Patent application title: Transgenic Cells Expressing Glucosyltransferase Nucleic Acids

Inventors: Diana Joy Bowles (Heslington, GB) Yi Li (Heslington, GB) Eng-Kiat Lim (Heslington, GB)
Assignees: THE UNIVERSITY OF YORK
IPC8 Class: AA01H700FI
USPC Class: 800319
Class name: Conifer
Publication date: 08/28/2008
Patent application number: 20080209597

Abstract:

The invention relates to transgenic cells which have been transformed with nucleic acids encoding glycosyltransferase polypeptides (GTases) and vectors for use in transformation of said cells.

Claims:

1. A transgenic plant comprising a nucleic acid molecule which encodes a polypeptide which has glucosyltransferase activity and is encoded byi) a nucleic acid molecule selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54; orii) a nucleic acid molecule which hybridizes to SEQ ID NO: 19 or any of the sequences represented in (i) above and which modifies biosynthetic intermediates in lignin polymerization; oriii) a nucleic acid molecule which is degenerate as a result of the genetic code to SEQ ID NO: 19 or any of the sequences defined in (i) and (ii) above.

2. A transgenic plant according to claim 1, wherein said intermediates are selected from the group consisting of: cinnamic acid; p-coumaric acid; caffeic acid; ferulic acid; sinapic acid; p-coumaryl aldehyde; coniferyl aldehyde; sinapyl aldehyde; p-coumaryl alcohol; coniferyl alcohol and sinapyl alcohol.

3. A transgenic plant according to claim 1, wherein the nucleic acid molecule anneals under stringent hybridization conditions to a nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54.

4. A transgenic plant according to claim 1, wherein the nucleic acid molecule is SEQ ID NO: 25, and the intermediates are monolignol glucosides.

5. A transgenic plant comprising a nucleic acid molecule, wherein the nucleic acid molecule is selected from the group consisting of:i) antisense sequences selected from the group consisting of SEQ ID NOs: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, parts thereof, and antisense sequence of the sense sequences presented in SEQ ID NOS: 34-54; andii) antisense sequences which hybridize to any of the sense sequences according to claim 1 and which inhibit GTase activity.

6. A transgenic plant according to claim 5, wherein the antisense sequence hybridizes to a sequence selected from the group consisting of SEQ ID NOS: 19 and 25.

7. A transgenic plant according to claim 1, wherein the nucleic acid is cDNA.

8. A transgenic plant according to claim 1, wherein the nucleic acid is genomic DNA.

9. A transgenic plant according to claim 1, wherein the plant is a woody plant selected from the group consisting of poplar; eucalyptus; Douglas fir; pine; walnut; ash; birch; oak; teak and spruce.

10. A transgenic plant according to claim 9, wherein said plant is poplar.

11. A transgenic plant according to claim 1, wherein the plant is a non-woody plant species.

12. A method for the manufacture of paper or paperboard comprising:i) pulping transgenic wood material derived from a transgenic woody plant according to claim 8; andii) producing paper or paperboard from the pulped transgenic wood material.

13. A transgenic eukaryotic cell comprising a nucleic acid molecule which encodes a polypeptide which has glucosyltransferase activity; said nucleic acid molecule being selected from the group consisting of:i) nucleic acid molecules comprising a sequence selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54;ii) nucleic acid molecules which hybridize to any of the sequences represented in (i) above and which glucosylate an anti-oxidant; andiii) nucleic acid molecules which are degenerate as a result of the genetic code to any of the sequences defined in (i) and (ii) above.

14. A transgenic eukaryotic cell according to claim 13, wherein the nucleic acid molecule is selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54.

15. A transgenic eukaryotic cell according to claim 14, wherein the nucleic acid molecule is selected from the group consisting of SEQ ID NOs: 1, 7, 10, 13, 19, 22, 25 and 28.

16. A transgenic prokaryotic cell comprising a nucleic acid molecule which encodes a polypeptide which has glucosyltransferase activity and is encoded by:i) a nucleic acid molecule selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54; orii) a nucleic acid molecule which hybridizes to any of the sequences represented in (i) above and which glucosylates an anti-oxidant; oriii) a nucleic acid molecule which is degenerate as a result of the genetic code to any of the sequences defined in (ii) and (iii) above.

17. A transgenic prokaryotic cell according to claim 16, wherein the nucleic acid molecule is selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54.

18. A transgenic prokaryotic cell according to claim 17, wherein the nucleic acid molecule is selected from the group consisting of SEQ ID NOs: 1, 7, 10, 13, 19, 22, 25 and 28.

Description:

CROSS REFERENCE TO RELATED APPLICATIONS

[0001]This application is a continuation of application Ser. No. 10/203,319 filed Aug. 9, 2002, which is a 371 national stage entry of international patent application no. PCT/GB2001/00477, filed Feb. 8, 2001, designating the United States of America, and published in United Kingdom on Aug. 16, 2001, as WO 2001/59140, the entire disclosure of which is incorporated herein by reference. Priority is claimed based on United Kingdom patent application no. 0002814.2, filed Feb. 9, 2000.

BACKGROUND OF THE INVENTION

[0002]The invention relates to transgenic cells which have been transformed with glucosyltransferase (GTases) nucleic acids.

[0003]GTases are enzymes which post-translationally transfer glucosyl residues from an activated nucleotide sugar to monomeric and polymeric acceptor molecules such as other sugars, proteins, lipids and other organic substrates. These glucosylated molecules take part in diverse metabolic pathways and processes. The transfer of a glucosyl moiety can alter the acceptor's bioactivity, solubility and transport properties within the cell and throughout the plant. One family of GTases in higher plants is defined by the presence of a C-terminal consensus sequence. The GTases of this family function in the cytosol of plant cells and catalyse the transfer of glucose to small molecular weight substrates, such as phenylpropanoid derivatives, coumarins, flavonoids, other secondary metabolites and molecules known to act as plant hormones. Available evidence indicates that GTases enzymes can be highly specific, such as the maize and Arabidopsis GTases that glucosylate indole-3-acetic acid (IAA).

[0004]The production and use of paper has increased in the last 10 years. For example, between 1989 and 1999 the production of paper and board in the UK has increased from 4.6 to 6.6 million tonnes. Worldwide consumption has also reflected a general increase in paper usage. For example, in the UK per capita consumption of paper is over 200 kg per annum. In the USA this figure is over 300 kg per annum.

[0005]Wood used in the paper industry is initially particulated, typically by chipping, before conversion to a pulp which can be utilised to produce paper. The pulping process involves the removal of lignin. Lignin is a major non-carbohydrate component of wood and comprises approximately one quarter of the raw material in wood pulp. The removal of lignin is desirable since the quality of the paper produced from the pulp is largely determined by the lignin content. Many methods have been developed to efficiently and cost effectively remove lignin from wood pulp. These methods can be chemical, mechanical or biological. For example, chemical methods to pulp wood are disclosed in WO9811294, EP0957198 and WO0047812. Although chemical methods are efficient means to remove lignin from pulp it is known that chemical treatments can result in degradation of polysaccharides and is expensive. Moreover, to remove residual lignin from pulp it is necessary to use strong bleaching agents which require removal before the pulp can be converted into paper. These agents are also damaging to the environment.

[0006]Biological methods to remove lignin are known. There are however disadvantages associated with such methods. For example it is important to provide micro-organisms (eg bacteria and/or fungi) which only secrete ligninolytic enzymes which do not affect cellulose fibres. This method is also very time consuming (can take 3-4 weeks) and expensive due to the need to provide bioreactors. Biological treatment can also include pre-treatment of wood chips to make them more susceptible to further biological or chemical pulping.

[0007]It is therefore desirable to provide further means by which lignin can be efficiently and cost effectively removed from wood pulp which do not have the disadvantages associated with prior art methods.

[0008]For the sake of clarity reference herein to transgenic means a plant which has been genetically modified to include a nucleic acid sequence not naturally found in said plant. For example, by over-expression of monolignol glucosyltransferases in planta, plant cell wall properties may be altered through increasing the flux through biosynthetic intermediates that are obligatory for incorporation and assembly of the lignin polymer. Conversely, reduction of the monolignol glucoside pools, such as through the use of nucleic acid comprising GTase sequences in antisense configuration may lead to altered properties through reducing the flux through specific intermediates. Changes in lignin composition, such as with decreased ratios of coniferyl alcohol to sinapyl alcohol are highly desirable in paper and pulping processes, because the more highly methylated lignin (sinapyl alcohol) is more easily removed during pulping processes (Chiang et al (1988) TAPPI J. 71, 173-176).

[0009]In some applications it may be desirable to change lignin composition and increase the lignin content of a plant cell to increase the mechanical strength of wood. This would have utility in, for example the construction industry or in furniture making.

[0010]Both lignin content and the level of cross-linking of polysaccharide polymers within plant cell walls, also play an important role in determining texture and quality of raw materials through altering the cell walls and tissue mechanical properties. For example, there is considerable interest in reducing cell separation in edible tissues since this would prevent over-softening and loss of juiciness. Phenolics, such as ferulic acid, play an important role in cell adhesion since they can be esterified to cell wall polysaccharides during synthesis and oxidatively cross-linked in the wall, thereby increasing rigidity. Most non-lignified tissues contain these phenolic components and their levels can be modified by altering flux through the same metabolic pathways as those culminating in lignin. Therefore, in the same way as for the manipulation of lignin composition and content, GTase nucleic acid in sense and/or antisense configurations can be used to affect levels of ferulic acid and related phenylpropanoid derivatives that function in oxidative cross-linking. These changes in content have utility in the control of raw material quality of edible plant tissues.

[0011]Lignin and oxidative cross-linking in plant cell walls also play important roles in stress and defence responses of most plant species. For example, when non-woody tissues are challenged by pests or pathogen attack, or suffer abiotic stress such as through mechanical damage or UV radiation, the plant responds by localised and systemic alteration in cell wall and cytosolic properties, including changes in lignin content and composition and changes in cross-linking of other wall components. Therefore, it can also be anticipated that cell- or tissue-specific changes in these responses brought about by changed levels of the relevant GTase activities will have utility in protecting the plant to biotic attack and biotic/abiotic stresses.

[0012]GTases also have utility with respect to the modification of antioxidants. Reactive oxygen species are produced in all aerobic organisms during respiration and normally exist in a cell in balance with biochemical anti-oxidants. Environmental challenges, such as by pollutants, oxidants, toxicants, heavy metals and so on, can lead to excess reactive oxygen species which perturb the cellular redox balance, potentially leading to wide-ranging pathological conditions. In animals and humans, cardiovascular diseases, cancers, inflammatory and degenerative disorders are linked to events arising from oxidative damage.

[0013]Because of the current prevalence of these diseases, there is considerable interest in anti-oxidants, consumed in the diet or applied topically such as in UV-screens. Anti-oxidant micronutrients obtained from vegetables and fruits, teas, herbs and medicinal plants are thought to provide significant protection against health problems arising from oxidative stress. Well known anti-oxidants from plant tissues include for example: quercetin, luteolin, and the catechin, epicatechin and cyanidin groups of compounds.

[0014]Caffeic acid (3,4-dihydroxycinnamic acid) is a further example of an anti-oxidant with beneficial therapeutic properties.

[0015]Certain plant species, organs and tissues are known to have relatively high levels of one or more compounds with anti-oxidant activity. Greater accumulation of these compounds in those species, their wider distribution in crop plants and plant parts already used for food and drink production, and the increased bioavailability of anti-oxidants (absorption, metabolic conversions and excretion rate) are three features considered to be highly desirable.

[0016]It will be apparent that changed levels of the relevant GTase activities capable of glucosylating anti-oxidant compounds in planta will allow the production of anti-oxidants with beneficial properties. GTase sequences can also be expressed in prokaryotes or simple eukaryotes, such as yeast, to produce enzymes for biotransformations in those cells, or as in vitro processing systems.

SUMMARY OF THE INVENTION

Statements of Invention

[0017]According to an aspect of the invention there is provided a transgenic cell comprising a nucleic acid molecule which encodes a polypeptide which has: [0018]i) glucosyltransferase activity: [0019]ii) is selected from the group comprising sequences of FIGS. 1A, 2A, 3A, 4A, 5A, 6A, 7A, 8A, 9A, 10A, 11A, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 [0020]iii) nucleic acids which hybridise to the sequences represented in (ii) above; and [0021]iv) nucleic acid sequences which are degenerate as a result of the genetic code to the sequences defined in (i) and (ii) above.

[0022]In a further preferred embodiment of the invention said nucleic acid molecule anneals under stringent hybridisation conditions to the sequence presented in FIGS. 1A, 2A, 3A, 4A, 5A, 6A, 7A, 8A, 9A, 10A, 11A, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32

[0023]More preferably still said nucleic acid molecule is selected from FIGS. 7A, 8A, 9A, 10A, 15, 18, 19, 28 or 31.

[0024]Stringent hybridisation/washing conditions are well known in the art. For example, nucleic acid hybrids that are stable after washing in 0.1×SSC, 0.1% SDS at 60° C. It is well known in the art that optimal hybridisation conditions can be calculated if the sequence of the nucleic acid is known. For example, hybridisation conditions can be determined by the GC content of the nucleic acid subject to hybridisation. Please see Sambrook et al (1989) Molecular Cloning; A Laboratory Approach. A common formula for calculating the stringency conditions required to achieve hybridisation between nucleic acid molecules of a specified homology is:

T_m=81.5° C.+16.6 Log [Na.sup.+]+0.41[% G+C]-0.63 (% formamide).

[0025]In a preferred embodiment of the invention said transgenic cell is a eukaryotic cell. Preferably said eukaryotic cell is a plant cell or yeast cell.

[0026]In an alternative embodiment of the invention said transgenic cell is a prokaryotic cell.

[0027]In a further preferred embodiment of the invention the nucleic acid molecule is selected from the group comprising: antisense sequences of the sequences of any one of FIGS. 1C, 2C, 3C, 4C, 5C, 6C, 7C, 8C, 9C, 10C and 11C or parts thereof, or antisense sequences of the sense sequences presented in FIGS. 12-32. More preferably still said antisense sequence is selected from FIG. 7C or 9C

[0028]In a further preferred embodiment of the invention said nucleic acid is cDNA.

[0029]In a yet further preferred embodiment of the invention said nucleic acid is genomic DNA.

[0030]In yet still a further preferred embodiment of the invention said plant is a woody plant selected from: poplar; eucalyptus; Douglas fir; pine; walnut; ash; birch; oak; teak; spruce. Preferably said woody plant is a plant used typically in the paper industry, for example poplar.

[0031]Methods to transform woody species of plant are well known in the art. For example the transformation of poplar is disclosed in U.S. Pat. No. 4,795,855 and WO9118094. The transformation of eucalyptus is disclosed in EP1050209 and WO9725434. Each of these patents is incorporated in their entirety by reference.

[0032]In a still further preferred embodiment of the invention said plant is selected from: corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (helianthus annuas), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Iopmoea batatus), cassaya (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citris tree (Citrus spp.) cocoa (Theobroma cacao), tea (Camellia senensis), banana (Musa spp.), avacado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifer indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia intergrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), oats, barley, vegetables and ornamentals.

[0033]Preferably, plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassaya, barley, pea, and other root, tuber or seed crops. Important seed crops are oil-seed rape, sugar beet, maize, sunflower, soybean, and sorghum. Horticultural plants to which the present invention may be applied may include lettuce, endive, and vegetable brassicas including cabbage, broccoli, and cauliflower, and carnations and geraniums. The present invention may be applied in tobacco, cucurbits, carrot, strawberry, sunflower, tomato, pepper, chrysanthemum.

[0034]Grain plants that provide seeds of interest include oil-seed plants and leguminous plants. Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc. Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava been, lentils, chickpea, etc.

[0035]According to a further aspect of the invention there is provided a vector comprising the nucleic acid according to the invention operably linked to a promoter.

[0036]Vector" includes, inter alia, any plasmid, cosmid, phage or Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self-transmissable or mobilizable, and which can transform a prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication ie an episomal vector).

[0037]Suitable vectors can constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. For further details see, for example, Molecular Cloning: Laboratory Manual: 2^nd edition, Sambrook et al. 1989, Cold Spring Habor Laboratory Press or Current Protocols in Molecular Biology, Second Edition, Ausubel et al. Eds., John Wiley & Sons, 1992.

[0038]Specifically included are shuffle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotic (e.g. higher plant, mammalian, yeast or fungal cells).

[0039]A vector including nucleic acid according to the invention need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce the nucleic acid into cells for recombination into the gene.

[0040]Preferably the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, (e.g. bacterial), or plant cell. The vector may be a bi-functional expression vector which functions in multiple hosts. In the case of GTase genomic DNA this may contain its own promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell.

[0041]By "promoter" is meant a nucleotide sequence upstream from the transcriptional initiation site and which contains all the regulatory regions required for transcription. Suitable promoters include constitutive, tissue-specific, inducible, developmental or other promoters for expression in plant cells comprised in plants depending on design. Such promoters include viral, fungal, bacterial, animal and plant-derived promoters capable of functioning in plant cells.

[0042]Constitutive promoters include, for example CaMV 35S promoter (Odell et al. (1985) Nature 313, 9810-812); rice actin (McElroy et al. (1990) Plant Cell 2: 163-171); ubiquitin (Christian et al. (1989) Plant Mol. Biol. 18 (675-689); pEMU (Last et al. (1991) Theor Appl. Genet. 81: 581-588); MAS (Velten et al. (1984) EMBO J. 3. 2723-2730); ALS promoter (U.S. Application Seriel No. 08/409,297), and the like. Other constitutive promoters include those in U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680, 5,268,463; and 5,608,142.

[0043]Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induced gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-1a promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88: 10421-10425 and McNellis et al. (1998) Plant J. 14(2): 247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227: 229-237, and U.S. Pat. Nos. 5,814,618 and 5,789,156, herein incorporated by reference.

[0044]Where enhanced expression in particular tissues is desired, tissue-specific promoters can be utilised. Tissue-specific promoters include those described by Yamamoto et al. (1997) Plant J. 12(2): 255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7): 792-803; Hansen et al. (1997) Mol. Gen. Genet. 254(3): 337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168; Rinehart et al. (1996) Plant Physiol. 112(3): 1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2): 525-535; Canevascni et al. (1996) Plant Physiol. 112(2): 513-524; Yamamoto et al. (1994) Plant Cell Physiol. 35(5): 773-778; Lam (1994) Results Probl. Cell Differ. 20: 181-196; Orozco et al. (1993) Plant Mol. Biol. 23(6): 1129-1138; Mutsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90 (20): 9586-9590; and Guevara-Garcia et al (1993) Plant J. 4(3): 495-50.

[0045]Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter. In a preferred aspect, the promoter is an inducible promoter or a developmentally regulated promoter.

[0046]Particular of interest in the present context are nucleic acid constructs which operate as plant vectors. Specific procedures and vectors previously used with wide success upon plants are described by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148. Suitable vectors may include plant viral-derived vectors (see e.g. EP-A-194809).

[0047]If desired, selectable genetic markers may be included in the construct, such as those that confer selectable phenotypes such as resistance to antibodies or herbicides (e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate).

[0048]According to a further aspect of the invention there is provided a method of enhancing monolignol glucoside synthesis in a plant comprising causing or allowing expression of at least one GTase nucleic acid according to the invention in a plant. Preferably the plant is a woody plant species.

[0049]According to a further aspect of the invention there is provided a method of inhibiting monolignol glucoside synthesis in a plant comprising causing or allowing expression of at least one GTase antisense nucleic acid according to the invention in a plant. Preferably the plant is a woody plant species.

[0050]Inhibition of GTase expression may, for instance, be achieved using anti-sense technology.

[0051]In using anti-sense genes or partial gene sequences to down-regulate gene expression, a nucleotide sequence is placed under the control of a promoter in a "reverse orientation" such that transcription yields RNA which is complementary to normal mRNA transcribed from the "sense" strand of the target gene. See, for example, Rothstein et al, 1987; Smith et al, (1998), Nature 334, 724-726; Zhang et al (1992) The Plant Cell 4, 1575-1588, English et al. (1996) The Plant Cell 8, 179 188. Antisense technology is also reviewed in Bourque (1995), Plant Science 105, 125-149, and Flavell (1994) PNAS USA 91, 3490-3496.

[0052]According to a further aspect of the invention there is provided a nucleotide sequence encoding an antisense RNA molecule complementary to a sense mRNA molecule encoding for a polypeptide having a glucosyl transferase activity in the biosynthesis of at least a monolignol glucoside in lignin biosynthesis in a plant, which nucleotide sequence is under transcriptional control of a promoter and a terminator, both promoter and terminator capable of functioning in plant cells.

[0053]Suitable promoters and terminators are referred to hereinabove.

[0054]According to a further aspect of the invention there is provided a nucleotide sequence according to the invention comprising a transcriptional regulatory sequence, a sequence under the transcriptional control thereof which encodes an RNA which consists of a plurality of subsequences, characterised in that the RNA subsequences are antisense RNAs to mRNAs of proteins having a GTase activity in the lignin biosynthesis pathway in plant cells.

[0055]In particular, the said RNA subsequences are antisense RNAs to mRNAs of GTase having a GTase activity in the lignin biosynthesis pathway in plant cells, such as the GTase of FIGS. 1-11(C)

[0056]The nucleotide sequence may encode an RNA having any number of subsequences. Preferably, the number of subsequences lies between 2 and 7 (inclusive) and more preferably lies between 2-4.

[0057]According to a further aspect of the invention there is provided a host cell transformed with nucleic acid or a vector according to the invention, preferably a plant or a microbial cell. The microbial cell may be prokaryotic (eg Escherchia coli, Bacillus subtilis) or eukaryotic (eg Saccharomyces cerevisiae).

[0058]In the transgenic plant cell the transgene may be on an extra-genomic vector or incorporated, preferably stably, into the genome. There may be more than one heterologous nucleotide sequence per haploid genome.

[0059]According to a yet further aspect of the invention there is provided a method of transforming a plant cell comprising introduction of a vector into a plant cell and causing or allowing recombination between the vector and the plant cell genome to introduce a nucleic acid according to the invention into the genome.

[0060]Plants transformed with a DNA construct of the invention may be produced by standard techniques known in the art for the genetic manipulation of plants. DNA can be introduced into plant cells using any suitable technology, such as a disarmed Ti-plasmid vector carried by Agrobacterium exploiting its natural gene transferability (EP-A-270355, EP-A-0116718, NAR 12(22):8711-87215 (1984), Townsend et al., U.S. Pat. No. 5,563,055); particle or microprojectile bombardment (U.S. Pat. No. 5,100,792, EP-A-444882, EP-A-434616; Sanford et al, U.S. Pat. No. 4,945,050; Tomes et al. (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment", in Plant Cell, Tissue and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); and McCabe et al. (1988) Biotechnology 6: 923-926); microinjection (WO 92/09696, WO 94/00583, EP 331083, EP 175966, Green et al. 91987) Plant Tissue and Cell Culture, Academic Press, Crossway et al. (1986) Biotechniques 4:320-334); electroporation (EP 290395, WO 8706614, Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606; D'Halluin et al. 91992). Plant Cell 4:1495-1505) other forms of direct DNA uptake (DE 4005152, WO 9012096, U.S. Pat. No. 4,684,611, Paszkowski et al. (1984) EMBO J. 3:2717-2722); liposome-mediated DNA uptake (e.g. Freeman et al (1984) Plant Cell Physiol, 29:1353); or the vortexing method (e.g. Kindle (1990) Proc. Nat. Acad. Sci. USA 87:1228). Physical methods for the transformation of plant cells are reviewed in Oard (1991) Biotech. Adv. 9:1-11. See generally, Weissinger et al. (1988) Ann. Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate Sciences and Technology 5:27-37; Christou et al. (1988) Plant Physiol. 87:671-674; McCabe et al. (1988) Bio/Technology 6:923-926; Finer and McMullen (1991) In Vitro Cell Dev. Biol. 27P:175-182; Singh et al. (1988) Theor. Appl. Genet. 96:319-324; Datta et al. (1990) Biotechnology 8:736-740; Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85: 4305-4309; Klein et al. (1988) Biotechnology 6:559-563; Tomes, U.S. Pat. No. 5,240,855; Buising et al. U.S. Pat. Nos. 5,322,783 and 5,324,646; Klein et al. (1988) Plant Physiol 91: 440-444; Fromm et al (1990) Biotechnology 8:833-839; Hooykaas-Von Slogteren et al. 91984). Nature (London) 311:763-764; Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349; De Wet et al. (1985) in The Experimental Manipuation of Ovule Tissues ed. Chapman et al. (Longman, New York), pp. 197-209; Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566; Li et al. (1993) Plant Cell Reports 12: 250-255 and Christou and Ford (1995) Annals of Botany 75: 407-413; Osjoda et al. (1996) Nature Biotechnology 14:745-750, all of which are herein incorporated by reference.

[0061]Agrobacterium transformation is widely used by those skilled in the art to transform dicotyledonous species. Recently, there has been substantial progress towards the routine production of stable, fertile transgenic plants in almost all economically relevant monocot plants (Toriyama et al. (1988) Bio/Technology 6: 1072-1074; Zhang et al. (1988) Plant Cell rep. 7379-384; Zhang et al. (1988) Theor. Appl. Genet. 76:835-840; Shimamoto et al. (1989) Nature 338:274-276; Datta et al. (1990) Bio/Technology 8: 736-740; Christou et al. (1991) Bio/Technology 9:957-962; Peng et al (1991) International Rice Research Institute, Manila, Philippines, pp. 563-574; Cao et al. (1992) Plant Cell Rep. 11: 585-591; Li et al. (1993) Plant Cell Rep. 12: 250-255; Rathore et al. (1993) Plant Mol. Biol. 21:871-884; Fromm et al (1990) Bio/Technology 8:833-839; Gordon Kamm et al. (1990) Plant Cell 2:603-618; D'Halluin et al. (1992) Plant Cell 4:1495-1505; Walters et al. (1992) Plant Mol. Biol. 18:189-200; Koziel et al. (1993). Biotechnology 11194-200; Vasil, I. K. (1994) Plant Mol. Biol. 25:925-937; Weeks et al (1993) Plant Physiol. 102:1077-1084; Somers et al. (1992) Bio/Technology 10:1589-1594; WO 92/14828. In particular, Agrobacterium mediated transformation is now emerging also as an highly efficient transformation method in monocots. (Hiei, et al. (1994) The Plant Journal 6:271-282). See also, Shimamoto, K. (1994) Current Opinion in Biotechnology 5:158-162; Vasil, et al. (1992) Bio/Technology 10:667-674; Vain, et al. (1995) Biotechnology Advances 13(4):653-671; Vasil, et al. (1996) Nature Biotechnology 14: 702).

[0062]Microprojectile bombardment, electroporation and direct DNA uptake are preferred where Agrobacterium is inefficient or ineffective. Alternatively, a combination of different techniques may be employed to enhance the efficiency of the transformation process, e.g. bombardment with Agrobacterium-coated microparticles (EP-A-486234) or microprojectile bombardment to induce wounding followed by co-cultivation with Agrobacterium (EP-A-486233).

[0063]Plants which include a plant cell according to the invention are also provided.

[0064]In addition to the regenerated plant, the present invention embraces all of the following: a clone of such a plant, seed, selfed of hybrid progeny and descendants (e.g. F1 and F2 descendants).

[0065]According to a further aspect of the invention there is provided an isolated nucleic acid molecule obtainable from Arabidopsis thaliana which comprises a nucleic acid sequence encoding a polypeptide having

(1) GTase functionality; and(2) is capable of adding a glucosyl group via an O-glucosidic linkage to form

[0066](a) a glucosyl ester of at least one of: [0067]cinnamic acid; p-coumaric acid; caffeic acid; ferulic acid; and sinapic acid; and/or

[0068](b) a 4-O-glucoside of at least one of:

cinnamic acid; p-coumaric acid; caffeic acid; ferulic acid; sinapic acid; p-coumaryl aldehyde; coniferyl aldehyde; sinapyl aldehyde; p-coumaryl alcohol; coniferyl alcohol; and sinapyl alcohol.

[0069]In a further aspect of the invention there is provided a polypeptide encoded by an isolated nucleic acid molecule of the present invention wherein the said polypeptide is selected from the polypeptides of FIGS. 1B, 2B, 3B, 4B, 5B, 6B, 7B, 8B, 9B, 10B and 111B or functional variants and/or parts thereof. Preferably the polypeptide is selected from the group of polypeptides of FIGS. 2B, 3B, 4B, 6B, 7B and 9B or functional variants and/or parts thereof. Preferably still the polypeptide is selected from the group of polypeptides selected from FIGS. 2B, 3B, 7B and 9B or functional variants and/or parts thereof. Most preferably the polypeptide is one of the polypeptides shown in FIGS. 2B, 3B, 7B or 9B. Polypeptides encoded by the sense nucleic acid sequences presented in FIGS. 12-32 are also provided and readily derived from these sense sequences.

[0070]Variants of sequences having substantial identity or homology with the GTase molecules of the invention may be utilized in the practices of the invention. That is, the GTase of FIGS. 1A-11A may be modified yet still remain functional. Generally, the GTase will comprise at least about 40%-60%, preferably about 60%-80%, more preferably about 80%-95% sequence identity with a GTase nucleotide sequence of FIGS. 1A-32 herein.

[0071]The activity of functional variant polypeptides may be assessed by transformation into a host capable of expressing the nucleic acid of the invention. Methodology for such transformation is described in more detail below.

[0072]In a further aspect of the invention there is disclosed a method of producing a derivative nucleic acid comprising the step of modifying any of the sequences disclosed above, particularly the coding sequence of FIGS. 1A, 2A, 3A, 4A, 5A, 6A, 7A, 8A, 9A, 10A, 11A, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32

[0073]Alternatively, changes to a sequence may produce a derivative by way of one or more of addition, insertion, deletion or substitution of one or more nucleotides in the nucleic acid, leading to the addition, insertion, deletion or substitution or one or more amino acids in the encoded polypeptide.

[0074]Other desirable mutations may be random or site directed mutagenesis in order to alter the activity (e.g. specificity) or stability of the encoded polypeptide or to produce dominant negative variants which may alter the flux through lignin biosynthetic pathways to alter the amount of lignin or an intermediate in the lignin biosynthetic pathway.

BRIEF DESCRIPTION OF THE DRAWINGS

[0075]The invention will now be described with reference to the following Figures and Examples which are not to be construed as limiting the invention.

[0076]Scheme 1: The major intermediates in lignin biosynthesis pathway.

[0077]FIG. 1A: Sense nucleotide sequence of A062 (SEQ ID NO: 1). The coding region starts from the first nucleotide and ends at the last nucleotide;

[0078]FIG. 1B: The amino acid sequence of A062 (SEQ ID NO: 2);

[0079]FIG. 1C: The antisense nucleotide sequence of A062 (SEQ ID NO:3);

[0080]FIG. 2A Sense nucleotide sequence of A320 (SEQ ID NO: 4). The coding region starts from the first nucleotide and ends at the last nucleotide;

[0081]FIG. 2B The amino acid sequence of A320 (SEQ ID NO: 5);

[0082]FIG. 2C: The antisense nucleotide sequence of A320 (SEQ ID NO: 6);

[0083]FIG. 3A: Sense nucleotide sequence of A41 (SEQ ID NO: 7). The coding region starts from the first nucleotide and ends at the last nucleotide;

[0084]FIG. 3B: The amino acid sequence of A41 (SEQ ID NO: 8);

[0085]FIG. 3C: The antisense nucleotide sequence of A41 (SEQ ID NO: 9);

[0086]FIG. 4A: Sense nucleotide sequence of A42 (SEQ ID NO: 10). The coding region starts from the first nucleotide and ends at the last nucleotide;

[0087]FIG. 4B: The amino acid sequence of A42 (SEQ ID NO: 1);

[0088]FIG. 4C: The antisense nucleotide sequence of A42 (SEQ ID NO: 12);

[0089]FIG. 5A: Sense nucleotide sequence of A43 (SEQ ID NO: 13). The coding region starts from the first nucleotide and ends at the last nucleotide;

[0090]FIG. 5B: The amino acid sequence of A43 (SEQ ID NO: 14);

[0091]FIG. 5C: The antisense nucleotide sequence of A43 (SEQ ID NO: 15);

[0092]FIG. 6A: Sense nucleotide sequence of A911 (SEQ ID NO: 16). The coding region starts from the first nucleotide and ends at the last nucleotide;

[0093]FIG. 6B: The amino acid sequence of A911 (SEQ ID NO: 17);

[0094]FIG. 6C: The antisense nucleotide sequence of A911 (SEQ ID NO: 18);

[0095]FIG. 7A: Sense nucleotide sequence of A119 (SEQ ID NO: 19). The coding region starts from the first nucleotide and ends at the last nucleotide;

[0096]FIG. 7B: The amino acid sequence of A119 (SEQ ID NO: 20);

[0097]FIG. 7C: The antisense nucleotide sequence of A119 (SEQ ID NO: 21);

[0098]FIG. 8A: Sense nucleotide sequence of A233 (SEQ ID NO: 22). The coding region starts from the first nucleotide and ends at the last nucleotide;

[0099]FIG. 8B: The amino acid sequence of A233 (SEQ ID NO: 23);

[0100]FIG. 8C: The antisense nucleotide sequence of A233 (SEQ ID NO: 24);

[0101]FIG. 9A: Sense nucleotide sequence of A407 (SEQ ID NO: 25). The coding region starts from the first nucleotide and ends at the last nucleotide;

[0102]FIG. 9B: The amino acid sequence of A407 (SEQ ID NO: 26);

[0103]FIG. 9C: The antisense nucleotide sequence of A407 (SEQ ID NO: 27);

[0104]FIG. 10A: Sense nucleotide sequence of A961 (SEQ ID NO: 28). The coding region starts from the first nucleotide and ends at the last nucleotide;

[0105]FIG. 10B: The amino acid sequence of A961 (SEQ ID NO: 29);

[0106]FIG. 10C: The antisense nucleotide sequence of A961 (SEQ ID NO: 30);

[0107]FIG. 11A: Sense nucleotide sequence of A962 (SEQ ID NO: 31). The coding region starts from the first nucleotide and ends at the last nucleotide;

[0108]FIG. 11B: The amino acid sequence of A962 (SEQ ID NO: 32);

[0109]FIG. 11C: The antisense nucleotide sequence of A962. (SEQ ID NO: 33);

[0110]FIG. 12: The sense nucleotide sequence of UGT71B5 (SEQ ID NO: 34);

[0111]FIG. 13 The sense nucleotide sequence of UGT71C3 (SEQ ID NO: 35);

[0112]FIG. 14 The sense nucleotide sequence of UGT71C5 (SEQ ID NO: 36);

[0113]FIG. 15 The sense nucleotide sequence of UGT71D1 (SEQ ID NO: 37);

[0114]FIG. 16 The sense nucleotide sequence of UGT73B1 (SEQ ID NO: 38);

[0115]FIG. 17 The sense nucleotide sequence of UGT73B2 (SEQ ID NO: 39);

[0116]FIG. 18 The sense nucleotide sequence of UGT73B4 (SEQ ID NO: 40);

[0117]FIG. 19 The sense nucleotide sequence of UGT73B5 (SEQ ID NO: 41);

[0118]FIG. 20 The sense nucleotide sequence of UGT73C1 (SEQ ID NO: 42);

[0119]FIG. 21 The sense nucleotide sequence of UGT731C (SEQ ID NO: 43);

[0120]FIG. 22 The sense nucleotide sequence of UGT73C5 (SEQ ID NO: 44);

[0121]FIG. 23 The sense nucleotide sequence of UGT73C6 (SEQ ID NO: 45);

[0122]FIG. 24 The sense nucleotide sequence of UGT73C7 (SEQ ID NO: 46);

[0123]FIG. 25 The sense nucleotide sequence of UGT74F2 (SEQ ID NO: 47);

[0124]FIG. 26 The sense nucleotide sequence of UGT76E1 (SEQ ID NO: 48);

[0125]FIG. 27 The sense nucleotide sequence of UGT76E11 (SEQ ID NO: 49);

[0126]FIG. 28 The sense nucleotide sequence of UGT76E12 (SEQ ID NO: 50);

[0127]FIG. 29 The sense nucleotide sequence of UGT76E2 (SEQ ID NO: 51);

[0128]FIG. 30 The sense nucleotide sequence of UGT78D1 (SEQ ID NO: 52);

[0129]FIG. 31 The sense nucleotide sequence of UGT89B1 (SEQ ID NO: 53);

[0130]FIG. 32 The sense nucleotide sequence of UGT72B3 (SEQ ID NO: 54);

[0131]FIG. 33 shows recombinant GST-UGT71C1 fusion protein purified from E. coli using glutathione-coupled Sepharose. The protein (5 μg) was analyzed using 10% SDS-PAGE and was visualized with Coomassive staining;

[0132]FIG. 34 shows three different glucose conjugates of caffeic acid, (caffeoyl-3-O-glucoside, caffeoyl-4-O-glucoside and 1-O-caffeoylglucose), obtained from the glucosyltransferase reactions containing the recombinant UGT71C1, UGT73B3 and UGT84A1 respectively. Each assay contained 1-2 μg of recombinant UGT, 1 mM caffeic acid, 5 mM UDP-glucose, 1.4 mM 2-mercaptoethanol and 50 mM TRIS-HCl, pH 7.0. The mix was incubated at 30° C. for 30 min and was analyzed by reverse-phase HPLC subsequently. Linear gradient (10-16%) of acetonitrile in H₂O at 1 ml/min over 20 min was used to separate the glucose conjugates from caffeic acid.

[0133]FIG. 35A shows the pH optima of UGT71C1 glucosyltransferase activity measured over the range pH 5.5-8.0 in the reactions containing 50 mM buffer, 1 μg of UGT71C1, 1 mM caffeic acid, 5 mM UDP-glucose and 1.4 mM 2-mercaptoethanol. The mix was incubated at 30° C. for 30 min. The reaction was stopped by the addition of 20 μl of trichloroacetic acid (240 mg/ml) and was analyzed by reverse-phase HPLC subsequently. The specific enzyme activity was expressed as nanomoles of caffeic acid glucosylated per second (nkat) by 1 mg of protein in 30 min of reaction time at 30° C. FIG. 35B, the time course of UGT71C1 glucosyltransferase activity was studied by measuring the amount of caffeic acid glucosylated by 1 μg of UGT71C1 in 50 mM TRIS-HCll, pH 7.0. The reactions were carried out and analyzed as described in A;

[0134]FIG. 36 shows UGT71C1 transgenic Arabidopsis thaliana plants and their ability to glucosylate caffeic acid; and

[0135]FIG. 37 summarises the GTase activities of various GTase polypeptides with respect to various anti-oxidant substrates.

EXAMPLES

Materials and Methods

Transformation of Woody Plant Species

[0136]The transformation of woody plant species is known in the art. See U.S. Pat. No. 4,795,855 and WO9118094; EP1050209 and WO9725434. Each of these patents are incorporated in their entirety by reference.

Transformation of Non-Woody Plant Species

[0137]Methods used in the transformation of plant species other than woody species are well known in the art and are extensively referenced herein.

Identification of GTase sequences

[0138]The GTase sequence identification was carried out using GCG software (Wisconsin package, version 8.1). Blasta programme was used to search Arabidopsis protein sequences containing a PSPG (plant secondary product UDP-glucose glucosyltransferase) signature motif (Hughes and Hughes (1994) DNA Sequence 5, 41-49) in EMBL and GenBank sequence database. The database information on the GTases described in the present invention are listed in Table 1.

Amplification and Cloning of the GTase Sequences

[0139]The GTase sequences were amplified from Arabidopsis thaliana Columbia genomic DNA with specific primers (Table 2), following standard methodologies (Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, 2^nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). 50 ng of genomic DNA isolated from Arabidopsis thaliana Columbia were incubated with 1× pfu PCR buffer (Stratagene), 250 μM dNTPS, 50 pmole primer for each end, and 5 units of pfu DNA polymerase (Stratagene) in a total of 100 μl. The PCR reactions were carried out as outlined in the programme described in Table 3.

[0140]After PCR amplification, the products were double digested by appropriate restriction enzymes listed in Table 2 (bold type). The digested DNA fragments were purified using an electro-eluction method (Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, 2^nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) and ligated into the corresponding cloning site on pGEX2T plasmid DNA (Pharmacia) by T4 DNA ligase (NEB) at 16° C. overnight. The resulting recombinant plasmid DNA was amplified in E. coli XL1-blue cells and was confirmed with the restriction enzymes listed in Table 2 (bold type) following the method described by Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, 2^nd Ed., Cold Spring Habor Laboratory, Cold Spring Harbor, N.Y.).

Preparation of Glucosyltransferase Recombinant Proteins

[0141]E. coli cells carrying recombinant plasmid DNA as described above were grown at 37° C. overnight on 2YT (16 g bacto tryptone, 10 g bacto-yeast extract, 5 g NaCl per litre) agar (1.8% w/v) plate which contained 50 μg/ml ampicillin. A single colony was picked into 2 ml of 2YT containing the same concentration of ampicillin. The bacterial culture was incubated at 37° C. with moderate agitation for 6 h. The bacterial culture was transferred into 1 L of 2YT and incubated at 20° C. subsequently. 0.1 mM IPTG was added when the culture reached logarithmic growth phase (A 600 nm 0.5). The bacterial culture was incubated for another 24 h. The cells were collected by a centrifugation at 7,000×g for 5 min at 4° C. and resuspended in 5 ml spheroblast buffer (0.5 mM EDTA, 750 mM sucrose, 200 mM Tris, pH 8.0). Lysozyme solution was added to a final concentration of 1 mg/ml. 7-fold volume of 0.5× spheroblast buffer was poured into the suspension immediately and the suspension was incubated for 4° C. for 30 min under gentle shaking. The spheroblasts were collected by a centrifugation at 12,000×g for 5 min at 4° C., and resuspended in 5 ml ice cold PBL buffer (140 mM NaCl, 80 mM, NA₂ HPO₄, 15 mM KH₂PO₄). 2 mM of PMSF was added into suspension immediately and the suspension was centrifuged at 12,000×g for 20 min at 4° C. in order to remove the cell debris. After the centrifugation, the supernatant was transferred to a 15 ml tube. 200 μl of 50% (v/v) slurry of Glutathione-coupled Sepharose 4B were added into the tube and the mixture was mixed gently for 30 min at room temperature. The mixture was then centrifuged at a very slow speed (500×g) for 1 min. the supernatant was discarded. The beads were washed with 5 ml ice cold PBS buffer three times. After each wash, a short centrifugation was applied as described above to sediment the Sepharose beads. To recover the expressed protein from Sepharose beads, 100 μl of 20 mM reduced glutathione were used to resuspend the beads. After 10 min incubation at room temperature, the beads were collected and the supernatant containing the expressed protein was collected. The elution step was repeated once, and both supernatant fractions were combined and stored at 4° C. for protein assay and further studies.

Protein Concentration Assay

[0142]The protein assays were carried out by adding 10 μl of protein solution into 900 μl of distilled water and 200 μl of Bio-Rad Protein Assay Dye. The absorbance at 595 nm was read. A series of BSA (bovine serium albumin) at different concentration was used as standard. Regression line was plotted based on the coordinates of the BSA concentration against the reading at 595 nm. The concentration of protein sample was therefore estimated from the regression line after the protein assay.

Assay for Enzyme Activity

[0143]A standard glucosylation reaction was set up by mixing 2 μg of recombinant proteins with 14 mM 2-mercaptoethanol, 5 mM UDP-glucose, 1 mM of various lignin or antioxidant substrate, 100 mM Tris, pH 7.0, to a total volume of 200 μl. The reaction was carried out at 30° C. for 30 min and stopped by the addition of 20 μl trichloroacetic acid (240 mg/ml). All the samples were stored at -20° C. before the liquid chromatographic assay.

High-Performance Liquid Chromatographic

[0144]Reverse-phase HPLC (Waters Separator 2690 and Waters Tunable Absorbance Detector 486, Waters Limited, Herts, UK) using a Columbus 5μ C₁₈ column (250×4.60 mm, Phenomenex). Linear gradient of acetonitrile in H₂O (all solutions contained 0.1% trifluoroacetic acid) at 1 ml/min over 20 min, was used to separate the glucose conjugates from their aglycone. The HPLC methods were described as the following: cinnamic acid, λ₂₈₈ nm, 10-55% acetonitrile; p-coumaric acid, λ₃₁₁ nm, 10-25% acetonitrile; caffeic acid, λ₃₁₁ nm, 10-16% acetonitrile; ferulic acid, λ₃₁₁ nm, 10-35% acetonitrile; sinapic acid, λ₃₀₆ nm, 10-40% acetonitrile; p-coumaryl aldehyde, λ₃₁₅ nm, 10-46% acetonitrile; coniferyl aldehyde, λ₂₈₃ nm, 10-47% acetonitrile; sinapyl aldehyde, λ₂₈₀ nm, 10-47% acetonitrile; p-coumaryl alcohol, p₂₈₃ nm, 10-27% acetonitrile; coniferyl alcohol, λ₃₀₆ nm, 10-25% acetonitrile; sinapyl alcohol, λ₂₈₅ nm, 10-25% acetonitrile. The retention time (R_t) of the glucose conjugates analysed is listed in the following: cinnamoylglucose, R_t=12.3 min; p-coumaroylglucose, R_t=10.6 min; caffeoylglucose, R_t=8.5 min; feruloylglucose, R_t=10.3 min; sinapoylglucose, R_t=9.7 min; caffeoyl-4-O-glucoside, R_t=6.8 min; feruloyl-4-O-glucoside, R_t=7.8 min; sinapoyl-4-O-glucoside, R_t=8.2 min; coniferin, R_t=8.2 min; syringin, R_t=9.1 min.

[0145]The recombinant GTases were shown to have GTase activity towards the major intermediates of the lignin biosynthesis pathway (Tables 5 and 6). It is clear from these results that the GTases display different specific activity reaction profiles relative to each other on the various lignin precursor substrates utilised. Michaelis-Menten kinetics were also studied on several of the GTases against their preferred substrates (Tables 7 and 8). It is clear from these results that the GTases display different enzyme kinetics for different substrates.

[0146]The results (in total) indicate that certain GTases show a greater potential for use in the alteration of lignin biosynthesis inplanta than others.

Reducing the Formation of Monolignol Glucosides In Planta

[0147]In one approach to reduce the formation of monolignol glucosides in planta, A119 and A407 are down regulated using an antisense strategy (A). Expression of the A119 and A407 antisense sequences is driven by the gene's own promoter. An alternative approach (B) is to modify the UDP-glucose binding motif through an in vitro mutagenesis method (Lim et al., 1998) such that the mutant protein is able to bind the monolignol substrates but loses its catalytic activity. Such mutant proteins are thought to compete with the functional native protein by binding specifically to monolignols, thereby reducing the formation of monolignol glucosides.

Anti-Sense Approach

Amplification and Cloning of the A119 and A407 Promoter Sequences

[0148]Approximately 2 kb of the 5' flanking sequences of A119 and A407 are amplified directly from genomic DNA by PCR. The promoter fragments are then cloned into a pBluescript plasmid vector (Sambrook et al., 1989).

Construct Chimaeric Genes of A119 and A407 Promoter and Their ORF Region in Antisense Orientation.

[0149]The A119 and A407 cDNA fragments are amplified from pGEXA119 and pGEXA407 by PCR. The fragments are then ligated correspondingly into the A119 and A407 promoter constructs described in (A)-(1) with the ORF region in the antisense orientation.

Preparation of Binary Construct Containing the A119 and A407 Antisense Chimaeric Gene

[0150]The DNA fragments containing the A119 and A407 antisense chimaeric genes are amplified by PCR from the chimaeric constructs described in (A)-(2). The fragments are then ligated into a binary vector (Sambrook et al., 1989). The final constructs are transformed into plants subsequently.

Mutant Gene Approach

In Vitro Site Mutagenesis to Modify the UDPglucose Binding Motif in A119 and A407

[0151]In vitro site mutagenesis is carried by PCR to modify the sequences encoding the UDPglucose binding motif in A119 and A407 (Lim et al., 1998). The constructs pGEXA119 and pGEXA407 are used in the DNA templates in the PCR reaction.

Construct Chimaeric Mutant Genes Regulated by A119 and A407 Promoters

[0152]The A119 and A407 mutant genes are amplified from the pGEXA119 and pGEXA407 mutant constructs described in (B)-(1) by PCR. The A119 and A407 mutant gene fragments are then ligated into the A119 and A407 promoter constructs described in (A)-(1) with the ORF region in the sense orientation.

Preparation of Binary Construct Containing the Chimaeric Mutant Genes A119 and A407

[0153]The DNA fragments containing the A119 and A407 mutant chimaeric genes are amplified by PCR from the chimaeric constructs described in (B)-(2). The fragments are then ligated into a binary vector (Sambrook et al., 1989). The final constructs are transformed into plants subsequently.

Enhancing the Formation of Monolignol Glucosides in Planta

[0154]The CaMV 35S promoter fragment is used to drive the expression of A119 and A497. DNA fragments containing A119 and A407 ORF sequences are amplified from pGEXA119 and pGEXA407 correspondingly by PCR. The DNA fragments are ligated downstream of the CaMV 35S promoter. The constructs are used to transform plants such that the lignin content and composition is altered.

TABLE-US-00001 TABLE 1 Database information on eleven Arabidopsis GTase genes Gene Database BAC/P1 gene name in name protein_id chromosome acc. no. clone database A062 Gi|3935156 I ac005106 T25N20 T25N20.20 A320 Not annotated III ab019232 MIL23 not annotated A41 Emb|CAB10326.1 IV z97339 FCA4 d13780c A42 Emb|CAB10327.1 IV z97339 FCA4 d13785c A43 Emb|CAB10328.1 IV z97339 FCA4 d13790c A911 Gi|2642451 II ac002391 T20D16 T20D16.11 A119 Not annotated V ab018119 MSN2 not annotated A233 Wrongly annotated IV al021961 F28A23 wrongly annotated A407 Gi|3319344 V af077407 F9D12 F9D12.4 A961 Gi|3582329 II ac005496 T27A16 T27A16.15 A962 Gi|3582341 II ac005496 T27A16 T27A16.16

[0155]Parameters used for the search of the above Arabidopsis sequences and the programme used are as follows:

NETBLAST with the default settings:

Infile2=nr

Matrix=Blosum 62

Translate=1

Dbtranslate=1

TABLE-US-00002 [0156]TABLE 2 DNA sequences and restriction enzyme sites in primers used in amplification of 11 Arabidopsis Gtase sequences from genomic DNA. Sequence complementary to either end of the ORFs are under- lined. Restriction enzyme sites that were used in making expression constructs were in BOLD type. restriction primer DNA sequence (5'→3') enzyme sites A062 5' CGGGTGATCAGGTACCATGGCGCCACCGCATTTTC BclI and KpnI SEQ ID NO: 55 A062 3' CGGAATTCGTCGAGTTACTTTACTTTTACCTCCTC EcoRI and SalI SEQ. ID NO: 56 A320 5' CCCCCGGGTACCATGGAGCTAGAATCTTCTCTCC SmaI and KpnI SEQ. ID NO: 57 A320 3' CGGAATTCTCGAGTTAAAAGGTTTTGATTGATCC EcoRI and XhoI SEQ. ID NO: 58 A41 5' TGGGATCCATATCAGAAATGGTGTTC BamHI SEQ. ID NO: 59 A41 3' GGGAATTCCTAGTATCCATTATCTTTAGTC EcoRI SEQ. ID NO: 60 A42 5' GGGGATCCATGGACCCGTCTCGTCATACTC BamHI SEQ. ID NO: 61 A42 3' GGGAATTCCACTAGTGTTCTCCGTTGTCTTC EcoRI SEQ. ID NO: 62 A43 5' GGGGATCCAATATGGAGATGGAATCGTCGTTAC BamHI SEQ. ID NO: 63 A43 3' GGGAATTCCTTACACGACATTATTAATGTTTG EcoRI SEQ. ID NO: 64 A911 5' GGGGTACCTGATCAATAATGGGCAGTAGTGAGGG KpnI and BclI SEQ. ID NO: 65 A911 3' CGGAATTCGTCGACGAGTTAGGCGATTGTGATATC EcoRI and SalI SEQ. ID NO: 66 A119 5' CGGGATCCGGTACCATGCATATCACAAAACCACAC BamHI and KpnI SEQ. ID NO: 67 A119 3' CGGAATTCGCTAGCTAAGCACCACGTGACAAGTCC EcoRI and NheI SEQ. ID NO: 68 A233 5' CGGGATCCGGTACCATGAGTAGTGATCCTCATCGT BamHI and KpnI SEQ. ID NO: 69 A233 3' CGGGATCCGAATTCTAGGAGGTAAACTCTTCTATG BamHI and SEQ. ID NO: 70 EcoRI A407 5' CGGGATCCGGTACCATGCATATCACAAAACCACAC BamHI and KpnI SEQ. ID NO: 71 A407 3' CGGAATTCGTCGACCTAAGCACCACGTCCCAAG EcoRI and SalI SEQ. ID NO: 72 A961 5' GGGTGATCAGGTACCATGGGGAAGCAAGAAGATG BclI and KpnI SEQ. ID NO: 73 A961 3' CGGAATTCGTCGACTACTTACTTATAGAAACGCCG EcoRI and SalI SEQ. ID NO: 74 A962 5' GAAGATCTGGTACCATGGCGAAGCAGCAAGAAG BglII and KpnI SEQ. ID NO: 75 A962 3' CGGAATTCGTCGACCGATGAAAGCCCATCTATG EcoRI and SalI SEQ. ID NO: 76

TABLE-US-00003 TABLE 3 PCR programme Stage I (1 cycle) Stage II (40 cycles) Stage III (1 cycle) 95° C. 5 min 95° C. 1 min 95° C. 2 min 55° C. 2 min 55° C. 1 min 55° C. 2 min 72° C. 3 min 72° C. 2 min 72° C. 5 min

TABLE-US-00004 TABLE 4 The HPLC conditions Detector Acetonitrile Wavelength Lignin Precursors Gradient (%) (nm) cinnamic acid 10-55 288 p-coumaric acid 10-25 311 caffeic acid 10-16 311 ferulic acid 10-35 311 sinapic acid 10-40 306 p-coumaryl aldehyde 10-46 315 coniferyl aldehyde 10-47 283 sinapyl aldehyde 10-47 280 p-coumaryl alcohol 10-27 283 coniferyl alcohol 10-25 306 sinapyl alcohol 10-25 285

TABLE-US-00005 TABLE 5 Specific activity of the recombinant GTases producing glucose ester against lignin precursors Each assay contained 0.5 mquadrature of potential substrates, 5 mM UDPG and 0.2 μg of recombinant GTases in a total volume of 200 μl. The reactions were incubated at 20° C. for 30 min and were stopped by addition of 20 μl TCA (240 mg/ml). Each reaction mix was then analysed using HPLC. The specific activity (nkat/mg) of the recombinant GTase is defined as the amount of substrate (nmole) converted to glucose ester per second by 1 mg of protein at 20° C. under the reaction conditions. A41 A320 A42 A43 A911 A062 Cinnamic acid 0.30 0.06 14.21 0.02 8.77 1.62 p-coumaric acid 13.53 0.05 4.69 0.03 4.31 2.54 Caffeic acid 2.61 0.05 0.62 0.01 0.77 0.26 Ferulic acid 6.64 0.54 15.63 0.04 2.88 0.08 Sinapic acid 5.35 15.58 11.97 0.05 0.15 0.1

TABLE-US-00006 TABLE 6 Specific activity of the recombinant GTases producing O-glucosides against lignin precursors The reactions were set up following the conditions described in Table 1. All the reactions, except those containing the aldehydes, were stopped by the addition of TCA. The aldehyde assay mixs were injected into HPLC immediately after the reactions were completed. The specific activity (nkat/mg) of the recombinant GTase is defined as the amount of substrate (nmole) converted to 4-O-glucoside per second by 1 mg of protein at 30° C. under the reaction conditions. A233 A119 A407 A961 A962 Cinnamic acid ND^a ND ND ND ND p-coumaric acid 0.09 0.02 0.01 0.01 0.01 caffeic acid 0.48 0.13 0.07 0.07 ND ferulic acid 0.37 14.48 0.25 ND ND sinapic acid 0.39 102.56 65.39 0.01 0.01 p-coumaryl aldehyde ND 0.03 ND 0.01 0.02 Coniferyl aldehyde ND 1.08 ND 0.16 0.34 sinapyl aldehyde ND 4.55 ND 0.57 0.50 p-coumaryl alcohol ND ND ND ND ND Coniferyl alcohol 0.46 67.53 2.78 0.57 0.49 sinapyl alcohol 0.05 126.16 114.76 0.35 0.45 ^aND, not detected

TABLE-US-00007 TABLE 7 Kinetic studies on the recombinant GTases producing glucose esters against lignin precursors A41 A320 A42 A911 A062 K_m V_max K_m V_max K_m V_max V_max V_max MM nkat/mg mM nkat/mg mM nkat/mg K_m mM nkat/mg K_m mM nkat/mg 1.51 -- 1.80 -- 0.72 -- 1.05 -- 2.36 -- -- -- -- -- 0.49 19.42 0.05 9.06 4.33 2.87 0.10 16.13 -- -- 0.40 6.67 0.39 11.10 5.05 4.91 0.06 20.24 -- -- 0.20 1.67 0.23 1.18 -- -- 0.35 11.35 -- -- 0.36 18.35 0.34 6.91 -- -- 0.24 6.78 0.06 8.37 0.13 12.80 -- -- -- --

TABLE-US-00008 TABLE 8 Kinetic studies on the recombinant GTases producing O-glucosides against lignin precursors A119 A407 K_m V_max K_m V_max mM nkat/mg mM nkat/mg UDPG 0.93 -- 0.89 -- ferulic acid 0.25 18.87 -- -- sinapic acid 0.51 131.58 0.14 75.19 coniferyl 0.26 92.59 -- -- alcohol sinapyl alcohol 1.10 322.58 1.07 357.10

TABLE-US-00009 TABLE 9 ¹H and ¹3C NMR spectra were recorded in deuterated methanol at 500 MHz and 125 MHz respectively. Chemical shifts are given on δ scale with TMS as internal standard. The position on the aromatic ring begins with the carbon joining the propanoic acid. d, doublet; dd, doublet of doublets; m, multiplet; J, coupling constant. Caffeic acid Caffeoyl-3-O-glucoside Position δ_H δ_C δ_H δ_C C1 -- 128.1 -- 127.6 C2 7.02 (1H, d, J = 2.0 Hz) 115.2 7.47 (1H, d, J = 2.0 Hz) 117.0 C3 -- 146.7 -- 146.0 C4 -- 149.4 -- 150.6 C5 6.77 (1H, d, J = 8.0 Hz) 116.6 6.84 (1H, d, J = 8.5 Hz) 117.8 C6 6.92 (1H, dd, J = 8.0, 2.0 Hz) 122.8 7.13 (1H, dd, J = 8.5, 2.0 Hz) 125.6 C7 7.53 (1H, d, J = 16.0 Hz) 146.9 7.45 (1H, d, J = 14.5 Hz) 146.6 C8 6.21 (1H, d, J = 15.5 Hz) 116.3 6.33 (1H, d, J = 14.5 Hz) 116.1 C9 -- 171.5 -- 170.4 Glc-1 ~4.86 (signal interrupted) 103.9 Glc-2 74.5 Glc-3 78.0 Glc-4 {close oversize brace} 3.40-3.50 (4H, m) 71.0 Glc-5 77.2 Glc-6 3.93 (1H, dd, J = 12.0, 2.0 Hz) 62.4 3.71 (1H, dd, J = 12.0, 5.5 Hz)

TABLE-US-00010 TABLE 10 Each assay contained 1 quadratureg of UGT71C1, 1 mM phenolic compound, 5 mM UDP-glucose, 1.4 mM 2-mercaptoethanol and 50 mM TRIS-HCl, pH 7.0. The mix was incubated at 30° C. for 30 min. The reaction was stopped by the addition of 20 quadraturel of trichloroacetic acid (240 mg/ml) and was analysed by reverse-phase HPLC subsequently. The results represent the mean of three replicates ± standard deviation. Specific activity Substrate nkat/mg o-Coumaric acid 1.5 ± 0.2 m-Coumaric acid 1.2 ± 0.2 p-Coumaric acid 0 Caffeic acid 2.9 ± 0.8 Ferulic acid 0 Sinapic acid 0 Esculetin 34.8 ± 4.2 Scopoletin 29.4 ± 3.9 Salicylic acid 0 4-hydroxybenzoic acid 0 3,4-dihydroxybenzoic acid 0 Eriodictyol 0 Luteolin 0.7 ± 0.1 Quercetin 1.4 ± 0.4 Catechin 0 Cyanidin 0

Sequence CWU 1

7611410DNAArabidopsis thaliana 1atggcgccac cgcattttct actggtaacg tttccggcgc aaggtcacgt gaacccatct 60ctccgttttg ctcgtcggct catcaaaaga accggcgcac gtgtcacttt cgtcacttgt 120gtctccgtct tccacaactc catgatcgca aaccacaaca aagtcgaaaa tctctctttc 180cttactttct ccgacggttt cgacgatgga ggcatttcca cctacgaaga ccgtcagaaa 240aggtcggtga atctcaaggt taacggcgat aaggcactat cggatttcat cgaagctact 300aagaatggtg actctcccgt gacttgcttg atctacacga ttcttctcaa ttgggctcca 360aaagtagcac gtagatttca acttccctcc gctcttctct ggatccaacc ggctttggtt 420ttcaacatct attacactca tttcatggga aacaagtccg ttttcgagtt acctaatctg 480tcttctctgg aaatcagaga tcttccatct ttcctcacac cttccaacac aaacaaaggc 540gcatacgatg cgtttcaaga aatgatggag tttctcataa aagaaaccaa accgaaaatt 600ctcatcaaca ctttcgattc gctggaacca gaggccttaa cggctttccc gaatatcgat 660atggtggcgg ttggtccttt acttcccacg gagattttct caggaagcac caacaaatca 720gttaaagatc aaagtagtag ttatacactt tggctagact cgaaaacaga gtcctctgtt 780atttacgttt cctttggaac aatggttgag ttgtccaaga aacagataga ggaactagcg 840agagcactca tagaagggaa acgaccgttt ttgtgggtta taactgataa atccaacaga 900gaaacgaaaa cagaaggaga agaagagaca gagattgaga agatagctgg attcagacac 960gagcttgaag aggttgggat gattgtgtcg tggtgttcgc agatagaggt tttaagtcac 1020cgagccgtag gttgttttgt gactcattgt gggtggagct cgacgctgga gagtttggtt 1080cttggcgttc cggttgtggc gtttccgatg tggtcggatc aaccgacgaa cgcgaagcta 1140ctggaagaaa gttggaagac tggtgtgagg gtaagagaga acaaggatgg tttggtggag 1200agaggagaga tcaggaggtg tttggaagcc gtgatggagg agaagtcggt ggagttgagg 1260gaaaacgcaa agaaatggaa gcgtttagcg atggaagcgg gtagagaagg aggatcttcg 1320gataagaaca tggaggcttt tgtggaggat atttgtggag aatctcttat tcaaaacttg 1380tgtgaagcag aggaggtaaa agtaaagtaa 14102469PRTArabidopsis thaliana 2Met Ala Pro Pro His Phe Leu Leu Val Thr Phe Pro Ala Gln Gly His 1 5 10 15Val Asn Pro Ser Leu Arg Phe Ala Arg Arg Leu Ile Lys Arg Thr Gly 20 25 30Ala Arg Val Thr Phe Val Thr Cys Val Ser Val Phe His Asn Ser Met 35 40 45Ile Ala Asn His Asn Lys Val Glu Asn Leu Ser Phe Leu Thr Phe Ser 50 55 60Asp Gly Phe Asp Asp Gly Gly Ile Ser Thr Tyr Glu Asp Arg Gln Lys 65 70 75 80Arg Ser Val Asn Leu Lys Val Asn Gly Asp Lys Ala Leu Ser Asp Phe 85 90 95Ile Glu Ala Thr Lys Asn Gly Asp Ser Pro Val Thr Cys Leu Ile Tyr 100 105 110Thr Ile Leu Leu Asn Trp Ala Pro Lys Val Ala Arg Arg Phe Gln Leu 115 120 125Pro Ser Ala Leu Leu Trp Ile Gln Pro Ala Leu Val Phe Asn Ile Tyr 130 135 140Tyr Thr His Phe Met Gly Asn Lys Ser Val Phe Glu Leu Pro Asn Leu145 150 155 160Ser Ser Leu Glu Ile Arg Asp Leu Pro Ser Phe Leu Thr Pro Ser Asn 165 170 175Thr Asn Lys Gly Ala Tyr Asp Ala Phe Gln Glu Met Met Glu Phe Leu 180 185 190Ile Lys Glu Thr Lys Pro Lys Ile Leu Ile Asn Thr Phe Asp Ser Leu 195 200 205Glu Pro Glu Ala Leu Thr Ala Phe Pro Asn Ile Asp Met Val Ala Val 210 215 220Gly Pro Leu Leu Pro Thr Glu Ile Phe Ser Gly Ser Thr Asn Lys Ser225 230 235 240Val Lys Asp Gln Ser Ser Ser Tyr Thr Leu Trp Leu Asp Ser Lys Thr 245 250 255Glu Ser Ser Val Ile Tyr Val Ser Phe Gly Thr Met Val Glu Leu Ser 260 265 270Lys Lys Gln Ile Glu Glu Leu Ala Arg Ala Leu Ile Glu Gly Lys Arg 275 280 285Pro Phe Leu Trp Val Ile Thr Asp Lys Ser Asn Arg Glu Thr Lys Thr 290 295 300Glu Gly Glu Glu Glu Thr Glu Ile Glu Lys Ile Ala Gly Phe Arg His305 310 315 320Glu Leu Glu Glu Val Gly Met Ile Val Ser Trp Cys Ser Gln Ile Glu 325 330 335Val Leu Ser His Arg Ala Val Gly Cys Phe Val Thr His Cys Gly Trp 340 345 350Ser Ser Thr Leu Glu Ser Leu Val Leu Gly Val Pro Val Val Ala Phe 355 360 365Pro Met Trp Ser Asp Gln Pro Thr Asn Ala Lys Leu Leu Glu Glu Ser 370 375 380Trp Lys Thr Gly Val Arg Val Arg Glu Asn Lys Asp Gly Leu Val Glu385 390 395 400Arg Gly Glu Ile Arg Arg Cys Leu Glu Ala Val Met Glu Glu Lys Ser 405 410 415Val Glu Leu Arg Glu Asn Ala Lys Lys Trp Lys Arg Leu Ala Met Glu 420 425 430Ala Gly Arg Glu Gly Gly Ser Ser Asp Lys Asn Met Glu Ala Phe Val 435 440 445Glu Asp Ile Cys Gly Glu Ser Leu Ile Gln Asn Leu Cys Glu Ala Glu 450 455 460Glu Val Lys Val Lys46531410DNAArabidopsis thaliana 3ttactttact tttacctcct ctgcttcaca caagttttga ataagagatt ctccacaaat 60atcctccaca aaagcctcca tgttcttatc cgaagatcct ccttctctac ccgcttccat 120cgctaaacgc ttccatttct ttgcgttttc cctcaactcc accgacttct cctccatcac 180ggcttccaaa cacctcctga tctctcctct ctccaccaaa ccatccttgt tctctcttac 240cctcacacca gtcttccaac tttcttccag tagcttcgcg ttcgtcggtt gatccgacca 300catcggaaac gccacaaccg gaacgccaag aaccaaactc tccagcgtcg agctccaccc 360acaatgagtc acaaaacaac ctacggctcg gtgacttaaa acctctatct gcgaacacca 420cgacacaatc atcccaacct cttcaagctc gtgtctgaat ccagctatct tctcaatctc 480tgtctcttct tctccttctg ttttcgtttc tctgttggat ttatcagtta taacccacaa 540aaacggtcgt ttcccttcta tgagtgctct cgctagttcc tctatctgtt tcttggacaa 600ctcaaccatt gttccaaagg aaacgtaaat aacagaggac tctgttttcg agtctagcca 660aagtgtataa ctactacttt gatctttaac tgatttgttg gtgcttcctg agaaaatctc 720cgtgggaagt aaaggaccaa ccgccaccat atcgatattc gggaaagccg ttaaggcctc 780tggttccagc gaatcgaaag tgttgatgag aattttcggt ttggtttctt ttatgagaaa 840ctccatcatt tcttgaaacg catcgtatgc gcctttgttt gtgttggaag gtgtgaggaa 900agatggaaga tctctgattt ccagagaaga cagattaggt aactcgaaaa cggacttgtt 960tcccatgaaa tgagtgtaat agatgttgaa aaccaaagcc ggttggatcc agagaagagc 1020ggagggaagt tgaaatctac gtgctacttt tggagcccaa ttgagaagaa tcgtgtagat 1080caagcaagtc acgggagagt caccattctt agtagcttcg atgaaatccg atagtgcctt 1140atcgccgtta accttgagat tcaccgacct tttctgacgg tcttcgtagg tggaaatgcc 1200tccatcgtcg aaaccgtcgg agaaagtaag gaaagagaga ttttcgactt tgttgtggtt 1260tgcgatcatg gagttgtgga agacggagac acaagtgacg aaagtgacac gtgcgccggt 1320tcttttgatg agccgacgag caaaacggag agatgggttc acgtgacctt gcgccggaaa 1380cgttaccagt agaaaatgcg gtggcgccat 141041491DNAArabidopsis thaliana 4atggagctag aatcttctcc tcctctacct cctcatgtga tgctcgtatc ttttccaggg 60caaggccacg ttaatccact tcttcgtctt ggtaagctct tagcttcaaa gggtttgctc 120ataaccttcg tcaccactga gtcatggggc aaaaagatgc gaatctccaa caaaatccaa 180gaccgtgtcc tcaaaccggt tggtaaaggc tatctccggt atgatttctt cgacgacggg 240cttcctgaag acgacgaagc tagcagaacc aacttaacca tcctccgacc acatctagag 300ctggtcggca aaagagagat caagaacctt gtgaaacgtt acaaggaagt aacgaaacag 360cccgtgacat gtcttatcaa caaccctttc gtctcttggg tctgtgacgt ggcagaagat 420cttcaaatcc cttgtgctgt tctttgggtt caatcttgtg cctgcttagc tgcttattac 480tattaccacc acaacctagt tgacttcccg accaaaacag aacccgagat cgatgtccaa 540atctctggca tgcctctctt gaaacatgac gagatccctt ctttcattca cccttcaagt 600cctcactccg ctttgcgaga agtgatcata gatcagatta aacggcttca caagactttc 660tccattttca tcgacacttt caactcattg gagaaagaca tcattgacca catgtcgacg 720ctctctctcc ccggtgttat cagaccgcta ggaccactct acaaaatggc taaaaccgta 780gcttatgatg tcgttaaagt aaacatctct gagccaacgg atccttgcat ggagtggtta 840gactcgcagc cagtttcctc cgttgtttac atctcattcg ggaccgttgc ttacttgaaa 900caagaacaaa tagacgagat cgcttacggt gtgttaaacg ccgacgttac gttcttgtgg 960gtgattagac aacaagagtt aggtttcaac aaagagaaac atgttttgcc ggaagaagtt 1020aaagggaaag ggaagatcgt tgaatggtgt tcacaagaga aagtattatc tcatccttca 1080gtggcatgtt tcgtgactca ctgtggatgg aactcaacga tggaagctgt gtcttccgga 1140gtcccgacgg tttgttttcc tcaatgggga gatcaagtca cggacgccgt ttacatgatc 1200gatgtttgga agacgggagt gaggctaagc cgtggagagg cggaggagag gttagtgccg 1260agggaggaag ttgcggagag gttgagagag gttactaaag gagagaaagc gatcgagttg 1320aaaaagaatg ctttgaagtg gaaggaagag gcggaggcgg cggttgctcg cggtggttcg 1380tcggatagga atcttgaaaa gtttgtggag aagttgggtg ccaaacctgt ggggaaagta 1440caaaacggga gtcataatca tgtcttggct ggatcaatca aaagctttta a 14915496PRTArabidopsis thaliana 5Met Glu Leu Glu Ser Ser Pro Pro Leu Pro Pro His Val Met Leu Val 1 5 10 15Ser Phe Pro Gly Gln Gly His Val Asn Pro Leu Leu Arg Leu Gly Lys 20 25 30Leu Leu Ala Ser Lys Gly Leu Leu Ile Thr Phe Val Thr Thr Glu Ser 35 40 45Trp Gly Lys Lys Met Arg Ile Ser Asn Lys Ile Gln Asp Arg Val Leu 50 55 60Lys Pro Val Gly Lys Gly Tyr Leu Arg Tyr Asp Phe Phe Asp Asp Gly 65 70 75 80Leu Pro Glu Asp Asp Glu Ala Ser Arg Thr Asn Leu Thr Ile Leu Arg 85 90 95Pro His Leu Glu Leu Val Gly Lys Arg Glu Ile Lys Asn Leu Val Lys 100 105 110Arg Tyr Lys Glu Val Thr Lys Gln Pro Val Thr Cys Leu Ile Asn Asn 115 120 125Pro Phe Val Ser Trp Val Cys Asp Val Ala Glu Asp Leu Gln Ile Pro 130 135 140Cys Ala Val Leu Trp Val Gln Ser Cys Ala Cys Leu Ala Ala Tyr Tyr145 150 155 160Tyr Tyr His His Asn Leu Val Asp Phe Pro Thr Lys Thr Glu Pro Glu 165 170 175Ile Asp Val Gln Ile Ser Gly Met Pro Leu Leu Lys His Asp Glu Ile 180 185 190Pro Ser Phe Ile His Pro Ser Ser Pro His Ser Ala Leu Arg Glu Val 195 200 205Ile Ile Asp Gln Ile Lys Arg Leu His Lys Thr Phe Ser Ile Phe Ile 210 215 220Asp Thr Phe Asn Ser Leu Glu Lys Asp Ile Ile Asp His Met Ser Thr225 230 235 240Leu Ser Leu Pro Gly Val Ile Arg Pro Leu Gly Pro Leu Tyr Lys Met 245 250 255Ala Lys Thr Val Ala Tyr Asp Val Val Lys Val Asn Ile Ser Glu Pro 260 265 270Thr Asp Pro Cys Met Glu Trp Leu Asp Ser Gln Pro Val Ser Ser Val 275 280 285Val Tyr Ile Ser Phe Gly Thr Val Ala Tyr Leu Lys Gln Glu Gln Ile 290 295 300Asp Glu Ile Ala Tyr Gly Val Leu Asn Ala Asp Val Thr Phe Leu Trp305 310 315 320Val Ile Arg Gln Gln Glu Leu Gly Phe Asn Lys Glu Lys His Val Leu 325 330 335Pro Glu Glu Val Lys Gly Lys Gly Lys Ile Val Glu Trp Cys Ser Gln 340 345 350Glu Lys Val Leu Ser His Pro Ser Val Ala Cys Phe Val Thr His Cys 355 360 365Gly Trp Asn Ser Thr Met Glu Ala Val Ser Ser Gly Val Pro Thr Val 370 375 380Cys Phe Pro Gln Trp Gly Asp Gln Val Thr Asp Ala Val Tyr Met Ile385 390 395 400Asp Val Trp Lys Thr Gly Val Arg Leu Ser Arg Gly Glu Ala Glu Glu 405 410 415Arg Leu Val Pro Arg Glu Glu Val Ala Glu Arg Leu Arg Glu Val Thr 420 425 430Lys Gly Glu Lys Ala Ile Glu Leu Lys Lys Asn Ala Leu Lys Trp Lys 435 440 445Glu Glu Ala Glu Ala Ala Val Ala Arg Gly Gly Ser Ser Asp Arg Asn 450 455 460Leu Glu Lys Phe Val Glu Lys Leu Gly Ala Lys Pro Val Gly Lys Val465 470 475 480Gln Asn Gly Ser His Asn His Val Leu Ala Gly Ser Ile Lys Ser Phe 485 490 49561491DNAArabidopsis thaliana 6ttaaaagctt ttgattgatc cagccaagac atgattatga ctcccgtttt gtactttccc 60cacaggtttg gcacccaact tctccacaaa cttttcaaga ttcctatccg acgaaccacc 120gcgagcaacc gccgcctccg cctcttcctt ccacttcaaa gcattctttt tcaactcgat 180cgctttctct cctttagtaa cctctctcaa cctctccgca acttcctccc tcggcactaa 240cctctcctcc gcctctccac ggcttagcct cactcccgtc ttccaaacat cgatcatgta 300aacggcgtcc gtgacttgat ctccccattg aggaaaacaa accgtcggga ctccggaaga 360cacagcttcc atcgttgagt tccatccaca gtgagtcacg aaacatgcca ctgaaggatg 420agataatact ttctcttgtg aacaccattc aacgatcttc cctttccctt taacttcttc 480cggcaaaaca tgtttctctt tgttgaaacc taactcttgt tgtctaatca cccacaagaa 540cgtaacgtcg gcgtttaaca caccgtaagc gatctcgtct atttgttctt gtttcaagta 600agcaacggtc ccgaatgaga tgtaaacaac ggaggaaact ggctgcgagt ctaaccactc 660catgcaagga tccgttggct cagagatgtt tactttaacg acatcataag ctacggtttt 720agccattttg tagagtggtc ctagcggtct gataacaccg gggagagaga gcgtcgacat 780gtggtcaatg atgtctttct ccaatgagtt gaaagtgtcg atgaaaatgg agaaagtctt 840gtgaagccgt ttaatctgat ctatgatcac ttctcgcaaa gcggagtgag gacttgaagg 900gtgaatgaaa gaagggatct cgtcatgttt caagagaggc atgccagaga tttggacatc 960gatctcgggt tctgttttgg tcgggaagtc aactaggttg tggtggtaat agtaataagc 1020agctaagcag gcacaagatt gaacccaaag aacagcacaa gggatttgaa gatcttctgc 1080cacgtcacag acccaagaga cgaaagggtt gttgataaga catgtcacgg gctgtttcgt 1140tacttccttg taacgtttca caaggttctt gatctctctt ttgccgacca gctctagatg 1200tggtcggagg atggttaagt tggttctgct agcttcgtcg tcttcaggaa gcccgtcgtc 1260gaagaaatca taccggagat agcctttacc aaccggtttg aggacacggt cttggatttt 1320gttggagatt cgcatctttt tgccccatga ctcagtggtg acgaaggtta tgagcaaacc 1380ctttgaagct aagagcttac caagacgaag aagtggatta acgtggcctt gccctggaaa 1440agatacgagc atcacatgag gaggtagagg aggagaagat tctagctcca t 149171473DNAArabidopsis thaliana 7atgggatcca tatcagaaat ggtgttcgaa acttgtccat ctccaaaccc aattcatgta 60atgctcgtct cgtttcaagg acaaggccac gtcaaccctc ttcttcgtct cggcaagtta 120attgcttcaa agggtttact cgttaccttc gttacaacgg agctttgggg caagaaaatg 180agacaagcca acaaaatcgt tgacggtgaa cttaaaccgg ttggttccgg ttcaatccgg 240tttgagttct ttgatgaaga atgggcagag gatgatgacc ggagagctga tttctctttg 300tacattgctc acctagagag cgttgggata cgagaagtgt ctaagcttgt gagaagatac 360gaggaagcga acgagcctgt ctcgtgtctt atcaataacc cgtttatccc atgggtctgc 420cacgtggcgg aagagttcaa cattccttgt gcggttctct gggttcagtc ttgtgcttgt 480ttctctgctt attaccatta ccaagatggc tctgtttcat tccctacgga aacagagcct 540gagctcgatg tgaagcttcc ttgtgttcct gtcttgaaga acgacgagat tcctagcttt 600ctccatcctt cttctaggtt cacgggtttt cgacaagcga ttcttgggca attcaagaat 660ctgagcaagt ccttctgtgt tctaatcgat tcttttgact cattggaaca agaagttatc 720gattacatgt caagtctttg tccggttaaa accgttggac cgcttttcaa agttgctagg 780acagttactt ctgacgtaag cggtgacatt tgcaaatcaa cagataaatg cctcgagtgg 840ttagactcga ggcctaaatc gtcagttgtc tacatttcgt tcgggacagt tgcatatttg 900aagcaagaac agatcgaaga gatcgctcac ggagttttga agtcgggttt atcgttcttg 960tgggtgatta gacctccacc acacgatctg aaggtcgaga cacatgtctt gcctcaagaa 1020cttaaagaga gtagtgctaa aggtaaaggg atgattgtgg attggtgccc acaagagcaa 1080gtcttgtctc atccttcagt ggcatgcttc gtgactcatt gtggatggaa ctcgacaatg 1140gaatctttgt cttcaggtgt tccggtggtt tgttgtccgc aatggggaga tcaagtgact 1200gatgcagtgt atttgatcga tgttttcaag accggggtta gactaggccg tggagcgacc 1260gaggagaggg tagtgccaag ggaggaagtg gcggagaagc ttttggaagc gacagttggg 1320gagaaggcag aggagttgag aaagaacgct ttgaaatgga aggcggaggc ggaagcagcg 1380gtggctccag gaggttcgtc ggataagaat tttagggagt ttgtggagaa gttaggtgcg 1440ggagtaacga agactaaaga taatggatac tag 14738484PRTArabidopsis thaliana 8Met Val Phe Glu Thr Cys Pro Ser Pro Asn Pro Ile His Val Met Leu 1 5 10 15Val Ser Phe Gln Gly Gln Gly His Val Asn Pro Leu Leu Arg Leu Gly 20 25 30Lys Leu Ile Ala Ser Lys Gly Leu Leu Val Thr Phe Val Thr Thr Glu 35 40 45Leu Trp Gly Lys Lys Met Arg Gln Ala Asn Lys Ile Val Asp Gly Glu 50 55 60Leu Lys Pro Val Gly Ser Gly Ser Ile Arg Phe Glu Phe Phe Asp Glu 65 70 75 80Glu Trp Ala Glu Asp Asp Asp Arg Arg Ala Asp Phe Ser Leu Tyr Ile 85 90 95Ala His Leu Glu Ser Val Gly Ile Arg Glu Val Ser Lys Leu Val Arg 100 105 110Arg Tyr Glu Glu Ala Asn Glu Pro Val Ser Cys Leu Ile Asn Asn Pro 115 120 125Phe Ile Pro Trp Val Cys His Val Ala Glu Glu Phe Asn Ile Pro Cys 130 135 140Ala Val Leu Trp Val Gln Ser Cys Ala Cys Phe Ser Ala Tyr Tyr His145 150 155 160Tyr Gln Asp Gly Ser Val Ser Phe Pro Thr Glu Thr Glu Pro Glu Leu 165 170 175Asp Val Lys Leu Pro Cys Val Pro Val Leu Lys Asn Asp Glu Ile Pro 180 185 190Ser Phe Leu His Pro Ser Ser Arg Phe Thr Gly Phe Arg Gln Ala Ile 195 200 205Leu Gly Gln Phe Lys Asn Leu Ser Lys Ser Phe Cys Val Leu Ile Asp 210 215 220Ser Phe Asp Ser Leu Glu Gln Glu Val Ile Asp Tyr Met Ser Ser Leu225 230 235 240Cys Pro Val Lys Thr Val Gly Pro Leu Phe Lys Val Ala Arg Thr Val 245 250 255Thr Ser Asp Val Ser Gly Asp Ile Cys Lys

Ser Thr Asp Lys Cys Leu 260 265 270Glu Trp Leu Asp Ser Arg Pro Lys Ser Ser Val Val Tyr Ile Ser Phe 275 280 285Gly Thr Val Ala Tyr Leu Lys Gln Glu Gln Ile Glu Glu Ile Ala His 290 295 300Gly Val Leu Lys Ser Gly Leu Ser Phe Leu Trp Val Ile Arg Pro Pro305 310 315 320Pro His Asp Leu Lys Val Glu Thr His Val Leu Pro Gln Glu Leu Lys 325 330 335Glu Ser Ser Ala Lys Gly Lys Gly Met Ile Val Asp Trp Cys Pro Gln 340 345 350Glu Gln Val Leu Ser His Pro Ser Val Ala Cys Phe Val Thr His Cys 355 360 365Gly Trp Asn Ser Thr Met Glu Ser Leu Ser Ser Gly Val Pro Val Val 370 375 380Cys Cys Pro Gln Trp Gly Asp Gln Val Thr Asp Ala Val Tyr Leu Ile385 390 395 400Asp Val Phe Lys Thr Gly Val Arg Leu Gly Arg Gly Ala Thr Glu Glu 405 410 415Arg Val Val Pro Arg Glu Glu Val Ala Glu Lys Leu Leu Glu Ala Thr 420 425 430Val Gly Glu Lys Ala Glu Glu Leu Arg Lys Asn Ala Leu Lys Trp Lys 435 440 445Ala Glu Ala Glu Ala Ala Val Ala Pro Gly Gly Ser Ser Asp Lys Asn 450 455 460Phe Arg Glu Phe Val Glu Lys Leu Gly Ala Gly Val Thr Lys Thr Lys465 470 475 480Asp Asn Gly Tyr91473DNAArabidopsis thaliana 9ctagtatcca ttatctttag tcttcgttac tcccgcacct aacttctcca caaactccct 60aaaattctta tccgacgaac ctcctggagc caccgctgct tccgcctccg ccttccattt 120caaagcgttc tttctcaact cctctgcctt ctccccaact gtcgcttcca aaagcttctc 180cgccacttcc tcccttggca ctaccctctc ctcggtcgct ccacggccta gtctaacccc 240ggtcttgaaa acatcgatca aatacactgc atcagtcact tgatctcccc attgcggaca 300acaaaccacc ggaacacctg aagacaaaga ttccattgtc gagttccatc cacaatgagt 360cacgaagcat gccactgaag gatgagacaa gacttgctct tgtgggcacc aatccacaat 420catcccttta cctttagcac tactctcttt aagttcttga ggcaagacat gtgtctcgac 480cttcagatcg tgtggtggag gtctaatcac ccacaagaac gataaacccg acttcaaaac 540tccgtgagcg atctcttcga tctgttcttg cttcaaatat gcaactgtcc cgaacgaaat 600gtagacaact gacgatttag gcctcgagtc taaccactcg aggcatttat ctgttgattt 660gcaaatgtca ccgcttacgt cagaagtaac tgtcctagca actttgaaaa gcggtccaac 720ggttttaacc ggacaaagac ttgacatgta atcgataact tcttgttcca atgagtcaaa 780agaatcgatt agaacacaga aggacttgct cagattcttg aattgcccaa gaatcgcttg 840tcgaaaaccc gtgaacctag aagaaggatg gagaaagcta ggaatctcgt cgttcttcaa 900gacaggaaca caaggaagct tcacatcgag ctcaggctct gtttccgtag ggaatgaaac 960agagccatct tggtaatggt aataagcaga gaaacaagca caagactgaa cccagagaac 1020cgcacaagga atgttgaact cttccgccac gtggcagacc catgggataa acgggttatt 1080gataagacac gagacaggct cgttcgcttc ctcgtatctt ctcacaagct tagacacttc 1140tcgtatccca acgctctcta ggtgagcaat gtacaaagag aaatcagctc tccggtcatc 1200atcctctgcc cattcttcat caaagaactc aaaccggatt gaaccggaac caaccggttt 1260aagttcaccg tcaacgattt tgttggcttg tctcattttc ttgccccaaa gctccgttgt 1320aacgaaggta acgagtaaac cctttgaagc aattaacttg ccgagacgaa gaagagggtt 1380gacgtggcct tgtccttgaa acgagacgag cattacatga attgggtttg gagatggaca 1440agtttcgaac accatttctg atatggatcc cat 1473101440DNAArabidopsis thaliana 10atggacccgt ctcgtcatac tcatgtgatg ctcgtatctt tccccggcca aggtcacgta 60aaccctctac ttcgtctcgg aaagctcata gcctctaaag gcttactcgt cacctttgtc 120accacagaga agccatgggg caagaagatg cgtcaagcca acaagattca agacggtgtg 180ctcaaaccgg tcggtctagg tttcatccgg tttgagttct tctctgacgg cttcgccgac 240gacgatgaaa aaagattcga cttcgatgcc ttccgaccac accttgaagc tgtcggaaaa 300caagagatca agaatctcgt taagagatat aacaaggagc cggtgacgtg tctcataaac 360aacgcttttg tcccatgggt atgtgatgtc gccgaggagc ttcacatccc ttcggctgtt 420ctatgggtcc agtcttgtgc ttgtctcacg gcttattact attaccacca ccggttagtt 480aagttcccga ccaaaaccga gccggacatc agcgttgaaa tcccttgctt gccattgtta 540aagcatgacg agatcccaag ctttcttcac ccttcgtctc cgtatacagc ttttggagat 600atcattttag accagttaaa gagattcgaa aaccacaagt ctttctatct tttcatcgac 660acttttcgcg aactagaaaa agacatcatg gaccacatgt cacaactttg tcctcaagcc 720atcatcagtc ctgtcggtcc gctcttcaag atggctcaaa ccttgagttc tgacgttaag 780ggagatatat ccgagccagc gagtgactgc atggaatggc ttgactcaag agaaccatcc 840tcagtcgttt acatctcctt tgggactata gccaacttga agcaagagca gatggaggag 900atcgctcatg gcgttttgag ctctggcttg tcggtcttat gggtggttcg gcctcccatg 960gaagggacat ttgtagaacc acatgttttg cctcgagagc tcgaagaaaa gggtaaaatc 1020gtggaatggt gtccccaaga gagagtcttg gctcatcctg cgattgcttg tttcttaagt 1080cactgcggat ggaactcgac aatggaggct ttaactgccg gagtccccgt tgtttgtttt 1140ccgcaatggg gagatcaagt gactgatgcg gtgtacttgg ctgatgtttt caagacagga 1200gtgagactag gccgcggagc cgctgaggag atgattgttt cgagggaggt tgtagcagag 1260aagctgcttg aggccacagt tggggaaaag gcggtggagc tgagagaaaa cgctcggagg 1320tggaaggcgg aggccgaggc cgccgtggcg gacggtggat catctgatat gaactttaaa 1380gagtttgtgg acaagttggt tacgaaacat gtgacgagag aagacaacgg agaacactag 144011479PRTArabidopsis thaliana 11Met Asp Pro Ser Arg His Thr His Val Met Leu Val Ser Phe Pro Gly 1 5 10 15Gln Gly His Val Asn Pro Leu Leu Arg Leu Gly Lys Leu Ile Ala Ser 20 25 30Lys Gly Leu Leu Val Thr Phe Val Thr Thr Glu Lys Pro Trp Gly Lys 35 40 45Lys Met Arg Gln Ala Asn Lys Ile Gln Asp Gly Val Leu Lys Pro Val 50 55 60Gly Leu Gly Phe Ile Arg Phe Glu Phe Phe Ser Asp Gly Phe Ala Asp 65 70 75 80Asp Asp Glu Lys Arg Phe Asp Phe Asp Ala Phe Arg Pro His Leu Glu 85 90 95Ala Val Gly Lys Gln Glu Ile Lys Asn Leu Val Lys Arg Tyr Asn Lys 100 105 110Glu Pro Val Thr Cys Leu Ile Asn Asn Ala Phe Val Pro Trp Val Cys 115 120 125Asp Val Ala Glu Glu Leu His Ile Pro Ser Ala Val Leu Trp Val Gln 130 135 140Ser Cys Ala Cys Leu Thr Ala Tyr Tyr Tyr Tyr His His Arg Leu Val145 150 155 160Lys Phe Pro Thr Lys Thr Glu Pro Asp Ile Ser Val Glu Ile Pro Cys 165 170 175Leu Pro Leu Leu Lys His Asp Glu Ile Pro Ser Phe Leu His Pro Ser 180 185 190Ser Pro Tyr Thr Ala Phe Gly Asp Ile Ile Leu Asp Gln Leu Lys Arg 195 200 205Phe Glu Asn His Lys Ser Phe Tyr Leu Phe Ile Asp Thr Phe Arg Glu 210 215 220Leu Glu Lys Asp Ile Met Asp His Met Ser Gln Leu Cys Pro Gln Ala225 230 235 240Ile Ile Ser Pro Val Gly Pro Leu Phe Lys Met Ala Gln Thr Leu Ser 245 250 255Ser Asp Val Lys Gly Asp Ile Ser Glu Pro Ala Ser Asp Cys Met Glu 260 265 270Trp Leu Asp Ser Arg Glu Pro Ser Ser Val Val Tyr Ile Ser Phe Gly 275 280 285Thr Ile Ala Asn Leu Lys Gln Glu Gln Met Glu Glu Ile Ala His Gly 290 295 300Val Leu Ser Ser Gly Leu Ser Val Leu Trp Val Val Arg Pro Pro Met305 310 315 320Glu Gly Thr Phe Val Glu Pro His Val Leu Pro Arg Glu Leu Glu Glu 325 330 335Lys Gly Lys Ile Val Glu Trp Cys Pro Gln Glu Arg Val Leu Ala His 340 345 350Pro Ala Ile Ala Cys Phe Leu Ser His Cys Gly Trp Asn Ser Thr Met 355 360 365Glu Ala Leu Thr Ala Gly Val Pro Val Val Cys Phe Pro Gln Trp Gly 370 375 380Asp Gln Val Thr Asp Ala Val Tyr Leu Ala Asp Val Phe Lys Thr Gly385 390 395 400Val Arg Leu Gly Arg Gly Ala Ala Glu Glu Met Ile Val Ser Arg Glu 405 410 415Val Val Ala Glu Lys Leu Leu Glu Ala Thr Val Gly Glu Lys Ala Val 420 425 430Glu Leu Arg Glu Asn Ala Arg Arg Trp Lys Ala Glu Ala Glu Ala Ala 435 440 445Val Ala Asp Gly Gly Ser Ser Asp Met Asn Phe Lys Glu Phe Val Asp 450 455 460Lys Leu Val Thr Lys His Val Thr Arg Glu Asp Asn Gly Glu His465 470 475121440DNAArabidopsis thaliana 12ctagtgttct ccgttgtctt ctctcgtcac atgtttcgta accaacttgt ccacaaactc 60tttaaagttc atatcagatg atccaccgtc cgccacggcg gcctcggcct ccgccttcca 120cctccgagcg ttttctctca gctccaccgc cttttcccca actgtggcct caagcagctt 180ctctgctaca acctccctcg aaacaatcat ctcctcagcg gctccgcggc ctagtctcac 240tcctgtcttg aaaacatcag ccaagtacac cgcatcagtc acttgatctc cccattgcgg 300aaaacaaaca acggggactc cggcagttaa agcctccatt gtcgagttcc atccgcagtg 360acttaagaaa caagcaatcg caggatgagc caagactctc tcttggggac accattccac 420gattttaccc ttttcttcga gctctcgagg caaaacatgt ggttctacaa atgtcccttc 480catgggaggc cgaaccaccc ataagaccga caagccagag ctcaaaacgc catgagcgat 540ctcctccatc tgctcttgct tcaagttggc tatagtccca aaggagatgt aaacgactga 600ggatggttct cttgagtcaa gccattccat gcagtcactc gctggctcgg atatatctcc 660cttaacgtca gaactcaagg tttgagccat cttgaagagc ggaccgacag gactgatgat 720ggcttgagga caaagttgtg acatgtggtc catgatgtct ttttctagtt cgcgaaaagt 780gtcgatgaaa agatagaaag acttgtggtt ttcgaatctc tttaactggt ctaaaatgat 840atctccaaaa gctgtatacg gagacgaagg gtgaagaaag cttgggatct cgtcatgctt 900taacaatggc aagcaaggga tttcaacgct gatgtccggc tcggttttgg tcgggaactt 960aactaaccgg tggtggtaat agtaataagc cgtgagacaa gcacaagact ggacccatag 1020aacagccgaa gggatgtgaa gctcctcggc gacatcacat acccatggga caaaagcgtt 1080gtttatgaga cacgtcaccg gctccttgtt atatctctta acgagattct tgatctcttg 1140ttttccgaca gcttcaaggt gtggtcggaa ggcatcgaag tcgaatcttt tttcatcgtc 1200gtcggcgaag ccgtcagaga agaactcaaa ccggatgaaa cctagaccga ccggtttgag 1260cacaccgtct tgaatcttgt tggcttgacg catcttcttg ccccatggct tctctgtggt 1320gacaaaggtg acgagtaagc ctttagaggc tatgagcttt ccgagacgaa gtagagggtt 1380tacgtgacct tggccgggga aagatacgag catcacatga gtatgacgag acgggtccat 1440131430DNAArabidopsis thaliana 13atggagatgg aatcgtcgtt acctcatgtg atgctcgtat cattcccagg gcaaggtcac 60ataagccctc ttcttcgtct cggaaagatc attgcctcta aaggcttaat cgtcaccttt 120gtaaccacag aggaaccatt gggcaagaag atgcgtcaag ccaacaatat tcaagacggt 180gtgctcaaac cggtcgggct aggttttctc cggttcgagt tcttcgagga tggatttgtc 240tacaaagaag actttgattt gttacaaaaa tcacttgaag tttccggaaa acgagagatc 300aagaatcttg tcaagaaata tgagaagcaa ccagtgagat gtctcataaa taatgccttt 360gttccatggg tttgtgacat agccgaggag cttcaaatcc catcagctgt tctttgggtc 420cagtcttgtg cttgcctcgc cgcttattac tattaccacc accagttagt taagtttccg 480accgaaaccg agccggaaat aaccgttgac gtccctttca agccattaac attgaagcat 540gacgagatcc ctagctttct tcacccttcc tctccgctgt cctctatagg aggtaccatt 600ttagagcaga tcaagcgact tcacaagcct ttctctgttc tcatcgaaac ttttcaagaa 660cttgaaaaag ataccattga ccacatgtcc cagctctgcc ctcaagtcaa cttcaacccc 720atcggtccgc tttttactat ggctaaaacc ataaggtctg acatcaaggg agacatctcc 780aagccagata gtgactgcat agagtggctt gactcgagag aaccatcctc cgttgtttac 840atctcttttg ggactttggc tttcttgaag caaaaccaga tcgacgagat tgctcacggc 900attctcaact ccgggttgtc ctgcttatgg gttttgcggc ctcccttaga aggcttagcc 960atagaaccgc atgtcttgcc tctagagctt gaagagaaag ggaagattgt ggaatggtgt 1020caacaagaga aagttttggc tcatcctgcg gttgcttgct tcttaagtca ctgtggatgg 1080aactcaacca tggaggcttt aacttcagga gttcccgtta tttgtttccc gcagtgggga 1140gatcaggtga caaatgcggt gtacatgatt gatgttttca agacaggatt gagactcagc 1200cgtggagctt ccgatgagag gattgttcca agggaggagg ttgctgagcg actgcttgag 1260gccaccgttg gagagaaggc ggtggagctg agagaaaacg ctcggaggtg gaaggaggag 1320gcggagtctg ccgtggctta cggtggaaca tcggaaagga attttcaaga gtttgttgac 1380aagttggttg atgtcaagac aatgacaaac attaataatg tcgtgtaagt 143014475PRTArabidopsis thaliana 14Met Glu Met Glu Ser Ser Leu Pro His Val Met Leu Val Ser Phe Pro 1 5 10 15Gly Gln Gly His Ile Ser Pro Leu Leu Arg Leu Gly Lys Ile Ile Ala 20 25 30Ser Lys Gly Leu Ile Val Thr Phe Val Thr Thr Glu Glu Pro Leu Gly 35 40 45Lys Lys Met Arg Gln Ala Asn Asn Ile Gln Asp Gly Val Leu Lys Pro 50 55 60Val Gly Leu Gly Phe Leu Arg Phe Glu Phe Phe Glu Asp Gly Phe Val 65 70 75 80Tyr Lys Glu Asp Phe Asp Leu Leu Gln Lys Ser Leu Glu Val Ser Gly 85 90 95Lys Arg Glu Ile Lys Asn Leu Val Lys Lys Tyr Glu Lys Gln Pro Val 100 105 110Arg Cys Leu Ile Asn Asn Ala Phe Val Pro Trp Val Cys Asp Ile Ala 115 120 125Glu Glu Leu Gln Ile Pro Ser Ala Val Leu Trp Val Gln Ser Cys Ala 130 135 140Cys Leu Ala Ala Tyr Tyr Tyr Tyr His His Gln Leu Val Lys Phe Pro145 150 155 160Thr Glu Thr Glu Pro Glu Ile Thr Val Asp Val Pro Phe Lys Pro Leu 165 170 175Thr Leu Lys His Asp Glu Ile Pro Ser Phe Leu His Pro Ser Ser Pro 180 185 190Leu Ser Ser Ile Gly Gly Thr Ile Leu Glu Gln Ile Lys Arg Leu His 195 200 205Lys Pro Phe Ser Val Leu Ile Glu Thr Phe Gln Glu Leu Glu Lys Asp 210 215 220Thr Ile Asp His Met Ser Gln Leu Cys Pro Gln Val Asn Phe Asn Pro225 230 235 240Ile Gly Pro Leu Phe Thr Met Ala Lys Thr Ile Arg Ser Asp Ile Lys 245 250 255Gly Asp Ile Ser Lys Pro Asp Ser Asp Cys Ile Glu Trp Leu Asp Ser 260 265 270Arg Glu Pro Ser Ser Val Val Tyr Ile Ser Phe Gly Thr Leu Ala Phe 275 280 285Leu Lys Gln Asn Gln Ile Asp Glu Ile Ala His Gly Ile Leu Asn Ser 290 295 300Gly Leu Ser Cys Leu Trp Val Leu Arg Pro Pro Leu Glu Gly Leu Ala305 310 315 320Ile Glu Pro His Val Leu Pro Leu Glu Leu Glu Glu Lys Gly Lys Ile 325 330 335Val Glu Trp Cys Gln Gln Glu Lys Val Leu Ala His Pro Ala Val Ala 340 345 350Cys Phe Leu Ser His Cys Gly Trp Asn Ser Thr Met Glu Ala Leu Thr 355 360 365Ser Gly Val Pro Val Ile Cys Phe Pro Gln Trp Gly Asp Gln Val Thr 370 375 380Asn Ala Val Tyr Met Ile Asp Val Phe Lys Thr Gly Leu Arg Leu Ser385 390 395 400Arg Gly Ala Ser Asp Glu Arg Ile Val Pro Arg Glu Glu Val Ala Glu 405 410 415Arg Leu Leu Glu Ala Thr Val Gly Glu Lys Ala Val Glu Leu Arg Glu 420 425 430Asn Ala Arg Arg Trp Lys Glu Glu Ala Glu Ser Ala Val Ala Tyr Gly 435 440 445Gly Thr Ser Glu Arg Asn Phe Gln Glu Phe Val Asp Lys Leu Val Asp 450 455 460Val Lys Thr Met Thr Asn Ile Asn Asn Val Val465 470 475151430DNAArabidopsis thaliana 15acttacacga cattattaat gtttgtcatt gtcttgacat caaccaactt gtcaacaaac 60tcttgaaaat tcctttccga tgttccaccg taagccacgg cagactccgc ctcctccttc 120cacctccgag cgttttctct cagctccacc gccttctctc caacggtggc ctcaagcagt 180cgctcagcaa cctcctccct tggaacaatc ctctcatcgg aagctccacg gctgagtctc 240aatcctgtct tgaaaacatc aatcatgtac accgcatttg tcacctgatc tccccactgc 300gggaaacaaa taacgggaac tcctgaagtt aaagcctcca tggttgagtt ccatccacag 360tgacttaaga agcaagcaac cgcaggatga gccaaaactt tctcttgttg acaccattcc 420acaatcttcc ctttctcttc aagctctaga ggcaagacat gcggttctat ggctaagcct 480tctaagggag gccgcaaaac ccataagcag gacaacccgg agttgagaat gccgtgagca 540atctcgtcga tctggttttg cttcaagaaa gccaaagtcc caaaagagat gtaaacaacg 600gaggatggtt ctctcgagtc aagccactct atgcagtcac tatctggctt ggagatgtct 660cccttgatgt cagaccttat ggttttagcc atagtaaaaa gcggaccgat ggggttgaag 720ttgacttgag ggcagagctg ggacatgtgg tcaatggtat ctttttcaag ttcttgaaaa 780gtttcgatga gaacagagaa aggcttgtga agtcgcttga tctgctctaa aatggtacct 840cctatagagg acagcggaga ggaagggtga agaaagctag ggatctcgtc atgcttcaat 900gttaatggct tgaaagggac gtcaacggtt atttccggct cggtttcggt cggaaactta 960actaactggt ggtggtaata gtaataagcg gcgaggcaag cacaagactg gacccaaaga 1020acagctgatg ggatttgaag ctcctcggct atgtcacaaa cccatggaac aaaggcatta 1080tttatgagac atctcactgg ttgcttctca tatttcttga caagattctt gatctctcgt 1140tttccggaaa cttcaagtga tttttgtaac aaatcaaagt cttctttgta gacaaatcca 1200tcctcgaaga actcgaaccg gagaaaacct agcccgaccg gtttgagcac accgtcttga 1260atattgttgg cttgacgcat cttcttgccc aatggttcct ctgtggttac aaaggtgacg 1320attaagcctt tagaggcaat gatctttccg agacgaagaa gagggcttat gtgaccttgc 1380cctgggaatg atacgagcat cacatgaggt aacgacgatt ccatctccat 1430161437DNAArabidopsis thaliana 16atgggcagta gtgagggtca agaaacacat gtcctaatgg taacactacc attccaaggt 60cacatcaatc caatgctcaa actcgcaaaa catctctcgt tatcatcaaa gaacctacac 120atcaatctcg ccactattga gtcagcccgt gatctcctct ccaccgtaga aaaacctcgt 180tatccggtgg acctcgtgtt cttctccgat ggtctaccta aagaagatcc aaaggcccct 240gaaactcttt tgaagtcatt gaataaagtc ggagccatga acttgtctaa aatcatcgaa 300gaaaagagat actcttgtat catctcttcg ccttttactc catgggttcc agctgttgca 360gcctctcata acatctcttg tgcaatactt tggatccaag cttgtggagc ttactcggtt 420tattaccgtt actacatgaa

gacaaactct ttccctgatc ttgaagatct gaatcaaacg 480gtggagttac cagctttacc attgttggaa gttcgagatc ttccatcgtt tatgttacct 540tctggtggtg ctcacttcta taatctaatg gcggaatttg cagattgttt gaggtatgtg 600aaatgggttt tggttaattc attctatgaa ctcgaatcag agataatcga atcgatggct 660gatttaaaac ctgtaattcc aattggtcct ctggtttctc catttctgtt gggcgatggt 720gaggaggaaa ccctagacgg taaaaaccta gatttttgta aatctgatga ttgttgtatg 780gagtggcttg acaagcaagc taggtcttct gttgtgtaca tatctttcgg aagtatgctc 840gaaacattgg agaatcaggt cgagaccata gcgaaggcgc tgaagaacag aggacttcca 900tttctttggg tgataaggcc aaaggagaaa gcccaaaacg ttgctgtttt gcaggagatg 960gtgaaagaag gacaaggggt tgttctcgag tggagtccac aagagaagat tttgagccac 1020gaggcaatct cttgttttgt cacgcattgc ggctggaact cgactatgga gacggtggtg 1080gctggtgttc ctgtggtagc gtaccctagc tggacggatc agcccattga cgcgcggttg 1140cttgttgatg tgtttggaat cggagtaagg atgaggaatg acagtgtcga tggcgagctt 1200aaggtcgaag aagtagaaag atgcattgag gccgtgacgg agggacccgc tgccgtggat 1260ataagaagga gagcggcgga gctaaagcgc gtggcgagat tggcgttggc acctggtgga 1320tcttcgacac ggaatttaga cttgttcatt agtgatatca caatcgccta actctttact 1380tcaactagta caaaatgtat gaatacaagg tttgatataa ccactatcaa ttgttag 143717456PRTArabidopsis thaliana 17Met Gly Ser Ser Glu Gly Gln Glu Thr His Val Leu Met Val Thr Leu 1 5 10 15Pro Phe Gln Gly His Ile Asn Pro Met Leu Lys Leu Ala Lys His Leu 20 25 30Ser Leu Ser Ser Lys Asn Leu His Ile Asn Leu Ala Thr Ile Glu Ser 35 40 45Ala Arg Asp Leu Leu Ser Thr Val Glu Lys Pro Arg Tyr Pro Val Asp 50 55 60Leu Val Phe Phe Ser Asp Gly Leu Pro Lys Glu Asp Pro Lys Ala Pro 65 70 75 80Glu Thr Leu Leu Lys Ser Leu Asn Lys Val Gly Ala Met Asn Leu Ser 85 90 95Lys Ile Ile Glu Glu Lys Arg Tyr Ser Cys Ile Ile Ser Ser Pro Phe 100 105 110Thr Pro Trp Val Pro Ala Val Ala Ala Ser His Asn Ile Ser Cys Ala 115 120 125Ile Leu Trp Ile Gln Ala Cys Gly Ala Tyr Ser Val Tyr Tyr Arg Tyr 130 135 140Tyr Met Lys Thr Asn Ser Phe Pro Asp Leu Glu Asp Leu Asn Gln Thr145 150 155 160Val Glu Leu Pro Ala Leu Pro Leu Leu Glu Val Arg Asp Leu Pro Ser 165 170 175Phe Met Leu Pro Ser Gly Gly Ala His Phe Tyr Asn Leu Met Ala Glu 180 185 190Phe Ala Asp Cys Leu Arg Tyr Val Lys Trp Val Leu Val Asn Ser Phe 195 200 205Tyr Glu Leu Glu Ser Glu Ile Ile Glu Ser Met Ala Asp Leu Lys Pro 210 215 220Val Ile Pro Ile Gly Pro Leu Val Ser Pro Phe Leu Leu Gly Asp Gly225 230 235 240Glu Glu Glu Thr Leu Asp Gly Lys Asn Leu Asp Phe Cys Lys Ser Asp 245 250 255Asp Cys Cys Met Glu Trp Leu Asp Lys Gln Ala Arg Ser Ser Val Val 260 265 270Tyr Ile Ser Phe Gly Ser Met Leu Glu Thr Leu Glu Asn Gln Val Glu 275 280 285Thr Ile Ala Lys Ala Leu Lys Asn Arg Gly Leu Pro Phe Leu Trp Val 290 295 300Ile Arg Pro Lys Glu Lys Ala Gln Asn Val Ala Val Leu Gln Glu Met305 310 315 320Val Lys Glu Gly Gln Gly Val Val Leu Glu Trp Ser Pro Gln Glu Lys 325 330 335Ile Leu Ser His Glu Ala Ile Ser Cys Phe Val Thr His Cys Gly Trp 340 345 350Asn Ser Thr Met Glu Thr Val Val Ala Gly Val Pro Val Val Ala Tyr 355 360 365Pro Ser Trp Thr Asp Gln Pro Ile Asp Ala Arg Leu Leu Val Asp Val 370 375 380Phe Gly Ile Gly Val Arg Met Arg Asn Asp Ser Val Asp Gly Glu Leu385 390 395 400Lys Val Glu Glu Val Glu Arg Cys Ile Glu Ala Val Thr Glu Gly Pro 405 410 415Ala Ala Val Asp Ile Arg Arg Arg Ala Ala Glu Leu Lys Arg Val Ala 420 425 430Arg Leu Ala Leu Ala Pro Gly Gly Ser Ser Thr Arg Asn Leu Asp Leu 435 440 445Phe Ile Ser Asp Ile Thr Ile Ala 450 455181437DNAArabidopsis thaliana 18ctaacaattg atagtggtta tatcaaacct tgtattcata cattttgtac tagttgaagt 60aaagagttag gcgattgtga tatcactaat gaacaagtct aaattccgtg tcgaagatcc 120accaggtgcc aacgccaatc tcgccacgcg ctttagctcc gccgctctcc ttcttatatc 180cacggcagcg ggtccctccg tcacggcctc aatgcatctt tctacttctt cgaccttaag 240ctcgccatcg acactgtcat tcctcatcct tactccgatt ccaaacacat caacaagcaa 300ccgcgcgtca atgggctgat ccgtccagct agggtacgct accacaggaa caccagccac 360caccgtctcc atagtcgagt tccagccgca atgcgtgaca aaacaagaga ttgcctcgtg 420gctcaaaatc ttctcttgtg gactccactc gagaacaacc ccttgtcctt ctttcaccat 480ctcctgcaaa acagcaacgt tttgggcttt ctcctttggc cttatcaccc aaagaaatgg 540aagtcctctg ttcttcagcg ccttcgctat ggtctcgacc tgattctcca atgtttcgag 600catacttccg aaagatatgt acacaacaga agacctagct tgcttgtcaa gccactccat 660acaacaatca tcagatttac aaaaatctag gtttttaccg tctagggttt cctcctcacc 720atcgcccaac agaaatggag aaaccagagg accaattgga attacaggtt ttaaatcagc 780catcgattcg attatctctg attcgagttc atagaatgaa ttaaccaaaa cccatttcac 840atacctcaaa caatctgcaa attccgccat tagattatag aagtgagcac caccagaagg 900taacataaac gatggaagat ctcgaacttc caacaatggt aaagctggta actccaccgt 960ttgattcaga tcttcaagat cagggaaaga gtttgtcttc atgtagtaac ggtaataaac 1020cgagtaagct ccacaagctt ggatccaaag tattgcacaa gagatgttat gagaggctgc 1080aacagctgga acccatggag taaaaggcga agagatgata caagagtatc tcttttcttc 1140gatgatttta gacaagttca tggctccgac tttattcaat gacttcaaaa gagtttcagg 1200ggcctttgga tcttctttag gtagaccatc ggagaagaac acgaggtcca ccggataacg 1260aggtttttct acggtggaga ggagatcacg ggctgactca atagtggcga gattgatgtg 1320taggttcttt gatgataacg agagatgttt tgcgagtttg agcattggat tgatgtgacc 1380ttggaatggt agtgttacca ttaggacatg tgtttcttga ccctcactac tgcccat 1437191446DNAArabidopsis thaliana 19atgcatatca caaaaccaca cgccgccatg ttttccagtc ccggaatggg ccatgtcatc 60ccggtgatcg agcttggaaa gcgtctctcc gctaacaacg gcttccacgt caccgtcttc 120gtcctcgaaa ccgacgcagc ctccgctcaa tccaagttcc taaactcaac cggcgtcgac 180atcgtcaaac ttccatcgcc ggacatttat ggtttagtgg accccgacga ccatgtagtg 240accaagatcg gagtcattat gcgtgcagca gttccagccc tccgatccaa gatcgctgcc 300atgcatcaaa agccaacggc tctgatcgtt gacttgtttg gcacagatgc gttatgtctc 360gcaaaggaat ttaacatgtt gagttatgtg tttatcccta ccaacgcacg ttttctcgga 420gtttcgattt attatccaaa tttggacaaa gatatcaagg aagagcacac agtgcaaaga 480aacccactcg ctataccggg gtgtgaaccg gttaggttcg aagatactct ggatgcatat 540ctggttcccg acgaaccggt gtaccgggat tttgttcgtc atggtctggc ttacccaaaa 600gccgatggaa ttttggtaaa tacatgggaa gagatggagc ccaaatcatt gaagtccctt 660ctaaacccaa agctcttggg ccgggttgct cgtgtaccgg tctatccaat cggtccctta 720tgcagaccga tacaatcatc cgaaaccgat cacccggttt tggattggtt aaacgaacaa 780ccgaacgagt cggttctcta tatctccttc gggagtggtg gttgtctatc ggcgaaacag 840ttaactgaat tggcgtgggg actcgagcag agccagcaac ggttcgtatg ggtggttcga 900ccaccggtcg acggttcgtg ttgtagcgag tatgtctcgg ctaacggtgg tggaaccgaa 960gacaacacgc cagagtatct accggaaggg ttcgtgagtc gtactagtga tagaggtttc 1020gtggtcccct catgggcccc acaagctgaa atcctgtccc atcgggccgt tggtgggttt 1080ttgacccatt gcggttggag ctcgacgttg gaaagcgtcg ttggcggcgt tccgatgatc 1140gcatggccac tttttgccga gcagaatatg aatgcggcgt tgctcagcga cgaactggga 1200atcgcagtca gattggatga tccaaaggag gatatttcta ggtggaagat tgaggcgttg 1260gtgaggaagg ttatgactga gaaggaaggt gaagcgatga gaaggaaagt gaagaagttg 1320agagactcgg cggagatgtc actgagcatt gacggtggtg gtttggcgca cgagtcgctt 1380tgcagagtca ccaaggagtg tcaacggttt ttggaacgtg tcgtggactt gtcacgtggt 1440gcttag 144620481PRTArabidopsis thaliana 20Met His Ile Thr Lys Pro His Ala Ala Met Phe Ser Ser Pro Gly Met 1 5 10 15Gly His Val Ile Pro Val Ile Glu Leu Gly Lys Arg Leu Ser Ala Asn 20 25 30Asn Gly Phe His Val Thr Val Phe Val Leu Glu Thr Asp Ala Ala Ser 35 40 45Ala Gln Ser Lys Phe Leu Asn Ser Thr Gly Val Asp Ile Val Lys Leu 50 55 60Pro Ser Pro Asp Ile Tyr Gly Leu Val Asp Pro Asp Asp His Val Val 65 70 75 80Thr Lys Ile Gly Val Ile Met Arg Ala Ala Val Pro Ala Leu Arg Ser 85 90 95Lys Ile Ala Ala Met His Gln Lys Pro Thr Ala Leu Ile Val Asp Leu 100 105 110Phe Gly Thr Asp Ala Leu Cys Leu Ala Lys Glu Phe Asn Met Leu Ser 115 120 125Tyr Val Phe Ile Pro Thr Asn Ala Arg Phe Leu Gly Val Ser Ile Tyr 130 135 140Tyr Pro Asn Leu Asp Lys Asp Ile Lys Glu Glu His Thr Val Gln Arg145 150 155 160Asn Pro Leu Ala Ile Pro Gly Cys Glu Pro Val Arg Phe Glu Asp Thr 165 170 175Leu Asp Ala Tyr Leu Val Pro Asp Glu Pro Val Tyr Arg Asp Phe Val 180 185 190Arg His Gly Leu Ala Tyr Pro Lys Ala Asp Gly Ile Leu Val Asn Thr 195 200 205Trp Glu Glu Met Glu Pro Lys Ser Leu Lys Ser Leu Leu Asn Pro Lys 210 215 220Leu Leu Gly Arg Val Ala Arg Val Pro Val Tyr Pro Ile Gly Pro Leu225 230 235 240Cys Arg Pro Ile Gln Ser Ser Glu Thr Asp His Pro Val Leu Asp Trp 245 250 255Leu Asn Glu Gln Pro Asn Glu Ser Val Leu Tyr Ile Ser Phe Gly Ser 260 265 270Gly Gly Cys Leu Ser Ala Lys Gln Leu Thr Glu Leu Ala Trp Gly Leu 275 280 285Glu Gln Ser Gln Gln Arg Phe Val Trp Val Val Arg Pro Pro Val Asp 290 295 300Gly Ser Cys Cys Ser Glu Tyr Val Ser Ala Asn Gly Gly Gly Thr Glu305 310 315 320Asp Asn Thr Pro Glu Tyr Leu Pro Glu Gly Phe Val Ser Arg Thr Ser 325 330 335Asp Arg Gly Phe Val Val Pro Ser Trp Ala Pro Gln Ala Glu Ile Leu 340 345 350Ser His Arg Ala Val Gly Gly Phe Leu Thr His Cys Gly Trp Ser Ser 355 360 365Thr Leu Glu Ser Val Val Gly Gly Val Pro Met Ile Ala Trp Pro Leu 370 375 380Phe Ala Glu Gln Asn Met Asn Ala Ala Leu Leu Ser Asp Glu Leu Gly385 390 395 400Ile Ala Val Arg Leu Asp Asp Pro Lys Glu Asp Ile Ser Arg Trp Lys 405 410 415Ile Glu Ala Leu Val Arg Lys Val Met Thr Glu Lys Glu Gly Glu Ala 420 425 430Met Arg Arg Lys Val Lys Lys Leu Arg Asp Ser Ala Glu Met Ser Leu 435 440 445Ser Ile Asp Gly Gly Gly Leu Ala His Glu Ser Leu Cys Arg Val Thr 450 455 460Lys Glu Cys Gln Arg Phe Leu Glu Arg Val Val Asp Leu Ser Arg Gly465 470 475 480Ala211446DNAArabidopsis thaliana 21ctaagcacca cgtgacaagt ccacgacacg ttccaaaaac cgttgacact ccttggtgac 60tctgcaaagc gactcgtgcg ccaaaccacc accgtcaatg ctcagtgaca tctccgccga 120gtctctcaac ttcttcactt tccttctcat cgcttcacct tccttctcag tcataacctt 180cctcaccaac gcctcaatct tccacctaga aatatcctcc tttggatcat ccaatctgac 240tgcgattccc agttcgtcgc tgagcaacgc cgcattcata ttctgctcgg caaaaagtgg 300ccatgcgatc atcggaacgc cgccaacgac gctttccaac gtcgagctcc aaccgcaatg 360ggtcaaaaac ccaccaacgg cccgatggga caggatttca gcttgtgggg cccatgaggg 420gaccacgaaa cctctatcac tagtacgact cacgaaccct tccggtagat actctggcgt 480gttgtcttcg gttccaccac cgttagccga gacatactcg ctacaacacg aaccgtcgac 540cggtggtcga accacccata cgaaccgttg ctggctctgc tcgagtcccc acgccaattc 600agttaactgt ttcgccgata gacaaccacc actcccgaag gagatataga gaaccgactc 660gttcggttgt tcgtttaacc aatccaaaac cgggtgatcg gtttcggatg attgtatcgg 720tctgcataag ggaccgattg gatagaccgg tacacgagca acccggccca agagctttgg 780gtttagaagg gacttcaatg atttgggctc catctcttcc catgtattta ccaaaattcc 840atcggctttt gggtaagcca gaccatgacg aacaaaatcc cggtacaccg gttcgtcggg 900aaccagatat gcatccagag tatcttcgaa cctaaccggt tcacaccccg gtatagcgag 960tgggtttctt tgcactgtgt gctcttcctt gatatctttg tccaaatttg gataataaat 1020cgaaactccg agaaaacgtg cgttggtagg gataaacaca taactcaaca tgttaaattc 1080ctttgcgaga cataacgcat ctgtgccaaa caagtcaacg atcagagccg ttggcttttg 1140atgcatggca gcgatcttgg atcggagggc tggaactgct gcacgcataa tgactccgat 1200cttggtcact acatggtcgt cggggtccac taaaccataa atgtccggcg atggaagttt 1260gacgatgtcg acgccggttg agtttaggaa cttggattga gcggaggctg cgtcggtttc 1320gaggacgaag acggtgacgt ggaagccgtt gttagcggag agacgctttc caagctcgat 1380caccgggatg acatggccca ttccgggact ggaaaacatg gcggcgtgtg gttttgtgat 1440atgcat 1446221446DNAArabidopsis thaliana 22atgagtagtg atcctcatcg taagctccat gttgtgttct tccctttcat ggcttatggt 60cacatgatac caactctaga catggctaag cttttctcta gcagaggagc caaatctaca 120atcctcacca cacctctcaa ctccaagatc ttccaaaaac ccatcgaaag attcaagaac 180ctgaatccga gtttcgaaat cgacatccag atcttcgatt tcccttgcgt ggatctcggg 240ttaccagaag gatgcgaaaa cgtcgatttc ttcacctcaa acaacaatga tgatagacag 300tatctgacct tgaagttctt taagtcgaca aggtttttca aagatcagct tgagaagctc 360ctcgagacaa cgagaccaga ctgtcttatc gccgacatgt tcttcccctg ggctacggaa 420gctgctgaga agttcaatgt gccaagactt gtgttccacg gtactggcta cttttcttta 480tgctctgaat attgcatcag agtgcataac ccacaaaaca tagtagcttc aaggtacgag 540ccatttgtga ttcctgatct cccggggaac atagtgataa ctcaagaaca gatagcagac 600cgtgacgaag aaagcgagat ggggaagttt atgattgagg tcaaagaatc tgatgtgaag 660agctcaggtg ttattgtaaa cagcttctac gagcttgaac ctgattacgc cgacttttac 720aagagtgttg tactgaagag agcgtggcat atcggtccgc tttcggttta caacagagga 780tttgaggaga aggctgagag aggaaagaaa gcaagcatta atgaggttga atgcctcaaa 840tggcttgact ccaagaaacc agattcagtc atttacattt cttttgggag cgtggcttgc 900ttcaagaacg agcagctatt cgagatcgct gcaggattag aaacttctgg agcaaatttc 960atctgggttg ttaggaaaaa cataggtatt gaaaaagaag aatggttacc agaagggttc 1020gaagagaggg tgaaaggaaa agggatgatt ataagaggat gggcaccaca ggtgctcata 1080cttgatcatc aagcaacttg tgggtttgtg acccattgcg gctggaactc gcttctggaa 1140ggagtggctg cagggctacc aatggtgaca tggcctgtag cagcggagca attctacaat 1200gagaaattgg ttacgcaagt gctcagaaca ggagtgagcg tgggagcgaa aaagaatgta 1260agaactacgg gagatttcat tagcagagag aaagtggtta aagcggtgag ggaggtgttg 1320gttggggaag aggcggatga gaggcgggag agggcaaaga agttggcaga gatggctaaa 1380gctgccgtgg aaggagggtc ttctttcaac gatctaaaca gcttcataga agagtttacc 1440tcgtaa 144623481PRTArabidopsis thaliana 23Met Ser Ser Asp Pro His Arg Lys Leu His Val Val Phe Phe Pro Phe 1 5 10 15Met Ala Tyr Gly His Met Ile Pro Thr Leu Asp Met Ala Lys Leu Phe 20 25 30Ser Ser Arg Gly Ala Lys Ser Thr Ile Leu Thr Thr Pro Leu Asn Ser 35 40 45Lys Ile Phe Gln Lys Pro Ile Glu Arg Phe Lys Asn Leu Asn Pro Ser 50 55 60Phe Glu Ile Asp Ile Gln Ile Phe Asp Phe Pro Cys Val Asp Leu Gly 65 70 75 80Leu Pro Glu Gly Cys Glu Asn Val Asp Phe Phe Thr Ser Asn Asn Asn 85 90 95Asp Asp Arg Gln Tyr Leu Thr Leu Lys Phe Phe Lys Ser Thr Arg Phe 100 105 110Phe Lys Asp Gln Leu Glu Lys Leu Leu Glu Thr Thr Arg Pro Asp Cys 115 120 125Leu Ile Ala Asp Met Phe Phe Pro Trp Ala Thr Glu Ala Ala Glu Lys 130 135 140Phe Asn Val Pro Arg Leu Val Phe His Gly Thr Gly Tyr Phe Ser Leu145 150 155 160Cys Ser Glu Tyr Cys Ile Arg Val His Asn Pro Gln Asn Ile Val Ala 165 170 175Ser Arg Tyr Glu Pro Phe Val Ile Pro Asp Leu Pro Gly Asn Ile Val 180 185 190Ile Thr Gln Glu Gln Ile Ala Asp Arg Asp Glu Glu Ser Glu Met Gly 195 200 205Lys Phe Met Ile Glu Val Lys Glu Ser Asp Val Lys Ser Ser Gly Val 210 215 220Ile Val Asn Ser Phe Tyr Glu Leu Glu Pro Asp Tyr Ala Asp Phe Tyr225 230 235 240Lys Ser Val Val Leu Lys Arg Ala Trp His Ile Gly Pro Leu Ser Val 245 250 255Tyr Asn Arg Gly Phe Glu Glu Lys Ala Glu Arg Gly Lys Lys Ala Ser 260 265 270Ile Asn Glu Val Glu Cys Leu Lys Trp Leu Asp Ser Lys Lys Pro Asp 275 280 285Ser Val Ile Tyr Ile Ser Phe Gly Ser Val Ala Cys Phe Lys Asn Glu 290 295 300Gln Leu Phe Glu Ile Ala Ala Gly Leu Glu Thr Ser Gly Ala Asn Phe305 310 315 320Ile Trp Val Val Arg Lys Asn Ile Gly Ile Glu Lys Glu Glu Trp Leu 325 330 335Pro Glu Gly Phe Glu Glu Arg Val Lys Gly Lys Gly Met Ile Ile Arg 340 345 350Gly Trp Ala Pro Gln Val Leu Ile Leu Asp His Gln Ala Thr Cys Gly 355

360 365Phe Val Thr His Cys Gly Trp Asn Ser Leu Leu Glu Gly Val Ala Ala 370 375 380Gly Leu Pro Met Val Thr Trp Pro Val Ala Ala Glu Gln Phe Tyr Asn385 390 395 400Glu Lys Leu Val Thr Gln Val Leu Arg Thr Gly Val Ser Val Gly Ala 405 410 415Lys Lys Asn Val Arg Thr Thr Gly Asp Phe Ile Ser Arg Glu Lys Val 420 425 430Val Lys Ala Val Arg Glu Val Leu Val Gly Glu Glu Ala Asp Glu Arg 435 440 445Arg Glu Arg Ala Lys Lys Leu Ala Glu Met Ala Lys Ala Ala Val Glu 450 455 460Gly Gly Ser Ser Phe Asn Asp Leu Asn Ser Phe Ile Glu Glu Phe Thr465 470 475 480Ser241446DNAArabidopsis thaliana 24ttacgaggta aactcttcta tgaagctgtt tagatcgttg aaagaagacc ctccttccac 60ggcagcttta gccatctctg ccaacttctt tgccctctcc cgcctctcat ccgcctcttc 120cccaaccaac acctccctca ccgctttaac cactttctct ctgctaatga aatctcccgt 180agttcttaca ttctttttcg ctcccacgct cactcctgtt ctgagcactt gcgtaaccaa 240tttctcattg tagaattgct ccgctgctac aggccatgtc accattggta gccctgcagc 300cactccttcc agaagcgagt tccagccgca atgggtcaca aacccacaag ttgcttgatg 360atcaagtatg agcacctgtg gtgcccatcc tcttataatc atcccttttc ctttcaccct 420ctcttcgaac ccttctggta accattcttc tttttcaata cctatgtttt tcctaacaac 480ccagatgaaa tttgctccag aagtttctaa tcctgcagcg atctcgaata gctgctcgtt 540cttgaagcaa gccacgctcc caaaagaaat gtaaatgact gaatctggtt tcttggagtc 600aagccatttg aggcattcaa cctcattaat gcttgctttc tttcctctct cagccttctc 660ctcaaatcct ctgttgtaaa ccgaaagcgg accgatatgc cacgctctct tcagtacaac 720actcttgtaa aagtcggcgt aatcaggttc aagctcgtag aagctgttta caataacacc 780tgagctcttc acatcagatt ctttgacctc aatcataaac ttccccatct cgctttcttc 840gtcacggtct gctatctgtt cttgagttat cactatgttc cccgggagat caggaatcac 900aaatggctcg taccttgaag ctactatgtt ttgtgggtta tgcactctga tgcaatattc 960agagcataaa gaaaagtagc cagtaccgtg gaacacaagt cttggcacat tgaacttctc 1020agcagcttcc gtagcccagg ggaagaacat gtcggcgata agacagtctg gtctcgttgt 1080ctcgaggagc ttctcaagct gatctttgaa aaaccttgtc gacttaaaga acttcaaggt 1140cagatactgt ctatcatcat tgttgtttga ggtgaagaaa tcgacgtttt cgcatccttc 1200tggtaacccg agatccacgc aagggaaatc gaagatctgg atgtcgattt cgaaactcgg 1260attcaggttc ttgaatcttt cgatgggttt ttggaagatc ttggagttga gaggtgtggt 1320gaggattgta gatttggctc ctctgctaga gaaaagctta gccatgtcta gagttggtat 1380catgtgacca taagccatga aagggaagaa cacaacatgg agcttacgat gaggatcact 1440actcat 1446251446DNAArabidopsis thaliana 25atgcatatca caaaaccaca cgccgccatg ttttccagtc ccggaatggg ccatgtcctc 60ccggtgatcg agctagctaa gcgtctctcc gctaaccacg gcttccacgt caccgtcttc 120gtccttgaaa ctgacgcagc ctccgttcag tccaagctcc ttaactcaac cggtgttgac 180atcgtcaacc ttccatcgcc cgacatttct ggcttggtag accccaacgc ccatgtggtg 240accaagatcg gagtcattat gcgtgaagct gttccaaccc tccgatccaa gatcgttgcc 300atgcatcaaa acccaacggc tctgatcatt gacttgtttg gcacagatgc gttatgtctt 360gcagcggagt taaacatgtt gacttatgtc tttatcgctt ccaacgcgcg ttatctcgga 420gtttcgatat attatccaac tttggacgaa gttatcaaag aagagcacac agtgcaacga 480aaaccgctca ctataccggg gtgtgaaccg gttagatttg aagatattat ggatgcatat 540ctggttccgg acgaaccggt gtaccacgat ttggttcgtc actgtctggc ctacccaaaa 600gcggatggaa tcttggtgaa tacatgggaa gagatggagc ccaaatcatt aaagtccctt 660caagacccga aacttttggg ccgggtcgct cgtgtaccgg tttatccggt tggtccgtta 720tgcagaccga tacaatcatc cacgaccgat cacccggttt ttgattggtt aaacaaacaa 780ccaaacgagt cggttctcta catttccttc gggagtggtg gttctctaac ggctcaacag 840ttaaccgaat tggcgtgggg gctcgaggag agccagcaac ggtttatatg ggtggttcga 900ccgcccgttg acggctcgtc ttgcagtgat tatttctcgg ctaaaggcgg tgtaaccaaa 960gacaacacgc cagagtatct accagaaggg ttcgtgactc gtacttgcga tagaggtttc 1020atgatcccat catgggcacc gcaagctgaa atcctagccc atcaggccgt tggtgggttt 1080ttaacacatt gtggttggag ctcgacgttg gaaagcgtcc tttgcggcgt tccaatgata 1140gcgtggccgc ttttcgccga gcagaatatg aacgcggcgt tgcttagcga tgaactggga 1200atctctgtta gagtggatga tccaaaggag gcgatttcta ggtcgaagat tgaggcgatg 1260gtgaggaagg ttatggctga ggacgaaggt gaagagatga gaaggaaagt gaagaagttg 1320agagacacgg cggagatgtc acttagtatt cacggtggtg gttcggcgca tgagtcgctt 1380tgcagagtca cgaaggagtg tcaacggttt ttggaatgtg tcggggactt gggacgtggt 1440gcttag 144626381PRTArabidopsis thaliana 26Met His Gln Asn Pro Thr Ala Leu Ile Ile Asp Leu Phe Gly Thr Asp 1 5 10 15Ala Leu Cys Leu Ala Ala Glu Leu Asn Met Leu Thr Tyr Val Phe Ile 20 25 30Ala Ser Asn Ala Arg Tyr Leu Gly Val Ser Ile Tyr Tyr Pro Thr Leu 35 40 45Asp Glu Val Ile Lys Glu Glu His Thr Val Gln Arg Lys Pro Leu Thr 50 55 60Ile Pro Gly Cys Glu Pro Val Arg Phe Glu Asp Ile Met Asp Ala Tyr 65 70 75 80Leu Val Pro Asp Glu Pro Val Tyr His Asp Leu Val Arg His Cys Leu 85 90 95Ala Tyr Pro Lys Ala Asp Gly Ile Leu Val Asn Thr Trp Glu Glu Met 100 105 110Glu Pro Lys Ser Leu Lys Ser Leu Gln Asp Pro Lys Leu Leu Gly Arg 115 120 125Val Ala Arg Val Pro Val Tyr Pro Val Gly Pro Leu Cys Arg Pro Ile 130 135 140Gln Ser Ser Thr Thr Asp His Pro Val Phe Asp Trp Leu Asn Lys Gln145 150 155 160Pro Asn Glu Ser Val Leu Tyr Ile Ser Phe Gly Ser Gly Gly Ser Leu 165 170 175Thr Ala Gln Gln Leu Thr Glu Leu Ala Trp Gly Leu Glu Glu Ser Gln 180 185 190Gln Arg Phe Ile Trp Val Val Arg Pro Pro Val Asp Gly Ser Ser Cys 195 200 205Ser Asp Tyr Phe Ser Ala Lys Gly Gly Val Thr Lys Asp Asn Thr Pro 210 215 220Glu Tyr Leu Pro Glu Gly Phe Val Thr Arg Thr Cys Asp Arg Gly Phe225 230 235 240Met Ile Pro Ser Trp Ala Pro Gln Ala Glu Ile Leu Ala His Gln Ala 245 250 255Val Gly Gly Phe Leu Thr His Cys Gly Trp Ser Ser Thr Leu Glu Ser 260 265 270Val Leu Cys Gly Val Pro Met Ile Ala Trp Pro Leu Phe Ala Glu Gln 275 280 285Asn Met Asn Ala Ala Leu Leu Ser Asp Glu Leu Gly Ile Ser Val Arg 290 295 300Val Asp Asp Pro Lys Glu Ala Ile Ser Arg Ser Lys Ile Glu Ala Met305 310 315 320Val Arg Lys Val Met Ala Glu Asp Glu Gly Glu Glu Met Arg Arg Lys 325 330 335Val Lys Lys Leu Arg Asp Thr Ala Glu Met Ser Leu Ser Ile His Gly 340 345 350Gly Gly Ser Ala His Glu Ser Leu Cys Arg Val Thr Lys Glu Cys Gln 355 360 365Arg Phe Leu Glu Cys Val Gly Asp Leu Gly Arg Gly Ala 370 375 380271446DNAArabidopsis thaliana 27ctaagcacca cgtcccaagt ccccgacaca ttccaaaaac cgttgacact ccttcgtgac 60tctgcaaagc gactcatgcg ccgaaccacc accgtgaata ctaagtgaca tctccgccgt 120gtctctcaac ttcttcactt tccttctcat ctcttcacct tcgtcctcag ccataacctt 180cctcaccatc gcctcaatct tcgacctaga aatcgcctcc tttggatcat ccactctaac 240agagattccc agttcatcgc taagcaacgc cgcgttcata ttctgctcgg cgaaaagcgg 300ccacgctatc attggaacgc cgcaaaggac gctttccaac gtcgagctcc aaccacaatg 360tgttaaaaac ccaccaacgg cctgatgggc taggatttca gcttgcggtg cccatgatgg 420gatcatgaaa cctctatcgc aagtacgagt cacgaaccct tctggtagat actctggcgt 480gttgtctttg gttacaccgc ctttagccga gaaataatca ctgcaagacg agccgtcaac 540gggcggtcga accacccata taaaccgttg ctggctctcc tcgagccccc acgccaattc 600ggttaactgt tgagccgtta gagaaccacc actcccgaag gaaatgtaga gaaccgactc 660gtttggttgt ttgtttaacc aatcaaaaac cgggtgatcg gtcgtggatg attgtatcgg 720tctgcataac ggaccaaccg gataaaccgg tacacgagcg acccggccca aaagtttcgg 780gtcttgaagg gactttaatg atttgggctc catctcttcc catgtattca ccaagattcc 840atccgctttt gggtaggcca gacagtgacg aaccaaatcg tggtacaccg gttcgtccgg 900aaccagatat gcatccataa tatcttcaaa tctaaccggt tcacaccccg gtatagtgag 960cggttttcgt tgcactgtgt gctcttcttt gataacttcg tccaaagttg gataatatat 1020cgaaactccg agataacgcg cgttggaagc gataaagaca taagtcaaca tgtttaactc 1080cgctgcaaga cataacgcat ctgtgccaaa caagtcaatg atcagagccg ttgggttttg 1140atgcatggca acgatcttgg atcggagggt tggaacagct tcacgcataa tgactccgat 1200cttggtcacc acatgggcgt tggggtctac caagccagaa atgtcgggcg atggaaggtt 1260gacgatgtca acaccggttg agttaaggag cttggactga acggaggctg cgtcagtttc 1320aaggacgaag acggtgacgt ggaagccgtg gttagcggag agacgcttag ctagctcgat 1380caccgggagg acatggccca ttccgggact ggaaaacatg gcggcgtgtg gttttgtgat 1440atgcat 1446281446DNAArabidopsis thaliana 28atggggaagc aagaagatgc agagctcgtc atcatacctt tccctttctc cggacacatt 60ctcgcaacaa tcgaactcgc caaacgtctc ataagtcaag acaatcctcg gatccacacc 120atcaccatcc tctattgggg attacctttt attcctcaag ctgacacaat cgctttcctc 180cgatccctag tcaaaaatga gcctcgtatc cgtctcgtta cgttgcccga agtccaagac 240cctccaccaa tggaactctt tgtggaattt gccgaatctt acattcttga atacgtcaag 300aaaatggttc ccatcatcag agaagctctc tccactctct tgtcttcccg cgatgaatcg 360ggttcagttc gtgtggctgg attggttctt gacttcttct gcgtccctat gatcgatgta 420ggaaacgagt ttaatctccc ttcttacatt ttcttgacgt gtagcgcagg gttcttgggt 480atgatgaagt atcttccaga gagacaccgc gaaatcaaat cggaattcaa ccggagcttc 540aacgaggagt tgaatctcat tcctggttat gtcaactctg ttcctactaa ggttttgccg 600tcaggtctat tcatgaaaga gacctacgag ccttgggtcg aactagcaga gaggtttcct 660gaagctaagg gtattttggt taattcatac acagctctcg agccaaacgg ttttaaatat 720ttcgatcgtt gtccggataa ctacccaacc atttacccaa tcgggccgat attatgctcc 780aacgaccgtc cgaatttgga ctcatcggaa cgagatcgga tcataacttg gctagatgac 840caacccgagt catcggtcgt gttcctctgt ttcgggagct tgaagaatct cagcgctact 900cagatcaacg agatagctca agccttagag atcgttgact gcaaattcat ctggtcgttt 960cgaaccaacc cgaaggagta cgcgagccct tacgaggctc taccacacgg gttcatggac 1020cgggtcatgg atcaaggcat tgtttgtggt tgggctcctc aagttgaaat cctagcccat 1080aaagctgtgg gaggattcgt atctcattgt ggttggaact cgatattgga gagtttgggt 1140ttcggcgttc caatcgccac gtggccgatg tacgcggaac aacaactaaa cgcgttcacg 1200atggtgaagg agcttggttt agccttggag atgcggttgg attacgtgtc ggaagatgga 1260gatatagtga aagctgatga gatcgcagga accgttagat ctttaatgga cggtgtggat 1320gtgccgaaga gtaaagtgaa ggagattgct gaggcgggaa aagaagctgt ggacggtgga 1380tcttcgtttc ttgcggttaa aagattcatc ggtgacttga tcgacggcgt ttctataagt 1440aagtag 144629481PRTArabidopsis thaliana 29Met Gly Lys Gln Glu Asp Ala Glu Leu Val Ile Ile Pro Phe Pro Phe 1 5 10 15Ser Gly His Ile Leu Ala Thr Ile Glu Leu Ala Lys Arg Leu Ile Ser 20 25 30Gln Asp Asn Pro Arg Ile His Thr Ile Thr Ile Leu Tyr Trp Gly Leu 35 40 45Pro Phe Ile Pro Gln Ala Asp Thr Ile Ala Phe Leu Arg Ser Leu Val 50 55 60Lys Asn Glu Pro Arg Ile Arg Leu Val Thr Leu Pro Glu Val Gln Asp 65 70 75 80Pro Pro Pro Met Glu Leu Phe Val Glu Phe Ala Glu Ser Tyr Ile Leu 85 90 95Glu Tyr Val Lys Lys Met Val Pro Ile Ile Arg Glu Ala Leu Ser Thr 100 105 110Leu Leu Ser Ser Arg Asp Glu Ser Gly Ser Val Arg Val Ala Gly Leu 115 120 125Val Leu Asp Phe Phe Cys Val Pro Met Ile Asp Val Gly Asn Glu Phe 130 135 140Asn Leu Pro Ser Tyr Ile Phe Leu Thr Cys Ser Ala Gly Phe Leu Gly145 150 155 160Met Met Lys Tyr Leu Pro Glu Arg His Arg Glu Ile Lys Ser Glu Phe 165 170 175Asn Arg Ser Phe Asn Glu Glu Leu Asn Leu Ile Pro Gly Tyr Val Asn 180 185 190Ser Val Pro Thr Lys Val Leu Pro Ser Gly Leu Phe Met Lys Glu Thr 195 200 205Tyr Glu Pro Trp Val Glu Leu Ala Glu Arg Phe Pro Glu Ala Lys Gly 210 215 220Ile Leu Val Asn Ser Tyr Thr Ala Leu Glu Pro Asn Gly Phe Lys Tyr225 230 235 240Phe Asp Arg Cys Pro Asp Asn Tyr Pro Thr Ile Tyr Pro Ile Gly Pro 245 250 255Ile Leu Cys Ser Asn Asp Arg Pro Asn Leu Asp Ser Ser Glu Arg Asp 260 265 270Arg Ile Ile Thr Trp Leu Asp Asp Gln Pro Glu Ser Ser Val Val Phe 275 280 285Leu Cys Phe Gly Ser Leu Lys Asn Leu Ser Ala Thr Gln Ile Asn Glu 290 295 300Ile Ala Gln Ala Leu Glu Ile Val Asp Cys Lys Phe Ile Trp Ser Phe305 310 315 320Arg Thr Asn Pro Lys Glu Tyr Ala Ser Pro Tyr Glu Ala Leu Pro His 325 330 335Gly Phe Met Asp Arg Val Met Asp Gln Gly Ile Val Cys Gly Trp Ala 340 345 350Pro Gln Val Glu Ile Leu Ala His Lys Ala Val Gly Gly Phe Val Ser 355 360 365His Cys Gly Trp Asn Ser Ile Leu Glu Ser Leu Gly Phe Gly Val Pro 370 375 380Ile Ala Thr Trp Pro Met Tyr Ala Glu Gln Gln Leu Asn Ala Phe Thr385 390 395 400Met Val Lys Glu Leu Gly Leu Ala Leu Glu Met Arg Leu Asp Tyr Val 405 410 415Ser Glu Asp Gly Asp Ile Val Lys Ala Asp Glu Ile Ala Gly Thr Val 420 425 430Arg Ser Leu Met Asp Gly Val Asp Val Pro Lys Ser Lys Val Lys Glu 435 440 445Ile Ala Glu Ala Gly Lys Glu Ala Val Asp Gly Gly Ser Ser Phe Leu 450 455 460Ala Val Lys Arg Phe Ile Gly Asp Leu Ile Asp Gly Val Ser Ile Ser465 470 475 480Lys301446DNAArabidopsis thaliana 30ctacttactt atagaaacgc cgtcgatcaa gtcaccgatg aatcttttaa ccgcaagaaa 60cgaagatcca ccgtccacag cttcttttcc cgcctcagca atctccttca ctttactctt 120cggcacatcc acaccgtcca ttaaagatct aacggttcct gcgatctcat cagctttcac 180tatatctcca tcttccgaca cgtaatccaa ccgcatctcc aaggctaaac caagctcctt 240caccatcgtg aacgcgttta gttgttgttc cgcgtacatc ggccacgtgg cgattggaac 300gccgaaaccc aaactctcca atatcgagtt ccaaccacaa tgagatacga atcctcccac 360agctttatgg gctaggattt caacttgagg agcccaacca caaacaatgc cttgatccat 420gacccggtcc atgaacccgt gtggtagagc ctcgtaaggg ctcgcgtact ccttcgggtt 480ggttcgaaac gaccagatga atttgcagtc aacgatctct aaggcttgag ctatctcgtt 540gatctgagta gcgctgagat tcttcaagct cccgaaacag aggaacacga ccgatgactc 600gggttggtca tctagccaag ttatgatccg atctcgttcc gatgagtcca aattcggacg 660gtcgttggag cataatatcg gcccgattgg gtaaatggtt gggtagttat ccggacaacg 720atcgaaatat ttaaaaccgt ttggctcgag agctgtgtat gaattaacca aaataccctt 780agcttcagga aacctctctg ctagttcgac ccaaggctcg taggtctctt tcatgaatag 840acctgacggc aaaaccttag taggaacaga gttgacataa ccaggaatga gattcaactc 900ctcgttgaag ctccggttga attccgattt gatttcgcgg tgtctctctg gaagatactt 960catcataccc aagaaccctg cgctacacgt caagaaaatg taagaaggga gattaaactc 1020gtttcctaca tcgatcatag ggacgcagaa gaagtcaaga accaatccag ccacacgaac 1080tgaacccgat tcatcgcggg aagacaagag agtggagaga gcttctctga tgatgggaac 1140cattttcttg acgtattcaa gaatgtaaga ttcggcaaat tccacaaaga gttccattgg 1200tggagggtct tggacttcgg gcaacgtaac gagacggata cgaggctcat ttttgactag 1260ggatcggagg aaagcgattg tgtcagcttg aggaataaaa ggtaatcccc aatagaggat 1320ggtgatggtg tggatccgag gattgtcttg acttatgaga cgtttggcga gttcgattgt 1380tgcgagaatg tgtccggaga aagggaaagg tatgatgacg agctctgcat cttcttgctt 1440ccccat 1446311425DNAArabidopsis thaliana 31atggcgaagc agcaagaagc agagctcatc ttcatcccat ttccaatccc cggacacatt 60ctcgccacaa tcgaactcgc gaaacgtctc atcagtcacc aacctagtcg gatccacacc 120atcaccatcc tccattggag cttacctttt cttcctcaat ctgacactat cgccttcctc 180aaatccctaa tcgaaacaga gtctcgtatc cgtctcatta ccttacccga tgtccaaaac 240cctccaccaa tggagctatt tgtgaaagct tccgaatctt acattcttga atacgtcaag 300aaaatggttc ctttggtcag aaacgctctc tccactctct tgtcttctcg tgatgaatcg 360gattcagttc atgtcgccgg attagttctt gatttcttct gtgtcccttt gatcgatgtc 420ggaaacgagt ttaatctccc ttcttacatc ttcttgacgt gtagcgcaag tttcttgggt 480atgatgaagt atcttctgga gagaaaccgc gaaaccaaac cggaacttaa ccggagctct 540gacgaggaaa caatatcagt tcctggtttt gttaactccg ttccggttaa agttttgcca 600ccgggtttgt tcacgactga gtcttacgaa gcttgggtcg aaatggcgga aaggttccct 660gaagccaagg gtattttggt caattcattt gaatctctag aacgtaacgc ttttgattat 720ttcgatcgtc gtccggataa ttacccaccc gtttacccaa tcgggccaat tctatgctcc 780aacgatcgtc cgaatttgga tttatcggaa cgagaccgga tcttgaaatg gctcgatgac 840caacccgagt catctgttgt gtttctctgc ttcgggagct tgaagagtct cgctgcgtct 900cagattaaag agatcgctca agccttagag ctcgtcggaa tcagattcct ctggtcgatt 960cgaacggacc cgaaggagta cgcgagcccg aacgagattt taccggacgg gtttatgaac 1020cgagtcatgg gtttgggcct tgtttgtggt tgggctcctc aagttgaaat tctggcccat 1080aaagcaattg gagggttcgt gtcacactgc ggttggaact cgatattgga gagtttgcgt 1140ttcggagttc caattgccac gtggccaatg tacgcggaac aacaactaaa cgcgttcacg 1200attgtgaagg agcttggttt ggcgttggag atgcggttgg attacgtgtc ggaatatgga 1260gaaatcgtga aagctgatga aatcgcagga gccgtacgat ctttgatgga cggtgaggat 1320gtgccgagga ggaaactgaa ggagattgcg gaggcgggaa aagaggctgt

gatggacggt 1380ggatcttcgt ttgttgcggt taaaagattc atagatgggc tttga 142532474PRTArabidopsis thaliana 32Met Ala Lys Gln Gln Glu Ala Glu Leu Ile Phe Ile Pro Phe Pro Ile 1 5 10 15Pro Gly His Ile Leu Ala Thr Ile Glu Leu Ala Lys Arg Leu Ile Ser 20 25 30His Gln Pro Ser Arg Ile His Thr Ile Thr Ile Leu His Trp Ser Leu 35 40 45Pro Phe Leu Pro Gln Ser Asp Thr Ile Ala Phe Leu Lys Ser Leu Ile 50 55 60Glu Thr Glu Ser Arg Ile Arg Leu Ile Thr Leu Pro Asp Val Gln Asn 65 70 75 80Pro Pro Pro Met Glu Leu Phe Val Lys Ala Ser Glu Ser Tyr Ile Leu 85 90 95Glu Tyr Val Lys Lys Met Val Pro Leu Val Arg Asn Ala Leu Ser Thr 100 105 110Leu Leu Ser Ser Arg Asp Glu Ser Asp Ser Val His Val Ala Gly Leu 115 120 125Val Leu Asp Phe Phe Cys Val Pro Leu Ile Asp Val Gly Asn Glu Phe 130 135 140Asn Leu Pro Ser Tyr Ile Phe Leu Thr Cys Ser Ala Ser Phe Leu Gly145 150 155 160Met Met Lys Tyr Leu Leu Glu Arg Asn Arg Glu Thr Lys Pro Glu Leu 165 170 175Asn Arg Ser Ser Asp Glu Glu Thr Ile Ser Val Pro Gly Phe Val Asn 180 185 190Ser Val Pro Val Lys Val Leu Pro Pro Gly Leu Phe Thr Thr Glu Ser 195 200 205Tyr Glu Ala Trp Val Glu Met Ala Glu Arg Phe Pro Glu Ala Lys Gly 210 215 220Ile Leu Val Asn Ser Phe Glu Ser Leu Glu Arg Asn Ala Phe Asp Tyr225 230 235 240Phe Asp Arg Arg Pro Asp Asn Tyr Pro Pro Val Tyr Pro Ile Gly Pro 245 250 255Ile Leu Cys Ser Asn Asp Arg Pro Asn Leu Asp Leu Ser Glu Arg Asp 260 265 270Arg Ile Leu Lys Trp Leu Asp Asp Gln Pro Glu Ser Ser Val Val Phe 275 280 285Leu Cys Phe Gly Ser Leu Lys Ser Leu Ala Ala Ser Gln Ile Lys Glu 290 295 300Ile Ala Gln Ala Leu Glu Leu Val Gly Ile Arg Phe Leu Trp Ser Ile305 310 315 320Arg Thr Asp Pro Lys Glu Tyr Ala Ser Pro Asn Glu Ile Leu Pro Asp 325 330 335Gly Phe Met Asn Arg Val Met Gly Leu Gly Leu Val Cys Gly Trp Ala 340 345 350Pro Gln Val Glu Ile Leu Ala His Lys Ala Ile Gly Gly Phe Val Ser 355 360 365His Cys Gly Trp Asn Ser Ile Leu Glu Ser Leu Arg Phe Gly Val Pro 370 375 380Ile Ala Thr Trp Pro Met Tyr Ala Glu Gln Gln Leu Asn Ala Phe Thr385 390 395 400Ile Val Lys Glu Leu Gly Leu Ala Leu Glu Met Arg Leu Asp Tyr Val 405 410 415Ser Glu Tyr Gly Glu Ile Val Lys Ala Asp Glu Ile Ala Gly Ala Val 420 425 430Arg Ser Leu Met Asp Gly Glu Asp Val Pro Arg Arg Lys Leu Lys Glu 435 440 445Ile Ala Glu Ala Gly Lys Glu Ala Val Met Asp Gly Gly Ser Ser Phe 450 455 460Val Ala Val Lys Arg Phe Ile Asp Gly Leu465 470331425DNAArabidopsis thaliana 33tcaaagccca tctatgaatc ttttaaccgc aacaaacgaa gatccaccgt ccatcacagc 60ctcttttccc gcctccgcaa tctccttcag tttcctcctc ggcacatcct caccgtccat 120caaagatcgt acggctcctg cgatttcatc agctttcacg atttctccat attccgacac 180gtaatccaac cgcatctcca acgccaaacc aagctccttc acaatcgtga acgcgtttag 240ttgttgttcc gcgtacattg gccacgtggc aattggaact ccgaaacgca aactctccaa 300tatcgagttc caaccgcagt gtgacacgaa ccctccaatt gctttatggg ccagaatttc 360aacttgagga gcccaaccac aaacaaggcc caaacccatg actcggttca taaacccgtc 420cggtaaaatc tcgttcgggc tcgcgtactc cttcgggtcc gttcgaatcg accagaggaa 480tctgattccg acgagctcta aggcttgagc gatctcttta atctgagacg cagcgagact 540cttcaagctc ccgaagcaga gaaacacaac agatgactcg ggttggtcat cgagccattt 600caagatccgg tctcgttccg ataaatccaa attcggacga tcgttggagc atagaattgg 660cccgattggg taaacgggtg ggtaattatc cggacgacga tcgaaataat caaaagcgtt 720acgttctaga gattcaaatg aattgaccaa aatacccttg gcttcaggga acctttccgc 780catttcgacc caagcttcgt aagactcagt cgtgaacaaa cccggtggca aaactttaac 840cggaacggag ttaacaaaac caggaactga tattgtttcc tcgtcagagc tccggttaag 900ttccggtttg gtttcgcggt ttctctccag aagatacttc atcataccca agaaacttgc 960gctacacgtc aagaagatgt aagaagggag attaaactcg tttccgacat cgatcaaagg 1020gacacagaag aaatcaagaa ctaatccggc gacatgaact gaatccgatt catcacgaga 1080agacaagaga gtggagagag cgtttctgac caaaggaacc attttcttga cgtattcaag 1140aatgtaagat tcggaagctt tcacaaatag ctccattggt ggagggtttt ggacatcggg 1200taaggtaatg agacggatac gagactctgt ttcgattagg gatttgagga aggcgatagt 1260gtcagattga ggaagaaaag gtaagctcca atggaggatg gtgatggtgt ggatccgact 1320aggttggtga ctgatgagac gtttcgcgag ttcgattgtg gcgagaatgt gtccggggat 1380tggaaatggg atgaagatga gctctgcttc ttgctgcttc gccat 1425341437DNAArabidopsis thaliana 34atgaagattg agcttgtgtt catacctttg ccggggattg gtcatctcag gccaaccgtg 60aagctagcga agcaactcat aggcagcgaa aaccgtcttt cgatcaccat aatcatcatc 120ccttcaagat ttgacgccgg tgatgcatcc gcctgtatcg catctctcac cacgttgtct 180caagatgatc gcctccatta cgaatccata tccgtcgcaa aacaaccacc aacctccgac 240ccggatcctg ttccggctca agtgtacata gagaaacaaa agacgaaagt gagagatgca 300gtcgcggcga gaatcgtcga tccaacaaga aagctcgcgg gattcgtggt ggacatgttc 360tgttcctcga tgatcgatgt agctaacgag tttggagttc cgtgttatat ggtatacaca 420tcgaacgcta cgtttttagg aaccatgctt cacgttcaac aaatgtacga tcaaaagaag 480tatgacgtca gcgagttaga aaactcggtc accgagttgg agtttccgtc tctgactcgt 540ccttatccag tgaagtgtct tcctcatatc ctcacttcaa aggagtggtt acctctctct 600ctagctcaag ctaggtgttt ccggaagatg aagggtattt tggtaaatac agttgctgag 660cttgaacctc acgctttgaa aatgttcaat attaatggtg acgatcttcc tcaagtttat 720cctgttggac cagtgttgca tctcgaaaac ggcaatgacg atgatgagaa gcaatcggaa 780attttgcggt ggctcgacga gcaaccgtct aaatctgttg tgtttctctg ctttgggagc 840ttgggaggtt tcactgaaga acaaacaaga gaaaccgctg tggccctaga tagaagcggt 900cagcggtttc tttggtgtct tcgtcacgca tcgccaaata taaaaacaga tcgtcccaga 960gattacacga atcttgagga ggttttaccg gaggggttct tggaacggac tttggataga 1020gggaaagtga ttggatgggc accacaagtg gcggtactag agaagccggc gataggaggg 1080tttgtcactc actgcggttg gaactctatt ttagagagct tgtggttcgg tgttccaatg 1140gtgacgtggc cgctatacgc ggaacagaag gttaacgcgt ttgagatggt tgaggagctg 1200ggtttggcgg tggagatacg gaagtactta aaaggagatt tgttcgccgg agagatggag 1260acggttaccg cggaggatat agagagagcc attaggcgtg tgatggagca agacagtgac 1320gttaggaaca acgtgaaaga gatggcggag aagtgccact tcgcgttaat ggacggtgga 1380tcttcgaagg cggctttgga aaagtttatt caagacgtga tagagaatat ggattaa 1437351431DNAArabidopsis thaliana 35atgaaagcag aagcagagat catcttcgtt acatatccat cccctggtca tcttcttgtc 60tccattgaat tcgctaaatc tctcatcaaa cgtgatgatc gcatccacac catcaccatc 120ctctactggg ctttacctct cgctcctcaa gcccaccttt tcgctaagtc cctcgttgct 180tcacagcctc gaatccgtct ccttgcgttg cctgatgttc aaaaccctcc accattggaa 240ctcttcttta aagctcccga agcttatatt cttgagtcca ccaagaaaac agttccttta 300gtcagagacg ctctctccac tctagtttct tcacgtaaag aatccggttc ggttcgtgta 360gtcggtttgg ttatcgattt tttttgtgtt ccaatgatcg aagtggcaaa cgagcttaac 420cttccttctt acatcttcct aacgtgtaac gctgggtttt taagtatgat gaagtatctc 480cctgagagac atcgcataac cacttctgag ctagatttaa gctccggcaa cgtagaacat 540ccaattcctg gctacgtctg ctccgtgccg acgaaggttt tgcctccagg tctattcgtg 600agagagtcct acgaggcttg ggtcgagatt gcagagaagt tccctggagc caagggcatt 660ttggtaaact cagtcacatg tcttgagcag aatgcatttg attacttcgc tcgtcttgat 720gagaactatc ctccggttta cccggtcgga ccggttctta gtttgaagga tcgtccgtct 780ccaaatctgg acgcatcgga ccgggatcgg atcatgagat ggctcgagga ccagccggag 840tcgtcaattg tgtatatctg cttcggaagc ctcggaatca ttggcaagct gcagattgaa 900gagatagctg aagccttgga actcaccggc cacaggtttc tttggtcaat acgtacaaat 960ccgacggaga aagcgagccc gtacgatctg ttgccggagg gatttctcga tcggacggcc 1020agtaagggat tggtgtgtga ttgggccccg caagtagaag ttctggccca taaagcgctc 1080ggaggattcg tgtctcactg cggttggaac tctgtactgg agagcttatg gttcggtgtt 1140ccgatcgcca cgtggccaat gtacgctgag caacagttaa acgcattctc gatggtgaag 1200gagttagggt tagccgtgga gctgcgttta gactacgttt cggcgtacgg agagatagta 1260aaagctgagg agatcgcggg agccatacga tcattgatgg acggtgagga tacgccgagg 1320aagagagtga aggagatggc ggaagcggcg aggaatgctt tgatggacgg aggatcttcg 1380tttgttgcgg ttaaacgatt tctcgacgag ttgatcggcg gagatgttta g 1431361443DNAArabidopsis thaliana 36atgaagacag cagagctcat attcgttcct ctgccggaga ccggccatct cttgtcaacg 60atcgagtttg gaaagcgtct actcaatcta gaccgtcgga tttctatgat tacaatcctc 120tccatgaatc ttccttacgc tcctcacgcc gacgcttctc ttgcttcgct aacagcctcc 180gagcctggta tccgaatcat cagtctcccg gagatccacg atccacctcc gatcaagctt 240cttgacactt cctccgagac ttacatcctc gatttcatcc ataaaaacat accttgtctc 300agaaaaacca tccaagattt agtctcatca tcatcatctt ccggaggtgg tagtagtcat 360gtcgccggct tgattcttga tttcttctgc gttggtttga tcgacatcgg ccgtgaggta 420aaccttcctt cctatatctt catgacttcc aactttggtt tcttaggggt tctacagtat 480ctcccggaac gacaacgttt gactccgtcg gagttcgatg agagctccgg cgaggaagag 540ttacatattc cggcgtttgt gaaccgtgtt cccgccaagg ttctgccgcc aggtgtgttc 600gataaactct cttacgggtc tctggtcaaa atcggcgagc gattacatga agccaagggt 660attttggtta attcatttac ccaagtggag ccttatgctg ctgaacattt ttctcaagga 720cgagattacc ctcacgtgta tcctgttggg ccggttctca acttaacggg ccgtacaaat 780ccgggtctag cttcggccca atataaagag atgatgaagt ggcttgacga gcaaccagac 840tcgtcggttt tgttcctgtg tttcgggagc atgggagtct tccctgcacc tcagatcaca 900gagattgctc acgcgctcga gcttatcggg tgcaggttca tctgggcgat ccgtacgaac 960atggcgggag atggcgatcc tcaggagccg cttccagaag gatttgtcga tcgaacaatg 1020ggccgtggaa ttgtgtgtag ttgggctcca caagtggata tcttggccca caaggcaaca 1080ggtggattcg tttctcactg cgggtggaat tccgtccaag agagtctatg gtacggtgta 1140cctattgcaa cgtggccaat gtatgcggag caacaactga acgcatttga gatggtgaag 1200gagttgggct tagcagtgga gataaggctt gactacgtgg cggatggtga tagggttact 1260ttggagatcg tgtcagccga tgaaatagcc acagccgtcc gatcattgat ggatagtgat 1320aaccccgtga gaaagaaggt tatagaaaaa tcttcagtgg cgaggaaagc tgttggtgat 1380ggtgggtctt ctacggtggc cacatgtaat tttatcaaag atattcttgg ggatcacttt 1440tga 1443371404DNAArabidopsis thaliana 37atgcggaatg tagagctcat cttcatcccc acaccaaccg ttggtcatct tgttccgttt 60cttgaatttg ctaggcgtct cattgagcaa gatgatagga tccgtatcac aatcctcttg 120atgaaactac aaggtcagtc tcatctagac acttatgtta aatcaattgc ctcctctcaa 180ccgtttgtta gattcattga tgtccctgag ttagaggaga aacctacact tggtagtaca 240caatctgtgg aagcttatgt gtatgatgtt attgagagaa atatccctct tgtgaggaat 300atagtcatgg atattttaac ttctcttgca ttggatggag ttaaggtcaa gggattagtt 360gttgactttt tctgtctccc tatgattgac gttgctaaag atataagtct ccctttctat 420gtgttcttga ctacaaattc cgggttctta gctatgatgc agtatctagc agatcgacat 480agtagagata catcggtttt tgtaagaaac tcggaagaaa tgttgtcgat acctggattt 540gtaaaccctg tcccagccaa tgttctgccg tcagctctgt ttgttgaaga tggttatgat 600gcttacgtta agctggccat attgtttaca aaggccaatg gaatcctagt gaatagctcc 660tttgatattg agccttactc tgtgaatcat tttcttcaag aacagaatta tccttctgtt 720tatgctgttg gccccatatt tgacttgaaa gcccagcctc atccagagca ggacctaacc 780cgtcgtgacg agttgatgaa atggcttgat gatcaacccg aggcatcggt tgtattcctt 840tgttttggga gtatggcaag gttaagaggt tctctagtga aggaaatagc tcatggactt 900gagctatgtc aatatagatt cctctggtca ctccgtaaag aagaggtgac aaaggatgat 960ttgccagagg ggttccttga ccgtgtcgat ggacgtggaa tgatatgtgg ttggtctcct 1020caggtagaaa tactggccca taaggcagtg ggaggctttg tttctcactg tggatggaac 1080tcaatagtag agagtttgtg gtttggcgtg ccaattgtga catggccaat gtatgcagag 1140caacaactca atgcgtttct gatggtgaag gaactgaagc tagctgtgga gctgaagctt 1200gattacaggg tacatagtga tgagatagta aacgcaaacg agatagagac cgctattcgt 1260tatgtaatgg acacggataa taatgttgtg aggaaacgag tgatggatat ctcgcagatg 1320atccagagag ctacgaagaa tggtggatct tcgtttgccg caattgagaa attcatatat 1380gacgtgatag gaattaagcc ctag 1404381592DNAArabidopsis thaliana 38atgggaactc ctgtcgaagt ctctaagctc catttcttgc tcttcccttt catggctcat 60ggccatatga taccaactct agacatggct aagctctttg ccaccaaagg agctaaatcc 120actatcctca ctacacctct caatgccaag ctcttcttcg agaaacccat caaatcattc 180aaccaagaca acccgggact cgaagacatc accatccaga tccttaattt cccttgcaca 240gagcttggtt tgcctgatgg ctgtgagaat actgatttca tcttctccac acctgaccta 300aacgtaggtg acttgagtca aaagttttta ctcgcaatga aatatttcga agagccacta 360gaggagctcc tcgtgacaat gagaccagac tgtcttgtcg gtaacatgtt cttcccttgg 420tccactaaag ttgctgagaa gttcggagta ccgagacttg tgttccacgg cacaggctac 480ttctctttat gtgcttctca ttgcataagg ctccctaaga atgtggcaac aagttctgag 540ccctttgtga ttcctgatct cccgggagac attttgatta cagaggaaca ggtcatggag 600acagaagaag agtctgtaat ggggaggttt atgaaggcaa taagagactc agagagagat 660agctttggcg tgttggtgaa cagcttctac gagcttgaac aggcttactc agattatttc 720aagagctttg tggcgaaaag agcgtggcat atcggtccgc tttccttagg aaatagaaag 780ttcgaggaga aagcagaaag aggcaaaaag gcaagcattg atgagcatga atgtttgaaa 840tggctcgact ccaagaaatg tgattcagtg atttacatgg cctttggaac catgtctagc 900tttaaaaacg agcagctgat agagattgca gctggtttag atatgtcagg acatgatttt 960gtctgggtgg ttaacagaaa aggcagccaa ggtaccatag acatcactct ctttgcagca 1020aaatcctctg tttttgtttt agagaaaaac caatgatcta attaggattc tactgtttca 1080aactctaact tttgcgtttg cattacatat aaatagttga gaaggaagat tggttaccag 1140aggggtttga agagaagacc aagggaaaag gattgataat ccgagggtgg gcgccacaag 1200tgctgatact tgagcacaaa gcaattggcg gatttttgac gcattgtgga tggaactcgt 1260tattagaagg ggtggcagcg ggcctgccaa tggtgacatg gcccgtggga gccgagcagt 1320tctacaacga gaaattggtg acacaagtgt tgaaaacagg agtgagtgtg ggagtgaaga 1380agatgatgca agtagttgga gacttcatta gcagagagaa agtggaggga gcggtgaggg 1440aagtgatggt tggagaagag aggaggaaac gggccaagga gttagcagaa atggcgaaaa 1500atgcggtgaa agaaggagga tcttcagatc tagaggtaga taggttgatg gaagagctta 1560cgttagttaa actgcaaaaa gagaaggtat aa 1592391541DNAArabidopsis thaliana 39atgggtagtg atcatcatca tcgaaagctc cacgttatgt tcttcccttt catggcttat 60ggtcacatga taccaactct agacatggct aagcttttct ctagcagagg agccaaatcc 120acaatcctca ccacatctct caactccaag atcctccaaa aacccatcga cacattcaag 180aatctgaatc cgggtctcga aatcgacatc cagatcttca atttcccttg cgtggagctg 240gggttaccag aaggatgtga aaacgttgat ttcttcactt caaacaacaa tgatgataaa 300aacgagatga tcgtgaaatt ctttttctcg acaaggtttt tcaaagacca gcttgagaaa 360ctcctcggga caacgagacc agactgtctt atcgccgaca tgttcttccc ctgggctact 420gaagctgctg ggaagttcaa tgtgccaaga cttgtgttcc acggcactgg ctacttctct 480ttatgcgctg gttattgcat cggagtgcat aaaccacaga agagagtggc ttcaagctct 540gagccatttg tgattcccga gctccctggg aacattgtga taactgaaga acagatcata 600gatggcgatg gagaatccga catgggaaag tttatgactg aagttaggga atcggaagtg 660aagagctcag gagttgtttt gaatagtttc tacgagctag aacatgatta cgccgatttt 720tacaaaagtt gtgtacaaaa gagagcgtgg catatcggtc cgctatcggt ttacaacagg 780ggatttgagg agaaggctga gagaggaaag aaagcgaaca ttgatgaggc tgaatgcctc 840aaatggcttg actccaagaa accaaattca gtcatttatg tttcctttgg gagcgtggct 900ttcttcaaga atgaacagtt attcgagatc gctgcagggt tagaagcttc cggtacaagt 960ttcatttggg ttgttaggaa aaccaaaggt attgaaattg acgtttgaag cctatattat 1020atagctgtaa tttgggtagc tttgatttta atctgacaca agatttggtg tgaacagatg 1080atagagaaga atggttacca gaagggttcg aagagagggt gaaagggaaa ggtatgataa 1140taagaggatg ggcaccacag gtgctgatac ttgaccacca agcaaccggt gggtttgtga 1200cccattgcgg ctggaactcg cttcttgaag gagtggctgc agggctacca atggtgacat 1260ggcctgtagg agcggagcaa ttctacaatg agaaattggt tacgcaagtg ctcagaacag 1320gagtgagcgt gggagcgagc aagcatatga aagttatgat gggagatttc attagcagag 1380agaaagtgga taaagcggtg agggaggttt tggctgggga agcagcagag gagaggcgga 1440gacgggcaaa gaagctagcg gcgatggcta aagctgccgt ggaagaagga gggtcttcct 1500tcaacgatct aaacagcttc atggaagagt ttagttcata a 1541401649DNAArabidopsis thaliana 40atgaacagag agcaaattca tattttgttc ttccccttca tggctcatgg ccacatgatt 60ccactcttag acatggccaa gcttttcgct agaagaggag ccaaatcaac tctcctcaca 120accccaataa atgctaagat cttggagaaa cccattgaag cattcaaagt tcaaaatcct 180gatctcgaaa tcggaatcaa gatcctcaat ttcccttgtg tagagcttgg attgccagaa 240ggatgcgaga accgtgactt cattaactca taccaaaaat ctgactcatt tgacttgttc 300ttgaagtttc ttttctctac caagtatatg aaacagcagt tggagagttt cattgaaaca 360accaaaccga gtgctcttgt agccgatatg ttcttccctt gggcaacaga atccgcggag 420aagatcggtg ttccaagact tgtgttccac ggcacatcat cctttgcctt gtgttgttcg 480tataacatga ggattcataa gccacacaag aaagtcgctt cgagttctac tccatttgta 540atccctggtc tccctggaga catagttatt acagaagacc aagccaatgt caccaacgaa 600gaaactccat tcggaaagtt ttggaaagaa gtcagggaat cagagaccag tagctttggt 660gttttggtga atagcttcta cgagctggaa tcatcttatg ctgattttta ccgtagtttt 720gtggcgaaaa aagcgtggca tataggtcca ctttcactat ccaacagagg gattgcagag 780aaagccggaa gagggaaaaa ggcaaacatt gatgagcaag aatgcctcaa atggcttgac 840tctaagacac ctggctcagt agtttacttg tcctttggta gcggaaccgg cttacccaac 900gaacagctgt tagagattgc tttcggcctt gaaggctctg gacaaaattt catttgggtg 960gttagcaaaa atgaaaacca aggtaatttt tttcctcctt aaccattatt aatcaatgta 1020gtctttatta gtatatttcc aaaaatatta acatttgtgt atacattttc ctattgccaa 1080atatgctatg atgccatagc aatgagtaga ttggtttgtg tactttatat attactttgt 1140agaacttcta acaattatga cttggtgttg gtgtagttgg gacaggtgaa aatgaagatt 1200ggttgcctaa agggtttgaa gagaggaata aaggaaaagg gctgataata cgcggatggg 1260ccccgcaagt gctgatactt gaccacaaag caatcggagg atttgtgacg cattgcggat 1320ggaactcgac tttggagggc attgccgcag ggctgcctat ggtgacttgg ccgatggggg 1380cagaacagtt ctacaacgag aagttattga

caaaagtgtt gagaatagga gtgaacgttg 1440gagctaccga gttggtgaaa aaaggaaagt tgattagtag agcacaagtg gagaaggcag 1500taagggaagt gattggtggt gagaaggcag aggaaaggcg gctaagggct aaggagctgg 1560gcgagatggc taaagccgct gtggaagaag gagggtcttc ttataatgat gtgaacaagt 1620ttatggaaga gctgaatggt agaaagtag 1649411636DNAArabidopsis thaliana 41atgaacagag aagtctctga gagaattcat attttgttct tccccttcat ggctcaaggc 60cacatgattc caattttgga catggccaag cttttctcga ggagaggagc caagtcaacc 120cttctcacaa ccccaatcaa cgctaagatc ttcgagaaac ctattgaagc attcaaaaat 180caaaaccctg atctcgaaat cggaatcaag atcttcaatt tcccttgtgt agagcttgga 240ttgcctgaag gatgcgagaa cgctgacttt atcaactcat accaaaaatc tgactcaggt 300gacttgttct tgaagtttct tttctctacc aagtatatga aacaacagtt ggagagtttc 360attgaaacaa ccaaaccaag tgctcttgtt gccgatatgt tcttcccttg ggcgacagaa 420tctgctgaga agctcggtgt accaagactt gtgttccacg gtacatcttt cttttctttg 480tgttgttcgt ataacatgag gattcataag ccacacaaga aagtcgctac gagttctact 540ccttttgtaa tccctggtct cccaggagac atagttatta cagaagacca agccaatgtt 600gccaaagaag aaacgccaat gggaaagttt atgaaagagg ttagggaatc agagaccaat 660agctttggtg tattggttaa tagcttctac gagctggaat cagcttatgc tgatttttat 720cgtagttttg tggcgaaaag agcttggcat atcggtccgc tttcgctatc taacagagag 780ttaggagaga aagccagaag agggaaaaag gctaacattg atgagcaaga atgcctaaaa 840tggctggact ctaagacacc tggttcagta gtttacttgt cctttgggag cggaactaat 900ttcaccaacg accagctgtt agagatcgct tttggtcttg aaggttctgg acaaagtttc 960atctgggtgg ttaggaaaaa tgaaaaccaa ggtaaattgt ttctccccag ccattattaa 1020ccaacatagt aatgttaata tttgtgtata tattcgtatt gccaaatatg ctctgatacc 1080atggcaagta atagattggc tcatgtattt tatttgtgat catgtagaat tttcttaaca 1140gttatgactt ggtgttggta tggttgggac aggtgacaat gaagagtggt tgcctgaagg 1200gtttaaagag aggacaacag ggaaagggct aataatacct ggatgggcgc cgcaagtgct 1260gatacttgac cataaagcaa ttggaggatt tgtgactcat tgcggatgga actcggctat 1320agagggcatt gccgcggggc tgcctatggt aacatggcca atgggggcag aacagttcta 1380caatgagaag ctattgacaa aagtgttgag aataggagtg aacgttggag ctaccgagtt 1440ggtgaaaaaa ggaaagttga ttagtagagc acaagtggag aaggcagtaa gggaagtgat 1500tggtggtgag aaggcagagg aaaggcggct atgggctaag aagctgggcg agatggctaa 1560agccgctgtg gaagaaggag ggtcctctta taatgatgtg aacaagttta tggaagagct 1620gaatggtaga aagtag 1636421476DNAArabidopsis thaliana 42atggcatcgg aatttcgtcc tcctcttcat tttgttctct tccctttcat ggctcaaggc 60cacatgatcc caatggtaga tattgcaagg ctcctggctc agcgcggggt gactataacc 120attgtcacta cacctcaaaa cgcaggccgg ttcaagaacg ttcttagccg ggctatccaa 180tccggcttgc ccatcaatct cgtgcaagta aagtttccat ctcaagaatc gggttcaccg 240gaaggacagg agaatttgga cttgctcgat tcattggggg cttcattaac cttcttcaaa 300gcatttagcc tgctcgagga accagtcgag aagctcttga aagagattca acctaggcca 360aactgcataa tcgctgacat gtgtttgcct tatacaaaca gaattgccaa gaatcttggt 420ataccaaaaa tcatctttca tggcatgtgt tgcttcaatc ttctttgtac gcacataatg 480caccaaaacc acgagttctt ggaaactata gagtctgaca aggaatactt ccccattcct 540aatttccctg acagagttga gttcacaaaa tctcagcttc caatggtatt agttgctgga 600gattggaaag acttccttga cggaatgaca gaaggggata acacttctta tggtgtgatt 660gttaacacgt ttgaagagct cgagccagct tatgttagag actacaagaa ggttaaagcg 720ggtaagatat ggagcatcgg accggtttcc ttgtgcaaca agttaggaga agaccaagct 780gagaggggaa acaaggcgga cattgatcaa gacgagtgta ttaaatggct tgattctaaa 840gaagaagggt cggtgctata tgtttgcctt ggaagtatat gcaatcttcc tctgtctcag 900ctcaaagagc tcggcttagg cctcgaggaa tcccaaagac ctttcatttg ggtcataaga 960ggttgggaga agtataacga gttacttgaa tggatctcag agagcggtta taaggaaaga 1020atcaaagaaa gaggccttct cataacagga tggtcgcctc aaatgcttat ccttacacat 1080cctgccgttg gaggattctt gacacattgt ggatggaact ctactcttga aggaatcact 1140tcaggcgttc cattactcac gtggccactg tttggagacc aattctgcaa tgagaaattg 1200gcggtgcaga tactaaaagc cggtgtgaga gctggggttg aagagtccat gagatgggga 1260gaagaggaga aaataggagt actggtggat aaagaaggag taaagaaggc agtggaggaa 1320ttgatgggtg atagtaatga tgctaaggag agaagaaaaa gagtgaaaga gcttggagaa 1380ttagctcaca aggctgtgga agaaggaggc tcttctcatt ccaacatcac attcttgcta 1440caagacataa tgcaattaga acaacccaag aaatga 1476431491DNAArabidopsis thaliana 43atggctacgg aaaaaaccca ccaatttcat ccttctcttc actttgtcct cttccctttc 60atggctcaag gccacatgat tcccatgatt gatattgcaa gactcttggc tcagcgtggt 120gtgaccataa caattgtcac gacacctcac aacgcagcaa ggtttaagaa tgtcctaaac 180cgagcgatcg agtctggctt ggccatcaac atactgcatg tgaagtttcc atatcaagag 240tttggtttgc cagaaggaaa agagaatata gattcgttag actcaacgga gttgatggta 300cctttcttca aagcggtgaa cttgcttgaa gatccggtca tgaagctcat ggaagagatg 360aaacctagac ctagctgtct aatttctgat tggtgtttgc cttatacaag cataatcgcc 420aagaacttca atataccaaa gatagttttc cacggcatgg gttgctttaa tcttttgtgt 480atgcatgttc tacgcagaaa cttagagatc ctagagaatg taaagtcgga tgaagagtat 540ttcttggttc ctagttttcc tgatagagtt gaatttacaa agcttcaact tcctgtgaaa 600gcaaatgcaa gtggagattg gaaagagata atggatgaaa tggtaaaagc agaatacaca 660tcctatggtg tgatcgtcaa cacatttcag gagttggagc caccttatgt caaagactac 720aaagaggcaa tggatggaaa agtatggtcc attggacccg tttccttgtg taacaaggca 780ggtgcagaca aagctgagag gggaagcaag gccgccattg atcaagatga gtgtcttcaa 840tggcttgatt ctaaagaaga aggttcggtg ctctatgttt gccttggaag tatatgtaat 900cttcctttgt ctcagctcaa ggagctgggg ctaggccttg aggaatctcg aagatctttt 960atttgggtca taagaggttc ggaaaagtat aaagaactat ttgagtggat gttggagagc 1020ggttttgaag aaagaatcaa agagagagga cttctcatta aagggtgggc acctcaagtc 1080cttatccttt cacatccttc cgttggagga ttcctgacac actgtggatg gaactcgact 1140ctcgaaggaa tcacctcagg cattccactg atcacttggc cgctgtttgg agaccaattc 1200tgcaaccaaa aactggtcgt tcaagtacta aaagccggtg taagtgccgg ggttgaagaa 1260gtcatgaaat ggggagaaga agataaaata ggagtgttag tggataaaga aggagtgaaa 1320aaggctgtgg aagaattgat gggtgatagt gatgatgcaa aagagaggag aagaagagtc 1380aaagagcttg gagaattagc tcacaaagct gtggaaaaag gaggctcttc tcattctaac 1440atcacactct tgctacaaga cataatgcaa ctagcacaat tcaagaattg a 1491441488DNAArabidopsis thaliana 44atggtttccg aaacaaccaa atcttctcca cttcactttg ttctcttccc tttcatggct 60caaggccaca tgattcccat ggttgatatt gcaaggctct tggctcagcg tggtgtgatc 120ataacaattg tcacgacgcc tcacaatgca gcgaggttca agaatgtcct aaaccgtgcc 180attgagtctg gcttgcccat caacttagtg caagtcaagt ttccatatct agaagctggt 240ttgcaagaag gacaagagaa tatcgattct cttgacacaa tggagcggat gatacctttc 300tttaaagcgg ttaactttct cgaagaacca gtccagaagc tcattgaaga gatgaaccct 360cgaccaagct gtctaatttc tgatttttgt ttgccttata caagcaaaat cgccaagaag 420ttcaatatcc caaagatcct cttccatggc atgggttgct tttgtcttct gtgtatgcat 480gttttacgca agaaccgtga gatcttggac aatttaaagt cagataagga gcttttcact 540gttcctgatt ttcctgatag agttgaattc acaagaacgc aagttccggt agaaacatat 600gttccagctg gagactggaa agatatcttt gatggtatgg tagaagcgaa tgagacatct 660tatggtgtga tcgtcaactc atttcaagag ctcgagcctg cttatgccaa agactacaag 720gaggtaaggt ccggtaaagc atggaccatt ggacccgttt ccttgtgcaa caaggtagga 780gccgacaaag cagagagggg aaacaaatca gacattgatc aagatgagtg ccttaaatgg 840ctcgattcta agaaacatgg ctcggtgctt tacgtttgtc ttggaagtat ctgtaatctt 900cctttgtctc aactcaagga gctgggacta ggcctagagg aatcccaaag acctttcatt 960tgggtcataa gaggttggga gaagtacaaa gagttagttg agtggttctc ggaaagcggc 1020tttgaagata gaatccaaga tagaggactt ctcatcaaag gatggtcccc tcaaatgctt 1080atcctttcac atccatcagt tggagggttc ctaacacact gtggttggaa ctcgactctt 1140gaggggataa ctgctggtct accgctactt acatggccgc tattcgcaga ccaattctgc 1200aatgagaaat tggtcgttga ggtactaaaa gccggtgtaa gatccggggt tgaacagcct 1260atgaaatggg gagaagagga gaaaatagga gtgttggtgg ataaagaagg agtgaagaag 1320gcagtggaag aattaatggg tgagagtgat gatgcaaaag agagaagaag aagagccaaa 1380gagcttggag attcagctca caaggctgtg gaagaaggag gctcttctca ttctaacatc 1440tctttcttgc tacaagacat aatggaactg gcagaaccca ataattga 1488451488DNAArabidopsis thaliana 45atggctttcg aaaaaaacaa cgaacctttt cctcttcact ttgttctctt ccctttcatg 60gctcaaggcc acatgattcc catggttgat attgcaaggc tcttggctca gcgaggtgtg 120cttataacaa ttgtcacgac gcctcacaat gcagcaaggt tcaagaatgt cctaaaccgt 180gccattgagt ctggtttgcc catcaaccta gtgcaagtca agtttccata tcaagaagct 240ggtctgcaag aaggacaaga aaatatggat ttgcttacca cgatggagca gataacatct 300ttctttaaag cggttaactt actcaaagaa ccagtccaga accttattga agagatgagc 360ccgcgaccaa gctgtctaat ctctgatatg tgtttgtcgt atacaagcga aatcgccaag 420aagttcaaaa taccaaagat cctcttccat ggcatgggtt gcttttgtct tctgtgtgtt 480aacgttctgc gcaagaaccg tgagatcttg gacaatttaa agtctgataa ggagtacttc 540attgttcctt attttcctga tagagttgaa ttcacaagac ctcaagttcc ggtggaaaca 600tatgttcctg caggctggaa agagatcttg gaggatatgg tagaagcgga taagacatct 660tatggtgtta tagtcaactc atttcaagag ctcgaacctg cgtatgccaa agacttcaag 720gaggcaaggt ctggtaaagc atggaccatt ggacctgttt ccttgtgcaa caaggtagga 780gtagacaaag cagagagggg aaacaaatca gatattgatc aagatgagtg ccttgaatgg 840ctcgattcta aggaaccggg atctgtgctc tacgtttgcc ttggaagtat ttgtaatctt 900cctctgtctc agctccttga gctgggacta ggcctagagg aatcccaaag acctttcatc 960tgggtcataa gaggttggga gaaatacaaa gagttagttg agtggttctc ggaaagcggc 1020tttgaagata gaatccaaga tagaggactt ctcatcaaag gatggtcccc tcaaatgctt 1080atcctttcac atccttctgt tggagggttc ttaacgcact gcggatggaa ctcgactctt 1140gaggggataa ctgctggtct accaatgctt acatggccac tatttgcaga ccaattctgc 1200aacgagaaac tggtcgtaca aatactaaaa gtcggtgtaa gtgccgaggt taaagaggtc 1260atgaaatggg gagaagaaga gaagatagga gtgttggtgg ataaagaagg agtgaagaag 1320gcagtggaag aactaatggg tgagagtgat gatgcaaaag agagaagaag aagagccaaa 1380gagcttggag aatcagctca caaggctgtg gaagaaggag gctcctctca ttctaatatc 1440actttcttgc tacaagacat aatgcaacta gcacagtcca ataattga 1488461473DNAArabidopsis thaliana 46atgtgttctc atgatcctct tcacttcgtc gtaataccct ttatggccca aggccatatg 60atcccattgg tcgacatctc taggctcttg tcccagcgcc aaggcgtgac tgtctgcatc 120atcacaacta ctcaaaatgt agccaagatc aagacttcac tctcattttc ctctttgttt 180gcgactatca acatcgttga agttaagttt ctgtctcaac aaacgggttt gccagaaggg 240tgcgagagtt tagatatgtt ggcttcaatg ggcgatatgg tgaagttctt tgatgctgcc 300aactcacttg aggagcaagt tgagaaagct atggaagaga tggttcagcc gcggccaagc 360tgcatcattg gagacatgag ccttcctttc acttcaagac ttgccaagaa attcaagatc 420cccaaactta tcttccatgg gttttcttgt ttcagcctca tgtctataca agtggttcga 480gaaagcggga tcttgaaaat gatagaatca aacgacgagt attttgattt gcccggcttg 540cctgacaaag ttgagttcac gaaacctcag gtctctgtgt tgcaacctgt tgaaggaaat 600atgaaagaga gtacggccaa gattattgaa gctgataatg actcttatgg tgttattgtg 660aacacttttg aagagttaga ggttgattat gcaagagaat ataggaaagc aagggctgga 720aaagtttggt gcgttggacc tgtttccttg tgcaataggt tagggttaga caaagctaaa 780agaggagata aggcttctat tggtcaagac caatgtcttc aatggcttga ctctcaagaa 840actggttcag tgctctacgt ttgccttgga agtctatgta atcttccctt ggctcagctc 900aaagagctgg gactaggcct tgaggcatct aataaacctt tcatatgggt tataagagaa 960tggggaaaat atggagattt agcaaattgg atgcaacaaa gcggatttga agagcggatc 1020aaagatagag gactggtgat caaaggttgg gcgccgcaag ttttcatcct ctcacacgca 1080tccattggag ggtttttgac tcactgtgga tggaactcga cactagaagg aattactgca 1140ggagttccat tattgacatg gcctttgttt gctgaacaat tcttgaatga gaagttagtt 1200gtgcagatac taaaagcagg gttaaagata ggagtagaga aattgatgaa atatggaaaa 1260gaagaggaga taggagcgat ggtgagcaga gaatgtgtga gaaaagctgt ggatgagcta 1320atgggtgata gtgaagaagc agaagagaga agaagaaaag ttacagaact tagtgacttg 1380gcaaataagg ctttggaaaa aggaggatct tcagattcta atatcacatt gctcattcaa 1440gatattatgg agcaatcaca aaatcaattt taa 1473471437DNAArabidopsis thaliana 47atggagcata agagaggaca tgtattagca gtgccgtacc caacgcaagg acacatcaca 60ccattccgcc aattctgcaa acgacttcac ttcaaaggtc tcaaaaccac tctcgctctc 120accactttcg tcttcaactc catcaatcct gacctatccg gtccaatctc catagccacc 180atctccgatg gctatgacca tgggggtttc gagacagctg actccatcga cgactacctc 240aaagacttta aaacttccgg ctcgaaaacc attgcagaca tcatccaaaa acaccagact 300agtgataacc ccatcacttg tatcgtctat gatgctttcc tgccttgggc acttgacgtt 360gctagagagt ttggtttagt tgcgactcct ttctttacgc agccttgtgc tgttaactat 420gtttattatc tttcttacat aaacaatgga agcttgcaac ttcccattga ggaattgcct 480tttcttgagc tccaagattt gccttctttc ttctctgttt ctggctctta tcctgcttac 540tttgagatgg tgcttcaaca gttcataaat ttcgaaaaag ctgatttcgt tctcgttaat 600agcttccaag agttggaact gcatgttaga tctctctcta tctctttctt acaattctta 660aaccatctct tgttcttgtg catgtactaa ctgctctttt tttgtttaca ggagaatgaa 720ttgtggtcga aagcttgtcc tgtgttgaca attggtccaa ctattccatc aatttactta 780gaccaacgta tcaaatcaga caccggctat gatcttaatc tctttgaatc gaaagatgat 840tccttctgca ttaactggct cgacacaagg ccacaagggt cggtggtgta cgtagcattc 900ggaagcatgg ctcagctgac taatgtgcag atggaggagc ttgcttcagc agtaagcaac 960ttcagcttcc tgtgggtggt cagatcttca gaggaggaaa aactcccatc agggtttctt 1020gagacagtga ataaagaaaa gagcttggtc ttgaaatgga gtcctcagct tcaagttctg 1080tcaaacaaag ccatcggttg tttcttgact cactgtggct ggaactcaac catggaggct 1140ttgaccttcg gggttcccat ggtggcaatg ccccaatgga ctgatcaacc gatgaacgca 1200aagtacatac aagatgtgtg gaaggctgga gttcgtgtga agacagagaa ggagagtggg 1260attgccaaga gagaggagat tgagtttagc attaaggaag tgatggaagg agagaggagc 1320aaagagatga agaagaacgt gaagaaatgg agagacttgg ctgtcaagtc actcaatgaa 1380ggaggttcta cggatactaa cattgataca tttgtatcaa gggttcagag caaatag 1437481451DNAArabidopsis thaliana 48atggaagaac taggagtgaa gagaaggata gtattggttc cagttccagc acaaggtcat 60gtaactccga ttatgcaact cgggaaggct ctttactcca agggcttctc catcactgtt 120gttctcacac agtataatcg agttagctca tccaaggact tctctgattt tcatttcctc 180accatcccag gcagcttgac cgagtctgat ctcaaaaacc ttggaccatt caagtttctc 240ttcaagctca atcaaatttg cgaggcaagc ttcaagcaat gtattggtca actattgcag 300gagcaaggta atgatatcgc ttgtgtcgtc tacgatgagt acatgtactt ctcccaagct 360gcagttaaag agtttcaact tcctagcgtc ctcttcagca cgacaagtgc tactgccttt 420gtctgtcgct ctgttttgtc tagagtcaac gcagagtcat tcttgcttga catgaaaggt 480actcaagatt ttttagcttg ttaactcaaa ctttaaaagt gcatttaggt atataaacca 540atccaaatgc tgttgtttgc tttgcagatc ccaaagtgtc agacaaggaa tttccagggt 600tgcatccgct aaggtacaag gacctgccaa cttcagcatt tgggccatta gagagtatac 660tcaaggttta cagtgagact gtcaacattc gaacagcttc ggcagttatc atcaactcaa 720caagctgtct agagagctca tctttggcat ggttacaaaa acaactgcaa gttccagtgt 780atcctatagg cccacttcac attgcagctt cagcgccttc tagtttactt gaagaggaca 840ggagttgcct tgagtggttg aacaagcaaa aaataggctc agtgatttac ataagtttgg 900gaagcttggc tctaatggaa actaaagaca tgttggagat ggcttggggt ttacgtaata 960gcaaccaacc tttcttatgg gtgatccgac cgggttctat tcccggctcg gaatggacag 1020agtctttacc ggaggaattc agtaggttgg tttcagaaag aggttacatt gtgaaatggg 1080caccacagat agaagttctc agacatcctg cagtgggagg gttttggagt cactgcggat 1140ggaactcgac cctagagagc atcggggaag gagttccgat gatctgtagg ccttttacgg 1200gagatcagaa agtcaatgcg aggtacttag agagagtttg gagaattggg gttcaattgg 1260aaggagagct ggataaagga acagtggaga gagctgtaga gagattgatt atggatgaag 1320aaggagcaga aatgaggaag agagttatca acttgaaaga gaagcttcaa gcctctgtca 1380agagtagagg ttcctcattc agctcattag acaactttgt caattcctta aaaatgatga 1440atttcatgta g 1451491433DNAArabidopsis thaliana 49atggaggaaa agccggcggg cagaagagta gtgttggttg cagttccagc tcaaggacat 60atctctccaa taatgcaact tgcaaaaaca cttcacttga agggtttctc aatcacaatc 120gctcagacaa agttcaatta ctttagccct tcagatgact tcactgattt tcagtttgtc 180accattccag aaagcttacc agagtctgat tttgaggatc tcgggccaat agagtttctg 240cataagctca acaaagagtg tcaggtgagc ttcaaagact gtttgggtca gttgttgctg 300caacaaggta atgagatagc ctgtgttgtc tacgacgagt tcatgtactt tgctgaagct 360gcagccaaag agtttaagct tccaaacgtc attttcagca ccacaagtgc cacggctttt 420gtttgccgct ctgcattcga caaactttat gcaaacagta tcctgactcc cttgaaaggt 480actcttgaat tctctgtctt ctattcttgc tggtttctat aatctgtaac agcatggttc 540ttgacctttt tgcagaaccc aaaggacaac aaaacgagct agtgccagag tttcatcccc 600tgagatgcaa agactttccg gtttcacatt gggcatcatt agaaagcatg atggagctgt 660ataggaatac agttgacaaa cggacagctt cctcggtgat aatcaacaca gcgagctgtc 720tagagagctc atctctgtct cgtctgcagc aacagctaca aattccagtt tatcctatag 780gccctcttca cctggtggca tcagcttcta cgagtcttct tgaagagaac aagagctgta 840ttgaatggtt gaacaaacaa aagaaaaact ctgtgatatt cgtaagcttg ggaagcttag 900ctttgatgga aatcaatgag gtgatagaaa ctgctttggg attggatagt agcaagcaac 960agttcttgtg ggtcattcgg ccagggtcag tacgtggttc ggaatggata gagaacttgc 1020ctaaggagtt tagtaagata atttcgggtc gaggttacat tgtgaaatgg gctccacaga 1080aggaagtact ttctcatcct gcagtaggag gattttggag ccattgcgga tggaactcga 1140cactagagag catcggggaa ggagttccaa tgatttgcaa gccgttttcc agtgatcaaa 1200tggtgaatgc gagatacttg gagtgtgtat ggaaaattgg gattcaagtt gagggtgatc 1260tagacagagg agcggtcgag agagctgtga ggaggttaat ggtggaggaa gaaggggagg 1320ggatgaggaa gagagctatc agtttgaaag agcaacttag agcctctgtt ataagtggag 1380gttcttcaca caactcgcta gaggagtttg tacactacat gaggactcta tga 1433501457DNAArabidopsis thaliana 50atgcaggttt tgggaatgga ggaaaagcct gcaaggagaa gcgtagtgtt ggttccattt 60ccagcacaag gacatatatc tccaatgatg caacttgcca aaacccttca cttaaagggt 120ttctcgatca cagttgttca gactaagttc aattacttta gcccttcaga tgacttcact 180catgattttc agttcgtcac cattccagaa agcttaccag agtctgattt caagaatctc 240ggaccaatac agtttctgtt taagctcaac aaagagtgta aggtgagctt caaggactgt 300ttgggtcagt tggtgctgca acaaagtaat gagatctcat gtgtcatcta cgatgagttc 360atgtactttg ctgaagctgc agccaaagag tgtaagcttc caaacatcat tttcagcaca 420acaagtgcca cggctttcgc ttgccgctct gtatttgaca aactatatgc aaacaatgtc 480caagctccct tgaaaggtac tctaaaactc tctgtttcgt ggtttccgcg agtggctata 540agattgaaac agcattgttt ttgacctttt ttgcagaaac taaaggacaa caagaagagc 600tagttccgga gttttatccc ttgagatata aagactttcc agtttcacgg tttgcatcat 660tagagagcat aatggaggtg tataggaata cagttgacaa acggacagct tcctcggtga 720taatcaacac tgcgagctgt ctagagagct catctctgtc ttttctgcaa caacaacagc 780tacaaattcc agtgtatcct ataggccctc ttcacatggt ggcctcagct cctacaagtc 840tgcttgaaga gaacaagagc tgcatcgaat ggttgaacaa acaaaaggta aactcggtga 900tatacataag catgggaagc atagctttaa

tggaaatcaa cgagataatg gaagtcgcgt 960caggattggc tgctagcaac caacacttct tatgggtgat ccgaccaggg tcaatacctg 1020gttccgagtg gatagagtcc atgcctgaag agtttagtaa gatggttttg gaccgaggtt 1080acattgtgaa atgggctcca cagaaggaag tactttctca tcctgcagta ggagggtttt 1140ggagccattg tggatggaac tcgacactag aaagcatcgg ccaaggagtt ccaatgatct 1200gcaggccatt ttcgggtgat caaaaggtga acgctagata cttggagtgt gtatggaaaa 1260ttgggattca agtggagggt gagctagaca gaggagtggt cgagagagct gtgaagaggt 1320taatggttga cgaagaagga gaggagatga ggaagagagc tttcagttta aaagagcaac 1380ttagagcctc tgttaaaagt ggaggctctt cacacaactc gctagaagag tttgtacact 1440tcataaggac tctatga 1457511434DNAArabidopsis thaliana 51atggaggaaa agcaagtgaa ggagacaagg atagtgttgg ttccagttcc agctcaaggt 60catgtaactc cgatgatgca actaggaaaa gctcttcact caaagggttt ctccatcact 120gttgttctga cacagtctaa tcgagttagc tcttccaaag acttctctga tttccatttc 180ctcaccatcc caggcagctt aactgagtct gatctccaaa acctaggacc acaaaagttt 240gtgctcaagc tcaatcaaat ttgtgaggca agcttcaagc agtgtatagg tcaactattg 300catgaacaat gtaataatga tattgcttgt gtcgtctacg atgagtacat gtacttctct 360catgctgcag taaaagagtt tcaacttcct agtgtcgtct ttagcacgac aagtgctact 420gcttttgtct gtcgctctgt tttgtctaga gtcaacgcag agtcgttctt gatcgacatg 480aaaggtattc aagattctag cttgttttat cttaattcaa aatcctattt atagaaacta 540atccaaatga tcgatgttat cttttcagat cctgaaacac aagacaaagt atttccaggg 600ttgcatcctc tgaggtacaa ggatctacca acttcagtat ttgggccaat agagagtacg 660ctcaaggttt acagtgagac tgtgaacact cgaacagctt ccgctgttat catcaactca 720gcaagctgtt tagagagctc atctttggca aggttgcaac aacaactgca agttccggtg 780tatcctatag gcccacttca tattacagct tcagcgcctt ctagtttact agaagaagac 840aggagttgcg ttgagtggtt gaacaagcaa aaatcaaatt cagttattta cataagcttg 900ggaagcttgg ctctaatgga caccaaagac atgttggaga tggcttgggg attaagtaat 960agcaaccaac ctttcttatg ggtggtcaga ccgggctcta ttccggggtc agaatggaca 1020gagtccttac cagaggaatt caataggttg gtttcagaaa gaggttacat tgtgaaatgg 1080gctccgcaga tggaagttct cagacatcct gcagtaggag ggttttggag tcactgtgga 1140tggaactcaa cagtagagag catcggggaa ggagttccga tgatatgtag gcctttcacc 1200ggggatcaga aagtcaatgc gaggtactta gagagagttt ggagaattgg ggttcaattg 1260gagggagatc tggataaaga aactgtggag agagctgtag agtggttgct tgtggatgaa 1320gaaggagcag aaatgaggaa gagagccatt gacttgaaag aaaagattga aacctctgtt 1380agaagtggag gttcctcatg cagctcacta gacgactttg ttaattccat gtga 1434521458DNAArabidopsis thaliana 52atgaccaaat tctccgagcc aatcagagac tcccacgtgg cagttctcgc gtttttcccc 60gttggcgctc atgccggtcc tctcttagcc gtcactcgcc gtctcgccgc cgcttctccc 120tccaccatct tttctttctt caacaccgca agatcaaacg cgtcgttgtt ctcctctgat 180catcccgaga acatcaaggt ccacgacgtc tctgacggtg ttccggaggg aaccatgctc 240gggaatccac tggagatggt cgagctgttt ctcgaagcgg ctccacgtat tttccggagc 300gaaatcgcgg cggcagagat agaagttgga aagaaagtga catgcatgct aacagatgcc 360ttcttctggt tcgcagcgga catagcggct gagctgaacg cgacttgggt tgccttctgg 420gccggcggag caaactcact ctgtgctcat ctctacactg atctcatcag agaaaccatc 480ggtctcaaag gtaactagct ttttagcgtt tagtgattat tccacaaatt cagctactac 540actttgtatg tatttatggt tattattatt atttatctcc tggtagatgt gagtatggaa 600gagacattag ggtttatacc aggaatggag aattacagag ttaaagatat accagaggaa 660gttgtatttg aagatttgga ctctgttttc ccaaaggctt tataccaaat gagtcttgct 720ttacctcgtg cctctgctgt tttcatcagt tcctttgaag agttagaacc tacattgaac 780tataacctaa gatccaaact taaacgtttc ttgaacatcg cccctctcac gttattatct 840tctacatcgg agaaagagat gcgtgatcct catggctgct ttgcttggat ggggaagaga 900tcagctgctt ctgtagcgta cattagcttc ggcaccgtca tggaacctcc tcctgaagag 960cttgtggcga tagcacaagg gttggaatca agcaaagtgc cgtttgtttg gtcgctgaag 1020gagaagaaca tggttcatct accaaaaggg tttttggatc ggacaagaga gcaagggata 1080gtggttcctt gggctccaca agtggaactg ctgaaacacg aggcaatggg tgtgaatgtg 1140acacattgtg gatggaactc agtgttggag agtgtgtcgg caggtgtacc gatgatcggc 1200agaccgattt tggcggataa taggctcaac ggaagagcag tggaggttgt gtggaaggtt 1260ggagtgatga tggataatgg agtcttcacg aaagaaggat ttgagaagtg tttgaatgat 1320gtttttgttc atgatgatgg taagacgatg aaggctaatg ccaagaagct taaagaaaaa 1380ctccaagaag atttctccat gaaaggaagc tctttagaga atttcaaaat attgttggac 1440gaaattgtga aagtttag 1458531420DNAArabidopsis thaliana 53atgaaagtga acgaggaaaa caacaagccg acaaagaccc atgtcttaat cttcccattt 60ccggcgcaag gtcacatgat tcccctcctc gacttcaccc accgccttgc tctccgcggc 120ggcgccgcct taaaaataac cgtcctagtc actccaaaaa accttccttt tctctctccg 180cttctctccg ccgtagttaa catcgaacca cttatcctcc cttttccctc ccacccttca 240atcccctccg gcgtcgaaaa cgtccaagac ttacctcctt caggcttccc tttaatgatc 300cacgcgcttg gtaatctcca cgcgccgctt atctcttgga ttacttctca cccttctcct 360ccagtagcca tcgtatctga tttcttcctt ggttggacca aaaacctcgg aatccctcgt 420ttcgatttct ctccctccgc tgctatcact tgctgcatac tcaatactct ctggatcgaa 480atgcccacca agatcaacga agatgacgat aacgagatcc tccactttcc caagatcccg 540aattgtccaa aataccgttt tgatcagatc tcctctcttt acagaagtta cgttcacgga 600gatccagctt gggagttcat aagagactcc tttagagata acgtggcgag ttggggactc 660gtcgtgaact cgttcaccgc catggaaggt gtttatctcg aacatcttaa gcgagagatg 720ggccatgatc gtgtatgggc tgtaggccca attattccgt tatctgggga taaccgtggt 780ggcccgactt ctgtttctgt tgatcacgtg atgtcgtggc ttgacgcacg tgaggataac 840cacgtggtgt acgtgtgctt tggaagtcaa gtagttttga ctaaagagca gactcttgca 900ctcgcctctg ggcttgagaa aagcggcgtc catttcatat gggccgtaaa ggagcccgtt 960gagaaagact caacacgtgg caacatcctg gacggtttcg acgatcgcgt ggctgggaga 1020ggtctggtga tcagaggatg ggctccacaa gtagctgtgc tacgtcaccg agccgttggc 1080gcgtttttaa cgcactgtgg ttggaactct gtggtggagg cggttgtcgc cggcgttttg 1140atgctgacgt ggccgatgag agctgaccag tacactgacg cgtctctggt ggttgatgag 1200ttgaaagtag gtgtgcgtgc ttgcgaagga cctgacacgg tgcctgaccc ggacgagtta 1260gctcgagttt tcgctgattc cgtgaccgga aatcaaacgg agaggatcaa agccgtggag 1320ctgaggaaag cagcgttgga tgcgattcaa gaacgtggga gctcagtgaa tgatttagat 1380ggatttatcc aacatgtcgt tagtttagga ctaaacaaat 1420541494DNAArabidopsis thaliana 54atgagcatag atatttttca agaaataaga ataaagaaaa ttctactctt aatggcggaa 60gcaaacactc cacacatagc aatcatgccg agtcccggta tgggtcacct tatcccattc 120gtcgagttag caaagcgact cgttcagcac gactgtttca ccgtcacaat gatcatctcc 180ggtgaaactt cgccgtctaa ggcacaaaga tccgttctca actctctccc ttcctccata 240gcctccgtat ttctccctcc cgccgatctt tccgatgttc cctccacagc gcgaatcgaa 300actcgggcca tgctcaccat gactcgttcc aatccggcgc tccgggagct ttttggctct 360ttatcaacga agaaaagtct cccggcggtt ctcgtcgtcg atatgtttgg tgcggatgcg 420ttcgacgtgg ccgttgactt ccacgtgtca ccatacattt tctatgcatc caatgcaaac 480gtcttgtcgt tttttcttca cttgccgaaa ctagacaaaa cggtgtcgtg tgagtttagg 540tacttaaccg aaccgcttaa gattcccggc tgtgtcccga taaccggtaa ggactttctt 600gatacggttc aagaccgaaa cgacgacgca tacaaattgc ttctccataa caccaagagg 660tacaaagaag ctaaagggat tctagtgaat tccttcgttg atttagagtc gaatgcaata 720aaggccttac aagaaccggc tcctgataaa ccaacggtat acccgattgg gccgctggtt 780aacacaagtt catctaatgt taacttggaa gacaagttcg gatgtttaag ttggctagac 840aaccaaccat tcggctcggt tctatacata tcatttggaa gcggcggaac acttacatgt 900gagcagttta atgagcttgc tattggtctt gcggagagcg gaaaacggtt tatttgggtc 960atacgaagtc caagcgagat agttagttcg tcgtatttca atccacacag cgagacagac 1020cccttttcgt ttttaccaat tgggttctta gaccgaacca aagagaaagg tttggtggtt 1080ccatcatggg ctccacaggt tcaaatcctg gctcatccat ccacatgcgg gtttttaaca 1140cactgtggat ggaattcgac cttagaaagc attgtaaacg gtgtaccact catagcgtgg 1200cctttattcg cggagcaaaa gatgaataca ttgctactcg tggaggatgt tggagcggct 1260ctaagaatcc atgcgggtga agatgggatt gtacggaggg aagaagtggt gagagtggtg 1320aaggcactga tggaaggtga agagggaaaa gccataggaa ataaagtgaa ggagttgaaa 1380gaaggagttg ttagagtctt gggtgacgat ggattgtcca gcaagtcatt tggtgaagtt 1440ttgttaaagt ggaaaacgca ccagcgagat atcaaccaag agacgtccca ctaa 14945535DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 55cgggtgatca ggtaccatgg cgccaccgca ttttc 355635DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 56cggaattcgt cgacttactt tacttttacc tcctc 355734DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 57cccccgggta ccatggagct agaatcttct ctcc 345834DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 58cggaattctc gagttaaaag cttttgattg atcc 345926DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 59tgggatccat atcagaaatg gtgttc 266030DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 60gggaattcct agtatccatt atctttagtc 306130DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 61ggggatccat ggacccgtct cgtcatactc 306231DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 62gggaattcca ctagtgttct ccgttgtctt c 316333DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 63ggggatccaa tatggagatg gaatcgtcgt tac 336432DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 64gggaattcct tacacgacat tattaatgtt tg 326534DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 65ggggtacctg atcaataatg ggcagtagtg aggg 346635DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 66cggaattcgt cgacgagtta ggcgattgtg atatc 356735DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 67cgggatccgg taccatgcat atcacaaaac cacac 356835DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 68cggaattcgc tagctaagca ccacgtgaca agtcc 356935DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 69cgggatccgg taccatgagt agtgatcctc atcgt 357035DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 70cgggatccga attctacgag gtaaactctt ctatg 357135DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 71cgggatccgg taccatgcat atcacaaaac cacac 357233DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 72cggaattcgt cgacctaagc accacgtccc aag 337334DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 73gggtgatcag gtaccatggg gaagcaagaa gatg 347435DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 74cggaattcgt cgactactta cttatagaaa cgccg 357533DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 75gaagatctgg taccatggcg aagcagcaag aag 337633DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 76cggaattcgt cgaccgatca aagcccatct atg 33

Patent applications by THE UNIVERSITY OF YORK

Patent applications in class Conifer

Patent applications in all subclasses Conifer

User Contributions:

Comment about this patent or add new information about this topic:

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: Transgenic Cells Expressing Glucosyltransferase Nucleic Acids

Inventors: Diana Joy Bowles (Heslington, GB) Yi Li (Heslington, GB) Eng-Kiat Lim (Heslington, GB)
Assignees: THE UNIVERSITY OF YORK
IPC8 Class: AA01H700FI
USPC Class: 800319
Class name: Conifer
Publication date: 08/28/2008
Patent application number: 20080209597

Abstract:

Claims:

Description:

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: Transgenic Cells Expressing Glucosyltransferase Nucleic Acids

Inventors: Diana Joy Bowles (Heslington, GB) Yi Li (Heslington, GB) Eng-Kiat Lim (Heslington, GB) Assignees: THE UNIVERSITY OF YORK IPC8 Class: AA01H700FI USPC Class: 800319 Class name: Conifer Publication date: 08/28/2008 Patent application number: 20080209597

Abstract:

Claims:

Description:

Inventors: Diana Joy Bowles (Heslington, GB) Yi Li (Heslington, GB) Eng-Kiat Lim (Heslington, GB)
Assignees: THE UNIVERSITY OF YORK
IPC8 Class: AA01H700FI
USPC Class: 800319
Class name: Conifer
Publication date: 08/28/2008
Patent application number: 20080209597