Patent application title: Transgenic Cells Expressing Glucosyltransferase Nucleic Acids
Inventors:
Diana Joy Bowles (Heslington, GB)
Yi Li (Heslington, GB)
Eng-Kiat Lim (Heslington, GB)
Assignees:
THE UNIVERSITY OF YORK
IPC8 Class: AA01H700FI
USPC Class:
800319
Class name: Plant, seedling, plant seed, or plant part, per se higher plant, seedling, plant seed, or plant part (i.e., angiosperms or gymnosperms) conifer
Publication date: 2008-08-28
Patent application number: 20080209597
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: Transgenic Cells Expressing Glucosyltransferase Nucleic Acids
Inventors:
Diana Joy Bowles
Yi Li
Eng-Kiat Lim
Agents:
CROWELL & MORING LLP;INTELLECTUAL PROPERTY GROUP
Assignees:
The University Of York
Origin: WASHINGTON, DC US
IPC8 Class: AA01H700FI
USPC Class:
800319
Abstract:
The invention relates to transgenic cells which have been transformed with
nucleic acids encoding glycosyltransferase polypeptides (GTases) and
vectors for use in transformation of said cells.Claims:
1. A transgenic plant comprising a nucleic acid molecule which encodes a
polypeptide which has glucosyltransferase activity and is encoded byi) a
nucleic acid molecule selected from the group consisting of SEQ ID NOs:
1, 4, 7, 10, 13, 16, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42,
43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54; orii) a nucleic acid
molecule which hybridizes to SEQ ID NO: 19 or any of the sequences
represented in (i) above and which modifies biosynthetic intermediates in
lignin polymerization; oriii) a nucleic acid molecule which is degenerate
as a result of the genetic code to SEQ ID NO: 19 or any of the sequences
defined in (i) and (ii) above.
2. A transgenic plant according to claim 1, wherein said intermediates are selected from the group consisting of: cinnamic acid; p-coumaric acid; caffeic acid; ferulic acid; sinapic acid; p-coumaryl aldehyde; coniferyl aldehyde; sinapyl aldehyde; p-coumaryl alcohol; coniferyl alcohol and sinapyl alcohol.
3. A transgenic plant according to claim 1, wherein the nucleic acid molecule anneals under stringent hybridization conditions to a nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54.
4. A transgenic plant according to claim 1, wherein the nucleic acid molecule is SEQ ID NO: 25, and the intermediates are monolignol glucosides.
5. A transgenic plant comprising a nucleic acid molecule, wherein the nucleic acid molecule is selected from the group consisting of:i) antisense sequences selected from the group consisting of SEQ ID NOs: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, parts thereof, and antisense sequence of the sense sequences presented in SEQ ID NOS: 34-54; andii) antisense sequences which hybridize to any of the sense sequences according to claim 1 and which inhibit GTase activity.
6. A transgenic plant according to claim 5, wherein the antisense sequence hybridizes to a sequence selected from the group consisting of SEQ ID NOS: 19 and 25.
7. A transgenic plant according to claim 1, wherein the nucleic acid is cDNA.
8. A transgenic plant according to claim 1, wherein the nucleic acid is genomic DNA.
9. A transgenic plant according to claim 1, wherein the plant is a woody plant selected from the group consisting of poplar; eucalyptus; Douglas fir; pine; walnut; ash; birch; oak; teak and spruce.
10. A transgenic plant according to claim 9, wherein said plant is poplar.
11. A transgenic plant according to claim 1, wherein the plant is a non-woody plant species.
12. A method for the manufacture of paper or paperboard comprising:i) pulping transgenic wood material derived from a transgenic woody plant according to claim 8; andii) producing paper or paperboard from the pulped transgenic wood material.
13. A transgenic eukaryotic cell comprising a nucleic acid molecule which encodes a polypeptide which has glucosyltransferase activity; said nucleic acid molecule being selected from the group consisting of:i) nucleic acid molecules comprising a sequence selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54;ii) nucleic acid molecules which hybridize to any of the sequences represented in (i) above and which glucosylate an anti-oxidant; andiii) nucleic acid molecules which are degenerate as a result of the genetic code to any of the sequences defined in (i) and (ii) above.
14. A transgenic eukaryotic cell according to claim 13, wherein the nucleic acid molecule is selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54.
15. A transgenic eukaryotic cell according to claim 14, wherein the nucleic acid molecule is selected from the group consisting of SEQ ID NOs: 1, 7, 10, 13, 19, 22, 25 and 28.
16. A transgenic prokaryotic cell comprising a nucleic acid molecule which encodes a polypeptide which has glucosyltransferase activity and is encoded by:i) a nucleic acid molecule selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54; orii) a nucleic acid molecule which hybridizes to any of the sequences represented in (i) above and which glucosylates an anti-oxidant; oriii) a nucleic acid molecule which is degenerate as a result of the genetic code to any of the sequences defined in (ii) and (iii) above.
17. A transgenic prokaryotic cell according to claim 16, wherein the nucleic acid molecule is selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54.
18. A transgenic prokaryotic cell according to claim 17, wherein the nucleic acid molecule is selected from the group consisting of SEQ ID NOs: 1, 7, 10, 13, 19, 22, 25 and 28.
Description:
CROSS REFERENCE TO RELATED APPLICATIONS
[0001]This application is a continuation of application Ser. No. 10/203,319 filed Aug. 9, 2002, which is a 371 national stage entry of international patent application no. PCT/GB2001/00477, filed Feb. 8, 2001, designating the United States of America, and published in United Kingdom on Aug. 16, 2001, as WO 2001/59140, the entire disclosure of which is incorporated herein by reference. Priority is claimed based on United Kingdom patent application no. 0002814.2, filed Feb. 9, 2000.
BACKGROUND OF THE INVENTION
[0002]The invention relates to transgenic cells which have been transformed with glucosyltransferase (GTases) nucleic acids.
[0003]GTases are enzymes which post-translationally transfer glucosyl residues from an activated nucleotide sugar to monomeric and polymeric acceptor molecules such as other sugars, proteins, lipids and other organic substrates. These glucosylated molecules take part in diverse metabolic pathways and processes. The transfer of a glucosyl moiety can alter the acceptor's bioactivity, solubility and transport properties within the cell and throughout the plant. One family of GTases in higher plants is defined by the presence of a C-terminal consensus sequence. The GTases of this family function in the cytosol of plant cells and catalyse the transfer of glucose to small molecular weight substrates, such as phenylpropanoid derivatives, coumarins, flavonoids, other secondary metabolites and molecules known to act as plant hormones. Available evidence indicates that GTases enzymes can be highly specific, such as the maize and Arabidopsis GTases that glucosylate indole-3-acetic acid (IAA).
[0004]The production and use of paper has increased in the last 10 years. For example, between 1989 and 1999 the production of paper and board in the UK has increased from 4.6 to 6.6 million tonnes. Worldwide consumption has also reflected a general increase in paper usage. For example, in the UK per capita consumption of paper is over 200 kg per annum. In the USA this figure is over 300 kg per annum.
[0005]Wood used in the paper industry is initially particulated, typically by chipping, before conversion to a pulp which can be utilised to produce paper. The pulping process involves the removal of lignin. Lignin is a major non-carbohydrate component of wood and comprises approximately one quarter of the raw material in wood pulp. The removal of lignin is desirable since the quality of the paper produced from the pulp is largely determined by the lignin content. Many methods have been developed to efficiently and cost effectively remove lignin from wood pulp. These methods can be chemical, mechanical or biological. For example, chemical methods to pulp wood are disclosed in WO9811294, EP0957198 and WO0047812. Although chemical methods are efficient means to remove lignin from pulp it is known that chemical treatments can result in degradation of polysaccharides and is expensive. Moreover, to remove residual lignin from pulp it is necessary to use strong bleaching agents which require removal before the pulp can be converted into paper. These agents are also damaging to the environment.
[0006]Biological methods to remove lignin are known. There are however disadvantages associated with such methods. For example it is important to provide micro-organisms (eg bacteria and/or fungi) which only secrete ligninolytic enzymes which do not affect cellulose fibres. This method is also very time consuming (can take 3-4 weeks) and expensive due to the need to provide bioreactors. Biological treatment can also include pre-treatment of wood chips to make them more susceptible to further biological or chemical pulping.
[0007]It is therefore desirable to provide further means by which lignin can be efficiently and cost effectively removed from wood pulp which do not have the disadvantages associated with prior art methods.
[0008]For the sake of clarity reference herein to transgenic means a plant which has been genetically modified to include a nucleic acid sequence not naturally found in said plant. For example, by over-expression of monolignol glucosyltransferases in planta, plant cell wall properties may be altered through increasing the flux through biosynthetic intermediates that are obligatory for incorporation and assembly of the lignin polymer. Conversely, reduction of the monolignol glucoside pools, such as through the use of nucleic acid comprising GTase sequences in antisense configuration may lead to altered properties through reducing the flux through specific intermediates. Changes in lignin composition, such as with decreased ratios of coniferyl alcohol to sinapyl alcohol are highly desirable in paper and pulping processes, because the more highly methylated lignin (sinapyl alcohol) is more easily removed during pulping processes (Chiang et al (1988) TAPPI J. 71, 173-176).
[0009]In some applications it may be desirable to change lignin composition and increase the lignin content of a plant cell to increase the mechanical strength of wood. This would have utility in, for example the construction industry or in furniture making.
[0010]Both lignin content and the level of cross-linking of polysaccharide polymers within plant cell walls, also play an important role in determining texture and quality of raw materials through altering the cell walls and tissue mechanical properties. For example, there is considerable interest in reducing cell separation in edible tissues since this would prevent over-softening and loss of juiciness. Phenolics, such as ferulic acid, play an important role in cell adhesion since they can be esterified to cell wall polysaccharides during synthesis and oxidatively cross-linked in the wall, thereby increasing rigidity. Most non-lignified tissues contain these phenolic components and their levels can be modified by altering flux through the same metabolic pathways as those culminating in lignin. Therefore, in the same way as for the manipulation of lignin composition and content, GTase nucleic acid in sense and/or antisense configurations can be used to affect levels of ferulic acid and related phenylpropanoid derivatives that function in oxidative cross-linking. These changes in content have utility in the control of raw material quality of edible plant tissues.
[0011]Lignin and oxidative cross-linking in plant cell walls also play important roles in stress and defence responses of most plant species. For example, when non-woody tissues are challenged by pests or pathogen attack, or suffer abiotic stress such as through mechanical damage or UV radiation, the plant responds by localised and systemic alteration in cell wall and cytosolic properties, including changes in lignin content and composition and changes in cross-linking of other wall components. Therefore, it can also be anticipated that cell- or tissue-specific changes in these responses brought about by changed levels of the relevant GTase activities will have utility in protecting the plant to biotic attack and biotic/abiotic stresses.
[0012]GTases also have utility with respect to the modification of antioxidants. Reactive oxygen species are produced in all aerobic organisms during respiration and normally exist in a cell in balance with biochemical anti-oxidants. Environmental challenges, such as by pollutants, oxidants, toxicants, heavy metals and so on, can lead to excess reactive oxygen species which perturb the cellular redox balance, potentially leading to wide-ranging pathological conditions. In animals and humans, cardiovascular diseases, cancers, inflammatory and degenerative disorders are linked to events arising from oxidative damage.
[0013]Because of the current prevalence of these diseases, there is considerable interest in anti-oxidants, consumed in the diet or applied topically such as in UV-screens. Anti-oxidant micronutrients obtained from vegetables and fruits, teas, herbs and medicinal plants are thought to provide significant protection against health problems arising from oxidative stress. Well known anti-oxidants from plant tissues include for example: quercetin, luteolin, and the catechin, epicatechin and cyanidin groups of compounds.
[0014]Caffeic acid (3,4-dihydroxycinnamic acid) is a further example of an anti-oxidant with beneficial therapeutic properties.
[0015]Certain plant species, organs and tissues are known to have relatively high levels of one or more compounds with anti-oxidant activity. Greater accumulation of these compounds in those species, their wider distribution in crop plants and plant parts already used for food and drink production, and the increased bioavailability of anti-oxidants (absorption, metabolic conversions and excretion rate) are three features considered to be highly desirable.
[0016]It will be apparent that changed levels of the relevant GTase activities capable of glucosylating anti-oxidant compounds in planta will allow the production of anti-oxidants with beneficial properties. GTase sequences can also be expressed in prokaryotes or simple eukaryotes, such as yeast, to produce enzymes for biotransformations in those cells, or as in vitro processing systems.
SUMMARY OF THE INVENTION
Statements of Invention
[0017]According to an aspect of the invention there is provided a transgenic cell comprising a nucleic acid molecule which encodes a polypeptide which has: [0018]i) glucosyltransferase activity: [0019]ii) is selected from the group comprising sequences of FIGS. 1A, 2A, 3A, 4A, 5A, 6A, 7A, 8A, 9A, 10A, 11A, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 [0020]iii) nucleic acids which hybridise to the sequences represented in (ii) above; and [0021]iv) nucleic acid sequences which are degenerate as a result of the genetic code to the sequences defined in (i) and (ii) above.
[0022]In a further preferred embodiment of the invention said nucleic acid molecule anneals under stringent hybridisation conditions to the sequence presented in FIGS. 1A, 2A, 3A, 4A, 5A, 6A, 7A, 8A, 9A, 10A, 11A, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32
[0023]More preferably still said nucleic acid molecule is selected from FIGS. 7A, 8A, 9A, 10A, 15, 18, 19, 28 or 31.
[0024]Stringent hybridisation/washing conditions are well known in the art. For example, nucleic acid hybrids that are stable after washing in 0.1×SSC, 0.1% SDS at 60° C. It is well known in the art that optimal hybridisation conditions can be calculated if the sequence of the nucleic acid is known. For example, hybridisation conditions can be determined by the GC content of the nucleic acid subject to hybridisation. Please see Sambrook et al (1989) Molecular Cloning; A Laboratory Approach. A common formula for calculating the stringency conditions required to achieve hybridisation between nucleic acid molecules of a specified homology is:
Tm=81.5° C.+16.6 Log [Na.sup.+]+0.41[% G+C]-0.63 (% formamide).
[0025]In a preferred embodiment of the invention said transgenic cell is a eukaryotic cell. Preferably said eukaryotic cell is a plant cell or yeast cell.
[0026]In an alternative embodiment of the invention said transgenic cell is a prokaryotic cell.
[0027]In a further preferred embodiment of the invention the nucleic acid molecule is selected from the group comprising: antisense sequences of the sequences of any one of FIGS. 1C, 2C, 3C, 4C, 5C, 6C, 7C, 8C, 9C, 10C and 11C or parts thereof, or antisense sequences of the sense sequences presented in FIGS. 12-32. More preferably still said antisense sequence is selected from FIG. 7C or 9C
[0028]In a further preferred embodiment of the invention said nucleic acid is cDNA.
[0029]In a yet further preferred embodiment of the invention said nucleic acid is genomic DNA.
[0030]In yet still a further preferred embodiment of the invention said plant is a woody plant selected from: poplar; eucalyptus; Douglas fir; pine; walnut; ash; birch; oak; teak; spruce. Preferably said woody plant is a plant used typically in the paper industry, for example poplar.
[0031]Methods to transform woody species of plant are well known in the art. For example the transformation of poplar is disclosed in U.S. Pat. No. 4,795,855 and WO9118094. The transformation of eucalyptus is disclosed in EP1050209 and WO9725434. Each of these patents is incorporated in their entirety by reference.
[0032]In a still further preferred embodiment of the invention said plant is selected from: corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (helianthus annuas), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Iopmoea batatus), cassaya (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citris tree (Citrus spp.) cocoa (Theobroma cacao), tea (Camellia senensis), banana (Musa spp.), avacado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifer indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia intergrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), oats, barley, vegetables and ornamentals.
[0033]Preferably, plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassaya, barley, pea, and other root, tuber or seed crops. Important seed crops are oil-seed rape, sugar beet, maize, sunflower, soybean, and sorghum. Horticultural plants to which the present invention may be applied may include lettuce, endive, and vegetable brassicas including cabbage, broccoli, and cauliflower, and carnations and geraniums. The present invention may be applied in tobacco, cucurbits, carrot, strawberry, sunflower, tomato, pepper, chrysanthemum.
[0034]Grain plants that provide seeds of interest include oil-seed plants and leguminous plants. Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc. Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava been, lentils, chickpea, etc.
[0035]According to a further aspect of the invention there is provided a vector comprising the nucleic acid according to the invention operably linked to a promoter.
[0036]Vector" includes, inter alia, any plasmid, cosmid, phage or Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self-transmissable or mobilizable, and which can transform a prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication ie an episomal vector).
[0037]Suitable vectors can constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. For further details see, for example, Molecular Cloning: Laboratory Manual: 2nd edition, Sambrook et al. 1989, Cold Spring Habor Laboratory Press or Current Protocols in Molecular Biology, Second Edition, Ausubel et al. Eds., John Wiley & Sons, 1992.
[0038]Specifically included are shuffle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotic (e.g. higher plant, mammalian, yeast or fungal cells).
[0039]A vector including nucleic acid according to the invention need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce the nucleic acid into cells for recombination into the gene.
[0040]Preferably the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, (e.g. bacterial), or plant cell. The vector may be a bi-functional expression vector which functions in multiple hosts. In the case of GTase genomic DNA this may contain its own promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell.
[0041]By "promoter" is meant a nucleotide sequence upstream from the transcriptional initiation site and which contains all the regulatory regions required for transcription. Suitable promoters include constitutive, tissue-specific, inducible, developmental or other promoters for expression in plant cells comprised in plants depending on design. Such promoters include viral, fungal, bacterial, animal and plant-derived promoters capable of functioning in plant cells.
[0042]Constitutive promoters include, for example CaMV 35S promoter (Odell et al. (1985) Nature 313, 9810-812); rice actin (McElroy et al. (1990) Plant Cell 2: 163-171); ubiquitin (Christian et al. (1989) Plant Mol. Biol. 18 (675-689); pEMU (Last et al. (1991) Theor Appl. Genet. 81: 581-588); MAS (Velten et al. (1984) EMBO J. 3. 2723-2730); ALS promoter (U.S. Application Seriel No. 08/409,297), and the like. Other constitutive promoters include those in U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680, 5,268,463; and 5,608,142.
[0043]Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induced gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-1a promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88: 10421-10425 and McNellis et al. (1998) Plant J. 14(2): 247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227: 229-237, and U.S. Pat. Nos. 5,814,618 and 5,789,156, herein incorporated by reference.
[0044]Where enhanced expression in particular tissues is desired, tissue-specific promoters can be utilised. Tissue-specific promoters include those described by Yamamoto et al. (1997) Plant J. 12(2): 255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7): 792-803; Hansen et al. (1997) Mol. Gen. Genet. 254(3): 337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168; Rinehart et al. (1996) Plant Physiol. 112(3): 1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2): 525-535; Canevascni et al. (1996) Plant Physiol. 112(2): 513-524; Yamamoto et al. (1994) Plant Cell Physiol. 35(5): 773-778; Lam (1994) Results Probl. Cell Differ. 20: 181-196; Orozco et al. (1993) Plant Mol. Biol. 23(6): 1129-1138; Mutsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90 (20): 9586-9590; and Guevara-Garcia et al (1993) Plant J. 4(3): 495-50.
[0045]Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter. In a preferred aspect, the promoter is an inducible promoter or a developmentally regulated promoter.
[0046]Particular of interest in the present context are nucleic acid constructs which operate as plant vectors. Specific procedures and vectors previously used with wide success upon plants are described by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148. Suitable vectors may include plant viral-derived vectors (see e.g. EP-A-194809).
[0047]If desired, selectable genetic markers may be included in the construct, such as those that confer selectable phenotypes such as resistance to antibodies or herbicides (e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate).
[0048]According to a further aspect of the invention there is provided a method of enhancing monolignol glucoside synthesis in a plant comprising causing or allowing expression of at least one GTase nucleic acid according to the invention in a plant. Preferably the plant is a woody plant species.
[0049]According to a further aspect of the invention there is provided a method of inhibiting monolignol glucoside synthesis in a plant comprising causing or allowing expression of at least one GTase antisense nucleic acid according to the invention in a plant. Preferably the plant is a woody plant species.
[0050]Inhibition of GTase expression may, for instance, be achieved using anti-sense technology.
[0051]In using anti-sense genes or partial gene sequences to down-regulate gene expression, a nucleotide sequence is placed under the control of a promoter in a "reverse orientation" such that transcription yields RNA which is complementary to normal mRNA transcribed from the "sense" strand of the target gene. See, for example, Rothstein et al, 1987; Smith et al, (1998), Nature 334, 724-726; Zhang et al (1992) The Plant Cell 4, 1575-1588, English et al. (1996) The Plant Cell 8, 179 188. Antisense technology is also reviewed in Bourque (1995), Plant Science 105, 125-149, and Flavell (1994) PNAS USA 91, 3490-3496.
[0052]According to a further aspect of the invention there is provided a nucleotide sequence encoding an antisense RNA molecule complementary to a sense mRNA molecule encoding for a polypeptide having a glucosyl transferase activity in the biosynthesis of at least a monolignol glucoside in lignin biosynthesis in a plant, which nucleotide sequence is under transcriptional control of a promoter and a terminator, both promoter and terminator capable of functioning in plant cells.
[0053]Suitable promoters and terminators are referred to hereinabove.
[0054]According to a further aspect of the invention there is provided a nucleotide sequence according to the invention comprising a transcriptional regulatory sequence, a sequence under the transcriptional control thereof which encodes an RNA which consists of a plurality of subsequences, characterised in that the RNA subsequences are antisense RNAs to mRNAs of proteins having a GTase activity in the lignin biosynthesis pathway in plant cells.
[0055]In particular, the said RNA subsequences are antisense RNAs to mRNAs of GTase having a GTase activity in the lignin biosynthesis pathway in plant cells, such as the GTase of FIGS. 1-11(C)
[0056]The nucleotide sequence may encode an RNA having any number of subsequences. Preferably, the number of subsequences lies between 2 and 7 (inclusive) and more preferably lies between 2-4.
[0057]According to a further aspect of the invention there is provided a host cell transformed with nucleic acid or a vector according to the invention, preferably a plant or a microbial cell. The microbial cell may be prokaryotic (eg Escherchia coli, Bacillus subtilis) or eukaryotic (eg Saccharomyces cerevisiae).
[0058]In the transgenic plant cell the transgene may be on an extra-genomic vector or incorporated, preferably stably, into the genome. There may be more than one heterologous nucleotide sequence per haploid genome.
[0059]According to a yet further aspect of the invention there is provided a method of transforming a plant cell comprising introduction of a vector into a plant cell and causing or allowing recombination between the vector and the plant cell genome to introduce a nucleic acid according to the invention into the genome.
[0060]Plants transformed with a DNA construct of the invention may be produced by standard techniques known in the art for the genetic manipulation of plants. DNA can be introduced into plant cells using any suitable technology, such as a disarmed Ti-plasmid vector carried by Agrobacterium exploiting its natural gene transferability (EP-A-270355, EP-A-0116718, NAR 12(22):8711-87215 (1984), Townsend et al., U.S. Pat. No. 5,563,055); particle or microprojectile bombardment (U.S. Pat. No. 5,100,792, EP-A-444882, EP-A-434616; Sanford et al, U.S. Pat. No. 4,945,050; Tomes et al. (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment", in Plant Cell, Tissue and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); and McCabe et al. (1988) Biotechnology 6: 923-926); microinjection (WO 92/09696, WO 94/00583, EP 331083, EP 175966, Green et al. 91987) Plant Tissue and Cell Culture, Academic Press, Crossway et al. (1986) Biotechniques 4:320-334); electroporation (EP 290395, WO 8706614, Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606; D'Halluin et al. 91992). Plant Cell 4:1495-1505) other forms of direct DNA uptake (DE 4005152, WO 9012096, U.S. Pat. No. 4,684,611, Paszkowski et al. (1984) EMBO J. 3:2717-2722); liposome-mediated DNA uptake (e.g. Freeman et al (1984) Plant Cell Physiol, 29:1353); or the vortexing method (e.g. Kindle (1990) Proc. Nat. Acad. Sci. USA 87:1228). Physical methods for the transformation of plant cells are reviewed in Oard (1991) Biotech. Adv. 9:1-11. See generally, Weissinger et al. (1988) Ann. Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate Sciences and Technology 5:27-37; Christou et al. (1988) Plant Physiol. 87:671-674; McCabe et al. (1988) Bio/Technology 6:923-926; Finer and McMullen (1991) In Vitro Cell Dev. Biol. 27P:175-182; Singh et al. (1988) Theor. Appl. Genet. 96:319-324; Datta et al. (1990) Biotechnology 8:736-740; Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85: 4305-4309; Klein et al. (1988) Biotechnology 6:559-563; Tomes, U.S. Pat. No. 5,240,855; Buising et al. U.S. Pat. Nos. 5,322,783 and 5,324,646; Klein et al. (1988) Plant Physiol 91: 440-444; Fromm et al (1990) Biotechnology 8:833-839; Hooykaas-Von Slogteren et al. 91984). Nature (London) 311:763-764; Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349; De Wet et al. (1985) in The Experimental Manipuation of Ovule Tissues ed. Chapman et al. (Longman, New York), pp. 197-209; Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566; Li et al. (1993) Plant Cell Reports 12: 250-255 and Christou and Ford (1995) Annals of Botany 75: 407-413; Osjoda et al. (1996) Nature Biotechnology 14:745-750, all of which are herein incorporated by reference.
[0061]Agrobacterium transformation is widely used by those skilled in the art to transform dicotyledonous species. Recently, there has been substantial progress towards the routine production of stable, fertile transgenic plants in almost all economically relevant monocot plants (Toriyama et al. (1988) Bio/Technology 6: 1072-1074; Zhang et al. (1988) Plant Cell rep. 7379-384; Zhang et al. (1988) Theor. Appl. Genet. 76:835-840; Shimamoto et al. (1989) Nature 338:274-276; Datta et al. (1990) Bio/Technology 8: 736-740; Christou et al. (1991) Bio/Technology 9:957-962; Peng et al (1991) International Rice Research Institute, Manila, Philippines, pp. 563-574; Cao et al. (1992) Plant Cell Rep. 11: 585-591; Li et al. (1993) Plant Cell Rep. 12: 250-255; Rathore et al. (1993) Plant Mol. Biol. 21:871-884; Fromm et al (1990) Bio/Technology 8:833-839; Gordon Kamm et al. (1990) Plant Cell 2:603-618; D'Halluin et al. (1992) Plant Cell 4:1495-1505; Walters et al. (1992) Plant Mol. Biol. 18:189-200; Koziel et al. (1993). Biotechnology 11194-200; Vasil, I. K. (1994) Plant Mol. Biol. 25:925-937; Weeks et al (1993) Plant Physiol. 102:1077-1084; Somers et al. (1992) Bio/Technology 10:1589-1594; WO 92/14828. In particular, Agrobacterium mediated transformation is now emerging also as an highly efficient transformation method in monocots. (Hiei, et al. (1994) The Plant Journal 6:271-282). See also, Shimamoto, K. (1994) Current Opinion in Biotechnology 5:158-162; Vasil, et al. (1992) Bio/Technology 10:667-674; Vain, et al. (1995) Biotechnology Advances 13(4):653-671; Vasil, et al. (1996) Nature Biotechnology 14: 702).
[0062]Microprojectile bombardment, electroporation and direct DNA uptake are preferred where Agrobacterium is inefficient or ineffective. Alternatively, a combination of different techniques may be employed to enhance the efficiency of the transformation process, e.g. bombardment with Agrobacterium-coated microparticles (EP-A-486234) or microprojectile bombardment to induce wounding followed by co-cultivation with Agrobacterium (EP-A-486233).
[0063]Plants which include a plant cell according to the invention are also provided.
[0064]In addition to the regenerated plant, the present invention embraces all of the following: a clone of such a plant, seed, selfed of hybrid progeny and descendants (e.g. F1 and F2 descendants).
[0065]According to a further aspect of the invention there is provided an isolated nucleic acid molecule obtainable from Arabidopsis thaliana which comprises a nucleic acid sequence encoding a polypeptide having
(1) GTase functionality; and(2) is capable of adding a glucosyl group via an O-glucosidic linkage to form
[0066](a) a glucosyl ester of at least one of: [0067]cinnamic acid; p-coumaric acid; caffeic acid; ferulic acid; and sinapic acid; and/or
[0068](b) a 4-O-glucoside of at least one of:
cinnamic acid; p-coumaric acid; caffeic acid; ferulic acid; sinapic acid; p-coumaryl aldehyde; coniferyl aldehyde; sinapyl aldehyde; p-coumaryl alcohol; coniferyl alcohol; and sinapyl alcohol.
[0069]In a further aspect of the invention there is provided a polypeptide encoded by an isolated nucleic acid molecule of the present invention wherein the said polypeptide is selected from the polypeptides of FIGS. 1B, 2B, 3B, 4B, 5B, 6B, 7B, 8B, 9B, 10B and 111B or functional variants and/or parts thereof. Preferably the polypeptide is selected from the group of polypeptides of FIGS. 2B, 3B, 4B, 6B, 7B and 9B or functional variants and/or parts thereof. Preferably still the polypeptide is selected from the group of polypeptides selected from FIGS. 2B, 3B, 7B and 9B or functional variants and/or parts thereof. Most preferably the polypeptide is one of the polypeptides shown in FIGS. 2B, 3B, 7B or 9B. Polypeptides encoded by the sense nucleic acid sequences presented in FIGS. 12-32 are also provided and readily derived from these sense sequences.
[0070]Variants of sequences having substantial identity or homology with the GTase molecules of the invention may be utilized in the practices of the invention. That is, the GTase of FIGS. 1A-11A may be modified yet still remain functional. Generally, the GTase will comprise at least about 40%-60%, preferably about 60%-80%, more preferably about 80%-95% sequence identity with a GTase nucleotide sequence of FIGS. 1A-32 herein.
[0071]The activity of functional variant polypeptides may be assessed by transformation into a host capable of expressing the nucleic acid of the invention. Methodology for such transformation is described in more detail below.
[0072]In a further aspect of the invention there is disclosed a method of producing a derivative nucleic acid comprising the step of modifying any of the sequences disclosed above, particularly the coding sequence of FIGS. 1A, 2A, 3A, 4A, 5A, 6A, 7A, 8A, 9A, 10A, 11A, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32
[0073]Alternatively, changes to a sequence may produce a derivative by way of one or more of addition, insertion, deletion or substitution of one or more nucleotides in the nucleic acid, leading to the addition, insertion, deletion or substitution or one or more amino acids in the encoded polypeptide.
[0074]Other desirable mutations may be random or site directed mutagenesis in order to alter the activity (e.g. specificity) or stability of the encoded polypeptide or to produce dominant negative variants which may alter the flux through lignin biosynthetic pathways to alter the amount of lignin or an intermediate in the lignin biosynthetic pathway.
BRIEF DESCRIPTION OF THE DRAWINGS
[0075]The invention will now be described with reference to the following Figures and Examples which are not to be construed as limiting the invention.
[0076]Scheme 1: The major intermediates in lignin biosynthesis pathway.
[0077]FIG. 1A: Sense nucleotide sequence of A062 (SEQ ID NO: 1). The coding region starts from the first nucleotide and ends at the last nucleotide;
[0078]FIG. 1B: The amino acid sequence of A062 (SEQ ID NO: 2);
[0079]FIG. 1C: The antisense nucleotide sequence of A062 (SEQ ID NO:3);
[0080]FIG. 2A Sense nucleotide sequence of A320 (SEQ ID NO: 4). The coding region starts from the first nucleotide and ends at the last nucleotide;
[0081]FIG. 2B The amino acid sequence of A320 (SEQ ID NO: 5);
[0082]FIG. 2C: The antisense nucleotide sequence of A320 (SEQ ID NO: 6);
[0083]FIG. 3A: Sense nucleotide sequence of A41 (SEQ ID NO: 7). The coding region starts from the first nucleotide and ends at the last nucleotide;
[0084]FIG. 3B: The amino acid sequence of A41 (SEQ ID NO: 8);
[0085]FIG. 3C: The antisense nucleotide sequence of A41 (SEQ ID NO: 9);
[0086]FIG. 4A: Sense nucleotide sequence of A42 (SEQ ID NO: 10). The coding region starts from the first nucleotide and ends at the last nucleotide;
[0087]FIG. 4B: The amino acid sequence of A42 (SEQ ID NO: 1);
[0088]FIG. 4C: The antisense nucleotide sequence of A42 (SEQ ID NO: 12);
[0089]FIG. 5A: Sense nucleotide sequence of A43 (SEQ ID NO: 13). The coding region starts from the first nucleotide and ends at the last nucleotide;
[0090]FIG. 5B: The amino acid sequence of A43 (SEQ ID NO: 14);
[0091]FIG. 5C: The antisense nucleotide sequence of A43 (SEQ ID NO: 15);
[0092]FIG. 6A: Sense nucleotide sequence of A911 (SEQ ID NO: 16). The coding region starts from the first nucleotide and ends at the last nucleotide;
[0093]FIG. 6B: The amino acid sequence of A911 (SEQ ID NO: 17);
[0094]FIG. 6C: The antisense nucleotide sequence of A911 (SEQ ID NO: 18);
[0095]FIG. 7A: Sense nucleotide sequence of A119 (SEQ ID NO: 19). The coding region starts from the first nucleotide and ends at the last nucleotide;
[0096]FIG. 7B: The amino acid sequence of A119 (SEQ ID NO: 20);
[0097]FIG. 7C: The antisense nucleotide sequence of A119 (SEQ ID NO: 21);
[0098]FIG. 8A: Sense nucleotide sequence of A233 (SEQ ID NO: 22). The coding region starts from the first nucleotide and ends at the last nucleotide;
[0099]FIG. 8B: The amino acid sequence of A233 (SEQ ID NO: 23);
[0100]FIG. 8C: The antisense nucleotide sequence of A233 (SEQ ID NO: 24);
[0101]FIG. 9A: Sense nucleotide sequence of A407 (SEQ ID NO: 25). The coding region starts from the first nucleotide and ends at the last nucleotide;
[0102]FIG. 9B: The amino acid sequence of A407 (SEQ ID NO: 26);
[0103]FIG. 9C: The antisense nucleotide sequence of A407 (SEQ ID NO: 27);
[0104]FIG. 10A: Sense nucleotide sequence of A961 (SEQ ID NO: 28). The coding region starts from the first nucleotide and ends at the last nucleotide;
[0105]FIG. 10B: The amino acid sequence of A961 (SEQ ID NO: 29);
[0106]FIG. 10C: The antisense nucleotide sequence of A961 (SEQ ID NO: 30);
[0107]FIG. 11A: Sense nucleotide sequence of A962 (SEQ ID NO: 31). The coding region starts from the first nucleotide and ends at the last nucleotide;
[0108]FIG. 11B: The amino acid sequence of A962 (SEQ ID NO: 32);
[0109]FIG. 11C: The antisense nucleotide sequence of A962. (SEQ ID NO: 33);
[0110]FIG. 12: The sense nucleotide sequence of UGT71B5 (SEQ ID NO: 34);
[0111]FIG. 13 The sense nucleotide sequence of UGT71C3 (SEQ ID NO: 35);
[0112]FIG. 14 The sense nucleotide sequence of UGT71C5 (SEQ ID NO: 36);
[0113]FIG. 15 The sense nucleotide sequence of UGT71D1 (SEQ ID NO: 37);
[0114]FIG. 16 The sense nucleotide sequence of UGT73B1 (SEQ ID NO: 38);
[0115]FIG. 17 The sense nucleotide sequence of UGT73B2 (SEQ ID NO: 39);
[0116]FIG. 18 The sense nucleotide sequence of UGT73B4 (SEQ ID NO: 40);
[0117]FIG. 19 The sense nucleotide sequence of UGT73B5 (SEQ ID NO: 41);
[0118]FIG. 20 The sense nucleotide sequence of UGT73C1 (SEQ ID NO: 42);
[0119]FIG. 21 The sense nucleotide sequence of UGT731C (SEQ ID NO: 43);
[0120]FIG. 22 The sense nucleotide sequence of UGT73C5 (SEQ ID NO: 44);
[0121]FIG. 23 The sense nucleotide sequence of UGT73C6 (SEQ ID NO: 45);
[0122]FIG. 24 The sense nucleotide sequence of UGT73C7 (SEQ ID NO: 46);
[0123]FIG. 25 The sense nucleotide sequence of UGT74F2 (SEQ ID NO: 47);
[0124]FIG. 26 The sense nucleotide sequence of UGT76E1 (SEQ ID NO: 48);
[0125]FIG. 27 The sense nucleotide sequence of UGT76E11 (SEQ ID NO: 49);
[0126]FIG. 28 The sense nucleotide sequence of UGT76E12 (SEQ ID NO: 50);
[0127]FIG. 29 The sense nucleotide sequence of UGT76E2 (SEQ ID NO: 51);
[0128]FIG. 30 The sense nucleotide sequence of UGT78D1 (SEQ ID NO: 52);
[0129]FIG. 31 The sense nucleotide sequence of UGT89B1 (SEQ ID NO: 53);
[0130]FIG. 32 The sense nucleotide sequence of UGT72B3 (SEQ ID NO: 54);
[0131]FIG. 33 shows recombinant GST-UGT71C1 fusion protein purified from E. coli using glutathione-coupled Sepharose. The protein (5 μg) was analyzed using 10% SDS-PAGE and was visualized with Coomassive staining;
[0132]FIG. 34 shows three different glucose conjugates of caffeic acid, (caffeoyl-3-O-glucoside, caffeoyl-4-O-glucoside and 1-O-caffeoylglucose), obtained from the glucosyltransferase reactions containing the recombinant UGT71C1, UGT73B3 and UGT84A1 respectively. Each assay contained 1-2 μg of recombinant UGT, 1 mM caffeic acid, 5 mM UDP-glucose, 1.4 mM 2-mercaptoethanol and 50 mM TRIS-HCl, pH 7.0. The mix was incubated at 30° C. for 30 min and was analyzed by reverse-phase HPLC subsequently. Linear gradient (10-16%) of acetonitrile in H2O at 1 ml/min over 20 min was used to separate the glucose conjugates from caffeic acid.
[0133]FIG. 35A shows the pH optima of UGT71C1 glucosyltransferase activity measured over the range pH 5.5-8.0 in the reactions containing 50 mM buffer, 1 μg of UGT71C1, 1 mM caffeic acid, 5 mM UDP-glucose and 1.4 mM 2-mercaptoethanol. The mix was incubated at 30° C. for 30 min. The reaction was stopped by the addition of 20 μl of trichloroacetic acid (240 mg/ml) and was analyzed by reverse-phase HPLC subsequently. The specific enzyme activity was expressed as nanomoles of caffeic acid glucosylated per second (nkat) by 1 mg of protein in 30 min of reaction time at 30° C. FIG. 35B, the time course of UGT71C1 glucosyltransferase activity was studied by measuring the amount of caffeic acid glucosylated by 1 μg of UGT71C1 in 50 mM TRIS-HCll, pH 7.0. The reactions were carried out and analyzed as described in A;
[0134]FIG. 36 shows UGT71C1 transgenic Arabidopsis thaliana plants and their ability to glucosylate caffeic acid; and
[0135]FIG. 37 summarises the GTase activities of various GTase polypeptides with respect to various anti-oxidant substrates.
EXAMPLES
Materials and Methods
Transformation of Woody Plant Species
[0136]The transformation of woody plant species is known in the art. See U.S. Pat. No. 4,795,855 and WO9118094; EP1050209 and WO9725434. Each of these patents are incorporated in their entirety by reference.
Transformation of Non-Woody Plant Species
[0137]Methods used in the transformation of plant species other than woody species are well known in the art and are extensively referenced herein.
Identification of GTase sequences
[0138]The GTase sequence identification was carried out using GCG software (Wisconsin package, version 8.1). Blasta programme was used to search Arabidopsis protein sequences containing a PSPG (plant secondary product UDP-glucose glucosyltransferase) signature motif (Hughes and Hughes (1994) DNA Sequence 5, 41-49) in EMBL and GenBank sequence database. The database information on the GTases described in the present invention are listed in Table 1.
Amplification and Cloning of the GTase Sequences
[0139]The GTase sequences were amplified from Arabidopsis thaliana Columbia genomic DNA with specific primers (Table 2), following standard methodologies (Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). 50 ng of genomic DNA isolated from Arabidopsis thaliana Columbia were incubated with 1× pfu PCR buffer (Stratagene), 250 μM dNTPS, 50 pmole primer for each end, and 5 units of pfu DNA polymerase (Stratagene) in a total of 100 μl. The PCR reactions were carried out as outlined in the programme described in Table 3.
[0140]After PCR amplification, the products were double digested by appropriate restriction enzymes listed in Table 2 (bold type). The digested DNA fragments were purified using an electro-eluction method (Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) and ligated into the corresponding cloning site on pGEX2T plasmid DNA (Pharmacia) by T4 DNA ligase (NEB) at 16° C. overnight. The resulting recombinant plasmid DNA was amplified in E. coli XL1-blue cells and was confirmed with the restriction enzymes listed in Table 2 (bold type) following the method described by Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Habor Laboratory, Cold Spring Harbor, N.Y.).
Preparation of Glucosyltransferase Recombinant Proteins
[0141]E. coli cells carrying recombinant plasmid DNA as described above were grown at 37° C. overnight on 2YT (16 g bacto tryptone, 10 g bacto-yeast extract, 5 g NaCl per litre) agar (1.8% w/v) plate which contained 50 μg/ml ampicillin. A single colony was picked into 2 ml of 2YT containing the same concentration of ampicillin. The bacterial culture was incubated at 37° C. with moderate agitation for 6 h. The bacterial culture was transferred into 1 L of 2YT and incubated at 20° C. subsequently. 0.1 mM IPTG was added when the culture reached logarithmic growth phase (A 600 nm 0.5). The bacterial culture was incubated for another 24 h. The cells were collected by a centrifugation at 7,000×g for 5 min at 4° C. and resuspended in 5 ml spheroblast buffer (0.5 mM EDTA, 750 mM sucrose, 200 mM Tris, pH 8.0). Lysozyme solution was added to a final concentration of 1 mg/ml. 7-fold volume of 0.5× spheroblast buffer was poured into the suspension immediately and the suspension was incubated for 4° C. for 30 min under gentle shaking. The spheroblasts were collected by a centrifugation at 12,000×g for 5 min at 4° C., and resuspended in 5 ml ice cold PBL buffer (140 mM NaCl, 80 mM, NA2 HPO4, 15 mM KH2PO4). 2 mM of PMSF was added into suspension immediately and the suspension was centrifuged at 12,000×g for 20 min at 4° C. in order to remove the cell debris. After the centrifugation, the supernatant was transferred to a 15 ml tube. 200 μl of 50% (v/v) slurry of Glutathione-coupled Sepharose 4B were added into the tube and the mixture was mixed gently for 30 min at room temperature. The mixture was then centrifuged at a very slow speed (500×g) for 1 min. the supernatant was discarded. The beads were washed with 5 ml ice cold PBS buffer three times. After each wash, a short centrifugation was applied as described above to sediment the Sepharose beads. To recover the expressed protein from Sepharose beads, 100 μl of 20 mM reduced glutathione were used to resuspend the beads. After 10 min incubation at room temperature, the beads were collected and the supernatant containing the expressed protein was collected. The elution step was repeated once, and both supernatant fractions were combined and stored at 4° C. for protein assay and further studies.
Protein Concentration Assay
[0142]The protein assays were carried out by adding 10 μl of protein solution into 900 μl of distilled water and 200 μl of Bio-Rad Protein Assay Dye. The absorbance at 595 nm was read. A series of BSA (bovine serium albumin) at different concentration was used as standard. Regression line was plotted based on the coordinates of the BSA concentration against the reading at 595 nm. The concentration of protein sample was therefore estimated from the regression line after the protein assay.
Assay for Enzyme Activity
[0143]A standard glucosylation reaction was set up by mixing 2 μg of recombinant proteins with 14 mM 2-mercaptoethanol, 5 mM UDP-glucose, 1 mM of various lignin or antioxidant substrate, 100 mM Tris, pH 7.0, to a total volume of 200 μl. The reaction was carried out at 30° C. for 30 min and stopped by the addition of 20 μl trichloroacetic acid (240 mg/ml). All the samples were stored at -20° C. before the liquid chromatographic assay.
High-Performance Liquid Chromatographic
[0144]Reverse-phase HPLC (Waters Separator 2690 and Waters Tunable Absorbance Detector 486, Waters Limited, Herts, UK) using a Columbus 5μ C18 column (250×4.60 mm, Phenomenex). Linear gradient of acetonitrile in H2O (all solutions contained 0.1% trifluoroacetic acid) at 1 ml/min over 20 min, was used to separate the glucose conjugates from their aglycone. The HPLC methods were described as the following: cinnamic acid, λ288 nm, 10-55% acetonitrile; p-coumaric acid, λ311 nm, 10-25% acetonitrile; caffeic acid, λ311 nm, 10-16% acetonitrile; ferulic acid, λ311 nm, 10-35% acetonitrile; sinapic acid, λ306 nm, 10-40% acetonitrile; p-coumaryl aldehyde, λ315 nm, 10-46% acetonitrile; coniferyl aldehyde, λ283 nm, 10-47% acetonitrile; sinapyl aldehyde, λ280 nm, 10-47% acetonitrile; p-coumaryl alcohol, p283 nm, 10-27% acetonitrile; coniferyl alcohol, λ306 nm, 10-25% acetonitrile; sinapyl alcohol, λ285 nm, 10-25% acetonitrile. The retention time (Rt) of the glucose conjugates analysed is listed in the following: cinnamoylglucose, Rt=12.3 min; p-coumaroylglucose, Rt=10.6 min; caffeoylglucose, Rt=8.5 min; feruloylglucose, Rt=10.3 min; sinapoylglucose, Rt=9.7 min; caffeoyl-4-O-glucoside, Rt=6.8 min; feruloyl-4-O-glucoside, Rt=7.8 min; sinapoyl-4-O-glucoside, Rt=8.2 min; coniferin, Rt=8.2 min; syringin, Rt=9.1 min.
[0145]The recombinant GTases were shown to have GTase activity towards the major intermediates of the lignin biosynthesis pathway (Tables 5 and 6). It is clear from these results that the GTases display different specific activity reaction profiles relative to each other on the various lignin precursor substrates utilised. Michaelis-Menten kinetics were also studied on several of the GTases against their preferred substrates (Tables 7 and 8). It is clear from these results that the GTases display different enzyme kinetics for different substrates.
[0146]The results (in total) indicate that certain GTases show a greater potential for use in the alteration of lignin biosynthesis inplanta than others.
Reducing the Formation of Monolignol Glucosides In Planta
[0147]In one approach to reduce the formation of monolignol glucosides in planta, A119 and A407 are down regulated using an antisense strategy (A). Expression of the A119 and A407 antisense sequences is driven by the gene's own promoter. An alternative approach (B) is to modify the UDP-glucose binding motif through an in vitro mutagenesis method (Lim et al., 1998) such that the mutant protein is able to bind the monolignol substrates but loses its catalytic activity. Such mutant proteins are thought to compete with the functional native protein by binding specifically to monolignols, thereby reducing the formation of monolignol glucosides.
Anti-Sense Approach
Amplification and Cloning of the A119 and A407 Promoter Sequences
[0148]Approximately 2 kb of the 5' flanking sequences of A119 and A407 are amplified directly from genomic DNA by PCR. The promoter fragments are then cloned into a pBluescript plasmid vector (Sambrook et al., 1989).
Construct Chimaeric Genes of A119 and A407 Promoter and Their ORF Region in Antisense Orientation.
[0149]The A119 and A407 cDNA fragments are amplified from pGEXA119 and pGEXA407 by PCR. The fragments are then ligated correspondingly into the A119 and A407 promoter constructs described in (A)-(1) with the ORF region in the antisense orientation.
Preparation of Binary Construct Containing the A119 and A407 Antisense Chimaeric Gene
[0150]The DNA fragments containing the A119 and A407 antisense chimaeric genes are amplified by PCR from the chimaeric constructs described in (A)-(2). The fragments are then ligated into a binary vector (Sambrook et al., 1989). The final constructs are transformed into plants subsequently.
Mutant Gene Approach
In Vitro Site Mutagenesis to Modify the UDPglucose Binding Motif in A119 and A407
[0151]In vitro site mutagenesis is carried by PCR to modify the sequences encoding the UDPglucose binding motif in A119 and A407 (Lim et al., 1998). The constructs pGEXA119 and pGEXA407 are used in the DNA templates in the PCR reaction.
Construct Chimaeric Mutant Genes Regulated by A119 and A407 Promoters
[0152]The A119 and A407 mutant genes are amplified from the pGEXA119 and pGEXA407 mutant constructs described in (B)-(1) by PCR. The A119 and A407 mutant gene fragments are then ligated into the A119 and A407 promoter constructs described in (A)-(1) with the ORF region in the sense orientation.
Preparation of Binary Construct Containing the Chimaeric Mutant Genes A119 and A407
[0153]The DNA fragments containing the A119 and A407 mutant chimaeric genes are amplified by PCR from the chimaeric constructs described in (B)-(2). The fragments are then ligated into a binary vector (Sambrook et al., 1989). The final constructs are transformed into plants subsequently.
Enhancing the Formation of Monolignol Glucosides in Planta
[0154]The CaMV 35S promoter fragment is used to drive the expression of A119 and A497. DNA fragments containing A119 and A407 ORF sequences are amplified from pGEXA119 and pGEXA407 correspondingly by PCR. The DNA fragments are ligated downstream of the CaMV 35S promoter. The constructs are used to transform plants such that the lignin content and composition is altered.
TABLE-US-00001 TABLE 1 Database information on eleven Arabidopsis GTase genes Gene Database BAC/P1 gene name in name protein_id chromosome acc. no. clone database A062 Gi|3935156 I ac005106 T25N20 T25N20.20 A320 Not annotated III ab019232 MIL23 not annotated A41 Emb|CAB10326.1 IV z97339 FCA4 d13780c A42 Emb|CAB10327.1 IV z97339 FCA4 d13785c A43 Emb|CAB10328.1 IV z97339 FCA4 d13790c A911 Gi|2642451 II ac002391 T20D16 T20D16.11 A119 Not annotated V ab018119 MSN2 not annotated A233 Wrongly annotated IV al021961 F28A23 wrongly annotated A407 Gi|3319344 V af077407 F9D12 F9D12.4 A961 Gi|3582329 II ac005496 T27A16 T27A16.15 A962 Gi|3582341 II ac005496 T27A16 T27A16.16
[0155]Parameters used for the search of the above Arabidopsis sequences and the programme used are as follows:
NETBLAST with the default settings:
Infile2=nr
Matrix=Blosum 62
Translate=1
Dbtranslate=1
TABLE-US-00002 [0156]TABLE 2 DNA sequences and restriction enzyme sites in primers used in amplification of 11 Arabidopsis Gtase sequences from genomic DNA. Sequence complementary to either end of the ORFs are under- lined. Restriction enzyme sites that were used in making expression constructs were in BOLD type. restriction primer DNA sequence (5'→3') enzyme sites A062 5' CGGGTGATCAGGTACCATGGCGCCACCGCATTTTC BclI and KpnI SEQ ID NO: 55 A062 3' CGGAATTCGTCGAGTTACTTTACTTTTACCTCCTC EcoRI and SalI SEQ. ID NO: 56 A320 5' CCCCCGGGTACCATGGAGCTAGAATCTTCTCTCC SmaI and KpnI SEQ. ID NO: 57 A320 3' CGGAATTCTCGAGTTAAAAGGTTTTGATTGATCC EcoRI and XhoI SEQ. ID NO: 58 A41 5' TGGGATCCATATCAGAAATGGTGTTC BamHI SEQ. ID NO: 59 A41 3' GGGAATTCCTAGTATCCATTATCTTTAGTC EcoRI SEQ. ID NO: 60 A42 5' GGGGATCCATGGACCCGTCTCGTCATACTC BamHI SEQ. ID NO: 61 A42 3' GGGAATTCCACTAGTGTTCTCCGTTGTCTTC EcoRI SEQ. ID NO: 62 A43 5' GGGGATCCAATATGGAGATGGAATCGTCGTTAC BamHI SEQ. ID NO: 63 A43 3' GGGAATTCCTTACACGACATTATTAATGTTTG EcoRI SEQ. ID NO: 64 A911 5' GGGGTACCTGATCAATAATGGGCAGTAGTGAGGG KpnI and BclI SEQ. ID NO: 65 A911 3' CGGAATTCGTCGACGAGTTAGGCGATTGTGATATC EcoRI and SalI SEQ. ID NO: 66 A119 5' CGGGATCCGGTACCATGCATATCACAAAACCACAC BamHI and KpnI SEQ. ID NO: 67 A119 3' CGGAATTCGCTAGCTAAGCACCACGTGACAAGTCC EcoRI and NheI SEQ. ID NO: 68 A233 5' CGGGATCCGGTACCATGAGTAGTGATCCTCATCGT BamHI and KpnI SEQ. ID NO: 69 A233 3' CGGGATCCGAATTCTAGGAGGTAAACTCTTCTATG BamHI and SEQ. ID NO: 70 EcoRI A407 5' CGGGATCCGGTACCATGCATATCACAAAACCACAC BamHI and KpnI SEQ. ID NO: 71 A407 3' CGGAATTCGTCGACCTAAGCACCACGTCCCAAG EcoRI and SalI SEQ. ID NO: 72 A961 5' GGGTGATCAGGTACCATGGGGAAGCAAGAAGATG BclI and KpnI SEQ. ID NO: 73 A961 3' CGGAATTCGTCGACTACTTACTTATAGAAACGCCG EcoRI and SalI SEQ. ID NO: 74 A962 5' GAAGATCTGGTACCATGGCGAAGCAGCAAGAAG BglII and KpnI SEQ. ID NO: 75 A962 3' CGGAATTCGTCGACCGATGAAAGCCCATCTATG EcoRI and SalI SEQ. ID NO: 76
TABLE-US-00003 TABLE 3 PCR programme Stage I (1 cycle) Stage II (40 cycles) Stage III (1 cycle) 95° C. 5 min 95° C. 1 min 95° C. 2 min 55° C. 2 min 55° C. 1 min 55° C. 2 min 72° C. 3 min 72° C. 2 min 72° C. 5 min
TABLE-US-00004 TABLE 4 The HPLC conditions Detector Acetonitrile Wavelength Lignin Precursors Gradient (%) (nm) cinnamic acid 10-55 288 p-coumaric acid 10-25 311 caffeic acid 10-16 311 ferulic acid 10-35 311 sinapic acid 10-40 306 p-coumaryl aldehyde 10-46 315 coniferyl aldehyde 10-47 283 sinapyl aldehyde 10-47 280 p-coumaryl alcohol 10-27 283 coniferyl alcohol 10-25 306 sinapyl alcohol 10-25 285
TABLE-US-00005 TABLE 5 Specific activity of the recombinant GTases producing glucose ester against lignin precursors Each assay contained 0.5 mquadrature of potential substrates, 5 mM UDPG and 0.2 μg of recombinant GTases in a total volume of 200 μl. The reactions were incubated at 20° C. for 30 min and were stopped by addition of 20 μl TCA (240 mg/ml). Each reaction mix was then analysed using HPLC. The specific activity (nkat/mg) of the recombinant GTase is defined as the amount of substrate (nmole) converted to glucose ester per second by 1 mg of protein at 20° C. under the reaction conditions. A41 A320 A42 A43 A911 A062 Cinnamic acid 0.30 0.06 14.21 0.02 8.77 1.62 p-coumaric acid 13.53 0.05 4.69 0.03 4.31 2.54 Caffeic acid 2.61 0.05 0.62 0.01 0.77 0.26 Ferulic acid 6.64 0.54 15.63 0.04 2.88 0.08 Sinapic acid 5.35 15.58 11.97 0.05 0.15 0.1
TABLE-US-00006 TABLE 6 Specific activity of the recombinant GTases producing O-glucosides against lignin precursors The reactions were set up following the conditions described in Table 1. All the reactions, except those containing the aldehydes, were stopped by the addition of TCA. The aldehyde assay mixs were injected into HPLC immediately after the reactions were completed. The specific activity (nkat/mg) of the recombinant GTase is defined as the amount of substrate (nmole) converted to 4-O-glucoside per second by 1 mg of protein at 30° C. under the reaction conditions. A233 A119 A407 A961 A962 Cinnamic acid NDa ND ND ND ND p-coumaric acid 0.09 0.02 0.01 0.01 0.01 caffeic acid 0.48 0.13 0.07 0.07 ND ferulic acid 0.37 14.48 0.25 ND ND sinapic acid 0.39 102.56 65.39 0.01 0.01 p-coumaryl aldehyde ND 0.03 ND 0.01 0.02 Coniferyl aldehyde ND 1.08 ND 0.16 0.34 sinapyl aldehyde ND 4.55 ND 0.57 0.50 p-coumaryl alcohol ND ND ND ND ND Coniferyl alcohol 0.46 67.53 2.78 0.57 0.49 sinapyl alcohol 0.05 126.16 114.76 0.35 0.45 aND, not detected
TABLE-US-00007 TABLE 7 Kinetic studies on the recombinant GTases producing glucose esters against lignin precursors A41 A320 A42 A911 A062 Km Vmax Km Vmax Km Vmax Vmax Vmax MM nkat/mg mM nkat/mg mM nkat/mg Km mM nkat/mg Km mM nkat/mg 1.51 -- 1.80 -- 0.72 -- 1.05 -- 2.36 -- -- -- -- -- 0.49 19.42 0.05 9.06 4.33 2.87 0.10 16.13 -- -- 0.40 6.67 0.39 11.10 5.05 4.91 0.06 20.24 -- -- 0.20 1.67 0.23 1.18 -- -- 0.35 11.35 -- -- 0.36 18.35 0.34 6.91 -- -- 0.24 6.78 0.06 8.37 0.13 12.80 -- -- -- --
TABLE-US-00008 TABLE 8 Kinetic studies on the recombinant GTases producing O-glucosides against lignin precursors A119 A407 Km Vmax Km Vmax mM nkat/mg mM nkat/mg UDPG 0.93 -- 0.89 -- ferulic acid 0.25 18.87 -- -- sinapic acid 0.51 131.58 0.14 75.19 coniferyl 0.26 92.59 -- -- alcohol sinapyl alcohol 1.10 322.58 1.07 357.10
TABLE-US-00009 TABLE 9 1H and 13C NMR spectra were recorded in deuterated methanol at 500 MHz and 125 MHz respectively. Chemical shifts are given on δ scale with TMS as internal standard. The position on the aromatic ring begins with the carbon joining the propanoic acid. d, doublet; dd, doublet of doublets; m, multiplet; J, coupling constant. Caffeic acid Caffeoyl-3-O-glucoside Position δH δC δH δC C1 -- 128.1 -- 127.6 C2 7.02 (1H, d, J = 2.0 Hz) 115.2 7.47 (1H, d, J = 2.0 Hz) 117.0 C3 -- 146.7 -- 146.0 C4 -- 149.4 -- 150.6 C5 6.77 (1H, d, J = 8.0 Hz) 116.6 6.84 (1H, d, J = 8.5 Hz) 117.8 C6 6.92 (1H, dd, J = 8.0, 2.0 Hz) 122.8 7.13 (1H, dd, J = 8.5, 2.0 Hz) 125.6 C7 7.53 (1H, d, J = 16.0 Hz) 146.9 7.45 (1H, d, J = 14.5 Hz) 146.6 C8 6.21 (1H, d, J = 15.5 Hz) 116.3 6.33 (1H, d, J = 14.5 Hz) 116.1 C9 -- 171.5 -- 170.4 Glc-1 ~4.86 (signal interrupted) 103.9 Glc-2 74.5 Glc-3 78.0 Glc-4 {close oversize brace} 3.40-3.50 (4H, m) 71.0 Glc-5 77.2 Glc-6 3.93 (1H, dd, J = 12.0, 2.0 Hz) 62.4 3.71 (1H, dd, J = 12.0, 5.5 Hz)
TABLE-US-00010 TABLE 10 Each assay contained 1 quadratureg of UGT71C1, 1 mM phenolic compound, 5 mM UDP-glucose, 1.4 mM 2-mercaptoethanol and 50 mM TRIS-HCl, pH 7.0. The mix was incubated at 30° C. for 30 min. The reaction was stopped by the addition of 20 quadraturel of trichloroacetic acid (240 mg/ml) and was analysed by reverse-phase HPLC subsequently. The results represent the mean of three replicates ± standard deviation. Specific activity Substrate nkat/mg o-Coumaric acid 1.5 ± 0.2 m-Coumaric acid 1.2 ± 0.2 p-Coumaric acid 0 Caffeic acid 2.9 ± 0.8 Ferulic acid 0 Sinapic acid 0 Esculetin 34.8 ± 4.2 Scopoletin 29.4 ± 3.9 Salicylic acid 0 4-hydroxybenzoic acid 0 3,4-dihydroxybenzoic acid 0 Eriodictyol 0 Luteolin 0.7 ± 0.1 Quercetin 1.4 ± 0.4 Catechin 0 Cyanidin 0
Sequence CWU
1
7611410DNAArabidopsis thaliana 1atggcgccac cgcattttct actggtaacg
tttccggcgc aaggtcacgt gaacccatct 60ctccgttttg ctcgtcggct catcaaaaga
accggcgcac gtgtcacttt cgtcacttgt 120gtctccgtct tccacaactc catgatcgca
aaccacaaca aagtcgaaaa tctctctttc 180cttactttct ccgacggttt cgacgatgga
ggcatttcca cctacgaaga ccgtcagaaa 240aggtcggtga atctcaaggt taacggcgat
aaggcactat cggatttcat cgaagctact 300aagaatggtg actctcccgt gacttgcttg
atctacacga ttcttctcaa ttgggctcca 360aaagtagcac gtagatttca acttccctcc
gctcttctct ggatccaacc ggctttggtt 420ttcaacatct attacactca tttcatggga
aacaagtccg ttttcgagtt acctaatctg 480tcttctctgg aaatcagaga tcttccatct
ttcctcacac cttccaacac aaacaaaggc 540gcatacgatg cgtttcaaga aatgatggag
tttctcataa aagaaaccaa accgaaaatt 600ctcatcaaca ctttcgattc gctggaacca
gaggccttaa cggctttccc gaatatcgat 660atggtggcgg ttggtccttt acttcccacg
gagattttct caggaagcac caacaaatca 720gttaaagatc aaagtagtag ttatacactt
tggctagact cgaaaacaga gtcctctgtt 780atttacgttt cctttggaac aatggttgag
ttgtccaaga aacagataga ggaactagcg 840agagcactca tagaagggaa acgaccgttt
ttgtgggtta taactgataa atccaacaga 900gaaacgaaaa cagaaggaga agaagagaca
gagattgaga agatagctgg attcagacac 960gagcttgaag aggttgggat gattgtgtcg
tggtgttcgc agatagaggt tttaagtcac 1020cgagccgtag gttgttttgt gactcattgt
gggtggagct cgacgctgga gagtttggtt 1080cttggcgttc cggttgtggc gtttccgatg
tggtcggatc aaccgacgaa cgcgaagcta 1140ctggaagaaa gttggaagac tggtgtgagg
gtaagagaga acaaggatgg tttggtggag 1200agaggagaga tcaggaggtg tttggaagcc
gtgatggagg agaagtcggt ggagttgagg 1260gaaaacgcaa agaaatggaa gcgtttagcg
atggaagcgg gtagagaagg aggatcttcg 1320gataagaaca tggaggcttt tgtggaggat
atttgtggag aatctcttat tcaaaacttg 1380tgtgaagcag aggaggtaaa agtaaagtaa
14102469PRTArabidopsis thaliana 2Met Ala
Pro Pro His Phe Leu Leu Val Thr Phe Pro Ala Gln Gly His 1
5 10 15Val Asn Pro Ser Leu Arg Phe Ala
Arg Arg Leu Ile Lys Arg Thr Gly 20 25
30Ala Arg Val Thr Phe Val Thr Cys Val Ser Val Phe His Asn Ser
Met 35 40 45Ile Ala Asn His Asn
Lys Val Glu Asn Leu Ser Phe Leu Thr Phe Ser 50 55
60Asp Gly Phe Asp Asp Gly Gly Ile Ser Thr Tyr Glu Asp Arg
Gln Lys 65 70 75 80Arg
Ser Val Asn Leu Lys Val Asn Gly Asp Lys Ala Leu Ser Asp Phe
85 90 95Ile Glu Ala Thr Lys Asn Gly
Asp Ser Pro Val Thr Cys Leu Ile Tyr 100 105
110Thr Ile Leu Leu Asn Trp Ala Pro Lys Val Ala Arg Arg Phe
Gln Leu 115 120 125Pro Ser Ala Leu
Leu Trp Ile Gln Pro Ala Leu Val Phe Asn Ile Tyr 130
135 140Tyr Thr His Phe Met Gly Asn Lys Ser Val Phe Glu
Leu Pro Asn Leu145 150 155
160Ser Ser Leu Glu Ile Arg Asp Leu Pro Ser Phe Leu Thr Pro Ser Asn
165 170 175Thr Asn Lys Gly Ala
Tyr Asp Ala Phe Gln Glu Met Met Glu Phe Leu 180
185 190Ile Lys Glu Thr Lys Pro Lys Ile Leu Ile Asn Thr
Phe Asp Ser Leu 195 200 205Glu Pro
Glu Ala Leu Thr Ala Phe Pro Asn Ile Asp Met Val Ala Val 210
215 220Gly Pro Leu Leu Pro Thr Glu Ile Phe Ser Gly
Ser Thr Asn Lys Ser225 230 235
240Val Lys Asp Gln Ser Ser Ser Tyr Thr Leu Trp Leu Asp Ser Lys Thr
245 250 255Glu Ser Ser Val
Ile Tyr Val Ser Phe Gly Thr Met Val Glu Leu Ser 260
265 270Lys Lys Gln Ile Glu Glu Leu Ala Arg Ala Leu
Ile Glu Gly Lys Arg 275 280 285Pro
Phe Leu Trp Val Ile Thr Asp Lys Ser Asn Arg Glu Thr Lys Thr 290
295 300Glu Gly Glu Glu Glu Thr Glu Ile Glu Lys
Ile Ala Gly Phe Arg His305 310 315
320Glu Leu Glu Glu Val Gly Met Ile Val Ser Trp Cys Ser Gln Ile
Glu 325 330 335Val Leu Ser
His Arg Ala Val Gly Cys Phe Val Thr His Cys Gly Trp 340
345 350Ser Ser Thr Leu Glu Ser Leu Val Leu Gly
Val Pro Val Val Ala Phe 355 360
365Pro Met Trp Ser Asp Gln Pro Thr Asn Ala Lys Leu Leu Glu Glu Ser 370
375 380Trp Lys Thr Gly Val Arg Val Arg
Glu Asn Lys Asp Gly Leu Val Glu385 390
395 400Arg Gly Glu Ile Arg Arg Cys Leu Glu Ala Val Met
Glu Glu Lys Ser 405 410
415Val Glu Leu Arg Glu Asn Ala Lys Lys Trp Lys Arg Leu Ala Met Glu
420 425 430Ala Gly Arg Glu Gly Gly
Ser Ser Asp Lys Asn Met Glu Ala Phe Val 435 440
445Glu Asp Ile Cys Gly Glu Ser Leu Ile Gln Asn Leu Cys Glu
Ala Glu 450 455 460Glu Val Lys Val
Lys46531410DNAArabidopsis thaliana 3ttactttact tttacctcct ctgcttcaca
caagttttga ataagagatt ctccacaaat 60atcctccaca aaagcctcca tgttcttatc
cgaagatcct ccttctctac ccgcttccat 120cgctaaacgc ttccatttct ttgcgttttc
cctcaactcc accgacttct cctccatcac 180ggcttccaaa cacctcctga tctctcctct
ctccaccaaa ccatccttgt tctctcttac 240cctcacacca gtcttccaac tttcttccag
tagcttcgcg ttcgtcggtt gatccgacca 300catcggaaac gccacaaccg gaacgccaag
aaccaaactc tccagcgtcg agctccaccc 360acaatgagtc acaaaacaac ctacggctcg
gtgacttaaa acctctatct gcgaacacca 420cgacacaatc atcccaacct cttcaagctc
gtgtctgaat ccagctatct tctcaatctc 480tgtctcttct tctccttctg ttttcgtttc
tctgttggat ttatcagtta taacccacaa 540aaacggtcgt ttcccttcta tgagtgctct
cgctagttcc tctatctgtt tcttggacaa 600ctcaaccatt gttccaaagg aaacgtaaat
aacagaggac tctgttttcg agtctagcca 660aagtgtataa ctactacttt gatctttaac
tgatttgttg gtgcttcctg agaaaatctc 720cgtgggaagt aaaggaccaa ccgccaccat
atcgatattc gggaaagccg ttaaggcctc 780tggttccagc gaatcgaaag tgttgatgag
aattttcggt ttggtttctt ttatgagaaa 840ctccatcatt tcttgaaacg catcgtatgc
gcctttgttt gtgttggaag gtgtgaggaa 900agatggaaga tctctgattt ccagagaaga
cagattaggt aactcgaaaa cggacttgtt 960tcccatgaaa tgagtgtaat agatgttgaa
aaccaaagcc ggttggatcc agagaagagc 1020ggagggaagt tgaaatctac gtgctacttt
tggagcccaa ttgagaagaa tcgtgtagat 1080caagcaagtc acgggagagt caccattctt
agtagcttcg atgaaatccg atagtgcctt 1140atcgccgtta accttgagat tcaccgacct
tttctgacgg tcttcgtagg tggaaatgcc 1200tccatcgtcg aaaccgtcgg agaaagtaag
gaaagagaga ttttcgactt tgttgtggtt 1260tgcgatcatg gagttgtgga agacggagac
acaagtgacg aaagtgacac gtgcgccggt 1320tcttttgatg agccgacgag caaaacggag
agatgggttc acgtgacctt gcgccggaaa 1380cgttaccagt agaaaatgcg gtggcgccat
141041491DNAArabidopsis thaliana
4atggagctag aatcttctcc tcctctacct cctcatgtga tgctcgtatc ttttccaggg
60caaggccacg ttaatccact tcttcgtctt ggtaagctct tagcttcaaa gggtttgctc
120ataaccttcg tcaccactga gtcatggggc aaaaagatgc gaatctccaa caaaatccaa
180gaccgtgtcc tcaaaccggt tggtaaaggc tatctccggt atgatttctt cgacgacggg
240cttcctgaag acgacgaagc tagcagaacc aacttaacca tcctccgacc acatctagag
300ctggtcggca aaagagagat caagaacctt gtgaaacgtt acaaggaagt aacgaaacag
360cccgtgacat gtcttatcaa caaccctttc gtctcttggg tctgtgacgt ggcagaagat
420cttcaaatcc cttgtgctgt tctttgggtt caatcttgtg cctgcttagc tgcttattac
480tattaccacc acaacctagt tgacttcccg accaaaacag aacccgagat cgatgtccaa
540atctctggca tgcctctctt gaaacatgac gagatccctt ctttcattca cccttcaagt
600cctcactccg ctttgcgaga agtgatcata gatcagatta aacggcttca caagactttc
660tccattttca tcgacacttt caactcattg gagaaagaca tcattgacca catgtcgacg
720ctctctctcc ccggtgttat cagaccgcta ggaccactct acaaaatggc taaaaccgta
780gcttatgatg tcgttaaagt aaacatctct gagccaacgg atccttgcat ggagtggtta
840gactcgcagc cagtttcctc cgttgtttac atctcattcg ggaccgttgc ttacttgaaa
900caagaacaaa tagacgagat cgcttacggt gtgttaaacg ccgacgttac gttcttgtgg
960gtgattagac aacaagagtt aggtttcaac aaagagaaac atgttttgcc ggaagaagtt
1020aaagggaaag ggaagatcgt tgaatggtgt tcacaagaga aagtattatc tcatccttca
1080gtggcatgtt tcgtgactca ctgtggatgg aactcaacga tggaagctgt gtcttccgga
1140gtcccgacgg tttgttttcc tcaatgggga gatcaagtca cggacgccgt ttacatgatc
1200gatgtttgga agacgggagt gaggctaagc cgtggagagg cggaggagag gttagtgccg
1260agggaggaag ttgcggagag gttgagagag gttactaaag gagagaaagc gatcgagttg
1320aaaaagaatg ctttgaagtg gaaggaagag gcggaggcgg cggttgctcg cggtggttcg
1380tcggatagga atcttgaaaa gtttgtggag aagttgggtg ccaaacctgt ggggaaagta
1440caaaacggga gtcataatca tgtcttggct ggatcaatca aaagctttta a
14915496PRTArabidopsis thaliana 5Met Glu Leu Glu Ser Ser Pro Pro Leu Pro
Pro His Val Met Leu Val 1 5 10
15Ser Phe Pro Gly Gln Gly His Val Asn Pro Leu Leu Arg Leu Gly Lys
20 25 30Leu Leu Ala Ser Lys
Gly Leu Leu Ile Thr Phe Val Thr Thr Glu Ser 35
40 45Trp Gly Lys Lys Met Arg Ile Ser Asn Lys Ile Gln Asp
Arg Val Leu 50 55 60Lys Pro Val Gly
Lys Gly Tyr Leu Arg Tyr Asp Phe Phe Asp Asp Gly 65 70
75 80Leu Pro Glu Asp Asp Glu Ala Ser Arg
Thr Asn Leu Thr Ile Leu Arg 85 90
95Pro His Leu Glu Leu Val Gly Lys Arg Glu Ile Lys Asn Leu Val
Lys 100 105 110Arg Tyr Lys Glu
Val Thr Lys Gln Pro Val Thr Cys Leu Ile Asn Asn 115
120 125Pro Phe Val Ser Trp Val Cys Asp Val Ala Glu Asp
Leu Gln Ile Pro 130 135 140Cys Ala Val
Leu Trp Val Gln Ser Cys Ala Cys Leu Ala Ala Tyr Tyr145
150 155 160Tyr Tyr His His Asn Leu Val
Asp Phe Pro Thr Lys Thr Glu Pro Glu 165
170 175Ile Asp Val Gln Ile Ser Gly Met Pro Leu Leu Lys
His Asp Glu Ile 180 185 190Pro
Ser Phe Ile His Pro Ser Ser Pro His Ser Ala Leu Arg Glu Val 195
200 205Ile Ile Asp Gln Ile Lys Arg Leu His
Lys Thr Phe Ser Ile Phe Ile 210 215
220Asp Thr Phe Asn Ser Leu Glu Lys Asp Ile Ile Asp His Met Ser Thr225
230 235 240Leu Ser Leu Pro
Gly Val Ile Arg Pro Leu Gly Pro Leu Tyr Lys Met 245
250 255Ala Lys Thr Val Ala Tyr Asp Val Val Lys
Val Asn Ile Ser Glu Pro 260 265
270Thr Asp Pro Cys Met Glu Trp Leu Asp Ser Gln Pro Val Ser Ser Val
275 280 285Val Tyr Ile Ser Phe Gly Thr
Val Ala Tyr Leu Lys Gln Glu Gln Ile 290 295
300Asp Glu Ile Ala Tyr Gly Val Leu Asn Ala Asp Val Thr Phe Leu
Trp305 310 315 320Val Ile
Arg Gln Gln Glu Leu Gly Phe Asn Lys Glu Lys His Val Leu
325 330 335Pro Glu Glu Val Lys Gly Lys
Gly Lys Ile Val Glu Trp Cys Ser Gln 340 345
350Glu Lys Val Leu Ser His Pro Ser Val Ala Cys Phe Val Thr
His Cys 355 360 365Gly Trp Asn Ser
Thr Met Glu Ala Val Ser Ser Gly Val Pro Thr Val 370
375 380Cys Phe Pro Gln Trp Gly Asp Gln Val Thr Asp Ala
Val Tyr Met Ile385 390 395
400Asp Val Trp Lys Thr Gly Val Arg Leu Ser Arg Gly Glu Ala Glu Glu
405 410 415Arg Leu Val Pro Arg
Glu Glu Val Ala Glu Arg Leu Arg Glu Val Thr 420
425 430Lys Gly Glu Lys Ala Ile Glu Leu Lys Lys Asn Ala
Leu Lys Trp Lys 435 440 445Glu Glu
Ala Glu Ala Ala Val Ala Arg Gly Gly Ser Ser Asp Arg Asn 450
455 460Leu Glu Lys Phe Val Glu Lys Leu Gly Ala Lys
Pro Val Gly Lys Val465 470 475
480Gln Asn Gly Ser His Asn His Val Leu Ala Gly Ser Ile Lys Ser Phe
485 490
49561491DNAArabidopsis thaliana 6ttaaaagctt ttgattgatc cagccaagac
atgattatga ctcccgtttt gtactttccc 60cacaggtttg gcacccaact tctccacaaa
cttttcaaga ttcctatccg acgaaccacc 120gcgagcaacc gccgcctccg cctcttcctt
ccacttcaaa gcattctttt tcaactcgat 180cgctttctct cctttagtaa cctctctcaa
cctctccgca acttcctccc tcggcactaa 240cctctcctcc gcctctccac ggcttagcct
cactcccgtc ttccaaacat cgatcatgta 300aacggcgtcc gtgacttgat ctccccattg
aggaaaacaa accgtcggga ctccggaaga 360cacagcttcc atcgttgagt tccatccaca
gtgagtcacg aaacatgcca ctgaaggatg 420agataatact ttctcttgtg aacaccattc
aacgatcttc cctttccctt taacttcttc 480cggcaaaaca tgtttctctt tgttgaaacc
taactcttgt tgtctaatca cccacaagaa 540cgtaacgtcg gcgtttaaca caccgtaagc
gatctcgtct atttgttctt gtttcaagta 600agcaacggtc ccgaatgaga tgtaaacaac
ggaggaaact ggctgcgagt ctaaccactc 660catgcaagga tccgttggct cagagatgtt
tactttaacg acatcataag ctacggtttt 720agccattttg tagagtggtc ctagcggtct
gataacaccg gggagagaga gcgtcgacat 780gtggtcaatg atgtctttct ccaatgagtt
gaaagtgtcg atgaaaatgg agaaagtctt 840gtgaagccgt ttaatctgat ctatgatcac
ttctcgcaaa gcggagtgag gacttgaagg 900gtgaatgaaa gaagggatct cgtcatgttt
caagagaggc atgccagaga tttggacatc 960gatctcgggt tctgttttgg tcgggaagtc
aactaggttg tggtggtaat agtaataagc 1020agctaagcag gcacaagatt gaacccaaag
aacagcacaa gggatttgaa gatcttctgc 1080cacgtcacag acccaagaga cgaaagggtt
gttgataaga catgtcacgg gctgtttcgt 1140tacttccttg taacgtttca caaggttctt
gatctctctt ttgccgacca gctctagatg 1200tggtcggagg atggttaagt tggttctgct
agcttcgtcg tcttcaggaa gcccgtcgtc 1260gaagaaatca taccggagat agcctttacc
aaccggtttg aggacacggt cttggatttt 1320gttggagatt cgcatctttt tgccccatga
ctcagtggtg acgaaggtta tgagcaaacc 1380ctttgaagct aagagcttac caagacgaag
aagtggatta acgtggcctt gccctggaaa 1440agatacgagc atcacatgag gaggtagagg
aggagaagat tctagctcca t 149171473DNAArabidopsis thaliana
7atgggatcca tatcagaaat ggtgttcgaa acttgtccat ctccaaaccc aattcatgta
60atgctcgtct cgtttcaagg acaaggccac gtcaaccctc ttcttcgtct cggcaagtta
120attgcttcaa agggtttact cgttaccttc gttacaacgg agctttgggg caagaaaatg
180agacaagcca acaaaatcgt tgacggtgaa cttaaaccgg ttggttccgg ttcaatccgg
240tttgagttct ttgatgaaga atgggcagag gatgatgacc ggagagctga tttctctttg
300tacattgctc acctagagag cgttgggata cgagaagtgt ctaagcttgt gagaagatac
360gaggaagcga acgagcctgt ctcgtgtctt atcaataacc cgtttatccc atgggtctgc
420cacgtggcgg aagagttcaa cattccttgt gcggttctct gggttcagtc ttgtgcttgt
480ttctctgctt attaccatta ccaagatggc tctgtttcat tccctacgga aacagagcct
540gagctcgatg tgaagcttcc ttgtgttcct gtcttgaaga acgacgagat tcctagcttt
600ctccatcctt cttctaggtt cacgggtttt cgacaagcga ttcttgggca attcaagaat
660ctgagcaagt ccttctgtgt tctaatcgat tcttttgact cattggaaca agaagttatc
720gattacatgt caagtctttg tccggttaaa accgttggac cgcttttcaa agttgctagg
780acagttactt ctgacgtaag cggtgacatt tgcaaatcaa cagataaatg cctcgagtgg
840ttagactcga ggcctaaatc gtcagttgtc tacatttcgt tcgggacagt tgcatatttg
900aagcaagaac agatcgaaga gatcgctcac ggagttttga agtcgggttt atcgttcttg
960tgggtgatta gacctccacc acacgatctg aaggtcgaga cacatgtctt gcctcaagaa
1020cttaaagaga gtagtgctaa aggtaaaggg atgattgtgg attggtgccc acaagagcaa
1080gtcttgtctc atccttcagt ggcatgcttc gtgactcatt gtggatggaa ctcgacaatg
1140gaatctttgt cttcaggtgt tccggtggtt tgttgtccgc aatggggaga tcaagtgact
1200gatgcagtgt atttgatcga tgttttcaag accggggtta gactaggccg tggagcgacc
1260gaggagaggg tagtgccaag ggaggaagtg gcggagaagc ttttggaagc gacagttggg
1320gagaaggcag aggagttgag aaagaacgct ttgaaatgga aggcggaggc ggaagcagcg
1380gtggctccag gaggttcgtc ggataagaat tttagggagt ttgtggagaa gttaggtgcg
1440ggagtaacga agactaaaga taatggatac tag
14738484PRTArabidopsis thaliana 8Met Val Phe Glu Thr Cys Pro Ser Pro Asn
Pro Ile His Val Met Leu 1 5 10
15Val Ser Phe Gln Gly Gln Gly His Val Asn Pro Leu Leu Arg Leu Gly
20 25 30Lys Leu Ile Ala Ser
Lys Gly Leu Leu Val Thr Phe Val Thr Thr Glu 35
40 45Leu Trp Gly Lys Lys Met Arg Gln Ala Asn Lys Ile Val
Asp Gly Glu 50 55 60Leu Lys Pro Val
Gly Ser Gly Ser Ile Arg Phe Glu Phe Phe Asp Glu 65 70
75 80Glu Trp Ala Glu Asp Asp Asp Arg Arg
Ala Asp Phe Ser Leu Tyr Ile 85 90
95Ala His Leu Glu Ser Val Gly Ile Arg Glu Val Ser Lys Leu Val
Arg 100 105 110Arg Tyr Glu Glu
Ala Asn Glu Pro Val Ser Cys Leu Ile Asn Asn Pro 115
120 125Phe Ile Pro Trp Val Cys His Val Ala Glu Glu Phe
Asn Ile Pro Cys 130 135 140Ala Val Leu
Trp Val Gln Ser Cys Ala Cys Phe Ser Ala Tyr Tyr His145
150 155 160Tyr Gln Asp Gly Ser Val Ser
Phe Pro Thr Glu Thr Glu Pro Glu Leu 165
170 175Asp Val Lys Leu Pro Cys Val Pro Val Leu Lys Asn
Asp Glu Ile Pro 180 185 190Ser
Phe Leu His Pro Ser Ser Arg Phe Thr Gly Phe Arg Gln Ala Ile 195
200 205Leu Gly Gln Phe Lys Asn Leu Ser Lys
Ser Phe Cys Val Leu Ile Asp 210 215
220Ser Phe Asp Ser Leu Glu Gln Glu Val Ile Asp Tyr Met Ser Ser Leu225
230 235 240Cys Pro Val Lys
Thr Val Gly Pro Leu Phe Lys Val Ala Arg Thr Val 245
250 255Thr Ser Asp Val Ser Gly Asp Ile Cys Lys
Ser Thr Asp Lys Cys Leu 260 265
270Glu Trp Leu Asp Ser Arg Pro Lys Ser Ser Val Val Tyr Ile Ser Phe
275 280 285Gly Thr Val Ala Tyr Leu Lys
Gln Glu Gln Ile Glu Glu Ile Ala His 290 295
300Gly Val Leu Lys Ser Gly Leu Ser Phe Leu Trp Val Ile Arg Pro
Pro305 310 315 320Pro His
Asp Leu Lys Val Glu Thr His Val Leu Pro Gln Glu Leu Lys
325 330 335Glu Ser Ser Ala Lys Gly Lys
Gly Met Ile Val Asp Trp Cys Pro Gln 340 345
350Glu Gln Val Leu Ser His Pro Ser Val Ala Cys Phe Val Thr
His Cys 355 360 365Gly Trp Asn Ser
Thr Met Glu Ser Leu Ser Ser Gly Val Pro Val Val 370
375 380Cys Cys Pro Gln Trp Gly Asp Gln Val Thr Asp Ala
Val Tyr Leu Ile385 390 395
400Asp Val Phe Lys Thr Gly Val Arg Leu Gly Arg Gly Ala Thr Glu Glu
405 410 415Arg Val Val Pro Arg
Glu Glu Val Ala Glu Lys Leu Leu Glu Ala Thr 420
425 430Val Gly Glu Lys Ala Glu Glu Leu Arg Lys Asn Ala
Leu Lys Trp Lys 435 440 445Ala Glu
Ala Glu Ala Ala Val Ala Pro Gly Gly Ser Ser Asp Lys Asn 450
455 460Phe Arg Glu Phe Val Glu Lys Leu Gly Ala Gly
Val Thr Lys Thr Lys465 470 475
480Asp Asn Gly Tyr91473DNAArabidopsis thaliana 9ctagtatcca
ttatctttag tcttcgttac tcccgcacct aacttctcca caaactccct 60aaaattctta
tccgacgaac ctcctggagc caccgctgct tccgcctccg ccttccattt 120caaagcgttc
tttctcaact cctctgcctt ctccccaact gtcgcttcca aaagcttctc 180cgccacttcc
tcccttggca ctaccctctc ctcggtcgct ccacggccta gtctaacccc 240ggtcttgaaa
acatcgatca aatacactgc atcagtcact tgatctcccc attgcggaca 300acaaaccacc
ggaacacctg aagacaaaga ttccattgtc gagttccatc cacaatgagt 360cacgaagcat
gccactgaag gatgagacaa gacttgctct tgtgggcacc aatccacaat 420catcccttta
cctttagcac tactctcttt aagttcttga ggcaagacat gtgtctcgac 480cttcagatcg
tgtggtggag gtctaatcac ccacaagaac gataaacccg acttcaaaac 540tccgtgagcg
atctcttcga tctgttcttg cttcaaatat gcaactgtcc cgaacgaaat 600gtagacaact
gacgatttag gcctcgagtc taaccactcg aggcatttat ctgttgattt 660gcaaatgtca
ccgcttacgt cagaagtaac tgtcctagca actttgaaaa gcggtccaac 720ggttttaacc
ggacaaagac ttgacatgta atcgataact tcttgttcca atgagtcaaa 780agaatcgatt
agaacacaga aggacttgct cagattcttg aattgcccaa gaatcgcttg 840tcgaaaaccc
gtgaacctag aagaaggatg gagaaagcta ggaatctcgt cgttcttcaa 900gacaggaaca
caaggaagct tcacatcgag ctcaggctct gtttccgtag ggaatgaaac 960agagccatct
tggtaatggt aataagcaga gaaacaagca caagactgaa cccagagaac 1020cgcacaagga
atgttgaact cttccgccac gtggcagacc catgggataa acgggttatt 1080gataagacac
gagacaggct cgttcgcttc ctcgtatctt ctcacaagct tagacacttc 1140tcgtatccca
acgctctcta ggtgagcaat gtacaaagag aaatcagctc tccggtcatc 1200atcctctgcc
cattcttcat caaagaactc aaaccggatt gaaccggaac caaccggttt 1260aagttcaccg
tcaacgattt tgttggcttg tctcattttc ttgccccaaa gctccgttgt 1320aacgaaggta
acgagtaaac cctttgaagc aattaacttg ccgagacgaa gaagagggtt 1380gacgtggcct
tgtccttgaa acgagacgag cattacatga attgggtttg gagatggaca 1440agtttcgaac
accatttctg atatggatcc cat
1473101440DNAArabidopsis thaliana 10atggacccgt ctcgtcatac tcatgtgatg
ctcgtatctt tccccggcca aggtcacgta 60aaccctctac ttcgtctcgg aaagctcata
gcctctaaag gcttactcgt cacctttgtc 120accacagaga agccatgggg caagaagatg
cgtcaagcca acaagattca agacggtgtg 180ctcaaaccgg tcggtctagg tttcatccgg
tttgagttct tctctgacgg cttcgccgac 240gacgatgaaa aaagattcga cttcgatgcc
ttccgaccac accttgaagc tgtcggaaaa 300caagagatca agaatctcgt taagagatat
aacaaggagc cggtgacgtg tctcataaac 360aacgcttttg tcccatgggt atgtgatgtc
gccgaggagc ttcacatccc ttcggctgtt 420ctatgggtcc agtcttgtgc ttgtctcacg
gcttattact attaccacca ccggttagtt 480aagttcccga ccaaaaccga gccggacatc
agcgttgaaa tcccttgctt gccattgtta 540aagcatgacg agatcccaag ctttcttcac
ccttcgtctc cgtatacagc ttttggagat 600atcattttag accagttaaa gagattcgaa
aaccacaagt ctttctatct tttcatcgac 660acttttcgcg aactagaaaa agacatcatg
gaccacatgt cacaactttg tcctcaagcc 720atcatcagtc ctgtcggtcc gctcttcaag
atggctcaaa ccttgagttc tgacgttaag 780ggagatatat ccgagccagc gagtgactgc
atggaatggc ttgactcaag agaaccatcc 840tcagtcgttt acatctcctt tgggactata
gccaacttga agcaagagca gatggaggag 900atcgctcatg gcgttttgag ctctggcttg
tcggtcttat gggtggttcg gcctcccatg 960gaagggacat ttgtagaacc acatgttttg
cctcgagagc tcgaagaaaa gggtaaaatc 1020gtggaatggt gtccccaaga gagagtcttg
gctcatcctg cgattgcttg tttcttaagt 1080cactgcggat ggaactcgac aatggaggct
ttaactgccg gagtccccgt tgtttgtttt 1140ccgcaatggg gagatcaagt gactgatgcg
gtgtacttgg ctgatgtttt caagacagga 1200gtgagactag gccgcggagc cgctgaggag
atgattgttt cgagggaggt tgtagcagag 1260aagctgcttg aggccacagt tggggaaaag
gcggtggagc tgagagaaaa cgctcggagg 1320tggaaggcgg aggccgaggc cgccgtggcg
gacggtggat catctgatat gaactttaaa 1380gagtttgtgg acaagttggt tacgaaacat
gtgacgagag aagacaacgg agaacactag 144011479PRTArabidopsis thaliana 11Met
Asp Pro Ser Arg His Thr His Val Met Leu Val Ser Phe Pro Gly 1
5 10 15Gln Gly His Val Asn Pro Leu
Leu Arg Leu Gly Lys Leu Ile Ala Ser 20 25
30Lys Gly Leu Leu Val Thr Phe Val Thr Thr Glu Lys Pro Trp
Gly Lys 35 40 45Lys Met Arg Gln
Ala Asn Lys Ile Gln Asp Gly Val Leu Lys Pro Val 50
55 60Gly Leu Gly Phe Ile Arg Phe Glu Phe Phe Ser Asp Gly
Phe Ala Asp 65 70 75
80Asp Asp Glu Lys Arg Phe Asp Phe Asp Ala Phe Arg Pro His Leu Glu
85 90 95Ala Val Gly Lys Gln Glu
Ile Lys Asn Leu Val Lys Arg Tyr Asn Lys 100
105 110Glu Pro Val Thr Cys Leu Ile Asn Asn Ala Phe Val
Pro Trp Val Cys 115 120 125Asp Val
Ala Glu Glu Leu His Ile Pro Ser Ala Val Leu Trp Val Gln 130
135 140Ser Cys Ala Cys Leu Thr Ala Tyr Tyr Tyr Tyr
His His Arg Leu Val145 150 155
160Lys Phe Pro Thr Lys Thr Glu Pro Asp Ile Ser Val Glu Ile Pro Cys
165 170 175Leu Pro Leu Leu
Lys His Asp Glu Ile Pro Ser Phe Leu His Pro Ser 180
185 190Ser Pro Tyr Thr Ala Phe Gly Asp Ile Ile Leu
Asp Gln Leu Lys Arg 195 200 205Phe
Glu Asn His Lys Ser Phe Tyr Leu Phe Ile Asp Thr Phe Arg Glu 210
215 220Leu Glu Lys Asp Ile Met Asp His Met Ser
Gln Leu Cys Pro Gln Ala225 230 235
240Ile Ile Ser Pro Val Gly Pro Leu Phe Lys Met Ala Gln Thr Leu
Ser 245 250 255Ser Asp Val
Lys Gly Asp Ile Ser Glu Pro Ala Ser Asp Cys Met Glu 260
265 270Trp Leu Asp Ser Arg Glu Pro Ser Ser Val
Val Tyr Ile Ser Phe Gly 275 280
285Thr Ile Ala Asn Leu Lys Gln Glu Gln Met Glu Glu Ile Ala His Gly 290
295 300Val Leu Ser Ser Gly Leu Ser Val
Leu Trp Val Val Arg Pro Pro Met305 310
315 320Glu Gly Thr Phe Val Glu Pro His Val Leu Pro Arg
Glu Leu Glu Glu 325 330
335Lys Gly Lys Ile Val Glu Trp Cys Pro Gln Glu Arg Val Leu Ala His
340 345 350Pro Ala Ile Ala Cys Phe
Leu Ser His Cys Gly Trp Asn Ser Thr Met 355 360
365Glu Ala Leu Thr Ala Gly Val Pro Val Val Cys Phe Pro Gln
Trp Gly 370 375 380Asp Gln Val Thr Asp
Ala Val Tyr Leu Ala Asp Val Phe Lys Thr Gly385 390
395 400Val Arg Leu Gly Arg Gly Ala Ala Glu Glu
Met Ile Val Ser Arg Glu 405 410
415Val Val Ala Glu Lys Leu Leu Glu Ala Thr Val Gly Glu Lys Ala Val
420 425 430Glu Leu Arg Glu Asn
Ala Arg Arg Trp Lys Ala Glu Ala Glu Ala Ala 435
440 445Val Ala Asp Gly Gly Ser Ser Asp Met Asn Phe Lys
Glu Phe Val Asp 450 455 460Lys Leu Val
Thr Lys His Val Thr Arg Glu Asp Asn Gly Glu His465 470
475121440DNAArabidopsis thaliana 12ctagtgttct ccgttgtctt
ctctcgtcac atgtttcgta accaacttgt ccacaaactc 60tttaaagttc atatcagatg
atccaccgtc cgccacggcg gcctcggcct ccgccttcca 120cctccgagcg ttttctctca
gctccaccgc cttttcccca actgtggcct caagcagctt 180ctctgctaca acctccctcg
aaacaatcat ctcctcagcg gctccgcggc ctagtctcac 240tcctgtcttg aaaacatcag
ccaagtacac cgcatcagtc acttgatctc cccattgcgg 300aaaacaaaca acggggactc
cggcagttaa agcctccatt gtcgagttcc atccgcagtg 360acttaagaaa caagcaatcg
caggatgagc caagactctc tcttggggac accattccac 420gattttaccc ttttcttcga
gctctcgagg caaaacatgt ggttctacaa atgtcccttc 480catgggaggc cgaaccaccc
ataagaccga caagccagag ctcaaaacgc catgagcgat 540ctcctccatc tgctcttgct
tcaagttggc tatagtccca aaggagatgt aaacgactga 600ggatggttct cttgagtcaa
gccattccat gcagtcactc gctggctcgg atatatctcc 660cttaacgtca gaactcaagg
tttgagccat cttgaagagc ggaccgacag gactgatgat 720ggcttgagga caaagttgtg
acatgtggtc catgatgtct ttttctagtt cgcgaaaagt 780gtcgatgaaa agatagaaag
acttgtggtt ttcgaatctc tttaactggt ctaaaatgat 840atctccaaaa gctgtatacg
gagacgaagg gtgaagaaag cttgggatct cgtcatgctt 900taacaatggc aagcaaggga
tttcaacgct gatgtccggc tcggttttgg tcgggaactt 960aactaaccgg tggtggtaat
agtaataagc cgtgagacaa gcacaagact ggacccatag 1020aacagccgaa gggatgtgaa
gctcctcggc gacatcacat acccatggga caaaagcgtt 1080gtttatgaga cacgtcaccg
gctccttgtt atatctctta acgagattct tgatctcttg 1140ttttccgaca gcttcaaggt
gtggtcggaa ggcatcgaag tcgaatcttt tttcatcgtc 1200gtcggcgaag ccgtcagaga
agaactcaaa ccggatgaaa cctagaccga ccggtttgag 1260cacaccgtct tgaatcttgt
tggcttgacg catcttcttg ccccatggct tctctgtggt 1320gacaaaggtg acgagtaagc
ctttagaggc tatgagcttt ccgagacgaa gtagagggtt 1380tacgtgacct tggccgggga
aagatacgag catcacatga gtatgacgag acgggtccat 1440131430DNAArabidopsis
thaliana 13atggagatgg aatcgtcgtt acctcatgtg atgctcgtat cattcccagg
gcaaggtcac 60ataagccctc ttcttcgtct cggaaagatc attgcctcta aaggcttaat
cgtcaccttt 120gtaaccacag aggaaccatt gggcaagaag atgcgtcaag ccaacaatat
tcaagacggt 180gtgctcaaac cggtcgggct aggttttctc cggttcgagt tcttcgagga
tggatttgtc 240tacaaagaag actttgattt gttacaaaaa tcacttgaag tttccggaaa
acgagagatc 300aagaatcttg tcaagaaata tgagaagcaa ccagtgagat gtctcataaa
taatgccttt 360gttccatggg tttgtgacat agccgaggag cttcaaatcc catcagctgt
tctttgggtc 420cagtcttgtg cttgcctcgc cgcttattac tattaccacc accagttagt
taagtttccg 480accgaaaccg agccggaaat aaccgttgac gtccctttca agccattaac
attgaagcat 540gacgagatcc ctagctttct tcacccttcc tctccgctgt cctctatagg
aggtaccatt 600ttagagcaga tcaagcgact tcacaagcct ttctctgttc tcatcgaaac
ttttcaagaa 660cttgaaaaag ataccattga ccacatgtcc cagctctgcc ctcaagtcaa
cttcaacccc 720atcggtccgc tttttactat ggctaaaacc ataaggtctg acatcaaggg
agacatctcc 780aagccagata gtgactgcat agagtggctt gactcgagag aaccatcctc
cgttgtttac 840atctcttttg ggactttggc tttcttgaag caaaaccaga tcgacgagat
tgctcacggc 900attctcaact ccgggttgtc ctgcttatgg gttttgcggc ctcccttaga
aggcttagcc 960atagaaccgc atgtcttgcc tctagagctt gaagagaaag ggaagattgt
ggaatggtgt 1020caacaagaga aagttttggc tcatcctgcg gttgcttgct tcttaagtca
ctgtggatgg 1080aactcaacca tggaggcttt aacttcagga gttcccgtta tttgtttccc
gcagtgggga 1140gatcaggtga caaatgcggt gtacatgatt gatgttttca agacaggatt
gagactcagc 1200cgtggagctt ccgatgagag gattgttcca agggaggagg ttgctgagcg
actgcttgag 1260gccaccgttg gagagaaggc ggtggagctg agagaaaacg ctcggaggtg
gaaggaggag 1320gcggagtctg ccgtggctta cggtggaaca tcggaaagga attttcaaga
gtttgttgac 1380aagttggttg atgtcaagac aatgacaaac attaataatg tcgtgtaagt
143014475PRTArabidopsis thaliana 14Met Glu Met Glu Ser Ser Leu
Pro His Val Met Leu Val Ser Phe Pro 1 5
10 15Gly Gln Gly His Ile Ser Pro Leu Leu Arg Leu Gly Lys
Ile Ile Ala 20 25 30Ser Lys
Gly Leu Ile Val Thr Phe Val Thr Thr Glu Glu Pro Leu Gly 35
40 45Lys Lys Met Arg Gln Ala Asn Asn Ile Gln
Asp Gly Val Leu Lys Pro 50 55 60Val
Gly Leu Gly Phe Leu Arg Phe Glu Phe Phe Glu Asp Gly Phe Val 65
70 75 80Tyr Lys Glu Asp Phe Asp
Leu Leu Gln Lys Ser Leu Glu Val Ser Gly 85
90 95Lys Arg Glu Ile Lys Asn Leu Val Lys Lys Tyr Glu
Lys Gln Pro Val 100 105 110Arg
Cys Leu Ile Asn Asn Ala Phe Val Pro Trp Val Cys Asp Ile Ala 115
120 125Glu Glu Leu Gln Ile Pro Ser Ala Val
Leu Trp Val Gln Ser Cys Ala 130 135
140Cys Leu Ala Ala Tyr Tyr Tyr Tyr His His Gln Leu Val Lys Phe Pro145
150 155 160Thr Glu Thr Glu
Pro Glu Ile Thr Val Asp Val Pro Phe Lys Pro Leu 165
170 175Thr Leu Lys His Asp Glu Ile Pro Ser Phe
Leu His Pro Ser Ser Pro 180 185
190Leu Ser Ser Ile Gly Gly Thr Ile Leu Glu Gln Ile Lys Arg Leu His
195 200 205Lys Pro Phe Ser Val Leu Ile
Glu Thr Phe Gln Glu Leu Glu Lys Asp 210 215
220Thr Ile Asp His Met Ser Gln Leu Cys Pro Gln Val Asn Phe Asn
Pro225 230 235 240Ile Gly
Pro Leu Phe Thr Met Ala Lys Thr Ile Arg Ser Asp Ile Lys
245 250 255Gly Asp Ile Ser Lys Pro Asp
Ser Asp Cys Ile Glu Trp Leu Asp Ser 260 265
270Arg Glu Pro Ser Ser Val Val Tyr Ile Ser Phe Gly Thr Leu
Ala Phe 275 280 285Leu Lys Gln Asn
Gln Ile Asp Glu Ile Ala His Gly Ile Leu Asn Ser 290
295 300Gly Leu Ser Cys Leu Trp Val Leu Arg Pro Pro Leu
Glu Gly Leu Ala305 310 315
320Ile Glu Pro His Val Leu Pro Leu Glu Leu Glu Glu Lys Gly Lys Ile
325 330 335Val Glu Trp Cys Gln
Gln Glu Lys Val Leu Ala His Pro Ala Val Ala 340
345 350Cys Phe Leu Ser His Cys Gly Trp Asn Ser Thr Met
Glu Ala Leu Thr 355 360 365Ser Gly
Val Pro Val Ile Cys Phe Pro Gln Trp Gly Asp Gln Val Thr 370
375 380Asn Ala Val Tyr Met Ile Asp Val Phe Lys Thr
Gly Leu Arg Leu Ser385 390 395
400Arg Gly Ala Ser Asp Glu Arg Ile Val Pro Arg Glu Glu Val Ala Glu
405 410 415Arg Leu Leu Glu
Ala Thr Val Gly Glu Lys Ala Val Glu Leu Arg Glu 420
425 430Asn Ala Arg Arg Trp Lys Glu Glu Ala Glu Ser
Ala Val Ala Tyr Gly 435 440 445Gly
Thr Ser Glu Arg Asn Phe Gln Glu Phe Val Asp Lys Leu Val Asp 450
455 460Val Lys Thr Met Thr Asn Ile Asn Asn Val
Val465 470 475151430DNAArabidopsis
thaliana 15acttacacga cattattaat gtttgtcatt gtcttgacat caaccaactt
gtcaacaaac 60tcttgaaaat tcctttccga tgttccaccg taagccacgg cagactccgc
ctcctccttc 120cacctccgag cgttttctct cagctccacc gccttctctc caacggtggc
ctcaagcagt 180cgctcagcaa cctcctccct tggaacaatc ctctcatcgg aagctccacg
gctgagtctc 240aatcctgtct tgaaaacatc aatcatgtac accgcatttg tcacctgatc
tccccactgc 300gggaaacaaa taacgggaac tcctgaagtt aaagcctcca tggttgagtt
ccatccacag 360tgacttaaga agcaagcaac cgcaggatga gccaaaactt tctcttgttg
acaccattcc 420acaatcttcc ctttctcttc aagctctaga ggcaagacat gcggttctat
ggctaagcct 480tctaagggag gccgcaaaac ccataagcag gacaacccgg agttgagaat
gccgtgagca 540atctcgtcga tctggttttg cttcaagaaa gccaaagtcc caaaagagat
gtaaacaacg 600gaggatggtt ctctcgagtc aagccactct atgcagtcac tatctggctt
ggagatgtct 660cccttgatgt cagaccttat ggttttagcc atagtaaaaa gcggaccgat
ggggttgaag 720ttgacttgag ggcagagctg ggacatgtgg tcaatggtat ctttttcaag
ttcttgaaaa 780gtttcgatga gaacagagaa aggcttgtga agtcgcttga tctgctctaa
aatggtacct 840cctatagagg acagcggaga ggaagggtga agaaagctag ggatctcgtc
atgcttcaat 900gttaatggct tgaaagggac gtcaacggtt atttccggct cggtttcggt
cggaaactta 960actaactggt ggtggtaata gtaataagcg gcgaggcaag cacaagactg
gacccaaaga 1020acagctgatg ggatttgaag ctcctcggct atgtcacaaa cccatggaac
aaaggcatta 1080tttatgagac atctcactgg ttgcttctca tatttcttga caagattctt
gatctctcgt 1140tttccggaaa cttcaagtga tttttgtaac aaatcaaagt cttctttgta
gacaaatcca 1200tcctcgaaga actcgaaccg gagaaaacct agcccgaccg gtttgagcac
accgtcttga 1260atattgttgg cttgacgcat cttcttgccc aatggttcct ctgtggttac
aaaggtgacg 1320attaagcctt tagaggcaat gatctttccg agacgaagaa gagggcttat
gtgaccttgc 1380cctgggaatg atacgagcat cacatgaggt aacgacgatt ccatctccat
1430161437DNAArabidopsis thaliana 16atgggcagta gtgagggtca
agaaacacat gtcctaatgg taacactacc attccaaggt 60cacatcaatc caatgctcaa
actcgcaaaa catctctcgt tatcatcaaa gaacctacac 120atcaatctcg ccactattga
gtcagcccgt gatctcctct ccaccgtaga aaaacctcgt 180tatccggtgg acctcgtgtt
cttctccgat ggtctaccta aagaagatcc aaaggcccct 240gaaactcttt tgaagtcatt
gaataaagtc ggagccatga acttgtctaa aatcatcgaa 300gaaaagagat actcttgtat
catctcttcg ccttttactc catgggttcc agctgttgca 360gcctctcata acatctcttg
tgcaatactt tggatccaag cttgtggagc ttactcggtt 420tattaccgtt actacatgaa
gacaaactct ttccctgatc ttgaagatct gaatcaaacg 480gtggagttac cagctttacc
attgttggaa gttcgagatc ttccatcgtt tatgttacct 540tctggtggtg ctcacttcta
taatctaatg gcggaatttg cagattgttt gaggtatgtg 600aaatgggttt tggttaattc
attctatgaa ctcgaatcag agataatcga atcgatggct 660gatttaaaac ctgtaattcc
aattggtcct ctggtttctc catttctgtt gggcgatggt 720gaggaggaaa ccctagacgg
taaaaaccta gatttttgta aatctgatga ttgttgtatg 780gagtggcttg acaagcaagc
taggtcttct gttgtgtaca tatctttcgg aagtatgctc 840gaaacattgg agaatcaggt
cgagaccata gcgaaggcgc tgaagaacag aggacttcca 900tttctttggg tgataaggcc
aaaggagaaa gcccaaaacg ttgctgtttt gcaggagatg 960gtgaaagaag gacaaggggt
tgttctcgag tggagtccac aagagaagat tttgagccac 1020gaggcaatct cttgttttgt
cacgcattgc ggctggaact cgactatgga gacggtggtg 1080gctggtgttc ctgtggtagc
gtaccctagc tggacggatc agcccattga cgcgcggttg 1140cttgttgatg tgtttggaat
cggagtaagg atgaggaatg acagtgtcga tggcgagctt 1200aaggtcgaag aagtagaaag
atgcattgag gccgtgacgg agggacccgc tgccgtggat 1260ataagaagga gagcggcgga
gctaaagcgc gtggcgagat tggcgttggc acctggtgga 1320tcttcgacac ggaatttaga
cttgttcatt agtgatatca caatcgccta actctttact 1380tcaactagta caaaatgtat
gaatacaagg tttgatataa ccactatcaa ttgttag 143717456PRTArabidopsis
thaliana 17Met Gly Ser Ser Glu Gly Gln Glu Thr His Val Leu Met Val Thr
Leu 1 5 10 15Pro Phe Gln
Gly His Ile Asn Pro Met Leu Lys Leu Ala Lys His Leu 20
25 30Ser Leu Ser Ser Lys Asn Leu His Ile Asn
Leu Ala Thr Ile Glu Ser 35 40
45Ala Arg Asp Leu Leu Ser Thr Val Glu Lys Pro Arg Tyr Pro Val Asp 50
55 60Leu Val Phe Phe Ser Asp Gly Leu Pro
Lys Glu Asp Pro Lys Ala Pro 65 70 75
80Glu Thr Leu Leu Lys Ser Leu Asn Lys Val Gly Ala Met Asn
Leu Ser 85 90 95Lys Ile
Ile Glu Glu Lys Arg Tyr Ser Cys Ile Ile Ser Ser Pro Phe 100
105 110Thr Pro Trp Val Pro Ala Val Ala Ala
Ser His Asn Ile Ser Cys Ala 115 120
125Ile Leu Trp Ile Gln Ala Cys Gly Ala Tyr Ser Val Tyr Tyr Arg Tyr
130 135 140Tyr Met Lys Thr Asn Ser Phe
Pro Asp Leu Glu Asp Leu Asn Gln Thr145 150
155 160Val Glu Leu Pro Ala Leu Pro Leu Leu Glu Val Arg
Asp Leu Pro Ser 165 170
175Phe Met Leu Pro Ser Gly Gly Ala His Phe Tyr Asn Leu Met Ala Glu
180 185 190Phe Ala Asp Cys Leu Arg
Tyr Val Lys Trp Val Leu Val Asn Ser Phe 195 200
205Tyr Glu Leu Glu Ser Glu Ile Ile Glu Ser Met Ala Asp Leu
Lys Pro 210 215 220Val Ile Pro Ile Gly
Pro Leu Val Ser Pro Phe Leu Leu Gly Asp Gly225 230
235 240Glu Glu Glu Thr Leu Asp Gly Lys Asn Leu
Asp Phe Cys Lys Ser Asp 245 250
255Asp Cys Cys Met Glu Trp Leu Asp Lys Gln Ala Arg Ser Ser Val Val
260 265 270Tyr Ile Ser Phe Gly
Ser Met Leu Glu Thr Leu Glu Asn Gln Val Glu 275
280 285Thr Ile Ala Lys Ala Leu Lys Asn Arg Gly Leu Pro
Phe Leu Trp Val 290 295 300Ile Arg Pro
Lys Glu Lys Ala Gln Asn Val Ala Val Leu Gln Glu Met305
310 315 320Val Lys Glu Gly Gln Gly Val
Val Leu Glu Trp Ser Pro Gln Glu Lys 325
330 335Ile Leu Ser His Glu Ala Ile Ser Cys Phe Val Thr
His Cys Gly Trp 340 345 350Asn
Ser Thr Met Glu Thr Val Val Ala Gly Val Pro Val Val Ala Tyr 355
360 365Pro Ser Trp Thr Asp Gln Pro Ile Asp
Ala Arg Leu Leu Val Asp Val 370 375
380Phe Gly Ile Gly Val Arg Met Arg Asn Asp Ser Val Asp Gly Glu Leu385
390 395 400Lys Val Glu Glu
Val Glu Arg Cys Ile Glu Ala Val Thr Glu Gly Pro 405
410 415Ala Ala Val Asp Ile Arg Arg Arg Ala Ala
Glu Leu Lys Arg Val Ala 420 425
430Arg Leu Ala Leu Ala Pro Gly Gly Ser Ser Thr Arg Asn Leu Asp Leu
435 440 445Phe Ile Ser Asp Ile Thr Ile
Ala 450 455181437DNAArabidopsis thaliana 18ctaacaattg
atagtggtta tatcaaacct tgtattcata cattttgtac tagttgaagt 60aaagagttag
gcgattgtga tatcactaat gaacaagtct aaattccgtg tcgaagatcc 120accaggtgcc
aacgccaatc tcgccacgcg ctttagctcc gccgctctcc ttcttatatc 180cacggcagcg
ggtccctccg tcacggcctc aatgcatctt tctacttctt cgaccttaag 240ctcgccatcg
acactgtcat tcctcatcct tactccgatt ccaaacacat caacaagcaa 300ccgcgcgtca
atgggctgat ccgtccagct agggtacgct accacaggaa caccagccac 360caccgtctcc
atagtcgagt tccagccgca atgcgtgaca aaacaagaga ttgcctcgtg 420gctcaaaatc
ttctcttgtg gactccactc gagaacaacc ccttgtcctt ctttcaccat 480ctcctgcaaa
acagcaacgt tttgggcttt ctcctttggc cttatcaccc aaagaaatgg 540aagtcctctg
ttcttcagcg ccttcgctat ggtctcgacc tgattctcca atgtttcgag 600catacttccg
aaagatatgt acacaacaga agacctagct tgcttgtcaa gccactccat 660acaacaatca
tcagatttac aaaaatctag gtttttaccg tctagggttt cctcctcacc 720atcgcccaac
agaaatggag aaaccagagg accaattgga attacaggtt ttaaatcagc 780catcgattcg
attatctctg attcgagttc atagaatgaa ttaaccaaaa cccatttcac 840atacctcaaa
caatctgcaa attccgccat tagattatag aagtgagcac caccagaagg 900taacataaac
gatggaagat ctcgaacttc caacaatggt aaagctggta actccaccgt 960ttgattcaga
tcttcaagat cagggaaaga gtttgtcttc atgtagtaac ggtaataaac 1020cgagtaagct
ccacaagctt ggatccaaag tattgcacaa gagatgttat gagaggctgc 1080aacagctgga
acccatggag taaaaggcga agagatgata caagagtatc tcttttcttc 1140gatgatttta
gacaagttca tggctccgac tttattcaat gacttcaaaa gagtttcagg 1200ggcctttgga
tcttctttag gtagaccatc ggagaagaac acgaggtcca ccggataacg 1260aggtttttct
acggtggaga ggagatcacg ggctgactca atagtggcga gattgatgtg 1320taggttcttt
gatgataacg agagatgttt tgcgagtttg agcattggat tgatgtgacc 1380ttggaatggt
agtgttacca ttaggacatg tgtttcttga ccctcactac tgcccat
1437191446DNAArabidopsis thaliana 19atgcatatca caaaaccaca cgccgccatg
ttttccagtc ccggaatggg ccatgtcatc 60ccggtgatcg agcttggaaa gcgtctctcc
gctaacaacg gcttccacgt caccgtcttc 120gtcctcgaaa ccgacgcagc ctccgctcaa
tccaagttcc taaactcaac cggcgtcgac 180atcgtcaaac ttccatcgcc ggacatttat
ggtttagtgg accccgacga ccatgtagtg 240accaagatcg gagtcattat gcgtgcagca
gttccagccc tccgatccaa gatcgctgcc 300atgcatcaaa agccaacggc tctgatcgtt
gacttgtttg gcacagatgc gttatgtctc 360gcaaaggaat ttaacatgtt gagttatgtg
tttatcccta ccaacgcacg ttttctcgga 420gtttcgattt attatccaaa tttggacaaa
gatatcaagg aagagcacac agtgcaaaga 480aacccactcg ctataccggg gtgtgaaccg
gttaggttcg aagatactct ggatgcatat 540ctggttcccg acgaaccggt gtaccgggat
tttgttcgtc atggtctggc ttacccaaaa 600gccgatggaa ttttggtaaa tacatgggaa
gagatggagc ccaaatcatt gaagtccctt 660ctaaacccaa agctcttggg ccgggttgct
cgtgtaccgg tctatccaat cggtccctta 720tgcagaccga tacaatcatc cgaaaccgat
cacccggttt tggattggtt aaacgaacaa 780ccgaacgagt cggttctcta tatctccttc
gggagtggtg gttgtctatc ggcgaaacag 840ttaactgaat tggcgtgggg actcgagcag
agccagcaac ggttcgtatg ggtggttcga 900ccaccggtcg acggttcgtg ttgtagcgag
tatgtctcgg ctaacggtgg tggaaccgaa 960gacaacacgc cagagtatct accggaaggg
ttcgtgagtc gtactagtga tagaggtttc 1020gtggtcccct catgggcccc acaagctgaa
atcctgtccc atcgggccgt tggtgggttt 1080ttgacccatt gcggttggag ctcgacgttg
gaaagcgtcg ttggcggcgt tccgatgatc 1140gcatggccac tttttgccga gcagaatatg
aatgcggcgt tgctcagcga cgaactggga 1200atcgcagtca gattggatga tccaaaggag
gatatttcta ggtggaagat tgaggcgttg 1260gtgaggaagg ttatgactga gaaggaaggt
gaagcgatga gaaggaaagt gaagaagttg 1320agagactcgg cggagatgtc actgagcatt
gacggtggtg gtttggcgca cgagtcgctt 1380tgcagagtca ccaaggagtg tcaacggttt
ttggaacgtg tcgtggactt gtcacgtggt 1440gcttag
144620481PRTArabidopsis thaliana 20Met
His Ile Thr Lys Pro His Ala Ala Met Phe Ser Ser Pro Gly Met 1
5 10 15Gly His Val Ile Pro Val Ile
Glu Leu Gly Lys Arg Leu Ser Ala Asn 20 25
30Asn Gly Phe His Val Thr Val Phe Val Leu Glu Thr Asp Ala
Ala Ser 35 40 45Ala Gln Ser Lys
Phe Leu Asn Ser Thr Gly Val Asp Ile Val Lys Leu 50
55 60Pro Ser Pro Asp Ile Tyr Gly Leu Val Asp Pro Asp Asp
His Val Val 65 70 75
80Thr Lys Ile Gly Val Ile Met Arg Ala Ala Val Pro Ala Leu Arg Ser
85 90 95Lys Ile Ala Ala Met His
Gln Lys Pro Thr Ala Leu Ile Val Asp Leu 100
105 110Phe Gly Thr Asp Ala Leu Cys Leu Ala Lys Glu Phe
Asn Met Leu Ser 115 120 125Tyr Val
Phe Ile Pro Thr Asn Ala Arg Phe Leu Gly Val Ser Ile Tyr 130
135 140Tyr Pro Asn Leu Asp Lys Asp Ile Lys Glu Glu
His Thr Val Gln Arg145 150 155
160Asn Pro Leu Ala Ile Pro Gly Cys Glu Pro Val Arg Phe Glu Asp Thr
165 170 175Leu Asp Ala Tyr
Leu Val Pro Asp Glu Pro Val Tyr Arg Asp Phe Val 180
185 190Arg His Gly Leu Ala Tyr Pro Lys Ala Asp Gly
Ile Leu Val Asn Thr 195 200 205Trp
Glu Glu Met Glu Pro Lys Ser Leu Lys Ser Leu Leu Asn Pro Lys 210
215 220Leu Leu Gly Arg Val Ala Arg Val Pro Val
Tyr Pro Ile Gly Pro Leu225 230 235
240Cys Arg Pro Ile Gln Ser Ser Glu Thr Asp His Pro Val Leu Asp
Trp 245 250 255Leu Asn Glu
Gln Pro Asn Glu Ser Val Leu Tyr Ile Ser Phe Gly Ser 260
265 270Gly Gly Cys Leu Ser Ala Lys Gln Leu Thr
Glu Leu Ala Trp Gly Leu 275 280
285Glu Gln Ser Gln Gln Arg Phe Val Trp Val Val Arg Pro Pro Val Asp 290
295 300Gly Ser Cys Cys Ser Glu Tyr Val
Ser Ala Asn Gly Gly Gly Thr Glu305 310
315 320Asp Asn Thr Pro Glu Tyr Leu Pro Glu Gly Phe Val
Ser Arg Thr Ser 325 330
335Asp Arg Gly Phe Val Val Pro Ser Trp Ala Pro Gln Ala Glu Ile Leu
340 345 350Ser His Arg Ala Val Gly
Gly Phe Leu Thr His Cys Gly Trp Ser Ser 355 360
365Thr Leu Glu Ser Val Val Gly Gly Val Pro Met Ile Ala Trp
Pro Leu 370 375 380Phe Ala Glu Gln Asn
Met Asn Ala Ala Leu Leu Ser Asp Glu Leu Gly385 390
395 400Ile Ala Val Arg Leu Asp Asp Pro Lys Glu
Asp Ile Ser Arg Trp Lys 405 410
415Ile Glu Ala Leu Val Arg Lys Val Met Thr Glu Lys Glu Gly Glu Ala
420 425 430Met Arg Arg Lys Val
Lys Lys Leu Arg Asp Ser Ala Glu Met Ser Leu 435
440 445Ser Ile Asp Gly Gly Gly Leu Ala His Glu Ser Leu
Cys Arg Val Thr 450 455 460Lys Glu Cys
Gln Arg Phe Leu Glu Arg Val Val Asp Leu Ser Arg Gly465
470 475 480Ala211446DNAArabidopsis
thaliana 21ctaagcacca cgtgacaagt ccacgacacg ttccaaaaac cgttgacact
ccttggtgac 60tctgcaaagc gactcgtgcg ccaaaccacc accgtcaatg ctcagtgaca
tctccgccga 120gtctctcaac ttcttcactt tccttctcat cgcttcacct tccttctcag
tcataacctt 180cctcaccaac gcctcaatct tccacctaga aatatcctcc tttggatcat
ccaatctgac 240tgcgattccc agttcgtcgc tgagcaacgc cgcattcata ttctgctcgg
caaaaagtgg 300ccatgcgatc atcggaacgc cgccaacgac gctttccaac gtcgagctcc
aaccgcaatg 360ggtcaaaaac ccaccaacgg cccgatggga caggatttca gcttgtgggg
cccatgaggg 420gaccacgaaa cctctatcac tagtacgact cacgaaccct tccggtagat
actctggcgt 480gttgtcttcg gttccaccac cgttagccga gacatactcg ctacaacacg
aaccgtcgac 540cggtggtcga accacccata cgaaccgttg ctggctctgc tcgagtcccc
acgccaattc 600agttaactgt ttcgccgata gacaaccacc actcccgaag gagatataga
gaaccgactc 660gttcggttgt tcgtttaacc aatccaaaac cgggtgatcg gtttcggatg
attgtatcgg 720tctgcataag ggaccgattg gatagaccgg tacacgagca acccggccca
agagctttgg 780gtttagaagg gacttcaatg atttgggctc catctcttcc catgtattta
ccaaaattcc 840atcggctttt gggtaagcca gaccatgacg aacaaaatcc cggtacaccg
gttcgtcggg 900aaccagatat gcatccagag tatcttcgaa cctaaccggt tcacaccccg
gtatagcgag 960tgggtttctt tgcactgtgt gctcttcctt gatatctttg tccaaatttg
gataataaat 1020cgaaactccg agaaaacgtg cgttggtagg gataaacaca taactcaaca
tgttaaattc 1080ctttgcgaga cataacgcat ctgtgccaaa caagtcaacg atcagagccg
ttggcttttg 1140atgcatggca gcgatcttgg atcggagggc tggaactgct gcacgcataa
tgactccgat 1200cttggtcact acatggtcgt cggggtccac taaaccataa atgtccggcg
atggaagttt 1260gacgatgtcg acgccggttg agtttaggaa cttggattga gcggaggctg
cgtcggtttc 1320gaggacgaag acggtgacgt ggaagccgtt gttagcggag agacgctttc
caagctcgat 1380caccgggatg acatggccca ttccgggact ggaaaacatg gcggcgtgtg
gttttgtgat 1440atgcat
1446221446DNAArabidopsis thaliana 22atgagtagtg atcctcatcg
taagctccat gttgtgttct tccctttcat ggcttatggt 60cacatgatac caactctaga
catggctaag cttttctcta gcagaggagc caaatctaca 120atcctcacca cacctctcaa
ctccaagatc ttccaaaaac ccatcgaaag attcaagaac 180ctgaatccga gtttcgaaat
cgacatccag atcttcgatt tcccttgcgt ggatctcggg 240ttaccagaag gatgcgaaaa
cgtcgatttc ttcacctcaa acaacaatga tgatagacag 300tatctgacct tgaagttctt
taagtcgaca aggtttttca aagatcagct tgagaagctc 360ctcgagacaa cgagaccaga
ctgtcttatc gccgacatgt tcttcccctg ggctacggaa 420gctgctgaga agttcaatgt
gccaagactt gtgttccacg gtactggcta cttttcttta 480tgctctgaat attgcatcag
agtgcataac ccacaaaaca tagtagcttc aaggtacgag 540ccatttgtga ttcctgatct
cccggggaac atagtgataa ctcaagaaca gatagcagac 600cgtgacgaag aaagcgagat
ggggaagttt atgattgagg tcaaagaatc tgatgtgaag 660agctcaggtg ttattgtaaa
cagcttctac gagcttgaac ctgattacgc cgacttttac 720aagagtgttg tactgaagag
agcgtggcat atcggtccgc tttcggttta caacagagga 780tttgaggaga aggctgagag
aggaaagaaa gcaagcatta atgaggttga atgcctcaaa 840tggcttgact ccaagaaacc
agattcagtc atttacattt cttttgggag cgtggcttgc 900ttcaagaacg agcagctatt
cgagatcgct gcaggattag aaacttctgg agcaaatttc 960atctgggttg ttaggaaaaa
cataggtatt gaaaaagaag aatggttacc agaagggttc 1020gaagagaggg tgaaaggaaa
agggatgatt ataagaggat gggcaccaca ggtgctcata 1080cttgatcatc aagcaacttg
tgggtttgtg acccattgcg gctggaactc gcttctggaa 1140ggagtggctg cagggctacc
aatggtgaca tggcctgtag cagcggagca attctacaat 1200gagaaattgg ttacgcaagt
gctcagaaca ggagtgagcg tgggagcgaa aaagaatgta 1260agaactacgg gagatttcat
tagcagagag aaagtggtta aagcggtgag ggaggtgttg 1320gttggggaag aggcggatga
gaggcgggag agggcaaaga agttggcaga gatggctaaa 1380gctgccgtgg aaggagggtc
ttctttcaac gatctaaaca gcttcataga agagtttacc 1440tcgtaa
144623481PRTArabidopsis
thaliana 23Met Ser Ser Asp Pro His Arg Lys Leu His Val Val Phe Phe Pro
Phe 1 5 10 15Met Ala Tyr
Gly His Met Ile Pro Thr Leu Asp Met Ala Lys Leu Phe 20
25 30Ser Ser Arg Gly Ala Lys Ser Thr Ile Leu
Thr Thr Pro Leu Asn Ser 35 40
45Lys Ile Phe Gln Lys Pro Ile Glu Arg Phe Lys Asn Leu Asn Pro Ser 50
55 60Phe Glu Ile Asp Ile Gln Ile Phe Asp
Phe Pro Cys Val Asp Leu Gly 65 70 75
80Leu Pro Glu Gly Cys Glu Asn Val Asp Phe Phe Thr Ser Asn
Asn Asn 85 90 95Asp Asp
Arg Gln Tyr Leu Thr Leu Lys Phe Phe Lys Ser Thr Arg Phe 100
105 110Phe Lys Asp Gln Leu Glu Lys Leu Leu
Glu Thr Thr Arg Pro Asp Cys 115 120
125Leu Ile Ala Asp Met Phe Phe Pro Trp Ala Thr Glu Ala Ala Glu Lys
130 135 140Phe Asn Val Pro Arg Leu Val
Phe His Gly Thr Gly Tyr Phe Ser Leu145 150
155 160Cys Ser Glu Tyr Cys Ile Arg Val His Asn Pro Gln
Asn Ile Val Ala 165 170
175Ser Arg Tyr Glu Pro Phe Val Ile Pro Asp Leu Pro Gly Asn Ile Val
180 185 190Ile Thr Gln Glu Gln Ile
Ala Asp Arg Asp Glu Glu Ser Glu Met Gly 195 200
205Lys Phe Met Ile Glu Val Lys Glu Ser Asp Val Lys Ser Ser
Gly Val 210 215 220Ile Val Asn Ser Phe
Tyr Glu Leu Glu Pro Asp Tyr Ala Asp Phe Tyr225 230
235 240Lys Ser Val Val Leu Lys Arg Ala Trp His
Ile Gly Pro Leu Ser Val 245 250
255Tyr Asn Arg Gly Phe Glu Glu Lys Ala Glu Arg Gly Lys Lys Ala Ser
260 265 270Ile Asn Glu Val Glu
Cys Leu Lys Trp Leu Asp Ser Lys Lys Pro Asp 275
280 285Ser Val Ile Tyr Ile Ser Phe Gly Ser Val Ala Cys
Phe Lys Asn Glu 290 295 300Gln Leu Phe
Glu Ile Ala Ala Gly Leu Glu Thr Ser Gly Ala Asn Phe305
310 315 320Ile Trp Val Val Arg Lys Asn
Ile Gly Ile Glu Lys Glu Glu Trp Leu 325
330 335Pro Glu Gly Phe Glu Glu Arg Val Lys Gly Lys Gly
Met Ile Ile Arg 340 345 350Gly
Trp Ala Pro Gln Val Leu Ile Leu Asp His Gln Ala Thr Cys Gly 355
360 365Phe Val Thr His Cys Gly Trp Asn Ser
Leu Leu Glu Gly Val Ala Ala 370 375
380Gly Leu Pro Met Val Thr Trp Pro Val Ala Ala Glu Gln Phe Tyr Asn385
390 395 400Glu Lys Leu Val
Thr Gln Val Leu Arg Thr Gly Val Ser Val Gly Ala 405
410 415Lys Lys Asn Val Arg Thr Thr Gly Asp Phe
Ile Ser Arg Glu Lys Val 420 425
430Val Lys Ala Val Arg Glu Val Leu Val Gly Glu Glu Ala Asp Glu Arg
435 440 445Arg Glu Arg Ala Lys Lys Leu
Ala Glu Met Ala Lys Ala Ala Val Glu 450 455
460Gly Gly Ser Ser Phe Asn Asp Leu Asn Ser Phe Ile Glu Glu Phe
Thr465 470 475
480Ser241446DNAArabidopsis thaliana 24ttacgaggta aactcttcta tgaagctgtt
tagatcgttg aaagaagacc ctccttccac 60ggcagcttta gccatctctg ccaacttctt
tgccctctcc cgcctctcat ccgcctcttc 120cccaaccaac acctccctca ccgctttaac
cactttctct ctgctaatga aatctcccgt 180agttcttaca ttctttttcg ctcccacgct
cactcctgtt ctgagcactt gcgtaaccaa 240tttctcattg tagaattgct ccgctgctac
aggccatgtc accattggta gccctgcagc 300cactccttcc agaagcgagt tccagccgca
atgggtcaca aacccacaag ttgcttgatg 360atcaagtatg agcacctgtg gtgcccatcc
tcttataatc atcccttttc ctttcaccct 420ctcttcgaac ccttctggta accattcttc
tttttcaata cctatgtttt tcctaacaac 480ccagatgaaa tttgctccag aagtttctaa
tcctgcagcg atctcgaata gctgctcgtt 540cttgaagcaa gccacgctcc caaaagaaat
gtaaatgact gaatctggtt tcttggagtc 600aagccatttg aggcattcaa cctcattaat
gcttgctttc tttcctctct cagccttctc 660ctcaaatcct ctgttgtaaa ccgaaagcgg
accgatatgc cacgctctct tcagtacaac 720actcttgtaa aagtcggcgt aatcaggttc
aagctcgtag aagctgttta caataacacc 780tgagctcttc acatcagatt ctttgacctc
aatcataaac ttccccatct cgctttcttc 840gtcacggtct gctatctgtt cttgagttat
cactatgttc cccgggagat caggaatcac 900aaatggctcg taccttgaag ctactatgtt
ttgtgggtta tgcactctga tgcaatattc 960agagcataaa gaaaagtagc cagtaccgtg
gaacacaagt cttggcacat tgaacttctc 1020agcagcttcc gtagcccagg ggaagaacat
gtcggcgata agacagtctg gtctcgttgt 1080ctcgaggagc ttctcaagct gatctttgaa
aaaccttgtc gacttaaaga acttcaaggt 1140cagatactgt ctatcatcat tgttgtttga
ggtgaagaaa tcgacgtttt cgcatccttc 1200tggtaacccg agatccacgc aagggaaatc
gaagatctgg atgtcgattt cgaaactcgg 1260attcaggttc ttgaatcttt cgatgggttt
ttggaagatc ttggagttga gaggtgtggt 1320gaggattgta gatttggctc ctctgctaga
gaaaagctta gccatgtcta gagttggtat 1380catgtgacca taagccatga aagggaagaa
cacaacatgg agcttacgat gaggatcact 1440actcat
1446251446DNAArabidopsis thaliana
25atgcatatca caaaaccaca cgccgccatg ttttccagtc ccggaatggg ccatgtcctc
60ccggtgatcg agctagctaa gcgtctctcc gctaaccacg gcttccacgt caccgtcttc
120gtccttgaaa ctgacgcagc ctccgttcag tccaagctcc ttaactcaac cggtgttgac
180atcgtcaacc ttccatcgcc cgacatttct ggcttggtag accccaacgc ccatgtggtg
240accaagatcg gagtcattat gcgtgaagct gttccaaccc tccgatccaa gatcgttgcc
300atgcatcaaa acccaacggc tctgatcatt gacttgtttg gcacagatgc gttatgtctt
360gcagcggagt taaacatgtt gacttatgtc tttatcgctt ccaacgcgcg ttatctcgga
420gtttcgatat attatccaac tttggacgaa gttatcaaag aagagcacac agtgcaacga
480aaaccgctca ctataccggg gtgtgaaccg gttagatttg aagatattat ggatgcatat
540ctggttccgg acgaaccggt gtaccacgat ttggttcgtc actgtctggc ctacccaaaa
600gcggatggaa tcttggtgaa tacatgggaa gagatggagc ccaaatcatt aaagtccctt
660caagacccga aacttttggg ccgggtcgct cgtgtaccgg tttatccggt tggtccgtta
720tgcagaccga tacaatcatc cacgaccgat cacccggttt ttgattggtt aaacaaacaa
780ccaaacgagt cggttctcta catttccttc gggagtggtg gttctctaac ggctcaacag
840ttaaccgaat tggcgtgggg gctcgaggag agccagcaac ggtttatatg ggtggttcga
900ccgcccgttg acggctcgtc ttgcagtgat tatttctcgg ctaaaggcgg tgtaaccaaa
960gacaacacgc cagagtatct accagaaggg ttcgtgactc gtacttgcga tagaggtttc
1020atgatcccat catgggcacc gcaagctgaa atcctagccc atcaggccgt tggtgggttt
1080ttaacacatt gtggttggag ctcgacgttg gaaagcgtcc tttgcggcgt tccaatgata
1140gcgtggccgc ttttcgccga gcagaatatg aacgcggcgt tgcttagcga tgaactggga
1200atctctgtta gagtggatga tccaaaggag gcgatttcta ggtcgaagat tgaggcgatg
1260gtgaggaagg ttatggctga ggacgaaggt gaagagatga gaaggaaagt gaagaagttg
1320agagacacgg cggagatgtc acttagtatt cacggtggtg gttcggcgca tgagtcgctt
1380tgcagagtca cgaaggagtg tcaacggttt ttggaatgtg tcggggactt gggacgtggt
1440gcttag
144626381PRTArabidopsis thaliana 26Met His Gln Asn Pro Thr Ala Leu Ile
Ile Asp Leu Phe Gly Thr Asp 1 5 10
15Ala Leu Cys Leu Ala Ala Glu Leu Asn Met Leu Thr Tyr Val Phe
Ile 20 25 30Ala Ser Asn Ala
Arg Tyr Leu Gly Val Ser Ile Tyr Tyr Pro Thr Leu 35
40 45Asp Glu Val Ile Lys Glu Glu His Thr Val Gln Arg
Lys Pro Leu Thr 50 55 60Ile Pro Gly
Cys Glu Pro Val Arg Phe Glu Asp Ile Met Asp Ala Tyr 65
70 75 80Leu Val Pro Asp Glu Pro Val Tyr
His Asp Leu Val Arg His Cys Leu 85 90
95Ala Tyr Pro Lys Ala Asp Gly Ile Leu Val Asn Thr Trp Glu
Glu Met 100 105 110Glu Pro Lys
Ser Leu Lys Ser Leu Gln Asp Pro Lys Leu Leu Gly Arg 115
120 125Val Ala Arg Val Pro Val Tyr Pro Val Gly Pro
Leu Cys Arg Pro Ile 130 135 140Gln Ser
Ser Thr Thr Asp His Pro Val Phe Asp Trp Leu Asn Lys Gln145
150 155 160Pro Asn Glu Ser Val Leu Tyr
Ile Ser Phe Gly Ser Gly Gly Ser Leu 165
170 175Thr Ala Gln Gln Leu Thr Glu Leu Ala Trp Gly Leu
Glu Glu Ser Gln 180 185 190Gln
Arg Phe Ile Trp Val Val Arg Pro Pro Val Asp Gly Ser Ser Cys 195
200 205Ser Asp Tyr Phe Ser Ala Lys Gly Gly
Val Thr Lys Asp Asn Thr Pro 210 215
220Glu Tyr Leu Pro Glu Gly Phe Val Thr Arg Thr Cys Asp Arg Gly Phe225
230 235 240Met Ile Pro Ser
Trp Ala Pro Gln Ala Glu Ile Leu Ala His Gln Ala 245
250 255Val Gly Gly Phe Leu Thr His Cys Gly Trp
Ser Ser Thr Leu Glu Ser 260 265
270Val Leu Cys Gly Val Pro Met Ile Ala Trp Pro Leu Phe Ala Glu Gln
275 280 285Asn Met Asn Ala Ala Leu Leu
Ser Asp Glu Leu Gly Ile Ser Val Arg 290 295
300Val Asp Asp Pro Lys Glu Ala Ile Ser Arg Ser Lys Ile Glu Ala
Met305 310 315 320Val Arg
Lys Val Met Ala Glu Asp Glu Gly Glu Glu Met Arg Arg Lys
325 330 335Val Lys Lys Leu Arg Asp Thr
Ala Glu Met Ser Leu Ser Ile His Gly 340 345
350Gly Gly Ser Ala His Glu Ser Leu Cys Arg Val Thr Lys Glu
Cys Gln 355 360 365Arg Phe Leu Glu
Cys Val Gly Asp Leu Gly Arg Gly Ala 370 375
380271446DNAArabidopsis thaliana 27ctaagcacca cgtcccaagt ccccgacaca
ttccaaaaac cgttgacact ccttcgtgac 60tctgcaaagc gactcatgcg ccgaaccacc
accgtgaata ctaagtgaca tctccgccgt 120gtctctcaac ttcttcactt tccttctcat
ctcttcacct tcgtcctcag ccataacctt 180cctcaccatc gcctcaatct tcgacctaga
aatcgcctcc tttggatcat ccactctaac 240agagattccc agttcatcgc taagcaacgc
cgcgttcata ttctgctcgg cgaaaagcgg 300ccacgctatc attggaacgc cgcaaaggac
gctttccaac gtcgagctcc aaccacaatg 360tgttaaaaac ccaccaacgg cctgatgggc
taggatttca gcttgcggtg cccatgatgg 420gatcatgaaa cctctatcgc aagtacgagt
cacgaaccct tctggtagat actctggcgt 480gttgtctttg gttacaccgc ctttagccga
gaaataatca ctgcaagacg agccgtcaac 540gggcggtcga accacccata taaaccgttg
ctggctctcc tcgagccccc acgccaattc 600ggttaactgt tgagccgtta gagaaccacc
actcccgaag gaaatgtaga gaaccgactc 660gtttggttgt ttgtttaacc aatcaaaaac
cgggtgatcg gtcgtggatg attgtatcgg 720tctgcataac ggaccaaccg gataaaccgg
tacacgagcg acccggccca aaagtttcgg 780gtcttgaagg gactttaatg atttgggctc
catctcttcc catgtattca ccaagattcc 840atccgctttt gggtaggcca gacagtgacg
aaccaaatcg tggtacaccg gttcgtccgg 900aaccagatat gcatccataa tatcttcaaa
tctaaccggt tcacaccccg gtatagtgag 960cggttttcgt tgcactgtgt gctcttcttt
gataacttcg tccaaagttg gataatatat 1020cgaaactccg agataacgcg cgttggaagc
gataaagaca taagtcaaca tgtttaactc 1080cgctgcaaga cataacgcat ctgtgccaaa
caagtcaatg atcagagccg ttgggttttg 1140atgcatggca acgatcttgg atcggagggt
tggaacagct tcacgcataa tgactccgat 1200cttggtcacc acatgggcgt tggggtctac
caagccagaa atgtcgggcg atggaaggtt 1260gacgatgtca acaccggttg agttaaggag
cttggactga acggaggctg cgtcagtttc 1320aaggacgaag acggtgacgt ggaagccgtg
gttagcggag agacgcttag ctagctcgat 1380caccgggagg acatggccca ttccgggact
ggaaaacatg gcggcgtgtg gttttgtgat 1440atgcat
1446281446DNAArabidopsis thaliana
28atggggaagc aagaagatgc agagctcgtc atcatacctt tccctttctc cggacacatt
60ctcgcaacaa tcgaactcgc caaacgtctc ataagtcaag acaatcctcg gatccacacc
120atcaccatcc tctattgggg attacctttt attcctcaag ctgacacaat cgctttcctc
180cgatccctag tcaaaaatga gcctcgtatc cgtctcgtta cgttgcccga agtccaagac
240cctccaccaa tggaactctt tgtggaattt gccgaatctt acattcttga atacgtcaag
300aaaatggttc ccatcatcag agaagctctc tccactctct tgtcttcccg cgatgaatcg
360ggttcagttc gtgtggctgg attggttctt gacttcttct gcgtccctat gatcgatgta
420ggaaacgagt ttaatctccc ttcttacatt ttcttgacgt gtagcgcagg gttcttgggt
480atgatgaagt atcttccaga gagacaccgc gaaatcaaat cggaattcaa ccggagcttc
540aacgaggagt tgaatctcat tcctggttat gtcaactctg ttcctactaa ggttttgccg
600tcaggtctat tcatgaaaga gacctacgag ccttgggtcg aactagcaga gaggtttcct
660gaagctaagg gtattttggt taattcatac acagctctcg agccaaacgg ttttaaatat
720ttcgatcgtt gtccggataa ctacccaacc atttacccaa tcgggccgat attatgctcc
780aacgaccgtc cgaatttgga ctcatcggaa cgagatcgga tcataacttg gctagatgac
840caacccgagt catcggtcgt gttcctctgt ttcgggagct tgaagaatct cagcgctact
900cagatcaacg agatagctca agccttagag atcgttgact gcaaattcat ctggtcgttt
960cgaaccaacc cgaaggagta cgcgagccct tacgaggctc taccacacgg gttcatggac
1020cgggtcatgg atcaaggcat tgtttgtggt tgggctcctc aagttgaaat cctagcccat
1080aaagctgtgg gaggattcgt atctcattgt ggttggaact cgatattgga gagtttgggt
1140ttcggcgttc caatcgccac gtggccgatg tacgcggaac aacaactaaa cgcgttcacg
1200atggtgaagg agcttggttt agccttggag atgcggttgg attacgtgtc ggaagatgga
1260gatatagtga aagctgatga gatcgcagga accgttagat ctttaatgga cggtgtggat
1320gtgccgaaga gtaaagtgaa ggagattgct gaggcgggaa aagaagctgt ggacggtgga
1380tcttcgtttc ttgcggttaa aagattcatc ggtgacttga tcgacggcgt ttctataagt
1440aagtag
144629481PRTArabidopsis thaliana 29Met Gly Lys Gln Glu Asp Ala Glu Leu
Val Ile Ile Pro Phe Pro Phe 1 5 10
15Ser Gly His Ile Leu Ala Thr Ile Glu Leu Ala Lys Arg Leu Ile
Ser 20 25 30Gln Asp Asn Pro
Arg Ile His Thr Ile Thr Ile Leu Tyr Trp Gly Leu 35
40 45Pro Phe Ile Pro Gln Ala Asp Thr Ile Ala Phe Leu
Arg Ser Leu Val 50 55 60Lys Asn Glu
Pro Arg Ile Arg Leu Val Thr Leu Pro Glu Val Gln Asp 65
70 75 80Pro Pro Pro Met Glu Leu Phe Val
Glu Phe Ala Glu Ser Tyr Ile Leu 85 90
95Glu Tyr Val Lys Lys Met Val Pro Ile Ile Arg Glu Ala Leu
Ser Thr 100 105 110Leu Leu Ser
Ser Arg Asp Glu Ser Gly Ser Val Arg Val Ala Gly Leu 115
120 125Val Leu Asp Phe Phe Cys Val Pro Met Ile Asp
Val Gly Asn Glu Phe 130 135 140Asn Leu
Pro Ser Tyr Ile Phe Leu Thr Cys Ser Ala Gly Phe Leu Gly145
150 155 160Met Met Lys Tyr Leu Pro Glu
Arg His Arg Glu Ile Lys Ser Glu Phe 165
170 175Asn Arg Ser Phe Asn Glu Glu Leu Asn Leu Ile Pro
Gly Tyr Val Asn 180 185 190Ser
Val Pro Thr Lys Val Leu Pro Ser Gly Leu Phe Met Lys Glu Thr 195
200 205Tyr Glu Pro Trp Val Glu Leu Ala Glu
Arg Phe Pro Glu Ala Lys Gly 210 215
220Ile Leu Val Asn Ser Tyr Thr Ala Leu Glu Pro Asn Gly Phe Lys Tyr225
230 235 240Phe Asp Arg Cys
Pro Asp Asn Tyr Pro Thr Ile Tyr Pro Ile Gly Pro 245
250 255Ile Leu Cys Ser Asn Asp Arg Pro Asn Leu
Asp Ser Ser Glu Arg Asp 260 265
270Arg Ile Ile Thr Trp Leu Asp Asp Gln Pro Glu Ser Ser Val Val Phe
275 280 285Leu Cys Phe Gly Ser Leu Lys
Asn Leu Ser Ala Thr Gln Ile Asn Glu 290 295
300Ile Ala Gln Ala Leu Glu Ile Val Asp Cys Lys Phe Ile Trp Ser
Phe305 310 315 320Arg Thr
Asn Pro Lys Glu Tyr Ala Ser Pro Tyr Glu Ala Leu Pro His
325 330 335Gly Phe Met Asp Arg Val Met
Asp Gln Gly Ile Val Cys Gly Trp Ala 340 345
350Pro Gln Val Glu Ile Leu Ala His Lys Ala Val Gly Gly Phe
Val Ser 355 360 365His Cys Gly Trp
Asn Ser Ile Leu Glu Ser Leu Gly Phe Gly Val Pro 370
375 380Ile Ala Thr Trp Pro Met Tyr Ala Glu Gln Gln Leu
Asn Ala Phe Thr385 390 395
400Met Val Lys Glu Leu Gly Leu Ala Leu Glu Met Arg Leu Asp Tyr Val
405 410 415Ser Glu Asp Gly Asp
Ile Val Lys Ala Asp Glu Ile Ala Gly Thr Val 420
425 430Arg Ser Leu Met Asp Gly Val Asp Val Pro Lys Ser
Lys Val Lys Glu 435 440 445Ile Ala
Glu Ala Gly Lys Glu Ala Val Asp Gly Gly Ser Ser Phe Leu 450
455 460Ala Val Lys Arg Phe Ile Gly Asp Leu Ile Asp
Gly Val Ser Ile Ser465 470 475
480Lys301446DNAArabidopsis thaliana 30ctacttactt atagaaacgc
cgtcgatcaa gtcaccgatg aatcttttaa ccgcaagaaa 60cgaagatcca ccgtccacag
cttcttttcc cgcctcagca atctccttca ctttactctt 120cggcacatcc acaccgtcca
ttaaagatct aacggttcct gcgatctcat cagctttcac 180tatatctcca tcttccgaca
cgtaatccaa ccgcatctcc aaggctaaac caagctcctt 240caccatcgtg aacgcgttta
gttgttgttc cgcgtacatc ggccacgtgg cgattggaac 300gccgaaaccc aaactctcca
atatcgagtt ccaaccacaa tgagatacga atcctcccac 360agctttatgg gctaggattt
caacttgagg agcccaacca caaacaatgc cttgatccat 420gacccggtcc atgaacccgt
gtggtagagc ctcgtaaggg ctcgcgtact ccttcgggtt 480ggttcgaaac gaccagatga
atttgcagtc aacgatctct aaggcttgag ctatctcgtt 540gatctgagta gcgctgagat
tcttcaagct cccgaaacag aggaacacga ccgatgactc 600gggttggtca tctagccaag
ttatgatccg atctcgttcc gatgagtcca aattcggacg 660gtcgttggag cataatatcg
gcccgattgg gtaaatggtt gggtagttat ccggacaacg 720atcgaaatat ttaaaaccgt
ttggctcgag agctgtgtat gaattaacca aaataccctt 780agcttcagga aacctctctg
ctagttcgac ccaaggctcg taggtctctt tcatgaatag 840acctgacggc aaaaccttag
taggaacaga gttgacataa ccaggaatga gattcaactc 900ctcgttgaag ctccggttga
attccgattt gatttcgcgg tgtctctctg gaagatactt 960catcataccc aagaaccctg
cgctacacgt caagaaaatg taagaaggga gattaaactc 1020gtttcctaca tcgatcatag
ggacgcagaa gaagtcaaga accaatccag ccacacgaac 1080tgaacccgat tcatcgcggg
aagacaagag agtggagaga gcttctctga tgatgggaac 1140cattttcttg acgtattcaa
gaatgtaaga ttcggcaaat tccacaaaga gttccattgg 1200tggagggtct tggacttcgg
gcaacgtaac gagacggata cgaggctcat ttttgactag 1260ggatcggagg aaagcgattg
tgtcagcttg aggaataaaa ggtaatcccc aatagaggat 1320ggtgatggtg tggatccgag
gattgtcttg acttatgaga cgtttggcga gttcgattgt 1380tgcgagaatg tgtccggaga
aagggaaagg tatgatgacg agctctgcat cttcttgctt 1440ccccat
1446311425DNAArabidopsis
thaliana 31atggcgaagc agcaagaagc agagctcatc ttcatcccat ttccaatccc
cggacacatt 60ctcgccacaa tcgaactcgc gaaacgtctc atcagtcacc aacctagtcg
gatccacacc 120atcaccatcc tccattggag cttacctttt cttcctcaat ctgacactat
cgccttcctc 180aaatccctaa tcgaaacaga gtctcgtatc cgtctcatta ccttacccga
tgtccaaaac 240cctccaccaa tggagctatt tgtgaaagct tccgaatctt acattcttga
atacgtcaag 300aaaatggttc ctttggtcag aaacgctctc tccactctct tgtcttctcg
tgatgaatcg 360gattcagttc atgtcgccgg attagttctt gatttcttct gtgtcccttt
gatcgatgtc 420ggaaacgagt ttaatctccc ttcttacatc ttcttgacgt gtagcgcaag
tttcttgggt 480atgatgaagt atcttctgga gagaaaccgc gaaaccaaac cggaacttaa
ccggagctct 540gacgaggaaa caatatcagt tcctggtttt gttaactccg ttccggttaa
agttttgcca 600ccgggtttgt tcacgactga gtcttacgaa gcttgggtcg aaatggcgga
aaggttccct 660gaagccaagg gtattttggt caattcattt gaatctctag aacgtaacgc
ttttgattat 720ttcgatcgtc gtccggataa ttacccaccc gtttacccaa tcgggccaat
tctatgctcc 780aacgatcgtc cgaatttgga tttatcggaa cgagaccgga tcttgaaatg
gctcgatgac 840caacccgagt catctgttgt gtttctctgc ttcgggagct tgaagagtct
cgctgcgtct 900cagattaaag agatcgctca agccttagag ctcgtcggaa tcagattcct
ctggtcgatt 960cgaacggacc cgaaggagta cgcgagcccg aacgagattt taccggacgg
gtttatgaac 1020cgagtcatgg gtttgggcct tgtttgtggt tgggctcctc aagttgaaat
tctggcccat 1080aaagcaattg gagggttcgt gtcacactgc ggttggaact cgatattgga
gagtttgcgt 1140ttcggagttc caattgccac gtggccaatg tacgcggaac aacaactaaa
cgcgttcacg 1200attgtgaagg agcttggttt ggcgttggag atgcggttgg attacgtgtc
ggaatatgga 1260gaaatcgtga aagctgatga aatcgcagga gccgtacgat ctttgatgga
cggtgaggat 1320gtgccgagga ggaaactgaa ggagattgcg gaggcgggaa aagaggctgt
gatggacggt 1380ggatcttcgt ttgttgcggt taaaagattc atagatgggc tttga
142532474PRTArabidopsis thaliana 32Met Ala Lys Gln Gln Glu Ala
Glu Leu Ile Phe Ile Pro Phe Pro Ile 1 5
10 15Pro Gly His Ile Leu Ala Thr Ile Glu Leu Ala Lys Arg
Leu Ile Ser 20 25 30His Gln
Pro Ser Arg Ile His Thr Ile Thr Ile Leu His Trp Ser Leu 35
40 45Pro Phe Leu Pro Gln Ser Asp Thr Ile Ala
Phe Leu Lys Ser Leu Ile 50 55 60Glu
Thr Glu Ser Arg Ile Arg Leu Ile Thr Leu Pro Asp Val Gln Asn 65
70 75 80Pro Pro Pro Met Glu Leu
Phe Val Lys Ala Ser Glu Ser Tyr Ile Leu 85
90 95Glu Tyr Val Lys Lys Met Val Pro Leu Val Arg Asn
Ala Leu Ser Thr 100 105 110Leu
Leu Ser Ser Arg Asp Glu Ser Asp Ser Val His Val Ala Gly Leu 115
120 125Val Leu Asp Phe Phe Cys Val Pro Leu
Ile Asp Val Gly Asn Glu Phe 130 135
140Asn Leu Pro Ser Tyr Ile Phe Leu Thr Cys Ser Ala Ser Phe Leu Gly145
150 155 160Met Met Lys Tyr
Leu Leu Glu Arg Asn Arg Glu Thr Lys Pro Glu Leu 165
170 175Asn Arg Ser Ser Asp Glu Glu Thr Ile Ser
Val Pro Gly Phe Val Asn 180 185
190Ser Val Pro Val Lys Val Leu Pro Pro Gly Leu Phe Thr Thr Glu Ser
195 200 205Tyr Glu Ala Trp Val Glu Met
Ala Glu Arg Phe Pro Glu Ala Lys Gly 210 215
220Ile Leu Val Asn Ser Phe Glu Ser Leu Glu Arg Asn Ala Phe Asp
Tyr225 230 235 240Phe Asp
Arg Arg Pro Asp Asn Tyr Pro Pro Val Tyr Pro Ile Gly Pro
245 250 255Ile Leu Cys Ser Asn Asp Arg
Pro Asn Leu Asp Leu Ser Glu Arg Asp 260 265
270Arg Ile Leu Lys Trp Leu Asp Asp Gln Pro Glu Ser Ser Val
Val Phe 275 280 285Leu Cys Phe Gly
Ser Leu Lys Ser Leu Ala Ala Ser Gln Ile Lys Glu 290
295 300Ile Ala Gln Ala Leu Glu Leu Val Gly Ile Arg Phe
Leu Trp Ser Ile305 310 315
320Arg Thr Asp Pro Lys Glu Tyr Ala Ser Pro Asn Glu Ile Leu Pro Asp
325 330 335Gly Phe Met Asn Arg
Val Met Gly Leu Gly Leu Val Cys Gly Trp Ala 340
345 350Pro Gln Val Glu Ile Leu Ala His Lys Ala Ile Gly
Gly Phe Val Ser 355 360 365His Cys
Gly Trp Asn Ser Ile Leu Glu Ser Leu Arg Phe Gly Val Pro 370
375 380Ile Ala Thr Trp Pro Met Tyr Ala Glu Gln Gln
Leu Asn Ala Phe Thr385 390 395
400Ile Val Lys Glu Leu Gly Leu Ala Leu Glu Met Arg Leu Asp Tyr Val
405 410 415Ser Glu Tyr Gly
Glu Ile Val Lys Ala Asp Glu Ile Ala Gly Ala Val 420
425 430Arg Ser Leu Met Asp Gly Glu Asp Val Pro Arg
Arg Lys Leu Lys Glu 435 440 445Ile
Ala Glu Ala Gly Lys Glu Ala Val Met Asp Gly Gly Ser Ser Phe 450
455 460Val Ala Val Lys Arg Phe Ile Asp Gly
Leu465 470331425DNAArabidopsis thaliana 33tcaaagccca
tctatgaatc ttttaaccgc aacaaacgaa gatccaccgt ccatcacagc 60ctcttttccc
gcctccgcaa tctccttcag tttcctcctc ggcacatcct caccgtccat 120caaagatcgt
acggctcctg cgatttcatc agctttcacg atttctccat attccgacac 180gtaatccaac
cgcatctcca acgccaaacc aagctccttc acaatcgtga acgcgtttag 240ttgttgttcc
gcgtacattg gccacgtggc aattggaact ccgaaacgca aactctccaa 300tatcgagttc
caaccgcagt gtgacacgaa ccctccaatt gctttatggg ccagaatttc 360aacttgagga
gcccaaccac aaacaaggcc caaacccatg actcggttca taaacccgtc 420cggtaaaatc
tcgttcgggc tcgcgtactc cttcgggtcc gttcgaatcg accagaggaa 480tctgattccg
acgagctcta aggcttgagc gatctcttta atctgagacg cagcgagact 540cttcaagctc
ccgaagcaga gaaacacaac agatgactcg ggttggtcat cgagccattt 600caagatccgg
tctcgttccg ataaatccaa attcggacga tcgttggagc atagaattgg 660cccgattggg
taaacgggtg ggtaattatc cggacgacga tcgaaataat caaaagcgtt 720acgttctaga
gattcaaatg aattgaccaa aatacccttg gcttcaggga acctttccgc 780catttcgacc
caagcttcgt aagactcagt cgtgaacaaa cccggtggca aaactttaac 840cggaacggag
ttaacaaaac caggaactga tattgtttcc tcgtcagagc tccggttaag 900ttccggtttg
gtttcgcggt ttctctccag aagatacttc atcataccca agaaacttgc 960gctacacgtc
aagaagatgt aagaagggag attaaactcg tttccgacat cgatcaaagg 1020gacacagaag
aaatcaagaa ctaatccggc gacatgaact gaatccgatt catcacgaga 1080agacaagaga
gtggagagag cgtttctgac caaaggaacc attttcttga cgtattcaag 1140aatgtaagat
tcggaagctt tcacaaatag ctccattggt ggagggtttt ggacatcggg 1200taaggtaatg
agacggatac gagactctgt ttcgattagg gatttgagga aggcgatagt 1260gtcagattga
ggaagaaaag gtaagctcca atggaggatg gtgatggtgt ggatccgact 1320aggttggtga
ctgatgagac gtttcgcgag ttcgattgtg gcgagaatgt gtccggggat 1380tggaaatggg
atgaagatga gctctgcttc ttgctgcttc gccat
1425341437DNAArabidopsis thaliana 34atgaagattg agcttgtgtt catacctttg
ccggggattg gtcatctcag gccaaccgtg 60aagctagcga agcaactcat aggcagcgaa
aaccgtcttt cgatcaccat aatcatcatc 120ccttcaagat ttgacgccgg tgatgcatcc
gcctgtatcg catctctcac cacgttgtct 180caagatgatc gcctccatta cgaatccata
tccgtcgcaa aacaaccacc aacctccgac 240ccggatcctg ttccggctca agtgtacata
gagaaacaaa agacgaaagt gagagatgca 300gtcgcggcga gaatcgtcga tccaacaaga
aagctcgcgg gattcgtggt ggacatgttc 360tgttcctcga tgatcgatgt agctaacgag
tttggagttc cgtgttatat ggtatacaca 420tcgaacgcta cgtttttagg aaccatgctt
cacgttcaac aaatgtacga tcaaaagaag 480tatgacgtca gcgagttaga aaactcggtc
accgagttgg agtttccgtc tctgactcgt 540ccttatccag tgaagtgtct tcctcatatc
ctcacttcaa aggagtggtt acctctctct 600ctagctcaag ctaggtgttt ccggaagatg
aagggtattt tggtaaatac agttgctgag 660cttgaacctc acgctttgaa aatgttcaat
attaatggtg acgatcttcc tcaagtttat 720cctgttggac cagtgttgca tctcgaaaac
ggcaatgacg atgatgagaa gcaatcggaa 780attttgcggt ggctcgacga gcaaccgtct
aaatctgttg tgtttctctg ctttgggagc 840ttgggaggtt tcactgaaga acaaacaaga
gaaaccgctg tggccctaga tagaagcggt 900cagcggtttc tttggtgtct tcgtcacgca
tcgccaaata taaaaacaga tcgtcccaga 960gattacacga atcttgagga ggttttaccg
gaggggttct tggaacggac tttggataga 1020gggaaagtga ttggatgggc accacaagtg
gcggtactag agaagccggc gataggaggg 1080tttgtcactc actgcggttg gaactctatt
ttagagagct tgtggttcgg tgttccaatg 1140gtgacgtggc cgctatacgc ggaacagaag
gttaacgcgt ttgagatggt tgaggagctg 1200ggtttggcgg tggagatacg gaagtactta
aaaggagatt tgttcgccgg agagatggag 1260acggttaccg cggaggatat agagagagcc
attaggcgtg tgatggagca agacagtgac 1320gttaggaaca acgtgaaaga gatggcggag
aagtgccact tcgcgttaat ggacggtgga 1380tcttcgaagg cggctttgga aaagtttatt
caagacgtga tagagaatat ggattaa 1437351431DNAArabidopsis thaliana
35atgaaagcag aagcagagat catcttcgtt acatatccat cccctggtca tcttcttgtc
60tccattgaat tcgctaaatc tctcatcaaa cgtgatgatc gcatccacac catcaccatc
120ctctactggg ctttacctct cgctcctcaa gcccaccttt tcgctaagtc cctcgttgct
180tcacagcctc gaatccgtct ccttgcgttg cctgatgttc aaaaccctcc accattggaa
240ctcttcttta aagctcccga agcttatatt cttgagtcca ccaagaaaac agttccttta
300gtcagagacg ctctctccac tctagtttct tcacgtaaag aatccggttc ggttcgtgta
360gtcggtttgg ttatcgattt tttttgtgtt ccaatgatcg aagtggcaaa cgagcttaac
420cttccttctt acatcttcct aacgtgtaac gctgggtttt taagtatgat gaagtatctc
480cctgagagac atcgcataac cacttctgag ctagatttaa gctccggcaa cgtagaacat
540ccaattcctg gctacgtctg ctccgtgccg acgaaggttt tgcctccagg tctattcgtg
600agagagtcct acgaggcttg ggtcgagatt gcagagaagt tccctggagc caagggcatt
660ttggtaaact cagtcacatg tcttgagcag aatgcatttg attacttcgc tcgtcttgat
720gagaactatc ctccggttta cccggtcgga ccggttctta gtttgaagga tcgtccgtct
780ccaaatctgg acgcatcgga ccgggatcgg atcatgagat ggctcgagga ccagccggag
840tcgtcaattg tgtatatctg cttcggaagc ctcggaatca ttggcaagct gcagattgaa
900gagatagctg aagccttgga actcaccggc cacaggtttc tttggtcaat acgtacaaat
960ccgacggaga aagcgagccc gtacgatctg ttgccggagg gatttctcga tcggacggcc
1020agtaagggat tggtgtgtga ttgggccccg caagtagaag ttctggccca taaagcgctc
1080ggaggattcg tgtctcactg cggttggaac tctgtactgg agagcttatg gttcggtgtt
1140ccgatcgcca cgtggccaat gtacgctgag caacagttaa acgcattctc gatggtgaag
1200gagttagggt tagccgtgga gctgcgttta gactacgttt cggcgtacgg agagatagta
1260aaagctgagg agatcgcggg agccatacga tcattgatgg acggtgagga tacgccgagg
1320aagagagtga aggagatggc ggaagcggcg aggaatgctt tgatggacgg aggatcttcg
1380tttgttgcgg ttaaacgatt tctcgacgag ttgatcggcg gagatgttta g
1431361443DNAArabidopsis thaliana 36atgaagacag cagagctcat attcgttcct
ctgccggaga ccggccatct cttgtcaacg 60atcgagtttg gaaagcgtct actcaatcta
gaccgtcgga tttctatgat tacaatcctc 120tccatgaatc ttccttacgc tcctcacgcc
gacgcttctc ttgcttcgct aacagcctcc 180gagcctggta tccgaatcat cagtctcccg
gagatccacg atccacctcc gatcaagctt 240cttgacactt cctccgagac ttacatcctc
gatttcatcc ataaaaacat accttgtctc 300agaaaaacca tccaagattt agtctcatca
tcatcatctt ccggaggtgg tagtagtcat 360gtcgccggct tgattcttga tttcttctgc
gttggtttga tcgacatcgg ccgtgaggta 420aaccttcctt cctatatctt catgacttcc
aactttggtt tcttaggggt tctacagtat 480ctcccggaac gacaacgttt gactccgtcg
gagttcgatg agagctccgg cgaggaagag 540ttacatattc cggcgtttgt gaaccgtgtt
cccgccaagg ttctgccgcc aggtgtgttc 600gataaactct cttacgggtc tctggtcaaa
atcggcgagc gattacatga agccaagggt 660attttggtta attcatttac ccaagtggag
ccttatgctg ctgaacattt ttctcaagga 720cgagattacc ctcacgtgta tcctgttggg
ccggttctca acttaacggg ccgtacaaat 780ccgggtctag cttcggccca atataaagag
atgatgaagt ggcttgacga gcaaccagac 840tcgtcggttt tgttcctgtg tttcgggagc
atgggagtct tccctgcacc tcagatcaca 900gagattgctc acgcgctcga gcttatcggg
tgcaggttca tctgggcgat ccgtacgaac 960atggcgggag atggcgatcc tcaggagccg
cttccagaag gatttgtcga tcgaacaatg 1020ggccgtggaa ttgtgtgtag ttgggctcca
caagtggata tcttggccca caaggcaaca 1080ggtggattcg tttctcactg cgggtggaat
tccgtccaag agagtctatg gtacggtgta 1140cctattgcaa cgtggccaat gtatgcggag
caacaactga acgcatttga gatggtgaag 1200gagttgggct tagcagtgga gataaggctt
gactacgtgg cggatggtga tagggttact 1260ttggagatcg tgtcagccga tgaaatagcc
acagccgtcc gatcattgat ggatagtgat 1320aaccccgtga gaaagaaggt tatagaaaaa
tcttcagtgg cgaggaaagc tgttggtgat 1380ggtgggtctt ctacggtggc cacatgtaat
tttatcaaag atattcttgg ggatcacttt 1440tga
1443371404DNAArabidopsis thaliana
37atgcggaatg tagagctcat cttcatcccc acaccaaccg ttggtcatct tgttccgttt
60cttgaatttg ctaggcgtct cattgagcaa gatgatagga tccgtatcac aatcctcttg
120atgaaactac aaggtcagtc tcatctagac acttatgtta aatcaattgc ctcctctcaa
180ccgtttgtta gattcattga tgtccctgag ttagaggaga aacctacact tggtagtaca
240caatctgtgg aagcttatgt gtatgatgtt attgagagaa atatccctct tgtgaggaat
300atagtcatgg atattttaac ttctcttgca ttggatggag ttaaggtcaa gggattagtt
360gttgactttt tctgtctccc tatgattgac gttgctaaag atataagtct ccctttctat
420gtgttcttga ctacaaattc cgggttctta gctatgatgc agtatctagc agatcgacat
480agtagagata catcggtttt tgtaagaaac tcggaagaaa tgttgtcgat acctggattt
540gtaaaccctg tcccagccaa tgttctgccg tcagctctgt ttgttgaaga tggttatgat
600gcttacgtta agctggccat attgtttaca aaggccaatg gaatcctagt gaatagctcc
660tttgatattg agccttactc tgtgaatcat tttcttcaag aacagaatta tccttctgtt
720tatgctgttg gccccatatt tgacttgaaa gcccagcctc atccagagca ggacctaacc
780cgtcgtgacg agttgatgaa atggcttgat gatcaacccg aggcatcggt tgtattcctt
840tgttttggga gtatggcaag gttaagaggt tctctagtga aggaaatagc tcatggactt
900gagctatgtc aatatagatt cctctggtca ctccgtaaag aagaggtgac aaaggatgat
960ttgccagagg ggttccttga ccgtgtcgat ggacgtggaa tgatatgtgg ttggtctcct
1020caggtagaaa tactggccca taaggcagtg ggaggctttg tttctcactg tggatggaac
1080tcaatagtag agagtttgtg gtttggcgtg ccaattgtga catggccaat gtatgcagag
1140caacaactca atgcgtttct gatggtgaag gaactgaagc tagctgtgga gctgaagctt
1200gattacaggg tacatagtga tgagatagta aacgcaaacg agatagagac cgctattcgt
1260tatgtaatgg acacggataa taatgttgtg aggaaacgag tgatggatat ctcgcagatg
1320atccagagag ctacgaagaa tggtggatct tcgtttgccg caattgagaa attcatatat
1380gacgtgatag gaattaagcc ctag
1404381592DNAArabidopsis thaliana 38atgggaactc ctgtcgaagt ctctaagctc
catttcttgc tcttcccttt catggctcat 60ggccatatga taccaactct agacatggct
aagctctttg ccaccaaagg agctaaatcc 120actatcctca ctacacctct caatgccaag
ctcttcttcg agaaacccat caaatcattc 180aaccaagaca acccgggact cgaagacatc
accatccaga tccttaattt cccttgcaca 240gagcttggtt tgcctgatgg ctgtgagaat
actgatttca tcttctccac acctgaccta 300aacgtaggtg acttgagtca aaagttttta
ctcgcaatga aatatttcga agagccacta 360gaggagctcc tcgtgacaat gagaccagac
tgtcttgtcg gtaacatgtt cttcccttgg 420tccactaaag ttgctgagaa gttcggagta
ccgagacttg tgttccacgg cacaggctac 480ttctctttat gtgcttctca ttgcataagg
ctccctaaga atgtggcaac aagttctgag 540ccctttgtga ttcctgatct cccgggagac
attttgatta cagaggaaca ggtcatggag 600acagaagaag agtctgtaat ggggaggttt
atgaaggcaa taagagactc agagagagat 660agctttggcg tgttggtgaa cagcttctac
gagcttgaac aggcttactc agattatttc 720aagagctttg tggcgaaaag agcgtggcat
atcggtccgc tttccttagg aaatagaaag 780ttcgaggaga aagcagaaag aggcaaaaag
gcaagcattg atgagcatga atgtttgaaa 840tggctcgact ccaagaaatg tgattcagtg
atttacatgg cctttggaac catgtctagc 900tttaaaaacg agcagctgat agagattgca
gctggtttag atatgtcagg acatgatttt 960gtctgggtgg ttaacagaaa aggcagccaa
ggtaccatag acatcactct ctttgcagca 1020aaatcctctg tttttgtttt agagaaaaac
caatgatcta attaggattc tactgtttca 1080aactctaact tttgcgtttg cattacatat
aaatagttga gaaggaagat tggttaccag 1140aggggtttga agagaagacc aagggaaaag
gattgataat ccgagggtgg gcgccacaag 1200tgctgatact tgagcacaaa gcaattggcg
gatttttgac gcattgtgga tggaactcgt 1260tattagaagg ggtggcagcg ggcctgccaa
tggtgacatg gcccgtggga gccgagcagt 1320tctacaacga gaaattggtg acacaagtgt
tgaaaacagg agtgagtgtg ggagtgaaga 1380agatgatgca agtagttgga gacttcatta
gcagagagaa agtggaggga gcggtgaggg 1440aagtgatggt tggagaagag aggaggaaac
gggccaagga gttagcagaa atggcgaaaa 1500atgcggtgaa agaaggagga tcttcagatc
tagaggtaga taggttgatg gaagagctta 1560cgttagttaa actgcaaaaa gagaaggtat
aa 1592391541DNAArabidopsis thaliana
39atgggtagtg atcatcatca tcgaaagctc cacgttatgt tcttcccttt catggcttat
60ggtcacatga taccaactct agacatggct aagcttttct ctagcagagg agccaaatcc
120acaatcctca ccacatctct caactccaag atcctccaaa aacccatcga cacattcaag
180aatctgaatc cgggtctcga aatcgacatc cagatcttca atttcccttg cgtggagctg
240gggttaccag aaggatgtga aaacgttgat ttcttcactt caaacaacaa tgatgataaa
300aacgagatga tcgtgaaatt ctttttctcg acaaggtttt tcaaagacca gcttgagaaa
360ctcctcggga caacgagacc agactgtctt atcgccgaca tgttcttccc ctgggctact
420gaagctgctg ggaagttcaa tgtgccaaga cttgtgttcc acggcactgg ctacttctct
480ttatgcgctg gttattgcat cggagtgcat aaaccacaga agagagtggc ttcaagctct
540gagccatttg tgattcccga gctccctggg aacattgtga taactgaaga acagatcata
600gatggcgatg gagaatccga catgggaaag tttatgactg aagttaggga atcggaagtg
660aagagctcag gagttgtttt gaatagtttc tacgagctag aacatgatta cgccgatttt
720tacaaaagtt gtgtacaaaa gagagcgtgg catatcggtc cgctatcggt ttacaacagg
780ggatttgagg agaaggctga gagaggaaag aaagcgaaca ttgatgaggc tgaatgcctc
840aaatggcttg actccaagaa accaaattca gtcatttatg tttcctttgg gagcgtggct
900ttcttcaaga atgaacagtt attcgagatc gctgcagggt tagaagcttc cggtacaagt
960ttcatttggg ttgttaggaa aaccaaaggt attgaaattg acgtttgaag cctatattat
1020atagctgtaa tttgggtagc tttgatttta atctgacaca agatttggtg tgaacagatg
1080atagagaaga atggttacca gaagggttcg aagagagggt gaaagggaaa ggtatgataa
1140taagaggatg ggcaccacag gtgctgatac ttgaccacca agcaaccggt gggtttgtga
1200cccattgcgg ctggaactcg cttcttgaag gagtggctgc agggctacca atggtgacat
1260ggcctgtagg agcggagcaa ttctacaatg agaaattggt tacgcaagtg ctcagaacag
1320gagtgagcgt gggagcgagc aagcatatga aagttatgat gggagatttc attagcagag
1380agaaagtgga taaagcggtg agggaggttt tggctgggga agcagcagag gagaggcgga
1440gacgggcaaa gaagctagcg gcgatggcta aagctgccgt ggaagaagga gggtcttcct
1500tcaacgatct aaacagcttc atggaagagt ttagttcata a
1541401649DNAArabidopsis thaliana 40atgaacagag agcaaattca tattttgttc
ttccccttca tggctcatgg ccacatgatt 60ccactcttag acatggccaa gcttttcgct
agaagaggag ccaaatcaac tctcctcaca 120accccaataa atgctaagat cttggagaaa
cccattgaag cattcaaagt tcaaaatcct 180gatctcgaaa tcggaatcaa gatcctcaat
ttcccttgtg tagagcttgg attgccagaa 240ggatgcgaga accgtgactt cattaactca
taccaaaaat ctgactcatt tgacttgttc 300ttgaagtttc ttttctctac caagtatatg
aaacagcagt tggagagttt cattgaaaca 360accaaaccga gtgctcttgt agccgatatg
ttcttccctt gggcaacaga atccgcggag 420aagatcggtg ttccaagact tgtgttccac
ggcacatcat cctttgcctt gtgttgttcg 480tataacatga ggattcataa gccacacaag
aaagtcgctt cgagttctac tccatttgta 540atccctggtc tccctggaga catagttatt
acagaagacc aagccaatgt caccaacgaa 600gaaactccat tcggaaagtt ttggaaagaa
gtcagggaat cagagaccag tagctttggt 660gttttggtga atagcttcta cgagctggaa
tcatcttatg ctgattttta ccgtagtttt 720gtggcgaaaa aagcgtggca tataggtcca
ctttcactat ccaacagagg gattgcagag 780aaagccggaa gagggaaaaa ggcaaacatt
gatgagcaag aatgcctcaa atggcttgac 840tctaagacac ctggctcagt agtttacttg
tcctttggta gcggaaccgg cttacccaac 900gaacagctgt tagagattgc tttcggcctt
gaaggctctg gacaaaattt catttgggtg 960gttagcaaaa atgaaaacca aggtaatttt
tttcctcctt aaccattatt aatcaatgta 1020gtctttatta gtatatttcc aaaaatatta
acatttgtgt atacattttc ctattgccaa 1080atatgctatg atgccatagc aatgagtaga
ttggtttgtg tactttatat attactttgt 1140agaacttcta acaattatga cttggtgttg
gtgtagttgg gacaggtgaa aatgaagatt 1200ggttgcctaa agggtttgaa gagaggaata
aaggaaaagg gctgataata cgcggatggg 1260ccccgcaagt gctgatactt gaccacaaag
caatcggagg atttgtgacg cattgcggat 1320ggaactcgac tttggagggc attgccgcag
ggctgcctat ggtgacttgg ccgatggggg 1380cagaacagtt ctacaacgag aagttattga
caaaagtgtt gagaatagga gtgaacgttg 1440gagctaccga gttggtgaaa aaaggaaagt
tgattagtag agcacaagtg gagaaggcag 1500taagggaagt gattggtggt gagaaggcag
aggaaaggcg gctaagggct aaggagctgg 1560gcgagatggc taaagccgct gtggaagaag
gagggtcttc ttataatgat gtgaacaagt 1620ttatggaaga gctgaatggt agaaagtag
1649411636DNAArabidopsis thaliana
41atgaacagag aagtctctga gagaattcat attttgttct tccccttcat ggctcaaggc
60cacatgattc caattttgga catggccaag cttttctcga ggagaggagc caagtcaacc
120cttctcacaa ccccaatcaa cgctaagatc ttcgagaaac ctattgaagc attcaaaaat
180caaaaccctg atctcgaaat cggaatcaag atcttcaatt tcccttgtgt agagcttgga
240ttgcctgaag gatgcgagaa cgctgacttt atcaactcat accaaaaatc tgactcaggt
300gacttgttct tgaagtttct tttctctacc aagtatatga aacaacagtt ggagagtttc
360attgaaacaa ccaaaccaag tgctcttgtt gccgatatgt tcttcccttg ggcgacagaa
420tctgctgaga agctcggtgt accaagactt gtgttccacg gtacatcttt cttttctttg
480tgttgttcgt ataacatgag gattcataag ccacacaaga aagtcgctac gagttctact
540ccttttgtaa tccctggtct cccaggagac atagttatta cagaagacca agccaatgtt
600gccaaagaag aaacgccaat gggaaagttt atgaaagagg ttagggaatc agagaccaat
660agctttggtg tattggttaa tagcttctac gagctggaat cagcttatgc tgatttttat
720cgtagttttg tggcgaaaag agcttggcat atcggtccgc tttcgctatc taacagagag
780ttaggagaga aagccagaag agggaaaaag gctaacattg atgagcaaga atgcctaaaa
840tggctggact ctaagacacc tggttcagta gtttacttgt cctttgggag cggaactaat
900ttcaccaacg accagctgtt agagatcgct tttggtcttg aaggttctgg acaaagtttc
960atctgggtgg ttaggaaaaa tgaaaaccaa ggtaaattgt ttctccccag ccattattaa
1020ccaacatagt aatgttaata tttgtgtata tattcgtatt gccaaatatg ctctgatacc
1080atggcaagta atagattggc tcatgtattt tatttgtgat catgtagaat tttcttaaca
1140gttatgactt ggtgttggta tggttgggac aggtgacaat gaagagtggt tgcctgaagg
1200gtttaaagag aggacaacag ggaaagggct aataatacct ggatgggcgc cgcaagtgct
1260gatacttgac cataaagcaa ttggaggatt tgtgactcat tgcggatgga actcggctat
1320agagggcatt gccgcggggc tgcctatggt aacatggcca atgggggcag aacagttcta
1380caatgagaag ctattgacaa aagtgttgag aataggagtg aacgttggag ctaccgagtt
1440ggtgaaaaaa ggaaagttga ttagtagagc acaagtggag aaggcagtaa gggaagtgat
1500tggtggtgag aaggcagagg aaaggcggct atgggctaag aagctgggcg agatggctaa
1560agccgctgtg gaagaaggag ggtcctctta taatgatgtg aacaagttta tggaagagct
1620gaatggtaga aagtag
1636421476DNAArabidopsis thaliana 42atggcatcgg aatttcgtcc tcctcttcat
tttgttctct tccctttcat ggctcaaggc 60cacatgatcc caatggtaga tattgcaagg
ctcctggctc agcgcggggt gactataacc 120attgtcacta cacctcaaaa cgcaggccgg
ttcaagaacg ttcttagccg ggctatccaa 180tccggcttgc ccatcaatct cgtgcaagta
aagtttccat ctcaagaatc gggttcaccg 240gaaggacagg agaatttgga cttgctcgat
tcattggggg cttcattaac cttcttcaaa 300gcatttagcc tgctcgagga accagtcgag
aagctcttga aagagattca acctaggcca 360aactgcataa tcgctgacat gtgtttgcct
tatacaaaca gaattgccaa gaatcttggt 420ataccaaaaa tcatctttca tggcatgtgt
tgcttcaatc ttctttgtac gcacataatg 480caccaaaacc acgagttctt ggaaactata
gagtctgaca aggaatactt ccccattcct 540aatttccctg acagagttga gttcacaaaa
tctcagcttc caatggtatt agttgctgga 600gattggaaag acttccttga cggaatgaca
gaaggggata acacttctta tggtgtgatt 660gttaacacgt ttgaagagct cgagccagct
tatgttagag actacaagaa ggttaaagcg 720ggtaagatat ggagcatcgg accggtttcc
ttgtgcaaca agttaggaga agaccaagct 780gagaggggaa acaaggcgga cattgatcaa
gacgagtgta ttaaatggct tgattctaaa 840gaagaagggt cggtgctata tgtttgcctt
ggaagtatat gcaatcttcc tctgtctcag 900ctcaaagagc tcggcttagg cctcgaggaa
tcccaaagac ctttcatttg ggtcataaga 960ggttgggaga agtataacga gttacttgaa
tggatctcag agagcggtta taaggaaaga 1020atcaaagaaa gaggccttct cataacagga
tggtcgcctc aaatgcttat ccttacacat 1080cctgccgttg gaggattctt gacacattgt
ggatggaact ctactcttga aggaatcact 1140tcaggcgttc cattactcac gtggccactg
tttggagacc aattctgcaa tgagaaattg 1200gcggtgcaga tactaaaagc cggtgtgaga
gctggggttg aagagtccat gagatgggga 1260gaagaggaga aaataggagt actggtggat
aaagaaggag taaagaaggc agtggaggaa 1320ttgatgggtg atagtaatga tgctaaggag
agaagaaaaa gagtgaaaga gcttggagaa 1380ttagctcaca aggctgtgga agaaggaggc
tcttctcatt ccaacatcac attcttgcta 1440caagacataa tgcaattaga acaacccaag
aaatga 1476431491DNAArabidopsis thaliana
43atggctacgg aaaaaaccca ccaatttcat ccttctcttc actttgtcct cttccctttc
60atggctcaag gccacatgat tcccatgatt gatattgcaa gactcttggc tcagcgtggt
120gtgaccataa caattgtcac gacacctcac aacgcagcaa ggtttaagaa tgtcctaaac
180cgagcgatcg agtctggctt ggccatcaac atactgcatg tgaagtttcc atatcaagag
240tttggtttgc cagaaggaaa agagaatata gattcgttag actcaacgga gttgatggta
300cctttcttca aagcggtgaa cttgcttgaa gatccggtca tgaagctcat ggaagagatg
360aaacctagac ctagctgtct aatttctgat tggtgtttgc cttatacaag cataatcgcc
420aagaacttca atataccaaa gatagttttc cacggcatgg gttgctttaa tcttttgtgt
480atgcatgttc tacgcagaaa cttagagatc ctagagaatg taaagtcgga tgaagagtat
540ttcttggttc ctagttttcc tgatagagtt gaatttacaa agcttcaact tcctgtgaaa
600gcaaatgcaa gtggagattg gaaagagata atggatgaaa tggtaaaagc agaatacaca
660tcctatggtg tgatcgtcaa cacatttcag gagttggagc caccttatgt caaagactac
720aaagaggcaa tggatggaaa agtatggtcc attggacccg tttccttgtg taacaaggca
780ggtgcagaca aagctgagag gggaagcaag gccgccattg atcaagatga gtgtcttcaa
840tggcttgatt ctaaagaaga aggttcggtg ctctatgttt gccttggaag tatatgtaat
900cttcctttgt ctcagctcaa ggagctgggg ctaggccttg aggaatctcg aagatctttt
960atttgggtca taagaggttc ggaaaagtat aaagaactat ttgagtggat gttggagagc
1020ggttttgaag aaagaatcaa agagagagga cttctcatta aagggtgggc acctcaagtc
1080cttatccttt cacatccttc cgttggagga ttcctgacac actgtggatg gaactcgact
1140ctcgaaggaa tcacctcagg cattccactg atcacttggc cgctgtttgg agaccaattc
1200tgcaaccaaa aactggtcgt tcaagtacta aaagccggtg taagtgccgg ggttgaagaa
1260gtcatgaaat ggggagaaga agataaaata ggagtgttag tggataaaga aggagtgaaa
1320aaggctgtgg aagaattgat gggtgatagt gatgatgcaa aagagaggag aagaagagtc
1380aaagagcttg gagaattagc tcacaaagct gtggaaaaag gaggctcttc tcattctaac
1440atcacactct tgctacaaga cataatgcaa ctagcacaat tcaagaattg a
1491441488DNAArabidopsis thaliana 44atggtttccg aaacaaccaa atcttctcca
cttcactttg ttctcttccc tttcatggct 60caaggccaca tgattcccat ggttgatatt
gcaaggctct tggctcagcg tggtgtgatc 120ataacaattg tcacgacgcc tcacaatgca
gcgaggttca agaatgtcct aaaccgtgcc 180attgagtctg gcttgcccat caacttagtg
caagtcaagt ttccatatct agaagctggt 240ttgcaagaag gacaagagaa tatcgattct
cttgacacaa tggagcggat gatacctttc 300tttaaagcgg ttaactttct cgaagaacca
gtccagaagc tcattgaaga gatgaaccct 360cgaccaagct gtctaatttc tgatttttgt
ttgccttata caagcaaaat cgccaagaag 420ttcaatatcc caaagatcct cttccatggc
atgggttgct tttgtcttct gtgtatgcat 480gttttacgca agaaccgtga gatcttggac
aatttaaagt cagataagga gcttttcact 540gttcctgatt ttcctgatag agttgaattc
acaagaacgc aagttccggt agaaacatat 600gttccagctg gagactggaa agatatcttt
gatggtatgg tagaagcgaa tgagacatct 660tatggtgtga tcgtcaactc atttcaagag
ctcgagcctg cttatgccaa agactacaag 720gaggtaaggt ccggtaaagc atggaccatt
ggacccgttt ccttgtgcaa caaggtagga 780gccgacaaag cagagagggg aaacaaatca
gacattgatc aagatgagtg ccttaaatgg 840ctcgattcta agaaacatgg ctcggtgctt
tacgtttgtc ttggaagtat ctgtaatctt 900cctttgtctc aactcaagga gctgggacta
ggcctagagg aatcccaaag acctttcatt 960tgggtcataa gaggttggga gaagtacaaa
gagttagttg agtggttctc ggaaagcggc 1020tttgaagata gaatccaaga tagaggactt
ctcatcaaag gatggtcccc tcaaatgctt 1080atcctttcac atccatcagt tggagggttc
ctaacacact gtggttggaa ctcgactctt 1140gaggggataa ctgctggtct accgctactt
acatggccgc tattcgcaga ccaattctgc 1200aatgagaaat tggtcgttga ggtactaaaa
gccggtgtaa gatccggggt tgaacagcct 1260atgaaatggg gagaagagga gaaaatagga
gtgttggtgg ataaagaagg agtgaagaag 1320gcagtggaag aattaatggg tgagagtgat
gatgcaaaag agagaagaag aagagccaaa 1380gagcttggag attcagctca caaggctgtg
gaagaaggag gctcttctca ttctaacatc 1440tctttcttgc tacaagacat aatggaactg
gcagaaccca ataattga 1488451488DNAArabidopsis thaliana
45atggctttcg aaaaaaacaa cgaacctttt cctcttcact ttgttctctt ccctttcatg
60gctcaaggcc acatgattcc catggttgat attgcaaggc tcttggctca gcgaggtgtg
120cttataacaa ttgtcacgac gcctcacaat gcagcaaggt tcaagaatgt cctaaaccgt
180gccattgagt ctggtttgcc catcaaccta gtgcaagtca agtttccata tcaagaagct
240ggtctgcaag aaggacaaga aaatatggat ttgcttacca cgatggagca gataacatct
300ttctttaaag cggttaactt actcaaagaa ccagtccaga accttattga agagatgagc
360ccgcgaccaa gctgtctaat ctctgatatg tgtttgtcgt atacaagcga aatcgccaag
420aagttcaaaa taccaaagat cctcttccat ggcatgggtt gcttttgtct tctgtgtgtt
480aacgttctgc gcaagaaccg tgagatcttg gacaatttaa agtctgataa ggagtacttc
540attgttcctt attttcctga tagagttgaa ttcacaagac ctcaagttcc ggtggaaaca
600tatgttcctg caggctggaa agagatcttg gaggatatgg tagaagcgga taagacatct
660tatggtgtta tagtcaactc atttcaagag ctcgaacctg cgtatgccaa agacttcaag
720gaggcaaggt ctggtaaagc atggaccatt ggacctgttt ccttgtgcaa caaggtagga
780gtagacaaag cagagagggg aaacaaatca gatattgatc aagatgagtg ccttgaatgg
840ctcgattcta aggaaccggg atctgtgctc tacgtttgcc ttggaagtat ttgtaatctt
900cctctgtctc agctccttga gctgggacta ggcctagagg aatcccaaag acctttcatc
960tgggtcataa gaggttggga gaaatacaaa gagttagttg agtggttctc ggaaagcggc
1020tttgaagata gaatccaaga tagaggactt ctcatcaaag gatggtcccc tcaaatgctt
1080atcctttcac atccttctgt tggagggttc ttaacgcact gcggatggaa ctcgactctt
1140gaggggataa ctgctggtct accaatgctt acatggccac tatttgcaga ccaattctgc
1200aacgagaaac tggtcgtaca aatactaaaa gtcggtgtaa gtgccgaggt taaagaggtc
1260atgaaatggg gagaagaaga gaagatagga gtgttggtgg ataaagaagg agtgaagaag
1320gcagtggaag aactaatggg tgagagtgat gatgcaaaag agagaagaag aagagccaaa
1380gagcttggag aatcagctca caaggctgtg gaagaaggag gctcctctca ttctaatatc
1440actttcttgc tacaagacat aatgcaacta gcacagtcca ataattga
1488461473DNAArabidopsis thaliana 46atgtgttctc atgatcctct tcacttcgtc
gtaataccct ttatggccca aggccatatg 60atcccattgg tcgacatctc taggctcttg
tcccagcgcc aaggcgtgac tgtctgcatc 120atcacaacta ctcaaaatgt agccaagatc
aagacttcac tctcattttc ctctttgttt 180gcgactatca acatcgttga agttaagttt
ctgtctcaac aaacgggttt gccagaaggg 240tgcgagagtt tagatatgtt ggcttcaatg
ggcgatatgg tgaagttctt tgatgctgcc 300aactcacttg aggagcaagt tgagaaagct
atggaagaga tggttcagcc gcggccaagc 360tgcatcattg gagacatgag ccttcctttc
acttcaagac ttgccaagaa attcaagatc 420cccaaactta tcttccatgg gttttcttgt
ttcagcctca tgtctataca agtggttcga 480gaaagcggga tcttgaaaat gatagaatca
aacgacgagt attttgattt gcccggcttg 540cctgacaaag ttgagttcac gaaacctcag
gtctctgtgt tgcaacctgt tgaaggaaat 600atgaaagaga gtacggccaa gattattgaa
gctgataatg actcttatgg tgttattgtg 660aacacttttg aagagttaga ggttgattat
gcaagagaat ataggaaagc aagggctgga 720aaagtttggt gcgttggacc tgtttccttg
tgcaataggt tagggttaga caaagctaaa 780agaggagata aggcttctat tggtcaagac
caatgtcttc aatggcttga ctctcaagaa 840actggttcag tgctctacgt ttgccttgga
agtctatgta atcttccctt ggctcagctc 900aaagagctgg gactaggcct tgaggcatct
aataaacctt tcatatgggt tataagagaa 960tggggaaaat atggagattt agcaaattgg
atgcaacaaa gcggatttga agagcggatc 1020aaagatagag gactggtgat caaaggttgg
gcgccgcaag ttttcatcct ctcacacgca 1080tccattggag ggtttttgac tcactgtgga
tggaactcga cactagaagg aattactgca 1140ggagttccat tattgacatg gcctttgttt
gctgaacaat tcttgaatga gaagttagtt 1200gtgcagatac taaaagcagg gttaaagata
ggagtagaga aattgatgaa atatggaaaa 1260gaagaggaga taggagcgat ggtgagcaga
gaatgtgtga gaaaagctgt ggatgagcta 1320atgggtgata gtgaagaagc agaagagaga
agaagaaaag ttacagaact tagtgacttg 1380gcaaataagg ctttggaaaa aggaggatct
tcagattcta atatcacatt gctcattcaa 1440gatattatgg agcaatcaca aaatcaattt
taa 1473471437DNAArabidopsis thaliana
47atggagcata agagaggaca tgtattagca gtgccgtacc caacgcaagg acacatcaca
60ccattccgcc aattctgcaa acgacttcac ttcaaaggtc tcaaaaccac tctcgctctc
120accactttcg tcttcaactc catcaatcct gacctatccg gtccaatctc catagccacc
180atctccgatg gctatgacca tgggggtttc gagacagctg actccatcga cgactacctc
240aaagacttta aaacttccgg ctcgaaaacc attgcagaca tcatccaaaa acaccagact
300agtgataacc ccatcacttg tatcgtctat gatgctttcc tgccttgggc acttgacgtt
360gctagagagt ttggtttagt tgcgactcct ttctttacgc agccttgtgc tgttaactat
420gtttattatc tttcttacat aaacaatgga agcttgcaac ttcccattga ggaattgcct
480tttcttgagc tccaagattt gccttctttc ttctctgttt ctggctctta tcctgcttac
540tttgagatgg tgcttcaaca gttcataaat ttcgaaaaag ctgatttcgt tctcgttaat
600agcttccaag agttggaact gcatgttaga tctctctcta tctctttctt acaattctta
660aaccatctct tgttcttgtg catgtactaa ctgctctttt tttgtttaca ggagaatgaa
720ttgtggtcga aagcttgtcc tgtgttgaca attggtccaa ctattccatc aatttactta
780gaccaacgta tcaaatcaga caccggctat gatcttaatc tctttgaatc gaaagatgat
840tccttctgca ttaactggct cgacacaagg ccacaagggt cggtggtgta cgtagcattc
900ggaagcatgg ctcagctgac taatgtgcag atggaggagc ttgcttcagc agtaagcaac
960ttcagcttcc tgtgggtggt cagatcttca gaggaggaaa aactcccatc agggtttctt
1020gagacagtga ataaagaaaa gagcttggtc ttgaaatgga gtcctcagct tcaagttctg
1080tcaaacaaag ccatcggttg tttcttgact cactgtggct ggaactcaac catggaggct
1140ttgaccttcg gggttcccat ggtggcaatg ccccaatgga ctgatcaacc gatgaacgca
1200aagtacatac aagatgtgtg gaaggctgga gttcgtgtga agacagagaa ggagagtggg
1260attgccaaga gagaggagat tgagtttagc attaaggaag tgatggaagg agagaggagc
1320aaagagatga agaagaacgt gaagaaatgg agagacttgg ctgtcaagtc actcaatgaa
1380ggaggttcta cggatactaa cattgataca tttgtatcaa gggttcagag caaatag
1437481451DNAArabidopsis thaliana 48atggaagaac taggagtgaa gagaaggata
gtattggttc cagttccagc acaaggtcat 60gtaactccga ttatgcaact cgggaaggct
ctttactcca agggcttctc catcactgtt 120gttctcacac agtataatcg agttagctca
tccaaggact tctctgattt tcatttcctc 180accatcccag gcagcttgac cgagtctgat
ctcaaaaacc ttggaccatt caagtttctc 240ttcaagctca atcaaatttg cgaggcaagc
ttcaagcaat gtattggtca actattgcag 300gagcaaggta atgatatcgc ttgtgtcgtc
tacgatgagt acatgtactt ctcccaagct 360gcagttaaag agtttcaact tcctagcgtc
ctcttcagca cgacaagtgc tactgccttt 420gtctgtcgct ctgttttgtc tagagtcaac
gcagagtcat tcttgcttga catgaaaggt 480actcaagatt ttttagcttg ttaactcaaa
ctttaaaagt gcatttaggt atataaacca 540atccaaatgc tgttgtttgc tttgcagatc
ccaaagtgtc agacaaggaa tttccagggt 600tgcatccgct aaggtacaag gacctgccaa
cttcagcatt tgggccatta gagagtatac 660tcaaggttta cagtgagact gtcaacattc
gaacagcttc ggcagttatc atcaactcaa 720caagctgtct agagagctca tctttggcat
ggttacaaaa acaactgcaa gttccagtgt 780atcctatagg cccacttcac attgcagctt
cagcgccttc tagtttactt gaagaggaca 840ggagttgcct tgagtggttg aacaagcaaa
aaataggctc agtgatttac ataagtttgg 900gaagcttggc tctaatggaa actaaagaca
tgttggagat ggcttggggt ttacgtaata 960gcaaccaacc tttcttatgg gtgatccgac
cgggttctat tcccggctcg gaatggacag 1020agtctttacc ggaggaattc agtaggttgg
tttcagaaag aggttacatt gtgaaatggg 1080caccacagat agaagttctc agacatcctg
cagtgggagg gttttggagt cactgcggat 1140ggaactcgac cctagagagc atcggggaag
gagttccgat gatctgtagg ccttttacgg 1200gagatcagaa agtcaatgcg aggtacttag
agagagtttg gagaattggg gttcaattgg 1260aaggagagct ggataaagga acagtggaga
gagctgtaga gagattgatt atggatgaag 1320aaggagcaga aatgaggaag agagttatca
acttgaaaga gaagcttcaa gcctctgtca 1380agagtagagg ttcctcattc agctcattag
acaactttgt caattcctta aaaatgatga 1440atttcatgta g
1451491433DNAArabidopsis thaliana
49atggaggaaa agccggcggg cagaagagta gtgttggttg cagttccagc tcaaggacat
60atctctccaa taatgcaact tgcaaaaaca cttcacttga agggtttctc aatcacaatc
120gctcagacaa agttcaatta ctttagccct tcagatgact tcactgattt tcagtttgtc
180accattccag aaagcttacc agagtctgat tttgaggatc tcgggccaat agagtttctg
240cataagctca acaaagagtg tcaggtgagc ttcaaagact gtttgggtca gttgttgctg
300caacaaggta atgagatagc ctgtgttgtc tacgacgagt tcatgtactt tgctgaagct
360gcagccaaag agtttaagct tccaaacgtc attttcagca ccacaagtgc cacggctttt
420gtttgccgct ctgcattcga caaactttat gcaaacagta tcctgactcc cttgaaaggt
480actcttgaat tctctgtctt ctattcttgc tggtttctat aatctgtaac agcatggttc
540ttgacctttt tgcagaaccc aaaggacaac aaaacgagct agtgccagag tttcatcccc
600tgagatgcaa agactttccg gtttcacatt gggcatcatt agaaagcatg atggagctgt
660ataggaatac agttgacaaa cggacagctt cctcggtgat aatcaacaca gcgagctgtc
720tagagagctc atctctgtct cgtctgcagc aacagctaca aattccagtt tatcctatag
780gccctcttca cctggtggca tcagcttcta cgagtcttct tgaagagaac aagagctgta
840ttgaatggtt gaacaaacaa aagaaaaact ctgtgatatt cgtaagcttg ggaagcttag
900ctttgatgga aatcaatgag gtgatagaaa ctgctttggg attggatagt agcaagcaac
960agttcttgtg ggtcattcgg ccagggtcag tacgtggttc ggaatggata gagaacttgc
1020ctaaggagtt tagtaagata atttcgggtc gaggttacat tgtgaaatgg gctccacaga
1080aggaagtact ttctcatcct gcagtaggag gattttggag ccattgcgga tggaactcga
1140cactagagag catcggggaa ggagttccaa tgatttgcaa gccgttttcc agtgatcaaa
1200tggtgaatgc gagatacttg gagtgtgtat ggaaaattgg gattcaagtt gagggtgatc
1260tagacagagg agcggtcgag agagctgtga ggaggttaat ggtggaggaa gaaggggagg
1320ggatgaggaa gagagctatc agtttgaaag agcaacttag agcctctgtt ataagtggag
1380gttcttcaca caactcgcta gaggagtttg tacactacat gaggactcta tga
1433501457DNAArabidopsis thaliana 50atgcaggttt tgggaatgga ggaaaagcct
gcaaggagaa gcgtagtgtt ggttccattt 60ccagcacaag gacatatatc tccaatgatg
caacttgcca aaacccttca cttaaagggt 120ttctcgatca cagttgttca gactaagttc
aattacttta gcccttcaga tgacttcact 180catgattttc agttcgtcac cattccagaa
agcttaccag agtctgattt caagaatctc 240ggaccaatac agtttctgtt taagctcaac
aaagagtgta aggtgagctt caaggactgt 300ttgggtcagt tggtgctgca acaaagtaat
gagatctcat gtgtcatcta cgatgagttc 360atgtactttg ctgaagctgc agccaaagag
tgtaagcttc caaacatcat tttcagcaca 420acaagtgcca cggctttcgc ttgccgctct
gtatttgaca aactatatgc aaacaatgtc 480caagctccct tgaaaggtac tctaaaactc
tctgtttcgt ggtttccgcg agtggctata 540agattgaaac agcattgttt ttgacctttt
ttgcagaaac taaaggacaa caagaagagc 600tagttccgga gttttatccc ttgagatata
aagactttcc agtttcacgg tttgcatcat 660tagagagcat aatggaggtg tataggaata
cagttgacaa acggacagct tcctcggtga 720taatcaacac tgcgagctgt ctagagagct
catctctgtc ttttctgcaa caacaacagc 780tacaaattcc agtgtatcct ataggccctc
ttcacatggt ggcctcagct cctacaagtc 840tgcttgaaga gaacaagagc tgcatcgaat
ggttgaacaa acaaaaggta aactcggtga 900tatacataag catgggaagc atagctttaa
tggaaatcaa cgagataatg gaagtcgcgt 960caggattggc tgctagcaac caacacttct
tatgggtgat ccgaccaggg tcaatacctg 1020gttccgagtg gatagagtcc atgcctgaag
agtttagtaa gatggttttg gaccgaggtt 1080acattgtgaa atgggctcca cagaaggaag
tactttctca tcctgcagta ggagggtttt 1140ggagccattg tggatggaac tcgacactag
aaagcatcgg ccaaggagtt ccaatgatct 1200gcaggccatt ttcgggtgat caaaaggtga
acgctagata cttggagtgt gtatggaaaa 1260ttgggattca agtggagggt gagctagaca
gaggagtggt cgagagagct gtgaagaggt 1320taatggttga cgaagaagga gaggagatga
ggaagagagc tttcagttta aaagagcaac 1380ttagagcctc tgttaaaagt ggaggctctt
cacacaactc gctagaagag tttgtacact 1440tcataaggac tctatga
1457511434DNAArabidopsis thaliana
51atggaggaaa agcaagtgaa ggagacaagg atagtgttgg ttccagttcc agctcaaggt
60catgtaactc cgatgatgca actaggaaaa gctcttcact caaagggttt ctccatcact
120gttgttctga cacagtctaa tcgagttagc tcttccaaag acttctctga tttccatttc
180ctcaccatcc caggcagctt aactgagtct gatctccaaa acctaggacc acaaaagttt
240gtgctcaagc tcaatcaaat ttgtgaggca agcttcaagc agtgtatagg tcaactattg
300catgaacaat gtaataatga tattgcttgt gtcgtctacg atgagtacat gtacttctct
360catgctgcag taaaagagtt tcaacttcct agtgtcgtct ttagcacgac aagtgctact
420gcttttgtct gtcgctctgt tttgtctaga gtcaacgcag agtcgttctt gatcgacatg
480aaaggtattc aagattctag cttgttttat cttaattcaa aatcctattt atagaaacta
540atccaaatga tcgatgttat cttttcagat cctgaaacac aagacaaagt atttccaggg
600ttgcatcctc tgaggtacaa ggatctacca acttcagtat ttgggccaat agagagtacg
660ctcaaggttt acagtgagac tgtgaacact cgaacagctt ccgctgttat catcaactca
720gcaagctgtt tagagagctc atctttggca aggttgcaac aacaactgca agttccggtg
780tatcctatag gcccacttca tattacagct tcagcgcctt ctagtttact agaagaagac
840aggagttgcg ttgagtggtt gaacaagcaa aaatcaaatt cagttattta cataagcttg
900ggaagcttgg ctctaatgga caccaaagac atgttggaga tggcttgggg attaagtaat
960agcaaccaac ctttcttatg ggtggtcaga ccgggctcta ttccggggtc agaatggaca
1020gagtccttac cagaggaatt caataggttg gtttcagaaa gaggttacat tgtgaaatgg
1080gctccgcaga tggaagttct cagacatcct gcagtaggag ggttttggag tcactgtgga
1140tggaactcaa cagtagagag catcggggaa ggagttccga tgatatgtag gcctttcacc
1200ggggatcaga aagtcaatgc gaggtactta gagagagttt ggagaattgg ggttcaattg
1260gagggagatc tggataaaga aactgtggag agagctgtag agtggttgct tgtggatgaa
1320gaaggagcag aaatgaggaa gagagccatt gacttgaaag aaaagattga aacctctgtt
1380agaagtggag gttcctcatg cagctcacta gacgactttg ttaattccat gtga
1434521458DNAArabidopsis thaliana 52atgaccaaat tctccgagcc aatcagagac
tcccacgtgg cagttctcgc gtttttcccc 60gttggcgctc atgccggtcc tctcttagcc
gtcactcgcc gtctcgccgc cgcttctccc 120tccaccatct tttctttctt caacaccgca
agatcaaacg cgtcgttgtt ctcctctgat 180catcccgaga acatcaaggt ccacgacgtc
tctgacggtg ttccggaggg aaccatgctc 240gggaatccac tggagatggt cgagctgttt
ctcgaagcgg ctccacgtat tttccggagc 300gaaatcgcgg cggcagagat agaagttgga
aagaaagtga catgcatgct aacagatgcc 360ttcttctggt tcgcagcgga catagcggct
gagctgaacg cgacttgggt tgccttctgg 420gccggcggag caaactcact ctgtgctcat
ctctacactg atctcatcag agaaaccatc 480ggtctcaaag gtaactagct ttttagcgtt
tagtgattat tccacaaatt cagctactac 540actttgtatg tatttatggt tattattatt
atttatctcc tggtagatgt gagtatggaa 600gagacattag ggtttatacc aggaatggag
aattacagag ttaaagatat accagaggaa 660gttgtatttg aagatttgga ctctgttttc
ccaaaggctt tataccaaat gagtcttgct 720ttacctcgtg cctctgctgt tttcatcagt
tcctttgaag agttagaacc tacattgaac 780tataacctaa gatccaaact taaacgtttc
ttgaacatcg cccctctcac gttattatct 840tctacatcgg agaaagagat gcgtgatcct
catggctgct ttgcttggat ggggaagaga 900tcagctgctt ctgtagcgta cattagcttc
ggcaccgtca tggaacctcc tcctgaagag 960cttgtggcga tagcacaagg gttggaatca
agcaaagtgc cgtttgtttg gtcgctgaag 1020gagaagaaca tggttcatct accaaaaggg
tttttggatc ggacaagaga gcaagggata 1080gtggttcctt gggctccaca agtggaactg
ctgaaacacg aggcaatggg tgtgaatgtg 1140acacattgtg gatggaactc agtgttggag
agtgtgtcgg caggtgtacc gatgatcggc 1200agaccgattt tggcggataa taggctcaac
ggaagagcag tggaggttgt gtggaaggtt 1260ggagtgatga tggataatgg agtcttcacg
aaagaaggat ttgagaagtg tttgaatgat 1320gtttttgttc atgatgatgg taagacgatg
aaggctaatg ccaagaagct taaagaaaaa 1380ctccaagaag atttctccat gaaaggaagc
tctttagaga atttcaaaat attgttggac 1440gaaattgtga aagtttag
1458531420DNAArabidopsis thaliana
53atgaaagtga acgaggaaaa caacaagccg acaaagaccc atgtcttaat cttcccattt
60ccggcgcaag gtcacatgat tcccctcctc gacttcaccc accgccttgc tctccgcggc
120ggcgccgcct taaaaataac cgtcctagtc actccaaaaa accttccttt tctctctccg
180cttctctccg ccgtagttaa catcgaacca cttatcctcc cttttccctc ccacccttca
240atcccctccg gcgtcgaaaa cgtccaagac ttacctcctt caggcttccc tttaatgatc
300cacgcgcttg gtaatctcca cgcgccgctt atctcttgga ttacttctca cccttctcct
360ccagtagcca tcgtatctga tttcttcctt ggttggacca aaaacctcgg aatccctcgt
420ttcgatttct ctccctccgc tgctatcact tgctgcatac tcaatactct ctggatcgaa
480atgcccacca agatcaacga agatgacgat aacgagatcc tccactttcc caagatcccg
540aattgtccaa aataccgttt tgatcagatc tcctctcttt acagaagtta cgttcacgga
600gatccagctt gggagttcat aagagactcc tttagagata acgtggcgag ttggggactc
660gtcgtgaact cgttcaccgc catggaaggt gtttatctcg aacatcttaa gcgagagatg
720ggccatgatc gtgtatgggc tgtaggccca attattccgt tatctgggga taaccgtggt
780ggcccgactt ctgtttctgt tgatcacgtg atgtcgtggc ttgacgcacg tgaggataac
840cacgtggtgt acgtgtgctt tggaagtcaa gtagttttga ctaaagagca gactcttgca
900ctcgcctctg ggcttgagaa aagcggcgtc catttcatat gggccgtaaa ggagcccgtt
960gagaaagact caacacgtgg caacatcctg gacggtttcg acgatcgcgt ggctgggaga
1020ggtctggtga tcagaggatg ggctccacaa gtagctgtgc tacgtcaccg agccgttggc
1080gcgtttttaa cgcactgtgg ttggaactct gtggtggagg cggttgtcgc cggcgttttg
1140atgctgacgt ggccgatgag agctgaccag tacactgacg cgtctctggt ggttgatgag
1200ttgaaagtag gtgtgcgtgc ttgcgaagga cctgacacgg tgcctgaccc ggacgagtta
1260gctcgagttt tcgctgattc cgtgaccgga aatcaaacgg agaggatcaa agccgtggag
1320ctgaggaaag cagcgttgga tgcgattcaa gaacgtggga gctcagtgaa tgatttagat
1380ggatttatcc aacatgtcgt tagtttagga ctaaacaaat
1420541494DNAArabidopsis thaliana 54atgagcatag atatttttca agaaataaga
ataaagaaaa ttctactctt aatggcggaa 60gcaaacactc cacacatagc aatcatgccg
agtcccggta tgggtcacct tatcccattc 120gtcgagttag caaagcgact cgttcagcac
gactgtttca ccgtcacaat gatcatctcc 180ggtgaaactt cgccgtctaa ggcacaaaga
tccgttctca actctctccc ttcctccata 240gcctccgtat ttctccctcc cgccgatctt
tccgatgttc cctccacagc gcgaatcgaa 300actcgggcca tgctcaccat gactcgttcc
aatccggcgc tccgggagct ttttggctct 360ttatcaacga agaaaagtct cccggcggtt
ctcgtcgtcg atatgtttgg tgcggatgcg 420ttcgacgtgg ccgttgactt ccacgtgtca
ccatacattt tctatgcatc caatgcaaac 480gtcttgtcgt tttttcttca cttgccgaaa
ctagacaaaa cggtgtcgtg tgagtttagg 540tacttaaccg aaccgcttaa gattcccggc
tgtgtcccga taaccggtaa ggactttctt 600gatacggttc aagaccgaaa cgacgacgca
tacaaattgc ttctccataa caccaagagg 660tacaaagaag ctaaagggat tctagtgaat
tccttcgttg atttagagtc gaatgcaata 720aaggccttac aagaaccggc tcctgataaa
ccaacggtat acccgattgg gccgctggtt 780aacacaagtt catctaatgt taacttggaa
gacaagttcg gatgtttaag ttggctagac 840aaccaaccat tcggctcggt tctatacata
tcatttggaa gcggcggaac acttacatgt 900gagcagttta atgagcttgc tattggtctt
gcggagagcg gaaaacggtt tatttgggtc 960atacgaagtc caagcgagat agttagttcg
tcgtatttca atccacacag cgagacagac 1020cccttttcgt ttttaccaat tgggttctta
gaccgaacca aagagaaagg tttggtggtt 1080ccatcatggg ctccacaggt tcaaatcctg
gctcatccat ccacatgcgg gtttttaaca 1140cactgtggat ggaattcgac cttagaaagc
attgtaaacg gtgtaccact catagcgtgg 1200cctttattcg cggagcaaaa gatgaataca
ttgctactcg tggaggatgt tggagcggct 1260ctaagaatcc atgcgggtga agatgggatt
gtacggaggg aagaagtggt gagagtggtg 1320aaggcactga tggaaggtga agagggaaaa
gccataggaa ataaagtgaa ggagttgaaa 1380gaaggagttg ttagagtctt gggtgacgat
ggattgtcca gcaagtcatt tggtgaagtt 1440ttgttaaagt ggaaaacgca ccagcgagat
atcaaccaag agacgtccca ctaa 14945535DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
55cgggtgatca ggtaccatgg cgccaccgca ttttc
355635DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 56cggaattcgt cgacttactt tacttttacc tcctc
355734DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 57cccccgggta ccatggagct agaatcttct ctcc
345834DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 58cggaattctc gagttaaaag cttttgattg atcc
345926DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 59tgggatccat atcagaaatg gtgttc
266030DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
60gggaattcct agtatccatt atctttagtc
306130DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 61ggggatccat ggacccgtct cgtcatactc
306231DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 62gggaattcca ctagtgttct ccgttgtctt c
316333DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 63ggggatccaa tatggagatg gaatcgtcgt tac
336432DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 64gggaattcct tacacgacat
tattaatgtt tg 326534DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
65ggggtacctg atcaataatg ggcagtagtg aggg
346635DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 66cggaattcgt cgacgagtta ggcgattgtg atatc
356735DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 67cgggatccgg taccatgcat atcacaaaac cacac
356835DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 68cggaattcgc tagctaagca ccacgtgaca agtcc
356935DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 69cgggatccgg taccatgagt
agtgatcctc atcgt 357035DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
70cgggatccga attctacgag gtaaactctt ctatg
357135DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 71cgggatccgg taccatgcat atcacaaaac cacac
357233DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 72cggaattcgt cgacctaagc accacgtccc aag
337334DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 73gggtgatcag gtaccatggg gaagcaagaa gatg
347435DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 74cggaattcgt cgactactta
cttatagaaa cgccg 357533DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
75gaagatctgg taccatggcg aagcagcaag aag
337633DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 76cggaattcgt cgaccgatca aagcccatct atg
33
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20150078546 | DIALER FOR CALL ROUTING SYSTEMS |
20150078545 | SYSTEM AND METHOD FOR PROVIDING AUTOMATED TRUNK SWITCHING FOR QUALITY OF SERVICE IMPROVEMENT |
20150078544 | INTERACTIVE CONTENT FOR CLICK-TO-CALL CALLS |
20150078543 | SYSTEM AND METHOD FOR RECONNECTING A DEVICE TO A GROUP CALL |
20150078542 | METHODS AND SYSTEMS FOR INBOUND CALL CONTROL |