PANZP2 gene using oligo-nucleotide primers containing the sequences 5'-ACTTCAGGACACGACTTGAC-3' (SEQ ID NO: 53) and 5'-CAATCAGAGATGGTAACTCC-3' (SEQ ID NO: 54) respectively. The cloned PANZP1 and PANZP2 genomic fragments were cloned separately into an E. coli expression vector between opposing T7 polymerase promoters. The expression clones were separately transformed into a strain of E. coli that carries an IPTG-inducible T7 polymerase. As a control, E. coli was transformed with a gene encoding the Green Fluorescent Protein (GFP).

[0111]Feeding RNAi was initiated from C. elegans L4 larvae at 23° C. on NGM plates containing IPTG and E. coli expressing the C. elegans PANZP1 dsRNA, PANZP2 dsRNA or GFP dsRNA. C. elegans exposed to E. coli expressing PANZP1 dsRNA or PANZP2 dsRNA exhibited severe reduction in brood size of the fed or P0 animal. In addition, of the eggs laid, only a fraction hatched, and the hatched animals died at the L1 or L2 larval stage. The sequence of the PANZP1 and PANZP2 genes is of sufficiently high complexity (i.e., unique) such that the RNAi is not likely to represent cross reactivity with other genes.

[0112]C. elegans cultures grown in the presence of E. coli expressing dsRNA from the PANZP1 or the PANZP2 gene were strongly impaired indicating that the PANZP genes provide essential functions in nematodes and that dsRNA from the PAN and ZP containing receptor-like genes is lethal when ingested by C. elegans. These results demonstrate that PANZPs are important for the viability of C. elegans and suggest that they are useful targets for the development of compounds (small molecule, peptide, protein or otherwise) that reduce the viability of nematodes.

Orthologs of PANZP1 are Present in Intestinal cDNA Libraries

[0113]An expressed sequence tag (EST) apparently encoding an orthologue of PANZP1 was identified from an Ascaris suum intestinal cDNA. The presence of a PANZP1 orthologue in an intestinal library suggests PANZP1 is expressed in the nematode intestine. In addition, the PANZP1 protein sequence contains sequences suggesting that PANZP1 is a transmembrane protein and that the PAN domains are extracellular. Together, these observations indicate that the PAN domains of PANZP1 may be accessible to drugs, peptides or proteins (e.g., antibodies) ingested by the worm.

[0114]PAN domains have been shown to be involved in protein-protein interactions in other systems (Renne et al. (2002) J. Biol. Chem. 277(7):4892-9). Therefore, one approach to inactivating the function of PANZP polypeptides is to interfere with protein-protein interactions using an antibody against a PAN domain, a peptide comprising a PAN domain or a portion of a PAN domain, or any peptide capable of strong intereaction with a native PAN domain. These entities may act as dominant negatives that will block the function of PANZP1 proteins. The intact protein fragments thereof can, for example, be over-expressed in plants where they could negatively interact with PANZP proteins of plant parasitic nematodes upon ingestion by the nematodes. Alternatively the intact proteins or fragments could be injected into or fed to a host animal and thus disrupt the function of animal parasitic nematode PANZP proteins upon ingestion by the nematodes. Since PANZP1 performs an essential function, entities that disrupt its function will have anthelmintic properties.

Identification of Additional PAN and ZP Domain Containing Receptor-Like Sequences

[0115]A skilled artisan can utilize the methods provided in the example above to identify additional nematode PAN and ZP domain containing receptor-like sequences, e.g., PANZP sequences from nematodes other than S. stercoralis, M. javanica, H. glycines, B. malayi, or C. elegans. In addition, nematode PANZP sequences can be identified by a variety of methods including computer-based database searches, hybridization-based methods, and functional complementation.

[0116]Database Identification A nematode PAN and ZP containing receptor-like sequence can be identified from a sequence database, e.g., a protein or nucleic acid database using a sequence disclosed herein as a query. Sequence comparison programs can be used to compare and analyze the nucleotide or amino acid sequences. One such software package is the BLAST suite of programs from the National Center for Biotechnology Institute (NCBI; Altschul et al. (1997) Nucl. Acids Research 25:3389-3402). A PAN and ZP containing receptor-like sequence of the invention can be used to query a sequence database, such as nr, dbest (expressed sequence tag (EST) sequences), and htgs (high-throughput genome sequences), using a computer-based search, e.g., FASTA, BLAST, or PSI-BLAST search. Homologous sequences in other species (e.g., plants and animals) can be detected in a PSI-BLAST search of a database such as nr (E value=10, H value=1e-2, using, for example, four iterations; available at www.ncbi.nlm.nih.gov). Sequences so obtained can be used to construct a multiple alignment, e.g., a ClustalX alignment, and/or to build a phylogenetic tree, e.g., in ClustalX using the Neighbor-Joining method (Saitou et al. (1987) Mol. Biol. Evol. 4:406-425) and bootstrapping (1000 replicates; Felsenstein (1985) Evolution 39:783-791). Distances may be corrected for the occurrence of multiple substitutions [Dcorr=-ln(1-D-D2/5) where D is the fraction of amino acid differences between two sequences] (Kimura (1983) The Neutral Theory of Molecular Evolution, Cambridge University Press).

[0117]The aforementioned search strategy can be used to identify PAN and ZP domain containing receptor-like sequences in nematodes of the following non-limiting, exemplary genera: Plant-parasitic nematode genera: Afrina, Anguina, Aphelenchoides, Belonolaimus, Bursaphelenchus, Cacopaurus, Cactodera, Criconema, Criconemoides, Cryphodera, Ditylenchus, Dolichodorus, Dorylaimus, Globodera, Helicotylenchus, Hemicriconemoides, Hemicycliophora, Heterodera, Hirschmanniella, Hoplolaimus, Hypsoperine, Longidorus, Meloidogyne, Mesoanguina, Nacobbus, Nacobbodera, Panagrellus, Paratrichodorus, Paratylenchus, Pratylenchus, Pterotylenchus, Punctodera, Radopholus, Rhadinaphelenchus, Rotylenchulus, Rotylenchus, Scutellonema, Subanguina, Thecavermiculatus, Trichodorus, Turbatrix, Tylenchorhynchus, Tylenchulus, Xiphinema.

[0118]Animal- and human-parasitic nematode genera: Acanthocheilonema, Aelurostrongylus, Ancylostoma, Angiostrongylus, Anisakis, Ascaris, Ascarops, Bunostomum, Brugia, Capillaria, Chabertia, Cooperia, Crenosoma, Cyathostome species (Small Strongyles), Dictyocaulus, Dioctophyma, Dipetalonema, Dirofiliaria, Dracunculus, Draschia, Elaneophora, Enterobius, Filaroides, Gnathostoma, Gonylonema, Habronema, Haemonchus, Hyostrongylus, Lagochilascaris, Litomosoides, Loa, Mammomonogamus, Mansonella, Muellerius, Metastrongylid, Necator, Nematodirus, Nippostrongylus, Oesophagostomum, Ollulanus, Onchocerca, Ostertagia, Oxyspirura, Oxyuris, Parafilaria, Parascaris, Parastrongyloides, Parelaphostrongylus, Physaloptera, Physocephalus, Protostrongylus, Pseudoterranova, Setaria, Spirocerca, Stephanurus, Stephanofilaria, Strongyloides, Strongylus, Spirocerca, Syngamus, Teladorsagia, Thelazia, Toxascaris, Toxocara, Trichinella, Trichostrongylus, Trichuris, Uncinaria, and Wuchereria.

[0119]Particularly preferred nematode genera include: Plant: Anguina, Aphelenchoides, Belonolaimus, Bursaphelenchus, Ditylenchus, Dolichodorus, Globodera, Heterodera, Hoplolaimus, Longidorus, Meloidogyne, Nacobbus, Pratylenchus, Radopholus, Rotylenchus, Tylenchulus, Xiphinema.

[0120]Animal and human: Ancylostoma, Ascaris, Brugia, Capillaria, Cooperia, Cyathostome species, Dictyocaulus, Dirofiliaria, Dracunculus, Enterobius, Haemonchus, Necator, Nematodirus, Oesophagostomum, Onchocerca, Ostertagia, Oxyspirura, Oxyuris, Parascaris, Strongyloides, Strongylus, Syngamus, Teladorsagia, Thelazia, Toxocara, Trichinella, Trichostrongylus, Trichuris, and Wuchereria.

[0121]Particularly preferred nematode species include: Plant: Anguina tritici, Aphelenchoides fragariae, Belonolaimus longicaudatus, Bursaphelenchus xylophilus, Ditylenchus destructor, Ditylenchus dipsaci Dolichodorus heterocephalous, Globodera pallida, Globodera rostochiensis, Globodera tabacum, Heterodera avenae, Heterodera cardiolata, Heterodera carotae, Heterodera cruciferae, Heterodera glycines, Heterodera major, Heterodera schachtii, Heterodera zeae, Hoplolaimus tylenchiformis, Longidorus sylphus, Meloidogyne acronea, Meloidogyne arenaria, Meloidogyne chitwoodi, Meloidogyne exigua, Meloidogyne graminicola, Meloidogyne hapla, Meloidogyne incognita, Meloidogyne javanica, Meloidogyne nassi, Nacobbus batatiformis, Pratylenchus brachyurus, Pratylenchus coffeae, Pratylenchus penetrans, Pratylenchus scribneri, Pratylenchus zeae, Radopholus similis, Rotylenchus reniformis, Tylenchulus semipenetrans, Xiphinema americanum.

[0122]Animal and human: Ancylostoma braziliense, Ancylostoma caninum, Ancylostoma ceylanicum, Ancylostoma duodenale, Ancylostoma tubaeforme, Ascaris suum, Ascaris lumbrichoides, Brugia malayi, Capillaria bovis, Capillaria plica, Capillariafeliscati, Cooperia oncophora, Cooperia punctata, Cyathostome species, Dictyocaulusfilaria, Dictyocaulus viviparus, Dictyocaulus arnfieldi, Dirofiliaria immitis, Dracunculus insignis, Enterobius vermicularis, Haemonchus contortus, Haemonchus placei, Necator americanus, Nematodirus helvetianus, Oesophagostomum radiatum, Onchocerca volvulus, Onchocerca cervicalis, Ostertagia ostertagi, Ostertagia circumcincta, Oxyuris equi, Parascaris equorum, Strongyloides stercoralis, Strongylus vulgaris, Strongylus edentatus, Syngamus trachea, Teladorsagia circumcincta, Toxocara cati, Trichinella spiralis, Trichostrongylus axei, Trichostrongylus colubriformis, Trichuris vulpis, Trichuris suis, Trichurs trichiura, and Wuchereria bancrofti.

[0123]Further, a PAN and ZP domain containing receptor-like sequence can be used to identify additional PANZP sequence homologs within a genome. Multiple homologous copies of a PANZP sequence can be present. For example, a nematode PANZP sequence can be used as a seed sequence in an iterative PSI-BLAST search (default parameters, substitution matrix=Blosum62, gap open=11, gap extend=1) of a non redundant database such as wormpep (E value=1e-2, H value=1e-4, using, for example 4 iterations) to determine the number of homologs in a database, e.g., in a database containing the complete genome of an organism. A nematode PANZP sequence can be present in a genome along with 1, 2, 3, 4, 5, 6, 8, 10, or more homologs.

[0124]Hybridization Methods A nematode PAN and ZP domain containing receptor-like sequence can be identified by a hybridization-based method using a sequence provided herein as a probe. For example, a library of nematode genomic or cDNA clones can be hybridized under low stringency conditions with the probe nucleic acid. Stringency conditions can be modulated to reduce background signal and increase signal from potential positives. Clones so identified can be sequenced to verify that they encode PANZP sequences.

[0125]Another hybridization-based method utilizes an amplification reaction (e.g., the polymerase chain reaction (PCR)). Oligonucleotides, e.g., degenerate oligonucleotides, are designed to hybridize to a conserved region of a PANZP sequence (e.g., a region conserved in the nematode sequences depicted in FIGS. 7 and 8). The oligonucleotides are used as primers to amplify a PANZP sequence from template nucleic acid from a nematode, e.g., a nematode other than S. stercoralis, M. javanica, H. glycines, B. malayi, or C. elegans. The amplified fragment can be cloned and/or sequenced.

[0126]Full-length cDNA and Sequencing Methods The following methods can be used, e.g., alone or in combination with another method described herein, to obtain full-length nematode PANZP genes and determine their sequences.

[0127]Plant parasitic nematodes are maintained on greenhouse pot cultures depending on nematode preference. Root Knot Nematodes (Meloidogyne sp) are propagated on Rutgers tomato (Burpee), while Soybean Cyst Nematodes (Heterodera sp) are propagated on soybean. Total nematode RNA is isolated using the TRIZOL reagent (Gibco BRL). Briefly, 2 ml of packed worms are combined with 8 ml TRIZOL reagent and solubilized by vortexing. Following 5 minutes of incubation at room temperature, the samples are divided into smaller volumes and spun at 14,000×g for 10 minutes at 4° C. to remove insoluble material. The liquid phase is extracted with 200 μl of chloroform, and the upper aqueous phase is removed to a fresh tube. The RNA is precipitated by the addition of 500 μl of isopropanol and centrifuged to pellet. The aqueous phase is carefully removed, and the pellet is washed in 75% ethanol and spun to re-collect the RNA pellet. The supernatant is carefully removed, and the pellet is air dried for 10 minutes. The RNA pellet is resuspended in 50 μl of DEPC-H2O and analyzed by spectrophotometry at λ 260 and 280 nm to determine yield and purity. Yields can be 1-4 mg of total RNA from 2 ml of packed worms.

[0128]Full-length cDNAs can be generated using 5' and 3' RACE techniques in combination with EST sequence information. The molecular technique 5' RACE (Life Technologies, Inc., Rockville, Md.) can be employed to obtain complete or near-complete 5' ends of cDNA sequences for nematode PANZP cDNA sequences. Briefly, following the instructions provided by Life Technologies, first strand cDNA is synthesized from total nematode RNA using Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) and a gene specific "antisense" primer, e.g., designed from available EST sequence. RNase H is used to degrade the original mRNA template. The first strand cDNA is separated from unincorporated dNTPs, primers, and proteins using a GlassMAX Spin Cartridge. Terminal deoxynucleotidyl transferase (TdT) is used to generate a homopolymeric dC tailed extension by the sequential addition of dCTP nucleotides to the 3' end of the first strand cDNA. Following addition of the dC homopolymeric extension, the first strand cDNA is directly amplified without further purification using Taq DNA polymerase, a gene specific "antisense" primer designed from available EST sequences to anneal to a site located within the first strand cDNA molecule, and a deoxyinosine-containing primer that anneals to the homopolymeric dC tailed region of the cDNA in a polymerase chain reaction (PCR). 5' RACE PCR amplification products are cloned into a suitable vector for further analysis and sequencing.

[0129]The molecular technique, 3' RACE (Life Technologies, Inc., Rockville, Md.), can be employed to obtain complete or near-complete 3' ends of cDNA sequences for nematode PANZP cDNA sequences. Briefly, following the instructions provided by Life Technologies (Rockville, Md.), first strand cDNA synthesis is performed on total nematode RNA using SuperScript® Reverse Transcriptase and an oligo-dT primer that anneals to the polyA tail. Following degradation of the original mRNA template with RNase H, the first strand cDNA is directly PCR amplified without further purification using Taq DNA polymerase, a gene specific primer designed from available EST sequences to anneal to a site located within the first strand cDNA molecule, and a "universal" primer which contains sequence identity to 5' end of the oligo-dT primer. 3' RACE PCR amplification products are cloned into a suitable vector for further analysis and sequencing.

Nucleic Acid Variants

[0130]Isolated nucleic acid molecules of the present invention include nucleic acid molecules that have an open reading frame encoding a PANZP polypeptide. Such nucleic acid molecules include molecules having: the sequences recited in SEQ ID NO: 1, 2, 7, 8, and 9 and the sequence coding for the PANZP proteins recited in SEQ ID NO: 3, 4, 10, 11, and 12. These nucleic acid molecules can be used, for example, in a hybridization assay to detect the presence of a S. stercoralis, M. javanica, H. glycines, or B. malayi nucleic acid in a sample.

[0131]The present invention includes nucleic acid molecules such as the ones shown in SEQ ID NO: 1, 2, 7, 8, and 9 that may be subjected to mutagenesis to produce single or multiple nucleotide substitutions, deletions, or insertions. Nucleotide insertional derivatives of the nematode gene of the present invention include 5' and 3' terminal fusions as well as intra-sequence insertions of single or multiple nucleotides. Insertional nucleotide sequence variants are those in which one or more nucleotides are introduced into a predetermined site in the nucleotide sequence, although random insertion is also possible with suitable screening of the resulting product. Deletion variants are characterized by the removal of one or more nucleotides from the sequence. Nucleotide substitution variants are those in which at least one nucleotide in the sequence has been removed and a different nucleotide inserted in its place. Such a substitution may be silent (e.g., synonymous), meaning that the substitution does not alter the amino acid defined by the codon. Alternatively, substitutions are designed to alter one amino acid for another amino acid (e.g., non-synonymous). A non-synonymous substitution can be conservative or non-conservative. A substitution can be such that activity, e.g., a PANZP activity, is not impaired. A conservative amino acid substitution results in the alteration of an amino acid for a similar acting amino acid, or amino acid of like charge, polarity, or hydrophobicity, e.g., an amino acid substitution listed in Table 4 below. At some positions, even conservative amino acid substitutions can disrupt the activity of the polypeptide.

TABLE-US-00004 TABLE 4 Conservative Amino Acid Replacements Amino acid Code Replace with any of Alanine Ala Gly, Cys, Ser Arginine Arg Lys, His Asparagine Asn Asp, Glu, Gln, Aspartic Acid Asp Asn, Glu, Gln Cysteine Cys Met, Thr, Ser Glutamine Gln Asn, Glu, Asp Glutamic Acid Glu Asp, Asn, Gln Glycine Gly Ala Histidine His Lys, Arg Isoleucine Ile Val, Leu, Met Leucine Leu Val, Ile, Met Lysine Lys Arg, His Methionine Met Ile, Leu, Val Phenylalanine Phe Tyr, His, Trp Proline Pro Serine Ser Thr, Cys, Ala Threonine Thr Ser, Met, Val Tryptophan Trp Phe, Tyr Tyrosine Tyr Phe, His Valine Val Leu, Ile, Met

[0132]The current invention also embodies splice variants of nematode PANZP sequences.

[0133]Another aspect of the present invention embodies a polypeptide-encoding nucleic acid molecule that is capable of hybridizing under conditions of low stringency (or high stringency) to the nucleic acid molecule put forth in SEQ ID NO: 1, 2, 7, 8, and 9 or their complements.

[0134]The nucleic acid molecules that encode for PAN and ZP domain containing receptor-like polypeptides may correspond to the naturally occurring nucleic acid molecules or may differ by one or more nucleotide substitutions, deletions, and/or additions. Thus, the present invention extends to genes and any functional mutants, derivatives, parts, fragments, naturally occurring polymorphisms, homologs or analogs thereof or non-functional molecules. Such nucleic acid molecules can be used to detect polymorphisms of PANZP genes, e.g., in other nematodes. As mentioned below, such molecules are useful as genetic probes; primer sequences in the enzymatic or chemical synthesis of the gene; or in the generation of immunologically interactive recombinant molecules. Using the information provided herein, such as the nucleotide sequence SEQ ID NO: 1, 2, 7, 8, and 9, a nucleic acid molecule encoding an PANZP molecule may be obtained using standard cloning and a screening techniques, such as a method described herein.

[0135]Nucleic acid molecules of the present invention can be in the form of RNA, such as mRNA, or in the form of DNA, including, for example, cDNA and genomic DNA obtained by cloning or produced synthetically. The DNA may be double-stranded or single-stranded. The nucleic acids may be in the form of RNA/DNA hybrids. Single-stranded DNA or RNA can be the coding strand, also referred to as the sense strand, or the non-coding strand, also known as the anti-sense strand.

[0136]One embodiment of the present invention includes a recombinant nucleic acid molecule, which includes the isolated nucleic acid molecules depicted in SEQ ID NO: 1, 2, 7, 8, and 9, inserted in a vector capable of delivering and maintaining the nucleic acid molecule into a cell. The DNA molecule may be inserted into an autonomously replicating vector (suitable vectors include, for example, pGEM3Z and pcDNA3, and derivatives thereof). The vector nucleic acid may be a bacteriophage DNA such as bacteriophage lambda or M13 and derivatives thereof. The vector may be either RNA or DNA, single- or double-stranded, prokaryotic, eukaryotic, or viral. Vectors can include transposons, viral vectors, episomes, (e.g., plasmids), chromosomes inserts, and artificial chromosomes (e.g. BACs or YACs). Construction of a vector containing a nucleic acid described herein can be followed by transformation of a host cell such as a bacterium. Suitable bacterial hosts include, but are not limited to, E. coli. Suitable eukaryotic hosts include yeast such as S. cerevisiae, other fungi, vertebrate cells, invertebrate cells (e.g., insect cells), plant cells, human cells, human tissue cells, and whole eukaryotic organisms. (e.g., a transgenic plant or a transgenic animal). Further, the vector nucleic acid can be used to generate a virus such as vaccinia or baculovirus.

[0137]The present invention also extends to genetic constructs designed for polypeptide expression. Generally, the genetic construct also includes, in addition to the encoding nucleic acid molecule, elements that allow expression, such as a promoter and regulatory sequences. The expression vectors may contain transcriptional control sequences that control transcriptional initiation, such as promoter, enhancer, operator, and repressor sequences. A variety of transcriptional control sequences are well known to those in the art and may be functional in, but are not limited to, a bacterium, yeast, plant, or animal cell. The expression vector can also include a translation regulatory sequence (e.g., an untranslated 5' sequence, an untranslated 3' sequence, a poly A addition site, or an internal ribosome entry site), a splicing sequence or splicing regulatory sequence, and a transcription termination sequence. The vector can be capable of autonomous replication or it can integrate into host DNA.

[0138]In an alternative embodiment, the DNA molecule is fused to a reporter gene such as β-glucuronidase gene, β-galactosidase (lacZ), chloramphenicol-acetyltransferase gene, a gene encoding green fluorescent protein (and variants thereof), or red fluorescent protein firefly luciferase gene, among others. The DNA molecule can also be fused to a nucleic acid encoding a polypeptide affinity tag, e.g. glutathione S-transferase (GST), maltose E binding protein, protein A, FLAG tag, hexa-histidine, or the influenza HA tag. The affinity tag or reporter fusion joins the reading frames of SEQ ID NO: 1, 2, 7, 8, and/or 9 to the reading frame of the reporter gene encoding the affinity tag such that a translational fusion is generated. Expression of the fusion gene results in translation of a single polypeptide that includes both a nematode PANZP region and reporter protein or affinity tag. The fusion can also join a fragment of the reading frame of SEQ ID NO: 1, 2, 7, 8, and/or 9. The fragment can encode a functional region of the PANZP polypeptides, a structurally intact domain, or an epitope (e.g., a peptide of about 8, 10, 20, or 30 or more amino acids). A nematode PANZP nucleic acid that includes at least one of a regulatory region (e.g., a 5'-regulatory region, a promoter, an enhancer, a 5'-untranslated region, a translational start site, a 3'-untranslated region, a polyadenylation site, or a 3'-regulatory region) can also be fused to a heterologous nucleic acid. For example, the promoter of a PANZP nucleic acid can be fused to a heterologous nucleic acid, e.g., a nucleic acid encoding a reporter protein.

[0139]Suitable cells to transform include any cell that can be transformed with a nucleic acid molecule of the present invention. A transformed cell of the present invention is also herein referred to as a recombinant or transgenic cell. Suitable cells can either be untransformed cells or cells that have already been transformed with at least one nucleic acid molecule. Suitable cells for transformation according to the present invention can either be: (i) endogenously capable of expressing the PANZP protein or; (ii) capable of producing such protein after transformation with at least one nucleic acid molecule of the present invention.

[0140]In an exemplary embodiment, a nucleic acid of the invention is used to generate a transgenic nematode strain, e.g., a transgenic C. elegans strain. To generate such a strain, nucleic acid is injected into the gonad of a nematode, thus generating a heritable extrachromosomal array containing the nucleic acid (see, e.g., Mello et al. (1991) EMBO J. 10:3959-3970). The transgenic nematode can be propagated to generate a strain harboring the transgene. Nematodes of the strain can be used in screens to identify inhibitors specific for a S. stercoralis, M. javanica, H. glycines, or B. malayi PANZP polypeptide.

Oligonucleotides

[0141]Also provided are oligonucleotides that can form stable hybrids with a nucleic acid molecule of the present invention. The oligonucleotides can be about 10 to 200 nucleotides, about 15 to 120 nucleotides, or about 17 to 80 nucleotides in length, e.g., about 10, 20, 30, 40, 50, 60, 80, 100, 120 nucleotides in length. The oligonucleotides can be used as probes to identify nucleic acid molecules, primers to produce nucleic acid molecules, or therapeutic reagents to inhibit nematode PANZP protein activity or production (e.g., antisense, triplex formation, ribozyme, and/or RNA drug-based reagents). The present invention includes oligonucleotides of RNA (ssRNA and dsRNA), DNA, or derivatives of either. The invention extends to the use of such oligonucleotides to protect non-nematode organisms (for example e.g., plants and animals) from disease by reading the viability of infecting nematodes, e.g., using a technology described herein. Appropriate oligonucleotide-containing therapeutic compositions can be administered to a non-nematode organism using techniques known to those skilled in the art, including, but not limited to, transgenic expression in plants or animals.

[0142]Primer sequences can be used to amplify a PAN and ZP domain containing receptor-like nucleic acid or fragment thereof. For example, at least 10 cycles of PCR amplification can be used to obtain such an amplified nucleic acid. Primers can be at least about 8-40, 10-30 or 14-25 nucleotides in length, and can anneal to a nucleic acid "template molecule", e.g., a template molecule encoding an PANZP genetic sequence, or a functional part thereof, or its complementary sequence. The nucleic acid primer molecule can be any nucleotide sequence of at least 10 nucleotides in length derived from, or contained within sequences depicted in SEQ ID NO: 1, 2, 7, 8, and/or 9 and their complements. The nucleic acid template molecule may be in a recombinant form, in a virus particle, bacteriophage particle, yeast cell, animal cell, plant cell, fungal cell, or bacterial cell. A primer can be chemically synthesized by routine methods.

[0143]This invention embodies any PAN and ZP domain containing receptor-like sequences that are used to identify and isolate similar genes from other organisms, including nematodes, prokaryotic organisms, and other eukaryotic organisms, such as other animals and/or plants.

[0144]In another embodiment, the invention provides oligonucleotides that are specific for a S. stercoralis, M. javanica, H. glycines, and B. malayi PANZP nucleic acid molecule. Such oligonucleotides can be used in a PCR test to determine if a S. stercoralis, M. javanica, H. glycines, and/or B. malayi derived nucleic acid is present in a sample, e.g., to monitor a disease caused S. stercoralis, M. javanica, H. glycines, and/or B. malayi.

Protein Production

[0145]Isolated PAN and ZP domain containing receptor-like proteins from nematodes can be produced in a number of ways, including production and recovery of the recombinant proteins and/or chemical synthesis of the protein. In one embodiment, an isolated nematode PANZP protein is produced by culturing a cell, e.g., a bacterial, fungal, plant, or animal cell, capable of expressing the protein, under conditions for effective production and recovery of the protein. The nucleic acid can be operably linked to a heterologous promoter, e.g., an inducible promoter or a constitutive promoter. Effective growth conditions are typically, but not necessarily, in liquid media comprising salts, water, carbon, nitrogen, phosphate sources, minerals, and other nutrients, but may be any solution in which PANZP proteins may be produced.

[0146]In one embodiment, recovery of the protein may refer to collecting the growth solution and need not involve additional steps of purification. Proteins of the present invention, however, can be purified using standard purification techniques, such as, but not limited to, affinity chromatography, thermaprecipitation, immunoaffinity chromatography, ammonium sulfate precipitation, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, and others.

[0147]The PAN and ZP domain containing receptor-like polypeptide can be fused to an affinity tag, e.g., a purification handle (e.g., glutathione-S-reductase, hexa-histidine, maltose binding protein, dihydrofolate reductases, or chitin binding protein) or an epitope tag (e.g., c-myc epitope tag, FLAG® tag, or influenza HA tag). Affinity tagged and epitope tagged proteins can be purified using routine art-known methods.

Antibodies Against PAN and ZP Domain Containing Receptor-Like Polypeptides

[0148]Recombinant PAN and ZP domain containing receptor-like gene products or derivatives thereof can be used to produce immunologically interactive molecules, such as antibodies, or functional derivatives thereof. Useful antibodies include those that bind to a polypeptide that has substantially the same sequence as the amino acid sequences recited in SEQ ID NO: 3, 4, 10, 11 and/or 12, or that has at least 80% similarity over 50 or more amino acids to these sequences. In a preferred embodiment, the antibody specifically binds to a polypeptide having the amino acid sequence recited in SEQ ID NO: 3, 4, 10, 11 and/or 12. The antibodies can be antibody fragments and genetically engineered antibodies, including single chain antibodies or chimeric antibodies that can bind to more than one epitope. Such antibodies may be polyclonal or monoclonal and may be selected from naturally occurring antibodies or may be specifically raised to a recombinant PANZP protein.

[0149]Antibodies can be derived by immunization with a recombinant or purified PANZP gene or gene product. As used herein, the term "antibody" refers to an immunoglobulin, or fragment thereof. Examples of antibody fragments include F(ab) and F(ab')2 fragments, particularly functional ones able to bind epitopes. Such fragments can be generated by proteolytic cleavage, e.g., with pepsin, or by genetic engineering. Antibodies can be polyclonal, monoclonal, or recombinant. In addition, antibodies can be modified to be chimeric, or humanized. Further, an antibody can be coupled to a label or a toxin.

[0150]Antibodies can be generated against a full-length PANZP protein, or a fragment thereof, e.g., an antigenic peptide. Such polypeptides can be coupled to an adjuvant to improve immunogenicity. Polyclonal serum is produced by injection of the antigen into a laboratory animal such as a rabbit and subsequent collection of sera. Alternatively, the antigen is used to immunize mice. Lymphocytic cells are obtained from the mice and fused with myelomas to form hybridomas producing antibodies.

[0151]Peptides for generating PAN and ZP domain containing receptor-like antibodies can be about 8, 10, 15, 20, 30 or more amino acid residues in length, e.g., a peptide of such length obtained from SEQ ID NO: 3, 4, 10, 11 and/or 12. Useful peptides include those containing a PAN or ZP domain, e.g., a PAN or ZP domain listed in Table 3. Peptides or epitopes can also be selected from regions exposed on the surface of the protein, e.g., hydrophilic or amphipathic regions. An epitope in the vicinity of an active or binding site can be selected such that an antibody binding such an epitope would block access to the active site or prevent binding. Antibodies reactive with, or specific for, any of these regions, or other regions or domains described herein are provided. An antibody to a PANZP protein can modulate a PANZP binding activity.

[0152]Monoclonal antibodies, which can be produced by routine methods, are obtained in abundance and in homogenous form from hybridomas formed from the fusion of immortal cell lines (e.g., myelomas) with lymphocytes immunized with PANZP polypeptides such as those set forth in SEQ ID NO: 3, 4, 10, 11 and/or 12.

[0153]In addition, antibodies can be engineered, e.g., to produce a single chain antibody (see, for example, Colcher et al. (1999) Ann NY Acad Sci 880: 263-280; and Reiter (1996) Clin Cancer Res 2: 245-252). In still another implementation, antibodies are selected or modified based on screening procedures, e.g., by screening antibodies or fragments thereof from a phage display library.

[0154]Antibodies of the present invention have a variety of important uses within the scope of this invention. For example, such antibodies can be used: (i) as therapeutic compounds to passively immunize an animal in order to protect the animal from nematodes susceptible to antibody treatment; (ii) as reagents in experimental assays to detect presence of nematodes; (iii) as tools to screen for expression of the gene product in nematodes, animals, fungi, bacteria, and plants; and/or (iv) as a purification tool of PANZP protein; (v) as PANZP inhibitors/activators that can be expressed or introduced into plants or animals for therapeutic purposes.

[0155]An antibody against a PAN and ZP domain containing receptor-like protein can be produced in a plant cell, e.g., in a transgenic plant or in culture (see, e.g., U.S. Pat. No. 6,080,560).

[0156]Antibodies that specifically recognize a S. stercoralis, M. javanica, H. glycines, and/or B. malayi PANZP proteins can be used to identify S. stercoralis, M. javanica, H. glycines, and/or B. malayi nematodes, and, thus, can be used to diagnose and/or monitor a disease caused by S. stercoralis, M. javanica, H. glycines, and/or B. malayi.

Immunization

[0157]The PANZP proteins of the invention and fragments thereof (e.g., a fragment that includes one or more PAN or ZP domains) can be used to immunize a mammal, e.g., a human, primate, or dog. The protein or peptide fragment can be introduced into a mammal as a unit dose inoculum in combination with any physiologically suitable diluent. One or more inoculums can be administered. Each inoculum can contain an amount of polypeptide effective to elicit an immune response, preferably a protective immune response that reduces the occurrence of subsequent infection by a nematode, e.g., S. steroralis or B. malayi. A unit dose can contain, e.g., at least 0.1, preferably at least 0.5 milligrams/kg of body weight of host.

[0158]The PANZP peptide immunogen can contain 10, 20, 30, 50, 100 or more amino acids and can include all or part of a PAN or ZP domain, e.g., a PAN or ZP domain listed in Table 3. The PANZP peptide immunogen can include 2, 3, 4, or more PANZP peptides that are the same or different. Moreover, the PANZP peptides can be flanked by other amino acid sequences. Thus, the immunogen can contain, e.g., two copies of a given PAN domain separated by a linker. The immunogen can include one or more portions of one, two or more PANZP proteins. Thus, the immunogen can include a portion of S. steroralis or B. malayi PANZP1 and a portion of S. steroralis PANZP2. The inoculum can include two or more non-contiguous portions of a PANZP protein, e.g., two or more portions including PAN domains.

[0159]The inoculum can include an adjuvant, e.g., complete or incomplete Freund's adjuvant. The PANZP peptide can be linked to a carrier such as tetanus toxoid, human BSA, or KLH. The inoculum can include stabilizers (e.g., sugars, preservatives, wetting agents, emulsifying agents, buffering agents, dyes, and additives) that improve viscosity of syringability. The inoculum can be administered once or multiple times (e.g., a prime and a boost).

[0160]A mammal can be inoculated by intravenous, intraperitoneal, intradermal, subcutaneous, or intramuscular method. Inoculation can be via a needle or needleless means.

Nucleic Acids Agents

[0161]Also featured are isolated nucleic acids that are antisense to nucleic acids encoding nematode PAN and ZP domain containing receptor-like proteins. An "antisense" nucleic acid includes a sequence that is complementary to the coding strand of a nucleic acid encoding a PANZP protein. The complementarity can be in a coding region of the coding strand or in a noncoding region, e.g., a 5'- or 3'-untranslated region, e.g., the translation start site. The antisense nucleic acid can be produced from a cellular promoter (e.g., a RNA polymerase II or III promoter), or can be introduced into a cell, e.g., using a liposome. For example, the antisense nucleic acid can be a synthetic oligonucleotide having a length of about 10, 15, 20, 30, 40, 50, 75, 90, 120 or more nucleotides in length.

[0162]An antisense nucleic acid can be synthesized chemically or produced using enzymatic reagents, e.g., a ligase. An antisense nucleic acid can also incorporate modified nucleotides, and artificial backbone structures, e.g., phosphorothioate derivative, and acridine substituted nucleotides.

[0163]Ribozymes The antisense nucleic acid can be a ribozyme. The ribozyme can be designed to specifically cleave RNA, e.g., a PANZP mRNA. Methods for designing such ribozymes are described in U.S. Pat. No. 5,093,246 or Haselhoff and Gerlach (1988) Nature 334:585-591. For example, the ribozyme can be a derivative of Tetrahymena L-19 IVS RNA in which the nucleotide sequence of the active site is modified to be complementary to a PANZP nucleic acid (see, e.g., Cech et al. U.S. Pat. No. 4,987,071; and Cech et al. U.S. Pat. No. 5,116,742).

[0164]Peptide Nucleic acid (PNA) An antisense agent directed against an PAN and ZP domain containing receptor-like nucleic acid can be a peptide nucleic acid (PNA). See Hyrup et al. (1996) Bioorganic & Medicinal Chemistry 4: 5-23) for methods and a description of the replacement of the deoxyribose phosphate backbone for a pseudopeptide backbone. A PNA can specifically hybridize to DNA and RNA under conditions of low ionic strength as a result of its electrostatic properties. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup et al. (1996) supra and Perry-O'Keefe et al. Proc. Natl. Acad. Sci. 93: 14670-14675.

[0165]RNA Mediated Interference (RNAi) A double stranded RNA (dsRNA) molecule can be used to inactivate a PAN and ZP domain containing receptor-like gene in a cell by a process known as RNA mediated-interference (RNAi; e.g., Fire et al. (1998) Nature 391:806-811, and Gonczy et al. (2000) Nature 408:331-336). The dsRNA molecule can have the nucleotide sequence of a PANZP nucleic acid described herein or a fragment thereof. The molecule can be injected into a cell, or a syncytium, e.g., a nematode gonad as described in Fire et al., supra. Alternatively, the molecule can be used to eradicate a nematode infection in vertebrates or other animals by delivery to a nematode-infected animal by injection or oral dosing.

[0166]Transgenic RNAi A double stranded RNA (dsRNA) molecule can be used to inactivate a PAN and ZP domain containing receptor-like gene in a cell by a process known as RNA mediated-interference (RNAi; e.g., Fire et al. (1998) Nature 391:806-811, and Gonczy et al. (2000) Nature 408:331-336). The dsRNA molecule can have the nucleotide sequence of all or a portion of a PANZP nucleic acid described herein or a fragment thereof. The RNAi triggering molecule can be produced by a transgenic plant engineered to produce dsRNA homologous to a PAN ZP domain-containing receptor-like gene and delivered to a plant parasitic nematode when it attacks and/or feeds on the transgenic plant. Various techniques are known in the art for expressing in plants nucleic acid molecule that inactivate a selected gene, including a nematode gene via RNAi or a related mechanism (see, e.g., Boutla et al. (2002) Nucl. Acids Res. 30:1688; and Wesley et al. (2001) Plant J. 27:581).

Screening Assays

[0167]Another embodiment of the present invention is a method of identifying a compound capable of altering (e.g., inhibiting or enhancing) the activity of PANZP molecules. This method, also referred to as a "screening assay," herein, includes, but is not limited to, the following procedure: (i) contacting an isolated PANZP protein (or a portion thereof, e.g., a PAN or ZP domain) with a test inhibitory compound under conditions in which, in the absence of the test compound, the protein has PANZP activity; and (ii) determining if the test compound alters the PANZP activity (i.e., binding of PANZP to its substrates). Suitable inhibitors or activators that alter a nematode PANZP activity include compounds that interface directly with a nematode PANZP protein substrate binding interaction. Compounds can also interact with other regions of the nematode PANZP protein outside the binding interface and enhance or interfere with PANZP-substrate interactions (e.g., allosteric effects).

[0168]Compounds A test compound can be a large or small molecule, for example, an organic compound with a molecular weight of about 100 to 10,000; 200 to 5,000; 200 to 2000; or 200 to 1,000 daltons. A test compound can be any chemical compound, for example, a small organic molecule, a carbohydrate, a lipid, an amino acid, a polypeptide, a nucleoside, a nucleic acid, or a peptide nucleic acid. Small molecules include, but are not limited to, metabolites, metabolic analogues, peptides, peptidomimetics (e.g., peptoids), amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic or inorganic compounds (i.e., including heteroorganic and organometallic compounds). Compounds and components for synthesis of compounds can be obtained from a commercial chemical supplier, e.g., Sigma-Aldrich Corp. (St. Louis, Mo.). The test compound or compounds can be naturally occurring, synthetic, or both. A test compound can be the only substance assayed by the method described herein. Alternatively, a collection of test compounds can be assayed either consecutively or concurrently by the methods described herein.

[0169]Compounds can act by allosteric inhibition or by directly by preventing the substrate PANZP interaction.

[0170]A high-throughput method can be used to screen large libraries of chemicals. Such libraries of candidate compounds can be generated or purchased, e.g., from Chembridge Corp. (San Diego, Calif.). Libraries can be designed to cover a diverse range of compounds. For example, a library can include 10,000, 50,000, or 100,000 or more unique compounds. Merely by way of illustration, a library can be constructed from heterocycles including pyridines, indoles, quinolines, furans, pyrimidines, triazines, pyrroles, imidazoles, naphthalenes, benzimidazoles, piperidines, pyrazoles, benzoxazoles, pyrrolidines, thiphenes, thiazoles, benzothiazoles, and morpholines. A library can be designed and synthesized to cover such classes of chemicals, e.g., as described in DeWitt et al. (1993) Proc. Natl. Acad. Sci. U.S.A. 90:6909-6913; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91:11422-11426; Zuckermann et al. (1994) J. Med. Chem. 37:2678-2685; Cho et al. (1993) Science 261:1303-1305; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and Gallop et al. (1994) J. Med. Chem. 37:1233-1251.

[0171]Organism-based Assays Organisms can be grown in microtiter plates, e.g., 6-well, 32-well, 64-well, 96-well, 384-well plates.

[0172]In one embodiment, the organism is a nematode. The nematodes can be genetically modified. Non-limiting examples of such modified nematodes include: 1) nematodes or nematode cells (S. stercoralis. M. javanica, H. glycines, B. malayi and/or C. elegans) having one or more PANZP genes inactivated (e.g., using RNA mediated interference); 2) nematodes or nematode cells expressing a heterologous PANZP gene, e.g., an PANZP gene from another species; and 3) nematodes or nematode cells having one or more endogenous PANZP genes inactivated and expressing a heterologous PANZP gene, e.g., a S. stercoralis. M. javanica, H. glycines, B. malayi and/or C. elegans PANZP gene as described herein.

[0173]A plurality of candidate compounds, e.g., a combinatorial library, can be screened. The library can be provided in a format that is amenable for robotic manipulation, e.g., in microtitre plates. Compounds can be added to the wells of the microtiter plates. Following compound addition and incubation, viability and/or reproductive properties of the nematodes or nematode cells are monitored.

[0174]The compounds can also be pooled, and the pools tested. Positive pools are split for subsequent analysis. Regardless of the method, compounds that decrease the viability or reproductive ability of nematodes, nematode cells, or progeny of the nematodes are considered lead compounds.

[0175]In another embodiment, the compounds can be tested on a microorganism or a eukaryotic or mammalian cell line, e.g., rabbit skin cells, Chinese hamster ovary cells (CHO), and/or Hela cells. For example, CHO cells absent for PANZP genes, but expressing a nematode PANZP gene can be used. The generation of such strains is routine in the art. As described above for nematodes and nematode cells, the cell lines can be grown in microtitre plates, each well having a different candidate compound or pool of candidate compounds. Growth is monitored during or after the assay to determine if the compound or pool of compounds is a modulator of a nematode PANZP polypeptide.

[0176]In Vitro Binding Assays The screening assay can also be a cell-free binding assay, e.g., an assay to identify compounds that bind a nematode PANZP polypeptide. For example, a nematode PANZP polypeptide can be purified and labeled. The labeled polypeptide is contacted to beads; each bead has a tag detectable by mass spectroscopy, and test compound, e.g., a compound synthesized by combinatorial chemical methods. Beads to which the labeled polypeptide is bound are identified and analyzed by mass spectroscopy. The beads can be generated using "split-and-pool" synthesis. The method can further include a second assay to determine if the compound alters the activity of the PANZP polypeptide.

[0177]Optimization of a Compound Once a lead compound has been identified, standard principles of medicinal chemistry can be used to produce derivatives of the compound. Derivatives can be screened for improved pharmacological properties, for example, efficacy, pharmacokinetics, stability, solubility, and clearance. The moieties responsible for a compound's activity in the above-described assays can be delineated by examination of structure-activity relationships (SAR) as is commonly practiced in the art. One can modify moieties on a lead compound and measure the effects of the modification on the efficacy of the compound to thereby produce derivatives with increased potency. For an example, see Nagarajan et al. (1988) J. Antibiot. 41:1430-1438. A modification can include N-acylation, amination, amidation, oxidation, reduction, alkylation, esterification, and hydroxylation. Furthermore, if the biochemical target of the lead compound is known or determined, the structure of the target and the lead compound can inform the design and optimization of derivatives. Molecular modeling software to do this is commercially available (e.g., Molecular Simulations, Inc.). "SAR by NMR," as described in Shuker et al. (1996) Science 274:1531-1534, can be used to design ligands with increased affinity, by joining lower-affinity ligands.

[0178]A preferred compound is one that interferes with the function of a nematode PAN and ZP domain containing receptor-like polypeptide and that is not substantially toxic to plants, animals, or humans. By "not substantially toxic" it is meant that the compound does not substantially affect the activity of animal, or human PAN or ZP containing proteins. Thus, particularly desirable inhibitors of S. stercoralis. M. javanica, H. glycines, B. malayi and/or C. elegans PANZP do not substantially inhibit human plasminogen, hepatycyte growth factor, Factor XI, or uromodulin activity of vertebrates, e.g., humans for example.

[0179]Standard pharmaceutical procedures can be used to assess the toxicity and therapeutic efficacy of a modulator of a PANZP activity. The LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population can be measured in cell cultures, experimental plants (e.g., in laboratory or field studies), or experimental animals. Optionally, a therapeutic index can be determined which is expressed as the ratio: LD50/ED50. High therapeutic indices are indicative of a compound being an effective PANZP inhibitor, while not causing undue toxicity or side effects to a subject (e.g., a host plant or host animal).

[0180]Alternatively, the ability of a candidate compound to modulate a non-nematode PAN or ZP containing polypeptide is assayed, e.g., by a method described herein. For example, the binding affinity of a candidate compound for a mammalian PAN containing polypeptide can be measured and compared to the binding affinity for a nematode PANZP polypeptide.

[0181]The aforementioned analyses can be used to identify and/or design a modulator with specificity for nematode PAN and ZP domain containing receptor-like polypeptide over vertebrate or other animal (e.g., mammalian) PAN or ZP containing polypeptides. Suitable nematodes to target are any nematodes with the PANZP proteins or proteins that can be targeted by compounds that otherwise inhibit, reduce, activate, or generally effect the activity of nematode PANZP proteins.

[0182]Inhibitors of nematode PAN and ZP domain containing receptor-like proteins can also be used to identify PAN and ZP domain containing receptor-like proteins in the nematode or other organisms using procedures known in the art, such as affinity chromatography. For example, a specific antibody may be linked to a resin and a nematode extract passed over the resin, allowing any PANZP proteins that bind the antibody to bind the resin. Subsequent biochemical techniques familiar to those skilled in the art can be performed to purify and identify bound PANZP proteins.

Agricultural Compositions

[0183]A compound that is identified as a PAN and ZP domain containing receptor-like polypeptide inhibitor can be formulated as a composition that is applied to plants, soil, or seeds in order to confer nematode resistance. The composition can be prepared in a solution, e.g., an aqueous solution, at a concentration from about 0.005% to 10%, or about 0.01% to 1%, or about 0.1% to 0.5% by weight. The solution can include an organic solvent, e.g., glycerol or ethanol. The composition can be formulated with one or more agriculturally acceptable carriers. Agricultural carriers can include: clay, talc, bentonite, diatomaceous earth, kaolin, silica, benzene, xylene, toluene, kerosene, N-methylpyrrolidone, alcohols (methanol, ethanol, isopropanol, n-butanol, ethylene glycol, propylene glycol, and the like), and ketones (acetone, methylethyl ketone, cyclohexanone, and the like). The formulation can optionally further include stabilizers, spreading agents, wetting extenders, dispersing agents, sticking agents, disintegrators, and other additives, and can be prepared as a liquid, a water-soluble solid (e.g., tablet, powder or granule), or a paste.

[0184]Prior to application, the solution can be combined with another desired composition such as another anthelmintic agent, germicide, fertilizer, plant growth regulator and the like. The solution may be applied to the plant tissue, for example, by spraying, e.g., with an atomizer, by drenching, by pasting, or by manual application, e.g., with a sponge. The solution can also be distributed from an airborne source, e.g., an aircraft or other aerial object, e.g., a fixture mounted with an apparatus for spraying the solution, the fixture being of sufficient height to distribute the solution to the desired plant tissues. Alternatively, the composition can be applied to plant tissue from a volatile or airborne source. The source is placed in the vicinity of the plant tissue and the composition is dispersed by diffusion through the atmosphere. The source and the plant tissue to be contacted can be enclosed in an incubator, growth chamber, or greenhouse, or can be in sufficient proximity that they can be outdoors.

[0185]If the composition is distributed systemically thorough the plant, the composition can be applied to tissues other than the leaves, e.g., to the stems or roots. Thus, the composition can be distributed by irrigation. The composition can also be injected directly into roots or stems.

[0186]A skilled artisan would be able to determine an appropriate dosage for formulation of the active ingredient of the composition. For example, the ED50 can be determined as described above from experimental data. The data can be obtained by experimentally varying the dose of the active ingredient to identify a dosage effective for killing a nematode, while not causing toxicity in the host plant or host animal (i.e. non-nematode animal).

[0187]A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.

Sequence CWU 1

5413750DNAStrongyloides stercoralisCDS(69)...(3434) 1cgactggagc acgaggacac tgacatggac tgaaggagta gaaaggttta aaaaacccag 60tttgagaa atg tct aag tct ggg ctt cat ctt gta gcc tac ata tta ttg 110 Met Ser Lys Ser Gly Leu His Leu Val Ala Tyr Ile Leu Leu 1 5 10ata ttt tta att tca act aat ata gca tct aaa att tct ggt gtt cca 158Ile Phe Leu Ile Ser Thr Asn Ile Ala Ser Lys Ile Ser Gly Val Pro 15 20 25 30tta tgc aac aaa gat act tca cca gta ttt aca ctt caa cat aat tct 206Leu Cys Asn Lys Asp Thr Ser Pro Val Phe Thr Leu Gln His Asn Ser 35 40 45act aat ggt att tta gct aga tct ctt cca caa cca gga tta att gat 254Thr Asn Gly Ile Leu Ala Arg Ser Leu Pro Gln Pro Gly Leu Ile Asp 50 55 60tgt tca gaa cat tgt tcc tct tcg tca gat tgt att ggc gtt gaa tat 302Cys Ser Glu His Cys Ser Ser Ser Ser Asp Cys Ile Gly Val Glu Tyr 65 70 75tgg cag gga att tgt aga gtt att tct caa gat aaa act tct att tat 350Trp Gln Gly Ile Cys Arg Val Ile Ser Gln Asp Lys Thr Ser Ile Tyr 80 85 90aca cca aca gat gaa act tca ata ctt tta aca aaa tca tgt gtt aaa 398Thr Pro Thr Asp Glu Thr Ser Ile Leu Leu Thr Lys Ser Cys Val Lys 95 100 105 110agt gat cgt ata tgt tca tca cca ttc cat ttt gat gtt tat gaa caa 446Ser Asp Arg Ile Cys Ser Ser Pro Phe His Phe Asp Val Tyr Glu Gln 115 120 125aaa ata tta gtt gga ttt gct aga gaa gtt gta cca gct gag tct att 494Lys Ile Leu Val Gly Phe Ala Arg Glu Val Val Pro Ala Glu Ser Ile 130 135 140gaa att tgt atg gct gct tgt ttg aat gct ttt gat aca tat ggt ttt 542Glu Ile Cys Met Ala Ala Cys Leu Asn Ala Phe Asp Thr Tyr Gly Phe 145 150 155gaa tgt gaa tca gct atg tat tat cca gtt gat agt gaa tgt att ctt 590Glu Cys Glu Ser Ala Met Tyr Tyr Pro Val Asp Ser Glu Cys Ile Leu 160 165 170aat act gaa gat aga ctt gat cga cca gat ctt ttt gtt gtt gaa aaa 638Asn Thr Glu Asp Arg Leu Asp Arg Pro Asp Leu Phe Val Val Glu Lys175 180 185 190gaa gat gtt gtt tat tat ctt gat tct aat tgt gct ggt tca caa tgt 686Glu Asp Val Val Tyr Tyr Leu Asp Ser Asn Cys Ala Gly Ser Gln Cys 195 200 205tat gct cca tac att aca caa tat att gct gtt gaa aat aaa caa ata 734Tyr Ala Pro Tyr Ile Thr Gln Tyr Ile Ala Val Glu Asn Lys Gln Ile 210 215 220gaa aat gaa tta gat aga aaa ttt gaa aat att gat ttc caa aca tgt 782Glu Asn Glu Leu Asp Arg Lys Phe Glu Asn Ile Asp Phe Gln Thr Cys 225 230 235gaa gaa tta tgt act ggt aga att act gtt aca caa aat gat ttt act 830Glu Glu Leu Cys Thr Gly Arg Ile Thr Val Thr Gln Asn Asp Phe Thr 240 245 250tgt aaa tca ttt atg tat aat cct gaa aca aaa gtt tgt tat ctt tct 878Cys Lys Ser Phe Met Tyr Asn Pro Glu Thr Lys Val Cys Tyr Leu Ser255 260 265 270gat gaa cgt tca aag cct ctt gga cgg gct aaa tta agt gat gct aat 926Asp Glu Arg Ser Lys Pro Leu Gly Arg Ala Lys Leu Ser Asp Ala Asn 275 280 285gga ttt act tat tat gaa aaa aaa tgt ttt gca tct cca aga aca tgc 974Gly Phe Thr Tyr Tyr Glu Lys Lys Cys Phe Ala Ser Pro Arg Thr Cys 290 295 300cgt caa aca cca tca ttt aat aga gta cca caa atg att ctt gtt ggt 1022Arg Gln Thr Pro Ser Phe Asn Arg Val Pro Gln Met Ile Leu Val Gly 305 310 315ttt gct gca ttt gtt atg gaa aat gta cca tct gtt act atg tgc ctt 1070Phe Ala Ala Phe Val Met Glu Asn Val Pro Ser Val Thr Met Cys Leu 320 325 330gat caa tgt aca aat cca cca cca gag aca ggt gaa aaa ttt gtc tgt 1118Asp Gln Cys Thr Asn Pro Pro Pro Glu Thr Gly Glu Lys Phe Val Cys335 340 345 350aaa tct gtt atg tac tat tat aat gaa caa gaa tgt att ctt aat gct 1166Lys Ser Val Met Tyr Tyr Tyr Asn Glu Gln Glu Cys Ile Leu Asn Ala 355 360 365gaa aca aga cat aca aag cca gat ctt ttt att aca gaa gga gat gaa 1214Glu Thr Arg His Thr Lys Pro Asp Leu Phe Ile Thr Glu Gly Asp Glu 370 375 380ttt ctt gtt gat tat ttt gat att tca tgt cat ctt gaa cca gaa aca 1262Phe Leu Val Asp Tyr Phe Asp Ile Ser Cys His Leu Glu Pro Glu Thr 385 390 395tgt cct aaa gga aca tat tta aaa gga att aaa tct atc aat tct gca 1310Cys Pro Lys Gly Thr Tyr Leu Lys Gly Ile Lys Ser Ile Asn Ser Ala 400 405 410ctt cct gag ggt gaa ggc tca ctt cat gtt att gag tct gct gga aaa 1358Leu Pro Glu Gly Glu Gly Ser Leu His Val Ile Glu Ser Ala Gly Lys415 420 425 430tca tta gaa gaa tgt atg gaa aaa tgt aac caa ctt cat cca gaa aaa 1406Ser Leu Glu Glu Cys Met Glu Lys Cys Asn Gln Leu His Pro Glu Lys 435 440 445tgt aga tca ttt aat ttt gaa aaa tca tct gga tta tgt aat ctt tta 1454Cys Arg Ser Phe Asn Phe Glu Lys Ser Ser Gly Leu Cys Asn Leu Leu 450 455 460tat ctt gat gga aaa aat act tta aaa cca ttt att aaa aat gga ttt 1502Tyr Leu Asp Gly Lys Asn Thr Leu Lys Pro Phe Ile Lys Asn Gly Phe 465 470 475gat ctt gtt gat tta caa tgt tta tca act aaa aaa gat tgc tct aca 1550Asp Leu Val Asp Leu Gln Cys Leu Ser Thr Lys Lys Asp Cys Ser Thr 480 485 490aaa aag aat gat att aat ttt gtt aaa tat ctt tac tct cat ttt gtt 1598Lys Lys Asn Asp Ile Asn Phe Val Lys Tyr Leu Tyr Ser His Phe Val495 500 505 510aaa tat ctt tac tct caa caa cct gga att cca aca aaa aca gaa aaa 1646Lys Tyr Leu Tyr Ser Gln Gln Pro Gly Ile Pro Thr Lys Thr Glu Lys 515 520 525gtt att ggt att tct aaa tgt ctt gat tta tgt act gat agt gaa cgt 1694Val Ile Gly Ile Ser Lys Cys Leu Asp Leu Cys Thr Asp Ser Glu Arg 530 535 540tgt gaa gga ctt aat tat aat aga aga act gga gaa tgt caa tta ttt 1742Cys Glu Gly Leu Asn Tyr Asn Arg Arg Thr Gly Glu Cys Gln Leu Phe 545 550 555gaa att att gat gga cct tct aat ctt aaa aaa tct gag cat ata gat 1790Glu Ile Ile Asp Gly Pro Ser Asn Leu Lys Lys Ser Glu His Ile Asp 560 565 570ttt tat caa aat ctt tgt tct act aaa gaa aat gaa gct ggt gtt tca 1838Phe Tyr Gln Asn Leu Cys Ser Thr Lys Glu Asn Glu Ala Gly Val Ser575 580 585 590tct gca tta aat gta cca caa tca tct gtt att cct att tca tca tca 1886Ser Ala Leu Asn Val Pro Gln Ser Ser Val Ile Pro Ile Ser Ser Ser 595 600 605caa aat att agt aaa agt gat gtt ttt gcc aaa aaa aat ctt aat aaa 1934Gln Asn Ile Ser Lys Ser Asp Val Phe Ala Lys Lys Asn Leu Asn Lys 610 615 620gat ggt aat aat caa gta aac att tat gaa cca gaa aaa aaa tac cat 1982Asp Gly Asn Asn Gln Val Asn Ile Tyr Glu Pro Glu Lys Lys Tyr His 625 630 635cca aaa gga tca aaa aat gaa aca tca tat gaa aca gga act gta aat 2030Pro Lys Gly Ser Lys Asn Glu Thr Ser Tyr Glu Thr Gly Thr Val Asn 640 645 650aaa tca aat gtt gaa gag gtt tct gaa act tta act aat agt gga gtt 2078Lys Ser Asn Val Glu Glu Val Ser Glu Thr Leu Thr Asn Ser Gly Val655 660 665 670gaa agt gga agt ctt gaa aaa aat att att aca gca cca cca tct ata 2126Glu Ser Gly Ser Leu Glu Lys Asn Ile Ile Thr Ala Pro Pro Ser Ile 675 680 685cca aaa att cct gaa ggt cca cta cca gtg cca att tta att cca gct 2174Pro Lys Ile Pro Glu Gly Pro Leu Pro Val Pro Ile Leu Ile Pro Ala 690 695 700gat caa gta caa act att tgt gat tat gaa ggt att aaa gta caa att 2222Asp Gln Val Gln Thr Ile Cys Asp Tyr Glu Gly Ile Lys Val Gln Ile 705 710 715aaa tca cca caa tca ttt act ggt gtt atc ttt gtt aaa aat cac tat 2270Lys Ser Pro Gln Ser Phe Thr Gly Val Ile Phe Val Lys Asn His Tyr 720 725 730gaa aca tgt cgt gtt gaa gtt tcc aac tct gat gca gct act ctt gag 2318Glu Thr Cys Arg Val Glu Val Ser Asn Ser Asp Ala Ala Thr Leu Glu735 740 745 750ctt ggt ctt cca gct tca ttt gga atg aaa cca gtt aca ctg tct gct 2366Leu Gly Leu Pro Ala Ser Phe Gly Met Lys Pro Val Thr Leu Ser Ala 755 760 765aca tct tca gat tct acc tct tca cag aat att act tct aat agt gga 2414Thr Ser Ser Asp Ser Thr Ser Ser Gln Asn Ile Thr Ser Asn Ser Gly 770 775 780cat aaa gtt gtt gga aga gca cgc cgt gat aca caa gaa aaa tct tgt 2462His Lys Val Val Gly Arg Ala Arg Arg Asp Thr Gln Glu Lys Ser Cys 785 790 795ggt ctt aca gaa att gaa aat gga aaa tat aaa agt act gtt gtt ata 2510Gly Leu Thr Glu Ile Glu Asn Gly Lys Tyr Lys Ser Thr Val Val Ile 800 805 810caa aca aat aac ctt gga att cct gga ctt gta aca tca aca gat caa 2558Gln Thr Asn Asn Leu Gly Ile Pro Gly Leu Val Thr Ser Thr Asp Gln815 820 825 830att tat gaa att ggt tgt gat tat agt agt atg tta gga gga aaa att 2606Ile Tyr Glu Ile Gly Cys Asp Tyr Ser Ser Met Leu Gly Gly Lys Ile 835 840 845act aca gca gct aat atg act gta aat gga cca aca cca act gat att 2654Thr Thr Ala Ala Asn Met Thr Val Asn Gly Pro Thr Pro Thr Asp Ile 850 855 860aaa cct aga ggt aaa att gaa ctt gga aat cct gtt ctt atg caa atg 2702Lys Pro Arg Gly Lys Ile Glu Leu Gly Asn Pro Val Leu Met Gln Met 865 870 875aat gct ggt aca ggt gat cat cag cca att tta caa gct aaa ctt gga 2750Asn Ala Gly Thr Gly Asp His Gln Pro Ile Leu Gln Ala Lys Leu Gly 880 885 890gat att ctt gaa tta aga tgg gaa att atg gct atg gat gaa gaa ctt 2798Asp Ile Leu Glu Leu Arg Trp Glu Ile Met Ala Met Asp Glu Glu Leu895 900 905 910gat ttc ttt gtt aaa gat tgt cat gca gaa cct ggt act ggt gct gga 2846Asp Phe Phe Val Lys Asp Cys His Ala Glu Pro Gly Thr Gly Ala Gly 915 920 925gga gat gaa aaa ctt cag ctt att gaa ggt gga tgc cca aca cca gct 2894Gly Asp Glu Lys Leu Gln Leu Ile Glu Gly Gly Cys Pro Thr Pro Ala 930 935 940gtt gct caa aaa ctt att cca caa cca ata aaa tta caa tca tca gct 2942Val Ala Gln Lys Leu Ile Pro Gln Pro Ile Lys Leu Gln Ser Ser Ala 945 950 955gtc aaa att gcc cat ctt caa gct ttc cgt ttt gat tca tcc tct tca 2990Val Lys Ile Ala His Leu Gln Ala Phe Arg Phe Asp Ser Ser Ser Ser 960 965 970gtt aga ata aca tgt aat att gaa att tgt aag gga gat tgt aaa cca 3038Val Arg Ile Thr Cys Asn Ile Glu Ile Cys Lys Gly Asp Cys Lys Pro975 980 985 990gca aca tgt gat atg cac gga gaa tca aaa caa tca tgg gga aga aaa 3086Ala Thr Cys Asp Met His Gly Glu Ser Lys Gln Ser Trp Gly Arg Lys 995 1000 1005aag aga cat att gaa gat gat aca att aca gaa ttt gag aca aat cgt 3134Lys Arg His Ile Glu Asp Asp Thr Ile Thr Glu Phe Glu Thr Asn Arg 1010 1015 1020tat aaa gtt cca aga ttt tca caa gca aca aca tct ctt tta att ctt 3182Tyr Lys Val Pro Arg Phe Ser Gln Ala Thr Thr Ser Leu Leu Ile Leu 1025 1030 1035gat cca ctt caa aat aac att gaa cca gca tca tta atg tca aaa gta 3230Asp Pro Leu Gln Asn Asn Ile Glu Pro Ala Ser Leu Met Ser Lys Val 1040 1045 1050tca tct ctt gat ttg tta gct gaa gat cct gca aaa aca tta ctt aag 3278Ser Ser Leu Asp Leu Leu Ala Glu Asp Pro Ala Lys Thr Leu Leu Lys1055 1060 1065 1070att aaa gag act gca cat ttg aat gga aat ctt tgt atg gga aaa att 3326Ile Lys Glu Thr Ala His Leu Asn Gly Asn Leu Cys Met Gly Lys Ile 1075 1080 1085aca ctt ttc tca gta ttt ggt gtt ctt ctt tca tta att gtt gtt caa 3374Thr Leu Phe Ser Val Phe Gly Val Leu Leu Ser Leu Ile Val Val Gln 1090 1095 1100gca att gtc gta aca aat tat att ttt aaa aga gtt atg tca agc aga 3422Ala Ile Val Val Thr Asn Tyr Ile Phe Lys Arg Val Met Ser Ser Arg 1105 1110 1115aag att acc aat taaactttaa taattaaaca ataattataa atatgccttt 3474Lys Ile Thr Asn 1120atgttctcaa aacgagtata atcctttttt ttgttattaa ttttagtatc aaaatatata 3534tacccgatgg catttacaat aataataaat acaactgaag aaagctataa tatgaaaccg 3594tgccagaaac ttattcaaag tttttaatct ctctctctct ctttctaatt tcctttcaaa 3654acattccatt tttttttttt gtttttattt aatcaaaaaa taataattaa atagtaattt 3714atgatatatc attaatattt ttataatatt tttttg 375021951DNAStrongyloides stercoralisCDS(11)...(1681) 2ggcacgagaa atg aac tgg cta tct ata gct tca att tgt aca ttc tta 49 Met Asn Trp Leu Ser Ile Ala Ser Ile Cys Thr Phe Leu 1 5 10att ata cca ata tct gct gtc ttt gaa tgt tca gga tca gaa act aca 97Ile Ile Pro Ile Ser Ala Val Phe Glu Cys Ser Gly Ser Glu Thr Thr 15 20 25gca ttt att aga ata tcc aga gca cgc ctt gat ggg aca cca gta gtt 145Ala Phe Ile Arg Ile Ser Arg Ala Arg Leu Asp Gly Thr Pro Val Val 30 35 40 45att tct aca gca gga cat gac ttg act tgt gca caa tat tgt aga aat 193Ile Ser Thr Ala Gly His Asp Leu Thr Cys Ala Gln Tyr Cys Arg Asn 50 55 60aat att gaa cca aca act ggt gct caa cgt gtc tgt gca tca ttt aat 241Asn Ile Glu Pro Thr Thr Gly Ala Gln Arg Val Cys Ala Ser Phe Asn 65 70 75ttt gat ggt cgt gaa aca tgc tac ttt ttt gat gat gct gcc tca cct 289Phe Asp Gly Arg Glu Thr Cys Tyr Phe Phe Asp Asp Ala Ala Ser Pro 80 85 90gct ggg act ggg gag ttg aat gaa gca cca tca gct aat aat ttt tat 337Ala Gly Thr Gly Glu Leu Asn Glu Ala Pro Ser Ala Asn Asn Phe Tyr 95 100 105tat gaa aaa gtt tgc ctt cca gct atc tct gct cat gaa gca tgt act 385Tyr Glu Lys Val Cys Leu Pro Ala Ile Ser Ala His Glu Ala Cys Thr110 115 120 125tat aga tca ttt tca ttt gaa aga act aga aat act caa tta gaa ggt 433Tyr Arg Ser Phe Ser Phe Glu Arg Thr Arg Asn Thr Gln Leu Glu Gly 130 135 140ttt gtt aaa aaa tca cta caa gtt aca tca cgt gaa gaa tgc ctt tct 481Phe Val Lys Lys Ser Leu Gln Val Thr Ser Arg Glu Glu Cys Leu Ser 145 150 155aca tgt tta aaa gaa agt gaa ttt gta tgt aga tca gtt aac tat aat 529Thr Cys Leu Lys Glu Ser Glu Phe Val Cys Arg Ser Val Asn Tyr Asn 160 165 170tat gaa aac ttt atg tgt gaa ctt tca aca gaa aga tcg cgt tct aaa 577Tyr Glu Asn Phe Met Cys Glu Leu Ser Thr Glu Arg Ser Arg Ser Lys 175 180 185cca caa aat atg aga atg tca gca gct cca gtt gat tat tat gat aat 625Pro Gln Asn Met Arg Met Ser Ala Ala Pro Val Asp Tyr Tyr Asp Asn190 195 200 205aat tgt tta aat aga caa aat aga tgt ggt gaa tct ggt gga aat ttg 673Asn Cys Leu Asn Arg Gln Asn Arg Cys Gly Glu Ser Gly Gly Asn Leu 210 215 220att ttt att aaa aca aca caa ttt gaa att cat tat tat gat cat act 721Ile Phe Ile Lys Thr Thr Gln Phe Glu Ile His Tyr Tyr Asp His Thr 225 230 235caa tca atg gaa gca caa gaa tca ttc tgt tta caa aaa tgt tta gat 769Gln Ser Met Glu Ala Gln Glu Ser Phe Cys Leu Gln Lys Cys Leu Asp 240 245 250tca tta aac acc ttc tgt aga tct gtt gaa tat tct cca tct gaa aaa 817Ser Leu Asn Thr Phe Cys Arg Ser Val Glu Tyr Ser Pro Ser Glu Lys 255 260 265aat tgt att gtt tct gat gaa gat aca tat tca aga gct gat caa caa 865Asn Cys Ile Val Ser Asp Glu Asp Thr Tyr Ser Arg Ala Asp Gln Gln270 275 280 285ggt gaa gtt aat aat aaa gat tat tat gaa cct gtt tgt gtt gct gct 913Gly Glu Val Asn Asn Lys Asp Tyr Tyr Glu Pro Val Cys Val Ala Ala 290 295 300gat ctt agt tca tct aca tgt cgt caa caa gct gct ttt gaa aga ttt 961Asp Leu Ser Ser Ser Thr Cys Arg Gln Gln Ala Ala Phe Glu Arg Phe 305 310 315att ggt tct gct att gaa ggt acc cca gtt gct aca gca caa caa gta 1009Ile Gly Ser Ala Ile Glu Gly Thr Pro Val Ala Thr Ala Gln Gln Val 320 325 330acc att tct gat tgt att tca ctt tgt ttc caa aat ttg aat tgt aaa 1057Thr Ile Ser Asp Cys Ile Ser Leu Cys Phe Gln Asn Leu Asn Cys Lys 335 340 345tca att aat tat gat cgt aca caa tct aca tgt tat att tat gct gtt 1105Ser Ile Asn Tyr Asp Arg Thr Gln Ser Thr Cys Tyr Ile Tyr Ala Val350 355

360 365gga aga caa gaa tct aat gtt aaa aat gat gca agt ttc gat tat tat 1153Gly Arg Gln Glu Ser Asn Val Lys Asn Asp Ala Ser Phe Asp Tyr Tyr 370 375 380gaa ttt aca att att gat aat gga tgc cca aga tat cct gct ctt gta 1201Glu Phe Thr Ile Ile Asp Asn Gly Cys Pro Arg Tyr Pro Ala Leu Val 385 390 395ggg cca gtt tta caa gat ttc gac aaa aat cgt ctt aaa tct gaa atg 1249Gly Pro Val Leu Gln Asp Phe Asp Lys Asn Arg Leu Lys Ser Glu Met 400 405 410aaa gca ttc cgt tta gat gga tca tat gat att caa att gaa tgt tct 1297Lys Ala Phe Arg Leu Asp Gly Ser Tyr Asp Ile Gln Ile Glu Cys Ser 415 420 425gtt atg ttt tgt gct ggt cca atg ggt tgt cca cca tct aat tgc ctt 1345Val Met Phe Cys Ala Gly Pro Met Gly Cys Pro Pro Ser Asn Cys Leu430 435 440 445gat tca gga aca aat gaa tta ttt gct tca cat gga aga aag aaa aga 1393Asp Ser Gly Thr Asn Glu Leu Phe Ala Ser His Gly Arg Lys Lys Arg 450 455 460agt att gtt gat ttc aaa aat aca aca aca tct gca gaa aca tta tct 1441Ser Ile Val Asp Phe Lys Asn Thr Thr Thr Ser Ala Glu Thr Leu Ser 465 470 475gct ata att aga gta ctt gct gct gga gaa gaa gaa tta gaa gtt gaa 1489Ala Ile Ile Arg Val Leu Ala Ala Gly Glu Glu Glu Leu Glu Val Glu 480 485 490gaa ttt tat aga aat gat act aat ttt aaa tat gat tct gaa gaa aat 1537Glu Phe Tyr Arg Asn Asp Thr Asn Phe Lys Tyr Asp Ser Glu Glu Asn 495 500 505atc tca gct cat aac tta tac tgt atg tct gaa atg tgg ttt gta tca 1585Ile Ser Ala His Asn Leu Tyr Cys Met Ser Glu Met Trp Phe Val Ser510 515 520 525gga att gtt tca atg gct atg atc tgt ctt ctt ctt tct gtt ctt ata 1633Gly Ile Val Ser Met Ala Met Ile Cys Leu Leu Leu Ser Val Leu Ile 530 535 540gtt atg tgg ggc tgt cat tca tta aat caa tct tca aaa tta cca atg 1681Val Met Trp Gly Cys His Ser Leu Asn Gln Ser Ser Lys Leu Pro Met 545 550 555tgaaggaaga tctttcaaca aaaaaaaacg attaattttt aatatttctt taatatatac 1741attccataat cagtatatac tataataatt gcaacataat aatttattgt agaagtctgt 1801ttataaaatc aaatcacaaa tttttctttt acagtactgt gcacaacaac aagaaattcc 1861aatctcttcc tatattttga tgtcgtacac acgtttataa aaacaaattc ttttggtttt 1921taatcagttt tcagtttaca tttatataat 195131122PRTStrongyloides stercoralis 3Met Ser Lys Ser Gly Leu His Leu Val Ala Tyr Ile Leu Leu Ile Phe 1 5 10 15Leu Ile Ser Thr Asn Ile Ala Ser Lys Ile Ser Gly Val Pro Leu Cys 20 25 30Asn Lys Asp Thr Ser Pro Val Phe Thr Leu Gln His Asn Ser Thr Asn 35 40 45Gly Ile Leu Ala Arg Ser Leu Pro Gln Pro Gly Leu Ile Asp Cys Ser 50 55 60Glu His Cys Ser Ser Ser Ser Asp Cys Ile Gly Val Glu Tyr Trp Gln65 70 75 80Gly Ile Cys Arg Val Ile Ser Gln Asp Lys Thr Ser Ile Tyr Thr Pro 85 90 95Thr Asp Glu Thr Ser Ile Leu Leu Thr Lys Ser Cys Val Lys Ser Asp 100 105 110Arg Ile Cys Ser Ser Pro Phe His Phe Asp Val Tyr Glu Gln Lys Ile 115 120 125Leu Val Gly Phe Ala Arg Glu Val Val Pro Ala Glu Ser Ile Glu Ile 130 135 140Cys Met Ala Ala Cys Leu Asn Ala Phe Asp Thr Tyr Gly Phe Glu Cys145 150 155 160Glu Ser Ala Met Tyr Tyr Pro Val Asp Ser Glu Cys Ile Leu Asn Thr 165 170 175Glu Asp Arg Leu Asp Arg Pro Asp Leu Phe Val Val Glu Lys Glu Asp 180 185 190Val Val Tyr Tyr Leu Asp Ser Asn Cys Ala Gly Ser Gln Cys Tyr Ala 195 200 205Pro Tyr Ile Thr Gln Tyr Ile Ala Val Glu Asn Lys Gln Ile Glu Asn 210 215 220Glu Leu Asp Arg Lys Phe Glu Asn Ile Asp Phe Gln Thr Cys Glu Glu225 230 235 240Leu Cys Thr Gly Arg Ile Thr Val Thr Gln Asn Asp Phe Thr Cys Lys 245 250 255Ser Phe Met Tyr Asn Pro Glu Thr Lys Val Cys Tyr Leu Ser Asp Glu 260 265 270Arg Ser Lys Pro Leu Gly Arg Ala Lys Leu Ser Asp Ala Asn Gly Phe 275 280 285Thr Tyr Tyr Glu Lys Lys Cys Phe Ala Ser Pro Arg Thr Cys Arg Gln 290 295 300Thr Pro Ser Phe Asn Arg Val Pro Gln Met Ile Leu Val Gly Phe Ala305 310 315 320Ala Phe Val Met Glu Asn Val Pro Ser Val Thr Met Cys Leu Asp Gln 325 330 335Cys Thr Asn Pro Pro Pro Glu Thr Gly Glu Lys Phe Val Cys Lys Ser 340 345 350Val Met Tyr Tyr Tyr Asn Glu Gln Glu Cys Ile Leu Asn Ala Glu Thr 355 360 365Arg His Thr Lys Pro Asp Leu Phe Ile Thr Glu Gly Asp Glu Phe Leu 370 375 380Val Asp Tyr Phe Asp Ile Ser Cys His Leu Glu Pro Glu Thr Cys Pro385 390 395 400Lys Gly Thr Tyr Leu Lys Gly Ile Lys Ser Ile Asn Ser Ala Leu Pro 405 410 415Glu Gly Glu Gly Ser Leu His Val Ile Glu Ser Ala Gly Lys Ser Leu 420 425 430Glu Glu Cys Met Glu Lys Cys Asn Gln Leu His Pro Glu Lys Cys Arg 435 440 445Ser Phe Asn Phe Glu Lys Ser Ser Gly Leu Cys Asn Leu Leu Tyr Leu 450 455 460Asp Gly Lys Asn Thr Leu Lys Pro Phe Ile Lys Asn Gly Phe Asp Leu465 470 475 480Val Asp Leu Gln Cys Leu Ser Thr Lys Lys Asp Cys Ser Thr Lys Lys 485 490 495Asn Asp Ile Asn Phe Val Lys Tyr Leu Tyr Ser His Phe Val Lys Tyr 500 505 510Leu Tyr Ser Gln Gln Pro Gly Ile Pro Thr Lys Thr Glu Lys Val Ile 515 520 525Gly Ile Ser Lys Cys Leu Asp Leu Cys Thr Asp Ser Glu Arg Cys Glu 530 535 540Gly Leu Asn Tyr Asn Arg Arg Thr Gly Glu Cys Gln Leu Phe Glu Ile545 550 555 560Ile Asp Gly Pro Ser Asn Leu Lys Lys Ser Glu His Ile Asp Phe Tyr 565 570 575Gln Asn Leu Cys Ser Thr Lys Glu Asn Glu Ala Gly Val Ser Ser Ala 580 585 590Leu Asn Val Pro Gln Ser Ser Val Ile Pro Ile Ser Ser Ser Gln Asn 595 600 605Ile Ser Lys Ser Asp Val Phe Ala Lys Lys Asn Leu Asn Lys Asp Gly 610 615 620Asn Asn Gln Val Asn Ile Tyr Glu Pro Glu Lys Lys Tyr His Pro Lys625 630 635 640Gly Ser Lys Asn Glu Thr Ser Tyr Glu Thr Gly Thr Val Asn Lys Ser 645 650 655Asn Val Glu Glu Val Ser Glu Thr Leu Thr Asn Ser Gly Val Glu Ser 660 665 670Gly Ser Leu Glu Lys Asn Ile Ile Thr Ala Pro Pro Ser Ile Pro Lys 675 680 685Ile Pro Glu Gly Pro Leu Pro Val Pro Ile Leu Ile Pro Ala Asp Gln 690 695 700Val Gln Thr Ile Cys Asp Tyr Glu Gly Ile Lys Val Gln Ile Lys Ser705 710 715 720Pro Gln Ser Phe Thr Gly Val Ile Phe Val Lys Asn His Tyr Glu Thr 725 730 735Cys Arg Val Glu Val Ser Asn Ser Asp Ala Ala Thr Leu Glu Leu Gly 740 745 750Leu Pro Ala Ser Phe Gly Met Lys Pro Val Thr Leu Ser Ala Thr Ser 755 760 765Ser Asp Ser Thr Ser Ser Gln Asn Ile Thr Ser Asn Ser Gly His Lys 770 775 780Val Val Gly Arg Ala Arg Arg Asp Thr Gln Glu Lys Ser Cys Gly Leu785 790 795 800Thr Glu Ile Glu Asn Gly Lys Tyr Lys Ser Thr Val Val Ile Gln Thr 805 810 815Asn Asn Leu Gly Ile Pro Gly Leu Val Thr Ser Thr Asp Gln Ile Tyr 820 825 830Glu Ile Gly Cys Asp Tyr Ser Ser Met Leu Gly Gly Lys Ile Thr Thr 835 840 845Ala Ala Asn Met Thr Val Asn Gly Pro Thr Pro Thr Asp Ile Lys Pro 850 855 860Arg Gly Lys Ile Glu Leu Gly Asn Pro Val Leu Met Gln Met Asn Ala865 870 875 880Gly Thr Gly Asp His Gln Pro Ile Leu Gln Ala Lys Leu Gly Asp Ile 885 890 895Leu Glu Leu Arg Trp Glu Ile Met Ala Met Asp Glu Glu Leu Asp Phe 900 905 910Phe Val Lys Asp Cys His Ala Glu Pro Gly Thr Gly Ala Gly Gly Asp 915 920 925Glu Lys Leu Gln Leu Ile Glu Gly Gly Cys Pro Thr Pro Ala Val Ala 930 935 940Gln Lys Leu Ile Pro Gln Pro Ile Lys Leu Gln Ser Ser Ala Val Lys945 950 955 960Ile Ala His Leu Gln Ala Phe Arg Phe Asp Ser Ser Ser Ser Val Arg 965 970 975Ile Thr Cys Asn Ile Glu Ile Cys Lys Gly Asp Cys Lys Pro Ala Thr 980 985 990Cys Asp Met His Gly Glu Ser Lys Gln Ser Trp Gly Arg Lys Lys Arg 995 1000 1005His Ile Glu Asp Asp Thr Ile Thr Glu Phe Glu Thr Asn Arg Tyr Lys 1010 1015 1020Val Pro Arg Phe Ser Gln Ala Thr Thr Ser Leu Leu Ile Leu Asp Pro1025 1030 1035 1040Leu Gln Asn Asn Ile Glu Pro Ala Ser Leu Met Ser Lys Val Ser Ser 1045 1050 1055Leu Asp Leu Leu Ala Glu Asp Pro Ala Lys Thr Leu Leu Lys Ile Lys 1060 1065 1070Glu Thr Ala His Leu Asn Gly Asn Leu Cys Met Gly Lys Ile Thr Leu 1075 1080 1085Phe Ser Val Phe Gly Val Leu Leu Ser Leu Ile Val Val Gln Ala Ile 1090 1095 1100Val Val Thr Asn Tyr Ile Phe Lys Arg Val Met Ser Ser Arg Lys Ile1105 1110 1115 1120Thr Asn4557PRTStrongyloides stercoralis 4Met Asn Trp Leu Ser Ile Ala Ser Ile Cys Thr Phe Leu Ile Ile Pro 1 5 10 15Ile Ser Ala Val Phe Glu Cys Ser Gly Ser Glu Thr Thr Ala Phe Ile 20 25 30Arg Ile Ser Arg Ala Arg Leu Asp Gly Thr Pro Val Val Ile Ser Thr 35 40 45Ala Gly His Asp Leu Thr Cys Ala Gln Tyr Cys Arg Asn Asn Ile Glu 50 55 60Pro Thr Thr Gly Ala Gln Arg Val Cys Ala Ser Phe Asn Phe Asp Gly65 70 75 80Arg Glu Thr Cys Tyr Phe Phe Asp Asp Ala Ala Ser Pro Ala Gly Thr 85 90 95Gly Glu Leu Asn Glu Ala Pro Ser Ala Asn Asn Phe Tyr Tyr Glu Lys 100 105 110Val Cys Leu Pro Ala Ile Ser Ala His Glu Ala Cys Thr Tyr Arg Ser 115 120 125Phe Ser Phe Glu Arg Thr Arg Asn Thr Gln Leu Glu Gly Phe Val Lys 130 135 140Lys Ser Leu Gln Val Thr Ser Arg Glu Glu Cys Leu Ser Thr Cys Leu145 150 155 160Lys Glu Ser Glu Phe Val Cys Arg Ser Val Asn Tyr Asn Tyr Glu Asn 165 170 175Phe Met Cys Glu Leu Ser Thr Glu Arg Ser Arg Ser Lys Pro Gln Asn 180 185 190Met Arg Met Ser Ala Ala Pro Val Asp Tyr Tyr Asp Asn Asn Cys Leu 195 200 205Asn Arg Gln Asn Arg Cys Gly Glu Ser Gly Gly Asn Leu Ile Phe Ile 210 215 220Lys Thr Thr Gln Phe Glu Ile His Tyr Tyr Asp His Thr Gln Ser Met225 230 235 240Glu Ala Gln Glu Ser Phe Cys Leu Gln Lys Cys Leu Asp Ser Leu Asn 245 250 255Thr Phe Cys Arg Ser Val Glu Tyr Ser Pro Ser Glu Lys Asn Cys Ile 260 265 270Val Ser Asp Glu Asp Thr Tyr Ser Arg Ala Asp Gln Gln Gly Glu Val 275 280 285Asn Asn Lys Asp Tyr Tyr Glu Pro Val Cys Val Ala Ala Asp Leu Ser 290 295 300Ser Ser Thr Cys Arg Gln Gln Ala Ala Phe Glu Arg Phe Ile Gly Ser305 310 315 320Ala Ile Glu Gly Thr Pro Val Ala Thr Ala Gln Gln Val Thr Ile Ser 325 330 335Asp Cys Ile Ser Leu Cys Phe Gln Asn Leu Asn Cys Lys Ser Ile Asn 340 345 350Tyr Asp Arg Thr Gln Ser Thr Cys Tyr Ile Tyr Ala Val Gly Arg Gln 355 360 365Glu Ser Asn Val Lys Asn Asp Ala Ser Phe Asp Tyr Tyr Glu Phe Thr 370 375 380Ile Ile Asp Asn Gly Cys Pro Arg Tyr Pro Ala Leu Val Gly Pro Val385 390 395 400Leu Gln Asp Phe Asp Lys Asn Arg Leu Lys Ser Glu Met Lys Ala Phe 405 410 415Arg Leu Asp Gly Ser Tyr Asp Ile Gln Ile Glu Cys Ser Val Met Phe 420 425 430Cys Ala Gly Pro Met Gly Cys Pro Pro Ser Asn Cys Leu Asp Ser Gly 435 440 445Thr Asn Glu Leu Phe Ala Ser His Gly Arg Lys Lys Arg Ser Ile Val 450 455 460Asp Phe Lys Asn Thr Thr Thr Ser Ala Glu Thr Leu Ser Ala Ile Ile465 470 475 480Arg Val Leu Ala Ala Gly Glu Glu Glu Leu Glu Val Glu Glu Phe Tyr 485 490 495Arg Asn Asp Thr Asn Phe Lys Tyr Asp Ser Glu Glu Asn Ile Ser Ala 500 505 510His Asn Leu Tyr Cys Met Ser Glu Met Trp Phe Val Ser Gly Ile Val 515 520 525Ser Met Ala Met Ile Cys Leu Leu Leu Ser Val Leu Ile Val Met Trp 530 535 540Gly Cys His Ser Leu Asn Gln Ser Ser Lys Leu Pro Met545 550 55553369DNAStrongyloides stercoralis 5atgtctaagt ctgggcttca tcttgtagcc tacatattat tgatattttt aatttcaact 60aatatagcat ctaaaatttc tggtgttcca ttatgcaaca aagatacttc accagtattt 120acacttcaac ataattctac taatggtatt ttagctagat ctcttccaca accaggatta 180attgattgtt cagaacattg ttcctcttcg tcagattgta ttggcgttga atattggcag 240ggaatttgta gagttatttc tcaagataaa acttctattt atacaccaac agatgaaact 300tcaatacttt taacaaaatc atgtgttaaa agtgatcgta tatgttcatc accattccat 360tttgatgttt atgaacaaaa aatattagtt ggatttgcta gagaagttgt accagctgag 420tctattgaaa tttgtatggc tgcttgtttg aatgcttttg atacatatgg ttttgaatgt 480gaatcagcta tgtattatcc agttgatagt gaatgtattc ttaatactga agatagactt 540gatcgaccag atctttttgt tgttgaaaaa gaagatgttg tttattatct tgattctaat 600tgtgctggtt cacaatgtta tgctccatac attacacaat atattgctgt tgaaaataaa 660caaatagaaa atgaattaga tagaaaattt gaaaatattg atttccaaac atgtgaagaa 720ttatgtactg gtagaattac tgttacacaa aatgatttta cttgtaaatc atttatgtat 780aatcctgaaa caaaagtttg ttatctttct gatgaacgtt caaagcctct tggacgggct 840aaattaagtg atgctaatgg atttacttat tatgaaaaaa aatgttttgc atctccaaga 900acatgccgtc aaacaccatc atttaataga gtaccacaaa tgattcttgt tggttttgct 960gcatttgtta tggaaaatgt accatctgtt actatgtgcc ttgatcaatg tacaaatcca 1020ccaccagaga caggtgaaaa atttgtctgt aaatctgtta tgtactatta taatgaacaa 1080gaatgtattc ttaatgctga aacaagacat acaaagccag atctttttat tacagaagga 1140gatgaatttc ttgttgatta ttttgatatt tcatgtcatc ttgaaccaga aacatgtcct 1200aaaggaacat atttaaaagg aattaaatct atcaattctg cacttcctga gggtgaaggc 1260tcacttcatg ttattgagtc tgctggaaaa tcattagaag aatgtatgga aaaatgtaac 1320caacttcatc cagaaaaatg tagatcattt aattttgaaa aatcatctgg attatgtaat 1380cttttatatc ttgatggaaa aaatacttta aaaccattta ttaaaaatgg atttgatctt 1440gttgatttac aatgtttatc aactaaaaaa gattgctcta caaaaaagaa tgatattaat 1500tttgttaaat atctttactc tcattttgtt aaatatcttt actctcaaca acctggaatt 1560ccaacaaaaa cagaaaaagt tattggtatt tctaaatgtc ttgatttatg tactgatagt 1620gaacgttgtg aaggacttaa ttataataga agaactggag aatgtcaatt atttgaaatt 1680attgatggac cttctaatct taaaaaatct gagcatatag atttttatca aaatctttgt 1740tctactaaag aaaatgaagc tggtgtttca tctgcattaa atgtaccaca atcatctgtt 1800attcctattt catcatcaca aaatattagt aaaagtgatg tttttgccaa aaaaaatctt 1860aataaagatg gtaataatca agtaaacatt tatgaaccag aaaaaaaata ccatccaaaa 1920ggatcaaaaa atgaaacatc atatgaaaca ggaactgtaa ataaatcaaa tgttgaagag 1980gtttctgaaa ctttaactaa tagtggagtt gaaagtggaa gtcttgaaaa aaatattatt 2040acagcaccac catctatacc aaaaattcct gaaggtccac taccagtgcc aattttaatt 2100ccagctgatc aagtacaaac tatttgtgat tatgaaggta ttaaagtaca aattaaatca 2160ccacaatcat ttactggtgt tatctttgtt aaaaatcact atgaaacatg tcgtgttgaa 2220gtttccaact ctgatgcagc tactcttgag cttggtcttc cagcttcatt tggaatgaaa 2280ccagttacac tgtctgctac atcttcagat tctacctctt cacagaatat tacttctaat 2340agtggacata aagttgttgg aagagcacgc cgtgatacac aagaaaaatc ttgtggtctt 2400acagaaattg aaaatggaaa atataaaagt actgttgtta tacaaacaaa taaccttgga 2460attcctggac ttgtaacatc aacagatcaa atttatgaaa ttggttgtga ttatagtagt 2520atgttaggag gaaaaattac tacagcagct

aatatgactg taaatggacc aacaccaact 2580gatattaaac ctagaggtaa aattgaactt ggaaatcctg ttcttatgca aatgaatgct 2640ggtacaggtg atcatcagcc aattttacaa gctaaacttg gagatattct tgaattaaga 2700tgggaaatta tggctatgga tgaagaactt gatttctttg ttaaagattg tcatgcagaa 2760cctggtactg gtgctggagg agatgaaaaa cttcagctta ttgaaggtgg atgcccaaca 2820ccagctgttg ctcaaaaact tattccacaa ccaataaaat tacaatcatc agctgtcaaa 2880attgcccatc ttcaagcttt ccgttttgat tcatcctctt cagttagaat aacatgtaat 2940attgaaattt gtaagggaga ttgtaaacca gcaacatgtg atatgcacgg agaatcaaaa 3000caatcatggg gaagaaaaaa gagacatatt gaagatgata caattacaga atttgagaca 3060aatcgttata aagttccaag attttcacaa gcaacaacat ctcttttaat tcttgatcca 3120cttcaaaata acattgaacc agcatcatta atgtcaaaag tatcatctct tgatttgtta 3180gctgaagatc ctgcaaaaac attacttaag attaaagaga ctgcacattt gaatggaaat 3240ctttgtatgg gaaaaattac acttttctca gtatttggtg ttcttctttc attaattgtt 3300gttcaagcaa ttgtcgtaac aaattatatt tttaaaagag ttatgtcaag cagaaagatt 3360accaattaa 336961674DNAStrongyloides stercoralis 6atgaactggc tatctatagc ttcaatttgt acattcttaa ttataccaat atctgctgtc 60tttgaatgtt caggatcaga aactacagca tttattagaa tatccagagc acgccttgat 120gggacaccag tagttatttc tacagcagga catgacttga cttgtgcaca atattgtaga 180aataatattg aaccaacaac tggtgctcaa cgtgtctgtg catcatttaa ttttgatggt 240cgtgaaacat gctacttttt tgatgatgct gcctcacctg ctgggactgg ggagttgaat 300gaagcaccat cagctaataa tttttattat gaaaaagttt gccttccagc tatctctgct 360catgaagcat gtacttatag atcattttca tttgaaagaa ctagaaatac tcaattagaa 420ggttttgtta aaaaatcact acaagttaca tcacgtgaag aatgcctttc tacatgttta 480aaagaaagtg aatttgtatg tagatcagtt aactataatt atgaaaactt tatgtgtgaa 540ctttcaacag aaagatcgcg ttctaaacca caaaatatga gaatgtcagc agctccagtt 600gattattatg ataataattg tttaaataga caaaatagat gtggtgaatc tggtggaaat 660ttgattttta ttaaaacaac acaatttgaa attcattatt atgatcatac tcaatcaatg 720gaagcacaag aatcattctg tttacaaaaa tgtttagatt cattaaacac cttctgtaga 780tctgttgaat attctccatc tgaaaaaaat tgtattgttt ctgatgaaga tacatattca 840agagctgatc aacaaggtga agttaataat aaagattatt atgaacctgt ttgtgttgct 900gctgatctta gttcatctac atgtcgtcaa caagctgctt ttgaaagatt tattggttct 960gctattgaag gtaccccagt tgctacagca caacaagtaa ccatttctga ttgtatttca 1020ctttgtttcc aaaatttgaa ttgtaaatca attaattatg atcgtacaca atctacatgt 1080tatatttatg ctgttggaag acaagaatct aatgttaaaa atgatgcaag tttcgattat 1140tatgaattta caattattga taatggatgc ccaagatatc ctgctcttgt agggccagtt 1200ttacaagatt tcgacaaaaa tcgtcttaaa tctgaaatga aagcattccg tttagatgga 1260tcatatgata ttcaaattga atgttctgtt atgttttgtg ctggtccaat gggttgtcca 1320ccatctaatt gccttgattc aggaacaaat gaattatttg cttcacatgg aagaaagaaa 1380agaagtattg ttgatttcaa aaatacaaca acatctgcag aaacattatc tgctataatt 1440agagtacttg ctgctggaga agaagaatta gaagttgaag aattttatag aaatgatact 1500aattttaaat atgattctga agaaaatatc tcagctcata acttatactg tatgtctgaa 1560atgtggtttg tatcaggaat tgtttcaatg gctatgatct gtcttcttct ttctgttctt 1620atagttatgt ggggctgtca ttcattaaat caatcttcaa aattaccaat gtga 167473847DNAMeloidogyne javanicaCDS(181)...(3810) 7gcgtcgatag tccgattttt taaggtttaa ttacccaagc ttaaggaata tttgaagctt 60atttttaaag aaaaaataaa ttaaataaga gattagcaca acaacaacag aaatttttct 120tgaatttaca acaaaataat tttttcttaa ttaaattcct ttaaattatc cacaacttct 180atg gtt aca aaa atc cca act ttt ccc ctc ctt ttt att ttc cca ttt 228Met Val Thr Lys Ile Pro Thr Phe Pro Leu Leu Phe Ile Phe Pro Phe 1 5 10 15tta ttt aca ttt tta acg aca aaa tgt cag gct tat tct ata cca tta 276Leu Phe Thr Phe Leu Thr Thr Lys Cys Gln Ala Tyr Ser Ile Pro Leu 20 25 30ata tca gaa tgt aat tcg gaa gaa gcc cca gtt ttt ctt ttg caa cgg 324Ile Ser Glu Cys Asn Ser Glu Glu Ala Pro Val Phe Leu Leu Gln Arg 35 40 45aat gtt tct tct atc gcc gga act gag cct tta aga act gtt cct gtt 372Asn Val Ser Ser Ile Ala Gly Thr Glu Pro Leu Arg Thr Val Pro Val 50 55 60aca ggg gga ttt ttg gaa tgt gcg gaa ctt tgt tca gca gca aat aat 420Thr Gly Gly Phe Leu Glu Cys Ala Glu Leu Cys Ser Ala Ala Asn Asn 65 70 75 80tgt gtt gct gtt aaa ttt tct att gaa aaa caa tgc caa ttg ttg ggg 468Cys Val Ala Val Lys Phe Ser Ile Glu Lys Gln Cys Gln Leu Leu Gly 85 90 95aaa aca act atg aca gca aca act tta tct tta caa gac att aat ttg 516Lys Thr Thr Met Thr Ala Thr Thr Leu Ser Leu Gln Asp Ile Asn Leu 100 105 110aca cta gct aga tta gct act aaa agt tgt gtt aag agc aaa aaa atc 564Thr Leu Ala Arg Leu Ala Thr Lys Ser Cys Val Lys Ser Lys Lys Ile 115 120 125tgt tct tcc ccc ttc cat ttt gat gtt cac gaa caa aaa ata ctt gtt 612Cys Ser Ser Pro Phe His Phe Asp Val His Glu Gln Lys Ile Leu Val 130 135 140ggt ttt gct aga gaa gtt gta tca gca gaa tct ata cat caa tgt tta 660Gly Phe Ala Arg Glu Val Val Ser Ala Glu Ser Ile His Gln Cys Leu145 150 155 160act gct tgt tta gat gct gtt gat act ttt ggc ttt gaa tgc gag tca 708Thr Ala Cys Leu Asp Ala Val Asp Thr Phe Gly Phe Glu Cys Glu Ser 165 170 175gta atg tat tat cca ttg gat gcc gaa tgt att tta aat aca gaa gac 756Val Met Tyr Tyr Pro Leu Asp Ala Glu Cys Ile Leu Asn Thr Glu Asp 180 185 190aga ctt gac cgt cca gat ttg ttt gtt gat gag aag gaa gat act gtt 804Arg Leu Asp Arg Pro Asp Leu Phe Val Asp Glu Lys Glu Asp Thr Val 195 200 205gtt tat ttg gat aat aat tgt gct gga tcc caa tgt cat gcc cct tat 852Val Tyr Leu Asp Asn Asn Cys Ala Gly Ser Gln Cys His Ala Pro Tyr 210 215 220gta acc caa tat gta gct gtt gaa gga aaa caa tta gct gag gaa ttg 900Val Thr Gln Tyr Val Ala Val Glu Gly Lys Gln Leu Ala Glu Glu Leu225 230 235 240gat cat aat ttt gag gga atg gag ttg aca gaa tgt gaa cag ctt tgt 948Asp His Asn Phe Glu Gly Met Glu Leu Thr Glu Cys Glu Gln Leu Cys 245 250 255aat caa aga ttg agt gtt tct gca aat gac ttt aat tgc aaa gca ttt 996Asn Gln Arg Leu Ser Val Ser Ala Asn Asp Phe Asn Cys Lys Ala Phe 260 265 270atg tac aat aac caa aca aga tct tgt att ctt tct gat gaa cgt tca 1044Met Tyr Asn Asn Gln Thr Arg Ser Cys Ile Leu Ser Asp Glu Arg Ser 275 280 285aga cct ttg ggt aga gct aat ttg aca gat gct aaa gga tgg act tat 1092Arg Pro Leu Gly Arg Ala Asn Leu Thr Asp Ala Lys Gly Trp Thr Tyr 290 295 300cac gag aaa aaa tgt ttt gcc tcc cca cgt aca tgc cga aat gtt cct 1140His Glu Lys Lys Cys Phe Ala Ser Pro Arg Thr Cys Arg Asn Val Pro305 310 315 320tct ttt acc cgc gtc cct caa atg tta tta gtt gga ttt gcc tct ttt 1188Ser Phe Thr Arg Val Pro Gln Met Leu Leu Val Gly Phe Ala Ser Phe 325 330 335gta atg gaa aat gtc cct tca gta act atg tgt ttg gat caa tgt aca 1236Val Met Glu Asn Val Pro Ser Val Thr Met Cys Leu Asp Gln Cys Thr 340 345 350aat cct ccc cca gaa act gga caa agt ttt gtt tgt aaa tct gtc atg 1284Asn Pro Pro Pro Glu Thr Gly Gln Ser Phe Val Cys Lys Ser Val Met 355 360 365tat tat tat aat gag caa gaa tgt att tta aat gct gaa tca cgt cat 1332Tyr Tyr Tyr Asn Glu Gln Glu Cys Ile Leu Asn Ala Glu Ser Arg His 370 375 380tcc aag cca gat tta ttt att ccc gaa gaa gac gat ttt gtt gta gat 1380Ser Lys Pro Asp Leu Phe Ile Pro Glu Glu Asp Asp Phe Val Val Asp385 390 395 400tat ttt gat ata aat tgc cgt cta gaa caa gaa caa tgt atc gat gga 1428Tyr Phe Asp Ile Asn Cys Arg Leu Glu Gln Glu Gln Cys Ile Asp Gly 405 410 415aga acg ccc caa tta gtt aga aca att aat tct gca ctt cca gaa ggg 1476Arg Thr Pro Gln Leu Val Arg Thr Ile Asn Ser Ala Leu Pro Glu Gly 420 425 430gag ggg tct ata cat gtt ttg gaa aca att aag gga gga gtt cag caa 1524Glu Gly Ser Ile His Val Leu Glu Thr Ile Lys Gly Gly Val Gln Gln 435 440 445tgt gct aaa aaa tgt tct gaa cgc gcc cca gac aaa tgt cgc tct ttc 1572Cys Ala Lys Lys Cys Ser Glu Arg Ala Pro Asp Lys Cys Arg Ser Phe 450 455 460aat ttt gat aaa caa gct ggt aat tgt aat tta ctt tat ttg gat gga 1620Asn Phe Asp Lys Gln Ala Gly Asn Cys Asn Leu Leu Tyr Leu Asp Gly465 470 475 480caa ggg tct tta cga cca gag caa aag aca caa ttc gat tta tac gat 1668Gln Gly Ser Leu Arg Pro Glu Gln Lys Thr Gln Phe Asp Leu Tyr Asp 485 490 495gtt cat tgt ttg agt gga aca tct caa ctt tta gga gaa aat tct aaa 1716Val His Cys Leu Ser Gly Thr Ser Gln Leu Leu Gly Glu Asn Ser Lys 500 505 510cat tct ccc tct gct tgt gtt gac cca gaa ggg gct att ttt agt cgt 1764His Ser Pro Ser Ala Cys Val Asp Pro Glu Gly Ala Ile Phe Ser Arg 515 520 525ttc ctc tac act cgt tgg gta gca aat tct ccc aat cgt gaa att tca 1812Phe Leu Tyr Thr Arg Trp Val Ala Asn Ser Pro Asn Arg Glu Ile Ser 530 535 540agt tta cca ctt tcc aaa tgt tta aat ctt tgt tcg gtt gga gga gaa 1860Ser Leu Pro Leu Ser Lys Cys Leu Asn Leu Cys Ser Val Gly Gly Glu545 550 555 560caa tgt gag ggt gtt aat tac aat cgc cga aat ggt tct tgt caa tta 1908Gln Cys Glu Gly Val Asn Tyr Asn Arg Arg Asn Gly Ser Cys Gln Leu 565 570 575ttt act tcc ctt cta tta aac tct tct cca aat tct caa caa gac aaa 1956Phe Thr Ser Leu Leu Leu Asn Ser Ser Pro Asn Ser Gln Gln Asp Lys 580 585 590gac gaa cat gtt gat ttt tac aga aat att tgt aga gtt aag gaa tcg 2004Asp Glu His Val Asp Phe Tyr Arg Asn Ile Cys Arg Val Lys Glu Ser 595 600 605aaa agt gat agt ggg gct gct aat gta ccc aaa aca caa caa gca acg 2052Lys Ser Asp Ser Gly Ala Ala Asn Val Pro Lys Thr Gln Gln Ala Thr 610 615 620gct gca cct ccc cct tct gtt caa tta act act aaa cct cca caa att 2100Ala Ala Pro Pro Pro Ser Val Gln Leu Thr Thr Lys Pro Pro Gln Ile625 630 635 640cgt gat tta aac aac aac aat aaa aca aca cac aaa gaa cca aat att 2148Arg Asp Leu Asn Asn Asn Asn Lys Thr Thr His Lys Glu Pro Asn Ile 645 650 655aaa ctt cca cca caa tca gca aaa cct ata aat gga aaa act gga aag 2196Lys Leu Pro Pro Gln Ser Ala Lys Pro Ile Asn Gly Lys Thr Gly Lys 660 665 670gaa caa ctt cct gta ggg tca aaa tct ttt ggg gtt act aat acg cgt 2244Glu Gln Leu Pro Val Gly Ser Lys Ser Phe Gly Val Thr Asn Thr Arg 675 680 685gat gat ggg gag aat tca ata act gga act gct cct cct cct gta gat 2292Asp Asp Gly Glu Asn Ser Ile Thr Gly Thr Ala Pro Pro Pro Val Asp 690 695 700ggc aaa tta att att aaa cct tca cca caa gtt tct att ccc tcc cct 2340Gly Lys Leu Ile Ile Lys Pro Ser Pro Gln Val Ser Ile Pro Ser Pro705 710 715 720gta ctt att ccg gca caa gaa gta cat act att tgt aat tat gaa gga 2388Val Leu Ile Pro Ala Gln Glu Val His Thr Ile Cys Asn Tyr Glu Gly 725 730 735att agt gtt caa att aaa cat tct tct cca ttc tct ggc gtt gtt ttt 2436Ile Ser Val Gln Ile Lys His Ser Ser Pro Phe Ser Gly Val Val Phe 740 745 750gtt cga aat aaa tat gat act tgc cgt gtg aag ttg aag gaa agg aca 2484Val Arg Asn Lys Tyr Asp Thr Cys Arg Val Lys Leu Lys Glu Arg Thr 755 760 765gcg ttg ttt tgg ttt tgg ggc ttc cag caa att ttg gaa atg aag cca 2532Ala Leu Phe Trp Phe Trp Gly Phe Gln Gln Ile Leu Glu Met Lys Pro 770 775 780att gct tta att aat tca caa aaa cat gga aaa ggg aat aaa aca cac 2580Ile Ala Leu Ile Asn Ser Gln Lys His Gly Lys Gly Asn Lys Thr His785 790 795 800gga gat act tta ctt tct att gaa ggt tcc aaa aaa caa att gaa ggg 2628Gly Asp Thr Leu Leu Ser Ile Glu Gly Ser Lys Lys Gln Ile Glu Gly 805 810 815ggt tct tca act gaa gat att caa tta ata aat tct caa aaa gac ctt 2676Gly Ser Ser Thr Glu Asp Ile Gln Leu Ile Asn Ser Gln Lys Asp Leu 820 825 830aaa cgt tca aga aga caa tta caa aga gat tgt gga tta caa gat atg 2724Lys Arg Ser Arg Arg Gln Leu Gln Arg Asp Cys Gly Leu Gln Asp Met 835 840 845gac aat gga act tac aaa act gtt att gtt gtc caa aca aat aat ttg 2772Asp Asn Gly Thr Tyr Lys Thr Val Ile Val Val Gln Thr Asn Asn Leu 850 855 860gga att ccg gga ctt gtt act tct atg gac caa ctt tat gag att tcc 2820Gly Ile Pro Gly Leu Val Thr Ser Met Asp Gln Leu Tyr Glu Ile Ser865 870 875 880tgt aac tat tca agt atg ttg gga ggc aaa gtc caa aca gca gct gca 2868Cys Asn Tyr Ser Ser Met Leu Gly Gly Lys Val Gln Thr Ala Ala Ala 885 890 895tta cgt gtt cac ggt ccc caa cct tca cta atc cag cct cgc ggc aaa 2916Leu Arg Val His Gly Pro Gln Pro Ser Leu Ile Gln Pro Arg Gly Lys 900 905 910ata gaa ttg gga aat cct gtt ttg atg caa atg ggg cct gta cgt agt 2964Ile Glu Leu Gly Asn Pro Val Leu Met Gln Met Gly Pro Val Arg Ser 915 920 925gaa agg caa agt ggg gaa ggg cct tta att caa gct aaa ttg ggg gat 3012Glu Arg Gln Ser Gly Glu Gly Pro Leu Ile Gln Ala Lys Leu Gly Asp 930 935 940att ctt gaa tta aaa tgg gaa att atg gca atg gat gaa gaa ttg gac 3060Ile Leu Glu Leu Lys Trp Glu Ile Met Ala Met Asp Glu Glu Leu Asp945 950 955 960ttt tta gtt cgt gat tgt ttt gca gag ccg gga act tct gga aat caa 3108Phe Leu Val Arg Asp Cys Phe Ala Glu Pro Gly Thr Ser Gly Asn Gln 965 970 975ggg gaa aga ctt cct tta att gag aat ggt tgt cca aca cca gca gta 3156Gly Glu Arg Leu Pro Leu Ile Glu Asn Gly Cys Pro Thr Pro Ala Val 980 985 990gca caa aaa tta att cca aat cca ata aaa gca att aat tct gca gtt 3204Ala Gln Lys Leu Ile Pro Asn Pro Ile Lys Ala Ile Asn Ser Ala Val 995 1000 1005aaa tta act tat tta caa gca ttc aga ttt gac agt tct cca gct att 3252Lys Leu Thr Tyr Leu Gln Ala Phe Arg Phe Asp Ser Ser Pro Ala Ile 1010 1015 1020aga ata act tgt cat tta gaa tta tgt aaa gaa aat tgt aaa tcg gtt 3300Arg Ile Thr Cys His Leu Glu Leu Cys Lys Glu Asn Cys Lys Ser Val1025 1030 1035 1040aat tgt aaa ttt aat gat gga att aaa gaa tcg tgg ggc aga aaa cgc 3348Asn Cys Lys Phe Asn Asp Gly Ile Lys Glu Ser Trp Gly Arg Lys Arg 1045 1050 1055cgt ttt gct att gac aat aac att aat agg aaa aat gaa gtt aaa gaa 3396Arg Phe Ala Ile Asp Asn Asn Ile Asn Arg Lys Asn Glu Val Lys Glu 1060 1065 1070ttc gaa act cgc cgt ttt gtc gtt ccc cgt ttt gcc caa gca aca act 3444Phe Glu Thr Arg Arg Phe Val Val Pro Arg Phe Ala Gln Ala Thr Thr 1075 1080 1085tct tta gtt att gta gac cct tta caa caa caa aat tct gtt ata aaa 3492Ser Leu Val Ile Val Asp Pro Leu Gln Gln Gln Asn Ser Val Ile Lys 1090 1095 1100aca gaa caa caa caa caa cca ttt att tca cat tcc tca ata tct aaa 3540Thr Glu Gln Gln Gln Gln Pro Phe Ile Ser His Ser Ser Ile Ser Lys1105 1110 1115 1120caa ata ttt gaa aat aat aaa aaa gaa aat aat aaa aat ata aca aaa 3588Gln Ile Phe Glu Asn Asn Lys Lys Glu Asn Asn Lys Asn Ile Thr Lys 1125 1130 1135aca gct aaa aaa tcc tct tct ctt ttt gaa gct ttt act gag gct gct 3636Thr Ala Lys Lys Ser Ser Ser Leu Phe Glu Ala Phe Thr Glu Ala Ala 1140 1145 1150ggt gga agg aaa att aat tta gaa tta aca aca aca aat tca gaa caa 3684Gly Gly Arg Lys Ile Asn Leu Glu Leu Thr Thr Thr Asn Ser Glu Gln 1155 1160 1165caa caa ctt tgt tta cat aaa tgg aca ctt ggg ggt gtt ttt gga act 3732Gln Gln Leu Cys Leu His Lys Trp Thr Leu Gly Gly Val Phe Gly Thr 1170 1175 1180ctt tta aca tta att gtt gtt caa agc ggg gtt gct gct aaa cat tta 3780Leu Leu Thr Leu Ile Val Val Gln Ser Gly Val Ala Ala Lys His Leu1185 1190 1195 1200att aat cga ttt att gtt gga aaa aga att taaaaaaaaa aaaaaaagta 3830Ile Asn Arg Phe Ile Val Gly Lys Arg Ile 1205 1210ctagtcgacg cgtggcc 38478752DNAHeterodera glycinesCDS(1)...(750) 8gag cag aag att ttg gtg ggt ttc gcg cgg gag gtg gtc tcc gcc gac 48Glu Gln Lys Ile Leu Val Gly Phe Ala Arg Glu Val Val Ser Ala Asp 1 5 10 15tca gtc cac cgc tgt ctg tcc gct tgt ctg aat gcg ttc gat acg ttc 96Ser Val His Arg Cys Leu Ser Ala Cys Leu Asn Ala Phe Asp Thr Phe 20 25

30ggc ttc gaa tgc gag tcg gtc atg tat tac cct gtg gac gcg gaa tgc 144Gly Phe Glu Cys Glu Ser Val Met Tyr Tyr Pro Val Asp Ala Glu Cys 35 40 45att ttg aac acg gag gac cga ttg gat cgg cct gac ctt ttc gtg gac 192Ile Leu Asn Thr Glu Asp Arg Leu Asp Arg Pro Asp Leu Phe Val Asp 50 55 60gag cac gag gac acg gtc atc tac ttg gac aac aat tgc gcc gga tgt 240Glu His Glu Asp Thr Val Ile Tyr Leu Asp Asn Asn Cys Ala Gly Cys 65 70 75 80gag tgc cat tgg cat ttt gac aat ttc aaa aca agc ggc att ttg aac 288Glu Cys His Trp His Phe Asp Asn Phe Lys Thr Ser Gly Ile Leu Asn 85 90 95gac caa caa ttc gca att gca gca caa tgt tac gca ccg tac gta acg 336Asp Gln Gln Phe Ala Ile Ala Ala Gln Cys Tyr Ala Pro Tyr Val Thr 100 105 110caa tac gtg gcg gtg gaa gga cgc caa ttg tcg gac gaa ttg gac cac 384Gln Tyr Val Ala Val Glu Gly Arg Gln Leu Ser Asp Glu Leu Asp His 115 120 125agt ttt gaa ggg ttg gag ctg agc gaa tgt gaa gag ttg tgc acg caa 432Ser Phe Glu Gly Leu Glu Leu Ser Glu Cys Glu Glu Leu Cys Thr Gln 130 135 140cgg tta agt gtt acg gca aac gac ttc aac tgc aaa tcg ttc atg tac 480Arg Leu Ser Val Thr Ala Asn Asp Phe Asn Cys Lys Ser Phe Met Tyr145 150 155 160agt aac ttg acg cgc agt tgc gtt ttg tcg gac gaa cgc tcg cgc cct 528Ser Asn Leu Thr Arg Ser Cys Val Leu Ser Asp Glu Arg Ser Arg Pro 165 170 175ttg ggc cgt gcc aat ttg gcc gaa gtg ccg gga tgg act tat ttc gag 576Leu Gly Arg Ala Asn Leu Ala Glu Val Pro Gly Trp Thr Tyr Phe Glu 180 185 190agc cgc ggc gtt ccg tcg ttt acg cga gtg ccg caa atg ctt ttg gtg 624Ser Arg Gly Val Pro Ser Phe Thr Arg Val Pro Gln Met Leu Leu Val 195 200 205ggc ttt gcc tct ttt gtg atg gaa aat gtg ccg tca gtg aca atg tgt 672Gly Phe Ala Ser Phe Val Met Glu Asn Val Pro Ser Val Thr Met Cys 210 215 220ttg gac caa tgc aca agc cct cct cct gag acg gga caa aac ttt gtg 720Leu Asp Gln Cys Thr Ser Pro Pro Pro Glu Thr Gly Gln Asn Phe Val225 230 235 240tgt aaa tcg gtg atg tac tac tac aac gag ca 752Cys Lys Ser Val Met Tyr Tyr Tyr Asn Glu 245 25092808DNABrugia malayiCDS(166)...(2808) 9cgactggagc acgaggacac tgacatggac tgaaggagta gaaaatttct gttgttcatt 60tcttatcaga ctgtcccatt catcatcgtg accactacca gtattacttc aggacagtaa 120tattcgggta aatttcggct gctcaatcgg taggaccgct ttaat atg cat ctt tcc 177 Met His Leu Ser 1aac cat gcc tca tca ctt ctg cat tac tat tca cat ctc atc ata att 225Asn His Ala Ser Ser Leu Leu His Tyr Tyr Ser His Leu Ile Ile Ile 5 10 15 20gca tac ttt tct gta ttt gct tca atc gaa ata caa gaa att cca tca 273Ala Tyr Phe Ser Val Phe Ala Ser Ile Glu Ile Gln Glu Ile Pro Ser 25 30 35tat cca gca tgt agc aat ggc gaa tca cct gtc ttt tta ctc caa cac 321Tyr Pro Ala Cys Ser Asn Gly Glu Ser Pro Val Phe Leu Leu Gln His 40 45 50aat gct aca gca ggt aat gtt ctg aag cga gct tca act tca cat ctg 369Asn Ala Thr Ala Gly Asn Val Leu Lys Arg Ala Ser Thr Ser His Leu 55 60 65gtc gac tgc act gac ctt tgt tca gct aac gat gaa tgt ttg gcg ata 417Val Asp Cys Thr Asp Leu Cys Ser Ala Asn Asp Glu Cys Leu Ala Ile 70 75 80acc tat gaa gat aaa gaa tgc aaa atg ttg tca agc att gga gaa tcg 465Thr Tyr Glu Asp Lys Glu Cys Lys Met Leu Ser Ser Ile Gly Glu Ser 85 90 95 100aca gga cat tta aat gat tat gta ttg ctg agt aaa aat tgt gct aaa 513Thr Gly His Leu Asn Asp Tyr Val Leu Leu Ser Lys Asn Cys Ala Lys 105 110 115agt gcg cgg atc tgc tca tcg cca ttt caa ttc gat gta cac aga caa 561Ser Ala Arg Ile Cys Ser Ser Pro Phe Gln Phe Asp Val His Arg Gln 120 125 130aaa att ttg gtt ggg ttt gct cgc gag gtt gtg tca gct gat tca tta 609Lys Ile Leu Val Gly Phe Ala Arg Glu Val Val Ser Ala Asp Ser Leu 135 140 145tcg tta tgt cta tca gct tgc ttg aat gca ttt gat tct ttc ggt ttt 657Ser Leu Cys Leu Ser Ala Cys Leu Asn Ala Phe Asp Ser Phe Gly Phe 150 155 160gaa tgt gag tcg gta atg tac tat cca gtt gat tca gaa tgc atc cta 705Glu Cys Glu Ser Val Met Tyr Tyr Pro Val Asp Ser Glu Cys Ile Leu165 170 175 180aac acc gaa gat cgt ctg gat cga cct gac ttg ttt ggg gat gaa tta 753Asn Thr Glu Asp Arg Leu Asp Arg Pro Asp Leu Phe Gly Asp Glu Leu 185 190 195gat gat aac gtc att tat ttg gat aac aac tgt gct gga tca cag tgt 801Asp Asp Asn Val Ile Tyr Leu Asp Asn Asn Cys Ala Gly Ser Gln Cys 200 205 210tat gct cca tac ata aca caa tac att gcc gtc gca aat cgt cag cta 849Tyr Ala Pro Tyr Ile Thr Gln Tyr Ile Ala Val Ala Asn Arg Gln Leu 215 220 225gct aac gag ttg gac aga caa ctg atc gct gat cgt gaa tca tgc gag 897Ala Asn Glu Leu Asp Arg Gln Leu Ile Ala Asp Arg Glu Ser Cys Glu 230 235 240tcg tta tgt act cag cga ctg tct aca acg aca aac gat ttc aac tgt 945Ser Leu Cys Thr Gln Arg Leu Ser Thr Thr Thr Asn Asp Phe Asn Cys245 250 255 260aaa tca ttt atg cat aat ccg gaa act aac gtt tgc ata ctt tct gat 993Lys Ser Phe Met His Asn Pro Glu Thr Asn Val Cys Ile Leu Ser Asp 265 270 275gaa cgt tct aaa cca ctt ggt cga ggc aat cta gtg aaa gct gac ggt 1041Glu Arg Ser Lys Pro Leu Gly Arg Gly Asn Leu Val Lys Ala Asp Gly 280 285 290ttc aca tat tat gag aag aaa tgt ttt gca tca cca cga aca tgt cgc 1089Phe Thr Tyr Tyr Glu Lys Lys Cys Phe Ala Ser Pro Arg Thr Cys Arg 295 300 305aat gta ccg tcg ttt gag cgc ata cct cag atg ata ctt gtt ggt ttt 1137Asn Val Pro Ser Phe Glu Arg Ile Pro Gln Met Ile Leu Val Gly Phe 310 315 320gct gca ttt gtt atg gaa aat gta cct tca gta acg atg tgc ctc gat 1185Ala Ala Phe Val Met Glu Asn Val Pro Ser Val Thr Met Cys Leu Asp325 330 335 340cag tgc aca aat cct cca ccg gaa act gga gaa aat ttc gaa tgc aaa 1233Gln Cys Thr Asn Pro Pro Pro Glu Thr Gly Glu Asn Phe Glu Cys Lys 345 350 355tct gtg atg tat tat tat aac gaa cag gaa tgt att tta aac gct gaa 1281Ser Val Met Tyr Tyr Tyr Asn Glu Gln Glu Cys Ile Leu Asn Ala Glu 360 365 370aca cga gaa aat aaa tcg gaa ttg ttt ata ccg gag gga gaa gaa ttc 1329Thr Arg Glu Asn Lys Ser Glu Leu Phe Ile Pro Glu Gly Glu Glu Phe 375 380 385caa gtc gat tat ttt gat atc act tgt cat ctg cgc cct gaa aca tgt 1377Gln Val Asp Tyr Phe Asp Ile Thr Cys His Leu Arg Pro Glu Thr Cys 390 395 400cca aat ggc aca aca tta cat act gta cgt acg gtt aat gca gca ctc 1425Pro Asn Gly Thr Thr Leu His Thr Val Arg Thr Val Asn Ala Ala Leu405 410 415 420cct gaa ggc gaa gga tcg atc cat att ttg cag tca gcc ggg aat tcg 1473Pro Glu Gly Glu Gly Ser Ile His Ile Leu Gln Ser Ala Gly Asn Ser 425 430 435gtt gct gat tgc atg aca aaa tgt tac gag atg gct ccc gag aaa tgt 1521Val Ala Asp Cys Met Thr Lys Cys Tyr Glu Met Ala Pro Glu Lys Cys 440 445 450cgc gca ttc aat ttt gat aag cag aca tct gac tgt gac ctg ctg tac 1569Arg Ala Phe Asn Phe Asp Lys Gln Thr Ser Asp Cys Asp Leu Leu Tyr 455 460 465gtt gat ggg aag aca acc tta cga cca gca gtc cac tcg ggc att gat 1617Val Asp Gly Lys Thr Thr Leu Arg Pro Ala Val His Ser Gly Ile Asp 470 475 480ctc tac gac ctt cat tgc cta gag cag aca aaa gtt tgc gct cag aaa 1665Leu Tyr Asp Leu His Cys Leu Glu Gln Thr Lys Val Cys Ala Gln Lys485 490 495 500aac aac gta aca cga ttt tcg aga tat ttg tac agt ata tat gat gca 1713Asn Asn Val Thr Arg Phe Ser Arg Tyr Leu Tyr Ser Ile Tyr Asp Ala 505 510 515gtg cca tcg caa ttc tac gaa gca act gcc ctc aca aat tgt ctt aat 1761Val Pro Ser Gln Phe Tyr Glu Ala Thr Ala Leu Thr Asn Cys Leu Asn 520 525 530ctt tgc gca tat acc gag cgt tgc gaa ggt gta aat tac aac aga agg 1809Leu Cys Ala Tyr Thr Glu Arg Cys Glu Gly Val Asn Tyr Asn Arg Arg 535 540 545aat ggt cgt tgt gaa tta ttt gat aag gtc gaa gga aat gga aag cca 1857Asn Gly Arg Cys Glu Leu Phe Asp Lys Val Glu Gly Asn Gly Lys Pro 550 555 560agt gat ttc acg gat ttt tac aaa aat ctt tgt ctg gtg gaa gaa gta 1905Ser Asp Phe Thr Asp Phe Tyr Lys Asn Leu Cys Leu Val Glu Glu Val565 570 575 580gaa tca gaa tat agc gcc gca gct aat gtt ccc aaa cat ctc ctt ccg 1953Glu Ser Glu Tyr Ser Ala Ala Ala Asn Val Pro Lys His Leu Leu Pro 585 590 595aat gtt tca cat tct gca gtt act cag aaa caa gaa gct aaa tta cac 2001Asn Val Ser His Ser Ala Val Thr Gln Lys Gln Glu Ala Lys Leu His 600 605 610att atc tca gca aaa aca aag cct ttc cta cgc gaa cag gaa gca cag 2049Ile Ile Ser Ala Lys Thr Lys Pro Phe Leu Arg Glu Gln Glu Ala Gln 615 620 625cga cga gct cca gaa aca ata aca gcg aag tcg tct tca gct tcc gga 2097Arg Arg Ala Pro Glu Thr Ile Thr Ala Lys Ser Ser Ser Ala Ser Gly 630 635 640aaa gta agt ggt gaa gca gga tca tca act aca ttc agc att tct tca 2145Lys Val Ser Gly Glu Ala Gly Ser Ser Thr Thr Phe Ser Ile Ser Ser645 650 655 660tcc gga agg ctt cca ggg cca gta gtc caa att gct cca aat gca gtg 2193Ser Gly Arg Leu Pro Gly Pro Val Val Gln Ile Ala Pro Asn Ala Val 665 670 675caa aca gtt tgc aat tat gaa ggc atc aaa gtg cag atg gag aac ccc 2241Gln Thr Val Cys Asn Tyr Glu Gly Ile Lys Val Gln Met Glu Asn Pro 680 685 690aaa gcc ttt tcg gga gtg ata ttt gtt aaa aat agg tat gaa acc tgt 2289Lys Ala Phe Ser Gly Val Ile Phe Val Lys Asn Arg Tyr Glu Thr Cys 695 700 705cga gta gag gtt acg gat agt gaa agt gca cca cta gta att ggt tta 2337Arg Val Glu Val Thr Asp Ser Glu Ser Ala Pro Leu Val Ile Gly Leu 710 715 720cca ccg aat ttt ggt tca aaa atg gta gct gat gaa aag gtt gcc gca 2385Pro Pro Asn Phe Gly Ser Lys Met Val Ala Asp Glu Lys Val Ala Ala725 730 735 740agc gaa gca aat att caa cca gaa ata tcc gga ggc gac aaa ctg gat 2433Ser Glu Ala Asn Ile Gln Pro Glu Ile Ser Gly Gly Asp Lys Leu Asp 745 750 755aaa ccc gct gat gaa ctg cgc ata aga cga caa gct tta gag cta cac 2481Lys Pro Ala Asp Glu Leu Arg Ile Arg Arg Gln Ala Leu Glu Leu His 760 765 770aga gat tgc gga atc cag gat atg aac aat ggt act tat aaa tca acg 2529Arg Asp Cys Gly Ile Gln Asp Met Asn Asn Gly Thr Tyr Lys Ser Thr 775 780 785gtg gtt gta caa aca aat aac ttg ggt ata cct gga ctg gta act tcc 2577Val Val Val Gln Thr Asn Asn Leu Gly Ile Pro Gly Leu Val Thr Ser 790 795 800atg gat cag att ttt gaa gtg agc tgt gat tat agt tca atg ctt ggt 2625Met Asp Gln Ile Phe Glu Val Ser Cys Asp Tyr Ser Ser Met Leu Gly805 810 815 820gga aaa gtt act gct ggt gcc aat ctc aca att gat ggt ccc gaa gca 2673Gly Lys Val Thr Ala Gly Ala Asn Leu Thr Ile Asp Gly Pro Glu Ala 825 830 835tct ctt att caa ccc cga gga aaa atc gaa ctt ggt aac ccg gtg ctt 2721Ser Leu Ile Gln Pro Arg Gly Lys Ile Glu Leu Gly Asn Pro Val Leu 840 845 850atg cag atg ttg agt gga caa gga gaa cct gtc cta caa gca aaa cta 2769Met Gln Met Leu Ser Gly Gln Gly Glu Pro Val Leu Gln Ala Lys Leu 855 860 865ggt gac att ctg cag cta cga tgg gaa atc atg gcg atg 2808Gly Asp Ile Leu Gln Leu Arg Trp Glu Ile Met Ala Met 870 875 880101210PRTMeloidogyne javanica 10Met Val Thr Lys Ile Pro Thr Phe Pro Leu Leu Phe Ile Phe Pro Phe 1 5 10 15Leu Phe Thr Phe Leu Thr Thr Lys Cys Gln Ala Tyr Ser Ile Pro Leu 20 25 30Ile Ser Glu Cys Asn Ser Glu Glu Ala Pro Val Phe Leu Leu Gln Arg 35 40 45Asn Val Ser Ser Ile Ala Gly Thr Glu Pro Leu Arg Thr Val Pro Val 50 55 60Thr Gly Gly Phe Leu Glu Cys Ala Glu Leu Cys Ser Ala Ala Asn Asn65 70 75 80Cys Val Ala Val Lys Phe Ser Ile Glu Lys Gln Cys Gln Leu Leu Gly 85 90 95Lys Thr Thr Met Thr Ala Thr Thr Leu Ser Leu Gln Asp Ile Asn Leu 100 105 110Thr Leu Ala Arg Leu Ala Thr Lys Ser Cys Val Lys Ser Lys Lys Ile 115 120 125Cys Ser Ser Pro Phe His Phe Asp Val His Glu Gln Lys Ile Leu Val 130 135 140Gly Phe Ala Arg Glu Val Val Ser Ala Glu Ser Ile His Gln Cys Leu145 150 155 160Thr Ala Cys Leu Asp Ala Val Asp Thr Phe Gly Phe Glu Cys Glu Ser 165 170 175Val Met Tyr Tyr Pro Leu Asp Ala Glu Cys Ile Leu Asn Thr Glu Asp 180 185 190Arg Leu Asp Arg Pro Asp Leu Phe Val Asp Glu Lys Glu Asp Thr Val 195 200 205Val Tyr Leu Asp Asn Asn Cys Ala Gly Ser Gln Cys His Ala Pro Tyr 210 215 220Val Thr Gln Tyr Val Ala Val Glu Gly Lys Gln Leu Ala Glu Glu Leu225 230 235 240Asp His Asn Phe Glu Gly Met Glu Leu Thr Glu Cys Glu Gln Leu Cys 245 250 255Asn Gln Arg Leu Ser Val Ser Ala Asn Asp Phe Asn Cys Lys Ala Phe 260 265 270Met Tyr Asn Asn Gln Thr Arg Ser Cys Ile Leu Ser Asp Glu Arg Ser 275 280 285Arg Pro Leu Gly Arg Ala Asn Leu Thr Asp Ala Lys Gly Trp Thr Tyr 290 295 300His Glu Lys Lys Cys Phe Ala Ser Pro Arg Thr Cys Arg Asn Val Pro305 310 315 320Ser Phe Thr Arg Val Pro Gln Met Leu Leu Val Gly Phe Ala Ser Phe 325 330 335Val Met Glu Asn Val Pro Ser Val Thr Met Cys Leu Asp Gln Cys Thr 340 345 350Asn Pro Pro Pro Glu Thr Gly Gln Ser Phe Val Cys Lys Ser Val Met 355 360 365Tyr Tyr Tyr Asn Glu Gln Glu Cys Ile Leu Asn Ala Glu Ser Arg His 370 375 380Ser Lys Pro Asp Leu Phe Ile Pro Glu Glu Asp Asp Phe Val Val Asp385 390 395 400Tyr Phe Asp Ile Asn Cys Arg Leu Glu Gln Glu Gln Cys Ile Asp Gly 405 410 415Arg Thr Pro Gln Leu Val Arg Thr Ile Asn Ser Ala Leu Pro Glu Gly 420 425 430Glu Gly Ser Ile His Val Leu Glu Thr Ile Lys Gly Gly Val Gln Gln 435 440 445Cys Ala Lys Lys Cys Ser Glu Arg Ala Pro Asp Lys Cys Arg Ser Phe 450 455 460Asn Phe Asp Lys Gln Ala Gly Asn Cys Asn Leu Leu Tyr Leu Asp Gly465 470 475 480Gln Gly Ser Leu Arg Pro Glu Gln Lys Thr Gln Phe Asp Leu Tyr Asp 485 490 495Val His Cys Leu Ser Gly Thr Ser Gln Leu Leu Gly Glu Asn Ser Lys 500 505 510His Ser Pro Ser Ala Cys Val Asp Pro Glu Gly Ala Ile Phe Ser Arg 515 520 525Phe Leu Tyr Thr Arg Trp Val Ala Asn Ser Pro Asn Arg Glu Ile Ser 530 535 540Ser Leu Pro Leu Ser Lys Cys Leu Asn Leu Cys Ser Val Gly Gly Glu545 550 555 560Gln Cys Glu Gly Val Asn Tyr Asn Arg Arg Asn Gly Ser Cys Gln Leu 565 570 575Phe Thr Ser Leu Leu Leu Asn Ser Ser Pro Asn Ser Gln Gln Asp Lys 580 585 590Asp Glu His Val Asp Phe Tyr Arg Asn Ile Cys Arg Val Lys Glu Ser 595 600 605Lys Ser Asp Ser Gly Ala Ala Asn Val Pro Lys Thr Gln Gln Ala Thr 610 615 620Ala Ala Pro Pro Pro Ser Val Gln Leu Thr Thr Lys Pro Pro Gln Ile625 630 635 640Arg Asp Leu Asn Asn Asn Asn Lys Thr Thr His Lys Glu Pro Asn Ile 645

650 655Lys Leu Pro Pro Gln Ser Ala Lys Pro Ile Asn Gly Lys Thr Gly Lys 660 665 670Glu Gln Leu Pro Val Gly Ser Lys Ser Phe Gly Val Thr Asn Thr Arg 675 680 685Asp Asp Gly Glu Asn Ser Ile Thr Gly Thr Ala Pro Pro Pro Val Asp 690 695 700Gly Lys Leu Ile Ile Lys Pro Ser Pro Gln Val Ser Ile Pro Ser Pro705 710 715 720Val Leu Ile Pro Ala Gln Glu Val His Thr Ile Cys Asn Tyr Glu Gly 725 730 735Ile Ser Val Gln Ile Lys His Ser Ser Pro Phe Ser Gly Val Val Phe 740 745 750Val Arg Asn Lys Tyr Asp Thr Cys Arg Val Lys Leu Lys Glu Arg Thr 755 760 765Ala Leu Phe Trp Phe Trp Gly Phe Gln Gln Ile Leu Glu Met Lys Pro 770 775 780Ile Ala Leu Ile Asn Ser Gln Lys His Gly Lys Gly Asn Lys Thr His785 790 795 800Gly Asp Thr Leu Leu Ser Ile Glu Gly Ser Lys Lys Gln Ile Glu Gly 805 810 815Gly Ser Ser Thr Glu Asp Ile Gln Leu Ile Asn Ser Gln Lys Asp Leu 820 825 830Lys Arg Ser Arg Arg Gln Leu Gln Arg Asp Cys Gly Leu Gln Asp Met 835 840 845Asp Asn Gly Thr Tyr Lys Thr Val Ile Val Val Gln Thr Asn Asn Leu 850 855 860Gly Ile Pro Gly Leu Val Thr Ser Met Asp Gln Leu Tyr Glu Ile Ser865 870 875 880Cys Asn Tyr Ser Ser Met Leu Gly Gly Lys Val Gln Thr Ala Ala Ala 885 890 895Leu Arg Val His Gly Pro Gln Pro Ser Leu Ile Gln Pro Arg Gly Lys 900 905 910Ile Glu Leu Gly Asn Pro Val Leu Met Gln Met Gly Pro Val Arg Ser 915 920 925Glu Arg Gln Ser Gly Glu Gly Pro Leu Ile Gln Ala Lys Leu Gly Asp 930 935 940Ile Leu Glu Leu Lys Trp Glu Ile Met Ala Met Asp Glu Glu Leu Asp945 950 955 960Phe Leu Val Arg Asp Cys Phe Ala Glu Pro Gly Thr Ser Gly Asn Gln 965 970 975Gly Glu Arg Leu Pro Leu Ile Glu Asn Gly Cys Pro Thr Pro Ala Val 980 985 990Ala Gln Lys Leu Ile Pro Asn Pro Ile Lys Ala Ile Asn Ser Ala Val 995 1000 1005Lys Leu Thr Tyr Leu Gln Ala Phe Arg Phe Asp Ser Ser Pro Ala Ile 1010 1015 1020Arg Ile Thr Cys His Leu Glu Leu Cys Lys Glu Asn Cys Lys Ser Val1025 1030 1035 1040Asn Cys Lys Phe Asn Asp Gly Ile Lys Glu Ser Trp Gly Arg Lys Arg 1045 1050 1055Arg Phe Ala Ile Asp Asn Asn Ile Asn Arg Lys Asn Glu Val Lys Glu 1060 1065 1070Phe Glu Thr Arg Arg Phe Val Val Pro Arg Phe Ala Gln Ala Thr Thr 1075 1080 1085Ser Leu Val Ile Val Asp Pro Leu Gln Gln Gln Asn Ser Val Ile Lys 1090 1095 1100Thr Glu Gln Gln Gln Gln Pro Phe Ile Ser His Ser Ser Ile Ser Lys1105 1110 1115 1120Gln Ile Phe Glu Asn Asn Lys Lys Glu Asn Asn Lys Asn Ile Thr Lys 1125 1130 1135Thr Ala Lys Lys Ser Ser Ser Leu Phe Glu Ala Phe Thr Glu Ala Ala 1140 1145 1150Gly Gly Arg Lys Ile Asn Leu Glu Leu Thr Thr Thr Asn Ser Glu Gln 1155 1160 1165Gln Gln Leu Cys Leu His Lys Trp Thr Leu Gly Gly Val Phe Gly Thr 1170 1175 1180Leu Leu Thr Leu Ile Val Val Gln Ser Gly Val Ala Ala Lys His Leu1185 1190 1195 1200Ile Asn Arg Phe Ile Val Gly Lys Arg Ile 1205 121011250PRTHeterodera glycines 11Glu Gln Lys Ile Leu Val Gly Phe Ala Arg Glu Val Val Ser Ala Asp 1 5 10 15Ser Val His Arg Cys Leu Ser Ala Cys Leu Asn Ala Phe Asp Thr Phe 20 25 30Gly Phe Glu Cys Glu Ser Val Met Tyr Tyr Pro Val Asp Ala Glu Cys 35 40 45Ile Leu Asn Thr Glu Asp Arg Leu Asp Arg Pro Asp Leu Phe Val Asp 50 55 60Glu His Glu Asp Thr Val Ile Tyr Leu Asp Asn Asn Cys Ala Gly Cys65 70 75 80Glu Cys His Trp His Phe Asp Asn Phe Lys Thr Ser Gly Ile Leu Asn 85 90 95Asp Gln Gln Phe Ala Ile Ala Ala Gln Cys Tyr Ala Pro Tyr Val Thr 100 105 110Gln Tyr Val Ala Val Glu Gly Arg Gln Leu Ser Asp Glu Leu Asp His 115 120 125Ser Phe Glu Gly Leu Glu Leu Ser Glu Cys Glu Glu Leu Cys Thr Gln 130 135 140Arg Leu Ser Val Thr Ala Asn Asp Phe Asn Cys Lys Ser Phe Met Tyr145 150 155 160Ser Asn Leu Thr Arg Ser Cys Val Leu Ser Asp Glu Arg Ser Arg Pro 165 170 175Leu Gly Arg Ala Asn Leu Ala Glu Val Pro Gly Trp Thr Tyr Phe Glu 180 185 190Ser Arg Gly Val Pro Ser Phe Thr Arg Val Pro Gln Met Leu Leu Val 195 200 205Gly Phe Ala Ser Phe Val Met Glu Asn Val Pro Ser Val Thr Met Cys 210 215 220Leu Asp Gln Cys Thr Ser Pro Pro Pro Glu Thr Gly Gln Asn Phe Val225 230 235 240Cys Lys Ser Val Met Tyr Tyr Tyr Asn Glu 245 25012881PRTBrugia malayi 12Met His Leu Ser Asn His Ala Ser Ser Leu Leu His Tyr Tyr Ser His 1 5 10 15Leu Ile Ile Ile Ala Tyr Phe Ser Val Phe Ala Ser Ile Glu Ile Gln 20 25 30Glu Ile Pro Ser Tyr Pro Ala Cys Ser Asn Gly Glu Ser Pro Val Phe 35 40 45Leu Leu Gln His Asn Ala Thr Ala Gly Asn Val Leu Lys Arg Ala Ser 50 55 60Thr Ser His Leu Val Asp Cys Thr Asp Leu Cys Ser Ala Asn Asp Glu65 70 75 80Cys Leu Ala Ile Thr Tyr Glu Asp Lys Glu Cys Lys Met Leu Ser Ser 85 90 95Ile Gly Glu Ser Thr Gly His Leu Asn Asp Tyr Val Leu Leu Ser Lys 100 105 110Asn Cys Ala Lys Ser Ala Arg Ile Cys Ser Ser Pro Phe Gln Phe Asp 115 120 125Val His Arg Gln Lys Ile Leu Val Gly Phe Ala Arg Glu Val Val Ser 130 135 140Ala Asp Ser Leu Ser Leu Cys Leu Ser Ala Cys Leu Asn Ala Phe Asp145 150 155 160Ser Phe Gly Phe Glu Cys Glu Ser Val Met Tyr Tyr Pro Val Asp Ser 165 170 175Glu Cys Ile Leu Asn Thr Glu Asp Arg Leu Asp Arg Pro Asp Leu Phe 180 185 190Gly Asp Glu Leu Asp Asp Asn Val Ile Tyr Leu Asp Asn Asn Cys Ala 195 200 205Gly Ser Gln Cys Tyr Ala Pro Tyr Ile Thr Gln Tyr Ile Ala Val Ala 210 215 220Asn Arg Gln Leu Ala Asn Glu Leu Asp Arg Gln Leu Ile Ala Asp Arg225 230 235 240Glu Ser Cys Glu Ser Leu Cys Thr Gln Arg Leu Ser Thr Thr Thr Asn 245 250 255Asp Phe Asn Cys Lys Ser Phe Met His Asn Pro Glu Thr Asn Val Cys 260 265 270Ile Leu Ser Asp Glu Arg Ser Lys Pro Leu Gly Arg Gly Asn Leu Val 275 280 285Lys Ala Asp Gly Phe Thr Tyr Tyr Glu Lys Lys Cys Phe Ala Ser Pro 290 295 300Arg Thr Cys Arg Asn Val Pro Ser Phe Glu Arg Ile Pro Gln Met Ile305 310 315 320Leu Val Gly Phe Ala Ala Phe Val Met Glu Asn Val Pro Ser Val Thr 325 330 335Met Cys Leu Asp Gln Cys Thr Asn Pro Pro Pro Glu Thr Gly Glu Asn 340 345 350Phe Glu Cys Lys Ser Val Met Tyr Tyr Tyr Asn Glu Gln Glu Cys Ile 355 360 365Leu Asn Ala Glu Thr Arg Glu Asn Lys Ser Glu Leu Phe Ile Pro Glu 370 375 380Gly Glu Glu Phe Gln Val Asp Tyr Phe Asp Ile Thr Cys His Leu Arg385 390 395 400Pro Glu Thr Cys Pro Asn Gly Thr Thr Leu His Thr Val Arg Thr Val 405 410 415Asn Ala Ala Leu Pro Glu Gly Glu Gly Ser Ile His Ile Leu Gln Ser 420 425 430Ala Gly Asn Ser Val Ala Asp Cys Met Thr Lys Cys Tyr Glu Met Ala 435 440 445Pro Glu Lys Cys Arg Ala Phe Asn Phe Asp Lys Gln Thr Ser Asp Cys 450 455 460Asp Leu Leu Tyr Val Asp Gly Lys Thr Thr Leu Arg Pro Ala Val His465 470 475 480Ser Gly Ile Asp Leu Tyr Asp Leu His Cys Leu Glu Gln Thr Lys Val 485 490 495Cys Ala Gln Lys Asn Asn Val Thr Arg Phe Ser Arg Tyr Leu Tyr Ser 500 505 510Ile Tyr Asp Ala Val Pro Ser Gln Phe Tyr Glu Ala Thr Ala Leu Thr 515 520 525Asn Cys Leu Asn Leu Cys Ala Tyr Thr Glu Arg Cys Glu Gly Val Asn 530 535 540Tyr Asn Arg Arg Asn Gly Arg Cys Glu Leu Phe Asp Lys Val Glu Gly545 550 555 560Asn Gly Lys Pro Ser Asp Phe Thr Asp Phe Tyr Lys Asn Leu Cys Leu 565 570 575Val Glu Glu Val Glu Ser Glu Tyr Ser Ala Ala Ala Asn Val Pro Lys 580 585 590His Leu Leu Pro Asn Val Ser His Ser Ala Val Thr Gln Lys Gln Glu 595 600 605Ala Lys Leu His Ile Ile Ser Ala Lys Thr Lys Pro Phe Leu Arg Glu 610 615 620Gln Glu Ala Gln Arg Arg Ala Pro Glu Thr Ile Thr Ala Lys Ser Ser625 630 635 640Ser Ala Ser Gly Lys Val Ser Gly Glu Ala Gly Ser Ser Thr Thr Phe 645 650 655Ser Ile Ser Ser Ser Gly Arg Leu Pro Gly Pro Val Val Gln Ile Ala 660 665 670Pro Asn Ala Val Gln Thr Val Cys Asn Tyr Glu Gly Ile Lys Val Gln 675 680 685Met Glu Asn Pro Lys Ala Phe Ser Gly Val Ile Phe Val Lys Asn Arg 690 695 700Tyr Glu Thr Cys Arg Val Glu Val Thr Asp Ser Glu Ser Ala Pro Leu705 710 715 720Val Ile Gly Leu Pro Pro Asn Phe Gly Ser Lys Met Val Ala Asp Glu 725 730 735Lys Val Ala Ala Ser Glu Ala Asn Ile Gln Pro Glu Ile Ser Gly Gly 740 745 750Asp Lys Leu Asp Lys Pro Ala Asp Glu Leu Arg Ile Arg Arg Gln Ala 755 760 765Leu Glu Leu His Arg Asp Cys Gly Ile Gln Asp Met Asn Asn Gly Thr 770 775 780Tyr Lys Ser Thr Val Val Val Gln Thr Asn Asn Leu Gly Ile Pro Gly785 790 795 800Leu Val Thr Ser Met Asp Gln Ile Phe Glu Val Ser Cys Asp Tyr Ser 805 810 815Ser Met Leu Gly Gly Lys Val Thr Ala Gly Ala Asn Leu Thr Ile Asp 820 825 830Gly Pro Glu Ala Ser Leu Ile Gln Pro Arg Gly Lys Ile Glu Leu Gly 835 840 845Asn Pro Val Leu Met Gln Met Leu Ser Gly Gln Gly Glu Pro Val Leu 850 855 860Gln Ala Lys Leu Gly Asp Ile Leu Gln Leu Arg Trp Glu Ile Met Ala865 870 875 880Met133633DNAMeloidogyne javanica 13atggttacaa aaatcccaac ttttcccctc ctttttattt tcccattttt atttacattt 60ttaacgacaa aatgtcaggc ttattctata ccattaatat cagaatgtaa ttcggaagaa 120gccccagttt ttcttttgca acggaatgtt tcttctatcg ccggaactga gcctttaaga 180actgttcctg ttacaggggg atttttggaa tgtgcggaac tttgttcagc agcaaataat 240tgtgttgctg ttaaattttc tattgaaaaa caatgccaat tgttggggaa aacaactatg 300acagcaacaa ctttatcttt acaagacatt aatttgacac tagctagatt agctactaaa 360agttgtgtta agagcaaaaa aatctgttct tcccccttcc attttgatgt tcacgaacaa 420aaaatacttg ttggttttgc tagagaagtt gtatcagcag aatctataca tcaatgttta 480actgcttgtt tagatgctgt tgatactttt ggctttgaat gcgagtcagt aatgtattat 540ccattggatg ccgaatgtat tttaaataca gaagacagac ttgaccgtcc agatttgttt 600gttgatgaga aggaagatac tgttgtttat ttggataata attgtgctgg atcccaatgt 660catgcccctt atgtaaccca atatgtagct gttgaaggaa aacaattagc tgaggaattg 720gatcataatt ttgagggaat ggagttgaca gaatgtgaac agctttgtaa tcaaagattg 780agtgtttctg caaatgactt taattgcaaa gcatttatgt acaataacca aacaagatct 840tgtattcttt ctgatgaacg ttcaagacct ttgggtagag ctaatttgac agatgctaaa 900ggatggactt atcacgagaa aaaatgtttt gcctccccac gtacatgccg aaatgttcct 960tcttttaccc gcgtccctca aatgttatta gttggatttg cctcttttgt aatggaaaat 1020gtcccttcag taactatgtg tttggatcaa tgtacaaatc ctcccccaga aactggacaa 1080agttttgttt gtaaatctgt catgtattat tataatgagc aagaatgtat tttaaatgct 1140gaatcacgtc attccaagcc agatttattt attcccgaag aagacgattt tgttgtagat 1200tattttgata taaattgccg tctagaacaa gaacaatgta tcgatggaag aacgccccaa 1260ttagttagaa caattaattc tgcacttcca gaaggggagg ggtctataca tgttttggaa 1320acaattaagg gaggagttca gcaatgtgct aaaaaatgtt ctgaacgcgc cccagacaaa 1380tgtcgctctt tcaattttga taaacaagct ggtaattgta atttacttta tttggatgga 1440caagggtctt tacgaccaga gcaaaagaca caattcgatt tatacgatgt tcattgtttg 1500agtggaacat ctcaactttt aggagaaaat tctaaacatt ctccctctgc ttgtgttgac 1560ccagaagggg ctatttttag tcgtttcctc tacactcgtt gggtagcaaa ttctcccaat 1620cgtgaaattt caagtttacc actttccaaa tgtttaaatc tttgttcggt tggaggagaa 1680caatgtgagg gtgttaatta caatcgccga aatggttctt gtcaattatt tacttccctt 1740ctattaaact cttctccaaa ttctcaacaa gacaaagacg aacatgttga tttttacaga 1800aatatttgta gagttaagga atcgaaaagt gatagtgggg ctgctaatgt acccaaaaca 1860caacaagcaa cggctgcacc tcccccttct gttcaattaa ctactaaacc tccacaaatt 1920cgtgatttaa acaacaacaa taaaacaaca cacaaagaac caaatattaa acttccacca 1980caatcagcaa aacctataaa tggaaaaact ggaaaggaac aacttcctgt agggtcaaaa 2040tcttttgggg ttactaatac gcgtgatgat ggggagaatt caataactgg aactgctcct 2100cctcctgtag atggcaaatt aattattaaa ccttcaccac aagtttctat tccctcccct 2160gtacttattc cggcacaaga agtacatact atttgtaatt atgaaggaat tagtgttcaa 2220attaaacatt cttctccatt ctctggcgtt gtttttgttc gaaataaata tgatacttgc 2280cgtgtgaagt tgaaggaaag gacagcgttg ttttggtttt ggggcttcca gcaaattttg 2340gaaatgaagc caattgcttt aattaattca caaaaacatg gaaaagggaa taaaacacac 2400ggagatactt tactttctat tgaaggttcc aaaaaacaaa ttgaaggggg ttcttcaact 2460gaagatattc aattaataaa ttctcaaaaa gaccttaaac gttcaagaag acaattacaa 2520agagattgtg gattacaaga tatggacaat ggaacttaca aaactgttat tgttgtccaa 2580acaaataatt tgggaattcc gggacttgtt acttctatgg accaacttta tgagatttcc 2640tgtaactatt caagtatgtt gggaggcaaa gtccaaacag cagctgcatt acgtgttcac 2700ggtccccaac cttcactaat ccagcctcgc ggcaaaatag aattgggaaa tcctgttttg 2760atgcaaatgg ggcctgtacg tagtgaaagg caaagtgggg aagggccttt aattcaagct 2820aaattggggg atattcttga attaaaatgg gaaattatgg caatggatga agaattggac 2880tttttagttc gtgattgttt tgcagagccg ggaacttctg gaaatcaagg ggaaagactt 2940cctttaattg agaatggttg tccaacacca gcagtagcac aaaaattaat tccaaatcca 3000ataaaagcaa ttaattctgc agttaaatta acttatttac aagcattcag atttgacagt 3060tctccagcta ttagaataac ttgtcattta gaattatgta aagaaaattg taaatcggtt 3120aattgtaaat ttaatgatgg aattaaagaa tcgtggggca gaaaacgccg ttttgctatt 3180gacaataaca ttaataggaa aaatgaagtt aaagaattcg aaactcgccg ttttgtcgtt 3240ccccgttttg cccaagcaac aacttcttta gttattgtag accctttaca acaacaaaat 3300tctgttataa aaacagaaca acaacaacaa ccatttattt cacattcctc aatatctaaa 3360caaatatttg aaaataataa aaaagaaaat aataaaaata taacaaaaac agctaaaaaa 3420tcctcttctc tttttgaagc ttttactgag gctgctggtg gaaggaaaat taatttagaa 3480ttaacaacaa caaattcaga acaacaacaa ctttgtttac ataaatggac acttgggggt 3540gtttttggaa ctcttttaac attaattgtt gttcaaagcg gggttgctgc taaacattta 3600attaatcgat ttattgttgg aaaaagaatt taa 363314750DNAHeterodera glycines 14gagcagaaga ttttggtggg tttcgcgcgg gaggtggtct ccgccgactc agtccaccgc 60tgtctgtccg cttgtctgaa tgcgttcgat acgttcggct tcgaatgcga gtcggtcatg 120tattaccctg tggacgcgga atgcattttg aacacggagg accgattgga tcggcctgac 180cttttcgtgg acgagcacga ggacacggtc atctacttgg acaacaattg cgccggatgt 240gagtgccatt ggcattttga caatttcaaa acaagcggca ttttgaacga ccaacaattc 300gcaattgcag cacaatgtta cgcaccgtac gtaacgcaat acgtggcggt ggaaggacgc 360caattgtcgg acgaattgga ccacagtttt gaagggttgg agctgagcga atgtgaagag 420ttgtgcacgc aacggttaag tgttacggca aacgacttca actgcaaatc gttcatgtac 480agtaacttga cgcgcagttg cgttttgtcg gacgaacgct cgcgcccttt gggccgtgcc 540aatttggccg aagtgccggg atggacttat ttcgagagcc gcggcgttcc gtcgtttacg 600cgagtgccgc aaatgctttt ggtgggcttt gcctcttttg tgatggaaaa tgtgccgtca 660gtgacaatgt gtttggacca atgcacaagc cctcctcctg agacgggaca aaactttgtg 720tgtaaatcgg tgatgtacta ctacaacgag 750152643DNABrugia malayi 15atgcatcttt ccaaccatgc ctcatcactt ctgcattact attcacatct catcataatt 60gcatactttt ctgtatttgc ttcaatcgaa atacaagaaa ttccatcata tccagcatgt 120agcaatggcg aatcacctgt ctttttactc caacacaatg ctacagcagg taatgttctg 180aagcgagctt caacttcaca tctggtcgac tgcactgacc

tttgttcagc taacgatgaa 240tgtttggcga taacctatga agataaagaa tgcaaaatgt tgtcaagcat tggagaatcg 300acaggacatt taaatgatta tgtattgctg agtaaaaatt gtgctaaaag tgcgcggatc 360tgctcatcgc catttcaatt cgatgtacac agacaaaaaa ttttggttgg gtttgctcgc 420gaggttgtgt cagctgattc attatcgtta tgtctatcag cttgcttgaa tgcatttgat 480tctttcggtt ttgaatgtga gtcggtaatg tactatccag ttgattcaga atgcatccta 540aacaccgaag atcgtctgga tcgacctgac ttgtttgggg atgaattaga tgataacgtc 600atttatttgg ataacaactg tgctggatca cagtgttatg ctccatacat aacacaatac 660attgccgtcg caaatcgtca gctagctaac gagttggaca gacaactgat cgctgatcgt 720gaatcatgcg agtcgttatg tactcagcga ctgtctacaa cgacaaacga tttcaactgt 780aaatcattta tgcataatcc ggaaactaac gtttgcatac tttctgatga acgttctaaa 840ccacttggtc gaggcaatct agtgaaagct gacggtttca catattatga gaagaaatgt 900tttgcatcac cacgaacatg tcgcaatgta ccgtcgtttg agcgcatacc tcagatgata 960cttgttggtt ttgctgcatt tgttatggaa aatgtacctt cagtaacgat gtgcctcgat 1020cagtgcacaa atcctccacc ggaaactgga gaaaatttcg aatgcaaatc tgtgatgtat 1080tattataacg aacaggaatg tattttaaac gctgaaacac gagaaaataa atcggaattg 1140tttataccgg agggagaaga attccaagtc gattattttg atatcacttg tcatctgcgc 1200cctgaaacat gtccaaatgg cacaacatta catactgtac gtacggttaa tgcagcactc 1260cctgaaggcg aaggatcgat ccatattttg cagtcagccg ggaattcggt tgctgattgc 1320atgacaaaat gttacgagat ggctcccgag aaatgtcgcg cattcaattt tgataagcag 1380acatctgact gtgacctgct gtacgttgat gggaagacaa ccttacgacc agcagtccac 1440tcgggcattg atctctacga ccttcattgc ctagagcaga caaaagtttg cgctcagaaa 1500aacaacgtaa cacgattttc gagatatttg tacagtatat atgatgcagt gccatcgcaa 1560ttctacgaag caactgccct cacaaattgt cttaatcttt gcgcatatac cgagcgttgc 1620gaaggtgtaa attacaacag aaggaatggt cgttgtgaat tatttgataa ggtcgaagga 1680aatggaaagc caagtgattt cacggatttt tacaaaaatc tttgtctggt ggaagaagta 1740gaatcagaat atagcgccgc agctaatgtt cccaaacatc tccttccgaa tgtttcacat 1800tctgcagtta ctcagaaaca agaagctaaa ttacacatta tctcagcaaa aacaaagcct 1860ttcctacgcg aacaggaagc acagcgacga gctccagaaa caataacagc gaagtcgtct 1920tcagcttccg gaaaagtaag tggtgaagca ggatcatcaa ctacattcag catttcttca 1980tccggaaggc ttccagggcc agtagtccaa attgctccaa atgcagtgca aacagtttgc 2040aattatgaag gcatcaaagt gcagatggag aaccccaaag ccttttcggg agtgatattt 2100gttaaaaata ggtatgaaac ctgtcgagta gaggttacgg atagtgaaag tgcaccacta 2160gtaattggtt taccaccgaa ttttggttca aaaatggtag ctgatgaaaa ggttgccgca 2220agcgaagcaa atattcaacc agaaatatcc ggaggcgaca aactggataa acccgctgat 2280gaactgcgca taagacgaca agctttagag ctacacagag attgcggaat ccaggatatg 2340aacaatggta cttataaatc aacggtggtt gtacaaacaa ataacttggg tatacctgga 2400ctggtaactt ccatggatca gatttttgaa gtgagctgtg attatagttc aatgcttggt 2460ggaaaagtta ctgctggtgc caatctcaca attgatggtc ccgaagcatc tcttattcaa 2520ccccgaggaa aaatcgaact tggtaacccg gtgcttatgc agatgttgag tggacaagga 2580gaacctgtcc tacaagcaaa actaggtgac attctgcagc tacgatggga aatcatggcg 2640atg 2643161065PRTCaenorhabditis elegans 16Met Lys Val Phe Ala Val Leu Ala Leu Val Val Ala Ser Val Leu Ala 1 5 10 15Asp Thr Leu Pro Ser Val Thr Leu Cys Pro Pro Glu Thr Gln Thr Ile 20 25 30Phe Val Leu Gln His Asn Thr Thr Val Gly Ala Arg Ile Arg Thr Ile 35 40 45Pro Thr Ser Asn Leu Ala Glu Cys Ser Asp His Cys Ser Ala Ser Leu 50 55 60Asp Cys Gln Gly Val Glu Phe Lys Asp Gly Ser Cys Ala Val Phe Arg65 70 75 80Ala Gly Ser Glu Lys Ala Thr Ala Gly Ser Gln Leu Leu Thr Lys Thr 85 90 95Cys Val Lys Ser Asp Arg Val Cys Gln Ser Pro Phe Gln Phe Asp Leu 100 105 110Phe Glu Gln Arg Ile Leu Val Gly Phe Ala Arg Glu Val Val Pro Ala 115 120 125Ala Asn Ile Gln Ile Cys Met Ala Ala Cys Leu Asn Ala Phe Asp Thr 130 135 140Phe Gly Phe Glu Cys Glu Ser Ala Met Phe Tyr Pro Val Asp Gln Glu145 150 155 160Cys Ile Leu Asn Thr Glu Asp Arg Leu Asp Arg Pro Ser Leu Phe Val 165 170 175Glu Glu Ser Asp Asp Thr Val Ile Tyr Met Asp Asn Asn Cys Ala Gly 180 185 190Phe Pro Leu Val Phe Lys Asn Tyr Asn Tyr Gln Lys Thr Thr Phe Ser 195 200 205Lys Ser Gln Cys Tyr Pro Pro Tyr Ile Thr Gln Tyr Ile Ala Val Glu 210 215 220Gly Lys Gln Leu Lys Asn Glu Leu Asp Arg Ile Ile Asn Val Asp Leu225 230 235 240Asp Ser Cys Gln Ala Leu Cys Thr Gln Arg Leu Ser Ile Ser Ser Asn 245 250 255Asp Phe Asn Cys Lys Ser Phe Met Tyr Asn Asn Lys Thr Arg Thr Cys 260 265 270Ile Leu Ala Asp Glu Arg Ser Lys Pro Leu Gly Arg Ala Asp Leu Ile 275 280 285Ala Thr Glu Gly Phe Thr Tyr Phe Glu Lys Lys Cys Phe Ala Ser Pro 290 295 300Asn Thr Cys Arg Asn Val Pro Ser Phe Lys Arg Val Pro Gln Met Ile305 310 315 320Leu Val Gly Phe Ala Ala Phe Val Met Glu Asn Val Pro Ser Val Thr 325 330 335Met Cys Leu Asp Gln Cys Thr Asn Pro Pro Pro Glu Thr Gly Asp Gly 340 345 350Phe Val Cys Lys Ser Val Met Tyr Tyr Tyr Asn Glu Gln Glu Cys Ile 355 360 365Leu Asn Ser Glu Thr Arg Glu Ser Lys Pro Glu Leu Phe Ile Pro Glu 370 375 380Gly Glu Glu Phe Leu Val Asp Tyr Phe Asp Ile Thr Cys His Leu Lys385 390 395 400Gln Glu Lys Cys Pro Thr Gly Gln His Leu Lys Ala Ile Arg Thr Ile 405 410 415Asn Ala Ala Leu Pro Glu Gly Glu Ser Glu Leu His Val Leu Lys Ala 420 425 430Ser Ala Ala Lys Gly Ile Lys Glu Cys Val Ala Lys Cys Phe Gly Leu 435 440 445Ala Pro Glu Lys Cys Arg Ser Phe Asn Tyr Asp Lys Lys Thr Lys Ser 450 455 460Cys Asp Leu Leu Tyr Leu Asp Gly His Asn Thr Leu Gln Pro Gln Val465 470 475 480Arg Gln Gly Val Asp Leu Tyr Asp Leu His Cys Leu Ala Val Glu Asn 485 490 495Asp Cys Ser Ala Asn Lys Asp Asp Ala Leu Phe Ser Arg Tyr Leu His 500 505 510Thr Lys Gln Arg Gly Ile Pro Ala Lys Val Tyr Lys Val Val Ser Leu 515 520 525Asn Ser Cys Leu Glu Val Cys Ala Gly Asn Pro Thr Cys Ala Gly Ala 530 535 540Asn Tyr Asn Arg Arg Leu Gly Asp Cys Thr Leu Phe Asp Ala Ile Asp545 550 555 560Asp Asp Ala Glu Ile Asn Glu His Thr Asp Phe Tyr Lys Asn Leu Cys 565 570 575Val Thr Lys Glu Ile Asp Thr Gly Ala Ser Ala Ala Ala Asn Val Pro 580 585 590Glu Thr Lys His Arg Val Ser Gly Thr Val Val Glu Gly Lys Asp Ser 595 600 605Lys Ser Gln Leu Leu Ala Thr Lys Lys Val Lys Lys Pro Thr Ile Lys 610 615 620Asn Thr Glu His Arg Arg Ala Pro Glu Ser Thr Val Pro Ile Gly Pro625 630 635 640Pro Val Glu Val Lys Ala Glu Ala Ile Gln Thr Ile Cys Asn Tyr Glu 645 650 655Gly Ile Lys Val Gln Ile Asn Asn Gly Glu Pro Phe Ser Gly Val Ile 660 665 670Phe Val Lys Asn Lys Phe Asp Thr Cys Arg Val Glu Val Ala Asn Ser 675 680 685Asn Ala Ala Thr Leu Val Leu Gly Leu Pro Lys Asp Phe Gly Met Arg 690 695 700Pro Ile Ser Leu Asp Asn Ile Asp Asp Asn Glu Thr Gly Lys Asn Lys705 710 715 720Thr Lys Lys Gly Glu Glu Thr Pro Leu Lys Asp Glu Ile Glu Glu Phe 725 730 735Arg Gln Lys Arg Gln Ala Ala Glu Phe Arg Asp Cys Gly Leu Val Asp 740 745 750Leu Leu Asn Gly Thr Tyr Lys Ser Thr Val Val Ile Gln Thr Asn Asn 755 760 765Leu Gly Ile Pro Gly Leu Val Thr Ser Met Asp Gln Leu Tyr Glu Val 770 775 780Ser Cys Asp Tyr Ser Ser Met Leu Gly Gly Arg Val Gln Ala Gly Tyr785 790 795 800Asn Met Thr Val Thr Gly Pro Glu Ala Asn Leu Ile Gln Pro Arg Gly 805 810 815Lys Ile Glu Leu Gly Asn Pro Val Leu Met Gln Leu Leu Asn Gly Asp 820 825 830Gly Thr Glu Gln Pro Leu Val Gln Ala Lys Leu Gly Asp Ile Leu Glu 835 840 845Leu Arg Trp Glu Ile Met Ala Met Asp Asp Glu Leu Asp Phe Phe Val 850 855 860Lys Asn Cys His Ala Glu Pro Gly Val Ala Gly Gly Lys Ala Gly Ala865 870 875 880Gly Glu Lys Leu Arg Leu Ile Asp Gly Gly Cys Pro Thr Pro Ala Val 885 890 895Ala Gln Lys Leu Ile Pro Gly Ala Ile Glu Ile Lys Ser Ser Ala Val 900 905 910Lys Thr Thr Lys Met Gln Ala Phe Arg Phe Asp Ser Ser Ala Ser Ile 915 920 925Arg Val Thr Cys Glu Val Glu Ile Cys Lys Gly Asp Cys Glu Pro Val 930 935 940Glu Cys Ala Leu Thr Gly Gly Val Lys Lys Ser Phe Gly Arg Lys Lys945 950 955 960Arg Glu Val Ser Asn Asn Ile Glu Glu Phe Glu Thr Asn Arg Tyr Leu 965 970 975Ile Pro Arg Arg Ser His Ala Thr Thr Ser Ile Val Ile Ile Asp Pro 980 985 990Leu Gln Gln Val Asn Glu Pro Val Ala Met Ser Arg Ala Ser Thr Leu 995 1000 1005Asp Leu Leu Arg Glu Asp Ala His Glu Val Gln Met Ile Glu Glu Gly 1010 1015 1020Ser Ile Cys Leu Asn Ser Val Thr Val Phe Ala Ile Phe Gly Thr Leu1025 1030 1035 1040Ala Val Leu Ile Leu Gly Gln Thr Val Val Ile Ala His Tyr Ala Val 1045 1050 1055Arg Arg Phe Ser Ser Glu Lys Thr Ala 1060 1065171069PRTCaenorhabditis elegans 17Met Lys Val Phe Ala Val Leu Ala Leu Val Val Ala Ser Val Leu Ala 1 5 10 15Asp Thr Leu Pro Ser Val Thr Leu Cys Pro Pro Glu Thr Gln Thr Ile 20 25 30Phe Val Leu Gln His Asn Thr Thr Val Gly Ala Arg Ile Arg Thr Ile 35 40 45Pro Thr Ser Asn Leu Ala Glu Cys Ser Asp His Cys Ser Ala Ser Leu 50 55 60Asp Cys Gln Gly Val Glu Phe Lys Asp Gly Ser Cys Ala Val Phe Arg65 70 75 80Ala Gly Ser Glu Lys Ala Thr Ala Gly Ser Gln Leu Leu Thr Lys Thr 85 90 95Cys Val Lys Ser Asp Arg Val Cys Gln Ser Pro Phe Gln Phe Asp Leu 100 105 110Phe Glu Gln Arg Ile Leu Val Gly Phe Ala Arg Glu Val Val Pro Ala 115 120 125Ala Asn Ile Gln Ile Cys Met Ala Ala Cys Leu Asn Ala Phe Asp Thr 130 135 140Phe Gly Phe Glu Cys Glu Ser Ala Met Phe Tyr Pro Val Asp Gln Glu145 150 155 160Cys Ile Leu Asn Thr Glu Asp Arg Leu Asp Arg Pro Ser Leu Phe Val 165 170 175Glu Glu Ser Asp Asp Thr Val Ile Tyr Met Asp Asn Asn Cys Ala Gly 180 185 190Phe Pro Leu Val Phe Lys Asn Tyr Asn Tyr Gln Lys Thr Thr Phe Ser 195 200 205Lys Ser Gln Cys Tyr Pro Pro Tyr Ile Thr Gln Tyr Ile Ala Val Glu 210 215 220Gly Lys Gln Leu Lys Asn Glu Leu Asp Arg Ile Ile Asn Val Asp Leu225 230 235 240Asp Ser Cys Gln Ala Leu Cys Thr Gln Arg Leu Ser Ile Ser Ser Asn 245 250 255Asp Phe Asn Cys Lys Ser Phe Met Tyr Asn Asn Lys Thr Arg Thr Cys 260 265 270Ile Leu Ala Asp Glu Arg Ser Lys Pro Leu Gly Arg Ala Asp Leu Ile 275 280 285Ala Thr Glu Gly Phe Thr Tyr Phe Glu Lys Lys Cys Phe Ala Ser Pro 290 295 300Asn Thr Cys Arg Asn Val Pro Ser Phe Lys Arg Val Pro Gln Met Ile305 310 315 320Leu Val Gly Phe Ala Ala Phe Val Met Glu Asn Val Pro Ser Val Thr 325 330 335Met Cys Leu Asp Gln Cys Thr Asn Pro Pro Pro Glu Thr Gly Asp Gly 340 345 350Phe Val Cys Lys Ser Val Met Tyr Tyr Tyr Asn Glu Gln Glu Cys Ile 355 360 365Leu Asn Ser Glu Thr Arg Glu Ser Lys Pro Glu Leu Phe Ile Pro Glu 370 375 380Gly Glu Glu Phe Leu Val Asp Tyr Phe Asp Ile Thr Cys His Leu Lys385 390 395 400Gln Glu Lys Cys Pro Thr Gly Gln His Leu Lys Ala Ile Arg Thr Ile 405 410 415Asn Ala Ala Leu Pro Glu Gly Glu Ser Glu Leu His Val Leu Lys Ala 420 425 430Ser Ala Ala Lys Gly Ile Lys Glu Cys Val Ala Lys Cys Phe Gly Leu 435 440 445Ala Pro Glu Lys Cys Arg Ser Phe Asn Tyr Asp Lys Lys Thr Lys Ser 450 455 460Cys Asp Leu Leu Tyr Leu Asp Gly His Asn Thr Leu Gln Pro Gln Val465 470 475 480Arg Gln Gly Val Asp Leu Tyr Asp Leu His Cys Leu Ala Ala Met Pro 485 490 495Leu Val Glu Asn Asp Cys Ser Ala Asn Lys Asp Asp Ala Leu Phe Ser 500 505 510Arg Tyr Leu His Thr Lys Gln Arg Gly Ile Pro Ala Lys Val Tyr Lys 515 520 525Val Val Ser Leu Asn Ser Cys Leu Glu Val Cys Ala Gly Asn Pro Thr 530 535 540Cys Ala Gly Ala Asn Tyr Asn Arg Arg Leu Gly Asp Cys Thr Leu Phe545 550 555 560Asp Ala Ile Asp Asp Asp Ala Glu Ile Asn Glu His Thr Asp Phe Tyr 565 570 575Lys Asn Leu Cys Val Thr Lys Glu Ile Asp Thr Gly Ala Ser Ala Ala 580 585 590Ala Asn Val Pro Glu Thr Lys His Arg Val Ser Gly Thr Val Val Glu 595 600 605Gly Lys Asp Ser Lys Ser Gln Leu Leu Ala Thr Lys Lys Val Lys Lys 610 615 620Pro Thr Ile Lys Asn Thr Glu His Arg Arg Ala Pro Glu Ser Thr Val625 630 635 640Pro Ile Gly Pro Pro Val Glu Val Lys Ala Glu Ala Ile Gln Thr Ile 645 650 655Cys Asn Tyr Glu Gly Ile Lys Val Gln Ile Asn Asn Gly Glu Pro Phe 660 665 670Ser Gly Val Ile Phe Val Lys Asn Lys Phe Asp Thr Cys Arg Val Glu 675 680 685Val Ala Asn Ser Asn Ala Ala Thr Leu Val Leu Gly Leu Pro Lys Asp 690 695 700Phe Gly Met Arg Pro Ile Ser Leu Asp Asn Ile Asp Asp Asn Glu Thr705 710 715 720Gly Lys Asn Lys Thr Lys Lys Gly Glu Glu Thr Pro Leu Lys Asp Glu 725 730 735Ile Glu Glu Phe Arg Gln Lys Arg Gln Ala Ala Glu Phe Arg Asp Cys 740 745 750Gly Leu Val Asp Leu Leu Asn Gly Thr Tyr Lys Ser Thr Val Val Ile 755 760 765Gln Thr Asn Asn Leu Gly Ile Pro Gly Leu Val Thr Ser Met Asp Gln 770 775 780Leu Tyr Glu Val Ser Cys Asp Tyr Ser Ser Met Leu Gly Gly Arg Val785 790 795 800Gln Ala Gly Tyr Asn Met Thr Val Thr Gly Pro Glu Ala Asn Leu Ile 805 810 815Gln Pro Arg Gly Lys Ile Glu Leu Gly Asn Pro Val Leu Met Gln Leu 820 825 830Leu Asn Gly Asp Gly Thr Glu Gln Pro Leu Val Gln Ala Lys Leu Gly 835 840 845Asp Ile Leu Glu Leu Arg Trp Glu Ile Met Ala Met Asp Asp Glu Leu 850 855 860Asp Phe Phe Val Lys Asn Cys His Ala Glu Pro Gly Val Ala Gly Gly865 870 875 880Lys Ala Gly Ala Gly Glu Lys Leu Arg Leu Ile Asp Gly Gly Cys Pro 885 890 895Thr Pro Ala Val Ala Gln Lys Leu Ile Pro Gly Ala Ile Glu Ile Lys 900 905 910Ser Ser Ala Val Lys Thr Thr Lys Met Gln Ala Phe Arg Phe Asp Ser 915 920 925Ser Ala Ser Ile Arg Val Thr Cys Glu Val Glu Ile Cys Lys Gly Asp 930 935 940Cys Glu Pro Val Glu Cys Ala Leu Thr Gly Gly Val Lys Lys Ser Phe945 950 955 960Gly Arg Lys Lys Arg Glu Val Ser Asn Asn Ile Glu Glu Phe Glu Thr 965 970 975Asn Arg Tyr Leu Ile Pro Arg Arg Ser His Ala Thr Thr Ser Ile Val 980 985

990Ile Ile Asp Pro Leu Gln Gln Val Asn Glu Pro Val Ala Met Ser Arg 995 1000 1005Ala Ser Thr Leu Asp Leu Leu Arg Glu Asp Ala His Glu Val Gln Met 1010 1015 1020Ile Glu Glu Gly Ser Ile Cys Leu Asn Ser Val Thr Val Phe Ala Ile1025 1030 1035 1040Phe Gly Thr Leu Ala Val Leu Ile Leu Gly Gln Thr Val Val Ile Ala 1045 1050 1055His Tyr Ala Val Arg Arg Phe Ser Ser Glu Lys Thr Ala 1060 106518741PRTCaenorhabditis elegans 18Met Trp Gly Val Ile Phe Leu Leu Leu Ser Ile Val Pro Ala Ala Gln 1 5 10 15Ser Val Phe Glu Cys Ser Ser His Glu Thr Thr Ala Phe Val Arg Ile 20 25 30Pro Arg Ala Arg Leu Asp Gly Thr Pro Val Val Ile Ser Thr Ala Gly 35 40 45His Asp Leu Thr Cys Ala Gln Tyr Cys Arg Asn Asn Ile Glu Pro Thr 50 55 60Thr Gly Ala Gln Arg Val Cys Ala Ser Phe Asn Phe Asp Gly Arg Glu65 70 75 80Thr Cys Tyr Phe Phe Asp Asp Ala Ala Thr Pro Ala Gly Thr Ser Gln 85 90 95Leu Thr Ala Asn Pro Ser Ala Asn Asn Phe Tyr Tyr Glu Lys Thr Cys 100 105 110Ile Pro Asn Val Ser Ala His Glu Ala Cys Thr Tyr Arg Ser Phe Ser 115 120 125Phe Glu Arg Ala Arg Asn Thr Gln Leu Glu Gly Phe Val Lys Lys Ser 130 135 140Val Thr Val Glu Asn Arg Glu His Cys Leu Ser Ala Cys Leu Lys Glu145 150 155 160Lys Glu Phe Val Cys Lys Ser Val Asn Phe His Tyr Asp Thr Ser Leu 165 170 175Cys Glu Leu Ser Val Glu Asp Lys Arg Ser Lys Pro Thr His Val Arg 180 185 190Met Ser Glu Lys Ile Asp Tyr Tyr Asp Asn Asn Cys Leu Ser Arg Gln 195 200 205Asn Arg Cys Gly Pro Ser Gly Gly Asn Leu Val Phe Val Lys Thr Thr 210 215 220Asn Phe Glu Ile Arg Tyr Tyr Asp His Thr Gln Ser Val Glu Ala Gln225 230 235 240Glu Ser Tyr Cys Leu Gln Lys Cys Leu Asp Ser Leu Asn Thr Phe Cys 245 250 255Arg Ser Val Glu Phe Asn Pro Lys Glu Lys Asn Cys Ile Val Ser Asp 260 265 270Glu Asp Thr Phe Ser Arg Ala Asp Gln Gln Gly Gln Val Val Gly Lys 275 280 285Asp Tyr Tyr Glu Pro Ile Cys Val Ala Ala Asp Leu Ser Ser Ser Thr 290 295 300Cys Arg Gln Gln Ala Ala Phe Glu Arg Phe Ile Gly Ser Ser Ile Glu305 310 315 320Gly Glu Val Val Ala Ser Ala Gln Gly Val Thr Ile Ser Asp Cys Ile 325 330 335Ser Leu Cys Phe Gln Asn Leu Asn Cys Lys Ser Ile Asn Tyr Asp Arg 340 345 350Thr Ala Ser Ser Cys Phe Ile Tyr Ala Val Gly Arg Gln Asp Ala Asn 355 360 365Ile Lys Ala Asn Pro Ser Met Asp Tyr Tyr Glu Phe Asn Cys Glu Ser 370 375 380Gln Phe Gly Gly Met Ala Leu Cys Thr Asn Glu Gly Ile Arg Phe Ile385 390 395 400Val Asn Thr Lys Glu Pro Tyr Thr Gly Ala Ile Tyr Ala Ala Glu Arg 405 410 415Phe Ser Thr Cys Ser Gln Val Val Glu Asn Ala Lys Gln Ile Ser Ile 420 425 430Thr Phe Pro Pro Pro Thr Val Ser Ser Asp Cys Gly Thr Val Ile Arg 435 440 445Asp Gly Lys Met Glu Ala Leu Val Val Val Ser Leu Asp Gly Val Leu 450 455 460Pro His Gln Val Thr Thr Glu Trp Asp Arg Phe Tyr Arg Val Ser Cys465 470 475 480Asp Val Ser Met Asp Lys Met Val Lys Glu Gly Ser Val Val Val Thr 485 490 495Thr Ile Tyr Glu Ala Ser Ser Gln Asn Thr Thr Val Leu Asp Val Ala 500 505 510Thr Pro Pro Pro Val Ser Ala Glu Leu Gln Ile Leu Asn Gln Leu Glu 515 520 525Glu Pro Leu His Lys Ala Ser Ile Gly Asp Pro Leu Leu Leu Val Ile 530 535 540Thr Ser Glu Gln Ala Gly Pro His Asn Met Met Val Thr Glu Cys Thr545 550 555 560Ala Thr Arg Val Gly Gly Phe Gly Asp Thr Val Pro Phe Thr Leu Ile 565 570 575Glu Asn Gly Cys Pro Arg Tyr Pro Ala Leu Val Gly Pro Val Glu Gln 580 585 590Asp Phe Asp Lys Asn Arg Leu Lys Ser Asp Leu Arg Ala Phe Arg Leu 595 600 605Asp Gly Ser Tyr Asp Val Gln Ile Val Cys Ser Ile Met Phe Cys Ala 610 615 620Gly Pro Asn Gly Cys Pro Val Ser Asn Cys Leu Asp Ser Gly Thr Asn625 630 635 640Glu Leu Phe Met Ser His Gly Arg Lys Lys Arg Ser Ala Asp Leu Glu 645 650 655Ala Gly Glu Thr Glu Glu Lys Leu Ser Ala Ile Ile Arg Val Phe Ala 660 665 670Lys Gly Glu Asp Glu Glu Glu Met Glu Met Ala Asn Asn Thr Met Met 675 680 685Thr Ser Met Ser Asp Ser Thr Glu Leu Leu Cys Ile Ala Glu Pro Phe 690 695 700Phe Val Ser Ser Val Val Ser Leu Ser Val Leu Cys Phe Ala Leu Ser705 710 715 720Ala Ile Ile Ala Ile Trp Gly Cys His Ser Leu His Ser Lys Pro Val 725 730 735Lys Gln Val Ala Ala 7401920DNAArtificial SequencePrimer 19ggccacgcgt cgactagtac 202022DNAArtificial SequencePrimer 20gggtttaatt acccaagttt ga 222137DNAArtificial SequencePrimer 21ggccacgcgt cgactagtac tttttttttt ttttttt 372244RNAArtificial SequencePrimer 22cgacuggagc acgaggacac ugacauggac ugaaggagua gaaa 442320DNAArtificial SequencePrimer 23ccgtccaaga ggctttgaac 202418DNAArtificial SequencePrimer 24gatctggtcg atcaagtc 182523DNAArtificial SequencePrimer 25cgactggagc acgaggacac tga 232626DNAArtificial SequencePrimer 26ggacactgac atggactgaa ggagta 262720DNAArtificial SequencePrimer 27tcagtgacgt tatgtcctcc 202820DNAArtificial SequencePrimer 28tgacagatgg aacattctcc 202920DNAArtificial SequencePrimer 29acttcaggac acgacttgac 203020DNAArtificial SequencePrimer 30caatcagaga tggtaactcc 203126DNAArtificial SequencePrimer 31cgttgtagac agtcgctgag tacata 263222DNAArtificial SequencePrimer 32ccaactcgtt agctagctga cg 223319DNAArtificial SequencePrimer 33cgaacatgtc gcaatgtac 193418DNAArtificial SequencePrimer 34catngccatd atytccca 183518DNAArtificial SequencePrimer 35ttyggnttyg artgygar 183619DNAArtificial SequencePrimer 36gatcgaggca catcgttac 193719DNAArtificial SequencePrimer 37gtttagatgc tgttgatac 193820DNAArtificial SequencePrimer 38tcdatyttnc cyctnggytg 203920DNAArtificial SequencePrimer 39caagatatgg acaatggaac 204020DNAArtificial SequencePrimer 40atacattcgg catccaatgg 204120DNAArtificial SequencePrimer 41actgactcgc attcaaagcc 204220DNAArtificial SequencePrimer 42tagctaatct agctagtgtc 204317DNAArtificial SequencePrimer 43garcaraara tgctngt 174420DNAArtificial SequencePrimer 44tgytcrttrt artartacat 20451068PRTCaenorhabditis briggsae 45Met Lys Val Phe Ala Val Val Ala Leu Leu Ala Val Ser Ala Leu Ala 1 5 10 15Asp Thr Leu Pro Ser Val Thr Ile Cys Pro Pro Glu Thr Gln Thr Ile 20 25 30Phe Val Leu Gln His Asn Ser Thr Val Gly Ala Arg Ile Arg Thr Ile 35 40 45Pro Thr Ser Asn Leu Ala Glu Cys Ser Asp His Cys Ala Ala Ser Leu 50 55 60Asp Cys Gln Gly Val Glu Phe Lys Asp Gly Ser Cys Ala Val Phe Arg65 70 75 80Ala Gly Ser Glu Lys Ala Thr Lys Gly Ser Gln Leu Leu Thr Lys Ser 85 90 95Cys Val Lys Ser Asp Arg Val Cys Gln Ser Pro Phe Gln Phe Asp Leu 100 105 110Phe Glu Gln Lys Ile Leu Val Gly Phe Ala Arg Glu Val Val Pro Ala 115 120 125Glu Asn Ile Gln Val Cys Met Ala Ala Cys Leu Asn Ala Phe Asp Thr 130 135 140Phe Gly Phe Glu Cys Glu Ser Ala Met Phe Tyr Pro Val Asp Gln Glu145 150 155 160Cys Ile Leu Asn Thr Glu Asp Arg Leu Asp Arg Pro Ser Leu Phe Val 165 170 175Asp Glu Ala Asp Asp Thr Val Ile Tyr Met Asp Asn Asn Cys Ala Gly 180 185 190Cys Lys Phe Gln Asn Pro Cys Ser His Val Asp Leu Tyr Phe Ser Leu 195 200 205Ala Gln Cys Tyr Pro Pro Tyr Ile Thr Gln Tyr Ile Ala Val Glu Gly 210 215 220Lys Gln Leu Lys Asn Glu Leu Asp Arg Ile Ile Asn Val Asp Leu Asp225 230 235 240Ser Cys Gln Ala Leu Cys Thr Gln Arg Leu Ser Ile Ser Ser Asn Asp 245 250 255Phe Asn Cys Lys Ser Phe Met Tyr Asn Asn Lys Thr Arg Thr Cys Ile 260 265 270Leu Ala Asp Glu Arg Ser Lys Pro Leu Gly Arg Ala Asp Leu Val Ala 275 280 285Thr Glu Gly Phe Thr Tyr Phe Glu Lys Lys Cys Phe Ala Ser Pro Asn 290 295 300Thr Cys Arg Asn Val Pro Ser Phe Lys Arg Val Pro Gln Met Ile Leu305 310 315 320Val Gly Phe Ala Ala Phe Val Met Glu Asn Val Pro Ser Val Thr Met 325 330 335Cys Leu Asp Gln Cys Thr Asn Pro Pro Pro Glu Thr Gly Asp Gly Phe 340 345 350Val Cys Lys Ser Val Met Tyr Tyr Tyr Asn Glu Gln Glu Cys Ile Leu 355 360 365Asn Ser Glu Thr Arg Glu Ser Lys Pro Glu Leu Phe Ile Pro Glu Gly 370 375 380Glu Glu Phe Leu Val Asp Tyr Phe Asp Ile Thr Cys His Leu Lys Gln385 390 395 400Glu Lys Cys Pro Ala Gly Gln His Leu Lys Ala Ile Arg Thr Ile Asn 405 410 415Ala Ala Leu Pro Glu Gly Glu Ser Glu Leu His Val Leu Lys Ser Ser 420 425 430Ala Ala Lys Gly Ile Lys Glu Cys Val Ala Lys Cys Phe Gly Leu Ala 435 440 445Pro Glu Lys Cys Arg Ser Phe Asn Tyr Asp Lys Lys Thr Lys Ser Cys 450 455 460Asp Leu Leu Tyr Leu Asp Gly His Asn Thr Leu Gln Pro Gln Val Arg465 470 475 480Gln Gly Val Asp Leu Tyr Asp Leu His Cys Leu Ala Ala Leu Pro Leu 485 490 495Val Glu Asn Asp Cys Ser Ala Asn Lys Asp Asp Ala Leu Phe Ser Arg 500 505 510Tyr Leu His Thr Lys Gln Arg Gly Ile Pro Ala Lys Ser Tyr Lys Val 515 520 525Val Ser Leu Asn Ser Cys Leu Glu Val Cys Ala Gly Asn Pro Thr Cys 530 535 540Ala Gly Ala Asn Tyr Asn Arg Arg Leu Gly Asp Cys Ser Leu Phe Asp545 550 555 560Ala Ile Asp Lys Asp Ala Glu Val Asn Glu His Thr Asp Phe Tyr Lys 565 570 575Asn Leu Cys Val Thr Lys Glu Val Asp Thr Gly Ala Ser Ala Ala Ala 580 585 590Asn Val Pro Glu Thr Lys His Arg Val Ser Gly Thr Val Val Glu Gly 595 600 605Lys Asp Ser Lys Ala Gln Leu Leu Ala Thr Lys Lys Val Lys Lys Pro 610 615 620Thr Ile Lys Asn Thr Glu His Arg Arg Ala Pro Glu Ser Thr Val Pro625 630 635 640Leu Gly Pro Pro Val Glu Val Lys Ala Glu Ala Ile Gln Thr Ile Cys 645 650 655Asn Tyr Glu Gly Ile Lys Val Gln Ile Asn Asn Gly Glu Pro Phe Ser 660 665 670Gly Val Ile Phe Val Lys Asn Lys Phe Asp Thr Cys Arg Val Glu Val 675 680 685Ala Asn Ser Asn Ala Ala Thr Leu Val Leu Gly Leu Pro Lys Asp Phe 690 695 700Gly Met Arg Pro Ile Ser Leu Asp Asn Leu Asp Asp Asn Glu Thr Gly705 710 715 720Lys Asn Lys Thr Lys Lys Gly Glu Glu Thr Pro Leu Lys Glu Glu Ile 725 730 735Glu Glu Phe Arg Gln Lys Arg Gln Ala Ala Glu Phe Arg Asp Cys Gly 740 745 750Leu Val Asp Leu Leu Asn Gly Thr Tyr Lys Ser Thr Val Val Ile Gln 755 760 765Thr Asn Asn Leu Gly Ile Pro Gly Leu Val Thr Ser Met Asp Gln Leu 770 775 780Tyr Glu Val Ser Cys Asp Tyr Ser Ser Met Leu Gly Gly Arg Val Gln785 790 795 800Ala Gly Tyr Asn Met Thr Val Thr Gly Pro Glu Ala Asn Leu Ile Gln 805 810 815Pro Arg Gly Lys Ile Glu Leu Gly Asn Pro Val Leu Met Gln Leu Leu 820 825 830Asn Gly Asp Gly Thr Glu Gln Pro Leu Val Gln Ala Lys Leu Gly Asp 835 840 845Ile Leu Glu Leu Arg Trp Glu Ile Met Ala Met Asp Asp Glu Leu Asp 850 855 860Phe Phe Val Lys Asn Cys His Ala Glu Pro Gly Leu Ala Gly Gly Lys865 870 875 880Ala Gly Ala Gly Glu Lys Leu Gln Leu Ile Asp Gly Gly Cys Pro Thr 885 890 895Pro Ala Val Ala Gln Lys Leu Ile Pro Gly Ala Ile Glu Val Lys Ser 900 905 910Ser Ala Val Lys Thr Thr Lys Met Gln Ala Phe Arg Phe Asp Ser Ser 915 920 925Ala Ser Ile Arg Val Thr Cys Glu Val Glu Ile Cys Lys Gly Asp Cys 930 935 940Glu Ala Val Glu Cys Ala Leu Thr Gly Gly Val Lys Lys Ser Phe Gly945 950 955 960Arg Lys Lys Arg Glu Val Asn Asn Asn Ile Glu Glu Phe Glu Thr Asn 965 970 975Arg Tyr Leu Ile Pro Arg Arg Ser His Ala Thr Thr Ser Ile Val Ile 980 985 990Ile Asp Pro Leu Gln Gln Val Asn Glu Pro Val Ala Met Ser Arg Ala 995 1000 1005Ser Thr Leu Asp Leu Leu Arg Glu Glu Ala His Glu Val Gln Val Ile 1010 1015 1020Glu Glu Gly Ser Ile Cys Leu Asn Arg Ile Thr Val Phe Ala Ile Phe1025 1030 1035 1040Gly Thr Leu Ala Val Leu Ile Leu Gly Gln Val Ile Val Val Ala His 1045 1050 1055Tyr Ala Val Arg Arg Phe Ser Thr Glu Lys Thr Ala 1060 106546742PRTCaenorhabditis briggsae 46Met Ser Pro Arg Val Ile Phe Leu Leu Leu Gly Ser Phe Leu Thr Ala 1 5 10 15Gln Ala Val Phe Glu Cys Ser Ser His Glu Thr Thr Ala Phe Val Arg 20 25 30Ile Pro Arg Ala Arg Leu Asp Gly Thr Pro Val Val Ile Ser Thr Ala 35 40 45Gly His Asp Leu Thr Cys Ala Gln Tyr Cys Arg Asn Asn Ile Glu Pro 50 55 60Thr Thr Gly Ala Gln Arg Val Cys Ala Ser Phe Asn Phe Asp Gly Arg65 70 75 80Glu Thr Cys Tyr Phe Phe Asp Asp Ala Ala Thr Pro Ala Gly Thr Ser 85 90 95Gln Leu Thr Ala Asn Pro Ser Ala Asn Asn Phe Tyr Tyr Glu Lys Thr 100 105 110Cys Ile Pro Asn Val Ser Ala His Glu Ala Cys Thr Tyr Arg Ser Phe 115 120 125Ser Phe Glu Arg Ala Arg Asn Thr Gln Leu Glu Gly Phe Val Lys Lys 130 135 140Ser Val Thr Val Lys Asn Arg Glu His Cys Leu Ser Ala Cys Leu Lys145 150 155 160Glu Lys Glu Phe Val Cys Lys Ser Val Asn Phe His Tyr Glu Asn Ser 165 170 175Leu Cys Glu Leu Ser Val Glu Asp Lys Arg Ser Lys Pro Thr His Val

180 185 190Arg Met Ser Glu Gly Ile Asp Tyr Tyr Asp Asn Asn Cys Leu Ser Arg 195 200 205Gln Asn Arg Cys Gly Pro Ser Gly Gly Asn Leu Val Phe Val Lys Thr 210 215 220Thr Asn Phe Glu Ile Arg Tyr Tyr Asp His Thr Gln Ser Val Glu Ala225 230 235 240Gln Glu Ser Tyr Cys Leu Gln Lys Cys Leu Asp Ser Leu Asn Thr Phe 245 250 255Cys Arg Ser Val Glu Phe Asn Pro Lys Glu Lys Asn Cys Ile Val Ser 260 265 270Asp Glu Asp Thr Phe Ser Arg Ala Asp Gln Gln Gly Gln Val Val Gly 275 280 285Lys Asp Tyr Tyr Glu Pro Ile Cys Val Ala Ala Asp Leu Ser Ser Ser 290 295 300Thr Cys Arg Gln Gln Ala Ala Phe Glu Arg Phe Ile Gly Ser Ser Ile305 310 315 320Glu Gly Glu Val Val Ala Ser Ala Gln Gly Val Thr Ile Ser Asp Cys 325 330 335Ile Ser Leu Cys Phe Gln Asn Leu Asn Cys Lys Ser Ile Asn Tyr Asp 340 345 350Arg Thr Ala Ser Ser Cys Phe Ile Tyr Ala Val Gly Arg Gln Asp Ala 355 360 365Asn Ile Lys Ala Asn Pro Ser Met Asp Tyr Tyr Glu Phe Asn Cys Glu 370 375 380Ser Gln Phe Gly Gly Met Ala Leu Cys Thr Asn Glu Gly Ile Arg Phe385 390 395 400Ile Val Asn Thr Lys Glu Pro Tyr Thr Gly Ala Ile Tyr Ala Ala Glu 405 410 415Arg Phe Ser Thr Cys Ser Gln Val Val Glu Asn Ala Lys Gln Ile Ser 420 425 430Ile Thr Phe Pro Pro Pro Thr Val Thr Ser Asp Cys Gly Thr Val Ile 435 440 445Arg Asp Gly Lys Met Glu Ala Leu Val Val Val Ser Leu Asp Gly Val 450 455 460Leu Pro His Gln Val Thr Thr Glu Trp Asp Arg Phe Tyr Arg Val Ser465 470 475 480Cys Asp Val Ser Met Asp Lys Met Val Lys Glu Gly Ser Val Val Val 485 490 495Thr Thr Ile Tyr Glu Ala Ser Ser Gln Asn Thr Thr Val Leu Asp Val 500 505 510Ala Thr Pro Pro Pro Val Thr Ala Glu Leu Gln Ile Leu Asn Gln Leu 515 520 525Glu Glu Pro Leu His Lys Ala Ser Ile Gly Asp Pro Leu Leu Leu Val 530 535 540Ile Thr Ser Glu Gln Ala Gly Pro His Asn Met Met Val Thr Glu Cys545 550 555 560Thr Ala Thr Arg Val Gly Gly Phe Gly Asp Thr Val Pro Phe Thr Leu 565 570 575Ile Glu Asn Gly Cys Pro Arg Tyr Pro Ala Leu Val Gly Pro Val Glu 580 585 590Gln Asp Phe Asp Lys Asn Arg Leu Lys Ser Asp Leu Arg Ala Phe Arg 595 600 605Leu Asp Gly Ser Tyr Asp Val Gln Ile Val Cys Ser Ile Met Phe Cys 610 615 620Ala Gly Pro Asn Gly Cys Pro Val Ser Asn Cys Leu Asp Ser Gly Thr625 630 635 640Asn Glu Leu Phe Met Ser His Gly Arg Lys Lys Arg Ser Val Asp Leu 645 650 655Glu Ala Gly Glu Thr Glu Glu Arg Leu Ser Ala Ile Ile Arg Val Phe 660 665 670Ala Lys Gly Glu Asp Glu Glu Glu Ile Glu Met Gly Asn Asn Thr Leu 675 680 685Met Thr Ser Leu Ala Glu Ser Thr Asp Leu Leu Cys Ile Ala Glu Pro 690 695 700Phe Phe Val Ser Ser Val Val Ser Leu Ser Val Leu Cys Phe Ala Leu705 710 715 720Ser Ala Ile Ile Ala Ile Trp Gly Cys His Ala Leu His Ala Lys Pro 725 730 735Thr Lys Gln Val Ala Ala 7404722DNAArtificial SequencePrimer 47gtaatacgac tcactatagg gc 224820DNAArtificial SequencePrimer 48aattaaccct cactaaaggg 204919DNAArtificial SequencePrimer 49gatttaggtg acactatag 195029DNAArtificial SequencePrimer 50ggccacgcgt cgactagtac ggggggggg 295120DNAArtificial SequencePrimer 51tcagtgacgt tatgtcctcc 205220DNAArtificial SequencePrimer 52tgacagatgg aacattctcc 205320DNAArtificial SequencePrimer 53acttcaggac acgacttgac 205420DNAArtificial SequencePrimer 54caatcagaga tggtaactcc 20


Patent applications by Andrew P. Kloek, San Francisco, CA US

Patent applications by Anita M. Frevert, St. Louis, MO US

Patent applications by Brandi Chiapelli, St. Louis, MO US

Patent applications by Catherine Baublite, St. Louis, MO US

Patent applications by Deryck J. Williams, University City, MO US

Patent applications by Jennifer A. Davila-Aponte, St. Louis, MO US

Patent applications by John D. Bradley, St. Louis, MO US

Patent applications by Merry B. Mclaird, Kirkwood, MO US

Patent applications by Michelle Coutu Hresko, Chesterfield, MO US

Patent applications by Siqun Xu, Ballwin, MO US

Patent applications in class 25 or more amino acid residues in defined sequence

Patent applications in all subclasses 25 or more amino acid residues in defined sequence


User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA