Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Article Abstract:

The distamycin A-sensitive fragile site FRA16B is due to the expansion of perfect-repeat copies of the 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(super c/sub a)TA)sub n, located at the site of repeat-copy number polymorphism in the normal population. This was gleaned from the isolation by positional cloning of FRA16B and comparison with folate-sensitive fragile sites, which found that the FRA16B repeat motif has striking homology with the polymorphic variable number tandem repeat at the COL2A1 collagen gene locus. Findings also indicate that the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats.

author: Sutherland, Grant R., Yu, Sui, Richards, Robert I., Hewett, Duncan, Le Paslier, Denis, Baker, Elizabeth, Mangelsdorf, Marie, Hobson, Lynne, Eyre, Helen J., Lapsys, Naras, Doggett, Norman A.
Publisher: Elsevier B.V.
Publication Name: Cell
Subject: Biological sciences
ISSN: 0092-8674
Year: 1997
Analysis, Nucleotide sequence, Base sequence, Chromosomes, Human chromosome abnormalities

User Contributions:

Comment about this article or add new information about this topic:

CAPTCHA

Molecular and biological characterization of a ligand for CD27 defines a new family of cytokines with homology to tumor necrosis factor

Article Abstract:

A fusion protein consisting of the extracellular domain of CD27 and the constant domain of a human immunoglobulin G1 molecule was used as a probe for the isolation of a cDNA encoding a ligand for CD27. CD27 is T and B cell surface antigen. The ligand for CD27, which was identified and cloned from an Epstein-Barr virus-transformed human B cell line, encodes for a type II transmembrane protein homologous to the tumor necrosis factor and the ligand for CD40. Biological characterization of the ligand suggests a role in the maturation of T cells.

author: Smith, Craig A., Jerzy, Rita, Cosman, David, Goodwin, Raymond G., Sutherland, Grant R., Alderson, Mark R., Armitage, Richard J., VandenBos, Tim, Tough, Teresa W., Schoenborn, Michael A., Davis-Smith, Terri, Hennen, Kathryn, Falk, Ben, Baker, Elizabeth, Grabstein, Kenneth H., Farrah, Terry, Giri, Judith G., Beckman, M. Patricia
Publisher: Elsevier B.V.
Publication Name: Cell
Subject: Biological sciences
ISSN: 0092-8674
Year: 1993
Cloning, T cells, Cell surface antigens

User Contributions:

Comment about this article or add new information about this topic:

CAPTCHA

Fragile sites--cytogenetic similarity with molecular diversity

Article Abstract:

Fragile sites involve both cytogenetic similarity and molecular diversity. Some common fragile sites may affect gene expression, setting up local regions of instability. Understanding mechanisms of the instability and the biological significance is a challenge. Just three of the various classes of rare fragile sites have been studied from the molecular perspective and more is known about the folate-sensitive ones than others. Fragile sites are classified with some cytogenetic and molecular properties.

author: Sutherland, Grant R., Richards, Robert I.
Publisher: University of Chicago Press
Publication Name: American Journal of Human Genetics
Subject: Biological sciences
ISSN: 0002-9297
Year: 1999
Australia, Physiological aspects, Gene mutations, Gene mutation, Chromosome mapping, Mutation (Biology), Mutation, Genetic disorders, Cytogenetics, Familial diseases

User Contributions:

Comment about this article or add new information about this topic:

CAPTCHA


subjects list: Research, Genetic aspects, Fragile X syndrome, Usage
This website is not affiliated with document authors or copyright owners. This page is provided for informational purposes only. Unintentional errors are possible.